Note: Descriptions are shown in the official language in which they were submitted.
CA 02367488 2001-09-14
WO 00/56910 PCT/GB00/01091
RETROVIRAL VECTORS COMPRISING FUNCTIONAL AND NON-FUNCTIONAL
SPLICE DONOR AND SPLICE ACCEPTOR SITES
The present invention relates to a vector.
In particular. the present invention relates to a novel system for packaging
and expressing
genetic material in a retroviral particle.
More in particular, the present invention relates to a novel system capable of
expressing a
retroviral particle that is capable of delivering a nucleotide sequence of
interest
1o (hereinafter abbreviated as "NOI") - or even a plurality of NOIs - to one
or more target
sites.
In addition. the present invention relates to inter alia a novel retroviral
vector useful in
gene therapy.
Gene therapy may include any one or more of: the addition, the replacement,
the deletion,
the supplementation, the manipulation etc. of one or more nucleotide sequences
in, for
example, one or more targeted sites - such as targeted cells. If the targeted
sites are
targeted cells, then the cells may be part of a tissue or an organ. General
teachings on
gene therapy may be found in Molecular Biology (Ed Robert Meyers, Pub VCH,
such as
pages 556-»8).
By way of further example, gene therapy can also provide a means by which any
one or
more of: a nucleotide sequence, such as a gene, can be applied to replace or
supplement a
defective gene; a pathogenic nucleotide sequence, such as a gene, or
expression product
thereof can be eliminated; a nucleotide sequence, such as a gene, or
expression product
thereof, can be added or introduced in order, for example, to create a more
favourable
phenotype; a nucleotide sequence, such as a gene, or expression product
thereof can be
added or introduced, for example, for selection purposes (i.e. to select
transformed cells
3o and the like over non-transformed cells); cells can be manipulated at the
molecular level
to treat, cure or prevent disease conditions - such as cancer (Schmidt-Wolf
and Schmidt-
Wolf, 1994, Annals of Hematology 69;273-279) or other disease conditions, such
as
CA 02367488 2001-09-14
WO 00/56910 PCT/GB00/01091
immune, cardiovascular, neurological, inflammatory or infectious disorders;
antigens can
be manipulated and/or introduced to elicit an immune response, such as genetic
vaccination.
In recent years, retroviruses have been proposed for use in gene therapy.
Essentially,
retroviruses are RNA viruses with a life cycle different to that of lytic
viruses. In this
regard. a retrovirus is an infectious entity that replicates through a DNA
intermediate.
When a retrovirus infects a cell, its genome is converted to a DNA form by a
reverse
transcriptase enzyme. The DNA copy serves as a template for the production of
new
1 o RNA genomes and virally encoded proteins necessary for the assembly of
infectious viral
particles.
20
There are many retroviruses and examples include: marine leukemia virus (MLV),
human
immunodeficiency virus (HIV), equine infectious anaemia virus (EIAV), mouse
mammary tumour virus (MMTV), Rous sarcoma virus (RSV), Fujinami sarcoma virus
(FuSV), Moloney marine leukemia virus (Mo-MLV), FBR marine osteosarcoma virus
(FBR MSV), Moloney marine sarcoma virus (Mo-MSV), Abelson marine leukemia
virus
(A-MLV), Avian myelocytomatosis virus-29 (MC29), and Avian erythroblastosis
virus
(AEV).
A detailed list of retroviruses may be found in Coffin et al ("Retroviruses"
1997 Cold
Spring Harbour Laboratory Press Eds: JM Coffin, SM Hughes, HE Varmus pp 758-
763).
Details on the genomic structure of some retroviruses may be found in the art.
By way of
example, details on HIV may be found from the NCBI Genbank (i.e. Genome
Accession
No. AF033819).
Essentially, all wild type retroviruses contain three major coding domains,
gag, pol, env,
which code for essential virion proteins. Nevertheless, retroviruses may be
broadly
3o divided into two categories: namely, ''simple" and ''complex". These
categories are
distinguishable by the organisation of their genomes. Simple retroviruses
usually carry
CA 02367488 2001-09-14
WO 00/56910 PCT/GB00/01091
3
only elementary information. In contrast, complex retroviruses also code for
additional
regulatory proteins derived from multiple spliced messages.
Retroviruses may even be further divided into seven groups. Five of these
groups
~ represent retroviruses with oncogenic potential. The remaining two groups
are the
lentiviruses and the spumaviruses. A review of these retroviruses is presented
in
"Retroviruses" (1997 Cold Spring Harbour Laboratory Press Eds: JM Coffin, SM
Hughes, HE Varmus pp I-25).
1 o All oncogenic members except the human T-cell leukemia virus-bovine
leukemia virus
group (HTLV-BLV) are simple retroviruses. HTLV, BLV and the lentiviruses and
spumamruses are complex. Some of the best studied oncogenic retroviruses are
Rous
sarcoma virus (RSV), mouse mammary tumour virus (MMTV) and murine leukemia
virus (MLV) and the human T-cell leukemia virus (HTLV).
The lentivirus group can be split even further into "primate" and "non-
primate".
Examples of primate lentiviruses include the human immunodeficiency virus
(HIV), the
causative agent of human auto-immunodeficiency syndrome (AIDS), and the simian
immunodeficiency virus (SIV). The non-primate lentiviral group includes the
prototype
?o ''slow virus" visna/maedi virus (VMV), as well as the related caprine
arthritis-encephalitis
virus (CAEV), equine infectious anaemia virus (EIAV) and the more recently
described
feline immunodeficiency virus (FIV) and bovine immunodeficiency virus (BIV).
A distinction between the lentivirus family and other types of retroviruses is
that
?5 lentiviruses have the capability to infect both dividing and non-dividing
cells (Lewis et al
1992 EMBO. J 11: 3053-3058; Lewis and Emerman 1994 J. Virol. 68: 510-516). In
contrast. other retroviruses - such as MLV - are unable to infect non-dividing
cells such as
those that make up, for example, muscle, brain, lung and liver tissue.
3o During the process of infection, a retrovirus initially attaches to a
specific cell surface
receptor. On entry into the susceptible host cell, the retroviral RNA genome
is then
copied to DNA by the virally encoded reverse transcriptase which is carried
inside the
CA 02367488 2001-09-14
WO 00/56910 PCT/GB00/01091
4
parent virus. This DNA is transported to the host cell nucleus where it
subsequently
integrates into the host genome. At this stage, it is typically referred to as
the provirus.
The provirus is stable in the host chromosome during cell division and is
transcribed like
other cellular proteins. The provirus encodes the proteins and packaging
machinery
required to make more virus, which can leave the cell by a process sometimes
called
''budding".
As already indicated, each retroviral genome comprises genes called gag, pol
and env
which code for virion proteins and enzymes. In the provirus, these genes are
flanked at
1 o both ends by regions called long terminal repeats (LTRs). The LTRs are
responsible for
proviral integration, and transcription. They also serve as enhancer-promoter
sequences.
In other words, the LTRs can control the expression of the viral gene.
Encapsidation of
the retroviral RNAs occurs by virtue of a psi sequence located at the 5' end
of the viral
genome.
The LTRs themselves are identical sequences that can be divided into three
elements,
which are called U3, R and U5. U3 is derived from the sequence unique to the
3' end of
the RNA. R is derived from a sequence repeated at both ends of the RNA and US
is
derived from the sequence unique to the 5' end of the RNA. The sizes of the
three
2o elements can vary considerably among different retroviruses.
For ease of understanding, simple, generic structures (not to scale) of the
RNA and the
DNA forms of the retroviral genome are presented in Figure 29 in which the
elementary
features of the LTRs and the relative positioning of gag, pol and env are
indicated.
As shown in Figure 29, the basic molecular organisation of an infectious
retroviral RNA
genome is (5') R - U~ - gag, pol, env - U3-R (3'). In a defective retroviral
vector genome
gag, pol and env may be absent or not functional. The R regions at both ends
of the
RNA are repeated sequences. US and U3 represent unique sequences at the 5' and
3'
3o ends of the RNA genome respectively.
Reverse transcription of the virion RNA into double stranded DNA takes place
in the
cytoplasm and involves two jumps of the reverse transcriptase from the 5'
terminus to the
CA 02367488 2001-09-14
WO 00/56910 PCT/GB00/01091
3' terminus of the template molecule. The result of these jumps is a
duplication of
sequences located at the ~' and 3' ends of the virion RNA. These sequences
then occur
fused in tandem on both ends of the viral DNA, forming the long terminal
repeats (LTRs)
which comprise R U~ and L'3 regions. On completion of the reverse
transcription, the
viral DNA is translocated into the nucleus where the linear copy of the
retroviral genome,
called a preintegration complex (PIC), is randomly inserted into chromosomal
DNA with
the aid of the virion integrase to form a stable provirus. The number of
possible sites of
integration into the host cellular genome is very large and very widely
distributed.
1 o The control of proviral transcription remains largely with the noncoding
sequences of the
viral LTR. The site of transcription initiation is at the boundary between U3
and R in the
left hand side LTR (as shown in Figure 29) and the site of poly (A) addition
(termination)
is at the boundary between R and US in the right hand side LTR (as shown
above). U3
contains most of the transcriptional control elements of the provirus, which
include the
I5 promoter and multiple enhancer sequences responsive to cellular and in some
cases, viral
transcriptional activator proteins. Some retroviruses have any one or more of
the
following genes such as tat, rev, tax and rex that code for proteins that are
involved in the
regulation of gene expression.
2o Transcription of proviral DNA recreates the full length viral RNA genomic
and
subgenomic-sized RNA molecules that are generated by RNA processing.
Typically, all
RNA products serve as templates for the production of viral proteins. The
expression of
the RNA products is achieved by a combination of RNA transcript splicing and
ribosomal
framshifting during translation.
RNA splicing is the process by which intervening or "intronic" RNA sequences
are
removed and the remaining "exonic" sequences are ligated to provide continuous
reading
frames for translation. The primary transcript of retroviral DNA is modified
in several
ways and closely resembles a cellular mRNA. However, unlike most cellular
mRNAs, in
3o which all introns are efficiently spliced, newly synthesised retroviral RNA
must be
diverted into two populations. One population remains unspliced to serve as
the Qenomic
RNA and the other population is spliced to provide subgenomic RNA.
CA 02367488 2001-09-14
WO 00/56910 PCT/GB00/01091
6
The full-length unspliced retroviral RNA transcripts serve two functions: (i)
they encode
the gag and pol gene products and (ii) they are packaged into progeny virion
particles as
genomic RNA. Sub-genomic-sized RNA molecules provide mRNA for the remainder of
the viral gene products. All spliced retroviral transcripts bear the first
exon, which spans
the U~ region of the ~' LTR. The final exon always retains the U3 and R
regions
encoded by the 3' LTR although it varies in size. The composition of the
remainder of
the RNA structure depends on the number of splicing events and the choice of
alternative
splice sites.
In simple retroviruses, one population of newly synthesised retroviral RNA
remains
unspliced to serve as the genomic RNA and as mRNA for gag and pol: The other
population is spliced, fusing the ~' portion of the genomic RNA to the
downstream genes,
most commonly env. Splicing is achieved with the use of a splice donor
positioned
upstream of gag and a splice acceptor near the 3' terminus of pol. The intron
between the
splice donor and splice acceptor that is removed by splicing contains the gag
and pol
genes. This splicing event creates the mRNA for envelope (Env) protein.
Typically the
splice donor is upstream of gag but in some viruses, such as ASLV, the splice
donor is
positioned a few codons into the gag gene resulting in a primary Env
translation product
that includes a few amino-terminal amino acid residues in common with Gag. The
Env
2o protein is synthesised on membrane-bound polyribosomes and transported by
the cell's
vesicular traffic to the plasma membrane, where it is incorporated into viral
particles.
Complex retroviruses generate both singly and multiply spliced transcripts
that encode
not only the env gene products but also the sets of regulatory and accessory
proteins
unique to these viruses. Compex retroviruses such as the lentiviruses, and
especially
HIV, provide striking examples of the complexity of alternative splicing that
can occur
during retroviral infection. For example, it is now known that HIV-1 is
capable of
producing over 30 different mRNAs by sub-optimal splicing from primary genomic
transcripts. This selection process appears to be regulated as mutations that
disrupt
competing splice acceptors can cause shifts in the splicing patterns and can
affect viral
infectivity (Purcell and Martin 1993 J Virol 67: 6365-6378).
CA 02367488 2001-09-14
WO 00/56910 PCT/GB00/01091
7
The relative proportions of full-length RNA and subgenomic-sized RNAs vary in
infected
cells and modulation of the levels of these transcripts is a potential control
step during
retroviral gene expression. For retroviral gene expression, both unspliced and
spliced
RNAs must be transported to the cytoplasm and the proper ratio of spliced and
unspliced
RNA must be maintained for efficient retroviral gene expression. Different
classes of
retroviruses have evolved distinct solutions to this problem. The simple
retroviruses,
which use only full-length and singly spliced RNAs regulate the cytoplasmic
ratios of
these species either by the use of variably efficient splice sites or by the
incorporation of
several cis-acting elements, that have been only partially defined, into their
genome. The
1o complex retroviruses, which direct the synthesis of both singly and
multiply spliced RNA,
regulate the transport and possibly splicing of the different genomic and
subgenomic-
sized RNA species through the interaction of sequences on the RNA with the
protein
product of one of the accessory genes, such as rev in HIV-1 and rex in HTLV-1.
With regard to the structural genes gag, pol and env themselves and in
slightly more
detail, gag encodes the internal structural protein of the virus. Gag is
proteolytically
processed into the mature proteins MA (matrix), CA (capsid) and NC
(nucleocapsid).
The pol gene encodes the reverse transcriptase (RT), which contains both DNA
polymerase, and associated RNase H activities and inte~rase (IN), which
mediates
3o replication of the genome. The env gene encodes the surface (SU)
glycoprotein and the
transmembrane (TM) protein of the virion, which form a complex that interacts
specifically with cellular receptor proteins. This interaction leads
ultimately to fusion of
the viral membrane with the cell membrane.
35 The Env protein is a viral protein which coats the viral particle and plays
an essential role
in permitting viral entry into a target cell. The envelope glycoprotein
complex of
retroviruses includes two polypeptides: an external, glycosylated hydrophilic
polypeptide
(SU) and a membrane-spanning protein (TM). Together, these form an oligomeric
"knob'' or "knobbed spike" on the surface of a virion. Both polypeptides are
encoded by
3o the env gene and are synthesised in the form of a polyprotein precursor
that is
proteolvtically cleaved during its transport to the cell surface. Although
uncleaved Env
proteins are able to bind to the receptor, the cleavage event itself is
necessary to activate
CA 02367488 2001-09-14
WO 00/56910 PCT/GB00/01091
8
the fusion potential of the protein, which is necessary- for entry of the
virus into the host
cell. Typically, both SU and TM proteins are glycosylated at multiple sites.
However, in
some viruses, exemplified by MLV, TM is not glycosylated.
Although the SU and TM proteins are not always required for the assembly of
enveloped
virion particles as such, they play an essential role in the entry process. In
this regard, the
SU domain binds to a receptor molecule, often~a specific receptor molecule, on
the target
cell. It is believed that this binding event activates the membrane fusion-
inducing
potential of the TM protein after which the viral and cell membranes fuse. In
some
viruses, notably MLV, a cleavage event, resulting in the removal of a short
portion of the
cytoplasmic tail of TM, is thought to play a key role in uncovering the full
fusion activity
of the protein (Brody et al 1994 J Virol 68: 4620-4627; Rein et al 1994 J
Virol 68: 1773-
1781 ). This cytoplasmic "tail", distal to the membrane-spanning segment of TM
remains
on the internal side of the viral membrane and it varies considerably in
length in different
retroviruses.
Thus, the specificity of the SU/receptor interaction can define the host range
and tissue
tropism of a retrovirus. In some cases, this specificity may restrict the
transduction
potential of a recombinant retroviral vector. Here, transduction includes a
process of
2o using a viral vector to deliver a non-viral gene to a target cell. For this
reason, many gene
therapy experiments have used MLV. A particular MLV that has an envelope
protein
called 4070A is known as an amphotropic virus, and this can also infect human
cells
because its envelope protein ''docks" with a phosphate transport protein that
is conserved
between man and mouse. This transporter is ubiquitous and so these viruses are
capable
of infecting many cell types. In some cases however, it may be beneficial,
especially
from a safety point of view, to specifically target restricted cells. To this
end, several
groups have engineered a mouse ecotropic retrovirus, which unlike its
amphotropic
relative normally only infects mouse cells, to specifically infect particular
human cells.
Replacement of a fragment of an Env protein with an erythropoietin segement
produced a
3o recombinant retrovirus which then binds specifically to human cells that
express the
erythropoietin receptor on their surface, such as red blood cell precursors
(Maulik and
CA 02367488 2001-09-14
WO 00/56910 PCT/GB00/01091
9
Patel 1997 "Molecular Biotechnology: Therapeutic Applications and Strategies''
1997
Wiley-Liss Inc. pp 4~).
In addition to gag, poi and env, the complex retroviruses also contain
"accessory' genes
which code for accessory or auxiliary proteins. Accessory or auxiliary
proteins are
defined as those proteins encoded by the accessory genes in addition to those
encoded by
the usual replicative or structural genes, gag, poi and env. These accessory
proteins are
distinct from those involved in the regulation of gene expression, like those
encoded by
tat, rev, tax and rex. Examples of accessory genes include one or more of vif,
vpr, vpx,
to vpu and nef. These accessory genes can be found in, for example, HIV (see,
for example
pages 802 and 803 of "Retroviruses" Ed. Coffin et al Pub. CSHL 1997). Non-
essential
accessory proteins may function in specialised cell types, providing functions
that are at
least in part duplicative of a function provided by a cellular protein.
Typically, the
accessory genes are located between poi and env, just downstream from env
including the
1 ~ U3 region of the LTR or overlapping portions of the env and each other.
The complex retroviruses have evolved regulatory mechanisms that employ
virally
encoded transcriptional activators as well as cellular transcriptional
factors. These trans-
acting viral proteins serve as activators of RNA transcription directed by the
LTRs. The
?o transcriptional traps-activators of the lentiviruses are encoded by the
viral tat genes. Tat
binds to a stable, stem-loop, RNA secondary structure, referred to as TAR, one
function
of which is to apparently optimally position Tat to traps-activate
transcription.
As mentioned earlier, retroviruses have been proposed as a delivery system
(otherwise
2~ expressed as a delivery vehicle or delivery vector) for inter alia the
transfer of a NOI, or a
plurality of NOIs, to one or more sites of interest. The transfer can occur in
vitro, ex vivo,
irr vivo, or combinations thereof. When used in this fashion, the retroviruses
are typically
called retroviral vectors or recombinant retroviral vectors. Retroviral
vectors have even
been exploited to study various aspects of the retrovirus life cycle,
including receptor
3o usage, reverse transcription and RNA packaging (reviewed by Miller, 1992
Curr Top
Microbiol Immunol 158:1-24).
CA 02367488 2001-09-14
WO 00/56910 PCT/GB00/01091
In a typical recombinant retroviral vector for use in gene therapy, at least
part of one or
more of the gag, pol and env protein coding regions may be removed from the
virus. This
makes the retroviral vector replication-defective. The removed portions may
even be
replaced by a NOI in order to generate a virus capable of integrating its
genome into a
5 host genome but wherein the modified viral genome is unable to propagate
itself due to a
lack of structural proteins. When integrated in the host genome, expression of
the NOI
occurs - resulting in, for example, a therapeutic and/or a diagnostic effect.
Thus, the
transfer of a NOI into a site of interest is typically achieved by:
integrating the NOI into
the recombinant viral vector; packaging the modified viral vector into a
virion coat; and
1 o allowing transduction of a site of interest - such as a targeted cell or a
targeted cell
population.
It is possible to propagate and isolate quantities of retroviral vectors (e.g.
to prepare
suitable titres of the retroviral vector) for subsequent transduction of, for
example, a site
of interest by using a combination of a packaging or helper cell line and a
recombinant
vector.
In some instances, propagation and isolation may entail isolation of the
retroviral gag, pol
and env genes and their separate introduction into a host cell to produce a
''packaging cell
line". The packaging cell line produces the proteins required for packaging
retroviral
DNA but it cannot bring about encapsidation due to the lack of a psi region.
However,
when a recombinant vector carrying a NOI and a psi region is introduced into
the
packaging cell line, the helper proteins can package the psi-positive
recombinant vector to
produce the recombinant virus stock. This can be used to transduce cells to
introduce the
NOI into the genome of the cells. The recombinant virus whose genome lacks all
genes
required to make viral proteins can tranduce only once and cannot propagate.
These viral
vectors which are only capable of a single round of transduction of target
cells are known
as replication defective vectors. Hence, the NOI is introduced into the
host/target cell
genome without the generation of potentially harmful retrovirus. A summary of
the
3o available packaging lines is presented in "Retroviruses" (1997 Cold Spring
Harbour
Laboratory Press Eds: JM Coffin, SM Hughes, HE Varmus pp 449).
CA 02367488 2001-09-14
WO 00/56910 PCT/GB00/01091
The design of retroviral packaging cell lines has evolved to address the
problem of inter
alia the spontaneous production of helper virus that was frequently
encountered with
early designs. As recombination is greatly facilitated by homology, reducing
or
eliminating homology between the genomes of the vector and the helper has
reduced the
problem of helper virus production. More recently, packaging cells have been
developed
in which the gag, pol and env viral coding regions are carried on separate
expression
plasmids that are independently transfected into a packaging cell line so that
three
recombinant events are required for wild type viral production. This reduces
the potential
for production of a replication-competent virus. This strategy is sometimes
referred to as
1o the three plasmid transfection method (Soneoka et al 1995 Nucl. Acids Res.
23: 628-633).
Transient transfection can also be used to measure vector production when
vectors are
being developed. In this regard, transient transfection avoids the longer time
required to
Qenerate stable vector-producing cell lines and is used if the vector or
retroviral packaging
components are toxic to cells. Components typically used to generate
retroviral vectors
include a plasmid encoding the Gag/Pol proteins, a plasmid encoding the Env
protein and
a plasmid containing a NOI. Vector production involves transient transfection
of one or
more of these components into cells containing the other required components.
If the
vector encodes toxic genes or genes that interfere with the replication of the
host cell.
2o such as inhibitors of the cell cycle or genes that induce apotosis, it may
be difficult to
generate stable vector-producing cell lines, but transient transfection can be
used to
produce the vector before the cells die. Also, cell lines have been developed
using
transient infection that produce vector titre levels that are comparable to
the levels
obtained from stable vector-producing cell lines (Pear et al 1993, Proc Natl
Acad Sci
2s 90:8392-8396).
In view of the toxicity of some HIV proteins - which can make it difficult to
generate
stable HIV-based packaging cells - HIV vectors are usually made by transient
transfection
of vector and helper virus. Some workers have even replaced the HIV Env
protein with
30 that of vesicular stomatis virus (VSV). Insertion of the Env protein of VSV
facilitates
vector concentration as HIV/VSV-G vectors with titres of 5 x 105 (108 after
concentration) have been generated by transient transfection (Naldini et al
1996 Science
CA 02367488 2001-09-14
WO 00/56910 PCT/GB00/01091
12
272: 263-267). Thus, transient transfection of HIV vectors may provide a
useful strategy
for the generation of high titre vectors (Yee et al 1994 PNAS. 91: 964-968).
With regard to vector titre, the practical uses of retroviral vectors have
been limited
largely by the titres of transducing particles which can be attained in in
vitro culture
(typically not more than 108 particles/ml) and the sensitivity of many
enveloped viruses
to traditional biochemical and physicochemical techniques for concentrating
and
purifying viruses.
1 o By way of example, several methods for concentration of retroviral vectors
have been
developed, including the use of centrifugation (Fekete and Cepko 1993 Mol Cell
Biol 13:
2604-2613), hollow fibre filtration (Paul et al 1993 Hum Gene Ther 4: 609-61
S) and
tangential flow filtration (Kotani et al 1994 Hum Gene Ther ~: 19-28).
Although a 20-
fold increase in viral titre can be achieved, the relative fragility of
retroviral Env protein
limits the ability to concentrate retroviral vectors and concentrating the
virus usually
results in a poor recovery of infectious virions. While this problem can be
overcome by
substitution of the retroviral Env protein with the more stable VSV-G protein,
as
described above, which allows for more effective vector concentration with
better yields,
it suffers from the drawback that the VSV-G protein is quite toxic to cells.
Although helper-virus free vector titres of 10' cfu/ml are obtainable with
currently
available vectors, experiments can often be done with much lower-titre vector
stocks.
However, for practical reasons, high-titre virus is desirable, especially when
a large-
number of cells must be infected. In addition, high titres are a requirement
for
transduction of a large percentage of certain cell types. For example, the
frequency of
human hematopoietic progenitor cell infection is strongly dependent on vector
titre, and
useful frequencies of infection occur only with very high-titre stocks (Hock
and Miller
1986 Nature 320: 27~-277; Hogge and Humphries 1987 Blood 69: 611-617). In
these
cases, it is not sufficient simply to expose the cells to a larger volume of
virus to
3o compensate for a low virus titre. On the contrary, in some cases, the
concentration of
infectious vector virions may be critical to promote efficient transduction.
CA 02367488 2001-09-14
WO 00/56910 PCT/GB00/01091
13
Workers are trying to create high titre vectors for use in gene delivery. By
way of
example, a comparison of different vector designs has proved useful in helping
to define
the essential elements required for high-titre viral production. Early work on
different
retroviral vector design showed that almost all of the internal protein-
encoding regions of
NILVs could be deleted without abolishing the infectivity of the vector
(Miller et al 1983
Proc Natl Acad Sci 80: 4709-4713). These early vectors retained only a small
portion of
the 3' end of the env-coding region. Subsequent work has shown that all of the
env-gene-
coding sequences can be removed without further reduction in vector titre
(Miller and
Rosman 1989 Biotechnique 7: 980-990; Morgenstern and Land 1990 Nucleic Acids
Res
l0 18: 3587-396). Only the viral LTRs and short regions adjoining the LTRs,
including the
segments needed for plus- and minus-strand DNA priming and a region required
for
selective packaging of viral RNA into virions (the psi site; Mann et al 1983
Cell 33: 1~3-
159) were deemed necessary for vector transmission. Nevertheless, viral titres
obtained
with these early vectors were still about tenfold lower than the parental
helper virus titre.
Additional experiments indicated that retention of sequences at the 5' end of
the gag gene
significantly raised viral vector titres and that this was due to an increase
in the packaging
efficiency of viral RNA into virions (Armentano et al 1987 J Virol 61: 1647-
1650;
Bender et al 1987 J Virol 61: 1639-1646; Adam and Miller 1988 J Virol 62: 3802-
3806).
This effect was not due to viral protein synthesis from the gag region of the
vector
because disruption of the gag reading frame or mutating the gag codon to a
stop codon
had no effect on vector titre (Bender et al 1987 ibicl). These experiments
demonstrated
that the sequences required for efficient packaging of genomic RNA in MLV were
larger
than the psi signal previously defined by deletion analysis (Mann et al 1983
ibicl). In
order to obtain high titres (106 to > 10'), it was shown to be important that
this larger
signal, called psi plus, be included in retroviral vectors. It has now been
demonstrated
that this signal spans from upstream of the splice donor to downstream of the
gag start
codon (Bender et al 1987 ibicl). Because of this position, in spliced env
expressing
transcripts this signal is deleted. This ensures that only full length
transcripts containing
3o all three essential genes for viral life cycle are packaged.
CA 02367488 2001-09-14
WO 00/56910 PCT/GB00/01091
14
Some alternative approaches to developing high titre vectors for gene delivery
have
included the use of: (i) defective viral vectors such as adenoviruses. adeno-
associated
virus (AAV), herpes viruses, and pox viruses and (ii) modified retroviral
vector designs.
The adenovirus is a double-stranded, linear DNA virus that does not go through
an RNA
intermediate. There are over 50 different human serotypes of adenovirus
divided into 6
subgroups based on the genetic sequence homology. The natural target of
adenovirus is
the respiratory and gastrointestinal epithelia, generally giving rise to only
mild symptoms.
Serotypes 2 and ~ (with 95% sequence homology) are most commonly used in
adenoviral
to vector systems and are normally associated with upper respiratory tract
infections in the
young.
Adenoviruses are nonenveloped, regular icosohedrons. A typical adenovirus
comprises a
140nm encapsidated DNA virus. The icosahedral symmetry of the virus is
composed of
152 capsomeres: 240 hexons and 12 pentons. The core of the particle contains
the 36kb
linear duplex DNA which is covalently associated at the 5' ends with the
Terminal
Protein (TP) which acts as a primer for DNA replication. The DNA has inverted
terminal
repeats (ITR) and the length of these varies with the serotype.
2o Entry of adenovirus into cells involves a series of distinct events.
Attachment of the virus
to the cell occurs via an interaction between the viral fibre (37nm) and the
fibre receptors
on the cell. This receptor has recently been identified for Ad2/5 serotypes
and designated
as CAR (Coxsackie and Adeno Receptor, Tomko et al (1997 Proc Natl Acad Sci 94:
3352-2258). Internalisation of the virus into the endosome via the cellular
av(33 and av(35
integrins is mediated by and viral RGD sequence in the penton-base capsid
protein
(Wickham et al., 1993 Cell 73: 309-319). Following internalisation, the
endosome is
disrupted by a process known as endosomolysis, an event which is believed to
be
preferentially promoted by the cellular av~35 integrin (Wickham et al., 1994 J
Cell Biol
127: 257-264). In addition, there is recent evidence that the Ad5 fibre knob
binds with
3o high affinity to the MHC class 1 a2 domain at the surface of certain cell
types including
human epithelial and B lymphoblast cells (Hong et al., 1997 EMBO 16: 2294-
2306).
CA 02367488 2001-09-14
WO 00/56910 PCT/GB00/01091
Subsequently the virus is translocated to the nucleus where activation of the
early regions
occurs and is shortly followed by DNA replication and activation of the late
regions.
Transcription, replication and packaging of the adenoviral DNA requires both
host and
viral functional protein machinery.
5
Viral gene expression can be divided into early (E) and late (L) phases. The
late phase is
defined by the onset of viral DNA replication. Adenovirus structural proteins
are
Qenerally synthesised during the late phase. Following adenovirus infection,
host cellular
mRNA and protein synthesis is inhibited in cells infected with most serotypes.
The
to adenovirus lytic cycle with adenovirus 2 and adenovirus 5 is very efficient
and results in
approximately 10, 000 virions per infected cell along with the synthesis of
excess viral
protein and DNA that is not incorporated into the virion. Early adenovirus
transcription
is a complicated sequence of interrelated biochemical events but it entails
essentially the
synthesis of viral RNAs prior to the onset of DNA replication.
The Schematic diagram shown in Figure 30 is of the adenovirus genome showing
the
relative direction and position of early and late gene transcription:
The organisation of the adenovirus genome is similiar in all of the adenovirus
groups and
2o specific functions are generally positioned at identical locations for each
serotype studied.
Early cytoplasmic messenger RNAs are complementary to four defined,
noncontiguous
regions on the viral DNA. These regions are designated E1-E4. The early
transcripts
have been classified into an array of intermediate early (E 1 a), delayed
early (E 1 b, E2a,
E2b, E3 and E4), and intermediate regions.
?5
The early genes are expressed about 6-8 hours after infection and are driven
from 7
promoters in gene blocks E 1-4
The E 1 a region is involved in transcriptional transactivation of viral and
cellular genes as
3o well as transcriptional repression of other sequences. The E 1 a gene
exerts an important
control function on all of the other early adenovirus messenger RNAs. In
normal tisssues,
in order to transcribe regions E 1 b, E2a, E2b, E3 or E4 efficiently, active E
1 a product is
CA 02367488 2001-09-14
WO 00/56910 PCT/GB00/01091
16
required. However, the E 1 a function may be bypassed. Cells may be
manipulated to
provide Ela-like functions or may naturally contain such functions. The virus
may also
be manipulated to bypass the E 1 a function. The viral packaging signal
overlaps with the
Ela enhancer (194-358 nt).
The E 1 b region influences viral and cellular metabolism and host protein
shut-off. It also
includes the gene encoding the pIX protein (3525-4088 nt) which is required
for
packaging of the full length viral DNA and is important for the
thermostability of the
virus. The E 1 b region is required for the normal progression of viral events
late in
I o infection. The E 1 b product acts in the host nucleus. Mutants generated
within the E 1 b
sequences exhibit diminished late viral mRNA accumulation as well as
impairment in the
inhibition of host cellular transport normally observed late in adenovirus
infection. E 1 b is
required for altering functions of the host cell such that processing and
transport are
shifted in favour of viral late gene products. These products then result in
viral packaging
I 5 and release of virions. E 1 b produces a 19 kD protein that prevents
apoptosis. E 1 b also
produces a 55 kD protein that binds to p53. For a review on adenoviruses and
their
replication, see WO 96/17053.
The E2 region is essential as it encodes the 72 kDa DNA binding protein, DNA
20 polymerase and the 80 kDa precurser of the 55 kDa Terminal Protein (TP)
needed for
protein priming to initiate DNA synthesis.
A 19 kDa protein (gpl9K) is encoded within the E3 region and has been
implicated in
modulating the host immune response to the virus. Expression of this protein
is
25 upregulated in response to TNF alpha during the first phase of the
infection and this then
binds and prevents migration of the MHC class I antigens to the epithelial
surface,
thereby dampening the recognition of the adenoviral infected cells by the
cvtotoxic T
lymphocytes. The E3 region is dispensible in in vitro studies and can be
removed by
deletion of a 1.9 kb XbaI fragment.
3o
The E4 region is concerned with decreasing the host protein synthesis and
increasing the
DNA replication of the virus.
CA 02367488 2001-09-14
WO 00/56910 PCT/GB00/01091
17
There are ~ families of late genes and all are initiated from the major late
promoter. The
expression of the late genes includes a very complex post-transcriptional
control
mechanism involving RNA splicing. The fibre protein is encoded within the L~
region.
The adenoviral genome is flanked by the inverted terminal repeat which in Ads
is 103 by
and is essential for DNA replication. 30-40 hours post infection viral
production is
complete.
Adenoviruses may be converted for use as vectors for gene transfer by deleting
the E 1
gene, which is important for the induction of the E2, E3 and E4 promoters. The
E1-
replication defective virus may be propagated in a cell line that provides the
E 1
polypeptides in trans, such as the human embryonic kidney cell line 293. A
therapeutic
gene or genes can be inserted by recombination in place of the E 1 gene.
Expression of
the gene is driven from either the E 1 promoter or a heterologous promoter.
Even more attenuated adenoviral vectors have been developed by deleting some
or all of
the E4 open reading frames (ORFs). However, certain second generation vectors
appear
not to give longer-term gene expression, even though the DNA seems to be
maintained.
Thus, it appears that the function of one or more of the E4 ORFs may be to
enhance gene
expression from at least certain viral promoters carried by the virus.
An alternative approach to making a more defective virus has been to "gut" the
virus
completely maintaining only the terminal repeats required for viral
replication. The
''gutted" or ''gutless" viruses can be grown to high titres with a first
generation helper
virus in the 293 cell line but it has been difficult to separate the "gutted"
vector from the
helper virus.
Replication-competent adenoviruses can also be used for gene therapy. For
example, the
ElA gene can be inserted into a first generation virus under the regulation of
a tumour-
specific promoter. In thoery, following injection of the virus into a tumour,
it could
3o replicated specifically in the tumour but not in the surrounding normal
cells. This type of
vector could be used either to kill tumour cells directly by lysis or to
deliver a "suicide
gene" such as the herpes-simplex-virus thymidine-kinase gene (HSV tk) which
can kill
CA 02367488 2001-09-14
WO 00/56910 PCT/GB00/01091
18
infected and bystander cells following treatment with ganciclovir.
Alternatively, an
adenovirus defective only for Elb has been used specifically for antitumour
treatment in
phase-1 clinical trials. The polypeptides encoded by Elb are able to block p~3-
mediated
apoptosis, preventing the cell from killing itself in response to viral
infection. Thus, in
normal nontumour cells, in the absence of E 1 b, the virus is unable to block
apoptosis and
is thus unable to produce infectious virus and spread. In tumour cells
deficient in p53, the
Elb defective virus can grow and spread to adjacent p~3-defective tumour cells
but not to
normal cells. Again, this type of vector could also be used to deliver a
therapeutic gene
such as HSV tk.
The adenovirus provides advantages as a vector for gene delivery over other
gene therapy
vector systems for the following reasons:
It is a double stranded DNA nonenveloped virus that is capable of in vivo and
in vitro
transduction of a broad range of cell types of human and non-human origin.
These cells
include respiratory airway epithelial cells, hepatocytes, muscle cells,
cardiac myocytes,
synoviocytes, primary mammary epithelial cells and post-mitotically terminally
differentiated cells such as neurons (with perhaps the important exception of
some
lymphoid cells including monocytes).
?o
Adenoviral vectors are also capable of transducing non dividing cells. This is
very
important for diseases, such as cystic fibrosis, in which the affected cells
in the lung
epithelium, have a slow turnover rate. In fact, several trials are underway
utilising
adenovirus-mediated transfer of cystic fibrosis transporter (CFTR) into the
lungs of
afflicted adult cystic fibrosis patients.
Adenoviruses have been used as vectors for gene therapy and for expression of
heterologous genes. The large (36 kilobase) genome can accommodate up to 8kb
of
foreign insert DNA and is able to replicate efficiently in complementing cell
lines to
3o produce very high titres of up to 102. Adenovirus is thus one of the best
systems to study
the expression of genes in primary non-replicative cells.
CA 02367488 2001-09-14
WO 00/56910 PCT/GB00/01091
19
The expression of viral or foreign genes from the adenovirus genome does not
require a
replicating cell. Adenoviral vectors enter cells by receptor mediated
endocytosis. Once
inside the cell, adenovirus vectors rarely integrate into the host chromosome.
Instead, it
functions episomally (independently from the host genome) as a linear genome
in the host
nucleus. Hence the use of recombinant adenovirus alleviates the problems
associated
with random integration into the host genome.
There is no association of human malignancy with adenovirus infection.
Attenuated
adenoviral strains have been developed and have been used in humans as live
vaccines.
However, current adenoviral vectors suffer from some major limitations for in
vivo
therapeutic use. These include: (i) transient gene expression- the adenoviral
vector
generally remains episomal and does not replicate so that it is not passed
onto subsequent
progeny (ii) because of its inability to replicate, target cell proliferation
can lead to
dilution of the vector (iii) an immunological response raised against the
adenoviral
proteins so that cells expressing adenoviral proteins, even at a low level,
are destroyed
and (iv) an inability to achieve an effective therapeutic index since in vivo
delivery leads
to an uptake of the vector and expression of the delivered genes in only a
proportion of
target cells.
If the features of adenoviruses can be combined with the genetic stability of
retro/lentiviruses then essentially the adenovirus can be used to transduce
target cells to
become transient retroviral producer cells that can stably infect neighbouring
cells.
In addition to manipulating retroviral and adenoviral vectors with a view to
increasing
vector titre, retroviral vectors have also been manipulated to self
inactivate.
By way of example, the first self inactivating retroviral vectors were
constructed by
deleting the transcriptional enhancers or the enhancers and promoter in the U3
region of
3o the 3' LTR. After one round of vector replication, these changes are copied
into both the ~'
and the 3' LTRS producing an inactive provirus (Yu et al 1986 Proc Natl Acad
Sci 83:
3194-3198; Dougherty and Temin 1987 Proc Natl Acad Sci 84: 1197-1201; Hawley
et al
CA 02367488 2001-09-14
WO 00/56910 PCT/GB00/01091
1987 Proc Natl Acad Sci 84: 2406-2410; Yee et al 1987 Proc Natl Acad Sci 91:
9564-
9~68). However, any promoters) internal to the LTRs in such vectors will still
be active.
This strategy has been employed to eliminate effects of the enhancers and
promoters in
the viral LTRs on transcription from internally placed genes. Such effects
include
5 increased transcription (Jolly et al 1983 Nucleic Acids Res 11: 1855-1872)
or suppression
of transcription (Emerman and Temin 1984 Cell 39: 449-467). This strategy can
also be
used to eliminate downstream transcription from the 3' LTR into genomic DNA
(Herman
and Coffin 1987 Science 236: 845-848). This is of particular concern in human
gene
therapy where it is of critical importance to prevent the adventitious
activation of an
1 o endogenous oncogene. The drawbacks of this strategy include the lower
titer of self
inactivating vectors in comparison with vectors having intact L'rRs (at least
tenfold lower)
and the propensity of the current vectors to arrange to produce viruses with
intact LTRs,
presumably by recombination of the vector with itself or with viral sequences
in the
retroviral packaging cells used to produce the vector stocks.
In addition to manipulating the retroviral vector with a view to increasing
vector titre,
retroviral vectors have also been designed to induce the production of a
specific NOI
(usually a marker protein) in transduced cells. As already mentioned, the most
common
retroviral vector design involves the replacement of retroviral sequences with
one or more
2o NOIs to create replication-defective vectors. The simplest approach has
been to use the
promoter in the retroviral ~' LTR to control the expresssion of a cDNA
encoding an NOI
or to alter the enhancer/promoter of the LTR to provide tissue-specific
expression or
inducibility. Alternatively, a single coding region has been expressed by
using an internal
promoter which permits more flexibility in promoter selection.
These strategies for expression of a gene of interest have been most easily
implemented
when the NOI is a selectable marker, as in the case of hypoxanthine-guanine
phosphoribosyl transferase (hprt) (Miller et al 1983 Proc Natl Acad Sci 80:
4709-4713)
which facilitates the selection of vector transduced cells. If the vector
contains an NOI
3o that is not a selectable marker, the vector can be introduced into
packaging cells by co-
transfection with a selectable marker present on a separate plasmid. This
strategy has an
appealing advantage for gene therapy in that a single protein is expressed in
the ultimate
CA 02367488 2001-09-14
WO 00/56910 PCT/GB00/01091
21
target cells and possible toxicity or antigenicity of a selectable marker is
avoided.
However, when the inserted gene is not selectable, this approach has the
disadvantage
that it is more difficult to generate cells that produce a high titre vector
stock. In addition
it is usually more difficult to determine the titre of the vector.
The current methodologies used to design retroviral vectors that express two
or more
proteins have relied on three general strategies. These include: (i) the
expression of
different proteins from alternatively spliced mRNAs transcribed from one
promoter; (ii)
the use of the promoter in the S' LTR and internal promoters to drive
transcription of
1 o different cDNAs and (iii) the use of internal ribosomal entry site (IRES)
elements to
allow translation of multiple coding regions from either a single mRNA or from
fusion
proteins that can then be expressed from an open reading frame.
Vectors containing internal promoters have been widely used to express
multiple genes.
An internal promoter makes it possible to exploit the promoter/enhancer
combinations
other than the viral LTR for driving gene expression. Multiple internal
promoters can be
included in a retroviral vector and it has proved possible to express at least
three different
cDNAs each from its own promoter (Overell et al 1988 Mol Cell Biol 8: 1803-
1808).
?o While there now exist many such modified retroviral vectors which may be
used for the
expression of NOIs in a variety of mammalian cells, most of these retroviral
vectors are
derived from simple retroviruses such as murine oncoretroviruses that are
incapable of
transducing non-dividing cells.
By way of example, a widely used vector that employs alternative splicing to
express
genes from the viral LTR SV(X) (Cepko et al 1984 Cell 37: 103-1062) contains
the
neomycin phosphotransferase gene as a selectable marker. The model for this
type of
vector is the parental virus, MO-MLV, in which the Gag and Gag-Pol proteins
are
translated from the full-length viral mRNA and the Env protein is made from
the spliced
3o mRNA. One of the proteins encoded by the vector is translated from the full-
length RNA
whereas splicing that links the splice donor near the 5'LTR to a splice
acceptor just
upstream of the second gene produces an RNA from which the second gene product
can
CA 02367488 2001-09-14
WO 00/56910 PCT/GB00/01091
22
be translated. One drawback of this strategy is that foreign sequences are
inserted into the
intron of the spliced gene. This can affect the ratio of spliced to unspliced
RNAs or
provide alternative splice acceptors that interfere with production of the
spliced RNA
encoding the second gene product (Korman et al 1987 Proc Natl Acad Sci 84:
2150-
21 ~4). Because these effects are unpredictable, they can affect the
production of the
encoded genes.
Other modified retroviral vectors can be divided into two classes with regards
to splicing
capabilities.
The first class of modified retroviral vector, typified by the pBABE vectors
(Morgenstern
et al 1990 Nucleic Acid Research 18: 3587-3596), contain mutations within the
splice
donor (GT to GC) that inhibit splicing of viral transcripts. Such splicing
inhibition is
beneficial for two reasons: Firstly, it ensures all viral transcripts contain
a packaging
~ 5 signal and thus all can be packaged in the producer cell. Secondly, it
prevents potential
aberrant splicing between viral splice donors and possible cryptic splice
acceptors of
inserted genes.
The second class of modified retroviral vector, typified by both N2 (Miller et
al 1989
2o Biotechniques 7: 980-990) and the more recent MFG (Dranoff et al 1993 Proc
Natl Acad
Sci 19: 3979-3986), contain functional introns. Both of these vectors use the
normal
splice donor found within the packaging signal. However, their respective
splice
acceptors (SAs) differ. For N2, the SA is found within the "extended"
packaging signal
(Bender et al 1987 ibid). For MFG, the natural SA (found within pol, see
Figure 1
25 thereof] is used. For both these vectors, it has been demonstrated that
splicing greatly
enhances gene expression in transduced cells (Miller et al 1989 ibid; Krall et
al 1996
Gene Therapy 3: 37-48). Such observations support previous findings that, in
general,
splicing can enhance mRNA translation (Lee et al 1981 Nature 294: 228-232;
Lewis et al
1986 Mol Cell Biol 6: 1998-2010; Chapman et al 1991 Nucleic Acids Res 19: 3979-
30 3986). One likely reason for this is that the same machinery involved in
transcript
splicing may also aid in transcript export from the nucleus.
CA 02367488 2001-09-14
WO 00/56910 PCT/GB00/01091
23
Unlike the modified retroviral vectors described above, there has been very
little work on
alternative splicing in the retroviral lentiviral systems which are capable of
infecting non-
dividing cells (Naldini et al 1996 Science 272: 263-267). To date the only
published
lentiviral vectors are those derived from HIV-1 (Kim et al 1997 J Virol 72:
811-816) and
FIV (Poeschla et al 1998 Nat Med 4: 354-357). These vectors still contain
virally derived
splice donor and acceptor sequences (Naldini et al 1996 ibicl).
The present invention seeks to provide a novel retroviral vector.
1o In particular, the present invention seeks to provide a novel retroviral
vector capable of
providing efficient expression of a NOI - or even a plurality of NOIs - at one
or more
desired target sites.
The present invention also seeks to provide a novel system for preparing high
titres of
vector virion which incorporates safety features for in vivo use and which is
capable of
providing efficient expression of a NOI - or even a plurality of NOIs - at one
or more
desired target sites.
According to a first aspect of the present invention, there is provided a
retroviral vector
2o comprising a functional splice donor site (FSDS) and a functional splice
acceptor (FSAS)
site; wherein the FSDS and the FSAS flank a first nucleotide sequence of
interest (NOI);
wherein the FSDS is upstream of the FSAS; wherein the retroviral vector is
derived from
a retroviral pro-vector; wherein the retroviral pro-vector comprises a first
nucleotide
sequence (NS) capable of yielding the functional splice donor site (FSDS); a
second NS
capable of yielding the functional splice acceptor site (FSAS); a third NS
capable of
yielding a non-functional splice donor site (NFSDS); a fourth NS capable of
yielding a
non-functional splice site (NFSS); wherein the first NS is downstream of the
second NS
and wherein the third NS and fourth NS are upstream of the second NS; such
that after
reverse transcription of the retroviral pro-vector at a desired target site
the retroviral
3o vector is capable of being spliced.
CA 02367488 2001-09-14
WO 00/56910 PCT/GB00/01091
24
According to a second aspect of the present invention, there is provided a
retroviral vector
wherein the retroviral pro-vector comprises a retroviral packaging signal; and
wherein the
second NS is located downstream of the retroviral packaging signal such that
splicing is
preventable at a primary target site.
According to a third aspect of the present invention, there is provided a
retroviral vector
wherein the second NS is placed downstream of the first NOI such that the
first NOI is
capable of being expressed at a primary target site.
to According to a fourth aspect of the present invention, there is provided a
retroviral vector
wherein the second NS is placed upstream of a multiple cloning site such that
one or more
additional NOIs may be inserted.
According to a fifth aspect of the present invention, there is provided a
retroviral vector
wherein the second NS is a nucleotide sequence coding for an immunological
molecule or
a part thereof.
According to a sixth aspect of the present invention, there is provided a
retroviral vector
wherein the immunological molecule is an immunoglobulin.
According to a seventh aspect of the present invention, there is provided a
retroviral
vector wherein the second NS is a nucleotide sequence coding for an
immunoglobulin
heavy chain variable region.
According to a eight aspect of the present invention, there is provided a
retroviral vector
wherein the vector additionally comprises a functional intron.
According to a ninth aspect of the present invention, there is provided a
retroviral vector
wherein the functional intron is positioned so that it is capable of
restricting expression of
at least one of the NOIs at a desired target site.
CA 02367488 2001-09-14
WO 00/56910 PCT/GB00/01091
According to a tenth aspect of the present invention, there is provided a
retroviral vector
wherein the target site is a cell.
According to a eleventh aspect of the present invention, there is provided a
retroviral
5 vector wherein the vector or pro-vector is derivable from a oncoretrovirus
or a lentivirus.
According to a twelfth aspect of the present invention, there is provided a
retroviral
vector wherein the vector is derivable from MMLV, MSV, MMTV, HIV-1 or EIAV.
1 o According to a thirteenth aspect of the present invention, there is
provided a retroviral
vector wherein the retroviral vector is an integrated provirus.
According to a fourteenth aspect of the present invention, there is provided a
retroviral
particle obtainable from a retroviral vector.
According to a fifteenth aspect of the present invention, there is provided a
cell
transfected or transduced with a retroviral vector.
According to a sixteenth aspect of the present invention there is provided a
retroviral
2o vector or a viral particle or a cell for use in medicine.
According to a seventeenth aspect of the present invention there is provided a
retroviral
vector or a viral particle or a cell for the manufacture of a pharmaceutical
composition to
deliver one or more NOIs to a target site in need of same.
According to a eighteenth aspect of the present invention there is provided a
method
comprising transfecting or transducing a cell with a retroviral vector or a
viral particle or
by use of a cell.
3o According to a nineteenth aspect of the present invention there is provided
a delivery
system for a retroviral vector or a viral particle or a cell wherein the
delivery system
comprises one or more non-retroviral expression vector(s), adenoviruse(s), or
plasmid(s)
CA 02367488 2001-09-14
WO 00/56910 PCT/GB00/01091
26
or combinations thereof for delivery of an NOI or a plurality of NOIs to a
first target cell
and a retroviral vector for delivery of an NOI or a plurality of NOIs to a
second target
cell.
According to a twentieth aspect of the present invention there is provided a
retroviral pro-
vector.
According to a twenty first aspect of the present invention there is provided
the use of a
functional intron to restrict expression of one or more NOIs within a desired
target cell.
According to a twenty second aspect of the present invention there is provided
the use of
a reverse transcriptase to deliver a first NS from the 3' end of a retroviral
pro-vector to the
5' end of a retroviral vector such that a functional intron is created upon
transduction.
According to a twenty third aspect of the present invention there is provided
a hybrid
viral vector system for in vivo gene delivery, which system comprises one or
more
primary viral vectors which encode a secondary viral vector, the primary
vector or vectors
capable of infecting a first target cell and of expressing therein the
secondary viral vector,
which secondary vector is capable of transducing a secondary target cell.
According to a twenty fourth aspect of the present invention there is provided
a hybrid
viral vector system wherein the primary vector is obtainable from or is based
on a
adenoviral vector and/or the secondary viral vector is obtainable from or is
based on a
retroviral vector preferably a lentiviral vector.
According to a twenty fifth aspect of the present invention there is provided
a hybrid viral
vector system wherein the lentiviral vector comprises or is capable of
delivering a split-
intron configuration.
According to a twenty sixth aspect of the present invention there is provided
a lentiviral
vector system wherein the lentiviral vector comprises or is capable of
delivering a split-
intron configuration.
CA 02367488 2001-09-14
WO 00/56910 PCT/GB00/01091
27
According to a twenty seventh aspect of the present invention there is
provided an
adenoviral vector system wherein the adenoviral vector comprises or is capable
of
delivering a split-intron configuration.
According to a twenty eighth aspect of the present invention there is provided
vectors or
plasmids basd on or obtained from any one or more of the entities presented as
pE 1 sp 1 A,
pCI-Neo, pE 1 RevE, pE 1 HORSE3.1, pE 1 PEGASUS4, pCI-Rab, pE 1 Rab.
According to a twenty ninth aspect of the present invention there is provided
a retroviral
1 o vector capable of differential expression of NOIs in target cells.
Another aspect of the present invention includes a hybrid viral vector system
for in vivo
gene delivery, which system comprises a primary viral vector which encodes a
secondary
viral vector, the primary vector capable of infecting a first target cell and
of expressing
therein the secondary viral vector, which secondary vector is capable of
transducing a
secondary target cell, wherein the primary vector is obtainable from or is
based on a
adenoviral vector and the secondary viral vector is obtainable from or is
based on a
retroviral vector preferably a lentiviral vector.
2o Another aspect of the present invention includes a hybrid viral vector
system for in vivo
gene delivery, which system comprises a primary viral vector which encodes a
secondary
viral vector, the primary vector capable of infecting a first target cell and
of expressing
therein the secondary viral vector, which secondary vector is capable of
transducing a
secondary target cell, wherein the primary vector is obtainable from or is
based on a
adenoviral vector and the secondary viral vector is obtainable from or is
based on a
retroviral vector preferably a lentiviral vector; wherein the viral vector
system comprises
a functional splice donor site (FSDS) and a functional splice acceptor (FSAS)
site;
wherein the FSDS and the FSAS flank a first nucleotide sequence of interest
(NOI);
wherein the FSDS is upstream of the FSAS; wherein the retroviral vector is
derived from
3o a retroviral pro-vector; wherein the retroviral pro-vector comprises a
first nucleotide
sequence (NS) capable of yielding the functional splice donor site (FSDS); a
second NS
capable of yielding the functional splice acceptor site (FSAS); a third NS
capable of
CA 02367488 2001-09-14
WO 00/56910 PCT/GB00/01091
28
yielding a non-functional splice donor site (NFSDS); a fourth NS capable of
yielding a
non-functional splice site (NFSS); wherein the first NS is downstream of the
second NS
and wherein the third NS and fourth NS are upstream of the second NS; such
that after
reverse transcription of the retroviral pro-vector at a desired target site
the retroviral
vector is capable of being spliced.
Another aspect of the present invention includes a self inactivating (SIN)
retroviral vector
comprising a functional splice donor site (FSDS) and a functional splice
acceptor (FSAS)
site; wherein the FSDS and the FSAS flank a first nucleotide sequence of
interest (NOI);
to wherein the FSDS is upstream of the FSAS; wherein the retroviral vector is
derived from
a retroviral pro-vector; wherein the retroviral pro-vector comprises a first
nucleotide
sequence (NS) capable of yielding the functional splice donor site (FSDS); a
second NS
capable of yielding the functional splice acceptor site (FSAS); a third NS
capable of
yielding a non-functional splice donor site (NFSDS); a fourth NS capable of
yielding a
non-functional splice site (NFSS); wherein the first NS is downstream of the
second NS
and wherein the third NS and fourth NS are upstream of the second NS; such
that a
retroviral vector cannot be packaged as a result of reverse transcription of
the retroviral
pro-vector at its desired target site.
2o Preferably the retroviral vector further comprises a second NOI; wherein
the second NOI
is downstream of the functional splice acceptor site.
Preferably the retroviral pro-vector comprises the second NOI; wherein the
second NOI is
downstream of the second NS.
Preferably the second NOI, or the expression product thereof, is or comprises
a
therapeutic agent or a diagnostic agent.
Preferably the first NOI, or the expression product thereof, is or comprises
any one or
3o more of an agent conferring selectablity (e.g. a marker element), a viral
essential element,
or a part thereof, or combinations thereof.
CA 02367488 2001-09-14
WO 00/56910 PCT/GB00/01091
29
Preferably the first NS is at or near to the 3' end of a retroviral pro-
vector; preferably
wherein the 3' end comprises a U3 region and an R region; and preferably
wherein the
first NS is located between the U3 region and the R region.
Preferably the U3 region and/or the first NS of the retroviral pro-vector
comprises an NS
that is a third NOI; wherein the NOI is any one or more of a transcriptional
control
element, a coding sequence or a part thereof.
Preferably the first NS is obtainable from a virus.
Preferably the first NS is an intron or a part thereof.
Preferably the intron is obtainable from the small t-intron of SV40 virus.
Preferably the vector components are regulated. In one preferred aspect of the
invention,
the vector components are regulated by hypoxia.
In another preferred aspect of the invention, the vector components are
regulated by
tetracycline on/off system.
Thus, the present invention provides a delivery system which utilises a
retroviral vector.
The retroviral vector of the delivery system of the present invention
comprises a
functional splice donor site (FSDS) and a functional splice acceptor site
(FSAS) which
flank a first NOI. The retroviral vector is formed as a result of reverse
transcription of a
retroviral pro-vector which may comprise a plurality of NOIs.
When the FSDS is positioned upstream of the FSAS, any intervening sequences)
are
capable of being spliced. Typically, splicing removes intervening or
''intronic" RNA
3o sequences and the remaining "exonic" sequences are ligated to provide
continuous
sequences for translation.
CA 02367488 2001-09-14
WO 00/56910 PCT/GB00/01091
The splicing process is pictorially represented in Figure 31.
In this pictorial representation, Y represents the intervening sequence that
is removed as a
5 result of splicing.
Preferably the intervening sequence (or intron) is positioned such that the
retroviral
packaging signal is deleted at the target site.
1o The natural splicing configuration for retroviral vectors is shown in
Figure 27a. The
splicing configuration of known vectors is shown in Figure 27b. The Splicing
configuration according to the present invention is shown in Figure 27c.
Preferably the intervening sequence is positioned such that the retroviral
packaging signal
15 is deleted at the desired target site and the retroviral vector is self
inactivated.
In accordance with the present invention, if the FSDS is downstream of the
FSAS, then
splicing cannot occur.
2o Likewise, if the FSDS is a non-functional splice donor site (NFSDS) and/or
the FSAS is a
non-functional acceptor acceptor site (NFSAS), then splicing cannot occur.
Preferably the fourth NS is capable of yielding a non-functional splice donor
site.
Preferably the fourth NS is capable of yielding a non-functional cryptic
splice donor site.
Preferably the fourth NS is capable of yielding a non-functional splice
acceptor site.
Preferably the fourth NS is capable of yielding a non-functional cryptic
splice acceptor
site.
Preferably the fourth NS is located within the retroviral packaging signal.
CA 02367488 2001-09-14
WO 00/56910 PCT/GB00/01091
31
An example of a NFSDS is a mutated FSDS such that the FSDS can no longer be
recognised by the splicing mechanism.
The term ''splice donor site'' includes identified and unidentified natural
and artificially
derived or derivable splice donor sites.
The term "cryptic" splice donor site includes a splice donor site located
within a
packaging signal which may even include a previously unidentified splice donor
site.
1o The term ''splice acceptor site" includes identified and unidentified
natural and artificially
derived or derivable splice acceptor sites.
The term ''cryptic" splice acceptor site includes a splice acceptor site
located within a
packaging signal which may even include a previously unidentified splice
acceptor site.
The term "splice site" includes identified and unidentified natural and
artificially derived
or derivable splice donor and/or splice acceptor sites including cryptic
splice donor and
cryptic splice acceptor sites.
2o The term "cryptic" splice site includes a cryptic splice donor site and/or
cryptic splice
acceptor site located within a packaging signal which may even include a
previously
unidentified splice donor or splice acceptor site.
In accordance with the present invention, each NS can be any suitable
nucleotide
sequence. For example, each sequence can be independently DNA or RNA - which
may
be synthetically prepared or may be prepared by use of recombinant DNA
techniques or
may be isolated from natural sources or may be combinations thereof. The
sequence may
be a sense sequence or an antisense sequence. There may be a plurality of
sequences,
which may be directly or indirectly joined to each other, or combinations
thereof.
3o
In accordance with the present invention, each NOI can be any suitable
nucleotide
sequence. For example, each sequence can be independently DNA or RNA - which
may
CA 02367488 2001-09-14
WO 00/56910 PCT/GB00/01091
32
be synthetically prepared or may be prepared by use of recombinant DNA
techniques or
may be isolated from natural sources or may be combinations thereof. The
sequence may
be a sense sequence or an antisense sequence. There may be a plurality of
sequences.
which may be directly or indirectly joined to each other, or combinations
thereof.
The first NOI may include but is not limited to any one or more of the
following
selectable markers which have been used successfully in retroviral vectors:
the bacterial
neomycin and hygromycin phosphotransferase genes which confer resistance to
6418 and
hygromycin respectively (Palmer et al 1987 Proc Natl Acad Sci 84: 105-1059;
Yang et
1o al 1987 Mol Cell Biol 7: 3923-3928); a mutant mouse dihydrofolate reductase
gene (dhfr)
which confers resistance to methotrexate (Miller et al 198 Mol Cell Biol 5:
431-437);
the bacterial gpt gene which allows cells to grow in medium containing
mycophenolic
acid, xanthine and aminopterin (Mann et al 1983 Cell 33: 153-159); the
bacterial hisD
gene which allows cells to grow in medium without histidine but containing
histidinol
(Danos and Mulligan 1988 Proc Natl Acad Sci 85: 6460-6464); the multidrug
resistance
gene (mdr) which confers resistance to a variety of drugs (Guild et al 1988
Proc Natl
Acad Sci 8~: 159-1599; Pastan et al 1988 Proc Natl Acad Sci 8~: 4486-4490) and
the
bacterial genes which confer resistance to puromycin or phleomycin .
(Morgenstern and
Land 1990 Nucleic Acid Res 18: 3587-3596).
All of these markers are dominant selectable markers and allow chemical
selection of
most cells expressing these genes: (3-galactosidase can also be considered a
dominant
marker; cells expressing (3-galactosidase can be selected by using the
fluorescence-
activated cell sorter. In fact, any cell surface protein can provide a
selectable marker for
cells not already making the protein. Cells expressing the protein can be
selected by
using the fluorescent antibody to the protein and a cell sorter. Other
selectable markers
that have been included in vectors include the hprt and HSV thymidine kinase
which
allows cells to grow in medium containing hypoxanthine, amethopterin and
thymidine.
The first NOI could contain non-coding sequences, for example the retroviral
packaging
site or non-sense sequences that render the second NOI non-functional in the
provector
CA 02367488 2001-09-14
WO 00/56910 PCT/GB00/01091
33
but when they are removed by the splicing the vector the second NOI is
revealed for
functional expression.
The first NOI may also encode a viral essential element such as env encoding
the Env
protein which can reduce the complexity of production systems. By way of
example, in
an adenoviral vector, this allows the retroviral vector genome and the
envelope to be
configured in a single adenoviral vector under the same promoter control thus
providing a
simpler system and leaving more capacity in the adenoviral vector for
additional
sequences. In one aspect, those additional sequences could be the gag pol
cassette itself.
Thus in one adenoviral vector one can produce a retroviral vector particle.
Previous
studies (Feng et al 1997 Nature Biotechnology 15: 866) have required the use
of multiple
adenoviral vectors.
If the retroviral component includes an env nucleotide sequence, then all or
part of that
sequence can be optionally replaced with all or part of another env nucleotide
sequence
such as, by way of example, the amphotropic Env protein designated 4070A or
the
influenza haemagglutinin (HA) or the vesicular stomatitis virus G (VSV-G)
protein.
Replacement of the env gene with a heterologous env gene is an example of a
technique
or strategy called pseudotyping. Pseudotyping is not a new phenomenon and
examples
2o may be found in WO-A-98/0579, WO-A-98/05754, WO-A-97/1747, WO-A-96/09400,
WO-A-91/00047 and Mebatsion et al 1997 Cell 90, 841-847.
In one preferred aspect, the retroviral vector of the present invention has
been
pseudotyped. In this regard, pseudotyping can confer one or more advantages.
For
2s example, with the lentiviral vectors, the env gene product of the HIV based
vectors would
restrict these vectors to infecting only cells that express a protein called
CD4. But if the
env gene in these vectors has been substituted with env sequences from other
RNA
viruses, then they may have a broader infectious spectrum (Verma and Somia
1997
Nature 389:239-242). By way of example, workers have pseudotyped an HIV based
3o vector with the glycoprotein from VSV (Verma and Somia 1997 ibic~.
CA 02367488 2001-09-14
WO 00/56910 PCT/GB00/01091
34
In another alternative, the Env protein may be a modified Env protein such as
a mutant or
engineered Env protein. Modifications may be made or selected to introduce
targeting
ability or to reduce toxicity or for another purpose (Valsesia-Wittman et al
1996 J Virol
70: 206-64: Nikon et al 1996 Gene Therapy 3: 280-6; Fielding et al 1998 Blood
9: 1802
and references cited therein).
Suitable second NOI coding sequences include those that are of therapeutic
and/or
diagnostic application such as, but are not limited to: sequences encoding
cytokines,
chemokines, hormones, antibodies, engineered immunoglobulin-like molecules, a
single
1 o chain antibody, fusion proteins, enzymes, immune co-stimulatory molecules,
immunomodulatory molecules, anti-sense RNA, a transdominant negative mutant of
a
target protein, a toxin, a conditional toxin, an antigen, a tumour suppressor
protein and
growth factors, membrane proteins, vasoactive proteins and peptides, anti-
viral proteins
and ribozymes, and derivatives therof (such as with an associated reporter
group). When
included, such coding sequences may be typically operatively linked to a
suitable
promoter, which may be a promoter driving expression of a ribozyme(s), or a
different
promoter or promoters.
The second NOI coding sequence may encode a fusion protein or a segment of a
coding
2o sequence
The retroviral vector of the present invention may be used to deliver a second
NOI such
as a pro-drug activating enzyme to a tumour site for the treatment of a
cancer. In each
. case, a suitable pro-drug is used in the treatment of the individual (such
as a patient) in
combination with the appropriate pro-drug activating enzyme. An appropriate
pro-drug is
administered in conjunction with the vector. Examples of pro-drugs include:
etoposide
phosphate (with alkaline phosphatase, Senter et al 1988 Proc Natl Acad Sci 8~:
4842-
4846); 5-fluorocytosine (with cytosine deaminase, Mullen et al 1994 Cancer Res
54:
1 X03-1506): Doxorubicin-N-p-hydroxyphenoxyacetamide (with Penicillin-V-
Amidase,
Kerr et al 1990 Cancer Immunol Immunother 31: 202-206); Para-N-bis(2-
chloroethyl)
aminobenzoyl glutamate (with carboxypeptidase G2); Cephalosporin nitrogen
mustard
carbamates (with (3-lactamase); SR4233 (with P450 Reducase); Ganciclovir (with
HSV
CA 02367488 2001-09-14
WO 00/56910 PCT/GB00/01091
thymidine kinase, Borrelli et al 1988 Proc Natl Acad Sci 85: 772-776); mustard
pro-
drugs with nitroreductase (Friedlos et al 1997 J Med Chem 40: 1270-1270 and
Cyclophosphamide (with P4~0 Chen et al 1996 Cancer Res ~6: 1331-1340).
The vector of the present invention may be a delivered to a target site by a
viral or a non-
viral vector.
As it is well known in the art, a vector is a tool that allows or. faciliates
the transfer of an
entity from one environment to another. By way of example, some vectors used
in
10 recombinant DNA techniques allow entities, such as a segment of DNA (such
as a
heterologous DNA segment, such as a heterologous cDNA segment), to be
transferred
into a target cell. Optionally, once within the target cell, the vector may
then serve to
maintain the heterologous DNA within the cell or may act as a unit of DNA
replication.
Examples of vectors used in recombinant DNA techniques include plasmids,
15 chromosomes, artificial chromosomes or viruses.
Non-viral delivery systems include but are not limted to DNA transfection
methods.
Here, transfection includes a process using a non-viral vector to deliver a
gene to a target
mammalian cell.
Typical transfection methods include electroporation, DNA biolistics, lipid-
mediated
transfection, compacted DNA-mediated transfection, liposomes, immunoliposomes,
lipofectin, cationic agent-mediated, cationic facial amphiphiles (CFAs)
(Nature
Biotechnology 1996 14; 5~6), and combinations thereof.
Viral delivery systems include but are not limited to adenovirus vector, an
adeno-
associated viral (AAV) vector, a herpes viral vector, retroviral vector,
lentiviral vector,
baculoviral vector or pox viral vector. Other examples of vectors include ex
vivo delivery
systems, which include but are not limited to DNA transfection methods such as
electroporation, DNA biolistics, lipid-mediated transfection, compacted DNA-
mediated
transfection.
CA 02367488 2001-09-14
WO 00/56910 PCT/GB00/01091
36
The vector delivery system of the present invention may consist of a primary
vector
manufactured in vitro which encodes the genes necessary to produce a secondary
vector
tn vtvo.
The primary viral vector or vectors may be a variety of different viral
vectors, such as
retroviral, adenoviral, herpes virus or pox virus vectors, or in the case of
multiple primary
viral vectors, they may be a mixture of vectors of different viral origin. In
whichever
case, the primary viral vectors are preferably defective in that they are
incapable of
independent replication. Thus, they are capable of entering a target cell and
delivering
1 o the secondary vector sequences, but not of replicating so as to go on to
infect further
target cells.
In the case where the hybrid viral vector system comprises more than one
primary vector
to encode the secondary vector, both or all three primary vectors will be used
to transfect
or transduce a primary target cell population, usually simultaneously.
Preferably, there is a single primary viral vector which encodes all
components of the
secondary viral vector.
2o The preferred single or multiple primary viral vectors are adenoviral
vectors.
Adenoviral vectors for use in the invention may be derived from a human
adenovirus or
an adenovirus which does not normally infect humans. Preferably the vectors
are derived
from adenovirus type 2 or adenovirus type 5 (Ad2 or Ad5) or a mouse adenovirus
or an
avian adenovirus such as CELO virus (Cotton et al 1993 J Virol 67:3777-3785).
The
vectors may be replication competent adenoviral vectors but are more
preferably
defective adenoviral vectors. Adenoviral vectors may be rendered defective by
deletion
of one or more components necessary for replication of the virus. Typically,
each
adenoviral vector contains at least a deletion in the E 1 region. For
production of
3o infectious adenoviral vector particles, this deletion may be complemented
by passage of
the virus in a human embryo fibroblast cell line such as human 293 cell line,
containing
an integrated copy of the left portion of Ads, including the E 1 gene. The
capacity for
CA 02367488 2001-09-14
WO 00/56910 PCT/GB00/01091
37
insertion of heterologous DNA into such vectors can be up to approximately
7kb. Thus
such vectors are useful for construction of a system according to the
invention comprising
three separate recombinant vectors each containing one of the essential
transcription units
for construction of the retroviral secondary vector.
Alternative adenoviral vectors are known in the art which contain further
deletions in
other adenoviral genes and these vectors are also suitable for use in the
invention.
Several of these second generation adenoviral vectors show reduced
immunogenicity (eg
E 1 + E2 deletions Gorziglia et al 1996 J Virol 70: 4173-4178; E 1 + E4
deletions Yeh et al
1996 J Virol 70: 559-565). Extended deletions serve to provide additional
cloning
capacity for the introduction of multiple genes in the vector. For example a
2~ kb
deletion has been described (Lieber et al 1996 J Virol 70: 8944-8960) and a
cloning
vector deleted of all viral genes has been reported (Fisher et al 1996
Virolology 217: 11-
22) which permit the introduction of more than 35 kb of heterologous DNA. Such
vectors may be used to generate an adenoviral primary vector according to the
invention
encoding two or three transcription units for construction of the retroviral
secondary
vector.
The secondary viral vector is preferably a retroviral vector. The secondary
vector is
2o produced by expression of essential genes for assembly and packaging of a
defective viral
vector particle, within the primary target cells. It is defective in that it
is incapable of
independent replication. Thus, once the secondary retroviral vector has
transduced a
secondary target cell, it is incapable of spreading by replication to any
further target cells.
The term "retroviral vector" typically includes a retroviral nucleic acid
which is capable
of infection, but which is not capable, by itself, of replication. Thus it is
replication
defective. A retroviral vector typically comprises one or more NOI(s),
preferably of non-
retroviral origin, for delivery to target cells. A retroviral vector may also
comprise a
functional splice donor site (FSDS); a functional splice acceptor site (FSAS);
a non-
functional splice donor site (NFSDS); and a non-functional splice site (NFSS)
so that
when the FSDS is upstream of the FSAS, any intervening sequences) are capable
of
being spliced. A retroviral vector may comprise further non-retroviral
sequences, such as
CA 02367488 2001-09-14
WO 00/56910 PCT/GB00/01091
38
non-retroviral control sequences in the U3 region which may influence
expression of an
NOI(s j once the retroviral vector is integrated as a provirus into a target
cell. The
retroviral vector need not contain elements from only a single retrovirus.
Thus, in
accordance with the present invention, it is possible to have elements
derivable from two
of more different retroviruses or other sources
The term "retroviral pro-vector" typically includes a retroviral vector genome
as
described above but which comprises a first nucleotide sequence (NS) capable
of yielding
a functional splice donor site (FSDS); a second NS capable of yielding a
functional splice
1o acceptor site (FSAS); a non-functional splice donor site (NFSDS); and a non-
functional
splice site (NFSS); wherein the first NS is downstream of the second NS;
wherein the
third and fourth NS are upstream of the second NS such that after reverse
transcription of
the retroviral pro-vector at a target site the retroviral vector is capable of
being spliced.
I s The term "retroviral vector particle" refers to the packaged retroviral
vector, that is
preferably capable of binding to and entering target cells. The components of
the particle,
as already discussed for the vector, may be modified with respect to the wild
type
retrovirus. For example, the Env proteins in the proteinaceous coat of the
particle may be
genetically modified in order to alter their targeting specificity or achieve
some other
2o desired function.
The retroviral vector of this aspect of the invention may be derivable from a
murine
oncoretrovirus such as MMLV, MSV or MMTV; or may be derivable from a
lentivirus
such as HIV-l, EIAV; or may be derivable from another retrovirus.
The retroviral vector of the invention can be modified to render a splice
donor site of the
retrovirus non-functional.
The retroviral vector of the invention can be modified to render a splice
acceptor site of
3o the retrovirus non-functional.
CA 02367488 2001-09-14
WO 00/56910 PCT/GB00/01091
39
The term "modification" includes but is not limited to silencing, disabling,
mutating or
removal of the splice donor or splice acceptor site.
Vectors, such as MLV based vectors, which have a mutated natural splice donor
site are
known in the art. An example of such a vector is pBABE (Morgenstern et al 1990
ibicl).
The secondary vector may be produced from expression of essential genes for
retroviral
vector production encoded in the DNA of the primary vector. Such genes may
include a
gag pol gene from a retrovirus, an env gene from an enveloped virus and a
defective
1o retroviral vector containing one or more therapeutic or diagnostic NOI(s).
The defective
retroviral vector contains in general terms sequences to enable reverse
transcription, at
least part of a 5' long terminal repeat (LTR), at least part of a 3'LTR and a
packaging
signal.
If it is desired to render the secondary vector replication defective, that
secondary vector
may be encoded by a plurality of transcription units, which may be located in
a single or
in two or more adenoviral or other primary vectors. Thus, there may be a
transcription
unit encoding the secondary vector genome, a transcription unit encoding gag
pol and a
transcription unit encoding env. Alternatively, two or more of these may be
combined.
?o For example, nucleic acid sequences encoding gag pol and env, or env and
the genome,
may be combined in a single transcription unit. Ways of achieving this are
known in the
art.
Transcription units as described herein are regions of nucleic acid containing
coding
?~ sequences and the signals for achieving expression of those coding
sequences
independently of any other coding sequences. T hus, each transcription unit
generally
comprises at least a promoter, an enhancer and a polyadenylation signal.
The term "promoter" is used in the normal sense of the art, e.g. an RNA
polymerise
30 binding site in the Jacob-Monod theory of gene expression.
CA 02367488 2001-09-14
WO 00/56910 PCT/GB00/01091
The term "enhancer" includes a DNA sequence which binds to other protein
components
of the transcription initiation complex and thus facilitates the initiation of
transcription
directed by its associated promoter.
5 The promoter and enhancer of the transcription units encoding the secondary
vector are
preferably strongly active, or capable of being strongly induced, in the
primary target
cells under conditions for production of the secondary viral vector. The
promoter and/or
enhancer may be constitutively efficient, or may be tissue or temporally
restricted in their
activity. Examples of suitable tissue restricted promoters/enhancers are those
which are
1 o highly active in tumour cells such as a promoter/enhancer from a MUC 1
gene, a CEA
Qene or a ~T4 antigen gene. Examples of temporally restricted
promoters/enhancers are
those which are responsive to ischaemia and/or hypoxia, such as hypoxia
response
elements or the promoter/enhancer of a grp78 or a grp94 gene. One preferred
promoter-
enhancer combination is a human cytomegalovirus (hCMV) major immediate early
(MIE)
15 promoter/enhancer combination.
Other preferred additional components include entities enabling efficient
expression of an
NOI or a plurality of NOIs.
2o In one preferred aspect of the present invention, there is hypoxia or
ischaemia regulatable
expression of the secondary vector components. In this regard, hypoxia is a
powerful
regulator of gene expression in a wide range of different cell types and acts
by the
induction of the activity of hypoxia-inducible transcription factors such as
hypoxia
inducible factor-1 (HIF-l; Wang & Semenza 1993 Proc Natl Acad Sci 90:430),
which
z5 bind to cognate DNA recognition sites, the hypoxia-responsive elements
(HREs) on
various gene promoters. Dachs et al ( 1997 Nature Med ~ : ~ 15) have used a
multimeric
form of the HRE from the mouse phosphoglycerate kinase-1 (PGK-1) gene (Firth
et al
1994 Proc Natl Acad Sci 91:6496-6500) to control expression of both marker and
therapeutic genes by human fibrosarcoma cells in response to hypoxia in vitro
and within
3o solid tumours in vivo (Dachs et al ibicl). Alternatively, the fact that
marked glucose
deprivation is also present in ischaemic areas of tumours can be used to
activate
heterologous gene expression specifically in tumours. A truncated 632 base
pair
CA 02367488 2001-09-14
WO 00/56910 PCT/GB00/01091
41
sequence of the grp 78 gene promoter, known to be activated specifically by
glucose
deprivation, has also been shown to be capable of driving high level
expression of a
reporter gene in murine tumours in vivo (Gazit et al 1995 Cancer Res X5:1660).
An alternative method of regulating the expression of such components is by
using the
tetracycline on/off system described by Gossen and Bujard (1992 Proc Natl Acad
Sci 89:
547) as described for the production of retroviral gal, pol and VSV-G proteins
by
Yoshida et al (1997 Biochem Biophys Res Comm 230: 426). Unusually this
regulatory
system is also used in the present invention to control the production of the
pro-vector
1 o genome. This ensures that no vector components are expressed from the
adenoviral
vector in the absence of tetracycline.
Safety features which may be incorporated into the hybrid viral vector system
are
described below. One or more such features may be present.
The secondary vector is also advantageous for in vivo use in that incorporated
into it are
one or more features which eliminate the possibility of recombination to
produce an
infectious virus capable of independent replication. Such features were not
included in
previous published studies (Feng et al 1997 ibic~. In particular, the
construction of a
2o retroviral vector from three components as described below was not
described by Feng et
al (ibicl).
Firstly, sequence homology between the sequences encoding the components of
the
secondary vector may be avoided by deletion of regions of homology. Regions of
homology allow genetic recombination to occur. In a particular embodiment,
three
transcription units are used to construct a secondary retroviral vector. The
first
transcription unit contains a retroviral gag pol gene under the control of a
non-retroviral
promoter and enhancer. The second transcription unit contains a retroviral env
gene
under the control of a non-retroviral promoter and enhancer. The third
transcription unit
3o comprises a defective retroviral genome under the control of a non-
retroviral promoter
and enhancer. In the native retroviral genome, the packaging signal is located
such that
part of the gag sequence is required for proper functioning. Normally when
retroviral
CA 02367488 2001-09-14
WO 00/56910 PCT/GB00/01091
42
vector systems are constructed therefrom, the packaging signal, including part
of the gag
gene, remains in the vector genome. In the present case however, the defective
retroviral
Qenome contains a minimal packaging signal which does not contain sequences
homologous to gag sequences in the first transcription unit. Also, in
retroviruses, for
example Moloney Murine Leukaemia virus (MMLV), there is a small region of
overlap
between the 3' end of the pol coding sequence and the ~' end of env. The
corresponding
region of homology between the first and second transcription units may be
removed by
altering the sequence of either the 3' end of the pol coding sequence or the
5' end of env
so as to change the codon usage but not the amino acid sequence of the encoded
proteins.
Secondly, the possibility of replication competent secondary viral vectors may
be avoided
by pseudotyping the genome of one retrovirus with the Env protein of another
retrovirus
or another enveloped virus so that regions of homology between the env and gag
pol
components are avoided.
In a particular embodiment the retroviral vector is constructed from the
following three
components: The first transcription unit contains a retroviral gag pol gene
under the
control of a non-retroviral promoter and enhancer. The second transcription
unit contains
the env gene from the alternative enveloped virus, under the control of a non-
retroviral
promoter and enhancer. The third transcription unit comprises a defective
retroviral
genome under the control of a non-retroviral promoter and enhancer. The
defective
retroviral genome contains a minimal packaging signal which does not contain
sequences
homologous to gag sequences in the first transcription unit.
Thirdly, the possibility of replication competent retroviruses can be
eliminated by using
two transcription units constructed in a particular way. The first
transcription unit
contains a gag pol coding region under the control of a promoter-enhancer
active in the
primary target cell such as a hCMV promoter-enhancer or a tissue restricted
promoter-
enhancer. The second transcription unit encodes a retroviral genome RNA
capable of
3o being packaged into a retroviral particle. The second transcription unit
contains retroviral
sequences necessary for packaging, integration and reverse transcription and
also contains
CA 02367488 2001-09-14
WO 00/56910 PCT/GB00/01091
43
sequences coding for an env protein of an enveloped virus and the coding
sequence of one
or more therapeutic genes.
In this example, the transcription of the env and an NOI coding sequences is
devised such
that the Env protein is preferentially produced in the primary target cell
while the NOI
expression product is or are preferentially produced in the secondary target
cell.
A suitable intron splicing arrangement is described later on in Example 5 and
illustrated
in Figure 17 and Figure 27c. Here, a splice donor site is positioned
downstream of a
1 o splice acceptor site in the retroviral genome sequence delivered by the
primary vector to
the primary target cell. Splicing will therefore be absent or infrequent in
the primary
target cell so the Env protein will preferentially be expressed. However, once
the vector
genome has gone through the process of reverse transcription and integration
into the
secondary target cell, a functional splice donor sequence will be located in
the 5' LTR,
upstream of a functional splice acceptor sequence. Splicing occurs to splice
out the env
sequence and transcripts of the NOI are produced.
In a second arrangement of this example, the expression of an NOI is
restricted to the
secondary target cell and prevented from being expressed in the primary target
cell as
2o follows: This arrangement is described later on in Example 6 and
illustrated in Figure 18.
There, a promoter-enhancer and a first fragment of an NOI containing the ~'
end of the
coding sequence and a natural or artificially derived or derivable splice
donor sequence
are inserted at the 3' end of the retroviral genome construct upstream of the
R-region. A
second fragment of the NOI which contains all the sequences required to
complete the
coding region is placed downstream of a natural or artificially derived or
derivable splice
acceptor sequence located downstream from the packaging signal in the
retroviral genome
construct. On reverse transcription and integration of the retroviral genome
in the
secondary target cell, the promoter 5' fragment of the NOI and the functional
splice donor
sequence are located upstream of the functional splice acceptor and the 3' end
of the NOI.
3o Transcription from the promoter and splicing then permit translation of the
NOI in the
secondary target cell.
CA 02367488 2001-09-14
WO 00/56910 PCT/GB00/01091
44
In a preferred embodiment the hybrid viral vector system according to the
invention
comprises single or multiple adenoviral primary vectors which encodes or
encode a
retroviral secondary vector.
Preferred embodiments of the present invention described address one of the
major
problems associated with adenoviral and other viral vectors, namely that gene
expression
from such vectors is transient. The retroviral particles generated from the
primary target
cells can transduce secondary target cells and gene expression in the
secondary target
cells is stably maintained because of the integration of the retroviral vector
genome into
1o the host cell genome. The secondary target cells do not express significant
amounts of
viral protein antigens and so are less immunogenic than cells transduced with
adenoviral
vector.
The use of a retroviral vector as the secondary vector is advantageous because
it allows a
degree of cellular discrimination, for instance by permitting the targeting of
rapidly
dividing cells. Furthermore, retroviral integration permits the stable
expression of
therapeutic genes in the target tissue, including stable expression in
proliferating target
cells.
3o The use of the novel retroviral vector design of the present invention is
also advantageous
in that gene expression can be limited to a primary or a secondary target
site. In this way,
single or multiple NOIs can be preferentially expressed at a secondary target
site and
poorly expressed or not expressed at a biologically significant level at a
primary target
site. As a result, the possible toxicity or antigenicity of an NOI may be
avoided.
Preferably, the primary viral vector preferentially transduces a certain cell
type or cell
types.
More preferably, the primary vector is a targeted vector, that is it has a
tissue tropism
3o which is altered compared to the native virus, so that the vector is
targeted to particular
cells.
CA 02367488 2001-09-14
WO 00/56910 PCT/GB00/01091
The term "targeted vector" is not necessarily linked to the term ''target
site" or target
cell".
"Target site'' refers to a site which a vector, whether native or targeted, is
capable of
5 transfecting or transducing.
"Primary target site" refers to a first site which a vector, whether native or
targeted, is
capable of transfecting or transducing.
10 ''Secondary target site" refers to a second site which a vector, whether
native or targeted,
is capable of transfecting or transducing.
"Target cell" simply refers to a cell which a vector, whether native or
targeted, is capable
of transfecting or transducing.
"Primary target cell" refers to a first cell which a vector, whether native or
targeted, is
capable of transfecting or transducing.
"Secondary target cell" refers to a second cell which a vector, whether native
or targeted,
2o is capable of transfecting or transducing.
The preferred, adenoviral primary vector according to the invention is also
preferably a
targeted vector, in which the tissue tropism of the vector is altered from
that of a wild-
type adenovirus. Adenoviral vectors can be modified to produce targeted
adenoviral
vectors for example as described in: Krasnykh et al 1996 J. Virol 70: 6839-
6846;
Wickham et al 1996 J. Virol 70: 6831-6838; Stevenson et al 1997 J. Virol 71:
4782-4790;
Wickham et al 199 Gene Therapy 2: 750-7~6; Douglas et al 1997 Neuromuscul.
Disord
7:284-298; Wickham et al 1996 Nature Biotechnology 14: 170-1573.
Primary target cells for the vector system according to the invention include
haematopoietic cells (including monocytes, macrophages, lymphocytes,
granulocytes or
CA 02367488 2001-09-14
WO 00/56910 PCT/GB00/01091
46
progenitor cells of any of these); endothelial cells: tumour cells; stromal
cells; astrocytes
or glial cells; muscle cells; and epithelial cells.
Thus, a primary target cell according to the invention, capable of producing
the second
viral vector, may be of any of the above cell types.
In a preferred embodiment, the primary target cell according to the invention
is a
monocyte or macrophage transduced by a defective adenoviral vector containing
a first
transcription unit for a retroviral gag pol and a second transcription unit
capable of
1 o producing a packageable defective retroviral genome. In this case at least
the second
transcription unit is preferably under the control of a promoter-enhancer
which is
preferentially active in a diseased location within the body such as an
ischaemic site or
the micro-environment of a solid tumour.
t 5 In a particularly preferred embodiment, the second transcription unit is
constructed such
that on insertion of the genome into the secondary target cell, an intron is
generated which
serves to reduce expression of a viral essential element, such as the viral
env gene, and
permit efficient expression of a therapeutic and/or diagnostic NOI or NOIs.
?o The packaging cell may be an in vivo packaging cell in the body of an
individual to be
treated or it may be a cell cultured in vitro such as a tissue culture cell
line. Suitable cell
lines include mammalian cells such as marine fibroblast derived cell lines or
human cell
lines. Preferably the packaging cell line is a human cell line, such as for
example:
HEK293, 293-T, TE671, HT1080.
?s
Alternatively, the packaging cell may be a cell derived from the individual to
be treated
such as a monocyte, macrophage, blood cell or fibroblast. The cell may be
isolated from
an individual and the packaging and vector components administered ex vivo
followed by
re-administration of the autologous packaging cells. Alternatively the
packaging and
3o vector components may be administered to the packaging cell in vivo.
Methods for
introducing retroviral packaging and vector components into cells of an
individual are
known in the art. For example, one approach is to introduce the different DNA
sequences
CA 02367488 2001-09-14
WO 00/56910 PCT/GB00/01091
47
that are required to produce a retroviral vector particle e.g. the env coding
sequence, the
gag pol coding sequence and the defective retroviral genome into the cell
simultaneously
by transient triple transfection (Landau & Littman 1992 J. Virol. 66, 5110;
Soneoka et al
199 Nucleic Acids Res 23:628-633).
The secondary viral vectors may also be targeted vectors. For retroviral
vectors, this may
be achieved by modifying the Env protein. The Env protein of the retroviral
secondary
vector needs to be a non-toxic envelope or an envelope which may be produced
in non-
toxic amounts within the primary target cell, such as for example a MMLV
amphotropic
1 o envelope or a modified amphotropic envelope. The safety feature in such a
case is
preferably the deletion of regions or sequence homology between retroviral
components.
Preferably the envelope is one which allows transduction of human cells.
Examples of
suitable env genes include, but are not limited to, VSV-G, a MLV amphotropic
env such
as the 4070A env, the RD 114 feline leukaemia virus env or haemagglutinin (HA)
from an
influenza virus. The Env protein may be one which is capable of binding to a
receptor on
a limited number of human cell types and may be an engineered envelope
containing
targeting moieties. The env and gag pol coding sequences are transcribed from
a
promoter and optionally an enhancer active in the chosen packaging cell line
and the
2o transcription unit is terminated by a polyadenylation signal. For example,
if the
packaging cell is a human cell, a suitable promoter-enhancer combination is
that from the
human cvtomegalovirus major immediate early (hCMV-MIE) gene and a
polyadenylation
signal from SV40 virus may be used. Other suitable promoters and
polyadenylation
signals are known in the art.
The secondary target cell population may be the same as the primary target
cell
population. For example delivery of a primary vector of the invention to
tumour cells
leads to replication and generation of further vector particles which can
transduce further
tumour cells.
Alternatively, the secondary target cell population may be different from the
primary
target cell population. In this case the primary target cells serve as an
endogenous factory
CA 02367488 2001-09-14
WO 00/56910 PCT/GB00/01091
48
within the body of the treated individual and produce additional vector
particles which
can transduce the secondary target cell population. For example, the primary
target cell
population may be haematopoietic cells transduced by the primary vector in
vivo or e~
vivo. The primary target cells are then delivered to or migrate to a site
within the body
such as a tumour and produce the secondary vector particles, which are capable
of
transducing for example mitotically active tumour cells within a solid tumour.
The retroviral vector particle according to the invention will also be capable
of
transducing cells which are slowly-dividing, and which non-lentiviruses such
as MLV
to would not be able to efficiently transduce: Slowly-dividing cells divide
once in about
every three to four days including certain tumour cells. Although tumours
contain rapidly
dividing cells, some tumour cells especially those in the centre of the
tumour, divide
infrequently. Alternatively the target cell may be a growth-arrested cell
capable of
undergoing cell division such as a cell in a central portion of a tumour mass
or a stem cell
such as a haematopoietic stem cell or a CD34-positive cell. As a further
alternative, the
target cell may be a precursor of a differentiated cell such as a monocyte
precursor, a
CD33-positive cell, or a myeloid precursor. As a further alternative, the
target cell may
be a differentiated cell such as a neuron, astrocyte, glial cell, microglial
cell, macrophage,
monocyte, epithelial cell. endothelial cell, hepatocyte, spermatocyte,
spermatid or
2o spermatozoa. Target cells may be transduced either in vitro after isolation
from a human
individual or may be transduced directly in vivo.
The invention permits the localised production of high titres of defective
retroviral vector
particles in vivo at or near the site at which action of a therapeutic protein
or proteins is
required with consequent efficient transduction of secondary target cells.
This is more
efficient than using either a defective adenoviral vector or a defective
retroviral vector
alone.
The invention also permits the production of retroviral vectors such as MMLV-
based
3o vectors in non-dividing and slowly-dividing cells in vivo. It had
previously been possible
to produce MMLV-based retroviral vectors only in rapidly dividing cells such
as tissue
culture-adapted cells proliferating in vitro or rapidly dividing tumour cells
in vivo.
CA 02367488 2001-09-14
WO 00/56910 PCT/GB00/01091
49
Extending the range of cell types capable of producing retroviral vectors is
advantageous
for delivery of genes to the cells of solid tumours, many of which are
dividing slowly, and
for the use of non-dividing cells such as endothelial cells and cells of
various
haematopoietic lineages as endogenous factories for the production of
therapeutic protein
products.
The delivery of one or more therapeutic genes by a vector system according to
the present
invention may be used alone or in combination with other treatments or
components of
the treatment.
For example, the retroviral vector of the present invention may be used to
deliver one or
more NOI(s) useful in the treatment of the disorders listed in WO-A-98/0~63~.
For ease
of reference, part of that list is now provided: cancer, inflammation or
inflammatory
disease, dermatological disorders, fever, cardiovascular effects, haemorrhage,
coagulation
and acute phase response, cachexia, anorexia, acute infection, HIV infection,
shock states,
graft-versus-host reactions, autoimmune disease, reperfusion injury,
meningitis, migraine
and aspirin-dependent anti-thrombosis; tumour growth, invasion and spread,
angiogenesis, metastases, malignant, ascites and malignant pleural effusion;
cerebral
ischaemia, ischaemic heart disease, osteoarthritis, rheumatoid arthritis,
osteoporosis,
2o asthma, multiple sclerosis, neurodegeneration, Alzheimer's disease,
atherosclerosis,
stroke, vasculitis, Crohn's disease and ulcerative colitis; periodontitis,
gingivitis;
psoriasis, atopic dermatitis, chronic ulcers, epidermolysis bullosa; corneal
ulceration,
retinopathy and surgical wound healing; rhinitis, allergic conjunctivitis,
eczema,
anaphylaxis; restenosis, congestive heart failure, endometriosis,
atherosclerosis or
endosclerosis.
In addition, or in the alternative, the retroviral vector of the present
invention may be used
to deliver one or more NOI(s) useful in the treatment of disorders listed in
WO-A-
98/07859. For ease of reference, part of that list is now provided: cytokine
and cell
3o proliferation/differentiation activity; immunosuppressant or
immunostimulant activity
(e.g. for treating immune deficiency, including infection with human immune
deficiency
virus; regulation of lymphocyte growth; treating cancer and many autoimmune
diseases,
CA 02367488 2001-09-14
WO 00/56910 PCT/GB00/01091
and to prevent transplant rejection or induce tumour immunity); regulation of
haematopoiesis, e.g. treatment of myeloid or lymphoid diseases; promoting
Qrowth of
bone, cartilage, tendon, ligament and nerve tissue, e.g. for healing wounds,
treatment of
burns, ulcers and periodontal disease and neurodegeneration; inhibition or
activation of
5 follicle-stimulating hormone (modulation of fertility);
chemotactic/chemokinetic activity
(e.g. for mobilising specific cell types to sites of injury or infection);
haemostatic and
thrombolytic activity (e.g. for treating haemophilia and stroke);
antiinflammatory activity
(for treating e.g. septic shock or Crohn's disease); as antimicrobials;
modulators of e.g.
metabolism or behaviour; as analgesics; treating specific deficiency
disorders; in
to treatment of e.g, psoriasis, in human or veterinary medicine.
In addition, or in the alternative, the retroviral vector of the present
invention may be used
to deliver one or more NOI(s) useful in the treatment of disorders listed in
WO-A-
98/09985. For ease of reference, part of that list is now provided: macrophage
inhibitory
15 and/or T cell inhibitory activity and thus, anti-inflammatory activity;
anti-immune
activity, i.e. inhibitory effects against a cellular and/or humoral immune
response,
including a response not associated with inflammation; inhibit the ability of
macrophages
and T cells to adhere to extracellular matrix components and fibronectin, as
well as up-
regulated fas receptor expression in T cells; inhibit unwanted immune reaction
and
2o inflammation including arthritis, including rheumatoid arthritis,
inflammation associated
with hypersensitivity, allergic reactions, asthma, systemic lupus
erythematosus, collagen
diseases and other autoimmune diseases, inflammation associated with
atherosclerosis,
arteriosclerosis, atherosclerotic heart disease, reperfusion injury, cardiac
arrest,
myocardial infarction, vascular inflammatory disorders, respiratory distress
syndrome or
25 other cardiopulmonary diseases, inflammation associated with peptic ulcer,
ulcerative
colitis and other diseases of the gastrointestinal tract, hepatic fibrosis,
liver cirrhosis or
other hepatic diseases, thyroiditis or other glandular diseases,
glomerulonephritis or other
renal and urologic diseases, otitis or other oto-rhino-laryngological
diseases, dermatitis or
other dermal diseases, periodontal diseases or other dental diseases, orchids
or epididimo-
30 orchids, infertility, orchidal trauma or other immune-related testicular
diseases, placental
dysfunction, placental insufficiency, habitual abortion, eclampsia, pre-
eclampsia and
other immune and/or inflammatory-related gynaecological diseases, posterior
uveitis,
CA 02367488 2001-09-14
WO 00/56910 PCT/GB00/01091
51
intermediate uveitis, anterior uveitis, conjunctivitis, chorioretinitis,
uveoretinitis, optic
neuritis, intraocular inflammation, e.g. retinitis or cystoid macular oedema,
sympathetic
ophthalmia, scleritis, retinitis pigmentosa, immune and inflammatory
components of
degenerative fondus disease, inflammatory components of ocular trauma, ocular
inflammation caused by infection, proliferative vitreo-retinopathies, acute
ischaemic optic
neuropathy, excessive scarring, e.g. following glaucoma filtration operation,
immune
and/or inflammation reaction against ocular implants and other immune and
inflammatory-related ophthalmic diseases, inflammation associated with
autoimmune
diseases or conditions or disorders where, both in the central nervous system
(CNS) or in
1 o any other organ,. immune and/or inflammation suppression would be
beneficial,
Parkinson's disease, complication and/or side effects from treatment of
Parkinson's
disease, AIDS-related dementia complex HIV-related encephalopathy, Devic's
disease,
Sydenham chorea, Alzheimer's disease and other degenerative diseases,
conditions or
disorders of the CNS, inflammatory components of stokes, post-polio syndrome,
immune
and inflammatory components of psychiatric disorders, myelitis, encephalitis,
subacute
sclerosing pan-encephalitis, encephalomyelitis, acute neuropathy, subacute
neuropathy,
chronic neuropathy, Guillaim-Barre syndrome, Sydenham chora, myasthenia
gravis,
pseudo-tumour cerebri, Down's Syndrome, Huntington's disease, amyotrophic
lateral
sclerosis, inflammatory components of CNS compression or CNS trauma or
infections of
3o the CNS, inflammatory components of muscular atrophies and dystrophies, and
immune
and inflammatory related diseases, conditions or disorders of the central and
peripheral
nervous systems, post-traumatic inflammation, septic shock, infectious
diseases,
inflammatory complications or side effects of surgery, bone marrow
transplantation or
other transplantation complications and/or side effects, inflammatory and/or
immune
complications and side effects of gene therapy, e.g. due to infection with a
viral carrier, or
inflammation associated with AIDS, to suppress or inhibit a humoral and/or
cellular
immune response, to treat or ameliorate monocyte or leukocyte proliferative
diseases, e.g.
leukaemia, by reducing the amount of monocytes or lymphocytes, for the
prevention
and/or treatment of graft rejection in cases of transplantation of natural or
artificial cells,
tissue and organs such as cornea, bone marrow, organs, lenses, pacemakers,
natural or
artificial skin tissue.
CA 02367488 2001-09-14
WO 00/56910 PCT/GB00/01091
52
Further provided according to the invention are methods of controlling
production of a
therapeutic NOI or NOIs such that the therapeutic NOI or NOIs is/are
preferentially
expressed in a secondary target cell population and is/are poorly expressed or
not
expressed at a biologically significant level in a primary target cell.
The present invention also provides a pharmaceutical composition for treating
an
individual by gene therapy, wherein the composition comprises a
therapeutically effective
amount of the retroviral vector of the present invention comprising one or
more
deliverable therapeutic and//or diagnostic NOI(s) or a viral particle produced
by or
obtained from same. The pharmaceutical composition nay be for human or animal
usage.
Typically, a physician will determine the actual dosage which will be most
suitable for an
individual subject and it will vary with the age, weight and response of the
particular
individual.
The composition may optionally comprise a pharmaceutically acceptable carrier,
diluent,
excipient or adjuvant. The choice of pharmaceutical carrier, excipient or
diluent can be
selected with regard to the intended route of administration and standard
pharmaceutical
practice. The pharmaceutical compositions may comprise as - or in addition to -
the
carrier, excipient or diluent any suitable binder(s), lubricant(s), suspending
agent(s),
2o coating agent(s), solubilising agent(s), and other carrier agents that may
aid or increase
the viral entry into the target site (such as for example a lipid delivery
system).
Where appropriate, the pharmaceutical compositions can be administered by any
one or
more of: inhalation, in the form of a suppository or pessary, topically in the
form of a
lotion, solution, cream, ointment or dusting powder, by use of a skin patch,
orally in the
form of tablets containing excipients such as starch or lactose, or in
capsules or ovules
either alone or in admixture with excipients, or in the form of elixirs,
solutions or
suspensions containing flavouring or colouring agents, or they can be injected
parenterally, for example intracavernosally, intravenously, intramuscularly or
3o subcutaneously. For parenteral administration, the compositions may be best
used in the
form of a sterile aqueous solution which may contain other substances, for
example
enough salts or monosaccharides to make the solution isotonic with blood. For
buccal or
CA 02367488 2001-09-14
WO 00/56910 PCT/GB00/01091
53
sublingual administration the compositions may be administered in the form of
tablets or
lozenges which can be formulated in a conventional manner.
In a further aspect of the present invention, there is provided a hybrid viral
vector system
in the general sense (i.e. not necessarily limited to the aforementioned first
aspect of the
present invention as defined above) for in vivo gene delivery, which system
comprises
one or more primary viral vectors which encode a secondary viral vector, the
primary
vector or vectors capable of infecting a first target cell and of expressing
therein the
secondary viral vector, which secondary vector is capable of transducing a
secondary
i o target cell.
With this particular embodiment, the genetic vector of the invention is thus a
hybrid viral
vector system for gene delivery which is capable of generation of defective
infectious
particles from within a target cell. Thus a genetic vector of the invention
consists of a
primary vector manufactured in vitro which encodes the genes necessary to
produce a
secondary vector in vivo. In use, the secondary vector carries one or more
selected genes
for insertion into the secondary target cell. The selected genes may be one or
more
marker genes and/or therapeutic genes. Marker genes encode selectable and/or
detectable
proteins.
2o
More aspects concerning this particular aspect of the present invention now
follow -
which teachings are also applicable to the aforementioned aspects of the
present
invention.
In another aspect the invention provides target cells infected by the primary
viral vector
or vectors and capable of producing infectious secondary viral vector
particles.
In a further aspect the invention provides a method of treatment of a human or
non-
human mammal, which method comprises administering a hybrid viral vector
system or
3o target cells infected by the primary viral vector or vectors, as described
herein.
CA 02367488 2001-09-14
WO 00/56910 PCT/GB00/01091
54
The primary viral vector or vectors may be a variety of different viral
vectors, such as
retroviral, adenoviral, herpes virus or pox virus vectors, or in the case of
multiple primary
viral vectors, they may be a mixture of vectors of different viral origin. In
whichever
case, the primary viral vectors are preferably defective in that they are
incapable of
independent replication. Thus, they are capable of entering a target cell and
delivering
the secondary vector sequences, but not of replicating so as to go on to
infect further
target cells.
In the case where the hybrid viral vector system comprises more than one
primary vector
I o to encode the secondary vector, both or all three primary vectors will be
used to infect a
primary target cell population, usually simultaneously. Preferably, there is a
single
primary viral vector which encodes all components of the secondary viral
vector.
The preferred single or multiple primary viral vectors are adenoviral vectors.
Adenovirus
I5 vectors have significant advantages over other viral vectors in terms of
the titres which
can be obtained from in vitro cultures. The adenoviral particles are also
comparatively
stable compared with those of enveloped viruses and are therefore more readily
purified
and stored. However, current adenoviral vectors suffer from major limitations
for in vivo
therapeutic use since gene expression from defective adenoviral vectors is
only transient.
2o Because the vector genome does not replicate, target cell proliferation
leads to dilution of
the vector. Also cells expressing adenoviral proteins, even at a low level,
are destroyed
by an immunological response raised against the adenoviral proteins.
The secondary viral vector is preferably a retroviral vector. The secondary
vector is
25 produced by expression of essential genes for assembly and packaging of a
defective viral
vector particle, within the primary target cells. It is defective in that it
is incapable of
independent replication. Thus, once the secondary retroviral vector has
transduced a
secondary target cell, it is incapable of spreading by replication to any
further target cells.
The secondary vector may be produced from expression of essential genes for
retroviral
3o vector production encoded in the DNA of the primary vector. Such genes may
include a
gag pol gene from a retrovirus, an envelope gene from an enveloped virus and a
defective
retroviral genome containing one or more therapeutic genes. The defective
retroviral
CA 02367488 2001-09-14
WO 00/56910 PCT/GB00/01091
genome contains in general terms sequences to enable reverse transcription, at
least part
of a 5' long terminal repeat (LTR), at least part of a 3'LTR and a packaging
signal.
Importantly, the secondary vector is also safe for in vivo use in that
incorporated into it
5 are one or more safety features which eliminate the possibility of
recombination to
produce an infectious virus capable of independent replication.
To ensure that it is replication defective the secondary vector may be encoded
by a
plurality of transcription units. which may be located in a single or in two
or more
1 o adenoviral or other primary vectors. Thus, there may be a transcription
unit encoding the
secondary vector genome, a transcription unit encoding gag pol and a
transcription unit
encoding env. Alternatively, two or more of these may be combined. For
example,
nucleic acid sequences encoding gag pol and env, or env and the genome, may be
combined in a single transcription unit. Ways of achieving this are known in
the art.
Transcription units as described herein are regions of nucleic acid containing
coding
sequences and the signals for achieving expression of those coding sequences
independently of any other coding sequences. Thus, each transcription unit
generally
comprises at least a promoter, an enhancer and a polyadenylation signal. The
promoter
2o and enhancer of the transcription units encoding the secondary vector are
preferably
strongly active, or capable of being strongly induced, in the primary target
cells under
conditions for production of the secondary viral vector. The promoter and/or
enhancer
may be constitutively efficient, or may be tissue or temporally restricted in
their activity.
Examples of suitable tissue restricted promoters/enhancers are those which are
highly
actme in tumour cells such as a promoter/enhancer from a MUC 1 gene, a CEA
gene or a
ST4 antigen gene. Examples of temporally restricted promoters/enhancers are
those
which are responsive to ischaemia and/or hypoxia, such as hypoxia response
elements or
the promoter/enhancer of a grp78 or a grp94 gene. One preferred promoter-
enhancer
combination is a human cytomegalovirus (hCMV) major immediate early (MIE)
3o promoter/enhancer combination.
CA 02367488 2001-09-14
WO 00/56910 PCT/GB00/01091
56
Hypoxia or ischaemia regulatable expression of secondary vector components may
be
particularly useful under certain circumstances. Hypoxia is a powerful
regulator of gene
expression in a wide range of different cell types and acts by the induction
of the activity
of hypoxia-inducible transcription factors such as hypoxia inducible factor-1
(HIF-l;
Wang & Semenza (1993). Proc. Natl. Acad. Sci USA 90:430), which bind to
cognate
DNA recognition sites, the hypoxia-responsive elements (HREs) on various gene
promoters. Dachs et al (1997). Nature Med. 5: 515.) have used a multimeric
form of the
HRE from the mouse phosphoglycerate kinase-1 (PGK-1) gene (Firth et al.
(1994). Proc.
Natl. Acad. Sci USA 91:6496-6500) to control expression of both marker and
therapeutic
genes by human fibrosarcoma cells in response to hypoxia in vitro and within
solid
tumours in vivo (Dachs et al ibicl). Alternatively, the fact that marked
glucose deprivation
is also present in ischaemic areas of tumours can be used to activate
heterologous gene
expression specifically in tumours. A truncated 632 base pair sequence of the
grp 78
gene promoter, known to be activated specifically by glucose deprivation, has
also been
shown to be capable of driving high level expression of a reporter gene in
marine tumours
in vivo (Gazit G, et al (1995). Cancer Res. 55:1660).
Safety features which may be incorporated into the hybrid viral vector system
are
described below. One or more such features may be present.
?0
Firstly, sequence homology between the sequences encoding the components of
the
secondary vector may be avoided by deletion of regions of homology. Regions of
homology allow genetic recombination to occur. In a particular embodiment,
three
transcription units are used to construct a secondary retroviral vector. A
first transcription
unit contains a retroviral gag pol gene under the control of a non-retroviral
promoter and
enhancer. A second transcription unit contains a retroviral env gene under the
control of a
non-retroviral promoter and enhancer. A third transcription unit comprises a
defective
retroviral genome under the control of a non-retroviral promoter and enhancer.
In the
native retroviral genome, the packaging signal is located such that part of
the gag
3o sequence is required for proper functioning. Normally when retroviral
vector systems are
constructed therefore, the packaging signal, including part of the gag gene,
remains in the
vector genome. In the present case however, the defective retroviral genome
contains a
CA 02367488 2001-09-14
WO 00/56910 PCT/GB00/01091
57
minimal packaging signal which does not contain sequences homologous to gag
sequences in the first transcription unit. Also, in retroviruses, for example
Moloney
Murine Leukaemia virus (MMLV), there is a small region of overlap between the
3' end
of the pol coding sequence and the 5' end of env. The corresponding region of
homology
between the first and second transcription units may be removed by altering
the sequence
of either the 3' end of the pol coding sequence or the 5' end of env so as to
chance the
codon usage but not the amino acid sequence of the encoded proteins.
Secondly, the possibility of replication competent secondary viral vectors may
be avoided
1o by pseudotyping the genome of one retrovirus with the envelope protein of
another
retrovirus or another enveloped virus so that regions of homology between the
env and
gag pol components are avoided. In a particular embodiment the retroviral
vector is
constructed from the following three components. The first transcription unit
contains a
retroviral gag pol gene under the control of a non-retroviral promoter and
enhancer. The
second transcription unit contains the env gene from the alternative enveloped
virus,
under the control of a non-retroviral promoter and enhancer. The third
transcription unit
comprises a defective retroviral genome under the control of a non-retroviral
promoter
and enhancer. The defective retroviral genome contains a minimal packaging
signal
which does not contain sequences homologous to gag sequences in the first
transcription
unit.
Pseudotyping may involve for example a retroviral genome based on a lentivirus
such as
an HIV or equine infectious anaemia virus (EIAV) and the envelope protein may
for
example be the amphotropic envelope protein designated 4070A. Alternatively,
the
35 retroviral genome may be based on MMLV and the envelope protein may be a
protein
from another virus which can be produced in nor-toxic amounts within the
primary target
cell such as an Influenza haemagglutinin or vesicular stomatitis virus G
protein. In
another alternative, the envelope protein may be a modified envelope protein
such as a
mutant or engineered envelope protein. Modifications may be made or selected
to
3o introduce targeting ability or to reduce toxicity or for another purpose.
CA 02367488 2001-09-14
WO 00/56910 PCT/GB00/01091
~8
Thirdly, the possibility of replication competent retroviruses can be
eliminated b~~ using
two transcription units constructed in a particular way. The first
transcription unit
contains a gag pol coding region under the control of a promoter-enhancer
active in the
primary target cell such as a hCMV promoter-enhancer or a tissue restricted
promoter-
s enhancer. The second transcription unit encodes a retroviral genome RNA
capable of
being packaged into a retroviral particle. The second transcription unit
contains retroviral
sequences necessary for packaging, integration and reverse transcription and
also contains
sequences coding for an env protein of an enveloped virus and the coding
sequence of one
or more therapeutic genes.
In a preferred embodiment the hybrid viral vector system according to the
invention
comprises single or multiple adenoviral primary vectors which encodes or
encode a
retroviral secondary vector. Adenoviral vectors for use in the invention may
be derived
from a human adenovirus or an adenovirus which does not normally infect
humans.
Preferably the vectors are derived from Adenovirus Type 2 or adenovirus Type 5
(Ad2 or
Ads) or a mouse adenovirus or an avian adenovirus such as CELO virus (Cotton
et al
1993 J. Virol. 67:3777-3785). The vectors may be replication competent
adenoviral
vectors but are more preferably defective adenoviral vectors. Adenoviral
vectors may be
rendered defective by deletion of one or more components necessary for
replication of the
2o virus. Typically, each adenoviral vector contains at least a deletion in
the E 1 region. For
production of infectious adenoviral vector particles, this deletion may be
complemented
by passage of the virus in a human embryo fibroblast cell line such as human
293 cell
line, containing an integrated copy of the left portion of AdS, including the
E 1 gene. The
capacity for insertion of heterologous DNA into such vectors can be up to
approximately
7kb. Thus such vectors are useful for construction of a system according to
the invention
comprising three separate recombinant vectors each containing one of the
essential
transcription units for construction of the retroviral secondary vector.
Alternative adenoviral vectors are known in the art which contain further
deletions in
other adenoviral genes and these vectors are also suitable for use in the
invention.
Several of these second generation adenoviral vectors show reduced
immunogenicity (eg
E 1 + E2 deletions Gorziglia et al 1996 J. Virol. 70: 4173-4178; E 1 + E4
deletions Yeh et
CA 02367488 2001-09-14
WO 00/56910 PCT/GB00/01091
~9
al 1996 J. Virol. 70: ~~9-~6~). Extended deletions serve to provide additional
cloning
capacity for the introduction of multiple genes in the vector. For example a
2~ kb
deletion has been described (Lieber et al. 1996 J. Virol. 70: 8944-8960) and a
cloning
vector deleted of all viral genes has been reported (Fisher et al 1996
Virolology 217: 11-
22.) which will permit the introduction of more than 35kb of heterologous DNA.
Such
vectors may be used to generate an adenoviral primary vector according to the
invention
encoding two or three transcription units for construction of the retroviral
secondary
vector.
1o Embodiments of the invention described solve one of the major problems
associated with
adenoviral and other viral vectors, namely that gene expression from such
vectors is
transient. The retroviral particles generated from the primary target cells
can infect
secondary target cells and gene expression in the secondary target cells is
stably
maintained because of the integration of the retroviral vector genome into the
host cell
genome. The secondary target cells do not express significant amounts of viral
protein
antigens and so are less immunogenic than the cells transduced with adenoviral
vector.
The use of a retroviral vector as the secondary vector is also advantageous
because it
allows a degree of cellular discrimination, for instance by permitting the
targeting of
2o rapidly dividing cells. Furthermore, retroviral integration permits the
stable expression of
therapeutic genes in the target tissue, including stable expression in
proliferating target
cells.
Preferably, the primary viral vector preferentially infects a certain cell
type or cell types.
More preferably, the primary vector is a targeted vector, that is it has a
tissue tropism
which is altered compared to the native virus, so that the vector is targeted
to particular
cells. The term "targeted vector" is not necessarily linked to the term
''target cell".
Thus, a primary target cell according to the invention, capable of producing
the second
viral vector, may be of any of the above cell types. In a preferred
embodiment, the
primary target cell according to the invention is a monocyte or macrophage
infected by a
defective adenoviral vector containing a first transcription unit for a
retroviral gag-pol and
CA 02367488 2001-09-14
WO 00/56910 PCT/GB00/01091
a second transcription unit capable of producing a packageable defective
retroviral
genome. In this case at least the second transcription unit is preferably
under the control
of a promoter-enhancer which is preferentially active in a diseased location
within the
bodv such as an ischaemic site or the micro-environment of a solid tumour. In
a
5 particularly preferred embodiment of this aspect of the invention, the
second transcription
unit is constructed such that on insertion of the genome into the secondary
target cell, an
intron is generated which serves to reduce expression of the viral env gene
and permit
efficient expression of a therapeutic gene.
1 o The secondary viral vectors may also be targeted vectors. For retroviral
vectors, this may
be achieved by modifying the envelope protein. The envelope protein of the
retroviral
secondary vector needs to be a non-toxic envelope or an envelope which may be
produced in non-toxic amounts within the primary target cell, such as for
example a
MMLV amphotropic envelope or a modified amphotropic envelope. The safety
feature in
15 such a case is preferably the deletion of regions or sequence homology
between retroviral
components.
The secondary target cell population may be the same as the primary target
cell
population. For example delivery of a primary vector of the invention to
tumour cells
20 leads to replication and generation of further vector particles which can
transduce further
tumour cells. Alternatively, the secondary target cell population may be
different from
the primary target cell population. In this case the primary target cells
serve as an
endogenous factory within the body of the treated individual and produce
additional
vector particles which can infect the secondary target cell population. For
example, the
25 primary target cell population may be haematopoietic cells transduced by
the primary
vector in vivo or ex vivo. The primary target cells are then delivered to or
migrate to a site
within the body such as a tumour and produce the secondary vector particles,
which are
capable of transducing for example tumour cells within a solid tumour.
3o The invention permits the localised production of high titres of defective
retroviral vector
particles in vivo at or near the site at which action of a therapeutic protein
or proteins is
required with consequent efficient transduction of secondary target cells.
This is more
CA 02367488 2001-09-14
WO 00/56910 PCT/GB00/01091
61
efficient than using either a defective adenoviral vector or a defective
retroviral vector
alone.
The invention also permits the production of retroviral vectors such as MMLV-
based
vectors in non-dividing and slowly-dividing cells in vivo. It had previously
been possible
to produce MMLV-based retroviral vectors only in rapidly dividing cells such
as tissue
culture-adapted cells proliferating in vitro or rapidly dividing tumour cells
in vivo.
Extending the range of cell types capable of producing retroviral vectors is
advantageous
for delivery of genes to the cells of solid tumours, many of which are
dividing slowly, and
for the use of non-dividing cells such as endothelial cells and cells of
various
haematopoietic lineages as endogenous factories for the production of
therapeutic protein
products.
The delivery of one or more therapeutic genes by a vector system according to
the
invention may be used alone or in combination with other treatments or
components of
the treatment. Diseases which may be treated include, but are not limited to:
cancer,
neurological diseases, inherited diseases, heart disease, stroke, arthritis,
viral infections
and diseases of the immune system. Suitable therapeutic genes include those
coding for
tumour suppressor proteins, enzymes, pro-drug activating enzymes,
immunomodulatory
2o molecules, antibodies, engineered immunoglobulin-like molecules, fusion
proteins,
hormones, membrane proteins, vasoactive proteins or peptides, cytokines,
chemokines,
anti-viral proteins, antisense RNA and ribozymes.
In a preferred embodiment of a method of treatment according to the invention,
a gene
encoding a pro-drug activating enzyme is delivered to a tumour using the
vector system
of the invention and the individual is subsequently treated with an
appropriate pro-drug.
Examples of pro-drugs include etoposide phosphate (used with alkaline
phosphatase
Senter et al., 1988 Proc. Natl. Acad. Sci. 85: 4842-4846); ~-fluorocytosine
(with Cytosine
deaminase Mullen et al. 1994 Cancer Res. 54: 1503-1506); Doxorubicin-N-p-
hydroxyphenoxyacetamide (with Penicillin-V-Amidase (Kerr et al. 1990 Cancer
Immunol. Immunother. 31: 202-206); Para-N-bis(2-chloroethyl) aminobenzoyl
glutamate
(with Carboxypeptidase G2); Cephalosporin nitrogen mustard carbamates (with b-
CA 02367488 2001-09-14
WO 00/56910 PCT/GB00/01091
62
lactamase); SR4233 (with P4~0 Reducase); Ganciclovir (with HSV thymidine
kinase,
Borrelli et al. 1988 Proc . Natl. Acad. Sci. 85: 772-7576) mustard pro-drugs
with
nitroreductase (Friedlos et al. 1997) Med Chem 40: 1270-1270 and
Cyclophosphamide
or Ifosfamide (with a cytochrome P450 Chen et al. 1996 Cancer Res 56: 1331-
1340).
Further provided according to the invention are methods of controlling
production of a
therapeutic gene such that the therapeutic gene is preferentially expressed in
the
secondary target cell population and is poorly expressed or not expressed at a
biologically
significant level in the primary target cell.
to
In accordance with the invention, standard molecular biology techniques may be
used
which are within the level of skill in the art. Such techniques are fully
described in the
literature. See for example; Sambrook et al (1989) Molecular Cloning; a
laboratory
manual; Hames and Glover (1985 - 1997) DNA Cloning: a practical approach,
Volumes
I- IV (second edition); Methods for the engineering of immunoglobulin genes
are given in
McCafferty et al (1996) "Antibody Engineering: A Practical Approach".
In summation, the present invention relates to a novel delivery system
suitable for
introducing one or more NOIs into a target cell.
In one broad aspect the present invention relates to a retroviral vector
comprising a
functional splice donor site (FSDS) and a functional splice acceptor (FSAS)
site; wherein
the FSDS and the FSAS flank a first nucleotide sequence of interest (NOI);
wherein the
FSDS is upstream of the FSAS; wherein the retroviral vector is derived from a
retroviral
pro-vector; wherein the retroviral pro-vector comprises a first nucleotide
sequence (NS)
capable of yielding the functional splice donor site (FSDS); a second NS
capable of
yielding the functional splice acceptor site (FSAS); a third NS capable of
yielding a non-
functional splice donor site (NFSDS); a fourth NS capable of yielding a non-
functional
splice site (NFSS); wherein the first NS is downstream of the second NS and
wherein the
3o third NS and fourth NS are upstream of the second NS; such that splicing of
the retroviral
vector occurs as a result of reverse transcription of the retroviral pro-
vector at its desired
target site.
CA 02367488 2001-09-14
WO 00/56910 PCT/GB00/01091
63
In a further broad aspect, the present invention provides a hybrid viral
vector system for
in vivo gene delivery, which system comprises one or more primary viral
vectors which
encode a secondary viral vector, the primary vector or vectors capable of
infecting a first
target cell and of eYpressina therein the secondary viral vector, which
secondary vector is
capable of transducing a secondary target cell.
Preferably the primary vector is obtainable from or is based on a adenoviral
vector and/or
the secondary viral vector is obtainable from or is based on a retroviral
vector preferably a
lentiviral vector.
The invention will now be further described by way of example in which
reference is
made to the following Figures:
Figure 1 which shows the structure of a retroviral proviral genome;
Figure 2 which shows the addition of a small T splice donor pLTR;
Figure 3 which shows a diagrammatic representation of pL-SA-N;
2o Figure 4 which shows a diagrammatic representation of pL-SA-N with a splice
donor
deletion;
Figure ~ which shows the sequence of MLV pICUT;
Figure 6 which shows the insertion of a splice donor at CMV/R junction of EIAV
LTR
plasmid;
Figure 7 which shows the insertion of a splice acceptor into pEGASUS-l;
3o Figure 8 which shows the removal of a wild-type splice donor from EIAV
vector;
CA 02367488 2001-09-14
WO 00/56910 PCT/GB00/01091
64
Figure 9 which shows the combination of pCMVLTR+SD with pEGASUS +SA (noSD)
to create pEICUT-1;
Figure 10 which shows the construction of pEICUT-LacZ;
Figure 11 which shows the pEICUT-LacZ sequence;
Figure 12 which shows the vector configuration in both transfected and
transduced cells;
1 o Figure 13 which shows the restriction of gene expression to either
packaging or
transduced cells;
Figure 14 which shows the construction of a MLV pICUT Neo-p450 vector that
restricts
hygromycin expression to producer cells and 2B6 (a p450 isoform) expression to
transduced cells;
Figure 15 which shows a sequence comparison of mutant env (m4070A) with wild
type
MMLV sequence from the 3' end of the pol gene;
2o Figure 16 which shows the complete sequence of the modified env gene
m4070A;
Figure 17 which shows a restricted gene expression construct; 4070A Envelope
to a first
cell; p450 to a second cell;
Figure 18 which shows the use of an intron to restrict NOI (in this example
p450)
expression to a transduced cell;
Figure 19 which shows a pictorial representation of the Transfer vector-pE 1
sp 1 A;
3o Figure 20 which shows a pictorial representation of pE 1 sp 1 A construct;
Figure 21 which shows a pictorial representation of pE 1 RevE construct;
CA 02367488 2001-09-14
WO 00/56910 PCT/GB00/01091
6~
Figure 22 which shows a pictorial representation of pEIHORSE3.l- gagpol
construct;
Figure 23 which shows a pictorial representation of pElPEGASUS4-Genome
construct;
Figure 24 which shows a pictorial representation of pCI-Neo construct;
Figure 25 which shows a pictorial representation of pCI-Rab construct;
Figure 26 which shows a pictorial representation of pE 1 Rab construct;
io
Figure 27a is a schematic representation of the natural splicing configuration
in a
retroviral vector;
Figure 27b is a schematic representation of the splicing configuration in
known retroviral
vectors;
Figure 27c is a schematic representation of the splicing configuration
according to the
present invention;
2o Figure 28 is a schematic representation of the dual hybrid viral vector
system according to
the present invention;
Figure 29 is a schematic diagram of the RNA and DNA forms of the retroviral
genome;
Figure 30 is a schematic diagram of the adenovirus showing the relative
direction and
position of early and late gene transcription;
Figure 31 is schematic diagram of the splicing mechanism;
3o Figure 32 which shows a pictorial representation of pTRONIN construct;
Figure 33 which shows the pTRONIN sequence;
CA 02367488 2001-09-14
WO 00/56910 PCT/GB00/01091
66
Figure 34 which shows a pictorial representation of a PCR reaction used to
amplify the
region from upstream of the small T splice donor to downstream of the splice
acceptor;
Figure 35 which shows a pictorial representation of pTRONIN-1 construct: and
Figure 36 which shows the pTRONIN-1 sequence.
In slightly more detail:
1o Figure 1 shows the structure of a retroviral proviral genome. In this
regard, the simplest
retroviruses such as the marine oncoretroviruses have three open reading
frames; gag, pol
and env. Frameshift during gag translation leads to pol translation. Env
expression and
translation is achieved by splicing between the splice donor (SD) and splice
acceptor
(SA) shown. The packaging signal is indicated as Psi and is only contained in
the full
length transcripts - not the env expressing sub-genomic transcripts where this
signal is
removed during the splicing event.
Figure 2 schematically shows the addition of small T splice donor to pLTR.
Here, the
small-t splice donor sequence is inserted into an LTR vector downstream of the
start of
2o transcription but upstream of R sequence such that upon reverse
transcription (in the final
construct) the U3-splice donor-R cassette is 'inherited' to 5' end of the
proviral vector and
RNA transcripts expressed contain a splice donor sequence near their 5'
terminus.
Figure 3 shows a schematic diagram of pL-SA-N. Both the consensus splice
acceptor
(T/C)nNC/TAG-G (Mount 1982 Nucleic Acids Res 10: 459-472) and branch point are
shown in underline and bold.. The arrow indicates the intron/exon junction.
Here, the
consensus splice acceptor sequence is inserted into the StullBanzHl sites of
pLXSN. By
such positioning this acceptor will therefore interact with any upstream
splice donor (in
the final RNA transcripts).
Figure 4 shows a schematic diagram for the construction of pL-SA-N with a
splice donor
deletion. The gT to gC change is made by performing a PCR reaction on the pL-
SA-N
CA 02367488 2001-09-14
WO 00/56910 PCT/GB00/01091
67
10
vector with the two oliQonucleotides shown below. The resulting product is
then cloned
Spel-Ascl into pL-SA-N thus replacing the wild-type splice donor gT with gC.
Both
Spe 1 and Asc 1 sites are shown in bold and the mutation in the Spe 1
oligonucleotide
shown in captial bold.
Figure 5 shows the sequence of MLV pICUT.
Figure 6 shows a schematic diagram of the insertion of splice donor at CMV/R
junction
of EIAV LTR plasmid. PCR is performed with the two oligonulceotides outlined
below
and the resulting PCR product cloned, Sacl-BamHl into CMVLTR with the
equivalent
piece removed. In the Sac 1 oligonucleotide the arrow indicates the start of
transcription,
the new insert is shown in capital with splice donor sequence underlined. The
start of R
is shown in italics.
1s Figure 7 shows a schematic diagram of the insertion of splice acceptor into
pEGASUS-1.
Here, the double stranded oligonucleotide described below is inserted into
Xhol-BpuI102
digested pEGASUS-1 to generate plasmid pEGASUS+SA. Both consensus splice
acceptor (T/C)nNC/TAG-G (Mount 1982 ibiclJ and branch point are shown in
underline
and bold. The arrow indicates the intron/exon junction.
Figure 8 shows a schematic diagram of the removal of wild-type splice donor
from EIAV
vector. Splice donor sequence removed by overlapping PCR using the
oliognucleotides
described below and the template pEGASUS+SA. First separate PCR reactions are
performed with oligosl+2 and oligos3+4. The resulting amplified products are
then
eluted and used combined in a third PCR reaction. After 10 cycles of this
third reaction
oligo2 and 4 are then added. The resulting product is then cloned Sacl-Sall
into
pEGASUS+SA to create the plasmid pEGASUS+SA(noSD). The position of the splice
donor (SD) is indicated. The point mutation changing the wild-type splice
donor from
GT to GC is shown in bold both in oligo 1 and the complementary oligo3.
CA 02367488 2001-09-14
WO 00/56910 PCT/GB00/01091
68
Figure 9 shows a schematic diagram of combining pCMVLTR+SD with
pEGASUS+SA(noSD) to create pEICUT-1. Here, one inserts the ~Lllatl fragment of
pEGASUS+SA(noSD) into the unique Mlul site of pCMV-LTR.
Figure 10 shows a schematic diagram of the construction of pEICUT-LacZ. It is
made by
the insertion of the Xhol-Bpul 102 LacZ fragment from pEGASUS-1 and inserting
it into
the Xhol Bpul 102 site of pEICUT-1 as outlined below.
Figure 11 shows the pEICUT-LacZ sequence.
Figure 12 shows a schematic diagram of the vector configuration in both
transfected and
transduced cells. Here, the starting pICUT vector contains no splice donor
upstream of a
splice acceptor (in this instance the consensus splice acceptor derived from
IgSA) and
therefore the resulting RNA transcripts will not be spliced. Thus all
transcripts will be
full length transcripts containing a packaging signal (A). Upon transduction
however the
splice donor (in this instance the small-T spliced donor) is 'inherited' to
the ~' of the
proviral vector such that all RNA transcripts now produced contain splice
donor uptsream
of a splice acceptor i.e. an intron and thus maximal splicing achieved (B).
2o Figure 13 shows a schematic diagram of the restriction of gene expression
to either
packaging and transduced cells. Restriction of gene expression in this
instance is
achieved by placing the hygromycin ORF upstream of the neomycin ORF in MLV
pEICUT (a). By this cloning strategy the resulting vector will now express RNA
transcripts that express hygromycin only in transfected cells because ribosome
~' cap-
dependent translation will read only the upstream ORF efficiently. However
upon
transduction hygromycin is now contained within a functional intron and is
thus deleted
from mature transcripts (b) and thus neomycin ORF is now translated in a ~'
cap-
dependent manner.
3o Figure 14 shows a schematic diagram of the construction of a MLV pICUT Neo-
p450
vector that restricts hygromycin expression to producer cells and 2B6 (a p450
isoform)
expression to transduced cells. The starting vector for this construction is
the pICUT
CA 02367488 2001-09-14
WO 00/56910 PCT/GB00/01091
69
vector of Figure 13 containing both hygro and neo. The neo gene is replaced
with the
complete p4~0 2B6 cDNA as follows: The complete 2B6 cDNA is obtained by RT-PCR
on human liver RNA (Clontech) using the following primers:
s ~'ttcgatgatcaccaccatggaactcagcgtcctcctcttccttgcac3'
5'ttcgagccggctcatcagcggggcaggaagcggatctggtatgttg3'
This generates the complete 2B6 cDNA with an optimised kosak sequence flanked
with
1o unique BcII and NgoMl sites. This cDNA is then cloned into the Bcll-NgoMl
site of
pICUT-Hyg-Neo thus replacing Neo with p450 (see (A) below). Also shown below
are
the proviral DNA constructs in both transfected (B) and transduced (C) cells.
Figure 1 ~ is a sequence comparison of mutant env (m4070A) with wild type MMLV
1 s sequence from the 3' end of the pol gene.
Figure 16 is the complete sequence of altered 4070A.
Figure 17 shows a gene restricted expression retroviral vector whereby the
first NOI (the
20 4070A envelope ORF) is expressed in the initial vector and the second NOI
(in this
instance p450) is expressed only after vector replication. After replication
the 4070A
gene is located within a functional intron and thus removed during RNA
splicing.
Figure 18 shows a retroviral expression vector whereby the 5' end of the p450
gene (flush
2s to a splice donor) is only found upstream of the 3' end of the p4~0 gene
(flush to SA)
after replication and thus only after replication is a functional p4~0 gene
expressed (from
spliced mRNA).
CA 02367488 2001-09-14
WO 00/56910 PCT/GB00/01091
EXAMPLES
Example 1 Construction of a split-intron MLV vector .
5 (i) Addition of small-T splice donor:
The starting plasmid for this construct is pLXSN (Miller et al 1989 ibiclJ;
Firstly this
construct is digested with Nhe l and the backbone re-ligated to create an LTR
(U3-R-U5)
plasmid. Into this plasmid is then inserted an oligonucleotide containing the
splice donor
1 o sequence between the Kpn 1-Bbe 1 sites. Also contained within this
oligonucleotide,
downstream of the splice donor is the MLV R sequence up to the Kpnl. The
resulting
plasmid is named 3'LTR-SD (see Figure 2 ).
(ii) Addition of splice acceptor:
The splice acceptor sequence used in this construct (including the branch
point- an A
residue between 20 and 40 bases upstream of the splice acceptor involved in
intron lariat
formation (Aebi et al 1987 Trends in Genetics 3: 102-107) is derived from an
immunoglobulin heavy chain variable region mRNA (Bothwell et al 1981 Cell 24:
625-
637) but with a consensus/optimised acceptor site. Such a sequence signal is
also present
in pCI (Promega). This acceptor sequence is firstly inserted into the BamHl-
Stul sites of
pLXSN as double stranded oligonucleotide to create the vector pL-SA-N (note:
SV40
promoter is lost from pLNSX during cloning). See Figure 3 for an outline of
the cloning
strategy.
(iii) Removal of original splice donor from pL-SA-N.
The removal of the splice donor contained within the gag sequence of pL-SA-N
is
achieved by PCR based site directed mutagenesis. Two oligonucleotides are used
to PCR
amplify the region spanning the ASCl and Spel uniques sites of pL-SA-N. Also
incorporated in the Spel-spanning olgonucleotide is the agGTaag to agGCaag
change
CA 02367488 2001-09-14
WO 00/56910 PCT/GB00/01091
71
also found in the splicing negative pBABE vectors (Morgenstern et al 1990
ibid). See
Figure 4 for cloning strategy outline.
(iv) Combining pL(noSD)-SA-N with 3'LTR-SD.
The pL(noSD)SA-N plasmid contains a normal MLV derived 3'LTR. This is replaced
with the 3'LTR-SD sequence by taking the Nhel insert from pL(noSD)SA-N and
dropping it into the Nhel digested 3'LTR-SD vector. The resulting plasmid,
named
pICUT (Intron Created Upon Transduction) contains all the features of this new
1 o generation of retroviral .vector (see Figure 5 for sequence data)
Example 2 Construction of a split-intron Lentivector.
Construction of initial EIAV lentiviral expression vector (also see WO
99/32646).
For the construction of a split-function lentiviral vector the starting point
is the vector
named pEGASUS-1 (see WO 99/32646). This vector is derived from infectious
proviral
EIAV clone pSPEIAV 19 (accession number: U01866; Payne et al 1994). Its
construction
is outlined as follows: First; the EIAV LTR, amplified by PCR, is cloned into
?o pBluescript II KS+ (Stratagene). The MIuIlMIuI (216/8124) fragment of
pSEIAV 19 is
then inserted to generate a wild-type proviral clone (pONY2) in pBluescript II
KS+
(Figure 1 ). The env region is then deleted by removal of the Hind IIIlHind
III fragment to
generate pONY2-H. In addition, a BgIIIlNcoI fragment within pol (1901/4949) is
deleted
and a (3-galactosidase gene driven by the HCMV IE enhancer/promoter inserted
in its
place. This is designated pONY2.lOnlsLacZ. To reduce EIAV sequence to 759 base
pairs and to drive primary transcript off a CMV promoter: First; sequence
encompassing
the EIAV polypurine tract (PPT) and the 3'LTR are PCR amplified from
pONY2.lOLacZ
using primers:
3o PPTEIAV+ (y$198): GACTACGACTAGTGTATGTTTAGAAAAACAAGG,
and
CA 02367488 2001-09-14
WO 00/56910 PCT/GB00/01091
72
3'NEGSpeI(Y8199): CTAGGCTACTAGTACTGTAGGATCTCGAACAG.
The PCR product is then cloned into the Spel site of pBS II KS+; orientated
such that U~
is proximal to Notl in the pBlueScript II KS+
Next, for the reporter gene cassette, a CMV promoter/LacZ from pONY
2.lOnlsLacZ is
removed by Pstl digest and cloned into the Pstl site of pBS.3'LTR orientated
such that
LacZ gene is proximal to the 3'LTR, this vector is named pBS CMVLacZ.3'LTR.
1 o The 5'region of the EIAV vector is constructed in the expression vector
pCIEneo which is
derivative of pCIneo (Promega)-modified by the inclusion of approximately 400
base
pairs derived from the Fend of the full CMV promoter as defined previously.
This 400
base pair fragment is obtained by PCR amplifcation using primers:
VSATl: (GGGCTATATGAGATCTTGAATAATAAAATGTGT) and
VSAT2: (TATTAATAACTAGT) and
pHIT60 (Soneoka et al 1995 Nucleic Acids Res 23: 628-633) as template. The
product
2o is digested with BgIII and SpeI and cloned into the BgIIIlSpe 1 sites of
pCIE-Neo.
A fragment of the EIAV genome running from the R region to nt 1~0 of the gag
coding
region (nt 268 to 675) is amplified from pSEIAV with primers:
2s CMVS'EIAV2:
(Z0591 )(GCTACGCAGAGCTCGTTTAGTGAACCGGGCACTCAGATTCTG:
(sequences underlined anneals to the EIAV R region)
3o and
3'PSLNEG (GCTGAGCTCTAGAGTCCTTTTCTTTTACAAAGTTGG).
CA 02367488 2001-09-14
WO 00/56910 PCT/GB00/01091
73
The resulting PCR product is flanked by Xbal and Sacl sites. This is then cut
and cloned
into the pCIE-IV'eo Xbal-SacI sites. The resulting plasmid, termed
pCIEneo~'EIAV now
contains the start of the EIAV R region at the transcriptional start point of
the CMV
promoter. The CMVLacZ/3LTR cassette is then inserted into the pCIEneo~'EIAV
plasmid by taking the Apal to ~Votl fragment from pBS.CMVLacZ.3LTR and cloning
it
into the Sall-Notl digested pCIEneo.S'EIAV (the Sall and Apal sites is T4
"polished" to
create blunt the ends prior to the vector and insert respective Notl digests).
The resulting
plasmid is named PEGASUS-1.
1o For use as a gene delivery vector PEGASUS-1 requires both gaglpol and env
expression
provided in traps by a packaging cell. For the source of gaglpol an EIAV
gagpol
expression plasmid (pONY3) is made by inserting the Mlu IlMlu I fragment from
pONY2-H into the mammalian expression plasmid pCI-neo (Promega) such that the
gag-
pol gene is expressed from the hCMV-MIE promoter-enhancer and contains no LTR
sequences. For the source of env; the pRV583 VSV-G expression plasmid is
routinely
used. These three vectors are used in a three plasmid co-transfection as
described for
MLV-based vectors (Soneoka et al 1995 Nucl. Acids Res. 23:628-633) the
resulting virus
routinely titres at between 10'~ and 10' lacZ forming units per ml on D 17
fibroblasts.
2o Construction of a EIAV lentiviral version vector of pICUT; named pEICUT
To construct pEICUT firstly PEGASUS-1 the Xmal-SexAl fragment is removed from
PEGASUS-1 and the ends 'blunted' with T4 polymerase and plasmid re-ligated to
create
a plasmid containg only the CMV-R-US part of PEGASUS-1 which retains the SV40-
Neo
cassette in the backbone. This plasmid is named CMVLTR. To insert a splice
donor at
the CMV-R border PCR is carried out with the two oligonucleotides shown below
in
Figure 6 and as outlined in the Figure 6 legend. The resulting plasmid is
named
pCMVLTR+SD. The same immunoglobulin based consensus splice acceptor as for MLV
pICUT (see earlier) is used in the EIAV version. This is inserted using
oligonucleotides
described in Figure 7 into the XhoI-Bpu1102 site of PEGASUS-1 to create the
plasmid
PEGASUS+SA. The wild-type splice donor of EIAV is removed by carrying out
overlapping PCR with the oligonulceotides and methodology as described in
Figure 8,
CA 02367488 2001-09-14
WO 00/56910 PCT/GB00/01091
74
using pEGASUS+SA as a template to generate the plasmid pEGASUS+SA(noSD). To
then create pEICLTT-1, the Mlarl-Mlul fragment from pEGASUS+SA(noSD) is then
inserted into the unique tl~Ilul site of pCMVLTR+SD to generate pEICUT-1 (see
Figure
9). LacZ can be then transferred from pEGASUS-1 into pEICUT-1 by Xhol-Bpu1102
digest and insertion to create pEICUT-Z (see Figure 10; for sequence data see
Figure 11).
Both the MLV and EIAV pICUT vectors contain a strong splice acceptor upstream
of the
splice donor and therefore no functional intron (introns require splice donors
positioned
5' of splice acceptors). For this reason, when the vector is transfected into
producer cells
1 o the resulting transcripts generated will not be spliced. Thus the
packaging signal will not
be lost and as a consequence maximal packaging is achievable (see Figure 12).
However because of the unique way by which retroviruses replicate, upon
transduction,
transcripts generated from the integrated pICUT vector will differ from those
of
transfected cells described above. This is because during replication the 3'U3
promoter
(up to the 5'start of R) is copied and used as the 5' promoter in transduced
cells. For this
reason transcripts generated from integrated pICUT will now contain a strong
splice
donor 5' of a strong splice acceptor, both of which being located upstream of
the neo
ORF. Such transcripts will therefore contain a functional intron in the ~'UTR
(untranslated region) and thus be maximally spliced and translated.
Another advantage of such vectors described above is that because the intron
is created
only upon transduction it is possible to limit gene expression to either
packaged or
transduced cells. One example of how this is achieved is outlined in Figures
13. The
strategy entails the cloning of a second gene (in this example hygromycin)
upstream of
the splice acceptor. This is achieved by taking out the hygromycin cDNA on a
SaII
fragment from SelctaVector Hygro (Ingenius; Oxfordshire, UK), and cloning this
into a
Xho 1 site (located upstream of the splice acceptor) of pICUT. This vector
selectively
expresses hygromycin in the transfected cells and neomycin in transduced
cells. The
reason for this is that in any one mRNA transcript only the first gene is
translated by the
ribsome without the aid of internal ribosome binding sites (IRESs). In the
transfected cell
this gene will be hygromycin. However in the transduced cells because the
hygromycin
CA 02367488 2001-09-14
WO 00/56910 PCT/GB00/01091
open reading frame (ORF) is contained within a functional intron this gene
will now be
removed from mature mRNA transcripts thus allowing neo ORF translation.
Vectors with such cell specific gene expression maybe of clinical use for a
variety of
5 reasons; By way of example, expression of resistance markers can be
restricted to
producer cells- where they are required and not in transduced cells where they
may be
immunogenic. By way of another example, expression of toxic genes such as
ricin and
dominant negative signalling proteins could be restricted to transduced cells
where thev
may be required to optionally arrest cell growth or kill cells but not in
producer cells-
I o where such features would prevent high titre virus production. Figure 14
shows a Neo-
p450 MLV pICUT construct such that only Neo is expressed in producer cells and
the
pro-drug p4~0 2B6 isoform expressed in transduced cells.
Another benefit of creating an intron upon transduction is that any essential
elements
15 required for vector function can now be placed inside a functional intron,
which is created
upon transduction, and be removed from transduced cell transcripts. By way of
example,
with both the MLV and the lentivector pICUT vectors, the viral transcript
contained the
functional Psi packaging signal (see Bender et al 1987 for the position of Psi
in MLV; see
patent application GB 9727135.7 for position of Psi in EIAV) within an intron
which was
20 created upon transduction and removed from the transduced cell transcripts.
The benefits from such an arrangement include:
(i) Enhanced translation from resulting transcripts because ribosomes may
''stutter" in the
25 presence of a Psi secondary structure- if present (Krall et al 1996 ibid
and reference
therein).
(ii) In the absence of the packaging signal, the vector is inactivated and
transcript
packaging by endogenous retroviruses is prevented.
(iii) Unwanted premature translation initiation is prevented when viral
essential elements
such as gag (and other potential ATG translation start sites) are removed from
the
CA 02367488 2001-09-14
WO 00/56910 PCT/GB00/01091
76
transcripts expressed in transduced cells. This is of particular benefit when
packaging
signals extend into gag as is the case for both the EIAV and MLV pICUT
vectors.
(iv) Promoter, enhancers and suppressors may be placed within an intron
created upon
transduction thus mimicking other transcript arrangements like those generated
from
CMV that contain such entities within introns (Chapman et al 1991 ibicl).
In summation the novel pICUT vector system described in the present invention
facilitates the following arrangments:
(i) Maximal packaging and reduced translation of transcripts in producer
cells.
(ii) Maximal splicing and therefore intron enhanced translation of transcripts
in
transduced cells
(iii) Restriction of gene and/or viral essential element expression to either
producer or
transduced cells.
(iv) Improved safety features when the vector is inactivated.
2o
Example 3 Construction of an MMLV amphotropic env gene with minimal
homology to the pol gene and a gag pol transcription cassette
In the Moloney murine leukaemia virus (MMLV), the first approximately 60 bps
of the
env coding sequence overlap with sequences at the 3' end of the pol gene. The
region of
homology between these two genes was removed to prevent the possibility of
recombination between them in cells expressing both genes.
The DNA sequence of the first 60 bps of the coding sequence of env was changed
while
retaining the amino acid sequence of the encoded protein as follows. A
synthetic
oligonucleotide was constructed to alter the codon usage of the 5'-end of env
(See Figure
15) and inserted into the remainder of env as follows.
CA 02367488 2001-09-14
WO 00/56910 PCT/GB00/01091
77
The starting plasmid for re-construction of the 5' end of the 4070A gene was
the pCI
plasmid (Promega) into which had previously been cloned the Xbal-Xbcrl
fragment
containing the 4070A gene from pHIT456 (Soneoka et al 1995 ibicl) to form pCI-
4070A.
A PCR reaction was performed with primers A and B (Figure 15) on pCI-4070A to
produce a 600 base pair product. This product was then cloned between the Nhe
1 and
Xhol sites of pCI-4070A. The resulting construct was sequenced across the
NhellXhol
region. Although the amino acid sequence of the resulting gene is the same as
the
original 4070A, the region of homology with the pol gene is removed.
1 o The complete sequence of the modified env gene m4070A is given in Figure
16. This
sequence is inserted into the expression vector pCI (Promega) by standard
techniques.
The CMV gag pol transcription unit is obtaind from pHIT60 (Soneoka et al 1995
ibia').
Example 4 Deletion of gag sequences from the retroviral packaging signal.
A DNA fragment containing the LTR and minimal functional packaging signal is
obtained from the retroviral vector MFG (Bandara et al 1993 Proc Natl Acad Sci
90:
10764-10768) or MMLV proviral DNA by PCR reaction using the following
oligonucleotide primers:
HindIIIR: GCATTAAAGCTTTGCTCT
L523: GCCTCGAGCAAAAATTCAGACGGA
This PCR fragment contains MMLV nucleotides +1 to +523 and thus does not
contain
gag coding sequences which start at +621 (numbering based on the nucleotide
sequence
of MMLV Shinnick et al 1981 Nature 293: 543-548).
The PCR fragment can be used to construct a retroviral genome vector by
digestion using
3o HincIIII and Xhol restriction enzymes and sub-cloning using standard
techniques. Such
vectors contain no homology with gag coding sequences.
CA 02367488 2001-09-14
WO 00/56910 PCT/GB00/01091
78
Example ~ Construction of defective retroviral genome
The transcription unit capable of producing a defective retroviral genome is
shown in
Figure 17. It contains the following elements: a hypoxia regulated promoter
enhancer
comprising 3 copies of the PGK - gene HRE and a SV40 promoter deleted of the
72bp-
repeat enhancer from pGL3 (Promega); a MMLV sequence containing R, U~ and the
packaging signal; the coding sequence of m4070A (Example 3); a splice
acceptor; a
cloning site for insertion of a coding sequence for a therapeutic protein; the
polypyrimidine tract from MMLV; a second copy of the HRE-containing promoter-
1 o enhancer; a splice donor site; and a second copy of R, U5.
On reverse transcription and integration of the vector into the secondary
target cell, the
splice donor is introduced upstream of the env gene causing it to be removed
from mRNA
by splicing and thereby permitting efficient expression of the therapeutic
gene only in the
secondary target cell (See Figure 17).
Example 6 Construction of a conditional expression vector for Cytochrome P450
Figure 18 shows the structure of retroviral expression vector cDNA coding
sequences
3o from the cytochrome P450 gene in two halves such that only upon
transduction is the
correct splicing achieved to allow P450 expression. This therefore restricts
expression to
transduced cells.
1 ) The starting plasmid for the construction of this vector is pLNSX (Miller
and Rosman
?5 1989 BioTechniques 7: 980-990). The natural splice donor (...agGTaag...)
contained
within the packaging signal of pLNSX (position 781/782) is mutated by PCR
mutagenesis
using the ALTERED SITES II mutageneisis kit (Promega) and a synthetic
oligonucleotide of the sequence:
30 ~'-caaccaccgggagGCaagctggccagcaactta-3'
CA 02367488 2001-09-14
WO 00/56910 PCT/GB00/01091
79
2) A CMV promoter from the pCI expression vector (Promega) is isolated b~~ PCR
using
the following two oligonucleotides:
Primer l: 5'-atcggctagcagatcttcaatattggccattagccatat-3'
Primer 2: ~'-atcgagatctgcggccgcttacctgcccagtgcctcacgaccaa-3'
This produces a fragment containing the CMV promoter with a 5'Nhe 1 site
(Primer 1 ) and
a 3' Notl andXbal site (Primer 2). It is cut with Nhel andXbal and cloned into
pLNSX
1 o from which an Nhe 1-Nhe 1 fragment has been removed.
3) The ~' end of a cytochrome P450 cDNA coding sequence is isolated by RT-PCR
from
human liver RNA (Clontech) with the following primers:
Primer 3: 5'-atcggcggccgcccaccatggaactcagcgtcctcctcttccttgcaccctagg-3'
Primer 4: ~'-atcggcggccgcacttacCtgtgtgccccaggaaagtatttcaagaagccag-3'
This amplifies the 5' end of the p450 from the ATG to residue 693 (numbering
from the
2o translation initiation site Yamano et al 1989 Biochem 28:7340-7348).
Contained on the
5' end of the fragment (derived from Primer 3) is also a Notl site and an
optimised
"Kozak" translation initiation signal. Contained on the 3' end of the sequence
(derived
from primer 4) is another Notl site and a consensus splice donor sequence
(also found in
pCI and originally derived from the human beta globin gene) with the GT splice
donor
pair located flush against residue 704 of P450 (the complementary residue is
shown in
uppercase in Primer 4). This fragment is digested with Notl and cloned into
the Notl
digested plasmid generated in step 2.
4) The Nhe 1-Nhe 1 fragment removed during the cloning of step 2 is then re-
introduced
3o into the plasmid of step 3. This creates a retroviral vector as described
in Figure 17 but
missing the 3' end P4~0.
CA 02367488 2001-09-14
WO 00/56910 PCT/GB00/01091
5) The 3' of the P4~0 coding sequence is isolated by RT-PCR amplification from
human
liver RNA (Clontech) using the following primers:
Primer 5:
actgtgatcataaacacctattggtcttactgacatccactttctctccacagGcaagtttacaaaacctgc
5 aggaaatcaatgcttacatt-3'
Primer 6: actgatcgatttccctcagccccttcagcggggcaggaagc-3'
This generates the PCR amplified 3' end of P450 from residue 705 (in uppercase
primer
1o 5) and extends past the translation termination codon. Contained within the
5' end of this
product and generated by primer 5 is a Bcll restriction site and a consensus
splice
acceptor and branch point (also found in pCI and originally from an
immunoglobulin
gene) upstream of residue 705. Contained at the 3' end of this product
downstream of the
stop codon and generated by primer 6 is a Clal site. This PCR product is then
digested
15 with Bcll and Clal and cloned into the vector of step 3 with the Bcll-Clal
fragment
removed to generate the retroviral vector as shown in Figure 18.
The following examples describe the construction of an adenolentiviral system
that can be
used for the transient production of lentivirus in vitro or in vivo.
First Generation Recombinant Adenovirus
The first generation adenovirus vectors consist of a deletion of the E l and
E3 regions of
the virus allowing insertion of foreign DNA, usually into the left arm of the
virus adjacent
to the left Inverted Terminal Repeat (ITR). The viral packaging signal ( 194-3
~ 8 nt)
overlaps with the E 1 a enhancer and hence is present in most E 1 deleted
vectors. This
sequence can be translocated to the right end of the viral genome (Hearing &
Shenk,1983
Cell 33: 59-74). Therefore, in an El deleted vector 3.2 kb can be deleted (358-
352 nt).
3o Adenovirus is able to package 105% length of the genome, thus allowing for
addition of
an extra 2.1 kb. Therefore, in an E 1 /E3 deleted viral vector the cloning
capacity becomes
7-8 kb (2.1 kb + 1.9 kb (removal of E3) + 3.2 kb (removal of El). Since the
recombinant
adenovirus lacks the essential E 1 early gene it is unable to replicate in non-
E 1
CA 02367488 2001-09-14
WO 00/56910 PCT/GB00/01091
81
complementing cell lines. The 293 cell line was developed by Graham et al. (
1977 J Gen
Virol 36: ~9-7-1) and contains approximately 4 kb from the left end of the Ad3
genome
including the ITR, packaging signal, E 1 a, E 1 b and pIX. The cells stably
express E 1 a and
E 1 b gene products, but not the late protein IX, even though pIX sequences
are within
E 1 b. In non-complementing cells the E 1 deleted virus transduces the cell
and is
transported to the nucleus but there is no expression from the El deleted
genome.
First Generation Adenovirus Production System
Microbix Biosystems - nbl Gene Sciences
The diagram in Figure 19 shows the general strategy used to create recombinant
adenoviruses using the microbix system
The general strategy involves cloning the foreign DNA into an El shuttle
vector, where
is the El region from 402-3328 by is replaced by the foreign DNA cassette. The
recombinant plasmid is then co-transfected into 293 cells with the pJMl7
plasmid. pJMl7
contains a deletion of the E3 region and an insertion of the prokaryotic pBRX
vector
(including the ampicillin resistance and bacterial on sequences) into the El
region at 3.7
map units. This 40 kb plasmid is therefore too large to be packaged into adeno
2o nucleocapsids but can be propagated in bacteria. Intracellular
recombination in 293 cells
results in replacement of the amp' and on sequences with the insert of foreign
DNA.
Example 7 Construction of Transfer plasmids for the creation of Adenoviruses
containing EIAV Components
7J
In order to produce lentiviral vectors four adenovirus need to be made:
genome, gagpol,
envelope (rabies G) and Rev. The lentiviral components are expressed from
heterologous
promoters they contain introns where needed (for high expression of gagpol,
Rev and
Rabies envelope) and a polyadenylation signal. When these four viruses are
transduced
3o into Ela minus cells the adenoviral components will not be expressed but
the heterlogous
promoters will allow the expression of the lentiviral components. An example
is outlined
below (example 1 ) of the construction of an EIAV adenoviral system
(Application
CA 02367488 2001-09-14
WO 00/56910 PCT/GB00/01091
82
number: 972713.7). The EIAV is based on a minimal system that is one lacking
any of the
non-essential EIAV encoded proteins (S2, Tat or envelope). The envelope used
to
pseudotype the EIAV is the rabies envelope (G protein). This has been shown to
pseudotvpe
EIAV well (.Application number: 9811152.9).
Transfer Plasmids
Decribed below is the construction of the transfer plasmids containing the
EIAV
components. The transfer plamsid is pE 1 sp 1 A (Figure 20).
The recombinant transfer plsamids can the be used to make recombinant
adenoviruses by
homologous recombination in 293 cells.
A pictorial representation of the following plasmids is attached.
A) pElRevE - Rev Construct
The plasmid pCI-Rev is cut with Apa LI and Cla I. The 2.3 kb band encoding
EIAV Rev
is blunt ended with Klenow polymerase and inserted into the Eco RV site of pE
1 sp 1 A to
give plasmid pE 1 RevE (Figure 21 ).
B) pEIHORSE3.1-gagpol Construct
pHORSE3.l was cut with Sna BI and Not I. The 6.1 kb band encoding EIAV gagpol
was
35 inserted into pE 1 RevE cut with Sna BI and Not I (7.5 kb band was
purified). This gives
plasmid pE 1 HORSE3.1 (Figure 22).
C) pEIPEGASUS - Genome Construct
3o pEGASUS4 was cut with Bgl II and Not I. The 6.8 kb band containing the EIAV
vector
genome was inserted into pE 1 RevE cut with Bgl II and Not I (6.7kb band was
purified).
This gave plasmid pEIPEGASUS (Figure 23).
CA 02367488 2001-09-14
WO 00/56910 PCT/GB00/01091
83
D) pCI-Rab - Rabies Construct
In order to make pElRab the rabies open reading frame was inserted into pCI-
Neo
(Figure 24) by cutting plasmid pSA9IRbG with Nsi I and Ahd I. The 1.2~ kb band
was
bluntended with T4 DNA polymerase and inserted into pCI-Neo cut with Sma I.
This
gave plasmid pCI-Rab (Figure 25).
F) pElRab - Rabies Construct
I o pCI-Rab was cut with Sna BI and Not I. The 1.9 b band encoding Rabies
envelope was
inserted into pElRevE cut with Sna BI and Not I (7.5 b band was purified).
This gave
plasmid pE 1 Rab (Figure 26).
EXAMPLE 8
Construction of pTRONIN
Rather than titreing on neomycin resistance as is required with pICUT, it was
decided to
also include a LacZ reporter. This was cloned into pICUT such that the LacZ
gene is
expressed from the LTR and the neomycin gene from an internal SV40 promoter.
The
construct was made as follows:
First pHITllI (Soneoka et al 1995 ibid) was digested with RsrII and then
partially
digested with BamHl. The 4144 by fragment (containing the LacZ-SV40 Neo
sequences)
?5 was taken and cloned into the Bcll-RsrII digested pICUT to make pICUT-ZN.
Next, the
upstream LTR from this plasmid is replaced with the 5' CMV LTR from pHIT 111
(Soneka et al 1995 ibid). This was done by taking the Scal-BsteII fragment,
containing
the 5'CMV LTR, to substitute the 5'LTR from pICUT-ZN similarly digested with
Scal
BstEII. The resulting plasmid is named pTRONIN (see Figure 31 for diagram and
Figure
32 for the sequence).
To investigate the splicing events in pTRONIN, an RT-PCR was carried out on
pTRONIN transduced HT1080 cells (see Jones et al 1975 Cell 6:245-252). This
was
CA 02367488 2001-09-14
WO 00/56910 PCT/GB00/01091
84
done by first extracting the RNA from transduced cells with Trizol (Gibco) as
described
by the manufacturer. Next, first strand cDNA was synthesised from this RI~TA
using
random primers and 'Universal Riboclone cDNA synthesis system' (Promega) as
described by the manufacture.
Finally for the PCR reaction, two primers were used. The first (primer A1) was
designed
to anneal downstream of the U3 start of transcription but upstream of the
small T SD
sequence (5'-gttaacactagtaagcttg-3'). The second primer (primer A2) was
designed to
anneal downstream of the splice acceptor in the reverse orientation (5'-
1o gattaagttgggtaacgccaggg-3'). These primers would therefore amplify between
the region
from upstream of the small T splice donor to downstream of the splice
acceptor.
Consequently this PCR reaction would pick up both full-length and spliced
message (see
Figure 34).
1 S Once complete, the PCR reaction was separated on an 1 % agarose gel. This
analysis
revealed there to be two products from the pTRONIN transduced cells. Both of
which
were smaller than full length transcripts, suggesting splicing had occured.
Both
fragments were gel extracted, cloned and sequenced to reveal that one product
was a
transcript generated by a spliceing reaction between the small T splice donor
( copied to
2o the ~' LTR during reverse transcription) and splice acceptor. The other,
larger product
instead contained a spliceing event between the splice acceptor and a
previously
unidentified cryptic splice donor contained within the packaging signal
(mapping to
position 810-811 of wild-type MLV; the sequence context being cagGTtaag (with
the GT
splice donor in bold).
To investigate this cryptic splice donor further, it was mutated in pTRONIN by
the
following method: First two olgos. were svthesised. The first spanned both the
unique
BsteII site and the GT of the cryptic splice donor. This oligo. contained a
splice donor
point change (shown in bold) of GT to GC. The BsteII site is shown as
uppercase. Its
3o sequence is shown below.
CA 02367488 2001-09-14
WO 00/56910 PCT/GB00/01091
~'-cgttaGGTTACCttctgctctgcaQaatggccaacctttaacgtcggatggccgcgagacggcacc
tttaaccgagacctcatcacccagGCtaagatcaaggtc-3'
5 The second oligo. was in the reverse orientation and spanned a unique Pme 1
site
(underlined):
5'-gcccagtgtttaaacactcgag-3'.
to These two oligos. were used in a PCR reaction with pTRONIN as a template.
The PCR
product was then cut with BstE 1 l and Pme l and then cloned into pTRONIN
similarly cut
with BstEl l and Pmel, thus replacing the cryptic splice donor GT with a
mutant GC
sequence. This vector was called pTRONIN-1 (see Figure 35 for diagram and
Figure 36
for sequence).
l~
The pTRONIN-1 vector was then compared with pTRONIN: By RT-PCR analysis it
revealed that pTRONIN-1 now only made one major transcript upon transduction,
unlike
the 2 transcripts from pTRONIN. When sequenced this product was shown to be
the
expected sequence if derived from a splicing reaction between small T SD and
splice
3o acceptor. Therefore the GT to GC mutagenesis of the cryptic splice donor
had disabled its
function.
When titres were compared, pTRONIN-1 was routinely shown to have between ~
fold
and 10 fold higher titres than pTRONIN. This would be in agreement with the
fact that
25 until transduction there is now no splice donor upstream of the splice
acceptor and
therefore no splicing during viral production. The fact that mutating the
cryptic splice
donor improves titre suggest that until deletion, the splicing between it and
the splice
acceptor in the producer cell (and consequent deletion of packaging signal) is
lowering
titre.
Another demonstration of the degree of splicing, upon transduction, of the
pTRONIN-1
vectors would be to compare its titre, relative to a control (pHITl l l Soneka
et al. ibid)),
CA 02367488 2001-09-14
WO 00/56910 PCT/GB00/01091
86
after one round of transduction. To do this the viral preparation were made
from the two
vectors by the transient transfection method (see Soneoka et al. ibid) and
then used to
transduce the packaging line FLYRD18 (Cosset et al J.Virol. 69:7430-6). After
two days
the respecti~~e supernatants from this packaging line were harvested, 0.4~
filtered, and
then titred. For the pHITllI control, the titres from transient production and
subsequently from FLYRD 18 were 1 x 106 per ml. and Sx 1 O6 per ml.
respectively. For
pTRONIN-1 the titre from transient production was similarly 1 x 1 O6 per ml.
However
from the FLYRD18 cells, (after one round of transduction) the titre dropped to
under ~0
per ml. Therefore relative to the pHIT 111 control the titre had been reduced
by over
100,000 fold. This demonstrates that the splicing event is efficient and that
almost all
transcripts are spliced and thus not packaged.
SUMMARY
I5 The present invention relates to a novel delivery system suitable for
introducing one or
more NOIs into a target cell.
In one preferred aspect the present invention covers a retroviral vector
comprising a
functional splice donor site (FSDS) and a functional splice acceptor (FSAS)
site; wherein
2o the FSDS and the FSAS flank a first nucleotide sequence of interest (NOI);
wherein the
FSDS is upstream of the FSAS; wherein the retroviral vector is derived from a
retroviral
pro-vector; wherein the retroviral pro-vector comprises a first nucleotide
sequence (NS)
capable of yielding the functional splice donor site (FSDS); a second NS
capable of
yielding the functional splice acceptor site (FSAS); a third NS capable of
yielding a non-
25 functional splice donor site (NFSDS); a fourth NS capable of yielding a non-
functional
splice site (NFSS); wherein the first NS is downstream of the second NS and
wherein the
third NS and fourth NS are upstream of the second NS; such that splicing of
the retroviral
vector occurs as a result of reverse transcription of the retroviral pro-
vector at its desired
target site.
Alternatively expressed, this aspect covers a novel delivery system which
comprises one
or more NOIs flanked by a functional SD site (FSDS) and a functional splice
acceptor site
CA 02367488 2001-09-14
WO 00/56910 PCT/GB00/01091
87
(FSAS) provided that this has been generated from a pro-vector in which the
order of the
SD and SA is reversed to render the splicing non-functional.
This aspect of the present invention can be called the "split-intron" aspect.
A schematic
diagram showing this aspect of the present invention is provided in Figure
27c. In
contrast, Figures 27a and 27b show splicing configurations in known retroviral
vectors.
Another broad aspects of the present invention include a novel delivery system
which
comprises one or more adenoviral vector components capable of packaging one or
more
lentiviral vector components, wherein optionally the lentiviral vector
comprises a split
intron configuration.
This aspect of the present invention in the general sense can be called a
hybrid viral
vector system. In this particular case, the combination of an adenoviral
component and a
lentiviral component can be called a dual hybrid viral vector system.
A schematic diagram showing this aspect of the present invention is provided
in Figure
28.
2o These and other broad aspects of the present invention are discussed
herein.
All publications mentioned in the above specification are herein incorporated
by
reference. Various modifications and variations of the described methods and
system of
the invention will be apparent to those skilled in the art without departing
from the scope
and spirit of the invention. Although the invention has been described in
connection with
specific preferred embodiments, it should be understood that the invention as
claimed
should not be unduly limited to such specific embodiments. Indeed, various
modifications of the described modes for carrying out the invention which are
obvious to
those skilled in molecular biology or related fields are intended to be within
the scope of
3o the following claims.
CA 02367488 2001-09-14
WO 00/56910 PCT/GB00/01091
SEQUENCE LISTING PART OF THE DESCRIPTION
SEQ ID 110. I
J GCTAGCTTAAGTAACGCCACTTTGCAAGGCATGGAAAAATACATAACTGAGAATAGAAAAGTTCAGATCAAG
GTCAGGAACAAAGAAACAGCTGAATACCAAACAGGATATCTGTGGTAAGCGGTTCCTGCCCCGGCTCAGGGC
CAAGAACAGATGAGACAGCTGAGTGATGGGCCAAACAGGATATCTGTGGTAAGCAGTTCCTGCCCCGGCTCG
GGGCCAAGAACAGATGGTCCCCAGATGCGGTCCAGCCCTCAGCAGTTTCTAGTGAATCATCAGATGTTTCCA
GGGTGCCCCAAGGACCTGAAAATGACCCTGTACCTTATTTGAACTAACCAATCAGTTCGCTTCTCGCTTCTG
TTCGCGCGCTTCCGCTCTCCGAGCTCAATAAAAGAGCCCACAACCCCTCACTCGGCGCGCCAGTCTTCCGAT
AGACTGCGTCGCCCGGGTACCCGTATTCCCAATAAAGCCTCTTGCTGTTTGCATCCGAATCGTGGTCTCGCT
GTTCCTTGGGAGGGTCTCCTCTGAGTGATTGACTACCCACGACGGGGGTCTTTCATTTGGGGGCTCGTCCGG
GATTTGGAGACCCCTGCCCAGGGACCACCGACCCACCACCGGGAGGCAAGCTGGCCAGCAACTTATCTGTGT
CTGTCCGATTGTCTAGTGTCTATGTTTGATGTTATGCGCCTGCGTCTGTACTAGTTAGCTAACTAGCTCTGT
1~ ATCTGGCGGACCCGTGGTGGAACTGACGAGTTCTGAACACCCGGCCGCAACCCTGGGAGACGTCCCAGGGAC
TTTGGGGGCCGTTTTTGTGGCCCGACCTGAGGAAGGGAGTCGATGTGGAATCCGACCCCGTCAGGATATGTG
GTTCTGGTAGGAGACGAGAACCTAAAACAGTTCCCGCCTCCGTCTGAATTTTTGCTTTCGGTTTGGAACCGA
AGCCGCGCGTCTTGTCTGCTGCAGCGCTGCAGCATCGTTCTGTGTTGTCTCTGTCTGACTGTGTTTCTGTAT
TTGTCTGAAAATTAGGGCCAGACTGTTACCACTCCCTTAAGTTTGACCTTAGGTCACTGGAAAGATGTCGAG
CGGATCGCTCACAACCAGTCGGTAGATGTCAAGAAGAGACGTTGGGTTACCTTCTGCTCTGCAGAATGGCCA
ACCTTTAACGTCGGATGGCCGCGAGACGGCACCTTTAACCGAGACCTCATCACCCAGGTTAAGATCAAGGTC
TTTTCACCTGGCCCGCATGGACACCCAGACCAGGTCCCCTACATCGTGACCTGGGAAGCCTTGGCTTTTGAC
CCCCCTCCCTGGGTCAAGCCCTTTGTACACCCTAAGCCTCCGCCTCCTCTTCCTCCATCCGCCCCGTCTCTC
CCCCTTGAACCTCCTCGTTCGACCCCGCCTCGATCCTCCCTTTATCCAGCCCTCACTCCTTCTCTAGGCGCC
2J GGAATTCGTTAACTCGAGGATCTAACCTAGGTCTCGAGTGTTTAAACACTGGGCTTGTCGAGACAGAGAAGA
CTCTTGCGTTTCTGATAGGCACCTATTGGTCTTACTGACATCCACTTTGCCTTTCTCTCCACAGGTGAGGCC
TAGGCTTTTGCAAAAAGCTTGGGCTGCAGGTCGAGGCGGATCTGATCAAGAGACAGGATGAGGATCGTTTCG
CATGATTGAACAAGATGGATTGCACGCAGGTTCTCCGGCCGCTTGGGTGGAGAGGCTATTCGGCTATGACTG
GGCACAACAGACAATCGGCTGCTCTGATGCCGCCGTGTTCCGGCTGTCAGCGCAGGGGCGCCCGGTTCTTTT
TGTCAAGACCGACCTGTCCGGTGCCCTGAATGAACTGCAGGACGAGGCAGCGCGGCTATCGTGGCTGGCCAC
GACGGGCGTTCCTTGCGCAGCTGTGCTCGACGTTGTCACTGAAGCGGGAAGGGACTGGCTGCTATTGGGCGA
AGTGCCGGGGCAGGATCTCCTGTCATCTCACCTTGCTCCTGCCGAGAAAGTATCCATCATGGCTGATGCAAT
GCGGCGGCTGCATACGCTTGATCCGGCTACCTGCCCATTCGACCACCAAGCGAAACATCGCATCGAGCGAGC
ACGTACTCGGATGGAAGCCGGTCTTGTCGATCAGGATGATCTGGACGAAGAGCATCAGGGGCTCGCGCCAGC
CGAACTGTTCGCCAGGCTCAAGGCGCGCATGCCCGACGGCGAGGATCTCGTCGTGACCCATGGCGATGCCTG
CTTGCCGAATATCATGGTGGAAAATGGCCGCTTTTCTGGATTCATCGACTGTGGCCGGCTGGGTGTGGCGGA
CCGCTATCAGGACATAGCGTTGGCTACCCGTGATATTGCTGAAGAGCTTGGCGGCGAATGGGCTGACCGCTT
CCTCGTGCTTTACGGTATCGCCGCTCCCGAT'TCGCAGCGCATCGCCTTCTATCGCCTTCTTGACGAGTTCTT
CTGAGCGGGACTCTGGGGTTCGATAAAATAAAAGATTTTATTTAGTCTCCAGAAAAAGGGGGGAATGAAAGA
CCCCACCTGTAGGTTTGGCAAGCTAGCTTAAGTAACGCCATTTTGCAAGGCATGGAAAAATACATAACTGAG
AATAGAGAAGTTCAGATCAAGGTCAGGAACAGATGGAACAGCTGAATATGGGCCAAACAGGATATCTGTGGT
AAGCAGTTCCTGCCCCGGCTCAGGGCCAAGAACAGATGGAACAGCTGAATATGGGCCAAACAGGATATCTGT
GGTAAGCAGTTCCTGCCCCGGCTCAGGGCCAAGAACAGATGGTCCCCAGATGCGGTCCAGCCCTCAGCAGTT
TCTAGAGAACCATCAGATGTTTCCAGGGTGCCCCAAGGACCTGAAATGACCCTGTGCCTTATTTGAACTAAC
CAATCAGTTCGCTTCTCGCTTCTGTTCGCGCGCTTCTGCTCCCCGAGCTCAATAAAAGAGCCCACAACCCCT
CACTCGGGGCGCCGTTAACACTAGTAAGCTTGCTCTAAGGTAAATATGTCGACAGGCCTGCGCCAGTCCTCC
GATTGACTGAGTCGCCCGGGTACCCGTGTATCCAATAAACCCTCTTGCAGTTGCATCCGACTTGTGGTCTCG
CTGTTCCTTGGGAGGGTCTCCTCTGAGTGATTGACTACCCGTCAGCGGGGGTCTTTCATTTGGGGGCTCGTC
CGGGATCGGGAGACCCCTGCCCAGGGACCACCGACCCACCACCGGGAGGTAAGCTGGCTGCCTCGCGCGTTT
CGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCGGAGACGGTCACAGCTTGTCTGTAAGCGGATGC
CGGGAGCAGACAAGCCCGTCAGGGCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCGCAGCCATGACCCAGTC
ACGTAGCGATAGCGGAGTGTATACTGGCTTAACTATGCGGCATCAGAGCAGATTGTACTGAGAGTGCACCAT
ATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGCGCTCTTCCGCTTCCTCGCTC
ACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTA
TCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAA
AAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGT
CAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCT
CCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCAT
AGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCC
GTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCG
CCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAG
TGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTC
GGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAG
CAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAG
6~ TGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTA
CA 02367488 2001-09-14
WO 00/56910 PCT/GB00/01091
AATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTA
ATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAG
ATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCG
GCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCC
GCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAAC
GTTGTTGCCATTGCTGCAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCC
CAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATC
GTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTC
ATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGG
CGACCGAGTTGCTCTTGCCCGGCGTCAACACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTC
ATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAA
CCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGA
AGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAA
TATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAA
1~ CAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACA
TTAACCTATAAAAATAGGCGTATCACGAGGCCCTTTCGTCTTCAAGAATTCATACCAGATCACCGAAAACTG
TCCTCCAAATGTGTCCCCCTCACACTCCCAAATTCGCGGGCTTCTGCCTCTTAGACCACTCTACCCTATTCC
CCACACTCACCGGAGCCAAAGCCGCGGCCCTTCCGTTTCTTTGCTTTTGAAAGACCCCACCCGTAGGTGGCA
A
SEQ ID NO. 2
TGAATAATAAAATGTGTGTTTGTCCGAAATACGCGTTTTGAGATTTCTGTCGCCGACTAAATTCATGTCGCG
CGATAGTGGTGTTTATCGCCGATAGAGATGGCGATATTGGAAAAATTGATATTTGAAAATATGGCATATTGA
2J AAATGTCGCCGATGTGAGTTTCTGTGTAACTGATATCGCCATTTTTCCAAAAGTGATTTTTGGGCATACGCG
ATATCTGGCGATAGCGCTTATATCGTTTACGGGGGATGGCGATAGACGACTTTGGTGACTTGGGCGATTCTG
TGTGTCGCAAATATCGCAGTTTCGATATAGGTGACAGACGATATGAGGCTATATCGCCGATAGAGGCGACAT
CAAGCTGGCACATGGCCAATGCATATCGATCTATACATTGAATCAATATTGGCCATTAGCCATATTATTCAT
TGGTTATATAGCATAAATCAATATTGGCTATTGGCCATTGCATACGTTGTATCCATATCGTAATATGTACAT
TTATATTGGCTCATGTCCAACATTACCGCCATGTTGACATTGATTATTGACTAGTTATTAATAGTAATCAAT
TACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGG
CTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGAC
TTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATAT
GCCAAGTCCGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTT
.iJ ACGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCA
GTACACCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGG
GAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTGCGATCGCCCGCCCCGTTG
ACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCGTTTAGTGAACCGGGCACTC
AGATTCTGCGGTCTGAGTCCCTTCTCTGCTGGGCTGAAAAGGCCTTTGTAATAAATATAATTCTCTACTCAG
TCCCTGTCTCTAGTTTGTCTGTTCGAGATCCTACAGTTGGCGCCCGAACAGGGACCTGAGAGGGGCGCAGAC
CCTACCTGTTGAACCTGGCTGATCGTAGGATCCCCGGGACAGCAGAGGAGAACTTACAGAAGTCTTCTGGAG
GTGTTCCTGGCCAGAACACAGGAGGACAGGTAAGATGGGAGACCCTTTGACATGGAGCAAGGCGCTCAAGAA
GTTAGAGAAGGTGACGGTACAAGGGTCTCAGAAATTAACTACTGGTAACTGTAATTGGGCGCTAAGTCTAGT
AGACTTATTTCATGATACCAACTTTGTAAAAGAAAAGGACTCTAGAGTCGACCCCCTCGACGTTTAAACACT
GGGCTTGTCGAGACAGAGAAGACTCTTGCGTTTCTGATAGGCACCTATTGGTCTTACTGACATCCACTTTGC
CTTTCTCTCCACAGGTCACGTGAAGCTAGCCTCGAGGATCTGCGGATCCGGGGAATTCCCCAGTCTCAGGAT
CCACCATGGGGGATCCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCC
TTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGT
TGCGCAGCCTGAATGGCGAATGGCGCTTTGCCTGGTTTCCGGCACCAGAAGCGGTGCCGGAAAGCTGGCTGG
AGTGCGATCTTCCTGAGGCCGATACTGTCGTCGTCCCCTCAAACTGGCAGATGCACGGTTACGATGCGCCCA
TCTACACCAACGTAACCTATCCCATTACGGTCAATCCGCCGTTTGTTCCCACGGAGAATCCGACGGGTTGTT
ACTCGCTCACATTTAATGTTGATGAAAGCTGGCTACAGGAAGGCCAGACGCGAATTATTTTTGATGGCGTTA
ACTCGGCGTTTCATCTGTGGTGCAACGGGCGCTGGGTCGGTTACGGCCAGGACAGTCGTTTGCCGTCTGAAT
TTGACCTGAGCGCATTTTTACGCGCCGGAGAAAACCGCCTCGCGGTGATGGTGCTGCGTTGGAGTGACGGCA
JJ GTTATCTGGAAGATCAGGATATGTGGCGGATGAGCGGCATTTTCCGTGACGTCTCGTTGCTGCATAAACCGA
CTACACAAATCAGCGATTTCCATGTTGCCACTCGCTTTAATGATGATTTCAGCCGCGCTGTACTGGAGGCTG
AAGTTCAGATGTGCGGCGAGTTGCGTGACTACCTACGGGTAACAGTTTCTTTATGGCAGGGTGAAACGCAGG
TCGCCAGCGGCACCGCGCCTTTCGGCGGTGAAATTATCGATGAGCGTGGTGGTTATGCCGATCGCGTCACAC
TACGTCTGAACGTCGAAAACCCGAAACTGTGGAGCGCCGAAATCCCGAATCTCTATCGTGCGGTGGTTGAAC
60 TGCACACCGCCGACGGCACGCTGATTGAAGCAGAAGCCTGCGATGTCGGTTTCCGCGAGGTGCGGATTGAAA
ATGGTCTGCTGCTGCTGAACGGCAAGCCGTTGCTGATTCGAGGCGTTAACCGTCACGAGCATCATCCTCTGC
ATGGTCAGGTCATGGATGAGCAGACGATGGTGCAGGATATCCTGCTGATGAAGCAGAACAACTTTAACGCCG
TGCGCTGTTCGCATTATCCGAACCATCCGCTGTGGTACACGCTGTGCGACCGCTACGGCCTGTATGTGGTGG
ATGAAGCCAATATTGAAACCCACGGCATGGTGCCAATGAATCGTCTGACCGATGATCCGCGCTGGCTACCGG
CGATGAGCGAACGCGTAACGCGAATGGTGCAGCGCGATCGTAATCACCCGAGTGTGATCATCTGGTCGCTGG
GGAATGAATCAGGCCACGGCGCTAATCACGACGCGCTGTATCGCTGGATCAAATCTGTCGATCCTTCCCGCC
CA 02367488 2001-09-14
WO 00/56910 PCT/GB00/01091
CGGTGCAGTATGAAGGCGGCGGAGCCGACACCACGGCCACCGATATTATTTGCCCGATGTACGCGCGCGTGG
ATGAAGACCAGCCCTTCCCGGCTGTGCCGAAATGGTCCATCAAAAAATGGCTTTCGCTACCTGGAGAGACGC
GCCCGCTGATCCTTTGCGAATACGCCCACGCGATGGGTAACAGTCTTGGCGGTTTCGCTAAATACTGGCAGG
CGTTTCGTCAGTATCCCCGTTTACAGGGCGGCTTCGTCTGGGACTGGGTGGATCAGTCGCTGATTAAATATG
ATGAAAACGGCAACCCGTGGTCGGCTTACGGCGGTGATTTTGGCGATACGCCGAACGATCGCCAGTTCTGTA
TGAACGGTCTGGTCTTTGCCGACCGCACGCCGCATCCAGCGCTGACGGAAGCAAAACACCAGCAGCAGTTTT
TCCAGTTCCGTTTATCCGGGCAAACCATCGAAGTGACCAGCGAATACCTGTTCCGTCATAGCGATAACGAGC
TCCTGCACTGGATGGTGGCGCTGGATGGTAAGCCGCTGGCAAGCGGTGAAGTGCCTCTGGATGTCGCTCCAC
AAGGTAAACAGTTGATTGAACTGCCTGAACTACCGCAGCCGGAGAGCGCCGGGCAACTCTGGCTCACAGTAC
GCGTAGTGC.~ACCGAACGCGACCGCATGGTCAGAAGCCGGGCACATCAGCGCCTGGCAGCAGTGGCGTCTGG
CGGAAAACCTCAGTGTGACGCTCCCCGCCGCGTCCCACGCCATCCCGCATCTGACCACCAGCGAAATGGATT
TTTGCATCGAGCTGGGTAATAAGCGTTGGCAATTTAACCGCCAGTCAGGCTTTCTTTCACAGATGTGGATTG
GCGATAAAAAACAACTGCTGACGCCGCTGCGCGATCAGTTCACCCGTGCACCGCTGGATAACGACATTGGCG
TAAGTGAAGCGACCCGCATTGACCCTAACGCCTGGGTCGAACGCTGGAAGGCGGCGGGCCATTACCAGGCCG
AAGCAGCGTTGTTGCAGTGCACGGCAGATACACTTGCTGATGCGGTGCTGATTACGACCGCTCACGCGTGGC
AGCATCAGGGGAAAACCTTATTTATCAGCCGGAAAACCTACCGGATTGATGGTAGTGGTCAAATGGCGATTA
CCGTTGATGTTGAAGTGGCGAGCGATACACCGCATCCGGCGCGGATTGGCCTGAACTGCCAGCTGGCGCAGG
TAGCAGAGCGGGTAAACTGGCTCGGATTAGGGCCGCAAGAAAACTATCCCGACCGCCTTACTGCCGCCTGTT
TTGACCGCTGGGATCTGCCATTGTCAGACATGTATACCCCGTACGTCTTCCCGAGCGAAAACGGTCTGCGCT
GCGGGACGCGCGAATTGAATTATGGCCCACACCAGTGGCGCGGCGACTTCCAGTTCAACATCAGCCGCTACA
GTCAACAGCAACTGATGGAAACCAGCCATCGCCATCTGCTGCACGCGGAAGAAGGCACATGGCTGAATATCG
ACGGTTTCCATATGGGGATTGGTGGCGACGACTCCTGGAGCCCGTCAGTATCGGCGGAATTCCAGCTGAGCG
CCGGTCGCTACCATTACCAGTTGGTCTGGTGTCAAAAATAATAATAACCGGGCAGGGGGGATCCGCAGATCC
GGCTGTGGAATGTGTGTCAGTTAGGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCA
?5 TGCCTGCAGCCCGGGGGATCCACTAGTGTATGTTTAGAAAAACAAGGGGGGAACTGTGGGGTTTTTATGAGG
GGTTTTATAAATGATTATAAGAGTAAAAAGAAAGTTGCTGATGCTCTCATAACCTTGTATAACCCAAAGGAC
TAGCTCATGTTGCTAGGCAACTAAACCGCAATAACCGCATTTGTGACGCGAGTTCCCCATTGGTGACGCGTT
TTGAGATTTCTGTCGCCGACTAAATTCATGTCGCGCGATAGTGGTGTTTATCGCCGATAGAGATGGCGATAT
TGGAAAAATTGATATTTGAAAATATGGCATATTGAAAATGTCGCCGATGTGAGTTTCTGTGTAACTGATATC
GCCATTTTTCCAAA.AGTGATTTTTGGGCATACGCGATATCTGGCGATAGCGCTTATATCGTTTACGGGGGAT
GGCGATAGACGACTTTGGTGACTTGGGCGATTCTGTGTGTCGCAAATATCGCAGTTTCGATATAGGTGACAG
ACGATATGAGGCTATATCGCCGATAGAGGCGACATCAAGCTGGCACATGGCCAATGCATATCGATCTATACA
TTGAATCAATATTGGCCATTAGCCATATTATTCATTGGTTATATAGCATAAATCAATATTGGCTATTGGCCA
TTGCATACGTTGTATCCATATCGTAATATGTACATTTATATTGGCTCATGTCCAACATTACCGCCATGTTGA
CATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTC
CGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATA
ATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAA
ACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTCCGCCCCCTATTGACGTCAATGACGGTAAA
TGGCCCGCCTGGCATTATGCCCAGTACATGACCTTACGGGACTTTCCTACTTGGCAGTACATCTACGTATTA
GTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACACCAATGGGCGTGGATAGCGGTTTGACTCACGG
GGATTTCCA~GTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCA
AAATGTCGTAACAACTGCGATCGCCCGCCCCGTTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCT
ATATAAGCAGAGCTCGTTTAGTGAACCGACTTAAGTCTTCCTGCAGGGGCTCTAAGGTAAATAGGGCACTCA
GATTCTGCGGTCTGAGTCCCTTCTCTGCTGGGCTGAAAAGGCCTTTGTAATAAATATAATTCTCTACTCAGT
CCCTGTCTCTAGTTTGTCTGTTCGAGATCCTACAGTTGGCGCCCGAACAGGGACCTGAGAGGGGCGCAGACC
CTACCTGTTGAACCTGGCTGATCGTAGGATCCCCGGCCAGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCA
GAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCATAGTCCCGCCCCTAACTCCGCCCATCCCGCCCC
TAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCATGGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGG
CCGCCTCGGCCTCTGAGCTATTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGGCTTTTGCAAAAAGC
TTGATTCTTCTGACACAACAGTCTCGAACTTAAGGCTAGAGCCACCATGATTGAACAAGATGGATTGCACGC
AGGTTCTCCGGCCGCTTGGGTGGAGAGGCTATTCGGCTATGACTGGGCACAACAGACAATCGGCTGCTCTGA
TGCCGCCGTGTTCCGGCTGTCAGCGCAGGGGCGCCCGGTTCTTTTTGTCAAGACCGACCTGTCCGGTGCCCT
GAATGAACTGCAGGACGAGGCAGCGCGGCTATCGTGGCTGGCCACGACGGGCGTTCCTTGCGCAGCTGTGCT
CGACGTTGTCACTGAAGCGGGAAGGGACTGGCTGCTATTGGGCGAAGTGCCGGGGCAGGATCTCCTGTCATC
TCACCTTGCTCCTGCCGAGAAAGTATCCATCATGGCTGATGCAATGCGGCGGCTGCATACGCTTGATCCGGC
TACCTGCCCATTCGACCACCAAGCGAAACATCGCATCGAGCGAGCACGTACTCGGATGGAAGCCGGTCTTGT
CGATCAGGATGATCTGGACGAAGAGCATCAGGGGCTCGCGCCAGCCGAACTGTTCGCCAGGCTCAAGGCGCG
CATGCCCGACGGCGAGGATCTCGTCGTGACCCATGGCGATGCCTGCTTGCCGAATATCATGGTGGAAAATGG
CCGCTTTTCTGGATTCATCGACTGTGGCCGGCTGGGTGTGGCGGACCGCTATCAGGACATAGCGTTGGCTAC
CCGTGATATTGCTGAAGAGCTTGGCGGCGAATGGGCTGACCGCTTCCTCGTGCTTTACGGTATCGCCGCTCC
CGATTCGCAGCGCATCGCCTTCTATCGCCTTCTTGACGAGTTCTTCTGAGCGGGACTCTGGGGTTCGAAATG
ACCGACCAAGCGACGCCCAACCTGCCATCACGATGGCCGCAATAAAATATCTTTATTTTCATTACATCTGTG
TGTTGGTTTTTTGTGTGAATCGATAGCGATAAGGATCGATCCGCGTATGGTGCACTCTCAGTACAATCTGCT
CTGATGCCGCATAGTTAAGCCAGCCCCGACACCCGCCAACACCCGCTGACGCGCCCTGACGGGCTTGTCTGC
TCCCGGCATCCGCTTACAGACAAGCTGTGACCGTCTCCGGGAGCTGCATGTGTCAGAGGTTTTCACCGTCAT
CACCGAAACGCGCGAGACGAAAGGGCCTCGTGATACGCCTATTTTTATAGGTTAATGTCATGATAATAATGG
TTTCTTAGACGTCAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATAC
ATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTA
CA 02367488 2001-09-14
WO 00/56910 PCT/GB00/01091
TGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACC
CAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATC
TCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTC
TGCTATGTGGCGCGGTATTATCCCGTATTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTC
AGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTAT
GCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGG
AGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATG
AAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAA
CTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGAC
CACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTC
GCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTC
AGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGT
CAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGA
AGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCG
TAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAAC
CACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCA
GCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAG
CACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTA
CCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACAC
AGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGC
TTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGC
TTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTT
TGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCT
TTTGCTGGCCTTTTGCTCACATGGCTCGACAGATCT
SEQ ID NO. 3
See Figure 16
35
ao
=~5
