Note: Descriptions are shown in the official language in which they were submitted.
CA 02370609 2001-10-19
WO 00/63377 PCT/US00/10454
Description
ADIPOCYTE COMPLEMENT RELATED PROTEIN HOMOLOG ZACRP3
BACKGROUND OF THE INVENTION
Energy balance (involving energy metabolism,
nutritional state, lipid storage and the like) is an
important criteria for health. This energy homeostasis
involves food intake and metabolism of carbohydrates and
lipids to generate energy necessary for voluntary and
involuntary functions. Metabolism of proteins can lead to
energy generation, but preferably leads to muscle
formation or repair. Among other consequences, a lack of
energy homeostasis lead to over or under formation of
adipose tissue.
Formation and storage of fat is insulin
modulated. For example, insulin stimulates the transport
of glucose into cells, where it is metabolized into oc
glycerophosphate which is used in the esterification of
fatty acids to permit storage thereof as triglycerides.
In addition, adipocytes (fat cells) express a specific
transport protein that enhances the transfer of free fatty
acids into adipocytes.
Adipocytes also secrete several proteins
believed to modulate homeostatic control of glucose and
lipid metabolism. These additional adipocyte-secreted
proteins include adipsin, complement factors C3 and B,
tumor necrosis factor oc, the o~b gene product and Acrp30.
Evidence also exists suggesting the existence of an
insulin-regulated secretory pathway in adipocytes.
Scherer et al., J. Biol. Chem. 270 45 26746-9, 1995.
Over or under secretion of these moieties, impacted in
part by over or under formation of adipose tissue, can
lead to pathological conditions associated directly or
indirectly with obesity or anorexia.
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
2
Acrp30 is a 247 amino acid polypeptide that is
expressed exclusively by adipocytes. The Acrp30
polypeptide is composed of a amino-terminal signal
sequence, a 27 amino acid stretch of no known homology, 22
perfect Gly-Xaa-Pro or imperfect Gly-Xaa-Xaa collagen
repeats and a carboxy terminal globular domain. See,
Scherer et al. as described above and International Patent
Application No. WO 96/39429. Acrp30, an abundant human
serum protein regulated by insulin, shares structural
similarity, particularly in the carboxy-terminal globular
domain, to complement factor Clq and to a summer serum
protein of hibernating Siberian chipmunks (Hib27).
Expression of Acrp30 is induced over 100-fold during
adipocyte differentiation. Acrp30 is suggested for use in
modulating energy balance and in identifying adipocytes in
test samples.
Another secreted protein that appears to be
exclusively produced in adipocytes is apMl, described, for
example, in Maeda et al., Biochem. Biophys. Res. Comm
221: 286-9, 1996. A 4517 by clone had a 244 amino acid
open reading frame and a long 3' untranslated region. The
protein included a signal sequence, an amino-terminal non-
collagenous sequence, 22 collagen repeats (Gly-XAA-Pro or
Gly-Xaa-Xaa), and a carboxy-terminal region with homology
to collagen X, collagen VIII and complement protein Clq.
Complement factor Clq consists of six copies of
three related polypeptides (A, B and C chains), with each
polypeptide being about 225 amino acids long with a near
amino-terminal collagen domain and a carboxy-terminal
globular region. Six triple helical regions are formed by
the collagen domains of the six A, six B and six C chains,
forming a central region and six stalks . A globular head
portion is formed by association of the globular carboxy
terminal domain of an A, a B and a C chain. Clq is
therefore composed of six globular heads linked via six
collagen-like stalks to a central fibril region. Sellar
et al., Biochem. J. 274: 481-90, 1991. This configuration
WO 00/G3377 CA 02370609 2001-l0-19 PCT/US00/10454
3
is often referred to as a bouquet of flowers. Acrp30 has
a similar bouquet structure formed from a single type of
polypeptide chain.
Clq has been found to stimulate defense
mechanisms as well as trigger the generation of toxic
oxygen species that can cause tissue damage (Tenner,
Behrinq Inst. Mitt. 93:241-53, 1993). Clq binding sites
are found on platelets. Additionally complement and Clq
play a role in inflammation. The complement activation is
initiated by binding of Clq to immunoglobulins
Inhibitors of Clq and the complement pathway
would be useful for anti-inflammatory applications,
inhibition of complement activation and thrombotic
activity.
The present invention provides such polypeptides
for these and other uses that should be apparent to those
skilled in the art from the teachings herein.
SUMMARY OF THE INVENTION
Within one aspect, the invention provides an
isolated polypeptide comprising a sequence of amino acid
residues that is at least 75% identical in amino acid
sequence to residues 51-246 of SEQ ID N0:2, wherein the
sequence comprises: Gly-Xaa-Xaa or Gly-Xaa-Pro repeats
forming a collagen domain, wherein Xaa is any amino acid;
and a carboxyl-terminal Clq domain comprising 10 beta
strands. Within one embodiment the polypeptide that is at
least 90o identical in amino acid sequence to residues
23-246 of SEQ ID N0:2. Within another embodiment the
collagen domain consists of 15 Gly-Xaa-Xaa repeats and 6
Gly-Xaa-Pro repeats. Within another embodiment the
carboxyl-terminal Clq domain comprises the sequence of SEQ
ID NO:10. Within another embodiment the carboxy-terminal
Clq domain comprises amino acid residues 119-123, 140-142,
148-151, 155,-158, 161-173, 175-182, 190-197, 200-212, 217-
222 and 236-241 of SEQ ID N0:2. Within another embodiment
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
4
any differences between the polypeptide and SEQ ID N0:2
are due to conservative amino acid substitutions. Within
another embodiment the polypeptide specifically binds with
an antibody that specifically binds with a polypeptide
consisting of the amino acid sequence of SEQ ID N0:2.
Within still another embodiment the polypeptide comprises
residues 23-246 of SEQ ID N0:2. Within another embodiment
the collagen domain consists of amino acid residues 51-113
of SEQ ID N0:2. Within yet another embodiment the Clq
domain consists of amino acid residues 114-246 of SEQ ID
N0:2. Within another embodiment the polypeptide is
covalently linked at the amino or carboxyl terminus to a
moiety selected from the group consisting of affinity
tags, toxins, radionucleotides, enzymes and fluorophores.
Also provided is an isolated polypeptide
selected from the group consisting of: a) a polypeptide
consisting of a sequence of amino acid residues that is
80% identical in amino acid sequence to amino acid residue
51 to amino acid residue 113 of SEQ ID N0:2, the
polypeptide consisting of Gly-Xaa-Xaa and Gly-Xaa-Pro
repeats forming a collagen domain; b) a polypeptide
consisting of a sequence of amino acid residues that is
80o identical in amino acid sequence to amino acid residue
114 to amino acid residue 246 of SEQ ID N0:2 comprising
the sequence of SEQ ID N0:5; and c) a polypeptide
consisting of a sequence of amino acid residues that is
80% identical in amino acid sequence to amino acid residue
51 to 246 of SEQ ID N0:2, the polypeptide consisting of
Gly-Xaa-Xaa and Gly-Xaa-Pro repeats forming a collagen
domain and comprising the sequence of SEQ ID N0:5.
Within another aspect is provided a fusion
protein comprising a first portion and a second portion
joined by a peptide bond, the first portion consisting of
a polypeptide selected from the group consisting of: a) a
polypeptide comprising a sequence of amino acid residues
that is at least 75% identical in amino acid sequence to
amino acid residue 51 to amino acid residue 246 of SEQ ID
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
N0:2; b) a polypeptide comprising a sequence of amino acid
residues as shown in SEQ ID N0:2 from amino acid residue 1
to amino acid residue 246; c) a portion of the zacrp3
polypeptide of SEQ ID N0:2, comprising the collagen-like
5 domain or a portion of the collagen-like domain capable of
dimerization or oligomerization; d) a portion of the
zacrp3 polypeptide of SEQ ID N0:2, comprising the Clq
domain or an active portion of the Clq domain; or e) a
portion of the zacrp3 polypeptide of SEQ ID N0:2
comprising of the collagen-like domain and the Clq domain;
and the second portion comprising another polypeptide.
Within one embodiment the first portion is selected from
the group consisting of: a) a polypeptide consisting of
the sequence of amino acid residue 51 to amino acid
residue 113 of SEQ ID N0:2; b) a polypeptide consisting of
the sequence of amino acid residue 114 to amino acid
residue 246 of SEQ ID N0:2; c) a polypeptide consisting of
the sequence of amino acid residue 51 to 246 of SEQ ID
N0:2.
The invention also provides a polypeptide as
described above; in combination with a pharmaceutically
acceptable vehicle.
Within another aspect, the invention provides an
antibody or antibody fragment that specifically binds to a
polypeptide as described above. Within one embodiment the
antibody is selected from the group consisting of: a)
polyclonal antibody; b) murine monoclonal antibody; c)
humanized antibody derived from b); and d) human
monoclonal antibody. Within another embodiment the
antibody fragment is selected from the group consisting of
F(ab'), F(ab), Fab', Fab, Fv, scFv, and minimal
recognition unit. Within another embodiment is provided
an anti-idiotype antibody that specifically binds to the
antibody described above.
Within another aspect, the invention provides an
isolated polynucleotide encoding a polypeptide comprising
a sequence of amino acid residues that is at least 75%
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
6
identical in amino acid sequence to residues 51-246 of SEQ
ID N0:2, wherein the sequence comprises: Gly-Xaa-Xaa or
Gly-Xaa-Pro repeats forming a collagen domain, wherein Xaa
is any amino acid; and a carboxyl-terminal Clq domain
consisting of 10 beta strands. Within one embodiment the
polypeptide is at least 90% identical in amino acid
sequence to residues 23-246 of SEQ ID N0:2. Within
another embodiment the collagen domain consists of 15 Gly-
Xaa-Xaa repeats and 6 Gly-Xaa-Pro repeats. Within another
embodiment the carboxyl-terminal Clq domain comprises the
sequence of SEQ ID N0:5. Within another embodiment the
carboxy-terminal Clq domain consists of amino acid
residues 119-123, 140-142, 148-151, 155-158, 161-173, 175-
182, 190-197, 200-212, 217-222 and 236-241 of SEQ ID N0:2.
Within another embodiment any differences between the
polypeptide and SEQ ID N0:2 are due to conservative amino
acid substitutions. Within yet another embodiment the
polypeptide specifically binds with an antibody that
specifically binds with a polypeptide consisting of the
amino acid sequence of SEQ ID N0:2. Within another
embodiment the polypeptide comprises residues 23-246 of
SEQ ID N0:2. Within another embodiment the collagen
domain consists of amino acid residues 51-113 of SEQ ID
N0:2. Within yet another embodiment the Clq domain
consists of amino acid residues 114-246 of SEQ ID N0:2.
Also provided is an isolated polynucleotide
selected from the group consisting of: a) a sequence of
nucleotides from nucleotide 1 to nucleotide 1696 of SEQ ID
NO:1; b) a sequence of nucleotides from nucleotide 69 to
nucleotide 806 of SEQ ID NO:1; c) a sequence of
nucleotides from nucleotide 135 to nucleotide 806 of SEQ
ID NO:1; d) a sequence of nucleotides from nucleotide 219
to nucleotide 806 of SEQ ID NO:1; e) a sequence of
nucleotides from nucleotide 408 to nucleotide 806 of SEQ
ID NO:l; f) a sequence of nucleotides from nucleotide 69
to nucleotide 407 of SEQ ID NO:1; g) a sequence of
nucleotides from nucleotide 135 to nucleotide 407 of SEQ
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
7
ID NO:1; h) a sequence of nucleotides from nucleotide 219
to nucleotide 407 of SEQ ID NO:1; i) a polynucleotide
encoding a polypeptide, the polypeptide consisting of a
sequence of amino acid residues that is at least 750
identical to a polypeptide consisting of the amino acid
sequence of residues 51 to 113 of SEQ ID N0:2; j) a
polynucleotide encoding a polypeptide, the polypeptide
consisting of a sequence of amino acid residues that is at
least 75% identical to a polypeptide consisting of the
amino acid sequence of residues 114 to 246 of SEQ ID N0:2;
k) a polynucleotide encoding a polypeptide, the
polypeptide consisting of a sequence of amino acid
residues that is at least 75% identical to a polypeptide
consisting of the amino acid sequence of residues 51 to
246 of SEQ ID N0:2; 1) a polynucleotide encoding a
polypeptide consisting of a sequence of amino acid
residues that is at least 75% identical to a polypeptide
consisting of the amino acid sequence of residues 23 to
113 of SEQ ID N0:2; m) a polynucleotide that remains
hybridized following stringent wash conditions to a
polynucleotide consisting of the nucleotide sequence of
SEQ ID NO:1, or the complement of SEQ ID NO:1; n)
nucleotide sequences complementary to a), b), c), d), e),
f), g), h), i), j), k), 1) or m) and o) degenerate
nucleotide sequences of i), j), k) or 1).
Also provided is an isolated polynucleotide
encoding a fusion protein comprises a first portion and a
second portion joined by a peptide bond, the first portion
is selected from the group consisting of: a) a polypeptide
comprising a sequence of amino acid residues that is at
least 75% identical in amino acid sequence to amino acid
residues 51 to 246 of SEQ ID N0:2; b) a polypeptide
comprising the sequence of amino acid residues 1 to 246 of
SEQ ID N0:2; c) a polypeptide comprising the sequence of
amino acid residues 23 to 246 of SEQ ID N0:2; d) a
polypeptide comprising the sequence of amino acid residues
23 to 113 of SEQ ID N0:2; e) a polypeptide comprising the
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
8
sequence of amino acid residues 1 to 113 of SEQ ID N0:2;
f) a portion of a polypeptide of SEQ ID N0:2 comprising
the collagen-like domain or a portion of the collagen-like
domain capable of dimerization or oligomerization; g) a
portion of the polypeptide of SEQ ID N0:2 containing the
Clq domain; or h) a portion of the polypeptide of SEQ ID
N0:2 including the collagen-like domain and the Clq
domain; and the second portion comprising another
polypeptide.
Also provided is an isolated polynucleotide
consisting of the sequence of nucleotide 1 to nucleotide
738 of SEQ ID NO:10.
Within another aspect, the invention provides an
expression vector comprising the following operably linked
elements: a transcription promoter; a DNA segment encoding
a polypeptide as described above; and a transcription
terminator. Within one embodiment the DNA segment encodes
a polypeptide that is at least 90o identical in amino acid
sequence to residues 23-246 of SEQ ID N0:2. Within
another embodiment the collagen domain consists of 15 Gly-
Xaa-Xaa repeats and 6 Gly-Xaa-Pro repeats. Within another
embodiment the carboxyl-terminal Clq domain comprises the
sequence of SEQ ID NO:10. Within another embodiment the
carboxy-terminal Clq domain consists of amino acid
residues 119-123, 140-142, 148-151, 155-158, 161-173, 175-
182, 190-197, 200-212, 217-222 and 236-241 of SEQ ID N0:2.
Within another embodiment differences between the
polypeptide and SEQ ID N0:2 are due to conservative amino
acid substitutions. Within yet another embodiment the
polypeptide specifically binds with an antibody that
specifically binds with a polypeptide consisting of the
amino acid sequence of SEQ ID N0:2. Within a further
embodiment the DNA segment encodes a polypeptide
comprising residues 23-246 of SEQ ID N0:2. Within another
embodiment the collagen domain consists of amino acid
residues 51-113 of SEQ ID N0:2. Within yet another
embodiment the C1q domain consists of amino acid residues
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
9
114-246 of SEQ ID N0:2. Within yet another embodiment the
DNA segment encodes a polypeptide covalently linked at the
amino or carboxyl terminus to an affinity tag. Within
another embodiment the DNA segment further encodes a
secretory signal sequence operably linked to the
polypeptide. Within a related embodiment the secretory
signal sequence comprises residues 1-22 of SEQ ID N0:2.
Within another aspect, the invention provides a
cultured cell into which has been introduced an expression
vector as described above, wherein the cell expresses the
polypeptide encoded by the DNA segment.
Within another aspect, the invention provides a
method of producing a polypeptide comprising: culturing a
cell into which has been introduced an expression vector
as describe above; whereby the cell expresses the
polypeptide encoded by the DNA segment; and recovering the
expressed polypeptide.
BRIEF DESCRIPTION OF THE DRAWING
The Figure illustrates a multiple alignment of
and zacrp3 polypeptide of the present invention and human
ACRP30 (ACR3) (SEQ ID N0:3, Maeda et al., Biochem.
Biophys. Res. Commun. 221:286-9, 1996) and human Clq C
(SEQ ID N0:4, Sellar et al., Biochem J. 274:481-90, 1991
and Reid, Biochem J. 179:361-71, 1979). The multiple
alignment performed using a Clustalx multiple alignment
tool with the default settings: Blosum Series Weight
Matricies, Gap Opening penalty:10.0, Gap Extension
penalty:0.05. Multiple alignments were further hand tuned
before computing percent identity.
DETAILED DESCRIPTION OF THE INVENTION
Prior to setting forth the invention in detail,
it may be helpful to the understanding thereof to define
the following terms.
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
The term "affinity tag" is used herein to denote
a peptide segment that can be attached to a polypeptide to
provide for purification or detection of the polypeptide
or provide sites for attachment of the polypeptide to a
5 substrate. In principal, any peptide or protein for which
an antibody or other specific binding agent is available
can be used as an affinity tag. Affinity tags include a
poly-histidine tract, protein A (Nilsson et al., EMBO J.
4:1075, 1985; Nilsson et al., Methods Enzymol. 198:3,
10 1991), glutathione S transferase (Smith and Johnson, Gene
67:31, 1988), substance P, FlagTM peptide (Hope et al.,
Biotechnoloay 6:1204-10, 1988; available from Eastman
Kodak Co., New Haven, CT), streptavidin binding peptide,
or other antigenic epitope or binding domain. See, in
general Ford et al., Protein Expression and Purification
2: 95-107, 1991. DNAs encoding affinity tags are
available from commercial suppliers (e. g., Pharmacia
Biotech, Piscataway, NJ).
The term "allelic variant" denotes any of two or
more alternative forms of a gene occupying the same
chromosomal locus. Allelic variation arises naturally
through mutation, and may result in phenotypic
polymorphism within populations. Gene mutations can be
silent (no change in the encoded polypeptide) or may
encode polypeptides having altered amino acid sequence.
The term allelic variant is also used herein to denote a
protein encoded by an allelic variant of a gene.
The terms "amino-terminal" and "carboxyl
terminal" are used herein to denote positions within
polypeptides and proteins. Where the context allows,
these terms are used with reference to a particular
sequence or portion of a polypeptide or protein to denote
proximity or relative position. For example, a certain
sequence positioned carboxyl-terminal to a reference
sequence within a protein is located proximal to the
carboxyl terminus of the reference sequence, but is not
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
11
necessarily at the carboxyl terminus of the complete
protein.
The term "complement/anti-complement pair"
denotes non-identical moieties that form a non-covalently
associated, stable pair under appropriate conditions. For
instance, biotin and avidin (or streptavidin) are
prototypical members of a complement/anti-complement pair.
Other exemplary complement/anti-complement pairs include
receptor/ligand pairs, antibody/antigen (or hapten or
epitope) pairs, sense/antisense polynucleotide pairs, and
the like. Where subsequent dissociation of the
complement/anti-complement pair is desirable, the
complement/anti-complement pair preferably has a binding
affinity of <109 M 1.
The term "complements of a polynucleotide
molecule" is a polynucleotide molecule having a
complementary base sequence and reverse orientation as
compared to a reference sequence. For example, the
sequence 5' ATGCACGGG 3' is complementary to 5' CCCGTGCAT
3'.
The term "contig" denotes a polynucleotide that
has a contiguous stretch of identical or complementary
sequence to another polynucleotide. Contiguous sequences
are said to "overlap" a given stretch of polynucleotide
sequence either in their entirety or along a partial
stretch of the polynucleotide. For example,
representative contigs to the polynucleotide sequence 5'-
ATGGCTTAGCTT-3' are 5'-TAGCTTgagtct-3' and 3'-
gtcgacTACCGA-5'.
The term "degenerate nucleotide sequence"
denotes a sequence of nucleotides that includes one or
more degenerate codons (as compared to a reference
polynucleotide molecule that encodes a polypeptide).
Degenerate codons contain different triplets of
nucleotides, but encode the same amino acid residue (i.e.,
GAU and GAC triplets each encode Asp).
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
12
The term "expression vector" denotes a DNA
molecule, linear or circular, that comprises a segment
encoding a polypeptide of interest operably linked to
additional segments that provide for its transcription.
Such additional segments may include promoter and
terminator sequences, and may optionally include one or
more origins of replication, one or more selectable
markers, an enhancer, a polyadenylation signal, and the
like. Expression vectors are generally derived from
plasmid or viral DNA, or may contain elements of both.
The term "isolated", when applied to a
polynucleotide, denotes that the polynucleotide has been
removed from its natural genetic milieu and is thus free
of other extraneous or unwanted coding sequences, and is
in a form suitable for use within genetically engineered
protein production systems. Such isolated molecules are
those that are separated from their natural environment
and include cDNA and genomic clones. Isolated DNA
molecules of the present invention are free of other genes
with which they are ordinarily associated, but may include
naturally occurring 5' and 3' untranslated regions such as
promoters and terminators. The identification of
associated regions will be evident to one of ordinary
skill in the art (see for example, Dynan and Tijan, Nature
316:774-78, 1985).
An "isolated" polypeptide or protein is a
polypeptide or protein that is found in a condition other
than its native environment, such as apart from blood and
animal tissue. In a preferred form, the isolated
polypeptide is substantially free of other polypeptides,
particularly other polypeptides of animal origin. It is
preferred to provide the polypeptides in a highly purified
form, i.e. greater than 95% pure, more preferably greater
than 99% pure. When used in this context, the term
"isolated" does not exclude the presence of the same
polypeptide in alternative physical forms, such as dimers
or alternatively glycosylated or derivatized forms.
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
13
The term "operably linked", when referring to
DNA segments, denotes that the segments are arranged so
that they function in concert for their intended purposes,
e.g. transcription initiates in the promoter and proceeds
through the coding segment to the terminator.
The term "ortholog" denotes a polypeptide or
protein obtained from one species that is the functional
counterpart of a polypeptide or protein from a different
species. Sequence differences among orthologs are the
result of speciation.
"Paralogs" are distinct but structurally related
proteins made by an organism. Paralogs are believed to
arise through gene duplication. For example, oc-globin, (3-
globin, and myoglobin are paralogs of each other.
The term "polynucleotide" denotes a single- or
double-stranded polymer of deoxyribonucleotide or
ribonucleotide bases read from the 5' to the 3' end.
Polynucleotides include RNA and DNA, and may be isolated
from natural sources, synthesized in vitro, or prepared
from a combination of natural and synthetic molecules.
Sizes of polynucleotides are expressed as base pairs
(abbreviated "bp"), nucleotides ("nt"), or kilobases
("kb"). Where the context allows, the latter two terms
may describe polynucleotides that are single-stranded or
double-stranded. When the term is applied to double-
stranded molecules it is used to denote overall length and
will be understood to be equivalent to the term " base
pairs ". It will be recognized by those skilled in the
art that the two strands of a double-stranded
polynucleotide may differ slightly in length and that the
ends thereof may be staggered as a result of enzymatic
cleavage; thus all nucleotides within a double-stranded
polynucleotide molecule may not be paired. Such unpaired
ends will in general not exceed 20 nt in length.
A "polypeptide" is a polymer of amino acid
residues joined by peptide bonds, whether produced
naturally or synthetically. Polypeptides of less than
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
14
about 10 amino acid residues are commonly referred to as
"peptides".
"Probes and/or primers" as used herein can be
RNA or DNA. DNA can be either cDNA or genomic DNA.
Polynucleotide probes and primers are single or double
stranded DNA or RNA, generally synthetic oligonucleotides,
but may be generated from cloned cDNA or genomic sequences
or its complements. Analytical probes will generally be
at least 20 nucleotides in length, although somewhat
shorter probes (14-17 nucleotides) can be used. PCR
primers are at least 5 nucleotides in length, preferably
or more nt, more preferably 20-30 nt. Short
polynucleotides can be used when a small region of the
gene is targeted for analysis. For gross analysis of
15 genes, a polynucleotide probe may comprise an entire exon
or more. Probes can be labeled to provide a detectable
signal, such as with an enzyme, biotin, a radionuclide,
fluorophore, chemiluminescer, paramagnetic particle and
the like, which are commercially available from many
sources, such as Molecular Probes, Inc., Eugene, OR, and
Amersham Corp., Arlington Heights, IL, using techniques
that are well known in the art.
The term "promoter" denotes a portion of a gene
containing DNA sequences that provide for the binding of
RNA polymerase and initiation of transcription. Promoter
sequences are commonly, but not always, found in the 5'
non-coding regions of genes.
The term "receptor" denotes a cell-associated
protein that binds to a bioactive molecule (i.e., a
ligand) and mediates the effect of the ligand on the cell.
Membrane-bound receptors are characterized by a multi-
domain structure comprising an extracellular ligand-
binding domain and an intracellular effector domain that
is typically involved in signal transduction. Binding of
ligand to receptor results in a conformational change in
the receptor that causes an interaction between the
effector domain and other molecules) in the cell. This
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
interaction in turn leads to an alteration in the
metabolism of the cell. Metabolic events that are linked
to receptor-ligand interactions include gene
transcription, phosphorylation, dephosphorylation,
5 increases in cyclic AMP production, mobilization of
cellular calcium, mobilization of membrane lipids, cell
adhesion, hydrolysis of inositol lipids and hydrolysis of
phospholipids. Most nuclear receptors also exhibit a
multi-domain structure, including an amino-terminal,
10 transactivating domain, a DNA binding domain and a ligand
binding domain. In general, receptors can be membrane
bound, cytosolic or nuclear; monomeric (e. g., thyroid
stimulating hormone receptor, beta-adrenergic receptor) or
multimeric (e. g., PDGF receptor, growth hormone receptor,
15 IL-3 receptor, GM-CSF receptor, G-CSF receptor,
erythropoietin receptor and IL-6 receptor).
The term "secretory signal sequence" denotes a
DNA sequence that encodes a polypeptide (a "secretory
peptide") that, as a component of a larger polypeptide,
directs the larger polypeptide through a secretory pathway
of a cell in which it is synthesized. The larger peptide
is commonly cleaved to remove the secretory peptide during
transit through the secretory pathway.
A "soluble receptor" is a receptor polypeptide
that is not bound to a cell membrane. Soluble receptors
are most commonly ligand-binding receptor polypeptides
that lack transmembrane and cytoplasmic domains. Soluble
receptors can comprise additional amino acid residues,
such as affinity tags that provide for purification of the
polypeptide or provide sites for attachment of the
polypeptide to a substrate, or immunoglobulin constant
region sequences. Many cell-surface receptors have
naturally occurring, soluble counterparts that are
produced by proteolysis or translated from alternatively
spliced mRNAs. Receptor polypeptides are said to be
substantially free of transmembrane and intracellular
polypeptide segments when they lack sufficient portions of
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
16
these segments to provide membrane anchoring or signal
transduction, respectively.
The term "splice variant" is used herein to
denote alternative forms of RNA transcribed from a gene.
Splice variation arises naturally through use of
alternative splicing sites within a transcribed RNA
molecule, or less commonly between separately transcribed
RNA molecules, and may result in several mRNAs transcribed
from the same gene. Splice variants may encode
polypeptides having altered amino acid sequence. The term
splice variant is also used herein to denote a protein
encoded by a splice variant of an mRNA transcribed from a
gene.
Molecular weights and lengths of polymers
determined by imprecise analytical methods (e.g., gel
electrophoresis) will be understood to be approximate
values. When such a value is expressed as "about" X or
"approximately" X, the stated value of X will be
understood to be accurate to ~10%.
The present invention is based in part upon the
discovery of a novel DNA sequence that encodes a
polypeptide having homology to an adipocyte complement
related protein (Acrp30). The novel DNA sequence encodes
a polypeptide having an amino-terminal signal sequence, an
adjacent N-terminal region of non-homology, a collagen
domain composed of 21 Gly-Xaa-Xaa or Gly-Xaa-Pro repeats
and a carboxy-terminal globular-like Clq domain followed
by a long 3' untranslated region. The general polypeptide
structure set forth above is shared by Acrp30 and Clq C.
Other regions of homology, found in the carboxy-terminal
globular Clq domain in the aligned proteins, are
identified herein as useful primers for searching for
other family members. Acrp30 and Clq C, for example,
would be identified in a search using the primers. Intra-
chain disulfide bonding may involve the cysteines at
residues 39, 42 and 43 of SEQ ID N0:2.
WO 00/63377 CA 02370609 2001-10-19 pCT/US00/10454
17
The novel zacrp3 polypeptides of the present
invention were initially identified by querying an EST
database for homologs of ACRP30, characterized by a signal
sequence, a collagen-like domain and a Clq domain.
Polypeptides corresponding to ESTs meeting those search
criteria were compared to known sequences to identify
proteins having homology to ACRP30. An assembled EST
cluster was discovered and predicted to be a secreted
protein. To identify the corresponding cDNA, a clone
considered likely to contain the entire coding sequence
was used for sequencing. The resulting 1696 by sequence is
disclosed in SEQ ID NO:1. Comparison of the originally
derived EST sequence with the sequence represented in SEQ
ID NO:1 showed that there were two frame shifts and an
unspliced intron. The novel polypeptide encoded by the
full length cDNA enabled the identification of a homolog
relationship with adipocyte complement related protein
Acrp30 (SEQ ID N0:3) and complement component Clq C (SEQ
ID N0:4) as is shown in the Figure. Zacrp3 shares 27.5 and
25.7% identity at the amino acid level with human ACRP30
and Clq C respectfully. Clq C and ACRP30 share 32.4%
identity. Within the Clq domain, zacrp3 shares 26.3 and
26% identity at the amino acid level when compared to
human ACRP30 and Clq C respectfully. Clg C and ACRP30
share 38.2% identity over this region.
The full sequence of the zacrp3 polypeptide was
obtained from a single clone believed to contain it,
wherein the clone was obtained from a chest wall soft
tissue library. This message was also found using
electronic searches, in libraries of connective tissues,
digestive, skeletal, respiratory and nervous system
tissues as well as urinary tract tissues.
The nucleotide sequence of zacrp3 is described
in SEQ ID NO:1, and its deduced amino acid sequence is
described in SEQ ID N0:2. As described generally above,
the zacrp3 polypeptide includes a signal sequence, ranging
from amino acid 1 (Met) to amino acid residue 22 (Cys).
WO 00/63377 CA 02370609 2001-10-19 pCT/US00/10454
18
The mature polypeptide therefore ranges from amino acid 23
(Gln) to amino acid 246 (Lys). Within the mature
polypeptide, an N-terminal region of no known homology is
found, ranging between amino acid residue 23 (Gln) and 50
(Arg) of SEQ ID N0:2. In addition, a collagen-like domain
is found between amino acid 51 (Gly) and 113 (Pro). In
the collagen-like domain, 6 perfect Gly-Xaa-Pro and 15
imperfect Gly-Xaa-Xaa repeats are observed. Acrp30
contains 22 perfect or imperfect repeats. Proline
residues found in this domain at amino acid residue 56,
59, 62 and 113 of SEQ ID N0:2 may be hydroxylated. The
zacrp3 polypeptide also includes a carboxy-terminal Clq
domain, ranging from about amino acid 114 (Pro) to 246
(Lys). There is a fair amount of conserved structure
within the Clq domain to enable proper folding. An
aromatic motif seen in all Clq domain containing proteins
( F-X ( 5 ) - [ND] -X ( 4 ) - [FYWL] -X ( 6 ) -F-X ( 5 ) -G-X-Y-X-F-X- [FY] (
SEQ
ID N0:5) is found between residues 169 and 199 of SEQ ID
N0:2. X represents any amino acid residue and the number
in parentheses () indicates the amino acid number of
residues. The amino acid residues contained within the
square parentheses [] restrict the choice of amino acid
residues at that particular position. Zacrp3 polypeptide,
human Clq C and Acrp30 appear to be homologous within the
collagen domain and in the Clq domain, but not in the N-
terminal portion of the mature polypeptide.
Another aspect of the present invention includes
zacrp3 polypeptide fragments. Preferred fragments include
those containing the collagen-like domain of zacrp3
polypeptides, ranging from amino acid 1 (Met), 23 (Gln) or
51 (Gly) to amino acid 1113 (Pro) of SEQ ID N0:2, a
portion of the zacrp3 polypeptide containing the collagen-
like domain or a portion of the collagen-like domain
capable of dimerization or oligomerization. As used
herein the term "collagen" or "collagen-like domain"
refers to a series of repeating triplet amino acid
sequences, "repeats" or "collagen repeats" represented by
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
19
the motifs Gly-Xaa-Pro or Gly-Xaa-Xaa, where Xaa is any
amino acid reside. Such domains may contain as many as
21 collagen repeats or more. Fragments or proteins
containing such collagen-like domains may form homomeric
constructs (dimers or oligomers of the same fragment or
protein). Moreover, such fragments or proteins containing
such collagen-like domains may form heteromeric
constructs, usually trimers.
These fragments are particularly useful in the
study of collagen dimerization or oligomerization or in
formation of fusion proteins as described more fully
below. Polynucleotides encoding such fragments are also
encompassed by the present invention, including the group
consisting of (a) polynucleotide molecule comprising a
sequence of nucleotides as shown in SEQ ID NO:1 from
nucleotide 1, 69, 135 or 219 to nucleotide 407; (b)
polynucleotide molecules that encode a zacrp3 polypeptide
fragment that is at least 80% identical to the amino acid
sequence of SEQ ID N0:2 from amino acid residue 51 (Gly)
to amino acid residue 113 (Pro); (c) molecules
complementary to (a) or (b); and (d) degenerate nucleotide
sequences encoding a zacrp3 polypeptide collagen-like
domain fragment.
Other preferred fragments include the globular
Clq domain of zacrp3 polypeptides, ranging from amino acid
114 (Pro) to 246 (Lys) of SEQ ID N0:2, a portion of the
zacrp3 polypeptide containing the Clq domain or an active
portion of the Clq domain. Other Clq domain containing
proteins include Clq A, B and C (Sellar et al., ibid.,
Reid, ibid., and Reid et al., Biochem. J. 203: 559-69,
1982), chipmunk hibernation-associated plasma proteins HP-
20, HP-25 and HP-27 (Takamatsu et al., Mol. Cell. Biol
13: 1516-21, 1993 and Kondo & Kondo, J. Biol. Chem. 267:
473-8, 1992), human precerebellin (Urade et al., Proc.
Natl. Acad. Sci. USA 88:1069-73, 1991), human endothelial
cell multimerin (Hayward et al., J. Biol. Chem. 270:18246
51, 1995) and vertebrate collagens type VIII and X
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
(Muragaki et al., Eur. J. Biochem. 197:615-22, 1991). The
globular Clq domain of ACRP30 has been determined to have
a 10 beta strand "jelly roll" topology (Shapiro and
Scherer, Curr. Biol. 8:335-8, 1998) that shows significant
5 homology to the TNF family and the zacrp3 sequence as
represented by SEQ ID N0:2 contains all 10 beta-strands of
this structure (amino acid residues 119-123, 140-142,
148-151, 155-158, 161-173, 175-182, 190-197, 200-212, 217-
222 and 236-241 of SEQ ID N0:2) . These strands have been
10 designated "A" , "A, " ~ "B" ~ "B. ~~ ~ '.C.. ~ "D.. ~ "E.~ ~ .'F.. ~ "G..
and "H" respectively.
Zacrp3 has two receptor binding loops, at amino
acid residues 111-139 and 170-182, does zacrp3 have
anything similar. The core receptor binding region is
15 predicted to include amino acid residues 124-150 and 181-
197 of SEQ ID N0:2. Amino acid residues 161 (Gly), 163
(Tyr), 212 (Leu) and 237 (Phe) appear to be conserved
across the superfamily including CD40, TNFOC, ACRP30 and
zacrp3.
20 These fragments are particularly useful in the
study or modulation of energy balance or
neurotransmission, particularly diet- or stress-related
neurotransmission. Anti-microbial activity may also be
present in such fragments. The homology to TNF proteins
suggests such fragments would be useful in obesity-related
insulin resistance, immune regulation, inflammatory
response, apoptosis and osteoclast maturation.
Polynucleotides encoding such fragments are also
encompassed by the present invention, including the group
consisting of (a) polynucleotide molecules comprising a
sequence of nucleotides as shown in SEQ ID NO:1 from
nucleotide 408 to nucleotide 806; (b) polynucleotide
molecules that encode a zacrp3 polypeptide fragment that
is at least 80% identical to the amino acid sequence of
SEQ ID N0:2 from amino acid residue 114 (Pro) to amino
acid residue 246 (Lys); (c) molecules complementary to (a)
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
21
or (b); and (d) degenerate nucleotide sequences encoding a
zacrp3 polypeptide Clq domain fragment.
Other zacrp3 polypeptide fragments of the
present invention include both the collagen-like domain
and the Clq domain ranging from amino acid residue 51
(Gly) to 806 (Lys) of SEQ ID N0:2. Polynucleotides
encoding such fragments are also encompassed by the
present invention, including the group consisting of (a)
polynucleotide molecules comprising a sequence of
nucleotides as shown in SEQ ID NO:l from nucleotide 291 to
nucleotide 806; (b) polynucleotide molecules that encode a
zacrp3 polypeptide fragment that is at least 80o identical
to the amino acid sequence of SEQ ID N0:2 from amino acid
residue 41 (Gly) to amino acid residue 246 (Lys); (c)
molecules complementary to (a) or (b); and (d) degenerate
nucleotide sequences encoding a zacrp3 polypeptide
collagen-like domain-Clq domain fragment.
The highly conserved amino acids, particularly
those in the carboxy-terminal Clq domain of the zacrp3
polypeptide, can be used as a tool to identify new family
members. For instance, reverse transcription-polymerase
chain reaction (RT-PCR) can be used to amplify sequences
encoding the conserved motifs from RNA obtained from a
variety of tissue sources. In particular, highly
degenerate primers and their complements designed from
conserved sequences are useful for this purpose. In
particular, the following primers are useful for this
purpose:
Amino acid residues 215-221 of SEQ ID N0:2
GGN GAN SAR GTN TGG YT (SEQ ID N0:6)
Amino acid residues 160-165 of SEQ ID N0:2
SN GNN NTN TAY TV~IY TTY R (SEQ ID N0:7)
Amino acid residues 237-242 of SEQ ID N0:2
TTY DSN GGN TTY YTN HT (SEQ ID N0:8)
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
22
Amino acid residues 147-153 of SEQ ID N0:2
Y TWY RAY RBN WBN WSN GG (SEQ ID N0:9)
Probes corresponding to complements of the polynucleotides
set forth above are also encompassed.
The present invention also provides
polynucleotide molecules, including DNA and RNA molecules,
that encode the zacrp3 polypeptides disclosed herein.
Those skilled in the art will readily recognize that, in
view of the degeneracy of the genetic code, considerable
sequence variation is possible among these polynucleotide
molecules. SEQ ID NO:10 is a degenerate DNA sequence that
encompasses all DNAs that encode the zacrp3 polypeptide of
SEQ ID N0:2. Those skilled in the art will recognize that
the degenerate sequence of SEQ ID NO:10 also provides all
RNA sequences encoding SEQ ID N0:2 by substituting U for
T. Thus, zacrp3 polypeptide-encoding polynucleotides
comprising nucleotide 1 to nucleotide 738 of SEQ ID NO:10
and their RNA equivalents are contemplated by the present
invention. Table 1 sets forth the one-letter codes used
within SEQ ID NO:10 to denote degenerate nucleotide
positions. "Resolutions" are the nucleotides denoted by a
code letter. "Complement" indicates the code for the
complementary nucleotide(s). For example, the code Y
denotes either C or T, and its complement R denotes A or
G, A being complementary to T, and G being complementary
to C.
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
23
TABLE 1
Nucleotide Resolution Complement Resolution
A A T T
C C G G
G G C C
T T A A
R A~G Y CST
Y CST R A~G
M ABC K GET
K GET M ABC
S CMG S CMG
W ACT W ACT
H A~C~T D A~G~T
B C~G~T V A~C~G
V A~C~G B C~G~T
D A~G~T H A~C~T
N A~C~G~T N A~C~G~T
The degenerate codons used in SEQ ID NO:10,
encompassing all possible codons for a given amino acid,
are set forth in Table 2.
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
24
TABLE 2
One
Amino Letter Colons Degenerate
Acid Code Colon
Cys C TGC TGT TGY
Ser S AGC AGTTCATCC TCG TCT WSN
Thr T ACA ACCACGACT ACN
Pro P CCA CCCCCGCCT CCN
Ala A GCA GCCGCGGCT GCN
Gly G GGA GGCGGGGGT GGN
Asn N AAC AAT ,qp,Y
Asp D GAC GAT GAY
Glu E GAA GAG GAR
Gln Q CAA CAG CAR
His H CAC CAT CAY
Arg R AGA AGGCGACGC CGG CGT MGN
Lys K AAA AAG Ap,R
Met M ATG ATG
Ile I ATA ATCATT ATH
Leu L CTA CTCCTGCTT TTA TTG YTN
Val V GTA GTCGTGGTT GTN
Phe F TTC TTT ~Y
Tyr Y TAC TAT TAY
Trp W TGG TGG
Ter . TAA TAGTGA TRR
Asn~Asp B ~Y
Glu~Gln Z SAR
Any X NNN
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
One of ordinary skill in the art will appreciate
that some ambiguity is introduced in determining a
degenerate codon, representative of all possible codons
encoding each amino acid. For example, the degenerate
5 codon for serine (WSN) can, in some circumstances, encode
arginine (AGR), and the degenerate codon for arginine
(MGN) can, in some circumstances, encode serine (AGY). A
similar relationship exists between codons encoding
phenylalanine and leucine. Thus, some polynucleotides
10 encompassed by the degenerate sequence may encode variant
amino acid sequences, but one of ordinary skill in the art
can easily identify such variant sequences by reference to
the amino acid sequence of SEQ ID N0:2. Variant sequences
can be readily tested for functionality as described
15 herein.
One of ordinary skill in the art will also
appreciate that different species can exhibit
"preferential codon usage." In general, see, Grantham, et
al., Nuc. Acids Res. 8:1893-912, 1980; Haas, et al. Curr.
20 Biol. 6:315-24, 1996; Wain-Hobson, et al., Gene 13:355-64,
1981; Grosjean and Fiers, Gene 18:199-209, 1982; Holm,
Nuc. Acids Res. 14:3075-87, 1986; Ikemura, J. Mol. Biol.
158:573-97, 1982. As used herein, the term "preferential
codon usage" or "preferential codons" is a term of art
25 referring to protein translation codons that are most
frequently used in cells of a certain species, thus
favoring one or a few representatives of the possible
codons encoding each amino acid (See Table 2). For
example, the amino acid threonine (Thr) may be encoded by
ACA, ACC, ACG, or ACT, but in mammalian cells ACC is the
most commonly used codon; in other species, for example,
insect cells, yeast, viruses or bacteria, different Thr
codons may be preferential. Preferential codons for a
particular species can be introduced into the
polynucleotides of the present invention by a variety of
methods known in the art. Introduction of preferential
codon sequences into recombinant DNA can, for example,
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
26
enhance production of the protein by making protein
translation more efficient within a particular cell type
or species. Therefore, the degenerate codon sequence
disclosed in SEQ ID NO:10 serves as a template for
optimizing expression of polynucleotides in various cell
types and species commonly used in the art and disclosed
herein. Sequences containing preferential codons can be
tested and optimized for expression in various species,
and tested for functionality as disclosed herein.
The present invention further provides variant
polypeptides and nucleic acid molecules that represent
counterparts from other species (orthologs). These
species include, but are not limited to mammalian, avian,
amphibian, reptile, fish, insect and other vertebrate and
invertebrate species. Of particular interest are zacrp3
polypeptides from other mammalian species, including
murine, porcine, ovine, bovine, canine, feline, equine,
and other primate polypeptides. A murine zacrp2 homolog
(SEQ ID N0:12) has been identified. The polynucleotide
sequence encoding this murine zacrp2 polypeptide disclosed
in SEQ ID NO:11. Orthologs of human zacrp3 can be cloned
using information and compositions provided by the present
invention in combination with conventional cloning
techniques. For example, a cDNA can be cloned using mRNA
obtained from a tissue or cell type that expresses zacrp3
as disclosed herein. Suitable sources of mRNA can be
identified by probing northern blots with probes designed
from the sequences disclosed herein. A library is then
prepared from mRNA of a positive tissue or cell line.
An zacrp3-encoding cDNA can then be isolated by
a variety of methods, such as by probing with a complete
or partial human cDNA or with one or more sets of
degenerate probes based on the disclosed sequences. A
cDNA can also be cloned using the polymerase chain
reaction with primers designed from the representative
human zacrp3 sequences disclosed herein. Within an
additional method, the cDNA library can be used to
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
27
transform or transfect host cells, and expression of the
cDNA of interest can be detected with an antibody to
zacrp3 polypeptide. Similar techniques can also be
applied to the isolation of genomic clones.
Those skilled in the art will recognize that the
sequence disclosed in SEQ ID NO:1 represents a single
allele of human zacrp3, and that allelic variation and
alternative splicing are expected to occur. Allelic
variants of this sequence can be cloned by probing cDNA or
genomic libraries from different individuals according to
standard procedures. Allelic variants of the nucleotide
sequence shown in SEQ ID NO:1, including those containing
silent mutations and those in which mutations result in
amino acid sequence changes, are within the scope of the
present invention, as are proteins which are allelic
variants of SEQ ID N0:2. cDNA molecules generated from
alternatively spliced mRNAs, which retain the properties
of the zacrp3 polypeptide are included within the scope of
the present invention, as are polypeptides encoded by such
cDNAs and mRNAs. Allelic variants and splice variants of
these sequences can be cloned by probing cDNA or genomic
libraries from different individuals or tissues according
to standard procedures known in the art.
Within preferred embodiments of the invention,
the isolated nucleic acid molecules can hybridize under
stringent conditions to nucleic acid molecules having the
nucleotide sequence of SEQ ID NO:1 or to nucleic acid
molecules having a nucleotide sequence complementary to
SEQ ID NO:1. In general, stringent conditions are
selected to be about 5°C lower than the thermal melting
point (Tm) for the specific sequence at a defined ionic
strength and pH. The Tm is the temperature (under defined
ionic strength and pH) at which 50% of the target sequence
hybridizes to a perfectly matched probe.
A pair of nucleic acid molecules, such as DNA-
DNA, RNA-RNA and DNA-RNA, can hybridize if the nucleotide
sequences have some degree of complementarity. Hybrids can
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
28
tolerate mismatched base pairs in the double helix, but
the stability of the hybrid is influenced by the degree of
mismatch. The Tm of the mismatched hybrid decreases by 1°C
for every 1-1.5o base pair mismatch. Varying the
stringency of the hybridization conditions allows control
over the degree of mismatch that will be present in the
hybrid. The degree of stringency increases as the
hybridization temperature increases and the ionic strength
of the hybridization buffer decreases. Stringent
hybridization conditions encompass temperatures of about
5-25°C below the Tm of the hybrid and a hybridization
buffer having up to 1 M Na'. Higher degrees of stringency
at lower temperatures can be achieved with the addition of
formamide which reduces the Tm of the hybrid about 1°C for
each 1% formamide in the buffer solution. Generally, such
stringent conditions include temperatures of 20-70°C and a
hybridization buffer containing up to 6x SSC and 0-50%
formamide. A higher degree of stringency can be achieved
at temperatures of from 40-70°C with a hybridization
buffer having up to 4x SSC and from 0-50% formamide.
Highly stringent conditions typically encompass
temperatures of 42-70°C with a hybridization buffer having
up to lx SSC and 0-50% formamide. Different degrees of
stringency can be used during hybridization and washing to
achieve maximum specific binding to the target sequence.
Typically, the washes following hybridization are
performed at increasing degrees of stringency to remove
non-hybridized polynucleotide probes from hybridized
complexes.
The above conditions are meant to serve as a
guide and it is well within the abilities of one skilled
in the art to adapt these conditions for use with a
particular polypeptide hybrid. The Tm for a specific
target sequence is the temperature (under defined
conditions) at which 50% of the target sequence will
hybridize to a perfectly matched probe sequence. Those
conditions which influence the Tm include, the size and
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
29
base pair content of the polynucleotide probe, the ionic
strength of the hybridization solution, and the presence
of destabilizing agents in the hybridization solution.
Numerous equations for calculating Tm are known in the art,
and are specific for DNA, RNA and DNA-RNA hybrids and
polynucleotide probe sequences of varying length (see, for
example, Sambrook et al., Molecular Clonina: A Laboratory
Manual, Second Edition (Cold Spring Harbor Press 1989);
Ausubel et al., (eds.), Current Protocols in Molecular
BioloaY (John Wiley and Sons, Inc. 1987); Berger and
Kimmel (eds.), Guide to Molecular Clonina Techniques,
(Academic Press, Inc. 1987); and Wetmur, Crit. Rev.
Biochem. Mol. Biol. 26:227 (1990)). Sequence analysis
software, such as OLIGO 6.0 (LSR; Long Lake, MN) and
Primer Premier 4.0 (Premier Biosoft International; Palo
Alto, CA), as well as sites on the Internet, are available
tools for analyzing a given sequence and calculating Tm
based on user defined criteria. Such programs can also
analyze a given sequence under defined conditions and
identify suitable probe sequences. Typically,
hybridization of longer polynucleotide sequences, >50 base
pairs, is performed at temperatures of about 20-25°C below
the calculated Tm. For smaller probes, <50 base pairs,
hybridization is typically carried out at the Tm or 5-10°C
below. This allows for the maximum rate of hybridization
for DNA-DNA and DNA-RNA hybrids.
The length of the polynucleotide sequence
influences the rate and stability of hybrid formation.
Smaller probe sequences, <50 base pairs, reach equilibrium
with complementary sequences rapidly, but may form less
stable hybrids. Incubation times of anywhere from minutes
to hours can be used to achieve hybrid formation. Longer
probe sequences come to equilibrium more slowly, but form
more stable complexes even at lower temperatures.
Incubations are allowed to proceed overnight or longer.
Generally, incubations are carried out for a period equal
to three times the calculated Cot time. Cot time, the
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
time it takes for the polynucleotide sequences to
reassociate, can be calculated for a particular sequence
by methods known in the art.
The base pair composition of polynucleotide
5 sequence will effect the thermal stability of the hybrid
complex, thereby influencing the choice of hybridization
temperature and the ionic strength of the hybridization
buffer. A-T pairs are less stable than G-C pairs in
aqueous solutions containing sodium chloride. Therefore,
10 the higher the G-C content, the more stable the hybrid.
Even distribution of G and C residues within the sequence
also contribute positively to hybrid stability. In
addition, the base pair composition can be manipulated to
alter the Tm of a given sequence. For example, 5-
15 methyldeoxycytidine can be substituted for deoxycytidine
and 5-bromodeoxuridine can be substituted for thymidine to
increase the Tm, whereas 7-deazz-2'-deoxyguanosine can be
substituted for guanosine to reduce dependence on Tm.
The ionic concentration of the hybridization
20 buffer also affects the stability of the hybrid.
Hybridization buffers generally contain blocking agents
such as Denhardt's solution (Sigma Chemical Co., St.
Louis, Mo.), denatured salmon sperm DNA, tRNA, milk
powders (BLOTTO), heparin or SDS, and a Na' source, such as
25 SSC (lx SSC: 0.15 M sodium chloride, 15 mM sodium citrate)
or SSPE ( lx SSPE : 1 . 8 M NaCl , 10 mM NaHzP09 , 1 mM EDTA, pH
7.7). By decreasing the ionic concentration of the
buffer, the stability of the hybrid is increased.
Typically, hybridization buffers contain from between 10
30 mM - 1 M Na'. The addition of destabilizing or denaturing
agents such as formamide, tetralkylammonium salts,
guanidinium cations or thiocyanate cations to the
hybridization solution will alter the Tm of a hybrid.
Typically, formamide is used at a concentration of up to
50% to allow incubations to be carried out at more
convenient and lower temperatures. Formamide also acts to
reduce non-specific background when using RNA probes.
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
31
As an illustration, a nucleic acid molecule
encoding a variant zacrp3 polypeptide can be hybridized
with a nucleic acid molecule having the nucleotide
sequence of SEQ ID NO:1 (or its complement) at 42°C
overnight in a solution comprising 50% formamide, 5x SSC
(lx SSC: 0.15 M sodium chloride and 15 mM sodium citrate),
50 mM sodium phosphate (pH 7.6), 5x Denhardt's solution
(100x Denhardt's solution: 2% (w/v) Ficoll 400, 2% (w/v)
polyvinylpyrrolidone, and 2% (w/v) bovine serum albumin),
10% dextran sulfate, and 20 ~g/ml denatured, sheared
salmon sperm DNA. One of skill in the art can devise
variations of these hybridization conditions. For
example, the hybridization mixture can be incubated at a
higher or lower temperature, such as about 65°C, in a
solution that does not contain formamide. Moreover,
premixed hybridization solutions are available (e. g.,
EXPRESSHYB Hybridization Solution from CLONTECH
Laboratories, Inc.), and hybridization can be performed
according to the manufacturer's instructions.
Following hybridization, the nucleic acid
molecules can be washed to remove non-hybridized nucleic
acid molecules under stringent conditions, or under highly
stringent conditions. Typical stringent washing
conditions include washing in a solution of 0.5x-2x SSC
with 0.1% sodium dodecyl sulfate (SDS) at 55-65°C. That
is, nucleic acid molecules encoding a variant zacrp3
polypeptide hybridize with a nucleic acid molecule having
the nucleotide sequence of SEQ ID NO:1 (or its complement)
under stringent washing conditions, in which the wash
stringency is equivalent to 0.5x-2x SSC with 0.1% SDS at
50-65°C, including 0.5x SSC with 0.1% SDS at 55°C, or 2x
SSC with 0.1% SDS at 65°C. One of skill in the art can
readily devise equivalent conditions, for example, by
substituting SSPE for SSC in the wash solution.
Typical highly stringent washing conditions
include washing in a solution of O.lx-0.2x SSC with 0.1%
sodium dodecyl sulfate (SDS) at 50-65°C. In other words,
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
32
nucleic acid molecules encoding a variant zacrp3
polypeptide hybridize with a nucleic acid molecule having
the nucleotide sequence of SEQ ID NO:1 (or its complement)
under highly stringent washing conditions, in which the
wash stringency is equivalent to O.lx-0.2x SSC with 0.1%
SDS at 50-65°C, including O.lx SSC with 0.1% SDS at 50°C,
or 0.2x SSC with O.lo SDS at 65°C.
The present invention also provides isolated
zacrp3 polypeptides that have a substantially similar
sequence identity to the polypeptides of SEQ ID N0:2, or
their orthologs. The term "substantially similar sequence
identity" is used herein to denote polypeptides having at
least 70%, at least 800, at least 900, at least 95% or
greater than 95 o sequence identity to the sequences shown
in SEQ ID NO : 2 , or their orthologs . The present invention
also includes polypeptides that comprise an amino acid
sequence having at least 70%, at least 80%, at least 90%,
at least 95% or greater than 95% sequence identity to the
sequence of amino acid residues 51 to 246 of SEQ ID N0:2.
The present invention further includes nucleic acid
molecules that encode such polypeptides. Methods for
determining percent identity are described below.
The present invention also contemplates zacrp3
variant nucleic acid molecules that can be identified
using two criteria: a determination of the similarity
between the encoded polypeptide with the amino acid
sequence of SEQ ID N0:2, and a hybridization assay, as
described above. Such zacrp3 variants include nucleic
acid molecules (1) that hybridize with a nucleic acid
molecule having the nucleotide sequence of SEQ ID NO:1 (or
its complement) under stringent washing conditions, in
which the wash stringency is equivalent to 0.5x-2x SSC
with O.lo SDS at 50-65°C, and (2) that encode a
polypeptide having at least 70%, at least 80%, at least
90%, at least 95% or greater than 95% sequence identity to
the amino acid sequence of SEQ ID N0:2. Alternatively,
zacrp3 variants can be characterized as nucleic acid
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
33
molecules (1) that hybridize with a nucleic acid molecule
having the nucleotide sequence of SEQ ID NO:1 (or its
complement) under highly stringent washing conditions, in
which the wash stringency is equivalent to O.lx-0.2x SSC
with O.lo SDS at 50-65°C, and (2) that encode a
polypeptide having at least 70%, at least 80%, at least
90%, at least 950 or greater than 95% sequence identity to
the amino acid sequence of SEQ ID N0:2.
Percent sequence identity is determined by
conventional methods. See, for example, Altschul et al.,
Bull. Math. Bio. 48:603, 1986, and Henikoff and Henikoff,
Proc. Natl. Acad. Sci. USA 89:10915, 1992. Briefly, two
amino acid sequences are aligned to optimize the alignment
scores using a gap opening penalty of 10, a gap extension
penalty of 1, and the "BLOSUM62" scoring matrix of
Henikoff and Henikoff (ibid.) as shown in Table 3 (amino
acids are indicated by the standard one-letter codes).
The percent identity is then calculated as: ([Total number
of identical matches]/ [length of the longer sequence plus
the number of gaps introduced into the longer sequence in
order to align the two sequences])(100).
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
~r
W --IN M
I
H In N N O
I I
d~ ~ M N N
I I
IW-1 rl d~M N
I I I I
w ~ ~ N N r-iM r-I
I I I
L(1O N v-Ic-~rirl i-1
I I I I I
II1W-IM rIO rI M N N
I I I 1 I I 1
a drN N O M N c-1N ~-Ir-1
M t I I I I I
I"I d~ N M rlO M N v-IM ri M
~ I I
M 1 I I 1
x p M M v-IN ri N v-IN N N M
I I I I I I I I I I
L7 lO N d' d'N M M N O N N M M
I I I I I I I I I I I
W toN O M M ~ N M rlO ri M N N
I I I I I I I I I I
Ot In N N O M N ri O M r1O ,-.W~7,~ N
I I I I I I I I I
U 01M d'M M rl rlM rlN M rl rl N N ~-1
I I I I I i I I 1 I I 1 I 1 I
l0 M O N rl ~ M d~rl M M riO ri ~ M M
I I I 1 I I I I I I 1 I 1
z l0rl M O O O ,-IM M O N M N ri O ~ N M
I I I I I I I I I
[Y., ll1O N M ri O N O M N N v-IM N rl r-1M N M
I I I I I I I I I I I I I
FI,'d~rl N N O ri rlO N ~-Irlrl rlN rlv-IO M N O
I I I I I I I I I I I I I I
~Crx z A U or w t7 x H a x ~ w w v~ H ~ ~I
u~ O In O
N
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
Those skilled in the art appreciate that there
are many established algorithms available to align two
amino acid sequences. The "FASTA" similarity search
algorithm of Pearson and Lipman is a suitable protein
5 alignment method for examining the level of identity
shared by an amino acid sequence disclosed herein and the
amino acid sequence of a putative variant zacrp3. The
FASTA algorithm is described by Pearson and Lipman, Proc.
Nat. Acad. Sci. USA 85:2444, 1988, and by Pearson, Meth.
10 Enzymol. 183:63, 1990.
Briefly, FASTA first characterizes sequence
similarity by identifying regions shared by the query
sequence (e. g., SEQ ID N0:2) and a test sequence that have
either the highest density of identities (if the ktup
15 variable is 1) or pairs of identities (if ktup=2), without
considering conservative amino acid substitutions,
insertions, or deletions. The ten regions with the
highest density of identities are then re-scored by
comparing the similarity of all paired amino acids using
20 an amino acid substitution matrix, and the ends of the
regions are "trimmed" to include only those residues that
contribute to the highest score. If there are several
regions with scores greater than the "cutoff" value
(calculated by a predetermined formula based upon the
25 length of the sequence and the ktup value), then the
trimmed initial regions are examined to determine whether
the regions can be joined to form an approximate alignment
with gaps. Finally, the highest scoring regions of the
two amino acid sequences are aligned using a modification
30 of the Needleman-Wunsch-Sellers algorithm (Needleman and
Wunsch, J. Mol. Biol. 48:444, 1970; Sellers, SIAM J. Appl.
Math. 26:787, 1974), which allows for amino acid
insertions and deletions. Illustrative parameters for
FASTA analysis are: ktup=1, gap opening penalty=10, gap
35 extension penalty=1, and substitution matrix=BLOSUM62.
These parameters can be introduced into a FASTA program by
modifying the scoring matrix file ("SMATRIX"), as
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
36
explained in Appendix 2 of Pearson, Meth. Enzymol. 183:63,
1990.
FASTA can also be used to determine the sequence
identity of nucleic acid molecules using a ratio as
disclosed above. For nucleotide sequence comparisons, the
ktup value can range between one to six, preferably from
four to six.
The present invention includes nucleic acid
molecules that encode a polypeptide having one or more
"conservative amino acid substitutions," compared with the
amino acid sequence of SEQ ID N0:2. Conservative amino
acid substitutions can be based upon the chemical
properties of the amino acids. That is, variants can be
obtained that contain one or more amino acid substitutions
of SEQ ID N0:2, in which an alkyl amino acid is
substituted for an alkyl amino acid in a zacrp3 amino acid
sequence, an aromatic amino acid is substituted for an
aromatic amino acid in a zacrp3 amino acid sequence, a
sulfur-containing amino acid is substituted for a sulfur-
containing amino acid in a zacrp3 amino acid sequence, a
hydroxy-containing amino acid is substituted for a
hydroxy-containing amino acid in a zacrp3 amino acid
sequence, an acidic amino acid is substituted for an
acidic amino acid in a zacrp3 amino acid sequence, a basic
amino acid is substituted for a basic amino acid in a
zacrp3 amino acid sequence, or a dibasic monocarboxylic
amino acid is substituted for a dibasic monocarboxylic
amino acid in a zacrp3 amino acid sequence.
Among the common amino acids, for example, a
"conservative amino acid substitution" is illustrated by a
substitution among amino acids within each of the
following groups: (1) glycine, alanine, valine, leucine,
and isoleucine, (2) phenylalanine, tyrosine, and
tryptophan, (3) serine and threonine, (4) aspartate and
glutamate, (5) glutamine and asparagine, and (6) lysine,
arginine and histidine.
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
37
The BLOSUM62 table is an amino acid substitution
matrix derived from about 2,000 local multiple alignments
of protein sequence segments, representing highly
conserved regions of more than 500 groups of related
proteins (Henikoff and Henikoff, Proc. Natl. Acad. Sci.
USA 89:10915, 1992). Accordingly, the- BLOSUM62
substitution frequencies can be used to define
conservative amino acid substitutions that may be
introduced into the amino acid sequences of the present
invention. Although it is possible to design amino acid
substitutions based solely upon chemical properties (as
discussed above), the language "conservative amino acid
substitution" preferably refers to a substitution
represented by a BLOSUM62 value of greater than -1. For
example, an amino acid substitution is conservative if the
substitution is characterized by a BLOSUM62 value of 0,
1, 2, or 3. According to this system, preferred
conservative amino acid substitutions are characterized by
a BLOSUM62 value of at least 1 (e. g., 1, 2 or 3), while
more preferred conservative amino acid substitutions are
characterized by a BLOSUM62 value of at least 2 (e.g., 2
or 3 ) .
Conservative amino acid changes in a zacrp3 gene
can be introduced by substituting nucleotides for the
nucleotides recited in SEQ ID NO:1. Such "conservative
amino acid" variants can be obtained, for example, by
oligonucleotide-directed mutagenesis, linker-scanning
mutagenesis, mutagenesis using the polymerase chain
reaction, and the like (see Ausubel (1995) at pages 8-10
to 8-22; and McPherson (ed.), Directed Mutagenesis: A
Practical Approach (IRL Press 1991)). The ability of such
variants to promote the energy balance modulating or other
properties of the wild-type protein can be determined
using a standard methods, such as the assays described
herein. Alternatively, a variant zacrp3 polypeptide can
be identified by the ability to specifically bind anti-
zacrp3 antibodies.
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
38
The proteins of the present invention can also
comprise non-naturally occurring amino acid residues.
Non-naturally occurring amino acids include, without
limitation, trans-3-methylproline, 2,4-methanoproline,
cis-4-hydroxyproline, trans-4-hydroxyproline, N-methyl-
glycine, allo-threonine, methylthreonine, hydroxyethyl-
cysteine, hydroxyethylhomocysteine, nitroglutamine, homo-
glutamine, pipecolic acid, thiazolidine carboxylic acid,
dehydroproline, 3- and 4-methylproline, 3,3-dimethyl-
proline, tert-leucine, norvaline, 2-azaphenylalanine, 3-
azaphenylalanine, 4-azaphenylalanine, and 4-fluorophenyl-
alanine. Several methods are known in the art for
incorporating non-naturally occurring amino acid residues
into proteins. For example, an in vitro system can be
employed wherein nonsense mutations are suppressed using
chemically aminoacylated suppressor tRNAs. Methods for
synthesizing amino acids and aminoacylating tRNA are known
in the art. Transcription and translation of plasmids
containing nonsense mutations is typically carried out in
a cell-free system comprising an E. coli S30 extract and
commercially available enzymes and other reagents.
Proteins are purified by chromatography. See, for
example, Robertson et al., J. Am. Chem. Soc. 113:2722,
1991, Ellman et al., Methods Enzymol. 202:301, 1991, Chung
et al., Science 259:806, 1993, and Chung et al., Proc.
Nat. Acad. Sci. USA 90:10145, 1993.
In a second method, translation is carried out
in Xenopus oocytes by microinjection of mutated mRNA and
chemically aminoacylated suppressor tRNAs (Turcatti et
al., J. Biol. Chem. 271:19991, 1996). Within a third
method, E. coli cells are cultured in the absence of a
natural amino acid that is to be replaced (e. g.,
phenylalanine) and in the presence of the desired non-
naturally occurring amino acids) (e.g., 2-
azaphenylalanine, 3-azaphenylalanine, 4-azaphenylalanine,
or 4-fluorophenylalanine). The non-naturally occurring
amino acid is incorporated into the protein in place of
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
39
its natural counterpart. See, Koide et al., Biochem.
33:7470, 1994. Naturally occurring amino acid residues
can be converted to non-naturally occurring species by in
vitro chemical modification. Chemical modification can be
combined with site-directed mutagenesis to further expand
the range of substitutions (Wynn and Richards, Protein
Sci. 2:395, 1993).
A limited number of non-conservative amino
acids, amino acids that are not encoded by the genetic
code, non-naturally occurring amino acids, and unnatural
amino acids may be substituted for zacrp3 amino acid
residues.
Multiple amino acid substitutions can be made
and tested using known methods of mutagenesis and
screening, such as those disclosed by Reidhaar-Olson and
Sauer (Science 241:53, 1988) or Bowie and Sauer (Proc.
Nat. Acad. Sci. USA 86:2152, 1989). Briefly, these
authors disclose methods for simultaneously randomizing
two or more positions in a polypeptide, selecting for
functional polypeptide, and then sequencing the
mutagenized polypeptides to determine the spectrum of
allowable substitutions at each position. Other methods
that can be used include phage display (e.g., Lowman et
al., Biochem. 30:10832, 1991, Ladner et al., U.S. Patent
No. 5,223,409, Huse, international publication No. WO
92/06204, and region-directed mutagenesis (Derbyshire et
al., Gene 46:145, 1986, and Ner et al., DNA 7:127, 1988).
Variants of the disclosed zacrp3 nucleotide and
polypeptide sequences can also be generated through DNA
shuffling as disclosed by Stemmer, Nature 370:389, 1994,
Stemmer, Proc. Nat. Acad. Sci. USA 91:10747, 1994, and
international publication No. WO 97/20078. Briefly,
variant DNA molecules are generated by in vitro homologous
recombination by random fragmentation of a parent DNA
followed by reassembly using PCR, resulting in randomly
introduced point mutations. This technique can be
modified by using a family of parent DNA molecules, such
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
as allelic variants or DNA molecules from different
species, to introduce additional variability into the
process. Selection or screening for the desired activity,
followed by additional iterations of mutagenesis and assay
5 provides for rapid "evolution" of sequences by selecting
for desirable mutations while simultaneously selecting
against detrimental changes.
Mutagenesis methods as disclosed herein can be
combined with high-throughput, automated screening methods
10 to detect activity of cloned, mutagenized polypeptides in
host cells. Mutagenized DNA molecules that encode
biologically active polypeptides, or polypeptides that
bind with anti-zacrp3 antibodies, can be recovered from
the host cells and rapidly sequenced using modern
15 equipment. These methods allow the rapid determination of
the importance of individual amino acid residues in a
polypeptide of interest, and can be applied to
polypeptides of unknown structure.
Essential amino acids in the polypeptides of the
20 present invention can be identified according to
procedures known in the art, such as site-directed
mutagenesis or alanine-scanning mutagenesis (Cunningham
and Wells, Science 244:1081, 1989, Bass et al., Proc. Nat.
Acad. Sci. USA 88:4498, 1991, Coombs and Corey, "Site
25 Directed Mutagenesis and Protein Engineering," in
Proteins: Analysis and Desicrn, Angeletti (ed.), pages 259-
311 (Academic Press, Inc. 1998)). In the latter
technique, single alanine mutations are introduced at
every residue in the molecule, and the resultant mutant
30 molecules are tested for biological activity as disclosed
below to identify amino acid residues that are critical to
the activity of the molecule. See also, Hilton et al., J.
Biol. Chem. 271:4699, 1996. The identities of essential
amino acids can also be inferred from analysis of
35 homologies with zacrp3.
The location of zacrp3 receptor binding domains
can be identified by physical analysis of structure, as
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
41
determined by such techniques as nuclear magnetic
resonance, crystallography, electron diffraction or
photoaffinity labeling, in conjunction with mutation of
putative contact site amino acids. See, for example, de
Vos et al., Science 255:306, 1992, Smith et al., J. Mol.
Biol. 224:899, 1992, and Wlodaver et al., FEBS Lett.
309:59, 1992. Moreover, zacrp3 labeled with biotin or
FITC can be used for expression cloning of zacrp3
receptors.
The present invention also provides polypeptide
fragments or peptides comprising an epitope-bearing
portion of a zacrp3 polypeptide described herein. Such
fragments or peptides may comprise an "immunogenic
epitope," which is a part of a protein that elicits an
antibody response when the entire protein is used as an
immunogen. Immunogenic epitope-bearing peptides can be
identified using standard methods (see, for example,
Geysen et al., Proc. Nat. Acad. Sci. USA 81:3998, 1983).
In contrast, polypeptide fragments or peptides
may comprise an "antigenic epitope," which is a region of
a protein molecule to which an antibody can specifically
bind. Certain epitopes consist of a linear or contiguous
stretch of amino acids, and the antigenicity of such an
epitope is not disrupted by denaturing agents. It is
known in the art that relatively short synthetic peptides
that can mimic epitopes of a protein can be used to
stimulate the production of antibodies against the protein
(see, for example, Sutcliffe et al., Science 219:660,
1983). Accordingly, antigenic epitope-bearing peptides
and polypeptides of the present invention are useful to
raise antibodies that bind with the polypeptides described
herein.
Antigenic epitope-bearing peptides and
polypeptides preferably contain at least four to ten amino
acids, at least ten to fifteen amino acids, or about 15 to
about 30 amino acids of SEQ ID N0:2. Such epitope-bearing
peptides and polypeptides can be produced by fragmenting a
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
42
zacrp3 polypeptide, or by chemical peptide synthesis, as
described herein. Moreover, epitopes can be selected by
phage display of random peptide libraries (see, for
example, Lane and Stephen, Curr. Opin. Immunol. 5:268,
1993, and Cortese et al., Curr. Opin. Biotechnol. 7:616,
1996). Standard methods for identifying epitopes and
producing antibodies from small peptides that comprise an
epitope are described, for example, by Mole, "Epitope
Mapping," in Methods in Molecular Biology, Vol. 10, Manson
(ed.), pages 105-16 (The Humana Press, Inc. 1992), Price,
"Production and Characterization of Synthetic Peptide-
Derived Antibodies," in Monoclonal Antibodies: Production,
Engineering, and Clinical Application, Ritter and Ladyman
(eds.), pages 60-84 (Cambridge University Press 1995), and
Coligan et al. (eds.), Current Protocols in Immunology,
pages 9.3.1 - 9.3.5 and pages 9.4.1 - 9.4.11 (John Wiley &
Sons 1997).
Regardless of the particular nucleotide sequence
of a variant zacrp3 gene, the gene encodes a polypeptide
that is characterized by its energy balance modulating
activity or other activities of the wild-type protein, or
by the ability to bind specifically to an anti-zacrp3
antibody. More specifically, variant zacrp3 genes encode
polypeptides which exhibit at least 50%, and preferably,
greater than 70, 80, or 900, of the activity of
polypeptide encoded by the human zacrp3 gene described
herein.
For any zacrp3 polypeptide, including variants
and fusion proteins, one of ordinary skill in the art can
readily generate a fully degenerate polynucleotide
sequence encoding that variant using the information set
forth in Tables 1 and 2 above. Moreover, those of skill
in the art can use standard software to devise zacrp3
variants based upon the nucleotide and amino acid
sequences described herein. Accordingly, the present
invention includes a computer-readable medium encoded with
a data structure that provides at least one of the
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
43
following sequences: SEQ ID NO:1, SEQ ID N0:2, and SEQ ID
NO:10. Suitable forms of computer-readable media include
magnetic media and optically-readable media. Examples of
magnetic media include a hard or fixed drive, a random
access memory (RAM) chip, a floppy disk, digital linear
tape (DLT), a disk cache, and a ZIP disk. Optically
readable media are exemplified by compact discs (e.g., CD-
read only memory (ROM), CD-rewritable (RW), and CD-
recordable), and digital versatile/video discs (DVD)
(e. g., DVD-ROM, DVD-RAM, and DVD+RW).
The present invention also provides zacrp3
fusion proteins. For example, fusion proteins of the
present invention encompass (1) a polypeptide selected
from the group consisting of: (a) polypeptide molecules
comprising a sequence of amino acid residues as shown in
SEQ ID N0:2 from amino acid residue 1 (Met), 23 (Gln) or
51 (Gly) to amino acid residue 246 (Lys); (b) polypeptide
molecules ranging from amino acid 51 (Gly) to amino acid
113 (Pro) of SEQ ID N0:2, a portion of the zacrp3
polypeptide containing the collagen-like domain or a
portion of the collagen-like domain capable of
dimerization or oligomerization; (c) polypeptide molecules
ranging from amino acid 114 (Pro) to 246 (Lys) of SEQ ID
N0:2, a portion of the zacrp3 polypeptide containing the
Clq domain or an active portion of the Clq domain; or (d)
polypeptide molecules ranging from amino acid 51 (Gly) to
246 (Lys), a portion of the zacrp3 polypeptide including
the collagen-like domain and the Clq domain; and (2)
another polypeptide. The other polypeptide may be
alternative or additional C1q domain, an alternative or
additional collagen-like domain, a signal peptide to
facilitate secretion of the fusion protein or the like.
The globular domain of complement binds IgG, thus, the
globular domain of zacrp3 polypeptide, fragment or fusion
may have a similar role.
Zacrp3 polypeptides, ranging from amino acid 1
(Met) to amino acid 246 (Lys); the mature zacrp3
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
44
polypeptides, ranging from amino acid 23 (Gln) to amino
acid 246 (Lys); or the secretion leader fragments thereof,
which fragments range from amino acid 1 (Met) to amino
acid 22 (Cys) may be used in the study of secretion of
proteins from cells. In preferred embodiments of this
aspect of the present invention, the mature polypeptides
are formed as fusion proteins with putative secretory
signal sequences; plasmids bearing regulatory regions
capable of directing the expression of the fusion protein
is introduced into test cells; and secretion of mature
protein is monitored. The monitoring may be done by
techniques known in the art, such as HPLC and the like.
The polypeptides of the present invention,
including full-length proteins, fragments thereof and
fusion proteins, can be produced in genetically engineered
host cells according to conventional techniques. Suitable
host cells are those cell types that can be transformed or
transfected with exogenous DNA and grown in culture, and
include bacteria, fungal cells, and cultured higher
eukaryotic cells. Eukaryotic cells, particularly cultured
cells of multicellular organisms, are preferred.
Techniques for manipulating cloned DNA molecules and
introducing exogenous DNA into a variety of host cells are
disclosed by Sambrook et al., ibid., and Ausubel et al.
ibid.
In general, a DNA sequence encoding a zacrp3
polypeptide of the present invention is operably linked to
other genetic elements required for its expression,
generally including a transcription promoter and
terminator within an expression vector. The vector will
also commonly contain one or more selectable markers and
one or more origins of replication, although those skilled
in the art will recognize that within certain systems
selectable markers may be provided on separate vectors,
and replication of the exogenous DNA may be provided by
integration into the host cell genome. Selection of
promoters, terminators, selectable markers, vectors and
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
other elements is a matter of routine design within the
level of ordinary skill in the art. Many such elements
are described in the literature and are available through
commercial suppliers.
5 To direct a zacrp3 polypeptide into the
secretory pathway of a host cell, a secretory signal
sequence (also known as a leader sequence, signal
sequence, prepro sequence or pre-sequence) is provided in
the expression vector. The secretory signal sequence may
10 be that of the zacrp3 polypeptide, or may be derived from
another secreted protein (e.g., t-PA) or synthesized de
novo. The secretory signal sequence is joined to the
zacrp3 polypeptide DNA sequence in the correct reading
frame. Secretory signal sequences are commonly positioned
15 5' to the DNA sequence encoding the polypeptide of
interest, although certain signal sequences may be
positioned elsewhere in the DNA sequence of interest (see,
e.g., Welch et al., U.S. Patent No. 5,037,743; Holland et
al., U.S. Patent No. 5,143,830). Conversely, the signal
20 sequence portion of the zacrp3 polypeptide (amino acid
residues 1-22 of SEQ ID N0:2) may be employed to direct
the secretion of an alternative protein by analogous
methods.
The secretory signal seguence contained in the
25 polypeptides of the present invention can be used to
direct other polypeptides into the secretory pathway. The
present invention provides for such fusion polypeptides.
A signal fusion polypeptide can be made wherein a
secretory signal sequence derived from amino acid residues
30 1-22 of SEQ ID N0:2 is operably linked to another
polypeptide using methods known in the art and disclosed
herein. The secretory signal sequence contained in the
fusion polypeptides of the present invention is preferably
fused amino-terminally to an additional peptide to direct
35 the additional peptide into the secretory pathway. Such
constructs have numerous applications known in the art.
For example, these novel secretory signal sequence fusion
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
46
constructs can direct the secretion of an active component
of a normally non-secreted protein, such as a receptor.
Such fusions may be used in vivo or in vitro to direct
peptides through the secretory pathway.
Cultured mammalian cells are suitable hosts
within the present invention. Methods for introducing
exogenous DNA into mammalian host cells include calcium
phosphate-mediated transfection (Wigler et al., Cell
14:725, 1978; Corsaro and Pearson, Somatic Cell Genetics
7:603, 1981: Graham and Van der Eb, Virology 52:456,
1973), electroporation (Neumann et al., EMBO J. 1:841-5,
1982), DEAE-dextran mediated transfection (Ausubel et al.,
ibid.), and liposome-mediated transfection (Hawley-Nelson
et al., Focus 15:73, 1993; Ciccarone et al., Focus 15:80,
1993, and viral vectors (Miller and Rosman, BioTechniques
7:980-90, 1989; Wang and Finer, Nature Med. 2:714-6,
1996). The production of recombinant polypeptides in
cultured mammalian cells is disclosed, for example, by
Levinson et al., U.S. Patent No. 4,713,339; Hagen et al.,
U.S. Patent No. 4,784,950; Palmiter et al., U.S. Patent
No. 4,579,821; and Ringold, U.S. Patent No. 4,656,134.
Suitable cultured mammalian cells include the COS-1 (ATCC
No. CRL 1650), COS-7 (ATCC No. CRL 1651), BHK (ATCC No.
CRL 1632), BHK 570 (ATCC No. CRL 10314), 293 (ATCC No. CRL
1573; Graham et al., J. Gen. Virol. 36:59-72, 1977) and
Chinese hamster ovary (e. g. CHO-K1; ATCC No. CCL 61) cell
lines. Additional suitable cell lines are known in the
art and available from public depositories such as the
American Type Culture Collection, Manassas, VA. In
general, strong transcription promoters are preferred,
such as promoters from SV-40 or cytomegalovirus. See,
e.g., U.S. Patent No. 4,956,288. Other suitable promoters
include those from metallothionein genes (U. S. Patent Nos.
4,579,821 and 4,601,978) and the adenovirus major late
promoter.
Drug selection is generally used to select for
cultured mammalian cells into which foreign DNA has been
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
47
inserted. Such cells are commonly referred to as
"transfectants". Cells that have been cultured in the
presence of the selective agent and are able to pass the
gene of interest to their progeny are referred to as
"stable transfectants." A preferred selectable marker is
a gene encoding resistance to the antibiotic neomycin.
Selection is carried out in the presence of a neomycin-
type drug, such as G-418 or the like. Selection systems
may also be used to .increase the expression level of the
gene of interest, a process referred to as
"amplification." Amplification is carried out by
culturing transfectants in the presence of a low level of
the selective agent and then increasing the amount of
selective agent to select for cells that produce high
levels of the products of the introduced genes. A
preferred amplifiable selectable marker is dihydrofolate
reductase, which confers resistance to methotrexate.
Other drug resistance genes (e. g., hygromycin resistance,
multi-drug resistance, puromycin acetyltransferase) can
also be used. Alternative markers that introduce an
altered phenotype, such as green fluorescent protein, or
cell surface proteins such as CD4, CD8, Class I MHC,
placental alkaline phosphatase may be used to sort
transfected cells from untransfected cells by such means
as FAGS sorting or magnetic bead separation technology.
Other higher eukaryotic cells can also be used
as hosts, including plant cells, insect cells and avian
cells. The use of Agrobacterium rhizogenes as a vector
for expressing genes in plant cells has been reviewed by
Sinkar et al., J. Biosci. (Banaalore) 11:47-58, 1987.
Transformation of insect cells and production of foreign
polypeptides therein is disclosed by Guarino et al., U.S.
Patent No. 5,162,222 and WIPO publication WO 94/06463.
Insect cells can be infected with recombinant baculovirus,
commonly derived from Autographa californica nuclear
polyhedrosis virus (AcNPV). See, King and Possee, The
Baculovirus Expression System: A Laboratory Guide,
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
48
London, Chapman & Hall; O'Reilly et al., Baculovirus
Expression Vectors: A Laboratory Manual, New York, Oxford
University Press., 1994; and, Richardson, C. D., Ed.,
Baculovirus Expression Protocols. Methods in Molecular
Biology, Totowa, NJ, Humana Press, 1995. A second method
of making recombinant zacrp3 baculovirus utilizes a
transposon-based system described by Luckow (Luckow et
al., J. Virol. 67:4566-79, 1993). This system, which
utilizes transfer vectors, is sold in the Bac-to-BacT"' kit
(Life Technologies, Rockville, MD). This system utilizes a
transfer vector, pFastBaclT"" (Life Technologies) containing
a Tn7 transposon to move the DNA encoding the zacrp3
polypeptide into a baculovirus genome maintained in E.
coli as a large plasmid called a "bacmid." The pFastBaclT""
transfer vector utilizes the AcNPV polyhedrin promoter to
drive the expression of the gene of interest, in this case
zacrp3. However, pFastBaclT"" can be modified to a
considerable degree. The polyhedrin promoter can be
removed and substituted with the baculovirus basic protein
promoter (also known as Pcor, p6.9 or MP promoter) which
is expressed earlier in the baculovirus infection, and has
been shown to be advantageous for expressing secreted
proteins. See, Hill-Perkins and Possee, J. Gen. Virol.
71:971-6, 1990; Bonning et al., J. Gen. Virol. 75:1551-6,
1994; and, Chazenbalk, and Rapoport, J. Biol. Chem.
270:1543-9, 1995. In such transfer vector constructs, a
short or long version of the basic protein promoter can be
used. Moreover, transfer vectors can be constructed which
replace the native zacrp3 secretory signal sequences with
secretory signal sequences derived from insect proteins.
For example, a secretory signal sequence from Ecdysteroid
Glucosyltransferase (EGT), honey bee Melittin (Invitrogen,
Carlsbad, CA), or baculovirus gp67 (PharMingen, San Diego,
CA) can be used in constructs to replace the native zacrp3
secretory signal sequence. In addition, transfer vectors
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
49
can include an in-frame fusion with DNA encoding an
epitope tag at the C- or N-terminus of the expressed
zacrp3 polypeptide, for example, a Glu-Glu epitope tag
(Grussenmeyer et al., Proc. Natl. Acad. Sci. 82:7952-4,
1985). Using a technique known in the art, a transfer
vector containing zacrp3 is transformed into E. coli, and
screened for bacmids which contain an interrupted lacZ
gene indicative of recombinant baculovirus. The bacmid
DNA containing the recombinant baculovirus genome is
isolated, using common techniques, and used to transfect
Spodoptera frugiperda cells, e.g. Sf9 cells. Recombinant
virus that expresses zacrp3 is subsequently produced.
Recombinant viral stocks are made by methods commonly used
the art.
The recombinant virus is used to infect host
cells, typically a cell line derived from the fall
armyworm, Spodoptera frugiperda. See, in general, Glick
and Pasternak, Molecular Biotechnology: Principles and
Applications of Recombinant DNA, ASM Press, Washington,
D.C., 1994. Another suitable cell line is the High FiveOT""
cell line (Invitrogen) derived from Trichoplusia ni (U. S.
Patent #5,300,435). Commercially available serum-free
media are used to grow and maintain the cells. Suitable
media are Sf900 IIT"" (Life Technologies) or ESF 921T"'
(Expression Systems) for the Sf9 cells; and Ex-ce11O405T""
(JRH Biosciences, Lenexa, KS) or Express FiveOT"" (Life
Technologies) for the T. ni cells. The cells are grown up
from an inoculation density of approximately 2-5 x 105
cells to a density of 1-2 x 106 cells at which time a
recombinant viral stock is added at a multiplicity of
infection (MOI) of 0.1 to 10, more typically near 3.
Procedures used are generally described in available
laboratory manuals (King and Possee, ibid.; O'Reilly et
al., ibid.; Richardson, ibid.). Subsequent purification
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
of the zacrp3 polypeptide from the supernatant can be
achieved using methods described herein.
Fungal cells, including yeast cells, can also be
used within the present invention. Yeast species of
5 particular interest in this regard include Saccharomyces
cerevisiae, Pichia pastoris, and Pichia methanolica.
Methods for transforming S. cerevisiae cells with
exogenous DNA and producing recombinant polypeptides
therefrom are disclosed by, for example, Kawasaki, U.S.
10 Patent No. 4,599,311; Kawasaki et al., U.S. Patent No.
4,931,373; Brake, U.S. Patent No. 4,870,008; Welch et al.,
U.S. Patent No. 5,037,743; and Murray et al., U.S. Patent
No. 4,845,075. Transformed cells are selected by
phenotype determined by the selectable marker, commonly
15 drug resistance or the ability to grow in the absence of a
particular nutrient (e. g., leucine). A preferred vector
system for use in Saccharomyces cerevisiae is the POT1
vector system disclosed by Kawasaki et al. (U. S. Patent
No. 4,931,373), which allows transformed cells to be
20 selected by growth in glucose-containing media. Suitable
promoters and terminators for use in yeast include those
from glycolytic enzyme genes (see, e.g., Kawasaki, U.S.
Patent No. 4,599,311; Kingsman et al., U.S. Patent No.
4,615,974; and Bitter, U.S. Patent No. 4,977,092) and
25 alcohol dehydrogenase genes. See also U.S. Patents Nos.
4,990,446; 5,063,154; 5,139,936 and 4,661,454.
Transformation systems for other yeasts, including
Hansenula polymorpha, Schizosaccharomyces pombe,
Kluyveromyces lactis, Kluyveromyces fragilis, Ustilago
30 maydis, Pichia pastoris, Pichia methanolica, Pichia
guillermondii and Candida maltosa are known in the art.
See, for example, Gleeson et al., J. Gen. Microbiol.
132:3459-65, 1986 and Cregg, U.S. Patent No. 4,882,279.
Aspergillus cells may be utilized according to the methods
35 of McKnight et al., U.S. Patent No. 4,935,349. Methods
for transforming Acremonium chrysogenum are disclosed by
Sumino et al., U.S. Patent No. 5,162,228. Methods for
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
51
transforming Neurospora are disclosed by Lambowitz, U.S.
Patent No. 4,486,533.
The use of Pichia methanolica as host for the
production of recombinant proteins is disclosed in VJIPO
Publications WO 97/17450, WO 97/17451, WO 98/02536, and WO
98/02565. DNA molecules for use in transforming P.
methanolica will commonly be prepared as double-stranded,
circular plasmids, which are preferably linearized prior
to transformation. For polypeptide production in P.
methanolica, it is preferred that the promoter and
terminator in the plasmid be that of a P. methanolica
gene, such as a P. methanolica alcohol utilization gene
(AUGI or AUG2). Other useful promoters include those of
the dihydroxyacetone synthase (DHAS), formate
dehydrogenase (FMD), and catalase (CAT) genes. To
facilitate integration of the DNA into the host
chromosome, it is preferred to have the entire expression
segment of the plasmid flanked at both ends by host DNA
sequences. A preferred selectable marker for use in
Pichia methanolica is a P. methanolica ADE2 gene, which
encodes phosphoribosyl-5-aminoimidazole carboxylase (AIRC;
EC 4.1.1.21) , which allows ade2 host cells to grow in the
absence of adenine. For large-scale, industrial processes
where it is desirable to minimize the use of methanol, it
is preferred to use host cells in which both methanol
utilization genes (AUG1 and AUG2) are deleted. For
production of secreted proteins, host cells deficient in
vacuolar protease genes (PEP4 and PRBI) are preferred.
Electroporation is used to facilitate the introduction of
a plasmid containing DNA encoding a polypeptide of
interest into P. methanolica cells. It is preferred to
transform P. methanolica cells by electroporation using
an exponentially decaying, pulsed electric field having a
field strength of from 2.5 to 4.5 kV/cm, preferably about
3.75 kV/cm, and a time constant (~) of from 1 to 40
milliseconds, most preferably about 20 milliseconds.
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
52
Prokaryotic host cells, including strains of the
bacteria Escherichia coli, Bacillus and other genera are
also useful host cells within the present invention.
Techniques for transforming these hosts and expressing
foreign DNA sequences cloned therein are well known in the
art (see, e.g., Sambrook et al., ibid.). When expressing
a zacrp3 polypeptide in bacteria such as E, coli, the
polypeptide may be retained in the cytoplasm, typically as
insoluble granules, or may be directed to the periplasmic
space by a bacterial secretion sequence. In the former
case, the cells are lysed, and the granules are recovered
and denatured using, for example, guanidine isothiocyanate
or urea. The denatured polypeptide can then be refolded
and dimerized by diluting the denaturant, such as by
dialysis against a solution of urea and a combination of
reduced and oxidized glutathione, followed by dialysis
against a buffered saline solution. In the latter case,
the polypeptide can be recovered from the periplasmic
space in a soluble and functional form by disrupting the
cells (by, for example, sonication or osmotic shock) to
release the contents of the periplasmic space and
recovering the protein, thereby obviating the need for
denaturation and refolding.
Transformed or transfected host cells are
cultured according to conventional procedures in a culture
medium containing nutrients and other components required
for the growth of the chosen host cells. A variety of
suitable media, including defined media and complex media,
are known in the art and generally include a carbon
source, a nitrogen source, essential amino acids, vitamins
and minerals. Media may also contain such components as
growth factors or serum, as required. The growth medium
will generally select for cells containing the exogenously
added DNA by, for example, drug selection or deficiency in
an essential nutrient which is complemented by the
selectable marker carried on the expression vector or co-
transfected into the host cell.
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
53
Expressed recombinant zacrp3 polypeptides (or
chimeric zacrp3 polypeptides) can be purified using
fractionation and/or conventional purification methods and
media. Ammonium sulfate precipitation and acid or
chaotrope extraction may be used for fractionation of
samples. Exemplary purification steps may include
hydroxyapatite, size exclusion, FPLC and reverse-phase
high performance liquid chromatography. Suitable
chromatographic media include derivatized dextrans,
agarose, cellulose, polyacrylamide, specialty silicas, and
the like. PEI, DEAE, QAE and Q derivatives are preferred.
Exemplary chromatographic media include those media
derivatized with phenyl, butyl, or octyl groups, such as
Phenyl-Sepharose FF (Pharmacia), Toyopearl butyl 650 (Toso
Haas, Montgomeryville, PA), Octyl-Sepharose (Pharmacia)
and the like; or polyacrylic resins, such as Amberchrom CG
. 71 (Toso Haas) and the like. Suitable solid supports
include glass beads, silica-based resins, cellulosic
resins, agarose beads, cross-linked agarose beads,
polystyrene beads, cross-linked polyacrylamide resins and
the like that are insoluble under the conditions in which
they are to be used. These supports may be modified with
reactive groups that allow attachment of proteins by amino
groups, carboxyl groups, sulfhydryl groups, hydroxyl
groups and/or carbohydrate moieties. Examples of coupling
chemistries include cyanogen bromide activation, N-
hydroxysuccinimide activation, epoxide activation,
sulfhydryl activation, hydrazide activation, and carboxyl
and amino derivatives for carbodiimide coupling
chemistries. These and other solid media are well known
and widely used in the art, and are available from
commercial suppliers. Methods for binding receptor
polypeptides to support media are well known in the art.
Selection of a particular method is a matter of routine
design and is determined in part by the properties of the
chosen support. See, for example, Affinity
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
54
Chromatocrraphy: Principles & Methods, Pharmacia LKB
Biotechnology, Uppsala, Sweden, 1988.
The polypeptides of the present invention can be
isolated by exploitation of their structural or binding
properties. For example, immobilized metal ion adsorption
(IMAC) chromatography can be used to purify histidine-rich
proteins or proteins having a His tag. Briefly, a gel is
first charged with divalent metal ions to form a chelate
(Sulkowski, Trends in Biochem. 3:1-7, 1985). Histidine-
rich proteins will be adsorbed to this matrix with
differing affinities, depending upon the metal ion used,
and will be eluted by competitive elution, lowering the
pH, or use of strong chelating agents.s~~Other methods of
purification include purification of glycosylated proteins
by lectin affinity chromatography and ion exchange
chromatography (Methods in Enzymol., Vol. 182, "Guide to
Protein Purification", Deutscher, (ed.), Acad. Press, San
Diego, 1990, pp. 529-39). Within an additional preferred
embodiments of the invention, a fusion of the polypeptide
of interest and an affinity tag (e. g., maltose-binding
protein, FLAG, Glu-Glu, an immunoglobulin domain) may be
constructed to facilitate purification as is discussed in
greater detail in the Example sections below.
Protein refolding (and optionally, reoxidation)
procedures may be advantageously used. It is preferred to
purify the protein to >80% purity, more preferably to >90%
purity, even more preferably >95%, and particularly
preferred is a pharmaceutically pure state, that is
greater than 99.9% pure with respect to contaminating
macromolecules, particularly other proteins and nucleic
acids, and free of infectious and pyrogenic agents.
Preferably, a purified protein is substantially free of
other proteins, particularly other proteins of animal
origin.
Zacrp3 polypeptides or fragments thereof may
also be prepared through chemical synthesis by methods
well known in the art. Such zacrp3 polypeptides may be
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
monomers or multimers; glycosylated or non-glycosylated;
pegylated or non-pegylated; and may or may not include an
initial methionine amino acid residue.
A ligand-binding polypeptide, such as a zacrp3
5 binding polypeptide, can also be used for purification of
ligand. The polypeptide is immobilized on a solid
support, such as beads of agarose, cross-linked agarose,
glass, cellulosic resins, silica-based resins,
polystyrene, cross-linked polyacrylamide, or like
10 materials that are stable under the conditions of use.
Methods for linking polypeptides to solid supports are
known in the art, and include amine chemistry, cyanogen
bromide activation, N-hydroxysuccinimide activation,
epoxide activation, sulfhydryl activation, and hydrazide
15 activation. The resulting medium will generally be
configured in the form of a column, and fluids containing
ligand are passed through the column one or more times to
allow ligand to bind to the ligand-binding polypeptide.
The ligand is then eluted using changes in salt
20 concentration, chaotropic agents (guanidine HC1), or pH to
disrupt ligand-receptor binding.
An assay system that uses a ligand-binding
receptor (or an antibody, one member of a complement/
anti-complement pair) or a binding fragment thereof, and a
25 commercially available biosensor instrument (BIAcoreTM,
Pharmacia Biosensor, Piscataway, NJ) may be advantageously
employed. Such receptor, antibody, member of a
complement/anti-complement pair or fragment is immobilized
onto the surface of a receptor chip. Use of this
30 instrument is disclosed by Karlsson, J. Immunol. Methods
145:229-40, 1991 and Cunningham and Wells, J. Mol. Biol.
234:554-63, 1993. A receptor, antibody, member or
fragment is covalently attached, using amine or sulfhydryl
chemistry, to dextran fibers that are attached to gold
35 film within the flow cell. A test sample is passed
through the cell. If a ligand, epitope, or opposite
member of the complement/anti-complement pair is present
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
56
in the sample, it will bind to the immobilized receptor,
antibody or member, respectively, causing a change in the
refractive index of the medium, which is detected as a
change in surface plasmon resonance of the gold film.
This system allows the determination of on- and off-rates,
from which binding affinity can be calculated, and
assessment of stoichiometry of binding.
Ligand-binding polypeptides can also be used
within other assay systems known in the art. Such systems
include Scatchard analysis for determination of binding
affinity (see Scatchard, Ann. NY Acad. Sci. 51: 660-72,
1949) and calorimetric assays (Cunningham et al., Science
253:545-48, 1991; Cunningham et al., Science 245:821-25,
1991).
The invention also provides anti-zacrp3
antibodies. Antibodies to zacrp3 can be obtained, for
example, using as an antigen the product of a zacrp3
expression vector, or zacrp3 isolated from a natural
source. Particularly useful anti-zacrp3 antibodies "bind
specifically" with zacrp3. Antibodies are considered to
be specifically binding if the antibodies bind to a zacrp3
polypeptide, peptide or epitope with a binding affinity
(Ka) of 106 M 1 or greater, preferably 10~ M 1 or greater,
more preferably 108 M 1 or greater, and most preferably
109 M 1 or greater. The binding affinity of an antibody
can be readily determined by one of ordinary skill in the
art, for example, by Scatchard analysis (Scatchard, Ann.
NY Acad. Sci. 51:660, 1949). Suitable antibodies include
antibodies that bind with zacrp3 in particular domains.
Anti-zacrp3 antibodies can be produced using
antigenic zacrp3 epitope-bearing peptides and
polypeptides. Antigenic epitope-bearing peptides and
polypeptides of the present invention contain a sequence
of at least nine, preferably between 15 to about 30 amino
acids contained within SEQ ID N0:2. However, peptides or
polypeptides comprising a larger portion of an amino acid
sequence of the invention, containing from 30 to 50 amino
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
57
acids, or any length up to and including the entire amino
acid sequence of a polypeptide of the invention, also are
useful for inducing antibodies that bind with zacrp3. It
is desirable that the amino acid sequence of the epitope-
bearing peptide is selected to provide substantial
solubility in aqueous solvents (i.e., the sequence
includes relatively hydrophilic residues, while
hydrophobic residues are preferably avoided). Hydrophilic
peptides can be predicted by one of skill in the art from
a hydrophobicity plot, see for example, Hopp and Woods
(Proc. Nat. Acad. Sci. USA 78:3824-8, 1981) and Kyte and
Doolittle (J. Mol. Biol. 157: 105-142, 1982). Moreover,
amino acid sequences containing proline residues may be
also be desirable for antibody production.
Polyclonal antibodies to recombinant zacrp3
protein or to zacrp3 isolated from natural sources can be
prepared using methods well-known to those of skill in the
art. See, for example, Green et al., "Production of
Polyclonal Antisera," in Immunochemical Protocols (Manson,
ed.), pages 1-5 (Humana Press 1992), and Williams et al.,
"Expression of foreign proteins in E. coli using plasmid
vectors and purification of specific polyclonal
antibodies," in DNA Cloning 2: Expression Systems, 2nd
Edition, Glover et al. (eds.), page 15 (Oxford University
Press 1995). The immunogenicity of a zacrp3 polypeptide
can be increased through the use of an adjuvant, such as
alum (aluminum hydroxide) or Freund's complete or
incomplete adjuvant. Polypeptides useful for immunization
also include fusion polypeptides, such as fusions of
zacrp3 or a portion thereof with an immunoglobulin
polypeptide or with maltose binding protein. The
polypeptide immunogen may be a full-length molecule or a
portion thereof. If the polypeptide portion is "hapten-
like," such portion may be advantageously joined or linked
to a macromolecular carrier (such as keyhole limpet
hemocyanin (KLH), bovine serum albumin (BSA) or tetanus
toxoid) for immunization.
WO 00/63377 CA 02370609 2001-10-19 PCT/US00110454
58
Although polyclonal antibodies are typically
raised in animals such as horses, cows, dogs, chicken,
rats, mice, rabbits, hamsters, guinea pigs, goats, or
sheep, an anti-zacrp3 antibody of the present invention
may also be derived from a subhuman primate antibody.
General techniques for raising diagnostically and
therapeutically useful antibodies in baboons may be found,
for example, in Goldenberg et al., international patent
publication No. WO 91/11465, and in Losman et al., Int. J.
Cancer 46:310, 1990. Antibodies can also be raised in
transgenic animals such as transgenic sheep, cows, goats
or pigs, and can also be expressed in yeast and fungi in
modified forms as will as in mammalian and insect cells.
Alternatively, monoclonal anti-zacrp3 antibodies
can be generated. Rodent monoclonal antibodies to
specific antigens may be obtained by methods known to
those skilled in the art (see, for example, Kohler et al.,
Nature 256:495 (1975), Coligan et al. (eds.), Current
Protocols in Immunology, Vol. 1, pages 2.5.1-2.6.7 (John
Wiley & Sons 1991), Picksley et al., "Production of
monoclonal antibodies against proteins expressed in E.
coli," in DNA Cloning 2: Expression Systems, 2nd Edition,
Glover et al. (eds.), page 93 (Oxford University Press
1995) ) .
Briefly, monoclonal antibodies can be obtained
by injecting mice with a composition comprising a zacrp3
gene product, verifying the presence of antibody
production by removing a serum sample, removing the spleen
to obtain B-lymphocytes, fusing the B-lymphocytes with
myeloma cells to produce hybridomas, cloning the
hybridomas, selecting positive clones which produce
antibodies to the antigen, culturing the clones that
produce antibodies to the antigen, and isolating the
antibodies from the hybridoma cultures.
In addition, an anti-zacrp3 antibody of the
present invention may be derived from a human monoclonal
antibody. Human monoclonal antibodies are obtained from
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
59
transgenic mice that have been engineered to produce
specific human antibodies in response to antigenic
challenge. In this technique, elements of the human heavy
and light chain locus are introduced into strains of mice
derived from embryonic stem cell lines that contain
targeted disruptions of the endogenous heavy chain and
light chain loci. The transgenic mice can synthesize human
antibodies specific for human antigens, and the mice can be
used to produce human antibody-secreting hybridomas.
Methods for obtaining human antibodies from transgenic mice
are described, for example, by Green et al., Nature Genet.
7:13, 1994, Lonberg et al., Nature 368:856, 1994, and
Taylor et al., Int. Immun. 6:579, 1994.
Monoclonal antibodies can be isolated and
purified from hybridoma cultures by a variety of well
established techniques. Such isolation techniques include
affinity chromatography with Protein-A Sepharose, size
exclusion chromatography, and ion-exchange chromatography
(see, for example, Coligan at pages 2.7.1-2.7.12 and pages
2.9.1-2.9.3; Baines et al., "Purification of
Immunoglobulin G (IgG)," in Methods in Molecular Biology,
Vol. 10, pages 79-104 (The Humana Press, Inc. 1992)).
For particular uses, it may be desirable to
prepare fragments of anti-zacrp3 antibodies. Such
antibody fragments can be obtained, for example, by
proteolytic hydrolysis of the antibody. Antibody
fragments can be obtained by pepsin or papain digestion of
whole antibodies by conventional methods. As an
illustration, antibody fragments can be produced by
enzymatic cleavage of antibodies with pepsin to provide a
5S fragment denoted F(ab')2. This fragment can be further
cleaved using a thiol reducing agent to produce 3.55 Fab'
monovalent fragments. Optionally, the cleavage reaction
can be performed using a blocking group for the sulfhydryl
groups that result from cleavage of disulfide linkages.
As an alternative, an enzymatic cleavage using pepsin
produces two monovalent Fab fragments and an Fc fragment
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
directly. These methods are described, for example, by
Goldenberg, U.S. patent No. 4,331,647, Nisonoff et al.,
Arch Biochem. Biophys. 89:230, 1960, Porter, Biochem. J.
73:119, 1959, Edelman et al., in Methods in Enzymolo y
5 Vol. l, page 422 (Academic Press 1967), and by Coligan,
ibid.
Other methods of cleaving antibodies, such as
separation of heavy chains to form monovalent light-heavy
chain fragments, further cleavage of fragments, or other
10 enzymatic, chemical or genetic techniques may also be
used, so long as the fragments bind to the antigen that is
recognized by the intact antibody.
For example, Fv fragments comprise an
association of VH and VL chains. This association can be
15 noncovalent, as described by Inbar et al., Proc. Natl.
Acad. Sci. USA 69:2659, 1972. Alternatively, the variable
chains can be linked by an intermolecular disulfide bond
or cross-linked by chemicals such as gluteraldehyde (see,
for example, Sandhu, Crit. Rev. Biotech. 12:437, 1992).
20 The Fv fragments may comprise VH and VL chains
which are connected by a peptide linker. These single-
chain antigen binding proteins (scFv) are prepared by
constructing a structural gene comprising DNA sequences
encoding the VH and VL domains which are connected by an
25 oligonucleotide. The structural gene is inserted into an
expression vector which is subsequently introduced into a
host cell, such as E. coli. The recombinant host cells
synthesize a single polypeptide chain with a linker
peptide bridging the two V domains. Methods for producing
30 scFvs are described, for example, by Whitlow et al.,
Methods: A Companion to Methods in Enzymology 2:97, 1991,
also see, Bird et al., Science 242:423, 1988, Ladner et
al., U.S. Patent No. 4,946,778, Pack et al.,
Bio/Technology 11:1271, 1993, and Sandhu, ibid.
35 As an illustration, a scFV can be obtained by
exposing lymphocytes to zacrp3 polypeptide in vitro, and
selecting antibody display libraries in phage or similar
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
61
vectors (for instance, through use of immobilized or
labeled zacrp3 protein or peptide). Genes encoding
polypeptides having potential zacrp3 polypeptide binding
domains can be obtained by screening random peptide
libraries displayed on phage (phage display) or on
bacteria, such as E. coli. Nucleotide sequences encoding
the polypeptides can be obtained in a number of ways, such
as through random mutagenesis and random polynucleotide
synthesis. These random peptide display libraries can be
used to screen for peptides which interact with a known
target which can be a protein or polypeptide, such as a
ligand or receptor, a biological or synthetic
macromolecule, or organic or inorganic substances.
Techniques for creating and screening such random peptide
display libraries are known in the art (Ladner et al.,
U.S. Patent No. 5,223,409, Ladner et al., U.S. Patent No.
4,946,778, Ladner et al., U.S. Patent No. 5,403,484,
Ladner et al. , U.S. Patent No. 5, 571, 698, and Kay et al. ,
Phage Display of Peptides and Proteins (Academic Press,
Inc. 1996)) and random peptide display libraries and kits
for screening such libraries are available commercially,
for instance from Clontech (Palo Alto, CA), Invitrogen
Inc. (San Diego, CA), New England Biolabs, Inc. (Beverly,
MA), and Pharmacia LKB Biotechnology Inc. (Piscataway,
NJ). Random peptide display libraries can be screened
using the zacrp3 sequences disclosed herein to identify
proteins which bind to zacrp3.
Another form of an antibody fragment is a
peptide coding for a single complementarity-determining
region (CDR). CDR peptides ("minimal recognition units")
can be obtained by constructing genes encoding the CDR of
an antibody of interest. Such genes are prepared, for
example, by using the polymerase chain reaction to
synthesize the variable region from RNA of antibody-
producing cells (see, for example, Larrick et al.,
Methods: A Companion to Methods in Enzymology 2:106,
1991), Courtenay-Luck, "Genetic Manipulation of Monoclonal
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
62
Antibodies," in Monoclonal Antibodies: Production,
Engineering and Clinical Application, Ritter et al.
(eds.), page 166 (Cambridge University Press, 1995), and
Ward et al., "Genetic Manipulation and Expression of
Antibodies," in Monoclonal Antibodies: Principles and
Applications, Birch et al., (eds.), page 137 (Wiley-Liss,
Inc. 1995)).
Alternatively, an anti-zacrp3 antibody may be
derived from a "humanized" monoclonal antibody. Humanized
monoclonal antibodies are produced by transferring mouse
complementary determining regions from heavy and light
variable chains of the mouse immunoglobulin into a human
variable domain. Typical residues of human antibodies are
then substituted in the framework regions of the murine
counterparts. The use of antibody components derived from
humanized monoclonal antibodies obviates potential
problems associated with the immunogenicity of murine
constant regions. General techniques for cloning murine
immunoglobulin variable domains are described, for
example, by Orlandi et al., Proc. Nat. Acad. Sci. USA
86:3833, 1989. Techniques for producing humanized
monoclonal antibodies are described, for example, by Jones
et al., Nature 321:522, 1986, Carter et al., Proc. Nat.
Acad. Sci. USA 89:4285, 1992, Sandhu, Crit. Rev. Biotech.
12:437, 1992, Singer et al., J. Immun. 150:2844, 1993,
Sudhir (ed.), Antibody Engineering Protocols (Humana
Press, Inc. 1995), Kelley, "Engineering Therapeutic
Antibodies," in Protein Engineering: Principles and
Practice, Cleland et al. (eds.), pages 399-434 (John Wiley
& Sons, Inc. 1996), and by Queen et al., U.S. Patent No.
5,693,762 (1997).
Polyclonal anti-idiotype antibodies can be
prepared by immunizing animals with anti-zacrp3 antibodies
or antibody fragments, using standard techniques. See,
for example, Green et al., "Production of Polyclonal
Antisera," in Methods In Molecular Biology: Immunochemical
Protocols, Manson (ed.), pages 1-12 (Humana Press 1992).
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
63
Also, see Coligan, ibid. at pages 2.4.1-2.4.7.
Alternatively, monoclonal anti-idiotype antibodies can be
prepared using anti-zacrp3 antibodies or antibody
fragments as immunogens with the techniques, described
above. As another alternative, humanized anti-idiotype
antibodies or subhuman primate anti-idiotype antibodies
can be prepared using the above-described techniques.
Methods for producing anti-idiotype antibodies are
described, for example, by Irie, U.S. Patent No.
5,208,146, Greene, et. al., U.S. Patent No. 5,637,677, and
Varthakavi and Minocha, J. Gen. Virol. 77:1875, 1996.
Genes encoding polypeptides having potential
zacrp3 polypeptide binding domains, "binding proteins",
can be obtained by screening random or directed peptide
libraries displayed on phage (phage display) or on
bacteria, such as E. coli. Nucleotide sequences encoding
the polypeptides can be obtained in a number of ways, such
as through random mutagenesis and random polynucleotide
synthesis. Alternatively, constrained phage display
libraries can also be produced. These peptide display
libraries can be used to screen for peptides which
interact with a known target which can be a protein or
polypeptide, such as a ligand or receptor, a biological or
synthetic macromolecule, or organic or inorganic
substances. Techniques for creating and screening such
peptide display libraries are known in the art (Ladner et
al., US Patent NO. 5,223,409; Ladner et al., US Patent NO.
4,946,778; Ladner et al., US Patent NO. 5,403,484 and
Ladner et al., US Patent NO. 5,571,698) and peptide
display libraries and kits for screening such libraries
are available commercially, for instance from Clontech
(Palo Alto, CA), Invitrogen Inc. (San Diego, CA), New
England Biolabs, Inc. (Beverly, MA) and Pharmacia LKB
Biotechnology Inc. (Piscataway, NJ). Peptide display
libraries can be screened using the zacrp3 sequences
disclosed herein to identify proteins which bind to
zacrp3. These "binding proteins" which interact with
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
64
zacrp3 polypeptides can be used essentially like an
antibody.
A variety of assays known to those skilled in
the art can be utilized to detect antibodies and/or
binding proteins which specifically bind to zacrp3
proteins or peptides. Exemplary assays are described in
detail in Antibodies: A Laboratory Manual, Harlow and Lane
(Eds.), Cold Spring Harbor Laboratory Press, 1988.
Representative examples of such assays include: concurrent
immunoelectrophoresis, radioimmunoassay, radioimmuno
precipitation, enzyme-linked immunosorbent assay (ELISA),
dot blot or Western blot assay, inhibition or competition
assay, and sandwich assay. In addition, antibodies can be
screened for binding to wild-type versus mutant zacrp3
protein or polypeptide.
Antibodies and binding proteins to zacrp3 may be
used for tagging cells that express zacrp3; for isolating
zacrp3 by affinity purification; for diagnostic assays for
determining circulating levels of zacrp3 polypeptides; for
detecting or quantitating soluble zacrp3 as marker of
underlying pathology or disease; in analytical methods
employing FACS; for screening expression libraries; for
generating anti-idiotypic antibodies; and as neutralizing
antibodies or as antagonists to block zacrp3 polypeptide
modulation of spermatogenesis or like activity in vitro
and in vivo. Suitable direct tags or labels include
radionuclides, enzymes, substrates, cofactors, inhibitors,
fluorescent markers, chemiluminescent markers, magnetic
particles and the like; indirect tags or labels may
feature use of biotin-avidin or other complement/anti-
complement pairs as intermediates. Moreover, antibodies
to zacrp3 or fragments thereof may be used in vitro to
detect denatured zacrp3 or fragments thereof in assays,
for example, Western Blots or other assays known in the
art.
Antibodies or polypeptides herein can also be
directly or indirectly conjugated to drugs, toxins,
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
radionuclides and the like, and these conjugates used for
in vivo diagnostic or therapeutic applications. For
instance, polypeptides or antibodies of the present
invention can be used to identify or treat tissues or
5 organs that express a corresponding anti-complementary
molecule (receptor or antigen, respectively, for
instance). More specifically, zacrp3 polypeptides or
anti-zacrp3 antibodies, or bioactive fragments or portions
thereof, can be coupled to detectable or cytotoxic
10 molecules and delivered to a mammal having cells, tissues
or organs that express the anti-complementary molecule.
An additional aspect of the present invention
provides methods for identifying agonists or antagonists
of the zacrp3 polypeptides disclosed above, which agonists
15 or antagonists may have valuable properties as discussed
further herein. Within one embodiment, there is provided
a method of identifying zacrp3 polypeptide agonists,
comprising providing cells responsive thereto, culturing
the cells in the presence of a test compound and comparing
20 the cellular response with the cell cultured in the
presence of the zacrp3 polypeptide, and selecting the test
compounds for which the cellular response is of the same
type.
Within another embodiment, there is provided a
25 method of identifying antagonists of zacrp3 polypeptide,
comprising providing cells responsive to a zacrp3
polypeptide, culturing a first portion of the cells in the
presence of zacrp3 polypeptide, culturing a second portion
of the cells in the presence of the zacrp3 polypeptide and
30 a test compound, and detecting a decrease in a cellular
response of the second portion of the cells as compared to
the first portion of the cells. In addition to those
assays disclosed herein, samples can be tested for
inhibition of zacrp3 activity within a variety of assays
35 designed to measure receptor binding or the
stimulation/inhibition of zacrp3-dependent cellular
responses. For example, zacrp3-responsive cell lines can
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
66
be transfected with a reporter gene construct that is
responsive to a zacrp3-stimulated cellular pathway.
Reporter gene constructs of this type are known in the
art, and will generally comprise a zacrp3-DNA response
element operably linked to a gene encoding an assayable
protein, such as luciferase. DNA response elements can
include, but are not limited to, cyclic AMP response
elements (CRE), hormone response elements (HRE), insulin
response element (IRE) (Nasrin et al., Proc. Natl. Acad.
Sci. USA 87:5273-7, 1990) and serum response elements
(SRE) (Shaw et al. Cell 56: 563-72, 1989). Cyclic AMP
response elements are reviewed in Roestler et al., J.
Biol. Chem. 263 (19):9063-6, 1988 and Habener, Molec.
Endocrinol. 4 (8):1087-94, 1990. Hormone response
elements are reviewed in Beato, Cell 56:335-44; 1989.
Candidate compounds, solutions, mixtures or extracts are
tested for the ability to inhibit the activity of zacrp3
on the target cells as evidenced by a decrease in zacrp3
stimulation of reporter gene expression. Assays of this
type will detect compounds that directly block zacrp3
binding to cell-surface receptors, as well as compounds
that block processes in the cellular pathway subsequent to
receptor-ligand binding. In the alternative, compounds or
other samples can be tested for direct blocking of zacrp3
binding to receptor using zacrp3 tagged with a detectable
label (e.g., 125I, biotin, horseradish peroxidase, FITC, and
the like). Within assays of this type, the ability of a
test sample to inhibit the binding of labeled zacrp3 to
the receptor is indicative of inhibitory activity, which
can be confirmed through secondary assays. Receptors used
within binding assays may be cellular receptors or
isolated, immobilized receptors.
Based on homology to other adipocyte complement
related proteins, zacrp3 polypeptides, fragments, fusions,
agonists or antagonists can be used to modulate energy
balance in mammals or to protect endothelial cells from
injury. With regard to modulating energy balance, zacrp3
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
67
polypeptides modulate cellular metabolic reactions. Such
metabolic reactions include adipogenesis, gluconeogenesis,
glycogenolysis, lipogenesis, glucose uptake, protein
synthesis, thermogenesis, oxygen utilization and the like.
Zacrp3 polypeptides may also find use as neurotransmitters
or as modulators of neurotransmission, as indicated by
expression of the polypeptide in tissues associated with
the sympathetic or parasympathetic nervous system. In
this regard, zacrp3 polypeptides may find utility in
modulating nutrient uptake, as demonstrated, for example,
by 2-deoxy-glucose uptake in the brain or the like.
Among other methods known in the art or
described herein, mammalian energy balance may be
evaluated by monitoring one or more of the following
metabolic functions: adipogenesis, gluconeogenesis,
glycogenolysis, lipogenesis, glucose uptake, protein
synthesis, thermogenesis, oxygen utilization or the like.
These metabolic functions are monitored by techniques
(assays or animal models) known to one of ordinary skill
in the art, as is more fully set forth below. For
example, the glucoregulatory effects of insulin are
predominantly exerted in the liver, skeletal muscle and
adipose tissue. Insulin binds to its cellular receptor in
these three tissues and initiates tissue-specific actions
that result in, for example, the inhibition of glucose
production and the stimulation of glucose utilization. In
the liver, insulin stimulates glucose uptake and inhibits
gluconeogenesis and glycogenolysis. In skeletal muscle
and adipose tissue, insulin acts to stimulate the uptake,
storage and utilization of glucose.
Art-recognized methods exist for monitoring all
of the metabolic functions recited above. Thus, one of
ordinary skill in the art is able to evaluate zacrp3
polypeptides, fragments, fusion proteins, antibodies,
agonists and antagonists for metabolic modulating
functions. Exemplary modulating techniques are set forth
below.
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
68
Adipogenesis, gluconeogenesis and glycogenolysis
are interrelated components of mammalian energy balance,
which may be evaluated by known techniques using, for
example, ob/ob mice or db/db mice. The ob/ob mice are
inbred mice that are homozygous for an inactivating
mutation at the ob (obese) locus. Such ob/ob mice are
hyperphagic and hypometabolic, and are believed to be
deficient in production of circulating OB protein. The
db/db mice are inbred mice that are homozygous for an
inactivating mutation at the db (diabetes) locus. The
db/db mice display a phenotype similar to that of ob/ob
mice, except db/db mice also display a diabetic phenotype.
Such db/db mice are believed to be resistant to the
effects of circulating OB protein. Also, various in vitro
methods of assessing these parameters are known in the
art.
Insulin-stimulated lipogenesis, for example, may
be monitored by measuring the incorporation of 14C-acetate
into triglyceride (Mackall et al. J. Biol. Chem. 251:6462-
4, 1976) or triglyceride accumulation (Kletzien et al.,
Mol. Pharmacol. 41:393-8, 1992).
Glucose uptake may be evaluated, for example, in
an assay for insulin-stimulated glucose transport. Non-
transfected, differentiated L6 myotubes (maintained in the
absence of 6418) are placed in DMEM containing 1 g/1
glucose, 0.5 or 1.0% BSA, 20 mM Hepes, and 2 mM glutamine.
After two to five hours of culture, the medium is replaced
with fresh, glucose-free DMEM containing 0.5 or 1.0% BSA,
20 mM Hepes, 1 mM pyruvate, and 2 mM glutamine.
Appropriate concentrations of insulin or IGF-1, or a
dilution series of the test substance, are added, and the
cells are incubated for 20-30 minutes. 3H or 14C-labeled
deoxyglucose is added to =50 1M final concentration, and
the cells are incubated for approximately 10-30 minutes.
The cells are then quickly rinsed with cold buffer (e. g.
PBS), then lysed with a suitable lysing agent (e.g. 1% SDS
or 1 N NaOH). The cell lysate is then evaluated by
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
69
counting in a scintillation counter. Cell-associated
radioactivity is taken as a measure of glucose transport
after subtracting non-specific binding as determined by
incubating cells in the presence of cytocholasin b, an
inhibitor of glucose transport. Other methods include
those described by, for example, Manchester et al., Am. J.
Physiol. 266 (Endocrinol. Metab. 29):E326-E333, 1994
(insulin-stimulated glucose transport).
Protein synthesis may be evaluated, for example,
by comparing precipitation of 35S-methionine-labeled
proteins following incubation of the test cells with 35S
methionine and 35S-methionine and a putative modulator of
protein synthesis.
Thermogenesis may be evaluated as described by
B. Stanley in The Biology of Neuropeptide Y and Related
Peptides, W. Colmers and C. Wahlestedt (eds.), Humana
Press, Ottawa, 1993, pp. 457-509; C. Billington et al.,
Am. J. Physiol. 260:8321, 1991; N. Zarjevski et al.,
Endocrinolocty 133:1753, 1993; C. Billington et al., Am. J.
Physiol. 266:81765, 1994; Heller et al., Am. J. Physiol.
252(4 Pt 2): 8661-7, 1987; and Heller et al., Am. J.
Physiol. 245: 8321-8, 1983. Also, metabolic rate, which
may be measured by a variety of techniques, is an indirect
measurement of thermogenesis.
Oxygen utilization may be evaluated as described
by Heller et al., Pfluaers Arch 369: 55-9, 1977. This
method also involved an analysis of hypothalmic
temperature and metabolic heat production. Oxygen
utilization and thermoregulation have also been evaluated
in humans as described by Haskell et al., J. Appl.
Physiol. 51: 948-54, 1981.
Neurotransmission functions may be evaluated by
monitoring 2-deoxy-glucose uptake in the brain. This
parameter is monitored by techniques (assays or animal
models) known to one of ordinary skill in the art, for
example, autoradiography. Useful monitoring techniques
are described, for example, by Kilduff et al., J.
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
Neurosci. 10 2463-75, 1990, with related techniques used
to evaluate the "hibernating heart" as described in Gerber
et al. Circulation 94: 651-8, 1996, and Fallavollita et
al., Circulation 95: 1900-9, 1997.
5 In addition, zacrp3 polypeptides, fragments,
fusions agonists or antagonists thereof may be
therapeutically useful for anti-microbial applications.
For example, complement component Clq plays a role in host
defense against infectious agents, such as bacteria and
10 viruses. Clq is known to exhibit several specialized
functions. For example, Clq triggers the complement
cascade via interaction with bound antibody or C-reactive
protein (CRP). Also, Clq interacts directly with certain
bacteria, RNA viruses, mycoplasma, uric acid crystals, the
15 lipid A component of bacterial endotoxin and membranes of
certain intracellular organelles. Clq binding to the Clq
receptor is believed to promote phagocytosis. Clq also
appears to enhance the antibody formation aspect of the
host defense system. See, for example, Johnston, Pediatr.
20 Infect. Dis. J. 12 11 933-41, 1993. Thus, soluble Clq-
like molecules may be useful as anti-microbial agents,
promoting lysis or phagocytosis of infectious agents.
Zacrp3 fragments as well as zacrp3 polypeptides,
fusion proteins, agonists, antagonists or antibodies may
25 be evaluated with respect to their anti-microbial
properties according to procedures known in the art. See,
for example, Barsum et al., Eur. Respir. J. 8 5 709-14,
1995; Sandovsky-Losica et al., J. Med. Vet. Mycol
(England) 28 4 279-87, 1990; Mehentee et al., J. Gen.
30 Microbiol. (England) 135 (Pt. 8): 2181-8, 1989; Segal and
Savage, J. Med. Vet. Mycol. 24: 477-9, 1986 and the like.
If desired, the performance of zacrp3 in this regard can
be compared to proteins known to be functional in this
regard, such as proline-rich proteins, lysozyme,
35 histatins, lactoperoxidase or the like. In addition,
zacrp3 fragments, polypeptides, fusion proteins, agonists,
antagonists or antibodies may be evaluated in combination
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
71
with one or more anti-microbial agents to identify
synergistic effects. One of ordinary skill in the art
will recognize that the anti-microbial properties of
zacrp3 polypeptides, fragments, fusion proteins, agonists,
antagonists and antibodies may be similarly evaluated.
As neurotransmitters or neurotransmission
modulators, zacrp3 polypeptide fragments as well as zacrp3
polypeptides, fusion proteins, agonists, antagonists or
antibodies of the present invention may also modulate
calcium ion concentration, muscle contraction, hormone
secretion, DNA synthesis or cell growth, inositol
phosphate turnover, arachidonate release, phospholipase-C
activation, gastric emptying, human neutrophil activation
or ADCC capability, superoxide anion production and the
like. Evaluation of these properties can be conducted by
known methods, such as those set forth herein.
The impact of zacrp3 polypeptide, fragment,
fusion, antibody, agonist or antagonist on intracellular
calcium level may be assessed by methods known in the art,
such as those described by Dobrzanski et al., Regulatory
Peptides 45: 341-52, 1993, and the like. The impact of
zacrp3 polypeptide, fragment, fusion, agonist or
antagonist on muscle contraction may be assessed by
methods known in the art, such as those described by Smits
& Lebebvre, J. Auton. Pharmacol. 14: 383-92, 1994, Belloli
et al., J. Vet. Pharmacol. Therap. 17: 379-83, 1994, Maggi
et al., Regulatory Peptides 53: 259-74, 1994, and the
like. The impact of zacrp3 polypeptide, fragment, fusion,
agonist or antagonist on hormone secretion may be assessed
by methods known in the art, such as those for prolactin
release described by Henriksen et al., J. Recep. Sig.
Transd. Res. 15(1-4): 529-41, 1995, and the like. The
impact of zacrp3 polypeptide, fragment, fusion, agonist or
antagonist on DNA synthesis or cell growth may be assessed
by methods known in the art, such as those described by
Dobrzanski et al., Regulatory Peptides 45: 341-52, 1993,
and the like. The impact of zacrp3 polypeptide, fragment,
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
72
fusion, agonist or antagonist on inositol phosphate
turnover may be assessed by methods known in the art, such
as those described by Dobrzanski et al., Rectulatory
Peptides 45: 341-52, 1993, and the like.
Also, the impact of zacrp3 polypeptide,
fragment, fusion, agonist or antagonist on arachidonate
release may be assessed by methods known in the art, such
as those described by Dobrzanski et al., Rectulatory
Peptides 45: 341-52, 1993, and the like. The impact of
zacrp3 polypeptide, fragment, fusion, agonist or
antagonist on phospholipase-C activation may be assessed
by methods known in the art, such as those described by
Dobrzanski et al., Regulatory Peptides 45: 341-52, 1993,
and the like. The impact of zacrp3 polypeptide, fragment,
fusion, agonist or antagonist on gastric emptying may be
assessed by methods known in the art, such as those
described by Varga et al., Eur. J. Pharmacol. 286: 109-
112, 1995, and the like. The impact of zacrp3
polypeptide, fragment, fusion, agonist or antagonist on
human neutrophil activation and ADCC capability may be
assessed by methods known in the art, such as those
described by Wozniak et al., Immunoloay 78: 629-34, 1993,
and the like. The impact of zacrp3 polypeptide, fragment,
fusion, agonist or antagonist on superoxide anion
production may be assessed by methods known in the art,
such as those described by Wozniak et al . , Immunoloay 78
629-34, 1993, and the like.
Collagen is a potent inducer of platelet
aggregation. This poses risks to patients recovering from
vascular injures. Inhibitors of collagen-induced platelet
aggregation would be useful for blocking the binding of
platelets to collagen-coated surfaces and reducing
associated collagen-induced platelet aggregation. Clq is
a component of the complement pathway and has been found
to stimulate defense mechanisms as well as trigger the
generation of toxic oxygen species that can cause tissue
damage (Tenner, Behring Inst. Mitt. 93:241-53, 1993). Clq
WO 00/6337? CA 02370609 2001-10-19 PCT/US00/10454
73
binding sites are found on platelets. Clq, independent of
an immune binding partner, has been found to inhibit
platelet aggregation but not platelet adhesion or shape
change. The amino terminal region of Clq shares homology
with collagen (Peerschke and Ghebrehiwet, J. Immunol.
145:2984-88, 1990). Inhibition of Clq and the complement
pathway can be determined using methods disclosed herein
or know in the art, such as described in Suba and Csako,
J. Immunol. 117:304-9, 1976.
The impact of zacrp3 polypeptide, fragments,
fusions, agonists or antagonists on collagen-mediated
platelet adhesion, activation and aggregation may be
evaluated using methods described herein or known in the
art, such as the platelet aggregation assay (Chiang et
al., Thrombosis Res. 37:605-12, 1985) and platelet
adhesion assays (Peerschke and Ghebrehiwet, J. Immunol.
144:221-25, 1990). Assays for platelet adhesion to
collagen and inhibition of collagen-induced platelet
aggregation can be measured using methods described in
Keller et al., J. Biol. Chem. 268:5450-6, 1993; Waxman and
Connolly, J. Biol. Chem. 268:5445-9, 1993; Noeske-Jungblut
et al . , J. Biol . Chem. 269 :5050-3 or 1994 Deckmyn et al . ,
Blood 85:712-9, 1995.
The impact of zacrp3 polypeptide, fragments,
fusions, agonists or antagonists on vasodilation of aortic
rings can be measured according to the methods of Dainty
et al., J. Pharmacol. 100:767, 1990 and Rhee et al.,
Neurotox. 16:179, 1995.
Various in vitro and in vivo models are
available for assessing the effects of zacrp3
polypeptides, fragments, fusion proteins, antibodies,
agonists and antagonists on ischemia and reperfusion
injury. See for example, Shandelya et al., Circulation
88:2812-26, 1993; Weisman et al., Science 249:146-151,
1991; Buerke et al., Circulation 91:393-402, 1995;
Horstick et al., Circulation 95:701-8, 1997 and Burke et
al., J. Phar. Exp. There. 286:429-38, 1998 . An ex vivo
WO 00/63377 CA 02370609 2001-10-19 pCT/US00/10454
74
hamster platelet aggregation assay is described by Deckmyn
et al . , ibid. Bleeding times in hamsters and baboons can
be measured following injection of zacrp3 polypeptides
using the model described by Deckmyn et al., ibid. The
formation of thrombus in response to administration of
proteins of the present invention can be measured using
the hamster femoral vein thrombosis model is provided by
Deckmyn et al., ibid. Changes in platelet adhesion under
flow conditions following administration of zacrp3 can be
measured using the method described in Harsfalvi et al.,
Blood 85:705-11, 1995.
Complement inhibition and wound healing can be
zacrp3 polypeptides, fragments, fusion proteins,
antibodies, agonists or antagonists be assayed alone or in
combination with other know inhibitors of collagen-induced
platelet activation and aggregation, such as palldipin,
moubatin or calm, for example.
Zacrp3 polypeptides, fragments, fusion proteins,
antibodies, agonists or antagonists can be evaluated using
methods described herein or known in the art, such as
healing of dermal layers in pigs (Lynch et al., Proc.
Natl. Acad. Sci. USA 84: 7696-700, 1987) and full-
thickness skin wounds in genetically diabetic mice
(Greenhalgh et al., Am. J. Pathol. 136: 1235-46, 1990),
for example. The polypeptides of the present invention
can be assayed alone or in combination with other known
complement inhibitors as described above.
Radiation hybrid mapping is a somatic cell
genetic technique developed for constructing high
resolution, contiguous maps of mammalian chromosomes (Cox
et al., Science 250:245-50, 1990). Partial or full
knowledge of a gene's sequence allows the designing of PCR
primers suitable for use with chromosomal radiation hybrid
mapping panels. Commercially available radiation hybrid
mapping panels which cover the entire human genome, such
as the Stanford G3 RH Panel and the GeneBridge 4 RH Panel
(Research Genetics, Inc., Huntsville, AL), are available.
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
These panels enable rapid, PCR based, chromosomal
localizations and ordering of genes, sequence-tagged sites
(STSs), and other nonpolymorphic- and polymorphic markers
within a region of interest. This includes establishing
5 directly proportional physical distances between newly
discovered genes of interest and previously mapped
markers. The precise knowledge of a gene's position can
be useful in a number of ways including: 1) determining if
a sequence is part of an existing contig and obtaining
10 additional surrounding genetic sequences in various forms
such as YAC-, BAC- or cDNA clones, 2) providing a
possible candidate gene for an inheritable disease which
shows linkage to the same chromosomal region, and 3) for
cross-referencing model organisms such as mouse which may
15 be beneficial in helping to determine what function a
particular gene might have.
The results showed linkage of Zacrp3 to the
human chromosome 5 framework marker SHGC-56588 with a LOD
score of 15.58 and at a distance of 0 cR 10000 from the
20 marker. The use of surrounding markers positions Zacrp3 in
the 5p12 region on the integrated LDB human chromosome 5
map. The present invention also provides reagents which
will find use in diagnostic applications. For example,
the zacrp3 gene, a probe comprising zacrp3 DNA or RNA, or
25 a subsequence thereof can be used to determine if the
zacrp3 gene is present on chromosome 5 or if a mutation
has occurred. Detectable chromosomal aberrations at the
zacrp3 gene locus include, but are not limited to,
aneuploidy, gene copy number changes, insertions,
30 deletions, restriction site changes and rearrangements.
These aberrations can occur within the coding sequence,
within introns, or within flanking sequences, including
upstream promoter and regulatory regions, and may be
manifested as physical alterations within a coding
35 sequence or changes in gene expression level.
In general, these diagnostic methods comprise
the steps of (a) obtaining a genetic sample from a
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
76
patient; (b) incubating the genetic sample with a
polynucleotide probe or primer as disclosed above, under
conditions wherein the polynucleotide will hybridize to
complementary polynucleotide sequence, to produce a first
reaction product; and (iii) comparing the first reaction
product to a control reaction product. A difference
between the first reaction product and the control
reaction product is indicative of a genetic abnormality in
the patient. Genetic samples for use within the present
invention include genomic DNA, cDNA, and RNA. The
polynucleotide probe or primer can be RNA or DNA, and will
comprise a portion of SEQ ID NO:1, the complement of SEQ
ID NO:1, or an RNA equivalent thereof. Suitable assay
methods in this regard include molecular genetic
techniques known to those in the art, such as restriction
fragment length polymorphism (RFLP) analysis, short tandem
repeat (STR) analysis employing PCR techniques, ligation
chain reaction (Barany, PCR Methods and Applications 1:5-
16, 1991), ribonuclease protection assays, and other
genetic linkage analysis techniques known in the art
(Sambrook et al., ibid.; Ausubel et. al., ibid.; Marian,
Chest 108:255-65, 1995). Ribonuclease protection assays
(see, e.g., Ausubel et al., ibid., ch. 4) comprise the
hybridization of an RNA probe to a patient RNA sample,
after which the reaction product (RNA-RNA hybrid) is
exposed to RNase. Hybridized regions of the RNA are
protected from digestion. Within PCR assays, a patient's
genetic sample is incubated with a pair of polynucleotide
primers, and the region between the primers is amplified
and recovered. Changes in size or amount of recovered
product are indicative of mutations in the patient.
Another PCR-based technique that can be employed is single
strand conformational polymorphism (SSCP) analysis
(Hayashi, PCR Methods and Applications 1:34-8, 1991).
Zacrp3 polypeptides may be used in the analysis
of energy efficiency of a mammal. Zacrp3 polypeptides
found in serum or tissue samples may be indicative of a
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
77
mammals ability to store food, with more highly efficient
mammals tending toward obesity. More specifically, the
present invention contemplates methods for detecting
zacrp3 polypeptide comprising:
exposing a sample possibly containing zacrp3
polypeptide to an antibody attached to a solid support,
wherein said antibody binds to an epitope of a zacrp3
polypeptide;
washing said immobilized antibody-polypeptide to
remove unbound contaminants;
exposing the immobilized antibody-polypeptide to
a second antibody directed to a second epitope of a zacrp3
polypeptide, wherein the second antibody is associated
with a detectable label; and
detecting the detectable label. The
concentration of zacrp3 polypeptide in the test sample
appears to be indicative of the energy efficiency of a
mammal. This information can aid nutritional analysis of
a mammal. Potentially, this information may be useful in
identifying and/or targeting energy deficient tissue.
A further aspect of the invention provides a
method for studying insulin. Such methods of the present
invention comprise incubating adipocytes in a culture
medium comprising zacrp3 polypeptide, monoclonal antibody,
agonist or antagonist thereof ~ insulin and observing
changes in adipocyte protein secretion or differentiation.
Anti-microbial protective agents may be directly
acting or indirectly acting. Such agents operating via
membrane association or pore forming mechanisms of action
directly attach to the offending microbe. Anti-microbial
agents can also act via an enzymatic mechanism, breaking
down microbial protective substances or the cell
wall/membrane thereof. Anti-microbial agents, capable of
inhibiting microorganism proliferation or action or of
disrupting microorganism integrity by either mechanism set
forth above, are useful in methods for preventing
contamination in cell culture by microbes susceptible to
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
78
that anti-microbial activity. Such techniques involve
culturing cells in the presence of an effective amount of
said zacrp3 polypeptide or an agonist or antagonist
thereof .
Also, zacrp3 polypeptides or agonists thereof
may be used as cell culture reagents in in vitro studies
of exogenous microorganism infection, such as bacterial,
viral or fungal infection. Such moieties may also be used
in in vivo animal models of infection.
The present invention also provides methods of
studying mammalian cellular metabolism. Such methods of
the present invention comprise incubating cells to be
studied, for example, human vascular endothelial cells, ~
zacrp3 polypeptide, monoclonal antibody, agonist or
antagonist thereof and observing changes in adipogenesis,
gluconeogenesis, glycogenolysis, lipogenesis, glucose
uptake, or the like.
An additional aspect of the invention provides a
method for studying dimerization or oligomerization. Such
methods of the present invention comprise incubating
zacrp3 polypeptides or fragments or fusion proteins
thereof containing a collagen-like domain alone or in
combination with other polypeptides bearing collagen-like
domains and observing the associations formed between the
collagen like domains. Such associations are indicated by
HPLC, circular dichroism or the like.
Zacrp3 polypeptides, fragments, fusion proteins,
antibodies, agonists or antagonists of the present
invention can be used in methods for promoting blood flow
within the vasculature of a mammal by reducing the number
of platelets that adhere and are activated and the size of
platelet aggregates. Used to such an end, Zacrp3 can be
administered prior to, during or following an acute
vascular injury in the mammal. Vascular injury may be due
to vascular reconstruction, including but not limited to,
angioplasty, coronary artery bypass graft, microvascular
repair or anastomosis of a vascular graft. Also
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
79
contemplated are vascular injuries due to trauma, stroke
or aneurysm. In other preferred methods the vascular
injury is due to plaque rupture, degradation of the
vasculature, complications associated with diabetes and
atherosclerosis. Plaque rupture in the coronary artery
induces heart attack and in the cerebral artery induces
stroke. Use of zacrp3 polypeptides, fragments, fusion
proteins, antibodies, agonists or antagonists in such
methods would also be useful for ameliorating whole system
diseases of the vasculature associated with the immune
system, such as disseminated intravascular coagulation
(DIC) and SIDS. Additionally the complement inhibiting
activity would be useful for treating non-vasculature
immune diseases such as arteriolosclerosis.
A correlation has been found between the
presence of Clq in localized ischemic myocardium and the
accumulation of leukocytes following coronary occlusion
and reperfusion. Release of cellular components following
tissue damage triggers complement activation which results
in toxic oxygen products that may be the primary cause of
myocardial damage (Rossen et al., Circ. Res. 62:572-84,
1998 and Tenner, ibid.). Blocking the complement pathway
was found to protect ischemic myocardium from reperfusion
injury (Buerke et al., J. Pharm. Exp. There. 286:429-38,
1998). Proteins having complement inhibition and Clq
binding activity would be useful for such purposes.
Collagen and Clq binding capabilities of
adipocyte complement related protein homologs such as
zacrp3 would be useful to pacify damaged collagenous
tissues preventing platelet adhesion, activation or
aggregation, and the activation of inflammatory processes
which lead to the release of toxic oxygen products. By
rendering the exposed tissue inert towards such processes
as complement activity, thrombotic activity and immune
activation, reduces the injurious effects of ischemia and
reperfusion. In particular, such injuries would include
trauma injury ischemia, intestinal strangulation, and
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
injury associated with pre- and post-establishment of
blood flow. Such polypeptides would be useful in the
treatment of cardiopulmonary bypass ischemia and
recesitation, myocardial infarction and post trauma
5 vasospasm, such as stroke or percutanious transluminal
angioplasty as well as accidental or surgical-induced
vascular trauma.
Additionally such collagen- and Clq-binding
polypeptides would be useful to pacify prosthetic
10 biomaterials and surgical equipment to render the surface
of the materials inert towards complement activation,
thrombotic activity or immune activation. Such materials
include, but are not limited to, collagen or collagen
fragment-coated biomaterials, gelatin-coated biomaterials,
15 fibrin-coated biomaterials, fibronectin-coated
biomaterials, heparin-coated biomaterials, collagen and
gel-coated stems, arterial grafts, synthetic heart
valves, artificial organs or any prosthetic application
exposed to blood that will bind zsig37 at greater than 1 x
20 108. Coating such materials can be done using methods
known in the art, see for example, Rubens, US Patent No.
5,272,074.
Complement and Clq play a role in inflammation.
The complement activation is initiated by binding of Clq
25 to immunoglobulins (Johnston, Pediatr. Infect. Dis. J.
12:933-41, 1993; Ward and Ghetie, Therap. Immunol. 2:77-
94, 1995). Inhibitors of Clq and complement would be
useful as anti-inflammatory agents. Such application can
be made to prevent infection. Additionally, such
30 inhibitors can be administrated to an individual suffering
from inflammation mediated by complement activation and
binding of immune complexes to Clq. Inhibitors of Clq and
complement would be useful in methods of mediating wound
repair, enhancing progression in wound healing by
35 overcoming impaired wound healing. Progression in wound
healing would include, for example, such elements as a
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
81
reduction in inflammation, fibroblasts recruitment, wound
retraction and reduction in infection.
Ability of tumor cells to bind to collagen may
contribute to the metastasis of tumors. Inhibitors of
collagen binding are also useful for mediating the
adhesive interactions and metastatic spread of tumors
(Noeske-Jungbult et al., US Patent No. 5,723,312).
In addition, zacrp3 polypeptides, fragments,
fusions agonists or antagonists thereof may be
therapeutically useful for anti-microbial applications.
For example, complement component Clq plays a role in host
defense against infectious agents, such as bacteria and
viruses. Clq is known to exhibit several specialized
functions. For example, Clq triggers the complement
cascade via interaction with bound antibody or C-reactive
protein (CRP). Also, Clq interacts directly with certain
bacteria, RNA viruses, mycoplasma, uric acid crystals, the
lipid A component of bacterial endotoxin and membranes of
certain intracellular organelles. Clq binding to the Clq
receptor is believed to promote phagocytosis. Clq also
appears to enhance the antibody formation aspect of the
host defense system. See, for example, Johnston, Pediatr.
Infect. Dis. J. 12 11 933-41, 1993. Thus, soluble Clq-
like molecules may be useful as anti-microbial agents,
promoting lysis or phagocytosis of infectious agents.
The positively charged, extracellular, triple
helix, collagenous domains of Clq and macrophage scavenger
receptor were determined to play a role in ligand binding
and were shown to have a broad binding specificity for
polyanions (Acton et al., J. Biol. Chem. 268:3530-37,
1993). Lysophospholipid growth factor (lysophosphatidic
acid, LPA) and other mitogenic anions localize at the site
of damaged tissues and assist in wound repair. LPA exerts
many biological effects including activation of platelets
and up-regulation of matrix assembly. It is thought that
LPA synergizes with other blood coagulation factors and
mediates wound healing.
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
82
The collagenous domains of proteins such as Clq
and macrophage scavenger receptor are know to bind acidic
phospholipids such as LPA. The interaction of zacrp3
polypeptides, fragments, fusions, agonists or antagonists
with mitogenic anions such as LPA can be determined using
assays known in the art, see for example, Acton et al.,
ibid. Inhibition of inflammatory processes by
polypeptides and antibodies of the present invention would
also be useful in preventing infection at the wound site.
For pharmaceutical use, the proteins of the
present invention can be formulated with pharmaceutically
acceptable carriers for parenteral, oral, nasal, rectal,
topical, transdermal administration or the like, according
to conventional methods. In a preferred embodiment
administration is made at or near the site of vascular
injury. In general, pharmaceutical formulations will
include a zacrp3 protein in combination with a
pharmaceutically acceptable vehicle, such as saline,
buffered saline, 5% dextrose in water or the like.
Formulations may further include one or more excipients,
preservatives, solubilizers, buffering agents, albumin to
prevent protein loss on vial surfaces, etc. Methods of
formulation are well known in the art and are disclosed,
for example, in Remington: The Science and Practice of
Pharmacy, Gennaro, ed., Mack Publishing Co., Easton PA,
19"' ed., 1995. Therapeutic doses will generally be
determined by the clinician according to accepted
standards, taking into account the nature and severity of
the condition to be treated, patient traits, etc.
Determination of dose is within the level of ordinary
skill in the art.
As used herein a "pharmaceutically effective
amount" of a zsig37 polypeptide, fragment, fusion protein,
agonist or antagonist is an amount sufficient to induce a
desired biological result. The result can be alleviation
of the signs, symptoms, or causes of a disease, or any
other desired alteration of a biological system. For
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
83
example, an effective amount of a zacrp3 polypeptide is
that which provides either subjective relief of symptoms
or an objectively identifiable improvement as noted by the
clinician or other qualified observer. Such an effective
amount of a zacrp3 polypeptide would provide, for example,
inhibition of collagen-activated platelet activation and
the complement pathway, including Clq, increase localized
blood flow within the vasculature of a patient and/or
reduction in injurious effects of ischemia and
reperfusion. Effective amounts of the zacrp3 polypeptides
can vary widely depending on the disease or symptom to be
treated. The amount of the polypeptide to be administered
and its concentration in the formulations, depends upon
the vehicle selected, route of administration, the potency
of the particular polypeptide, the clinical condition of
the patient, the side effects and the stability of the
compound in the formulation. Thus, the clinician will
employ the appropriate preparation containing the
appropriate concentration in the formulation, as well as
the amount of formulation administered, depending upon
clinical experience with the patient in question or with
similar patients. Such amounts will depend, in part, on
the particular condition to be treated, age, weight, and
general health of the patient, and other factors evident
to those skilled in the art. Typically a dose will be in
the range of 0.01-100 mg/kg of subject. In applications
such as balloon catheters the typical dose range would be
0.05-5 mg/kg of subject. Doses for specific compounds may
be determined from in vitro or ex vivo studies in
combination with studies on experimental animals.
Concentrations of compounds found to be effective in vitro
or ex vivo provide guidance for animal studies, wherein
doses are calculated to provide similar concentrations at
the site of action.
Polynucleotides encoding zacrp3 polypeptides are
useful within gene therapy applications where it is
desired to increase or inhibit zacrp3 activity. If a
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
84
mammal has a mutated or absent zacrp3 gene, the zacrp3
gene can be introduced into the cells of the mammal. In
one embodiment, a gene encoding a zacrp3 polypeptide is
introduced in vivo in a viral vector. Such vectors
include an attenuated or defective DNA virus, such as, but
not limited to, herpes simplex virus (HSV),
papillomavirus, Epstein Barr virus (EBV), adenovirus,
adeno-associated virus (AAV), and the like. Defective
viruses, which entirely or almost entirely lack viral
genes, are preferred. A defective virus is not infective
after introduction into a cell. Use of defective viral
vectors allows for administration to cells in a specific,
localized area, without concern that the vector can infect
other cells. Examples of particular vectors include, but
are not limited to, a defective herpes simplex virus 1
(HSV1) vector (Kaplitt et al., Molec. Cell. Neurosci.
2:320-30, 1991); an attenuated adenovirus vector, such as
the vector described by Stratford-Perricaudet et al., J.
Clin. Invest. 90:626-30, 1992; and a defective adeno-
associated virus vector (Samulski et al., J. Virol.
61:3096-101, 1987; Samulski et al., J. Virol. 63:3822-8,
1989).
In another embodiment, a zacrp3 gene can be
introduced in a retroviral vector, e.g., as described in
Anderson et al., U.S. Patent No. 5,399,346; Mann et al.
Cell 33:153, 1983; Temin et al., U.S. Patent No.
4,650,764; Temin et al., U.S. Patent No. 4,980,289;
Markowitz et al., J. Virol. 62:1120, 1988; Temin et al.,
U.S. Patent No. 5,124,263; WIPO Publication WO 95/07358;
and Kuo et al., Blood 82:845, 1993. Alternatively, the
vector can be introduced by lipofection in vivo using
liposomes. Synthetic cationic lipids can be used to
prepare liposomes for in vivo transfection of a gene
encoding a marker (Felgner et al., Proc. Natl. Acad. Sci.
USA 84:7413-7, 1987; Mackey et al., Proc. Natl. Acad. Sci.
USA 85:8027-31, 1988). The use of lipofection to introduce
exogenous genes into specific organs in vivo has certain
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
practical advantages. Molecular targeting of liposomes to
specific cells represents one area of benefit. More
particularly, directing transfection to particular cells
represents one area of benefit. For instance, directing
5 transfection to particular cell types would be
particularly advantageous in a tissue with cellular
heterogeneity, such as the pancreas, liver, kidney, and
brain. Lipids may be chemically coupled to other
molecules for the purpose of targeting. Targeted peptides
10 (e.g., hormones or neurotransmitters), proteins such as
antibodies, or non-peptide molecules can be coupled to
liposomes chemically.
It is possible to remove the target cells from
the body; to introduce the vector as a naked DNA plasmid;
15 and then to re-implant the transformed cells into the
body. Naked DNA vectors for gene therapy can be
introduced into the desired host cells by methods known in
the art, e.g., transfection, electroporation,
microinjection, transduction, cell fusion, DEAE dextran,
20 calcium phosphate precipitation, use of a gene gun or use
of a DNA vector transporter. See, e.g., Wu et al., J.
Biol. Chem. 267:963-7, 1992; Wu et al., J. Biol. Chem.
263:14621-4, 1988.
Antisense methodology can be used to inhibit
25 zacrp3 gene transcription, such as to inhibit cell
proliferation in vivo. Polynucleotides that are
complementary to a segment of a zacrp3-encoding
polynucleotide (e.g., a polynucleotide as set froth in SEQ
ID NO:1) are designed to bind to zacrp3-encoding mRNA and
30 to inhibit translation of such mRNA. Such antisense
polynucleotides are used to inhibit expression of zacrp3
polypeptide-encoding genes in cell culture or in a
subject.
Transgenic mice, engineered to express the
35 zacrp3 gene, and mice that exhibit a complete absence of
zacrp3 gene function, referred to as "knockout mice"
(Snouwaert et al., Science 257:1083, 1992), may also be
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
86
generated (Lowell et al., Nature 366:740-42, 1993). These
mice may be employed to study the zacrp3 gene and the
protein encoded thereby in an in vivo system.
The invention is further illustrated by the
following non-limiting examples.
EXAMPLES
Example 1
Chromosomal Assignment and Placement of Zacrp3
Zacrp3 was mapped to human chromosome 5 using
the commercially available version of the Stanford G3
Radiation Hybrid Mapping Panel (Research Genetics, Inc.,
Huntsville, AL). The Stanford G3 RH Panel contains PCRable
DNAs from each of 83 radiation hybrid clones of the whole
human genome, plus two control DNAs (the RM donor and the
A3 recipient). A publicly available WWW server
(http://shgc-www.stanford.edu) allows chromosomal
localization of markers.
For the mapping of zacrp3 with the Stanford G3
RH Panel, 20 ~.zl reactions were set up in a 96-well
microtiter plate (Stratagene, La Jolla, CA) and used in a
RoboCycler Gradient 96 thermal cycler (Stratagene). Each
of the 85 PCR reactions consisted of 2 ul lOX KlenTaq PCR
reaction buffer (Clontech Laboratories, Inc., Palo Alto,
CA), 1.6 ul dNTPs mix (2.5 mM each, PERKIN-ELMER, Foster
City, CA) , 1 ul sense primer, ZC 21, 913 ( SEQ ID NO : 13 ) , 1
ul antisense primer, ZC 21,914 (SEQ ID N0:14), 2 ul
RediLoad (Research Genetics, Inc.), 0.4 ul 50X Advantage
KlenTaq Polymerase Mix (Clontech Laboratories, Inc.), 25
ng of DNA from an individual hybrid clone or control and
ddHzO for a total volume of 20 ul. The reactions were
overlaid with an equal amount of mineral oil and sealed.
The PCR cycler conditions were as follows: an initial 1
cycle 5 minute denaturation at 94oC, 35 cycles of a 45
seconds denaturation at 94°C, 45 seconds annealing at 62oC
and 1 minute and 15 seconds extension at 72oC, followed by
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
87
a final 1 cycle extension of 7 minutes at 72oC. The
reactions were separated by electrophoresis on a 20
agarose gel (Life Technologies, Gaithersburg, MD).
The results showed linkage of Zacrp3 to the
human chromosome 5 framework marker SHGC-56588 with a LOD
score of 15.58 and at a distance of 0 cR 10000 from the
marker. The use of surrounding markers positions Zacrp3 in
the 5p12 region on the integrated LDB human chromosome 5
map (The Genetic Location Database, University of
Southhampton, WWW server: http://cedar.genetics.soton.ac.
uk/public html/).
Example 2
Baculovirus Expression of Zacrp3
An expression vector, pzacrp3cee, was prepared
to express human zacrp3 polypeptides having a carboxy-
terminal Glu-Glu tag, in insect cells.
A. Construction of pzacrp3cee
A 766 by fragment containing sequence for zacrp3
(SEQ ID NO:1) and a polynucleotide sequence encoding BamHI
and Xbal restriction sites on the 5' and 3' ends,
respectively, was generated by PCR amplification from a
plasmid containing zacrp3 cDNA using primers ZC23377 (SEQ
ID N0:15) and ZC23378 (SEQ ID N0:16). The PCR reaction
conditions were as follows: 1 cycle of 94C for 4 minutes,
followed by 25 cycles of 94°C for 45 seconds, 50°C for 45
seconds, and 72°C for 2 minutes; 1 cycle at 72°C for 10
min; followed by a 4C soak. The fragment was visualized by
gel electrophoresis (1% Seaplaque/1% NuSieve). The band
was excised, diluted to 0.5% agarose with 2 mM MgCl2,
melted at 65°C and ligated into an BamHI/XbaI digested
baculovirus expression donor vector, pZBV32L. The pZBV32L
vector is a modification of the pFastBaclT"" (Life
Technologies) expression vector, where the polyhedron
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
88
promoter has been removed and replaced with the late
activating Basic Protein Promoter and the coding sequence
for the Glu-Glu tag (SEQ ID N0:17) as well as a stop
signal is inserted at the 3' end of the multiple cloning
region). About 11 nanograms of the restriction digested
zacrp3 insert and about 23 ng of the corresponding vector
were ligated overnight at 16°C. The ligation mix was
diluted 3 fold in TE (10 mM Tris-HC1, pH 7.5 and 1 mM
EDTA) and 4 fmol of the diluted ligation mix was
transformed into DH5oc Library Efficiency competent cells
(Life Technologies) according to manufacturer's direction
by heat shock for 45 seconds in a 42°C waterbath. The
transformed DNA and cells were diluted in 450 ~,1 of SOC
media (2% Bacto Tryptone, 0.5o Bacto Yeast Extract, 10 ml
1M NaCl, 1.5 mM KC1, 10 mM MgCl2, 10 mM MgS04 and 20 mM
glucose) and plated onto LB plates containing 100 ~Lg/ml
ampicillin. Clones were analyzed by restriction digests
and 1 x.1,1 of the positive clone was transformed into 20 E.1.1
DHlOBac Max Efficiency competent cells (GIBCO-BRL,
Gaithersburg, MD) according to manufacturer's instruction,
by heat shock for 45 seconds in a 42°C waterbath. The
transformed cells were then diluted in 980 ).~,1 SOC media
(2% Bacto Tryptone, 0.5a Bacto Yeast Extract, 10 ml 1M
NaCl, 1.5 mM KCl, 10 mM MgCl2, 10 mM MgS04 and 20 mM
glucose) out grown in shaking incubator at 37C for four
hours and plated onto Luria Agar plates containing 50
~g/ml kanamycin, 7 ~g/ml gentamicin, 10 ~g/ml
tetracycline, IPTG and Bluo Gal. The plated cells were
incubated for 48 hours at 37°C. A color selection was used
to identify those cells having zacrp3cee encoding donor
insert that had incorporated into the plasmid (referred to
as a "bacmid"). Those colonies, which were white in
color, were picked for analysis. Bacmid DNA was isolated
from positive colonies using the QiaVac Miniprep8 system
(Qiagen) according the manufacturer's directions. Clones
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
89
were screened for the correct insert by amplifying DNA
using primers to the transposable element in the bacmid
via PCR using primers ZC447 (SEQ ID N0:18) and ZC976 (SEQ
ID N0:19). The PCR reaction conditions were as follows:
35 cycles of 94°C for 45 seconds, 50°C for 45 seconds, and
72°C for 5 minutes; 1 cycle at 72°C for 10 min. ; followed
by 4oC soak. The PCR product was run on a 1% agarose gel
to check the insert size. Those having the correct insert
were used to transfect Spodoptera frugiperda (Sf9) cells.
B. Transfection
Sf9 cells were seeded at 5 x 106 cells per 35 mm
plate and allowed to attach for 1 hour at 27°C. Five
microliters of bacmid DNA was diluted with 100 ~1 Sf-900
II SFM (Life Technologies) . Six ~.~1 of CeIIFECTIN Reagent
(Life Technologies) was diluted with 100 x.1.1 Sf-900 II SFM.
The bacmid DNA and lipid solutions were gently mixed and
incubated 30-45 minutes at room temperature. The media
from one plate of cells were aspirated, the cells were
washed 1X with 2 ml fresh Sf-900 II SFM media. Eight
hundred microliters of Sf-900 II SFM was added to the
lipid-DNA mixture. The wash media was aspirated and the
DNA-lipid mix added to the cells. The cells were
incubated at 27°C for 4-5 hours. The DNA-lipid mix was
aspirated and 2 ml of Sf-900 II media was added to each
plate. The plates were incubated at 27°C, 90o humidity,
for 96 hours after which the virus was harvested.
C. Primary Amplification
Sf9 cells were grown in 50 ml Sf-900 II SFM in a
125 ml shake flask to an approximate density of 0.41-0.52
x 105 cells/ml. They were then infected with 150 ~,1 of the
virus stock from above and incubated at 27°C for 3 days
after which time the virus was harvested according to
standard methods known in the art.
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
Examt~le 3
Purification of Baculovirus Expressed Glu-Glu-tagged
zacrp3 polypeptides
5
Unless otherwise noted, all operations were
carried out at 4°C. A mixture of protease inhibitors were
added to a 2 liter sample of conditioned media from C-
terminal Glu-Glu (EE) tagged zacrp3 baculovirus-infected
10 Sf9 cells to final concentrations of 2.5 mM
ethylenediaminetetraacetic acid (EDTA, Sigma Chemical Co.
St. Louis, MO), 0.001 mM leupeptin (Boehringer-Mannheim,
Indianapolis, IN), 0.001 mM pepstatin (Boehringer-
Mannheim) and 0.4 mM Pefabloc (Boehringer-Mannheim). The
15 sample was centrifuged at 10,000 rpm for 30 min at 4°C in
a Beckman JLA-10.5 rotor (Beckman Instruments) in a
Beckman Avanti J25I centrifuge (Beckman Instruments) to
remove cell debris. To the supernatant fraction was added
a 50.0 ml sample of anti-EE Sepharose, prepared as
20 described below, and the mixture was gently agitated on a
Wheaton (Millville, NJ) roller culture apparatus for 18.0
h at 4°C.
The mixture was poured into a 5.0 x 20.0 cm
Econo-Column (Bio-Rad Laboratories) and the gel was washed
25 with 30 column volumes of phosphate buffered saline (PBS).
The unretained flow-through fraction was discarded. Once
the absorbance of the effluent at 280 nM was less than
0.05, flow through the column was reduced to zero and
the anti-EE Sepharose gel was washed with 2.0 column
30 volumes of PBS containing 0.2 mg/ml of EE peptide
(AnaSpec, San Jose, CA). The peptide used has the
sequence Glu-Tyr-Met-Pro-Val-Asp (SEQ ID N0:20). After
1.0 hour at 4°C, flow was resumed and the eluted protein
was collected. This fraction was referred to as the
35 peptide elution. The anti-EE Sepharose gel was washed
with 2.0 column volumes of 0.1 M glycine, pH 2.5, and the
glycine wash was collected separately. The pH of the
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
91
glycine-eluted fraction was adjusted to 7.0 by the
addition of a small volume of lOX PBS and stored at 4°C.
The peptide elution was concentrated to 5.0 ml
using a 5,000 molecular weight cutoff membrane
concentrator (Millipore) according to the manufacturer's
instructions. The concentrated peptide elution was
separated from free peptide by chromatography on a 1.5 x
50 cm Sephadex G-50 (Pharmacia) column equilibrated in PBS
at a flow rate of 1.0 ml/min using a BioCad Sprint HPLC
(PerSeptive BioSystems). Two ml fractions were collected
and the absorbance at 280 nM was monitored. The first
peak of material absorbing at 280 nM and eluting near the
void volume of the column was collected. This material
represented purified zacrp3CEE and was composed of two
major bands of apparent molecular weights.
Preparation of anti-EE Sepharose
A 100 ml bed volume of protein G-Sepharose
(Pharmacia) was washed 3 times with 100 ml of PBS
containing 0.020 sodium azide using a 500 ml Nalgene 0.45
micron filter unit. The gel was washed with 6.0 volumes
of 200 mM triethanolamine, pH 8.2 (TEA, Sigma), and an
equal volume of EE antibody solution containing 900 mg of
antibody was added. After an overnight incubation at 4°C,
unbound antibody was removed by washing the resin with 5
volumes of 200 mM TEA as described above. The resin was
resuspended in 2 volumes of TEA, transferred to a
suitable container, and dimethylpimilimidate-2 HC1
(Pierce), dissolved in TEA, was added to a final
concentration of 36 mg/ml of gel. The gel was rocked at
room temperature for 45 min and the liquid was removed
using the filter unit as described above. Nonspecific
sites on the gel were then blocked by incubating for 10
minutes at room temperature with 5 volumes of 20 mM
ethanolamine in 200 mM TEA. The gel was then washed with
5 volumes of PBS containing 0 . 02 o sodium azide and stored
in this solution at 4°C.
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
92
Example 4
Adhesion Molecule Assays
Upon stimulation with inflammatory cytokines
such as TNF (tumor necrosis factor), human microvascular
bone marrow cells (TRBMEC) express cell surface adhesion
molecules, including E-selectin (endothelial leukocyte
adhesion molecule), V-CAM (vascular cell adhesion
molecule), and I-CAM (intercellular adhesion molecule.
The effect of zacrp3 on expression of cell
surface adhesion molecules was determined using
microvascular bone marrow cells (TRBMEC) in a cell based
ELISA according to Ouchi et al., (Circulation 100:2473-7,
1999). Briefly, TRBMEC cells were grown in 96 well, flat
bottom plates (Costar, Pleasanton, CA) until confluent.
Both wild type control media and baculovirus-expressed
zacrp3 media was concentrated lOX before testing
(Centricon Centrifugal Filtration Unit 5,OOOK cutoff,
Millipore Corp., Bedford, MA) according to the
manufacturer's instructions. To each well 90 ~,1 of
zacrp3-containing media or control media was added, and
the plates were incubated at 37oC, 5% C02 overnight. The
next day, half of the samples received 10 ~L1 of TNFOC (10
ng/ml, R&D Systems, Minneapolis, MN), the other samples
were untreated, measuring basal expression. The plates
were then incubated at 37oC, 5% C02 for 4 hours.
Following incubation, the media was removed from
the plates and 50 x.1.1 anti-human VCAM antibody (1:1000
dilution of a 1 mg/ml stock, R&D Systems) , 50 ~,l of anti
human ICAM-1 monoclonal antibody (1:1000 dilution of a 1
mg/ml stock, R&D Systems), or 50 ~,1 of anti-human E-
selectin antibodies (1:1000 dilution of a 1 mg/ml stock,
R&D Systems) were then added to triplicate wells and the
plates were incubated at 37oC, 5% C02 for 1 hour.
The antibody solution was removed and the plates
were washed three times in warm RPMI + 5% FBS. Following
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
93
the last wash, 100 ~1/well of an 0.05% gluteraldehyde
solution (1:1000 of 50% gluteraldehyde in PBS) was added
to the wells and the plates were incubated at room
temperature for 10 minutes. The plates were washed three
times with PBS and 50 ~1/well of secondary antibody
(1:1000 dilution of goat Oc-mouse IgG whole molecule HRP
conjugate, (Sigma Chemical Co., St. Louis, Mo.) was added
to all wells. The plates were incubated for one hour at
37oC.
The plates were then washed five times with
washing buffer (PBS + 0.05% Tween 20) and 100 ~1/well TMB
solution (100 ~l of 4 mg/ml Tetra methyl benzidine (Sigma)
in DMSO, in 10 ml 60 mM Na Acetate pH 5 . 0 and 100 x..1.1 1 . 2 %
H2O2) was added to each well. The plates were allowed to
develop at room temperature for 15-20 minutes at which
time the reaction was quenched by adding 100 ~.1/well 1M
H2S04. Plates were read at 450 nm with reference
wavelength of 655 nm.
Zacrp3 showed no effect on ICAM-1 expression.
Zacrp3 did show an effect on VCAM-1 expression. When
compared to the maximal TNF response, zacrp3 treated cells
showed about 50% inhibition. Zacrp3 also had an effect,
although less, 10~ inhibition of E-selection expression.
VCAM-1 expression was measured following direct
adenovirus infection of TRBMEC cells. Briefly, TRBMEC
cells were directly infected with an adenovirus containing
zacrp3 or the parental adenovirus strain. The virus was
added at various multiplicities of infection (moi 500,
1,000 and 5,000). Cells were incubated at 37oC, 5% COz for
43 hours. Following infection, the adenovirus-infected
cells were challenged with TNFOC (1 ng/ml) for four hours.
VCAM expression was measured as described above.
Inhibition of VCAM-1 expression was about 13% at moi 5000,
about 5% at moi 1000 and no effect was seen at moi 500.
Adenovirus conditioned media was concentrated
lOX (Centricon Centrifugal Filtration Unit 5,OOOK cutoff,
Millipore Corp., Bedford, MA) according to the
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
94
manufacturer's instructions followed by heat inactivation
at 56oC for 30 minutes). The concentrated heat
inactivated samples were assayed as described above. For
VCAM-1 and E-selectin, inhibition was 100%. Similar
results were observed when either IL-1 or LPS was used to
induce adhesion molecule expression. For ICAM-1,
inhibition was reduced to nearly baseline. The experiment
was repeated with varying concentrations of zacrp3 heat
inactivated adenovirus conditioned media. Complete
inhibition was seen at 5X, 50o inhibition at 2.5X and no
inhibition at 0.5X.
A THP-1 monocyte adherence assay according to
Ouchi et al., (ibid.) and Cybulsky and Gimbrone, (Science
251:788-91, 1991) showed the same results as were seen for
VCAM-1 above.
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
- 1
SEQUENCE LISTING
<110> ZymoGenetics, Inc.
<120> ADIPOCYTE-SPECIFIC PROTEIN HOMOLOG ZACRP3
<130> 99-09
<150> 60/130,199
<151> 1999-04-20
<160> 20
<170> FastSEQ for Windows Version 3.0
<210>1
<211>1696
<212>DNA
<213>Homo sapiens
<220>
<221> CDS
<222> (69)...(806)
<400> 1
cccgaggaga ccacgctcct ggagctctgc tgtcttctca gggagactct gaggctctgt 60
tgagaatc atg ctt tgg agg cag ctc atc tat tgg caa ctg ctg get ttg 110
Met Leu Trp Arg Gln Leu Ile Tyr Trp Gln Leu Leu Ala Leu
1 5 10
ttt ttc ctc cct ttt tgc ctg tgt caa gat gaa tac atg gag tct cca 158
Phe Phe Leu Pro Phe Cys Leu Cys Gln Asp Glu Tyr Met Glu Ser Pro
15 20 25 30
caa acc gga gga cta ccc cca gac tgc agt aag tgt tgt cat gga gac 206
Gln Thr Gly Gly Leu Pro Pro Asp Cys Ser Lys Cys Cys His Gly Asp
35 40 45
tac agc ttt cga ggc tac caa ggc ccc cct ggg cca ccg ggc cct cct 254
Tyr Ser Phe Arg Gly Tyr Gln Gly Pro Pro Gly Pro Pro Gly Pro Pro
50 55 60
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
- 2
ggc att cca gga aac cat gga aac aat ggc aac aat gga gcc act ggt 302
Gly Ile Pro Gly Asn His Gly Asn Asn Gly Asn Asn Gly Ala Thr Gly
65 70 75
cat gaa gga gcc aaa ggt gag aag ggc gac aaa ggt gac ctg ggg cct 350
His G1u Gly A1a Lys Gly G1u Lys Gly Asp Lys Gly Asp Leu Gly Pro
80 85 90
cga ggg gag cgg ggg cag cat ggc ccc aaa gga gag aag ggc tac ccg 398
Arg Gly Glu Arg Gly Gln His Gly Pro Lys Gly Glu Lys Gly Tyr Pro
95 100 105 110
ggg att cca cca gaa ctt cag att gca ttc atg get tct ctg gca acc 446
Gly Ile Pro Pro Glu Leu Gln Ile Ala Phe Met Ala Ser Leu Ala Thr
115 120 125
cac ttc agc aat cag aac agt ggg att atc ttc agc agt gtt gag acc 494
His Phe Ser Asn Gln Asn Ser Gly Ile Ile Phe Ser Ser Val Glu Thr
130 135 140
aac att gga aac ttc ttt gat gtc atg act ggt aga ttt ggg gcc cca 542
Asn Ile Gly Asn Phe Phe Asp Val Met Thr Gly Arg Phe Gly Ala Pro
145 150 155
gta tca ggt gtg tat ttc ttc acc ttc agc atg atg aag cat gag gat 590
Val Ser Gly Val Tyr Phe Phe Thr Phe Ser Met Met Lys His Glu Asp
160 165 170
gtt gag gaa gtg tat gtg tac ctt atg cac aat ggc aac aca gtc ttc 638
Val Glu Glu Ual Tyr Val Tyr Leu Met His Asn Gly Asn Thr Val Phe
175 180 185 190
agc atg tac agc tat gaa atg aag ggc aaa tca gat aca tcc agc aat 686
Ser Met Tyr Ser Tyr Glu Met Lys Gly Lys Ser Asp Thr Ser Ser Asn
195 200 205
cat get gtg ctg aag cta gcc aaa ggg gat gag gtt tgg ctg cga atg 734
His Ala Val Leu Lys Leu Ala Lys Gly Asp Glu Ual Trp Leu Arg Met
210 215 220
ggc aat ggc get ctc cat ggg gac cac caa cgc ttc tcc acc ttt gca 782
Gly Asn Gly Ala Leu His Gly Asp His Gln Arg Phe Ser Thr Phe Ala
225 230 235
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
3
gga ttc ctg ctc ttt gaa act aag taaatatatg actagaatag ctccactttg 836
Gly Phe Leu Leu Phe Glu Thr Lys
240 245
gggaagacttgtagctgagctgatttgttacgatctgaggaacattaaagttgagggttt896
tacattgctgtattcaaaaaattattggttgcaatgttgttcacgctacaggtacaccaa956
taatgttggacaattcaggggctcagaagaatcaaccacaaaatagtcttctcagatgac1016
cttgactaatatactcagcatctttatcactctttccttggcacctaaaagataattctc1076
ctctgacgcaggttggaaatatttttttctatcacagaagtcatttgcaaagaattttga1136
ctactctgcttttaatttaataccagttttcaggaacccctgaagttttaagttcattat1196
tctttataacatttgagagaatcggatgtagtgatatgacagggctggggcaagaacagg1256
ggcactagctgccttattagctaatttagtgccctccgtgttcagcttagcctttgaccc1316
tttccttttgatccacaaaatacattaaaactctgaattcacatacaatgctattttaaa1376
gtcaatagattttagctataaagtgcttgaccagtaatgtggttgtaattttgtgtatgt1436
tcccccacatcgcccccaacttcggatgtggggtcaggaggttgaggttcactattaaca1496
aatgtcataaatatctcatagaggtacagtgccaatagatattcaaatgttgcatgttga1556
ccagagggattttatatctgaagaacatacactattaataaataccttagagaaagattt1616
tgacctggctttagataaaactgtggcaagaaaaatgtaatgagcaatatatggaaataa1676
acacacctttgttaaagata 1696
<210>2
<211>246
<212>PRT
<213>Homo Sapiens
<400> 2
Met Leu Trp Arg Gln Leu Ile Tyr Trp Gln Leu Leu Ala Leu Phe Phe
1 5 - 10 15
Leu Pro Phe Cys Leu Cys Gln Asp Glu Tyr Met Glu Ser Pro Gln Thr
20 25 30
Gly Gly Leu Pro Pro Asp Cys Ser Lys Cys Cys His Gly Asp Tyr Ser
35 40 45
Phe Arg Gly Tyr Gln Gly Pro Pro Gly Pro Pro Gly Pro Pro Gly Ile
50 55 60
Pro Gly Asn His Gly Asn Asn Gly Asn Asn Gly Ala Thr Gly His Glu
65 70 75 g0
Gly Ala Lys Gly Glu Lys Gly Asp Lys Gly Asp Leu Gly Pro Arg Gly
85 90 95
Glu Arg Gly Gln His Gly Pro Lys Gly Glu Lys Gly Tyr Pro Gly Ile
100 105 110
Pro Pro Glu Leu Gln Ile Ala Phe Met Ala Ser Leu Ala Thr His Phe
115 120 125
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
4
Ser Asn Gln Asn Ser Gly Ile Ile Phe Ser Ser Val Glu Thr Asn Ile
130 135 140
Gly Asn Phe Phe Asp Val Met Thr Gly Arg Phe Gly Ala Pro Val Ser
145 150 155 160
Gly Val Tyr Phe Phe Thr Phe Ser Met Met Lys His Glu Asp Val Glu
165 170 175
Glu Val Tyr Val Tyr Leu Met His Asn Gly Asn Thr Val Phe Ser Met
180 185 190
Tyr Ser Tyr Glu Met Lys Gly Lys Ser Asp Thr Ser Ser Asn His Ala
195 200 205
Val Leu Lys Leu Ala Lys Gly Asp Glu Val Trp Leu Arg Met Gly Asn
210 215 220
Gly Ala Leu His Gly Asp His Gln Arg Phe Ser Thr Phe Ala Gly Phe
225 230 235 240
Leu Leu Phe Glu Thr Lys
245
<210>3
<211>244
<212>PRT
<213>Homo Sapiens
<400> 3
Met Leu Leu Leu Gly Ala Val Leu Leu Leu Leu Ala Leu Pro Gly His
1 5 10 15
Asp Gln Glu Thr Thr Thr Gln Gly Pro Gly Val Leu Leu Pro Leu Pro
20 25 30
Lys Gly Ala Cys Thr Gly Trp Met Ala Gly Ile Pro Gly His Pro Gly
35 40 45
His Asn Gly Ala Pro Gly Arg Asp Gly Arg Asp Gly Thr Pro Gly Glu
50 55 60
Lys Gly Glu Lys Gly Asp Pro Gly Leu Ile Gly Pro Lys Gly Asp Ile
65 70 75 80
Gly Glu Thr Gly Val Pro Gly Ala Glu Gly Pro Arg Gly Phe Pro Gly
85 90 95
Ile Gln Gly Arg Lys Gly Glu Pro Gly Glu Gly Ala Tyr Val Tyr Arg
100 105 110
Ser Ala Phe Ser Val Gly Leu Glu Thr Tyr Ual Thr Ile Pro Asn Met
115 120 125
Pro Ile Arg Phe Thr Lys Ile Phe Tyr Asn Gln Gln Asn His Tyr Asp
130 135 140
Gly Ser Thr Gly Lys Phe His Cys Asn Ile Pro Gly Leu Tyr Tyr Phe
145 150 155 160
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
Ala Tyr His Ile Thr Val Tyr Met Lys Asp Val Lys Val Ser Leu Phe
165 170 175
Lys Lys Asp Lys Ala Met Leu Phe Thr Tyr Asp Gln Tyr Gln Glu Asn
180 185 190
Asn Val Asp Gln Ala Ser Gly Ser Val Leu Leu His Leu Glu Val Gly
195 200 205
Asp Gln Val Trp Leu Gln Val Tyr Gly Glu Gly Glu Arg Asn Gly Leu
210 215 220
Tyr Ala Asp Asn Asp Asn Asp Ser Thr Phe Thr Gly Phe Leu Leu Tyr
225 230 235 240
His Asp Thr Asn
<210>4
<211>245
<212>PRT
<213>Homo Sapiens
<400> 4
Met Asp Val Gly Pro Ser Ser Leu Pro His Leu Gly Leu Lys Leu Leu
1 5 10 15
Leu Leu Leu Leu Leu Leu Ala Leu Arg Gly Gln Ala Asn Thr Gly Cys
20 25 30
Tyr Gly Ile Pro Gly Met Pro Gly Leu Pro Gly Ala Pro Gly Lys Asp
35 40 45
Gly Tyr Asp Gly Leu Pro Gly Pro Lys Gly Glu Pro Gly Ile Pro Ala
50 55 60
Ile Pro Gly Ile Arg Gly Pro Lys Gly Gln Lys Gly Glu Pro Gly Leu
65 70 75 80
Pro Gly His Pro Gly Lys Asn Gly Pro Met Gly Pro Pro Gly Met Pro
85 90 95
Gly Val Pro Gly Pro Met Gly Ile Pro Gly Glu Pro Gly Glu Glu Gly
100 105 110
Arg Tyr Lys Gln Lys Phe Gln Ser Val Phe Thr Val Thr Arg Gln Thr
115 120 125
His Gln Pro Pro Ala Pro Asn Ser Leu Ile Arg Phe Asn Ala Val Leu
130 135 140
Thr Asn Pro Gln Gly Asp Tyr Asp Thr Ser Thr Gly Lys Phe Thr Cys
145 150 155 160
Lys Val Pro Gly Leu Tyr Tyr Phe Val Tyr His Ala Ser His Thr Ala
165 170 175
Asn Leu Cys Val Leu Leu Tyr Arg Ser Gly Val Lys Val Val Thr Phe
180 185 190
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
6
Cys Gly His Thr Ser Lys Thr Asn Gln Ual Asn Ser Gly Gly Ual Leu
195 200 205
Leu Arg Leu Gln Val Gly Glu Glu Val Trp Leu Ala Val Asn Asp Tyr
210 215 220
Tyr Asp Met Ual Gly Ile Gln Gly Ser Asp Ser Val Phe Ser Gly Phe
225 230 235 240
Leu Leu Phe Pro Asp
245
<210> 5
<211> 31
<212> PRT
<213> Artificial Sequence
<220>
<223> Aromatic motif
<221> VARIANT
<222> (2)...(6)
<223> Each Xaa is independently any amino acid residue
<221> VARIANT
<222> (7)...(7)
<223> Xaa is asparagine or aspartic acid
<221> VARIANT
<222> (8)...(11)
<223> Each Xaa is independently any amino acid residue
<221> VARIANT
<222> (12)...(12)
<223> Xaa is phenyalanine, tyrosine, tryptohan or
leucine
<221> VARIANT
<222> (13)...(18)
<223> Each Xaa is independently any amino acid residue
<221> VARIANT
<222> (20)...(24)
<223> Each Xaa is independently any amino acid residue.
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
7
<221> VARIANT
<222> (26)...(26)
<223> Xaa is any amino acid residue
<221> VARIANT
<222> (28)...(28)
<223> Xaa is any amino acid residue
<221> VARIANT
<222> (30)...(30)
<223> Xaa is any amino acid residue
<221> VARIANT
<222> (31)...(31)
<223> Xaa is phenyalanine or tyrosine
<400> 5
Phe Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
1 5 10 15
Xaa Xaa Phe Xaa Xaa Xaa Xaa Xaa Gly Xaa Tyr Xaa Phe Xaa Xaa
20 25 30
<210> 6
<211> 17
<212> DNA
<213> Artificial Sequence
<220>
<223> Degenerate nucleotide primer
<221> variation
<222> (1)...(18)
<223> Each N is independently any nucleotide
<400> 6
ggngansarg tntggyt 17
<210> 7
<211> 18
<212> DNA
<213> Artificial Sequence
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
8
<220>
<223> Degenerate nucleotide primer
<221> variation
<222> (1)...(17)
<223> Each N is independently any nucleotide
<400> 7
sngnnntnta ytwyttyr lg
<210> 8
<211> 17
<212> DNA
<213> Artificial Sequence
<220>
<223> Degenerate nucleotide primer
<221> variation
<222> (1)...(17)
<223> Each N is independently any nucleotide
<400> 8
ttydsnggnt tyytnht 17
<210> 9
<211> 18
<212> DNA
<213> Artificial Sequence
<220>
<223> Degenerate nucleotide primer
<221> variation
<222> (1)...(18)
<223> Each N is independently any nucleotide
<400> 9
ytwyrayrbn wbnwsngg lg
<210> 10
<211> 738
<212> DNA
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
9
<213> Artificial Sequence
<220>
<223> Degenerate nucleotide sequence encoding the
polypeptide of SEQ ID N0:2
<221> variation
<222> (1)...(738)
<223> Each N is independently any nucleotide
<400> 10
atgytntggmgncarytnathtaytggcarytnytngcnytnttyttyytnccnttytgy 60
ytntgycargaygartayatggarwsnccncaracnggnggnytnccnccngaytgywsn 120
aartgytgycayggngaytaywsnttymgnggntaycarggnccnccnggnccnccnggn 180
ccnccnggnathccnggnaaycayggnaayaayggnaayaayggngcnacnggncaygar 240
ggngcnaarggngaraarggngayaarggngayytnggnccnmgnggngarmgnggncar 300
cayggnccnaarggngaraarggntayccnggnathccnccngarytncarathgcntty 360
atggcnwsnytngcnacncayttywsnaaycaraaywsnggnathathttywsnwsngtn 420
garacnaayathggnaayttyttygaygtnatgacnggnmgnttyggngcnccngtnwsn 480
ggngtntayttyttyacnttywsnatgatgaarcaygargaygtngargargtntaygtn 540
tayytnatgcayaayggnaayacngtnttywsnatgtaywsntaygaratgaarggnaar 600
wsngayacnwsnwsnaaycaygcngtnytnaarytngcnaarggngaygargtntggytn 660
mgnatgggnaayggngcnytncayggngaycaycarmgnttywsnacnttygcnggntty 720
ytnytnttygaracnaar 738
<210>11
<211>1117
<212>DNA
<213>Mus musculus
<220>
<221> CDS
<222> (111)...(848)
<400> 11
gctgcagctc tcatctccaa acctggcatt tgcctgaggc gaccacggta cctccagccc 60
ctgtcaagct tccctgcgag actcttgtcg atttgccgat ttgccgagcc atg ctc 116
Met Leu
1
ggg agg cag cgc atc tgg tgg cac ctg ctg cct ttg ctt ttc ctc cca 164
Gly Arg Gln Arg Ile Trp Trp His Leu Leu Pro Leu Leu Phe Leu Pro
10 15
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
ttt tgc ctg tgt caa gat gaa tac atg gag tct cca caa get gga gga 212
Phe Cys Leu Cys Gln Asp Glu Tyr Met Glu Ser Pro Gln Ala Gly Gly
25 30
ctg ccc cca gac tgc agc aag tgt tgc cat gga gat tat gga ttt cgt 260
Leu Pro Pro Asp Cys Ser Lys Cys Cys His Gly Asp Tyr Gly Phe Arg
35 40 45 50
ggt tac caa ggg ccc cct gga cct cca ggt cct cct ggc att cca gga 308
Gly Tyr Gln Gly Pro Pro Gly Pro Pro Gly Pro Pro Gly Ile Pro Gly
55 60 65
aac cat gga aac aat ggg aac aat gga get act ggc cat gaa ggg gcc 356
Asn His Gly Asn Asn Gly Asn Asn Gly Ala Thr Gly His Glu Gly Ala
70 75 80
aaa ggt gag aaa gga gac aaa ggc gac cta ggc cct cga gga gaa cgg 404
Lys Gly Glu Lys Gly Asp Lys Gly Asp Leu Gly Pro Arg Gly Glu Arg
85 90 95
ggg cag cat ggc ccc aaa gga gag aaa ggc tac cca ggg gtg cca cca 452
Gly Gln His Gly Pro Lys Gly Glu Lys Gly Tyr Pro Gly Val Pro Pro
100 105 110
gaa ctg cag att gca ttc atg get tct cta gca act cac ttc agc aat 500
Glu Leu Gln Ile Ala Phe Met Ala Ser Leu Ala Thr His Phe Ser Asn
115 120 125 130
cag aac agt ggc att atc ttc agc agt gtt gag acc aac att gga aac 548
Gln Asn Ser Gly Ile Ile Phe Ser Ser Val Glu Thr Asn Ile Gly Asn
135 140 145
ttc ttc gat gtc atg act ggg aga ttt ggg gcc ccc gta tca ggt gtg 596
Phe Phe Asp Val Met Thr Gly Arg Phe Gly Ala Pro Val Ser Gly Val
150 155 160
tat ttc ttc acc ttc agc atg atg aag cat gag gac gta gag gaa gtg 644
Tyr Phe Phe Thr Phe Ser Met Met Lys His Glu Asp Val Glu Glu Val
165 170 175
tat gtg tac ctt atg cac aac ggc aac aca gtc ttc agc atg tac agc 692
Tyr Val Tyr Leu Met His Asn Gly Asn Thr Val Phe Ser Met Tyr Ser
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
11
180 185 190
tat gaa aca aag gga aaa tca gat aca tcc agc aac cat gca gtg ctg 740
Tyr Glu Thr Lys Gly Lys Ser Asp Thr Ser Ser Asn His Ala Ual Leu
195 200 205 210
aag ttg gcc aaa gga gat gaa gtc tgg cta aga atg ggc aac ggt gcc 788
Lys Leu Ala Lys Gly Asp Glu Ual Trp Leu Arg Met Gly Asn Gly Ala
215 220 225
ctc cac ggg gac cac cag cgc ttc tcc acc ttc gca ggc ttt ctg ctc 836
Leu His Gly Asp His Gln Arg Phe Ser Thr Phe Ala Gly Phe Leu Leu
230 235 240
ttt gaa act aag tgacaaggaa gacaggatat ctccactttg ggggcaattt 888
Phe Glu Thr Lys
245
atagctgagc tagggttgtt aggatatgaa ggatgttgaa gtcgggggtt ctttatggag 948
catttaagtg ttgcattggt cacactgcta ctcattctaa tggcatacca ataatgttgg 1008
atgcttcagg ggctcactgc tactcattct aatggcatac caataatgtt ggatgcttca 1068
ggggctcact gctactcatt ctaatggcaa taccaataat gttggatgc 1117
<210>12
<211>246
<212>PRT
<213>Mus musculus
<400> 12
Met Leu Gly Arg Gln Arg Ile Trp Trp His Leu Leu Pro Leu Leu Phe
1 5 10 15
Leu Pro Phe Cys Leu Cys Gln Asp Glu Tyr Met Glu Ser Pro Gln Ala
20 25 30
Gly Gly Leu Pro Pro Asp Cys Ser Lys Cys Cys His Gly Asp Tyr Gly
35 40 45
Phe Arg Gly Tyr Gln Gly Pro Pro Gly Pro Pro Gly Pro Pro Gly Ile
50 55 60
Pro Gly Asn His Gly Asn Asn Gly Asn Asn Gly Ala Thr Gly His Glu
65 70 75 80
Gly Ala Lys Gly Glu Lys Gly Asp Lys Gly Asp Leu Gly Pro Arg Gly
85 90 95
Glu Arg Gly Gln His Gly Pro Lys Gly Glu Lys Gly Tyr Pro Gly Ual
100 105 110
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
12
Pro Pro Glu Leu Gln Ile Ala Phe Met Ala Ser Leu Ala Thr His Phe
115 120 125
Ser Asn Gln Asn Ser Gly Ile Ile Phe Ser Ser Val Glu Thr Asn Ile
130 135 140
Gly Asn Phe Phe Asp Val Met Thr Gly Arg Phe Gly Ala Pro Ual Ser
145 150 155 160
Gly Val Tyr Phe Phe Thr Phe Ser Met Met Lys His Glu Asp Ual Glu
165 170 175
Glu Val Tyr Val Tyr Leu Met His Asn Gly Asn Thr Ual Phe Ser Met
180 185 190
Tyr Ser Tyr Glu Thr Lys Gly Lys Ser Asp Thr Ser Ser Asn His Ala
195 200 205
Val Leu Lys Leu Ala Lys Gly Asp Glu Val Trp Leu Arg Met Gly Asn
210 215 220
Gly Ala Leu His Gly Asp His Gln Arg Phe Ser Thr Phe Ala Gly Phe
225 230 235 240
Leu Leu Phe Glu Thr Lys
245
<210> 13
<211> 18
<212> DNA
<213> Artificial Sequence
<220>
<223> Oligonucleotide ZC21913
<400> 13
tgaccagagg gattttat lg
<210> 14
<211> 18
<212> DNA
<213> Artificial Sequence
<220>
<223> Oligonucleotide ZC21914
<400> 14
ttgccacagt tttatcta lg
<210> 15
<211> 25
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
13
<212> DNA
<213> Artificial Sequence
<220>
<223> Oligonucleotide ZC23377
<400> 15
ctctgttggg atccatgctt tgga 24
<210> 16
<211> 23
<212> DNA
<213> Artificial Sequence
<220>
<223> ZC23378
<400> 16
gtcatctaga tacttagttt ca 22
<210> 17
<211> 7
<212> PRT
<213> Artificial Sequence
<220>
<223> Glu-Glu tag
<400> 17
Glu Glu Tyr Met Pro Met Glu
1 5
<210> 18
<211> 17
<212> DNA
<213> Artificial Sequence
<220>
<223> ZC447
<400> 18
taacaatttc acacagg 17
WO 00/63377 CA 02370609 2001-10-19 PCT/US00/10454
14
<210> 19
<211> 18
<212> DNA
<213> Artificial Sequence
<220>
<223> Oligonucleotide ZC976
<400> 19
cgttgtaaaa cgacggcc lg
<210> 20
<211> 6
<212> PRT
<213> Artificial Sequence
<220>
<223> purification peptide
<400> 20
Glu Tyr Met Pro Val Asp
1 5
