Note: Descriptions are shown in the official language in which they were submitted.
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
Death Domain Containing Receptors
Background of the Invention
Field of the Invention
The present invention relates to a novel member of the tumor necrosis
factor family of receptors. Mare specifically, isolated nucleic acid molecules
are
provided encoding human Death Domain Containing Receptors (DR3 and
DR3-Vl). Death Domain Containing Receptor polypeptides are also provided,
as are vectors, host cells and recombinant methods for producing the same. The
invention further relates to screening methods for identifying agonists and
antagonists .of DR3 activity.
Related Art
Many biological actions, for instance, response to certain stimuli and
natural biological processes, are controlled by factors, such as cytokines.
Many
cytokines act through receptors by engaging the receptor and producing an
intra-
cellular response.
For example, tumor necrosis factors (TNF) alpha and beta are cytokines
which act through TNF receptors to regulate numerous biological processes,
including protection against infection and induction of shock and inflammatory
disease. The TNF molecules belong to the "TNF-ligand" superfamily, and act
together with their receptors or counter-ligands, the "TNF-receptor"
superfamily.
So far, nine members of the TNF ligand superfamily have been identified and
ten
members of the TNF-receptor superfamily have been characterized.
Among the ligands there are included TNF-a, Iymphotoxin-a (LT-a, also
known as TNF-(3), LT-~3 (found in complex heterotrimer LT-a2-(3), Fast,
CD40L, CD27L, CD30L, 4-1BBL, OX40L and nerve growth factor (NGF). The
superfamily of TNF receptors includes the p55TNF receptor, p75TNF receptor,
TNF receptor-related protein, FAS antigen or APO-1, CD40, CD2?, CD30,
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-2-
4-1BB, OX40, low afl=inity p75 and NGF-receptor (A. Meager, Biologicals,
22:291-295 (1994)).
Many members of the TNF-ligand superfamily are expressed by activated
T-cells, implying that they are necessary for T-cell interactions with other
cell
types which underlie cell ontogeny and functions. (A. Meager, supra).
Considerable insight into the essential functions of several members ofthe
TNF receptor family has been gained from the identification and creation of
mutants that abolish the expression of these proteins. For example, naturally
occurring mutations in the FAS antigen and its ligand cause
lymphoproliferative
disease (R. Watanabe-Fukunaga etal., Nature 356:314 ( 1992)), perhaps
reflecting
a failure of programmed cell death. Mutations of the CD40 ligand cause an X-
linked immunodeficiency state characterized by high levels of immunoglobulin M
and low levels of immunoglobulin G in plasma, indicating faulty T-cell-
dependent
B-cell activation (R. C. Allen et al., Science 259:990 ( 1993)). Targeted
mutations
of the low afl=inity nerve growth factor receptor cause a disorder
characterized by
faulty sensory innovation of peripheral structures (K.F. Lee et al., Cell
69:737
(1992)).
TNF and LT-a are capable ofbinding to two TNF receptors (the SS- and
75-kd TNF receptors). A large number of biological eB'ects elicited by TNF and
LT-a, acting through their receptors, include hemorrhagic necrosis
oftransplanted
tumors, cytotoxicity, a role in endotoxic shock, inflammation,
immunoregulation,
proliferation and anti-viral responses, as well as protection against the
deleterious
effects of ionizing radiation. TNF and LT-a are involved in the pathogenesis
of
a wide range of diseases, including endotoxic shock, cerebral malaria, tumors,
autoimmune disease, AIDS and graft-host rejection (B. Beutler and C. Von
Huffel, Science 264:667-668 (1994)). Mutations in the p55 receptor cause
increased susceptibility to microbial infection.
Moreover, an about 80 amino acid domain near the C-terminus of TNFRl
(p55) and Fas was reported as the "death domain," which is responsible for
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-3-
transducing signals for programmed cell death (Tartaglia et al., Cell 74:845
(1993)).
Apoptosis, or programmed cell death, is a physiologic process essential to
the normal development and homeostasis of multicellular organisms (H. Steller,
Science 267, 1445-1449 (1995)). Derangements of apoptosis contribute to the
pathogenesis of several human diseases including cancer, neurodegenerative
disorders, and acquired immune deficiency syndrome (C.B. Thompson, Science
267, 1456-1462 (1995)). Recently, much attention has focused on the signal
transduction and biological function of two cell surface death receptors,
Fas/APO-1 and TNFR-1 (J.L. Cleveland etal., Cell8l, 479-482 (1995); A. Fraser
et al., Cell 85, 781-784 (1996); S. Nagata et al., Science 267, 1449-56
(1995)).
Both are members of the TNF receptor family which also include TNFR-2, low
afFmity NGFR, CD40, and CD30, among others (C.A. Smith et al., Science 248,
1019-23 (1990); M. Tewari et al., in Modular Texts in Molecular and Cell
Biology M. Purton, Heldin, Carl, Ed. (Chapman and Hall, London, 1995). While
family members are defined by the presence of cysteine-rich repeats in their
extracellular domains, Fas/APO-1 and TNFR-1 also share a region
ofintracellular
homology, appropriately designated the "death domain," which is distantly
related
to the Drosophila suicide gene, reaper (P. Golstein et al., Cell8l, 185-6
(1995);
K. White et al., Science 264, 677-83 (1994)). This shared death domain
suggests
that both receptors interact with a related set of signal transducing
molecules that,
until recently, remained unidentified. Activation of Fas/APO-1 recruits the
death
domain-containing adapter molecule FADD/MORT1 (A.M. Chinnaiyan et al.,
Cell 81, 505-12 (1995); M. P. Boldin et al., J. Biol Chem 270, 7795-8 (1995);
F.C. Kischkel et al., F.MBO 14, 5579-5588 (1995)), which in turn binds and
presumably activates FLICE/MACH1, a member of the ICE/CED-3 family of
pro-apoptotic proteases (M. Muzio et al., C'e1185, 817-827 (1996); M.P. Boldin
et al., Cell85, 803-815 (1996)). While the central role ofFas/APO-1 is to
trigger
cell death, TNFR-1 can signal an array of diverse biological activities-many
of
which stem from its ability to activate NF-kB (L.A. Tartaglia et al., Immunol
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-4-
Today 13, 151-3 (1992)). Accordingly, TNFR-1 recruits the multivalent adapter
molecule TRADD, which like FADD, also contains a death domain (H. Hsu et al.,
Cell 81, 495-504 (1995); H. Hsu et al., Cell 84, 299-308 (1996)). Through its
associations with a number of signaling molecules including FADD, TRAF2, and
RIP, TRADD can signal both apoptosis and NF-kB activation, Id.; H. Hsu et al.,
Immunity 4, 387-396 (1996)).
The effects of TNF family ligands and TNF family receptors are varied and
influence numerous functions, both normal and abnormal, in the biological
processes of the mammalian system. There is a clear need, therefore, for
identification and characterization of such receptors and ligands that
influence
biological activity, both normally and in disease states. In particular, there
is a
need to isolate and characterize novel members of the TNF receptor family.
Summary of the Invention
The present invention provides for isolated nucleic acid molecules
comprising, or alternatively consisting of, nucleic acid sequences encoding
the
amino acid sequences shown in SEQ ID N0:2 and SEQ ID N0:4 or the amino
acid sequence encoding the cDNAs deposited as ATCC Deposit No. 97456 on
March l, 1996 and ATCC Deposit No. 97757 on October 10, 1996.
The present invention also provides vectors and host cells for recombinant
expression of the nucleic acid molecules described herein, as well as to
methods
of making such vectors and host cells and for using them for production of DR3
or DR3 Variant 1 (DR3-V1) (formerly named DDCR) polypeptides or peptides
by recombinant techniques.
The invention further provides an isolated DR3 or DR3-V 1 polypeptide
having an amino acid sequence encoded by a polynucleotide described herein.
The present invention also provides diagnostic assays such as quantitative
and diagnostic assays for detecting levels of DR3 or DR3-V1 protein. Thus, for
instance, a diagnostic assay in accordance with the invention for detecting
over-
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-S-
expression of DR3 or DR3-V1, or soluble form thereof, compared to normal
control tissue samples may be used to detect the presence of tumors.
Tumor Necrosis Factor (TNF) family ligands are known to be among the
most pleiotropic cytokines, inducing a large number of cellular responses,
including cytotoxicity, anti-viral activity, immunoregulatory activities, and
the
transcriptional regulation of several genes. Cellular response to TNF-family
ligands include not only normal physiological responses, but also diseases
associated with increased apoptosis or the inhibition of apoptosis. Apoptosis-
programmed cell death-is a physiological mechanism involved in the deletion of
peripheral T lymphocytes of the immune system, and its dysregulation can lead
to
a number of different pathogenic processes. Diseases associated with increased
cell survival, or the inhibition of apoptosis, include cancers, autoimmune
disorders,
viral infections, inflammation, graft v. host disease, acute graft rejection,
and
chronic graft rejection. Diseases associated with increased apoptosis include
AIDS, neurodegenerative disorders, myelodysplastic syndromes, ischemic injury,
toxin-induced liver disease, septic shock, cachexia and anorexia.
Thus, the invention further provides a method for enhancing apoptosis
induced by a TNF-family ligand, which involves administering to a cell which
expresses the DR3 polypeptide an effective amount of an agonist capable of
increasing DR3 mediated signaling. Preferably, DR3 mediated signaling is
increased to treat and/or prevent a disease wherein decreased apoptosis is
exhibited.
In a further aspect, the present invention is directed to a method for
inhibiting apoptosis induced by a TNF-family ligand, which involves
administering
to a cell which expresses the DR3 polypeptide an effective amount of an
antagonist capable of decreasing DR3 mediated signaling. Preferably, DR3
mediated signaling is decreased to treat and/or prevent a disease wherein
increased
apoptosis is exhibited.
Whether any candidate "agonist" or "antagonist" of the present invention
can enhance or inhibit apoptosis can be determined using art-known TNF-family
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-6-
ligand/receptor cellular response assays, including those described in more
detail
below. Thus, in a further aspect, a screening method is provided for
determining
whether a candidate agonist or antagonist is capable of enhancing or
inhibiting a
cellular response to a TNF-family ligand. The method involves contacting cells
which express the DR3 or DR3-V 1 polypeptide with a candidate compound and
a TNF-family ligand, assaying a cellular response, and comparing the cellular
response to a standard cellular response, the standard being assayed when
contact
is made with the ligand in absence of the candidate compound, whereby an
increased cellular response over the standard indicates that the candidate
compound is an agonist of the ligand/receptor signaling pathway and a
decreased
cellular response compared to the standard indicates that the candidate
compound
is an antagonist of the ligand/receptor signaling pathway. By the invention, a
cell
expressing the DR3 or DR3-Vl polypeptide can be contacted with either an
endogenous or exogenously administered TNF-family ligand.
Brief Description of the Figures
FIG. lA-1C (SEQ ID NOs:l and 2) shows the nucleotide and deduced
amino acid sequence of DR3-V1. It is predicted that amino acids 1-35
constitute
the signal peptide, amino acids 36-212 constitute the extracellular domain,
amino
acids 213-235 constitute the transmembrane domain, amino acids 236-428
constitute the intracellular domain, and amino acids 353-419 the death domain.
FIG. 2A-2B (SEQ ID NOs:3 and 4) shows the nucleotide and deduced
amino acid sequence ofDR3. It is predicted that amino acids 1-24 constitute
the
signal peptide, amino acids 25-201 constitute the extracellular domain, amino
acids 202-224 constitute the transmembrane domain, amino acids 225-417
constitute the intracellular domain, and amino acids 342-408 constitute the
death
domain.
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
_'7_
FIG. 3A-3D shows the regions of similarity between the amino acid
sequences of the DR3-V1, human tumor necrosis factor receptor 1, and Fas
receptor (SEQ 117 NOs:S and 6).
FIG. 4 shows an analysis of the DR3-V1 amino acid sequence. Alpha,
beta, turn and coil regions; hydrophilicity and hydrophobicity; amphipathic
regions; flexible regions; antigenic index and surface probability are shown.
In the
"Antigenic Index-Jameson-Wolf' graph, amino acid residues 1-22, 33-56, 59-82,
95-112, 122-133, 161-177, 179-190, 196-205 in SEQ ID N0:2 correspond to the
shown highly antigenic regions of the DR3-V1 protein.
Detailed Description of the Preferred Embodiments
The present invention provides isolated nucleic acid molecules comprising,
or alternatively consisting of, a nucleic acid sequence encoding the DR3-V1 or
DR3 polypeptide whose amino acid sequence is shown in SEQ ID N0:2 and SEQ
~ N0:4, respectively, or a fragment of the polypeptide. The DR3-V 1 and DR3
polypeptides of the present invention share sequence homology with human TNF
RI and Fas (FIG. 4). The nucleotide sequence shown in SEQ >I7 NO:1 was
obtained by sequencing the HTTNB61 clone, which was deposited on March 1,
1996 at the American Type Culture Collection, 10801 University Blvd.,
Manassas,
VA 20110-2209, USA, and given Accession Number 97456. The deposited
cDNA is contained in the pBluescript SK(-) plasmid (Stratagene, LaJolla, CA).
The nucleotide sequence shown in SEQ >l7 N0:3 was obtained by sequencing a
cDNA obtained from a HCTVEC library, which was deposited on October 10,
1996 at the American Type Culture Collection, 10801 University Blvd.,
Manassas,
VA 20110-2209, USA, and given Accession Number 97757. The deposited
cDNA is contained in the pBluescript SK(-) plasmid (Stratagene, LaJolla, CA).
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
_g_
Nucleic Aci~l Molecules
Unless otherwise indicated, all nucleotide sequences determined by
sequencing a DNA molecule herein were determined using an automated DNA
sequencer (such as the Model 373 from Applied Biosystems, Inc.), and all amino
acid sequences of polypeptides encoded by DNA molecules determined herein
were predicted by translation of a DNA sequence determined as above.
Therefore, as is known in the art for any DNA sequence determined by this
automated approach, any nucleotide sequence determined herein may contain
some errors. Nucleotide sequences determined by automation are typically at
least
about 90% identical, more typically at least about 95% to at least about 99.9%
identical to the actual nucleotide sequence of the sequenced DNA molecule. The
actual sequence can be more precisely determined by other approaches including
manual DNA sequencing methods well known in the art. As is also known in the
art, a single insertion or deletion in a determined nucleotide sequence
compared
to the actual sequence will cause a frame shift in translation of the
nucleotide
sequence such that the predicted amino acid sequence encoded by a determined
nucleotide sequence will be completely different from the amino acid sequence
actually encoded by the sequenced DNA molecule, beginning at the point of such
an insertion or deletion.
By "isolated" polypeptide or protein is intended a polypeptide or protein
removed from its native environment. For example, recombinantly produced
polypeptides and proteins expressed in host cells are considered isolated for
purposes of the invention, as are native or recombinant polypeptides which
have
been substantially purified by any suitable technique such as, for example,
the
single-step purification method disclosed in Smith and Johnson, Gene 67:31-40
(1988).
Using the information provided herein, such as the nucleic acid sequence
set out in SEQ ID NO:1 or SEQ ID N0:3, a nucleic acid molecule of the present
invention encoding a DR3-V 1 or DR3 polypeptide may be obtained using standard
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-9-
cloning and screening procedures, such as those for cloning cDNAs using mRNA
as starting material. Illustrative of the invention, the nucleic acid molecule
described in SEQ >D NO: l was discovered in a cDNA library derived from cells
of a human testis tumor. Also illustrative of the invention, the nucleic acid
molecule described in SEQ ID N0:3 was discovered in a human HUVEC cDNA
library. In addition, the genes of the present invention have also been
identified
in cDNA libraries of the following tissues: fetal liver, fetal brain, tonsil
and
leukocyte. Furthermore, multiple forms of DR3 transcript are seen in Northern
Blots and PCR reactions indicating that multiple variants of the transcript
exists,
possibly due to alternate splicing of the message.
The DR3-V1 (formerly called DDCR) gene contains an open reading
frame encoding a protein of about 428 amino acid residues whose initiation
codon
is at position 198-200 of the nucleotide sequence shown in SEQ ID NO. l, with
a leader sequence of about 35 amino acid residues, and a deduced molecular
weight of about 47 kDa. Of known members of the TNF receptor family, the
DR3-V 1 polypeptide of the invention shares the greatest degree of homology
with
human TNF Rl. The DR3-V1 polypeptide shown in SEQ ID N0:2 is about 20%
identical and about 50% similar to human TNF Rl.
The DR3 gene contains an open reading frame encoding a protein of about
417 amino acid residues whose initiation codon is at position 1-3 ofthe
nucleotide
sequence shown in SEQ ID N0:3, with a leader sequence of about 24 amino acid
residues, and a deduced molecular weight of about 43 kDa. Of known members
of the TNF receptor family, the DR3 polypeptide of the invention shares the
greatest degree of homology with human TNF Rl. The DR3 polypeptide shown
in SEQ ID N0:3 is about 20% identical and about 50% similar to human TNF Rl.
As indicated, the present invention also provides the mature forms) ofthe
DR3-V1 and DR3 protein of the present invention. According to the signal
hypothesis, proteins secreted by mammalian cells have a signal or secretory
leader
sequence which is cleaved from the mature protein once export of the growing
protein chain across the rough endoplasmic reticulum has been initiated. Most
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-10-
mammalian cells and even insect cells cleave secreted proteins with the same
specificity. However, in some cases, cleavage of a secreted protein is not
entirely
uniform,, which results in two or more mature species of the protein. Further,
it
has long been known that the cleavage specificity of a secreted protein is
ultimately determined by the primary structure of the complete protein, that
is, it
is inherent in the amino acid sequence of the polypeptide. Therefore, the
present
invention provides a nucleotide sequence encoding the mature DR3-V 1 or DR3
polypeptides having the amino acid sequence encoded by the cDNAs contained
in the host identified as ATCC Deposit No. 97456 or 97757, respectively, and
as
shown in SEQ ID N0:2 and SEQ ID N0:4. By the mature DR3-V 1 or DR3
protein having the amino acid sequence encoded by the cDNAs contained in the
host identified as ATCC Deposit No. 97456 or 97757, respectively, is meant the
mature forms) of the DR3-V1 or DR3 protein produced by expression in a
mammalian cell (e.g., COS cells, as described below) of the complete open
reading frame encoded by the human DNA sequence of the cDNA contained in
the vector in the deposited host. As indicated below, the mature DR3-V 1 or
DR3
having the amino acid sequence encoded by the cDNAs contained in ATCC
Deposit No. 97456 or 97757, respectively, may or may not differ from the
predicted "mature" DR3-V 1 protein shown in SEQ ID N0:2 (amino acids from
about 36 to about 428) or DR3 protein shown in SEQ ID N0:4 (amino acids from
about 24 to about 417) depending on the accuracy of the predicted cleavage
site
based on computer analysis.
Methods for predicting whether a protein has a secretory leader as well as
the cleavage point for that leader sequence are available. For instance, the
method
of McGeoch (Virus Res. 3:271-286 (1985)) and von Heinje (Nucleic Acids Res.
14:4683-4690 ( 1986)) can be used. The accuracy of predicting the cleavage
points of known mammalian secretory proteins for each of these methods is in
the
range of 75-80%. von Heinje, supra. However, the two methods do not always
produce the same predicted cleavage points) for a given protein.
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-11-
In the present case, the predicted amino acid sequences of the complete
DR3-V1 and DR3 polypeptides of the present invention were analyzed by a
computer program ("PSORT"), see, K. Nakai and M. Kanehisa, Genomics
14:897-911 (1992)), which is an expert system for predicting the cellular
location
of a protein based on the amino acid sequence. As part of this computational
prediction of localization, the methods of McGeoch and von Heinje are
incorporated. The analysis by the PSORT program predicted the cleavage sites
between amino acids 35 and 36 in SEQ ID N0:2 and between amino acids 24 and
25 in SEQ 117 N0:4. Thereafter, the complete amino acid sequences were further
analyzed by visual inspection, applying a simple form of the (-1,-3) rule of
von
Heine. von Heinje, supra. Thus, the leader sequence for the DR3-V 1 protein is
predicted to consist of amino acid residues 1- 35 in SEQ ID N0:2, while the
predicted mature DR3-V1 protein consists of residues 36-428. The leader
sequence for the DR3 protein is predicted to consist of amino acid residues 1-
24
in SEQ >D N0:4, while the predicted mature DR3 protein consists of residues 25-
417.
As one of ordinary skill would appreciate, due to the possibilities of
sequencing errors discussed above, as well as the variability of cleavage
sites for
leaders in different known proteins, the actual DR3-V1 polypeptide encoded by
the deposited cDNA comprises about 428 amino acids, but may be anywhere in
the range of 410-440 amino acids; and the actual leader sequence of this
protein
is about 35 amino acids, but may be anywhere in the range of about 25 to about
45 amino acids. The actual DR3 polypeptide encoded by the deposited cDNA
comprises about 417 amino acids, but may be anywhere in the range of 400-430
amino acids; and the actual leader sequence of this protein is about 24 amino
acids, but may be anywhere in the range of about 14 to about 34 amino acids.
As indicated, nucleic acid molecules ofthe present invention may be in the
form of RNA, such as mRNA, or in the form of DNA, including, for instance,
cDNA and genomic DNA obtained by cloning or produced synthetically. The
DNA may be double-stranded or single-stranded. Single-stranded DNA may be
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-12-
the coding strand, also known as the sense strand, or it may be the non-coding
strand, also referred to as the anti-sense strand.
By "isolated" nucleic acid molecules) is intended a nucleic acid molecule,
DNA or RNA, which has been removed from its native environment. For
example, recombinant DNA molecules contained in a vector are considered
isolated for the purposes of the present invention. Further examples of
isolated
DNA molecules include recombinant DNA molecules maintained in heterologous
host cells or purified (partially or substantially) DNA molecules in solution.
Isolated RNA molecules include in vivo or in vitro RNA transcripts of the DNA
molecules of the present invention. Isolated nucleic acid molecules according
to
the present invention further include such molecules produced synthetically.
However, a nucleic acid contained in a clone that is a member of a library
(e.g., a genomic or cDNA library) that has not been isolated from other
members
of the library (e.g., in the form of a homogeneous solution containing the
clone
and other members of the library) or a chromosome isolated or removed from a
cell or a cell lysate (e.g., a "chromosome spread," as in a karyotype), is not
"isolated" for the purposes of the invention. As discussed further herein,
isolated
nucleic acid molecules according to the present invention may be produced
naturally, recombinantly, or synthetically.
Isolated nucleic acid molecules of the present invention include DR3-V 1
DNA molecules comprising, or alternatively consisting of, an open reading
frame
(ORF) shown in SEQ ID NO:1 and further include DNA molecules which
comprise, or alternatively consist of, a sequence substantially different than
all or
part of the ORF whose initiation codon is at position 198-200 of the
nucleotide
sequence shown in SEQ ID NO:1 but which, due to the degeneracy of the genetic
code, still encode the DR3-V 1 polypeptide or a fragment thereof. Isolated
nucleic
acid molecules of the present invention also include DR3 DNA molecules
comprising, or alternatively consisting of, an open reading frame (ORF) shown
in
SEQ ID N0:3 and further include DNA molecules which comprise, or
alternatively consist of, a sequence substantially different than all or part
of the
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-13-
ORF whose initiation codon is at position 1-3 of the nucleotide sequence shown
in SEQ D7 N0:3 but which, due to the degeneracy of the genetic code, still
encode the DR3 polypeptide or a fragment thereof. Of course, the genetic code
is well known in the art. Thus, it would be routine for one skilled in the art
to
generate such degenerate variants.
In another aspect, the invention provides isolated nucleic acid molecules
encoding the DR3-V 1 polypeptide having an amino acid sequence encoded by the
cDNA contained in the plasmid deposited as ATCC Deposit No. 97456 on March
l, 1996. The invention provides isolated nucleic acid molecules encoding the
DR3 polypeptide having an amino acid sequence encoded by the cDNA contained
in the plasmid deposited as ATCC Deposit No. 97757 on October 10, 1996.
Preferably, these nucleic acid molecules will encode the mature polypeptide
encoded by the above-described deposited cDNAs. The invention further
provides an isolated nucleic acid molecule having the nucleotide sequence
shown
in SEQ >I7 NO:1 or SEQ B7 N0:3 or the nucleotide sequence of the DR3-V 1 or
DR3 cDNA contained in the above-described deposited plasmids, or a nucleic
acid
molecule having a sequence complementary to one of the above sequences. Such
isolated DNA molecules and fragments thereof are useful, for example, as DNA
probes for gene mapping by in situ hybridization with chromosomes, and for
detecting expression of the DR3-V 1 or DR3 gene in human tissue (including
testis
tumor tissue) by Northern blot analysis.
DR3 expression has been detected in a wide range of tissues and cell types
including endothelial cells, liver cells, hepatocellular tumor, lymph nodes,
Hodgkin's lymphoma, tonsil, bone marrow, spleen, heart, thymus, pericardium,
healing wound (skin), brain, pancreas tumor, burned skin, U937 cells, testis,
colon
cancer (metasticized to liver), pancreas, rejected kidney, adipose, ovary,
olfactory
epithelium, striatum depression, HeLa cells, LNCAP (upon treatment with +30
nM androgen), 8 week embryo tissues, 9 week embryo tissues, fetal brain
tissues,
fetal kidney tissues, fetal heart tissues, fetal thymus tissues, fetal lung
tissues, fetal
liver tissues, fetal spleen tissues, T-cell helper II, activated T-cell ( 16
hr), activated
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-14-
T-cell (24 hr), primary dendritic cells, eosinophils, monocytes, keratinocytes
and
HUVEC (human umbilical vein endothelial cells).
The present invention is further directed to polynucleotides comprising, or
alternatively consisting of, fragments of the isolated nucleic acid molecules
described herein. By a fragment of an isolated nucleic acid molecule having
the
nucleotide sequence of one of the deposited cDNAs or the nucleotide sequence
shown in SEQ ID NO:1 or SEQ >D N0:3 is intended fragments at least about 15
nt, and more preferably at least about 20 nt, still more preferably at least
about 30
nt, and even more preferably, at least about 40 nt in length which are useful
as
diagnostic probes and primers as discussed herein. In this context "about"
includes the particularly recited value and values larger or smaller by
several (5,
4, 3, 2, or 1 ) nucleotides. Of course, larger fragments comprising, or
alternatively
consisting of, at least 50, 75, 100, 125, 150, 175, 200, 225, 250, 275, 300,
325,
350, 375, 400, 425, 450, 475, 500, 525, 550, 575, 600, 625, 650, 675, 700,
725,
750, 775, 800, 825, 850, 875, 900, 925, 950, 975, 1000, 1025, 1050, 1075,
1100,
1125, 1150, 1175, 1200, 1225, 1250 or 1283 nt are also useful according to the
present invention as are fragments corresponding to most, if not all, of the
nucleotide sequence of one of the deposited cDNAs or as shown in SEQ 1D NO:1
or SEQ >D N0:3. By a fragment at least 20 nt in length, for example, is
intended
fragments which include 20 or more contiguous bases from the nucleotide
sequence of one of the deposited cDNAs or the nucleotide sequence as shown in
SEQ >D NO:1 or SEQ ID N0:3.
The present invention is further directed to polynucleotides comprising, or
alternatively consisting of, fragments of isolated nucleic acid molecules
which
encode subportions of DR3-V 1 and DR3. In particular, the invention provides
polynucleotides comprising, or alternatively consisting of, the nucleotide
sequences of a member selected from the group consisting ofnucleotides 198-
257,
208-267, 218-277, 228-287, 238-297, 248-307, 258-317, 268-327, 278-337,
288-347, 298-357, 308-367, 318-377, 328-387, 338-397, 348-407, 358-417,
368-427, 378-437, 388-447, 398-457, 408-469, 428-487, 458-517, 478-537,
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-15-
498-557, 518-577, 538-597, 558-617, 578-637, 598-657, 638-697, 658-717,
698-757, 708-767, 718-767, 728-787, 738-797, 748-807, 758-817, 778-837,
788-847, 808-867, 828-887, 848-907, 868-927, 888-947, 898-957, 908-967,
918-977, 928-987, 948-1007, 968-1027, 988-1047, 998-1067, 1018-1077,
1038-1097, 1058-1117, 1068-1127, 1088-1147, 1098-1157, 1118-1177,
1138-1197, 1158-1217, 1178-1237, 1198-1257, 1218-1277, 1238-1297,
1258-1317, 1278-1337, 1298-1357, 1318-1377, 1338-1397, 1358-1417,
1378-1437, 1398-1457, 1418-1477, and 1428-1481 of SEQ ID NO:1.
The present invention is further directed to polynucleotides comprising, or
alternatively consisting of, isolated nucleic acid molecules which encode
domains
of DR3-V 1 and DR3. In one aspect, the invention provides polynucleotides
comprising, or alternatively consisting of, nucleic acid molecules which
encode
beta-sheet regions ofDR3-V 1 protein set out in Table 2. Representative
examples
of such polynucleotides include nucleic acid molecules which encode a
polypeptide comprise, or alternatively consist of, one, two, three, four, five
or
more amino acid sequences selected from the group consisting of amino acid
residues from about 24 to about 32, amino acid residues from about 53 to about
58, amino acid residues from about 133 to about 142, amino acid residues from
about 202 to about 234, amino acid residues from about 281 to about 288, amino
acid residues from about 304 to about 312, and amino acid residues from about
346 to about 350 in SEQ ID N0:2. In this context "about" includes the
particularly recited value and values larger or smaller by several (5, 4, 3,
2, or 1)
amino acids. Polypeptides encoded by these polynucleotides are also
encompassed by the invention.
Preferred nucleic acid fragments of the present invention include nucleic
acid molecules encoding one, two, three, four, five, or more amino acids
sequences selected from the group consisting of a polypeptide comprising, or
alternatively consisting of, the DR3-V 1 extracellular domain (amino acid
residues
from about 36 to about 212 in SEQ ID N0:2); a polypeptide comprising, or
alternatively consisting of, the DR3-V1 transmembrane domain (amino acid
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-16-
residues from about 213 to about 23 5 in SEQ ID N0:2; a polypeptide
comprising,
or alternatively consisting of, the DR3-V1 intracellular domain (amino acid
residues from about 236 to about 428 in SEQ ID N0:2; and a polypeptide
comprising, or alternatively consisting of, the DR3-V 1 death domain (amino
acid
residues from about 353 to about 419 in SEQ >Z7 N0:2). In this context "about"
includes the particularly recited value and values larger or smaller by
several (5,
4, 3, 2, or 1) amino acids. Since the location of these domains have been
predicted by computer graphics, one of ordinary skill would appreciate that
the
amino acid residues constituting these domains may vary slightly (e.g., by
about
1 to 15 residues) depending on the criteria used to define the domain.
Polypeptides encoded by these polynucleotides are also encompassed by the
invention.
The invention also provides polynucleotides comprising, or alternatively
consisting of, nucleic acid molecules encoding: amino acid residues from about
1
to about 215 of SEQ ID N0:2; amino acid residues from about 30 to about 215
of SEQ ID N0:2; amino acid residues from about 21 S to about 240 of SEQ ID
N0:2; amino acid residues from about 240 to about 428 of SEQ 117 N0:2; and
amino acid residues from about 350 to about 420 of SEQ ID N0:2. In this
context "about" includes the particularly recited value and values larger or
smaller
by several (5, 4, 3, 2, or 1) amino acids. Polypeptides encoded by these
polynucleotides are also encompassed by the invention.
Preferred nucleic acid fragments of the present invention further include
nucleic acid molecules encoding epitope-bearing portions of the DR3-V 1
protein.
In particular, such nucleic acid fragments of the present invention include
nucleic
acid molecules encoding: a polypeptide comprising, or alternatively consisting
of,
amino acid residues from about 1 to about 22 in SEQ ID N0:2; a polypeptide
comprising, or alternatively consisting of, amino acid residues from about 33
to
about 56 in SEQ ID N0:2; a polypeptide comprising, or alternatively consisting
of, amino acid residues from about 59 to about 82 in SEQ ID N0:2; a
polypeptide
comprising, or alternatively consisting of, amino acid residues from about 95
to
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-17-
about 112 in SEQ ID N0:2; a polypeptide comprising, or alternatively
consisting
of, amino acid residues from about 122 to about 133 in SEQ >D N0:2; a
polypeptide comprising, or alternatively consisting of, amino acid residues
from
about 161 to about 177 in SEQ ID N0:2; a polypeptide comprising, or
alternatively consisting of, amino acid residues from about 179 to about 190
in
SEQ 117 N0:2; and a polypeptide comprising, or alternatively consisting of,
amino acid residues from about 196 to about 205 in SEQ ID N0:2. In this
context "about" includes the particularly recited value and values larger or
smaller
by several (5, 4, 3, 2, or 1) amino acids. The inventors have determined that
the
above polypeptide fragments are antigenic regions of the DR3-V1 protein.
a
Methods for determining other such epitope-bearing portions of the DR3-Vl
protein are described in detail below. Polypeptides encoded by these
polynucleotides are also encompassed by the invention.
Preferred nucleic acid fragments of the present invention also include
nucleic acid molecules encoding epitope-bearing portions of the DR3 protein.
In
particular, such nucleic acid fragments of the present invention include
nucleic
acid molecules encoding the corresponding regions to those epitope-bearing
regions of the DR3-V 1 protein disclosed above. Methods for determining other
such epitope-bearing portions of the DR3 protein are described in detail
below.
In another aspect, the invention provides an isolated nucleic acid molecule
comprising, or alternatively consisting of, a polynucleotide which hybridizes
under
stringent hybridization conditions to a portion of the polynucleotide in a
nucleic
acid molecule of the invention described above, for instance, the complement
of
a polynucleotide fragment described herein, or the cDNA plasmids contained in
ATCC Deposit 97456 or ATCC Deposit 97757. By "stringent hybridization
conditions" is intended overnight incubation at 42°C in a solution
comprising, or
alternatively consisting of: 50% formamide, Sx SSC (750mM NaCI, 75mM
trisodium citrate), 50 mM sodium phosphate (pH 7.6), Sx Denhardt's solution,
10% dextran sulfate, and 20 pg/ml denatured, sheared salmon sperm DNA,
followed by washing the filters in 0. lx SSC at about 65 °C.
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-18-
By a polynucleotide which hybridizes to a "portion" of a polynucleotide
is intended a polynucleotide (either DNA or RNA) hybridizing to at least about
15 nucleotides (nt), and more preferably at least about 20 nt, still more
preferably
at least about 30 nt, and even more preferably about 30-70 nt of the reference
polynucleotide. These are useful as diagnostic probes and primers as discussed
above and in more detail below. In this context "about" includes the
particularly
recited value and values larger or smaller by several (S, 4, 3, 2, or 1)
nucleotides.
By a portion of a polynucleotide of "at least 20 nt in length," for example,
is intended 20 or more contiguous nucleotides from the nucleotide sequence
ofthe
reference polynucleotide (e.g., the deposited cDNAs or the nucleotide sequence
as shown in SEQ ID NO:1 or SEQ ID N0:3).
Of course, a polynucleotide which hybridizes only to a poly A sequence
(such as the 3' terminal poly(A) tract of the DR3-V1 cDNA shown in SEQ >D
NO: l ), or to a complementary stretch of T (or U) resides, would not be
included
in a polynucleotide of the invention used to hybridize to a portion of a
nucleic acid
of the invention, since such a polynucleotide would hybridize to any nucleic
acid
molecule containing a poly (A) stretch or the complement thereof (e.g.,
practically
any double-stranded cDNA clone generated from an oligo-dT primed cDNA
library).
As indicated, nucleic acid molecules ofthe present invention which encode
the DR3-V 1 or DR3 polypeptide may include, but are not limited to the coding
sequence for the mature polypeptide, by itself; the coding sequence for the
mature
polypeptide and additional sequences, such as those encoding a leader or
secretary
sequence, such as a pre-, or pro- or prepro- protein sequence; the coding
sequence
of the mature polypeptide, with or without the aforementioned additional
coding
sequences, together with additional, non-coding sequences, including for
example,
but not limited to introns and non-coding 5' and 3' sequences, such as the
transcribed, non-translated sequences that play a role in transcription, mRNA
processing - including splicing and polyadenylation signals, for example -
ribosome binding and stability of mRNA; additional coding sequence which codes
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-19-
for additional amino acids, such as those which provide additional
functionalities.
Thus, for instance, the polypeptide may be fused to a marker sequence, such as
a
peptide, which facilitates purification of the fused polypeptide. In certain
preferred embodiments of this aspect of the invention, the marker sequence is
a
hexa-histidine peptide, such as the tag provided in a pQE vector (Qiagen,
Inc.),
among others, many of which are commercially available. As described in Gentz
et al., Proc. Natl. Acad. Sci. USA 86:821-824 (1989), for instance, hexa-
histidine
provides for convenient purification of the fusion protein. The HA tag
corresponds to an epitope derived of influenza hemagglutinin protein, which
has
been described by Wilson et al., Cell 37:767 (1984), for instance.
The present invention further relates to variants of the nucleic acid
molecules of the present invention, which encode for fragments, analogs or
derivatives of the DR3-V1 or DR3 polypeptide. Variants may occur naturally,
such as an allelic variant. By an "allelic variant" is intended one of several
alternate forms of a gene occupying a given locus on a chromosome of an
organism. Genesll, Lewin, B., ed., John Wiley & Sons, New York (1985). Non-
naturally occurring variants may be produced using art-known mutagenesis
techniques.
Such variants include those produced by nucleotide substitutions,
deletions, or additions which may involve one or more nucleotides. The
variants
may be altered in coding or non-coding regions or both. Alterations in the
coding
regions may produce conservative or non-conservative amino acid substitutions,
deletions, or additions.
Further embodiments of the invention include isolated nucleic acid
molecules that are at least 80% identical, and more preferably at least 85%,
90%,
92%, 95%, 96%, 97%, 98% or 99% identical, to (a) a nucleotide sequence
encoding the full-length DR3-V1 polypeptide having the complete amino acid
sequence in SEQ ID N0:2, including the predicted leader sequence; (b)
nucleotide
sequence encoding the full-length DR3 polypeptide having the complete amino
acid sequence in SEQ ID N0:4, including the predicted leader sequence; (c) a
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-20-
nucleotide sequence encoding the mature DR3-Vl polypeptide (full-length
polypeptide with the leader removed) having the amino acid sequence at
positions
about 36 to about 428 in Figure 1 (SEQ ID N0:2); (d) a nucleotide sequence
encoding the full-length DR3-V1 polypeptide having the complete amino acid
sequence including the leader encoded by the cDNA contained in ATCC Deposit
No. 97456; (e) a nucleotide sequence encoding the full-length DR3 polypeptide
having the complete amino acid sequence including the leader encoded by the
cDNA contained in ATCC Deposit No. 97757; (f) a nucleotide sequence encoding
the mature DR3-V 1 polypeptide having the amino acid sequence encoded by the
cDNA contained in ATCC Deposit No. 97456; (g) a nucleotide sequence
encoding the mature DR3-V 1 polypeptide having the amino acid sequence
encoded by the cDNA contained in ATCC Deposit No. 97757; (h) a nucleotide
sequence that encodes the DR3 extracellular domain; (i) a nucleotide sequence
that encodes the DR3 transmembrane domain; (j) a nucleotide sequence that
encodes the DR3 intracellular domain; (k) a nucleotide sequence that encodes
the
DR3 death domain; or (1) a nucleotide sequence complementary to any of the
nucleotide sequences in (a), (b), (c), (d), (e), (f), (g), (h), (i), (j) or
(k) above. In
this context "about" includes the particularly recited value and values larger
or
smaller by several (5, 4, 3, 2, or 1) amino acids. Polypeptides encoded by
these
polynucleotides are also encompassed by the invention.
By a polynucleotide having a nucleotide sequence at least, for example,
95% "identical" to a reference nucleotide sequence encoding a DR3-V1 or DR3
polypeptide is intended that the nucleotide sequence of the polynucleotide is
identical to the reference sequence except that the polynucleotide sequence
may
include up to five mismatches per each 100 nucleotides of the reference
nucleotide
sequence encoding DR3-V 1 or DR3. In other words, to obtain a polynucleotide
having a nucleotide sequence at least 95% identical to a reference nucleotide
sequence, up to 5% of the nucleotides in the reference sequence may be deleted
or substituted with another nucleotide, or a number of nucleotides up to 5% of
the
total nucleotides in the reference sequence may be inserted into the reference
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-21-
sequence. These mismatches of the reference sequence may occur at the 5' or 3'
terminal positions of the reference nucleotide sequence or anywhere between
those terminal positions, interspersed either individually among nucleotides
in the
reference sequence or in one or more contiguous groups within the reference
sequence. The reference (query) sequence may be the entire DR3-Vl or DR3
encoding nucleotide sequence shown respectively in SEQ >D N0:2 and SEQ B7
N0:4 or any DR3-V1 or DR3 polynucleotide fragment (e.g., a polynucleotide
encoding the amino acid sequence of any of the DR3-V1 or DR3 N- and/or C
terminal deletions described herein), variant, derivative or analog, as
described
herein.
As a practical matter, whether any particular nucleic acid molecule is at
least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to, for
instance, the encoding nucleotide sequence shown in SEQ D7 N0:2 or SEQ >D
N0:4, or to the nucleotide sequence of the deposited cDNAs, can be determined
conventionally using known computer programs such as the Bestfit program
(Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer
Group, University Research Park, 575 Science Drive, Madison, WI 53711).
Bestfit uses the local homology algorithm of Smith and Waterman, Advances in
Applied Mathematics 2:482-489 (1981), to find the best segment of homology
between two sequences. When using Bestfit or any other sequence alignment
program to determine whether a particular sequence is, for instance, 95%
identical
to a reference sequence according to the present invention, the parameters are
set,
of course, such that the percentage of identity is calculated over the full
length of
the reference nucleotide sequence and that gaps in homology of up to 5% of the
total number of nucleotides in the reference sequence are allowed.
In a specific embodiment, the identity between a reference (query)
sequence (a sequence of the present invention) and a subject sequence, also
referred to as a global sequence alignment, is determined using the FASTDB
computer program based on the algorithm of Brutlag et al. (Comp. App. Biosci.
6:237-245 (1990)). Preferred parameters used in a FASTDB alignment ofDNA
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-22-
sequences to calculate percent identity are: Matrix=Unitary, k-tuple=4,
Mismatch
Penalty=l, Joining Penalty=30, Randomization Group Length=0, Cutof~Score=1,
Gap Penalty=5, Gap Size Penalty 0.05, Window Size=500 or the length of the
subject nucleotide sequence, whichever is shorter. According to this
embodiment,
if the subject sequence is shorter than the query sequence because of 5' or 3'
deletions, not because of internal deletions, a manual correction is made to
the
results to take into consideration the fact that the FASTDB program does not
account for 5' and 3' truncations ofthe subject sequence when calculating
percent
identity. For subject sequences truncated at the S' or 3' ends, relative to
the query
sequence, the percent identity is corrected by calculating the number of bases
of
the query sequence that are 5' and 3' of the subject sequence, which are not
matched/aligned, as a percent of the total bases of the query sequence. A
determination ofwhether a nucleotide is matched/aligned is determined by
results
of the FASTDB sequence alignment. This percentage is then subtracted from the
percent identity, calculated by the above FASTDB program using the specified
parameters, to arrive at a final percent identity score. This corrected score
is what
is used for the purposes of this embodiment. Only bases outside the 5' and 3'
bases of the subject sequence, as displayed by the FASTDB alignment, which are
not matched/aligned with the query sequence, are calculated for the purposes
of
manually adjusting the percent identity score. For example, a 90 base subject
sequence is aligned to a 100 base query~sequence to determine percent
identity.
The deletions occur at the 5' end of the subject sequence and therefore, the
FASTDB alignment does not show a matched/alignment of the first 10 bases at
5' end. The 10 unpaired bases represent 10% of the sequence (number of bases
at the 5' and 3' ends not matched/total number of bases in the query sequence)
so
10% is subtracted from the percent identity score calculated by the FASTDB
program. If the remaining 90 bases were perfectly matched the final percent
identity would be 90%. In another example, a 90 base subject sequence is
compared with a 100 base query sequence. This time the deletions are internal
deletions so that there are no bases on the 5' or 3' of the subject sequence
which
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-23-
are not matched/aligned with the query. In this case the percent identity
calculated by FASTDB is not manually corrected. Once again, only bases 5' and
3' of the subject sequence which are not matched/aligned with the query
sequence
are manually corrected for. No other manual corrections are made for the
purposes of this embodiment.
The present application is directed to nucleic acid molecules at least 80%,
85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to the nucleic acid
sequence shown in SEQ ID NO:1, SEQ ID N0:3 or to the nucleic acid sequence
ofthe deposited cDNAs, irrespective ofwhether they encode a polypeptide having
DR3 functional activity. The present application is also directed to nucleic
acid
molecules at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical
to the nucleic acid sequences disclosed herein, (e.g., nucleic acid sequences
encoding a polypeptide having the amino acid sequence of an N- and/or
C-terminal deletion disclosed herein, such as, for example, a nucleic acid
molecule
encoding amino acids 30 to 200, 30 to 215, 215 to 240, 240 to 428, 350 to 420,
or 2 to 428 of SEQ ID N0:2), irrespective of whether they encode a polypeptide
having DR3 functional activity. This is because even where a particular
nucleic
acid molecule does not encode a polypeptide having DR3 functional activity,
one
of skill in the art would still know how to use the nucleic acid molecule, for
instance, as a hybridization probe or a polymerase chain reaction (PCR)
primer.
Uses of the nucleic acid molecules of the present invention that do not encode
a
polypeptide having DR3 functional activity include, inter alia, (1) isolating
the
DR3 gene or allelic variants thereof in a cDNA library; (2) in situ
hybridization
(e.g., "FISH") to metaphase chromosomal spreads to provide precise
chromosomal location of the DR3-V 1 or DR3 gene, as described in Verma et al.,
Human Chromosomes: A Manual of Basic Techniques, Pergamon Press, New
York (1988); and (3) Northern Blot analysis for detecting DR3-V1 or DR3
mRNA expression in specific tissues.
Preferred, however, are nucleic acid molecules having sequences at least
80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to the nucleic acid
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-24-
sequence shown in SEQ ID NO:1, SEQ ID N0:3 or to the nucleic acid sequence
of the deposited cDNAs which do, in fact, encode a polypeptide having DR3
functional activity. By "a polypeptide having DR3 functional activity" is
intended
polypeptides exhibiting activity similar, but not necessarily identical, to an
activity
of the DR3 proteins of the invention (either the full-length protein or,
preferably,
the mature protein), as measured in a particular biological assay. For
example, a
DR3-V 1 or DR3 functional activity can routinely be measured by determining
the
ability of a DR3-V1 or DR3 polypeptide to bind a DR3-V1 or DR3 ligand (e.g.,
TNF-y-(3, NF-kB, TRADD). Further, DR3 functional activity can be measured
using the cell death assays performed essentially as previously described
(A.M.
Chinnaiyan et al., Cell 81, 505-12 (1995); M.P. Boldin et al., JBiol Chem 270,
7795-8 (1995); F.C. Kischkel et al., EMBO 14, 5579-5588 (1995); A.M.
Chinnaiyan, et al., J Biol Chem 271, 4961-4965 (1996)), and as set forth in
Example 6, below. In MCF7 cells, plasmids encoding full-length DR3 or a
candidate death domain containing receptors are co-transfected with the
pLantern
reporter construct encoding green fluorescent protein. Nuclei of cells
transfected
with DR3 will exhibit apoptotic morphology as assessed by DAPI staining.
Similar to TNFR-1 and Fas/APO-1 (M. Muzio et al., Cell85, 817-827 (1996); M.
P. Boldin et al., Cell 85, 803-815 (1996); M. Tewari et al., .I Biol Chem 270,
3255-60 (1995)), DR3-induced apoptosis is blocked by the inhibitors ofICE-like
proteases, CrmA and z-VAD-fmk. In addition, apoptosis induced by DR3 is also
blocked by dominant negative versions of FADD (FADD-DN) or FLICE
(FLICE-DN/MACHaI C360S).
The functional activity of DR3 polypeptides, and fragments, variants
derivatives, and analogs thereof, can be assayed by various methods.
For example, in one embodiment where one is assaying for the ability to
bind or compete with full-length polypeptide for binding to anti-DR3 antibody,
various immunoassays known in the art can be used, including but not limited
to,
competitive and non-competitive assay systems using techniques such as
radioimmunoassays, ELISA (enzyme linked immunosorbent assay), "sandwich"
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-25-
immunoassays, immunoradiometric assays, gel diffusion precipitation reactions,
immunodiffusion assays, in situ immunoassays (using colloidal gold, enzyme or
radioisotope labels, for example), western blots, precipitation reactions,
agglutination assays (e.g., gel agglutination assays, hemagglutination
assays),
complement fixation assays, immunofluorescence assays, protein A assays, and
immunoelectrophoresis assays, etc. In one embodiment, antibody binding is
detected by detecting a label on the primary antibody. In another embodiment,
the
primary antibody is detected by detecting binding of a secondary antibody or
reagent to the primary antibody. In a further embodiment, the secondary
antibody
is labeled. Many means are known in the art for detecting binding in an
immunoassay and are within the scope of the present invention.
In another embodiment, where a ligand is identified (e.g., TNF-y-(3
(International Publication No. WO 00/08139, the entire disclosure of which is
incorporated herein by reference)), or the ability of a polypeptide fragment,
variant
or derivative of the invention to multimerize is being evaluated, binding can
be
assayed, e.g., by means well-known in the art, such as, for example, reducing
and
non-reducing gel chromatography, protein affinity chromatography, and affinity
blotting. See generally, Phizicky, E. et al., 1995, Microbiol. Rev. 59:94-123.
In
another embodiment, physiological correlates of binding to its substrates
(signal
transduction) can be assayed.
Other methods will be known to the skilled artisan and are within the
scope of the invention.
Of course, due to the degeneracy of the genetic code, one of ordinary skill
in the art will immediately recognize that a large number of the nucleic acid
molecules having a sequence at least 80%, 85%, 90%, 92%, 95%, 96%, 97%,
98% or 99% identical to the nucleic acid sequence of the deposited cDNAs, the
nucleic acid sequence shown in SEQ ID N0:2 or SEQ ID N0:4, or fragments
thereof, will encode polypeptides "having DR3 functional activity." In fact,
since
degenerate variants of any of these nucleotide sequences all encode the same
polypeptide, in many instances, this will be clear to the skilled artisan even
without
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-26-
performing the above described comparison assay. It will be further recognized
in the art that, for such nucleic acid molecules that are not degenerate
variants, a
reasonable number will also encode a polypeptide having DR3 functional
activity.
This is because the skilled artisan is fully aware of amino acid substitutions
that are
either less likely or not likely to significantly effect protein function
(e.g., replacing
one aliphatic amino acid with a second aliphatic amino acid), as further
described
below.
For example, guidance concerning how to make phenotypically silent
amino acid substitutions is provided in Bowie, J.U. et al., "Deciphering the
Message in Protein Sequences: Tolerance to Amino Acid Substitutions," Science
247:1306-1310 (1990), wherein the authors indicate that proteins are
surprisingly
tolerant of amino acid substitutions.
Polynucleotide Assays
This invention is also related to the use of the DR3-V 1 or DR3
polynucleotides to detect complementary polynucleotides such as, for example,
as a diagnostic reagent. Detection of a mutated form of DR3-V1 or DR3
associated with a dysfunction will provide a diagnostic tool that can add or
define
a diagnosis of a disease or susceptibility to a disease which results from
under
expression over-expression or altered expression of DR3-V 1 or DR3 or a
soluble
form thereof, such as, for example, tumors or autoimmune disease.
Individuals carrying mutations in the DR3-Vl or DR3 gene may be
detected at the DNA level by a variety of techniques. Nucleic acids for
diagnosis
may be obtained from a patient's cells, such as from blood, urine, saliva,
tissue
biopsy and autopsy material. The genomic DNA may be used directly for
detection or may be amplified enzymatically by using PCR prior to analysis.
(Saiki
et al., Nature 324:163-166 (1986)). RNA or cDNA may also be used in the same
ways. As an example, PCR primers complementary to the nucleic acid encoding
DR3-V 1 or DR3 can be used to identify and analyze DR3-V1 or DR3 expression
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-27-
and mutations. For example, deletions and insertions can be detected by a
change
in size of the amplified product in comparison to the normal genotype. Point
mutations can be identified by hybridizing amplified DNA to radiolabeled DR3-V
1
or DR3 RNA or alternatively, radiolabeled DR3-V1 or DR3 antisense DNA
sequences. Perfectly matched sequences can be distinguished from mismatched
duplexes by RNase A digestion or by differences in melting temperatures.
Sequence differences between a reference gene and genes having
mutations also may be revealed by direct DNA sequencing. In addition, cloned
DNA segments may be employed as probes to detect specific DNA segments.
The sensitivity of such methods can be greatly enhanced by appropriate use of
PCR or another amplification method. For example, a sequencing primer is used
with double-stranded PCR product or a single-stranded template molecule
generated by a modified PCR. The sequence determination is performed by
conventional procedures with radiolabeled nucleotide or by automatic
sequencing
procedures with fluorescent-tags.
Genetic testing based on DNA sequence differences may be achieved by
detection of alteration in electrophoretic mobility of DNA fragments in gels,
with
or without denaturing agents. Small sequence deletions and insertions can be
visualized by high resolution gel electrophoresis. DNA fragments of different
sequences may be distinguished on denaturing formamide gradient gels in which
the mobilities of different DNA fragments are retarded in the gel at different
positions according to their specific melting or partial melting temperatures
(see,
e.g., Myers e1 al., Science 230:1242 (1985)).
Sequence changes at specific locations also may be revealed by nuclease
protection assays, such as RNase and Sl protection or the chemical cleavage
method (e.g., Cotton et al., Proc. Natl. Acad. Sci. USA 85: 4397-4401 (1985)).
Thus, the detection of a specific DNA sequence may be achieved by
methods such as hybridization, RNase protection, chemical cleavage, direct DNA
sequencing or the use of restriction enzymes, (e.g., restriction fragment
length
polymorphisms ("RFLP") and Southern blotting of genomic DNA.
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-28-
In addition to more conventional gel-electrophoresis and DNA sequencing,
mutations also can be detected by in situ analysis.
Chromosome assays
The sequences of the present invention are also valuable for chromosome
identification. The sequence is specifically targeted to and can hybridize
with a
particular location on an individual human chromosome. The mapping of DNAs
to chromosomes according to the present invention is an important first step
in
correlating those sequences with genes associated with disease.
In certain preferred embodiments in this regard, the cDNA herein disclosed
is used to clone genomic DNA of a DR3-V1 or a DR3 gene. This can be
accomplished using a variety of well known techniques and libraries, which
generally are available commercially. The genomic DNA is then used for in situ
chromosome mapping using well known techniques for this purpose.
In addition, sequences can be mapped to chromosomes by preparing PCR
primers (preferably 1 S-25 bp) from the cDNA. Computer analysis of the 3'
untranslated region of the gene is used to rapidly select primers that do not
span
more than one exon in the genomic DNA, thus complicating the amplification
process. These primers are then used for PCR screening of somatic cell hybrids
containing individual human chromosomes.
Fluorescence in situ hybridization ("FISH") of a cDNA clone to a
metaphase chromosomal spread can be used to provide a precise chromosomal
location in one step. This technique can be used with cDNA as short as 50 or
60.
For a review of this technique, see Verma et al., Human Chromosomes: aManual
ofBasic Techniques, Pergamon Press, New York (1988).
Once a sequence has been mapped to a precise chromosomal location, the
physical position of the sequence on the chromosome can be correlated with
genetic map data. Such data are found, for example, in V. McKusick, Mendelian
Inheritance in Man, available on line through Johns Hopkins University, Welch
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-29-
Medical Library. The relationship between genes and diseases that have been
mapped to the same chromosomal region are then identified through linkage
analysis (coinheritance of physically adjacent genes).
Next, it is necessary to determine the differences in the cDNA or genomic
sequence between affected and unaffected individuals. If a mutation is
observed
in some or all ofthe affected individuals but not in any normal individuals,
then the
mutation is likely to be the causative agent of the disease.
Vectors and Host Cells
The present invention also relates to vectors which include DNA
molecules of the present invention, host cells which are genetically
engineered
with vectors of the invention and the production of polypeptides of the
invention
by recombinant techniques.
Host cells can be genetically engineered to incorporate nucleic acid
molecules and express polypeptides ofthe present invention. The
polynucleotides
may be introduced alone or with other polynucleotides. Such other
polynucleotides may be introduced independently, co-introduced or introduced
joined to the polynucleotides of the invention.
In accordance with this aspect of the invention the vector may be, for
example, a plasmid vector, a single or double-stranded phage vector, a single
or
double-stranded RNA or DNA viral vector. Such vectors may be introduced into
cells as polynucleotides, preferably DNA, by well known techniques for
introducing DNA and RNA into cells. Viral vectors may be replication competent
or replication defective. In the latter case, viral propagation generally will
occur
only in complementing host cells.
Preferred among vectors, in certain respects, are those for expression of
polynucleotides and polypeptides of the present invention. Generally, such
vectors comprise cis-acting control regions effective for expression in a host
operatively linked to the polynucleotide to be expressed. Appropriate traps-
acting
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-3 0-
factors either are supplied by the host, supplied by a complementing vector,
or
supplied by the vector itself upon introduction into the host.
A great variety of expression vectors can be used to express a polypeptide
of the invention. Such vectors include chromosomal, episomal and virus-derived
vectors, e.g., vectors derived from bacterial plasmids, from bacteriophage,
from
yeast episomes, from yeast chromosomal elements, from viruses such as
baculoviruses, papova viruses, such as SV40, vaccinia viruses, adenoviruses,
fowl
pox viruses, pseudorabies viruses and retroviruses, and vectors derived from
combinations thereof, such as those derived from plasmid and bacteriophage
genetic elements, such as cosmids and phagemids, all may be used for
expression
in accordance with this aspect of the present invention. Generally, any vector
suitable to maintain, propagate or express polynucleotides to express a
polypeptide in a host may be used for expression in this regard.
The DNA sequence in the expression vector is operatively linked to
appropriate expression control sequence(s), including, for instance, a
promoter to
direct mRNA transcription. Representatives of such promoters include the phage
lambda PL promoter, the E. coli lac, trp and tac promoters, the SV40 early and
late promoters and promoters of retroviral LTRs, to name just a few of the
well-
known promoters. In general, expression constructs will contain sites for
transcription, initiation and termination, and, in the transcribed region, a
ribosome
binding site for translation. The coding portion of the mature transcripts
expressed by the constructs will include a translation initiating AUG at the
beginning and a termination codon (UAA, UGA or UAG) appropriately
positioned at the end of the polypeptide to be translated.
In addition, the constructs may contain control regions that regulate as
well as engender expression. Generally, such regions will operate by
controlling
transcription, such as repressor binding sites and enhancers, among others.
Vectors for propagation and expression generally will include selectable
markers. Such markers also may be suitable for amplification or the vectors
may
contain additional markers for this purpose. In this regard, the expression
vectors
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-31-
preferably contain one or more selectable marker genes to provide a phenotypic
trait for selection of transformed host cells. Preferred markers include
dihydrofolate reductase or neomycin resistance for eukaryotic cell culture,
and
tetracycline or ampicillin resistance genes for culturing E. coli and other
bacteria.
The vector containing the appropriate DNA sequence as described
elsewhere herein, as well as an appropriate promoter, and other appropriate
control sequences, may be introduced into an appropriate host using a variety
of
well known techniques suitable to expression therein of a desired polypeptide.
Representative examples of appropriate hosts include bacterial cells, such as
E.
coli, Streptomyces and Salmonella typhimurium cells; fungal cells, such as
yeast
cells; insect cells such as Drosophila S2 and Spodoptera S~ cells; animal
cells
such as CHO, COS, and Bowes melanoma cells; and plant cells. Hosts for a great
variety of expression constructs are well known, and those of skill will be
enabled
by the present disclosure readily to select a host for expressing a
polypeptides in
accordance with this aspect of the present invention. Appropriate culture
mediums and conditions for the above-described host cells are known in the
art.
Among vectors preferred for use in bacteria are pQE70, pQE60 and
pQE-9, available from Qiagen; pBS vectors, Phagescript vectors, Bluescript
vectors, pNHBA, pNHl6a, pNHl8A, pNH46A, available from Stratagene; and
ptrc99a, pKK223-3, pKK233-3, pDR540, pRITS available from Pharmacia.
Among preferred eukaryotic vectors are pWLNEO, pSV2CAT, pOG44, pXTl
and pSG available from Stratagene; and pSVK3, pBPV, pMSG and pSVL
available from Pharmacia. These vectors are listed solely by way of
illustration of
the many commercially available and well known vectors available to those of
skill
in the art.
Selection of appropriate vectors and promoters for expression in a host
cell is a well known procedure and the requisite techniques for expression
vector
construction, introduction of the vector into the host and expression in the
host
are routine skills in the art.
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-3 2-
The present invention also relates to host cells containing the above-
described constructs discussed above. The host cell can be a higher eukaryotic
cell, such as a mammalian cell, or a lower eukaryotic cell, such as a yeast
cell, or
the host cell can be a prokaryotic cell, such as a bacterial cell.
Introduction of the construct into the host cell can be effected by calcium
phosphate transfection, DEAE-dextran mediated transfection, cationic lipid-
mediated transfection, electroporation, transduction, infection or other
methods.
Such methods are described in many standard laboratory manuals, such as Davis
et
al., Basic Methods in Molecular Biology (1986).
In addition to encompassing host cells containing the vector constructs
discussed herein, the invention also encompasses primary, secondary, and
immortalized host cells of vertebrate origin, particularly mammalian origin,
that
have been engineered to delete or replace endogenous genetic material (e.g.,
the
DR3 coding sequence), and/or to include genetic material (e.g., heterologous
polynucleotide sequences) that is operably associated with DR3-V1 or DR3
polynucleotides of the invention, and which activates, alters, and/or
amplifies
endogenous DR3-V1 or DR3 polynucleotides. For example, techniques known
in the art may be used to operably associate heterologous control regions
(e.g.,
promoter and/or enhancer) and endogenous DR3-V1 or DR3 polynucleotide
sequences via homologous recombination (see, e.g., US Patent Number
5,641,670, issued June 24, 1997; International Publication Number WO 96/29411,
published September 26, 1996; International Publication Number WO 94/12650,
published August 4, 1994; Koller et al., Proc. Natl. Acad. Sci. USA 86:8932-
893 S
(1989); and Zijlstra et al., Nature 342: 435-438 (1989), the disclosures of
each of
which are incorporated by reference in their entireties).
The polypeptide may be expressed in a modified form, such as a fusion
protein, and may include not only secretion signals but also additional
heterologous functional regions. Thus, for instance, a region of additional
amino
acids, particularly charged amino acids, may be added to the N-terminus of the
polypeptide to improve stability and persistence in the host cell, during
purification
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-33-
or during subsequent handling and storage. Also, region also may be added to
the
polypeptide to facilitate purification. Such regions may be removed prior to
ftnal
preparation of the polypeptide. The addition of peptide moieties to
polypeptides
to engender secretion or excretion, to improve stability and to facilitate
purification, among others, are familiar and routine techniques in the art. A
preferred fusion protein comprises a heterologous region from immunoglobulin
that is useful to solubilize proteins. For example, EP-A-O 464 533 (Canadian
counterpart 2045869) discloses fusion proteins comprising various portions of
constant region of immunoglobin molecules together with another human protein
or part thereof. In many cases, the Fc part in a fusion protein is thoroughly
advantageous for use in therapy and diagnosis and thus results, for example,
in
improved pharmacokinetic properties (EP-A 0232 262). On the other hand, for
some uses it would be desirable to be able to delete the Fc part after the
fusion
protein has been expressed, detected and purified in the advantageous manner
described. This is the case when Fc portion proves to be a hindrance to use in
therapy and diagnosis, for example when the fusion protein is to be used as
antigen for immunizations. In drug discovery, for example, human proteins,
such
as, hIL-5-receptor has been fused with Fc portions for the purpose of
high-throughput screening assays to identify antagonists of hIL-5. See, D.
Bennett et al., .lournal ofModecular Recognition, Vol. 8:52-58 (1995) and K.
Johanson et al., The Journal of Biological Chemistry, Vol. 270, No.
16:9459-9471 (1995).
The DR3 and DR3-Vl polypeptides can be recovered and purified from
recombinant cell cultures by well-known methods including ammonium sulfate or
ethanol precipitation, acid extraction, anion or cation exchange
chromatography,
phosphocellulose chromatography, hydrophobic interaction chromatography,
affinity chromatography, hydroxylapatite chromatography and lectin
chromatography. Most preferably, high performance liquid chromatography
("HPLC") is employed for purification. Well known techniques for refolding
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-3 4-
protein may be employed to regenerate active conformation when the polypeptide
is denatured during isolation and/or purification.
Polypeptides of the present invention include naturally purified products,
products of chemical synthetic procedures, and products produced by
recombinant
techniques from a prokaryotic or eukaryotic host, including, for example,
bacterial, yeast, higher plant, insect and mammalian cells. Depending upon the
host employed in a recombinant production procedure, the polypeptides of the
present invention may be glycosylated or may be non-glycosylated. In addition,
polypeptides of the invention may also include an initial modified methionine
residue, in some cases as a result of host-mediated processes.
DR3-V1 or DR3 polynucleotides and polypeptides may be used in
accordance with the present invention for a variety of applications,
particularly
those that make use of the chemical and biological properties of DR3. Among
these are applications in treatment and/or prevention of tumors, resistance to
parasites, bacteria and viruses, to induce proliferation of T-cells,
endothelial cells
and certain hematopoietic cells, to treat and/or prevent restenosis, graft vs.
host
disease, to regulate anti-viral responses and to prevent certain autoimmune
diseases after stimulation ofDR3 by an agonist. Additional applications relate
to
the prognosis, diagnosis, prevention and/or treatment of disorders of cells,
tissues
and organisms. These aspects of the invention are discussed further below.
DR3 Polypeptides and Fragments
The invention further provides an isolated DR3-V 1 or DR3 polypeptide
having the amino acid sequence shown in SEQ ID N0:2 and SEQ ID N0:4,
respectively, or a fragment thereof. It will be recognized in the art that
some
amino acid sequence of DR3-V 1 or DR3 can be varied without significant effect
of the structure or function of the protein. If such differences in sequence
are
contemplated, it should be remembered that there will be critical areas on the
protein which determine activity. Such areas will usually comprise residues
which
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-3 5-
make up the ligand binding site or the death domain, or which form tertiary
structures which afJ'ect these domains.
Thus, the invention further includes variations of the DR3-V1 or DR3
protein which show substantial DR3 functional activity or which include
regions
of DR3-V 1 or DR3 such as the protein fragments discussed below. Such mutants
include deletions, insertions, inversions, repeats, and type substitutions. As
indicated above, guidance concerning which amino acid changes are likely to be
phenotypically silent can be found in J.U. Bowie et al., Science 247: 1306-
1310
( 1990).
Of particular interest are substitutions of charged amino acids with another
charged amino acid and with neutral or negatively charged amino acids. The
latter
results in proteins with reduced positive charge to improve the
characteristics of
the DR3-V 1 or DR3 protein. The prevention of aggregation is highly desirable.
Aggregation of proteins not only results in a loss of activity but can also be
problematic when preparing pharmaceutical formulations, because they can be
immunogenic. (Pinckard et al., Clin Exp. Immunol. 2:331-340 (1967); Robbins
et al., Diabetes 36:838-845 (1987); Cleland e1 al. Crit. Rev. Therapeutic Drug
Carrier Systems 10:307-377 (1993)).
The replacement of amino acids can also change the selectivity of binding
to cell surface receptors. Ostade et al., Nature 361:266-268 (1993) describes
certain mutations resulting in selective binding of TNF-a to only one of the
two
known types of TNF receptors. Thus, the DR3-Vl or DR3 receptor of the
present invention may include one or more amino acid substitutions, deletions
or
additions, either from natural mutations or human manipulation.
As indicated, changes are preferably of a minor nature, such as
conservative amino acid substitutions that do not significantly affect the
folding
or activity of the protein (see Table 1).
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-3 6-
TABLE 1. Conservative Amino Acid Substitutions.
Aromatic Phenylalanine
Tryptophan
Tyrosi ne
Hydrophobic Leucine
Isoleucine
Valine
Polar ~ Glutamine
Asparagine
Basic Arginine
Lysine
Histidine
Acidic Aspartic Acid
Glutamic Acid
Small Alanine
Serine
Threonine
Methionine
Glycine
Of course, the number of amino acid substitutions a skilled artisan would
make depends on many factors, including those described above. Generally
speaking, the number of substitutions for any given DR3-V 1 or DR3 polypeptide
will not be more than 50, 40, 30, 25, 20, 15, 10, 5 or 3.
Amino acids in the DR3-Vl or DR3 protein of the present invention that
are essential for function can be identified by methods known in the art, such
as
site-directed mutagenesis or alanine-scanning mutagenesis (Cunningham and
Wells, Science 244:1081-1085 (1989)). The latter procedure introduces single
alanine mutations at every residue in the molecule. The resulting mutant
molecules are then tested for biological activity such as receptor binding or
in
vitro, or in vitro proliferative activity. Sites that are critical for ligand-
receptor
binding can also be determined by structural analysis such as crystallization,
nuclear magnetic resonance or photoafl''mity labeling (Smith et al., J. Mol.
Biol.
224:899-904 (1992) and de Vos et al. Science 255:306-312 (1992)).
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-3 7-
The polypeptides of the present invention are preferably provided in an
isolated form, and preferably are substantially purified. A recombinantly
produced
version of the DR3-V1 or DR3 polypeptide is substantially purified by the one-
step method described in Smith and Johnson, Gene 67:31-40 (1988).
The polypeptides of the present invention also include the polypeptide
encoded by the deposited cDNAs including the leader, the mature polypeptide
encoded by the deposited the cDNAs minus the leader (i.e., the mature
protein),
the polypeptide of SEQ ID N0:2 or SEQ ID N0:4 including the leader, the
polypeptide of SEQ ID N0:2 or SEQ ID N0:4 minus the leader, the extracellular
domain, the transmembrane domain, the intracellular domain, soluble
polypeptides
comprising, or alternatively consisting of, all or part of the extracellular
and
intracellular domains but lacking the transmembrane domain as well as
polypeptides which are at least 80% identical, more preferably at least 80% or
85% identical, still more preferably at least 90%, 92%, 95%, 96%, 97%, 98% or
99% identical to the polypeptide encoded by the deposited cDNAs, to the
polypeptide of SEQ ID N0:2 or SEQ ID N0:4, and also include portions of such
polypeptides with at least 30 amino acids and more preferably at least 50
amino
acids. Polynucleotides encoding these polypeptides are also encompassed by the
invention.
By a polypeptide having an amino acid sequence at least, for example,
95% "identical" to a reference amino acid sequence of a DR3-V1 or DR3
polypeptide is intended that the amino acid sequence of the polypeptide is
identical
to the reference sequence except that the polypeptide sequence may include up
to
five amino acid alterations per each 100 amino acids of the reference amino
acid
of a DR3-V1 or DR3. In other words, to obtain a polypeptide having an amino
acid sequence at least 95% identical to a reference amino acid sequence, up to
5%
of the amino acid residues in the reference sequence may be deleted or
substituted
with another amino acid, or a number of amino acids up to 5% of the total
amino
acid residues in the reference sequence may be inserted into the reference
sequence. These alterations of the reference sequence may occur at the amino
or
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-3 8-
carboxy terminal positions of the reference amino acid sequence or anywhere
between those terminal positions, interspersed either individually among
residues
in the reference sequence or in one or more contiguous groups within the
reference sequence.
As a practical matter, whether any particular polypeptide is at least 80%,
85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to, for instance, the
amino acid sequence shown in SEQ D7 N0:2 or SEQ >Z7 N0:4, the amino acid
sequence encoded by the deposited cDNAs, or fragments thereof, can be
determined conventionally using known computer programs such as the Bestfit
program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics
Computer Group, University Research Park, 575 Science Drive, Madison, WI
53711). When using Bestfit or any other sequence alignment program to
determine whether a particular sequence is, for instance, 95% identical to a
reference sequence according to the present invention, the parameters are set,
of
course, such that the percentage of identity is calculated over the full
length of the
reference amino acid sequence and that gaps in homology of up to 5% of the
total
number of amino acid residues in the reference sequence are allowed.
In a specific embodiment, the identity between a reference (query)
sequence (a sequence of the present invention) and a subject sequence, also
referred to as a global sequence alignment, is determined using the FASTDB
computer program based on the algorithm of Brutlag et al. (Comp. App. Biosci.
6:237-245 (1990)). Preferred parameters used in a FASTDB amino acid
alignment are: Matrix=PAM 0, k-tuple=2, Mismatch Penalty=l, Joining
Penalty=20, Randomization Group Length=0, Cutoff Score=1, Window
Size=sequence length, Gap Penalty=5, Gap Size Penalty=0.05, Window Size=500
or the length ofthe subject amino acid sequence, whichever is shorter.
According
to this embodiment, if the subject sequence is shorter than the query sequence
due
to N- or C-terminal deletions, not because of internal deletions, a manual
correction is made to the results to take into consideration the fact that the
FASTDB program does not account for N- and C-terminal truncations of the
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-3 9-
subject sequence when calculating global percent identity. For subject
sequences
truncated at the N- and C-termini, relative to the query sequence, the percent
identity is corrected by calculating the number of residues of the query
sequence
that are N- and C-terminal of the subject sequence, which are not
matched/aligned
with a corresponding subject residue, as a percent of the total bases of the
query
sequence. A determination of whether a residue is matched/aligned is
determined
by results ofthe FASTDB sequence alignment. This percentage is then subtracted
from the percent identity, calculated by the above FASTDB program using the
specified parameters, to arrive at a final percent identity score. This final
percent
identity score is what is used for the purposes of this embodiment. Only
residues
to the N- and C-termini of the subject sequence, which are not matched/aligned
with the query sequence, are considered for the purposes ofmanually adjusting
the
percent identity score. That is, only query residue positions outside the
farthest
N- and C-terminal residues of the subject sequence. For example, a 90 amino
acid
residue subject sequence is aligned with a 100 residue query sequence to
determine percent identity. The deletion occurs at the N-terminus of the
subject
sequence and therefore, the FASTDB alignment does not show a
matching/alignment of the first 10 residues at the N-terminus. The 10 unpaired
residues represent 10% of the sequence (number of residues at the N- and C-
termini not matched/total number of residues in the query sequence) so 10% is
subtracted from the percent identity score calculated by the FASTDB program.
If the remaining 90 residues were perfectly matched the final percent identity
would be 90%. In another example, a 90 residue subject sequence is compared
with a 100 residue query sequence. This time the deletions are internal
deletions
so there are no residues at the N- or C-termini of the subject sequence which
are
not matched/aligned with the query. In this case the percent identity
calculated
by FASTDB is not manually corrected. Once again, only residue positions
outside
the N- and C-terminal ends of the subject sequence, as displayed in the FASTDB
alignment, which are not matched/aligned with the query sequence are manually
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-40-
corrected for. No other manual corrections are made for the purposes of this
embodiment.
The present inventors have discovered that the DR3-V 1 polypeptide is a
428 residue protein exhibiting three main structural domains. First, the
ligand
binding domain was identified within amino acid residues from about 36 to
about
212 in SEQ ID N0:2. Second, the transmembrane domain was identified within
amino acid residues from about 213 to about 235 in SEQ ID N0:2. Third, the
intracellular domain was identified within amino acid residues from about 236
to
about 428 in SEQ 117 N0:2. Importantly, the intracellular domain includes a
death domain at amino acid residues from about 3 53 to about 419. Further
preferred fragments of the polypeptide shown in SEQ ID N0:2 include the mature
protein from amino acid residues about 36 to about 428 and soluble
polypeptides
comprising, or alternatively consisting of, all or part of the extracellular
and
intracellular domains but lacking the transmembrane domain. In this context
"about" includes the particularly recited value and values larger or smaller
by
several (5, 4, 3, 2, or 1 ) amino acids. Polynucleotides encoding these
polypeptides
are also encompassed by the invention.
The invention also provides polypeptides comprising, or alternatively
consisting of, one, two, three, four, five or more amino acid sequences
selected
from the group consisting of amino acid residues from about 1 to about 215 of
SEQ ID N0:2; amino acid residues from about 30 to about 215 of SEQ ID N0:2;
amino acid residues from about 21 S to about 240 of SEQ ID N0:2; amino acid
residues from about 240 to about 428 of SEQ ID N0:2; and amino acid residues
from about 350 to about 420 of SEQ ID N0:2. In this context "about" includes
the particularly recited value and values larger or smaller by several (5, 4,
3, 2, or
1) amino acids. Polynucleotides encoding these polypeptides are also
encompassed by the invention.
The present inventors have also discovered that the DR3 polypeptide is a
417 residue protein exhibiting three main structural domains. First, the
ligand
binding domain was identified within amino acid residues from about 25 to
about
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-41-
201 in SEQ B7 N0:4. Second, the transmembrane domain was identified within
amino acid residues from about 202 to about 224 in SEQ ID N0:4. Third, the
intracellular domain was identified within amino acid residues from about 225
to
about 417 in SEQ ID N0:4. Importantly, the intracellular domain includes a
death domain at amino acid residues from about 342 to about 408. Further
preferred fragments of the polypeptide shown in SEQ ID N0:4 include the mature
protein from amino acid residues about 25 to about 417 and soluble
polypeptides
comprising, or alternatively consisting of, all or part of the extracellular
and
intracellular domains but lacking the transmembrane domain. In this context
"about" includes the particularly recited value and values larger or smaller
by
several (5, 4, 3, 2, or 1 ) amino acids. Polynucleotides encoding these
polypeptides
are also encompassed by the invention.
As one of skill in the art will recognize, the full length polypeptides
encoded by the DR3-V 1 and DR3 cDNA differ only in the amino acid sequence
of the leader peptide. The first 24 amino acids of the polypeptide shown in
SEQ
ID N0:2 are replaced by the first 13 amino acids shown in SEQ ID N0:4 but the
rest of the amino acid sequence is the same. Thus, both the DR3-V 1 cDNA and
DR3 cDNA encode an identical mature protein having the same biological
activity.
Thus, the invention further provides DR3-V 1 or DR3 polypeptides
encoded by the deposited cDNAs including the leader and DR3-Vl or DR3
polypeptide fragments selected from the mature protein, the extracellular
domain,
the transmembrane domain, the intracellular domain, and the death domain.
The polypeptides of the present invention have uses which include, but are
not limited to, as sources for generating antibodies that bind the
polypeptides of
the invention, and as molecular weight markers on SDS-PAGE gels or on
molecular sieve gel filtration columns using methods well known to those of
skill
in the art.
In another aspect, the invention provides a peptide or polypeptide
comprising, or alternatively consisting of, an epitope-bearing portion of a
polypeptide described herein.
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-42-
Antigenic epitope-bearing peptides and polypeptides of the invention are
therefore useful to raise antibodies, including monoclonal antibodies, that
bind
specifically to a polypeptide ofthe invention. See, for instance, Wilson et
al.., Cell
37:767-778 (1984) at 777.
Antigenic epitope-bearing peptides and polypeptides of the invention
preferably contain a sequence of at least seven, more preferably at least nine
and
most preferably between at least about 15 to about 30 amino acids contained
within the amino acid sequence of a polypeptide of the invention. In this
context
"about" includes the particularly recited value and values larger or smaller
by
several (5, 4, 3, 2, or 1) amino acids. Polynucleotides encoding these
antigenic
epitope-bearing peptides are also encompassed by the invention.
Non-limiting examples of antigenic polypeptides or peptides that can be
used to generate DR3-specific antibodies include: a polypeptide comprising, or
alternatively consisting of, amino acid residues from about 1 to about 22 in
SEQ
ID N0:2; a polypeptide comprising, or alternatively consisting of, one, two,
three,
four, five or more amino acid sequences selected from the group consisting of
amino acid residues from about 33 to about 56 in SEQ ID N0:2; a polypeptide
comprising, or alternatively consisting of, amino acid residues from about 59
to
about 82 in SEQ ID N0:2; a polypeptide comprising, or alternatively consisting
of, amino acid residues from about 95 to about 112 in SEQ ID N0:2; a
polypeptide comprising, or alternatively consisting of, amino acid residues
from
about 122 to about 133 in SEQ ID N0:2; a polypeptide comprising, or
alternatively consisting of, amino acid residues from about 161 to about 177
in
SEQ ID N0:2; a polypeptide comprising, or alternatively consisting of, amino
acid
residues from about 179 to about 190 in SEQ ID N0:2; and a polypeptide
comprising, or alternatively consisting of, amino acid residues from about 196
to
about 205 in SEQ ~ N0:2. In this context "about" includes the particularly
recited value and values larger or smaller by several (5, 4, 3, 2, or 1) amino
acids.
Polynucleotides encoding these antigenic epitope-bearing peptides are also
encompassed by the invention. In addition, antigenic polypeptides or peptides
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-43-
include polypeptides comprising, or alternatively consisting of, the amino
acid
residues that are the corresponding residues to those polypeptides of DR3-V1
disclosed above. As indicated above, the inventors have determined that the
above polypeptide fragments are antigenic regions of the DR3-V1 and DR3
protein.
The epitope-bearing peptides and polypeptides of the invention may be
produced by any conventional means. R.A. Houghten,"General method for the
rapid solid-phase synthesis of large numbers of peptides: specificity of
antigen-antibody interaction at the level of individual amino acids," Proc.
Natl.
Acad. Sci. USA 82:5131-5135 (1985). This "Simultaneous Multiple Peptide
Synthesis (SMPS)" process is further described in U.S. Patent No. 4,631,211 to
Houghten et al. (1986).
As one of skill in the art will appreciate, DR3-V 1 or DR3 polypeptides of
the present invention, and the epitope-bearing fragments thereof, described
above,
can be combined with parts of the constant domain of immunoglobulins (IgG),
resulting in chimeric polypeptides. These fusion proteins facilitate
purification and
show an increased half life in vivo. This has been shown, e.g., for chimeric
proteins consisting of the first two domains of the human CD4-polypeptide and
various domains ofthe constant regions of the heavy or light chains
ofmammalian
immunoglobulins (EPA 394,827; Traunecker et al., Nature 331:84- 86 (1988)).
Fusion proteins that have a disulfide-linked dimeric structure due to the IgG
part
can also be more efficient in binding and neutralizing other molecules than
the
monomeric DR3-V 1 or DR3 protein or protein fragment alone (Fountoulakis et
al., JBiochem 270:3958-3964 (1995)).
The present invention thus encompasses polypeptides comprising, or
alternatively consisting of, an epitope of the polypeptide having an amino
acid
sequence of SEQ ID N0:2 or SEQ ID N0:4, or an epitope of the polypeptide
sequence encoded by a polynucleotide sequence contained in the plasmid
deposited as ATCC Deposit No. 97456 or 97757 or encoded by a polynucleotide
that hybridizes to the complement of the sequence of SEQ ID NO: l or SEQ m
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-44-
N0:3 or contained in the plasmid deposited as ATCC Deposit No. 97456 or
97757 under stringent hybridization conditions or lower stringency
hybridization
conditions as defined supra. The present invention further encompasses
polynucleotide sequences encoding an epitope of a polypeptide sequence of the
invention (such as, for example, the sequence disclosed in SEQ ID NO: l or SEQ
117 N0:3), polynucleotide sequences of the complementary strand of a
polynucleotide sequence encoding an epitope ofthe invention, and
polynucleotide
sequences which hybridize to the complementary strand under stringent
hybridization conditions or lower stringency hybridization conditions defined
supra. Polynucleotides encoding these antigenic epitope-bearing peptides are
also
encompassed by the invention.
The term "epitopes," as used herein, refers to portions of a polypeptide
having antigenic or immunogenic activity in an animal, preferably a mammal,
and
most preferably in a human. In a preferred embodiment, the present invention
encompasses a polypeptide comprising an epitope, as well as the polynucleotide
encoding this polypeptide. An "immunogenic epitope," as used herein, is
defined
as a portion of a protein that elicits an antibody response in an animal, as
determined by any method known in the art, for example, by the methods for
generating antibodies described infra. (See, for example, Geysen et al., Proc.
Natl. Acad. Sci. USA 81:3998-4002 (1983)). The term "antigenic epitope," as
used herein, is defined as a portion of a protein to which an antibody can
immunospecifically bind its antigen as determined by any method well known in
the art, for example, by the immunoassays described herein. Immunospecific
binding excludes non-specific binding but does not necessarily exclude cross-
reactivity with other antigens. Antigenic epitopes need not necessarily be
immunogenic.
As to the selection of peptides or polypeptides bearing an antigenic epitope
(i. e., that contain a region of a protein molecule to which an antibody can
bind),
it is well known in that art that relatively short synthetic peptides that
mimic part
of a protein sequence are routinely capable of eliciting an antiserum that
reacts
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-45-
with the partially mimicked protein. See, for instance, J.G. Sutcliffe et al.,
"Antibodies that react with predetermined sites on proteins," Science 219: 660-
666
(1983). Peptides capable of eliciting protein-reactive sera are frequently
represented in the primary sequence of a protein, can be characterized by a
set of
simple chemical rules, and are confined neither to immunodominant regions of
intact proteins (i.e., immunogenic epitopes) nor to the amino or carboxyl
terminals.
Fragments that function as epitopes may be produced by any conventional
means. (See, e.g., Houghten, Proc. Natl. Acad. Sci. USA 82:5131-5135 (1985),
further described in U.S. Patent No. 4,631,211).
In the present invention, antigenic epitopes preferably contain a sequence
of at least 4, at least 5, at least 6, at least 7, more preferably at least 8,
at least 9,
at least 10, at least 15, at least 20, at least 25, and, most preferably,
between about
to about 30 amino acids. Preferred polypeptides comprising immunogenic or
15 antigenic epitopes are at least 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60,
65, 70,
75, 80, 85, 90, 95, or 100 amino acid residues in length. Antigenic epitopes
are
useful, for example, to raise antibodies, including monoclonal antibodies,
that
specifically bind the epitope. Antigenic epitopes can be used as the target
molecules in immunoassays. (See, for instance, Wilson et al., Cell 37:767-778
(1984); Sutcliffe et al., Science 219:660-666 (1983)).
Similarly, immunogenic epitopes can be used, for example, to induce
antibodies according to methods well known in the art. (See, for instance,
Sutcliffe et al., supra; Wilson et al., supra; Chow et al., Proc. Natl. Acad.
Sci.
USA 82:910-914; and Bittle et al., J. Gen. Virol. 66:2347-2354 (1985). The
polypeptides comprising one or more immunogenic epitopes may be presented for
eliciting an antibody response together with a carrier protein, such as an
albumin,
to an animal system (such as, for example, rabbit or mouse), or, if the
polypeptide
is of suWcient length (at least about 25 amino acids), the polypeptide may be
presented without a carrier. However, immunogenic epitopes comprising as few
as 8 to 10 amino acids have been shown to be sufficient to raise antibodies
capable
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-46-
of binding to, at the very least, linear epitopes in a denatured polypeptide
(e.g., in
Western blotting).
Epitope-bearing polypeptides of the present invention may be used to
induce antibodies according to methods well known in the art including, but
not
limited to, in vivo immunization, in vitro immunization, and phage display
methods. See, e.g., Sutcliffe e1 al., supra; Wilson et al., supra, and Bittle
et al.,
J. Gen. Virol., 66:2347-2354 (1985). Ifin vivo immunization is used, animals
may
be immunized with free peptide; however, anti-peptide antibody titer may be
boosted by coupling the peptide to a macromolecular carrier, such as keyhole
limpet hemacyanin (KL,H) or tetanus toxoid. For instance, peptides containing
cysteine residues may be coupled to a carrier using a linker such as
maleimidobenzoyl-N-hydroxysuccinimide ester (MBS), while other peptides may
be coupled to carriers using a more general linking agent such as
glutaraldehyde.
Animals such as, for example, rabbits, rats, and mice are immunized with
either
free or carrier-coupled peptides, for instance, by intraperitoneal and/or
intradermal
injection of emulsions containing about 100 micrograms of peptide or carrier
protein and Freund's adjuvant or any other adjuvant known for stimulating an
immune response. Several booster injections may be needed, for instance, at
intervals of about two weeks, to provide a useful titer of anti-peptide
antibody that
can be detected, for example, by ELISA assay using free peptide adsorbed to a
solid surface. The titer of anti-peptide antibodies in serum from an immunized
animal may be increased by selection of anti-peptide antibodies, for instance,
by
adsorption to the peptide on a solid support and elution ofthe selected
antibodies
according to methods well known in the art.
As one of skill in the art will appreciate, and as discussed above, the
polypeptides of the present invention comprising an immunogenic or antigenic
epitope can be fused to other polypeptide sequences. For example, the
polypeptides of the present invention may be fused with the constant domain of
immunoglobulins (IgA, IgE, IgG, IgM), or portions thereof (CH1, CH2, CH3, or
any combination thereof and portions thereof) resulting in chimeric
polypeptides.
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-47-
Such fusion proteins may facilitate purification and may increase half life in
vivo.
This has been shown for chimeric proteins consisting of the first two domains
of
the human CD4-polypeptide and various domains of the constant regions of the
heavy or light chains of mammalian immunoglobulins. See, e.g., EP 394,827;
Traunecker et al., Nature, 331:84-86 (1988). IgG Fusion proteins that have a
disulfide-linked dimeric structure due to the IgG portion disulfide bonds have
also
been found to be more efficient in binding and neutralizing other molecules
than
monomeric polypeptides or fragments thereof alone. See, e.g., Fountoulakis et
al., J. Biochem., 270:3958-3964 (1995). Nucleic acids encoding the above
epitopes can also be recombined with a gene of interest as an epitope tag
(e.g., the
hemagglutinin ("HA") tag or flag tag) to aid in detection and purification of
the
expressed polypeptide. For example, a system described by Janknecht et al.
allows for the ready purification of non-denatured fusion proteins expressed
in
human cell lines (Janknecht et al., 1991, Proc. Natl. Acad. Sci. USA 88:8972-
897). In this system, the gene of interest is subcloned into a vaccinia
recombination plasmid such that the open reading frame of the gene is
translationally fused to an amino-terminal tag consisting of six histidine
residues.
The tag serves as a matrix-binding domain for the fusion protein. Extracts
from
cells infected with the recombinant vaccinia virus are loaded onto Niz+
nitriloacetic
acid-agarose column and histidine-tagged proteins can be selectively eluted
with
imidazole-containing buffers.
Additional fusion proteins of the invention may be generated through the
techniques of gene-shuffling, motif shuffling, exon-shuffling, and/or codon-
shuflling (collectively referred to as "DNA shuffling"). DNA shuffling may be
employed to modulate the activities of polypeptides of the invention, such
methods can be used to generate polypeptides with altered activity, as well as
agonists and antagonists of the polypeptides. See, generally, U.S. Patent Nos.
5,605,793; 5,811,238; 5,830,721; 5,834,252; and 5,837,458, and Patten et al.,
Curr. Opinion Biotechnol. 8:724-33 (1997); Harayama, Trends Biotechnol.
16(2):76-82 ( 1998); Hansson et al., J. Mol. Biol. 287:265-76 ( 1999); and
Lorenzo
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-48-
and Blasco, BioTechniques 24(2):308- 13 (1998) (each of these patents and
publications are hereby incorporated by reference in its entirety). In one
embodiment, alteration of polynucleotides corresponding to SEQ ID NO:1 or
SEQ ID N0:3 and the polypeptides encoded by these polynucleotides may be
achieved by DNA shuffling. DNA shuffling involves the assembly oftwo or more
DNA segments by homologous or site-specific recombination to generate
variation in the polynucleotide sequence. In another embodiment,
polynucleotides
of the invention, or the encoded polypeptides, may be altered by being
subjected
to random mutagenesis by error-prone PCR, random nucleotide insertion or other
methods prior to recombination. In another embodiment, one or more
components, motifs, sections, parts, domains, fragments, etc., of a
polynucleotide
coding a polypeptide of the invention may be recombined with one or more
components, motifs, sections, parts, domains, fragments, etc. of one or more
heterologous molecules.
As mentioned above, even if deletion of one or more amino acids from the
N-terminus of a protein results in modification of loss of one or more
biological
functions of the protein, other functional activities (e.g., biological
activities,
ability to multimerize, ability to bind DR3-V1 ligand) may still be retained.
For
example, the ability of shortened DR3-Vl muteins to induce and/or bind to
antibodies which recognize the complete or mature forms of the polypeptides
generally will be retained when less than the majority of the residues of the
complete or mature polypeptide are removed from the N-terminus. Whether a
particular polypeptide lacking N-terminal residues of a complete polypeptide
retains such immunologic activities can readily be determined by routine
methods
described herein and otherwise known in the art. It is not unlikely that an
DR3-V 1 mutein with a large number of deleted N-terminal amino acid residues
may retain some biological or immunogenic activities. In fact, peptides
composed
of as few as six DR3-V1 amino acid residues may often evoke an immune
response.
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-49-
Accordingly, the present invention further provides polypeptides having
one or more residues deleted from the amino terminus of the DR3-V 1 amino acid
sequence shown in SEQ )D N0:2, up to the arginine residue at position number
423 and polynucleotides encoding such polypeptides. In particular, the present
invention provides polypeptides comprising, or alternatively consisting of,
the
amino acid sequence of residues n1-428 of SEQ ID N0:2, where n1 is an integer
from 2 to 423 corresponding to the position of the amino acid residue in SEQ
ID
N0:2. Polynucleotides encoding these polypeptides are also encompassed by the
invention.
More in particular, the invention provides polynucleotides encoding
polypeptides comprising, or alternatively consisting of, the amino acid
sequence
of a member selected from the group consisting of amino acid residues E-2 to
P-428; E-3 to P-428; T-4 to P-428; Q-5 to P-428; Q-6 to P-428; G-7 to P-428;
E-8 to P-428; A-9 to P-428; P-10 to P-428; R-11 to P-428; G-12 to P-428; Q-13
to P-428; L-14 to P-428; R-15 to P-428; G-16 to P-428; E-17 to P-428; S-18 to
P-428; A-19 to P-428; A-20 to P-428; P-21 to P-428; V-22 to P-428; P-23 to
P-428; Q-24 to P-428; A-25 to P-428; L-26 to P-428; L-27 to P-428; L-28 to
P-428; V-29 to P-428; L-30 to P-428; L-31 to P-428; G-32 to P-428; A-33 to
P-428; R-34 to P-428; A-35 to P-428; Q-36 to P-428; G-37 to P-428; G-38 to
P-428; T-39 to P-428; R-40 to P-428; S-41 to P-428; P-42 to P-428; R-43 to
P-428; C-44 to P-428; D-45 to P-428; C-46 to P-428; A-47 to P-428; G-48 to
P-428; D-49 to P-428; F-50 to P-428; H-51 to P-428; K-52 to P-428; K-53 to
P-428; I-54 to P-428; G-55 to P-428; L-56 to P-428; F-57 to P-428; C-58 to
P-428; C-59 to P-428; R-60 to P-428; G-61 to P-428; C-62 to P-428; P-63 to
P-428; A-64 to P-428; G-65 to P-428; H-66 to P-428; Y-67 to P-428; L-68 to
P-428; K-69 to P-428; A-70 to P-428; P-71 to P-428; C-72 to P-428; T-73 to
P-428; E-74 to P-428; P-75 to P-428; C-76 to P-428; G-77 to P-428; N-78 to
P-428; S-79 to P-428; T-80 to P-428; C-81 to P-428; L-82 to P-428; V-83 to
P-428; C-84 to P-428; P-85 to P-428; Q-86 to P-428; D-87 to P-428; T-88 to
P-428; F-89 to P-428; L-90 to P-428; A-91 to P-428; W-92 to P-428; E-93 to
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-S 0-
P-428; N-94 to P-428; H-95 to P-428; H-96 to P-428; N-97 to P-428; S-98 to
P-428; E-99 to P-428; C-100 to P-428; A-101 to P-428; R-102 to P-428; C-103
to P-428; Q-104 to P-428; A-105 to P-428; C-106 to P-428; D-107 to P-428;
E-108 to P-428; Q-109 to P-428; A-110 to P-428; S-111 to P-428; Q-112 to
P-428; V-113 to P-428; A-114 to P-428; L-11 S to P-428; E-116 to P-428; N-117
to P-428; C-118 to P-428; S-119 to P-428; A-120 to P-428; V-121 to P-428;
A-122 to P-428; D-123 to P-428; T-124 to P-428; R-125 to P-428; C-126 to
P-428; G-127 to P-428; C-128 to P-428; K-129 to P-428; P-130 to P-428; G-131
to P-428; W-132 to P-428; F-133 to P-428; V-134 to P-428; E-135 to P-428;
C-136 to P-428; Q-137 to P-428; V-138 to P-428; S-139 to P-428; Q-140 to
P-428; C-141 to P-428; V-142 to P-428; S-143 to P-428; S-144 to P-428; S-145
to P-428; P-146 to P-428; F-147 to P-428; Y-148 to P-428; C-149 to P-428;
Q-150 to P-428; P-151 to P-428; C-152 to P-428; L-153 to P-428; D-154 to
P-428; C-155 to P-428; G-156 to P-428; A-157 to P-428; L-158 to P-428; H-159
to P-428; R-160 to P-428; H-161 to P-428; T-162 to P-428; R-163 to P-428;
L-164 to P-428; L-165 to P-428; C-166 to P-428; S-167 to P-428; R-168 to
P-428; R-169 to P-428; D-170 to P-428; T-171 to P-428; D-172 to P-428; C-173
to P-428; G-174 to P-428; T-175 to P-428; C-176 to P-428; L-177 to P-428;
P-178 to P-428; G-179 to P-428; F-180 to P-428; Y-181 to P-428; E-182 to
P-428; H-183 to P-428; G-184 to P-428; D-185 to P-428; G-186 to P-428; C-187
to P-428; V-188 to P-428; S-189 to P-428; C-190 to P-428; P-191 to P-428;
T-192 to P-428; S-193 to P-428; T-194 to P-428; L-195 to P-428; G-196 to
P-428; S-197 to P-428; C-198 to P-428; P-199 to P-428; E-200 to P-428; R-201
to P-428; C-202 to P-428; A-203 to P-428; A-204 to P-428; V-205 to P-428;
C-206 to P-428; G-207 to P-428; W-208 to P-428; R-209 to P-428; Q-210 to
P-428; M-211 to P-428; F-212 to P-428; W-213 to P-428; V-214 to P-428;
Q-215 to P-428; V-216 to P-428; L-217 to P-428; L-218 to P-428; A-219 to
P-428; G-220 to P-428; L-221 to P-428; V-222 to P-428; V-223 to P-428; P-224
to P-428; L-225 to P-428; L-226 to P-428; L-227 to P-428; G-228 to P-428;
A-229 to P-428; T-230 to P-428; L-231 to P-428; T-232 to P-428; Y-233 to
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-51-
P-428; T-234 to P-428; Y-235 to P-428; R-236 to P-428; H-237 to P-428; C-238
to P-428; W-239 to P-428; P-240 to P-428; H-241 to P-428; K-242 to P-428;
P-243 to P-428; L-244 to P-428; V-245 to P-428; T-246 to P-428; A-247 to
P-428; D-248 to P-428; E-249 to P-428; A-250 to P-428; G-251 to P-428; M-252
to P-428; E-253 to P-428; A-254 to P-428; L-255 to P-428; T-256 to P-428;
P-257 to P-428; P-258 to P-428; P-259 to P-428; A-260 to P-428; T-261 to
P-428; H-262 to P-428; L-263 to P-428; S-264 to P-428; P-265 to P-428; L-266
to P-428; D-267 to P-428; S-268 to P-428; A-269 to P-428; H-270 to P-428;
T-271 to P-428; L-272 to P-428; L-273 to P-428; A-274 to P-428; P-275 to
P-428; P-276 to P-428; D-277 to P-428; S-278 to P-428; S-279 to P-428; E-280
to P-428; K-281 to P-428; I-282 to P-428; C-283 to P-428; T-284 to P-428;
V-285 to P-428; Q-286 to P-428; L-287 to P-428; V-288 to P-428; G-289 to
P-428; N-290 to P-428; S-291 to P-428; W-292 to P-428; T-293 to P-428; P-294
to P-428; G-295 to P-428; Y-296 to P-428; P-297 to P-428; E-298 to P-428;
T-299 to P-428; Q-300 to P-428; E-301 to P-428; A-302 to P-428; L-303 to
P-428; C-304 to P-428; P-305 to P-428; Q-306 to P-428; V-307 to P-428; T-308
to P-428; W-309 to P-428; S-310 to P-428; W-311 to P-428; D-312 to P-428;
Q-313 to P-428; L-314 to P-428; P-315 to P-428; S-316 to P-428; R-317 to
P-428; A-318 to P-428; L-319 to P-428; G-320 to P-428; P-321 to P-428; A-322
to P-428; A-323 to P-428; A-324 to P-428; P-325 to P-428; T-326 to P-428;
L-327 to P-428; S-328 to P-428; P-329 to P-428; E-330 to P-428; S-331 to
P-428; P-332 to P-428; A-333 to P-428; G-334 to P-428; S-335 to P-428; P-336
to P-428; A-337 to P-428; M-338 to P-428; M-339 to P-428; L-340 to P-428;
Q-341 to P-428; P-342 to P-428; G-343 to P-428; P-344 to P-428; Q-345 to
P-428; L-346 to P-428; Y-347 to P-428; D-348 to P-428; V-349 to P-428; M-350
to P-428; D-351 to P-428; A-352 to P-428; V-353 to P-428; P-354 to P-428;
A-355 to P-428; R-356 to P-428; R-357 to P-428; W-358 to P-428; K-359 to
P-428; E-360 to P-428; F-361 to P-428; V-362 to P-428; R-363 to P-428; T-364
to P-428; L-365 to P-428; G-366 to P-428; L-367 to P-428; R-368 to P-428;
E-369 to P-428; A-370 to P-428; E-371 to P-428; I-372 to P-428; E-373 to
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-52-
P-428; A-374 to P-428; V-375 to P-428; E-376 to P-428; V-377 to P-428; E-378
to P-428; I-379 to P-428; G-380 to P-428; R-381 to P-428; F-382 to P-428;
R-383 to P-428; D-384 to P-428; Q-385 to P-428; Q-386 to P-428; Y-387 to
P-428; E-388 to P-428; M-389 to P-428; L-390 to P-428; K-391 to P-428; R-392
to P-428; W-393 to P-428; R-394 to P-428; Q-395 to P-428; Q-396 to P-428;
Q-397 to P-428; P-398 to P-428; A-399 to P-428; G-400 to P-428; L-401 to
P-428; G-402 to P-428; A-403 to P-428; V-404 to P-428; Y-405 to P-428; A-406
to P-428; A-407 to P-428; L-408 to P-428; E-409 to P-428; R-410 to P-428;
M-411 to P-428; G-412 to P-428; L-413 to P-428; D-414 to P-428; G-415 to
P-428; C-416 to P-428; V-417 to P-428; E-418 to P-428; D-419 to P-428; L-420
to P-428; R-421 to P-428; S-422 to P-428; and R-423 to P-428 of the DR3-V 1
sequence shown in SEQ ID N0:2. The present invention is also directed to
nucleic acid molecules comprising, or alternatively consisting of, a
polynucleotide
sequence at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical
to the polynucleotide sequences encoding the polypeptides described above. The
present invention also encompasses the above polynucleotide sequences fused to
a heterologous polynucleotide sequence. Polypeptides encoded by these
polynucleotides are also encompassed by the invention.
Also as mentioned above, even if deletion of one or more amino acids from
the C-terminus of a protein results in modification of loss of one or more
biological functions of the protein, other functional activities (e.g.,
biological
activities, ability to multimerize, ability to bind DR3-V 1 ligand) may still
be
retained. For example the ability of the shortened DR3-V 1 mutein to induce
and/or bind to antibodies which recognize the complete or mature forms of the
polypeptide generally will be retained when less than the majority of the
residues
of the complete or mature polypeptide are removed from the C-terminus.
Whether a particular polypeptide lacking C-terminal residues of a complete
polypeptide retains such immunologic activities can readily be determined by
routine methods described herein and otherwise known in the art. It is not
unlikely that an DR3-V 1 mutein with a large number of deleted C-terminal
amino
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-53-
acid residues may retain some biological or immunogenic activities. In fact,
peptides composed of as few as six DR3-V 1 amino acid residues may often evoke
an immune response.
Accordingly, the present invention further provides polypeptides having
one or more residues deleted from the carboxy terminus of the amino acid
sequence of the DR3-V 1 polypeptide shown in SEQ ID N0:2, up to the glutamine
residue at position number 6, and polynucleotides encoding such polypeptides.
In particular, the present invention provides polypeptides comprising, or
alternatively consisting of, the amino acid sequence of residues 1-ml of SEQ
ID
N0:2, where ml is an integer from 6 to 427 corresponding to the position of
the
amino acid residue in SEQ ID N0:2. Polynucleotides encoding these polypeptides
are also encompassed by the invention.
More in particular, the invention provides polynucleotides encoding
polypeptides comprising, or alternatively consisting of, the amino acid
sequence
of a member selected from the group consisting of amino acid residues M-1 to
G-427; M-1 to R-426; M-1 to Q-425; M-1 to L-424; M-1 to R-423; M-1 to
S-422; M-1 to R-421; M-1 to L-420; M-1 to D-419; M-1 to E-418; M-1 to
V-417; M-1 to C-416; M-1 to G-415; M-1 to D-414; M-1 to L-413; M-1 to
G-412; M-1 to M-411; M-1 to R-410; M-1 to E-409; M-1 to L-408; M-1 to
A-407; M-1 to A-406; M-1 to Y-405; M-1 to V-404; M-1 to A-403; M-1 to
G-402; M-1 to L-401; M-1 to G-400; M-1 to A-399; M-1 to P-398; M-1 to
Q-397; M-1 to Q-396; M-1 to Q-395; M-1 to R-394; M-1 to W-393; M-1 to
R-392; M-1 to K-391; M-1 to L-390; M-1 to M-389; M-1 to E-388; M-1 to
Y-387; M-1 to Q-386; M-1 to Q-385; M-1 to D-384; M-1 to R-383; M-1 to
F-382; M-1 to R-381; M-1 to G-380; M-1 to I-379; M-1 to E-378; M-1 to V-377;
M-1 to E-376; M-1 to V-375; M-1 to A-374; M-1 to E-373; M-1 to I-372; M-1
to E-371; M-1 to A-370; M-1 to E-369; M-1 to R-368; M-1 to L-367; M-1 to
G-366; M-1 to L-365; M-1 to T-364; M-1 to R-363; M-1 to V-362; M-1 to
F-361; M-1 to E-360; M-1 to K-359; M-1 to W-358; M-1 to R-357; M-1 to
R-356; M-1 to A-355; M-1 to P-354; M-1 to V-353; M-1 to A-352; M-1 to
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-54-
D-351; M-1 to M-350; M-1 to V-349; M-1 to D-348; M-1 to Y-347; M-1 to
L-346; M-1 to Q-345; M-1 to P-344; M-1 to G-343; M-1 to P-342; M-1 to
Q-341; M-1 to L-340; M-1 to M-339; M-1 to M-338; M-1 to A-337; M-1 to
P-336; M-1 to S-335; M-1 to G-334; M-1 to A-333; M-1 to P-332; M-1 to
S-331; M-1 to E-330; M-1 to P-329; M-1 to S-328; M-1 to L-327; M-1 to T-326;
M-1 to P-325; M-1 to A-324; M-1 to A-323; M-1 to A-322; M-1 to P-321; M-1
to G-320; M-1 to L-319; M-1 to A-318; M-1 to R-317; M-1 to S-316; M-1 to
P-315; M-1 to L-314; M-1 to Q-313; M-1 to D-312; M-1 to W-311; M-1 to
S-310; M-1 to W-309; M-1 to T-308; M-1 to V-307; M-1 to Q-306; M-1 to
P-305; M-1 to C-304; M-1 to L-303; M-1 to A-302; M-1 to E-301; M-1 to
Q-300; M-1 to T-299; M-1 to E-298; M-1 to P-297; M-1 to Y-296; M-1 to
G-295; M-1 to P-294; M-1 to T-293; M-1 to W-292; M-1 to S-291; M-1 to
N-290; M-1 to G-289; M-1 to V-288; M-1 to L-287; M-1 to Q-286; M-1 to
V-285; M-1 to T-284; M-1 to C-283; M-1 to I-282; M-1 to K-281; M-1 to
E-280; M-1 to S-279; M-1 to S-278; M-1 to D-277; M-1 to P-276; M-1 to P-275;
M-1 to A-274; M-1 to L-273; M-1 to L-272; M-1 to T-271; M-1 to H-270; M-1
to A-269; M-1 to S-268; M-1 to D-267; M-1 to L-266; M-1 to P-265; M-1 to
S-264; M-1 to L-263; M-1 to H-262; M-1 to T-261; M-1 to A-260; M-1 to
P-259; M-1 to P-258; M-1 to P-257; M-1 to T-256; M-1 to L-255; M-1 to A-254;
M-1 to E-253; M-1 to M-252; M-1 to G-251; M-1 to A-250; M-1 to E-249; M-1
to D-248; M-1 to A-247; M-1 to T-246; M-1 to V-245; M-1 to L-244; M-1 to
P-243; M-1 to K-242; M-1 to H-241; M-1 to P-240; M-1 to W-239; M-1 to
C-238; M-1 to H-237; M-1 to R-236; M-1 to Y-235; M-1 to T-234; M-1 to
Y-233; M-1 to T-232; M-1 to L-231; M-1 to T-230; M-1 to A-229; M-1 to
G-228; M-1 to L-227; M-1 to L-226; M-1 to L-225; M-1 to P-224; M-1 to
V-223; M-1 to V-222; M-1 to L-221; M-1 to G-220; M-1 to A-219; M-1 to
L-218; M-1 to L-217; M-1 to V-216; M-1 to Q-215; M-1 to V-214; M-1 to
W-213; M-1 to F-212; M-1 to M-211; M-1 to Q-210; M-1 to R-209; M-1 to
W-208; M-1 to G-207; M-1 to C-206; M-1 to V-205; M-1 to A-204; M-1 to
A-203; M-1 to C-202; M-1 to R-201; M-1 to E-200; M-1 to P-199; M-1 to
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-55-
C-198; M-1 to S-197; M-1 to G-196; M-1 to L-195; M-1 to T-194; M-1 to
S-193; M-1 to T-192; M-1 to P-191; M-1 to C-190; M-1 to S-189; M-1 to
V-188; M-1 to C-187; M-1 to G-186; M-1 to D-185; M-1 to G-184; M-1 to
H-183; M-1 to E-182; M-1 to Y-181; M-1 to F-180; M-1 to G-179; M-1 to
P-178; M-1 to L-177; M-1 to C-176; M-1 to T-175; M-1 to G-174; M-I to
C-173; M-1 to D-172; M-1 to T-171; M-1 to D-170; M-1 to R-169; M-1 to
R-168; M-1 to S-167; M-1 to C-166; M-1 to L-165; M-1 to L-164; M-1 to
R-163; M-1 to T-162; M-1 to H-161; M-1 to R-160; M-1 to H-159; M-1 to
L-158; M-1 to A-157; M-1 to G-156; M-1 to C-155; M-1 to D-154; M-1 to
L-153; M-1 to C-152; M-1 to P-151; M-1 to Q-150; M-1 to C-149; M-1 to
Y-148; M-1 to F-147; M-1 to P-146; M-1 to S-145; M-1 to S-144; M-1 to S-143;
M-1 to V-142; M-1 to C-141; M-1 to Q-140; M-1 to S-139; M-1 to V-138; M-1
to Q-137; M-1 to C-136; M-1 to E-135; M-1 to V-134; M-1 to F-133; M-1 to
W-132; M-1 to G-131; M-1 to P-130; M-1 to K-129; M-1 to C-128; M-1 to
G-127; M-1 to C-126; M-1 to R-125; M-1 to T-124; M-1 to D-123; M-1 to
A-122; M-1 to V-121; M-1 to A-120; M-1 to S-119; M-1 to C-118; M-1 to
N-117; M-1 to E-116; M-1 to L-115; M-1 to A-114; M-1 to V-113; M-1 to
Q-112; M-1 to S-111; M-1 to A-110; M-1 to Q-109; M-1 to E-108; M-1 to
D-107; M-1 to C-106; M-1 to A-105; M-1 to Q-104; M-1 to C-103; M-1 to
R-102; M-1 to A-101; M-1 to C-100; M-1 to E-99; M-1 to S-98; M-1 to N-97;
M-1 to H-96; M-1 to H-95; M-1 to N-94; M-1 to E-93; M-1 to W-92; M-1 to
A-91; M-1 to L-90; M-1 to F-89; M-1 to T-88; M-1 to D-87; M-1 to Q-86; M-1
to P-85; M-1 to C-84; M-1 to V-83; M-1 to L-82; M-1 to C-81; M-1 to T=80;
M-1 to S-79; M-1 to N-78; M-1 to G-77; M-1 to C-76; M-1 to P-75; M-1 to
E-74; M-1 to T-73; M-1 to C-72; M-1 to P-71; M-1 to A-70; M-1 to K-69; M-1
to L-68; M-1 to Y-67; M-l to H-66; M-1 to G-65; M-1 to A-64; M-1 to P-63;
M-1 to C-62; M-1 to G-61; M-1 to R-60; M-1 to C-59; M-1 to C-58; M-1 to
F-57; M-1 to L-56; M-1 to G-55; M-1 to I-54; M-1 to K-53; M-1 to K-52; M-1
to H-51; M-1 to F-50; M-1 to D-49; M-1 to G-48; M-1 to A-47; M-1 to C-46;
M-1 to D-45; M-1 to C-44; M-1 to R-43; M-1 to P-42; M-1 to S-41; M-1 to
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-S 6-
R-40; M-1 to T-39; M-1 to G-38; M-1 to G-37; M-1 to Q-36; M-1 to A-35; M-1
to R-34; M-1 to A-33; M-1 to G-32; M-1 to L-31; M-1 to L-30; M-1 to V-29;
M-1 to L-28; M-1 to L-27; M-1 to L-26; M-1 to A-25; M-1 to Q-24; M-1 to
P-23; M-1 to V-22; M-1 to P-21; M-1 to A-20; M-1 to A-19; M-1 to S-18; M-1
to E-17; M-1 to G-16; M-1 to R-15; M-1 to L-14; M-1 to Q-13; M-1 to G-12;
M-1 to R-11; M-1 to P-10; M-1 to A-9; M-1 to E-8; M-1 to G-7; and M-1 to Q-6
of the sequence of the DR3-V1 sequence shown in SEQ >D N0:2. The present
invention is also directed to nucleic acid molecules comprising, or
alternatively
consisting of, a polynucleotide sequence at least 80%, 85%, 90%, 92%, 95%,
96%, 97%, 98%, or 99% identical to the polynucleotide sequences encoding the
polypeptides described above. The present invention also encompasses the above
polynucleotide sequences fused to a heterologous polynucleotide sequence.
Polypeptides encoded by these polynucleotides are also encompassed by the
invention.
The invention also provides polypeptides having one or more amino acids
deleted from both the amino and the carboxyl termini of an DR3-V 1
polypeptide,
which may be described generally as having residues nl-ml of SEQ ID N0:2,
where n1 and ml are integers as described above. Polynucleotides encoding
these
polypeptides are also encompassed by the invention.
As mentioned above, even if deletion of one or more amino acids from the
N-terminus of an extracellular domain of a protein results in modification of
loss
of one or more biological functions of the protein, other functional
activities (e.g.,
biological activities, ability to multimerize, ability to bind DR3-V 1 ligand)
may still
be retained. For example, the ability of shortened DR3-V1 extracellular domain
muteins to induce and/or bind to antibodies which recognize the complete,
mature
or extracellular domain forms of the polypeptides generally will be retained
when
less than the majority of the residues of the complete, mature or
extracellular
domain polypeptide are removed from the N-terminus. Whether a particular
polypeptide lacking N-terminal residues of an extracellular domain of a
polypeptide retains such immunologic activities can readily be determined by
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-57-
routine methods described herein and otherwise known in the art. It is not
unlikely that a DR3-Vl extracellular domain mutein with a large number of
deleted N-terminal amino acid residues may retain some biological or
immunogenic activities. In fact, peptides composed of as few as six DR3-V1
extracellular domain amino acid residues may often evoke an immune response.
Accordingly, the present invention further provides polypeptides having one or
more residues deleted from the amino terminus of the DR3-V1 extracellular
domain amino acid sequence shown in SEQ 1D N0:2, up to the cysteine residue
at position number 206 and polynucleotides encoding such polypeptides. In
particular, the present invention provides polypeptides comprising, or
alternatively
consisting of, the amino acid sequence of residues n2-212 of SEQ ID N0:2,
where n2 is an integer from 36 to 206 corresponding to the position of the
amino
acid residue in SEQ 117 N0:2. Polynucleotides encoding these polypeptides are
also encompassed by the invention.
More in particular, the invention provides polynucleotides encoding
polypeptides comprising, or alternatively consisting of, the amino acid
sequence
of a member selected from the group consisting of amino acid residues Q-36 to
F-212; G-37 to F-212; G-38 to F-212; T-39 to F-212; R-40 to F-212; S-41 to
F-212; P-42 to F-212; R-43 to F-212; C-44 to F-212; D-45 to F-212; C-46 to
F-212; A-47 to F-212; G-48 to F-212; D-49 to F-212; F-50 to F-212; H-51 to
F-212; K-52 to F-212; K-53 to F-212; I-54 to F-212; G-55 to F-212; L-56 to
F-212; F-57 to F-212; C-58 to F-212; C-59 to F-212; R-60 to F-212; G-61 to
F-212; C-62 to F-212; P-63 to F-212; A-64 to F-212; G-65 to F-212; H-66 to
F-212; Y-67 to F-212; L-68 to F-212; K-69 to F-212; A-70 to F-212; P-71 to
F-212; C-72 to F-212; T-73 to F-212; E-74 to F-212; P-75 to F-212; C-76 to
F-212; G-77 to F-212; N-78 to F-212; S-79 to F-212; T-80 to F-212; C-81 to
F-212; L-82 to F-212; V-83 to F-212; C-84 to F-212; P-85 to F-212; Q-86 to
F-212; D-87 to F-212; T-88 to F-212; F-89 to F-212; L-90 to F-212; A-91 to
F-212; W-92 to F-212; E-93 to F-212; N-94 to F-212; H-95 to F-212; H-96 to
F-212; N-97 to F-212; S-98 to F-212; E-99 to F-212; C-100 to F-212; A-101 to
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-58-
F-212; R-102 to F-212; C-103 to F-212; Q-104 to F-212; A-105 to F-212; C-106
to F-212; D-107 to F-212; E-108 to F-212; Q-109 to F-212; A-110 to F-212;
S-111 to F-212; Q-112 to F-212; V-113 to F-212; A-114 to F-212; L-115 to
F-212; E-116 to F-212; N-117 to F-212; C-118 to F-212; S-119 to F-212; A-120
to F-212; V-121 to F-212; A-122 to F-212; D-123 to F-212; T-124 to F-212;
R-125 to F-212; C-126 to F-212; G-127 to F-212; C-128 to F-212; K-129 to
F-212; P-130 to F-212; G-131 to F-212; W-132 to F-212; F-133 to F-212; V-134
to F-212; E-13 5 to F-212; C-13 6 to F-212; Q-13 7 to F-212; V-13 8 to F-212;
S-139 to F-212; Q-140 to F-212; C-141 to F-212; V-142 to F-212; S-143 to
F-212; S-144 to F-212; S-145 to F-212; P-146 to F-212; F-147 to F-212; Y-148
to F-212; C-149 to F-212; Q-150 to F-212; P-151 to F-212; C-152 to F-212;
L-153 to F-212; D-154 to F-212; C-155 to F-212; G-156 to F-212; A-157 to
F-212; L-15 8 to F-212; H-15 9 to F-212; R-160 to F-212; H-16 I to F-212; T-
162
to F-212; R-163 to F-212; L-164 to F-212; L-165 to F-212; C-166 to F-212;
S-167 to F-212; R-168 to F-212; R-169 to F-212; D-170 to F-212; T-171 to
F-212; D-172 to F-212; C-173 to F-212; G-174 to F-212; T-175 to F-212; C-176
to F-212; L-177 to F-212; P-178 to F-212; G-179 to F-212; F-180 to F-212;
Y-181 to F-212; E-182 to F-212; H-183 to F-212; G-184 to F-212; D-185 to
F-212; G-186 to F-212; C-187 to F-212; V-188 to F-212; S-189 to F-212; C-190
to F-212; P-191 to F-212; T-192 to F-212; S-193 to F-212; T-194 to F-212;
L-195 to F-212; G-196 to F-212; S-197 to F-212; C-198 to F-212; P-199 to
F-212; E-200 to F-212; R-201 to F-212; C-202 to F-212; A-203 to F-212; A-204
to F-212; V-205 to F-212; and C-206 to F-212 ofthe DR3-V1 sequence shown
in SEQ ID N0:2. The present invention is also directed to nucleic acid
molecules
comprising, or alternatively consisting of, a polynucleotide sequence at least
80%,
85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to the polynucleotide
sequences encoding the polypeptides described above. The present invention
also
encompasses the above polynucleotide sequences fused to a heterologous
polynucleotide sequence. Polypeptides encoded by these polynucleotides are
also
encompassed by the invention.
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-59-
Also as mentioned above, even if deletion of one or more amino acids from
the C-terminus of an extracellular domain of a protein results in modification
of
loss of one or more biological functions of the protein, other functional
activities
(e.g., biological activities, ability to multimerize, ability to bind DR3-V1
ligand)
may still be retained. For example the ability of the shortened DR3-V1
extracellular domain mutein to induce and/or bind to antibodies which
recognize
the complete, mature or extracellular domain forms of the polypeptide
generally
will be retained when less than the majority of the residues of the complete,
mature or extracellular domain of a polypeptide are removed from the C-
terminus.
Whether a particular polypeptide lacking C-terminal residues of an
extracellular
domain of a polypeptide retains such immunologic activities can readily be
determined by routine methods described herein and otherwise known in the art.
It is not unlikely that a DR3-V 1 extracellular domain mutein with a large
number
of deleted C-terminal amino acid residues may retain some biological or
immunogenic activities. In fact, peptides composed of as few as six DR3-V1
extracellular domain amino acid residues may often evoke an immune response.
Accordingly, the present invention further provides polypeptides having
one or more residues deleted from the carboxy terminus of the amino acid
sequence of the extracellular domain of the DR3-V 1 polypeptide shown in SEQ
ID N0:2, up to the proline residue at position number 42, and polynucleotides
encoding such polypeptides. In particular, the present invention provides
polypeptides comprising, or alternatively consisting of, the amino acid
sequence
of residues 36-m2 of SEQ ID N0:2, where m2 is an integer from 42 to 212
corresponding to the position of the amino acid residue in SEQ ID N0:2.
Polynucleotides encoding these polypeptides are also encompassed by the
invention.
More in particular, the invention provides polynucleotides encoding
polypeptides comprising, or alternatively consisting of, the amino acid
sequence
of a member selected from the group consisting of amino acid residues Q-36 to
F-212; Q-36 to M-211; Q-36 to Q-210; Q-36 to R-209; Q-36 to W-208; Q-36 to
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-60-
G-207; Q-36 to C-206; Q-36 to V-205; Q-36 to A-204; Q-36 to A-203; Q-36 to
C-202; Q-36 to R-201; Q-36 to E-200; Q-36 to P-199; Q-36 to C-198; Q-36 to
S-197; Q-36 to G-196; Q-36 to L-195; Q-36 to T-194; Q-36 to S-193; Q-36 to
T-192; Q-3 6 to P-191; Q-3 6 to C-190; Q-3 6 to S-189; Q-3 6 to V-18 8; Q-3 6
to
C-187; Q-36 to G-186; Q-36 to D-185; Q-36 to G-184; Q-36 to H-183; Q-36 to
E-182; Q-36 to Y-181; Q-36 to F-180; Q-36 to G-179; Q-36 to P-178; Q-36 to
L-177; Q-36 to C-176; Q-36 to T-175; Q-36 to G-174; Q-36 to C-173; Q-36 to
D-172; Q-36 to T-171; Q-36 to D-170; Q-36 to R-169; Q-36 to R-168; Q-36 to
S-167; Q-36 to C-166; Q-36 to L-165; Q-36 to L-164; Q-36 to R-163; Q-36 to
T-162; Q-36 to H-161; Q-36 to R-160; Q-36 to H-159; Q-36 to L-158; Q-36 to
A-157; Q-36 to G-156; Q-36 to C-155; Q-36 to D-154; Q-36 to L-153; Q-36 to
C-152; Q-36 to P-151; Q-36 to Q-150; Q-36 to C-149; Q-36 to Y-148; Q-36 to
F-147; Q-36 to P-146; Q-36 to S-145; Q-36 to S-144; Q-36 to S-143; Q-36 to
V-142; Q-3 6 to C-141; Q-3 6 to Q-140; Q-3 6 to S-13 9; Q-3 6 to V-13 8; Q-3 6
to
Q-137; Q-36 to C-136; Q-36 to E-135; Q-36 to V-134; Q-36 to F-133; Q-36 to
W-132; Q-36 to G-131; Q-36 to P-130; Q-36 to K-129; Q-36 to C-128; Q-36 to
G-127; Q-36 to C-126; Q-36 to R-125; Q-36 to T-124; Q-36 to D-123; Q-36 to
A-122; Q-36 to V-121; Q-36 to A-120; Q-36 to S-119; Q-36 to C-118; Q-36 to
N-117; Q-36 to E-116; Q-36 to L-115; Q-36 to A-114; Q-36 to V-113; Q-36 to
Q-112; Q-36 to S-111; Q-36 to A-110; Q-36 to Q-109; Q-36 to E-108; Q-36 to
D-107; Q-36 to C-106; Q-36 to A-105; Q-36 to Q-104; Q-36 to C-103; Q-36 to
R-102; Q-3 6 to A-101; Q-3 6 to C-100; Q-3 6 to E-99; Q-3 6 to S-98; Q-3 6 to
N-97; Q-36 to H-96; Q-36 to H-95; Q-36 to N-94; Q-36 to E-93; Q-36 to W-92;
Q-36 to A-91; Q-36 to L-90; Q-36 to F-89; Q-36 to T-88; Q-36 to D-87; Q-36
to Q-86; Q-36 to P-85; Q-36 to C-84; Q-36 to V-83; Q-36 to L-82; Q-36 to
C-81; Q-36 to T-80; Q-36 to S-79; Q-36 to N-78; Q-36 to G-77; Q-36 to C-76;
Q-36 to P-75; Q-36 to E-74; Q-36 to T-73; Q-36 to C-72; Q-36 to P-71; Q-36
to A-70; Q-36 to K-69; Q-36 to L-68; Q-36 to Y-67; Q-36 to H-66; Q-36 to
G-65; Q-36 to A-64; Q-36 to P-63; Q-36 to C-62; Q-36 to G-61; Q-36 to R-60;
Q-36 to C-59; Q-36 to C-58; Q-36 to F-57; Q-36 to L-56; Q-36 to G-55; Q-36
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-61-
to I-54; Q-36 to K-53; Q-36 to K-52; Q-36 to H-51; Q-36 to F-50; Q-36 to D-49;
Q-36 to G-48; Q-36 to A-47; Q-36 to C-46; Q-36 to D-45; Q-36 to C-44; Q-36
to R-43; and Q-36 to P-42 of the sequence of the DR3-V1 sequence shown in
SEQ ID N0:2. The present invention is also directed to nucleic acid molecules
comprising, or alternatively consisting of, a polynucleotide sequence at least
80%,
85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to the polynucleotide
sequences encoding the polypeptides described above. The present invention
also
encompasses the above polynucleotide sequences fused to a heterologous
polynucleotide sequence. Polypeptides encoded by these polynucleotides are
also
encompassed by the invention.
The invention also provides polypeptides having one or more amino acids
deleted from both the amino and the carboxyl termini of an DR3-V 1
polypeptide,
which may be described generally as having residues n2-m2 of SEQ ID N0:2,
where n2 and m2 are integers as described above. Polynucleotides encoding
these
polypeptides are also encompassed by the invention.
As mentioned above, even if deletion of one or more amino acids from the
N-terminus of a protein results in modification of loss of one or more
biological
functions of the protein, other functional activities (e.g., biological
activities,
ability to multimerize, ability to bind DR3 ligand) may still be retained. For
example, the ability of shortened DR3 muteins to induce and/or bind to
antibodies
which recognize the complete or mature forms of the polypeptides generally
will
be retained when less than the majority of the residues of the complete or
mature
polypeptide are removed from the N-terminus. Whether a particular polypeptide
lacking N-terminal residues of a complete polypeptide retains such immunologic
activities can readily be determined by routine methods described herein and
otherwise known in the art. It is not unlikely that a DR3 mutein with a large
number of deleted N-terminal amino acid residues may retain some biological or
immunogenic activities. In fact, peptides composed of as few as six DR3 amino
acid residues may often evoke an immune response.
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-62-
Accordingly, the present invention further provides polypeptides having
one or more residues deleted from the amino terminus of the DR3 amino acid
sequence shown in SEQ ID N0:4, up to the arginine residue at position number
412 and polynucleotides encoding such polypeptides. In particular, the present
invention provides polypeptides comprising, or alternatively consisting of,
the
amino acid sequence of residues n3-417 of SEQ ID N0:4, where n3 is an integer
from 2 to 412 corresponding to the position of the amino acid residue in SEQ
ID
N0:4. Polynucleotides encoding these polypeptides are also encompassed by the
invention.
More in particular, the invention provides polynucleotides encoding
polypeptides comprising, or alternatively consisting of, the amino acid
sequence
of a member selected from the group consisting of amino acid residues E-2 to
P-417; Q-3 to P-417; R-4 to P-417; P-5 to P-417; R-6 to P-417; G-7 to P-417;
C-8 to P-417; A-9 to P-417; A-10 to P-417; V-11 to P-417; A-12 to P-417; A-13
to P-417; A-14 to P-417; L-1 S to P-417; L-16 to P-417; L-17 to P-417; V-18 to
P-417; L-19 to P-417; L-20 to P-417; G-21 to P-417; A-22 to P-417; R-23 to
P-417; A-24 to P-417; Q-25 to P-417; G-26 to P-417; G-27 to P-417; T-28 to
P-417; R-29 to P-417; S-30 to P-417; P-31 to P-417; R-32 to P-417; C-33 to
P-417; D-34 to P-417; C-35 to P-417; A-36 to P-417; G-37 to P-417; D-38 to
P-417; F-39 to P-417; H-40 to P-417; K-41 to P-417; K-42 to P-417; I-43 to
P-417; G-44 to P-417; L-45 to P-417; F-46 to P-417; C-47 to P-417; C-48 to
P-417; R-49 to P-417; G-50 to P-417; C-51 to P-417; P-52 to P-417; A-53 to
P-417; G-54 to P-417; H-55 to P-417; Y-56 to P-417; L-57 to P-417; K-58 to
P-417; A-59 to P-417; P-60 to P-417; C-61 to P-417; T-62 to P-417; E-63 to
P-417; P-64 to P-417; C-65 to P-417; G-66 to P-417; N-67 to P-417; S-68 to
P-417; T-69 to P-417; C-70 to P-417; L-71 to P-417; V-72 to P-417; C-73 to
P-417; P-74 to P-417; Q-75 to P-417; D-76 to P-417; T-77 to P-417; F-78 to
P-417; L-79 to P-417; A=80 to P-417; W-81 to P-417; E-82 to P-417; N-83 to
P-417; H-84 to P-417; H-85 to P-417; N-86 to P-417; S-87 to P-417; E-88 to
P-417; C-89 to P-417; A-90 to P-417; R-91 to P-417; C-92 to P-417; Q-93 to
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-63-
P-417; A-94 to P-417; C-95 to P-417; D-96 to P-417; E-97 to P-417; Q-98 to
P-417; A-99 to P-417; S-100 to P-417; Q-101 to P-417; V-102 to P-417; A-103
to P-417; L-104 to P-417; E-105 to P-417; N-106 to P-417; C-107 to P-417;
S-108 to P-417; A-109 to P-417; V-110 to P-417; A-111 to P-417; D-112 to
P-417; T-113 to P-417; R-114 to P-417; C-11 S to P-417; G-116 to P-417; C-117
to P-417; K-118 to P-417; P-119 to P-417; G-120 to P-417; W-121 to P-417;
F-122 to P-417; V-123 to P-417; E-124 to P-417; C-125 to P-417; Q-126 to
P-417; V-127 to P-417; S-128 to P-417; Q-129 to P-417; C-130 to P-417; V-131
to P-417; S-132 to P-417; S-133 to P-417; S-134 to P-417; P-135 to P-417;
F-13 6 to P-417; Y-13 7 to P-417; C-13 8 to P-417; Q-13 9 to P-417; P-140 to
P-417; C-141 to P-417; L-142 to P-417; D-143 to P-417; C-144 to P-417; G-145
to P-417; A-146 to P-417; L-147 to P-417; H-148 to P-417; R-149 to P-417;
H-150 to P-417; T-151 to P-417; R-152 to P-417; L-153 to P-417; L-154 to
P-417; C-155 to P-417; S-156 to P-417; R-157 to P-417; R-158 to P-417; D-159
to P-417; T-160 to P-417; D-161 to P-417; C-162 to P-417; G-163 to P-417;
T-164 to P-417; C-165 to P-417; L-166 to P-417; P-167 to P-417; G-168 to
P-417; F-169 to P-417; Y-170 to P-417; E-171 to P-417; H-172 to P-417; G-173
to P-417; D-174 to P-417; G-175 to P-417; C-176 to P-417; V-177 to P-417;
S-178 to P-417; C-179 to P-417; P-180 to P-417; T-181 to P-417; S-182 to
P-417; T-183 to P-417; L-184 to P-417; G-185 to P-417; S-186 to P-417; C-187
to P-417; P-188 to P-417; E-189 to P-417; R-190 to P-417; C-191 to P-417;
A-192 to P-417; A-193 to P-417; V-194 to P-417; C-195 to P-417; G-196 to
P-417; W-197 to P-417; R-198 to P-417; Q-199 to P-417; M-200 to P-417;
F-201 to P-417; W-202 to P-417; V-203 to P-417; Q-204 to P-417; V-205 to
P-417; L-206 to P-417; L-207 to P-417; A-208 to P-417; G-209 to P-417; L-210
to P-417; V-211 to P-417; V-212 to P-417; P-213 to P-417; L-214 to P-417;
L-215 to P-417; L-216 to P-417; G-217 to P-417; A-218 to P-417; T-219 to
P-417; L-220 to P-417; T-221 to P-417; Y-222 to P-417; T-223 to P-417; Y-224
to P-417; R-225 to P-417; H-226 to P-417; C-227 to P-417; W-228 to P-417;
P-229 to P-417; H-230 to P-417; K-231 to P-417; P-232 to P-417; L-233 to
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-64-
P-417; V-234 to P-417; T-235 to P-417; A-236 to P-417; D-237 to P-417; E-238
to P-417; A-23 9 to P-417; G-240 to P-417; M-241 to P-417; E-242 to P-417;
A-243 to P-417; L-244 to P-417; T-245 to P-417; P-246 to P-417; P-247 to
P-417; P-248 to P-417; A-249 to P-417; T-250 to P-417; H-251 to P-417; L-252
to P-417; S-253 to P-417; P-254 to P-417; L-255 to P-417; D-256 to P-417;
S-257 to P-417; A-258 to P-417; H-259 to P-417; T-260 to P-417; L-261 to
P-417; L-262 to P-417; A-263 to P-417; P-264 to P-417; P-265 to P-417; D-266
to P-417; S-267 to P-417; S-268 to P-417; E-269 to P-417; K-270 to P-417;
I-271 to P-417; C-272 to P-417; T-273 to P-417; V-274 to P-417; Q-275 to
P-417; L-276 to P-417; V-277 to P-417; G-278 to P-417; N-279 to P-417; S-280
to P-417; W-281 to P-417; T-282 to P-417; P-283 to P-417; G-284 to P-417;
Y-285 to P-417; P-286 to P-417; E-287 to P-417; T-288 to P-417; Q-289 to
P-417; E-290 to P-417; A-291 to P-417; L-292 to P-417; C-293 to P-417; P-294
to P-417; Q-295 to P-417; V-296 to P-417; T-297 to P-417; W-298 to P-417;
S-299 to P-417; W-300 to P-417; D-301 to P-417; Q-302 to P-417; L-303 to
P-417; P-304 to P-417; S-305 to P-417; R-306 to P-417; A-307 to P-417; L-308
to P-417; G-309 to P-417; P-310 to P-417; A-311 to P-417; A-312 to P-417;
A-313 to P-417; P-314 to P-417; T-315 to P-417; L-316 to P-417; S-317 to
P-417; P-318 to P-417; E-319 to P-417; S-320 to P-417; P-321 to P-413; A-322
to P-417; G-323 to P-417; S-324 to P-417; P-325 to P-417; A-326 to P-417;
M-327 to P-417; M-328 to P-417; L-329 to P-417; Q-330 to P-417; P-331 to
P-417; G-3 3 2 to P-417; P-3 3 3 to P-417; Q-3 3 4 to P-417; L-3 3 5 to P-417;
Y-3 3 6
to P-417; D-337 to P-417; V-338 to P-417; M-339 to P-417; D-340 to P-417;
A-341 to P-417; V-342 to P-417; P-343 to P-417; A-344 to P-417; R-345 to
P-417; R-346 to P-417; W-347 to P-417; K-348 to P-417; E-349 to P-417; F-350
to P-417; V-351 to P-417; R-352 to P-417; T-353 to P-417; L-354 to P-417;
G-355 to P-417; L-356 to P-417; R-357 to P-417; E-358 to P-417; A-359 to
P-417; E-360 to P-417; I-361 to P-417; E-362 to P-417; A-363 to P-417; V-364
to P-417; E-365 to P-417; V-366 to P-417; E-367 to P-417; I-368 to P-417;
G-369 to P-417; R-370 to P-417; F-371 to P-417; R-372 to P-417; D-373 to
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-65-
P-417; Q-374 to P-417; Q-375 to P-417; Y-376 to P-417; E-377 to P-417; M-378
to P-417; L-3 79 to P-417; K-3 80 to P-417; R-3 81 to P-417; W-3 82 to P-417;
R-383 to P-417; Q-384 to P-417; Q-385 to P-417; Q-386 to P-417; P-387 to
P-417; A-3 8 8 to P-417; G-3 89 to P-417; L-3 90 to P-417; G-3 91 to P-417; A-
3 92
to P-417; V-393 to P-417; Y-394 to P-417; A-395 to P-417; A-396 to P-417;
L-397 to P-417; E-398 to P-417; R-399 to P-417; M-400 to P-417; G-401 to
P-417; L-402 to P-417; D-403 to P-417; G-404 to P-417; C-405 to P-417; V-406
to P-417; E-407 to P-417; D-408 to P-417; L-409 to P-417; R-410 to P-417;
S-411 to P-417; and R-412 to P-417 of the DR3 sequence shown in SEQ 117
N0:4. The present invention is also directed to nucleic acid molecules
comprising, or alternatively consisting of, a polynucleotide sequence at least
80%,
85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to the polynucleotide
sequences encoding the polypeptides described above. The present invention
also
encompasses the above polynucleotide sequences fused to a heterologous
polynucleotide sequence. Polypeptides encoded by these polynucleotides are
also
encompassed by the invention.
Also as mentioned above, even if deletion of one or more amino acids from
the C-terminus of a protein results in modification of loss of one or more
biological functions of the protein, other functional activities (e.g.,
biological
activities, ability to multimerize, ability to bind DR3 ligand) may still be
retained.
For example the ability of the shortened DR3 mutein to induce and/or bind to
antibodies which recognize the complete or mature forms of the polypeptide
generally will be retained when less than the majority of the residues of the
complete or mature polypeptide are removed from the C-terminus. Whether a
particular polypeptide lacking C-terminal residues of a complete polypeptide
retains such immunologic activities can readily be determined by routine
methods
described herein and otherwise known in the art. It is not unlikely that a DR3
mutein with a large number of deleted C-terminal amino acid residues may
retain
some biological or immunogenic activities. In fact, peptides composed of as
few
as six DR3 amino acid residues may often evoke an immune response.
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-66-
Accordingly, the present invention further provides polypeptides having
one or more residues deleted from the carboxy terminus of the amino acid
sequence of the DR3 polypeptide shown in SEQ ID N0:4, up to the arginine
residue at position number 6, and polynucleotides encoding such polypeptides.
In particular, the present invention provides polypeptides comprising, or
alternatively consisting of, the amino acid sequence of residues 1-m3 of SEQ
ID
N0:4, where m3 is an integer from 6 to 416 corresponding to the position of
the
amino acid residue in SEQ ID N0:4. Polynucleotides encoding these polypeptides
are also encompassed by the invention.
More in particular, the invention provides polynucleotides encoding
polypeptides comprising, or alternatively consisting of, the amino acid
sequence
of a member selected from the group consisting of amino acid residues M-1 to
G-416; M- I to R-415; M-1 to Q-414; M-1 to L-413; M-1 to R-412; M-1 to
S-411; M-1 to R-410; M-1 to L-409; M-1 to D-408; M-1 to E-407; M-1 to
V-406; M-1 to C-405; M-1 to G-404; M-1 to D-403; M-I to L-402; M-1 to
G-401; M-1 to M-400; M-I to R-399; M-1 to E-398; M-1 to L-397; M-1 to
A-396; M-1 to A-395; M-1 to Y-394; M-1 to V-393; M-1 to A-392; M-1 to
G-391; M-1 to L-390; M-1 to G-389; M-1 to A-388; M-1 to P-387; M-1 to
Q-386; M-1 to Q-385; M-1 to Q-384; M-1 to R-383; M-1 to W-382; M-1 to
R-381; M-1 to K-380; M-1 to L-379; M-1 to M-378; M-1 to E-377; M-1 to
Y-376; M-1 to Q-375; M-1 to Q-374; M-1 to D-373; M-1 to R-372; M-1 to
F-371; M-I to R-370; M-1 to G-369; M-1 to I-368; M-1 to E-367; M-1 to V-366;
M-1 to E-365; M-1 to V-364; M-I to A-363; M-1 to E-362; M-1 to I-361; M-1
to E-360; M-1 to A-359; M-1 to E-358; M-1 to R-357; M-1 to L-356; M-1 to
G-355; M-1 to L-354; M-1 to T-353; M-1 to R-352; M-1 to V-351; M-1 to
F-350; M-1 to E-349; M-1 to K-348; M-1 to W-347; M-1 to R-346; M-1 to
R-345; M-I to A-344; M-1 to P-343; M-1 to V-342; M-1 to A-341; M-1 to
D-340; M-1 to M-339; M-1 to V-338; M-1 to D-337; M-1 to Y-336; M-I to
L-335; M-1 to Q-334; M-1 to P-333; M-1 to G-332; M-1 to P-331; M-1 to
Q-330; M-1 to L-329; M-I to M-328; M-1 to M-327; M-1 to A-326; M-1 to
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-67-
P-325; M-1 to S-324; M-1 to G-323; M-1 to A-322; M-1 to P-321; M-1 to
S-320; M-1 to E-319; M-1 to P-318; M-1 to S-317; M-1 to L-316; M-1 to T-315;
M-1 to P-314; M-1 to A-313; M-1 to A-312; M-1 to A-311; M-1 to P-310; M-1
to G-309; M-1 to L-308; M-1 to A-307; M-1 to R-306; M-1 to S-305; M-1 to
P-304; M-1 to L-303; M-1 to Q-302; M-1 to D-301; M-1 to W-300; M-1 to
S-299; M-1 to W-298; M-1 to T-297; M-1 to V-296; M-1 to Q-295; M-1 to
P-294; M-1 to C-293; M-1 to L-292; M-1 to A-291; M-1 to E-290; M-1 to
Q-289; M-1 to T-288; M-1 to E-287; M-1 to P-286; M-1 to Y-285; M-1 to
G-284; M-1 to P-283; M-1 to T-282; M-1 to W-281; M-1 to S-280; M-1 to
N-279; M-1 to G-278; M-1 to V-277; M-1 to L-276; M-1 to Q-275; M-1 to
V-274; M-1 to T-273; M-1 to C-272; M-1 to I-271; M-1 to K-270; M-1 to
E-269; M-1 to S-268; M-1 to S-267; M-1 to D-266; M-1 to P-265; M-1 to P-264;
M-1 to A-263; M-1 to L-262; M-1 to L-261; M-1 to T-260; M-1 to H-259; M-1
to A-258; M-1 to S-257; M-1 to D-256; M-1 to L-255; M-1 to P-254; M-1 to
S-253; M-1 to L-252; M-1 to H-251; M-1 to T-250; M-1 to A-249; M-1 to
P-248; M-1 to P-247; M-1 to P-246; M-1 to T-245; M-1 to L-244; M-1 to A-243;
M-1 to E-242; M-1 to M-241; M-1 to G-240; M-1 to A-239; M-1 to E-238; M-1
to D-237; M-1 to A-236; M-1 to T-235; M-1 to V-234; M-1 to L-233; M-1 to
P-232; M-1 to K-231; M-1 to H-230; M-1 to P-229; M-1 to W-228; M-1 to
C-227; M-1 to H-226; M-1 to R-225; M-1 to Y-224; M-1 to T-223; M-1 to
Y-222; M-1 to T-221; M-1 to L-220; M-1 to T-219; M-1 to A-218; M-1 to
G-217; M-1 to L-216; M-1 to L-215; M-1 to L-214; M-1 to P-213; M-1 to
V-212; M-1 to V-211; M-1 to L-210; M-1 to G-209; M-1 to A-208; M-1 to
L-207; M-1 to L-206; M-1 to V-205; M-1 to Q-204; M-1 to V-203; M-1 to
W-202; M-1 to F-201; M-1 to M-200; M-1 to Q-199; M-1 to R-198; M-1 to
W-197; M-1 to G-196; M-1 to C-195; M-1 to V-194; M-1 to A-193; M-1 to
A-192; M-1 to C-191; M-1 to R-190; M-1 to E-189; M-1 to P-188; M-1 to
C-187; M-1 to S-186; M-1 to G-185; M-1 to L-184; M-1 to T-183; M-1 to
S-182; M-1 to T-181; M-1 to P-180; M-1 to C-179; M-1 to S-178; M-1 to
V-177; M-1 to C-176; M-1 to G-175; M-1 to D-174; M-1 to G-173; M-1 to
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-68-
H-172; M-1 to E-171; M-1 to Y-170; M-1 to F-169; M-1 to G-168; M-1 to
P-167; M-1 to L-166; M-1 to C-165; M-1 to T-164; M-1 to G-163; M-1 to
C-162; M-1 to D-161; M-1 to T-160; M-1 to D-159; M-1 to R-158; M-1 to
R-157; M-1 to S-156; M-1 to C-1 S5; M-1 to L-154; M-1 to L-153; M-1 to
R-152; M-1 to T-151; M-1 to H-150; M-1 to R-149; M-1 to H-148; M-1 to
L-147; M-1 to A-146; M-1 to G-145; M-1 to C-144; M-1 to D-143; M-1 to
L-142; M-1 to C-141; M-1 to P-140; M-1 to Q-139; M-1 to C-138; M-1 to
Y-137; M-1 to F-136; M-1 to P-135; M-1 to S-134; M-1 to S-133; M-1 to S-132;
M-1 to V-131; M-1 to C-130; M-1 to Q-129; M-1 to S-128; M-1 to V-127; M-1
to Q-126; M-1 to C-125; M-1 to E-124; M-1 to V-123; M-1 to F-122; M-1 to
W-121; M-1 to G-120; M-1 to P-119; M-1 to K-118; M-1 to C-117; M-1 to
G-116; M-1 to C-115; M-1 to R-114; M-1 to T-113; M-1 to D-112; M-1 to
A-111; M-1 to V-110; M-1 to A-109; M-1 to S-108; M-1 to C-107; M-1 to
N-106; M-1 to E-105; M-1 to L-104; M-1 to A-103; M-1 to V-102; M-1 to
Q-101; M-1 to S-100; M-1 to A-99; M-1 to Q-98; M-1 to E-97; M-1 to D-96;
M-1 to C-95; M-1 to A-94; M-1 to Q-93; M-1 to C-92; M-1 to R-91; M-1 to
A-90; M-1 to C-89; M-1 to E-88; M-1 to S-87; M-1 to N-86; M-1 to H-85; M-1
to H-84; M-1 to N-83; M-1 to E-82; M-1 to W-81; M-1 to A-80; M-1 to L-79;
M-1 to F-78; M-1 to T-77; M-1 to D-76; M-1 to Q-75; M-1 to P-74; M-1 to
C-73; M-1 to V-72; M-1 to L-71; M-1 to C-70; M-1 to T-69; M-1 to S-68; M-1
to N-67; M-1 to G-66; M-1 to C-65; M-1 to P-64; M-1 to E-63; M-1 to T-62;
M-1 to C-61; M-1 to P-60; M-1 to A-59; M-1 to K-58; M-1 to L-57; M-1 to
Y-56; M-1 to H-55; M-1 to G-54; M-1 to A-53; M-1 to P-52; M-1 to C-51; M-1
to G-50; M-1 to R-49; M-1 to C-48; M-1 to C-47; M-1 to F-46; M-1 to L-45;
M-1 to G-44; M-1 to I-43; M-1 to K-42; M-1 to K-41; M-1 to H-40; M-1 to
F-39; M-1 to D-38; M-1 to G-37; M-1 to A-36; M-1 to C-35; M-1 to D-34; M-1
to C-33; M-1 to R-32; M-1 to P-31; M-1 to S-30; M-1 to R-29; M-1 to T-28;
M-1 to G-27; M-1 to G-26; M-1 to Q-25; M-1 to A-24; M-1 to R-23; M-1 to
A-22; M-1 to G-21; M-1 to L-20; M-1 to L-19; M-1 to V-18; M-1 to L-17; M-1
to L-16; M-1 to L-15; M-1 to A-14; M-1 to A-13; M-1 to A-12; M-1 to V-11;
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-69-
M-1 to A-10; M-1 to A-9; M-1 to C-8; M-1 to G-7; and M-1 to R-6 of the
sequence of the DR3 sequence shown in SEQ ID N0:4. The present invention
is also directed to nucleic acid molecules comprising, or alternatively
consisting
of, a polynucleotide sequence at least 80%, 85%, 90%, 92%, 95%, 96%, 97%,
98%, or 99% identical to the polynucleotide sequences encoding the
polypeptides
described above. The present invention also encompasses the above
polynucleotide sequences fused to a heterologous polynucleotide sequence.
Polypeptides encoded by these polynucleotides are also encompassed by the
invention.
The invention also provides polypeptides having one or more amino acids
deleted from both the amino and the carboxyl termini of an DR3 polypeptide,
which may be described generally as having residues n3-m3 of SEQ ID N0:4,
where n3 and m3 are integers as described above. Polynucleotides encoding
these
polypeptides are also encompassed by the invention.
As mentioned above, even if deletion of one or more amino acids from the
N-terminus of an extracellular domain of a protein results in modification of
loss
of one or more biological functions of the protein, other functional
activities (e.g.,
biological activities, ability to multimerize, ability to bind DR3 ligand) may
still be
retained. For example, the ability of shortened DR3 extracellular domain
muteins
to induce and/or bind to antibodies which recognize the complete, mature or
extracellular domain forms of the polypeptides generally will be retained when
less
than the majority of the residues of the complete, mature or extracellular
domain
polypeptide are removed from the N-terminus. Whether a particular polypeptide
lacking N-terminal residues of a complete polypeptide retains such immunologic
activities can readily be determined by routine methods described herein and
otherwise known in the art. It is not unlikely that a DR3 extracellular domain
mutein with a large number of deleted N-terminal amino acid residues may
retain
some biological or immunogenic activities. In fact, peptides composed of as
few
as six DR3 extracellular domain amino acid residues may often evoke an immune
response.
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-70-
Accordingly, the present invention further provides polypeptides having
one or more residues deleted from the amino terminus of the DR3 extracellular
domain amino acid sequence shown in SEQ ID N0:4, up to the cysteine residue
at position number 195 and polynucleotides encoding such polypeptides. In
particular, the present invention provides polypeptides comprising, or
alternatively
consisting of, the amino acid sequence of residues n4-201 of SEQ ID N0:4,
where n4 is an integer from 25 to 195 corresponding to the position of the
amino
acid residue in SEQ ID N0:4. Polynucleotides encoding these polypeptides are
also encompassed by the invention.
More in particular, the invention provides polynucleotides encoding
polypeptides comprising, or alternatively consisting of, the amino acid
sequence
of a member selected from the group consisting of amino acid residues Q-25 to
F-201; G-26 to F-201; G-27 to F-201; T-28 to F-201; R-29 to F-201; S-30 to
F-201; P-31 to F-201; R-32 to F-201; C-33 to F-201; D-34 to F-201; C-35 to
F-201; A-36 to F-201; G-37 to F-201; D-38 to F-201; F-39 to F-201; H-40 to
F-201; K-41 to F-201; K-42 to F-201; I-43 to F-201; G-44 to F-201; L-45 to
F-201; F-46 to F-201; C-47 to F-201; C-48 to F-201; R-49 to F-201; G-50 to
F-201; C-51 to F-201; P-52 to F-201; A-53 to F-201; G-54 to F-201; H-55 to
F-201; Y-56 to F-201; L-57 to F-201; K-58 to F-201; A-59 to F-201; P-60 to
F-201; C-61 to F-201; T-62 to F-201; E-63 to F-201; P-64 to F-201; C-65 to
F-201; G-66 to F-201; N-67 to F-201; S-68 to F-201; T-69 to F-201; C-70 to
F-201; L-71 to F-201; V-72 to F-201; C-73 to F-201; P-74 to F-201; Q-75 to
F-201; D-76 to F-201; T-77 to F-201; F-78 to F-201; L-79 to F-201; A-80 to
F-201; W-81 to F-201; E-82 to F-201; N-83 to F-201; H-84 to F-201; H-85 to
F-201; N-86 to F-201; S-87 to F-201; E-88 to F-201; C-89 to F-201; A-90 to
F-201; R-91 to F-201; C-92 to F-201; Q-93 to F-201; A-94 to F-201; C-95 to
F-201; D-96 to F-201; E-97 to F-201; Q-98 to F-201; A-99 to F-201; S-100 to
F-201; Q-101 to F-201; V-102 to F-201; A-103 to F-201; L-104 to F-201; E-105
to F-201; N-106 to F-201; C-107 to F-201; S-108 to F-201; A-109 to F-201;
V-110 to F-201; A-111 to F-201; D-112 to F-201; T-113 to F-201; R-114 to
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-71-
F-201; C-11 S to F-201; G-116 to F-20 I ; C-117 to F-201; K-118 to F-201; P-
119
to F-201; G-120 to F-201; W-121 to F-201; F-122 to F-201; V-123 to F-201;
E-124 to F-201; C-125 to F-201; Q-126 to F-201; V-127 to F-201; S-128 to
F-201; Q-129 to F-201; C-130 to F-201; V-131 to F-201; S-132 to F-201; S-133
to F-201; S-134 to F-201; P-135 to F-201; F-136 to F-201; Y-137 to F-201;
C-138 to F-201; Q-139 to F-201; P-140 to F-201; C-141 to F-201; L-142 to
F-201; D-143 to F-201; C-144 to F-201; G-145 to F-201; A-146 to F-201; L-147
to F-201; H-148 to F-201; R-149 to F-201; H-150 to F-201; T-151 to F-201;
R-152 to F-201; L-153 to F-201; L-154 to F-201; C-155 to F-201; S-156 to
F-201; R-157 to F-201; R-158 to F-201;.D-159 to F-201; T-160 to F-201; D-161
to F-201; C-162 to F-201; G-163 to F-201; T-164 to F-201; C-165 to F-201;
L-166 to F-201; P-167 to F-201; G-168 to F-201; F-169 to F-201; Y-170 to
F-201; E-171 to F-201; H-172 to F-201; G-173 to F-201; D-174 to F-201; G-175
to F-201; C-176 to F-201; V-177 to F-201; S-178 to F-201; C-179 to F-201;
P-180 to F-201; T-181 to F-201; S-182 to F-201; T-183 to F-201; L-184 to
F-201; G-185 to F-201; S-186 to F-201; C-187 to F-201; P-188 to F-201; E-189
to F-201; R-190 to F-201; C-191 to F-201; A-192 to F-201; A-193 to F-201;
V-194 to F-201; and C-195 to F-201 of the DR3 sequence shown in SEQ ID
N0:4. The present invention is also directed to nucleic acid molecules
comprising, or alternatively consisting of, a polynucleotide sequence at least
80%,
85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to the polynucleotide
sequences encoding the polypeptides described above. The present invention
also
encompasses the above polynucleotide sequences fused to a heterologous
polynucleotide sequence. Polypeptides encoded by these polynucleotides are
also
encompassed by the invention.
Also as mentioned above, even if deletion of one or more amino acids from
the C-terminus of an extracellular domain of a protein results in modification
of
loss of one or more biological functions of the protein, other functional
activities
(e.g., biological activities, ability to multimerize, ability to bind DR3
ligand) may
still be retained. For example the ability of the shortened DR3 extracellular
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-72-
domain mutein to induce and/or bind to antibodies which recognize the complete
or mature forms of the polypeptide generally will be retained when less than
the
majority of the residues of the complete or mature polypeptide are removed
from
the C-terminus. Whether a particular polypeptide lacking C-terminal residues
of
a complete polypeptide retains such immunologic activities can readily be
determined by routine methods described herein and otherwise known in the art.
It is not unlikely that a DR3 extracellular domain mutein with a large number
of
deleted C-terminal amino acid residues may retain some biological or
immunogenic activities. In fact, peptides composed of as few as six DR3
extracellular domain amino acid residues may often evoke an immune response.
Accordingly, the present invention further provides polypeptides having
one or more residues deleted from the carboxy terminus of the amino acid
sequence of the DR3 extracellular domain polypeptide shown in SEQ >D N0:4,
up to the proline residue at position number 31, and polynucleotides encoding
such polypeptides. In particular, the present invention provides polypeptides
comprising, or alternatively consisting of, the amino acid sequence of
residues
1-m4 of SEQ ID N0:4, where m4 is an integer from 31 to 201 corresponding to
the position ofthe amino acid residue in SEQ ID N0:4. Polynucleotides encoding
these polypeptides are also encompassed by the invention.
More in particular, the invention provides polynucleotides encoding
polypeptides comprising, or alternatively consisting of, the amino acid
sequence
of a member selected from the group consisting of amino acid residues Q-25 to
F-201; Q-25 to M-200; Q-25 to Q-199; Q-25 to R-198; Q-25 to W-197; Q-25 to
G-196; Q-25 to C-195; Q-25 to V-194; Q-25 to A-193; Q-25 to A-192; Q-25 to
C-191; Q-25 to R-190; Q-25 to E-189; Q-25 to P-188; Q-25 to C-187; Q-25 to
S-186; Q-25 to G-185; Q-25 to L-184; Q-25 to T-183; Q-25 to S-182; Q-25 to
T-181; Q-25 to P-180; Q-25 to C-179; Q-25 to S-178; Q-25 to V-177; Q-25 to
C-176; Q-25 to G-175; Q-25 to D-174; Q-25 to G-173; Q-25 to H-172; Q-25 to
E-171; Q-25 to Y-170; Q-25 to F-169; Q-25 to G-168; Q-25 to P-167; Q-25 to
L-166; Q-25 to C-165; Q-25 to T-164; Q-25 to G-163; Q-25 to C-162; Q-25 to
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-73-
D-161; Q-25 to T-160; Q-25 to D-159; Q-25 to R-158; Q-25 to R-157; Q-25 to
S-156; Q-25 to C-155; Q-25 to L-154; Q-25 to L-153; Q-25 to R-152; Q-25 to
T-151; Q-25 to H-150; Q-25 to R-149; Q-25 to H-148; Q-25 to L-147; Q-25 to
A-146; Q-25 to G-145; Q-25 to C-144; Q-25 to D-143; Q-25 to L-142; Q-25 to
C-141; Q-25 to P-140; Q-25 to Q-139; Q-25 to C-138; Q-25 to Y-137; Q-25 to
F-136; Q-25 to P-135; Q-25 to S-134; Q-25 to S-133; Q-25 to S-132; Q-25 to
V-131; Q-25 to C-130; Q-25 to Q-129; Q-25 to S-128; Q-25 to V-127; Q-25 to
Q-126; Q-25 to C-125; Q-25 to E-124; Q-25 to V-123; Q-25 to F-122; Q-25 to
W-121; Q-25 to G-120; Q-25 to P-119; Q-25 to K-118; Q-25 to C-117; Q-25 to
G-116; Q-25 to C-115; Q-25 to R-114; Q-25 to T-113; Q-25 to D-112; Q-25 to
A-111; Q-25 to V-110; Q-25 to A-109; Q-25 to S-108; Q-25 to C-107; Q-25 to
N-106; Q-25 to E-105; Q-25 to L-104; Q-25 to A-103; Q-25 to V-102; Q-25 to
Q-101; Q-25 to S-100; Q-25 to A-99; Q-25 to Q-98; Q-25 to E-97; Q-25 to
D-96; Q-25 to C-95; Q-25 to A-94; Q-25 to Q-93; Q-25 to C-92; Q-25 to R-91;
Q-25 to A-90; Q-25 to C-89; Q-25 to E-88; Q-25 to S-87; Q-25 to N-86; Q-25
to H-85; Q-25 to H-84; Q-25 to N-83; Q-25 to E-82; Q-25 to W-81; Q-25 to
A-80; Q-25 to L-79; Q-25 to F-78; Q-25 to T-77; Q-25 to D-76; Q-25 to Q-75;
Q-25 to P-74; Q-25 to C-73; Q-25 to V-72; Q-25 to L-71; Q-25 to C-70; Q-25
to T-69; Q-25 to S-68; Q-25 to N-67; Q-25 to G-66; Q-25 to C-65; Q-25 to P-64;
Q-25 to E-63; Q-25 to T-62; Q-25 to C-61; Q-25 to P-60; Q-25 to A-59; Q-25
to K-58; Q-25 to L-57; Q-25 to Y-56; Q-25 to H-55; Q-25 to G-54; Q-25 to
A-53; Q-25 to P-52; Q-25 to C-51; Q-25 to G-50; Q-25 to R-49; Q-25 to C-48;
Q-25 to C-47; Q-25 to F-46; Q-25 to L-45; Q-25 to G-44; Q-25 to I-43; Q-25 to
K-42; Q-25 to K-41; Q-25 to H-40; Q-25 to F-39; Q-25 to D-38; Q-25 to G-37;
Q-25 to A-36; Q-25 to C-35; Q-25 to D-34; Q-25 to C-33; Q-25 to R-32; and
Q-25 to P-31 of the sequence of the DR3 sequence shown in SEQ ID N0:4. The
present invention is also directed to nucleic acid molecules comprising, or
alternatively consisting of, a polynucleotide sequence at least 80%, 85%, 90%,
92%, 95%, 96%, 97%, 98%, or 99% identical to the polynucleotide sequences
encoding the polypeptides described above. The present invention also
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-74-
encompasses the above polynucleotide sequences fused to a heterologous
polynucleotide sequence. Polypeptides encoded by these polynucleotides are
also
encompassed by the invention.
The invention also provides polypeptides having one or more amino acids
deleted from both the amino and the carboxyl termini of a DR3 extracellular
domain polypeptide, which may be described generally as having residues n4-m4
of SEQ ID N0:4, where n4 and m4 are integers as described above.
Polynucleotides encoding these polypeptides are also encompassed by the
invention.
The present application is also directed to proteins containing polypeptides
at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to the
DR3 polypeptide sequence set forth herein as nl-ml, n2-m2, n3-m3, and/or
n4-m4. In preferred embodiments, the application is directed to proteins
containing polypeptides at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or
99% identical to polypeptides having the amino acid sequence of the specific
DR3
N- and C-terminal deletions recited herein. Polynucleotides encoding these
polypeptides are also encompassed by the invention.
In certain preferred embodiments, DR3 proteins ofthe invention comprise,
or alternatively consist of, fusion proteins as described above wherein the
DR3
polypeptides are those described as nl-ml, n2-m2, n3-m3, and/or n4-m4 herein.
In preferred embodiments, the application is directed to nucleic acid
molecules at
least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to the nucleic
acid sequences encoding polypeptides having the amino acid sequence of the
specific N- and C-terminal deletions recited herein. Polynucleotides encoding
these polypeptides are also encompassed by the invention.
It is believed one or more of the cysteine rich regions of DR3-V 1 and DR3
are important for interactions between DR3-V 1 and DR3 and their respective
ligands. Accordingly, specific embodiments of the invention are directed to
polynucleotides encoding polypeptides which comprise, or alternatively consist
of,
the amino acid sequence of amino acid residues 58 to 103, 106 to 136, 141 to
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-75-
173, or 176 to 206 of SEQ ID N0:2. Additional embodiments of the invention
are directed to polynucleotides encoding DR3-Vl or DR3 polypeptides which
comprise, or alternatively consist of, any combination of 1, 2, 3, or all 4 of
the
cysteine rich regions described above. Polypeptides encoded by these
polynucleotides are also encompassed by the invention.
Preferably, the polynucleotide fragments of the invention encode a
polypeptide which demonstrates a DR3 functional activity. By a polypeptide
demonstrating a DR3-V 1 or DR3 "functional activity" is meant, a polypeptide
capable of displaying one or more known functional activities associated with
a
full-length (complete) DR3-V 1 or DR3 protein. Such functional activities
include,
but are not limited to, biological activity (e.g., ability to induce
apoptosis),
antigenicity (the ability to bind, or compete for binding with a DR3-V1 or DR3
polypeptide for binding, to an anti-DR3-V 1 or anti-DR3 antibody),
immunogenicity (ability to generate antibody which binds to a DR3-V1 or DR3
polypeptide), ability to form multimers with DR3-V 1 or DR3 polypeptides of
the
invention, and ability to bind to a receptor or ligand for a DR3-V 1 or DR3
polypeptide (e.g., TNF-~y, TNF-y-(3).
The functional activity of DR3-V 1 or DR3 polypeptides, and fragments,
variants derivatives, and analogs thereof, can be assayed by various methods.
For example, in one embodiment where one is assaying for the ability to
bind or compete with full-length DR3-V1 or DR3 polypeptide for binding to
anti-DR3-V1 or anti-DR3 antibody, various immunoassays known in the art can
be used, including but not limited to, competitive and non-competitive assay
systems using techniques such as radioimmunoassays, ELISA (enzyme linked
immunosorbent assay), "sandwich" immunoassays, immunoradiometric assays, gel
diffusion precipitation reactions, immunodiffusion assays, in situ
immunoassays
(using colloidal gold, enzyme or radioisotope labels, for example), western
blots,
precipitation reactions, agglutination assays (e.g., gel agglutination assays,
hemagglutination assays), complement fixation assays, immunofluorescence
assays, protein A assays, and immunoelectrophoresis assays, etc. In one
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-76-
embodiment, antibody binding is detected, by detecting a label on the primary
antibody. In another embodiment, the primary antibody is detected by detecting
binding of a secondary antibody or reagent to the primary antibody. In a
further
embodiment, the secondary antibody is labeled. Many means are known in the art
for detecting binding in an immunoassay and are within.the scope of the
present
invention.
In another embodiment, where a DR3-V1 or DR3 ligand is identified, or
the ability of a polypeptide fragment, variant or derivative of the invention
to
multimerize is being evaluated, binding can be assayed, e.g., by means well-
known
in the art, such as, for example, reducing and non-reducing gel
chromatography,
protein affinity chromatography, and ai~mity blotting. See generally,
Phizicky, E.,
et al., Microbiol. Rev. 59:94-123 (1995). In another embodiment, physiological
correlates of DR3-V1 or DR3 binding to its substrates (signal transduction)
can
be assayed.
In addition, assays described herein (see Example 6 and otherwise known
in the art may routinely be applied to measure the ability of DR3-V 1 or DR3
polypeptides and fragments, variants derivatives and analogs thereof to elicit
DR3-V1 or DR3 related biological activity (e.g., to induce apoptosis in vitro
or
in vivo). The ability of polynucleotides and polypeptides of the invention to
increase or decrease apoptosis can routinely be determined using techniques
known in the art. For example, biological activity can routinely be measured
using
cell death assays performed essentially as previously described (Chinnaiyan et
al.,
Cell 8l : 505-512 ( 1995); Boldin et al. , J. Biol. Chem. 2 70:7795-8( 1995);
Kischkel
et al., EMBO 14:5579-5588 (1995); Chinnaiyan et al., J. Biol. Chem. 271:4961
4965 (1996)).
It is believed one or more of the cysteine rich regions of DR3-V 1 or DR3
is important for interactions between DR3-V 1 or DR3 and its ligands.
Accordingly, specific embodiments of the invention are directed to
polypeptides
which comprise, or alternatively consist of, the amino acid sequence of amino
acid
residues 58 to 103, 106 to 136, 141 to 173, or 176 to 206 of SEQ ID N0:2.
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
_77_
Additional embodiments of the invention are directed to polypeptides which
comprise, or alternatively consist of, any combination of 1, 2, 3, or all 4 of
the
cysteine rich regions described above. Polynucleotides encoding these
polypeptides are also encompassed by the invention.
Among the especially preferred fragments of the invention are fragments
characterized by structural or functional attributes of DR3-V 1 or DR3. Such
fragments include amino acid residues that comprise alpha-helix and alpha-
helix
forming regions ("alpha-regions"), beta-sheet and beta-sheet-forming regions
("beta-regions"), turn and turn-forming regions ("turn-regions"), coil and
coil-
forming regions ("coil-regions"), hydrophilic regions, hydrophobic regions,
alpha
amphipathic regions, beta amphipathic regions, surface forming regions, and
high
antigenic index regions (i.e., containing four or more contiguous amino acids
having an antigenic index of greater than or equal to 1.5, as identified using
the
default parameters of the Jameson-Wolf program) of complete (i.e., full-
length)
DR3-V 1 or DR3 (SEQ ID N0:2 or SEQ ID N0:4). Certain preferred regions are
those set out in FIG. 4 and include, but are not limited to, regions of the
aforementioned types identified by analysis of the amino acid sequence
depicted
in SEQ ID N0:2 or SEQ ID N0:4, such preferred regions include; Garnier-
Robson predicted alpha-regions, beta-regions, turn-regions, and coil-regions;
Chou-Fasman predicted alpha-regions, beta-regions, turn-regions, and coil-
regions; Kyte-Doolittle predicted hydrophilic and hydrophobic regions;
Eisenberg
alpha and beta amphipathic regions; Emini surface-forming regions; and Jameson
Wolf high antigenic index regions, as predicted using the default parameters
of
these computer programs. Polynucleotides encoding these polypeptides are also
encompassed by the invention.
In additional embodiments, the polynucleotides of the invention encode
functional attributes of DR3-V 1 or DR3 . Preferred embodiments of the
invention
in this regard include fragments that comprise alpha-helix and alpha-helix
forming
regions ("alpha-regions"), beta-sheet and beta-sheet forming regions
("beta-regions"), turn and turn-forming regions ("turn-regions"), coil and
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-78-
coil-forming regions ("coil-regions"), hydrophilic regions, hydrophobic
regions,
alpha amphipathic regions, beta amphipathic regions, flexible regions,
surface-forming regions and high antigenic index regions of DR3-V1 or DR3.
The data representing the structural or functional attributes of DR3-V 1 or
DR3 set forth in FIG. 4 and/or Table 2, as described above, was generated
using
the various modules and algorithms of the DNA* STAR set on default parameters.
In a preferred embodiment, the data presented in columns VIII, IX, XIII, and
XIV
of Table 2 can be used to determine regions of DR3-Vl which exhibit a high
degree of potential for antigenicity. Regions of high antigenicity are
determined
from the data presented in columns VIII, IX, XIII, and/or IV by choosing
values
which represent regions of the polypeptide which are likely to be exposed on
the
surface of the polypeptide in an environment in which antigen recognition may
occur in the process of initiation of an immune response.
Certain preferred regions in these regards are set out in FIG. 4, but may,
as shown in Table 2, be represented or identified by using tabular
representations
of the data presented in FIG. 4. The DNA*STAR computer algorithm used to
generate FIG. 4 (set on the original default parameters) was used to present
the
data in FIG. 4 in a tabular format (See Table 2). The tabular format of the
data
in FIG. 4 may be used to easily determine specific boundaries of a preferred
region.
The above-mentioned preferred regions set out in FIG. 4 and in Table 2
include, but are not limited to, regions of the aforementioned types
identified by
analysis of the amino acid sequence set out in SEQ ID N0:2. As set out in FIG.
4 and in Table 2, such preferred regions include Gamier-Robson alpha-regions,
beta-regions, turn-regions, and coil-regions (columns I, III, V, and VII in
Table
2), Chou-Fasman alpha-regions, beta-regions, and turn-regions (columns II, IV,
and VI in Table 2), Kyte-Doolittle hydrophilic regions (column VIII in Table
2),
Hopp-Woods hydrophobic regions (column IX in Table 2), Eisenberg alpha- and
beta-amphipathic regions (columns X and XI in Table 2), Karplus-Schulz
flexible
regions (column XII in Table 2), Jameson-Wolf regions of high antigenic index
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-79-
(column XIII in Table 2), and Emini surface-forming regions (column XIV in
Table 2).
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
O I~ ~n ~n v~ N ~ oo a\ oo Ov N M O~ ~ ~ ~n M
y p ~ ~ Ov O WE 00 O ~ O Ov O~ N O ~1' oo O o0
N N N N ~ ~ N ~ N O ~ ~ ~ ~ O -i O
v1 v1 v~ ~n O O O ~ oo N ~ O ~O ~n ~ o0 N O
O~ O~ O~ O~ .-~.-~O ~O ~ V1 Q\ V ~ V1 ~' .~ ~ M
O O O O ~ ~-~~ ~ N N N M N N N N N N
b
w w w w w w w w w w w w w w
-~ ~ ~-
'~ C~ l~ O~ 01 ~O ~ ~--'~ ~O ~ M ~O ~ O O ~O
~O ~O ~O ~O N I~ M o0 00 00 w ~1 ~ O ~O ~ v1 I
O O O O ~ O O O O O O O O ~ O O O O
i i i i i i ~ i i i i ~ i i ~ ~ i i
O ~ ~ 0~0 ~ p ~ ~ N '"''N N N ~ M M
00 .-, M ~ ~ ~ ~ M ~O l~ O
O
-. .-~,~ ,~ N N ,~ N ,~ ,~ .~ ,-~,.-~,~ O O ,
N
U U U U . . U U U U . U
H
E-~ H F~ E
H E~-i. . . . E-
,..,
G
d d d d d d
0
0
O ~ N M Ut ~ ~O I~ 00
N M d' ~W O l~ 00 Qv ~ ,~ ,--,
y y ~ ~ ~ L: ~ ~, ~ cd O ~ ~, G' ~ dp ~, ~ t-.
w ~ ~ ~ H t5 e7 ~ ~ ~ a~ ~ ~ c~ a ~ c~ c7
., o v~ o
.-i N
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-81-
V1 l~ 00 ~O 00 O M ~ v'1 00 00
~O ~ I~ C~ ~ M M ~ O O O ~ N M ~O C~ [~ r.
C O O O O O O O O O O O O O O O O O
O W
0
O O O O O O O O O O O ~ ; ;
~ ,- N M
b
C . . . . . . . . . . . . . . . . w w w
-, ,-,O~ O O~ l~ M M Q\ l~ O ~ M ~ O p M N I~
N ~ ~n I~ O O N ~n ~1 M ~O ~t N
O O O p O O O O
~ O O O --~~ ~ ~ ~ ~ O ,
~O I~ 01 ~D ~ ~ ~ M M ~ O M N
~ ~O ~ M ~D N N M O~ N O N I~ N
N ~ N
O ~ ~ ~ N N N N N N ~ O O
~ ,
O O O ~ i ~ ~ ~. i i ~ ~ ~ ~ ~ i O , ,-
U U U
H H H
H H
~
i. . . . . . pq pa pq pq pq pa pa pa W
.,
b
,.., d d d d d d d d d d d d d d
. . . .
0
0
.
.
.
a\ O ~ N M d' ~ ~O l~ 0o O~ O ~ N M ~ N ~O I~
N N N N N N N N N N M M M M M M M M
cd ai O O ~ cd ~ ~ ~ ~ ~ ,'~,ctS bA cd t~ ~,
_ _ _ _
A..i~ ~ ~ ~ ~ r~ ~ r~ ~
~n O v~
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-82-
l~ N O ~ M ~n ~ N oo O ~ O O~ ~O ~n ~ ~n N M
~
p. ~ M ~D V' ~D ~ M N ~ M N Ov I~ N I~ ~ ~ ~ O
.~
'~,~ ~ N ~ ~ O O O O O O O ~ ~ O O O O O
~D M O I~ 'c~'O ~ M N -~ O O O O V1 ~lI O O O
I~ ~n oo I~ Ov ~ ~ oo ~O O I~ l~ ~ ~ O~ N ~ ~ N
'C N N N N N M N ~ ~ ~ O O ~ ~ O O O O
b
~C w w w w w w . . . . . . w w w w
-x-
.x.
h O~ O O
~ O~ ~O M
M ~ o ~ ~ O ~ ~ ~ ~ N N lw 0 vD O O .-.l~
O O o O ~ ~ O O O O O O O O O~ p p p O
O
N N ~ ~ N 0o 'ctM M -~ ~' ~O I~ Q\ ~ ,-, ~O N 00
v0 v0 ~n ~n N ~ Ov o0 ~ ~ ~n N M v0 ~ ,-, v~ v~ M
O O O O O O ~ O O O p O, O O
U
H . . H H H H . H H H H
E-aH H . H E- H E- . . . . . . . F-~ H H E-~
i.~.,. . . . . . . . . . . . . . . ~ pa p4 pa
b
~ ~ d ~ ~ ~ ~
0
0 0o Ov O -~ N M ~ ~n ~D I~ oo O~ O ~--~N M ~ ~n ~D
CLIM M ~ ~ ~ ~ ~ ~ ~ d' '~f~ N V~ V1 ~ t!1~!1N
_,'T~"'~ Lr O ~ ~ ~ ~ Cd ~, ~ O Vj v1 VJ _,~
W C7 E~-~ v~ 0.,~ U ~ U ~ C7 d per.,~..,~"~-~'1~-~1~ C'7~-1
~n o ~n
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-83-
Ov O W ~ O l~ ~ ~ N ~ ~ ~O O ~O v0 ~ p w1 ~O
O
O O O ~ N M N ~ ~ o0 0o N N ~ ~ ~ M N I
O O O O O O O O O O O ~ O O O O O O O
O O
N ~ ~ pp O o0 ~p '~ N ~O N M O~ O Ov .~ M
N N
~ ~ ,_,~ N O 0o Q\ v y~ ~ Ov ~
O O
0 O ,-;~ N ~ O O O O O O N M N N N
PC . . . . . . . . . . . . . . w w w w w
~- ~. . . ~ . ~. ~.
M I~ ~ ~D I~ p ~ ~ l~ O l~ O ~ M M v7 O O
M O ~O 00 M M M
~ ~ Q O O O O
O O O O O O O O O O O Q ,
~
1~.~ 00 O ~ r" I~ O ~O ~ ~ M 00 O 00 ~ O Q\
O V1 M M D ~ O M ~O V1 O V1 V1 l~
O - O ' ~
i i p O O O O O O O O O O O O O
U . . . U
H H H E-~H H H H . . . E~ E~ H E~ E~ H
H H H H E-~E-iH H F~ E~ H H E~ . E~ E~ E~ . H
p4 ~1
b
0
...
0 I~ o0 Ov O ~ N M V v W l~ 00 Ov O .--.
O
O cd ~' ~ ~
j, ~ ~, N ~, ~ ~, ,~ -- t~
~ ' ~ ~ ~ .
w U U C U w C7 H ~ a w U E-aL7 w
7
m o ~.-,
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-84-
O 00 O ~ M 00 Q\ .--~~ Ov O~ ~D O~ N M 00 ~O ~O O
t~ ~n N M N O O ~ M ~n ~ O ~O ~ ~t ~ I~ N O
C O O O O O O O O O O O ~ O O O O O .~ N
O h ~ ~ ~ O
Q\ (~ M o ~ ~O ~ ~ N
o
p O O O O O O O O O
O O , O O O O ~
p
~C w w w w w . . . . w w w w . .
O O
~ M O ~' I~ ~ O ~' ~ ~O O~ I~ I~ ~ O~ O
M M
N ~ ~ ~ ~ [~ M N M M N I~ M I~ I~ V1 N
O O O O O O O O O O O O O O O O O
~ ~ '-'~ M M M ~ 00 ~O O ~
~D ~O 00 l~ l~ O
O O O O O O O O O
O O O , ~ i ~ O O O
H H H . . . ~ H H
H H ~ H H
H
~r
O
.
.,
.
.,..,
H
O v0 ~ oo Q\ O ~ N M ~ ~n ~D I~ 00 Ov O ~ N M d'
t~ t~ ~ ~ 00 00 00 00 00 00 00 00 00 0o a\ a\ Ov Q\ Ov
J ~ ~ ~- rr~~ v~ ~ t1,~.,p ~ d f1
, .. p c ~
_ G~ ~ J, y.., ~' .~ s~ p t-~.-,m
fs;U C~ ~ cn E-~U ~ ~J U p..C7 d H . ~ ~ H C7
p
, ..,~..
v~ o
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-85-
U1 V1 M ~ O D\ M M 00 M 00 M M ~ O O M
~n ~n 00 ~O a\ M M N N M M O ~O 00 ~O N I~ M ~n
~C N N O O O O O O O O O ~ O O N ~ O O O
' O O
~O N oo pv O d M N -~ O O v1 ~n ~n O O v~ ~ M
v'tQ\ ~ ~' ~ ~O v1 Q\ O M ~O I~ l~ I~ a\ O~ ~
~ O
'C O ~ N N M N ~ O O O O O O O O O O
5C . w w w w . . . . . . . w w w w w
.~ . ~ ~ ~-
.~
I~ l~ ~ ~O ~O ~O M ~ V' l~ ~
o0 N ~ ~D ~n ~n ~ ~ ~ O wn ~ ~ lw 0 ~
O O O O O O O O O O O O O O C
0 ; p O
~O 00 00 O~ N ~D O M M M O O a1 ~O O O ~O ~O ~O
N ~ 00 O~ M M 00 ~ d' ~ ~ ~ ~O M ~n V7 M M M
N N ~ ~ ~ ~ O O O O ~ ~ O ~ O O O O O
b
H H H H
H H H H H H
b d d . . . . d d d d d d d d d d d d d
,..,. . . . . . d d d d d d d d d d d d d
a
0
.
.
.
..,
O ~ N M ~ ~n ~D l~ oo Ov O ~ N M
o ~w 0 l~ 00 Ov O O O O O O O O O O ~
A-IOv Q\ O, Ov D\ ,~ .-,,~ ,~ ,~ ~ ,~ r-,.-,
H r~ v~ ~ ~ ~ v' c~ by ~ t cd 'i'G~
"
~ , _ ~ ~
~C x ~..~d v~ C7 U 4 ~ U C7 ~ U d C7 C7
"
~n o ~n
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-86-
o0 '- o0 o0 ~ O ~ ~O N M 0o .-~I~ Ov O Q\ Wit'I~
~O N M M M N N V't00 '~ V1 M M M N M M
O O O O O O O O O O O O O O O O O O
O O O O O O
O O ~ ~, ~ ~ O N ~ ~ M O O
M ~n l~ ~ O M oo M O O ~O N ~1
O O O O O ~
~ ~ O ,~ N N N N N ~ O O O
b
w w rs.~. . . w w
O Ov ~ a\ p p d\ ~ ~ M ~' O~ v7 ~ ~ ~D l~ O
O N ~ O ~ O M v1 t~ N
~ O O O O O O O 0
O O O O O , , p 0 O O O
M O M ~ O~ M O Ch u1
~ ~ M N ~ ~ ~ ,~
' O O O O O O O O
' ~ ~ ~ ~ ~ O ,--~O O ~ O
b
U
r
H H H H . . H H H H
H H H H H . H H H
.,
G d d d d d d
d d d d d d d d d d
c
0
...
~O oo Q\ O ~ N M ~ ~n ~D l~ oo Ov O ~ N
~ N N N N N N N N N N M M M
cd c~ ~r bA ~' fn
~ ~ ~ ~, .~ w H
~
r~;~ a ~ d U v~ ~ ~ ~ d H a U C v a ~
~n o ~n
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
_g7_
V1 00 l~ M O I~ ~ 00 00 ~ V't~D ~D O O~ d' M
N ~ N ~ N N N M M M tn ~ ~ ~ ~O N N N
J'CO O O O O O O O O O O O ~ O O O O O O
O O O O
O O O O ~ N ~ O ~ O O O ~ O
N ~ ~ M M N N O N
O O O O O O O ~
~ ~ 0 O O O O O O O O
b
C . . . . . . . . . w w w w w
.~ ~ ~
I~ ~ ~O M ~ p ~ M -~ ~ O O~ l~ O ~ ~D ~ O
l~ t~ Ov '~t O v0 ~ ~ ~ N ~n l~ I~ t~ I~ Ov N
~
O O O O O O O O O O O O O O O O ~ O
N ~ I~ ~' O ~ ~ 00 Ov M o0 ~ o0
U1 ~ ~n l~ ~ ~ O N -~ O I~ O N N M O
O O O O O O O O O O O O O O O O
O i i i i i i i i i i i ~ i O O i i i
E~ E-~H E-~ . H E-~
H H H H H H H H H . H H H H . H
0.1GA pa GG pa pa pa GA GA ~q
b
c
0
.
.
.
M ~ V1 ~O l~ 00 O~ O ~ N M ~Y V7 ~p ~ 00 Ov O
~ M M M M M M M ~ ~ ~f ~ ~ ~ ~ ~ ~ ~ V1 V~
t~ ~ ~
J, ~ ~ ~, cd ~ N ~ ~ ~ ~, ~, O
4 0..' C7 U C7 ~ rn C7 U ~ v~ r~ v~ p.,. E-~ U C7 p..,
a.,
~n o m
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
_88_
Ov ~ M I~ Ov O ~ ~ l~ N N M M C~ N ~ O
N ~ O ~ N N ~O O Ov Ov ~ M M ~ ~ oo ~n ~ Q\
'C O O O O O O O ~ ~ ~ ~ O O O O O
N ~
O O O O O ~ ~n ~n ~n O ~ 00 N v0 O v0
V1 V1 V~ .~ I~ ~ ~ CY l~ ~ M d' l~ ~ O 00
~ ~ ~
~, O O O O O O O O O O ~ N N M M N
w w w
M 'ch~ I~ O WE t~ ~ ~ ~D
~ M O~ O M ,~ ,-.O '"'~ ~O ~O 00 v1 V1
N O ~ M
~ O O O O 0 O O O O
O O O O O O O ,
N N M O~ N ~ ~D O O M M N I~ M
M 00 O~ ~ M N l~ O~ O~ O~ ~ 00
O O O O ~
~ O O O O O O O O O O O O
H
H H H H H . . . . . . . . ~ ~ H H
H H . . . . . . . . H ~ ~ H ~ ~ H
d d d d d d d d
...... . . d d d d d d d d
a
0
.r
w
.r
N M ~t v p t~ oo Ov O ~ N M ~ ~n ~O ~ oo Ov O
. by bD ~ ~ N bA by
Q ~ ~ c~ ~ ~ ~ ~..
c~ v a d v c~ ~ a x ~ x H ~ a a v
~n o ~n
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-89-
~O ~ M M N N O~ ~ o0 N N ~ o0 l~ O O ~ O ~n
O WE N ~ ~ N ~ N ~O ~ l~ N M ~ N N
~'CO O O O O O O O O ~ O ~ ~ O O D O O O
w 0 ~ O v0 t~ 00 O we ~n ~n v~ O O ~n O v~ O O
~t ~ ~O ~ ~O O ~ O ti'00 O O V1 ~ 00 ~O V1 M O
J'CN N ~ O O O O O O O ~ N N N ~ ~ 0 0 0
b
~C w w w w
.~ ~ .~ ~ ~.
v'1O ~t M C~ O ~ ~ ~O O~ M ~ ~ M ~ O M M '-'
p N '-'~O oo w D ~n <''~~ O O O p O O V1
i i i O O O O ~ O O O ~ i i ~ i O O O
~ 0 D
O~ N O o0 ~ 0 ~ oo ~ ~ oo N ,~ ~---~p~ pp y
0
l~ ~ ~n ~ ~ '-. oo N oo M l~ N O
O O O O O
O p ~ p p O ~ O O O O O ~
U U U
E~ H H . . . H F~ H H . . H H H H
H H H E-a H . . . H E--~f~ H H E~ E1 H H E-~H
b
c
0
N M ~ ~1 ~O t~ o0 ~ O ~ N M ~ ~w 0 t~ o0 Ov
I~ l~ I~ l~ t~ l~ l~ l~ I~ 00 00 00 o0 o0 o0 00 00 o0 00
~ r O' ~
r ~ ~ ~ ~.
~
r~ H d U c7 H U a a; t7 a H ~7 ~ ~7 d c7 v
~n o ~.~,
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-90-
~ O ~ O ~ v W v~ ~O N O ~1 O Ov N M
O
M I~ d' 00 l~ N M M 00 ~ M ~O M ~ O ~ ~ M
O O O O O O O O O O O O O O O O O O O
~n ~n ow n ~O l~ o0 O~ O O~ M N ~ ~ ~ ~ ~ N
~D M M ~ ~ O O~ V1 .-~I~ ~D Q\ ~D
O O O O O
O O O O O ~ -~ N M N ~ O p ,
b
5C . w w w w w w w w w w
x . . . . . . . . . . . . . . ~. . ~.
~.
l~ Q\ M I~ O~ M l~ O ~ ~p N ~ M N '-'M ~O ~O l~
V M ~ ~ N ~t M N ~ v1 ~ v1
O O O O O O 0
O O O O O O p , ~ ,-,O O O
I~ M ~ ~O N t~ M ~ O~ 00 O~ N M
N O O N N ~ M M N M M
O ~O M
O O O O O . p O O O O O O O
0 O O O O p ,
U
r~
H H H H . . . . H H H H
H H H H H H H . H H . . . . . . H H
pa pq p4 pa GG pa GA
b
c
0
.r
.r
O ~ N M d' N ~ l~ 00 01 O -~ N M ~' ~n ~D l~ 00
O a\ O~ O~ ~ O~ ~ O~ ~ O~ O~ O O O O O O O O O
N N N N N N N N N
~- s ~ ~ s v' ~ dp v' . v'
p .. ~ ~ _ .., O ~ ~ ~
, c
U Q H tn H l C7 v~ U ~ C7 ~ U ~ ~ ~ U C7 H
, .
-
~n o ~n
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-91-
O~ ~ N ~O O v0 ~ v~ O O O O~ ~O M ~ - m O O~
v0 l~ ~n ~t N .~ ,~ ,~ N ,~ .~ p ,-.r. ,~ ,--~, ~ N
~, O O O O O O O O O O O O O O O O O O O
O O O O O O O O O O O O O O O O O O O
~O ~D ~O N ~ ~ ~O ~ ~D ~D ~D ~O ~D ~O ~O ~O ~O ~D ~D
O O O O O O O O O O O O O O O O O O O
i i i i i i i i i i i i i ~ ~ i i
~ . . . . . . . . ~t-
~O I~ ~D O O~ ~O l~ O~ M l~ C~ ~ -~ O ~O O ~O O
l~ O N l~ '~t~D I~ ~' O~ O N N O O N ~ N O Ov
O N ~ ~ l~ M M ~ O O O ~D O O ~O
M N v't~ O l~ 00 ~ ~ ~O ~ ~O ~O M ~D ~ O
~ O
O O O ~--~N ~ ~ N N N N N N N N N N
i i O O i i i ~ ~ i i i i i i ~ i i i
H
~ ~ ~ ~
b
C
O
O ~ N M ~ ~n ~O l~ oo Ov O .--~N M ~ ~ ~D l~
O O ,--~~ ,-, ,-.,-,,~ ~ .-,
W N N N N N N N N N N N N N N N N N N N
~ ~ ~ ~ w ~ > 7 > ~ ~ ~
r C L a ~ ~ C . w i i i
i
o m
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-92-
Ov N N O O Ov N ~O oo M N ~t ~' Ov ~ ~n M M O~
M v0 Q\ ~ o0 .~ ,~ ~ oo l~ ~ 00 N Ov oo ~O v1 v~
~, O O O O ~ ~ M ~ O O O O O -~ O O O O O
O O O O ~n ~ ~ O
v0 W O v0 ~t O O ~ O p O O O v~ v1 v1 ~ O O
~,~N N N O yn M -, N M
O O O O O O ~ p O ~
O O O O O O O O O
b
~C . . . . . . . . . . . . . . w w
.~ ~ ~ ~ .~ ~ ~ ~ ~ ~ ~ . ~.
.~
~
~O ~O M M ~O ~O l~ ~O O~ ~ l~ p 'cYM O l~ d' N N
Ov O oo ,w 0 ~ v~ W O ~D M ~n ~D ~ N
~ ~ O
O ~ O ~ O O O O O O O O O O p
l~ 00 O O 00 (~ l~ O M ~O M N M 00
v1 v1 O ~
~ I~ ~O l~ M v~ 00 Ov '~t~t ~ N ~n l~
~ ~ ~
i i i ~ O O O O ~ ~ ~ ~ ~ O O O O O O
U . . U U U
H H H H H E~ H H
,~ . . . . . H H H H H E-~. E-iE-~
~
pa pa pa pa W L~ pa
~
,. . . . . . . . . . . . . . . . . d d d
.,
.~ d d d d . . . . . . . . . . . . . d d
a
0
0o Ov O ~ N M ~ ~n ~ I~ oo pv O ~ N M '~t~n ~D
N N M M M M M M M M M M
N N N N N N N N N N N N N N N N N N N
J ~ ~ ~ ~ ~
y ' .~ ~ ,.~>, ~' ~, '_n ,~,~,'~ v_' C' d
_ ,s' ~ ~
fx C7 ~ H ~ H E-~H H ~ x U H ~ x '1 ~ ~ ~ E
~- -
~n o v~
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-93-
N t~ ~O ~ Ov M l~ M ~t N N o0 o0 O o0 o0 M M N
i.~.l~ ~ ~O ~ ~O M ~ t~ --~O O I~ ~ ~ I~ C~ ~O I~ I
C O O O ~ O O O O ~ ~ ~ .-~.-~O O O O O O
V'1~fl~ O O O ~ ~ V1 O ~ O O V1 ~ ~ ~. ~!1V'1
~ O~ ~O M O 00 M 00 M V' V
ce, O O O O O O ~ ~ O O ~ O O O ~ O O O O
~C w w w w . . . . . ~., w w w w . . . w w
.x.
N <h ~ O ~ ue ~
N ~ N d ~ ~ ~ O
'
O O O O O ~ p O O ~ O O O O O O O O O
N ~ ''..'00 0 v0 ~ rte.,r" p v0 N p
N ~ N O N N N ~n ~O O N
O O ~ O O, O ~ O ~ O O ~ O O O O O O
O
U U U U . . . . . U U
H H H H . . H H
E--H
pq pa
b d d d d d d d d d d d
., d d d d d d d d . . . . . . d
0
.
.
.
t~ 00 Ov O ~ N M V' ~n ~O t~ oo Ov O ~ N M d- ~n
~t d' ~ ~n v-, ~n ~n ~n ~n v mn ~n Im o vo vo ~ ~D vo
~ N N N N N N N N N N N N N N N N N N N
O. ~ c~ ~ ~ ~ c~ ~ ~ O O O cd ~ m ~ ~ O
d U' ~ C'~ ,~ C~J~ r~ H ~ 0.iP~.i
O V'7
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-94-
Ov O ~ ~ ~ ~ 0o V M N ~O ~1 o0 l~ ~ o0 N N M
H 00 O~ 00 00 d' M ~ V1 ~ O ~D 00 ~O ~O V7 V1 M M
'C O O O O O O O O O ~ ~ N M ~ O O O O O
O O O O N
~ N ~p O v0 N M Ov O O
<t 00 ~ ~ ~D V~ ~ wD ~ ~O ~ M M
0 O O O p O
~ O
, O O i i i i i O ~ N M N N ~ O O O i
~C w w w . . . . . . w w w w w w w
.~ ~ ~ . . .~
O~ ~ I~ ~ l~ O~ M
~ O _ ~ ,~ 0o M ~ Ov ~ N N
O N N ~ ~ l~ N r .
.,
~ ~ ~ O ' ' O O O O
O O O O O O O O ; ~ 0
o ~ ~D ~ ~ ~
O
_ ~ ~ M N O N N ~ ~ ~ N O
O
~ O o N N
O
O O O O O O ; ;
O O O , ~ ~ ~ ,- O O O O ~ O
b
U . . . . . . . U U U
E-~E-~. . . . . . . H H H H
H
~
~ . . . . . . . . . . . . . . . pa pa pq G4
.,
~1 pq pq . . . . . . . . . . p4
I~ . . d d d d d d d
d d d d . . . . . . . d d d d d d
c
0
.
..
N M ~ ~w 0 l~ o0 Ov O ~ N M ~t
I~ l~ l~ l~ l~ I~ I~ l~ 00 o0 00 00 00
f~ N N N N N N N N N N N N N N N N N N N
~ ~
~ c .~ N N ~ O O ~" N N
W.! a d va ~ ~ E-i,~ ,~ ~ a~ a d v~ vo C7 ~ ~ U
, , ~
~n o ~n
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-95-
O~ N ~ ~n v~ ~n N Ov N N o0 ~O o0 M ~t l~ I
~
.1 ~ N N v1 M ~!1~ ~ ~ N ~' ~' M r" ~O d' ~ <t
1.
~'CO O O O O O -~ ~ ~ ~ N N N ~ N ~ O O O
~ v1 v~ O O O O O O O O O O ~n ~ O
M M ~ M M M M ~O O M ~O O~ ~ M
O O O ~ ~ ~
O O O O O O O ~ ~ O O O O
w w w w w w w w w w w w w
.~
O~ ~O <h 01 I~ O M ~ ~ p ~ ~ ~ M l~ O
00 ~O V1 00 U ~D ~t 00 00 ~ O O
Q O O O O ~ O
O O O O O O O O O O O ,
N ~ N N ~ M O ~ ~ o0 00 l~ a\ O~ l~ O
M O ~D N ~n N ~n oo ~n Ov ~ l~ O~ O
O O O O O O
p p O .--~,~ .~ ,~ .-.r. O O
U U U U U U
H H H H H H H H
H H H H . . . . . . E
pq
b . . . . . . . . . . . . . d d d d d d
.., d d d d d
, . . . . . . . . . . . . . .
c
0
.
..
v1 ~O l~ 00 Ov O -a N M ~h ~ ~ l~ o0 ~ O ~ N M
0 00 00 00 00 00 O~ Q~ O~ O~ ~ ~ Q\ O~ O~ O~ O O O O
.
W N N N N N N N N N N N N N N N M M M M
~ i ~ ~ W ~' a " p ~ 0 ~ ~ ~ ~S
d C .- r ~ O .~ y~, ~, ~..., .~
n
r~ 'U ~ ~ C7 d Cn H f-~ ~ 'U h P-iU' H U' 'U
r
v7 O V~
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-96-
O Ov t~ M M ~ N ~ Ov Q\ N ~ ~ I~ I~ 00 O O v0
H N N M O~ ~O ~O V ~ -~ '-''N M ~ I~ l~ ~t M M v1
'C O O O O O O ~ O ~ ~--~N ~ O O O O O O O
N ~ N N ~ O ~ O ~ ~ O ono~ ~ ~ N
O O O O O O O ~ O ~ N M '--~~ ~ ~ O ~ O
p
w w w w w w w w w
~C
M ~ oMO ~ ~ ~ ~ ~ N ~ ~ O -~ ~ O O v~1
N ~ O
O O ~ O --~O O O O O ~ ~ O O ~ ~ O O
N ~ N ~ ~ ~ M ~ ~ ,-,O ~h M N O Wit'c~i
~ N ~ ~ ~ ~ ~ ~ ~ M
O O O O O O O O
O i i i O ~ O O O ~ ~ O O O i i ~ i i
b
U U U . . . U U U U
H H H H
H H E--~E--~E-~E-~E-~H . . . H H H
,.'~..,pa pa GG PA p~ f~ pa G4 GA
d
c
0
.
,
.
~w 0 t~ oo O~ O ~ N M ~t ~w 0 t~ oo ~ O ~ N
O O O O O O ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ N N N
AI M M M M M M M M M M M M M M M M M M M
<n m p .t". t1.i..,p, Q-' _~,'~ p s-,by ~ ~ _>,O cd
f.~U ~, C7 ~ H H v~ H ~ C7 ,...ap~ m
v~ o ~n
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-97-
N M o0 00 ~ ~--~~ N I~ O o0 d' l~ l~ O~ O O O WE
00 ~ ~ 00 V'1M ~ ~ N ~ 01 I~ ~ ~ M V1 V7
~, O O O O ~--~~--~~ ~ ~ ~ O O O O O O O O O
~ O O Vl O V~ O O Vl O ~ M ~ ~ ~ O
O O O O N ~ l~ Os N ~n ~ N O O
O ~ ~ ~ ~ ~ N N ~ ~ p ~ O O O
b
w w w w w w w w w w w w
l~ M O~ ~ ~p ~ O ~ ~ ~ ~ ~O O~ I~ ~O M I~ I~ O
N ~n ~ ~ O N ~ ~O ~ ~ ~O
O O O p O, O O O O O O ~ O O O O O O O
i..il~ ~O N
~I Ov ~ M ~ ~ N ~ ~ ~ O ~ ~ N ~n r' '-'O
O O O O~ p p p O O ~ O p ~ O O O O O
b
U U U U U U U U U . U U . . . . . U
H H H E-~H E~ E-~E~ . . . . . H
H
.,
W pq pq
~ ~
0
r
.
.r
M ~' v1 ~D l~ 00 O~ O ~ N M ~ v7 ~O I~ 00 O~ O
N N N N N N N M M M M M M M M M M
AI M M M M M M M M M M M M M M M M M M M
v' c~ cd O ~ O s-.O _~ ~ O cd _~,s..O cd ~ N
V7 O V7
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-98-
.-. ~--i00 M ~ ~ ~!1 M ~ 00 M l~ O~ ~ l~ V'tV~
M M N M O~ ~O ~O I~ M M ~ ~ O O 00 N I~ O O
~ O O O O O O O O -~ -~ N M N
O O O O
O O O O ~ ~ p p ,n ~ O O O O ~n
~O M M N M M d\ V Q\ O~ O~ 01 I~
' p O O O O ~ ~ p
C O O O p , O O O O O O O
yC w w w w . . . . . . . . . . w w w w
~-
C .x..x.-~ -~ ~ ~. -~ ~. ~ ~.
I~ ~ M ~ ~ ~D O ~D ~D
Q\ ~O M M ~ M O O ~O ,-,M M p~ O v7 ,~ 00 ~D ~p
M ~ N ~ M ~t .-~N r' M
p O O O O O
O O O O O O O O O ~ p , O ~
I~ l~ N N M Ov ~ ~ ~ p N ~ M M N N ~ N
N o0 0o N '~t~ O V1 N N ~ ~ ~' t~
~ ~ p O O O
r O O O O O O , ~ O O ,-,
p
U U U U
H H H
,..,
p4 pa W p4 pq
b . . . ~ ~ d ~ ~ a d ~ ~ . ~ ~ ~ ~ ~ d
. . . . . . . .
0
,
..
~ N M ~ ~n ~ ~ o0 Ov O ~--~N M ~ ~W O l~ 00 Ov O
0 ~h ~ ~ ~ ~ ~ ~ ~ ~n ~m n ~n v~ ~n v~ v mn ~w O
QI M M M M M M M M M M M M M M M M M M M
O >, O G' ~ ~.,~1, ~ C~.cd O cti
C~ a C7 w t~ a H ~ ~ ~ d ~ ~ a ~ ~ ~ ~ a C7
s ~
~n o ~.,
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-99-
O~ ~ N v7 ~O M ~ O~ ~n ~!1I~ M I~ ~ l~ ~O O~
~
L ~ ~!1M M 00 l~ ~n -~ I~ ~O 00 M ~O N ~O N N ~O M
.I
0 0 0 0 0 0 ~ 0 ~ 0 0 0 0 0 0 0 0 0
p V1 O ~ ~ O O O u1 V1 O O O O O O O O O O
i--1~ M V1 ~O M l~ l~ Q\ ~ ~ ~O ~O ~O ~D M ~O M
'C O O ~ ~ O O O O O O O O O O O O O O O
yC . . . . . . . . w r~
~. . . . . ~.
l~ O ~ ~ ~ O O M ~ l~ I~ M M M O O ~D
O _ O I~ N t~ l~ ~ M ~O ~O v1 v~ ~n ,--.~~O
O O ~ O O O O O O O O O O O O O
~ ~ ~ ~
00 ~ -~ O ~ N o0 o0 o0 N N
O ~ ,~ ,-..-~ p ~O ,-,l~ Ov ,~ O~ N N ~n Ov W O
M ~ ~ M ~ p p
O O O O O O O O O O O O O O O O O O O
i i i i i i ~ ~ ~ i i
U
r~
b
b d d d d d d d d d d d d d d d d d d d
d d d d d d d d d d d d d d d d d d d
0
0
.
.
.
...
_
N M ~ v W I~ o0 Ov O ~ N M ~ v1 ~ I~ 00 Ov
D
a1 M M M M M M M M M M M M M M M M M M M
.tar~ ~ .S",~ ~' ~ ~ ~ c~
v7 O V~
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-1 DO-
o0 00 .~ v~ O o0 N ~O Ov M ~ ~ v1 O Ov ~ ~t o0
H Q\ 00 r., 00 O --,O ~1 t~ O~ M V7 ~D V1 00 l~ ~D 00 00
~C O O N M M ~O M -~ ~ ~ ~ ~ N ~1 ~ M M ~ O
O ~n O O O O O v~ ~n u1 ~n ~n O O O O O O ~n
M I~ Ov Ov O~ Ov Q\ ~ ~t ~ ~ ~ O M Ov O N N <t
iC O O O O O O O O O O O ~ ~ ~ O ~ O ~ O
b
5C . w w w w w w . . . . . w w w w w w w
O O O~ ~O ~O M 'c?'~ ~ M O~ O~ O O~ ~O <t'
I~ O W ~ 0o r- .-~ W O I~ M ~ o0
O
O - O O O O O O O O O O O O O O O
i ~
M M O~ ~ M 00 ~O O O ~ N N I~ h ~O 00 O~ I~
O~ O~ ~ ~n ~i'~ N O O l~ o0 0o O O ~ ~O N M M
O O ~ ~ N N -~ N N ~ ~ ~ N N N N N
U U U
E- H
H H H . H
,..,
b d d d d d d d d d d d d d d d d d .
d d d d d d d d d d d . . . d
c
0
,
.. O ~ N M ~t ~n ~D I~ o0 Ov O ~ N M ~ ~n ~ l~ o0
00 00 00 00 00 00 00 00 00 0o a\ Q\ Ov a\ Ov a\ a\ Ov a\
~I M M M M M M M M M M M M M M M M M M M
~ ~ ~ ~ ~ ~ ~ j t~A by s.."S"-,~' O
d C7 C7 ~, ~7 ~ ~ ~ ~ _ _ _
C7 C7 C7
p., H a "..~ H w
V7 O V7
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-101-
O Ov V' N N l~ M Q\ M ~n M N ~ O v0 N N ~ N
v1 N ~ N N N N M O ~O v0 ~n O ~O ~ - N ~ N
'C O O O O O O O O ~ O O O ~ O O O O O O
~n O O O O O ~ ~ ~ ~ O O v~ O O O O O O
M M M I~ 00 I~ ~ l~ O
'C O O p, O O O O O O O ~ O O O O O O ~ O
~C w
C
I~ ~ ~ ~ ~ ~ Ov O w0 N O ~ ohoN ~ N
N M ~O O~ Q\ O O ~n O O M O O
O O O O O ~ ~ O O O O, O O O O ~ O
Q\ 00 ~D 00 M ~ I~ N 00 M
'-'N ~ O '~'~O M ~ ~O ~ M ~ '_-'M O O ~ M N
O O ~ ~ ~ ~ O O O O O 0 ~ O O O O
U U U
H H . . . . . . . . . . . . H H H H
H
b . . . . d d d d d d d d d . . . . . d
..~. . . . d d d d d d d d d d d d d d d
0
0
....
0v O ~ N M ~ ~w 0 I~ o0 Q~ O ~ N M V ~1 ~O l~
Qv O O O O O O O O O O ~
I~IM ~ ~ d' d' V' ~ ~ ~i'~ ~' ~ ~f ~t ~ ~ ~ V
cd _~,~ ~ cd ~ ~ c~ cd ~ ~ ~ ~ ~ ~ ~' ,_.~'~, c~
G~ C7 a C7 ~ 'J H ~ ~ a c7 ~ ~ L7 ,.~ d L~ U
v~ O V~
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-102-
M l~ ~ ~ Ov O ~ N ~n ~ Wit'
O 00 M M M ~ O~ N
'C O ~ N ~ ~ M
O O O O O O O O ~n ~n v~
~D O~ a\ Q\ O~ M M I~ V1 O O
'C O O O O O
~C . w w w w w w w
l~ ~ Q\ ~ ~ ~ O C~ M O ~O
~D l~ N N o0 o0 ~ ~ ~O N
O O ~ ~ O O ~ O O O O
i i i i i i i i ~ i
M ~ 00 ~ r' I~ ~O 00 00 Q\ Q\
l~ N Ov O wn M l~ N ~ ~O
O O O O ~ ~ ~ ~ ~ ~ O
U U
H H H H
H H H H
b d d d d d d d
d d d d d
c
0
.
.
.
..,
o Q O ~ N M Wit'~n ~O l~ 00
O v
_ _
~ ~
' '-' .~
~ C7 d a ~ C/~ a c7 ~ C7 w
v~ o
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-103-
Among highly preferred fragments in this regard are those that comprise,
or alternatively consist of, regions of DR3-V 1 and DR3 that combine several
structural features, such as several of the features set out above in Table 2.
The invention further provides for the proteins containing polypeptide
sequences encoded by the polynucleotides of the invention.
The present invention is further directed to isolated polypeptides
comprising, or alternatively consisting of, fragments of DR3-V1 and DR3. In
particular, the invention provides isolated polypeptides comprising, or
alternatively
consisting of, the amino acid sequences of a member selected from the group
consisting of amino acids 1-60, 11-70, 21-80, 31-90, 41-100, 51-110, 61-120,
71-130, 81-140, 91-150, 101-160, 111-170, 121-180, 131-190, 141-200,
151-210, 161-220, 171-230, 181-240, 191-250, 201-260, 211-270, 221-280,
231-290, 241-300, 251-310, 261-320, 271-330, 281-340, 291-350, 301-360,
311-370, 321-380, 331-390, 341-400, 351-410, 361-420, and 371-428 of SEQ
ID N0:2, as well as isolated polynucleotides which encode these polypeptides.
The invention also provides isolated polypeptides comprising, or alternatively
consisting of, the amino acid sequences of a member selected from the group
consisting of amino acids 1-60, 11-70, 21-80, 31-90, 41-100, 51-110, 61-120,
71-130, 81-140, 91-150, 101-160, 111-170, 121-180, 131-190, 141-200,
151-210, 161-220, 171-230, 181-240, 191-250, 201-260, 211-270, 221-280,
231-290, 241-300, 251-310, 261-320, 271-330, 281-340, 291-350, 301-360,
311-370, 321-380, 331-390, 341-400, 351-410, and 361-417 of SEQ ID N0:4,
as well as isolated polynucleotides which encode these polypeptides.
The DR3-V 1 or DR3 proteins of the invention may be in monomers or
multimers (i.e., dimers, trimers, tetramers, and higher multimers).
Accordingly,
the present invention relates to monomers and multimers of the DR3-V 1 or DR3
proteins of the invention, their preparation, and compositions (preferably,
pharmaceutical compositions) containing them. In specific embodiments, the
polypeptides of the invention are monomers, dimers, trimers or tetramers. In
additional embodiments, the multimers of the invention are at least dimers, at
least
trimers, or at least tetramers.
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-104-
Multimers encompassed by the invention may be homomers or heteromers.
As used herein, the term homomer, refers to a multimer containing only DR3-V1
or DR3 proteins of the invention (including DR3-V 1 or DR3 fragments,
variants,
and fusion proteins, as described herein). These homomers may contain DR3-V 1
or DR3 proteins having identical or different polypeptide sequences. In a
specific
embodiment, a homomer of the invention is a multimer containing only DR3-V 1
or DR3 proteins having an identical polypeptide sequence. In another specific
embodiment, a homomer of the invention is a multimer containing DR3-V1 or
DR3 proteins having different polypeptide sequences. In specific embodiments,
the multimer of the invention is a homodimer (e.g., containing DR3-V 1 or DR3
proteins having identical or different polypeptide sequences) or a homotrimer
(e.g., containing DR3-V1 or DR3 proteins having identical or different
polypeptide sequences). In additional embodiments, the homomeric multimer of
the invention is at least a homodimer, at least a homotrimer, or at least a
homotetramer.
As used herein, the term heteromer refers to a multimer containing
heterologous proteins (i.e., proteins containing only polypeptide sequences
that
do not correspond to a polypeptide sequences encoded by the DR3 gene) in
addition to the DR3-V1 or DR3 proteins of the invention. In a specific
embodiment, the multimer of the invention is a heterodimer, a heterotrimer, or
a
heterotetramer. In additional embodiments, the heteromeric multimer of the
invention is at least a heterodimer, at least a heterotrimer, or at least a
heterotetramer.
Multimers of the invention may be the result of hydrophobic, hydrophilic,
ionic and/or covalent associations and/or may be indirectly linked, by for
example,
liposome formation. Thus, in one embodiment, multimers of the invention, such
as, for example, homodimers or homotrimers, are formed when proteins of the
invention contact one another in solution. In another embodiment,
heteromultimers of the invention, such as, for example, heterotrimers or
heterotetramers, are formed when proteins of the invention contact antibodies
to
the polypeptides of the invention (including antibodies to the heterologous
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-105-
polypeptide sequence in a fusion protein of the invention) in solution. In
other
embodiments, multimers of the invention are formed by covalent associations
with
and/or between the DR3-V 1 or DR3 proteins of the invention. Such covalent
associations may involve one or more amino acid residues contained in the
polypeptide sequence of the protein (e.g., the polypeptide sequence recited in
SEQ ID N0:2 or the polypeptide encoded by the deposited cDNA). In one
instance, the covalent associations are cross-linking between cysteine
residues
located within the polypeptide sequences of the proteins which interact in the
native (i.e., naturally occurring) polypeptide. In another instance, the
covalent
associations are the consequence of chemical or recombinant manipulation.
Alternatively, such covalent associations may involve one or more amino acid
residues contained in the heterologous polypeptide sequence in a DR3-V 1 or
DR3
fusion protein. In one example, covalent associations are between the
heterologous sequence contained in a fusion protein ofthe invention (see,
e.g., US
IS Patent Number 5,478,925). In a specific example, the covalent associations
are
between the heterologous sequence contained in a DR3-V 1-Fc or DR3-Fc fusion
protein of the invention (as described herein). In another specific example,
covalent associations of fusion proteins of the invention are between
heterologous
polypeptide sequences from another TNF family ligand/receptor member that is
capable of forming covalently associated multimers, such as for example,
oseteoprotegerin (see, e.g., International Publication No. WO 98/49305, the
contents of which are herein incorporated by reference in its entirety).
The multimers of the invention may be generated using chemical
techniques known in the art. For example, proteins desired to be contained in
the
multimers of the invention may be chemically cross-linked using linker
molecules
and linker molecule length optimization techniques known in the art (see,
e.g., US
Patent Number 5,478,925, which is herein incorporated by reference in its
entirety). Additionally, multimers of the invention may be generated using
techniques known in the art to form one or more inter-molecule cross-links
between the cysteine residues located within the polypeptide sequence of the
proteins desired to be contained in the multimer (see, e.g., US Patent Number
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-106-
5,478,925, which is herein incorporated by reference in its entirety).
Further,
proteins of the invention may be routinely modified by the addition of
cysteine or
biotin to the C terminus or N-terminus of the polypeptide sequence of the
protein
and techniques known in the art may be applied to generate multimers
containing
one or more of these modified proteins (see, e.g., US Patent Number 5,478,925,
which is herein incorporated by reference in its entirety). Additionally,
techniques
known in the art may be applied to generate liposomes containing the protein
components desired to be contained in the multimer of the invention (see,
e.g., US
Patent Number 5,478,925, which is herein incorporated by reference in its
entirety).
Alternatively, multimers of the invention may be generated using genetic
engineering techniques known in the art. In one embodiment, proteins contained
in multimers of the invention are produced recombinantly using fusion protein
technology described herein or otherwise known in the art (see, e.g., US
Patent
Number 5,478,925, which is herein incorporated by reference in its entirety).
In
a specific embodiment, polynucleotides coding for a homodimer of the invention
are generated by ligating a polynucleotide sequence encoding a polypeptide of
the
invention to a sequence encoding a linker polypeptide and then further to a
synthetic polynucleotide encoding the translated product of the polypeptide in
the
reverse orientation from the original C-terminus to the N-terminus (lacking
the
leader sequence) (see, e.g., US Patent Number 5,478,925, which is herein
incorporated by reference in its entirety). In another embodiment, recombinant
techniques described herein or otherwise known in the art are applied to
generate
recombinant polypeptides ofthe invention which contain a transmembrane domain
and which can be incorporated by membrane reconstitution techniques into
liposomes (see, e.g., US Patent Number 5,478,925, which is herein incorporated
by reference in its entirety).
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-107-
Protein Modification
In addition, proteins of the invention can be chemically synthesized using
techniques known in the art (e.g., see Creighton, 1983, Proteins: Structures
and
Molecular Principles, W.H. Freeman & Co., N.Y., and Hunkapiller, M. et al.,
Nature 310:1 OS-111 ( 1984)). For example, a peptide corresponding to a
fragment
of the DR3-V1 or DR3 polypeptides of the invention can be synthesized by use
of a peptide synthesizer. Furthermore, if desired, nonclassical amino acids or
chemical amino acid analogs can be introduced as a substitution or addition
into
the DR3-V 1 or DR3 polypeptide sequence. Non-classical amino acids include,
but are not limited to, to the D-isomers of the common amino acids,
2,4-diaminobutyric acid, a-amino isobutyric acid, 4-aminobutyric acid, Abu, 2-
amino butyric acid, a-Abu, a-Ahx, 6-amino hexanoic acid, Aib, 2-amino
isobutyric acid, 3-amino propionic acid, ornithine, norleucine, norvaline,
hydroxyproline, sarcosine, citrulline, homocitrulline, cysteic acid, t-
butylglycine,
t-butylalanine, phenylglycine, cyclohexylalanine, a-alanine, fluoro-amino
acids,
designer amino acids such as a-methyl amino acids, Ca-methyl amino acids,
Na-methyl amino acids, and amino acid analogs in general. Furthermore, the
amino acid can be D (dextrorotary) or L (levorotary).
Non-naturally occurring variants may be produced using art-known
mutagenesis techniques, which include, but are not limited to oligonucleotide
mediated mutagenesis, alanine scanning, PCR mutagenesis, site directed
mutagenesis (see, e.g., Carter et al., Nucl. Acids Res. 13:4331 (1986); and
Zoller
etal., Nucl. AcidsRes. 10:6487 (1982)), cassette mutagenesis (see, e.g., Wells
et
al., Gene 34:315 (1985)), restriction selection mutagenesis (.see, e.g., Wells
et al..,
Philos. Traps. R. Soc. London SerA 317:41 S (1986)).
The invention additionally, encompasses DR3-V1 and DR3 polypeptides
which are differentially modified during or after translation; e.g., by
glycosylation,
acetylation, phosphorylation, amidation, derivatization by known
protecting/blocking groups, proteolytic cleavage, linkage to an antibody
molecule
or other cellular ligand, etc. Any of numerous chemical modifications may be
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-108-
carried out by known techniques, including but not limited to, specific
chemical
cleavage by cyanogen bromide, trypsin, chymotrypsin, papain, V8 protease,
NaBH4, acetylation, formylation, oxidation, reduction, metabolic synthesis in
the
presence of tunicamycin; etc.
Additional post-translational modifications encompassed by the invention
include, for example, e.g., N-linked or O-linked carbohydrate chains,
processing
of N-terminal or C-terminal ends), attachment of chemical moieties to the
amino
acid backbone, chemical modifications of N-linked or O-linked carbohydrate
chains, and addition or deletion of an N-terminal methionine residue as a
result of
procaryotic host cell expression. The polypeptides may also be modified with a
detectable label, such as an enzymatic, fluorescent, isotopic or affinity
label to
allow for detection and isolation of the protein.
Also provided by the invention are chemically modified derivatives of
DR3-V 1 or DR3 which may provide additional advantages such as increased
solubility, stability and circulating time of the polypeptide, or decreased
immunogenicity (see U. S. Patent No. 4,179,337). The chemical moieties for
derivitization may be selected from water soluble polymers such as
polyethylene
glycol, ethylene glycol/propylene glycol copolymers, carboxymethylcellulose,
dextran, polyvinyl alcohol and the like. The polypeptides may be modified at
random positions within the molecule, or at predetermined positions within the
molecule and may include one, two, three or more attached chemical moieties.
The polymer may be of any molecular weight, and may be branched or
unbranched. For polyethylene glycol, the preferred molecular weight is between
about 1 kDa and about 100 kDa (the term "about" indicating that in
preparations
of polyethylene glycol, some molecules will weigh more, some less, than the
stated
molecular weight) for ease in handling and manufacturing. Other sizes may be
used, depending on the desired therapeutic profile (e.g., the duration of
sustained
release desired, the. effects, if any on biological activity, the ease in
handling, the
degree or lack of antigenicity and other known effects of the polyethylene
glycol
to a therapeutic protein or analog). For example, the polyethylene glycol may
have an average molecular weight of about 200, 500, 1000, 1500, 2000, 2500,
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-109-
3000, 3500, 4000, 4500, 5000, 5500, 6000, 6500, 7000, 7500, 8000, 8500, 9000,
9500, 10,000, 10,500, 11,000, 11,500, 12,000, 12,500, 13,000, 13,500, 14,000,
14,500, 15,000, 15,500, 16,000, 16,500, 17,000, 17,500, 18,000, 18,500,
19,000,
19,500, 20,000, 25,000, 30,000, 35,000, 40,000, 50,000, 55,000, 60,000,
65,000,
70,000, 75,000, 80,000, 85,000, 90,000, 95,000, or 100,000 kDa.
As noted above, the polyethylene glycol may have a branched structure.
Branched polyethylene glycols are described, for example, in U.S. Patent No.
5,643,575; Morpurgo et al., Appl. Biochem. Biotechnol. 56:59-72 (1996);
Vorobjev et al., Nucleosides Nucleotide.r 18:2745-2750 (1999); and Caliceti et
al., Bioconjug. Chem. 10:638-646 (1999), the disclosures of each of which are
incorporated herein by reference.
The polyethylene glycol molecules (or other chemical moieties) should be
attached to the protein with consideration of effects on functional or
antigenic
domains of the protein. There are a number of attachment methods available to
those skilled in the art, e.g., EP 0 401 384, herein incorporated by reference
(coupling PEG to G-CSF), see also Malik et al., Exp. Hematol. 20:1028-1035
(1992) (reporting pegylation of GM-CSF using tresyl chloride). For example,
polyethylene glycol may be covalently bound through amino acid residues via a
reactive group, such as, a free amino or carboxyl group. Reactive groups are
those to which an activated polyethylene glycol molecule may be bound. The
amino acid residues having a free amino group may include lysine residues and
the
N-terminal amino acid residues; those having a free carboxyl group may include
aspartic acid residues, glutamic acid residues and the C-terminal amino acid
residue. Sulfhydryl groups may also be used as a reactive group for attaching
the
polyethylene glycol molecules. Preferred for therapeutic purposes is
attachment
at an amino group, such as attachment at the N-terminus or lysine group.
As suggested above, polyethylene glycol may be attached to proteins via
linkage to any of a number of amino acid residues. For example, polyethylene
glycol can be linked to a proteins via covalent bonds to lysine, histidine,
aspartic
acid, glutamic acid, or cysteine residues. One or more reaction chemistries
may
be employed~to attach polyethylene glycol to specific amino acid residues
(e.g.,
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-110-
lysine, histidine, aspartic acid, glutamic acid, or cysteine) ofthe protein or
to more
than one type of amino acid residue (e.g., lysine, histidine, aspartic acid,
glutamic
acid, cysteine and combinations thereof) of the protein.
One may specifically desire proteins chemically modified at the N-
terminus. Using polyethylene glycol as an illustration of the present
composition,
one may select from a variety of polyethylene glycol molecules (by molecular
weight, branching, etc.), the proportion of polyethylene glycol molecules to
protein (or peptide) molecules in the reaction mix, the type of pegylation
reaction
to be performed, and the method of obtaining the selected N-terminally
pegylated
protein. The method of obtaining the N-terminally pegylated preparation (i.e.,
separating this moiety from other monopegylated moieties if necessary) may be
by purification of the N-terminally pegylated material from a population of
pegylated protein molecules. Selective proteins chemically modified at the N-
terminus modification may be accomplished by reductive alkylation which
exploits
differential reactivity of different types of primary amino groups (lysine
versus the
N-terminal) available for derivatization in a particular protein. Under the
appropriate reaction conditions, substantially selective derivatization ofthe
protein
at the N-terminus with a carbonyl group containing polymer is achieved.
As indicated above, pegylation of the proteins of the invention may be
accomplished by any number of means. For example, polyethylene glycol may be
attached to the protein either directly or by an intervening linker.
Linkerless
systems for attaching polyethylene glycol to proteins are described in Delgado
et
al., Crit. Rev. Thera. Drug Carrier Sys. 9:249-304 (1992); Francis et al..,
Intern.
J. of Hematol. 68:1-18 (1998); U.S. Patent No. 4,002,531; U.S. Patent No.
5,349,052; WO 95/06058; and WO 98/32466, the disclosures of each ofwhich are
incorporated herein by reference.
One system for attaching polyethylene glycol directly to amino acid
residues of proteins without an intervening linker employs tresylated MPEG,
which is produced by the modification of monmethoxy polyethylene glycol
(MPEG) using tresylchloride (C1SOZCHZCF3). Upon reaction of protein with
tresylated MPEG, polyethylene glycol is directly attached to amine groups of
the
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-111-
protein. Thus, the invention includes protein-polyethylene glycol conjugates
produced by reacting proteins ofthe invention with a polyethylene glycol
molecule
having a 2,2,2-trifluoreothane sulphonyl group.
Polyethylene glycol can also be attached to proteins using a number of
different intervening linkers. For example, U. S. Patent No. 5,612,460, the
entire
disclosure of which is incorporated herein by reference, discloses urethane
linkers
for connecting polyethylene glycol to proteins. Protein-polyethylene glycol
conjugates wherein the polyethylene glycol is attached to the protein by a
linker
can also be produced by reaction of proteins with compounds such as MPEG-
succinimidylsuccinate, MPEG activated with 1,1'-carbonyldiimidazole, MPEG-
2,4,5-trichloropenylcarbonate, MPEG-p-nitrophenolcarbonate, and various
MPEG-succinate derivatives. A number additional polyethylene glycol
derivatives
and reaction chemistries for attaching polyethylene glycol to proteins are
described
in WO 98/32466, the entire disclosure of which is incorporated herein by
reference. Pegylated protein products produced using the reaction chemistries
set
out herein are included within the scope of the invention.
The number ofpolyethylene glycol moieties attached to each protein ofthe
invention (i.e., the degree of substitution) may also vary. For example, the
pegylated proteins of the invention may be linked, on average, to 1, 2, 3, 4,
5, 6,
7, 8, 9, 10, 12, 15, 17, 20, or more polyethylene glycol molecules. Similarly,
the
average degree of substitution within ranges such as 1-3, 2-4, 3-5, 4-6, 5-7,
6-8,
7-9, 8-10, 9-11, 10-12, 11-13, 12-14, 13-15, 14-16, 15-17, 16-18, 17-19, or 18
20 polyethylene glycol moieties per protein molecule. Methods for determining
the degree of substitution are discussed, for example, in Delgado et al.,
Crit. Rev.
Thera. Drug Carrier Sys. 9:249-304 (1992).
Polypeptide Assays
The present invention also relates to diagnostic assays such as quantitative
and diagnostic assays for detecting levels of DR3-V1 or DR3 protein, or the
soluble form thereof, in cells and tissues, including determination of normal
and
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-112-
abnormal levels. Thus, for, instance, a diagnostic assay in accordance with
the
invention for detecting over-expression of DR3-V 1 or DR3, or soluble form
thereof, compared to normal control tissue samples may be used to detect the
presence of tumors, for example. Assay techniques that can be used to
determine
levels of a protein, such as an DR3 protein of the present invention, or a
soluble
form thereof, in a sample derived from a host are well-known to those of skill
in
the art. Such assay methods include radioimmunoassays, competitive-binding
assays, Western Blot analysis and ELISA assays.
Assaying DR3-V 1 or DR3 protein levels in a biological sample can occur
using any art-known method. Preferred for assaying DR3-V1 or DR3 protein
levels in a biological sample are antibody-based techniques. For example, DR3-
V1 or DR3 protein expression in tissues can be studied with classical
immunohistological methods. M. Jalkanen et al., J. Cell. Biol. 101:976-985
(1985); M. Jalkanen et al., .l. Cell. . Biol. 105:3087-3096 (1987).
Other antibody-based methods useful for detecting DR3-V 1 or DR3
protein gene expression include immunoassays, such as the enzyme linked
immunosorbent assay (ELISA) and the radioimmunoassay (RIA).
Suitable labels are known in the art and include enzyme labels, such as
glucose oxidase, radioisotopes, such as iodine ('zSI, '2'I), carbon ('4C),
sulphur
(35S), tritium (3H), indium ("zIn), and technetium (9~"'Tc), and fluorescent
labels,
such as fluorescein and rhodamine, and biotin.
Antibodies
The present invention further relates to antibodies and T-cell antigen
receptors (TCR) which immunospecifically bind a polypeptide, preferably an
epitope, of the present invention (as determined by immunoassays well known in
the art for assaying specific antibody-antigenbinding). Antibodies ofthe
invention
include, but are not limited to, polyclonal, monoclonal, multispecific, human,
humanized or chimeric antibodies, single chain antibodies, Fab fragments,
F(ab')
fragments, fragments produced by a Fab expression library, anti-idiotypic
(anti-Id)
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-113-
antibodies (including, e.g., anti-Id antibodies to antibodies of the
invention), and
epitope-binding fragments of any of the above. The term "antibody," as used
herein, refers to immunoglobulin molecules and immunologically active portions
of immunoglobulin molecules, i. e., molecules that contain an antigen binding
site
that immunospecifically binds an antigen. The immunoglobulin molecules of the
invention can be of any type (e.g., IgG, IgE, IgM, IgD, IgA and IgY), class
(e.g.,
IgGI, IgG2, IgG3, IgG4, IgAl and IgA2) or subclass of immunoglobulin
molecule.
Most preferably the antibodies are human antigen-binding antibody
fragments of the present invention and include, but are not limited to, Fab,
Fab'
and F(ab')2, Fd, single-chain Fvs (scFv), single-chain antibodies, disulfide-
linked
Fvs (sdFv) and fragments comprising either a VL or VH domain. Antigen-binding
antibody fragments, including single-chain antibodies, may comprise the
variable
regions) alone or in combination with the entirety or a portion of the
following:
hinge region, CH1, CH2, and CH3 domains. Also included in the invention are
antigen-binding fragments also comprising any combination of variable regions)
with a hinge region, CH1, CH2, and CH3 domains. The antibodies of the
invention may be from any animal origin including birds and mammals.
Preferably,
the antibodies are human, murine, donkey, ship rabbit, goat, guinea pig,
camel,
horse, or chicken. As used herein, "human" antibodies include antibodies
having
the amino acid sequence of a human immunoglobulin and include antibodies
isolated from human immunoglobulin libraries or from animals transgenic for
one
or more human immunoglobulin and that do not express endogenous
immunoglobulins, as described infra and, for example in, U.S. Patent No.
5,939,598 by Kucherlapati et al.
The antibodies of the present invention may be monospecific, bispecific,
trispecific or of greater multispecificity. Multispecific antibodies may be
specific
for different epitopes of a polypeptide of the present invention or may be
specific
for both a polypeptide of the present invention as well as for a heterologous
epitope, such as a heterologous polypeptide or solid support material. See,
e.g.,
PCT publications WO 93/17715; WO 92/08802; WO 91/00360; WO 92/05793;
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-114-
Tutt et al., J. Immunol. 147:60-69 (1991); U.S. Patent Nos. 4,474,893;
4,714,681; 4,925,648; 5,573,920; 5,601,819; Kostelny et al., J. Immunol.
148:1547-1553 (1992).
Antibodies of the present invention may be described or specified in terms
of the epitope(s) or portions) of a polypeptide of the present invention that
they
recognize or specifically bind. The epitope(s) or polypeptide portions) may be
specified as described herein, e.g., by N-terminal and C-terminal positions,
by size
in contiguous amino acid residues, or listed in the Tables and Figures.
Antibodies
that specifically bind any epitope or polypeptide of the present invention may
also
be excluded. Therefore, the present invention includes antibodies that
specifically
bind polypeptides of the present invention, and allows for the exclusion of
the
same.
Antibodies of the present invention may also be described or specified in
terms of their cross-reactivity. Antibodies that do not bind any other analog,
ortholog, or homolog of a polypeptide of the present invention are included.
Antibodies that bind polypeptides with at least 95%, at least 90%, at least
85%,
at least 80%, at least 75%, at least 70%, at least 65%, at least 60%, at least
55%,
and at least 50% identity (as calculated using methods known in the art and
described herein) to a polypeptide of the present invention are also included
in the
present invention. Antibodies that do not bind polypeptides with less than
95%,
less than 90%, less than 85%, less than 80%, less than 75%, less than 70%,
less
than 65%, less than 60%, less than 55%, and less than 50% identity (as
calculated
using methods known in the art and described herein) to a polypeptide of the
present invention are also included in the present invention. Further included
in
the present invention are antibodies that bind polypeptides encoded by
polynucleotides which hybridize to a polynucleotide of the present invention
under
stringent hybridization conditions (as described herein). Antibodies ofthe
present
invention may also be described or specified in terms of their binding
affinity to a
polypeptide of the invention. Preferred binding affinities include those with
a
dissociation constant orKd less than 5X10-zM, 10-2M, 5X10-3M, 10-3M, SX10-4M,
10-4M, 5 X 10-SM, 10-5M, S X 10-6M, 10-~M, 5 X 10-'M, 10-'M, 5 X 10-8M, 10-$M,
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-115-
SX10-9M, 10-9M, SX10-'°M, 10-'°M, SX10-"M, 10-"M, SX10-'zM,
10-'2M,
SX10-'3M, 10-'3M, SX10-'4M, 10~'4M, SX10-'SM, and 10-'SM.
The invention also provides antibodies that competitively inhibit binding
of an antibody to an epitope of the invention as determined by any method
known
in the art for determining competitive binding, for example, the immunoassays
described herein. In preferred embodiments, the antibody competitively
inhibits
binding to the epitope by at least 90%, at least 80%, at least 70%, at least
60%,
or at least 50%.
Antibodies of the present invention may act as agonists or antagonists of
the polypeptides of the present invention. For example, the present invention
includes antibodies which disrupt the receptor/ligand interactions with the
polypeptides of the invention either partially or fully. The invention
features both
receptor-specific antibodies and ligand-specific antibodies. The invention
also
features receptor-specific antibodies which do not prevent ligand binding but
prevent receptor activation. Receptor activation (i.e., signaling) may be
determined by techniques described herein or otherwise known in the art. For
example, receptor activation can be determined by detecting the
phosphorylation
(e.g., tyrosine or serine/threonine) of the receptor or its substrate by
immunoprecipitation followed by western blot analysis (for example, as
described
supra). In specific embodiments, antibodies are provided that inhibit ligand
or
receptor activity by at least 90%, at least 80%, at least 70%, at least 60%,
or at
least 50% of the activity in absence of the antibody.
The invention also features receptor-specific antibodies which both prevent
ligand binding and receptor activation as well as antibodies that recognize
the
receptor-ligand complex, and, preferably, do not specifically recognize the
unbound receptor or the unbound ligand. Likewise, included in the invention
are
neutralizing antibodies which bind the ligand and prevent binding of the
ligand to
the receptor, as well as antibodies which bind the ligand, thereby preventing
receptor activation, but do not prevent the ligand from binding the receptor.
Further included in the invention are antibodies which activate the receptor.
These antibodies may act as receptor agonists, i. e., potentiate or activate
either all
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-116-
or a subset of the biological activities of the ligand-mediated receptor
activation.
The antibodies may be specified as agonists, antagonists or inverse agonists
for
biological activities comprising the specific biological activities of the
peptides of
the invention disclosed herein. Thus, the invention further relates to
antibodies
which act as agonists or antagonists of the polypeptides of the present
invention.
The above antibody agonists can be made using methods known in the art. See,
e.g., PCT publication WO 96/40281; U.S. Patent No. 5,811,097; Deng et al.,
Blood 92(6):1981-1988 (1998); Chen et al., Cancer Res. 58(16):3668-3678
(1998); Harrop et al., J. Immunol. 161(4):1786-1794 (1998); Zhu etal., Cancer
Res. 58(15):3209-3214 (1998); Yoon et al., J. Immunol. 160(7):3170-3179
(1998); Prat et al., .I. Cell. Sci. lll(Pt2):237-247 (1998); Pitard et al.,
.l.
Immunol. Methods205(2):177-190 (1997); Liautard etal., Cytokine 9(4):233-241
(1997); Carlson et al., J. Biol. Chem. 272(17):11295-11301 (1997); Taryman et
al., Neuron 14(4):755-762 (1995); Muller et al.., Structure 6(9):1153-1167
(1998); Bartunek et al., Cytokine 8(1):14-20 (1996) (which are all
incorporated
by reference herein in their entireties).
Antibodies of the present invention may be used, for example, but not
limited to, to purify, detect, and target the polypeptides of the present
invention,
including both in vitro and in vivo diagnostic and therapeutic methods. For
example, the antibodies have use in immunoassays for qualitatively and
quantitatively measuring levels of the polypeptides of the present invention
in
biological samples. See, e.g., Harlow et al., Antibodies: A Laboratory Manual,
(Cold Spring Harbor Laboratory Press, 2nd ed. 1988) (incorporated by reference
herein in its entirety).
As discussed in more detail below, the antibodies of the present invention
may be used either alone or in combination with other compositions. The
antibodies may further be recombinantly fused to a heterologous polypeptide at
the N- or C-terminus or chemically conjugated (including covalently and
non-covalently conjugations) to polypeptides or other compositions. For
example,
antibodies of the present invention may be recombinantly fused or conjugated
to
molecules useful as labels in detection assays and effector molecules such as
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-117-
heterologous polypeptides, drugs, or toxins. See, e.g., PCT publications WO
92/08495; WO 91/14438; WO 89/12624; U.S. Patent No. 5,314,995; and EP
396,387.
The antibodies ofthe invention include derivatives that are modified, i.e,
by the covalent attachment of any type of molecule to the antibody such that
covalent attachment does not prevent the antibody from generating an
anti-idiotypic response. For example, but not by way of limitation, the
antibody
derivatives include antibodies that have been modified, e.g., by
glycosylation,
acetylation, pegylation, phosphorylation, amidation, derivatization by known
protecting/blocking groups, proteolytic cleavage, linkage to a cellular ligand
or
other protein, etc. Any of numerous chemical modifications may be carried out
by known techniques, including, but not limited to specific chemical cleavage,
acetylation, formylation, metabolic synthesis oftunicamycin, etc.
Additionally, the
derivative may contain one or more non-classical amino acids.
The antibodies of the present invention may be generated by any suitable
method known in the art. Polyclonal antibodies to an antigen of interest can
be
produced by various procedures well known in the art. For example, a
polypeptide ofthe invention can be administered to various host animals
including,
but not limited to, rabbits, mice, rats, etc. to induce the production of sera
containing polyclonal antibodies specific for the antigen. Various adjuvants
may
be used to increase the immunological response, depending on the host species,
and include but are not limited to, Freund's (complete and incomplete),
mineral
gels such as aluminum hydroxide, surface active substances such as
lysolecithin,
pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet
hemocyanins,
dinitrophenol, and potentially useful human adjuvants such as BCG (bacille
Calmette-Guerin) and Corynebacterium parvum. Such adjuvants are also well
known in the art.
Monoclonal antibodies can be prepared using a wide variety oftechniques
known in the art including the use of hybridoma, recombinant, and phage
display
technologies, or a combination thereof. For example, monoclonal antibodies can
be produced using hybridoma techniques including those known in the art and
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-118-
taught, for example, in Harlow et al z Antibodies: A Laboratory Manual, (Cold
Spring Harbor Laboratory Press; ~nd ed. 1988); Hammerling et al., in:
Monoclonal Antibodies and T-Cell Hybridomas 563-681 (Elsevier, N.Y., 1981)
(said references incorporated by reference in their entireties). The term
"monoclonal antibody" as used herein is not limited to antibodies produced
through hybridoma technology. The term "monoclonal antibody" refers to an
antibody that is derived from a single clone, including any eukaryotic,
prokaryotic,
or phage clone, and not the method by which it is produced. Thus, the term
"monoclonal antibody" is not limited to antibodies produced through hybridoma
technology. Monoclonal antibodies can be prepared using a wide variety of
techniques known in the art including the use of hybridoma and recombinant and
phage display technology.
Methods for producing and screening for specific antibodies using
hybridoma technology are routine and well-known in the art and are discussed
in
detail in Example 8. Briefly, mice can be immunized with a polypeptide of the
invention or a cell expressing such peptide. Once an immune response is
detected,
e.g., antibodies specific for the antigen are detected in the mouse serum, the
mouse spleen is harvested and splenocytes isolated. The splenocytes are then
fused by well-known techniques to any suitable myeloma cells, for example
cells
from cell line SP20 available from the ATCC. Hybridomas are selected and
cloned by limited dilution. The hybridoma clones are then assayed by methods
known in the art for cells that secrete antibodies capable of binding a
polypeptide
of the invention. Ascites fluid, which generally contains high levels of
antibodies,
can be generated by immunizing mice with positive hybridoma clones.
Accordingly, the present invention provides methods of generating
monoclonal antibodies as well as antibodies produced by the method comprising
culturing a hybridoma cell secreting an antibody of the invention wherein,
preferably, the hybridoma is generated by fusing splenocytes isolated from a
mouse immunized with an antigen of the invention with myeloma cells and then
screening the hybridomas resulting from the fusion for hybridoma clones that
secrete an antibody able to bind a polypeptide of the invention.
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-119-
Antibody fragments that recognize specific epitopes may be generated by
known techniques. For example, Fab and F(ab')2 fragments of the invention may
be produced by proteolytic cleavage ofimmunoglobulin molecules, using enzymes
such as papain (to produce Fab fragments) or pepsin (to produce F(ab')2
fragments). F(ab')2 fragments contain the variable region, the light chain
constant
region and the CH1 domain of the heavy chain.
For example, the antibodies of the present invention can also be generated
using various phage display methods known in the art. In phage display
methods,
functional antibody domains are displayed on the surface ofphage particles
which
carry the polynucleotide sequences encoding them. In a particular, such phage
can
be utilized to display antigen-binding domains expressed from a repertoire or
combinatorial antibody library (e.g., human or murine). Phage expressing an
antigen binding domain that binds the antigen of interest can be selected or
identified with antigen, e.g., using labeled antigen or antigen bound or
captured
to a solid surface or bead. Phage used in these methods are typically
filamentous
phage including fd and M13 binding domains expressed from phage with Fab, Fv
or disulfide stabilized Fv antibody domains recombinantly fused to either the
phage gene III or gene VIII protein. Examples of phage display methods that
can
be used to make the antibodies of the present invention include those
disclosed in
Brinkman et al., J. Immunol. Methods 182:41-50 (1995); Ames et al., J.
Immunol. Methods 184:177-186 (1995); Kettleborough et al., Eur. J. Immunol.
24:952-958 (1994); Persic et al., Gene 187:9-18 (1997); Burton et al.,
Advances
in Immunology57:191-280 (1994); PCT application No. PCT/GB91/01134; PCT
publications WO 90/02809; WO 91/10737; WO 92/01047; WO 92/18619; WO
93/11236; WO 95/15982; WO 95/20401; and U.S. Patent Nos. 5,698,426;
5,223,409; 5,403,484; 5,580,717; 5,427,908; 5,750,753; 5,821,047; 5,571,698;
5,427,908; 5,516,637; 5,780,225; 5,658,727; 5,733,743 and 5,969,108; each of
which is incorporated herein by reference in its entirety.
As described in the above references, after phage selection, the antibody
coding regions from the phage can be isolated and used to generate whole
antibodies, including human antibodies, or any other desired antigen binding
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-120-
fragment, and expressed in any desired host, including mammalian cells, insect
cells, plant cells, yeast, and bacteria, e.g., as described in detail below.
For
example, techniques to recombinantly produce Fab, Fab' and F(ab')2 fragments
can also be employed using methods known in the art such as those disclosed in
PCT publication WO 92/22324; Mullinax et al., BioTechniques 12(6):864-869
(1992); and Sawai et ad., AJRI 34:26-34 (1995); and Better et al., Science
240:1041-1043 (1988) (said references incorporated by reference in their
entireties).
Examples of techniques which can be used to produce single-chain Fvs and
antibodies include those described in U.S. Patents 4,946,778 and 5,258,498;
Huston et al., Methods in Enzymology 203:46-88 (1991); Shu et al., PNAS
90:7995-7999 (1993); and Skerra et al., Science 240:1038-1040 (1988). For
some uses, including in vivo use of antibodies in humans and in vitro
detection
assays, it may be preferable to use chimeric, humanized, or human antibodies.
A
chimeric antibody is a molecule in which different portions of the antibody
are
derived from different animal species; such as antibodies having a variable
region
derived from a murine monoclonal antibody and a human .immunoglobulin
constant region. Methods for producing chimeric antibodies are known in the
art.
See, e.g., Morrison, Science 229:1202 (1985); Oi et al., BioTechniques 4:214
(1986); Gillies etal., (1989) J. Immunol. Methods 125:191-202; U.S. PatentNos.
5,807,715; 4,816,567; and 4,816397, which are incorporated herein by reference
in their entireties. Humanized antibodies are antibody molecules from non-
human
species antibody that binds the desired antigen having one or more
complementarity determining regions (CDRs) from the non-human species and
framework regions from a human immunoglobulin molecule. Often, framework
residues in the human framework regions will be substituted with the
corresponding residue from the CDR donor antibody to alter, preferably
improve,
antigen binding. These framework substitutions are identified by methods well
known in the art, e.g., by modeling ofthe interactions ofthe CDR and framework
residues to identify framework residues important for antigen binding and
sequence comparison to identify unusual framework residues at particular
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-121-
positions. (See, e.g., Queen et al., U. S. Patent No. 5,585,089; Riechmann et
al.,
Nature 332:323 (1988), which are incorporated herein by reference in their
entireties.) Antibodies can be humanized using a variety of techniques known
in
the art including, for example, CDR-grafting (EP 239,400; PCT publication WO
91/09967; U.S. Patent Nos. 5,225,539; 5,530,101; and 5,585,089), veneering or
resurfacing (EP 592,106; EP 519,596; Padlan, Molecular Immunology
28(4/5):489-498 (1991); Studnicka et al., Protein Engineering 7(6):805-814
(1994); Roguska. et al., PNAS 91:969-973 (1994)), and chain shuffling (U.S.
Patent No. 5,565,332).
Completely human antibodies. are particularly desirable for therapeutic
treatment of human patients. Human antibodies can be made by a variety of
methods known in the art including phage display methods described above using
antibody libraries derived from human immunoglobulin sequences. See also, U.
S.
Patent Nos. 4,444,887 and 4,716,111; and PCT publications WO 98/46645, WO
98/50433, WO 98/24893, WO 98/16654, WO 96/34096, WO 96/33735, and WO
91/10741; each of which is incorporated herein by reference in its entirety.
Human antibodies can also be produced using transgenic mice which are
incapable of expressing functional endogenous immunoglobulins, but which can
express human immunoglobulin genes. For example, the human heavy and light
chain immunoglobulin gene complexes may be introduced randomly or by
homologous recombination into mouse embryonic stem cells. Alternatively, the
human variable region, constant region, and diversity region may be introduced
into mouse embryonic stem cells in addition to the human heavy and light chain
genes. The mouse heavy and light chain immunoglobulin genes may be rendered
non-functional separately or simultaneously with the introduction of human
immunoglobulin loci by homologous recombination. In particular, homozygous
deletion of the JH region prevents endogenous antibody production. The
modified embryonic stem cells are expanded and microinjected into blastocysts
to
produce chimeric mice. The chimeric mice are then bred to produce homozygous
offspring that express human antibodies. The transgenic mice are immunized in
the normal fashion with a selected antigen, e.g., all or a portion of a
polypeptide
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-122-
of the invention. Monoclonal antibodies directed against the antigen can be
obtained from the immunized, transgenic mice using conventional hybridoma
technology. The human immunoglobulin transgenes harbored by the transgenic
mice rearrange during B cell differentiation, and subsequently undergo class
switching and somatic mutation. Thus, using such a technique, it is possible
to
produce therapeutically useful IgG, IgA, IgM and IgE antibodies. For an
overview of this technology for producing human antibodies, see Lonberg and
Huszar (1995, Int. Rev. Immunol. 13:65-93). For a detailed discussion of this
technology for producing human antibodies and human monoclonal antibodies and
protocols for producing such antibodies, see, e.g., PCT publications WO
98/24893; WO 96/34096; WO 96/33735; U. S. PatentNos. 5,413,923; 5,625,126;
5,633,425; 5,569,825; 5,661,016; 5,545,806; 5,814,318; and 5,939,598, which
are
incorporated by reference herein in their entirety. In addition, companies
such as
Abgenix, Inc. (Freemont, CA) and GenPharm (San Jose, CA) can be engaged to
provide human antibodies directed against a selected antigen using technology
similar to that described above.
Completely human antibodies which recognize a selected epitope can be
generated using a technique referred to as "guided selection." In this
approach a
selected non-human monoclonal antibody, e.g., a mouse antibody, is used to
guide
the selection of a completely human antibody recognizing the same epitope.
(Jespers et al., Bioltechnology 12:899-903 (1988)).
Further, antibodies to the polypeptides of the invention can, in turn, be
utilized to generate anti-idiotype antibodies that "mimic" polypeptides of the
invention using techniques well known to those skilled in the art. (See, e.g.,
Greenspan & Bona, FASEB.I. 7(5):437-444 (1989) and Nissinoff, J. Immunol.
147(8):2429-2438 (1991)). For example, antibodies which bind to and
competitively inhibit polypeptide multimerization and/or binding of a
polypeptide
of the invention to a ligand can be used to generate anti-idiotypes that
"mimic" the
polypeptide multimerization and/or binding domain and, as a consequence, bind
to and neutralize polypeptide and/or its ligand. Such neutralizing anti-
idiotypes
or Fab fragments of such anti-idiotypes can be used in therapeutic regimens to
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-123-
neutralize polypeptide ligand. For example, such anti-idiotypic antibodies can
be
used to bind a polypeptide of the invention and/or to bind its
ligands/receptors,
and thereby block its biological activity.
A. Polynucleotides Encoding Antibodies.
The invention further provides polynucleotides comprising a nucleotide
sequence encoding an antibody of the invention and fragments thereof. The
invention also encompasses polynucleotides that hybridize under stringent or
lower stringency hybridization conditions, e.g., as defined supra, to
polynucleotides that encode an antibody, preferably, that specifically binds
to a
polypeptide of the invention, preferably, an antibody that binds to a
polypeptide
having the amino acid sequence of SEQ ID N0:2 or 4.
The polynucleotides may be obtained, and the nucleotide sequence of the
polynucleotides determined, by any method known in the art. For example, if
the
nucleotide sequence of the antibody is known, a polynucleotide encoding the
antibody may be assembled from chemically synthesized oligonucleotides (e.g.,
as described in Kutmeier et al., BioTechniques 17:242 (1994)), which, briefly,
involves the synthesis of overlapping oligonucleotides containing portions of
the
sequence encoding the antibody, annealing and ligation of those
oligonucleotides,
and then amplification of the ligated oligonucleotides by PCR.
Alternatively, a polynucleotide encoding an antibody may be generated
from nucleic acid from a suitable source. If a clone containing a nucleic acid
encoding a particular antibody is not available, but the sequence of the
antibody
molecule is known, a nucleic acid encoding the immunoglobulin may be obtained
from a suitable source (e.g., an antibody cDNA library, or a cDNA library
generated from, or nucleic acid, preferably poly A+ RNA, isolated from, any
tissue or cells expressing the antibody, such as hybridoma cells selected to
express
an antibody of the invention) by PCR amplification using synthetic primers
hybridizable to the 3' and 5' ends of the sequence or by cloning using an
oligonucleotide probe specific for the particular gene sequence to identify,
e.g.,
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-124-
a cDNA clone from a cDNA library that encodes the antibody. Amplified nucleic
acids generated by PCR may then be cloned into replicable cloning vectors
using
any method well known in the art.
Once the nucleotide sequence and corresponding amino acid sequence of
the antibody is determined, the nucleotide sequence of the antibody may be
manipulated using methods well known in the art for the manipulation of .
nucleotide sequences, e.g., recombinant DNA techniques, site directed
mutagenesis, PCR, etc. (see, for example, the techniques described in Sambrook
et al., 1990, Molecular Cloning, A Laboratory Manual, 2d Ed., Cold Spring
Harbor Laboratory, Cold Spring Harbor, NY and Ausubel et al., eds., 1998,
Current Protocols in Molecular Biology, John Wiley & Sons, NY, which are both
incorporated by reference herein in their entireties), to generate antibodies
having
a different amino acid sequence, for example to create amino acid
substitutions,
deletions, and/or insertions.
In a specific embodiment, the amino acid sequence of the heavy and/or
light chain variable domains may be inspected to identify the sequences of the
complementarity determining regions (CDRs) by methods that are well know in
the art, e.g., by comparison to known amino acid sequences of other heavy and
light chain variable regions to determine the regions of sequence
hypervariability.
Using routine recombinant DNA techniques, one or more of the CDRs may be
inserted within framework regions, e.g., into human framework regions to
humanize a non-human antibody, as described supra. The framework regions may
be naturally occurring or consensus framework regions, and preferably human
framework regions (see, e.g., Chothia et al., J. Mol. Biol. 278:457-479 (1998)
for
a listing of human framework regions). Preferably, the polynucleotide
generated
by the combination of the framework regions and CDRs encodes an antibody that
specifically binds a polypeptide of the invention. Preferably, as discussed
.supra,
one or more amino acid substitutions may be made within the framework regions,
and, preferably, the amino acid substitutions improve binding of the antibody
to
its antigen. Additionally, such methods may be used to make amino acid
substitutions or deletions of one or more variable region cysteine residues
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-125-
participating in an intrachain disulfide bond to generate antibody molecules
lacking
one or more intrachain disulfide bonds. Other alterations to the
polynucleotide are
encompassed by the present invention and within the skill of the art.
In addition, techniques developed for the production of "chimeric
antibodies" (Morrison et al., 1984, Proc. Natl. Acad. Sci. 81:851-855;
Neuberger
et al., 1984, Nature 312:604-608; Takeda et al., 1985, Nature 314:452-454) by
splicing genes from a mouse antibody molecule of appropriate antigen
specificity
together with genes from a human antibody molecule of appropriate biological
activity can be used. As described supra, a chimeric antibody is a molecule in
which different portions are derived from different animal species, such as
those
having a variable region derived from a murine mAb and a human immunoglobulin
constant region, e.g., humanized antibodies.
Alternatively, techniques described for the production of single chain
antibodies (U.S. Patent No. 4,694,778; Bird, 1988, Science 242:423-42; Huston
et al., 1988, Proc. Natl. Acad. Sci. USA 85:5879-5883; and Ward et al., 1989,
Nature 334:544-554) can be adapted to produce single chain antibodies. Single
chain antibodies are formed by linking the heavy and light chain fragments of
the
Fv region via an amino acid bridge, resulting in a single chain polypeptide.
Techniques for the assembly of functional Fv fragments in E. coli may also be
used (Skerra et al., 1988, Science 242:1038- 1041).
B. Methods of Producing Antibodies
The antibodies of the invention can be produced by any method known in
the art for the synthesis of antibodies, in particular, by chemical synthesis
or
preferably, by recombinant expression techniques.
Recombinant expression of an antibody of the invention, or fragment,
derivative or analog thereof, e.g., a heavy or light chain of an antibody of
the
invention, requires construction of an expression vector containing a
polynucleotide that encodes the antibody. Once a polynucleotide encoding an
antibody molecule or a heavy or light chain of an antibody, or portion thereof
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-126-
(preferably containing the heavy or light chain variable domain), of the
invention
has been obtained, the vector for the production of the antibody molecule may
be
produced by recombinant DNA technology using techniques well known in the
art. Thus, methods for preparing a protein by expressing a polynucleotide
containing an antibody encoding nucleotide sequence are described herein.
Methods which are well known to those skilled in the art can be used to
construct
expression vectors containing antibody coding sequences and appropriate
transcriptional and translational control signals. These methods include, for
example, in vitro recombinant DNA techniques, synthetic techniques, and in
vivo
genetic recombination. The invention, thus, provides replicable vectors
comprising a nucleotide sequence encoding an antibody molecule of the
invention,
or a heavy or light chain thereof, or a heavy or light chain variable domain,
operably linked to a promoter. Such vectors may include the nucleotide
sequence
encoding the constant region ofthe antibody molecule (see, e.g., PCT
Publication
WO 86/05807; PCT Publication WO 89/01036; and U.S. Patent No. 5,122,464)
and the variable domain of the antibody may be cloned into such a vector for
expression of the entire heavy or light chain.
The expression vector is transferred to a host cell by conventional
techniques and the transfected cells are then cultured by conventional
techniques
to produce an antibody of the invention. Thus, the invention includes host
cells
containing a polynucleotide encoding an antibody of the invention, or a heavy
or
light chain thereof, operably linked to a heterologous promoter. In preferred
embodiments for the expression of double-chained antibodies, vectors encoding
both the heavy and light chains may be co-expressed in the host cell for
expression
of the entire immunoglobulin molecule, as detailed below.
A variety of host-expression vector systems may be utilized to express the
antibody molecules of the invention. Such host-expression systems represent
vehicles by which the coding sequences of interest may be produced and
subsequently purified, but also represent cells which may, when transformed or
transfected with the appropriate nucleotide coding sequences, express an
antibody
molecule of the invention in situ. These include but are not limited to
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-127-
microorganisms such as bacteria (e.g., E. coli, B. subtilis) transformed with
recombinant bacteriophage DNA, plasmid DNA or cosmid DNA expression
vectors containing antibody coding sequences; yeast (e.g., Saccharomyces,
Pichia) transformed with recombinant yeast expression vectors containing
antibody coding sequences; insect cell systems infected with recombinant virus
expressionvectors (e.g., baculovirus) containing antibody coding sequences;
plant
cell systems infected with recombinant virus expression vectors (e.g.,
cauliflower
mosaic virus, CaNIV; tobacco mosaic virus, TMV) or transformed with
recombinant plasmid expression vectors (e.g., Ti plasmid) containing antibody
coding sequences; or mammalian cell systems (e.g., COS, CHO, BHK, 293, 3T3
cells) harboring recombinant expression constructs containing promoters
derived
from the genome of mammalian cells (e.g., metallothionein promoter) or from
mammalian viruses (e.g., the adenovirus late promoter; the vaccinia virus 7.5K
promoter). Preferably, bacterial cells such as Escherichia coli, and more
preferably, eukaryotic cells, especially for the expression of whole
recombinant
antibody molecule, are used for the expression of a recombinant antibody
molecule. For example, mammalian cells such as Chinese hamster ovary cells
(CHO), in conjunction with a vector such as the major intermediate early gene
promoter element from human cytomegalovirus is an effective expression system
for antibodies (Foecking et ad., 1986, Gene 45:101; Cockett et al., 1990,
BiolTechnology 8:2).
In bacterial systems, a number of expression vectors may be
advantageously selected depending upon the use intended for the antibody
molecule being expressed. For example, when a large quantity of such a protein
is to be produced, for the generation of pharmaceutical compositions of an
antibody molecule, vectors which direct the expression of high levels of
fusion
protein products that are readily purified may be desirable. Such vectors
include,
but are not limited, to the E. coli expression vector pUR278 (Ruther et al.,
1983,
EMBO J. 2:1791), in which the antibody coding sequence may be ligated
individually into the vector in frame with the lac Z coding region so that a
fusion
protein is produced; pIN vectors (Inouye & Inouye, 1985, Nucleic Acids Re.s.
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-128-
13:3101-3109; Van Heeke & Schuster, 1989, J Biol. Chem. 24:5503-5509); and
the like. pGEX vectors may also be used to express foreign polypeptides as
fusion
proteins with glutathione S-transferase (GST). In general, such fusion
proteins
are soluble and can easily be purified from lysed cells by adsorption and
binding
to a matrix glutathione-agarose beads followed by elution in the presence of
free
glutathione. The pGEX vectors are designed to include thrombin or factor Xa
protease cleavage sites so that the cloned target gene product can be released
from the GST moiety.
In an insect system, Autographs californica nuclear polyhedrosis virus
(AcNPV) is used as a vector to express foreign genes. The virus grows in
Spodoptera frugiperda cells. The antibody coding sequence may be cloned
individually into non-essential regions (for example the polyhedrin gene) of
the
virus and placed under control of an AcNPV promoter (for example the
polyhedrin promoter).
In mammalian host cells, a number of viral-based expression systems may
be utilized. In cases where an adenovirus is used as an expression vector, the
antibody coding sequence of interest may be ligated to an adenovirus
transcription/translation control complex, e.g., the late promoter and
tripartite
leader sequence. This chimeric gene may then be inserted in the adenovirus
genome by in vitro or in vivo recombination. Insertion in a non- essential
region
of the viral genome (e.g., region El or E3) will result in a recombinant virus
that
is viable and capable of expressing the antibody molecule in infected hosts.
(e.g.,
see Logan & Shenk, 1984, Proc. Natl. Acad. Sci. USA 81:355-359). Specific
initiation signals may also be required for efficient translation of inserted
antibody
coding sequences. These signals include the ATG initiation codon and adjacent
sequences. Furthermore, the initiation codon must be in phase with the reading
frame of the desired coding sequence to ensure translation of the entire
insert.
These exogenous translational control signals and initiation codons can be of
a
variety of origins, both natural and synthetic. The efficiency of expression
may be
enhanced by the inclusion of appropriate transcription enhancer elements,
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-129-
transcription terminators, etc. (see Bittner et al.,1987, Methods inEnzynZOl.
153: 51-544).
In addition, a host cell strain may be chosen which modulates the
expression of the inserted sequences, or modifies and processes the gene
product
in the specific fashion desired. Such modifications (e.g., glycosylation) and
processing (e.g., cleavage) of protein products may be important for the
function
of the protein. DifFerent host cells have characteristic and specific
mechanisms for
the post-translational processing and modification of proteins and gene
products.
Appropriate cell lines or host systems can be chosen to ensure the correct
modification and processing of the foreign protein expressed. To this end,
eukaryotic host cells which possess the cellular machinery for proper
processing
of the primary transcript, glycosylation, and phosphorylation of the gene
product
may be used. Such mammalian host cells include but are not limited to CHO,
VERY, BHK, Hela, COS, MDCK, 293, 3T3, WI38, and in particular, breast
cancer cell lines such as, for example, BT483, Hs578T, HTB2, BT20 and T47D,
and normal mammary gland cell line such as, for example, CRL7030 and
Hs578Bst.
For long-term, high-yield production of recombinant proteins, stable
expression is preferred. For example, cell lines which stably express the
antibody
molecule may be engineered. Rather than using expression vectors which contain
viral origins of replication, host cells can be transformed with DNA
controlled by
appropriate expression control elements (e.g., promoter, enhancer, sequences,
transcription terminators, polyadenylation sites, etc.), and a selectable
marker.
Following the introduction of the foreign DNA, engineered cells may be allowed
to grow for 1-2 days in an enriched media, and then are switched to a
selective
media. The selectable marker in the recombinant plasmid confers resistance to
the
selection and allows cells to stably integrate the plasmid into their
chromosomes
and grow to form foci which in turn can be cloned and expanded into cell
lines.
This method may advantageously be used to engineer cell lines which express
the
antibody molecule. Such engineered cell lines may be particularly useful in
screening and evaluation of compounds that interact directly or indirectly
with the
antibody molecule.
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-130-
A number of selection systems may be used, including but not limited to
the herpes simplex virus thymidine kinase (Wigler et al., 1977, Cell 11:223),
hypoxanthine-guanine phosphoribosyltransferase (Szybalska & Szybalski, 192,
Proc. Natl. Acad. Sci. USA 48:202), and adenine phosphoribosyltransferase
(Lowy et al., 1980, Cell 22:817) genes can be employed in tk-, hgprt- or aprt-
cells, respectively. Also, antimetabolite resistance can be used as the basis
of
selection for the following genes: dhfr, which confers resistance to
methotrexate
(Wigler et al., 1980, Natl. Acad. Sci. USA 77:357; O'Hare et al.., 1981, Proc.
Natl. Acad. Sci. USA 78:1527); gpt, which confers resistance to mycophenolic
acid (Mulligan & Berg, 1981, Proc. Natl. Acad. Sci. USA 78:2072); neo, which
confers resistance to the aminoglycoside G-418 Clinical Pharmacy 12:488-505;
Wu and Wu, 1991, Biotherapy 3:87-95; Tolstoshev, 1993, Ann. Rev. Pharmacol.
Toxicol. 32:573-596; Mulligan, 1993, Science 260:926-932; and Morgan and
Anderson, 1993, Ann. Rev. Biochem. 62:191-217; May, 1993, TIB TECH
11(5):155-215); and hygro, which confers resistance to hygromycin (Santerre et
al., 1984, Gene 30:147). Methods commonly known in the art of recombinant
DNA technology which can be used are described in Ausubel et al. (eds.), 1993,
Current Protocols in Molecular Biology, John Wiley & Sons, NY; Kriegler, 1990,
Gene Transfer and Expression, A Laboratory Manual, Stockton Press, NY; and
in Chapters 12 and 13, Dracopoli et al. (eds), 1994, Current Protocols in
Human
Genetics, John Wiley & Sons, NY.; Colberre-Garapin et al., 1981, J. Mol. Biol.
150:1, which are incorporated by reference herein in their entireties.
The expression levels of an antibody molecule can be increased by vector
amplification (for a review, see Bebbington and Hentschel, The use of vectors
based on gene amplification for the expression of cloned genes in mammalian
cells
in DNA cloning, Vol. 3. (Academic Press, New York, 1987)). When a marker in
the vector system expressing antibody is amplifiable, increase in the level of
inhibitor present in culture of host cell will increase the number of copies
of the
marker gene. Since the amplified region is associated with the antibody gene,
production ofthe antibody will also increase (Grouse et al., 1983, Mol. Cell.
Biol.
3:257).
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-131-
The host cell may be co-transfected with two expression vectors of the
invention, the first vector encoding a heavy chain derived polypeptide and the
second vector encoding a light chain derived polypeptide. The two vectors may
contain identical selectable markers which enable equal expression of heavy
and
light chain polypeptides. Alternatively, a single vector may be used which
encodes
both heavy and light chain polypeptides. In such situations, the light chain
should
be placed before the heavy chain to avoid an excess of toxic free heavy chain
(Proudfoot, 1986, Nature 322:52; Kohler, 1980, Proc. Natl. Acad Sci. USA
77:2197). The coding sequences for the heavy and light chains may comprise
cDNA or genomic DNA.
Once an antibody molecule of the invention has been recombinantly
expressed, it may be purified by any method known in the art for purification
of
an immunoglobulin molecule, for example, by chromatography (e.g., ion
exchange, affinity, particularly by affinity for the specific antigen after
Protein A,
and sizing column chromatography), centrifugation, differential solubility, or
by
any other standard technique for the purification of proteins.
C. Antibody Conjugates
The present invention encompasses antibodies recombinantly fused or
chemically conjugated (including both covalently and non-covalently
conjugations)
to a polypeptide (or portion thereof, preferably at least 10, 20 or 50 amino
acids
of the polypeptide) of the present invention to generate fusion proteins. The
fusion does not necessarily need to be direct, but may occur through linker
sequences. The antibodies may be specific for antigens other than polypeptides
(or portion thereof, preferably at least 10, 20 or SO amino acids of the
polypeptide) of the present invention. For example, antibodies may be used to
target the polypeptides of the present invention to particular cell types,
either in
vitro or in vivo, by fusing or conjugating the polypeptides of the present
invention
to antibodies specific for particular cell surface receptors. Antibodies fused
or
conjugated to the polypeptides of the present invention may also be used in in
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-132-
vitro immunoassays and purification methods using methods known in the art.
See e.g., Harbor et al., .supra, and PCT publication WO 93/21232; EP 439,095;
Naramura et al., Immunol. Lett. 39:91-99 (1994); U.S. Patent 5,474,981;
Gillies
et al., PNAS 89:1428-1432 (1992); Fell et al., J. Immunol. 146:2446-2452
(1991), which are incorporated by reference in their entireties.
The present invention further includes compositions comprising the
polypeptides of the present invention fused or conjugated to antibody domains
other than the variable regions. For example, the polypeptides of the present
invention may be fused or conjugated to an antibody Fc region, or portion
thereof.
The antibody portion fused to a polypeptide of the present invention may
comprise
the constant region, hinge region, CH1 domain, CH2 domain, and CH3 domain
or any combination of whole domains or portions thereof. The polypeptides may
also be fused or conjugated to the above antibody portions to form multimers.
For example, Fc portions fused to the polypeptides of the present invention
can
form dimers through disulfide bonding between the Fc portions. Higher
multimeric forms can be made by fusing the polypeptides to portions of IgA and
IgM. Methods for fusing or conjugating the polypeptides ofthe present
invention
to antibody portions are known in the art. See, e.g., U.S. Patent Nos.
5,336,603;
5,622,929; 5,359,046; 5,349,053; 5,447,851; 5,112,946; EP 307,434; EP
367,166; PCT publications WO 96/04388; WO 91/06570; Ashkenazi etal., Proc.
Natl. Acad. Sci. USA 88:10535-10539 (1991); Zheng et al.; J. Immunol.
154:5590-5600 (1995); and Vil et al., Proc. Natl. Acad. Sci. USA 89:11337-
11341 ( 1992) (said references incorporated by reference in their entireties).
As discussed, .supra, the polypeptides of the present invention may be
fused or conjugated to the above antibody portions to increase the in vivo
half life
of the polypeptides or for use in immunoassays using methods known in the art.
Further, the polypeptides of the present invention may be fused or conjugated
to
the above antibody portions to facilitate purification. One reported example
describes chimeric proteins consisting of the first two domains of the human
CD4-polypeptide and various domains of the constant regions of the heavy or
light chains of mammalian immunoglobulins. (EP 394,827; Traunecker et al.,
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-133-
Nature 331:84-86 (1988). The polypeptides of the present invention fused or
conjugated to an antibody having disulfide- linked dimeric structures (due to
the
IgG) may also be more efficient in binding and neutralizing other-molecules,
than
the monomeric secreted protein or protein fragment alone. (Fountoulakis et
al.,
J. Biochem. 270:3958-3964 (1995)). In many cases, the Fc part in a fusion
protein is beneficial in therapy and diagnosis, and thus can result in, for
example,
improved pharmacokinetic properties. (EP A 232,262). Alternatively, deleting
the Fc part after the fusion protein has been expressed, detected, and
purified,
would be desired. For example, the Fc portion may hinder therapy and diagnosis
if the fusion protein is used as an antigen for immunizations. In drug
discovery,
for example, human proteins, such as hIL-5 receptor, have been fused with Fc
portions for the purpose of high-throughput screening assays to identify
antagonists of hIL-5. (See, D. Bennett et al., J. Molecular Recognition 8:52-
58
(1995); K. Johanson et al., J. Biol. Chem. 270:9459-9471 (1995).
Moreover, the antibodies or fragments thereofofthe present invention can
be fused to marker sequences, such as a peptide to facilitates their
purification.
In preferred embodiments, the marker amino acid sequence is a hexa-histidine
peptide, such as the tag provided in a pQE vector (QIAGEN, Inc., 9259 Eton
Avenue, Chatsworth, CA, 91311), among others, many ofwhich are commercially
available. As described in Gentz et al., Proc. Natl. Acad. Sci. USA 86:821-824
(1989), for instance, hexa-histidine provides for convenient purification of
the
fusion protein. Other peptide tags useful for purification include, but are
not
limited to, the "HA" tag, which corresponds to an epitope derived from the
influenza hemagglutinin protein (Wilson et al., Cell 37:767 ( 1984)) and the
"flag"
tag.
The present invention further encompasses antibodies or fragments thereof
conjugated to a diagnostic or therapeutic agent. The antibodies can be used
diagnostically to, for example, monitor the development or progression of a
tumor
as part of a clinical testing procedure to, e.g., determine the efficacy of a
given
treatment and/or prevention regimens. Detection can be facilitated by coupling
the antibody to a detectable substance. Examples of detectable substances
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-134-
include various enzymes, prosthetic groups, fluorescent materials, luminescent
materials, bioluminescent materials, radioactive materials, positron emitting
metals
using various positron emission tomographies, and nonradioactive paramagnetic
metal ions. See, for example, U.S. Patent No. 4,741,900 for metal ions which
can be conjugated to antibodies for use as diagnostics according to the
present
invention. Examples of suitable enzymes include horseradish peroxidase,
alkaline
phosphatase, (3-galactosidase, or acetylcholinesterase; examples of suitable
prosthetic group complexes include streptavidin/biotin and avidin/biotin;
examples
of suitable fluorescent materials include umbelliferone, fluorescein,
fluorescein
. isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl
chloride or
phycoerythrin; an example of a luminescent material includes luminol; examples
of bioluminescent materials include luciferase, luciferin, and aequorin; and
examples of suitable radioactive material include lzsl '3'I, "'In or 99Tc.
Further, an antibody or fragment thereof may be conjugated to a
therapeutic moiety such as a cytotoxin, e.g., a cytostatic or cytocidal agent,
a
therapeutic agent or a radioactive metal ion. A cytotoxin or cytotoxic agent
includes any agent that is detrimental to cells. Examples include paclitaxol,
cytochalasin B, gramicidin D, ethidium bromide, emetine, mitomycin, etoposide,
tenoposide, vincristine, vinblastine, colchicin, doxorubicin, daunorubicin,
dihydroxy anthracin dione, mitoxantrone, mithramycin, actinomycin D,
1-dehydrotestosterone, glucocorticoids, procaine, tetracaine, lidocaine,
propranolol, and puromycin and analogs or homologs thereof. Therapeutic agents
include, but are not limited to, antimetabolites (e.g., methotrexate,
6-mercaptopurine, 6-thioguanine, cytarabine, 5-fluorouracil decarbazine),
alkylating agents (e.g., mechlorethamine, thioepa chlorambucil, melphalan,
carmustine (BSNU) and lomustine (CCNU), cyclothosphamide, busulfan,
dibromomannitol, streptozotocin, mitomycin C, and cis-dichlorodiamine platinum
(II) (DDP) cisplatin), anthracyclines (e.g., daunorubicin (formerly
daunomycin)
and doxorubicin), antibiotics (e.g., dactinomycin (formerly actinomycin),
bleomycin, mithramycin, and anthramycin (AMC)), and anti-mitotic agents (e.g.,
vincristine and vinblastine).
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-135-
The conjugates of the invention can be used for modifying a given
biological response, the therapeutic agent or drug moiety is not to be
construed
as limited to classical chemical therapeutic agents. For example, the drug
moiety
may be a protein or polypeptide possessing a desired biological activity. Such
proteins may include, for example, a toxin such as abrin, xicin A, pseudomonas
exotoxin, or diphtheria toxin; a protein such as tumor necrosis factor, a-
interferon,
13-interferon, nerve growth factor, platelet derived growth factor, tissue
plasminogen activator, a thrombotic agent or an anti-angiogenic agent, e.g.,
angiostatin or endostatin; or, biological response modifiers such as, for
example,
lymphokines, interleukin-1 ("IL,-1 "), interleukin-2 ("IL,-2"), interleukin-6
("IL,-6"),
granulocyte macrophase colony stimulating factor ("GM-CSF"), granulocyte
colony stimulating factor ("G-CSF"), or other growth factors.
Antibodies may also be attached to solid supports, which are particularly
useful for immunoassays or purification of the target antigen. Such solid
supports
include, but are not limited to, glass, cellulose, polyacrylamide, nylon,
polystyrene,
polyvinyl chloride or polypropylene.
Techniques for conjugating such therapeutic moiety to antibodies are well
known, see, e.g., Arnon et al.., "Monoclonal Antibodies For Immunotargeting Of
Drugs In Cancer Therapy", in Monoclonal Antibodies And Cancer Therapy,
Reisfeld et al. (eds.), pp. 243-56 (Alan R. Liss, Inc. 1985); Hellstrom et
al.,
"Antibodies For Drug Delivery", in Controlled Drug Delivery (2nd Ed.),
Robinson
et al. (eds.), pp. 623-53 (Marcel Dekker, Inc. 1987); Thorpe, "Antibody
Carriers
Of Cytotoxic Agents In Cancer Therapy: A Review", in Monoclonal Antibodies
'84: Biological And Clinical Applications, Pinchera et al. (eds.), pp. 475-506
(1985); "Analysis, Results, And Future Prospective Of The Therapeutic Use Of
Radiolabeled Antibody In Cancer Therapy", in Monoclonal Antibodies For Cancer
Detection And Therapy, Baldwin et al. (eds.), pp. 303-16 (Academic Press
1985),
and Thorpe et al., "The Preparation And Cytotoxic Properties OfAntibody-Toxin
Conjugates", Immunol. Rev. 62:119-58 (1982).
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-136-
Alternatively, an antibody can be conjugated to a second antibody to form
an antibody heteroconjugate as described by Segal in U. S. Patent No.
4,676,980,
which is incorporated herein by reference in its entirety.
An antibody, with or without a therapeutic moiety conjugated to it,
administered alone or in combination with cytotoxic factors) and/or
cytokine(s)
can be used as a therapeutic.
D. Assays For Antibody Binding
The antibodies ofthe invention may be assayed for immunospecific binding
by any method known in the art. The immunoassays which can be used include
but are not limited to competitive and non-competitive assay systems using
techniques such as western blots, radioimmunoassays, ELISA (enzyme linked
immunosorbent assay), "sandwich" immunoassays, immunoprecipitation assays,
precipitin reactions, gel diffusion precipitin reactions, immunodiffusion
assays,
agglutination assays, complement-fixation assays, immunoradiometric assays,
fluorescent immunoassays, protein A immunoassays, to name but a few. Such
assays are routine and well known in the art (see, e.g., Ausubel et al., eds,
1994,
Current Protocols in Molecular Biology, Vol. 1, John Wiley & Sons, Inc., New
York, which is incorporated by reference herein in its entirety). Exemplary
immunoassays are described briefly below (but are not intended by way of
limitation).
Immunoprecipitation protocols generally comprise lysing a population of
cells in a lysis buffer such as RIPA buffer ( 1 % NP-40 or Triton X-100, 1 %
sodium
deoxycholate, 0.1% SDS, 0.15 M NaCI, 0.01 M sodium phosphate at pH 7.2, 1%
Trasylol) supplemented with protein phosphatase and/or protease inhibitors
(e.g.,
EDTA, PMSF, aprotinin, sodium vanadate), adding the antibody of interest to
the
cell lysate, incubating for a period of time (e.g., 1-4 hours) at 4° C,
adding protein
A and/or protein G sepharose beads to the cell lysate, incubating for about an
hour
or more at 4° C, washing the beads in lysis buffer and resuspending the
beads in
SDS/sample buffer. The ability of the antibody of interest to
immunoprecipitate
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-137-
a particular antigen can be assessed by, e.g., western blot analysis. One of
skill in
the art would be knowledgeable as to the parameters that can be modified to
increase the binding of the antibody to an antigen and decrease the background
(e.g., pre-clearing the cell lysate with sepharose beads). For further
discussion
regarding immunoprecipitation protocols see, e.g., Ausubel et al., eds, 1994,
Current Protocols in Molecular Biology, Vol. 1, John Wiley & Sons, Inc., New
York at 10.16.1.
Western blot analysis generally comprises preparing protein samples,
electrophoresis of the protein samples in a polyacrylamide gel (e.g., 8%-20%
SDS-PAGE depending on the molecular weight of the antigen), transferring the
protein sample from the polyacrylamide gel to a membrane such as
nitrocellulose,
PVDF or nylon, blocking the membrane in blocking solution (e.g., PBS with 3%
B SA or non-fat milk), washing the membrane in washing buffer (e.g. , PB S-
Tween
20), blocking the membrane with primary antibody (the antibody of interest)
diluted in blocking buffer, washing the membrane in washing buffer, blocking
the
membrane with a secondary antibody (which recognizes the primary antibody,
e.g., an anti-human antibody) conjugated to an enzymatic substrate (e.g.,
horseradish peroxidase or alkaline phosphatase) or radioactive molecule (e.g.,
3zP
or 'z5I) diluted in blocking buffer, washing the membrane in wash buffer, and
detecting the presence of the antigen. One of skill in the art would be
knowledgeable as to the parameters that can be modified to increase the signal
detected and to reduce the background noise. For further discussion regarding
western blot protocols see, e.g., Ausubel et al., eds, 1994, Current Protocols
in
Molecular Biology, Vol. 1, John Wiley & Sons, Inc., New York at 10.8.1.
ELISAs comprise preparing antigen, coating the well of a 96 well
microtiter plate with the antigen, adding the antibody of interest conjugated
to a
detectable compound such as an enzymatic substrate (e.g., horseradish
peroxidase
or alkaline phosphatase) to the well and incubating for a period of time, and
detecting the presence of the antigen. In ELISAs the antibody of interest does
not
have to be conjugated to a detectable compound; instead, a second antibody
(which recognizes the antibody of interest) conjugated to a detectable
compound
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-138-
may be added to the well. Further, instead of coating the well with the
antigen,
the antibody may be coated to the well. In this case, a second antibody
conjugated to a detectable compound may be added following the addition of the
antigen of interest to the coated well. One of skill in the art would be
knowledgeable as to the parameters that can be modified to increase the signal
detected as well as other variations of ELISAs known in the art. For further
discussion regarding ELISAs see, e.g., Ausubel et al., eds, 1994, Current
Protocols in Molecular Biology, Vol. 1, John Wiley & Sons, Inc., New York at
11.2.1.
The binding affinity of an antibody to an antigen and the off rate of an
antibody-antigen interaction can be determined by competitive binding assays.
One example of a competitive binding assay is a radioimmunoassay comprising
the
incubation of labeled antigen (e.g., 3H or'zsI) with the antibody of interest
in the
presence of increasing amounts of unlabeled antigen, and the detection of the
antibody bound to the labeled antigen. The affinity of the antibody of
interest for
a particular antigen and the binding off rates can be determined from the data
by
scatchard plot analysis. Competition with a second antibody can also be
determined using radioimmunoassays. In this case, the antigen is incubated
with
antibody of interest is conjugated to a labeled compound (e.g., 3H or'zsI) in
the
presence of increasing amounts of an unlabeled second antibody.
E. Antibody Based Therapies
The present invention is further directed to antibody-based therapies which
involve administering antibodies of the invention to an animal, preferably a
mammal, and most preferably a human, patient for treating and/or preventing
one
or more of the disorders or conditions described herein. Therapeutic compounds
of the invention include, but are not limited to, antibodies of the invention
(including fragments, analogs and derivatives thereof as described herein) and
nucleic acids encoding antibodies of the invention (including fragments,
analogs
and derivatives thereof as described herein).
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-139-
While not intending to be bound to theory, DR3 receptors are believed to
induce programmed cell death by the association/cross-linking of death domains
between different receptor molecules. Thus, agents (e.g., antibodies) which
prevent association/cross-linking of DR3 death domains will prevent DR3
mediated programmed cell death, and agents (e.g., antibodies) which induce
association/cross-linking of DR3 death domains will induce DR3 mediated
programmed cell death. Further, DR3 ligands (e.g., TNF-'y-~3) which induce DR3
mediated programmed cell death are believed to function by causing the
association/cross-linking of DR3 death domains.
As suggested above, DR3 receptors have been shown to bind TNF-y-(3
(see PCT Publication No. WO 00/08139, the entire disclosure of which is
incorporated herein by reference). DR3 receptors are also known to be present
in a number of tissues and on the surfaces of a number of cell types. These
tissues
and cell types include endothelial cells, liver cells, hepatocellular tumor,
lymph
nodes, Hodgkin's lymphoma, tonsil, bone marrow, spleen, heart, thymus,
pericardium, healing wound (skin), brain, pancreas tumor, burned skin, U937
cells, testis, colon cancer (metasticized to liver), pancreas, rejected
kidney,
adipose, ovary, olfactory epithelium, striatum depression, HeLa cells, LNCAP
(upon treatment with +30 nM androgen), HL1VEC (human umbilical vein
endothelial cells), 8 week embryo tissues, 9 week embryo tissues, fetal brain
tissues, fetal kidney tissues, fetal heart tissues, fetal thymus tissues,
fetal lung
tissues, fetal liver tissues, fetal spleen tissues, T-cell helper II,
activated T-cell (16
hr), activated T-cell (24 hr), primary dendritic cells, eosinophils,
monocytes, and
keratinocytes. Further, TNF-~-~3 has been shown to induce apoptosis, to have
anti-angiogenic activity, and to inhibit the growth of tumor cells in vivo.
Additionally, TNF-y-(3 activities are believed to be modulated, at least in
part,
through interaction with DR3 receptors.
Antibodies which act as both agonists and antagonists of receptor
functions are known in the art. For example, Deng et al., (Blood 92:1981-1988
( 1998)) describe a monoclonal antibody which binds to the human c-Mpl
receptor
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-140-
and stimulates megakaryocytopoiesis. The monoclonal antibody described in
Deng et al. is thus a c-Mpl receptor agonist.
Antibodies which bind to DR3 receptors will have varying effects on these
receptors. These effects differ based on the specific portions of the DR3
receptor
to which the antibodies bind and the three-dimensional conformation of the
antibody molecules themselves. Thus, antibodies which bind to the
extracellular
domain of a DR3 receptor can either stimulate or inhibit DR3 activities (e.g.,
the
induction of apoptosis). Antibodies which stimulate DR3 receptor activities
(e.g.,
by facilitating the association between DR3 receptor death domains) are DR3
agonists and antibodies which inhibit DR3 receptor activities (e.g., by
blocking the
binding of TNF-'y-~3 and/or preventing the association between DR3 receptor
death domains) are DR3 antagonists.
Antibodies ofthe invention which function as agonists and antagonists of
DR3 receptors include antigen-binding antibody fragments such as Fab and
F(ab')2
fragments, Fd, single-chain Fvs (scFv), disulfide-linked Fvs (sdFv) and
fragments
comprising either a VL or VH domain, as well as polyclonal, monoclonal and
humanized antibodies. Each of these antigen-binding antibody fragments and
antibodies are described in more detail elsewhere herein.
In view of the above, antibodies of the invention, as well as other agonists,
are useful for stimulating DR3 death domain activity in endothelial cells,
resulting
in anti-angiogenic activity. Antibodies of this type are useful for prevention
and/or
treating diseases and conditions associated with hypervascularization and
neovascularization, such as rheumatoid arthritis and solid tissue cancers
(e.g., skin
cancer, head and neck tumors, breast tumors, endothelioma, osteoblastoma,
osteoclastoma, and Kaposi's sarcoma), as well as diseases and conditions
associated with chronic inflammation.
Diseases and conditions associated with chronic inflammation, such as
ulcerative colitis and Crohn's disease, often show histological changes
associated
with the ingrowth of new blood vessels into the inflamed tissues. Agonists of
the
invention which stimulate the activity of DR3 death domains will induce
apoptosis
in endothelial cells. As a result, agonists of the invention can inhibit the
formation
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-141-
of blood and lymph vessels and, thus, can be used to prevent and/or treat
diseases
and conditions associated with hypervascularization and neovascularization.
Other diseases and conditions associated with angiogenesis which can be
prevented and/or treated using agonists of the invention include hypertrophic
and
keloid scarring, proliferative diabetic retinopathy, arteriovenous
malformations,
atherosclerotic plaques, hemophilic joints, nonunion fractures, Osler-Weber
syndrome, psoriasis, pyogenic granuloma, scleroderma, tracoma, menorrhagia,
and vascular adhesions.
As noted above, DR3 receptors are also found on T-cells. Thus, agonists
of the invention (e.g., anti-DR3 receptor antibodies) are also useful for
inhibiting
T-cell mediated immune responses, as well as preventing and/or treating
diseases
and conditions associated with increased T-cell proliferation. Diseases and
conditions associated with T-cell mediated immune responses and increased T-
cell
proliferation include graft-v-host responses and diseases, inflammation,
autoimmune diseases, and T-cell leukemias.
Further, agents which inhibit DR3 death domain activity (e.g., DR3
antagonists) are also useful for preventing and/or treating a number of
diseases
and conditions associated with decreased vascularization, decreased T-cell
proliferation, and decreases in T-cell populations. As indicated above,
examples
of antagonists of DR3 receptor activity include anti-DR3 receptor antibodies.
These antibodies can function, for examples, by either binding to DR3
receptors
and blocking the binding of ligands which stimulate DR3 death domain activity
(e.g., TNF-y-(3) or inhibiting DR3 receptor conformational changes associated
with membrane signal transduction.
An example of a condition associated with decreased vascularization that
can be treated using antagonists of the~invention is delayed wound healing.
The
elderly, in particular, often heal at a slower rate than younger individuals.
Antagonists of the invention can thus prevent and/or inhibit apoptosis from
occurring in endothelial cells at wound sites and thereby promote wound
healing
in healing impaired individuals, as well as in individuals who heal at
"normal"
rates. Thus, antagonists of the invention can be used to promote and/or
accelerate
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-142-
wound healing. Antagonists of the invention are also useful for treating
and/or
preventing other diseases and conditions including restenosis, myocardial
infarction, peripheral arterial disease, critical limb ischemia, angina,
atherosclerosis, ischemia, edema, liver cirrhosis, osteoarthritis, and
pulmonary
fibrosis.
Antagonists of the invention (e.g., anti-DR3 receptor antibodies) are also
useful for enhancing T-cell mediated immune responses, as well as preventing
and/or treating diseases and conditions associated with decreased T-cell
proliferation. Antibodies of the invention which block the binding of DR3
receptor ligands to DR3 receptors or interfere with DR3 receptor
conformational
changes associated with membrane signal transduction can inhibit DR3 mediated
T-cell apoptosis. The inhibition of DR3 mediated apoptosis can, for examples,
either result in an increase in the expansion rate of in vivo T-cell
populations or
prevent a decrease in the size of such populations. Thus, antagonists of the
invention can be used to prevent and/or treat diseases or conditions
associated
with decreased or decreases in T-cell populations. Examples of such diseases
and
conditions included acquired immune deficiency syndrome (AIDS) and related
afflictions (e.g., A>0)S related complexes), T-cell immunodeficiencies,
radiation
sickness, and T-cell depletion due to radiation and/or chemotherapy.
Further, when an antagonist of the invention is administered to an
individual for the treatment and/or prevention of a disease or condition
associated
with decreased T-cell populations, the antagonist may be co-administered with
an
agent which activates and/or induces lymphocyte proliferation (e.g., a
cytokine).
Combination therapies of this nature, as well as other combination therapies,
are
discussed below in more detail.
Anti-DR3 antibodies are thus useful for treating and/or preventing
malignancies, abnormalities, diseases and/or conditions involving tissues and
cell
types which express DR3 receptors. Further, malignancies, abnormalities,
diseases and/or conditions which can be treated and/or prevented by the
induction
of programmed cell death in cells which express DR3 receptors can be treated
and/or prevented using DR3 receptor agonists of the invention. Similarly,
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-143-
malignancies, abnormalities, diseases and/or conditions which can be treated
and/or prevented by inhibiting programmed cell death in cells which express
DR3
receptors can be treated and/or prevented using DR3 receptor antagonists of
the
invention.
A number of additional malignancies, abnormalities, diseases and/or
conditions which can be treated using the agonists and antagonists of the
invention
are set out elsewhere herein, for example, in the section below entitled
"Therapeutics".
The antibodies of the present invention may be used therapeutically in a
number of ways, includes binding polynucleotides or polypeptides of the
present
invention locally or systemically in the body or by direct cytotoxicity of the
antibody, e.g., as mediated by complement (CDC) or by effector cells (ADCC).
The antibodies of this invention may be advantageously utilized in
combination with other monoclonal or chimeric antibodies, or with lymphokines,
tumor necrosis factors (e.g., TNF-y-(3) or hematopoietic growth factors (e.g.,
IL-2, 1L-3 and IL-7). For example, agonistic anti-DR3 antibodies may be
administered in conjunction with TNF-y-[3 when one seeks to induce DR3
mediated cell death in cells which express DR3 receptors of the invention.
Combination therapies of this nature, as well as other combination therapies,
are
discussed below in more detail.
The antibodies of the invention may be administered alone or in
combination with other types oftreatments (e.g. , radiation therapy,
chemotherapy,
hormonal therapy, immunotherapy and anti-tumor agents). Generally,
administration of products of a species origin or species reactivity (in the
case of
antibodies) that is the same species as that of the patient is preferred.
Thus, in a
preferred embodiment, human antibodies, fragments derivatives, analogs, or
nucleic acids, are administered to a human patient for therapy or prophylaxis.
It is preferred to use high affinity and/or potent in vivo inhibiting and/or
neutralizing antibodies against polypeptides or polynucleotides of the present
invention, fragments or regions thereof, for both immunoassays directed to and
therapy of disorders related to polynucleotides or polypeptides, including
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-144-
fragments thereof, of the present invention. Such antibodies, fragments, or
regions, will preferably have an affinity for polynucleotides or polypeptides,
including fragments thereof. Preferred binding affinities include those with a
dissociation constant orKd less than SX10'6M, 10'~M, SX10''M, 10''M, SX10'~M,
10'8M, SX10'9M, 10'9M, 5X10'"'M, 10''°M, SX10-"M, 10'"M, SX10''ZM,
10''2M,
SX10''3M, 10''3M, SX10-'4M, 10''4M, SX10-'SM, and 10''5M.
Transgenic Non-Human Animals
The proteins of the invention can also be expressed in transgenic animals.
Animals of any species, including, but not limited to, mice, rats, rabbits,
hamsters,
guinea pigs, pigs, micro-pigs, goats, sheep, cows and non-human primates,
e.g.,
baboons, monkeys, and chimpanzees may be used to generate transgenic animals.
In a specific embodiment, techniques described herein or otherwise known in
the
art, are used to express polypeptides of the invention in humans, as part of a
gene
therapy protocol.
Any technique known in the art may be used to introduce the transgene
(i. e., nucleic acids of the invention) into animals to produce the founder
lines of
transgenic animals. Such techniques include, but are not limited to,
pronuclear
microinjection (Paterson etal., Appl. Microbiol. Biotechnol. 40:691-698
(1994);
Carver et al., Biotechnology (NY) 11:1263-1270 (1993); Wright et al.,
Biotechnology (NY) 9:830-834 (1991); and Hoppe et al., US Patent Number
4,873,191 (1989)); retrovirus mediated gene transfer into germ lines (Van der
Putten et al., Proc. Natl. Acad. Sci., USA 82:6148-6152 (1985)), blastocysts
or
embryos; gene targeting in embryonic stem cells (Thompson et al., Cell 56:313-
321 (1989)); electroporation of cells or embryos (Lo, Mol. Cell. Biol. 3:1803-
1814 (1983)); introduction of the polynucleotides of the invention using a
gene
gun (see, e.g., Ulmer et al., Science 259:1745 (1993); introducing nucleic
acid
constructs into embryonic pleuripotent stem cells and transferring the stem
cells
back into the blastocyst; and sperm-mediated gene transfer (Lavitrano et al.,
Cell
57:717-723 (1989); etc. For a review of such techniques, see Gordon,
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-145-
"Transgenic Animals," Intl. Rev. Cytol.. 115:171-229 (1989), which is
incorporated by reference herein in its entirety. Further, the contents of
each of
the documents recited in this paragraph is herein incorporated by reference in
its
entirety. See also, U. S. Patent No. 5,464,764 (Capecchi et al., Positive-
Negative
Selection Methods and Vectors); U.S. Patent No. 5,631,153 (Capecchi et al.,
Cells and Non-Human Organisms Containing Predetermined Genomic
Modifications and Positive-Negative Selection Methods and Vectors for Making
Same); U.S. Patent No. 4,736,866 (Leder et al., Transgenic Non-Human
Animals); and U. S. Patent No. 4,873,191 (Wagner et al., Genetic
Transformation
of Zygotes); each of which is hereby incorporated by reference in its
entirety.
Any technique known in the art may be used to produce transgenic clones
containing polynucleotides of the invention, for example, nuclear transfer
into
enucleated oocytes of nuclei from cultured embryonic, fetal, or adult cells
induced
to quiescence (Campell et al., Nature 380:64-66 (1996); Wilmut et al., Nature
385:810-813 ( 1997)), each of which is herein incorporated by reference in its
entirety).
The present invention provides for transgenic animals that carry the
transgene in all their cells, as well as animals which carry the transgene in
some,
but not all their cells, i. e., mosaic animals or chimeric animals. The
transgene may
be integrated as a single transgene or as multiple copies such as in
concatamers,
e.g., head-to-head tandems or head-to-tail tandems. The transgene may also be
selectively introduced into and activated in a particular cell type by
following, for
example, the teaching of Lasko et al. (Lasko et al., Proc. Natl. Acad. Sci.
USA
89:6232-6236 (1992)). The regulatory sequences required for such a cell-type
specific activation will depend upon the particular cell type of interest, and
will be
apparent to those of skill in the art. When it is desired that the
polynucleotide
transgene be integrated into the chromosomal site of the endogenous gene, gene
targeting is preferred. Briefly, when such a technique is to be utilized,
vectors
containing some nucleotide sequences homologous to the endogenous gene are
designed for the purpose of integrating, via homologous recombination with
chromosomal sequences, into and disrupting the function of the nucleotide
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-146-
sequence of the endogenous gene. The transgene may also be selectively
introduced into a particular cell type, thus inactivating the endogenous gene
in
only that cell type, by following, for example, the teaching of Gu et al. (Gu
et al.,
Science 265:103-106 (1994)). The regulatory sequences required for such a cell-
s type specific inactivation will depend upon the particular cell type of
interest, and
will be apparent to those of skill in the art. The contents of each of the
documents
recited in this paragraph is herein incorporated by reference in its entirety.
Once transgenic animals have been generated, the expression of the
recombinant gene may be assayed utilizing standard techniques. Initial
screening
may be accomplished by Southern blot analysis or PCR techniques to analyze
animal tissues to verify that integration of the transgene has taken place.
The level
of mRNA expression of the transgene in the tissues of the transgenic animals
may
also be assessed using techniques which include, but are not limited to,
Northern
blot analysis of tissue samples obtained from the animal, in situ
hybridization
analysis, and reverse transcriptase-PCR (rt-PCR). Samples of transgenic gene-
expressing tissue may also be evaluated immunocytochemically or
immunohistochemically using antibodies specific for the transgene product.
Once the founder animals are produced, they may be bred, inbred, outbred,
or crossbred to produce colonies of the particular animal. Examples of such
breeding strategies include, but are not limited to: outbreeding of founder
animals
with more than one integration site in order to establish separate lines;
inbreeding
of separate lines in order to produce compound transgenics that express the
transgene at higher levels because of the ei~'ects of additive expression of
each
transgene; crossing of heterozygous transgenic animals to produce animals
homozygous for a given integration site in order to both augment expression
and
eliminate the need for screening of animals by DNA analysis; crossing of
separate
homozygous lines to produce compound heterozygous or homozygous lines; and
breeding to place the transgene on a distinct background that is appropriate
for an
experimental model of interest.
Transgenic and "knock-out" animals of the invention have uses which
include, but are not limited to, animal model systems useful in elaborating
the
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-147-
biological function of DR3-V 1 or DR3 polypeptides, studying conditions and/or
disorders associated with aberrant DR3-V 1 or DR3 expression, and in screening
for compounds effective in ameliorating such conditions and/or disorders.
In further embodiments of the invention, cells that are genetically
engineered to express the proteins of the invention, or alternatively, that
are
genetically engineered not to express the proteins of the invention (e.g.,
knockouts) are administered to a patient in vivo. Such cells may be obtained
from
the patient (i.e., animal, including human) or an MHC compatible donor and can
include, but are not limited to fibroblasts, bone marrow cells, blood cells
(e.g.,
lymphocytes), adipocytes, muscle cells, endothelial cells, etc. The cells are
genetically engineered in vitro using recombinant DNA techniques to introduce
the coding sequence of polypeptides of the invention into the cells, or
alternatively, to disrupt the coding sequence and/or endogenous regulatory
sequence associated with the polypeptides of the invention, e.g., by
transduction
(using viral vectors, and preferably vectors that integrate the transgene into
the
cell genome) or transfection procedures, including, but not limited to, the
use of
plasmids, cosmids, YACs, naked DNA, electroporation, liposomes, etc. The
coding sequence of the polypeptides of the invention can be placed under the
control of a strong constitutive or inducible promoter or promoter/enhancer to
achieve expression, and preferably secretion, of the polypeptides of the
invention.
The engineered cells which express and preferably secrete the polypeptides of
the
invention can be introduced into the patient systemically, e.g., in the
circulation,
or intraperitoneally. Alternatively, the cells can be incorporated into a
matrix and
implanted in the body, e.g., genetically engineered fibroblasts can be
implanted as
part of a skin graft; genetically engineered endothelial cells can be
implanted as
part of a lymphatic or vascular graft. (See, e.g., Anderson et al., US Patent
Number 5,399,349; and Mulligan & Wilson, US Patent Number 5,460,959, each
of which is incorporated by reference herein in its entirety).
When the cells to be administered are non-autologous or non-MHC
compatible cells, they can be administered using well known techniques which
prevent the development of a host immune response against the introduced
cells.
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-148-
For example, the cells may be introduced in an encapsulated form which, while
allowing for an exchange of components with the immediate extracellular
environment, does not allow the introduced cells to be recognized by the host
immune system.
Therapeutics
The Tumor Necrosis Factor (TNF) family ligands are known to be among
the most pleiotropic cytokines, inducing a large number of cellular responses,
including cytotoxicity, anti-viral activity, immunoregulatory activities, and
the
transcriptional regulation of several genes (D.V. Goeddel et al., "Tumor
Necrosis
Factors: Gene Structure and Biological Activities," Symp. Quant. Biol. 51:597-
609 (1986), Cold Spring Harbor; B. Beutler and A. Cerami, Annu. Rev. Biochem.
57:505-518 (1988); L.J. Old, Sci. Am. 258:59-75 (1988); W. Fiers, FEBS Lett.
285:199-224 (1991)). The TNF-family ligands induce such various cellular
responses by binding to TNF-family receptors, including the DR3-V 1 or DR3 of
the present invention.
Cells which express the DR3-V 1 or DR3 polypeptide and are believed to
have a potent cellular response to DR3-V1 or DR3 ligands include lymphocytes,
fibroblasts, macrophages, synovial cells, activated T-cells, lymphoblasts and
epithelial cells. By "a cellular response to a TNF-family ligand" is intended
any
genotypic, phenotypic, and/or morphologic change to a cell, cell line, tissue,
tissue
culture or patient that is induced by a TNF-family ligand. As indicated, such
cellular responses include not only normal physiological responses to TNF-
family
ligands, but also diseases associated with increased apoptosis or the
inhibition of
apoptosis. Apoptosis-programmed cell death-is a physiological mechanism
involved in the deletion of peripheral T lymphocytes of the immune system, and
its dysregulation can lead to a number of dii~erent pathogenic processes (J.C.
Ameisen, AIDS 8:1197-1213 (1994); P.H. Krammer et al., Curr. Opin. Immunol.
6:279-289 (1994)).
DR3-V 1 or DR3 polynucleotides, polypeptides, agonists or antagonists of
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-149-
the invention may be used. in developing treatments and diagnostic/prognostic
assays for any disorder mediated (directly or indirectly) by defective, or
insufficient amounts of DR3. DR3-V1 or DR3 polypeptides, agonists or
antagonists may be administered to a patient (e.g., mammal, preferably human)
ai~licted with such a disorder. Alternatively, a gene therapy approach may be
applied to treat and/or prevent such disorders. Disclosure herein of DR3-V1 or
DR3 nucleotide sequences permits the detection of defective DR3 genes, and the
replacement thereof with normal DR3-encoding genes. Defective genes may be
detected in in vitro diagnostic assays, and by comparison of the DR3-V 1 or
DR3
nucleotide sequence disclosed herein with that of a DR3 gene derived from a
patient suspected of harboring a defect in this gene.
Diseases associated with increased cell survival, or the inhibition of
apoptosis, include cancers (such as follicular lymphomas, carcinomas with p53
mutations, and hormone-dependent tumors, such as breast cancer, prostrate
cancer, Karposi's sarcoma and ovarian cancer); autoimmune disorders (such as
multiple sclerosis, Sjogren's syndrome, Hashimoto's thyroiditis, biliary
cirrhosis,
Behcet's disease, Crohn's disease, polymyositis, systemic lupus erythematosus,
immune-related glomerulonephritis, and rheumatoid arthritis) and viral
infections
(such as herpes viruses, pox viruses and adenoviruses), information graft
versus
host disease, acute graft rejection, and chronic graft rejection. Diseases
associated
with increased apoptosis include A117S; neurodegenerative disorders (such as
Alzheimer's disease, Parkinson's disease, Amyotrophic lateral sclerosis,
Retinitis
pigmentosa, Cerebellar degeneration); myelodysplastic syndromes (such as
aplastic anemia), ischemic injury (such as that caused by myocardial
infarction,
stroke and reperfusion injury), toxin-induced liver disease (such as that
caused by
alcohol), septic shock, cachexia, and anorexia.
Additional diseases or conditions associated with increased cell survival
include, but are not limited to, progression, and/or metastases of
malignancies and
related disorders such as leukemia (including acute leukemias (e.g., acute
lymphocytic leukemia, acute myelocytic leukemia (including myeloblastic,
promyelocytic, myelomonocytic, monocytic, and erythroleukemia)) and chronic
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-150-
leukemias (e.g., chronic myelocytic (granulocytic) leukemia and chronic
lymphocytic leukemia)), polycythemia vera, lymphomas (e.g., Hodgkin's disease
and non-Hodgkin's disease), multiple myeloma, Waldenstrom's
macroglobulinemia, heavy chain disease, and solid tumors including, but not
limited to, sarcomas and carcinomas such as fibrosarcoma, myxosarcoma,
liposarcoma, chondrosarcoma, osteogenic sarcoma, chordoma, angiosarcoma,
endotheliosarcoma, lymphangiosarcoma, lymphangioendotheliosarcoma,
synovioma, mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma,
colon carcinoma, pancreatic cancer, breast cancer, ovarian cancer, prostate
cancer, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat
gland carcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary
adenocarcinomas, cystadenocarcinoma, medullary carcinoma, bronchogenic
carcinoma, renal cell carcinoma, hepatoma, bile duct carcinoma,
choriocarcinoma,
seminoma, embryonal carcinoma, Wilm's tumor, cervical cancer, testicular
tumor,
lung carcinoma, small cell lung carcinoma, bladder carcinoma, epithelial
carcinoma, glioma, astrocytoma, medulloblastoma, craniopharyngioma,
ependymoma, pinealoma, hemangioblastoma, acoustic neuroma,
oligodendroglioma, menangioma, melanoma, neui-oblastoma, and retinoblastoma.
Diseases associated with increased apoptosis include AIDS;
, neurodegenerative disorders (such as Alzheimer's disease, Parkinson's
disease,
Amyotrophic lateral sclerosis, Retinitis pigmentosa, Cerebellar degeneration
and
brain tumor or prior associated disease); autoimmune disorders (such as,
multiple
sclerosis, Sjogren's syndrome, Grave's disease Hashimoto's thyroiditis,
autoimmune diabetes, biliary cirrhosis, Behcet's disease, Crohn's disease,
polymyositis, systemic lupus erythematosus, immune-related glomerulonephritis,
autoimmune gastritis, thrombocytopenic purpura, and rheumatoid arthritis)
myelodysplastic syndromes (such as aplastic anemia), graft vs. host disease
(acute
and/or chronic), ischemic injury (such as that caused by myocardial
infarction,
stroke and reperfusion injury), liver injury or disease (e.g., hepatitis
related liver
injury, cirrhosis, ischemia/reperfusion injury, cholestosis (bile duct injury)
and liver
cancer); toxin-induced liver disease (such as that caused by alcohol), septic
shock,
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-151-
ulcerative colitis, cachexia and anorexia. In preferred embodiments, DR3
polynucleotides, polypeptides, agonists, and/or antagonists are used to treat,
prevent, diagnose and/or prognose the diseases and disorders listed above.
Thus, in one aspect, the present invention is directed to a method for
enhancing apoptosis induced by a TNF-family ligand, which involves
administering
to a cell which expresses the DR3-Vl or DR3 polypeptide an effective amount of
DR3-V1 or DR3 ligand, analog or an agonist capable of increasing DR3-V1 or
DR3 mediated signaling. Preferably, DR3-V1 or DR3 mediated signaling is
increased to treat and/or prevent a disease wherein decreased apoptosis or
~ decreased cytokine and adhesion molecule expression is exhibited. An agonist
can
include soluble forms of DR3-V1 or DR3 and monoclonal antibodies directed
against the DR3-V 1 or DR3 polypeptide.
In a further aspect, the present invention is directed to a method for
inhibiting apoptosis induced by a TNF-family ligand, which involves
administering
to a cell which expresses the DR3-V 1 or DR3 polypeptide an elective amount of
an antagonist capable of decreasing DR3-V 1 or DR3 mediated signaling.
Preferably, DR3-V 1 or DR3 mediated signaling is decreased to treat and/or
prevent a disease wherein increased apoptosis or NF-kB expression is
exhibited.
An antagonist can include soluble forms of DR3-V 1 or DR3 and monoclonal
antibodies directed against the DR3-V 1 or DR3 polypeptide.
In another aspect, DR3-V1-Fc and DR3-Fc proteins and soluble portions
ofthe extracellular domains ofDR3-V 1 and DR3 proteins are useful in
stimulating
neovascularization and angiogenesis. Thus, these polypeptides are useful, for
example, for the treatment and/or prevention of diseases and conditions
associated
withhypovascularization (e.g., Turner's syndrome, cardiovascular aging,
bronchial
stenosis, depression). .
Specifically included within the scope of the invention are DR3-V 1-Fc and
DR3-Fc proteins receptor/Fc fusion proteins, and nucleic acid molecules which
encode such proteins. These fusion proteins include those having amino acid
sequences of the extracellular domains of the DR3 proteins of the invention.
Examples of portions of DR3 extracellular domains which are useful in the
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-152-
preparation of DR3 receptor/Fc fusion proteins include amino acids 1 to 199 in
SEQ ID N0:4 and amino acids 1 to 210, 37 to 210, SO to 210, and 100 to 210 in
SEQ ID N0:2.
Further, afflictions which can be treated and/or prevented by DR3-V 1 and
DR3 mediated stimulation of angiogenesis include soft tissue traumas (e.g.,
cuts
and bruises), ulcers (e.g., peptic, skin and venous), and sclerodermas.
By "agonist" is intended naturally occurring and synthetic compounds
capable of enhancing or potentiating apoptosis. By "antagonist" is intended
naturally occurring and synthetic compounds capable of inhibiting apoptosis.
Whether any candidate "agonist" or "antagonist" of the present invention can
enhance or inhibit apoptosis can be determined using art-known TNF-family
ligand/receptor cellular response assays, including those described in more
detail
below.
One such screening procedure involves the use of melanophores which are
transfected to express the receptor of the present invention. Such a screening
technique is described in PCT WO 92/01810, published February 6, 1992. Such
an assay may be employed, for example, for screening for a compound which
inhibits (or enhances) activation of the receptor polypeptide of the present
invention by contacting the melanophore cells which encode the receptor with
both a TNF-family ligand and the candidate antagonist (or agonist). Inhibition
or
enhancement of the signal generated by the ligand indicates that the compound
is
an antagonist or agonist of the ligand/receptor signaling pathway.
Other screening techniques include the use of cells which express the
receptor (for example, transfected CHO cells) in a system which measures
extracellular pH changes caused by receptor activation, for example, as
described
in Science 246:181-296 (October 1989). For example, compounds may be
contacted with a cell which expresses the receptor polypeptide of the present
invention and a second messenger response, e.g., signal transduction or pH
changes, may be measured to determine whether the potential compound activates
or inhibits the receptor.
Another such screening technique involves introducing RNA encoding the
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-153-
receptor into Xenopus oocytes to transiently express the receptor. The
receptor
oocytes may then be contacted with the receptor ligand and a compound to be
screened, followed by detection of inhibition or activation of a calcium
signal in
the case of screening for compounds which are thought to inhibit activation of
the
receptor.
Another screening technique involves expressing in cells a construct
wherein the receptor is linked to a phospholipase C or D. Such cells include
endothelial cells, smooth muscle cells, embryonic kidney cells, etc. The
screening
may be accomplished as herein above described by detecting activation of the
receptor or inhibition of activation of the receptor from the phospholipase
signal.
Another method involves screening for compounds which inhibit activation
of the receptor polypeptide of the present invention antagonists by
determining
inhibition of binding of labeled ligand to cells which have the receptor on
the
surface thereof. Such a method involves transfecting a eukaryotic cell with
DNA
encoding the receptor such that the cell expresses the receptor on its surface
and
contacting the cell with a compound in the presence of a labeled form of a
known
ligand. The ligand can be labeled, e.g., by radioactivity. The amount of
labeled
ligand bound to the receptors is measured, e.g., by measuring radioactivity of
the
receptors. If the compound binds to the receptor as determined by a reduction
of
labeled ligand which binds to the receptors, the binding of labeled ligand to
the
receptor is inhibited.
Further screening assays for agonist and antagonist of the present
invention are described in L.A. Tartaglia and D.V. Goeddel, .I. Biol. Chem.
267:4304-4307(1992).
Thus, in a further aspect, a screening method is provided for determining
whether a candidate agonist or antagonist is capable of enhancing or
inhibiting a
cellular response to a TNF-family ligand. The method involves contacting cells
which express the DR3-Vl or DR3 polypeptide with a candidate compound and
a TNF-family ligand, assaying a cellular response, and comparing the cellular
response to a standard cellular response, the standard being assayed when
contact
is made with the ligand in absence of the candidate compound, whereby an
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-154-
increased cellular response over the standard indicates that the candidate
compound is an agonist of the ligand/receptor signaling pathway and a
decreased
cellular response compared to the standard indicates that the candidate
compound
is an antagonist of the ligand/receptor signaling pathway. By "assaying a
cellular
response" is intended qualitatively or quantitatively measuring a cellular
response
to a candidate compound and/or a TNF-family ligand (e.g., determining or
estimating an increase or decrease in T cell proliferation or tritiated
thymidine
labeling). By the invention, a cell expressing the DR3-V 1 or DR3 polypeptide
can
be contacted with either an endogenous or exogenously administered TNF-family
ligand.
Agonist according to the present invention include naturally occurring and
synthetic compounds such as, for example, TNF family ligand peptide fragments,
transforming growth factor ~3, neurotransmitters (such as glutamate, dopamine,
N methyl-D-aspartate), tumor suppressors (p53), cytolytic T cells and
antimetabolites. Preferred agonist include chemotherapeutic drugs such as, for
example, cisplatin, doxorubicin, bleomycin, cytosine arabinoside, nitrogen
mustard, methotrexate and vincristine. Others include ethanol and ~3-amyloid
peptide (Science 267:1457-1458 (1995)). Further preferred agonists include
polyclonal and monoclonal antibodies raised against the DR3-V1 or DR3
polypeptide, or a fragment thereof. Such agonist antibodies raised against a
TNF-
family receptor are disclosed in L.A. Tartaglia et al., Proc. Natl. Acad. Sci.
USA
88:9292-9296 (1991); and L.A. Tartaglia and D.V. Goeddel, supra. See, also,
PCT Application WO 94/09137.
Antagonist according to the present invention include naturally occurring
and synthetic compounds such as, for example, the CD40 ligand, neutral amino
acids, zinc, estrogen, androgens, viral genes (such as AdenovirusElB,
Baculovirus
p35 and IAP, Cowpox virus crmA, Epstein-Barr virus BHRT'l, LMP-I, African
swine fever virus LMWS-HL, and Herpes virus y1 34. 5), calpain inhibitors,
cysteine
protease inhibitors, and tumor promoters (such as PMA, Phenobarbital, and a
Hexachlorocyclohexane).
Other potential antagonists include antisense molecules. Thus, in specific
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-155-
embodiments, antagonists according to the present invention are nucleic acids
corresponding to the sequences contained in DR3-V 1 or DR3, or the
complementary strand thereof, and/or to nucleotide sequences contained in the
deposited cDNAs having ATCC Deposit No. 97456 and 97757. In one
embodiment, antisense sequence is generated internally by the organism, in
another embodiment, the antisense sequence is separately administered (see,
for
example, O'Connor, J., Neurochem. 56:560 (1991), and Oligodeoxynucleotides
as Antisense Inhibitors of Gene Expression, CRC Press, Boca Raton, FL (1988).
Antisense technology can be used to control gene expression through antisense
DNA or RNA, or through triple-helix formation. Antisense techniques are
discussed for example, in Okano, J., Neurochem. 56:560 (1991);
Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression, CRC Press,
Boca Raton, FL (1988). Triple helix formation is discussed in, for instance,
Lee
et al., Nucleic Acids Research 6:3073 (1979); Cooney et al., Science 241:456
(1988); and Dervan et al., Science 251:1300 (1991). The methods are based on
binding of a polynucleotide to a complementary DNA or RNA.
For example, the 5' coding portion of a polynucleotide that encodes the
mature polypeptide of the present invention may be used to design an antisense
RNA oligonucleotide of from about 10 to 40 base pairs in length. A DNA
oligonucleotide is designed to be complementary to a region of the gene
involved
in transcription thereby preventing transcription and the production of the
receptor. The antisense RNA oligonucleotide hybridizes to the mRNA in vivo and
blocks translation of the mRNA molecule into receptor polypeptide.
In one embodiment, the DR3-V 1 or DR3 antisense nucleic acid of the
invention is produced intracellularly by transcription from an exogenous
sequence.
For example, a vector or a portion thereof, is transcribed, producing an
antisense
nucleic acid (RNA) of the invention. Such a vector would contain a sequence
encoding the DR3-V1 or DR3 antisense nucleic acid. Such a vector can remain
episomal or become chromosomally integrated, as long as it can be transcribed
to
produce the desired antisense RNA. Such vectors can be constructed by
recombinant DNA technology methods standard in the art. Vectors can be
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-156-
plasmid, viral, or others know in the art, used for replication and expression
iri
vertebrate cells. Expression of the sequence encoding DR3-V1 or DR3, or
fragments thereof, can be by any promoter known in the art to act in
vertebrate,
preferably human cells. Such promoters can be inducible or constitutive. Such
promoters include, but are not limited to, the SV40 early promoter region
(Bernoist and Chambon, Nature 29:304-310 ( 1981 ), the promoter contained in
the
3' long terminal repeat of Rous sarcoma virus (Yamamoto et al., Cel122:787-797
(1980), the herpes thymidine promoter (Wagner et al., Proc. Natl. Acad. Sci.
U.S.A. 78:1441-1445 (1981), the regulatory sequences ofthe metallothioneingene
(Brinster et al., Nature 296:39-42 (1982)), etc.
The antisense nucleic acids of the invention comprise, or alternatively
consist of, a sequence complementary to at least a portion of an RNA
transcript
of a DR3 gene. However, absolute complementarity, although preferred, is not
required. A sequence "complementary to at least a portion of an RNA," referred
to herein, means a sequence having sufficient complementarity to be able to
hybridize with the RNA, forming a stable duplex; in the case of double
stranded
DR3-V 1 or DR3 antisense nucleic acids, a single strand of the duplex DNA may
thus be tested, or triplex formation may be assayed. The ability to hybridize
will
depend on both the degree of complementarity and the length of the antisense
nucleic acid Generally, the larger the hybridizing nucleic acid, the more base
mismatches with a DR3-Vl or DR3 RNA it may contain and still form a stable
duplex (or triplex as the case may be). One skilled in the art can ascertain a
tolerable degree of mismatch by use of standard procedures to determine the
melting point of the hybridized complex.
Oligonucleotides that are complementary to the S' end of the message,
e.g., the 5' untranslated sequence up to and including the AUG initiation
codon,
should work most efficiently at inhibiting translation. However, sequences
complementary to the 3' untranslated sequences of mRNAs have been shown to
be effective at inhibiting translation of mRNAs as well. See generally,
Wagner,
R., 1994, Nature 372:333-335. Thus, oligonucleotides complementary to either
the 5'- or 3'- non- translated, non-coding regions of the DR3-V 1 or DR3 shown
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-157-
in SEQ ID N0:2 and SEQ ID N0:4 could be used in an antisense approach to
inhibit translation of endogenous DR3-V1 or DR3 mRNA. Oligonucleotides
complementary to the 5' untranslated region of the mRNA should include the
complement ofthe AUG start codon. Antisense oligonucleotides complementary
to mRNA coding regions are less efficient inhibitors of translation but could
be
used in accordance with the invention. Whether designed to hybridize to the 5'-
,
3'- or coding region of DR3-V 1 or DR3 mRNA, antisense nucleic acids should
be at least six nucleotides in length, and are preferably oligonucleotides
ranging
from 6 to about 50 nucleotides in length. In specific aspects the
oligonucleotide
is at least about 10 nucleotides, at least about 17 nucleotides, at least
about 25
nucleotides or at least about 50 nucleotides. In this context "about" includes
the
particularly recited value and values larger or smaller by several (S, 4, 3,
2, or 1 )
nucleotides.
The polynucleotides of the invention can be DNA or RNA or chimeric
mixtures or derivatives or modified versions thereof, single-stranded or
double-
stranded. The oligonucleotide can be modified at the base moiety, sugar
moiety,
or phosphate backbone, for example, to improve stability of the molecule,
hybridization, etc. The oligonucleotide may include other appended groups such
as peptides (e.g., for targeting host cell receptors in vivo), or agents
facilitating
transport across the cell membrane (see, e.g., Letsinger et al., Proc. Natl.
Acad.
Sci. U.S.A. 86:6553-6556 (1989); Lemaitre et al., Proc. Nall. Acad. Sci.
84:648-
652 (1987); PCT Publication No. W088/09810, published December 15, 1988)
or the blood-brain barrier (see, e.g., PCT Publication No. W089/10134,
published
April 25, 1988), hybridization-triggered cleavage agents. (See, e.g., Krol et
al.,
BioTechniyues 6:958-976 (1988)) or intercalating agents. (See, e.g., Zon,
Pharm.
Res. 5:539-549 (1988)). To this end, the oligonucleotide may be conjugated to
another molecule, e.g., a peptide, hybridization triggered cross-linking
agent,
transport agent, hybridization-triggered cleavage agent, etc.
The antisense oligonucleotide may comprise at least one modified base
moiety which is selected from the group including, but not limited to,
5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine,
xantine,
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-158-
4-acetylcytosine, 5-(carboxyhydroxylmethyl)uracil, 5-carboxymethylaminomethyl-
2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, (3-D-
galactosylqueosine, inosine, N6-isopentenyladenine, 1-methylguanine,
1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine,
3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine,
5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, (3-
D-mannosylqueosine, S-methoxycarboxymethyluracil, S-methoxyuracil,
2-methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid (v), wybutoxosine,
pseudouracil, queosine, 2-thiocytosine, S-methyl-2-thiouracil, 2-thiouracil,
4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methylester, uracil-5-
oxyacetic
acid (v), 5-methyl-2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl)uracil,
(acp3)w,
and 2,6-diaminopurine.
The antisense oligonucleotide may also comprise at least one modified
sugar moiety selected from the group including, but not limited to, arabinose,
2-fluoroarabinose, xylulose, and hexose.
In yet another embodiment, the antisense oligonucleotide comprises at
least one modified phosphate backbone selected from the group including, but
not
limited to, a phosphorothioate, a phosphorodithioate, a phosphoramidothioate,
a
phosphoramidate, a phosphordiamidate, a methylphosphonate, an alkyl
phosphotriester, and a formacetal or analog thereof.
In yet another embodiment, the antisense oligonucleotide is an a-anomeric
oligonucleotide. An a-anomeric oligonucleotide forms specific double-stranded
hybrids with complementary RNA in which, contrary to the usual (3-units, the
strands run parallel to each other (Gautier et al., Nucl. Acids Res. 15:6625-
6641
(1987)). The oligonucleotide is a 2-0-methylribonucleotide (moue et al., Nucl.
Acids Res. 15:6131-6148 (1987)), or a chimeric RNA-DNA analogue (moue et
al., FEBSLett. 215:327-330 (1987)).
Polynucleotides of the invention may be synthesized by standard methods
known in the art, e.g., by use of an automated DNA synthesizer (such as are
commercially available from Biosearch, Applied Biosystems, etc.). As examples,
phosphorothioate oligonucleotides may be synthesized by the method of Stein et
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-159-
al. (Nucl.. Acids Re.s. 16:3209 (1988)), methylphosphonate oligonucleotides
can
be prepared by use of controlled pore glass polymer supports (Sarin et al.,
Proc.
Natl. Acad. Sci. U.S.A. 85:7448-7451 (1988)), etc.
While antisense nucleotides complementary to the DR3-V 1 or DR3 coding
region sequence could be used, those complementary to the transcribed
untranslated region are most preferred.
Potential antagonists according to the invention also include catalytic
RNA, or a ribozyme (See, e.g., PCT International Publication WO 90/11364,
published October 4, 1990; Sarver et al., Science 247:1222-1225 (1990). While
ribozymes that cleave mRNA at site specific recognition sequences can be used
to destroy DR3-V 1 or DR3 mRNAs, the use of hammerhead ribozymes is
preferred. Hammerhead ribozymes cleave mRNAs at locations dictated by
flanking regions that form complementary base pairs with the target mRNA. The
sole requirement is that the target mRNA have the following sequence of two
bases: 5'-UG-3'. The construction and production of hammerhead ribozymes is
well known in the art and is described more fully in Haseloffand Gerlach,
Nature
334:585-591 (1988). There are numerous potential hammerhead ribozyme
cleavage sites within the nucleotide sequence of DR3-V 1 (SEQ ID N0:2) or DR3
(SEQ ID N0:4). Preferably, the ribozyme is engineered so that the cleavage
recognition site is located near the 5' end of the DR3-V 1 or DR3 mRNA; i. e.,
to
increase efficiency and minimize the intracellular accumulation of non-
functional
mRNA transcripts.
As in the antisense approach, the ribozymes of the invention can be
composed of modified oligonucleotides (e.g., for improved stability,
targeting,
etc.) and should be delivered to cells which express DR3-V1 or DR3 in vivo.
DNA constructs encoding the ribozyme may be introduced into the cell in the
same manner as described above for the introduction of antisense encoding DNA.
A preferred method of delivery involves using a DNA construct "encoding" the
ribozyme under the control of a strong constitutive promoter, such as, for
example, pol III or pol II promoter, so that transfected cells will produce
sufficient
quantities of the ribozyme to destroy endogenous DR3-V 1 or DR3 messages and
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-160-
inhibit translation. Since ribozymes unlike antisense molecules, are
catalytic, a
lower intracellular concentration is required for efficiency.
Endogenous gene expression can also be reduced by inactivating or
"knocking out" the DR3 gene and/or its promoter using targeted homologous
recombination. (See, e.g., Smithies et al., Nature 317:230-234 (1985); Thomas
& Capecchi, Cell 51:503-512 (1987); Thompson et al., Cell 5:313-321 (1989);
each of which is incorporated by reference herein in its entirety). For
example, a
mutant, non-functional polynucleotide of the invention (or a completely
unrelated
DNA sequence) flanked by DNA homologous to the endogenous polynucleotide
sequence (either the coding regions or regulatory regions of the gene) can be
used,
with or without a selectable marker and/or a negative selectable marker, to
transfect cells that express polypeptides of the invention in vivo. In another
embodiment, techniques known in the art are used to generate knockouts in
cells
that contain, but do not express the gene of interest. Insertion of the DNA
construct, via targeted homologous recombination, results in inactivation of
the
targeted gene. Such approaches are particularly suited in research and
agricultural
fields where modifications to embryonic stem cells can be used to generate
animal
offspring with an inactive targeted gene (see, e.g., Thomas & Capecchi 1987
and
Thompson 1989, supra). However this approach can be routinely adapted for use
in humans provided the recombinant DNA constructs are directly administered or
targeted to the required site in vivo using appropriate viral vectors that
will be
apparent to those of skill in the art. The contents of each of the documents
recited
in this paragraph is herein incorporated by reference in its entirety.
In other embodiments, antagonists according to the present invention
include soluble forms of DR3-V 1 or DR3 (e.g., fragments of the DR3-V 1 shown
in SEQ ID N0:2 and DR3 shown in SEQ ID N0:4) that include the ligand binding
domain from the extracellular region of the full length receptor). Such
soluble
forms of the DR3-V1 or DR3, which may be naturally occurring or synthetic,
antagonize DR3-V 1 or DR3 mediated signaling by competing with the cell
surface
bound forms of the receptor for binding to TNF-family ligands. Antagonists of
the present invention also include antibodies specific for TNF-family ligands
and
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-161-
both DR3-V1-Fc and DR3-Fc fusion proteins.
By a "TNF-family ligand" is intended naturally occurring, recombinant, and
synthetic ligands that are capable of binding to a member of the TNF receptor
family and inducing and/or blocking the ligand/receptor signaling pathway.
Members of the TNF ligand family include, but are not limited to, TNF-a,
lymphotoxin-a (LT-a, also known as TNF-~3), LT-~3 (found in complex
heterotrimer LT-a2-~3), FasL, TNF-y (International Publication No. WO
96/14328), TNF-y-a, TNF-y-(3 (International Publication No. WO 00/08139),
AIM-I (International Publication No. WO 97/33899), AIM-II (International
Publication No. WO 97/34911), APRIL (J. Exp. Med. 188(6):1185-1190),
endokine-a (International Publication No. WO 98/07880), neutrokine-a
(International Publication No. WO 98/I 8921), CD40L, CD27L, CD30L, 4-1BBL,
OX40L and nerve growth factor (NGF).
Antibodies according to the present invention may be prepared by any of
a variety of standard methods using DR3-V 1 or DR3 receptor immunogens of the
present invention. Such DR3-V 1 or DR3 receptor immunogens include the
DR3-Vl protein shown in SEQ ID N0:2 and the DR3 protein shown in SEQ ID
N0:4 (each of which may or may not include a leader sequence) and polypeptide
fragments of the receptor comprising, or alternatively consisting of, the
ligand
binding, extracellular, transmembrane, the intracellular domains of DR3-V 1 or
DR3, or any combination thereof.
Polyclonal and monoclonal antibody agonists or antagonists according to
the present invention can be raised according to the methods disclosed herein
and/or known in the art, such as, for example, those methods described in
Tartagliaand Goeddel,J. Biol. Chem. 267(7):4304-4307(1992)); Tartagliaetal.,
Cell 73:213-216 (1993)), and PCT Application WO 94/09137 (the contents of
each of these three applications are herein incorporated by reference in their
entireties), and are preferably specific to polypeptides of the invention
having the
amino acid sequence of SEQ >Z7 NOs:2 or 4.
Further antagonist according to the present invention include soluble forms
of DR3-V1 or DR3, i.e., DR3-V1 or DR3 fragments that include the ligand
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-162-
binding domain from the extracellular region of the full length receptor. Such
soluble forms of the receptor, which may be naturally occurring or synthetic,
antagonize DR3-V 1 or DR3 mediated signaling by competing with the cell
surface
DR3-V1 or DR3 for binding to TNF-family ligands. Thus, soluble forms ofthe
receptor that include the ligand binding domain are novel cytokines capable of
inhibiting apoptosis induced by TNF-family ligands. These are preferably
expressed as dimers or trimers, since these have been shown to be superior to
monomeric forms of soluble receptor as antagonists, e.g., IgG-Fc-TNF receptor
family fusions. Other such cytokines are known in the art and include Fas B (a
soluble form of the mouse Fas receptor) that acts physiologically to limit
apoptosis
induced by Fas ligand (D.P. Hughes and LN. Crispe, J. Exp. Med. 182:1395-1401
(1995)).
The experiments set forth in Examples 6 and 7 demonstrate that DR3 is
a death domain-containing molecule capable of triggering both apoptosis and
NF-kB activation, two pathways dominant in the regulation ofthe immune system.
The experiments also demonstrate the internal signal transduction machinery of
this novel cell death receptor. In addition, the experiments set forth below
demonstrate that DR3-induced apoptosis was blocked by the inhibitors of ICE-
like
proteases, CrmA and z-VAD-fmk. Importantly, apoptosis induced by DR3 was
also blocked by dominant negative versions of FADD (FADD-DN) or FLICE
(FLICE-DN/MACHalC360S), which were previously shown to inhibit death
signaling by Fas/APO-1 and TNFR-1. Thus, inhibitors of ICE-like proteases,
FADD-DN and FLICE-DN/MACHaI C360S could also be used as antagonists for
DR3 activity.
The term "antibody" (Ab) or "monoclonal antibody" (mAb) as used herein
is meant to include intact molecules as well as fragments thereof (such as,
for
example, Fab and F(ab')2 fragments) which are capable ofbinding an antigen.
Fab
and F (ab')Z fragments lack the Fc fragment of intact antibody, clear more
rapidly
from the circulation, and may have less non-specific tissue binding of an
intact
antibody (Wahl et al., J Nucl. Med. 24:316-325 (1983)).
Antibodies according to the present invention may be prepared by any of
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-163-
a variety of methods using DR3-V 1 or DR3 immunogens of the present invention.
As indicated, such DR3-V 1 or DR3 immunogens include the full length DR3-V 1
or DR3 polypeptide (which may or may not include the leader sequence) and
DR3-V 1 or DR3 polypeptide fragments such as the ligand binding domain, the
transmembrane domain, the intracellular domain and the death domain.
Proteins and other compounds which bind the DR3-V1 or DR3 domains
are also candidate agonist and antagonist according to the present invention.
Such
binding compounds can be "captured" using the yeast two-hybrid system (Fields
and Song, Nature 340:245-246 (1989)). A modified version of the yeast two-
hybrid system has been described by Roger Brent and his colleagues (J. Gyuris
et
al., Cell 75:791-803 (1993); A.S. Zervos et al., Cell 72:223-232 (1993)).
Preferably, the yeast two-hybrid system is used according to the present
invention
to capture compounds which bind to either the DR3-V1 or DR3 ligand binding
domain or to the DR3-V1 or DR3 intracellular domain. Such compounds are
good candidate agonist and antagonist of the present invention.
By a "TNF-family ligand" is intended naturally occurring, recombinant, and
synthetic ligands that are capable of binding to a member of the TNF receptor
family and inducing the ligand/receptor signaling pathway. Members of the TNF
ligand family include, but are not limited to, the DR3-V1 or DR3 ligand, TNF-
a,
lymphotoxin-a (LT-a, also known as TNF-(3), (International Publication No. WO
96/14328), TNF-y-a (PCT Publication No. WO 00/08139), TNF-y-(3 (PCT
Publication No. WO 00/08139), LT-(3 (found in complex heterotrimer LT-a2-(3),
Fast, CD40, CD27, CD30, 4-1BB, OX40, and nerve growth factor (NGF).
Representative therapeutic applications of the present invention are
discussed in-more detail below. The state ofimmunodeficiency that defines AIDS
is secondary to a decrease in the number and function of CD4+ T-lymphocytes.
Recent reports estimate the daily loss ofCD4+ T cells to be between 3.5 X 10'
and
2 X 109 cells (X. Wei et al., Nature 373:117-122 (1995)). One cause of CD4+ T
cell depletion in the setting of HIV infection is believed to be HIV-induced
apoptosis. Indeed, HIV-induced apoptotic cell death has been demonstrated not
only in vitro but also, more importantly, in infected individuals (J.C.
Ameisen,
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-164-
AIDS 8:1197-1213 (1994); T.H. Finkel and N.K. Banda, Curr. Opin. Immunol.
6:605-615(1995); C.A. Muro-Cacho etal., J Immunol. 154:5555-5566 (1995)).
Furthermore, apoptosis and CD4+ T-lymphocyte depletion are tightly correlated
in different animal models of AIDS (T. Brunner et al., Nature 373:441-444
(1995); M.L. Gougeon et al., AIDSRes. Hum. Retroviruses 9:553-563 (1993)),
and apoptosis is not observed in those animal models in which viral
replication
does not result in AIDS. Id. Further data indicates that uninfected but primed
or
activated T lymphocytes from HIV-infected individuals undergo apoptosis after
encountering the TNF-family ligand Fast. Using monocytic cell lines that
result
in death following HIV infection, it has been demonstrated that infection of
U937
cells with HIV results in the de novo expression of Fast and that Fast
mediates
HIV-induced apoptosis (A.D. Badley et al., .l. virol. 70:199-206 (1996)).
Further, the TNF-family ligand was detectable in uninfected macrophages and
its
expression was upregulated following HIV infection resulting in selective
killing
of uninfected CD4 T-lymphocytes. Id. Thus, by the invention, a method for
treating HIV+ individuals is provided which involves administering an
antagonist
of the present invention to reduce selective killing of CD4 T-lymphocytes.
Modes
of administration and dosages are discussed in detail below.
In rejection of an allograft, the immune system of the recipient animal has
not previously been primed to respond because the immune system for the most
part is only primed by environmental antigens. Tissues from other members of
the
same species have not been presented in the same way that, for example,
viruses
and bacteria have been presented. In the case of allograft rejection,
immunosuppressive regimens are designed to prevent the immune system from
reaching the effector stage. However, the immune profile of xenograft
rejection
may resemble disease recurrence more that allograft rejection. In the case of
disease recurrence, the immune system has already been activated, as evidenced
by destruction of the native islet cells. Therefore, in disease recurrence the
immune system is already at the effector stage. Agonist of the present
invention
are able to suppress the immune response to both allografts and xenografts
because lymphocytes activated and differentiated into effector cells will
express
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-165-
the DR3-V 1 or DR3 polypeptide, and thereby are susceptible to compounds
which enhance apoptosis. Thus, the present invention further provides a method
for creating immune privileged tissues. Antagonist of the invention can
further be
used in the treatment and/or prevention of Inflammatory Bowel-Disease.
DR3, like TNFR1, also activates the NF-kB transcription factor, which is
very closely associated with the stimulation of cytokine (e.g., II,-8) and
adhesion
molecule (e.g., ELAM) transcription. Hence, like TNF, the ligand (or agonist)
for
DR3 and DR3-V1 may in some circumstances be proinflammatory, and
antagonists may be useful reagents for blocking this response. Thus, DR3 and
DR3-V 1 antagonists may be useful for treating, preventing, diagnosing and/or
prognosing inflammatory diseases, such as rheumatoid arthritis,
osteoarthritis,
psoriasis, septicemia, and inflammatory bowel disease.
In addition, due to lymphoblast expression of DR3, soluble DR3, agonist
or antagonist mABs may be used to diagnose, prognose, treat and/or prevent
this
form of cancer. Further, soluble DR3 or neutralizing mABs may be used to treat
and/or prevent various chronic and acute forms of inflammation such as
rheumatoid arthritis, osteoarthritis, psoriasis, septicemia, and inflammatory
bowel
disease.
DR3 polynucleotides, polypeptides, agonists or antagonists of the
invention may be used to diagnose, prognose, treat and/or prevent
cardiovascular
disorders, including peripheral artery disease, such as limb ischemia.
Cardiovascular disorders include cardiovascular abnormalities, such as
arterio-arterial fistula, arteriovenous fistula, cerebral arteriovenous
malformations,
congenital heart defects, pulmonary atresia, and Scimitar Syndrome. Congenital
heart defects include aortic coarctation, cor triatriatum, coronary vessel
anomalies,
crisscross heart, dextrocardia, patent ductus arteriosus, Ebstein's anomaly,
Eisenmenger complex, hypoplastic left heart syndrome, levocardia, tetralogy of
fallot, transposition of great vessels, double outlet right ventricle,
tricuspid atresia,
persistent truncus arteriosus, and heart septal defects, such as
aortopulmonary
septal defect, endocardial cushion defects, Lutembacher's Syndrome, trilogy of
Fallot, ventricular heart septal defects.
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-166-
Cardiovascular disorders also include heart disease, such as arrhythmias,
carcinoid heart disease, high cardiac output, low cardiac output, cardiac
tamponade, endocarditis (including bacterial), heart aneurysm; cardiac arrest,
congestive heart failure, congestive cardiomyopathy, paroxysmal dyspnea,
cardiac
edema, heart hypertrophy, congestive cardiomyopathy, left ventricular
hypertrophy, right ventricular hypertrophy, post-infarction heart rupture,
ventricular septal rupture, heart valve diseases, myocardial diseases,
myocardial
ischemia, pericardial effusion, pericarditis (including constrictive and
tuberculous),
pneumopericardium, postpericardiotomy syndrome, pulmonary heart disease,
rheumatic heart disease, ventricular dysfunction, hyperemia, cardiovascular
pregnancy complications, Scimitar Syndrome, cardiovascular syphilis, and
cardiovascular tuberculosis.
Arrhythmias include sinus arrhythmia, atrial fibrillation, atrial flutter,
bradycardia, extrasystole, Adams-Stokes Syndrome, bundle-branch block,
sinoatrial block, long QT syndrome, parasystole, Lown-Ganong-Levine
Syndrome, Mahaim-type pre-excitation syndrome, Wolff Parkinson-White
syndrome, sick sinus syndrome, tachycardias, and ventricular fibrillation.
Tachycardias include paroxysmal tachycardia, supraventricular tachycardia,
accelerated idioventricular rhythm, atrioventricular nodal reentry
tachycardia,
ectopic atrial tachycardia, ectopic functional tachycardia, sinoatrial nodal
reentry
tachycardia, sinus tachycardia, Torsades de Pointes, and ventricular
tachycardia.
Heart valve disease include aortic valve insufficiency, aortic valve stenosis,
hear murmurs, aortic valve prolapse, mural valve prolapse, tricuspid valve
prolapse, mitral valve insufficiency, mural valve stenosis, pulmonary atresia,
pulmonary valve insuffciency, pulmonary valve stenosis, tricuspid atresia,
tricuspid valve insuffciency, and tricuspid valve stenosis.
Myocardial diseases include alcoholic cardiomyopathy, congestive
cardiomyopathy, hypertrophic cardiomyopathy, aortic subvalvular stenosis,
pulmonary subvalvular stenosis, restrictive cardiomyopathy, Chagas
cardiomyopathy, endocardial fibroelastosis, endomyocardial fibrosis, Kearns
Syndrome, myocardial reperfusion injury, and myocarditis.
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-167-
Myocardial ischemias include coronary disease, such as angina pectoris,
coronary aneurysm, coronary arteriosclerosis, coronary thrombosis, coronary
vasospasm, myocardial infarction and myocardial stunning.
Cardiovascular diseases also include vascular diseases such as aneurysms,
angiodysplasia, angiomatosis, bacillary angiomatosis, Hippel-Lindau Disease,
Klippel-Trenaunay-Weber Syndrome, Sturge-Weber Syndrome, angioneurotic
edema, aortic diseases, Takayasu's Arteritis, aortitis, Leriche's Syndrome,
arterial
occlusive diseases, arteritis, enarteritis, polyarteritis nodosa,
cerebrovascular
disorders, diabetic angiopathies, diabetic retinopathy, embolisms, thrombosis,
erythromelalgia, hemorrhoids, hepatic veno-occlusive disease, hypertension,
hypotension, ischemia, peripheral vascular diseases, phlebitis, pulmonary veno
occlusive disease, Raynaud's disease, CREST syndrome, retinal vein occlusion,
Scimitar syndrome, superior vena cava syndrome, telangiectasia, atacia
telangiectasia, hereditary hemorrhagic telangiectasia, varicocele, varicose
veins,
varicose ulcer, vasculitis, and venous insufficiency.
Aneurysms include dissecting aneurysms, false aneurysms, infected
aneurysms, ruptured aneurysms, aortic aneurysms, cerebral aneurysms, coronary
aneurysms, heart aneurysms, and iliac aneurysms.
Arterial occlusive diseases include arteriosclerosis, intermittent
claudication, carotid stenosis, fibromuscular dysplasias, mesenteric vascular
occlusion, Moyamoya disease, renal artery obstruction, retinal artery
occlusion,
and thromboangiitis obliterans. ,
Cerebrovascular disorders include carotid artery diseases, cerebral amyloid
angiopathy, cerebral aneurysm, cerebral anoxia, cerebral arteriosclerosis,
cerebral
arteriovenous malformation, cerebral artery diseases, cerebral embolism and
thrombosis, carotid artery thrombosis, sinus thrombosis, Wallenberg's
syndrome,
cerebral hemorrhage, epidural hematoma, subdural hematoma, subaraxhnoid
hemorrhage, cerebral infarction, cerebral ischemia (including transient),
subclavian
steal syndrome, periventricular leukomalacia, vascular headache, cluster
headache,
migraine, and vertebrobasilar insufficiency.
Embolisms include air embolisms, amniotic fluid embolisms, cholesterol
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-168-
embolisms, blue toe syndrome, fat embolisms, pulmonary embolisms, and
thromoboembolisms. Thrombosis include coronary thrombosis, hepatic vein
thrombosis, retinal vein occlusion, carotid artery thrombosis, sinus
thrombosis,
Wallenberg's syndrome, and thrombophlebitis.
Ischemia includes cerebral ischemia, ischemic colitis, compartment
syndromes, anterior compartment syndrome, myocardial ischemia, reperfusion
injuries, and peripheral limb ischemia. Vasculitis includes aortitis,
arteritis,
Behcet's Syndrome, Churg-Strauss Syndrome, mucocutaneous lymph node
syndrome, thromboangiitis obliterans, hypersensitivity vasculitis, Schoenlein-
Henoch purpura, allergic cutaneous vasculitis, and Wegener's granulomatosis.
In one embodiment, a DR3 polynucleotide, polypeptide, agonist, or
antagonist of the invention is used to diagnose, prognose, treat and/or
prevent
thrombotic microangiopathies. One such disorder is thrombotic thrombocytopenic
purpura (TTP) (Kwaan, H.C., Semin. Hematol. 24:71 (1987); Thompson et al.,
Blood 80:1890 (1992)). Increasing TTP-associated mortality rates have been
reported by the U. S. Centers for Disease Control (Torok et al., Am. J.
Hematol.
50:84 (1995)). Plasma from patients afflicted with TTP (including HIV+ and
HIV- patients) induces apoptosis of human endothelial cells of dermal
microvascular origin, but not large vessel origin (Lawrence et al., Blood
87:3245
( 1996)). Plasma of TTP patients thus is thought to contain one or more
factors
that directly or indirectly induce apoptosis. Another thrombotic
microangiopathy
is hemolytic-uremic syndrome (HUS) (Moake, J.L., Lancet, 343:393, 1994;
Melnyk e1 al., (Arch. Intern. Med., 155:2077, 1995; Thompson et al., supra).
Thus, in one embodiment, the invention is directed to use of DR3 to diagnose,
prognose, treat and/or prevent the condition that is often referred to as
"adult
HUS" (even though it can strike children as well). A disorder known as
childhood/diarrhea-associated HUS differs in etiology from adult HUS. In
another embodiment, conditions characterized by clotting of small blood
vessels
may be diagnosed, prognosed, treated and/or prevented using DR3. Such
conditions include, but are not limited to, those described herein. For
example,
cardiac problems seen in about 5-10% of pediatric AIDS patients are believed
to
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-169-
involve clotting of small blood vessels. Breakdown ofthe microvasculature in
the
heart has been reported in multiple sclerosis patients. As a further example,
treatment, prevention, diagnosis and/or prognosis of systemic lupus
erythematosus
(SLE) is contemplated.
DR3 polynucleotides, polypeptides, agonists or antagonists of the
invention may be employed in combination with other agents useful in treating,
preventing, diagnosing and/or prognosing a particular disorder. For example,
in
an in vitro study reported by Laurence et al. (Blood 87:3245 (1996)), some
reduction of TTP plasma-mediated apoptosis of microvascular endothelial cells
was achieved by using an anti-Fas blocking antibody, aurintricarboxylic acid,
or
normal plasma depleted of cryoprecipitate. Thus, a patient may be treated with
a polynucleotide and/or polypeptide of the invention in~combination with an
agent
that inhibits Fas-ligand-mediated apoptosis of endothelial cells, such as, for
example, an agent described above. In one embodiment, a DR3 polynucleotide,
polypeptide, agonist or antagonist, and an anti-FAS blocking antibody are both
administered to a patient afflicted with a disorder characterized by
thrombotic
microanglopathy, such as TTP or HUS. Examples of blocking monoclonal
antibodies directed against Fas antigen (CD95) are described in International
patent application publication number WO 95/10540, hereby incorporated by
reference.
The naturally occurring balance between endogenous stimulators and
inhibitors of angiogenesis is one in which inhibitory influences predominate.
Rastinejad et al., Cell 56:345-355 (1989). In those rare instances in which
neovascularization occurs under normal physiological conditions, such as wound
healing, organ regeneration, embryonic development, and female reproductive
processes, angiogenesis is stringently regulated and spatially and temporally
delimited. Under conditions of pathological angiogenesis such as that
characterizing solid tumor growth, these regulatory controls fail.
Unregulated angiogenesis becomes pathologic and sustains progression of
many neoplastic and non-neoplastic diseases. A number of serious diseases are
dominated by abnormal neovascularization including solid tumor growth and
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-170-
metastases, arthritis, some types of eye disorders, and psoriasis. See, e.g.,
reviews
by Moses et al., Biotech. 9:630-634 (1991); Folkman et al., N. Engl. J. Med.,
333:1757-1763 (1995); Auerbach et al., .l Microvasc. Res. 29:401-411 (1985);
Folkman, Advances in Cancer Research, eds. Klein and Weinhouse, Academic
Press, New York, pp. 175-203 (1985); Patz, Am. J. Opthalmol. 94:715-743
(1982); and Folkman et al., Science 221:719-725 (1983). In a number of
pathological conditions, the process of angiogenesis contributes to the
disease
state. For example, significant data have accumulated which suggest that the
growth of solid tumors is dependent on angiogenesis. Folkman and Klagsbrun,
Science 235:442-447 (1987).
The present invention provides for treatment, prevention, diagnosis and/or
prognosis of diseases or disorders associated with neovascularization by
administration of the DR3 polynucleotides and/or polypeptides of the invention
(including DR3 agonists and/or antagonists). Malignant and metastatic
conditions
which can be diagnosed, prognosed, treated and/or prevented with the
polynucleotides and polypeptides of the invention include, but are not limited
to
those malignancies, solid tumors, and cancers described herein and otherwise
known in the art (for a review of such disorders, see Fishnian et al.,
Medicine, 2d
Ed., J. B. Lippincott Co., Philadelphia (1985)).
Additionally, ocular disorders associated with neovascularization which
can be diagnosed, prognosed, treated and/or prevented with the DR3
polynucleotides and polypeptides ofthe present invention (including DR3
agonists
and DR3 antagonists) include, but are not limited to: neovascular glaucoma,
diabetic retinopathy, retinoblastoma, retrolental fibroplasia, uveitis,
retinopathy of
prematurity macular degeneration, corneal graft neovascularization, as well as
other eye inflammatory diseases, ocular tumors and diseases associated with
choroidal or iris neovascularization. See, e.g., reviews by Waltman et al.,
Am. J.
Ophthal. 85:704-710 (1978) and Gartner et al., Surv. Ophthal. 22:291-312
(1978).
Additionally, disorders which can be diagnosed, prognosed, treated and/or
prevented with the DR3 polynucleotides and polypeptides of the present
invention
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-171-
(including DR3 agonists and DR3 antagonists) include, but are not limited to,
hemangioma, arthritis, psoriasis, angiofibroma, atherosclerotic plaques,
delayed
wound healing, granulations, hemophilic joints, hypertrophic scars, nonunion
fractures, Osler-Weber syndrome, pyogenic granuloma, scleroderma, trachoma,
and vascular adhesions.
Polynucleotides and/or polypeptides of the invention, and/or agonists
and/or antagonists thereof, are useful in the prognosis, diagnosis, treatment
and/or
prevention of a wide range of diseases and/or conditions. Such diseases and
conditions include, but are not limited to, cancer (e.g., immune cell related
cancers, breast cancer, prostate cancer, ovarian cancer, follicular lymphoma,
gliobalstoma, cancer associated with mutation or alteration of p53, brain
tumor,
bladder cancer, uterocervical cancer, colon cancer, colorectal cancer, non-
small
cell carcinoma ofthe lung, small cell carcinoma of the lung, stomach cancer,
etc.),
lymphoproliferative disorders (e.g., lymphadenopathy and lymphomas (e.g., EBV
induced lymphoproliferations and Hodgkin's disease), microbial (e.g., viral,
bacterial, etc.) infection (e.g., H1V-1 infection, HIV-2 infection,
herpesvirus
infection (including, but not limited .to, HSV-1, HSV-2, CMV, VZV, HHV-6,
HHV-7, EBV), adenovirus infection, poxvirus infection, human papilloma virus
infection, hepatitis infection (e.g., HAV, HBV, HCV, etc.), Helicobacter
pylori
infection, invasiveStaphylococcia, etc.), parasitic infection, nephritis, bone
disease
(e.g., osteoporosis), atherosclerosis, pain, cardiovascular disorders (e.g.,
neovascularization, hypovascularization or reduced circulation (e.g., ischemic
disease (e.g., myocardial infarction, stroke, etc.)), AIDS, allergy,
inflammation,
neurodegenerative disease (e.g., Alzheimer's disease, Parkinson's disease,
amyotrophic lateral sclerosis, pigmentary retinitis, cerebellar degeneration,
etc.),
graft rejection (acute and chronic), graft vs. host disease, diseases due to
osteomyelodysplasia (e.g., aplastic anemia, etc.), joint tissue destruction in
rheumatism, liver disease (e.g., acute and chronic hepatitis, liver injury,
and
cirrhosis), autoimmune disease (e.g., multiple sclerosis, myasthenia gravis,
rheumatoid arthritis, systemic lupus erythematosus, immune complex
glomerulonephritis, autoimmune diabetes, autoimmune thrombocytopenic
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-172-
purpura, Grave's disease, Hashimoto's thyroiditis, inflammatory autoimmune
diseases, etc.), cardiomyopathy (e.g., dilated cardiomyopathy), diabetes,
diabetic
complications (e.g., diabetic nephropathy, diabetic neuropathy, diabetic
retinopathy), influenza, asthma, psoriasis, glomerulonephritis, septic shock,
and
ulcerative colitis.
Polynucleotides and/or polypeptides of the invention and/or agonists
and/or antagonists thereof are useful in promoting angiogenesis, wound healing
(e.g., wounds, burns, and bone fractures), and regulating bone formation and
treating and/or preventing osteoporosis.
Polynucleotides and/or polypeptides of the invention and/or agonists
and/or antagonists thereof are also useful as an adjuvant to enhance immune
responsiveness to specific antigen and/or anti-viral immune responses.
More generally, polynucleotides and/or polypeptides of the invention
and/or agonists and/or antagonists thereof are useful in regulating (i. e.,
elevating
or reducing) immune response. For example, polynucleotides and/or polypeptides
of the invention may be useful in preparation or recovery from surgery,
trauma,
radiation therapy, chemotherapy, and transplantation, or may be used to boost
immune response and/or recovery in the elderly and immunocompromised
individuals. Alternatively, polynucleotides and/or polypeptides of the
invention
and/or agonists and/or antagonists thereof are useful as immunosuppressive
agents, for example in the treatment and/or prevention of autoimmune disorders
or in the prevention of transplant rejection. In specific embodiments,
polynucleotides and/or polypeptides of the invention are used to diagnose,
prognose, treat and/or prevent chronic inflammatory, allergic or autoimmune
conditions, such as those described herein or are otherwise known in the art.
Gene Therapy
In a specific embodiment, nucleic acids comprising sequences encoding
antibodies or functional derivatives thereof, are administered to treat,
inhibit
and/or prevent a disease or disorder associated with aberrant expression
and/or
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-173-
activity of a polypeptide of the invention, by way of gene therapy. Gene
therapy
refers to therapy performed by the administration to a subject of an expressed
or
expressible nucleic acid. In this embodiment of the invention, the nucleic
acids
produce their encoded protein that mediates a therapeutic effect.
Any of the methods for gene therapy available in the art can be used
according to the present invention. Exemplary methods are described below.
For general reviews of the methods of gene therapy, see Goldspiel et al.,
1993, Clinical Pharmacy 12:488-505; Wu and Wu, 1991, Biotherapy 3:87-95;
Tolstoshev, 1993, Ann. Rev. Pharmacol. Toxicol. 32:573-596; Mulligan, 1993,
Science 260:926-932; and Morgan and Anderson, 1993, Ann. Rev. Biochem.
62:191-217; May, 1993, TIBTECH 11(5):155-215). Methods commonly known
in the art of recombinant DNA technology which can be used are described in
Ausubel et al. (eds.), 1993, Current Protocols in Molecular Biology, John
Wiley
& Sons, NY; and Kriegler, 1990, Gene Transfer and Expression, A Laboratory
Manual, Stockton Press, NY.
In a preferred aspect, the compound comprises nucleic acid sequences
encoding an antibody, said nucleic acid sequences being part of expression
vectors
that express the antibody or fragments or chimeric proteins or heavy or light
chains thereof in a suitable host. In particular, such nucleic acid sequences
have
promoters operably linked to the antibody coding region, said promoter being
inducible or constitutive, and, optionally, tissue- specific. In another
particular
embodiment, nucleic acid molecules are used in which the antibody coding
sequences and any other desired sequences are flanked by regions that promote
homologous recombination at a desired site in the genome, thus providing for
intrachromosomal expression of the antibody nucleic acids (Koller and
Smithies,
1989, Proc. Natl. Acad. Sci. USA 86:8932-8935; Zijlstra et al., 1989, Nature
342:435-438). In specific embodiments, the expressed antibody molecule is a
single chain antibody; alternatively, the nucleic acid sequences include
sequences
encoding both the heavy and light chains, or fragments thereof, of the
antibody.
Delivery of the nucleic acids into a patient may be either direct, in which
case the patient is directly exposed to the nucleic acid or nucleic acid-
carrying
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-174-
vectors, or indirect, in which case, cells are first transformed with the
nucleic acids
in vitro, then transplanted into the patient. These two approaches are known,
respectively, as in vivo or ex vivo gene therapy.
In a specific embodiment, the nucleic acid sequences are directly
administered in vivo, where it is expressed to produce the encoded product.
This
can be accomplished by any of numerous methods known in the art, e.g., by
constructing them as part of an appropriate nucleic acid expression vector and
administering it so that they become intracellular, e.g., by infection using
defective
or attenuated retrovirals or other viral vectors (see U.S. Patent No.
4,980,286),
or by direct injection of naked DNA, or by use of microparticle bombardment
(e.g., a gene gun; Biolistic, Dupont), or coating with lipids or cell-surface
receptors or transfecting agents, encapsulation in liposomes, microparticles,
or
microcapsules, or by administering them in linkage to a peptide which is known
to enter the nucleus, by administering it in linkage to a ligand subject to
receptor-
mediated endocytosis (see, e.g., Wu and Wu, 1987, J. Biol. Chem. 262:4429-
4432) (which can be used to target cell types specifically expressing the
receptors), etc. In another embodiment, nucleic acid-ligand complexes can be
formed in which the ligand comprises a fixsogenic viral peptide to disrupt
endosomes, allowing the nucleic acid to avoid lysosomal degradation. In yet
another embodiment, the nucleic acid can be targeted in vivo for cell specific
uptake and expression, by targeting a specific receptor (see, e.g., PCT
Publications WO 92/06180 dated April 16, 1992 (Wu et al. ); WO 92/2263 5 dated
December 23, 1992 (Wilson et al.); W092/20316 dated November 26, 1992
(Findeis et al.); W093/14188 dated July 22, 1993 (Clarke et al.), WO 93/20221
dated October 14, 1993 (Young)). Alternatively, the nucleic acid can be
introduced intracellularly and incorporated within host cell DNA for
expression,
by homologous recombination (Koller and Smithies, 1989, Proc. Natl. Acad. Sci.
USA 86:8932-8935; Zijlstra et al., 1989, Nature 342:435-438).
In a specific embodiment, viral vectors that contains nucleic acid sequences
encoding an antibody of the invention are used. For example, a retroviral
vector
can be used (see Miller et al., 1993, Meth. Enzymol. 217:581-599). These
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-175-
retroviral vectors have been to delete retroviral sequences that are not
necessary
for packaging ofthe viral genome and integration into host cell DNA. The
nucleic
acid sequences encoding the antibody to be used in gene therapy are cloned
into
one or more vectors, which facilitates delivery of the gene into a patient.
More
detail about retroviral vectors can be found in Boesen et al., 1994,
Biotherapy
6:291-302, which describes the use of a retroviral vector to deliver the mdrl
gene
to hematopoietic stem cells in order to make the stem cells more resistant to
chemotherapy. Other references illustrating the use of retroviral vectors in
gene
therapy are: Clowes et al., 1994, J. Clin. Invest. 93:644-651; Kiem e1 al.,
1994,
Blood 83 :1467-1473; Salmons and Gunzberg, 1993, Human Gene Therapy 4:129-
141; and Grossman and Wilson, 1993, Curr. Opin. in Genetics and Devel. 3:110-
114.
Adenoviruses are other viral vectors that can be used in gene therapy.
Adenoviruses are especially attractive vehicles for delivering genes to
respiratory
epithelia. Adenoviruses naturally infect respiratory epithelia where they
cause a
mild disease. Other targets for adenovirus-based delivery systems are liver,
the
central nervous system, endothelial cells, and muscle. Adenoviruses have the
advantage of being capable of infecting non-dividing cells. Kozarsky and
Wilson,
1993, Current Opinion in Genetics and Development 3 :499-503 present a review
of adenovirus-based gene therapy. Bout et al., 1994, Human Gene Therapy 5:3-
10 demonstrated the use of adenovirus vectors to transfer genes to the
respiratory
epithelia of rhesus monkeys. Other instances of the use of adenoviruses in
gene
therapy can be found in Rosenfeld et al., 1991, Science 252:431-434; Rosenfeld
et ad., 1992, Cell 68:143- 155; Mastrangeli et al., 1993, J. Clin. Invest.
91:225-
234; PCT Publication W094/12649; and Wang et al., 1995, Gene Therapy 2:775-
783. In a preferred embodiment, adenovirus vectors are used.
Adeno-associated virus (AAV~ has also been proposed for use in gene
therapy (Walsh etal., 1993, Proc. Soc. Exp. Biol. Med. 204:289-300; U.S.
Patent
No. 5,436,146).
Another approach to gene therapy involves transferring a gene to cells in
tissue culture by such methods as electroporation, lipofection, calcium
phosphate
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-176-
mediated transfection, or viral infection. Usually, the method of transfer
includes
the transfer of a selectable marker to the cells. The cells are then placed
under
selection to isolate those cells that have taken up and are expressing the
transferred gene. Those cells are then delivered to a patient.
In this embodiment, the nucleic acid is introduced into a cell prior to
administration in vivo of the resulting recombinant cell. Such introduction
can be
carried out by any method known in the art, including but not limited to
transfection, electroporation, microinjection, infection with a viral or
bacteriophage vector containing the nucleic acid sequences, cell fusion,
chromosome-mediated gene transfer, microcell-mediated gene transfer,
spheroplast fusion, etc. Numerous techniques are known in the art for the
introduction of foreign genes into cells (see, e.g., Loei~ler and Behr, 1993,
Meth.
Enzymol. 217:599-618; Cohen et al., 1993, Meth. Enzymol. 217:618-644; Cline,
1985, Pharmac. Ther. 29:69-92) and may be used in accordance with the present
invention, provided that the necessary developmental and physiological
functions
of the recipient cells are not disrupted. The technique should provide for the
stable transfer of the nucleic acid to the cell, so that the nucleic acid is
expressible
by the cell and preferably heritable and expressible by its cell progeny.
The resulting recombinant cells can be delivered to a patient by various
methods known in the art. Recombinant blood cells (e.g., hematopoietic stem or
progenitor cells) are preferably administered intravenously. The amount of
cells
envisioned for use depends on the desired effect, patient state, etc., and can
be
determined by one skilled in the art.
Cells into which a nucleic acid can be introduced for purposes of gene
therapy encompass any desired, available cell type, and include but are not
limited
to epithelial cells, endothelial cells, keratinocytes, fibroblasts, muscle
cells,
hepatocytes; blood cells such as T-lymphocytes, B-lymphocytes, monocytes,
macrophages, neutrophils, eosinophils, megakaryocytes, granulocytes; various
stem or progenitor cells, in particular hematopoietic stem or progenitor
cells, e.g.,
as obtained from bone marrow, umbilical cord blood, peripheral blood, fetal
liver,
etc.
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-177-
In a preferred embodiment, the cell used for gene therapy is autologous to
the patient.
In an embodiment in which recombinant cells are used in gene therapy,
nucleic acid sequences encoding an antibody are introduced into the cells such
that
they are expressible by the cells or their progeny, and the recombinant cells
are
then administered in vivo for therapeutic effect. In a specific embodiment,
stem
or progenitor cells are used. Any stem and/or progenitor cells which can be
isolated and maintained in vitro can potentially be used in accordance with
this
embodiment of the present invention (see, e.g., PCT Publication WO 94/08598,
dated April 28, 1994; Stemple and Anderson, 1992, Cell 71:973-985; Rheinwald,
1980, Meth. Cell Bio. 21A:229; and Pittelkow and Scott, 1986, Mayo Clinic
Proc. 61:771 ).
In a specific embodiment, the nucleic acid to be introduced for purposes
of gene therapy comprises an inducible promoter operably linked to the coding
region, such that expression of the nucleic acid is controllable by
controlling the
presence or absence of the appropriate inducer of transcription.
Modes of Administration
The invention provides methods of treatment, inhibition and prophylaxis
by administration to a subject of an effective amount of a compound or
pharmaceutical composition ofthe invention. In a preferred aspect, the
compound
is substantially purified (e.g., substantially free from substances that limit
its effect
or produce undesired side-effects). The subject is preferably an animal,
including
but not limited to animals such as cows, pigs, horses, chickens, cats, dogs,
etc.,
and is preferably a mammal, and most preferably human.
Formulations and methods of administration that can be employed when
the compound comprises a nucleic acid or an immunoglobulin are described
above; additional appropriate formulations and routes of administration can be
selected from among those described herein below.
The agonist or antagonists described herein can be administered in vitro,
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-178-
ex vivo, or in vivo to cells which express the receptor ofthe present
invention. By
administration of an "effective amount" of an agonist or antagonist is
intended an
amount of the compound that is sufficient to enhance or inhibit a cellular
response
to a TNF-family ligand and include polypeptides. In particular, by
administration
of an "effective amount" of an agonist or antagonists is intended an amount
effective to enhance or inhibit DR3-V 1 or DR3 mediated apoptosis. Of course,
where apoptosis is to be enhanced, an agonist according to the present
invention
can be co-administered with a TNF-family ligand. One of ordinary skill will
appreciate that effective amounts of an agonist or antagonist can be
determined
empirically and may be employed in pure form or in pharmaceutically acceptable
salt, ester or prodrug form. The agonist or antagonist may be administered in
compositions in combination with one or more pharmaceutically acceptable
excipients.
It will be understood that, when administered to a human patient, the total
daily usage of the compounds and compositions of the present invention will be
decided by the attending physician within the scope of sound medical
judgement.
The specific therapeutically effective dose level for any particular patient
will
depend upon factors well known in the medical arts.
As a general proposition, the total pharmaceutically effective amount of
a DR3 polypeptide administered parenterally per dose will be in the range of
about
1 ~g/kg/day to 10 mg/kg/day of patient body weight, although, as noted above,
this will be subject to therapeutic discretion. More preferably, this dose is
at least
0.01 mg/kg/day, and most preferably for humans between about 0.01 and 1
mg/kg/day for the hormone. If given continuously, the DR3 agonists or
antagonists is typically administered at a dose rate of about 1 ~g/kg/hour to
about
50 ~g/kg/hour, either by 1-4 injections per day or by continuous subcutaneous
infusions, for example, using a mini-pump. An intravenous bag solution may
also
be employed.
Dosaging may also be arranged in a patient specific manner to provide a
predetermined concentration of an agonist or antagonist in the blood, as
determined by the RIA technique. Thus patient dosaging may be adjusted to
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-179-
achieve regular on-going trough blood levels, as measured by RIA, on the order
of from 50 to 1000 ng/ml, preferably 150 to 500 ng/ml.
Various delivery systems are known and can be used to administer a
compound of the invention, e.g., encapsulation in liposomes, microparticles,
microcapsules, recombinant cells capable of expressing the compound, receptor
mediated endocytosis (see, e.g., Wu and Wu, 1987, J. Biol. Chem. 262:4429-
4432), construction of a nucleic acid as part of a retroviral or other vector,
etc.
Methods of introduction include but are not limited to intradermal,
intramuscular,
intraperitoneal, intravenous, subcutaneous, intranasal, epidural, and oral
routes.
The compounds or compositions may be administered by any convenient route,
for example by infusion or bolus injection, by absorption through epithelial
or
mucocutaneous linings (e.g., oral mucosa, rectal and intestinal mucosa, etc.)
and
may be administered together with other biologically active agents.
Administration can be systemic or local. In addition, it may be desirable to
introduce the pharmaceutical compounds or compositions ofthe invention into
the
central nervous system by any suitable route, including intraventricular and
intrathecal injection; intraventricular injection may be facilitated by an
intraventricular catheter, for example, attached to a reservoir, such as an
Ommaya
reservoir. Pulmonary administration can also be employed, e.g., by use of an
inhaler or nebulizer, and formulation with an aerosolizing agent.
Pharmaceutical compositions are provided comprising an agonist or
antagonist and a pharmaceutically acceptable carrier or excipient, which may
be
administered orally, rectally, parenterally, intracistemally, intravaginally,
intraperitoneally, topically (as by powders, ointments, drops or transdermal
patch),
bucally, or as an oral or nasal spray. Importantly, by co-administering an
agonist
and a TNF-family ligand, clinical side effects can be reduced by using lower
doses
of both the ligand and the agonist. It will be understood that the agonist can
be
"co-administered" either before, after, or simultaneously with the TNF-family
ligand, depending on the exigencies of a particular therapeutic application.
By
"pharmaceutically acceptable carrier" is meant a non-toxic solid, semisolid or
liquid filler, diluent, encapsulating material or formulation auxiliary of any
type.
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-180-
The term "parenteral" as used herein refers to modes of administration which
include intravenous, intramuscular, intraperitoneal, intrasternal,
subcutaneous and
intraarticular injection and infusion.
Pharmaceutical compositions of the present invention for parenteral
injection can comprise pharmaceutically acceptable sterile aqueous or
nonaqueous
solutions, dispersions, suspensions or emulsions as well as sterile powders
for
reconstitution into sterile injectable solutions or dispersions just prior to
use.
In addition to soluble DR3-V1 or DR3 polypeptides, DR3-V1 or DR3
polypeptide containing the transmembrane region can also be used when
appropriately solubilized by including detergents, such as CHAPS or NP-40,
with
buffer.
In a specific embodiment, it may be desirable to administer the
pharmaceutical compounds or compositions of the invention locally to the area
in
need of treatment; this may be achieved by, for example, and not by way of
limitation, local infusion during surgery, topical application, e.g., in
conjunction
with a wound dressing after surgery, by injection, by means of a catheter, by
means of a suppository, or by means of an implant, said implant being of a
porous,
non-porous, or gelatinous material, including membranes, such as sialastic
membranes, or fibers. Preferably, when administering a protein, including an
antibody, of the invention, care must be taken to use materials to which the
protein does not absorb.
In another embodiment, the compound or composition can be delivered
in a vesicle, in particular a liposome (see Langer, 1990, Science 249:1527-
1533;
Treat et al., in Liposomes in the Therapy of Infectious Disease and Cancer,
Lopez-Berestein and Fidler (eds.), Liss, New York, pp. 353-365 (1989); Lopez-
Berestein, ibid., pp. 317-327; see generally ibid.)
In yet another embodiment, the compound or composition can be delivered
in a controlled release system. In one embodiment, a pump may be used (see
Langer, supra; Sefton, 1987, C'RC Crit. Ref. Biomed. Eng. 14:201; Buchwald et
al., 1980, Surgery 88:507; Saudek et al., 1989, N. Engl. J. Med. 321:574). In
another embodiment, polymeric materials can be used (see Medical Applications
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-181-
of Controlled Release, Langer and Wise (eds.), CRC Pres., Boca Raton, Florida
(1974); Controlled Drug Bioavailability, Drug Product Design and Performance,
Smolen and Ball (eds.), Wiley, New York (1984); Ranger and Peppas, J., 1983,
Macromol. Sci. Rev. Macromol. Chem. 23:61; see also Levy et al., 1985, Science
228:190; During et al., 1989, Ann. Neurol. 25:351; Howard et al., 1989, J
Neurosurg. 71:105). In yet another embodiment, a controlled release system can
be placed in proximity of the therapeutic target, i. e., the brain, thus
requiring only
a fraction of the systemic dose (see, e.g., Goodson, in Medical Applications
of
Controlled Release, supra, vol. 2, pp. 115-138 (1984)).
Other controlled release systems are discussed in the review by Langer
(1990, Science 249:1527-1533).
In a specific embodiment where the compound of the invention is a nucleic
acid encoding a protein, the nucleic acid can be administered in vivo to
promote
expression of its encoded protein, by constructing it as part of an
appropriate
nucleic acid expression vector and administering it so that it becomes
intracellular,
e.g., by use of a retroviral vector (see U.S. Patent No. 4,980,286), or by
direct
injection, or by use of microparticle bombardment (e.g., a gene gun;
Biolistic,
Dupont), or coating with lipids or cell-surface receptors or transfecting
agents, or
by administering it in linkage to a homeobox- like peptide which is known to
enter
the nucleus (see, e.g., Joliot et al., 1991, Proc. Natl. Acad. Sci. USA
88:1864-
1868), etc. Alternatively, a nucleic acid can be introduced intracellularly
and
incorporated within host cell DNA for expression, by homologous recombination.
The present invention also provides pharmaceutical compositions. Such
compositions comprise a therapeutically effective amount of a compound, and a
pharmaceutically acceptable carrier. In a specific embodiment, the term
"pharmaceutically acceptable" means approved by a regulatory of the Federal or
a state government or listed in the U.S. Pharmacopeia or other generally
recognized pharmacopeia for use in animals, and more particularly in humans.
The term "carrier" refers to a diluent, adjuvant, excipient, or vehicle with
which
the therapeutic is administered. Such pharmaceutical carriers can be sterile
liquids, such as water and oils, including those of petroleum, animal,
vegetable or
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-182-
synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and
the
like. Water is a preferred carrier when the pharmaceutical composition is
administered intravenously. Saline solutions and aqueous dextrose and glycerol
solutions can also be employed as liquid carriers, particularly for injectable
solutions. Suitable pharmaceutical excipients include starch, glucose,
lactose,
sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate,
glycerol
monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene,
glycol,
water, ethanol and the like. The composition, if desired, can also contain
minor
amounts of wetting or emulsifying agents, or pH buffering agents. These
compositions can take the form of solutions, suspensions, emulsion, tablets,
pills,
capsules, powders, sustained-release formulations and the like. The
composition
can be formulated as a suppository, with traditional binders and carriers such
as
triglycerides. Oral formulation can include standard - carriers such as
pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium
saccharine, cellulose, magnesium carbonate, etc. Examples of suitable
pharmaceutical carriers are described in "Remington's Pharmaceutical Sciences"
by E.W. Martin. Such compositions will contain a therapeutically effective
amount of the compound, preferably in purified form, together with a suitable
amount of carrier so as to provide the form for proper administration to the
patient. The formulation should suit the mode of administration.
The compounds of the invention can be formulated as neutral or salt
forms. Pharmaceutically acceptable salts include those formed with anions such
as those derived from hydrochloric, phosphoric, acetic, oxalic, tartaric
acids, etc.,
and those formed with canons such as those derived from sodium, potassium,
ammonium, calcium, ferric hydroxides, isopropylamine, triethylamine, 2-
ethylamino ethanol, histidine, procaine, etc.
The amount of the compound of the invention which will be effective in
the treatment, inhibition and/or prevention of a disease or disorder
associated with
aberrant expression and/or activity of a polypeptide of the invention can be
determined by standard clinical techniques. In addition, in vitro assays may
optionally be employed to help identify optimal dosage ranges. The precise
dose
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-183-
to be employed in the formulation will also depend on the route of
administration,
and the seriousness of the disease or disorder, and should be decided
according
to the judgment of the practitioner and each patient's circumstances.
Effective
doses may be extrapolated from dose-response curves derived from in vitro or
animal model test systems.
For antibodies, the dosage administered to a patient is typically 0.1 mg/kg
to 100 mg/kg of the patient's body weight. Preferably, the dosage administered
to a patient is between 0.1 mg/kg and 20 mg/kg of the patient's body weight,
more preferably 1 mg/kg to 10 mg/kg of the patient's body weight. Generally,
human antibodies have a longer half life within the human body than antibodies
from other species due to the immune response to the foreign polypeptides.
Thus,
lower dosages of human antibodies and less frequent administration is often
possible. Further, the dosage and frequency of administration of antibodies
ofthe
invention may be reduced by enhancing uptake and tissue penetration (e.g.,
into
the brain) of the antibodies by modifications such as, for example,
lipidation.
In a preferred embodiment, the composition is formulated in accordance
with routine procedures as a pharmaceutical composition adapted for
intravenous
administration to human beings. Typically, compositions for intravenous
administration are solutions in sterile isotonic aqueous buffer. Where
necessary,
the composition may also include a solubilizing agent and a local anesthetic
such
as lignocaine to ease pain at the site of the injection. Generally, the
ingredients are
supplied either separately or mixed together in unit dosage form, for example,
as
a dry lyophilized powder or water free concentrate in a hermetically sealed
container such as an ampule or sachette indicating the quantity of active
agent.
Where the composition is to be administered by infusion, it can be dispensed
with
an infusion bottle containing sterile pharmaceutical grade water or saline.
Where
the composition is administered by injection, an ampule of sterile water for
injection or saline can be provided so that the ingredients may be mixed prior
to
administration.
The compounds or pharmaceutical compositions of the invention are
preferably tested in vitro, and then in vivo for the desired therapeutic or
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-184-
prophylactic activity, prior to use in humans. For example, in vitro assays to
demonstrate the therapeutic or prophylactic utility of a compound or
pharmaceutical composition include, the effect of a compound on a cell line or
a
patient tissue sample. The effect of the compound or composition on the cell
line
and/or tissue sample can be determined utilizing techniques known to those of
skill
in the art including, but not limited to, rosette formation assays and cell
lysis
assays. In accordance with the invention, in vitro assays which can be used to
determine whether administration of a specific compound is indicated, include
in
vitro cell culture assays in which a patient tissue sample is grown in
culture, and
exposed to or otherwise administered a compound, and the effect of such
compound upon the tissue sample is observed.
The compositions of the invention may be administered alone or in
combination with other therapeutic agents. Therapeutic agents that may be
administered in combination with the compositions of the invention, include
but
not limited to, other members of the TNF family, chemotherapeutic agents,
antibiotics, steroidal and non-steroidal anti-inflammatories, conventional
immunotherapeutic agents, cytokines and/or growth factors. Combinations may
be administered either concomitantly, e.g., as an admixture, separately but
simultaneously or concurrently; or sequentially. This includes presentations
in
which the combined agents are administered together as a therapeutic mixture,
and
also procedures in which the combined agents are administered separately but
simultaneously, e.g., as through separate intravenous lines into the same
individual. Administration "in combination" further includes the separate
administration of one of the compounds or agents given first, followed by the
second.
In one embodiment, the compositions of the invention are administered in
combination with other members of the TNF family. TNF, TNF-related or TNF-
like molecules that may be administered with the compositions of the invention
include, but are not limited to, soluble forms of TNF-a, lymphotoxin-a (LT-a,
also known as TNF-(3), LT-~3 (found in complex heterotrimer LT-a2-Vii), OPGL,
Fast, CD27L, CD30L, CD40L, 4-1BBL, DcR3, OX40L, TNF-y (International
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-185-
Publication No. WO 96/14328), TNF-y-a (International Publication No. WO
00/08139), TNF-y-~3 (International Publication No. WO 00/08139), AIM-I
(International Publication No. WO 97/33899), AIM-II (International Publication
No. WO 97/34911), endokine-a (International Publication No. WO 98/07880),
TR6 (International Publication No. WO 98/30694), OPG, and neutrokine-a
(International Publication No. WO 98/18921, OX40, and nerve growth factor
(NGF), and soluble forms of Fas, CD30, CD27, CD40 and 4-IBB, TR2
(International Publication No. WO 96/34095), DR4 (International Publication
No. WO 98/32856), TRS (International Publication No. WO 98/30693), TR6
(International Publication No. WO 98/30694), TR7 (International PublicationNo.
WO 98/41629), TRANK, TR9 (International Publication No. WO
98/56892),TR10 (International Publication No. WO 98/54202), 31X2
(International Publication No. WO 98/06842), and TR12, and soluble forms of
CD 154, CD70, and CD 153 .
In another embodiment, the compositions ofthe invention are administered
in combination with CD40 ligand (CD40L), a soluble form of CD40L (e.g.,
AVRENDT""), biologically active fragments, variants, or derivatives of CD40L,
anti-CD40L antibodies (e.g., agonistic or antagonistic antibodies), and/or
anti-
CD40 antibodies (e.g., agonistic or antagonistic antibodies).
In yet another embodiment, the compositions of the invention are
administered in combination with one, two, three, four, five, or more of the
following compositions: tacrolimus (Fujisawa), thalidomide (e.g., Celgene),
anti-
Tac(Fv)-PE40 (e.g., Protein Design Labs), inolimomab (Biotest), MAK-195F
(Knoll), ASM-981 (Novartis), interleukin-1 receptor(e.g., Immunex),
interleukin-
4 receptor (e.g., Immunex), ICM3 (ICOS), BMS-188667 (Bristol-Myers Squibb),
anti-TNF Ab (e.g., Therapeutic antibodies), CG-1088 (Celgene), anti-B7 Mab
(e.g., Innogetics), MEDI-507 (BioTransplant), ABX-CBL (Abgenix).
In certain embodiments, compositions of the invention are administered in
combination with antiretroviral agents, nucleoside reverse transcriptase
inhibitors,
non-nucleoside reverse trariscriptase inhibitors, and/or protease inhibitors.
Nucleoside reverse transcriptase inhibitors that may be administered in
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-186-
combination with the compositions of the invention, include, but are not
limited
to, RETROVIRTM (zidovudine/AZT), VIDEXT"~ (didanosine/ddI), HIVIDT~~
(zalcitabine/ddC), ZERITT"' (stavudine/d4T), EPIVIRT~" (lamivudine/3TC), and
COMBIVIRT"~ (zidovudine/lamivudine). Non-nucleoside reverse transcriptase
inhibitors that may be administered in combination with the compositions of
the
invention, include, but are not limited to, VIRAMUNET"" (nevirapine),
RESCRIPTORT"' (delavirdine), and SUSTIVAT"~ (efavirenz). Protease inhibitors
that may be administered in combination with the compositions of the
invention,
include, but are not limited to, CRIXIVANT"" (indinavir), NORVIRT""
(ritonavir),
INVIRASET"' (saquinavir), and VIRACEPTT~" (nelfinavir). In a specific
embodiment, antiretroviral agents, nucleoside reverse transcriptase
inhibitors, non-
nucleoside reverse transcriptase inhibitors, and/or protease inhibitors may be
used
in any combination with compositions of the invention to treat, prevent,
and/or
diagnose AIDS and/or to treat, prevent, and/or diagnose HIV infection. 1
In other embodiments, compositions ofthe invention may be administered
in combination with anti-opportunistic infection agents. Anti-opportunistic
agents
that may be administered in combination with the compositions of the
invention,
include, but are not limited to, TRIMETHOPRIM-SULFAMETHOXAZOLET"',
DAPSONET"", PENTAMID1NET"", ATOVAQUONET"~, ISONIAZIDT"",
RIFAMPINT"~, PYRAZINAMIDET"~, ETHAMBUTOLT"", RIFABUTINT"~,
CLARITHROMYCINT"~, AZITHROMYCINT"", GANCICLOVIRT"~,
FOSCARNETT"", CIDOFOVIRT"", FLUCONAZOLET"~, ITRACONAZOLET~",
KETOCONAZOLET~~, ACYCLOVIRT"~, FAMCICOLVIRT"~,
PYRIMETHAMINET"', LEUCOVORINr"", NEUPOGENT"" (filgrastim/G-CSF),
and LEUKINET"" (sargramostim/GM-CSF). In a specific embodiment,
compositions of the invention are used in any combination with
TRIMETHOPRIM-SULFAMETHOXAZOLET"~, DAPSONET"',
PENTAMIDINET"", and/or ATOVAQUONET"~ to prophylactically treat, prevent,
and/or diagnose an opportunistic Pneumocystis carinii pneumonia infection. In
another specific embodiment, compositions of the invention are used in any
combination with ISONIAZIDT"~, RIFAMPINT"~, PYRAZINAMIDEr"~, and/or
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-187-
ETHAMBUTOLT"" to prophylactically treat, prevent, and/or diagnose an
opportunistic Mycobacterium avium complex infection. In another specific
embodiment, compositions of the invention are used in any combination with
RIFABUTINT"', CLARITHROMYCINT~", and/or AZITHROMYCINT"" to
prophylactically treat, prevent, and/or diagnose an opportunistic
Mycobacterium
tuberculosis infection. In another specific embodiment, compositions of the
invention are used in any combination with GANCICLOVIRT"~, FOSCARNETT"",
and/or CIDOFOVIRT"~ to prophylactically treat, prevent, and/or diagnose an
opportunistic cytomegalovirus infection. In another specific embodiment,
compositions of the invention are used in any combination with
FLUCONAZOLET"', ITRACONAZOLET"~, and/or KETOCONAZOLET"" to
prophylactically treat, prevent, and/or diagnose an opportunistic fungal
infection.
In another specific embodiment, compositions of the invention are used in any
combination with ACYCLOVIRT"" and/or FAMCICOLVIRT"~ to prophylactically
treat, prevent, and/or diagnose an opportunistic herpes simplex virus type I
and/or
type II infection. In another specific embodiment; compositions of the
invention
are used in any combination with PYRIMETHAMINET"~ and/or LEUCOVORINr""
to prophylactically treat, prevent, and/or diagnose an opportunistic
Toxoplasma
gondii infection. In another specific embodiment, compositions of the
invention
are used in any combination with LEUCOVORINr"~ and/or NEUPOGENT"" to
prophylactically treat, prevent, and/or diagnose an opportunistic bacterial
infection.
In a further embodiment, the compositions of the invention are
administered in combination with an antiviral agent. Antiviral agents that may
be
administered with the compositions of the invention include, but are not
limited
to, acyclovir, ribavirin, amantadine, and remantidine.
In a further embodiment, the compositions of the invention are
administered in combination with an antibiotic agent. Antibiotic agents that
may
be administered with the compositions of the invention include, but are not
limited to, amoxicillin, aminoglycosides, ~i-lactam (glycopeptide), (3-
lactamases,
Clindamycin, chloramphenicol, cephalosporins, ciprofloxacin,. ciprofloxacin,
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-188-
erythromycin, fluoroquinolones, macrolides, metronidazole, penicillins,
quinolones, rifampin, streptomycin, sulfonamide, tetracyclines, trimethoprim,
trimethoprim-sulfamthoxazole, and vancomycin.
Conventional nonspecific immunosuppressive agents, that may be
administered in combination with the compositions of the invention include,
but
are not limited to, steroids, cyclosporine, cyclosporine analogs,
cyclophosphamide
methylprednisone, prednisone, azathioprine, FK-506, 15-deoxyspergualin, and
other immunosuppressive agents that act by suppressing the function of
responding T cells.
In specific embodiments, compositions of the invention are administered ,
in combination with immunosuppressants. Immunosuppressants preparations that
may be administered with the compositions of the invention include, but are
not
limited to, ORTHOCLONET"" (OKT3), SANDIIVIMLTNET""/NEORALT"~~
SANGDYAT"" (cyclosporin), PROGRAFT"~ (tacrolimus), CELLCEPTT"~
(mycophenolate), Azathioprine, glucorticosteroids, and RAPAIVIUNET"~
(sirolimus). In a specific embodiment, immunosuppressants may be used to
prevent rejection of organ or bone marrow transplantation.
In one embodiment, the compositions of the invention are administered
in combination with steroid therapy. Steroids that may be administered in
combination with the compositions of the invention, include, but are not
limited
to, oral corticosteroids, prednisone, and methylprednisolone (e.g., IV
methylprednisolone). In a specific embodiment, compositions ofthe invention
are
administered in combination with prednisone. In a further specific embodiment,
the compositions of the invention are administered in combination with
prednisone and an immunosuppressive agent. Immunosuppressive agents that
may be administered with the compositions of the invention and prednisone are
those described herein, and include, but are not limited to, azathioprine,
cylophosphamide, and cyclophosphamide IV. In a another specific embodiment,
compositions of the invention are administered in combination with
methylprednisolone. In a further specific embodiment, the compositions of the
invention are administered in combination with methylprednisolone and an
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-189-
immunosuppressive agent. Immunosuppressive agents that may be administered
with the compositions of the invention and methylprednisolone are those
described herein, and include, but are not limited to, azathioprine,
cylophosphamide, and cyclophosphamide IV.
In another embodiment, the compositions of the invention are
administered in combination with an antimalarial. Antimalarials that may be
administered with the compositions of the invention include, but are not
limited
to, hydroxychloroquine, chloroquine, and/or quinacrine.
In one embodiment, the compositions of the invention are administered
in combination with an NSAlT7.
In another embodiment, the compositions of the invention are
administered in combination with one, two, three, four, five, ten, or more of
the
following drugs: NRD-101 (Hoechst Marion Roussel), diclofenac (Dimethaid),
oxaprozin potassium (Monsanto), mecasermin (Chiron), T-614 (Toyama),
pemetrexed disodium (Eli Lilly), atreleuton (Abbott), valdecoxib (Monsanto),
eltenac (Byk Gulden), campath, AGM-1470 (Takeda), CDP-571 (Celltech
Chiroscience), CM-101 (CarboMed), ML-3000 (Merckle), CB-2431 (KS
Biomedix), CBF-BS2 (KS Biomedix), IL-1Ra gene therapy (Valentis), JTE-522
(Japan Tobacco), paclitaxel (Angiotech), DW-166HC (bong Wha), darbufelone
mesylate (Warner-Lambert), soluble TNF receptor 1 (synergen; Amgen), 1PR-
6001 (Institute for Pharmaceutical Research), trocade (Hoffman-La Roche), EF-5
(Scotia Pharmaceuticals), BILL-284 (Boehringer Ingelheim), BIIF-1149
(Boehringer Ingelheim), LeukoVax (Inflammatics), MK-663 (Merck), ST-1482
(Sigma-Tau), and butixocort propionate (WarnerLambert).
In yet another embodiment, the compositions of the invention are
administered in combination with one, two, three, four, five or more of the
following drugs: methotrexate, sulfasalazine, sodium aurothiomalate,
auranofin,
cyclosporine, penicillamine, azathioprine, an antimalarial drug (e.g., as
described
herein), cyclophosphamide, chlorambucil, gold, ENBRELT"~ (Etanercept), anti-
TNF antibody, and prednisolone. In a more preferred embodiment, the
compositions of the invention are administered in combination with an
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-190-
antimalarial, methotrexate, anti-TNF antibody, ENBRELT"" and/or suflasalazine.
In one embodiment, the compositions of the invention are administered in
combination with methotrexate. In another embodiment, the compositions of the
invention are administered in combination with anti-TNF antibody. In another
embodiment, the compositions of the invention are administered in combination
with methotrexate and anti-TNF antibody. In another embodiment, the
compositions ofthe invention are administered in combination with
suflasalazine.
In another specific embodiment, the compositions of the invention are
administered in combination with methotrexate, anti-TNF antibody, and
suflasalazine. In another embodiment, the compositions of the invention are
administered in combination ENBRELT"'. In another embodiment, the
compositions of the invention are administered in combination with ENBRELT"'
and methotrexate. In another embodiment, the compositions of the invention are
administered in combination with ENBRELT"", methotrexate and suflasalazine.
In another embodiment, the compositions of the invention are administered in
combination with ENBRELT"", methotrexate and suflasalazine. In other
embodiments, one or more antimalarials is combined with one of the above-
recited combinations. In a specific embodiment, the compositions of the
invention are administered in combination with an antimalarial (e.g.,
hydroxychloroquine), ENBRELT"~, methotrexate and suflasalazine. In another
specific embodiment, the compositions of the invention are administered in
combination with an antimalarial (e.g., hydroxychloroquine), sulfasalazine,
anti-
TNF antibody, and methotrexate.
In a further embodiment, the compositions of the invention are
administered in combination with an antibiotic agent. Antibiotic agents that
may
be administered with the compositions of the invention include, but are not
limited to, tetracycline, metronidazole, amoxicillin, (3-lactamases,
aminoglycosides, macrolides, quinolones, fluoroquinolones, cephalosporins,
erythromycin, ciprofloxacin, and streptomycin.
In an additional embodiment, the compositions of the invention are
administered alone or in combination with an anti-inflammatory agent. Anti-
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-191-
inflammatory agents that may be administered with the compositions of the
invention include, but are not limited to, glucocorticoids and the
nonsteroidal
anti-inflammatories, aminoarylcarboxylic acid derivatives, arylacetic acid
derivatives, arylbutyric acid derivatives, arylcarboxylic acids, arylpropionic
acid
derivatives, pyrazoles, pyrazolones, salicylic acid derivatives,
thiazinecarboxamides, e-acetamidocaproicacid, S-adenosylmethionine, 3-amino
4-hydroxybutyric acid, amixetrine, bendazac, benzydamine, bucolome,
difenpiramide, ditazol, emorfazone, guaiazulene, nabumetone, nimesulide,
orgotein, oxaceprol, paranyline, perisoxal, pifoxime, proquazone, proxazole,
and
tenidap.
In another embodiment, compositions of the invention are administered
in combination with a chemotherapeutic agent. Chemotherapeutic agents that
may be administered with the compositions of the invention include, but are
not
limited to, antibiotic derivatives (e.g., doxorubicin, bleomycin,
daunorubicin, and
dactinomycin); antiestrogens (e.g., tamoxifen); antimetabolites (e.g.,
fluorouracil,
5-FU, methotrexate, floxuridine, interferon a-2b, glutamic acid, plicamycin,
mercaptopurine, and 6-thioguanine); cytotoxic agents (e.g., carmustine, BCNU,
lomustine, CCNLT, cytosine arabinoside, cyclophosphamide, estramustine,
hydroxyurea, procarbazine, mitomycin, busulfan, cis-platin, and vincristine
sulfate); hormones (e.g., medroxyprogesterone, estramustine phosphate sodium,
ethinyl estradiol, estradiol, megestrol acetate, methyltestosterone,
diethylstilbestrol diphosphate, chlorotrianisene, and testolactone); nitrogen
mustard derivatives (e.g., mephalen, chorambucil, mechlorethamine (nitrogen
mustard) and thiotepa); steroids and combinations (e.g., bethamethasone sodium
phosphate); and others (e.g., dicarbazine, asparaginase, mitotane, vincristine
sulfate, vinblastine sulfate, and etoposide).
In an additional embodiment, the compositions of the invention are
administered in combination with cytokines. Cytokines that may be administered
with the compositions of the invention include, but are not limited to, IL-2,
IL-3,
IL,-4, IL-5, IL,-6, IL-7, IL,-10, IL-12, IL,-13, IL,-15, anti-CD40, CD40L, IFN-
y
and TNF-a.
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-192-
In an additional embodiment, the compositions of the invention are
administered in combination with angiogenic proteins. Angiogenic proteins that
may be adnunistered with the compositions of the invention include, but are
not
limited to, Glioma Derived Growth Factor (GDGF), as disclosed in European
Patent Number EP-399816; Platelet Derived Growth Factor-A (PDGF-A), as
disclosed in European Patent Number EP-682110; Platelet Derived Growth
Factor-B (PDGF-B), as disclosed in European Patent Number EP-282317;
Placental Growth Factor (P1GF), as disclosed in International Publication
Number
WO 92/06194; Placental Growth Factor-2 (P1GF-2), as disclosed in Hauser et
al.,
Growth Factors, 4:259-268(1993); Vascular Endothelial GrowthFactor(VEGF),
as disclosed in International Publication Number WO 90/13649; Vascular
Endothelial Growth ~ Factor-A (VEGF-A), as disclosed in European Patent
Number EP-506477; Vascular Endothelial Growth Factor-2 (VEGF-2), as
disclosed in International Publication Number WO 96/39515; Vascular
Endothelial
Growth Factor B-186 (VEGF-B 186), as disclosed in International Publication
Number WO 96/26736; Vascular Endothelial Growth Factor-D (VEGF-D), as
disclosed in International Publication Number WO 98/02543; Vascular
Endothelial
Growth Factor-D (VEGF-D), as disclosed in International Publication Number
WO 98/07832; and Vascular Endothelial Growth Factor-E (VEGF-E), as
disclosed in German Patent Number DE19639601. The above mentioned
references are incorporated herein by reference herein.
In an additional embodiment, the compositions of the invention are
administered in combination with Fibroblast Growth Factors. Fibroblast Growth
Factors that may be administered with the compositions of the invention
include,
but are not limited to, FGF-1, FGF-2, FGF-3, FGF-4, FGF-5, FGF-6, FGF-7,
FGF-8, FGF-9, FGF-10, FGF-11, FGF-12, FGF-13, FGF-14, and FGF-15.
In additional embodiments, the compositions of the invention are
administered in combination with other therapeutic or prophylactic regimens,
such as, for example, radiation therapy.
The invention also provides a method of delivering compositions
containing the polypeptides of the invention (e.g., compositions containing
DR3
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-193-
polypeptides or anti-DR3 antibodies associated with heterologous polypeptides,
heterologous nucleic acids, toxins, or prodrugs) to targeted cells, expressing
the
membrane-bound form of DR3 on their surface, or alternatively, an DR3 receptor
on their surface. DR3 polypeptides or anti-DR3 antibodies of the invention may
~ be associated with heterologous polypeptides, heterologous nucleic acids,
toxins,
or prodrugs via hydrophobic, hydrophilic, ionic and/or covalent interactions.
In one embodiment, the invention provides a method for the specific
delivery of compositions of the invention to cells by administering
polypeptides
of the invention (e.g., DR3 or anti-DR3 antibodies) that are associated with
heterologous polypeptides or nucleic acids. In one example, the invention
provides a method for delivering a therapeutic protein into the targeted cell.
In
another example, the invention provides a method for delivering a single
stranded
nucleic acid (e.g., antisense or ribozymes) or double stranded nucleic acid
(e.g.,
DNA that can integrate into the cell's genome or replicate episomally and that
can
be transcribed) into the targeted cell.
In another embodiment, the invention provides a method for the specific
destruction of cells (e.g., the destruction of tumor cells) by administering
polypeptides ofthe invention (e.g., DR3 polypeptides or anti-DR3 antibodies)
in
association with toxins or cytotoxic prodrugs.
In a specific embodiment, the invention provides a method for the specific
destruction of cells expressing the membrane-bound form ofDR3 on their surface
(e.g., spleen, bone marrow, kidney and PBLs) by administering anti-DR3
antibodies in association with toxins or cytotoxic prodrugs.
By "toxin" is meant compounds that bind and activate endogenous
cytotoxic erector systems, radioisotopes, holotoxins, modified toxins,
catalytic
subunits of toxins, cytotoxins (cytotoxic agents), or any molecules or enzymes
not normally present in or on the surface of a cell that under defined
conditions
cause the cell's death. Toxins that may be used according to the methods of
the
invention include, but are not limited to, radioisotopes known in the art,
compounds such as, for example, antibodies (or complement fixing containing
portions thereof) that bind an inherent or induced endogenous cytotoxic
effector
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-194-
system, thymidine kinase, endonuclease, RNAse, alpha toxin, ricin, abrin,
P.seudomonas exotoxin A, diphtheria toxin, saporin, momordin, gelonin,
pokeweed antiviral protein, a-sarcin and cholera toxin. "Toxin" also includes
a
cytostatic or cytocidal agent, a therapeutic agent or a radioactive metal ion,
e.g.,
a-emitters such as, for example, 2'3Bi, or other radioisotopes such as, for
example,'°3Pd, 133~re' 131I' G8Ge' S7C~' 65Zn' SSsr' 32P' 355' 90y'
153sm' 153Gd' 169«'
5'Cr, 54Mn, '55e, "35n, 9°Yttrium, "'Tin, l~6Rhenium, '6GHolmium, alnUd
'ggRhenium; luminescent labels, such as luminol; and fluorescent labels, such
as
fluorescein and rhodamine, and biotin.
Techniques known in the art may be applied to label proteins (including
antibodies) of the invention. Such techniques include, but are not limited to,
the
use of bifunctional conjugating agents (see, e.g., U.S. Patent Nos. 5,756,065;
5,714,631; 5,696,239; 5,652,361; 5,505,931; 5,489,425; 5,435,990; 5,428,139;
5,342,604; 5,274,119; 4,994,560; and 5,808,003; the contents of each of which
are hereby incorporated by reference in its entirety). A cytotoxin or
cytotoxic
agent includes any agent that is detrimental to cells. Examples include
paclitaxol,
cytochalasin B, gramicidin D, ethidium bromide, emetine, mitomycin, etoposide,
tenoposide, vincristine, vinblastine, colchicin, doxorubicin, daunorubicin,
dihydroxy anthracin dione, mitoxantrone, mithramycin, actinomycin D, 1-
dehydrotestosterone, glucocorticoids, procaine, tetracaine, lidocaine,
propranolol,
and puromycin and analogs or homologs thereof. Therapeutic agents include, but
are not limited to, antimetabolites (e.g., methotrexate, 6-mercaptopurine, 6-
thioguanine, cytarabine, 5-fluorouracil decarbazine), alkylating agents (e.g.,
mechlorethamine, thioepa chlorambucil, melphalan, carmustine (BSNU) and
lomustine (CCNU), cyclothosphamide, busulfan, dibromomannitol,
streptozotocin, mitomycin C, and cis-dichlorodiamine platinum (II) (DDP)
cisplatin), anthracyclines (e.g., daunorubicin (formerly daunomycin) and
doxorubicin), antibiotics (e.g., dactinomycin (formerly actinomycin),
bleomycin,
mithramycin, and anthramycin (AMC)), and anti-mitotic agents (e.g.,
vincristine
and vinblastine).
By "cytotoxic prodrug" is meant a non-toxic compound that is converted
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-195-
by an enzyme, normally present in the cell, into a cytotoxic compound.
Cytotoxic
prodrugs that may be used according to the methods ofthe invention include,
but
are not limited to, glutamyl derivatives of benzoic acid mustard alkylating
agent,
phosphate derivatives of etoposide or mitomycin C, cytosine arabinoside,
daunorubisin, and phenoxyacetamide derivatives of doxorubicin.
As discussed in more detail below, the invention also provides a
pharmaceutical pack or kit comprising one or more containers filled with one
or
more of the ingredients of the pharmaceutical compositions of the invention.
Optionally associated with such containers) can be a notice in the form
prescribed by a governmental agency regulating the manufacture, use or sale of
pharmaceuticals or biological products, which notice reflects approval by the
agency of manufacture, use or sale for human administration.
Diagnosis and Imaging
Labeled antibodies, and derivatives and analogs thereof, which specifically
bind to a polypeptide of interest can be used for diagnostic purposes to
detect,
diagnose, or monitor diseases and/or disorders associated with the aberrant
expression and/or activity of a polypeptide of the invention. The invention
provides for the detection of aberrant expression of a polypeptide of
interest,
comprising (a) assaying the expression of the polypeptide of interest in cells
or
body fluid of an individual using one or more antibodies specific to the
polypeptide interest and (b) comparing the level of gene expression with a
standard gene expression level, whereby an increase or decrease in the assayed
polypeptide gene expression level compared to the standard expression level is
indicative of aberrant expression.
The invention provides a diagnostic assay for diagnosing a disorder,
comprising (a) assaying the expression of the polypeptide of interest in cells
or
body fluid of an individual using one or more antibodies specific to the
polypeptide interest and (b) comparing the level of gene expression with a
standard gene expression level, whereby an increase or decrease in the assayed
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-196-
polypeptide gene expression level compared to the standard expression level is
indicative of a particular disorder. With respect to cancer, the presence of a
relatively high amount of transcript in biopsied tissue from an individual may
indicate a predisposition for the development of the disease, or may provide a
means for detecting the disease prior to the appearance of actual clinical
symptoms. A more definitive diagnosis of this type may allow health
professionals to employ preventative measures or aggressive treatment earlier
thereby preventing the development or further progression of the cancer.
Antibodies of the invention can be used to assay protein levels in a
biological sample using classical immunohistological methods known to those of
skill in the art (e.g., see Jalkanen, M. et al., J. Cell. Biol. 101:976-985
(1985);
Jalkanen, M. etal., J. Cell.. Biol. 105:3087-3096 (1987)). Other antibody-
based
methods useful for detecting protein gene expression include immunoassays,
such
as the enzyme linked immunosorbent assay (ELISA) and the radioimmunoassay
(RIA). Suitable antibody assay labels are known in the art and include enzyme
labels, such as, glucose oxidase; radioisotopes, such as iodine ('zSI, 'z'I),
carbon
('4C), sulfur (35S), tritium (3H), indium ("zIn), and technetium (99Tc);
luminescent
labels, such as luminol; and fluorescent labels, such as fluorescein and
rhodamine,
and biotin.
One aspect of the invention is the detection and diagnosis of a disease or
disorder associated with aberrant expression of a polypeptide of the interest
in an
animal, preferably a mammal and most preferably a human. In one embodiment,
diagnosis comprises: a) administering (for example, parenterally,
subcutaneously,
or intraperitoneally) to a subject an effective amount of a labeled molecule
which
specifically binds to the polypeptide of interest; b) waiting for a time
interval
following the administering for permitting the labeled molecule to
preferentially
concentrate at sites in the subject where the polypeptide is expressed (and
for
unbound labeled molecule to be cleared to background level); c) determining
background level; and d) detecting the labeled molecule in the subject, such
that
detection of labeled molecule above the background level indicates that the
subject has a particular disease or disorder associated with aberrant
expression
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-197-
of the polypeptide of interest. Background level can be determined by various
methods including, comparing the amount of labeled molecule detected to a
standard value previously determined for a particular system.
It will be understood in the art that the size of the subject and the imaging
system used will determine the quantity of imaging moiety needed to produce
diagnostic images. In the case of a radioisotope moiety, for a human subject,
the
quantity of radioactivity injected will normally range from about 5 to 20
millicuries of 99mTc. The labeled antibody or antibody fragment will then
preferentially accumulate at the location of cells which contain the specific
protein. In vivo tumor imaging is described in S.W. Burchiel e1 al.,
"Immunopharmacokinetics of Radiolabeled Antibodies and Their Fragments."
(Chapter 13 in Tumor lmaging: The Radiochemical Detection of Cancer, S.W.
Burchiel and B. A. Rhodes, eds., Masson Publishing Inc. (1982)).
Depending on several variables, including the type of label used and the
mode of administration, the time interval following the administration for
permitting the labeled molecule to preferentially concentrate at sites in the
subject
and for unbound labeled molecule to be cleared to background level is 6 to 48
hours or 6 to 24 hours or 6 to 12 hours. In another embodiment the time
interval
following administration is 5 to 20 days or 5 to 10 days.
In an embodiment, monitoring of the disease or disorder is carried out by
repeating the method for diagnosing the disease or disease, for example, one
month after initial diagnosis, six months after initial diagnosis, one year
after
initial diagnosis, etc.
Presence of the labeled molecule can be detected in the patient using
methods known in the art for in vivo scanning. These methods depend upon the
type of label used. Skilled artisans will be able to determine the appropriate
method for detecting a particular label. Methods and devices that may be used
in the diagnostic methods of the invention include, but are not limited to,
computed tomography (CT), whole body scan such as position emission
tomography (PET), magnetic resonance imaging (MRI), and sonography.
In a specific embodiment, the molecule is labeled with a radioisotope and
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-198-
is detected in the patient using a radiation responsive surgical instrument
(Thurston et al., U.S. Patent No. 5,441,050). In another embodiment, the
molecule is labeled with a fluorescent compound and is detected in the patient
using a fluorescence responsive scanning instrument. In another embodiment,
the
molecule is labeled with a positron emitting metal and is detected in the
patent
using positron emission-tomography. In yet another embodiment, the molecule
is labeled with a paramagnetic label and is detected in a patient using
magnetic
resonance imaging (1VLRI).
Kits
The present invention provides kits that can be used in the above methods.
In one embodiment, a kit comprises an antibody of the invention, preferably a
purified antibody, in one or more containers. In a specific embodiment, the
kits
of the present invention contain a substantially isolated polypeptide
comprising
an epitope which is specifically immunoreactive with an antibody included in
the
kit. Preferably, the kits of the present invention further comprise a control
antibody which does not react with the polypeptide of interest. In another
specific embodiment, the kits of the present invention contain a means for
detecting the binding of an antibody to a polypeptide of interest (e.g., the
antibody may be conjugated to a detectable substrate such as a fluorescent
compound, an enzymatic substrate, a radioactive compound or a luminescent
compound, or a second antibody which recognizes the first antibody may be
conjugated to a detectable substrate).
In another specific embodiment of the present invention, the kit is a
diagnostic kit for use in screening serum containing antibodies specific
against
proliferative and/or cancerous polynucleotides and polypeptides. Such a kit
may
include a control antibody that does not react with the polypeptide of
interest.
Such a kit may include a substantially isolated polypeptide antigen comprising
an
epitope which is specifically immunoreactive with at least one anti-
polypeptide
antigen antibody. Further, such a kit includes means for detecting the binding
of
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-199-
said antibody to the antigen (e.g., the antibody may be conjugated to a
fluorescent
compound such as fluorescein or rhodamine which can be detected by flow
cytometry). In specific embodiments, the kit may include a recombinantly
produced or chemically synthesized polypeptide antigen. The polypeptide
antigen
of the kit may also be attached to a solid support.
In a more specific embodiment the detecting means of the above
described kit includes a solid support to which said polypeptide antigen is
attached. Such a kit may also include a non-attached reporter-labeled anti-
human
antibody. In this embodiment, binding ofthe antibody to the polypeptide
antigen
can be detected by binding of the said reporter-labeled antibody.
In an additional embodiment, the invention includes a diagnostic kit for
use in screening serum containing antigens of the polypeptide of the
invention.
The diagnostic kit includes a substantially isolated antibody specifically
immunoreactive with polypeptide or polynucleotide antigens, and means for
IS detecting the binding of the polynucleotide or polypeptide antigen to the
antibody. In one embodiment, the antibody is attached to a solid support. In a
specific embodiment, the antibody may be a monoclonal antibody. The detecting
means of the kit may include a second, labeled monoclonal antibody.
Alternatively, or in addition, the detecting means may include a labeled,
competing antigen.
In one diagnostic configuration, test serum is reacted with a solid phase
reagent having a surface-bound antigen obtained by the methods of the present
invention. After binding with specific antigen antibody to the reagent and
removing unbound serum components by washing, the reagent is reacted with
reporter-labeled anti-human antibody to bind reporter to the reagent in
proportion
to the amount of bound anti-antigen antibody on the solid support. The reagent
is again washed to remove unbound labeled antibody, and the amount of reporter
associated with the reagent is determined. Typically, the reporter is an
enzyme
which is detected by incubating the solid phase in the presence of a suitable
fluorometric, luminescent or colorimetric substrate (Sigma, St. Louis, MO).
The solid surface reagent in the above assay is prepared by known
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-200-
techniques for attaching protein material to solid support material, such as
polymeric beads, dip sticks, 96-well plate or filter material. These
attachment
methods generally include non-specific adsorption of the protein to the
support
or covalent attachment of the protein, typically through a free amine group,
to a
chemically reactive group on the solid support, such as an activated carboxyl,
hydroxyl, or aldehyde group. Alternatively, streptavidin coated plates can be
used in conjunction with biotinylated antigen(s).
Thus, the invention provides an assay system or kit for carrying out this
diagnostic method. The kit generally includes a support with surface-bound
recombinant antigens, and a reporter-labeled anti-human antibody for detecting
surface-bound anti-antigen antibody.
Example 1
Expression and Purification in E. coli
The DNA sequence encoding the mature DR3-V 1 protein in the cDNA
contained in ATCC No. 97456 is amplified using PCR oligonucleotide primers
specific to the amino terminal sequences of the DR3-V 1 protein and to vector
sequences 3' to the gene. Additional nucleotides containing restriction sites
to
facilitate cloning are added to the 5' and 3' sequences respectively.
The following primers are used for expression of DR3 extracellular
domain in E. coli 5' primer:
5'-GCGCCATGGGGGCCCGGCGGCAG-3' (SEQ ID N0:7) contains an NcoI
site and 15 nucleotide starting from 290 nucleotide to 304 in SEQ ID NO:l.
3' primer:
5'-GCGAAGCTTCTAGGACCCAGAACATCTGCC-3' (SEQ ID N0:8)
' contains a HindIII site, a stop codon and 18 nucleotides complimentary to
nucleotides from 822 to 840 in SEQ ID NO:1. Vector is pQE60. The protein is
not tagged.
The restriction sites are convenient to restriction enzyme sites in the
bacterial expression vector pQE60, which are used for bacterial expression in
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-201-
these examples. (Qiagen, Inc. 9259 Eton Avenue, Chatsworth, CA, 91311).
pQE60 encodes ampicillin antibiotic resistance ("Amp"') and contains a
bacterial
origin of replication ("ori"), an IPTG inducible promoter, a ribosome binding
site
("RB S").
The amplified DR3-V1 DNA and the vector pQE60 both are digested
with NcoI and HindIII and the digested DNAs are then ligated together.
Insertion of the DDCR protein DNA into the restricted pQE60 vector places the
DR3-V 1 protein coding region downstream of and operably linked to the
vector's
IPTG-inducible promoter and in-frame with an initiating AUG appropriately
positioned for translation of DR3-V1 protein.
The ligation mixture is transformed into competent E. coli cells using
standard procedures. Such procedures are described in Sambrook et al.,
Molecular Cloning: a Laboratory Manual, 2nd Ed.; Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, N.Y. (1989). E. coli strain M15/rep4,
containing multiple copies of the plasmid pREP4, which expresses lac repressor
and confers kanamycin resistance ("Kan"'), is used in carrying out the
illustrative
example described herein. This strain, which is only one of many that are
suitable
for expressing DR3-V1 protein, is available commercially from Qiagen.
Transformants are identified by their ability to grow on LB plates in the
presence of ampicillin and kanamycin. Plasmid DNA is isolated from resistant
colonies and the identity of the cloned DNA confirmed by restriction analysis.
Clones containing the desired constructs are grown overnight ("O/N") in
liquid culture in LB media supplemented with both ampicillin (100 pg/ml) and
kanamycin (25 pg/ml).
The O/N culture is used to inoculate a large culture, at a dilution of
approximately 1:100 to 1:250. The cells are grown to an optical density at
600nm ("OD600") ofbetween 0.4 and 0.6. Isopropyl-B-D-thiogalactopyranoside
("IPTG") is then added to a final concentration of 1 mM to induce
transcription
from lac repressor sensitive promoters, by inactivating the lacI repressor.
Cells
subsequently are incubated further for 3 to 4 hours. Cells then are harvested
by
centrifugation and disrupted, by standard methods. Inclusion bodies are
purified
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-202-
from the disrupted cells using routine collection techniques, and protein is
solublized from the inclusion bodies into 8M urea. The 8M urea solution
containing the solublized protein is passed over a PD-10 column in 2X
phosphate-buffered saline ("PBS"), thereby removing the urea, exchanging the
buffer and refolding the protein. The protein is purified by a further step of
chromatography to remove endotoxin. Then, it is sterile filtered. The sterile
filtered protein preparation is stored in 2X PBS at a concentration of 95
~/ml.
Example 2
Expression in Mammalian Cells
Most of the vectors used for the transient expression of a given gene
sequence in mammalian cells carry the SV40 origin of replication. This allows
the
replication of the vector to high copy numbers in cells (e.g., COS cells)
which
express the T antigen required for the initiation of viral DNA synthesis. Any
other mammalian cell line can also be utilized for this purpose.
A typical mammalian expression vector contains the promoter element,
which mediates the initiation of transcription of mRNA, the protein coding
sequence, and signals required for the termination of transcription and
polyadenylation ofthe transcript. Additional elements include enhancers, Kozak
sequences and intervening sequences flanked by donor and acceptor sites for
RNA splicing. Highly efficient transcription can be achieved with the early
and
late promoters from SV40, the long terminal repeats (LTRs) from Retroviruses,
e.g., RSV, HTLVI, HIVI, and the early promoter ofthe cytomegalovirus (CMV).
However, also cellular signals can be used (e.g., human actin, promoter).
Suitable expression vectors for use in practicing the present invention
include, for
example, vectors such as pSVL and pMSG (Pharmacia, Uppsala, Sweden),
pRSVcat (ATCC 37152), pSV2dhfr (ATCC 37146) and pBCI2MI
(ATCC67109). Mammalian host cells that could be used include, human HeLa,
283, H9 and Jurkat cells, mouse NIH3T3 and C127 cells, Cos 1, Cos 7, and CV1
African green monkey cells, quail QC1-3 cells, mouse L cells, and Chinese
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-203-
hamster ovary (CHO) cells.
Alternatively, a gene of interest can be expressed in stable cell lines that
contain the gene integrated into a chromosome. The co-transfection with a
selectable marker such as dhfr, gpt, neomycin, hygromycin allows the
identification and isolation of the transfected cells.
The transfected gene can also be amplified to express large amounts ofthe
encoded protein. The DHFR (dihydrofolate reductase) is a useful marker to
develop cell lines that carry several hundred or even several thousand copies
of
the gene of interest. Using this marker, the mammalian cells are grown in
increasing amounts of methotrexate for selection and the cells with the
highest
resistance are selected. These cell lines contain the amplified genes)
integrated
into a chromosome. Chinese hamster ovary (CHO) cells are often used for the
production of proteins.
The expression vectors pCl and pC4 contain the strong promoter (LTR)
of the Rous Sarcoma Virus (Cullen et al., Molecular and Cellular Biology
438:44701 (March 1985)), plus a fragment of the CMV-enhancer (Boshart et al.,
Ce1141:521-530 (1985)). Multiple cloning sites, e.g. with the restriction
enzyme
cleavage sites BamHI, XhaI and Asp718, facilitate the cloning of the gene of
interest. The vectors contain in addition the 3' intron, the polyadenylation
and
termination signal of the rat preproinsulin gene.
Example 2A
Expression of extracellular soluble domain of DR3-VI and DR3 in COS cells
The expression plasmid, pDR3-V1 HA, is made by cloning a cDNA
encoding DR3-V 1 (ATCC No. 97456) into the expression vector pcDNAI/Amp
(which can be obtained from Invitrogen, Inc.). Expression plasmid, pDR3 HA,
is made by cloning a cDNA encoding DR3 (ATCC No. 97757) into the
expression vector pcDNAI/Amp.
The expression vector pcDNAI/amp contains: (1) an E. coli origin of
replication effective for propagation in E. coli and other prokaryotic cell;
(2) an
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-204-
ampicillin resistance gene for selection of plasmid-containing prokaryotic
cells;
(3) an SV40 origin of replication for propagation in eukaryotic cells; (4) a
CMV
promoter; a polylinker, an SV40 intron, and a polyadenylation signal arranged
so
that a cDNA conveniently can be placed under expression control of the CMV
promoter and operably linked to the SV40 intron and the polyadenylation signal
by means of restriction sites in the polylinker.
A DNA fragment encoding the entire DR3-V 1 or Dr3 precursor and a HA
tag fused in frame to its 3' end is cloned into the polylinker region of the
vector
so that recombinant protein expression is directed by the CMV promoter. The
HA tag corresponds to an epitope derived from the influenza hemagglutinin
protein described by Wilson et al., Cell 37:767 ( 1984). The fusion of the HA
tag
to the target protein allows easy detection of the recombinant protein with an
antibody that recognizes the HA epitope.
The plasmid construction strategy is as follows:
The DR3-V1 or DR3 cDNA of the deposit cDNA is amplified using
primers that contained convenient restriction sites, much as described above
regarding the construction of expression vectors for expression of DR3-V 1 or
DR3 in E. coli and S. fugiperda.
To facilitate detection, purification and characterization of the expressed
DR3-V 1 or DR3, one of the primers contains a hemagglutinin tag ("HA tag") as
described above.
Suitable primers for DR3-V I include the following, which are used in this
example, the 5' primer:
5' CGCGGATCCGCCATCATGGAGGAGACGCAGCAG 3' (SEQ >D N0:9)
contains the underlined BamHI site, an ATG start codon and S codons
thereafter.
Suitable primers for DR3 include the following, which are used in this
example, the 5' primer:
5' CGCGGATCCGCCATCATGGAGCAGCGGCCGCGG 3' (SEQ >D NO:10)
contains the underlined BamHI site, an ATG start codon and 5 codons
thereafter.
The 3' primer for both DR3 and DR3-V 1, containing the underlined XbaI
site, stop codon, hemagglutinin tag and last 14 nucleotide of 3' coding
sequence
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-205-
(at the 3' end) has the following sequence:
5'GCGTCTAGATCAAAGCGTAGTCTGGGACGTCGTATGGGTACGGG
CCGCGCTGCA 3' (SEQ ID NO:11).
The PCR amplified DNA fragment and the vector, pcDNAI/Amp, are
digested with BamHI and XhaI and then ligated. The ligation mixture is
transformed into E. coli strain SURE (available from Stratagene Cloning
Systems, 1 I 099 North Torrey Pines Road, La Jolla, CA 92037) the transformed
culture is plated on ampicillin media plates which then are incubated to allow
growth of ampicillin resistant colonies. Plasmid DNA is isolated from
resistant
colonies and examined by restriction analysis and gel sizing for the presence
of
the DR3-V 1 or DR3-encoding fragment.
For expression of recombinant DR3-V 1 or DR3, COS cells are
transfected with an expression vector, as described above, using DEAE-
DEXTRAN, as described, for instance, in Sambrook et al., Molecular Cloning.'
a Laboratory Manual, Cold Spring Laboratory Press, Cold Spring Harbor, NY
(1989).
Cells are incubated under conditions for expression of DR3-V 1 or DR3
by the vector.
Expression of the DR3-V 1 HA fusion protein or the DR3 HA fusion
protein is detected by radiolabelling and immunoprecipitation, using methods
described in, for example Harlow et al., Antibodies: a Laboratory Manual, 2nd
Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1988). To
this end, two days after transfection, the cells are labeled by incubation in
media
containing 35S-cysteine for 8 hours. The cells and the media are collected,
and the
cells are washed and then lysed with detergent-containing RIPA buffer: 150 mM
NaCI, 1% NP-40, 0.1% SDS, 1% NP-40, 0.5% DOC, 50 mM TRIS, pH 7.5, as
described by Wilson et al. cited above. Proteins are precipitated from the
cell
lysate and from the culture media using an HA-specific monoclonal antibody.
The precipitated proteins then are analyzed by SDS-PAGE gels and
autoradiography. An expression product of the expected size is seen in the
cell
lysate, which is not seen in negative controls.
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-206-
Example 2B
Expression and purification of human DR3-Vl and DR3 using the CHO
Expression System
The vector pCl is used for the expression of DR3-Vl or DR3 (ATCC
No. 97456 or ATCC No. 97757, respectively) protein. Plasmid pCl is a
derivative of the plasmid pSV2-dhfr (ATCC Accession No. 37146). Both
plasmids contain the mouse DHFR gene under control of the SV40 early
promoter. Chinese hamster ovary- or other cells lacking dihydrofolate activity
that are transfected with these plasmids can be selected by growing the cells
in a
selective medium (alpha minus MEM, Life Technologies) supplemented with the
chemotherapeutic agent methotrexate. The amplification of the DHFR genes in
cells resistant to methotrexate (MTX) has been well documented (see, e.g.,
F.W.
Alt et al., J Biol. Chem. 253:1357-1370 (1978); J.L. Hamlin and C. Ma,
Biochem. et Biophys. Acta, 1097:107-143 (1990); M.J. Page and M.A.
Sydenham, Biotechnology 9:64-68 (1991)). Cells grown in increasing
concentrations of MTX develop resistance to the drug by overproducing the
target enzyme, DHFR, as a result of amplification of the DHFR gene. If a
second
gene is linked to the DHFR gene it is usually co-amplified and over-expressed.
It is state of the art to develop cell lines carrying more than 1,000 copies
of the
genes. Subsequently, when the methotrexate is withdrawn, cell lines contain
the
amplified gene integrated into the chromosome(s).
Plasmid pC 1 contains for the expression of the gene of interest a strong
promoter of the long terminal repeat (LTR) of the Rous Sarcoma Virus (Cullen
et al., Molecular and CellularBiology 5:43 8-447 (March 1985)), plus a
fragment
isolated from the enhancer of the immediate early gene of human
cytomegalovirus
(CMV) (Boshart et al., Cell 41:521-530 (1985)). Downstream from the
promoter are the following single restriction enzyme cleavage sites that allow
the
integration of the genes: BamHI followed by the 3' intron and the
polyadenylation
site of the rat preproinsulin gene. Other high e~cient promoters can also be
used
for the expression, e.g., the human ~3-actin promoter, the SV40 early or late
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-207-
promoters or the long terminal repeats from other retroviruses, e.g., HIV and
HTLVI. For the polyadenylation of the mRNA other signals, e.g., from the
human growth hormone or globin genes can be used as well.
Stable cell lines carrying a gene of interest integrated into the
chromosomes can also be selected upon co-transfection with a selectable marker
such as gpt, 6418 or hygromycin. It is advantageous to use more than one
selectable marker in the beginning, e.g., G418 plus methotrexate.
The plasmid pC 1 is digested with the restriction enzyme BamHI and then
dephosphorylated using calf intestinal phosphates by procedures known in the
art.
The vector is then isolated from a 1% agarose gel.
The DNA sequence encoding DR3-V 1 or DR3 in the deposited cDNA is
amplified using PCR oligonucleotide primers specific to the amino acid
carboxyl
terminal sequence of the DR3-V 1 or DR3 protein and to vector sequences 3' to
the gene. Additional nucleotides containing restriction sites to facilitate
cloning
are added to the 5' and 3' sequences respectively.
The 5' oligonucleotide primer for DR3-V 1 has the sequenc:
5' CGCGGATCCGCCATCATGGAGGAGACGCAGCAG 3' (SEQ >D N0:12)
containing the underlined BamHI restriction site, which encodes a start AUG,
followed by the Kozak sequence and 18 nucleotides of the DR3-V 1 coding
sequence set out in SEQ ID NO:1 beginning with the first base of the ATG
codon.
The S' oligonucleotide primer for DR3 has the sequence:
5' CGCGGATCCGCCATCATGGAGCAGCGGCCGCGG 3' (SEQ ID N0:13)
containing the underlined BamHI restriction site, which encodes a start AUG,
followed by the Kozak sequence and 18 nucleotides of the DR3 coding sequence
set out in SEQ ID N0:3 beginning with the first base of the ATG codon.
The 3' primer for both DR3 and DR3-V 1 has the sequence:
5' CGCGGATCCTCACGGGCCGCGCTGCA 3' (SEQ ID N0:14) containing
the underlined BamHI restriction site followed by 17 nucleotides complementary
to the last 14 nucleotides of the DR3-V 1 or DR3 coding sequence set out in
SEQ
ID NO:1 or SEQ >D N0:3, respectively, plus the stop codon.
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-208-
The restrictions sites are convenient to restriction enzyme sites in the
CHO expression vectors pC 1.
The amplified DR3 or DR3-Vl DNA and the vector pCl both are
digested with BamHI and the digested DNAs then ligated together. Insertion of
the DR3-V 1 or DR3 DNA into the BamHI restricted vector placed the DR3-V 1
or DR3 coding region downstream of and operably linked to the vector's
promoter. The sequence of the inserted gene is confirmed by DNA sequencing.
Trarcsfectioh of CHO-DHFR-cells
Chinese hamster ovary cells lacking an active DHFR enzyme are used for
transfection. 5 pg of the expression plasmid C 1 are cotransfected with 0. 5 ~
g of
the plasmid pSVneo using the lipofecting method (Felgner et al., supra). The
plasmid pSV2-neo contains a dominant selectable marker, the gene neo from Tn5
encoding an enzyme that confers resistance to a group of antibiotics including
6418. The cells are seeded in alpha minus MEM supplemented with 1 mg/ml
6418. After 2 days, the cells are trypsinized and seeded in hybridoma cloning
plates (Greiner, Germany) and cultivated from 10-14 days. After this period,
single clones are trypsinized and then seeded in 6-well petri dishes using
different
concentrations of methotrexate (25 nM, 50 nM, 100 nM, 200 nM, 400 nM).
Clones growing at the highest concentrations ofmethotrexate are then
transferred
to new 6-well plates containing even higher concentrations of methotrexate
(500
nM, 1 pM, 2 pM, 5 ~M). The same procedure is repeated until clones grow at
a concentration of 100 pM.
The expression of the desired gene product is analyzed by Western blot
analysis and SDS-PAGE.
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-209-
Example 3
Cloning and expression of the soluble extracellular domain of DR3-VI and
DR3 in a baculovirus expression system
The cDNA sequence encoding the soluble extracellular domain of DR3-
V 1 or DR3 protein in the deposited clone (ATCC No. 97456 or ATCC No.
97757, respectively) is amplified using PCR oligonucleotide primers
corresponding to the 5' and 3' sequences of the gene:
The 5' primer for DR3-V 1 has the sequence:
5' CGCGGATCC GCCATCATGGAGGAGACGCAGCAG 3' (SEQ ID NO:15)
containing the underlined BamHI restriction enzyme site followed by a Kozak
sequence and a number of bases of the sequence of DR3-V1 of SEQ ID NO:1.
Inserted into an expression vector, as described below, the 5' end of the
amplified
fragment encoding DR3-V 1 provides an efficient signal peptide. An efficient
signal for initiation of translation in eukaryotic cells, as described by M.
Kozak,
J. Mol. Biol. 196:947-950 (1987) is appropriately located in the vector
portion
of the construct.
The 5' primer for DR3 has the sequence:
5' CGCGGATCC GCCATCATGGAGCAGCGGCCGCGG 3' (SEQ ID N0:16)
containing the underlined BamHI restriction enzyme site followed by a Kozak
sequence and a number of bases of the sequence of DR3 of SEQ ID N0:3.
Inserted into an expression vector, as described below, the 5' end ofthe
amplified
fragment encoding DR3 provides an efficient signal peptide. An efficient
signal
for initiation of translation in eukaryotic cells, as described by M. Kozak,
J. Mol.
Biol. 196:947-950 (1987) is appropriately located in the vector portion of the
construct.
The 3' primer for both DR3 and DR3-Vl has the sequence:
5' GCGAGATCTAGTCTGGACCCAGAACATCTGCCTCC 3' (SEQ ID
N0:17) containing the underlined XbaI restriction followed by nucleotides
complementary to the DR3-Vl or DR3 nucleotide sequence set out in SEQ ID
NO:1 or SEQ ID N0:3, respectively, followed by the stop codon.
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-210-
The amplified fragment is isolated from a 1% agarose gel using a
commercially available kit ("Geneclean," BIO 101 Inc., La Jolla, Ca.) The
fragment then is digested with BamHI and Asp718 and again is purified on a 1
agarose gel. This fragment is designated herein F2.
The vector pA2 is used to express the DR3-Vl or DR3 protein in the
baculovirus expression system, using standard methods, such as those described
in Summers et al. , A Manual ofMethods for Baculovirus hectors and Insect Cell
Culture Procedures, Texas Agricultural Experimental Station Bulletin No. 1555
(1987). This expression vector contains the strong polyhedron promoter of the
Autograph californica nuclear polyhedrosis virus (ACMNPV) followed by
convenient restriction sites. For an easy selection of recombinant virus the
~i-
galactosidase gene from E coli is inserted in the same orientation as the
polyhedron promoter and is followed by the polyadenylation signal of the
polyhedron gene. The polyhedron sequences are flanked at both sides by viral
sequences for cell-mediated homologous recombination with wild-type viral DNA
to generate viable virus that express the cloned polynucleotide.
Many other baculovirus vectors could be used in place of pA2, such as
pAc373, pVL941 and pAcIMI provided, as those of skill readily will appreciate,
that construction provides appropriately located signals for transcription,
translation, trafficking and the like, such as an in-frame AUG and a signal
peptide,
as required. Such vectors are described in Luckow et al., Virology 170:31-39
(1989), among others.
The plasmid is digested with the restriction enzymesBamHI andXbaI and
then is dephosphorylated using calf intestinal phosphatase, using routine
procedures known in the art. The DNA is then isolated from a 1% agarose gel
using a commercially available kit ("Geneclean" BIO 101 Inc., La Jolla, Ca.).
This vector DNA is designated herein "V2".
Fragment F2 and the dephosphorylated plasmid V2 are ligated together
with T4 DNA lipase. E coli HB 101 cells are transformed with ligation mix and
spread on culture plates. Bacteria are identified that contain the plasmid
with the
human DDCR gene by digesting DNA from individual colonies using BamHI and
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-211-
XbaI and then analyzing the digestion product by gel electrophoresis. The
sequence of the cloned fragment is confirmed by DNA sequencing. This plasmid
is designated herein pBac DR3-V1 or pBac DR3.
pg ofthe plasmid pBac DR3-V 1 or pBac DR3 is co-transfected with 1.0
5 pg of a commercially available linearized baculovirus DNA ("BaculoGoldTM
baculovirus DNA", Pharmingen, San Diego, CA.), using the lipofection method
described by Felgner et al.., Proc. Natl. Acad. Sci. USA 84:7413-7417 (1987).
1 pg of BaculoGoldTM virus DNA and 5 pg of the plasmid pBac DR3-V1 are
mixed in a sterile well of a microliter plate containing 50 p1 of serum free
Grace's
medium (Life Technologies Inc., Gaithersburg, MD). Afterwards 10 p1
Lipofectin plus 90 p1 Grace's medium are added, mixed and incubated for 15
minutes at room temperature. Then the transfection mixture is added drop-wise
to Sf~ insect cells (ATCC CRL 1711) seeded in a 35 mm tissue culture plate
with
1 ml Grace's medium without serum. The plate is rocked back and forth to mix
the newly added solution. The plate is then incubated for 5 hours at 27
° C. After
5 hours the transfection solution is removed from the plate and I ml of
Grace's
insect medium supplemented with 10% fetal calf serum is added. The plate is
put
back into an incubator and cultivation is continued at 27°C for four
days.
After four days the supernatant is collected and a plaque assay is
performed, as described by Summers and Smith, cited above. An agarose gel
with "Blue Gal" (Life Technologies Inc., Gaithersburg) is used to allow easy
identification and isolation of gal-expressing clones, which produce blue-
stained
plaques. (A detailed description of a "plaque assay" of this type can also be
found
in the user's guide for insect cell culture and baculovirology distributed by
Life
Technologies Inc., Gaithersburg, page 9-10).
Four days after serial dilution, the virus is added to the cells. After
appropriate incubation, blue stained plaques are picked with the tip of an
Eppendorf pipette. The agar containing the recombinant viruses is then
resuspended in an Eppendorf tube containing 200 p1 of Grace's medium. The
agar is removed by a brief centrifugation and the supernatant containing the
recombinant baculovirus is used to infect Sf~ cells seeded in 35 mm dishes.
Four
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-212-
days later the supernatants of these culture dishes are harvested and then
they are
stored at 4 ° C. A clone containing properly inserted DR3-V 1 or DR3 is
identified
by DNA analysis including restriction mapping and sequencing. This is
designated herein as V- DR3-V 1 or V-DR3.
S~ cells are grown in Grace's medium supplemented with 10% heat-
inactivated FBS. The cells are infected with the recombinant baculovirus V-
DR3-V1 at a multiplicity of infection ("MOI") of about 2 (about 1 to about 3).
Six hours later the medium is removed and is replaced with SF900 II medium
minus methionine and cysteine (available from Life Technologies Inc.,
Gaithersburg). 42 hours later, 5 pCi of 35S-methionine and 5 pCi 35S cysteine
(available from Amersham) are added. The cells are further incubated for 16
hours and then they are harvested by centrifugation, lysed and the labeled
proteins
are visualized by SDS-PAGE and autoradiography.
Example 4
A. Tissue distribution of DR3-VI gene expression
Northern blot analysis is carried out to examine DR3-V1 gene (ATCC
No. 97456) expression in human tissues, using methods described by, among
others, Sambrook et al., cited above. A cDNA probe containing the entire
nucleotide sequence of the DR3-V 1 protein (SEQ ID NO:1) is labeled with'2P
using the rediprimeTM DNA labeling system (Amersham Life Science), according
to manufacturer's instructions. After labeling, the probe is purified using a
CHROMA SPIN-100TM column (Clontech Laboratories, Inc.), according to
manufacturer's protocol number PT1200-1. The purified labeled probe is then
used to examine various human tissues for DR3-V1 mRNA.
Multiple Tissue Northern (MTN) blots containing various human tissues
(H) or human immune system tissues (IM) are obtained from Clontech and are
examined with labeled probe using ExpressHybTM hybridization solution
(Clontech) according to manufacturer's protocol number PT1190-1. Following
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-213-
hybridization and washing, the blots are mounted and exposed to film at -
70°C
overnight, and films developed according to standard procedures. Expression of
DR3-V 1 was detected in tissues enriched in lymphocytes including peripheral
blood leukocytes (PBLs), thymus, spleen, colon, and small intestine. DR3-Vl
expression appears to be restricted to lymphocyte compartments, it can be
envisaged that DR3-V1 plays a role in lymphocyte homeostasis.
B. Tissue distribution of'DR3 gene expression
Northern blot analysis is carried out to examine DR3 gene (ATCC No.
97757) expression in human tissues, using methods described by, among others,
Sambrook et al., cited above. A cDNA probe containing the entire nucleotide
sequence of the DR3 protein (SEQ ID NO:1) is labeled with '2P using the
rediprimeTM DNA labeling system (Amersham Life Science), according to
manufacturer's instructions. After labeling, the probe is purified using a
CHROMA SPIN-100TM column (Clontech Laboratories, Inc.), according to
manufacturer's protocol number PT1200-1. The purified labeled probe is then
used to examine various human tissues for DR3 mRNA.
Multiple Tissue Northern (MTN) blots containing various human tissues
(H) or human immune system tissues (IM) are obtained from Clontech and are
examined with labeled probe using ExpressHybTM hybridization solution
(Clontech) according to manufacturer's protocol number PT1190-1. Following
hybridization and washing, the blots are mounted and exposed to film at -
70°C
overnight, and films developed according to standard procedures.
Expression of DR3 was detected in tissues enriched in lymphocytes
including peripheral blood leukocytes (PBLs), thymus, spleen, colon, and small
intestine. By contrast, TNFR-1 is ubiquitously expressed and Fas/APO-1 is
expressed in lymphocytes, liver, heart, lung, kidney, and ovary (Watanabae-
Fukunaga et al., J. Immunol 148:1274-9 (1992)).
DR3 expression appears to be restricted to lymphocyte compartments, it
can be envisaged that DR3 plays a role in lymphocyte homeostasis.
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-214-
C. Northern Blot analysis of DR3 in various cell lines
Methods
Cells
Unless stated otherwise, cell lines were obtained from the American Type
Culture Collection (Manassas, VA). The myeloid (Koefller et al. (1980);
Koeffler (1983); Harris and Ralph (1985); and Tucker et al. (1987)) and B-cell
lines (Jonak et al. (1922)) studied represent cell types at different stages
of the
differentiation pathway. KGla and PLB 985 cells (Tucker et al. (1987)) were
obtained from H.P. Koefller (UCLA School of Medicine). BJA-B was from Z.
Jonak (SmithKline Beecham). TF274, a stromal cell line exhibiting osteoblastic
features, was generated from the bone marrow of a healthy male donor (Z. Jonak
and K.B. Tan, unpublished). Primary carotid artery endothelial cells were
purchased from Clonetics Corp. (San Diego, CA) and monocytes were prepared
by differential centrifugation of peripheral blood mononuclear cells and
adhesion
to tissue culture dish. CD 19+~ CD4+ and CD8+ cells (>90% pure) were isolated
with cell type specific immunomagnetic beads (Drynal, Lake Success, NY).
RNA Analysis
Total RNA of adult tissues were purchased from Clonetech (Palo Alto,
CA). Total RNA was extracted from cell lines (in exponential growth phase) and
primary cells with TriReagent (Molecular Research Center, Inc., Cincinnati,
OH).
5 to 7.5 pg of total RNA was fractionated in a 1% agarose gel containing
formaldehyde cast in a Wide Mini-Sub Cell gel tray (Bio-Rad, Hercules, CA) as
described (Sambrook, et al.) with slight modifications. The formaldehyde
concentration was reduced to O.SM and the RNA was stained prior to
electrophoresis with 100 pg/ml of ethidium bromide that was added to the
loading buffer. After electrophoresis with continuous buffer recirculation (60
volts/90 min), the gel was photographed and the RNA was transferred
quantitatively to Zeta-probe nylon membrane (Biorad, Hercules, CA) by vacuum-
blotting with 25 mM NaOH for 90 min. After neutralization for 5-10 min, with
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-215-
1M Tris-HCI, pH 7.5 containing 3M NaCI, the blots were prehybridized with
50% formamide, 8% dextran sulfate, 6xSSPE, 0.1% SDS and 100 pg/ml of
sheared and denatured salmon sperm DNA for at least 30 min at 42 ° C.
cDNA
inserts labeled with 32P-dCTP by random priming (Stratagene, La Jolla, CA),
were denatured with 0.25M NaOH (10 min at 37°C) and added to the
prehybridization solution. After 24-65 hr at 42°C, the blots were
washed under
high stringency conditions (Sambrook, et al.) and exposed to X-ray films.
Results
Expression of DR3 was assessed by Northern blot in the following cell
lines: TF274 (bone marrow stromal); MG63, TE85 (osteosarcoma); K562
(erythroid); KGIa, KG1, PLB985, HL60, U937, TNHP-1 (myeloid); REH,
BJAB, Raji, IM-9 (B cell); Sup-T1, Jurkat, H9, Molt-3 (T cell); RL95-2
(endometrial carcinoma); MCF-7 (breast cancer); BE, HT29 (colon cancer);
IMR32 (neuroblastoma) and could only be detected in KGIa cells. DR3
expression was detected in several lymphoblast cell lines. In the purified
human
hematopoietic cell populations, DR3 was weakly expressed in CD19+ cells, and
more highly expressed in monocytes. However the highest levels were observed
in T cells (CD4+ or CD8+) upon stimulation with PMA and PHA, indicating that
DR3 probably plays a role in the regulation of T cell activation.
Example 5
Intracellular Signaling Molecules used by DR3 Protein
In vitro and in vivo binding studies were undertaken to investigate DR3
signaling pathways. Since DR3 contains a death domain, the inventors
postulated
that DR3, like TNFR-1 and Fas/APO-1, may transduce signals by recruiting death
domain-containing adapter molecules (DAMs) such as FADD, TRADD, and RIP.
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-216-
Experimental Design
In vitro binding experiments were performed as described previously
(A.M. Chinnaiyan et ad., Cell8l: 505-12 (1995); M.P. Boldin et al.., JBiol
Chem
270: 7795-8 (1995); F.C. Kischkel etal., TMBO 14: 5579-5588 (1995)). Briefly,
the cytoplasmic domains of DR3 (amino acid residues 215-393 (SEQ ID N0:4))
and the death domain mutant ODR3 (amino acid residues 215-321 (SEQ ID
N0:4) were amplified by PCR using appropriate templates and primers into
pGSTag. pGSTag and pGSTag-TNFR-1 were described previously (A.M.
Chinnaiyan et al.., Cell 8l: 505-12 (1995); M.P. Boldin et al., JBiol Chem
270:
7795-8 (1995); F.C. Kischkel et al., EMBO l4: 5579-5588 (1995)). GST and
GST fusion proteins were prepared from E. coli strain BL21(DE3)pLysS using
standard published procedures and the recombinant proteins immobilized onto
glutathione-agarose beads. 35S-Labeled FADD, RIP and TRADD were prepared
by in vitro transcription-translation using the TNT or T7 or SP6-coupled
reticulocyte lysate system from Promega according to manufacturer's
instructions, using pcDNA3 AU1-FADD (A.M. Chinnaiyan et al., Cell8l: 505-
12 (1995); M.P. Boldin et al., .IBiol C'hem 270: 7795-8 (1995); F.C. Kischkel
et
al., EMBO 14: 5579-5588 (1995)), pRK myc-TRADD (H. Hsu et al., Cell 81:
495-504 (1995)), or pRK myc-RIP (H. Hsu et al., Immunity 4: 387-396 (1996))
as template. Following translation, equal amounts of total 355-labeled
reticulocyte
lysate were diluted into 150 p1 GST binding buffer (50 mM Tris, pH 7.6, 120 mM
NaCI, 1 % NP-40) and incubated for 2 hrs. at 4 ° C with the various GST
fusion
proteins complexed to beads, following the beads were pelleted by plus
centrifugation, washed three times in GST buffer, boiled in SDS-sample buffer
and resolved on a 12.5% SDS-PAGE. Bound proteins were visualized following
autoradioraphy at -80 ° C. In vitro translated 35S-labeled RIP, TRADD
and FADD
were incubated with glutathione beads containing GST alone or GST fusions of
the cytoplasmic domain of Fas, TNFR-1, DR3 (215-393), or DDR3 (215-321).
After the beads were washed, retained proteins were analyzed by SDS-PAGE and
autoradiography. The gel was Coomassie stained to monitor equivalency of
loading.
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-217-
To demonstrate the association of DR3 and TRADD in vivo, constructs
encoding Flag-TNFR-1 and Flag-OTNFR-1 were used. The Flag-TNFR-1 and
Flag-OTNFR-1 constructs were described elsewhere (A.M. Chinnaiyan et al., J
Biol Chem 271: 4961-4965 (1996)). The constructs encoding Flag-TNFR-1 and
Flag-OTNFR-1 were described elsewhere (A.M. Chinnaiyan et al., JBiol Chem
271: 4961-4965 (1996)). To facilitate epitope tagging, DR3 and ODR3 (1-321)
were cloned into the IBI Kodak FLAG plasmid (pCMVIFLAG) utilizing the
signal peptide provided by the vector. 293 cells (2 x 106/100mm plate) were
grown in DMEM media containing 10% heat-inactivated fetal bovine serum
containing penicillin G, streptomycin, glutamine, and non-essential amino
acids.
Cells were transfected using calcium phosphate precipitation with the
constructs
encoding the indicated proteins in combination with pcDNA3-CrmA (M. Tewari
et al., JBiol Chem 270: 3255-60 (1995)) to prevent cell death and thus
maintain
protein expression. Cells were lysed in 1 ml lysis buffer (50mM Hepes, 150mM
NaCI, 1 mM EDTA, 1 % NP-40, and a protease inhibitor cocktail). Lysates were
immunoprecipitated with a control monoclonal antibody or anti-Flag antibody
for
at least 4 hrs, at 4°C as previously described (A.M. Chinnaiyan et al.,
JBiol
C'hem 271: 4961-4965 (1996)). The beads were washed with lysis buffer 3X, but
in the case of TRADD binding, the NaCI concentration was adjusted to 1M. The
precipitates were fractioned on 12.5% SDS-PAGE and transferred to
nitrocellulose. Subsequent Western blotting was performed as described
elsewhere (H. Hsu et al., Cell84: 299-308 ( 1996); A.M. Chinnaiyan et al.,
JBiol
Chem 271, 4961-4965 (1996)). After 24-32 hours, extracts were prepared and
immunoprecipitated with a control monoclonal antibody or anti-Flag monoclonal
antibody (IBI Kodak). Western analysis indicated that myc-TRADD and death
receptor expression levels were similar in all samples. Coprecipitating
myc-TRADD was detected by immunoblotting using an anti-myc HRP
conjugated antibody (Boehringer Mannheim).
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-218-
Results
As an initial screen, in vitro translated radiolabeled DAMS were
precipitated with various glutathione S-transferase (GST) fusion proteins
immobilized on glutathione-Sepharose beads. As predicted from previous studies
(A.M. Chinnaiyan et al., Cell8l: 505-12 (1995); M.P. Boldin et al., JBiol Chem
270: 7795-8 (1995); F.C. Kischkel et al., EMBO 14: 5579-5588 (1995); H. Hsu
et al., Cell 81: 495-504 ( 1995)), FADD associated with the GST-Fas
cytoplasmic
domain while TRADD associated with the GST-TNFR-1 cytoplasmic domain.
In addition, there was a direct, albeit weak, interaction between RIP and
GST-TNFR-1. Interestingly, GST-DDCR associated specifically with TRADD,
but not FADD or RIP. Furthermore, a truncated death domain mutant of DR3
(GST-DDR3) failed to interact with TRADD. To demonstrate the association
of DR3 and TRADD in vivo, 293 cells were transiently transfected with plasmids
that direct the synthesis of myc-epitope tagged TRADD (myc-TRADD) and
Flag-epitopetaggedDR3(Flag-DR3),Flag-TNFR-lormutants. Consistent with
the in vitro binding study, TRADD specifically coprecipitated with DR3 and
TNFR-1, but not with the death domain mutants, DDR3 and DTNFR-1. Thus,
it appears that DR3, like TNFR-l, may activate downstream signaling cascades
by virtue of its ability to recruit the adapter molecule TRADD.
Overexpression ofTRADD induces apoptosis and NF-kB activation-two
ofthe most important activities signaled by TNFR-1 (H. Hsu et al., supra).
Upon
oligomerization of TNFR-1 by trimeric TNF, TRADD is recruited to the receptor
signaling complex (H. Hsu et al., Cell 84:299-308 (1996)). TRADD can then
recruit the following signal transducing molecules: 1) TRAF2, a TNFR-2- and
CD40 - associated molecule (M. Rothe et al., Cell 78: 681-92 (1994); M. Rothe
et al., Science 269:1424-1427 (1995)), that mediates NF-kB activation, 2) RIP,
originally identified as a Fas/APO-1-interacting protein by two-hybrid
analysis
(B.Z. Stanger et al., Cell8l: 513-23 (1995)), that mediates NF-kB activation
and
apoptosis (H.' Hsu et al., Immunity 4: 387-396 (1996)), and 3) FADD, a
Fas/APO-1- associated molecule, that mediates apoptosis (A.M. Chinnaiyan et
al., Cell8l: 505-12 (1995); M.P. Boldin et al., J. Biol Chem 270:7795-8
(1995);
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-219-
F.C. Kischkel et al., EMBO 14: 5579-5588 (1995)). Thus, the inventors
demonstrate that RIP, TRAF2 and FADD could be co-immunoprecipitated with
DR3. In 293 cells expressing DR3 and RIP, only a weak association could be
detected between the two molecules. However, in the presence of TRADD, RIP
association with DR3 was significantly enhanced. Likewise, very little TRAF2
directly co-precipitated with DR3 in 293 cells. However, when DR3 and TRAF2
were expressed_in the presence of TRADD and RIP (both of which can bind
TRAF2), an enhanced binding of TRAF2 to DR3 could be detected. A similar
association between FADD and DR3 was also observed. In the presence of
TRADD, FADD efficiently coprecipitated with DR3.
Previous studies demonstrated that FADD could recruit the
ICE/CED-3-like protease FLICE to the Fas/APO-1 death inducing signaling
complex (M. Muzio et ad., Cell 85: 817-827 (1996); M.P. Boldin et al., Cell85:
803-815 (1996)). To demonstrate that FLICE can associate with TNFR-1 and
DR3, coprecipitation experiments in 293 cells were carried out. Interestingly,
FLICE was found complexed to TNFR-1 and DR3 . Co-transfection of TRADD
and/or FADD failed to enhance the FLICE-TNFR-1/DR3 interaction, suggesting
that endogenous amounts of these adapter molecules were sufficient to maintain
this association.
Example 6
DR3 Induced Apoptosis and NF kB Activation
Overexpression of Fas/APO-1 and TNFR-1 in mammalian cells mimics
receptor activation (M. Muzio et al., Cell 85: 817-827 (1996); M. P. Boldin et
al., Cell 85: 803-815 (1996)). Thus, this system was utilized to study the
functional role of DDCR. Ectopic expression of DR3 in MCF7 breast carcinoma
cells and 293 human embryonic kidney cells induced rapid apoptosis.
Experimental Design
Cell death assays were performed essentially as previously described
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-220-
(A.M. Chinnaiyan etal., Cell8l: 505-12 (1995); M.P. Boldinetal.,.IBiol. Chem
270: 7795-8 (1995); F.C. Kischkel et al., EMBO 14: 5579-5588 (1995); A.M.
Chinnaiyan et al., JBiol Chem 271: 4961-4965 (1996)). Briefly, MCF-7 human
breast carcinoma clonal cell lines stably transfected with either vector
alone, a
CrmA expression construct (M. Tewari et al., J Biol Chem 270: 3255-60
(1995)), or FADD-DN expression construct (A.M. Chinnaiyan et al., J Biol
Chem 271: 4961-4965 (1996)) were transiently transfected with pCMV-(3-
galatosidase in the presence of a ten-fold excess of pcDNA3 expression
constructs encoding the indicated proteins using lipofectamine (GIBCO-BRL).
293 cells were likewise transfected using the CaP04 method. The ICE family
inhibitor z-VAD-fink (Enzyme Systems Products, Dublin, CA) was added to the
cells at a concentration of IOpM, 5 hrs after transfection. 32 hours following
transfection, cells were fixed and stained with X-Gal as previously described
(A.M. Chinnaiyan et al., Cell8l: 505-12 (1995); M.P. Boldin et al., JBiol Chem
270: 7795-8 (1995); F.C. Kischkel et al., EMBO 14: 5579-5588 (1995)). The
data (mean +/- SD) shown are the percentage of round blue cells among the
total
number of blue cells counted. Data were obtained from at least three
independent
experiments.
NF-kB luciferase assays were performed as described elsewhere (H. Hsu
et al., Immunity 4: 387-396 (1996); M.D. Adams et al., Nature 377.' 3-174
(1995); G.S. Feng et al., .I Biol Chem 271: 12129-32 (1996); M. Rothe et al.,
Cell 78: 681-92 (1994); M. Rothe et al., Science 269:1424-1427 (1995); A.M.
Chinnaiyan et al., JBiol Chem 271: 4961-4965 (1996)). Briefly, 293 cells were
co-transfected by calcium phosphate precipitation with pCMV-~i-galactosidase,
E-selectin-luciferase reporter gene (M. Rothe et al., Cell 78: 681-92 (1994);
M.
Rothe et al., Science 269:1424-1427 (1995)), the indicated death receptors,
and
the indicated dominant negative inhibitors. In addition, DR3 or DDR3 was
cotransfected with the pLantern expression construct (GIBCO-BRL) which
encodes green fluorescent protein (photographic inset). Cells were visualized
by
fluorescence microscopy using a FITC range barrier filter cube. Nuclei of
transfected cells were visualized by DAPI staining and the image overlaid.
(Cell
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-221-
death assays were performed essentially as previously described (Chinnaiyan et
al., Cell 81:505-12 (1995); Boldin, et al., J. Biol. Chem. 270:7795-8 (1995);
Kischkel et al., TMBO 14:5579-5588 (1995)); Chinnaiyan et al., .I. Biol. Chem.
271:4961-4965 (1996)). The dominant negative inhibitors were used at a 4-fold
higher quantity than the death receptors. Total DNA was kept constant.
To show that DR3 induces NF-kB activation which is inhibitable by
RIP-DN (Stanger et al., CellBl :513-23 ( 1995)) and TRAF2-DN (Hsu et al., Cell
81:495-504 (1995); Rothe et al., Cell 78:681-92 (1994); Rothe et al. Science
269:1424-1427 (1995)), 293 cells were co-transfected with the indicated
molecules and an NF-kB luciferase reporter plasmid (Rothe et al., Cell 78:681-
92
(1994); Rothe et al., Science 269:1424-1427 (1995)), and luciferase activities
subsequently determined. NF-xB luciferase assays were performed as described
elsewhere (Hsu et al., Immunity 4:387-396 (1996); Adams et al., Nature 377.~3-
174 (1995); Feng et al., .l. Biol. Chem. 271:12129-32 (1996); Rothe et al.,
Cell
78:681-92 (1994); Rothe et al. Science 269:1424-1427 (1995); Chinnaiyan etal.,
.1. Biol. Chem. 271: 4961-4965 ( 1996)). Briefly, 293 cells were co-
transfected by
calcium phosphate precipitation with pCMB-(3-galactosidase, E-selectin-
luciferase
reporter gene (Rothe et al., Cell 78:681-92 (1994); Rothe et al., Science
269:1424-1427 ( 1995)), the indicated death receptors, and the indicated
dominant
negative inhibitors. The dominant negative inhibitors were used at a 4-fold
higher
quantity than the death receptors. Total DNA was kept constant. Representative
experiment performed in duplicate three independent times (mean + SD).
Results
The cells displayed morphological alterations typical of cells undergoing
apoptosis, becoming rounded, condensed and detaching from the dish. In MCF7
cells, plasmids encoding full-length DR3 or DDR3 were co-transfected with the
pLantern reporter construct encoding green fluorescent protein. Nuclei of
cells
transfected with DR3, but not DDR3, exhibited apoptotic morphology as
assessed by DAPI staining. Similar to TNFR-1 and Fas/APO-1 (M. Muzio et al.,
Cell. 85: 817-827 (1996); M. P. Boldin et al., Cell 85: 803-815 (1996); M.
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-222-
Tewari et ad., JBiol Chem 270: 3255-60 (1995)), DR3-induced apoptosis was
blocked by the inhibitors of ICE-like proteases, CrmA and z-VAD-fmk.
Importantly, apoptosis induced by DR3 was also blocked by dominant negative
versions ofFADD (FADD-DN) or FLICE (FLICE-DN/MACHaI C360S), which
were previously shown to inhibit death signaling by Fas/APO-1 and TNFR-1 (M.
Muzio et al., Cell 85: 817-827 (1996); M. P. Boldin et al., Cell. 85: 803-815
(1996); H. Hsu et al.., Cell 84: 299-398 (1996); A.M. Chinnaiyan et al., .I
Biol
Chem 271: 4961-4965 (1996)). Thus, FADD and the ICE-like protease FLICE
are likely necessary components of DR3-induced apoptosis.
As DR3 activation recruits three molecules implicated in TNF-induced
NF-kB activation, we examined whether DR3 could activate NF-kB.
Transfection of a control vector or expression of Fas/APO-1 failed to induce
NF-kB activation. By contrast, NF-kB was activated by ectopic expression of
DR3 or TNFR-1, but not by the inactive signaling mutants DDR3 or DTNFR-1.
Importantly, DR3-induced NF-kB activation was blocked by dominant negative
derivatives of RIP (RIP-DN) and TRAF2 (TRAF2-DN), which were previously
shown to abrogate TNF-induced NF-kB activation (H. Hsu et al., Cell 84: 299-
398 (1996); H. Hsu et al., Immunity 4: 387-396 (1996)). As expected,
FADD-DN did not interfere with DR3-mediated NF-kB activation (H. Hsu et al.,
Cell 84: 299-398 (1996); A.M. Chinnaiyan et al., JBiol Chem 271: 4961-4965
(1996)).
Thus, the experiments set forth in Examples 6 and 7 demonstrate that
DR3 is a death domain-containing molecule capable of triggering both apoptosis
and NF-kB activation, two pathways dominant in the regulation of the immune
system. The experiments also demonstrate the internal signal transduction
machinery of this novel cell death receptor. The DR3 signaling complex
assembles in a hierarchical manner with the recruitment ofthe multivalent
adapter
molecule TRADD, from which two distinct signaling cascades emanate: 1)
NF-kB activation mediated by TRAF2 and RIP and 2) cell death mediated by
FADD, FLICE, and RIP.
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-223-
Example 7
Gene Therapy Using Endogenous DR3 Gene
Another method of gene therapy according to the present invention
involves operably associating the endogenous DR3 sequence with a promoter via
homologous recombination as described, for example, in US Patent Number
5,641,670, issued June 24, 1997; International Publication Number WO
96/2941 l, published September 26, 1996; International Publication Number WO
94/12650, published August 4, 1994; Koller et al., Proc. Natl. Acad. Sci. USA
86:8932-8935 (1989); and Zijlstra et al., Nature 342:435-438 (1989). This
method involves the activation of a gene which is present in the target cells,
but
which is not expressed in the cells, or is expressed at a lower level than
desired.
Polynucleotide constructs are made which contain a promoter and targeting
sequences, which are homologous to the 5' non-coding sequence of endogenous
DR3, flanking the promoter. The targeting sequence will be sufficiently near
the
5' end of DR3 so the promoter will be operably linked to the endogenous
sequence upon homologous recombination. The promoter and the targeting
sequences can be amplified using PCR. Preferably, the amplified promoter
contains distinct restriction enzyme sites on the 5' and 3' ends. Preferably,
the
3' end ofthe first targeting sequence contains the same restriction enzyme
site as
the 5' end of the amplified promoter and the 5' end of the second targeting
sequence contains the same restriction site as the 3' end of the amplified
promoter.
The amplified promoter and the amplified targeting sequences are digested
with the appropriate restriction enzymes and subsequently treated with calf
intestinal phosphatase. The digested promoter and digested targeting sequences
are added together in the presence of T4 DNA ligase. The resulting mixture is
maintained under conditions appropriate for ligation of the two fragments. The
construct is size fractionated on an agarose gel then purified by phenol
extraction
and ethanol precipitation.
In this Example, the polynucleotide constructs are administered as naked
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-224-
polynucleotides via electroporation. However, the polynucleotide constructs
may
also be administered with transfection-facilitating agents, such as liposomes,
viral
sequences, viral particles, precipitating agents, etc. Such methods of
delivery are
known in the art.
Once the cells are transfected, homologous recombination will take place
which results in the promoter being operably linked to the endogenous DR3
sequence. This results in the expression of DR3-V1 or DR3 in the cell.
Expression may be detected by immunological staining, or any other method
known in the art.
Fibroblasts are obtained from a subject by skin biopsy. The resulting
tissue is placed in DMEM.+ 10% fetal calf serum. Exponentially growing or
early stationary phase fibroblasts are trypsinized and rinsed from the plastic
surface with nutrient medium. An aliquot of the cell suspension is removed for
counting, and the remaining cells are subjected to centrifugation. The
supernatant
is aspirated and the pellet is resuspended in 5 ml of electroporation buffer
(20 mM
HEPES pH 7.3, 137 mM NaCI, 5 mM KCI, 0.7 mM Na2 HP04, 6 mM dextrose).
The cells are recentrifuged, the supernatant aspirated, and the cells
resuspended
in electroporation buffer containing 1 mg/ml acetylated bovine serum albumin.
The final cell suspension contains approximately 3X106 cells/ml.
Electroporation
should be performed immediately following resuspension.
Plasmid DNA is prepared according to standard techniques. For example,
to construct a plasmid for targeting to the DR3 locus, plasmid pUC I 8 (MBI
Fermentas, Amherst, NY) is digested with HindIII. The CMV promoter is
amplified by PCR with an XhaI site on the S' end and a BamHI site on the
3'end.
Two DR3 non-coding sequences are amplified via PCR: one DR3 non-coding
sequence (DR3 fragment 1 ) is amplified with a HindIII site at the 5' end and
an
XbaI site at the 3'end; the other DR3 non-coding sequence (DR3 fragment 2) is
amplified with a BamHI site at the Send and a HindIII site at the 3'end. The
CMV promoter and DR3 fragments are digested with the appropriate enzymes
(CMV promoter - Xf~aI and BamHI; DR3 fragment 1 - XhaI; DR3 fragment 2 -
BamHI) and ligated together. The resulting ligation product is digested with
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-225-
HindIII, and ligated with the HindIII-digested pUC 18 plasmid.
Plasmid DNA is added to a sterile cuvette with a 0.4 cm electrode gap
(Bio-Rad). The final DNA concentration is generally at least 120 ~cg/ml. 0.5
ml
of the cell suspension (containing approximately 1.5X106 cells) is then added
to
the cuvette, and the cell suspension and DNA solutions are gently mixed.
Electroporation is performed with a Gene-Pulser apparatus (Bio-Rad).
Capacitance and voltage are set at 960 ~F and 250-300 V, respectively. As
voltage increases, cell survival decreases, but the percentage of surviving
cells
that stably incorporate the introduced DNA into their genome increases
dramatically. Given these parameters, a pulse time of approximately 14-20 mSec
should be observed.
Electroporated cells are maintained at room temperature for
approximately 5 minutes, and the contents of the cuvette are then gently
removed
with a sterile transfer pipette. The cells are added directly to 10 ml of
prewarmed
nutrient media (DMEM with 1 S% calf serum) in a 10 cm dish and incubated at
37°C. The following day, the media is aspirated and replaced with 10 ml
offresh
media and incubated for a further 16-24 hours.
The engineered fibroblasts are then injected into the host, either alone or
after having been grown to confluence on cytodex 3 microcarrier beads. The
fibroblasts now produce the protein product. The fibroblasts can then be
introduced into a patient as described above.
Example 8
Production of an Antibody
A. Hybridoma Technology
The antibodies of the present invention can be prepared by a variety of
methods. (See, Ausubel et al., eds., 1998, Current Protocols in Molecular
Biology, John Wiley & Sons, NY, Chapter 2.) As one example of such methods,
cells expressing DR3-VI or DR3 are administered to an animal to induce the
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-226-
production of sera containing polyclonal antibodies. In a preferred method, a
preparation of DR3-V1 or DR3 protein is prepared and purified to render it
substantially free of natural contaminants. Such a preparation is then
introduced
into an animal in order to produce polyclonal antisera of greater specific
activity.
Monoclonal antibodies specific for protein DR3-V 1 or DR3 are prepared
using hybridoma technology. (Kohler et al., Nature 256:495 (1975); Kohler et
al., Eur. J. Immunol. 6:511 (1976); Kohleretal., Eur. J. Immunol. 6:292
(1976);
Hammerling et al., in: Monoclonal Antibodies and T-Cell Hybridomas, Elsevier,
N.Y., pp. 563-681 (1981)). In general, an animal (preferably a mouse) is
, immunized with DR3-V 1 or DR3 polypeptide or, more preferably, with a
secreted DR3-V 1 or DR3 polypeptide-expressing cell. Such polypeptide-
expressing cells are ciritured in any suitable tissue culture medium,
preferably in
Earle's modified Eagle's medium supplemented with 10% fetal bovine serum
(inactivated at about 56°C), and supplemented with about 10 g/1 of
nonessential
amino acids, about 1,000 U/ml of penicillin, and about 100 pg/ml of
streptomycin.
The splenocytes of such mice are extracted and fused with a suitable
myeloma cell line. Any suitable myeloma cell line may be employed in
accordance with the present invention; however, it is preferable to employ the
parent myeloma cell line (5P20), available from the ATCC. After fusion, the
resulting hybridoma cells are selectively maintained in HAT medium, and then
cloned by limiting dilution as described by Wands et al. (Gastroenterology
80:225-232 (1981). The hybridoma cells obtained through such a selection are
then assayed to identify clones which secrete antibodies capable of binding
the
DR3-V 1 or DR3 polypeptide.
Alternatively, additional antibodies capable of binding to DR3-V 1 or DR3
polypeptide can be produced in a two-step procedure using anti-idiotypic
antibodies. Such a method makes use of the fact that antibodies are themselves
antigens, and therefore, it is possible to obtain an antibody which binds to a
second antibody. In accordance with this method, protein specific antibodies
are
used to immunize an animal, preferably a mouse. The splenocytes of such an
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-227-
animal are then used to produce hybridoma cells, and the hybridoma cells are
screened to identify clones which produce an antibody whose ability to bind to
the DR3-V1 or DR3 protein-specific antibody can be blocked by DR3-V1 or
DR3. Such antibodies comprise anti-idiotypic antibodies to the DR3-V 1 or DR3
protein-specific antibody and are used to immunize an animal to induce
formation
of further DR3-V 1 or DR3 protein-specific antibodies.
For in vivo use of antibodies in humans, an antibody is "humanized".
Such antibodies can be produced using genetic constructs derived from
hybridoma cells producing the monoclonal antibodies described above. Methods
for producing chimeric and humanized antibodies are known in the art and are
discussed infra. (See, for review, Morrison, Science 229:1202 (1985); Oi et
al.,
BioTechniques 4:214 (1986); Cabilly et al., U.S. Patent No. 4,816,567;
Taniguchi et al., EP 171496; Morrison et al., EP 173494; Neuberger et al., WO
8601533; Robinson et al., WO 8702671; Boulianne et al., Nature 312:643
(1984); Neuberger et al., Nature 314:268 (1985).)
B. IsolationOfAntibodyFragmentsDirectedAgainstDR3-VI and
DR3 From A Library Of scFvs
Naturally occurring V-genes isolated from human PBLs are constructed
into a large library of antibody fragments which contain reactivities against
polypeptides of the present invention to which the donor may or may not have
been exposed (see, e.g., U. S. Patent 5,885,793 incorporated herein in its
entirety
by reference).
Rescue of the Library
A library of scFvs is constructed from the RNA of human PBLs as
described in W092/01047. To rescue phage displaying antibody fragments,
approximately 109 E. coli harboring the phagemid are used to inoculate 50 ml
of
2xTY containing 1 % glucose and 100 pg/ml of ampicillin (2xTY-AMP-GLU) and
grown to an O.D. of 0.8 with shaking. Five ml of this culture is used to
innoculate 50 ml of 2xTY-AMP-GLU, 2x10 TU of delta gene 3 helper phage
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-228-
(M13 delta gene III, see W092/01047) are added and the culture incubated at
37°C for 45 minutes without shaking and then at 37° C for 45
minutes with
shaking. The culture is centrifuged at 4000 r.p.m. for 10 minutes and the
pellet
resuspended in 2 liters of 2xTY containing 100 pg/ml ampicillin and 50 ~tg/ml
kanamycin and grown overnight. Phage are prepared as described in
W092/01047.
M13 delta gene Ill is prepared as follows: M13 delta gene III helper
phage does not encode gene III protein, hence the phage(mid) displaying
antibody
fragments have a greater avidity of binding to antigen. Infectious M13 delta
gene
III particles are made by growing the helper phage in cells harboring a pUCl9
derivative supplying the wild type gene III protein during phage
morphogenesis.
The culture is incubated for 1 hour at 37°C without shaking and then
for a further
hour at 37°C with shaking. Cells are pelleted (IEC-Centra 8, 4000
revs/min for
10 min), resuspended in 300 ml 2xTY broth containing 100 ~g ampicillin/ml and
25 pg kanamycin/ml (2xTY-AMP-KAN) and grown overnight, shaking at 37°C.
Phage particles are purified and concentrated from the culture medium by two
PEG-precipitations (Sambrook et al., 1990), resuspended in 2 ml PBS and passed
through a 0.45 pm filter (Minisart NML; Sartorius) to give a final
concentration
of approximately 1013 transducing units/ml (ampicillin-resistant clones).
Panning of the Library
Immunotubes (Nunc) are coated overnight in PBS with 4 ml of either 100
mg/ml or 10 mg/ml of a polypeptide of the present invention. Tubes are blocked
with 2% Marvel-PBS for 2 hours at 37°C and then washed 3 times in PBS.
Approximately 10'3 TU of phage are applied to the tube and incubated for 30
minutes at room temperature tumbling on an over and under turntable and then
left to stand for another 1.5 hours. Tubes are washed 10 times with PBS, 0.1%
Tween-20 and 10 times with PBS. Phage are eluted by adding 1 ml of 100 mM
triethylamine and rotating 15 minutes on an under and over turntable after
which
the solution is immediately neutralized with 0.5 ml of I.OM Tris-HCI, pH 7.4.
Phage are then used to infect 10 ml of mid-log E. coli TG1 by incubating
eluted
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-229-
phage with bacteria for 30 minutes at 37°C. The E coli are then plated
on TYE
plates containing 1% glucose and 100 pg/ml ampicillin. The resulting bacterial
library is then rescued with delta gene 3 helper phage as described above to
prepare phage for a subsequent round of selection. This process is then
repeated
for a total of 4 rounds of affinity purification with tube-washing increased
to 20
times with PBS, 0.1% Tween-20 and 20 times with PBS for rounds 3 and 4.
Characterization of Binders
Eluted phage from the 3rd and 4th rounds of selection are used to infect
E coli HB 21 S 1 and soluble scFv is produced (Marks et al., J. Mol. Biol.
222: S81-S97 (1991 )) from single colonies for assay. ELISAs are performed
with
microtitre plates coated with either 10 pg/ml of the polypeptide of the
present
invention in SO mM bicarbonate pH 9.6. Clones positive in ELISA are further
characterized by PCR fingerprinting (see, e.g., W092/01047) and then by
sequencing.
Example 9
Method of Determining Alterations in the DR3 Gene
RNA is isolated from entire families or individual patients presenting with
a phenotype of interest (such as a disease). cDNA is then generated from these
RNA samples using protocols known in the art. (See, Sambrook et al., 1990)
The cDNA is then used as a template for PCR, employing primers surrounding
regions of interest in SEQ ID NO:1. Suggested PCR conditions consist of 35
cycles at 9S °C for 30 seconds; 60-120 seconds at S2-S8 ° C; and
60-120 seconds
at 70 ° C, using buffer solutions described in Sidransky, D., et al.,
Science 252:706
(1991).
PCR products are then sequenced using primers labeled at their S' end
with T4 polynucleotide kinase, employing SequiTherm Polymerase. (Epicentre
Technologies). The intron-exon borders of selected exons of DR3 are also
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-23 0-
determined and genomic PCR products analyzed to confirm the results. PCR
products harboring suspected mutations in DR3 are then cloned and sequenced
to validate the results of the direct sequencing.
PCR products of DR3 are cloned into T-tailed vectors as described in
Holton, T.A. and Graham, M.W., Nucleic Acids Research, 19:1156 (1991) and
sequenced with T7 polymerase (United States Biochemical). Affected individuals
are identified by mutations in DR3 not present in unaffected individuals.
Genomic rearrangements are also observed as a method of determining
alterations in the DR3 gene. Genomic clones isolated using techniques known in
the art are nick-translated with digoxigenindeoxy-uridine 5'-triphosphate
(Boehringer Manheim), and FISH performed as described in Johnson, C. et al.,
Methods Cell. Biol. 35:73-99 (1991). Hybridization with the labeled probe is
carried out using a vast excess of human cot-1 DNA for specific hybridization
to
the DR3 genomic locus.
Chromosomes are counterstained with 4,6-diamino-2-phenylidole and
propidium iodide, producing a combination of C- and R-bands. Aligned images
for precise mapping are obtained using a triple-band filter set (Chroma
Technology, Brattleboro, VT) in combination with a cooled charge-coupled
device camera (Photometrics, Tucson, AZ) and variable excitation wavelength
filters. (Johnson, C. et al.., Genet. Anal. Tech. Appl., 8:75 (1991).) Image
collection, analysis and chromosomal fractional length measurements are
performed using the ISee Graphical Program System. (Inovision Corporation,
Durham, NC.) Chromosome alterations of the genomic region of DR3
(hybridized by the probe) are identified as insertions, deletions, and
translocations. These DR3 alterations are used as a diagnostic marker for an
associated disease.
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-231-
Example 10
Method of Detecting Abnormal Levels of DR3 in a Biological Sample
DR3 polypeptides can be detected in a biological sample, and if an
increased or decreased level of DR3 is detected, this polypeptide is a marker
for
a particular phenotype. Methods of detection are numerous, and thus, it is
understood that one skilled in the art can modify the following assay to fit
their
particular needs.
For example, antibody-sandwich ELISAs are used to detect DR3 in a
sample, preferably a biological sample. Wells of a microtiter plate are coated
with
specific antibodies to DR3, at a final concentration of 0.2 to 10 ~g/ml. The
antibodies are either monoclonal or polyclonal and are produced using
technique
known in the art. The wells are blocked so that non-specific binding of DR3 to
the well is reduced.
The coated wells are then incubated for > 2 hours at RT with a sample
containing DR3. Preferably, serial dilutions of the sample should be used to
validate results. The plates are then washed three times with deionized or
distilled water to remove unbounded DR3.
Next, SO ~l of specific antibody-alkaline phosphatase conjugate, at a
concentration of 25-400 ng, is added and incubated for 2 hours at room
temperature. The plates are again washed three times with deionized or
distilled
water to remove unbounded conjugate.
75 ~l of 4-methylumbelliferyl phosphate (MUP) or p-nitrophenyl
phosphate (NPP) substrate solution is then added to each well and incubated 1
hour at room temperature to allow cleavage of the substrate and fluorescence.
The fluorescence is measured by a microtiter plate reader. A standard curve is
prepared using the experimental results from serial dilutions of a control
sample
with the sample concentration plotted on the X-axis (log scale) and
fluorescence
or absorbance on the Y-axis (linear scale). The DR3 polypeptide concentration
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-232-
in a sample is then interpolated using the standard curve based on the
measured
fluorescence of that sample.
Example 11
Method of Treating Increased Levels of DR3
The present invention relates to a method for treating an individual in need
of a decreased level of DR3 biological activity in the body comprising,
administering to such an individual a composition comprising a therapeutically
effective amount of DR3 antagonist. Preferred antagonists for use in the
present
invention are DR3-specific antibodies.
Moreover, it will be appreciated that conditions caused by a decrease in
the standard or normal expression level of DR3 in an individual can be treated
by
administering DR3, preferably in a soluble and/or secreted form. Thus, the
invention also provides a method of treatment of an individual in need of an
increased level ofDR3 polypeptide comprising administering to such an
individual
a pharmaceutical composition comprising an amount of DR3 to increase the
biological activity level of DR3 in such an individual.
For example, a patient with decreased levels of DR3 polypeptide receives
a daily dose 0.1-100 pg/kg of the polypeptide for six consecutive days.
Preferably, the polypeptide is in a soluble and/or secreted form.
Example 12
Method of Treating Decreased Levels of DR3
The present invention also relates to a method for treating an individual
in need of an increased level of DR3 biological activity in the body
comprising
administering to such an individual a composition comprising a therapeutically
effective amount of DR3 or an agonist thereof.
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-233-
Antisense technology is used to inhibit production of DR3. This
technology is one example of a method of decreasing levels of DR3 polypeptide,
preferably a soluble and/or secreted form, due to a variety of etiologies,
such as
cancer.
For example, a patient diagnosed with abnormally increased levels of DR3
is administered intravenously antisense polynucleotides at 0.5, 1.0, 1.5, 2.0
and
3.0 mg/kg day for 21 days. This treatment is repeated after a 7-day rest
period
if the is determined to be well tolerated.
Example 13
Method of Treatment Using Gene Therapy - Ex Vivo
One method of gene therapy transplants fibroblasts, which are capable of
expressing soluble and/or mature DR3 polypeptides, onto a patient. Generally,
fibroblasts are obtained from a subject by skin biopsy. The resulting tissue
is
placed in tissue-culture medium and separated into small pieces. Small chunks
of the tissue are placed on a wet surface of a tissue culture flask,
approximately
ten pieces are placed in each flask. The flask is turned upside down, closed
tight
and left at room temperature over night. After 24 hours at room temperature,
the
flask is inverted and the chunks of tissue remain fixed to the bottom of the
flask
and fresh media (e.g., Ham's F12 media, with 10% FBS, penicillin and
streptomycin) is added. The flasks are then incubated at 37°C for
approximately
one week.
At this time, fresh media is added and subsequently changed every several
days. After an additional two weeks in culture, a monolayer of fibroblasts
emerge. The monolayer is trypsinized and scaled into larger flasks.
pMV-7 (Kirschmeier, P.T. et al., DNA, 7:219-25 (1988)), flanked by the
long terminal repeats of the Moloney murine sarcoma virus, is digested with
EcoRI and HindIII and subsequently treated with calfintestinal phosphatase.
The
r
linear vector is fractionated on agarose gel and purified, using glass beads.
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-234-
The cDNA encoding DR3 can be amplified using PCR primers which
correspond to the 5' and 3' end encoding sequences respectively. Preferably,
the
5' primer contains an EcoRI site and the 3' primer includes a HindIII site.
Equal
quantities of the Moloney murine sarcoma virus linear backbone and the
amplified
EcoRI and HindIII fragment are added together, in the presence of T4 DNA
ligase. The resulting mixture is maintained under conditions appropriate for
ligation of the two fragments. The ligation mixture is then used to transform
E.
coli HB 1 O 1, which are then plated onto agar containing kanamycin for the
purpose of confirming that the vector contains properly inserted DR3.
The amphotropic pA317 or GP+am 12 packaging cells are grown in tissue
culture to confluent density in Dulbecco's Modified Eagles Medium (DMEM)
with 10% calf serum (CS), penicillin and streptomycin. The MSV vector
containing the DR3 gene is then added to the media and the packaging cells
transduced with the vector. The packaging cells now produce infectious viral
particles containing the DR3 gene (the packaging cells are now referred to as
producer cells). Fresh media is added to the transduced producer cells, and
subsequently, the media is harvested from a 10 cm plate of confluent producer
cells. The spent media, containing the infectious viral particles, is filtered
through
a Millipore filter to remove detached producer cells and this media is then
used
to infect fibroblast cells. Media is removed from a sub-confluent plate of
fibroblasts and quickly replaced with the media from the producer cells. This
media is removed and replaced with fresh media. If the titer of virus is high,
then
virtually all fibroblasts will be infected and no selection is required. If
the titer is
very low, then it is necessary to use a retroviral vector that has a
selectable
marker, such as neo or his. Once the fibroblasts have been eff ciently
infected, the
fibroblasts are analyzed to determine whether DR3 protein is produced.
The engineered fibroblasts are then transplanted onto the host, either
alone or after having been grown to confluence on cytodex 3 microcarrier
beads.
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-235-
Example 14
Method of Treatment Using Gene Therapy - In Vivo.
Another aspect of the present invention is using in vivo gene therapy
methods to treat disorders, diseases and conditions. The gene therapy method
relates to the introduction of naked nucleic acid (DNA, RNA, and antisense DNA
or RNA) DR3 sequences into an animal to increase or decrease the expression of
the DR3 polypeptide. The DR3 polynucleotide may be operatively linked to a
promoter or any other genetic elements necessary for the expression of the DR3
polypeptide by the target tissue. Such gene therapy and delivery techniques
and
methods are known in the art, see, for example, W090/11092, W098/11779;
U. S. Patent No. 5,693,622, 5,705,1 S 1, 5,580,859; Tabata H. et al.,
Cardiovarc.
Res. 35:470-479 (1997); Chao J. et al., Pharmacol. Res. 35:517-522 (1997);
WoIffJ.A. Neuromuscul. Disord 7:314-318 (1997); Schwartz B. et al,. Gene
Ther. 3:405-411 (1996); Tsurumi Y. et al., Circulation 94:3281-3290 (1996)
(incorporated herein by reference).
The DR3 polynucleotide constructs may be delivered by any method that
delivers injectable materials to the cells of an animal, such as, injection
into the
interstitial space of tissues (heart, muscle, skin, lung, liver, intestine and
the like).
The DR3 polynucleotide constructs can be delivered in a pharmaceutically
acceptable liquid or aqueous carrier.
The term "naked" polynucleotide, DNA or RNA, refers to sequences that
are free from any delivery vehicle that acts to assist, promote, or facilitate
entry
into the cell, including viral sequences, viral particles, liposome
formulations,
lipofectin or precipitating agents and the like. However, the DR3
polynucleotides
may also be delivered in liposome formulations (such as those taught in
Felgner,
P. et al. Ann. NYAcad. Sci. 772:126-139 (1995), and Abdallah, B. et al. Biol.
Cell 85:1-7 (1995)) which can be prepared by methods well known to those
skilled in the art.
The DR3 polynucleotide vector constructs used in the gene therapy
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-236-
method are preferably constructs that will not integrate into the host genome
nor
will they contain sequences that allow for replication. Any strong promoter
known to those skilled in the art can be used for driving the expression of
DNA.
Unlike other gene therapy techniques, one major advantage of introducing naked
nucleic acid sequences into target cells is the transitory nature of the
polynucleotide synthesis in the cells. Studies have shown that non-replicating
DNA sequences can be introduced into cells to provide production of the
desired
polypeptide for periods of up to six months.
The DR3 polynucleotide construct can be delivered to the interstitial
space of tissues within an animal, including of muscle, skin, brain, lung,
liver,
spleen, bone marrow, thymus, heart, lymph, blood, bone, cartilage, pancreas,
kidney, gall bladder, stomach, intestine, testis, ovary, uterus, rectum,
nervous
system, eye, gland, and connective tissue. Interstitial space of the tissues
comprises the intercellular fluid, mucopolysaccharide matrix among the
reticular
fibers of organ tissues, elastic fibers in the walls of vessels or chambers,
collagen
fibers of fibrous tissues, or that same matrix within connective tissue
ensheathing
muscle cells or in the lacunae of bone. It is similarly the space occupied by
the
plasma of the circulation and the lymph fluid of the lymphatic channels.
Delivery
to the interstitial space of muscle tissue is preferred for the reasons
discussed
below. They may be conveniently delivered by injection into the tissues
comprising these cells. They are preferably delivered to and expressed in
persistent, non-dividing cells which are differentiated, although delivery and
expression may be achieved in non-differentiated or less completely
differentiated
cells, such as, for example, stem cells of blood or skin fibroblasts. In vivo
muscle
. cells are particularly competent in their ability to take up and express
polynucleotides.
For the naked DR3 polynucleotide injection, an effective dosage amount
of DNA or RNA will be in the range of from about 0.05 pg/kg body weight to
about 50 mg/kg body weight. Preferably the dosage will be from about 0.005
mg/kg to about 20 mg/kg and more preferably from about 0.05 mg/kg to about
5 mg/kg. Of course, as the artisan of ordinary skill will appreciate, this
dosage
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-23 7-
will vary according to the tissue site of injection. The appropriate and
effective
dosage of nucleic acid sequence can readily be determined by those of ordinary
skill in the art and may depend on the condition being treated and the route
of
administration. The preferred route of administration is by the parenteral
route
ofinjection into the interstitial space oftissues. However, other parenteral
routes
may also be used, such as, inhalation of an aerosol formulation particularly
for
delivery to lungs or bronchial tissues, throat or mucous membranes of the
nose.
In addition, naked DR3 polynucleotide constructs can be delivered to arteries
during angioplasty by the catheter used in the procedure.
The dose response effects of injected DR3 polynucleotide in muscle in
vivo are determined as follows. Suitable DR3 template DNA for production of
mRNA coding for DR3 polypeptide is prepared in accordance with a standard
recombinant DNA methodology. The template DNA, which may be either
circular or linear, is either used as naked DNA or complexed with liposomes.
The
quadriceps muscles of mice are then injected with various amounts of the
template DNA.
Five to six week old female and male Balb/C mice are anesthetized by
intraperitoneal injection with 0.3 ml of 2.5% Avertin. A 1.5 cm incision is
made
on the anterior thigh, and the quadriceps muscle is directly visualized. The
DR3
template DNA is injected in 0.1 ml of carrier in a 1 cc syringe through a 27
gauge
needle over one minute, approximately 0.5 cm from the distal insertion site
ofthe
muscle into the knee and about 0.2 cm deep. A suture is placed over the
injection
site for future localization, and the skin is closed with stainless steel
clips.
After an appropriate incubation time (e.g., 7 days) muscle extracts are
prepared by excising the entire quadriceps. Every fifth 15 pm cross-section of
the
individual quadriceps muscles is histochemically stained for DR3 protein
expression. A time course for DR3 protein expression may be done in a similar
fashion except that quadriceps from different mice are harvested at different
times. Persistence of DR3 DNA in muscle following injection may be determined
by Southern blot analysis after preparing total cellular DNA and HIRT
supernatants from injected and control mice. The results of the above
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-23 8-
experimentation in mice can be use to extrapolate proper dosages and other
treatment parameters in humans and other animals using DR3 naked DNA.
It will be clear that the invention may be practiced otherwise than as
particularly described in the foregoing description and examples.
Numerous modifications and variations of the present invention are
possible in light of the above teachings and, therefore, are within the scope
of the
appended claims.
The entire disclosures of all patents, patent applications, and publications
referred to herein are hereby incorporated by reference.
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
238.1
Applicant's or agent's file ~ International application Nod be assigned
reverence number 1488.031PC09
INDICATIONS RELATING TO DEPOSITED MICROORGANISM
OR OTHER BIOLOGICAL MATERIAL
(PCT Rule 136is)
A. The indications made below
relate to the microorganism
referred to in the description
on page _ 4-, line -17
B. IDENTIFICATION OF DEPOSIT
Further deposits are identified
on an additional sheet
Name of depository institution
American Type Culture Collection
Address of depository institution
(including postal code and country)
10801 University Boulevard
Manassas, Virginia 20110-2209
United States of America
Date of deposit March 1, 1996 Accession Number ATCC 97456
C. ADDITIONAL INDICATIONS (leave
blank if not applicable) This
information is continued on
an additional sheet ~
DNA Plasmid, 231556
D. DESIGNATED STATES FOR WHICH
INDICATIONS ARE MADE (ijthe
indications are not jor all
designated States)
E. SEPARATE FURNISHING OF INDICATIONS
(leave blank if nor npplicable)
The indications listed below
will be submitted to the international
Bureau later (specify the general
nature of the indications, e.g.,
"Accession Number of Deposit")
For receiving Office use only For International Bureau use only
D This sheet was received with ~ This sheet was received by the International
the international application Bureau on:
Authorized ofticer Authorized officer
Form PCT/R0/134 (July 1998) 031pc09.dep
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
238.2
Applicant's or agent's file ~ International application No~O be assigned.
reference number 1488.031PC't)9
INDICATIONS RELATING TO DEPOSITED MICROORGANISM
OR OTHER BIOLOGICAL MATERIAL
(PCT Rule l3bis)
A. The indications made below
relate to the nucroorganism referred
to in the description on page
4-, line -18
B. H)ENTIFICATION OF DEPOSIT Further
deposits are identified on an
additional sheet o
Name of depository institution
American Type Culture Collection
Address of depository institution
(including postal code and country)
10801 University Boulevard
Manassas, Virginia 20110-2209
United States of America
Date of deposit October 10, 1996 Accession Number ATCC 97757
C. ADDITIONAL INDICATIONS (leave
blank if not applicable) This
information is continued on an
additional sheet 0
DNA Plasmid, 1198782
D. DESIGNATED STATES FOR WHICH
INDICATIONS ARE MADE (i,(tl~e
indications are not,far all designated
States)
E. SEPARATE FURNISHING OF INDICATIONS
(leave blank if not applicable)
The indications listed below will
be submitted to the international
Bureau later (specify the general
nature of the indications, e.g.,
'Accession Number of Deposit")
For receiving Office use only For International Bureau use only
o This sheet was received with O This sheet was received by the International
the international application Bureau on:
Authorized officer Authorized officer
Form PCT/R0/134 (July 1998) 031pc09.dep1
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-1-
SEQUENCE LISTING
<110> Human Genome Sciences, Inc.
The Regents of the University of Michigan
Yu, Guo-Liang
Ni, Jian
Dixit, Vishva
Gentz, Refiner L.
Dillon, Patrick J. '
<120> Death Domain Containing Receptors
<130> 1488.031PC09
<140>
<141>
<150> US 60/136,741
<151> 1999-05-28
<150> US 60/130,488
<151> 1999-04-22
<160> 17
<170> PatentIn Ver. 2.1
<210> 1
<211> 1783
<212> DNA
<213> Homo Sapiens
<220>
<221> CDS
<222> (198)..(1481)
<400> 1
catgggtggg ggtgggggcg ctgctggatt cctgctctgg tggaggggaa acttgtgagg 60
ggctggtaag cgccccctcc gaagcctggt gtgtgcgcgg ggggaaggaa gttagtttcc 120
tctccaccca tgggcacccc ttctgcccgg ggcctgggaa gtgggctgct ctgtgggcaa 180
atgctggggc ctctgaa atg gag gag acg cag cag gga gag gcc cca cgt 230
Met Glu Glu Thr Gln Gln Gly Glu Ala Pro Arg
1 5 10
ggg cag ctg cgc gga gag tca gca gca cct gtc ccc cag gcg ctc ctc 278
Gly Gln Leu Arg Gly Glu Ser Ala Ala Pro Val Pro Gln Ala Leu Leu
15 20 25
ctg gtg ctg ctg ggg gcc cgg gcc cag ggc ggc act cgt agc ccc agg 326
Leu Val Leu Leu Gly Ala Arg Ala Gln Gly Gly Thr Arg Ser Pro Arg
30 35 40
tgt gac tgt gcc ggt gac ttc cac aag aag att ggt ctg ttt tgt tgc 374
Cys Asp Cys Ala Gly Asp Phe His Lys Lys Ile Gly Leu Phe Cys Cys
45 50 55
aga ggc tgc cca gcg ggg cac tac ctg aag gcc cct tgc acg gag ccc 422
Arg Gly Cys Pro Ala Gly His Tyr Leu Lys Ala Pro Cys Thr Glu Pro
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-2-
60 65 70 75
tgcggcaac tccacc tgccttgtg tgtccccaa gacaccttc ttggcc 470
CysGlyAsn SerThr CysLeuVal CysProGln AspThrPhe LeuAla
80 85 90
tgggagaac caccat aattctgaa tgtgcccgc tgccaggcc tgtgat 518
TrpGluAsn HisHis AsnSerGlu CysAlaArg CysGlnAla CysAsp
95 100 105
gagcaggcc tcccag gtggcgctg gagaactgt tcagcagtg gccgac 566
GluGlnAla SerGln ValAlaLeu GluAsnCys SerAlaVal AlaAsp
110 115 120
acccgctgt ggctgt aagccaggc tggtttgtg gagtgccag gtcagc 614
ThrArgCys GlyCys LysProGly TrpPheVal GluCysGln ValSer
125 130 135
caatgtgtc agcagt tcacccttc tactgccaa ccatgccta gactgc 662
GlnCysVal SerSer SerProPhe TyrCysGln ProCysLeu AspCys
140 145 150 155
ggggccctg caccgc cacacacgg ctactctgt tcccgcaga gatact 710
GlyAlaLeu HisArg HisThrArg LeuLeuCys SerArgArg AspThr
160 165 170
gactgtggg acctgc ctgcctggc ttctatgaa catggcgat ggctgc 758
AspCysGly ThrCys LeuProGly PheTyrGlu HisGlyAsp GlyCys
175 180 185
gtgtcctgc cccacg agcaccctg gggagctgt ccagagcgc tgtgcc 806
ValSerCys ProThr SerThrLeu GlySerCys ProGluArg CysAla
190 195 200
getgtctgt ggctgg aggcagatg ttctgggtc caggtgctc ctgget 854
AlaValCys GlyTrp ArgGlnMet PheTrpVal GlnValLeu LeuAla
205 210 215
ggccttgtg gtcccc ctcctgctt ggggccacc ctgacctac acatac 902
GlyLeuVal ValPro LeuLeuLeu GlyAlaThr LeuThrTyr ThrTyr
220 225 230 235
cgccactgc tggcct cacaagccc ctggttact gcagatgaa getggg 950
ArgHisCys TrpPro HisLysPro LeuValThr AlaAspGlu AlaGly
240 245 250
atggagget ctgacc ccaccaccg gccacccat ctgtcaccc ttggac 998
MetGluAla LeuThr ProProPro AlaThrHis LeuSerPro LeuAsp
255 260 265
agcgcccac accctt ctagcacct cctgacagc agtgagaag atctgc 1046
SerAlaHis ThrLeu LeuAlaPro ProAspSer SerGluLys IleCys
270 275 280
accgtccag ttggtg ggtaacagc tggacccct ggctacccc gagacc 1094
ThrValGln LeuVal GlyAsnSer TrpThrPro GlyTyrPro GluThr
285 290 295
caggaggcg ctctgc ccgcaggtg acatggtcc tgggaccag ttgccc 1142
GlnGluAla LeuCys ProGlnVal ThrTrpSer TrpAspGln LeuPro
300 305 310 315
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-3-
agc aga get ctt ggc ccc get get gcg ccc aca ctc tcg cca gag tcc 1190
Ser Arg Ala Leu Gly Pro Ala Ala Ala Pro Thr Leu Ser Pro Glu Ser
320 325 330
cca gcc ggc tcg cca gcc atg atg ctg cag ccg ggc ccg cag ctc tac 1238
Pro Ala Gly Ser Pro Ala Met Met Leu Gln Pro Gly Pro Gln Leu Tyr
335 340 345
gac gtg atg gac gcg gtc cca gcg cgg cgc tgg aag gag ttc gtg cgc 1286
Asp Val Met Asp Ala Val Pro Ala Arg Arg Trp Lys Glu Phe Val Arg
350 355 360
acg ctg ggg ctg cgc gag gca gag atc gaa gcc gtg gag gtg gag atc 1334
Thr Leu Gly Leu Arg Glu Ala Glu Ile Glu Ala Val Glu Val Glu Ile
365 370 375
ggc cgc ttc cga gac cag cag tac gag atg ctc aag cgc tgg cgc cag 1382
Gly Arg Phe Arg Asp Gln Gln Tyr Glu Met Leu Lys Arg Trp Arg Gln
380 385 390 395
cag cag ccc gcg ggc ctc gga gcc gtt tac gcg gcc ctg gag cgc atg 1430
Gln Gln Pro Ala Gly Leu Gly Ala Val Tyr Ala Ala Leu Glu Arg Met
400 405 410
ggg ctg gac ggc tgc gtg gaa gac ttg cgc agc cgc ctg cag cgc ggc 1478
Gly Leu Asp Gly Cys Val Glu Asp Leu Arg Ser Arg Leu Gln Arg Gly
415 420 425
ccg tgacacggcg cccacttgcc acctaggcgc tctggtggcc cttgcagaag 1531
Pro
ccctaagtac ggttacttat gcgtgtagac attttatgtc acttattaag ccgctggcac 1591
ggccctgcgt agcagcacca gccggcccca cccctgctcg cccctatcgc tccagccaag 1651
gcgaagaagc acgaacgaat gtcgagaggg ggtgaagaca tttctcaact tctcggccgg 1711
agtttggctg agatcgcggt attaaatctg tgaaagaaaa caaaacaaaa caaaaaaaaa 1771
aaaaaaaaaa as 1783
<210> 2
<211> 428
<212> PRT
<213> Homo Sapiens
<400> 2
Met Glu Glu Thr Gln Gln Gly Glu Ala Pro Arg Gly Gln Leu Arg Gly
1 5 10 15
Glu Ser Ala Ala Pro Val Pro Gln Ala Leu Leu Leu Val Leu Leu Gly
20 25 30
Ala Arg Ala Gln Gly Gly Thr Arg Ser Pro Arg Cys Asp Cys Ala Gly
35 40 45
Asp Phe His Lys Lys Ile Gly Leu Phe Cys Cys Arg Gly Cys Pro Ala
50 55 60
Gly His Tyr Leu Lys Ala Pro Cys Thr Glu Pro Cys Gly Asn Ser Thr
65 70 75 80
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-4-
Cys Leu Val Cys Pro Gln Asp Thr Phe Leu Ala Trp Glu Asn His His
85 90 95
Asn Ser Glu Cys Ala Arg Cys Gln Ala Cys Asp Glu Gln Ala Ser Gln
100 105 110
Val Ala Leu Glu Asn Cys Ser Ala Val Ala Asp Thr Arg Cys Gly Cys
115 120 125
Lys Pro Gly Trp Phe Val Glu Cys Gln Val Ser Gln Cys Val Ser Ser
130 135 140
Ser Pro Phe Tyr Cys Gln Pro Cys Leu Asp Cys Gly Ala Leu His Arg
145 150 155 160
His Thr Arg Leu Leu Cys Ser Arg Arg Asp Thr Asp Cys Gly Thr Cys
165 170 175
Leu Pro Gly Phe Tyr Glu His Gly Asp Gly Cys Val Ser Cys Pro Thr
180 185 190
Ser Thr Leu Gly Ser Cys Pro Glu Arg Cys Ala Ala Val Cys Gly Trp
195 200 205
Arg Gln Met Phe Trp Val Gln Val Leu Leu Ala Gly Leu Val Val Pro
210 215 220
Leu Leu Leu Gly Ala Thr Leu Thr Tyr Thr Tyr Arg His Cys Trp Pro
225 230 235 240
His Lys Pro Leu Val Thr Ala Asp Glu Ala Gly Met Glu Ala Leu Thr
245 250 255
Pro Pro Pro Ala Thr His Leu Ser Pro Leu Asp Ser Ala His Thr Leu
260 265 270
Leu Ala Pro Pro Asp Ser Ser Glu Lys Ile Cys Thr Val Gln Leu Val
275 280 285
Gly Asn Ser Trp Thr Pro Gly Tyr Pro Glu Thr Gln Glu Ala Leu Cys
290 295 300
Pro Gln Val Thr Trp Ser Trp Asp Gln Leu Pro Ser Arg Ala Leu Gly
305 310 315 320
Pro Ala Ala Ala Pro Thr Leu Ser Pro Glu Ser Pro Ala Gly Ser Pro
325 330 335
Ala Met Met Leu Gln Pro Gly Pro Gln Leu Tyr Asp Val Met Asp Ala
340 345 350
Val Pro Ala Arg Arg Trp Lys Glu Phe Val Arg Thr Leu Gly Leu Arg
355 360 365
Glu Ala Glu Ile Glu Ala Val Glu Val Glu Ile Gly Arg Phe Arg Asp
370 375 380
Gln Gln Tyr Glu Met Leu Lys Arg Trp Arg Gln Gln Gln Pro Ala Gly
385 390 395 400
Leu Gly Ala Val Tyr Ala Ala Leu Glu Arg Met Gly Leu Asp Gly Cys
405 410 415
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-5-
Val Glu Asp Leu Arg Ser Arg Leu Gln Arg Gly Pro
420 425
<210>
3
<211>
1254
<212>
DNA
<213> sapiens
Homo
<220>
_
<221>
CDS
<222> (1251)
(1)..
<400>
3
atggag cagcggccg cggggctgc gcggcggtg gcggcggcg ctcctc 48
MetGlu GlnArgPro ArgGlyCys AlaAlaVal AlaAlaAla LeuLeu
1 5 10 15
ctggtg ctgctgggg gcccgggcc cagggcggc actcgtagc cccagg 96
LeuVal LeuLeuGly AlaArgAla GlnGlyGly ThrArgSer ProArg
20 25 30
tgtgac tgtgccggt gacttccac aagaagatt ggtctgttt tgttgc 144
CysAsp CysAlaGly AspPheHis LysLysIle GlyLeuPhe CysCys
35 40 45
agaggc tgcccagcg gggcactac ctgaaggcc ccttgcacg gagccc 192
ArgGly CysProAla GlyHisTyr LeuLysAla ProCysThr GluPro
50 55 60
tgcggc aactccacc tgccttgtg tgtccccaa gacaccttc ttggcc 240
CysGly AsnSerThr CysLeuVal CysProGln AspThrPhe LeuAla
65 , 70 75 80
tgggag aaccaccat aattctgaa tgtgcccgc tgccaggcc tgtgat 288
TrpGlu AsnHisHis AsnSerGlu CysAlaArg CysGlnAla CysAsp
85 90 95
gagcag gcctcccag gtggcgctg gagaactgt tcagcagtg gccgac 336
GluGln AlaSerGln ValAlaLeu GluAsnCys SerAlaVal AlaAsp
100 105 110
acccgc tgtggctgt aagccaggc tggtttgtg gagtgccag gtcagc 384
ThrArg CysGlyCys LysProGly TrpPheVal GluCysGln ValSer
115 120 125
caatgt gtcagcagt tcacccttc tactgccaa ccatgccta gactgc 432
GlnCys ValSerSer SerProPhe TyrCysGln ProCysLeu AspCys
130 135 140
ggggcc ctgcaccgc cacacacgg ctactctgt tcccgcaga gatact 480
GlyAla LeuHisArg HisThrArg LeuLeuCys SerArgArg AspThr
145 150 155 160
gactgt gggacctgc ctgcctggc ttctatgaa catggcgat ggctgc 528
AspCys GlyThrCys LeuProGly PheTyrGlu HisGlyAsp GlyCys
165 170 175
gtgtcc tgccccacg agcaccctg gggagctgt ccagagcgc tgtgcc 576
ValSer CysProThr SerThrLeu GlySerCys ProGluArg CysAla
180 185 190
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-6-
getgtc tgtggctgg aggcagatg ttctgggtc caggtgctc ctgget 624
AlaVal CysGlyTrp ArgGlnMet PheTrpVal GlnValLeu LeuAla
195 200 205
ggcctt gtggtcccc ctcctgctt ggggccacc ctgacctac acatac 672
GlyLeu ValValPro LeuLeuLeu GlyAlaThr LeuThrTyr ThrTyr
210 215 220
cgccac tgctggcct cacaagccc ctggttact gcagatgaa getggg 720
ArgHis CysTrpPro HisLysPro LeuValThr AlaAspGlu AlaGly
225 230 235 240
atggag getctgacc ccaccaccg gccacccat ctgtcaccc ttggac 768
MetGlu AlaLeuThr ProProPro AlaThrHis LeuSerPro LeuAsp
245 250 255
agcgcc cacaccctt ctagcacct cctgacagc agtgagaag atctgc 816
SerAla HisThrLeu LeuAlaPro ProAspSer SerGluLys IleCys
260 265 270
accgtc cagttggtg ggtaacagc tggacccct ggctacccc gagacc 864
ThrVal GlnLeuVal GlyAsnSer TrpThrPro GlyTyrPro GluThr
275 280 285
caggag gcgctctgc ccgcaggtg acatggtcc tgggaccag ttgccc 912
GlnGlu AlaLeuCys ProGlnVal ThrTrpSer TrpAspGln LeuPro
290 295 300
agcaga getcttggc cccgetget gcgcccaca ctctcgcca gagtcc 960
SerArg AlaLeuGly ProAlaAla AlaProThr LeuSerPro GluSer
305 310 315 320
ccagcc ggctcgcca gccatgatg ctgcagccg ggcccgcag ctctac 1008
ProAla GlySerPro AlaMetMet LeuGlnPro GlyProGln LeuTyr
325 330 335
gacgtg atggacgcg gtcccagcg cggcgctgg aaggagttc gtgcgc 1056
AspVal MetAspAla ValProAla ArgArgTrp LysGluPhe ValArg
340 345 350
acgctg gggctgcgc gaggcagag atcgaagcc gtggaggtg gagatc ll04
ThrLeu GlyLeuArg GluAlaGlu IleGluAla ValGluVal GluIle
355 360 365
ggccgc ttccgagac cagcagtac gagatgctc aagcgctgg cgccag 1152
GlyArg PheArgAsp GlnGlnTyr GluMetLeu LysArgTrp ArgGln
370 375 380
cagcag cccgcgggc ctcggagcc gtttacgcg gccctggag cgcatg 1200
GlnGln ProAlaGly LeuGlyAla ValTyrAla AlaLeuGlu ArgMet
385 390 395 400
gggctg gacggctgc gtggaagac ttgcgcagc cgcctgcag cgcggc 1248
GlyLeu AspGlyCys ValGluAsp LeuArgSer ArgLeuGln ArgGly
405 410 415
ccgtga 1254
Pro
<210> 4
<211> 417
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
<212> PRT
<213> Homo Sapiens
<400> 4
Met Glu Gln Arg Pro Arg Gly Cys Ala Ala Val Ala Ala Ala Leu Leu
1 5 10 15
Leu Val Leu Leu Gly Ala Arg Ala Gln Gly Gly Thr Arg Ser Pro Arg
20 25 30
Cys Asp Cys Ala Gly Asp Phe His Lys Lys Ile Gly Leu Phe Cys Cys
35 40 45
Arg Gly Cys Pro Ala Gly His Tyr Leu Lys Ala Pro Cys Thr Glu Pro
50 55 60
Cys Gly Asn Ser Thr Cys Leu Val Cys Pro Gln Asp Thr Phe Leu Ala
65 70 75 80
Trp Glu Asn His His Asn Ser Glu Cys Ala Arg Cys Gln Ala Cys Asp
85 90 95
Glu Gln Ala Ser Gln Val Ala Leu Glu Asn Cys Ser Ala Val Ala Asp
100 105 110
Thr Arg Cys Gly Cys Lys Pro Gly Trp Phe Val Glu Cys Gln Val Ser
115 120 125
Gln Cys Val Ser Ser Ser Pro Phe Tyr Cys Gln Pro Cys Leu Asp Cys
130 135 140
Gly Ala Leu His Arg His Thr Arg Leu Leu Cys Ser Arg Arg Asp Thr
145 150 155 160
Asp Cys Gly Thr Cys Leu Pro Gly Phe Tyr Glu His Gly Asp Gly Cys
165 170 175
Val Ser Cys Pro Thr Ser Thr Leu Gly Ser Cys Pro Glu Arg Cys Ala
180 185 190
Ala Val Cys Gly Trp Arg Gln Met Phe Trp Val Gln Val Leu Leu Ala
195 200 205
Gly Leu Val Val Pro Leu Leu Leu Gly Ala Thr Leu Thr Tyr Thr Tyr
210 215 220
Arg His Cys Trp Pro His Lys Pro Leu Val Thr Ala Asp Glu Ala Gly
225 230 235 240
Met Glu Ala Leu Thr Pro Pro Pro Ala Thr His Leu Ser Pro Leu Asp
245 250 255
Ser Ala His Thr Leu Leu Ala Pro Pro Asp Ser Ser Glu Lys Ile Cys
260 265 270
Thr Val Gln Leu Val Gly Asn Ser Trp Thr Pro Gly Tyr Pro Glu Thr
275 280 285
Gln Glu Ala Leu Cys Pro Gln Val Thr Trp Ser Trp Asp Gln Leu Pro
290 295 300
Ser Arg Ala Leu Gly Pro Ala Ala Ala Pro Thr Leu Ser Pro Glu Ser
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
_g_
305 310 315 320
Pro Ala Gly Ser Pro Ala Met Met Leu Gln Pro Gly Pro Gln Leu Tyr
325 330 335
Asp Val Met Asp Ala Val Pro Ala Arg Arg Trp Lys Glu Phe Val Arg
340 345 350
Thr Leu Gly Leu Arg Glu Ala Glu Ile Glu Ala Val Glu Val Glu Ile
355 360 365
Gly Arg Phe Arg Asp Gln Gln Tyr Glu Met Leu Lys Arg Trp Arg Gln
370 375 380
Gln Gln Pro Ala Gly Leu Gly Ala Val Tyr Ala Ala Leu Glu Arg Met
385 390 395 400
Gly Leu Asp Gly Cys Val Glu Asp Leu Arg Ser Arg Leu Gln Arg Gly
405 410 415
Pro
<210> 5
<211> 455
<212> PRT
<213> Homo sapiens
<400> 5
Met Gly Leu Ser Thr Val Pro Asp Leu Leu Leu Pro Leu Val Leu Leu
1 5 10 15
Glu Leu Leu Val Gly Ile Tyr Pro Ser Gly Val Ile Gly Leu Val Pro
20 25 30
His Leu Gly Asp Arg Glu Lys Arg Asp Ser Val Cys Pro Gln Gly Lys
35 40 45
Tyr Ile His Pro Gln Asn Asn Ser Ile Cys Cys Thr Lys Cys His Lys
50 55 60
Gly Thr Tyr Leu Tyr Asn Asp Cys Pro Gly Pro Gly Gln Asp Thr Asp
65 70 75 80
Cys Arg Glu Cys Glu Ser Gly Ser Phe Thr Ala Ser Glu Asn His Leu
85 90 95
Arg His Cys Leu Ser Cys Ser Lys Cys Arg Lys Glu Met Gly Gln Val
100 105 110
Glu Ile Ser Ser Cys Thr Val Asp Arg Asp Thr Val Cys Gly Cys Arg
115 120 125
Lys Asn Gln Tyr Arg His Tyr Trp Ser Glu Asn Leu Phe Gln Cys Phe
130 135 140
Asn Cys Ser Leu Cys Leu Asn Gly Thr Val His Leu Ser Cys Gln Glu
145 150 155 160
Lys Gln Asn Thr Val Cys Thr Cys His Ala Gly Phe Phe Leu Arg Glu
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-9-
165 170 175
Asn Glu Cys Val Ser Cys Ser Asn Cys Lys Lys Ser Leu Glu Cys Thr
180 185 190
Lys Leu Cys Leu Pro Gln Ile Glu Asn Val Lys Gly Thr Glu Asp Ser
195 200 205
Gly Thr Thr Val Leu Leu Pro Leu Val Ile Phe Phe Gly Leu Cys Leu
210 215 220
Leu Ser Leu Leu Phe Ile Gly Leu Met Tyr Arg Tyr Gln Arg Trp Lys
225 230 235 240
Ser Lys Leu Tyr Ser Ile Val Cys Gly Lys Ser Thr Pro Glu Lys Glu
245 250 255
Gly Glu Leu Glu Gly Thr Thr Thr Lys Pro Leu Ala Pro Asn Pro Ser
260 265 270
Phe Ser Pro Thr Pro Gly Phe Thr Pro.Thr Leu Gly Phe Ser Pro Val
275 280 285
Pro Ser Ser Thr Phe Thr Ser Ser Ser Thr Tyr Thr Pro Gly Asp Cys
290 295 300
Pro Asn Phe Ala Ala Pro Arg Arg Glu Val Ala Pro Pro Tyr Gln Gly
305 310 315 320
Ala Asp Pro Ile Leu Ala Thr Ala Leu Ala Ser Asp Pro Ile Pro Asn
325 330 335
Pro Leu Gln Lys Trp Glu Asp Ser Ala His Lys Pro Gln Ser Leu Asp
340 345 350
Thr Asp Asp Pro Ala Thr Leu Tyr Ala Val Val Glu Asn Val Pro Pro
355 360 365
Leu Arg Trp Lys Glu Phe Val Arg Arg Leu Gly Leu Ser Asp His Glu
370 375 380
Ile Asp Arg Leu Glu Leu Gln Asn Gly Arg Cys Leu Arg Glu Ala Gln
385 390 395 400
Tyr Ser Met Leu Ala Thr Trp Arg Arg Arg Thr Pro Arg Arg Glu Ala
405 410 415
Thr Leu Glu Leu Leu Gly Arg Val Leu Arg Asp Met Asp Leu Leu Gly
420 425 430
Cys Leu Glu Asp Ile Glu Glu Ala Leu Cys Gly Pro Ala Ala Leu Pro
435 440 445
Pro Ala Pro Ser Leu Leu Arg
450 455
<210> 6
<211> 335
<212> PRT
<213> Homo sapiens
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-10-
<400> 6
Met Leu Gly Ile Trp Thr Leu Leu Pro Leu Val Leu Thr Ser Val Ala
1 5 10 15
Arg Leu Ser Ser Lys Ser Val Asn Ala Gln Val Thr Asp Ile Asn Ser
20 25 30
Lys Gly Leu Glu Leu Arg Lys Thr Val Thr Thr Val Glu Thr Gln Asn
35 40 45
Leu Glu Gly Leu His His Asp Gly Gln Phe Cys His Lys Pro Cys Pro
50 55 60
Pro Gly Glu Arg Lys Ala Arg Asp Cys Thr Val Asn Gly Asp Glu Pro
65 70 75 80
Asp Cys Val Pro Cys Gln Glu Gly Lys Glu Tyr Thr Asp Lys Ala His
85 90 95
Phe Ser Ser Lys Cys Arg Arg Cys Arg Leu Cys Asp Glu Gly His Gly
100 105 110
Leu Glu Val Glu Ile Asn Cys Thr Arg Thr Gln Asn Thr Lys Cys Arg
115 120 125
Cys Lys Pro Asn Phe Phe Gln Asn Ser Thr Val Cys Glu His Cys Asp
130 135 140
Pro Cys Thr Lys Cys Glu His Gly Ile Ile Lys Glu Cys Thr Leu Thr
145 150 155 160
Ser Asn Thr Lys Cys Lys Glu Glu Gly Ser Arg Ser Asn Leu Gly Trp
165 170 175
Leu Cys Leu Leu Leu Leu Pro Ile Pro Leu Ile Val Trp Val Lys Arg
180 185 190
Lys Glu Val Gln Lys Thr Cys Arg Lys His Arg Lys Glu Asn Gln Gly
195 200 205
Ser His Glu Ser Pro Thr Leu Asn Pro Glu Thr Val Ala Ile Asn Leu
210 215 220
Ser Asp Val Asp Leu Ser Lys Tyr Ile Thr Thr Ile Ala Gly Val Met
225 230 235 240
Thr Leu Ser Gln Val Lys Gly Phe Val Arg Lys Asn Gly Val Asn Glu
245 250 255
Ala Lys Ile Asp Glu Ile Lys Asn Asp Asn Val Gln Asp Thr Ala Glu
260 265 270
Gln Lys Val Gln Leu Leu Arg Asn Trp His Gln Leu His Gly Lys Lys
275 280 285
Glu Ala Tyr Asp Thr Leu Ile Lys Asp Leu Lys Lys Ala Asn Leu Cys
290 295 300
Thr Leu Ala Glu Lys Ile Gln Thr Ile Ile Leu Lys Asp Ile Thr Ser
305 310 315 320
Asp Ser Glu Asn Ser Asn Phe Arg Asn Glu Ile Gln Ser Leu Val
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-11
325 330 335
<210> 7
<211> 23
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: primer
<400> 7
gcgccatggg ggcccggcgg cag 23
<210> 8
<211> 30
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: primer
<400> 8
gcgaagcttc taggacccag aacatctgcc 30
<210> 9
<211> 33
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: primer
<400> 9
cgcggatccg ccatcatgga ggagacgcag cag 33
<210> 10
<211> 33
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: primer
<400> 10
cgcggatccg ccatcatgga gcagcggccg cgg 33
<210> 11
<211> 54
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: primer
<400> 11
gcgtctagat caaagcgtag tctgggacgt cgtatgggta cgggccgcgc tgca 54
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-12-
<210> 12
<211> 33
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: primer
<400> 12
cgcggatccg ccatcatgga ggagacgcag cag 33
<210> 13
<211> 33
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: primer
<400> 13
cgcggatccg ccatcatgga gcagcggccg cgg 33
<210> 14
<211> 26
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: primer
<400> 14
cgcggatcct cacgggccgc gctgca 26
<210> 15
<211> 33
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: primer
<400> 15
cgcggatccg ccatcatgga ggagacgcag cag 33
<210> 16
<211> 33
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: primer
<400> 16
cgcggatccg ccatcatgga gcagcggccg cgg 33
<210> 17
<211> 35
CA 02371114 2001-10-22
WO 00/64465 PCT/US00/10741
-13-
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: primer
<400> 17
gcgagatcta gtctggaccc agaacatctg cctcc 35
