Note: Descriptions are shown in the official language in which they were submitted.
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
Tumor Necrosis Factor Receptor 5
Background of the Invention
Field of the Invention
The present invention relates to a novel human gene encoding a
polypeptide which is a member of the TNF receptor family, and has now been
found to bind TRAIL. More specifically, an isolated nucleic acid molecule is
provided encoding a human polypeptide named tumor necrosis factor receptor-5,
sometimes referred to as "TNFR-5" or "TRS," and now referred to hereinafter as
"TRAIL receptor without intracellular domain" or "TRID." TRID polypeptides
are also provided, as are vectors, host cells, and recombinant methods for
producing the same. The invention further relates to screening methods for
identifying agonists or antagonists of TRID polypeptide activity. Also
provided
are diagnostic and therapeutic methods utilizing such compositions.
Related Art
Many biological actions, for instance, response to certain stimuli and
natural biological processes, are controlled by factors, such as cytokines.
Many
cytokines act through receptors by engaging the receptor and producing an
intra-
cellular response.
For example, tumor necrosis factors (TNF) alpha and beta are cytokines,
which act through TNF receptors to regulate numerous biological processes,
including protection against infection and induction of shock and inflammatory
disease. The TNF molecules belong to the "TNF-ligand" superfamily, and act
together with their receptors or counter-ligands, the "TNF-receptor"
superfamily.
So far, nine members of the TNF ligand superfamily have been identified and
ten
members of the TNF-receptor superfamily have been characterized.
Among the ligands, there are included TNF-a, lymphotoxin-a (LT-a, also
known as TNF-~3), LT-(3 (found in complex heterotrimer LT-a2-~3, FasL, CD40L,
CD27L, CD30L, 4-1BBL, OX40L and nerve growth factor (NGF). The
superfamily of TNF receptors includes the p55TNF receptor, p75TNF receptor,
TNF receptor-related protein. FAS antigen or APO-1, CD40, CD27, CD30,
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-2-
4-1BB, OX40, low affinity p75 and NGF-receptor (Meager, A., Biologicals
22:291-295 (1994)).
Many members of the TNF-ligand superfamily are expressed by activated
T-cells, implying that they are necessary for T-cell interactions with other
cell
types which underlie cell ontogeny and functions (Meager, A., supra).
Considerable insight into the essential functions of several members of the
TNF receptor family has been gained from the identification and creation of
mutants that abolish the expression of these proteins. For example, naturally
occurring mutations in the FAS antigen and its ligand cause
lymphoproliferative
disease (Watanabe-Fukunaga, R. et al., Nature 36:314 (1992)), perhaps
reflecting a failure of programmed cell death. Mutations of the CD40 ligand
cause
an X-linked immunodeficiency state characterized by high levels of
immunoglobulin M and low levels of immunoglobulin G in plasma, indicating
faulty T-cell-dependent B-cell activation (Allen, R.C. et al., Science 259:990
(1993)). Targeted mutations of the low affinity nerve growth factor receptor
cause a disorder characterized by faulty sensory innovation of peripheral
structures
(Lee, K.F. et al., Cell 69:737 (1992)).
TNF and LT-a are capable of binding to two TNF receptors (the 55- and
75-kd TNF receptors). A large number of biological effects elicited by TNF and
LT-a, acting through their receptors, include hemorrhagic necrosis of
transplanted
tumors, cytotoxicity, a role in endotoxic shock, inflammation,
immunoregulation,
proliferation and anti-viral responses, as well as protection against the
deleterious
effects of ionizing radiation. TNF and LT-a are involved in the pathogenesis
of
a wide range of diseases, including endotoxic shock, cerebral malaria, tumors,
autoimmune disease, AIDS and graft-host rejection (Beutler, B. and Von Huffel,
C., Science 264:667-668 ( 1994)). Mutations in the p55 Receptor cause
increased
susceptibility to microbial infection.
Moreover, an about 80 amino acid domain near the C-terminus of TNFR1
(p55) and Fas was reported as the "death domain," which is responsible for
transducing signals for programmed cell death (Tartaglia et al., Cell 74:845
(1993)).
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-3-
Apoptosis, or programmed cell death, is a physiologic process essential for
the normal development and homeostasis of multicellular organisms (H. Steller,
Science 267, 1445-1449 (1995)). Derangements of apoptosis contribute to the
pathogenesis of several human diseases including cancer, neurodegenerative
disorders, and acquired immune deficiency syndrome (C.B. Thompson, Science
267, 1456-1462 (1995)). One mechanism of immune mediated killing is the
engagement of death receptors. Recently, much attention has focused on the
signal transduction and biological function of two cell surface death
receptors,
Fas/APO-1 and TNFR-1 (J.L. Cleveland et al., Cell 81, 479-482 (1995); A.
Fraser, et al., Cell 85, 781-784 (1996); S. Nagata et al., Science 267, 1449-
56
(1995)). Both are members of the TNF receptor family which also include
TNFR-2, low affinity NGFR, CD40, and CD30, among others (C.A. Smith et al.,
Science 248, 1019-23 (1990); M. Tewari et al., in Modular Texts in Molecular
and Cell Biology M. Purton, Heldin, Carl, Ed. (Chapman and Hall, London,
1995). While family members are defined by the presence of cysteine-rich
repeats
in their extracellular domains, Fas/APO-1 and TNFR-1 also share a region of
intracellular homology, appropriately designated the "death domain", which is
distantly related to the Drosophila suicide gene, reaper (P. Golstein, et al.,
Cell
81, 185-186 (1995); K. White etal., Science 264, 677-83 (1994)). This shared
death domain suggests that both receptors interact with a related set of
signal
transducing molecules that, until recently, remained unidentified. Activation
of
Fas/APO-1 recruits the death domain-containing adapter molecule
FADD/MORT1 (A.M. Chinnaiyan et al., Cell8l, 505-12 ( 1995); M. P. Boldin et
al., J. Biol Chem 270, 7795-8 (1995); F.C. Kischkel etal., EMBO I-l, 5579-5588
( 1995)), which in turn binds and presumably activates FLICE/MACH 1, a member
of the ICE/CED-3 family of pro-apoptotic proteases (M. Muzio et al., Cell 85,
817-827 (1996); M.P. Boldin et al., Cell 8~, 803-815 (1996)). While the
central
role of Fas/APO-1 is to trigger cell death, TNFR-I can signal an array of
diverse
biological activities-many of which stem from its ability to activate NF-kB
(L.A.
Tartagliaetal., ImmunolTodayl3,151-3 (1992)). Accordingly,TNFR-1 recruits
the multivalent adapter molecule TRADD, which like FADD, also contains a death
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-4-
domain (H. Hsu et al., Cell 81, 495-504 (1995); H. Hsu, et al., Cell 8~, 299-
308
( 1996)). Through its associations with a number of signaling molecules
including
FADD, TRAF2, and RIP, TRADD can signal both apoptosis and NF-kB
activation (H. Hsu et al., Cell 8-l, 299-308 (1996); H. Hsu, et al., Immunity
4,
387-396 (1996)).
Recently, a new apoptosis -inducing TNF ligand has been discovered. S.R.
Wiley et al., Immunity 3,673-682 (1995) named the molecule - "TNF-related
apoptosis-inducing ligand" or simply "TRAIL." The molecule has also been
called
"Apo-2 ligand" or "Apo-2L." R.M. Pitt et al., J. Biol. Chem. 271,12687-12690
(1996). This molecule was also disclosed in co-pending U.S. provisional
application no. 60/013,405. For convenience, the molecule will be referred to
herein as TRAIL.
Unlike FAS ligand, whose transcripts appear to be largely restricted to
stimulated T-cells, significant levels of TRAIL are detected in many human
tissues
(e.g., spleen, lung, prostate, thymus, ovary, small intestine, colon,
peripheral blood
lymphocytes, placenta, kidney), and is constitutively transcribed by some cell
lines.
It has been shown that TRAIL acts independently from the Fas ligand (Whey et
al., supra). It has also been shown that TRAIL activates apoptosis rapidly,
within
a time frame that is similar to death signalling by Fas/Apo-1L, but much
faster
than TNF-induced apoptosis. S.A. Marsters et al., Current Biology 6, 750-752
(1996). The inability of TRAIL to bind TNFR-1, Fas, or the recently identified
DR3, suggests that TRAIL may interact with a unique receptor(s).
The effects of TNF family ligands and TNF family receptors are varied and
influence numerous functions, both normal and abnormal, in the biological
processes of the mammalian system. There is a clear need, therefore, for
identification and characterization of such receptors and ligands that
influence
biological activity, both normally and in disease states. In particular, there
is a
need to isolate and characterize additional novel receptors that bind TRAIL.
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-5-
Summary of the Invention
The present invention provides isolated nucleic acid molecules comprising,
or alternatively consisting of, a polynucleotide encoding the TRID polypeptide
having the amino acid sequence shown in SEQ ID N0:2, or the amino acid
sequence encoded by the cDNA clone deposited as ATCC Deposit Number 97798
on November 20, 1996. The nucleotide sequence determined by sequencing the
deposited TRID clone, which is shown in SEQ ID NO:1 contains an open reading
frame encoding a polypeptide of about 259 amino acid residues, with a leader
sequence of about 26 amino acids.
The present invention also relates to recombinant vectors, which include
the isolated nucleic acid molecules of the present invention, and to host
cells
containing the recombinant vectors, as well as to methods of making such
vectors
and host cells and methods for using them for production of TRID polypeptides
or peptides by recombinant techniques.
The invention further provides an isolated TRID polypeptide having an
amino acid sequence encoded by a polynucleotide described herein.
The present invention also provides diagnostic assays such as quantitative
and diagnostic assays for detecting levels of TRID protein. Thus, for
instance, a
diagnostic assay in accordance with the invention for detecting expression of
TRID, or soluble form thereof, may be used to detect the ability of normal
tissue
to withstand or be protected from the deleterious effects of TRAIL, such as
TRAIL-induced apoptosis.
Tumor Necrosis Factor (TNF) family ligands are known to be among the
most pleiotropic cytokines, inducing a large number of cellular responses,
including cytotoxicity, anti-viral activity, immunoregulatory activities, and
the
transcriptional regulation of several genes. Cellular response to TNF-family
ligands include not only normal physiological responses, but also diseases
associated with increased apoptosis or the inhibition of apoptosis. Apoptosis -
programmed cell death - is a physiological mechanism involved in the deletion
of
peripheral T lymphocytes of the immune system, and its dysregulation can lead
to
a number of different pathogenic processes. Diseases associated with increased
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-6-
cell survival, orthe inhibition of apoptosis, include cancers, autoimmune
disorders,
viral infections, inflammation, graft vs. host disease, acute graft rejection,
and
chronic graft rejection. Diseases associated with increased apoptosis include
AIDS, neurodegenerative disorders, myelodysplastic syndromes, ischemic injury,
toxin-induced liver disease, septic shock, cachexia and anorexia.
Thus, the invention further provides a method for enhancing apoptosis
induced by a TNF-family ligand, such as TRAIL, which involves administering to
a cell which expresses the TRID polypeptide an effective amount of an
antagonist
capable of decreasing TRID's ability to bind TRAIL. Preferably, TRID binding
is decreased to treat a disease wherein decreased apoptosis is exhibited.
In a further aspect, the present invention is directed to a method for
inhibiting apoptosis induced by a TNF-family ligand, such as TRAIL, which
involves administering to a cell an effective amount of TRID or an agonist
capable
of increasing TRID activity. Preferably, TRID activity is increased to treat a
disease wherein increased apoptosis is exhibited.
Whether any candidate "agonist" or "antagonist" of the present invention
can enhance or inhibit apoptosis can be determined using art-known TNF-family
ligand/receptor cellular response assays, including those described in more
detail
below. Thus, in a further aspect, a screening method is provided for
determining
whether a candidate agonist or antagonist is capable of enhancing or
inhibiting a
cellular response to a TNF-family ligand, such as TRAIL. The method involves
contacting cells which co-expresses the TRID polypeptide and a second TNFR
with a candidate compound and a TNF-family ligand (e.g., TRAIL), assaying a
cellular response, and comparing the cellular response to a standard cellular
response, the standard being assayed when contact is made with the ligand in
absence of the candidate compound, whereby an increased cellular response over
the standard indicates that the candidate compound is a TRID antagonist and a
decreased cellular response compared to the standard indicates that the
candidate
compound is TRID agonist. By the invention, a cell expressing the TNFR
polypeptide can be contacted with either an endogenous or exogenously
administered TNF-family ligand, such as TRAIL.
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
_7_
Brief Description of the Figures
Figure 1 A-B shows the nucleotide sequence (SEQ ID NO: l ) and deduced
amino acid sequence (SEQ ID N0:2) of TRID.
Figure 2A-P shows an alignment created by the Clustal method using the
Megaline program in the DNAstar suite comparing the amino acid sequences of
TNFR-5 (now called "TRID," denoted as "TNFR-like" in the figure), with other
TNF receptors, as follows: TNFR1 (SEQ ID N0:3); TNFR2 (SEQ ID N0:4);
NGFR (SEQ ID NO:S) LTbR (SEQ ID N0:6); FAS (SEQ ID N0:7); CD27
(SEQ ID N0:8); CD30 (SEQ ID N0:9); CD40 (SEQ ID NO:10); 4-1 BB (SEQ
ID NO:11 ); OX40 (SEQ ID N0:12); VC22 (SEQ ID N0:13); and CRMB (SEQ
ID N0:14). Residues that match the consensus are shaded.
Figure 3 shows an analyses of the TRID amino acid sequences. Alpha,
beta, turn and coil regions; hydrophilicity and hydrophobicity; amphipathic
regions; flexible regions; antigenic index and surface probability are shown,
as
predicted for the amino acid sequence depicted in SEQ ID N0:2 using the
default
parameters of the recited computer program. The "Antigenic Index -
Jameson-Wolf' graphs, indicate the location of the highly antigenic regions of
the
proteins, i. e. , regions from which epitope-bearing peptides of the invention
may
be obtained.
Figure 4 shows the nucleotide sequence of gene fragments related to the
TRID gene of the present invention, including: HPRCB54R (SEQ ID NO:15),
HSJAU57RA (SEQ ID N0:16), HELBP70R (SEQ ID N0:17), and HUSCB54R
(SEQ ID N0:18) all of which are related to SEQ ID NO:1.
Figure SA is an immunoblot showing that TRID-Fc (as well as DR4 and
DRS) specifically bound TRAIL, but not the related cytotoxic ligand TNFa,. The
bottom panel of Fig. 5A shows the input Fc-fusions present in the binding
assays.
Figure SB is a bar graph showing that TRID-Fc blocked the ability of TRAIL to
induce apoptosis. The data (mean ~ SD) shown in Fig. 5B are the percentage of
apoptotic nuclei among total nuclei counted (n=4). Figure SC is a bar graph
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
_g_
showing that TRID-Fc had no effect on TNFa-induced apoptosis under conditions
where TNFR1-Fc completely abolished TNFoc killing.
Figure 6 is a bar graph showing that MCF7 cells expressing TRID were
protected from TRAIL-induced apoptosis, as were cells expressing the virally
encoded caspase inhibitor CrmA.
Detailed Description of the Preferred Embodiments
The present invention provides isolated nucleic acid molecules comprising,
or alternatively consisting of, a polynucleotide encoding a TRID polypeptide,
having the amino acid sequence shown in SEQ ID N0:2, which was determined
by sequencing a cloned cDNA. The nucleotide sequence shown in SEQ ID NO:1
was obtained by sequencing the HPRCB54 clone, which was deposited on
November 20, 1996 at the American Type Culture Collection, 10801 University
Boulevard, Manassas, Virginia, 20110-2209, and given accession number ATCC
97798. The deposited clone is inserted in the pBluescript SK(-) plasmid
(Stratagene, La Jolla, CA).
The TRID protein of the present invention has an amino acid sequence
which is 21.7% identical to and shares multiple conserved cysteine rich
domains
with the translation product of the human nerve growth factor (hNGF) mRNA
(SEQ ID NO:S) as illustrated in Figure 2A-P. hNGF is thought to play an
important role in the development, survival, apoptosis and function of neurons
(Lee, F.K. et al., Cell 69:737) and lymphocytes (Torcia, M. et al., Cell
85:3369
( 1996)).
Sequence alignment and comparison reveal that TRID's extracellular
cysteine-rich domain to be strikingly similar to the corresponding domains of
both
DR4 and DRS with 69% and 52% amino acid identity, respectively. In addition,
like DR4 and DRS, TRID was also found to be homologous to the cysteine-rich
domain in CAR1, a chicken TNF receptor family member with amino acid
identities ranging from 42-48% (J. Brojatsh et al., Cell 87:1 (1996)). A
potential
protective role for TRID was suggested by the finding that its transcript was
detectable in many normal human tissues but not in most transformed cell
lines.
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-9-
TRID has an extracellular TRAIL binding domain and a transmembrane
domain but, surprisingly, lacks a putative intracellular signalling domain, in
keeping with the possibility that this receptor does not signal following
ligand
binding. Given the absence of an intracellular domain, this receptor was
termed
"TRID" for TRAIL Receptor Without an Intracellular Domain.
Nucleic Acid Molecules
Unless otherwise indicated, all nucleotide sequences determined by
sequencing a DNA molecule herein were determined using an automated DNA
sequencer (such as the Model 373 from Applied Biosystems, Inc., Foster City,
CA), and all amino acid sequences of polypeptides encoded by DNA molecules
determined herein were predicted by translation of a DNA sequence determined
as above. Therefore, as is known in the art for any DNA sequence determined by
this automated approach, any nucleotide sequence determined herein may contain
some errors. Nucleotide sequences determined by automation are typically at
least
about 90% identical, more typically at least about 95% to at least about 99.9%
identical to the actual nucleotide sequence of the sequenced DNA molecule. The
actual sequence can be more precisely determined by other approaches including
manual DNA sequencing methods well known in the art. As is also known in the
art, a single insertion or deletion in a determined nucleotide sequence
compared
to the actual sequence will cause a frame shift in translation of the
nucleotide
sequence such that the predicted amino acid sequence encoded by a determined
nucleotide sequence will be completely different from the amino acid sequence
actually encoded by the sequenced DNA molecule, beginning at the point of such
an insertion or deletion.
By "nucleotide sequence" of a nucleic acid molecule or polynucleotide is
intended, for a DNA molecule or polynucleotide, a sequence of
deoxyribonucleotides, and for an RNA molecule or polynucleotide, the
corresponding sequence of ribonucleotides (A, G, C and U), where each
thymidine
deoxyribonucleotide (T) in the specified deoxyribonucleotide sequence is
replaced
by the ribonucleotide uridine (U).
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-10-
Using the information provided herein, such as the nucleotide sequence set
out in SEQ ID NO:1, a nucleic acid molecule of the present invention encoding
a TRID polypeptide may be obtained using standard cloning and screening
procedures, such as those for cloning cDNAs using mRNA as starting material.
Illustrative of the invention, the TRID nucleic acid molecule described in SEQ
ID
NO:1 was discovered in a cDNA library derived from prostate tissue. Additional
clones ofthe same gene were also identified in cDNA libraries from the
following
tissues: endothelial cells, stimulated monocytes, and kerotinocytes.
The determined nucleotide sequence of the TRID cDNA of SEQ ID NO:1
contains an open reading frame encoding a protein of about 259 amino acid
residues, with an initiation codon at nucleotide positions 183-185 of the
nucleotide
sequences in SEQ ID NO:1.
The open reading frame ofthe TRID gene shares sequence homology with
the translation product of the human mRNA for NGFR, including the following
conserved domains: (a) a soluble extracellular domain of about 214 amino acids
(amino acid residues from about 27 to about 240 in SEQ ID N0:2); (b) a
transmembrane domain of about 19 amino acids (amino acid residues from about
241 to about 259 in SEQ ID N0:2); and (c) a cysteine rich domain of about 97
amino acids (amino acid residues from about 53 to about 150 in SEQ ID N0:2).
As one of ordinary skill would appreciate, due to the possibility of
sequencing
errors discussed above, the actual complete TRID polypeptide encoded by the
deposited cDNAs, which comprise about 259 amino acids, may be somewhat
longer or shorter. More generally, the actual open reading frames may be
anywhere in the range of ~20 amino acids, more likely in the range of ~10
amino
acids, of that predicted from the first methionine codon from the N-terminus
shown in SEQ ID NO:1, which is in-frame with the translated sequences shown
in each respective figure. It will further be appreciated that, depending on
the
analytical criteria used for identifying various functional domains, the exact
"address" of the extracellular, cysteine rich, and transmembrane domains) of
the
TNFR polypeptides may differ slightly from the predicted positions above. For
example, the exact location of the extracellular domain, cysteine-rich domain,
and
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-11-
transmembrane domain in SEQ ID N0:2 may vary slightly (e.g., the address may
"shift" by about 1 to about 20 residues, more likely about 1 to about 5
residues)
depending on the criteria used to define the domain. In this case, the
beginning
of the transmembrane domain and the end of the extracellular domain were
predicted on the basis of the identification of the hydrophobic amino acid
sequence
in the above indicated positions, as shown in Figure 3. In any event, as
discussed
further below, the invention further provides polypeptides having various
residues
deleted from the N-terminus of the complete TRID, including polypeptides
lacking
one or more amino acids from the N-terminus of the extracellular domain
described herein, which constitute soluble forms of the extracellular domain
of the
TRID protein.
Leader and Mature Seguences
The amino acid sequence of the TRID protein includes a leader sequence
and a mature protein, as shown in SEQ ID N0:2. More in particular, the present
invention provides nucleic acid molecules encoding mature forms of the TRID
protein. Thus, according to the signal hypothesis, once export of the growing
protein chain across the rough endoplasmic reticulum has been initiated,
proteins
secreted by mammalian cells have a signal or secretory leader sequence which
is
cleaved from the complete polypeptide to produce a secreted "mature" form of
the
protein. Most mammalian cells and even insect cells cleave secreted proteins
with
the same specificity. However, in some cases, cleavage of a secreted protein
is not
entirely uniform, which results in two or more mature species of the protein.
Further, it has long been known that the cleavage specificity of a secreted
protein
is ultimately determined by the primary structure of the complete protein,
that is,
it is inherent in the amino acid sequence of the polypeptide. Therefore, the
present
invention provides a nucleotide sequence encoding a mature TRID polypeptide
having the amino acid sequence encoded by a cDNA clone identified as ATCC
Deposit No. 97798. By the "mature TRID polypeptide having the amino acid
sequence encoded by a cDNA clone in ATCC Deposit No. 97798" is meant the
mature forms) of the protein produced by expression in a mammalian cell (e.g.
,
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-12-
COS cells, as described below) of the complete open reading frame encoded by
the human DNA sequence of the clone contained in the deposited plasmid.
Methods for predicting whether a protein has a secretory leader as well as
the cleavage point for that leader sequence are available. For instance, the
method
of McGeoch (Virus Res. 3:271-286 ( 1985)) uses the information from a short N-
terminal charged region and a subsequent uncharged region of the complete
(uncleaved) protein. The method of von Heinje (Nucleic Acids Res. 14:4683-
4690 ( 1986)) uses the information from the residues surrounding the cleavage
site,
typically residues -13 to +2 where +1 indicates the amino terminus of the
mature
protein. The accuracy of predicting the cleavage points of known mammalian
secretory proteins for each of these methods is in the range of 75-80% (von
Heinje, supra). However, the two methods do not always produce the same
predicted cleavage points) for a given protein.
In the present case, the deduced amino acid sequence of the complete
TRID polypeptide was analyzed by a computer program "PSORT." See, K. Nakai
and M. Kanehisa, Genomics 14:897-911 (1992). PSORT is an expert system for
predicting the cellular location of a protein based on the amino acid
sequence. As
part of this computational prediction of localization, the methods of McGeoch
and
von Heinje are incorporated. The analysis by the PSORT program predicted the
cleavage sites between amino acids 26 and 27 in SEQ ID N0:2. Thereafter, the
complete amino acid sequences were further analyzed by visual inspection,
applying a simple form ofthe (-1,-3) rule ofvon Heinje. von Heinje, supra.
Thus,
the leader sequence for the TRID protein is predicted to consist of amino acid
residues from about 1 to about 26, underlined in SEQ ID N0:2, while the mature
TRID protein is predicted to consist of residues from about 27 to about 259 in
SEQ ID N0:2.
As one of ordinary skill would appreciate, due to the possibilities of
sequencing errors, as well as the variability of cleavage sites for leaders in
different
known proteins, the mature TRID polypeptide encoded by the deposited cDNA
comprises about 233 amino acids, but may be anywhere in the range of about 223
to about 243 amino acids, and the predicted leader sequence of this protein is
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-13-
about 26 amino acids, but may be anywhere in the range of about 16 to about 36
amino acids.
As indicated, nucleic acid molecules of the present invention may be in the
form of RNA, such as mRNA, or in the form of DNA, including, for instance,
cDNA and genomic DNA obtained by cloning or produced synthetically. The
DNA may be double-stranded or single-stranded. Single-stranded DNA or RNA
may be the coding strand, also known as the sense strand, or it may be the
non-coding strand, also referred to as the anti-sense strand.
By "isolated" nucleic acid molecules) is intended a nucleic acid molecule,
DNA, or RNA, which has been removed from its native environment. For
example, recombinant DNA molecules contained in a vector are considered
isolated for the purposes of the present invention. Further examples of
isolated
DNA molecules include recombinant DNA molecules maintained in heterologous
host cells or purified (partially or substantially) DNA molecules in solution.
Isolated RNA molecules include in vivo or in vitro RNA transcripts of the DNA
molecules of the present invention. Isolated nucleic acid molecules according
to
the present invention further include such molecules produced synthetically.
However, a nucleic acid molecule contained in a clone that is a member of
a mixed clone library (e.g., a genomic or cDNA library) and that has not been
isolated from other clones of the library (e.g., in the form of a homogeneous
solution containing the clone without other members of the library) or a
chromosome isolated or removed from a cell or a cell lysate (e.g., a
"chromosome
spread", as in a karyotype), is not "isolated" for the purposes of this
invention.
Isolated nucleic acid molecules of the present invention include DNA
molecules comprising, or alternatively consisting of, an open reading frame
(ORF)
shown in SEQ ID NO: l ; DNA molecules comprising, or alternatively consisting
of, the coding sequence for the mature TRID protein; and DNA molecules which
comprise, or alternatively consist of, a sequence substantially different from
those
described above, but which, due to the degeneracy of the genetic code, still
encode the TRID protein. Of course, the genetic code is well known in the art.
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-14-
Thus, it would be routine for one skilled in the art to generate such
degenerate
variants.
In addition, the invention provides nucleic acid molecules having
nucleotide sequences related to extensive portions of SEQ ID NO:1, which have
been determined from the following related cDNA clones: HELBP70R (SEQ ID
N0:17), HPRCB54R (SEQ ID N0:15), HSJAU57RA (SEQ ID N0:16) and
HUSCB54R (SEQ ID NO: I 8). The nucleotide sequences of each of these gene
fragments is shown in Figure 4.
In another aspect, the invention provides isolated nucleic acid molecules
encoding the TRID polypeptide having an amino acid sequence as encoded by the
cDNA clone contained in the plasmid deposited as ATCC Deposit No. 97798. In
a further embodiment, nucleic acid molecules are provided that encode the
mature
TRID polypeptide or the full length TRID polypeptide each lacking the N-
terminal
methionine.
The invention further provides an isolated nucleic acid molecule having the
nucleotide sequence shown in SEQ ID NO:I or the nucleotide sequence of the
TRID cDNA contained in the above-described deposited clone, or a nucleic acid
molecule having a sequence complementary to one of the above sequences. Such
isolated molecules, particularly DNA molecules, are useful as probes for gene
mapping, by in situ hybridization with chromosomes, and for detecting
expression
of the TRID gene in human tissue, for instance, by Northern blot analysis.
The present invention is further directed to fragments of the isolated
nucleic acid molecules described herein. By a fragment of an isolated nucleic
acid
molecule having the nucleotide sequence of the deposited cDNA (the cDNA
contained in the plasmid deposited as ATCC Deposit No. 97798) or the
nucleotide
sequence shown in SEQ ID NO:1 are intended DNA fragments at least 20 nt, and
more preferably at least 30 nt in length, and even more preferably, at least
about
40, 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750,
800, 850, 900, 950, 1000, 1050, 1100, 1150, 1200, 1250, 1300, 1350, 1400,
1450, or 1500 nt in length, which are useful as DNA probes as discussed
herein.
Of course, DNA fragments corresponding to most, if not all, of the nucleotide
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-15-
sequence shown in SEQ ID NO:1 are also useful as DNA probes. By a fragment
at least 20 nt in length, for example, is intended fragments which include 20
or
more contiguous bases from the nucleotide sequence of a deposited cDNA or the
nucleotide sequence as shown in SEQ ID NO:1. In this context "about includes
the particularly recited size, larger or smaller by several (5, 4, 3, 2, or 1
)
nucleotides, at either terminus or at both termini.
Representative examples of TRID polynucleotide fragments of the
invention include, for example, fragments that comprise, or alternatively,
consist
of, a sequence from about nucleotide 1 to 50, 51 to 100, 101, to 150, 151 to
182,
183 to 260, 261 to 300, 301 to 350, 351 to 400, 401 to 450, 451 to 500, 501 to
550, 551 to 600, 600 to 650, 651 to 700, 701 to 750, 751 to 800, 800 to 850,
851
to 902, 903 to 959, 960 to 1000, 1001 to 1050, 1051 to 1100, 1101 to 1150,
1151 to 1200, 1201 to 1250, 1251 to 1300, 1301 to 1350, and/or 1351 to 1392,
of SEQ ID NO:1, or the complementary strand thereto, or the cDNA contained
in the deposited clone. In this context "about" includes the particularly
recited
ranges, larger or smaller by several (5, 4, 3, 2, or 1 ) nucleotides, at
either terminus
or at both termini.
Preferably, the polynucleotide fragments of the invention encode a
polypeptide which demonstrates a TRID functional activity. By a polypeptide
demonstrating a TRID "functional activity" is meant, a polypeptide capable of
displaying one or more known functional activities associated with a full-
length
(complete) TRID protein. Such functional activities include, but are not
limited
to, biological activity (e.g., binding TRAIL), antigenicity [ability to bind
(or
compete with a TRID polypeptide for binding) to an anti-TRID antibody],
immunogenicity (ability to generate antibody which binds to a TRID
polypeptide),
ability to form multimers with TRID polypeptides of the invention, and ability
to
bind to a receptor or ligand for a TRID polypeptide (e.g., TRAIL).
The functional activity of TRID polypeptides, and fragments, variants
derivatives,
and analogs thereof, can be assayed by various methods.
For example, in one embodiment where one is assaying for the ability to
bind or compete with full-length TRID polypeptide for binding to anti-TRID
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 16-
antibody, various immunoassays known in the art can be used, including but not
limited to, competitive and non-competitive assay systems using techniques
such
as radioimmunoassays, ELISA (enzyme linked immunosorbent assay), "sandwich"
immunoassays, immunoradiometric assays, gel diffusion precipitation reactions,
immunodiffusion assays, in situ immunoassays (using colloidal gold, enzyme or
radioisotope labels, for example), western blots, precipitation reactions,
agglutination assays (e.g., gel agglutination assays, hemagglutination
assays),
complement fixation assays, immunofluorescence assays, protein A assays, and
immunoelectrophoresis assays, etc. In one embodiment, .antibody binding is
detected by detecting a label on the primary antibody. In another embodiment,
the
primary antibody is detected by detecting binding of a secondary antibody or
reagent to the primary antibody. In a further embodiment, the secondary
antibody
is labeled. Many means are known in the art for detecting binding in an
immunoassay and are within the scope of the present invention.
In another embodiment, where a TRID ligand is identified (e.g, TRAIL),
or the ability of a polypeptide fragment, variant or derivative of the
invention to
multimerize is being evaluated, binding can be assayed, e.g., by means well-
known
in the art, such as, for example, reducing and non-reducing gel
chromatography,
protein affinity chromatography, and affinity blotting. See generally,
Phizicky, E.,
et al., Microbiol. Rev. 59:94-123 (1995). In another embodiment, physiological
correlates of TRID binding to its substrates (signal transduction) can be
assayed.
In addition, assays described herein (see e.g. , Examples 5 and 6, and those
otherwise known in the art may routinely be applied to measure the ability of
TRID polypeptides and fragments, variants derivatives and analogs thereof to
elicit TRID related biological activity (e.g. , to block TRAIL induced
apoptosis in
vitro or in vivo).
Other methods will be known to the skilled artisan and are within the
scope of the invention.
Preferred nucleic acid fragments of the present invention include nucleic
acid molecules encoding: epitope-bearing portions of the TRID polypeptide as
identified in Figure 3 and described in more detail below.
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 17-
In particular, the invention provides polynucleotides having a nucleotide
sequence representing the portion of SEQ ID NO:1, which consist of positions
183-959 of SEQ ID NO:l. Also contemplated are polynucleotides encoding
TRID polypeptides which lack an amino terminal methionine. One such preferred
polynucleotide of the invention encodes a full-length TRID polypeptide lacking
the nucleotides encoding the amino-terminal methionine (e.g., nucleotides 186-
959
in SEQ ID NO:1 ) as it is known that the methionine is cleaved naturally and
such
sequences maybe useful in genetically engineering TRID expression vectors.
Polypeptides encoded by such polynucleotides are also, provided, such as
polypeptides comprising, or alternatively consisting of, an amino acid
sequence at
positions 2-259 of SEQ ID N0:2, or the polypeptide sequence encoded by the
clone deposited with the ATCC as Deposit No. 97798 lacking an amino terminal
methionine.
Preferred nucleic acid fragments of the present invention include nucleic
acid molecules encoding a member selected from the group: a polypeptide
comprising, or alternatively consisting of, the TRID extracellular domain
(amino
acid residues from about 27 to about 240 in SEQ ID N0:2); a polypeptide
comprising or alternatively consisting of, the TRID cysteine rich domain
(amino
acid residues from about 53 to about 1 SO in SEQ ID N0:2); a polypeptide
comprising, or alternatively consisting of, the TRID transmembrane domain
(amino acid residues from about 241 to about 259 in SEQ ID N0:2); and a
polypeptide comprising, or alternatively consisting of, one, two, three, four
or
more, epitope bearing portions of the TRID receptor protein. In additional
embodiments, the polynucleotide fragments ofthe invention encode apolypeptide
comprising, or alternatively consisting of, any combination of 1, 2, 3, 4, or
all 5
of the above-encoded polypeptide embodiments. Since the location of these
domains have been predicted by computer graphics, one of ordinary skill would
appreciate that the amino acid residues constituting these domains may vary
slightly (e.g., by about 1 to 15 residues) depending on the criteria used to
define
each domain.
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-18-
It is believed one or both of the extracellular cysteine rich motifs of TRID
disclosed in Figures 1 A-B is important for interactions between TRID and its
ligands (e.g., TRAIL). Accordingly, specific embodiments of the invention are
directed to polynucleotides encoding polypeptides which comprise, or
alternatively
consist of, the amino acid sequence of amino acid residues 53 to 110, and/or
111
to 150 of SEQ ID N0:2, as disclosed in Figures lA-B. In a specific embodiment
the polynucleotides encoding TRID polypeptides of the invention comprise, or
alternatively consist of both of the extracellular cysteine rich motifs
disclosed in
Figures lA-B. Polypeptides encoded by these polynucleotides are also
. encompassed by the invention.
In additional embodiments, the polynucleotides of the invention encode
functional attributes of TRID. Preferred embodiments of the invention in this
regard include fragments that comprise alpha-helix and alpha-helix forming
regions
("alpha-regions"), beta-sheet and beta-sheet forming regions ("beta-regions"),
turn
and turn-forming regions ("turn-regions"), coil and coil-forming regions
("coil-regions"), hydrophilic regions, hydrophobic regions, alpha amphipathic
regions, beta amphipathic regions, flexible regions, surface-forming regions
and
high antigenic index regions of TRID.
The data representing the structural or functional attributes of TRID set
forth in Figure 3 and/or Table I, as described above, was generated using the
various modules and algorithms of the DNA* STAR set on default parameters. In
a preferred embodiment, the data presented in columns VIII, IX, XIII, and XIV
of Table I can be used to determine regions of TRID which exhibit a high
degree
of potential for antigenicity. Regions of high antigenicity are determined
from the
data presented in columns VIII, IX, XIII, and/or XIV by choosing values which
represent regions of the polypeptide which are likely to be exposed on the
surface
of the polypeptide in an environment in which antigen recognition may occur in
the process of initiation of an immune response.
Certain preferred regions in these regards are set out in Figure 3, but may,
as shown in Table I, be represented or identified by using tabular
representations
of the data presented in Figure 3. The DNA*STAR computer algorithm used to
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 19-
generate Figure 3 (set on the original default parameters) was used to present
the
data in Figure 3 in a tabular format (See Table I). The tabular format of the
data
in Figure 3 may be used to easily determine specific boundaries of a preferred
region.
The above-mentioned preferred regions set out in FIG. 3 and in Table I
include, but are not limited to, regions of the aforementioned types
identified by
analysis of the amino acid sequence set out in SEQ ID N0:2. As set out in FIG.
3 and in Table I, such preferred regions include Gamier-Robson alpha-regions,
beta-regions, turn-regions, and coil-regions (columns I, III, V, and VII in
Table
I), Chou-Fasman alpha-regions, beta-regions, and turn-regions (columns II, IV,
and VI in Table I), Kyte-Doolittle hydrophilic regions (column VIII in Table
I),
Hopp-Woods hydrophobic regions (column IX in Table I), Eisenberg alpha- and
beta-amphipathic regions (columns X and XI in Table I), Karplus-Schulz
flexible
regions (column XII in Table I), Jameson-Wolf regions of high antigenic index
(column XIII in Table I), and Emini surface-forming regions (column XIV in
Table I). Among highly preferred polynucleotides in this regard are those that
encode polypeptides comprising, or alternatively consisting of, regions of
TRID
that combine several structural features, such as several (e.g., 1, 2, 3, or
4) of the
same or different region features set out above.
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-20-
Table I
Res I II IIIN V VI VII VIII IX X XI XII XIIIXN
Position
$
Met 1 A . -0.23 0.09* * -0.100.57
Ala 2 A . . . . . 0.20 0.09* * -0.100.62
Ar<~ 3 A . . . . 0.28 -0.34* * 0.500.97
Ile 4 A . . . . -0.14 -0.29* * 0.657.42
Pro 5 A . . 0.29 -0.21* * F 0.801.16
Lys 6 A . . . . 0.19 -0.71* * F 1.101.18
Thr 7 A . B . . . -0.08 0.07* * F 0.00l.4fi
Leu 8 A . . B . . . -1.04 0.03* * F -0.150.70
Lvs 9 A . B . . -1.01 0.24* * -0.300.26
1 S Phe 10 A . . B . . -1.69 0.89* * -0.600.13
Val 11 . B B . . -2.59 1.09* * -0.600.11
Val 12 . . B B . . . -2.87 1.04* * . -0.600.04
Val 13 . . B B . . -2.91 1.54* * . -0.600.05
Ile 14 . . B B . . -3.77 1.40* * -0.600.05
Val 15 A . . B . . -3.88 1.44 -0.fi00.05
Ala 16 A . B . . . -3.23 1.49 -O.f>00.06
Val 17 A . . B . . -3.23 1.27. . -0.600.13
Leu 18 A B . -3.19 1.23 -0.600.13
Leu 19 . . B B . . . -2.89 1.27* -0.600.11
2$ Pro 20 A . . B . . . -2.28 1.27 . -0.600.15
Val 21 A . B . -1.99 1.39. -0.600.28
Leu 22 A . B . -1.72 1.C19 -0.6(10.46
Ala 23 A . B . -1.22 0.90* . -0.600.30
Tyr 24 A . . B . -0.72 0.96. . -O.fiO0.58
Ser 25 A . B . . . -1.10 0.80* * -0.451.02
Alu 26 A . B . . . -0.13 0.61* . -0.451.02
Tlu- 27 A . B . . . 0.68 0.11 * F 0.001.28
Tlu- 28 A A . B . . 1.27 -0.24 * F -0.601.65
Alu 29 A A . B . 1.57 -0.63 . F 0.902.83
3$ Ark 30 A A . B 0.96 -1.13 . F 0.903.40
Gv~ 31 A A B . . . 1.33 -0.97 F 0.901.75
Glu 32 A A . B . 1.64 -1.03 * F 0.902.68
Glu 33 A A . . . 1.96 -1.13 * F 0.902.37
Val 34 . A . . . . C 2.23 -0.73* F 1.102.37
Pro 35 . A T . 1.27 -0.64* . F 1.301.97
Glit 36 . . . B T 0.68 -0.00 F 0.850.85
SUBSTITUTE SHEET (RULE26)
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-21 -
Table I (continued)
Res Position I II III N V VI VII VIII IX X XI XII XIII XN
Ghi 37 . . B . . C 0.470.50 . F -0.107.15
Tlu 38 B . . C 0.470.29 . F 0.20 1.15
Val 39 . B . . C 1.320.26 . P 0.20 1.15
Ala 40 . B . . C 1.530.26* * F 0.20 1.15
Pro 41 A . . B . . . 1.640.26* F 0.00 1.38
Ghl 42 A . . . . . 1.61-0.23* F 1.14 3.64
Ghi 43 A . . . . . 1.62-0.37* * F 1.48 4.91
Gln 44 A . . . . T . 1.78-0.49* * F 2.02 4.25
Ar~~ 45 . . . T T . 2.41-0.13* * F 2.76 2.13
His 46 . . . . T T . 2.28-0.53* * F 3.40 2.46
Ser 47 . . . . . T C 2.28-0.50* * 2.71 1.40
Phe 48 . A . . T . . 2.28-0.90* * F 2.32 1.24
Lvs 49 . A . . T . . 1.61-0.90* * F 1.98 1.58
Gly 50 . A . . T . . 1.29-0.83* * F 1.49 0.63
1 S Glu 51 . A . . T . 0.73-0.79. * P I 1.13
.30
Glu 52 A A . . . . . 0.69-1.07. * P 0.75 0.57
Cys 53 A . . . . T . 1.09-0.64 * F 1.15 0.57
Pro 54 A . . T 1.01-0.fi9* * F 1.15 (1.44
Ala 55 A . . . T 1.47-0.19* * F 0.85 0.35
Glv 56 A . . . T 7.17-0.19 * F 1.00 1.27
Ser 57 A . . . . . . 1.17-0.37. * F 0.80 1.10
His 58 A . . . 1.80-0.80 * F 1.44 1.88
Arg 59 A . . . . . . 1.70-0.80. * F 1.78 2.59
Ser 60 . . . . T . 1.94-0.74. * F 2.52 2.78
2S Glu 61 . . . . T . . 1.70-0.70. * F 2.86 2.03
His 62 . . . . T T . 1.33-0.70* * F 3.40 1.04
Tlrr 63 . . . T T . 1.37-0.13* * F 2.61 0.42
Glv 64 . . . T T . 1.04-0.11* * 2.12 0.39
Ala 65 . . . . T T . 0.680.31 . . 1.18 0.44
Cvs 66 . . . . T . . 0.370.39. . 0.64 0.16
Asn 67 . . . T C 0.400.39. . . 0.30 0.24
Pro 68 . . . . T T . 0.37-0.04* . F 1.53 0.47
Cys 69 . T T . -0.14-0.11* . F 1.81 0.76
Thr 70 . . . . T T . 0.44-0.04* F 2.09 0.35
3S Glu 71 B . . . 0.87-0.44* . F 1.77 0.38
Glv 72 . . . . T T . 0.56-0.11* . F 2.80 1.10
SUBSTITUTE SHEET (RULE26)
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 22 -
Table I (continued)
Res Position I II III N V VI VII VIII IX X XI XII XIII XN
Val 73 B . . T . 0.77-0.20. F 2.12 1.1
()
Asp 74 . B . . T . 0.84-0.29. . 1.69 1.02
Tyr 75 . . . . T C 0.860.21. . 1.01 1.04
.
Tlw 76 . . . . C 0.860.17 F 0.68 1.88
Asn 77 . . . . C 1.20-0.07 . F 1.34 1.81
Alu 78 . . . . T C 2.060.33 . F 1.28 1.86
.
Ser 79 . . . T T . 1.84-0.43. . F 2.42 2.24
Asn 80 . . . T T . 1.79-0.49 . F 2.76 2.15
.
Asn 81 . . . T T . 1.43-0.50* . F 3.40 2.85
Glu 82 . . . . T C 0.73-0.43* . F 2.56 1.14
Pro 83 . . T T . I.11-0.03. F 2.27 O.fil
.
Ser 84 . . . T T . 0.74-0.00 . F 1.93 0.59
.
Cys 85 . . . T T . 0.430.17* * . 0.84 0.18
Phe 86 . B . . T . -0.420.66* . . -0.200.17
.
Pro 87 . . . T T . -1.090.87* . . 0.20 0.09
.
Cys 88 . . . T T . -0.831.06* . . 0.20 0.09
.
Thr 89 A . . . T . -0.830.49* . . -0.200.22
.
Val 90 A . . . . . -0.170.09* . . -0.100.19
Cys 91 A . . . T . 0.53-0.34* * . 0.70 0.59
.
Lys 92 A . . . T . 0.79-0.51* . F 1.15 0.71
.
Ser 93 A . . . T . 1.42-1.00. * F 1.64 1.90
.
Asp 94 A . . T . 1.78-1.14* * F 1.98 4.84
Glii 95 A . . . . 2.33-1.71* * F 2.12 4.84
Lys 96 . . . T . 2.70-1.33, * F 2.86 4.84
His 97 . . . T T 1.99-1.33. * F 3.40 3.88
.
Lys 98 . . . T T 1.98-0.76. * F 3.06 1.20
.
Ser 99 . . T T . 1.38-0.67. * F 2.57 0.87
Ser 100 . . . T T . 1.07-0.06* * F 1.93 0.63
.
Cys lOl . . B T . 1.13-0.07* * F 1.19 0.45
Thr 102 . . B T . 1.17-0.07* . . 0.70 0.66
.
Met 103 . . B T . 0.81-0.46* * . 0.70 0.83
.
Thr 104 . . T T -0.11-0.29* . F 1.40 1.15
.
Asp 106 . . . T T . 0.56-0.20* . F 1.25 0.62
.
Thr 107 A . . . T . 0.20-0.41* * . 0.70 0.75
.
3S Val 108 A . B . . 0.84-0.33* . . 0.64 0.20
.
Cys 109 A . B . . 1.16-0.33* . . 0.98 0.24
.
SUBSTITUTE SHEET (RULE26)
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 23 -
Table I (continued)
Res Position I II III N V VI VII VIII IX X XI XII XIII XN
Gln 110 . B T . . 0.70-0.33* . 1.720.29
.
Cys I11 . . . T T 0.39-0.39 . . 2.460.39
.
Lys 112 . . . T T . -0.00-0.54* * F 3.401.05
.
Glu 113 . . . T T . 0.97-0.33* * F 2.610.53
.
Gly 1l4 . . . T T . 1.63-0.73. * F 3.061.92
.
Thr 115 . . . T . . 1.63-090* * P 2.861.55
Phe 116 . . . . . C 2.30-0.90 * F 2.fifi1.55
.
ArD 117 . . T . . 1.96-0.50. * F 2.862.51
.
Asu 118 . . . T T 1.74-0.54* * F 3.402.33
l0 Glu 119 . . . T T . 2.09-0.60 * F 3.064.17
,
Asn 120 . . T C 1.80-1.39. * F 2.523.68
.
Ser 121 . . . T C 1.83-0.77. * F 2.182.27
.
Pro 122 . . T . 1.83-0.60* * F 1.690.70
.
Glu 123 A . . . . . 1.88-0.60* . F 1.260.85
.
I S Met 124 A . . . . . 1.21-1.00* . . 1.571.28
.
Cys 125 A . . . T . 0.91-0.81* * 1.930.44
.
Arg 126 . . T T 1.32-0.86* * 2.640.34
Lys 127 . . . T T . 0.87-0.86* * F 3.10O.fiB
.
Cys 128 . . . T T . 0.66-0.90* * F 2.790.68
.
2~ Ser 129 . . . T . . 0.96-1.04* * F 2.590.53
Arg 130 . . . T . 1.28-0.66* * F 2.590.36
.
Cys l31 . . . . T C 1.17-0.23* * F 2.290.66
.
Pro 132 . . T T . 0.27-0.80* * F 2.790.85
.
Ser 133 . . . T T . 0.93-0.54* * F 3.100.32
.
25 Gly 134 . . . T T . 0.38-0.14* * F 2.641.05
.
Glu 135 . . B T . . -0.03-0.07* * F 1.780.50
Val 136 . B B . . 0.63-0.11 * F 1.070.50
.
Glii 137 . B B . 0.18-0.10 * . E3.610.82
.
Val 138 . B . . T . 0.170.04. * 0.100.25
.
3~ Ser 139 . . T T . 0.210.53 * 0.200.49
Asn 140 . . . T T . -0.080.27. * F 0.650.38
.
Cys 141 . . . T T . 0.780.79. * F 0.630.54
.
Thr 142 . . . T . . 0.780.14. * F 1.010.67
.
Ser 143 . . . T . . 0.74-0.24. * F 1.890.70
3 $ Trp 144 . . . T T . 1.040.04. * F 1.770.91
.
Asp 145 T T 0.38-0.13* . F 2.801.09
Asp 146 . . . T T . 0.19-0.04* F 2.370.44
.
SUBSTITUTE SHEET (RULE26)
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-24- _
Table I (continued)
Res Position 1 Il III N V VI VII VIII IX X XI XIl
Ile l47 A . . . T 0.500.21
Glii 148 A A . . . . 0.80-0.70
Cys 149 A B . 0.39-0.70
Val 150 A A . . 0.040.09
$ Glu 151 A A . . -0.54-0.17
Glu 152 A A . . 0.34-0.07
Phe 153 A A . -0.24-0.24
Gly 154 A . . . . T 0.11-0.39
Ala 155 A . . T 0.110.10
Asn 156 A . . . . T 0.110.74
Ala 157 A . . . T -0.20-0.04
Thr 158 A A . . 0.290.01
Val 759 A A . . . 0.04-0.06 * F
Glu 160 A A . . . 0.040.04 * F
I $ Tlrr 161 A A . 0.040.04 * F
Pro 162 A A . . 0.63-0.44 * F
Ala 163 A A . . 0.63-1.09 F
Ala 1f>4A A . . . 0.89-0.60 * F
Glu 165 A A . . . . 0.89-0.47 . F
Glu 166 A A . . . . 0.89-0.50* F
Thr 167 A A . . . 0.80-0.51* F
Met 168 A T 1.18-0.63 F
Asn 169 . A . . T . . 1.42-0.20. * F
Thr 170 . A . . . . C 1.110.2 F
3
2$ Ser 171 . . T C 0.900.23 . F
Pro 172 . . T T . 0.620.04. F
Gly 173 . T C 1.010.14. F
Thr 174 . . . T C 0.420.09 F -
Pro 175 . . . C 0.140.20 F
Alu 176 . A . C 0.440.27 . F
Pro 177 A A . . 0.66-0.16
Ala 178 A A . . . 0.69-0.64
Ala 179 A A . . 0.40-0.59
Glu 180 A A . . . 0.61-0.47* F
3 $ Glu 181 A A . . . . 0.89-0.50* F
Thr 182 A A . . . . 0.80-0.51* F
Met 183 . A T 1.18-0.63. F
SUBSTITUTE SHEET (RULE26)
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 25 -
Table I (continued)
Res Position I II III N V VI VII VIII IX X X1 XII XIII XN
ASn 184 . A . . T . . 1.42-0.20 * F 1.001.57
.
Tlw 185 . A . C 1.110.23 F 0.201.08
Ser 186 . 1' C 0.900.23 F 0.601.57
Pro 187 . . T T . 0.620.04 F 0.801.51
Glv 188 T C 1.010.14 F 0.601.06
Tlu 189 . T C 0.420.09 P 0.601.22
I'ro 190 C 0.740.20 F 0.250.8()
Ala 191 A . . . C 0.440.27 F 0.050.82
.
1'ro 192 A A . . . 0.66-0.16 0.300.98
Ala 193 A A . . 0.69-0.64 0.751.10
Ale l94 A A . 0.40-0.59 0.751.57
Gln 195 A A . . . 0.30-0.47 F 0.601.00
Glu 196 A A . . . . 0.58-0.41 F 0.601.43
Tllr 197 A A . . . . . 0.49-0.43 F O.fiO2.05
Met 198 A A . . . 0.87-0.54 F 1.061.58
Tlw l99 A . . T . 1.11-0.11 F 1.321.41
Tlw 200 A . . C 0.800.31 P 0.530.97
Ser 201 . . T C 0.590.31 F 1.241.41
Pro 202 . T T . 0.310.13 F 1.601.51
Gly 203 T C 0.7(10.14 F 1.241.06
Tlu 204 . T C 0.420.09 F 1.081.22
.
Pro 205 . . . C 0.140.20 F 0.570.80
Ala 206 A . . . C 0.440.27 F 0.210.82
Pro 207 A A . . . . 0.66-0.16 . 0.300.98
.
2$ Ala 208 A A . . O.fi9-O.fi4 0.751.10
Ala 209 A A . . . 0.40-0.59 . 0.751.57
Glu 210 A A . . 0.30-0.47 F 0.601.00
Glu 21l A A . . . 0.58-0.41 F O.f~1.43
Tlu' 212 A A . . . 0.49-0.43 F 0.602.05
Met 213 A A . 0.87-0.54 F 1.061.58
Tlw 214 . A . T 1.11-0.11 F 1.321.41
Tlu' 215 . A . C 0.800.31 F 0.530.97
Ser 216 . . . . T C 0.590.31 F 1.241.41
Pro 217 . . T T 0.310.13 . F 1.601.51
3 5 Gly 218 . . . T C 0.700.14 F 1.241.06
.
TIIr 219 . T C 0.420.09 F 1.081.22
Pro 220 . . C 0.140.20 F 0.570.80
SUBSTITUTE SHEET (RULE26)
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-26-
Table
1 (continued)
Res Position I II III IV V VI VIIVIIIIX X XI XIlIXIV
XII
Ala 221 A . . . C 0.440.27 . F 0.210.82
.
Pro 222 A A . . . . 0.66-0.16 0.300.98
Ales 223 A A . . . 0.69-0.64 0.751.10
Ala 224 A A . . . . . 0.40-0.59 0.751.57
Ulu 225 A A . . . 0.30-0.47 F 0.601.00
Ulu 226 A A . . . 0.58-0.47 P 0.601.43
Thr 227 A A . . 0.49-0.43 F 0.722.05
Met 228 A A . . 0.87-0.54 F 1.141.58
Thr 229 A . . T . I.11-0.71 F 1.361.41
Tlu 230 . A . . . C 0.800.31 . F 0.530.97
Ser 231 . . T C 0.590.31 . F 1.201.41
Pro 232 . . . T C 0.310.13 F 1.081.51
Glv 233 . . . T C 0.610.14 F 0.961.06
.
Tlvr 234 . . . T C 0.620.04 . F 0.841.06
.
1 Pro 235 . . . . C 0.900.04 . F 0.370.92
S
Ala 236 . . . . T . 0.960.11 . F 0.601.26
Ser 237 T T 0.360.44 F 0.501.37
Ser 238 . T T 0.400.64 0.2(70.73
His 239 . T T . 0.040.60 . 0.200.97
Tyr 240 . . . T T . -0.060.67 * . 0.200.39
Leu 241 . B T . -0.360.77 . -0.200.42
Ser 242 . B T -0.911.07 -0.200.22
Cys 243 B B -0.961.21 . . -0.600.70
*
Thr 244 B B . -1.810.89 . -0.600.12
*
2,5 Ile 245 B B -2.460.89 -0.600.06
.
Val 246 . . B B . . . -2.501.19 * . -0.600.08
Gly 247 . . B B . . . -3.011.26 . -0.600.04
.
Ile 248 . . B B . . -3.231.46 -0.600.05
*
Ile 249 . B B . . -3.781.46 . -0.600.05
.
Val 250 . B B . . . -3.701.46 . -0.600.04
Leu 251 . B B . . . -3.661.71 -0.600.04
.
Ile 252 . B B . . . -4.201.71 -0.600.05
.
Val 253 . . B B . -4.171.71 -0.600.05
.
Lett 254 . . B B . . . -3.981.71 . . -0.600.04
.
Leu 255 A . . B . . . -3.981.81 -0.600.05
Ile 256 A . B . . -3.561.77 . -0.600.05
Val 257 . B 13 . -3.061.56 -0.600.08
SUBSTITUTE SHEET (RULE26)
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 27 -
Table I (continued)
Res Position I II III N V VI VII VIII IX X XI XII XIII XIV
Phe 258 A . B . . . -2.59 1.30 -().60 0.13
Val 259 A B . . -2.17 1.04 -0.60 0.23
Among highly preferred fragments in this regard are those that comprise,
or alternatively consist of, regions of the TRID protein that combine several
structural features, such as several ofthe features set out above. Preferred
nucleic
acid fragments of the present invention further include nucleic acid molecules
encoding a polypeptide comprising, or alternatively consisting of, one, two,
three,
four, five, or more epitope-bearing portions of the TRID protein. In
particular,
such nucleic In this context "about" includes the particularly recited size,
larger
or smaller by several (5, 4, 3, 2 or 1) nucleotides, at either terminus or at
both
termini. acid fragments of the present invention include nucleic acid
molecules
encoding: a polypeptide comprising, or alternatively consisting of, amino acid
residues from about Gln-42 to about Glu-52 in SEQ ID N0:2; a polypeptide
comprising, or alternatively consisting of, amino acid residues from about His-
58
to about Cys-66 in SEQ ID N0:2; a polypeptide comprising, or alternatively
consisting of, amino acid residues from about Pro-68 to about Thr-76 in SEQ ID
N0:2; a polypeptide comprising, or alternatively consisting of, amino acid
residues from about Ser-79 to about Cys-85 in SEQ ID N0:2; a polypeptide
comprising, or alternatively consisting of, amino acid residues from about Cys-
91
to about Thr-102 in SEQ >D N0:2; a polypeptide comprising, or alternatively
consisting of, amino acid residues from about Gln-I 10 to about Pro-122 in SEQ
ID N0:2; a polypeptide comprising, or alternatively consisting of, amino acid
residues from about Arg-126 to about Val-136 in SEQ ID N0:2; and a
polypeptide comprising, or alternatively consisting of, amino acid residues
from
about Thr-I 42 to about Gln-148 in SEQ ID N0:2. The inventors have determined
that the above polypeptide fragments are antigenic regions of the TRID
protein.
Methods for determining other such epitope-bearing portions of the TRID
protein
are described in detail below.
SUBSTITUTE SHEET (RULE26)
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 28 -
In specific embodiments, the polynucleotides of the invention are less than
100000 kb, 50000 kb, 10000 kb, 1000 kb, 500 Icb, 400 kb, 350 kb, 300 kb, 250
kb, 200 kb, 175 kb, 150 kb, 125 kb, 100 kb, 75 kb, 50 kb, 40 kb, 30 kb, 25 kb,
20
kb, 15 kb, 10 kb, 7.5 kb, or 5 kb in length.
In further embodiments, polynucleotides of the invention comprise, or
alternatively consist of, at least 15, at least 30, at least 50, at least 100,
or at least
250, at least 500, or at least 1000 contiguous nucleotides of TRID coding
sequence, but consist of less than or equal to 1000 kb, 500 kb, 250 kb, 200
kb,
150 kb, 100 kb, 75 kb, 50 kb, 30 kb, 25 kb, 20 kb, 15 kb, 1.0 kb, or 5 kb of
genomic DNA that flanks the 5' or 3' coding nucleotide set forth in Figures 1
A-D
(SEQ ID NO:1 ). In further embodiments, polynucleotides of the invention
comprise, or alternatively consist of, at least 15, at least 30, at least 50,
at least
100, or at least 250, at least 500, or at least 1000 contiguous nucleotides of
TRID
coding sequence, but do not comprise all or a portion of any TRID intron. In
another embodiment, the nucleic acid comprising, or alternatively consisting
of
TRID coding sequence does not contain coding sequences of a genomic flanking
gene (i.e., 5' or 3' to the TRID gene in the genome). In other embodiments,
the
polynucleotides of the invention do not contain the coding sequence of more
than
1000, 500, 250, 100, 50, 25, 20, 15, 10, 5, 4, 3, 2, or 1 genomic flanking
gene(s).
Further, the invention includes a polynucleotide comprising, or
alternatively consisting of, any portion of at least about 30 nucleotides,
preferably
at least about 50 nucleotides, of SEQ ID NO: l from residue 183 to 959. In
this
context "about" includes the particularly recited size, larger or smaller by
several
(5, 4, 3, 2, or 1 ) nucleotides, at either terminus or at both termini.
In another aspect, the invention provides an isolated nucleic acid molecule
comprising, or alternatively consisting of, a polynucleotide which hybridizes
under
stringent hybridization conditions to a portion of the polynucleotide in a
nucleic
acid molecule of the invention described above, for instance, a cDNA clone
contained in ATCC Deposit No. 97798. By "stringent hybridization conditions"
is intended overnight incubation at 42° C in a solution comprising, or
alternatively
consisting of,: 50% formamide, 5x SSC (750 mM NaCI, 75 mM trisodium citrate),
CA 02374674 2001-11-20
WO 00/71150 PCT/iJS00/13515
-29-
50 mM sodium phosphate (pH 7.6), Sx Denhardt's solution, 10% dextran sulfate,
and 20 ~g/ml denatured, sheared salmon sperm DNA, followed by washing the
filters in O.lx SSC at about 65° C. Polypeptides encoded by these
nucleic acid
molecules are also encompassed by the invention.
In another aspect, the invention provides an isolated nucleic acid molecule
comprising, or alternatively consisting of, a polynucleotide which hybridizes
under
lower stringency conditions to a portion of the polynucleotide in a nucleic
acid
molecule of the invention described above, for instance, a cDNA clone
contained
in ATCC Deposit No. 97798. By "lower stringency conditions" is intended
overnight incubation at 35° C or 42° C in a solution comprising,
or alternatively
consisting of: 50% formamide, Sx SSC (750 mM NaCI, 75 mM trisodium citrate),
50 mM sodium phosphate (pH 7.6), Sx Denhardt's solution, 10% dextran sulfate,
and 20 qg/ml denatured, sheared salmon sperm DNA, followed by washing the
filters in 3x, 2x, lx, or O.Sx SSC at about 35° C, 45° C,
55° C, or 65° C.
Polypeptides encoded by these nucleic acid molecules are also encompassed by
the
invention.
By a polynucleotide which hybridizes to a "portion" of a polynucleotide
is intended a polynucleotide (either DNA or RNA) hybridizing to at least about
15 nucleotides (nt), and more preferably at least about 20 nt, still more
preferably
at least about 30 nt, and even more preferably about 30-70 (e.g., 50) nt of
the
reference polynucleotide. In this context "about" includes the particularly
recited
size, larger or smaller by several (5, 4, 3, 2, or 1 ) nucleotides, at either
terminus
or at both termini. These have uses, which include, but are not limited to, as
diagnostic probes and primers as discussed above and in more detail below.
By a portion of a polynucleotide of "at least 20 nt in length," for example,
is intended 20 or more contiguous nucleotides from the nucleotide sequence of
the
reference polynucleotide (e.g., a deposited cDNA or the nucleotide sequence as
shown in SEQ ID NO:1). Of course, a polynucleotide which hybridizes only to
a poly A sequence (such as the 3' terminal poly(A) tract of the TRID cDNA
shown in SEQ ID NO: l ), or to a complementary stretch of T (or U) residues,
would not be included in a polynucleotide of the invention used to hybridize
to a
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-30-
portion of a nucleic acid of the invention, since such a polynucleotide would
hybridize to any nucleic acid molecule containing a poly (A) stretch or the
complement thereof (e.g., practically any double-stranded cDNA clone).
As indicated, nucleic acid molecules of the present invention which encode
a TRID polypeptide may include, but are not limited to the coding sequence for
the mature polypeptide, by itself; the coding sequence for the mature
polypeptide
and additional sequences, such as those encoding a leader or secretary
sequence,
such as a pre-, or pro- or prepro- protein sequence; the coding sequence of
the
mature polypeptide, with or without the aforementioned additional coding
sequences, together with additional, non-coding sequences, including for
example,
but not limited to introns and non-coding 5' and 3' sequences, such as the
transcribed, non-translated sequences that play a role in transcription. mRNA
processing - including splicing and polyadenylation signals, for example -
ribosome
binding and stability of mRNA; additional coding sequence which codes for
additional amino acids, such as those which provide additional
functionalities.
Thus, for instance, the polypeptide may be fused to a marker sequence, such as
a
peptide, which facilitates purification of the fused polypeptide. In certain
preferred embodiments of this aspect of the invention, the marker sequence is
a
hexa-histidine peptide, such as the tag provided in a pQE vector (Qiagen,
Inc.),
among others, many of which are commercially available. As described in Gentz
et al., Proc. Natl. Acad. Sci. USA 86: 821-824 (1989), for instance, hexa-
histidine provides for convenient purification of the fusion protein. The "HA"
tag
is another peptide useful for purification which corresponds to an epitope
derived
from the influenza hemagglutinin protein, which has been described by Wilson
et
al., Cell 37:767-778(1984). As discussed below, other such fusion proteins
include the TRID receptor fused to Fc at the N- or C- terminus.
Variant and Mutant Polynucleotides
The present invention further relates to variants of the nucleic acid
molecules of the present invention, which encode portions, analogs, or
derivatives
of the TRID receptor. Variants may occur naturally, such as a natural allelic
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-31 -
variant. By an "allelic variant" is intended one of several alternate forms of
a gene
occupying a given locus on a chromosome of an organism. Genes II, Lewin, B.,
ed., John Wiley & Sons, New York ( 1985). Non-naturally occurring variants may
be produced using art-known mutagenesis techniques.
Such variants include those produced by nucleotide substitutions, deletions
or additions. The substitutions, deletions or additions may involve one or
more
nucleotides. The variants may be altered in coding regions, non-coding
regions,
or both. Alterations in the coding regions may produce conservative or
non-conservative amino acid substitutions, deletions or additions. Especially
preferred among these are silent substitutions, additions and deletions, which
do
not alter the properties and activities of the TRID polypeptide or portions
thereof.
Also especially preferred in this regard are conservative substitutions.
Further embodiments of the invention include an isolated nucleic acid
molecule comprising, or alternatively consisting of, a polynucleotide having a
nucleotide sequence at least 90% identical, and more preferably at least 95%,
96%, 97%, 98% or 99% identical to: (a) a nucleotide sequence encoding the
polypeptide having the amino acid sequence in SEQ ID N0:2; (b) a nucleotide
sequence encoding the polypeptide having the amino acid sequence in SEQ ID
N0:2, but lacking the amino terminal methionine; (c) a nucleotide sequence
encoding the polypeptide having the amino acid sequence at positions from
about
1 to about 259 in SEQ ID N0:2; (d) a nucleotide sequence encoding the
polypeptide having the amino acid sequence encoded by the cDNA clone
contained in ATCC Deposit No. 97798; (e) a nucleotide sequence encoding the
mature TRID polypeptide having the amino acid sequence at positions from about
27 to about 259 in SEQ ID N0:2; (f) a nucleotide sequence encoding the mature
TRID polypeptide having the amino acid sequence encoded by the cDNA clone
contained in ATCC Deposit No. 97798; (g) a nucleotide sequence encoding the
TRID extracellular domain having the amino acid sequence at positions from
about 27 to about 240 in SEQ ID N0:2; (h) a nucleotide sequence that encoding
the TRID extracellular domain having the amino acid sequence encoded by the
cDNA contained in ATCC Deposit No. 97798; (i) a nucleotide sequence
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-32-
encoding the TRID cysteine rich domain having the amino acid sequence at
positions from about 53 to about 150 in SEQ ID N0:2; (j) a nucleotide sequence
encoding the TRID cysteine rich domain having the amino acid sequence encoded
by the cDNA contained in ATCC Deposit No. 97798; (k) a nucleotide sequence
encoding the TRID transmembrane domain having the amino acid sequence at
positions from about 241 to about 259 of SEQ ID N0:2; (1) a nucleotide
sequence
encoding the TRID transmembrane domain having the amino acid sequence
encoded by the cDNA contained in ATCC Deposit No. 97798;(m) a nucleotide
sequence that encodes a fragment of the polypeptide of (e) or .(~ having TRID
functional activity (e.g., antigenic or biological activity); and (n) a
nucleotide
sequence complementary to any of the nucleotide sequences in (a), (b), (c),
(d),
(e), (f), (g), (h), (i), (j), (k), (1) or (m) above. Also contemplated are
polypeptides
encoded by the nucleotide sequences in (a), (b), (c), (d), (e), (f), (g), (h),
(i), (j),
(k), (1) or (m) above. In this context "about" includes the particularly
recited size,
larger or smaller by several (5, 4, 3, 2 or 1 ) nucleotides, at either
terminus or at
both termini.
Further embodiments of the invention include isolated nucleic acid
molecules that comprise, or alternatively consist of, a polynucleotide which
hybridizes under stringent hybridization conditions to a polynucleotide in
(a), (b),
(c), (d), (e), (f), (g), (h), (i), (j), (k), (1) or (m) above. This
polynucleotide which
hybridizes does not hybridize under stringent hybridization conditions to a
polynucleotide having a nucleotide sequence consisting of only A residues or
of
only T residues. An additional nucleic acid embodiment of the invention
relates
to an isolated nucleic acid molecule comprising, or alternatively consisting
of, a
polynucleotide which encodes the amino acid sequence of an epitope-bearing
portion of a TRID polypeptide having an amino acid sequence in (a), (b), (c),
(d),
(e), (f), (g), (h), (i), (j), (k), (1) or (m) above.
By a polynucleotide having a nucleotide sequence at least, for example,
95% "identical" to a reference nucleotide sequence encoding a TRID polypeptide
is intended that the nucleotide sequence of the polynucleotide is identical to
the
reference sequence except that the polynucleotide sequence may include up to
five
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-33-
mismatches per each 100 nucleotides of the reference nucleotide sequence
encoding the TRID polypeptide. In other words, to obtain a polynucleotide
having a nucleotide sequence at least 95% identical to a reference nucleotide
sequence, up to 5% of the nucleotides in the reference sequence may be deleted
or substituted with another nucleotide, or a number of nucleotides up to 5% of
the
total nucleotides in the reference sequence may be inserted into the reference
sequence. These mutations of the reference sequence may occur at the 5' or 3'
terminal positions of the reference nucleotide sequence or anywhere between
those terminal positions, interspersed either individually among nucleotides
in the
reference sequence or in one or more contiguous groups within the reference
sequence. The reference (query) sequence may be the entire TRID encoding
nucleotide sequence shown in SEQ ID NO:1 or any TRID polynucleotide
fragment (e.g., a polynucleotide encoding the amino acid sequence of any of
the
TRID N- and/or C- terminal deletions described herein), variant, derivative or
analog, as described herein.
As a practical matter, whether any particular nucleic acid molecule is at
least 90%, 95%, 96%, 97%, 98% or 99% identical to, for instance, the
nucleotide
sequence shown in SEQ ID NO:1, or to the nucleotide sequence of the deposited
cDNA clone can be determined conventionally using known computer programs
such as the Bestfit program (Wisconsin Sequence Analysis Package, Version 8
for
Unix, Genetics Computer Group, University Research Park, 575 Science Drive,
Madison, WI 53711 ). Bestfit uses the local homology algorithm of Smith and
Waterman, Advances in Applied Mathematics 2:482-489 ( 1981 ), to find the best
segment of homology between two sequences. When using Bestfit or any other
sequence alignment program to determine whether a particular sequence is, for
instance, 95% identical to areference sequence according to the present
invention.
the parameters are set, of course, such that the percentage of identity is
calculated
over the full length of the reference nucleotide sequence and that gaps in
homology of up to 5% of the total number of nucleotides in the reference
sequence are allowed.
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-34-
In a specific embodiment, the identity between a reference (query)
sequence (a sequence of the present invention) and a subject sequence, also
referred to as a global sequence alignment, is determined using the FASTDB
computer program based on the algorithm of Brutlag et al. (Comp. App. Biosci.
6:237-245 (1990)). Preferred parameters used in a FASTDB alignment of DNA
sequences to calculate percent identity are: Matrix=Unitary, k-tuple=4,
Mismatch
Penalty=l, Joining Penalty=30, Randomization Group Length=0, Cutoff Score=1,
Gap Penalty=5, Gap Size Penalty 0.05, Window Size=500 or the length of the
subj ect nucleotide sequence, whichever is shorter. According to this
embodiment,
if the subject sequence is shorter than the query sequence because of 5' or 3'
deletions, not because of internal deletions. a manual correction is made to
the
results to take into consideration the fact that the FASTDB program does not
account for 5' and 3' truncations of the subj ect sequence when calculating
percent
identity. For subject sequences truncated at the 5' or 3' ends, relative to
the query
sequence, the percent identity is corrected by calculating the number of bases
of
the query sequence that are 5' and 3' of the subject sequence, which are not
matched/aligned, as a percent of the total bases of the query sequence. A
determination of whether a nucleotide is matched/aligned is determined by
results
of the FASTDB sequence alignment. This percentage is then subtracted from the
percent identity, calculated by the above FASTDB program using the specified
parameters, to arrive at a final percent identity score. This corrected score
is what
is used for the purposes of this embodiment. Only bases outside the 5' and 3'
bases of the subject sequence, as displayed by the FASTDB alignment, which are
not matched/aligned with the query sequence, are calculated for the purposes
of
manually adjusting the percent identity score. For example, a 90 base subject
sequence is aligned to a 100 base query sequence to determine percent
identity.
The deletions occur at the 5' end of the subject sequence and therefore, the
FASTDB alignment does not show a matched/alignment of the first 10 bases at
5' end. The 10 unpaired bases represent 10% of the sequence (number of bases
at the 5' and 3' ends not matched/total number of bases in the query sequence)
so
10% is subtracted from the percent identity score calculated by the FASTDB
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-35-
program. If the remaining 90 bases were perfectly matched the final percent
identity would be 90%. In another example, a 90 base subject sequence is
compared with a 100 base query sequence. This time the deletions are internal
deletions so that there are no bases on the 5' or 3' of the subject sequence
which
are not matched/aligned with the query. In this case the percent identity
calculated
by FASTDB is not manually corrected. Once again, only bases 5' and 3' of the
subject sequence which are not matched/aligned with the query sequence are
manually corrected for. No other manual corrections are made for the purposes
of this embodiment.
The present application is directed to nucleic acid molecules at least 90%,
95%, 96%, 97%, 98% or 99% identical to a nucleic acid sequence shown in SEQ
ID NO:1, or to the nucleic acid sequence of the deposited cDNA, irrespective
of
whether they encode a polypeptide having TRID activity. This is because even
where a particular nucleic acid molecule does not encode a polypeptide having
TRID activity, one of skill in the art would still know how to use the nucleic
acid
molecule, for instance, as a hybridization probe or a polymerise chain
reaction
(PCR) primer. Uses of the nucleic acid molecules of the present invention that
do
not encode a polypeptide having TRID activity include, inter alias ( 1 )
isolating a
TRID gene or allelic variants thereof in a cDNA library; (2) in situ
hybridization
(e.g., "FISH") to metaphase chromosomal spreads to provide precise
chromosomal location of the TRID gene, as described in Verma et al., Human
Chromosomes: A Manual of Basic Techniques, Pergamon Press, New York
( 1988); and Northern Blot analysis for detecting TRID mRNA expression in
specific tissues.
Preferred, however, are nucleic acid molecules having sequences at least
90%, 95%, 96%, 97%, 98% or 99% identical to a nucleic acid sequence shown
in SEQ ID NO:1, or to the nucleic acid sequence of the deposited cDNA which
does, in fact, encode a polypeptide having TRID receptor activity. By "a
polypeptide having TRID receptor activity" is intended polypeptides exhibiting
activity similar, but not necessarily identical, to an activity of the TRID
receptor
of the invention (either the full length protein or preferably the mature
protein or
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-36-
extracellular domain alone), as measured in a particular biological assay. The
TNF
family ligands (including TRAIL) induce various cellular responses by binding
to
TNF-family receptors, including the TRID of the present invention. Cells which
express TRID are believed to have a potent cellular response to ligands
including
TRAIL. By a "cellular response to a TNF-family ligand" is intended any
genotypic, phenotypic, and/or morphological change to a cell, cell line,
tissue,
tissue culture or patient that is induced by a TNF-family ligand. As
indicated, such
cellular responses include not only normal physiological responses to TNF-
family
ligands, but also diseases associated with increased cell proliferation or the
inhibition of increased cell proliferation, such as by the inhibition of
apoptosis.
Of course, due to the degeneracy of the genetic code, one of ordinary skill
in the art will immediately recognize that a large number of the nucleic acid
molecules having a sequence at least 90%, 95%, 96%, 97%, 98%, or 99%
identical to the nucleic acid sequence of a deposited cDNA or the nucleic acid
sequence shown in SEQ ID NO: l will encode a polypeptide "having TRID protein
activity." In fact, since degenerate variants of these nucleotide sequences
all
encode the same polypeptide, this will be clear to the skilled artisan even
without
performing the above described comparison assay. It will be further recognized
in the art that, for such nucleic acid molecules that are not degenerate
variants, a
reasonable number will also encode a polypeptide having TRID protein activity.
This is because the skilled artisan is fully aware of amino acid substitutions
that are
either less likely or not likely to significantly effect protein function
(e.g., replacing
one aliphatic amino acid with a second aliphatic amino acid), as further
described
below.
For example, guidance concerning how to make phenotypically silent
amino acid substitutions is provided in Bowie et al., "Deciphering the Message
in
Protein Sequences: Tolerance to Amino Acid Substitutions," Science 247:1306-
1310 ( 1990), wherein the authors indicate that proteins are surprisingly
tolerant
of amino acid substitutions.
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-37-
Polynucleotide Assays
This invention is also related to the use of the TRID polynucleotides to
detect complementary polynucleotides such as, for example, as a diagnostic
reagent. Detection of a mutated form of TRID associated with a dysfunction
will
provide a diagnostic tool that can add or define a diagnosis of a disease or
susceptibility to a disease which results from under-expression over-
expression or
altered expression of TRID or a soluble form thereof, such as, for example,
tumors or autoimmune disease.
Individuals carrying mutations in the TRID gene may be detected at the
DNA level by a variety of techniques. Nucleic acids for diagnosis may be
obtained
from a patient's cells, such as from blood, urine, saliva, tissue biopsy and
autopsy
material. The genomic DNA may be used directly for detection or may be
amplified enzymatically by using PCR prior to analysis. (Saiki et al., Nature
324:163-166 (1986)). RNA or cDNA may also be used in the same ways. As an
example, PCR primers complementary to the nucleic acid encoding TRID can be
used to identify and analyze TRID expression and mutations. For example,
deletions and insertions can be detected by a change in size of the amplified
product in comparison to the normal genotype. Point mutations can be
identified
by hybridizing amplified DNA to radiolabeled TRID RNA or alternatively,
radiolabeled TRID antisense DNA sequences. Perfectly matched sequences can
be distinguished from mismatched duplexes by RNase A digestion or by
differences in melting temperatures.
Sequence differences between a reference gene and genes having
mutations also may be revealed by direct DNA sequencing. In addition, cloned
DNA segments may be employed as probes to detect specific DNA segments.
The sensitivity of such methods can be greatly enhanced by appropriate use of
PCR or another amplification method. For example, a sequencing primer is used
with double-stranded PCR product or a single-stranded template molecule
generated by a modified PCR. The sequence determination is performed by
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-38-
conventional procedures with radiolabeled nucleotide or by automatic
sequencing
procedures with fluorescent-tags.
Genetic testing based on DNA sequence differences may be achieved by
detection of alteration in electrophoretic mobility of DNA fragments in gels,
with
or without denaturing agents. Small sequence deletions and insertions can be
visualized by high resolution gel electrophoresis. DNA fragments of different
sequences may be distinguished on denaturing formamide gradient gels in which
the mobilities of different DNA fragments are retarded in the gel at different
positions according to their specific melting or partial melting temperatures
(see,
e.g., Myers et al., Science 230:1242 (1985)).
Sequence changes at specific locations also may be revealed by nuclease
protection assays, such as RNase and S1 protection or the chemical cleavage
method (e.g., Cotton et al., Proc. Natl. Acad. Sci. USA 85: 4397-4401 (1985)).
Thus, the detection of a specific DNA sequence may be achieved by
methods such as hybridization, RNase protection, chemical cleavage, direct DNA
sequencing or the use of restriction enzymes, (e.g., restriction fragment
length
polymorphisms ("RFLP") and Southern blotting of genomic DNA.
In addition to more conventional gel-electrophoresis and DNA sequencing,
mutations also can be detected by in situ analysis.
Vectors and Host Cells
The present invention also relates to vectors which include the isolated
DNA molecules of the present invention, host cells which are genetically
engineered with the recombinant vectors of the invention and the production of
TRID polypeptides or fragments thereof by recombinant techniques.
Host cells can be genetically engineered to incorporate nucleic acid
molecules and express polypeptides of the present invention. The
polynucleotides
may be introduced alone or with other polynucleotides. Such other
polynucleotides may be introduced independently, co-introduced or introduced
joined to the polynucleotides of the invention.
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-39-
In accordance with this aspect of the invention the vector may be, for
example, a plasmid vector, a single or double-stranded phage vector, a single
or
double-stranded RNA or DNA viral vector. Such vectors may be introduced into
cells as polynucleotides, preferably DNA, by well known techniques for
introducing DNA and RNA into cells. Viral vectors may be replication competent
or replication defective. In the latter case viral propagation generally will
occur
only in complementing host cells.
Preferred among vectors, in certain respects, are those for expression of
polynucleotides and polypeptides of the present invention. Generally, such
vectors
comprise cis-acting control regions effective for expression in a host
operatively
linked to the polynucleotide to be expressed. Appropriate trans-acting factors
either are supplied by the host, supplied by a complementing vector or
supplied
by the vector itself upon introduction into the host.
A great variety of expression vectors can be used to express a polypeptide
of the invention. Such vectors include chromosomal, episomal and virus-derived
vectors e.g., vectors derived from bacterial plasmids, from bacteriophage,
from
yeast episomes, from yeast chromosomal elements, from viruses such as
baculoviruses, papova viruses, such as SV40, vaccinia viruses, adenoviruses,
fowl
pox viruses, pseudorabies viruses and retroviruses, and vectors derived from
combinations thereof, such as those derived from plasmid and bacteriophage
genetic elements, such as cosmids and phagemids, all may be used for
expression
in accordance with this aspect of the present invention. Generally, any vector
suitable to maintain, propagate or express polynucleotides to express a
polypeptide in a host may be used for expression in this regard.
The DNA sequence in the expression vector is operatively linked to
appropriate expression control sequence(s)), including, for instance, a
promoter
to direct mRNA transcription. Representatives of such promoters include the
phage lambda PL promoter, the E. coli lac, trp and tac promoters, the SV40
early
and late promoters and promoters of retroviral LTRs, to name just a few of the
well-known promoters. In general, expression constructs will contain sites for
transcription, initiation and termination, and, in the transcribed region, a
ribosome
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-40-
binding site for translation. The coding portion of the mature transcripts
expressed by the constructs will include a translation initiating AUG at the
beginning and a termination codon (UAA, UGA or UAG) appropriately positioned
at the end of the polypeptide to be translated.
In addition, the constructs may contain control regions that regulate as
well as engender expression. Generally, such regions will operate by
controlling
transcription, such as repressor binding sites and enhancers, among others.
Vectors for propagation and expression generally will include selectable
markers. Such markers also may be suitable for amplification or the vectors
may
contain additional markers for this purpose. In this regard, the expression
vectors
preferably contain one or more selectable marker genes to provide a phenotypic
trait for selection of transformed host cells. Preferred markers include
dihydrofolate reductase or neomycin resistance for eukaryotic cell culture,
and
tetracycline or ampicillin resistance genes for culturing E. coli and other
bacteria.
The vector containing the appropriate DNA sequence as described
elsewhere herein, as well as an appropriate promoter, and other appropriate
control sequences, may be introduced into an appropriate host using a variety
of
well known techniques suitable to expression therein of a desired polypeptide.
Representative examples of appropriate hosts include bacterial cells, such as
E.
coli, Streptomyces and Salmonella typhimurium cells; fungal cells, such as
yeast
cells; insect cells such as Drosophila S2 and Spodoptera Sf~ cells; animal
cells
such as CHO, COS and Bowes melanoma cells; and plant cells. Hosts for of a
great variety of expression constructs are well known, and those of skill will
be
enabled by the present disclosure readily to select a host for expressing a
polypeptides in accordance with this aspect of the present invention.
Among vectors preferred for use in bacteria are pQE70, pQE60 and
pQE-9, available from Qiagen; pBS vectors, Phagescript vectors, Bluescript
vectors, pNHBA, pNHl6a, pNHlBA, pNH46A, available from Stratagene; and
ptre99a, pKK223-3, pKK233-3, pDR540, pRITS available from Pharmacia.
Among preferred eukaryotic vectors are pWLNEO, pSV2CAT, pOG44, pXTI
and pSG available from Stratagene; and pSVK3, pBPV, pMSG and pSVL
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-41 -
available from Pharmacia. These vectors are listed solely by way of
illustration of
the many commercially available and well known vectors available to those of
skill
in the art.
Selection of appropriate vectors and promoters for expression in a host cell
is a well known procedure and the requisite techniques for expression vector
construction, introduction of the vector into the host and expression in the
host
are routine skills in the art.
The present invention also relates to host cells containing the above-
described vector constructs described herein, and additionally encompasses
host
cells containing nucleotide sequences of the invention that are operably
associated
with one or more heterologous control regions (e.g., promoter and/or enhancer)
using techniques known of in the art. The host cell can be a higher eukaryotic
cell,
such as a mammalian cell (e.g., a human derived cell), or a lower eukaryotic
cell,
such as a yeast cell, or the host cell can be a prokaryotic cell, such as a
bacterial
cell. The host strain may be chosen which modulates the expression of the
inserted gene sequences, or modifies and processes the gene product in the
specific fashion desired. Expression from certain promoters can be elevated in
the
presence of certain inducers: thus expression of the genetically engineered
polypeptide may be controlled. Furthermore, different host cells have
characteristics and specific mechanisms for the translational and post-
translational
processing and modification (e.g., phosphorylation, cleavage) of proteins.
Appropriate cell lines can be chosen to ensure the desired modifications and
processing of the foreign protein expressed.
Introduction of the construct into the host cell can be effected by calcium
phosphate transfection, DEAE-dextran mediated transfection, cationic
lipid-mediated transfection, electroporation, transduction, infection or other
methods. Such methods are described in many standard laboratory manuals, such
as Davis et al., Basic Methods In Molecular Biology (1986).
In addition to encompassing host cells containing the vector constructs
discussed herein, the invention also encompasses primary, secondary, and
immortalized host cells of vertebrate origin, particularly mammalian origin,
that
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-42-
have been engineered to delete or replace endogenous genetic material (e.g.,
TRID coding sequence), and/or to include genetic material (e.g., heterologous
polynucleotide sequences) that is operably associated with TRID
polynucleotides
of the invention, and which activates, alters, and/or amplifies endogenous
TRID
polynucleotides. For example, techniques known in the art may be used to
operably associate heterologous control regions (e.g., promoter and/or
enhancer)
and endogenous TRID polynucleotide sequences via homologous recombination
(see, e.g., US Patent Number 5,641,670, issued June 24, 1997; International
Publication Number WO 96/2941 l, published September 26, 1996; International
Publication Number WO 94/12650, published August 4, 1994; Koller et al., Proc.
Natl. Acad. Sci. USA 86:8932-8935 (1989); and Zijlstra et al., Nature 342:435-
43 8 ( 1989), the disclosures of each of which are incorporated by reference
in their
entireties).
TRID receptor polynucleotides and polypeptides may be used in
accordance with the present invention for a variety of applications,
particularly
those that make use of the chemical and biological properties of TRID. Among
these are applications in treatment of tumors, resistance to parasites,
bacteria and
viruses, to induce proliferation of T-cells, endothelial cells and certain
hematopoietic cells, to treat restenosis, graft vs. host disease, to regulate
anti-viral
responses and to prevent certain autoimmune diseases after stimulation of TRID
by an agonist or by a TRAIL binding facilitator. Additional applications
relate to
diagnosis and to treatment of disorders of cells, tissues and organisms. These
aspects of the invention are discussed further below.
Transgenics and "Knockouts"
The proteins of the invention can also be expressed in transgenic animals.
Animals of any species, including, but not limited to, mice, rats, rabbits,
hamsters,
guinea pigs, pigs, micro-pigs, goats, sheep, cows and non-human primates,
e.g.,
baboons, monkeys, and chimpanzees may be used to generate transgenic animals.
In a specific embodiment, techniques described herein or otherwise known in
the
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 43 -
art, are used to express polypeptides of the invention in humans, as part of a
gene
therapy protocol.
Any technique known in the art may be used to introduce the transgene
(i. e., nucleic acids of the invention) into animals to produce the founder
lines of
transgenic animals. Such techniques include, but are not limited to,
pronuclear
microinjection (Paterson etal., Appl. Microbiol. Biotechnol. 40:691-698
(1994);
Carver et al., Biotechnology (NY) 11:1263-1270 (1993); Wright et al.,
Biotechnology (NY) 9:830-834 (1991); and Hoppe et al., US Patent Number
4,873,191 (1989)); retrovirus mediated gene transfer into germ lines (Van der
Putten et al., Proc. Natl. Acad. Sci., USA 82:6148-6152 (1985)), blastocysts
or
embryos; gene targeting in embryonic stem cells (Thompson et al., Cell ~6:313-
321 (1989)); electroporation of cells or embryos (Lo, Mol Cell. Biol. 3:1803-
1814
(1983)); introduction of the polynucleotides of the invention using a gene gun
(see, e.g., Ulmer et al., Science 259:1745 (1993); introducing nucleic acid
constructs into embryonic pleuripotent stem cells and transferring the stem
cells
back into the blastocyst; and sperm-mediated gene transfer (Lavitrano et al.,
Cell
~ 7:717-723 (1989); etc. For a review of such techniques, see Gordon,
"Transgenic Animals," Intl. Rev. Cytol. 115:171-229 ( 1989), which is
incorporated by reference herein in its entirety. Further, the contents of
each of
the documents recited in this paragraph is herein incorporated by reference in
its
entirety.
Any technique known in the art may be used to produce transgenic clones
containing polynucleotides of the invention, for example, nuclear transfer
into
enucleated oocytes of nuclei from cultured embryonic, fetal, or adult cells
induced
to quiescence (Campell et al., Nature 380:64-66 (1996); Wilmut et al., Nature
385:810-813 ( 1997)), each of which is herein incorporated by reference in its
entirety).
The present invention provides for transgenic animals that carry the
transgene in all their cells, as well as animals which carry the transgene in
some,
but not all their cells, i. e., mosaic animals or chimeric animals. The
transgene may
be integrated as a single transgene or as multiple copies such as in
concatamers,
CA 02374674 2001-11-20
WO 00/71150 PCT/LJS00/13515
-44-
e.g., head-to-head tandems or head-to-tail tandems. The transgene may also be
selectively introduced into and activated in a particular cell type by
following, for
example, the teaching of Lasko et al. (Proc. Natl. Acad. Sci. USA 89:6232-6236
( 1992)). The regulatory sequences required for such a cell-type specific
activation
will depend upon the particular cell type of interest, and will be apparent to
those
of skill in the art. When it is desired that the polynucleotide transgene be
integrated into the chromosomal site of the endogenous gene, gene targeting is
preferred. Briefly, when such a technique is to be utilized, vectors
containing
some nucleotide sequences homologous to the endogenous gene are designed for
the purpose of integrating. via homologous recombination with chromosomal
sequences, into and disrupting the function of the nucleotide sequence of the
endogenous gene. The transgene may also be selectively introduced into a
particular cell type, thus inactivating the endogenous gene in only that cell
type,
by following, for example, the teaching of Gu et al. (Science 26~ :103-106 (
1994)).
The regulatory sequences required for such a cell-type specific inactivation
will
depend upon the particular cell type of interest, and will be apparent to
those of
skill in the art. The contents of each of the documents recited in this
paragraph
is herein incorporated by reference in its entirety.
Once transgenic animals have been generated, the expression of the
recombinant gene may be assayed utilizing standard techniques. Initial
screening
may be accomplished by Southern blot analysis or PCR techniques to analyze
animal tissues to verify that integration of the transgene has taken place.
The level
of mRNA expression of the transgene in the tissues of the transgenic animals
may
also be assessed using techniques which include, but are not limited to,
Northern
blot analysis of tissue samples obtained from the animal, in situ
hybridization
analysis, and reverse transcriptase-PCR (rt-PCR). Samples of transgenic gene-
expressing tissue may also be evaluated immunocytochemically or
immunohistochemically using antibodies specific for the transgene product.
Once the founder animals are produced, they may be bred, inbred, outbred,
or crossbred to produce colonies of the particular animal. Examples of such
breeding strategies include, but are not limited to: outbreeding of founder
animals
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 45
with more than one integration site in order to establish separate lines;
inbreeding
of separate lines in order to produce compound transgenics that express the
transgene at higher levels because of the effects of additive expression of
each
transgene; crossing of heterozygous transgenic animals to produce animals
homozygous for a given integration site in order to both augment expression
and
eliminate the need for screening of animals by DNA analysis; crossing of
separate
homozygous lines to produce compound heterozygous or homozygous lines; and
breeding to place the transgene on a distinct background that is appropriate
for an
experimental model of interest.
Transgenic and "knock-out" animals of the invention have uses which
include, but are not limited to, animal model systems useful in elaborating
the
biological function of TRID polypeptides, studying conditions and/or disorders
associated with aberrant TRID expression, and in screening for compounds
effective in ameliorating such conditions and/or disorders.
In further embodiments of the invention, cells that are genetically
engineered to express the proteins of the invention, or alternatively, that
are
genetically engineered not to express the proteins of the invention (e.g.,
knockouts) are administered to a patient in vivo. Such cells may be obtained
from
the patient (i. e. , animal, including human) or an MHC compatible donor and
can
include, but are not limited to fibroblasts, bone marrow cells, blood cells
(e.g.,
lymphocytes), adipocytes, muscle cells, endothelial cells, etc. The cells are
genetically engineered in vitro using recombinant DNA techniques to introduce
the coding sequence of polypeptides of the invention into the cells, or
alternatively, to disrupt the coding sequence and/or endogenous regulatory
sequence associated with the polypeptides of the invention, e.g., by
transduction
(using viral vectors, and preferably vectors that integrate the transgene into
the
cell genome) or transfection procedures, including, but not limited to, the
use of
plasmids, cosmids, YACs, naked DNA, electroporation, liposomes, etc. The
coding sequence of the polypeptides of the invention can be placed under the
control of a strong constitutive or inducible promoter or promoter/enhancer to
achieve expression, and preferably secretion, ofthe polypeptides ofthe
invention.
CA 02374674 2001-11-20
WO 00/71150 PCT/LJS00/13515
-46-
The engineered cells which express and preferably secrete the polypeptides
of the invention can be introduced into the patient systemically, e.g., in the
circulation, or intraperitoneally. Alternatively, the cells can be
incorporated into
a matrix and implanted in the body, e. g. , genetically engineered fibroblasts
can be
implanted as part of a skin graft; genetically engineered endothelial cells
can be
implanted as part of a lymphatic or vascular graft. (See, for example,
Anderson
et al. US Patent Number 5,399,349; and Mulligan & Wilson, US Patent Number
5,460,959, each of which is incorporated by reference herein in its entirety).
When the cells to be administered are non-autologous or non-MHC
compatible cells, they can be administered using well known techniques which
prevent the development of a host immune response against the introduced
cells.
For example, the cells may be introduced in an encapsulated form which, while
allowing for an exchange of components with the immediate extracellular
environment, does not allow the introduced cells to be recognized by the host
immune system.
TRID Polypeptides and Fragments
The polypeptides of the present invention are preferably provided in an
isolated form. For example, a recombinantly produced version of the TRID
polypeptide can be substantially purified by the one-step method described in
Smith and Johnson, Gene 67:31-40 (1988). The invention further provides an
isolated TRID polypeptide having the amino acid sequences encoded by the
deposited cDNA, or the amino acid sequences in SEQ ID N0:2, or a peptide or
polypeptide comprising, or alternatively consisting of, a portion of the above
polypeptides.
Polypeptide fragments of the present invention include polypeptides
comprising or alternatively, consisting of, an amino acid sequence contained
in
SEQ ID N0:2, encoded by the cDNA contained in the deposited clone, or
encoded by nucleic acids which hybridize (e.g., under stringent hybridization
conditions) to the nucleotide sequence contained in the deposited clone, or
shown
in SEQ ID NO:1 or the complementary strand thereto. Protein fragments may be
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-47-
"free-standing," or comprised within a larger polypeptide of which the
fragment
forms a part or region, most preferably as a single continuous region.
Representative examples of polypeptide fragments of the invention, include,
for
example, fragments that comprise or alternatively, consist of from about amino
acid residues: 1 to 26, 27 to 50, 51 to 100, 151 to 200, 201 to 240, and/or
241 to
259, of SEQ ID N0:2. Additional representative examples of polypeptide
fragments of the invention, include, for example, fragments that comprise, or
alternatively consisting of, from about amino acid residues: 1-60, 11-70, 21-
80,
31-90, 41-100, 51-110, 61-120, 71-130, 81-140, 91-150, 101-160, 111-170,
121-180, 131-190, 141-200, 151-210, 161-220, 171-230, 181-240, 191-250,
and/or 201-249 of SEQ ID N0:2, as well as isolated polynucleotides which
encode these polypeptides. In this context "about" includes the particularly
recited
value, larger or smaller by several (5, 4, 3, 2, or 1 ) amino acids, at either
extreme
or at both extremes. Moreover, polypeptide fragments can be at least 10, 20,
30,
40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 175 or 200 amino acids
in
length. Polynucleotides encoding these polypeptides are also encompassed by
the
invention.
In specific embodiments, polypeptide fragments of the invention comprise,
or alternatively consist of, amino acid residues: 1-259, 27-259, 27-240, 53-
150,
and/or 241-259, of TRID as depicted in SEQ ID N0:2. Polynucleotides encoding
these polypeptides are also encompassed by the invention.
In additional embodiments, the polypeptide fragments of the invention
comprise, or alternatively consist, of one or more TRID domains. Preferred
polypeptide fragments ofthe present invention include a member selected from
the
group: (a) a polypeptide comprising or alternatively, consisting of, the TRID
transmembrane domain (predicted to constitute amino acid residues from about
241 to about 259 of SEQ ID N0:2); (b) a polypeptide comprising or
alternatively,
consisting of, the TRID receptor extracellular domain (predicted to constitute
amino acid residues from about 27 to about 240 of SEQ ID N0:2); (c) a
polypeptide comprising or alternatively, consisting of, the TRID cysteine rich
domain (predicted to constitute amino acid residues from about 53 to about 150
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-48-
of SEQ ID N0:2); (d) a polypeptide comprising or alternatively, consisting of,
fragment of the predicted mature TRID polypeptide, wherein the fragment has a
TRID functional activity (e.g., antigenic activity or biological acitivity);
or (e) a
polypeptide comprising, or alternatively consisting of, one, two, three, four
or
more, epitope bearing portions of the TRID receptor protein. In additional
embodiments, the polypeptide fragments of the invention comprise, or
alternatively consist of, any combination of (a), (b), (c), (d), or (e) of the
above
members. Polynucleotides encoding these polypeptides are also encompassed by
the invention.
As discussed above, it is believed that one or both of the extracellular
cysteine rich motifs of TRID is important for interactions between TRID and
its
ligands (e.g., TRAIL). Accordingly, in preferred embodiments, polypeptide
fragments ofthe invention comprise, or alternatively consist of amino acid
residues
53 to 110, and/or 111 to 153 of SEQ ID N0:2. In a specific embodiment the
polypeptides of the invention comprise, or alternatively consist of both of
the
extracellular cysteine rich motifs disclosed in SEQ ID N0:2. Polynucleotides
encoding these polypeptides are also encompassed by the invention.
Among the especially preferred fragments of the invention are fragments
characterized by structural or functional attributes of TRID. Such fragments
include amino acid residues that comprise alpha-helix and alpha-helix forming
regions ("alpha-regions"), beta-sheet and beta-sheet-forming regions ("beta-
regions"), turn and turn-forming regions ("turn-regions"), coil and coil-
forming
regions ("coil-regions"), hydrophilic regions, hydrophobic regions, alpha
amphipathic regions, beta amphipathic regions, surface forming regions, and
high
antigenic index regions (i.e., containing four or more contiguous amino acids
having an antigenic index of greater than or equal to 1.5, as identified using
the
default parameters of the Jameson-Wolf program) of complete (i. e. , full-
length)
TRID (SEQ ID N0:2). Certain preferred regions are those set out in Figure 3
and
include, but are not limited to, regions of the aforementioned types
identified by
analysis of the amino acid sequence depicted in SEQ ID N0:2, such preferred
regions include; Gamier-Robson predicted alpha-regions, beta-regions, turn-
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-49-
regions, and coil-regions; Chou-Fasman predicted alpha-regions, beta-regions,
and
turn-regions; Kyte-Doolittle predicted hydrophilic and Hopp-Woods hydrophobic
regions; Eisenberg alpha and beta amphipathic regions; Emini surface-forming
regions; and Jameson-Wolf high antigenic index regions, as predicted using the
default parameters of these computer programs. Polynucleotides encoding these
polypeptides are also encompassed by the invention.
Among highly preferred fragments in this regard are those that comprise,
or alternatively consist of, regions of TRID that combine several structural
features, such as several of the features set out above.
The present invention encompasses TRID proteins containing the
polypeptide sequence encoded by the polynucleotides ofthe invention. The TRID
proteins of the invention may be in monomers or multimers (i. e. , dimers,
trimers,
tetramers, and higher multimers). Accordingly, the present invention relates
to
monomers and multimers of the TRID proteins of the invention, their
preparation,
and compositions (preferably, pharmaceutical compositions) containing them. In
specific embodiments, the polypeptides of the invention are monomers, dimers,
trimers or tetramers. In additional embodiments, the multimers of the
invention
are at least dimers, at least trimers, or at least tetramers.
Multimers encompassed by the invention may be homomers or heteromers.
As used herein, the term homomer, refers to a multimer containing only TRID
proteins of the invention (including TRID fragments, variants, and fusion
proteins,
as described herein). These homomers may contain TRID proteins having
identical or different polypeptide sequences. In a specific embodiment, a
homomer of the invention is a multimer containing only TRID proteins having an
identical polypeptide sequence. In another specific embodiment, a homomer of
the invention is a multimer containing TRID proteins having different
polypeptide
sequences. In specific embodiments, the multimer of the invention is a
homodimer
(e.g., containing TRID proteins having identical or different polypeptide
sequences) or a homotrimer (e.g., containing TRID proteins having identical or
different polypeptide sequences). In additional embodiments, the homomeric
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-50-
multimer of the invention is at least a homodimer, at least a homotrimer, or
at least
a homotetramer.
As used herein, the term heteromer refers to a multimer containing
heterologous proteins (i.e., proteins containing only polypeptide sequences
that
do not correspond to a polypeptide sequences encoded by the TRID gene) in
addition to the TRID proteins of the invention. In a specific embodiment, the
multimer of the invention is a heterodimer, a heterotrimer, or a
heterotetramer.
In additional embodiments, the heteromeric multimer of the invention is at
least
a heterodimer, at least a heterotrimer, or at least a heterotetrarr~er.
Multimers of the invention may be the result of hydrophobic, hydrophilic,
ionic and/or covalent associations and/or may be indirectly linked, by for
example,
liposome formation. Thus, in one embodiment, multimers of the invention, such
as, for example, homodimers or homotrimers, are formed when proteins of the
invention contact one another in solution. In another embodiment,
heteromultimers of the invention, such as, for example, heterotrimers or
heterotetramers, are formed when proteins of the invention contact antibodies
to
the polypeptides of the invention (including antibodies to the heterologous
polypeptide sequence in a fusion protein of the invention) in solution. In
other
embodiments, multimers of the invention are formed by covalent associations
with
and/or between the TRID proteins of the invention. Such covalent associations
may involve one or more amino acid residues contained in the polypeptide
sequence of the protein (e.g., the polypeptide sequence recited in SEQ ID N0:2
or the polypeptide encoded by the deposited cDNA clone). In one instance, the
covalent associations are cross-linking between cysteine residues located
within
the polypeptide sequences of the proteins which interact in the native (i.e.,
naturally occurring) polypeptide. In another instance, the covalent
associations
are the consequence of chemical or recombinant manipulation. Alternatively,
such
covalent associations may involve one or more amino acid residues contained in
the heterologous polypeptide sequence in a TRID fusion protein. In one
example,
covalent associations are between the heterologous sequence contained in a
fusion
protein of the invention (see, e.g., US Patent Number 5,478,925). In a
specific
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-51-
example, the covalent associations are between the heterologous sequence
contained in a TRID-Fc fusion protein of the invention (as described herein).
In
another specific example, covalent associations of fusion proteins of the
invention
are between heterologous polypeptide sequences from another TNF family
ligand/receptor member that is capable of forming covalently associated
multimers, such as for example, oseteoprotegerin (see, e.g., International
Publication No. WO 98/49305, the contents of which are herein incorporated by
reference in its entirety).
The multimers of the invention may be generated , using chemical
techniques known in the art. For example, proteins desired to be contained in
the
multimers ofthe invention may be chemically cross-linked using linker
molecules
and linker molecule length optimization techniques known in the art (see,
e.g., US
Patent Number 5,478,925, which is herein incorporated by reference in its
entirety). Additionally, multimers of the invention may be generated using
techniques known in the art to form one or more inter-molecule cross-links
between the cysteine residues located within the polypeptide sequence of the
proteins desired to be contained in the multimer (see, e.g., US Patent Number
5,478,925, which is herein incorporated by reference in its entirety).
Further,
proteins of the invention may be routinely modified by the addition of
cysteine or
biotin to the C terminus or N-terminus of the polypeptide sequence of the
protein
and techniques known in the art may be applied to generate multimers
containing
one or more of these modified proteins (see, e.g., US Patent Number 5,478,925,
which is herein incorporated by reference in its entirety). Additionally,
techniques
known in the art may be applied to generate liposomes containing the protein
components desired to be contained in the multimer of the invention (see, e.
g. , US
Patent Number 5,478,925, which is herein incorporated by reference in its
entirety).
Alternatively, multimers of the invention may be generated using genetic
engineering techniques known in the art. In one embodiment, proteins contained
in multimers of the invention are produced recombinantly using fusion protein
technology described herein or otherwise known in the art (see, e.g., US
Patent
CA 02374674 2001-11-20
WO 00/71150 PCT/LJS00/13515
-52-
Number 5,478,925, which is herein incorporated by reference in its entirety).
In
a specific embodiment, polynucleotides coding for a homodimer of the invention
are generated by ligating a polynucleotide sequence encoding a polypeptide of
the
invention to a sequence encoding a linker polypeptide and then further to a
synthetic polynucleotide encoding the translated product of the polypeptide in
the
reverse orientation from the original C-terminus to the N-terminus (lacking
the
leader sequence) (see, e.g., US Patent Number 5,478,925, which is herein
incorporated by reference in its entirety). In another embodiment, recombinant
techniques described herein or otherwise known in the art are applied to
generate
recombinant polypeptides of the invention which contain a transmembrane domain
and which can be incorporated by membrane reconstitution techniques into
liposomes (see, e.g., US Patent Number 5,478,925, which is herein incorporated
by reference in its entirety).
N Terminal and C Terminal Deletion Mutants
To improve or alter the characteristics of a TRID polypeptide, protein
engineering may be employed. Recombinant DNA technology known to those
skilled in the art can be used to create novel mutant proteins or "muteins"
including single or multiple amino acid substitutions, deletions, additions or
fusion
proteins. Such modified polypeptides can show, e.g., enhanced activity or
increased stability. In addition, they may be purified in higher yields and
show
better solubility than the corresponding natural polypeptide, at least under
certain
purification and storage conditions.
For instance, for many proteins, including the extracellular domain of a
membrane associated protein or the mature forms) of a secreted protein, it is
known in the art that one or more amino acids may be deleted from the N-
terminus or C-terminus without substantial loss of biological function. For
instance, Ron et al., J. Biol. Chem., 268:2984-2988 (1993) reported modified
KGF proteins that had heparin binding activity even if 3, 8, or 27 amino-
terminal
amino acid residues were missing. In the present case, since the proteins of
the
invention are members of the TNFR polypeptide family, deletions of N-terminal
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-53-
amino acids up to the cysteine at position C-53 of SEQ ID N0:2 may retain some
biological activity such as regulation of proliferation and apoptosis of
lymphoid
cells. Polypeptides having furtherN-terminal deletions including the C-53
residue
in SEQ ID N0:2, would not be expected to retain such biological activities
because it is known that these residues in a TRID-related polypeptide are
required
for forming a disulfide bridge to provide structural stability which is needed
for
ligand binding.
However, even if deletion of one or more amino acids from the N-terminus
of a protein results in modification or loss of one or more biological
functions of
the protein, other functional activities (e.g., biological activities, ability
to
multimerize, ability to bind TRIAL ligand) may still be retained. For example,
the
ability of the shortened protein to induce and/or bind to antibodies which
recognize the complete or mature form of the TRID protein generally will be
retained when less than the majority of the residues of the complete protein
or
1 S extracellular domain are removed from the N-terminus. Whether a particular
polypeptide lacking N-terminal residues of a complete protein retains such
immunologic activities can readily be determined by routine methods described
herein and otherwise known in the art. TRID muteins with a large number of
deleted N-terminal amino acid residues are expected to retain some biological
or
immunogenic activities. In fact, peptides composed of as few as six TRID amino
acid residues may often evoke an immune response.
Accordingly, the present invention further provides polypeptides having
one or more residues deleted from the amino terminus of the amino acid
sequence
shown in SEQ ID N0:2, up to the cysteine residue in each which is at position
number 53, and polynucleotides encoding such polypeptides. In particular, the
present invention provides TRID polypeptides comprising, or alternatively
consisting of, the amino acid sequence of residues n'-259 of SEQ ID N0:2 where
n' is an integer in the range of 1-53 where 53 is the position of the first
cysteine
residue from the N-terminus of the complete TRID polypeptide (shown in SEQ
ID N0:2) believed to be required for activity of the TRID protein.
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-54-
More in particular, the invention provides polynucleotides encoding
polypeptides having the amino acid sequence of residues: M-1 to V-259; A-2 to
V-259; R-3 to V-259; I-4 to V-259; P-5 to V-259; K-6 to V-259; T-7 to V-259;
L-8 to V-259; K-9 to V-259; F-10 to V-259; V-11 to V-259; V-12 to V-259; V-
13 to V-259; I-14 to V-259; V-15 to V-259; A-16 to V-259; V-17 to V-259; L-
18 to V-259; L-19 to V-259; P-20 to V-259; V-21 to V-259; L-22 to V-259; A-
23 to V-259; Y-24 to V-259; S-25 to V-259; A-26 to V-259; T-27 to V-259; T-
28 to V-259; A-29 to V-259; R-30 to V-259; Q-31 to V-259; E-32 to V-259; E-
33 to V-259; V-34 to V-259; P-35 to V-259; Q-36 to V-259; Q-37 to V-259; T-
38 to V-259; V-39 to V-259; A-40 to V-259; P-41 to V-259; Q-42 to V-259; Q-
43 to V-259; Q-44 to V-259; R-45 to V-259; H-46 to V-259; S-47 to V-259; F-
48 to V-259; K-49 to V-259; G-50 to V-259; E-51 to V-259; E-52 to V-259;
and/or C-53 to V-259 of SEQ ID N0:2. Polynucleotides encoding these
polypeptides also are provided.
The present invention is also directed to nucleic acid molecules
comprising, or alternatively consisting of, a polynucleotide sequence at least
80%,
85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to the polynucleotide
sequences encoding the polypeptides described above. The invention is further
directed to nucleic acid molecules comprising, or alternatively consisting of,
polynucleotide sequences which encode polypeptides that are at least 80%, 85%,
90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to the polypeptides described
above. The present invention also encompasses the above polynucleotide
sequences fused to a heterologous polynucleotide sequence. Polypeptides
encoded by these polynucleotides are also encompassed by the invention.
Similarly, the present invention further provides polypeptides having one
or more residues deleted from the amino terminus of the TRID amino acid
sequence shown in SEQ ID N0:2, up to the leucine residue at position number
255 and polynucleotides encoding such polypeptides. In particular, the present
invention provides polypeptides comprising, or alternatively consisting of,
the
amino acid sequence of residues n'-259 of SEQ ID N0:2, where n' is an integer
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-55-
from 2 to 254 corresponding to the position of the amino acid residue in SEQ
ID
N0:2.
More in particular, the invention provides polynucleotides encoding
polypeptides comprising, or alternatively consisting of, the amino acid
sequence
of residues of A-2 to V-259; R-3 to V-259; I-4 to V-259; P-5 to V-259; K-6 to
V-259; T-7 to V-259; L-8 to V-259; K-9 to V-259; F-10 to V-259; V-11 to V-
259; V-12 to V-259; V-13 to V-259; I-14 to V-259; V-15 to V-259; A-16 to V-
259; V-17 to V-259; L-18 to V-259; L-19 to V-259; P-20 to V-259; V-21 to V-
259; L-22 to V-259; A-23 to V-259; Y-24 to V-259; S-25 to V-259; A-26 to V-
259; T-27 to V-259; T-28 to V-259; A-29 to V-259; R-30 to V-259; Q-31 to V-
259; E-32 to V-259; E-33 to V-259; V-34 to V-259; P-35 to V-259; Q-36 to V-
259; Q-37 to V-259; T-38 to V-259; V-39 to V-259; A-40 to V-259; P-41 to V-
259; Q-42 to V-259; Q-43 to V-259; Q-44 to V-259; R-45 to V-259; H-46 to V-
259; S-47 to V-259; F-48 to V-259; K-49 to V-259; G-50 to V-259; E-51 to V-
259; E-52 to V-259; C-53 to V-259; P-54 to V-259; A-55 to V-259; G-56 to V-
259; S-57 to V-259; H-58 to V-259; R-59 to V-259; S-60 to V-259; E-61 to V-
259; H-62 to V-259; T-63 to V-259; G-64 to V-259; A-65 to V-259; C-66 to V-
259; N-67 to V-259; P-68 to V-259; C-69 to V-259; T-70 to V-259; E-71 to V-
259; G-72 to V-259; V-73 to V-259; D-74 to V-259; Y-75 to V-259; T-76 to V-
259; N-77 to V-259; A-78 to V-259; S-79 to V-259; N-80 to V-259; N-81 to V-
259; E-82 to V-259; P-83 to V-259; S-84 to V-259; C-85 to V-259; F-86 to V-
259; P-87 to V-259; C-88 to V-259; T-89 to V-259; V-90 to V-259; C-91 to V-
259; K-92 to V-259; S-93 to V-259; D-94 to V-259; Q-95 to V-259; K-96 to V-
259; H-97 to V-259; K-98 to V-259; S-99 to V-259; S-100 to V-259; C-101 to
V-259; T-102 to V-259; M-103 to V-259; T-104 to V-259; R-105 to V-259; D-
106 to V-259; T-107 to V-259; V-108 to V-259; C-109 to V-259; Q-110 to V-
259; C-111 to V-259; K-112 to V-259; E-113 to V-259; G-114 to V-259; T-115
to V-259; F-116 to V-259; R-117 to V-259; N-118 to V-259; E-119 to V-259;
N-120 to V-259; S-121 to V-259; P-122 to V-259; E-123 to V-259; M-124 to V-
259; C-125 to V-259; R-126 to V-259; K-127 to V-259; C-128 to V-259; S-129
to V-259; R-130 to V-259; C-131 to V-259; P-132 to V-259; S-133 to V-259;
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-56-
G-134 to V-259; E-135 to V-259; V-136 to V-259; Q-137 to V-259; V-138 to
V-259; S-139 to V-259; N-140 to V-259; C-141 to V-259; T-142 to V-259; S-
143 to V-259; W-144 to V-259; D-145 to V-259; D-146 to V-259; I-147 to V-
259; Q-148 to V-259; C-149 to V-259; V-150 to V-259; E-151 to V-259; E-152
to V-259; F-153 to V-259; G-154 to V-259; A-155 to V-259; N-156 to V-259;
A-157 to V-259; T-158 to V-259; V-159 to V-259; E-160 to V-259; T-161 to V-
259; P-162 to V-259; A-163 to V-259; A-164 to V-259; E-165 to V-259; E-166
to V-259; T-167 to V-259; M-168 to V-259; N-169 to V-259; T-170 to V-259;
S-171 to V-259; P-172 to V-259; G-173 to V-259; T-174 to V-259; P-175 to V-
259; A-176 to V-259; P-177 to V-259; A-178 to V-259; A-179 to V-259; E-180
to V-259; E-181 to V-259; T-182 to V-259; M-183 to V-259; N-184 to V-259;
T-185 to V-259; S-186 to V-259; P-187 to V-259; G-188 to V-259; T-189 to V-
259; P-190 to V-259; A-191 to V-259; P-192 to V-259; A-193 to V-259; A-194
to V-259; E-195 to V-259; E-196 to V-259; T-197 to V-259; M-198 to V-259;
T-199 to V-259; T-200 to V-259; S-201 to V-259; P-202 to V-259; G-203 to V-
259; T-204 to V-259; P-205 to V-259; A-206 to V-259; P-207 to V-259; A-208
to V-259; A-209 to V-259; E-210 to V-259; E-211 to V-259; T-212 to V-259;
M-213 to V-259; T-214 to V-259; T-215 to V-259; S-216 to V-259; P-217 to V-
259; G-218 to V-259; T-219 to V-259; P-220 to V-259; A-221 to V-259; P-222
to V-259; A-223 to V-259; A-224 to V-259; E-225 to V-259; E-226 to V-259;
T-227 to V-259; M-228 to V-259; T-229 to V-259; T-230 to V-259; S-231 to V-
259; P-232 to V-259; G-233 to V-259; T-234 to V-259; P-235 to V-259; A-236
to V-259; S-237 to V-259; S-238 to V-259; H-239 to V-259; Y-240 to V-259;
L-241 to V-259; S-242 to V-259; C-243 to V-259; T-244 to V-259; I-245 to V-
259; V-246 to V-259; G-247 to V-259; I-248 to V-259; I-249 to V-259; V-250
to V-259; L-251 to V-259; I-252 to V-259; V-253 to V-259; and/or L-254 to V-
259; of the TRID sequence shown in SEQ ID N0:2. Polypeptides encoded by
these polynucleotides are also encompassed by the invention.
The present invention is also directed to nucleic acid molecules
comprising, or alternatively consisting of, a polynucleotide sequence at least
80%,
85%, 90%, 92%, 95%, 96%. 97%, 98%, or 99% identical to the polynucleotide
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-57-
sequences encoding the polypeptides described above. The invention is further
directed to nucleic acid molecules comprising, or alternatively consisting of,
polynucleotide sequences which encode polypeptides that are at least 80%, 85%,
90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to the polypeptides described
above. The present invention also encompasses the above polynucleotide
sequences fused to a heterologous polynucleotide sequence. Polypeptides
encoded by these polynucleotides are also encompassed by the invention.
Similarly, many examples of biologically functional C-terminal deletion
muteins are known. For instance, interferon gamma shows up to ten times higher
activities by deleting 8-10 amino acid residues from the carboxy terminus of
the
protein (Dobeli et al., J. Biotechnology 7:199-216 (1988)). In the present
case,
since the protein of the invention is a member of the TNFR polypeptide family,
deletions of C-terminal amino acids up to the cysteine at position 149 of SEQ
ID
N0:2, may retain some biological activity such as regulation of proliferation
and
apoptosis of lymphoid cells. Polypeptides having further C-terminal deletions
including the cysteine at position 149 of SEQ ID N0:2 would not be expected to
retain such biological activities because it is known that this residue in TNF
receptor-related polypeptides is required for forming a disulfide bridge to
provide
structural stability which is needed for ligand binding.
Also as mentioned above, even if deletion of one or more amino acids from
the C-terminus of a protein results in modification or loss of one or more
biological functions of the protein, other functional activities (e.g.,
biological
activities, ability to multimerize, ability to bind TRID ligand) may still be
retained.
Thus, the ability of the shortened protein to induce and/or bind to antibodies
which
recognize the complete or mature form of the protein generally will be
retained
when less than the majority of the residues of the complete or mature form
protein
are removed from the C-terminus. Whether a particular polypeptide lacking
C-terminal residues of a complete protein retains such immunologic activities
can
readily be determined by routine methods described herein and otherwise known
in the art. TRID muteins with a large number of deleted C-terminal amino acid
residues are expected to retain some biological or immunogenic activities. In
fact,
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-58-
peptides composed of as few as six TRID amino acid residues may often evoke
an immune response.
Accordingly, the present invention further provides polypeptides having
one or more residues from the carboxy terminus of the amino acid sequence of
TRID shown in SEQ ID N0:2 up to the cysteine at position 149 of SEQ ID
N0:2, and polynucleotides encoding such polypeptides. In particular, the
present
invention provides polypeptides having the amino acid sequence of residues 1-
m'
of the amino acid sequence in SEQ ID N0:2, where m' is any integer in the
range
of 149-259. Polynucleotides encoding these polypeptides also. are provided.
More in particular, the invention provides polynucleotides encoding
polypeptides comprising, or alternatively consisting of, the amino acid
sequence
of residues: M-1 to V-259; M-1 to F-258; M-I to V-257; M-1 to I-256; M-1 to
L-255; M-1 to L-254; M-1 to V-253; M-1 to I-252; M-1 to L-251; M-I to V-250;
M-1 to I-249; M-I to I-248; M-1 to G-247; M-1 to V-246; M-1 to I-245; M-1 to
T-244; M-1 to C-243; M-1 to S-242; M-1 to L-241; M-1 to Y-240; M-1 to H-
239; M-1 to S-238; M-1 to S-237; M-1 to A-236; M-I to P-235; M-1 to T-234;
M-1 to G-233; M-1 to P-232; M-I to S-231; M-1 to T-230; M-1 to T-229; M-1
to M-228; M-1 to T-227; M-1 to E-226; M-1 to E-225; M-1 to A-224; M-1 to A-
223; M-1 to P-222; M-1 to A-221; M-1 to P-220; M-I to T-219; M-I to G-218;
M-1 to P-217; M-1 to S-216; M-1 to T-215; M-1 to T-214; M-1 to M-213; M-1
to T-212; M-1 to E-211; M-1 to E-210; M-1 to A-209; M-1 to A-208; M-1 to P-
207; M-1 to A-206; M-1 to P-205; M-1 to T-204; M-1 to G-203; M-1 to P-202;
M-1 to S-201; M-1 to T-200; M-1 to T-199; M-1 to M-198; M-1 to T-197; M-1
to E-196; M-1 to E-195; M-1 to A-194; M-1 to A-193; M-1 to P-192; M-1 to A-
191; M-1 to P-190; M-1 to T-189; M-1 to G-188; M-I to P-187; M-1 to S-186;
M-1 to T-185; M-1 to N-184; M-1 to M-183; M-1 to T-182; M-1 to E-181; M-1
to E-180; M-1 to A-179; M-1 to A-178; M-1 to P-177; M-1 to A-176; M-1 to P-
175; M-1 to T-174; M-1 to G-173; M-1 to P-172; M-1 to S-171; M-1 to T-170;
M-1 to N-169; M-1 to M-168; M-1 to T-167; M-1 to E-166; M-1 to E-165; M-1
to A-164; M-1 to A-163; M-1 to P-162; M-1 to T-161; M-1 to E-160; M-1 to V-
159; M-1 to T-158; M-1 to A-157; M-1 to N-156; M-1 to A-155; M-I to G-154;
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-59-
M-1 to F-153; M-1 to E-152; M-1 to E-151; M-1 to V-150; and/or M-1 to C-149.
Polypeptides encoded by these polynucleotides are also encompassed by the
invention.
The present invention is also directed to nucleic acid molecules
comprising, or alternatively consisting of, a polynucleotide sequence at least
80%,
85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to the polynucleotide
sequences encoding the polypeptides described above. The invention is further
directed to nucleic acid molecules comprising, or alternatively consisting of,
polynucleotide sequences which encode polypeptides that are at least 80%, 85%,
90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to the polypeptides described
above. The present invention also encompasses the above polynucleotide
sequences fused to a heterologous polynucleotide sequence. Polypeptides
encoded by these polynucleotides are also encompassed by the invention.
The present invention further provides polypeptides having one or more
residues deleted from the carboxy terminus of the amino acid sequence of the
TRID polypeptide shown in SEQ ID N0:2, up to the lysine residue at position
number 6, and polynucleotides encoding such polypeptides. In particular, the
present invention provides polypeptides comprising, or alternatively
consisting of,
the amino acid sequence of residues 1-m'- of SEQ ID N0:2, where m' is an
integer
from 6 to 258 corresponding to the position of the amino acid residue in SEQ
ID
N0:2.
More in particular, the invention provides polynucleotides encoding
polypeptides comprising, or alternatively consisting of, the amino acid
sequence
of residues: M-1 to F-258; M-1 to V-257; M-1 to I-256; M-1 to L-255; M-1 to
L-254; M-1 to V-253; M-1 to I-252; M-1 to L-251; M-1 to V-250; M-1 to I-249;
M-1 to I-248; M-1 to G-247; M-1 to V-246; M-1 to I-245; M-1 to T-244; M-1
to C-243; M-1 to S-242; M-1 to L-241; M-1 to Y-240; M-1 to H-239; M-1 to 5-
238; M-1 to S-237; M-1 to A-236; M-1 to P-235; M-1 to T-234; M-1 to G-233;
M-1 to P-232; M-1 to S-231; M-1 to T-230; M-1 to T-229; M-1 to M-228; M-1
to T-227; M-1 to E-226; M-1 to E-225; M-1 to A-224; M-1 to A-223; M-1 to P-
222; M-I to A-221; M-1 to P-220; M-1 to T-219; M-1 to G-218; M-1 to P-217;
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-60-
M-1 to S-216; M-1 to T-215; M-I to T-214; M-1 to M-213; M-1 to T-212; M-1
to E-211; M-1 to E-210; M-1 to A-209; M-1 to A-208; M-I to P-207; M-1 to A-
206; M-I to P-205; M-1 to T-204; M-1 to G-203; M-1 to P-202; M-1 to S-201;
M-I to T-200; M-1 to T-199; M-1 to M-198; M-1 to T-197; M-1 to E-196; M-I
to E-195; M-1 to A-194; M-1 to A-193; M-I to P-192; M-1 to A-191; M-1 to P-
190; M-1 to T-189; M-1 to G-188; M-1 to P-187; M-1 to S-186; M-1 to T-185;
M-1 to N-184; M-1 to M-183; M-1 to T-182; M-1 to E-181; M-1 to E-180; M-1
to A-179: M-1 to A-178; M-1 to P-177; M-1 to A-176; M-1 to P-175; M-1 to T-
174; M-1 to G-173; M-1 to P-172; M-1 to S-171; M-1 to T-170; M-1 to N-169;
M-1 to M-168; M-1 to T-167; M-1 to E-166; M-1 to E-165; M-1 to A-164; M-1
to A-163; M-I to P-162; M-I to T-161; M-I to E-160; M-1 to V-159; M-1 to T-
158; M-1 to A-157; M-1 to N-156; M-1 to A-I55; M-1 to G-154; M-1 to F-153;
M-1 to E-152; M-1 to E-I51; M-1 to V-I50; M-I to C-149; M-1 to Q-148; M-1
to I-147; M-1 to D-146; M-1 to D-145; M-1 to W-144; M-1 to S-143; M-I to T-
142; M-1 to C-141; M-I to N-140; M-1 to S-139; M-1 to V-138; M-1 to Q-137;
M-1 to V-136; M-1 to E-135; M-1 to G-134; M-1 to S-133; M-1 to P-132; M-1
to C-131; M-1 to R-130; M-1 to S-129; M-1 to C-128; M-I to K-127; M-1 to 8-
126; M-I to C-125; M-I to M-124; M-1 to E-123; M-I to P-122; M-1 to S-121;
M-1 to N-120; M-I to E-119; M-1 to N-118; M-1 to R-117; M-1 to F-116; M-I
to T-115; M-1 to G-114; M-1 to E-113; M-1 to K-112; M-1 to C-1 I I; M-1 to Q-
I 10; M-1 to C-109; M-1 to V-108; M-I to T-107; M-1 to D-106; M-I to R-105;
M-1 to T-104; M-1 to M-103; M-1 to T-102; M-1 to C-101; M-1 to S-100; M-1
to S-99; M-1 to K-98; M-1 to H-97; M-I to K-96; M-1 to Q-95; M-1 to D-94;
M-1 to S-93; M-I to K-92; M-1 to C-91; M-1 to V-90; M-1 to T-89; M-1 to C-
88; M-1 to P-87; M-1 to F-86; M-1 to C-85; M-1 to S-84; M-I to P-83; M-1 to
E-82; M-1 to N-81; M-1 to N-80; M-I to S-79; M-I to A-78; M-1 to N-77; M-1
to T-76; M-1 to Y-75; M-I to D-74; M-1 to V-73; M-1 to G-72; M-I to E-71;
M-I to T-70; M-I to C-69; M-1 to P-68; M-1 to N-67; M-1 to C-66; M-1 to A-
65; M-1 to G-64; M-1 to T-63; M-1 to H-62; M-1 to E-61; M-I to S-60; M-1 to
R-59; M-1 to H-58; M-1 to S-57; M-1 to G-56; M-1 to A-55; M-1 to P-54; M-1
to C-53; M-1 to E-52; M-1 to E-51; M-1 to G-50; M-1 to K-49; M-I to F-48; M-
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-61 -
I to S-47; M-1 to H-46; M-1 to R-45; M-1 to Q-44; M-1 to Q-43; M-1 to Q-42;
M-I to P-41; M-1 to A-40; M-1 to V-39; M-I to T-38; M-1 to Q-37; M-1 to Q-
36; M-1 to P-35; M-1 to V-34; M-1 to E-33; M-I to E-32; M-I to Q-31; M-I to
R-30; M-1 to A-29; M-1 to T-28; M-1 to T-27; M-1 to A-26; M-1 to S-25; M-I
to Y-24; M-1 to A-23; M-1 to L-22; M-1 to V-21; M-1 to P-20; M-1 to L-19; M-
1 to L-18; M-1 to V-17; M-1 to A-16; M-1 to V-15; M-1 to I-14; M-1 to V-13;
M-I to V-12; M-I to V-11; M-I to F-10; M-1 to K-9; M-1 to L-8; M-1 to T-7;
and/or M-1 to K-6; of the TRID sequence shown in SEQ ID N0:2. Polypeptides
encoded by these polynucleotides are also encompassed by the invention.
The present invention is also directed to nucleic acid molecules
comprising, or alternatively consisting of, a polynucleotide sequence at least
80%,
85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to the polynucleotide
sequences encoding the polypeptides described above. The invention is further
directed to nucleic acid molecules comprising, or alternatively consisting of,
polynucleotide sequences which encode polypeptides that are at least 80%, 85%,
90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to the polypeptides described
above. The present invention also encompasses the above polynucleotide
sequences fused to a heterologous polynucleotide sequence. Polypeptides
encoded by these polynucleotides are also encompassed by the invention.
Similarly, the present invention further provides polypeptides having one
or more residues deleted from the carboxy terminus of the amino acid sequence
of the extracellular domain of the TRID polypeptide shown in SEQ ID N0:2, up
to the glutamine residue at position number 33, and polynucleotides encoding
such
polypeptides. In particular, the present invention provides polypeptides
comprising, or alternatively consisting of, the amino acid sequence of
residues
27-m3 of SEQ ID N0:2, where m' is an integer from 33 to 259 corresponding to
the position of the amino acid residue in SEQ ID N0:2.
More in particular, the invention provides polynucleotides encoding
polypeptides comprising, or alternatively consisting of, the amino acid
sequence
of residues: T-27 to F-258; T-27 to V-257; T-27 to I-256; T-27 to L-255; T-27
to L-254; T-27 to V-253; T-27 to I-252; T-27 to L-251; T-27 to V-250; T-27 to
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-62-
I-249; T-27 to I-248; T-27 to G-247; T-27 to V-246; T-27 to I-245; T-27 to T-
244; T-27 to C-243; T-27 to S-242; T-27 to L-241; T-27 to Y-240; T-27 to H-
239; T-27 to S-238; T-27 to S-237; T-27 to A-236; T-27 to P-235; T-27 to T-
234; T-27 to G-233; T-27 to P-232; T-27 to S-231; T-27 to T-230; T-27 to T-
229; T-27 to M-228; T-27 to T-227; T-27 to E-226; T-27 to E-225; T-27 to A-
224; T-27 to A-223; T-27 to P-222; T-27 to A-221; T-27 to P-220; T-27 to T-
219; T-27 to G-218; T-27 to P-217; T-27 to S-216; T-27 to T-215; T-27 to T-
214; T-27 to M-213; T-27 to T-212; T-27 to E-211; T-27 to E-210; T-27 to A-
209; T-27 to A-208; T-27 to P-207; T-27 to A-206; T-27 to P-205; T-27 to T-
204; T-27 to G-203; T-27 to P-202; T-27 to S-201; T-27 to T-200; T-27 to T-
199; T-27 to M-198; T-27 to T-197; T-27 to E-196; T-27 to E-195; T-27 to A-
194; T-27 to A-193; T-27 to P-192; T-27 to A-191; T-27 to P-190; T-27 to T-
189; T-27 to G-188; T-27 to P-187; T-27 to S-186; T-27 to T-185; T-27 to N-
184; T-27 to M-183; T-27 to T-182; T-27 to E-181; T-27 to E-180; T-27 to A-
179; T-27 to A-178; T-27 to P-177; T-27 to A-176; T-27 to P-175; T-27 to T-
174; T-27 to G-173; T-27 to P-172; T-27 to S-171; T-27 to T-170; T-27 to N-
169; T-27 to M-168; T-27 to T-167; T-27 to E-166; T-27 to E-165; T-27 to A-
164; T-27 to A-163; T-27 to P-162; T-27 to T-161; T-27 to E-160; T-27 to V-
159; T-27 to T-158; T-27 to A-157; T-27 to N-156; T-27 to A-155; T-27 to G-
154; T-27 to F-153; T-27 to E-152; T-27 to E-151; T-27 to V-150; T-27 to C-
149; T-27 to Q-148; T-27 to I-147; T-27 to D-146; T-27 to D-145; T-27 to W-
144; T-27 to S-143; T-27 to T-142; T-27 to C-141; T-27 to N-140; T-27 to 5-
139; T-27 to V-138; T-27 to Q-137; T-27 to V-136; T-27 to E-135; T-27 to 6-
134; T-27 to S-133; T-27 to P-132; T-27 to C-131; T-27 to R-130; T-27 to S-
129; T-27 to C-128; T-27 to K-127; T-27 to R-126; T-27 to C-125; T-27 to M-
124; T-27 to E-123; T-27 to P-122; T-27 to S-121; T-27 to N-120; T-27 to E-
119; T-27 to N-118; T-27 to R-117; T-27 to F-116; T-27 to T-I 15; T-27 to 6-
114; T-27 to E-113; T-27 to K-112; T-27 to C-111; T-27 to Q-110; T-27 to C-
109; T-27 to V-108; T-27 to T-107; T-27 to D-106; T-27 to R-105; T-27 to T-
104; T-27 to M-103; T-27 to T-102; T-27 to C-101; T-27 to S-100; T-27 to S-99;
T-27 to K-98; T-27 to H-97; T-27 to K-96; T-27 to Q-95; T-27 to D-94; T-27 to
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-63-
S-93; T-27 to K-92; T-27 to C-91; T-27 to V-90; T-27 to T-89; T-27 to C-88; T-
27 to P-87; T-27 to F-86; T-27 to C-85; T-27 to S-84; T-27 to P-83; T-27 to E-
82; T-27 to N-81; T-27 to N-80; T-27 to S-79; T-27 to A-78; T-27 to N-77; T-27
to T-76; T-27 to Y-75; T-27 to D-74; T-27 to V-73; T-27 to G-72; T-27 to E-71;
T-27 to T-70; T-27 to C-69; T-27 to P-68; T-27 to N-67; T-27 to C-66; T-27 to
A-65; T-27 to G-64; T-27 to T-63; T-27 to H-62; T-27 to E-61; T-27 to S-60; T-
27 to R-59; T-27 to H-58; T-27 to S-57; T-27 to G-56; T-27 to A-55; T-27 to P-
54; T-27 to C-53; T-27 to E-52; T-27 to E-51; T-27 to G-50; T-27 to K-49; T-27
to F-48; T-27 to S-47; T-27 to H-46; T-27 to R-45; T-27 to Q-44; T-27 to Q-43;
T-27 to Q-42; T-27 to P-41; T-27 to A-40; T-27 to V-39; T-27 to T-38; T-27 to
Q-37; T-27 to Q-36; T-27 to P-35; T-27 to V-34; and/or T-27 to E-33; of the
TRID extracellular domain sequence shown in SEQ ID N0:2. Polypeptides
encoded by these polynucleotides are also encompassed by the invention.
The present invention is also directed to nucleic acid molecules
comprising, or alternatively consisting of, a polynucleotide sequence at least
80%,
85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to the polynucleotide
sequences encoding the polypeptides described above. The invention is further
directed to nucleic acid molecules comprising, or alternatively consisting of,
polynucleotide sequences which encode polypeptides that are at least 80%, 85%,
90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to the polypeptides described
above. The present invention also encompasses the above polynucleotide
sequences fused to a heterologous polynucleotide sequence. Polypeptides
encoded by these polynucleotides are also encompassed by the invention.
The invention also provides polypeptides having one or more amino acids
deleted from both the amino and the carboxyl termini, which may be described
generally as having residues n'-m', n'-m', n'-mz, nz-m', n'-m3, or nZ-m3 of
SEQ ID
N0:2, where n', n', m', m'-, and m3 are integers as described above.
Also included are a nucleotide sequence encoding a polypeptide consisting
of a portion of a complete TRID amino acid sequence encoded by a cDNA clone
contained in ATCC Deposit No. 97798, where this portion excludes from 1 to
about 49 amino acids from the amino terminus of the complete amino acid
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-64-
sequence encoded by the cDNA clone contained in ATCC Deposit No. 97798, or
from 1 to about 110 amino acids from the carboxy terminus of the complete
amino
acid sequence encoded by the cDNA clone contained in ATCC Deposit No.
97798, or any combination of the above amino terminal and carboxy terminal
, deletions, of the complete amino acid sequence encoded by the cDNA clone
contained in ATCC Deposit No. 97798. Polynucleotides encoding all of the
above deletion mutant polypeptide forms also are provided.
Outer Mutants
In addition to terminal deletion forms of the protein discussed above, it
will also be recognized by one of ordinary skill in the art that some amino
acid
sequences of the TRID polypeptide can be varied without significant effect on
the
structure or function of the proteins. If such differences in sequence are
contemplated, it should be remembered that there will be critical areas on the
protein which determine activity. Thus, the invention further includes
variations
of the TRID polypeptide, which show substantial TRID polypeptide activity or
which include regions of TRID protein such as the protein portions discussed
below. Such mutants include deletions, insertions, inversions, repeats, and
type
substitutions. Guidance concerning which amino acid changes are likely to be
phenotypically silent can be found in Bowie, J. U. et al., "Deciphering the
Message
in Protein Sequences: Tolerance to Amino Acid Substitutions," Science
247:1306-1310 (1990).
Thus, the fragment, derivative, or analog of the polypeptide of SEQ ID
N0:2, or that encoded by the deposited cDNA, may be: (i) one in which one or
more of the amino acid residues are substituted with a conserved or non-
conserved amino acid residue (preferably a conserved amino acid residue(s),
and
more preferably at least one but less than ten conserved amino acid
residue(s)),
and such substituted amino acid residues) may or may not be one encoded by the
genetic code; or (ii) one in which one or more of the amino acid residues
includes
a substituent group;or (iii) one in which the mature or soluble extracellular
polypeptide is fused with another compound, such as a compound to increase the
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-65-
half life of the polypeptide (for example, polyethylene glycol); or (iv) one
in which
the additional amino acids are fused to the mature polypeptide, such as an IgG
Fc
fusion region peptide or leader or secretory sequence or a sequence which is
employed for purification of the mature polypeptide or a proprotein sequence.
Such fragments, derivatives and analogs are deemed to be within the scope of
those skilled in the art from the teachings herein.
Thus, the TRID of the present invention may include one or more amino
acid substitutions, deletions or additions, either from natural mutations or
human
manipulation. As indicated, changes are preferably of a minor nature, such as
conservative amino acid substitutions that do not significantly affect the
folding
or activity of the protein (see Table 2).
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-66-
TABLE 2. Conservative Amino Acid Substitutions
Aromatic Phenylalanine
Tryptophan
Tyrosine
Hydrophobic Leucine
Isoleucine
Valine
Polar Glutamine
Asparagine
Basic Arginine
Lysine
Histidine
Acidic Aspartic Acid
Glutamic Acid
Small Alanine
Serine
Threonine
Methionine
Glycine
In specific embodiments, the number of substitutions, additions or
deletions in the amino acid sequence of SEQ ID N0:2 and/or any of the
polypeptide fragments described herein (e.g., the extracellular domain or
transmembrane domain) is 75, 70, 60, 50, 40, 35, 30, 25, 20, 15, 10, 9, 8, 7,
6, 5,
4, 3, 2, 1 or 30-20, 20-15, 20-10, 15-10, 10-l, 5-10, 1-5, 1-3 or 1-2.
Amino acids in the TRID protein of the present invention that are essential
for function can be identified by methods known in the art, such as site-
directed
mutagenesis or alanine-scanning mutagenesis (Cunningham and Wells, Science
244:1081-1085 (1989)). The latter procedure introduces single alanine
mutations
at every residue in the molecule. The resulting mutant molecules are then
tested
for biological activity such as receptor binding or in vitro proliferative
activity.
Of particular interest are substitutions of charged amino acids with another
charged amino acids and with neutral or negatively charged amino acids. The
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-67-
latter results in proteins with reduced positive charge to improve the
characteristics of the TRID protein. The prevention of aggregation is highly
desirable. Aggregation of proteins not only results in a loss of activity but
can also
be problematic when preparing pharmaceutical formulations, because they can be
immunogenic. (Pinckard et al., Clin Exp. Immunol. 2:331-340 (1967); Robbins
et al., Diabetes 36:838-845 (1987); Cleland et al., Crit. Rev. Therapeutic
Drug
Carrier Systems 10:307-377 (1993)).
The replacement of amino acids can also change the selectivity of binding
of a ligand to cell surface receptors. For example, Ostade et al., Nature
361:266-
268 (1993), describes certain mutations resulting in selective binding of TNF-
a,
to only one of the two known types of TNF receptors. Sites that are critical
for
ligand-receptor binding can also be determined by structural analysis such as
crystallization, nuclear magnetic resonance or photoaffinity labeling (Smith
et al.,
J. Mol. Biol. 224:899-904 (1992) and de Vos et al., Science 255:306-312
( 1992)).
Non-naturally occurring variants may be produced using art-known
mutagenesis techniques, which include, but are not limited to oligonucleotide
mediated mutagenesis, alanine scanning, PCR mutagenesis, site directed
mutagenesis (see e.g., Carter et al., Nucl. Acids Res. 13:4331 (1986); and
Zoller
et al., Nucl. Acids Res. 10:6487 (1982)), cassette mutagenesis (see e.g.,
Wells et
al., Gene 34:315 (1985)), restriction selection mutagenesis (see e.g., Wells
etal.,
Philos. Traps. R. Soc. London SerA 317:415 ( 1986)).
Thus, the invention also encompasses TRID derivatives and analogs that
have one or more amino acid residues deleted, added, or substituted to
generate
TRID polypeptides that are better suited for expression, scale up, etc., in
the host
cells chosen. For example, cysteine residues can be deleted or substituted
with
another amino acid residue in order to eliminate disulfide bridges; N-linked
glycosylation sites can be altered or eliminated to achieve, for example,
expression
of a homogeneous product that is more easily recovered and purified from yeast
hosts which are known to hyperglycosylate N-linked sites. To this end, a
variety
of amino acid substitutions at one or both of the first or third amino acid
positions
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-68-
on any one or more of the glycosylation recognitions sequences in the TRID
polypeptides of the invention, and/or an amino acid deletion at the second
position
of any one or more such recognition sequences will prevent glycosylation of
the
TRID at the modified tripeptide sequence (see, e.g., Miyajimo et al., EMBO J
5(6):1193-1197).
The present inventors have discovered that the TRID polypeptide is a 259
residue protein exhibiting two main structural domains. First, the
extracellular
TRAIL ligand binding domain was identified within residues from about 27 to
about 240 in SEQ ID N0:2. Second, the transmembrane domain was identified
within residues from about 241 to about 259 in SEQ ID N0:2. As mentioned
above, however, TRID, surprisingly lacks a putative intracellular signalling
domain, thus, the name "TRID" (TRAIL Receptor Without an Intracellular
Domain").
The polypeptides of the present invention include the polypeptide encoded
by the deposited cDNA including the leader; the mature polypeptide encoded by
the deposited the cDNA minus the leader (i.e., the mature protein); a
polypeptide
comprising, or alternatively consisting of, amino acids about 1 to about 259
in
SEQ ID N0:2; a polypeptide comprising, or alternatively consisting of amino
acids about 2 to about 259 in SEQ ID N0:2 as well as polypeptides which are at
least 80% identical, more preferably at least 90% or 95% identical, still more
preferably at least 96%, 97%, 98%, or 99% identical to the polypeptides
described
above, and also include portions of such polypeptides with at least 30 amino
acids
and more preferably at least 50 amino acids.
By a polypeptide having an amino acid sequence at least, for example,
95% "identical" to a reference amino acid sequence of a TRID polypeptide is
intended that the amino acid sequence of the polypeptide is identical to the
reference sequence except that the polypeptide sequence may include up to five
amino acid alterations per each 100 amino acids of the reference amino acid of
the
TRID polypeptide. In other words, to obtain a polypeptide having an amino acid
sequence at least 95% identical to a reference amino acid sequence, up to 5%
of
the amino acid residues in the reference sequence may be deleted or
substituted
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-69-
with another amino acid, or a number of amino acids up to 5% of the total
amino
acid residues in the reference sequence may be inserted into the reference
sequence. These alterations of the reference sequence may occur at the amino
or
carboxy terminal positions of the reference amino acid sequence or anywhere
between those terminal positions, interspersed either individually among
residues
in the reference sequence or in one or more contiguous groups within the
reference sequence.
As a practical matter, whether any particular polypeptide is at least 90%,
95%, 96%, 97%, 98% or 99% identical to, for instance, the amino acid sequence
shown in SEQ ID N0:2, or to the amino acid sequence encoded by the deposited
cDNA clone, can be determined conventionally using known computer programs
such the Bestfit program (Wisconsin Sequence Analysis Package, Version 8 for
Unix, Genetics Computer Group, University Research Park, 575 Science Drive,
Madison, WI 53711). When using Bestfit or any other sequence alignment
program to determine whether a particular sequence is, for instance, 95%
identical
to a reference sequence according to the present invention, the parameters are
set,
of course, such that the percentage of identity is calculated over the full
length of
the reference amino acid sequence and that gaps in homology of up to 5% of the
total number of amino acid residues in the reference sequence are allowed.
In a specific embodiment, the identity between a reference (query)
sequence (a sequence of the present invention) and a subject sequence, also
referred to as a global sequence alignment, is determined using the FASTDB
computer program based on the algorithm of Brutlag et al. (Comp. App. Biosci.
6:237-245 (1990)). Preferred parameters used in a FASTDB amino acid
alignment are: Matrix=PAM 0, k-tuple=2, Mismatch Penalty=1, Joining
Penalty=20, Randomization Group Length=0, Cutoff Score=l, Window
Size=sequence length, Gap Penalty=5, Gap Size Penalty=0.05, Window Size=500
or the length of the subj ect amino acid sequence, whichever is shorter.
According
to this embodiment, if the subject sequence is shorter than the query sequence
due
to N- or C-terminal deletions, not because of internal deletions, a manual
correction is made to the results to take into consideration the fact that the
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-70-
FASTDB program does not account for N- and C-terminal truncations of the
subject sequence when calculating global percent identity. For subject
sequences
truncated at the N- and C-termini, relative to the query sequence, the percent
identity is corrected by calculating the number of residues of the query
sequence
that are N- and C-terminal of the subject sequence, which are not
matched/aligned
with a corresponding subject residue, as a percent of the total bases of the
query
sequence. A determination of whether a residue is matched/aligned is
determined
by results of the FASTDB sequence alignment. This percentage is then
subtracted
from the percent identity, calculated by the above FASTDB program using the
specified parameters, to arrive at a final percent identity score. This final
percent
identity score is what is used for the purposes of this embodiment. Only
residues
to the N- and C-termini of the subject sequence, which are not matched/aligned
with the query sequence, are considered for the purposes of manually adjusting
the
percent identity score. That is, only query residue positions outside the
farthest
N- and C-terminal residues of the subj ect sequence. For example, a 90 amino
acid
residue subject sequence is aligned with a 100 residue query sequence to
determine percent identity. The deletion occurs at the N-terminus of the
subject
sequence and therefore, the FASTDB alignment does not show a
matching/alignment of the first 10 residues at the N-terminus. The 10 unpaired
residues represent 10% of the sequence (number of residues at the N- and C-
termini not matched/total number of residues in the query sequence) so 10% is
subtracted from the percent identity score calculated by the FASTDB program.
If the remaining 90 residues were perfectly matched the final percent identity
would be 90%. In another example, a 90 residue subject sequence is compared
with a 100 residue query sequence. This time the deletions are internal
deletions
so there are no residues at the N- or C-termini of the subject sequence which
are
not matched/aligned with the query. In this case the percent identity
calculated by
FASTDB is not manually corrected. Once again, only residue positions outside
the N- and C-terminal ends of the subject sequence, as displayed in the FASTDB
alignment, which are not matched/aligned with the query sequence are manually
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-71 -
corrected for. No other manual corrections are made for the purposes of this
embodiment.
The polypeptide of the present invention have uses which include, but are
not limited to, as sources for generating antibodies that bind the
polypeptides of
the invention, and as a molecular weight marker on SDS-PAGE gels or on
molecular sieve gel filtration columns using methods well known to those of
skill
in the art.
The present application is also directed to proteins containing polypeptides
at least 90%, 95%, 96%, 97%, 98% or 99% identical to the TRID polypeptide
sequence set forth herein as n'-259, nz-259,1-m', 1-m', I-m', n'-m', n'--m',
n'-m',
n'-m', n'-m3, or n'-m3 of SEQ ID N0:2, where n', n', m', m', and m3 are
integers
as described above. In preferred embodiments, the application is directed to
proteins containing polypeptides at least 90%, 95%, 96%, 97%, 98% or 99%
identical to polypeptides having the amino acid sequence of the specific TRID
N-
and C-terminal deletions recited herein. Polynucleotides encoding these
polypeptides are also encompassed by the invention.
In certain preferred embodiments, TRID proteins of the invention
comprise, or alternatively consist of, fusion proteins as described herein
wherein
the TRID polypeptides are those described as n'-259, n'--259,1-m', l-m'-, 1-
m3, n'-
m', n'-m', n'-m', n'-m', n'-m', or n'--m' of SEQ ID N0:2, where n', n2, m',
m',
and m' are integers as described above. In preferred embodiments, the
application
is directed to nucleic acid molecules at least 90%, 95%, 96%, 97%, 98% or 99%
identical to the nucleic acid sequences encoding polypeptides having the amino
acid sequence of the specific N- and C-terminal deletions recited herein.
Polynucleotides encoding these polypeptides are also encompassed by the
invention.
Epitope-Bearing Portions
The present invention encompasses polypeptides comprising, or
alternatively consisting of, an epitope of the polypeptide having an amino
acid
sequence of SEQ ID N0:2, or an epitope of the polypeptide sequence encoded by
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-72-
a polynucleotide sequence contained in the cDNA assigned ATCC Accession No.
97798, encoded by a polynucleotide that hybridizes to the complement of the
sequence of SEQ ID NO:1, or contained in the cDNA assigned ATCC Accession
No. 97798 under stringent hybridization conditions or lower stringency
hybridization conditions as defined supra. The present invention further
encompasses polynucleotide sequences encoding an epitope of a polypeptide
sequence of the invention (such as, for example, the sequence disclosed in SEQ
ID NO:1 ), polynucleotide sequences of the complementary strand of a
polynucleotide sequence encoding an epitope ofthe invention, and
polynucleotide
sequences which hybridize to the complementary strand under stringent
hybridization conditions or lower stringency hybridization conditions defined
supra.
The term "epitopes," as used herein, refers to portions of a polypeptide
having antigenic or immunogenic activity in an animal, preferably a mammal,
and
most preferably in a human. In a preferred embodiment, the present invention
encompasses a polypeptide comprising an epitope, as well as the polynucleotide
encoding this polypeptide. An "immunogenic epitope," as used herein, is
defined
as a portion of a protein that elicits an antibody response in an animal, as
determined by any method known in the art, for example, by the methods for
generating antibodies described infra. (See, for example, Geysen et al., Proc.
Natl. Acad. Sci. USA 81:3998-4002 (1983)). The term "antigenic epitope," as
used herein, is defined as a portion of a protein to which an antibody can
immunospecifically bind its antigen as determined by any method well known in
the art, for example, by the immunoassays described herein. Immunospecific
binding excludes non-specific binding but does not necessarily exclude cross-
reactivity with other antigens. Antigenic epitopes need not necessarily be
immunogenic.
Fragments that function as epitopes may be produced by any conventional
means. (See, e.g., Houghten, Proc. Natl. Acad. Sci. USA 82:5131-5135 (1985),
further described in U.S. Patent No. 4,631,211).
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-73-
Antigenic epitope-bearing peptides and polypeptides of the invention are
therefore useful to raise antibodies, including monoclonal antibodies, that
bind
specifically to a polypeptide of the invention. See, for instance, Wilson et
al., Cell
3 7:767-778 ( 1984) at 777.
In the present invention, antigenic epitopes preferably contain a sequence
of at least 4, at least 5, at least 6, at least 7, more preferably at least 8,
at least 9,
at least 10, at least 15, at least 20, at least 25, and, most preferably,
between about
to about 30 amino acids contained within the amino acid sequence of a
polypeptide ofthe invention. Preferred polypeptides comprising.immunogenic or
10 antigenic epitopes are at least 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60,
65, 70,
75, 80, 85, 90, 95, or 100 amino acid residues in length. Antigenic epitopes
are
useful, for example, to raise antibodies, including monoclonal antibodies,
that
specifically bind the epitope. Antigenic epitopes can be used as the target
molecules in immunoassays. (See, for instance, Wilson et al., Cell 37:767-778
15 ( 1984); Sutcliffe et al., Science 219:660-666 ( 1983)). Polynucleotides
encoding
these polypeptides are also encompassed by the invention.
Similarly, immunogenic epitopes can be used, for example, to induce
antibodies according to methods well known in the art. (See, for instance,
Sutcliffe et al., supra; Wilson et al., supra; Chow et al., Proc. Natl. Acad.
Sci.
USA 82:910-914; and Bittle et al., J. Gen. Virol. 66:2347-2354 (1985). A
preferred immunogenic epitope includes the secreted protein. The polypeptides
comprising one or more immunogenic epitopes may be presented for eliciting an
antibody response together with a carrier protein, such as an albumin, to an
animal
system (such as, for example, rabbit or mouse), or, if the polypeptide is of
sufficient length (at least about 25 amino acids), the polypeptide may be
presented
without a carrier. However, immunogenic epitopes comprising as few as 8 to 10
amino acids have been shown to be sufficient to raise antibodies capable of
binding
to, at the very least, linear epitopes in a denatured polypeptide (e.g., in
Western
blotting).
Epitope-bearing polypeptides of the present invention may be used to
induce antibodies according to methods well known in the art including, but
not
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-74-
limited to, in vivo immunization, in vitro immunization, and phage display
methods. See, e.g., Sutcliffe et al., supra; Wilson et al., supra, and Bittle
et al.,
J. Gen. virol., 66:2347-2354 (1985). If in vivo immunization is used, animals
may
be immunized with free peptide; however, anti-peptide antibody titer may be
boosted by coupling the peptide to a macromolecular carrier, such as keyhole
limpet hemacyanin (KLH) or tetanus toxoid. For instance, peptides containing
cysteine residues may be coupled to a carrier using a linker such as
maleimidobenzoyl-N-hydroxysuccinimide ester (MBS), while other peptides may
be coupled to carriers using a more general linking agent such as
glutaraldehyde.
Animals such as, for example, rabbits. rats, and mice are immunized with
either
free or carrier-coupled peptides, for instance, by intraperitoneal and/or
intradermal
injection of emulsions containing about 100 micrograms of peptide or carrier
protein and Freund's adjuvant or any other adjuvant known for stimulating an
immune response. Several booster injections may be needed, for instance, at
intervals of about two weeks, to provide a useful titer of anti-peptide
antibody that
can be detected, for example, by ELISA assay using free peptide adsorbed to a
solid surface. The titer of anti-peptide antibodies in serum from an immunized
animal may be increased by selection of anti-peptide antibodies, for instance,
by
adsorption to the peptide on a solid support and elution of the selected
antibodies
according to methods well known in the art.
As to the selection of peptides or polypeptides bearing an antigenic epitope
(i.e., that contain a region of a protein molecule to which an antibody can
bind),
it is well known in that art that relatively short synthetic peptides that
mimic part
of a protein sequence are routinely capable of eliciting an antiserum that
reacts
with the partially mimicked protein. See, for instance, Sutcliffe, J. G., et
al.,
"Antibodies That React With Predetermined Sites on Proteins," Science,
219:660-666 (1983). Peptides capable of eliciting protein-reactive sera are
frequently represented in the primary sequence of a protein, can be
characterized
by a set of simple chemical rules, and are confined neither to immunodominant
regions of intact proteins (i.e., immunogenic epitopes) nor to the amino or
carboxyl terminals. Antigenic epitope-bearing peptides and polypeptides of the
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-75-
invention are therefore useful to raise antibodies, including monoclonal
antibodies,
that bind specifically to a polypeptide of the invention. See, for instance,
Wilson
et al., Cell 37:767-778 (1984) at 777.
Non-limiting examples of antigenic polypeptides or peptides that can be
used to generate TRID-specific antibodies include: a polypeptide comprising,
or
alternatively consisting of, amino acid residues from about Gln-42 to about
Glu-52
in SEQ ID N0:2; a polypeptide comprising, or alternatively consisting of,
amino
acid residues from about His-58 to about Cys-66 in SEQ ID N0:2; a polypeptide
comprising, or alternatively consisting of, amino acid residues from about Pro-
68
to about Thr-76 in SEQ ID N0:2; a polypeptide comprising, or alternatively
consisting of, amino acid residues from about Ser-79 to about Cys-85 in SEQ ID
N0:2; a polypeptide comprising, or alternatively consisting of, amino acid
residues
from about Cys-91 to about Thr-102 in SEQ ID N0:2; a polypeptide comprising,
or alternatively consisting of, amino acid residues from about Gln-110 to
about
Pro-122 in SEQ ID N0:2; a polypeptide comprising, or alternatively consisting
of, amino acid residues from about Arg-126 to about Val-136 in SEQ ID N0:2;
and a polypeptide comprising, or alternatively consisting of, amino acid
residues
from about Thr-142 to about Gln-148 in SEQ ID N0:2. As indicated above, the
inventors have determined that the above polypeptide fragments are antigenic
regions oftheTRID protein. Polynucleotides encoding these polypeptides are
also
encompassed by the invention.
The epitope-bearing peptides and polypeptides of the invention may be
produced by any conventional means *See, e.g., Houghten, R. A. "General
method for the rapid solid-phase synthesis of large numbers of peptides:
specificity
of antigen-antibody interaction at the level of individual amino acids." Proc.
Natl.
Acad. Sci. USA 82:5131-5135 (1985); this "Simultaneous Multiple Peptide
Synthesis (SMPS)" process is further described in U.S. Patent No. 4,631,211 to
Houghten et al. ( 1986)).
Further still, U.S. Patent No. 5,194,392 to Geysen (1990) describes a
general method of detecting or determining the sequence of monomers (amino
acids or other compounds) which is a topological equivalent of the epitope
(i.e.,
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-76-
a "mimotope") which is complementary to a particular paratope (antigen binding
site) of an antibody of interest. More generally, U.S. Patent No. 4,433,092 to
Geysen (1989) describes a method of detecting or determining a sequence of
monomers which is a topographical equivalent of a ligand which is
complementary
to the ligand binding site of a particular receptor of interest. Similarly, U.
S. Patent
No. 5,480,971 to Houghten, R. A. et al. ( 1996) on Peralkylated Oligopeptide
Mixtures discloses linear C1-C7-alkyl peralkylated oligopeptides and sets and
libraries of such peptides, as well as methods for using such oligopeptide
sets and
libraries for determining the sequence of a peralkylated oligopeptide that
preferentially binds to an acceptor molecule of interest. Thus, non-peptide
analogs
of the epitope-bearing peptides of the invention also can be made routinely by
these methods.
Fusion Proteins and Modified Proteins
As one of skill in the art will appreciate, TRID receptor polypeptides of the
present invention and the epitope-bearing fragments thereof described herein
above (e.g., corresponding to a portion of the extracellular domain, such as,
for
example, polypeptide sequence comprising, or alternatively, consisting of,
amino
acid residues 1 to 240, 27 to 240, 30 to 240, 35 to 240, 40 to 240 and 50 to
240
of SEQ ID N0:2) fused to other polypeptide sequences. For example, the
polypeptides of the present invention may be fused with the constant domain of
immunoglobulins (IgA, IgE, IgG, IgM), or portions thereof (CHl, CH2, CH3, or
any combination thereof and portions thereof) resulting in chimeric
polypeptides.
Such fusion proteins may facilitate purification and may increase half life in
vivo.
This has been shown for chimeric proteins consisting of the first two domains
of
the human CD4-polypeptide and various domains of the constant regions of the
heavy or light chains of mammalian immunoglobulins. See, e.g., EP 394,827;
Traunecker et al., Nature, 331:84-86 (1988). IgG Fusion proteins that have a
disulfide-linked dimeric structure due to the IgG portion disulfide bonds have
also
been found to be more efficient in binding and neutralizing other molecules
than
monomeric polypeptides or fragments thereof alone. See, e.g., Fountoulakis et
al. ,
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
_77_
J. Biochem., 270:3958-3964 (1995). Nucleic acids encoding the above epitopes
can also be recombined with a gene of interest as an epitope tag (e.g., the
hemagglutinin ("HA") tag or flag tag) to aid in detection and purification of
the
expressed polypeptide. For example, a system described by Janknecht et al.
allows for the ready purification of non-denatured fusion proteins expressed
in
human cell lines (Janknecht et al., 1991, Proc. Natl. Acad. Sci. USA 88:8972-
897). In this system, the gene of interest is subcloned into a vaccinia
recombination plasmid such that the open reading frame of the gene is
translationally fused to an amino-terminal tag consisting of six histidine
residues.
The tag serves as a matrix-binding domain for the fusion protein. Extracts
from
cells infected with the recombinant vaccinia virus are loaded onto Ni'+
nitriloacetic
acid-agarose column and histidine-tagged proteins can be selectively eluted
with
imidazole-containing buffers.
Additional fusion proteins of the invention may be generated through the
techniques of gene-shuffling, motif shuffling, exon-shuffling, and/or codon-
shuffling (collectively referred to as "DNA shuffling"). DNA shuffling may be
employed to modulate the activities of polypeptides of the invention, such
methods can be used to generate polypeptides with altered activity, as well as
agonists and antagonists of the polypeptides. See, generally, U.S. Patent Nos.
5,605,793; 5,811,238; 5,830,721; 5,834,252; and 5,837,458, and Patten et al.,
Curr. Opinion Biotechnol. 8:724-33 (1997); Harayama, Trends Biotechnol.
16(2):76-82 (1998); Hanssonetal., J. Mol. Biol. 287:265-76 (1999); andLorenzo
and Blasco, Biotechniques 24(2):308-13 (1998) (each of these patents and
publications are hereby incorporated by reference in its entirety). In one
embodiment, alteration of polynucleotides corresponding to SEQ ID NO: l and
the
polypeptides encoded by these polynucleotides may be achieved by DNA
shuffling. DNA shuffling involves the assembly of two or more DNA segments
by homologous or site-specific recombination to generate variation in the
polynucleotide sequence. In another embodiment, polynucleotides of the
invention, or the encoded polypeptides, may be altered by being subjected to
random mutagenesis by error-prone PCR, random nucleotide insertion or other
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
_78_
methods prior to recombination. In another embodiment, one or more
components, motifs, sections, parts, domains, fragments, etc., of a
polynucleotide
coding a polypeptide of the invention may be recombined with one or more
components, motifs, sections, parts, domains, fragments, etc. of one or more
heterologous molecules.
As one of skill in the art will appreciate, TRID polypeptides of the present
invention and the epitope-bearing fragments thereof described herein (e.g.,
corresponding to a portion of the extracellular domain such as, for example,
amino
acid residues 1 to 240 of SEQ ID N0:2) can be combined with parts of the
constant domain of immunoglobulins (IgG), resulting in chimeric polypeptides.
These fusion proteins facilitate purification and show an increased half life
in vivo.
This has been shown, e.g., for chimeric proteins consisting of the first two
domains of the human CD4-polypeptide and various domains of the constant
regions of the heavy or light chains of mammalian immunoglobulins (EPA
394,827; Traunecker et al., Nature 331:84- 86 ( 1988)). Fusion proteins that
have
a disulfide-linked dimeric structure due to the IgG part can also be more
efficient
in binding and neutralizing other molecules than the monomeric TRID protein or
protein fragment alone (Fountoulakis et al., JBiochem 270:3958-3964 (1995)).
The epitope-bearing peptides and polypeptides of the invention may be produced
by any conventional means. Houghten, R.A., "General method for the rapid
solid-phase synthesis of large numbers of peptides: specificity ofantigen-
antibody
interaction at the level of individual amino acids," Proc. Natl. Acad. Sci.
USA
82:5131-5135 (1985). This "Simultaneous Multiple Peptide Synthesis (SMPS)"
process is further described in U.S. Patent No. 4,631,211 to Houghten et al.
(1986).
The polypeptide may be expressed in a modified form, such as a fusion
protein, and can include not only secretion signals but also additional
heterologous
functional regions. Thus, for instance, a region of additional amino acids,
particularly charged amino acids, can be added to the N-terminus of the
polypeptide to improve stability and persistence in the host cell, during
purification
or during subsequent handling and storage. Also, peptide moieties can be added
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-79-
to the polypeptide to facilitate purification. Such regions can be removed
prior to
final preparation of the polypeptide. The addition of peptide moieties to
polypeptides to engender secretion or excretion, to improve stability and to
facilitate purification, among others, are familiar and routine techniques in
the art.
A preferred fusion protein comprises a heterologous region from
immunoglobulin that is useful to solubilize proteins. For example, EP-A-O 464
533 (Canadian counterpart 2045869) discloses fusion proteins comprising
various
portions of constant region of immunoglobin molecules together with another
human protein or part thereof. In many cases, the Fc part in a.fusion protein
is
thoroughly advantageous for use in therapy and diagnosis and thus results, for
example, in improved pharmacokinetic properties (EP-A 0232 262). On the other
hand, for some uses, it would be desirable to be able to delete the Fc part
after the
fusion protein has been expressed, detected and purified in the advantageous
manner described. This is the case when the Fc portion proves to be a
hindrance
to use in therapy and diagnosis, for example, when the fusion protein is to be
used
as an antigen for immunizations. In drug discovery, for example, human
proteins,
such as the hILS-receptor, have been fused with Fc portions for the purpose of
high-throughput screening assays to identify antagonists of hIL-5. See, D.
Bennett et al., Journal ofMolecularRecognition 8:52-58 (1995) and K. Johanson
et al., The Journal of Biological Chemistry 270:16:9459-9471 (1995).
In another embodiment, TRID receptor polypeptides of the present
invention and the epitope-bearing fragments thereof described herein above
(e.g.,
corresponding to a portion of the extracellular domain, such as, for example,
polypeptide sequence comprising, or alternatively, consisting of, amino acid
residues 1 to 240, 27 to 240, 30 to 240, 35 to 240, 40 to 240 and 50 to 240 of
SEQ ID N0:2) can be combined as a fusion protein with a polypeptide having
intracellular signaling activity which is activated upon ligand binding. For
example, a TRID polypeptide of the present invention can be coupled with the
intracellular activation domain of a heterologous TNF-family receptor. Such a
fusion protein, when expressed in a host cell, would, when bound to TRAIL,
activate a detectable signal, such as, but not limited to, apoptosis or NF-kB
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-80-
activation . Such a fusion protein is useful for screening for ligand binding,
or
screening for agonists and/or antagonists of a TRID polypeptide.
In addition, proteins of the invention can be chemically synthesized using
techniques known in the art (e.g., see Creighton, Proteins: Structures and
Molecular Principles, W.H. Freeman & Co., N.Y. (1983), and Hunkapiller, M.,
et al., Nature 310:105-111 (1984)). For example, a peptide corresponding to a
fragment of the TRID polypeptides of the invention can be synthesized by use
of
a peptide synthesizer. Furthermore, if desired, nonclassical amino acids or
chemical amino acid analogs can be introduced as a substitution or addition
into
the TRID polypeptide sequence. Non-classical amino acids include, but are not
limited to, to the D-isomers of the common amino acids, 2,4-diaminobutyric
acid,
a-amino isobutyric acid, 4-aminobutyric acid, Abu, 2-amino butyric acid, g-
Abu,
e-Ahx, 6-amino hexanoic acid, Aib, 2-amino isobutyric acid, 3-amino propionic
acid, ornithine, norleucine, norvaline, hydroxyproline, sarcosine, citrulline,
homocitrulline, cysteic acid, t-butylglycine, t-butylalanine, phenylglycine,
cyclohexylalanine, b-alanine, fluoro-amino acids, designer amino acids such as
b-
methyl amino acids, Ca-methyl amino acids, Na-methyl amino acids, and amino
acid analogs in general. Furthermore, the amino acid can be D (dextrorotary)
or
L (levorotary).
Non-naturally occurring variants may be produced using art-known
mutagenesis techniques, which include, but are not limited to oligonucleotide
mediated mutagenesis, alanine scanning, PCR mutagenesis, site directed
mutagenesis (see, e.g., Carter et al., Nucl. Acids Res. 13:4331 (1986); and
Zoller
et al., Nucl. Acids Res. 10:6487 (1982)), cassette mutagenesis (see, e.g.,
Wells et
al., Gene 34:315 ( 1985)), restriction selection mutagenesis (see, e.g. ,
Wells et al.,
Philos. Traps. R. Soc. London SerA 317:415 (1986)).
The TRID polypeptides of the invention can be recovered and purified by
well-known methods including ammonium sulfate or ethanol precipitation, acid
extraction, anion or canon exchange chromatography, phosphocellulose
chromatography, hydrophobic interaction chromatography, affinity
chromatography, hydroxylapatite chromatography and lectin chromatography:
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-81-
Most preferably, high performance liquid chromatography ("HPLC") is employed
for purification.
Polypeptides of the present invention include naturally purified products,
products of chemical synthetic procedures, and products produced by
recombinant
techniques from a prokaryotic or eukaryotic host, including, for example,
bacterial, yeast, higher plant, insect and mammalian cells. Depending upon the
host employed in a recombinant production procedure, the polypeptides of the
present invention may be glycosylated or non-glycosylated. In addition,
polypeptides of the invention may also include an initial modified methionine
residue, in some cases as a result of host-mediated processes.
The invention additionally, encompasses TRID polypeptides which are
differentially modified during or after translation, e.g., by glycosylation,
acetylation, phosphorylation, amidation, derivatization by known
protecting/blocking groups, proteolytic cleavage, linkage to an antibody
molecule
or other cellular ligand, etc. Any of numerous chemical modifications may be
carried out by known techniques, including but not limited to, specific
chemical
cleavage by cyanogen bromide, trypsin, chymotrypsin, papain, V 8 protease,
NaBH4, acetylation, formylation, oxidation, reduction, metabolic synthesis in
the
presence of tunicamycin, etc.
Additional post-translational modifications encompassed by the invention
include, for example, e.g., N-linked or O-linked carbohydrate chains,
processing
of N-terminal or C-terminal ends), attachment of chemical moieties to the
amino
acid backbone, chemical modifications of N-linked or O-linked carbohydrate
chains, and addition or deletion of an N-terminal methionine residue as a
result of
procaryotic host cell expression. The polypeptides may also be modified with a
detectable label, such as an enzymatic, fluorescent, isotopic or affinity
label to
allow for detection and isolation of the protein.
Also provided by the invention are chemically modified derivatives of
TRID which may provide additional advantages such as increased solubility,
stability and circulating time ofthe polypeptide, or decreased immunogenicity
(see
U. S. Patent No. 4,179,337). The chemical moieties for derivitization may be
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-82-
selected from water soluble polymers such as polyethylene glycol, ethylene
glycol/propylene glycol copolymers, carboxymethylcellulose, dextran, polyvinyl
alcohol and the like. The polypeptides may be modified at random positions
within the molecule, or at predetermined positions within the molecule and may
include one, two, three or more attached chemical moieties.
The polymer may be of any molecular weight, and may be branched or
unbranched. For polyethylene glycol, the preferred molecular weight is between
about 1 kDa and about 100 kDa (the term "about" indicating that in
preparations
of polyethylene glycol, some molecules will weigh more, some less, than the
stated
molecular weight) for ease in handling and manufacturing. Other sizes may be
used, depending on the desired therapeutic profile (e. g. , the duration of
sustained
release desired, the effects, if any on biological activity, the ease in
handling, the
degree or lack of antigenicity and other known effects of the polyethylene
glycol
to a therapeutic protein or analog). For example, the polyethylene glycol may
have an average molecular weight of about 200, 500, 1000, 1500, 2000, 2500,
3000, 3500, 4000, 4500, 5000, 5500, 6000, 6500, 7000, 7500, 8000, 8500, 9000,
9500, 10,000, 10,500, 11,000, 11,500, 12,000, 12,500, 13,000, 13,500, 14,000,
14,500, 15,000, 15,500, 16,000, 16,500, 17,000, 17,500, 18,000, 18;500,
19,000,
19,500, 20,000, 25,000, 30,000, 35,000, 40,000, 50,000, 55,000, 60,000,
65,000,
70,000, 75,000, 80,000, 85,000, 90,000, 95,000, or 100,000 kDa.
The polyethylene glycol molecules (or other chemical moieties) should be
attached to the protein with consideration of effects on functional or
antigenic
domains of the protein. There are a number of attachment methods available to
those skilled in the art, e.g., EP 0 401 384, herein incorporated by reference
(coupling PEG to G-CSF), see also Malik et al., Exp. Hematol. 20:1028-1035
(1992) (reporting pegylation of GM-CSF using tresyl chloride). For example,
polyethylene glycol may be covalently bound through amino acid residues via a
reactive group, such as, a free amino or carboxyl group. Reactive groups are
those to which an activated polyethylene glycol molecule may be bound. The
amino acid residues having a free amino group may include lysine residues and
the
N-terminal amino acid residues; those having a free carboxyl group may include
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-83-
aspartic acid residues glutamic acid residues and the C-terminal amino acid
residue. Sulfhydryl groups may also be used as a reactive group for attaching
the
polyethylene glycol molecules. Preferred for therapeutic purposes is
attachment
at an amino group, such as attachment at the N-terminus or lysine group.
As suggested above, polyethylene glycol may be attached to proteins via
linkage to any of a number of amino acid residues. For example, polyethylene
glycol can be linked to a proteins via covalent bonds to lysine, histidine,
aspartic
acid, glutamic acid, or cysteine residues. One or more reaction chemistries
may
be employed to attach polyethylene glycol to specific amino acid residues
(e.g.,
lysine, histidine, aspartic acid, glutamic acid, or cysteine) of the protein
or to more
than one type of amino acid residue (e.g., lysine, histidine, aspartic acid,
glutamic
acid, cysteine and combinations thereof) of the protein.
One may specifically desire proteins chemically modified at the N-terminus.
Using polyethylene glycol as an illustration of the present composition, one
may
select from a variety of polyethylene glycol molecules (by molecular weight,
branching, etc.), the proportion of polyethylene glycol molecules to protein
(or
peptide) molecules in the reaction mix, the type of pegylation reaction to be
performed, and the method of obtaining the selected N-terminally pegylated
protein. The method of obtaining the N-terminally pegylated preparation (i.e.,
separating this moiety from other monopegylated moieties if necessary) may be
by
purification of the N-terminally pegylated material from a population of
pegylated
protein molecules. Selective proteins chemically modified at the N-terminus
modification may be accomplished by reductive alkylation which exploits
differential reactivity of different types of primary amino groups (lysine
versus the
N-terminal) available for derivatization in a particular protein. Under the
appropriate reaction conditions, substantially selective derivatization ofthe
protein
at the N-terminus with a carbonyl group containing polymer is achieved.
As indicated above, pegylation of the proteins of the invention may be
accomplished by any number of means. For example, polyethylene glycol may be
attached to the protein either directly or by an intervening linker.
Linkerless
systems for attaching polyethylene glycol to proteins are described in Delgado
et
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-84-
al., Crit. Rev. Thera. Drug Carrier Sys. 9:249-304 (1992); Francis et al.,
Intern.
J. of Hematol. 68:1-18 (1998); U.S. Patent No. 4,002,531; U.S. Patent No.
5,349,052; WO 95/06058; and WO 98/32466, the disclosures of each of which are
incorporated herein by reference.
One system for attaching polyethylene glycol directly to amino acid
residues of proteins without an intervening linker employs tresylated MPEG,
which is produced by the modification of monmethoxy polyethylene glycol
(MPEG) using tresylchloride (C1SO~CH~CF3). Upon reaction of protein with
tresylated MPEG, polyethylene glycol is directly attached to amine groups of
the
protein. Thus, the invention includes protein-polyethylene glycol conjugates
produced by reacting proteins of the invention with a polyethylene glycol
molecule
having a 2,2,2-trifluoreothane sulphonyl group.
Polyethylene glycol can also be attached to proteins using a number of
different intervening linkers. For example, U.S. Patent No. 5,612,460, the
entire
disclosure of which is incorporated herein by reference, discloses urethane
linkers
for connecting polyethylene glycol to proteins. Protein-polyethylene glycol
conjugates wherein the polyethylene glycol is attached to the protein by a
linker
can also be produced by reaction of proteins with compounds such as MPEG-
succinimidylsuccinate, MPEG activated with 1,1'-carbonyldiimidazole, MPEG-
2,4,5-trichloropenylcarbonate, MPEG-p-nitrophenolcarbonate, and various
MPEG-succinate derivatives. A number additional polyethylene glycol
derivatives
and reaction chemistries for attaching polyethylene glycol to proteins are
described
in WO 98/32466, the entire disclosure of which is incorporated herein by
reference. Pegylated protein products produced using the reaction chemistries
set
out herein are included within the scope of the invention.
The number ofpolyethylene glycol moieties attached to each protein ofthe
invention (i.e., the degree of substitution) may also vary. For example, the
pegylated proteins of the invention may be linked, on average, to 1, 2, 3, 4,
5, 6,
7, 8, 9, 10, 12, 15, 17, 20, or more polyethylene glycol molecules. Similarly,
the
average degree of substitution within ranges such as 1-3, 2-4, 3-S, 4-6, 5-7,
6-8,
7-9, 8-10, 9-11, 10-12, 11-13, 12-14, 13-15, 14-16, 15-17, 16-18, 17-19, or 18-
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-85-
20 polyethylene glycol moieties per protein molecule. Methods for determining
the degree of substitution are discussed, for example, in Delgado et al.,
Crit. Rev.
Thera. Drug Carrier Sys. 9:249-304 (1992).
As mentioned the TRID proteins of the invention may be modified by
either natural processes, such as posttranslational processing, or by chemical
modification techniques which are well known in the art. It will be
appreciated
that the same type of modification may be present in the same or varying
degrees
at several sites in a given TRID polypeptide. TRID polypeptides may be
branched, for example, as a result of ubiquitination, and they may be cyclic,
with
or without branching. Cyclic, branched, and branched cyclic TRID polypeptides
may result from posttranslation natural processes or may be made by synthetic
methods. Modifications include acetylation, acylation, ADP-ribosylation,
amidation, covalent attachment of flavin, covalent attachment of a heme
moiety,
covalent attachment of a nucleotide or nucleotide derivative, covalent
attachment
of a lipid or lipid derivative, covalent attachment of phosphotidylinositol,
cross-
linking, cyclization, disulfide bond formation, demethylation, formation of
covalent
cross-links, formation of cysteine, formation of pyroglutamate, formylation,
gamma-carboxylation, glycosylation, GPI anchor formation, hydroxylation,
iodination, methylation, myristoylation, oxidation, pegylation, proteolytic
processing, phosphorylation, prenylation, racemization, selenoylation,
sulfation,
30
transfer-RNA mediated addition of amino acids to proteins such as
arginylation,
and ubiquitination. (See, for instance, PROTEINS - STRUCTURE AND
MOLECULAR PROPERTIES, 2nd Ed., T. E. Creighton, W. H. Freeman and
Company, New York (1993); POSTTRANSLATIONAL COVALENT
MODIFICATION OF PROTEINS, B. C. Johnson, Ed., Academic Press, New
York, pgs. 1-12 (1983); Seifter et al., Meth Enzymol 182:626-646 (1990);
Rattan
et al., Ann NYAcad Sci 663:48-62 (1992).)
Antibodies
TRID-protein specific antibodies for use in the present invention can be
raised against the intact TRID proteins or an antigenic polypeptide fragment
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-86-
thereof, which may be presented together with a carrier protein, such as an
albumin, to an animal system (such as rabbit or mouse) or, if it is long
enough (at
least about 25 amino acids), without a carrier.
The present invention further relates to antibodies and T-cell antigen
receptors (TCR) which specifically bind the polypeptides ofthe present
invention.
The antibodies of the present invention include IgG (including IgG 1, IgG2,
IgG3,
and IgG4), IgA (including IgAI and IgA2), IgD, IgE, or IgM, and IgY. As used
herein, the term "antibody" (Ab) or "monoclonal antibody" (Mab) is meant to
include intact molecules (e.g., whole antibodies), as well as antibody
fragments
including single-chain whole antibodies, and antigen-binding fragments thereof
(such as, for example, Fab and F(ab')2 fragments) which are capable of
specifically
binding to a TNFR protein. Fab and F(ab')2 fragments lack the Fc fragment of
intact antibody, clear more rapidly from the circulation, and may have less
non-specific tissue binding of an intact antibody (Wahl et al., J. Nucl. Med.
24:316-325 (1983)). Thus, these fragments are preferred.
Most preferably the antibodies are human antigen-binding antibody
fragments of the present invention and include, but are not limited to, Fab,
Fab'
and F(ab')2, Fd, single-chain Fvs (scFv), single-chain antibodies, disulfide-
linked
Fvs (sdFv) and fragments comprising either a V~ or VH domain. Antigen-binding
antibody fragments, including single-chain antibodies, may comprise the
variable
regions) alone or in combination with the entirety or a portion of the
following:
hinge region, CH1, CH2, and CH3 domains. Also included in the invention are
antigen-binding fragments also comprising any combination of variable regions)
with a hinge region, CH1, CH2, and CH3 domains. The antibodies of the
invention may be from any animal origin including birds and mammals.
Preferably,
the antibodies are human, murine, donkey, ship rabbit, goat, guinea pig,
camel,
horse, or chicken. As used herein, "human" antibodies include antibodies
having
the amino acid sequence of a human immunoglobulin and include antibodies
isolated from human immunoglobulin libraries or from animals transgenic for
one
or more human immunoglobulin and that do not express endogenous
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
_87_
immunoglobulins, as described infra and, for example in, U.S. Patent No.
5,939,598 by Kucherlapati et al.
The antibodies of the present invention may be monospecific, bispecific,
trispecific or of greater multispecificity. Multispecific antibodies may be
specific
for different epitopes of a polypeptide of the present invention or may be
specific
for both a polypeptide of the present invention as well as for heterologous
compositions, such as a heterologous polypeptide or solid support material.
See,
e.g., WO 93/17715; WO 92/08802; WO 91/00360; WO 92/05793; Tutt, A. et al.
J. Immunol. 1;t7:60-69 (1991); US Patents 5,573,920, 4,474,893, 5,601,819.
4,714,681, 4,925,648; Kostelny, S.A. et al. J. Immunol. 148:1547-1553 (1992).
Antibodies of the present invention may be described or specified in terms
of the epitope(s) or portions) of a polypeptide of the present invention which
are
recognized or specifically bound by the antibody. The epitope(s) or
polypeptide
portions) may be specified as described herein, e. g. , by N-terminal and C-
terminal
positions, by size in contiguous amino acid residues, or listed in the Tables
and
Figures. Antibodies which specifically bind any epitope or polypeptide of the
present invention may also be excluded. Therefore, the present invention
includes
antibodies that specifically bind polypeptides of the present invention, and
allows
for the exclusion of the same.
Antibodies of the present invention may also be described or specified in
terms of their cross-reactivity. Antibodies that do not bind any other analog,
ortholog, or homolog of the polypeptides of the present invention are
included.
Antibodies that do not bind polypeptides with less than 95%, less than 90%,
less
than 85%, less than 80%, less than 75%, less than 70%, less than 65%, less
than
60%, less than 55%, and less than 50% identity (as calculated using methods
known in the art and described herein) to a polypeptide of the present
invention
are also included in the present invention. Further included in the present
invention are antibodies which only bind polypeptides encoded by
polynucleotides
which hybridize to a polynucleotide of the present invention under stringent
hybridization conditions (as described herein). Antibodies of the present
invention
may also be described or specified in terms of their binding affinity.
Preferred
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
_88_
binding affinities include those with a dissociation constant or Kd less than
SX10-ZM, 10-2M, SX10-3M, 10-3M, SX10-4M, 10-4M, SX10-SM, 10-5M, SX10-6M,
10-6M, SX10-'M, 10-'M, SXIO-8M, 10-8M, SX10-9M, 10-9M, SX10-'°M, 10-
'°M,
SX10-"M, 10-"M, SX10-''-M, 10-''M, SX10-'3M, 10-'3M, SX10-'~M, 10-'4M,
SXIO-'SM, and 10-'SM.
The invention also provides antibodies that competitively inhibit binding
of an antibody to an epitope of the invention as determined by any method
known
in the art for determining competitive binding, for example, the immunoassays
described herein. In preferred embodiments, the antibody competitively
inhibits
binding to the epitope by at least 90%, at least 80%, at least 70%, at least
60%,
or at least 50%.
Antibodies of the present invention may act as agonists, TRAIL binding
facilitators, or antagonists of the polypeptides of the present invention. For
example, the present invention includes antibodies which disrupt the
receptor/ligand interactions with the polypeptides of the invention either
partially
or fully. The invention features both receptor-specific antibodies and
ligand-specific antibodies. The invention also features receptor-specific
antibodies
which do not prevent ligand binding but prevent receptor activation. Receptor
activation (i. e. , signaling) may be determined by techniques described
herein or
otherwise known in the art. For example, receptor activation can be determined
by detecting the phosphorylation (e.g., tyrosine or serine/threonine) of the
receptor or its substrate by immunoprecipitation followed by western blot
analysis
(for example, as described supra). In specific embodiments, antibodies are
provided that inhibit ligand or receptor activity by at least 90%, at least
80%, at
least 70%, at least 60%, or at least 50% of the activity in absence of the
antibody.
The invention also features receptor-specific antibodies which both prevent
ligand binding and receptor activation as well as antibodies that recognize
the
receptor-ligand complex, and, preferably, do not specifically recognize the
unbound receptor or the unbound ligand. Likewise, included in the invention
are
neutralizing antibodies which bind the ligand and prevent binding of the
ligand to
the receptor, as well as antibodies which bind the ligand, thereby preventing
CA 02374674 2001-11-20
WO 00/71150 PCT/LJS00/13515
-89-
receptor activation, but do not prevent the ligand from binding the receptor.
Further included in the invention are antibodies which activate the receptor.
These
antibodies may act as receptor agonists, i.e., potentiate or activate either
all or a
subset of the biological activities of the ligand-mediated receptor
activation. The
antibodies may be specified as agonists, TRAIL binding facilitators,
antagonists
or inverse agonists for biological activities comprising the specific
biological
activities of the peptides of the invention disclosed herein. Thus, the
invention
further relates to antibodies which act as agonists, TRAIL binding
facilitators, or
antagonists of the polypeptides of the present invention. The above antibody
agonists or TRAIL binding facilitators can be made using methods known in the
art. See, e.g., PCT publication WO 96/40281; U.S. Patent No. 5,811,097; Deng
et al., Blood 92(6):1981-1988 (1998); Chen etal., CancerRes. 58(16):3668-3678
(1998); Harrop et al., J. Immunol. 161 (4):1786-1794 (1998); Zhu et al.,
Cancer
Res. 58(15):3209-3214 (1998); Yoon et al., J. Immunol. 160(7):3170-3179
(1998); Prat et al., J. Cell. Sci. 111 (Pt2):237-247 (1998); Pitard et al., J.
Immunol. Methods 205(2):177-190 (1997); Liautard et al., Cytokine 9(-1):233-
241
(1997); Carlson et al., J. Biol. Chem. 272(17):11295-11301 (1997); Taryman et
al., Neuron 14(4):755-762 (1995); Muller et al., Structure 6(9):1153-1167
(1998); Bartunek et al., Cytokine 8(1):14-20 (1996) (which are all
incorporated
by reference herein in their entireties).
Antibodies of the present invention have uses that include, but are not
limited to, methods known in the art to purify, detect, and target the
polypeptides
of the present invention including both in vitro and in vivo diagnostic and
therapeutic methods. For example, the antibodies have use in immunoassays for
qualitatively and quantitatively measuring levels of the polypeptides of the
present
invention in biological samples. See, e.g., Harlow et al., ANTIBODIES: A
LABORATORY MANUAL, (Cold Spring Harbor Laboratory Press, 2nd ed.
1988) (incorporated by reference in the entirety).
The antibodies of the present invention may be used either alone or in
combination with other compositions. The antibodies may further be
recombinantly fused to a heterologous polypeptide at the N- or C-terminus or
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-90-
chemically conjugated (including covalently and non-covalently conjugations)
to
polypeptides or other compositions. For example, antibodies of the present
invention may be recombinantly fused or conjugated to molecules useful as
labels
in detection assays and effector molecules such as heterologous polypeptides,
drugs, or toxins. See, e.g., WO 92/08495; WO 91/14438; WO 89/12624; US
Patent 5,314,995; and EP 0 396 387.
The antibodies of the invention include derivatives that are modified, i. e,
by the covalent attachment of any type of molecule to the antibody such that
covalent attachment does not prevent the antibody from generating an
anti-idiotypic response. For example, but not by way of limitation, the
antibody
derivatives include antibodies that have been modified, e.g., by
glycosylation,
acetylation, pegylation, phosphorylation, amidation, derivatization by known
protecting/blocking groups, proteolytic cleavage, linkage to a cellular ligand
or
other protein, etc. Any of numerous chemical modifications may be carried out
by known techniques, including, but not limited to specific chemical cleavage,
acetylation, formylation, metabolic synthesis of tunicamycin, etc.
Additionally, the
derivative may contain one or more non-classical amino acids.
The antibodies of the present invention may be generated by any suitable
method known in the art. Polyclonal antibodies to an antigen of interest can
be
produced by various procedures well known in the art. For example, a
polypeptide of the invention can be administered to various host animals
including,
but not limited to, rabbits, mice, rats, etc. to induce the production of sera
containing polyclonal antibodies specific for the antigen. Various adjuvants
may
be used to increase the immunological response, depending on the host species,
and include but are not limited to, Freund's (complete and incomplete),
mineral
gels such as aluminum hydroxide, surface active substances such as
lysolecithin,
pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet
hemocyanins,
dinitrophenol, and potentially useful human adjuvants such as BCG (bacille
Calmette-Guerin) and Corynebacterium parvum. Such adjuvants are also well
known in the art.
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-91 -
In the most preferred method, the antibodies of the present invention are
monoclonal antibodies. The term "monoclonal antibody" is not a limited to
antibodies produced through hybridoma technology. The term "monoclonal
antibody" refers to an antibody that is derived from a single clone, including
any
eukaryotic, prokaryotic, or phage clone, and not the method by which it is
produced. Monoclonal antibodies can be prepared using a wide variety of
techniques known in the art including the use of hybridoma, recombinant, and
phage display technology.
For example, monoclonal antibodies can be prepared using hybridoma
technology (Kohler et al., Nature 256:495 ( 1975); Kohler et al., Eur. J.
Immunol.
6:511 ( 1976); Kohler et al., Eur. J. Immunol. 6:292 ( 1976); Hammerling et
al., in:
Monoclonal Antibodies and T Cell Hybridomas, Elsevier, N.Y., (1981) pp.
563-681 ). In general, such procedures involve immunizing an animal
(preferably
a mouse) with a TRID protein antigen or, more preferably, with a TRID
protein-expressing cell. Suitable cells can be recognized by their capacity to
bind
anti-TRID protein antibody. Such cells may be cultured in any suitable tissue
culture medium; however, it is preferable to culture cells in Earle's modified
Eagle's medium supplemented with 10% fetal bovine serum (inactivated at about
56° C), and supplemented with about 10 g/1 of nonessential amino acids,
about
1,000 U/ml of penicillin, and about 100 qg/ml of streptomycin. The splenocytes
of such mice are extracted and fused with a suitable myeloma cell line. Any
suitable myeloma cell line may be employed in accordance with the present
invention; however, it is preferable to employ the parent myeloma cell line
(SP20), available from the American Type Culture Collection, Rockville,
Maryland. After fusion, the resulting hybridoma cells are selectively
maintained
in HAT medium, and then cloned by limiting filution as described by Wands et
al.
(Gastroenterology 80:225-232 ( 1981 )). The hybridoma cells obtained through
such a selection are then assayed to identify clones which secrete antibodies
capable of binding the desired TRID antigen.
Accordingly, the present invention provides methods of generating
monoclonal antibodies as well as antibodies produced by the method comprising
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-92-
culturing a hybridoma cell secreting an antibody of the invention wherein,
preferably, the hybridoma is generated by fusing splenocytes isolated from a
mouse immunized with an antigen of the invention with myeloma cells and then
screening the hybridomas resulting from the fusion for hybridoma clones that
secrete an antibody able to bind a polypeptide of the invention.
Antibody fragments that recognize specific epitopes may be generated by
known techniques. For example, Fab and F(ab')2 fragments of the invention may
be produced by proteolytic cleavage of immunoglobulin molecules, using enzymes
such as papain (to produce Fab fragments) or pepsin (to produce F(ab')2
fragments). F(ab')2 fragments contain the variable region, the light chain
constant
region and the CH1 domain of the heavy chain.
Hybridoma techniques include those known in the art and taught in Harlow
et al., ANTIBODIES: A LABORATORY MANUAL, (Cold Spring Harbor
Laboratory Press, 2nd ed. 1988); Hammerling, et al., in: MONOCLONAL
ANTIBODIES AND T-CELL HYBRIDOMAS 563-681 (Elsevier, N.Y., 1981 )
(said references incorporated by reference in their entireties). It will be
appreciated
that Fab and F(ab')2 and other fragments of the antibodies of the present
invention
may be used according to the methods disclosed herein. Fab and F(ab')2
fragments
may be produced by proteolytic cleavage, using enzymes such as papain (to
produce Fab fragments) or pepsin (to produce F(ab')2 fragments).
Alternatively,
TRID protein-binding fragments can be produced through the application of
recombinant DNA technology or through synthetic chemistry.
Alternatively, additional antibodies capable of binding to the TRID antigen
may be produced in a two-step procedure through the use of anti-idiotypic
antibodies. Such a method makes use of the fact that antibodies are themselves
antigens, and that, therefore, it is possible to obtain an antibody which
binds to a
second antibody. In accordance with this method, TRID-protein specific
antibodies are used to immunize an animal, preferably a mouse. The splenocytes
of such an animal are then used to produce hybridoma cells, and the hybridoma
cells are screened to identify clones which produce an antibody whose ability
to
bind to the TRID protein-specific antibody can be blocked by the TRID protein
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-93-
antigen. Such antibodies comprise anti-idiotypic antibodies to the TRID
protein-specific antibody and can be used to immunize an animal to induce
formation of further TRID protein-specific antibodies.
For in vivo use of anti-TRID in humans, it may be preferable to use
"humanized" chimeric monoclonal antibodies. Such antibodies can be produced
using genetic constructs derived from hybridoma cells producing the monoclonal
antibodies described above. Methods for producing chimeric antibodies are
known in the art. See, for review, Morrison, Science 229:1202 (1985); Oi et
al.,
BioTechnigue.s 4:214 ( 1986); Cabilly et al., U.S. Patent No. 4,816,567;
Taniguchi
et al., EP 171496; Morrison et al., EP 173494; Neuberger et al., WO 8601533;
Robinson et al., WO 8702671; Boulianne et al., Nature 312:643 (1984);
Neuberger et al., Nature 314:268 (1985).
Alternatively, antibodies of the present invention can be produced through
the application of recombinant DNA and phage display technology or through
synthetic chemistry using methods known in the art. For example, the
antibodies
of the present invention can be prepared using various phage display methods
known in the art. In phage display methods, functional antibody domains are
displayed on the surface of a phage particle which carries polynucleotide
sequences encoding them. Phage with a desired binding property are selected
from a repertoire or combinatorial antibody library (e.g. human or murine) by
selecting directly with antigen, typically antigen bound or captured to a
solid
surface or bead. Phage used in these methods are typically filamentous phage
including fd and M13 with Fab, Fv or disulfide stabilized Fv antibody domains
recombinantly fused to either the phage gene III or gene VIII protein.
Examples
of phage display methods that can be used to make the antibodies of the
present
invention include those disclosed in Brinkman U. et al. J. Immunol. Methods
182:41-50 (1995); Ames, R.S. et al. J. Immunol. Methods 184:177-186 (1995);
Kettleborough, C.A. et al. Eur. J. Immunol. 24:952-958 (1994); Persic, L. et
al.
Gene 187:9-18 (1997); Burton, D.R. et al. Advances in Immunology 57:191-280
(1994); PCT/GB91/01134; WO 90/02809; WO 91/10737; WO 92/01047; WO
92/18619; WO 93/11236; WO 95/15982; WO 95/20401; and US Patents
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-94- v
5,698,426, 5,223,409, 5,403,484, 5,580,717, 5,427,908, 5,750,753, 5,821,047,
5,571,698, 5,427,908, 5,516,637, 5,780,225, 5,658,727, 5,733,743, and
5,969,108 (said references incorporated by reference in their entireties).
As described in the above references, after phage selection, the antibody
coding regions from the phage can be isolated and used to generate whole
antibodies, including human antibodies, or any other desired antigen binding
fragment, and expressed in any desired host including mammalian cells, insect
cells, plant cells, yeast, and bacteria. For example, techniques to
recombinantly
produce Fab, Fab' and F(ab')2 fragments can also be employed using methods
known in the art such as those disclosed in WO 92/22324; Mullinax, R.L. et al.
BioTechnigues 12(6):864-869 (1992); and Sawai, H. etal. AJRI34:26-34 (1995);
and Better, M. et al. Science 240:1041-1043 (1988) (said references
incorporated
by reference in their entireties).
Examples of techniques which can be used to produce single-chain Fvs and
antibodies include those described in U.S. Patents 4,946,778 and 5,258,498;
Huston et al. Methods in Enzymology 203:46-88 ( 1991 ); Shu, L. et al. PNAS
90:7995-7999 (1993); and Skerra, A. et al. Science 240:1038-1040 (1988). For
some uses, including in vivo use of antibodies in humans and in vitro
detection
assays, it may be preferable to use chimeric, humanized, or human antibodies.
Methods for producing chimeric antibodies are known in the art. See e.g.,
Morrison, Science 229:1202 (1985); Oi et al., BioTechnigues 4:214 (1986);
Gillies, S.D. et al. J. Immunol. Methods 125:191-202 (1989); and US Patent
5,807,715. Antibodies can be humanized using a variety of techniques including
CDR-grafting (EP 0 239 400; WO 91/09967; US Patent 5,530,101; and
5,585,089), veneering or resurfacing (EP 0 592 106; EP 0 519 596; Padlan E.A.,
Molecular Immunology 28(4/5):489-498 (1991); Studnicka G.M. et al. Protein
Engineering 7(6):805-814 (1994); Roguska M.A. et al. PNAS 91:969-973
( 1994)), and chain shuffling (US Patent 5,565,332). Completely human
antibodies
are particularly desirable for therapeutic treatment of human patients. Human
antibodies can be made by a variety of methods known in the art including
phage
display methods described above. See also, US Patents 4,444,887, 4,716,111,
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-95-
5,545,806, and 5,814,318; and International patent application publication
numbers WO 98/46645, WO 98/50433, WO 98/24893, WO 98/16654, WO
96/34096, WO 96/33735, and WO 91/10741 (said references incorporated by
reference in their entireties).
Human antibodies can also be produced using transgenic mice which are
incapable of expressing functional endogenous immunoglobulins, but which can
express human immunoglobulin genes. For example, the human heavy and light
chain immunoglobulin gene complexes may be introduced randomly or by
homologous recombination into mouse embryonic stem cells. Alternatively, the
human variable region, constant region, and diversity region may be introduced
into mouse embryonic stem cells in addition to the human heavy and light chain
genes. The mouse heavy and light chain immunoglobulin genes may be rendered
non-functional separately or simultaneously with the introduction of human
immunoglobulin loci by homologous recombination. In particular, homozygous
deletion of the JH region prevents endogenous antibody production. The
modified
embryonic stem cells are expanded and microinjected into blastocysts to
produce
chimeric mice. The chimeric mice are then bred to produce homozygous offspring
that express human antibodies. The transgenic mice are immunized in the normal
fashion with a selected antigen, e.g., all or a portion of a polypeptide of
the
invention. Monoclonal antibodies directed against the antigen can be obtained
from the immunized, transgenic mice using conventional hybridoma technology.
The human immunoglobulin transgenes harbored by the transgenic mice rearrange
during B-cell differentiation, and subsequently undergo class switching and
somatic mutation. Thus, using such a technique, it is possible to produce
therapeutically useful IgG, IgA, IgM and IgE antibodies. For an overview of
this
technology for producing human antibodies, see Lonberg and Huszar ( 1995, Int.
Rev. Immunol. 13:65-93). For a detailed discussion of this technology for
producing human antibodies and human monoclonal antibodies and protocols for
producing such antibodies, see, e.g., PCT publications WO 98/24893; WO
96/34096; WO 96/33735; U.S. Patent Nos. 5,413,923; 5,625,126; 5,633,425;
5,569,825; 5,661,016; 5,545,806; 5,814,318; and 5,939,598, which are
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-96-
incorporated by reference herein in their entirety. In addition, companies
such as
Abgenix, Inc. (Freemont, CA) and GenPharm (San Jose, CA) can be engaged to
provide human antibodies directed against a selected antigen using technology
similar to that described above.
Completely human antibodies which recognize a selected epitope can be
generated using a technique referred to as "guided selection." In this
approach a
selected non-human monoclonal antibody, e. g. , a mouse antibody, is used to
guide
the selection of a completely human antibody recognizing the same epitope.
(Jespers et al., Bioltechnology 12:899-903 (1988)).
As discussed above, antibodies to the TRID proteins of the invention can,
in turn, be utilized to generate anti-idiotype antibodies that "mimic" TRID
using
techniques well known to those skilled in the art. (See, e.g., Greenspan &
Bona,
FASEB J. 7(5):437-444; (1989) and Nissinoff, J. Immunol. 147(8):2429-2438
( 1991 )). For example, antibodies which bind to TRID and competitively
inhibit
TRID multimerization and/or binding to ligand can be used to generate anti-
idiotypes that "mimic" the TRID mutimerization and/or binding domain and, as a
consequence, bind to and neutralize TRID and/or its ligand. Such neutralizing
anti-idiotypes or Fab fragments of such anti-idiotypes can be used in
therapeutic
regimens to neutralize TRID ligand. For example, such anti-idiotypic
antibodies
can be used to bind TRID, or to bind TRID ligands/receptors, and thereby block
TRID mediated inhibition of apoptosis.
Further included in the present invention are antibodies recombinantly
fused or chemically conjugated (including both covalently and non-covalently
conjugations) to a polypeptide of the present invention. The antibodies may be
specific for antigens other than polypeptides of the present invention. For
example, antibodies may be used to target the polypeptides of the present
invention to particular cell types, either in vitro or in vivo, by fusing or
conjugating the polypeptides of the present invention to antibodies specific
for
particular cell surface receptors. Antibodies fused or conjugated to the
polypeptides of the present invention may also be used in in vitro
immunoassays
and purification methods using methods known in the art. See e.g., Harbor et
al.
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-97-
supra and WO 93/21232; EP 0 439 095; Naramura, M. et al. Immunol. Lett.
39:91-99 (1994); US Patent 5,474,981; Gillies, S.O. et al. PNAS 89:1428-1432
( 1992); Fell, H.P. et al. J. Immunol. 146:2446-2452 ( 1991 ) (said references
incorporated by reference in their entireties).
The present invention further includes compositions comprising, or
alternatively consisting of, TRID polypeptides of the present invention fused
or
conjugated to antibody domains other than the variable regions. For example,
the
polypeptides of the present invention may be fused or conjugated to an
antibody
Fc region, or portion thereof. The antibody portion fused to a polypeptide of
the
present invention may comprise the hinge region, CH I domain, CH2 domain, and
CH3 domain or any combination of whole domains or portions thereof. The
polypeptides of the present invention may be fused or conjugated to the above
antibody portions to increase the in vivo half life of the polypeptides or for
use in
immunoassays using methods known in the art. The polypeptides may also be
fused or conjugated to the above antibody portions to form multimers. For
example, Fc portions fused to the polypeptides of the present invention can
form
dimers through disulfide bonding between the Fc portions. Higher multimeric
forms can be made by fusing the polypeptides to portions of IgA and IgM.
Methods for fusing or conjugating the polypeptides of the present invention to
antibody portions are known in the art. See e.g., US Patents 5,336,603,
5,622,929, 5,359,046, 5,349,053, 5,447,851, 5,112,946; EP 0 307 434, EP 0 367
166; WO 96/04388, WO 91/06570; Ashkenazi, A. et al. PNAS 88:10535-10539
(1991); Zheng, X.X. et al. J. Immunol. 154:5590-5600 (1995); and Vil, H. et
al.
PNAS 89:11337-11341 (1992) (said references incorporated by reference in their
entireties).
In addition, the present invention includes antibodies which disrupt the
ability of the proteins of the invention to multimerize. In another example,
the
present invention includes antibodies which allow the proteins of the
invention to
multimerize, but disrupts the ability of the proteins of the invention to bind
one or
more TRID receptor(s)/ligand(s) (e.g., TRAIL). In yet another example, the
present invention includes antibodies which allow the proteins of the
invention to
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-98-
multimerize, and bind TRID receptor(s)/ligand(s) (e.g., TRAIL), but blocks
biological activity associated with the TRID/receptor/ligand complex.
A. Polynucleotides Encoding Antibodies.
The invention further provides polynucleotides comprising a nucleotide
sequence encoding an antibody of the invention and fragments thereof. The
invention also encompasses polynucleotides that hybridize under stringent or
lower stringency hybridization conditions, e.g., as defined supra, to
polynucleotides that encode an antibody, preferably, that specifically binds
to a
polypeptide of the invention, preferably, an antibody that binds to a
polypeptide
having the amino acid sequence of SEQ ID N0:2.
The polynucleotides may be obtained, and the nucleotide sequence of the
polynucleotides determined, by any method known in the art. For example, if
the
nucleotide sequence of the antibody is known, a polynucleotide encoding the
antibody may be assembled from chemically synthesized oligonucleotides (e.g.,
as described in Kutmeier et al., BioTechnigues 17:242 (1994)), which, briefly,
involves the synthesis of overlapping oligonucleotides containing portions of
the
sequence encoding the antibody, annealing and ligation ofthose
oligonucleotides,
and then amplification of the ligated oligonucleotides by PCR.
Alternatively, a polynucleotide encoding an antibody may be generated
from nucleic acid from a suitable source. If a clone containing a nucleic acid
encoding a particular antibody is not available, but the sequence of the
antibody
molecule is known, a nucleic acid encoding the immunoglobulin may be obtained
from a suitable source (e.g., an antibody cDNA library, or a cDNA library
generated from, or nucleic acid, preferably poly A+ RNA, isolated from, any
tissue or cells expressing the antibody, such as hybridoma cells selected to
express
an antibody of the invention) by PCR amplification using synthetic primers
hybridizable to the 3' and 5' ends of the sequence or by cloning using an
oligonucleotide probe specific for the particular gene sequence to identify,
e.g.,
a cDNA clone from a cDNA library that encodes the antibody. Amplified nucleic
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-99-
acids generated by PCR may then be cloned into replicable cloning vectors
using
any method well known in the art.
Once the nucleotide sequence and corresponding amino acid sequence of
the antibody is determined, the nucleotide sequence of the antibody may be
manipulated using methods well known in the art for the manipulation of
nucleotide sequences, e.g., recombinant DNA techniques, site directed
mutagenesis, PCR, etc. (see, for example, the techniques described in Sambrook
et al., 1990, Molecular Cloning, A Laboratory Manual, 2d Ed., Cold Spring
Harbor Laboratory, Cold Spring Harbor, NY and Ausubel et. al., eds., 1998.
Current Protocols in Molecular Biology, John Wiley & Sons, NY, which are both
incorporated by reference herein in their entireties), to generate antibodies
having
a different amino acid sequence, for example to create amino acid
substitutions,
deletions, and/or insertions.
In a specific embodiment, the amino acid sequence of the heavy and/or
light chain variable domains may be inspected to identify the sequences of the
complementarity determining regions (CDRs) by methods that are well know in
the art, e.g., by comparison to known amino acid sequences of other heavy and
light chain variable regions to determine the regions of sequence
hypervariability.
Using routine recombinant DNA techniques, one or more of the CDRs may be
inserted within framework regions, e.g., into human framework regions to
humanize a non-human antibody, as described supra. The framework regions may
be naturally occurring or consensus framework regions, and preferably human
framework regions (see, e.g., Chothia et al., J. Mol. Biol. 278:457-479 (1998)
for
a listing of human framework regions). Preferably, the polynucleotide
generated
by the combination of the framework regions and CDRs encodes an antibody that
specifically binds a polypeptide of the invention. Preferably, as discussed
supra,
one or more amino acid substitutions may be made within the framework regions,
and, preferably, the amino acid substitutions improve binding of the antibody
to
its antigen. Additionally, such methods may be used to make amino acid
substitutions or deletions of one or more variable region cysteine residues
participating in an intrachain disulfide bond to generate antibody molecules
lacking
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 100 -
one or more intrachain disulfide bonds. Other alterations to the
polynucleotide are
encompassed by the present invention and within the skill of the art.
In addition, techniques developed for the production of "chimeric
antibodies" (Morrison et al., 1984, Proc. Natl. Acad Sci. 81:851-855;
Neuberger
et al., 1984, Nature 312:604-608; Takeda et al., 1985, Nature 314:452-454) by
splicing genes from a mouse antibody molecule of appropriate antigen
specificity
together with genes from a human antibody molecule of appropriate biological
activity can be used. As described supra, a chimeric antibody is a molecule in
which different portions are derived from different animal species, such as
those
having a variable region derived from a murine monoclonal antibody and a human
immunoglobulin constant region, e.g., humanized antibodies.
Alternatively, techniques described for the production of single chain
antibodies (U.S. Patent No. 4,694,778; Bird, 1988, Science 242:423-42; Huston
et al., 1988, Proc. Natl. Acad. Sci. USA 85:5879-5883; and Ward et al., 1989,
Nature 334:544-554) can be adapted to produce single chain antibodies. Single
chain antibodies are formed by linking the heavy and light chain fragments of
the
Fv region via an amino acid bridge. resulting in a single chain polypeptide.
Techniques for the assembly of functional Fv fragments in E. coli may also be
used
(Skerra et al., 1988, Science 242:1038- 1041).
B. Methods of Producing Antibodies
The antibodies of the invention can be produced by any method known in
the art for the synthesis of antibodies, in particular, by chemical synthesis
or
preferably, by recombinant expression techniques.
Recombinant expression of an antibody of the invention, or fragment,
derivative or analog thereof, e.g., a heavy or light chain of an antibody of
the
invention, requires construction of an expression vector containing a
polynucleotide that encodes the antibody. Once a polynucleotide encoding an
antibody molecule or a heavy or light chain of an antibody, or portion thereof
(preferably containing the heavy or light chain variable domain), of the
invention
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 101 -
has been obtained, the vector for the production of the antibody molecule may
be
produced by recombinant DNA technology using techniques well known in the
art. Thus, methods for preparing a protein by expressing a polynucleotide
containing an antibody encoding nucleotide sequence are described herein.
Methods which are well known to those skilled in the art can be used to
construct
expression vectors containing antibody coding sequences and appropriate
transcriptional and translational control signals. These methods include, for
example, in vitro recombinant DNA techniques, synthetic techniques, and in
vivo
genetic recombination. The invention, thus, provides replicable vectors
comprising a nucleotide sequence encoding an antibody molecule of the
invention,
or a heavy or light chain thereof, or a heavy or light chain variable domain,
operably linked to a promoter. Such vectors may include the nucleotide
sequence
encoding the constant region of the antibody molecule (see, e. g. , PCT
Publication
WO 86/05807; PCT Publication WO 89/01036; and U.S. Patent No. 5,122,464)
and the variable domain of the antibody may be cloned into such a vector for
expression of the entire heavy or light chain.
The expression vector is transferred to a host cell by conventional
techniques and the transfected cells are then cultured by conventional
techniques
to produce an antibody of the invention. Thus, the invention includes host
cells
containing a polynucleotide encoding an antibody of the invention, or a heavy
or
light chain thereof, operably linked to a heterologous promoter. In preferred
embodiments for the expression of double-chained antibodies, vectors encoding
both the heavy and light chains may be co-expressed in the host cell for
expression
of the entire immunoglobulin molecule, as detailed below.
A variety of host-expression vector systems may be utilized to express the
antibody molecules of the invention. Such host-expression systems represent
vehicles by which the coding sequences of interest may be produced and
subsequently purified, but also represent cells which may, when transformed or
transfected with the appropriate nucleotide coding sequences, express an
antibody
molecule of the invention in situ. These include but are not limited to
microorganisms such as bacteria (e.g., E. coli, B. subtilis) transformed with
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 102 -
recombinant bacteriophage DNA, plasmid DNA or cosmid DNA expression
vectors containing antibody coding sequences; yeast (e.g., Saccharomyces,
Pichia) transformed with recombinant yeast expression vectors containing
antibody coding sequences; insect cell systems infected with recombinant virus
expression vectors (e.g., baculovirus) containing antibody coding sequences;
plant
cell systems infected with recombinant virus expression vectors (e.g.,
cauliflower
mosaic virus, CaMV; tobacco mosaic virus, TMV) or transformed with
recombinant plasmid expression vectors (e.g., Ti plasmid) containing antibody
coding sequences; or mammalian cell systems (e.g., COS, CHO, BHK, 293, 3T3
cells) harboring recombinant expression constructs containing promoters
derived
from the genome of mammalian cells (e.g., metallothionein promoter) or from
mammalian viruses (e.g., the adenovirus late promoter; the vaccinia virus 7.5K
promoter). Preferably, bacterial cells such as Escherichia coli, and more
preferably, eukaryotic cells, especially for the expression of whole
recombinant
antibody molecule, are used for the expression of a recombinant antibody
molecule. For example, mammalian cells such as Chinese hamster ovary cells
(CHO), in conjunction with a vector such as the major intermediate early gene
promoter element from human cytomegalovirus is an effective expression system
for antibodies (Foecking et al. , 1986, Gene -15:101; Cockett et al. , 1990,
BiolTechnology 8:2).
In bacterial systems, a number of expression vectors may be
advantageously selected depending upon the use intended for the antibody
molecule being expressed. For example, when a large quantity of such a protein
is to be produced, for the generation of pharmaceutical compositions of an
antibody molecule, vectors which direct the expression of high levels of
fusion
protein products that are readily purified may be desirable. Such vectors
include,
but are not limited, to the E. coli expression vector pUR278 (Ruther et al.,
1983,
EMBO J. 2:1791 ), in which the antibody coding sequence may be ligated
individually into the vector in frame with the lac Z coding region so that a
fusion
protein is produced; pIN vectors (Inouye & Inouye, 1985, Nucleic Acids Res.
13:3101-3109; Van Heeke & Schuster, 1989, J. Biol. Chem. 24:5503-5509); and
CA 02374674 2001-11-20
WO 00/71150 PCT/IJS00/13515
-103-
the like. pGEX vectors may also be used to express foreign polypeptides as
fusion
proteins with glutathione S-transferase (GST). In general, such fusion
proteins
are soluble and can easily be purified from lysed cells by adsorption and
binding
to a matrix glutathione-agarose beads followed by elution in the presence of
free
glutathione. The pGEX vectors are designed to include thrombin or factor Xa
protease cleavage sites so that the cloned target gene product can be released
from
the GST moiety.
In an insect system. Autographa californica nuclear polyhedrosis virus
(AcNPV) is used as a vector to express foreign genes. The. virus grows in
Spodoptera,frugiperda cells. The antibody coding sequence may be cloned
individually into non-essential regions (for example the polyhedrin gene) of
the
virus and placed under control of an AcNPV promoter (for example the
polyhedrin promoter).
In mammalian host cells, a number of viral-based expression systems may
be utilized. In cases where an adenovirus is used as an expression vector, the
antibody coding sequence of interest may be ligated to an adenovirus
transcription/translation control complex, e.g., the late promoter and
tripartite
leader sequence. This chimeric gene may then be inserted in the adenovirus
genome by in vitro or in vivo recombination. Insertion in a non- essential
region
of the viral genome (e.g., region E1 or E3) will result in a recombinant virus
that
is viable and capable of expressing the antibody molecule in infected hosts.
(e.g.,
see Logan & Shenk, 1984, Pf-oc. Natl. Acad. Sci. USA 81:355-359). Specific
initiation signals may also be required for efficient translation of inserted
antibody
coding sequences. These signals include the ATG initiation codon and adjacent
sequences. Furthermore, the initiation codon must be in phase with the reading
frame of the desired coding sequence to ensure translation of the entire
insert.
These exogenous translational control signals and initiation codons can be of
a
variety of origins, both natural and synthetic. The efficiency of expression
may be
enhanced by the inclusion of appropriate transcription enhancer elements,
transcription terminators, etc. (see Bittner et al., 1987, Methods in Enzymol.
153:51-544).
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 104 -
In addition, a host cell strain may be chosen which modulates the
expression of the inserted sequences, or modifies and processes the gene
product
in the specific fashion desired. Such modifications (e.g., glycosylation) and
processing (e.g., cleavage) of protein products may be important for the
function
of the protein. Different host cells have characteristic and specific
mechanisms for
the post-translational processing and modification of proteins and gene
products.
Appropriate cell lines or host systems can be chosen to ensure the correct
modification and processing of the foreign protein expressed. To this end,
eukaryotic host cells which possess the cellular machinery for proper
processing
of the primary transcript, glycosylation, and phosphorylation of the gene
product
may be used. Such mammalian host cells include but are not limited to CHO,
VERY, BHK, HeLa, COS, MDCK, 293, 3T3, WI38, and in particular, breast
cancer cell lines such as, for example, BT483, Hs578T, HTB2, BT20 and T47D,
and normal mammary gland cell line such as, for example, CRL7030 and
Hs578Bst.
For long-term, high-yield production of recombinant proteins, stable
expression is preferred. For example, cell lines which stably express the
antibody
molecule may be engineered. Rather than using expression vectors which contain
viral origins of replication, host cells can be transformed with DNA
controlled by
appropriate expression control elements (e.g., promoter, enhancer, sequences,
transcription terminators, polyadenylation sites, etc.), and a selectable
marker.
Following the introduction of the foreign DNA, engineered cells may be allowed
to grow for 1-2 days in an enriched media, and then are switched to a
selective
media. The selectable marker in the recombinant plasmid confers resistance to
the
selection and allows cells to stably integrate the plasmid into their
chromosomes
and grow to form foci which in turn can be cloned and expanded into cell
lines.
This method may advantageously be used to engineer cell lines which express
the
antibody molecule. Such engineered cell lines may be particularly useful in
screening and evaluation of compounds that interact directly or indirectly
with the
antibody molecule.
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 105 -
A number of selection systems may be used, including but not limited to
the herpes simplex virus thymidine kinase (Wigler et al., 1977, Cell 11:223),
hypoxanthine-guanine phosphoribosyltransferase (Szybalska & Szybalski, 192,
Proc. Natl. Acad. Sci. USA 48:202), and adenine phosphoribosyltransferase
(Lowy et al., 1980, Cell 22:817) genes can be employed in tk-, hgprt- or aprt-
cells, respectively. Also, antimetabolite resistance can be used as the basis
of
selection for the following genes: dhfr, which confers resistance to
methotrexate
(Wigler et al., 1980, Natl. Acad. Sci. USA 77:357; O'Hare et al., 1981, Proc.
Natl. Acad. Sci. USA 78:1527); gpt, which confers resistance to mycophenolic
acid (Mulligan & Berg, 1981. Proc. Natl. Acad. Sci. USA 78:2072); neo, which
confers resistance to the aminoglycoside G-418 Clinical Pharmacy 12:488-505;
Wu and Wu, 1991, Biotherapy 3:87-95; Tolstoshev, 1993, Ann. Rev. Pharmacol.
Toxicol. 32:573-596; Mulligan, 1993, Science 260:926-932; and Morgan and
Anderson, 1993, Ann. Rev. Biochem. 62:191-217; May, 1993, TIB TECH
11(5):155-215); and hygro, which confers resistance to hygromycin (Santerre et
al., 1984, Gene 30:147). Methods commonly known in the art of recombinant
DNA technology which can be used are described in Ausubel et al. (eds.), 1993,
Current Protocols in Molecular Biology, John Wiley & Sons, NY; Kriegler,
1990, Gene Transfer and Expression, A Laboratory Manual, Stockton Press, NY;
and in Chapters 12 and 13, Dracopoli et al. (eds), 1994, Current Protocols in
Human Genetics, John Wiley & Sons, NY.; Colberre-Garapin et al. , 1981, J.
Mol.
Biol. 10:1, which are incorporated by reference herein in their entireties.
The expression levels of an antibody molecule can be increased by vector
amplification (for a review, see Bebbington and Hentschel, The use of vectors
based on gene amplification for the expression of cloned genes in mammalian
cells in DNA cloning, Vol. 3. (Academic Press, New York, 1987)). When a
marker in the vector system expressing antibody is amplifiable, increase in
the level
of inhibitor present in culture of host cell will increase the number of
copies of the
marker gene. Since the amplified region is associated with the antibody gene,
production of the antibody will also increase (Grouse et al. , 1983, Mol.
Cell. Biol.
3:257).
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 106 -
The host cell may be co-transfected with two expression vectors of the
invention, the first vector encoding a heavy chain derived polypeptide and the
second vector encoding a light chain derived polypeptide. The two vectors may
contain identical selectable markers which enable equal expression of heavy
and
light chain polypeptides. Alternatively. a single vector may be used which
encodes
both heavy and light chain polypeptides. In such situations, the light chain
should
be placed before the heavy chain to avoid an excess of toxic free heavy chain
(Proudfoot, 1986, Nature 322:52; Kohler, 1980, Proc. Natl. Acad. Sci. USA
77:2197). The coding sequences for the heavy and light chains may comprise
cDNA or genomic DNA.
Once an antibody molecule of the invention has been recombinantly
expressed, it may be purified by any method known in the art for purification
of
an immunoglobulin molecule, for example, by chromatography (e.g., ion
exchange, affinity, particularly by affinity for the specific antigen after
Protein A,
and sizing column chromatography), centrifugation, differential solubility, or
by
any other standard technique for the purification of proteins.
C. Antibody Conjugates
The present invention encompasses antibodies recombinantly fused or
chemically conjugated (including both covalently and non-covalently
conjugations)
to a polypeptide (or portion thereof, preferably at least 10, 20 or 50 amino
acids
of the polypeptide) of the present invention to generate fusion proteins. The
fusion does not necessarily need to be direct, but may occur through linker
sequences. The antibodies may be specific for antigens other than polypeptides
(or portion thereof, preferably at least 10, 20 or 50 amino acids of the
polypeptide) of the present invention. For example, antibodies may be used to
target the polypeptides of the present invention to particular cell types,
either in
vitro or in vivo, by fusing or conjugating the polypeptides of the present
invention
to antibodies specific for particular cell surface receptors. Antibodies fused
or
conjugated to the polypeptides of the present invention may also be used in in
vitro immunoassays and purification methods using methods known in the art.
See
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 107 -
e.g., Harbor et al., supra, and PCT publication WO 93/21232; EP 439,095;
Naramura et al., Immunol. Lett. 39:91-99 (1994); U.S. Patent 5,474,981;
Gillies
et al., PNAS 89:1428-1432 (1992); Fell et al., J. Immunol. 146:2446-2452
( 1991 ), which are incorporated by reference in their entireties.
The present invention further includes compositions comprising the
polypeptides of the present invention fused or conjugated to antibody domains
other than the variable regions. For example, the polypeptides of the present
invention may be fused or conjugated to an antibody Fc region, or portion
thereof.
The antibody portion fused to a polypeptide of the present invention may
comprise
the constant region, hinge region, CH 1 domain, CH2 domain, and CH3 domain
or any combination of whole domains or portions thereof. The polypeptides may
also be fused or conjugated to the above antibody portions to form multimers.
For example, Fc portions fused to the polypeptides of the present invention
can
form dimers through disulfide bonding between the Fc portions. Higher
multimeric forms can be made by fusing the polypeptides to portions of IgA and
IgM. Methods for fusing or conjugating the polypeptides of the present
invention
to antibody portions are known in the art. See, e.g., U.S. Patent Nos.
5,336,603;
5,622,929; 5,359,046; 5,349,053; 5,447,851; 5,112,946; EP 307,434; EP
367,166; PCT publications WO 96/04388; WO 91 /06570; Ashkenazi et al., Proc.
Natl. Acad. Sci. USA 88:10535-10539 (1991); Zheng et al., J. Immunol.
154:5590-5600 (1995); and Vil et al., Proc. Natl. Acad. Sci. USA 89:11337-
11341 ( 1992) (said references incorporated by reference in their entireties).
As discussed, supra, the polypeptides of the present invention may be
fused or conjugated to the above antibody portions to increase the in vivo
half life
of the polypeptides or for use in immunoassays using methods known in the art.
Further, the polypeptides of the present invention may be fused or conjugated
to
the above antibody portions to facilitate purification. One reported example
describes chimeric proteins consisting of the first two domains of the human
CD4-polypeptide and various domains of the constant regions of the heavy or
light
chains of mammalian immunoglobulins. (EP 394,827; Traunecker et al., Nature
331:84-86 ( 1988). The polypeptides of the present invention fused or
conjugated
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 108 -
to an antibody having disulfide- linked dimeric structures (due to the IgG)
may
also be more efficient in binding and neutralizing other molecules, than the
monomeric secreted protein or protein fragment alone. (Fountoulakis et al., J.
Biochem. 270:3958-3964 (1995)). In many cases, the Fc part in a fusion protein
is beneficial in therapy and diagnosis, and thus can result in, for example,
improved
pharmacokinetic properties. (EP A 232,262). Alternatively, deleting the Fc
part
after the fusion protein has been expressed, detected, and purified, would be
desired. For example, the Fc portion may hinder therapy and diagnosis if the
fusion protein is used as an antigen for immunizations. In drug discovery, for
example, human proteins, such as hIL-5 receptor, have been fused with Fc
portions for the purpose of high-throughput screening assays to identify
antagonists of hIL-5. (See, D. Bennett et al., J. Molecular Recognition 8:52-
58
(1995); K. Johanson et al., J. Biol. Chem. 270:9459-9471 (1995).
Moreover, the antibodies or fragments thereof of the present invention can
be fused to marker sequences, such as a peptide to facilitates their
purification.
In preferred embodiments, the marker amino acid sequence is a hexa-histidine
peptide, such as the tag provided in a pQE vector (QIAGEN, Inc., 9259 Eton
Avenue, Chatsworth, CA, 91311 ), among others, many of which are commercially
available. As described in Gentz et al., Proc. Natl. Acad. Sci. USA 86:821-824
(1989), for instance, hexa-histidine provides for convenient purification of
the
fusion protein. Other peptide tags useful for purification include, but are
not
limited to, the "HA" tag, which corresponds to an epitope derived from the
influenzahemagglutininprotein(Wilsonetal., Cel137:767(1984))andthe"flag"
tag.
The present invention further encompasses antibodies or fragments thereof
conjugated to a diagnostic or therapeutic agent. The antibodies can be used
diagnostically to, for example, monitor the development or progression of a
tumor
as part of a clinical testing procedure to, e.g., determine the efficacy of a
given
treatment and/or prevention regimens. Detection can be facilitated by coupling
the antibody to a detectable substance. Examples of detectable substances
include
various enzymes, prosthetic groups, fluorescent materials, luminescent
materials,
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 109 -
bioluminescent materials, radioactive materials, positron emitting metals
using
various positron emission tomographies, and nonradioactive paramagnetic metal
ions. See, for example, U.S. Patent No. 4,741,900 for metal ions which can be
conjugated to antibodies for use as diagnostics according to the present
invention.
Examples of suitable enzymes include horseradish peroxidase, alkaline
phosphatase, ~3-galactosidase, or acetylcholinesterase; examples of suitable
prosthetic group complexes include streptavidin/biotin and avidin/biotin;
examples
of suitable fluorescent materials include umbelliferone, fluorescein,
fluorescein
isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride
or
phycoerythrin; an example of a luminescent material includes luminol; examples
of bioluminescent materials include luciferase, luciferin, and aequorin; and
examples of suitable radioactive material include''SI,'3'I, "'In or 99Tc.
Further, an antibody or fragment thereof may be conjugated to a
therapeutic moiety such as a cytotoxin, e.g., a cytostatic or cytocidal agent,
a
therapeutic agent or a radioactive metal ion. A cytotoxin or cytotoxic agent
includes any agent that is detrimental to cells. Examples include paclitaxol,
cytochalasin B, gramicidin D, ethidium bromide, emetine, mitomycin, etoposide,
tenoposide, vincristine, vinblastine, colchicin, doxorubicin, daunorubicin,
dihydroxy anthracin dione, mitoxantrone, mithramycin, actinomycin D,
1-dehydrotestosterone, glucocorticoids, procaine, tetracaine, lidocaine,
propranolol, and puromycin and analogs or homologs thereof. Therapeutic agents
include, but are not limited to, antimetabolites (e.g., methotrexate,
6-mercaptopurine, 6-thioguanine, cytarabine, 5-fluorouracil decarbazine),
alkylating agents (e.g., mechlorethamine, thioepa chlorambucil, melphalan,
carmustine (BSNU) and lomustine (CCNU), cyclothosphamide, busulfan,
dibromomannitol, streptozotocin, mitomycin C, and cis-dichlorodiamine platinum
(II) (DDP) cisplatin), anthracyclines (e.g., daunorubicin (formerly
daunomycin)
and doxorubicin), antibiotics (e.g., dactinomycin (formerly actinomycin),
bleomycin, mithramycin, and anthramycin (AMC)), and anti-mitotic agents (e.g.,
vincristine and vinblastine).
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 110 -
The conjugates of the invention can be used for modifying a given
biological response, the therapeutic agent or drug moiety is not to be
construed
as limited to classical chemical therapeutic agents. For example, the drug
moiety
may be a protein or polypeptide possessing a desired biological activity. Such
proteins may include, for example, a toxin such as abrin, ricin A, pseudomonas
exotoxin, or diphtheria toxin; a protein such as tumor necrosis factor, a-
interferon,
13-interferon, nerve growth factor, platelet derived growth factor, tissue
plasminogen activator, a thrombotic agent or an anti-angiogenic agent, e.g.,
angiostatin or endostatin; or, biological response modifiers such as, for
example,
lymphokines, interleukin-1 ("IL-1 "), interleukin-2 ("IL-2"), interleukin-6
("IL-6"),
granulocyte macrophase colony stimulating factor ("GM-CSF"), granulocyte
colony stimulating factor ("G-CSF"), or other growth factors.
Antibodies may also be attached to solid supports, which are particularly
useful for immunoassays or purification of the target antigen. Such solid
supports
include, but are not limited to, glass, cellulose, polyacrylamide, nylon,
polystyrene,
polyvinyl chloride or polypropylene.
Techniques for conjugating such therapeutic moiety to antibodies are well
known, see, e.g., Arnon et al., "Monoclonal Antibodies For Immunotargeting Of
Drugs In Cancer Therapy", in Monoclonal Antibodies And Cancer Therapy,
Reisfeld et al. (eds.), pp. 243-56 (Alan R. Liss, Inc. 1985); Hellstrom et
al.,
"Antibodies For Drug Delivery", in Controlled Drug Delivery (2nd Ed.),
Robinson et al. (eds.), pp. 623-53 (Marcel Dekker, Inc. 1987); Thorpe,
"Antibody
Carriers Of Cytotoxic Agents In Cancer Therapy: A Review", in Monoclonal
Antibodies '84: Biological And Clinical Applications, Pinchera et al. (eds.),
pp.
475-506 (1985); "Analysis, Results, And Future Prospective Of The Therapeutic
Use Of Radiolabeled Antibody In Cancer Therapy", in Monoclonal Antibodies For
Cancef° Detection And Therapy, Baldwin et al. (eds.), pp. 303-16
(Academic
Press 1985), and Thorpe et al., "The Preparation And Cytotoxic Properties Of
Antibody-Toxin Conjugates", Immunol. Rev. 62:119-58 (1982).
CA 02374674 2001-11-20
WO 00/71150 PCT/LTS00/13515
- 111 -
Alternatively, an antibody can be conjugated to a second antibody to form
an antibody heteroconjugate as described by Segal in U.S. Patent No.
4,676,980,
which is incorporated herein by reference in its entirety.
An antibody, with or without a therapeutic moiety conjugated to it,
administered alone or in combination with cytotoxic factors) and/or
cytokine(s)
can be used as a therapeutic.
D. Assays For Antibody Binding
The antibodies ofthe invention may be assayed for immunospecific binding
by any method known in the art. The immunoassays which can be used include
but are not limited to competitive and non-competitive assay systems using
techniques such as western blots, radioimmunoassays, ELISA (enzyme linked
immunosorbent assay), "sandwich" immunoassays, immunoprecipitation assays,
precipitin reactions, gel diffusion precipitin reactions, immunodiffusion
assays,
agglutination assays, complement-fixation assays, immunoradiometric assays,
fluorescent immunoassays, protein A immunoassays, to name but a few. Such
assays are routine and well known in the art (see, e.g., Ausubel et al., eds,
1994,
Current Protocols in Molecular Biology, Vol. l, John Wiley & Sons, Inc., New
York, which is incorporated by reference herein in its entirety). Exemplary
immunoassays are described briefly below (but are not intended by way of
limitation).
Immunoprecipitation protocols generally comprise lysing a population of
cells in a lysis buffer such as RIPA buffer ( 1 % NP-40 or Triton X-100, 1 %
sodium
deoxycholate, 0.1 % SDS, 0.15 M NaCI, 0.01 M sodium phosphate at pH 7.2, 1
Trasylol) supplemented with protein phosphatase and/or protease inhibitors
(e.g.,
EDTA, PMSF, aprotinin, sodium vanadate), adding the antibody of interest to
the
cell lysate, incubating for a period of time (e.g., 1-4 hours) at 4° C,
adding protein
A and/or protein G sepharose beads to the cell lysate, incubating for about an
hour
or more at 4° C, washing the beads in lysis buffer and resuspending the
beads in
SDS/sample buffer. The ability of the antibody of interest to
immunoprecipitate
a particular antigen can be assessed by, e.g. , western blot analysis. One of
skill in
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 112 -
the art would be knowledgeable as to the parameters that can be modified to
increase the binding of the antibody to an antigen and decrease the background
(e.g., pre-clearing the cell lysate with sepharose beads). For further
discussion
regarding immunoprecipitation protocols see, e.g., Ausubel et al., eds, 1994,
Current Protocols in Molecular Biology, Vol. 1, John Wiley & Sons, Inc., New
York at 10.16.1.
Western blot analysis generally comprises preparing protein samples,
electrophoresis of the protein samples in a polyacrylamide gel (e.g., 8%-20%
SDS-PAGE depending on the molecular weight of the antigen), transferring the
protein sample from the polyacrylamide gel to a membrane such as
nitrocellulose,
PVDF or nylon, blocking the membrane in blocking solution (e.g., PBS with 3%
BSA or non-fat milk), washing the membrane in washing buffer (e.g., PBS-Tween
20), blocking the membrane with primary antibody (the antibody of interest)
diluted in blocking buffer, washing the membrane in washing buffer, blocking
the
membrane with a secondary antibody (which recognizes the primary antibody,
e.g., an anti-human antibody) conjugated to an enzymatic substrate (e.g.,
horseradish peroxidase or alkaline phosphatase) or radioactive molecule (e.g.,
3zP
or 'z5I) diluted in blocking buffer, washing the membrane in wash buffer, and
detecting the presence of the antigen. One of skill in the art would be
knowledgeable as to the parameters that can be modified to increase the signal
detected and to reduce the background noise. For further discussion regarding
western blot protocols see, e.g., Ausubel et al., eds, 1994, Current Protocols
in
Molecular Biology, Vol. l, John Wiley & Sons, Inc., New York at 10.8.1.
ELISAs comprise preparing antigen, coating the well of a 96 well
microtiter plate with the antigen, adding the antibody of interest conjugated
to a
detectable compound such as an enzymatic substrate (e. g. , horseradish
peroxidase
or alkaline phosphatase) to the well and incubating for a period of time, and
detecting the presence of the antigen. In ELISAs the antibody of interest does
not
have to be conjugated to a detectable compound: instead, a second antibody
(which recognizes the antibody of interest) conjugated to a detectable
compound
may be added to the well. Further, instead of coating the well with the
antigen,
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 113 -
the antibody may be coated to the well. In this case, a second antibody
conjugated
to a detectable compound may be added following the addition of the antigen of
interest to the coated well. One of skill in the art would be knowledgeable as
to
the parameters that can be modified to increase the signal detected as well as
other
variations of ELISAs known in the art. For further discussion regarding ELISAs
see, e.g., Ausubel et al., eds, 1994, Current Protocols in Molecular Biology,
Vol.
l, John Wiley & Sons, Inc., New York at 11.2.1.
The binding affinity of an antibody to an antigen and the off rate of an
antibody-antigen interaction can be determined by competitive binding assays.
One example of a competitive binding assay is a radioimmunoassay comprising
the
incubation of labeled antigen (e.g., 3H or'ZSI) with the antibody of interest
in the
presence of increasing amounts of unlabeled antigen, and the detection of the
antibody bound to the labeled antigen. The affinity of the antibody of
interest for
a particular antigen and the binding off rates can be determined from the data
by
scatchard plot analysis. Competition with a second antibody can also be
determined using radioimmunoassays. In this case, the antigen is incubated
with
antibody of interest is conjugated to a labeled compound (e.g., 3H or'Z5I) in
the
presence of increasing amounts of an unlabeled second antibody.
E. Antibody Based Therapies
The present invention is further directed to antibody-based therapies v~Thich
involve administering antibodies of the invention to an animal, preferably a
mammal, and most preferably a human patient for treating and/or preventing one
or more of the disorders or conditions described herein. Therapeutic compounds
of the invention include, but are not limited to, antibodies of the invention
(including fragments, analogs and derivatives thereof as described herein) and
nucleic acids encoding antibodies of the invention (including fragments,
analogs
and derivatives thereof as described herein).
While not intending to be bound to theory, TRID receptors are believed
to inhibit programmed cell death by a process which involves the binding of
TRID
ligands (e.g., TRAIL) which are then not available to bind to receptors which
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 114 -
mediate programmed cell death. Thus, agents (e.g., antibodies) which prevent
binding of ligand to TRID will enhance programmed cell death.
As noted above, TRID receptors have been shown to bind TRAIL. TRID
receptors are also known to be present in a number of tissues and on the
surfaces
of a number of cell types.
TRAIL is a member of the TNF family of cytokines which has been shown
to induce apoptotic cell death in a number of tumor cell lines and appears to
mediate its apoptosis inducing effects through interaction with, e.g., DR4 and
DRS receptors. These death domain containing receptors are believed to form
membrane-bound self activating signaling complexes which initiate apoptosis
through cleavage of caspases.
In addition, and as shown herein, TRAIL also binds to several receptors
proposed to be "decoy" receptors, e.g., TRID, DcR2 (a receptor with a
truncated
death domain), DcRI (a GPI-anchored receptor), and OPG (a secreted protein
which binds to another member of the TNF family, RANKL).
Antibodies which bind to TRID receptors are useful for treating and/or
preventing diseases and conditions associated with increased or decreased
apoptotic cell death. Further, these antibodies vary in the effect they have
on
TRID receptors. These effects differ based on the specific portions of the
TRID
receptor to which the antibodies bind, the three-dimensional conformation of
the
antibody molecules themselves, and/or the manner in which they interact with
the
TRID receptor. Thus, antibodies which bind to the extracellular domain of a
TRID receptor can either stimulate or inhibit TRID activities (e.g., the
binding of
TRAIL). Antibodies which stimulate TRID receptor's ability to bind TRAIL are
TRAIL binding facilitators, and antibodies which inhibit TRID receptor
activities
(e.g., by blocking the binding of TRAIL) are TRID antagonists. In addition,
TRID has an intracellular domain which may be involved in an intracellular
signaling pathway. Agonists, including antibodies, are molecules which bind
TRID in a manner which stimulates the intracellular signaling pathway.
Antibodies ofthe invention which function as agonists and antagonists, and
TRAIL binding facilitators of TRID receptors include antigen-binding antibody
CA 02374674 2001-11-20
WO 00/71150 PCT/LJS00/13515
- 115 -
fragments such as Fab and F(ab')2 fragments, Fd, single-chain Fvs (scFv),
disulfide-linked Fvs (sdFv) and fragments comprising either a V~ or VH domain,
as well as polyclonal, monoclonal and humanized antibodies. Each of these
antigen-binding antibody fragments and antibodies are described in more detail
elsewhere herein.
In view of the above, antibodies of the invention, as well as other TRID
antagonists, are useful for inhibiting TRID activity, thereby promoting
apoptosis
in cells which express TRID receptors (e.g., cancer cells). Antibodies ofthis
type
are useful for prevention andlor treating diseases and conditions associated
with
increased cell survival and/or insensitivity to apoptosis-inducing agents
(e.g.,
TRAIL), such as solid tissue cancers (e.g., skin cancer, head and neck tumors,
breast tumors, endothelioma, lung cancer, osteoblastoma, osteoclastoma, and
Kaposi's sarcoma) and leukemias.
The invention encompasses anti-TRID antibodies that enhance the binding
of TRAIL, denoted herein as TRAIL binding facilitators. TRAIL binding
facilitators function by preventing apoptosis and are useful for preventing
and/or
treating diseases associated with increased apoptotic cell death. Examples of
such
diseases include diabetes mellitus, AIDS, neurodegenerative disorders,
myelodysplastic syndromes, ischemic injury, toxin-induced liver disease,
septic
shock, cachexia and anorexia.
When an antagonist of the invention is administered to an individual for the
treatment and/or prevention of a disease or condition associated with
increased
T-cell populations or increased cell proliferation (e. g., cancer), the
antagonist may
be co-administered with another agent which induces apoptosis (e.g., TRAIL) or
otherwise inhibits cell proliferation (e.g., an anti-cancer drug). Combination
therapies of this nature, as well as other combination therapies, are
discussed
below in more detail.
Further, TRAIL binding facilitators of the invention (e.g., TRID
antibodies which enhance the binding of TRAIL) are also useful for enhancing
T-cell mediated immune responses, as well as preventing and/or treating
diseases
and conditions associated with decreased T-cell proliferation. Antibodies of
the
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 116 -
invention which enhance the binding of TRID receptor ligands to TRID receptors
can inhibit T-cell apoptosis. The inhibition of apoptosis can, for example,
either
result in an increase in the expansion rate of in vivo T-cell populations or
prevent
a decrease in the size of such populations. Thus, TRAIL binding facilitators
of the
invention can be used to prevent and/or treat diseases or conditions
associated
with decreased or decreases in T-cell populations. Examples of such diseases
and
conditions include acquired immune deficiency syndrome (AIDS) and related
afflictions (e.g., AIDS related complexes), T-cell immunodeficiencies,
radiation
sickness, and T-cell depletion due to radiation and/or chemotherapy.
When a TRAIL binding facilitator of the invention is administered to an
individual for the treatment and/or prevention of a disease or condition
associated
with decreased T-cell populations, the TRAIL binding facilitator may be
co-administered with an agent which activates and/or induces lymphocyte
proliferation (e.g., a cytokine). Combination therapies of this nature, as
well as
other combination therapies, are discussed below in more detail.
TRID antibodies are thus useful for treating and/or preventing
malignancies, abnormalities, diseases and/or conditions involving tissues and
cell
types which express TRID receptors. Further, malignancies, abnormalities,
diseases and/or conditions which can be treated and/or prevented by the
induction
of programmed cell death in cells which express TRID receptors can be treated
and/or prevented using TRID receptor antagonists of the invention. Similarly,
malignancies, abnormalities, diseases and/or conditions which can be treated
and/or prevented by inhibiting programmed cell death in cells which express
TRID
receptors can be treated and/or prevented using TRID receptor TRAIL binding
facilitators of the invention.
A number of additional malignancies, abnormalities, diseases and/or
conditions which can be treated using the TRAIL binding facilitators,
agonists,
and antagonists of the invention are set out elsewhere herein, for example, in
the
section below entitled "Modes of Administration".
The antibodies of the present invention may be used therapeutically in a
number of ways. For example, antibodies which bind polynucleotides or
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 117 -
polypeptides of the present invention can be administered to an individual
(e.g.,
a human) either locally or systemically. Further, these antibodies can be
administered alone, in combination with another therapeutic agent, or
associated
with or bound to a toxin.
TRID antibodies may be utilized in combination with other monoclonal or
chimeric antibodies, or with lymphokines, tumor necrosis factors or TNF-
related
molecules (e.g., TNF-a, TNF-~3, TNF-y, TNF-y-a, TNF-y-(3, and TRAIL), or
hematopoietic growth factors (e.g., IL-2, IL-3 and IL-7). For example,
antagonistic TRID antibodies may be administered in conjunction with TRAIL
when one seeks to induce programmed cell death in cells which express TRID
receptors of the invention. Combination therapies of this nature, as well as
other
combination therapies, are discussed below in more detail.
The antibodies of the invention may be administered alone or in
combination with other types of treatments (e. g. , radiation therapy,
chemotherapy,
hormonal therapy, immunotherapy and anti-tumor agents). Generally,
administration of products of a species origin or species reactivity (in the
case of
antibodies) that is the same species as that of the patient is preferred.
Thus, in a
preferred embodiment, human antibodies, fragments derivatives, analogs, or
nucleic acids, are administered to a human patient for therapy or prophylaxis.
It is preferred to use high affinity and/or potent in vivo inhibiting and/or
neutralizing antibodies against polypeptides or polynucleotides of the present
invention, fragments or regions thereof, for both immunoassays directed to and
therapy of disorders related to polynucleotides or polypeptides, including
fragments thereof, of the present invention. Such antibodies, fragments, or
regions, will preferably have an affinity for polynucleotides or polypeptides,
including fragments thereof. Preferred binding affinities include those with a
dissociation constant or Kd less than SX10-6M,10-6M, SX10-'M,10-'M, SX 10-8M,
10-8M, SX10-9M,10-9M, SX10-'°M, 10-'°M, SX10-"M,10-"M, 5X10-
'ZM,10-'ZM,
SX10-''M, 10-''M, SX10-'4M, 10-'4M, SX10-'SM, and 10~'SM.
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 118 -
Immune System-Related Disorders
Diagnosis
The present inventors have discovered that TRID is expressed in
hematopoeitic tissues and other normal human tissues. For a number of immune
system-related disorders, substantially altered (increased or decreased)
levels of
TRID gene expression can be detected in immune system tissue or other cells or
bodily fluids (e.g,, sera and plasma) taken from an individual having such a
disorder, relative to a "standard" TRID gene expression level, that is, the
TRID
expression level in immune system tissues or bodily fluids from an individual
not
having the immune system disorder. Thus, the invention provides a diagnostic
method useful during diagnosis of an immune system disorder, which involves
measuring the expression level of the gene encoding the TRID protein in immune
system tissue or other cells or body fluid from an individual and comparing
the
measured gene expression level with a standard TRID gene expression level,
whereby an increase or decrease in the gene expression level compared to the
standard is indicative of an immune system disorder.
In particular, it is believed that certain tissues in mammals with cancer
express significantly enhanced levels of the TRID protein and mRNA encoding
the
TRID when compared to a corresponding "standard" level. Further, it is
believed
that enhanced levels of the TRID protein can be detected in certain body
fluids
(e.g. , sera and plasma) from mammals with such a cancer when compared to sera
from mammals of the same species not having the cancer.
Thus, the invention provides a diagnostic method useful during diagnosis
of an immune system disorder, including cancers which involves measuring the
expression level of the gene encoding the TRID protein in immune system tissue
or other cells or body fluid from an individual and comparing the measured
gene
expression level with a standard TRID gene expression level, whereby an
increase
or decrease in the gene expression level compared to the standard is
indicative of
an immune system disorder.
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 1 I9 -
Where a diagnosis of a disorder in the immune system including diagnosis
of a tumor has already been made according to conventional methods, the
present
invention is useful as a prognostic indicator, whereby patients exhibiting
altered
(particularly enhanced) gene expression will experience a worse clinical
outcome
relative to patients expressing the gene at a level nearer the standard level.
By "assaying the expression level of the gene encoding a TRID protein"
is intended qualitatively or quantitatively measuring or estimating the level
of
TRID or the level of the mRNA encoding TRID in a first biological sample
either
directly (e. g. , by determining or estimating absolute protein level or mRNA
level)
or relatively (e.g., by comparing to the TRID protein level or mRNA level in a
second biological sample). Preferably. the TRID protein level or mRNA level in
the first biological sample is measured or estimated and compared to a
standard
TRID protein level or mRNA level, the standard being taken from a second
biological sample obtained from an individual not having the disorder or being
determined by averaging levels from a population of individuals not having a
disorder of the immune system. As will be appreciated in the art, once
standard
TRID protein levels or mRNA levels are known, they can be used repeatedly as
a standard for comparison.
By "biological sample" is intended any biological sample obtained from an
individual, body fluid, cell line, tissue culture, or other source which
contains
TRID protein or mRNA. As indicated, biological samples include body fluids
(such as sera, plasma, urine, synovial fluid and spinal fluid) which contain
free
extracellular domains) (or soluable form(s)) of a TRID protein, immune system
tissue, and other tissue sources found to express complete or extracellular
domain
of TRID. Methods for obtaining tissue biopsies and body fluids from mammals
are well known in the art. Where the biological sample is to include mRNA, a
tissue biopsy is the preferred source.
The invention also contemplates the use of a gene of the present invention
for diagnosing mutations in the TRID gene. For example, if a mutation is
present
in one of the genes of the present invention, conditions would result from a
lack
of production of the receptor polypeptides of the present invention. Further,
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 120 -
mutations which enhance receptor polypeptide activity would lead to diseases
associated with an over expression of the receptor polypeptide, e.g.,
endotoxic
shock. Mutations in the genes can be detected by comparing the sequence of the
defective gene with that of a normal one. Subsequently one can verify that a
mutant gene is associated with a disease condition or the susceptibility to a
disease
condition. That is, a mutant gene which leads to the overexpression of TRID
would be associated with an inability of TRAIL to inhibit tumor growth.
Other immune system disorders which may be diagnosed by the foregoing
assays include hypersensitivity, allergy, infectious disease, graft-host
disease,
immunodeficiency, autoimmune diseases and the like.
Individuals carrying mutations in the genes of the present invention may
be detected at the DNA level by a variety of techniques. Nucleic acids used
for
diagnosis may be obtained from a patient's cells, such as from blood, urine,
saliva
and tissue biopsy among other tissues. The genomic DNA may be used directly
for detection or may be amplified enzymatically by using PCR (Saiki et al.,
Nature,
324:163-166 (1986)) prior to analysis. RNA or cDNA may also be used for the
same purpose. As an example, PCR primers complementary to the nucleic acid
of the instant invention can be used to identify and analyze mutations in the
human
genes of the present invention. For example, deletions and insertions can be
detected by a change in the size of the amplified product in comparison to the
normal genotype. Point mutations can be identified by hybridizing amplified
DNA
to radiolabeled RNA or alternatively, radiolabeled antisense DNA sequences of
the present invention. Perfectly matched sequences can be distinguished from
mismatched duplexes by RNase A digestion or by differences in melting
temperatures. Such a diagnostic would be particularly useful for prenatal or
even
neonatal testing.
Sequence differences between the reference gene and "mutants" may be
revealed by the direct DNA sequencing method. In addition, cloned DNA
segments may be used as probes to detect specific DNA segments. The
sensitivity
of this method is greatly enhanced when combined with PCR. For example, a
sequencing primary used with double stranded PCR product or a single stranded
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 121 -
template molecule generated by a modified PCR product. The sequence
determination is performed by conventional procedures with radiolabeled
nucleotides or by automatic sequencing procedures with fluorescent tags.
Sequence changes at the specific locations may be revealed by nuclease
protection assays, such as RNase and S 1 protection or the chemical cleavage
method (for example, Cotton et al., PNAS, 85:4397-4401 (1985)).
Assaying TRID protein levels in a biological sample can occur using
antibody-based techniques. For example, TRID protein expression in tissues can
be studied with classical immunohistological methods (Jalkanen, M., et al.,
.I.
Cell. Biol. 101: 976-985 (1985); Jalkanen, M., etal., J. Cell. Biol. 105:3087-
3096
( 1987)). Other antibody-based methods useful for detecting TRID gene
expression include immunoassays, such as the enzyme linked immunosorbent assay
(ELISA) and the radioimmunoassay (RIA). Suitable antibody assay labels are
known in the art and include enzyme labels, such as, glucose oxidase, and
radioisotopes, such as iodine ('25I, '2'I), carbon ('4C), sulfur (35S),
tritium (3H),
indium ("'In), and technetium (99mTc), and fluorescent labels, such as
fluorescein
and rhodamine, and biotin.
In addition to assaying TRID protein levels in a biological sample obtained
from an individual, TRID proteins can also be detected in vivo by imaging.
Antibody labels or markers for in vivo imaging of TRID proteins include those
detectable by X-radiography, NMR or ESR. For X-radiography, suitable labels
include radioisotopes such as barium or cesium, which emit detectable
radiation
but are not overtly harmful to the subject. Suitable markers for NMR and ESR
include those with a detectable characteristic spin, such as deuterium, which
may
be incorporated into the antibody by labeling of nutrients for the relevant
hybridoma.
A TRID-specific antibody or antibody fragment which has been labeled
with an appropriate detectable imaging moiety, such as a radioisotope (for
example,'3'I, "'In 99mTC), a radio-opaque substance, or a material detectable
by
nuclear magnetic resonance, is introduced (for example, parenterally,
subcutaneously or intraperitoneally) into the mammal to be examined for immune
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 122 -
system disorder. It will be understood in the art that the size of the subject
and the
imaging system used will determine the quantity of imaging moiety needed to
produce diagnostic images. In the case of a radioisotope moiety, for a human
subject, the quantity of radioactivity injected will normally range from about
5 to
20 millicuries of 99"'Tc. The labeled antibody or antibody fragment will then
preferentially accumulate at the location of cells which contain TRID protein.
In
vivo tumor imaging is described in S. W. Burchiel et al.,
"Immunopharmacokinetics
of Radiolabeled Antibodies and Their Fragments" (Chapter 13 in Tumor Imaging:
The Radiochemical Detection of Cancer, S. W. Burchiel and B..A. Rhodes, eds.,
Masson Publishing Inc. ( 1982)).
Treatment
The Tumor Necrosis Factor (TNF) family ligands are known to be among
the most pleiotropic cytokines, inducing a large number of cellular responses,
including cytotoxicity, anti-viral activity, immunoregulatory activities, and
the
transcriptional regulation of several genes (Goeddel, D.V. etal., "Tumor
Necrosis
Factors: Gene Structure and Biological Activities," Symp. Quant. Biol. 51:597-
609 ( 1986), Cold Spring Harbor; Beutler, B., and Cerami, A., Annu. Rev.
Biochem. 57:505-518 (1988); Old, L.J., Sci. Am. 258:59-75 (1988); Fiers, W.,
FEBS Lett. 285:199-224 ( 1991 )). The TNF-family ligands induce such various
cellular responses by binding to TNF-family receptors. Cells which express a
TRID polypeptide and are believed to have a potent cellular response to TNFR
ligands include lymphocytes, endothelial cells, keratinocytes, and prostate
tissue.
By "a cellular response to a TNF-family ligand" is intended any genotypic,
phenotypic, and/or morphologic change to a cell, cell line, tissue, tissue
culture or
patient that is induced by a TNF-family ligand. As indicated, such cellular
responses include not only normal physiological responses to TNF-family
ligands,
but also diseases associated with increased apoptosis or the inhibition of
apoptosis.
TRID polynucleotides, polynucleotides, TRAIL binding facilitators,
agonists, and/or antagonists of the invention may be administered to a patient
(e.g., mammal, preferably human) afflicted with any disease or disorder
mediated
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 123 -
(directly or indirectly) by defective, or deficient levels of, TRID.
Alternatively, a
gene therapy approach may be applied to treat such diseases or disorders. In
one
embodiment of the invention, TRID polynucleotide sequences are used to detect
mutein TRID genes, including defective genes. Mutein genes may be identified
in in vitro diagnostic assays, and by comparison of the TRID nucleotide
sequence
disclosed herein with that of a TRID gene obtained from a patient suspected of
harboring a defect in this gene. Defective genes may be replaced with normal
TRID -encoding genes using techniques known to one skilled in the art.
In another embodiment, the TRID polypeptides, polynuc,leotides, TRAIL
binding facilitators, agonists, and/or antagonists of the present invention
are used
as research tools for studying the phenotypic effects that result from
inhibiting
TRAIL/TRID interactions on various cell types. TRID polypeptides and
antagonists (e.g. monoclonal antibodies to TRID) also may be used in in vitro
assays for detecting TRAIL or TRID or the interactions thereof.
It has been reported that certain ligands of the TNF family (of which
TRAIL is a member) bind to more than one distinct cell surface receptor
protein.
For example, a receptor protein designated DR4 reportedly binds TRAIL, but is
distinct from the TRID of the present invention (Pan et al., Science 276:111-
113,
( 1997); hereby incorporated by reference). In another embodiment, a purified
TRID polypeptide, TRAIL binding facilitator, agonist, and/or antagonist is
used
to inhibit binding of TRAIL to endogenous cell surface TRAIL receptors. By
competing for TRAIL binding, soluble TRID polypeptides ofthe present invention
may be employed to inhibit the interaction of TRAIL not only with cell surface
TRID, but also with TRAIL receptor proteins distinct from TRID.
Thus, in a further embodiment, TRID polynucleotides, polynucleotides,
TRAIL binding facilitators, agonists, and/or antagonists ofthe invention are
used
to inhibit a functional activity of TRAIL, in in vitro or in vivo procedures.
By
inhibiting binding of TRAIL to cell surface receptors, TRID also inhibits
biological
effects that result from the binding of TRAIL to endogenous receptors. Various
forms of TRID may be employed, including, for example, the above-described
TRID fragments, derivatives, and variants that are capable of binding TRAIL.
In
CA 02374674 2001-11-20
WO 00/71150 PCT/L1S00/13515
- 124 -
a preferred embodiment, a soluble TRID, is employed to inhibit a functional
activity of TRAIL, e.g., to inhibit TRAIL-mediated apoptosis of cells
susceptible
to such apoptosis. Thus, in an additional embodiment, TRID is administered to
a
mammal (e.g., a human) to treat a TRAIL-mediated disorder. Such
TRAIL-mediated disorders include conditions caused (directly or indirectly) or
exacerbated by TRAIL.
Diseases associated with increased cell survival, or the inhibition of
apoptosis, include cancers (such as follicular lymphomas, carcinomas with p53
mutations, and hormone-dependent tumors, including, but not, limited to colon
cancer, cardiac tumors, pancreatic cancer, melanoma, retinoblastoma,
glioblastoma, lung cancer, intestinal cancer, testicular cancer, stomach
cancer,
neuroblastoma, myxoma, myoma, lymphoma, endothelioma, osteoblastoma,
osteoclastoma, osteosarcoma, chondrosarcoma, adenoma, breast cancer, prostate
cancer, Kaposi's sarcoma and ovarian cancer); autoimmune disorders (such as
multiple sclerosis, Sjogren's syndrome, Hashimoto's thyroiditis, biliary
cirrhosis,
Behcet's disease, Crohn's disease, polymyositis, systemic lupus erythematosus
and
immune-related glomerulonephritis rheumatoid arthritis) and viral infections
(such
as herpes viruses, pox viruses and adenoviruses), information graft v. host
disease,
acute graft rejection, and chronic graft rejection. In preferred embodiments,
TRID
polynucleotides, polypeptides, and/or antagonists of the invention are used to
inhibit growth, progression, and/or metasis of cancers, in particular those
listed
above and in the following paragraph.
Additional diseases or conditions associated with increased cell survival
include, but are not limited to, progression, and/or metastases of
malignancies and
related disorders such as leukemia (including acute leukemias (e.g., acute
lymphocytic leukemia, acute myelocytic leukemia (including myeloblastic,
promyelocytic, myelomonocytic, monocytic, and erythroleukemia)) and chronic
leukemias (e.g., chronic myelocytic (granulocytic) leukemia and chronic
lymphocytic leukemia)), polycythemia vera, lymphomas (e.g. , Hodgkin's disease
and non-Hodgkin's disease), multiple myeloma, Waldenstrom's
macroglobulinemia, heavy chain disease, and solid tumors including, but not
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-125-
limited to, sarcomas and carcinomas such as fibrosarcoma, myxosarcoma,
liposarcoma, chondrosarcoma, osteogenic sarcoma, chordoma, angiosarcoma,
endotheliosarcoma, lymphangiosarcoma, lymphangioendotheliosarcoma,
synovioma, mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma,
colon carcinoma, pancreatic cancer, breast cancer, ovarian cancer, prostate
cancer,
squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland
carcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary
adenocarcinomas, cystadenocarcinoma, medullary carcinoma, bronchogenic
carcinoma, renal cell carcinoma, hepatoma, bile duct carcinoma,
choriocarcinoma,
seminoma, embryonal carcinoma, Wilm's tumor, cervical cancer, testicular
tumor,
lung carcinoma, small cell lung carcinoma, bladder carcinoma, epithelial
carcinoma, glioma, astrocytoma, medulloblastoma, craniopharyngioma,
ependymoma, pinealoma, hemangioblastoma, acoustic neuroma,
oligodendroglioma, menangioma, melanoma, neuroblastoma, and retinoblastoma.
Diseases associated with increased apoptosis include AIDS;
neurodegenerative disorders (such as Alzheimer's disease, Parkinson's disease,
Amyotrophic lateral sclerosis, Retinitis pigmentosa, Cerebellar degeneration
and
brain tumor or prior associated disease); autoimmune disorders (such as,
multiple
sclerosis, Sjogren's syndrome, Hashimoto's thyroiditis, biliary cirrhosis,
Behcet's
disease, Crohn's disease, polymyositis, systemic lupus erythematosus and
immune-
related glomerulonephritis and rheumatoid arthritis), myelodysplastic
syndromes
(such as aplastic anemia), graft v. host disease, ischemic injury (such as
that
caused by myocardial infarction, stroke and reperfusion injury), liver injury
(such
as hepatitis related liver injury, ischemia/reperfusion injury, cholestosis
(bile duct
injury) and liver cancer), toxin-induced liver disease (such as that caused by
alcohol), septic shock, cachexia and anorexia. In preferred embodiments, TRID
polynucleotides, polypeptides TRAIL binding facilitators, and/or agonists axe
used
to treat the diseases and disorders listed above.
Many of the pathologies associated with HIV are mediated by apoptosis,
including HIV-induced nephropathy and HIV encephalitis. Thus, in additional
preferred embodiments, TRID polynucleotides, polypeptides, TRAIL binding
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 126 -
facilitators, and/or TRID agonists of the invention are used to treat AIDS and
pathologies associated with AIDS.
Another embodiment of the present invention is directed to the use of
TRID to reduce TRAIL-mediated death of T cells in HIV-infected patients. The
role of T cell apoptosis in the development of AIDS has been the subject of a
number of studies (see, for example, Meyaard et al., Science 257:217-219,
1992;
Groux et al., .I Exp. Med., 175:331, 1992; and Oyaizu et al., in Cell
Activation
and Apoptosis in HIV Infection, Andrieu and Lu, Eds., Plenum Press, New York,
1995, pp. 101-114). Fas-mediated apoptosis has been implicated in the loss of
T
cells in HIV individuals (Katsikis et al., J. Exp. Med. 181:2029-2036, 1995).
The state of immunodeficiency that defines AIDS is secondary to a decrease in
the
number and function of CD4y T-lymphocytes. Recent reports estimate the daily
loss of CD4~ T cells to be between 3.5 X 10' and 2 X 109 cells (Wei X., et
al.,
Nature 373:117-122 (1995)). One cause of CD4' T cell depletion in the setting
of HIV infection is believed to be HIV-induced apoptosis. Indeed, HIV-induced
apoptotic cell death has been demonstrated not only in vitro but also, more
importantly, in infected individuals (Ameisen, J.C., AIDS 8:1197-1213 (1994) ;
Finkel, T.H., and Banda, N.K., Curr. Opin. Immunol. 6:605-615(1995); Muro-
Cacho, C.A. et al., J. Immunol. 14:5555-5566 (1995)). Furthermore, apoptosis
and CD4+ T-lymphocyte depletion is tightly correlated in different animal
models
of AIDS (Brunner, T., et al., Nature 373:441-444 (1995); Gougeon, M.L., et
al.,
AIDSRes. Hum. Retroviruses 9:553-563 (1993)) and, apoptosis is not observed
in those animal models in which viral replication does not result in AIDS
(Gougeon, M.L. et al., AIDS Res. Hum. Retroviruses 9:553-563 ( 1993)). Further
data indicates that uninfected but primed or activated T lymphocytes from HIV-
infected individuals undergo apoptosis after encountering the T'NF-family
ligand
Fast. Using monocytic cell lines that result in death following HIV infection,
it
has been demonstrated that infection of U937 cells with HIV results in the de
novo
expression of Fast and that Fast mediates HIV-induced apoptosis (Badley, A.D.
et al., J. Virol. 70:199-206 ( 1996)). Further the TNF-family ligand was
detectable
in uninfected macrophages and its expression was upregulated following HIV
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 127 -
infection resulting in selective killing of uninfected CD4 T-lymphocytes
(Badley,
A.D et al., J. virol. 70:199-206 (1996)). It is also possible that T cell
apoptosis
occurs through multiple mechanisms.
Thus, by the invention, a method for treating HIV individuals is provided
which involves administering soluble TRID (e.g., the extracellular domain)
and/or
TRID agonists of the present invention to reduce selective killing of CD4' T-
lymphocytes. Modes of administration and dosages are discussed in detail
below.
While not wanting to be bound by theory, activated human T-cells are believed
to
be induced to undergo programmed cell death (apoptosis) upon triggering
through
the CD3/T-cell receptor complex, a process termed activated-induced cell death
(AICD). AICD of CD4+ T-cells isolated from HIV-Infected asymptomatic
individuals has been reported (Groux et al., supra). Thus, AICD may play a
role
in the depletion of CD4+ T-cells and the progression to AIDS in HIV-infected
individuals. Thus, the present invention provides a method of inhibiting
TRAIL-mediated T-cell death in HIV patients, comprising administering a TRID
polypeptide of the invention (preferably, a soluble TRID polypeptide) and/or
TRID agonist of the invention to the patients. Modes of administration and
dosages are discussed in detail below. In one embodiment, the patient is
asymptomatic when treatment with TRID commences. If desired, prior to
treatment, peripheral blood T-cells may be extracted from an HIV patient, and
tested for susceptibility to TRAIL-mediated cell death by procedures known in
the art. In one embodiment, a patient's blood or plasma is contacted with TRID
polypeptides of the invention ex vivo. The TRID polypeptides of the invention
may be bound to a suitable chromatography matrix by procedures known in the
art. The patient's blood or plasma flows through a chromatography column
containing TRID bound to the matrix, before being returned to the patient. The
immobilized TRID polypeptide binds TRAIL, thus removing TRAIL protein from
the patient's blood.
In additional embodiments a TRID polypeptide and/or agonist of the
invention is administered in combination with other inhibitors of T-cell
apoptosis.
For example, as discussed above, Fas-mediated apoptosis also has been
implicated
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 128 -
in loss of T-cells in HIV individuals (Katsikis et al., J. Exp. Med. 181:2029-
2036,
1995). Thus, a patient susceptible to both Fas ligand mediated and TRAIL
mediated T-cell death may be treated with both an agent that blocks
TRAIL/TRAIL receptor interactions and an agent that blocks Fas-ligand/Fas
interactions. Suitable agents for blocking binding of Fas-ligand to Fas
include, but
are not limited to, soluble Fas polypeptides; multimeric forms of soluble Fas
polypeptides (e.g., dimers of sFas/Fc); anti-Fas antibodies that bind Fas
without
transducing the biological signal that results in apoptosis; anti-Fas-ligand
antibodies that block binding of Fas-ligand to Fas; and muteins of Fas-ligand
that
bind Fas but do not transduce the biological signal that results in apoptosis.
Preferably, the antibodies employed according to this method are monoclonal
antibodies. Examples of suitable agents for blocking Fas-ligand/Fas
interactions,
including blocking anti-Fas monoclonal antibodies, are described in
International
application publication number WO 95/10540, hereby incorporated by reference.
TRID polypeptides or polynucleotides encoding TRID of the invention
may be used to treat cardiovascular disorders, including peripheral artery
disease,
such as limb ischemia.
Cardiovascular disorders include cardiovascular abnormalities, such as
arterio-arterial fistula, arteriovenous fistula, cerebral arteriovenous
malformations,
congenital heart defects, pulmonary atresia, and Scimitar Syndrome. Congenital
heart defects include aortic coarctation, cor triatriatum, coronary vessel
anomalies,
crisscross heart, dextrocardia, patent ductus arteriosus, Ebstein's anomaly,
Eisenmenger complex, hypoplastic left heart syndrome, levocardia, tetralogy of
fallot, transposition of great vessels, double outlet right ventricle,
tricuspid atresia,
persistent truncus arteriosus, and heart septal defects, such as
aortopulmonary
septal defect, endocardial cushion defects, Lutembacher's Syndrome, trilogy of
Fallot, thrombotic microangiopathies (e.g., thrombotic thromboc~peni~urpura
(TTP~) and hemolytic-uremic syndrome (HUS)), and ventricular heart septal
defects.
Cardiovascular disorders also include heart disease, such as arrhythmias,
carcinoid heart disease, high cardiac output, low cardiac output, cardiac
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 129 -
tamponade, endocarditis (including bacterial), heart aneurysm,
cardiac arrest,
congestive heart failure, congestive cardiomyopathy, paroxysmal
dyspnea, cardiac
edema, heart hypertrophy, congestive cardiomyopathy, left
ventricular
hypertrophy, right ventricular hypertrophy, post-infarction
heart rupture,
ventricular septal rupture, heart valve diseases, myocardial
diseases, myocardial
ischemia, pericardial effusion, pericarditis (including
constrictive and tuberculous),
pneumopericardium, postpericardiotomy syndrome, pulmonary
heart disease,
rheumatic heart disease, ventricular dysfunction, hyperemia,
cardiovascular
pregnancy complications, Scimitar Syndrome. cardiovascular
syphilis, and
cardiovascular tuberculosis.
Arrhythmias include sinus arrhythmia, atrial fibrillation,
atrial flutter,
bradycardia, extrasystole, Adams-Stokes Syndrome, bundle-branch
block,
sinoatrial block, long QT syndrome, parasystole, Lown-Ganong-Levine
Syndrome, Mahaim-type pre-excitation syndrome, Wolff Parkinson-White
syndrome, sick sinus syndrome, tachycardias, and ventricular
fibrillation.
Tachycardias include paroxysmal tachycardia, supraventricular
tachycardia,
accelerated idioventricular rhythm, atrioventricular nodal
reentry tachycardia,
ectopic atrial tachycardia, ectopic functional tachycardia,
sinoatrial nodal reentry
tachycardia, sinus tachycardia, Torsades de Pointes, and
ventricular tachycardia.
Heart valve disease include aortic valve insufficiency,
aortic valve stenosis,
hear murmurs, aortic valve prolapse, mural valve prolapse,
tricuspid valve
prolapse, mitral valve insufficiency, mural valve stenosis,
pulmonary atresia,
pulmonary valve insufficiency, pulmonary valve stenosis,
tricuspid atresia,
tricuspid valve insufficiency, and tricuspid valve stenosis.
Myocardial diseases include alcoholic cardiomyopathy,
congestive
cardiomyopathy, hypertrophic cardiomyopathy, aortic subvalvular
stenosis,
pulmonary subvalvular stenosis, restrictive cardiomyopathy,
Chagas
cardiomyopathy, endocardial fibroelastosis, endomyocardial
fibrosis, Kearns
Syndrome, myocardial reperfusion injury, and myocarditis.
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 130 -
Myocardial ischemias include coronary disease, such as angina pectoris,
coronary aneurysm, coronary arteriosclerosis, coronary thrombosis, coronary
vasospasm, myocardial infarction and myocardial stunning.
Cardiovascular diseases also include vascular diseases such as aneurysms,
angiodysplasia, angiomatosis, bacillary angiomatosis, Hippel-Lindau Disease,
Klippel-Trenaunay-Weber Syndrome, Sturge-Weber Syndrome, angioneurotic
edema, aortic diseases, Takayasu's Arteritis, aortitis, Leriche's Syndrome,
arterial
occlusive diseases, arteritis, enarteritis, polyarteritis nodosa,
cerebrovascular
disorders, diabetic angiopathies, diabetic retinopathy, embolisms, thrombosis,
erythromelalgia, hemorrhoids, hepatic veno-occlusive disease. hypertension,
hypotension, ischemia, peripheral vascular diseases, phlebitis, pulmonary veno-
occlusive disease, Raynaud's disease, CREST syndrome, retinal vein occlusion,
Scimitar syndrome, superior vena cava syndrome, telangiectasia, atacia
telangiectasia, hereditary hemorrhagic telangiectasia, varicocele, varicose
veins,
varicose ulcer, vasculitis, and venous insufficiency.
Aneurysms include dissecting aneurysms, false aneurysms, infected
aneurysms, ruptured aneurysms, aortic aneurysms, cerebral aneurysms, coronary
aneurysms, heart aneurysms, and iliac aneurysms.
Arterial occlusive diseases include arteriosclerosis, intermittent
claudication, carotid stenosis, fibromuscular dysplasias, mesenteric vascular
occlusion, Moyamoya disease, renal artery obstruction. retinal artery
occlusion,
and thromboangiitis obliterans.
Cerebrovascular disorders include carotid artery diseases, cerebral amyloid
angiopathy, cerebral aneurysm, cerebral anoxia, cerebral arteriosclerosis,
cerebral
arteriovenous malformation, cerebral artery diseases, cerebral embolism and
thrombosis, carotid artery thrombosis, sinus thrombosis, Wallenberg's
syndrome,
cerebral hemorrhage, epidural hematoma, subdural hematoma, subaraxhnoid
hemorrhage, cerebral infarction, cerebral ischemia (including transient),
subclavian
steal syndrome, periventricular leukomalacia, vascular headache, cluster
headache,
migraine, and vertebrobasilar insufficiency.
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 131 -
Embolisms include air embolisms, amniotic fluid embolisms, cholesterol
embolisms, blue toe syndrome, fat embolisms, pulmonary embolisms, and
thromoboembolisms. Thrombosis include coronary thrombosis, hepatic vein
thrombosis, retinal vein occlusion, carotid artery thrombosis, sinus
thrombosis,
Wallenberg's syndrome, and thrombophlebitis.
Ischemia includes cerebral ischemia, ischemic colitis, compartment
syndromes, anterior compartment syndrome, myocardial ischemia, reperfusion
injuries, and peripheral limb ischemia. Vasculitis includes aortitis,
arteritis,
Behcet's Syndrome, Churg-Strauss Syndrome, mucocutaneo.us lymph node
syndrome, thromboangiitis obliterans, hypersensitivity vasculitis, Schoenlein-
Henoch purpura, allergic cutaneous vasculitis, and Wegener's granulomatosis.
In one embodiment, TRID polynucleotides, polypeptides, TRAIL binding
facilitators, and/or agonists of the invention are used to treat and/or
prevent
thrombotic microangiopathies. One such disorder is thrombotic thrombocytopenic
purpura (TTP) (Kwaan, H.C., Semin. Hematol. 24:71 (1987); Thompson et al.,
Blood 80:1890 (1992)). Increasing TTP-associated mortality rates have been
reported by the U.S. Centers for Disease Control (Torok et al., Am. J.
Hematol.
50:84 (1995)). Plasma from patients afflicted with TTP (including HIV+ and
HIV- patients) induces apoptosis of human endothelial cells of dermal
microvascular origin, but not large vessel origin (Laurence et al., Blood
87:3245
( 1996)). Plasma of TTP patients thus is thought to contain one or more
factors
that directly or indirectly induce apoptosis. As described in International
patent
application number WO 97/01633 (hereby incorporated by reference), TRAIL is
present in the serum of TTP patients, and is likely to play a role in inducing
apoptosis of microvascular endothelial cells. Another thrombotic
microangiopathy
is hemolytic-uremic syndrome (HUS) (Moake, J.L., Lancet, 343:393 (1994);
Melnyk et al., (Arch. Intern. Med., 155:2077 (1995); Thompson et al., supra).
Thus, in one embodiment, the invention is directed to use of TRID to treat
and/or
prevent the condition that is often referred to as "adult HUS" (even though it
can
strike children as well). A disorder known as childhood/diarrhea-associated
HUS
differs in etiology from adult HUS. In another embodiment, conditions
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 132 -
characterized by clotting of small blood vessels may be treated and/or
prevented
using TRID Such conditions include, but are not limited to, those described
herein. For example, cardiac problems seen in about 5-10% of pediatric AIDS
patients are believed to involve clotting of small blood vessels. Breakdown
ofthe
microvasculature in the heart has been reported in multiple sclerosis
patients. As
a further example, treatment and/or prevention of systemic lupus erythematosus
(SLE) is contemplated. In one embodiment, a patient's blood or plasma is
contacted TRID polynucleotides and/or polypeptides of the invention may be
bound to a suitable chromatography matrix by procedures known in the art.
According to this embodiment, the patient's blood or plasma flows through a
chromatography column containing TRID polynucleotides and/or polypeptides of
the invention bound to the matrix, before being returned to the patient. The
immobilized TRID binds TRAIL, thus removing TRAIL protein from the patient's
blood. Alternatively, TRID polynucleotides and/or polypeptides of the
invention
may be administered in vivo to a patient afflicted with a thrombotic
microangiopathy. In one embodiment, a soluble form of TRID polypeptide of the
invention is administered to the patient. Thus, the present invention provides
a
method for treating and/or preventing a thrombotic microangiopathy, involving
use of an effective amount of TRID. A TRID polypeptide may be employed in in
vivo or ex vivo procedures, to inhibit TRAIL-mediated damage to (e.g.,
apoptosis
of) microvascular endothelial cells.
TRID polynucleotides and/or polypeptides of the invention may be
employed in combination with other agents useful in treating and/or preventing
a
particular disorder. For example, in an in vitro study reported by Laurence et
al.
(Blood 87:3245 (1996)), some reduction of TTP plasma-mediated apoptosis of
microvascular endothelial cells was achieved by using an anti-Fas blocking
antibody, aurintricarboxylic acid, or normal plasma depleted of
cryoprecipitate.
Thus, a patient may be treated with a polynucleotide and/or polypeptide of the
invention in combination with an agent that inhibits Fas-ligand-mediated
apoptosis
of endothelial cells, such as, for example, an agent described above. In one
embodiment, TRID polynucleotides and/or polypeptides of the invention and an
CA 02374674 2001-11-20
WO 00/71150 PCT/LIS00/13515
-133-
anti-FAS blocking antibody are both administered to a patient afflicted with a
disorder characterized by thrombotic microanglopathy, such as TTP or HUS.
Examples ofblocking monoclonal antibodies directed against Fas antigen (CD95)
are described in International patent application publication number WO
95/10540, hereby incorporated by reference.
The naturally occurring balance between endogenous stimulators and
inhibitors of angiogenesis is one in which inhibitory influences predominate.
Rastinejad et al., Cell 56:345-355 (1989). In those rare instances in which
neovascularization occurs under normal physiological conditions, such as wound
healing, organ regeneration, embryonic development, and female reproductive
processes, angiogenesis is stringently regulated and spatially and temporally
delimited. Under conditions of pathological angiogenesis such as that
characterizing solid tumor growth, these regulatory controls fail. Unregulated
angiogenesis becomes pathologic and sustains progression of many neoplastic
and
non-neoplastic diseases. A number of serious diseases are dominated by
abnormal
neovascularization including solid tumor growth and metastases, arthritis,
some
types of eye disorders, and psoriasis. See, e.g., reviews by Moses et al.,
Biotech.
9:630-634 (1991); Folkman et al., N. Engl. J. Med., 333:1757-1763 (1995);
Auerbach et al., J. Microvasc. Res. 29:401-411 (1985); Folkman, Advances in
Cancer Research, eds. Klein and Weinhouse, Academic Press, New York, pp.
175-203 ( 1985); Patz, Am. J. Opthalmol. 94:715-743 ( 1982); and Folkman et
al.,
Science 221:719-725 ( 1983). In a number of pathological conditions, the
process
of angiogenesis contributes to the disease state. For example, significant
data have
accumulated which suggest that the growth of solid tumors is dependent on
angiogenesis. Folkman and Klagsbrun, Science 235:442-447 (1987).
The present invention provides for treatment of diseases or disorders
associated with neovascularization by administration of the TRID
polynucleotides
and/or polypeptides of the invention (including TRID agonists and/or
antagonists).
Malignant and metastatic conditions which can be treated with the
polynucleotides
and polypeptides of the invention include, but are not limited to those
malignancies, solid tumors, and cancers described herein and otherwise known
in
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 134 -
the art (for a review of such disorders, see Fishman et al., Medicine, 2d Ed.,
J. B.
Lippincott Co., Philadelphia (1985)).
Additionally, ocular disorders associated with neovascularization which
can be treated with the TRID polynucleotides and polypeptides of the present
invention (including TRID agonists and TRID antagonists) include, but are not
limited to: neovascular glaucoma, diabetic retinopathy, retinoblastoma,
retrolental
fibroplasia, uveitis, retinopathy of prematurity macular degeneration, corneal
graft
neovascularization, as well as other eye inflammatory diseases, ocular tumors
and
diseases associated with choroidal or iris neovascularization. See., e.g.,
reviews by
Waltman et al., Am. J Ophthal. 85:704-710 (1978) and Gartner et al., Surv.
Ophthal. 22:291-312 (1978).
Additionally, disorders which can be treated with the TRID
polynucleotides and polypeptides of the present invention (including TRID
agonists and TRID antagonists) include, but are not limited to, hemangioma,
arthritis, psoriasis, angiofibroma, atherosclerotic plaques, delayed wound
healing,
granulations, hemophilic joints, hypertrophic scars, nonunion fractures, Osler-
Weber syndrome, pyogenic granuloma, scleroderma, trachoma, and vascular
adhesions.
In rej ection of an allograft, the immune system of the recipient animal has
not previously been primed to respond because the immune system for the most
part is only primed by environmental antigens. Tissues from other members of
the
same species have not been presented in the same way that, for example,
viruses
and bacteria have been presented. In the case of allograft rejection,
immunosuppressive regimens are designed to prevent the immune system from
reaching the effector stage. However, the immune profile of xenograft
rejection
may resemble disease recurrence more than allograft rejection. In the case of
disease recurrence, the immune system has already been activated, as evidenced
by destruction of the native islet cells. Therefore, in disease recurrence the
immune system is already at the effector stage. Antagonist of the present
invention are able to suppress the immune response to both allografts and
xenografts because lymphocytes activated and differentiated into effector
cells will
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 135 -
express TRID polypeptides, and thereby are susceptible to compounds which
enhance TRID activity. Thus, the present invention further provides a method
for
creating immune privileged tissues.
TRID antagonists or agonists of the invention may be useful for treating
and/or preventing inflammatory diseases, such as rheumatoid arthritis,
osteoarthritis, psoriasis, septicemia, and inflammatory bowel disease.
Polynucleotides and/or polypeptides of the invention and/or agonists
and/or antagonists thereof are useful in the diagnosis and treatment or
prevention
of a wide range of diseases and/or conditions. Such diseases and conditions
include, but are not limited to, cancer (e.g., immune cell related cancers,
breast
cancer, prostate cancer, ovarian cancer, follicular lymphoma, cancer
associated
with mutation or alteration of p53, brain tumor, bladder cancer, uterocervical
cancer, colon cancer, colorectal cancer, non-small cell carcinoma of the lung,
small
cell carcinoma of the lung, stomach cancer, etc.), lymphoproliferative
disorders
(e.g., lymphadenopathy), microbial (e.g., viral, bacterial, etc.) infection
(e.g.,
HIV-1 infection, HIV-2 infection, herpesvirus infection (including, but not
limited
to, HSV-1, HSV-2, CMV, VZV, HHV-6, HHV-7, EBV), adenovirus infection,
poxvirus infection, human papilloma virus infection, hepatitis infection
(e.g., HAV,
HBV, HCV, etc.), Helicobacter pylori infection, invasive Staphylococcia,
etc.),
parasitic infection, nephritis, bone disease (e.g., osteoporosis),
atherosclerosis,
pain, cardiovascular disorders (e.g., neovascularization, hypovascularization
or
reduced circulation (e.g., ischemic disease (e.g., myocardial infarction,
stroke,
etc.))), AIDS, allergy, inflammation, neurodegenerative disease (e.g.,
Alzheimer's
disease, Parkinson's disease, amyotrophic lateral sclerosis, pigmentary
retinitis,
cerebellar degeneration, etc.), graft rejection (acute and chronic), graft vs.
host
disease, diseases due to osteomyelodysplasia (e.g., aplastic anemia, etc.),
joint
tissue destruction in rheumatism, liver disease (e.g., acute and chronic
hepatitis,
liver injury, and cirrhosis), autoimmune disease (e.g., multiple sclerosis,
rheumatoid arthritis, systemic lupus erythematosus, immune complex
glomerulonephritis, autoimmune diabetes, autoimmune thrombocytopenic purpura,
Grave's disease, Hashimoto's thyroiditis, etc.), cardiomyopathy (e.g., dilated
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 136 -
cardiomyopathy), diabetes, diabetic complications (e.g., diabetic nephropathy,
diabetic neuropathy, diabetic retinopathy), influenza, asthma, psoriasis,
glomerulonephritis, septic shock, and ulcerative colitis.
Polynucleotides and/or polypeptides of the invention and/or agonists
and/or antagonists thereof are useful in promoting angiogenesis, and wound
healing (e.g., wounds, burns, and bone fractures), and regulating
hematopoiesis.
Polynucleotides and/or polypeptides of the invention and/or agonists and/or
antagonists thereof are also useful as an adjuvant to enhance immune
responsiveness to specific antigen, anti-viral immune responses,.
More generally, polynucleotides and/or polypeptides of the invention
and/or agonists and/or antagonists thereof are useful in regulating (i. e.,
elevating
or reducing) immune response. For example, polynucleotides and/or polypeptides
of the invention may be useful in preparation or recovery from surgery,
trauma,
radiation therapy, chemotherapy, and transplantation, or may be used to boost
immune response and/or recovery in the elderly and immunocompromised
individuals. Alternatively, polynucleotides and/or polypeptides of the
invention
and/or agonists and/or antagonists thereof are useful as immunosuppressive
agents, for example in the treatment or prevention of autoimmune disorders. In
specific embodiments, polynucleotides and/or polypeptides of the invention are
used to treat or prevent chronic inflammatory, allergic or autoimmune
conditions,
such as those described herein or are otherwise known in the art.
Thus, in one aspect. the present invention is directed to a method for
enhancing apoptosis induced by a TNF-family ligand, which involves
administering
to a cell which expresses a TNFR polypeptide an effective amount of an
antagonist
of the TRID polypeptide, capable of inhibiting TRID expression or its ligand
binding ability (e.g. , to TRAIL). Preferably, TNFR mediated signaling is
increased
to treat a disease wherein decreased apoptosis is exhibited. Antagonist can
include monoclonal antibodies directed against the TRID polypeptide.
By "antagonist" is intended naturally occurring and synthetic compounds
capable of enhancing or potentiating apoptosis. By "agonist" is intended
naturally
occurring and synthetic compounds capable of inhibiting apoptosis. Whether any
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 137 -
candidate "antagonist" or "agonist" of the present invention can enhance or
inhibit
apoptosis can be determined using art-known TNF-family ligand/receptor
cellular
response assays, including those described in more detail below.
One such screening procedure involves the use of melanophores which are
transfected to co-express a TNFR receptor which binds a TRAIL such as DR4 or
DRS, described elsewhere herein, and the TRID receptor of the present
invention.
Such a screening technique is described in PCT WO 92/01810, published February
6, 1992. Such an assay may be employed, for example, for screening for a
compound which inhibits (or enhances) the activity of the receptor polypeptide
of
the present invention by contacting the melanophore cells which encode the
receptors with both a TNF-family ligand and the candidate antagonist (or
agonist).
Inhibition or enhancement of the signal generated by the ligand indicates that
the
compound is an antagonist or agonist of TRID activity. The TRID polypeptide
and its agonists inhibit activation of the TNFR receptor, e.g., TRAIL
receptor,
whereas antagonists will increase activation.
Other screening techniques include the use of cells which express a TRAIL
receptor and TRID (for example, transfected CHO cells) in a system which
measures extracellular pH changes caused by receptor activation, for example,
as
described in Science 246:181-296 (October 1989). For example, compounds may
be contacted with a cell which expresses a TRAIL receptor polypeptide and TRID
of the present invention and a second messenger response, e.g. , signal
transduction
or pH changes, may be measured to determine whether the potential compound
activates or inhibits the TRAIL receptor.
Another such screening technique involves introducing RNA encoding the
receptors into Xenopus oocytes to transiently express TRID and a TRAIL
receptor. The receptor oocytes may then be contacted with the receptor ligand
and a compound to be screened, followed by detection of inhibition or
activation
of a calcium signal in the case of screening for compounds which are thought
to
inhibit activation of the receptor.
Another screening technique involves expressing in cells a construct
wherein the TRAIL receptor is linked to a phospholipase C or D. Such cells
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 138 -
include endothelial cells, smooth muscle cells, embryonic kidney cells, etc.
The
screening may be accomplished as hereinabove described by detecting activation
of the receptor or inhibition of activation of the receptor from the
phospholipase
signal in the presence of TRID either co-expressed or added in soluble form
along
with the candidate compound.
Another method involves screening for compounds which inhibit activation
of a TRAIL receptor polypeptide in the presence of the TRID polypeptide of the
present invention, either co-expressed or in soluble form. Agonists of the
present
invention are identified by determining inhibition of binding of.labeled
ligand to
cells which have the TRAIL receptor on the surface thereof. Such a method
involves transfecting a eukaryotic cell with DNA encoding a TRAIL binding
receptor such that the cell expresses the receptor on its surface and
contacting the
cell with a compound in the presence of a labelled TRAIL and TRID. TRAIL can
be labeled, e.g., by radioactivity. The amount of labeled TRAIL bound to the
receptors is measured, e.g., by measuring radioactivity of the receptors. If
the
compound binds to the TRID receptor as determined by an increase of labeled
TRAIL which binds to the TRAIL receptor, the compound is a TRID antagonist.
Further screening assays for agonist and antagonist of the present invention
are described in Tartaglia, L.A., and Goeddel, D.V., J. Biol. Chem.
267(7):4304-
4307( 1992).
Thus, in a further aspect, a screening method is provided for determining
whether a candidate TRID antagonist or agonist is capable of enhancing or
inhibiting a cellular response to a TNF-family ligand (e.g., apoptosis induced
by
TRAIL). The method involves contacting cells which express a TNFR
polypeptide with a candidate compound, TRID, and a TNF-family ligand,
assaying a cellular response, and comparing the cellular response to a
standard
cellular response, the standard being assayed when contact is made with the
ligand
in the presence of TRID but in absence of the candidate compound, whereby an
increased cellular response over the standard indicates that the candidate
compound is an antagonist and a decreased cellular response compared to the
standard indicates that the candidate compound is an agonist. By "assaying a
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 139 -
cellular response" is intended qualitatively or quantitatively measuring a
cellular
response to a candidate compound and/or a TNF-family ligand (e.g., determining
or estimating an increase or decrease in T cell proliferation or tritiated
thymidine
labeling). By the invention, a cell expressing the TNFR polypeptide can be
contacted with either an endogenous or exogenously administered TNF-family
ligand.
Antagonist according to the present invention include naturally occurring
and synthetic compounds such as, for example, TNF family ligand peptide
fragments, transforming growth factor, neurotransmitters (such as glutamate,
dopamine, N-methyl-D-aspartate), tumor suppressors (p53), cytolytic T cells
and
antimetabolites. Preferred agonist include chemotherapeutic drugs such as, for
example, cisplatin, doxorubicin, bleomycin, cytosine arabinoside, nitrogen
mustard, methotrexate and vincristine. Others include ethanol and -amyloid
peptide. (Science 267:1457-1458 (1995)). Further preferred antagonist includes
polyclonal and monoclonal antibodies raised against the TRID polypeptide, or a
fragment thereof.
Agonists according to the present invention include naturally occurring and
synthetic compounds such as, for example, the CD40 ligand, neutral amino
acids,
zinc, estrogen, androgens, viral genes.(such as Adenovirus EIB, Baculovirusp3~
and IAP, Cowpox virus crmA, Epstein-Barr virus BHRFI, LMP-l, African swine
fever virus LMWS-HL, and Herpesvirus y1 34.5), calpain inhibitors, cysteine
protease inhibitors, and tumor promoters (such as PMA, Phenobarbital, and -
Hexachlorocyclohexane). Other Agonists include polyclonal and monoclonal
antagonist antibodies raised against TRAIL polypeptides or a fragment thereof.
Other potential antagonists include antisense molecules. In specific
embodiments, antagonists according to the present invention are nucleic acids
corresponding to the sequences contained in TRID, or the complementary strand
thereof, and/or to nucleotide sequences contained in ATCC Deposit No. 97798.
In one embodiment, antisense sequence is generated internally by the organism,
in another embodiment, the antisense sequence is separately administered (see,
for
example, Okano H. et al., J. Neurochem. X6:560 (1991), and
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 140 -
Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression, CRC Press,
Boca Raton, FL (1988). Antisense technology can be used to control gene
expression through antisense DNA or RNA or through triple-helix formation.
Antisense techniques are discussed, for example, in Okano, J. Neurochem. ~
6:560
( 1991 ); Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression,
CRC
Press, Boca Raton, FL ( 1988). Triple helix formation is discussed in, for
instance
Lee etal., NucleicAcidsResearch 6:3073 (1979); Cooney etal., Science 2=11:456
(1988); and Dervan et al., Science 251:1360 (1991). The methods are based on
binding of a polynucleotide to a complementary DNA or RNA.
For example, the 5' coding portion of a polynucleotide that encodes the
mature polypeptide of the present invention may be used to design an antisense
RNA oligonucleotide of from about 10 to 40 base pairs in length. A DNA
oligonucleotide is designed to be complementary to a region of the gene
involved
in transcription thereby preventing transcription and the production of the
receptor. The antisense RNA oligonucleotide hybridizes to the mRNA in vivo and
blocks translation of the mRNA molecule into receptor polypeptide. The
oligonucleotides described above can also be delivered to cells such that the
antisense RNA or DNA may be expressed in vivo to inhibit production of the
receptor.
In one embodiment, the TRID antisense nucleic acid of the invention is
produced intracellularly by transcription from an exogenous sequence. For
example, a vector or a portion thereof, is transcribed, producing an antisense
nucleic acid (RNA) of the invention. Such a vector would contain a sequence
encoding the TRID antisense nucleic acid. Such a vector can remain episomal or
become chromosomally integrated, as long as it can be transcribed to produce
the
desired antisense RNA. Such vectors can be constructed by recombinant DNA
technology methods standard in the art. Vectors can be plasmid, viral, or
others
know in the art, used for replication and expression in vertebrate cells.
Expression
of the sequence encoding TRID, or fragments thereof, can be by any promoter
known in the art to act in vertebrate, preferably human cells. Such promoters
can
be inducible or constitutive. Such promoters include, but are not limited to,
the
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 141 -
SV40 early promoter region (Bernoist and Chambon, Nature 29:304-310 ( 1981 ),
the promoter contained in the 3' long terminal repeat of Rous sarcoma virus
(Yamamoto et al., Cell 22:787-797 (1980), the herpes thymidine promoter
(Wagneretal., Proc. Natl. Acad. Sci. U.S.A. 78:1441-1445 (1981), the
regulatory
sequences of the metallothionein gene (Brinster, et al., Nature 296:39-42
(1982)),
etc.
The antisense nucleic acids of the invention comprise, or alternatively
consist of, a sequence complementary to at least a portion of an RNA
transcript
of a TRID gene. However, absolute complementarity, although, preferred, is not
required. A sequence "complementary to at least a portion of an RNA," referred
to herein, means a sequence having sufficient complementarity to be able to
hybridize with the RNA, forming a stable duplex; in the case of double
stranded
TRID antisense nucleic acids, a single strand of the duplex DNA may thus be
tested, or triplex formation may be assayed. The ability to hybridize will
depend
on both the degree of complementarity and the length of the antisense nucleic
acid
Generally, the larger the hybridizing nucleic acid, the more base mismatches
with
a TRID RNA it may contain and still form a stable duplex (or triplex as the
case
may be). One skilled in the art can ascertain a tolerable degree of mismatch
by use
of standard procedures to determine the melting point of the hybridized
complex.
Oligonucleotides that are complementary to the 5' end of the message, e.g. ,
the 5' untranslated sequence up to and including the AUG initiation codon,
should
work most efficiently at inhibiting translation. However, sequences
complementary to the 3' untranslated sequences of mRNAs have been shown to
be effective at inhibiting translation of mRNAs as well. See generally,
Wagner,
R., Nature 372:333-335 (1994). Thus, oligonucleotides complementary to either
the 5'- or 3'- non- translated, non-coding regions of the TRID shown in SEQ ID
NO: l could be used in an antisense approach to inhibit translation of
endogenous
TRID mRNA. Oligonucleotides complementary to the 5' untranslated region of
the mRNA should include the complement of the AUG start codon. Antisense
oligonucleotides complementary to mRNA coding regions are less efficient
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 142 -
inhibitors of translation but could be used in accordance with the invention.
Whether designed to hybridize to the 5'-, 3'- or coding region of TRID mRNA,
antisense nucleic acids should be at least six nucleotides in length, and are
preferably oligonucleotides ranging from 6 to about 50 nucleotides in length.
In
specific aspects the oligonucleotide is at least 10 nucleotides, at least 17
nucleotides, at least 25 nucleotides or at least 50 nucleotides.
The polynucleotides of the invention can be DNA or RNA or chimeric
mixtures or derivatives or modified versions thereof, single-stranded or
double-
stranded. The oligonucleotide can be modified at the base moiety, sugar
moiety.
or phosphate backbone, for example, to improve stability of the molecule,
hybridization, etc. The oligonucleotide may include other appended groups such
as peptides (e.g., for targeting host cell receptors in vivo), or agents
facilitating
transport across the cell membrane (see, e.g., Letsinger et al., Proc. Natl.
Acad.
Sci. U.S.A. 86:6553-6556 (1989); Lemaitre et al., Proc. Natl. Acad. Sci.
84:648-
652 (1987); PCT Publication No. W088/09810, published December 15, 1988)
or the blood-brain barrier (see, e.g., PCT Publication No. W089/10134,
published
April 25, 1988), hybridization-triggered cleavage agents. (See, e.g., Krol et
al.,
BioTechniqueS 6:958-976 ( 1988)) or intercalating agents. (See, e.g., Zon,
Pharm.
Res. 5:539-549 (1988)). To this end, the oligonucleotide may be conjugated to
another molecule, e.g., a peptide, hybridization triggered cross-linking
agent,
transport agent, hybridization-triggered cleavage agent, etc.
The antisense oligonucleotide may comprise at least one modified base
moiety which is selected from the group including, but not limited to,
5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine,
xantine,
4-acetylcytosine, 5-(carboxyhydroxylmethyl) uracil, 5-carboxymethylaminomethyl-
2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-
galactosylqueosine, inosine, N6-isopentenyladenine, 1-methylguanine,
1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine,
3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine,
5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-
D-mannosylqueosine, 5~-methoxycarboxymethyluracil, 5-methoxyuracil,
CA 02374674 2001-11-20
WO 00/71150 PCT/LJS00/13515
-143-
2-methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid (v), wybutoxosine,
pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil,
4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methylester, uracil-5-
oxyacetic
acid (v), 5-methyl-2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl) uracil,
(acp3)w,
and 2,6-diaminopurine.
The antisense oligonucleotide may also comprise at least one modified
sugar moiety selected from the group including, but not limited to, arabinose,
2-fluoroarabinose, xylulose, and hexose.
In yet another embodiment, the antisense oligonucleotide comprises at
least one modified phosphate backbone selected from the group including, but
not
limited to, a phosphorothioate, a phosphorodithioate, a phosphoramidothioate,
a
phosphoramidate, a phosphordiamidate, a methylphosphonate, an alkyl
phosphotriester, and a formacetal or analog thereof.
In yet another embodiment, the antisense oligonucleotide is an a-anomeric
oligonucleotide. An a-anomeric oligonucleotide forms specific double-stranded
hybrids with complementary RNA in which, contrary to the usual (3-units, the
strands run parallel to each other (Gautier et al., Nucl. Acids Res. 15:6625-
6641
( 1987)). The oligonucleotide is a 2~-0-methylribonucleotide (moue et al.,
Nucl.
Acids Res. 15:6131-6148 (1987)), or a chimeric RNA-DNA analogue (moue et
al., FEBS Lett. 215:327-330 (1987)).
Polynucleotides of the invention may be synthesized by standard methods
known in the art, e.g. by use of an automated DNA synthesizer (such as are
commercially available from Biosearch, Applied Biosystems, etc.). As examples,
phosphorothioate oligonucleotides may be synthesized by the method of Stein et
al. (Nucl. Acids Res. 16:3209 (1988)), methylphosphonate oligonucleotides can
be prepared by use of controlled pore glass polymer supports (Sarin et al.,
Proc.
Natl. Acad. Sci. U.S.A. 85:7448-7451 (1988)), etc.
While antisense nucleotides complementary to the TRID coding region
sequence could be used, those complementary to the transcribed untranslated
region are most preferred.
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 144 -
Potential antagonists according to the invention also include catalytic
RNA, or a ribozyme (See, e.g., PCT International Publication WO 90/11364,
published October 4, 1990; Sarver et al, Science 247:1222-1225 (1990). While
ribozymes that cleave mRNA at site specific recognition sequences can be used
to destroy TRID mRNAs, the use of hammerhead ribozymes is preferred.
Hammerhead ribozymes cleave mRNAs at locations dictated by flanking regions
that form complementary base pairs with the target mRNA. The sole requirement
is that the target mRNA have the following sequence of two bases: 5'-UG-3'.
The
construction and production of hammerhead ribozymes is well. known in the art
and is described more fully in Haseloff and Gerlach, Nature 334:585-591 (
1988).
There are numerous potential hammerhead ribozyme cleavage sites within the
nucleotide sequence of TRID (SEQ ID NO:1 ). Preferably, the ribozyme is
engineered so that the cleavage recognition site is located near the 5' end of
the
TRID mRNA; i.e., to increase efficiency and minimize the intracellular
accumulation of non-functional mRNA transcripts.
As in the antisense approach, the ribozymes of the invention can be
composed of modified oligonucleotides (e.g., for improved stability,
targeting,
etc.) and should be delivered to cells which express TRID in vivo. DNA
constructs encoding the ribozyme may be introduced into the cell in the same
manner as described above for the introduction of antisense encoding DNA. A
preferred method of delivery involves using a DNA construct "encoding" the
ribozyme under the control of a strong constitutive promoter, such as, for
example, pol III or pol II promoter, so that transfected cells will produce
sufficient
quantities of the ribozyme to destroy endogenous TRID messages and inhibit
translation. Since ribozymes unlike antisense molecules, are catalytic, a
lower
intracellular concentration is required for efficiency.
Endogenous gene expression can also be reduced by inactivating or
"knocking out" the TRID gene and/or its promoter using targeted homologous
recombination. (E.g., see Smithies et al., Natuf°e 317:230-234 (1985);
Thomas
& Capecchi, Cell 51:503-512 (1987); Thompson et al., Cell 5:313-321 (1989);
each of which is incorporated by reference herein in its entirety). For
example, a
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-145-
mutant, non-functional polynucleotide of the invention (or a completely
unrelated
DNA sequence) flanked by DNA homologous to the endogenous polynucleotide
sequence (either the coding regions or regulatory regions of the gene) can be
used,
with or without a selectable marker and/or a negative selectable marker, to
transfect cells that express polypeptides of the invention in vivo. In another
embodiment, techniques known in the art are used to generate knockouts in
cells
that contain, but do not express the gene of interest. Insertion of the DNA
construct, via targeted homologous recombination, results in inactivation of
the
targeted gene. Such approaches are particularly suited in research and
agricultural
fields where modifications to embryonic stem cells can be used to generate
animal
offspring with an inactive targeted gene (e.g. , see Thomas & Capecchi ( 1987)
and
Thompson (1989), supra). However this approach can be routinely adapted for
use in humans provided the recombinant DNA constructs are directly
administered
or targeted to the required site in vivo using appropriate viral vectors that
will be
apparent to those of skill in the art. The contents of each of the documents
recited
in this paragraph is herein incorporated by reference in its entirety.
Further agonist according to the present invention include soluble forms
of TRID, i.e., TRID fragments that include the ligand binding domain from the
extracellular region of the full-length receptor. Such soluble forms of the
receptor, which may be naturally occurring or synthetic, antagonize TNFR
mediated signaling by competing with the cell surface TNFR for binding to TNF-
family ligands. Thus, soluble forms of the TRID receptor that include the
ligand
binding domain are novel cytokines capable of inhibiting apoptosis induced by
TNF-family ligands. Other such cytokines are known in the art and include Fas
B (a soluble form of the mouse Fas receptor) that acts physiologically to
limit
apoptosis induced by Fas ligand (Hughes, D.P. and Crispe, I.N., J. Exp. Med.
182:1395-1401 (1995)).
Proteins and other compounds which bind the extracellular domains are
also candidate agonist and antagonist according to the present invention. Such
binding compounds can be "captured" using the yeast two-hybrid system (Fields
and Song, Nature 340:245-246 (1989)). A modified version of the yeast two-
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 146 -
hybrid system has been described by Roger Brent and his colleagues (Gyuris, J.
et al., Cell 75:791-803 (1993); Zervos, A.S. et al., Cell 72:223-232 (1993)).
By a "TNF-family ligand" is intended naturally occurring, recombinant, and
synthetic ligands that are capable of binding to a member of the TNF receptor
family and inducing and/or blocking the ligand/receptor signaling pathway.
Members of the TNF ligand family include, but are not limited to, soluble
forms
of TNF-a, lymphotoxin-alpha (LT-a, also known as TNF-(3), LT-(3 (found in
complex heterotrimer LT-a2-(3), OPGL, Fast, TRAIL, CD27L, CD30L, CD40L,
4-1BBL, DcR3, OX40L, TNF-y (International Publication No: WO 96/14328),
AIM-I (International Publication No. WO 97/33899), AIM-II (International
Publication No. WO 97/34911), APRIL (J Exp. Med. 188(6):1185-1190),
endokine-alpha (International Publication No. WO 98/07880), TR6 (International
Publication No. WO 98/30694), OPG, OX40, and nerve growth factor (NGF),
and soluble forms of Fas, CD30, CD27, CD40 and 4-IBB, TR2 (International
Publication No. WO 96/34095), DR3 (International Publication No. WO
97/33904), DR4 (International Publication No. WO 98/32856), TR6 (International
Publication No. WO 98/30694), TR7 (International Publication No. WO
98/41629), TRANK, TR9 (International Publication No. WO 98/56892), TR10
(International Publication No. WO 98/54202), 31 X2 (International Publication
No. WO 98/06842), and TR12, and soluble forms CD 154, CD70, and CD 153.
TNF-a has been shown to protect mice from infection with herpes simplex
virus type 1 (HSV-1 ) (Rossol-Voth et al., J. Gen. Virol. 72:143-147 ( 1991
)). The
mechanism of the protective effect of TNF-a is unknown but appears to involve
neither interferons nor NK cell killing. One member of the family has been
shown
to mediate HSV-I entry into cells (Montgomery et al., Eur. Cytokine Newt.
7:159
( 1996)). Further, antibodies specific for the extracellular domain of this
block
HSV-1 entry into cells. Thus, TRID antagonists of the present invention
include
both TRID amino acid sequences and antibodies capable of preventing mediated
viral entry into cells. Such sequences and antibodies can function by either
competing with cell surface localized for binding to virus or by directly
blocking
binding of virus to cell surface receptors.
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 147 -
As indicated polyclonal and monoclonal antibody agonist or antagonist
according
to the present invention can be raised according to the methods disclosed in
Tartaglia, L.A., and Goeddel, D.V., J. Biol. Chem. 267(7):4304-4307(1992);
Tartaglia, L.A. et al., Cell 73:213-216 (1993), and PCT Application WO
94/09137 (the contents of each of these three applications are herein
incorporated
by reference in their entireties), and are preferably specific to polypeptides
of the
invention having the amino acid sequence of SEQ ID N0:2. The term "antibody"
(Ab) or "monoclonal antibody" (mAb) as used herein is meant to include intact
molecules as well as fragments thereof (such as, for example,. Fab and F(ab'),
fragments) which are capable of binding an antigen. Fab and F (ab')~ fragments
lack the Fc fragment of intact antibody, clear more rapidly from the
circulation,
and may have less non-specific tissue binding of an intact antibody (Wahl et
al.,
J. Nucl. Med. 24:316-325 (1983)).
Antibodies according to the present invention may be prepared by any of
a variety of standard methods, such as those described above and known in the
art,
using TRID receptor immunogens of the present invention. Such TRID receptor
immunogens include the TRID protein shown in SEQ ID N0:2 (which may or
may not include a leader sequence) and polypeptide fragments of the receptor
comprising, or alternatively consisting of, the ligand binding, extracellular,
transmembrane, the intracellular domains of TRID, or any combination thereof.
Gene Therapy
In a specific embodiment, nucleic acids comprising sequences encoding
antibodies or functional derivatives thereof, are administered to treat,
inhibit
and/or prevent a disease or disorder associated with aberrant expression
and/or
activity of a polypeptide of the invention, by way of gene therapy. Gene
therapy
refers to therapy performed by the administration to a subject of an expressed
or
expressible nucleic acid. In this embodiment of the invention, the nucleic
acids
produce their encoded protein that mediates a therapeutic effect.
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 148 -
Any of the methods for gene therapy available in the art can be used
according to the present invention. Exemplary methods are described below.
For general reviews of the methods of gene therapy, see Goldspiel et al. ,
1993, Clinical Pharmacy 12:488-505; Wu and Wu, 1991, Biotherapy 3:87-95;
Tolstoshev, 1993, Ann. Rev. Pharmacol. Toxicol. 32:573-596; Mulligan, 1993,
Science 260:926-932; and Morgan and Anderson, 1993, Ann. Rev. Biochem.
62:191-217; May, 1993, TIBTECH 11(5):155-215). Methods commonly known
in the art of recombinant DNA technology which can be used are described in
Ausubel et al. (eds.), 1993, Current Protocols in Molecular Biology, John
Wiley
& Sons. NY; and Kriegler, 1990, Gene Transfer and Expression, A Laboratory
Manual, Stockton Press, NY.
In a preferred aspect, the compound comprises nucleic acid sequences
encoding an antibody, said nucleic acid sequences being part of expression
vectors
that express the antibody or fragments or chimeric proteins or heavy or light
chains thereof in a suitable host. In particular, such nucleic acid sequences
have
promoters operably linked to the antibody coding region, said promoter being
inducible or constitutive, and, optionally, tissue- specific. In another
particular
embodiment, nucleic acid molecules are used in which the antibody coding
sequences and any other desired sequences are flanked by regions that promote
homologous recombination at a desired site in the genome, thus providing for
intrachromosomal expression of the antibody nucleic acids (Koller and
Smithies,
1989, Proc. Natl. Acad. Sci. USA 86:8932-8935; Zijlstra et al., 1989, Nature
342:435-438). In specific embodiments, the expressed antibody molecule is a
single chain antibody; alternatively, the nucleic acid sequences include
sequences
encoding both the heavy and light chains, or fragments thereof, of the
antibody.
Delivery of the nucleic acids into a patient may be either direct, in which
case the patient is directly exposed to the nucleic acid or nucleic acid-
carrying
vectors, or indirect, in which case, cells are first transformed with the
nucleic acids
in vitro, then transplanted into the patient. These two approaches are known,
respectively, as in vivo or ex vivo gene therapy.
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 149 -
In a specific embodiment, the nucleic acid sequences are directly
administered in vivo, where it is expressed to produce the encoded product.
This
can be accomplished by any of numerous methods known in the art, e.g., by
constructing them as part of an appropriate nucleic acid expression vector and
administering it so that they become intracellular, e.g., by infection using
defective
or attenuated retrovirals or other viral vectors (see U.S. Patent No.
4,980,286),
or by direct injection of naked DNA, or by use of microparticle bombardment
(e.g., a gene gun; Biolistic, Dupont), or coating with lipids or cell-surface
receptors or transfecting agents, encapsulation in liposomes, microparticles,
or
microcapsules, or by administering them in linkage to a peptide which is known
to enter the nucleus, by administering it in linkage to a ligand subject to
receptor-
mediated endocytosis (see, e.g., Wu and Wu, 1987, J. Biol. Chem. 262:4429-
4432) (which can be used to target cell types specifically expressing the
receptors), etc. In another embodiment, nucleic acid-ligand complexes can be
formed in which the ligand comprises a fusogenic viral peptide to disrupt
endosomes, allowing the nucleic acid to avoid lysosomal degradation. In yet
another embodiment, the nucleic acid can be targeted in vivo for cell specific
uptake and expression, by targeting a specific receptor (see, e.g., PCT
Publications WO 92/06180 dated April I 6,1992 (Wu et al. ); WO 92/22635 dated
December 23, 1992 (Wilson et al. ); W092/20316 dated November 26, 1992
(Findeis et al. ); W093/14188 dated July 22, 1993 (Clarke et al. ), WO
93/20221
dated October 14, 1993 (Young)). Alternatively, the nucleic acid can be
introduced intracellularly and incorporated within host cell DNA for
expression,
by homologous recombination (Koller and Smithies, 1989, Proc. Natl. Acad. Sci.
USA 86:8932-8935; Zijlstra et al., 1989, Nature 342:435-438).
In a specific embodiment, viral vectors that contains nucleic acid sequences
encoding an antibody of the invention are used. For example, a retroviral
vector
can be used (see Miller et al., 1993, Meth. Enzymol. 217:581-599). These
retroviral vectors have been to delete retroviral sequences that are not
necessary
for packaging of the viral genome and integration into host cell DNA. The
nucleic
acid sequences encoding the antibody to be used in gene therapy are cloned
into
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 150 -
one or more vectors, which facilitates delivery of the gene into a patient.
More
detail about retroviral vectors can be found in Boesen et al., 1994,
Biotherapy
6:291-302, which describes the use of a retroviral vector to deliver the mdrl
gene
to hematopoietic stem cells in order to make the stem cells more resistant to
chemotherapy. Other references illustrating the use of retroviral vectors in
gene
therapy are: Clowes et al., 1994, J. Clin. Invest. 93:644-651; Kiem et al.,
1994,
Blood 83:1467-1473; Salmons and Gunzberg, 1993, Human Gene Therapy 4:129-
141; and Grossman and Wilson, 1993, Curr. Opin. in Genetics and Devel. 3:110-
114.
Adenoviruses are other viral vectors that can be used in gene therapy.
Adenoviruses are especially attractive vehicles for delivering genes to
respiratory
epithelia. Adenoviruses naturally infect respiratory epithelia where they
cause a
mild disease. Other targets for adenovirus-based delivery systems are liver,
the
central nervous system, endothelial cells, and muscle. Adenoviruses have the
I 5 advantage of being capable of infecting non-dividing cells. Kozarsky and
Wilson,
1993, Current Opinion in Genetics and Development 3:499-503 present a review
of adenovirus-based gene therapy. Bout et al., 1994, Human Gene Therapy 5:3-
10 demonstrated the use of adenovirus vectors to transfer genes to the
respiratory
epithelia of rhesus monkeys. Other instances of the use of adenoviruses in
gene
therapy can be found in Rosenfeld et al., 1991, Science 252:431-434; Rosenfeld
et al., 1992, Cell 68:143- 155; Mastrangeli et al., 1993, J. Clin. Invest.
91:225-
234; PCT Publication W094/12649; and Wang etal.,1995, Gene Therapy 2:775-
783. In a preferred embodiment, adenovirus vectors are used.
Adeno-associated virus (AAV) has also been proposed for use in gene
therapy (Walsh et al., 1993, Proc. Soc. Exp. Biol. Med. 204:289-300; U.S.
Patent
No. 5,436,146).
Another approach to gene therapy involves transferring a gene to cells in
tissue culture by such methods as electroporation, lipofection, calcium
phosphate
mediated transfection, or viral infection. Usually, the method of transfer
includes
the transfer of a selectable marker to the cells. The cells are then placed
under
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 151 -
selection to isolate those cells that have taken up and are expressing the
transferred gene. Those cells are then delivered to a patient.
In this embodiment, the nucleic acid is introduced into a cell prior to
administration in vivo of the resulting recombinant cell. Such introduction
can be
carried out by any method known in the art, including but not limited to
transfection, electroporation, microinjection, infection with a viral or
bacteriophage vector containing the nucleic acid sequences, cell fusion,
chromosome-mediated gene transfer, microcell-mediated gene transfer,
spheroplast fusion, etc. Numerous techniques are known in the art for the
introduction of foreign genes into cells (see, e.g., Loeffler and Behr, 1993,
Metlz.
Enzymol. 217:599-618; Cohen et al., 1993, Meth. Enzymol. 217:618-644; Cline,
1985, Pharmac. Ther. 29:69-92) and may be used in accordance with the present
invention, provided that the necessary developmental and physiological
functions
of the recipient cells are not disrupted. The technique should provide for the
stable transfer of the nucleic acid to the cell, so that the nucleic acid is
expressible
by the cell and preferably heritable and expressible by its cell progeny.
The resulting recombinant cells can be delivered to a patient by various
methods known in the art. Recombinant blood cells (e.g., hematopoietic stem or
progenitor cells) are preferably administered intravenously. The amount of
cells
envisioned for use depends on the desired effect, patient state, etc., and can
be
determined by one skilled in the art.
Cells into which a nucleic acid can be introduced for purposes of gene
therapy encompass any desired, available cell type, and include but are not
limited
to epithelial cells, endothelial cells, keratinocytes, fibroblasts, muscle
cells,
hepatocytes; blood cells such as T-lymphocytes, B-lymphocytes, monocytes,
macrophages, neutrophils, eosinophils, megakaryocytes, granulocytes; various
stem or progenitor cells, in particular hematopoietic stem or progenitor
cells, e. g.,
as obtained from bone marrow, umbilical cord blood, peripheral blood, fetal
liver,
etc.
In a preferred embodiment, the cell used for gene therapy is autologous to
the patient.
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 152 -
In an embodiment in which recombinant cells are used in gene therapy,
nucleic acid sequences encoding an antibody are introduced into the cells such
that
they are expressible by the cells or their progeny, and the recombinant cells
are
then administered in vivo for therapeutic effect. In a specific embodiment,
stem
or progenitor cells are used. Any stem and/or progenitor cells which can be
isolated and maintained in vitro can potentially be used in accordance with
this
embodiment of the present invention (see, e.g., PCT Publication WO 94/08598,
dated April 28, 1994; Stemple and Anderson, 1992, Cell 71:973-985; Rheinwald,
1980, Meth. Cell Bio. 21A:229; and Pittelkow and Scott, 1986, Mayo Clinic
Proc. 61:771 ).
In a specific embodiment, the nucleic acid to be introduced for purposes
of gene therapy comprises an inducible promoter operably linked to the coding
region, such that expression of the nucleic acid is controllable by
controlling the
presence or absence of the appropriate inducer of transcription.
Modes of Administration
The invention provides methods of treatment, inhibition and prophylaxis
by administration to a subject of an effective amount of a compound or
pharmaceutical composition of the invention, preferably an antibody of the
invention. In a preferred aspect, the compound is substantially purified
(e.g.,
substantially free from substances that limit its effect or produce undesired
side-
effects). The subject is preferably an animal, including but not limited to
animals
such as cows, pigs, horses, chickens, cats, dogs, etc., and is preferably a
mammal,
and most preferably human.
Formulations and methods of administration that can be employed when
the compound comprises a nucleic acid or an immunoglobulin are described
above; additional appropriate formulations and routes of administration can be
selected from among those described herein below.
The agonist or antagonists described herein can be administered in vitro,
ex vivo, or in vivo to cells which express the receptor of the present
invention. By
administration of an "effective amount" of an agonist or antagonist is
intended an
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-153-
amount of the compound that is sufficient to enhance or inhibit a cellular
response
to a TNF-family ligand and include polypeptides. In particular, by
administration
of an "effective amount" of an agonist or antagonists is intended an amount
effective to enhance or inhibit TRID activity. Of course, where apoptosis is
to be
enhanced, a TRID antagonist according to the present invention can be co-
administered with a TNF-family ligand. One of ordinary skill will appreciate
that
effective amounts of an agonist or antagonist can be determined empirically
and
may be employed in pure form or in pharmaceutically acceptable salt, ester or
prodrug form. The agonist or antagonist may be administered in compositions in
combination with one or more pharmaceutically acceptable excipients.
It will be understood that, when administered to a human patient, the total
daily usage of the compounds and compositions of the present invention will be
decided by the attending physician within the scope of sound medical
judgement.
The specific therapeutically effective dose level for any particular patient
will
depend upon factors well known in the medical arts.
As a general proposition, the total pharmaceutically effective amount of
TRID polypeptide administered parenterally per dose will be in the range of
about
1 ~g/kg/day to 10 mg/kg/day of patient body weight, although, as noted above,
this will be subject to therapeutic discretion. More preferably, this dose is
at least
0.01 mg/kg/day, and most preferably for humans between about 0.01 and 1
mg/kg/day. If given continuously, the TRID agonist or antagonist is typically
administered at a dose rate of about 1 ~g/kg/hour to about 50 ~g/kg/hour,
either
by 1-4 injections per day or by continuous subcutaneous infusions, for
example,
using a mini-pump. An intravenous bag solution may also be employed.
Dosaging may also be arranged in a patient specific manner to provide a
predetermined concentration of an agonist or antagonist in the blood, as
determined by the RIA technique. Thus patient dosaging may be adjusted to
achieve regular on-going trough blood levels, as measured by RIA, on the order
of from 50 to 1000 ng/ml, preferably 150 to 500 ng/ml.
Pharmaceutical compositions of the present invention for parenteral
injection can comprise pharmaceutically acceptable sterile aqueous or
nonaqueous
CA 02374674 2001-11-20
WO 00/71150 PCT/IJS00/13515
- 154 -
solutions, dispersions, suspensions or emulsions as well as sterile powders
for
reconstitution into sterile injectable solutions or dispersions just prior to
use.
In addition to soluble TRID polypeptides, TRID polypeptides containing
the transmembrane region can also be used when appropriately solubilized by
including detergents, such as CHAPS or NP-40, with buffer.
The compounds or pharmaceutical compositions of the invention are
preferably tested in vitro, and then in vivo for the desired therapeutic or
prophylactic activity, prior to use in humans. For example, in vitro assays to
demonstrate the therapeutic or prophylactic utility of a compound or
pharmaceutical composition include, the effect of a compound on a cell line or
a
patient tissue sample. The effect of the compound or composition on the cell
line
and/or tissue sample can be determined utilizing techniques known to those of
skill
in the art including, but not limited to, rosette formation assays and cell
lysis
assays. In accordance with the invention, in vitro assays which can be used to
determine whether administration of a specific compound is indicated, include
in
vitro cell culture assays in which a patient tissue sample is grown in
culture, and
exposed to or otherwise administered a compound, and the effect of such
compound upon the tissue sample is observed.
The present invention also provides pharmaceutical compositions. Such
compositions comprise a therapeutically effective amount of a compound, and a
pharmaceutically acceptable carrier. In particular embodiments, pharmaceutical
compositions are provided comprising a TRID agonist or antagonist and a
pharmaceutically acceptable carrier or excipient, which may be administered
orally, rectally, parenterally, intracistemally, intravaginally,
intraperitoneally,
topically (as by powders, ointments, drops or transdermal patch), bucally, or
as
an oral or nasal spray. Importantly, by co-administering a TRID antagonist and
a TNF-family ligand, clinical side effects can be reduced by using lower doses
of
both the ligand and the antagonist. It will be understood that the antagonist
can
be "co-administered" either before, after, or simultaneously with the TNF-
family
ligand, depending on the exigencies of a particular therapeutic application.
By
"pharmaceutically acceptable carrier" is meant a non-toxic solid, semisolid or
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-155-
liquid filler, diluent, encapsulating material or formulation auxiliary of any
type.
In a specific embodiment, the term "pharmaceutically acceptable" means
approved
by a regulatory agency of the Federal or a state government or listed in the
U.S.
Pharmacopeia or other generally recognized pharmacopeia for use in animals,
and
more particularly in humans. The term "parenteral" as used herein refers to
modes
of administration which include intravenous, intramuscular, intraperitoneal,
intrasternal, subcutaneous and intraarticular injection and infusion. The term
"carrier" refers to a diluent, adjuvant, excipient, or vehicle with which the
therapeutic is administered. Such pharmaceutical carriers can be sterile
liquids,
such as water and oils, including those of petroleum, animal, vegetable or
synthetic
origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like.
Water
is a preferred carrier when the pharmaceutical composition is administered
intravenously. Saline solutions and aqueous dextrose and glycerol solutions
can
also be employed as liquid carriers, particularly for injectable solutions.
Suitable
pharmaceutical excipients include starch, glucose, lactose, sucrose, gelatin,
malt,
rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc,
sodium
chloride, dried skim milk, glycerol, propylene, glycol, water, ethanol and the
like.
The composition, if desired, can also contain minor amounts of wetting or
emulsifying agents, or pH buffering agents. These compositions can take the
form
of solutions, suspensions, emulsion, tablets, pills, capsules, powders,
sustained-
release formulations and the like. The composition can be formulated as a
suppository, with traditional binders and carriers such as triglycerides. Oral
formulation can include standard carriers such as pharmaceutical grades of
mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose,
magnesium carbonate, etc. Examples of suitable pharmaceutical carriers are
described in "Remington's Pharmaceutical Sciences" by E.W. Martin. Such
compositions will contain a therapeutically effective amount of the compound,
preferably in purified form, together with a suitable amount of carrier so as
to
provide the form for proper administration to the patient. The formulation
should
suit the mode of administration.
CA 02374674 2001-11-20
WO 00/71150 PCT/iJS00/13515
- 156 -
In a preferred embodiment, the composition is formulated in accordance
with routine procedures as a pharmaceutical composition adapted for
intravenous
administration to human beings. Typically, compositions for intravenous
administration are solutions in sterile isotonic aqueous buffer. Where
necessary,
the composition may also include a solubilizing agent and a local anesthetic
such
as lignocaine to ease pain at the site of the injection. Generally, the
ingredients are
supplied either separately or mixed together in unit dosage form, for example,
as
a dry lyophilized powder or water free concentrate in a hermetically sealed
container such as an ampule or sachette indicating the quantity of active
agent.
Where the composition is to be administered by infusion, it can be dispensed
with
an infusion bottle containing sterile pharmaceutical grade water or saline.
Where
the composition is administered by injection, an ampule of sterile water for
injection or saline can be provided so that the ingredients may be mixed prior
to
administration.
The compounds of the invention can be formulated as neutral or salt forms.
Pharmaceutically acceptable salts include those formed with anions such as
those
derived from hydrochloric, phosphoric, acetic, oxalic, tartaric acids, etc.,
and
those formed with cations such as those derived from sodium, potassium,
ammonium, calcium, ferric hydroxides, isopropylamine, triethylamine, 2-
ethylamino ethanol, histidine, procaine, etc.
The TRID polypeptide is also suitably administered by sustained-release
systems. Suitable examples of sustained-release compositions include semi-
permeable polymer matrices in the form of shaped articles, e.g., films, or
mirocapsules. Sustained-release matrices include polylactides (U.S. Pat. No.
3,773,919, EP 58,481), copolymers of L-glutamic acid and gamma-ethyl-L-
glutamate (Sidman, U. et al., Biopolymers 22:547-556 (1983)), poly (2-
hydroxyethyl methacrylate) (R. Langer et al., J. Biomed. Mater. Res. 15:167-
277
( 198 I ), and R. Langer, Chem. Tech.12:98-1 OS ( 1982)), ethylene vinyl
acetate (R.
Langer et al., Id.) or poly-D- (-)-3-hydroxybutyric acid (EP 133,988).
Sustained-
release TRID polypeptide compositions also include liposomally entrapped TRID
polypeptides. Liposomes containing TRID polypeptides are prepared by methods
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 157 -
known per se: DE 3,218,121; Epstein et al., Proc. Natl. Acad. Sci. (USA)
82:3688-3692 (1985); Hwang et al., Proc. Natl. Acad. Sci. (USA) 77:4030-4034
(1980); EP 52,322; EP 36,676; EP 88.046; EP 143,949; EP 142,641; Japanese
Pat. Appl. 83-118008; U.S. Pat. Nos. 4,485,045 and 4,544,545; and EP 102,324.
Ordinarily, the liposomes are ofthe small (about 200-800 Angstroms)
unilamellar
type in which the lipid content is greater than about 30 mol. percent
cholesterol,
the selected proportion being adjusted for the optimal TNFR polypeptide
therapy.
The carrier suitably contains minor amounts of additives such as
substances that enhance isotonicity and chemical stability. Such materials are
non-
toxic to recipients at the dosages and concentrations employed, and include
buffers such as phosphate, citrate, succinate, acetic acid, and other organic
acids
or their salts; antioxidants such as ascorbic acid; low molecular weight (less
than
about ten residues) polypeptides, e.g., polyarginine or tripeptides; proteins,
such
as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as
polyvinylpyrrolidone; amino acids, such as glycine, glutamic acid, aspartic
acid,
or arginine; monosaccharides, disaccharides, and other carbohydrates including
cellulose or its derivatives, glucose, manose, or dextrins; chelating agents
such as
EDTA; sugar alcohols such as mannitol or sorbitol; counterions such as sodium;
and/or nonionic surfactants such as polysorbates, poloxamers, or PEG.
The TRID polypeptide is typically formulated in such vehicles at a
concentration of about 0.1 mg/ml to 100 mg/ml, preferably 1-10 mg/ml, at a pH
of about 3 to 8. It will be understood that the use of certain of the
foregoing
excipients, carriers, or stabilizers will result in the formation of TRID
polypeptide
salts.
TRID polypeptides to be used for therapeutic administration must be
sterile. Sterility is readily accomplished by filtration through sterile
filtration
membranes (e.g., 0.2 micron membranes). Therapeutic TRID polypeptide
compositions generally are placed into a container having a sterile access
port, for
example, an intravenous solution bag or vial having a stopper pierceable by a
hypodermic injection needle.
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 158 -
TRID polypeptides ordinarily will be stored in unit or mufti-dose
containers, for example, sealed ampoules or vials, as an aqueous solution or
as a
lyophilized formulation for reconstitution. As an example of a lyophilized
formulation, 10-ml vials are filled with 5 ml of sterile-filtered 1 % (w/v)
aqueous
TRID polypeptide solution, and the resulting mixture is lyophilized. The
infusion
solution is prepared by reconstituting the lyophilized TRID polypeptide using
bacteriostatic Water-for-Injection.
As indicated above, the compositions of the invention may be administered
alone or in combination with other therapeutic agents. Therapeutic agents that
may be administered in combination with the compositions of the invention,
include but are not limited to, other members of the TNF family,
chemotherapeutic
agents, antibiotics, steroidal and non-steroidal anti-inflammatories,
conventional
immunotherapeutic agents, cytokines, chemokines and/or growth factors.
Combinations may be administered either concomitantly, e.g., as an admixture,
separately but simultaneously or concurrently; or sequentially. This includes
presentations in which the combined agents are administered together as a
therapeutic mixture, and also procedures in which the combined agents are
administered separately but simultaneously, e.g. , as through separate
intravenous
lines into the same individual. Administration "in combination" further
includes
the separate administration of one of the compounds or agents given first,
followed by the second.
In one embodiment, the compositions of the invention are administered in
combination with other members of the TNF family. TNF, TNF-related or TNF-
like molecules that may be administered with the compositions of the invention
include, but are not limited to, soluble forms of TNF-alpha, lymphotoxin-alpha
(LT-alpha, also known as TNF-beta), LT-beta (found in complex heterotrimer LT-
alpha2-beta), OPGL, Fast, CD27L, CD30L, CD40L, 4-1BBL, DcR3, OX40L,
TNF-gamma (International Publication No. WO 96/14328), (International
Publication No. WO 96/14328), TNF-'y-a, TNF-y-~3 (International Publication
No. WO 00/08139), TRAIL, AIM-II (International Publication No. WO
97/34911), APRIL (J. Exp. Med. 188(6):1185-1190), endokine-alpha
CA 02374674 2001-11-20
WO 00/71150 PCT/LJS00/13515
- 159 -
(International Publication No. WO 98/07880), TR6 (International Publication
No.
WO 98/30694), OPG, and neutrokine-alpha (International Publication No. WO
98/18921, OX40, and nerve growth factor (NGF), and soluble forms of Fas,
CD30, CD27, CD40 and 4-IBB, TR2 (International Publication No. WO
96/34095), DR3 (International Publication No. WO 97/33904), DR4
(International Publication No. WO 98/32856, TR6 (International Publication No.
WO 98/30694), TR7 (International Publication No. WO 98/41629), TRANK,
TR9 (International Publication No. WO 98/56892), TR10 (International
Publication No. WO 98/54202), 31X2 (International Publication No. WO
98/06842), and TR12, AIM-I (International Publication No. WO 97/33899), and
soluble forms CD 154, CD70, and CD 153.
In another embodiment, the compositions of the invention are administered
in combination with CD40 ligand (CD40L), a soluble form of CD40L (e.g.,
AVRENDTM), biologically active fragments, variants, or derivatives of CD40L,
anti-CD40L antibodies (e.g., agonistic or antagonistic antibodies), and/or
anti-
CD40 antibodies (e.g., agonistic or antagonistic antibodies).
In yet another embodiment, the compositions of the invention are
administered in combination with one, two, three, four, five, or more of the
following compositions: tacrolimus (Fujisawa), thalidomide (e.g., Celgene),
anti-
Tac(Fv)-PE40 (e.g., Protein Design Labs), inolimomab (Biotest), MAK-195F
(Knoll), ASM-981 (Novartis), interleukin-1 receptor (e.g., Immunex),
interleukin-
4 receptor (e.g., Immunex), ICM3 (ICOS), BMS-188667 (Bristol-Myers Squibb),
anti-TNF Ab (e.g., Therapeutic antibodies), CG-1088 (Celgene), anti-B7
monoclonal antibody (e.g., Innogetics), MEDI-507 (BioTransplant), ABX-CBL
(Abgenix).
According to the invention, a patient susceptible to both Fas ligand (Fas-L)
mediated and TRAIL mediated cell death may be treated with both an agent that
inhibits TRAIL/TRAIL-R interactions and an agent that inhibits Fas-L/Fas
interactions. Suitable agents for blocking binding of Fas-L to Fas include,
but are
not limited to, soluble Fas polypeptides; oligomeric forms of soluble Fas
polypeptides (e.g., dimers of sFas/Fc); anti-Fas antibodies that bind Fas
without
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 160 -
transducing the biological signal that results in apoptosis; anti-Fas-L
antibodies
that block binding of Fas-L to Fas; and muteins of Fas-L that bind Fas but do
not
transduce the biological signal that results in apoptosis. Preferably, the
antibodies
employed according to this method are monoclonal antibodies. Examples of
suitable agents for blocking Fas-L/Fas interactions, including blocking anti-
Fas
monoclonal antibodies, are described in WO 95/10540, hereby incorporated by
reference.
In certain embodiments, compositions ofthe invention are administered in
combination with antiretroviral agents, nucleoside reverse transcriptase
inhibitors,
non-nucleoside reverse transcriptase inhibitors, and/or protease inhibitors.
Nucleoside reverse transcriptase inhibitors that may be administered in
combination with the compositions of the invention, include, but are not
limited
to, RETROVIRT"~ (zidovudine/AZT), VIDEXT"~ (didanosine/ddI), HIVIDT""
(zalcitabine/ddC), ZERITT"" (stavudine/d4T), EPIVIRT"" (lamivudine/3TC), and
COMBIVIRT"~ (zidovudine/lamivudine). Non-nucleoside reverse transcriptase
inhibitors that may be administered in combination with the compositions of
the
invention, include, but are not limited to, VIRAMUNET"" (nevirapine),
RESCRIPTORT"" (delavirdine), and SUSTIVAT"~ (efavirenz). Protease inhibitors
that may be administered in combination with the compositions of the
invention,
include, but are not limited to, CRIXIVANT"" (indinavir), NORVIRT""
(ritonavir),
INVIRASET"" (saquinavir), and VIRACEPTT"" (nelfinavir). In a specific
embodiment, antiretroviral agents, nucleoside reverse transcriptase
inhibitors, non-
nucleoside reverse transcriptase inhibitors. and/or protease inhibitors may be
used
in any combination with compositions of the invention to treat AIDS and/or to
prevent or treat HIV infection.
In other embodiments, compositions of the invention may be administered
in combination with anti-opportunistic infection agents. Anti-opportunistic
agents
that may be administered in combination with the compositions of the
invention,
include, but are not limited to, TRIMETHOPRIM-SULFAMETHOXAZOLET"",
DAPSONET"", PENTAMIDINET"~, ATOVAQUONET"~, ISONIAZIDT"~,
RIFAMPINT"" PYRAZINAMIDET~", ETHAMBUTOLT"~, RIFABUTINT"',
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 161 -
CLARITHROMYCINT"~, AZITHROMYCINT"", GANCICLOVIRT"~,
FOSCARNETT"", CIDOFOVIRT"', FLUCONAZOLET"~, ITRACONAZOLET"~
KETOCONAZOLET"", ACYCLOVIRT"", FAMCICOLVIRT""
PYRIMETHAMINET"", LEUCOVORINT"", NEUPOGENT"" (filgrastim/G-CSF),
and LEUKINET~" (sargramostim/GM-CSF). In a specific embodiment,
compositions of the invention are used in any combination with
TRIMETHOPRIM-SULFAMETHOXAZOLET"", DAPSONET""
PENTAMIDINET"", and/or ATOVAQUONET"" to prophylactically treat and/or
prevent an opportunistic Pneumocystis carinii pneumonia infection. In another
specific embodiment, compositions of the invention are used in any combination
with ISONIAZIDT~~, RIFAMPINT"~, PYRAZINAMIDET"~, and/or
ETHAMBUTOLT"" to prophylactically treat and/or prevent an opportunistic
Mycobacterium avium complex infection. In another specific embodiment,
compositions of the invention are used in any combination with RIFABUTINTM,
CLARITHROMYCINT"", and/or AZITHROMYCINT"' to prophylactically treat
and/or prevent an opportunistic Mycobacterium tuberculosis infection. In
another
specific embodiment, compositions of the invention are used in any combination
with GANCICLOVIRT"", FOSCARNETT"~, and/or CIDOFOVIRT"~ to
prophylactically treat and/or prevent an opportunistic cytomegalovirus
infection.
In another specific embodiment, compositions of the invention are used in any
combination with FLUCONAZOLET"~, ITRACONAZOLET"", and/or
KETOCONAZOLET"" to prophylactically treat and/or prevent an opportunistic
fungal infection. In another specific embodiment, compositions of the
invention
are used in any combination with ACYCLOVIRT"" and/or FAMCICOLVIRT"~ to
prophylactically treat and/or prevent an opportunistic herpes simplex virus
type
I and/or type II infection. In another specific embodiment, compositions of
the
invention are used in any combination with PYRIMETHAMINET"~ and/or
LEUCOVORINT"" to prophylactically treat and/or prevent an opportunistic
Toxoplasma gondii infection. In another specific embodiment, compositions of
the invention are used in any combination with LEUCOVORINT"" and/or
NEUPOGENT"~ to prophylactically treat and/or prevent an opportunistic
bacterial
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 162 -
infection.
In a further embodiment, the compositions of the invention are
administered in combination with an antiviral agent. Antiviral agents that may
be
administered with the compositions of the invention include, but are not
limited
to, acyclovir, ribavirin, amantadine, and remantidine.
In a further embodiment, the compositions of the invention are
administered in combination with an antibiotic agent. Antibiotic agents that
may
be administered with the compositions of the invention include, but are not
limited
to, amoxicillin, aminoglycosides, beta-lactam (glycopeptide), beta-lactamases,
Clindamycin, chloramphenicol, cephalosporins, ciprofloxacin, ciprofloxacin,
erythromycin, fluoroquinolones, macrolides, metronidazole, penicillins,
quinolones, rifampin, streptomycin, sulfonamide, tetracyclines, trimethoprim,
trimethoprim-sulfamthoxazole, and vancomycin.
Conventional nonspecific immunosuppressive agents, that may be
administered in combination with the compositions of the invention include,
but
are not limited to, steroids, cyclosporine, cyclosporine analogs,
cyclophosphamide
methylprednisone, prednisone, azathioprine, FK-506, 15-deoxyspergualin, and
other immunosuppressive agents that act by suppressing the function of
responding T-cells.
In specific embodiments, compositions of the invention are administered
in combination with immunosuppressants. Immunosuppressants preparations that
may be administered with the compositions of the invention include, but are
not
limited to, ORTHOCLONET"~ (OKT3), SANDIMMLTNET""/NEORALT""~
SANGDYAT"~ (cyclosporin), PROGRAFT"" (tacrolimus), CELLCEPTT""
(mycophenolate), Azathioprine, glucorticosteroids, and RAPAMLTNET""
(sirolimus). In a specific embodiment, immunosuppressants may be used to
prevent rejection of organ or bone marrow transplantation.
In an additional embodiment, compositions of the invention are
administered alone or in combination with one or more intravenous immune
globulin preparations. Intravenous immune globulin preparations that may be
administered with the compositions of the invention include, but not limited
to,
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-163-
GAMMART"", IVEEGAMT"", SANDOGLOBUL1NT"~, GAMMAGARD S/DT"~, and
GAMIMUNET"~. In a specific embodiment, compositions of the invention are
administered in combination with intravenous immune globulin preparations in
transplantation therapy (e.g., bone marrow transplant).
In an additional embodiment, the compositions of the invention are
administered alone or in combination with an anti-inflammatory agent. Anti-
inflammatory agents that may be administered with the compositions of the
invention include, but are not limited to, glucocorticoids and the
nonsteroidal
anti-inflammatories, aminoarylcarboxylic acid derivatives, .arylacetic acid
derivatives, arylbutyric acid derivatives, arylcarboxylic acids, arylpropionic
acid
derivatives, pyrazoles, pyrazolones, salicylic acid derivatives,
thiazinecarboxamides, e-acetamidocaproic acid, S-adenosylmethionine, 3-amino-
4-hydroxybutyric acid, amixetrine, bendazac, benzydamine, bucolome,
difenpiramide, ditazol, emorfazone, guaiazulene, nabumetone, nimesulide,
orgotein, oxaceprol, paranyline, perisoxal, pifoxime, proquazone, proxazole,
and
tenidap.
In one embodiment, the compositions of the invention are administered
in combination with steroid therapy. Steroids that may be administered in
combination with the compositions of the invention, include, but are not
limited
to, oral corticosteroids, prednisone, and methylprednisolone (e.g., IV
methylprednisolone). In a specific embodiment, compositions ofthe invention
are
administered in combination with prednisone. In a further specific embodiment,
the compositions of the invention are administered in combination with
prednisone and an immunosuppressive agent. Immunosuppressive agents that
may be administered with the compositions of the invention and prednisone are
those described herein, and include, but are not limited to, azathioprine,
cylophosphamide, and cyclophosphamide IV. In a another specific embodiment,
compositions of the invention are administered in combination with
methylprednisolone. In a further specific embodiment, the compositions of the
invention are administered in combination with methylprednisolone and an
immunosuppressive agent. Immunosuppressive agents that may be administered
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 164 -
with the compositions of the invention and methylprednisolone are those
described herein, and include, but are not limited to, azathioprine,
cylophosphamide, and cyclophosphamide IV.
In another embodiment, the compositions of the invention are
administered in combination with an antimalarial. Antimalarials that may be
administered with the compositions of the invention include, but are not
limited
to, hydroxychloroquine, chloroquine, and/or quinacrine.
In yet another embodiment, the compositions of the invention are
administered in combination with an NSAID.
In a nonexclusive embodiment, the compositions of the invention are
administered in combination with one, two, three, four, five, ten, or more of
the
following drugs: NRD-101 (Hoechst Marion Roussel), diclofenac (Dimethaid),
oxaprozin potassium (Monsanto), mecasermin (Chiron), T-614 (Toyama),
pemetrexed disodium (Eli Lilly), atreleuton (Abbott), valdecoxib (Monsanto),
eltenac (Byk Gulden), campath, AGM-1470 (Takeda), CDP-571 (Celltech
Chiroscience), CM-101 (CarboMed), ML-3000 (Merckle), CB-2431 (KS
Biomedix), CBF-BS2 (KS Biomedix), IL-1 Ra gene therapy (Valentis), JTE-522
(Japan Tobacco), paclitaxel (Angiotech), DW-166HC (Dong Wha), darbufelone
mesylate (Warner-Lambert), soluble TNF receptor 1 (synergen; Amgen), IPR-
6001 (Institute for Pharmaceutical Research), trocade (Hoffman-La Roche), EF-5
(Scotia Pharmaceuticals), BIIL-284 (Boehringer Ingelheim), BIIF-1149
(Boehringer Ingelheim), LeukoVax (Inflammatics), MK-663 (Merck), ST-1482
(Sigma-Tau), and butixocort propionate (WarnerLambert).
In yet another embodiment, the compositions of the invention are
administered in combination with one, two, three, four, five or more of the
following drugs: methotrexate, sulfasalazine, sodium aurothiomalate,
auranofin,
cyclosporine, penicillamine, azathioprine, an antimalarial drug (e.g., as
described
herein), cyclophosphamide, chlorambucil, gold, ENBRELT"~ (Etanercept), anti-
TNF antibody, and prednisolone. In a more preferred embodiment, the
compositions of the invention are administered in combination with an
antimalarial, methotrexate, anti-TNF antibody, ENBRELT"" and/or suflasalazine.
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-165-
In one embodiment, the compositions of the invention are administered
in combination with methotrexate. In another embodiment, the compositions of
the invention are administered in combination with anti-TNF antibody. In
another
embodiment, the compositions of the invention are administered in combination
with methotrexate and anti-TNF antibody. In another embodiment, the
compositions of the invention are administered in combination with
suflasalazine.
In another specific embodiment, the compositions of the invention are
administered in combination with methotrexate, anti-TNF antibody, and
suflasalazine. In another embodiment, the compositions of tl~e invention are
administered in combination ENBRELT"". In another embodiment, the
compositions of the invention are administered in combination with ENBRELT""
and methotrexate. In another embodiment, the compositions of the invention are
administered in combination with ENBRELT"", methotrexate and suflasalazine.
In another embodiment, the compositions of the invention are administered in
combination with ENBRELT"", methotrexate and suflasalazine. In other
embodiments, one or more antimalarials is combined with one of the above-
recited combinations. In a specific embodiment, the compositions of the
invention are administered in combination with an antimalarial (e.g.,
hydroxychloroquine), ENBRELT"~, methotrexate and suflasalazine. In another
specific embodiment, the compositions of the invention are administered in
combination with an antimalarial (e. g. , hydroxychloroquine), sulfasalazine,
anti-
TNF antibody, and methotrexate.
In another embodiment, compositions of the invention are administered
in combination with a chemotherapeutic agent. Chemotherapeutic agents that
may be administered with the compositions of the invention include, but are
not
limited to, antibiotic derivatives (e.g. , doxorubicin, bleomycin,
daunorubicin, and
dactinomycin); antiestrogens (e.g., tamoxifen); antimetabolites (e.g.,
fluorouracil,
5-FU, methotrexate, floxuridine, interferon alpha-2b, glutamic acid,
plicamycin,
mercaptopurine, and 6-thioguanine); cytotoxic agents (e.g., carmustine, BCNU,
lomustine, CCNU, cytosine arabinoside, cyclophosphamide, estramustine,
hydroxyurea, procarbazine, mitomycin, busulfan, cis-platin, and vincristine
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 166 -
sulfate); hormones (e.g., medroxyprogesterone, estramustine phosphate sodium,
ethinyl estradiol, estradiol, megestrol acetate, methyltestosterone,
diethylstilbestrol diphosphate, chlorotrianisene, and testolactone); nitrogen
mustard derivatives (e.g., mephalen, chorambucil, mechlorethamine (nitrogen
mustard) and thiotepa); steroids and combinations (e.g., bethamethasone sodium
phosphate); and others (e.g., dicarbazine, asparaginase, mitotane, vincristine
sulfate, vinblastine sulfate, and etoposide).
In an additional embodiment, the compositions of the invention are
administered in combination with cytokines. Cytokines that may be administered
with the compositions of the invention include, but are not limited to, IL-2,
IL-3,
IL-4, IL-5, IL-6, IL-7, IL-10, IL-12, IL-13, IL-15, anti-CD40, CD40L, IFN-
gamma and T'NF-alpha.
In an additional embodiment, the compositions of the invention are
administered in combination with angiogenic proteins. Angiogenic proteins that
may be administered with the compositions of the invention include, but are
not
limited to,. Glioma Derived Growth Factor (GDGF), as disclosed in European
Patent Number EP-399816; Platelet Derived Growth Factor-A (PDGF-A), as
disclosed in European Patent Number EP-682110; Platelet Derived Growth
Factor-B (PDGF-B), as disclosed in European Patent Number EP-282317;
Placental Growth Factor (P1GF), as disclosed in International Publication
Number
WO 92/06194; Placental Growth Factor-2 (P1GF-2), as disclosed in Hauser et
al.,
Growth Factors, 4:259-268 (1993): Vascular Endothelial Growth Factor
(VEGF), as disclosed in International Publication Number WO 90/13649;
Vascular Endothelial Growth Factor-A (VEGF-A), as disclosed in European
Patent Number EP-506477; Vascular Endothelial Growth Factor-2 (VEGF-2),
as disclosed in International Publication Number WO 96/39515; Vascular
Endothelial Growth Factor B-186 (VEGF-B186), as disclosed in International
Publication Number WO 96/26736; Vascular Endothelial Growth Factor-D
(VEGF-D), as disclosed in International Publication Number WO 98/02543;
Vascular Endothelial Growth Factor-D (VEGF-D), as disclosed in International
Publication Number WO 98/07832; and Vascular Endothelial Growth Factor-E
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 167 -
(VEGF-E), as disclosed in German Patent Number DE19639601. The above
mentioned references are incorporated herein by reference herein.
In an additional embodiment, the compositions of the invention are
administered in combination with Fibroblast Growth Factors. Fibroblast Growth
Factors that may be administered with the compositions of the invention
include,
but are not limited to, FGF-1. FGF-2, FGF-3, FGF-4, FGF-5, FGF-6, FGF-7,
FGF-8, FGF-9, FGF-10, FGF-11, FGF-12, FGF-13, FGF-14, and FGF-15.
In additional embodiments, the compositions of the invention are
administered in combination with other therapeutic or prophylactic regimens,
such
as, for example, radiation therapy.
In one embodiment, the compositions of the invention are administered in
combination with one or more chemokines. In specific embodiments, the
compositions of the invention are administered in combination with an a(CxC)
chemokine selected from the group consisting of gamma-interferon inducible
protein-10 (yIP-10), interleukin-8 (IL-8), platelet factor-4 (PF4), neutrophil
activating protein (NAP-2), GRO-a., GRO-~3, GRO-y, neutrophil-activating
peptide (ENA-78), granulocyte chemoattractant protein-2 (GCP-2), and stromal
cell-derived factor-1 (SDF-1, or pre-B-cell stimulatory factor (PBSF)); and/or
a
(3 (CC) selected from the group consisting of: RANTES (regulated on
activation,
normal T expressed and secreted), macrophage inflammatory protein-1 alpha
(MIP-1 a,), macrophage inflammatory protein-1 beta (MIP-1 (3), monocyte
chemotactic protein-1 (MCP-1), monocyte chemotactic protein-2 (MCP-2),
monocyte chemotactic protein-3 (MCP-3), monocyte chemotactic protein-4
(MCP-4) macrophage inflammatory protein-1 gamma (MIP-1 y), macrophage
inflammatory protein-3 alpha (MIP-3 a), macrophage inflammatory protein-3 beta
(MIP-3 (3), macrophage inflammatory protein-4 (MIP-4/DC-CK-1/PARC),
eotaxin, Exodus, and I-309; and/or the y(C) chemokine, lymphotactin.
Various delivery systems are known and can be used to administer a
compound of the invention, e.g., encapsulation in liposomes, microparticles,
microcapsules, recombinant cells capable of expressing the compound, receptor-
mediated endocytosis (see, e.g., Wu and Wu, 1987, J. Biol. Chem. 262:4429-
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 168 -
4432), construction of a nucleic acid as part of a retroviral or other vector,
etc.
Methods of introduction include but are not limited to intradermal,
intramuscular,
intraperitoneal, intravenous, subcutaneous, intranasal, epidural, and oral
routes.
The compounds or compositions may be administered by any convenient route,
for example by infusion or bolus injection, by absorption through epithelial
or
mucocutaneous linings (e.g., oral mucosa, rectal and intestinal mucosa, etc.)
and
may be administered together with other biologically active agents.
Administration can be systemic or local. In addition, it may be desirable to
introduce the pharmaceutical compounds or compositions of the invention into
the
central nervous system by any suitable route, including intraventricular and
intrathecal injection; intraventricular injection may be facilitated by an
intraventricular catheter, for example, attached to a reservoir, such as an
Ommaya
reservoir. Pulmonary administration can also be employed, e.g., by use of an
inhaler or nebulizer, and formulation with an aerosolizing agent.
In a specific embodiment, it may be desirable to administer the
pharmaceutical compounds or compositions of the invention locally to the area
in
need of treatment; this may be achieved by, for example, and not by way of
limitation, local infusion during surgery, topical application, e.g., in
conjunction
with a wound dressing after surgery, by injection, by means of a catheter, by
means of a suppository, or by means of an implant, said implant being of a
porous,
non-porous, or gelatinous material, including membranes, such as sialastic
membranes, or fibers. Preferably, when administering a protein, including an
antibody, of the invention, care must be taken to use materials to which the
protein
does not absorb.
In another embodiment, the compound or composition can be delivered in
a vesicle, in particular a liposome (see Langer, 1990, Science 249:1527-1533;
Treat et al., in Liposomes in the Therapy of Infectious Disease and Cancer,
Lopez-Berestein and Fidler (eds.), Liss, New York, pp. 353- 365 (1989); Lopez-
Berestein, ibid., pp. 317-327; see generally ibid.)
In yet another embodiment, the compound or composition can be delivered
in a controlled release system. In one embodiment, a pump may be used (see
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 169 -
Langer, supra; Sefton, 1987, CRC Crit. Ref. Biomed. Eng. 14:201; Buchwald et
al., 1980, Surgery 88:507; Saudek et al., 1989, N. Engl. J. Med. 321:574). In
another embodiment, polymeric materials can be used (see Medical Applications
of Controlled Release, Langer and Wise (eds.), CRC Pres., Boca Raton, Florida
( 1974); Controlled Drug Bioavailability, Drug Product Design and Performance,
Smolen and Ball (eds.), Wiley, New York (1984); Ranger and Peppas, J., 1983,
Macromol. Sci. Rev. Macromol. Chem. 23:61; see also Levy et al., 1985, Science
228:190; During et al., 1989, Ann. Neurol. 25:351; Howard et al., 1989, J.
Neuro.surg. 71:105). In yet another embodiment, a controlled release system
can
be placed in proximity of the therapeutic target, i. e. , the brain, thus
requiring only
a fraction of the systemic dose (see, e.g., Goodson, in Medical Applications
of
Controlled Release, supra, vol. 2, pp. 115-138 (1984)).
Other controlled release systems are discussed in the review by Langer
(1990, Science 249:1527-1533).
In a specific embodiment where the compound of the invention is a nucleic
acid encoding a protein, the nucleic acid can be administered in vivo to
promote
expression of its encoded protein, by constructing it as part of an
appropriate
nucleic acid expression vector and administering it so that it becomes
intracellular,
e.g., by use of a retroviral vector (see U.S. Patent No. 4,980,286), or by
direct
injection, or by use of microparticle bombardment (e.g., a gene gun;
Biolistic,
Dupont), or coating with lipids or cell-surface receptors or transfecting
agents, or
by administering it in linkage to a homeobox- like peptide which is known to
enter
the nucleus (see, e.g., Joliot et al., 1991, Proc. Natl. Acad. Sci. USA
88:1864-
1868), etc. Alternatively, a nucleic acid can be introduced intracellularly
and
incorporated within host cell DNA for expression, by homologous recombination.
The amount of the compound of the invention which will be effective in
the treatment, inhibition and prevention of a disease or disorder associated
with
aberrant expression and/or activity of a polypeptide of the invention can be
determined by standard clinical techniques. In addition, in vitro assays may
optionally be employed to help identify optimal dosage ranges. The precise
dose
to be employed in the formulation will also depend on the route of
administration,
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 170 -
and the seriousness of the disease or disorder, and should be decided
according
to the judgment of the practitioner and each patient's circumstances.
Effective
doses may be extrapolated from dose-response curves derived from in vitro or
animal model test systems.
For antibodies, the dosage administered to a patient is typically 0.1 mg/kg
to 100 mg/kg of the patient's body weight. Preferably, the dosage administered
to a patient is between 0.1 mg/kg and 20 mg/kg of the patient's body weight,
more preferably 1 mg/kg to 10 mg/kg of the patient's body weight. Generally,
human antibodies have a longer half life within the human body than antibodies
from other species due to the immune response to the foreign polypeptides.
Thus,
lower dosages of human antibodies and less frequent administration is often
possible. Further, the dosage and frequency of administration of antibodies of
the
invention may be reduced by enhancing uptake and tissue penetration (e.g.,
into
the brain) of the antibodies by modifications such as, for example,
lipidation.
In one embodiment, the invention provides a method of delivering
compositions containing the polypeptides of the invention (e.g., compositions
containing TRID polypeptides or anti-TRID antibodies (e.g., agonist or
antagonist
antibodies) associated with heterologous polypeptides, heterologous nucleic
acids,
toxins, or prodrugs) to targeted cells, expressing the membrane-bound form of
TRID on their surface. TRID polypeptides or anti-TRID antibodies of the
invention may be associated with heterologous polypeptides, heterologous
nucleic
acids, toxins, or prodrugs via hydrophobic, hydrophilic, ionic and/or covalent
interactions.
In one embodiment, the invention provides a method for the specific
delivery of compositions ofthe invention to cells by administering
polypeptides of
the invention (e.g., TRID or anti-TRID antibodies) that are associated with
heterologous polypeptides or nucleic acids. In one example, the invention
provides a method for delivering a therapeutic protein into the targeted cell.
In
another example, the invention provides a method for delivering a single
stranded
nucleic acid (e.g., antisense or ribozymes) or double stranded nucleic acid
(e.g.,
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-171-
DNA that can integrate into the cell's genome or replicate episomally and that
can
be transcribed) into the targeted cell.
In another embodiment, the invention provides a method for the specific
destruction of cells (e.g., the destruction of tumor cells) by administering
polypeptides of the invention (e.g. , TRID polypeptides or anti-TRID
antibodies)
in association with toxins or cytotoxic prodrugs.
In a specific embodiment, the invention provides a method for the specific
destruction of cells expressing TRID receptors on their surface (e.g.,
activated
T-cells, cancer cells, or leukemic cells) by administering TRID. polypeptides
or
anti-TRID antibodies in association with toxins or cytotoxic prodrugs.
In another specific embodiment, the invention provides a method for the
specific destruction of cells expressing the membrane-bound form of TRID on
their surface (e.g., spleen, bone marrow, kidney and PBLs) by administering
anti-
TRID antibodies in association with toxins or cytotoxic prodrugs.
By "toxin" is meant compounds that bind and activate endogenous
cytotoxic effector systems, radioisotopes, holotoxins, modified toxins,
catalytic
subunits of toxins, cytotoxins (cytotoxic agents), or any molecules or enzymes
not
normally present in or on the surface of a cell that under defined conditions
cause
the cell's death. Toxins that may be used according to the methods of the
invention include, but are not limited to, radioisotopes known in the art,
compounds such as, for example, antibodies (or complement fixing containing
portions thereof) that bind an inherent or induced endogenous cytotoxic
effector
system, thymidine kinase, endonuclease, RNAse, alpha toxin, ricin, abrin,
Pseudomonas exotoxin A, diphtheria toxin, saporin, momordin, gelonin,
pokeweed antiviral protein, alpha-sarcin and cholera toxin. "Toxin" also
includes
a cytostatic or cytocidal agent, a therapeutic agent or a radioactive metal
ion, e.g.,
alpha-emitters such as, for example, z'3Bi, or other radioisotopes such as,
for
example, lo3Pd, 133Xe' 131I' 68Ge' S7C~' 65zn' 85Sr 32P 35s' 90Y' 153sm'
153Gd' 169Yb'
5'Cr, 54Mn, 75Se, "3Sn, 9°Yttrium, "7Tin,'g6Rhenium,'66Holmium,
and'88Rhenium;
luminescent labels, such as luminol; and fluorescent labels, such as
fluorescein and
rhodamine, and biotin.
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 172 -
Techniques known in the art may be applied to label proteins (including
antibodies) of the invention. Such techniques include, but are not limited to,
the
use of bifunctional conjugating agents (see, e.g., U.S. Patent Nos. 5,756,065;
5,714,631; 5,696,239; 5,652,361; 5,505,931; 5,489,425; 5,435,990; 5,428,139;
5,342,604; 5,274,119; 4,994,560; and 5,808,003; the contents of each of which
are hereby incorporated by reference in its entirety). A cytotoxin or
cytotoxic
agent includes any agent that is detrimental to cells. Examples include
paclitaxol,
cytochalasin B, gramicidin D, ethidium bromide, emetine, mitomycin, etoposide,
tenoposide, vincristine, vinblastine, colchicin, doxorubicin, daunorubicin,
dihydroxy anthracin dione, mitoxantrone, mithramycin, actinomycin D, 1-
dehydrotestosterone, glucocorticoids, procaine, tetracaine, lidocaine,
propranolol,
and puromycin and analogs or homologs thereof. Therapeutic agents include, but
are not limited to, antimetabolites (e.g., methotrexate, 6-mercaptopurine, 6-
thioguanine, cytarabine, 5-fluorouracil decarbazine), alkylating agents (e.g.,
mechlorethamine, thioepa chlorambucil, melphalan, carmustine (BSNU) and
lomustine (CCNU), cyclothosphamide, busulfan, dibromomannitol, streptozotocin,
mitomycin C, and cis-dichlorodiamine platinum (II) (DDP) cisplatin),
anthracyclines (e.g., daunorubicin (formerly daunomycin) and doxorubicin),
antibiotics (e.g., dactinomycin (formerly actinomycin), bleomycin,
mithramycin,
and anthramycin (AMC)), and anti-mitotic agents (e.g., vineristine and
vinblastine).
By "cytotoxic prodrug" is meant a non-toxic compound that is converted
by an enzyme, normally present in the cell, into a cytotoxic compound.
Cytotoxic
prodrugs that may be used according to the methods of the invention include,
but
are not limited to, glutamyl derivatives of benzoic acid mustard alkylating
agent,
phosphate derivatives of etoposide or mitomycin C, cytosine arabinoside,
daunorubicin, and phenoxyacetamide derivatives of doxorubicin.
The invention also provides a pharmaceutical pack or kit comprising one
or more containers filled with one or more of the ingredients of the
pharmaceutical
compositions of the invention. Optionally associated with such containers) can
be a notice in the form prescribed by a governmental agency regulating the
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-173-
manufacture, use or sale of pharmaceuticals or biological products, which
notice
reflects approval by the agency of manufacture, use or sale for human
administration.
Diagnosis and Imaging
Labeled antibodies, and derivatives and analogs thereof, which specifically
bind to a polypeptide of interest can be used for diagnostic purposes to
detect,
diagnose, or monitor diseases and/or disorders associated with the aberrant
expression and/or activity of a polypeptide of the invention. The invention
provides for the detection of aberrant expression of a polypeptide of
interest,
comprising (a) assaying the expression of the polypeptide of interest in cells
or
body fluid of an individual using one or more antibodies specific to the
polypeptide
interest and (b) comparing the level of gene expression with a standard gene
expression level, whereby an increase or decrease in the assayed polypeptide
gene
expression level compared to the standard expression level is indicative of
aberrant
expression.
The invention provides a diagnostic assay for diagnosing a disorder,
comprising (a) assaying the expression of the polypeptide of interest in cells
or
body fluid of an individual using one or more antibodies specific to the
polypeptide
interest and (b) comparing the level of gene expression with a standard gene
expression level, whereby an increase or decrease in the assayed polypeptide
gene
expression level compared to the standard expression level is indicative of a
particular disorder. With respect to cancer, the presence of a relatively high
amount of transcript in biopsied tissue from an individual may indicate a
predisposition for the development of the disease, or may provide a means for
detecting the disease prior to the appearance of actual clinical symptoms. A
more
definitive diagnosis of this type may allow health professionals to employ
preventative measures or aggressive treatment earlier thereby preventing the
development or further progression of the cancer.
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- I 74 -
Antibodies of the invention can be used to assay protein levels in a
biological sample using classical immunohistological methods known to those of
skill in the art (e.g., see Jalkanen, M. et al., J. Cell. Biol. 101:976-985
(1985);
Jalkanen, M. et al., J. Cell. Biol. 105:3087-3096 (1987)). Other antibody-
based
methods useful for detecting protein gene expression include immunoassays,
such
as the enzyme linked immunosorbent assay (ELISA) and the radioimmunoassay
(RIA). Suitable antibody assay labels are known in the art and include enzyme
labels, such as, glucose oxidase; radioisotopes, such as iodine (''SI,'2'I),
carbon
('4C), sulfur ('SS), tritium (3H), indium ("'In), and technetium (99Tc);
luminescent
labels, such as luminol; and fluorescent labels, such as fluorescein and
rhodamine,
and biotin.
One aspect of the invention is the detection and diagnosis of a disease or
disorder associated with aberrant expression of a polypeptide of the interest
in an
animal, preferably a mammal and most preferably a human. In one embodiment,
diagnosis comprises: a) administering (for example, parenterally,
subcutaneously,
or intraperitoneally) to a subject an effective amount of a labeled molecule
which
specifically binds to the polypeptide of interest; b) waiting for a time
interval
following the administering for permitting the labeled molecule to
preferentially
concentrate at sites in the subject where the polypeptide is expressed (and
for
unbound labeled molecule to be cleared to background level); c) determining
background level; and d) detecting the labeled molecule in the subject, such
that
detection of labeled molecule above the background level indicates that the
subject
has a particular disease or disorder associated with aberrant expression of
the
polypeptide of interest. Background level can be determined by various methods
including, comparing the amount of labeled molecule detected to a standard
value
previously determined for a particular system.
It will be understood in the art that the size of the subject and the imaging
system used will determine the quantity of imaging moiety needed to produce
diagnostic images. In the case of a radioisotope moiety, for a human subject,
the
quantity of radioactivity injected will normally range from about 5 to 20
millicuries
of 99mTc. The labeled antibody or antibody fragment will then preferentially
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 175 -
accumulate at the location of cells which contain the specific protein. In
vivo
tumor imaging is described in S. W. Burchiel et al., "Immunopharmacokinetics
of
Radiolabeled Antibodies and Their Fragments." (Chapter 13 in Tumor Imaging:
The Radiochemical Detection of Cancer, S.W. Burchiel and B. A. Rhodes, eds.,
Masson Publishing Inc. ( 1982)).
Depending on several variables, including the type of label used and the
mode of administration, the time interval following the administration for
permitting the labeled molecule to preferentially concentrate at sites in the
subj ect
and for unbound labeled molecule to be cleared to background. level is 6 to 48
hours or 6 to 24 hours or 6 to 12 hours. In another embodiment the time
interval
following administration is 5 to 20 days or 5 to 10 days.
In an embodiment, monitoring of the disease or disorder is carried out by
repeating the method for diagnosing the disease or disease, for example, one
month after initial diagnosis, six months after initial diagnosis, one year
after initial
diagnosis, etc.
Presence of the labeled molecule can be detected in the patient using
methods known in the art for in vivo scanning. These methods depend upon the
type of label used. Skilled artisans will be able to determine the appropriate
method for detecting a particular label. Methods and devices that may be used
in
the diagnostic methods of the invention include, but are not limited to,
computed
tomography (CT), whole body scan such as position emission tomography (PET),
magnetic resonance imaging (MRI), and sonography.
In a specific embodiment, the molecule is labeled with a radioisotope and
is detected in the patient using a radiation responsive surgical instrument
(Thurston et al., U.S. Patent No. 5,441,050). In another embodiment, the
molecule is labeled with a fluorescent compound and is detected in the patient
using a fluorescence responsive scanning instrument. In another embodiment,
the
molecule is labeled with a positron emitting metal and is detected in the
patent
using positron emission-tomography. In yet another embodiment, the molecule
is labeled with a paramagnetic label and is detected in a patient using
magnetic
resonance imaging (MRI).
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 176 -
Kits
The present invention provides kits that can be used in the above methods.
In one embodiment, a kit comprises an antibody of the invention, preferably a
purified antibody, in one or more containers. In a specific embodiment, the
kits
of the present invention contain a substantially isolated polypeptide
comprising an
epitope which is specifically immunoreactive with an antibody included in the
kit.
Preferably, the kits of the present invention further comprise a control
antibody
which does not react with the polypeptide of interest. In another specific
embodiment, the kits of the present invention contain a means for detecting
the
binding of an antibody to a polypeptide of interest (e.g., the antibody may be
conjugated to a detectable substrate such as a fluorescent compound, an
enzymatic
substrate, a radioactive compound or a luminescent compound, or a second
antibody which recognizes the first antibody may be conjugated to a detectable
substrate).
In another specific embodiment of the present invention, the kit is a
diagnostic kit for use in screening serum containing antibodies specific
against
proliferative and/or cancerous polynucleotides and polypeptides. Such a kit
may
include a control antibody that does not react with the polypeptide of
interest.
Such a kit may include a substantially isolated polypeptide antigen comprising
an
epitope which is specifically immunoreactive with at least one anti-
polypeptide
antigen antibody. Further, such a kit includes means for detecting the binding
of
said antibody to the antigen (e.g. , the antibody may be conjugated to a
fluorescent
compound such as fluorescein or rhodamine which can be detected by flow
cytometry). In specific embodiments, the kit may include a recombinantly
produced or chemically synthesized polypeptide antigen. The polypeptide
antigen
of the kit may also be attached to a solid support.
In a more specific embodiment the detecting means of the above-described
kit includes a solid support to which said polypeptide antigen is attached.
Such
a kit may also include a non-attached reporter-labeled anti-human antibody. In
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 177 -
this embodiment, binding of the antibody to the polypeptide antigen can be
detected by binding of the said reporter-labeled antibody.
In an additional embodiment, the invention includes a diagnostic kit for use
in screening serum containing antigens of the polypeptide of the invention.
The
diagnostic kit includes a substantially isolated antibody specifically
immunoreactive with polypeptide or polynucleotide antigens, and means for
detecting the binding of the polynucleotide or polypeptide antigen to the
antibody.
In one embodiment, the antibody is attached to a solid support. In a specific
embodiment, the antibody may be a monoclonal antibody. The detecting means
of the kit may include a second, labeled monoclonal antibody. Alternatively,
or
in addition, the detecting means may include a labeled, competing antigen.
In one diagnostic configuration, test serum is reacted with a solid phase
reagent having a surface-bound antigen obtained by the methods of the present
invention. After binding with specific antigen antibody to the reagent and
removing unbound serum components by washing, the reagent is reacted with
reporter-labeled anti-human antibody to bind reporter to the reagent in
proportion
to the amount of bound anti-antigen antibody on the solid support. The reagent
is again washed to remove unbound labeled antibody, and the amount of reporter
associated with the reagent is determined. Typically, the reporter is an
enzyme
which is detected by incubating the solid phase in the presence of a suitable
fluorometric, luminescent or colorimetric substrate (Sigma, St. Louis, MO).
The solid surface reagent in the above assay is prepared by known
techniques for attaching protein material to solid support material, such as
polymeric beads, dip sticks, 96-well plate or filter material. These
attachment
methods generally include non-specific adsorption of the protein to the
support or
covalent attachment of the protein, typically through a free amine group, to a
chemically reactive group on the solid support, such as an activated carboxyl,
hydroxyl, or aldehyde group. Alternatively, streptavidin coated plates can be
used
in conjunction with biotinylated antigen(s).
Thus, the invention provides an assay system or kit for carrying out this
diagnostic method. The kit generally includes a support with surface-bound
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-178-
recombinant antigens, and a reporter-labeled anti-human antibody for detecting
surface-bound anti-antigen antibody.
Chromosome Assays
The nucleic acid molecules of the present invention are also valuable for
chromosome identification. The sequence is specifically targeted to and can
hybridize with a particular location on an individual human chromosome.
Moreover, there is a current need for identifying particular sites on the
chromosome. Few chromosome marking reagents based on actual sequence data
(repeat polymorphisms) are presently available for marking chromosomal
location.
The mapping of DNAs to chromosomes according to the present invention is an
important first step in correlating those sequences with genes associated with
disease.
In certain preferred embodiments in this regard, the cDNAs herein
disclosed are used to clone genomic DNA of a TRID protein gene. This can be
accomplished using a variety of well known techniques and libraries, which
generally are available commercially. The genomic DNA then is used for in situ
chromosome mapping using well known techniques for this purpose.
In addition, in some cases, sequences can be mapped to chromosomes by
preparing PCR primers (preferably 15-25 bp) from the cDNA. Computer analysis
of the 3' untranslated region of the gene is used to rapidly select primers
that do
not span more than one exon in the genomic DNA, thus complicating the
amplification process. These primers are then used for PCR screening of
somatic
cell hybrids containing individual human chromosomes. Fluorescence in situ
hybridization ("FISH") of a cDNA clone to a metaphase chromosomal spread can
be used to provide a precise chromosomal location in one step. This technique
can be used with probes from the cDNA as short as 50 or 60 bp. For a review of
this technique, see Verma et al., Human Chromosomes: A Manual Of Basic
Technigues, Pergamon Press, New York (1988).
Once a sequence has been mapped to a precise chromosomal location, the
physical position of the sequence on the chromosome can be correlated with
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 179 -
genetic map data. Such data are found, for example, in V. McKusick, Mendelian
Inheritance In Man, available on-line through Johns Hopkins University, Welch
Medical Library. The relationship between genes and diseases that have been
mapped to the same chromosomal region are then identified through linkage
analysis (coinheritance of physically adjacent genes).
Next, it is necessary to determine the differences in the cDNA or genomic
sequence between affected and unaffected individuals. If a mutation is
observed
in some or all of the affected individuals but not in any normal individuals,
then the
mutation is likely to be the causative agent of the disease.
Having generally described the invention, the same will be more readily
understood by reference to the following examples, which are provided by way
of
illustration and are not intended as limiting.
Examples
Example 1: Expression and Purification of the "His-tagged" Extracellular
form of TRID in E. coli
The bacterial expression vector pQE9 (pDlO) is used for bacterial
expression in this example. (QIAGEN, Inc., 9259 Eton Avenue, Chatsworth, CA,
91311). pQE9 encodes ampicillin antibiotic resistance ("Ampr") and contains a
bacterial origin of replication ("ori"), an IPTG inducible promoter, a
ribosome
binding site ("RBS"), six codons encoding histidine residues that allow
affinity
purification using nickel-nitrilo-tri-acetic acid ("Ni-NTA") affinity resin
sold by
QIAGEN, Inc., supra, and suitable single restriction enzyme cleavage sites.
These
elements are arranged such that an inserted DNA fragment encoding a
polypeptide
expresses that polypeptide with the six His residues (i.e., a "6 X His tag")
covalently linked to the amino terminus of that polypeptide.
The DNA sequence encoding the desired portion of the TRID protein
comprising, or alternatively consisting of, the extracellular form of the TRID
amino acid sequence is amplified from the deposited cDNA clone using PCR
oligonucleotide primers which anneal to sequence encoding the amino terminal
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 180 -
sequences of the desired portion of the TRID protein and to carboxy terminal
sequences of the desired portion of the extracellular form of the TRID protein
in
the deposited cDNA. Additional nucleotides containing restriction sites to
facilitate cloning in the pQE9 vector are added to the 5' and 3' primer
sequences,
respectively.
For cloning the extracellular form of the TRID protein, the 5' primer has
the sequence 5' CGCGGATCCACCACTGCCCGGCAGGAG 3'(SEQ ID NO:
19) containing the underlined BamHI restriction site followed by 18
nucleotides
of the amino terminal coding sequence of the extracellular TRID sequence in
SEQ
ID N0:2. One of ordinary skill in the art would appreciate, of course, that
the
point in the protein coding sequence where the 5' primer begins and where the
3'
primer ends may be varied to amplify a DNA segment encoding any desired
portion of the complete TRID protein shorter or longer than the extracellular
form
of the protein. The 3' primer has the sequence
5' GCGTCTAGACTAGTAATGAGAAGAGGCAGG 3' (SEQ ID N0:20)
containing the underlined XbaI restriction site followed by 18 nucleotides
complementary to the 3' end of cDNA encoding the extracellular domain of the
TRID protein in SEQ ID N0:2.
The amplified TRID DNA fragment and the vector pQE9 are digested with
BamHI and XbaI and the digested DNAs are then ligated together. Insertion of
the TRID DNA into the restricted pQE9 vector places the TRID protein coding
region downstream from the IPTG-inducible promoter and in-frame with an
initiating AUG and the six histidine codons.
The ligation mixture is transformed into competent E. coli cells using
standard procedures such as those described in Sambrook et al., Molecular
Cloning: a LaboYatory Manual, 2nd Ed.; Cold Spring Harbor Laboratory Press,
Cold Spring Harbor, NY (1989). E. coli strain M15/rep4, containing multiple
copies of the plasmid pREP4, which expresses the lac repressor and confers
kanamycin resistance ("Kanr"), is used in carrying out the illustrative
example
described herein. This strain, which is only one of many that are suitable for
expressing TRID protein, is available commercially from QIAGEN, Inc., supra.
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 181 -
Transformants are identified by their ability to grow on LB plates in the
presence
of ampicillin and kanamycin. Plasmid DNA is isolated from resistant colonies
and
the identity of the cloned DNA confirmed by restriction analysis, PCR and DNA
sequencing.
Clones containing the desired constructs are grown overnight ("O/N") in
liquid culture in LB media supplemented with both ampicillin ( 100 ~g/ml) and
kanamycin (25 ~g/ml). The O/N culture is used to inoculate a large culture, at
a
dilution of approximately 1:25 to 1:250. The cells are grown to an optical
density
at 600 nm ("OD600") of between 0.4 and 0.6. Isopropyl-(3-D-
thiogalactopyranoside ("IPTG") is then added to a final concentration of 1 mM
to
induce transcription from the lac repressor sensitive promoter, by
inactivating the
lacI repressor. Cells subsequently are incubated further for 3 to 4 hours.
Cells
then are harvested by centrifugation.
The cells are then stirred for 3-4 hours at 4° C in 6M guanidine-
HC1, pH
8. The cell debris is removed by centrifugation, and the supernatant
containing the
TRID is loaded onto a nickel-nitrilo-tri-acetic acid ("Ni-NTA") affinity resin
column (available from QIAGEN, Inc., supra). Proteins with a 6 x His tag bind
to the Ni-NTA resin with high affinity and can be purified in a simple one-
step
procedure (for details see: The QIAexpressionist, 1995, QIAGEN, Inc., supra).
Briefly the supernatant is loaded onto the column in 6 M guanidine-HCI, pH 8,
the
column is first washed with 10 volumes of 6 M guanidine-HCI, pH 8, then washed
with 10 volumes of 6 M guanidine-HC1 pH 6, and finally the TRID is eluted with
6 M guanidine-HCI, pH 5.
The purified protein is then renatured by dialyzing it against phosphate-
buffered saline (PBS) or 50 mM Na-acetate, pH 6 buffer plus 200 mM NaCI.
Alternatively, the protein can be successfully refolded while immobilized on
the
Ni-NTA column. The recommended conditions are as follows: renature using a
linear 6M-1 M urea gradient in 500 mM NaCI, 20% glycerol, 20 mM Tris/HCl pH
7.4, containing protease inhibitors. The renaturation should be performed over
a
period of 1.5 hours or more. After renaturation the proteins can be eluted by
the
addition of 250 mM immidazole. Immidazole is removed by a final dialyzing step
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 182 -
against PBS or 50 mM sodium acetate pH 6 buffer plus 200 mM NaCI. The
purified protein is stored at 4° C or frozen at -80° C.
Example 2: Cloning and Expression of TRID in a Baculovirus Expression
System
In this illustrative example, the plasmid shuttle vector pA2 is used to insert
the cloned DNA encoding complete protein, including its naturally associated
secretory signal (leader) sequence, into a baculovirus to express the mature
TRID
protein, using standard methods as described in Summers et al., A Manual of
Methods for Baculovirus Vectors and Insect Cell Culture Procedures, Texas
Agricultural Experimental Station Bulletin No. 1555 (1987). This expression
vector contains the strong polyhedrin promoter of the Autographa californica
nuclear polyhedrosis virus (AcMNPV) followed by convenient restriction sites
such as BamHI, Xba I and Asp718. The polyadenylation site of the simian virus
40 ("SV40") is used for efficient polyadenylation. For easy selection of
recombinant virus, the plasmid contains the beta-galactosidase gene from E.
coli
under control of a weak Drosophila promoter in the same orientation, followed
by the polyadenylation signal of the polyhedrin gene. The inserted genes are
flanked on both sides by viral sequences for cell-mediated homologous
recombination with wild-type viral DNA to generate a viable virus that express
the
cloned polynucleotide.
Many other baculovirus vectors could be used in place of the vector above,
such as pAc373, pVL941 and pAcIMI, as one skilled in the art would readily
appreciate, as long as the construct provides appropriately located signals
for
transcription, translation, secretion and the like, including a signal peptide
and an
in-frame AUG as required. Such vectors are described, for instance, in Luckow
et al., Virology 170:31-39 (1989).
The cDNA sequence encoding the full length TRID protein in a deposited
clone, including the AUG initiation codon and the naturally associated leader
sequence shown in SEQ ID N0:2 is amplified using PCR oligonucleotide primers
corresponding to the 5' and 3' sequences of the gene. The 5' primer for TRID
has
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-183-
the sequence 5' CGCTCTAGACCGCCATCATGGCCCGGATCCCCAAG 3'
(SEQ ID N0:21 ) containing the underlined XbaI restriction enzyme site. The
described primers encode an efficient signal for initiation of translation in
eukaryotic cells, as described by Kozak, M., J. Mol. Biol. 196:947-950 (1987).
The 3' primer for TRID has the sequence
5' GCGTCTAGACTAGTAATGAGAAGAGGCAGG 3' (SEQ ID N0:22)
containing the underlined XbaI restriction site.
The amplified fragment is isolated from a 1 % agarose gel using a
commercially available kit ("Geneclean," BIO 101 Inc., La Jolla, Ca.). The
fragment then is digested with the appropriate restriction enzyme for each of
the
primers used, as specified above, and again is purified on a 1 % agarose gel.
The plasmid is digested with the same restriction enzymes and optionally,
can be dephosphorylated using calf intestinal phosphatase, using routine
procedures known in the art. The DNA is then isolated from a 1 % agarose gel
using a commercially available kit ("Geneclean" BIO 1 O 1 Inc., La Jolla,
Ca.).
The fragment and dephosphorylated plasmid are ligated together with T4 DNA
ligase. E. coli HB 1 O1 or other suitable E. coli hosts such as XL-1 Blue
(Statagene Cloning Systems, La Jolla, CA) cells are transformed with the
ligation
mixture and spread on culture plates. Bacteria are identified that contain the
plasmid with the human TNF receptor gene by digesting DNA from individual
colonies using the enzymes used immediately above and then analyzing the
digestion product by gel electrophoresis. The sequence of the cloned fragment
is
confirmed by DNA sequencing. This plasmid is designated herein pA2-TRID.
Five ~g of the plasmid pA2-TRID is co-transfected with 1.0 ~cg of a
commercially
available linearized baculovirus DNA ("BaculoGoldT"' baculovirus DNA",
Pharmingen, San Diego, CA), using the lipofection method described by Felgner
et al., Proc. Natl. Acad. Sci. USA 84: 7413-7417 (1987). One ~g of
BaculoGoldT"' virus DNA and 5 ,ug of the plasmid pA2-TNFR are mixed in a
sterile well of a microtiter plate containing 50 ,u1 of serum-free Grace's
medium
(Life Technologies Inc., Gaithersburg, MD). Afterwards, 10 ,u1 Lipofectin plus
90 ~1 Grace's medium are added, mixed and incubated for 15 minutes at room
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 184 -
temperature. Then the transfection mixture is added drop-wise to Sfi7 insect
cells
(ATCC CRL 1711 ) seeded in a 35 mm tissue culture plate with 1 ml Grace's
medium without serum. The plate is then incubated for 5 hours at 27° C.
The
transfection solution is then removed from the plate and 1 ml of Grace's
insect
medium supplemented with 10% fetal calf serum is added. Cultivation is then
continued at 27° C for four days.
After four days, the supernatant is collected and a plaque assay is
performed, as described by Summers and Smith, supra. An agarose gel with
"Blue Gal" (Life Technologies Inc., Gaithersburg) is used . to allow easy
identification and isolation of gal-expressing clones, which produce blue-
stained
plaques. (A detailed description of a "plaque assay" of this type can also be
found
in the user's guide for insect cell culture and baculovirology distributed by
Life
Technologies Inc., Gaithersburg, page 9-10). After appropriate incubation,
blue
stained plaques are picked with the tip of a micropipettor (e.g., Eppendorf).
The
agar containing the recombinant viruses is then resuspended in a
microcentrifuge
tube containing 200 ~1 of Grace's medium and the suspension containing the
recombinant baculovirus is used to infect Sfi7 cells seeded in 35 mm dishes.
Four
days later, the supernatants of these culture dishes are harvested and then
they are
stored at 4° C. The recombinant virus is called V-TRID.
To verify the expression of the V-TRID, Sfi7 cells are grown in Grace's
medium supplemented with 10% heat-inactivated FBS. The cells are infected with
the recombinant baculovirus V-TRID at a multiplicity of infection ("MOI") of
about 2. If radiolabeled proteins are desired, 6 hours later the medium is
removed
and is replaced with SF900 II medium minus methionine and cysteine (available
from Life Technologies Inc., Rockville, MD). After 42 hours, 5 ~Ci of 35S-
methionine and 5 ~Ci 35S-cysteine (available from Amersham) are added. The
cells are further incubated for 16 hours and then are harvested by
centrifugation.
The proteins in the supernatant as well as the intracellular proteins are
analyzed
by SDS-PAGE followed by autoradiography (if radiolabeled).
Microsequencing of the amino acid sequence of the amino terminus of
purified protein may be used to determine the amino terminal sequence of the
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-185-
mature protein and thus the cleavage point and length of the secretory signal
peptide.
Example 3: Cloning and Expression of TRID in Mammalian Cells
A typical mammalian expression vector contains the promoter element,
which mediates the initiation of transcription of mRNA, the protein coding
sequence, and signals required for the termination of transcription and
polyadenylation of the transcript. Additional elements include enhancers,
Kozak
sequences and intervening sequences flanked by donor and acceptor sites for
RNA
splicing. Highly efficient transcription can be achieved with the early and
late
promoters from SV40, the long terminal repeats (LTRs) from Retroviruses, e.g.,
RSV, HTLVI, HIVI and the early promoter of the cytomegalovirus (CMV).
However, cellular elements can also be used (e.g., the human actin promoter).
Suitable expression vectors for use in practicing the present invention
include, for
example, vectors such as pSVL and pMSG (Pharmacia, Uppsala, Sweden),
pRSVcat (ATCC 37152), pSV2dhfr (ATCC 37146) and pBCI2MI (ATCC
67109). Mammalian host cells that could be used include: human Hela 293, H9
and Jurkat cells, mouse NIH3T3 and C127 cells, Cos l, Cos 7 and CVI, quail
QC 1-3 cells, mouse L cells and Chinese hamster ovary (CHO) cells.
Alternatively, the gene can be expressed in stable cell lines that contain the
gene integrated into a chromosome. The co-transfection with a selectable
marker
such as dhfr, gpt, neomycin, hygromycin allows the identification and
isolation of
the transfected cells.
The transfected gene can also be amplified to express large amounts of the
encoded protein. The dihydrofolate reductase (DHFR) marker is useful to
develop cell lines that carry several hundred or even several thousand copies
ofthe
gene of interest. Another useful selection marker is the enzyme glutamine
synthase (GS) (Murphy et al., Biochem J. 227:277-279 ( 1991 ); Bebbington et
al.,
BiolTechnology 10:169-175 (1992)). Using these markers, the mammalian cells
are grown in selective medium and the cells with the highest resistance are
selected. These cell lines contain the amplified genes) integrated into a
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 186 -
chromosome. Chinese hamster ovary (CHO) and NSO cells are often used for the
production of proteins.
The expression vectors pC 1 and pC4 contain the strong promoter (LTR)
of the Rous Sarcoma Virus (Cullen et al., Molecular and Cellular Biology, 438
447 (March, 1985)) plus a fragment of the CMV-enhancer (Bosharl et al., Cell
41:521-530 (1985)). Multiple cloning sites, e.g., with the restriction enzyme
cleavage sites BamHI, XbaI and Asp718, facilitate the cloning of the gene of
interest. The vectors contain in addition the 3' intron, the polyadenylation
and
termination signal of the rat preproinsulin gene.
Example 3(a): Cloning and Expression in COS Cells
The expression plasmid, pTRID-HA, is made by cloning a cDNA encoding
TRID into the expression vector pcDNAI/Amp or pcDNAIII (which can be
obtained from Invitrogen, Ine.).
The expression vector pcDNAI/Amp contains: (1) an E. coli origin of
replication effective for propagation in E. coli and other prokaryotic cells;
(2) an
ampicillin resistance gene for selection ofplasmid-containing prokaryotic
cells; (3)
an SV40 origin of replication for propagation in eukaryotic cells; (4) a CMV
promoter, a polylinker, an SV40 intron; (5) several codons encoding a
hemagglutinin fragment (i.e., an "HA" tag to facilitate purification) followed
by
a termination codon and polyadenylation signal arranged so that a cDNA can be
conveniently placed under expression control of the CMV promoter and operably
linked to the SV40 intron and the polyadenylation signal by means of
restriction
sites in the polylinker. The HA tag corresponds to an epitope derived from the
influenza hemagglutinin protein described by Wilson et al., Cell 37: 767
(1984).
The fusion of the HA tag to the target protein allows easy detection and
recovery
of the recombinant protein with an antibody that recognizes the HA epitope.
pcDNAIII contains, in addition, the selectable neomycin marker.
A DNA fragment encoding the TRID is cloned into the polylinker region
of the vector so that recombinant protein expression is directed by the CMV
promoter. The plasmid construction strategy is as follows. The TRID cDNA of
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 187 -
the deposited clone is amplified using primers that contain convenient
restriction
sites, much as described above for construction of vectors for expression of a
TNF
receptor in E. coli. Suitable primers include the following, which are used in
this
example. The 5' primer for TNFR-5, containing the underlined EcoRI site, has
the following sequence:
5' CGCGAATTCCGCCATCATGGCCCGGATCCCCAAG 3' (SEQ IDN0:23).
The 3' primer, containing the underlined XbaI site, has the following
sequence:
5' GCGTCTAGAGTAATGAGAAGAGGCAGG 3' (SEQ ID N0:24).
The PCR amplified DNA fragment and the vector, pcDNAI/Amp, are
digested with XbaI and EcoRI and then ligated. The ligation mixture is
transformed into E. coli strain SURE (available from Stratagene Cloning
Systems,
11099 North Torrey Pines Road, La Jolla, CA 92037), and the transformed
culture is plated on ampicillin media plates which then are incubated to allow
growth of ampicillin resistant colonies. Plasmid DNA is isolated from
resistant
colonies and examined by restriction analysis or other means for the presence
of
the fragment encoding the TRID polypeptide.
For expression of recombinant TRID, COS cells are transfected with an
expression vector, as described above, using DEAE-DEXTRAN, as described, for
instance, in Sambrook et al., Molecular Cloning: a Laboratory Manual, Cold
Spring Laboratory Press, Cold Spring Harbor, New York (1989). Cells are
incubated under conditions for expression of TRID by the vector.
Expression of the pTRID-HA fusion protein is detected by radiolabeling
and immunoprecipitation, using methods described in, for example Harlow et
al.,
Antibodies: A Laboratory Manual, 2nd Ed.; Cold Spring Harbor Laboratory
Press, Cold Spring Harbor, New York (1988). To this end, two days after
transfection, the cells are labeled by incubation in media containing 35S-
cysteine
for 8 hours. The cells and the media are collected, and the cells are washed
and
the lysed with detergent-containing RIPA buffer: 150 mM NaCI, 1 % NP-40, 0.1
SDS, 1% NP-40, 0.5% DOC, 50 mM TRIS, pH 7.5, as described by Wilson et al.
cited above. Proteins are precipitated from the cell lysate and from the
culture
media using an HA-specific monoclonal antibody. The precipitated proteins then
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 188 -
are analyzed by SDS-PAGE and autoradiography. An expression product of the
expected size is seen in the cell lysate, which is not seen in negative
controls.
Example 3(b): Cloning and Expression in CHO Cells
The vector pC4 is used for the expression of TRID polypeptides. Plasmid
pC4 is a derivative of the plasmid pSV2-dhfr (ATCC Accession No. 37146). The
plasmid contains the mouse DHFR gene under control of the SV40 early
promoter. Chinese hamster ovary- or other cells lacking dihydrofolate activity
that
are transfected with these plasmids can be selected by growing the cells in a
selective medium (alpha minus MEM, Life Technologies) supplemented with the
chemotherapeutic agent methotrexate. The amplification of the DHFR genes in
cells resistant to methotrexate (MTX) has been well documented (see, e.g.,
Alt,
F. W., Kellems, R. M., Bertino, J. R., and Schimke, R. T., 1978, J. Biol.
Chem.
253:1357-1370, Hamlin, J. L. and Ma, C. 1990, Biochem. et Biophys. Acta,
1097:107-143, Page, M. J. and Sydenham, M. A. 1991, Biotechnology 9:64-68).
Cells grown in increasing concentrations of MTX develop resistance to the drug
by overproducing the target enzyme, DHFR, as a result of amplification of the
DHFR gene. If a second gene is linked to the DHFR gene, it is usually co-
amplified and over-expressed. It is known in the art that this approach may be
used to develop cell lines carrying more than 1,000 copies of the amplified
gene(s). Subsequently, when the methotrexate is withdrawn, cell lines are
obtained which contain the amplified gene integrated into one or more
chromosomes) of the host cell.
Plasmid pC4 contains for expressing the gene of interest the strong
promoter of the long terminal repeat (LTR) of the Rous Sarcoma Virus (Cullen
et al., Molecular and Cellular Biology 5:438-447 (1985) plus a fragment
isolated
from the enhancer of the immediate early gene of human cytomegalovirus (CMV)
(Boshart et al., Cell 41:521-530 (1985)). Downstream of the promoter are the
following single restriction enzyme cleavage sites that allow the integration
ofthe
genes: BamHI, Xba I, and Asp718. Behind these cloning sites the plasmid
contains the 3' intron and polyadenylation site of the rat preproinsulin gene.
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 189 -
Other high efficiency promoters can also be used for the expression, e.g., the
human 13-actin promoter, the SV40 early or late promoters or the long terminal
repeats from other retroviruses, e.g., HIV and HTLVI. Clontech's Tet-Off and
Tet-On gene expression systems and similar systems can be used to express the
TRID receptor polypeptide in a regulated way in mammalian cells (Gossen, M.,
& Bujard, H. 1992, Proc. Natl. Acad. Sci. USA 89:5547-5551). For the
polyadenylation ofthe mRNA other signals, e.g., from the human growth hormone
or globin genes can be used as well. Stable cell lines carrying a gene of
interest
integrated into the chromosomes can also be selected upon co-transfection with
a selectable marker such as gpt, 6418 or hygromycin. It is advantageous to use
more than one selectable marker in the beginning, e.g., G418 plus
methotrexate.
The plasmid pC4 is digested with the restriction enzymes appropriate for
the specific primers used to amplify TRID as outlined below and then
dephosphorylated using calf intestinal phosphates by procedures known in the
art.
The vector is then isolated from a 1 % agarose gel.
The DNA sequence encoding the TRID polypeptide is amplified using
PCR oligonucleotide primers corresponding to the 5' and 3' sequences of the
desired portion of the gene. The 5' primer for TRID containing the underlined
XbaI site. has the following sequence:
5' CGCTCTAGACCGCCATCATGGCCCGGATCCCCAAG 3' (SEQ ID
N0:25).
The 3' primer for TRID, containing the underlined XbaI site, has the
following sequence: 5' GCGTCTAGACTAGTAATGAGAAGAGGCAGG 3'
(SEQ ID N0:26).
The amplified fragment is digested with the endonucleases which will cut
at the engineered restriction sites) and then purified again on a 1 % agarose
gel.
The isolated fragment and the dephosphorylated vector are then ligated with T4
DNA ligase. E. coli HB 1 O 1 or XL-1 Blue cells are then transformed and
bacteria
are identified that contain the fragment inserted into plasmid pC4 using, for
instance, restriction enzyme analysis.
CA 02374674 2001-11-20
WO 00/71150 PCT/iJS00/13515
- 190 -
Chinese hamster ovary cells lacking an active DHFR gene are used for
transfection. Five ~g of the expression plasmid pC4 is cotransfected with 0.5
qg
of the plasmid pSVneo using lipofectin (Felgner et al., supra). The plasmid
pSV2-
neo contains a dominant selectable marker, the neo gene from Tn5 encoding an
enzyme that confers resistance to a group of antibiotics including 6418. The
cells
are seeded in alpha minus MEM supplemented with 1 mg/ml 6418. After 2 days,
the cells are trypsinized and seeded in hybridoma cloning plates (Greiner,
Germany) in alpha minus MEM supplemented with 10, 25, or 50 ng/ml of
metothrexate plus 1 mg/ml 6418. After about 10-14 days, single clones are
trypsinized and then seeded in 6-well petri dishes or 10 ml flasks using
different
concentrations of methotrexate (50 nM, 100 nM, 200 nM, 400 nM, 800 nM).
Clones growing at the highest concentrations of methotrexate are then
transferred
to new 6-well plates containing even higher concentrations of methotrexate (1
~M, 2 qM, 5 ~M, 10 mM, 20 mM). The same procedure is repeated until clones
are obtained which grow at a concentration of 100 - 200 qM. Expression of the
desired gene product is analyzed, for instance, by SDS-PAGE and Western blot
or by reversed phase HPLC analysis.
Example 4: Protein Fusions of TRID
TRID polypeptides of the invention are optionally fused to other proteins.
These fusion proteins can be used for a variety of applications. For example,
fusion of TRID polypeptides to His-tag, HA-tag, protein A, IgG domains, and
maltose binding protein facilitates purification. (See EP A 394,827;
Traunecker,
et al., Nature 331:84-86 (1988).) Similarly, fusion to IgG-1, IgG-3, and
albumin
increases the halflife time irr vivo. Nuclear localization signals fused to
TRID
polypeptides can target the protein to a specific subcellular localization,
while
covalent heterodimer or homodimers can increase or decrease the activity of a
fusion protein. Fusion proteins can also create chimeric molecules having more
than one function. Finally, fusion proteins can increase solubility and/or
stability
of the fused protein compared to the non-fused protein. All of the types of
fusion
proteins described above can be made using techniques known in the art or by
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-191-
using or routinely modifying the following protocol, which outlines the fusion
of
a polypeptide to an IgG molecule (SEQ ID N0:27).
Briefly, the human Fc portion of the IgG molecule can be PCR amplified,
using primers that span the 5' and 3' ends of SEQ ID N0:27. These primers also
preferably contain convenient restriction enzyme sites that will facilitate
cloning
into an expression vector, preferably a mammalian expression vector.
For example, if the pC4 (Accession No. 209646) expression vector is used,
the human Fc portion can be ligated into the BamHI cloning site. Note that the
3' BamHI site should be destroyed. Next, the vector containing the human Fc
portion is re-restricted with BamHI, linearizing the vector, and TRID
polynucleotide, isolated by the PCR protocol described in Example 1, is
ligated
into this BamHI site. Note that the polynucleotide is cloned without a stop
codon,
otherwise a fusion protein will not be produced.
If the naturally occurring signal sequence is used to produce the secreted
protein, pC4 does not need a second signal peptide. Alternatively, if the
naturally
occurring signal sequence is not used, the vector can be modified to include a
heterologous signal sequence. (See, e.g., WO 96/34891.)
Example 5: The Extracellular Domain of TRID Binds the Cytotoxic
Ligand-TRAIL, Blocks TRAIL-Induced Apoptosis
As discussed above, TRAIL/Apo2L is a cytotoxic ligand that belongs to
the tumor necrosis factor (TNF) ligand family and induces rapid cell death of
many
transformed cell lines, but not normal tissues, despite its death domain
containing
receptor, DR4, being expressed on both cell types. This example identifies an
antagonist decoy receptor, designated "TRAIL Receptor Without Intracellular
Domain" or "TRID", that also binds TRAIL and may in part explain the resistant
phenotype of normal tissues. That is, TRID, an antagonistic receptor, binds
and
sequesters TRAIL, but is incapable of transducing an intracellular signal.
Given the similarity of the extracellular ligand binding cysteine-rich
domains of TRID and DR4, the present inventors theorized that TRID would also
bind TRAIL. To confirm this, the soluble extracellular ligand binding domain
of
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 192 -
TRID was expressed as a fusion to the Fc portion of human immunoglobulin
(IgG).
As shown in Fig. 5A, TRID-Fc specifically bound TRAIL, but not the
related cytotoxic ligand TNFa. In this experiment, the Fc-extracellular
domains
of TRID, DRS, DR4, or TNFR 1 and the corresponding ligands were prepared and
binding assays performed as described in Pan et al. , Science 276:111 ( 1997).
The
respective Fc-fusions were precipitated with protein G-Sepharose and co-
precipitated soluble ligands were detected by immunoblotting with anti-Flag
(Babco) or anti-myc-HRP (BMB). The bottom panel of Fig. 5A shows the input
Fc-fusions present in the binding assays.
Additionally, TRID-Fc blocked the ability of TRAIL to induce apoptosis
(Fig. 5B). MCF7 cells were treated with soluble TRAIL (200 ng/ml) in the
presence of equal amounts of Fc-fusions or Fc alone. Six hours later, cells
were
fixed and examined as desribed in Pan et al., Id The data (mean ~ SD) shown in
Fig. 5B are the percentage of apoptotic nuclei among total nuclei counted
(n=4).
Further, TRID-Fc had no effect on TNFa-induced apoptosis under
conditions where TNFR1-Fc completely abolished TNFa killing (Fig SC). MCF7
cells were treated with TNFa (40 ng/ml; Genentech, Inc.) in the presence of
equal
amounts of Fc-fusions or Fc alone. Nuclei were stained and examined 11-15
hours later.
Example 6: TRID Protects Cells from TRAIL-luduced Apoptosis
As shown in Fig. 6, cells expressing TRID were protected from TRAIL-
induced apoptosis as were cells expressing the virally encoded caspase
inhibitor
CrmA.
Given the absence of an intracellular signalling domain, it was likely that
native TRID could itself similarly attenuate TRAIL-induced cell death. This
was
confirmed by asking if overexpression of native TRID in TRAIL-sensitive cells
(MCF7) would protect them from TRAIL-induced apoptosis. Overexpression of
TRID by itself did not induce apoptosis. However, when the cells were exposed
to TRAIL, cells expressing TRID were as protected from TRAIL-induced
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-193-
apoptosis as were cells expressing the virally encoded caspase inhibitor CrmA
(Fig. 6).
MCF7 cells were transfected with TRID, or CrmA expression construct
or vector alone together with a b-Gal reporter construct. Twenty four hours
after
transfection, TRAIL was added at 50 ng/ml and 100 ng/ml. Six hours later,
cells
were stained with X-gal as previously described (A.M. Chinnaiyan, et al., Cell
81,
505-12 (1995); M.P. Boldin, et al., J Biol Chem 270, 7795-8 (1995); F.C.
Kischkel, et al., EMBO 14, 5579-5588 (1995)), and examined microscopically.
Taken together, these findings are consistent with a guardian role for
TRID that allows normal tissues to withstand the potentially deleterious
effects of
constitutively expressed TRAIL.
The new identification of the antagonist decoy receptor TRID as a
receptor for TRAIL adds further complexity to the biology of TRAIL-initiated
signal transduction.
Example 7: Production of an Antibody
A. Hybridorna Technology
The antibodies of the present invention can be prepared by a variety of
methods. (See, Ausubel etal., eds, 1994, Current Protocols in Molecular
Biology,
Vol. 1, John Wiley & Sons, Inc., New York, Chapter 2.) As one example of such
methods, cells expressing TRID are administered to an animal to induce the
production of sera containing polyclonal antibodies. In a preferred method, a
preparation of TRID protein is prepared and purified to render it
substantially free
of natural contaminants. Such a preparation is then introduced into an animal
in
order to produce polyclonal antisera of greater specific activity.
Monoclonal antibodies specific for TRID are prepared using hybridoma
technology. (Kohler et al., Nature 256:495 (1975); Kohler et al., Eur. J.
Immunol. 6:511 (1976); Kohler et al., Eur. J. Immunol. 6:292 (1976);
Hammerling et al. , in: Monoclonal Antibodies and T-Cell Hybridomas, Elsevier,
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 194 -
N.Y., pp. 563-681 ( 1981 )). In general, an animal (preferably a mouse) is
immunized with a TRID polypeptide or, more preferably, with a secreted TRID
polypeptide-expressing cell. Such polypeptide-expressing cells are cultured in
any
suitable tissue culture medium, preferably in Earle's modified Eagle's medium
supplemented with 10% fetal bovine serum (inactivated at about 56°C),
and
supplemented with about 10 g/1 of nonessential amino acids, about 1,000 U/ml
of
penicillin, and about 100 ~g/ml of streptomycin.
The splenocytes of such mice are extracted and fused with a suitable
myeloma cell line. Any suitable myeloma cell line may be employed in
accordance
with the present invention; however, it is preferable to employ the parent
myeloma
cell line (SP20), available from the ATCC. After fusion, the resulting
hybridoma
cells are selectively maintained in HAT medium, and then cloned by limiting
dilution as described by Wands et al. (Gastroenterology 80:225-232 ( 1981 ).
The
hybridoma cells obtained through such a selection are then assayed to identify
clones which secrete antibodies capable of binding the TRID polypeptide.
Alternatively, additional antibodies capable of binding to a TRID
polypeptide can be produced in a two-step procedure using anti-idiotypic
antibodies. Such a method makes use of the fact that antibodies are themselves
antigens, and therefore, it is possible to obtain an antibody which binds to a
second
antibody. In accordance with this method, protein specific antibodies are used
to
immunize an animal, preferably a mouse. The splenocytes of such an animal are
then used to produce hybridoma cells, and the hybridoma cells are screened to
identify clones which produce an antibody whose ability to bind to the TRID
protein-specific antibody can be blocked by TRID. Such antibodies comprise
anti-
idiotypic antibodies to the TRID protein-specific antibody and are used to
immunize an animal to induce formation of further TRID protein-specific
antibodies.
For in vivo use of antibodies in humans, an antibody is "humanized". Such
antibodies can be produced using genetic constructs derived from hybridoma
cells
producing the monoclonal antibodies described above. Methods for producing
chimeric and humanized antibodies are known in the art and are discussed
infra.
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-195-
(See, for review, Morrison, Science 229:1202 (1985); Oi et al., BioTechniques
4:214 (1986); Cabilly et al., U.S. Patent No. 4,816,567; Taniguchi et al., EP
171496; Morrison et al., EP 173494; Neuberger et al., WO 8601533; Robinson
et al., WO 8702671; Boulianne et al., Nature 312:643 (1984); Neuberger et al.,
Nature 31-1:268 (1985)).
B. Isolation OfAntibody FragmentsDirectedAgainstPolypeptides
of the Present Invention From A Library Of scFvs
Naturally occurring V-genes isolated from human PBLs are constructed
into a large library of antibody fragments which contain reactivities against
polypeptides of the present invention to which the donor may or may not have
been exposed (see e.g., U.S. Patent 5,885,793 incorporated herein in its
entirety
by reference).
Rescue of the library
A library of scFvs is constructed from the RNA of human PBLs as
described in W092/01047. To rescue phage displaying antibody fragments,
approximately 109 E. coli harbouring the phagemid are used to inoculate 50 ml
of
2xTY containing 1 % glucose and 100 ug/ml of ampicillin (2xTY-AMP-GLU) and
grown to an O.D. of 0.8 with shaking. Five ml of this culture is used to
innoculate
50 ml of 2xTY-AMP-GLU, 2x108 TU of gene 3 helper phage (M13 gene III,
see W092/01047) are added and the culture incubated at 37° C for 45
minutes
without shaking and then at 37° C for 45 minutes with shaking. The-
culture is
centrifuged at 4000 r.p.m. for 10 minutes and the pellet resuspended in 2
liters of
2xTY containing 100 ug/ml ampicillin and 50 ug/ml kanamycin and grown
overnight. Phage are prepared as described in W092/01047.
M 13 gene III is prepared as follows: M 13 gene III helper phage does not
encode gene III protein, hence the phage(mid) displaying antibody fragments
have
a greater avidity of binding to antigen. Infectious M 13 gene III particles
are made
by growing the helper phage in cells harbouring a pUC 19 derivative supplying
the
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 196 -
wild type gene III protein during phage morphogenesis. The culture is
incubated
for 1 hour at 37° C without shaking and then for a further hour at
37° C with
shaking. Cells are pelleted (IEC-Centra 8, 4000 revs/min for 10 min),
resuspended
in 300 ml 2xTY broth containing 100 ug ampicillin/ml and 25 ug kanamycin/ml
(2xTY-AMP-KAN) and grown overnight, shaking at 37° C. Phage particles
are
purified and concentrated from the culture medium by two PEG-precipitations
(Sambrook et al., Molecular Cloning: a Laboratory Manual, 2nd Ed.; Cold
Spring Harbor Laboratory Press, Cold Spring Harbor, NY ( 1989).), resuspended
in 2 ml PBS and passed through a 0.45 um filter (Minisart NML; Sartorius) to
give a final concentration of approximately 10' 3 transducing units/ml
(ampicillin-
resistant clones).
Panning of the library
Immunotubes (Nunc) are coated overnight in PB S with 4 ml of either 100
mg/ml or 10 mg/ml of a TRID polypeptide. Tubes are blocked with 2% Marvel-
PBS for 2 hours at 37° C and then washed 3 times in PBS.
Approximately 10'3
TU of phage are applied to the tube and incubated for 30 minutes at room
temperature tumbling on an over and under turntable and then left to stand for
another 1.5 hours. Tubes are washed 10 times with PBS 0.1% Tween-20 and 10
times with PBS. Phage are eluted by adding 1 ml of 100 mM triethylamine and
rotating 15 minutes on an under and over turntable after which the solution is
immediately neutralized with 0.5 ml of 1.0M Tris-HCI, pH 7.4. Phage are then
used to infect 10 ml of mid-log E. coli TG1 by incubating eluted phage with
bacteria for 30 minutes at 37° C. The E. coli are then plated on TYE
plates
containing 1 % glucose and 100 ug/ml ampicillin. The resulting bacterial
library is
then rescued with gene III helper phage as described above to prepare phage
for
a subsequent round of selection. This process is then repeated for a total of
4
rounds of affinity purification with tube-washing increased to 20 times with
PBS,
0.1% Tween-20 and 20 times with PBS for rounds 3 and 4
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 197 -
Characterization of binders
Eluted phage from the 3rd and 4th rounds of selection are used to infect
E. coli HB 2151 and soluble scFv is produced (Marks, et al., 1991 ) from
single
colonies for assay. ELISAs are performed with microtitre plates coated with
either
pg/ml ofthe polypeptide ofthe present invention in 50 mM bicarbonate pH 9.6.
Clones positive in ELISA are further characterized by PCR fingerprinting (see
e.g., W092/01047) and then by sequencing.
10 Example 8: Tissue distribution of TRID mRNA expression
Northern blot analysis was carried out to examineTRID gene expression
in human tissues, using methods described by, among others, Sambrook et al.,
Molecular Cloning: a Laboratory Manual, 2nd Ed.; Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, NY ( 1989).. A cDNA probe containing
the entire nucleotide sequence of the TRID protein (SEQ ID NO:1 ) was labeled
with 32P using the rediprimeT"' DNA labeling system (Amersham Life Science),
according to manufacturer's instructions. After labeling, the probe was
purified
using a CHROMA SPIN-100T"~ column (Clontech Laboratories. Inc.), according
to manufacturer's protocol number PT1200-1. The purified labeled probe was
then used to examine various human tissues for TRID mRNA.
Multiple Tissue Northern (MTN) blots containing various human tissues
(H) or human immune system tissues (IM) were obtained from Clontech (Palo
Alto, CA) and examined with labeled probe using ExpressHybT"~ hybridization
solution (Clontech) according to manufacturer's protocol number PT1190-1.
Following hybridization and washing, the blots were mounted and exposed to
film
at -70 ° C overnight. The films were developed according to standard
procedures.
Expression of TRID was detected in many normal human tissues, such as heart,
brain, placenta, lung, liver, kidney, pancreas, spleen, thymus, peripheral
blood
leukocytes (PBLs), lymph node, bone marrow, and fetal liver, but not in most
transformed cancer cell lines.
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-198-
Expression of TRID was also assessed by Northern blot in the following
cancer cell lines, HL60 (promyelocytic leukemia), Hela cell S3, K562 (chronic
myelogeneous leukemia), MOLT4 (lymphoblast leukemia), Raji (Burkitt's
lymphoma), SW480 (colorectal adenocarcinoma), A549 (lung carcinoma), and
6361 (melanoma), and was detected in only SW480 and Hela cell S3.
Example 9: Method of Determining Alterations in the TRID Gene
RNA is isolated from entire families or individual patients presenting with
a phenotype of interest (such as a disease). cDNA is then generated from these
RNA samples using protocols known in the art. (See Sambrook et al., Molecular
Cloning: a Laboratory Manual, 2nd Ed.; Cold Spring Harbor Laboratory Press,
Cold Spring Harbor, NY (1989).) The cDNA is then used as a template for PCR,
employing primers surrounding regions of interest in SEQ ID NO: l . Suggested
PCR conditions consist of 35 cycles at 95° C for 30 seconds; 60-120
seconds at
52-58° C; and 60-120 seconds at 70° C, using buffer solutions
described in
Sidransky, D., et al., Science 252:706 (1991).
PCR products are then sequenced using primers labeled at their 5' end with
T4 polynucleotide kinase, employing SequiTherm Polymerise. (Epicentre
Technologies). The intron-exon borders of selected exons of TRID are also
determined and genomic PCR products analyzed to confirm the results. PCR
products harboring suspected mutations in TRID is then cloned and sequenced to
validate the results of the direct sequencing.
PCR products of TRID are cloned into T-tailed vectors as described in
Holton, T.A. and Graham, M.W., Nucleic Acids Research, 19:1156 (1991) and
sequenced with T7 polymerise (United States Biochemical). Affected individuals
are identified by mutations in TRID not present in unaffected individuals.
Genomic rearrangements are also observed as a method of determining
alterations in the TRID gene. Genomic clones isolated using techniques known
in the art are nick-translated with digoxigenindeoxy-uridine 5'-triphosphate
(Boehringer Manheim), and FISH performed as described in Johnson, C. et al.,
Methods Cell Biol. 3:73-99 (1991). Hybridization with the labeled probe is
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 199 -
carried out using a vast excess of human cot-1 DNA for specific hybridization
to
the TRID genomic locus.
Chromosomes are counterstained with 4,6-diamino-2-phenylidole and
propidium iodide, producing a combination of C- and R-bands. Aligned images
for precise mapping are obtained using a triple-band filter set (Chroma
Technology, Brattleboro, VT) in combination with a cooled charge-coupled
device camera (Photometrics, Tucson, AZ) and variable excitation wavelength
filters. (Johnson, Cv. et al., Genet. Anal. Tech. Appl., 8:75 (1991).) Image
collection, analysis and chromosomal fractional length measurements are
performed using the ISee Graphical Program System. (Inovision Corporation,
Durham, NC.) Chromosome alterations of the genomic region of TRID
(hybridized by the probe) are identified as insertions, deletions, and
translocations.
These TRID alterations are used as a diagnostic marker for an associated
disease.
Example 1 D: Method of Detecting Abnormal Levels of TRID in a
Biological Sample
TRID polypeptides can be detected in a biological sample, and if an
increased or decreased level of TRID is detected, this polypeptide is a marker
for
a particular phenotype. Methods of detection are numerous, and thus, it is
understood that one skilled in the art can modify the following assay to fit
their
particular needs.
For example, antibody-sandwich ELISAs are used to detect TRID in a
sample, preferably a biological sample. Wells of a microtiter plate are coated
with
specific antibodies to TRID, at a final concentration of 0.2 to 10 uglml. The
antibodies are either monoclonal or polyclonal and are produced using
technique
known in the art. The wells are blocked so that non-specific binding of TRID
to
the well is reduced.
The coated wells are then incubated for > 2 hours at RT with a sample
containing TRID. Preferably, serial dilutions of the sample should be used to
validate results. The plates are then washed three times with deionized or
distilled
water to remove unbounded TRID.
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 200 -
Next, 50 u1 of specific antibody-alkaline phosphatase conjugate, at a
concentration of 25-400 ng, is added and incubated for 2 hours at room
temperature. The plates are again washed three times with deionized or
distilled
water to remove unbounded conjugate.
75 u1 of 4-methylumbelliferyl phosphate (MUP) or p-nitrophenyl
phosphate (NPP) substrate solution is then added to each well and incubated 1
hour at room temperature to allow cleavage of the substrate and flourescence.
The flourescence is measured by a microtiter plate reader. A standard curve is
preparded using the experimental results from serial dilutions of a control
sample
with the sample concentration plotted on the X-axis (log scale) and
fluorescence
or absorbance on the Y-axis (linear scale). The TRID polypeptide concentration
in a sample is then interpolated using the standard curve based on the
measured
flourescence of that sample.
Example Il: Method of Effecting Decreased Levels of TRID
The present invention relates to a method for treating an individual in need
of a decreased level of TRID biological activity in the body comprising,
administering to such an individual a composition comprising a therapeutically
effective amount of TRID antagonist. Preferred antagonists for use in the
present
invention are TRID-specific antibodies.
Additionally, antisense technology is used to inhibit production of TRID.
This technology is one example of a method of decreasing levels of TRID
polypeptide, preferably a soluble and/or secreted form, due to a variety of
etiologies, such as cancer.
For example, a patient diagnosed with abnormally increased levels of
TRID is administered intravenously antisense polynucleotides at 0.5, 1.0, 1.5,
2.0
and 3.0 mg/kg day for 21 days. This treatment is repeated after a 7-day rest
period if the is determined to be well tolerated.
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 201 -
Example 12: Method of Effecting Increased Levels of TRID
The present invention also relates to a method for treating an individual in
need of an increased level of TRID biological activity in the body comprising
administering to such an individual a composition comprising a therapeutically
effective amount of TRID or an agonist thereof.
Moreover, it will be appreciated that conditions caused by a decrease in
the standard or normal expression level of TRID in an individual can be
treated by
administering TRID, preferably in a soluble and/or secreted form. Thus, the
invention also provides a method of treatment of an individual in need of an
increased level of TRID polypeptide comprising administering to such an
individual a pharmaceutical composition comprising an amount of TRID to
increase the biological activity level of TRID in such an individual.
For example, a patient with decreased levels of TRID polypeptide receives
a daily dose 0.1-100 ug/kg ofthe polypeptide for six consecutive days.
Preferably,
the polypeptide is in a soluble and/or secreted form.
Example 13: Method of Treatment Using Gene Therapy - Ex Vivo
One method of gene therapy transplants fibroblasts, which are capable of
expressing soluble and/or mature TRID polypeptides, onto a patient. Generally,
fibroblasts are obtained from a subject by skin biopsy. The resulting tissue
is
placed in tissue-culture medium and separated into small pieces. Small chunks
of
the tissue are placed on a wet surface of a tissue culture flask,
approximately ten
pieces are placed in each flask. The flask is turned upside down, closed tight
and
left at room temperature over night. After 24 hours at room temperature, the
flask is inverted and the chunks of tissue remain fixed to the bottom of the
flask
and fresh media (e.g., Ham's F12 media, with 10% FBS, penicillin and
streptomycin) is added. The flasks are then incubated at 37 ° C for
approximately
one week.
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 202 -
At this time, fresh media is added and subsequently changed every several
days. After an additional two weeks in culture, a monolayer of fibroblasts
emerge.
The monolayer is trypsinized and scaled into larger flasks.
pMV-7 (Kirschmeier, P.T. et al., DNA, 7:219-25 (1988)), flanked by the
long terminal repeats of the Moloney murine sarcoma virus, is digested with
EcoRI and HindIII and subsequently treated with calf intestinal phosphatase.
The
linear vector is fractionated on agarose gel and purified, using glass beads.
The cDNA encoding TRID can be amplified using PCR primers which
correspond to the 5' and 3' end encoding sequences respectively.. Preferably,
the
5' primer contains an EcoRI site and the 3' primer includes a HindIII site.
Equal
quantities of the Moloney murine sarcoma virus linear backbone and the
amplified
EcoRI and HindIII fragment are added together, in the presence of T4 DNA
ligase. The resulting mixture is maintained under conditions appropriate for
ligation of the two fragments. The ligation mixture is then used to transform
E.
coli HB101, which are then plated onto agar containing kanamycin for the
purpose of confirming that the vector contains properly inserted TRID.
The amphotropic pA317 or GP+aml2 packaging cells are grown in tissue
culture to confluent density in Dulbecco's Modified Eagles Medium (DMEM) with
10% calf serum (CS), penicillin and streptomycin. The MSV vector containing
the TRID gene is then added to the media and the packaging cells transduced
with
the vector. The packaging cells now produce infectious viral particles
containing
the TRID gene (the packaging cells are now referred to as producer cells).
Fresh media is added to the transduced producer cells, and subsequently,
the media is harvested from a 10 cm plate of confluent producer cells. The
spent
media, containing the infectious viral particles, is filtered through a
millipore filter
to remove detached producer cells and this media is then used to infect
fibroblast
cells. Media is removed from a sub-confluent plate of fibroblasts and quickly
replaced with the media from the producer cells. This media is removed and
replaced with fresh media. If the titer of virus is high, then virtually all
fibroblasts
will be infected and no selection is required. If the titer is very low, then
it is
necessary to use a retroviral vector that has a selectable marker, such as neo
or
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 203 -
his. Once the fibroblasts have been efficiently infected, the fibroblasts are
analyzed
to determine whether TRID protein is produced.
The engineered fibroblasts are then transplanted onto the host, either alone
or after having been grown to confluence on cytodex 3 microcarrier beads.
Example 14: Method of Treatment Using Gene Therapy - in vivo
Another aspect of the present invention is using in vivo gene therapy
methods to treat disorders, diseases and conditions. The gene therapy method
relates to the introduction of naked nucleic acid (DNA, RNA, and antisense DNA
or RNA) TRID sequences into an animal to increase or decrease the expression
of the TRID polypeptide. The TRID polynucleotide may be operatively linked to
a promoter or any other genetic elements necessary for the expression of the
TRID polypeptide by the target tissue. Such gene therapy and delivery
techniques
and methods are known in the art, see, for example, W090/11092, W098/11779;
U.S. Patent NO. 5693622, 5705151, 5580859; TabataH. etal., Cardiovasc. Res.
35:470-479 ( 1997); Chao J. et al., Pharmacol. Res. 35:517-522 ( 1997); Wolff
J.A. Neuromuscul. Disord. 7:314-318 (1997); Schwartz B. et al., Gene Ther.
3:405-411 (1996); Tsurumi Y. et al., Circulation 94:3281-3290 (1996)
(incorporated herein by reference).
The TRID polynucleotide constructs may be delivered by any method that
delivers injectable materials to the cells of an animal, such as, injection
into the
interstitial space of tissues (heart, muscle, skin, lung, liver, intestine and
the like).
The TRID polynucleotide constructs can be delivered in a pharmaceutically
acceptable liquid or aqueous carrier.
The term "naked" polynucleotide, DNA or RNA, refers to sequences that
are free from any delivery vehicle that acts to assist, promote, or facilitate
entry
into the cell, including viral sequences, viral particles, liposome
formulations,
lipofectin or precipitating agents and the like. However, the TRID
polynucleotides may also be delivered in liposome formulations (such as those
taught in Felgner P.L., et al. Ann. NY Acad. Sci. 772:126-139 (1995), and
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 204 -
Abdallah B., et al. Biol. Cell 85( 1 ):1-7 ( 1995)) which can be prepared by
methods
well known to those skilled in the art.
The TRID polynucleotide vector constructs used in the gene therapy
method are preferably constructs that will not integrate into the host genome
nor
will they contain sequences that allow for replication. Any strong promoter
known to those skilled in the art can be used for driving the expression of
DNA.
Unlike other gene therapies techniques, one maj or advantage of introducing
naked
nucleic acid sequences into target cells is the transitory nature of the
polynucleotide synthesis in the cells. Studies have shown that. non-
replicating
DNA sequences can be introduced into cells to provide production of the
desired
polypeptide for periods of up to six months.
The TRID polynucleotide construct can be delivered to the interstitial
space of tissues within the an animal, including of muscle, skin, brain. lung,
liver,
spleen, bone marrow, thymus, heart, lymph, blood, bone, cartilage, pancreas,
kidney, gall bladder, stomach, intestine, testis, ovary, uterus, rectum,
nervous
system, eye, gland, and connective tissue. Interstitial space of the tissues
comprises the intercellular fluid, mucopolysaccharide matrix among the
reticular
fibers of organ tissues, elastic fibers in the walls of vessels or chambers,
collagen
fibers of fibrous tissues, or that same matrix within connective tissue
ensheathing
muscle cells or in the lacunae of bone. It is similarly the space occupied by
the
plasma of the circulation and the lymph fluid of the lymphatic channels.
Delivery
to the interstitial space of muscle tissue is preferred for the reasons
discussed
below. They may be conveniently delivered by injection into the tissues
comprising these cells. They are preferably delivered to and expressed in
persistent, non-dividing cells which are differentiated, although delivery and
expression may be achieved in non-differentiated or less completely
differentiated
cells, such as, for example, stem cells of blood or skin fibroblasts. In vivo
muscle
cells are particularly competent in their ability to take up and express
polynucleotides.
For the naked TRID polynucleotide injection, an effective dosage amount
of DNA or RNA will be in the range of from about 0.05 g/kg body weight to
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 205 -
about 50 mg/kg body weight. Preferably the dosage will be from about 0.005
mg/kg to about 20 mg/kg and more preferably from about 0.05 mg/kg to about
mg/kg. Of course, as the artisan of ordinary skill will appreciate, this
dosage
will vary according to the tissue site of injection. The appropriate and
effective
5 dosage of nucleic acid sequence can readily be determined by those of
ordinary
skill in the art and may depend on the condition being treated and the route
of
administration. The preferred route of administration is by the parenteral
route of
injection into the interstitial space of tissues. However, other parenteral
routes
may also be used, such as, inhalation of an aerosol formulation particularly
for
delivery to lungs or bronchial tissues, throat or mucous membranes of the
nose.
In addition, naked TRID polynucleotide constructs can be delivered to arteries
during angioplasty by the catheter used in the procedure.
The dose response effects of injected TRID polynucleotide in muscle in
vivo is determined as follows. Suitable TRID template DNA for production of
mRNA coding for TRID polypeptide is prepared in accordance with a standard
recombinant DNA methodology. The template DNA, which may be either circular
or linear, is either used as naked DNA or complexed with liposomes. The
quadriceps muscles of mice are then injected with various amounts ofthe
template
DNA.
Five to six week old female and male Balb/C mice are anesthetized by
intraperitoneal injection with 0.3 ml of 2.5% Avertin. A 1.5 cm incision is
made
on the anterior thigh, and the quadriceps muscle is directly visualized. The
TRID
template DNA is injected in 0.1 ml of carrier in a 1 cc syringe through a 27
gauge
needle over one minute, approximately 0.5 cm from the distal insertion site of
the
muscle into the knee and about 0.2 cm deep. A suture is placed over the
injection
site for future localization, and the skin is closed with stainless steel
clips.
After an appropriate incubation time (e.g., 7 days) muscle extracts are
prepared by excising the entire quadriceps. Every fifth 15 um cross-section of
the
individual quadriceps muscles is histochemically stained for TRID protein
expression. A time course for TRID protein expression may be done in a similar
fashion except that quadriceps from different mice are harvested at different
times.
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 206 -
Persistence of TRID DNA in muscle following injection may be determined by
Southern blot analysis after preparing total cellular DNA and HIRT
supernatants
from injected and control mice. The results of the above experimentation in
mice
can be use to extrapolate proper dosages and other treatment parameters in
humans and other animals using TRID naked DNA.
Example 1 S: Assays to detect stimulation or inhibition of B cell
proliferation
and differentiation
Generation of functional humoral immune responses requires both soluble
and cognate signaling between B-lineage cells and their microenvironment.
Signals may impart a positive stimulus that allows a B-lineage cell to
continue its
programmed development, or a negative stimulus that instructs the cell to
arrest
its current developmental pathway. To date, numerous stimulatory and
inhibitory
signals have been found to influence B cell responsiveness including IL-2, IL-
4,
ILS, IL6, IL-7, IL10, IL-13, IL14 and IL15. Interestingly, these signals are
by
themselves weak effectors but can, in combination with various co-stimulatory
proteins, induce activation, proliferation, differentiation, homing, tolerance
and
death among B cell populations. One of the best studied classes of B-cell co-
stimulatory proteins is the TNF-superfamily. Within this family CD40, CD27,
and
CD30 along with their respective ligands CD154, CD70, and CD153 have been
found to regulate a variety of immune responses. Assays which allow for the
detection and/or observation of the proliferation and differentiation of these
B-cell
populations and their precursors are valuable tools in determining the effects
various proteins may have on these B-cell populations in terms of
proliferation and
differentiation. Listed below are two assays designed to allow for the
detection of
the differentiation, proliferation, or inhibition of B-cell populations and
their
precursors.
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 207 -
Experimental Procedure:
In vitro assay- Purified TRID protein, or truncated forms thereof, is
assessed for its ability to induce activation, proliferation, differentiation
or
inhibition and/or death in B-cell populations and their precursors. The
activity of
TRID protein on purified human tonsillar B cells, measured qualitatively over
the
dose range from 0.1 to 10,000 ng/mL, is assessed in a standard B-lymphocyte co-
stimulation assay in which purified tonsillar B cells are cultured in the
presence of
either formalin-fixed Staphylococcus aureus Cowan I (SAC) or immobilized anti-
human IgM antibody as the priming agent. Second signals such as IL-2 and IL-15
synergize with SAC and IgM crosslinking to elicit B cell proliferation as
measured
by tritiated-thymidine incorporation. Novel synergizing agents can be readily
identified using this assay. The assay involves isolating human tonsillar B
cells by
magnetic bead (MACS) depletion of CD3-positive cells. The resulting cell
population is greater than 95% B cells as assessed by expression of
CD45R(B220). Various dilutions of each sample are placed into individual wells
of a 96-well plate to which are added 105 B-cells suspended in culture medium
(RPMI 1640 containing 10% FBS, 5 X 10-5M (3ME, 100U/ml penicillin, l0ug/ml
streptomycin, and 10-5 dilution of SAC) in a total volume of 1 SOuI.
Proliferation
or inhibition is quantitated by a 20h pulse (luCi/well) with 3H-thymidine (6.7
Ci/mM) beginning 72h post factor addition. The positive and negative controls
are
IL2 and medium respectively.
In vivo assay- BALB/c mice are injected (i.p.) twice per day with buffer
only, or 2 mg/Kg of TRID protein, or truncated forms thereof. Mice receive
this
treatment for 4 consecutive days, at which time they are sacrificed and
various
tissues and serum collected for analyses. Comparison of H&E sections from
normal and TRID protein-treated spleens identify the results of the activity
of
TRID protein on spleen cells, such as the diffusion of peri-arterial lymphatic
sheaths, and/or significant increases in the nucleated cellularity of the red
pulp
regions, which may indicate the activation of the differentiation and
proliferation
of B-cell populations. Immunohistochemical studies using a B cell marker, anti-
CD45R(B220), are used to determine whether any physiological changes to
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/1~515
- 208 -
splenic cells, such as splenic disorganization, are due to increased B-cell
representation within loosely defined B-cell zones that infiltrate established
T-cell
regions.
Flow cytometric analyses of the spleens from TRID protein-treated mice
is used to indicate whether TRID protein specifically increases the proportion
of
ThB+, CD45R(B220)dull B cells over that which is observed in control mice.
Likewise, a predicted consequence of increased mature B-cell
representation in vivo is a relative increase in serum Ig titers. Accordingly,
serum
IgM and IgA levels are compared between buffer and TRID protein-treated mice.
The studies described in this example test the activity in TRID protein.
However, one skilled in the art could easily modify the exemplified studies to
test
the activity of TRID polynucleotides (e.g., gene therapy), agonists, and/or
antagonists of TRID.
Example 18: T Cell Proliferation Assay
A CD3-induced proliferation assay is performed on PBMCs and is
measured by the uptake of 3H-thymidine. The assay is performed as follows.
Ninety-six well plates are coated with 100 pl/well of mAb to CD3 (HIT3a,
Pharmingen) or isotype-matched control mAb (B33.1 ) overnight at 4°C (
1 pg/ml
in .05M bicarbonate buffer, pH 9.5), then washed three times with PBS. PBMC
are isolated by Ficoll-Hypaque gradient centrifugation from human peripheral
blood and added to quadruplicate wells (5 x 104/well) of mAb coated plates in
RPMI containing 10% fetal bovine serum, about 1,000 U/ml of penicillin, and
about 100 ~g/ml of streptomycin in the presence of varying concentrations of
TRID protein (total volume 200 p1). Relevant protein buffer and medium alone
are controls. After 48 hr. culture at 37°C, plates are spun for 2 min.
at 1000 rpm
and 100 ~ l of supernatant is removed and stored -20°C for measurement
of IL-2
(or other cytokines) if effect on proliferation is observed. Wells are
supplemented
with 100 ~,l of medium containing 0.5 qCi of 3H-thymidine and cultured at
37°C
for 18-24 hr. Wells are harvested and incorporation of'H-thymidine used as a
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-209-
measure of proliferation. Anti-CD3 alone is the positive control for
proliferation.
IL-2 ( 100 U/ml) is also used as a control which enhances proliferation.
Control
antibody which does not induce proliferation of T cells is used as the
negative
controls for the effects of TRID proteins.
The studies described in this example test the activity in TRID protein.
However. one skilled in the art could easily modify the exemplified studies to
test
the activity of TRID polynucleotides (e.g., gene therapy), agonists, and/or
antagonists of TRID.
Example 17: Effect of TRID on the Expression of MHC Class II,
Costimulatory and Adhesion Molecules and Cell Differentiation of
Monocytes and Monocyte-Derived Human Dendritic Cells
Dendritic cells are generated by the expansion of proliferating precursors
found in the peripheral blood: adherent PBMC or elutriated monocytic fractions
are cultured for 7-10 days with GM-CSF (50 ng/ml) and IL-4 (20 ng/ml). These
dendritic cells have the characteristic phenotype of immature cells
(expression of
CD 1, CD80, CD86, CD40 and MHC class II antigens). Treatment with activating
factors, such as TNF-oc, causes a rapid change in surface phenotype (increased
expression of MHC class I and II, costimulatory and adhesion molecules,
downregulation of FCyRII, upregulation of CD83). These changes correlate with
increased antigen-presenting capacity and with functional maturation of the
dendritic cells.
FACS analysis of surface antigens is performed as follows. Cells are
treated 1-3 days with increasing concentrations of TRID or LPS (positive
control). washed with PBS containing 1% BSA and 0.02 mM sodium azide, and
then incubated with 1:20 dilution of appropriate FITC- or PE-labeled
monoclonal
antibodies for 30 minutes at 4°C. After an additional wash, the labeled
cells are
analyzed by flow cytometry on a FACScan (Becton Dickinson).
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-210-
Effect on the production of cytokines
Cytokines generated by dendritic cells, in particular IL-12, are important
in the initiation of T-cell dependent immune responses. IL-12 strongly
influences
the development of Thl helper T-cell immune response, and induces cytotoxic T
and NK cell function. An ELISA is used to measure the IL-12 release as
follows.
Dendritic cells ( 1 O6/ml) are treated with increasing concentrations of TRID
for 24
hours. LPS (100 ng/ml) is added to the cell culture as positive control.
Supernatants from the cell cultures are then collected and analyzed for IL-12
content using commercial ELISA kit (e.g., R & D Systems (Minneapolis, MN)).
The standard protocols provided with the kits are used.
Effect on the expression of MHC Class 11, costimulatory and adhesion
molecules.
Three major families of cell surface antigens can be identified on
monocytes: adhesion molecules, molecules involved in antigen presentation, and
Fc receptor. Modulation of the expression of MHC class II antigens and other
costimulatory molecules, such as B7 and ICAM-1, may result in changes in the
antigen presenting capacity of monocytes and ability to induce T cell
activation.
Increase expression of Fc receptors may correlate with improved monocyte
cytotoxic activity, cytokine release and phagocytosis.
FACS analysis is used to examine the surface antigens as follows.
Monocytes are treated 1-5 days with increasing concentrations of TRID or LPS
(positive control), washed with PBS containing 1 % BSA and 0.02 mM sodium
azide, and then incubated with 1:20 dilution of appropriate FITC- or PE-
labeled
monoclonal antibodies for 30 minutes at 4°C. After an additional wash,
the
labeled cells are analyzed by flow cytometry on a FACScan (Becton Dickinson).
Monocyte activation and/or increased survival.
Assays for molecules that activate (or alternatively, inactivate) monocytes
and/or increase monocyte survival (or alternatively, decrease monocyte
survival)
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 211 -
are known in the art and may routinely be applied to determine whether a
molecule of the invention functions as an inhibitor or activator of monocytes.
TRID, agonists, or antagonists of TRID can be screened using the three assays
described below. For each of these assays, Peripheral blood mononuclear cells
(PBMC) are purified from single donor leukopacks (American Red Cross,
Baltimore, MD) by centrifugation through a Histopaque gradient (Sigma).
Monocytes are isolated from PBMC by counterflow centrifugal elutriation.
1. Monocyte Survival Assay.
Human peripheral blood monocytes progressively lose viability when
cultured in absence of serum or other stimuli. Their death results from
internally
regulated process (apoptosis). Addition to the culture of activating factors,
such
as TNF-alpha dramatically improves cell survival and prevents DNA
fragmentation. Propidium iodide (PI) staining is used to measure apoptosis as
follows. Monocytes are cultured for 48 hours in polypropylene tubes in serum-
free
medium (positive control), in the presence of 100 ng/ml TNF-alpha (negative
control), and in the presence of varying concentrations of the compound to be
tested. Cells are suspended at a concentration of 2 x 1 O6/ml in PBS
containing PI
at a final concentration of 5 ~g/ml, and then incubated at room temperature
for 5
minutes before FAC Scan analysis. PI uptake has been demonstrated to correlate
with DNA fragmentation in this experimental paradigm.
2. Effect on cytokine release.
-
An important function of monocytes/macrophages is their regulatory
activity on other cellular populations of the immune system through the
release of
cytokines after stimulation. An ELISA to measure cytokine release is performed
as follows. Human monocytes are incubated at a density of SxlOs cells/ml with
increasing concentrations of TRID and under the same conditions, but in the
absence of TRID. For IL-12 production, the cells are primed overnight with IFN-
'y (100 U/ml) in presence of TRID. LPS (10 ng/ml) is then added. Conditioned
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 212 -
media are collected after 24h and kept frozen until use. Measurement of TNF-a,
IL-10, MCP-1 and IL-8 is then performed using a commercially available ELISA
kit (e.g., R & D Systems (Minneapolis, MN)) applying the standard protocols
provided with the kit.
3. Oxidative burst.
Purified monocytes are plated in 96-well plate at 2-1 x 1 OS cell/well.
Increasing concentrations of TRID are added to the wells in a total volume of
0.2
ml culture medium (RPMI 1640 + 10% FCS, glutamine and antibiotics). After 3
days incubation, the plates are centrifuged and the medium is removed from the
wells. To the macrophage monolayers, 0.2 ml per well of phenol red solution (
140
mM NaCI, 10 mM potassium phosphate buffer pH 7.0, 5.5 mM dextrose, 0.56
mM phenol red and 19 U/ml of HRPO) is added, together with the stimulant (200
nM PMA). The plates are incubated at 37°C for 2 hours and the reaction
is
stopped by adding 20 E.tl 1N NaOH per well. The absorbance is read at 610 nm.
To calculate the amount of H,Oz produced by the macrophages, a standard curve
of a H~O~ solution of known molarity is performed for each experiment.
The studies described in this example test the activity in TRID protein.
However, one skilled in the art could easily modify the exemplified studies to
test
the activity of TRID polynucleotides (e.g., gene therapy), agonists, and/or
antagonists of TRID.
Example 18: The Effect of TRID on the Growth of l~ascular Endothelial
Cells -
On day 1, human umbilical vein endothelial cells (HUVEC) are seeded at
2-5x104 cells/35 mm dish density in M199 medium containing 4% fetal bovine
serum (FBS), 16 units/ml heparin, and 50 units/ml endothelial cell growth
supplements (ECGS, Biotechnique, Inc.). On day 2, the medium is replaced with
M199 containing 10% FBS, 8 units/ml heparin. TRID protein of SEQ ID NO. 2,
and positive controls, such as VEGF and basic FGF (bFGF) are added, at varying
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 213 -
concentrations. On days 4 and 6, the medium is replaced. On day 8, cell number
is determined with a Coulter Counter.
An increase in the number of HUVEC cells indicates that TRID may
proliferate vascular endothelial cells.
The studies described in this example test the activity in TRID protein.
However, one skilled in the art could easily modify the exemplified studies to
test
the activity of TRID polynucleotides (e.g., gene therapy), agonists, and/or
antagonists of TRID.
Example 19: Stimulatory Effect of TRID on the Proliferation of Vascular
Endothelial Cells
For evaluation of mitogenic activity of growth factors, the colorimetric
MTS (3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-
sulfophenyl)2H-tetrazolium) assay with the electron coupling reagent PMS
(phenazine methosulfate) was performed (CellTiter 96 AQ, Promega). Cells are
seeded in a 96-well plate (5,000 cells/well) in 0.1 ml serum-supplemented
medium
and are allowed to attach overnight. After serum-starvation for 12 hours in
0.5%
FBS, conditions (bFGF, VEGF,65 or TRID in 0.5% FBS) with or without Heparin
(8 U/ml) are added to wells for 48 hours. 20 mg of MTS/PMS mixture (1:0.05)
are added per well and allowed to incubate for 1 hour at 37°C before
measuring
the absorbance at 490 nm in an ELISA plate reader. Background absorbance from
control wells (some media, no cells) is subtracted, and seven wells are
performed
in parallel for each condition. See, Leak et al. In vitro Cell. Dev. Biol.
30A: 512-
518 (1994).
The studies described in this example test the activity in TRID protein.
However, one skilled in the art could easily modify the exemplified studies to
test
the activity of TRID polynucleotides (e.g., gene therapy), agonists, and/or
antagonists of TRID.
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 214 -
Example 20: Inhibition of PDGF induced Vascular Smooth Muscle Cell
Proliferation Stimulatory Effect
HAoSMC proliferation can be measured, for example, by BrdUrd
incorporation. Briefly, subconfluent, quiescent cells grown on the 4-chamber
slides are transfected with CRP or FITC-labeled AT2-3LP. Then, the cells are
pulsed with 10% calf serum and 6 mg/ml BrdUrd. After 24 h.
immunocytochemistry is performed by using BrdUrd Staining Kit (Zymed
Laboratories). In brief, the cells are incubated with the biotinylated mouse
anti-
BrdUrd antibody at 4 °C for 2 h after exposing to denaturing solution
and then
with the streptavidin-peroxidase and diaminobenzidine. After counterstaining
with hematoxylin, the cells are mounted for microscopic examination, and the
BrdUrd-positive cells are counted. The BrdUrd index is calculated as a percent
of
the BrdUrd-positive cells to the total cell number. In addition, the
simultaneous
detection of the BrdUrd staining (nucleus) and the FITC uptake (cytoplasm) is
performed for individual cells by the concomitant use of bright field
illumination
and dark field-UV fluorescent illumination. See, Hayashida et al., J. Biol.
Chem.
6;271(36):21985-21992 (1996).
The studies described in this example test the activity in TRID protein.
However, one skilled in the art could easily modify the exemplified studies to
test
the activity of TRID polynucleotides (e.g., gene therapy), agonists, and/or
antagonists of TRID.
Example 21: Stimulation of Endothelial Migration
This example will be used to explore the possibility that TRID may
stimulate lymphatic endothelial cell migration.
Endothelial cell migration assays are performed using a 48 well
microchemotaxis chamber (Neuroprobe Inc., Cabin John, MD; Falk, W.,
Goodwin, R. H. J., and Leonard, E. J. "A 48 well micro chemotaxis assembly for
rapid and accurate measurement of leukocyte migration." J. Immunological
Methods 1980;33:239-247). Polyvinylpyrrolidone-free polycarbonate filters with
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 215 -
a pore size of 8 um (Nucleopore Corp. Cambridge, MA) are coated with 0.1
gelatin for at least 6 hours at room temperature and dried under sterile air.
Test
substances are diluted to appropriate concentrations in M 199 supplemented
with
0.25% bovine serum albumin (BSA), and 25 u1 ofthe final dilution is placed in
the
lower chamber of the modified Boyden apparatus. Subconfluent, early passage
(2-6) HUVEC or BMEC cultures are washed and trypsinized for the minimum
time required to achieve cell detachment. After placing the filter between
lower
and upper chamber, 2.5 x 105 cells suspended in 50 u1 M199 containing 1 % FBS
are seeded in the upper compartment. The apparatus is then incubated for 5
hours
at 37°C in a humidified chamber with 5% C02 to allow cell migration.
After the
incubation period, the filter is removed and the upper side of the filter with
the
non-migrated cells is scraped with a rubber policeman. The filters are fixed
with
methanol and stained with a Giemsa solution (Diff Quick, Baxter, McGraw Park,
IL). Migration is quantified by counting cells of three random high-power
fields
(40x) in each well, and all groups are performed in quadruplicate.
The studies described in this example test the activity in TRID protein.
However, one skilled in the art could easily modify the exemplified studies to
test
the activity of TRID polynucleotides (e.g., gene therapy), agonists, and/or
antagonists of TRID.
Example 22: Stimulation of Nitric Oxide Production by Endothelial Cells
Nitric oxide released by the vascular endothelium is believed to be a
mediator of vascular endothelium relaxation. Thus, TRID activity can be
assayed
by determining nitric oxide production by endothelial cells in response to
TRID.
Nitric oxide is measured in 96-well plates of confluent microvascular
endothelial
cells after 24 hours starvation and a subsequent 4 hr exposure to various
levels of
a positive control (such as VEGF-1) and TRID. Nitric oxide in the medium is
determined by use of the Griess reagent to measure total nitrite after
reduction of
nitric oxide-derived nitrate by nitrate reductase. The effect of TRID on
nitric oxide
release is examined on HUVEC.
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-216-
Briefly, NO release from cultured HUVEC monolayer is measured with
a NO-specific polarographic electrode connected to a NO meter (Iso-NO, World
Precision Instruments Inc.). Calibration of the NO element is performed
according to the following equation:
2KN0~+2KI+2H,S0462N0+I,+2H,0+2K,S04
The standard calibration curve is obtained by adding graded concentrations
of KNOZ (0, 5, 10, 25, 50, 100, 250, and 500 nmol/L) into the calibration
solution
containing KI and H,S04. The specificity of the Iso-NO electrode to NO is
previously determined by measurement of NO from authentic NO gas. The culture
medium is removed and HUVECs are washed twice with Dulbecco's phosphate
buffered saline. The cells are then bathed in 5 ml of filtered Krebs-Henseleit
solution in 6-well plates, and the cell plates are kept on a slide warmer (Lab
Line
Instruments Inc.) to maintain the temperature at 37°C. The NO sensor
probe is
inserted vertically into the wells, keeping the tip of the electrode 2 mm
under the
surface of the solution, before addition of the different conditions. S-
nitroso
acetyl penicillamin (SNAP) is used as a positive control. The amount of
released
NO is expressed as picomoles per lxl O6 endothelial cells. All values reported
are
means of four to six measurements in each group (number of cell culture
wells).
See, Leak et al. Biochem. and Biophys. Res. Comm. 217:96-105 (1995).
The studies described in this example test the activity in TRID protein.
However, one skilled in the art could easily modify the exemplified studies to
test
the activity of TRID polynucleotides (e.g., gene therapy), agonists, and/or
antagonists of TRID.
Example 23: Effect of TRID on Cord Formation in Angiogenesis
Another step in angiogenesis is cord formation, marked by differentiation
of endothelial cells. This bioassay measures the ability of microvascular
endothelial cells to form capillary-like structures (hollow structures) when
cultured
in vitro.
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-217-
CADMEC (microvascular endothelial cells) are purchased from Cell
Applications, Inc. as proliferating (passage 2) cells and are cultured in Cell
Applications' CADMEC Growth Medium and used at passage 5. For the in vitro
angiogenesis assay, the wells of a 48-well cell culture plate are coated with
Cell
Applications' Attachment Factor Medium (200 ql/well) for 30 min. at
37°C.
CADMEC are seeded onto the coated wells at 7,500 cells/well and cultured
overnight in Growth Medium. The Growth Medium is then replaced with 300 ~g
Cell Applications' Chord Formation Medium containing control buffer or TRID
(0.1 to 100 ng/ml) and the cells are cultured for an additional 48. hr. The
numbers
and lengths of the capillary-like chords are quantitated through use of the
Boeckeler VIA-170 video image analyzer. All assays are done in triplicate.
Commercial (R&D) VEGF (50 ng/ml) is used as a positive control.
b-esteradiol (1 ng/ml) is used as a negative control. The appropriate buffer
(without protein) is also utilized as a control.
The studies described in this example test the activity in TRID protein.
However, one skilled in the art could easily modify the exemplified studies to
test
the activity of TRID polynucleotides (e.g., gene therapy), agonists, and/or
antagonists of TRID.
Example 24: Angiogenic Effect on Cltick Cltorioallantoic Membrane
Chick chorioallantoic membrane (CAM) is a well-established system to
examine angiogenesis. Blood vessel formation on CAM is easily visible and
quantifiable. The ability of TRID to stimulate angiogenesis in CAM can be
examined.
Fertilized eggs of the White Leghorn chick (callus gallus) and the
Japanese quail (Coturnix coturnix) are incubated at 37.8°C and 80%
humidity.
Differentiated CAM of 16-day-old chick and 13-day-old quail embryos is studied
with the following methods.
On Day 4 of development, a window is made into the egg shell of chick
eggs. The embryos are checked for normal development and the eggs sealed with
cellotape. They are further incubated until Day 13. Thermanox coverslips
(Nunc,
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-218-
Naperville, IL) are cut into disks of about 5 mm in diameter. Sterile and salt-
free
growth factors, and the protein to be tested, are dissolved in distilled water
and
about 3.3 mg/ 5 ml are pipetted on the disks. After air-drying, the inverted
disks
are applied on CAM. After 3 days, the specimens are fixed in 3% glutaraldehyde
and 2% formaldehyde and rinsed in 0.12 M sodium cacodylate buffer. They are
photographed with a stereo microscope [Wild M8] and embedded for semi- and
ultrathin sectioning as described above. Controls are performed with carrier
disks
alone.
The studies described in this example test the activity in TRID protein.
However, one skilled in the art could easily modify the exemplified studies to
test
the activity of TRID polynucleotides (e.g., gene therapy), agonists, and/or
antagonists of TRID.
Example 25: Angiogenesis Assay Using a Matrigel Implant in Mouse
In order to establish an in vivo model for angiogenesis to test TRID
protein activities, mice and rats are implanted subcutaneously with
methylcellulose disks containing either 20 mg of BSA (negative control), 1 mg
of
TRID, or 0.5 mg of VEGF-1 (positive control). The negative control disks
should
contain little vascularization, while the positive control disks should show
signs
of vessel formation.
The studies described in this example test the activity in TRID protein.
However, one skilled in the art could easily modify the exemplified studies to
test
the activity of TRID polynucleotides (e.g., gene therapy), agonists, and/or
antagonists of TRID.
Example 26: Rescue of Ischemia in Rabbit Lower Limb Model
To study the in vivo effects of TRID on ischemia, a rabbit hindlimb
ischemia model is created by surgical removal of one femoral arteries as
described
previously (Takeshita, S. et al., Am J. Pathol 147:1649-1660 (1995)). The
excision of the femoral artery results in retrograde propagation of thrombus
and
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-219-
occlusion of the external iliac artery. Consequently, blood flow to the
ischemic
limb is dependent upon collateral vessels originating from the internal iliac
artery
(Takeshita, S. et al., Am J. Pathol 147:1649-1660 (1995)). An interval of 10
days is allowed for post-operative recovery of rabbits and development of
endogenous collateral vessels. At 10 day post-operatively (day 0), after
performing a baseline angiogram, the internal i 1 iac artery of the ischemic
limb is
transfected with 500 mg naked TRID expression plasmid by arterial gene
transfer
technology using a hydrogel-coated balloon catheter as described (Riessen, R.
et
al., Hum Gene Ther. 4:749-758 ( 1993); Leclerc, G. et al., J. Clin, Invest.
90: 936-
944 ( 1992)). When TRID is used in the treatment, a single bolus of 500 mg
TRID
protein or control is delivered into the internal iliac artery of the ischemic
limb
over a period of 1 min. through an infusion catheter. On day 30, various
parameters are measured in these rabbits: (a) BP ratio - The blood pressure
ratio
of systolic pressure of the ischemic limb to that of normal limb; (b) Blood
Flow
and Flow Reserve - Resting FL: the blood flow during undilated condition and
Max FL: the blood flow during fully dilated condition (also an indirect
measure
of the blood vessel amount) and Flow Reserve is reflected by the ratio of max
FL:
resting FL; (c) Angiographic Score - This is measured by the angiogram of
collateral vessels. A score is determined by the percentage of circles in an
overlaying grid that with crossing opacified arteries divided by the total
number
m the rabbit thigh; (d) Capillary density - The number of collateral
capillaries
determined in light microscopic sections taken from hindlimbs.
The studies described in this example test the activity in TRID protein.
However, one skilled in the art could easily modify the exemplified studies to
test
the activity of TRID polynucleotides (e.g., gene therapy), agonists, and/or
antagonists of TRID.
CA 02374674 2001-11-20
WO 00/71150 PCT/I1S00/13515
- 220 -
Example 27: Rat Ischemic Skin Flap Model
The evaluation parameters include skin blood flow, skin temperature, and
factor VIII immunohistochemistry or endothelial alkaline phosphatase reaction.
S TRID expression, during the skin ischemia, is studied using in situ
hybridization.
The study in this model is divided into three parts as follows:
a) Ischemic skin
b) Ischemic skin wounds
c) Normal wounds
The experimental protocol includes:
a) Raising a 3x4 cm, single pedicle full-thickness random skin flap
(myocutaneous flap over the lower back of the animal).
b) An excisional wounding (4-6 mm in diameter) in the ischemic skin
(skin-flap).
c) Topical treatment with TRID of the excisional wounds (day 0, 1,
2, 3, 4 post-wounding) at the following various dosage ranges: lmg to 100 mg.
d) Harvesting the wound tissues at day 3, 5, 7, 10, 14 and 21
post-wounding for histological, immunohistochemical, and in situ studies.
The studies described in this example test the activity in TRID protein.
However, one skilled in the art could easily modify the exemplified studies to
test
the activity of TRID polynucleotides (e.g., gene therapy), agonists, and/or
antagonists of TRID.
Example 28: Peripheral Arterial Disease Model
-
Angiogenic therapy using TRID is a novel therapeutic strategy to obtain
restoration of blood flow around the ischemia in case of peripheral arterial
diseases. The experimental protocol includes:
a) One side of the femoral artery is ligated to create ischemic muscle
of the hindlimb, the other side of hindlimb serves as a control.
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 221 -
b) TRID protein, in a dosage range of 20 mg - 500 mg, is delivered
intravenously and/or intramuscularly 3 times (perhaps more) per week for 2-3
weeks.
c) The ischemic muscle tissue is collected after ligation ofthe femoral
artery at 1, 2, and 3 weeks for the analysis of TRID expression and histology.
Biopsy is also performed on the other side of normal muscle of the
contralateral
hindlimb.
The studies described in this example test the activity in TRID protein.
However, one skilled in the art could easily modify the exemplified studies to
test
the activity of TRID polynucleotides (e.g., gene therapy), agonists, and/or
antagonists of TRID.
Example 29: Isclzemic Myocardial Disease Model
TRID is evaluated as a potent mitogen capable of stimulating the
development of collateral vessels, and restructuring new vessels after
coronary
artery occlusion. Alteration of TRID expression is investigated in situ. The
experimental protocol includes:
a) The heart is exposed through a left-side thoracotomy in the rat.
Immediately, the left coronary artery is occluded with a thin suture (6-0) and
the
thorax is closed.
b) TRID protein, in a dosage range of 20 mg - 500 mg, is delivered
intravenously and/or intramuscularly 3 times (perhaps more) per week for 2-4
weeks.
c) Thirty days after the surgery, the heart is removed and
cross-sectioned for morphometric and in situ analyzes.
The studies described in this example test the activity in TRID protein.
However, one skilled in the art could easily modify the exemplified studies to
test
the activity of TRID polynucleotides (e.g., gene therapy), agonists, and/or
antagonists of TRID.
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 222 -
Example 30: Rat Corneal Wound Healing Model
This animal model shows the effect of TRID on neovascularization. The
experimental protocol includes:
a) Making a 1-1.5 mm long incision from the center of cornea into the
stromal layer.
b) Inserting a spatula below the lip of the incision facing the outer
corner of the eye.
c) Making a pocket (its base is 1-1.5 mm form the edge of the eye).
d) Positioning a pellet, containing SOng- Sug of TRID, within the
pocket.
e) TRID treatment can also be applied topically to the corneal wounds
in a dosage range of 20mg - SOOmg (daily treatment for five days).
The studies described in this example test the activity in TRID protein.
However, one skilled in the art could easily modify the exemplified studies to
test
the activity of TRID polynucleotides (e.g., gene therapy), agonists, and/or
antagonists of TRID.
Example 31: Diabetic Mouse and Glucocorticoid Impaired Wound Healing
Models
A. Diabetic db+ldb+ Mouse Model.
To demonstrate that TRID accelerates the healing process, the genetically
diabetic mouse model of wound healing is used. The full thickness wound
healing
model in the db+/db+ mouse is a well characterized, clinically relevant and
reproducible model of impaired wound healing. Healing of the diabetic wound is
dependent on formation of granulation tissue and re-epithelialization rather
than
contraction (Gartner, M.H. et al., J. Surg. Res. 52:389 (1992); Greenhalgh,
D.G.
et al., Am. J. Pathol. 136:1235 (1990)).
The diabetic animals have many of the characteristic features observed in
Type II diabetes mellitus. Homozygous (db+/db+) mice are obese in comparison
to their normal heterozygous (db+/+m) littermates. Mutant diabetic (db+/db+)
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 223 -
mice have a single autosomal recessive mutation on chromosome 4 (db+)
(Coleman et al. Proc. Natl. Acad. Sci. USA 77:283-293 (1982)). Animals show
polyphagia, polydipsia and polyuric. Mutant diabetic mice (db+/db+) have
elevated blood glucose, increased or normal insulin levels, and suppressed
cell-
s mediated immunity (Mandel et al., J. Immunol. 120:1375 (1978); Debray-Sachs,
M. et al., Clin. Exp. Immunol. 51 (I):1-7 (1983); Leiter et al., Am. J. of
Pathol.
114:46-55 (1985)). Peripheral neuropathy, myocardial complications, and
microvascular lesions, basement membrane thickening and glomerular filtration
abnormalities have been described in these animals (Norido, F. et.al. , Exp.
Neurol.
83(2):221-232 (1984); Robertson etal.,Diabetes 29(1):60-67 (1980); Giacomelli
etal., Lablnvest. 400):460-473 (1979); Coleman, D.L., Diabetes 31 (Suppl):1-6
( 1982)). These homozygous diabetic mice develop hyperglycemia that is
resistant
to insulin analogous to human type II diabetes (Mandel et al., J. Imnzunol.
120:1375-1377 (1978)).
The characteristics observed in these animals suggests that healing in this
model may be similar to the healing observed in human diabetes (Greenhalgh, et
al., Am. J. ofPathol. 136:1235-1246 (1990)).
Genetically diabetic female C57BL/KsJ (db+/db+) mice and their non-
diabetic (db+/+m) heterozygous littermates are used in this study (Jackson
Laboratories). The animals are purchased at 6 weeks of age and were 8 weeks
old
at the beginning of the study. Animals are individually housed and received
food
and water ad libitum. All manipulations are performed using aseptic
techniques.
The experiments are conducted according to the rules and guidelines of Human
Genome Sciences, Inc. Institutional Animal Care and Use Committee and the
Guidelines for the Care and Use of Laboratory Animals.
Wounding protocol is performed according to previously reported
methods (Tsuboi, R. and Rifkin, D.B., J. Exp. Med. 172:245-251 (1990)).
Briefly, on the day of wounding, animals are anesthetized with an
intraperitoneal
injection ofAvertin (0.01 mg/mL), 2,2,2-tribromoethanol and 2-methyl-2-butanol
dissolved in deionized water. The dorsal region of the animal is shaved and
the
skin washed with 70% ethanol solution and iodine. The surgical area is dried
with
CA 02374674 2001-11-20
WO 00/71150 PCT/LJS00/13515
-224-
sterile gauze prior to wounding. An 8 mm full-thickness wound is then created
using a Keyes tissue punch. Immediately following wounding, the surrounding
skin is gently stretched to eliminate wound expansion. The wounds are left
open
for the duration of the experiment. Application of the treatment is given
topically
for 5 consecutive days commencing on the day of wounding. Prior to treatment,
wounds are gently cleansed with sterile saline and gauze sponges.
Wounds are visually examined and photographed at a fixed distance at the
day of surgery and at two day intervals thereafter. Wound closure is
determined
by daily measurement on days 1-5 and on day 8. Wounds are measured
horizontally and vertically using a calibrated Jameson caliper. Wounds are
considered healed if granulation tissue is no longer visible and the wound is
covered by a continuous epithelium.
TRID is administered using at a range different doses of TRID, from 4mg
to SOOmg per wound per day for 8 days in vehicle. Vehicle control groups
received SOmL of vehicle solution.
Animals are euthanized on day 8 with an intraperitoneal injection of
sodium pentobarbital (300mg/kg). The wounds and surrounding skin are then
harvested for histology and immunohistochemistry. Tissue specimens are placed
in 10% neutral buffered formalin in tissue cassettes between biopsy sponges
for
further processing.
Three groups of 10 animals each (5 diabetic and 5 non-diabetic controls)
are evaluated: 1) Vehicle placebo control, 2) TRID.
Wound closure is analyzed by measuring the area in the vertical and
horizontal axis and obtaining the total square area of the wound. Contraction
is
then estimated by establishing the differences between the initial wound area
(day
0) and that of post treatment (day 8). The wound area on day 1 was 64mm2, the
corresponding size of the dermal punch. Calculations were made using the
following formula:
[Open area on day 8] - [Open area on day 1 ] / [Open area on day 1 ]
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 225 -
Specimens are fixed in 10% buffered formalin and paraffin embedded
blocks are sectioned perpendicular to the wound surface (Smm) and cut using a
Reichert-Jung microtome. Routine hematoxylin-eosin (H&E) staining is
performed on cross-sections of bisected wounds. Histologic examination of the
wounds are used to assess whether the healing process and the morphologic
appearance of the repaired skin is altered by treatment with TRID. This
assessment included verification of the presence of cell accumulation,
inflammatory cells, capillaries, fibroblasts, re-epithelialization and
epidermal
maturity (Greenhalgh, D.G. et al., Am. J. Pathol. 136:1235 (1990)). A
calibrated
lens micrometer is used by a blinded observer.
Tissue sections are also stained immunohistochemically with a polyclonal
rabbit anti-human keratin antibody using ABC Elite detection system. Human
skin
is used as a positive tissue control while non-immune IgG is used as a
negative
control. Keratinocyte growth is determined by evaluating the extent of
reepithelialization of the wound using a calibrated lens micrometer.
Proliferating cell nuclear antigen/cyclin (PCNA) in skin specimens is
demonstrated by using anti-PCNA antibody ( 1:50) with an ABC Elite detection
system. Human colon cancer served as a positive tissue control and human brain
tissue is used as a negative tissue control. Each specimen included a section
with
omission of the primary antibody and substitution with non-immune mouse IgG.
Ranking of these sections is based on the extent of proliferation on a scale
of 0-8,
the lower side of the scale reflecting slight proliferation to the higher side
reflecting intense proliferation.
Experimental data are analyzed using an unpaired t test. A p value of
0.05 is considered significant.
B. Steroid Impaired Rat Model
The inhibition of wound healing by steroids has been well documented in
various in vitro and in vivo systems (Wahl, S.M. Glucocorticoids and Wound
healing. In: Anti-Inflammatory Steroid Action: Basic and Clinical Aspects. 280-
302 (1989); Wahl, S.M.etal., J. Immunol. 11~: 476-481 (1975); Werb, Z. etal.,
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-226-
J. Exp. Med. 147:1684-1694 (1978)). Glucocorticoids retard wound healing by
inhibiting angiogenesis, decreasing vascular permeability ( Ebert, R.H., et
al., An.
Intern. Med. 3 7:701-705 ( 1952)), fibroblast proliferation, and collagen
synthesis
(Beck, L.S. et al., Growth Factors. 5: 295-304 (1991); Haynes, B.F. et al., J.
Clin. Invest. 61: 703-797 (1978)) and producing a transient reduction of
circulating monocytes (Haynes, B.F., et al., J. Clin. Invest. 61: 703-797
(1978);
Wahl, S. M., "Glucocorticoids and wound healing", In: Antiinflammatory Steroid
Action: Basic and Clinical Aspects, Academic Press, New York, pp. 280-302
(1989)). The systemic administration of steroids to impaired wound healing is
a
well establish phenomenon in rats (Beck, L.S. et al., Growth Factors. ~: 295-
304 (1991); Haynes, B.F., et al., J. Clin. Invest. 61: 703-797 (1978); Wahl,
S.
M., "Glucocorticoids and wound healing", In: Antiinflammatory Steroid Action:
Basic and Clinical Aspects, Academic Press, New York, pp. 280-302 (1989);
Pierce, G.F. et al., Proc. Natl. Acad. Sci. USA 86: 2229-2233 (1989)).
To demonstrate that TRID can accelerate the healing process, the effects
of multiple topical applications of TRID on full thickness excisional skin
wounds
in rats in which healing has been impaired by the systemic administration of
methylprednisolone is assessed.
Young adult male Sprague Dawley rats weighing 250-300 g (Charles River
Laboratories) are used in this example. The animals are purchased at 8 weeks
of
age and were 9 weeks old at the beginning of the study. The healing response
of
rats is impaired by the systemic administration of methylprednisolone (
17mg/kg/rat
intramuscularly) at the time of wounding. Animals are individually housed and
received food and water ad libitum. All manipulations are performed using
aseptic techniques. This study is conducted according to the rules and
guidelines
of Human Genome Sciences, Inc. Institutional Animal Care and Use Committee
and the Guidelines for the Care and Use of Laboratory Animals.
The wounding protocol is followed according to section A, above. On the day of
wounding, animals are anesthetized with an intramuscular injection of ketamine
(50 mg/kg) and xylazine (5 mg/kg). The dorsal region of the animal is shaved
and
the skin washed with 70% ethanol and iodine solutions. The surgical area is
dried
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 227 -
with sterile gauze prior to wounding. An 8 mm full-thickness wound is created
using a Keyes tissue punch. The wounds are left open for the duration of the
experiment. Applications of the testing materials are given topically once a
day
for 7 consecutive days commencing on the day of wounding and subsequent to
methylprednisolone administration. Prior to treatment, wounds are gently
cleansed with sterile saline and gauze sponges.
Wounds are visually examined and photographed at a fixed distance at the
day of wounding and at the end of treatment. Wound closure is determined by
daily measurement on days 1-5 and on day 8 for Figure. Wounds are measured
horizontally and vertically using a calibrated Jameson caliper. Wounds are
considered healed if granulation tissue was no longer visible and the wound is
covered by a continuous epithelium.
TRID is administered using at a range different doses of TRID, from 4mg
to SOOmg per wound per day for 8 days in vehicle. Vehicle control groups
received SOmL of vehicle solution.
Animals are euthanized on day 8 with an intraperitoneal injection of
sodium pentobarbital (300mg/kg). The wounds and surrounding skin are then
harvested for histology. Tissue specimens are placed in 10% neutral buffered
formalin in tissue cassettes between biopsy sponges for further processing.
Four groups of 10 animals each (5 with methylprednisolone and 5 without
glucocorticoid) were evaluated: 1 ) Untreated group 2) Vehicle placebo control
3)
TRID treated groups.
Wound closure is analyzed by measuring the area in the vertical and
horizontal axis and obtaining the total area of the wound. Closure is then
estimated by establishing the differences between the initial wound area (day
0)
and that of post treatment (day 8). The wound area on day 1 was 64mm'-, the
corresponding size of the dermal punch. Calculations were made using the
following formula:
[Open area on day 8] - [Open area on day 1 ] / [Open area on day 1 ]
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-228-
Specimens are fixed in 10% buffered formalin and paraffin embedded
blocks are sectioned perpendicular to the wound surface (Smm) and cut using an
Olympus microtome. Routine hematoxylin-eosin (H&E) staining was performed
on cross-sections of bisected wounds. Histologic examination of the wounds
allows assessment of whether the healing process and the morphologic
appearance
of the repaired skin was improved by treatment with TRID. A calibrated lens
micrometer is used by a blinded observer to determine the distance of the
wound
gap.
Experimental data are analyzed using an unpaired t test.. A p value of
0.05 is considered significant.
The studies described in this example test the activity in TRID protein.
However, one skilled in the art could easily modify the exemplified studies to
test
the activity of TRID polynucleotides (e.g., gene therapy), agonists, and/or
antagonists of TRID.
Example 32: Lymphadema Animal Model
The purpose of this experimental approach is to create an appropriate and
consistent lymphedema model for testing the therapeutic effects of TRID in
lymphangiogenesis and re-establishment of the lymphatic circulatory system in
the
rat hind limb. Effectiveness is measured by swelling volume of the affected
limb,
quantification of the amount of lymphatic vasculature, total blood plasma
protein,
and histopathology. Acute lymphedema is observed for 7-10 days. Perhaps more
importantly, the chronic progress of the edema is followed for up to 3-4
weeks.
Prior to beginning surgery, blood sample is drawn for protein
concentration analysis. Male rats weighing approximately -~-350g are dosed
with
Pentobarbital. Subsequently, the right legs are shaved from knee to hip. The
shaved area is swabbed with gauze soaked in 70% EtOH. Blood is drawn for
serum total protein testing. Circumference and volumetric measurements are
made prior to injecting dye into paws after marking 2 measurement levels (0.5
cm
above heel, at mid-pt of dorsal paw). The intradermal dorsum of both right and
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 229 -
left paws are injected with 0.05 ml of 1 % Evan's Blue. Circumference and
volumetric measurements are then made following injection of dye into paws.
Using the knee joint as a landmark, a mid-leg inguinal incision is made
circumferentially allowing the femoral vessels to be located. Forceps and
hemostats are used to dissect and separate the skin flaps. After locating the
femoral vessels, the lymphatic vessel that runs along side and underneath the
vessels) is located. The main lymphatic vessels in this area are then
electrically
coagulated or suture ligated.
Using a microscope, muscles in back of the leg (near the semitendinosis
and adductors) are bluntly dissected. The popliteal lymph node is then
located.
The 2 proximal and 2 distal lymphatic vessels and distal blood supply of the
popliteal node are then and ligated by suturing. The popliteal lymph node, and
any
accompanying adipose tissue, is then removed by cutting connective tissues.
Care is taken to control any mild bleeding resulting from this procedure.
After lymphatics are occluded, the skin flaps are sealed by using liquid skin
(Vetbond) (AJ Buck). The separated skin edges are sealed to the underlying
muscle tissue while leaving a gap of ~0.5 cm around the leg. Skin also may be
anchored by suturing to underlying muscle when necessary.
To avoid infection, animals are housed individually with mesh (no
bedding). Recovering animals are checked daily through the optimal edematous
peak, which typically occurred by day 5-7. The plateau edematous peak are then
observed. To evaluate the intensity of the lymphedema, the circumference and
volumes of 2 designated places on each paw before operation and daily for 7
days
are measured. The effect plasma proteins on lymphedema is determined and
whether protein analysis is a useful testing perimeter is also investigated.
The
weights of both control and edematous limbs are evaluated at 2 places.
Analysis
is performed in a blind manner.
Circumference Measurements: Under brief gas anesthetic to prevent limb
movement, a cloth tape is used to measure limb circumference. Measurements are
done at the ankle bone and dorsal paw by 2 different people then those 2
readings
are averaged. Readings are taken from both control and edematous limbs.
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-230-
Volumetric Measurements: On the day of surgery, animals are anesthetized
with Pentobarbital and are tested prior to surgery. For daily volumetrics
animals
are under brief halothane anesthetic (rapid immobilization and quick
recovery),
both legs are shaved and equally marked using waterproof marker on legs. Legs
are first dipped in water, then dipped into instrument to each marked level
then
measured by Buxco edema software(Chen/Victor). Data is recorded by one
person, while the other is dipping the limb to marked area.
Blood-plasma protein measurements: Blood is drawn, spun, and serum
separated prior to surgery and then at conclusion for total protein and Ca2+
comparison.
Limb Weight Comparison: After drawing blood, the animal is prepared for
tissue collection. The limbs were amputated using a quillitine, then both
experimental and control legs were cut at the ligature and weighed. A second
weighing is done as the tibio-cacaneal joint was disarticulated and the foot
was
weighed.
Histological Preparations: The transverse muscle located behind the knee
(popliteal) area is dissected and arranged in a metal mold, filled with
FreezeGel,
dipped into cold methylbutane, placed into labeled sample bags at -
80°C until
sectioning. Upon sectioning, the muscle was observed under fluorescent
microscopy for lymphatics. Other immuno/histological methods are currently
being evaluated.
The studies described in this example test the activity in TRID protein.
However, one skilled in the art could easily modify the exemplified studies to
test
the activity of TRID polynucleotides (e.g., gene therapy), agonists, and/or
antagonists of TRID.
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 231 -
It will be clear that the invention may be practiced otherwise than as
particularly described in the foregoing description and examples. Numerous
modifications and variations of the present invention are possible in light of
the
above teachings and, therefore, are within the scope of the appended claims.
The entire disclosure of each document cited (including patents, patent
applications, journal articles, abstracts, laboratory manuals, books, or other
disclosures) in the Background of the Invention, Detailed Description, and
Examples is hereby incorporated herein by reference.
Further, the Sequence Listing submitted herewith, in paper form, is hereby
incorporated by reference in its entirety.
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
- 232 -
Applicant's or agent's file International application No~
reference number: 1488.128PC05 TB ~A
INDICATIONS RELATING TO A DEPOSITED MICROORGANISM
(PCT Rule l3bis)
A. The indications made below
relate to the microorganism
referred to in the description
on page 5, line 6.
B. IDENTIFICATION OF DEPOSIT
Further deposits are identified
on an additional sheet ~
Name of depository institution
American Type Culture Collection
Address of depository institution
(including postal code and country)
10801 University Boulevard
Manassas, Virginia 20110-2209
United States of America
Date of deposit Accession Number
20 November 1996 (20.11.96) 97798
C. ADDITIONAL INDICATIONS (leave
blank if not applicable) This
information is continued on
an additional sheet 0
DNA Plasmid 1658760
D. DESIGNATED STATES FOR WHICH
INDICATIONS ARE MADE (ijtle
indications are not jot all
designated Stares)
E. SEPARATE FURNISHING OF INDICATIONS
(leave blank if not appueabie)
The indications listed below
will be submitted to the international
Bureau later (specify the general
nature of the indications, e.g.,
'Accession Number of Deposit")
For receiving Office use only For International Bureau use only
I~This sheet was received with~ This sheet was received by the International
the international application Bureau on:
Authorized officer 1 ; F""
, Authorized officer
~:r'i c~.:~ ~:;,:~~OY~S
~,1 G:~;Le.~~~s ..=;~n ieam
1
I 'W ~~_~;W : ~~ n ire...
Form PCT/RO/134 (July 1992) 128deposit.jp
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-1-
SEQUENCE LISTING
<110> Human Genome Sciences, Inc.
Wei, Ying-Fei
Ni, Jian
Gentz, Refiner
Ruben, Steven
<120> Tumor Necrosis Factor Receptor 5
<130> 1488.128PC05
<140>
<141>
<160> 27
<170> PatentIn Ver. 2.1
<210> 1
<211> 1392
<212> DNA
<213> Homo Sapiens
<220>
<221> CDS
<222> (183)..(959)
<400> 1
cctctccacg cgcacgaact cagccaacga tttctgatag atttttggga gtttgaccag 60
agatgcaagg ggtgaaggag cgcttcctac cgttagggaa ctctggggac agagcgcccc 120
ggccgcctga tggccgaggc agggtgcgac ccaggaccca ggacggcgtc gggaaccata 180
cc atg gcc cgg atc ccc aag acc cta aag ttc gtc gtc gtc atc gtc 227
Met Ala Arg I1e Pro Lys Thr Leu Lys Phe Val Val Val Ile Val
1 5 10 15
gcg gtc ctg ctg cca gtc cta get tac tct gcc acc act gcc cgg cag 275
Ala Val Leu Leu Pro Val Leu Ala Tyr Ser Ala Thr Thr Ala Arg Gln
20 25 30
gag gaa gtt ccc cag cag aca gtg gcc cca cag caa cag agg cac agc 323
Glu Glu Val Pro Gln Gln Thr Val Ala Pro Gln Gln Gln Arg His Ser
35 40 45
ttc aag ggg gag gag tgt cca gca gga tct cat aga tca gaa cat act 371
Phe Lys Gly G1u Glu Cys Pro Ala G1y Ser His Arg Ser Glu His Thr
50 55 60
gga gcc tgt aac ccg tgc aca gag ggt gtg gat tac acc aac get tcc 419
Gly Ala Cys Asn Pro Cys Thr Glu Gly Val Asp Tyr Thr Asn Ala Ser
65 70 75
aac aat gaa cct tct tgc ttc cca tgt aca gtt tgt aaa tca gat caa 467
Asn Asn Glu Pro Ser Cys Phe Pro Cys Thr Val Cys Lys Ser Asp Gln
80 85 90 95
aaa cat aaa agt tcc tgc acc atg acc aga gac aca gtg tgt cag tgt 515
Lys His Lys Ser Ser Cys Thr Met Thr Arg Asp Thr Val Cys Gln Cys
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-2-
100 105 110
aaa gaa ggc acc ttc cgg aat gaa aac tcc cca gag atg tgc cgg aag 563
Lys Glu Gly Thr Phe Arg Asn Glu Asn Ser Pro Glu Met Cys Arg Lys
115 120 125
tgt agc agg tgc cct agt ggg gaa gtc caa gtc agt aat tgt acg tcc 611
Cys Ser Arg Cys Pro Ser Gly Glu Val Gln Val Ser Asn Cys Thr Ser
130 135 140
tgg gat gat atc cag tgt gtt gaa gaa ttt ggt gcc aat gcc act gtg 659
Trp Asp Asp Ile Gln Cys Val Glu Glu Phe Gly Ala Asn Ala Thr Va1
145 150 155
gaa acc cca get get gaa gag aca atg aac acc agc ccg ggg act cct 707
Glu Thr Pro Ala Ala Glu Glu Thr Met Asn Thr Ser Pro Gly Thr Pro
160 165 170 175
gcc cca get get gaa gag aca atg aac acc agc cca ggg act cct gcc 755
Ala Pro Ala Ala Glu Glu Thr Met Asn Thr Ser Pro Gly Thr Pro Ala
180 185 190
cca get get gaa gag aca atg acc acc agc ccg ggg act cct gcc cca 803
Pro Ala Ala Glu Glu Thr Met Thr Thr Ser Pro Gly Thr Pro Ala Pro
195 200 205
get get gaa gag aca atg acc acc agc ccg ggg act cct gcc cca get 851
Ala Ala Glu Glu Thr Met Thr Thr Ser Pro Gly Thr Pro Ala Pro Ala
210 215 220
get gaa gag aca atg acc acc agc ccg ggg act cct gcc tct tct cat 899
Ala Glu Glu Thr Met Thr Thr Ser Pro Gly Thr Pro Ala Ser Ser His
225 230 235
tac ctc tca tgc acc atc gta ggg atc ata gtt cta att gtg ctt ctg 947
Tyr Leu Ser Cys Thr Ile Val Gly Ile Ile Val Leu Ile Val Leu Leu
240 245 250 255
att gtg ttt gtt tgaaagactt cactgtggaa gaaattcctt ccttacctga 999
Ile Val Phe Val
aaggttcagg taggcgctgg ctgagggcgg ggggcgctgg acactctctg ccctgcctcc 1059
ctctgctgtg ttcccacaga cagaaacgcc tgcccctgcc ccaagtcctg gtgtctccag 1119
cctggctcta tcttcctcct tgtgatcgtc ccatccccac atcccgtgca ccccccagga 1179
ccctggtctc atcagtccct ctcctggagc tgggggtcca cacatctccc agccaagtcc 1239
aagaggcagg gccagttcct cccatcttca ggcccagcca ggcagggggc agtcggctcc 1299
tcaactgggt gacaagggtg aggatgagaa gtggtcacgg gatttattca gccttggtca 1359
gagcagaaca cagagatttt ccgtgaaaaa aaa 1392
<210> 2
<211> 259
<212> PRT
<213> Homo sapiens
<400> 2
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-3-
Met Ala Arg Ile Pro Lys Thr Leu Lys Phe Val Val Val Ile Val Ala
1 5 10 15
Val Leu Leu Pro Val Leu Ala Tyr Ser Ala Thr Thr Ala Arg Gln Glu
20 25 30
Glu Val Pro Gln Gln Thr Val Ala Pro Gln Gln Gln Arg His Ser Phe
35 40 45
Lys Gly Glu Glu Cys Pro Ala Gly Ser His Arg Ser Glu His Thr Gly
50 55 60
Ala Cys Asn Pro Cys Thr Glu Gly Val Asp Tyr Thr Asn Ala Ser Asn
65 70 75 80
Asn Glu Pro Ser Cys Phe Pro Cys Thr Val Cys Lys Ser Asp Gln Lys
85 90 95
His Lys Ser Ser Cys Thr Met Thr Arg Asp Thr Val Cys G,ln Cys Lys
100 105 110
Glu Gly Thr Phe Arg Asn Glu Asn Ser Pro Glu Met Cys Arg Lys Cys
115 120 125
Ser Arg Cys Pro Ser Gly Glu Val Gln Val Ser Asn Cys Thr Ser Trp
130 135 140
Asp Asp Ile G1n Cys Val Glu Glu Phe Gly Ala Asn Ala Thr Val Glu
145 150 155 160
Thr Pro Ala Ala Glu Glu Thr Met Asn Thr Ser Pro Gly Thr Pro Ala
165 170 175
Pro Ala Ala Glu Glu Thr Met Asn Thr Ser Pro Gly Thr Pro Ala Pro
180 185 190
Ala Ala Glu Glu Thr Met Thr Thr Ser Pro Gly Thr Pro Ala Pro Ala
195 200 205
Ala Glu Glu Thr Met Thr Thr Ser Pro Gly Thr Pro Ala Pro Ala Ala
210 215 220
Glu Glu Thr Met Thr Thr Ser Pro Gly Thr Pro Ala Ser Ser His Tyr
225 230 235 240
Leu Ser Cys Thr Ile Val Gly Ile Ile Val Leu Ile Val Leu Leu Ile
245 250 255
Val Phe Val
<210> 3
<211> 455
<212> PRT
<213> Homo sapiens
<400> 3
Met Gly Leu Ser Thr Val Pro Asp Leu Leu Leu Pro Leu Val Leu Leu
1 5 10 15
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-4-
Glu Leu Leu Val Gly Ile Tyr Pro Ser Gly Val Ile Gly Leu Val Pro
20 25 30
His Leu Gly Asp Arg Glu Lys Arg Asp Ser Val Cys Pro Gln Gly Lys
35 40 45
Tyr Ile His Pro Gln Asn Asn Ser Ile Cys Cys Thr Lys Cys His Lys
50 55 60
Gly Thr Tyr Leu Tyr Asn Asp Cys Pro Gly Pro Gly Gln Asp Thr Asp
65 70 75 80
Cys Arg Glu Cys Glu Ser Gly Ser Phe Thr Ala Ser Glu Asn His Leu
85 90 95
Arg His Cys Leu Ser Cys Ser Lys Cys Arg Lys Glu Met Gly Gln Val
100 105 110
Glu Ile Ser Ser Cys Thr Val Asp Arg Asp Thr Val Cys Gly Cys Arg
115 120 125
Lys Asn Gln Tyr Arg His Tyr Trp Ser Glu Asn Leu Phe Gln Cys Phe
130 135 140
Asn Cys Ser Leu Cys Leu Asn Gly Thr Val His Leu Ser Cys Gln Glu
145 150 155 160
Lys Gln Asn Thr Val Cys Thr Cys His Ala Gly Phe Phe Leu Arg Glu
165 170 175
Asn Glu Cys Val Ser Cys Ser Asn Cys Lys Lys Ser Leu Glu Cys Thr
180 185 190
Lys Leu Cys Leu Pro Gln Ile Glu Asn Val Lys Gly Thr Glu Asp Ser
195 200 205
Gly Thr Thr Val Leu Leu Pro Leu Val Ile Phe Phe Gly Leu Cys Leu
210 215 220
Leu Ser Leu Leu Phe Ile Gly Leu Met Tyr Arg Tyr Gln Arg Trp Lys
225 230 235 240
Ser Lys Leu Tyr Ser Ile Val Cys Gly Lys Ser Thr Pro Glu Lys Glu
245 250 255
Gly Glu Leu Glu Gly Thr Thr Thr Lys Pro Leu Ala Pro Asn Pro Ser
260 265 270
Phe Ser Pro Thr Pro Gly Phe Thr Pro Thr Leu Gly Phe Ser Pry Val
275 280 285
Pro Ser Ser Thr Phe Thr Ser Ser Ser Thr Tyr Thr Pro Gly Asp Cys
290 295 300
Pro Asn Phe Ala Ala Pro Arg Arg Glu Val Ala Pro Pro Tyr Gln Gly
305 310 315 320
Ala Asp Pro Ile Leu Ala Thr Ala Leu Ala Ser Asp Pro Ile Pro Asn
325 330 335
Pro Leu Gln Lys Trp Glu Asp Ser Ala His Lys Pro Gln Ser Leu Asp
340 345 350
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-5-
Thr Asp Asp Pro Ala Thr Leu Tyr Ala Val Val Glu Asn Val Pro Pro
355 360 365
Leu Arg Trp Lys Glu Phe Val Arg Arg Leu Gly Leu Ser Asp His Glu
370 375 380
Ile Asp Arg Leu Glu Leu Gln Asn Gly Arg Cys Leu Arg Glu Ala Gln
385 390 395 400
Tyr Ser Met Leu Ala Thr Trp Arg Arg Arg Thr Pro Arg Arg Glu Ala
405 410 415
Thr Leu Glu Leu Leu Gly Arg Val Leu Arg Asp Met Asp Leu Leu Gly
420 425 430
Cys Leu Glu Asp Ile G1u Glu Ala Leu Cys Gly Pro Ala Ala Leu Pro
435 440 445
Pro Ala Pro Ser Leu Leu Arg
450 455
<210> 4
<211> 461
<212> PRT
<213> Homo Sapiens
<400> 4
Met Ala Pro Val Ala Val Trp Ala Ala Leu Ala Val Gly Leu Glu Leu
1 5 10 15
Trp Ala Ala Ala His Ala Leu Pro Ala Gln Val Ala Phe Thr Pro Tyr
20 25 30
Ala Pro Glu Pro Gly Ser Thr Cys Arg Leu Arg Glu Tyr Tyr Asp Gln
35 40 45
Thr Ala Gln Met Cys Cys Ser Lys Cys Ser Pro Gly Gln His Ala Lys
SO 55 60
Val Phe Cys Thr Lys Thr Ser Asp Thr Val Cys Asp Ser Cys Glu Asp
65 70 75 80
Ser Thr Tyr Thr Gln Leu Trp Asn Trp Val Pro Glu Cys Leu Ser Cys
85 90 95
Gly Ser Arg Cys Ser Ser Asp Gln Val Glu Thr Gln Ala Cys Thr Arg
100 105 110
Glu G1n Asn Arg Ile Cys Thr Cys Arg Pro Gly Trp Tyr Cys Ala Leu
115 120 125
Ser Lys Gln Glu Gly Cys Arg Leu Cys Ala Pro Leu Arg Lys Cys Arg
130 135 140
Pro Gly Phe Gly Val Ala Arg Pro Gly Thr Glu Thr Ser Asp Val Val
145 150 155 160
Cys Lys Pro Cys Ala Pro Gly Thr Phe Ser Asn Thr Thr Ser Ser Thr
165 170 175
Asp Ile Cys Arg Pro His Gln Ile Cys Asn Val Val Ala Ile Pro Gly
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-6-
180 185 190
Asn Ala Ser Arg Asp Ala Val Cys Thr Ser Thr Ser Pro Thr Arg Ser
195 200 205
Met Ala Pro Gly Ala Val His Leu Pro Gln Pro Val Ser Thr Arg Ser
210 215 220
Gln His Thr Gln Pro Thr Pro Glu Pro Ser Thr Ala Pro Ser Thr Ser
225 230 235 240
Phe Leu Leu Pro Met Gly Pro Ser Pro Pro Ala G1u Gly Ser Thr Gly
245 250 255
Asp Phe Ala Leu Pro Val Gly Leu Ile Val Gly Val Thr Ala Leu Gly
260 265 270
Leu Leu Ile Ile Gly Val Val Asn Cys Val Ile Met Thr Gln Val Lys
275 280 285
Lys Lys Pro Leu Cys Leu G1n Arg Glu Ala Lys Val Pro His Leu Pro
290 295 300
Ala Asp Lys Ala Arg Gly Thr Gln Gly Pro Glu Gln Gln His Leu Leu
305 310 315 320
Ile Thr Ala Pro Ser Ser Ser Ser Ser Ser Leu Glu Ser Ser Ala Ser
325 330 335
Ala Leu Asp Arg Arg Ala Pro Thr Arg Asn Gln Pro Gln Ala Pro Gly
340 395 350
Val Glu Ala Ser Gly Ala Gly Glu Ala Arg Ala Ser Thr Gly Ser Ser
355 360 365
Asp Ser Ser Pro Gly Gly His Gly Thr Gln Val Asn Val Thr Cys Ile
370 375 380
Val Asn Val Cys Ser Ser Ser Asp His Ser Ser Gln Cys Ser Ser Gln
385 390 395 400
Ala Ser Ser Thr Met Gly Asp Thr Asp Ser Ser Pro Ser Glu Ser Pro
405 410 415
Lys Asp Glu Gln Val Pro Phe Ser Lys Glu Glu Cys Ala Phe Arg Ser
420 425 430
Gln Leu Glu Thr Pro Glu Thr Leu Leu Gly Ser Thr Glu Glu Lys Pro
435 440 445
Leu Pro Leu Gly Val Pro Asp Ala Gly Met Lys Pro Ser
450 455 460
<210> 5
<211> 427
<212> PRT
<213> Homo sapiens
<400> 5
Met Gly Ala Gly Ala Thr Gly Arg Ala Met Asp Gly Pro Arg Leu Leu
1 5 10 15
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
_'7_
Leu Leu Leu Leu Leu Gly Val Ser Leu Gly Gly Ala Lys Glu Ala Cys
20 25 30
Pro Thr Gly Leu Tyr Thr His Ser Gly Glu Cys Cys Lys Ala Cys Asn
35 40 45
Leu Gly Glu Gly Val Ala Gln Pro Cys Gly Ala Asn Gln Thr Val Cys
50 55 60
Glu Pro Cys Leu Asp Ser Val Thr Phe Ser Asp Val Val Ser Ala Thr
65 70 75 80
Glu Pro Cys Lys Pro Cys Thr Glu Cys Val Gly Leu Gln Ser Met Ser
85 90 95
Ala Pro Cys Val Glu Ala Asp Asp Ala Val Cys Arg Cys Ala Tyr Gly
100 105 110
Tyr Tyr Gln Asp Glu Thr Thr Gly Arg Cys Glu Ala Cys Axg Val Cys
115 120 125
Glu Ala Gly Ser Gly Leu Val Phe Ser Cys Gln Asp Lys Gln Asn Thr
130 135 140
Val Cys Glu Glu Cys Pro Asp Gly Thr Tyr Ser Asp Glu Ala Asn His
145 150 155 160
Val Asp Pro Cys Leu Pro Cys Thr Val Cys Glu Asp Thr Glu Arg Gln
165 170 175
Leu Arg Glu Cys Thr Arg Trp Ala Asp Ala Glu Cys Glu Glu Ile Pro
180 185 190
Gly Arg Trp Ile Thr Arg Ser Thr Pro Pro Glu Gly Ser Asp Ser Thr
195 200 205
Ala Pro Ser Thr Gln Glu Pro Glu Ala Pro Pro Glu Gln Asp Leu Ile
210 215 220
Ala Ser Thr Val Ala Gly Val Val Thr Thr Val Met Gly Ser Ser G1n
225 230 235 240
Pro Val Val Thr Arg Gly Thr Thr Asp Asn Leu Ile Pro Val Tyr Cys
245 250 255
Ser Ile Leu Ala Ala Val Val Val Gly Leu Val Ala Tyr Ile Ala Phe
260 265 270
Lys Arg Trp Asn Ser Cys Lys Gln Asn Lys Gln Gly Ala Asn Se-r Arg
275 280 285
Pro Val Asn Gln Thr Pro Pro Pro Glu Gly Glu Lys Leu His Ser Asp
290 295 300
Ser Gly Ile Ser Val Asp Ser Gln Ser Leu His Asp Gln Gln Pro His
305 310 315 320
Thr Gln Thr Ala Ser Gly Gln Ala Leu Lys Gly Asp Gly Gly Leu Tyr
325 330 335
Ser Ser Leu Pro Pro Ala Lys Arg Glu Glu Val Glu Lys Leu Leu Asn
340 345 350
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
_g_
Gly Ser Ala Gly Asp Thr Trp Arg His Leu Ala Gly Glu Leu Gly Tyr
355 360 365
Gln Pro Glu His Ile Asp Ser Phe Thr His Glu Ala Cys Pro Val Arg
370 375 380
Ala Leu Leu Ala Ser Trp Ala Thr Gln Asp Ser Ala Thr Leu Asp Ala
385 390 395 400
Leu Leu Ala Ala Leu Arg Arg Ile Gln Arg Ala Asp Leu Val Glu Ser
405 410 415
Leu Cys Ser Glu Ser Thr Ala Thr Ser Pro Val
420 425
<210> 6
<211> 415
<212> PRT
<213> Homo sapiens
<400> 6
Met Arg Leu Pro Arg Ala Ser Ser Pro Cys Gly Leu Ala Trp G1y Pro
1 5 10 15
Leu Leu Leu Gly Leu Ser Gly Leu Leu Val Ala Ser Gln Pro Gln Leu
20 25 30
Val Pro Pro Tyr Arg Ile Glu Asn Gln Thr Cys Trp Asp Gln Asp Lys
35 40 45
Glu Tyr Tyr Glu Pro Met His Asp Val Cys Cys Ser Arg Cys Pro Pro
50 55 60
Gly Glu Phe Val Phe Ala Val Cys Ser Arg Ser Gln Asp Thr Val Cys
65 70 75 80
Lys Thr Cys Pro His Asn Ser Tyr Asn Glu His Trp Asn His Leu Ser
85 90 95
Thr Cys Gln Leu Cys Arg Pro Cys Asp Ile Val Leu Gly Phe Glu Glu
100 105 110
Val Ala Pro Cys Thr Ser Asp Arg Lys Ala Glu Cys Arg Cys Gln Pro
115 120 125
Gly Met Ser Cys Val Tyr Leu Asp Asn Glu Cys Val His Cys Glu Glu
130 135 140
Glu Arg Leu Val Leu Cys Gln Pro Gly Thr Glu Ala Glu Val Thr Asp
145 150 155 160
Glu Ile Met Asp Thr Asp Val Asn Cys Val Pro Cys Lys Pro Gly His
165 170 175
Phe G1n Asn Thr Ser Ser Pro Arg Ala Arg Cys Gln Pro His Thr Arg
180 185 190
Cys Glu I1e Gln Gly Leu Val Glu Ala Ala Pro Gly Thr Ser Tyr Ser
195 200 205
Asp Thr Ile Cys Lys Asn Pro Pro Glu Pro Gly Ala Met Leu Leu Leu
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-9-
210 215 220
Ala Ile Leu Leu Ser Leu Val Leu Phe Leu Leu Phe Thr Thr Val Leu
225 230 235 240
Ala Cys Ala Trp Met Arg His Pro Ser Leu Cys Arg Lys Leu Gly Thr
245 250 255
Leu Leu Lys Arg His Pro Glu Gly Glu Glu Ser Pro Pro Cys Pro Ala
260 265 270
Pro Arg Ala Asp Pro His Phe Pro Asp Leu Ala Glu Pro Leu Leu Pro
275 280 285
Met Ser Gly Asp Leu Ser Pro Ser Pro Ala Gly Pro Pro Thr Ala Pro
290 295 300
Ser Leu Glu Glu Val Val Leu Gln Gln Gln Ser Pro Leu Val Gln Ala
305 310 315 320
Arg Glu Leu Glu Ala Glu Pro Gly Glu His Gly Gln Val Ala His Gly
325 330 335
Ala Asn Gly Ile His Val Thr Gly Gly Ser Val Thr Val Thr Gly Asn
340 345 350
Ile Tyr Ile Tyr Asn Gly Pro Val Leu Gly Gly Thr Arg Gly Pro Gly
355 360 365
Asp Pro Pro Ala Pro Pro Glu Pro Pro Tyr Pro Thr Pro Glu Glu Gly
370 375 380
Ala Pro Gly Pro Ser Glu Leu Ser Thr Pro Tyr Gln Glu Asp Gly Lys
385 390 395 400
Ala Trp His Leu Ala Glu Thr Glu Thr Leu Gly Cys Gln Asp Leu
405 410 415
<210> 7
<211> 335
<212> PRT
<213> Homo sapiens
<400> 7
Met Leu Gly Ile Trp Thr Leu Leu Pro Leu Val Leu Thr Ser Val Ala
1 5 10 15
Arg Leu Ser Ser Lys Ser Val Asn Ala Gln Val Thr Asp Ile Asn Ser
20 25 30
Lys Gly Leu Glu Leu Arg Lys Thr Val Thr Thr Val Glu Thr Gln Asn
35 40 45
Leu Glu Gly Leu His His Asp Gly Gln Phe Cys His Lys Pro Cys Pro
50 55 60
Pro Gly Glu Arg Lys Ala Arg Asp Cys Thr Val Asn Gly Asp Glu Pro
65 70 75 80
Asp Cys Val Pro Cys Gln Glu Gly Lys Glu Tyr Thr Asp Lys Ala His
g5 g0 95
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-10-
Phe Ser Ser Lys Cys Arg Arg Cys Arg Leu Cys Asp Glu Gly His Gly
100 105 110
Leu Glu Val Glu Ile Asn Cys Thr Arg Thr Gln Asn Thr Lys Cys Arg
115 120 125
Cys Lys Pro Asn Phe Phe Cys Asn Ser Thr Val Cys Glu His Cys Asp
130 135 140
Pro Cys Thr Lys Cys Glu His Gly Ile Ile Lys Glu Cys Thr Leu Thr
145 150 155 160
Ser Asn Thr Lys Cys Lys Glu Glu Gly Ser Arg Ser Asn Leu Gly Trp
165 170 175
Leu Cys Leu Leu Leu Leu Pro Ile Pro Leu Ile Val Trp Val Lys Arg
180 185 190
Lys Glu Val Gln Lys Thr Cys Arg Lys His Arg Lys Glu Asn Gln Gly
195 200 205
Ser His Glu Ser Pro Thr Leu Asn Pro Glu Thr Val A1a Ile Asn Leu
210 215 220
Ser Asp Val Asp Leu Ser Lys Tyr Ile Thr Thr Ile Ala Gly Val Met
225 230 235 240
Thr Leu Ser Gln Val Lys Gly Phe Val Arg Lys Asn Gly Val Asn Glu
245 250 255
Ala Lys Ile Asp Glu Ile Lys Asn Asp Asn Val Gln Asp Thr Ala Glu
260 265 270
Gln Lys Val Gln Leu Leu Arg Asn Trp His Gln Leu His Gly Lys Lys
275 280 285
Glu Ala Tyr Asp Thr Leu Ile Lys Asp Leu Lys Lys Ala Asn Leu Cys
290 295 300
Thr Leu Ala Glu Lys Ile Gln Thr Ile I1e Leu Lys Asp Ile Thr Ser
305 310 315 320
Asp Ser G1u Asn Ser Asn Phe Arg Asn Glu Ile Gln Ser Leu Val
325 330 335
<210> 8
<211> 260
<212> PRT
<213> Homo
sapiens
<400> 8
Met Ala Pro Pro Trp LeuCys Leu ThrLeu
Arg His Trp Val G1y Val
1 5 10 15
Gly Leu Ala Pro Ala LysSer Pro ArgHis
Ser Thr Pro Cys Glu Tyr
20 25 30
Trp Ala Gly Leu Cys GlnMet Glu GlyThr
Gln Lys Cys Cys Pro Phe
35 40 45
Leu Val Lys Asp Cys Asp G1n His Arg Lys Ala Ala Gln Cys Asp Pro
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-11-
50 55 60
Cys Ile Pro Gly Val Ser Phe Ser Pro Asp His His Thr Arg Pro His
65 70 75 80
Cys Glu Ser Cys Arg His Cys Asn Ser Gly Leu Leu Val Arg Asn Cys
85 90 95
Thr Ile Thr Ala Asn Ala Glu Cys Ala Cys Arg Asn Gly Trp Gln Cys
100 105 110
Arg Asp Lys Glu Cys Thr Glu Cys Asp Pro Leu Pro Asn Pro Ser Leu
115 120 125
Thr Ala Arg Ser Ser Gln Ala Leu Ser Pro His Pro Gln Pro Thr His
130 135 140
Leu Pro Tyr Val Ser Glu Met Leu Glu Ala Arg Thr Ala Gly His Met
145 150 155 160
Gln Thr Leu Ala Asp Phe Arg Gln Leu Pro Ala Arg Thr Leu Ser Thr
165 170 175
His Trp Pro Pro Gln Arg Ser Leu Cys Ser Ser Asp Phe Ile Arg Ile
180 185 190
Leu Val Ile Phe Ser Gly Met Phe Leu Val Phe Thr Leu Ala Gly Ala
195 200 205
Leu Phe Leu His Gln Arg Arg Lys Tyr Arg Ser Asn Lys Gly Glu Ser
210 215 220
Pro Val Glu Pro Ala Glu Pro Cys Arg Tyr Ser Cys Pro Arg G1u Glu
225 230 235 240
Glu Gly Ser Thr Ile Pro Ile Gln G1u Asp Tyr Arg Lys Pro Glu Pro
245 250 255
Ala Cys Ser Pro
260
<210> 9
<211> 595
<212> PRT
<213> Homo Sapiens
<400> 9
Met Arg Val Leu Leu Ala Ala Leu Gly Leu Leu Phe Leu Gly Ala Leu
1 5 10 15
Arg Ala Phe Pro Gln Asp Arg Pro Phe Glu Asp Thr Cys His Gly Asn
20 25 30
Pro Ser His Tyr Tyr Asp Lys Ala Val Arg Arg Cys Cys Tyr Arg Cys
35 40 45
Pro Met Gly Leu Phe Pro Thr Gln Gln Cys Pro Gln Arg Pro Thr Asp
50 55 60
Cys Arg Lys Gln Cys Glu Pro Asp Tyr Tyr Leu Asp Glu Ala Asp Arg
65 70 75 80
CA 02374674 2001-11-20
WO 00/71150 PCT/~JS00/13515
-12-
Cys Thr Ala Cys Val Thr Cys Ser Arg Asp Asp Leu Val Glu Lys Thr
85 90 95
Pro Cys Ala Trp Asn Ser Ser Arg Val Cys Glu Cys Arg Pro Gly Met
100 105 110
Phe Cys Ser Thr Ser Ala Val Asn Ser Cys Ala Arg Cys Phe Phe His
115 120 125
Ser Val Cys Pro Ala Gly Met Ile Val Lys Phe Pro Gly Thr Ala Gln
130 135 140
Lys Asn Thr Val Cys Glu Pro Ala Ser Pro Gly Val Ser Pro Ala Cys
145 150 155 160
Ala Ser Pro Glu Asn Cys Lys Glu Pro Ser Ser Gly Thr Ile Pro Gln
165 170 175
Ala Lys Pro Thr Pro Val Ser Pro Ala Thr Ser Ser Ala Ser Thr Met
180 185 190
Pro Val Arg Gly Gly Thr Arg Leu Ala Gln Glu Ala Ala Ser Lys Leu
195 200 205
Thr Arg Ala Pro Asp Ser Pro Ser Ser Val Gly Arg Pro Ser Ser Asp
210 215 220
Pro Gly Leu Ser Pro Thr Gln Pro Cys Pro Glu Gly Ser Gly Asp Cys
225 230 235 240
Arg Lys Gln Cys Glu Pro Asp Tyr Tyr Leu Asp Glu Ala Gly Arg Cys
245 250 255
Thr Ala Cys Val Ser Cys Ser Arg Asp Asp Leu Val Glu Lys Thr Pro
260 265 270
Cys Ala Trp Asn Ser Ser Arg Thr Cys Glu Cys Arg Pro Gly Met Ile
275 280 285
Cys Ala Thr Ser Ala Thr Asn Ser Cys Ala Arg Cys Val Pro Tyr Pro
290 295 300
Ile Cys Ala Ala Glu Thr Val Thr Lys Pro Gln Asp Met Ala Glu Lys
305 310 315 320
Asp Thr Thr Phe Glu Ala Pro Pro Leu Gly Thr Gln Pro Asp Cys Asn
325 330 335
Pro Thr Pro Glu Asn Gly Glu Ala Pro Ala Ser Thr Ser Pro The Gln
340 345 350
Ser Leu Leu Val Asp Ser Gln Ala Ser Lys Thr Leu Pro Ile Pro Thr
355 360 365
Ser Ala Pro Val Ala Leu Ser Ser Thr Gly Lys Pro Val Leu Asp Ala
370 375 380
Gly Pro Val Leu Phe Trp Val Ile Leu Val Leu Val Val Val Val Gly
385 390 395 400
Ser Ser Ala Phe Leu Leu Cys His Arg Arg Ala Cys Arg Lys Arg Ile
405 410 415
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-13-
Arg Gln Lys Leu His Leu Cys Tyr Pro Val Gln Thr Ser Gln Pro Lys
420 425 430
Leu Glu Leu Val Asp Ser Arg Pro Arg Arg Ser Ser Thr Gln Leu Arg
435 440 445
Ser Gly Ala Ser Val Thr Glu Pro Val Ala Glu Glu Arg Gly Leu Met
450 455 460
Ser Gln Pro Leu Met Glu Thr Cys His Ser Val Gly Ala Ala Tyr Leu
465 470 475 480
Glu Ser Leu Pro Leu Gln Asp Ala Ser Pro Ala Gly Gly Pro Ser Ser
485 490 495
Pro Arg Asp Leu Pro Glu Pro Arg Val. Ser Thr Glu His Thr Asn Asn
500 505 510
Lys Ile Glu Lys Ile Tyr Ile Met Lys Ala Asp Thr Val Ile Val Gly
515 520 525
Thr Val Lys Ala Glu Leu Pro Glu Gly Arg G1y Leu Ala Gly Pro Ala
530 535 540
Glu Pro Glu Leu Glu Glu Glu Leu Glu Ala Asp His Thr Pro His Tyr
545 550 555 560
Pro Glu Gln Glu Thr Glu Pro Pro Leu Gly Ser Cys Ser Asp Val Met
565 570 575
Leu Ser Val G1u Glu Glu Gly Lys G1u Asp Pro Leu Pro Thr Ala Ala
580 585 590
Ser Gly Lys
595
<210> 10
<211> 277
<212> PRT
<213> Homo sapiens
<900> 10
Met Val Arg Leu Pro Leu Gln Cys Val Leu Trp Gly Cys Leu Leu Thr
1 5 10 15
Ala Val His Pro Glu Pro Pro Thr Ala Cys Arg Glu Lys Gln Tyr Leu
20 25 30
Ile Asn Ser Gln Cys Cys Ser Leu Cys Gln Pro Gly Gln Lys Leu Val
35 40 45
Ser Asp Cys Thr Glu Phe Thr Glu Thr Glu Cys Leu Pro Cys Gly Glu
50 55 60
Ser Glu Phe Leu Asp Thr Trp Asn Arg Glu Thr His Cys His Gln His
65 70 75 80
Lys Tyr Cys Asp Pro Asn Leu Gly Leu Arg Val Gln Gln Lys Gly Thr
g5 90 95
Ser G1u Thr Asp Thr Ile Cys Thr Cys Glu Glu Gly Trp His Cys Thr
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-14-
100 105 110
Ser Glu Ala Cys Glu Ser Cys Val Leu His Arg Ser Cys Ser Pro Gly
115 120 125
Phe Gly Val Lys Gln Ile Ala Thr Gly Val Ser Asp Thr Ile Cys Glu
130 135 140
Pro Cys Pro Val Gly Phe Phe Ser Asn Val Ser Ser Ala Phe Glu Lys
145 150 155 160
Cys His Pro Trp Thr Ser Cys Glu Thr Lys Asp Leu Val Val Gln Gln
165 170 175
Ala Gly Thr Asn Lys Thr Asp Val Val Cys Gly Pro Gln Asp Arg Leu
180 185 190
Arg Ala Leu Val Val Ile Pro Ile Ile Phe Gly Ile Leu Phe Ala Ile
195 200 205
Leu Leu Val Leu Val Phe Ile Lys Lys Val Ala Lys Lys Pro Thr Asn
210 215 220
Lys Ala Pro His Pro Lys Gln Glu Pro Gln Glu Ile Asn Phe Pro Asp
225 230 235 240
Asp Leu Pro Gly Ser Asn Thr Ala Ala Pro Val Gln Glu Thr Leu His
245 250 255
Gly Cys Gln Pro Val Thr Gln Glu Asp Gly Lys Glu Ser Arg Ile Ser
260 265 270
Val Gln Glu Arg Gln
275
<210> 11
<211> 255
<212> PRT
<213> Homo sapiens
<400> 11
Met Gly Asn Ser Cys Tyr Asn Ile Val Ala Thr Leu Leu Leu Val Leu
1 5 10 15
Asn Phe Glu Arg Thr Arg Ser Leu Gln Asp Pro Cys Ser Asn Cys Pro
20 25 30
Ala Gly Thr Phe Cys Asp Asn Asn Arg Asn Gln Ile Cys Ser Pro Cys
35 40 45
Pro Pro Asn Ser Phe Ser Ser Ala Gly Gly Gln Arg Thr Cys Asp Ile
50 55 60
Cys Arg Gln Cys Lys Gly Val Phe Arg Thr Arg Lys Glu Cys Ser Ser
65 70 75 80
Thr Ser Asn Ala Glu Cys Asp Cys Thr Pro Gly Phe His Cys Leu Gly
85 90 95
Ala Gly Cys Ser Met Cys Glu Gln Asp Cys Lys Gln Gly Gln Glu Leu
100 105 110
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-15-
Thr Lys Lys Gly Cys Lys Asp Cys Cys Phe Gly Thr Phe Asn Asp Gln
115 120 125
Lys Arg Gly Ile Cys Arg Pro Trp Thr Asn Cys Ser Leu Asp Gly Lys
130 135 140
Ser Val Leu Val Asn Gly Thr Lys Glu Arg Asp Val Val Cys Gly Pro
145 150 155 160
Ser Pro A1a Asp Leu Ser Pro Gly Ala Ser Ser Val Thr Pro Pro Ala
165 170 175
Pro Ala Arg Glu Pro Gly His Ser Pro Gln Ile Ile Ser Phe Phe Leu
180 185 190
Ala Leu Thr Ser Thr Ala Leu Leu Phe Leu Leu Phe Phe Leu Thr Leu
195 200 205
Arg Phe Ser Val Val Lys Arg Gly Arg Lys Lys Leu Leu Tyr Ile Phe
210 215 220
Lys Gln Pro Phe Met Arg Pro Val Gln Thr Thr Gln Glu Glu Asp Gly
225 230 235 240
Cys Ser Cys Arg Phe Pro Glu Glu Glu Glu Gly Gly Cys Glu Leu
245 250 255
<210>
12
<211> 7
27
<212> T
PR
<213> mo
Ho Sapiens
<400>
12
MetCys ValGly AlaArgArg LeuGlyArgGly ProCysAla AlaLeu
1 5 10 15
LeuLeu LeuGly LeuGlyLeu SerThrValThr GlyLeuHis CysVal
20 25 30
GlyAsp ThrTyr ProSerAsn AspArgCysCys HisGluCys ArgPro
35 40 45
GlyAsn GlyMet ValSerArg CysSerArgSer GlnAsnThr ValCys
50 55 60
ArgPro CysGly ProGlyPhe TyrAsnAspVal ValSerSer LysPro
65 70 75 80
CysLys ProCys ThrTrpCys AsnLeuArgSer GlySerGlu ArgLys
85 90 95
GlnLeu CysThr AlaThrGln AspThrValCys ArgCysArg AlaGly
100 105 110
ThrGln ProLeu AspSerTyr LysProGlyVal AspCysAla ProCys
115 120 125
ProPro GlyHis PheSerPro GlyAspAsnGln AlaCysLys ProTrp
130 135 140
ThrAsn CysThr LeuAlaGly LysHisThrLeu GlnProA1a SerAsn
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-16-
145 150 155 160
Ser Ser Asp Ala Ile Cys Glu Asp Arg Asp Pro Pro Ala Thr Gln Pro
165 170 175
Gln Glu Thr Gln Gly Pro Pro Ala Arg Pro Ile Thr Val Gln Pro Thr
180 185 190
Glu Ala Trp Pro Arg Thr Ser Gln Gly Pro Ser Thr Arg Pro Val Glu
195 200 205
Val Pro Gly Gly Arg Ala Val Ala Ala Ile Leu Gly Leu Gly Leu Val
210 215 220
Leu Gly Leu Leu Gly Pro Leu Ala Ile Leu Leu Ala Leu Tyr Leu Leu
225 230 235 240
Arg Arg Asp Gln Arg Leu Pro Pro Asp Ala His Lys Pro Pro Gly Gly
295 250 255
Gly Ser Phe Arg Thr Pro Ile Gln Glu Glu Gln Ala Asp Ala His Ser
260 265 270
Thr Leu Ala Lys Ile
275
<210> 13
<211> 349
<212> PRT
<213> Homo sapiens
<400> 13
Met Lys Ser Val Leu Tyr Leu Tyr Ile Leu Phe Leu Ser Cys Ile Ile
1 5 10 15
Ile Asn Gly Arg Asp Ala Ala Pro Tyr Thr Pro Pro Asn Gly Lys Cys
20 25 30
Lys Asp Thr Glu Tyr Lys Arg His Asn Leu Cys Cys Leu Ser Cys Pro
35 40 45
Pro Gly Thr Tyr A1a Ser Arg Leu Cys Asp Ser Lys Thr Asn Thr Gln
50 55 60
Cys Thr Pro Cys Gly Ser Gly Thr Phe Thr Ser Arg Asn Asn His Leu
65 70 75 80
Pro Ala Cys Leu Ser Cys Asn Gly Arg Cys Asn Ser Asn Gln Va1 Glu
85 90 95
Thr Arg Ser Cys Asn Thr Thr His Asn Arg Ile Cys Glu Cys Ser Pro
100 105 110
Gly Tyr Tyr Cys Leu Leu Lys Gly Ser Ser Gly Cys Lys Ala Cys Val
115 120 125
Ser Gln Thr Lys Cys Gly Ile Gly Tyr Gly Val Ser Gly His Thr Ser
130 135 140
Val Gly Asp Val Ile Cys Ser Pro Cys Gly Phe Gly Thr Tyr Ser His
145 150 155 160
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-17-
Thr Val Ser Ser Ala Asp Lys Cys Glu Pro Val Pro Asn Asn Thr Phe
165 170 175
Asn Tyr Ile Asp Val Glu Ile Thr Leu Tyr Pro Val Asn Asp Thr Ser
180 185 190
Cys Thr Arg Thr Thr Thr Thr Gly Leu Ser Glu Ser Ile Leu Thr Ser
195 200 205
Glu Leu Thr I1e Thr Met Asn His Thr Asp Cys Asn Pro Val Phe Arg
210 215 220
Glu Glu Tyr Phe Ser Val Leu Asn Lys Val Ala Thr Ser Gly Phe Phe
225 230 235 240
Thr Gly Glu Asn Arg Tyr Gln Asn Ile Ser Lys Val Cys Thr Leu Asn
245 250 255
Phe Glu Ile Lys Cys Asn Asn Lys Gly Ser Ser Phe Lys G1n Leu Thr
260 265 270
Lys Ala Lys Asn Asp Asp Gly Met Met Ser His Ser Glu Thr Val Thr
275 280 285
Leu Ala Gly Asp Cys Leu Ser Ser Val Asp Ile Tyr Ile Leu Tyr Ser
290 295 300
Asn Thr Asn Ala Gln Asp Tyr Glu Thr Asp Thr Ile Ser Tyr Arg Val
305 310 315 320
Gly Asn Val Leu Asp Asp Asp Ser His Met Pro Gly Ser Cys Asn Ile
325 330 335
His Lys Pro Ile Thr Asn Ser Lys Pro Thr Arg Phe Leu
340 345
<210>
14
<211> 5
35
<212> T
PR
<213> mo
Ho sapiens
<400>
14
Met SerTyr IleLeuLeu LeuLeuLeu SerCysIleIle IleIle
Lys
1 5 10 15
Asn AspIle ThrProHis GluProSer AsnGlyLysCys LysAsp
Ser
20 25 30
Asn TyrLys ArgHisHis LeuCysCys LeuSerCysPro ProGly
Glu
35 40 45
Thr AlaSer ArgLeuCys AspSerLys ThrAsnThrAsn ThrGln
Tyr
50 55 60
Cys ProCys AlaSerAsp ThrPheThr SerArgAsnAsn HisLeu
Thr
65 70 75 80
Pro CysLeu SerCysAsn GlyArgCys AspSerAsnGln ValGlu
Ala
85 90 95
Thr SerCys AsnThrThr HisAsnArg IleCysAspCys AlaPro
Arg
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-18-
100 105 110
Gly Tyr Tyr Cys Phe Leu Lys Gly Ser Ser Gly Cys Lys Ala Cys Val
115 120 125
Ser Gln Thr Lys Cys Gly Ile Gly Tyr Gly Val Ser Gly His Thr Pro
130 135 140
Thr Gly Asp Val Val Cys Ser Pro Cys Gly Leu Gly Thr Tyr Ser His
145 150 155 160
Thr Val Ser Ser Val Asp Lys Cys Glu Pro Val Pro Ser Asn Thr Phe
165 170 175
Asn Tyr Ile Asp Val Glu Ile Asn Leu Tyr Pro Val Asn Asp Thr Ser
180 185 190
Cys Thr Arg Thr Thr Thr Thr Gly Leu Ser Glu Ser Ile Ser Thr Ser
195 200 205
Glu Leu Thr Ile Thr Met Asn His Lys Asp Cys Asp Pro Val Phe Arg
210 215 220
Asn Gly Tyr Phe Ser Val Leu Asn Glu Val Ala Thr Ser Gly Phe Phe
225 230 235 240
Thr Gly Gln Asn Arg Tyr Gln Asn Ile Ser Lys Val Cys Thr Leu Asn
245 250 255
Phe Glu Ile Lys Cys Asn Asn Lys Asp Ser Tyr Ser Ser Ser Lys Gln
260 265 270
Leu Thr Lys Thr Lys Asn Asp Asp Asp Ser Ile Met Pro His Ser Glu
275 280 285
Ser Val Thr Leu Val Gly Asp Cys Leu Ser Ser Val Asp Ile Tyr Ile
290 295 300
Leu Tyr Ser Asn Thr Asn Thr Gln Asp Tyr Glu Thr Asp Thr Ile Ser
305 310 315 320
Tyr His Val Gly Asn Val Leu Asp Val Asp Ser His Met Pro Gly Arg
325 330 335
Cys Asp Thr His Lys Leu Ile Thr Asn Ser Asn Ser Gln Tyr Pro Thr
340 345 350
His Phe Leu
355
<210> 15
<211> 506
<212> DNA
<213> Homo Sapiens
<400> 15
gaattcggca nagcctctcc acgcgcagaa ctcagccaac gatttctgat agatttttgg 60
gagtttgacc agagatgcaa ggggtgaagg agcgcttcct accgttagga actctgggga 120
cagnncgccc cggccgcctg atggccgagg cagggtgcga cccaggaccc aggacggcgt 180
cgggaaccat accatggccc ggatccccaa gaccctaaag ttcgtggtcg tcatcgtcgc 240
ggtcctgctg ccagtcctag cttactctgc caccactgcc cggcagagga agttncccag 300
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-19-
cagncantgg ncccacagca acagnggcac agtttcaagg gggnaggagt tttccancaa 360
gtttttatag ttcagaacnt attggngctn tnaacccttg cacaagggtt tggnttaaac 420
caangtttcc aanatgnact ttttngttcc ctgttanatt ttttaattag ttnaanttaa 480
atttntnaac cttnccnggg naaatt 506
<210> 16
<211> 325
<212> DNA
<213> Homo sapiens
<400> 16
ggcagaggtg tctccagcct ggctctatct tcctccttgt natcgtccca tccccacatc 60
ccgtgcaccc cccaggaccc tggtctcatc agtccctctc ctggagctgg gggtccacac 120
atctcccagc caagtccaag agggcagggc cagttcctcc catcttcagg cccagccagg 180
cagggggcag tcggctcctc aactgggtga caagggtgag gatgagaagt ggtcacgggg 240
atttattcag ccttggtcag agcagaacac agatttttcc gtgtgttggt ttttactctn 300
nttccccttc ttnatncccc tttcn 325
<210> 17
<211> 340
<212> DNA
<213> Homo Sapiens
<400> 17
ggcagaggcc ccagctgctg aagagacaat aatcaccagc ccggggactc ctgnntctnc 60
tnattacctc tnatgcacca tcgtagggat catagttcta attgtgcctt ctaattgttt 120
ttgtttgaaa aganttcact gtggaagaaa ttccttcctt acctgtaagt tncaggtagg 180
ngcctggctg agggcggggg gcgctggtac actctctgac cctgcctccc tctgnctgtt 240
ttcccacaga cagaaacgcc tgcccctgnc cccaagttcc tngtgttttc cagcctggct 300
ctatcttnnc tccttgtgaa tcgttcccat ccccacangc 340
<210> 18
<211> 241
<212> DNA
<213> Homo Sapiens
<400> 18
ccagggtctc ctnccccacc tgctgaagag acantgacca ccagcccggg gactcctgcc 60
tcttcctcat tacctctnat gnancatcgt agggatcata gttctaattg tgccttctga 120
attgtgcttt gtttggaaag acttcactgt gggaagaaat tccttcctta cctgaagttg 180
caggtaggcc ctgggtnagg gcgnggggcg ctggacantn tctggncctg gctgcccgct 240
g 241
<210> 19
<211> 27
<212> DNA
<213> Homo sapiens
<400> 19
cgcggatcca ccactgcccg gcaggag 27
<210> 20
<211> 30
<212> DNA
<213> Artificial Sequence
<220>
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-20-
<223> Description of Artificial Sequence: DNA Primer
<400> 20
gcgtctagac tagtaatgag aagaggcagg 30
<210> 21
<211> 35
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: DNA Primer
<400> 21
cgctctagac cgccatcatg gcccggatcc ccaag 35
<210> 22
<211> 30
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: DNA Primer
<400> 22
gcgtctagac tagtaatgag aagaggcagg 30
<210> 23
<211> 34
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: DNA Primer
<400> 23
cgcgaattcc gccatcatgg cccggatccc caag 34
<210> 24
<211> 27
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: DNA Primer
<400> 24
gcgtctagag taatgagaag aggcagg 27
<210> 25
<211> 35
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: DNA Primer
CA 02374674 2001-11-20
WO 00/71150 PCT/US00/13515
-21-
<400> 25
cgctctagac cgccatcatg gcccggatcc ccaag 35
<210> 26
<211> 30
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: DNA Primer
<400> 26
gcgtctagac tagtaatgag aagaggcagg 30
<210> 27
<211> 733
<212> DNA
<213> Homo Sapiens
<400> 27
gggatccgga gcccaaatct tctgacaaaa ctcacacatg cccaccgtgc ccagcacctg 60
aattcgaggg tgcaccgtca gtcttcctct tccccccaaa acccaaggac accctcatga 120
tctcccggac tcctgaggtc acatgcgtgg tggtggacgt aagccacgaa gaccctgagg 180
tcaagttcaa ctggtacgtg gacggcgtgg aggtgcataa tgccaagaca aagccgcggg 240
aggagcagta caacagcacg taccgtgtgg tcagcgtcct caccgtcctg caccaggact 300
ggctgaatgg caaggagtac aagtgcaagg tctccaacaa agccctccca acccccatcg 360
agaaaaccat ctccaaagcc aaagggcagc cccgagaacc acaggtgtac accctgcccc 420
catcccggga tgagctgacc aagaaccagg tcagcctgac ctgcctggtc aaaggcttct 480
atccaagcga catcgccgtg gagtgggaga gcaatgggca gccggagaac aactacaaga 540
ccacgcctcc cgtgctggac tccgacggct ccttcttcct ctacagcaag ctcaccgtgg 600
acaagagcag gtggcagcag gggaacgtct tctcatgctc cgtgatgcat gaggctctgc 660
acaaccacta cacgcagaag agcctctccc tgtctccggg taaatgagtg cgacggccgc 720
gactctagag gat 733
