Note: Descriptions are shown in the official language in which they were submitted.
CA 02374938 2001-11-22
WO 00/71139 PCT/CA00/00611
LACTQBACILLU$ COMPOSITIONS AND bIETHODS FOR PREV'SNTING
W_O_UND INFECTIONS AND HIOFILM FORD~TION pN I~dP~,AN2'AHLE
~tQRQIC~IL DEVICES
S This invention relates to probiotic
compositions and methods of employing said compositions
for treating and preventing wound infections and biofilm
formation on implantable surgical devices.
Wound infections represent a catchall category
for a group of diverse anatomic problems ranging from
superficial and cutaneous to infections involving tissue
and muscle invasion and foreign implants. Wound
infections are caused by accidental (e.g. burns) and
intentional (e.g. surgical) trauma, nosocomial
complications of surgery, hospitalization and insertion
of implants. Wound infections are also caused by
occupational and recreational activities. The infection-
causing organisms (e. g. bacteria, viruses, yeasts) come
from the patient, the hospital environment and a diverse
microbial biosphere. Infections associated with wounds
at the skin-material interface are particularly difficult
to prevent and treat.
The primary causes of wound infections are
Bacteroides sp., Enterococcus faecalis (vancomycin-
resistant - VRF are particularly problematic), S, aureus
(including methicillin-resistant - l~tSA), S. epidermidis
(including methicillin-resistant) - MRSE), Streptococcus
pyogenes, Clostridum sp, Escheri chia coli, Pseudomonas
aeruginosa, Klebsiella sp. Proteus sp, and
Peptostreptococcus sp. (Blatan, et al. (1996) "Ten Year
Experience with the use of ofloxacin in the treatment of
wound infection," Antibiotiki i Kh~.rnioterapiia; DiRosa,
et al. (1996) "Anaerobic bacteria in postsurgical
-:L-
CA 02374938 2001-11-22
WO 00/71139 PCT/CA00/00611
infections: isolation rate and antimicrobial
susceptibility," J. Chemother., 8:91-95; Mehta, et al.
(1996) "Contaminated wounds: infection rates with
subcutaneous sutures," Annals Emerg. Med., 27:43-48;
Mousa, (1997) "Aerobic, anaerobic and fungal burn wound
infections," J. Hosp. Infect., 37:317-323; Shinigawa, et
al. (1997) "Bacteria isolated from surgical infections
and their susceptibilities to antimicrobial agents.
Special references to bacteria isolated between July
1995 and June 1996," Japanese J. Antibiotics, 50:143-
177; Emmerson (1998) "A microbiologist's view of factors
contributing to infection," New Horizons 6(2 Suppl.),
S3-10). Few studies have been undertaken to examine
bacterial growth and spread or to investigate the
infecting strains within biofilms.
The increasing emergence of multi-drug
resistant organisms reduces treatment options and places
the patient's life in danger. In 1992, Harold Neu wrote
in Science, 257:1064-1073 about "The crisis in antibiotic
resistance". Since then, studies have further shown that
antibiotic resistance is on the increase. This is
epitomized by two extreme examples: the finding of
massive increases in E. coli resistance to
trimethoprim/sulfamethoxazole, the most commonly
prescribed antibiotic against simple urinary tract
infection, (see Reid G., et al. (1997) "Drug resistance
amongst uropathogens isolated from women in a suburban
population: laboratory findings over 7 years," Can. J.
Urol, 4:432-437; Gupta K., et al. (1999) "Increasing
prevalence of antimicrobial resistance among uropathogens
causing acute uncomplicated cystitis in women", JAMA
281:736-738) and in the isolation of a new strain of
-2-
SUBSTITh'TE SHEET (RULE26)
CA 02374938 2001-11-22
WO 00/71139 PCT/CA00/00611
multi-drug resistant S. aureus, containing methicillin
and vancomycin resistance genes. The latter strain
represents a "superbug" capable of causing severe
morbidity and death amongst patients with wounds.
Microbial biofilms, defined as an accumulation
of microorganisms and connecting extracellular products
on a surface or to each other at some distance away from
a surface, (see Costerton GD, et al. (1989), "Microbial
and foreign body factors in the pathogenesis of medical
device infections In: Infections associated with
indwelling medical devices. Bisno AL, Waldvogel FA
(eds), ASM, Washington, pp. 27-59; Reid, et al. (1998),
Microbial biofilms and urinary tract infections, W.
Bromfitt, T. Hamilton-Miller and R.R. Bailey (eds),
Chapman and Hall, London, pp. 111-118) have been found
extensively in nature and in the environment in places
ranging from food fermentors to oil well drilling pipes,
ship hulls. Microbial biofilms are commonly associated
with human disease.
For biofilms associated with infectious
diseases, accurate prevalence and incidence figures are
not available. However, microbial biofilms have been
associated with many conditions including dental plaque,
upper respiratory infections, peritonitis, urogenital
infections, and diseases associated with surgically
implanted medical devices. Dankert et al., (1986),
"Biomedical polymers: bacterial adhesion, colonization,
and infection," CRC Crit. Rev. Biocompat., 2:219-301;
Costerton, et al. (1987), "Bacterial biofilms in nature
and disease", Ann. Rev. Microbiol., 41:435-464; Bisno, et
al., (1989), "Infections associated with indwelling
medical devices. (eds), ASM, Washington, pp. 3-26; Blake,
-3-
SUBSTITUTE SHEET (RULE26)
CA 02374938 2001-11-22
WO 00/71139 PCT/CA00/00611
et al. (1989), "Aggregation by fragilis and non-fragilis
bacteroides strains, J. Med. Microbiol., 28: 9-14;
Kowalewska-Grochowska, et al. (1991), "Guidewire catheter
change in central venous catheter biofilm formation in a
burn population", Chest, 100:1090-1095; Elliott, et al.
(1992), "Infections and intravascular devices, British J.
Hospital Med., 48:496-503; Bos, et al. (1996), "Co-
adhesion of oral microbial pairs under flow in the
presence of saliva and lactose, J. Dent. Res., 75:809-
815; Reid, et al., (1998), "Microbial biofilms and
urinary tract infections", In, Urinary tract infections,
W. Brumfitt, T. Hamilton-Miller, and R.R. Bailey (eds),
Chapman and Hall, London, pp. 111-118. Microbial biofilms
have also been associated with a total artificial heart.
(Jarvik, (1981), "The total artificial heart, Sci. Am.,
244 : 74 ) .
Surgically implanted medical devices, such as
heart valves and artificial veins and joints, are
especially vulnerable to microbial biofilm formation and
disease. Gristina, (1987), "Biomaterial-centered
infection: microbial adhesion versus tissue integration",
Science, 237:1588-1595. The surfaces of such devices are
not protected by host defenses and thus provide a focal
point for infecting pathogens. Closed implants are
frequently associated with life-threatening infections,
with Staphylococcus epidermidis and S. aureus
constituting the major pathogenic force, Costerton, et
al. (1989), supra.
When such organisms exist as biofilms, as is
the case in 80~ of all infections and 850,000 catheter-
associated infections in North America each year,
treatment is extremely difficult. Few studies have been
-4-
SUBSTITUTE SHEET (RL'LE26)
CA 02374938 2001-11-22
WO 00/71139 PCT/CA00/00611
undertaken to examine bacterial growth and spread or to
investigate effective methods to prevent, treat or
otherwise reduce the occurrence of infecting strains
within biofilms.
Surgical infections are a great source of human
morbidity and mortality. Clinical studies have shown
that, under optimal circumstances, the surgical infection
rate in clean wounds (i.e., Class 1 wounds) may be as low
as 0.01 ~. This percentage however, rapidly increases
with increasing contamination of the surgical site. This
is particularly true when the surgical site is
complicated by the implantation of a surgical device such
an osteosynthesis plate or soft tissue alloplast
augmentation. In the absence of appropriate autogenous
materials to achieve the surgical goal of restoring
normal anatomical relationships and physiologic
functioning, surgeons are increasingly forced to use
alloplastic implant material to support increasingly
complicated organism trauma.
To combat the significant infectious
complication rates associated with the use of surgical
implants, several strategies have been employed. Thus
far, these have been mainly limited to: improved surgical
techniques; improved regimens of administering peri-
operative systemic antibiotics; local antibiotic
irrigation procedures; modified surface characteristics
of surgical implants; and impregnating surgical implants
with antibiotics.
Despite such strategies, little progress has
been made to effectively prevent, treat or reduce the
occurrence of wound infections and infections resulting
from surgical implantation of medical devices.
-S-
SUBSTITUTE SHEET (RULE26)
CA 02374938 2001-11-22
WO 00/71139 PCT/CA00/00611
Current citations in the literature utilize traditional
methods of management, such as use of antibiotics,
antiseptics and/or surgical debridement. Such methods
have failed to impact infection and fatality rates.
S We have shown previously that non-pathogenic
bacteria cannot only prevent pathogenic colonization of
tissues and biomaterials, but also displace these
organisms. Millsap, et al., (1994), "Adhesion and
displacement of Enterococcus faecalis by Lactobacillus
l0 and Streptococcus sp. from hydrophobic and hydrophilic
substrata as studies in a parallel plate flow chamber.
Ap~l. Environ. Microbiol. 60:1867-1874; Velraeds, et al.
(1996), "Inhibition of initial adhesion of uropathogenic
Enterococcus faecalis by biosurfactants from
l5 Lactobacillus isolates" Appl. Environ. Microbiol,
62:1958-1963; Velraeds MC, et al. (1998), "Interference
in initial adhesion of uropathogenic bacteria and yeasts
silicone rubber by a Lactobacillus acidophilus
biosurfactant" J. Med. Microbiol. 49:790-794. The
?0 artificial implantation of such non-pathogens is referred
to as probiotics. Lactobacillus bacteria are found in the
intestine and urogenital tract where they are part of the
normal, healthy flora: they represent one example of
probiotics. The use of other organisms, such as avirulent
?5 skin flora, such as staphylococci, can also be applied to
reduce the risk of wound infections.
In Western and Asian society per se and
clinical practice specifically, there is a slow but
definite trend emerging towards the avoidance, where
30 possible, of antibiotics and the use of naturally
occurring substances for disease prevention. Studies
have shown that lactobacilli not only inhibit pathogen
-6-
SUBSTITUTE SHEET (RULE26)
CA 02374938 2001-11-22
WO 00/71139 PCT/CA00/00611
colonization and binding to cells and materials, but also
displace these pathogens. The present invention applies
this knowledge to a new area, namely the site of wounds,
where the environment involves skin, implanted devices
such as drainage tubes, hip joints, catheters, lines, and
other prostheses.
The present invention provides methods and
compositions for the use of Lactobacillus and associated
by products including biosurfactants, avirulent
l0 staphylococci and other probiotic organisms, to prevent,
treat, inhibit or reduce the risk of infections around
wounds and at the site of implants. The present
invention demonstrates that lactobacilli with
antagonistic properties against pathogens provide
f5 protection against infection when applied topically or
after oral intake.
In the practice of the compositions and methods
of the present invention, the Lactobacillus may be
administered as viable whole cells. The Lactobacillus
'0 species may be aerobically grown or microaerophilically
grown and selected from Lactobacillus casei, L.
acidophilus, L. plantarum, L. fermentum, L. brevis, L.
jensenii, L. crispatus, L. rhamnosus, L. reuteri, L.
paracasei, L. gasseri, L. cellobiosis, L. delbruckii, L.
a5 helveticus, L. salvarius, L. collinoides, L. buchneri, L.
rogosae and L. bifidium.
The present invention provides a method for
inhibiting the occurrence of wound infections in a mammal
by administration of a probiotic organism. In a preferred
SO embodiment the probiotic organism is a Lactobacillus. In
a most preferred embodiment, the Lactobacillus species
SUBSTITUTE SHEET (RULE26)
CA 02374938 2001-11-22
WO 00/71139 PCT/CA00/00611
are L. rhamnosus GR-1, L. fermentum RC-14 and L.
fermentum B-54.
In another embodiment, the present invention
provides a method for inhibiting the occurrence of wound
infections in a mammal in need of such treatment by
administration of Lactobacillus and a prebiotic compound.
In another embodiment, the present invention
describes a method for inhibiting or reducing the
occurrence of biofilm formation in a mammal by coating at
least part of a surgically implantable device with a
therapeutically effective amount of a probiotic organism
or a by product thereof including biosurfactant. In a
preferred embodiment the probiotic organism is a
Lactobacillus. In a most preferred embodiment, the
Lactobacillus species are L. rhamnosus GR-1, L. fermentum
RC-14 and L. fermentum B-54.
In still another embodiment the present
invention provides a pharmaceutical composition suitable
for inhibiting the occurrence of wound infections in
mammals which comprises a therapeutically effective
amount of a probiotic organism and a pharmaceutically
acceptable carrier. In a preferred embodiment the
probiotic organism is a Lactobacillus. In a most
preferred embodiment, the Lactobacillus species are L.
rhamnosus GR-1, L. fermentum RC-14 and L. fermentum B-54.
Figure 1A is a bar graph showing the effect of
L. fermentum RC-14 on surgical implant infection in
Sprague Dawley rats. Surgical implants removed from RC-14
treated rats (see Table 2) were rinsed in PBS and then
briefly sonicated (30 sec) to recover implant associated
bacteria. PBS diluted bacterial suspensions (10 -3) were
then plated onto MRS agar plates and incubated overnight
_g_
SUBSTITfTE SHEET (RULE26)
CA 02374938 2001-11-22
WO 00/71139 PCT/CA00/00611
at 37°C in an anaerobic (5% COZ) bacterial chamber.
Colonies were then scored for each of the 7 groups of
inoculated rats (9 rats/group).
Figure 1B is a bar graph showing the effect of
L. rhamnosus GR-1 on surgical implant infection in
Sprague Dawley rats. Surgical implants removed from GR-1
treated rats (see Table 2) were rinsed in PBS and then
briefly sonicated (30 sec) to recover implant associated
bacteria. PBS diluted bacterial suspensions (10 -3) were
then plated onto MRS agar plates and incubated overnight
at 37°C in an anaerobic (5% CO~) bacterial chamber.
Colonies were then scored for each of the 7 groups of
inoculated rats (9 rats/group).
Figure 2 is a surface enhanced laser
desorption/ionization (SELDI) mass profile of
lactobacillus expression of collagen binding proteins in
Lactobacillus acidophilus RC-14; L.rhamnosus GR-1 and L.
rhamnosus 36W.
Figure 3 is a SELDI mass profile of
ZO lactobacillus expression of collagen binding proteins in
Lactobacillus acidophilus RC-14 using protein chip
PS-1/CN-III.
Figure 4 is a bar graph illustrating dose
dependant S. aureus rates and associated S. aureus
ZS surgical implant colony forming units (CFUs). Silicone
implants (lcm ') placed within a surgically subcutaneous
pocket located on the dorsum of male rats (Sprague
Dawley, 300gm) were inoculated with the indicated number
of colony forming units (CFUs) of S. aureus. Animals were
30 sacrificed 3 days later. Acute infection rates were
scored and the number of S. aureus [CFUs] per implant
-9-
SUBSTITUTE SHEET (RULE26)
CA 02374938 2001-11-22
WO 00/71139 PCT/CA00/00611
determined. The 50% infectious dose (IDso) for S. aureus
in this in vivo model was determined to be -7x10 6 CFUs.
Figure 5A is a bar graph illustrating the
effect of co-inoculation of S. aureus (IDso%) and L.
fermentum RC-14 on the incidence of surgical implant
infection in Sprague-Dawley rats. Surgical implants were
recovered from rats co-inoculated with S. aureus [ID50]
and the indicated number of RC-14 CFUs 3 days after
surgery (see Table 2). Implants were rinsed in PBS and
then briefly sonicated (30 sec) to recover implant
associated bacteria. The indicated dilutions of the
implant associated bacterial suspensions were then plated
on either MRS (RC-14) or BH agar (S. aureus) plates and
incubated overnight at 37°C. MRS plates were incubated in
IS a specific anaerobic (5% CO~) chamber. Colonies were then
scored for each of the indicated co-inoculated groups of
rats (9 rats/group).
Figure 5B depicts the results of PCR-based
identification of implant associated RC-14 CFUs from S.
aureus and RC-14 co-inoculated rats. Surgical implant
associated L. fermentum RC-14 CFUs were positively
identified using RC-14 specific primers that were
designed to amplify a specific portion (-l0obp) of the
16S-23S rDNA intergenic spacer region. To control for the
possibility that the RC-14 scored CFUs are S. aureus
positive PCR was performed on genomic DNA extracted from
several single MRS colonies using both S. aureus and RC-
14 specific primers. PCR identification of the S. aureus
species was performed using Staphylococcus specific 165-
23S rDNA intergenic spacer primers (Mendoza et a1. (1998)
International Journal of Systematic Bacteriology 48:1049-
-10-
SUBSTITUTE SHEET (RULE26)
CA 02374938 2001-11-22
WO 00/71139 PCT/CA00/00611
1055, incorporated herein by reference). ND* = no DNA
(negative control reaction), M = 1 Kb DNA ladder marker.
Figure 5C depicts the results of PCR-based
identification of implant associated S. aureus CFUs from
S. aureus and RC-14 co-inoculated rats. Surgical implant
associated S. aureus CFUs were positively identified
using Staphylococcus specific 16S-23S rDNA intergenic
spacer primers (see Mendoza et a1. International Journal
of Systematic Bacteriology 48:1049-1055, 1998, supra). To
control for the possibility that the S. aureus scored
CFUs were also RC-14 positive, PCR was performed on
genomic DNA extracted from single BH-agar colonies using
both S. aureus and RC-14 specific primers. M = 1 Kb DNA
ladder marker.
Figure 6 is a bar graph showing the effect of
Biosurfactants (BSF) isolated from probiotic strain L.
fermentum RC-14 on S. aureus [ID50] induced surgical
implant infection in rats. Silicone implants (lcm 2)
were pretreated (12 hrs, 4°C) with L. fermentum RC-14 BSF
(1 mg/ml) prior to surgical placement in the animals as
described above. The surgical site containing the
silicone implant was then co-inoculated with S. aureus
[ID50] and 100 mg of L. fermentum RC-14 BSF,
respectively. Animals were sacrificed 3 days after
surgery. Acute surgical infection was scored and the
number of surgical implant associated S. aureus CFUs
determined, as described above. **P < 0.004
Figure 7 is a bar graph showing the effect of
p29 collagen binding protein (p29CnB) on S. aureus
[ID100] induced surgical implant infection in rats.
Silicone implants (lcm ~) were pretreated (12 hrs, 4°C)
with recombinant p29CnB (His-tag) or BSA (1 mg/ml) prior
-11-
SUBSTITUTE SHEET (RULE26)
CA 02374938 2001-11-22
WO 00/71139 PCT/CA00/00611
to surgical placement in the animals as described above.
The surgical site containing the silicone implants were
then co-inoculated with 106 CFUs of S. aureus [ID100] and
either 100 mg of p29CnB or BSA (negative control),
respectively. Animals were sacrificed 3 days after
surgery. Acute surgical infection was scored and wound
tissue and implants collected for further analysis.** P <
0.05 (Infection rate and Implant S. aureus CFUs).
The present invention provides methods for the
inhibition of wound infections of mammals including
humans which comprises administering a therapeutically
effective amount of a probiotic organism or a by product
thereof to a wound infection site and/or a biocompatible
medical device. By "inhibition" is meant treating or
reducing the occurrence of wound infections with the
probiotic organisms of the present invention. By "by
product" is meant biosurfactants, anti-adhesion molecules
and immune modulators which exhibit the infection-
inhibiting activity of probiotics.
The artificial implantation of non-pathogenic
probiotics provides novel intervention strategies that
reduce the risk of infections around wounds and other
surgical sites. The adherence of these strains and their
expression of antagonistic activity against pathogens,
i.e., against adhesion, growth or ability to dominate the
flora, are critical factors in competition. Such
microbial competition and interference takes place at
certain wound locations such as on the skin, in the oral
and gastrointestinal (GI) tract and the genito-urinary
tract .
By "probiotic" is meant an organism which has
one or more of the following characteristics, an ability
-12-
SUBSTITUTE SHEET (RL'LE26)
CA 02374938 2001-11-22
WO 00/71139 PCT/CA00/00611
to facilitate or enhance wound healing comprising an
ability to: adhere to epidermal or epithelial cells by
electrostatic, hydrophobic or specific adhesins including
a collagen binding protein; pass through the stomach and
reach the small and large intestine; grow and persist in
the gastrointestinal, urogenital tracts and at a wound
surface interfaces; inhibit the adhesion of wound-
associated pathogens including organisms which cause
infection; coaggregate; produce acid and other substances
such as hydrogen peroxide and/or bacteriocins and
bacteriocin-like compounds which inhibit pathogen growth;
produce biosurfactant or related by-products of growth
which interfere with adhesion of pathogens to cells and
materials; resist antimicrobial agents; and/or enhance
the host's immune function to further inhibit pathogen
growth. A preferred probiotic bacteria is one or more
species of lactobacillus or by-products thereof such as
proteins or peptides or amino acids as identified using
SELDI methodology.
Separation and detection of biosurfactants
produced by lactobacilli may be preferably accomplished
by the SELDI technique (Surface Enhanced Laser
desorption/ionization). By "SELDI system" is meant a
method which uses protein chips which contain chemically
or biologically treated surfaces that specifically
interact with or bind the proteins of interest. The
protein chips are inserted into a reader which provides
an accurate mass profile of the proteins bound to each
chip in just a few minutes. A most preferred probiotic
lactobacillus species is L. fermentum RC-14. Another
preferred lactobacillus species is L. rhamnosus GR-1.
-13-
SUBSTITUTE SHEET (RULE26)
CA 02374938 2001-11-22
WO 00/71139 PCT/CA00/00611
Still another preferred lactobacillus species is
L.fermentum B-54.
The preferred strains of lactobacilli within
the scope of this invention are anaerobic and
S microaerophilic isolates.
By "biosurfactant" is meant a biological
substance, for example a protein or peptide, produced by
a lactobacillus having a molecular weight of about 5 kd
to about 100 kd which inhibits the binding of pathogenic
bacteria to surfaces. Components of the biosurfactant
can stimulate immune defenses of a host to promote the
reduction and prevention of wound infections. The
preferred lactobacillus by-product is a biosurfactant
having a molecular weight of about 8 kd to about 90 kd.
By "anti-adhesin" is meant a biological
substance which inhibits, reduces or prevents adhesion of
pathogenic bacteria to surfaces.
By "prebiotic" is meant a nonmetabolized,
nonabsorbed substrate that is useful for the host which
selectively enhances the growth and/or the metabolic
activity of a bacterium or a group of bacteria. A
prebiotic also includes a nutrient utilized by
lactobacilli to stimulate and/or enhance growth of
lactobacilli relative to pathogenic bacteria.
By "infected wound" is meant an area of open
and inflamed epidermal tissue with detectable levels of
pathogens e.g., staphylococcus or candida, present. In
accordance with the present invention visual inspection
of a wound can accurately determine indicia of infection,
including but not limited to, inflammation, discharge,
the patient's subjective pain assessments, bleeding, and
presence of dead cells, for example.
-14-
SUBSTITUTE SHEET (RULE26)
CA 02374938 2001-11-22
WO 00/71139 PCT/CA00/00611
In accordance with the present invention a
"biofilm" means an accumulation of microorganisms and
connecting extracellular products on a surface or to each
other at some distance away from a surface.
Also defined within the present invention are
compositions suitable for inhibiting wound infections of
mammals including humans which comprise one or more
lactobacillus viable whole cells, non-viable whole cells
or cell wall fragments and a pharmaceutically acceptable
carrier.
In a preferred aspect, the lactobacillus is
aerobically, microaerophilically or anaerobically grown
and may be selected from the group consisting of
Lactobacillus casei, L. acidophilus, L. plantarum, L.
fermentum, L. brevis, L. jensenii, L. crispatus, L.
rhamnosus, L.reuteri, L. paracasei, L. gasseri, L.
cellobiosis, L. delbruckii, L. helveticus, L. sat varius,
L. collinoides, L. buchneri, L. rogosae and L. bifidium.
The lactobacillus may be microaerophilically or
anaerobically grown and selected from the group
consisting of Lactobacillus casei var rhamnosus (GR-1
(ATCC 55826), L. casei var rhamnosus GR-2 (ATCC 55915),
L. casei var rhamnosus GR-3 (ATCC 55917), L. casei var
rhamnosus GR-4 (ATCC 55916), L. casei var rhamnosus RC-9,
L. casei var rhamnosus RC-17 (ATCC 55825), L. casei var
alactosus RC-21, L. casei NRC 430, L. casei ATCC 7469, L.
casei var rhamnosus 81, L. casei var rhamnosus 76, L.
casei var rhamnosus 36W, L. casei var rhamnosus 36g, L.
casei RC-65, L. casei RC-15, L. casei 558, L. casei, RC-
21, L. casei 55, L. casei 8, L. casei 43, L. plantarum
RC-12 (ATCC 55895), L. acidophilus RC-25, L. plantarum
RC-19, L. jensenii RC-11 (ATCC 55901), L. acidophilus
-15-
SUBSTITUTE SHEET (RULE26)
CA 02374938 2001-11-22
WO 00/71139 PCT/CA00/00611
ATCC 4357, L. acidophilus 2099B, L. acidophilus 2155C, L.
acidophilus T-13, L. acidophilus 1807B, L. acidophilus
RC-16, L. acidophilus RC-26, L. acidophilus RC-10, L.
acidophilus RC-24, L. acidophilus RC-13, L. acidophilus
RC-14, L. acidophilus RC-12, L. acidophilus RC-22, L.
acidophilus 2099B, L. acidophilus 2155C, L. acidophilus
T-13, L. plantarum ATCC 8014, L. plantarum LTH 2153, L.
plantarum 260, L. plantarum RC-20, L. plantarum 75, L.
plantarum RC-6, L. fermentum A-60, L. fermentum B-54
(ATCC 55920), L. cellobiosis RC-2, L. crispatus 1350B and
L. crispatus 2142B.
In another aspect of this invention, a
pharmaceutical composition is provided for inhibiting
wound infections in humans and lower animals which
comprises a therapeutically effective amount of one or
more of the aforementioned lactobacilli, together with a
pharmaceutically acceptable carrier.
Bacteria on surfaces, such as mucosal tissues
and skin, exist in biofilms and compete with other
organisms for space and nutrients.
The lactobacillus compositions of the present
invention at various doses (e. g., 103-10") significantly
reduce surgical implant infection caused by S. aureus,
staphylococci and candida by competitively excluding such
pathogens. Non-pathogenic organisms, such as viable or
non-viable lactobacilli, or their by-products such as
biosurfactants, anti-adhesins and immune modulators, are
applied to the wound surface interface or the
biocompatible device-host interface, to reduce the risk
of infecting pathogens colonizing and infecting the host.
The lactobacilli form a barrier to biofilm formation and
infection by organisms which infect the host, for
-16-
SUBSTITUTE SHEET (RULE26)
CA 02374938 2001-11-22
WO 00/71139 PCT/CA00/00611
example, opportunistic pathogens such as S. aureus.
Biosurfactants produced by lactobacilli
significantly inhibit the binding of pathogens to wound
sites. These biosurfactants contain carbohydrate and
proteinaceous compounds. Biochemical analysis using
PAGE, affinity chromatography, and amino acid sequencing
of biosurfactant produced by L. fermentum RC-14 evidences
a 26kD protein which binds to collagen. This protein,
and others which also bind to collagen, play a role in
,0 the colonization by lactobacilli at the wound surface
interface. This 26kD protein is also understood, in
accordance with the present invention to play an
important role in the protection of the heart against
urogenital pathogens. Moreover, this 26kD protein (known
l5 in accordance with the present invention as p29 or p26
collagen binding protein (p29CnB or p26CnB))
significantly decreases the implant infection rate caused
by S. aureus.
When more than 100,000 bacteria are present per
~0 cubic cm (per gram tissue), the killing capacity of the
host's while blood cells is diminished. To effectively
reduce and inhibit the occurrence of pathogenic bacteria
a dosage of 10' to about 1011 viable or non-viable
lactobacilli per ml, and optionally about 0.1 to about
?5 10~,g/ml of biosurfactant or other anti-adhesion molecule
is applied directly to the wound infection site on the
skin or device interface. This administration is
embodied in a suitable carrier, such as a cream, paste,
solution, hydrogel, liposome, for example. The treatment
i0 using the organisms is preferably administered in a
single dose. For curative treatment administration of
the compositions contemplated by the present invention is
-17-
SUBSTITUTE SHEET (RULE26)
CA 02374938 2001-11-22
WO 00/71139 PCT/CA00/00611
from about 1 to about 3 times daily to about 1 to about 3
times weekly depending upon the severity of the
infection.
The effect of the probiotic composition is
further enhanced by stimulating lactobacilli growth over
that of pathogens at a surface, using prebiotics, such as
a natural sugar, inulin, extracted from chicory roots and
found not to be metabolized by humans but to act as a
substrate for growth of lactobacilli, for example. (See
Roberfroid MB (1998) British J. Nutrition, 80 suppl.
2:S197-5202, incorporated herein by reference).
Although this invention is not intended to be
limited to any particular mode of application, topical,
intraveneous or oral administration of the compositions
are preferred. The compositions may be administered in
the form of a cream, liquid, paste, or gel as desired.
One preferred form is a cream formulation comprising one
or more lactobacillus viable whole cells, non-viable
whole cells or in a base that is non-toxic nor irritating
to the skin such as a hydrogel or liposome base. For
example, a contemplated cream formulation includes cocoa
butter. Another preferred form of application involves
the preparation of a freeze-dried capsule, taken orally
comprising the composition of the present invention. It
has been found that a capsule comprising about 103 to
about 101'probiotic organisms is suitable. In accordance
with the present invention a capsule may contain one
single or two or more different species of probiotic
organism(s).
By "therapeutically effective amount" as used
herein is meant an amount of a probiotic organism, e.g.,
Lactobacillus, high enough to significantly positively
-18-
SUBSTITUTE SHEET (RULE26)
CA 02374938 2001-11-22
WO 00/71139 PCT/CA00/00611
modify the condition to be treated but low enough to
avoid serious side effects (at a reasonable benefit/risk
ratio), within the scope of sound medical judgment. A
therapeutically effective amount of lactobacillus will
vary with the particular wound infection being treated,
the age and physical condition of the patient being
treated, the severity of the infection, the duration of
treatment, the nature of concurrent therapy and the
specific lactobacillus employed. The effective amount of
0 lactobacillus will thus be the minimum amount which will
provide the desired attachment to epithelial and
epidermal cells. The presence of about 103 to about 101'
bacteria, as viable or non-viable whole cells, in 0.05 ml
solution of phosphate buffered saline solution, or in
5 0.05 ml of suspension of broth, or the dry weight
equivalent of cell wall fragments, is effective when
administered in quantities of from about 0.05 ml to about
20 ml.
By "pharmaceutically-acceptable carrier" as
;0 used herein is meant one or more compatible solid or
liquid filler diluents, or encapsulating substances. By
"compatible" as used herein is meant that the components
of the composition are capable of being comingled without
interacting in a manner which would substantially
;5 decrease the pharmaceutical efficacy of the total
composition under ordinary use situations.
A decided practical advantage is that the
probiotic organism may be administered in a convenient
manner such as by the topical, oral, intravenous (where
.0 non-viable), or suppository (vaginal or rectal) routes.
Depending on the route of administration, the active
ingredients which comprise probiotic organisms may be
-19-
SUBSTITUTE SHEET (RULE26)
CA 02374938 2001-11-22
WO 00/71139 PCT/CA00/00611
required to be coated in a material to protect said
organisms from the action of enzymes, acids and other
natural conditions which may inactivate said organisms.
In order to administer probiotic organisms by other than
parenteral administration, they should be coated by, or
administered with, a material to prevent inactivation.
For example, probiotic organisms may be co-administered
with enzyme inhibitors or in liposomes. Enzyme
inhibitors include pancreatic trypsin inhibitor,
diisopropylfluorophosphate (DFP) and trasylol. Liposomes
include water-in-oil-in-water P40 emulsions as well as
conventional and specifically designed liposomes which
transport lactobacilli or their by-products to the
urogenital surface.
The probiotic organisms may also be
administered parenterally or intraperitoneally.
Dispersions can also be prepared, for example, in
glycerol, liquid polyethylene glycols, and mixtures
thereof, and in oils.
The pharmaceutical forms suitable for
injectable use include sterile aqueous solutions (where
water soluble) or dispersions and sterile powders for the
extemporaneous preparation of sterile injectable
solutions or dispersion. In all cases the form must be
sterile and must be fluid to the extent that easy
syringability exists. It must be stable under the
conditions of manufacture and storage. The carrier can be
a solvent or dispersion medium containing, for example,
water, ethanol, polyol (for example, glycerol, propylene
glycol, liquid polyethylene glycol, and the like),
suitable mixtures thereof and vegetable oils. The proper
fluidity can be maintained, for example, by the use of a
coating such as lecithin, by the maintenance of the
-20-
SUBSTITUTE SHEET (RULE26)
CA 02374938 2001-11-22
WO 00/71139 PCT/CA00/00611
required particle size in the case of dispersion. In many
cases it will be preferable to include isotonic agents,
for example, sugars or sodium chloride. Prolonged
absorption of the injectable compositions can be brought
about by the use in the compositions of agents delaying
absorption, for example, aluminum monostearate and
gelatin.
Sterile injectable solutions are prepared by
incorporating the probiotic organisms in the required
amount in the appropriate solvent with various of the
other ingredients enumerated above, as required, followed
by filtered sterilization. Generally, dispersions are
prepared by incorporating the various sterilized probiotic
organisms into a sterile vehicle which contains the basic
dispersion medium and the required other ingredients from
those enumerated above. In the case of sterile powders
for the preparation of sterile injectable solutions, the
preferred methods of preparation are vacuum-drying and the
freeze-drying technique which yield a powder of the active
ingredient plus any additional desired ingredient from
previously sterile-filtered solution thereof. Additional
preferred methods of preparation include but are not
limited to lyophilization and heat-drying.
When the probiotic organisms are suitably
protected as described above, the active compound may be
orally administered, for example, with an inert diluent or
with an assimilable edible carrier, or it may be enclosed
in hard or soft shell gelatin capsule, or it may be
compressed into tablets designed to pass through the
stomach (i.e., enteric coated), or it may be incorporated
directly with the food of the diet. For oral therapeutic
administration, the probiotic organisms may be
-21-
SUBSTITUTE SHEET (RULE26)
CA 02374938 2001-11-22
WO 00/71139 PCT/CA00/00611
incorporated with excipients and used in the form of
ingestible tablets, buccal tablets, troches, capsules,
elixirs, suspensions, syrups, wafers, and the like.
Compositions or preparations according to the present
invention are prepared so that an oral dosage unit form
contains about 103to about 1011 viable or non-viable e.g.,
lactobacilli per ml.
The tablets, troches, pills, capsules or
lactobacilli in suspension as described above, may also
contain the following: a binder such as gum tragacanth,
acacia, corn starch or gelatin; excipients such as
dicalcium phosphate; a disintegrating agent such as corn
starch, potato starch, alginic acid, and the like; a
lubricant such as magnesium stearate; and a sweetening
agent such as sucrose, lactose or saccharin may be added
or a flavoring agent such as peppermint, oil or
wintergreen or cherry flavoring. When
the dosage unit form is a capsule, it may contain, in
addition to materials of the above type, a liquid
carrier. Various other materials may be present as
coatings or to otherwise modify the physical form
of the dosage unit. For instance, tablets, pills or
capsules or lactobacilli in suspension may be coated with
shellac, sugar or both.
A syrup or elixir may contain the active
compound, sucrose as a sweetening agent, methyl and
propylparabens as preservatives, a dye and flavoring such
as cherry or orange flavor. Of course, any material used
in preparing any dosage unit form should be
~ pharmaceutically pure and substantially non-toxic in the
amounts employed. In addition, the probiotic organism may
-22-
SUBSTITUTE SHEET (RULE26)
CA 02374938 2001-11-22
WO 00/71139 PCT/CA00/00611
be incorporated into sustained-release preparations and
formulations.
It is especially advantageous to formulate
parenteral compositions in dosage unit form for ease of
administration and uniformity of dosage. Dosage unit form
as used herein refers to physically discrete units suited
as unitary dosages for the mammalian subjects to be
treated; each unit containing a predetermined quantity of
the probiotic organisms calculated to produce the desired
0 therapeutic effect in association with the required
pharmaceutical carrier. The specification for the novel
dosage unit forms of the invention are dictated by and
directly depending on (a) the unique characteristics of
the probiotic organism and the particular therapeutic
5 effect to be achieved, and (b) the limitations inherent in
the art of compounding such probiotic for the
establishment and maintenance of a healthy urogenital
flora .
The probiotic organism is compounded for
;0 convenient and effective administration in effective
amounts with a suitable pharmaceutically or food
acceptable carrier in dosage unit form as hereinbefore
disclosed. A unit dosage form can, for example, contain
the principal active compound in an amount approximating
'S 103 to about 1011 viable or non-viable lactobacilli, per
ml. In the case of compositions containing supplementary
ingredients such as prebiotics, the dosages are determined
by reference to the usual dose and manner of
administration of the said ingredients.
.0 The pharmaceutically acceptable carrier may be
in the form of milk or portions thereof including yogurt.
Skim milk, skim milk powder, non-milk or non-lactose
-23-
SUBSTITUTE SHEET (RULE26)
CA 02374938 2001-11-22
WO 00/71139 PCT/CA00/00611
containing products may also be employed. The skim milk
powder is conventionally suspended in phosphate buffered
saline (PBS), autoclaved or filtered to eradicate
proteinaceous and living contaminants, then freeze dried
heat dried, vacuum dried, or lyophilized.
Some other examples of substances which can
serve as pharmaceutical carriers are sugars, such as
lactose, glucose and sucrose; starches such as corn starch
and potato starch; cellulose and its derivatives such as
sodium carboxymethycellulose, ethylcellulose and cellulose
acetates; powdered tragancanth; malt; gelatin; talc;
stearic acids; magnesium stearate; calcium sulfate;
calcium carbonate; vegetable oils, such as peanut oils,
cotton seed oil, sesame oil, olive oil, corn oil and oil
of theobroma; polyols such as propylene glycol, glycerine,
sorbitol, manitol, and polyethylene glycol; agar; alginic
acids; pyrogen-free water; isotonic saline; cranberry
extracts and phosphate buffer solution; skim milk powder;
as well as other non-toxic compatible substances used in
pharmaceutical formulations such as Vitamin C, estrogen
and echinacea, for example. Wetting agents and lubricants
such as sodium lauryl sulfate, as well as coloring agents,
flavoring agents, lubricants, excipients, tabletting
agents, stabilizers, anti-oxidants and preservatives, can
also be present.
Accordingly, in a preferred form of treatment of
wound infections, the patient is administered a
therapeutically effective amount of a lactobacillus
composition in accordance with the present invention, for
example, topically.
A most preferred composition comprises one or
more lactobacillus viable whole cells and a
-24-
SUBSTITUTE SHEET (RULE26)
CA 02374938 2001-11-22
WO 00/71139 PCT/CA00/00611
pharmaceutically acceptable carrier. This composition may
be administered topically, orally or intravenously in the
form of a cream, capsule, gel, liquid or paste.
Preferably, the lactobacillus is selected from
the group comprising L. casei ss rhamnosus, L. casei ss
alactosus, L. fermentum and L. brevis. Most preferably,
the lactobacillus is either L. rhamnosus GR-1, L.
fermentum B-54 or L. fermentum RC-14.
In a further aspect of this invention, a method
0 of treating or preventing biofilm formation is provided
which involves coating a surgically implantable device
with a therapeutically effective amount of one or more of
lactobacillus viable whole cells, non-viable whole cells,
or a cell wall fragment.
5 The administration of lactobacilli probiotics to
a wound site and subsequent production of anti-pathogenic
products by the lactobacilli (e. g., biosurfactants, acids,
hydrogen peroxide, bacteriocins) stimulates the immune
response against infection and reduces the risk of medical
'0 device associated infections. While not wishing to be
bound by a particular mechanism, host responses are
stimulated which inhibit pathogens and/or create a
microenvironment less conducive to pathogen spread.
Accordingly, in a preferred embodiment of stimulating host
'S responses, a medical device is contacted or coated with
lactobacillus at a concentration of about 103 to about 1011
organisms/ml prior to introduction into a patient in need
of such device.
The surgically implantable device may be
t0 composed of polymers such as fluorinated ethylene
propylene, sulfonated polystyrene, polystyrene, polyvinyl
chloride (PVC), polyurethane or polyethylene terephthalate
-25-
SUBSTITUTE SHEET (RULE26)
CA 02374938 2001-11-22
WO 00/71139 PCT/CA00/00611
silicon rubber or other biomaterials and in addition,
glass or hydrophilic substrata. The devices contemplated
by the present invention include, but are not limited to,
artificial heart valves, artificial veins, artificial
arteries, shunts, drainage tubes, joints or catheters,
intrauterine devices, catheters, stents, intravenous
lines, diaphragms, implants, screws, sutures, pads and
tampons, for example.
Although the present invention is not bound by
any one theory or mode of operation, it is believed that,
at least to some degree, a combination of coaggregation of
lactobacillus and the production by lactobacillus of one
or more inhibitory substances is responsible for excluding
pathogens and/or reducing their numbers at the wound site.
IS For example, a collagen binding protein is contemplated to
transduce a signal which interferes with pathogen
virulence. The signal transduced by the collagen binding
protein causes the pathogen to rapidly become avirulent or
aseptic.
Thus, the present invention contemplates methods
for inhibiting pathogenic colonization in a host at a
wound-surface interface, for example, by the
administration of a probiotic cultured to induce the
production of a collagen binding protein.
From the standpoint of physical exclusion, the
attachment of lactobacillus acts as a block to pathogens
by preventing access to receptor sites. Although complete
exclusion of pathogens theoretically can occur, the most
common finding of the results of the present invention is
that there is a reduction in pathogen numbers compared to
lactobacilli. In other words, although some lactobacilli
-26-
SUBSTITUTE SHEET (RULE26)
CA 02374938 2001-11-22
WO 00/71139 PCT/CA00/00611
may not completely exclude pathogens, they are still
capable of interfering with pathogen colonization in vivo.
The following examples are intended to further
illustrate the invention.
-27-
SUBSTITUTE SHEET (RULE26)
CA 02374938 2001-11-22
WO 00/71139 PCT/CA00/00611
EBAMPhE 1
Animal Housing
Eight week-old (300 gram) male Sprague-Dawley
rats (Charles River Inc, Montreal QC) were housed in
shoebox plastic cages (2 animals per cage) in the animal
facilities of the Lawson Research Institute, maintained on
a 12-hour light cycle, and given free access to standard
rodent chow and water. Following surgery, the animals
were examined daily for clinical signs of infection.
0
Bacterial Cultures
Staphylococcus aureus (Oxford strain) was
cultured in Brain Heart (BH) growth media overnight at
37°C and plated on BH agar culture plates to determine the
l5 colony-forming unit (CFU) activity of the bacteria.
Following CFU measurements Staphylococcus aureus (SA)
suspensions were diluted in phosphate buffered saline
(PBS) to attain the correct number of CFUs for subsequent
animal inoculations. In a similar procedure, Lactobacillus
>0 fermentum RC-14 and Lactobacillus rhair~nosus GR-1 were
prepared using MRS Broth and MRS agar culture plates.
Appropriate CFU measurements and inoculation dilutions
were prepared as described above for S. aureus (SA).
?5 Biosurfactant Production and isolation
Crude biosurfactant (BSF) was collected from
Lactobacilli strains GR-1 and RC-14 as previously
described (Raid et al. Methods in Enzymology 310:426-433,
1999, incorporated herein by reference). Briefly,
30 bacterial cells were harvested by centrifugation (10,000 x
g, 10 min, 10°C), washed twice in demineralized water and
suspended in PBS. The Lactobacilli were placed at room
-28-
SUBSTITUTE SHEET (RULE26)
CA 02374938 2001-11-22
WO 00/71139 PCT/CA00/00611
temperature for biosurfactant release with gentle stirring
(2 hr). The bacteria and surfactant were separated by
centrifugation (10,000 x g, 10 min, 10°C), and the
supernatant was removed, filtered (0.22mm) and dialyzed
against double demineralized water at 4°C using spectrapor
dialysis tubing (6000-8000 Da M.W. cutoff). The dialyzed
BSF was either used directly or freeze-dried (-10°C , -5uM
Hg, 1-2 days) followed by overnight drying (Savant
speedvac, RCT4104). The biosurfactant powder was stored at
-20°C. Protein concentrations were determined using a
protein assay kit (Pierce, ON). For surgical implant
experiments the BSF was suspended in sterile PBS (2mg/ml)
and incubated with the surgical implants for 12 hours at
4°C prior to placing them in the animals.
Animal surgery
Sprague-Dawley rats were anaesthetized via
peritoneal injection of a mixture of hydrochloride-
ketamine (100 mg/ml) and xylazine (lOmg/ml) at the rate
of O.iml per 100g of body weight. Each anaesthetized rat
was clipped of dorsal hair at the surgical site and
liberally swabbed with a povi-iodine antiseptic solution
prior to surgery. A single 2cm incision was made along the
dorsal skin. A single (lcm x lcm x 0.5 mm) sterile
silicone implant (Dagnone Inc, Quebec) was then inserted
into the subcutaneous pocket adjacent to the skin incision
and inoculated with the indicated number of bacterial CFUs
and/or BSF. The incision was closed with 3.0 coated
polygalactin 910 (vicryl) interrupted sutures and a post-
operative analgesic (buprenorphine hydrochloride, 0.01
mg/kg subcutaneously) was administered to each animal.
-29-
SUBSTITUTE SHEET (RULE26)
CA 02374938 2001-11-22
WO 00/71139 PCT/CA00/00611
Harvesting of implants and tissue
At the specified post-operative times animals
were sacrificed by CO~asphyxiation. Acute surgical
infection was scored (large fluid-filled capsule
containing the surgical implant) and the surgical
implants, wound tissue and fluid harvested for further
analysis. Implants from uninfected rats were free of any
signs of inflammation. The implant-associated bacteria
[CFUs) numbers were quantified using standard
microbiological techniques. Briefly, implants were rinsed
in PBS and then subjected to a 30-second sonication
treatment. Diluted bacterial suspensions were then plated
on either MRS- or BH-agar plates.
Gram staining of Implants
Harvested implants were analyzed using a Gram
staining kit (CMS protocol, Fisher) in order to assess
both the extent of the biofilm on the implant and the
efficiency of the sonication treatment. The staining
procedure included: Crystal violet (1 min), iodine
solution (1 min), decolorizing agent (30 sec), sephranin
(1 min). Implants were then imaged using a light
microscope (Axiophot, Zeiss).
Polymerase Chain reaction (PCR)
The PCR technique was used to unambiguously
identify the types of bacterial CFUs obtained from each
surgical implant. Briefly, bacteria colonies were picked,
washed in Tris-EDTA buffer (pH 7.4), and lysed in 10% SDS
for 30 minutes (Bollet et al. Nucleic Acid Research
19(8):1955 ). The lysate was isolated by brief
centrifugation (4000 rpm, 5min) and heated in a 300 Watt-
-3 0-
SUBSTITUTE SHEET (RULE26)
CA 02374938 2001-11-22
WO 00/71139 PCT/CA00/00611
microwave (Hi power) for 5 minutes. The pellets were
subjected to one round of phenol/chloroform/isoamyl
alcohol (24:23:1) extraction (pH 8.0) and the DNA
precipitated with two volumes of absolute ethanol. The DNA
was then added to a PCR reaction mixture containing the
following additional reagents: 0.5mM specific oligo-
nucleotide primers [Staphylococcus aureus (Jensen et al.
Appl. Environ. Microbiol. 59:945-952, 1993; Mendoza et a1.
International Journal of Systematic Bacteriology 48:1049-
1055, 1998) forward primer = 5'GAAGTCGTAACAAGG-3' (SEQ ID
NO:1) and reverse primer = 5'-CAAGGCATCCACCGT-3'(SEQ ID
N0:2); L. fermentum RC-14 forward primer - 5'-
AAACTTTCTTATTCTATTCTGGT -3'(SEQ ID N0:3) and reverse
primer = 5'-AACTGATTCGTCCCGTAAA-3'(SEQ ID N0:4); L.
rhamnosus GR-1 (Tilsala-Timisjarvi and Alatossava Appl.
Environ. Microbiol. 64(12):4816-4819, 1998) forward primer
- 5'-ACGAGGCAC-3'(SEQ ID N0:5), reverse primer = 5'-
ACGCGCCCT-3'(SEQ ID N0:6)], 0.3 mM dNTP, 2mM MgCl~, and 1
unit of Platinum Taq Polymerase (Gibco-BRL) to a total
volume reaction of 50m1. PCR thermal cycling (Model 212
Lab-line) profiles used included: denaturation (2 min /
94°C), 25 amplification cycles for S. aureus [denaturation
(1 min at 94°C), annealing (7 min at 52°C) and elongation
(2 min at 68°C)] or 40 cycles for RC-14 and GR-1
[denaturation (1 min / 94°C), annealing (2 min / 52°C or
35°C, respectively) and extension (2 min at 68°C)]. The PCR
products were then separated by electrophoresis on a 2%
agarose gel and photographed.
-31-
SUBSTITUTE SHEET (RULE26)
CA 02374938 2001-11-22
WO 00/71139 PCT/CA00/00611
Table ~ The effects of Probiotic strains of Lactobicilli on
Surgical Implants in Rats
Lactobacillus strain Dose [CFUs]' Infection (%)b
S
106 0
101 0
GR-1 108 0
109 0
10'° 0
10~~ 0
106 0
10~ 0
RC-14 108 0
109 0
10~° 0
10~~ 0
' The number of colony forming units [CFUs] used to inoculate
surgical implants.
The percentage of acute surgical infection (Day 3) .
Table 1. The effect of L. fermentum RC-14 and L. rhamnosus
GR-1 on surgical implants in Sprague Dawley rats. Silicone
implants (lcm -) were surgically placed in a small dorsal
subcutaneous pocket in male rats (Sprague Dawley, 300gm)
and inoculated with the indicated number of colony forming
units [CFUs] of L. fermentum RC-14 or L. rhamnosus GR-1.
Animals were sacrificed 3 days after surgery. Wound tissue
and surgical implants were collected for further analysis.
-32-
SUBSTITUTE SHEET (RULE26)
CA 02374938 2001-11-22
WO 00/71139 PCT/CA00/00611
Table Z The effects of Probiotic strains of Lactobicilli on S. aur~eus
induced Surgical Implant Infection in Rats
Bacterial strains Lactoba a7/1 Infection (°~)b
[CFUs]
S. aureus [1D50]° - 55
108 55
10~ 55
GR-1+ S. aureus [1D50] 108 44
9 44
10 lo~0 44
1011 55
108 44
10~ 22
RC-14+ S, aureus [1D50] 108 11
109 11
101 0
1011 0
Number of Lactobacilli colony forming units (CFUs) used to inoculate the
surgical subcutaneous pockets containing the silicone implant
Acute surgical infection (Day 3)
Dose or number of S. aureus CFUs that caused acute surgical infection in
50°~L of the rats
Table 2. The Effect of Probiotic Strains of Lactobacilli
on S. aureus induced surgical Implant Infection in Sprague
Dawley rats. Silicone implants (lcm ') were surgically
placed in a small dorsal subcutaneous pocket in male rats
(Sprague Dawley, 300gm) and co-inoculated with the
indicated number of colony forming units [CFUs] of S.
aureus and either L. fermentum RC-14 or L. rhamnosus GR-1.
Animals were sacrificed 3 days after surgery. Acute
surgical infection (large fluid-filled capsule containing
the surgical implant) was scored and wound tissue and
implants collected for further analysis.
-33-
SUBSTITUTE SHEET (RULE26)
CA 02374938 2001-11-22
WO 00/71139 PCT/CA00/00611
Table 3 The Effects of L. fermentum RC-14 on S. aureus (SA)
induced Acute Surgical Implant Infection in Rats
Bacterial Strains Day Infection
(%)
~ SA [1D50] 50
SA [ID50]+RC-14 10" CFUs 2 0
SA [1D50] 50
SA [ID50]+RC-14 10" CFUs 3 0
SA [1D50] 50
SA [ID50]+RC-14 10" CFUs 4 0
SA [1D50] 50
I SA [ID50]+RC-14 10" CFUs 5 0
Table 3. The effect of L. fermentum RC-14 on S. aureus
(BA) induced surgical implant infection: an extended
Acute Time Course study. Silicone implants (lcm 2) were
surgically placed in a small dorsal subcutaneous pocket
in male rats (Sprague Dawley, 300gm) and inoculated with
the indicated number of colony forming units [CFUs] of
L. fermentum RC-14 and/or S. aureus. [ID50). Animals
were sacrificed and signs of acute surgical infection
assessed on the indicated days after surgery.
The lactobacillus compositions of the present
invention at various doses ( 103-1011 ) significantly
reduced surgical implant infection caused by of S.
aureus (See Figures lA-1B and 6).
-34-
SUBSTITUTE SHEET (RULE26)
CA 02374938 2001-11-22
WO 00/71139 PCT/CA00/00611
EBAMPLE 2
Identification of Lactobacillus by-products-collagen
bindinc,~~rotein
Proteins usually do not act alone and are
often complexed with other important proteins. For
example, the transcription and replication machinery,
ribosomes and the cytoskeleton are all multiprotein
complexes that control fundamental cellular processes.
Identifying and characterizing the proteins present
within these complexes is paramount to understanding how
they function normally. Recent advances in biological
mass spectroscopy were used to analyze trace
concentrations of proteins in their native environments.
The SELDI (Surface Enhanced Laser Desorption/Ionization)
ProteinChip technology of Ciphergen Biosystems combines
the analytical sensitivity of mass spectroscopy (10-15 to
10-12 range) with novel surface chemistry capable of
either general or selective capture of proteins from
ZO small crude biological samples.
Using this technology, lactobacilli components
were identified that promoted bacterial homeostasis in a
wound. This identification was possible because
lactobacilli and other probiotic organisms out-competed
ZS the pathogens, such as Staphylococcus aureus and S.
epidermidis, and because the pathogens triggered
Lactobacillus to produce a bioactive compound, i.e. a
collagen binding protein that either directly or
indirectly (immune stimulation) inhibited the growth of
30 the pathogens. The effect was also aided by the
probiotic organisms acting as chemotactic agents for
immune defenses, such as neutrophils, macrophages,
lymphocytes, antibodies and complement.
-3 5-
SUBSTITL,'TE SHEET (RULE26)
CA 02374938 2001-11-22
WO 00/71139 PCT/CA00/00611
EBAMPLE 3
SELDI (surface enhanced laser
desorption/ionization) was used to separate, detect and
analyze native proteins at the femtomole level without
using labeling or time consuming biochemical analytical
systems. The SELDI system was used to quickly and
accurately determine whether clinically important
strains of lactobacilli expressed collagen binding
proteins.
Four Lactobacillus strains were tested. L.
fermentum RC-14 was selected because of its potent
biosurfactant inhibitory activity against many
urogenital pathogens. L. rhamnosus GR-1 and 36 also
produced biosurfactant, and were also inhibitory to
enterococci.
The organisms were grown in MRS broth
overnight, harvested and the biosurfactant isolated by
incubating the organisms for two hours at room
temperature.
SELDI System. The resultant data showed the
presence of several collagen binding proteins in the RC-
14 biosurfactant preparation tested with calf skin and
human placental collagen, particularly at 1.9, 4.7, 9.4,
14.2, 26 and 37 kDa (Figures 2 and 3). Strains GR-1,
RC-14 and 36 contained both a 26 kD and 36 kD protein.
Further analysis of the biosurfactants showed the
presence of sixteen amino acids present in varying
amounts. (Table 4)
-3 6-
SUBSTITUTE SHEET (RULE26)
CA 02374938 2001-11-22
WO 00/71139 PCT/CA00/00611
U
b
O ~ O
., ~ ~ ~ rd -r1
a ri so e< c1 w
u~ -.
rd +
' i o i
Q N ~- 1!~
-r/ .F.
as to N H U7
J tri W
r1 1~
H N ~ t~0 ~ ~-1
Z r- et ri ~ U
l U
r c0
a~ , ~ b~
- .- eh b ,~r1
~
t0
N o = N t~0 O O r1
a ~ , ci
a m
cn o N ~ '~ ro'
z ~ ~ O w
H
J ui r Qi a U
G4 G=rO a0 N tt
O ~ (/~ ~ M N M w 'L.'4I
0 o s.~U
O O ~ r ~. N
w CO O ~ O , 0 .~ ~yN
En V ~ ~
,.~
H
~n o ~ ~ a
H U > ,
O a ti o
H O b rt1+~
V ~ ~ ; '~ ~ b
D W Q Q ~ N ?, r~~l+1
H O M ~ O ~ 'J N -rl
O N ~ ~ ?,Zf
!~ ~ -r1 +~ U
00 o U
9 0 N
Cl~~ U1
U) O O
a1 r-i
1n et 47
-V,o 0o N N r1td
v b b
~
o
N N ~ -~ o ,c
tri ~ N
U w
' so o c~o-
=
F ri ~ s! rtf b r-1C7
-
a +~ rax
v
H N O O CL
Q O ~ ~ ~ b ~
r-1 G Ql
_ ~
O ~ ~ H
e0
r ft1 C3 (>
V CI) r.~
r
m N M v * ro
'
- 37 -
SUBSTITUTE SHEET (RULE26)
CA 02374938 2001-11-22
WO 00/71139 PCT/CA00/00611
EgAMPLE 4
Lactobacilli were rapidly detected from surgical
implant associated specimens via intergenic 16S-23S
Ribosomal spacer PCR analysis using specific primers of L.
fermentum RC14. The following method was employed:
Lactobacilli isolates were cultured at 37°C for
48 hours on an LBS plate in anaerobic chamber. One loop
of bacteria colonies was picked from the LBS plate and
suspended in 1 ml of d~HZO, then centrifuged for 1 min at
12,000 rpm. 200 ~C1 of InstaGene matrix (Bio-Rad) was
added to the pellet and incubated at 56°C in a water bath
for 30 min. The pellet was vortexed at high speed for 10
seconds keeping the sample in the boiling waterbath for 8
min. The sample was vortexed at high speed again and spun
at 12,000 rpm for 3 min. The chromosomal DNA was stored
at -20°C until used.
Optimal PCR conditions for different strains of
Lactobacillus were established by using two universal
primers from E. coli. The DNA fragment containing the
spacer regions between 16S rRNA and 23S rRNA genes of RC-
14 strains was amplified by using PCR with two universal
primers A1 and B1 from E. coli. The 5' primer,
5'AGTCGTAACAAGGTAAGCCG3' (SEQ ID N0:7) corresponds to a
conserved sequence motif from the 3' end of 16S rRNAs
[Primer A1, position 1493 - 1513 (Escherichia coli 16S
rRNA numbering)] and the 3' primer, 5'C T/C A/G T/C
TGCCAAGCATCCACT3' (SEQ ID N0:8) was deduced from an
alignment of the 13 23S 5' sequences [primer B1, position
23 - 43 (Escherichia coli 23S rRNA numbering)),
respectively. DNA templates (1.6 ug, 40 ~,1) were
amplified in a 100 ~1 reaction volume that contained 2.5 a
Taq polymerase (Boehringer Mannheim), 100 ng of each of
_3 S_
SUBSTITUTE SHEET (RULE26)
CA 02374938 2001-11-22
WO 00/71139 PCT/CA00/00611
the primers, 4 mM MgCl~,0.2 mM of each of the four dNTPs
(Pharmacia Biotech), 10 mM Tris-C1 (PH 8.0), 50 mM KC1 and
1% (v/v) Triton X-100. Reaction mixtures were overlaid
with 100 ~cl mini oil (liquired paraffin, VWR) and
preheated at 95° for 5 min. Amplification was carried out
in a AMPLITRON II Thermolyne for 40 cycles. Each
amplification cycle was as follows: 30 seconds at 95°C
(denaturation), 1 min. at 40°C, 45°C or 50°C. The optimal
annealing temperature was 40°C for RC-14, and 1 min at 72°C
(extension). Post dwell 7 min. at 72°C. Controls were
included in each set of amplifications. The controls
consisted of a reaction mixture with no DNA template
added.
Analysis of the degree and the specificity of
PCR products was conducted by 2.5% agarose gel in lx TAE
buffer, running at 70 Volts for 22 hours. The gel was
stained with ethidium bromide and photographed under W
light. DNA fragment sizes were compared with the 100bp
DNA Molecular Weight (Gibco-Life Tech.) There were two
PCR bands for RC14 (Band 1: 220bp and Band 2: 180bp).
A QIAquick Gel Extraction Kit (Qiagen,
Mississauga, Ontario) for extraction of DNA fragments
70bp-lOkb from standard agrose gel in TAE or TBE buffer
was used to purify PCR bands.
Each of the two PCR DNA fragment bands were
excised from the agarose gel with a scalpel and the gel
slice was weighed. The protocol of QIAquick Gel
Extraction Kit was then followed. The Kit system combined
the spin-column with the silica-gel membrane. The DNA
band was dissolved completely with solubilization buffer
in 50°C for 10 min. DNA adsorbed to the silica membrane
in the high salt conditions. Pure DNA was eluted with
-3 9-
SUBSTITUTE SHEET (RULE26)
CA 02374938 2001-11-22
WO 00/71139 PCT/CA00/00611
Tris buffer (PH 8.0). This pure PCR product was stored at
-20°C for later use.
Each PCR band product was ligated into pGEM-T
vector (Promega). Each pGEM-T vector was transformed into
E. coli JM 109 high efficiency competent cells by using
Transformation Aid (MBI Fermentas Inc.) on the LB plate
with 50 ug/ml ampicillin. Several white colonies or light
blue colonies were selected as positive colonies which
contained the PCR insert. Colonies were cultured on the
LB-ampicillin plate. Each plate contained 32 different
colonies. Colonies were cultured with LB-ampicillin
broth. One part of culture was frozen quickly by using
liquid nitrogen and was kept at -80°C. Another part of
culture was used for further miniprep of plasmid DNA. The
remainder of culture was kept at 4°C.
The QIAprep Spin Miniprep Kit (Qiagen,
Mississauga, Ontario) was used to prepare plasmid DNA.
Each of two PCR products was automatically sequenced by
using T7 & SP6 promoter primers with two directions.
Analysis of sequence was performed using the sequence
analysis software package - DNA Star program.
DNA templates (1.6 ug, 40 ~cl) were amplified in
a 100 ~1 reaction volume that contained 2.5 a Taq
polymerase (Boehringer Mannheim), 100 ng of each of the
primer, 4 mM MgCl2, 0.2 mM of each of the four dNTPs
(Pharmacia Biotech), 10 mM Tris-C1 (PH 8.0), 50 mM KC1,
and 1% (v/v) Triton X-100. Reaction mixtures were
overlaid with 100 u1 mini oil and preheated at 95°C for 5
min. Amplification was carried out in a AMPLITRON II
Thermolyne for 25 cycles. Each amplification cycle was as
follows: 30 seconds at 95°C (denaturation), 1 min. at 60°C
(annealing), and 1 min. at 72°C (extension). Post dwell 7
-40-
SUBSTITUTE SHEET (RULE26)
CA 02374938 2001-11-22
WO 00/71139 PCT/CA00/00611
min. at 72°C. Controls were included in each set of
amplifications.
Verification and confirmation of detection of
Lactobacillus fermentum RC-14 and S. aureus was performed
using a traditional API 50 commercial biochemistry test
(API Systems, La Balme, Les Grottes, France) and PCR
primer. (See Figures 5B & 5C)
15
25
-41-
SUBSTITUTE SHEET (RULE26)
