Note: Descriptions are shown in the official language in which they were submitted.
CA 02375207 2001-11-29
WO 00/78805 PCT/NZ00/00102
PEPTIDE HAVING PREPTIN FUNCTIONALITY
This invention relates to a bioactive peptide. In particular, it relates to a
peptide
secreted by the pancreatic islet ~3-cell that stimulates insulin secretion.
BACKGROUND
Pancreatic islet ~-cells play a major regulatory role in physiology, mainly
through
their secretion of insulin, a peptide hormone which exerts profound effects on
intermediary metabolism (Draznin et al (1994)). A second (3-cell hormone,
amylin,
may also contribute to (3-cell regulatory function through its actions on
insulin
secretion and tissue insulin sensitivity (Cooper, G (1994); Hettiarachchi et
al (1997)).
In islet ~3-cells, hormones are packaged in secretory granules, which undergo
regulated release in response to signals such as fuels (eg. glucose, amino
acids) or
neurohormonal stimuli. These granules contain dense cores rich in insulin and
Zn,
while smaller amounts of insulin C-peptide, amylin, proinsulin, chromogranin-
derived peptides, proteases and other proteins are found in the granule matrix
(Hutton, J ( 1989)).
What the applicants have now determined is that pancreatic islet (3-cells
secrete yet a
further regulatory peptide. The applicants have further determined that this
peptide
enhances glucose-mediated insulin secretion.
It is generally towards this peptide, which the applicants have termed
preptin, that
the present invention is directed in its various aspects.
SUMMARY OF THE INVENTION
Accordingly, in a first aspect the present invention provides the peptide
preptin or an
analog thereof.
By "preptin", the applicants mean a peptide of 34 amino acids, the sequence of
which
is as follows:
Asp Val Ser Thr R1 Rz R3 Val Leu Pro Asp R4 Phe Pro Arg Tyr Pro Val Gly Lys
Phe Phe RS Rs Asp Thr Trp R~ Gln Ser Ra R9 Arg Leu
1
CA 02375207 2001-11-29
WO 00/78805 PCT/NZ00/00102
wherein:
R~ is Ser or Pro;
Rz is Gln or Pro;
Rs is Ala or Thr;
R4 is Asp or Asn;
R5 is Gln or Lys;
Rs is Tyr or Phe;
R~ is Arg or Lys;
Rs is Ala or Thr; and
Rs is Gly or Gln,
or an analog thereof.
In one embodiment, the invention provides human preptin having the amino acid
sequence:
Asp Val Ser Thr Pro Pro Thr Val Leu Pro Asp Asn Phe Pro Arg Tyr Pro Val Gly
Lys Phe Phe Gln Tyr Asp Thr Trp Lys Gln Ser Thr Gln Arg Leu.
In another embodiment, the invention provides rat preptin having the amino
acid
sequence:
Asp Val Ser Thr Ser Gln Ala Val Leu Pro Asp Asp Phe Pro Arg Tyr Pro Val Gly
Lys Phe Phe Lys Phe Asp Thr Trp Arg Gln Ser Ala Gly Arg Leu.
In yet another embodiment, the invention provides mouse preptin having the
amino
acid sequence:
Asp Val Ser Thr Ser Gln Ala Val Leu Pro Asp Asp Phe Pro Arg Tyr Pro Val Gly
Lys Phe Phe Gln Tyr Asp Thr Trp Arg Gln Ser Ala Gly Arg Leu.
The amino acid sequence corresponds to Aspss-Lemon of the proIGF-II E-peptide
in
each mammal.
In still a further aspect, the present invention provides a polynucleotide
which
encodes preptin or an analog thereof.
2
CA 02375207 2001-11-29
WO 00/78805 PCT/NZ00/00102
In another aspect, the invention provides a vector or cell-line which includes
a
polynucleotide which encodes preptin or an analog thereof and which is capable
of
expressing preptin or said analog.
Preptin salts, which are preferably physiologically acceptable, are also
provided.
In a further aspect, the invention further provides a pharmaceutical
composition
which comprises preptin or an analog thereof, or preptin salts.
In still a further aspect, the invention provides a method of stimulating
insulin
secretion for a therapeutic or prophylactic purpose which comprises the step
of
administering to a patient in need of such therapy or prophylaxis an effective
amount
of preptin or an analog thereof.
In yet a further aspect, the invention provides the use of preptin or an
analog thereof
or a salt thereof in the preparation of a medicament, particularly for
stimulating
insulin secretion.
In still a further aspect, the invention provides a method of modulating
glucose
mediated insulin secretion which comprises the step of administering to a
patient an
effective amount of preptin, a preptin analog, a preptin agonist or a preptin
antagonist.
In yet further embodiments, the invention provides antibodies which bind
preptin or
its analogs, assays which employ such antibodies and assay kits which contain
such
antibodies.
The above summary is not exhaustive. Other aspects of the invention will be
apparent from the following description, and from the appended claims.
DESCRIPTION OF THE DRAWINGS
Although the invention is broadly as defined above, it will also be understood
that it
includes embodiments of which the description provided below gives examples.
In
addition, the invention will be better understood by reference to the
accompanying
drawings in which:
3
CA 02375207 2001-11-29
WO 00/78805 PCT/NZ00/00102
Figure 1 shows purification and characterisation of preptin. a) assays for
marker
proteins indicating the localisation of organelles from (3TC6-F7 cells within
the
continuous OptiPrep gradient; granule core (insulin), granule matrix (amylin),
lysosomes (aryl sulphatase), mitochondia (citrate synthase). b) Granule
proteins
purified by RP-HPLC. The indicated peak (hatched) was collected and further
purified. c) Purity and mass (M + H+) of the major peptide from the hatched
peak
confirmed by MALDI-TOF MS. d) RP-HPLC profile from the Lys-C digest of the
peptide purified from the hatched peak. 1:NH2-terminal fragment; 2: COON-
terminal
fragment; 3: undigested peptide. e) Structure of mouse preptin as determined
by
sequencing of Lys-C-derived peptides from (d); NHZ-terminal fragment: normal
font;
COOH-terminal fragment: italicised-bold, and its localisation in a segment of
murine
proIGF-II E-peptide shown. Domains of proIGF-II (B, C, A, D, E) are indicated.
Recognised cleavage site at Argss is indicated in bold, while putative dibasic
motifs
are shown as discontinuous lines.
Figure 2 shows cellular preptin secretion. a) Preptin RIA standard curve. b)
RIA
characterisation of preptin-like immunoreactive material (PLIM) in RP-HPLC
fractions
of 24-h (3TC6-F7 conditioned medium and intra-granular fractions from Figure
1b. c)
MALDI-TOF MS of the major PLIM containing fraction secreted from ~3TC6-F7
cells.
Peak corresponds to murine preptin (M + H+) with 0.07% error.
Figure 3 shows the effects of preptin on insulin secretion. a) Preptin-
mediated insulin
secretion from (3TC6-F7 cells. Graph illustrates increments in insulin
concentration
above basal (0 added preptin). b) preptin-mediated insulin secretion from
isolated
perfused rat pancreas. Points are mean + sem (duplicate analyses; n=4
pancreases
for each curve). Area under curve (second phase of insulin secretion P = 0.03
unpaired 2-tailed t-test).
Figure 4 shows the immunohistochemistry of murine pancreas. Pancreas harvested
from adult FVB/n mice was sectioned and stained with haematoxylin and
polyclonal
rabbit antisera using immunoperoxidase-conjugated goat-anti-rabbit second
antibody. Panels are: a, anti-insulin antiserum ( 1:40); b, anti-preptin
antiserum,
( 1:40); c,d, anti-preptin antiserum ( 1:40) pre-incubated for 30 min with
synthetic rat
preptin at c, 1 mg.ml-1, d, 5 mg.ml-'. Bar = 100 Vim.
4
CA 02375207 2001-11-29
WO 00/78805 PCT/NZ00/00102
Figure 5 shows the RIA characterisation of preptin-like immunoreactive
material
(PLIM) in RP-HPLC fractions from rat islets or ~TC6-F7 granule fractions
(standard;
Fig. 1 b) .
Figure 6 shows preptin and insulin co-secretion from (3TC6-F7 cells and
isolated rat
islets. a,b Glucose-mediated co-secretion of preptin with insulin from a,
(3TC6-F7
cells and b, isolated rat islets.
Figure 7 shows the effects of preptin on insulin secretion. a, b, Purity and
mass of
purified a, rabbit anti-rat preptin 'y globulin and b, non-immune rabbit ~-
globulin. 1:
light chain IgG, M + H+; 2: whole IgG, M + 4H+; 3: heavy chain IgG, M + H+; 4:
whole
IgG, M + 2H+; whole IgG, M + H+. c, 1-min preptin-binding capacity of perfused
anti-
preptin 'y-globulin at 35 ~g.ml-~, 37~C, pH 7.4 to simulate contact time,
dilution,
temperature and pH of the antibody perfusion experiments. d, Effect of
infusion of
anti-preptin 'y-globulin or control (non-immune rabbit 'y-globulin) on insulin
secretion
from glucose-stimulated (20 mM; square wave) isolated perfused rat pancreases.
Each point is mean ~ s.e.m. (duplicate analyses; n = 5 pancreases per curve).
AUC
(second phase of insulin secretion; P = 0.03, unpaired 1-tailed t-test).
DESCRIPTION OF THE INVENTION
As broadly defined above, the present invention is directed to a novel peptide
which
has been found in pancreatic islet (3-cell granules. This peptide, preptin,
has been
determined to stimulate glucose-evoked insulin secretion.
In summary, preptin was identified using a single-step density-gradient
centrifugal
method to purify secretory granules from cultured murine (3TC6-F7 cells with
purity
being confirmed by marker-protein analysis (Figure la). Insulin was used to
track
purification of granule-cores, whereas amylin, which is present in the granule-
matrix
(Johnson, K (1988)), was measured to verify granule-membrane integrity (Figure
la).
Soluble granule components were then separated using reversed-phase HPLC
(A214; Figure 1b). Peptide-identity was determined by mass spectrometry and
NH2-
terminal amino-acid sequencing. Major peaks contained murine insulins-I and -
II
and C-peptides-I and -II (Figure la). No non-(3-cell peptides were detected
and the
5
CA 02375207 2001-11-29
WO 00/78805 PCT/NZ00/00102
molar ratio of amylin:insulin ( 1:23) and mouse insulin I:mouse insulin II (
1:3) were
equivalent to those of physiological (3-cells (Cooper ( 1994); Linde ( 1989)).
A major peak eluting immediately prior to insulin-I was found to contain a
previously
unknown peptide (Figure 1b). This was purified to homogeneity and had a
molecular
mass of 3950 Da (Figure lc). The molecule was digested with a lysine-specific
protease, and the resulting peptides separated by RP-HPLC (Figure 1d) prior to
complete NH2-terminal protein sequencing. The complete sequence confirmed that
the molecule contained 34-amino acids, which corresponded to Aspse-Lemon of
murine proIGF-II E-peptide (Figure 1e). This peptide is mouse preptin.
Preptin is flanked NH2-terminally by a recognised Arg cleavage-site, and COOH-
terminally by a putative dibasic (Arg-Arg) cleavage motif (Bell et al.,
(1985)) (Fig. 1e).
These residues are highly conserved between species, and are likely to serve
as post-
translational processing signals.
While others have shown the existence of different proIGF-II E-peptide-derived
peptides in cell culture medium and various mammalian biological fluids (Hylka
et
al., (1985), Daughaday et al (1992) and Liu et aL, (1993)), none have
identified one
that is equivalent to preptin.
The amino acid sequence of mouse preptin is as follows:
Asp Val Ser Thr Ser Gln Ala Val Leu Pro Asp Asp Phe Pro Arg Tyr Pro Val Gly
Lys Phe Phe Gln Tyr Asp Thr Trp Arg Gln Ser Ala Gly Arg Leu
The equivalent amino acid sequences for human and rat preptin are,
respectively:
Asp Val Ser Thr Pro Pro Thr Val Leu Pro Asp Asn Phe Pro Arg Tyr Pro Val Gly
Lys Phe Phe Gln Tyr Asp Thr Trp Lys Gln Ser Thr Gln Arg Leu; and
Asp Val Ser Thr Ser Gln Ala Val Leu Pro Asp Asp Phe Pro Arg Tyr Pro Val Gly
Lys Phe Phe Lys Phe Asp Thr Trp Arg Gln Ser Ala Gly Arg Leu.
6
CA 02375207 2001-11-29
WO 00/78805 PCT/NZ00/00102
Preptin is encoded by polynucleotides having the following nucleotide
sequences:
gacgtgtcgacccctccgaccgtgcttccggacaacttccccagataccccgtgggcaagttcttccaatatga
cacctggaagcagtccacccagcgcctg (human)
gacgtgtctacctctcaggccgtacttccggacgacttccccagataccccgtgggcaagttcttcaaattcgac
acctggagacagtccgcgggacgcctg (rat)
gacgtgtctacctctcaggccgtacttccggacgacttccccagataccccgtgggcaagttcttccaatatgac
acctggagacagtccgcgggacgcctg (mouse)
Preptin may be generated by synthetic or recombinant means. For example, to be
prepared synthetically, preptin may be synthesised using any of the
commercially
available solid phase techniques such as the Merryfield solid phase synthesis
method, where amino acids are sequentially added to a growing amino acid chain
(see Merryfield, J. Am Soc. 85:2146-2149 ( 1963)). Equipment for automative
synthesis of peptides is also commercially available from suppliers such as
Perkin
Elmer/Applied Biosystems, Inc and may be operated according to the
manufacturers
instructions.
Preptin may also be produced recombinantly by inserting a polynucleotide
(usually
DNA) sequence that encodes the protein into an expression vector and
expressing the
peptide in an appropriate host. Any of a variety of expression vectors known
to those
of ordinary skill in the art may be employed. Expression may be achieved in
any
appropriate host cell that has been transformed or transfected with an
expression
vector containing a DNA molecule which encodes the recombinant peptides.
Suitable
host cells include prokaryotes, yeasts and higher eukaryotic cells.
Standard techniques for recombinant production are described for example, in
Maniatis et a.1, Molecular Cloning - A Laboratory Manual, Cold Spring Harbour
Laboratories, Cold Spring Harbour, New York ( 1989).
Vectors and/or cells lines which express preptin have utility in their own
right and
also form part of the invention.
Analogs of preptin and of its encoding polynucleotides are also within the
scope of
the present invention. Such analogs include functional equivalents of preptin
and of
the polynucleotides described above.
7
CA 02375207 2001-11-29
WO 00/78805 PCT/NZ00/00102
In terms of preptin itself, functional equivalents include all proteins which
are
immunologically cross-reactive with and have substantially the same function
as
preptin. That equivalent may, for example, be a fragment of preptin containing
from
6 to 33 amino acids (usually representing a C-terminal truncation) and
including a
preptin active site or sites, a substitution, addition or deletion mutant of
preptin, or a
fusion of preptin or a fragment or a mutant with other amino acids.
The six amino acids forming the smallest fragment can be from any part of the
sequence, provided they are consecutive in that sequence and fulfil the
functional
requirement. It is of course also possible (and expressly contemplated) that
the
bioactive peptide include any one of those hexapeptides, or indeed be or
include any
heptapeptide, octapeptide, nonapeptide, or decapeptide from the sequence.
Peptides which are, or include a hexapeptide, heptapeptide, octapeptide,
nonapeptide
or decapeptide from human preptin are particularly preferred.
Variations in the residues included in the peptide are also both possible and
contemplated. For example, it is possible to substitute amino acids in a
sequence
with equivalent amino acids using conventional techniques. Groups of amino
acids
known normally to be equivalent are:
(a) Ala Ser Thr Pro Gly;
(b) Asn Asp Glu Gln;
(c) His Arg Lys;
(d) Met Glu Ile Val; and
(e) Phe Tyr Trp.
Additions and/or deletions of amino acids may also be made as long as the
resulting
peptide is immunologically cross-reactive with and has substantially the same
function as preptin.
Equivalent polynucleotides include nucleic acid sequences that encode proteins
equivalent to preptin as defined above. Equivalent polynucleotides also
include
nucleic acid sequences that, due to the degeneracy of the nucleic acid code,
differ
from native polynucleotides in ways that do not effect the corresponding amino
acid
sequences.
8
CA 02375207 2001-11-29
WO 00/78805 PCT/NZ00/00102
A prediction of whether a particular polynucleotide or polypeptide is
equivalent to
those given above can be based upon homology. Polynucleotide or polypeptide
sequences may be aligned, and percentage of identical nucleotides in a
specified
region may be determined against another sequence, using computer algorithms
that
are publicly available. 'Iwo exemplary algorithms for aligning and identifying
the
similarity of polynucleotide sequences are the BLASTN and FASTA algorithms.
The
similarity of polypeptide sequences may be examined using the BLASTP
algorithm.
Both the BLASTN and BLASTP software are available on the NCBI anonymous FTP
server (ftp://ncbi.nlm.nih.gov) under /blast/executables/. The BLASTN
algorithm
version 2Ø4 [Feb-24-1998], set to the default parameters described in the
documentation and distributed with the algorithm, is preferred for use in the
determination of variants according to the present invention. The use of the
BLAST
family of algorithms, including BLASTN and BLASTP, is described at NCBI's
website
at URL http://www.ncbi.nlm.nih.gov/BLAST/newblast.html and in the publication
of Altschul, Stephen F, et a1 (1997). "Gapped BLAST and PSI-BLAST: a new
generation of protein database search programs", Nucleic Acids Res. 25:3389-
3402.
The computer algorithm FASTA is available on the Internet at the ftp site
ftp://ftp.virginia.edu.pub/fasta/. Version 2.0u4, February 1996, set to the
default
parameters described in the documentation and distributed with the algorithm,
is
preferred for use in the determination of variants according to the present
invention.
The use of the FASTA algorithm is described in the W R Pearson and D.J.
Lipman,
"Improved Tools for Biological Sequence Analysis," Proc. NatL Acad. Sci. USA
85:2444-2448 (1988) and W.R. Pearson, "Rapid and Sensitive Sequence Comparison
with FASTP and FASTA," Methods in Enzyrr~logy 183:63-98 ( 1990).
Analogs according to the invention also include the homologues of preptin from
species other than human, rat or mouse. Such homologues can be readily
identified
using, for example, nucleic acid probes based upon the conserved regions of
the
polynucleotides which encode human, rat and mouse preptin.
Preptin or its analogs can also be present in various degrees of purity.
Preferably,
the preptin/analog component makes up at least 50% by weight of the
preparation,
more preferably at least 80% by weight, still more preferably at least 90% by
weight,
still more preferably at least 95% by weight and yet more preferably at least
99% by
weight. It is however generally preferred that, for pharmaceutical
application, the
preptin or analog be present in a pure or substantially pure form.
9
CA 02375207 2001-11-29
WO 00/78805 PCT/NZ00/00102
For administration to a patient, it is possible for preptin or preptin analogs
to be
used as such pure or substantially pure compounds. However, preptin or preptin
analogs may also be presented as a pharmaceutical composition. Such
compositions
may comprise preptin or preptin analogs together with one or more
pharmaceutically
acceptable Garners therefor and optionally other therapeutic ingredients where
desirable.
The carrier must be acceptable in the sense of being compatible with the
preptin or
preptin analog and not deleterious to the patient to be treated. Desirably,
the
composition should not include substances with which peptides are known to be
incompatible.
The compositions may conveniently be presented in unit dosage form and may be
prepared by any of the methods well known in the art of pharmacy. All methods
include the step of bringing the active ingredients into association with a
carrier
which constitutes one or more accessory ingredients.
The precise form the composition will take will largely be dependent upon the
administration route chosen. For example, preptin or preptin analogs may be
injected parenterally, eg. intravenously into the blood stream of the patient
being
treated. However, it will be readily appreciated by those skilled in the art
that the
route can vary, and can be intravenous, subcutaneous, intramuscular,
intraperitoneal, enterally, transdermally, transmucously, sustained release
polymer
compositions (eg. a lactide polymer or co-polymer microparticle or implant),
perfusion, pulmonary (eg. inhalation), nasal, oral, etc.
Compositions suitable for parenteral and in particular intravenous
administration
are presently preferred. Such compositions conveniently comprise sterile
aqueous
solutions of preptin or the preptin analog. Preferably, the solutions are
isotonic with
the blood of the patient to be treated. Such compositions may be conveniently
prepared by dissolving the preptin or analog in water to produce an aqueous
solution
and rendering this solution sterile. The composition may then be presented in
unit
or multi-dose containers, for example sealed ampoules or vials.
One particularly preferred composition is preptin in a physiological buffer
solution
suitable for injection.
CA 02375207 2001-11-29
WO 00/78805 PCT/NZ00/00102
Compositions suitable for sustained release parenteral administrations (eg.
biodegradable polymer formulations) are also well known in the art. See, for
example, US Patent Nos. 3,773,919 and 4,767,628 and PCT Publication No.
WO 94/ 15587.
It is also convenient for preptin to be converted to be in the form of a salt.
Such a
salt will generally be physiologically acceptable, and can be formed using any
convenient art standard approach.
Preptin salts formed by combination of preptin with anions of organic acids
are
particularly preferred. Such salts include, but are not limited to, malate,
acetate,
propionate, butyrate, oxaloacetate, citrate, isocitrate, a-ketoglutarate,
succinate,
fumarate and trifluoroacetate salts.
The salts this formed can also be formulated into pharmaceutical compositions
for
therapeutic administration where this is desired.
Aspects of the invention will now be described with reference to the following
non-
limiting experimental section.
EXPERIMENTAL
Section A
Methods and Materials
Cell Culture
~3TC6-F7 murine pancreatic islet (3-cells, passages 49-60, were cultured at
37~C in
Oa:COa95:5 (v/v) in triple flasks in nDMEM (Gibco) supplemented with 15% heat-
inactivated horse serum and 2.5% fetal bovine serum, and subcultured every 5 d
by
washing with PBS followed by trypsinization (2.5% Trypsin-EDTA). Each flask
yielded approx 2.0 x 10$ cells at 70% confluence.
Granule purification
(3-cells at passages 55-60 from 8-12 triple flasks were harvested by
trypsinization,
yielding on average 2.5-4.0 ml of pure cells (1.6 - 2.4 x 109), which then
were
concentrated (1700 x g, 5 min), washed twice with PBS, and once with
11
CA 02375207 2001-11-29
WO 00/78805 PCT/NZ00/00102
Homogenisation Medium (0.3 M sucrose/ 10 mM MES K (Sigma)/1 mM KaEGTA/ 1
mM MgzS04/pH 6.5), then homogenised on ice in the same medium at 1:5 (v/v).
The
cell suspension was homogenised by 20 passages through a ball-bearing
homogeniser (7.87 x 10-5 cm clearance), then clarified by centrifugation (400
x g, 10
min), the pellet once re-homogenised and centrifuged, and the supernatants
combined (final vol = 20 ml). Solutions (v/v) of 13% and 31% OptiPrepT""
(Nycomed)
were prepared by dilution with Homogenisation Medium, and 6 x 10 ml continous
gradients (31%-13% OptiPrep) poured (Auto Densi-Flow II, Haakebuchler) into
Ultra-
Clear tubes (Beckman). Pelleted material was over-layered or under-layered,
then
ultracentrifuged (SW40 Ti/ 160,000 x g/ 16 h/4~C). Fractions with RI of 1.363-
1.368,
containing highest purity secretory granules, were collected, whereas
mitochondria
and lysosomes were isolated to fractions with RI > 1.371. Integrity of granule
preparations was monitored using radioimmunoassays for insulin (crystalline
granule core), amylin (granule matrix); purity by functional assays for aryl
sulphatase (lysosomes) and citrate synthase (mitochondria); and total protein
content
using Bicinchoninic acid (Pierce).
RP-HPLC
Granule proteins were purified in two sequential RP-HPLC runs (A: 0.08% TFA
v/v;
B: 80% acetonitrile with 20% A; Applied Biosystems 1408/785A/ 112A system;
Jupiter C18 RP column,250 x 2.0 mm (Phenomonex); 250-300 ~1/min; A2i4).
Secretory granule material was initially centrifuged ( 16,000 x g, 20 min)
before
loading. An initial 15 min isocratic step was employed, and sequential 30s
fractions
collected from 19 min post-injection. Slightly different gradients were used
sequentually to purify proteins; the first semi-purified granule proteins,
whereas the
second was slightly flatter, to increase resolution and purity.
Peptide sequence analysis
Purified peptides were identified by N-terminal sequence determination
(automated
Edman method; ABI ProciseT"") combined with accurate mass determination by
MALDI-TOF MS. For complete sequence verification, purified mouse preptin
isolates
were cleaved using Lys-C (Boehringer Mannheim), and the resulting peptide
fragments repurified by RP-HPLC.
MALDI-TOF mass spectrometry
Peptide molecule weights were determined by MALDI-TOF MS (Hewlett-Packard
G2025A; 337 nm-emission nitrogen laser/ 150 ~J maximum output/3 ns
12
CA 02375207 2001-11-29
WO 00/78805 PCT/NZ00/00102
pulsewidth/30 kV ion acceleration potential) fitted with a 500 MHz digital
oscilloscope (G2030AA, LeCroy) using an a-CHC matrix with recombinant human
insulin (Novo Nordisk; M + H+, 5808.66 Da; M + 2H+, 2904.83) and somatostatin
(Bachem; M + H+, 1638.91, M + Na+, 1660.90) mass standards. MS was performed
under high vacuum (< 1.0 ~Torr) and data acquired (ChemStation; 0-20PS method
positive polarity in the 0-20 kDa range) with external mass calibration in
"single
shots" mode. Accurate molecular weights of purified peptides were confirmed by
interpolation with external mass standardisation.
Chemical synthesis of rat preptin
The sequences of rat and human preptin were determined by comparison with
known predicted IGF-II sequences. Rat preptin was chemically synthesised
(Auspep
Pty, Australia), according to the predicted sequence, using Fmoc chemistry on
an
Advanced Chem Tech 396 Robotics Peptide Synthesiser starting with FmocLeu-
Wang resin. The peptide was deprotected and cleaved from the resin with a
solution
of 92.5% TFA: 2.5% water:2.5% triisopropylsilane: 2.5% dithiothreitol for 3 h.
The
peptide was precipitated from the TFA solution by addition of diisopropyl
ether and
the precipitate dissolved in 30% acetonitrile: water, lyophilised, and
purified by RP
HPLC. Purity was confirmed as >99% by analytical RP-HPLC (rat preptin eluted
at
47%B), while MALDI-TOF MS validated the mass as 3932.4 Da ~ 0.026%.
Preptin radioimmunoassay
Synthetic rat preptin was conjugated to the carrier, ovalbumin, using the
single step
glutaraldehyde method at pH 7.0, then used to raise polyclonal antisera in NZW
rabbits. Preptin was 1251-radiolabelled using the chloramine-T method, and
(125I)preptin (362 ~Ci/~g) purified by Sephadex G-10 chromatography (50 mM
phosphate buffer, pH 7.5). An optimised RIA for preptin was then developed,
with
B/F separation by the PEG-assisted second antibody (goat-anti-rabbit method).
This
employed a final dilution of antiserum at 1: 10,000 (final assay dilution 1:
30,000) at
an R/T value of 0:30; tracer at 8,000 cpm/tube; incubation times of 24h + 72h;
and
had an EC2o value of 344 pM preptin; ECso of 39 pM; minimum detectable
concentration of 11.2 + 9.8 pM; and zero cross-reactivity with rodent
(rat/mouse)
insulins and amylin.
Cellular preptin secretion
Preptin secretion was studied in ~3TC6-F7 cells (passage #52), cultured
otherwise as
above in 24-well plates at 4 x 105 cells per well. Preptin stimulation was
performed
13
CA 02375207 2001-11-29
WO 00/78805 PCT/NZ00/00102
after 3 d growth, at 80% confluence. Cells were washed twice in HEPES-buffered
KRB before commencement of secretion studies, then preincubated for 1 h in 1
ml/well incubation buffer (0 mM glucose; 0.1% w/w Fraction V BSA (Sigma)
dissolved in HEPES-KRB) 500 ~1/well was then removed, and replaced with an
equivalent volume of fresh incubation buffer containing various concentrations
of
glucose. After 2 h incubation (37~C), incubation medium was removed, cells
washed
thrice with PBS, then lysed with lysis buffer. Incubation supernatants and
cell
lysates were then assayed for insulin and preptin contents using the described
RIAs.
In separate experiments, time-dependent hormone secretion was also determined.
Characterisation of secreted preptin-like immunoreactiue material (PLIM)
Since preptin is a cleavage product of the E-peptide of IGF-II, and other
cleavage
products from a similar region have been isolated from serum in the past
(Hylka
( 1985); Daughaday ( 1992); Liu ( 1993)), quantitation by preptin RIA was
insufficient
to characterise the nature of the secreted and circulating peptide. A combined
RP-
HPLC/preptin RIA method was therefore developed to further characterise PLIM.2
ml
aliquots of separated plasma from a human donor, and ~3TC6-F7 conditioned
medium, were acidified with 0.1 ml of 4M acetic acid and applied to a C-18 Sep
Pak
(Waters, 1 ml volume) which had been pre-equilibrated with 10 ml of 100%
methanol
and 20 ml of 4% (v/v) acetic acid. The Sep Pak was washed with 20 ml of 4%
acetic
acid, before bound components were eluted with 2 ml of 0.1 M acetic acid in
70%
methanol, and the final volume of eluate reduced to 150 ~1 by rotary
evaporation.
Eluates were then subjected to RP-HPLC as above, and corresponding fractions
combined from multiple runs. Fractions likely to contain preptin and insulin
were
subjected to MALDI-TOF MS. All fractions were then made up to a volume of 350
~l
with preptin assay buffer, then analysed by preptin and insulin RIAs. In order
to
compare profiles of immunoreactivety of these secreted products with the
intragranular profile (Figure 1b), 10 ~l samples from the initial RP-HPLC
granule
fractions were diluted to a final volume of 610 ~1 with preptin RIA buffer,
and also
assayed for insulin and preptin.
Rate of carbohydrate metabolism in isolated rat skeletal muscle
The ~-cell hormones amylin and insulin modulate carbohydrate utilisation in
peripheral tissues, including skeletal muscle. The ability of preptin to alter
glucose
uptake and incorporation into muscle glycogen was investigated using isolated
incubated stripped soleus muscle as a model tissue. All animal methods were
carried out with appropriate permission from the Institutional Animal Ethics
14
CA 02375207 2001-11-29
WO 00/78805 PCT/NZ00/00102
Committee. Male Wistar rats (200 + 20 g) were housed in controlled conditions
(20°C, 12 h light/dark cycle) and fed standard rat chow (Diet 86, NRM
Tegel,
Auckland) and water ad libitum 18-h fasted rats were anaesthetised (45 mg/kg
Pentobarbitone sodium) then sacrificed by cervical dislocation, and soleus
mucles
dissected under carboxygenated-KHB (Oz:COa95: 5 v/v), then incubated in nDMEM
supplemented with various concentrations of insulin and preptin. Muscles were
teased longitudinally into 3 equal strips with a final radius of approximately
1.5 mm
[(U)~4C] D(+)-glucose (1 mCi/ml, Amersham) was diluted 1: 20 (v/v) in 70%
ethanol to
yield a final concentration of 0.5 ~Ci/ 10 ~1. Actrapid~ Recombinant Human
Insulin
( 100 U/ml, Novo Nordisk) was diluted 1 / 1000 in 10 ml nDMEM. 60 ~g rat
preptin
was dissolved in 1526 ~l of nDMEM to a concentration of 10 ~M, then further
diluted
in nDMEM to give stock solutions of 1 ~M, 100 nM, 10 nM, 100 pM and 1 pM. Two
different experimental paradigms were employed to determine whether preptin
(i)
stimulated the rate of glucose incorporation into glycogen, or (ii) acted as
an
antagonist of insulin-evoked glucose incorporation into glycogen.
Preptin antagonist incubation protocol
Four muscle strips were transferred into each of 9 flasks, which contained 10
ml of
carboxygenated nDMEM, 0 (control) or maximally-effective insulin (23.7 nM),
and
various concentrations of preptin ( 10 fM, 100 fM, 1 pM, 0, 10 pM, 100 pM, 1
nM or
10 nM). Flasks were then equilibrated in a shaking water bath (30°C, 20
min),
following which 10 ~1 of (0.5 ~Ci) D-[(U)~4C] glucose was added, at strict 1.5
min
intervals. Muscle strips were then incubated for 120 min at 30°C under
carbogen.
After incubation, strips were removed from each flask at 1.5 min intervals,
and
blotted dry. They were then snap-frozen in liquid N2, freeze-dried for 24 h in
pre-
weighed tubes, then strip dry-weights determined. Muscle strips were then
solubilised in 250 ~l or 60% KOH, incubated at 70°C for 45 min, then
cooled before
overnight precipitation at -20°C with ice-cold ethanol. Glycogen
pellets were then
prepared by centrifugation (9,OOOxg, 15 min, 0°C), pellets resuspended,
and re-
precipitated twice, before the supernatant was finally aspirated and glycogen
pellets
over-dried at 70°C for 2 h. incorporation of 14C was then determined by
scintillation
counting.
Preptin agonist protocol
All methods were as described above, except that strips were incubated in the
absence of insulin (except for the positive control, at 23.7 nM) and final
preptin
concentrations of 0, 0.1, 1, 10 and 100 nM.
CA 02375207 2001-11-29
WO 00/78805 PCT/NZ00/00102
Effect of preptin on insulin secretion
Insulin and amylin are known to modulate (3-cell insulin secretion via
presumed
autocrine mechanisms. The effect of preptin on insulin secretion was therefore
tested using a ~-cell secretagogue protocol (3TC6-F7 cells were subcultured at
passage #52 into 24-well plates at 4 x 105 cells/well. They were grown for 3d
in
nDMEM to 80% confluence, then washed twice with KRB-HEPES. Stock preptin was
serially diluted in incubation medium containing 10 mM D(+) glucose to yield
final
concentrations of 150, 75, 25, 5, 1 and 0.1 nM. Cells were then washed, and 1
ml/well of incubation medium containing 10 mM and various final preptin
concentrations was added to each well. Cells were incubated at 37~C for 2 h,
then
medium removed. Cells were washed thrice with PBS, then lysed with 500 ~1 of
lysis
buffer. Incubation medium was centrifuged (16,000 x g, 3 min) and the
supernatant
separated from pelleted debris. Incubation medium and lysates were then
analysed
for insulin, preptin and protein as above.
Results
The results of the above are shown in Figures 1, 2 and 3.
Discussion
Mouse preptin is a 34 amino acid peptide which corresponds to Aspss-Lemoz of
murine proIGF-II E-peptide.
Preptin was present in granules at 1:8 the content of insulin, but 2:1 that of
amylin
(mol/mol), as determined by integration of RP-HPLC peak-areas. Preptin is
flanked
NHz-terminally by a recognised Arg cleavage site, and COOH-terminally by a
putative
dibasic (Arg-Arg) cleavage motif (Bell ( 1984)) (Figure 1e). These residues
likely serve
as post-translational processing signals, and are highly conserved between
species.
Many prohormone precursors incorporate more than one hormone with differential
proteolytic processing often being tissue specific (Martinez ( 1989)). The
above results
indicated that proIGF-II is a prohormone with more than one peptide-hormone
product.
IGF-II is a member of the insulin family that regulates cell growth,
differentiation and
metabolism (De Chiara et a.L (1990). It is a single polypeptide chain derived
from the
16
CA 02375207 2001-11-29
WO 00/78805 PCT/NZ00/00102
BCA and D domains of proIGF-II (see Figure 1e) and is widely synthesised in
fetal
and adult tissues. Insulin expression, on the other hand, is almost completely
confined to p-cells. In mammalian genomes, the IGF-II gene is contiguous with
those
of insulin (Bell ( 1985)) and recent studies in humans have identified a VNTR
polymorphism upstream of the INS and IGF-ll genes, which may contribute to
differential regulation of both genes (Ong (1999)).
The preptin radioimmunoassay (RIA) (Figure 2a) and reanalysis of the granule
purification profiles of Figures la with the preptin RIA showed that preptin
co-
purified with insulin and amylin, confirming that it was indeed a granule
component. Preptin-like immunoreactive material (PLIM) was characterised by RP-
HPLC/RIA in purified granules and in (3TC6-F7 conditioned medium. The major
form
of both intra-granular and extracellular PLIM co-eluted on RP-HPLC (Figure
2b).
Mass spectrometry of HPLC-purified material corresponding to the PLIM peak
from
(3TC6-F7 cells showed the presence of a single species, with molecular mass
identical
to that of murine preptin (Figure 2c). RP-HPLC also demonstrated that the
major
form of PLIM from human and rat plasma co-eluted with intragranular murine
preptin. Preptin was co-secreted with insulin from (3TC6-F7 cells in response
to
glucose-stimulation (Figure 2d), reaching maximal levels at 1-mM or greater.
These results confirm that preptin is synthesised in islet (3-cells and
packaged in
secretory granules. Further, it is co-secreted with insulin in a glucose-
dependent
manner.
There is evidence that insulin secretion may be modulated by islet (3-cell
hormones,
including insulin (Kulkarni ( 1999); Elahi ( 1982); Argoud ( 1987)), amylin
(Waggoner et
al (1993); Silvestre (1996); Degano et al (1993)), and pancreastatin (Tatemoto
(1986)).
These are thought to act through autocrine negative-feedback loops, mediated
via
binding to specific cell-surface receptors. The effects of preptin on insulin
secretion
were therefore investigated. The results obtained showed that synthetic rat
preptin
enhanced the glucose ( 10-mM)-stimulated secretion of insulin from cultured
(3TC6-F7
cells, in a manner that was both concentration-dependent and saturable (Figure
3a).
Significant effects of preptin compared to controls (0 added preptin) were
detected at
concentrations of 0.1-nM and greater, and reached maximal at 75-nM. This
concentration is equivalent to that at which amylin elicits inhibition of
insulin
secretion (Degano et al (1993)). These preptin concentrations are similar to
those
secreted from (3TC6-F7 cells (Figure 2d), and are thus likely to occur
adjacent to (3-
17
CA 02375207 2001-11-29
WO 00/78805 PCT/NZ00/00102
cell membranes in situ in physiological islets. This demonstration of
concentration-
dependent and saturable stimulation of insulin secretion by preptin suggests
that it
elicits these effects by binding to a cell surface receptor.
The effect of infused synthetic rat preptin on glucose (20-mM)-stimulated
insulin
secretion in the isolated-perused rat pancrease (Figure 3b) was measured
employing
a maximally-effective preptin concentration (75-nM). Preptin significantly
enhanced
(by 30%; p = 0.03, 2-tailed t-test of areas-under-curve) the second phase of
insulin
secretion, compared with control values (0-added preptin) (Figure 3b). These
findings are consistent with those obtained from (3TC6-F7 cells (Figure 3a).
They
suggest that preptin is a physiological regulator of insulin secretion, which
acts in a
newly recognised feed-forward autocrine loop to enhance glucose-stimulated
insulin
secretion, and may function to counterbalance the inhibitory effects of other
p-cell
hormones on insulin secretion.
It is therefore the applicants view that preptin acts to recruit, prime and co-
ordinate
the glucose-responsive activity of (3-cells in a local manner, amplifying the
glucose-
evoked signal to the (3-cell organ. This action would be similar to the feed-
forward
mechanism effected in platelets by the thrombin-elicited release of
thromboxane A2
(Barntt ( 1992)).
The existence of a previously unsuspected mechanism, through which a new islet
(3-
cell hormone amplifies glucose-mediated insulin secretion, suggests that
preptin
biology will be important in type 2 diabetes mellitus, which is characterised
by a
complex impairment of insulin secretion (De Fronzo et al ( 1992)). A defect in
preptin
synthesis, secretion, or action could contribute to the defective glucose-
mediated
insulin secretion in this condition and preptin administration may be
advantageous
for the treatment of type 2 diabetes mellitus or other disorders associated
with
diminished (3-cell insulin secretion. It is noted that, in humans, the
variable number
of tandem repeat (VNTR) polymorphism upstream of the adjacent insulin (INS)
and
IGF-II genes regulates expression of both genes, and is associated with an
increased
tendency to both type 2 diabetes mellitus and polycystic ovary syndrome.
Section B
18
CA 02375207 2001-11-29
WO 00/78805 PCT/NZ00/00102
Preptin is co-packaged with insulin in islet tissue
To study preptin physiology, immunohistochemical studies were performed in
normal murine pancreas using a preptin-specific antiserum. Synthetic rat
preptin,
prepared as above, (Auspep Pty Ltd) was conjugated to ovalbumin using the
single-
s step gluteraldehyde method at pH 7.0 (Harlow and Lane). New Zealand white
rabbits
were used to raise polyclonal antisera against the rat preptin conjugate.
Serial sections from normal adult mouse (FVB/n) pancreas were stained with
haematoxylin and specific anti-preptin or anti-insulin antisera, all at final
dilutions
of 1:40 (v/v), and with goat-anti-rabbit immunoperoxidase-labelled second
antibody.
Preptin (1 or 5 mg.ml-1) was pre-incubated with anti-preptin antiserum for 30
min
before addition to sections to demonstrate the specificity of preptin
immunostaining.
Preptin-like irnmunoreactive material (PLIM) and insulin-like immunoreactive
material were co-localised in islet (3-cells (Figs. 4a,b). Competition studies
showed
that PLIM-staining was suppressed by pre-incubating preptin antiserum with
synthetic preptin in a concentration dependent manner (Figs. 4b-d). These
studies
suggest that preptin is present in physiological pancreatic islet (3-cells.
PLIM is present in normal islet tissue
To establish the identity of PLIM in normal islet tissue, we performed RP-
HPLC/RIA
of acid ethanol extracts from isolated rat islets. Pancreatic islets were
isolated from
normal adult male Wistar rats, and the contents extracted with acid ethanol
according to a modification of published methods (Wollheim and Sharp ( 1981),
Romanus ( 1988)).
The results are shown in Figure 5.
Although preptin levels were much lower than in (3TC6-F7 cells, the major peak
of
PLIM co-eluted with intra-granular preptin, indicating that preptin is the
dominant
physiological component of PLIM in normal islets (Fig. 5). These data confirm
that
the preptin purified from the ~TC6-F7 cells was not simply an artefact
resulting from
proteolysis during purification, but exists and is secreted in this form from
both
~3TC6-F7 cells and normal rat islets.
19
CA 02375207 2001-11-29
WO 00/78805 PCT/NZ00/00102
Preptin is co-secreted with insulin in response to glucose stimulation.
Given the co-localisation of preptin and insulin within the (3-cell secretory
granule,
experiments were undertaken to determine whether preptin and insulin are co-
secreted in a regulated manner. Glucose-stimulated peptide secretion was
studied
according to published methods using both (3TC6-F7 cells (Efrat et al (1993),
Knaack
et aI ( 1994)) and isolated rat islets (Gotoh et a1 ( 1987)), and
concentrations of preptin
and insulin were measured using specific RIAs.
The results are shown in Figure 6. These indicated that while (3TC6-F7 cells
were
responding to sub-physiological concentrations of glucose (<5 mM) (S Efrat,
personal
communication), a clear pattern of insulin/preptin co-secretion was observed
from
both ~TC6-F7 cells (Fig. 6a) and normal rat islets (Fig. 6b). The amount of
preptin
secreted from the islet tissue (preptin:insulin 1:500) was much lower than the
level
secreted from the ~3TC6-F7 cells (preptin:insulin 1:8). This observation
supported the
HPLC/RIA results which indicated much lower levels of preptin in physiological
tissue than in the cultured (3-cells. Although preptin levels are much lower
in
physiological islets, both of these models clearly showed that preptin is co-
secreted
with insulin from physiological islet (3-cells in response to glucose-
stimulation.
Removal of endogenous preptin significantly decreases insulin secretion from
the
isolated-perjured rat pancreas.
To determine the role that endogenous pancreatic preptin might play in insulin
secretion, the action of endogenous preptin was removed by infusing anti-
preptin
antibodies into the isolated perfused pancreas model as follows:
Pancreases were perfused with KHB supplemented with 4% dextran, 0.5% BSA, 3
mM-arginine and 5.5 mM glucose (final concentrations). Perfusate was gassed
with a
mixture of 95% Oz/5% C02 and infused by peristaltic pump at 2.7 ml.min-'
without
re-circulation. Pancreases were perfused and equilibrated for 20-min prior to
each
70-min perfusion. 10-min into the experiment either anti-preptin 'y-globulin
or non-
immune rabbit 'y-globulin were introduced via a side-arm infusion (final 'y-
globulin
concentration in perfusate: 35 ~g.ml-1 in Garner buffer (0.1% BSA in 0.9%
NaCI). In
addition, at 25-min, glucose was infused for 20-min (measured final
concentration in
perfusate: 20 mM). Continuous 1-min fractions were collected on ice and
assayed for
insulin (RIA).
CA 02375207 2001-11-29
WO 00/78805 PCT/NZ00/00102
Rabbit anti-rat preptin 'y-globulin or control (non-immune rabbit) 'y-globulin
were
purified by Protein A affinity chromatography (Pharmacia-Biotech, Hi-Trap
Protein A
Tech. Rep. (Wikstroms, Sweden ( 1999)) to diminish the potential influence
from other
serum constituents. The compositions of the two different 'y-globulin
fractions were
confirmed by MALDI-TOF MS (Fig. 7a,b), and the binding capacities of the two
different 'y-globulin fractions were determined under conditions simulating
the
antibody perfusion experiments as above. The maximal amount of preptin
completely
bound by anti-preptin 'y-globulin under the perfused pancreas experimental
conditions was 20 ng/min (Fig. 7c).
Isolated perfused pancreases were infused with anti-preptin or control 'y-
globulin and
subjected to square-wave stimulation by 20 mM glucose (Fig. 7d). Secretion of
insulin in both the first and second phase was significantly decreased by anti-
preptin
y-globulin (first phase: average 29% inhibition compared to controls, P =
0.02, 1-
tailed t-test; second phase: average 26% inhibition compared to controls,
P'=0.03, 1-
tailed t-test of AUC). In this experiment we have shown that removal of
endogenous
circulating preptin causes a significant decrease in glucose-mediated insulin
secretion. This result is all the more interesting given that preptin has been
estimated to be present in relatively low concentrations in the physiological
islet
(approximately 500x less than insulin) and yet still has the ability to exert
a
significant effect on insulin secretion. These experiments are consistent with
the
premise that physiological concentrations of pancreatic preptin play an
autocrine
role to increase glucose-mediated insulin secretion. This action may be
similar to the
feed-forward mechanism evoked in platelets by the thrombin-elicited release of
thromboxane A2 (Barrit (1992)).
Overall Conclusion
In summary, preptin is a previously unknown, pancreatic islet ~-cell hormone.
It is
produced from the E-peptide of pro-IGF-II, is present in islet (3-cell
granules in
significant amounts, is co-secreted with insulin in a regulated manner,
enhances
glucose-stimulated insulin secretion, and may act in a feed-forward autocrine
loop,
probably via binding to a ~-cell surface receptor.
21
CA 02375207 2001-11-29
WO 00/78805 PCT/NZ00/00102
INDUSTRIAL APPLICATION
As described above, the present invention provides preptin (including in its
human,
rat and mouse forms) and analogs of preptin. Preptin and its analogs play a
physiological role in the stimulation of glucose evoked insulin secretion.
The invention therefore also provides methods by which glucose-evoked insulin
secretion can be modulated. Such modulation will usually involve
administration of
preptin and its analogs as described above. However, modulation can also be
achieved by use of preptin agonists and antagonists.
A preptin agonist is a compound which promotes or potentiates the effect of
preptin
on insulin secretion. In contrast, a preptin antagonist is a compound which
competes with preptin or otherwise interacts with preptin to block or reduce
the
effect of preptin on insulin secretion.
Preptin agonists and preptin antagonists can be identified by assay systems
which
measure the effect preptin has on insulin secretion in the presence and
absence of a
test compound. For example, the assay systems described in the experimental
section herein can be used.
Where it is desired that a preptin agonist or preptin antagonist be employed
in
modulating insulin secretion, the agonist/antagonist can be administered as a
pure
compound or formulated as a pharmaceutical composition as described above for
preptin.
Also provided herein are immunological reagents which bind preptin. Such
reagents
(which can be polyclonal antibodies) can be generated using art standard
techniques,
including those described in the experimental section.
Monoclonal antibodies can also be provided. Such antibodies will typically be
made
by standard procedures as described, eg. in Harlow and Lane 1988. Briefly,
appropriate animals are selected and the desired immunisation protocol
followed.
After the appropriate period of time, the spleens of such animals are excised
and
individual spleen cells fused, typically, to immortalised myeloma cells under
appropriate selection conditions. Thereafter, the cells are clonally separated
and the
supernatants of each clone tested for the production of an appropriate
antibody
specific for the desired region of the immunising antigen.
22
CA 02375207 2001-11-29
WO 00/78805 PCT/NZ00/00102
Other suitable techniques for preparing antibodies involve in vitro exposure
of
lymphocytes to the antigen or alternatively, to selection of libraries of
antibodies in
phage or similar vectors. See, for example Huse et al 1989.
Also, recombinant antibodies may be produced using procedures known in the
art.
See, for example, US Patent 4,816,567.
The antibodies may be used with or without modification. Frequently,
antibodies will
be labelled by joining, either covalently or non-covalently a substance which
provides
a detectable signal. A wide variety of labels and conjugation techniques are
known
and are reported extensively in the literature.
Antibodies as above to preptin can therefore be used to monitor the presence
of
preptin in a patient or in preptin quantification assays. In such assays, any
convenient immunological format can be employed. Such formats include
immunohistochemical assays, RIA, IRMA and ELISA assays.
The assays can be conducted in relation to any biological fluid which does, or
should, contain preptin. Such fluids include blood, serum, plasma, urine and
cerebrospinal fluid.
The antibodies can also be included in assay kits. Such kits can contain, in
addition, a number of optional but conventional components, the selection of
which
will be routine to the art skilled worker. Such additional components will
however
generally include a preptin reference standard, which may be preptin itself or
an
analog (such as a fragment).
It will also be appreciated that antibodies such as described above can, if
some
circumstances, also function as preptin antagonists by binding to preptin and
partly
or completely interfering with preptin activity.
As alluded to above, the applicants findings in respect of preptin also have
diagnostic
implications. For example, individuals whose preptin production is less than
is
required in order to elicit insulin secretion at appropriate levels, or who
produce
preptin in a less active or inactive (mutant) form will require therapeutic
intervention.
Diagnostic or prognostic methods are therefore within the scope of the
invention.
23
CA 02375207 2001-11-29
WO 00/78805 PCT/NZ00/00102
In one specific embodiment, a diagnostic or prognostic method will involve
detection
of mutations in the gene coding for preptin and/or the preptin secretory
mechanism.
Detection can occur using any one of a number of art standard techniques
including
Single Stranded Confirmation Analysis (Orita et al ( 1989)) or the
Amplification
Refractory Mutation System (ARMS) as disclosed in European Patent Application
Publication No 0 332 435.
If a mutation is detected, corrective approaches become possible. These
include but
are not limited to gene therapy. Again, art standard techniques will be
employed.
Other implications and applications of the applicants identification of
preptin will be
apparent to those persons skilled in the art, who will appreciate that the
above
description is provided by way of example only and that the invention is not
limited
thereto.
24
CA 02375207 2001-11-29
WO 00/78805 PCT/NZ00/00102
REFERENCES
Draznin, B. and LeRoith, D. (eds). Molecular biology of diabetes II. Insulin
action,
effects on gene expression and regulation, and glucose transport (Humana Press
Inc.,
New Jersey ( 1994)).
Cooper, G. Endocr. Reu. 15, 163-201 ( 1994).
Waggoner, P., Chen, C., Worley, J., Dukes, I. and Oxford, G. Proc. Natn. Acad.
Sci.,
USA, 90, 9145-9149 ( 1993).
Hettiarachchi, M., et al. Am J. Physiol. 273, E859-E867 ( 1997).
Hutton, J. Diabetologia 12, 271-281 ( 1989).
Efrat, S. et al. Diabetes. 42, 901-907 ( 1993).
Knaack, D. et al. Diabetes. 43, 1413-1417 ( 1994).
Linde, S. et aL J. Chromatgr. 4642, 243-254 ( 1989).
Johnson, K., et al. Am J. Pathol. 130, 1-8 ( 1988).
Bell, G. I., et al. Nature. 310, 775-777 ( 1984).
Martinez, J. (ed) Peptide hormones prohormones; processing, biological
activity,
pharmacology (Elks Horwood Ltd, Chichester, 1989).
DeChiara, T., Efstradiadis, A. and Robertson, E. Nature 345, 78-89 (1990).
Kulkarni, R. et al. Cell 96, 329-339 ( 1999).
Elahi, D. et al. N. Eng. J. Med. 306, 1196-1202 ( 1982).
Argoud, G., Schade, D. and Eaton, R. Diabetes 36, 959-962 ( 1987).
Silvestre, R. et aL Br. J. Pharmacol. 117, 347-350 ( 1996).
CA 02375207 2001-11-29
WO 00/78805 PCT/NZ00/00102
Degano, P., Silvestre, R., Salas, M. and Peiro, E. ReguL. Pep. 43, 91-96
(1993).
Tatemoto, K. et al. Nature 324, 476-478 ( 1986).
Barntt, G. Communication within animal cells. (Oxford University Press,
Oxford,
1992) .
DeFronzo, R., Bonadonna, R. and Ferrannini, E. Diabetes Care 15, 318-368 (
1992).
Hutton, J., Penn, E. and Peshavaria, M. Diabetologia 2, 365-373 ( 1982).
Grodsky, G. and Fanska, R. Methods Enzyrr~l. 39, 364-372 ( 1975).
Stempien, M., Fong, N., Rall, L. and Bell, G. DNA, 5, 357-361 ( 1986).
Dull, T., Gray, A. Hayflick, J. and Ullrich, A. Nature 310, 777-780 ( 1984).
Harlow and Lane (1988). Antibodies: A Laboratory Manual. (Cold Spring Harbour
Laboratory, Cold Spring Harbour, New York).
Huse et aL ( 1989). Science 246: 1275-1281.
Orita et al. ( 1989). Proc. Natl. Sci., USA. 86: 276-277.
Hylka, V., Teplow, D., Kent, S. and Strauss, D. J. BioL Chem 260, 14417-14420
( 1985) .
Daughaday, W. and Trivedi, B. J. CLin. Endocrinol. Metab. 75, 641-645 ( 1992).
Liu, F., Baker, B., Powell, D. and Hintz, R. J. Clin. Endocrinol. Metabol. 76,
1095-
1100 ( 1993) .
Bell, G., Gerhard, D., Fong, N., Sanchez-Pescador, R. and Rall, L. Proc. NatL.
Acad.
Sci. USA 82, 6450-6454 ( 1985).
Ong, K. et al. Nat. Genet 21, 262-263 (1999).
26
