Note: Descriptions are shown in the official language in which they were submitted.
CA 02375498 2001-12-17
WO 00/78955 PCT/US00/16900
EPITHELIAL CELL GROWTH INHIBITORS
Field of the Invention
This invention relates to a family of epithelial cell growth inhibitors useful
in the
diagnosis and treatment of epithelial cell cancers.
Background of the Invention
Epithelial cell cancers, for example, prostate cancer, breast cancer, colon
cancer, lung
cancer, pancreatic cancer, ovarian cancer, cancer of the spleen, testicular
cancer, cancer of the
thymus, etc., are diseases characterized by abnormal, accelerated growth of
epithelial cells.
This accelerated growth initially causes a tumor to form. Eventually,
metastasis to different
organ sites can also occur. Although progress has been made in the diagnosis
and treatment of
various cancers, these diseases still result in significant mortality.
The treatment of cancer is greatly enhanced by early detection. However, there
are
difficulties in detecting the disease in its early stages. For example,
epithelial tissue-
containing organs such as the prostate, ovary, and others, are not easily
palpated. The
detection of abnormal tumor growth in such organs is difficult without
frequent screening and
appropriate markers. A substantial drawback of available cancer diagnostic
assays is a high
rate of false positive and negative results, making the available tests less
reliable than desired.
For this reason, there is a great need to identify new diagnostic as well as
new therapeutic
agents to improve diagnosis and treatment of cancer, for example, prostate
cancer, breast
CA 02375498 2001-12-17
WO 00/78955 PCT/US00/16900
cancer, colon cancer, lung cancer, pancreatic cancer, ovarian cancer, cancer
of the spleen,
testicular cancer, cancer of the thymus, etc. ,
A novel, specific, mammary cell growth inhibitor, Mammastatin, has recently
been
identified and characterized. Mammastatin has been expressed from variant
clones, MammA
(PCT/US97/18026, ATCC# 97451, deposited 22 February 1996); Mamma
(PCT/US97/27147, ATCC# , deposited 15 June 2000); and MammC, described in
copending PCT application No. PCT/US00/ , filed on even date herewith (ATCC#
deposited 15 June 2000).
Mammastatin is produced and secreted by normal mammary cells, and is detected
in
blood samples of normal individuals. Blood concentrations of the mammary cell
growth
inhibitor, and particularly of the active, phosphorylated form of Mammastatin,
are reduced or
absent in breast cancer patients. Administration of protein comprising active
Mammastatin
(secreted from normal human breast cancer cells) is effective to reduce tumor
size and
number, and to prevent tumor growth in late stage cancer patients.
Epithelial cell growth inhibitors having similarity to Mammastatin have now
been
discovered, isolated, and characterized. These inhibitors bear partial
sequence identity to
Mammastatin at the 5' end of the sequence, and have little or no identity at
the 3' end of the
molecule. Like Mammastatin, the newly discovered family of epithelial cell
growth inhibitors
(ECGI) are differentially expressed in normal epithelial cell tissues, but not
in cancerous
epithelial cell tissues. Also, like Mammastatin, the newly discovered family
of epithelial cell
growth inhibitors are detected in blood samples taken from normal individuals,
but not in the
blood of patients with epithelial cell cancers, as shown in the Examples
below.
2
CA 02375498 2001-12-17
WO 00/78955 PCT/US00/16900
Summary of the Invention
A family of epithelial cell growth inhibitors (ECGI) have now been identified
in a
number of different epithelial cells. These ECGI are differentially expressed
in normal
epithelial cells, but not in epithelial cancer cells. As shown in the Examples
below,
Mammastatin-like ECGI proteins have been discovered in a variety of epithelial
cell tissues,
including prostate, colon, ovary, lung, spleen, testis, thymus, and others.
The ECGI of the invention are expressed in normal epithelial cells but not in
cancerous
epithelial cells. The Mammastatin-like ECGI proteins are encoded by nucleic
acid sequences
that hybridize to nucleic acid sequences encoding Mammastatin. The ECGI
proteins also bind
anti-Mammastatin antibody. A nucleic acid sequence encoding ECGI in prostate
cells (PRT-6,
SEQ ID NO: 4) has been isolated and characterized (PRT-6, ATCC# , deposited 15
June 2000), as described in the Examples below.
Because the ECGI of the invention are differently expressed by normal
epithelial cells
and not by cancerous epithelial cells, the presence or amount of the ECGI can
be analyzed to
diagnose cancer and/or to monitor treatment. The inventive ECGI proteins and
nucleic acids
encoding them also provide useful therapeutic agents to inhibit epithelial
cell growth, prevent
tumor formation, and treat cancer.
3
CA 02375498 2001-12-17
WO 00/78955 PCT/US00/16900
Brief Description of the Fi es
Figure 1A is a schematic diagram of an mRNA test panel showing locations of
specific
tissue mRNAs for analysis.
Figure 1B is a computer scanned image of a Northern blot showing hybridization
of
Mammastatin nucleic acid sequence to mRNA from a variety of tissues according
to the plan
shown in Figure 1A.
Figure 2 is a computer scanned image of a dot blot assay showing control,
Mammastatin standard protein, serum samples from breast cancer patients, and
conditioned
medium from normal and cancerous human prostate cells probed with anti-
Mammastatin
antibody, 7G6.
Figure 3 is a computer scanned image of a Western blot assay, showing normal
human
mammary cell lysate (A), human prostate cancer LnCap cell lysate (B), MCF7
breast cancer
cell lysate (C), and normal human prostate cell lysate (D) probed with anti-
Mammastatin
antibody, 7G6.
Figure 4 is a computer scanned image of a Western blot assay, showing cell
lysates
from normal prostate cells (A), LnCap prostate cancer cells (B), normal colon
cells (C), and
colon cancer cells (D) probed with anti-Mammastatin antibody, 7G6.
Figure 5 is a computer scanned image of a Western blot assay, showing cell
lysates
from human ovarian cancer cells (B), normal human ovarian cells (C), and
normal human
mammary cells (D) probed with anti-Mammastatin antibody, 7G6. Lane A contained
molecular weight standards.
4
CA 02375498 2001-12-17
WO 00/78955 PCT/US00/16900
Figure 6 is a computer scanned image of a dot blot assay showing serum samples
from
healthy male adults (A,C,D) and from a prostate cancer patient (B) probed with
anti-
Mammastatin antibody, 7G6.
Figure 7 is a computer scanned image of a DNA gel containing putative prostate
ECGF
DNA clones.
Figure 8 is a diagramatic representation of Prostate ECGI and its structural
relationship
to other sequences.
Detailed Description of the Invention
Proteins of the invention:
"Epithelial cell growth inhibitor (ECGI) proteins" of the invention are
defined herein to
mean Mammastatin-like proteins produced by and active to inhibit the growth of
normal
epithelial cells. Active, inhibitory ECGI proteins of the invention are
reduced or absent in
cancerous epithelial cells. The ECGI protein family disclosed herein appears
to include
inhibitors that are specific to each epithelial tissue, with little or no
inhibitory activity across
tissue types. As discussed more fully below, it is postulated that each ECGI
protein contains a
growth inhibitory domain and a tissue-specificity domain.
The ECGI proteins of the invention exhibit significant homology to
Mammastatin, a
mammary cell growth inhibitor produced by normal human mammary cells, and
previously
demonstrated be useful in the diagnosis and treatment of breast cancer
(PCT/US97/18026).
ECGI proteins bind one or more anti-Mammastatin antibodies such as 7G6
(Neomarkers,
Freemont, CA), and are encoded by nucleic acid sequences sharing significant
homology with
nucleic acid sequences encoding Mammastatin.
5
CA 02375498 2001-12-17
WO 00/78955 PCT/US00/16900
Studies reported in the Examples below demonstrate the differential expression
of
ECGI proteins in normal epithelial cell tissues, but not in cancerous
epithelial cell tissues,
including breast, prostate, ovary, and colon. Like Mammastatin, the ECGI
proteins of the
invention appear, for example, in Western blots, as doublets or triplet bands,
with one major
band and one or two smaller, less prominent bands. This pattern of expression
was
demonstrated for Mammastatin to be due to phosphorylation of the protein.
Mammastatin has
an approximate molecular weight of 53 kilodaltons when phosphorylated at two
sites. Smaller
sized Mammastatin, 49 and 44 kilodaltons, correspond to one or none of the
sites being
phosphorylated. Phosphorylation of the Mammastatin protein is correlated with
its inhibitory
activity.
Western blots of ECGI probed with the anti-Mammastatin antibody 7G6,
demonstrate
the approximate size of ECGI produced by various epithelial cell tissues. As
shown more
fully in the Examples below (see, for example, Figures 4-5), ECGI from
prostate cells
migrates in a Western blot to approximately 55 kilodaltons, with less
prominent, smaller bands
at 51 and 46 kilodaltons suggestive of phosphorylated forms similar to the
pattern seen for
Mammastatin. ECGI from colon cells migrates to approximately 50 KD, with less
prominent
bands at approximately 47 and 43 kilodaltons. ECGI from ovarian cells migrates
to
approximately 60 kilodaltons.
Nucleic Acid Sequences Encoding ECGI
Nucleic acid sequences of the invention are defined herein as those nucleic
acid
sequences that encode ECGI proteins, as defined above. Nucleic acid sequences
encoding
ECGI proteins share significant sequence homology to nucleic acid sequences
encoding
6
CA 02375498 2001-12-17
WO 00/78955 PCT/US00/16900
Mammastatin, and hybridize to nucleic acid sequences encoding Mammastatin
under
conditions of high stringency.
Mammastatin-like epithelial cell growth inhibitors preferably have substantial
identity
(at least 90 % , and preferably at least 95 % identity) over approximately
1000 contiguous
nucleotides of a nucleic acid sequence encoding Mammastatin. Nucleic acids
encoding
Mammastatin include those DNA inserts of MammA (PCT/US97/18026, ATCC# 97451,
deposited 22 February 1996); Mamma (PCT/US97/27147, ATCC# , deposited 15
June 2000); and MammC, described herein (ATCC# , deposited 15 June 2000).
Consensus sequences determined for known Mammastatin clones are shown in the
Comparative Sequence Table 5 below, and as SEQ ID NO: 1 (MammA); SEQ ID NO: 2
(Mamma); SEQ ID NO: 3 (MammC). Prostate ECGI nucleic acid sequence (SEQ ID NO:
4)
is shown in Tables 1, 2, and 5.
ECGI can be amplified from a specific epithelial cell nucleic acid library,
for example,
using internal Mammastatin primers and/or by hybridization to Mammastatin
under conditions
of strict stringency. As shown more fully in the Examples below, nucleic acid
sequences
hybridizing to Mammastatin have been demonstrated in numerous epithelial
tissues, including
central nervous system, heart, small intestine, large intestine, appendix,
rectum, lymphatic
cells, bone marrow cells, lung and air passages, bladder, uterus, prostate,
testis, ovary, liver,
pancreas, adrenal gland, salivary gland, and mammary gland (See Figure 1).
The nucleic acid sequence of a ECGI isolated from prostate cells, for example,
shares
greater than 95 % identity to Mammastatin at the 5' half of the molecule, with
little or no
identity of sequence, however, at the 3' half. It is postulated that the 5'
end, sharing identity
7
CA 02375498 2001-12-17
WO 00/78955 PCT/~JS00/16900
with Mammastatin, includes a growth inhibitory domain of the molecule, whereas
the 3' end,
having little identity to Mammastatin, includes a tissue-specificity domain.
Diagnostic Methods
The invention further provides an in vitro assay for detecting active,
inhibitory ECGI in
patient samples, including tissues, cells, and fluids. Epithelial cell cancer
and advancing
metastatic disease is diagnosed by correlating the presence and type of ECGI
protein in a
patient's sample with that of normal or cancerous human epithelial cells. A
patient's blood or
tissue sample is analyzed for the ECGI protein, e.g., for the abundance of the
ECGI protein
and/or for its molecular weight forms. As discussed below, the absence or loss
of ECGI
protein, particularly of the higher molecular weight, phosphorylated forms, is
correlated with
a specific epithelial cell indicative of advancing metastatic disease.
Analysis of ECGI can be performed using a variety of known analytical tools
and
methods, including immunoassays, hybridization, PCR techniques, and the like.
Preferred are
immunoassay, including ELISA, Western Blot, and dot-blot analysis of a
patient's sample
methods, using anti-ECGI antibodies. Preferably, recombinant ECGI standards
are used to
provide a standard curve for reliable quantitation of inhibitor levels. Such
immunoassays are
exemplified by the dot-blot assays and Western blot assays shown in the
examples below. In
an alternative preferred embodiment of the invention, tissue samples, such as
tumor biopsies,
are analyzed by immunohistochemistry, or by culturing a patient's tumor cells
and examining
the cultures for expression of ECGI.
In a particularly preferred embodiment, an assay for the diagnosis of an
epithelial cell
cancer includes at least two specific antibodies: an antibody to identify the
sampled tissue as
8
CA 02375498 2001-12-17
WO 00/78955 PCT/US00/16900
epithelial tissue, such as an anti-cytokeratin antibody, and a specific anti-
ECGI antibody. For
example, using an immunoblot format, prostate tissue suspected of containing
the prostate
cancer cells is homogenized, separated on an SDS/PAGE gel, transferred to
membrane, and
probed with both anti-keratin and anti-prostate ECGI antibodies. Isotype
specific second
antibodies that are conjugated to a suitable marker system such as peroxidase
or alkaline
phosphates are used to detect bound antibodies. Membranes containing bound
first and second
antibodies are then developed using known colormetric or fluorometric
techniques and
quantitated by known methods.
In the most preferred embodiment, the sample is analyzed for the size and/or
phosphorylated forms of the ECGI, such as by Western Blot, using anti-ECGI
antibodies. A
decline or absence of the high molecular weight ECGI protein form correlates
with advancing
cancer.
Diagnostic kits of the invention include ECGI protein or nucleic acid
sequences
encoding ECGI, for example, as controls. Optionally, the diagnostic kit
contains one or more
antibodies that bind the epithelial cell ECGI to be detected or quantified.
The antibodies may
bind a Mammastatin-like domain (for example, 7G6), or may be tissue-specific
ECGI
antibodies. Alternatively, the diagnostic kit includes one or more
amplification primer or
hybridization probe for the amplification and/or detection of nucleic acid
sequences encoding
an epithelial cell ECGI, for example, the primers used in the Examples below.
Therapeutic Use
ECGI protein for therapeutic use is produced from epithelial cell cultures
under serum
free conditions or by recombinant means. Preferably, ECGI protein is produced
in yeast or
9
CA 02375498 2001-12-17
WO 00/78955 PCT/US00/16900
higher eucaryotic cells to achieve phosphorylation of the protein. Recombinant
protein is
produced in host cells or by synthetic means.
Functional ECGI is administered to patients by known method for the
administration of
phosphoprotein, preferably by injection, to increase inhibitor levels in the
bloodstream and
increase the inhibitor's interactions with the desired epithelial.
The protein may be delivered to the patient by methods known in the field for
delivery
of phosphorylated protein agents. In general, the inhibitor is mixed with the
delivery vehicle
and administered by injection.
The dosage of inhibitor to be administered may be determined by one skilled in
the art,
and will vary with the type of treatment modality and extent of disease. Since
Mammastatin
inhibits approximately 50 % of mammary cancer cell growth at a concentration
of 10 ng/ml
and stops growth at about 20-25 ng/ml in vitro, a useful therapeutic dosage
range of ECGI is
about 2.5 ~.g to about 250 pg administered daily dose. Preferred is
approximately 125 p.g
daily administered dose. The aim of the administration is to result in a final
body dose that is
in the physiological (e.g. 15-50 ng/ml) or slightly higher range (for example,
25-75 ng/ml).
For clinical use, the preferred dosage range is about 500 ng/ml for initial
treatment of
metastatic disease, followed by a maintenance dosage of about 50 ng/ml. In
clinical studies
using Mammastatin, an administered daily dose of about 50 ng/ml to about 750
ng/ml was
sufficient to induce remission to Stage IV breast cancer patients.
Since active ECGI is a phosphorylated protein, it is anticipated that multiple
doses of
the inhibitor will be required to maintain growth inhibiting levels of ECGI in
the patient's
blood. Also, since ECGI generally acts as a cytostatic agent rather than a
cytocidal agent, it is
CA 02375498 2001-12-17
WO 00/78955 PCT/US00/16900
expected that a maximum effect of the inhibitor will require regular
maintenance of inhibitor
levels in epithelial cell cancer patients.
In its preferred use, the ECGI is administered in high dosages ( > 50 ng/ml,
preferably
about 50-500 ng/ml) to induce tumor regression. Lower, maintenance doses ( <
50 ng/ml,
preferably 20-50 ng/ml) are used to prevent cancer cell growth.
Clinical experience with administered Mammastatin in Stage IV breast cancer
patients
indicates a useful dose is that which maintains physiological levels of
Mammastatin in the
blood. Administration is preferably daily, but, may be, for example, by
continuous infusion,
by slow release depot, or by injection once every 2-3 days. Anecdotal evidence
suggests
continuous administration may induce feedback inhibition, thus, a preferred
administration
scheme is to administer daily dose of Mammastatin for approximately 25-28
days, followed by
2-5 days without administration.
Diagnostic Assay
Assays of the present invention for detecting the presence of the functional
inhibitor in
human tissue and serum are useful in screening patients for epithelial cell
cancer, for screening
the population for those at high risk of developing epithelial cell cancer,
for detecting early
onset of epithelial cancer, and for monitoring patient levels of inhibitor
during treatment. For
example, analysis of a patient's blood ECGI, for example, may indicate a
reduced amount of
high molecular weight, phosphorylated prostate ECGI, as compared with a normal
control or
with the patient's prior prostate ECGI profile. Such a change is correlated
with increased risk
of prostate cancer, with early onset of prostate cancer, and with advancing
metastatic prostate
cancer. Diagnostic assay for phosphorylated, active, 55 kD prostate ECGI
preferably is by
11
CA 02375498 2001-12-17
WO 00/78955 PCT/US00/16900
Western blot immunoassay, or ELISA using specific anti-ECGI antibodies.
Screening, for
example, in serum, is preferably by immunoassay, e.g., ELISA, Western blot, or
dot blot
assay.
For best results, the patient samples should be assayed within a short time of
sampling
(within one week), stored at 4°C (less than one year), or frozen for
long term storage. Most
preferably, samples are frozen until time of assay.
EXAMPLES
The invention may be better understood by reference to the following Examples,
which
are not intended to limit the invention in any way.
EXAMPLE 1
Multiple Tissue Expression of ECGI
Northern blot analysis was performed on a multiple tissue expression array
(Clonetech,
Inc. #7775-1) to demonstrate the expression of ECGI in a variety of epithelial
cell tissues. A
digoxin-labeled EcoRl fragment of Mammastatin, containing approximately 1800
base pairs of
the 3' region of pMammC, SEQ ID NO: 3 (approximately nucleotide 359 - end) was
used as
a probe. The DIG-labeled Mammastatin cDNA was hybridized to the array in 10 ml
easy
HYB solution (Roche) for 16 hours at 65° C, with 65° C washes,
anti-DIG antibody
hybridization and CSPD development performed according to the manufacture's
instructions.
The blot was then exposed to Kodak X-GMAT film for 30 minutes at room
temperature.
The tissue plan of the multiple tissue expression array is shown in Figure 1A.
Hybridization of the Mammastatin cDNA to the mRNA of the array is shown in
Figure 1B,
12
CA 02375498 2001-12-17
WO 00/78955 PCT/US00/16900
and demonstrates the variety of epithelial cell tissues expressing a
Mammastatin-like ECGI
sequence. Specific tissues that hybridized to the Mammastatin cDNA included:
central
nervous system, heart, small intestine, large intestine, appendix, rectum,
lymphatic cells, bone
marrow cells, lung and air passages, bladder, uterus, prostate, testis, ovary,
liver, pancreas,
adrenal gland, salivary gland, and mammary gland.
EXAMPLE 2
Normal Versus Cancerous Prostate Cells
Normal prostate cells obtained from surgical samples and cancerous prostate
cells,
LnCap, obtained from the American Type Culture Collection (ATCC) were
incubated and
analyzed for the production of a prostate ECGI. The cells were cultured in
DMEM/F12 media
with 40 pM calcium, supplemented with 5 % Chelex-treated horse serum, 10 ng/mL
EGF, 10
pg/mL insulin, 100 ng/mL Cholera toxin and 1 ~g/mL hydrocortisone for four
days.
Conditioned media samples were then collected and analyzed.
Normal human mammary cells obtained from patient samples were incubated in the
same medium and Mammastatin secreted into the culture medium was used as a
control.
Serum obtained from breast cancer patients was also analyzed and used as a
control.
Sample fluids were collected and loaded by suction onto a nitrocellulose
membrane on
a dot blot apparatus. The membranes were then probed with the anti-Mammastatin
antibody
7G6, and antibody binding was detected with goat-anti mouse antibody labeled
with alkaline
phosphates. Color was developed with NBT/BCIP substrate system (Life
Technologies). The
results are shown in Figure 2.
13
CA 02375498 2001-12-17
WO 00/78955 PCT/US00/16900
The anti-Mammastatin antibody recognized a protein produced by normal prostate
cells but not cancerous prostate cells. This is analgous to the antibody's
recognition of the
mammary cell growth inhibitor, Mammastatin, produced by normal mammary cells,
but not
breast cancer cells. This data, in combination with the data from Example 1,
demonstrates the
production of Mammastatin-like ECGI in other epithelial cell tissues, and
particularly, in
prostate cells.
EXAMPLE 3
Differential Expression of ECGI in Prostate, Colon, and Ovary
Prostate
Normal prostate cells (Clonetech, Inc.), LnCap prostate cancer cells
(A.T.C.C.),
MCF7 breast cancer cells (A.T.C.C.) and normal human mammary cells (obtained
from
hospital tissue) were incubated as described above for Example 2. After at
least 48 hours
incubation, cells were lysed in sample loading buffer and analyzed for the
presence of ECGI
by Western blot, using the anti-Mammastatin antibody, 7G6 as a probe. Normal
human
mammary cell protein (NHMC) lysate (1 mg/ml) was used as a Mammastatin control
(A).
The data are shown in Figure 3.
Normal prostate cell lysate (D) contained a protein that was recognized by
anti-
Mammastatin antibody, while prostate cancer cells (LnCap) (B) and breast
cancer cells
(MCF7) (C) did not. The protein recognized in the prostate cell lysate (D) was
of a similar
size to that of Mammastatin (A).
14
CA 02375498 2001-12-17
WO 00/78955 PCT/US00/16900
Colon and Prostate
Normal prostate cells (Clonetech, Inc.), LnCap prostate cancer cells
(A.T.C.C.), Sw
948 colon cancer cells (A.T.C.C.), and normal colon epithelial cells (obtained
from patient
surgery tissue) were incubated as described above for Example 2. Cell lysates
were prepared
in sample loading buffer and analyzed for expression of ECGI by Western blot,
using the anti-
Mammastatin antibody, 7G6 as a probe.
As shown in Figure 4, normal prostate (A) and normal colon (C) epithelial
cells
expressed a protein that was recognized by the anti-Mammastatin antibody,
while cancer cells
from these tissues did not (B,D). The differential expression of protein is
similar to that
demonstrated for Mammastatin in breast tissue. In addition, the pattern of
bands shown in the
Western blot for normal prostate and colon tissues is similar to the
Phosphorylation pattern
demonstrated for Mammastatin produced in normal human mammary cells. A larger
prominent band is shown together with two smaller, fainter bands. This pattern
has been
correlated with Phosphorylation of Mammastatin.
Prostate ECGI is shown in the Western blot analysis (Figure 4) to have an
approximate
molecular weight of 51 kilodaltons; Colon ECGI is shown to have an approximate
molecular
weight of 50 kilodaltons.
Ovary
OvCar-ovarian cancer cells (A.T.C.C.), normal human ovarian cells (patient
surgery
tissue) and normal human mammary cells (patient surgery tissue) were incubated
as described
above for Example 2. After an incubation period of at least 48 hours, direct
lysates were
prepared by removing growth media and rinsing cells with saline and SDS-PAGE
sample
loading buffer until viscous. Lysates were collected and separated on 10% SDS-
PAGE,
CA 02375498 2001-12-17
WO 00/78955 PCT/US00/16900
transferred electrophoretically onto nitrocellulose, and probed with the 7G6
anti-Mammastatin
antibody. The data are shown in Figure 5, where lane A contains molecular
weight standards;
B, OvCar-ovarian cancer cell lysate; C, normal human ovarian cell lysate; and
D, normal
human mammary cell lysate.
Figure 5 demonstrates that a Mammastatin-like ECGI protein is produced in
normal
human ovarian tissues and is recognized by anti-Mammastatin antibody. The
protein is not
expressed in the ovarian cancer cells analyzed. The ovarian ECGI has an
approximate
molecular weight of 60 kilodaltons.
Example 4
Differential Detection of Prostate ECGI in Blood
Serum samples from three healthy male volunteers were analyzed for the
presence of
the prostate ECGI, and compared with that of serum from a prostate cancer
patient. Serum
samples were loaded at 400 microliter and 200 microliter samples in duplicate.
The samples
were drawn onto nitrocellulose by vacuum in a 96 well dot blot apparatus. The
filters were
then probed with the anti-Mammastatin antibody, 7G6, and developed with
NBT/BCIP
substrate. The data are shown in Figure 6.
Normal human mammary cell (NHMC) cultures produced standard conditioned
medium for comparison. Standards, in duplicate, contained 400, 200, 100, 50,
25, 12, and 6
microliters of NHCM medium. Serum samples from healthy adult males (A,C,D) and
from an
adult prostate cancer patient (B) were assayed using 400 and 200 microlites of
serum sample.
A prominent signal from normal serum (A,C,D) demonstrated the presence of
prostate ECGI,
while the prostate cancer patient's serum showed only a weak signal.
16
CA 02375498 2001-12-17
WO 00/78955 PCT/US00/16900
Example 5
Inhibitory Activity of Prostate ECGI
Normal prostate cells (Clonetech, Inc.), PC3 and LnCap prostate cancer cells
(A.T.C.C.) were plated at a density of 5.0 x 10' cells per milliliter in 12
well plates in 12PMI
medium containing 10% fetal bovine serum. After 24 hours, the cultures were
supplemented
with 10% conditioned medium. Each sample was run in triplicate. Plates were
allowed to
incubate for six days at 37°C and 5 % COz, and at the end of the
incubation period, cells were
lysed with Cetrimide and counted using a Colter Counter. Percent inhibition
was calculated
by comparing treated versus non-treated wells, and the data shown in the table
below.
Androgen-insensitive PC3 cells were not inhibited by the normal prostate cell
media or by the
conditioned medium obtained from normal prostate cells. In contrast, LnCap
cells were
inhibited by the addition of growth medium, with the inhibition somewhat
greater by media
derived from normal prostate versus media derived from cancer cells.
Cell Type % Inhibition by % Inhibition
Normal Prostate by
medium Prostate Tumor
medium
LnCap #1 22.5 + /- 3.3 8.3 + /- 0.4
LnCap #2 22.7 + /- 0.6 16.7 + /- 15.8
PC3 0 0
Example 6
Isolation and Characterization of Prostate ECGI DNA
Nucleic acid libraries were produced from the mRNA of normal prostate cells
(patient
surgery tissue) and from LnCap, prostate tumor cells (A.T.C.C.).
17
CA 02375498 2001-12-17
WO 00/78955 PCT/US00/16900
The nucleic acid sequences in the normal and cancerous prostate cell libraries
were
incorporated into vectors and used to transform bacteria. Colonies of bacteria
expressing the
normal and cancer prostate cell nucleic acid sequences were screened by
hybridization with a
digoxin-labeled Mammastatin nucleic acid probe under stringent conditions, as
described
above.
The positive colonies were selected and grown in LB broth. Plasmids obtained
from the
positive colonies were purified and digested with ECO R1 and Xhol to release
the CDNA
inserts. The digested DNA was then separated on a 1 % agarose gel (see Figure
7A) and the
separated DNA was subjected to Southern blot analysis using the digoxin-
labeled Mammastatin
fragment as a probe. As shown in Figure 7 below, two prostate ECGI clones were
isolated,
each having an approximate size of 2 Kb: One clone was isolated from the
normal prostate
tissue library (PRN2.1) and one from the LnCap prostate tumor cell library
(PRT-6).
PRT-6 was further characterized, and its nucleic acid sequence was determined.
As
shown below in Table 1, the nucleic acid sequence encoding Prostate ECGI has
substantial
identity to Mammastatin (greater than 90%) at the 5' end of the molecule
(approximately
nucleotides 15-1032 of MammC), with little or no identity at the 3' end of the
molecule.
These regions of similarity and distinction are shown diagrammatically in
Figure 8.
Example 7
Isolation and Characterization of Prostate ECGI DNA
Nucleic acid libraries were constructed from the mRNA or normal prostate cells
(obtained from patient surgery tissue) and from LnCap prostate tumor cells
(A.T.C.C.). The
library cDNA was used to transfer E.coli and plated out for colony
hybridization. The
18
CA 02375498 2001-12-17
WO 00/78955 PCT/US00/16900
colonies were screened with a digoxin-labeled Mammastatin C fragment generated
by PCR
using external PCR primers M200 and M2200.
[Sequence ID NO: 5] M200: GCGCCGGCCGGGCGCGACCCG
[Sequence ID NO: 6] M2200: GCAATCTCAGCGCACTGCTGC
Bacterial colonies expressing prostate ECGI clones were hybridized to the
labeled
Mammastatin probe under strict hybridization conditions, as described above.
Example 8
Homology of Prostate ECGI
The prostate ECGI sequence was analyzed against nucleic acid sequences present
in
GenBank. Portions of two molecules showed some similarity to domains within
the prostate
ECGI sequence: 28SmRNA and Hip55.
28SmRNA homology has been identified in many gene sequences with importance in
growth regulation (Hu et al., 1999, PNAS 96:1339-1344; Mauro et al., 1997,
PNAS 94:422-
427). Hip55 is a protein that binds to hematopoetic progenitor type 1 kinase,
a protein
involved in the src signal transduction pathway (Ensena et al, 1999, JBC
274:33945-50).
Using the open reading frame known for Hip55, a putative amino acid sequence
was
deducted for the prostate clone. As shown below in Table 3, the translation
includes several
internal stop codons.
Also using the Hip55 ORF, a putative amino acid sequence was deduced for Mamma
and MammC sequences, shown in Tables 4 and 5.
19
CA 02375498 2001-12-17
EPO - DO ~
18. 1 Q 2000
SEQUENCE LISTING
<110> HIOTHERAPIES, INC.
<120> EPITHELIAL CELL GROWTH INHIBITORS
<130> 4273.3WOU1
<140> PCT/US00/16900
<141> 2000-06-19
<150> 607139;995
<151> 1999-06-18
<160> 10
<170> Patentln Ver. 2.1
<210> 1
<211> 2418
<212> DNA
<213> Homo sapiens
<400> 1
tggggctcca ccccggtggc ggccgctcta gaactagtgg atcccccggg ctgcaggaat 60
tcggcacgag cacggtgaag agacatgaga ggtgtagaat ccgtgqgagg cccccggcgc 120
ccccccggtg tccccgcgag gggcccgggg cggggtccgccggccctgcg ggccgccggt 180
gaaataccac tactcttatc gttttttcac tgacccggtc gagcgggggg gcgagccccg 290
aggggctctc gcttctggcg ccaagcgccc ggccgcgcgc cggccgggcg cgacccgctc 300
cggggacaqt gccaggtggg gagtttgact ggggcggtac acctgtcaaa cggtaacgca 360
ggtgtcctaa ggcgagctca qggaggacag aaacctcceg tggagcaqaa gggcaaaagc 420
tcgcttgatc ttgattttca gtacgaatac agaccgtgta agcggggcct cacgatcctt 480
ctgacctttt gggttttaag caggaggtgt cagaaaagtt accacaggga taactggctt 540
gtgqcggcca agcgttcatt aggacgtcgc tttttgatcc ttcgatgtcg gctcttccta 600
tcattgtgta gcagaattca ccaagcgttg gattgttcac ccactaatag ggaacgtgag 660
ctgggtttag accgtcgtga gacaggttat ttttacccta ctgatga.ttg tttgttgcca 720
tggttatcc.t gctcagtacg agaggaaccg caggttcaga eatttggtgt atgtgcttgg,780
ctgaggagcc aatggggcga agctaccatc tgtgggatta tgactgacgc tctaagtcat 890
gaatcccgcc caggcggaac gatacggcag cgccgcggag cctcggttgg cctcggatta 900
gccggtcccc cgcctgtccc cgccggcggg ccgccccccc ccctccacgc gccccgcgcg 960
cgcgggaggg cgcgtgcccc gccgcgcgcc gggaccgggg tccggtgcgg agtgcccttc:-1020
gtcctgggaa acgqggcqcg gccggaaagg cggccgcccc ctcgcccgtc acgcaccgca 1080
cgttcgtgct cgtgccgaat tcggcacgag tgcacccatt cacaatatac atacaagtgc 1140
atgtatcttt atgatataat gaattctttt cctttgggta gatatccagt agtgggattg 1200
ctagatcacc tggtagttct atttctggtt tatttagaaa tcttcatact gatttccata 1260
gaggttgtac aaatttacat ccctaccaaa gtgatttttt taaatatgaa agaatggtct 1320
ggagaaatgc ccctcattag tatccccctt ttacctctct actgcagaat gacttcaagg 1380
ggtacaggta tttacaagtt tcattataca gacaaattga atattgaaat tttctgcata 1940
1
~f
~ry~e 20'-09 2E~01~ , 'e,~~~~~~ ~ ~~ ~ .~ , ~ '= _
5~wh-L~R.23"fineaaik. Fti~:~.W?~' .~44.ei~:.we~r.G~i~.uxu
" _.. ... t'1 .. .... ,.::.! ".,.v..";,,. ....._.
i~~_ ..rs~: . 'r,:.. ,
CA 02375498 2001-12-17
agaggcacag attttaggat tcaaagttgt atgaacaagg acaagtgctc tagggacttg 1500
caaagctgga attggaaatc tcagatgaaa tacatttcta gtagtaccac cagcatatat 1560
tctactgaat tggcttttgt gatcatcatt aatacctact att:aaaact-aatgaaaagg 1620
gtttatatca aatatacttt aaggtataaa aatcasatta taggta agc tgttttcttt 1680
agcattttaa tttcaaaaca taaaatagct acegtctatt gqgcatttat actgtacgag 1790
acactgtgtt tgtcacattt caaaaatgtt'ctcatggtaa tgttcacaat aattctgtcg 1800
ggtgagaaaa tagtcttacc gtagtaagac tattcagtaa aacgaaacct ctgaaccttg 1860
gagttcaact tgcgcaaagt tagtaacagg actaggactt gaacctgaaC catcacactc 1920
gagatctctc cataccacac tgctagcaca tgtgcctgtc atcttattcc tggctccctt 1980
ttttatttcc tttcccttcc tcccacaacc cctttttccc cccatttctt ctt~ctttt 2090
tatttqttaa ttacataact aatacatgtt tatgagaaca attgatatag cacaaaagga 2100
tataaagtac gggggagtga tagctcatcc ctgtaatcct agcactttgg aaggccaagg:2160
caggcagatc actttgagtc cagagttcga gaccagcctg ggcaacatgg 'tgaaaccctg 2220
tctctacaaa aaaatacaaa aaatttagcc gggcgtgctg gcacagacct gtagtctcag.2280
ctactctgag ggctgaggtg ggaagattga ttgagcccag gaggtggaag ctgcagcagt 2390
gcgctgagat tgcgccattg cactccagcc tgggtgagag agagagaccc tgtctccaaa 2900
aaaaaaaaaa aaaaaaaa 2418
<210> 2
<211> 2326
<212> DNA
<213> Homo sapiens
<400> 2-- . _ _ _
cggcacgagc acggtgaaga gacatgagag gtgtagaata agtgggaggc ccccggcgcc 60
cccccggtgt ccccgcgagg ggcccgcggg tccgccggcc cgcgggcgcc ggtgaaatac 120
cactactctg atcgtttttt cactgacccg gtgaggcggg gggcgagccc cgaggggctc X80
tcgcttctgg-Cgccaagcgc ccggccgcgc gccggccggg cgcgaccCgc tccggggaca 240
gtgccagtgg ggagtttgac tggggcggta cacctgtcaa acggtaacgc aggtgtccta 300
aggcgagctc agggaggaca aaacctcccg tggagcagaa gggcaaaatg atcttgattt 360
tcagtacgaa tacagaccgt gaaagcgggg cctcagatct tctgaccttt tgggttttaa,920
gcaggaggtg tcagaaaagt taccacaggg ataactggct tgtggcggcc aagcgttcaa 980
agcgacgtcg ctttttgatc cttegatgtc ggctcttcct atcattggga agcagaattc 590
accaagcgtt ggattgttca-cccactaata gggaacgtga gctgggtt.ta gaccgtcgtg .600
agacaggttt gtttecccta ctgatgatgt gttgttgcca tggtaatcct gctcagtacg 660
agaggaaceg caggttcaga -catttggtgt atgtgcttgg ctggggagcc aatggggcga 720
agctaccatc tgtgggatta ttactgaacg cctctaagtc agaatcccgc ccaggcggaa 780
cgatacggca gcgccgcgga gcctcggttg gcctcggatg gccggtcccc cgcctgtccc 890
cgccggcggg cgcccceccc cctccacgcg ccccgcgcgc gcgggagggc gcgtgccccg 900
ccgcgcgccg ggaccggggt ccggtgcgga gtgcccttcg tcctgggaaa cggggcgcgg 960
ccggaaaggc ggccgccccc tcgcccgtca cgcaccgcac gttcgtgctc gtgccgaatt 1020
cggcacgagt agcaccattc acaatagaca tacaagtgca tgtatcttta ttatataatg 1080
aattcttttc ctttggggag atatccagta gtgggabtgc tagatcacct ggtagttcta 1190
tttctggttt attgagaaat cttcatactg atttccatag aggttgtaca aatttacatc 1200
cctaccaagt gattttttta aatatgaaag aatggtctgg agaaatgccc ctcattagta 1260
tccccctttt acctctctac tgcagaatga cttcaagggg tacaggtatt tacaagtttc 1320
attatacaga caaattgaat attgaaattt ctgcattaga ggcacagatt ttaggattca 1380
2
''6 ' "'11f" ' CA 02375498 2001-12-17
aagttgtaag aacaaggaca agtgctctag ggacttgcaa agctggaatt ggaaatctca 1440
gaagaaatac atttctagta gtaccaccag catatattct actgaattgg ctttgtgatc 1500
atcatttata cctacttatt aaaactaatg aaaagggttt atatcaaata tactttaagg 1560
taaaaaaatc aaattatagg aaaagctgtt ttcttttgca ttttaatttcaaaacaaaaa 1620
atagctaccg tctattgggc atttatactg taccagacac tgtgtttgtc acatttcaaa 1680
aatgttctca tggtaatgtt cacaataatt ctgtagggtg gagaaatagt cttaccqtag 1740
taagactatt cagaaacgaa acctcegaac cttggagttc aacttgcgca aagttagtaa 1800
caggactagg act.tgaacct gaaccatcac actccagatc tctccatacc acactgctag 1860
cacatg.tgcc tgtcatctta ttcctggctc cctkyttatt tcctttccct tcctcccaca 1920
accccttttt ccccccattt cttttctttc tttttatttg ttaattacat aactaataca 1980
tgtttatcag aacaattgat atagcacaaa agqatataaa gtacgggtga gtgatagctc 2040
atccctgtaa tctagcactt tggaaggcca aggcag_gcag atcacttgat ccaz~agttcg 2100
agaccagcct gggcaacatg gtgaaaccct gtctctacaa aaaaatacaa aaatttagcc.2160
gggcgtgctg gcacacacct gtagtctcag ctactctgag ggctgaggtg ggaagattga -2220
ttgagcccag gaggtggaag ctgcagcagt gcgctgagat tgcgccattg cactccagcc :2280
tgggtgagag agagagaccc tgtcttcaaa aaaaaaaaaa aaaaaa 2326
<210> 3
<211> 2355
<212> DNA
<213> Homo Sapiens
<400> 3
gaattcggca cgagcacqgt_gaagagacat gaqaggtgta gaataagtgg gaggcccccg 60
gcgccccccc ggtgtccccg cgaggggccc ggggcggggt ccgccggcec tgcgggccgc 120
cqgtgaaata.ccactactct gatcgttttt tcactgaccc ggtgagqcqg:,gggggcgagc-180
cccgaggggc tctcgcttct ggcgccaagc gcccggccgc_gcgccggccg:'g_gcgcqaccc 240
gctccgggga cagtgccagg tggggagttt gactggggcg gtacacctqt caaacggtaa 300
cgcaggtgtc ctasgqcgag ctcagggagg, acagaaacct cccgtggagc agaaqggcaa 360
aagctcgctt gatcttgatt ttcagtacga atacagaccq tgaaagcggg gcctcacgat 420
ccttctgacc ttttgggttt taagcaggag",gtgtcagaaa agttaccaca.gggataactg 480
gcttgtggcg gccaagcgtt cat,agcgacg tcgctttttg atccttcgat gtcggctctt 590
cctatcattg tgaagcagaa ttcaccaagc gttggattgt tcacccacta ataq.ggaacg, 600
tgagctgggt ttagaccgtc gtgagacagg ttagttttaa cctactgatg atgtgttgtt 660
gccatggtaa tcctgctcag tacgagagga accgcaggtt cagacatttg gtgtatgtgc 720
ttqgctgagg agccaatggg gcgaa'gctac catctgtggg attatgactg aacgcctcta 780
agtcagaatc ccgcccagqc ggaacgatac ggcagcgccg cggagcctcg.gttggcctcg 840
gatagccggt cccecgcctg tccccgccgg'cgggccgccc ccccccetcc acgcgccccg 900
cgcgcgcggg agggcgcgtg ccccgccgcg cgccgggacc ggggtccggt gcggagtgcc 960
cttcgtcctg ggaaacgggg cgcggccgga aaggcggccg ccccctcgcc cgtcacgcac 1020
cgcacgttcg tgctcgtgcc gaattcggca cgagtagcac cattcacaat agacatacaa 1080
gtgcatgtat ctttatgata taatgaattc ttttcctttg ggtagatatc cagtagtggg 1190
attgctagat cacctggtag ttctatttct ggtttattga gaaatcttca tactgatttc 1200
catagaggtt gtacaaattt acatccctac caagtgattt ttttaaatat gaaagaatgg 1260
tctggagaaa tgcccctcat tagtatcccc cttttacctc tctactgcag aatgacttca 1320
aggggtacag gtatttacaa gtttcattat acagacaaat tgaatattga aatttctgca 1380
taagaggcac aqattttagg attcaaagtt gtatgaacaa ggacaagtgc tctagggact 1440
3
a e~ ;~. a~~wy . n .
~~ r, .~~ '
~Prmted:2~-09 2~~01 ~~ a ~~ _; ~t ~ ~ ~.~r~. .
.~ ~'~-.R~o- t ; , - _ . ' .
CA 02375498 2001-12-17
tgcaaagctg gaattggaaa °ctcagatga aatacat tc tagtagtacc accagcatat 1500
attctactga attggctttg tgatcattat taatacctac ttattaaaac taatgaaaa'g 1560
ggtttatatc aaatatactt taaggtataaaaatcaaatt.ataggtaaag ctgttttctt 1620
tagcatttta atttcaaaac ataaaatagc taccgtctat tgggcattta tactgtacca 1680
gacactgtgt ttgtcacatt tcaaaaatgt tctcatggta atgttcacaa taattctgta 1740
gggtgagaaa tagtcttacc gtagtaagac tattca9taa acgaaacctc tgaaccttgg 1800
agttcaactt qcgcaaagtt agtaacagga ctaggacttg aacctgaacc atcacactcc 1860
agatctctcc ataccacact gctagcacat gtgcctgtca tcttatt~cct-ggctcctgtt 1920
atttcccttt ttatttcctt tcccttcctc ccacaacccc tttttccccc catttctttt 1980
ctttcttttt aattgttaat tacataacta atacatgctt atcagaacaa ttgatatagc 2090
acaaaaggat ataaagtaeg ggtgagtgat agctcatccc tgtaatccta gcactttgga 2100
aggccaaggc aggcagatca cttgagtcca gagttcgaga ccagcctggg caacatggtg 2160
aaaccctgtc tctacaaaaa aatacaaaaa tttagccggg cgtgctggca cacacctgta 2220
gtctcagcta ctctgagggc tgaggtggga agattgattg-agcccaggag gtggaagctg'2280
cagcagtgcg ctgagattgc gccattgcac tccagcctgg gtgagagaga gagaccctgt 2340
sctcaaaaaaa aaaaa 2355
<210> 9
<211> 2333
<212> DNA
.<213> Homo Sapiens
<900> 9
gcacgagatt cccactgtcc ctacctatta tccagcgaaa ccacagccaa gggaacgggc--60
ttggcqgaat cagcggggaa agaagaccct gttgagcttg ggcccccggc gcccccccgg 120
tgtccccgcg aggggcccgg ggcggggtcc gccggccctg cgggccgccg gtgaaatacc 180
actactctga tcgttttttc actgacccgg tgaggcgggg gggcgagccc cgaggggctc 240
tcgcttctgg cgccaagcgc ccggccgcgc gccggccggg cgcgacccgc tccggggaca 300
gtgccaggtg gggagtttga ctggggcggt acacctgtca aacggtaacg caggtgtcct 360
aaggcgagct cagggaggac agaaacctcc cgtggagcag aagggcaaaa gctcgcttga 420
tcttgatttt cagtacgaat acagaccgtg aaagcggggc ctcacgatcc ttctgacctt 980
ttgggtttta agcaggaggt gtcagaaaag ttaccacagg gataactggc ttgtggcggc 540
caagcgttca tagcgacgtc gctttttgat ccttcgatgt cggctcttcc tatcattgtg 600
aagcagaatt caccaagcgt tggattgttc acccactaat agggaacqtg agctgggatt 660
agaccgtcgt gagacaggtt agttttaccc tactgatgat gtgttgttgc catggtaatc 720
ctgctcagta cgagaggaac cgcaggttca gacatttggt gtatgtgctt ggctgaqgag 7B0
ccaatggggc gaagctacca tctgtgggat tatgactgaa cgcctctaag tcagaatccc 890
gcccaggcgg aacgatacgg cagcgccgcg gagcctcggt tggcctcgga tagccggtcc 900
cccgcctgtc cccgccggcg ggccgccccc ccctccacgc gccccgcgcg cgcgqgaggg 960
cgcgtgcccc gccgcgcgcc gggaccgggg tccggtgcgg agtgcccttc gtcctgggaa 1020
acggggcgcg gccggaaagg cggccgcccc ctcgcccgtc acgcaccgca cgttcgtggg 1080
gaacctggcg ctaaaccacc tccatctcca gtcctcagcc tggcaagctg aggagcccct 1140
tcctgcagaa gcagctcacc caaccagaga cccactttgg cagagagcca gctgctgcca 1200
tctcaaggcc cagggcagat ctccctgctg aggagccggc gcccagcact cctccatgtc 1260
tggtgcaggc agaagaggag gctgtgtatg aggaacctcc agagcaggag accttctacg 1320
agcagccccc actggtgcag cagcaaggtg ctggctctga gcacattgac caccacattc 1380
agggccaggg gctcagtggg caagggctct gtgcccgtgc cctgtacgac taccaggcag 1940
9
.Printed 20=09 X00'1 ,~~~~j~~~~ ,r . ,,
..: _ ... . . . . . ,: r. _ .. a - ~~r_..,~;~ ~.2..: .. :_._
CA 02375498 2001-12-17
ccgacgacac agagatctcc tttgaccccg agaacctcat cacgggcatc gaggtgatcg 1500
acgaaggctg gtggcgtggc tatgggccgg atggccattt tggcatgttc cctgccaact 1560
acgtggagct cattgagtga ggctqagggc acatcttgcc cttcccctct cagacatggc 1620
ttccttattg ctggaagagg aggcctggga gttgacattc agcactcttc caggaatagg 1680
acccccagtg aggatgaggc ctcagggctc cctccggctt ggcagactca gcctgtcacc 1790
ccaaatgcag caatggcctg gtgattccca cacatccttc ctgcatcccc cgaccctccc 1800
agacagcttg gctcttgccc ctgacaggat actgagccaa gccctgcctg tggccaagcc 1860
ctgagtggcc actgccaagc Cgcggggaag ggtcctgagc aggggcatct gggagqctct 1920
ggctgccttc tgcatttatt tgcctttttt ctttttctct tgcttctaag gggtggtggc 1980
caccactgtt tagaatgacc cttgggaaca gtgaacgtag agaattgttt ttagcagagt 2090
ttgtgaccaa agtcagagtg gatcatggtg gtttggcagc agggaatttg tcttgttgga 2100
gcctgctctg tgctccccac tccatttctc tgtccctctg cctgggctat gggaagtggg 2160
gatgcagatg gccaagctcc caccctgggt attcaaaaac ggcagacaca acatgttcct 2220
ccacgcqgct cactcgatgc ctgcaggccc cagtgtgtgc ctcaactgat tctgacttca 2280
ggaaaagtaa aaaaaaaaaa aaaaaactcg agaagctttg gacttcttcg cca 2333
<210> 5
<211> 21
<212>- DNA
<213> Homo Sapiens
<900> 5
gcgccggccg ggcgcgaccc g 21
<2i0> 6
<211> 2T
<212> DNA
<213> Homo sapiens
<400> 6
gcaatctcag cgcactgctg c 21
<210> 7
<211> 2843
<212> DNA
<213> Homo Sapiens
<400> 7
ctttgggagg ccgaqgccgt aggatccctc gaggaatcgc ctaaccctgg ggaggttgag 60
gttgcagtga gtgagccata gttgtgtcac tgtgctccag tctgggcgaa agacagaatg 120
aggccctgcc acaggcaggc aggcaggcag gcaggcagaa agacaacagc tgtattatgt 180
tcttctcagg gtaggaagca aaaataacag aatacagcac ttaattaatt tttttttttt 290
ccttcggacg gagtttcact cttggtgccc acgctggagt gcagtggcac catctcggct 300
caccgcaacc tccacctccc gcgttcaagc gattctcctg cctcagcctc ctgagtagct 360
gggattacag ggaggagcca ccacacccag ctgattttgt attgttagta gagacggcat 920
~.a~~.=:
I
CI ~2C~.~~ ~ ~~d1.: ~ a ~ ~ ~; ~f~'_
-,b _,. , _ _. . . ., .......... .. ,. ...." .. _ ...._ m~"'~°-
~W°*~~"'~~°'~' "°'"'q"'~u~""°"~
r,k_..:~
CA 02375498 2001-12-17
ttctccatgt gggtcaggct.ggtctcgaac tggcgacccc agtggatctg cccgccccgg 980
cctcccaaaq tgctggggtg-acaggcgtga gccatcgtga ctggccggct acgtttattt:540
atttattttt ttaattattt tacttttttt tagttttcca ttttaatcta tttatttat.t 600
tacatttatt tatttattta tttatttact tatttattta ttttcgagac agactctcgc.660
tctgctgccc aggctggagt gcagcggcgt gatctcggct cactgcaacg :tccgcctccc 720
gggttcacgc cattctcctg cctcagcctc ccaagtagcG.gggactacag-gcgcccgcca 780
ccgtgcccgg ctaacttttt gtattttgag tagagatggg gtttcactgt ggtagccagg,890
atggtctcga,tctcctgacc,ccgtgatccg tccacctcgg cctcccaaag tgctgggatg :900
acaggcgtga gccaccggct ccggcctatt tatctattta ttaactttga gtccaggtta 960
tgaaaccagt tagtttttgt:aatttttttt tttttttttt ttttttgaga,cgaggtttca 1D20
ccgtgttgcc aaggcttgga ccgagggatc caccggccct cggcctecca aaaqtgcggg 1080
gatgacaggc:,gcgagcctac cgcgcccgga cccccccttt ccccttcccc,-cgcttgtctt 1190
cccgacagac agtttcacgg cagagcgttt ggctggcgtg cttaaactca ttctaaatag 1200
aaatttggga cgtcagcttc tggcctcacg gactctgagc cgaggagtcc cctggtctgt 1260
ctatcacagg accgtacacg taaggaggag aaaaatcgta acgttcaaag tcagtcattt 1320
tgtgatacag aaatacacgg attcacccaa aacacagaaa ccagtctttt agaaatggcc 1380
ttagccctgg tgtccgtgcc agtgattctt ttcggtttgg accttgactg agaggattcc 1940
cagtcggtct ctcgtctctg gacggaagtt ccagatgatc cgatgggtgg gggacttagg.1500
ctgcgtcccc ccaggagccc tggtcgatta gttgtgggga tcgccttgga gggcgcggtg 1560
acccactgtg ctgtgggagc ctccatcctt ccccccaccc cctccccagg gggatcccaa 1620
ttcattccgg gctgacacgc tcactggcag gcgtcgggca tcacctagcg gtcactgtta 1680
ctctgaaaac ggaggcctca cagaggaagg gagcaccagg ccgcctgcgc acagcctggg 1740
gcaactgtgt cttctccacc gcccccgccc ccacctccaa gttcctccct cccttgttgc 1800
ctaggaaatc gccactttga cgaccgggtc tgattgacct ttgatcaggc aaaaacgaac 1860
aaacagataa ataaataaaa taacacaaaa gtaactaact aaataaaata agtcaataca 1920
acccattaca atacaataag atacgatacg ataggatgcg ataggatacg ataggataca 1980
atacaatagg atacgataca atacaataca atacaataca atacaataca atacaataca 2090
atacaataca atacaatacg ccgggcgcgg tggctcatgc ctgtcatccc gtcactttgg 2100
gatgccgagg tggacgcatc acctgaagtc gggagttgga gacaagcccg accaacatgg 2160
agaaatcccg tctcaattga aaatacaaaa ctagccgggc gcggtggcac atgcctataa:2220
tcccagctgc taggaaggct gaggcaggag aatcgcttga acctgggaag cggaggttgc 2280
agtgagccga gattgcgcca tcgcactcca gtctgagcaa caagagcgaa actccgtctc 2390
aaaaataaat acataaataa atacatacat acatacatac atacatacat acatacatac 2400
ataaattaaa ataaataaat aaaataaaat aaataaatgg gccctgcgcg gtggctcaag 2460
cctgtcatcc cctcactttg ggaggccaag gccggtggat caagaggcgg tcagaccaac 2520
agggccagta tggtgaaacc ccgtctctac tcacaataca caacattagc cgggcgctgt 2580
gctgtgctgt actgtctgta atcccagcta ctcgggaggc cgagctgagg caggagaatc 2690
gcttgaacct gggaggcgga ggttgcagtg agccgagatc gcgccactgc aacccagcct 2700
gggcgacaga gcgagactcc gtctccaaaa aatgaaaatg aaaatgaaac gcaacaaaat 2760
aattaaaaag tgagtttctg gggaaaaaga agaaaagaaa aaagaaaaaa acaacaaaac 2820
agaacaaccc caccgtgaca tac 2893
<210> 8
<211> 1331
<212> DNA
<213> Homo Sapiens
6
..., , ~ ,. , 's: # _ . .., .. n ., .. y.,~. ° ' ~,~" ','~,y~ ~,. ...
k~::'~G
CA 02375498 2001-12-17 "f
<900> 8
atggcggcga acctgagccg gaacgggcca gcgctgcaag aggcctacgt gcgggtggtc 60
accgagaagt ccccgaccga ctgggctctc tttacctatg aaggcaacag caatgacatc 120
cgcgtggctg gcacagggga gggtggcctg gaggagatgg tggaggagct caacagcggg 180
aaggtgatgt acgccttctg cagagtgaag gaccccaact ctggactgcc caaatttgtc 290
ctcatcaact ggacaggcga gggcgtgaac gatgtgcgga agggagcctg tgccagccac 300
gtcagcacca tggccagctt cctgaagggg gcccatgtga ccatcaacgc acgggccgag 360
gaggatgtgg agcctgagtg catcatggag aaggtggcca aggcttcagg tgccaactac 920
agctttcaca aggagagtgg ccgcttccag gacgtgggac cccaqgcccc agtgggctct 480
gtgtaccaga agaccaatgc cgtgtctgag attaaaaggg ttggtaaaga cagcttctgg 590
gccaaagcag agaaggagga ggagaaccgt cggctggagg aaaaqcggcg ggccqaggag 600
gcacagcggc agctggagca ggagcgccgg gagcgtgagc tgcgtgaggc tgcacgccgg 660
gagcagcgct atcaggagca ggqtggcgag qccagccccc agaggacgtg ggagcaqcag 720
caagaagtgg tttcaaggaa ccgaaatgag caggagtctg ccgtgcaccc gagggagatt 780
ttcaagcaga aggagagggc catgtccacc acctccatct ccagtcctca gcctggcaag 840
ctgaggagcc ccttcctgca gaagcagctc acccaaccag agacccactt tggcagagag 900
ccagctgctg ccatctcaag gcccagggca gatctccctg ctgaggagcc ggcgcccagc 960
actcctccat gtctggtgca ggcagaagag gaggctgtgt atgaggaacc tccagagcag 1020
gagaccttct acgagcagcc cccactggtg cagcagcaag gtgccggctc tgagcacatt 1080
gaccaccaca ttcagggcca ggggctcagt gggcaagggc tctgtgcccg tgccctgtac 1140
gactaccagg cagccgacga cacagagatc tcctttgacc ccgagaacct catcacgggd 1200
atcgaggtga tcgacgaagg ctgqtggcgt qgctatgggc cggatggcca ttttggcatg 1260
ttccctgcca actacgtgga gctcattgag tgaggctgag ggcggccgct agactagtct 1320
agagaaaaaa c 1331
<210> 9
<211> 760
<212> PRT
<213> Homo sapiens
<220>
<221> UNSURE
<222> (16)
<220>
<221> UNSURE
<222> (41)
<220>
<221> UNSURE
<222> (99)
<220>
<221> UNSURE
<222> (48)
<220>
r4J ><~c' trA 7 .:.in
Printed X20 p°g ~", ~. ~" ~
~2001-.~ 1
~~kf°~ f
~G4~wS4h''~~ 2c4
-.___....._...__- '.~ X35.1:.:'
~..'CA 02375498 2001-12-17
<221> UNSURE
<222> (69)
<220>
<221> UNSURE
<222> (96)
<220>
<221> UNSURE
<222> 11121
<22:0>
<221> UNSURE
<222> (118)
<220>
<221> UNSURE
<222> 4131)
<220>
<221> UNSURE
<222> (199)
<220>
<221> UNSURE
<222> (160)
<220>
<221> UNSURE
<222> (168)
<220>
<221> UNSORE
<222> (173)
<220>
<221> UNSURE
<222> (192)
<220>
<221> UNSURE
<222> (198)
<220>
<221> UNSURE
<222> (208)
<220>
B
p .
S.W . ~ ~'r~ n't ,Waw.., T =;t.
CA 02375498 2001-12-17
<221> UNSURE
<222> (227)
<220>
<221> UNSURE
<222> (240)
<220>
<221> UNSURE
<222> (256)
<220>
<221> UNSURE
<222> (264)
<220>
<221> UNSURE
<222> (276)
<220>
<221> UNSURE
<222> (288) -
<220>
<221> UNSURE
<222> (302)
<220>
<221> UNSURE
<222> (309)
<220>
<221> UNSURE
<222> (336)
<220>
<221> UNSURE
<222> (352)
<220>
<221> UNSURE
<222> (383)
<220>
<221> UNSURE
<222> (3991
<220>
9
~~ "5y ~ ' w~t'~~' x E a,' : ~.
~'rinited:2~-09=2001 ' k ~ r ) > ~a~ _
... ._. ,...,.. , .... a~,.slu_..,a~*,two.. e.,.d YSr
~...ae.:f~di.hi3.kY,~".a. _ "'
g y ~~~a,~x~ -~-~a: ,.-~_... I , .. , . .. .
CA 02375498 2001-12-17
c
<221> UNSURE
<222> (431)
<220>
<221> UNSURE
<222> (947)
<220>
<221> UNSURE
<222> (9~9)
<220>
<221> UNSURE
<222> (995)
<220>
<221> UNSURE
<222> (520)
<220>
<221> UNSURE
<222> (527)
<220>
<221> UNSURE
<222> (593)
<220>
<221> UNSURE
<222> ;552)
<220>
<221> UNSURE
<222> (575)
<220>
<221> UNSURE
<222> (591)
<220>
<221> UNSURE
<222> ffi22)
<220>
<221> UNSURE
<222> (639)
<220>
Y x s 1~'
~~; ~~v <: nx :.. :.<. ~ . . ~< ~~,cy'C. k ~F~.s<'sr~
L
,., ,.... . . . ... . . . . .. _< . ..W. "._ ~. ! ~.. .. '=.tari",:.
I CA 02375498 2001-12-17
<221> UNSURE
<222> (671)
<220>
<221> UNSURE
<222> (687)
<220>
<221> UNSURE
<222> (719)
<220>
<221> UNSURE
<222> (735
<900> 9
His Glu Ile Pro Thr Val Pro Thr Tyr Tyr Pro Ala Lys Pro Gln Xaa
1 5 10 15
Glu Arg Ala Trp Arg Asn Gln Arg Gly Lys Lys Thr Leu Leu Ser Thr
20 25 30
Leu Val Trp His Gly Glu Glu Thr Xaa Glu Val Xaa Asn Lys Trp Xaa
35 40 45
Ala Pro Gly Ala Pro Pro Val Ser Pro Arg G1y Ala Arg Gly Gly Xaa
50 55 60
Arg Pro Cys Gly Pro.Pro Val Lys Tyr His Tyr Ser Asp Arg Phe Thr
65 70 75 80
Asp Pro Val Arg Arg Gly Gly Glu Pro Arg Gly Ala Leu Ala Ser Xaa
g5 90 95
Ala Lys Arg Pro Ala Ala Arg Arg Pro Gly Ala Thr Arg Ser Gly Xaa
100 105 110
Ala Arg Trp Gly Val Xaa Leu Gly Arg Tyr Thr Cys G1n Thr Val Gln
115 120 125
Val Ser Xaa Gly Glu Leu Arg Glu Asp Arg Asn Leu Pro Trp Ser Xaa
130 135 190
Arg Ala Lys Ala Arg Leu Ile Leu Ile Phe Ser Thr Asn Thr Asp Xaa
145 150 155 160
Ser Gly Ala Ser Arg Ser Phe Xaa Pro Phe Gly Phe Xaa Ala Gly Val
165 170 17s
11
r(tlt~ ~~ ~9=~C~O~ ' ~f? ~ ~~' ,:~ p C 't1 ~1=' ~ ,
yTS&'e.
.~.,s,1_., .. ,~, .... . a es ." ,....". ~hY~w'i4rf~~.rn.~.W Mi:"
.'~'yiwh,y~.~°'" . . . ~~..~I~~. 1:F,p.:. ...>.~'.,.:.
CA 02375498 2001-12-17
Arg Lys Val Thr Thr Gly Ile Thr Gly Leu Trp Arg Pro Ser Val Xaa
180 185 190
Ser Asp Val Ala Phe Xaa Ser Phe Asp Val Gly Ser Ser Tyr His'Xaa
195 200 205
Ala Glu Phe Thr Lys Arg Trp Ile Val His Pro Leu Ile Gly Asn Ser
210 215 220
Trp Asp Xaa Thr Val Val Arg Gln Val Ser Phe Thr Leu Leu Met Xaa
225 230 235 290
Cys Cys Cys His Gly Asn Pro Ala Gln Tyr Glu Arg Asn Arg Arg Xaa
295 250 255
His Leu Val Tyr Val Leu Gly Xaa Gly Ala Asn Gly Ala Lys Leu Ser
260 265 270
Val Gly Leu Xaa Leu Asn Ala Ser Lys Ser Glu Ser Arg Prfl Gly Xaa
275 280 285
Thr Ile Arg Gln Arg Arg Gly Ala Ser Val Gly Leu Gly Xaa Pro Xaa
290 295 300
Arg Leu Ser Pro Pro Ala Gly Arg Pro Pro Leu His Ala Pro Arg Arg
305 310 315 320
Gly Arg Ala Arg Ala Pro Pro Arg Ala Gly Thr Gly Val Arg Cys Xaa
325 330 335
Val Pro Phe Val Leu Gly Asn Gly Ala Arg Pro Glu Arg Arg Pro Xaa
390 395 350
Arg Pro Ser Arg Thr Ala Arg Ser Trp Gly Thr Trp Arg Thr Ser Ile
355 360 365
Ser Ser Pro Gln Pro Gly Lys Leu Arg Ser Pro Phe Leu Gln Xaa Gln
370 375 380
Leu Thr Gln Pro Glu Thr His Phe Gly Arg Glu Pro Ala Ala Xaa Ser
385 390 395 400
Arg Pro Arg Ala Asp Leu Pro Ala Glu Glu Pro Ala Pro Ser Pro Pro
405 410 415
Cys Leu Val Gln Ala Glu Glu Glu Ala Val Tyr Glu Glu Pro Xaa Glu
420 425 930 j
12
~'~i~'l~f.'f.~#~~ ~~-~~~~~ ~
'a~ _. ....... . . _ ~~v'~:. ~'.at:~ar~ia~r.~ ~';S;IaCa'.v.-'.~. :,~'.
i
CA 02375498 2001-12-17
Gln Glu Thr Phe Tyr Glu Gln Pro Pro Leu Val Gln Glt~ Gln Xaa Gly
435 940 995
Ser Glu His Ile Asp His His Ile Gln Gly Gln Gly Leu Ser Gln Gly
450 455 460
Leu Cys Ala Arg Ala Leu Tyr Asp Tyr Gln Ala Ala Asp Asp Xaa Glu
465 470 475 980
Ile Ser Phe Asp Pro Glu Asn Leu Ile Thr Gly Ile Glu Val Xaa Glu
485 _ 990 495
Gly Trp Trp Arg Gly Tyr Gly Pro Asp Gly His Phe Gly Met Pro Ala
500 505 510
Asn Tyr Val Glu Leu Ile Glu Xaa Gly Xaa Gly His Ile Leu Xaa Phe
515 520 525
Pro Ser Gln Thr Trp Leu Pro Tyr Cys Trp Lys Arg Arg Pro Xaa Xaa
530 535 540
His Ser Ala Leu Phe Gln Glu Xaa Asp Pro Gln Xaa Gly Xaa Leu Arg
545 550 555 560
Ala Pro Ser Gly Leu Ala Asp Ser Ala Cys His Pro Lys Cys Xaa Asn
565 570 575
Gly Leu Val Ile Pro Thr His Pro Ser Cys Ile Pro Arg Pro Xaa Thr
580 585 590
Ala Trp Leu Leu Pro Leu Thr Gly Tyr Xaa Ala Lys Pro Cys Trp Pro -
595 600 605
Ser Pro Glu Trp Pro Leu Pro Ser Cys Gly Glu Gly Ser Xaa Xaa Gly
610 615 620
Ala Ser Gly Arg Leu Trp Leu Pro Ser Ala Phe Ile Cys Leu Xaa Phe
625 630 635 690
Ser Leu Ala Ser Lys Gly Trp Trp Pro Pro Leu Phe Arg Met Leu Gly
645 650 655
Asn Ser Glu Arg Arg Glu Leu Phe Leu Ala Glu Phe Val Thr Xaa Val
660 665 670
Arg Val Asp His Gly Gly Leu Ala Ala Gly Asn Leu Ser Cys Xaa Leu
675 680 685
1
~'tn~eda00~ 20~~ ~ '' i'~ , , a , .,.
1 ~~ . ~ ~ j H
w ..Vwusn:~;~~" s..~wiv'oxa~~~YC.~
-a..S~_,.,lM,ur.u,~ »..,a., ws..a4vZ.3vuu-..~w,-
CA 02375498 2001-12-17
Leu Cys Ala Pro His Ser Ile Ser Leu Ser Leu Cys Leu Gly Gly Lys
690 695 700
Trp Gly Cys Arg Trp Pro Ser Ser His Pro Gly Tyr Ser Lys Xaa Ala
705 710 715 720
Asp Thr Thr Cys Ser Ser Thr Arg Leu Thr Arg Cys Leu Gin Xaa Val
725 730 735
Cys Ala Ser Thr Asp Ser Asp Phe Arg Lys Ser Lys Lys Lys Lys Lys
740 795 750
Leu Glu Lys Leu Trp Thr Ser Ser
755 760
<210> 10
<211> 753
<212> PRT
<213> Homo Sapiens
<220>
<221> UNSURE
<222> (10)
<220>
<221> UNSURE
<222> (13)
<220>
<221> UNSURE
<222> (32)
<220>
<221> UNSURE
<222> (98)
<220>
<221> UNSURE
<222> (80)
<220>
<221> UNSURE
<222> (87)
<220>
<221> UNSURE
19
~rinx~d~~~~-09 ,:200'1 r
_ . . ....", . ,.~~ , __, ...,~, t ,,>.,t~;.~~ ~ ~'.~
CA 02375498 2001-12-17
<222> (96)
<220>
<221> UNSURE
<222> (100)
<220>
<221> UNSURE
<222> (127)
<220>
<221> UNSURE
<222> (137)
<220>
<221> UNSURE
<222> (142)
<220>
<221> UNSURE
<222> (194)
<220>
<221> UNSURE
<222> (166)
<220>
<221> UNSURE
<222> (176)
<220>
<221> UNSURE
<222> (192)
<220>
<221> UNSURE
<222> (196)
<220>
<221> UNSURE
<222> (224)
<220>
<221> UNSURE
<222> (233)
<220>
<221> UNSURE
-.
Pi~tnfd:20 Og-2Q01 ' y~p~ l~ ~ ~,~ ~ ~'~' . . . .
~ , , ~,.
CA 02375498 2001-12-17
<222> (240)
<220>
<221> UNSURE
<222> (245)
<220>
<221> UNSURE
<222> (272)
<220>
<221> UNSURE
<222> (288)
<220>
<221> UNSURE
<222> (320)
<220>
<221> UNSURE
<222> (336)
<220>
<221> UNSURE
<222> (352)..(353)
<220>
<221> UNSURE
<222> (363)
<220>
<221> UNSURE
<222> (368)
<220>
<221> UNSURE
<222> (371)
<220>
<221> UNSURE
<222> (383)..(385)
<220>
<221> UNSURE
<222> (410)
<220>
<221> UNSURE
16
~R~~I'I~~~I ~~I'-~0~,-~~~~"I'
. .~,.,~ . _w,... , x . .... . .,_ ,.. ,.. . .~~~ ..~ . ~.~,~.-=o"°.k,_
h. _~'1 ... .., , ._ .
CA 02375498 2001-12-17
<222> (916)
<220>
<221> UNSURE
<222> (432)
<220>
<221> UNSURE
<222> (438)
<220>
<221> UNSURE
<222> (964)
<220>
<221> UNSURE
<222> (480)
<220>
<221> UNSURE
<222> (487)
<220>
<221> UNSURE
<222> (495)..(997)
<220>
<221> UNSURE
<222> (505)
<220>
<221> UNSURE
<222> (512)..(513)
<220>
<221> UNSURE
<222> (522)
<220>
<221> UNSURE
<222> (528)
<220>
<221> UNSURE
<222> (550)
<220>
<221> UNSURE
r.~* , .
P~riii~~~~0~'a8~t301:~ ~ ~~ ~:~~ '~ ~ n=:. . .
.. a ..... ..........:r:. a ."x..~.~.~... ~R~._ ,~:'e~'~u'.~z°f"" -
'~~''s'L'"-'°"":~''~"'"::'.~r""'.
~~~~fa~~ ~iy~~~~o 1 t .
CA 02375498 2001-12-17
<222> (554)
<220>
<221> UNSURE
<222> (560)
<220>
<221> UNSURE
<222> (579)
<220>
<221> UNSURE
<222> (576)
<220>
<221> UNSURE
<222> (589)
<220>
<221> UNSURE
<222> (591)
<220>
<221> UNSURE
<222> (608)
<220>
<221> UNSURE
<222> (624)
<220>
<221> UNSURE
<222> (652)
<220>
<221> UNSURE
<222> 1656)..(657)
<220>
<221> UNSURE
<222> 1662)..(663)
<220>
<221> UNSURE
<222> 1672)
<220>
<221> UNSURE
,~"" _:~
r ,
~lntecl.~0 t~9. ~~001' ~~ . ,
_ a _ . _...._. . ~ s .. _~: ~ _ .._ ~~ P
CA 02375498 2001-12-17
<222> (702)
<220>
<221> UNSURE
<222> (704)
<220>
<221> UNSURE
<222> (718)
<220>
<221> UNSURE
<222> ('120)
<220>
<221> UNSURE
<222> (723)
<220>
<221> UNSURE
<222> (734)
<220>
<221> UNSURE
<222> (743)
<220>
<221> UNSURE
<222> (752)
<400> 10
Ile Arg His Glu His Gly Glu Glu Thr Xaa Glu Val Xaa Asn Lys Glu
1 5 10 15
Ala Pro Gly Ala Pro Pro Val Ser Pro Arg Gly Ala Arg Gly Gly Xaa
20 25 30
Arg Arg Pro Cys Gly Pro Pro Val Lys Tyr His Tyr Ser Asp Arg Xaa
35 40 45
Thz Asp Pro Val Arg Arg Gly Gly Glu Pro Arg Gly Ala Leu Ala Gly
50 55 60
Ala Lys Arg Pro Ala Ala Arg Arg Pro Gly Ala Thr Arg Ser Gly Xaa
65 70 75 BO
Ser Ala Arg Trp Gly Val Xaa Leu Gly Arg Tyr Thr Cys Gln Thr Xaa
85 90 95
~~i~a~ rrW,s'~"~~r~ir~~- . ~s.
P~rrrtted 20 09-2fl01 i epo ) .. . . ... _.., _. ~ . _ . _,. .. -
CA 02375498 2001-12-17
Gln Val 5er Xaa Gly Glu Leu Arg Glu Asp Arg Asn Leu Pro Trp Arg
100 105 110
Arg Ala Lys Ala Arg Leu Ile Leu Ile Phe Ser Thr Asn Thr Asp Xaa
115 120 125
Glu Ser Gly Ala Ser Arg Ser Phe Xaa Pro Phe Gly Phe Xaa Ala Xaa
130 135 190
Val Arg Lys Val Thr Thr Gly Ile Thr Gly Leu Trp Arg Pro Ser His
195 150 155 160
Ser Asp Val Ala Phe Xaa Ser Phe Asp Val Gly Ser Ser Tyr His Xaa
165 170 175
Glu Ala Glu Phe Thr Lys Arg Trp Ile Val His Pro Leu Ile Gly Xaa
180 185 190
Ser Trp Val Xaa Thr val Val Arg Gln Val Ser Phe Thr Leu Leu Met
195 200 205
Cys Cys Cys His Gly Asn Pro Ala Gln Tyr Glu Arg Asn Arg Arg Xaa
210 215 220
Arg His Leu Val Tyr Val Leu Gly Xaa Gly Ala Asn Gly Ala Lys Xaa
225 230 235 290
Ser Val Gly Leu Xaa Leu Asn Ala Ser Lys Ser Glu Ser Arg Pro Gly
295 250 255
Thr Ile Arg Gln Arg Arg Gly Ala Ser Val Gly Leu Gly Xaa Pro Xaa
260 265 270
Pro Arg Leu Ser Pro Pro Ala Gly Arg Pro Pro Pro Ser Thr Arg Xaa
275 280 285
Arg Ala Gly Gly Arg Val Pro Arg Arg Ala Pro Gly Pro Gly Ser Ala
290 295 300
Glu Cys Pro Ser Ser Trp Glu Thr Gly Arg Gly Arg Lys Gly Gly Xaa
305 310 315 320
Pro Leu Ala Arg His Ala Pro His Val Arg Ala Arg Ala Glu Phe Xaa
325 330 335
Ser Ser Thr Ile His Asn Arg His Thr Ser Ala Cys Ile Phe Met Xaa
390 395 350
. Pr~ntsd.~D-09=2001 ~~p~Ii~e'~~ ,... ~ ~~rl~p~c~io~=
CA 02375498 2001-12-17
Xaa Ile Leu Phe Leu Trp Val Asp Ile Gln Xaa Trp Asp Cys Xaa Xaa
355 360 365
Thr Trp Xaa Phe Tyr Phe Trp Phe Ile Glu Lys Ser Ser Tyr Xaa Xaa
370 375 380
Xaa Arg Leu Tyr Lys Phe Thr Ser Leu Pro Ser Asp Phe Phe Lys Glu
385 390 395 900
Arg Met Val Trp Arg Asn Ala Pro His Xaa Tyr Pro Pro Phe Thr Xaa
405 910 415
Leu Leu Gln Asn Asp Phe Lys Gly Tyr Arg Tyr Leu Gln Val Ser Xaa
920 425 430
Arg Gln Ile Glu Tyr Xaa Asn Phe Cys Ile Arg Gly Thr Asp Phe Ile
935 490 995
Gln Ser Cys Met Asn Lys Asp Lys Cys Ser Arg Asp Leu Gln Ser Xaa
450 955 960
Asn Trp Lys Ser Gln Met Lys Tyr Ile Ser Ser Ser Thr Thr Ser Xaa
465 970 975 980
Ser Thr Glu Leu Ala Leu Xaa Ser Ser Leu Ile Pro Thr Tyr Xaa Xaa
485 490 495
Xaa Lys Gly Phe Ile Ser Asn Iie Leu Xaa Gly Ile Lys Ile Lys Xaa
500 505 510
Xaa Val Lys Leu Phe Ser Leu Ala Phe Xaa Phe Gln Asn Ile Lys Xaa
515 520 525
Pro Ser Ile Gly His Leu Tyr Cys Thr Arg His Cys Val Cys His Ser
530 535 590
Lys Met Phe Ser Trp Xaa Cys Ser Gln Xaa Phe Cys Arg Val Arg Xaa
545 550 555 560
Ser Leu Thr Val Val Arg Leu Phe Ser Lys Arg Asn Leu Xaa Thr Xaa
565 570 575
Phe Asn Leu Arg Lys Val Ser Asn Arg Thr Arg Thr Xaa Thr Xaa Ile
580 585 590
Thr Leu Gln Ile Ser Pro Tyr His Thr Ala Ser Thr Cys Ala Cys Xaa
595 600 605
~ ~~ ~r~~~p~~r~~~ . s~~
R'~inted:20~-Q9=2001 '' ~ ~ rz.: .
.. ~x ~P_.,~. .~H~a~h.~. ~ ,~ ... ~.._ .. ..
_ ~ CA 02375498 2001-12-17
Leu Ile Pro Gly Ser Cys Tyr Phe Pro Phe Tyr Phe Leu-Ser Leu Xaa
610 615 620
Thr Thr Pro Phe Ser Pro His Phe Phe Ser Phe Phe heu Ile Val Tyr
625 630 635 690
Ile Thr Asn Thr Cys Leu Ser Glu Gln Leu Ile Xaa His Lys Arg Xaa
695 650 655
Xaa Ser Thr Gly Glu Xaa Xaa Leu Ile Pro Val Ile Leu Ala Leu Xaa
660 665 670
Ala Lys Ala Gly Arg Ser Leu Glu Ser Arg Val Arg Asp Gln Pro Gln
675 680 685
His Gly Glu Thr Leu Ser Leu Gln Lys Asn Thr Lys Ile Xaa Pro Xaa
690 695 700
Val Leu Ala His Thr Cys Ser Leu Ser Tyr Ser Glu Gly Xaa Gly Xaa
705 710 715 720
Ile Asp Xaa Ala Gln Glu Val Glu Ala Ala Ala Val Arg Xaa Asp Ala
725 730 735
Ile Ala Leu Gln Pro Gly Xaa Glu Arg Glu Thr Leu Ser Gln Lys Xaa
790 795 750
Lys
w ~'t~
P~rii~ted 20-~9-2~4~:~ ~~pc~r~~ ~='F~e~ras~es ~~~
x . _ . .. ... . . _ ~.. _. r_ _. .~ ~ ~,a p. ~ ,_..~.. _ _
