Note: Descriptions are shown in the official language in which they were submitted.
CA 02376406 2002-O1-14
WO 01/14554 PCT/US00/21566
-1-
G PROTEIN-COUPLED RECEPTOR EXPRESSED IN BRAIN
FIELD OF THE INVENTION
The present invention relates generally to the fields of genetics and
cellular and molecular biology. More particularly, the invention relates to a
novel G
protein seven transmembrane receptor that polynucleotide and polypeptide
sequence
that is localized to the brain.
DESCRIPTION OF RELATED ART
Humans and other life forms are comprised of living cells. Among the
mechanisms through which the cells of an organism communicate with each other
and
obtain information and stimuli from their environment is through cell membrane
receptor molecules expressed on the cell surface. Many such receptors have
been
identified, characterized, and sometimes classified into major receptor
superfamilies
based on structural motifs and signal transduction features. Such families
include (but
are not limited to) ligand-gated ion channel receptors, voltage-dependent ion
channel
receptors, receptor tyrosine kinases, receptor protein tyrosine phosphatases,
and G
protein coupled receptors. The receptors are a first essential link for
translating an
extracellular signal into a cellular physiological response.
The G protein-coupled receptors (GPCR) form a vast superfamily of
cell surface receptors which are characterized by an amino-terminal
extracellular
domain, a carboxyl-terminal intracellular domain, and a serpentine structure
that
passes through the cell membrane seven times. Hence, such receptors are
sometimes
also referred to as seven transmembrane (7TM) receptors. These seven
transmembrane domains define three extracellular loops and three intracellular
loops,
in addition to the amino- and carboxyl terminal domains. The extracellular
portions
of the receptor have a role in recognizing and binding one or more
extracellular
binding partners (ligands), whereas the intracellular portions have a role in
recognizing and communicating with downstream effector molecules.
CA 02376406 2002-O1-14
WO 01/14554 PCT/US00/21566
-2-
The G protein coupled receptors bind a variety of ligands including
calcium ions, hormones, chemokines, neuropeptides, and neurotransmitters,
nucleotides, lipids, odorants, and even photons, and are important in the
normal (and
sometimes the aberrant) function of many cell types. [See generally A.D.
Strosberg,
Eur. J. Biochem., 196: 1-10 (1991) and S. K. Bohm et al., Biochem J., 322: 1-
18
(1997).] When a specific ligand binds to its corresponding receptor, the
ligand
stimulates the receptor to activate a specific heterotrimeric
guanine-nucleotide-binding regulatory protein (G-protein) that is coupled to
the
intracellular portion of the receptor. The G protein in turn transmits a
signal to an
effector molecule within the cell, by either stimulating or inhibiting the
activity of that
effector molecule. These effector molecules include adenylate cyclase,
phospholipases and ion channels. Adenylate cyclase and phospholipases are
enzymes
that are involved in the production of the second messenger molecules cAMP,
inositol
triphosphate and diacyglycerol. It is through this sequence of events that an
1 S extracellular ligand stimuli exerts intracellular changes through a G
protein coupled
receptor. Each such receptor has its own characteristic primary structure,
expression
pattern, ligand-binding profile, and intracellular effector system.
Because of the vital role of G protein coupled receptors in the
communication between cells and their environment, such receptors are
attractive
targets for therapeutic intervention, and many drugs have been registered
which are
directed towards activating or antagonizing such receptors. For receptors
having a
known ligand, the identification of agonists or antagonists may be sought
specifically
for enhancing or inhibiting the action of the ligand. Some G protein coupled
receptors
have roles in disease pathogenesis (e.g., certain chemokine receptors that act
as HIV
co-receptors and may have a role in AIDS pathogenesis), and are attractive
targets for
therapeutic intervention even in the absence of knowledge of the natural
ligand of the
receptor. Other receptors are attractive targets for therapeutic intervention
by virtue of
their expression pattern in tissues or cell types that are attractive targets
for
therapeutic intervention. Examples of this latter category of receptors
include
receptors expressed in immune cells, for targeting to enhance immune responses
to
fight pathogens or cancer or inhibit autoimmune responses; and receptors
expressed in
CA 02376406 2002-O1-14
WO 01/14554 PCT/US00/21566
-3-
the brain or other neurons, for targeting to treat schizophrenia, depression,
bipolar
disease, or other neurological disorders. This latter category of receptor is
also useful
as a marker for identifying and/or purifying (e.g., via fluorescence activated
cell
sorting) cellular subtypes that express the receptor. Unfortunately, only a
limited
number of G protein receptors from the central nervous system (CNS) are known.
A
need exists for identifying the existence and structure of such G protein
coupled
receptors.
SUMMARY OF THE INVENTION
The present invention addresses one or more of the needs identified
above in that it provides a purified polynucleotide encoding a heretofore
unknown G
protein coupled receptor termed CON167; constructs and recombinant host cells
incorporating the polynucleotide; the CON167 polypeptide encoded by the gene;
antibodies to the polypeptide; and methods of making and using all of the
foregoing.
As set forth in detail herein, CON167 is expressed in the brain, heart and
skeletal
muscle, liver, and other tissues, providing a therapeutic indication for
CON167
binding partners to treat diseases associated with such tissues.
In one embodiment, the invention provides a purified and isolated
CON167 seven transmembrane receptor polypeptide comprising the amino acid
sequence set forth in SEQ ID NO: 2, or a fragment thereof comprising an
epitope
specific to the seven transmembrane receptor. By "epitope specific to" is
meant a
portion of the CON167 receptor that is recognizable by an antibody that is
specific for
CON167 seven transmembrane receptor, as defined in detail below. A preferred
embodiment comprises a purified and isolated polypeptide comprising the
complete
amino acid sequence set forth in SEQ ID NO: 2.
Although SEQ ID NO: 2 provides a particular human sequence, the
invention is intended to include within its scope other human allelic
variants; non-
human mammalian forms of CON167, and other vertebrate forms of CON167.
It will be appreciated that extracellular epitopes are particularly useful
for generating and screening for antibodies and other binding compounds that
bind to
receptors such as CON167. Thus, in another preferred embodiment, the invention
CA 02376406 2002-O1-14
WO 01/14554 PCT/US00/21566
-4-
provides a purified and isolated polypeptide comprising at least one
extracellular
domain of CON167. By "extracellular domain" is meant the amino terminal
extracellular domain or an extracellular loop that spans two transmembrane
domains.
A purified and isolated polypeptide comprising the N-terminal extracellular
domain of
CON167 is highly preferred. Also preferred is a purified and isolated
polypeptide
comprising a CON167 seven transmembrane receptor fragment selected from the
group consisting of the N-terminal extracellular domain of CONI 67,
transmembrane
domains of CON167, extracellular loops connecting transmembrane domains of
CON167, intracellular loops connecting transmembrane domains of CON167, the
C-terminal cytoplasmic domain of CON167, and fusions thereof. Such fragments
may be continuous portions of the native receptor. However, it will also be
appreciated that knowledge of the CON167 gene and protein sequences as
provided
herein permits recombining of various domains that are not contiguous in the
native
protein.
In another embodiment, the invention provides purified and isolated
polynucleotides (e.g., cDNA, genomic DNA, synthetic DNA, RNA, or combinations
thereof, single or double stranded) that comprise a nucleotide sequence
encoding the
amino acid sequence of the polypeptides of the invention. Another embodiment
provides a purified and isolated polynucleotide encoding the amino acid
sequence of
the polypeptide of the invention fused to a heterologous tag amino acid
sequence.
Such polynucleotides are useful for recombinantly expressing the receptor and
also for
detecting expression of the receptor in cells (e.g., using Northern
hybridization and in
situ hybridization assays. Such polynucleotides also are useful to design
antisense
and other molecules for the suppression of CON167 expression in a cultured
cell or
animal (for therapeutic purposes or to provide a model for diseases
characterized by
aberrant CON167 expression). Such polynucleotides are also useful to design
antisense and other molecules for the suppression of CON167 expression in a
cultured
cell or tissue or in an animal, for therapeutic purposes or to provide a model
for
diseases characterized by aberrant CON167 expression. Specifically excluded
from
the definition of polynucleotides of the invention are entire isolated
chromosomes of
native host cells. A preferred polynucleotide set forth in SEQ >D NO: 1
corresponds
CA 02376406 2002-O1-14
WO 01/14554 PCT/US00/21566
-5-
to a naturally occurring CON167 sequence. It will be appreciated that numerous
other
sequences exist that also encode CON167 of SEQ-ID NO: 2, due to the well-known
degeneracy of the universal genetic code.
The invention also provides a purified and isolated polynucleotide
comprising a nucleotide sequence that encodes a mammalian seven transmembrane
receptor, wherein the polynucleotide hybridizes to the nucleotide sequence set
forth in
SEQ >D NO: 1 or the non-coding strand complementary thereto, under the
following
hybridization conditions:
(a) hybridization for 16 hours at 42 °C in a hybridization solution
comprising
SO% formamide, 1% SDS, 1M NaCI, 10% Dextran sulphate; and
(b) washing 2 times for 30 minutes at 60°C in a wash solution
comprising
0.1% SSC, 1% SDS. Polynucleotides that encode a human allelic variant are
highly
preferred.
In a related embodiment, the invention provides vectors comprising a
polynucleotide of the invention. Such vectors are useful, e.g., for amplifying
the
polynucleotides in host cells to create useful quantities thereof. In
preferred
embodiments, the vector is an expression vector wherein the polynucleotide of
the
invention is operatively linked to a polynucleotide comprising an expression
control
sequence. Such vectors are useful for recombinant production of polypeptides
of the
invention.
In another related embodiment, the invention provides host cells that
are transformed or transfected (stably or transiently) with polynucleotides of
the
invention or vectors of the invention. As stated above, such host cells are
useful for
amplifying the polynucleotides and also for expressing the CON167 seven
transmembrane receptor polypeptide or fragment thereof encoded by the
polynucleotide. Such host cells are useful in assays as described herein.
In still another related embodiment, the invention provides a method
for producing a seven transmembrane receptor polypeptide (or fragment thereof)
comprising the steps of growing a host cell of the invention in a nutrient
medium and
isolating the polypeptide or variant thereof from the cell or the medium.
Since
CON167 is a seven transmembrane receptor, it will be appreciated that, for
some
CA 02376406 2002-O1-14
WO 01/14554 PCT/US00/21566
-6-
applications, such as certain activity assays, the preferable isolation may
involve
isolation of cell membranes containing the polypeptide embedded therein,
whereas for
other applications a more complete isolation may be preferable.
In still another embodiment, the invention provides an antibody that is
specific for the CON167 seven transmembrane receptor of the invention.
Antibody
specificity is described in greater detail below. However, it should be
emphasized
that antibodies that can be generated from polypeptides that have previously
been
described in the literature and that are capable of fortuitously cross-
reacting with
CON167 (e.g., due to the fortuitous existence of a similar epitope in both
polypeptides) are considered "cross-reactive" antibodies. Such cross-reactive
antibodies are not antibodies that are "specific" for CON167. The
determination of
whether an antibody is specific for CON167 or is cross-reactive with another
known
receptor is made using Western blotting assays or several other assays well
known in
the literature. For identifying cells that express CON167 and also for
modulating
CON167-ligand binding activity, antibodies that specifically bind to an
extracellular
epitope of the CON167 seven transmembrane receptor are preferred.
In one preferred variation, the invention provides monoclonal
antibodies. Hybridomas that produce such antibodies also are intended as
aspects of
the invention. In yet another variation, the invention provides a humanized
antibody.
Humanized antibodies are useful for in vivo therapeutic indications.
In another variation, the invention provides a cell-free composition
comprising polyclonal antibodies, wherein at least one of the antibodies is an
antibody
of the invention specific for CON167. Antisera isolated from an animal is an
exemplary composition, as is a composition comprising an antibody fraction of
an
antisera that has been resuspended in water or in another diluent, excipient,
or carrier.
In still another related embodiment, the invention provides an
anti-idiotypic antibody specific for an antibody that is specific for CON167.
It is well known that antibodies contain relatively small antigen
binding domains that can be isolated chemically or by recombinant techniques.
Such
domains are useful CON167 binding molecules themselves, and also may be
reintroduced into human antibodies, or fused to toxins or other polypeptides.
Thus, in
CA 02376406 2002-O1-14
WO 01/14554 PCT/US00/21566
-7_
still another embodiment, the invention provides a polypeptide comprising a
fragment
of a CON167-specific antibody, wherein the fragment and the polypeptide bind
to the
CON167 seven transmembrane receptor. By way of non-limiting example, the
invention provides polypeptides that are single chain antibodies and CDR-
grafted
antibodies.
Also within the scope of the invention are compositions comprising
polypeptides, polynucleotides, or antibodies of the invention that have been
formulated with, e.g., a pharmaceutically acceptable carrier.
The invention also provides methods of using antibodies of the
invention. For example, the invention provides a method for modulating ligand
binding of a CON167 seven transmembrane receptor comprising the step of
contacting the seven transmembrane receptor with an antibody specific for the
seven
transmembrane receptor, under conditions wherein the antibody binds the
receptor.
CON167 is expressed in the brain, providing an indication that
1 S aberrant CON167 signaling activity may correlate with one or more
neurological
disorders. The invention also provides a method for treating a neurological
disorder
comprising the step of administering to a mammal in need of such treatment an
amount of a antibody-like polypeptide of the invention that is sufficient to
modulate
ligand binding of CON167 seven transmembrane receptor in neurons of the
mammal.
In addition to administration of antibody-like polypeptides, administration of
natural
ligands for CON167 as well as modulators of CON167 activity, such as small
molecules that mimic, agonize or antagonize ligand-mediated CON167 signaling,
are
contemplated. The expression pattern provides an indication that such
molecules will
have utility for treating neurological andlor psychiatric diseases, including
but not
limited to schizophrenia, depression, anxiety, bipolar disease, affective
disorders,
attention deficit hyperactivity disorder/attention deficit disorder
(ADHD/ADO),
epilepsy, neuritis, neurasthenia, neuropathy, neuroses, Alzheimer's disease,
Parkinson's disease, migraine, senile dementia, and the like. Treatment of
individuals
having any of these disorders is contemplated as an aspect of the invention.
CON167 also is expressed in the liver and in skeletal and heart muscle,
providing an indication that aberrant CON167 expression or signaling activity
may
CA 02376406 2002-O1-14
WO 01/14554 PCT/US00/21566
_g_
correlate with one or more cardiovascular, muscular, or hepatic disorders. The
invention provides a method for treating such a disorder comprising the step
of
administering to a mammal in need of such treatment an amount of antibody-like
polypeptide of the invention that is sufficient to modulate ligand binding of
CON167
seven transmembrane receptor that is expressed in the affected heart, muscle,
or liver
tissue of the mammal.
The invention also provides assays to identify compounds that bind
CON167 seven transmembrane receptor. One such assay comprises the steps o~ (a)
contacting a composition comprising CON167 seven transmembrane receptor with a
compound suspected of binding CON167; and (b) measuring binding between the
compound and CON167. In one variation, the composition comprises a cell
expressing CON167 on its surface. In another variation, isolated CON167 or
cell
membranes comprising CON167 are employed. The binding may be measured
directly, e.g., using a labeled compound, or may be measured indirectly by
several
techniques, including measuring intracellular signaling of CON167 induced by
the
compound (or measuring changes in the level of CON167 signaling).
The invention also provides a method for identifying a modulator of
binding between a CON167 seven transmembrane receptor and a CON167 binding
partner, comprising the steps o~ (a) contacting a CON167 binding partner and a
composition comprising a CON167 seven transmembrane receptor in the presence
and in the absence of a putative modulator compound; (b) detecting binding
between
the binding partner and the CON167; and (c) identifying a putative modulator
compound in view of decreased or increased binding between the binding partner
and
the CON167 in the presence of the putative modulator, as compared to binding
in the
absence of the putative modulator.
CON167 binding partners that stimulate CON167 are useful as
agonists in disease states characterized by insufficient CON167 signaling
(e.g., as a
result of insufficient expression of active CON167 ligand). CON167 binding
partners
that block ligand-mediated CON167 signaling are useful as CON167 antagonists
to
treat disease states characterized by excessive CON167 signaling.
CA 02376406 2002-O1-14
WO 01/14554 PCT/US00/21566
-9-
Additional features and variations of the invention will be apparent to
those skilled in the art from the entirety of this application, including the
drawing and
detailed description, and all such features are intended as aspects of the
invention.
Likewise, features of the invention described herein can be re-combined into
additional embodiments that also are intended as aspects of the invention,
irrespective
of whether the combination of features is specifically mentioned above as an
aspect or
embodiment of the invention. Also, only such limitations which are described
herein
as critical to the invention should be viewed as such; variations of the
invention
lacking limitations which have not been described herein as critical are
intended as
aspects of the invention.
In addition to the foregoing, the invention includes, as an additional
aspect, all embodiments of the invention narrower in scope in any way than the
variations specifically mentioned above. Although the applicants) invented the
full
scope of the claims appended hereto, the claims appended hereto are not
intended to
encompass within their scope the prior art work of others. Therefore, in the
event that
statutory prior art within the scope of a claim is brought to the attention of
the
applicants by a Patent Office or other entity or individual, the applicants)
reserve the
right to exercise amendment rights under applicable patent laws to redefine
the
subject matter of such a claim to specifically exclude such statutory prior
art or
obvious variations of statutory prior art from the scope of such a claim.
Variations of
the invention defined by such amended claims also are intended as aspects of
the
invention.
BRIEF DESCRIPTION OF THE DRAWING
Figure 1 depicts an alignment of a portion of the CON167 amino acid
sequence and a portion of the amino acid sequence of the human olfactory
receptor
FAT11 (Genbank Accession No. L35475, SEQ >D NO: 8). Identical residues and
residues of similar character (+) are indicated.
Figure 2 depicts an alignment of a portion of the CON167 amino acid
sequence with a portion of the amino acid sequence of the murine olfactory
receptor
CA 02376406 2002-O1-14
WO 01/14554 PCT/US00/21566
-10-
G7 (Genbank AF102537, SEQ ID NO: 9). Identical residues and residues of
similar
character (+) are indicated.
DETAILED DESCRIPTION OF THE INVENTION
The present invention provides purified and isolated polynucleotides
(e.g., DNA sequences and RNA transcripts, both sense and complementary
antisense
strands, both single and double stranded, including splice variants thereof)
encoding a
human G protein coupled receptor referred to herein as CON167. DNA
polynucleotides of the invention include genomic DNA, cDNA, and DNA that has
been chemically synthesized in whole or in part. "Synthesized" as used herein
and
understood in the art, refers to polynucleotides produced by purely chemical,
as
opposed to enzymatic, methods. "Wholly" synthesized DNA sequences are
therefore
produced entirely by chemical means, and "partially" synthesized DNAs embrace
those wherein only portions of the resulting DNA were produced by chemical
means.
Genomic DNA of the invention comprises the protein coding region
for a polypeptide of the invention and is also intended to include allelic
variants
thereof. It is widely understood that, for many genes, genomic DNA is
transcribed
into RNA transcripts that undergo one or more splicing events wherein intron
(i. e.,
non-coding regions) of the transcripts are removed, or "spliced out." RNA
transcripts
that can be spliced by alternative mechanisms, and therefore be subject to
removal of
different RNA sequences but still encode a CON167 polypeptide, are referred to
in the
art as splice variants which are embraced by the invention. Splice variants
comprehended by the invention therefore are encoded by the same original
genomic
DNA sequences but arise from distinct mRNA transcripts. Allelic variants are
modified forms of a wild type gene sequence, the modification resulting from
recombination during chromosomal segregation or exposure to conditions which
give
rise to genetic mutation. Allelic variants, like wild type genes, are
naturally occurring
sequences (as opposed to non-naturally occurnng variants which arise from in
vitro
manipulation).
The invention also comprehends cDNA that is obtained through
reverse transcription of an RNA polynucleotide encoding CON167 (conventionally
CA 02376406 2002-O1-14
WO 01/14554 PCT/US00/21566
-11-
followed by second strand synthesis of a complementary strand to provide a
double-
stranded DNA).
A preferred DNA sequence encoding a human CON167 polypeptide is
set out in SEQ ID NO: 1. The worker of skill in the art will readily
appreciate that the
preferred DNA of the invention comprises a double stranded molecule, for
example
the molecule having the sequence set forth in SEQ >D NO: 1 along with the
complementary molecule (the "non-coding strand" or "complement") having a
sequence deducible from the sequence of SEQ >D NO: 1 according to Watson-Crick
base pairing rules for DNA. Also preferred are other polynucleotides encoding
the
CON167 polypeptide of SEQ ID NO: 2, which differ in sequence from the
polynucleotide of SEQ ID NO: 1 by virtue of the well-known degeneracy of the
universal genetic code.
The invention further embraces species, preferably mammalian,
homologs of the human CON167 DNA. Species homologs, sometimes referred to as
"orthologs," in general, share at least 35%, at least 40%, at least 45%, at
least 50%, at
least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least
85%, at least
90%, at least 95%, at least 98%, or at least 99% homology with human DNA of
the
invention. Percent sequence "homology' with respect to polynucleotides of the
invention is defined herein as the percentage of nucleotide bases in the
candidate
sequence that are identical to nucleotides in the CON167 sequence set forth in
SEQ
>D NO: 1, after aligning the sequences and introducing gaps, if necessary, to
achieve
the maximum percent sequence identity.
The polynucleotide sequence information provided by the invention
makes possible large scale expression of the encoded polypeptide by techniques
well
known and routinely practiced in the art. Polynucleotides of the invention
also permit
identification and isolation of polynucleotides encoding related CON167
polypeptides, such as human allelic variants and species homologs, by well
known
techniques including Southern and/or Northern hybridization, and polymerase
chain
reaction (PCR). Examples of related polynucleotides include human and non-
human
genomic sequences, including allelic variants, as well as polynucleotides
encoding
polypeptides homologous to CON167 and structurally related polypeptides
sharing
CA 02376406 2002-O1-14
WO 01/14554 PCT/US00/21566
-12-
one or more biological, immunological, and/or physical properties of CON167.
Non-human species genes encoding proteins homologous to CON 167 can also be
identified by Southern and/or PCR analysis and are useful in animal models for
CON167 disorders. Knowledge of the sequence of a human CON167 DNA also
makes possible through use of Southern hybridization or polymerase chain
reaction
(PCR) the identification of genomic DNA sequences encoding CON167 expression
control regulatory sequences such as promoters, operators, enhancers,
repressors, and
the like. Polynucleotides of the invention are also useful in hybridization
assays to
detect the capacity of cells to express CON167. Polynucleotides of the
invention may
also be the basis for diagnostic methods useful for identifying a genetic
alterations) in
a CON167 locus that underlies a disease state or states, which information is
useful
both for diagnosis and for selection of therapeutic strategies.
The disclosure herein of a full length polynucleotide encoding a
CON167 polypeptide makes readily available to the worker of ordinary skill in
the art
every possible fragment of the full length polynucleotide. The invention
therefore
provides fragments of CON167-encoding polynucleotides comprising at least 14-
15,
and preferably at least 18, 20, 25, 50, or 75 consecutive nucleotides of a
polynucleotide encoding CON167. Preferably, fragment polynucleotides of the
invention comprise sequences unique to the CON167-encoding polynucleotide
sequence, and therefore hybridize under highly stringent or moderately
stringent
conditions only (i.e., "specifically") to polynucleotides encoding CON167 (or
fragments thereof). Fragments derived from nucleotides 1 to 769 of SEQ >D NO:
1,
that are upstream of the sequence found in clone 2939091H1 are highly
preferred.
Polynucleotide fragments of genomic sequences of the invention comprise not
only
sequences unique to the coding region, but also include fragments of the full
length
sequence derived from introns, regulatory regions, and/or other non-translated
sequences. Sequences unique to polynucleotides of the invention are
recognizable
through sequence comparison to other known polynucleotides, and can be
identified
through use of alignment programs routinely utilized in the art, e.g., those
made
available in public sequence databases. Such sequences also are recognizable
from
Southern and Northern hybridization analyses to determine the number of
fragments
CA 02376406 2002-O1-14
WO 01/14554 PCT/US00/21566
-13-
of genomic DNA and RNA to which a polynucleotide will hybridize.
Polynucleotides
of the invention can be labeled in a manner that permits their detection,
including
radioactive, fluorescent, and enzymatic labeling.
Fragment polynucleotides are particularly useful as probes for
detection of full length or other fragment CON167 polynucleotides. One or more
fragment polynucleotides can be included in kits that are used to detect the
presence
of a polynucleotide encoding CON167, or used to detect variations in a
polynucleotide
sequence encoding CON167.
The invention also embraces DNAs encoding CON167 polypeptides
which DNAs hybridize under moderately stringent or high stringency conditions
to
the non-coding strand, or complement, of the polynucleotide in SEQ ID NO: 1.
Exemplary highly stringent hybridization conditions are as follows:
hybridization at 42°C in a hybridization solution comprising 50%
formamide, 1%
SDS, 1M NaCI, 10% Dextran sulfate, and washing twice for 30 minutes at
60°C in a
wash solution comprising 0.1 X SSC and 1% SDS. It is understood in the art
that
conditions of equivalent stringency can be achieved through variation of
temperature
and buffer, or salt concentration as described Ausubel, et al. (Eds.),
Protocols in
Molecular Biolo~v, John Wiley & Sons (1994), pp. 6Ø3 to 6.4.10.
Modifications in
hybridization conditions can be empirically determined or precisely calculated
based
on the length and the percentage of guanosine/cytosine (GC) base pairing of
the probe.
The hybridization conditions can be calculated as described in Sambrook, et
al.,
(Eds.), Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory
Press: Cold Spring Harbor, New York (1989), pp. 9.47 to 9.51.
Autonomously replicating recombinant expression constructs such as
plasmid and viral DNA vectors incorporating polynucleotides of the invention
are also
provided. Expression constructs wherein CON167-encoding polynucleotides are
operatively linked to an endogenous or exogenous expression control DNA
sequence
and a transcription terminator are also provided. Expression control DNA
sequences
include promoters, enhancers, and operators, and are generally selected based
on the
expression systems in which the expression construct is to be utilized.
Preferred
promoter and enhancer sequences are generally selected for the ability to
increase
CA 02376406 2002-O1-14
WO 01/14554 PCT/US00/21566
- 14-
gene expression, while operator sequences are generally selected for the
ability to
regulate gene expression. Expression constructs of the invention may also
include
sequences encoding one or more selectable markers that permit identification
of host
cells bearing the construct. Expression constructs may also include sequences
that
S facilitate, and preferably promote, homologous recombination in a host cell.
Preferred
constructs of the invention also include sequences necessary for replication
in a host
cell.
Expression constructs are preferably utilized for production of an
encoded protein, but may also be utilized simply to amplify a CON167-encoding
polynucleotide sequence.
According to another aspect of the invention, host cells are provided,
including prokaryotic and eukaryotic cells, comprising a polynucleotide of the
invention (or vector of the invention) in a manner which permits expression of
the
encoded CON167 polypeptide. Polynucleotides of the invention may be introduced
into the host cell as part of a circular plasmid, or as linear DNA comprising
an
isolated protein coding region or a viral vector. Methods for introducing DNA
into
the host cell well known and routinely practiced in the art include
transformation,
transfection, electroporation, nuclear injection, or fusion with carriers such
as
liposomes, micelles, ghost cells, and protoplasts. Expression systems of the
invention
include bacterial, yeast, fungal, plant, insect, invertebrate, and mammalian
cells
systems.
Host cells of the invention are a valuable source of immunogen for
development of antibodies specifically immunoreactive with CON167. Host cells
of
the invention are also useful in methods for large scale production of CON167
polypeptides wherein the cells are grown in a suitable culture medium and the
desired
polypeptide products are isolated from the cells or from the medium in which
the cells
are grown by purification methods known in the art, e.g., conventional
chromatographic methods including immunoaffinity chromatography, receptor
affinity
chromatography, hydrophobic interaction chromatography, lectin affinity
chromatography, size exclusion filtration, cation or anion exchange
chromatography,
high pressure liquid chromatography (HPLC), reverse phase HPLC, and the like.
Still
CA 02376406 2002-O1-14
WO 01/14554 PCT/US00/21566
-15-
other methods of purification include those wherein the desired protein is
expressed
and purified as a fusion protein having a specific tag, label, or chelating
moiety that is
recognized by a specific binding partner or agent. The purified protein can be
cleaved
to yield the desired protein, or be left as an intact fusion protein. Cleavage
of the
fusion component may produce a form of the desired protein having additional
amino
acid residues as a result of the cleavage process.
Knowledge of CON167 DNA sequences allows for modification of
cells to permit, or increase, expression of endogenous CON167. Cells can be
modified (e.g., by homologous recombination) to provide increased expression
by
replacing, in whole or in part, the naturally occurnng CON167 promoter with
all or
part of a heterologous promoter so that the cells express CON167 at higher
levels.
The heterologous promoter is inserted in such a manner that it is operatively
linked to
endogenous CON167 encoding sequences. [See, for example, PCT International
Publication No. WO 94/12650, PCT International Publication No. WO 92/20808,
and
PCT International Publication No. WO 91/09955.] It is also contemplated that,
in
addition to heterologous promoter DNA, amplifiable marker DNA (e.g., ada,
dhfr, and
the multifunctional CAD gene which encodes carbamyl phosphate synthase,
aspartate
transcarbamylase, and dihydroorotase) and/or intron DNA may be inserted along
with
the heterologous promoter DNA. If linked to the CON167 coding sequence,
amplification of the marker DNA by standard selection methods results in
co-amplification of the CON167 coding sequences in the cells.
The DNA sequence information provided by the present invention also
makes possible the development through, e.g. homologous recombination or
"knock-out" strategies [Capecchi, Science 244:1288-1292 (1989)], of animals
that fail
to express functional CON167 or that express a variant of CON167. Such animals
(especially small laboratory animals such as rats, rabbits, and mice) are
useful as
models for studying the in vivo activities of CON167 and modulators of CON167.
Also made available by the invention are anti-sense polynucleotides
which recognize and hybridize to polynucleotides encoding CON167. Full length
and
fragment anti-sense polynucleotides are provided. Fragment anti-sense
molecules of
the invention include (i) those which specifically recognize and hybridize to
CON167
CA 02376406 2002-O1-14
WO 01/14554 PCT/US00/21566
- 16-
RNA (as determined by sequence comparison of DNA encoding CON167 to DNA
encoding other known molecules). Identification of sequences unique to CON167-
encoding polynucleotides can be deduced through use of any publicly available
sequence database, and/or through use of commercially available sequence
comparison programs, and can be further verified by hybridization analysis
against
genomic DNA. After identification of the desired sequences, isolation through
restriction digestion or amplification using any of the various polymerase
chain
reaction techniques well known in the art can be performed. Anti-sense
polynucleotides are particularly relevant to regulating expression of CON 167
by those
cells expressing CON167 mRNA.
Antisense nucleic acids (preferably 10 to 20 base pair oligonucleotides)
capable of specifically binding to CON167 expression control sequences or
CON167
RNA are introduced into cells (e.g., by a viral vector or colloidal dispersion
system
such as a liposome). The antisense nucleic acid binds to the CON167 target
nucleotide sequence in the cell and prevents transcription or translation of
the target
sequence. Phosphorothioate and methylphosphonate antisense oligonucleotides
are
specifically contemplated for therapeutic use by the invention. The antisense
oligonucleotides may be further modified by poly-L-lysine, transferrin
polylysine, or
cholesterol moieties at their 5' end. Suppression of CON167 expression at
either the
transcriptional or translational level is useful to general cellular and/or
animal models
for diseases characterized by aberrant expression. Suppression of CON167
expression at either the transcriptional or translational level is useful to
generate
cellular animal models for diseases characterized by aberrant CON167
expression.
The CON167 sequences taught in the present invention facilitate the
design of novel transcription factors for modulating CON167 expression in
native
cells and animals, and cells transformed or transfected with CON167
polynucleotides. For example, the Cysz-Hisz zinc finger proteins, which bind
DNA
via their zinc finger domains, have been shown to be amenable to structural
changes
that lead to the recognition of different target sequences. These artificial
zinc finger
proteins recognize specific target sites with high affinity and low
dissociation
constants, and are able to act as gene switches to modulate gene expression.
CA 02376406 2002-O1-14
WO 01/14554 PCT/US00/21566
-17-
Knowledge of the particular CON167 target sequence of the present invention
facilitates the engineering of zinc finger proteins specific for the target
sequence using
known methods such as a combination of structure-based modeling and screening
of
phage display libraries [Segal et al., Proc. Natl. Acad. Sc.i U.S.A., 96: 2758-
2763
S (1999); Liu et al., Proc. Natl. Acad. Sci. U.S.A., 94: 5525-30 (1997);
Greisman and
Patio, Science, 275: 657-61 (1997); Choo et al., J. Mol. Biol., 273: 525-32
(1997)].
Each zinc finger domain usually recognizes three or more base pairs. Since a
recognition sequence of 18 base pairs is generally sufficient in length to
render it
unique in any known genome, a zinc finger protein consisting of 6 tandem
repeats of
zinc fingers would be expected to ensure specificity for a particular sequence
[Segal et
al., Proc. Natl. Acad. Sci. U.S.A., 96: 2758-2763 (1999)]. The artificial zinc
finger
repeats, designed based on CON167 sequences, are fused to activation or
repression
domains to promote or suppress CON167 expression [Liu et al., Proc. Natl.
Acad. Sci.
U.S.A., 94: 5525-30 (1997)]. Alternatively, the zinc finger domains can be
fused to
the TATA box-binding factor (TBP) with varying lengths of linker region
between the
zinc finger peptide and the TBP to create either transcriptional activators or
repressors
[Kim et al., Proc. Natl. Acad. Sci. U.S.A., 94: 3616-3620 (1997)]. Such
proteins, and
polynucleotides that encode them, have utility for modulating CON167
expression in
vivo in both native cells, animals and humans; and/or cells transfected with
CON167-
encoding sequences. The novel transcription factor can be delivered to the
target cells
by transfecting constructs that express the transcription factor (gene
therapy), or by
introducing the protein. Engineered zinc finger proteins can also be designed
to bind
RNA sequences for use in therapeutics as alternatives to antisense or
catalytic RNA
methods [McColl et al., Proc. Natl. Acad. Sci. U.S.A, 96:9521-6 (1999); Wu et
al.,
Proc. Natl. Acad. Sci. U.S.A., 92:344-348 (1995)]. The present invention
contemplates methods of designing such transcription factors based on the gene
sequence of the invention, as well as customized zinc finger proteins, that
are useful
to modulate CON167 expression in cells (native or transformed) whose genetic
complement includes these sequences.
The invention also provides purified and isolated mammalian CON167
polypeptides encoded by a polynucleotide of the invention. Presently preferred
is a
CA 02376406 2002-O1-14
WO 01/14554 PCT/US00/21566
-18-
human CON167 polypeptide comprising the amino acid sequence set out in SEQ >D
NO: 2.
The invention also embraces polypeptides that have at least 99%,at
least 95%, at least 90%, at least 85%, at least 80%, at least 75%, at least
70%, at least
S 65%, at least 60%, at least 55% or at least SO% identity and/or homology to
the
preferred polypeptide of the invention. Percent amino acid sequence "identity"
with
respect to the preferred polypeptide of the invention is defined herein as the
percentage of amino acid residues in the candidate sequence that are identical
with the
residues in the CON167 sequence after aligning both sequences and introducing
gaps,
if necessary, to achieve the maximum percent sequence identity, and not
considering
any conservative substitutions as part of the sequence identity. Percent
sequence
"homology" with respect to the preferred polypeptide of the invention is
defined
herein as the percentage of amino acid residues in the candidate sequence that
are
identical with the residues in the CON167 sequence after aligning the
sequences and
introducing gaps, if necessary, to achieve the maximum percent sequence
identity, and
also considering any conservative substitutions as part of the sequence
identity.
In one aspect, percent homology is calculated as the percentage of
amino acid residues in the smaller of two sequences which align with identical
amino
acid residue in the sequence being compared, when four gaps in a length of 100
amino
acids may be introduced to maximize alignment [Dayhoff, in Atlas of Protein
Sequence and Structure, Vol. 5, p. 124, National Biochemical Research
Foundation,
Washington, D.C. (1972), incorporated herein by reference].
Polypeptides of the invention may be isolated from natural cell
sources or may be chemically synthesized, but are preferably produced by
recombinant procedures involving host cells of the invention. Use of mammalian
host
cells is expected to provide for such post-translational modifications (e.g.,
glycosylation, truncation, lipidation, and phosphorylation) as may be needed
to confer
optimal biological activity on recombinant expression products of the
invention.
Glycosylated and non-glycosylated forms of CON167 polypeptides are embraced.
The invention also embraces variant (or analog) CON167 polypeptides.
In one example, insertion variants are provided wherein one or more amino acid
CA 02376406 2002-O1-14
WO 01/14554 PCT/US00/21566
-19-
residues supplement a CON167 amino acid sequence. Insertions may be located at
either or both termini of the protein, or may be positioned within internal
regions of
the CON167 amino acid sequence. Insertional variants with additional residues
at
either or both termini can include for example, fusion proteins and proteins
including
amino acid tags or labels.
Insertion variants include CON167 polypeptides wherein one or more
amino acid residues are added to a CON 167 amino acid sequence, or to a
biologically
active fragment thereof.
Variant products of the invention also include mature CON167
products, i.e., CON167 products wherein leader or signal sequences are
removed, with
additional amino terminal residues. The additional amino terminal residues may
be
derived from another protein, or may include one or more residues that are not
identifiable as being derived from a specific proteins. CON167 products with
an
additional methionine residue at position -1 (Met-'-CON167) are contemplated,
as are
variants with additional methionine and lysine residues at positions -2 and -1
(Met-z-Lys'-CON167). Variants of CON167 with additional Met, Met-Lys, Lys
residues (or one or more basic residues in general) are particularly useful
for enhanced
recombinant protein production in bacterial host cell.
The invention also embraces CON167 variants having additional
amino acid residues which result from use of specific expression systems. For
example, use of commercially available vectors that express a desired
polypeptide as
part of glutathione-S-transferase (GST) fusion product provides the desired
polypeptide having an additional glycine residue at position -1 after cleavage
of the
GST component from the desired polypeptide. Variants which result from
expression
in other vector systems are also contemplated.
Insertional variants also include fusion proteins wherein the amino
and/or carboxy termini of CON167 is fused to another polypeptide.
In another aspect, the invention provides deletion variants wherein one
or more amino acid residues in a CON167 polypeptide are removed. Deletions can
be
effected at one or both termini of the CON167 polypeptide, or with removal of
one or
CA 02376406 2002-O1-14
WO 01/14554 PCT/US00/21566
-20-
more residues within the CON167 amino acid sequence. Deletion variants,
therefore,
include all fragments of a CON167 polypeptide.
The invention also embraces polypeptide fragments of the sequence set
out in SEQ m NO: 2 wherein the fragments maintain biological (e.g., ligand
binding
S and/or intracellular signaling) immunological properties of a CON167
polypeptide.
Fragments comprising at least 5, 10, 15, 20, 25, 30, 35, or 40 consecutive
amino acids
of SEQ B7 NO: 2 are comprehended by the invention. Preferred polypeptide
fragments display antigenic properties unique to or specific for human CON167
and
its allelic and species homologs. Fragments of the invention having the
desired
biological and immunological properties can be prepared by any of the methods
well
known and routinely practiced in the art.
In still another aspect, the invention provides substitution variants of
CON167 polypeptides. Substitution variants include those polypeptides wherein
one
or more amino acid residues of a CON167 polypeptide are removed and replaced
with
alternative residues. In one aspect, the substitutions are conservative in
nature,
however, the invention embraces substitutions that ore also non-conservative.
Conservative substitutions for this purpose may be defined as set out in
Tables A, B,
or C below.
Variant polypeptides include those wherein conservative substitutions
have been introduced by modification of polynucleotides encoding polypeptides
of the
invention. Amino acids can be classified according to physical properties and
contribution to secondary and tertiary protein structure. A conservative
substitution is
recognized in the art as a substitution of one amino acid for another amino
acid that
has similar properties. Exemplary conservative substitutions are set out in
Table A
(from WO 97/09433, page 10, published March 13, 1997 (PCT/GB96/02197, filed
9/6/96), immediately below.
CA 02376406 2002-O1-14
WO 01/14554 PCT/US00/21566
-21
Table I
Conservative Substitutions I
SIDE CHAIN
CHARACTERISTIC AMINO ACID
Aliphatic
Non-polar G A P
ILV
Polar - uncharged C S T M
N Q
Polar - charged D E
KR
Aromatic H F W Y
Other N Q D E
Alternatively, conservative amino acids can be grouped as described in
Lehninger,
[Biochemistry, Second Edition; Worth Publishers, Inc. NY:NY (1975), pp.71-77]
as
set out in Table B, immediately below.
Table B
Conservative Substitutions II
SIDE CHAIN
CHARACTERISTIC AMINO ACID
Non-polar (hydrophobic)
A. Aliphatic: A L I V P
B. Aromatic: F W
C. Sulfur-containing: M
D. Borderline: G
Uncharged-polar
A. Hydroxyl: S
TY
B. Amides: N Q
C. Sulfhydryl: C
D. Borderline: G
Positively Charged (Basic): K R H
Negatively Charged (Acidic):
DE
As still an another alternative, exemplary conservative substitutions are set
out in
Table C, immediately below.
CA 02376406 2002-O1-14
WO 01/14554 PCT/US00/21566
-22-
Table C
Conservative Substitutions III
Original Exem~lar~ Substitution
Residue
Ala (A) Val, Leu, Ile
Arg (R) Lys, Gln, Asn
Asn (N) Gln, His, Lys, Arg
Asp (D) Glu
Cys (C) Ser
Gln (Q) Asn
Glu (E) Asp
His (H) Asn, Gln, Lys, Arg
Ile (I) Leu, Val, Met, Ala,
Phe,
Leu (L) Ile, Val, Met, Ala,
Phe
Lys (K) Arg, Gln, Asn
Met (M) Leu, Phe, Ile
Phe (F) Leu, Val, Ile, Ala
Pro (P) Gly
Ser (S) Thr
Thr (T) Ser
Trp (W) Tyr
Tyr (Y) Trp, Phe, Thr, Ser
Val (V) Ile, Leu, Met, Phe,
Ala
CON167 variants that display ligand binding properties of native
CON167 and are expressed at higher levels, and variants that provide for
constitutive
active receptor are particularly useful in assays of the invention. Such
variants also are
useful in cellular and animal models for diseases characterized by aberrant
CON 167
expression/activity.
CA 02376406 2002-O1-14
WO 01/14554 PCT/US00/21566
-23-
It should be understood that the definition of polypeptides of the
invention is intended to include polypeptides bearing modifications other than
insertion, deletion, or substitution of amino acid residues. By way of
example, the
modifications may be covalent in nature, and include for example, chemical
bonding
with polymers, lipids, other organic, and inorganic moieties. Such derivatives
may be
prepared to increase circulating half life of a polypeptide, or may be
designed to
improve targeting capacity for the polypeptide to desired cells, tissues, or
organs.
Similarly, the invention further embraces CON167 polypeptides that
have been covalently modified to include one or more water soluble polymer
attachments such as polyethylene glycol, polyoxyethylene glycol, or
polypropylene
glycol.
In a related embodiment, the present invention provides compositions
comprising purified polypeptides of the invention. Preferred compositions
comprise,
in addition to the polypeptide of the invention, a pharmaceutically acceptable
(i. e.,
sterile and non-toxic) liquid, semisolid, or solid diluents that serve as
pharmaceutical
vehicles, excipients, or media. Any diluent known in the art may be used.
Exemplary
diluents include, but are not limited to, water, saline solutions,
polyoxyethylene
sorbitan monolaurate, magnesium stearate, methyl- and propylhydroxybenzoate,
talc,
alginates, starches, lactose, sucrose, dextrose, sorbitol, mannitol, glycerol,
calcium
phosphate, mineral oil, and cocoa butter.
Also comprehended by the present invention are antibodies (e.g.,
monoclonal and polyclonal antibodies, single chain antibodies, chimeric
antibodies,
bifunctional/bispecific antibodies, humanized antibodies, human antibodies,
and
complementary determining region (CDR)-grafted antibodies, including compounds
which include CDR sequences which specifically recognize a polypeptide of the
invention) specific for CON167 or fragments thereof. Preferred antibodies of
the
invention are human antibodies which can be produced and identified according
to
methods described in W093/11236, published June 20, 1993, which is
incorporated
herein by reference in its entirety. Antibody fragments, including Fab, Fab',
F(ab')Z,
and F~, are also provided by the invention. The term "specific for," when used
to
describe antibodies of the invention, indicates that the variable regions of
the
CA 02376406 2002-O1-14
WO 01/14554 PCT/US00/21566
-24-
antibodies of the invention recognize and bind CON167 polypeptides exclusively
(i.e.,
able to distinguish CON167 polypeptides from other known GPCR polypeptides by
virtue of measurable differences in binding affinity, despite the possible
existence of
localized sequence identity, homology, or similarity between CON167 and such
polypeptides). It will be understood that specific antibodies may also
interact with
other proteins (for example; S. aureus protein A or other antibodies in ELISA
techniques) through interactions with sequences outside the variable region of
the
antibodies, and in particular, in the constant region of the molecule.
Screening assays
to determine binding specificity of an antibody of the invention are well
known and
routinely practiced in the art. For a comprehensive discussion of such assays,
see
Harlow et al. (Eds), Antibodies A Laboratory Manual; Cold Spring Harbor
Laboratory; Cold Spring Harbor , NY (1988), Chapter 6. Antibodies that
recognize
and bind fragments of the CON167 polypeptides of the invention are also
contemplated, provided that the antibodies are, first and foremost, specific
for
CON167 polypeptides. Antibodies of the invention can be produced using any
method well known and routinely practiced in the art.
Non-human antibodies may be humanized by any methods known in
the art. In one method, the non-human CDRs are inserted into a human antibody
or
consensus antibody framework sequence. Further changes can then be introduced
into
the antibody framework to modulate affinity or immunogenicity.
Antibodies of the invention are useful for, for example, therapeutic
purposes (by modulating activity of CON167), diagnostic purposes to detect or
quantitate CON167, as well as purification of CON167. Kits comprising an
antibody of the invention for any of the purposes described herein are also
comprehended. In general, a kit of the invention also includes a control
antigen for
which the antibody is immunospecific.
Specific binding molecules, including natural ligands and synthetic
compounds, can be identified or developed using isolated or recombinant CON167
products, CON167 variants, or preferably, cells expressing such products.
Binding
partners are useful for purifying CON167 products and detection or
quantification of
CON167 products in fluid and tissue samples using known immunological
CA 02376406 2002-O1-14
WO 01/14554 PCT/US00/21566
-25-
procedures. Binding molecules are also manifestly useful in modulating (i.e.,
blocking, inhibiting or stimulating) biological activities of CON167,
especially those
activities involved in signal transduction.
The DNA and amino acid sequence information provided by the
present invention also makes possible identification of binding partner
compounds
with which a CON167 polypeptide or polynucleotide will interact. Methods to
identify binding partner compounds include solution assays, in vitro assays
wherein
CON167 polypeptides are immobilized, and cell based assays. Identification of
binding partner compounds of CON167 polypeptides provides candidates for
therapeutic or prophylactic intervention in pathologies associated with CON167
normal and aberrant biological activity.
The invention includes several assay systems for identifying CON167
binding partners. In solution assays, methods of the invention comprise the
steps of
(a) contacting a CON167 polypeptide with one or more candidate binding partner
compounds and (b) identifying the compounds that bind to the CON167
polypeptide.
Identification of the compounds that bind the CON167 polypeptide can be
achieved
by isolating the CON167 polypeptide/binding partner complex, and separating
the
CON167 polypeptide from the binding partner compound. An additional step of
characterizing the physical, biological, and/or biochemical properties of the
binding
partner compound in also comprehended in another embodiment of the invention.
In
one aspect, the CON167 polypeptide/binding partner complex is isolated using a
antibody immunospecific for either the CON167 polypeptide or the candidate
binding
partner compound.
In still other embodiments, either the CON167 polypeptide or the
candidate binding partner compound comprises a label or tag that facilitates
its
isolation, and methods of the invention to identify binding partner compounds
include
a step of isolating the CON167 polypeptidelbinding partner complex through
interaction with the label or tag. An exemplary tag of this type is a poly-
histidine
sequence, generally around six histidine residues, that permits isolation of a
compound so labeled using nickel chelation. Other labels and tags, such as the
CA 02376406 2002-O1-14
WO 01/14554 PCT/US00/21566
-26-
FLAG~ tag (Eastman Kodak, Rochester, NY), well known and routinely used in the
art, are embraced by the invention..
In one variation of an in vitro assay, the invention provides a method
comprising the steps of (a) contacting an immobilized CON167 polypeptide with
a
candidate binding partner compound and (b) detecting binding of the candidate
compound to CON167 polypeptide. In an alternative embodiment, the candidate
binding partner compound is immobilized and binding of CON167 is detected.
Immobilization is accomplished using any of the methods well known in the art,
including covalent bonding to a support, a bead, or a chromatographic resin,
as well as
non-covalent, high affinity interaction such as antibody binding, or use of
streptavidin/biotin binding wherein the immobilized compound includes a biotin
moiety. Detection of binding can be accomplished (i) using a radioactive label
on the
compound that is not immobilized, (ii) using of a fluorescent label on the non-
immobilized compound, (iii) using an antibody immunospecific for the non-
immobilized compound, (iv) using a label on the non-immobilized compound that
excites a fluorescent support to which the immobilized compound is attached,
as well
as other techniques well known and routinely practiced in the art.
The invention also provides cell-based assays to identify binding
partner compounds of a CON167 polypeptide. In one embodiment, the invention
provides a method comprising the steps of contacting a CON167 polypeptide
expressed on the surface of a cell with a candidate binding partner compound
and
detecting binding of the candidate binding partner compound to the CON167
polypeptide. In a preferred embodiment, the detection comprises detecting a
calcium
flux or other physiological cellular event caused by the binding of the
molecule.
Agents that modulate (i.e., increase, decrease, or block) CON167
activity or expression may be identified by incubating a putative modulator
with a cell
expressing a CON 167 polypeptide or polynucleotide and determining the effect
of the
putative modulator on CON167 activity or expression. The selectivity of a
compound
that modulates the activity of CON167 can be evaluated by comparing its
effects on
CON167 to its effect on other GPCR compounds. Selective modulators may
include,
for example, antibodies and other proteins, peptides, or organic molecules
which
CA 02376406 2002-O1-14
WO 01/14554 PCT/US00/21566
-27-
specifically bind to a CON167 polypeptide or a CON167-encoding nucleic acid.
Modulators of CON167 activity will be therapeutically useful in treatment of
diseases
and physiological conditions in which normal or aberrant CON167 activity is
involved.
Methods of the invention to identify modulators include variations on
any of the methods described above to identify binding partner compounds, the
variations including techniques wherein a binding partner compound has been
identified and the binding assay is carned out in the presence and absence of
a
candidate modulator. A modulator is identified in those instances where
binding
between the CON167 polypeptide and the binding partner compound changes in the
presence of the candidate modulator compared to binding in the absence of the
candidate modulator compound. A modulator that increases binding between the
CON167 polypeptide and the binding partner compound is described as an
enhancer
or activator, and a modulator that decreases binding between the CON167
polypeptide
and the binding partner compound is described as an inhibitor.
The invention also comprehends high throughput screening (HTS)
assays to identify compounds that interact with or inhibit biological activity
(i. e.,
inhibit enzymatic activity, binding activity, etc.) of a CON167 polypeptide.
HTS
assays permit screening of large numbers of compounds in an efficient manner.
Cell-
based HTS systems are contemplated to investigate CON167 receptor-ligand
interaction. HTS assays are designed to identify "hits" or 'lead compounds"
having
the desired property, from which modifications can be designed to improve the
desired property. Chemical modification of the "hit" or "lead compound" is
often
based on an identifiable structure/activity relationship between the "hit" and
the
CON167 polypeptide.
Mutations in the CON167 gene that result in loss of normal function of
the CON167 gene product underlie CON167-related human disease states. The
invention comprehends gene therapy to restore CON167 activity to treat those
disease
states. Delivery of a functional CON167 gene to appropriate cells is effected
ex vivo,
in situ, or in vivo by use of vectors, and more particularly viral vectors
(e.g.,
adenovirus, adeno-associated virus, or a retrovirus), or ex vivo by use of
physical
CA 02376406 2002-O1-14
WO 01/14554 PCT/US00/21566
-28-
DNA transfer methods (e.g., liposomes or chemical treatments). See, for
example,
Anderson, Nature, supplement to vol. 392, no. 6679, pp.25-20 (1998). For
additional
reviews of gene therapy technology see Friedmann, Science, 244: 1275-1281
(1989);
Verma, Scientific American: 68-84 (1990); and Miller, Nature, 357: 455-460
(1992).
Alternatively, it is contemplated that in other human disease states,
preventing the
expression of or inhibiting the activity of CON167 will be useful in treating
the
disease states. It is contemplated that antisense therapy or gene therapy
could be
applied to negatively regulate the expression of CON167.
Additional features of the invention will be apparent from the
following Examples.
EXAMPLE 1
CLONING OF CON167 G PROTEIN COUPLED RECEPTOR
A. Database search
The Incyte and Genbank expressed sequence tag (EST) databases were
searched with the NCBI program Blastall using all known GPCR's as query
sequences
to find patterns suggestive of novel G protein coupled receptors. Positive
hits from
the find-pattern program were further analyzed with the GCG program BLAST to
determine which ones were the most likely candidates to encode G-protein
coupled
receptors using the standard (default) alignment produced by BLAST as a guide.
This searching identified Clone 2939091H1 in the Incyte database as
an interesting candidate sequence. The 2939091H1 clone was obtained and
sequenced using standard techniques. From the sequence it was deduced that
Clone
2939091H contained only the seventh transmembrane region (TM7) of a GPCR.
Referring to SEQ ID NO: l, the nucleotide sequence of Clone 2939091H1
corresponds to bases 770 to 948 of what was eventually determined to be the
complete
sequence of a novel seven transmembrane receptor. A database search with this
partial sequence showed a 56% match to an olfactory receptor.
CA 02376406 2002-O1-14
WO 01/14554 PCT/US00/21566
-29-
B. Screening of a Phaee Librarv to Obtain a.Full-Length GPCR Clone
Based on the complete sequence of Clone 2939091H1, two
oligonucleotide primers were designed to screen a genomic library in an
attempt to
isolate a full-length clone of a novel GPCR:
Primer LW 1129: 5'-GCCTCTATCTTCTACACAGTCC-3' (SEQ ~ NO: 3), and
Primer LW 1130: 5'-CCAAAACCTATAAACCATCC-3' (SEQ >l7 NO: 4).
These primers were designed to amplify a 251 base pair portion of a clone
containing
the partial putative GPCR sequence found in Clone 2939091H1 (assuming the
absence of introns in this region).
To prepare a suitable library for screening, two microliters of a human
genomic library 0108 plaque forming units per milliliter (PFU/ml) (Clontech)
were
added to 6 ml of an overnight culture of K802 cells (ClonTech), then
distributed as
250 ~l aliquots into each of 24 tubes. The tubes were incubated at 37°C
for 15
minutes, and then seven millimeters of 0.8% agrarose were added to each tube.
After
mixing, the contents of the tubes were poured onto LB plates and incubated
overnight
at 37°C.
A BA85 nitrocellulose filter (Schleicher & Schuell) was placed on top
of each of the confluent plates for 10-1 S minutes. The filter was removed,
placed
phage side up in a petri dish, and covered with 4 ml of SM media (0.1M NaCI,
8.1
pM MgS04~7H20, SOmM Tris-Cl, pH 7.5, 0.001% gelatin) for 15 minutes to elute
the
phage. One milliliter of SM was removed from each plate, centrifuged to remove
bacteria, and the supernatant put into a fresh tube and stored at 4°C.
Polymerase chain reaction (PCR) was selected as a technique for
screening the phage library. Each PCR reaction was done in a 20 p1 reaction
volume
containing 8.84 p1 HZO, 2 p1 1 Ox PCR buffer II (Perkin-Elmer), 2 p1 of 25 mM
MgClz, 0.8 p1 10 mM dNTP mixture (dATP, dCTP, dGTP, dCTP), 0.12 p1 of primer
LW 1129 (approx. 1 p g/pl), 0.12 p1 of primer LW 1130, 0.12 p1 AmpliTaq Gold
polymerase (5 U/pl, Perkin Elmer) and 2 p1 of phage from each of the 24 tubes.
The
PCR reaction involved 1 cycle at 95°C for 10 minutes and 80°C
for 30 minutes,
followed by 10 cycles at 95°C for 30 seconds, 50°C for 2
minutes, 72°C for 30
CA 02376406 2002-O1-14
WO 01/14554 PCT/US00/21566
-30-
seconds, followed by 30 cycles of at 95°C for 15 seconds, 50°C
for 30 seconds, 72°C
for 30 seconds, followed by a final "cycle" at 72°C for 5 minutes.
Following PCR cycling, the contents from each reaction tube was
loaded onto a 2% agarose gel and electrophoresed adjacent to known size
standards to
screen for PCR products of the expected size length indicative of a clone
containing
the 251 by portion of Clone 2939091H1 amplified by the two selected primers.
Positive clones were identified in one of the 24 tubes.
From the original tube that had given a PCR product of the correct
size, a 5 p1 phage aliquot was used to set up a series of dilutions that were
plated,
incubated and filter lifted in the same manner as the original phage library.
The PCR
reaction was run as above, and the plate of the lowest dilution to give a PCR
product
of the expected size was selected for subsequent experiments. This culture
tube was
again subdivided, filter lifted, and screened using the same PCR procedure.
The
series of dilutions and subdividing of the plate was continued until a single
plaque
was isolated that gave a positive PCR band.
Once a single plaque was isolated, 20 p1 phage supernatant was used to
infect 250 p1 of lOxK802 cells (resuspended in SM). The cells were cultured at
37°C
for 16 hours, and genomic phage DNA was isolated using Qiagen's Lambda Midi
Kit.
Sequencing of this genomic DNA identified a methionine-initiated 945
nucleotide
open reading frame that included sequence corresponding to Clone 2939091H1.
Analysis of the sequence revealed seven hydrophobic regions that were
identified as
putative transmembrane regions of a novel GPCR designated CON167. The DNA
and deduced amino acid sequences of CON167 are set forth in SEQ ~ NOs: 1 and
2.
C. Subcloning of the Coding Region of CON167 via PCR
Additional experiments were conducted to subclone the coding region
of the CON167 clone into a useful vector. Two additional PCR primers were
designed based on the coding region of CON167. The first, Primer LW 1168, from
5'
to 3' (SEQ m NO: 5):
GCACTAGTAATACGACTCACTATAGGGAGACCACCATGGGAAGATGGGTGAACCAGTCC,
includes the 5' end of the CON167 coding sequence (underlined) as well as
upstream
CA 02376406 2002-O1-14
WO 01/14554 PCT/US00/21566
-31 -
sequence of the T7 promoter, useful for subsequent expression work. The
second,
Primer LW 1169, from 5' to 3' (SEQ ID NO: 6):
GACTGGATCCCCCGGGCTTTTTT1"hTTTTTTTGCGGCCGCTCAGTGCTGGCTGCCAATCC,
includes sequence complementary to the 3' end of the CON167 coding sequence
(underlined), followed by sequence useful for subsequent cloning and
expression
work.
The PCR was performed in a 50 p1 reaction containing 35 p1 HzO, 5 p1
lOX TT buffer (140 mM Ammonium Sulfate, 0.1% gelatin, 0.6 M Tris-tricine pH
8.4), 5 p1 15 mM MgS04, 2 p1 10 mM dNTP, 2 p1 genomic phage DNA (0.175
pg/~1), 0.3 pg/pl Primer LW1168 (1 pg/pl), 0.3 p1 Primer LW1169 (1 qg/~1), 0.5
p1
High Fidelity Taq polymerase (Boehringer Mannheim). The PCR reaction was
started
with 1 cycle of 94°C for 2 minutes; followed by 10 cycles at
94°C for 30 seconds,
55 °C for 2 minutes, and 72°C for 2 minutes; followed by 25
cycles at 94°C for 30
seconds, 55 ° C for 30 seconds, and 72 ° C for 2 minutes.
The contents from the PCR reaction was loaded onto a 1.2% agarose
gel and electroeluted. The DNA band of expected size was excised from the gel,
placed in GenElute Agarose spin column (Supelco) and spun for 10 minutes at
maximum speed. The eluted DNA was ethanol-precipitated and resuspended in 6 p1
H20 for ligation.
The PCR fragment containing the CON167 coding sequence was
ligated into a commercial vector using Invitrogen's Original TA Cloning Kit.
The
ligation reaction consisted of 6 p1 DNA, 1 p1 l Ox ligation buffer, 2 ~1 of
plasmid
pCR2.1 (25 ng/p l), Invitrogen), 1 ~ 1 T4 DNA ligase (Invitrogen) and was
incubated
overnight at 14°C. The reaction was heated at 65 °C for 10
minutes to inactivate the
enzyme, and then on microliter of the ligation reaction was transformed in One
Shot
cells (Invitrogen) and plated onto ampicillin plates. A single colony
containing an
insert was used to inoculate 50 ml culture of LB medium. The culture was grown
for
16 hours at 37°C, and centrifuged into a cell pellet. Plasmid DNA was
purified from
the pellet using a Qiagen Plasmid Midi Kit and then sequenced to confirm
successful
cloning of the CON167 insert, using an ABI377 fluorescence-based sequencer
(Perkin
CA 02376406 2002-O1-14
WO 01/14554 PCT/US00/21566
-32-
Elmer/Applied Biosystems Division, PE/ABD, Foster City, CA) and the ABI
PRISMTM Ready Dye-Deoxy Terminator kit with Taq FSTM polymerase.
Each ABI cycle sequencing reaction contained about 0.5 pg of plasmid
DNA. Cycle-sequencing was performed using an initial denaturation at
98°C for 1
minute, followed by 50 cycles: 98°C denaturation for 30 seconds,
annealing at 50°C
for 30 seconds, and extension at 60°C for 4 minutes. Temperature cycles
and times
were controlled by a Perkin-Elmer 9600 thermocycler. Extension products were
purified using CentriflexTM gel filtration cartridges (Advanced Genetic
Technologies
Corp., Gaithersburg, MD). Each reaction product was loaded by pipette onto the
column, which was then centrifuged in a swinging bucket centrifuge (Sorvall
model
RT6000B table top centrifuge) at 1500 x g for 4 minutes at room temperature.
Column-purified samples were dried under a vacuum for about 40 minutes and
then
dissolved in S p.1 of a DNA loading solution (83% deionized formamide, 8.3 mM
EDTA, and 1.6 mg/ml Blue Dextran). The samples were then heated to
90°C for
three minutes and loaded into the gel sample wells for sequence analysis by
the
ABI377 sequencer. Sequencer analysis was done by importing ABI377 files into
the
Sequencer program (Gene Codes, Ann Arbor, MI). Generally sequence reads of 700
by were obtained. Potential sequence errors were minimized by obtaining
sequence
information from both DNA strands and by re-sequencing difficult areas using
primers at different locations until all sequencing ambiguities were removed.
EXAMPLE 2
Analysis of the CON167 Sequence
The DNA and deduced amino acid sequence for CON167 are set forth
in SEQ ID NO: 1 and 2, respectively. Beginning with the initiator methionine,
the
CON167 genomic clone contains an open reading frame of 945 nucleotides
encoding
31 S amino acids, followed by a stop codon. Using a FORTRAN computer program
called "tmtrest.all" [Parodi et al., Comput. Appl. Biosci., 5: 527-535
(1994)], CON167
was deduced to contain seven transmembrane-spanning domains corresponding to
residues 27-51, 60-79, 92-121, 151-170, 196-220, 242-260, 274-294.
CA 02376406 2002-O1-14
WO 01/14554 PCT/US00/21566
-33-
CON167 contains a DHY sequence following the third transmembrane
domain (TM3), which distinguishes CON167 from most GPCR which have a DRY
sequence at this location. The sequence DHY is not unheard of, however, and
has
been observed, for example, in the receptor known as GPR1. [See Marchese et
al.,
Genomics, 23:609-618 (1994)].
The sequence of the CON167 was compared to sequences of known
genes. CON167 is 45% identical and 63% similar to a rat olfactory receptor
[see
Guillaume et al., Recept. Channels, 3: 33-40 (1994)] and 46% identical/63%
similar
to the human olfactory receptor fatl l [Fan et al., Immunogenetics, 44: 97-103
(1996)].
A subsequent database search revealed that a 223 amino acid stretch of CON167
was
83% identical (187/223) and 87% similar (198/223) to murine olfactory receptor
G7
[Krautwurst et al., Cell, 95: 917-926 (1998)]. This level of sequence
similarity
suggests that CON167 represents an ortholog (species equivalent) of the G7
receptor,
but at least two important differences are evident. A Northern hybridization
using a
CONl 67 probe showed expression in several areas of the brain including the
cerebellum, cerebral cortex and the medulla. Second, following transmembrane
III,
the CON167 polypeptide has a DHY sequence while the mouse has a DRY. The
GPCR known as GPR1 provides a precedence for this observation, where the human
gene has a DHY sequence but the rat othologue has a DRY. (See Marchese et al.,
Biochem. Biophy. Res. Comm., 205: 1952-1958 (1994).) A Northern hybridization
showed a different distribution in the brain for the human and rat receptor
which the
authors believed demonstrated a functional variation for this receptor in
these two
species.
EXAMPLE 3
Hybridization Analysis demonstrates that CON167 is expressed in the brain
Hybridization analyses were performed as follows to determine
cells/tissues in which the CON167 gene is expressed. The full-length CON167
coding insert DNA was labeled (3ZP, specific activity = 1.1 x 109 cpm/ug) with
the
Prime-It II labeling kit from Stratagene, following the supplier's protocol.
Human
multiple tissue northern blots (Clontech 7755-1 and 7760-1, polyA+ RNA) were
CA 02376406 2002-O1-14
WO 01/14554 PCT/US00/21566
-34-
hybridized with the CON167 probe and washed according to the supplier's
protocol
(ExpressHyb solution, high stringency (68°C), and the blots were
analyzed on a
phosphorimager (Molecular Dynamics). The resulting image revealed a signal at
about 2.2 kb in the following tissues: heart, brain, placenta, lung, skeletal
muscle,
kidney, and pancreas. Expression appeared to be highest in the heart,
placenta, and
. liver. The human brain blot gave a positive signal for the cerebellum,
cerebral cortex,
medulla, spinal cord, occiptal pole, frontal lobe, temporal lobe, and the
putamen.
Expression appeared to be highest in the cerebellum, cerebral cortex, and
medulla.
Expression of CON167 in the brain provides an indication that modulators of
CON167 activity have utility for treating neurological disorders, including
but not
limited to schizophrenia, depression, anxiety, bipolar disease, epilepsy,
neuritis,
neurasthenia, neuropathy, neuroses, and the like. Use of CON167 modulators,
including CON167 ligands and anti-CON167 antibodies, to treat individuals
having
such disease states is intended as an aspect of the invention.
An additional signal of about 2.7 kb was observed in heart and skeletal
muscle mRNA. Expression in these muscular tissues provides an indication that
modulators of CON167 activity have utility for treating cardiovascular or
skeletal
muscle disease states, including but not limited to congestive heart failure,
restenosis,
muscular dystrophy, myositis, myopathies, myasthenias, and the like. Use of
CON167 modulators, including ligands and anti-CON167 antibodies, to treat
individuals having such disease states is intended as an aspect of the
invention.
EXAMPLE 4
Recombinant Expression of CON167 in Eukaryotic Host Cells
To produce CON167 protein, a CON167-encoding polynucleotide is
expressed in a suitable host cell using a suitable expression vector, using
standard
genetic engineering techniques. For example, the CON167-encoding sequence
described in Example 1 is subcloned into the commercial expression vector
pzeoSV2
(Invitrogen, San Diego, CA) and transfected into Chinese Hamster Ovary (CHO)
cells
using the transfection reagent fuGENE 6 (Boehringer-Mannheim) and the
transfection
protocol provided in the product insert. Alternative eukaryotic cell lines,
such as
CA 02376406 2002-O1-14
WO 01/14554 PCT/US00/21566
-35-
African Green Monkey Kidney cells (COS-7, ATCC C1RL,-1651) or human kidney
cells, ( e.g., HEK-293, ATCC CRL-1573) may be employed. Cells stably
expressing
Con 167 are selected by growth in the presence of 100 ug/ml zeocin
(Stratagene,
LaJolla, CA). Optionally, the CON167 is purified from the cells using standard
chromatographic techniques. To facilitate purification, antisera is raised
against one
or more synthetic peptide sequences that correspond to portions of the CON167
amino acid sequence, and the antisera is used to affinity purify CON167. The
CON167 also may be expressed in frame with a tag sequence (e.g.,
polyhistidine,
hemaggluttinin, FLAG) to facilitate purification. Moreover, it will be
appreciated that
many of the uses for CON 167 polypeptides, such as assays described below, do
not
require purification of CON167 from the host cell.
EXAMPLE 5
Assays to Identify Modulators of CON167 Activity
Set forth below are assays for identifying modulators (agonists and
antagonists) of CON167 activity. Among the modulators that can be identified
by
these assays include natural ligand compounds of the receptor; synthetic
analogs and
derivatives of natural ligands; antibodies, antibody fragments, and/or
antibody-like
compounds derived from natural antibodies or from antibody-like combinatorial
libraries; and/or synthetic compounds identified through high throughput
screening of
libraries; and the like. All modulators that bind CON167 are useful for
identifying
CON167 in tissue samples (e.g., for diagnostic purposes, pathological
purposes, and
the like). Agonist and antagonist modulators are useful for up-regulating and
down-
regulating CON167 activity, respectively, to treat disease states
characterized by
abnormal levels of CON167 activity. CON167 binding molecules also may be used
to
deliver a therapeutic compound or a label to cells that express CON167 (e.g.,
by
attaching the compound or label to the binding molecule). The assays may be
performed using single putative modulators, and/or may be performed using a
known
agonist in combination with candidate antagonists (or visa versa).
CA 02376406 2002-O1-14
WO 01/14554 PCT/US00/21566
-36-
A. cAMP Assavs
In one type of assay, levels of cyclic adenosine monophosphate
(CAMP) are measured in CON167-transfected cells that have been exposed to
candidate modulator compounds. Protocols for cAMP assays have been described
in
the literature. [See, e.g., Sutherland et al., Circulation, 37: 279 (1968);
Frandsen,
E.K. and Krishna, G, Life Sciences, 18: 529-541 (1976); Dooley et al., Journal
of
Pharmacology and Experimental Therapeutics, 283 (2): 735-41 (1997); and George
et
al., Journal of Biomolecular Screening, 2 (4): 235-40 (1997).] An exemplary
protocol for such an assay, using an Adenylyl Cyclase Activation FlashPlate~
Assay
from NENTM Life Science Products, is set forth below.
Briefly, the CON167 coding sequence (e.g., a cDNA or intronless
genomic DNA) is subcloned into a commercial expression vector, such as pzeoSV2
(Invitrogen, San Diego, CA), and transiently transfected into Chinese Hamster
Ovary
(CHO) cells using known methods, such as the transfection reagent FuGENE 6
(Boehringer-Mannheim) and the transfection protocol provided in the product
insert.
The transfected CHO cells are seeded into the 96 well microplates from the
FlashPlate~ assay kit, which are coated with solid scintillant to which
antisera to
cAMP has been bound. For a control, some wells are seeded with wild type
(untransfected) CHO cells. Other wells on the plate receive various amounts of
cAMP standard solution for use in creating a standard curve.
One or more test compounds are added to the cells in each well, with
water andlor compound-free media/diluent serving as a control. After
treatment,
cAMP is allowed to accumulate in the cells for exactly 15 minutes at room
temperature. The assay is terminated by the addition of lysis buffer
containing ['25I]-
labelled cAMP, and the plate is counted using a Packard TopcountTM 96-well
microplate scintillation counter. Unlabelled cAMP from the lysed cells (or
from
standards) competes with the fixed amounts of ['ZSI]-cAMP for antibody bound
to the
plate. A standard curve is constructed, and cAMP values for the unknowns are
obtained by interpolation. Changes in intracellular cAMP level of the cells in
response to exposure to a test compound are indicative of CON167 modulating
activity. Modulators that act as agonists at receptors which couple to the Gs
subtype
CA 02376406 2002-O1-14
WO 01/14554 PCT/US00/21566
-37-
of g-proteins will stimulate production of cAMP, leading to a measurable 3-10
fold
increase. Receptor agonists which couple to the Gi/o subtype of g-proteins
will
inhibit forskolin-stimulated cAMP production, leading to a measurable decrease
of
50-100%. Modulators that act as inverse agonists will reverse these effects at
receptors that are either constitutively active or activated by known
agonists.
B. Aequorin Assays
In another assay cells (e.g., CHO cells) are transiently co-transfected
with both a CON167 expression construct and a construct that encodes the
photoprotein apoaquorin. In the presence of the cofactor coelenterazine,
apoaquorin
will emit a measurable luminescence that is proportional to the amount of
intracellular
(cytoplasmic) free calcium. [See generally Cobbold P.H. and Lee, J.A.C.
"Aequorin
measurements of cytoplasmic free calcium. In: McCormack J.G. and Cobbold P.H.,
eds., Cellular Calcium: A Practical Approach. Oxford:IRL Press (1991); Stables
et
al., Analytical Biochemistry, 252: 115-26 (1997); and Haugland, R.P. Handbook
of
Fluorescent Probes and Research Chemicals. Sixth edition. Eugene OR: Molecular
Probes (1996).]
In one exemplary assay, CON167 is subcloned into the commercial
expression vector pzeoSV2 (Invitrogen, San Diego, CA) and transiently co-
transfected
along with a construct that encodes the photoprotein apoaequorin (Molecular
Probes,
Eugene, OR) into CHO cells using the transfection reagent FuGENE 6
(Boehringer-Mannheim) and the transfection protocol provided in the product
insert.
The cells are cultured for 24 hours at 37°C in alpha MEM
(Gibco/BRL, Gaithersburg, MD) supplemented with 10% fetal bovine serum, 2 mM
glutamine, 10 U/ml penicillin and 10 ~g/ml streptomycin, at which time the
media is
changed to serum-free aMEM containing 5 ~M coelenterazine (Molecular Probes,
Eugene, OR), and the cells are cultured for two additional hours at
37°C. Cells are
then detached from the plate using VERSEN (GibcoBRL), washed and resuspended
at 200,000 cells/ml in serum-free aMEM.
Dilutions of candidate CON167 modulator drugs are prepared in
serum-free aMEM and dispensed into wells of an opaque 96-well assay plate, 50
CA 02376406 2002-O1-14
WO 01/14554 PCT/US00/21566
-38-
pl/well. Plates are loaded onto an MLX microtiter plate luminometer (Dynex
Technologies, Inc., Chantilly, VA). The instrument is programmed to dispense
50 p1
cell suspension into each well, one well at a time, and immediately read
luminescence
for 15 seconds. Dose-response curves for the modulator candidates are
constructed
using the area under the curve for each light signal peak. Data are analyzed
with
SlideWrite, using the equation for 1-site ligand, and ECSO values are
obtained.
Changes in luminescence caused by the drugs are considered indicative of
modulatory
activity. Modulators that act as receptor agonists which couple to the Gq
subtype of
g-proteins give an increase in luminescence of up to 100 fold. Modulators that
act as
inverse agonists will reverse this effect at receptors that are either
constitutively active
or activated by known agonists.
C. Luciferase Reporter Gene Assay
The photoprotein luciferase provides another useful tool for assaying
for modulators of CON167 activity. Cells (e.g., CHO cells or COS 7 cells) are
transiently co-transfected with both a CON167 expression construct (e.g.,
CON167 in
pzeoSV2 (Invitrogen, San Diego, CA)) and a reporter construct which includes a
gene
for the luciferase protein downstream from a transcription factor, either
cAMP-response element (CRE), AP-1, or NF kappa B. Agonist binding to receptors
coupled to the Gs subtype of g-proteins leads to increases in cAMP, activating
the
CRE transcription factor and resulting in expression of the luciferase gene.
Agonist
binding to receptors coupled to the Gq subtype of g-protein leads to
production of
diacylglycerol that activates protein kinase C. As a result, the AP-1 or NF
kappa B
transcription factors are activated which stimulate expression of the
luciferase gene.
Expression levels of luciferase reflect the activation status of the signaling
events.
[See generally George et al., Journal ofBiomolecular Screening, 2(4): 235-40
(1997);
and Stratowa et al., Current Opinion in Biotechnology, 6: 574-81 (1995).]
Luciferase
activity may be quantitatively measured using, e.g., luciferase assay reagents
that are
commercially available from Promega (Madison, WI).
In one exemplary assay, CHO cells are plated to 24-well culture dishes
at a density of 100,000 cells/well one day prior to transfection and cultured
at 37°C.
CA 02376406 2002-O1-14
WO 01/14554 PCT/US00/21566
-39-
in aMEM (Gibco/BRL, Gaithersburg, MD) supplemented with 10% fetal bovine
serum, 2 mM glutamine, 10 U/ml penicillin and 10 ~g/ml streptomycin. Cells are
transiently co-transfected with both a CON167 expression construct and a
reporter
construct containing the luciferase gene. The reporter plasmids CRE-
luciferase,
AP-1-luciferase and NF kappa B-luciferase may be purchased from Stratagene
(LaJolla, CA). Transfections are performed using FuGENE 6 transfection reagent
(Boehringer-Mannheim), and the protocol provided in the product insert. Cells
transfected with the reporter construct alone are used as a control. 24 hours
after
transfection, cells are washed once with phosphate buffered saline (PBS) pre-
warmed
to 37°C. Serum-free aMEM is then added to the cells either alone
(control) or with
one or more candidate modulators and the cells are incubated at 37°C
for five hours.
Thereafter, cells are washed once with ice cold PBS and lysed by the addition
of 100
~1 of lysis buffer/well (from luciferase assay kit, Promega, Madison, Wn.
After
incubation for 15 minutes at room temperature, 15 ~1 of the lysate is mixed
with 50 ~l
substrate solution (Promega) in an opaque white 96-well plate, and the
luminescence
is read immediately on a Wallace model 1450 MicroBeta scintillation and
luminescence counter (Wallace Instruments, Gaithersburg, MD).
Differences in luminescence in the presence versus the absence of a
candidate modulator compound are indicative of modulatory activity. Receptors
that
are either constitutively active or activated by agonists give a 3-20 fold
stimulation of
luminescence compared to cells transfected with the reporter gene alone.
Modulators
that act as inverse agonists will reverse this effect.
D. Intracellular Calcium Measurement using FLIPR
Changes in intracellular calcium levels are another recognized
indicator of G protein coupled receptor activity, and such assays can be
employed to
evaluate modulators of CON167 activity. For example, CHO cells stably
transfected
with a CON167 expression vector are plated at a density of 4 x 104 cells/well
in
Packard black-walled 96-well plates specially designed to isolate fluorescent
signal to
individual wells. The cells are incubated for 60 minutes at 37°C in
modified
Dulbecco's PBS (D-PBS) containing, 36 mg/L of pyruvate and 1 g/L of glucose
with
CA 02376406 2002-O1-14
WO 01/14554 PCT/US00/21566
-40-
the addition of 1 % fetal bovine serum and one of four calcium indicator dyes
(Fluo-
3TM AM, Fluo-4TM AM, Calcium GreenTM-1 AM, or Oregon GreenTM 488 BAPTA-1
AM) at a concentration of 4 pM. Plates are washed once with modified D-PBS
without 1% fetal bovine serum and incubated for 10 minutes at 37°C to
remove
residual dye from the cellular membrane. In addition, a series of washes with
modified D-PBS without 1% fetal bovine serum is performed immediately prior to
activation of the calcium response.
Calcium response is initiated by the addition of one or more candidate
receptor agonist compounds, calcium ionophore A23187 (10 pM), or ATP (4 pM).
Fluorescence is measured by Molecular Device's FLIPR with an argon laser,
excitation at 488 nm. [See, e.g., Kuntzweiler et al., Drug Development
Research,
44(1): 14-20 (1998).] The F-stop for the detector camera was set at 2.5 and
the length
of exposure was 0.4 msec. Basal fluorescence of cells was measured for 20
seconds
prior to addition of agonist, ATP, or A23187, and was subtracted from the
response
signal. The calcium signal is measured for approximately 200 seconds, taking
readings every two seconds. Calcium ionophore and ATP increase the calcium
signal
200% above baseline levels. In general, activated orphan GPCRs increase the
calcium
signal approximately 10-15% above baseline signal.
E. Mitogenesis Assay
In mitogenesis assays, the ability of candidate modulators to induce or
inhibit CON167-mediated cell growth is determined. [See, e.g., Lajiness et
al.,
Journal ofPharmacology and Experimental Therapeutics, 267(3): 1573-81 (1993).]
For example, CHO cells stably expressing CON167 are seeded into 96-well plates
at a
density of 5000 cells/well and grown at 37°C in aMEM supplemented with
10% fetal
calf serum for 48 hrs, at which time the cells are rinsed twice with serum-
free aMEM.
After rinsing, 80 p1 of fresh aMEM, or aMEM containing a known mitogen, is
added
along with 20 p l aMEM containing varying concentrations of one or more test
compounds diluted in serum free media. As controls, some wells on each plate
receive serum-free media alone, and some receive media containing 10% fetal
bovine
CA 02376406 2002-O1-14
WO 01/14554 PCT/US00/21566
-41 -
serum. Untransfected cells or cells transfected with vector alone also may
serve as
controls.
After culture for 16-18 hours, 1 ~.Ci/well of [3H]-thymidine (cpm) is
added to the wells and cells are incubated for an additional 2 hours at 37
°C. The
cells are trypsinized and harvested onto filter mats with a cell harvester
(Tomtec) and
the filters are counted in a Betaplate counter. The incorporation of 3H-
thymidine in
serum-free test wells is compared to the results achieved in cells stimulated
with
serum. Use of multiple concentrations of test compounds permits creation and
analysis of dose-response curves using the non-linear, least squares fit
equation: A =
B x [C/ (D + C)] + G where A is the percent of serum stimulation; B is the
maximal
effect minus baseline; C is the ECSO; D is the concentration of the compound;
and G is
the maximal effect. Parameters B, C and G are determined by Simplex
optimization.
Agonists that bind to the receptor are expected to increase
[3H]-thymidine incorporation into cells, showing up to 80% of the response to
serum.
Antagonists that bind to the receptor will inhibit the stimulation seen with a
known
agonist by up to 100%.
F. ~-35S]GTPyS Binding AssaX
Because G protein coupled receptors signal through intracellular "G
proteins" whose activity involves GTP/GDP binding and hydrolysis, measurement
of
binding of the non-hydrolyzable GTP analog [-35S]GTP~yS in the presence and
absence
of putative modulators provides another indicator of modulator activity. [See,
e.g.,
Kowal, et al., Neuropharmacology, 37: 179-87 (1998).]
In one exemplary assay, cells stably transfected with a CON167
expression vector are grown in 10 cm dishes to subconfluence, rinsed once with
5 ml
of ice cold Caz+/Mgz+ free PBS, and scraped into 5 ml of the same buffer.
Cells are
pelleted by centrifugation (500 x g, 5 minutes), resuspended in 25 mM Tris, 5
mM
EDTA, 5 mM EGTA, pH 7.5 (TEE), and frozen in liquid nitrogen. After thawing,
the
cells are homogenized using a dounce (one ml TEE per plate of cells), and
centrifuged
at 1,000 x g for 5 minutes to remove nuclei and unbroken cells.
CA 02376406 2002-O1-14
WO 01/14554 PCT/US00/21566
-42-
The homogenate supernatant is centrifuged at 20,000 x g for 20
minutes to isolate the membrane fraction, and the membrane pellet is washed
once
with TEE and resuspended in binding buffer (20 mM HEPES, pH 7.5, 1 SO mM NaCI,
mM MgCIZ, 1 mM EDTA). The resuspended membranes can be frozen in liquid
S nitrogen and stored at -70°C until use.
Aliquots of cell membranes prepared as described above and stored at -
70°C are thawed, homogenized, and diluted to a concentration of 10-50
~g/ml in
buffer containing 20 mM HEPES, 10 mM MgCl2, 1 mM EDTA, 120 mM NaCI, 10
pM GDP, and 0.2 mM ascorbate. In a final volume of 90 ~1, homogenates are
10 incubated with varying concentrations of putative modulator compounds or
100 ~M
GTP for 30 minutes at 30°C and then placed on ice. To each sample, 10
~l guanosine
S'-O-(3[35S]thio) triphosphate (NEN, 1200 Ci/mmol), ([35S]-GTPyS), was added
to a
final concentration of 100-200 pM. Samples are incubated at 30°C for an
additional
30 minutes, and then the reaction is then stopped by the addition of 1 ml of
10 mM
HEPES, and 10 mM MgClz, (pH 7.4), at 4°C, and filtration.
Samples are filtered over Whatman GFB filters and filters are washed
with 20 ml ice-cold 10 mM HEPES, (pH 7.4) and 10 mM MgCl2. Filters are counted
by liquid scintillation spectroscopy. Nonspecific binding of [35S]-GTPyS is
measured
in the presence of 100 ~M GTP and subtracted from the total. Compounds are
selected that modulate the amount of [3SS]-GTPyS binding in the cells,
compared to
untransfected control cells. Activation of receptors by agonists gives up to a
five-fold
increase in [35S]GTPyS binding. This response is blocked by antagonists.
G. MAP Kinase Activity Assay
Evaluation of MAP Kinase activity in cells expressing a GPCR provide
another assay to identify modulators of GPCR activity. [See, e.g., Lajiness et
al.,
Journal of Pharmacology and Experimental Therapeutics, 267(3): 1573-81 (1993);
and Boulton et al., Cell, 65: 663-75 (1991).]
In one embodiment, CHO cells stably transfected with CON167 are
seeded into 6 well plates at a density of 70,000 cells/well 48 hours prior to
the assay.
During this time, the cells are cultured at 37°C in aMEM media
supplemented with
CA 02376406 2002-O1-14
WO 01/14554 PCT/US00/21566
- 43 -
10% fetal bovine serum, 2 mM glutamine, 10 U/ml penicillin and 10 pg/ml
streptomycin. The cells are serum starved for 1-2 hours prior to the addition
of
stimulants.
For the assay, the cells are treated with media alone or media
containing a putative agonist or phorbal ester-myistoyl acetate (PMA) as a
positive
control. After treatment, the cells are incubated at 37°C for varying
times. To stop
the reaction, the plates are placed on ice, the media is aspirated, and the
cells are
rinsed with 1 ml of ice-cold PBS containing 1 mM EDTA. Thereafter, 200 ~1 cell
lysis buffer (12.5 mM MOPS, (pH 7.3), 12.5 mM (3-glycerophosphate, 7.5 mM
MgClz, 0.5 mM EGTA, 0.5 mM sodium vanadate, 1 mM benzamidine, 1 mM
dithiothreitol, 10 pg/ml leupeptin, 10 pg/ml aprotinin, 2 ~g/ml pepstatin A,
and 1 pM
okadaic acid) is added to the cells. The cells are scraped from the plates and
homogenized by 10 passages through a 23 3/4 gauge needle. The cytosol fraction
is
prepared by centrifugation at 53,000 rpm for 15 minutes.
Aliquots (5-10 p1 containing 1-5 ~g protein) of cytosols are mixed with
1 mM MAPK Substrate Peptide (APRTPGGRR (SEQ >D NO: 7), Upstate
Biotechnology, Inc., N.Y.) and 50 pM [y 32P]ATP, (NEN, 3000 Ci/mmol) diluted
to a
final specific activity of 2000 cpm/pmol in a total volume of 25 ~.1. The
samples are
incubated for 5 minutes at 30°C, and reactions are stopped by spotting
20 p1 on 2 cmz
of Whatman P81 phosphocellulose paper. The filter squares are washed in 4
changes
of 1 % H3P04, and the squares are counted by liquid scintillation
spectroscopy.
Equivalent cytosolic extracts are incubated without MAPK substrate peptide,
and the
cpm from these samples are subtracted from the matched samples with the
substrate
peptide. The cytosolic extract from each well is used as a separate point.
Protein
concentrations are determined by a dye binding protein assay (Bio-Rad).
Agonist
activation of the receptor is expected to result in up to a five fold increase
in MAPK
enzyme activity. This increase is blocked by antagonists.
H. j3H]Arachidonic Acid Release
The activation of GPCR's also has been observed to potentiate
arachidonic acid release in cells, providing yet another useful assay for
modulators of
CA 02376406 2002-O1-14
WO 01/14554 PCT/US00/21566
-44-
GPCR activity. [See, e.g., Kanterman et al., Molecular Pharmacology, 39: 364-9
(1991).] For example, CHO cells that are stably transfected with a CON167
expression vector are plated in 24-well plates at a density of 15,000
cells/well and
grown in aMEM media supplemented with 10% fetal bovine serum, 2 mM glutamine,
10 U/ml penicillin and 10 pg/ml streptomycin for 48 hours at 37°C
before use. Cells
of each well are labeled by incubation with [3H]arachidonic acid (Amersham
Corp.,
210 Ci/mmol) at 0.5 pCi/ml in 1 ml aMEM supplemented with 10 mM HEPES (pH
7.5), and 0.5% fatty-acid-free bovine serum albumin for 2 hours at
37°C. The cells
are then washed twice with 1 ml of the same buffer.
Candidate modulator compounds are added in 1 ml of the same buffer,
either alone or containing 10 pM ATP (Adenosine 5'-triphosphate) and the cells
are
incubated at 37°C for 30 minutes. Buffer alone and mock transfected
cells are used as
controls. Samples (0.5 ml) from each well are counted by liquid scintillation
spectroscopy. Agonists which activate the receptor will lead to potentiation
of the
ATP-stimulated release of [3H]-arachidonic Acid. This potentiation is blocked
by
antagonists.
I. Extracellular Acidification Rate
In yet another assay, the effects of putative modulators of CON167
activity are assayed by monitoring extracellular changes in pH induced by the
putative
modulators. [See, e.g., Dunlop et al., Journal of Pharmacological and
Toxicological
Methods, 40(1): 47-55 (1998).]
CHO cells transfected with a CON167 expression vector are seeded
into 12-mm capsule cups (Molecular Devices Corp.) at 4 x 105 cells/cup in aMEM
supplemented with 10% fetal bovine serum, 2 mM 1-glutamine, 10 units/ml
penicillin, and 10 pg/ml streptomycin. The cells are incubated in this media
at 37°C
in 5% COZ for 24 hours.
Extracellular acidification rates are measured using a Cytosensor
microphysiometer (Molecular Devices Corp.). The capsule cups are loaded into
the
sensor chambers of the microphysiometer and the chambers are perfused with
running
buffer (bicarbonate free aMEM supplemented with 4 mM 1-glutamine, 10 units/ml
CA 02376406 2002-O1-14
WO 01/14554 PCT/US00/21566
- 45 -
penicillin, 10 ~g/ml streptomycin, 26 mM NaCI) at a flow rate of 100 ~1/min.
Agonists or other agents are diluted into the running buffer and perfused
through a
second fluid path. During each 60 second pump cycle, the pump is run for 38
seconds
and is off for the remaining 22 seconds. The pH of the running buffer in the
sensor
chamber is recorded during the cycle from 43-58 seconds, and the pump is re-
started
at 60 seconds to start the next cycle. The rate of acidification of the
running buffer
during the recording time is calculated by the Cytosoft program. Changes in
the rates
of acidification are calculated by subtracting the baseline value (the average
of 4 rate
measurements immediately before addition of modulator candidates) from the
highest
rate measurement obtained after addition of a modulator candidate. The
selected
instrument detects 61 mV/pH unit. Modulators that act as agonists at the
receptor
result in an increase in the rate of extracellular acidification as compared
to the rate in
the absence of agonist. This response is blocked by modulators which act as
antagonists at the receptor.
EXAMPLE 6
Hybridization Analysis Demonstrates that CON167 is Expressed in the Brain
In situ hybridization experiments were performed to analyze the
expression pattern of CON167 in the brain. Coronal and sagittal oriented rat
brain
sections were cryosectioned (20 pm thick) using a Leica CM3050 cryostat. The
individual sections were thaw-mounted onto silanated, nuclease-free slides
(CEL
Associates, Inc., Houston, TX), and stored at -80°C. The sections were
processed
starting with post-fixation in cold 4% paraformaldehyde (pH 7.4), rinsed in
cold
phosphate-buffered saline (PBS), acetylated using acetic anhydride in
triethanolamine
buffer, and dehydrated through 70%, 95%, and 100% alcohol at room temperature
(RT). Following dehydration, the sections were subjected to delipidation in
chloroform, and then rehydration in 100% and 95% alcohol at RT. Sections were
allowed to air dry prior to hybridization.
Two antisense oligonucleotides were designed based the cDNA
sequence of CON167 (SEQ )D NO: 1) plus the 5' untranslated region (SEQ ~ NO:
10). These oligonucleotides were obtained from Sigma-Genosys (St. Louis, MO)
and
CA 02376406 2002-O1-14
WO 01/14554 PCT/US00/21566
-46-
used as probes for in situ hybridization. The first oligonucleotide,
designated
CON167-1031 has the sequence
5'TGAGGATGGGATAGTGAAGTGGGTGGCTAACGGCCACGTAGTG3'(SEQ
m NO: 11) which corresponds to the complement of nucleotides 367-409 of SEQ ID
NO: 1. The second oligonucleotide, designated CON167-570, has the sequence
5'TGACATGTCTCTATTGTGCTCCAAATTCTTCAGTTCAACAGCGTATGCTC3'
(SEQ ID NO: 12) which corresponds to the complement of nucleotides -102 to 53
of
SEQ B7 NO: 10. Both oligonucleotides, CON167-1031 and CON167-570, were
reconstituted with 1 x TE buffer to a concentration of 20 pMol/pl and labeled
with 33P-
dATP to yield a specific activity of 3.05 x 106 and 2.49 x 106 cpm/pl,
respectively.
For use in the hybridization experiments, both oligoprobes were
denatured at 70°C for 3 minutes and pooled in an aqueous hybridization
buffer which
contained 50% formamide, 10% dextran, 0.3 M NaCI, 10 mM Tris (pH 8.0), 1 mM
EDTA, lx Denhardt's, and 200 mM DTT. The final concentration of both probes in
the hybridization buffer was 2 pmol/ml. Sequential brain cryosections were
hybridized
with 45 pl/slide of the sense and antisense oligoprobe hybridization mixture
and then
covered with silanized, nuclease-free glass coverslips. The sections were
hybridized
overnight (15-18 hours) at 37°C in an incubator.
Following the hybridizations, the coverslips were washed off the slides
with 1 x SSC for 45 minutes. The slides were then washed for 20 minutes at RT
in 1 x
SSC followed by three high stringency washes in lx SSC at 65 °C for 20
minutes.
Subsequently, the slides washed two additional times in lx SSC for 45 minutes
at RT.
After washing, the slides were dehydrated with 70% and 95% ethanol containing
0.3
mM NH40Ac, and then 100% ethanol, air-dried, and exposed to Kodak BioMax MR-1
film. After 15 days of exposure, the film was developed. Based on these
results,
sections that showed a hybridization signal on film autoradiography were
coated with
Kodak NTB-2 nuclear track emulsion and stored in the dark for 30 days. The
slides
were then developed with Kodak D-19 developer and fixer, then counterstained
with
hematoxylin 2 (Richard-Allen Scientific, Kalamazoo, MI). Emulsion-coated
sections
were analyzed microscopically to determine the specificity of labeling. The
signal was
judged to be specific if autoradiographic grains (generated by antisense probe
CA 02376406 2002-O1-14
WO 01/14554 PCT/US00/21566
-47-
hybridization) were associated clearly with crystal violet stained cell
bodies.
Autoradiographic grains found between cell bodies were deemed non-specific.
Specific labeling with the antisense probe showed wide spread
distribution of CON167 mRNA in the rat brain. Labeled regions included the
piriform cortex, hippocampus, and hypothalamus (SON-supra optic nucleus, SCN-
supra chiasmatic nucleus). The sense probe did not generate specific labeling.
The observed regional distribution of CON167 mIRNA provides a
therapeutic indication for natural ligands for CON167 as well as modulators of
CON167 activity, such as anti-CON167 antibody substances or small molecules
that
mimic, agonize or antagonize ligand-mediated CON167 signaling. In particular,
the
expression pattern provides an indication that such molecules will have
utility for
treating neurological and/or psychiatric diseases, including but not limited
to
schizophrenia, affective disorders, attention def cit hyperactivity
disorder/attention
deficit disorder, depression, anxiety, bipolar disease, epilepsy, neuritis,
neurasthenia,
neuropathy, neuroses, Alzheimer's disease, Parkinson's Disease, migraine,
senile
dementia, and the like. Use of CON167 modulators, including CON167 ligands and
anti-CON167 antibodies, to treat individuals having such disease states is
intended as
an aspect of the invention. Such modulators are administered by any means
effective
to safely deliver the modulators to the CON167-expressing cells, including but
not
limited to oral administration, inhalation, or injection of compositions
comprising the
modulators in a pharmaceutically acceptable diluent, adjuvant, or earner.
Efficacy of
treatment can initially be determined in any accepted animal model that
provides a
biochemical or behavioral marker that correlates with disease severity or
treatment
efficacy.
EXAMPLE 6
Antibodies to CON167
Standard techniques are employed to generate polyclonal or monoclonal
antibodies to the CON167 receptor, and to generate useful antigen-binding
fragments
thereof or variants thereof, including "humanized" variants. Such protocols
can be
found, for example, in Sambrook et al., Molecular Cloning. a Laboratory
Manual.
CA 02376406 2002-O1-14
WO 01/14554 PCT/US00/21566
-48-
Second Edition, Cold Spring Harbor, New York: Cold Spring Harbor Laboratory
(1989); Harlow et al. (Eds), Antibodies A Laboratory Manual; Cold Spring
Harbor
Laboratory; Cold Spring Harbor , NY (1988); and other documents cited below.
In
one embodiment, recombinant CON167 polypeptides (or cells or cell membranes
S containing such polypeptides) are used as an antigen to generate the
antibodies. In
another embodiment, one or more peptides having amino acid sequences
corresponding to an immunogenic portion of CON167 (e.g., 6, 7, 8, 9, 10, 11,
12, 13,
14, 15, 16, 17, 18, 19, 20, or more amino acids) are used as antigen. Peptides
corresponding to extracellular portions of CON167, especially hydrophilic
extracellular portions, are preferred. The antigen may be mixed with an
adjuvant or
linked to a hapten to increase antibody production.
A. Polyclonal or Monoclonal antibodies
As one exemplary protocol, recombinant CON167 or a synthetic
fragment thereof is used to immunize a mouse for generation of monoclonal
antibodies
(or larger mammal, such as a rabbit, for polyclonal antibodies). To increase
antigenicity, peptides are conjugated to Keyhole Lympet Hemocyanine (Pierce),
according to the manufacturer's recommendations. For an initial injection, the
antigen
is emulsified with Freund's Complete Adjuvant and injected subcutaneously. At
intervals of two to three weeks, additional aliquots of CON167 antigen are
emulsified
with Freund's Incomplete Adjuvant and injected subcutaneously. Prior to the
final
booster injection, a serum sample is taken from the immunized mice and assayed
by
Western blot to confirm the presence of antibodies that immunoreact with
CON167.
Serum from the immunized animals may be used as a polyclonal antisera or used
to
isolate polyclonal antibodies that recognize CON167. Alternatively, the mice
are
sacrificed and their spleen removed for generation of monoclonal antibodies.
To generate monoclonal antibodies, the spleens are placed in 10 ml
serum-free RPMI 1640, and single cell suspensions are formed by grinding the
spleens
in serum-free RPMI 1640, supplemented with 2 mM L-glutamine, 1 mM sodium
pyruvate, 100 units/ml penicillin, and 100 pg/ml streptomycin (RPMI) (Gibco,
Canada). The cell suspensions are filtered and washed by centrifugation and
CA 02376406 2002-O1-14
WO 01/14554 PCT/US00/21566
-49-
resuspended in serum-free RPMI. Thymocytes taken from three naive Balb/c mice
are
prepared in a similar manner and used as a Feeder Layer. NS-1 myeloma cells,
kept in
log phase in RPMI with 10% fetal bovine serum (FBS) (Hyclone Laboratories,
Inc.,
Logan, Utah) for three days prior to fusion, are centrifuged and washed as
well.
To produce hybridoma fusions, spleen cells from the immunized mice
are combined with NS-1 cells and centrifuged, and the supernatant is
aspirated. The
cell pellet is dislodged by tapping the tube, and 2 ml of 37 °C PEG
1500 (5O% in
75mM Hepes, pH 8.0) (Boehringer Mannheim) is stirred into the pellet, followed
by
the addition of serum-free RPMI. Thereafter, the cells are centrifuged and
resuspended in RPMI containing 15% FBS, 100 ~M sodium hypoxanthine, 0.4 ~M
aminopterin, 16 ~M thymidine (HAT) (Gibco), 25 units/ml of IL-6 (Boehringer
Mannheim) and 1.5 x 106 thymocytes/ml and plated into 10 Corning flat-bottom
96-well tissue culture plates (Corning, Corning New York).
On days 2, 4, and 6, after the fusion, 100 ~ 1 of medium is removed from
the wells of the fusion plates and replaced with fresh medium. On day 8, the
fusions
are screened by ELISA, testing for the presence of mouse IgG that binds to
CON167.
Selected fusion wells are further cloned by dilution until monoclonal cultures
producing anti-CON167 antibodies are obtained.
B. Humanization of Anti-CON167 Monoclonal Antibodies
The expression patterns of CON167 as reported herein and the proven
track record of GPCR's as targets for therapeutic intervention suggest
therapeutic
indications for CON167 inhibitors (antagonists). CON167-neutralizing
antibodies
comprise one class of therapeutics useful as antagonists. Following are
protocols to
improve the utility of anti-CON167 monoclonal antibodies as therapeutics in
humans,
by "humanizing" the monoclonal antibodies to improve their serum half life and
render them less immunogenic in human hosts (i.e., to prevent human antibody
response to non-human anti-CON167 antibodies).
The principles of humanization have been described in the literature
and are facilitated by the modular arrangement of antibody proteins. To
minimize the
CA 02376406 2002-O1-14
WO 01/14554 PCT/US00/21566
-50-
possibility of binding complement, a humanized antibody of the IgG4 isotype is
preferred.
For example, a level of humanization is achieved by generating
chimeric antibodies comprising the variable domains of non-human antibody
proteins
of interest with the constant domains of human antibody molecules. (See, e.g.,
Morrison and Oi, Adv. Immunol., 44:65-92 (1989). The variable domains of
CON167
neutralizing anti-CON167 antibodies are cloned from the genomic DNA of a B-
cell
hybridoma or from cDNA generated from mRNA isolated from the hybridoma of
interest. The V region gene fragments are linked to exons encoding human
antibody
constant domains, and the resultant construct is expressed in suitable
mammalian host
cells (e.g., myeloma or CHO cells).
To achieve an even greater level of humanization, only those portions
of the variable region gene fragments that encode antigen-binding
complementarity
determining regions ("CDR") of the non-human monoclonal antibody genes are
cloned
into human antibody sequences. [See, e.g., Jones et al., Nature, 321:522-525
(1986);
Riechmann et al., Nature, 332:323-327 (1988); Verhoeyen et al., Science,
239:1534-36 (1988); and Tempest et al., BiolTechnology, 9:266-71 (1991). If
necessary, the ~3-sheet framework of the human antibody surrounding the CDR3
regions also is modified to more closely mirror the three dimensional
structure of the
antigen-binding domain of the original monoclonal antibody. (See Kettleborough
et al., Protein Engin., 4:773-783 (1991); and Foote et al., J. Mol. Biol.,
224:487-499
(1992).
In an alternative approach, the surface of a non-human monoclonal
antibody of interest is humanized by altering selected surface residues of the
non-human antibody, e.g., by site-directed mutagenesis, while retaining all of
the
interior and contacting residues of the non-human antibody. See Padlan,
Molecular
Immunol., 28(4/5):489-98 (1991).
The foregoing approaches are employed using CON167-neutralizing
anti-CON167 monoclonal antibodies and the hybridomas that produce them to
generate humanized CON167-neutralizing antibodies useful as therapeutics to
treat or
CA 02376406 2002-O1-14
WO 01/14554 PCT/US00/21566
-51 -
palliate conditions wherein CON167 expression or ligand-mediated CON167
signaling
is detrimental.
C. Human CON167-Neutralizing Antibodies from Phage Display
Human CON167-neutralizing antibodies are generated by phage display
techniques such as those described in Aujame et al., Human Antibodies,
8(4):155-168
(1997); Hoogenboom, TIBTECH, 15:62-70 (1997); and Rader et al., Curr. Opin.
Biotechnol., 8:503-508 ( 1997), all of which are incorporated by reference.
For
example, antibody variable regions in the form of Fab fragments or linked
single chain
Fv fragments are fused to the amino terminus of filamentous phage minor coat
protein
p>ZI. Expression of the fusion protein and incorporation thereof into the
mature phage
coat results in phage particles that present an antibody on their surface and
contain the
genetic material encoding the antibody. A phage library comprising such
constructs is
expressed in bacteria, and the library is panned (screened) for CON167-
specific
phage-antibodies using labelled or immobilized CON167 as antigen-probe.
D. Human CON167-Neutralizin,~; Antibodies from Transgenic Mice
Human CON167-neutralizing antibodies are generated in transgenic
mice essentially as described in Bruggemann and Neuberger, Immunol. Today,
17(8):391-97 (1996) and Bruggemann and Taussig, Curr. Opin. Biotechnol., 8:455-
58
( 1997). Transgenic mice carrying human V-gene segments in germline
configuration
and that express these transgenes in their lymphoid tissue are immunized with
a
CON167 composition using conventional immunization protocols. Hybridomas are
generated using B cells from the immunized mice using conventional protocols
and
screened to identify hybridomas secreting anti-CON167 human antibodies (e.g.,
as
described above).
While the present invention has been described in terms of specific
embodiments, it is understood that variations and modifications will occur to
those in
the art, all of which are intended as aspects of the present invention.
Accordingly, only
such limitations as appear in the claims should be placed on the invention.
CA 02376406 2002-O1-14
WO 01/14554 PCT/US00/21566
-1-
SEQUENCE LISTING
<110> Pharmacia & Upjohn
<120> G PROTEIN COUPLED RECEPTOR EXPRESSED IN BRAIN
<130> 28341/6202P
<140>
<141>
<150> US 09/377,563
<151> 2000-08-19
<160> 12
<170> PatentIn Ver. 2.0
<210>
1
<211>
948
<212>
DNA
<213> sapiens
Homo
<220>
<221>
CDS
<222> (945)
(1)
. .
<400>
1
atg agatgggtg aaccagtcc tacacagat ggcttc ttcctcttg 48
gga
Met ArgTrpVal AsnGlnSer TyrThrAsp GlyPhe PheLeuLeu
Gly
1 5 10 15
ggc ttttcccac agccagact gaccttgtc ctcttc tctgcagtt 96
atc
Gly PheSerHis SerGlnThr AspLeuVal LeuPhe SerAlaVal
Ile
20 25 30
atg gtcttcaca gtggccctc tgtgggaat gtcctc ctcatcttc 144
gtg
Met ValPheThr ValAlaLeu CysGlyAsn ValLeu LeuIlePhe
Val
35 40 45
ctc tacctggac getggactt cacaccccc atgtac ttcttcctc 192
atc
Leu TyrLeuAsp AlaGlyLeu HisThrPro MetTyr PhePheLeu
Ile
50 55 60
agc ctctccctc atggacctc atgttggtc tgtaac attgtgcca 240
cag
Ser LeuSerLeu MetAspLeu MetLeuVal CysAsn IleValPro
Gln
65 70 75 80
aag gcagccaac ttcctgtct ggcaggaag tccatc tcctttgtg 288
atg
Lys AlaAlaAsn PheLeuSer GlyArgLys SerIle SerPheVal
Met
85 90 95
ggc ggcatacaa attggcttt tttgtctct cttgtg ggatctgag 336
tgt
Gly GlyIleGln IleGlyPhe PheValSer LeuVal GlySerGlu
Cys
100 105 110
ggg ttgctggga ctcatgget tatgaccac tacgtg gccgttagc 384
ctc
Gly LeuLeuGly LeuMetAla TyrAspHis TyrVal AlaValSer
Leu
115 120 125
CA 02376406 2002-O1-14
WO 01/14554 PCT/US00/21566
-2-
cac cca ctt cac tat ccc atc ctc atg aat cag agg gtc tgt ctc cag 432
His Pro Leu His Tyr Pro Ile Leu Met Asn Gln Arg Val Cys Leu Gln
130 135 140
att act ggg agc tcc tgg gcc ttt ggg ata ata gat gga gtg att cag 480
Ile Thr Gly Ser Ser Trp Ala Phe Gly Ile Ile Asp Gly Val Ile Gln
145 150 155 160
atggtg gcagccatg ggcttacct tactgtggc tcaaggagc gtggat 528
MetVal AlaAlaMet GlyLeuPro TyrCysGly SerArgSer ValAsp
165 170 175
cacttt ttctgtgag gtacaaget ttattgaag ctggcctgt gcagac 576
HisPhe PheCysGlu ValGlnAla LeuLeuLys LeuAlaCys AlaAsp
180 185 190
acttcc ctttttgac accctcctc tttgettgc tgtgtcttc atgctt 624
ThrSer LeuPheAsp ThrLeuLeu PheAlaCys CysValPhe MetLeu
195 200 205
ctcctt cccttctcc atcatcatg gcctcctat gettgcatc ctaggg 672
LeuLeu ProPheSer IleIleMet AlaSerTyr AlaCysIle LeuGly
210 215 220
getgtg ctccgaata cgctctget caggcctgg aaaaaagcc ctggcc 720
AlaVal LeuArgIle ArgSerAla GlnAlaTrp LysLysAla LeuAla
225 230 235 240
acctgc tcctcccac ctaacaget gtcaccctc ttctatggg gcagcc 768
ThrCys SerSerHis LeuThrAla ValThrLeu PheTyrGly AlaAla
245 250 255
atgttc atgtacctg aggcctagg cgctaccgg gcccctagc catgac 816
MetPhe MetTyrLeu ArgProArg ArgTyrArg AlaProSer HisAsp
260 265 270
aaggtg gcctctatc ttctacaca gtccttact cccatgctg aacccc 864
LysVal AlaSerIle PheTyrThr ValLeuThr ProMetLeu AsnPro
275 280 285
ctcatt tacagcttg aggaatggg gaggtgatg ggggcactg aggaag 912
LeuIle TyrSerLeu ArgAsnGly GluValMet GlyAlaLeu ArgLys
290 295 300
gggctg gaccgctgc aggattggc agccagcac tga 948
GlyLeu AspArgCys ArgIleGly SerGlnHis
305 310 315
<210> 2
<211> 315
<212> PRT
<213> Homo sapiens
<400> 2
Met Gly Arg Trp Val Asn Gln Ser Tyr Thr Asp Gly Phe Phe Leu Leu
1 5 10 15
Gly Ile Phe Ser His Ser Gln Thr Asp Leu Val Leu Phe Ser Ala Val
20 25 30
CA 02376406 2002-O1-14
WO 01/14554 PCT/US00/21566
-3-
Met Val Val Phe Thr Val Ala Leu Cys Gly Asn Val Leu Leu Ile Phe
35 40 45
Leu Ile Tyr Leu Asp Ala Gly Leu His Thr Pro Met Tyr Phe Phe Leu
50 55 60
Ser Gln Leu Ser Leu Met Asp Leu Met Leu Val Cys Asn Ile Val Pro
65 70 75 80
Lys Met Ala Ala Asn Phe Leu Ser Gly Arg Lys Ser Ile Ser Phe Val
85 90 95
Gly Cys Gly Ile Gln Ile Gly Phe Phe Val Ser Leu Val Gly Ser Glu
100 105 110
Gly Leu Leu Leu Gly Leu Met Ala Tyr Asp His Tyr Val Ala Val Ser
115 120 125
His Pro Leu His Tyr Pro Ile Leu Met Asn Gln Arg Val Cys Leu Gln
130 135 140
Ile Thr Gly Ser Ser Trp Ala Phe Gly Ile Ile Asp Gly Val Ile Gln
145 150 155 160
Met Val Ala Ala Met Gly Leu Pro Tyr Cys Gly Ser Arg Ser Val Asp
165 170 175
His Phe Phe Cys Glu Val Gln Ala Leu Leu Lys Leu Ala Cys Ala Asp
180 185 190
Thr Ser Leu Phe Asp Thr Leu Leu Phe Ala Cys Cys Val Phe Met Leu
195 200 205
Leu Leu Pro Phe Ser Ile Ile Met Ala Ser Tyr Ala Cys Ile Leu Gly
210 215 220
Ala Val Leu Arg Ile Arg Ser Ala Gln Ala Trp Lys Lys Ala Leu Ala
225 230 235 240
Thr Cys Ser Ser His Leu Thr Ala Val Thr Leu Phe Tyr Gly Ala Ala
245 250 255
Met Phe Met Tyr Leu Arg Pro Arg Arg Tyr Arg Ala Pro Ser His Asp
260 265 270
Lys Val Ala Ser Ile Phe Tyr Thr Val Leu Thr Pro Met Leu Asn Pro
275 280 285
Leu Ile Tyr Ser Leu Arg Asn Gly Glu Val Met Gly Ala Leu Arg Lys
290 295 300
Gly Leu Asp Arg Cys Arg Ile Gly Ser Gln His
305 310 315
<210> 3
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: PRIMER
CA 02376406 2002-O1-14
WO 01/14554 PCT/US00/21566
-4-
SEQUENCE
<400> 3
gcctctatct tctacacagt cc 22
<210> 4
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: PRIMER
SEQUENCE
<400> 4
ccaaaaccta taaaccatcc 20
<210> 5
<211> 59
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: PRIMER
SEQUENCE
<400> 5
gcactagtaa tacgactcac tatagggaga ccaccatggg aagatgggtg aaccagtcc 59
<210> 6
<211> 60
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: PRIMER
SEQUENCE
<400> 6
gactggatcc cccgggcttt tttttttttt ttgcggccgc tcagtgctgg ctgccaatcc 60
<210> 7
<211> 9
<212> PRT
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: MAP KINASE
SUBSTRATE PEPTIDE
<400> 7
Ala Pro Arg Thr Pro Gly Gly Arg Arg
1 5
<210> 8
<211> 316
<212> PRT
CA 02376406 2002-O1-14
WO 01/14554 PCT/US00/21566
-5-
<213> Homo sapiens
<400> 8
Met Asp Asn Gln Ser Ser Thr Pro Gly Phe Leu Leu Leu Gly Phe Ser
1 5 10 15
Glu His Pro Gly Leu Gly Arg Thr Leu Phe Val Asp Val Ile Thr Ser
20 25 30
Tyr Leu Leu Thr Leu Val Gly Asn Thr Leu Ile Ile Leu Leu Ser Ala
35 40 45
Leu Asp Thr Lys Leu His Ser Pro Met Tyr Phe Phe Leu Ser Asn Leu
50 55 60
Ser Phe Leu Asp Leu Cys Phe Thr Thr Ser Cys Val Pro Gln Met Leu
65 70 75 80
Ala Asn Leu Trp Gly Pro Lys Lys Thr Ile Ser Phe Leu Asp Cys Ser
85 90 95
Val Gln Ile Phe Ile Phe Leu Ser Leu Gly Thr Thr Glu Cys Ile Leu
100 105 110
Met Lys Val Met Ala Phe Asp Arg Tyr Val Ala Val Cys Gln Pro Leu
115 120 125
His Tyr Ala Thr Ile Ile His Pro Arg Leu Cys Trp Gln Leu Ala Ser
130 135 140
Val Ala Trp Val Ile Gly Leu Val Gly Ser Val Val Gln Thr Pro Ser
145 150 155 160
Thr Leu His Leu Pro Phe Cys Pro Asp Arg Gln Val Asp Asp Phe Val
165 170 175
Cys Glu Val Pro Ala Leu Ile Arg Leu Ser Cys Glu Asp Thr Ser Tyr
180 185 190
Asn Glu Ile Gln Val Ala Val Ala Ser Val Phe Ile Leu Val Val Pro
195 200 205
Leu Ser Leu Ile Leu Val Ser Tyr Gly Ala Ile Thr Trp Ala Val Leu
210 215 220
Arg Ile Asn Ser Ala Thr Ala Trp Arg Lys Ala Phe Gly Thr Cys Ser
225 230 235 240
Ser His Leu Thr Val Val Thr Leu Phe Tyr Ser Ser Val Ile Ala Val
245 250 255
Tyr Leu Gln Pro Lys Asn Pro Tyr Ala Gln Gly Arg Gly Lys Phe Phe
260 265 270
Gly Leu Phe Tyr Ala Val Gly Thr Pro Ser Leu Asn Pro Leu Val Tyr
275 280 285
Thr Leu Arg Asn Lys Glu Ile Lys Arg Ala Leu Arg Arg Leu Leu Gly
290 295 300
CA 02376406 2002-O1-14
WO 01/14554 PCT/US00/21566
-6-
Lys Glu Arg Asp Ser Arg Glu Ser Trp Arg Ala Ala
305 310 315
<210> 9
<211> 223
<212> PRT
<213> Mus musculus
<400> 9
Ser Gln Leu Ser Leu Met Asp Leu Met Leu Val Cys Asn Ile Val Pro
1 5 10 15
Lys Met Ala Val Asn Phe Leu Ser Gly Arg Lys Ser Ile Ser Phe Ala
20 25 30
Gly Cys Gly Ile Gln Ile Gly Phe Phe Val Ser Leu Val Gly Ser Glu
35 40 45
Gly Leu Leu Leu Gly Leu Met Ala Tyr Asp Arg Tyr Val Ala Ile Ser
50 55 60
His Pro Leu His Tyr Pro Ile Leu Met Ser Gln Lys Val Cys Leu Gln
65 70 75 80
Ile Ala Gly Ser Ser Trp Ala Phe Gly Ile Leu Asp Gly Ile Ile Gln
85 90 95
Met Val Ala Ala Met Ser Leu Pro Tyr Cys Gly Ser Arg Tyr Ile Asp
100 105 110
His Phe Phe Cys Glu Val Pro Ala Leu Leu Lys Leu Ala Cys Ala Asp
115 120 125
Thr Ser Leu Phe Asp Thr Leu Leu Phe Ala Cys Cys Val Phe Met Leu
130 135 140
Leu Leu Pro Phe Ser Ile Ile Val Thr Ser Tyr Ala Arg Ile Leu Gly
145 150 155 160
Ala Val Leu Arg Met His Ser Ala Gln Ser Arg Lys Lys Ala Leu Ala
165 170 175
Thr Cys Ser Ser His Leu Thr Ala Val Ser Leu Phe Tyr Gly Ala Ala
180 185 190
Met Phe Ile Tyr Leu Arg Pro Arg Arg Tyr Arg Ala Pro Ser His Asp
195 200 205
Lys Val Val Ser Ile Phe Tyr Thr Val Leu Thr Pro Met Leu Asn
210 215 220
<210> 10
<211> 1070
<212> DNA
<213> Homo Sapiens
<400> 10
gtgtcctcct gcatgtctca gagcatacgc tgttgaactg aagaatttgg agcacaatag 60
agacatgtca ctcaatctta taatttctct tatgttctca ggtgacagtg aacaactaag 120
ccatgggaag atgggtgaac cagtcctaca cagatggctt cttcctcttg ggcatctttt 180
CA 02376406 2002-O1-14
WO 01/14554 PCT/US00/21566
cccacagcca gactgacctt gtcctcttct ctgcagttat ggtggtcttc acagtggccc 240
tctgtgggaa tgtcctcctc atcttcctca tctacctgga cgctggactt cacaccccca 300
tgtacttctt cctcagccag ctctccctca tggacctcat gttggtctgt aacattgtgc 360
caaagatggc agccaacttc ctgtctggca ggaagtccat ctcctttgtg ggctgtggca 420
tacaaattgg cttttttgtc tctcttgtgg gatctgaggg gctcttgctg ggactcatgg 480
cttatgacca ctacgtggcc gttagccacc cacttcacta tcccatcctc atgaatcaga 540
gggtctgtct ccagattact gggagctcct gggcctttgg gataatagat ggagtgattc 600
agatggtggc agccatgggc ttaccttact gtggctcaag gagcgtggat cactttttct 660
gtgaggtaca agctttattg aagctggcct gtgcagacac ttcccttttt gacaccctcc 720
tctttgcttg ctgtgtcttc atgcttctcc ttcccttctc catcatcatg gcctcctatg 780
cttgcatcct aggggctgtg ctccgaatac gctctgctca ggcctggaaa aaagccctgg 840
ccacctgctc ctcccaccta acagctgtca ccctcttcta tggggcagcc atgttcatgt 900
acctgaggcc taggcgctac cgggccccta gccatgacaa ggtggcctct atcttctaca 960
cagtccttac tcccatgctg aaccccctca tttacagctt gaggaatggg gaggtgatgg 1020
gggcactgag gaaggggctg gaccgctgca ggattggcag ccagcactga 1070
<210> 11
<211> 43
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:
Oligonucleotide Primer
<400> 11
tgaggatggg atagtgaagt gggtggctaa cggccacgta gtg 43
<210> 12
<211> 50
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:
Oligonucleotide Primer
<400> 12
tgacatgtct ctattgtgct ccaaattctt cagttcaaca gcgtatgctc 50
