Note: Descriptions are shown in the official language in which they were submitted.
CA 02377427 2001-12-21
WO 01/00796 PCT/CA00/00777
GLYCOSYLTRANSFERASES OF HELICO8ACTER PYLORI AS A NEW
TARGET IN PREVENTION AND TREATMENT OF H. PYLORI INFECTIONS
s FIELD OF THE INVENTION
The invention relates to newly identified and isolated polynucleotides and
polypeptides of bacterial origin, in particular to novel polynucleotides and
polypeptides related to glycosyltransferases involved in biosynthesis of
io lipopolysaccharides of Helicobacter pylori.
BACKGROUND OF THE INVENTION
is Helicobacter pylori is a spiral, microaerophilic, Gram-negative bacterium
infecting
about 50% of the global human population, and is now recognised as the most
common bacterial pathogen of humans worldwide. It is the causative agent of
chronic active gastritis in all who harbour it, is responsible for the
development of
most gastro-duodenal ulcers, and is formally recognised as the carcinogen for
2o certain gastric cancers (Blaser, Gastroenterology 102: 720-727 (1992);
Parsonnet et al, N. Engl. J. Med. 325: 1127-1131 (1991 )). H. pylori is a
highly
motile organism and migrates through the superficial mucus layer of the
gastric
lumen to colonize the underlying gastric pits and associated epithelium. The
precise mechanisms by which H. pylori injures the gastric mucosa to elicit the
2s aforementioned pathogenic states remains unknown, but it is clear that
urease
production (Eaton et al, Infect. lmmun. 59: 2470-2475 (1991 )) and motility
are
required for gastric colonisation of experimental animals. However, the
development of gastro-duodenal disease clearly requires additional bacterial
virulence factors (Phadnis et al, Infect. Immun. 62:1557-1565 (1994); Tummuru
3o et al, Mol. Microbiol. 18: 867-876 (1995)). Although several bacterial
adhesins
and putative receptors on host epithelium have been described (Evans et al, J.
Bacteriol. 175: 674-683 (1993); Boren et al, Science 262: 1892-1895 (1993);
CA 02377427 2001-12-21
WO 01/00796 PCT/CA00/00777
Odenbreit et al, Gut 37 (Suppl. 1 ): A1 (1995)), their role in gastric
colonization by
H. pylori has not been clearly established.
Gram-negative bacteria, such as H. pylori, have their bacterial cell wall
covered
s with an outer membraneous layer consisting of lipids, proteins and
lipopolysaccharides (LPS). LPS contain lipid A, a disaccharide of two
phosphorylated glucosamine (GIcN) residues with attached fatty acids, and a
polysaccharide attached to one of the glucosamine residues through a
glycosidic
bond. The polysaccharide is composed of a core of approximately 10 sugar
to residues followed by a repeating series of units of 3 to 5 sugars called
the O side
chain (O-chain). The number of repeating units in the O-chain varies from
about
to 40. The sugars found in the O-chain vary among bacterial species, whereas
the composition of the core polysaccharide is relatively constant.
Lipopolysaccharides are released from bacteria undergoing lysis and are toxic
to
is animals and humans. They are often referred to as endotoxins.
While much attention has focused on the role of bacterial and host proteins in
H.
pylori infection and immunity, the role of LPS in these processes has received
less consideration (Moran, Aliment. Pharmacol. Ther. 10 (supply: 39-50 (1996);
2o Yokota et al, Infect. Immun. 66: 3006-3011 (1998); Wang et al, Mol.
Microbiol. 31:
1265-1274 (1999)). As a major cell surface component, this molecule is well
situated to selectively interact with surface components of the host. In
particular,
LPS could facilitate initial gastric colonisation, be responsible for
biological
interactions which modify the inflammatory response, and promote a chronic
2s infection.
Comprehensive, detailed structural analysis of H. pylori LPS has revealed some
unique features of the molecule which may account for certain aspects of H.
pylori-induced pathogenesis (Aspinall et al, Biochemistry 35: 2489-2497; 2498-
30 2504 (1996); Aspinall et al, Eur. J. Biochem. 248: 592-601 (1997); Monteiro
et al,
J. Biol. Chem. 273: 11533-11543 (1998)). In addition, H. pylori LPS, unlike
typical LPS, has low endotoxic properties. Fresh clinical isolates usually
display
typical smooth type LPS (S-type). The O-chain polysaccharide structure of H.
2
CA 02377427 2001-12-21
WO 01/00796 PCT/CA00/00777
pylori type strain (NCTC11637) LPS is composed of a type 2 N-acetyllactosamine
(LacNAc) chain of various lengths and this O-chain may be partially a-L-
fucosylated or less commonly a-D-glucosylated or a-D-galactosylated and may
be terminated at the nonreducing end by Lewis blood group epitopes which
s mimic human cell surface glycoconjugates and glycolipids. However, it
remains to
be formally established if the O-chain of H. pylori LPS contributes to
pathogenesis or generates protective immunity. For instance, the Lewis
antigens
present on the O-chain polysaccharide might reduce the immunogenicity of this
molecule during infection, or might trigger autoimmunity. The ability to
produce
io structurally defined truncated LPS molecules should help elucidate the
biological
role of LPS in H. pylori infection and immunity and possibly open a new
approach
to the treatment and prevention of H. pylori infections.
Known methods of prevention and treatment of H. pylori infections are either
is immunogenic or drug-based. The immunogenic approach is mostly intended to
provide an immunogenic protection against the bacterium by vaccinating the
individual with a usually bacterium-derived immunogen, to elicit an immune
response of the organism to future H. pylori infections. Among many others,
immunogens (antigens) derived from the LPS of H. pylori are known in this
group
20 of treatments (see, for example, WO 97/14782 and WO 87/07148).
According to the second approach, H. pylori infections are treated with
antibacterial drugs or combinations of such drugs, intended to eradicate the
bacterial population in the infected individual. In this group of treatments,
the
2s currently most common are so called triple therapies, in which patients are
administered simultaneously two different antibiotics and an acid secretion
inhibiting drug. The efficacy of these therapies varies and is often adversely
affected by the developing resistance to broad spectrum antibiotics used for
this
purpose and by side effects of antibiotic therapies, which frequently result
in
3o termination of the therapy before completely healing the infection.
In view of the above-indicated deficiencies of the current antibiotic
therapies,
attempts are made to develop more specific drugs against H. pylori, such as
3
CA 02377427 2001-12-21
WO 01/00796 PCT/CA00/00777
drugs modulating the activity of enzymes specific to the bacteria (see, for
example, US 5,801,013 and US 5,942,409). An ideal anti-helicobacterial drug
should be selective, meaning that the drug should inhibit H. pylori but not
the
bacterial population of the microflora of the lower intestine. This means that
the
s molecular target of the drug should be unique to H. pylori and/or should be
related to its unique phenotypic characteristics, particularly those
facilitating the
colonization of bacterium's natural ecological niche (the human stomach).
While
improving the understanding of H. pylori pathogenesis, the present invention
provides means for developing new anti-helicobacterial drugs possessing such
io desirable characteristics.
SUMMARY OF THE INVENTION
In one aspect, the present invention provides isolated and/or recombinant
nucleic
is acids which encode certain glycosyltransferases of Helicobacter origin. The
invention also provides recombinant DNA constructs and vectors containing
polynucleotide sequences encoding such glycosyltransferases or portions
thereof. These nucleic acids and constructs may be used to produce recombinant
glycosyltransferases of Helicobacter origin by expressing the polynucleotide
2o sequences in suitable host cells.
In another aspect, the invention provides isolated polypeptides having the
enzymatic activity of glycosyltransferases of Helicobacter origin. Such
polypeptides are useful, among other things, for the identification of
modulators,
2s in particular inhibitors of their enzymatic activity, which inhibitors are
potential
antimicrobial agents. Using the isolated polypeptides of the present
invention,
potential inhibitors of these enzymes can be screened for antimicrobial or
antibiotic effects, without culturing pathogenic strains of Helicobacter
bacteria,
such as H. pylori.
According to one embodiment of the invention, preferred glycosyltransferases
of
Helicobacter origin are glycosyltransferases of H. pylori involved in the
biosynthesis of the bacterial lipopolysaccharide (LPS), in particular of LPS
core or
LPS O-chain. Disrupting genes of such glycosyltransferases in several strains
of
4
CA 02377427 2001-12-21
WO 01/00796 PCT/CA00/00777
H. pylori resulted in mutants unable to complete the structural assembly of
LPS
and having as a result a reduced ability to colonize the murine stomach.
According to yet another aspect, the present invention provides novel antigens
s and vaccines used in immunization against Helicobacter bacteria, in
particular H.
pylori. The novel antigens are derived from bacteria having deactivated gene
of a
glycosyltransferase involved in the biosynthesis of the bacterial
lipopolysaccharide, in particular of LPS core or LPS O-chain. Purified or
partially
purified LPS isolated from such mutants is a preferred antigen.
to
Other advantages, objects and features of the present invention will be
readily
apparent to those skilled in the art from the following detailed description
of
preferred embodiments in conjunction with the accompanying drawings and
claims.
BRIEF DESCRIPTION OF THE DRAWINGS
Fig. 1 shows amino acid sequence alignment of glycosyltransferases from H.
2o pylori, H. influenzae, H. somnus and N. meningitides. Multiple sequence
alignment was performed using the Clustal Alignment Programme (Higgins et al,
Gene 73: 237-244 (1988)). Designations on the left side refer to the origin of
the
sequences; HP0826 of genebank AE000594 (Tomb et al, Nature 388:539-547
(1997)), Haemophilus influenzae Iex2B, 005670 (Cope et al, Mol. Microbiol. 5:
1113-1124 (1994)), Haemophilus somnus lob1, 094833 (Inzana et al, Infect.
Immun. 65: 4675-4681 (1997)) and Neisseria meningitides IgtB, AAC44085
(Jennings et al, Mol. Microbiol. 18: 729-740 (1995). Numbers on the right side
indicate amino acid positions. Gaps introduced to maximise the alignment are
indicated by dashes. Shadings were obtained using the Genedoc Programme
(www.cris.com/~ketchuplgenedoc.shtml). Black indicates 100% identity, dark
grey indicates 80% identity, and light grey indicates 60% identity.
Fig. 2 shows a complete FAB-MS spectrum of the methylated intact LPS of
26695::HP0826kan strain.
5
CA 02377427 2001-12-21
WO 01/00796 PCT/CA00/00777
Fig. 3 is a schematic showing the chemical structure of LPS from parent
strains
26695 and SS1 and isogenic mutants of HP0826, HP0159 and HP0479.
Fig. 4 shows results of CZE-MS/MS analysis (+ion mode) of delipidated LPS from
s H. pylori 26695::0159 mutant. Tandem mass spectrum of precursor ions at m/z
902 (doubly protonated ions). Separation conditions: 10 mM ammonium acetate
containing 5% methanol, pH 9.0, +25 kV. For MS/MS experiments, nitrogen as a
collision gas, E~ab: 70 eV (laboratory frame of reference).
to Fig. 5 shows results of CZE-MS/MS (+ion mode) analysis of delipidated LPS
from
H. pylori 0479 mutants. Tandem mass spectrum of precursor ions at m/z 1612.
Separation conditions: 10 mM ammonium acetate containing 5% methanol, pH
9.0, +25 kV. For MS/MS experiments, nitrogen as a collision gas, E~ab: 60 eV
(laboratory frame of reference).
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
As used herein, the terms "identity" and "similarity" mean the degree of
sequence
2o relatedness between two or more polynucleotide or polypeptide sequences as
determined by the match between strings of such sequences. "Identity" or
"similarity" can be readily quantified by algorithms well known to those
skilled in
the art, implemented in a number of publicly available computer software
packages, for example BLAST software package available from NCB/ and other
2s sources. The identity or similarity is usually expressed as a percentage of
identity
with respect to some reference sequence. For example, in a polynucleotide
having a sequence 95% identical to a reference nucleotide sequence, 5% of the
nucleotides of the reference sequence have been deleted or substituted with
another nucleotide, or 5% of another nucleotides have been inserted into the
3o reference sequence. These substitutions, insertions, and/or deletions may
take
place anywhere between 5' and 3' terminal positions, either interspersed
individually among nucleotides of the reference sequence or in one or more
contiguous groups within the reference sequence.
6
CA 02377427 2001-12-21
WO 01/00796 PCT/CA00/00777
The term "isolated" as used herein means altered by the hand of man with
respect to its natural state. For a substance occurring in nature, it means
that this
substance has been changed or removed from its natural environment, or both.
s For example, a polynucleotide or a polypeptide naturally present in a living
organism is not isolated, but the same polynucleotide or polypeptide separated
from its natural matrix and coexisting materials is isolated, as the term is
employed herein.
io The term "polynucleotide" or "nucleic acid" refers to any
polyribonucleotide or
polydeoxyribonucleotide, which may be unmodified or modified RNA or DNA,
whether single- or double-stranded. The term "polypeptide" or "protein" refers
to
any peptide or protein comprising at least two amino acid residues joined to
each
other by peptide bonds or modified peptide bonds.
is
The term "variant" as used herein means a polynucleotide or polypeptide that
differs from a reference polynucleotide or polypeptide but retains its
essential
properties. A typical variant of a polynucleotide differs in nucleotide
sequence
from another, reference polynucleotide. Changes in the nucleotide sequence of
2o the variant may or may not alter the amino acid sequence of a polypeptide
encoded by the reference polynucleotide. A typical variant of a polypeptide
differs
in amino acid sequence from another, reference polypeptide. These difference
are usually limited and variants of a polypeptide are closely similar overall
and
identical in many regions. A variant of a polynucleotide or polypeptide may be
2s naturally occurring, such as an allelic variant, or may be prepared by
mutagenesis techniques, by direct synthesis, or by other recombinant methods
well known to those skilled in the art.
A "fragment" can be considered as a variant of a polynucleotide or
polypeptide,
3o having the same nucleotide or amino acid sequence as part of the reference
polynucleotide or peptide. A fragment may be "free-standing" or comprised
within
a larger polynucleotide or polypeptide, normally as a single continuous
region.
7
CA 02377427 2001-12-21
WO 01/00796 PCT/CA00/00777
Nucleic acids referred to herein as "recombinant" are nucleic acids which have
been produced by recombinant DNA methodology, including those nucleic acids
that are generated by procedures which rely upon a method of artificial
recombination, such as polymerase chain reaction (PCR) and/or cloning into a
s vector using restriction enzymes.
According to one aspect, the invention provides novel isolated polynucleotides
and polypeptides, as described in greater detail below. In particular, the
invention
provides isolated polynucleotides and polypeptides related to
to glycosyltransferases involved in the biosynthesis of bacterial
lipopolysaccharides
of bacteria of the genus Helicobacter, more particularly the
lipopolysaccharides of
the species Helicobacter pylori and various strains thereof. In a preferred
embodiment, the glucosyltransferases as those involved in the biosynthesis of
the bacterial LPS, in particular of LPS core or LPS O-chain. Most
particularly, the
is invention provides isolated polynucleotides and polypeptides identical over
their
entire lengths to sequences set out in Table 1.
8
CA 02377427 2001-12-21
WO 01/00796 PCT/CA00/00777
Table 1. Polynucleotide and polypeptide sequences
Sequences from strain 26695 of H. pylori
s A. polynucleotide sequence: ORF HP0826 [SEQ ID N0:1]
ttgcgtgttt ttgccatttc tttaaatcaa aaagtgtgcg atacatttgg tttagttttt 60
agagacacca caactttact caatagcatc aatgccaccc accaccaagc gcaaattttt 120
gatgcgattt attctaaaac ttttgaaggc gggttgcacc ccttagtgaa aaagcattta 180
cacccttatt tcatcacgca aaacatcaaa gacatgggga ttacaaccaa tctcatcagt 240
gaggtttcta agttttatta cgctttaaaa taccatgcga agtttatgag cttgggggag 300
cttgggtgct atgcgagtca ttattccttg tgggaaaaat gcatagaact caatgaagcg 360
atctgtattt tagaagacga tataaccttg aaagaggatt ttaaagaggg cttggatttt 420
ttagaaaaac acatccaaga gttaggctat atccgcttga tgcatttatt gtatgatgcc 480
agtgtaaaaa gtgagccatt gagccataaa aaccacgaga tacaagagcg tgtggggatc 540
attaaagctt atagcgaagg ggtggggact caaggctatg tgatcacgcc taagattgcc 600
aaagtttttt tgaaatgcag ccgaaaatgg gttgttcctg tggatacgat aatggacgct 660
acttttatcc atggcgtgaa aaatctggtg ttacaacctt ttgtgatcgc tgatgatgag 720
caaatctcta cgatagcacg aaaagaagaa ccttatagcc ctaaaatcgc cttaatgaga 780
gaactccatt ttaaatattt gaaatattgg cagtttgtat as 822
B. polypeptide sequence deduced from sequence A [SEQ ID N0:2]
25Leu ArgValPhe AlaIleSerLeu AsnGlnLys ValCysAsp ThrPhe
1 5 10 15
Gly LeuValPhe ArgAspThrThr ThrLeuLeu AsnSerIle AsnAla
20 25 30
Thr HisHisGln AlaGlnIlePhe AspAlaIle TyrSerLys ThrPhe
35 40 45
Glu GlyGlyLeu HisProLeuVal LysLysHis LeuHisPro TyrPhe
50 55 60
Ile ThrGlnAsn IleLysAspMet GlyIleThr ThrAsnLeu IleSer
65 70 75 SO
35Glu ValSerLys PheTyrTyrAla LeuLysTyr HisAlaLys PheMet
g5 90 95
Ser LeuGlyGlu LeuGlyCysTyr AlaSerHis TyrSerLeu TrpGlu
100 105 110
Lys CysIleGlu LeuAsnGluAla IleCysIle LeuGluAsp AspIle
115 120 125
Thr LeuLysGlu AspPheLysGlu GlyLeuAsp PheLeuGlu LysHis
130 135 140
Ile GlnGluLeu GlyTyrIleArg LeuMetHis LeuLeuTyr AspAla
145 150 155 160
45Ser ValLysSer GluProLeuSer HisLysAsn HisGluIle GlnGlu
165 170 175
Arg ValGlyIle IleLysAlaTyr SerGluGly ValGlyThr GlnGly
180 185 190
Tyr ValIleThr ProLysIleAla LysValPhe LeuLysCys SerArg
195 200 205
Lys TrpValVal ProValAspThr IleMetAsp AlaThrPhe IleHis
210 215 220
Gly ValLysAsn LeuValLeuGln ProPheVal IleAlaAsp AspGlu
225 230 235 240
SJGln IleSerThr IleAlaArgLys GluGluPro TyrSerPro LysIle
245 250 255
9
CA 02377427 2001-12-21
WO 01/00796 PCT/CA00/00777
Ala Leu Met Arg Glu Leu His Phe Lys Tyr Leu Lys Tyr Trp Gln Phe
260 265 270
Val
C. polynucleotide sequence: ORF HP0159 [SEQ ID N0:3]
atgagtattattattcctattgtcatcgcttttgataatcactatgccatgccggctggc60
gtgagcttgtattccatgctagcttgcgctaaaacagaacacccccaatcacaaaatgat120
agtgaaaaacttttttataagatccactgcctggtggataacttaagccttgaaaaccag180
agcaaactaaaagagactctagccccctttagcgctttttcgagcctagaatttttagac240
atttcaacccccaatcttcacgccactccaatagaaccctctgcgattgataaaatcaat300
gaagcttttttgcaactcaatatttacgctaagactcgcttttctaaaatggtcatgtgc360
cgcttgtttttggcttctttattcccacaatacgacaaaatcatcatgtttgatgcagac420
actttgtttttaaacgatgtgagcgagagctttttcatcccactagatggctattatttt480
ggagcggctaaagattttgcttccgataaaagccctaaacattttcaaatagtgcgagaa540
aaagaccctcgtcaagccttttccctttatgagcattaccttaatgaaagcgatatgcaa600
atcatctatgaaagcaattataacgccgggtttttagtcgtgaatttaaagctgtggcgt660
gctgatcatttagaagagcgcttactcaatttaacccatcaaaaaggccagtgcgtgttt720
taccctgaacaggaccttttaacgctcgcatgctatcaaaaagttttaatcttgccttat780
atttataacacccaccctttcatggccaatcaaaaacgcttcatccctgacaaaaaagaa840
atcgtcatgctgcatttttattttgtaggaaaaccttgggttttacctactttttcatat900
tctaaagaatggcatgagactcttttaaaaacccctttttatgctgaatattccgtgaaa960
ttccttaaacaaatgacagaatgtttaagccttaaagacaaacaaaaaacctttgaattt1020
cttgcccccctactcaataaaaaaacccttttagaatacgtcttttttagattgaatagg1080
attttcaaacgcttaaaagaaaaattttttaactcttag 1119
D. polypeptide sequence deduced from sequence C [SEQ ID N0:4]
Met Ser Ile Ile Ile Pro Ile Val Ile Ala Phe Asp Asn His Tyr Ala
1 5 10 15
Met Pro Ala Gly Val Ser Leu Tyr Ser Met Leu Ala Cys Ala Lys Thr
20 25 30
Glu His Pro Gln Ser Gln Asn Asp Ser Glu Lys Leu Phe Tyr Lys Ile
35 40 45
His Cys Leu Val Asp Asn Leu Ser Leu Glu Asn Gln Ser Lys Leu Lys
50 55 60
Glu Thr Leu Ala Pro Phe Ser Ala Phe Ser Ser Leu Glu Phe Leu Asp
65 70 75 80
Ile Ser Thr Pro Asn Leu His Ala Thr Pro Ile Glu Pro Ser Ala Ile
85 90 95
Asp Lys Ile Asn Glu Ala Phe Leu Gln Leu Asn Ile Tyr Ala Lys Thr
100 105 110
Arg Phe Ser Lys Met Val Met Cys Arg Leu Phe Leu Ala Ser Leu Phe
115 120 125
Pro Gln Tyr Asp Lys Ile Ile Met Phe Asp Ala Asp Thr Leu Phe Leu
130 135 140
Asn Asp Val Ser Glu Ser Phe Phe Ile Pro Leu Asp Gly Tyr Tyr Phe
145 150 155 160
Gly Ala Ala Lys Asp Phe Ala Ser Asp Lys Ser Pro Lys His Phe Gln
165 170 175
Ile Val Arg Glu Lys Asp Pro Arg Gln Ala Phe Ser Leu Tyr Glu His
180 185 190
Tyr Leu Asn Glu Ser Asp Met Gln Ile Ile Tyr Glu Ser Asn Tyr Asn
195 200 205
Ala Gly Phe Leu Val Val Asn Leu Lys Leu Trp Arg Ala Asp His Leu
210 215 220
CA 02377427 2001-12-21
WO 01/00796 PCT/CA00/00777
Glu GluArgLeu LeuAsnLeuThr HisGlnLysGly GlnCysVal Phe
225 230 235 240
Tyr ProGluGln AspLeuLeuThr LeuAlaCysTyr GlnLysVal Leu
245 250 255
Ile LeuProTyr IleTyrAsnThr HisProPheMet AlaAsnGln Lys
260 265 270
Arg PheIlePro AspLysLysGlu IleValMetLeu HisPheTyr Phe
275 280 285
Val GlyLysPro TrpValLeuPro ThrPheSerTyr SerLysGlu Trp
290 295 300
His GluThrLeu LeuLysThrPro PheTyrAlaGlu TyrSerVal Lys
305 310 315 320
Phe LeuLysGln MetThrGluCys LeuSerLeuLys AspLysGln Lys
325 330 335
Thr PheGluPhe LeuAlaProLeu LeuAsnLysLys ThrLeuLeu Glu
340 345 350
Tyr ValPhePhe ArgLeuAsnArg IlePheLysArg LeuLysGlu Lys
355 360 365
Phe PheAsnSer
370
E. polynucleotide sequence: ORF HP0479 [SEQ ID N0:5]
atgcatgttg cttgtctttt ggctttaggg gataatctca tcacgcttag ccttttaaaa 60
gaaatcgctt tcaaacagca acaacccctt aaaatcctag gtactcgttt gactttaaaa 120
atcgccaagc ttttagaatg cgaaaaacat tttgaaatca ttcctctttt tgaaaatgtc 180
cctgcttttt atgaccttaa aaaacaaggc gtttttttgg cgatgaagga ttttttatgg 240
ttgttaaaag cgattaaaaa gcatcaaatc aaacgtttga ttttggaaaa acaggatttt 300
agaagcactt ttttagccaa attcattccc ataaccactc caaataaaga aattaaaaac 360
gtttatcaaa accgccagga gttgttttct caaatttatg ggcatgtttt tgataacccc 420
ccatatccca tgaatttaaa aaaccccaaa aagattttga tcaacccttt cacaagatcc 480
atagaccgaa gtatcccttt agagcattta caaatcgttt taaaactttt aaaacccttt 540
tgtgttacgc ttttagattt tgaagaacga tacgcttttt taaaagacag agtcgctcat 600
tatcgcgcta aaaccagttt agaagaagtt aaaaacctga ttttagaaag cgatttgtat 660
ataggagggg attcgttttt gatccatttg gcttactatt taaagaaaaa ttattttatc 720
tttttttata gggataatga tgatttcatg ccgcctaata gtaagaataa aaattttcta 780
aaagcccaca aaagccattc tatagaacaa gatttagcca aaaaattccg ccatttgggg 840
ctattataa 849
F. polypeptide sequence deduced from sequence E (SEQ ID N0:6]
Met His Val Ala Cys Leu Leu Ala Leu Gly Asp Asn Leu Ile Thr Leu
1 5 10 15
Ser Leu Leu Lys Glu Ile Ala Phe Lys Gln Gln Gln Pro Leu Lys Ile
20 25 30
Leu Gly Thr Arg Leu Thr Leu Lys Ile Ala Lys Leu Leu Glu Cys Glu
35 40 45
Lys His Phe Glu Ile Ile Pro Leu Phe Glu Asn Val Pro Ala Phe Tyr
50 55 60
Asp Leu Lys Lys Gln Gly Val Phe Leu Ala Met Lys Asp Phe Leu Trp
65 70 75 80
Leu Leu Lys Ala Ile Lys Lys His Gln Ile Lys Arg Leu Ile Leu Glu
85 90 95
Lys Gln Asp Phe Arg Ser Thr Phe Leu Ala Lys Phe Ile Pro Ile Thr
100 105 110
Thr Pro Asn Lys Glu Ile Lys Asn Val Tyr Gln Asn Arg Gln Glu Leu
11
CA 02377427 2001-12-21
WO 01/00796 PCT/CA00/00777
115 120 125
Phe Ser Gln Ile Tyr Gly His Val Phe Asp Asn Pro Pro Tyr Pro Met
130 135 140
Asn LeuLysAsn ProLysLysIle LeuIleAsn ProPheThr ArgSer
145 150 155 160
Ile AspArgSer IleProLeuGlu HisLeuGln IleValLeu LysLeu
165 170 175
Leu LysProPhe CysValThrLeu LeuAspPhe GluGluArg TyrAla
180 185 190
Phe LeuLysAsp ArgValAlaHis TyrArgAla LysThrSer LeuGlu
195 200 205
Glu ValLysAsn LeuIleLeuGlu SerAspLeu TyrIleGly GlyAsp
210 215 220
Ser PheLeuIle HisLeuAlaTyr TyrLeuLys LysAsnTyr PheIle
225 230 235 240
Phe PheTyrArg AspAsnAspAsp PheMetPro ProAsnSer LysAsn
245 250 255
Lys AsnPheLeu LysAlaHisLys SerHisSer IleGluGln AspLeu
260 265 270
Ala LysLysPhe ArgHisLeuGly LeuLeu
275 280
G. polynucleotide sequence: ORF 1191 [SEQ ID N0:7]
atgagcgtaaatgcacccaaacgcatgcgtattttattgcgtttgcctaattggttaggc60
gatggggtgatggcaagttcgcttttttacacccttaaacaccactaccctaacgcgcat120
tttatcttagtgggcccaaccattacttgcgaacttttcaaaaaagatgaaaaaatagaa180
gccgtttttatagacaacaccaaaaaatcctttttcaggetgctagccattcacaaactc240
gctcaaaaaatagggcgttgcgatatagcgatcactttaaacaaccatttctattccgct300
tttttgctctatgcgacaaaaacgcccgttcgcatcggttttgctcaattttttcgttct360
ttgtttctcagccatgcgatcgctcctgcccctaaagagtatcaccaagtggaaaagtat420
tgctttttattttcgcaatttttagaaaaagaattggatcaaaaaagcgttttaccctta480
aaactggcctttaacctccccactcacaccccaaacacccctaaaaaaatcggctttaac540
cctagcgcaagctatgggagtgctaaaagatggccagcttcttattacgctgaagtttct600
gctgttttgttagaaaaagggcatgaaatttatttttttggggctaaagaagacgctatc660
gtttctgaagaaattttaaaactcatcaaaggctcattaaaaaacccctcattgttccat720
aacgcttacaatctgtgcgggaaaacaagcattgaagaattgatagagcgcatcgctgtt780
ttagatttattcatcactaacgatagcggccctatgcatgtggctgctagcatgcaaacc840
cccttaatcgctctttttggccccactgatgaaaaagagactcgcccctataaagctcaa900
aaaacgatcgtattgaaccaccatttaagctgtgcgccttgcaagaaacgagtttgccct960
ttaaagaatgcaaaaaaccatttgtgcatgaaatctatcacgccccttgaagtcctagaa1020
gccgctcacactcttttagaagagccttaa 1050
H. polypeptide sequence deduced from sequence G [SEQ ID N0:8)
Met Ser Val Asn Ala Pro Lys Arg Met Arg Ile Leu Leu Arg Leu Pro
1 5 10 15
Asn Trp Leu Gly Asp Gly Val Met Ala Ser Ser Leu Phe Tyr Thr Leu
20 25 30
Lys His His Tyr Pro Asn Ala His Phe Ile Leu Val Gly Pro Thr Ile
35 40 45
Thr Cys Glu Leu Phe Lys Lys Asp Glu Lys Ile Glu Ala Val Phe Ile
50 55 60
Asp Asn Thr Lys Lys Ser Phe Phe Arg Leu Leu Ala Ile His Lys Leu
70 75 80
Ala Gln Lys Ile Gly Arg Cys Asp Ile Ala Ile Thr Leu Asn Asn His
85 90 95
12
CA 02377427 2001-12-21
WO 01/00796 PCT/CA00/00777
Phe TyrSerAla PheLeuLeuTyr AlaThrLysThr ProValArg Ile
100 105 110
Gly PheAlaGln PhePheArgSer LeuPheLeuSer HisAlaIle Ala
115 120 125
Pro AlaProLys GluTyrHisGln ValGluLysTyr CysPheLeu Phe
130 135 140
Ser GlnPheLeu GluLysGluLeu AspGlnLysSer ValLeuPro Leu
145 150 155 160
Lys LeuAlaPhe AsnLeuProThr HisThrProAsn ThrProLys Lys
165 170 175
Ile GlyPheAsn ProSerAlaSer TyrGlySerAla LysArgTrp Pro
180 185 190
Ala SerTyrTyr AlaGluValSer AlaValLeuLeu GluLysGly His
195 200 205
15Glu IleTyrPhe PheGlyAlaLys GluAspAlaIle ValSerGlu Glu
210 215 220
Ile LeuLysLeu IleLysGlySer LeuLysAsnPro SerLeuPhe His
225 230 235 240
Asn AlaTyrAsn LeuCysGlyLys ThrSerIleGlu GluLeuIle Glu
245 250 255
Arg IleAlaVal LeuAspLeuPhe IleThrAsnAsp SerGlyPro Met
260 265 270
His ValAlaAla SerMetGlnThr ProLeuIleAla LeuPheGly Pro
275 280 285
25Thr AspGluLys GluThrArgPro TyrLysAlaGln LysThrIle Val
290 295 300
Leu AsnHisHis LeuSerCysAla ProCysLysLys ArgValCys Pro
305 310 315 320
Leu LysAsnAla LysAsnHisLeu CysMetLysSer IleThrPro Leu
325 330 335
Glu ValLeuGlu AlaAlaHisThr LeuLeuGluGlu Pro
340 345
3s Sequences from strain SS1 of H. ,cue
I. polynucleotide sequence: ORF SS0826 [SEQ ID N0:9]
ttgcgtattt ttatcatttc tttaaatcaa aaagtgtgcg ataaatttgg tttggttttt 60
agagacacca cgactttact caatagcatc aatgccaccc accaccaagt gcaaattttt 120
gatgcgattt attctaaaac ttttgaaggc gggttgcacc ccttagtgaa aaagcattta 180
cacccttatt tcatcacgca aaacatcaaa gacatgggaa ttacaaccag tctcatcagt 240
gaggtttcta agttttatta cgctttaaaa taccatgcga agtttatgag cttgggagag 300
cttgggtgct atgcgagcca ttattccttg tgggaaaaat gcatagaact caatgaagcg 360
atctgtattt tagaagacga tataaccttg aaagaggatt ttaaagaggg cttggatttt 420
ttagaaaaac acatccaaga gttaggctat gttcgcttga tgcatttatt atatgatccc 480
aatattaaaa gtgagccatt gaaccataaa aaccacgaga tacaagagcg tgtagggatt 540
attaaagctt atagcgaagg ggtggggact caaggctatg tgatcacgcc caagattgcc 600
aaagttttta aaaaacacag ccgaaaatgg gttgttcctg tggatacgat aatggacgct 660
acttttatcc atggcgtgaa aaatctggtg ttacaacctt ttgtgatcgc tgatgatgag 720
caaatctcta cgatagcgcg aaaagaacaa ccttatagcc ctaaaatcgc cttaatgaga 780
gaactccatt ttaaatattt gaaatattgg cagtttatat ag 822
ss J. polypeptide sequence deduced from sequence I [SEQ ID N0:10]
Leu Arg Ile Phe Ile Ile Ser Leu Asn Gln Lys Val Cys Asp Lys Phe
1 5 10 15
13
CA 02377427 2001-12-21
WO 01/00796 PCT/CA00/00777
Gly LeuValPheArg AspThrThr ThrLeuLeuAsn SerIleAsn Ala
20 25 30
Thr HisHisGlnVal GlnIlePhe AspAlaIleTyr SerLysThr Phe
35 40 45
Glu GlyGlyLeuHis ProLeuVal LysLysHisLeu HisProTyr Phe
50 55 60
Ile ThrGlnAsnIle LysAspMet GlyIleThrThr SerLeuIle Ser
65 70 75 80
Glu ValSerLysPhe TyrTyrAla LeuLysTyrHis AlaLysPhe Met
85 90 95
Ser LeuGlyGluLeu GlyCysTyr AlaSerHisTyr SerLeuTrp Glu
100 105 110
Lys CysIleGluLeu AsnGluAla IleCysIleLeu GluAspAsp Ile
115 120 125
15Thr LeuLysGluAsp PheLysGlu GlyLeuAspPhe LeuGluLys His
130 135 140
Ile GlnGluLeuGly TyrValArg LeuMetHisLeu LeuTyrAsp Pro
145 150 155 160
Asn IleLysSerGlu ProLeuAsn HisLysAsnHis GluIleGln Glu
165 170 175
Arg ValGlyIleIle LysAlaTyr SerGluGlyVal GlyThrGln Gly
180 185 190
Tyr ValIleThrPro LysIleAla LysValPheLys LysHisSer Arg
195 200 205
25Lys TrpValValPro ValAspThr IleMetAspAla ThrPheIle His
210 215 220
Gly ValLysAsnLeu ValLeuGln ProPheValIle AlaAspAsp Glu
225 230 235 240
Gln IleSerThrIle AlaArgLys GluGlnProTyr SerProLys Ile
245 250 255
Ala LeuMetArgGlu LeuHisPhe LysTyrLeuLys TyrTrpGln Phe
260 265 270
Ile
K. polynucleotide sequence: ORF SS0159 [SEQ ID N0:11]
atgagtattactattcctattgttatcgcttttgacaatcattacgccattccggctggc60
gtgagcctgtattccatgctagcttgcactaaaacagaacacccccaatcacaaaatgat120
agtgaaaaacttttttataaaatccactgcctggtagataacttaagccttgaaaaccag180
tgcaaattgaaagaaactctagccccctttagcgcttttatgagcgtggattttttagac240
atttcaacccctaatctttacaccccttcaatagaaccctctgcgattgataaaatcaat300
gaagcttttttgcaactcaatatttacgctaagactcgcttttctaaaatggtcatgtgc360
cgcttgtttttggcttctttattcccgcaatacgacaaaatcatcatgtttgatgcggac420
actttgtttttaaacgatgtgagcgagagtttttttatcccgctagatggttattatttt480
ggagcggctaaagatttttcttctcctaaaaaccttaaacattttcaaacagaaagggag540
agagagcctcgccaaaaattttttctccatgagcattaccttaaagaaaaagacatgaaa600
atcatttgtgaaaaccactataatgttgggtttttaatcgtgaatttaaagctgtggcgt660
gctgatcatttagaagaacgcttactcaatttaacccatcaaaaaggccagtgtgtgttt720
tgccctgaacaggatattttaacgctcgcatgctatcaaaaagttttacaattaccttat780
atttacaacacccaccctttcatggtcaatcaaaaacgcttcatccctaacaaaaaagaa840
atcgtcatgctgcatttttattttgtaggaaaaccttgggttttacccactgctttatat900
tctaaagaatggcatgagactcttttaaaaacccctttttacgctgaatattccgtgaaa960
tttcttaaacaaatgacagaatttttaagccttaaagacaaacaaaaaacctttgaattt1020
cttgcccccctactcaataaaaaaacccttttagaatatgtcttttttagattgaatagg1080
attttcaaacgcttaaaagaaaaacttttaaactcttagc 1120
14
CA 02377427 2001-12-21
WO 01/00796 PCT/CA00/00777
L. polypeptide sequence deduced from sequence K [SEQ ID N0:12]
Met Ser Ile Thr Ile Pro Ile Val Ile Ala Phe Asp Asn His Tyr Ala
1 5 10 15
Ile Pro Ala Gly Val Ser Leu Tyr Ser Met Leu Ala Cys Thr Lys Thr
20 25 30
Glu His Pro Gln Ser Gln Asn Asp Ser Glu Lys Leu Phe Tyr Lys Ile
35 40 45
His Cys Leu Val Asp Asn Leu Ser Leu Glu Asn Gln Cys Lys Leu Lys
50 55 60
Glu Thr Leu Ala Pro Phe Ser Ala Phe Met Ser Val Asp Phe Leu Asp
65 70 75 80
Ile Ser Thr Pro Asn Leu Tyr Thr Pro Ser Ile Glu Pro Ser Ala Ile
85 90 95
Asp Lys Ile Asn Glu Ala Phe Leu Gln Leu Asn Ile Tyr Ala Lys Thr
100 105 110
Arg Phe Ser Lys Met Val Met Cys Arg Leu Phe Leu Ala Ser Leu Phe
115 120 125
Pro Gln Tyr Asp Lys Ile Ile Met Phe Asp Ala Asp Thr Leu Phe Leu
130 135 140
Asn Asp Val Ser Glu Ser Phe Phe Ile Pro Leu Asp Gly Tyr Tyr Phe
145 150 155 160
Gly Ala Ala Lys Asp Phe Ser Ser Pro Lys Asn Leu Lys His Phe Gln
165 170 175
Thr Glu Arg Glu Arg Glu Pro Arg Gln Lys Phe Phe Leu His Glu His
180 185 190
Tyr Leu Lys Glu Lys Asp Met Lys Ile Ile Cys Glu Asn His Tyr Asn
195 200 205
Val Gly Phe Leu Ile Val Asn Leu Lys Leu Trp Arg Ala Asp His Leu
210 215 220
Glu Glu Arg Leu Leu Asn Leu Thr His Gln Lys Gly Gln Cys Val Phe
225 230 235 240
Cys Pro Glu Gln Asp Ile Leu Thr Leu Ala Cys Tyr Gln Lys Val Leu
245 250 255
Gln Leu Pro Tyr Ile Tyr Asn Thr His Pro Phe Met Val Asn Gln Lys
260 265 270
Arg Phe Ile Pro Asn Lys Lys Glu Ile Val Met Leu His Phe Tyr Phe
275 280 285
Val Gly Lys Pro Trp Val Leu Pro Thr Ala Leu Tyr Ser Lys Glu Trp
290 295 300
His Glu Thr Leu Leu Lys Thr Pro Phe Tyr Ala Glu Tyr Ser Val Lys
305 310 315 320
Phe Leu Lys Gln Met Thr Glu Phe Leu Ser Leu Lys Asp Lys Gln Lys
325 330 335
Thr Phe Glu Phe Leu Ala Pro Leu Leu Asn Lys Lys Thr Leu Leu Glu
340 345 350
Tyr Val Phe Phe Arg Leu Asn Arg Ile Phe Lys Arg Leu Lys Glu Lys
355 360 365
Leu Leu Asn Ser
370
M. polynucleotide sequence: ORF SS0479 [SEQ ID N0:13]
atgcatgttg cttgtctttt ggctttaggg gataacctca tcacgcttag cctttgtgaa 60
gaaatcgctc tcaaacagca acaacccctt aaaatcctag gtactcgttt gactttaaaa 120
atcgccaagc ttttagaatg cgaaaaacat tttgaaatca ttcctgtttt taaaaatatc 180
cccgcttttt atgaccttaa aaaacaaggc gttttttggg cgatgaagga ttttttatgg 240
CA 02377427 2001-12-21
WO 01/00796 PCT/CA00/00777
ttattaaaag cgcttaagaa gcacaaaatc aaacacttga ttttagaaaa acaagatttt 300
agaagcgctc ttttatccaa atttgtttcc ataaccactc caaataaaga aattaaaaat 360
gcttatcaaa accgccagga gttgttttct caaatttatg ggcatgtttt tgataatagt 420
caatattcca tgagtttaaa aaaccccaaa aagattttaa tcaacccttt cacgagagaa 480
aataatagaa atatttcttt agaacatttg caaatcgttt taaaactgtt aaaacccttt 540
tgtgttacgc ttttagattt tgaagaacga tacgcttttt taaaagatga agtcgctcat 600
tatcgcgcta aaaccagttt agaagaagct aaaaacctga ttttagaaag cgatttgtat 660
ataggggggg attcgttttt gatccatttg gcttactatt taaagaaaaa ttattttatc 720
tttttttata gggataatga cgatttcatg ccgcctaaga atgaaaattt tctaaaagcc 780
cataaaagcc atttcataga gcaggattta gccacccagt tccgccattt ggggctatta 840
taa 843
N. polypeptide sequence deduced from sequence M [SEQ ID N0:14]
Met HisValAla CysLeuLeuAla LeuGlyAsp AsnLeuIle ThrLeu
1 5 10 15
Ser LeuCysGlu GluIleAlaLeu LysGlnGln GlnProLeu LysIle
20 25 30
Leu GlyThrArg LeuThrLeuLys IleAlaLys LeuLeuGlu CysGlu
35 40 45
Lys HisPheGlu IleIleProVal PheLysAsn IleProAla PheTyr
50 55 60
Asp LeuLysLys GlnGlyValPhe TrpAlaMet LysAspPhe LeuTrp
65 70 75 80
Leu LeuLysAla LeuLysLysHis LysIleLys HisLeuIle LeuGlu
85 90 95
Lys GlnAspPhe ArgSerAlaLeu LeuSerLys PheValSer IleThr
100 105 110
Thr ProAsnLys GluIleLysAsn AlaTyrGln AsnArgGln GluLeu
115 120 125
Phe SerGlnIle TyrGlyHisVal PheAspAsn SerGlnTyr SerMet
130 135 140
Ser LeuLysAsn ProLysLysIle LeuIleAsn ProPheThr ArgGlu
145 150 155 160
Asn AsnArgAsn IleSerLeuGlu HisLeuGln IleValLeu LysLeu
165 170 175
Leu LysProPhe CysValThrLeu LeuAspPhe GluGluArg TyrAla
180 185 190
Phe LeuLysAsp GluValAlaHis TyrArgAla LysThrSer LeuGlu
195 200 205
Glu AlaLysAsn LeuIleLeuGlu SerAspLeu TyrIleGly GlyAsp
210 215 220
Ser PheLeuIle HisLeuAlaTyr TyrLeuLys LysAsnTyr PheIle
225 230 235 240
Phe PheTyrArg AspAsnAspAsp PheMetPro ProLysAsn GluAsn
245 250 255
Phe LeuLysAla HisLysSerHis PheIleGlu GlnAspLeu AlaThr
260 265 270
Gln PheArgHis LeuGlyLeuLeu
275 280
Sequences from strain PJ1 of H. ,nylori
O. polynucleotide sequence: ORF PJ1-0479 [SEQ ID N0:15]
atgcatgttg cttgtctttt ggctttaggg gataacctca tcacgcttag ccttttaaaa 60
gaaatcgctt ccaaacagca acggcccctt aaaatcctag gcactcgttt gactttaaaa 120
16
CA 02377427 2001-12-21
WO 01/00796 PCT/CA00/00777
atcgccaagc ttttagaatg cgaaaaacat tttgaaatca ttcctatttt tgaaaatatc 180
cctgcttttt atgatcttaa aaaacaaggc gttttttggg cgatgaagga ttttttatgg 240
ttgttaaaag caattaagaa gcacaaaatc aaacatttga ttttagaaaa acaagatttt 300
agaagttttc ttttatccaa atttgtttcc ataaccactc ccaataaaga aattaaaaac 360
gtttatcaaa accgccagga gttgttttct ccaatttatg ggcatgtttt tgataacccc 420
ccatatccca tgaatttaaa aaaccccaaa aagattttga tcaacccttt cacaagatcc 480
atagagcgaa gtatcccttt agagcattta aaaatcgttt taaaactctt aaaacccttt 540
tgtgttacgc ttttagattt tgaagaacga tacgcttttt tacaaaatga agccactcat 600
tatcgtgcta aaaccagttt agaagaagtt aaaagcctga ttttagaaag cgatttgtat 660
ataggggggg attcgttttt aatccatttg gcttactatt taaagaaaaa ttattttatc 720
tttttttata gggataatga cgatttcatg ccacctaatg gtaagaagga aaattttcta 780
aaagcccaca aaagccatta catagaacag gatttagcca aaaaattccg ccatttgggg 840
cttattataa 850
P. polypeptide sequence deduced from sequence O [SEQ ID N0:16]
Met HisValAla CysLeuLeu AlaLeuGlyAsp AsnLeuIle ThrLeu
1 5 10 15
Ser LeuLeuLys GluIleAla SerLysGlnGln ArgProLeu LysIle
20 25 30
Leu GlyThrArg LeuThrLeu LysIleAlaLys LeuLeuGlu CysGlu
35 40 45
Lys HisPheGlu IleIlePro IlePheGluAsn IleProAla PheTyr
50 55 60
Asp LeuLysLys GlnGlyVal PheTrpAlaMet LysAspPhe LeuTrp
65 70 75 80
Leu LeuLysAla IleLysLys HisLysIleLys HisLeuIle LeuGlu
85 90 95
Lys GlnAspPhe ArgSerPhe LeuLeuSerLys PheValSer IleThr
100 105 110
Thr ProAsnLys GluIleLys AsnValTyrGln AsnArgGln GluLeu
115 120 125
Phe SerProIle TyrGlyHis ValPheAspAsn ProProTyr ProMet
130 135 140
Asn LeuLysAsn ProLysLys IleLeuIleAsn ProPheThr ArgSer
145 150 155 160
Ile GluArgSer IleProLeu GluHisLeuLys IleValLeu LysLeu
165 170 175
Leu LysProPhe CysValThr LeuLeuAspPhe GluGluArg TyrAla
180 185 190
Phe LeuGlnAsn GluAlaThr HisTyrArgAla LysThrSer LeuGlu
195 200 205
Glu ValLysSer LeuIleLeu GluSerAspLeu TyrIleGly GlyAsp
210 215 220
Ser PheLeuIle HisLeuAla TyrTyrLeuLys LysAsnTyr PheIle
225 230 235 240
Phe PheTyrArg AspAsnAsp AspPheMetPro ProAsnGly LysLys
245 250 255
Glu AsnPheLeu LysAlaHis LysSerHisTyr IleGluGln AspLeu
260 265 270
Ala LysLysPhe ArgHisLeu GlyLeuIleIle
275 280
l~
CA 02377427 2001-12-21
WO 01/00796 PCT/CA00/00777
Preferred embodiments of the invention are polynucleotides coding for H.
pylori
glycosyltransferases involved in the biosynthesis of the core or O-chain
regions
of the bacterial lipopolysaccharide (LPS), in particular polynucleotides
having
sequences shown in Table 1 (SEQ I D NO: 1, 3, 5, 7, 9, 11, 13 and 15),
s polynucleotides closely related thereto, as well as fragments and variants
thereof.
Another preferred embodiments of the invention are polynucleotides that are at
least 70% identical over their entire length to polynucleotides shown in Table
1,
preferably at least 80% identical, more preferably at least 90% identical,
most
preferably at least 95% identical, and polynucleotides that are complementary
to
to such polynucleotides. Furthermore, those with at least 97% are highly
preferred
among those with at least 95%, and among these those with at least 98% and at
least 99% are particularly highly preferred, with at least 99% being the most
preferred.
is Of the polynucleotides showing substantial identity to the polynucleotides
shown
in Table 1 (SEQ ID NO: 1, 3, 5, 7, 9, 11, 13 and 15), preferred are those
which
encode polypeptides showing substantially the same biological function or
activity
as the polypeptides shown in Table 1 (SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14 and
16).
Polynucleotides shown in Table 1 correspond to open reading frames HP0826
(SEQ ID NO: 1 ), HP0159 (SEQ ID NO: 3), HP0479 (SEQ ID NO: 5) and HP1191
(SEQ ID N0:7) of the genomic DNA of H. pylori strain 26695, to open reading
frames SS0826 (SEQ ID NO: 9), SS0159 (SEQ ID NO: 11 ) and SS0479 (SEQ ID
2s NO: 13) of the genomic DNA of H. pylori strain SS1, and to open reading
frame
PJ1-0479 (SEQ ID N0:15) of the genomic DNA of H. pylori strain PJ1. Among
several others, ORFs HP0826, HP0159, HP0479 and HP1191 have been
identified using the complete annotated genome sequence of H. pylori strain
26695 and BLAST analysis as potentially coding for glycosyltransferases. They
3o have been proven, directly or indirectly, to encode a ~3-1,4-
galactosyltransferase
(HP0826), a a-1,6-glucosyltransferase (HP0159), a heptosyltransferase
(HP0479), and an ADP-heptose-LPS heptosyltransferase II (HP1191 ), which are
enzymes involved in the biosynthesis of the H. pylori lipopolysaccharide. ORFs
18
CA 02377427 2001-12-21
wo onoo~96 PcTicAOOioo~~~
identified by BLAST analysis have been cloned, expressed, and isolated using
techniques well known to those skilled in the art, also discussed more in
detail
further in this disclosure.
s The isolated polynucleotides of the present invention can be used in the
production of polypeptides they encode. For example, a polynucleotide
containing all or part of the coding sequence for a Helicobacter
glycosyltransferase can be incorporated into various DNA constructs, such as
expression cassettes, and vectors, such as recombinant plasmids, adapted for
to further manipulation of polypeptide sequences or for the production of the
encoded polypeptide in suitable host cells, either eukaryotic, such as yeast
or
plant cells, or prokaryotic, such as bacteria, for example E. coli. This can
be
achieved using recombinant DNA techniques and methodologies well known to
those skilled in the art.
is
Thus the present invention further provides recombinant nucleic acids
comprising
polynucleotide sequences which encode glycosyltransferases involved in the
biosynthesis of lipopolysaccharides of bacteria of the genus Helicobacter,
more
particularly of lipopolysaccharides of the species Helicobacter pylori and
various
2o strains thereof. Most particularly, the invention provides recombinant
nucleic
acids comprising polynucleotides identical over their entire lengths to
polynucleotides having sequences set out in Table 1, as well as fragments and
variants of such sequences. Among fragments and variants, preferred are those
coding for polypeptides retaining the biological function or activity of the
reference
2s polypeptides.
The isolated polynucleotides and fragments thereof can also be used as DNA
diagnostic probes specific to H. pylori, for diagnostic or similar purposes.
They
may be used, for example, to check whether or not the polynucleotides
according
3o to the present invention are transcribed in bacteria of an infected tissue.
They
may be also useful in diagnosis of the stage of infection and determining the
specific pathogen involved.
19
CA 02377427 2001-12-21
WO 01/00796 PCT/CA00/00777
The isolated polynucleotides of the present invention may further be used as
hybridization probes for RNA, cDNA and genomic DNA, for example to isolate
cDNA or genomic clones of other genes that have a high sequence similarity to
the polynucleotides of the present invention. Such probes will comprise at
least
s 15 bases, preferably at least 30 bases, but may have even more than 50
bases.
Preferred isolated or recombinant polypeptides of the present invention are
those
showing the activity of glycosyltransferases involved in biosynthesis of the
bacterial lipopolysaccharides of bacteria of the genus Helicobacter, more
to particularly lipopolysaccharides of the species Helicobacter pylori and
various
strains thereof. Most particularly preferred are polypeptides coded by
polynucleotides having sequences shown in Table 1 (SEQ ID NOs: 1, 3, 5, 7, 9,
11, 13 and 15), and also those which have at least 50% identity to
polypeptides
shown in Table 1 (SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14 and 16), preferably at
least
is 70% identity, more preferably at least 80% identity, most preferably at
least 95%
identity, polypeptides closely related thereto as well as fragments and
variants
thereof. Of the polypeptides having substantial identity to polypeptides of
Table 1,
preferred are those having the same biological function or activity as the
polypeptides appearing in Table 1.
Polypeptides having amino acid sequences shown in Table 1 correspond to
those coded by open reading frames HP0826 (SEQ ID NO: 2), HP0159 (SEQ ID
NO: 4), HP0479 (SEO ID NO: 6) and HP1191 (SEQ ID N0:8) of the genomic
DNA of H. pylori strain 26695, by open reading frames SS0826 (SEQ ID NO: 10),
2s SS0159 (SEQ ID NO: 12) and SS0479 (SEQ ID NO: 14) of the genomic DNA of
H. pylori strain SS1, and by open reading frame PJ0479 of the genomic DNA of
H. pylori strain PJ1. Among several others, these ORFs have been cloned and
expressed in suitable host cells and their function has been determined in
vitro
using techniques well known to those skilled in the art and discussed more in
3o detail further in this disclosure.
Polypeptides of the present invention can be produced as discussed above in
connection with recombinant nucleic acids of the present invention. They can
be
CA 02377427 2001-12-21
WO 01/00796 PCT/CA00/00777
recovered and purified from recombinant cell cultures by methods and
techniques
well known to those skilled in the art, including ammonium sulfate or ethanol
precipitation, acid extraction, and various forms of chromatography, in
particular
ion exchange and high performance liquid chromatography (HPLC). Well known
s techniques for refolding protein may be employed to regenerate active
conformation when the polypeptide is denaturated during isolation and/or
purification.
The invention also relates to methods of screening compounds, to identify
those
to which enhance (agonists) or block (antagonists) the action of
polynucleotides or
polypeptides of the present invention. Of those, antagonists acting as
bacteriostatic or bactericidal agents are of particular interest. Potential
antagonists include small organic molecules, peptides, polypeptides and
antibodies that bind to a polynucleotide or polypeptide of the present
invention
is and therefore inhibit its activity. Polynucleotides and polypeptides of the
present
invention may be used to assess the binding of small molecule substrates and
ligands from various sources, including cells, cell-free preparations,
chemical
libraries, and natural product mixtures. The substrates and ligands may be
natural substrates and ligands or may be structural or functional mimetics.
Polypeptides of the present invention are particularly useful for screening
chemical compounds modulating the enzymatic activity of glycosyltransferases
of
Helicobacter origin involved in the biosynthesis of bacterial
lipopolysaccharides,
to identify those which enhance (agonists) or inhibit (antagonists or
inhibitors) the
2s action of Helicobacter glycosyltransferases, in particular compounds that
are
bacteriostatic and/or bactericidal. The method of screening may involve high-
throughput techniques and assays. In a typical assay, a synthetic reaction mix
comprising a polypeptide of the present invention and a labelled substrate or
ligand of such polypeptide is incubated in the absence and in the presence of
a
3o candidate substance, a potential agonist or antagonist of the enzyme under
study. This capability is reflected in decreased binding of the labeled ligand
or in
decreased production of a product from the labeled substrate. Detection of the
rate or level of production of the product from the substrate may be enhanced
by
21
CA 02377427 2001-12-21
WO 01/00796 PCT/CA00/00777
using a suitable reporter system, such as a colorimetrically labelled
substrate
which is converted into a colorimetrically assayable product or a reporter
gene
responsive to changes in the enzymatic activity of the polypeptide.
s The polypeptides of the present invention showing enzymatic activity of
Helicobacter glycosyltransferases are also useful for the enzymatic synthesis
of
bacterial lipopolysaccharides and fragments thereof. When included in suitable
reaction mixtures, these polypeptides catalyze the transfer of mono- or
oligosaccharide residues to a suitable acceptor. In a preferred embodiment,
the
io polypeptides of the present invention are used for the preparation of
various
mimics, analogues and derivatives of Helicobacter lipopolysaccharides.
In yet another aspect, the invention provides novel mutants of Helicobacter
bacteria, in particular mutants of H. pylori, having mutated (deactivated)
genes of
is glycosyltransferases involved in the biosynthesis of bacterial
lipopolysaccharides,
in particular of the core or O-chain regions of LPS. Structural analysis of
LPS
isolated from the mutants confirmed that O-chain synthesis has been affected
by
the mutations and revealed the exact structure of the truncated LPS molecules.
The mutant strains were also shown to have a reduced capacity of gastric
2o colonization.
The mutant bacteria expressing the truncated LPS and the LPS isolated from
such mutants are useful as sources of antigens to be used in vaccination
against
Helicobacter bacteria, in particular against H. pylori. Such vaccines are
normally
2s prepared from dead bacterial cells, using methods well known to those
skilled in
the art, and usually contain various auxiliary components, such as an
appropriate
adjuvant and a delivery system. A delivery system aiming at mucosal delivery
is
preferred. Preferably but not essentially, the antigenic preparation is
administered
orally to the host, but parenteral admistration is also possible. Live
vaccines
3o based on H. pylori mutants may also be prepared, but would normally require
an
appropriate vector for mucosal delivery. Vaccines of the present invention are
useful in preventing and reducing the number of H. pylori infections and
indirectly
22
CA 02377427 2001-12-21
WO 01/00796 PCT/CA00/00777
in reducing the incidence of pathological conditions associated with such
infections, in particular gastric cancer.
Chemically modified LPS isolated from mutants expressing the truncated LPS is
a preferred antigen for use in vaccines according to the present invention. It
is
isolated from the bacteria and at least partially purified using techniques
well
known to those skilled in the art. Preparations of at least 70%, particularly
80%,
more particularly 90%, most particularly 95% pure LPS are preferred. The
purity
of an LPS preparation is expressed as the weight percentage of the total
to Helicobacter antigens present in the preparation. The purified LPS can be
used
as antigen either directly or after being conjugated to a suitable carrier
protein.
In the following, the invention will be described in still greater detail, by
way of
examples and with respect to the preferred embodiments.
Identification and cloning of ~-1,4-galactosyltransferase
A search of the H. pylori genomic database of translated proteins revealed
three
open reading frames (ORFs) (HP0826, HP0805 and HP0619) which exhibited
limited homology with the Iex28 gene from Haemophilus influenzae (39%
identity) and the lobl gene from Haemophilus somnus (32% identity). While both
the Iex2B and lobl genes of Haemophilus have been shown to be involved in
synthesis of the outer core region of the lipooligosaccharide (Jarosik et al,
Infect.
Immun. 62: 4861-4867 (1994); Inzana et al, Infect. Immun. 65: 4675-4681
(1997)), to date no definitive function for either gene has been proposed.
There
is evidence that they are involved in addition of glucose (Iex2B) and
galactose
(lob1) to the core heptose region. Both Iex2B and lobl show significant
homology to a larger group of LOS biosynthesis proteins which include the H.
influenzae Iex1llic2A genes (Cope et al, Mol. Microbiol. 5: 1113-1124 (1994))
3o and Iic28 gene (High et al, Mol. Microbiol. 9: 1275 (1993)), Neisseria IgfB
and
IgtE genes (Wakarchuk et al, J. Bio. Chem. 271: 19166-19173 (1996)) and lpsA
of P, haemolytica (Potter et al, FEMS Microbiol. Lett. 129: 75-81 (1995) which
are
all involved in outer core assembly. The LgtB and LgtE proteins of N.
meningitidis
23
CA 02377427 2001-12-21
WO 01/00796 PCT/CA00/00777
have been shown to be galactosyltransferases involved in the transfer of
galactose in a ~-1,4 linkage in the terminal lacto-N-neotetraose structure.
LgtB is
responsible for the addition of Gal to GIcNAc, an identical function to that
described here for HP0826, while LgtE catalyses the addition of Gal to Glc
s (Wakarchuk et al, supra). Clustal multiple sequence alignment of HP0826
amino
acid (aa) sequence and Iex2B, lob1 and IgtB as sequences from this group of
related LOS biosynthesis proteins did identify two regions of conservation
spanning the regions in HP0826 from approx. aa90 to aa142 and aa189 to aa235
(see Fig 1 ). Limited homology was also observed with waaX from E. coli
to (Heinrichs et al, Mol. Microbiol. 30: 221-232 (1998)), a putative core ~i-
1,4-
galactosyltransferase, only in the region spanning aa96-aa142 (data not
shown).
No significant homology was obtained with any putative glycosyltransferases
involved in O-chain assembly from Gram-negative bacteria.
is Synthetic oligonucleotide primers which contained BamHl restriction sites
which
flanked the 5' and 3' ends of HP0826, HP0619, and HP0805 respectively,. were
used in a PCR reactions containing chromosomal DNA of H. pylori 26695 or SS1
as a template. A single PCR product was obtained in each case and this was
cloned into pUCl9 to give plasmids pHP0826, pHP0805, and pHP0619. DNA
2o sequencing was used to confirm the identity of the cloned PCR products from
26695 and SS1.
Three additional open reading frames of H. pylori genome, HP0159, HP1191 and
HP0479, have been identified by BLAST analysis as potentially coding for LPS
2s glycosyltransferases. Of those, HP0159 displayed homology to the rfaJ,
lipopolysaccharide 1,2-glucosyltransferase gene from a number of bacterial
species, HP0479 and HP1191 displayed homology to waaC and waaF
respectively, which are heptosyltransferase genes responsible for the addition
of
LD heptose to KDO in the core backbone.
Functional analysis of Iex2B homologues
~i-1,4-galactosyltransferase activity has previously been detected in H.
pylori
(Chan et al, Glycobiology 5: 683-688 (1995)), but the genes) for this enzyme
24
CA 02377427 2001-12-21
WO 01/00796 PCT/CA00/00777
have not been described. Enzyme activity was detected in extracts of E. coli
pHP0826 but not from clones of HP0805 and HP0619 using the synthetic
acceptor molecule FCHASE aminophenyl~-GIcNAc and UDP-Gal as the donor.
The lack of detectable activity in HP0805 and HP0619 clones could be a lack of
s the appropriate donor/acceptor molecule for their respective enzymatic
activities.
~-1,4-galactosyltransferase activity was also present in parent H. pylori
strains
but not in the H. pylori HP0826 mutants. The assays were followed by TLC
analysis of the reaction mixtures as previously described (Gilbert et al, Eur.
J.
8iochem. 249: 187-194 (1997)). A more sensitive capillary electrophoresis (CE)
to analysis of the reaction mixtures clearly demonstrated a loss of
galactosyltransferase activity in the mutants. The product of the enzymatic
reaction had an identical CE mobility compared to a known FCHASE-
aminophenyl-~3-N-acetyllactosamine standard, and was subjected to NMR
analysis to determine the linkage. The ~H and '3C chemical shift data (Table
2)
Is and 1 D NOE analysis were consistent with the linkage of the Gal being ~3-
1,4 to
the GIcNAc. The product was also sensitive to ~i-galactosidase.
CA 02377427 2001-12-21
WO 01/00796 PCT/CA00/00777
Table 2. Linkage analysis of the product formed by HP0826 encoded protein.
' H and '3C chemical shifts of the glycoside of Gal-~i-1,4-GIcNAc-~-FEXa
Residue Position H C
A, (3-GlcNAc 1 4.86 100.6
2 3.91 55.8
3 3.72 73.4
4 3.72 79.0
S 3.46 75.8
6 3.74, 3.83 60.8
NAc 1.91 22.9
B, (3-Gal 1 4.46 103.8
2 3.58 72.0
3 3.68 73.4
4 3.94 69.4
S 3.73 76.3
6 3.77, 3.77 62.0
FEXas 3.09 29.4
FEXms 2.80 36.9
FEXxs 3.57 37.6
FEXa 1 6.92 118.2
FEXx1 7.28 124.4
FEXa2 7.17 132.5
EXm2 7.70 123.3
F EXx2 8.00 121. 5
FEXa3 7.22 132.7
FEXa3' 7.13 131.1
FEXm3 6.82 121.5
FEXx3 6.91 104.3
a in ppm from the 600 MHz HSQC spectrum of the sample in D20 at 35°C.
Chemical
shifts are referenced to the methyl resonance of acetone set at 2.225 ppm
for'H and
31.07 ppm'3C. The error is ~ 0.03 ppm for'H and ~ 0.3 for'3C chemical shifts.
The AMX spin system of CHz-CH2-S-CHZ is at 3.09, 2.80, 3.57 ppm with JAM=6.4
Hz and
with their respective'3C signals at 29.4, 36.9 and 37.6 ppm. The aminophenyl
A2X2 spin
1o system is at 6.92 and 7.28 ppm with JAX=8.7 Hz and their respective'3C
signals at 118.2
and 124.4 ppm. The three AMX spin system for fluorescein carboxamido group
with
JAM=8-9 Hz and JMX= 1-2 Hz are at (7.17, 7.70, 8.00), (7.22, 6.82, 6.91) and
(7.13, 6.82,
6.91 ) ppm. Their respective '3C signals are at (132.5, 123.3, 121.5), (132.7,
121.5,
104.3) and (131.1, 121.5, 104.3) ppm.
26
CA 02377427 2001-12-21
WO 01/00796 PCT/CA00/00777
Functional analysis of rfaJ homologue (HP0159)
Enzyme activity was detected in extracts of E. coli pHP0159 using the
synthetic
acceptor molecule FCHASE aminophenyl-a-maltose or FCHASE aminophenyl-a-
glucose and UDP-Glc as the donor. Activity was also present in parent H.
pylori
s strains but not in H. pylori HP0159 mutants. The assays were followed by TLC
and CE analysis of the reaction mixtures as previously described (Gilbert et
al,
Eur. J. Biochem. 249: 187-194 (1997)). The more sensitive capillary
electrophoresis (CE) analysis of the reaction mixtures demonstrated a loss of
glucosyltransferase activity in the mutants. The product of the enzymatic
reaction
io was subjected to NMR analysis to determine the linkage (Table 3). The 'H
and
'3C chemical shift data, and 1 D NOE analysis were consistent with the linkage
of
Glc being a-1,6 to the Glc.
27
CA 02377427 2001-12-21
WO 01/00796 PCT/CA00/00777
Table 3. Linkage analysis of the product formed by HP0159 encoded protein.
'H and'3C chemical shifts of Glc-a-1,6-Glc-a-1,6-Glc-a-FEXa
Residue Position H C
A, a-Glc-FEX 1 5.35 98.3
2 3.62 72.1
3 3.80 74.1
4 3.48 70.6
5 3.72 72.1
3.43, 3.69 66.5
B, a-Glc 1 4.74 98.8
2 3.47 72.2
3 3.61 74.3
4 3.48 70.6
j 3.73 71.2
3.59, 3.87 66.5
C, a-Glc 1 4.89 98.8
(terminal)
2 3.52 72.5
3 3.70 74.1
4 3.41 70.5
5 3.67 72.8
3.74,3.79 61.5
FEXas 3.02 29.3
FEXms 2.74 36.9
FEXxs 3.52 37.5
FEXa 1 7.00 118.6
F EXx 1 7.27 124.2
FEXa2 6.92 131.9
FEXm2 7.60 124.6
F EXx2 8.07 120.7
FEXa3 6.95 132.0
FEXa3' 6.92 131.9
FEXm3 6.69 119.6
FEXx3 I 6.79 104.1
a in ppm from the 600 MHz HSQC spectrum of the sample in D20 at 40°C.
Chemical
shifts are referenced to the methyl resonance of acetone set at 2.225 ppm for
' H and
31.07 ppm for'3C. The error is ~ 0.03 ppm for'H and ~ 0.3 for'3C chemical
shifts.
28
CA 02377427 2001-12-21
WO 01/00796 PCT/CA00/00777
Functional analysis of waaF homologue (HP1191 )
Complementation analysis was used to determine the function of the HP1191
from Helicobacter pylori strain 26695. The H. pylori HP1191 gene was amplified
by PCR (see Table 6 for primer sequences used) and cloned into pUC19 to
s obtain pHP1191. WaaF mutant strain S. typhimurium 3789 was electroporated
with this recombinant plasmid, and one of the resultant transformants selected
for
further study. SDS-PAGE was used to analyze LPS molecules produced by the
relevant S. typhimurium strains. The LPS of the wild type strain formed the
ladder like pattern indicative of the presence of the O antigen repeat unit
whereas
to the LPS of the S. typhimurium waaF mutant appeared as a single fast
migrating
band. The migration pattern of this mutant was not affected by the presence of
the plasmid vector. However, when the H. pylori gene HP1191 was present in
traps in strain 3789, this S. typhimurium mutant synthesized an LPS which
migrated in a pattern identical to that obtained with the LPS of the wild type
Is strain. This confirmed the activity of HP1191 to be involved in catalyzing
the
addition of a second heptose molecule onto the heptose linked directly to KDO
in
the core.
Construction of H, pylori mutants carrying a disrupted HP0826 gene
2o In order to determine the role of the HP0826 ORF in LPS biosynthesis, H.
pylori
mutants carrying a disrupted HP0826 gene were constructed by allelic exchange.
Briefly, the HP0826 ORF cloned in pUC19 was disrupted by using reverse
primers 5'TACAGATCGCTTCATTGAGTTCT3' and
5'CCAAGAGTTAGGCTATATCCGCTT3' in a PCR reaction and ligating a
2s kanamycin resistance cassette (or Km') to the gel purified product to make
plasmid pHP0826::kan. H, pylori strains 26695, NCTC11637, 0:3 and Sydney
strain (SS1 ) were transformed with plasmid pHP0826::kan DNA following the
procedure of Haas et al, Mol. Microbiol. 8:753-760 (1993). This construct
contains 515bp of homologous DNA upstream of the mutation and 464bp
3o downstream of the mutation. Following transformation, cells were plated on
blood
agar containing kanamycin (20 ~g/ml). Km' colonies were isolated and passaged
on the same medium. Individual colonies were selected and screened for the
presence of a double cross over mutation in the chromosome of the kan mutant.
29
CA 02377427 2001-12-21
WO 01/00796 PCT/CA00/00777
To assess the insertion site of the disrupted gene PCR analysis was used, with
chromosomal DNA from parent and mutant H. pylori strains as templates and the
primer pair 5'ACACTGGCATCATACAAT3' and
5'CCATGCGAAGTTTATGAGCT3' which are internal in the structural gene. This
s analysis demonstrated conclusively that the Km' cassette was inserted into
the
chromosomal copy of HP0826. The primer pair amplified the expected 212bp
fragment in the parent strain, but resulted in a 1.6kb fragment consistent
with
insertion of the 1.4kb Km' cassette. Plasmid vector sequences were not
detected
by Southern blotting and a single 1.7kb Hind III fragment corresponding to
io insertion of the kan cassette in the HP0826 ORF was present in chromosomal
DNA's of 26695::0826kan mutant and SS1::0826kan mutant but not in parental
DNA when probed with the kan cassette. These data confirm that the insertion
mutant was the result of a double cross-over event. Four kanamycin resistant
transformants were independently tested to verify that gene disruption and
gene
is replacement had occurred. All four mutants grew normally in vitro (as
assessed
by OD vs viable numbers) and produced a truncated LPS as assessed by
electrophoretic mobility on SDS-PAGE gels. The overall protein composition of
the total membrane fraction was unchanged in the knockout mutants of SS1 and
26695 as assessed by SDS-PAGE and Coomassie blue staining. The
2o contribution of polar effects to the phenotype of the HP0826 mutant is
highly
unlikely as a transcriptional terminator lies immediately downstream of the
HP0826 ORF, the transcriptional organization switches strands and the
downstream annoted ORF HP0827 is unrelated to LPS biosynthesis.
2s The construction of H. pylori mutants carrying disrupted HP0159 and HP0479
genes was carried out in essentially the same manner as above.
Genomic Organization and Allelic Variation of SS1
To ascertain if the structural organization found in 26695 and J99 is
conserved
3o within the SS1 genome, PCR amplification and sequencing of the HP0826
homologue and flanking sequence was obtained from SS1. As with 26695 and
J99, the upstream and downstream ORFs are conserved although variation in
the intervening sequence was evident. Allelic variation of SS1 HP0826 resulted
CA 02377427 2001-12-21
WO 01/00796 PCT/CA00/00777
in 31 base pair differences between SS1 and 26695 and 46 base pair
differences between SS1 and J99. These differences in DNA sequence results in
a total of 9 amino acid changes in the SS1 protein when compared with 26695
and J99 amino acid sequences. In both comparisons the variations were located
s predominately at the N and C terminal region of the protein.
SDS-PAGE analysis of H. pylori HP0826 mutants
To characterize the effect of the HP0826 mutation on LPS structure in H.
pylori,
proteinase K digested whole cell lysates from both parent and mutant cells
grown
to in broth were analyzed by SDS-PAGE. Silver staining revealed significant
differences in the electrophoretic mobility of LPS isolated from parent and
mutant
cells of each strain examined. LPS from strains 26695, SS1, 0:3 and
NCTC11637 appeared to have typical high molecular weight, smooth form LPS
(S-LPS), while the HP0826 mutant of each strain no longer produced the S-LPS,
is but appeared to produce a semi-rough type LPS. Immunoblotting with
monoclonal antibodies to Lewis X (Lex) and Lewis Y (Le'') antigens confirmed
that
the LPS from all mutants no longer displayed immunoreactive material of high
molecular weight typical of the corresponding parental O-chain which displays
Lewis antigens.
SDS-PAGE analysis of H. pylori HP0159, 0479 and 1191 mutants
To characterize the effect of the HP0159, 0479 and 1191 mutations on LPS
structure in H. pylori, proteinase K digested whole cell lysates from both
parent
and mutant cells grown in broth were analyzed by SDS-PAGE. Silver staining
2s revealed significant differences in the electrophoretic mobility of LPS
isolated
from parent and mutant cells of each strain examined. In all cases, LPS from
mutant cells no longer produced S-type LPS but instead only a fast migrating
rough type LPS was observed.
3o Structural investigations of H. pylori HP0826 LPS mutants of strains 26695,
SS1, and NCTC 11637
The LPS molecules of H. pylori strains 26695, SS1 ( M. A. Monteiro et al, Eur.
J.
Biochem. 267: 305-320 (2000) and type strain NCTC 11637 (Aspinall et al,
31
CA 02377427 2001-12-21
WO 01/00796 PCT/CA00/00777
supra) have been determined to carry O- chain regions that express Le" and Ley
blood-group determinants. These Lewis-mimicking O chains were shown to be
covalently connected to a core oligosaccharide. Sugar composition analysis
(Table 4) of the intact LPSs of H. pylori 26695::HP0826kan, SS1::HP0826kan
s and NCTC 11637::HP0826kan demonstrated a clear reduction in levels of those
sugars known to form the O chain components, namely L-Fuc, D-Gal and D-
GIcNAc, when compared to parent LPSs.
Table 4. Approximate molar ratios of the alditol acetate derivatives of 26695,
SS1 and
1o NCTC 11637 HP0826 isogenic mutants intact LPSs. Numbers in parentheses
indicate ratios obtained for respective parent strains. Analyses performed on
LPS prepared from broth grown cells.
Strain L-Fuc D-Glc D-Gal GIcNAc DD-Hep LD-Hep
15 26695::Hp0826kan 0.8 (6) 6 (7) 1 (10) 1 (8) 2 (2) 1.8 (1.6)
SS1::Hp0826kan 0.8 (6) 2 (2) 1 (10) 1 (8) 2 (2) 1.8 (1.6)
NCTC11637::Hp0826kan 0.8 (6) 6 (7) 1 (10) 1 (8) 2 (2) 1.8 (1.6)
2o Methylation linkage analysis performed on the intact H. pylori mutant LPSs
from
each strain showed the presence of terminal and 3-substituted Fuc, terminal, 3-
,
and 6-(except in SS1 strain) substituted Glc, terminal, 3- and 4-substituted
Gal, 2-
(only in 26695), 3-(only in 26695), 6-(only in 26695), 7- and 2,7-substituted
DD-
Hep, 2- and 3,7-substituted LD-Hep, and terminal and 3-substituted GIcNAc
2s units. All sugars were present in the pyranose conformation. In order to
obtain
sugar sequence information of the outer-extremities of the LPS molecule (O-
chain perimeter), a fast atom bombardment-mass spectrometry (FAB-MS)
experiment in the positive ion mode was carried out on the methylated intact
mutant LPSs from each strain. The FAB-MS spectra showed several A-type
3o primary glycosyl oxonium ions of defined composition. The trace amounts of
terminal GIcNAc that were observed in the linkage analyses were also detected
in each of the three mutant LPS FAB-MS spectra at m/z 260 [GIcNAc]+ (Fig. 2).
A-type primary glycosyl oxonium ions containing Lewis blood-group related Fuc
32
CA 02377427 2001-12-21
WO 01/00796 PCT/CA00/00777
and GIcNAc residues were observed at m/z 434 [Fuc, GIcNAc]+, 508 [GIcNAc,
Hep]+, and 682 [Fuc, GIcNAc, Hep]+. The ion m/z 434 stood for a disaccharide
composed of Fuc and GIcNAc and ion m/z 508 characterized a possible
connection between the O-chain related GIcNAc and a heptose from the core
s region. The ion m/z 682 [Fuc, GIcNAc, Hep]+ represented a moiety containing
GIcNAc and Fuc residues of the O-chain region and a single heptose unit from
the core region which bridges the O-chain and the core oligosaccharide. Since
no terminal Hep unit was detected, these m/z 508 and 682 ions must originate
from cleavage at the heptose glycosidic bond and represent a partial O-chain
io repeating unit [Fuc, GIcNAc, Hep]+. No 3,4-substituted GIcNAc, 2-
substituted Gal
and no m/z 638 (characteristic of Le") and 812 (characteristic of Le'')
glycosyl
oxonium ions were detected, and therefore no evidence of an O-chain containing
LeX or Le'' determinants was found in these analyses of 26695::HP0826kan,
SS1::HP0826kan and NCTC 11637::HP0826kan LPSs. In addition, higher mass
Is ions in the FAB-MS spectrum of NCTC11637::HP0826kan at m/z 886 [Fuc,
GIcNAc, Hep, Glc]+, 1090 [Fuc, GIcNAc, Hep, GIc2]+, and 1294 [Fuc, GIcNAc,
Hep, GIc3]+ (Fig. 2) represented the characteristic glucosylated by a [(1-6)-a-
glucan] heptose unit (Aspinall et al, supra) in strain NCTC 11637 and 26695
(Fig.
2). The same primary ions were also observed in the FAB-MS spectrum of the
2o methylated LPS of 26695::HP0826kan, but not of SS1::HP0826kan, in line with
the structural findings in the parent strains (M. A. Monteiro, unpublished).
In the
three FAB-MS spectra, the primary ion m/z 668 and its corresponding secondary
ion m/z 228 (Fig. 2) pointed to the presence of the type 1 linear B blood-
group
[Gal-(1-3)-Gal-(1-3)-GIcNAc] antigen, a blood-group determinant found in the
2s LPSs of 26695, SS1 (M. A. Monteiro, unpublished), and in NCTC 11637
(Monteiro et al, J. Biol. Chem. 273: 11533-11543 (1998)). The glycose units
emanating from the core oligosaccharide regions were of the same type as those
found in the respective parent LPSs. The GIcNAc and Fuc units observed were
remnants of an incomplete O chain. A comparison of the structures identified
in
3o parent and mutant LPS from 26695 and SS1 and the respective HP0826,0159
and 0479 isogenic mutants is presented in Fig 3.
33
CA 02377427 2001-12-21
WO 01/00796 PCT/CA00/00777
Structural characterization of H, pylori LPS mutants 26695::HP0159kan and
SS1:: HP0159kan
Growth of bacterial strains and isolation of LPS by hot aqueous phenol method
s were carried out as described previously (Logan et al, Mol. Microbiol. 35:
1156-
1167 (2000)). Sugar analysis of the intact LPS of H. pylori 26695:: HP0159kan,
SS1:: HP0159kan, 0:3:: HP0159kan showed significant reduction in L-Fuc, D-
Gal, and DD-Hep (for serotype 0:3 mutant) when compared with the parent LPS
indicating the presence of the structure devoid of O-chain and DD-heptan.
io Methylation analysis of the intact LPS from each strain showed the presence
of
terminal and 3-substituted L-Fuc, terminal and 4-substituted D-Glc, terminal,
S-
and 4-substituted D-Gal, terminal, 2-, 6-, 7- and 2,7-substituted DD-Hep,
terminal,
2- and 3-substituted LD-Hep and terminal, 3-substituted and 4-substituted D-
GIcNAc. All sugars were present in the pyranose form. In addition, methylation
Is analysis of LPS from 26695::HP0159kan and 0:3::HP0159kan revealed the
presence of 4-substituted D-Glc, no 6-substituted D-Glc was observed. NMR
analysis of a high molecular mass fraction, isolated by gel filtration
chromatography from a partially delipidated LPS (1.5% acetic acid, 1 h,
100°C)
from 26695:: HP0159kan by gel filtration chromatography, indicated it to
contain
20 ~-1,4-linked glucan, a contaminant produced by some strains of H. pylori
(Knirel
et al, Eur. J. Biochem. 266: 123-131 (2000)). In order to deduce the sequence
information on the outer extremities of the LPS molecule, permethylated intact
LPS from each strain was subjected to the fast-atom-bombardment mass
spectrometric analysis in the positive mode. A-type primary glycosyl oxonium
2s ions containing Lewis blood group related Fuc and GIcNAc residues were
observed at m/z 260 [GIcNAc]+ and m/z 682 [Fuc,GIcNAc, Hep]+. No higher mass
ions representing a glucosylated DD-heptose unit were detected. This evidence
together with the absence of 6-substituted glucose in methylation analysis
indicated this LPS mutant to be deficient in the biosynthesis of a(1-6~lucan
3o present in both 26695 and 0:3 parent strains. Absence of the 3.-substituted
glucose in methylation analysis of LPS from 26695::HP0159kan,
SS::HP0159kan, suggested that addition of a 1,3-linked glucopyranosyl residue
was also impaired by this mutation. In the three FAB-MS spectra, the primary
ion
m/z 668 and its corresponding secondary ion m/z 228 pointed to the presence of
34
CA 02377427 2001-12-21
WO 01/00796 PCT/CA00/00777
the type 1 linear B blood group [Gal(1-3)Gal(1-3)GIcNAc] antigen, a blood
group
antigen found in the LPS of 26695 and SS1 (Monteiro et al, Eur. J. Biochem.
267:305-320 (2000)). Other Lewis blood group-related secondary ions were
observed at m/z 228 (260-32) [GIcNAc] +, 402 (434-32) [Fuc,GIcNAc]+, 576 (608-
s 32) [Fuc (1-3)Fuc (1-4)GIcNAc]+ as previously described (Monteiro et al, J.
Biol.
Chem. 273: 11533-11543 (1998), Logan et al, Mol. Microbiol. 35: 1156-1167
(2000)).
LPS from 26695::HP0159kan was treated with 0.1 M sodium acetate buffer, pH
Io 4.2 (2 h, 100°C) and following the removal of lipid A by low speed
centrifugation,
subjected to the gel filtration chromatography on a Bio-Gel P-2 column,
followed
by capillary electrophoresis-electrospray mass spectrometry (CE-ESMS) as
described previously (Thibault and Richards, Meth. Mol. Biol. 145: 327-343
(2000)). The CE-ESMS spectrum of the delipidated LPS confirmed the presence
Is of a major glycoform produced by the 26695::HP0159 mutant LPS,
corresponding to FucGIcNAcHex2Hep4(PE)KDO (m/z 902, doubly protonated
ion). MS-MS of the doubly charged ion (m/z 902) (Fig. 4) afforded a singly
charged fragment at m/z 1601 consistent with the loss of GIcNAc (and its
anhydro form at m/z 1583) which subsequently lost Fuc and Hep residues to
2o afford a fragment ion at m/z 1262. A comparison of the structures
identified in
parent and HP0159 mutant LPS is presented in Fig. 3.
Structural characterization of H. pylori LPS mutants 26695::HP0479kan and
SS1::HP0479kan.
2s
Sugar analysis of the HP0479 LPS mutants indicated reduction in the amount of
L-Fuc, D-Gal and DD-Hep and methylation analysis confirmed this. Methylation
analysis of the intact LPS from each strain indicated absence of 3-substituted
and
6-substituted D-Glc, 3-substituted DD-Hep and 6-substituted DD-Hep (for
30 0:3::HP0479 and 26695::HP0479 LPS) and a significant decrease in 2-
substituted DD-Hep, suggesting deficiencies in the core biosynthesis.
FAB-MS analysis in the positive mode of the permethylated LPS from each strain
indicated the presence of primary glycosyl oxonium ions at m/z 260 [GIcNAc]+
3s
CA 02377427 2001-12-21
WO 01/00796 PCT/CA00/00777
and m/z 434 [Fuc,GIcNAc]+ and secondary glycosyl oxonium ions at m/z 228
(260-32) [GIcNAc]+ and m/z 402 (434-32) [Fuc,GIcNAc]+. This evidence together
with the absence of the primary glycosyl oxonium ion at mlz 682 [Fuc, GIcNAc,
Hep]+ suggested that the mutant LPS structure was lacking DD-Hep residue
s which bridges O-chain and the core oligosaccharide in the respective parent
LPS
(Monteiro et al, Eur. J. Biochem. 267: 305-320 (2000), Logan et al, Mol.
Microbiol. 35: 1168-1179 (2000)). LPS from SS1:: HP0479 and 26695 was
delipidated and desalted following gel filtration chromatography on a Bio-Gel
P-2
column. Fractions containing core oligosaccharide components were subjected to
to the mass spectrometric analysis using combined capillary zone
electrophoresis-
electrospray-mass spectrometry (CZE-ESMS) in the positive mode, followed by
MS/MS analysis of the most abundant oligosaccharide fragments. The product
ion spectrum showed two major singly charged fragment ions at m/z 1612 and
m/z 1246, containing an anhydro-KDO. The fragment ion at m/z 1612 could be
is assigned to the glycoform FucGIcNAcHex2Hep3(PE)KDO (Fig. 5), based on the
linkage and FAB-MS analyses data and recent structural studies (Monteiro et
al,
Eur. J. Biochem. 267: 305-320 (2000)). The MS/MS spectrum of m/z 1246 was
consistent with the core fragment Hex2Hep3(PE)KDO as confirmed by a
consecutive cleavage of glycosidic bonds yielding a direct sequence
assignment.
2o These structural assignments are consistent with the presence of 2,7-
substituted
DD-Hep, 7-substituted DD-Hep and 2-substituted DD-Hep in the methylation
analysis of LPS mutants 26695::HP0479kan, SS1::HP0479kan, 0:3::HP0479kan.
Absence of the first DD-Hep which serves as a link between the O-chain and the
core oligosaccharide and is glycosylated by 1,6-glucan, resulted in the loss
of O
2s chain and DD-heptan (for serotype 0:3). A comparison of the structures
identified
in parent and HP0479 mutant LPS is presented in Fig. 3.
Mouse Colonization Studies
The role of S-type LPS in gastric colonisation was investigated using the SS1
3o strain of H. pylori which others (Lee et al, Gastroenterology 112: 1386-
1397
(1997); Ferrero et al, Infect. Immun. 66: 1349-1355 (1998); Conlan et al, Can.
J.
Microbiol. 45:975-980 (1999)) have shown to be capable of colonising the
stomachs of mice, including the CD1 strain used in the present study. Both
36
CA 02377427 2001-12-21
WO 01/00796 PCT/CA00/00777
parental SS1 and SS1 HP0826 mutant which was obtained by natural
transformation were used to orogastrically inoculate mice. The parent SS1
cells
produce considerable amounts of S type LPS displaying Lewis Y epitopes while
cells in which HP0826 has been inactivated produce a faster migrating, rough
s type LPS molecule no longer displaying Lewis epitopes. To minimise the
likelihood that any observed differences in in vivo behaviour arose as a
result of
exogenous influences, care was taken to ensure that the mutant and parental
strains underwent equivalent in vitro manipulations before being gavaged into
mice. In an initial experiment, groups of mice were gavaged with either wild-
type
to or mutated H. pylori SS1. Representative mice from each group were killed 6
or
12 weeks later and the stomach burdens of H. pylori, and level of Helicobacter
specific circulating immunoglobulin G determined. By 6 weeks of infection,
5.65
+/- 0.26 Iog~oCFU (colony-forming units) of wild-type bacteria were recovered
from the stomachs of mice (n=4) challenged with this organism, whereas only
is 4.27+/- 0.26 Iog~oCFU of the mutant bacteria were recovered from the
stomachs
of mice gavaged with it. This 24-fold decreased recovery of mutant versus wild-
type H. pylori SS1 was statistically significant according to the Mann-Whitney
Rank Sum Test (p<0.05). Similarly, by 12 weeks there was a 10-fold difference
in numbers of wild-type (5.81+/-0.51 Iog~oCFU, n=5) and mutant (4.79+/-0.43
2o Iog~oCFU, n=5) bacteria recovered, and this too was statistically
significant
(p<0.05). PCR performed on digested stomach tissue confirmed the above
findings, indicating that the decreased recovery was not due to any innate
unculturability of the mutant bacteria. Likewise, by 12 weeks of infection
sera
from mice infected with wild-type SS1 all reacted by ELISA against a sonicate
of
2s H. pylori as coating antigen (average IgG titre = 1270+/-2166) whereas only
3/5
mice infected with mutant SS1 had seroconverted (mean IgG titre of
seropositives = 123+/-94). Additionally, when either parental or mutant LPS
was
used as the coating antigen in ELISA, only mice infected with the parental
strain
of H. pylori showed evidence of seroconversion.
To determine whether the colonisation differences observed in the
aforementioned experiment were due to an initial inability of the mutant
strain to
colonise or due to its subsequent elimination, a complementary experiment
37
CA 02377427 2001-12-21
WO 01/00796 PCT/CA00/00777
examined gastric colonization levels of parental and mutated H. pylori SS1 at
1
and 3 weeks post-challenge. By one-week post-challenge, 5.81+/-0.29 Iog~oCFU
(n=5) of wild-type bacteria, but only 3.94+/-0.33 Iog~oCFU (n=5) of the mutant
bacteria were recovered from the stomachs of the respectively infected mice.
This 74-fold difference was statistically significant (P< 0.05) and
convincingly
shows that H. pylori SS1 bacteria unable to produce S-type LPS are
significantly
impaired in their ability to initially colonise the murine stomach. In this
experiment,
approximately 17-fold more wild-type than mutant H. pylori (5.4+/-0.34 logo
CFU,
n=5 versus 4.18+/-0.14 Iog~oCFU, n=5) were recovered from the stomachs of
to relevant mice at three weeks of infection.
Results of mouse colonization experiments for the parent (SS1 ) strain of H.
pylori
and their mutant strains SS0826, SS0159 and SS0479 are summarized in Table
5.
Table 5. Mouse colonization data. Numbers in the table show levels of
colonization of
mice stomachs (as Iog,oCFU/stomach +/- standard deviation) after the indicated
number of weeks (WK) of infection. ND: not determined BDL: less than 500
bacteria
STRAIN WK 1 WK 3 WK 6 WK 12 WK 20
EXP SS1 5,81 +i_ 5.40 +i- 5.65 5.81 +i- ND
1 o.2s 0.34 +i- 0.51
o.2s
(n = 5) (n = 5) (n = (n = 5)
4)
SS0826 3.94 +i- 4.18 +i- 4.27 4.79 +i- ND
0.33 o.~~ +i- 0.43
o.2s
(n = 5) (n = 5) (n = (n = 5)
4)
EXP SS1 5.43 +i- ND ND 5.94 +i- 5.84
2 0.03 0.33 +i-
~.~o
(n = 4) (n = 5) (n =
5)
SS0159 3.37 +i- ND ND 3.09 +i- < 3.76
0.2o 0.42
(n = 4) (n = 5) (n =
5)
EXP SS1 4.76 +i- ND ND 5.02 +i- ND
3 0.93 ~.os
(n = 5) (n = 5)
SS0479 BDL ND ND BDL ND
(n = 5) ( n=5)
38
CA 02377427 2001-12-21
WO 01/00796 PCT/CA00/00777
Exp 1: Individual mice inoculated by gavage on D1, D3, D6 with 0.2m1 of
broth grown cells suspended in PBS at cell concentration of ~1 x
10'°/ml.
s Exp 2: Individual mice inoculated by gavage on D1 + D3 with 0.2m1 of
broth grown cells suspended in PBS at cell concentration of ~2 x
10'°/ml.
Exp 3: Individual mice inoculated by gavage on D1 and D3 with 0.2m1 of
to broth gown cells suspended in PBS at cell concentration of
4.7x10 °/m1 (D1 ) and 1 x107/ml (D3)
The above data show that all the mutants with disrupted genes have a reduced
is ability to colonize the murine stomach, as compared with the parent strain.
SS0479 strain (H. pylori strain SS1 having disrupted gene HP0479) is the least
capable of colonization.
2o EXPERIMENTAL
Bacterial strains and culture conditions
Helicobacter pylori strain 26695 (Tomb et al, supra) used for the initial
cloning
was obtained from R. A. Alm, Astra, Boston. H. pylori strain SS1 was obtained
Zs from A. Lee. H. pylori reference strain ATCC43504 and H. pylori serogroup
0:3
isolate were from J. Penner. PJ1 was a fresh clinical isolate of H. pylori.
Helicobacter strains were grown on at 37°C on antibiotic supplemented
(Lee et al,
supra) trypticase soy agar plates containing 7% horse blood (GSS agar) in a
microaerophilic environment for 48h (Kan 20 ~g/ml). For growth in liquid
culture,
3o antibiotic supplemented Brucella broth containing 5% fetal bovine serum,
was
inoculated with H. pylori cells harvested from 48h trypticase soy agar/horse
blood
plates and incubated for 36h in a Trigas (Nuaire, Plymouth, MN) incubator (85%
N2, 10%C02, 5%02) on a shaking platform. Escherichia coli strain DHSa was
used as host for plasmid cloning experiments and was grown on L-agar plates at
3s 37°C supplemented with ampicillin (50~gm1~') and/or kanamycin
(20~gm1-')
39
CA 02377427 2001-12-21
WO 01/00796 PCT/CA00/00777
~i-1,4-galactosyltransferase activity
Glycosyltransferase assays were performed essentially as described previously
(Gilbert et al., supra). Cells were scraped from a 3 day old plate culture of
H.
pylori, the cells were stored frozen at -20oC. Cell extracts were made by
mixing
s the cell pellet with 2 volumes of glass beads, and grinding with a ground
glass
pestle in the microcentrifuge tube. The paste was extracted twice with 50 ~I
of 50
mM MOPS-NaOH buffer pH 7Ø Reactions contained 0.5 mM FCHASE-
aminophenyl-~i-GIcNAc, 10 mM MnCl2, 0.5 mM UDP-Gal, 50 mM MOPS-NaOH
pH 7.0, and 10 p.1 of cell extract in a final volume of 20 p.1. For reactions
with the
io cell extracts of H. pylori the reactions were incubated 3-5 h at 37oC,
whereas
with the extracts containing the recombinant enzyme the reactions times were
30
- 60 min at 37oC. The TLC and CE analysis was performed as previously
described (Gilbert et al., supra). For TLC analysis 0.5 ~.I of the reaction
mixture
were spotted and developed and for CE analysis samples were diluted to an
Is FCHASE-aminophenyl-~-GIcNAc concentration of 10 ~M prior to analysis.
Recombinant DNA techniques and nucleotide sequence analysis
DNA sequencing of PCR products was performed using an Applied Biosystems
(model 370A) automated DNA sequencer using the manufacturers cycle
2o sequencing kit. All standard methods of DNA manipulation were performed
according to the protocols of Sambrook et al, Molecular Cloning: A Laboratory
Manual, 2"d edn. Cold Spring Harbor, New York: Cold Spring Harbor Laboratory
Press (1989). DNA probes for Southern blotting were labelled with DIG-11-dUTP
using DIG-High Prime (Boehringer Mannheim, Montreal, Canada) and detection
2s of hybridized probe with DIG Luminescent Detection Kit (Boehringer Mannheim
Montreal, Canada). Primers used for the PCR gene amplification and for mutant
constructs are shown in Table 6.
CA 02377427 2001-12-21
WO 01/00796 PCT/CA00/00777
Table 6. Primer sequences for PCR amplification of HP0826, HP0159, HP0479 and
HP1191 genes and for construction of respective mutant strains .
Primer Primer (5'-3' )sequence
io
20
HP0826-F1 cggatccGGTTTTTATAGCCATGATGC
HP0826-R1 cggatccAAGGCGGTTAAGTTTTGTTC
H P0826-mutt TACAGATCGCTTCATTGAGTTCT
HP0826-mutt CCAAGAGTTAGGCTATATCCGCTT
HP0159-F1 cgggatccTGTCAAATTCGCCTATAGCGT
HP0159-R1 cgggatccACCTATTTTAGGGAAACCGCT
HP0159-mutt GCCGGGTTTTTAGTCGTGAAT
HP0159-mutt AGGGAAAAGGCTTGACGAGG
H P0479-F 1 G CCTTTATCAAG CTAGAG
H P0479-R 1 CATAAATGTCCTAACAAGC
HP0479-mutF1 CAAAACCGCCAGGAGTTG
HP0479-mutR1 GGTTATGGGAATGAATTTGG
HP1191-F1 cgggatccCGGTCTTTAAACCCGCTCAACA
HP1191-R1 cgggatccCCGCTCTTCTCACGCCTTTAA
Site specific mutagenesis of HP0826
2s HP0826 clone of Helicobacter pylori strain 26695 was mutagenized in E. coli
by
ligation of the Km~ cassette described by Labigne et al (J. 8acteriol. 170:
1704-
1708 (1988)) to pUC19 containing the HP0826 gene. Deletion of a central 66bp
region of the gene was achieved by reverse PCR (Pwo polymerise, Boehringer
Mannheim) using the outward primers 5'TACAGATCGCTTCATTGAGTTCT3' and
30 5'CCAAGAGTTAGGCTATATCCGCTT3' followed by blunt end ligation with the
Km~ cassette. The mutated allele was returned to Helicobacter by natural
transformation according to the method of Haas et al (supra).
Electrophoresis and Western blotting
3s SDS-PAGE was performed with a mini-slab gel apparatus (Biorad) by the
method
of Laemmli (Nature 227: 680-685 (1970)). LPS samples were prepared from
whole cells according to a previously described method (Logan et al, Infect.
Immun. 45: 210-216 (1984)), equivalent amounts loaded in each lane and
stained according to Tsai et al (Anal. Biochem. 119: 115-119 (1982)) or
ao transferred to nitrocellulose for immunological detection as previously
described
41
CA 02377427 2001-12-21
WO 01/00796 PCT/CA00/00777
(Logan et al, supra). Anti Lewis monoclonal antibodies (Signet Laboratories
Inc,
Dedham, MA) were used at 1:500 dilution.
Isolation of membrane fraction
s Broth grown cells (18h) were harvested and resuspended in 20mM Tris (pH
7.4).
Following sonication (3x60sec) intact cells were removed by centrifugation at
4000xg, and membranes sedimented by centrifugation at 40,OOOxg, washed in
20mM Tris (pH7.4) recentrifuged, and resuspended in 0.5m1 20mM Tris (pH7.4).
Equivalent amounts of SS1, 26695 parent and mutant strains were analyzed by
to SDS-PAGE and stained by Coomassie Blue.
Isolation of Lipopolysaccharides
The LPSs were isolated by the hot phenol-water extraction procedure (Westphal
et al, Meth. Carbohydr. Chem. 5: 83-91 (1965)). The LPSs were purified by gel-
ls permeation-chromatography on a column of Bio-Gel P-2 (1 m x 1 cm) with
water
as eluent. In all cases, only one carbohydrate positive fraction was obtained
which eluted in the high M~ range (Dubois et al, Anal. Chem. 28: 350-356
(1956)).
These intact H. pylori LPSs then were used for chemical analyses.
2o Sugar Composition and Methylation Linkage Analyses
Sugar composition analysis was performed by the alditol acetate method
(Sawardeker et al, Anal. Chem. 39:1602-1604 (1967)). The hydrolysis was done
in 4M trifluoroacetic acid at 100°C for 4h or 2M trifluoroacetic acid
at 100°C for
16h followed by reduction in H20 with NaBD4, and subsequent acetylation with
2s acetic anhydride and with residual sodium acetate as the catalyst. Alditol
acetate
derivatives were analyzed by gas-liquid-chromatography mass-spectrometry
(GLC-MS) using a Hewlett-Packard chromatograph equipped with a 30 m DB-17
capillary column [210°C (30 min) to 240°C at 2°C/min] and
MS in the electron
impact (El) mode was recorded using a Varian Saturn II mass spectrometer.
3o Methylation linkage analysis was carried out by the NaOH/DMSO/CH31
procedure
(Ciucanu et al, Carbohydr. Res. 131: 209-217 (1984)) and with characterization
of permethylated alditol acetate derivatives by GLC-MS in the EI mode (DB-17
column, isothermally at 190°C for 60 min).
42
CA 02377427 2001-12-21
WO 01/00796 PCT/CA00/00777
Fast Atom Bombardment-Mass Spectrometry (FAB-MS)
A fraction of the methylated sample was used for positive ion fast atom
bombardment-mass spectrometry (FAB-MS) which was performed on a Jeol
s JMS-AX505H mass spectrometer with glycerol(1 ) : thioglycerol(3) as the
matrix.
A 6 kV Xenon beam was used to produce pseudo molecular ions which were
then accelerated to 3kV and their mass analyzed. Product ion scan (B/E) and
precursor ion scan (B2/E) were preformed on metastable ions created in the
first
free field with a source pressure of 5x10-5 torr. The interpretations of
positive ion
Io mass spectra of the permethylated LPS derivatives were as previously
described
by Dell et al (Carbohydr. Res. 200: 59-67 (1990).
Electrospray mass spectrometry
Samples were analyzed on a crystal Model 310 CE instrument (ATI Unicam,
is Boston, MA, USA) coupled to an API 3000 mass spectrometer (Perkin
Elmer/Sciex, Concord, Canada) via a microlonspray interface. A sheath solution
(isopropanol-methanol, 2:1 ) was delivered at a flow rate of 1 ~L/min to a low
dead
volume tee (250 pm i.d., Chromatographic Specialties, Brockville, Canada). All
aqueous solutions were filtered through a 0.45-p,m filter (Millipore, Bedford,
MA,
2o USA) before use. An electrospray stainless steel needle (27 gauge) was
butted
against the low dead volume tee and enabled the delivery of the sheath
solution
to the end of the capillary column. The separation were obtained on about 90
cm
length bare fused-silica capillary using 10 mM ammonium acetate/ammonium
hydroxide in deionized waster, pH 9.0, containing 5% methanol. A voltage of 25
2s kV was typically applied at the injection. The outlet of the capillary was
tapered to
ca. 15 ~m i.d. using a laser pulley (Suffer Instruments, Novato, CA, USA).
Mass
spectra were acquired with dwell times of 3.0 ms per step of 1 m/z unit in
full-
mass-scan mode. For CZE-ES-MS/MS experiments, about 30 nL sample was
introduced using 300 mbar for 0.1 min. The MS/MS data were acquired with dwell
3o times of 1.0 ms per step of 1 m/z unit. Fragment ions formed by collision
activation of selected precursor ions with nitrogen in the RF-only quadrupole
collision cell, were mass-analyzed by scanning the third quadrupole. Collision
energies were typically 60 eV (laboratory frame of reference).
43
CA 02377427 2001-12-21
WO 01/00796 PCT/CA00/00777
Mouse Colonization
Specific Pathogen free Female CD1 mice were purchased from Charles Rivers
Laboratories, Montreal when they were 6-8 weeks old. Mice were maintained
s and used in accordance with the recommendations of the Canadian Council on
Animal Care, Guide to the Care and Use of Experimental Animals (1993). Mice
were inoculated with bacteria harvested from 36h broth culture. Aliquots of
0.2
ml, containing approximately 10$ bacteria resuspended in PBS were given by
gavage directly into the gastric lumen using a 20g gavage needle. Three
inocula
to were given over a period of 6 days. No attempt was made to neutralize
gastric
acidity prior to inoculation. To recover viable bacteria from the stomach,
mice
were killed by C02 asphyxiation, and their stomachs removed whole. Stomachs
were cut open along the greater curvature, and the exposed lumenal surface was
gently irrigated with 10 ml of sterile PBS, delivered via a syringe fitted
with a 20g
is gavage needle, to dislodge the loosely adherent stomach contents. This step
effectively diminished the small numbers of ubiquitous contaminating bacteria
that otherwise overgrow on GSS agar to thereby mask the presence of the slower
growing H. pylori organisms. The washed stomach tissue was then
homogenised, and serial dilutions plated on GSS agar. H. pylori colonies were
2o counted following 3-6 days incubation.
Detection of H. pylori specific antibodies by ELISA
Sera for antibody determinations were prepared from clotted blood obtained
from
a lateral tail vein during the course of an experiment or by cardiac puncture
at the
2s time of necropsy. Sera were screened for the presence of specific IgG
isotype
anti- H. pylori antibodies by ELISA essentially by the method of Engvall et al
(J.
lmmunol. 109: 129-135 (1972)). Briefly, microtitre plates (Dynatech Immunolon
II) were coated with 100 p,1 antigen (50 ~g protein/ml in 0.05M carbonate
buffer
pH 9.8) and incubated overnight at 4°C. Antigen was prepared by
resuspending
3o plate grown H. pylori in PBS and sonicating the suspension until a
translucent
solution was obtained. The sonicate was membrane fitter sterilized through a
0.45 ~m filter. The protein content of the filtrate was determined by Lowry
assay
using a commercial kit. Sodium azide was added to 0.05% w/v and the antigen
44
CA 02377427 2001-12-21
WO 01/00796 PCT/CA00/00777
solution was stored at 4°C. When LPS was used as the coating antigen
the
concentration was 10ug/ml. Sera were screened at a starting dilution of 1/40
and
were titrated through a two-fold dilution series down a column of 8 wells. The
developing antibody was goat-anti-mouse IgG conjugated to alkaline
s phosphatase (Caltag Laboratories). Titres were determined from plots of
absorbance at 410 nm versus dilution and were defined as the reciprocal of the
dilution giving an A4,o equivalent to 0.25. Standard negative and positive
control
sera identified by a preliminary ELISA of candidate samples were included on
each plate. Titres were analysed statistically by Mann Whitney Rank Sum Test
io and were considered to be significantly different to comparative samples
when p
values <0.05 were obtained.
Although various particular embodiments of the present invention have been
described hereinbefore for purposes of illustration, it would be apparent to
those
is skilled in the art that numerous variations may be made thereto without
departing
from the spirit and scope of the invention, as defined in the appended claims.
CA 02377427 2001-12-21
WO 01/00796 PCT/CA00/00777
SEQUENCE LISTING
<110> National Research Council of Canada
Logan, Susan M.
Wakarchuk, Warren
Conlan, W.
Monteiro, Mario A.
Altman, Eleonora
Hiratsuka, Koji
<120> Glycosyltransferases of Helicobacter pylori as a new
target in prevention and treatment of H. pylori
infections
<130> 11041-98
<140>
<141>
<150> 60/140,820
<151> 1999-06-28
<160> 16
<170> PatentIn Ver. 2.1
<210> 1
<211> 822
<212> DNA
<213> Helicobacter pylori
<400> 1
ttgcgtgttt ttgccatttc tttaaatcaa aaagtgtgcg atacatttgg tttagttttt 60
agagacacca caactttact caatagcatc aatgccaccc accaccaagc gcaaattttt 120
gatgcgattt attctaaaac ttttgaaggc gggttgcacc ccttagtgaa aaagcattta 180
cacccttatt tcatcacgca aaacatcaaa gacatgggga ttacaaccaa tctcatcagt 240
gaggtttcta agttttatta cgctttaaaa taccatgcga agtttatgag cttgggggag 300
cttgggtgct atgcgagtca ttattccttg tgggaaaaat gcatagaact caatgaagcg 360
atctgtattt tagaagacga tataaccttg aaagaggatt ttaaagaggg cttggatttt 420
ttagaaaaac acatccaaga gttaggctat atccgcttga tgcatttatt gtatgatgcc 480
agtgtaaaaa gtgagccatt gagccataaa aaccacgaga tacaagagcg tgtggggatc 540
attaaagctt atagcgaagg ggtggggact caaggctatg tgatcacgcc taagattgcc 600
aaagtttttt tgaaatgcag ccgaaaatgg gttgttcctg tggatacgat aatggacgct 660
acttttatcc atggcgtgaa aaatctggtg ttacaacctt ttgtgatcgc tgatgatgag 720
caaatctcta cgatagcacg aaaagaagaa ccttatagcc ctaaaatcgc cttaatgaga 780
gaactccatt ttaaatattt gaaatattgg cagtttgtat as 822
<210> 2
<211> 273
<212> PRT
<213> Helicobacter pylori
<400> 2
Leu Arg Val Phe Ala Ile Ser Leu Asn Gln Lys Val Cys Asp Thr Phe
1 5 10 15
Gly Leu Val Phe Arg Asp Thr Thr Thr Leu Leu Asn Ser Tie Asn Ala
20 25 30
1/13
SUBSTITUTE SHEET (RULE 26)
CA 02377427 2001-12-21
WO 01/00796 PCT/CA00/00777
Thr His His Gln Ala Gln Ile Phe Asp Ala I'_e Tyr Ser Lys Thr Phe
35 40 45
Glu Gly Gly Leu His Pro Leu Val Lys Lys His Leu His Pro Tyr Phe
50 55 60
Ile Thr Gln Asn Ile Lys Asp Met Gly Ile Thr Thr Asn Leu Ile Ser
65 70 75 80
Glu Val Ser Lys Phe Tyr Tyr Ala Leu Lys Tyr His Ala Lys Phe Met
85 90 95
Ser Leu Gly Glu Leu Gly Cys Tyr Ala Ser His Tyr Ser Leu Trp Glu
100 105 110
Lys Cys Ile Glu Leu Asn Glu Ala Ile Cys Ile Leu Glu Asp Asp Ile
115 120 125
Thr Leu Lys Glu Asp Phe Lys Glu Gly Leu Asp Phe Leu Glu Lys His
130 135 140
Ile Gln Glu Leu Gly Tyr Ile Arg Leu Met His Leu Leu Tyr Asp Ala
145 150 155 160
Ser Val Lys Ser Glu Pro Leu Ser His Lys Asn His Glu Ile Gln Glu
165 170 175
Arg Val Gly Ile Ile Lys Ala Tyr Ser Glu Gly Val Gly Thr Gln Gly
180 185 190
Tyr Val Ile Thr Pro Lys Ile Ala Lys Val Phe Leu Lys Cys Ser Arg
195 200 205
Lys Trp Val Val Pro Val Asp Thr Ile Met Asp Ala Thr Phe Ile His
210 215 220
Gly Val Lys Asn Leu Val Leu Gln Pro Phe Val Ile Ala Asp Asp Glu
225 230 235 240
Gln Ile Ser Thr Ile Ala Arg Lys Glu Glu Pro Tyr Ser Pro Lys Ile
245 250 255
Ala Leu Met Arg Glu Leu His Phe Lys Tyr Leu Lys Tyr Trp Gln Phe
260 265 270
Val
<210> 3
<211> 1119
<212> DNA
<213> Helicobacter pylori
<400> 3
atgagtatta ttattcctat tgtcatcgct tttgataatc actatgccat gccggctggc 60
gtgagcttgt attccatgct agcttgcgct aaaacagaac acccccaatc acaaaatgat 120
agtgaaaaac ttttttataa gatccactgc ctggtggata acttaagcct tgaaaaccag 180
agcaaactaa aagagactct agcccccttt agcgcttttt cgagcctaga atttttagac 240
atttcaaccc ccaatcttca cgccactcca atagaaccct ctgcgattga taaaatcaat 300
gaagcttttt tgcaactcaa tatttacgct aagactcgct tttctaaaat ggtcatgtgc 360
2/13
SUBSTITUTE SHEET (RULE 26)
CA 02377427 2001-12-21
WO 01/00796 PCT/CA00/00777
cgcttgtttt tggcttcttt attcccacaa tacgacaaaa tcatcatgtt tgatgcagac 420
actttgtttt taaacgatgt gagcgagagc tttttcatcc cactagatgg ctattatttt 480
ggagcggcta aagattttgc ttccgataaa agccctaaac attttcaaat agtgcgagaa 540
aaagaccctc gtcaagcctt ttccctttat gagcattacc ttaatgaaag cgatatgcaa 600
atcatctatg aaagcaatta taacgccggg tttttagtcg tgaatttaaa gctgtggcgt 660
gctgatcatt tagaagagcg cttactcaat ttaacccatc aaaaaggcca gtgcgtgttt 720
taccctgaac aggacctttt aacgctcgca tgctatcaaa aagttttaat cttgccttat 780
atttataaca cccacccttt catggccaat caaaaacgct tcatccctga caaaaaagaa 840
atcgtcatgc tgcattttta ttttgtagga aaaccttggg ttttacctac tttttcatat 900
tctaaagaat ggcatgagac tcttttaaaa accccttttt atgctgaata ttccgtgaaa 960
ttccttaaac aaatgacaga atgtttaagc cttaaagaca aacaaaaaac ctttgaattt
1020
cttgcccccc tactcaataa aaaaaccctt ttagaatacg tcttttttag attgaatagg
1080
attttcaaac gcttaaaaga aaaatttttt aactcttag
1119
<210> 4
<211> 372
<212> PRT
<213> Helicobacter pylori
<400> 4
Met Ser Ile Ile Ile Pro Ile Val Ile Ala Phe Asp Asn His Tyr Ala
1 5 10 15
Met Pro Ala Gly Val Ser Leu Tyr Ser Met Leu Ala Cys Ala Lys Thr
20 25 30
Glu His Pro Gln Ser Gln Asn Asp Ser Glu Lys Leu Phe Tyr Lys Ile
35 40 45
His Cys Leu Val Asp Asn Leu Ser Leu Glu Asn Gln Ser Lys Leu Lys
50 55 60
Glu Thr Leu Ala Pro Phe Ser Ala Phe Ser Ser Leu Glu Phe Leu Asp
65 70 75 80
Ile Ser Thr Pro Asn Leu His Ala Thr Pro Iie Glu Pro Ser Ala Ile
85 90 95
Asp Lys Ile Asn Glu Ala Phe Leu Gln Leu Asn Ile Tyr Ala Lys Thr
100 105 110
Arg Phe Ser Lys Met Val Met Cys Arg Leu Phe Leu Ala Ser Leu Phe
115 120 125
Pro Gln Tyr Asp Lys Ile Ile Met Phe Asp Ala Asp Thr Leu Phe Leu
130 135 140
Asn Asp Val Ser Glu Ser Phe Phe Ile Pro Leu Asp Gly Tyr Tyr Phe
145 150 155 160
Gly Ala Ala Lys Asp Phe Ala Ser Asp Lys Ser Pro Lys His Phe Gln
165 170 175
Ile Val Arg Glu Lys Asp Pro Arg Gln Ala Phe Ser Leu Tyr Glu His
180 185 190
Tyr Leu Asn Glu Ser Asp Met Gln Ile Ile Tyr Glu Ser :=_sn T:rr Asn
3/13
SUBSTTTUTE SHEET (RULE 26)
CA 02377427 2001-12-21
WO 01/00796 PCT/CA00/00777
195 200 205
Ala Gly Phe Leu Val Val Asn Leu Lys Leu Trp Arg Ala Asp His Leu
210 215 220
Glu Glu Arg Leu Leu Asn Leu Thr His Gln Lys Gly Gln Cys Val Phe
225 230 235 240
Tyr Pro Glu Gln Asp Leu Leu Thr Leu Ala Cys Tyr Gln Lys Val Leu
245 250 255
Ile Leu Pro Tyr Ile Tyr Asn Thr His Pro Phe Met Ala Asn Gln Lys
260 265 270
Arg Phe Ile Pro Asp Lys Lys Glu Ile Val Met Leu His Phe Tyr Phe
275 280 285
Val Gly Lys Pro Trp Val Leu Pro Thr Phe Ser Tyr Ser Lys Glu Trp
290 295 300
His Glu Thr Leu Leu Lys Thr Pro Phe Tyr Ala Glu Tyr Ser Val Lys
305 310 315 320
Phe Leu Lys Gln Met Thr Glu Cys Leu Ser Leu Lys Asp Lys Gln Lys
325 330 335
Thr Phe Glu Phe Leu Ala Pro Leu Leu Asn Lys Lys Thr Leu Leu Glu
340 345 350
Tyr Val Phe Phe Arg Leu Asn Arg Ile Phe Lys Arg Leu Lys Glu Lys
355 360 365
Phe Phe Asn Ser
370
<210> 5
<211> 849
<212> DNA
<213> Helicobacter pylori
<400> 5
atgcatgttg cttgtctttt ggctttaggg gataatctca tcacgcttag ccttttaaaa 60
gaaatcgctt tcaaacagca acaacccctt aaaatcctag gtactcgttt gactttaaaa 120
atcgccaagc ttttagaatg cgaaaaacat tttgaaatca ttcctctttt tgaaaatgtc 180
cctgcttttt atgaccttaa aaaacaaggc gtttttttgg cgatgaagga ttttttatgg 240
ttgttaaaag cgattaaaaa gcatcaaatc aaacgtttga ttttggaaaa acaggatttt 300
agaagcactt ttttagccaa attcattccc ataaccactc caaataaaga aattaaaaac 360
gtttatcaaa accgccagga gttgttttct caaatttatg ggcatgtttt tgataacccc 420
ccatatccca tgaatttaaa aaaccccaaa aagattttga tcaacccttt cacaagatcc 480
atagaccgaa gtatcccttt agagcattta caaatcgttt taaaactttt aaaacccttt 540
tgtgttacgc ttttagattt tgaagaacga tacgcttttt taaaagacag agtcgctcat 600
tatcgcgcta aaaccagttt agaagaagtt aaaaacctga ttttagaaag cgatttgtat 660
ataggagggg attcgttttt gatccatttg gcttactatt taaagaaaaa ttattttatc 720
tttttttata gggataatga tgatttcatg ccgcctaata gtaagaataa aaattttcta 780
aaagcccaca aaagccattc tatagaacaa gatttagcca aaaaattccg ccatttgggg 840
ctattataa 849
<210> 6
<211> 282
4/ 13
SUBSTITUTE SHEET (RULE 26)
CA 02377427 2001-12-21
WO 01/00796 PCT/CA00/00777
<212> PRT
<213> Helicobacter pylori
<400> 6
Met His Val Ala Cys Leu Leu Ala Leu Gly Asp Asn Leu Ile Thr Leu
1 5 10 15
Ser Leu Leu Lys Glu Ile Ala Phe Lys Gln Gln Gln Pro Leu Lys Ile
20 25 30
Leu Gly Thr Arg Leu Thr Leu Lys Ile Ala Lys Leu Leu Glu Cys Glu
35 40 45
Lys His Phe Glu Ile Ile Pro Leu Phe Glu Asn Val Pro Ala Phe Tyr
50 55 60
Asp Leu Lys Lys Gln Gly Val Phe Leu Ala Met Lys Asp Phe Leu Trp
65 70 75 80
Leu Leu Lys Ala Ile Lys Lys His Gln Ile Lys Arg Leu Ile Leu Glu
85 90 95
Lys Gln Asp Phe Arg Ser Thr Phe Leu Ala Lys Phe Ile Pro Ile Thr
100 105 110
Thr Pro Asn Lys Glu Ile Lys Asn Val Tyr Gln Asn Arg Gln Glu Leu
115 120 125
Phe Ser Gln Ile Tyr Gly His Val Phe Asp Asn Pro Pro Tyr Pro Met
130 135 140
Asn Leu Lys Asn Pro Lys Lys Ile Leu Ile Asn Pro Phe Thr Arg Ser
145 150 155 160
Ile Asp Arg Ser Ile Pro Leu Glu His Leu Gln Ile Val Leu Lys Leu
165 170 175
Leu Lys Pro Phe Cys Val Thr Leu Leu Asp Phe Glu Glu Arg Tyr Ala
180 185 190
Phe Leu Lys Asp Arg Val Ala His Tyr Arg Ala Lys Thr Ser Leu Glu
195 200 205
Glu Val Lys Asn Leu Ile Leu Glu Ser Asp Leu Tyr Ile Gly Gly Asp
210 215 220
Ser Phe Leu Ile His Leu Ala Tyr Tyr Leu Lys Lys Asn Tyr Phe Ile
225 230 235 240
Phe Phe Tyr Arg Asp Asn Asp Asp Phe Met Pro Pro Asn Ser Lys Asn
245 250 255
Lys Asn Phe Leu Lys Ala His Lys Ser His Ser Ile Glu Gln Asp Leu
260 265 270
5/13
SUBSTITUTE SHEET (RULE 26)
CA 02377427 2001-12-21
WO 01/00796 PCT/CA00/00777
Ala Lys Lys Phe Arg His Leu Gly Leu Leu
275 280
<210> 7
<211> 1050
<212> DNA
<213> Helicobacter pylori
<400> 7
atgagcgtaa atgcacccaa acgcatgcgt attttattgc gtttgcctaa ttggttaggc 60
gatggggtga tggcaagttc gcttttttac acccttaaac accactaccc taacgcgcat 120
tttatcttag tgggcccaac cattacttgc gaacttttca aaaaagatga aaaaatagaa 180
gccgttttta tagacaacac caaaaaatcc tttttcaggc tgctagccat tcacaaactc 240
gctcaaaaaa tagggcgttg cgatatagcg atcactttaa acaaccattt ctattccgct 300
tttttgctct atgcgacaaa aacgcccgtt cgcatcggtt ttgctcaatt ttttcgttct 360
ttgtttctca gccatgcgat cgctcctgcc cctaaagagt atcaccaagt ggaaaagtat 420
tgctttttat tttcgcaatt tttagaaaaa gaattggatc aaaaaagcgt tttaccctta 480
aaactggcct ttaacctccc cactcacacc ccaaacaccc ctaaaaaaat cggctttaac 540
cctagcgcaa gctatgggag tgctaaaaga tggccagctt cttattacgc tgaagtttct 600
gctgttttgt tagaaaaagg gcatgaaatt tatttttttg gggctaaaga agacgctatc 660
gtttctgaag aaattttaaa actcatcaaa ggctcattaa aaaacccctc attgttccat 720
aacgcttaca atctgtgcgg gaaaacaagc attgaagaat tgatagagcg catcgctgtt 780
ttagatttat tcatcactaa cgatagcggc cctatgcatg tggctgctag catgcaaacc 840
cccttaatcg ctctttttgg ccccactgat gaaaaagaga ctcgccccta taaagctcaa 900
aaaacgatcg tattgaacca ccatttaagc tgtgcgcctt gcaagaaacg agtttgccct 960
ttaaagaatg caaaaaacca tttgtgcatg aaatctatca cgccccttga agtcctagaa
1020
gccgctcaca ctcttttaga agagccttaa
1050
<210> 8
<211> 349
<212> PRT
<213> Helicobacter pylori
<400> 8
Met Ser Val Asn Ala Pro Lys Arg Met Arg Ile Leu Leu Arg Leu Pro
1 5 10 15
Asn Trp Leu Gly Asp Gly Val Met Ala Ser Ser Leu Phe Tyr Thr Leu
20 25 30
Lys His His Tyr Pro Asn Ala His Phe Ile Leu Val Gly Pro Thr Ile
35 40 45
Thr Cys Glu Leu Phe Lys Lys Asp Glu Lys Ile Glu Ala Val Phe Ile
50 55 60
Asp Asn Thr Lys Lys Ser Phe Phe Arg Leu Leu Ala Ile His Lys Leu
65 70 75 80
Ala Gln Lys Ile Gly Arg Cys Asp Ile Ala Ile Thr Leu Asn Asn His
85 90 95
Phe Tyr Ser Ala Phe Leu Leu Tyr Ala Thr Lys Thr Pro Val Arg Ile
100 105 110
6/13
SUBSTITUTE SHEET (RULE 26)
CA 02377427 2001-12-21
WO 01/00796 PCT/CA00/00777
Gly Phe Ala Gln Phe Phe Arg Ser Leu Phe Leu Ser His Ala Ile Ala
115 120 125
Pro Ala Pro Lys Glu Tyr His Gln Val Glu Lys Tyr Cys Phe Leu Phe
130 135 140
Ser Gln Phe Leu Glu Lys Glu Leu Asp Gln Lys Ser Val Leu Pro Leu
145 150 155 160
Lys Leu Ala Phe Asn Leu Pro Thr His Thr Pro Asn Thr Pro Lys Lys
165 170 175
Ile Gly Phe Asn Pro Ser Ala Ser Tyr Gly Ser Ala Lys Arg Trp Pro
180 185 190
Ala Ser Tyr Tyr Ala Glu Val Ser Ala Val Leu Leu Glu Lys Gly His
195 200 205
Glu Ile Tyr Phe Phe Gly Ala Lys Glu Asp Ala Ile Val Ser Glu Glu
210 215 220
Ile Leu Lys Leu Ile Lys Gly Ser Leu Lys Asn Pro Ser Leu Phe His
225 230 235 240
Asn Ala Tyr Asn Leu Cys Gly Lys Thr Ser Ile Glu Glu Leu Ile Glu
245 250 255
Arg Ile Ala Val Leu Asp Leu Phe Ile Thr Asn Asp Ser Gly Pro Met
260 265 270
His Val Ala Ala Ser Met Gln Thr Pro Leu Ile Ala Leu Phe Gly Pro
275 280 285
Thr Asp Glu Lys Glu Thr Arg Pro Tyr Lys Ala Gln Lys Thr Ile Val
290 295 300
Leu Asn His His Leu Ser Cys Ala Pro Cys Lys Lys Arg Val Cys Pro
305 310 315 320
Leu Lys Asn Ala Lys Asn His Leu Cys Met Lys Ser Ile Thr Pro Leu
325 330 335
Glu Val Leu Glu Ala Ala His Thr Leu Leu Glu Glu Pro
340 345
<210> 9
<211> 822
<212> DNA
<213> Helicobacter pylori
<400> 9
ttgcgtattt ttatcatttc tttaaatcaa aaagtgtgcg ataaatttgg tttggttttt 60
agagacacca cgactttact caatagcatc aatgccaccc accaccaagt gcaaattttt 120
gatgcgattt attctaaaac ttttgaaggc gggttgcacc ccttagtgaa aaagcattta 180
cacccttatt tcatcacgca aaacatcaaa gacatgggaa ttacaaccag tctcatcagt 240
gaggtttcta agttttatta cgctttaaaa taccatgcga agtttatgag cttgggagag 300
cttgggtgct atgcgagcca ttattccttg tgggaaaaat gcatagaact caatgaagcg 360
atctgtattt tagaagacga tataaccttg aaagaggatt ttaaagaggg cttggatttt 420
ttagaaaaac acatccaaga gttaggctat gttcgcttga tgcatttatt atatgatccc 480
aatattaaaa gtgagccatt gaaccataaa aaccacgaga tacaagagcg tgtagggatt 540
7/13
SUBSTITUTE SHEET (RULE 26)
CA 02377427 2001-12-21
WO 01/00796 PCT/CA00/00777
attaaagctt atagcgaagg ggtggggact caaggctatg tgatcacgcc caagattgcc 600
aaagttttta aaaaacacag ccgaaaatgg gttgttcctg tggatacgat aatggacgct 660
acttttatcc atggcgtgaa aaatctggtg ttacaacctt ttgtgatcgc tgatgatgag 720
caaatctcta cgatagcgcg aaaagaacaa ccttatagcc ctaaaatcgc cttaatgaga 780
gaactccatt ttaaatattt gaaatattgg cagtttatat ag 822
<210> 10
<211> 273
<212> PRT
<213> Helicobacter pylori
<400> 10
Leu Arg Ile Phe Ile Ile Ser Leu Asn Gln Lys Val Cys Asp Lys Phe
1 5 10 15
Gly Leu Val Phe Arg Asp Thr Thr Thr Leu Leu Asn Ser Ile Asn Ala
20 25 30
Thr His His Gln Val Gln Ile Phe Asp Ala Ile Tyr Ser Lys Thr Phe
35 40 45
Glu Gly Gly Leu His Pro Leu Val Lys Lys His Leu His Pro Tyr Phe
50 55 60
Ile Thr Gln Asn Ile Lys Asp Met Gly Ile Thr Thr Ser Leu Ile Ser
65 70 75 80
Glu Val Ser Lys Phe Tyr Tyr Ala Leu Lys Tyr His Ala Lys Phe Met
85 90 95
Ser Leu Gly Glu Leu Gly Cys Tyr Ala Ser His Tyr Ser Leu Trp Glu
100 105 110
Lys Cys Ile Glu Leu Asn Glu Ala Ile Cys Ile Leu Glu Asp Asp Ile
115 120 125
Thr Leu Lys Glu Asp Phe Lys Glu Gly Leu Asp Phe Leu Glu Lys His
130 135 140
Ile Gln Glu Leu Gly Ty~r Val Arg Leu Met His Leu Leu '~~r Asp Pro
145 150 155 160
Asn Ile Lys Ser Glu Pro Leu Asn His Lys Asn His Glu Ile Gln Glu
165 170 175
Arg Val Gly Ile Ile Lys Ala Tyr Ser Glu Gly Val Gly Thr Gln Gly
180 185 190
Tyr Val Ile Thr Pro Lys Ile Ala Lys Val Phe Lys Lys His Ser Arg
195 200 205
Lys Trp Val Val Pro Val Asp Thr Ile Met Asp Ala Thr Phe Ile His
210 215 220
Gly Val Lys Asn Leu Val Leu Gln Pro Phe Val Ile Ala Asp Asp Glu
225 230 235 240
8/13
SUBSTITUTE SHEET (RULE 26)
CA 02377427 2001-12-21
WO 01/00796 PCT/CA00/00777
Gln Ile Ser Thr Ile Ala Arg Lys Glu Gln Pro Tyr Ser Pro Lys Ile
245 250 255
Ala Leu Met Arg Glu Leu His Phe Lys T-~rr Leu Lys Tyr Trp Gln Phe
260 265 270
Ile
<210> 11
<211> 1120
<212> DNA
<213> Helicobacter pylori
<400> 11
atgagtatta ctattcctat tgttatcgct tttgacaatc attacgccat tccggctggc 60
gtgagcctgt attccatgct agcttgcact aaaacagaac acccccaatc acaaaatgat 120
agtgaaaaac ttttttataa aatccactgc ctggtagata acttaagcct tgaaaaccag 180
tgcaaattga aagaaactct agcccccttt agcgctttta tgagcgtgga ttttttagac 240
atttcaaccc ctaatcttta caccccttca atagaaccct ctgcgattga taaaatcaat 300
gaagcttttt tgcaactcaa tatttacgct aagactcgct tttctaaaat ggtcatgtgc 360
cgcttgtttt tggcttcttt attcccgcaa tacgacaaaa tcatcatgtt tgatgcggac 420
actttgtttt taaacgatgt gagcgagagt ttttttatcc cgctagatgg ttattatttt 480
ggagcggcta aagatttttc ttctcctaaa aaccttaaac attttcaaac agaaagggag 540
agagagcctc gccaaaaatt ttttctccat gagcattacc ttaaagaaaa agacatgaaa 600
atcatttgtg aaaaccacta taatgttggg tttttaatcg tgaatttaaa gctgtggcgt 660
gctgatcatt tagaagaacg cttactcaat ttaacccatc aaaaaggcca gtgtgtgttt 720
tgccctgaac aggatatttt aacgctcgca tgctatcaaa aagttttaca attaccttat 780
atttacaaca cccacccttt catggtcaat caaaaacgct tcatccctaa caaaaaagaa 840
atcgtcatgc tgcattttta ttttgtagga aaaccttggg ttttacccac tgctttatat 900
tctaaagaat ggcatgagac tcttttaaaa accccttttt acgctgaata ttccgtgaaa 960
tttcttaaac aaatgacaga atttttaagc cttaaagaca aacaaaaaac ctttgaattt
1020
cttgcccccc tactcaataa aaaaaccctt ttagaatatg tcttttttag attgaatagg
1080
attttcaaac gcttaaaaga aaaactttta aactcttagc
1120
<210> 12
<211> 372
<212> PRT
<213> Helicobacter pylori
<400> 12
Met Ser Ile Thr Ile Pro Ile Val Ile Ala Phe Asp Asn His Tyr Ala
1 5 10 15
Ile Pro Ala Gly Val Ser Leu Tyr Ser Met Leu Ala Cys Thr Lys Thr
20 25 30
Glu His Pro Gln Ser Gln Asn Asp Ser Glu Lys Leu Phe Tyr Lys Ile
35 40 45
His Cys Leu Val Asp Asn Leu Ser Leu Glu Asn Gln Cys Lys Leu Lys
50 55 60
Glu Thr Leu Ala Pro Phe Ser Ala Phe Met Ser Val Asp Phe Leu Asp
65 70 75 80
9/13
SUBSTITUTE SKEET (RULE 26)
CA 02377427 2001-12-21
WO 01/00796 PCT/CA00/00777
Ile Ser Thr Pro Asn Leu Tyr Thr Pro Ser Ile Glu Pro Ser Ala Ile
85 90 95
Asp Lys Ile Asn Glu Ala Phe Leu Gln Leu Asn Ile Tyr Ala Lys Thr
100 105 110
Arg Phe Ser Lys Met Val Met Cys Arg Leu Phe Leu Ala Ser Leu Phe
115 120 125
Pro Gln Tyr Asp Lys Ile Ile Met Phe Asp Ala Asp Thr Leu Phe Leu
130 135 140
Asn Asp Val Ser Glu Ser Phe Phe Ile Pro Leu Asp Gly Tyr Tyr Phe
145 150 155 160
Gly Ala Ala Lys Asp Phe Ser Ser Pro Lys Asn Leu Lys His Phe Gln
165 170 175
Thr Glu Arg Glu Arg Glu Pro Arg Gln Lys Phe Phe Leu His Glu His
180 185 190
Tyr Leu Lys Glu Lys Asp Met Lys Ile Ile C=rs Glu Asn His Tyr Asn
195 200 205
Val Gly Phe Leu Ile Val Asn Leu Lys Leu Trp Arg Ala Asp His Leu
210 215 220
Glu Glu Arg Leu Leu Asn Leu Thr His Gln Lys Gly Gln Cys Val Phe
225 230 235 240
Cys Pro Glu Gln Asp Ile Leu Thr Leu Ala Cys Tyr Gln Lys Val Leu
245 250 255
Gln Leu Pro Tyr Ile Tyr Asn Thr His Pro Phe Met Val Asn Gln Lys
260 265 270
Arg Phe Ile Pro Asn Lys Lys Glu Ile Val Met Leu His Phe Tyr Phe
275 280 285
Val Gly Lys Pro Trp Val Leu Pro Thr Ala Leu Tyr Ser Lys Glu Trp
290 295 300
His Glu Thr Leu Leu Lys Thr Pro Phe Tyr Ala Glu Tyr Ser Val Lys
305 310 315 320
Phe Leu Lys Gln Met Thr Glu Phe Leu Ser Leu Lys Asp Lys Gln Lys
325 330 335
Thr Phe Glu Phe Leu Ala Pro Leu Leu Asn Ly_s Lvs Thr Leu Leu Glu
340 345 . 350
Tyr Val Phe Phe Arg Leu Asn Arg Ile Phe Lys Arg Leu Lys Glu Lys
355 360 365
Leu Leu Asn Ser
370
<210> 13
<211> 843
<212> DNA
10/13
SUBSTITUTE SHEET (RULE Z6)
CA 02377427 2001-12-21
WO 01/00796 PCT/CA00/00777
<213> Helicobacter pylori
<400> 13
atgcatgttg cttgtctttt ggctttaggg gataacctca tcacgcttag cctttgtgaa 60
gaaatcgctc tcaaacagca acaacccctt aaaatcctag gtactcgttt gactttaaaa 120
atcgccaagc ttttagaatg cgaaaaacat tttgaaatca ttcctgtttt taaaaatatc 180
cccgcttttt atgaccttaa aaaacaaggc gttttttggg cgatgaagga ttttttatgg 240
ttattaaaag cgcttaagaa gcacaaaatc aaacacttga ttttagaaaa acaagatttt 300
agaagcgctc ttttatccaa atttgtttcc ataaccactc caaataaaga aattaaaaat 360
gcttatcaaa accgccagga gttgttttct caaatttatg ggcatgtttt tgataatagt 420
caatattcca tgagtttaaa aaaccccaaa aagattttaa tcaacccttt cacgagagaa 480
aataatagaa atatttcttt agaacatttg caaatcgttt taaaactgtt aaaacccttt 540
tgtgttacgc ttttagattt tgaagaacga tacgcttttt taaaagatga agtcgctcat 600
tatcgcgcta aaaccagttt agaagaagct aaaaacctga ttttagaaag cgatttgtat 660
ataggggggg attcgttttt gatccatttg gcttactatt taaagaaaaa ttattttatc 720
tttttttata gggataatga cgatttcatg ccgcctaaga atgaaaattt tctaaaagcc 780
cataaaagcc atttcataga gcaggattta gccacccagt tccgccattt ggggctatta 840
taa 843
<210> 14
<211> 280
<212> PRT
<213> Helicobacter pylori
<400> 14
Met His Val Ala Cys Leu Leu Ala Leu Gly Asp Asn Leu Ile Thr Leu
1 5 10 15
Ser Leu Cys Glu Glu Ile Ala Leu Lys Gln Gln Gln Pro Leu Lys Ile
20 25 30
Leu Gly Thr Arg Leu Thr Leu Lys Ile Ala Lys Leu Leu Glu Cys Glu
35 40 45
Lys His Phe Glu Ile Ile Pro Val Phe Lys Asn Ile Pro Ala Phe Tyr
50 55 60
Asp Leu Lys Lys Gln Gly Val Phe Trp Ala Met Lys Asp Phe Leu Trp
65 70 75 80
Leu Leu Lys Ala Leu Lys Lys His Lys Ile Lys His Leu Ile Leu Glu
85 90 95
Lys Gln Asp Phe Arg Ser Ala Leu Leu Ser Lys Phe Val Ser Ile Thr
100 105 110
Thr Pro Asn Lys Glu Ile Lys Asn Ala Tyr Gln Asn Arg Gln Glu Leu
115 120 125
Phe Ser Gln Ile Tyr Gly His Val Phe Asp Asn Ser Gln Tyr Ser Met
130 135 140
Ser Leu Lys Asn Pro Lys Lys Ile Leu Ile Asn Pro Phe Thr Arg Glu
145 150 155 160
Asn Asn Arg Asn Ile Ser Leu Glu His Leu Gln Ile Val Leu Lys Leu
165 170 175
Leu Lys Pro Phe Cys Val Thr Leu Leu Asp Phe Glu Glu Arg Tyr Ala
180 185 190
11/13
SUBSTITUTE SHEET (RULE 26)
CA 02377427 2001-12-21
WO 01/00796 PCT/CA00/00777
Phe Leu Lys Asp Glu Val Ala His Tyr Arg Ala Lys Thr Ser Leu Glu
195 200 205
Glu Ala Lys Asn Leu Ile Leu Glu Ser Asp Leu Tyr Ile Gly Gly Asp
210 215 220
Ser Phe Leu Ile His Leu Ala Tyr Tyr Leu Lys Lys Asn Tyr Phe Ile
225 230 235 240
Phe Phe Tyr Arg Asp Asn Asp Asp Phe Met Pro Pro Lys Asn Glu Asn
245 250 255
Phe Leu Lys Ala His Lys Ser His Phe Ile Glu Gln Asp Leu Ala Thr
260 265 270
Gln Phe Arg His Leu Gly Leu Leu
275 280
<210> 15
<211> 850
<212> DNA
<213> Helicobacter pylori
<400> 15
atgcatgttg cttgtctttt ggctttaggg gataacctca tcacgcttag ccttttaaaa 60
gaaatcgctt ccaaacagca acggcccctt aaaatcctag gcactcgttt gactttaaaa 120
atcgccaagc ttttagaatg cgaaaaacat tttgaaatca ttcctatttt tgaaaatatc 180
cctgcttttt atgatcttaa aaaacaaggc gttttttggg cgatgaagga ttttttatgg 240
ttgttaaaag caattaagaa gcacaaaatc aaacatttga ttttagaaaa acaagatttt 300
agaagttttc ttttatccaa atttgtttcc ataaccactc ccaataaaga aattaaaaac 360
gtttatcaaa accgccagga gttgttttct ccaatttatg ggcatgtttt tgataacccc 420
ccatatccca tgaatttaaa aaaccccaaa aagattttga tcaacccttt cacaagatcc 480
atagagcgaa gtatcccttt agagcattta aaaatcgttt taaaactctt aaaacccttt 540
tgtgttacgc ttttagattt tgaagaacga tacgcttttt tacaaaatga agccactcat 600
tatcgtgcta aaaccagttt agaagaagtt aaaagcctga ttttagaaag cgatttgtat 660
ataggggggg attcgttttt aatccatttg gcttactatt taaagaaaaa ttattttatc 720
tttttttata gggataatga cgatttcatg ccacctaatg gtaagaagga aaattttcta 780
aaagcccaca aaagccatta catagaacag gatttagcca aaaaattccg ccatttgggg 840
cttattataa 850
<210> 16
<211> 283
<212> PRT
<213> Helicobacter pylori
<400> 16
Met His Val Ala Cys Leu Leu Ala Leu Gly Asp Asn Leu Ile Thr Leu
1 5 10 15
Ser Leu Leu Lys Glu Ile Ala Ser Lys Gln Gln Arg Pro Leu Lys Ile
20 25 30
Leu Gly Thr Arg Leu Thr Leu Lys Ile Ala Lys Leu Leu Glu Cys Glu
35 40 45
Lys His Phe Glu Ile Ile Pro Ile Phe Glu Asn Ile Pro Ala Phe Tyr
50 55 60
12/13
SUBSTITUTE SHEET (RULE 26)
Leu Lys Pro Phe Cys Val Thr Leu Leu As
CA 02377427 2001-12-21
WO 01/00796 PCT/CA00/00777
Asp Leu Lys Lys Gln Gly Val Phe Trp Ala Met Lys Asp Phe Leu Trp
65 70 75 80
Leu Leu Lys Ala Ile Lys Lys His Lys Ile Lys His Leu Ile Leu Glu
85 90 95
Lys Gln Asp Phe Arg Ser Phe Leu Leu Ser Lys Phe Val Ser Ile Thr
100 105 110
Thr Pro Asn Lys Glu Ile Lys Asn Val Tyr Gln Asn Arg Gln Glu Leu
115 120 125
Phe Ser Pro Ile Tyr Gly His Val Phe Asp Asn Pro Pro Tyr Pro Met
130 135 140
Asn Leu Lys Asn Pro Lys Lys Ile Leu Ile Asn Pro Phe Thr Arg Ser
145 150 155 160
Ile Glu Arg Ser Ile Pro Leu Glu His Leu Lys Ile Val Leu Lys Leu
165 170 175
Leu Lys Pro Phe Cys Val Thr Leu Leu Asp Phe Glu Glu Arg Tyr Ala
180 185 190
Phe Leu Gln Asn Glu Ala Thr His Tyr Arg Ala Lys Thr Ser Leu Glu
195 200 205
Glu Val Lys Ser Leu Ile Leu Glu Ser Asp Leu Tyr Ile Gly Gly Asp
210 215 220
Ser Phe Leu Ile His Leu Ala Tyr Tyr Leu Lys Lys Asn Tyr Phe Ile
225 230 235 240
Phe Phe Tyr Arg Asp Asn Asp Asp Phe Met Pro Pro Asn Gly Lys Lys
245 250 255
Glu Asn Phe Leu Lys Ala His Lys Ser His Tyr Ile Glu Gln Asp Leu
260 265 270
Ala Lys Lys Phe Arg His Leu Gly Leu Ile Ile
275 280
13/13
SUBSTITUTE SHEET (RULE 26)
