Note: Descriptions are shown in the official language in which they were submitted.
' CA 02377482 2001-12-21
p
1
DIHYDROOROTATE DEHYDROGENASE SEQUENCE OF CORYNEBACTERIUM
GLUTAMICUM AND THE USE THEREOF IN MICROBIAL PRODUCTION OF
PYRIMIDINE AND/OR COMPOUNDS USED WITH PYRIMIDINE
The present invention is concerned with the process for
producing pyrimidines by fermentation with the aid of a
genetically manipulated .organism. This inveritibn
comprises the sequence of the dihydroorotate
dehydrogenase from Corynebacterium glutamicum and the
use thereof for the microbial production of pyrimidiizes
and/or pyrimidine-related compounds.
The biosynthetic pathway for pyrimidines is essential
for all living .organisms (a review article on this by
Switzer, R.L. and Quinn, C.L. is to be found in
Bacillus subtilis (editors: Sonenshein, A.L.,
Hoch, J.A. and Losick, R., American Society for
Microbiology, Washington, D.C.), 1993, pp. 343-358. The
pyrimidine nucleotides are pyrimidine derivatives and,
as such, activated precursors of DNA and RNA and for
many biosynthetic pathways. In the pyrimidine
nucleosides cytidine, uridine, deoxycytidine and
deoxythymidine, a pyrimidine base is bonded to a
pentose, and the pyrimidine nucleotides~are phosphate
esters of the pyrimidine nucleosides. Pyrimidine
nucleosides and pyrimidine nucleotides and derivatives
thereof are also important starting compounds for
synthesizing valuable drugs such as, for example, CDP-
choline, orotic acid or UMP (a review article on this
by Kuninaka, A. is to be found in Biotechnology, vol. 6
(editors: Rehm, H.-J. and Reed, G.), VCH, Weinheim,
Germany, 1996, pp. 561-612).
Many, but not all, microorganisms are able to
synthesize their pyrimidine nucleotides both de novo
and from pyrimidine bases and pyrimidine nucleosides
supplied from outside. Pyrimidine bases and/or
pyrimidine nucleosides normally do not occur inside
' CA 02377482 2001-12-21
0091/00004 - 2 -
cells. However, under some conditions of growth they
may be formed in excess and are then secreted into the
culture medium. For this reason, microorganisms can be
employed for the fermentative production of pyrimidine
nucleotides and/or related compounds.
The biosynthetic efficiency "of microorganisms for
pyrimidine nucleotides can be optimized by genetically
manipulating the pyrimidine biosynthetic pathway.
Genetic manipulation means in this connection that the
number of gene copies and/or the rate of transcription
of the genes for the pyrimidine synthetic pathway is
increased. As a consequence of this, the proportion of
gene product and the intracellular enzymatic activity
increases. An increased enzymatic activity leads to
increased conversion of compounds supplied in the
nutrient medium into pyrimidine nucleotides and/or
related compounds and thus increases the synthetic
efficiency. Thus, it has been possible to show that,
for example, an increase in the activity of
dihydroorotate dehydrogenase, which catalyzes the
oxidation of (S)-dihydroorotate to orotate - this is
the fourth stage in de novo pyrimidine biosynthesis for
pyrimidine nucleotides - increases the efficiency of
UMP synthesis ~ in Corynebacterium ainmoniagenes
(Nudler, A.A., Garibyan, A.G. and Bourd, G.I. (1991)
FEMS Microbiol. Lett. 82:263-266).
The invention is concerned with the novel pyrD gene for
the dihydroorotate dehydrogenase of the pyrimidine
biosynthetic pathway from Corynebacterium glutamicum
and its use for preparing pyrimidine nucleotides and/or
pyrimidine-related compounds.
One part of the invention comprises the pyrD gene
product. SEQ ID N0. 2 describes a polypeptide sequence.
The pyrD gene encodes a polypeptide of 322 amino acids
with ~: molecular weight of 33953. The present invention-
' CA 02377482 2001-12-21
?:
oass~oflooa . - 3 -
is, however, also concerned with functional derivatives
of ~ this polypeptide which can be obtained by replacing
one or more amino acids in SEQ ID N0. 2, preferably up
to 25~ of .the amino acids, most suitably up to 15~; by
deletion, insertion or substitution or by a combination
of deletion, insertion and substitution. The term
functional derivative means that the enzymit activity
of the derivative is still of the same order of
magnitude as that of the polypeptide having the
sequence SEQ ID N0. 2.
Another part of the invention comprises the
polynucleotide sequences which encode the pol~peptides
described above. The polynucleotide'sequences can be
generated starting from sequences isolated. from.
Corynebacterium.glutamicum (i.e. SEQ ID N0. 1), in
which these sequences are modified by site-directed
mutagenesis or, after back-translation of the corres-
ponding polypeptide using the genetic code, a total
chemical synthesis is carried out.
These polynucleotide sequences can most suitably be
employed in the form of gene constructs for the
transformation of host organisms, preferably of
microorganisms.' These gene constructs consist of at
least on.e copy of one of the polynucleotides together
with at least one regulatory sequence. Regulatory
sequences comprise promoters, terminators, enhancers
and ribosome binding sites. w w
Preferred host organisms for transformation with these
gene constructs are Corynebacterium and Bacillus
species, but any eukaryotic microorganisms can also be
employed for this purpose, preferably strains of yeast
of the genus Ashbya, Candida, Pichia, Saccharomyces and
Hansenula.
~rrother part of the invention comprises the process for
' CA 02377482 2001-12-21
,. '
ooss~oooa4 - 4 -
preparing pyrimidines and pyrimidine derivatives by
cultivation of a host organism which is transformed in
the manner described above, as the subsequent isolation .
of the pyrimidines. A pyrimidine derivative~means a
compound having a pyrimidine ring which can be prepared
by transforming a host organism with one of the
polynucleotides corresponding to the present invention. -.
The processes and procedures for cultivating micro
20 organisms and for isolating pyrimidines from a
microbial production are familiar to trained staff.
The following examples describe how the invention arose
and its application in the genetic manipulation of
microorganisms for increased .efficiency of production
of pyrimidine nucleotides and/or related compounds..
Example 1
Construction of a genome library from Corynebacterium
glutamicum ATCC 13032
DNA from the genome of Coryn eba c~t eri um g1 a tami cum.
ATCC 13032 can be obtained by standard methods which.
have already been described, for example by
.I..Altenbuchner and J. Cullum (1984, Mol. Gen. Genet.
195:134-138). The genome library can be prepared by
standard protocols (for example: Sambrook, J. et a1:
(1989) Molecular cloning: a laboratory manual, Cold
Spring Harbor Laboratory Press) using any cloning
vector, for example pBluescript II KS- (Stratagene.) or
ZAP Expresses (Stratagene). It is moreover possible t~o w
use any size of fragments, preferably Sau3AI fragments
with a length of 2-9 kb, which can be incorporated in..
cloning vectors with digested BamHI.
' CA 02377482 2001-12-21
0091/00004 - 5 -
Example 2
Analysis of the nucleic acid sequence to the .genome
library
Individual E. co3i clones can be selected from the- '
genome library produced in.example 1. E.'coli cells, are .
cultivated by standard methods in suitable media (e. g.
LB supplemented with 100 mg/1 ampicillin), and the
plasmid DNA can then be isolated. If genome fragments
from the DNA of Corynebacterium glutamicum .are cloned
into pBluescript II KS- (see example 1), the DNA can be
sequenced with the aid of the ~oligonucleotides
5'-AATTAACCCTCACTAAAGGG-3' and ~5'-GTAATACGACTCACTATA
. GGGC-3'.
Example 3
Computer analysis of the sequences of isolated nucleic
acids
The nucleotide sequences can join together for exa~le
with the aid of the BLASTX algorithm (Altschul et al.
(1990) J. Mol. Biol. 225:403-410). It is possible in
this way to discover novel sequences and elucidate the
function of these novel genes.
Example 4
Identification of an E. coli clone which comprises the ..
gene for dihydroorotate dehydrogenase (EC 1.3.3.1)
Analysis of the E. coli clones as described in
example 2, which was followed by analysis, as described
in example 3, of the sequences obtained thereby,
revealed a sequence as described by SEQ ID NO. 1. Use
of the BLASTX algorithm (see example 3) revealed that
this sequence was similar to the dihydroorotate
,' CA 02377482 2001-12-21
Y
0091/00004 - 6 -
dehydrogenase (PyrD; EC 1.3.3.1) from various
organisms. The greatest similarity was with the
dihydroorotate dehydrogenase from Mycobacterium leprae
(SWISSPROT p46727; 67~ agreement at the amino acid
level}.
Examples 5.
Use of the gene for the dihydroorotate dehydrog.enase
(pyrD) from Corynebacterium glutamicum for .producing
pyrimidine and/or pyrimidine-related compounds .
The gene for the dihydraorotate dehydrogenase from
Corynebacter,iun~ glutamicum can be introduced with the
aid of suitable cloning and/or expression systems into
Corynebacterium glutamicum or into any other
microorganism. It is possible to produce genetically
manipulated microorganisms which differ from the wild .
type in the activity or the number of copies of the
genes. These novel, genetically manipulated strains can
be employed for producing pyrimidine and/or pyrimidine
related compounds.
Sequence list
(I) General information
(1) Applicant
(A) Name: BASF-LYNX Biosci-ence AG
(B) Street: Im Neuenheimer Feld 515
(C) City: Heidelberg
(D) Country: Germany
(E) Postal code: 69120
(F) Telephone: 06221/4546
(G) Fax: 06221/454770
CA 02377482 2001-12-21
0091/00004 - 7 -
(2) Title: The sequence
of the dihydroorotate
dehydrogenase from Corynebacterium glutamicum and
the use thereof in
the microbial production
of
pyrimidines and/or pyrimidine-related compounds
(3) Number of sequences:
2
(4) Type of computer-readable
form:
. 10 (A) Medium type: diskette
(B) Computer: IBM PC compatible '
(C) Operating system: Windows NT
(D) Software: Microsoft~word 97 SR-1
(I) Information on SEQ ID N0. 1:
"(1) Sequence characteristics:
(A) Length: 966
(B) Type: nucleic acid w
(C) Strand type: double strand
(D) Topology: linear
(2) Molecule type: DNA
(3) Hypothetical: no
(4) Antisense: no
(5) Source:
(A) Organism: Corynebacterium glutamicuirt
(6) Description of the sequence: SEQ ID N0. 1:
CA 02377482 2001-12-21
>.
t
0091/000p4 - g _
ATGGAAAAAATCATCGCAGTGCACGATGATTCCCTCTCCCbGGAAGTCTTCGGCGTCACCTTCCC
RCGACCACTAGGCtTCGCCGCAGGTTTCGACAA.AAACGCATC?ATGGCTGA1~GCCTGGGG'rGCCG
TTGGATTCGGATACGCCGAACTTGGCACCGTCACCGCCTCCCCACAGCCAGGAAACCCCACCCC.G
CGCCTTTTCCGCCTGCCTGCCGACAAAGCTATCTTGAACCGC~!TGGGATT'CAACAACCTGGGTGC
AGCAGAAGTCGCAAAAAACCTGCGCAACCGGAAATCUCCGATGTCATCGGCATCAACATCGGTA
AAACCAAAGTGGTTCCCGCTGAACACGCAGTAGATGACTACCGCCGTTCTGCATCTTg"t'GTTAGGT
GATCTTGCTGATTACCTGGTTGTCAACGT3'TCCTCCCCCAACACTCCGGGTCTCCGCGATCTGCA
GGCTGTGGAATCTTTGCGACCAATCCTCGCCGCAGTGCAGGAATCCACCACCGTCCCAGTCTTGG
TGAAAATCGCACCAGACCTCTCCGACGAAGACATCGACGCCGTAGCTGACCTGGUGTTGAGCTC
AAACTCGCCGGAATCGTAGCCACCAATACCACCATTTCCCGCGAAGGCCTCAACACTCCTTCAGG
TGAAGTCGAAGCCATGGGTGCTGGCGGAATCTCCGGTGCTCCAGTAGUGCCCGATCTTTGGAGG
TACTCPAGCGCCTCTACGCACGGGTAGGCAAAGAGATGGTGTTGATCTCTGTCGGTGGUTCAGC
ACCCCTGAGCAAGCCTGGGAACGCATCACCTCCGGCGCAACCCTTCTt,CAGGGATACACCCCATT
CATCTACGG~GGCCCCGATTGGATCAGAGATATCCACCTTGGTATCGCCAAGUGCTGAiU4GCTC
ACGGTCTGCGCAACATCGCTGACGCTGTGGGCAGCGAATTGGAGTGGAAGAACTAA
(I) Information for SEQ ID NO. 2:
(1) Sequence characteristics:
(A) Length: 322
(B) Type: amino acid
(C) Strand type: one chain
(D) Topology: linear
(2) Molecule tyke: amino acid.
(3) Hypothetical: no
(4) Antisense: no
(5) Source:
(B) Organism: Corynebacterium glutamicum
(6) Description of the sequence: SEQ ID N0. 2:
MEKI IAVf~'JDSLSQE~GVTFPRPLGi.FsA~GFDJ4~TASMADAWGAVGFGYAELGI'VTASPQPGNPTP
RLFFtLFADKAILNRMGi~TNLGAAEVAT~ILRNRKSTDVIGINIGKTKWPAEFiP.VbDYRRSASLLG
DLADYLVViWSSPNTPGLFcDLQAV'SLRPILAAVQESTTVPVLVKIAPDLSDEDIDAVADLAVE:~
KLAG IVATNTTI SREGLNTPSGEVEA_MGAGGI SGAPVAARSLEVLIQiLYARVGI~iVLISVGGIS
TFEQAWERITSGATLLQGYTPFIYGGPD~'I?tDIHLGIAICQLKA~iG..RNIADAVGSELEWK~t
