Note: Descriptions are shown in the official language in which they were submitted.
081.7 /00010 CA 02381316 2002-02-07
Homogentisate-dioxygenase
1
The present invention relates to novel genetic constructs such as
expression cassettes and vectors for generating plants with an
elevated tocopherol content, to transgenic plants generated thus,
and to methods for the generation of transgenic plants with an
elevated tocopherol content.
The generation of plants with an elevated sugar, enzyme and amino
acid content has hitherto been an important objective in plant
molecular genetics. The development of plants with an elevated
vitamin content, such as, for example, with an elevated
tocopherol (vitamin E) content, is, however, also of economic
interest.
The naturally occurring eight compounds with vitamin E activity
are derivatives of 6-chromanol (Ullmann's Encyclopedia of
Industrial Chemistry, Vol. A 27 (1996), VCH Verlagsgesellschaft,
Chapter 4., 478-488, Vitamin E). The first group (la-d)
encompasses the tocopherols (I), while the second group (2a-d)
encompasses the tocotrienols (II):
1
(I)
i
3
4 ~u' ~/ 8
la, a.-tocopherol: R1 = RZ = R3 = CH3
1b, (3-tocopherol: R1 = R3 = CH3 , R2 = H
lc, y-tocopherol: R1 = H, R2 = R3 = CH3
1d, b-tocopherol: R1 = RZ = H, R3 = CH3
1
\ ~ / / /
R~ ~ 3~ 7~ 11~
3
(II)
2a, a.-tocopherol: R1 = R2 = R3 = CH3
2b, (3-tocopherol: R1 = R3 = CH3 , RZ = H
2c. y-tocopherol: R1 = H, R2 = R3 = CH3
2d, 8-tocopherol: R1 = Rz = H, R3 = CH3
7 00010 CA 02381316 2002-02-07
2
where
R1, R2 and R3 are as defined above.
At present, alpha-tocopherol is of great economic importance.
The development of crop plants with an elevated tocopherol
content by means of tissue culture or seed mutagenesis and
natural selection is set a limit. On the one hand, it must be
possible for the tocopherol content to be recorded as early as
during the tissue culture stages and, on the other hand, only
those plants can be manipulated via tissue culture techniques
which can be successfully regenerated from cell cultures into
whole plants. Moreover, crop plants can show undesirable
properties after mutagenesis and selection, and the former have
to be eliminated by in some cases repeated backcrosses. Also,
increasing the tocopherol content by means of crosses would be
limited to plants of the same species.
This is why the genetic engineering approach of isolating the
essential biosynthesis genes which encode tocopherol synthesis
performance and introducing them into crop plants in a directed
fashion is superior to the traditional plant breeding method.
Knowledge of the biosynthesis pathways and its regulation, and
identification of genes which affect biosynthesis performance,
are prerequisites for this method.
The tocopherol synthesis pathway in plants is shown schematically
in the appended Figure 1. As yet, no useful approach exists in
the prior art which allows the tocopherol biosynthesis in plants
to be elevated in a targeted fashion.
Short description of the invention:
It is an object of the present invention to provide means with
the aid of which an improved tocopherol biosynthesis can be
achieved.
We have found that this object is achieved by providing genetic
constructs with the aid of which the biosynthesis of
homogentisate, a tocopherol precursor, and thus the formation of
tocopherol, can be increased. Simultaneously, it is possible in
accordance with the invention to prevent the undesired
homogentisate efflux to maleyl acetoacetate, thus improving
tocopherol synthesis further.
817 / V001 V CA 02381316 2002-02-07
3
A first subject of the invention therefore relates to an
expression cassette comprising
a) the coding nucleic acid sequence for 4-hydroxyphenylpyruvate
dioxygenase (HPPD) or for a functional equivalent thereof,
thus increasing the homogentisate biosynthesis rate upon
expression; and/or
b) at least one nucleic acid sequence (anti-HGD) which is
capable of inhibiting the homogentisate dioxygenase (HGD)
activity
under the genetic control of regulatory nucleic acid sequences.
"Inhibition" is to be interpreted broadly in the present context
and encompasses the partial or essentially complete prevention or
blocking of the HGD enzyme activity in the plant or the plant
organ or tissue which has been transformed with an anti-HGD
construct according to the invention, this prevention or blocking
being based on different mechanisms in cell biology. Inhibition
for the purposes of the invention also encompasses a quantitative
reduction of active HGD in the plant down to an essentially
complete absence (i.e. lack of detectability of HGD enzyme
activity or lack of immunological detectability of HGD) of HGD
protein.
According to the invention several strategies for decreasing or
inhibiting of the HGD activity are comprised. A person skilled in
the art will recognize that a variety of different methods are
available in order to affect the HGD gene expression in a
desirable manner.
A preferred strategy according to the invention comprises the use
of a nucleic acid sequence (anti-HGD) which can be transcribed
into an antisense nucleic acid sequence which is capable of
inhibiting the homogentisate dioxygenase (HGD) activity, for
example by inhibiting the expression of endogenous HGD.
Further methods of inhibiting the HGD expression comprise the
overexpression of homologous HGD nucleic acid sequences leading
to cosuppression (Jorgensen et al. (1996): "Chalcone synthase
cosuppression phenotypes in petunia flowers: Comparison of sense
vs. antisense constructs and single copy vs. complex T-DNA
sequences.", Plant Mol. Biol. 31 (5): 957-973.), induction of
specific RNA degradation by a plant with the help of a viral
expression system (amplicon) (Angell, S. M., Baulcombe, D. C.
(1999): "Technical advance: Potato virus x amplicon mediated
silencing of nuclear genes." Plant J. 20 (3): 357-362.),
0$17 0001,0 CA 02381316 2002-02-07
4
insertion of nonsense mutations into the endogene by means of
introduction of RNA/DNA oligo nucleotides into the plant (Zhu et
al. (2000): "Engineering herbicide resistant maize using chimeric
RNA/DNA oligonucleotides." Nat. Biotechnol. 18 (5): 555-558.) or
5 generating knockout mutants, e. g. with the help of T-DNA
mutagenesis (Koncz et al. (1992): "T-DNA insertional mutagenesis
in Arabidopsis." Plant Mol. Biol. 20 (5): 963-976.) or homolgous
recombination (Hohn, B.; Puchta, H. (1999): "Gene therapy in
plants." Proc. Natl. Acad. Sci. USA 96: 8321-8323.).
The above mentioned documents and the methods for the regulation
of gene expression in plants described therein are herewith
incorporated by reference.
The anti-HGD sequence in the sense of the present invention is
thus particularly selected among:
a) antisense nucleic acid sequences;
b) nucleic acid sequences coding for homologous HGD and leading
to cosuppression;
c) viral nucleic acid sequences and expression constructs
affecting HGD-RNA degradation;
d) nonsense mutations of nucleic acid sequences coding for
endogenous HGD;
e) nucleic acid sequences coding for knockout mutants;
f) nucleic acid sequences suitable for homologous recombination;
wherein the expression of each of these sequences can effect an
"inhibition" of the HGD activity in the sense of the present
invention. A combined use of such sequences is also possible.
The coding HPPD sequence is according to the invention preferably
linked functionally to the coding sequence of a
plant-organelle-specific transit peptide. The transit peptide
preferably has specificity for the seeds or the plastids such as,
for example, the chloroplasts, chromoplasts and/or leukoplasts,
of the plant. The transit peptide directs the expressed HPPD
activity to the desired target within the plant and, once this is
achieved, is eliminated from the HPPD protein moiety, preferably
proteolytically. In the expression construct according to the
invention, the coding transit peptide sequence is preferably
located 5'-upstream from the coding HPPD sequence.
In a further preferred embodiment, the coding HPPD sequence and
the anti-HGD sequence are in each case under the genetic control
of a plant-specific promoter.
7 00010 CA 02381316 2002-02-07
Expression cassettes which are especially preferred in accordance
with the invention encompass a coding HPPD nucleic acid sequence
which encodes a protein containing an amino acid sequence in
accordance with SEQ ID N0:15 or a functional equivalent thereof,
5 or which encompasses a nucleic acid sequence from the nucleotide
in position 8 to the nucleotide in position 1153 inclusive, in
accordance with SEQ ID N0:14 or a functional equivalent thereof.
In a preferred embodiment the anti-HGD nucleic acid sequence can
contain the coding nucleic acid sequence of homogentisate
dioxygenase or a functional fragment thereof, inserted in
antisense orientation. A preferred embodiment of the expression
cassettes according to the invention encompasses an HGD sequence
motif in accordance with SEQ ID N0:1 in antisense orientation.
This leads to the increased transcription of nucleic acid
sequences in the transgenic plant which are complementary to the
endogenous coding HGD sequence or a portion thereof and which
hybridize herewith at DNA or RNA level.
The invention further relates to recombinant vectors encompassing
at least one expression cassette in accordance with the above
definition. Examples of vectors according to the invention
encompass at least one expression construct of the following
type:
5'-plant-specific promoter/HPPD or anti-HGD/terminator-3'. The
coding HPPD sequence may also be replaced by a coding sequence
for a fusion protein of transit peptide and HPPD.
Preferred examples encompass monomeric vectors comprising one of
the following expression constructs:
a) 5'-35S-promoter/anti-HGD/OCS-terminator-3';
b1) 5'-legumin-B-promoter/HPPD/NOS-terminator-3';
b2) 5'-legumin-B-promoter/transit peptide-HPPD/NOS-terminator-3'.
The constructs a) and b) require the plant to be co-transformed
with both vectors, i.e. with a) and b1) or b2).
Preferred examples also encompass binary vectors comprising the
following constructs:
c1) 5'-35S-promoter/anti-HGD/OCS-terminator/legumin-B-
promoter/HPPD/NOS-terminator-3'; and
c2) 5'-35S-promoter/anti-HGD/OCS-terminator/legumin-B-
promoter/transit peptide-HPPD/NOS-terminator-3'.
X817 / OOV 10 CA 02381316 2002-02-07
6
Construct c1) or c2) allows the simultaneous transformation of
the plant with HPPD and anti-HGD.
The invention furthermore relates to microorganisms comprising at
least one recombinant vector according to the invention.
Preferred organisms are those which are capable of infecting
plants and thus of transferring the constructs according to the
invention.
Preferred microorganisms are those from the genus Agrobacterium,
in particular the species Agrobacterium tumefaciens.
The invention furthermore relates to the use of a vector or
microorganism according to the invention for the transformation
of plants, plant cells, plant tissues or plant organs, in
particular with the purpose of making them capable of an improved
tocopherol synthesis.
The invention furthermore relates to a transgenic plant,
transformed with at least one vector or microorganism according
to the invention, and to transgenic cells, tissue, organs or
transgenic propagation material of such plants.
The transgenic plants according to the invention are in
particular selected from amongst crop plants such as cereals,
maize, soybeans, rice, cotton, sugar beet, canola, sunflowers,
flax, potatoes, tobacco, tomatoes, oilseed rape, alfalfa, salad
species such as cress, and the various tree, nut and grapevine
species.
The invention furthermore relates to a method for generating
transgenic plants with improved tocopherol production, which
comprises transforming plants which are capable of producing
tocopherol, or plant cells, plant tissue or plant organs or
protoplasts thereof, with at least one vector according to the
invention or at least one microorganism according to the
invention, culturing the transformed cells, tissue, plant organs
or protoplasts in a growth medium and, if appropriate,
regenerating plants from the culture.
The invention furthermore relates to the use of an expression
cassette, a vector, a microorganism or a transgenic plant in
accordance with the above definition for obtaining plant
metabolites, in particular tocopherols.
CA 02381316 2002-02-07
7
Finally, the invention relates to a process for the preparation
of tocopherols, which comprises isolating in a known manner the
desired tocopherol from a culture of a plant which has been
transformed in accordance with the invention.
Detailed description of the invention:
The transformation according to the invention of plants with an
HPPD-encoding construct leads to the overexpression of this
protein and thus to an increased homogentisate formation. The
simultaneous transformation with anti-HGD, in particular the
antisense-HGD construct, avoids an undesired efflux of this
metabolite to maleyl acetoacetate. Thus, an increased
homogentisate quantity is available in the transgenic plant for
the formation of tocopherols via the intermediates
methyl-6-phytylquinol and 2,3-dimethylphytylquinol (cf. Figure
1).
A nucleotide or nucleic acid sequence is to be understood as
meaning in accordance with the invention for example a genomic or
a complementary DNA sequence or an RNA sequence or semi- or fully
synthetic analogs thereof.
The HPPD or anti-HGD nucleotide sequences of the constructs
according to the invention can be produced synthetically or
obtained naturally or comprise a mixture of synthetic and natural
DNA components, or else be composed of various heterologous HGD
or HPPD gene segments of various organisms. The anti-HGD sequence
can be derived from one or more exons and/or introns, in
particular exons of the HGD gene.
For example, synthetic nucleotide sequences can be generated
which have codons which are preferred by the plants to be
transformed. These codons which are preferred by plants can be
determined for the plant in the customary manner with the aid of
the codon usage. When preparing an expression cassette, various
DNA fragments can be manipulated in such a way that the result is
a nucleotide sequence with the correct direction of reading and a
correct reading frame. To connect the nucleic acid fragments to
each other, adapters or linkers may be attached to the fragments.
Functional equivalents of the HPPD gene are those sequences which
still encode a protein with the desired functions in accordance
with the invention, i.e. an enzyme with homogentisate-forming
activity, despite a deviating nucleotide sequence.
CA 02381316 2002-02-07
Functional equivalents of anti-HGD encompass those nucleotide
sequences which prevent the HGD enzyme function in the transgenic
plant to a sufficient degree. This can be effected for example by
hindering or preventing HGD processing, the transport of HGD or
its mRNA, inhibition of ribosome attachment, inhibition of RNA
splicing, induction of an RNA-degrading enzyme and/or inhibition
of translation elongation or translation termination.
Functional equivalents generally encompass naturally occuring
l0.variants of the sequences described herein and also artificial
nucleotide sequences, for example artificial nucleotide sequences
obtained by chemical synthesis which are adapted to the codon
usage of a plant.
Functional equivalents are also to be understood as meaning, in
particular, natural or artificial mutations of an originally
isolated sequence which encodes HGD or HPPD which continue to
show the desired function. Mutations encompass substitutions,
additions, deletions, exchanges or insertions of one or more
nucleotide residues. Thus, the present invention also ,
encompasses, for example, those nucleotide sequences which are
obtained by modifying the HGD or HPPD nucleotide sequence. The
purpose of such a modification may be, for example, the further
limitation of the encoding sequence contained therein or else,
for example, the insertion of further restriction enzyme cleavage
sites.
Functional equivalents are also those variants whose function is
attenuated or increased compared with the starting gene or gene
fragment, that is to say for example those HPPD genes which
encode an HPPD variant with a lower or higher enzymatic activity
than that of the original gene.
Also suitable are artificial nucleic acid sequences as long as
they mediate the desired characteristic, for example an elevated
tocopherol content in the plant, by overexpression of the HPPD
gene or expression of an anti-HGD sequence in crop plants, as
described above. Such artificial nucleotide sequences can be
identified, for example, by back translation of proteins with HGD
or HPPD activity which have been constructed by means of
molecular modeling, or else by in vitro selection. Especially
suitable are coding nucleotide sequences which have been obtained
by back translating a polypeptide sequence in accordance with the
host-plant-specific codon usage. An expert skilled in the art of
plant genetic methods will readily be able to identify the
specific codon usage by computer evaluations of other known genes
of the plant to be transformed. To circumvent undesired
7 00010 CA 02381316 2002-02-07
9
regulatory mechanisms of the plant, it is possible, for example,
to back translate DNA fragments starting from the amino acid
sequence of a bacterial HPPD and taking into consideration the
plant codon usage, and thus generate the complete exogenous HPPD
sequence which is optimized for use in the plant. This expresses
an HPPD enzyme which is not, or only insufficiently, accessible
to regulation by the plant, thus fully allowing enzyme activity
to be overexpressed.
Further suitable equivalent nucleic acid sequences which must be
mentioned are sequences which encode fusion proteins, for example
an HPPD polypeptide or a functionally equivalent portion of these
being a constituent of the fusion protein. The second portion of
the fusion protein may be, for example, another enzymatically
active polypeptide, or an antigenic polypeptide sequence with the
aid of which detection of HPPD expression is possible (for
example myc-tag or his-tag). However, it is preferably a
regulatory protein sequence such as, for example, a signal or
transit peptide which leads the HPPD protein to the desired site
of action.
An elevated tocopherol content in the plant is to be understood
as meaning for the purposes of the present invention the
artificially acquired capability of an increased biosynthetic
performance regarding at least one compound from the group of the
tocopherols and tocotrienols as defined above in the plant in
comparison with the non-genetically-modified plant for the
duration of at least one plant generation.
The tocopherol biosynthesis site is generally the leaf tissue but
also the seed, so that leaf-specific and/or seed-specific
expression in particular of the HPPD gene and/or, if appropriate,
anti-HGD are meaningful. However, it is obvious that tocopherol
biosynthesis need not be limited to the seed but may also take
place in a tissue-specific fashion in all the other remaining
parts of the plant.
Constitutive expression of the exogenous gene is also
advantageous. On the other hand, inducible expression may also be
desirable.
The regulatory nucleic acid sequences contained in the expression
cassettes according to the invention govern the expression of the
coding sequences (such as HPPD sequence, if appropriate fused to
a transit peptide sequence) and the anti-HGD sequence.
Preferably, the constructs according to the invention comprise a
promoter 5'-upstream from the coding sequence in question and a
CA 02381316 2002-02-07
l
terminator sequence 3'-downstream, and, if appropriate, other
customary regulatory elements, in each case operatively linked
with the coding sequence. Operative linkage is to be understood
as meaning the sequential arrangement of promoter, encoding
sequence, terminator and, if appropriate, further regulatory
elements in such a way that each of the regulatory elements can
fulfill its function as intended when the encoding sequence or
the antisense sequence is expressed. Examples of operatively
linkable sequences are other targeting sequences (which differ
from the transit-peptide-encoding sequences) for guaranteeing
subcellular localization in the apoplast, in the vacuole, in
plastids, in the mitochondrion, in the endoplasmatic reticulum
(ER), in the nucleus, in elaioplasts or in other compartments;
and translation enhancers such as the tobacco mosaic virus
5'-leader sequence (Gallie et al., Nucl. Acids Res. 15 (1987),
8693 -8711), and the like.
Suitable polyadenylation signals are plant polyadenylation
signals, preferably those which essentially correspond to
Agrobacterium tumefaciens T-DNA polyadenylation signals, in
particular those of gene 3 of the T-DNA (octopine synthase) of
the Ti plasmid pTiACHS (Gielen et al., EMBO J. 3 (1984), 835 et
seq.) or functional equivalents thereof. Examples of especially
suitable terminator sequences are the OCS (octopine synthase)
terminator and the NOS (nopaline synthase) terminator.
A suitable promoter of the expression cassettes is, in principle,
any promoter which is capable of governing the expression of
genes, in particular foreign genes, in plants. In particular, a
plant promoter or a promoter derived from a plant virus is
preferably used. Particularly preferred is the cauliflower mosaic
virus CaMV 35S promoter (Franck et al., Cell 21 (1980),
285 - 294). As is known, this promoter contains various
recognition sequences for transcriptional effectors which in
their totality lead to permanent and constitutive expression of
the introduced gene (Benfey et al., EMBO J. 8 (1989), 2195-2202).
Another example of a suitable promoter is the legumin B promoter
(accession No. X03677).
The expression cassette may also comprise a chemically inducible
promoter which allows expression of the exogenous gene in the
plant to be governed at a particular point in time. Such
promoters, for example the PRP1 promoter (Ward et al., Plant.
Mol. Biol. 22 (1993), 361-366), a salicylic-acid-inducible
promoter (WO 95/19443), a benzenesulfonamide-inducible promoter
(EP-A-0388186), a tetracyclin-inducible promoter (Gatz et al.,
(1992) Plant J. 2, 397-404), an abscisic-acid-inducible promoter
CA 02381316 2002-02-07
11
(EP-A 335528) or an ethanol- or cyclohexanone-inducible promoter
(WO 93/21334), may also be used.
Furthermore, particularly preferred promoters are those which
ensure expression in tissues or plant organs in which the
biosynthesis of tocopherol or its precursors takes place.
Promoters which ensure leaf-specific expression must be mentioned
in particular. Promoters which must be mentioned are the potato
cytosolic FBPase or the potato ST-LSI promoter (Stockhaus et al.,
EMBO J. 8 (1989), 2445 - 245). Examples of seed-specific
promoters are the phaseolin promoter (US 5504200), the USP
promoter (Baumlein, H. et al., Mol. Gen. Genet. (1991) 225 (3),
459 - 467) or the LEB4 promoter (Fiedler, U. et al.,
Biotechnology (NY) (1995), 13 (10) 1090) together with the LEB4
signal peptide.
An expression cassette is generated by fusing a suitable promoter
to a suitable anti-HDG or HPPD nucleotide sequence, if
appropriate a sequence encoding a transit peptide, which is
preferably arranged between the promoter and the HPPD sequence,
and a terminator or polyadenylation signal. To this end,
customary recombination and cloning techniques are used as they
are described, for example, by T. Maniatis, E.F. Fritsch and
J. Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring
Harbor Laboratory, Cold Spring Harbor, NY (1989) and by
T.J. Silhavy, M.L. Berman and L.W. Enquist, Experiments with Gene
Fusions, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
(1984) and by Ausubel, F.M. et al., Current Protocols in
Molecular Biology, Greene Publishing Assoc. and Wiley
Interscience (1987).
As already mentioned other expression cassettes which can be used
are those whose DNA sequence encodes an HPPD fusion protein, part
of the fusion protein being a transit peptide which governs
translocation of the polypeptide. Examples are
chloroplast-specific transit peptides which are cleaved off
enzymatically from the HPPD residue after translocation of the
HPPD gene into the chloroplasts.
Particular mention must be made of the transit peptide derived
from plastid transketolase (TK) or from a functional equivalent
of this transit peptide (for example the transit peptide of the
RubisCO small subunit or of ferredoxin: NADP oxidoreductase).
The promoter and terminator regions may expediently be provided,
in the direction of transcription, with a linker or polylinker
containing one or more restriction sites for insertion of this
CA 02381316 2002-02-07
12
sequence. As a rule, the linker has 1 to 10, in most cases 1 to
8, preferably 2 to 6, restriction sites. In general, the linker
within the regulatory regions has a size less than 100 bp,
frequently less than 60 bp, but at least 5 bp.
The promoter, terminator and the other regulatory elements may be
native (homologous) or else foreign (heterologous) to the host
plant.
Genetic manipulations which provide suitable restriction cleavage
sites or which eliminate the excess DNA or restriction cleavage
sites may also be employed for the purposes of the invention.
Techniques known per se, such as, in-vitro mutagenesis, primer
repair, restriction or ligation may be used in cases where
insertions, deletions or substitutions such as, for example,
transitions and transversions, are suitable. Complementary ends
of the fragments may be provided for ligation by manipulations
such as, for example, restriction, chewing back or filling in
overhangs for blunt ends.
The expression cassettes according to the invention are
preferably inserted into suitable transformation vectors.
Suitable vectors are described, inter alia, in "Methods in Plant
Molecular Biology and Biotechnology" (CRC Press), Chapter 6/7,
pp. 71 - 119 (1993).
They are preferably cloned into a vector such as, for example,
pBinl9, pBinAR, pPZP200 or pPTV, which is suitable for
transforming Agrobacterium tumefaciens. Agrobacteria transformed
with such a vector can then be used in a known manner for
transforming plants, in particular crop plants, such as, for
example, tobacco plants, for example by bathing wounded leaves or
leaf sections in an agrobacterial suspension and subsequently
growing them in suitable media. The transformation of plants by
agrobacteria is known, inter alia, from F.F. White, Vectors for
Gene Transfer in Higher Plants; in Transgenic Plants, Vol. 1,
Engineering and Utilization, edited by S.D. Kung and R. Wu,
Academic Press, 1993, pp. 15 - 38.
Transgenic plants can be regenerated in a known manner from the
transformed cells of the wounded leaves or leaf sections.
The transfer of foreign genes into the genome of a plant is
termed transformation. It exploits the above-described methods of
transforming and regenerating plants from plant tissues or plant
cells for transient or stable transformation. Suitable methods
are protoplast transformation by polyethylene-glycol-induced DNA
817 / V V V 1 V CA 02381316 2002-02-07
13
uptake, the biolistic method using the gene gun, the so-called
particle bombardment method, electroporation, incubation of dry
embryos in DNA-containing solution, microinjection and
agrobacterium-mediated gene transfer. The abovementioned methods
are described, for example, in B. Jenes et al., Techniques for
Gene Transfer, in: Transgenic Plants, Vol. 1, Engineering and
Utilization, edited by S.D. Kung and R. Wu, Academic Press
(1993), 128 - 143, and in Potrykus, Annu. Rev. Plant Physiol.
Plant Molec. Biol. 42 (1991), 205 - 225). The construct to be
expressed is preferably cloned into a vector which is suitable
for the transformation of Agrobacterium tumefaciens, for example
pBinl9 (Bevan et al., Nucl. Acids Res. 12 (1984), 8711).
Agrobacteria transformed with an expression cassette can equally
be used in a known manner for transforming plants, in particular
crop plants such as cereals, maize, oats, soybeans, rice, cotton,
sugar beet, canola, sunflowers, flax, hemp, potatoes, tobacco,
tomatoes, oilseed rape, alfalfa, lettuce and the various tree,
nut and grapevine. species, for example by bathing wounded leaves
or leaf sections in an agrobacterial suspension and subsequently
growing them in suitable media.
The invention also relates to transgenic plants transformed with
an expression cassette according to the invention and to
transgenic cells, tissue, organs and propagation material of such
plants. Especially preferred in this context are transgenic crop
plants such as, for example, barley, wheat, rye, maize, oats,
soybeans, rice, cotton, sugar beet, canola, sunflowers, flax,
hemp, potatoes, tobacco, tomatoes, oilseed rape, alfalfa, lettuce
and the various tree, nut and grapevine species. Plants for the
purposes of the invention are monocotyledonous and dicotyledonous
plants or algae.
The invention is now illustrated in greater detail in the use
examples which follow, taking into consideration the appended
figures:
Figure 1 shows a schematic representation of the tocopherol
biosynthesis pathway in plants; PP represents
pyrophosphate; if homogentisate is reacted with
geranylgeranyl-PP (not shown) in the plant, the
corresponding tocotrienols are formed in a similar
fashion;
Figure 2 shows a binary transformation vector which expresses
HPPDop in the seeds of transformed plants and
simultaneously suppresses the expression of the
CA 02381316 2002-02-07
14
endogenous HGD: A = 35S-promoter; B = HGD in antisense
orientation; C = OCS terminator; D = legumin B promoter;
E = FNR transit peptide; F = HPPDop; G = NOS terminator;
15
5 Figure 3 shows construction schemes of the HPPD-encoding plasmids
pUCI9HPPDop and pCRScriptHPPDop;
Figure 4 shows construction schemes of the antiHGD-encoding
plasmids pBinARHGDanti and pCRScriptHGDanti; and
Figure 5 shows construction schemes of the transformation vectors
pPTVHGDanti and pPZP200HPPD.
General methods:
a) General cloning methods
The cloning steps carried out for the purposes of the present
invention, such as, for example, restriction cleavages, agarose
gel electrophoresis, purification of DNA fragments, transfer of
nucleic acids to nitrocellulose and nylon membranes, linkage of
DNA fragments, transformation of E. coli cells, growing bacteria,
multiplying phages and sequence analysis of recombinant DNA, were
carried out as described by Sambrook et al. (1989) Cold Spring
Harbor Laboratory Press; TSBN 0-87969-309-6.
b) Sequence analysis of recombinant DNA
The recombinant DNA molecules were sequenced with a Licor laser
fluorescence DNA sequencer (available from MWG Biotech,
Ebersbach) by the method of Sanger (Sanger et al., Proc. Natl.
Acad. Sci. USA 74 (1977), 5463 - 5467).
Example 1: Cloning a hydroxyphenylpyruvate dioxygenase (HPPD)
with a DNA sequence optimized for expression in Brassica napus
The amino acid sequence of the hydroxyphenylpyruvate dioxygenase
(HPPD) from Streptomyces avermitilis (accession No. U11864) was
back-translated into a DNA sequence taking into consideration the
codon usage in Brassica napus (oilseed rape). The codon usage was
determined by means of the database http://www.dna.affrc.go.jp/
-nakamura/index.html. The deduced sequence (SEQ ID N0:14) was
synthesized by ligating overlapping oligonucleotides, followed by
PCR amplification (Rouwendal, GJA; et al, (1997) PMB 33:
989-999), while attaching SalI cleavage sites. The correctness of
the sequence of the synthetic gene was checked by sequencing. The
0817 00010 CA 02381316 2002-02-07
synthetic gene was inserted into the vector pBluescript II SK+
(Stratagene).
Example 2: Cloning a Brassica napus homogentisate dioxygenase
5 (HGD)
a) Isolation of total RNA from Brassica napus flowers
Open flowers were harvested from Brassica napus var. Westar and
10 frozen in liquid nitrogen. The material was subsequently reduced
to a powder in a mortar and taken up in Z6 buffer (8M guanidinium
hydrochloride, 20 mM MES, 20 mM EDTA, brought to pH 7.0 with
NaOH; treated with 400 ~.1 mercaptoethanol/100 ml buffer
immediately prior to use). The suspension was then transferred
15 into reaction vessels and extracted by shaking with one volume of
phenol/chloroform/isoamyl alcohol 25:24:1. After centrifugation
for 10 minutes at 15,000 rotations, the supernatant was
transferred into a fresh reaction vessel and the RNA was
precipitated with 1/20 volume 1N acetic acid and 0.7 volume
ethanol (absolute). After recentrifugation, the pellet was first
washed with 3M sodium acetate solution and, after a further
centrifugation, with 70~ ethanol. The pellet was subsequently
dissolved in DEPC (diethylpyrocarbonate) water, and the RNA
concentration was determined photometrically.
b) Preparation of cDNA from total RNA from Brassica napus flowers
First, 20 ~,g of total RNA were treated with 3.3 ~,1 of 3M sodium
acetate solution, 2 ~,1 of 1M magnesium sulfate solution and made
up to an end volume of 10 ~,1 with DEPC water. To this, 1 ~.1 of
RNase-free DNase (Boehringer Mannheim) was added, and the mixture
was incubated for 45 minutes at 37 degrees. After the enzyme had
been removed by extraction by shaking with
phenol/chloroform/isoamyl alcohol, the RNA was precipitated with
ethanol and the pellet was taken up in 100 ~ul of DEPC water.
2.5 ~,g of RNA from this solution were transcribed into cDNA using
a cDNA kit (Gibco BRL) following the manufacturer's instructions.
c) PCR amplification of a subfragment of the Brassica napes HGD
A comparison of the DNA sequences of the known homogentisate
dioxygenases (HGD) from Arabidopsis thaliana (accession No.
U80668), Homo sapiens (accession No. U63008) and Mus musculus
(accession No. U58988) allowed oligonucleotides to be deduced,
for a PCR, which had an Sall cleavage site added at the 5'
terminus and an Asp718 restriction cleavage site at the 3'
CA 02381316 2002-02-07
16
10
terminus. The oligonucleotide at the 5' terminus encompasses the
sequence:
GTCGACGGNCCNATNGGNGCNAANGG (SEQ ID N0:2),
starting with base 661 of the Arabidopsis gene. The
oligonucleotide at the 3' terminus encompasses the sequence:
GGTACCTCRAACATRAANGCCATNGTNCC (SEQ ID N0:3),
starting with base 1223 of the Arabidopsis gene, where N is in
each case inosine and R represents the incorporation of A or G
into the oligonucleotide.
The PCR reaction was carried out with TAKARA Taq polymerase
following the manufacturer's instructions. The template used was
0.3 ~g of the cDNA. The PCR program was:
1 cycle: 94 degrees 1 min
5 cycles: 94 degrees 4 sec
50 degrees 30 sec
72 degrees 1 min
5 cycles: 94 degrees 4 sec
48 degrees 30 sec
72 degrees 1 min
25 cycles: 94 degrees 4 sec
46 degrees 30 sec
72 degrees 1 min
1 cycle: 72 degrees 30 min
The fragment was purified by means of NucleoSpin Extract (Machery
and Nagel) and cloned into the vector pGEMT (Promega) following
the manufacturer's instructions.
The correctness of the fragment was checked by sequencing.
Example 3: Generation of a plant transformation construct for
overexpressing HPPD with optimized DNA sequence (HPPDop) and
elimination of HGD
To generate plants which express HPPDop in seeds and in which the
expression of the endogenous HGD is suppressed by means of
antisense technology, a binary vector was constructed which
contains both gene sequences (Figure 2, construct VI).
CA 02381316 2002-02-07
17
a) Generation of an HPPDop expression cassette
To this end, the components of the cassette for expressing the
HPPDop, composed of the legumin B promoter (accession No.
5 X03677), the transit peptide of the spinach ferredoxin:NADP+
oxidoreductase (FNR; Jansen, T, et al (1988) Current Genetics 13,
517-522) and the NOS terminator (contained in pBI101 accession
No. U12668) were first provided with the necessary restriction
cleavage sites by means of PCR.
The legumin promoter was amplified by means of PCR from the
plasmid plePOCS (Baumlein, H, et a1.(1986) Plant J. 24, 233-239)
with the upstream oligonucleotide:
GAATTCGATCTGTCGTCTCAAACTC (SEQ ID NO: 4)
and the downstream oligonucleotide:
GGTACCGTGATAGTAAACAACTAATG (SEQ ID NO: 5)
and cloned into the vector PCR-Script (Stratagene) following the
manufacturer's instructions.
The transit peptide was amplified from the plasmid pSK-FNR
(Andrea Babette Regierer "Molekulargenetische Ansatze zur
Veranderung der Phosphat-Nutzungseffizienz von hoheren Pflanzen"
[Approaches in molecular genetics for altering the phosphate
utilization efficacy of higher plants], P+H Wissenschaftlicher
Verlag, Berlin 1998 ISBN: 3-9805474-9-3) by means of PCR using
the 5' oligonucleotide:
ATGGTACCTTTTTTGCATAAACTTATCTTCATAG (SEQ ID NO: 6)
and the 3' oligonucleotide:
ATGTCGACCCGGGATCCAGGGCCCTGATGGGTCCCATTTTCCC (SEQ ID NO: 7).
The NOS terminator was amplified from the plasmid pBI101
(Jefferson, R.A., et al (1987) EMBO J. 6 (13), 3901-3907) by
means of PCR using the 5' oligonucleotide:
GTCGACGAATTTCCCCGAATCGTTC: (SEQ ID NO: 8)
and the 3' oligonucleotide
AAGCTTCCGATCTAGTAACATAGA (SEQ ID N0: 9).
CA 02381316 2002-02-07
18
The amplicon was cloned in each case into the vector pCR-Script
(Stratagene) following the manufacturer's instructions.
For the expression cassette, the NOS terminator was first
recloned as an SalI/HindIII fragment into a suitably cut pUCl9
vector (Yanisch-Perron, C., et al (1985) Gene 33, 103-119). The
transit peptide was subsequently introduced into this plasmid as
an Asp718/Sall fragment. The legumin promoter was then cloned in
as an EcoRI/Asp718 fragment. The gene HPPDop was introduced into
this construct as an SalI fragment (Figure 3, construct III).
The finished cassette in pUCl9 was used as template for a PCR,
for which purpose the oligonucleotide:
AAGCTTGATCTGTCGTCTCAAACTC (SEQ ID NO: 10)
was used for the legumin promoter and the oligonucleotide:
AAGCTTCCGATCTAGTAACATAGA (SEQ ID NO: 11)
for the NOS terminator. The amplicon was cloned into pCR-Script
and named pCR-ScriptHPPDop (Figure 3, construct IV).
b) Construction of an antiHGD expression cassette
To eliminate HGD using the antisense technique, the gene fragment
was cloned as an SalI/Asp718 fragment into the vector pBinAR
(Hofgen, R. and Willmitzer, L., (1990) Plant Sci. 66: 221-230) in
which the 35S promoter and the OCS terminator are present (Figure
4, construct I). The construct acted as template for a PCR
reaction with the oligonucleotide:
ATTCTAGACATGGAGTCAAAGATTCAAATAGA (SEQ ID NO: 12),
specifically for the 35S promoter sequence,
and the oligonucleotide:
ATTCTAGAGGACAATCAGTAAATTGAACGGAG (SEQ ID NO: 13).
specifically for the OCS terminator sequence
The amplicon was cloned into the vector PCR-Script (Stratagene)
and named HGDanti (Figure 3, construct II).
.,
CA 02381316 2002-02-07
19
c) Construction of the binary vector
To construct a binary vector for the transformation of oilseed
rape, the construct HGDanti from pCRScriptHGDanti was first
cloned into the vector pPTV (Becker, D., (1992) PMB 20,
1195-1197) as an Xbal fragment (Figure 5, construct V). The
construct LegHPPDop from pCRScriptHPPDop was inserted into this
plasmid as an HindIII fragment. This plasmid was termed
pPTVHPPD/HGDanti (Figure 2, construct VI).
Example 4: Construction of cotransformation constructs for
overexpressing HPPDop and eliminating HGD in Brassica napes
plants
To cotransform plants with HPPDop and antiHGD, the construct
legumin B promoter/transit peptide/HPPDop/NOS was excised from
the vector pCRScriptHPPDop (Figure 3, construct IV) as an HindIII
fragment and inserted into the suitably cut vector pPZP200
(Hajdukiewicz, P., et al., (1994) PMB 25(6): 989-94) (Figure 5,
construct VII). This plasmid was used later for cotransforming
plants together with the vector pPTVHGDanti (Figure 5, construct
V) of Example 3 c).
Example 5: Generation of transgenic Brassica napes plants
The generation of transgenic oilseed rape plants approximately
followed a protocol by Bade, ,T. B. and Damm, B. (in Gene Transfer
to Plants, Potrykus, I. and Spangenberg, G., Hrsg., Springer Lab
Manual, Springer Verlag, 1995, 30-38), which also indicates the
composition of the media and buffers used.
The transformation was carried out with the Agrobacterium
tumefaciens strain EHA105 ( Li, X.Q., et al., PMB (1992) 20,
1037). Either the abovementioned plasmid pPTVHPPDopHGDanti
(Figure 2) or cultures of agrobacteria with the plasmids
pPTVHGDanti and pPZP200HPPDop (Figure 5), which cultures had been
mixed after growing, were used for the transformation.
Seeds of Brassica napes var. westar were surface-sterilized with
70o ethanol (v/v), washed in water for 10 minutes at 55°C,
incubated for 20 minutes in a to strength hypochlorite solution
(25o v/v Teepol, 0.1~ v/v Tween 20) and washed six times for
20 minutes with sterile water. The seeds were dried for three
days on filter paper and 10-15 seeds were germinated in a glass
flask containing 15 ml of germination medium. The roots and
apices were removed from several seedlings (approximate size
10 cm) and the remaining hypocotyls were cut into sections
CA 02381316 2002-02-07
approximately 6 mm in length. The approximately 600 explants thus
obtained were washed for 30 minutes in 50 ml of basal medium and
transferred into a 300-ml flask. After 100 ml of callus induction
medium had been added, the cultures were incubated for 24 hours
5 at 100 rpm.
Overnight cultures of the Agrobacterium strains were set up at
29~C in Luria broth medium supplemented with kanamycin (20 mg/1),
of which 2 ml were incubated for 4 hours at 29~C in 50 ml of Luria
10 broth medium without kanamycin until an OD6oo of 0.4-0.5 had been
reached. After the culture had been pelleted for 25 minutes at
2000 rpm, the cell pellet was resuspended in 25 ml of basal
.medium. The bacterial concentration in the solution was brought
to an OD6oo of 0.3 by adding more basal medium. For the
15 cotransformation, equal portions of the solution of both strains
were mixed.
The callus induction medium was removed from the oilseed rape
explants by means of sterile pipettes, 50 ml of Agrobacterium
20 solution were added, everything was mixed carefully and the
mixture was incubated for 20 minutes. The Agrobacterium
suspension was removed, the oilseed rape explants were washed for
1 minute with 50 ml of callus induction medium, and 100 ml of
callus induction medium were subsequently added. Cocultivation
was carried out for 24 hours on an orbital shaker at 100 rpm.
Cocultivation was stopped by removal of the callus induction
medium, and the explants were washed twice for 1 minute in each
case with 25 ml and twice for 60 minutes with in each case 100 ml
of wash medium at 100 rpm. The wash medium together with the
explants were transferred into 15-cm Petri dishes and the medium
was removed using sterile pipettes.
For the regeneration, in each case 20-30 explants were
transferred into 90-mm Petri dishes containing 25 ml of shoot
induction medium supplemented with phosphinotricin. The Petri
dishes were sealed with 2 layers of Leukopor and incubated at 25°C
and 2000 lux at photoperiods of 16 hours light/8 hours darkness.
Every 12 days, the calli which developed were transferred to
fresh Petri dishes with shoot induction medium. All further steps
for the regeneration of entire plants were carried out as
described by Bade, J.B and Damm, B. (in: Gene Transfer to Plants,
Potrykus, I. and Spangenberg, G., Hrsg., Springer Lab Manual,
Springer Verlag, 1995, 30-38).
CA 02381316 2002-02-07
21
SEQUENCE LISTING
<110> BASF Aktiengesellschaft
<120> Homogentisat-Dioxygenase
<130> M/40226
<140> 19937957.2
<141> 1999-08-11
<160> 15
<170> PatentIn Ver. 2.1
<210> 1
<211> 575
<212> DNA
<213> Brassica napus
<220>
<221> misc_feature
<222> (1). (6)
<223> /function= "Restriktionsschnittstelle
<220>
<221> misc_feature
<222> (570)..(575)
<223> /function = "Restriktionsschnittstelle"
<400> 1
gtcgacgggc cgatgggggc gaagggtctt gctgcaccaa gagattttct tgcaccaacg 60
gcatggtttg aggaagggct acggcctgac tacactattg ttcagaagtt tggcggtgaa 120
ctctttactg ctaaacaaga tttctctccg ttcaatgtgg ttgcctggca tggcaattac 180
gtgccttata agtatgacct gcacaagttc tgtccataca acactgtcct tgtagaccat 240
ggagatccat ctgtaaatac agttctgaca gcaccaacgg ataaacctgg tgtggccttg 300
cttgattttg tcatattccc tcctcgttgg ttggttgctg agcatacctt tcgacctcct 360
tactaccatc gtaactgcat gagtgaattt atgggcctaa tctatggtgc ttacgaggcc 420
aaagctgatg gatttctacc tggtggcgca agtcttcaca gttgtatgac acctcatggt 480
ccagatacaa ccacatacga ggcgacgatt gctcgtgtaa atgcaatggc tccttataag 540
ctcacaggca ccatggcctt catgtttgag gtacc 575
<210> 2
<211> 26
<212> DNA
<213> Kiinstliche Sequenz
<220>
<223> Beschreibung der kiinstlichen Sequenz: /desc =
"Oligonukleotid"
<220>
<221> misc_feature
<222> (9)
<223> /mod base = i
CA 02381316 2002-02-07
' . 22
<220>
<221> misc_feature
<222> (12)
<223> /mod base = i
<220>
<221> misc_feature
<222> (15)
<223> /mod base = i
<220>
<221> misc_feature
<222> (18)
<223> /mod base = i
<220>
<221> misc_feature
<222> (21)
<223> /mod base = i
<220>
<221> misc_feature
<222> (24)
<223> /mod base = i
<400> 2
gtcgacggnc cnatnggngc naangg 26
<210> 3
<211> 29
<212> DNA
<213> Kiinstliche Sequenz
<220>
<223> Beschreibung der kiinstlichen Sequenz: /desc =
"Oligonukleotid"
<220>
<221> misc_feature
<222> (18)
<223> /mod base = i
<220>
<221> misc_feature
<222> (24)
<223> /mod base = i
<220>
<221> misc_feature
<222> (27)
<223> /mod base = i
<400> 3
ggtacctcra acatraangc catngtncc 29
CA 02381316 2002-02-07
'. 23
<210> 4
<211> 25
<212> DNA
<213> Kiinstliche Sequenz
<220>
<223> Beschreibung der kiinstlichen Sequenz: /desc =
"Oligonukleotid"
<400> 4
gaattcgatc tgtcgtctca aactc 25
<210> 5
<211> 26
<212> DNA
<213> Kiinstliche Sequenz
<220>
<223> Beschreibung der kiinstlichen Sequenz: /desc =
"Oligonukleotid"
<400> 5
ggtaccgtga tagtaaacaa ctaatg 26
<210> 6
<211> 34
<212> DNA
<213> Kiinstliche Sequenz
<220>
<223> Beschreibung der kiinstlichen Sequenz: /desc =
"Oligonukleotid"
<400> 6
atggtacctt ttttgcataa acttatcttc stag 34
<210> 7
<211> 43
<212> DNA
<213> Kiznstliche Sequenz
<220>
<223> Beschreibung der kiinstlichen Sequenz: /desc =
"Oligonukleotid"
<400> 7
atgtcgaccc gggatccagg gccctgatgg gtcccatttt ccc 43
<210> 8
<211> 25
1
CA 02381316 2002-02-07
'. 24
<212> DNA
<213> Kiinstliche Sequenz
<220>
<223> Beschreibung der kiinstlichen Sequenz: /desc =
Oligonukleotid"
<400> 8
gtcgacgaat ttccccgaat cgttc 25
<210> 9
<211> 24
<212> DNA
<213> Kiinstliche Sequenz
<220>
<223>~Beschreibung der kiinstlichen Sequenz: /desc =
"Oligonukleotid"
<400> 9
aagcttccga tctagtaaca taga 24
<210> 10
<211> 25
<212> DNA
<213> Kiinstliche Sequenz
<220>
<223> Beschreibung der kiinstlichen Sequenz: /desc =
"Oligonukleotid"
<400> 10
aagcttgatc tgtcgtctca aactc 25
<210> 11
<211> 24
<212> DNA
<213> Kiinstliche Sequenz
<220>
<223> Beschreibung der kiinstlichen Sequenz: /desc =
"Oligonukleotid"
<400> 11
aagcttccga tctagtaaca taga 24
<210> 12
<211> 32
<212> DNA
<213> Kiinstliche Sequenz
<220>
CA 02381316 2002-02-07
<223> Beschreibung der kiinstlichen Sequenz: /desc =
"Oligonukleotid"
<400> 12
attctagaca tggagtcaaa gattcaaata ga 32
<210> 13
<211> 32
<212> DNA
<213> Kiinstliche Sequenz
<220>
<223> Beschreibung der kiinstlichen Sequenz: /desc =
"Oligonukleotid"
<400> 13
attctagagg acaatcagta aattgaacgg ag 32
<210> 14
<211> 1159
<212> DNA
<213> Kiinstliche Sequenz
<220>
<223> Beschreibung der kiinstlichen Sequenz: /desc =
"DNA"
<220>
<221> misc_feature
<222> (I)..(6)
<223> /function = "Restriktionsschnittstelle"
<220>
<221> CDS
<222> (8)..(1153)
<220>
<221> misc_feature
<222> (1154)..(1159)
<223> /function = "Restriktionsschnittstelle"
<400> 14
gtcgact atg act caa act act cat cat act cca gat act get aga caa 49
Met Thr Gln Thr Thr His His Thr Pro Asp Thr Ala Arg Gln
1 5 10
get gat cct ttt cca gtt aag gga atg gat get gtt gtt ttc get gtt 97
Ala Asp Pro Phe Pro Val Lys Gly Met Asp Ala Val Val Phe Ala Val
15 20 25 30
gga aac get aag caa get get cat tac tac tct act get ttc gga atg 145
Gly Asn Ala Lys Gln Ala Ala His Tyr Tyr Ser Thr Ala Phe Gly Met
40 45
CA 02381316 2002-02-07
' . 26
caa ctt gtt get tac tct gga cca gaa aac gga tct aga gaa act get 193
Gln Leu Val Ala Tyr Ser Gly Pro Glu Asn Gly Ser Arg Glu Thr Ala
50 55 60
tct tac gtt ctt act aac gga tct get aga ttc gtt ctt act tct gtt 241
Ser Tyr Val Leu Thr Asn Gly Ser Ala Arg Phe Val Leu Thr Ser Val
65 70 75
att aag cca get acc cca tgg gga cat ttc ctt get gat cac gtt get 289
Ile Lys Pro Ala Thr Pro Trp Gly His Phe Leu Ala Asp His Val Ala
80 85 90
gaa cac gga gat gga gtt gtt gat ctt get att gaa gtt cca gat get 337
Glu His Gly Asp Gly Val Val Asp Leu Ala Ile Glu Val Pro Asp Ala
95 100 105 110
aga get get cat get tac get att gaa cat gga get aga tct gtt get 385
Arg Ala Ala His Ala Tyr Ala Ile Glu His Gly Ala Arg Ser Val Ala
115 120 125
gaa cca tac gaa ctt aag gat gaa cat gga act gtt gtt ctt get get 433
Glu Pro Tyr Glu Leu Lys Asp Glu His Gly Thr Val Val Leu Ala Ala
130 135 140
att get act tac gga aag act aga cat act ctt gtt gat aga act gga 481
Ile Ala Thr Tyr Gly Lys Thr Arg His Thr Leu Val Asp Arg Thr Gly
145 150 155
tac gat gga cca tac ctt cca gga tac gtt get get get cca att gtt 529
Tyr Asp Gly Pro Tyr Leu Pro Gly Tyr Val Ala Ala Ala Pro Ile Val
160 165 170
gaa cca cca get cat aga acc ttc caa get att gac cat tgt gtt ggt 577
Glu Pro Pro Ala His Arg Thr Phe Gln Ala Ile Asp His Cys Val Gly
175 180 185 190
aac gtt gaa ctc gga aga atg aac gaa tgg gtt gga ttc tac aac aag 625
Asn Val Glu Leu Gly Arg Met Asn Glu Trp Val Gly Phe Tyr Asn Lys
195 200 205
gtt atg gga ttc act aac atg aag gaa ttc gtt gga gat gat att get 673
Val Met Gly Phe Thr Asn Met Lys Glu Phe Val Gly Asp Asp Ile Ala
210 215 220
act gag tac tct get ctt atg tct aag gtt gtt get gat gga act ctt 721
Thr Glu Tyr Ser Ala Leu Met Ser Lys Val Val Ala Asp Gly Thr Leu
225 230 235
aag gtt aaa ttc cca att aat gaa cca get ctt get aag aag aag tct 769
Lys Val Lys Phe Pro Ile Asn Glu Pro Ala Leu Ala Lys Lys Lys Ser
240 245 250
cag att gat gaa tac ctt gag ttc tac gga gga get gga gtt caa cat 817
Gln Ile Asp Glu Tyr Leu Glu Phe Tyr Gly Gly Ala Gly Val Gln His
255 260 265 270
CA 02381316 2002-02-07
27
att get ctt aac act gga gat atc gtg gaa act gtt aga act atg aga 865
Ile Ala Leu Asn Thr Gly Asp Ile Val Glu Thr Val Arg Thr Met Arg
275 280 285
get gca gga gtt caa ttc ctt gat act cca gat tct tac tac gat act 913
Ala Ala Gly Val Gln Phe Leu Asp Thr Pro Asp Ser Tyr Tyr Asp Thr
290 295 300
ctt ggt gaa tgg gtt gga gat act aga gtt cca gtt gat act ctt aga 961
Leu Gly Glu Trp Val Gly Asp Thr Arg Val Pro Val Asp Thr Leu Arg
305 310 315
gaa ctt aag att ctt get gat aga gat gaa gat gga tac ctt ctt caa 1009
Glu Leu Lys Ile Leu Ala Asp Arg Asp Glu Asp Gly Tyr Leu Leu Gln
320 325 330
atc ttc act aag cca gtt caa gat aga cca act gtg ttc ttc gaa atc 1057
Ile Phe Thr Lys Pro Val Gln Asp Arg Pro Thr Val Phe Phe Glu Ile
335 340 345 350
att gaa aga cat gga tct atg gga ttc gga aag ggt aac ttc aag get 1105
Ile Glu Arg His Gly Ser Met Gly Phe Gly Lys Gly Asn Phe Lys Ala
355 360 365
ctt ttc gaa get att gaa aga gaa caa gag aag aga gga aac ctt tag 1153
Leu Phe Glu Ala Ile Glu Arg Glu Gln Glu Lys Arg Gly Asn Leu
370 375 380
gtcgac 1159
<210> 15
<211> 381
<212> PRT
<213> Kiinstliche Sequenz
<223> Beschreibung der kiinstlichen Sequenz: /desc =
"DNA"
<400> 15
Met Thr Gln Thr Thr His His Thr Pro Asp Thr Ala Arg Gln Ala Asp
1 5 10 15
Pro Phe Pro Val Lys Gly Met Asp Ala Val Val Phe Ala Val Gly Asn
20 25 30
Ala Lys Gln Ala Ala His Tyr Tyr Ser Thr Ala Phe Gly Met Gln Leu
35 40 45
Val Ala Tyr Ser Gly Pro Glu Asn Gly Ser Arg Glu Thr Ala Ser Tyr
50 55 60
Val Leu Thr Asn Gly Ser Ala Arg Phe Val Leu Thr Ser Val Ile Lys
65 70 75 80
Pro Ala Thr Pro Trp Gly His Phe Leu Ala Asp His Val Ala Glu His
85 90 95
CA 02381316 2002-02-07
28
Gly Asp Gly Val Val Asp Leu Ala Ile Glu Val Pro Asp Ala Arg Ala
100 105 110
Ala His Ala Tyr Ala Ile Glu His Gly Ala Arg Ser Val Ala Glu Pro
115 120 125
Tyr Glu Leu Lys Asp Glu His Gly Thr Val Val Leu Ala Ala Ile Ala
130 135 140
Thr Tyr Gly Lys Thr Arg His Thr Leu Val Asp Arg Thr Gly Tyr Asp
145 150 155 160
Gly Pro Tyr Leu Pro Gly Tyr Val Ala Ala Ala Pro Ile Val Glu Pro
165 170 175
Pro Ala His Arg Thr Phe Gln Ala Ile Asp His Cys Val Gly Asn Val
180 185 190
Glu Leu Gly Arg Met Asn Glu Trp Val Gly Phe Tyr Asn Lys Val Met
195 200 205
Gly Phe Thr Asn Met Lys Glu Phe Val Gly Asp Asp Ile Ala Thr Glu
210 215 220
Tyr Ser Ala Leu Met Ser Lys Val Val Ala Asp Gly Thr Leu Lys Val
225 230 235 240
Lys Phe Pro Ile Asn Glu Pro Ala Leu Ala Lys Lys Lys Ser Gln Ile
245 250 255
Asp Glu Tyr Leu Glu Phe Tyr Gly Gly Ala Gly Val Gln His Ile Ala
260 265 270
Leu Asn Thr Gly Asp Ile Val Glu Thr Val Arg Thr Met Arg Ala Ala
275 280 285
Gly Val Gln Phe Leu Asp Thr Pro Asp Ser Tyr Tyr Asp Thr Leu Gly
290 295 300
Glu Trp Val Gly Asp Thr Arg Val Pro Val Asp Thr Leu Arg Glu Leu
305 310 315 320
Lys Ile Leu Ala Asp Arg Asp Glu Asp Gly Tyr Leu Leu Gln Ile Phe
325 330 335
Thr Lys Pro Val Gln Asp Arg Pro Thr Val Phe Phe Glu Ile Ile Glu
340 345 350
Arg His Gly Ser Met Gly Phe Gly Lys Gly Asn Phe Lys Ala Leu Phe
355 360 365
Glu Ala Ile Glu Arg Glu Gln Glu Lys Arg Gly Asn Leu
370 375 380
