Note: Descriptions are shown in the official language in which they were submitted.
CA 02384123 2002-03-06
WO 01/18182 PCT/L1S00/24110
Description
PICHIA METHANOLICA GLYCERALDEHYDE-3-PHOSPHATE
DEHYDROGENASE 2 PROMOTER AND TERMINATOR
BACKGROUND OF THE INVENTION
Methylotrophic yeasts are those yeasts that are able to utilize methanol
as a sole source of carbon and energy. Species of yeasts that have the
biochemical
pathways necessary for methanol utilization are classified in four genera,
Hansenula,
Pichia, Candida, and Torulopsis. These genera are somewhat artificial, having
been
based on cell morphology and growth characteristics, and do not reflect close
genetic
relationships (Billon-Grand, Mycotaxon 35:201-204, 1989; Kurtzman, Mycolo~ia
84:72-76, 1992). Furthermore, not all species within these genera are capable
of
utilizing methanol as a source of carbon and energy. As a consequence of this
classification, there are great differences in physiology and metabolism
between
individual species of a genus.
Methylotrophic yeasts are attractive candidates for use in recombinant
2 0 protein production systems for several reasons. First, some methylotrophic
yeasts have
been shown to grow rapidly to high biomass on minimal defined media. Second,
recombinant expression cassettes are genomically integrated and therefore
mitotically
stable. Third, these yeasts are capable of secreting large amounts of
recombinant
proteins. See, for example, Faber et al., Yeast 11:1331, 1995; Romanos et al.,
Yeast
8:423, 1992; Cregg et al., Bio/Technology 11:905, 1993; U.S. Patent No.
4,855,242;
U.S. Patent No. 4,857,467; U.S. Patent No. 4,879,231; and U.S. Patent No.
4,929,555;
and Raymond, U.S. Patents Nos. 5,716,808, 5,736,383, 5,854,039, and 5,888,768.
Previously described expression systems for methylotrophic yeasts rely
largely on the use of methanol-inducible transcription promoters. The use of
methanol
3 0 induced promoters is, however, problematic as production is scaled up to
commercial
levels. The overall volume of methanol used during the fermentation process
can be as
much as 40% of the final fermentation volue, and at 1000-liter fermentation
scale and
above the volumes of methanol required for induction necessitate complex and
potentially expensive considerations.
3 5 There remains a need in the art for additional materials and methods to
enable the use of methylotrophic yeasts for production of polypeptides of
economic
CA 02384123 2002-03-06
WO 01/18182 PCT/US00/24110
2
importance, including industrial enzymes and pharmaceutical proteins. The
present
invention provides such materials and methods as well as other, related
advantages.
SUMMARY OF THE INVENTION
It is an object of the present invention to provide transcription promoter
and terminator sequences for use in Pichia methanolica. It is a further object
of the
invention to provide materials and methods for obtaining constitutive
expression of
heterologous DNA in P. methanolica. It is also an object of the invention to
provide
methods for production of polypeptides in P. methanolica, which methods can be
readily scaled up to industrial levels, and to provide materials that can be
used within
these methods. It is another object of the invention to provide materials and
methods
for obtaining constitutive transcription of heterologous DNA to produce
recombinant
proteins in P. methanolica.
Within one aspect, the present invention provides an isolated DNA
molecule of up to 5000 nucleotides in length comprising nucleotide 93 to
nucleotide
1080 of SEQ ID NO:1.
Within a second aspect of the invention there is provided a DNA
construct comprising the following operably linked elements: a first DNA
segment
comprising at least a portion of the sequence of SEQ >D NO:1 from nucleotide
93 to
2 0 nucleotide 1092, wherein the portion is a functional transcription
promoter; a second
DNA segment encoding a protein of interest other than a Pichia methanolica
glyceraldehyde-3-phosphate dehydrogenase; and a third DNA segment comprising a
transcription terminator. Within one embodiment, the first DNA segment is from
900
to 1500 nucleotides in length. Within another embodiment, the first DNA
segment is
2 5 from 900 to 1000 nucleotides in length. Within an additional embodiment,
the first
DNA segment is substantially free of Pichia methanolica glyceraldehyde-3-
phosphate
dehydrogenase gene coding sequence. The DNA construct may further comprise a
selectable marker, preferably a Pichia methanolica gene, more preferably a
Pichia
methanolica ADE2 gene. The DNA construct may be a closed, circular molecule or
a
3 0 linear molecule. Within other embodiments, the DNA constuct further
comprises a
secretory signal sequence, such as the S. cerevisiae alpha-factor pre-pro
sequence,
operably linked to the first and second DNA segments. Within additional
embodiments, the third DNA segment comprises a transcription terminator of a
Pichia
methanolica AUGl or GAP2 gene.
3 5 Within a third aspect of the invention there is provided a Pichia
methanolica cell containing a DNA construct as disclosed above. Within one
embodiment, the DNA construct is genomically integrated. Within a related
CA 02384123 2002-03-06
WO 01/18182 PCT/US00/24110
3
embodiment, the DNA construct is genomically integrated in multiple copies.
Within a
further embodiment, the P. methanolica cell is functionally deficient in
vacuolar
proteases proteinase A and proteinase B.
Within a fourth aspect of the invention there is provided a method of
producing a protein of interest comprising the steps of (a) culturing a P.
methanolica
cell as disclosed above whereby the second DNA segment is expressed and the
protein
of interest is produced, and (b) recovering the protein of interest from the
cultured cell.
Within a fifth aspect of the invention there is provided a DNA construct
comprising the following operably linked elements: a first DNA segment
comprising a
Pichia methanolica gene transcription promoter; a second DNA segment encoding
a
protein of interest other than a Pichia methanolica protein; and a third DNA
segment
comprising nucleotides 2095 to 2145 of SEQ ID NO:1.
These and other aspects of the invention will become evident upon
reference to the following detailed description of the invention.
DETAILED DESCRIPTION OF THE INVENTION
The term "allelic variant" is used herein to denote an alternative form of
a gene. Allelic variation is known to exist in populations and arises through
mutation.
A "DNA construct" is a DNA molecule, either single- or double-
t 0 stranded, that has been modified through human intervention to contain
segments of
DNA combined and juxtaposed in an arrangement not existing in nature.
A "DNA segment" is a portion of a larger DNA molecule having
specified attributes. For example, a DNA segment encoding a specified
polypeptide is
a portion of a longer DNA molecule, such as a plasmid or plasmid fragment,
that, when
2 5 read from the 5' to the 3' direction, encodes the sequence of amino acids
of the
specified polypeptide.
The term "functionally deficient" denotes the expression in a cell of less
than 10% of an activity as compared to the level of that activity in a wild-
type
counterpart. It is preferred that the expression level be less than 1 % of the
activity in
3 0 the wild-type counterpart, more preferably less than 0.01 % as determined
by
appropriate assays. It is most preferred that the activity be essentially
undetectable (i.e.,
not significantly above background). Functional deficiencies in genes can be
generated
by mutations in either coding or non-coding regions.
The term "gene" is used herein to denote a DNA segment encoding a
3 5 polypeptide. Where the context allows, the term includes genomic DNA (with
or
without intervening sequences), cDNA, and synthetic DNA. Genes may include non
coding sequences, including promoter elements.
CA 02384123 2002-03-06
WO 01/18182 PCT/US00/24110
4
The term "isolated", when applied to a polynucleotide, denotes that the
polynucleotide has been removed from its natural genetic milieu and is thus
free of
other extraneous or unwanted coding sequences, and is in a form suitable for
use within
genetically engineered protein production systems. Such isolated molecules are
those
that are separated from their natural environment and include cDNA and genomic
clones.
"Operably linked", when referring to DNA segments, indicates that the
segments are arranged so that they function in concert for their intended
purposes, e.g.,
transcription initiates in the promoter and proceeds through the coding
segment to the
terminator.
A "polynucleotide" is a single- or double-stranded polymer of
deoxyribonucleotide or ribonucleotide bases read from the 5' to the 3' end.
Polynucleotides include RNA and DNA, and may be isolated from natural sources,
synthesized in vitro, or prepared from a combination of natural and synthetic
molecules.
Sizes of polynucleotides are expressed as base pairs (abbreviated "bp"),
nucleotides
("nt"), or kilobases ("kb"). Where the context allows, the latter two terms
may describe
polynucleotides that are single-stranded or double-stranded. When these terms
are
applied to double-stranded molecules they are used to denote overall length
and will be
understood to be equivalent to the term "base pairs". It will be recognized by
those
2 0 skilled in the art that the two strands of a double-stranded
polynucleotide may differ
slightly in length and that the ends thereof may be staggered as a result of
enzymatic
cleavage; thus all nucleotides within a double-stranded polynucleotide
molecule may
not be paired. Such unpaired ends will in general not exceed 20 nt in length.
A "polypeptide" is a polymer of amino acid residues joined by peptide
2 5 bonds, whether produced naturally or synthetically. Polypeptides of less
than about 10
amino acid residues are commonly referred to as "peptides".
The term "promoter" is used herein for its art-recognized meaning to
denote a portion of a gene containing DNA sequences that provide for the
binding of
RNA polymerase and initiation of transcription. Promoter sequences are
commonly,
3 0 but not always, found in the 5' non-coding regions of genes. Sequences
within
promoters that function in the initiation of transcription are often
characterized by
consensus nucleotide sequences. These promoter elements include RNA polymerase
binding sites, TATA sequences, and transcription factor binding sites. See, in
general,
Watson et al., eds., Molecular Biology of the Gene, 4th ed., The
Benjamin/Cummings
3 5 Publishing Company, Inc., Menlo Park, CA, 1987.
A "pro sequence" is a DNA sequence that commonly occurs
immediately 5' to the mature coding sequence of a gene encoding a secretory
protein.
CA 02384123 2002-03-06
WO 01/18182 PCT/US00/24110
The pro sequence encodes a pro peptide that serves as a cis-acting chaperone
as the
protein moves through the secretory pathway.
A "protein" is a macromolecule comprising one or more polypeptide
chains. A protein may also comprise non-peptidic components, such as
carbohydrate
5 groups. Carbohydrates and other non-peptidic substituents may be added to a
protein
by the cell in which the protein is produced, and will vary with the type of
cell.
Proteins are commonly defined in terms of their amino acid backbone
structures;
substituents such as carbohydrate groups are generally not specified, but may
be present
nonetheless.
l0 The term "secretory signal sequence" denotes a DNA sequence that
encodes a polypeptide (a "secretory peptide") that, as a component of a larger
polypeptide, directs the larger polypeptide through a secretory pathway of a
cell in
which it is synthesized. The larger polypeptide is commonly cleaved to remove
the
secretory peptide during transit through the secretory pathway. A secretory
peptide and
a pro peptide may be collectively referred to as a pre-pro peptide.
The present invention provides isolated DNA molecules comprising a
Pichia methanolica glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene
promoter. The invention also provides isolated DNA molecules comprising a P.
methanolica GAPDH gene terminator. The promoter and terminator can be used
within
2 0 methods of producing proteins of interest, including proteins of
pharmaceutical or
industrial value.
The sequence of a DNA molecule comprising a Pichia methanolica
glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene promoter, coding region,
and terminator is shown in SEQ ID NO:1. The gene has been designated GAP2.
Those
2 5 skilled in the art will recognize that SEQ ID NO: l represents a single
allele of the P.
methanolica GAP2 gene and that other functional alleles (allelic variants) are
likely to
exist, and that allelic variation may include nucleotide changes in the
promoter region,
coding region, or terminator region.
The partial sequence of a second P. methanolica glyceraldehyde-3-
30 phosphate dehydrogenase gene, designated GAPl, is shown in SEQ >D N0:2.
Within SEQ ID NO:I, the GAPDH open reading frame begins with the
methionine codon (ATG) at nucleotides 1093 - 1095. The transcription promoter
is
located upstream of the ATG. Gene expression experiments showed that a
functional
promoter was contained within the ca. 1000 nucleotide 5'-flanking region of
the GAP2
3 5 gene.
Preferred portions of the sequence shown in SEQ m NO:1 for use
within the present invention as transcription promoters include segments
comprising at
CA 02384123 2002-03-06
WO 01/18182 PCT/LJS00/24110
6
least 900 contiguous nucleotides of the 5' non-coding region of SEQ >D NO:1,
and
preferably comprising nucleotide 93 to nucleotide 1080 of the sequence shown
in SEQ
>D NO:1. Those skilled in the art will recognize that longer portions of the
5' non-
coding region of the P. methanolica GAP2 gene can also be used. Promoter
sequences
of the present invention can thus include the sequence of SEQ ID NO:1 through
nucleotide 1092 in the 3' direction and can extend to or beyond nucleotide 1
in the 5'
direction. In general, the promoter used within an expression DNA construct
will not
exceed 1.5 kb in length, and will preferably not exceed 1.0 kb in length. In
addition to
these promoter fragments, the invention also provides isolated DNA molecules
of up to
l0 about 3300 bp, as well as isolated DNA molecules of up to 5000 bp, wherein
said
molecules comprise the P. methanolica GAP2 promoter sequence.
As disclosed in more detail in the examples that follow, the sequence of
SEQ >D NO:1 from nucleotide 93 to nucleotide 1080 provides a functional
transcription
promoter. However, additional nucleotides can be removed from either or both
ends of
this sequence and the resulting sequence tested for promoter function by
joining it to a
sequence encoding a protein, preferably a protein for which a convenient assay
is
readily available.
Within the present invention it is preferred that the GAP2 promoter be
substantially free of GAP2 gene coding sequence, which begins with nucleotide
1093 in
2 0 SEQ >D NO:1. As used herein, "substantially free" of GAP2 gene coding
sequence
means that the promoter DNA includes not more than 15 nucleotides of the GAP2
coding sequence, preferably not more than 10 nucleotides, and more preferably
not
more than 3 nucleotides. Within a preferred embodiment of the invention, the
GAP2
promoter is provided free of coding sequence of the P. methanolica GAP2 gene.
2 5 However, those skilled in the art will recognize that a GAP2 gene fragment
that
includes the initiation ATG (nucleotides 1093 to 1095) of SEQ >D NO:1 can be
operably linked to a heterologous coding sequence that lacks an ATG, with the
GAP2
ATG providing for intition of translation of the heterologous sequence. Those
skilled
in the art will further recognize that additional GAP2 coding sequences can
also be
3 0 included, whereby a fusion protein comprising GAP2 and heterologous amino
acid
sequences is produced. Such a fusion protein may comprise a cleavage site to
facilitate
separation of the GAP2 and heterologous sequences subsequent to translation.
In addition to the GAP2 promoter sequence, the present invention also
provides transcription terminator sequences derived from the 3' non-coding
region of
3 5 the P. methanolica GAP2 gene. A consensus transcription termination
sequence (Chen
and Moore, Mol. Cell. Biol. 12:3470-3481, 1992) is at nucleotides 2136 to 2145
of SEQ
m NO:1. Within the present invention, there are thus provided transcription
terminator
CA 02384123 2002-03-06
WO 01/18182 PCT/US00/24110
7
gene segments of at least about 50 bp, preferably at least 60 bp, more
preferably at least
90 bp, still more preferably about 200 by in length. The terminator segments
of the
present invention may comprise 500-1000 nucleotides of the 3' non-coding
region of
SEQ >D NO:1. These segments comprise the termination sequence disclosed above,
and preferably have as their 5' termini nucleotide 2095 of SEQ >D NO:l. Those
skilled
in the art will recognize, however, that the transcription terminator segment
that is
provided in an expression vector can include at its 5' terminus the TAA
translation
termination codon at nucleotides 2092-2094 of SEQ 1D NO: l to permit the
insertion of
coding sequences that lack a termination codon.
1 o Techniques for manipulating cloned DNA molecules and introducing
exogenous DNA into a variety of host cells are well known in the art and are
disclosed
by, for example, Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd
ed.,
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989; Murray,
ed.,
Gene Transfer and Expression Protocols, Humana Press, Clifton, NJ, 1991; Glick
and
Pasternak, Molecular Biotechnology: Principles and Applications of Recombinant
DNA, ASM Press, Washington, D.C., 1994; Ausubel et al. (eds.), Short Protocols
in
Molecular Biolo~y, 3rd edition, John Wiley and Sons, Inc., NY, 1995; Wu et
al.,
Methods in Gene Biotechnology, CRC Press, New York, 1997. DNA vectors,
including expression vectors, commonly contain a selectable marker and origin
of
2 0 replication that function in a bacterial host (e.g., E. coli) to permit
the replication and
amplification of the vector in a prokaryotic host. If desired, these
prokaryotic elements
can be removed from a vector before it is introduced into an alternative host.
For
example, such prokaryotic sequences can be removed by linearization of the
vector
prior to its introduction into a P. methanolica host cell.
2 5 Within certain embodiments of the invention, expression vectors are
provided that comprise a first DNA segment comprising at least a portion of
the
sequence of SEQ >D NO:1 that is a functional transcription promoter operably
linked to
a second DNA segment encoding a protein of interest. When it is desired to
secrete the
protein of interest, the vector will further comprise a secretory signal
sequence operably
3 0 linked to the first and second DNA segments. The secretory signal sequence
may be
that of the protein of interest, or may be derived from another secreted
protein,
preferably a secreted yeast protein. A preferred such yeast secretory signal
sequence is
the S. cerevisiae alpha-factor (MFal) pre-pro sequence (disclosed by Kurjan et
al., U.S.
Patent No. 4,546,082 and Brake, U.S. Patent No. 4,870,008).
3 5 Within other embodiments of the invention, expression vectors are
provided that comprise a DNA segment comprising a portion of SEQ ID NO:1 that
is a
functional transcription terminator operably linked to an additional DNA
segment
CA 02384123 2002-03-06
WO 01/18182 PCT/US00/24110
8
encoding a protein of interest. Within one embodiment, the GAP2 promoter and
terminator sequences of the present invention are used in combination, wherein
both are
operably linked to a DNA segment encoding a protein of interest within an
expression
vector.
Expression vectors of the present invention further comprise a selectable
marker to permit identification and selection of P. methanolica cells
containing the
vector. Selectable markers provide for a growth advantage of cells containing
them.
The general principles of selection are well known in the art. The selectable
marker is
preferably a P. methanolica gene. Commonly used selectable markers are genes
that
encode enzymes required for the synthesis of amino acids or nucleotides. Cells
having
mutations in these genes cannot grow in media lacking the specific amino acid
or
nucleotide unless the mutation is complemented by the selectable marker. Use
of such
"selective" culture media ensures the stable maintenance of the heterologous
DNA
within the host cell. A preferred selectable marker of this type for use in P.
methanolica is a P. methanolica ADE2 gene, which encodes phosphoribosyl-5-
aminoimidazole carboxylase (AIRC; EC 4.1.1.21). See, Raymond, U.S. Patent No.
5,736,383. The ADE2 gene, when transformed into an ade2 host cell, allows the
cell to
grow in the absence of adenine. The coding strand of a representative P.
methanolica
ADE2 gene sequence is shown in SEQ m N0:3. The sequence illustrated includes
2 0 1006 nucleotides of 5' non-coding sequence and 442 nucleotides of 3' non-
coding
sequence, with the initiation ATG codon at nucleotides 1007-1009. Within a
preferred
embodiment of the invention, a DNA segment comprising nucleotides 407-2851 is
used
as a selectable marker, although longer or shorter segments could be used as
long as the
coding portion is operably linked to promoter and terminator sequences. In the
2 5 alternative, a dominant selectable marker, which provides a growth
advantage to wild
type cells, may be used. Typical dominant selectable markers are genes that
provide
resistance to antibiotics, such as neomycin-type antibiotics (e.g., G418),
hygromycin B,
and bleomycin/phleomycin-type antibiotics (e.g., ZeocinTM; available from
Invitrogen
Corporation, San Diego, CA). A preferred dominant selectable marker for use in
P.
3 o methanolica is the Sh bla gene, which inhibits the activity of ZeocinTM.
The use of P. methanolica cells as a host for the production of
recombinant proteins is disclosed in WIPO Publications WO 97/17450, WO
97/17451,
WO 98/02536, and WO 98/02565; and U.S. Patents Nos. 5,716,808, 5,736,383,
5,854,039, and 5,736,383. Expression vectors for use in transforming P.
methanolica
3 5 will commonly be prepared as double-stranded, circular plasmids, which are
preferably
linearized prior to transformation. To facilitate integration of the
expression vector
DNA into the host chromosome, it is preferred to have the entire expression
segment of
CA 02384123 2002-03-06
WO 01/18182 PCT/US00/24110
9
the plasmid flanked at both ends by host DNA sequences (e.g., AUGI 3'
sequences).
Electroporation is used to facilitate the introduction of a plasmid containing
DNA
encoding a polypeptide of interest into P. methanolica cells. It is preferred
to transform
P. methanolica cells by electroporation using an exponentially decaying,
pulsed electric
field having a field strength of from 2.5 to 4.5 kV/cm, preferably about 3.75
kV/cm,
and a time constant (~) of from 1 to 40 milliseconds, most preferably about 20
milliseconds.
Integrative transformants are preferred for use in protein production
processes. Such cells can be propagated without continuous selective pressure
because
1 o DNA is rarely lost from the genome. Integration of DNA into the host
chromosome can
be confirmed by Southern blot analysis. Briefly, transformed and untransformed
host
DNA is digested with restriction endonucleases, separated by electrophoresis,
blotted to
a support membrane, and probed with appropriate host DNA segments. Differences
in
the patterns of fragments seen in untransformed and transformed cells are
indicative of
integrative transformation. Restriction enzymes and probes can be selected to
identify
transforming DNA segments (e.g., promoter, terminator, heterologous DNA, and
selectable marker sequences) from among the genomic fragments.
Differences in expression levels of heterologous proteins can result from
such factors as the site of integration and copy number of the expression
cassette among
2 0 individual isolates. It is therefore advantageous to screen a number of
isolates for
expression level prior to selecting a production strain. Isolates exhibiting a
high
expression level will commonly contain multiple integrated copies of the
desired
expression cassette. A variety of suitable screening methods are available.
For
example, transformant colonies are grown on plates that are overlayed with
membranes
2 5 (e.g., nitrocellulose) that bind protein. Proteins are released from the
cells by secretion
or following lysis, and bind to the membrane. Bound protein can then be
assayed using
known methods, including immunoassays. More accurate analysis of expression
levels
can be obtained by culturing cells in liquid media and analyzing conditioned
media or
cell lysates, as appropriate. Methods for concentrating and purifying proteins
from
3 0 media and lysates will be determined in part by the protein of interest.
Such methods
are readily selected and practiced by the skilled practitioner.
For production of secreted proteins, host cells having functional
deficiencies in the vacuolar proteases proteinase A, which is encoded by the
PEP4
gene, and proteinase B, which is encoded by the PRBI gene, are preferred in
order to
3 5 minimize spurious proteolysis. Vacuolar protease activity (and therefore
vacuolar
protease deficiency) is measured using any of several known assays. Preferred
assays
are those developed for Saccharomyces cerevisiae and disclosed by Jones,
Methods
CA 02384123 2002-03-06
WO 01/18182 PCT/iJS00/24110
Ei2zymol. 194:428-453, 1991. A preferred such assay is the APNE overlay assay,
which
detects activity of carboxypeptidase Y (CpY). See, Wolf and Fink, J. Bact.
123:1150-
1156, 1975. Because the zymogen (pro)CpY is activated by proteinase A and
proteinase B, the APNE assay is indicative of vacuolar protease activity in
general. The
5 APNE overlay assay detects the carboxypeptidase Y-mediated release of (3-
naphthol
from N-acetyl-phenylalanine-(3-naphthyl-ester (APNE), which results in the
formation
of an isoluble red dye by the reaction of the (3-naphthol with the diazonium
salt Fast
Garnet GBC. Cells growing on assay plates (YEPD plates are preferred) at room
temperature are overlayed with 8 ml RxM. RxM is prepared by combining 0.175 g
10 agar, 17.5 ml HBO, and 5 ml 1 M Tris-HCl pH 7.4, microwaving the mixture to
dissolve
the agar, cooling to ~55°C, adding 2.5 ml freshly made APNE (2 mg/ml in
dimethylformamide) (Sigma Chemical Co., St. Louis, MO), and, immediately
before
assay, 20 mg Fast Garnet GBC salt (Sigma Chemical Co.). The overlay is allowed
to
solidify, and color development is observed. Wild-type colonies are red,
whereas CPY
deletion strains are white. Carboxypeptidase Y activity can also be detected
by the well
test, in which cells are distributed into wells of a microtiter test plate and
incubated in
the presence of N benzoyl-L-tyrosine p-nitroanilide (BTPNA) and
dimethylformamide.
The cells are permeabilized by the dimethylformamide, and CpY in the cells
cleaves the
amide bond in the BTPNA to give the yellow product p-nitroaniline. Assays for
CpY
2 0 will detect any mutation that reduces protease activity so long as that
activity ultimately
results in the reduction of CpY activity.
P. methanolica cells are cultured in a medium comprising adequate
sources of carbon, nitrogen and trace nutrients at a temperature of about
25°C to 35°C.
Liquid cultures are provided with sufficient aeration by conventional means,
such as
2 5 shaking of small flasks or sparging of fermentors. A preferred culture
medium for P.
methanolica is YEPD (2% D-glucose, 2% BactoTM Peptone (Difco Laboratories,
Detroit, MI), 1 % BactoTM yeast extract (Difco Laboratories), 0.004% adenine,
0.006%
L-leucine).
For large-scale culture, one to two colonies of a P. methanolica strain
3 0 can be picked from a fresh agar plate (e.g, YEPD agar) and suspended in
250 ml of
YEPD broth contained in a two-liter baffled shake flask. The culture is grown
for 16 to
24 hours at 30°C and 250 rpm shaking speed. Approximately 50 to 80
milliliters of
inoculum are used per liter starting fermentor volume (5 - 8% v/v inoculum).
A preferred fermentation medium is a soluble medium comprising
3 5 glucose as a carbon source, inorganic ammonia, potassium, phosphate, iron,
and citric
acid. As used herein, a "soluble medium" is a medium that does not contain
visible
precipitation. Preferably, the medium lacks phosphate glass (sodium
CA 02384123 2002-03-06
WO 01/18182 PCT/US00/24110
11
hexametaphosphate). A preferred medium is prepared in deionized water and does
not
contain calcium sulfate. As a minimal medium, it is preferred that the medium
lacks
polypeptides or peptides, such as yeast extracts. However, acid hydrolyzed
casein (e.g.,
casamino acids or amicase) can be added to the medium if desired. An
illustrative
fermentation medium is prepared by mixing the following compounds: (NH4)~S04
(11.5 grams/liter), KZHP04 (2.60 grams/liter), KH~P04 (9.50 grams/liter),
FeS04~7H20
(0.40 grams/liter), and citric acid ( 1.00 gram/liter). After adding
distilled, deionized
water to one liter, the solution is sterilized by autoclaving, allowed to
cool, and then
supplemented with the following: 60% (w/v) glucose solution (47.5
milliliters/liter),
lOx trace metals solution (20.0 milliliters/liter), 1 M MgS04 (20.0
milliliters/liter), and
vitamin stock solution (2.00 milliliters/liter). The lOx trace metals solution
contains
FeS04~7H~0 (100 mM), CuS04~5H20 (2 mM), ZnS04~7H20 (8 mM), MnS04~H~0 (8
mM), CoC12~6H20 (2 mM), Na~Mo04~2H~0 (1 mM), H~B03 (8 mM), KI (0.5 mM),
NiS04~6H20 (1 mM), thiamine (0.50 grams/liter), and biotin (5.00
milligrams/liter).
The vitamin stock solution contains inositol (47.00 grams/liter), pantothenic
acid (23.00
grams/liter), pyrodoxine ( 1.20 grams/liter), thiamine (5.00 grams/liter), and
biotin (0.10
gram/liter). Those of skill in the art can vary these particular ingredients
and amounts.
For example, ammonium sulfate can be substituted with ammonium chloride, or
the
amount of ammonium sulfate can be varied, for example, from about 11 to about
22
2 0 grams/liter.
After addition of trace metals and vitamins, the pH of the medium is
typically adjusted to pH 4.5 by addition of 10% H3P04. Generally, about 10
milliliters/liter are added, and no additional acid addition will be required.
During
fermentation, the pH is maintained between about 3.5 to about 5.5, or about
4.0 to
2 5 about 5.0, depending on protein produced, by addition of 5 N NH40H.
An illustrative fermentor is a BIOFLO 3000 fermentor system (New
Brunswick Scientific Company, Inc.; Edison, NJ). This fermentor system can
handle
either a six-liter or a fourteen-liter fermentor vessel. Fermentations
performed with the
six-liter vessel are prepared with three liters of medium, whereas
fermentations
3 0 performed with the fourteen-liter vessel are prepared with six liters of
medium. The
fermentor vessel operating temperature is typically set to 30°C for the
course of the
fermentation, although the temperature can range between 27-31 °C
depending on the
protein expressed. The fermentation is initiated in a batch mode. The glucose
initially
present is often used by approximately 10 hours elapsed fermentation time
(EFT), at
3 5 which time a glucose feed can be initiated to increase the cell mass. An
illustrative
glucose feed contains 900 milliliters of 60% (w/v) glucose, 60 milliliters of
50% (w/v)
(NH4)~S04, 60 milliliters of lOx trace metals solution, and 30 milliliters of
1 M MgS04.
CA 02384123 2002-03-06
WO 01/18182 PCT/US00/24110
12
Pichia methanolica fermentation is robust and requires high agitation,
aeration, and
oxygen sparging to maintain the percentage dissolved oxygen saturation above
30%.
The percentage dissolved oxygen should not drop below 15% for optimal
expression
and growth. The biomass typically reaches about 30 to about 80 grams dry cell
weight
per liter at 48 hours EFT.
Proteins produced according to the present invention are recovered from
the host cells using conventional methods. If the protein is produced
intracellulary, the
cells are harvested (e.g., by centrifugation) and lysed to release the
cytoplasmic
contents. Methods of lysis include enzymatic and mechanical disruption. The
crude
l0 extract is then fractionated according to known methods, the specifics of
which will be
determined for the particular protein of interest. Secreted proteins are
recovered from
the conditioned culture medium using standard methods, also selected for the
particular
protein. See, in general, Scopes, Protein Purification: Principles and
Practice,
Springer-Verlag, New York, 1994.
The materials and methods of the present invention can be used to
produce proteins of research, industrial, or pharmaceutical interest. Such
proteins
include enzymes, such as lipases, cellulases, and proteases; enzyme
inhibitors,
including protease inhibitors; growth factors such as platelet derived growth
factor
(PDGF), fibroblast growth factors (FGF), epidermal growth factor (EGF),
vascular
2 0 endothelial growth factors (VEGFs); glutamic acid decarboxylase (GAD);
cytokines,
such as erythropoietin, thrombopoietin, colony stimulating factors,
interleukins, and
interleukin antagonist; hormones, such as insulin, proinsulin, leptin, and
glucagon; and
receptors, including growth factor receptors, which can be expressed in
truncated form
("soluble receptors") or as fusion proteins with, for example, immunoglobulin
constant
2 5 region sequences. DNAs encoding these and other proteins are known in the
art. See,
for example, U.S. Patents Nos. 4,889,919; 5,219,759; 4,868,119; 4,968,607;
4,599,311;
4,784,950; 5,792,850; 5,827,734; 4,703,008; 4,431,740; and 4,762,791; and WIPO
Publications WO 95/21920 and WO 96/22308.
It is particularly preferred to use the present invention to produce
3 0 unglycosylated pharmaceutical proteins. Yeast cells, including P.
methanolica cells,
produce glycoproteins with carbohydrate chains that differ from their
mammalian
counterparts. Mammalian glycoproteins produced in yeast cells may therefore be
regarded as "foreign" when introduced into a mammal, and may exhibit, for
example,
different pharmacokinetics than their naturally glycosylated counterparts.
3 5 The invention is further illustrated by the following, non-limiting
examples.
CA 02384123 2002-03-06
WO 01/18182 PCT/US00/24110
13
EXAMPLES
Example 1
To clone the P. methanolica GAPl gene, sense (ZC11,356; SEQ ID
N0:4) and antisense (ZC11,357; SEQ ID NO:S) PCR primers were designed from an
alignment of the coding regions of GAPDH genes of Saccharomyces cerevisiae,
Kluyveromyces lactis, and mouse. The primers were then used to amplify P.
methanolica genomic DNA. An amplified sequence 608 by long was recovered and
was found to have 78.1 °7o homology to the corresponding S. cerevisiae
GAPDH gene
sequence.
A P. methanolica genomic library was constructed in the vector pRS426
(Christianson et al., Gene 110:119-122, 1992), a shuttle vector comprising 2~
and S.
cerevisiae URA3 sequences, allowing it to be propagated in S. cerevisiae.
Genomic
DNA was prepared from strain CBS6515 according to standard procedures.
Briefly,
cells were cultured overnight in rich media, spheroplasted with zymolyase, and
lysed
with SDS. DNA was precipitated from the lysate with ethanol and extracted with
a
phenol/chloroform mixture, then precipitated with ammonium acetate and
ethanol. Gel
electrophoresis of the DNA preparation showed the presence of intact, high
molecular
weight DNA and appreciable quantities of RNA. The DNA was partially digested
with
Sau 3A by incubating the DNA in the presence of a dilution series of the
enzyme.
2 0 Samples of the digests were analyzed by electrophoresis to determine the
size
distribution of fragments. DNA migrating between 4 and 12 kb was cut from the
gel
and extracted from the gel slice. The size-fractionated DNA was then ligated
to
pRS426 that had been digested with Bam HI and treated with alkaline
phosphatase.
Aliquots of the reaction mixture were electroporated into E. coli MC1061 cells
using an
2 5 electroporator (Gene PulserTM; BioRad Laboratories, Hercules, CA) as
recommended
by the manufacturer.
The library was screened by PCR using sense (ZC11,733; SEQ ID
N0:6) and antisense (ZC11,734; SEQ m N0:7) primers designed from the sequenced
region of the P. methanolica GAPDH. The PCR reaction mixture was incubated for
3 0 one minute at 94°C; followed by 34 cycles of 94°C, one
minute, 52°C, 45 seconds,
72°C, two minutes; and a termination cycle of 94°C, one minute,
54°C, one minute,
72°C, eleven minutes. Starting with 43 library pools, positive pools
were identified and
broken down to individual colonies. A single colony with a pRS426 plasmid
containing the P. methanolica GAPDH gene as its insert was isolated. The
orientation
3 5 of the GAPDH gene and the length of the 5' and 3' flanking sequences in
the insert
were deduced by DNA sequencing (SEQ ID N0:2). This gene was designated GAPl.
CA 02384123 2002-03-06
WO 01/18182 PCT/US00/24110
14
Within SEQ ~ N0:2, the GAPDH open reading frame begins with the
methionine codon (ATG) at nucleotides 1733 - 1735. The transcription promoter
is
located upstream of the ATG. Gene expression experiments showed that a
functional
promoter was contained within the ca. 900 nucleotide 5'-flanking region of the
GAPI
gene. Analysis of this promoter sequence revealed the presence of a number of
sequences homologous to Saccharomyces cerevisiae promoter elements. These
sequences include a concensus TATAAA box at nucleotides 1584 to 1591, a
consensus
Raplp binding site (Graham and Chambers, Nuc. Acids Res. 22:124-130, 1994) at
nucleotides 1355 to 1367, and potential Gcrlp binding sites (Shore, Trends
Genet.
10:408-412, 1994) at nucleotides 1225 to 1229, 1286 to 1290, 1295 to 1299,
1313 to
1317, 1351 to 1354, 1370 to 1374, 1389 to 1393, and 1457 to 1461. A consensus
transcription termination sequence (Chen and Moore, Mol. Cell. Biol. 12:3470-
3481,
1992) was identified at nucleotides 2774 to 2787 of SEQ ~ N0:2.
A plasmid containing the GAPl gene, designated pGAPDH, has been
deposited as an E. coli strain MC 1061 transformant with American Type Culture
Collection, Manassas, VA under the terms of the Budapest Treaty. The deposited
strain
has been assigned the designation PTA-3 and a deposit date of May 4, 1999.
Example 2
2 0 Analysis of the P. methanolica genome by Southern blotting, using a
PCR product from the coding region of the cloned GAPI gene as a probe,
indicated the
presence of three independent GAPDH genes. Primers designed from the cloned
sequence were used in various combinations to amplify P. methanolica genomic
DNA.
Positive pools were screened by PCR, and positives were re-amplified. PCR
products
2 5 were sequenced. Eight pools were found to be the same and corresponded to
the
previously cloned GAPI gene. Two pools were distinct from the previously
cloned
gene and were identical to each other. Each of these two pools was plated and
amplified by PCR through several rounds of sub-dividing. Sub-pools were
streaked,
and single colonies were picked for a final round of PCR screening. Positive
clones
3 0 were analyzed by PCR and restriction digestion. Each clone was found to be
carried on
a ~5 kb genomic segment. This gene, which was designated GAP2, was partially
sequenced. The sequenced region included an open reading frame of 1002 base
pairs
(including the termination codon), a 5' non-coding region of 1092 base pairs,
and a 3'
non-coding region of 1239 base pairs (SEQ m NO:1).
CA 02384123 2002-03-06
WO 01/18182 PCT/US00/24110
Example 3
A fragment of GAP2 DNA (SEQ ID NO:1 ) was isolated by PCR using
two primers. Primer ZC19,334 (SEQ ~ N0:8) contained 26 by of vector flanking
sequence and 25 by corresponding to the 5' end of the first 1000 by of the
GAP2
5 promoter. Primer ZC 19,333 (SEQ ID N0:9) contained 35 by of the 3' end
corresponding to S. cerevisiae alpha factor pre-pro sequence and 29 by
corresponding
to the 3' end of the GAP2 promoter. The latter primer altered the 5' flanking
sequence
at nucleotides 1081-1092 to GAATTCAAAAGA (SEQ ID NO:10), resulting in the
introduction of an EcoRI site. The PCR reaction conditions (five tubes in all)
were: 20
10 cycles of 94°C for 30 seconds, 55°C for 30 seconds, and
72°C for 1 minute; followed
by a 4°C soak. The five samples were combined into one tube and
precipitated with 2
volumes of 100% ethanol. The resulting pellet was resuspended in 10 ~1 of
water. The
sample was serially diluted into TE (10 mM Tris, 2mM EDTA) as 1:5, 1:25, and
1:125
dilutions. DNA concentration was estimated by running the PCR product on a 1 %
15 agarose gel. The expected approximately 1 kb fragment was seen. The
remaining 8 ~l
of product was used for recombination as described below.
An expression plasmid named pTAP96, containing the P. methanolica
GAP2 promoter, S. cerevisiae alpha factor pre-pro sequence, and a cDNA
encoding
leptin with an amino-terminal Glu-Glu affinity tag (Grussenmeyer et al., Proc.
Natl.
2 0 Acad. Sci. USA 82:7952-4, 1985), was constructed via homologous
recombination
using portions of the plasmids pTAP37 and pCZR189. Plasmid pTAP37 comprises a
modified P. methanolica GAPI promoter, the P. methanolica ADE2 selectable
marker,
the gene for ampicillin resistance in E. coli, the S. cerevisiae URA3
selectable marker,
and the CEN-ARS of S. cerevisiae. pCZR189 comprises the S. cerevisiae alpha
factor
2 5 pre-pro sequence and the leptin coding sequence. One hundred microliters
of
competent yeast cells (S. cerevisiae) were combined with 7 ~1 of a mixture
containing
approximately 1 ~g of NotI-cut pCZR189, 1 ~g PCR product containing the GAP2
promoter as described above, and 100 ng of EcoRI-cut pTAP37 vector, and the
mixture
was transferred to a 0.2 cm electroporation cuvette. The yeast/DNA mixture was
3 0 electropulsed at 0.75 kV (5 kV/cm), infinite ohms, 25 ~.F. To each cuvette
was added
600 ~ul of 1.2 M sorbitol, and the yeast was then plated in two 300-~l
aliquots onto two
-URA D plates and incubated at 30°C.
After about 48 hours, the Ura+ yeast transformants from a single plate
were resuspended in 1 ml H20 and spun briefly to pellet the yeast cells. The
cell pellet
3 5 was resuspended in 1 ml of lysis buffer (2% t-
octylphenoxypolyethoxyethanol (Triton~
X-100), 1% SDS, 100.mM NaCI, 10 mM Tris, pH 8.0, 1 mM EDTA). Five hundred
microliters of the lysis mixture was added to a microcentrifuge tube
containing 300 ~1
CA 02384123 2002-03-06
WO 01/18182 PCT/US00/24110
16
acid-washed glass beads and 200 q1 phenol-chloroform, vortexed for 1 minute
intervals
two or three times, followed by a 5 minute spin in a microcentrifuge at
maximum
speed. Three hundred microliters of the aqueous phase was transferred to a
fresh tube,
and the DNA was precipitated with 600 ~ul ethanol, followed by centrifugation
for 10
minutes at 4°C. The DNA pellet was resuspended in 100 ~,1 HBO.
Forty ~1 of electrocompetent E. coli cells (MC1061; Casadaban et al., J.
Mol. Biol. 138, 179-207, 1980) were transformed by electroporation with 1 ~,1
of the
yeast DNA preparation at 2.0 kV, 25 ~F, and 400 ohms. Following
electroporation, 0.6
ml SOC (2% BactoTM Tryptone (Difco Laboratories), 0.5% yeast extract (Difco
1 o Laboratories), 10 mM NaCI, 2.5 mM KCI, 10 mM MgCI~, 10 mM MgS04, 20 mM
glucose) was plated in one aliquot on LB + Amp plates (LB broth, 1.8% BactoTM
Agar
(Difco Laboratories), 100 mg/L Ampicillin).
Cells harboring the correct expression construct for the GAP2 promoter
driving synthesis of the alpha factor pre-pro/leptin fusion were screened via
PCR using
the same primers used to generate the GAP2 promoter. The PCR conditions were:
25
cycles of 94°C for 30 seconds, 55°C for 30 seconds, and
72°C for 1 minute; followed
by a 4°C soak. Two positive clones were identified on a 1 % agarose gel
and were
subjected to sequence analysis. One of the correct clones was selected and
designated
pTAP96.
2 0 Plasmid pTAP96 DNA was prepared by anion exchange
chromatography using a commercially available plasmid isolation kit (QIAGEN~
Plasmid Maxi Kit; Qiagen, Inc., Valencia, CA). DNA was diagnostically cut with
ScaI,
producing the expected bands of approximately 1700 bp, 2250 by doublet, and
6000 by
on a 1 % gel. 1 ~.g of pTAP96 DNA was then cut with NotI and transformed into
electrocompetent P. methanolica strain PMAD16 (disclosed in Example 4, below)
as
disclosed in U.S. Patent No. 5,854,039. Transformants were selected on -ADE DS
plates (Table 1 ).
CA 02384123 2002-03-06
WO 01/18182 PCT/US00/24110
17
Tahla 1
-ADE DS
0.056% -Ade -Trp -Thr powder
0.67% yeast nitrogen base without amino acids
2% D-glucose
0.5% 200X tryptophan, threonine solution
18.22% D-sorbitol
-Ade -Trp -Thr powder
powder made by combining 3.0 g arginine, 5.0 g aspartic
acid, 2.0 g histidine, 6.0 g isoleucine, 8.0 g leucine, 4.0 g
lysine, 2.0 g methionine, 6.0 g phenylalanine, 5.0 g
serine, 5.0 g tyrosine, 4.0 g uracil, and 6.0 g valine (all L-
amino acids)
200X tryptophan, threonine solution
3.0% L-threonine, 0.8% L-tryptophan in HBO
For plates, add 1.8% BactoTM agar (Difco Laboratories)
White colonies, indicating the presence of the ADE2 gene, were patched
onto -ADE plates, and cells were allowed to grow overnight. The cells were
then
2 0 replica plated onto YEPD plates and overlaid with a nitrocellulose
membrane. The
next day the filters were washed gently under deionized HZO, then denatured in
1X
Western denaturing buffer (625 mM Tris, 625 mM glycine, pH9.0, 5 mM (3-
mercaptoethanol) at 65°C for 10 minutes. Filters were blocked for 30
minutes in TTBS
(160 mM NaCI, 20 mM Tris pH7.4, 0.1% Tween 20) and 5% non-fat dry milk. The
2 5 filters were then exposed to an anti-Glu-Glu tag antibody conjugated to
horseradish
peroxidase (5 ~,1 of antibody diluted into 10 ml TTBS + 5% non-fat dry milk)
at room
temperature for 1 hour. Filters were washed twice for 5 minutes in TTBS with
no milk
and rinsed briefly in water. The filters were screened using commercially
available
chemiluminescence reagents (ECLTM direct labelling kit; Amersham Corp.,
Arlington
3 0 Heights, IL) as a 1:1 dilution, and the filters were immediately exposed
to film. One
clone produced a detectable signal.
Example 4
To generate a P. methanolica strain deficient for vacuolar proteases, the
3 5 PEP4 and PRBI genes were identified and disrupted. PEP4 and PRBl sequences
were
amplified by PCR in reaction mixtures containing 100 pmol of primer DNA, 1X
buffer
as supplied (Boehringer Mannheim, Indianapolis, IN), 250 ~M dNTPs, 1-100 pmol
of
CA 02384123 2002-03-06
WO 01/18182 PCT/US00/24110
18
template DNA, and 1 unit of Taq polymerise in a reaction volume of 100 ~1. The
DNA
was amplified over 30 cycles of 94°C, 30 seconds; 50°C, 60
seconds; and 72°C, 60
seconds.
Using an alignment of PEP4 sequences derived from S. cerevisiae
(Ammerer et al., Mol. Cell. Biol. 6:2490-2499, 1986; Woolford et al., Mol.
Cell. Biol.
6:2500-2510, 1986) and P. pastoris (Gleeson et al., U.S. Patent No.
5,324,660), several
sense and antisense primers corresponding to conserved regions were designed.
One
primer set, ZC9118 (SEQ ID NO:11 ) and ZC9464 (SEQ ID N0:12) produced a PCR
product of the expected size from genomic DNA, and this set was used to
identify a
genomic clone corresponding to the amplified region. DNA sequencing of a
portion of
this genomic clone (shown in SEQ ID N0:13) revealed an open reading frame
encoding
a polypeptide (SEQ ID N0:14) with 70% amino acid identity with proteinase A
from S.
cerevisiae.
Primers for the identification of P. methanolica PRB 1 were designed on
the basis of alignments between the PRBI genes of S. cerevisiae (Moehle et
al., Mol.
Cell. Biol. 7:4390-4399, 1987), P. pastoris (Gleeson et al., U.S. Pat. No.
5,324,660),
and Kluyveromyces lactis (Fleer et al., WIPO Publication WO 94/00579). One
primer
set, ZC9126 (SEQ LD NO:15) and ZC9741 (SEQ ID N0:16) amplified a ca. 400 by
fragment from genomic DNA (SEQ ID N0:17). This product was sequenced and found
2 0 to encode a polypeptide (SEQ ID N0:18) with 70% amino acid identity with
proteinase
B from S. cerevisiae. The PRB primer set was then used to identify a genomic
clone
encompassing the P. methanolica PRBI gene.
Deletion mutations in the P. methanolica PEP4 and PRBI genes were
generated using available restriction enzyme sites. The cloned genes were
restriction
2 5 mapped. The pep4a allele was created by deleting a region of approximately
500 by
between BamHI and NcoI sites and including nucleotides 1 through 393 the
sequence
shown in SEQ m N0:13. The prbl4 allele was generated by deleting a region of
approximately 1 kbp between NcoI and EcoRV sites and including the sequence
shown
in SEQ ID N0:17. The cloned PEP4 and PRBI genes were subcloned into pCZR139,
3 0 a phagemid vector (pBluescript~ II KS(+), Stratagene, La Jolla, CA) that
carried a 2.4
kb SpeI ADE2 insert, to create the deletions. In the case of PEP4 gene, the
unique
BamHI site in pCZR139 was eliminated by digestion, fill-in, and relegation.
The vector
was then linearized by digestion with EcoRI and HindllI, and a ca. 4 kb EcoRI -
HindIll
fragment spanning the PEP4 gene was legated to the linearized vector to
produce
35 plasmid pCZR142. A ca. 500 by deletion was then produced by digesting
pCZR142
with BamHI and NcoI, filling in the ends, and relegating the DNA to produce
plasmid
pCZR143. The PRBI gene (~5 kb XhoI - BamHI fragment) was subcloned into
CA 02384123 2002-03-06
WO 01/18182 PCT/US00/24110
19
pCZR139, and an internal EcoRV - NcoI fragment, comprising the sequence shown
in
SEQ ID N0:17, was deleted to produce plasmid pCZR 153.
Plasmid pCZR143 was linearized with Asp718, which cut at a unique
site. The linearized plasmid was introduced into the P. methanolica PMAD11
strain
(an ade2 mutant generated as disclosed in U.S. Patent No. 5,736,383).
Transformants
were grown on -ADE DS (Table 1 ) to identify Ade+ transformants. Two classes
of
white, Ade+ transformants were analyzed. One class arose immediately on the
primary
transformation plate; the second became evident as rapidly growing white
papillae on
the edges of unstable, pink transformant colonies.
Southern blotting was used to identify transformants that had undergone
the desired homologous integration event. 100 q1 of cell paste was scraped
from a 24-
48 hour YEPD plate and washed in 1 ml water. Washed cells were resuspended in
400
~1 of spheroplast buffer (1.2 M sorbitol, 10 mM Na citrate pH 7.5, 10 mM EDTA,
10
mM DTT, 1 mg/ml zymolyase 100T) and incubated at 37°C for 10 minutes.
Four
hundred ~l of 1 % SDS was added, the cell suspension was mixed at room
temperature
until clear, 300 ~,1 of 5 M potassium acetate was mixed in, and the mixture
was clarified
by microcentrifugation for 5 minutes. 750 ~l of the clarified lysate was
extracted with
an equal volume of phenol:chloroform:isoamyl alcohol (25:24:1), 600 ~,1 was
transferred to a fresh tube, 2 volumes of 100% ethanol was added, and the DNA
was
2 0 precipitated by microcentrifugation for 15 minutes at 4°C. The
pellet was resuspended
in 50 ~.1 of TE (10 mM Tris pH 8.0, 1 mM EDTA) containing 100 ~,g/ml of RNAase
A.
Ten ~l of DNA (approximately 100 ng) was digested in 100 q,1 total volume with
appropriate enzymes, precipitated with 200 ~1 ethanol, and resuspended in 10
~1 of
DNA loading dye. The DNA was separated in 0.7% agarose gels and transferred to
2 5 nylon membranes (Nytran N+, Amersham Corp., Arlington Heights, IL) in a
semi-dry
blotting apparatus (BioRad Laboratories, Richmond, CA) as recommended by the
manufacturer. Transferred DNA was denatured, neutralized, and cross-linked to
the
membrane with UV light using a Stratalinker (Stratagene, La Jolla, CA). To
identify
strains with a tandem integration at PEP4, two probes were used. One was a
1400 by
3 0 EcoRI - HindIll fragment from the 3' end of PEP4. The second was a 2000 by
BamHI
- EcoRI fragment from the 5' end of PEP4. Fragments were detected using
chemiluminescence reagents (ECLTM direct labelling kit; Amersham Corp.,
Arlington
Heights, IL).
Parent strains harboring a tandem duplication of the wild-type and
3 5 deletion alleles of the gene were grown in YEPD broth overnight to allow
for the
generation of looped-out, Ade- strains. These cells were then plated at a
density of
2000-5000 colonies per plate on adenine-limited YEPD plates, grown for 3 days
at
CA 02384123 2002-03-06
WO 01/18182 PCT/US00/24110
30°C and 3 days at room temperature. The shift to room temperature
enhanced
pigmentation of rare, pink, Ade- colonies. Loop-out strains were consistently
detected
at a frequency of approximately one pink, Ade- colony per 10,000 colonies
screened.
These strains were screened for retention of the wild-type or mutant genes by
Southern
5 blotting or by PCR using primers that spanned the site of the deletion. An
ade2-ll
pep4d strain was designated PMAD15.
The PRBl gene was then deleted from PMAD15 essentially as described
above by transformation with plasmid pCZR153. Blots were probed with PCR-
generated probes for internal portions of the PRBI and ADE2 genes. The PRBI
probe
10 was generated by subcloning a 2.6 kb CIaI - SpeI fragment of PRBI into the
phagemid
vector pBluescript~ II KS(+) to produce pCZR150, and amplifying the desired
region
by PCR using primers ZC447 (SEQ ID N0:19) and ZC976 (SEQ ID N0:20). The
ADE2 probe was generated by amplifying the ADE2 gene in pCZR139 with primers
ZC9079 (SEQ ID N0:21 ) and ZC9080 (SEQ ID N0:22). The resulting ade2-ll pep4d
15 prbl d strain was designated PMAD 16.
From the foregoing, it will be appreciated that, although specific
embodiments of the invention have been described herein for purposes of
illustration,
various modifications may be made without deviating from the spirit and scope
of the
2 0 invention. Accordingly, the invention is not limited except as by the
appended claims.
CA 02384123 2002-03-06
WO 01/18182 PCT/US00/24110
1
SEQUENCE LISTING
<110> ZymoGenetics, Inc.
<120> PICHIA METHANOLICA GLYCERALDEHYDE-3-PHOSPHATE DEHYDROGENASE 2
PROMOTER AND TERMINATOR
<130> 98-57PC
<160> 22
<170> FastSEQ for Windows Version 3.0
<210>1
<211>3333
<212>DNA
<213>Pichia methanolica
<220>
<221> CDS
<222> (1093)...(2094)
<400>
1
cataaaccataatagtataatttgttagacaagttcaaagaatttccaataaaagtgtaa60
ttttcacatgcatttcaacccggagaataaaattttaagaaatccgattggatagtgtag120
aattattgttcatattgtgttataataattgcaattacccaacaaaacttgcattggtta180
gtcatcgtatttcatgctattagctgaaagtagggtaatcgagcggtttgaatggctctg240
taaatctaaactctttatctgaaatgtatattagatccgacatgatgcatttggaggttc300
tgagaggtaccgcattgaatttctgtgtggaattagatgagttgttgtaccagaagaggg360
aaaatgggcaagtggtggcaatagtaaattatgggaagtatggtggatattggcccggcg420
tagtgacatcctcaccttaaaattgccttaggggataatgtgccgggcacgtccagctaa480
ctaatttagtagtcgtctaaaactggggaacatttgttgttcctttgatagttatacgaa540
actgattgaataaaaagtttatattcttcttgatgatccttctgtctaattgatagaata600
ggaatttagatagaaatatggaaatacacaaaatatatgtaataaaatcaaaaggggaac660
aattcaaaggattcagcaatcaaaagggatgagtgattctgggtaataaatgagcaataa720
attagtaataaattagtaacaagttagtaataaattagtaataaattagcaacaaatgaa780
caatagtaaaagctaaaagataaaacaaaaggtaggagataagcagtaaagtccgaaagt840
aatcaggtgactagagtaaggatgagaatgaaggacagattccttacagctacataagta900
gatgagctgttgacggtcagatggtgccttggtccatggtttcatatataaagaccctct960
tcgtctccttttgttcgcttgtttcacactcaactgtttctgattttaccttttttcccc1020
tgcttgattcccccattgaatcagatcaagtgttttcatagaacccacttttatttattt1080
CA 02384123 2002-03-06
WO 01/18182 PCT/US00/24110
2
tagttgcaca as atg gcc att aac gtt ggt att aac ggt ttc ggg aga atc 1131
Met Ala Ile Asn Val Gly Ile Asn Gly Phe Gly Arg Ile
1 5 10
ggc aga tta gtc ttg aga gtt gcc tta tcg aga aaa gac atc aac gtc 1179
Gly Arg Leu Val Leu Arg Val Ala Leu Ser Arg Lys Asp Ile Asn Val
15 20 25
gtt get gtc aac gat cct ttc att get cct gat tac get get tac atg 1227
Val Ala Ual Asn Asp Pro Phe Ile Ala Pro Asp Tyr Ala Ala Tyr Met
30 35 40 45
ttc aag tac gat tcc act cac ggt aag tac act ggt gaa gtt tca agt 1275
Phe Lys Tyr Asp Ser Thr His Gly Lys Tyr Thr Gly Glu Ual Ser Ser
50 55 60
gat ggt aaa tac tta atc att gat ggt aag aag att gaa gtt ttc caa 1323
Asp Gly Lys Tyr Leu Ile Ile Asp Gly Lys Lys Ile Glu Val Phe Gln
65 70 75
gaa aga gat cca gcc aac atc cca tgg ggg aaa gaa ggt gtt cag tac 1371
Glu Arg Asp Pro Ala Asn Ile Pro Trp Gly Lys Glu Gly Val Gln Tyr
80 85 90
gtt att gaa tcc act ggc gtt ttc acc acc ttg get ggt get caa aag 1419
Val Ile Glu Ser Thr Gly Val Phe Thr Thr Leu Ala Gly Ala Gln Lys
95 100 105
cac att gat get ggt gcg gaa aag gtt atc atc act get cca tct tct 1467
His Ile Asp Ala Gly Ala Glu Lys Val Ile Ile Thr Ala Pro Ser Ser
110 115 120 125
gat get cca atg ttt gtt gtt ggt gtt aac gaa aag gaa tac act cct 1515
Asp Ala Pro Met Phe Val Val Gly Val Asn Glu Lys Glu Tyr Thr Pro
130 135 140
gac ttg aag att gtt tca aat gcc tca tgt acc acc aac tgc gtg get 1563
Asp Leu Lys Ile Val Ser Asn Ala Ser Cys Thr Thr Asn Cys Val Ala
145 150 155
aca tta get aaa gtt gtt gac gat aac ttt gga att gaa tct ggg tta 1611
Thr Leu Ala Lys Ual Val Asp Asp Asn Phe Gly Ile Glu Ser Gly Leu
160 165 170
CA 02384123 2002-03-06
WO 01/18182 PCT/US00/24110
3
atg acc get gtt cac gcc att act get tcc caa aag atc gtc gat ggt 1659
Met Thr Ala Ual His Ala Ile Thr Ala Ser Gln Lys Ile Ual Asp Gly
175 180 185
ccc tcc cac aag gac tgg aga ggt ggt aga acc get tcc ggc aac att 1707
Pro Ser His Lys Asp Trp Arg Gly Gly Arg Thr Ala Ser Gly Asn Ile
190 195 200 205
atc cca tca tca act ggt get get aag get gtt ggt aag gtt ttg cca 1755
Ile Pro Ser Ser Thr Gly Ala Ala Lys Ala Ual Gly Lys Ual Leu Pro
210 215 220
get tta get ggc aag cta acc ggt atg tct ata agg gtt cct act act 1803
Ala Leu Ala Gly Lys Leu Thr Gly Met Ser Ile Arg Ual Pro Thr Thr
225 230 235
gat gtt tcc gtt get gat tta acc gtt aac tta aag act get acc acc 1851
Asp Ual Ser Val Ala Asp Leu Thr Ual Asn Leu Lys Thr Ala Thr Thr
240 245 250
tac cag gaa att tgc get get ata aag aag get tct gaa ggt gaa tta 1899
Tyr Gln Glu Ile Cys Ala Ala Ile Lys Lys Ala Ser Glu Gly Glu Leu
255 260 265
aag ggt att tta ggt tac act gaa gat gcc gtt gtt tca acc gac ttc 1947
Lys Gly Ile Leu Gly Tyr Thr Glu Asp Ala Ual Ual Ser Thr Asp Phe
270 275 280 285
tta acc gat agc aga tcg tct atc ttc gat gcc aaa get ggt atc tta 1995
Leu Thr Asp Ser Arg Ser Ser Ile Phe Asp Ala Lys Ala Gly Ile Leu
290 295 300
tta acc cca acc ttc gtt aag cta atc tct tgg tac gat aac gaa tac 2043
Leu Thr Pro Thr Phe Ual Lys Leu Ile Ser Trp Tyr Asp Asn Glu Tyr
305 310 315
ggt tat tcc acc aga gtt gtt gac tta cta caa cat gtt get tcc gcc 2091
Gly Tyr Ser Thr Arg Ual Ual Asp Leu Leu Gln His Ual Ala Ser Ala
320 325 330
taa atcttccaac ctaaattgcg aaatataagc aagcaaaaat tatatgtata 2144
CA 02384123 2002-03-06
WO 01/18182 PCT/US00/24110
4
tttgtcttccattgcataagtctatctttcctgagaaataacaaaaatatgttcttttcg2204
agacacttaagttttatttttgcccttagtacaaggcatccatttgcagttgctgcttac2264
agccctgaaggctattgcatcagcccaattggaaacaagtatagcatactgatttgaggg2324
tttaattatctgtaatattcaagtacttatatgcgtagaacctccaaatagcaacacgaa2384
aatccatcatccaacaatcaaagatgtggagcaggccaagcaagatgatattttctcggt2444
ggtggcggtttcaatttctggggtgcgttattgtgtggcttgtaccttgcagggtaaacc2504
ttcgccagcagttccagtggtctcttcgacgaacaacaggctgaaattcggctgtttcag2564
catggcttgtttttcctccatgggactagcgtagatttatccccccagaaagtttctctt2624
cttgaatatctctggtaccgaccactaactagattatagattactgcgacatgttaaagc2684
attgtcggggtctttaagcatgctcaaccaacaggttgcctgaagagctgcgtactaacc2744
tggaacagggttcacagaaagagggcaacccagaaaaaacactatttgttaacccttata2804
gtgaagagtgggggtacaaaatctttgacccgtactccactacgacagttttgataaaca2864
cttgcagattacctaatttggtatgtacaatttctaggcatgggataagtatagctttta2924
atccggaaggttcggataaatactgtgctgtgtgccaggcaaatgcgtcccactggagaa2984
aaaggtaaagccgactaaccgaagacccacctacaataaatttaccgagccaccgaaaaa3044
ctcacgttactcaatatatgagtaatgtactactataactatgtgtggaatagaattgta3104
ttgtatagtagctcagctttcttcctggtatacggtcgactttagcctaaacacttgttg3164
gttcagtgaatacagcctgattagactaaaaggtagaaggactataaaggtgtacatacg3224
gaaatcctactccccacttaaatagacaaaacccctctaagtgttgtttcgacgtaaagc3284
tttgtttactgacaagccttggcaccgatcccccgggctgcaggaattc 3333
<210>2
<211>4409
<212>DNA
<213>Pichia methanolica
<220>
<221> CDS
<222> (1733)...(2734)
<400>
2
cccgggggatcttattttctgcaagaacttaaccgagggacatgtcaaaccaagcatact 60
gtaaaagaaatagccgatggtttatatatatatatacttgcgttagtagaaacagtttat 120
gcatgcatggatgcaagaactcagatatcaggttatcaagaaacatggagaaattcctaa 180
acagaaacggaattaatccgaaattctcggtctcccaaagaaaatagatgcacaagctaa 240
tacagcttgctaactagcttcaactttcaaaaaaaattctaagctattgaatattcatca 300
agataatagtctatataaagatgtaaagtcattattattgggatatataaacgtcctata 360
tattgctgaaatgttaggtgtatgtactgaaaacaatcagtttgagtttaccagagagag 420
acgatggatctacagatcaatagagagagaataagatgagaataagatgattaatagtga 480
gaggtagtagccactggcgggaggatgaaaatatcccggataaacttagaaagaaattaa 540
ttacacgtataggtaacatttgttattgtcgaatctcagatcagttgatgcctggaacag 600
CA 02384123 2002-03-06
WO 01/18182 PCT/US00/24110
atcgacttatagatattatcagatcataatcatgaggcgaggtgcgactagtaccaggtg660
atgatatattgtttccggttatttcaaatagttgacgtcgttgtgtgattgggaaggcgt720
cggagtaacagaaacagtaacggtacaagcatcattatgagttgagggtatgtagggaag780
cagttgtttgtaagcatgtttacaaatgcaatgcatgttacgattggactacaattaaat840
ccgaatgtacctatataacgtgttgtacgtgttgtgccgtaagtagcccgatactagatg900
cttactacgtcactgatctgttcggatctcagtccattcatgtgtcaaaatagttagtag960
ctaagggggatacagggaagatgtttggtacgattatcggagggatgtgtcttctgaggg1020
gggaggagagagggcgtgtaaggagtttgtttgtttgtttgtttgttgagagaagggggg1080
gagaagagggggtggtgggctgatggcaattgatatagagggagagtgtgcgttaactgt1140
ttagtgtggtggcggtacggggtacactgtagagggggacattataatggttatgtgtat1200
atgctgtatatatgaatacaagtagggagtgactacacattgcaattgataatatgtgta1260
tgtgtgcgcatcagtatatacactcggaggttctgaaagccatcattgtattggacgttt1320
gaatggtattagatgacttgttgtactagaggacggagaatgggtgagtggaagcaatag1380
ataataatggaaagtttgctcggtggtggacattggcccggagtagtgataccgtcacct1440
taaaattgcagttaggggatgatgctccggggcacgacctgccaactaatttaatagtcg1500
tctaacgctggaacaggtgttgttccacaagtagatgagtttgttggttggctggtcaaa1560
tgctgccttgatccatcgttttatatataaagactcacttctcctcctcttgttcaattg1620
tttcacactcaactgcttctcccttatcttttttttttccctgttttattccccattgaa1680
ctagatcacatcttttcatattacacacttttatttattataattacacaas atg 1738
get
Met Ala
1
att aac gtt ggt att aac ggt ttc ggt aga atc ggt aga tta gtc ttg 1786
Ile Asn Ual Gly Ile Asn Gly Phe Gly Arg Ile Gly Arg Leu Val Leu
5 10 15
aga gtt get tta tca aga aag gac atc aac att gtt get gtc aat gat 1834
Arg Ual Ala Leu Ser Arg Lys Asp Ile Asn Ile Ual Ala Ual Asn Asp
20 25 30
cct ttc att get get gaa tac get get tac atg ttc aag tac gat tcc 1882
Pro Phe Ile Ala Ala Glu Tyr Ala Ala Tyr Met Phe Lys Tyr Asp Ser
35 40 45 50
act cac ggt aag tac gcc ggc gaa gtt tcc agt gac ggt aaa tac tta 1930
Thr His Gly Lys Tyr Ala Gly Glu Ual Ser Ser Asp Gly Lys Tyr Leu
55 60 65
atc att gat ggt aag aag att gaa gtt ttc caa gaa aga gac cca gtt 1978
Ile Ile Asp Gly Lys Lys Ile Glu Ual Phe Gln Glu Arg Asp Pro Ual
70 75 80
CA 02384123 2002-03-06
WO 01/18182 PCT/US00/24110
6
aac atc cca tgg ggt aaa gaa ggt gtc caa tac gtt att gac tcc act 2026
Asn Ile Pro Trp Gly Lys Glu Gly Val Gln Tyr Val Ile Asp Ser Thr
85 90 95
ggt gtt ttc act acc ttg get ggt get caa aag cac att gat gcc ggt 2074
Gly Val Phe Thr Thr Leu Ala Gly Ala Gln Lys His Ile Asp Ala Gly
100 105 110
get gaa aag gtt atc atc act get cca tct get gat get cca atg ttc 2122
Ala Glu Lys Val Ile Ile Thr Ala Pro Ser Ala Asp Ala Pro Met Phe
115 120 125 130
gtt gtt ggt gtt aac gaa aag gaa tac act tct gac ttg aag att gtt 2170
Val Val Gly Val Asn Glu Lys Glu Tyr Thr Ser Asp Leu Lys Ile Val
135 140 145
tct aac get tca tgt acc acc aac tgt ttg get cca tta get aag gtt 2218
Ser Asn Ala Ser Cys Thr Thr Asn Cys Leu Ala Pro Leu Ala Lys Val
150 155 160
gtt aac gac aac ttt ggt att gaa tca ggt tta atg acc act gtc cac 2266
Val Asn Asp Asn Phe Gly Ile Glu Ser Gly Leu Met Thr Thr Val His
165 170 175
tcc att acc get acc caa aag acc gtc gat ggt cca tca cac aag gac 2314
Ser Ile Thr Ala Thr Gln Lys Thr Val Asp Gly Pro Ser His Lys Asp
180 185 190
tgg aga ggt ggt aga act get tcc ggt aac att atc cca tca tct act 2362
Trp Arg Gly Gly Arg Thr Ala Ser Gly Asn Ile Ile Pro Ser Ser Thr
195 200 205 210
ggt get get aag get gtt ggt aag gtt tta cct gtc tta get ggt aag 2410
Gly Ala Ala Lys Ala Val Gly Lys Val Leu Pro Ual Leu Ala Gly Lys
215 220 225
tta acc ggt atg tct tta aga gtt cct act acc gat gtt tcc gtt gtt 2458
Leu Thr Gly Met Ser Leu Arg Val Pro Thr Thr Asp Ual Ser Val Ual
230 235 240
gat tta acc gtt aac tta aag act cca acc act tac gaa get att tgt 2506
Asp Leu Thr Val Asn Leu Lys Thr Pro Thr Thr Tyr Glu Ala Ile Cys
245 250 255
CA 02384123 2002-03-06
WO 01/18182 PCT/US00/24110
7
get get atg aag aag get tct gaa ggt gaa tta aag ggt gtt tta ggt 2554
Ala Ala Met Lys Lys Ala Ser Glu Gly Glu Leu Lys Gly Ual Leu Gly
260 265 270
tac act gaa gac get gtt gtt tcc act gat ttc tta acc gat aac aga 2602
Tyr Thr Glu Asp Ala Ual Ual Ser Thr Asp Phe Leu Thr Asp Asn Ang
275 280 285 290
tca tct atc ttt gat get aag get ggt atc tta tta acc cca act ttc 2650
Ser Ser Ile Phe Asp Ala Lys Ala Gly Ile Leu Leu Thr Pro Thr Phe
295 300 305
gtt aag tta atc tct tgg tac gat aac gaa tac ggt tac tcc acc aga 2698
Ual Lys Leu Ile Ser Trp Tyr Asp Asn Glu Tyr Gly Tyr Ser Thr Arg
310 315 320
gtt gtt gat tta cta caa cac gtt get tcc get taa atcttacaat 2744
Ual Ual Asp Leu Leu Gln His Ual Ala Ser Ala
325 330
ctagattgtgaagtataagtaagcaaaaattatatatatatttgtctttcatagtataag2804
tatagttttcatgagaaatacagataaacaacaaaaaataagttctttttgaaaaagtta2864
gattttattcttgaacttagtaaaagccttccttttacagctgcttacttacaaccttga2924
aggctattgcataagctcaattgaaaacgagtataatatactgatttcaaggtttaatta2984
tctgtaattttcaagtacttccatacgtggaaacctcccacaattaacagcaacacgaaa3044
catccatcatccaacaaccgagatgcggattaggcccggagagataatatttttcggtgt3104
ggcggtggtttcaactccgaacgcagcgcagccaaaagcaaacagatgatttagtgaact3164
cttcttatgatagatttttggctgattgagttgatctgacctgtgtggttcgatcgaatt3224
ctattgtgtttgatgccctggtagtggtgtgcttcatcttattgtgaagtgtgaatccta3284
gcgattatggcatttggacgccaactactagctctgacggtagtggcttctacgaatgta3344
acttacaattctgctcaattcgaacatcttttcagtaagagaagttatatatgtatgtgt3404
gtatgtgtatgtaaatatacataaccgcttgtgggggtgatttttggtttgtactgatgt3464
gaaactcagtgctatcggatgatgctgtcaccaacaacagctgcttaaccttctttttac3524
tattctgatacagaattaggaaagtttccggatttgtgatgtgcggctttggttgccatt3584
agtctcctttttttggagggaggagtgaagtggtgcgttatgtgccctgatccaatggtt3644
ttgaaagagggagctagggatagttaatgggtagacctatgaacattgtgtattaatata3704
ttgaaatatacaaacataacggctgaaaacagcaagaaatcaaaaaggcacaatttcaat3764
ggtatataacttcaataatgatagtaatagtaatggtagtagttattacaggaggaataa3824
tatcaagaaaggaaaactaaaagtacaccaacgtattcagaaatacaaaaacagcgaaca3884
aaatcgtcgattagtaattcatatcatgattgccatccaaacagctttctttcattgaac3944
tcacgagggcttgcactattttccctgcttgatgagtaatccatcatttcaaactcggtt4004
gaacctgtagcaccagaagcgccatttgacgtaattggccttgtaatttgctgttgttgt4064
CA 02384123 2002-03-06
WO 01/18182 PCT/LJS00/24110
8
tgggatatgtttgattcattttggaaacgttcatgatgccctctttttttgttgtttgtt4124
gttggtatcggtgaattcgatctagatgcagaactgccactattgttgttattgccgttg4184
ttcgcattattgttatcgtcaaagtcaaagtcaagtaatggaagaccaagggaagcatca4244
acaccaaaatcattcaacatcagtaaatccgagtacgacttaatggtatctgcctgaatc4304
gttgcttgctgctgattatgctgttgttggttttgttgttgctgtttcgcagtcagttgg4364
aaatgatccactagttctagagcggccgccaccgcggtggagctc 4409
<210>3
<211>3077
<212>DNA
<213>Pichia methanolica
<400>
3
cagctgctctgctccttgattcgtaattaatgttatccttttactttgaactcttgtcgg 60
tccccaacagggattccaatcggtgctcagcgggatttcccatgaggtttttgacaactt 120
tattgatgctgcaaaaacttttttagccgggtttaagtaactgggcaatatttccaaagg 180
ctgtgggcgttccacactccttgcttttcataatctctgtgtattgttttattcgcattt 240
tgattctcttattaccagttatgtagaaagatcggcaaacaaaatatcaacttttatctt 300
gaacgctgacccacggtttcaaataactatcagaactctatagctataggggaagtttac 360
tgcttgcttaaagcggctaaaaagtgtttggcaaattaaaaaagctgtgacaagtaggaa 420
ctcctgtaaagggccgattcgacttcgaaagagcctaaaaacagtgactattggtgacgg 480
aaaattgctaaaggagtactagggctgtagtaataaataatggaacagtggtacaacaat 540
aaaagaatgacgctgtatgtcgtagcctgcacgagtagctcagtggtagagcagcagatt 600
gcaaatctgttggtcaccggttcgatccggtctcgggcttccttttttgctttttcgata 660
tttgcgggtaggaagcaaggtctagttttcgtcgtttcggatggtttacgaaagtatcag 720
ccatgagtgtttccctctggctacctaatatatttattgatcggtctctcatgtgaatgt 780
ttctttccaagttcggctttcagctcgtaaatgtgcaagaaatatttgactccagcgacc 840
tttcagagtcaaattaattttcgctaacaatttgtgtttttctggagaaacctaaagatt 900
taactgataagtcgaatcaacatctttaaatcctttagttaagatctctgcagcggccag 960
tattaaccaatagcatattcacaggcatcacatcggaacattcagaatggactcgcaaac 1020
tgtcgggattttaggtggtggccaacttggtcgtatgatcgttgaagctgcacacagatt 1080
gaatatcaaaactgtgattctcgaaaatggagaccaggctccagcaaagcaaatcaacgc 1140
tttagatgaccatattgacggctcattcaatgatccaaaagcaattgccgaattggctgc 1200
caagtgtgatgttttaaccgttgagattgaacatgttgacactgatgcgttggttgaagt 1260
tcaaaaggcaactggcatcaaaatcttcccatcaccagaaactatttcattgatcaaaga 1320
taaatacttgcaaaaagagcatttgattaagaatggcattgctgttgccgaatcttgtag 1380
tgttgaaagtagcgcagcatctttagaagaagttggtgccaaatacggcttcccatacat 1440
gctaaaatctagaacaatggcctatgacggaagaggtaattttgttgtcaaagacaagtc 1500
atatatacctgaagctttgaaagttttagatgacaggccgttatacgccgagaaatgggc 1560
tccattttcaaaggagttagctgttatggttgtgagatcaatcgatggccaagtttattc 1620
ctacccaactgttgaaaccatccaccaaaacaacatctgtcacactgtctttgctccagc 1680
tagagttaacgatactgtccaaaagaaggcccaaattttggctgacaacgctgtcaaatc 1740
tttcccaggtgctggtatctttggtgttgaaatgtttttattacaaaatggtgacttatt 1800
CA 02384123 2002-03-06
WO 01/18182 PCT/US00/24110
9
agtcaacgaaattgccccaagacctcacaattctggtcactataccatcgacgcttgtgt1860
cacctcgcaatttgaagctcatgttagggccattactggtctacccatgccgaagaactt1920
cacttgtttgtcgactccatctacccaagctattatgttgaacgttttaggtggcgatga1980
gcaaaacggtgagttcaagatgtgtaaaagagcactagaaactcctcatgcttctgttta2040
cttatacggtaagactacaagaccaggcagaaaaatgggtcacattaatatagtttctca2100
atcaatgactgactgtgagcgtagattacattacatagaaggtacgactaacagcatccc2160
tctcgaagaacagtacactacagattccattccgggcacttcaagcaagccattagtcgg2220
tgtcatcatgggttccgattcggacctaccagtcatgtctctaggttgtaatatattgaa2280
gcaatttaacgttccatttgaagtcactatcgtttccgctcatagaaccccacaaagaat2340
ggccaagtatgccattgatgctccaaagagagggttgaagtgcatcattgctggtgctgg2400
tggtgccgctcatttaccgggaatggttgcggcgatgacgccgctgcctgttattggtgt2460
ccctgttaaaggctctactttggatggtgttgattcactacactccatcgttcaaatgcc2520
aagaggtattcctgttgctactgtggctattaacaatgctactaacgctgccttgctagc2580
tatcacaatcttaggtgccggcgatccaaatacttgtctgcaatggaagtttatatgaac2640
aatatggaaaatgaagttttgggcaaggctgaaaaattggaaaatggtggatatgaagaa2700
tacttgagtacatacaagaagtagaaccttttatatttgatatagtacttactcaaagtc2760
ttaattgttctaactgttaatttctgctttgcatttctgaaaagtttaagacaagaaatc2820
ttgaaatttctagttgctcgtaagaggaaacttgcattcaaataacattaacaataaatg2880
acaataatatattatttcaacactgctatatggtagttttataggtttggttaggatttg2940
agatattgctagcgcttatcattatccttaattgttcatcgacgcaaatcgacgcatttc3000
cacaaaaattttccgaacctgtttttcacttctccagatcttggtttagtatagcttttg3060
acacctaatacctgcag 3077
<210> 4
<211> 19
<212> DNA
<213> Artificial Sequence
<220>
<223> Oligonucleotide primer ZC11,356
<400> 4
ttacatgttc aagtacgat 19
<210> 5
<211> 18
<212> DNA
<213> Artificial Sequence
<220>
<223> Oligonucleotide primer ZC11,357
<400> 5
CA 02384123 2002-03-06
WO 01/18182 PCT/US00/24110
tgatttcatc gtaagtgg 18
<210> 6
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Oligonucleotide primer ZC11,733
<400> 6
atcccatggg gtaaagaagg 20
<210> 7
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Oligonucleotide primer ZC11,734
<400> 7
ataccggtta acttaccagc 20
<210> 8
<211> 55
<212> DNA
<213> Artificial Sequence
<220>
<223> Oligonucleotide primer ZC19,334
<400> 8
ccatgattac gccaagctag cggccgcaat ttttaagaaa tccgattgga tagtg 55
<210> 9
<211> 64
<212> DNA
<213> Artificial Sequence
<220>
<223> Oligonucleotide primer ZC19,333
CA 02384123 2002-03-06
WO 01/18182 PCT/US00/24110
11
<400> 9
gtaaaaatag aaggaaatct cattcttttg aattcaaata aataaaagtg ggttctatga 60
aaac 64
<210> 10
<211> 12
<212> DNA
<213> Artificial Sequence
<220>
<223> engineered sequence
<400> 10
gaattcaaaa ga 12
<210> 11
<211> 17
<212> DNA
<213> Artificial Sequence
<220>
<223> Oligonucleotide primer ZC9118
<400> 11
acctcccagt aagcctt 17
<210> 12
<211> 17
<212> DNA
<213> Artificial Sequence
<220>
<223> Oligonucleotide primer ZC9464
<221> misc_feature
<222> (1). .(17)
<223> n = A,T,C or G
<400> 12
ttyggnaart tygaygg 17
<210> 13
<211> 421
CA 02384123 2002-03-06
WO 01/18182 PCT/US00/24110
12
<212> DNA
<213> Pichia methanolica
<220>
<221> CDS
<222> (2)...(421)
<400> 13
g gaa ggt aac gtt tct cag gat act tta get tta ggt gat tta gtt att 49
Glu Gly Asn Val Ser Gln Asp Thr Leu Ala Leu Gly Asp Leu Val Ile
1 5 10 15
cca aaa caa gac ttt gcc gaa get act tct gag cca ggt tta gca ttc 97
Pro Lys Gln Asp Phe Ala Glu Ala Thr Ser Glu Pro Gly Leu Ala Phe
20 25 30
gca ttt ggt aaa ttt gat ggt att tta ggt tta get tac gat agc att 145
Ala Phe Gly Lys Phe Asp Gly Ile Leu Gly Leu Ala Tyr Asp Ser Ile
35 40 45
tcg gtc aac aag att gtt cct cct att tat aat get tta aac ttg ggt 193
Ser Val Asn Lys Ile Val Pro Pro Ile Tyr Asn Ala Leu Asn Leu Gly
50 55 60
tta tta gat gaa cct caa ttt gcc ttc tac cta ggt gat act aac acc 241
Leu Leu Asp Glu Pro Gln Phe Ala Phe Tyr Leu Gly Asp Thr Asn Thr
65 70 75 80
aat gaa gaa gat ggt ggt ctt gcc act ttt ggt ggt gtt gat gag tcc 289
Asn Glu Glu Asp Gly Gly Leu Ala Thr Phe Gly Gly Val Asp Glu Ser
85 90 95
aag tat act ggt aaa gtt aca tgg tta cca gtc aga aga aag get tac 337
Lys Tyr Thr Gly Lys Val Thr Trp Leu Pro Val Arg Arg Lys Ala Tyr
100 105 110
tgg gaa gtt tca tta gac ggt att tca tta ggt gat gaa tac gcg cca 385
Trp Glu Val Ser Leu Asp Gly Ile Ser Leu Gly Asp Glu Tyr Ala Pro
115 120 125
tta gaa ggc cat gga get gcc att gat aca ggt acc 421
Leu Glu Gly His Gly Ala Ala Ile Asp Thr Gly Thr
130 135 140
CA 02384123 2002-03-06
WO 01/18182 PCT/US00/24110
13
<210> 14
<211> 140
<212> PRT
<213> Pichia methanolica
<400> 14
Glu Gly Asn Ual Ser Gln Asp Thr Leu Ala Leu Gly Asp Leu Ual Ile
1 5 10 15
Pro Lys Gln Asp Phe Ala Glu Ala Thr Ser Glu Pro Gly Leu Ala Phe
20 25 30
Ala Phe Gly Lys Phe Asp Gly Ile Leu Gly Leu Ala Tyr Asp Ser Ile
35 40 45
Ser Ual Asn Lys Ile Ual Pro Pro Ile Tyr Asn Ala Leu Asn Leu Gly
50 55 60
Leu Leu Asp Glu Pro Gln Phe Ala Phe Tyr Leu Gly Asp Thr Asn Thr
65 70 75 80
Asn Glu Glu Asp Gly Gly Leu Ala Thr Phe Gly Gly Ual Asp Glu Ser
85 90 95
Lys Tyr Thr Gly Lys Ual Thr Trp Leu Pro Ual Arg Arg Lys Ala Tyr
100 105 110
Trp Glu Ual Ser Leu Asp Gly Ile Ser Leu Gly Asp Glu Tyr Ala Pro
115 120 125
Leu Glu Gly His Gly Ala Ala Ile Asp Thr Gly Thr
130 135 140
<210> 15
<211> 17
<212> DNA
<213> Artificial Sequence
<220>
<223> Oligonucleotide primer ZC9126
<400> 15
atgtcaacac atttacc 17
<210> 16
<211> 17
<212> DNA
<213> Artificial Sequence
CA 02384123 2002-03-06
WO 01/18182 PCT/US00/24110
14
<220>
<223> Oligonucleotide primer ZC9741
<221> misc_feature
<222> (1). .(17)
<223> n = A.T,C or G
<400> 16
cayggnacnc aytgygc 17
<210> 17
<211> 368
<212> DNA
<213> Pichia methanolica
<220>
<221> CDS
<222> (1)...(366)
<221> misc_feature
<222> (1). .(368)
<223> n = A,T,C or G
<400> 17
ggg tcc gna cnc atg gtg ttt cta aga att gcc cac att gtt gcc gtc 48
Gly Ser Xaa Xaa Met Val Phe Leu Arg Ile Ala His Ile Val Ala Val
1 5 10 15
aaa gtt tta aga tct aac ggt tca ggt tct atg ccc gat gtt gtc aag 96
Lys Val Leu Arg Ser Asn Gly Ser Gly Ser Met Pro Asp Val Val Lys
20 25 30
ggt gtt gaa tat get ccc aat get cac ctt gcg gaa gcc aag get aac 144
Gly Val Glu Tyr Ala Pro Asn Ala His Leu Ala Glu Ala Lys Ala Asn
35 40 45
aag agt ggt ttt aaa ggt tct acc gcg aac atg tca tta ggt ggt ggt 192
Lys Ser Gly Phe Lys Gly Ser Thr Ala Asn Met Ser Leu Gly Gly Gly
50 55 60
aaa tct cca get tta gat atg tct gtt aac get cct gtt aaa gca ggt 240
Lys Ser Pro Ala Leu Asp Met Ser Val Asn Ala Pro Val Lys Ala Gly
65 70 75 80
CA 02384123 2002-03-06
WO 01/18182 PCT/US00/24110
tta cac ttt gcc gtt acc get ggt aac gat aac act gat gca tgt aac 288
Leu His Phe Ala Val Thr Ala Gly Asn Asp Asn Thr Asp Ala Cys Asn
85 90 95
tat tct cca gcc act act gaa aat act gtc act gtt gtt get tcc act 336
Tyr Ser Pro Ala Thr Thr Glu Asn Thr Val Thr Ual Val Ala Ser Thr
100 105 110
tta tct gat tcg aga get gac atg tct aac tc 368
Leu Ser Asp Ser Arg Ala Asp Met Ser Asn
115 120
<210> 18
<211> 122
<212> PRT
<213> Pichia methanolica
<220>
<221> VARIANT
<222> (1)...(122)
<223> Xaa = Any Amino Acid
<400> 18
Gly Ser Xaa Xaa Met Val Phe Leu Arg Ile Ala His Ile Val Ala Val
1 5 10 15
Lys Val Leu Arg Ser Asn Gly Ser Gly Ser Met Pro Asp Val Val Lys
25 30
Gly Val Glu Tyr Ala Pro Asn Ala His Leu Ala Glu Ala Lys Ala Asn
35 40 45
Lys Ser Gly Phe Lys Gly Ser Thr Ala Asn Met Ser Leu Gly Gly Gly
50 55 60
Lys Ser Pro Ala Leu Asp Met Ser Val Asn Ala Pro Val Lys Ala Gly
65 70 75 80
Leu His Phe Ala Val Thr Ala Gly Asn Asp Asn Thr Asp Ala Cys Asn
85 90 95
Tyr Ser Pro Ala Thr Thr Glu Asn Thr Val Thr Val Val Ala Ser Thr
100 105 110
Leu Ser Asp Ser Arg Ala Asp Met Ser Asn
115 120
<210> 19
CA 02384123 2002-03-06
WO 01/18182 PCT/US00/24110
16
<211> 17
<212> DNA
<213> Artificial Sequence
<220>
<223> Oligonucleotide primer ZC447
<400> 19
taacaatttc acacagg 17
<210> 20
<211> 18
<212> DNA
<213> Artificial Sequence
<220>
<223> Oligonucleotide primer ZC976
<400> 20
cgttgtaaaa cgacggcc 1g
<210> 21
<211> 39
<212> DNA
<213> Artificial Sequence
<220>
<223> Oligonucleotide primer ZC9079
<400> 21
cagctgccta ggactagttt cctcttacga gcaactaga 39
<210> 22
<211> 38
<212> DNA
<213> Artificial Sequence
<220>
<223> Oligonucleotide primer ZC9080
<400> 22
tgatcaccta ggactagtga caagtaggaa ctcctgta 38
