Note: Descriptions are shown in the official language in which they were submitted.
DEMANDES OU BREVETS VOLUMINEUX
LA PRESENTE PARTIE I)E CETTE DEMANDE OU CE BREVETS
COMPRI~:ND PLUS D'UN TOME.
CECI EST ~.E TOME 1 DE 2
NOTE: Pour les tomes additionels, veillez contacter 1e Bureau Canadien des
Brevets.
JUMBO APPLICATIONS / PATENTS
THIS SECTION OF THE APPLICATION / PATENT CONTAINS MORE
THAN ONE VOLUME.
THIS IS VOLUME 1 OF 2
NOTE: For additional vohxmes please contact the Canadian Patent Oi~ice.
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
DNA ENCODING A HUMAN MEI,ANANIN CONCENTRATING HORMONE
RECEPTOR (MCH1) AND USES THEREOF
BACKGROUND OF THE INVENTION
Throughout this application, various publications are
referenced in parentheses by author and year. Full
citations for these references may be found at the end of
l0 the specification immediately preceding the sequence
listings and the claims. The disclosure of these
publications in their entireties are hereby incorporated
by reference into this application to describe more fully
the state of the art to which this invention pertains.
l5
IVeuroregulators comprise a diverse group of natural
products that subserve or modulate communication in the
nervous system. They include, but are not limited to,
neuropeptides, amino acids, biogenic amines, lipids and
20 lipid metabolites, and other metabolic byproducts. Many
of these neuroregulator substances interact with specific
cell surface receptors which transduce signals from the
outside to the inside of the cell. G-protein coupled
receptors (GPCRs) represent a major class of cell surface
25 receptors with which many neurotransmitters interact to
mediate their effects. GPCRs are predicted to have seven
membrane-spanning domains. and are coupled to their
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-2-
effectors via G-proteins linking receptor activation with
intracellular biochemical sequelae such as stimulation of
adenylyl cyclase,
Melanin-concentrating hormone (MCH) is a cyclic peptide
originally isolated from salmonid (teleost fish)
pituitaries (Kawauchi et al., 1983). In fish the 17 amino
acid peptide causes aggregation of melanin within the
melanophores and inhibits the release of ACTH, acting as
a functional antagonist of a-MSH. Mammalian MCH (19 amino
acids) is highly conserved between rat, mouse, and human,
exhibiting 1000 amino acid identity, but its physiological
roles are less clear. MCH has been reported to
participate in a variety of processes including feeding,
water balance, energy metabolism, general
arousai/attention state, memory and cognitive functions,
and psychiatric disorders (for reviews, see Baker, 1991;
Baker, 1994; Nation, 1994;, Knigge et al., 1996). Its role
in feeding or body weight regulation is supported b~y a
recent Nature publication (Qu et al., 1996) demonstrating
that MCH is overexpressed in the hypothalamus of ob/ob
mice compared with ob/+ mice, and that fasting further
increased MCH mRNA in both obese and normal mice during
fasting. MCH also stimulated feeding in normal rats when
injected into the lateral ventricles (Rossi et al., 1997).
MCH also has been reported to functionally antagonize the
behavioral effects of a-MSH (Miller et al., 1993; Gonzalez
et al, 1996; Sanchez et al., 1997); in addition, stress
has been shown to increase POMC mRNA levels while
decreasing the MCH precursor preproMCH (ppMCH) mRNA levels
(Presse et al., 1992). Thus MCH may serve as an
integrative neuropeptide. involved in the reaction to
stress, as well as in the regulation of feeding and sexual
activity (Baker, 1991; Knigge et al., 1996).
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-3-
The gene encoding the MCH precursor (ppMCH) has been
cloned and encodes two additional peptides, neuropeptide
EI (13 AA) and neuropeptide GE (19AA) (Nation et al.,
1989), which may also have biological activity. MCH
peptide is synthesized primarily in hypothalamic neurons
(the zona incerta and lateral hypothalamus) which project
diffusely to many brain areas and to the pituitary
(Bittencourt et al., 1992'); NEI has also been identified
in medium from explanted hypothalamic neurons (Parker and
Vale, 1993). Localization studies of the mRNA indicate
that MCH is also present in the periphery (testes and GI
tract; Hervieu and Nation, 1995) but the highest
concentrations are in the hypothalamus. There is also
evidence for differential tissue-dependent processing of
proMCH in mammals. A shorter MCH gene transcript that may
result from alternate splicing was found in several brain
areas and peripheral tissues, and a different peptide form
was also found in the periphery (Viale et al., 1997). In
humans, the gene encoding authentic MCH has been localized
to chromosome 12, but two copies of a variant (truncated)
gene are present on chromosome 5 (Breton et al., 1993);
the functional significance, if any, of the variant is not
yet known. Finally, the rat MCH gene may encode an
additional putative peptide in a different reading frame
(Toumaniantz et al., 1996).
Although the biological effects of MCH are believed to be
mediated by specific receptors, binding sites for MCH have
not been well described. A tritiated ligand ([3H]-MCH) was
reported to exhibit specific binding to brain membranes
but was unusable for saturation analyses, so neither
affinity nor Bma,{ were determined (Drozdz and Eberle, 1995).
Radioiodination of the tyrosine at position thirteen
resulted in a ligand with dramatically reduced biological
activity (see Drozdz and Eberle, 1995). In contrast, the
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-4-
radioiodination of the MCH analogue [Phel3, Tyrl~] -MCH was
successful (Drozdz et al., 1995); the ligand retained
biological activity and exhibited specific binding to a
variety of cell lines including mouse melanoma (B16-F1,
G4F, and G4F-7), PC12, and COS cells. In G4F-7 cells, the
KL, = 0.118nM and the Bma;_ ~'1100 sites/cell. Importantly,
the binding was not inhibited by a-MSH but was weakly
inhibited by rat ANF (Ki - 116 nM vs. l2 nM for native
MCH) (Drozdz et al., 1995). More recently specific NICH
binding was reported in transformed keratinocytes (Burgaud
et al., 1997) and melanoma cells (Drozdz et al., 1998),
where photo-crosslinking studies suggest that the receptor
is a membrane protein with an apparent molecular weight of
45-50 kDaltons, compatible with the molecular weight range
of the GPCR superfamily of receptors. No
radioautoradiographic studies of MCH receptor localization
using this ligand have been reported as yet.
Signal transduction mechanisms for MCH receptors remain
obscure. No direct evidence supporting G-protein coupling
exists in mammals, but two lines of weak evidence exist in
teleost fish for Gaq- and/or Gai- type coupling: 1)
indirect evidence exists for MCH acting via phospholipase
C in teleost fish melanophores (phospholipase C inhibitors
and protein kinase C inhibitors shift the MCH dose-
response curve to the right, and TPA mimics MCH at low
doses (Abrao et al., 1991)); and 2) MCH-elicited pigment
aggregation in fish melanophores is associated with a
reduction in basal cAMP levels, similar to that observed
with norepinephrine (Svensson et al., 1991; Morishita et
al., 1993). Arguing against G-protein coupling is the
general structural homology of MCH with ANF, whose
receptors are not in the GPCR superfamily. Recently the
actions of MCH were reported to be mediated via activation
of a phosphatidylinositol-3-kinase pathway which is
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-5-
typical of tyrosine kinase and cytokine receptors (Qu et
al., 1998); however, since multiple signaling pathways
(receptor cross talk) may produce this mediator no
conclusions can be reached regarding MCH signal
transduction pathways in mammalian systems.
The localization and biological activities of MCH peptide
suggest that the modulation of MCH receptor activity may
be useful in a number of therapeutic applications. The
role of MCH in feeding is the best characterized of its
potential clinical uses. MCH is expressed in the lateral
hypothalamus, a brain area implicated in the regulation of
thirst and hunger (Grillon et al., 1997); recently orexins
A and B, which are potent orexigenic agents, have been
shown to have very similar localization to MCH in the
lateral hypothalamus (Sakurai et al., 1998). MCH mRNA
levels in this brain region are increased in rats after 24
hours of food-deprivation (Nerve and Fellman, 1997);
after insulin injection, a significant increase in the
abundance and staining intensity of MCH immunoreactive
perikarya and fibres was observed concurrent with a
significant increase in the level of MCH mRNA (Bahjaoui-
Bouhaddi et al., 1994). Consistent with the ability of MCH
to stimulate feeding in rats (Rossi et al., 1997) is the
observation that MCH mRNA levels are upregulated in the
hypothalami of obese ob/ob mice (Qu et al., 1996), and
decreased in the hypothalami of rats treated with leptin,
whose food intake and body weight gains are also decreased
(Sahu, 1998). MCH appears to act as a functional
antagonist of the melanocortin system in its effects on
food intake and on hormone secretion within the I-IPA
(hypothalamopituitary /adrenal axis) (Ludwig et al.,
1998). Further evidence of the involvement of MCH in the
regulation of feeding behavior came from studies in mice
in which the gene encoding the MCH peptide has been
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
deleted (Shimada et al., 1998). In these mice, the genetic
deficiency of MCH led to a phenotype characterized by
reduced body weight, low body fat content, and increased
metabolic rate. More recently, it has been shown that the
overexpression of the gene encoding MCH in different
strains of mice can lead to obese phenotypes with and
without secondary impairment of glucose homeostasis and
insulin resistance (Tritos et al., 2000).
Together these data suggest a role for endogenous MCH in
the regulation of energy balance and response to stress,
and provide a rationale for the development of specific
compounds acting at MCH receptors for use in the treatment
of obesity and stress-related disorders.
In all species studied to date., a major portion of the
neurons of the MCH cell group occupies a rather constant
location in those areas of the lateral hypothalamus and
subthalamus where they lie and may be a part of some of
the so-called "extrapyramidal" motor circuits. These
involve substantial striato- and pallidofugal pathways
involving the thalamus and cerebral cortex, hypothalamic
areas, and reciprocal connections to subthalamic nucleus,
substantia nigra, and mid-brain centers (Bittencourt et
al., 1992). In their location, the MCH cell group may
offer a bridge or mechanism for expressing hypothalamic
visceral activity with appropriate and coordinated motor
activity. Clinically it may be of some value to consider
the involvement of this MCH system in movement disorders,
such as Parkinson's disease and Huntingdon's Chorea in
which extrapyramidal circuits are known to be involved.
Human genetic linkage studies have located authentic hMCH
loci on chromosome 12 (12q23-24) and the variant hMCH loci
on chromosome 5 (5q12-13) (Pedeutour et al., 1994). Locus
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
12q23-24 coincides with a locus to which autosomal
dominant cerebellar ataxia type II (SCA2) has been mapped
(Auburger et al., 1992; Twells et al., 1992). This
disease comprises neurodegenerative disorders, including
an olivopontocerebellar atrophy. Furthermore, the gene
for Darier' s disease, has been mapped to locus 12q23-24
(Craddock et al., 1993). Dariers' disease is
characterized by abnormalities I keratinocyte adhesion and
mental illnesses in some families. In view of the
functional and neuroanatomical patterns of the MCH neural
system in the rat and human brains, the MCH gene may
represent a good candidate for SCA2 or Darier's disease.
Interestingly, diseases with high social impact have been
mapped to this locus. Indeed, the gene responsible for
chronic or acute forms of spinal muscular atrophies has
been assigned to chromosome 5q12-13 using genetic linkage
analysis (Melki et al., 1990; Westbrook et al., 1992).
Furthermore, independent lines of evidence support the
assignment of a major schizophrenia locus to chromosome
5q11.2-13.3 (Sherrington et al., 1988; Bassett et al.,
1988; Gilliam et al., 1989) . The above studies suggest
that MCH may play a role in neurodegenerative diseases and
disorders of emotion.
Additional therapeutic applications for MCH-related
compounds are suggested by the observed effects of MCH in
other biological systems. For example, MCH may regulate
reproductive functions in male and female rats. MCH
transcripts and MCH peptide were found within germ cells
in testes of adult rats, suggesting that MCH may
participate in stem cell renewal and/or differentiation of
early spermatocytes (Hervieu et al., 1996). MCH injected
directly into the medial preoptic area (MPOA) or
ventromedial nucleus (VMN) stimulated sexual activity in
female rats (Gonzalez et al., 1996). In ovariectomized
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
_g_
rats primed with estradiol, MCH stimulated luteinizing
hormone (LH) release while anti-MCH antiserum inhibited LH
release (Gonzalez et al., 1997). The zona incerta, which
contains a large population of MCH cell bodies, has
previously been identified as a regulatory site for the
pre-ovulatory LH surge (MacKenzie et al., 1984). MCH has
been reported to influence release of pituitary hormones
including ACTH and oxytocin. MCH analogues may also be
useful in treating epilepsy. In the PTZ seizure model,
injection of MCH prior to seizure induction prevented
seizure activity in both rats and guinea pigs, suggesting
that MCH-containing neurons may participate in the neural
circuitry underlying PTZ-induced seizure (Knigge and
Wagner, 1997). MCH has also been observed to affect
behavioral correlates of cognitive functions. MCH
treatment hastened extinction of the passive avoidance
response in rats (McBride et al., 1994), raising the
possibility that MCH receptor antagonists may be
beneficial for memory storage and/or retention. A
possible role for MCH in the modulation or perception of
pain is supported by the dense innervation of the
periaqueductal grey (PAG) by MCH-positive fibers.
Finally, MCH may participate in the regulation of fluid
intake. ICV infusion of MCH in conscious sheep produced
diuretic, natriuretic, and kaliuretic changes in response
to increased plasma volume (Parker, 1996). Together with
anatomical data reporting the presence of MCH in fluid
regulatory areas of the brain, the results indicate that
MCH may be an important peptide involved in the central
control of fluid homeostasis in mammals.
In light of the localization of MCH1 throughout limbic
regions of the rat CNS as described hereinafter, a series
of in vivo behavioral experiments were carried out to
evaluate the antidepressant and anxiolytic properties of
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-9-
a selective MCH1 receptor antagonist. The rat Forced Swim
Test and the rat Social Interaction Test were employed to
evaluate the use of selective MCH1 receptor antagonists to
treat depression and anxiety. These models are considered
by experts in the field to reflect the potential of agents
to treat depression and anxiety.
Rat Forced Swim Test (FSTI
The rat Forced Swim Test (FST) is a behavioral test that
is used to screen compounds for antidepressant efficacy
(Porsolt et al., 1977, 1978; Porsolt, 1981). This test is
widely used as it is reliable across laboratories,
relatively easy to perform and is sensitive to the effects
of some of the major classes of antidepressants drugs,
l5 including TCAs and MAOIs, and various atypical
antidepressants. Furthermore, this test is relatively
selective for antidepressant drugs, as few psychoactive
drugs produce similar behavioral actions in the FST.
In the rat FST, animals are placed in a cylinder of water,
from which there is no escape, for an extended period of
time. Typically, animals will display a range of
behaviors such as immobility, climbing, swimming, and
diving, with immobility being predominant after several
minutes of immersion in the water. Consequently, many
past studies have only measured or scored immobility after
the administration of the test agent. Unfortunately, this
method does not score any other active behaviors that may
be produced by potential antidepressants. Thus, if a
particular class of antidepressant were to have very
little effect on immobility, yet produce characteristic
behaviors during the FST, these behaviors would not be
scored and the conclusion would be that the compound in
question does not possess antidepressant action.
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-10-
Recently, however, a sampling technique was developed to
score active behaviors in the FST, such as swimming,
climbing and diving, in addition to immobility (Detke, et
al., 1995; Lucki, 1997; Page, et al., 1999; Reneric and
Zucki, 1998). This modified sampling technique has
indicated that SSRIs, such as fluoxetine, paroxetine and
sertraline, significantly decrease immobility and increase
swimming time (Detke, et al . , 1995; Page, et al . , 1999) .
In contrast, selective reuptake inhibitors of
norepinephrine (NE) increase climbing behavior but do not
alter swimming time (Detke, et al . , 1995; Page, et al . ,
1999) .
Rat Social Interaction Test (SIT)
There are a number of paradigms that have been used to
determine whether a compound possesses anxiolytic action.
A number of these tests involve food or water deprivation,
punishment or measurement of consummatory behavior (see
File, et al., 1980, File, 1985, Rodgers, et al., 1997 and
?0 Treit, 1985, for review). In addition, in these models,
prior conditioning reduces the uncertainty or anxiety. Tn
general, these tests lack~ethological validity.
One model that is based upon an unconditioned response
that does not involve punishment or deprivation is the
Social Interaction Test (SIT) (File and Hyde, 1978, 1979).
In this model, rats previously housed singly are placed in
a familiar, dimly lit, test arena with weight-matched,
novel partners. The principal anxiogenic stimulus under
these conditions is the partner novelty, which involves an
unconditioned response to a potential threat. After
pharmacological treatments, the following behaviors are
scored as active social interaction: grooming, sniffing,
biting, boxing, wrestling, following, crawling over and
crawling under. A wide range of psychoactive drugs have
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-11-
been examined in this paradigm and it has been shown that
the social interaction test can distinguish anxiolytics
from antidepressants, antipsychotics, analeptics and
sedative agents (File, 1985; Guy and Gardner, 1985). This
test can detect anxiolytic agents such as the
benzodiazepines (File and Hyde, 1978; File and Hyde, 1979;
File, 1980), in addition to non-benzodiazepines, including
paroxetine and other SSRIs (Zightowler, et al., 1994).
Finally, the social interaction test can detect anxiogenic
l0 agents, including the inverse benzodiazepine receptor
agonists (File, et al., 1982, File and Pellow, 1983; File
and Pellow, 1984, File, 1985).
From the binding and functional activity information
l5 described hereinafter, it has been unexpectedly discovered
that compounds which are MCH1 receptor antagonists are
effective in animal models of obesity, depression and
anxiety, which are predictive of efficacy in humans. Thus,
we demonstrate that MCHl receptor antagonists provide a
20 novel method to treat obesity. Additionally, we
demonstrate that MCH1 receptor antagonists provide a novel
method to treat depression andlor anxiety.
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-12-
StTN~IARY OF THE INVENTION
This invention provides an isolated nucleic acid encoding
a human MCHl receptor or a mutant of such human MCH1
receptor which is activated by MCH or an analog or homolog
thereof.
This invention provides a nucleic acid encoding a human
MCH1 receptor, wherein the nucleic acid (a) hybridizes to
a nucleic acid having the defined sequence shown in Figure
1 (SEQ ID NO: 1) under low stringency conditions or a
sequence complementary thereto and (b) is further
characterized by its ability to cause a change in the pH
of a culture of CHO cells when an MCHl ligand is added to
the culture and the CHO cells contain the nucleic acid
which hybridized to the nucleic acid having the defined
sequence or its complement.
This invention provides a purified human MCH1 receptor
protein.
This invention provides a vector comprising a nucleic acid
encoding a human MCH1 receptor, particularly a vector
adapted for expression of the human MCH1 receptor in
mammalian or non-mammalian cells. One such vector is a
plasmid designated pEXJ.HR-TL231 (ATCC Accession No.
203197) which comprises a nucleotide sequence encoding a
human MCHl receptor.
This invention also provides a cell comprising a vector
which comprises a nucleic acid encoding a human MCH1
receptor as well as a membrane preparation isolated from
such cells.
This invention further provides a nucleic acid probe
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-13-
comprising at least 15 nucleotides which specifically
hybridizes with a nucleic acid encoding a mammalian MCH1
receptor, wherein the probe has a unique sequence
corresponding to a sequence present within the nucleic
acid which encodes the human MCH1 receptor or its
complement, both of which are present in plasmid pEXJ.HR-
Tv231 (ATCC Accession No. 203197).
This invention further provides a nucleic acid probe
comprising at least 15 nucleotides which specifically
hybridizes with a nucleic acid encoding a mammalian MCH1
receptor, wherein the probe has a unique sequence
corresponding to a sequence present within (a) the nucleic
acid sequence shown in Figure 1 (SEQ ID N0: 1) or (b) the
l5 reverse complement thereof.
This invention also provides an antisense oligonucleotide
having a sequence capable of specifically hybridizing an
RNA encoding a human MCH1 receptor, so as to prevent
translation of the RNA and an antisense oligonucleotide
having a sequence capable of specifically hybridizing to
the genomic DNA encoding a human~MCHl receptor.
This invention further provides an antibody capable of
binding to a human MCH1, receptor as well as an agent
capable of competitively inhibiting the binding of the
antibody to a human MCH1 receptor.
This invention provides a pharmaceutical composition
comprising (a) an amount of the oligonucleotide described
above capable of passing through a cell membrane and
effective to reduce expression of a human MCH1 receptor
and (b) a pharmaceutically acceptable carrier capable of
passing through the cell membrane.
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-14-
Moreover, this invention provides a transgenic, nonhuman
mammal expressing DNA encoding a human MCH1 receptor.
This invention alsorprovides a transgenic, nonhuman mammal
comprising a homologous recombination knockout of the
native human MCH1 receptor. This invention further
provides a transgenic, nonhuman mammal whose genome
comprises antisense DNA complementary to the DNA encoding
a human MCHl receptor so placed within the genome as to be
transcribed into antisense mRNA which is complementary to
mRNA encoding the human MCH1 receptor and which hybridizes
to mRNA encoding the human MCH1 receptor, thereby reducing
its translation.
In one embodiment this invention provides a process for
identifying a chemical compound which specifically binds
to a mammalian MCH1 receptor which comprises contacting
cells containing DNA encoding and expressing on their cell
surface a mammalian MCH1 receptor, wherein such cells do
not normally express the mammalian MCH1 receptor, with the
compound under conditions suitable for binding, and
detecting specific binding of the chemical compound to the
mammalian MCHl receptor.
This invention provides a process for identifying a
chemical compound which specifically binds to a mammalian
MCH1 receptor which comprises contacting a membrane
preparation from cells transfected with DNA encoding and
expressing on their cell surface the mammalian MCH1
receptor, wherein such cells do not normally express the
mammalian MCH1 receptor, with the compound under
conditions suitable for binding, and detecting specific
binding of the chemical compound to the mammalian MCH1
receptor.
This invention provides a process involving competitive
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-15-
binding for identifying a chemical compound which
specifically binds to a mammalian MCH1 receptor which
comprises separately contacting cells expressing on their
cell surface the mammalian MCH1 receptor, wherein such
cells do not normally express the mammalian MCH1 receptor,
with both the chemical compound and a second chemical
compound known to bind to the receptor, and with only the
second chemical compound, under conditions suitable for
binding of both compounds, and detecting specific binding
of the chemical compound to the mammalian MCHl receptc~r,
a decrease in the binding of the second chemical compound
to the mammalian MCH1 receptor in the presence of the
chemical compound indicating that the chemical compound
binds to the mammalian MCH1 receptor.
This invention provides a process involving competitive
binding for identifying a chemical compound which
specifically binds to a mammalian MCH1 receptor which
comprises separately contacting a membrane fraction from
a cell extract of cells expressing on their cell surface
the mammalian MCH1 receptor, wherein such cells do not
normally express the mammalian MCHl receptor, with both
the chemical compound and a second chemical compound known
to bind to the receptor, and with only the second chemical
compound, under conditions suitable for binding of both
compounds, and detecting specific binding of the chemical
compound to the mammalian MCH1 receptor, a decrease in the
binding of the second chemical compound to the mammalian
MCH1 receptor in the presence of the chemical compound
indicating that the chemical compound binds to the
mammalian MCH1 receptor.
This invention provides a method of screening a plurality
of chemical compounds not known to bind to a mammalian
MCH1 receptor to identify a compound which specifically
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-16-
binds to the mammalian MCH1 receptor, which comprises (a)
contacting cells transfected with and expressing DNA
encoding the mammalian MCHl receptor with a compound known
to bind specifically to the mammalian MCHl receptor; (b)
contacting the preparation of step (a) with the plurality
of compounds not known to bind specifically to the
mammalian MCH1 receptor, under conditions permitting
binding of compounds known to bind the mammalian MCHl
receptor; (c) determining whether the binding of the
compound known to bind to the mammalian MCH1 receptor is
reduced in the presence of the compounds within the
plurality of compounds, relative to the binding of the
compound in the absence of the plurality of compounds; and
if so (d) separately determining the binding to the
l5 mammalian MCH1 receptor of compounds included in the
plurality of compounds, so as to thereby identify the
compound which specifically binds to the mammalian MCH1
receptor.
This invention provides a method of screening a plurality
of chemical compounds not known to bind to a mammalian
MCHl receptor to identify a compound which specifically
binds to the mammalian MCH1 receptor, which comprises (a)
contacting a membrane preparation from cells transfected
L5 with and expressing DNA encoding a mammalian MCH1 receptor
with a compound known to bind specifically to the
mammalian MCH1 receptor; (b) contacting the preparation of
step (a) with the plurality of compounds not known to
bind specifically to the mammalian MCH1 receptor, under
conditions permitting binding of compounds known to bind
the mammalian MCH1 receptor; (c) determining whether the
binding of the compound known to bind to the mammalian
MCH1 receptor is reduced in the presence of the compounds
within the plurality of compounds, relative to the binding
of the compound in the absence of the plurality of
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-17-
compounds; and if so (d) separately determining the
binding to the mammalian MCH1 receptor of compounds
included in the plurality of compounds, so as to thereby
identify the compound which specifically binds to the
mammalian MCH1 receptor.
This invention provides a method of detecting expression
of a mammalian MCH1 receptor by detecting the presence of
mRNA coding for the mammalian MCH1 receptor which
comprises obtaining total mRNA from the cell and
contacting the mRNA so obtained with a nucleic acid probe
under hybridizing conditions, detecting the presence of
mRNA hybridizing to the probe, and thereby detecting the
expression of the mammalian MCH1 receptor by the cell.
This invention provides a method of detecting the presence
of a mammalian MCH1 receptor on the surface of a cell
which comprises contacting the cell with an antibody under
C011ditions permitting binding of the antibody to the
receptor, detecting the presence of the antibody bound to
the cell, and thereby detecting the presence of the
mammalian MCH1 receptor on the surface of the cell.
This invention provides a method of determining the
physiological effects of varying levels of activity of
human MCH1 receptors which comprises producing a
transgenic, nonhuman mammal whose levels of human MCH1
receptor activity are varied by use of an inducible
promoter which regulates human MCH1 receptor expression.
This invention provides a method of determining the
physiological effects of varying levels of activity of
human MCH1 receptors which comprises producing a panel of
transgenic, nonhuman mammals each expressing a different
amount of human MCH1 receptor.
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
_Z8_
This invention provides a method for identifying an
antagonist capable of alleviating an abnormality wherein
the abnormality is alleviated by decreasing the activity
of a human MCHl receptor comprising administering a
compound to the transgenic, nonhuman mammal and
determining whether the compound alleviates the physical
and behavioral abnormalities displayed by the transgenlc,
nonhuman mammal as a result of overactivity of a human
MCH1 receptor, the alleviation of the abnormality
identifying the compound as an antagonist. This invEntion
also provides an antagonist identified by this method.
This invention further provides a pharmaceutical
composition comprising an antagonist identified by this
method and a pharmaceutically acceptable carrier.
This invention provides a method of treating an
abnormality in a subject wherein the abnormality is
alleviated by decreasing the activity of a human MCH1
receptor which comprises administering to the subject an
effective amount of this pharmaceutical composition,
thereby treating the abnormality.
This invention provides a method for identifying an
agonist capable of alleviating an abnormality in a subject
wherein the abnormality is alleviated by increasing the
activity of a human MCH1 receptor comprising administering
a compound to a transgenic, nonhuman mammal, and
determining whether the compound alleviates the physical
and behavioral abnormalities displayed by the transgenic,
nonhuman mammal, the alleviation of the abnormality
identifying the compound as an agonist. This invention
also provides an agonist identified by this method. This
invention further provides a pharmaceutical composition
comprising an agonist identified by this method and a
pharmaceutically acceptable carrier. This invention
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-19-
provides a method of treating an abnormality in a subject
wherein the abnormality is alleviated by increasing the
activity of a human MCH1 receptor which comprises
administering to the subject an effective amount of this
pharmaceutical composition, thereby treating the
abnormality.
This invention provides a method for diagnosing a
predisposition to a disorder associated with the activity
of a specific mammalian allele which comprises: (a)
obtaining DNA of subjects suffering from the disorder; (b)
performing a restriction digest of the DNA with a panel of
restriction enzymes; (c) electrophoretically separating
the resulting DNA fragments on a sizing gel; (d)
contacting the resulting gel with a nucleic acid probe
capable of specifically hybridizing with a unique sequence
included within the sequence of a nucleic acid molecule
encoding a human MCH1 receptor and labeled with a
detectable marker; (e) detecting labeled bands which have
hybridized to the DNA encoding a human MCH1 receptor
labeled with a detectable marker to create a unique band
pattern specific to the DNA of subjects suffering from the
disorder; (f) preparing DNA obtained for diagnosis by
steps (a)-(e); and (g) comparing the unique band pattern
specific to the DNA of subjects suffering from the
disorder from step (e) and the DNA obtained for diagnosis
from step (f) to determine whether the patterns are the
same or different and to diagnose thereby predisposition
to the disorder if the patterns are the same.
This invention provides a method of preparing a purified
human MCHl receptor which comprises: (a) inducing cells to
express the human MCHl receptor; (b) recovering the human
MCH1 receptor from the induced cells; and (c) purifying
the human MCH1 receptor so recovered.
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-20-
This invention provides a method of preparing a purified
human MCHl receptor which comprises: (a)inserting nucleic
acid encoding the human MCH1 receptor in a suitable
vector; (b) introducing the resulting vector in a suitable
host cell; (c) placing the resulting cell in suitable
condition permitting the production of the isolated human
MCHl receptor; (d) recovering the human MCH1 receptor
produced by the resulting cell; and (e) purifying the
human MCHl receptor so recovered.
This invention provides a process for determining whether
a chemical compound is a mammalian MCH1 receptor agonist
which comprises contacting cells transfected with and
expressing DNA encoding the mammalian MCH1 receptor with
the compound under conditions permitting the activation of
the mammalian MCH1 receptor, and detecting an increase in
mammalian MCH1 receptor activity, so as to thereby
determine whether the compound is a mammalian MCH1
receptor agonist. This invention also provides a
pharmaceutical composition which comprises an amount of a
mammalian MCH1 receptor agonist determined by this process
effective to increase activity of a mammalian MCH1
receptor and a pharmaceutically acceptable carrier.
This invention provides a process for determining whether
a chemical compound is a mammalian MCH1 receptor
antagonist which comprises contacting cells transfected
with and expressing DNA encoding the mammalian MCH1
receptor with the compound in the presence of a known
mammalian MCH1 receptor agonist, under conditions
permitting the activation of the mammalian MCH1 receptor,
and detecting a decrease in mammalian MCH1 receptor
activity, so as to thereby determine whether the compound
is a mammalian MCH1 receptor antagonist. This invention
also provides a pharmaceutical composition which comprises
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
_21_
an amount of a mammalian MCH1 receptor antagonist
determined by this process effective to reduce activity of
a mammalian MCH1 receptor and a pharmaceutically
acceptable carrier.
This invention provides a process for determining whether
a r_hemical compound specifically binds to and activates a
mammalian MCH1 receptor, which comprises contacting cells
producing a second messenger response and expressing on
their cell surface the mammalian MCH1 receptor, wherein
such cells do not normally express the mammalian MCH1
receptor, with the chemical compound under conditions
suitable for activation of the mammalian MCH1 receptor,
and measuring the second messenger response in the
presence and in the absence of the chemical compound, a
change in the second messenger response in the presence of
the chemical compound indicating that the compound
activates the mammalian MCH1 receptor. This invention
also provides a compound determined by this process. This
invention further provides a pharmaceutical composition
which comprises an amount of the compound (a MCHl receptor
agonist) determined by this process effective to increase
activity of a mammalian MCH1 receptor and a
pharmaceutically acceptable carrier.
This invention provides a process for determining whether
a chemical compound specifically binds to and inhibits
activation of a mammalian MCH1 receptor, which comprises
separately contacting cells producing a second messenger
response and expressing on their cell surface the
mammalian MCH1 receptor; wherein such cells do not
normally express the mammalian MCH1 receptor, with both
the chemical compound and a second chemical compound known
to activate the mammalian MCH1 receptor, and with only the
second chemical compound, under conditions suitable for
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-22-
activation of the mammalian MCH1 receptor, and measuring
the second messenger response in the presence of only the
second chemical compound and in the presence of both the
second chemical compound and the chemical compound, a
smaller change in the second messenger response in the
presence of both the chemical compound and the second
chemical compound than in~the presence of only the second
chemical compound indicating that the chemical compound
inhibits activation of the mammalian MCH1 receptor. This
invention also provides a compound determined by this
process. This invention further provides a pharmaceutical
composition which comprises an amount of the compound (a
mammalian MCH1 receptor antagonist) determined by this
effective to reduce activity of a mammalian MCH1 receptor
and a pharmaceutically acceptable carrier.
This invention provides a method of screening a plurality
of chemical compounds not known to activate a mammalian
MCHl receptor to identify a compound which activates the
mammalian MCH1 receptor which comprises: (a) contacting
cells transfected with arid expressing the mammalian MCH1
receptor with the plurality of compounds not known to
activate the mammalian MCH1 receptor, under conditions
permitting activation of the mammalian MCH1 receptor; (b)
determining whether the activity of the mammalian MCH1
receptor is increased in the presence of the compounds;
and if so (c) separately determining whether the
activation of the mammalian MCH1 receptor is increased by
each compound included in the plurality of compounds, so
as to thereby identify the compound which activates the
mammalian MCH1 receptor. This invention also provides a
compound identified by this method. This invention
further provides a pharmaceutical composition which
comprises an amount of the compound (a mammalian MCH1
receptor agonist) identified by this method effective to
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-23-
increase activity of a mammalian MCHl receptor and a
pharmaceutically acceptable carrier.
This invention provides a method of screening a plurality
of chemical compounds not known to inhibit the activation
of a mammalian MCHl receptor to identify a compound which
inhibits the activation of the mammalian MCH1 receptor,
which comprises: (a) contacting cells transfected with and
expressing the mammalian MCH1 receptor with the plurality
of compounds in the presence of a known mammalian MCHl
receptor agonist, under conditions permitting activation
of the mammalian MCH1 receptor; (b) determining whether
the activation of the mammalian MCH1 receptor is reduced
in the presence of the plurality of compounds, relative to
the activation of the mammalian MCHl receptor in the
absence of the plurality of compounds; and if so (c)
separately determining the inhibition of activation of the
mammalian MCH1 receptor for each compound included in the
plurality of compounds, so as to thereby identify the
compound which inhibits the activation of the mammalian
MCH1 receptor. This invention also provides a compound
identified by this method. This invention further
provides a pharmaceutical composition which comprises an
amount of the compound (a mammalian MCH1 receptor
antagonist) identified by this process effective to
decrease activity of a mammalian MCH1 receptor and a
pharmaceutically acceptable carrier.
This invention provides a method of treating an
abnormality in a subject wherein the abnormality is
alleviated by increasing the activity of a mammalian MCH1
receptor which comprises administering to the subject an
amount of a compound which is a mammalian MCH1 receptor
agonist effective to treat the abnormality.
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-24-
This invention provides a method of treating an
abnormality in a subject wherein the abnormality is
alleviated by decreasing the activity of a mammalian MCH1
receptor which comprises administering to the subject an
amount of a compound which is a mammalian MCH1 receptor
antagonist effective to treat the abnormality.
This invention provides a process for making a composition
of matter which specifically binds to a mammalian MCH1
receptor which comprises identifying a chemical compound
using any of the processes described herein for
identifying a compound which binds to and/or activates or
inhibits activation of a mammalian MCH1 receptor and then
synthesizing the chemical compound or a novel structural
and functional analog or homolog thereof. This invention
further provides a process for preparing a pharmaceutical
composition which comprises administering a
pharmaceutically acceptable carrier and a pharmaceutically
acceptable amount of a chemical compound identified by any
of the processes described herein for identifying a
compound which binds to and/or activates or inhibits
activation of a mammalian MCH1 receptor or a novel
structural and functional analog or homolog thereof.
This invention provides a process for determining whether
a chemical compound is a human MCH1 receptor antagonist
which comprises contacting cells transfected with and
expressing DNA encoding the human MCH1 receptor with the
compound in the presence . of a known human MCH1 receptor
agonist, under conditions permitting the activation of the
human MCH1 receptor, and detecting a decrease in human
MCH1 receptor activity, so as to thereby determine whether
the compound is a~human MCHl receptor antagonist, wherein
the DNA encoding the human MCH1 receptor comprises the
sequence shown in Figure 1 (Seq. ID No. 1) or contained in
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-25-
plasmid pEXJ.HR-TL231 (ATCC Accession No. 203197), the
known human MCH1 receptor agonist is MCH or a homolog or
analog of MCH, and the cells do not express the MCHl
receptor prior to transfecting them.
This invention also provides a process for determining
whether a chemical compound specifically binds to and
inhibits activation of a human MCH1 receptor, which
comprises separately contacting cells expressing on their
cell surface the human MCHl receptor and producing a
second messenger response upon activation of the human
MCH1 receptor, wherein such cells do not normally express
the human MCH1 receptor and the DNA encoding the human
MCH1 receptor comprises the sequence shown in Figure 1
(Seq. ID No. 1) or contained in plasmid pEXJ.HR-TL231
(ATCC Accession No. 203197), with both the chemical
compound and a second chemical compound known to activate
the human MCHI receptor, and with only the second chemical
compound, under conditions suitable for activation of the
human MCH1 receptor, and measuring the second messenger
response in the presence of only the second chemical
compound and in the presence of both the second chemical
compound and the chemical compound, a smaller change in
the second messenger .response in the presence of both the
chemical compound and the second chemical compound than in
the presence of only the second chemical compound
indicating that the chemical compound inhibits activation
of the human MCH1 receptor, wherein the second chemical
compound is MCH or a homolog or analog of MCH.
This invention further provides a method of screening a
plurality of chemical compounds not known to inhibit the
activation of a human MCHl. receptor to identify a compound
which inhibits the activation of the human MCH1 receptor,
which comprises:
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-2 6-
(a) contacting cells transfected with and expressing the
human MCHl receptor, wherein such cells do not
normally express the human MCH1 receptor and the DNA
encoding the human MCHl receptor comprises the
sequence shown in Figure 1 (Seq. ID No. 1) or
contained in plasmid pEXJ.HR-TL231 (ATCC Accession
No. 203197), with the plurality of compounds in the
presence of a known human MCH1 receptor agonist,
under conditions permitting activation of the human
MCH1 receptor, wherein the known MCH1 receptor
agonist is MCH or a homolog or analog of MCH;
(b) determining whether the activation of the human MCH1
receptor is reduced in the presence of the plurality
of compounds, relative to the activation of the
human MCH1 receptor in the absence of the plurality
of compounds; and if so
(c) separately determining the extent of inhibition of
activation of the human MCH1 receptor for each
compound included in the plurality of compounds, so
as to thereby identify the compound which inhibits
the activation of the human MCH1 receptor.
This invention provides a process for making a composition
of matter which specifically binds to a human MCH1
receptor which comprises identifying a chemical compound
which specifically binds to the human MCH1 receptor and
then synthesizing the chemical compound or a structural
and functional analog or homolog thereof, wherein the
chemical compound is identified as binding to the human
MCH1 receptor by a process involving competitive binding
which comprises contacting cells expressing on their cell
surface the human MCH1 receptor, with both the chemical
compound and a second chemical compound known to bind to
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-27-
the receptor, and separately with only the second chemical
compound, under conditions suitable for binding of both
compounds, and detecting the extent of specific binding of
the chemical compound to the human MCHl receptor, a
decrease in the binding of the second chemical compound to
the human MCH1 receptor in the presence of the chemical
compound indicating that the chemical compound binds to
the human MCHl receptor, wherein the cells do not normally
express the human MCH1 receptor, the human MCH1 receptor
is encoded by nucleic acid comprising the sequence shown
in Figure 1 (Seq. ID No. 1) or contained in plasmid
pEXJ.HR-TL231 (ATCC Accession No. 203197), and the second
chemical compound is MCH or a homolog or analog of MCH.
This invention further provides a process for making a
composition of matter which specifically binds to a human
MCH1 receptor which comprises identifying a chemical
compound which specifically binds to the human MCH1
receptor and then synthesizing the chemical compound or a
structural and functional analog or homolog thereof,
wherein the chemical compound is identified as binding to
the human MCHl receptor by a process involving competitive
binding which comprises contacting a membrane preparation
from cells expressing on their cell surface the human MCH1
receptor, with both the chemical compound and a second
chemical compound known to bind to the receptor, and
separately with only the second chemical compound, under
conditions suitable for binding of both compounds, and
detecting the extent of specific binding of the chemical
compound to the human MCH1 receptor, a decrease in the
binding of the second chemical compound to the human MCH1
receptor in the presence of the chemical compound
indicating that the chemical compound binds to the human
MCH1 receptor, wherein the cells do not normally express
the human MCH1 receptor, the human MCH1 receptor is
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-28-
encoded by nucleic acid comprising the sequence shown in
Figure 1 (Seq. ID No. 1) or contained in plasmid pEXJ.HR-
TL231 (ATCC Accession No. 203197), and the second chemical
compound is MCH or a homolog or analog of MCH.
This invention also provides a process for making a
composition of matter which is a human MCH1 receptor
antagonist which comprises identifying a chemical compound
which is a human MCH1 receptor antagonist and then
synthesizing the chemical compound or a structural and
functional analog or homolog thereof, wherein the chemical
compound is identified as a human MCH1 receptor antagonist
by a process which comprises contacting cells transfected
with and expressing DNA encoding the human MCH1 receptor
with the compound in the presence of a known human MCH1
receptor agonist, under conditions permitting the
activation of the human MCH1 receptor, and detecting a
decrease in human MCH1 receptor activity, so as to thereby
determine whether the compound is a human MCH1 receptor
antagonist, wherein the cells do not normally express the
human MCH1 receptor, the human MCH1 receptor is encoded by
nucleic acid comprising the sequence shown in Figure 1
(Seq. ID No. 1) or contained in plasmid pEXJ.HR-TZ231
(ATCC Accession No. 203197), and the known human MCH1
receptor agonist is MCH or a homolog or analog of MCH.
This inventions still further provides a process for
making a composition of matter which specifically binds to
and inhibits the activation of a human MCH1 receptor which
comprises identifying a chemical compound which
specifically binds to and inhibits the activation of the
human MCH1 receptor and then synthesizing the chemical
compound or a structural and functional analog or homolog
thereof, wherein the chemical compound is~identified as
binding to and inhibiting the activation of the human MCH1
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-29-
receptor by a process which comprises separately
contacting cells expressing on their cell surface the
human MCH1 receptor and producing a second messenger
response upon activation of the human MCHI receptor,
wherein such cells do not normally express the human MCH1
receptor and the human MCH1 receptor is encoded by nucleic
acid comprising the sequence shown in Figure 1 (Seq. ID
No. 1) or contained in plasmid pEXJ.HR-TZ231 (ATCC
Accession No. 203197), with both the chemical compound and
a second chemical compound known to activate the human
MCH1 receptor, and with only the second chemical compound,
under conditions suitable for activation of the human MCH1
receptor, and measuring the second messenger response in
the presence of only the second chemical compound and in
the presence of both the second chemical compound and the
chemical compound, a smaller change in the second
messenger response in the presence of both the chemical
compound and the second chemical compound than in the
presence of only the second chemical compound indicating
that the chemical compound inhibits activation of the
human MCH1 receptor, wherein tree second chemical compound
is MCH or a homolog or analog of MCH. .
This invention provides a process for preparing a
composition which comprises identifying a chemical
compound which specificall y binds to a human MCH1
receptor, and then admixing a carrier and the chemical
compound or a structural and functional analog or homolog
thereof, wherein the chemical compound is identified as
binding to the human MCH1 receptor by a process involving
competitive binding which comprises contacting cells
expressing on their cell surface the human MCH1 receptor,
with both the chemical compound and a second chemical
compound known to bind to the receptor, and separately
with only the second chemical compound, under conditions
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-30-
suitable for binding of both compounds, and detecting the
e:>tent of specific binding of the chemical compound to the
human MCHl receptor, a decrease in the binding of the
second chemical compound to the human MCHl receptor in the
presence of the chemical compound indicating that the
chemical compound binds to the human MCH1 receptor,
wherein the cells do not normally express the human MCHl
receptor, the human MCH1 receptor is encoded by nucleic
acid comprising the sequence shown in Figure 1 (Seq. ID
No. 1) or contained in plasmid pEXJ.HR-TL231 (ATCC
Accession No. 203197), and the second chemical compound is
MCH or a homolog or analog of MCH.
This invention further provides a process for preparing a
composition which comprises identifying a chemical
compound which specifically binds to a human MCHl
receptor, and then admixing a carrier and the chemical
compound or a structural and functional analog or homolog
thereof, wherein the chemical compound is identified as
binding to the human MCH1 receptor by a process involving
competitive binding which comprises contacting a membrane
preparation from cells expressing on their cell surface
the human MCH1 receptor, with both the chemical compound
and a second chemical compound known to bind to the
receptor, and separately with only the second chemical
compound, under conditions suitable for binding of both
compounds, and detecting the extent of specific binding of
the chemical compound to the human MCH1 receptor, a
decrease in the binding of the second chemical compound to
the human MCH1 receptor in the presence of the chemical
compound indicating that the chemical compound binds to
the human MCH1 receptor, wherein the cells do not normally
express the human MCH1 receptor, the human MCH1 receptor
is encoded by nucleic acid comprising the sequence shown
in Figure 1 (Seq. ID No. 1) or contained in plasmid
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-31-
pEXJ.HR-TL231 (ATCC Accession No. 203197), and the second
chemical compound is MCH br a homolog or analog of MCH.
This invention also provides a process for preparing a
composition which comprises identifying a chemical
compound which is a human MCH1 receptor antagonist, and
then admixing a carrier and the chemical compound or a
structural and functional analog or homolog thereof,
wherein the chemical compound is identified as a human
MCH1 receptor antagonist by a process which comprises
contacting cells transfected with and expressing DNA
encoding the human MCH1 receptor with the compound in the
presence of a known human MCHl receptor agonist, under
conditions permitting the activation of the human MCH1
receptor, and detecting a~decrease in human MCH1 receptor
activity, so as to thereby determine whether the compound
is a human MCH1 receptor antagonist, wherein the cells do
not normally express the human MCH1 receptor, the human
MCH1 receptor is encoded by nucleic acid comprising the
sequence shown in Figure 1 (Seq. ID No. 1) or contained in
plasmid pEXJ.HR-TL231 (ATCC Accession No. 203197), and the
known human MCH1 receptor agonist is MCH or a homolog or
analog of MCH.
This invention still further provides a process for
preparing a composition which comprises identifying a
chemical compound which specifically binds to and inhibits
the activation of a human MCH1 receptor, and then admixing
a carrier and the chemical compound or a structural and
functional analog or homolog thereof, wherein the chemical
compound is identified as binding to and inhibiting
activation of the human MCH1 receptor by a process which
comprises separately contacting cells expressing on their
cell surface the human MCH1 receptor and producing a
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-32-
second messenger response upon activation of the human
MCHl receptor, wherein such cells do not normally express
the human MCH1 receptor and the human MCHl receptor is
encoded by nucleic acid comprising the sequence shown in
Figure 1 (Seq. ID No. 1) or contained in plasmid pEXJ.HR-
TL231 (ATCC Accession No.~203197), with both the chemical
compound and a second chemical compound known to activate
the human MCH1 receptor, and with only the second chemical
compound, under conditions suitable for activation of the
human MCH1 receptor, and measuring the second messenger
response in the presence of only the second chemical
compound and in the presence of both the second chemical
compound and the chemical compound, a smaller change in
the second messenger response in the presence of both the
chemical compound and the second chemical compound than in
the presence of only the second chemical compound
indicating that the chemical compound inhibits activation
of the human MCH1 receptor, wherein the second chemical
compound is MCH or a homolog or analog of MCH.
This invention provides a method of treating an eating
disorder or obesity in a subject which comprises
administering to the subject a therapeutically effective
amount of an MCHl antagonist which inhibits the activation
of the MCH1 receptor.
This invention provides a method of reducing the body mass
of a subject which comprises administering to the subject
an amount of an MCH1 antagonist effective to reduce the
body mass of the subject.
This invention further provides a method of treating an
eating disorder in a subject which comprises administering
to the subject a therapeutically effective amount of an
MCH1 agonist which activates the MCH1 receptor.
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-33-
This invention also provides a method of treating
depression and/or anxiety in a subject which comprises
administering to the subject a composition comprising a
pharmaceutically acceptable carrier and a therapeutically
effective amount of a MCH1 receptor antagonist, wherein:
(a) (1) the MCH1 receptor antagonist does not inhibit
the activity of central monoamine oxidase A greater
than 50 percent, at a concentration of lOmM; and
(2) the MCH1 receptor antagonist does not inhibit
the activity of central monoamine oxidase B greater
than 50 percent, at a concentration of lOmM; and
(b) the MCH1 receptor antagonist binds to the human MCH1
receptor with a binding affinity at least ten-fold
higher than the binding affinity with which it
binds to each of the following transporters:
serotonin transporter, norepinephrine transporter,
and dopamine transporter.
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-34-
BRIEF DESCRIPTION OF THE FIGURES
Figure 1
Nucleotide sequence encoding a human MCH1 receptor (MCH1)
(SEQ ID N0: 1). Three potential start (ATG) codons and the
stop (TGA) codon are underlined.
Figure 2
Deduced amino acid sequence (SEQ TD NO: 2) of the human
MCH1 receptor (MCHl) encoded by the nucleotide sequence
shown Figure 1 (SEA ID NO: 1).
Figure 3
Deduced amino acid sequence for human MCH1 (SEQ ID NO: 2).
The seven putative transmembrane (TM) regions are
underlined.
Figure 4
Nucleotide sequence of rat MCH1 (SEQ ID NO: 3). One start
(ATG) codon and the stop codon (TGA) are underlined.
Figure 5
Deduced amino acid sequence for rat MCHI (SEQ ID NO: 4).
Figure 6
MCHl-mediated PI dose response to MCH.
Figure 7
MCH1 challenge with several compounds of interest.
FicLure 8
MCH1-mediated extracellular acidification response to MCH
and Phel~,TyrlS-MCH. Results are reported as the average of
two independent experiments performed in duplicate.
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-35-
Figure 9
Transcriptional response of MCH1-transfected Cos-7 cells
to MCH.
Figure 10
Binding of [1='I] Phe1', Tyrl='-MCH on MCH1-transfected Cos-7
cell membranes. Results are means ~ S.E.M. (vertical
lines) of triplicate determinations.
Figure 11
RT-PCR detection of MCH1 receptor mRNA in human mRNA
samples.
Figure 12
Amino acid alignment of the N-terminal regions of MCH1
receptors encoded by various plasmids. The mutations
present in 8106 (SEQ ID NO: 16) and 8114 (SEQ ID NO: 1?)
are shown in lower case. Potential initiating methionines
are shown in bold. The amino acid sequence downstream of
position 100 is identical for all four plasmids.
Figure 13
Amino acid sequence (SEQ ID N0: 26) of the mutant human
MCH1 receptor encoded by plasmid 8106.
Figure 14
Amino acid sequence (SEQ ID N0: 27) of the mutant human
MCH1 receptor encoded by plasmid 8114.
Figure 15
Amino acid sequence (SEQ ID N0: 28) of the mutant human
MCH1, receptor encoded by plasmid B0120.
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-36-
Figure 16
Antagonism by Compound 10 shown by the phosphoinositide
response induced by MCH in Cos-7 cells transfected with
MCH1 . Inset : Schild plot, y axis = ( (ECSOMCx+Cmpdl0~EC50MCH) -
1); x axis - Log (CmpdlO)[M]. The analysis by linear
regression analysis estimated a pA2 (x-intercept) - 9.24,
slope = 0.97 ~ 0.2 and r'= 0.94.
Figure 17
Saturation equilibrium binding of [3H]Compound 10 to the
human MCH1 receptor. Membrane preparations from Cos-7
cells transfected with MCH1 were incubated with varying
concentrations of [3H]Compound 10 (SA: 56 Ci/mmol) at room
temperature for 90 min, in a volume of 0.250 ml. The
reaction was terminated by filtration in GF/C filters, and
the radioactivity determined by scintillation counting.
Non-specific binding was defined as the amount of
radioactivity retained in the filter after incubating the
reaction mixture in the presence of unlabeled Compound 10
(10 mM) .
Figure 18
Competition binding of [3H]Compound 10 to the human MCH1
receptor. Membrane preparations from Cos-7 cells
transfected with MCH1 were incubated with 0.4 nM
[3H]Compound in the presence of varying concentrations of
MCH (from 1E-11 to 1E-6 M) or unlabeled Compound 10 (from
1E-10 to 1E-5 M), for 90 min at room temperature. The
reaction was terminated by filtration in GF/C filters and
the radioactivity bound to the membrane was determined by
scintillation counting.
Figure 19
Autoradiographic localization of MCH1 receptor binding
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-37-
sites in the rat diencephalon. A. Total MCHl receptor
binding obtained with 0.1 nM [3H]Compound 10 in the
presence of 1 ,uM prazosin and 100 ~M dopamine. B.
Nonspecific binding observed in the presence of l ,uM cold
Compound 10.
Figures 20A and 20B
Autoradiographic distribution of MCH1 binding sites using
[ H]Compound 10 in the presence of 1 ,uM prazosin and 100 ,uM
dopamine in the rat CNS presented rostrocaudally. Coronal
rat brain sections at the level of the frontal cortex (A),
the forebrain/basal ganglia (B), the basal ganglia (C),
the diencephalon (D-H), the midbrain (I-J), the brain stem
(K-L), and transverse through the lumbar spinal cord (M).
Note the dense labeling of several brain regions such as
the caudate-putamen (CPu) and accumbens nucleus (AobSh and
AcbC) (B). Moderate labeling was observed in the
hippocampus (E-H), subthalamic nucleus (F) and locus
coeruleus (L) while weaker labeling is seen in the
thalamus and hypothalamus~(D-H).
List of Abbreviations
AAV anterior amygdaloid area, ventral
AcbC accumbens nucleus, core
AcbSh accumbens nucleus, core
ACo anterior cortical amygdaloid nucleus
AD anterodorsal thalamic nucleus
AH anterior hypothalamus
AI agranular insular cortex
Arc arcuate hypothalamic nucleus
AON anterior olfactory nucleus
AU auditory cortex
AV anteroventral hypothalamic nucleus
BLA basolateral amygdaloid nucleus
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-38-
BSTM bed nucleus of the stria terminalis, medial
div.
CA1,2,3 fields CA1, 2, 3 of hippocampus
Cg oingulate cortex
CL claustrum
CPu caudate-putamen
DLG dorsal lateral geniculate
DM dorsomedial hypothalamic nucleus
DR dorsal raphe nucleus
DTN dorsal tegmental nucleus
Ent entorhinal cortex
GP globus pallidus
IAM interanteromedial thalamic nucleus
IC inferior colliculus
ICjM islands of Calleja, major island
IG indusium griseum
La lateral amygdaloid nucleus
LC locus coeruleus
LD laterodorsal thalamic nucleus
LH lateral hypothalamic area
LO lateral preoptic area
LSD lateral septal nucleus, dorsal part
LSO lateral superior olive
M1 primary motor cortex
Me medial amygdaloid nucleus
MG medial geniculate nucleus
MHb medial habenular nucleus
MM medial mammillary nucleus
MPO medial preoptic area
OC occipital cortex
PAG periaqueductal gray
PB parabrachial nucleus
PF parafascicular thalamic nucleus
PH posterior hypothalamic area
Pir piriform cortex
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-39-
PMCo posteromedial amygdaloid nucleus
Pn pontine nuclei
Po posterior thalamic nuclear group
PVA paraventricular thalamic nucleus
PVP paraventricular thalamic nucleus, posterior
RSG retrosplenial granular cortex
SC superior colliculus
SNR substantia nigra, reticular part
STh subthalamic nucleus
S1 primary somatosensory cortex
so stratum oriens field CA1
sr stratum radiatum field CA1
Tu olfactory tubercle
V2 secondary visual cortex
VL ventrolateral thalamic nucleus
VMH ventromedial hypothalamic nucleus
VP ventroposterior thalamic nucleus
Figrure 21
Effect of Compound 10 on MCH-induced stimulatior_ of food
intake in rats. MCH (3 nmol) or vehicle was administered
into the third venticle, and food intake measured 30, 60
and 120 minutes later. Some rats were pretreated with
vehicle or Compound 10 (1 or 10 mg/kg) i.p. 20 minutes
prior to i.c.v. injection.
* Significantly greater than vehicle, + significantly less
than vehicle /MCH.
Fa.g-ure 22
Effect of Compound 10 on body weight gain in young growing
rats. Compound 10 (10 mg/kg/day), fenfluramine (6
mg/kg/day) or vehicle were administered to rats for 14
days via subcutaneously implanted osmotic minipumps.
Significant differences from vehicle are denoted by
**P<0.001, *P<0.01, xP<0.05, as determined by ANOVA and
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-40-
Newman-Keuls test.
Ficxure 23
Effect of Compound 10 on body weight gain in young growing
rats. Compound 10 (l, 3 or 10 mg/kg) or vehicle (dashed
line) was administered to rats twice daily by i.p.
injection. Significant differences from vehicle are
denoted by **P<0.001, *P<0.01, as determined.by ANOVA and
Newman-Keuls test.
Fi,~ure 24
Effect of Compound 94 on body weight gain in young growing
rats. Compound 94 (3, 10 or 30 mg/kg) or vehicle was
administered to rats twice daily by i.p. injection.
Significant differences from vehicle are denoted by
+P<0.05, *P<0.01, as determined by ANOVA and Newman-Keuls
test.
Figure 25
Effect of Compound 95 on body weight gain in young growing
rats. Compound 67173 (3, 10 or 30 mg/kg) or vehicle was
administered to rats twice daily by i.p. injection.
Significant differences from vehicle are denoted by
*P<0.001, as determined by ANOVA and Newman-Keuls test.
Ficrure 2 6
Effect of Compound 10 on sweetened condensed milk
consumption in rats. Rats were trained to drink sweetened
condensed milk for 20 minutes a day. On the t~-ast day,
Compound 10 (3, 10 or 30 mg/kg), fenfluramine (3 mg/kg) or
vehicle was administered i.p. 30 minutes prior to milk
exposure. Significant differences from vehicle are denoted
by *P<0.05, **P<0.001 as determined by two-tailed t-test.
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-41-
DETAILED DESCRIPTION OF THE INVENTION
Throughout this application, the following standard
abbreviations are used to indicate specific nucleotide
bases:
A = adenine
G = guanine
C = cytosine
T = thymine
U = uracil
M = adenine r cytosine
o
R = adenine r guanine
o
W = adenine, thymine, r uracil
o
S = cytosine or guanine
Y = cytosine, thymine, or uracil
K = guanine, thymine, r uracil
o
V = adenine, cytosine, or guanine(not thymine
or uracil
H = adenine, cytosine, thymine, or uracil (not
guanine)
D = adenine, guanine, thymine, or uracil (not
cytosine)
B = cytosine, guanine, thymine, or uracil (not
adenine)
N = adenine, cytosine, guanine,
thymine,
or uracil
(or other modified base such as inosine)
I - inosine
Furthermore, the term "agonist" is used throughout this
application to indicate any peptide or non-peptidyl
compound which increases the activity of any of the
polypeptides of the subject invention. The term
"antagonist" is used throughout this application to
indicate any peptide or non-peptidyl compound which
decreases the activity of any of the polypeptides of the
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-42-
subject invention. The term "mammalian" is used
throughout this invention to include mutant forms of the
human MCH1 receptor.
The activity of a G-protein coupled receptor such as the
polypeptides disclosed herein may be measured using any of
a variety of functional assays in which activation of the
receptor in question results in an observable change in
the level of some second messenger system, including, but
not limited to, adenylate cyclase, calcium mobilization,
arachidonic acid release, ion channel activity, inositol
phospholipid hydrolysis or guanylyl cyclase. Heterologous
expression systems utilizing appropriate host cells to
express the nucleic acid of the subject invention are used
to obtain the desired second messenger coupling. Receptor
activity may also be assayed in an oocyte expression
system.
In the case that a receptor has activity in the absence of
an agonist (constitutive receptor activity) the antagonist
may act as an inverse agonist or an allosteric modulator,
as opposed to a neutral antagonist, and suppress receptor
signaling independent of the agonist (Lutz and Kenakin,
1999). The categories of "antagonist compounds" are
therefore seen to include 1) neutral antagonists (which
block agonist actions but do not affect constitutive
activity); 2) inverse agonists (which block agonist
actions as well as constitutive activity by stabilizing an
inactive receptor conformation); 3) and allosteric
modulators (which block agonist actions to a limited
extent and which may also block constitutive activity
through allosteric regulation). The probability that an
antagonist is neutral and therefore of "zero efficacy" is
relatively low, given that this would require identical
affinities for different tertiary conformations of the
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-43-
receptor. Thus, Kenakin proposed in 1996 that, "with the
development of sensitive test systems for the detection of
inverse agonism will come a reclassification of many
drugs.... it might be observed that numerous previously
classified neutral antagonists may be inverse agonists"
(Kenakin, 1996). Indeed, there is now evidence from
studies with known pharmacological agents to support the
existence of inverse agonists for numerous receptors,
including histamine, 5HT1~, 5HT~~., cannabinoid, dopamine,
calcitonin and human formyl peptide receptors, among
others (de Ligt, et al, 2000; Herrick-Davis, et al, 2000;
Bakker, et al, 2000). In the case of the 5HT.,~ receptor,
clinically effective atypical antipsychotics drugs such as
sertindole, clozapine, olanzapine, ziprasidone,
risperidone, zotepine, tiospirone, fluperlapine and
tenilapine displayed potent inverse activity whereas
typical antipsychotic drugs such as chlorpromazine,
thioridazine, spiperone and thiothixene were classified as
neutral antagonists (Herrick-Davis et al, 2000). In the
case of the histamine Hlreceptor, the therapeutically used
anti-allergics cetirizine, loratadine and epinastine were
found to be inverse agonists. These findings further
extend the idea that many compounds previously thought of
as neutral antagonists will be reclassified as inverse
agonists when tested in a constitutively active receptor
system (de Ligt et al, 2000).
It is possible that the human MCH1 receptor gene contains
introns and furthermore, the possibility exists that
additional introns could exist in coding or non-coding
regions. In addition, spliced forms) of mRNA may encode
additional amino acids either upstream of the currently
defined starting methionine or within the coding region.
Further, the existence and use of alternative exons is
possible, whereby the mRNA may encode different amino
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-44-
acids within the region comprising the exon. In addition,
single amino acid substitutions may arise via the
mechanism of RNA editing such that the amino acid sequence
of the expressed protein is different than that encoded by
the original gene. (Burns et al., 1996; Chu et al., 1996).
Such variants may exhibit pharmacologic properties
differing from the polypeptide encoded by the original
gene.
This invention provides splice variants of the human MCH1
receptor disclosed herein. This invention further provides
for alternate translation initiation sites and alternately
spliced or edited variants of nucleic acids encoding the
human MCH1 receptor of this invention.
The nucleic acid of the subject invention also includes
nucleic acid analogs of the human MCH1 receptor gene,
wherein the human MCH1 receptor gene comprises the nucleic
acid sequence shown in Fig. 1 or contained in plasmid
pEXJ.HR-TL231 (ATCC Accession No. 203197). Nucleic acid
analogs of the human MCH1 receptor genes differ from the
human MCH1 receptor gene described herein in terms of the
identity or location of one or more nucleic acid bases
(deletion analogs containing less than all of the nucleic
acid bases shown in Fig. 1 or contained in plasmid
pEXJ.HR-Th231, substitution analogs wherein one or more
nucleic acid bases shown in Fig. 1 or contained in
plasmids pEXJ.HR-TL231 are replaced by other nucleic acid
bases, and addition analogs, wherein one or more nucleic
acid bases are added to a terminal or medial portion of
the nucleic acid sequence) and which encode proteins which
share some or all of the properties of the proteins
encoded by the nucleic acid sequences shown in Fig. 1 or
contained in plasmid pEXJ.HR-TL231. In one embodiment of
the present invention, the nucleic acid analog encodes a
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-45-
protein which comprises an amino acid sequence as shown in
Fig. 2 or encoded by the nucleic acid sequence contained
in plasmid pEXJ.HR-TL231. In another embodiment, the
nucleic acid analog encodes a protein comprising an amino
acid sequence which differs from the amino acid sequences
shown in Fig. 2 or encoded by the nucleic acid contained
in plasmids pEXJ.HR-TL231. In a further embodiment, the
protein encoded by the nucleic acid analog has a function
which is the same as the function of the receptor protein
comprising the amino acid sequence shown in Fig. 2. In
another embodiment, the function of the protein encoded by
the nucleic acid analog differs from the function of the
receptor protein comprising the amino acid sequence shown
in Fig. 2. In another embodiment, the variation in the
nucleic acid sequence occurs within the transmembrane (TM)
region of the protein. In a further embodiment, the
variation in the nucleic acid sequence occurs outside of
the TM region. .
This invention provides the above-described isolated
nucleic acid, wherein the nucleic acid is DNA. In an
embodiment, the DNA is cDNA. In another embodiment, the
DNA is genomic DNA. In still another embodiment; the
nucleic acid is RNA. Methods for production and
manipulation of nucleic acid molecules are well known in
the art.
This invention further provides nucleic acid which is
degenerate with respect to the DNA encoding the
polypeptides described herein. In an embodiment, the
nucleic acid comprises a nucleotide sequence which is
degenerate with respect to the nucleotides sequence shown
in Figure 1 (SEQ ID N0: 2) or the nucleotide sequence
contained in the plasmid pEXJ.HR-TL231, that is, a
nucleotide sequence which is translated into the same
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-46-
amino acid sequence.
This invention also encompasses DNAs and cDNAs which
encode amino acid sequences which differ from those of the
polypeptides of this invention, but which should not
produce phenotypic changes. Alternately, this invention
also encompasses DNAs, cDNAs, and RNAs which hybridise to
the DNA, cDNA, and RNA of the subject invention.
Hybridization methods are well known to those of skill in
the art.
The nucleic acids of the subject invention also include
nucleic acid molecules coding far polypeptide analogs,
fragments or derivatives of antigenic polypeptides which
differ from naturally-occurring forms in terms of the
identity or location of one or more amino acid residues
(deletion analogs containing less than all of the residues
specified for the protein, substitution analogs wherein
one or more residues specified are replaced by other
residues and addition analogs wherein one or more amino
acid residues is added to a terminal or medial portion of
the polypeptides) and which share some or all properties
of naturally-occurring forms. These molecules include: the
incorporation of codons "preferred" for expression by
selected non-mammalian hosts; the provision of sites for
cleavage by restriction endonuclease enzymes; and the
provision of additional initial, terminal or intermediate
DNA sequences that facilitate construction of readily
expressed vectors. The creation of polypeptide analogs is
well known to those of skill in the art (R.F. Spurney et
al. (1997); Fong, T.M. et al. (1995); Underwood, D.J. et
al. (1994); Graziano, M.P. et al. (1996); Guan X.M. et al.
(1995)).
The modified polypeptides of this invention may be
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-47-
transfected into cells either transiently or stably using
methods well-known in the art, examples of which are
disclosed herein. This invention also provides for
binding assays using the modified polypeptides, in which
the polypeptide is expressed either transiently or in
stable cell lines. This invention further provides a
compound identified using a modified polypeptide in a
binding assay such as the binding assays described herein.
The nucleic acids described and claimed herein are useful
for the information which they provide concerning the
amino acid sequence of the polypeptide and as products for
the large scale synthesis of the polypeptides by a variety
of recombinant techniques. The nucleic acid molecule is
useful for generating new cloning and expression vectors,
transformed and transfected prokaryotic and eukaryotic
host cells, and new and useful methods for cultured growth
of such host cells capable of expression of the
polypeptide and related products.
This invention provides an isolated nucleic acid encoding
a human MCH1 receptor or a mutant of such human MCHl
receptor which is activated by MCH or an analog or homolog
thereof, In one embodiment, the nucleic acid is DNA. In
another embodiment, the DNA is cDNA. In another
embodiment, the DNA is genomic DNA. In another
embodiment, the nucleic acid is RNA,
This invention also provides methods of using an isolated
nucleic acid encoding species homologs of the MCH1
receptor encoded by the nucleic acid sequence shown in
Fig. 1 (SEQ ID N0: 1) or encoded by the plasmid pEXJ.HR-
Tv231. In one embodiment, the nucleic acid encodes a
mammalian MCHl receptor homolog which has substantially
the same amino acid sequence as does the MCH1 receptor
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-48-
encoded by the plasmid pEXJ.HR-TL231. In another
embodiment, the nucleic acid encodes a mammalian MCH1
receptor homolog which has above ~5o amino acid identity
to the MCH1 receptor encoded by the plasmid pEXJ.HR-TL231;
preferably above 75o amino acid identity to the MCHl
receptor encoded by the plasmid pEXJ,HR-TL231; more
preferably above 85o amino acid identity to the MCH1
receptor encoded by the plasmid pEXJ.HR-TL231; most
preferably above 95o amino acid identity to the MCH1
receptor encoded by the plasmid pEXJ.HR-TL231. In another
embodiment, the mammalian MCH1 receptor homolog has above
70% nucleic acid identity to the MCH1 receptor gene
contained in plasmid pEXJ.HR-TL231; preferably above 800
nucleic acid identity to the MCH1 receptor gene contained
in the plasmid pEXJ.HR-TL231; more preferably above 900
nucleic acid identity to the MCH1 receptor gene contained
in the plasmid pEXJ.HR-TL231. Examples of methods for
isolating and purifying species homologs are described
elsewhere (e. g., U.S. Patent No. 5,602,024, W094/14957,
W097/26853, W098/15570).
In a separate embodiment of the present invention, the
nucleic acid encodes a MCH1 receptor which has an amino
acid sequence identical to that encoded by the plasmid
pEXJ.HR-TL231. In a further embodiment, the MCH1 receptor
comprises a sequence substantially the same as the amino
acid sequence shown in Figure 2 (SEQ ID N0: 2). In another
embodiment, the MCH1 receptor comprises an amino acid
sequence as shown in Figure 2 (SEQ ID NO: 2).
In one embodiment, the mutant human MCH1 receptor
comprises an amino acid sequence as shown in Figure 13
(SEQ TD NO: 26). In another embodiment, the mutant human
MCH1 receptor comprises an amino acid sequence as shown in
Figure 14 (SEQ ID N0: 27). In still another embodiment,
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-4 9-
the mutant human MCHl receptor comprises an amino acid
sequence as shown in Figure 15 (SEQ ID NO: 28).
In separate embodiments, the human MCH1 receptor is
encoded by the nucleic acid sequence shown in Figure 1
beginning with any of the three indicated start (ATG)
codons.
This invention provides an isolated nucleic acid encoding
l0 a modified human MCH1 receptor, which differs from a human
MCH1 receptor by having an amino acids) deletion,
replacement, or addition in the third intracellular
domain.
This invention provides a nucleic acid encoding a human
MCH1 receptor, wherein the nucleic acid (a) hybridizes to
a nucleic acid having the defined sequence shown in Figure
1 (SEQ ID NO: 1) under low stringency conditions or a
sequence complementary thereto and (b) is further
characterized by its ability to cause a change in the pH
of a culture of CHO cells when a MCHl ligand is added to
the culture and the CHO cells contain the nucleic acid
which hybridized to the nucleic acid having the defined
sequence or its complement. Hybridization at low
stringency is performed at 40"C in a hybridization buffer
containing 25o formamide, 5X SCC, 7mM Tris, 1X Denhardt's,
25u1/ml salmon sperm DNA. Wash at 40°C in 0.1X SCC, 0.10
SDS. Changes in pH are measured through microphysiometric
measurement of receptor mediated extracellular
acidification rates. Because cellular metabolism is
intricately involved in a broad range of cellular events
(including receptor activation of multiple messenger
pathways), the use of microphysiometric measurements of
cell metabolism can in principle provide a generic assay
of cellular activity arising from the activation of any
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-50-
receptor regardless of the specifics of the receptor's
signaling pathway. General guidelines for transient
receptor expression, cell preparation and
microphysiometric recording are described elsewhere
(Salon, J.A. and Owicki, J.A., 1996). Receptors and/or
control vectors are transiently expressed in CHO-Kl cells,
by liposome mediated transfection according to the
manufacturers recommendations (LipofectAMINE, GibcoBRL,
Gaithersburg, MD), and maintained in Ham's F-12 complete
(10o serum). A total of 10~g of DNA is used to transfect
each 75cm= flask which had been split 24 hours prior to the
transfection and judged to be 70-80o confluent at the time
of transfection. 24 hours post transfection, the cells
are harvested and 3 x 10=' cells seeded into
microphysiometer capsules. Cells are allowed to attach to
the capsule membrane for an additional 24 hours; during
the last 16 hours, the cells are switched to serum-free F-
12 complete to minimize ill-defined metabolic stimulation
caused by assorted serum factors. On the day of the
experiment the cell capsules are transferred to the
microphysiometer and allowed to equilibrate in recording
media (low buffer RPMI 1640, no bicarbonate, no serum
(Molecular Devices Corporation, Sunnyvale, CA) containing
0.1o fatty acid free BSA), during which a baseline
measurement of basal metabolic activity is established.
A standard recording protocol specifies a 100u1/min flow
rate, with a 2 min total pump cycle which includes a 30
sec flow interruption during which the acidification rate
measurement is taken. Ligand challenges involve a 1 min
20 sec exposure to the sample just prior to the first post
challenge rate measurement being taken, followed by two
additional pump cycles for a total of 5 min 20 sec sample
exposure. Typically, drugs in a primary screen are
presented to the cells at lOUM final concentration.
Ligand samples are then washed out and the acidification
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-51-
rates reported are expressed as a percentage increase of
the peak response over the baseline rate observed just
prior to challenge. An examples of a MCH ligand includes,
but is not limited to, the endogenous MCH peptide.
This invention provides a purified human MCH1 receptor
protein.
This invention provides a vector comprising nucleic acid
encoding a human MCHl receptor. In an embodiment, the
vector is adapted for expression in a cell which comprises
the regulatory elements necessary for expression of the
nucleic acid in the cell operatively linked to the nucleic
acid encoding the human MCH1 receptor as to permit
expression thereof. In separate embodiments, the cell is
a bacterial cell, an amphibian cell, a yeast cell, an
insect cell or a mammalian cell. In another embodiment,
the vector is a baculovirus. In one embodiment, the
vector is a plasmid.
This invention provides a plasmid designated pEXJ.HR-TL231
(ATCC Accession No. 203197). This plasmid comprises the
regulatory elements necessary for expression of DNA in a
mammalian cell operatively linked to DNA encoding the
human MCH1 receptor so as to permit expression thereof.
This plasmid (pEXJ.HR-TL231) was deposited on September
17, 1998, with the American Type Culture Collection
(ATCC), 12301 Parklawn Drive, Rockville, Maryland 20852,
U.S.A. under the provisions of the Budapest Treaty for the
International Recognition of the Deposit of Microorganisms
for the Purposes of Patent Procedure and was accordec'. ATCC
Accession No. 203197.
This invention further provides for any vector or plasmid
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-52-
which comprises modified untranslated sequences, which are
beneficial for expression in desired host cells or for use
in binding or functional assays. For example, a vector or
plasmid with untranslated sequences of varying lengths may
express differing amounts of the polypeptide depending
upon the host cell used. In an embodiment, the vector or
plasmid comprises the coding sequence of the polypeptide
and the regulatory elements necessary for expression in
the host cell.
This invention provides a cell comprising a vector
comprising a nucleic acid encoding the human MCHl
receptor. In an embodiment, the cell is a non-mammalian
cell. In a further embodiment, the non-mammalian cell is
a Xenopus oocyte cell or a Xenopus melanophore cell. In
another embodiment, the cell is a mammalian cell. In a
further embodiment, the mammalian cell is a COS-7 cell, a
293 human embryonic kidney cell, a NIH-3T3 cell, a LM(tk-)
cell, a mouse Y1 cell, or a CHO cell.
This invention provides an insect cell comprising a vector
adapted for expression in an insect cell which comprises
a nucleic acid encoding a human MCHl receptor. In another
embodiment, the insect cell is an Sf9 cell, an Sf21 cell
or a Trichoplusia ni 5B1-4 (HighFive) cell.
This invention provides a membrane preparation isolated
from any one of the cells described above.
This invention provides a nucleic acid probe comprising at
least 15 nucleotides, which probe specifically hybridizes
with a nucleic acid encoding a human MCH1 receptor,
wherein the probe has a unique sequence corresponding to
a sequence present within one of the two strands of the
nucleic acid encoding a human MCH1 receptor present in
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-53-
plasmid pEXJ.HR-TL231. This invention also provides a
nucleic acid probe comprising at least 15 nucleotides,
which probe specifically hybridizes with a nucleic acid
encoding a human MCH1 receptor, wherein the probe has a
unique sequence corresponding to a sequence present within
( a ) the nucleic acid sequence shown in Figure 1 ( SEQ I D
N0: 1) or (b) the reverse complement thereto. In one
embodiment, the nucleic acid is DNA. In another
embodiment, the nucleic acid is RNA.
As used herein, the phrase "specifically hybridizing"
means the ability of a nucleic acid molecule to recognize
a nucleic acid sequence complementary to its own and to
form double-helicalsegments through hydrogen bonding
between complementary base pairs.
Nucleic acid probe technology is well known to those
skilled in the art who will readily appreciate that such
probes may vary greatly in length and may be labeled with
a detectable label, such as a radioisotope or flourescent
dye, to facilitate detection of the probe. DNA probe
molecules may be produced by insertion of a DNA molecule
which encodes the polypeptides of this invention into
suitable vectors, such as plasmids or bacteriophages,
followed by transforming into suitable bacterial host
cells, replication in the transformed bacterial host cells
and harvesting of the DNA probes, using methods well known
in the art. Alternatively, probes may be generated
chemically from DNA synthesizers.
RNA probes may be generated by inserting the DNA molecule
which encodes the polypeptides of this invention
downstream of a bacteriophage promoter such as T3, T7, or
SP6. Large amounts of RNA probe may be produced by
incubating the labeled nucleotides with the linearized
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-54-
fragment where it contains an upstream promoter in the
presence of the appropriate RNA polymerise.
This invention provides an antisense oligonucleotide
having a sequence capable of specifically hybridizing to
RNA encoding a human MCHI receptor, so as to prevent
translation of the RNA. This invention also provides an
antisense oligonucleotide having a sequence capable of
specifically hybridizing to genomic DNA encoding a human
MCHl receptor. In one embodiment, the oligonucleotide
comprises chemically modified nucleotides or nucleotide
analogues.
This invention provides an antibody capable of binding to
a human MCHl receptor encoded by a nucleic acid encoding
a human MCH1 receptor. This invention also provides an
agent capable of competitively inhibiting the binding of
the antibody to a human MCHI receptor. In one embodiment,
the antibody is a monoclonal antibody or antisera.
2O
This invention provides a pharmaceutical composition
comprising (a) an amount of the oligonucleotide capable of
passing through a cell membrane and effective to reduce
expression of a human MCH1 receptor and (b) a
pharmaceutically acceptable carrier capable of passing
through the cell membrane. In an embodiment, the
oligonucleotide is coupled to a substance which
inactivates mRNA. In a further embodiment, the substance
which inactivates mRNA is a ribozyme. In another
embodiment, the pharmaceutically acceptable carrier
comprises a structure which binds to a human MCH1 receptor
on a cell capable of being taken up by the cells after
binding to the structure. In a further embodiment, the
pharmaceutically acceptable carrier is capable of binding
to a human MCH1 receptor which is specific for a selected
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-55-
cell type.
This invention provides a pharmaceutical composition which
comprises an amount of an antibody effective to block
binding of a ligand to a human MCH1 receptor and a
pharmaceutically acceptable carrier.
As used herein, the phrase "pharmaceutically acceptable
carrier" means any of the standard pharmaceutically
acceptable carriers and is any pharmaceutical carrier
known to those of ordinary skill in the art as useful in
formulating pharmaceutical compositions. Examples include,
but are not limited to, phosphate buffered saline,
physiological saline, water, and emulsions, such as
oil/water emulsions.
On December 24, 1997 the Food and Drug Administration of
the United States Department of Health and Human Services
published a guidance entitled "Q3C Impurities: Residual
Solvent". The guidance recommends acceptable amounts of
residual solvents in pharmaceuticals for the safety of the
patient, and recommends the use of less toxic solvents in
the manufacture of drug substances and dosage forms. Table
1 of the guidance lists "Class 1 Solvents". The guidance
then states that the use of Class 1 Solvents should be
avoided in the production of drug substances, excipients,
or drug products unless their use can be strongly
justified in a risk-benefit assessment. The guidance
further states that Class 2 Solvents should be limited in
order to protect patients from potentially adverse
effects. The guidance characterized the following
solvents as Class 1 Solvents: benzene, carbon
tetrachloride, 1,2-dichloroethane, 1,1-dichloroethene, and
1,1,1-trichloroethane. The guidance characterized the
following solvents as Class 2 Solvents: acetonitrile,
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-56-
chlorobenzene, chloroform, cyclohexane, 1,2-
dichloroethene, dichloromethane, 1,2-dimethoxyethane, N,N-
dimethylacetamide, N,N-dimethylformamide, 1,4-dioxane, 2-
ethoxyethanol, ethyleneglycol, formamide, hexane,
methanol, 2-methoxyethanol, methylbutyl ketone,
methylcyclohexane, N-methylpyrrolidone, nitromethane,
pyridine, sulfolane, tetralin, toluene, 1,1,2
trichloroethene and xylene. As used in this invention the
term "pharmaceutically acceptable carrier" shall not
include Class 1 or Class 2 Solvents.
In an embodiment of the present invention, the
pharmaceutical carrier may be a liquid and the
pharmaceutical composition would be in the form of a
solution. In another embodiment, the pharmaceutically
acceptable carrier is a solid and the composition is in
the form of a powder or tablet. In a further embodiment,
the pharmaceutical carrier is a gel and the composition is
in the form of a suppository or cream. In a further
embodiment the compound may be formulated as a part of a
pharmaceutically acceptable transdermal patch. In yet a
further embodiment, the compound may be delivered to the
subject by means of a spray or inhalant.
A solid carrier can include one or more substances which
may also act as endogenous carriers (e.g. nutrient or
micronutrient carriers), flavoring agents, lubricants,
solubilizers, suspending agents, fillers, glidants,
compression aids, binders or tablet-disintegrating agents;
it can also be an encapsulating material. In powders, the
carrier is a finely divided solid which is in admixture
with the finely divided active ingredient. In tablets,
the active ingredient is mixed with a carrier having the
necessary compression properties in suitable proportions
and compacted in the shape and size desired. The powders
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-57-
and tablets preferably contain up to 990 of the active
ingredient. Suitable solid carriers include, for example,
calcium phosphate, magnesium stearate, talc, sugars,
lactose, dextrin, starch, gelatin, cellulose,
polyvinylpyrrolidine, low melting waxes and ion exchange
resins.
Liquid carriers are used in preparing solutions,
suspensions, emulsions, syrups, elixirs and pressurized
compositions. The active ingredient can be dissolved or
suspended in a pharmaceutically acceptable liquid carrier
such as water, an organic solvent, a mixture of both or
pharmaceutically acceptable oils or fats. The liquid
carrier can contain other suitable pharmaceutical
additives such as solubilizers, emulsifiers, buffers,
preservatives, sweeteners, flavoring agents, suspending
agents, thickening agents, colors, viscosity regulators,
stabilizers or osmoregulators. Suitable examples of
liquid carriers for oral and parenteral administration
include water (partially containing additives as above,
e.g. cellulose derivatives, preferably sodium
carboxymethyl cellulose solution), alcohols (including
monohydric alcohols and polyhydric alcohols, e.g. glycols)
and their derivatives, and oils (e. g. fractionated coconut
oil and arachis oil). For parenteral administration, the
carrier can also be an oily ester such as ethyl oleate or
isopropyl myristate. Sterile liquid carriers are useful in
sterile liquid form compositions for parenteral
administration. The liquid carrier for pressurized
compositions can be halogenated hydrocarbon or other
pharmaceutically acceptable propellent.
Liquid pharmaceutical compositions which are sterile
solutions or suspensions can be utilized by for example,
intramuscular, intrathecal, epidural, intraperitoneal or
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-58-
subcutaneous injection. Sterile solutions can also be
administered intravenously. The compounds may be prepared
as a sterile solid composition which may be dissolved or
suspended at the time of administration using sterile
water, saline, or other appropriate sterile injectable
medium. Carriers are intended to include necessary and
inert binders, suspending agents, lubricants, flavorants,
sweeteners, preservatives, dyes, and coatings.
The MCH1 antagonist can be administered orally in the form
of a sterile solution or suspension containing other
solutes or suspending agents (for example, enough saline
or glucose to make the solution isotonic), bile salts,
acacia, gelatin, sorbitan monoleate, polysorbate 80
(oleate esters of sorbitol and its anhydrides
.copolymerized with ethylene oxide) and the like.
The MCH1 antagonist can also be administered orally either
in liquid or solid composition form. Compositions suitable
for oral administration include solid forms, such as
pills, capsules, granules, tablets, and powders, and
liquid forms, such as solutions, syrups, elixirs, and
suspensions. Forms useful for parenteral administration
include sterile solutions, emulsions, and suspensions.
Optimal dosages to be administered may be determined by
those skilled in the art, and will vary with the
particular compound in use, the strength of the
preparation, the mode of administration, and the
advancement of the disease condition. Additional factors
depending on the particular subject being treated will
result in a need to adjust dosages, including subject age,
weight, gender, diet, and time of administration.
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-59-
This invention provides a transgenic, nonhuman mammal
expressing DNA encoding a human MCHl receptor. This
invention also provides a transgenic, nonhuman mammal
comprising a homologous recombination knockout of the
native human MCHl receptor. This invention further
provides a transgenic, nonhuman mammal whose genome
comprises antisense DNA complementary to the DNA encoding
a human MCHI receptor so placed within the genome as to be
transcribed into antisense mRNA which is complementary to
mRNA encoding the human MCH1 receptor and which hybridizes
to mRNA encoding the, human MCH1 receptor, thereby reducing
its translation. In an embodiment, the DNA encoding the
human MCH1 receptor additionally comprises an inducible
promoter. In another embodiment, the DNA encoding the
human MCH1 receptor additionally comprises tissue specific
regulatory elements. In a further embodiment, the
transgenic, nonhuman mammal is a mouse.
Animal model systems which elucidate the physiological and
behavioral roles of the polypeptides of this invention are
produced by creating transgenic animals in which the
activity of the polypeptide is either increased or
decreased, or the amino acid sequence of the expressed
polypeptide is altered, by a variety of techniques.
Examples of these techniques include, but are not limited
to: 1) Insertion of normal or mutant versions of DNA
encoding the polypeptide, by microinjection,
electroporation, retrovir.al transfection or other means
well known to those in the art, into appropriate
fertil,'_zed embryos in order to produce a transgenic animal
or 2) Homologous recombination of mutant or normal, human
or animal versions of these genes with the native gene
locus in transgenic animals to alter the regulation of
expression or the structure of these polypeptide
sequences. The technique of homologous recombination is
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-60-
well known in the art. .It replaces the native gene with
the inserted gene and so is useful for producing an animal
that cannot express native polypeptides but does express,
for example, an inserted mutant polypeptide, which has
replaced the native polypeptide in the animal's genome by
recombination, resulting in underexpression of the
transporter. Microinjection adds genes to the genome, but
does not remove them, and so is useful for producing an
animal which expresses its own and added polypeptides,
resulting in overexpression of the polypeptides.
One means available for producing a transgenic animal,
with a mouse as an example, is as follows: Female mice are
mated, and the resulting fertilized eggs are dissected out
of their oviducts. The eggs are stored in an appropriate
medium such as M2 medium. DNA or cDNA encoding a
polypeptide of this invention is purified from a vector by
methods well known in the~art. Inducible promoters may be
fused with the coding region of the DNA to provide an
experimental means to regulate expression of the trans-
gene. Alternatively, or in addition, tissue specific
regulatory elements may be fused with the coding region to
permit tissue-specific expression of the trans-gene. The
DNA, in an appropriately buffered solution, is put into a
microinjection needle (which may be made from capillary
tubing using a pipette pulley) and the egg to be injected
is put in a depression slide. The needle is inserted into
the pronucleus of the egg, and the DNA solution is
injected. The injected egg is then transferred into the
oviduct of a pseudopregnant mouse ( a mouse stimulated by
the appropriate hormones to maintain pregnancy but which
is not actually pregnant ), where it proceeds to the
uterus, implants, and develops to term. As noted above,
microinjection is not the only method for inserting DNA
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-61-
into the egg cell, and is used here only for exemplary
purposes.
This invention provides a process for identifying a
chemical compound which specifically binds to a mammalian
MCH1 receptor which comprises contacting cells comprising
DNA encoding, and expressing on their cell surface, the
mammalian MCH1 receptor, with the compound under
conditions suitable for binding, and detecting specific
binding of the chemical compound to the mammalian MCHl
receptor, wherein the cells do not normally express the
mammalian MCH1 receptor and the DNA encoding the mammalian
MCH1 receptor (a) hybridizes to a nucleic acid having the
defined sequence shown in Figure 1 (SEQ ID N0: 1) under
low stringency conditions or a sequence complementary
thereto and (b) is further characterized by its ability to
cause a change in the pH of a culture of CHO cells when a
MCH1 ligand is added to the culture and the CHO cells
contain the nucleic acid which hybridized to the nucleic
acid having the defined sequence or its complement. This
invention also provides a process for identifying a
chemical compound which specifically binds to a mammalian
MCH1 receptor which comprises contacting a membrane
preparation from cells comprising DNA encoding, and
~5 expressing on their cell surface, the mammalian MCH1
receptor, with the compound under conditions suitable for
binding, and detecting specific binding of the chemical
compound to the mammalian MCH1 receptor, wherein the cells
do not normally express the mammalian MCH1 receptor and
the DNA encoding the mammalian MCH1 receptor (a)
hybridizes to a nucleic acid having the defined sequence
shown in Figure 1 (SEQ ID N0: 1) under low stringency
conditions or a sequence complementary thereto and (b) is
further characterized by its ability to cause a change in
the pH of a culture of CHO cells when a MCH1 ligand is
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-62-
added to the culture and the CHO cells contain the nucleic
acid which hybridized to the nucleic acid having the
defined sequence or its complement. In one embodiment,
the MCH1 receptor is a human MCH1 receptor. In another
embodiment, the MCH1 receptor is a rat MCH1 receptor. In
another embodiment, the mammalian MCH1 receptor comprises
substantially the same amino acid sequence as the sequence
of the human MCH1 receptor encoded by plasmid pEXJ.HR-
TL231. In a further embodiment, the mammalian MCH1
receptor comprises substantially the same amino acid
sequence as that shown i~ Figure 2 (SEQ ID NO: 2) . In
another embodiment, the mammalian MCH1 receptor comprises
the amino acid sequence shown in Figure 2 (SEQ ID NO: 2).
In a different embodiment, the mammalian MCH1 receptor
comprises the amino acid sequence shown in Figure 13 (SEQ
ID NO: 26). In another embodiment, the mammalian MCH1
receptor comprises the amino acid sequence shown in Figure
14 (SEQ ID N0: 27). In still another embodiment, the
mammalian MCH1 receptor comprises the amino acid sequence
shown in Figure 15 (SEQ ID N0: 28 ) . In one embodiment,
the compound is not previously known to bind to a
mammalian MCH1 receptor. This invention further provides
a compound identified by the above-described processes.
Tn one embodiment of the.above-described processes, the
cell is an insect cell. In another embodiment, the cell
is a mammalian cell. In a further embodiment, the cell
is nonneuronal in origin. In a further embodiment, the
nonneuronal cell is a COS-7 cell, 293 human embryonic
kidney cell, a CHO cell, a NIH-3T3 cell, a mouse Yl cell,
or a LM(tk-) cell.
This invention provides a process involving competitive
binding for identifying a chemical compound which
specifically binds to a mammalian MCH1 receptor which
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-~3-
comprises contacting cells expressing on their cell
surface the mammalian MCH1 receptor, with both the
chemical compound and a second chemical compound known to
bind to the receptor, and separately with only the second
chemical compound, under conditions suitable for binding
of both compounds, and detecting specific binding of the
chemical compound to the mammalian MCH1 receptor, a
decrease in the binding of the second chemical compound to
the mammalian MCH1 receptor in the presence of the
chemical compound indicating that the chemical compound
binds to the mammalian MCH1 receptor, wherein the cells do
not normally express the mammalian MCH1 receptor and the
DNA encoding the mammalian MCH1 receptor (a) hybridizes to
a nucleic acid having the defined sequence shown in Figure
1 (SEQ ID N0: 1) under low stringency conditions or a
sequence complementary thereto and (b) is further
characterized by its ability to cause a change in the pH
of a culture of CHO cells when a MCHI ligand is added to
the culture and the CH0 cells contain the nucleic acid
which hybridized to the nucleic acid having the defined
sequence or its complement.
This invention also provides a process involving
competitive binding for identifying a chemical compound
which specifically binds to a mammalian MCH1 receptor
which comprises contacting a membrane preparation from
cells expressing on their cell surface the mammalian MCH1
receptor, with both the chemical compound and a second
chemical compound known ~to bind to the receptor, and
separately with only the second chemical compound, under
conditions suitable for binding of both compounds, and
detecting specific binding of the chemical compound to the
mammalian MCH1 receptor, a decrease in the binding of the
second chemical compound to the mammalian MCH1 receptor in
the presence of the chemical compound indicating that the
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-64-
chemical compound binds to the mammalian MCH1 receptor,
wherein the cells do not normally express the mammalian
MCH1 receptor and the DNA encoding the mammalian MCHl
receptor (a) hybridizes to a nucleic acid having the
defined sequence shown in Figure 1 (SEQ ID NO: 1) under
low stringency conditions or a sequence complementary
thereto and (b) is further characterized by its ability to
cause a change in the pH of a culture of CHO cells when a
MCH1 ligand is added to the culture and the CHO cells
contain the nucleic acid which hybridized to the nucleic
acid having the defined sequence or its complement.
Tn one embodiment, the mammalian MCH1 receptor is a human
MCH1 receptor or a mutant of such human MCH1 receptor
which is activated by MCH or an analog or homolog thereof.
In another embodiment, the mammalian MCH1 receptor is a
rat MCH1 receptor. In another embodiment, the mammalian
MCH1 receptor comprises substantially the same amino acid
sequence as the human MCH1 receptor encoded by plasmid
pEXJ.HR-TL231. In a further embodiment, the mammalian
MCH1 receptor comprises substantially the same amino acid
sequence as that shown in Figure 2 (SEQ ID NO: 2) . Tn
another embodiment, the mammalian MCH1 receptor comprises
the amino acid sequence shown in Figure 2 (SEQ ID NC: 2).
In one embodiment, the cell is an insect cell. In another
embodiment, the cell is a mammalian cell. In a further
embodiment, the cell is nonneuronal in origin. In another
embodiment, the nonneuronal cell is a COS-7 cell, 293
human embryonic kidney cell, a CHO cell, a NIH-3T3 cell,
a mouse Y1 cell, or a LM ( tk-) cell . In one embodiment,
the compound is not previously known to bind to a
mammalian MCH1 receptor.
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-65-
This invention provides a compound identified by the
above-described processes.
This invention provzdes a method of screening a plurality
of chemical compounds not known to bind to a mammalian
MCH1 receptor to identify a compound which specifically
binds to the mammalian MCH1 receptor, which comprises (a)
contacting cells transfected with and expressing DNA
encoding the mammalian MCH1 receptor with the plurality of
compounds not known to bind specifically to the mammalian
MCH1 receptor, under conditions permitting binding of
compounds known to bind the mammalian MCH1 receptor; (b)
determining whether the binding of a compound known to
bind to the mammalian MCH1 receptor is reduced in the
presence of the compounds within the plurality of
compounds, relative to the binding of the compound in the
absence of the plurality of compounds; and if so (c)
separately determining the binding to the mammalian MCH1
receptor of compounds included in the plurality of
compounds, so as to thereby identify the compound which
specifically binds to the mammalian MCH1 receptor.
This invention provides a method of screening a plurality
of chemical compounds not known to bind to a mammalian
MCH1 receptor to identify a compound which specifically
binds to the mammalian MCH1 receptor, which comprises (a)
contacting a membrane preparation from cells transfected
with and expressing the mammalian MCH1 receptor with the
plurality of compounds not known to bind specifically to
the mammalian MCH1 receptor, under conditions permitting
binding of compounds known to bind the mammalian MCH1
receptor; (b) determining whether the binding of a
compound known to bind to the mammalian MCH1 receptor is
reduced in the presence of the compounds within the
plurality of compounds, relative to the binding of the
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-66-
compound in the absence of the plurality of compounds; and
if so (c) separately determining the binding to the
mammalian MCHl receptor of compounds included in the
plurality of compounds, so as to thereby identify the
compound which specifically binds to the mammalian MCH1
receptor.
In one embodiment of the above-described methods, the
mammalian MCH1 receptor is a human MCH1 receptor or a
mutant of such human MCH1 receptor which is activated by
MCH or an analog or homolog thereof. In another
embodiment, the mammalian MCH1 receptor is a rat MCHl
receptor. In another embodiment, the cell is a mammalian
cell. In a further embodiment, the mammalian cell is non-
neuronal in origin. In another embodiment, the non-
neuronal cell is a COS-7 cell, a 293 human embryonic
kidney cell, a LM(tk-) cell, a CHO cell, a mouse Y1 cell,
or an NIH-3T3 cell.
This invention also provides a method of detecting
expression of a mammalian MCH1 receptor by detecting the
presence of mRNA coding for the mammalian MCH1 receptor
which comprises obtaining total mRNA from the cell and
contacting the mRNA so obtained from a nucleic acid probe
under hybridizing conditions, detecting the .presence of
mRNA hybridizing to the probe, and thereby detecting the
expression of the mammalian MCH1 receptor by the cell.
This invention further provides a method of detecting the
presence of a mammalian MCH1 receptor on the surface of a
cell which comprises contacting the cell with an antibody
under conditions permitting binding of the antibody to the
receptor, detecting the presence of the antibody bound to
the cell, and thereby detecting the presence of the
mammalian MCH1 receptor on the surface of the cell.
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
- 6'7 -
This invention provides a method of determining the
physiological effects ofwarying levels of activity of
human MCHl receptors which comprises producing a
transgenic, nonhuman mammal whose levels of human MCH1
receptor activity are varied by use of an inducibie
promoter which regulates human MCH1 receptor expression.
This invention also provides a method of determining the
physiological effects of varying levels of activity of
human MCH1 receptors which comprises producing a panel of
transgenic, nonhuman mammals each expressing a different
amount of human MCH1 receptor.
This invention provides a method for identifying an
antagonist capable of alleviating an abnormality wherein
the abnormality is alleviated by decreasing the activity
of a human MCHl receptor comprising administering a
compound to a transgenic, nonhuman mammal, and determining
whether the compound alleviates the physical and
behavioral abnormalities displayed by the transgenic,
nonhuman mammal as a result of overactivity of a human
MCH1 receptor, the alleviation of the abnormality
identifying the compound as an antagonist. This invention
also provides an antagonist identified by the above-
described method. This invention further provides a
pharmaceutical composition comprising an antagonist
identified by the above-described method and a
pharmaceutically acceptable carrier. This invention
provides a method of treating an abnormality in a subject
wherein the abnormality is alleviated by decreasing the
activity of a human MCH1 receptor which comprises
administering to the subject an effective amount of this
pharmaceutical composition, thereby treating the
abnormality.
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-68-
This invention provides a method for identifying an
agonist capable of alleviating an abnormality in a subject
wherein the abnormality is alleviated by increasing the
activity of a human MCH1 receptor comprising administering
a compound to transgenic, nonhuman mammal, and determining
whether the compound alleviates the physical and
behavioral abnormalities displayed by the transgenic,
nonhuman mammal, the alleviation of the abnormality
identifying the compound 'as an agonist. This invention
also provides an agonist identified by the above-described
method. This invention further provides a pharmaceutical
composition comprising an agonist identified by the above-
described method and a pharmaceutically acceptable
carrier. This invention further provides a method of
treating an abnormality in a subject wherein the
abnormality is alleviated by increasing the activity of
a human MCH1 receptor which comprises administering to the
subject an effective amount of this pharmaceutical
composition, thereby treating the abnormality.
This invention provides a method for diagnosing a
predisposition to a disorder associated with the activity
of a specific mammalian allele which comprises: (a)
obtaining DNA of subjects suffering from the disorder; (b)
performing a restriction digest of the DNA with a panel of
restriction enzymes; (c) electrophoretically separating
the resulting DNA fragments on a sizing gel; (d)
contacting the resulting gel with a nucleic acid probe
capable of specifically hybridizing with a unique sequence
included within the sequence of a nucleic acid molecule
encoding a human MCH1 receptor and labeled with a
detectable marker; (e) detecting labeled bands which have
hybridized to the DNA encoding a human MCH1 receptor
labeled with a detectable marker to create a unique band
pattern specific to the DNA of subjects suffering from the
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-69-
disorder; (f) preparing DNA obtained for diagnosis by
steps (a)-(e); and (g) comparing the unique band pattern
specific to the DNA of subjects suffering from the
disorder from step (e) and the DNA obtained for diagnosis
from step (f) to determine whether the patterns are the
same or different and to diagnose thereby predisposition
to the disorder if the patterns are the same. In one
embodiment, a disorder associated with the activity of a
specific mammalian allele is diagnosed.
This invention provides a method of preparing the purified
human MCH1 receptor which comprises: (a) inducing cells to
express the human MCHl receptor; (b) recovering the human
MCH1 receptor from the induced cells; and (c) purifying
the human MCH1 receptor so recovered.
This invention provides a method of preparing the purified
human MCH1 receptor which comprises: (a) inserting nucleic
acid encoding the human MCH1 receptor in a suitable
vector; (b) introducing the resulting vector in a suitable
host cell; (c) placing the resulting cell in suitable
condition permitting the production of the isolated human
MCH1 receptor; (d) recovering the human MCH1 receptor
produced by the resulting cell; and (e) purifying the
human MCH1 receptor so recovered.
This invention provides a process for determining whether
a chemical compound is a mammalian MCH1 receptor agonist
which comprises contacting cells transfected with and
expressing DNA encoding the mammalian MCHl receptor with
the compound under conditions permitting the activation of
the mammalian MCH1 receptor, and detecting an increase in
mammalian MCH1 receptor activity, so as ,to thereby
determine whether the compound is a mammalian MCH1
receptor agonist. This invention also provides a process
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-70-
for determining whether a chemical compound is a mammalian
MCH1 receptor antagonist which comprises contacting cells
transfected with and expressing DNA encoding the mammalian
MCH1 receptor with the compound in the presence of a known
mammalian MCHl receptor agonist, under conditions
permitting the activation of the mammalian MCH1 receptor,
and detecting a decrease in mammalian MCH1 receptor
activity, so as to thereby determine whether the compound
is a mammalian MCHl receptor antagonist. In one
embodiment, the mammalian MCH1 receptor is a human MCHl
receptor or a mutant of such human MCH1 receptor which is
activated by MCH or an analog or homolog thereof.
This invention further provides a pharmaceutical
composition which comprises an amount of a mammalian MCH1
receptor agonist determined by the above-described process
effective to increase activity of a mammalian NICH1
receptor and a pharmaceutically acceptable carrier. In
one embodiment, the mammalian MCH1 receptor agonist is not
previously known.
This invention provides a pharmaceutical composition which
comprises an amount of a mammalian MCH1 receptor
antagonist determined by the above-described process
effective to reduce activity of a mammalian MCH1 receptor
and a pharmaceutically acceptable carrier. In one
embodiment, the mammalian MCHl receptor antagonist is not
previously known.
This invention provides a process for determining whether
a chemical compound specifically binds to and activates a
mammalian MCH1 receptor, which comprises contacting cells
producing a second messenger response and expressing on
their cell surface the mammalian MCH1 receptor, wherein
such cells do not normally express the mammalian MCH1
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-71-
receptor, with the chemical compound under conditions
suitable for activation of the mammalian MCHl receptor,
and measuring the second messenger response in the
presence and in the absence of the chemical compound, a
change in the second messenger response in the presence of
the chemical compound indicating that the compound
activates the mammalian MCH1 receptor. In one embodiment,
the second messenger response comprises chloride channel
activation and the change in second messenger is an
increase in the level of inward chloride current.
This invention also provides a process for determining
whether a chemical compound specifically binds to and
inhibits activation of a mammalian MCH1 receptor, which
comprises separately contacting cells producing a second
messenger response and expressing on their cell surface
the mammalian MCH1 receptor, wherein such cells do not
normally express the mammalian MCH1 receptor, with both
the chemical compound and a second chemical compound known
to activate the mammalian,MCH1 receptor, and with only the
second chemical compound, under conditions suitable for
activation of the mammalian MCH1 receptor, and measuring
the second messenger response in the presence of only the
second chemical compound and in the presence of both the
second chemical compound and the chemical compound, a
smaller change in the second messenger response in the
presence of both the chemical compound and the second
chemical compound than in the presence of only the second
chemical compound indicating that the chemical compound
inhibits activation of the mammalian MCH1 receptor. In
one embodiment, the second messenger response comprises
chloride channel activation and the change in second
messenger response is a smaller increase in the level of
inward chloride current in the presence of both the
chemical compound and the second chemical compound than in
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-72-
the presence of only the second chemical compound. This
invention also provides the above-described processes
performed with membrane preparations from cells producing
a second messenger response and transfected with and
expressing the mammalian MCH1 receptor.
In one embodiment of the above-described processes, the
mammalian MCH1 receptor is a human MCHl receptor or a
mutant of such human MCH1 receptor which is activated by
MCH or an analog or homolog thereof. In another
embodiment, the mammalian MCH1 receptor is a rat MCH1
receptor. In another embodiment, the mammalian MCH1
receptor comprises substantially the same amino acid
sequence as encoded by the plasmid pEXJ.HR-TL231. In a
further embodiment, the mammalian MCH1 receptor comprises
substantially the same amino acid sequence as that shown
in Figure 2 (SEA ID NO: 2). In another embodiment, the
mammalian MCH1 receptor comprises an amino acid sequence
as shown in Figure 2 (SEQ ID N0: 2). In an embodiment,
the cell is an insect cell. In a further embodiment, the
cell is a mammalian cell. In a still further embodiment,
the mammalian cell is nonneuronal in origin. In another
embodiment, the nonneuronal cell is a COS-7 cell, CHO
cell, 293 human embryonic kidney cell, NIH-3T3 cell or
LM(tk-) cell. In an embodiment, the compound is not
previously known to bind to a mammalian MCH1 receptor.
This invention also provides a compound determined by the
above-described processes.
This invention also provides a pharmaceutical composition
which comprises an amount of a mammalian MCH1 receptor
agonist determined by the above-described processes
effective to increase activity of a mammalian MCH1
receptor and a pharmaceutically acceptable carrier. In
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-73-
one embodiment, the mammalian MCH1 receptor agonist is not
previously known.
This invention further provides a pharmaceutical
composition which comprises an amount of a mammalian MCH1
receptor antagonist determined by the above-described
processes effective to reduce activity of a mammalian MCH1
receptor and a pharmaceutically acceptable carrier. In
one embodiment, the mammalian MCHl receptor antagonist is
1.0 not previously known.
This invention provides a method of screening a plurality
of chemical compounds not knocm to activate a mammalian
MCH1 receptor to identify a compound which activates the
mammalian MCH1 receptor which comprises: (a) contacting
cells transfected with and expressing the mammalian MCH1
receptor with the plurality of compounds not known to
activate the mammalian MCH1 receptor, under conditions
permitting activation of the mammalian MCH1 receptor; (b)
determining whether the activity of the mammalian MCH1
receptor is increased in the presence of the compounds;
and if so (c) separately determining whether the
activation of the mammalian MCH1 receptor is increased by
each compound included in the plurality of compounds, so
as to thereby identify the compound which activates the
mammalian MCH1 receptor. In one embodiment, the
mammalian MCH1 receptor is a human MCH1 receptor or a
mutant of such human MCH1 receptor which is activated by
MCH or an analog or homolog thereof. In another
embodiment, the mammalian MCH1 receptor is a rat MCH1
receptor.
This invention provides a method of screening a plurality
of chemical compounds not known to inhibit the activation
of a mammalian MCH1 receptor to identify a compound which
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-74-
inhibits the activation of the mammalian MCH1 receptor,
which comprises: (a) contacting cells transfected with and
expressing the mammalian MCH1 receptor with the plurality
of compounds in the presence of a known mammalian MCH1
receptor agonist, under conditions permitting activation
of the mammalian MCH2 receptor; (b) determining whether
the activation of the mammalian MCH1 receptor is reduced
in the presence of the plurality of compounds, relative to
the activation of the mammalian MCHl receptor in the
l0 absence of the plurality of compounds; and if so (e)
separately determining the inhibition of activation of the
mammalian MCH1 receptor for each compound included in the
plurality of compounds, so as to thereby identify the
compound.which inhibits the activation o'f the mammalian
MCHl receptor. In one embodiment, the mammalian MCH1
receptor is a human MCH1 receptor or a mutant of such
human MCH1 receptor which is activated by MCH or an analog
or homolog thereof. In another embodiment, the mammalian
MCH1 receptor is a rat MCH1 receptor.
'? 0
In one embodiment of the above-described methods, the cell
is a mammalian cell. In another embodiment, the mammalian
cell is non-neuronal in origin. In a further embodiment,
the non-neuronal cell is a COS-7 cell, a 293 human
embryonic kidney cell, a LM(tk-) cell or an NIH-3T3 cell.
This invention provides a pharmaceutical composition
comprising a compound identified by the above-described
methods effective to increase mammalian MCH1 receptor
activity and a pharmaceutically acceptable carrier.
This invention also provides a pharmaceutical composition
comprising a compound identified by the above-described
methods effective to decrease mammalian MCH1 receptor
activity and a pharmaceutically acceptable carrier.
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-75-
This invention further provides a method of measuring
receptor activation in an oocyte expression system such as
a Xenopus oocyte expression system or melanophore. In an
embodiment, receptor activation is determined by
measurement of ion channel activity. In another
embodiment, receptor activation is measured by aequorin
luminescence.
Expression of genes in Xenopus oocytes is well known in
the art (Coleman, A., 1984; Masu, Y.,et al., 1994) and is
performed using microinjection of native mRNA or in vitro
synthesized mRNA into frog oocytes. The preparation of in
vitro synthesized mRNA can be performed by various
standard techniques (Sambrook, et al. 1989) including
using T7 polymerase with the mCAP RNA mapping kit
(Stratagene).
This invention provides a method of treating an
abnormality in a subject wherein the abnormality is
alleviated by increasing the activity of a mammalian MCH1
receptor which comprises .administering to the subject an
amount of a compound which is a mammalian MCH1 receptor
agonist effective to treat the abnormality. In separate
embodiments, the abnormality is a regulation of a steroid
or pituitary hormone disorder, an epinephrine release
disorder, a gastrointestinal disorder, a cardiovascular
disorder, an electrolyte balance disorder, hypertension,
diabetes, a respiratory disorder, asthma, a reproductive
function disorder, an immune disorder, an endocrine
disorder, a musculoskeletal disorder, a neuroendocrine
disorder, a cognitive disorder, a memory disorder such as
Alzheimer's disease, a sensory modulation and transmission
disorder, a motor coordination disorder, a sensory
integration disorder, a motor integration disorder, a
dopaminergic function disorder such as Parkinson's
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-76-
disease, a sensory transmission disorder, an olfaction
disorder, a sympathetic innervation disorder, an affective
disorder such as depression, a stress-related disorder, a
fluid-balance disorder, a urinary disorder such as
urinary incontinence, a seizure disorder, pain, psychotic
behavior such as schizophrenia, morphine tolerance, opiate
addiction or migraine.
This invention provides a method of treating an
abnormality in a subject wherein the abnormality is
alleviated by decreasing the activity of a mammalian MCH1
receptor which comprises administering to the subject an
amount of a compound which is a mammalian MCH1 receptor
antagonist effective to treat the abnormality. In
separate embodiments, the abnormality is a regulation of
a steroid or pituitary hormone disorder, an epinephrine
release disorder, a gastrointestinal disorder, a
cardiovascular disorder, an electrolyte balance disorder,
hypertension, diabetes, a respiratory disorder, asthma, a
reproductive function disorder, an immune disorder, an
endocrine disorder, a musculoskeletal disorder, a
neuroendocrine disorder, a cognitive disorder, a memory
disorder such as Alzheimer's disease, a sensory modulation
and transmission disorder, a motor coordination disorder,
a sensory integration disorder, a motor integration
disorder, a dopaminergic function disorder such as
Parkinson's disease, a sensory transmission disorder, an
olfaction disorder, a sympathetic innervation disorder, an
affective disorder such as depression, a stress-related
disorder, a fluid-balance disorder, a urinary disorder
such as urinary incontinence, a seizure disorder, pain,
psychotic behavior such as schizophrenia, morphine
tolerance, opiate addiction or migraine.
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
_77_
This invention provides a process for making a composition
of matter which specifically binds to a mammalian MCH1
receptor which comprises identifying a chemical compound
using any of the processes described herein for
identifying a compound which binds to and/or activates or
inhibits activation of a mammalian MCH1 receptor and then
synthesizing the chemical compound or a novel structural
and functional analog or homolog thereof. In one
embodiment, the mammalian MCH1 receptor is a human MCH1
receptor or a mutant of such human MCH1 receptor which is
activated by MCH or an analog or homolog thereof. In
another embodiment, the mammalian MCH1 receptor is a rat
MCHl receptor.
This invention further provides a process for preparing a
composition which comprises admixing a pharmaceutically
acceptable carrier and a therapeutically effective amount
of a chemical compound identified by any of the processes
described herein for identifying a compound which binds to
and/or activates or inhibits activation of a mammalian
MCH1 receptor or a novel structural and functional analog
or homolog thereof. In one embodiment, the mammalian MCH1
receptor is a human MCH1 receptor or a mutant of such
human MCH1 receptor which is activated by MCH or an analog
or homolog thereof. In another embodiment, the mammalian
MCH1 receptor is a rat MCH1 receptor.
This invention provides a process for determining whether
a chemical compound is a human MCHl receptor antagonist
which comprises contacting cells transfected with and
expressing DNA encoding the human MCH1 receptor with the
compound in the presence of a known human MCHl receptor
agonist, under conditions permitting the activation of the
human MCH1 receptor, and detecting a decrease in human
MCHl receptor activity, so as to thereby determine whether
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
_78-
the compound is a human MCH1 receptor antagonist, wherein
the DNA encoding the human MCH1 receptor comprises the
sequence shown in Figure 1 (Seq. ID No. 1) or contained in
plasmid pEXJ.HR-TL231 (ATCC Accession No. 203197), the
known human MCH1 receptor agonist is MCH or a homolog or
analog of MCH, and the cells do not express the MCH1
receptor prior to transfecting them.
This invention also provides a process for determining
whether a chemical compound specifically binds to and
inhibits activation of a human MCH1 receptor, which
comprises separately contacting cells expressing on their
cell surface the human MCH1 receptor and producing a
second messenger response upon activation of the human
MCH1 receptor, wherein such cells do not normally express
the human MCH1 receptor and the DNA encoding the human
MCH1 receptor comprises the sequence shown in Figure 1
(Seq. ID No. 1) or contained in plasmid pEXJ.HR-TL232
(ATCC Accession No. 203197), with both the chemical
compound and a second chemical compound known to activate
the human MCHl receptor, and with only the second chemical
compound, under conditions suitable for activation of the
human MCH1 receptor, and measuring the second messenger
response in the presence of only the second chemical
compound and in the presence of both the second chemical
compound and the chemical compound, a smaller change in
the second messenger response in the presence of both the
chemical compound and the second chemical compound than in
the presence of only the second chemical compound
indicating that the chemical compound inhibits activation
of the human MCH1 receptor, wherein the second chemical
compound is MCH or a homolog or analog of MCH. In one
embodiment, the second messenger response comprises
chloride channel activation and the change in second
messenger response is a smaller increase in the level of
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
_79_
inward chloride current in the presence of both the
chemical compound and the second chemical compound than in
the presence of only the second chemical compound.
This invention further provides a method of screening a
plurality of chemical compounds not known to inhibit the
activation of a human MCH1 receptor to identify a compound
which inhibits the activation of the human MCH1 receptor,
which comprises:
(a) contacting cells transfected with and expressing the
human MCH1 receptor, wherein such cells do not
normally express the human MCH1 receptor and the DNA
encoding the human MCH1 receptor comprises the
sequence shown in Figure 1 (Seq. ID No.. 1) or
contained in plasmid pEXJ.HR-TL231 (ATCC Accession
No. 203197), with the plurality of compounds in the
presence of a known human MCH1 receptor agonist,
under conditions permitting activation of the human
MCHl receptor, wherein the known MCH1 receptor
agonist is MCH or a homolog or analog of MCH;
(b) determining whether the activation of the human MCH1
receptor is reduced in the presence of the plurality
of compounds, relative to the activation of the human
MCHl receptor in the absence of the plurality of
compounds; and if so
(c) separately determining the extent of inhibition of
activation of the human MCH1 receptor for each
compound included in the plurality of compounds, so
as to thereby identify the compound which inhibits
the activation of the human MCHl receptor.
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-80-
In one embodiment of the above-described methods, the cell
is an insect cell. In another embodiment, the cell is a
mammalian cell. In still another embodiment, the cell is
a mammalian cell which is nonneuronal in origin. In
further embodiments, the cell is a COS-7 cell, a CHO cell,
a 293 human embryonic kidney cell, a NIH-3T3 cell, a mouse
Y1 cell, or a LM(tk-) cell.
This invention provides a process for making a composition
of matter which specifically binds to a human MCH1
receptor which comprises identifying a chemical compound
which specifically binds~to the human MCH1 receptor and
then synthesizing the chemical compound or a structural
and functional analog or homolog thereof, wherein the
chemical compound is identified as binding to the human
MCHl receptor by a process involving competitive binding
which comprises contacting cells expressing on their cell
surface the human MCH1 receptor, with both the chemical
compound and a second chemical compound known to bind to
the receptor, and separately with only the second chemical
compound, under conditions suitable for binding of both
compounds, and detecting the extent of specific binding of
the chemical compound to the human MCH1 receptor, a
decrease in the binding of the second chemical compound to
the human MCHl receptor in the presence of the chemical
compound indicating that~the chemical compound binds to
the human MCH1 receptor, wherein the cells do not normally
express the human MCH1 receptor, the human MCHl receptor
is encoded by nucleic acid comprising the sequence shown
in Figure 1 (Seq. ID No. 1) or contained in plasmid
pEXJ.HR-TL231 (ATCC Accession No. 203197), and the second
chemical compound is MCH or a homolog or analog of MCH.
This invention further provides a process for making a
composition of matter which specifically binds to a human
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-81-
MCH1 receptor which comprises identifying a chemical
compound which specifically binds to the human MCH1
receptor and then synthesizing the chemical compound or a
structural and functional analog or homolog thereof,
wherein the chemical compound is identified as binding to
the human MCH1 receptor by a process involving competitive
binding which comprises contacting a membrane preparation
from cells expressing on their cell surface the human MCH1
receptor, with both the chemical compound and a second
chemical compound known to bind to the receptor, and
separately with only the second chemical compound, under
- conditions suitable for binding of both compounds, and
detecting the extent of specific binding of the chemical
compound to the human MCH1 receptor, a decrease in the
binding of the second chemical compound to the human MCH1
receptor in the presence of the chemical compound
indicating that the chemical compound binds to the human
MCH1 receptor, wherein the cells do not normally express
the human MCH1 receptor, the human MCH1 receptor is
encoded by nucleic acid comprising the sequence shown in
Figure 1 (Seq. ID No. 1) or contained in plasmid pEXJ.HR-
TL231 (ATCC Accession No. 203197), and the second chemical
compound is MCH or a homolog or analog of MCH.
This invention also provides a process for making a
composition of matter which is a human MCH1 receptor
antagonist which comprises identifying a chemical compound
which is a human MCH1 receptor antagonist and then
synthesizing the chemical compound or a structural and
functional analog or homolog thereof, wherein the chemical
compound is identified as a human MCH1 receptor antagonist
by a process which comprises contacting cells transfected
with and expressing DNA encoding the human MCH1 receptor
with the compound in the presence of a known human MCH1
receptor agonist, under conditions permitting the
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-82-
activation of the human MCH1 receptor, and detecting a
decrease in human MCH1 receptor activity, so as to thereby
determine whether the compound is a human MCHl receptor
antagonist, wherein the cells do not normally express the
human MCH1 receptor, the human MCH1 receptor is encoded by
nucleic acid comprising the sequence shown in Figure 1
(Seq. ID No. 1) or contained in plasmid pEXJ.HR-TL231
(ATCC Accession No. 203197), and the known human MCHl
receptor agonist is MCH or a homolog or analog of MCH.
This invention still further provides a process for making
a composition of matter which specifically binds to and
inhibits the activation of a human MCH1 receptor which
comprises identifying a chemical compound which
specifically binds to and inhibits the activation of the
human MCH1 receptor and then synthesizing the chemical
compound or a structural and functional analog or homolog
thereof, wherein the chemical compound is identified as
binding to and inhibiting the activation of the human MCH1
receptor by a process which comprises separately
contacting cells expressing on their cell surface the
human MCH1 receptor and producing a second messenger
response upon activation of the human MCH1 receptor,
wherein such cells do not normally express the human MCH1
receptor and the human MCH1 receptor is encoded by nucleic
acid comprising the sequence shown in Figure 1 (Seq. ID
No. 1) or contained in plasmid pEXJ.HR-TL231 (ATCC
Accession No. 203197), with both the chemical compound and
a second chemical compound known to activate the human
MCH1 receptor, and with only the second chemical compound,
under conditions suitable for activation of the human MCH1
receptor, and measuring the second messenger response in
the presence of only the second chemical compound and in
the presence of both the second chemical compound and the
chemical compound, a smaller change in the second
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-83-
messenger response in the presence of both the chemical
compound and the second chemical compound than in the
presence of only the second chemical compound indicating
that the chemical compound inhibits activation of the
human MCH1 receptor, wherein the second chemical compound
is MCH or a homolog or analog of MCH. In one embodiment,
the second messenger response comprises chloride channel
activation and the change in second messenger response is
a smaller increase in the~level of inward chloride current
in the presence of both the chemical compound and the
second chemical compound than in the presence of only the
second chemical compound.
This invention provides a process for preparing a
composition which comprises identifying a chemical
compound which specifically binds to a human MCH1
receptor, and then admixing a carrier and the chemical
compound or a structural and functional analog or homolog
thereof, wherein the chemical compound is identified as
binding to the human MCH1 receptor by a process involving
competitive binding which comprises contacting cells
expressing on their cell surface the human MCH1 receptor,
with both the chemical compound and a second chemical
compound known to bind to the receptor, and separately
with only the second chemical compound, under conditions
suitable for binding of both compounds, and detecting the
extent of specific binding of the chemical compound to the
human MCH1 receptor, a decrease in the binding of the
second chemical compound to the human MCH1 receptor in the
presence of the chemical compound indicating that the
chemical compound binds to the human MCH1 receptor,
wherein the cells do not normally express the human MCH1
receptor, the human MCH1 receptor is encoded by nucleic
acid comprising the sequence shown in Figure 1 (Seq. ID
No. 1) or contained in plasmid pEXJ.HR-TZ231 (ATCC
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-84-
Accession No. 203197), and the second chemical compound is
MCH or a homolog or analog of MCH.
This invention further provides a process for preparing a
composition which comprises identifying a chemical
compound which specifically binds to a human MCH1
receptor, and then admixing a carrier and the chemical
compound or a structural and functional analog or homolog
thereof, wherein the chemical compound is identified as
binding to the human MCH1 receptor by a process involving
competitive binding which comprises contacting a membrane
preparation from cells expressing on their cell surface
the human MCH1 receptor, with both the chemical compound
and a second chemical compound known to bind to the
receptor, and separately with only the second chemical
compound, under conditions suitable for binding of both
compounds, and detecting the extent of specific binding of
the chemical compound to the human MCH1 receptor, a
decrease in the binding of the second chemical compound to
the human MCH1 receptor in the presence of the chemical
compound indicating that the chemical compound binds to
the human MCH1 receptor, wherein the cells do not normally
express the human MCH1 receptor, the human MCH1 receptor
is encoded by nucleic acid comprising the sequence shown
in Figure 1 (Seq. ID No. 1) or contained in plasmid
pEXJ.HR-TL231 (ATCC Accession No. 203197), and the second
chemical compound is MCH or a homolog or analog of MCH.
This invention also provides a process for preparing a
composition which comprises identifying a chemical
compound which is a human MCH1 receptor antagonist, and
then admixing a carrier and the chemical compound or a
structural and functional analog or homolog thereof,
wherein the chemical compound is identified as a human
MCHl receptor antagonist by a process which comprises
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-85-
contacting cells transfected with and expressing DNA
encoding the human MCHl receptor with the compound in the
presence of a known human MCH1 receptor agonist, under
conditions permitting the activation of the human MCH1
receptor, and detecting a decrease in human MCH1 receptor
activity, so as to thereby determine whether the compound
is a human MCH1 receptor antagonist, wherein the cells do
not normally express the human MCH1 receptor, the human
MCH1 receptor is encoded by nucleic acid comprising the
sequence shown in Figure 1 (Seq. ID No. 1) or contained in
plasmid pEXJ.HR-TL231 (ATCC Accession No. 203197), and the
known human MCH1 receptor agonist is MCH or a homolog or
analog of MCH.
This invention still further provides a process for
preparing a composition .which comprises identifying a
chemical compound which specifically binds to and inhibits
the activation of a human MCH1 receptor, and then admixing
a carrier and the chemical compound or a structural and
functional analog or homolog thereof, wherein the chemical
compound is identified as binding to and inhibiting
activation of the human MCH1 receptor by a process which
comprises separately contacting cells expressing on their
cell surface the human MCH1 receptor and producing a
second messenger response upon activation of the human
MCHl receptor, wherein such cells do not normally express
the human MCH1 receptor and the human MCHl receptor is
encoded by nucleic acid comprising the sequence shown in
Figure 1 (Seq. ID No. 1) or contained in plasmid pEXJ.HR-
TL231 (ATCC Accession No. 203197), with both the chemical
compound and a second chemical compound known to activate
the human MCH1 receptor, and with only the second chemical
compound, under conditions suitable for activation of the
human MCH1 receptor, and measuring the second messenger
response in the presence of only the second chemical
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-86-
compound and in the presence of both the second chemical
compound and the chemical compound, a smaller change in
the second messenger response in the presence of both the
chemical compound and the second chemical compound than in
the presence of only the second chemical compound
indicating that the chemical compound inhibits activation
of the human MCH1 receptor, wherein the second chemical
compound is MCH or a homolog or analog of MCH. In one
embodiment, the second messenger response comprises
chloride channel activation and the change in second
messenger response is a smaller increase in the level of
inward chloride current in the presence of both the
chemical compound and the second chemical compound than in
the presence of only the second chemical compound.
In one embodiment of any of the above methods, the cell is
an insect cell. In another embodiment, the cell is a
mammalian cell. In another embodiment, the mammalian cell
is nonneuronal in origin. In further embodiments, the
nonneuronal cell is a C0S-7 cell, a 293 human embryonic
kidney cell, a CHO cell, a NIH-3T3 cell, a mouse Y1 cell,
or a LM (tk-) cell.
For the purposes of this invention, "antagonist potency"
is measured as KB which is defined as the equilibrium
dissociation constant for the antagonist-receptor complex.
For the purposes of this invention, "agonist potency" is
measured as EC50 which is defined as the concentration
that is required to elicit 500 of the maximum response in
a functional assay.
Throughout the invention, the term "binding affinity"
describes the concentration of a compound required to
occupy one-half of the binding sites in a receptor
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
population, as detectable by radioligand binding. Binding
affinity concentration can be represented as Ki, inhibition
constant, or K~" dissociation constant.
The term "selectivity of binding affinity" refers to the
ability of a chemical compound to discriminate one
receptor from another. For example, a compound showing
selectivity for receptor A versus receptor B will bind
receptor A at lower concentrations than those required to
bind receptor B.
Therefore, the statements of the form "binds to the MCH1
receptor with a binding affinity at least ten-fold higher
than" a named receptor, indicates that the binding
affinity at the MCH1 receptor is at least ten-fold greater
than that for a named receptor, and binding affinity
measurements (i.e. Ki or KI,) for the compound are at least
ten-fold lower in numerical value.
This invention provides a method of treating an eating
disorder or obesity in a subject which comprises
administering to the subject a therapeutically effective
amount of an MCH1 antagonist which inhibits the activation
of the MCH1 receptor. In an embodiment, the MCH1
antagonist additionally inhibits the activation of the
MCH1 receptor with an antagonist potency which is at least
30-fold greater than the antagonist potency with which the
MCH1 antagonist inhibits the activation of each of the 5-
HT2C and MC-4 receptors.
In a further embodiment, the MCH1 antagonist additionally
inhibits the activation of the MCH1 receptor with an
antagonist potency which is at least 10-fold greater than
the antagonist potency with which the MCH1 antagonist
inhibits the activation of each of the NPY1, NPY5, GALR1,
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
_88_
GALR2, and GALR3 receptors. In another embodiment, the
MCHl antagonist additionally inhibits the activation of
the MCH1 receptor with an antagonist potency which is at
least 100-fold greater than the antagonist potency with
which the MCH1 antagonist inhibits the activation of each
of the 5-HT2C and MC-4 receptors.
In an additional embodiment, the MCH1 antagonist
additionally inhibits the activation of the MCH1 receptor
with an antagonist potency which is at least 100-fold
greater than the antagonist potency with which the MCH1
antagonist inhibits the activation of each of the NPY1,
NPY5, GALR1, GALR2, and GALR3 receptors. In an
embodiment, the MCH1 antagonist additionally inhibits the
activation of the MCH1 receptor with an antagonist potency
which ~is at least 30-fold greater than the binding
affinity with which the MCH1 antagonist binds to each of
the 5-HT2C and MC-4 receptors.
In another embodiment, the MCH1 antagonist additionally
inhibits the activation of the MCH1 receptor with an
antagonist potency which is at least 10-fold greater than
the binding affinity with which the MCH1 antagonist binds
to each of the NPY1, NPYS, GALR1, GALR2, and GALR3
receptors. In a further embodiment, the MCH1 antagonist
additionally inhibits the~activation of the MCH1 receptor
with an antagonist potency which is at least 100-fold
greater than the binding affinity with which the MCH1
antagonist binds to each of the 5-HT2C and MC-4 receptors.
In an additional embodiment, the MCH1 antagonist
additionally inhibits the activation of the MCH1 receptor
with an antagonist potency which is at least 100-fold
greater than the binding affinity with which the MCH1
antagonist binds to each of the NPY1, NPY5, GALR1, GALR2,
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-89-
and GALR3 receptors. In yet another embodiment, the MCH1
antagonist additionally binds to the MCH1 receptor with a
binding affinity which is at least 30-fold greater than
the binding affinity with which the MCH1 antagonist binds
to each of the 5-HT2C and MC-4 receptors. In still
another embodiment, the MCH1 antagonist additionally binds
to the MCH1 receptor with a binding affinity which is at
least 10-fold greater than the binding affinity with which
the MCH1 antagonist binds to each of the NPY1, NPYS,
GALR1, GALR2, and GALR3 receptors.
In a further embodiment, the MCH1 antagonist additionally
binds to the MCH1 receptor with a binding affinity which
is at least 100-fold greater than the binding affinity
with which the MCH1 antagonist binds to each of the 5-HT2C
and MC-4 receptors. In an additional embodiment, the MCH1
antagonist additionally binds to the MCH1 receptor with a
binding affinity which is at least 100-fold greater than
the binding affinity with which the MCH1 antagonist binds
to each of the NPY1, NPYS, GALR1, GALR2, and GALR3
receptors.
In another embodiment, the MCH1 antagonist additionally
binds to the MCH1 receptor with a binding affinity which
is at least 30-fold greater than the binding affinity with
which the MCH1 antagonist binds to the dopamine D2
receptor. In another embodiment, the MCH1 antagonist
additionally binds to the MCH1 receptor with a binding
affinity which is at least 30-fold greater than the
binding affinity with which the MCH1 antagonist binds to
the histamine H1 receptor.
In still other embodiments, the MCH1 antagonist
additionally binds to the MCH1 receptor with a binding
affinity which is at least 100-fold greater than the
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-90-
binding affinity with which the MCHl antagonist binds the
dopamine D2 receptor. In another embodiment, the MCH1
antagonist additionally binds to the MCH1 receptor with a
binding affinity which is at least 100-fold greater than
the binding affinity with which the MCH1 antagonist binds
to the H1 histamine receptor.
In another embodiment, the MCH1 antagonist additionally
binds to the MCH1 receptor with a binding affinity which
is at least 200-fold greater than the binding affinity
with which the MCH1 antagonist binds the dopamine D2
receptor. In still another embodiment, the MCH1 antagonist
additionally binds to the MCH1 receptor with a binding
affinity which is at least 200-fold greater than the
binding affinity with which the MCH1 antagonist binds to
the H1 histamine receptor.
In further embodiments, the MCH1 antagonist additionally
binds to the MCH1 receptor with a binding affinity which
is at least 10-fold greater than the binding affinity with
which the MCH1 antagonist binds to the alA adrenoceptor. In
another embodiment, the MCH1 antagonist additionally binds
to the MCH1 receptor with a binding affinity which is at
least 100-fold greater than the binding affinity with
which the MCH1 antagonist binds to the alA adrenoceptor.
In other embodiments, the MCH1 antagonist additionally
binds to the a1R adrenoceptor with a binding affinity which
is no more than 10-fold greater than the binding affinity
with which the MCH1 antagonist binds to the MCH1
receptor. In still other embodiments, the MCH1 antagonist
additionally binds to the alp adrenoceptor with a binding
affinity which is no more than 100-fold greater than the
binding affinity with which the MCH1 antagonist binds to
the MCHl receptor.
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-91-
In any of the embodiments of the present invention, the
eating or feeding disorder is bulimia, obesity or bulimia
nervosa. In one embodiment, the subject is a vertebrate,
a mammal, a human or a canine. In another embodiment, the
MCH1 antagonist is administered in combination with food.
This invention also provides a method of treating an
eating disorder in a subject which comprises administering
to the subject a therapeutically effective amount of an
MCH1 agonist which activates the MCH1 receptor. In one
embodiment, the MCH1 agonist additionally activates the
MCH1 receptor with an agonist potency which is at least
30-fold greater than the agonist potency with which the
MCH1 agonist activates each of the 5-HT2C and MC-4
receptors.
In another embodiment, the MCH1 agonist additionally
activates the MCHl receptor with an agonist potency which
is at least 10-fold greater than the agonist potency with
which the MCH1 agonist activates each of the NPY1, NPY5,
GALR1, GALR2, and GALR3 receptors. In a further
embodiment, the MCH1 agonist additionally activates the
MCH1 receptor with an agonist potency which is at least
100-fold greater than the agonist potency with which the
MCH1 agonist activates each of the 5-HT2C and MC-4
receptors.
In yet another embodiment, the MCH1 agonist additionally
activates the MCH1 receptor with an agonist potency which
is at least 100-fold greater than the agonist potency with
which the MCH1 agonist activates each of the NPY1, NPY5,
GALR1, GALR2, and GALR3 receptors. In further
embodiments, the eating disorder is anorexia nervosa. In
another embodiment, the subject is a vertebrate, a mammal,
a human or a canine. In a final embodiment, the MCH1
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-92-
agonist is administered in combination with food.
In the subject invention a "therapeutically effective
amount" is any amount of a compound which, when
administered to a subject suffering from a disease against
which the compounds are effective, causes reduction,
remission, or regression of the disease. In the subject
application, a "subject" is a vertebrate, a mammal, a
human or a canine.
l0
This invention further provides a method of modifying
feeding behavior of a subject which comprises
administering to the subject an amount of a compound of
the present invention effective to decrease the
consumption of food by the subject and/or decrease the
body mass of the subject. In one embodiment, the subject
is a vertebrate, a mammal, a human or a canine. In
another embodiment, the MCH1 antagonist is administered in
combination with food.
The present invention includes within its scope prodrugs
of the compounds of the invention. In general, such
prodrugs will be functional derivatives of the compounds
of the invention which are readily convertible in vivo
into the required compound. Thus, in the present
invention, the term "administering" shall encompass the
treatment of the various conditions described with the
MCH1 antagonist specifically disclosed or with a compound
which may not be specifically disclosed, but which
converts to the specified MCH1 antagonist in vivo of ter
administration to the patient. Conventional procedures for
the selection and preparation of suitable prodrug
derivatives are described, for example, in Design of
Prodrugs, ed. H. Bundgaard, Elsevier, 1985.
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-93-
The present invention provides a method of treating
depression andlor anxiety in a subject which comprises
administering to the subject a composition comprising a
pharmaceutically acceptable carrier and a therapeutically
effective amount of a MCH1 antagonist, wherein:
(a) (1) the MCHl antagonist does not inhibit the
activity of central monoamine oxidase A greater
than 50 percent, at a concentration of lOmM; and
(2) the MCH1 antagonist does not inhibit the
activity of central monoamine oxidase B greater
than 50 percent, at a concentration of lOmM; and
(b) the MCH1 antagonist binds to the MCH1 receptor with
a binding affinity at least ten-fold higher than
the binding affinity with which it binds to each of
the following transporters: serotonin transporter,
norepinephrine transporter, and dopamine
transporter.
For the purposes of this invention the term
"pharmaceutically acceptable carrier" has been defined
herein.
In other embodiments, the MCH1 antagonist also binds to
the MCH1 receptor with a binding affinity at least ten-
fold higher than the binding binding affinity with which
it binds to each of the human 5HT1A, human 5HT1B, human
5HTlI" human 5HT1E, human 5HT1F, human SHT~A, rat 5HT~~, human
5HT~, human 5HT6 and human 5HT~ receptors .
In still another embodiment, the MCH1 antagonist also
binds to the MCH1 receptor with a binding affinity at
least ten-fold higher than the binding affinity with which
it binds to the human histamine HI and HZ receptors.
In still another embodiment, the MCH1 antagonist also
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-94-
binds to the MCH1 receptor with a binding affinity at
least ten-fold higher than the binding affinity with which
it binds to the human dopamine D1, D2, D3, Ds and D,
receptors.
In a further embodiment, the MCHl antagonist also binds to
the MCH1 receptor with a~binding affinity at least ten-
fold higher than the binding affinity with which it binds
to the human alp adrenoceptor, the human alB adrenoceptor
and the human a1D adrenoceptor.
In another embodiment, the MCH1 antagonist also binds to
the MCH1 receptor with a binding affinity at least ten-
fold higher than the binding affinity with which it binds
to the human a~A adrenoceptor, the human a2$ adrenoceptor
and the human a~~ adrenoceptor.
In some embodiments the MCH1 antagonist does not inhibit
the activity of central monoamine oxidase A greater than
60 percent. In further embodiments the MCH1 antagonist
does not inhibit the activity of central monoamine oxidase
B greater than 60 percent. In other embodiments the MCH1
antagonist does not inhibit the activity of central
monoamine oxidase A greater than 70 percent. In still
other embodiments the MCH1 antagonist does not inhibit the
activity of central monoamine oxidase B greater than 70
percent.
The binding properties of compounds at different receptors
were determined using cultured cell lines that selectively
express the receptor of interest. Cell lines were prepared
by transfecting the cloned cDNA or cloned genomic DNA or
constructs containing both genomic DNA and cDNA encoding
the receptors as further. described in the Experimental
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-95-
Details herein below. Furthermore, the binding
interactions of compounds at different transporters and
enzymes can be determined using tissue preparations and
specific assays well known in the art.
In connection with this invention, a number of cloned
receptors discussed herein, as stably transfected cell
lines, have been made pursuant to, and in satisfaction of,
the Budapest Treaty on the International Recognition of
the Deposit of Microorganisms for the Purpose of Patent
Procedure, and are made 'with the American Type Culture
Collection, 10801 University Blvd., Manassas, Virginia
20110-209. Specifically, these deposits have been
accorded ATCC Accession Numbers as follows:
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-96-
ATCC De posits:
Designation Receptor ATCC Date
Accession of
No. Deposit
human GALL CRL-1650
(CHO)hGalR human GAL2 ~ CRL 12379 07/22/1997
2-2 64
L-hGalR3-228 human GALS CRL-12373 07/01/1997
5HT1A-3 human 5-HT1, CRL 11889 05/11/1995
Ltk-11 human 5-HT1B CRL 10422 04/17/1990
(formerly
human
5-HT1D2 )
Ltk-8-30-84 human 5-HT1~, CRL 10421 04/17/1990
(formerly
human
5-HT1D1)
5HT1E-7 human 5-HT1E CRL 10913 11/06/1991
L-5-HT1F human 5-HT1~. CRL 10957 12/27/1991
L-NGC-SHT~ human 5- CRL 10287 10/31/1989
HT_A(formerly
human
5-HT2)
pSr-1c rat 5-HT=~ 67636
(formerly
rat
5HT1C)
pBluescript- human 5-HTi 75392 12/22/1992
hSlO
L-5HT-4B human 5-HT, CRL 11166 10/20/1992
(formerly
human 5-
HT4B)
L-a,l~ human a.lw CRL11140 09/25/1992
(formerly
human a1C)
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-97-
L-a,~
human a,~ CRL11139 09/25/1992
L-alA human a, L, CRL11138 09/25/1992
(formerly
hum a1A)
L-a~A human a~; CRL 1118 0 11 / 0 6 /
19 9 2
L-NGC-a~H human a=B CRL10275 10/25/1989
L-a~c human a.,c CRL 11181 11 / 0 6 /
19 9 2
pDopDl-GL-30 human D, 40839 07/10/1990
(formerly
hum D1(3)
pCEXV-H1 human .H, 75346 11/06/1992
~ The "5-HTlc", "5-HTln~", "5-HT1L,=", "5-HT9B", and "5-HT_"
receptors were renamed the "5-HT~c", "5-HTIn", "5-HT,G,",
"5-HT.,", and "5-HT~A" receptors, respectively, by the
Serotonin Receptor Nomenclature Committee of the
IUPHAR.
~ The "human a " "human a " and "human D " were renamed
is ~ is ~ 1 p
the "human a " "human a " and "human D~"
1A i 1D ~
respectively.
25
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
_98_
The following receptor sequences have been deposited with
the GenBank DNA database, which is managed by the National
Center for Biotechnology (Bethesda, MD).
GENBANK DEPOSITS
DESIGNATTON RECEPTOR GENBANK No.
human mRNA for human D~
D-1 receptor (formerly human D1~) X58987
human dopamine
D2 receptor human D~ M29066
(DRD2) mRNA
complete cds
Rat mRNA for
dopamine D3 rat D, X53944
receptor
Homo sapiens
dopamine D4 human D9 h12397
receptor
(DRD4) gene
(D4.4)
sequence
* The inhuman Dla" receptor was renamed the inhuman D1"
receptor.
Thus, once the gene for a targeted receptor subtype is
cloned, it is placed into a recipient cell which then
expresses the targeted receptor subtype on its surface.
This cell, which expresses a single population of the
targeted human receptor subtype, is then propagated
resulting in the establishment of a cell line. This cell
line, which constitutes a drug discovery system, is used
in two different types of assays: binding assays and
functional assays. In binding assays, the affinity of a
compound for both the receptor subtype that is the target
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-99-
of a particular drug discovery program and other receptor
subtypes that could be associated with side effects are
measured. These measurements enable one to predict the
potency of a compound, as well as the degree of
selectivity that the compound has for the targeted
receptor subtype over other receptor subtypes. The data
obtained from binding assays also enable chemists to
design compounds toward or away from one or more of the
relevant subtypes, as appropriate, for optimal therapeutic
efficacy. In functional assays, the nature of the response
of the receptor subtype to the compound is determined.
Data from the functional assays show whether the compound
is acting to inhibit or enhance the activity of the
receptor subtype, thus enabling pharmacologists to
evaluate compounds rapidly at their ultimate human
receptor subtypes targets permitting chemists to
rationally design drugs that will be more effective and
have fewer or substantially less severe side effects than
existing drugs.
'' 0
L
Approaches to designing and synthesizing receptor subtype-
selective compounds are well known and include traditional
medicinal chemistry and the newer technology of
combinatorial chemistry, both of which are supported by
computer-assisted molecular modeling. With such
approaches, chemists and pharmacologists use their
knowledge of the structures of the targeted receptor
subtype and compounds determined to bind and/or activate
or inhibit activation of the receptor subtype to design
and synthesize structures that will have activity at these
receptor subtypes.
Combinatorial chemistry involves automated synthesis of a
variety of novel compounds by assembling them using
different combinations of chemical building blocks. The
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-100-
use of combinatorial chemistry greatly accelerates the
process of generating compounds. The resulting arrays of
compounds are called libraries and are used to screen for
compounds ("lead compounds") that demonstrate a sufficient
level of activity at receptors of interest. Using
combinatorial chemistry it is possible to synthesize
"focused" libraries of compounds anticipated to be highly
biased toward the receptor target of interest.
Once lead compounds are identified, whether through the
use of combinatorial chemistry or traditional medicinal
chemistry or otherwise, a variety of homologs and analogs
are prepared to facilitate an understanding of the
relationship between chemical structure and biological or
functional activity. These studies define structure
activity relationships which are then used to design drugs
with improved potency, selectivity and pharmacokinetic
properties. Combinatorial chemistry is also used to
rapidly generate a variety of structures for lead
optimization. Traditional medicinal chemistry, which
involves the synthesis of compounds one at a time, is also
used for further refinement and to generate compounds not
accessible by automated techniques. Once such drugs are
defined the production is scaled up using standard
chemical manufacturing methodologies utilized throughout
the pharmaceutical and chemistry industry.
This invention will be better understood from the
Experimental Details which follow. However, one skilled
in the art will readily appreciate that the specific
methods and results discussed are merely illustrative of
the invention as described more fully in the claims which
follow thereafter.
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-101-
EXPERIMENTAh DETAINS
Materials and methods
Cloning of human MCH1 receptor
Discovery of an Expressed Sequence Tag (ESTI F07228 in
GENEMBL Homologous to FB4la
A BLAST search of GENEMBL was performed with the GCG
sequence analysis package (Genetics Computer Group,
Madison, WI) using a Synaptic Pharmaceutical Corporation
proprietary sequence, FB4la, as a query. This resulted in
the identification of an EST (accession number F07228)
with a high degree of homology to FB4la and somatostatin,
opiate and galanin receptors.
Construction and Screening of a Human Hippocampal cDNA
Library
Poly A+ RNA was purified from human hippocampal RNA
(Clontech) using a FastTrack kit (Invitrogen, Corp.). DS
cDNA was synthesized from poly A+ RNA according to Gubler
and Hoffman (1983) with minor modifications. The resulting
cDNA was ligated to BstXI adaptors (Invitrogen, Corp.) and
the excess adaptors removed by exclusion column
chromatography. High molecular weight fractions of size-
selected ds-cDNA were ligated in pEXJ.BS, an Okayama and
Berg expression vector modified from pcEXV (Miller and
Germain, 1986) to contain BstXI and other additional
restriction sites. A total of 2.2 xlOEindependent clones
with a mean insert size of 3.0 kb were generated. The
library was plated on agar plates (ampicillin selection)
and glycerol stocks for 450 pools of 5000 independent
clones were prepared. Primary glycerol stocks were also
grouped together in groups of approximately 10 to create
superpools.
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-102-
Clonin g of the full-length sequence of MCH1
Glycerol stocks of the superpools and primary pools from
the human hippocampal cDNA library were screened by PCR
with F07228 specific primers T579 and T580 using Taq DNA
Polymerase (Boehringer-Mannheim, Indianapolis, IN) and the
following PCR protocol: 94°C hold for 5 minutes; 40 cycles
of 94°C for 2 minute, 68°C for 4 minutes; 7 minute hold at
68'C; 4°C hold until the samples are run on a gel. One
positive primary pool 490, was successively divided into
. subpools, amplified in LB medium overnight and screened by
PCR using primers T579 and T580. One positive subpool,
490-4-10-23 was plated on agar plates (ampicillin
selection), and colonies were transferred to
nitrocellulose membranes (Schleicher and Schuell, Keene,
NH). Filters were hybridized for two days under high
stringency conditions with 10~' cpm/ml of a 3=P-labeled cDNA
probe, T581, designed against the F07228 EST sequence.
Filters were washed and apposed to Biomax MS film (Kodak).
Seven positive colonies were picked, streaked on LB-AMP
plates, and grown overnight. Two individual colonies from
each of the original seven were picked and subjected to
vector-anchored PCR using the following primer pairs: T95,
T580 and T94, T579. One positive colony, G1, was
amplified overnight in TB and processed for plasmid
purification. This plasmid was designated TL230 and
sequenced on both strands with a Sequenase kit (US
Biochemical, Cleveland, Ohio). Nucleotide and peptide
sequence analysis were performed with GCG programs
(Genetics Computer Group,' Madison, WI). A HindIII- KpnI
fragment of TL230 was subcloned into the mammalian
expression vector pEXJ, and named TL231.
Primers and Probes:
TL579: 5'-GGGAACTCCACGGTCATCTTCGCGGT-3' (SEQ ID NO: 5)
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-103-
TL580: 5'-TAGCGGTCAATGGCCATGGCGGTCAG-3' (SEQ ID NO: 6)
TL581:
5'-CTCCTGGGCATGCCCTTCATGATCCACCAGCTCATGGGCAATGGG-3'
(SEQ ID NO: 7)
TL94: 5'-CTTCTAGGCCTGTACGGAAGTGTTA-3' (SEQ ID N0: 8)
TL95: 5'-GTTGTGGTTTGTCCAAACTCATCAATG-3' (SEQ ID NO: 9)
Isolation of a Fragment of a species homologue of TL231
(human MCH1)
To obtain a fragment of a species homologue of TL231, the
species genomic DNA (Clontech) may be amplified with a
forward PCR primer corresponding to one of the TM regions
of TL231 and a reverse primer corresponding to another TM
region of TL231. PCR may be performed with the Expand
Long Template PCR System (Boeringer Mannheim), for
example, under the following conditions: 30 sec at 94"C,
1.5 min at 50°C, 1.5 min at 68°C for 40 cycles, with a pre-
and post-incubation of 5 .min at 94°C and 7 min at 68°C,
respectively. A band is isolated, subcloned using the TA
cloning kit (Invitrogen), and sequenced. The sequence is
run and analyzed on an ABI PRISM 377 BigDye Terminator
Cycle Sequencing Kit Sequencer. Forward and reverse PCR
primers are designed against this sequence and used to
amplify a band from genomic DNA using, for example, the
following conditions: 30 sec at 94°C, 1.5 min at 68°C for
cycles, with a pre- and post-incubation of 5 min at 94°C
and 5 min at 68°C, respectively. The PCR product is
30 subcloned using the TA cloning kit (Invitrogen). Miniprep
cultures of transformants are prepared and sequenced as
above.
35 Isolation of a full-length species homoloa of TL231 (human
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-104-
MCH1
A nucleic acid sequence encoding an MCH1 receptor may be
isolated using standard molecular biology techniques and
approaches such as those briefly described below:
Approach #1: To obtain a full-length MCH1 receptor, a
cosmid library could be screened with a '=P-labeled
oligonucleotide probe.
The full-length sequence may be obtained by sequencing
this cosmid clone with additional sequencing primers.
Since one intron is present in this gene the full-length
intronless gene may be obtained from cDNA using standard
molecular biology techniques. For example, a forward PCR
primer designed in the 5'UT and a reverse PCR primer
designed in the 3'UT may be used to amplify a full-length,
intronless gene from cDNA. Standard molecular biology
techniques could be used to subclone this gene into a
mammalian expression vector.
Approach #2: Standard molecular biology techniques could
be used to screen commercial cDNA phage libraries by
hybridization under high. stringency with a 3=P-labeled
oligonucleotide probe. One may isolate a full-length MCH1
receptor by obtaining a plaque purified clone from the
lambda libraries and then subjecting the clone to direct
DNA sequencing. Alternatively, standard molecular biology
techniques could be used to screen in-house cDNA plasmid
libraries by PCR amplification of library pools using
primers to the MCH1 sequence. A full-length clone could
be isolated by Southern hybridization of colony lifts of
positive pools with a3=P-labeled oligonucleotide probe.
Approach #3: As yet another alternative method, one could
utilize 3' and 5' RACE to generate PCR products from cDNA
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-105-
expressing MCH1 which contain the additional sequences of
MCH1. These RACE PCR products could then be sequenced to
determine the missing sequence. This new sequence could
then be used to design a forward PCR primer in the 5'UT
and a reverse primer in the 3'UT. These primers could
then be used to amplify a full-length MCHl clone from
cDNA.
Construction of Human MCH1 Mutants
The plasmid TL231 encodes three in frame methionine
residues, any of which could potentially initiate
translation of the MCH1 receptor. The ability of these
residues to function in a heterologous expression system
was examined by constructing mutants of TL231 in which one
or more of the downstream methionine residues was mutated
to alanine. Mutagenesis was performed using the
QuickChange site-directed mutagenesis kit (Stratagene).
Each 50 u1 PCR reaction contained 10 mM KC1, 10 mM
(NHS) _S0;, 20 mM Tris-HC1 (pH 8 . 8 ) , 2 mM MgS04, 0 . 1 a Triton
X-100, 0.lmg/ml nuclease-free BSA, 114 ng each of two
mutagenesis primers (see below), 50 ng of plasmid DNA
template (see below), 2.5 units of PfuTurbo DNA
polymerase, and 1 u1 of the proprietary dNTP mix provided
in the kit. Thermocycling was performed with an Applied
Biosystems 9700 machine using the following cycling
parameters: one cycle of 95° for 30 seconds; eighteen
cycles of 95° for 30 seconds, 55° for 1 minute, 68° for
2.5
minutes; a final hold at 4°. Next, 1 u1 (10 units) of DpnI
restriction enzyme was added to the mutagenesis reaction
followed by incubation at 37° for 1 hour. A 2 u1 aliquot
of this digestion was used to transform 50 u1 of E . coli
XL1-Blue cells provided with the mutagenesis kit.
Transformants were selected by their ability to grow at
37°on LB plates containing 100 ug/ml ampicillin. Single
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-106-
colonies which resulted from the overnight incubation of
the plates were used to inoculate 2 ml cultures of LB-
ampicillin and allowed to grow overnight at 37° with
shaking. Miniprep DNA was prepared from these cultures
using the Qiagen miniprep system and subjected to
automated sequence analysis. This allowed both the
confirmation of the desired mutation and the integrity of
the remainder of the MCH1 coding sequence. After
identification of a correctly mutated clone, a large scale
DNA prep was prepared using a Qiagen megaprep column.
To create the clone encoding only the M70A mutation, the
template DNA was TL231 and the mutagenesis primers were
RP192 and RP193. This clone is designated 8106 (SEQ ID NO:
16) and encodes only the first two potential start codons
(See Figure 12). To create the clone encoding both the M6A
and the M70A mutations, the template DNA was 8106 and the
mutagenesis primers were RP190 and RP191. The resulting
clone is designated 8114 (SEA ID NO: 17) and encodes only
first start codon (See Figure 12).
If desired, the same mutagenesis technology can be
employed to construct additional MCH1 mutants that encode
other combinations of the available methionine residues.
The mutation M1A could be constructed using primers X1 and
X2. Such a change would eliminate the first methionine
but retain the two downstream residues. Likewise, the
double mutation M1A, M70A could be constructed by
sequentially using primer pairs X1/ X2 and RP192/RP193.
This would create a gene in which only the second
methionine was left intact.
Primers used in the generation of hMCH1 mutant receptor
constructs:
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-107-
Mutant Primer Primer Sequence
8106 RP192 5' CGGCACTGGCTGGGCGGACCTGGAAGCCTCG 3'
(SEQ ID NO: 18)
M70A) RP193 5' CGAGGCTTCCAGGTCCGCCCAGCCAGTGCCG 3'
(SEQ ID NO: 19)
8114 RP190 5' ATGTCAGTGGGAGCCGCGAAGAAGGGAGTGGG 3'
(SEQ ID N0: 20)
(M6A, RP191 5' CCCACTCCCTTCTTCGCGGCTCCCACTGACAT 3'
M70A) (SEQ ID NO: 21)
(M1A) X1 5' TAATGTGTCTAGGTGGCGTCAGTGGGAGCCATG 3'
(SEQ ID N0: 22)
X2 5'CATGGCTCCCACTGACGCCACCTAGACACATTA 3'
(SEQ ID NO: 23)
Construction of a short form of the human MCH1 receptor
A short form of the human MCH1 receptor expressing only
the most downstream of the three potential initiating
methionines was generated as follows. TL231 was amplified
with BB1122 (a forward primer beginning 10 nucleotides
upstream of the third methionine in TL231, and also
incorporating a HindIII site) and BB1123 (a reverse primer
in the second transmembrane domain) and the resulting
product digested with HindIII and BglIIA. PCR was
performed with the Expand Long Template PCR System (Roche
Molecular Biochemicals, Indianapolis, IN) under the
following conditions: 20 seconds at 94°C, 1 minute at 68°C
for 40 cycles, with a pre- and post-incubation of 5
minutes at 94°C and 7 minutes at 68°C respectively. The 270
by product was gel purified and ligated to a 4 kb
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-108-
HindIII/BglII restriction fragment from TL231. The
resulting construct was named B0120.
Primers used in the construction of the truncated human
MCH1 receptor:
BB1122 5'- TGACACTAAGCTTCACTGGCTGGATGGACCTGGAAGC -3' (SEQ
ID NO: 24)
BB1123 5'- GCCCAGGAGAAAGAGGAGATCTAC -3'(SEQ ID NO: 25)
Host cells
A broad variety of host cells can be used to study
heterologously expressed proteins. These cells include but
are not restricted to assorted mammalian lines such as;
Cos-7, CHO, LM(tk-), HEK293, etc.; insect cell lines such
as; Sf9, Sf2l, etc.; amphibian cells such as xenopus
oocytes; and others.
COS-7 cells are grown on 150 mm plates in DMEM with
supplements (Dulbecco's Modified Eagle Medium with 100
bovine calf serum, 4 mM glutamine, 100 units/ml
penicillin/100 ~g/ml streptomycin) at 37°C, 5o CO". Stock
plates of COS-7 cells are trypsinized and split 1:6 every
3-4 days.
Human embryonic kidney 293 cells are grown on 150 mm
plates in DMEM with supplements (10o bovine calf serum, 4
mM glutamine, 100 units/ml penicillin/100 ug/ml
streptomycin) at 37°C, 5o CO~. Stock plates of 293 cells
are trypsinized and split 1:6 every 3-4 days.
Mouse fibroblast LM(tk-) cells are grown on 150 mm plates
in D-MEM with supplements (Dulbecco's Modified Eagle
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-109-
Medium with loo bovine calf serum, 4 mM glutamine, 100
units/ml penicillin/100 ug/ml streptomycin) at 37°C, 5%
CO_. Stock plates of LM(tk-) cells are trypsinized and
split 1:10 every 3-4 days.
Chinese hamster ovary (CHO) cells were grown on 150 mm
plates in HAM's F-12 medium with supplements (loo bovine
calf serum, 4 mM L-glutamine and 100 units/ml penicillin/
100 ug/ml streptomycin) at 37°C, 5o CO~. Stock plates of
CHO cells are trypsinized and split 1:8 every 3-4 days.
Mouse embryonic fibroblast NIH-3T3 cells are grown on 150
mm plates in Dulbecco's Modified Eagle Medium (DMEM) with
supplements (loo bovine calf serum, 4 mM glutamine, 100
units/ml penicillin/100 ug/ml streptomycin) at 37°C, 50
CO=. Stock plates of NIH-3T3 cells are trypsinized and
split 1:15 every 3-4 days.
Sf9 and Sf21 cells are grown in monolayers on 150 mm
tissue culture dishes in TMN-FH media supplemented with
10 ~, fetal calf serum, at 27°C, no CO~. High Five insect
cells are grown on 150 mm tissue culture dishes in Ex-Cell
400'=r' medium supplemented with L-Glutamine, also at 27°C,
no CO~ .
In some cases, cell lines that grow as adherent monolayers
can be converted to suspension culture to increase cell
yield and provide large batches of uniform assay material
for routine receptor screening projects.
Xenopus oocytes can also be used as a host system for
transient expression of heterologous proteins. Their
maintenance and usage is described in the
electrophysiological methods section that follows.
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-110-
Transient expression
DNA encoding proteins to be studied can be transiently
expressed in a variety of mammalian, insect, amphibian and
other cell lines by several methods including but not
restricted to; calcium phosphate-mediated, DEAF-dextran
mediated, Liposomal-mediated, viral-mediated,
electroporation-mediated and microinjection delivery.
Each of these methods may require optimization of assorted
experimental parameters depending on the DNA, cell line,
ZO and the type of assay to be subsequently employed.
A typical protocol for the calcium phosphate method as
applied to LM(tk-) cells is described as follows; Adherent
cells are harvested approximately twenty-four hours before
l5 transfection and replated at a density of 1-2 x 10~
cells/cm' in a 100 mm tissue culture dish and allowed to
incubate over night at 37°C at 5o CO~. 250 u1 of a mixture
of CaCl~, and DNA (20 ~g DNA in 250 mM CaCl~) is added to a
5 ml plastic tube and 250 u1 of 2X HBS (250 mM NaCl, 10 mM
20 KC1, 1.5 mM Na~HPO~, 12 mM dextrose, 50 mM HEPES) is slowly
added with gentle mixing. The mixture is allowed to
incubate for 20 minutes at room temperature to allow a DNA
precipitate to form. The cells are then washed with
complete medium, 10 ml of culture medium is added to each
25 plate, followed by addition of the DNA precipitate. The
cells are then incubated for 24 to 48 hours at 37°C at 50
CO..
A typical protocol for the DEAF-dextran method as applied
30 to Cos-7 cells is described as follows; Cells to be used
for transfection are split 24 hours prior to the
transfection to provide flasks which are 70-80% confluent
at the time of transfection. Briefly, 8 ug of receptor
DNA plus 8 ug of any additional DNA needed (e. g. Ga protein
35 expression vector, reporter construct, antibiotic
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-111-
resistance marker, mock vector, etc.) are added to 9 ml of
complete DMEM plus DEAE-dextran mixture (10 mg/ml in PBS).
Cos-7 cells plated into a T225 flask (sub-confluent) are
washed once with PBS and the DNA mixture is added to each
flask. The cells are allowed to incubate for 30 minutes
at 37°C, 5 o CO., . Following the incubation, 3 6 ml of
complete DMEM with 80 uM chloroquine is added to each
flask and allowed to incubate an additional 3 hours. The
medium is then aspirated and 24 ml of complete medium
containing 10o DMSO for exactly 2 minutes and then
aspirated. The cells are then washed 2 times with PBS and
30 ml of complete DMEM added to each flask. The cells are
then allowed to incubate over night. The next day the
cells are harvested by trypsinization and reseeded as
needed depending upon the type of assay to be performed.
A typical protocol for liposomal-mediated transfection as
applied to CHO cells is described as follows; Cells to be
used for transfection are split 24 hours prior to the
transfection to provide flasks which are 70-80o confluent
at the time of transfection. A total of l0ug of DNA which
may include varying ratios of receptor DNA plus any
additional DNA needed (e. g. G~ protein expression vector,
reporter construct, antibiotic resistance marker, mock
vector, etc. ) is used to transfect each 75 cm= flask of
cells. Ziposomal mediated transfection is carried out
according to the manufacturer's recommendations
(L,ipofectAMINE, GibcoBRL,, Bethesda, MD). Transfected
cells are harvested 24 h post transfection and used or
reseeded according the requirements of the assay to be
employed.
A typical protocol for the electroporation method as
applied to Cos-7 cells is described as follows; Cells to
be used for transfection are split 24 hours prior to the
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-112-
transfection to provide flasks which are subconfluent at .
the time of transfection. The cells are harvested by
trypsinization resuspended in their growth media and
counted. 4 x lOb cells are suspended in 300 u1 of DMEM and
placed into an electroporation cuvette. 8 ug of receptor
DNA plus 8 ug of any additional DNA needed (e. g. G~ protein
expression vector, reporter construct, antibiotic
resistance marker, mock vector, etc.) is added to the cell
suspension, the cuvette is placed into a BioRad Gene
10' Pulser and subjected to an electrical pulse (Gene Pulser
settings: 0.25 kV voltage, 950 uF capacitance). Following
the pulse, 800 u1 of complete DMEM is added to each
cuvette and the suspension transferred to a sterile tube.
Complete medium is added to each tube to bring the final
cell concentration to 1 x 10 cells/100 ~l. The cells are
then plated as needed depending upon the type of assay to
be performed.
A typical protoool for viral mediated expression of
heterolgous proteins is described as follows for
baculovirus infection of insect Sf9 cells. The coding
region of DNA encoding the receptor disclosed herein may
be subcloned into pBlueBacIII into existing restriction
sites or sites engineered into sequences 5' and 3' to the
coding region of the polypeptides. To generate
baculovirus, 0.5 ug of viral DNA (BaculoGold) and 3 ~g of
DNA construct encoding a polypeptide may be co-transfected
into 2 x 10F Spodoptera frugiperda insect Sf9 cells by the
calcium phosphate co-precipitation method, as outlined in
by Pharmingen (in "Baculovirus Expression Vector System:
Procedures and Methods Manual"). The cells then are
incubated for 5 days at 27°C. The supernatant of the co-
transfection plate may be collected by centrifugation and
the recombinant virus plaque purified. The procedure to
infect cells with virus, to prepare stocks of virus and to
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-113-
titer the virus stocks are as described in Pharmingen's
manual. Similar principals would in general apply to
mammalian cell expression via retro-viruses, Simliki
forest virus and double stranded DNA viruses such as
adeno-, herpes-, and vacinia-viruses, and the like.
Microinjection of cRNA encoding for proteins of interest
is useful for the study of protein function in xenopus
oocytes as well as cultured mammalian cells. A typical
protocol for the preparation of cRNA and injection into
xenopus oocytes can be found in the following
electrophysiology section.
Stable expression
Heterologous DNA can be.stably incorporated into host
cells, causing the cell to perpetually express a foreign
protein. Methods for the delivery of the DNA into the cell
are similar to those described above for transient
expression but require the co-transfection of an ancillary
gene to confer drug resistance on the targeted host cell.
The ensuing drug resistance can be exploited to select and
maintain cells that have taken up the heterologous DNA. An
assortment of resistance genes are available including but
not restricted to Neomycin, Kanamycin, and Hygromycin. For
the purposes of receptor studies, stable expression of a
heterologous receptor protein is carried out in, but not
necessarily restricted to, mammalian cells including, CHO,
HEK293, LM(tk-), etc.
Cell membrane preparation
For binding assays, pellets of transfected cells are
suspended in ice-cold buffer (20 mM Tris.HCl, 5 mM EDTA,
pH 7.4) and homogenized by sonication for 7 sec. The cell
lysates are centrifuged at 200 x g for 5 min at 4°C. The
supernatants are then centrifuged at 40,000 x g for 20 min
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-114-
at 4°C. The resulting pellets are washed once in the
homogenization buffer and suspended in binding buffer (see
methods for radioligand binding). Protein concentrations
are determined by the method of Bradford (1976) using
bovine serum albumin as the standard. Binding assays are
usually performed immediately, however it is possible to
prepare membranes in batch and store frozen in liquid
nitrogen for future use.
Radioligand bindincr assays
Cells may be screened for the presence of endogenous human
receptor by radioligand binding (described in detail
below). Cells with either no or a low level of the
endogenous human receptor disclosed herein may be
transfected with the exogenous receptor.
MCH1 binding experiments with membranes (20-40 ~g membrane
protein) from transfected cells are performed with 0.1 nM
[~-'I] Phei3-Tyrl9-MCH (Custom labeled by NEN) using
incubation buffer consisting of 50mM Tris pH 7.4, lOmM
MgCl , 2 ug/ml aprotonin, 0.5mM PMSF and 50 ug/ml
bacitracin. Binding wis~performed at 25°C for 1 hr.
Incubations are terminated by rapid vacuum filtration over
GF/C glass fiber filters, presoaked in 5o PEI using 50 mM
Tris pH 7.4 containing O.Olo triton X-100 as wash buffer.
In all experiments nonspecific binding is defined using 10
~M unlabeled MCH.
Functional assays
Cells may be screened for the presence of endogenous
mammalian receptor using functional assays (described in
detail below). Cells with no or a low level of endogenous
receptor present may be ~transfected with the exogenous
receptor for use in the following functional assays.
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-115-
A wide spectrum of assays can be employed to screen for
receptor activation. These range from traditional
measurements of phosphatidyl inositol, cAMP, Ca~T, and K',
for example; to systems measuring these same second
messengers but which have been modified or adapted to be
higher throughput, more generic, and more sensitive; to
cell based platforms reporting more general cellular
events resulting from receptor activation such as
metabolic changes, differentiation, and cell
division/proliferation, for example; to high level
organism assays which monitor complex physiological or
behavioral changes thought to be involved with receptor
activation including cardiovascular, analgesic,
orexigenic, anxiolytic, and sedation effects, for example.
CVClic AMP (CAMP) assay
The receptor-mediated stimulation or inhibition of cyclic
AMP (CAMP) formation may be assayed in cells expressing
the mammalian receptors. Cells are plated in 96-well
plates and incubated in Dulbecco's phosphate buffered
saline (PBS) supplemented with 10 mM HEPES, 1mM
isobutylmethylxanthine for 20 min at 37°C, in 5o CO.,. Test
compounds are added with~or without 10 uM forskolin and
incubated for an additional 10 min at 37°C. The medium is
then aspirated and the reaction stopped by the addition of
100 mM HC1. The plates are stored at 4°C for 15 min, and
the cAMP content in the stopping solution measured by
radioimmunoassay. Radioactivity may be quantified using
a gamma counter equipped with data reduction software.
Arachidonic acid release assay
Cells expressing the mammalian receptor are seeded into 96
well plates and grown for 3 days in HAM's F-12 with
supplements. [3H]-arachidonic acid (specific activity -
0.75 uCi/ml) is delivered as a 100 uL aliquot to each well
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-116-
and samples were incubated at 37° C, 5o CO., for 18 hours.
The labeled cells are washed three times with 200 uL HAM's
F-12. The wells are then filled with medium (200 uL) and
the assay is initiated with the addition of peptides or
buffer (22 uL). Cells are incubated for 30 min at 37°C, 5'~
CO_. Supernatants are transferred to a microtiter plate
and evaporated to dryness at 75°C in a vacuum oven. Samples
are then dissolved and resuspended in 25 ~ZL distilled
water. Scintillant (300 ~L) is added to each well and
samples are counted for jH in a Trilux plate reader. Data
are analyzed using nonlinear regression and statistical
techniques available in the GraphPAD Prism package (San
Diego, CA).
Intracellular calcium mobilization assay
The intracellular free calcium concentration may be
measured by microspectroflourometry using the fluorescent
indicator dye Fura-2/AM (Bush et al, 1991). Cells are
seeded onto a 35 mm culture dish containing a glass
coverslip insert, washed with HBS and loaded with 100 uL
of Fura-2/AM (10 ~M) for 20 to 40 min. After washing with
HBS to remove the Fura-2/AM solution, cells are
equilibrated in HBS for 10 to 20 min. Cells are then
visualized under the 40X objective of a Leitz Fluovert FS
microscope and fluorescence emission is determined at 510
nM with excitation wavelengths alternating between 340 nM
and 380 nM. Raw fluorescence data are converted to
calcium concentrations using standard calcium
concentration curves and software analysis techniques.
Inositol phosphate assay
Guidelines for cell preparation and assay of the second
messenger inositol phosphate (IP) are described below for
a typical protocol involving transiently transfected Cos-7
cells; For a 96 well microplate format assay, cells are
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-117-
plated at 70,000 cells per well and allowed to incubate
for 24 hours after the transfection procedure. The cells
are then labeled with 0.5~uCi [jH]myo-inositol per micro-
well over night at 37°C, 5° CO~. Immediately before the
assay, the medium is removed and replaced with 90 u1 PBS
containing 10 mM LiCl. The plates are then incubated for
minutes at 37°C, 5o CO..,_ Following the incubation, the
transfectants are challenged with agonist (10 ~1/well; lOX
concentration) for 30 minutes at 37°C, 5o CO,. The
10 challenge is terminated and the cells lysed by the
addition of 100 u1 cold 5o V/V trichloroacetic acid (TCA),
followed by an incubation at 4°C for greater than 30
minutes. Total IPs are isolated from the lysate by ion
exchange chromatography. Briefly, the lysed contents of
15 the wells are transferred to a Multiscreen HV filter plate
(Millipore) containing 100 u1 Dowex AG1-X8 suspension (500
v/v, water:resin) (200-400 mesh, formate form). The
filter plates are placed on a vacuum manifold to wash and
elute the resin bed. Bach well is first washed 2 times
with 200 u1 5 mM myoinositol . Total [3H] IPs are eluted
with 75 u1 of 1.2 M ammonium formate/0.1 M formic acid
into Wallac 96-well plates. 200 u1 of SuperMix
scintillation cocktail is added to each well, mixed well,
allowed to equilibrate and counted on a Micro Beta Trilux
scintillation counter. (Note: The assay may be scaled to
a 24 well format by simple adjustment of reagent volumes
and employing individual chromatographic columns.)
GTPYS functional assay
Membranes from cells transfeCted with the mammalian
receptors are suspended in assay buffer (50 mM Tris, 100
mM NaCl, 5 mM MgCl~, pH 7.4) supplemented with 0.2o BSA
and 10 uM GDP. Membranes are incubated on ice for 20
minutes, transferred to a 96-well Millipore microtiter
GF/C filter plate and mixed with GTPy''S (e. g., 250,000
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-118-
cpm/sample, specific activity 1000 Ci/mmol) plus or minus
GTPYS (final concentration - 100 uM). Final membrane
protein concentration ~ 90 ug/ml. Samples are incubated
in the presence or absence of MCH (final concentration =
1 ~M) for 30 min. at room temperature, then filtered on
a Millipore vacuum manifold and washed three times with
cold assay buffer. Samples collected in the filter plate
are treated with scintillant and counted for ~r'S in a
Trilux (Wallac) liquid scintillation counter. It is
expected that optimal results are obtained when the
mammalian receptor membrane preparation is derived from an
appropriately engineered heterologous expression system,
i.e., an expression system resulting in high levels of
expression of the mammalian receptor and/or expressing G-
proteins having high turnover rates (for the exchange of
GDP for GTP). GTPyS assays are well-known in the art, and
it is expected that variations on the method described
above, such as are described by e.g., Tian et al. (1994)
or Lazareno and Birdsall (1993), may be used by one of
LO ordinary skill in the art.
Transcription assay
Guidelines for cell preparation and assay of receptor
mediated transcription of Cos-7 cells transiently
transfected by the DEAE-dextran method in a 96 microwell
format is as follows; The c-fos-~i-gal promoter/reporter
construct used for these studies consists of the cfos
promoter region (-384 to +19) (Schilling et al 1991,
Yalkinoglu et al, 1995) inserted upstream of (3-
galactosidase cDNA containing expression vector pNASS(3
(Clontech). Transcription activity is measured by assay
of (3-galactosidase enzyme activity as detected in a
colorimetric assay. Forty-eight hours following transient
transfection, the medium, is removed and replaced with
medium containing drug (e.g. MCH) typically at a
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-119-
concentration of 10 uM. The cells are allowed to incubate
at 37°C, 5o CO" for at least 18 hours, after which the
medium is aspirated and the cells washed with 200 u1
PBS/well. The cells are then lysed with 100 u1 AB buffer
(100 mM Sodium Phosphate buffer, pH 8.0, 2 mM MgSO~, 0.1 mM
MnCl") for 10 minutes at room temperature. 100 u1 of
AB/Tx/~i-mercaptoethanol (AB buffer with 0.5o Triton X-100,
40 mM ~i-mercaptoethanol) is then added to each well and
the lysate allowed to incubate an additional 10 minutes at
room temperature. The' enzymatic color reaction is
initiated by the addition of the substrate, ONPG/AB (4
mg/ml 0-nitrophenyl-b-D-galactopyranoside in AB buffer).
The reaction is allowed to proceed for 30 minutes or until
yellow color becomes evident. Measurement of optical
density is taken at 405 nm using a Dynatech microplate
reader.
MAP kinase assay
MAP kinase (mitogen activated kinase) may be monitored to
evaluate receptor activation. MAP kinase is activated by
multiple pathways in the cell. A primary mode of
activation involves the ras/raf/MEK/MAP kinase pathway.
Growth factor (tyrosine kinase) receptors feed into this
pathway via SHC/Grb-2/SOS/ras. Gi coupled receptors are
also known to activate ras and subsequently produce an
activation of MAP kinase. Receptors that activate
phospholipase C (Gq and G11) produce diacylglycerol (DAG)
as a consequence of phosphatidyl inositol hydrolysis. DAG
activates protein kinase C which in turn phosphorylates
MAP kinase.
MAP kinase activation can be detected by several
approaches. One approach is based on an evaluation of the
phosphorylation state, either unphosphorylated (inactive)
or phosphorylated (active). The phosphorylated protein
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-120-
has a slower mobility in SDS-PAGE and can therefore be
compared with the unstimulated protein using Western
blotting. Alternatively, antibodies specific for the
phosphorylated protein are available (New England
Biolabs) which can be used to detect an increase in the
phosphorylated kinase. In either method, cells are
stimulated with the mitogen and then extracted with
Laemmli buffer. The soluble fraction is applied to an
SDS-PAGE gel and proteins are transferred
electrophoretically to nitrocellulose or Immobilon.
Immunoreactive bands are detected by standard Western
blotting technique. Visible or chemiluminescent signals
are recorded on film and may be quantified by
densitometry.
Another approach is based on evaluation of the MAP kinase
activity via a phosphorylation assay. Cells, are
stimulated with the mitogen and a soluble extract is
prepared. The extract is incubated at 30°C for 10 min with
gamma-32-ATP, an ATP regenerating system, and a specific
substrate for MAP kinase such as phosphorylated heat and
acid stable protein regulated by insulin, or PHAS-I. The
reaction is terminated by the addition of H3P09 and samples
are transferred to ice. An aliquot is spotted onto
Whatman P81 chromatography paper, which retains the
phosphorylated protein. The chromatography paper is
washed and counted for '-P in a liquid scintillation
counter. Alternatively,~the cell extract is incubated
with gamma-32-ATP, an ATP regenerating system, and
biotinylated myelin basic protein bound by streptavidin to
a filter support. The myelin basic protein is a substrate
for activated MAP kinase. The phosphorylation reaction
is carried out for 10 min at 30°C. The extract can then
be aspirated through the filter, which retains the
phosphorylated myelin basic protein. The filter is washed
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-121-
and counted for 3=P by liquid scintillation counting.
Cell proliferation assay
Activation of a G protein coupled receptor may lead to a
mitogenic or proliferative response which can be monitored
via [jH]-thymidine uptake. When cultured cells are
incubated with [3H]-thymidine, the thymidine translocates
into the nuclei where it is phosphorylated to thymidine
triphosphate. The nucleotide triphosphate is then
incorporated into the cellular DNA at a rate that is
proportional to the rate of cell growth. Typically, cells
are grown in culture for 1-3 days. Cells are forced into
quiescence by the removal of serum for 24' hrs. A
mitogenic agent is then added to the media. 24 hrs later,
the cells are incubated with ['H]-thymidine at specific
activities ranging from 1 to 10 pCi/ml for 2-6 hrs.
Harvesting procedures may involve trypsinization and
trapping of cells by filtration over GF/C filters with or
without a prior incubation in TCA to extract soluble
thymidine. The filters are processed with scintillant and
counted for 3H by liquid scintillation counting.
Alternatively, adherent cells are fixed in MeOH or TCA,
washed in water, and solubilized in 0.050 deoxycholate/0.1
N NaOH. The soluble extract is transferred to
scintillation vials and counted for 3H by liquid
scintillation counting.
Methods for recording currents in Xenopusoocvtes
Female Xenopus laevis (Xenopus-1, Ann Arbor, MI) are
anesthetized in 0.2o tricain (3-aminobenzoic acid ethyl
ester, Sigma Chemical Corp.) and a portion of ovary is
removed using aseptic technique (Quick and Lester, 1994).
Oocytes are defolliculated using 2 mg/ml collagenase
(Worthington Biochemical Corp., Freehold, NJ) in a
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-122-
solution containing 87.5 mM NaCl, 2 mM KC1, 2 mM MgCl_ and
mM HEPES, pH 7.5. Oocytes may be injected (Nanoject,
Drummond Scientific, Broomall, PA) with mammalian mRNA.
Other oocytes may be injected with a mixture of mammalian
5 mRNA and mRNA encoding the genes for G-protein-activated
inward rectifiers (GIRK1 and GIRK4, U.S. Patent Nos.
5,734,021 and 5,728,535). Genes encoding G-protein
inwardly rectifying K~ (GIRK) channels 1 and 4 (GIRK1 and
GIRK4) were obtained by PCR using the published sequences
(Kubo et al., 1993; Dascal et al., 1993; Krapivinsky et
al., 1995 and 1995b) to derive appropriate 5' and 3'
primers. Human heart cDNA was used as template together
with the primers
5'-CGCGGATCCATTATGTCTGCACTCCGAAGGAAATTTG-3' (SEQ ID NO:
10 ) and
5'-CGCGAATTCTTATGTGAAGCGATCAGAGTTCATTTTTC-3' (SEQ ID NO:
11) for GIRK1 and
5'-GCGGGATCCGCTATGGCTGGTGATTCTAGGAATG-3' (SEQ ID NO: 12)
and
5'- CCGGAATTCCCCTCACACCGAGCCCCTGG-3' (SEQ ID NO: 13) for
GIRK4.
In each primer pair, the upstream primer contained a BamHI
site and the downstream primer contained an EcoRI site to
facilitate cloning of the PCR product into pcDNA1-Amp
(Invitrogen). The transcription template for the
mammalian receptor may be similarly obtained. mRNAs are
prepared from separate ' DNA plasmids containing the
complete coding regions of the mammalian receptor, GIRK1,
and GIRK4. Plasmids are linearized and transcribed using
the T7 polymerase ("Message Machine", Ambion).
Alternatively, mRNA may be translated from a template
generated by PCR, incorporating a T7 promoter and a poly
A' tail. Each oocyte receives 2 ng each of GIRK1 and GIRK4
mRNA in combination with 25 ng of mammalian receptor mRNA.
After injection of mRNA, oocytes are incubated at 16° C on
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-123-
a rotating platform for 3-8 days. Dual electrode voltage
clamp ("GeneClamp", Axon Instruments Inc., Foster City, CA)
is performed using 3 M KCl-filled glass microelectrodes
having resistances of 1-3 Mohms. Unless otherwise
specified, oocytes are voltage clamped at a holding
potential of -80 mV. During recordings, oocytes are
bathed in continuously flowing (2-5 ml/min) medium
containing 96 mM NaCl, 2 mM KC1, 2 mM CaCl2, 2 mM T~IgCl.,
and 5 mM HEPES, pH 7.5 ("ND96"), or, in the case of oocytes
expressing GIRK1 and GIRK4, elevated K~ containing 96 mM
KC1, 2 mM NaCl, 2 mM CaCl,, 2 mM MgCl.,, and 5 mM HEPES, pH
7.5 ("hK"). Drugs are applied by switching from a series
of gravity fed perfusion lines.
Heterologous expression of GPCRs in Xenopus oocytes has
been widely used to determine the identity of signaling
pathways activated by agonist stimulation (Gundersen et
al., 1983; Takahashi et al., 1987). Activation of the
phospholipase C (PLC) pathway is assayed by applying test
compound in ND96 solution to oocytes previously injected
with mRNA for the mammalian receptor and observing inward
currents at a holding potential of -80 mV. The appearance
of currents that reverse at -25 mV and display other
properties of the Ca+~-activated Cl- (chloride) channel is
indicative of mammalian receptor-activation of PLC and
release of IP3 and intracellular Ca++. Such activity is
exhibited by GPCRs that couple to Gq.
Measurement of inwardly rectifying K+ (potassium) channel
(GIRK) activity is monitored in oocytes that have been co-
injected with mRNAs encoding the mammalian receptor,
.GIRK1, and GIRK4. The two GIRK gene products co-assemble
to form a G-protein activated potassium channel known to
be activated (i.e., stimulated) by a number of GPCRs that
couple to Gi or G~ (Kubo et al., 1993; Dascal et al.,
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-124-
1993). Oocytes expressing the mammalian receptor plus the
two GIRK subunits are tested for test compound
responsivity by measuring K' currents in elevated K'
solution (hK). Activation of inwardly rectifying currents
that are sensitive to 300 uM BaT+ signifies the mammalian
receptor coupling to a G,.or G~. pathway in the oocytes.
Receptor/G protein co-transfection studies
A strategy for determining whether MCH1 can couple
preferentially to selected G proteins involves co
transfection of MCH1 receptor cDNA into a host cell
together with the cDNA for a G protein alpha sub-unit.
Examples of G alpha sub-units include members of the
Gai/Gao.class (including Gat2 and Gaz), the Gaq class, the
Gas class, and the Gal2/13 class. A typical procedure
involves transient transfection into a host cell such as
COS-7. Other host cells may be used. A key consideration
is whether the cell has a downstream effector (a
particular adenylate cyclase, phospholipase C, or channel
isoform, for example) to. support a functional response
through the G protein under investigation. G protein beta
gamma sub-units native to the cell are presumed to
complete the G protein heterotrimer; otherwise specific
beta and gamma sub-units may be co-transfected as well.
Additionally, any individual or combination of alpha,
beta, or gamma subunits may be co-transfected to optimize
the functional signal mediated by the receptor.
The receptor/G alpha co-transfected cells are evaluated in
a binding assay, in which case the radioligand binding may
be enhanced by the presence of the optimal G protein
coupling or in a functional assay designed to test the
receptor/G protein hypothesis. In one example, the MCH1
receptor may be hypothesized to inhibit cAMP accumulation
through coupling with G alpha sub-units of the Gai/Gao
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-125-
class. Host cells co-transfected with the MCHl receptor
and appropriate G alpha sub-unit cDNA are stimulated with
forskolin +/- MCH1 agonist, as described above in cAMP
methods. Intracellular cAMP is extracted for analysis by
radioimmunoassay. Other assays may be substituted for
cAMP inhibition, including GTPY3'S binding assays and
inositol phosphate hydrolysis assays. Host cells
transfected with MCH1 minus G alpha or with G alpha minus
MCH1 would be tested simultaneously as negative controls.
MCH1 receptor expression in transfected cells may be
confirmed in radioligand binding studies using membranes
from transfected cells. G alpha expression in transfected
cells may be confirmed by Western blot analysis of
membranes from transfected cells, using antibodies
specific for the G protein of interest.
The efficiency of the transient transfection procedure is
a critical factor for signal to noise in an inhibitory
assay, much more so than in a stimulatory assay. If a
positive signal present in all cells (such as forskolin-
stimulated cAMP accumulation) is inhibited only in the
fraction of cells successfully transfected with receptor
and G alpha, the signal to noise ratio will be poor. One
method for improving the signal to noise ratio is to
create a stably transfected cell line in which 1000 of the
cells express both the receptor and the G alpha subunit.
Another method involves transient co-transfection with a
third cDNA for a G protein-coupled receptor which
positively regulates the signal which is to be inhibited.
Tf the co-transfected cells simultaneously express the
stimulatory receptor, the inhibitory receptor, and a
requisite G protein for the inhibitory receptor, then a
positive signal may be elevated selectively in transfected
cells using a receptor-specific agonist. An example
involves co-transfection of COS-7 cells with 5-HT4
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-126-
receptor, MCH1 receptor, and a G alpha sub-unit.
Transfected cells are stimulated with a 5-HT4 agonist +/-
MCH1 agonist. Cyclic AMP is expected to be elevated only
in the cells also expressing MCH1 and the G alpha subunit
of interest, and a MCH1-dependent inhibition may be
measured with an improved signal to noise ratio.
It is to be understood that the cell lines described
herein are merely illustrative of the methods used to
evaluate the binding and function of the mammalian
receptors of the present invention, and that other
suitable cells may be used in the assays described herein.
Promiscuous second messenger assays
It is possible to coax receptors of different functional
classes to signal through a pre-selected pathway through
the use of promiscuous G" subunits. For example, by
providing a cell based receptor assay system with an
exogenously supplied promiscuous G~ subunit .such as G~1F, or
a chimeric Ga subunit such as Ga_q, a GPCR which normally
might prefer to couple through a specific signaling
pathway ( a . g . GS, Gi, G9, G~, etc . ) , can be made to couple
through the pathway defined by the promiscuous G,~ subunit
and upon agonist activation produce the second messenger
associated with that subunit's pathway. In the case of G,xls
and/or Gaq~ this would involve activation of the Gq pathway
and production of the second messenger inositol phosphate.
Through similar strategies and tools, it is possible to
bias receptor signaling through pathways producing other
second messengers such as CaTT, cAMP, K+ currents, etc.
Microphysiometric assa~r
Because cellular metabolism is intricately involved in and
effected by a broad range of cellular events (including
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-127-
receptor activation of various second messenger pathways),
the use of microphysiometric measurements of cell
metabolism can in principle provide a generic assay of
cellular activity arising from the activation of any
receptor regardless of the specifics of the receptor's
proximal signaling pathway.
General guidelines for cell preparation and
microphysiometric recording have been previously reported
(Salon, J.A. and Owicki, J.A., 1996). A typical protocol
employing transiently transfected CHO cells is as follows;
24 hours prior to recording, transfected cells are
harvested and counted. 3 x 10' cells are seeded into cell
culture capsules (Costar), and allowed to attach to the
capsule membrane. 10 hours later (14 hours prior to
recording) the cell media is switched to serum free F-12
complete to minimize ill-defined metabolic stimulation
caused by assorted serum factors.
On the day of the experiment the cell capsules are
transferred to the microphysiometer (Cytosensor, Molecular
Devices Corporation, Sunnyvale, CA) and allowed to
equilibrate in recording media (low buffered RPMI 1640, no
bicarbonate, no serum) with O.lo BSA (essentially fatty
acid free), during which a baseline measurement of basal
metabolic activity is established. The recording paradigm
consists of a 100 ul/min flow rate, with a 2 min pump
cycle which includes a 30 sec flow interruption during
which the rate measurement is taken. Challenges involve
a 1 min 20 sec exposure to a drug just prior to the first
post challenge rate measurement being taken, followed by
two additional pump cycles for a total of 5 min 20 sec
drug exposure. Drug is then washed out and rates allowed
to return to basal. Reported extracellular acidification
rates are expressed as a percentage increase of the peak
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-128-
response over the baseline rate observed just prior to
challenge.
GPCR ligand librar~r
Functional assays of new receptors such as MCH1 may
include a preliminary test of a small library of compounds
containing representative~agonists for all known GPCRs as
well as other oompounds which may be agonists for
prospective GPCRs or which may be effectors for targets
peripherally involved with GPCRs. The collection used in
this study comprises approximately 180 compounds
(including small molecules, hormones, preprohormones,
peptides, etc.) for more than 45 described classes of
GPCRs (serotonin, dopamine, noradrenaline, opioids, etc.)
and additionally includes ligands for known or suspected
but not necessarily pharmacological characterized or
cloned GPCR families (such as MCH).
The diversity of the library can be expanded to include
agonist and antagonist compounds specific for GPCR
subtypes, combinatorial peptide and/or small molecule
libraries, natural product collections, and the like. To
facilitate robotic handling, the substances are
distributed as either separate or pooled compound
concentrates in 96 well plates and stored frozen as ready
to use reagent plates.
Localization of mRNA coding for human MCH1 receptors
Development of probes for MCH1: To facilitate the
production of radiolabeled, antisense RNA probes a
fragment of the gene encoding rat MCH1 will be subcloned
into a plasmid vector containing RNA polymerase promoter
sites. The full length cDNA encoding the rat MCHl will be
digested with Pst 1, (nucleotides 905-1194) and this 289
nucleotide fragment will be cloned into the Pst I site of
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-129-
pGEM 3z, containing both sp6 and T7 RNA polymerase
promoter sites. The construct will be sequencE~d to
confirm sequence identity and orientation. To synthesize
antisense strands of RNA, this construct will be
linearized with Hind III or Eco RI (depending on
orientation) and T7 or sp6 RNA polymerase will be used to
incorporate radiolabeled nucleotide as described below.
A probe coding for the rat glyceraldehyde 3-phosphate
dehydrogenase (GAPDH) gene, a constitutively expressed
protein, was used concurrently. GAPDH is expressed at a
relatively constant level in most tissue and its detection
is used to compare expression levels of the rat MCH1
receptors gene in different regions.
Synthesis of probes: MCH1 and GAPDH cDNA sequences
preceded by phage polymerase promoter sequences will be
used to synthesize radiolabeled riboprobes. Conditions
for the synthesis of riboprobes will be: 0.25-1.0 ~g
linearized DNA plasmid template, 1.5 u1 of ATP, GTP, UTP
(10 mM each), 3 u1 dithiothreitol (0.1 M), 30 units RNAsin
RNAse inhibitor, 0.5-1.0 ~1 (15-20 units/~1) RNA
polymerase, 7.0 u1 transcription buffer (Promega Corp.),
and 12.5 ~1 cx3'P-CTP (specific activity 3,OOOCi/mmol). 0.1
mM CTP (0.02-1.0 u1) will be added to the reactions, and
the volume will be adjusted to 35 ,u1 with DEPC-treated
water. Labeling reactions will be incubated at 37°C for
60 min, after which 3 units of RQ1 RNAse-free DNAse
(Promega Corp.) will be added to digest the template.
Riboprobes will be separated from unincorpcrated
nucleotides using Microspin S-300 columns (Pharmacia
Biotech). TCA precipitation and liquid scintillation
spectrometry will be used to measure the amount of label
incorporated into the probe. A fraction of all riboprobes
synthesized will be size-fractionated on 0.25 mm thick 7M
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-130-
urea, 4.5o acrylamide sequencing gels. These gels will be
apposed to storage phosphor screens and the resulting
autoradiograph scanned using a phoshorimager (Molecular
Dynamics, Sunnyvale, CA) to confirm that the probes
synthesized were full-length and not degraded.
Solution hybridization/ribonuclease protection assay
(RPA): For solution hybridization 2.0 ug of mRNA isolated
from tissues will be used. Negative controls consisted of
30 ug transfer RNA (tRNA) or no tissue blanks. All mRNA
samples will be placed in 1.5-ml microfuge tubes and
vacuum dried. Hybridization buffer (40 u1 of 400 mM NaCl,
mM Tris, pH 6.4, 2 mM EDTA, in 80% formamide)
containing 0.25-2.0 Ebcounts of each probe will be added
15 to each tube. Samples will be heated at 95°C for 15 min,
after which the temperature will be lowered to 55°C for
hybridization.
After hybridization for 14-18 hr, the RNA/probe mixtures
20 will be digested with RNAse A (Sigma) and RNAse T1 (Life
Technologies). A mixture of 2.0 ug RNAse A and 1000 units
of RNAse T1 in a buffer containing 330 mM NaCl, 10 mM Tris
(pH 8.0) and 5 mM EDTA (400 u1) will be added to each
sample and incubated for 90 min at room temperature.
After digestion with RNAses, 20 ~l of 10o SDS and 50 ug
proteinase K will be added to each tube and incubated at
37°C for 15 min. Samples will be extracted with
phenol/chloroform:isoamyl, alcohol and precipitated in 2
volumes of ethanol for 1 hr at -70°C. Pellet Paint
(Novagen) will be added to each tube (2.0 ug) as a carrier
to facilitate precipitation. Following precipitation,
samples will be centrifuged, washed with cold 70o ethanol,
and vacuum dried. Samples will be dissolved in formamide
loading buffer and size-fractionated on a urea/acrylamide
sequencing gel (7.0 M urea, 4.5o acrylamide in Tris-
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-131-
borate-EDTA). Gels will be dried and apposed to storage
phosphor screens and scanned using a phosphorimager
(Molecular Dynamics, Sunnyvale, CA).
RT-PCR: For the detection of RNA encoding human MCH1, RT-
PCR was carried out on mRNA extracted from human tissue.
Reverse transcription and PCR reactions were carried out
in 50 ml volumes using EZrTth DNA polymerase (Perkin
Elmer). Primers with the following sequences were used:
Forward primer (RA SLCla /MCH F); TCA GCT CGG TTG TGG
GAG CA ( S E Q I D NO : ,14 )
Reverse primer (RA/SLCIa MCH B); CTT GGA CTT CTT CAC
GAC (SEQ ID NO: 15)
These primers will amplify a 248 base pair fragment from
nucleotide 169 to 417.
Each reaction contained 0.1 ug mRNA and 0.3uM of each
primer. Concentrations of reagents in each reaction were:
300 ~M each of GTP; dATP; dCTP; dTTP; 2.5mM Mn(OAc)2; 50
mM Bicine; 1I5 mM potassium acetate, 8o glycerol and 5
units EZrTth DNA polymerase. All reagents for PCR (except
mRNA and oligonucleotide primers) were obtained from
Perkin Elmer. Reactions were carried out under the
following conditions: 65°C 60 min., 94°C 2 min., (94°C, 1
min., 65°C 1 min) 35 cycles, 72°C 10 min. PCR reactions
were size fractionated by gel electrophoresis using 100
polyacrylamide. DNA was stained with SYBR Green I
(Molecular Probes, Eugene OR) and scanned on a Molecular
Dynamics (Sunnyvale CA) Storm 860 in blue fluorescence
mode at 450 nM.
Positive controls for PCR reactions consisted of
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-132-
amplification of the target sequence from a plasmid
construct, as well as reverse transcribing and amplifying
a known sequence. Negative controls consisted of mRNA
blanks, as well as primer and mRNA blanks. To confirm
that the mRNA was not contaminated with genomic DNA,
samples were digested with RNAses before reverse
transcription. Integrity of RNA was assessed by
amplification of mRNA coding for GAPDH.
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-133-
Receptor Audioradiographic Experiments hocalizing the MCHl
Receptor in the rat CNS
Animals
Male Sprague-Dawley rats (Charles Rivers, Rochester, NY)
were euthanized using CO., and decapitated and their brains
rapidly removed and frozen on crushed dry ice. Coronal
sections were cut at 20um using a cryostat and thaw
mounted onto gelatin-coated slides then stored at -20~'C
until use.
Radioliaand Binding Studies
In radioligand binding assays [~H]Compound 10 (specific
activity 56 Ci/mmol (NEN, Boston, MA) was used at 0.1 nM.
Dopamine, prazosin, and phenanthroline were obtained from
Sigma (St. Louis, MO). Phenylmethylsulfonyl Fluoride
(PMSF) was from Calbiochem (La Jolla, CA).
In vitro autoradioaraph~
Tissue sections were allowed to equilibrate to room
temperature for one hour. Sections were incubated at 25°C
for 1.5 hours in 50 mM Tris-HCl buffer, pH 7.4, containing
10 mM MgCl~, 0.16 mM PMSF, 0.3 mM phenanthroline, 0.2%
bovine serum albumin ~(Boehringer Mannheim, Indianapolis,
IN), 100 ,uM dopamine, 1 j~M prazosin, and 0.01 nM
[~H]Compound 10. Nonspecific binding was determined by
including 10 ,uM unlabeled Compound 10 in the incubation
buffer. Following incubation the sections were washed
twice for 5 minutes each in 4"C 50 mM Tris-buffer, pH 7.4,
then rapidly dipped in ice-cold distilled water to remove
the salts. Tissues were dried under a stream of cold air
and apposed together with 'H-plastic standard scales, to
Hyperfilm-3H (Amersham, Piscataway, NJ) for 6 weeks. Films
were developed using a Kodak developer-D19 and Rapid fixer
(Kodak, Rochester, NY) . Specific [3H] Compound 10 binding
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-134-
to the MCH1 receptor was interpreted by observation of the
remaining optical density on the autoradiogram in the
various regions of rat brain in the presence of the
appropriate displacers.
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-135-
Chemical Synthetic Methods
General Methods: All reactions (except for those done by
parallel synthesis reaction arrays) were performed under
an Argon atmosphere and the reagents, neat or in
appropriate solvents, were transferred to the reaction
vessel via syringe and cannula techniques. The parallel
synthesis reaction arrays were performed in vials (without
an inert atmosphere) using J-KEM heating shakers (Saint
Louis, MO). Anhydrous solvents were purchased from
Aldrich Chemical Company and used as received. The
examples described in the patent (1-37) were named using
ACD/Name program (version 2.51, Advanced Chemistry
Development Inc., Toronto, Ontario, M5H2L3, Canada).
Unless otherwise noted, the 1H and 13C NMR spectra were
recorded at 300 and 75 MHz (QE Plus) with CDC13 as solvent
and tetramethylsilane as internal standard. s = singlet;
d = doublet; t = triplet; q = quartet; p = pentet; sextet;
septet; br - broad; m - multiplet. Elemental analyses
were performed by Robertson Microlit Laboratories, Inc.
Unless otherwise noted, mass spectra were obtained using
low-resolution electrospray (ESMS) and MH+ is reported.
Thin-layer chromatography (TLC) was carried out on glass
plates precoated with silica gel 60 F254 (0.25 mm, EM
Separations Tech.). Preparative thin-layer chromatography
was carried out on glass sheets precoated with silica gel
GF (2 mm, Analtech). Flash column chromatography was
performed on Merck silica gel 60 (230 - 400 mesh).
Melting points (mp) were determined in open capillary
tubes on a Mel-Temp apparatus and are uncorrected.
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-136-
Procedures for the Synthesis of the Dihydropyrimidine
Intermediates
5-METHOXYCARBONYL-4-METHOXYMETHYL-1,2,3,6-TETRAHYDRO-2-
OXO-6- (3,4-DIFLUOROPHENYL)-PYRIMIDINE: To a stirring
mixture of methyl 4-methoxyacetoacetate (50.0 g, 0.342
mol), 3,4-difluorobenz-aldehyde (51.4 g, 0.362 mol), and
urea (31.6 g, 0.527 mole) in THF (300 mL) at room
temperature were added copper(I) oxide (5.06 g, 0.035
mole) and acetic acid (2.05 mL), sequentially, followed by
dropwise addition of boron trifluoride diethyl etherate
(56.0 mL, 0.442 mole). The mixture was stirred and
refluxed for 8 h, whereupon TLC (1/1 EtOAc/hexanes)
analysis indicated completion of the reaction. The
reaction mixture was cooled and poured into a mixture of
ice and sodium bicarbonate (100 g) and the resulting
mixture was filtered through Celite. The Celite pad was
washed with dichloromethane (400 mL). The organic layer
was separated from the filtrate and the aqueous layer was
extracted with more dichloromethane (3 X 300 mL). The
combined organic extracts were dried (sodium sulfate) and
the solvent evaporated. The crude product was purified by
flash column (ethyl acetate/hexanes, 111; then ethyl
acetate), giving the product as pale yellow foam, which on
trituration with hexane became white powder (103 g, 97a).
H NMR d 3.48 (s, 3H), 3.65 (s, 3H), 4.65 (s, 2H), 5.39 (s,
1H), 6.60 (br s, 1H, NH), 7.00 - 7.20 (m, 3H), 7.72 (br s,
1H, NH) .
(+)-5-METHOXYCARBONYL-4-METHOXYMETHYL-1,2,3,6-TETRAHYDRO
-2- OXO-6-(3,4-DIFLUOROPHENYL)-PYRIMIDINE: The racemic
i n t a r m a d i a t a
5-methoxycarbonyl-4-methoxymethyl-1,2,3,6-tetrahydro-2-o
xo-6- (3,4-difluorophenyl)pyrimidine was resolved by
chiral HPLC [Chiralcel OD 20 X 250 mm #369-703-30604;
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-137-
lambda 254 nm; hexanes/ethanol 90/10; 85 mg per injection;
retention time of the desired enantiomer: 16.94 min., the
first enantiomer peak to elute], giving
(+)-5-methoxycarbonyl-4-methoxymetilyl-
1,2,3,6-tetrahydro-2oxo-6-(3,4-difluorophenyl)-pyrimidine
(40-42 wto isolation of the desired enantiomer from the
racemate); [a]L, - + 83.8 (c - 0.5, chloroform). The
(-)-isomer was also isolated as the later eluting fraction
from the chiral chromatography column.
(+)-5-METHOXYCARBONYL-4-METHOXYMETHYL-1,2,3,6-TETRAHYDRO
2 - O X O -
6-(3,4-DIFLUOROPHENYL)-1-[(4-NITROPHENYLOXY)CARBONYL]PYR
I M I D I N E : T o a s o 1 a t i o n o f
(+)-5-methoxycarbonyl-4-methoxymethyl-1,2,3,6
tetrahydro-2-oxo-6-(3,4- difluorophenyl)-pyrimidine (1.98
g, 6.34 mmol) in anhydrous THF (20 mL) at -78 °C under
argon atmosphere, a solution of lithium
hexamethyldisilazide in THF (1M, 18.0 mL, 18.0 mmol) was
added over 2-3 min. and the mixture was stirred for l0
min. This solution was added over 6 min., via a cannula,
to a stirred solution of 4-nitrophenyl chloroformate (4.47
g, 22.2 mmol) in THF (20 mL) at -78 °C. Stirring was
continued for 10 min. and the mixture was poured onto ice
(50 g) and extracted with chloroform (2 X 50 mL). The
combined extracts were dried (sodium sulfate) and the
solvent was evaporated. The residue was purified by flash
column chromatography (hexanes/ethyl acetate, 4/1 to
3.5/1) as the eluent. The product was obtained as yellow
syrup which upon trituration with hexanes became a white
powder (2.40 g, 790): '-H NMR d 3.52 (s, 3H), 3.74 (s, 3H),
4.65-4.80 (q, J=16.5 Hz, 2H), 6.32 (s, 2H), 7.10-7.30 (m,
4H), 7.36 (d, J=9 Hz, 2H), 8.27 (d, J=9 Hz, 2H).
BENZYL 3-[(3,4-DIFLUOROPHENYL)METHYLENE]-4-OXOPENTANOATE:
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-138-
A solution of benzyl propionylacetate (36.3 g, 176 mmol),
3,4- difluorobenzaldehyde. (25.0 g, 176 mmol), piperidine
(0.86 mL, 9.0 mmol) and acetic acid (0.49 mL, 9.0 mmol)
was refluxed with removal of water using a Dean-Stark
apparatus for 5 h. The solvent was removed in vacuo and
the residue was dissolved in EtOAc. The reaction mixture
was washed with water (100 mL), followed by brine (100 mL)
and dried over anhydrous Na~S04. The solvent was
evaporated, giving a pale yellow syrup (60.2 g). The
product was used in the next step without further
purification.
5-(BENZYLOXYCARBONYL)-1,6-DIHYDRO-2-METHOXY-4-ETHYL-~-(3
,4-DI-FLUOROPHENYL)PYRIMIDINE: A suspension of benzyl
3-[(3,4-di-fluorophenyl)methylene]-4-oxopentanoate (16,0
g, 48.0 mmol), O-methylisourea hydrogen sulfate (16,7 g,
97.0 mmol) and NaHC03 (16.3 g, 130 mmol) in DMF (190 mL)
was stirred at 70 °C for 20 h. After cooling to room
temperature, the mixture was filtered and the filtrate was
.20 diluted with EtOAc (300 mL) and then washed with water
(4X100 mL) , brine (200 mL) and dried over Na~SOq, After
removal of solvent, the residue was purified by column
chromatography (EtOAc/Hexane, 1/9 to 3/7), giving the
title compound as a colorless oil (10.6 g, 58%). The NMR
analysis showed it to be a mixture of amine/imine
tautomers and was used as is in the next step.
5-(BENZYLOXYCARBONYL)-4-ETHYL-1,6-DIHYDRO-2-METHOXY-6-(3
4 - D I -
FLUOROPHENYL)-1-[(4-NITROPHENYLOXY)CARBONYL]PYRIMIDINE:
T o a s t i r r i n g s o 1 a t i o n o f
5 - ( b a n z y 1 o x y c a r b o n y 1 ) - 1 , 6 - d i h y d r o - 2 -
methoxy-4-ethyl-6-(3,4-difluorophenyl)pyrimidine (17.0 g,
44.0 mmol) and 4-dimethylaminopyridine (7.00 g, 57.3 mmo1)
in CH.~C1~ (200 mL) was added 4-nitrophenyl chloroformate as
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-139-
a powder (11.5 g, 57.1 mmol) at room temperature. The
reaction mixture was stirred for 12 h and then the solvent
was removed in vacuo. The residue was purified by
chromatography (EtOAc/Hexane, 1/9 to 3/7), giving
5-(benzyloxycarbonyl)-4-ethyl-1,6-dihydro-2-
methoxy-6-(3,4-difluorophenyl)-1-[(4-nitrophenyloxy)carb
onyl]pyr-imidine as a colorless viscous oil (12.6 g, 50~).
=H NMR d 1 .24 (t, J=7 .2 Hz, 3H) , 2 , 81-2 . 98 (m, 3H) , 3 . 97
(s, 3H), 5.14 (ABq, A=5.08, B= 5.20, J= 12.3 Hz, 2H),
6.28 (s, 3H) , 7 .03-7 .29 (m, 8H) , 7 .35 (d, J=9.2 Hz, 2H) ,
8.26 (d, J=9.2 Hz, 2H).
5-(BENZYLOXYCARBONYL)-4-ETHYL-1,6-DIHYDRO-1-{N-[1-PHENYL
E T H Y L ] } -
CARBOXAMIDO-2-METHOXY-6-(3,4-DIFLUOROPHENYL)PYRIMIDINE:
T o a s t i r r a d m i x t a r a o f
5-(benzyloxycarbonyl)-4-ethyl-1,6-dihydro-2-
methoxy-6-(3,4-difluorophenyl)-1-[(4-nitrophenyloxy)carb
onyl]pyr-imidine (12.6 g, 22.9 mmol) in THF (150 mL) was
added a solution of R-(+)'-a-methyl benzylamine (3.53 mL,
27.1 mmol) at room temperature. The stirring was
continued for 12 h and the solvent was removed in vacuo.
The yellow residue was dissolved in chloroform (200 mL)
and was washed with 10o K.~CO, solution (2x30 mL). The
organic layer was dried over Na~SOq, filtered and sclvent
was removed in vacuo. The resulting mixture of
diastereomers was separated by column chromatography
(petroleum ether/ether, 9/1 to 4/1). The first major
p r o d a c t t o a 1 a t a w a s
(+)-5-(benzyloxycarbonyl)-4-ethyl-1,6-dihydro-1-{N-[1-
p h a n y 1 ) -
ethyl]}carboxamido-2-methoxy-6-(3,4-difluorophenyl)pyrim
idine. Colorless oil; Rf= 0.31 (petroleum ether/ether,
4/1) ; yield: 3.8 g (310) ; [a,]L, _ +267.05 (c = 0.76, CHC1,) ;
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-140-
-H NMR d 1.22 (t, J=7 .5 Hz, 3H) , 1.52 (d, J=6. 9 Hz, 3H) ,
2.88 (q, J=6.0 Hz, 2H) , 3. 99 (s, 3H) , 4.99 (m, 1H) , 5.09
(ABq, A=5.00, B= 5.19, J= 12.6 Hz, 2H), 6.66 (s, 1H),
6.99-7.36 (m, 13H). The second major product to elute was
(-)-5-(benzyloxycarbonyl)-4-ethyl-1,~-dihydro-1-{N-
[2-phenyl)ethyl]}carboxamido-2-methoxy-6-(3,4-difluoroph
enyl)pyr-imidine. Colorless oil; Rf= 0.22 (petroleum
ether/ether, 4/1); yield: 3.20 g (260); [a]P = -146.89 (c
- 0.38, CHC13 ) ; 1H NMR b 1.22 (t, J=7.2 Hz, 3H) , 1.49
(d, J=6.6 Hz, 3H),2.88 (q, J=6.0 Hz, 2H), 3.94 (s, 3H),
5. 03 (m, 1H) , 5.11 (ABq, A=5. 02, B= 5.19, J= 12. 6 I-Iz,
2H) , 6. 68 (s, 1H) , 6.91-7.34 (m, 13H) .
(+)-5-(BENZYLOXYCARBONYL)-1,6-DIHYDRO-2-METHOXY-4-ETHYL-
l5 6-(3,4-DI-FLUOROPHENYL)PYRIMIDINE: To a stirred solution
o f ( + ) - 5 - ( b a n z -
yloxycarbonyl)-4-ethyl-1,6-dihydro-1-{N-[2-phenyl)ethyl]
}carbox-amido-2-methoxy-6-(3,4-difluorophenyl)pyrimidine
(1.00 g, 1.83 mmol) in toluene (10 mL) was added
1,8-diazabicyclo[5,4,0]-undec- 7-ene (0.120 mL, 0.810
mmol) at room temperature and the resulting solution was
heated at reflux temperature for 5 h and then stirred for
12 h at room temperature.. The solvent was evaporated and
the residue was purified by flash column (EtOAc/Hexanes,
1/3), giving (+)-5-(benzyloxycarbonyl)-1,6-
d i h y d r o - 2 - m a t h o x y - 4 - a t h y 1 - 6 -
(3,4-difluorophenyl)pyrimidine (0.560 g, 770).
(+)-5-(BENZYLOXYCARBONYL)-4-ETHYL-1,6-DIHYDRO-2-METHOXY-
6 - ( 3 , 4 - D I -
FLUOROPHENYL)-1-[(4-NITROPHENYLOXY)CARBONYL]PYRIMIDINE:
T o a s t i r r i n g s o 1 a t i o n o f
(+)-5-(benzyloxycarbonyl)-1,6-dihydro-2-
methoxy-4-ethyl-6-(3,4-difluorophen-yl)pyrimidine (17.0 g,
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-141-
44.0 mmol) and 4-dimethylaminopyridine (6.99 g, 57.3 mmol)
in CH.,Cl~ (200 mL) was added 4-nitrophenyl chloroformate
(11.6 g, 57.3 mmol) at room temperature. The reaction
mixture was stirred for 12 h and then the solvent was
removed in vacuo. The residue was purified by
chromatography (EtOAc/Hexane, 1/9 to 3/7), giving
(+)-5-(benzyloxycarbonyl)-4-ethyl-1,6-dihydro-2-methoxy-
6-(3,4- difluorophenyl)-1-[(4-nitrophenyloxy)
carbonyl]pyrimidine as .a viscous colorless oil (19.3 g,
760) .
5-METHYLBENZFUROXAN: 4-Methyl-2-nitroaniline (100 g,
0.650 mol) was suspended, in saturated methanolic sodium
hydroxide solution (1.50 L). This suspension was cooled
(5 'C) and aqueous sodium hypochlorite until the red color
disappeared. The resulting fluffy yellow precipitate was
filtered, washed with cold water and recrystallized from
ethanol, giving 5-methylbenzfuroxan (88.2 g, 89 % yield)
as a pale yellow solid: iH NMR d 2.39 (s, 3 H), 6.90-7.40
(br m. 3 H) .
5-METHYLBENZOFURAZAN: To 5-Methylbenzfuroxan (88.2 g,
0.590 mol) in refluxing EtOH (75 mL) was added dropwise
P(OEt)~ (150 mL). Heating was continued at reflux
temperature for 1 h. The solvent was removed in vacuo and
the residue was shaken with water (200 mL) and allowed to
stand overnight at (0-5 °C).. The resulting brown solid was
filtered, washed with water. The crude product was
purified by flash chromatography, giving
5-methylbenzofurazan (70.0 g, 87 0) as white needles; 1H
NMR c~ 2.41 (s, 1 H) , 7.19 (dd, J=9.3, 1.1 Hz, 1 H) , 7 .48
(d, J=1.1 Hz, 1 H), 7.66 (d, J=9.3 Hz, 1 H).
5-DIBROMOMETHYLBENZOFURAZAN: An anhydrous solution of
5-methylbenzofurazan (70.0 g, 0.520 mol),
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-142-
N-bromosuccinamide (325 g), and benzoyl peroxide (0.50 g)
in carbon tetrachloride (1.5 L) was heated at reflux
temperature with stirring for 30 h. The reaction mixture
was washed with water (2 X 500 mL), dried (NaS09), and the
solvent was removed in vacuo. The residue was
chromatograghed (EtOAc/hexane, 1/150), giving 122 g (800)
of the title compound as a white solid: 1H NMR d 6.69 (s,
1 H), 7.69 (d, J=9.6 Hz, 1 H), 7.77 (s, 1 H), 7.89 (d,
J=9. 6 Hz, 1 H) .
5-FORMYLBENZOFURAZAN: AgNO; (163 g) in 2 L of water was
added to a refluxing mixture of dibromomethylbenzofurazan
(122 g, 418 mmol) in EtOH (1 L). Heating at reflux
temperature was continued for 2 h. The mixture was
cooled, the precipitated Agar was removed by filtration
through Celite, and the solvent was concentrated. The
resulting solution was extracted with toluene (10 X 100
mL), dried over magnesium sulfate, and the solvent was
removed in vacuo. The residue was chromatograghed
(EtOAc/hexane, 1/125), giving the title aldehyde (48.2 g,
78 ~ ) as a white solid: 1H NMR cS 7. 92 (m, 2H) , 8 . 39 (s, 1
H) , 10.10 (s, 1 H) .
METHYL 2-{(BENZOFURAN-5-YL)METHYLENE}-3-OXOBUTYRATE: A
mixture of 5-formylbenzofurazan (0.60 g, 4.1 mmol), methyl
acetoacetate (0.52 g, 4.5 mmol), piperidine (0.019 g, 0.23
mmol), and acetic acid (0.014 g, 0.23 mmol) in benzene (30
mL) was heated at reflux temperature (equipped with a
Dean-Stark trap) for 8 h. Benzene was evaporated in
30. vacuo, the residue was dissolved .in ethyl acetate (80 mL)
and washed with brine (50 mL), saturated potassium
bisulfate solution (50 mL), and saturated sodium
bicarbonate solution. The ethyl acetate solution was
dried over magnesium sulfate, the solvent removed under
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-143-
reduced pressure and the residue was purified by column
chromatography (EtOAc/hexane, 1/9 to 3/20). The desired
product was obtained as oil (0.98 g, 980) and was used in
the next step without any further characterization.
6-(BENZOFURAZAN-5-YL)-1,6-DIHYDRO-2-METHOXY-5-METHOXYCAR
BONYL-4- METHYLPYRIMIDINE: A mixture of methyl
2-{(benzofuran-5-yl)-methylene}-3-oxobutyrate (1.02 g,
4.10 mmol), O-methylisourea hydrogen sulfate (1.06 g, 6.20
mmol) , and NaHCO~ (1.30 g, 16.4 mmol) in DMF (15 mL) was
stirred and heated at 70 ~'C for 16 h. The mixture was
cooled, diluted with EtOAc (50 mL) and washed with water
(5X 50 mL), brine (50 mL) and dried over magnesium
sulfate. The solvent was evaporated and the crude product
was purified by flash chromatography (EtOAc/hexane, 1/9 to
1/5), giving the desired product as an oil (0.520 g, 430):
-HNMR ~ 2.38 and 2.42 (2 s, 3 H), 3.60 and 3.66 (2 s, 3 H),
3.74 and 3.82 (2 s, 3 H), 5.53 and 5.68 (2 s, 1 H), 6.31
and 6.32 (br s, 1 H), 7.0-7.8 (m, 3 H).
6-(BENZOFURAZAN-5-YL)-1,6-DTHYDRO-2-METHOXY-5-METHOXYCAR
BONYL-4- METHYL-1-[(4-NITROPHENYLOXY)CARBONYL]PYRIMIDINE:
T o a s o 1 a t i o n o f
6-(benzofuran-5-yl)-1,6-dihydro-2-methoxy
-5-methoxycarbonyl-4- methylpyrimidine (0.485 g, 1.6 mmol)
and 4-dimethylaminopyridine (0.200 g, 1.64 mmol) in CH_C1
(20 mL) at 0-5 °C was added 4-nitrophenyl chloroformate
(0.307 g, 1.52 mmol). The mixture was then allowed to
warm to room temperature. After 12 h, the solvent was
evaporated and the residue was purified by flash
chromatography (EtOAc/hexane, 1/9 to 3/20), giving the
desired product as white crystals (0.665 g, 890); mp
180-183 °C; 1H NMR 8 2.54 (s, 3 H) , 3.75 (s, 3 H) , 3. 98 (s,
3 H), 6.37 (s, 1 H), 7.40 (d, J=9.3 Hz, 2 H), 7._52 (d,
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-144-
J=9.0 Hz, 1 H) , 7. 68 (s, 1 H) , 7.84 (d, J=9.0 Hz, l H) ,
8.32 (d, J=9.3 Hz, 2 H).
(+) and (-)-6-(BENZOFURAZAN-5-YL)-1,6-DIHYDRO-2-METHOXY-5-
METHOXYCARBONYL-1-[N-(S)-1-(1-PHENYLETHYL)]-4-METHYLPYRI
MIDINE: A solution of 6-(benzofurazan-5-
yl)-1,6-dihydro-2-methoxy-5- methoxycarbonyl-4-methyl
-1-(4-nitrophenoxy)carbonylpyrimidine (800 mg, 1.71 mmol)
- and (S)-(-)-a-methylbenzylamine (269 mg, 2.22 mmol) in THF
l0 (50 mL) was stirred at room temperature for 12 h. The THF
was removed in vacuo and the residue was dissolved in
EtOAc (100 mL), washed by loo aqueous K~C03 solution (3x50
mL) , brine (50 mL) and dried (Na.,SO~) . After removal of
the solvent, the residue was purified by chromatography
(EtOAc/hexane, 1120 to 3/20), separating the two
diastereomers. The isomers of
6-(benzofurazan-5-yl)-1,6-dihydro-
2-methoxy-5-methoxycarbonyl-1-[N-(S)-1-(1-phenylethyl)]-
4-methylpyrimidine were obtained as colorless oils. 1st
~0 Isomer (367 mg, 47.70) : [a]j = +278 (c=0.50, CHCl,j); 1H NMR
b' 1.54 (d, J=6.9 Hz, 3H) , 2. 45 (s, 3H) , 3. 68 (s, 3H) , 3. 99
(s, 3H), 5.02 (quintet, J=6.9 Hz, 1H), 6.71 (s, 1H), 6.89
(d, J=6. 6 Hz, 1H) , 7 .2-7 . 9 (m, 8H) . 2nd Isomer (205 mg,
2 6 . 6 a ) : [a] L, =-81 ( c=0 . 43, CHC1 ,) ; 1H NMR 8 l . 52 ( d, J=6 . 6
Hz, 3H), 2.48 (s, 3H), 3.71 (s, 3H), 3.96 (s, 3H), 5.00
(quintet, J=6.6 Hz, 2H), 6.74 (s, 1H), 6.90 (d, J=6.5 Hz,
1H), 7.2-7.9 (m, 8H).
6-(BENZOFURAZAN-5-YL)-1,6-DIHYDRO-2-METHOXY-5-METHOXYCAR
BONYL-4- METHYLPYRIMIDNE: A solution of the 1st isomer of
6-(benzofura-zan-5-yl)-1,6-dihydro-2-methoxy-
5-methoxycarbon-yl-1-[N-(S)-1-(1-phenylethyl)]-4-methylp
yrimidine (960 mg, 2.14 mmol) and
1,8-diazabicyclo[5,4,0]under-7-ene (107 mg, 0.705 mmol) in
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-145-
toluene (50 mL) was stirred at 100 °C for 5 h. After
cooling to room temperature, toluene was removed in vacuo
and the residue was purified by chromatography
(EtOAc/hexane, 1/9 to 3/7). 6-(Benzofurazan-5
yl)-1,6-dihydro-2-methoxy
5-methoxycarbonyl- 4-methylpyrimidine was obtained as a
colorless oil (635 mg, 98.30). 1H NMR82.38 (s, 3H), 3.66
(s, 3H), 3.74 (s, 3H), 5.68 (s, 1H), 6.32 (br s, 1H),
7.0-7.8 (m, 3H) .
6-(BENZOFURAZAN-5-YL)-1,6-DIHYDRO-2-METHOXY-5-METHOXYCAR
BONYL-4-METHYL-1-(4-NITROPHENOXY)CARBONYLPYRIMIDINE: To
a solution of 6-(benzofuran-5-yl)-1,6-dihydro-2-methoxy-
5-methoxycarbonyl- 4-methylpyrimidine (0.485 g, 1.60 mmol)
and 4-dimethylamino-pyridine (0.200 g, 1.60 mmol) in CH~C1
(20 mL), at 0-5 °C, was added 4-nitrophenyl chloroformate
(0.307 g, 1.52 mmol). After addition, the mixture was
allowed to warm to zoom temperature. After 12 hours, the
solvent was evaporated and the residue was purified by
flash column chromatography (EtOAc/hexane, 1/9 to 3/20),
giving the desired product as white crystals (0.665 g,
890) : mp 180-183 °C; 1H NMR82.54 (s, 3 H), 3.75 (s, 3 H),
3. 98 (s, 3 H) , 6.37 (s, 1 H) , 7 .40 (d, J = 9.3 Hz, 2 H) ,
7.52 (d, J = 9.0 Hz, 1 H), 7.68 (s, 1 H), 7.84 (d, J = 9.0
Hz, 1 H), 8.32 (d, J = 9.3 Hz, 2 H); [a]p = +266 (c=2.70,
CH~C1~) .
METHYL 2-{(3,4-DIFLUOROPHENYL)METHYLENE}-3-OXOBUTYRATE:
A mixture of 3,4-difluorobenzaldehyde (14.2 g, 0.100 mol),
methyl acetoacetate (12.2 g, 0.105 mol), piperidine (0.430
g, 5 mmol), and acetic acid (0.30 g, 5 mmol) in benzene
(150 mL) was stirred and heated at reflux temperature
(equipped with a Dean-Stark trap) for 8 h. The benzene
was evaporated and the residue was dissolved in ethyl
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-146-
acetate (200 mL). The resulting solution was washed with
brine (50 mL), saturated potassium bisulfate solution (50
mL), and saturated sodium bicarbonate solution. The ethyl
acetate solution was dried over magnesium sulfate and the
. solvent was removed under reduced pressure. The residue
was purified by column chromatography (EtOAc/hexane, 1/9
to 3/20), giving the desired product as a yellow oil (9.80
g, 410) which was used in the subsequent step without any
further characterization.
6-(3,4-DIFLUOROPHENYL)-l,~-DIHYDRO-2-METHOXY-5-METHOXYCA
RBONYL-4-METHYLPYRIMIDINE: A mixture of methyl
2-{(3,4-difluorophenyl)-methylene}-3-oxobutyrate (8.80 g,
36.3 mmol), 0-methylisourea hydrogen sulfate (9.40 g, 546
mmol), and NaHC03 (12.3 g, 146 mol) in DMF (30 mL) was
heated at 70 °C with stirring for 16 h. The mixture was
cooled, diluted with EtOAc (300 mL) and washed with water
(5 X 300 mL), brine (300 mL), and dried over magnesium
sulfate. The solvent was evaporated and the crude product
was purified by flash chromatography (EtOAc/hexane, 1/9 to
3/7) as the gradient eluent, giving the desired product as
an oil (3.82 g, 350).
6-(3,4-DIFLUOROPHENYL)-1,6-DIHYDRO-2-METHOXY-5-METHOXYCA
RBONYL-4-METHYL-1-[(4-NITROPHENYLOXY)CARBONYL]PYRIMIDINE:
4-Nitrophenyl chloroformate (1.82 g, 9.04 mmol) was added
t o a s o 1 a t i o n o f
6-(3,4-difluorophenyl)-1,6-dihydro-2-methoxy-
5-methoxycarbonyl-4-methylpyrimidine (2.82 g, 9.46 mmol)
and 4-dimethylaminopyridine (1.16 g, 9.52 mmol) in CH=C1.~
(50 mL), at 0-5 °C and the mixture was then allowed to warm
to room temperature. After 12 h, the solvent was
evaporated and the residue was purified by flash
chromatography (EtOAc/hexane, 1/9 to 3/20), giving the
desired product as white crystals (3.72, 85%): mp 172-174
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-147-
°C .
6-(3,4-DIFLUOROPHENYL)-1,2,3,6-TETRAHYDRO-2-OXO-5-METHOX
YCARBON-YL-4-METHYL-1-(4-NITROPHENOXY)CARBONYLPYRIMIDINE:
Aqueous 6 N hydrochloric acid (10 mL) was added to a
stirring solution of 6-(3,4-difluorophenyl)-1,6-
d i h y d r o - 2 - m a t h o x y - 5 - m a t h o x y c a r b o n y 1 -
4-methyl-1(4-nitrophenoxy)carbonylpyrimidine (10.0 g) in
THF (200 mL) at room temperature. The stirring was
continued for 3 h. The solvent was evaporated and the
residue was dried under vacuum, giving the desired product
as a white powder (9.70 g, 1000): mp 185-186 °C.
(+)-1-(3-BROMO-PROPYLCARBAMOYL)-6-(3,4-DIFLUOROPHENYL)-4
-METHYL- 2-OXO-1,6-DIHYDRO-PYRIMIDINE-5-CARBOXYLIC ACID
METHYL ESTER: A solution of 10o aqueous HCl (5 mL) was
added to a stirring solution of
(+)-6-(3,4-difluorophenyl)-1,6-dihydro- 2-methoxy-
5-methoxycarbonyl-4-methyl-1-
[(4-nitrophenyloxy)-carbonyl]pyrim-idine (4.10 g, 9.10
mmol) in THF (20 mL) at room temperature and the resulting
solution was stirred overnight. The THF was removed in
vacuo and the resulting residue was extracted with EtOAc
(3 X 20 mL), washed with brine (10 mL) and then dried over
Na-..SOS. The solvent was removed in vacuo, giving
(+)-6-(3,4-di-fluorophenyl)-1,6-dihydro-2-
o x o - 5 - m a t h o x y c a r b o n y 1 - 4 - m a t h y 1 - 1 -
[(4-nitrophenyloxy)carbonyl]pyrimidine as a viscous oil
(3.8 g, 8.5 mmol) . The oil was dissolved in THF (20 mL)
and 3-bromo-propylamine hydrobromide (2.33 g, 10.8 mmol)
and NaHC03 (1.81 g, 21.5 mmol) were added. The resulting
suspension was stirred at room temperature overnight. The
THF was removed in vacuo and the resulting residue was
dissolved in water (10 mL) and then extracted with EtOAc
(3 X 20 mL). The EtOAc extracts were combined, dried over
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-148-
Na.,S04, filtered and the solvent was removed , giving
(+)-1-(3-bromo-propylcarbamoyl)-6- (3,4-difluorophenyl)-
4-methyl-2-oxo-1,6-dihydropyrimidine-5-carboxylic acid
methyl ester (3.28 g, 830) : '-H NMR 8 2.05-2.15 (m, 2 H) ,
2.43 (s, 3 H), 3.40-3.56 (m, 4 H), 3.72 (s, 3 H), 6.69 (s,
1 H), 7.08-7.27 (m, 3 H), 7.57 (br s, 1 H), 8.84 (br t, 1
H) . Anal. Calcd for Cl,HlrN~O~ F~Br: C, 45.76; H, 4.07; N,
9.42. Found: C, 45.70; H, 3.99; N, 9.16.
3-{(3,4,5-TRIFLUOROPHENYL)METHYLENE}-2,4-PENTANEDIONE:
A stirring mixture of 3,4,5-trifluorobenzaldehyde (4.20 g,
26.2 mmol), 2,4-pentanedione (2.62 g, 26.2 mmol),
piperidine (0.430 g, 5.00 mmol) in benzene (150 mL) was
heated at reflux temperature (equipped with a Dean-Stark
trap) for 8 h. The benzene was evaporated and the yellow
o i 1 y r a s i d a a ,
2-{(3,4,5-trifluorophenyl)methylene}-2,4-pentanedione, was
used in the next step without further purification.
6-(3,4,5-TRIFLUOROPHENYL)-1,6-DIHYDRO-2-METHOXY-5-ACETYL
-4-METHYLPYRIMIDINE: A mixture of
2-{(3,4,5-trifluorophenyl)-
methylene}- 2,4-pentanedione (26.2 mmol), 0-methylisourea
hydrogen sulfate (3.22 g,. 39.3 mmol) , and NaHC03 (6. 6 g,
78.6 mmol) in EtOH (400 mL) was stirred and heated at
95-100 °C for 6 h. The mixture was filtered and the solid
residue was washed with ethanol (100 mL). The solvent was
evaporated from the combined filtrates and the crude
product was purified by flash column chromatography
(EtOAc/hexane, 1/9 to 1/4), giving the desired product as
an oil (2.80 g, 36%).
6-(3,4,5-TRIFLUOROPHENYL)-1,6-DIHYDRO-2-METHOXY-5-ACETYL
-4-METH-YL-1-[(4-NITROPHENYLOXY)CARBONYL~PYRIMIDINE:
4-Nitrophenyl chloroformate (1.89 g, 9.38 mmol) was added
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-149-
to a solution of 6-(3,4,5-trifluorophenyl)-1,6-dihydro-
2-methoxy-5-acetyl-4-meth-ylpyrimidine (2.80 g, 9.38 mmol)
and pyridine (10 mL) in CH~Cl~ (200 mL) at 0-5 °C, and the
resulting mixture was allowed to warm to room temperature.
After 12 h, the solvent was evaporated and the residue was
purified by flash chromatography (dichloro-methane/EtOAc,
1/9 to 3/20), giving the desired product as a white powder
(4.00 g, 920) .
6-(3,4,5-TRIFLUOROPHENYL)-1,2,3,6-TETRAHYDRO-2-0X0-5-ACE
TYL-4- METHYL-1-[(4-NITROPHENYLOXY)CARBONYL]PYRIMIDINE:
A solution of 6 N aqueous HC1 (4 mL) was added to a
s t i r r i n g s o 1 a t i o n o f 6 -
(3,4,5-trifluorophenyl)-1,6-dihydro-
2 - m a t h o x y - 5 - a c a t y 1 - 4 - m a t h y 1 -
1-[(4-nitrophenyloxy)carbonyl]
pyrimidine (4.00 g, 8.63 mmol) in THF (100 mL) at 0-5 "C,
and the mixture was allowed to warm to room temperature.
After 2 h, solvent was evaporated and the product dried
under vacuum. The product was obtained as a pure single
component and used in the next step without any further
purification (3.88 g, 1000).
Procedures for the Synthesis of the Piperidine
Intermediates
(reference for the general procedure for Pd coupling of
vinyl triflate and boronic acids or tributyl tin reagents:
See, Wuston, Wise Synthesis (1991), 993)
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
- 150 -
Piperidine Side Chain Intermediates
TERT-BUTYh 4- { [ (TRIFhUOROMETHYh) SUI~FONYh~ OXY} -1 , 2 , 3 , 6-
TETRAHYDRO-1-PYRIDINECARBOXY7~ATE:
n-Butyl lithium (17.6 mL, 44.2 mmol, 2.5 M in hexanes)
was added to a solution of diisopropyl amine (96.2 mL,
'44.2 mmol) in 40 mL of dry THF at 0 °C and stirred for 20
minutes. The reaction mixture was cooled to -78 °C and
tert-butyl 4-oxo-1-piperidinecarboxylate (Aldrich
Chemical Company, 40.0 mmol) in THF (40 mL) was added
dropwise to the reaction mixture and stirred for 30
minutes. Tf~NPh (42.0 mmol, 15.0 g) in THF (40 mL) was
added dropwise to the reaction mixture and stirred at °C
overnight. The reaction mixture was concentrated in
vacuo, re-dissolved in hexanes:EtOAc (9:1), passed
through a plug of alumina and the alumina plug was
washed with hexanes:EtOAc .(9:1). The combined extracts
were concentrated to yield 16.5 g of the desired product
that was contaminated with some starting Tf2NPh.
1H NMR (400 MHz, CDC13) 8 5.77 (s, 1 ,H), 4.05 (dm, 2 H,
J=3.0 Hz), 3.63 (t, 2 H, J=5.7 Hz), 2.45 (m, 2 H), 1.47
(s, 9 H) .
TERT-BUTYh 4-[3-(AMINO)PHENYh~-1,2,3,6-TETRAHYDRO-1-
PYRIDINECARBOXYhPaTE:
A mixture of 2 M aqueous Na2C03 solution (4.2 mL), t2rt-
butyl 4-([(trifluoromethyl)sulfonyl]oxy}-1,2,3,6-
tetrahydro-1-pyridine-carboxylate (0.500 g, 1.51 mmol),
3-aminophenylboronic acid hemisulfate (0.393 g, 2.11
mmol), lithium chloride (0.191 g, 4.50 mmol) and
tetrakis-triphenylphosphine palladium (0) (0.080 g,
0.075 mmol) in dimethoxyethane (5 mL) was heated at
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
- 151 -
reflux temperature for 3 hours, under an inert
atmosphere (an initial degassing of the mixture is
recommended to prevent the formation of
triphenylphosphine oxide). The organic layer of the
cooled reaction mixture was separated and the aqueous
layer was washed with ethyl acetate (3X). The combined
organic extracts were dried and concentrated in vacuo.
The crude product was chromatograghed (silica,
hexanes:EtOAc:dichloromethane (6:1:1) with to added
isopropylamine to protect the BOC group from hydrolysis)
to give 0.330 g of the desired product in 81% yield:
~H NMR (400 yMHz, CDC13) 8 7.12 (t, 1H, J= 7.60 Hz) , 6.78
(d, 1H, J= 8.4 Hz), 6.69 (t, 1H, J= 2.0 Hz), 6.59 (dd,
1H, J= 2.2, 8.0 Hz), 6.01 (m, 1H), 4.10-4.01 (d, 2H, J=
2.40 Hz), 3.61 (t, 2H, J= 5.6 Hz), 2.52-2.46 (m, 2H),
1.49 (s, 9H); ESMS m/e ..275.2 (M + H)+.
Anal. Calc. for C16H~4N202: C, 70.04; H, 8.08; N, 10.21.
Found: C, 69.78; H, 7.80; N, 9.92
TERT-BUTYL 4-[3-(AMINO)PHENYL]-1-PIPERIDINECARBOXYLATE
A mixture of 3.10 g of tert-butyl 4-(3-aminophenyl)-
1,2,3,6-tetrahydropyridine-1-carboxylate (11.3 mmol)..f~and
1.0 g of 10o Pd/C in 200 mL of ethanol was hydrogenated
at room temperature using the balloon method for 2 days.
The reaction mixture was filtered and washed with
ethanol. The combined ethanol extracts were
concentrated in vacuo and the residue was
chromatographed on silica (dichloromethane: methanol
95:5 with 1o isopropylamine added to protect the BOC
group from hydrolysis) to give 2.63 g of the desired
product (840).
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
- 152 -
TERT-BUTYL 4-(3-NITROPHENYh)-3,6-DIHYDRO-1(2H)-
PYRIDINECARBOXYLATE
1H NMR (400 MHz, CHC13) 8 8.23 (s, 1H) , 8.11 (d, 1H,
J=8.0 Hz), 7.69 (d, 1H, J=8.0 Hz), 7.51 (t, 1H, J=8.0
Hz), 6.20 (m, 1H), 4.17-4.08 (m, 2H), 3.67 (t, 2H, J=5.6
Hz), 2.61-2.52 (m, 2H), 1.50 (s, 9H); ESMS m/e . 249.1
(M + H - C4H$)+.
1,2,3,6=TETRAHYDRO-4-(3-NITROPHENYZ)PYRIDINE: Into a
stirred solution of 5.00 g (16.0 mmol) of tert-butyl
1,2,3,6-tetrahydro-4-(3-nitrophenyl)pyridine-1-
carboxylate in 100 ml of 1,4-dioxane at 0°C was bubbled
HC1 gas for 10 minutes. The reaction mixture was
allowed to warm to room temperature and the bubbling of
the HCl gas was continued for an additional 1 hour. The
solvent was removed in vacuo, the residue was dissolved
in 50 mL of water and was neutralized by the addition of
KOH pellets. The aqueous solution was extracted with 3
X 80 mL of dichloromethane and the combined organic
extracts were dried (MgS04), filtered and concentrated in
vacuo. The residue was purified by column ,-''
chromatography (silica, 9 . 1 ,dichloromethane .
methanol + 1o isopropyl amine)'to afford 2.85 g (87.50
yield) of the desired product: 1H NMR (400 MHz, CDC13) 8
8.24 (s, 1H), 8.09 (d, 1H, J=8.4 Hz), 7.71 (d, 1H, J=8.0
Hz), 7.49 (t, 1H, J=8.0 Hz), 6.35-6.25 (m, 1H), 3.58
(apparent q, 2H, J=3.0 Hz), 3.14 (t, 2H, J=5.6 Hz),
2.54-2.46 (m, 2H) .
TERT-BUTYL 3- (4- (3-NITROPHENYT~) -3, 6-DIHYDRO-1 (2H) -
PYRIDINYL)PROPYLCARBAMATE: A mixture of 2.80 g (14.0
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
- 153 -
mmol) of 1,2,3,6-tetrahydro-4-(3-nitrophenyl)pyridine,
3.60 g (15.0 mmol) of tart-butyl N-(3-
bromopropyl)carbamate, 11.6 g (84.0 mmol) of K2C03, 14.6
mL (84.0 mmol) of diisopropylethylamine and 0.78 g (2.00
mmol) of tetrabutylammonium iodide in 250 mL of 1,4-
dioxane was heated at reflux temperature for 14 hours.
The reaction mixture was filtered and the filtrate was
dried (MgS04), concentrated in vacuo and the residue was
purified by column chromatography (silica, 9:1,
dichloromethane: methanol + 1o isopropyl amine) to
afford 4.35 g (85.70 yield) of the desired product: 1H
NMR (400 MHz, CDC13) 8 8.24 (t, 1H, J=1.9 Hz), 8.09 (dd,
1H, J=1.9, 8.0 Hz), 7.70 (apparent d, 1H, J=8.0 Hz),
7. 49 (t, 1H, J=8.0 Hz) , 6.23 (m, 1H) , 3.29-3..18 (m, 4H) ,
2.75 (t, 2H, J=5.6 Hz), 2.64-2.54 (m, 4H), 1.82-1.70 (m,
2H) , 1.44 (s, 9H) ; ESMS m/e . 362.2 (M + H)'~.
3-(4-(3-NITROPHENYL)-3,6-DIHYDRO-1(2H)-PYRIDINYL)-1-
PROPANAMINE: Into a stirred solution of 4.35 (12.0 mmol)
of tart-butyl 3-(4-(3-nitrophenyl)-3,6-dihydro-1(2H)-
pyridinyl)propylcarbamate in 100 ml of 1,4-dioxane at
0°C was bubbled HC1 gas for 10 minutes. The reaction
mixture was allowed to warm to room temperature and the
f
bubbling was continued for an additional 1 hour. The
solvent was removed in vacuo, the residue was dissolved
in 50 mL of water and was neutralized by the addition of
KOH pellets. The aqueous solution was extracted with 3
X 80 mL of dichloromethane, the combined organic
extracts were dried (MgS04), filtered and concentrated in
Vacuo. The residue was purified by column
chromatography (silica, 9 . 1 ,dichloromethane .
methanol + 1o isopropyl amine) to afford 3.05 g (97.0o
yield) of the desired product: 1H NMR (400 MHz, CDC.13) 8
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
- 154 -
8.24 (t, 1H, J=1.8 Hz), 8.09 (dd, 1H, J=1.8, 8.2 Hz),
7. 69 (dd,1H, J=1.8, 8.2 Hz) , 7.48 1H, J=8.2 Hz) ,
(t,
6.24 (m, 1H), 3.21 (d, 2H, J=3.6 Hz), 2.84 (t, 2H, J=6.6
Hz) , 2.75(t, 2H, J=5. 8 Hz) , 2. 64-2.54(m, 4H) , 1.76
(m,
2H) ; ESM S m/e . 262.2 (M + H)+; Anal . Calc. for
C14H19 N302(0.06 CHC13) : C, 62.90; H,
7.16; N, 15. 65.
Found: C, 63.20; H, 7.16; N, 15.65.
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
- 155 -
METHYL (4S) -3- [ ( { 3- [4- (3-AMINOPHENYL) -1-
PIPERIDINYL]PROPYL}AMINO)CARBONYL]-4-(3,4-
DIFLUOROPHENYL)-6-(METHOXYMETHYL)-2-OXO-1,2,3,4-
TETRAHYDRO-5-PYRIMIDINECARBOXYLATE: A mixture of 3.02 g
(6.33 mmol) 5-methyl 1-(4-nitrophenyl) (6S)-6-(3,4-
difluorophenyl)-4-(methoxymethyl)-2-oxo-3,6-dihydro-
1,5(2H)-pyrimidinedicarboxylate, 1.50 g (5.80 mmol) of
3-(4-(3-nitrophenyl)-3,6-dihydro-1(2H)-pyridinyl)-1-
propanamine, 7.94 g (75.5 mmol) of K2C03 and 1.00 mL of
methanol in 200 mL dichloromethane (under argon) was
stirred at room temperature for 1 hour. The reaction
mixture was filtered and concentrated in ~racuo. The
residue was'dissolved in 100 mL of ethyl acetate and
washed 3 X 50 mL of 5o aqueous NaOH solution, the
organic layer was dried (MgS04) and concentrated in
vacuo. The residue was dissolved in 100 mL of anhydrous
ethanol containing 0.50 g 10o Pd/C and the reaction
mixture was stirred under a hydrogen balloon for 24
hours. The reaction mixture was passed through a column
of Celite 545 filtering agent, washed with ethanol, the
filtrate was dried (MgS04) and concentrated in uacuo.
The residue was purified by column chromatography
(silica, 9.5 . 0.5 ,dichloromethane . methanol + 1o~s'
isopropyl amine) to afford 1.65 g (52.0o yield) ofrthe
desired product.
TERT-BUTYL 4-[3-(ISOBUTYRYLAMINO)PHENYL]-3,6-DIHYDRO-
1(2H)-PYRIDINECARBOXYLATE: Into a solution of 4.00 g
(16.0 mmol) of tert-butyl 4-(3-aminophenyl)-3,6-dihydro-
1(2H)-pyridinecarboxylate and 5.60 mL (32.0 mmo1) of
diisopropylethylamine in 100 mL dichloromethane was
slowly added 1.90 mL (19.0 mmol) of isobutyryl chloride.
The reaction mixture was stirred at room temperature for
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
- 156 -
2 hours, washed with water, dried (MgS04), and
concentrated in vacuo. The residue was purified by
column chromatography (silica, 50 . 46 . 3 . 1, hexanes
. dichloromethane . methanol . isopropyl amine) to
afford 2.90 g (52.0o yield) of the desired product: 1H
NMR (400 MHz, CDC13) 8 7.69 (s, l H), 7.34 (d, 1 H, J=7.8
Hz), 7.27 (t, 1H; J=7.8 Hz), 7.11 (d, 1H, J=7.8 Hz),
6.04 (s, 1H), 4.05 (s, 2H), 3.62 (apparent t, 2 H, J=4.9
Hz) , 2.51 (m, 3H) , 1.49 '(s, 9H) , 1.25 (d, 6H, J=7.4 Hz) ;
ESMS m/e: 345.5 (M + H)+. Anal. Calc. for
C~pH2gN2O3+0.175 CHC13: C, 66.33; H, 7.77; N, 7.67. Found:
C, 66.20; H, 7.41; N, 7.88
TERT-BUTYL 4- [3- (ISOBUTYRYLAMINO) PHENYL] -1-
PIPERTDINECARBOXYLATE: A mixture of 2.90 g (8.40 mmol)
of tert-butyl 4-[3-(isobutyrylamino)phenyl]-3,6-dihydro-
1(2H)-pyridinecarboxylate and 0.80 g of 10o yield Pd/C
in 100 mL of ethanol was stirred under a hydrogen
balloon for 24 hours. The reaction mixture was passed
through a column of Celite 545 filtering agent, the
filtrate was dried (MgS04) and concentrated in vacuo.
The residue was purified. by column chromatography
(silica, 9.5 . 0.5 ,dichloromethane . methanol + 1o'f
isopropyl amine) to afford 2.40._g (84.0% yield) of the
desired product: 1H NMR (400 MHz, CDC13) 8 7.49-7.44 (m,
2H), 7.24 (t, 1H, J=7.6 Hz), 6.93 (d, 1H, J=7.6 Hz),
4.20-4.10 (m, 2H), 2.86-2.45 (m, 4H), 1.86-1.75 (m, 4H),
1.48 (s, 9H), 1.24 (d, 6H, J=6.8 Hz); ESMS m/e . 345.2
(M + H)+; Anal. Calc. for C2oH3oN?03+0.3H~0: C, 68.27; H,
8.77; N, 7.96. Found: C, 68.25; H, 8.54; N, 7.84.
2-METHYL-N-[3-(4-PIPERIDINYL)PHENYL]PROPANAMIDE: Into a
stirred solution of 2.20 (6.50 mmol) of tert-butyl 4-[3-
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
- 157 -
(isobutyrylamino)phenyl]-1-piperidinecarboxylate in 100
ml of 1,4-dioxane at 0 °C was bubbled HC1 gas for 10
minutes. The reaction mixture was allowed to warm to
room temperature and the bubbling of the HC1 gas was
continued for 1 hour. The solvent was removed in vacuo,
the residue was dissolved in 50 mL of water and was
neutralized by the addition of KOH pellets. The aqueous
solution was extracted with 3 X 80 mL of
dichloromethane, the combined organic extracts were
dried (MgS04), filtered and concentrated in vacuo. The
residue was purified by column chromatography (silica, 9
. 1 ,dichloromethane . methanol + to isopropyl amine) to
afford 0.700 g (46.0o yield) of the desired product: 1H
NMR (400 MHz, CDC13) ~ 7.47 (s, 1H), 7.40 (d, 1H, J=7.8
Hz), 7.24 (t, 1H, J=7.8 Hz), 7.00 (d, 1H, J=7.8 Hz),
3.23-3. 14 (m, 5H) , 2.82-2.57 (m, 4H) , 1.20 (d, 6H, J=6. 8
Hz); ESMS m/e . 247.2 (M + H)~;
The hydrochloride salt was used for the combustion
analysis: Anal. Calc. for ClSHaaN20+HCl+0.15 CHC13: C,
60.51; H, 7.76; N, 9.32. Found: C, 60.57; H, 7.83; N,
8.88.
3-(4-PIPERIDINYL)ANILINE: 1H NMR (400' MHz, CDC13) 8 ,7'f01
(t, 1H, J=7.6 Hz), 6.62-6.54 (m, 3H), 3.16 (br d, 2H,
J=10.3 Hz), 2.75 (dt, 2H, J=2.7, 12.3 Hz), 2.56 (tt, 1H,
J=3.6, 12.3 Hz), 1.81 (br d, 2H, J=12.3 Hz), 1.65~(dq,
2H, J=4.0, 12.3 Hz); ESMS m/e . 177.2 (M + H)+.
TERT-BUTYL 4- (4-NITROPHENYL) -3, 6-DIHYDRO-1 (2H) -
PYRIDINECARBOXYLATE: To a 25-mL RB flask, equipped with
a condensor, was added tent-butyl 4-
([(trifluoromethyl)sulfonyl]oxy}-3,6-dihydro-1(2H)-
pyridinecarboxylate (1.0 g), 4-nitrophenylboronic acid
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
- 158 -
(0.71 g), sodium carbonate (0.430 mL of 2M solution),
lithium chloride (0.382 g),
tetrakis(triphenylphosphine)- palladium (0) (0.173 g)
and ethylene glycol dimethyl ether (10 mL). The
reaction mixture was flushed with Argon three times,
then the reaction mixture was heated to 100 °C for 3 hrs.
After cooling to room temperature, the reaction mixture
was diluted with methylene chloride (30 mL) and water
(30 mL) and the organic layer was separated. The
aqueous layer was extracted with methylene chloride
(3x20 mL) and the combined organic extracts were washed
with sat NH4C1 (20 mL) and brine (20 mL), dried over
MgS04 and concentrated under reduced pressure. The
residue was purified by chromatography (6:1=hexane: ethyl
acetate with 1o NH3) to afford the product (0.55 g,
59.90) as.a yellow oil. The compound is not stable at
room temperature and should be used as prompt as
practical: 1H NMR (400 MHz, CDC13) b 8.20 (d, 2H, J=8.6
Hz), 7.51 (d, 2H, J=8.6 Hz), 6.24 (m, 1H), 4.13 (m, 2H),
3.67 (apparent t, 2H, J=5.5 Hz), 2.55 (m, 2H), 1.49 (s,
9H) .
4-(4-NITROPHENYL)-1,2,3,6-TETRAHYDROPYRIDINE:
4-(4-Nitrophenyl)-1,2,3,6-tetrahydropyridine was
prepared by a similar procedure to that used for the
preparation of 2-methyl-N-[3-(4-
piperidinyl)phenyl]propanamide using HCl gas and tert-
Butyl 4-(4-Nitrophenyl)-3,6-dihydro-1(2H)-
pyridinecarboxylate (130 mg) in dioxane (5.0 mL) at room
temperature. The reaction mixture was concentrated in
vacuo to gi~re the crude product (69.8 mg) that used in
the next reaction without further purification.
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
- 159 -
Dihydropyrimidine Intermediates
3-(3,4,5-TRIFLUOROBENZYLIDENE)-2,4-PENTANEDIONE: A
stirring mixture of 3,4,5-trifluorobenzaldehyde (4.20 g,
2 6 . 2 mmol ) , 2, 4-pentanedione ( 2 . 62 g, 2 6 . 2 mmol ) ,
piperidine (0.430 g, 5Ø0 mmol) in benzene (150 mL) was
heated at reflux temperature in a Dean-Stark apparatus
for 8 h. The benzene was evaporated and the yellow oily
residue was used in the next step without further
purification.
1- [2-METHOXY-4-METHYL-6- (3, 4, 5-TRIFLUOROPHENYL) -1, 6-
DIHYDRO-5-PYRIMIDINYL]ETHANONE: A mixture 3-(3,4,5-
trifluorobenzylidene)-2,4-pentanedione (26.2 mmol), 0-
methylisourea hydrogen sulfate (3.22 g, 39.3 mmol), and
NaHC03 (6.6 g, 78.6 mmol) in EtOH (400 mL) was stirred
and heated at 95-100 °C for 6 h. The mixture was
filtered and the solid filter cake was washed with
ethanol (100 mL). The .solvent was evaporated from the
combined filtrates and the crude product was purified by
flash column chromatography (EtOAc/hexane, 1/9 to 1/4),
to afford the desired product as an oil (2.80 g, 3Co~.
4-NITROPHENYL 5-ACETYL-2-METHOXY-4-METHYL-6- (3, 4, 5-
TRIFLUOROPHENYL)-2(6H)-PYRIMIDINECARBOXYLATE:
4-Nitrophenyl chloroformate (1.89 g, 9.38 mmol) was
added to a solution of 1-[2-methoxy-4-methyl-6-(3,9,5-
trifluorophenyl)-1,6-dihydro-5-pyrimidinyl]ethanone
(2.80 g, 9.38 mmol) and pyridine (10 mL) in CH~Cl~ (200
mL) at 0-5 °C, and the resulting mixture was allowed to
warm to room temperature. After 12 h, the solvent was
evaporated and the residue was purified by flash
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
- 160 -
chromatography (dichloromethane/EtOAc, 1/9 to 3/20), to
give the desired product as a white powder (4.00 g,
920) .
4-NITROPHENYL 5-ACETYL-4-METHYL-2-OXO-6-(3,4,5-
TRIFLUOROPHENYL) -3, 6-DIHYDRO-1 (2H) -
PYRIMIDINECARBOXYLATE:
A solution of 6 N aqueous HC1 (4 mL) was added to a
well-stirred solution of 4-nitrophenyl 5-acetyl-2-
methoxy-4-methyl-6-(3,4,5-trifluorophenyl)-1(6H)-
pyrimidinecarboxylate (4..00 g, 8.63 mmol) in THF (100
. mL) at 0-5 °C, and the mixture was allowed to warm to
room temperature. After 2 h, solvent was evaporated and
the product dried under vacuum. The product was
obtained as a pure single component and used in the next
step without further purification (3.88 g, 100%).
. 1H NMR (DMSO) b 10.29 (s, 1H), 8.23 (d, 2H, J=9.1 Hz),
7.51 (d, 2H, J=9.1 Hz), 7.15-7.07 (m, 2H), 6.18 (s, 1H),
2.30 (s, 3H), 2.28 (s, 3H); ESMS m/e: 450.2 (M + H)+;
Anal . Calc . for C2pH14F'3N3~6 : C. 53 . 4 6; H, 3 . 14 ; N, 9 . 35 .
Found: C, 53.26; H, 3,21; N, 9.35.
BENZYL 2-PROPIONYL-3-(3,4,5-TRTFLUOROPHENYL)-2-
PROPENOATE. A solution of benzyl propionylacetate (36.3
g, 176 mmol), 3,4-difluorobenzaldehyde (25.0 g, 176
mmol), piperidine (0.86 mL, 9.0 mmol) and acetic acid
(0.49 mL, 9.0 mmol) were heated at reflux temperature
with removal of water using a Dean-Stark apparatus for
5h. The solvent was removed in vacuo and the residue was
dissolved in EtOAc. The organic layer was washed with
water (100 mL) followed by brine (100 mL) and dried over
anhydrous Na2S04. The solvent was evaporated to afford a
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
- 161 -
pale yellow syrup (60.2 g), which was used in the next
step without further purification.
BENZYL 6-(3,4-DIFLUOROPHENYL)-4-ETHYL-2-METHOXY-1,6-
DIHYDRO-5-PYRIMIDINECARBOXYLATE. A suspension of benzyl
2-propionyl-3-(3,4,5-trifluorophenyl)-2-propenoate (16.0
g, 48.0 mmol), O-methylisourea hydrogen sulfate (16.65
g, 97.02 mmol), NaHC03 (16.3 g, 130.2 mmol) in DMF (190
mL) was stirred at 70 °C for 20h. After cooling to room
temperature, the reaction mixture was filtered and the
filtrate was diluted with EtOAc (300 mL) and then washed
with water (4X100 mL), brine (200 mL) and dried over
Na2S04. After removal of solvent, the residue was
purified by column chromatography (SiO~, EtOAc/Hexane,
100-300) to afford benzyl 6-(3,4-difluorophenyl)-4-
ethyl-2-methoxy-1,6-dihydro-5-pyrimidinecarboxylate as a
colorless oil (10.6 g, 58o yield). The product was
directly used in the next step after 1H NMR spectroscopy
which showed it to be a mixture of amine/imine
tautomers.
5-BENZYL 1-(4-NITROPHENYL) 6-(3,4-DIFLUOROPHENYL)-4-
ETHYL-2-METHOXY-I,5(6H)-PYRIMIDINEDICARBOXYLATE.
Into a well-stirred solution of benzyl 6-(3,4-
difluorophenyl)-4-ethyl-2-methoxy-1,6-dihydro-5-
pyrimidinecarboxylate (27.5 g, 68.75 mmol) and pyridine
(9.2 mL) in CH2C12 (300 mL) was added 4-nitrophenyl
chloroformate (14.49 g, 82.5 mmol) at room temperature.
The reaction mixture was stirred for 4 h and then washed
with loo aqueous ECOH solution (2 X 150 mL). The organic
layer was separated and dried over NazS04. The solvent
was removed in vacuo and the residue was used in the
next step without further purification: lI-I NMR (CDC13) cS
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
- 162 -
1.24 (t, J=7.2 Hz, 3H), 2.81-2.98 (m, 3H), 3.97 (s, 3H),
5.14 (ABq, 2H), 6.28 (s, 3H), 7.03-7.29 (m, 8H), 7.35 (d,
J=9.2 Hz, 2H), 8.26 (d; J=9.2 Hz, 2H).
BENZYL 6-(3,4-DIFLUOROPHENYL)-4-ETHYL-2-METHOXY-1-
({[(1R)-1-PHENYLETHYL]AMINO}CARBONYL)-1,6-DIHYDRO-5-
PYRIMIDINECARBOXYLATE.
Into a stirred mixture of 5-benzyl 1-(4-nitrophenyl) 6-
(3,4-difluorophenyl)-4-ethyl-2-methoxy-1,5(6H)-
pyrimidinedicarboxylate (12.6 g, 22.86 mmol) in THF (150
mL) was added a solution of R-(+)-a-methyl benzylamine
(3.53 mL, 27.44 mmol) at room temperature. The stirring
was continued for 12 h and~the solvent was removed in
vacuo. The yellow residue was dissolved in chloroform
(200 mL) and was washed with 10o KZC03 solution (2 x 30
mL). The organic layer was dried over Na2S04, filtered
and the solvent was removed in vacuo. The resulting
mixture of diastereomers was separated by column
chromatography over silica gel with 9:1 pet. ether: ether
to 4:1 pet. ether: ether. First major product to elute
was (+)-benzyl 6-(3,4-difluorophenyl)-4-ethyl-2-methoxy-
1-({[(1R)-1-phenylethyl]amino}carbonyl)-1,6-dihydro-5-
pyrimidinecarboxylate: Colorless oil, Rf= 0.31(4:l,.pet
ether:ether); wt.= 3.8 g (60a yield); [oc]D = +267.05 (c
- 0.76, CHC13); 1H NMR (CDC13) 8 1.22 (t, J=7.5 Hz, 3H),
1.52 (d, J=6.9 Hz, 3H), 2.88 (q, J=6.0 Hz, 2H), 3.199 (s,
3H), 4.99 (m, 1H), 5.09 (ABq, 2H), 6.66 (s, 1H), 6.99-
7.36 (m, 13H); The second major product to elute was (-
-benzyl 6-(3,4-difluorophenyl)-4-ethyl-2-methoxy-1-
(([(1R)-1-phenylethyl]amino}carbonyl)-1,6-dihydro-5-
pyrimidinecarboxylate: Colorless oil; Rf= 0.22 (4:1 pet
ether:ether) ; wt.= 3.2 g (51.2 o yield) ; [oc] p = -146.89
(c = 0.38, CHC13) ; 1H NMR (CDC13) ~ 1.22 (t, J=7 .2 Hz,
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
- 163 -
3H), 1.49 (d, J=6.6 Hz, 3H), 2.88 (q, J=6.0 Hz, 2H),
3.94 (s, 3H), 5.03 (m, 1H), 5.11 (ABq, 2H), 6.68 (s, 1H),
6.91-7.34 (m, 13H).
(+)-BENZYL 6-(3,4-DIFLUOROPHENYL)-4-ETHYL-2-METHOXY-1,6-
DIHYDRO-5-PYRIMIDINECARBOXYLATE. Into a stirred solution
of (+)-benzyl 6-(3,4-difluorophenyl)-4-ethyl-2-methoxy-
1-({[(1R)-1-phenylethyl]amino}carbonyl)-1,6-dihydro-5-
pyrimidinecarboxylate (17.1 mmol, 9.35 g) in CH2C12 was
added.l,8-diazabicyclo[5,4,0]-undec-7-ene (17.1 mmol,
2.56 mL) and stirring was continued for l6 h at room
temperature. The solvent was evaporated and the residue
was purified by flash column chromatography on silica
gel with 3:1 EtOAc/Hexanes as the eluting system. 5.27 g
of the (+)-benzyl 6-(3,4-difluorophenyl)-4-ethyl-2-
methoxy-1,6-dihydro-5-pyrimidinecarboxylate was obtained
(77 o yield) .
(+)-5-BENZYL 1-(4-NITROPHENYL) 6-(3,4-DIFLUOROPHENYL)-4-
ETHYL-2-METHOXY-1,5(6H)-PYRIMIDINEDICARBOXYLATE. Into a
well-stirred solution of (+)-benzyl 6-(3,4-
difluorophenyl)-4-ethyl-2-methoxy-1,6-dihydro-5-
pyrimidinecarboxylate (6.4 g, 16.0 mmol) and pyridine
(1.5 mL) in CH2C12 (150 mL) was added 4-nitrophenyl
chloroformate (3.41 g, 19.2 mmol) at room temperature.
The reaction mixture was stirred for 4 h and then'it was
washed with 10o aqueous KOH solution (2 X 100 mL). The
organic layer was separated and dried over Na2S04. The
solvent was removed in vacuo. The residue of (+)-5-
benzyl 1-(4-nitrophenyl) 6-(3,4-difluorophenyl)-4-ethyl-
2-methoxy-1,5(6H)-pyrimidinedicarboxylate was used in
the next step without further purification.
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
- 164 -
a. 2-(4-METHOXYBENZYL)-2-THIOPSEUDOUREA HYDROCHLORIDE.
Into a well-stirred suspension of thiourea (7.6 g, 0.1
mol) in THF (50 mL) at 0 °C, 4-methoxybenzyl chloride (16
g, 0.1 mol) was added in 10 min and the reaction mixture
was allowed to warm to room temperature. After 2 hours
the reaction mixture was heated to 65 °C and kept at that
temperature for 5 hours. The reaction mixture was
cooled to room temperature and diluted with diethyl
ether (200 mL). The white precipitate that formed was
filtered and dried (22.5 g, 96o yield); m. p. 161-163 °C.
b. METHYL 2-{(4-NITROPHENYL)METHYLENE}-3-OXOBUTYRATE.
A mixture of 4-nitrobenzaldehyde (15.1 g, 0.1 mol),
methyl acetoacetate (12.773 g, 0.11 mol), piperidine
(0.41 g, 4.80 mmol), and acetic acid (0.288 g, 4.8 mmol)
in 2-propanol (400 mL) was stirred at room temperature
for 48 hours. The resulting white solid, methyl 2-~{(4-
nitrophenyl)methylene}-3-oxobutyrate was filtered,
washed with 2-propanol (2 X 50 mL) and dried (21.8 g,
93o yield).
c.
1,6-DIHYDRO-5-METHOXYCARBONYL-2-[{(4-METHOXYPHENYL)I~THY
L}THIO]-4-METHYL-6-(4-NITROPHENYL)PYRIMIDINE.
A mixture of methyl 2-{(4-nitrophenyl)methylene}-3-
oxobutyrate (8.96 g, 0.04 mol), 2-(4-methoxybenzyl)-2-
thiopseudourea hydrochloride (9.28 g, 0.04 mol), and
NaOAc (3.28 g, 0.04 mol) in DMF (100 mL) was stirred and
heated at 70-75 °C for 4.5 hours. The reaction mixture
was cooled to room temperature, poured into ice-water
(300 mL) and extracted with EtOAc (2 X 400 mL). The
combined EtOAc extracts were washed with 10% NaHC03
solution (2 X 60 mL), brine (100 mL), and then dried
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
- 165 -
(MgS04). The solvent was evaporated and the crude
product was purified by flash column chromatography on
silica gel using loo through 30o EtOAc in hexane as the
gradient eluent. The desired product was obtained as an
oil, which on trituration with EtOAc/hexane became a
yellow solid (11.4 g, 66.70 yield) which was shown by 1H
NMR to be a mixture of tautomers: m.p. 138-139 °C; 1H NMR
(CDC13) 8 2.25 (s, 3 H), 3.62 (s, 3 H), 3.72 (s, 3 H),
4.05 and 5.78 (s and d, J=3 Hz, 1 H), 4.08, 4.20 (AB q,
J=12.5 Hz, 2 H), 4.21 and 6.40 (s and d, J=3 Hz, 1 H),
6.66 (2 d, J=8.5 Hz, 2 H), 7.08 (2 d, J=8.5 Hz, 2 H),
7.37 (2 d, J=8.8 Hz, 2 H), 8.7 (2 d, J=8.8 Hz, 2 H);
Anal . Calcd. for C21H21N3~5S ~ C, 59 . 00; H, 4 . 95; N, 9. 83 .
Found: C, 59.02; H, 4.93; N, 9.77.
d. I,6-DIHYDRO-5-METHOXYCARBONYL-2-[{(4-METHOXYPHENYL)
METHYL}THIO] -4-METHYL-6- (4-NITROPHENYL) -1- [ (4-NITROPHENY
LOXY)CARBONYL]PYRIMIDINE.
Into a well-stirred mixture of 1,6-dihydro-5-methoxy
carbonyl-2-[{(4-methoxyphenyl)methyl}thio]-4-methyl-6-(4
-nitrophenyl)pyrimidine (4.50 g, 10.5 mmol), NaHC03 (3.69
g, 0.044 mol), CHZCIz (200 mL), and water (50 mL) at 0-5
°C, 4-nitrophenyl chloroformate (2.40 g, 12.0 mmo1),.'was
added over a 5 min period and the reaction mixture was
allowed to warm to room temperature. After 10 hours,
the TLC analysis of the reaction mixture showed the
presence of a small amount of starting pyrimidine,
therefore, more 4-nitrophenyl chloroformate (0.65 g,
0.0032 mol) was added and the stirring was continued for
an additional 4 hours. The two layers were separated,
the CHZC12 layer was washed with saturated aqueous NaHC03
solution (3 X 50 mL), dried (MgS04), and the solvent
evaporated. The residue was recrystallized from CH2C1~
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
- 166 -
and hexane to give the product as white crystals (5.50
g, 88.4% yield): m.p. 156-157 °C; 1H-NMR (CDC13) 8 2.53
(s, 3 H), 3.70 (s, 3 H), 3.81 (s, 3 H), 4.06, 4.36 (ABq,
J=13.5 Hz, 2 H) , 6.30 (s, 1 H) , 6.78 (d, J=8 . 6 Hz, 2 H) ,
7.17 (d, J=8.6 Hz, 2 H), 7.20 (d, J=8.8 Hz, 2 H), 7.32
(d, J=8.8 Hz, 2 H), 7.97 (d, J=8.8 Hz, 2 H), 8.25 (d,
J=8. 8 Hz, 2 H) ; Anal. Calcd. for C2gH~4N4OgS: C, 56. 75; H,
4.08; N, 9.45. Found: C, 56.49; H, 4.28; N, 9.25.
a. 6-(BENZOFURAZAN-5-YL)-1,6-DIHYDRO-2-OXO-5-
METHOXYCARBONYL-4-BROMOMETHYL-1-[(4-NITROPHENYL-
OXY)CARBONYL]PYRIMIDINE.
Into a well-stirred solution of 6-(benzofurazan-5-yl)-
1,6-dihydro-2-methoxy-5-methoxycarbonyl-4-methyl-1-[(4-
nitrophenyl-oxy)carbonyl]pyrimidine (0.310 mmol, 0.140
g) in 1.5 mL of chloroform was added a solution of
bromine (0.310 mmol, 0.020 mL) in 1.5 mL of chloroform
at 0 °C and the solution was allowed to attain room
temperature over 1.5 h. The solvent was removed in
vacuo and the residue was again dissolved in CHC13 (10
mL) and washed with brine. The organic layer was
separated, dried over NaaSOQ, filtered and the solvent
was removed in vacuo to obtain 0.15 g (88o yield) of~~6-
(benzofurazan-5-yl)-1,6-dihydro-2-oxo-5-methoxycarbonyl-
4-bromomethyl-1-[(4-nitrophenyl-oxy)carbonyl]pyrimidine
as a yellow foam. The crude product was used in the
next step without purification. 1H NMR (CDC13) 8 3.79
(s, 3 H) , 4.72 (ABq, 2 H) , 6. 47 (s, 1 H) , 7.37 (d, J=9. 1
Hz, 2 H), 7.51 (d, J=7.8 Hz, 1 H), 7.80 (s, 1 H), 7.92
(d, J=9.1 Hz, 1 H), 8.30 (d, J=9.1 Hz, 2 H).
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
- 167 -
c. 4-NITROPHENYL 4-(~,1,3-BENZOXADIAZOL-5-YL)-2,5-DIOXO-
1,2,5,7-TETRAHYDROFURO[3,4-D]PYRIMIDINE-3(4H)-
CARBOXYLATE.
6-(3,4-Benzofurazan-5-yl)-1,6-dihydro-2-oxo-5-methoxy-
carbonyl-4-bromomethyl-1-[(4-
nitrophenyloxy)carbonyl]pyrimidine (0.27 mmol, 0.15 g)
was heated in oil bath for 3 h (bath temperature 130 °C.
The brownish-yellow residue thus obtained was washed
with CHC13 and 4-nitrophenyl 4-(2,1,3-benzoxadiazol-5-
yl)-2,.5-dioxo-1,2,5,7-tetrahydrofuro[3,4-d]pyrimidine-
3(4H)-carboxylate was obtained as an off-white solid
which was used in the next step without further
purification (crude wt. 0.21 g, 93o yield): 1H NMR (DMSO-
d6) 8 8.38-7.56 (m, 7H), 6.33 (s, 1H), 5.02 (s, 2H);
Anal. Calc. for C19H11NSO$+2.3H20: C, 47.85; H, 3.28; N,
14.63. Found: C, 47.73; H, 2.51; N, 14.77.
5-METHYL 1- (4-NITROPHENYL) 4- (BROMOMETHYL) -6- (3, 4-
DIFLUOROPHENYL)-2-OXO-3,6-DIHYDRO-1,5(2Hj-
PYRIMIDINEDICARBOXYLATE: Into a well-stirred solution of
6-(3,4-Difluorophenyl)-1,6-dihydro-2-methoxy-5-
methoxycarbonyl-4-methyl-1-[(4-
nitrophenyloxy)carbonyl]pyrimidine (1.5 mmol, 0.66 g) in
5 mL of chloroform was added a solution of bromine (1.5
mmol, 0.09 mL) in 3 mL of chloroform at 0 °C~and the
solution was allowed to attain room temperature over 1.5
h. The solvent was removed in vacuo and the residue was
again dissolved in CHC13 (20 mL) and washed with brine.
The organic layer was separated, dried over Na~SOQ,
filtered and the solvent was removed .in vacuo to afford
the desired product as a yellow foam, which was used in
the next step without purification. 1H NMR 8 3.75 (s, 3
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
- 168 -
H), 4.67 (ABq, 2 H), 6.35 (s, 1 H), 7.09-7.19 (m, 4 H),
7.37 (d, J=9.0 Hz, 2 H), 8.27 (d, J=9.0 Hz, 2 H).
4-NITROPHENYL 4-(3,4-DIFLUOROPHENYL)-2,5-DIOXO-1,2,5,7-
TETRAHYDROFURO[3,4-D]PYRIMIDINE-3(4H)-CARBOXYLATE.
5-methyl 1-(4-nitrophenyl) 4-(bromomethyl)-6-(3,4-
difluorophenyl)-2-oxo-3,6-dihydro-1,5(2H)-
pyrimidinedicarboxylate (1.5 mmol, 0.81 g) was heated in
an oil bath for 3 h (bath temperature 130 °C). The brown
residue thus obtained was washed with CHC13 and the
desired product was obtained as a pale brown solid which
was used in the next step without further purification
(crude wt. 0.51 g) : 1H NMR ,(DMSO-ds) b 4.94 (br s, 2 H) ,
6.08 (s, 1 H), 7.20-7.43 (m, 4 H), 8.35 (d, J=10.2 Hz, 2
H) .
4-NITROPHENYL 4-(1,3-BENZODIOXOL-5-YL)-2,5-
DIOXOHEXAHYDROFURO[3,4-D]PYRIMIDINE-3(4H)-CARBOXYLATE: 1H
NMR (DMSO) 8 11.35 (s, 1H), 8.16 (d, 2H, J=9.5 Hz), 7.32
(d, 2H, J=8.9 Hz), 6.81-6.65 (m, 3H), 5.88 (s, 1H), 4.85
(ABq, 2H); ESMS m/e . 440.1 (M + H)+; Anal. Calc. for
C2°H15N309+1.5H20: C, 51.29; H, 3.87; N, 8.97. Found: C,
51.38; H, 2.85; N, 8.73.'
5-METHYL 1-(4-NITROPHENYL) (6S)-6-(3,4-DIFLUOROPHENYL)-
4-METHYL-2-OXO-3, 6-DIHYDRO-l, 5 (2H) -
PYRIMIDINEDICARBOXYLATE: 1H NMR (400 MHz, CDC13) 8 8.29
(d, 2H, J=9.1 Hz), 7.36 (d, 2H, J=8.9 Hz), 7.25-7.11 (m,
3H), 6.37 (s, 1H), 3.75 (s, 3H), 2.46 (s, 3H); ESMS m/e:
948.1 (M + H)+; Anal. Calc. for C2°Hi5F2N30~: C, 53.70; H,
3.38; N, 9.39. Found: C, 53.35; H, 3.36; N, 9.27.
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
- 169 -
General Procedure for the reaction of pyrimidine-3-
carboxylic acid-4-nitrophenyl esters with amines:
A solution of substituted pyrimidine-3-carboxylic acid-
4-nitrophenyl ester ((0.29 mmol) and a substituted 4-
phenyl-1-(3-propylaminopiperidine (0.30 mmol) in 10 mL
of anhydrous THF was stirred overnight at room
temperature. The solvent was removed in vacuo and the
residue was purified by column chromatography.
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-170-
T E R T - B U T Y L
4-{[(TRIFLUOROMETHYL)SULFONYL]OXY}-1,2,3,6-TETRA-HYDRO-1-
PYRIDINECARBOXYLATE: n-Butyllithium (17.6 mL, 44.2 mmol,
2.5 M in hexanes) was added to a solution of diisopropyl
amine (96.2 mL, 44.2 mmol) in 40 mL of dry THF at 0 "C and
stirred for 20 minutes. The reaction mixture was cooled
to -78 °C and tert- butyl 4-oxo-1-piperidinecarboxylate
.10 (40.0 mmol) in THF (40 mL) was added dropwise to the
reaction mixture and stirred for 30 minutes. Tf~NPh (15.0
g, 42.0 mmol) in THF (40 mL) was added dropwise to the
reaction mixture and the mixture was stirred at 0 °C
overnight. The reaction mixture was concentrated in
J.5 vacuo, re-dissolved in hex~anes/EtOAc (9/1), passed through
a plug of alumina and washed with hexanes/EtOAc (9/1).
The combined extracts were concentrated to yield 16.5 g of
the desired product that was contaminated with a small
amount of Tf2 Nph. 1H NMRB 5.77 (s, 1 H) , 4.05 (dm, 2 H,
20 J=3.0 Hz), 3.63 (t, 2 H, J=5.7 Hz), 2.45 (m, 2 H), 1.47
(s, 9 H) .
TERT-BUTYL 4-[3-(ACETYLAMINO)PHENYL]-1,2,3,6-TETRAHYDRO-1-
PYRIDINECARBOXYLATE: A mixture of saturated of aqueous
25 Na~CO 3 solution (25 mL) , tert-butyl
4-{[(trifluoromethyl)sulfonyl]oxy}- 1,2,3,6-tetrahydro-1-
pyridine-carboxylate (20 mmol), 3-acet-amidophenylboronic
acid (30 mmol) and tetrakis-triphenylphosphine palladium
(0) (1.15 g) and dimethoXyethane (40 mL) was heated at
30 reflux temperature overnight. The organic layer of the
cooled reaction mixture was separated and the aqueous
layer was washed with ethyl acetate (3X) . The combined
organic extracts were dried and concentrated in vacuo.
The crude product was chromatograghed, giving the desired
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-171-
product 1H NMRB 8.11 (br s, 1 H), 7.57 (br s, 1 H), 7.41
(br 8 , 1 H, J=7 . 8 Hz ) , 7 . 25 ( apparent t, 1 H, J=7 . 8 Hz ) ,
7.08 (br d, 1 H, J=7.8 Hz) , 5. 99 (b s, 1 H) , 4.03 (br m,
2 H, J=2.7 Hz) , 3.59 (t, 2 H, J=5.7 Hz) , 2.46 (m, 2 H, ) ,
2.16 (s, 3 H), 1.49 (s, 9.H).
N1-[3-(1,2,3,6-TETRAHYDRO-4-PYRIDINYL)PHENYL]ACETAMIDE:
A solution of 4 M HC1 in dioxane (10 mL) was added to
tert-butyl 4-[3-(acetylamino)phenyl]-1,2,3,6-tetrahydro-
1-pyridinecarboxyl-ate (8.25 mmol) in dichloromethar~e (30
mL). The reaction mixture was stirred at room temperature
overnight, concentrated in vacuo, giving the desired
product as the hydrochloride salt (2.1 g). 1H NMR 8
7 . 41-7 . 00 (m, 4 H) , 6.10 (br, 1 H) , 3.55 (m, 2 H) , 3. 16
(t, 2 H, J = 5.7 Hz), 2.44 (m, 2 H), 2.19 (s, 3 H).
TERT-BUTYL N-(3-BROMOPROPYL)CARBAMATE: Prepared from
3-bromopropylamine hydrobromide and BOC~O in the presence
of base in dichloromethane: 1H NMR 8 5.07 (br, 1 H), 3.31
(t, 2 H, J=6.6 Hz), 3.12 (apparent br q, 2 H, J=6.0 Hz),
1.92 (p, 2 H, J=6.6 Hz), 1.30 (s, 9H).
REACTION OF N1-[3-(1,2,3,6-TETRAHYDRO-4-PYRIDINYL)PHENYL]
ACETAMIDE WITH TERT-BUTYL N-(3-BROMOPROPYL)CARBAMATE
TERT-BUTYL N-(3-{4-[3-(ACETYLAMINO)PHENYL]
-1,2,3,6-TETRAHYDRO- 1-PYRIDINYL}PROPYL)CARBAMATE: A
solution of N1-[3-(1,2,3,6- tetrahydro-
4-pyridinyl)phenyl]acetamide hydrochloride (8.24 mmol),
tert-butyl N-(3-bromopropyl)carbamate and potassium
carbonate (33 mmol) in dry dioxane (30 mL) was heated at
reflux temperature overnight. The solids were removed by
filtration, the solution was concentrated in vacuo and the
product was chromatographed, giving the desired product
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-172-
(110 mg) . 1H NMRB 7.65 (s, 1 H) , 6. 98 (s, 1 H) , 7.45 (d,
l H, J=7.8 Hz), 7.16 (apparent t, 1 H, J=7.8 Hz), 7.10 (d,
1 H, J=7. 8 Hz) , 6.02 (s, 1 H) , 5.23 (b, 1 H) , 3. 40 (b, 2
H), 3.30-1.80 (m, 10 H), 2.18 (s, 3 H), 1.45 (s, 9 H).
Deprotection of BOC:
Nl-{3-[1-(3-AMINOPROPYL)-1,2,3,6-TETRAHYDRO-4-PYRIDINYL]
PHENYL}ACETAMIDE: A 1:1 solution of TFA:CHZC1~ (5 mL) was
added to tert-butyl N-(3-{4-[3-(acetylamino)
phenyl]-1,2,3,6-tetrahydro-1- pyridinyl}propel)carbamate
in dichloromethane (5 mL). The resulting solution was
stirred at room temperature for 1-3 days, saturated NaHC03
was added until pH > 6, the organic layer was separated,
and dried in vacuo, giving the desired product (45 mg)
1H NMR b 7.68 (br, 1 H) , 7.35 (dm, 1 H, J=7.8 Hz) , 7.25
(apparent t, 1 H, J=7.8 Hz), 7.15 (dm, 1 H, J=7.8 Hz),
6.12 (m', 1 H), 3.22 (m, 2 H), 3.03 (t, 2 H, J=7.3 Hz),
2.78 (t, 2 H, J=5.5 Hz), 2.70-2.50 (m, 4 H), 2.10 (s, 3
H) , 1.87 (p, 2 H, J=7.3 Hz) .
T E R T - B U T Y L
4-[3-(ACETYLAMINO)PHENYL]-1-PIPERIDINECARBOXYLATE: A
mixture tert-butyl 4-[3-(acetylamino)phenyl]-
1,2,3,6-tetra-hydro-1-pyridinecarboxylate (710 mg) and 50
Pd/C (100 mg) in EtOH (10 mL) was hydrogenated (balloon
technique) at room temperature overnight. The reaction
mixture was passed through a pad of Celite 545 and the pad
of Celite was washed with ethanol. The combined ethanol
extracts were concentrated and chromatograghed, giving the
desired product (660 mg). 1H NMR b 7.80 (s, 1 H), 7.41-7.20
(m, 3 H), 6.94 (d, 1 H, J=7.5 Hz), 4.21 (m, 2 H), 2.75 (m,
2 H), 2.62 (m, 1 H), 2.16 (s, 3 H), 1.78 (m, 2 H), 1.56
(m, 2 H) , 1. 48 (s, 9 H) .
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-173-
N1-[3-(4-PIPERIDYL)PHENYL]ACETAMIDE: A solution of HCl in
dioxane (4N, 5 mL) was added to tert-butyl
4-[3-(acetylamino)-phenyl]-1-piperidinecarboxylate (660
mg) in dry dichloromethane (15 mL). The reaction mixture
was stirred at room temperature overnight and concentrated
in vacuo, giving the desired product (550 mg): mp 102-104
°C; '-H NMR ~ 2.02 (d, J=13.2 Hz, 2H), 2.11-2.45 (m, 5H),
2.67-2.77 (m, 1H), 3.00-3.10 (m, 2H), 3.51 (d, J=10.5 Hz,
2H), 6.94 (d, J=7.5 Hz, 1H), 7.20-7.46 (m, 3H), 7.60 (s,
1H) .
TERT-BUTYL N-(3-{4-[3-(ACETYLAMINO)PHENYL]PIPERIDINO}
PROPYL)-CARBAMATE: A solution of N1-[3-(4-piperidyl)
phenyl]acetamide (550 mg, 0.210 mmol), tert-butyl
N-(3-bromopropyl)-carbamate (550 mg, 0.230 mmol), K~C03
(1.10 g, 0.890 mmol), diisopropylethyl amine (1.50 mL) and
a few crystals of KI in dioxane (20 mL) was heated at
reflux temperature for 2 days. The precipitated salts
were removed by filtration, concentrated in vacuo and the
crude product was chromatographed, giving the desired
product (340 mg) . 1H NMR ~ 8 .15 (s, 1 H) , 7 .47-7 .44 (m, 2
H), 7.22 (t, 1 H, J=7.8 Hz), 6.94 (d, 1 H, J=7.8 Hz), 5.53
(b, 1 H), 3.23 (b, 6 H), 2.80-1.60 (m, 9 H), 2.20 (s, 3
H) , 1.45 (s, 9 H) .
N1-{3-[1-(3-AMINOPROPYL)-4-PIPERIDYL]PHENYL}ACETAMIDE: TFA
(1.0 mL) was added to a solution of tert-butyl
N - ( 3 - { 4 - [ 3 - ( a c a t y 1 -
amino)phenyl]piperidino}propyl)carbamate (340 mg) in dry
dichloromethane (10 mL) and stirred at room temperature
for 5 h. A 10o aqueous solution of KOH was added to the
reaction mixture until pH > 6 and then the dichloromethane
was removed in vacuo. The aqueous layer was frozen and
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-174-
lyophilized, giving a solid which was then extracted with
methanol. Removal of methanol gave the desired product
(120 mg) as an oil. 1H NMR 8 8.56 - 8.46 (s, 1H), 7.43 -
7.30 (m, 2H), 7.23 - 7.16 (apparent t, 1H, J=7,5 Hz), 6.95
- 6. 92 (m, 1H) , 3.03 - 2. 99 (m, 2H) , 2.77 - 2.73 (t, 2H,
J = 6.6 Hz), 2.50-1.60 (m, 10 H), 2.13 (s, 3 H).
1-BENZYL-4-HYDROXY-4-(4-FLUORO-2-METHYLPHENYL)PIPERIDINE:
'H NMR 8 7.40-7.26 (M, 5 H), 6.91-6.76 (m, 3 H), 3.57 (s,
2 H), 2.83- 2.72 (m, 2 H), 2.61 (s, 3 H), 2.58-2.43 (m, 2
H), 2.23-2.12 (m, 2 H).
1-BENZYL-4-(4-FLUORO-2-METHYLPHENYL)-1,2,3,6-TETRAHYDROP
YRIDINE: 1H NMR 8 7.41-7.26 (m, 5 H), 7.05 (dd, 1 H, J=6.0,
8.1 Hz), 6.87-6.80 (m, 2 H), 5.52-5.50 (m, 2 H), 3.65 (s,
2 H) , 3.13 (q, 2 H, J=3.3 Hz) , 2. 69-2.66 (t, 2 H, J=5.1
Hz), 2.35-2.31 (m, 2 H), 2.27 (s, 3 H).
4-(4-FLUORO-2-METHYLPHENYL)PIPERIDINE: 1H NMR $ 7.17 (t, 1
H, J=7.2 Hz), 6.83-6.80 (m, 2 H), 3.22 (m, 2 H), 2.81-2.73
(m, 2 H), 2.66 (br s, 1 H), 2.33 (s, 3 H), 1.80-1.60 (m,
4 H) .
1-BENZYL-4-(3,4,5-TRIFLUOROPHENYL)-1,2,3,6-TETRAHYDROPYR
IDINE: 1H NMR 8 7.50-7.20 (m, 7 H), 5.67 (m, 1 H), 3.69 (s,
2 H), 3.19 (apparent q, 2 H, J=2.7 Hz), 2.75 (t, 2 H,
J=5.7 Hz), 2.34 (m, 2 H).
4-(3,4,5-TRIFLUOROPHENYL)PIPERIDINE: mp 197-199 °C; 1H NMR
~ 2.05 (d, J=13.2 Hz, 2H), ), 2.33 (dd, J=25.5 Hz, J=12.9
Hz, 2H), 3.06-3.23 (m, 3H), 3.73 (d, J=12.0 Hz, 2H),
6.94-7.04 (m, 2H).
4-(3,4,5-TRIFLUOROPHENYL)PIPERIDINE: 1H NMR 8 7.20-6.80 (m,
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-175-
2 H) , 3.73 (m, 2 H) , 3.14 (m, 3 H) , 2.33 (m, 2 H) , 2 . 05
(m, 2 H) .
T E R T - B U T Y L
N-3-[4-(3,4,5-TRIFLUOROPHENYL)PIPERIDINO]PROPYL-CARBAMATE:
~H NMR 8 6. 91 (m, 2 H) , 5. 62 (b, 1 H) , 4.31 (t, 2 H, J=5.4
Hz), 3.63 (m, 2 H), 3.39 (dt, 2 H, J= 2.1, 6.0 Hz),
3.40-2.70 (m, 7 H), 2.46 (t, 2 H, J=6.9 Hz), 2.10-1.60 (m,
4 H) , 1.45 (s, 9 H) .
3-[4-(3,4,5-TRIFLUOROPHENYL)PIPERIDINO]-1-PROPANAMINE: 1H
NMR 86.93 (m, 2 H), 4.30 (b, 1 H), 3.36 (b, 1 H), 3.06 (m,
2 H), 2.77 (m, 2 H), 2.43 (m, 2 H), 2.20-1.40 (m, 9 H).
1-BENZYL-4-(5-FLUORO-2-METHOXYPHENYL)-4-PIPERIDINOL:1H NMR
cS7.40-6.80 (m, 8 H), 3.94 and 3.85 (s, 3 H), 3.61 and 3.58
(s, 2 H), 2.80-1.90 (m, 8 H).
1-BENZYL-4-(5-FLUORO-2-METHOXYPHENYL)-1,2,3,6-TETRAHYDRO
PYRIDINE: 1H NMR 8 7.40-6.70 (m, 8 H), 5.84 (m, 1 H), 3.77
(s, 3 H), 3.64 (s, 2 H), 3.17 (m, 2 H), 2.68 (t, 2 H,
J=5.7 Hz), 2.54 (m, 2 H).
4-(5-FLUORO-2-METHOXY)PHENYL PIPERIDINE: mp 254-258 °C; 1H
NMR X1.53-1.68 (m, 2H), 1.79 (d, J=11.7 Hz, 2H), 2.12 (dt,
J=2.1 Hz, J=11.7 Hz, 1H), 2.77 (dt, J=1.8 Hz, J=12.3 Hz,
1H), 2.90-3.05 (m, 1H), 3.10-3.22 (m, 2H), 3.68 (s, 1H),
3.79 (s, 3H), 6.72-6.93 (m, 3H). Anal. Calcd. For
Ci=H1~NOFC1 + 0.14 CH~Cl~: C, 56.60; H, 6.76; N, 5.44.
Found: C, 56.60; H, 6.92; N, 5.28.
T E R T - B U T Y L
N-3-[4-(5-FLUORO-2-METHOXYPHENYL)PIPERIDINO]PROPYL-
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-176-
CARBAMATE: 1H NMR 8 6.90-6.70 (m, 3 H), 5.76 (b, 1 H), 3.80
(s, 3 H), 3.68 (m, 1 H), 3.40-2.90 (m, 4 H), 2.45 (t, 2 H,
J=6. 6 Hz) , 2.20-1. 60 (m, 9 H) , 1 . 45 (s, 9 H) .
3-[4-(5-FLUORO-2-METHOXYPHENYL)PIPERIDINO]-1-PROPANAMINE:
1H NMR 8 7 .00-6.80 (m, 3 H) , 3. 80 (s, 3 H) , 3.05 (d, 2 H,
J=11.4 Hz), 2.76 (t, 2 H, J=6.9 Hz), 2.43 (dd, 2 H, J=7.8
Hz), 2.05 (dt, 2 H, J=2.4, 11.7 Hz), 1.90-1.20 (m, l0 H).
T E R T - B U T Y L
4-(1-NAPHTHYL)-1,2,3,6-TETRAHYDRO-1-PYRIDINECARBOXYL-ATE:
1H NMR 8 8.00-7.80 (m, 2 H), 7.76 (d, 1 H, J=8.1 Hz),
7.50-7.44 (m, 2 H), 7.42 (d, 1 H, J=8.1 Hz), 7.27 (d, 1 H,
J=8.1 Hz), 5.76 (br, 1 H), 4.14 (m, 2 H), 4 or 3.29 (t, 2
H, J=5.7 Hz), 2.52 (br m, 2 H), 1.53 (s, 9H).
4-(1-NAPHTHYL)PIPERIDINE: HC1 salt; mp 330-332 °C; 1H NMRB
1.66-1.70 (m, 2H), 2.20-2.26 (m, 2H), 2.30-2.43 (m, 2H),
2.72-2.84 (m, 1H), 3.15-3.26 (m, 2H), 7.42-7.56 (m, 4H),
7.78 (d, J=8.1 Hz, 1H), 7.90 ( d, J=8.1 Hz, 1H), 8.04 (d,
J=8 . 1 Hz, 1H) . Anal . Calcd. For Cl,Hi8NOC1 + 0 . 20 CHnCl-, : C,
68.96; H, 7.00; N, 5.29. Found: C, 68.64; H, 7.04; N,
5.24.
TERT-BUTYL N-3-[4-(1-NAPHTHYL)PIPERIDINO]PROPYLCARBAMATE:
'-H NMR88.09 (d, 1 J=8.4 Hz),7.86 (dd,1 H, J=1.8,
H, 7.5
Hz), 7.71 (dd, 1 J=2.4, Hz), 7.60-7.30 (m, 4 H),
H, 6.9
6. 31 (br, 1 H) 5.75 (br, 1 4 .26 (t, 1 H, J=5. 4
, H) , Hz) ,
3.40-3.00 (m, H), 2.54 (t, H, 6.9 Hz),
6 2 J= 2.24
(dt,
2
H, J= 3.0, 11.4 Hz), 2.00-1.60 (m, H), 1.45 (s, 9 H).
6
4-(3-METHYL-2-PYRIDYL)-4-PIPERIDINOL: 1H NMR88.21 (dd, 1
H, J=1.2, 4.5 Hz), 7.36 (dd, 1 H, J=6.6, 7.8 Hz), 7.02
(dd, 1 H, J=4.8, 7.5 Hz), 3.07 (dt, 2 H, J=2.7, 12.3 Hz),
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-177-
2.89 (m, 2 H) , 2.46 (s, 3 H) , 2.22 (dt, 2 H, J=4.8, 12.3
Hz), 1.39 (dm, 2 H, J=12.3 Hz).
T E R T - B U T Y L
4-(3-METHYL-2-PYRIDYL)-1,2,3,6-TETRAHYDRO-1-PYRIDINE-
CARBOXYLATE : 1H NMR ~ 8 . 16 ( dd, 1 H, J=1 . 2 , 3 . 3 Hz ) , 7 . 51
(dm, 1 H, J=7.5 Hz), 7.15 (dd, 1 H, J=4.8, 7.5 Hz), 5.73
(br, 1 H) , 4 .01 (m, 2 H) , 3.59 (t, 2 H, J=5.7 Hz) , 2 . 40
(m, 2 H) , 1. 44 (s, 9 H) .
T E R T - B U T Y L
N-3-[4-(3-METHYL-2-PYRIDYL)PIPERIDINO]PROPYLCARBAMATE: 1H
NMR88.37 (dd, 1 H, J=4.2, 4.8 Hz), 7.51 (dd, 1 H, J=7.2,
7.5 Hz), 7.20 (dd, 1 H, J=4.5, 7.5 Hz), 6.73 (br, 1 H),
3.26 (m, 4 H) , 3.05 (d, 2 H, J=12.0 Hz) , 2. 80-2 . 40 (m, 4
H) , 2. 61 (s, 3 H) , 1 . 82 (p, 2 H, J=6. 3 Hz) , 1.54 (d, 2 H,
J= 12.0 Hz).
T E R T - B U T Y L
4-(3-METHOXYPHENYL)-1,2,3,6-TETRAHYDRO-1-PYRIDINECARB
OXYLATE : 1H NMR 8 7 . 23 ( t, 1 H, J= 8 . 1 Hz ) , 6 . 96 ( d, 1 H,
J=7.5 Hz), 6.89 (d, 1 H, J=1.8 Hz), 6.80 (dd, 1 H, J=2.4,
8.1 Hz), 6.02 (br, 1 H), 4.20-4.00 (m, 3 H), 3.80 (s, 3
H) , 3. 62 (t, 2 H, J=5.7 Hz) , 2.51 (br, 2 H) , 1.49 (s, 9
H).
1-BENZYL-4-METHYL-PIPERIDZN-4-OL: Methyllithium (1.4 M in
Et.,O, 54.0 mL) was added to a solution of
1-benzyl-4-piperidone (5.00 mL, 27.0 mmol) in anhydrous
ether at -78 °C under argon. Stirring was continued at -78
"C for 1.5 hours. Ether (200 mL) and water (40 mL) -were
added, and the two phases were separated. The aqueous
solution was extracted with Et,O (3 x 50 mL). The combined
organic solutions were dried over magnesium sulfate and
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-178-
concentrated. The residue was chromatographed (EtOAc to
EtOAc-MeOH 9/1), giving 4.81 g (870) of the desired
product as a colorless oil: 1H NMR 8 1.21 (s, 3 H) , 1 .56
(dt, J - 13, 3 Hz, 2 H), 1.65 (td, J = 10, 4 Hz, 2 H),
2 .35 (td, J = 10, 3 Hz, 2 H) , 2.53 (m, 2 H) , 7 .24 (m, 1
H) , 7 .29 (m, 4 H) ; 13C NMR 8 30. 44, 39.37, 50.39, 63. 80,
X8.50, 127.56, 128.80, 129.80, 139.17.
1-BENZYL-4-METHYL-4-PHENYLPIPERIDINE: 1-Benzyl-4-methyl-
piperidin-4-of (4.81 g, 23.4 mmol) was added to a
suspension of AlCl~ (15.62 g, 117 mmol) in benzene (100
mL) at room temperature under argon. The mixture was
stirred at reflux for 24 hours, then cooled and poured
cautiously into ice water (100 g of ice, 50 mL of water).
The aqueous phase was adjusted to pH 11-12 by addition of
6 N aqueous NaOH at 0 °C, and extracted with EtOAc (3 x 100
mL). The combined organic solutions were dried over
magnesium sulfate and concentrated. The residue was
chromatographed (hexane- Et~O 19/1 to 9/1, followed by
hexane-EtOAc 3/1), giving the desired product (3.23 g,
520) as a brown oil: 1H NMR81.25 (s, 3 H), 1.80 (m, 2 H),
2. 17 (m, 2 H) , 2.44 (m, 2 H) , 2.55 (m, 2 H) , 3.50 (s, 2
H) , 7 .25 (m, 1 H) , 7.35 (m, 4 H) ; 13C NMR 8 36.82, 37 . 65,
50.95, 54.93, 64.08, 126.19, 126.51, 127.59, 128.83,
128.95, 129.05, 129.89, 139.24.
4-METHYL-4-PHENYLPIPERIDINE: Freshly prepared methanolic
formic acid solution (4.4% by weight, 70 mL) was added to
1-benzyl-4-methyl-4-phenylpiperidine (3.23 g, 12.2 mmol).
To the resulting solution was added 10o palladium on
carbon (2.00 g). The mixture was stirred at room
temperature for 24 hours. The solid was filtered out and
washed with MeOH (30 mL) , H~O (15 mL) , CHzCl2 (30 mL) and
MeOH (15 mL). The combined filtrate and washings were
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-179-
concentrated, and the residue was dissolved in CH~Cl~ (50
mL) and Hz0 (10 mL). The aqueous phase was adjusted to pH
11 by addition of 1 N aqueous NaOH. The organic phase was
separated, dried over magnesium sulfate and concentrated.
The residual oil was purified by flash chromatography
(CHC13/MeOH/2 N NH3 in MeOH 100/4/0 to 100/20/10), giving
1-benzyl-4- methyl-4- phenylpiperidine (1.20 g) and 1.10
g (510, 82o based on consumed starting material) of
4-methyl-4-phenylpiperidine: '-H NMR81.24 (s, 3 H), 1.71
(m, 2 H), 2.06 (m, 2 H), 2.82 (m, 3 H), 2.94 (m, 2 H),
7.19 (m, 1 H), 7.32 (m, 4 H); 1'C NMR 837.22, 38.54, 43.44,
47.74, 126.31, 127.43, 129.01, 149.73.
3-AMINOPROPYL-4-METHYL-4-PHENYLPIPERIDINE: A solution of
4-methyl-4-phenylpiperidine (I.00 g, 5.70 mmol), 3-bromo-
propylamine hydrobromide (1.87 g, 8.55 mmol) and potassium
carbonate (1.97 g, 14.2 mmol) in refluxing dioxane (20 mL)
was stirred for 36 hours. After removal of the solvent,
water (50 mL) was added and the pH adjusted to 11-12 by
the addition of 1 N aqueous NaOH. The mixture was
extracted with CH~Cl.~ (150~mL + 3 x 100 mL). The combined
organic solutions were dried over magnesium sulfate and
concentrated. The residue was purified by flash
chromatography (CHC13/MeOH/2 N NH3 in MeOH 100/20110),
giving the desired product as a colorless oil (241 mg,
18 0) : ~H NMR81.18 (s, 3 H) , 1. 61 (p, J = 7 Hz, 2 H) , 1.75
(m, 2 H) , 2 .10 (m, 2 H) , 2.33 (t, J = 7 Hz, 2 H) , 2 . 40 (m,
2 H) , 2.45 (m, 2 H) , 2.72 (t, J = 6 Hz, 2 H) , 3.02 (br s,
2 H), 7.14 (m, 1 H), 7.30 (m, 4 H); 1~C NMR830.28, 36.78,
37.64, 41.51, 50.96, 57.51, 126.16, 126.40, 128.91,
149.20.
Preparation of 3-[4-(4-Fluorophenyl)piperidin-
1-yl]propylamine
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-180-
4-(4-FLUOROPHENYL)PIPERIDINE HYDROCHLORIDE: To a solution
of 4-(4-fluorophenyl)-1,2,3,6-tetrahydropyridine
hydrochloride (10 g) in methanol (200 mL) was added l00
palladium on charcoal (0.5 g) and the mixture was
hydrogenated at 50 psi for 3 h. The catalyst was removed
by filtration and solvent was evaporated, leaving the
product (10.0 g) as a white powder, which was used in the
next step without purification. The product appeared to be
pure based on 1H NMR and TLC analysis . 1H NMR 8 1 . 95-2 . 03 (br
d, 2H), 2.14-2.29 (m, 2H), 2.70-2.80 (m, 1H), 2.91-3.07
(br q, 2H), 3.60-3.64 (br d, 2H), 6.96-7.03 (m, 2H),
7 . 19-7 . 22 (m, 2H) , 9. 60 (br s, 1H) , 9. 71 (br s, 1H) .
4-(4-FLUOROPHENYL)PIPERIDINE: mp °C; 1H NMR81.51-1.66 (m,
2H), 1.80 (d, J=7.2 Hz, 2H), 2.53-2.64 (m, 1H), 2.67-2.77
(m, 2H), 3.17 (d, J=12.0 Hz, 2H), 6.94-7.03 (m, 2H),
7.13-7.21 (m, 2H).
Anal. Calcd. For C11H1qNF + C,H40~: C, 58.70; H, 5.83; N,
4.18.
Found: C, 58.72; H, 5.84; N, 3.98.
3-[4-(4-FLUOROPHENYL)PIPERIDIN-1-YL]PROPYLPHTHALIMIDE: A
mixture of 4-(4-fluorophenyl)piperidine hydrochloride
(5.08 g, 23.2 mmol), 3-bromopropylphthalimide (6.22 g,
23.2 mmol), and potassium,carbonate (15 g) in DMF (100 mL)
was stirred at 95-100 °C for 12 h. About 800 of the
solvent was evaporated under reduced pressure. The
residue was diluted with ethyl acetate (200 mL) and washed
with brine (3 X 100 mL) and dried (Na~SOq) . The solvent
was evaporated from the ethyl acetate solution and the
residue was purified by column chromatography (1/1
hexane-ethyl acetate to 1000 ethyl acetate), giving crude
product (7.50 g, 880). This crude product was crystallized
from isopropanol, giving a white crystalline solid (4.50
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-181-
g, 1st crop). This material was used in the next step.
Concentration of the mother liquor and cooling gave the
second crop of desired product (1.0 g). 1H NMR81.43-1.52
(m, 2H), 1.67-1.75 (m, 2H), 1.80-1.96 (m, 4H), 2.33-2.46
(m, 3H), 2.94-2.99 (br d, 2H), 3.78 (t, J=7 Hz, 2H),
6.90-7.04 (m, 4H), 7.70-7.74 (m, 2H), 7.84-7.87 (m, 2H).
3-[4-(4-FLUOROPHENYL)PIPERIDIN-1-YL]PROPYLAMINE:
Hydrazine (4 mL) was added to a solution of
3-[4-(4-fluorophenyl)piperidin- 1-yl]propylphthalimide
(4.50 g, 12.3 mmol) in methanol (200 mL), and the mixture
was stirred at reflux for 8 h. The solution was cooled to
room temperature, and the resulting white solid which
formed was filtered and washed with methanol (20 mL). The
solvent was evaporated from the filtrate and residue was
dried under vacuum for 4 h. The crude product was
dissolved in 50 mL of chloroform, stirred for 1 h, and
filtered. The white solid was washed with additional
chloroform (20 mL), the solvent was evaporated from the
combined filtrates to leave the crude product as an oil.
The oil was purified by column chromatography
(dichloromethane / methanol / 2 M ammonia in methanol,
10/3/1), giving the desired product (2.70 g, 930). 1H NMR
cS 1.60-1.83 (m, 6H), 1.96-2.07 (m, 4H), 2.40-2.55 (m, 3H),
2.70-2.85 (br t, 2H), 3.03-3.07 (br d, 2H), 6.93-7.00 (m,
2H), 7.14-7.20 (m, 2H).
4-(4-METHYL-4-(3,5-DIMETHYLPHENYL)PIPERIDINE: hygroscopic;
1H NMR81.20 (s, 3H), 1.74=2.80 (m, 2H), 2.08-2.26 (m, 2H),
2.30 (s, 6H), 2.50-2.56 (m, 2H), 2.64-2.68 (m, 2H),
2.97-3.04 (m, 1H) , 6.87 (s, 1H) , 6.94 (s, 2H) .
BENZYL 4-{[(TERT-BUTOXYCARBONYL)AMINO]METHYL}
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-182-
CYCLOHEXYLCARBAMATE:
Oxalyl chloride (1.1 equivalents) was added dropwise to a
mixture of 4-[[(tert-butoxycarbonyl)-amino]methyl]
cyclohexanecarboxylic acid (1 equivalent, Maybridge) in
toluene. The reaction mixture was stirred at room
temperature for 2-6 h. The solvent was removed in vacuo,
the residue was dissolved in acetone and the resulting
mixture was added dropwise to an aqueous solution of
sodium azide (1.2 equivalents) at a rate such as to
maintain a temperature of 10-15 °C. After the completion
of the reaction, the reaction mixture was extracted with
ethyl acetate, the combined extracts were dried and
concentrated in vacuo. The residue was dissolved in
acetone and added slowly to warm (60 °C) benzene. After
the completion of the reaction, benzyl alcohol was added
to the reaction mixture, stirred for 2 days and the
desired product was isolated (For Typical References, See:
G. Schroeter Ber. 1909, 42, 3356; and Allen, C.F.H.; Bell,
A. Org. Syn. Coll. Vol. 3 (1955) 846. ) .
A s o 1 a t i o n o f b a n z y 1
4-{[(tert-butoxycarbonyl)amino]methyl}-cyclohexylcarbamate
in MeOH containing loo Pd/C was hydrogenated at 50 psi
overnight. The reaction mixture was filtered through
Celite 545 and the Celite 545 was washed with methanol.
The combined methanol extracts were concentrated in vacuo,
giving trans-tert-butyl 4-aminocyclohexylmethylcarbamate
(95 0) .
3 0 9 H - 9 - F L U O R E N Y L M E T H Y Z
N-[4-(AMINOMETHYL)CYCLOHEXYL]CARBAMATE: . 1H NMR 88.02 (br,
1 H) , 7.33 (m, 5 H) , 5.07 (s, 2 H) , 3.71 (s, 1 H) , 3.40
(br m, 1 H), 2.80 (br m, 2 H), 1.94 (ABq, 4 H), 1.68 (br,
1 H), 1.30-1.00 (m, 5 H).
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-183-
N1-[4-(AMINOMETHYL)CYCLOHEXYL]-1-NAPHTHAMIDE: HC1 in
dioxane (10 mL, 4 N) was added to' a solution of tert-
butyl[4-(1-naphthoyl-amino)cyclohexyl]methylcarbamate
(0.350 g) in dichloromethane (20 mL), stirred overnight,
concentrated in vacuo, giving the desired product: 1H NMR
cS8.24 (dd, 1 H, J=1.2, 8.7 Hz), 7.85 (dt, 2 H, J=2.7, 9.7
Hz) , 7 . 60-7.30 (m, 4 H) , 5.98 (m, 1 H) , 4.02 (m, 1 H) ,
3.80-3.40 (m, 4 H), 2.53 (d, 2 H, J=6.0 Hz), 2.02 (ABq, 4
H), 1.41-1.90 (m, 4 H).
TERT-BUTYL N-(4-[(1-NAPHTHYLCARBONYL)AMINO]
CYCLOHEXYLMETHYL)-CARBAMATE: A mixture of 1-naphthoic acid
(1.00 mmol, 0.172 g), DMAP (2.00 mmol, 0.250 g) and ECD
(0.383 g, 2.00 mmol) in dry dichloromethane (20 mL) was
stirred at room temperature for 0.5 h followed by the
addition of tert-butyl(4-amino)cyclohexyl)methyl-carbamate
amine (1.09 mmol, 0.250 g). The reaction mixture was
stirred at room temperature overnight and purified by
flash chromatography, giving the desired product as a
white solid (0.160 g): 1H NMR88.29 (dd, 1 H, J=1.8, 9.1
Hz) , 7 . 89 (m, 2 H) , 7 . 60-7 . 40 (m, 4 H) , 5. 85 (br d, 1 H,
J=6.3 Hz), 4.65 (m, 1 H), 4.04 (m, 1 H), 3.02 (t, 1 H,
J=6.3 Hz) , 2. 05 (ABq, 4 H) , 1. 62 (m, 2 H) , 1 .46 (s, 9 H) ,
1.40-1.10 (m, 4 H).
-
4-ACETYL-1-(3-AMINOPROPYL)-4-PHENYLPIPERIDINE: A solution
of 4-Acetyl-4-phenylpiperidine (7, 1.53 g, 7.50 mmol),
3-bromo-propylamine hydrobromide (1.64 g, 7.50 mmol) and
potassium carbonate (1.24 g, 9.00 mmol) was stirred in
refluxing 1,4-dioxane (50 mL) for 12 h. After removal of
dioxane, water (50 mL) was added and the pH was adjusted
to 11-12 by addition of 1 N aqueous NaOH. The mixture was
extracted with CHzCl~ (100 mL + 3 x 50 mL). The combined
organic solutions were dried over magnesium sulfate and
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-184-
concentrated. The residue was purified by flash
chromatography (EtOAc-MeOH-Et3N 100/40/20), giving the
desired product as a colorless oil (780 mg, 40%): -H NMR
8 1 . 56 (p, J = 7 Hz, 2 H) , 1. 84 (s, 3 H) , I . 98 (m, 2 H) ,
2.15 (br t, J = 12 Hz, 2 H), 2.29 (t, J = 7 Hz, 2 H), 2.41
(br d, J = 12 Hz, 2 H) , 2. 66 (t, J = 7 Hz, 4 H) , 7. 18 -
7.30 (m, 5 H); 23C NMRS 26.28, 31.11, 33.43, 41.47, 51.62,
55.31, 57.19, 77.32, 77.74, 78.17, 126.95, 127.69, 129.44,
142.25, 210.15.
For the preparation of benzo-4',5'[H]furanpiperidine refer
to W.E.Parham et a1, J. Org. Chem. (1976) 41, 2268.
TERT-BUTOXY{[3-(BENZO-4',5'[H]FURANPIPERIDIN-1-
YL)PROPYL]AMINO}METHANOL: To a stirred solution of the
N- [4- (benzo-4', 5' [H] furanpiperidine (0.566 g, 3.27 mmol)
i n d i o x a n a ( 2 0 m L ) ,
N-(tert-butoxycarbonyl)-3-bromopropylamine (0.772 g, 3.27
mmol) and potassium carbonate (0.904 g, 6.54 mmol) were
added and the solution was refluxed for 24 h. The
reaction mixture was cooled to room temperature,
concentrated and partitioned between chloroform (40 mL)
and water (5 mL). The organic layer was dried over sodium
sulfate, filtered and concentrated. The crude product was
purified by column chromatography (ethyl acetate/
methanol, 4.5/0.5), giving the desired product as a
colorless oil (0.856 g, .79 0) ; 1H NMR (1.45 (s, 9 H) ,
1.63-2.04 (m, 6 H), 2.33-2.52 (m, 4 H), 2.87 (d, J=11.0
Hz, 2 H) , 3.2 (br s, 2 H) , 5.07 (s, 2 H) , 5. 6 (br s, 1 H) ,
7.13-7.28 (m, 4 H).
3-(4-METHYL-4-PHENYL-1-PIPERDINYL)PROPYLAMINE:
Trifluoroacetic acid (1 mL) was added to tert-butoxy{[3-
(4-methyl-4-phenyl-1-piperdinyl)propyl]-
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-185-
amino}methanol(0.500 g, 1.51 mmol) in dichloromethane (5
mL) and the solution was stirred at room temperature for
1 h. The solution was concentrated, neutralized with 10
KOH solution and extracted with dichloromethane (25 mL).
The organic layer was dried over sodium sulfate, filtered
and concentrated, giving 0.340 g (98o) of 3-(4-methyl-4-
phenyl-1-piperdinyl)propylamine which was used without
further purification in the subsequent step.
Procedures for the Reaction of the Amine Side Chains with
the p-Nitrophenylcarbamate Intermediates:
General Procedure:
An equimolar solution of an amine side chain such as 3-(4-
methyl-4-phenyl-1-piperdinyl)propylamine and a
p-nitrophenylcarbamate intermediate such . as
5 - m a t h o x y c a r b o n y 1 - 4 - m a t h o x y m a t h y 1 -
1,2,3,6-tetrahydro-2-oxo-6-(3,4-difluorophenyl)-1-[(4-ni
trophen-yloxy)carbonyl]pyrimidine and 1-2 equivalents of
a base such as diisopropylethylamine in dichloromethane
were stirred at room temperature overnight. The reaction
mixture was concentrated and purified by flash
chromatography, giving the desired product. In case of
2-methoxy intermediates, conversion to the oxo derivatives
was accomplished by treatment of the 2-methoxy product
with HC1 in dioxane.
2-OXO-3-{SPIRO[1H-INDANE-1,4'-PIPERIDINE]PROPYLAMINE(0.0
319 g, 0.123 mmol) was added to (~)-6-(3,4-difluoro
phenyl)-1,6-dihydro- 2-methoxy-5-methoxycarbonyl
4-ethyl-1-(4-nitrophenoxy)carbonyl-pyrimidine (0.052 g,
0.112 mmol) in dry dichloromethane (10 mL) and the
solution was stirred at room temperature for 24 h. The
reaction mixture was stirred for another 1 h after
addition of 6 N HCl (2 mL). After neutralization with
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-18 6-
aqueous loo KOH solution, the reaction mixture was
extracted into dichloromethane (3 x 10 mL). The organic
layer was dried over sodium sulfate, filtered and
concentrated. The crude product was purified by flash
chromatography (EtOAc/ MeOH, 4.5/0.5), giving of the
desired product (0.040 g) as a syrup.
1 N HC1 in ether (5 mL) was added to the free base (0.040
g, 0.072 mmol) in dichloromethane (4 mL) and the solution
was concentrated under reduced pressure. The crude
product was recrystallized from ether, giving the desired
compound (0.042 g, 99 0) as a pale yellow solid; mp
178-182 °C; Anal. Calcd. for C~qH34F~N90~C1~ + 0.6 H~O: C,
57.87; H,5.73, N 9.31. Found: C, 58.11; H 5.90; N 8.95.
General Procedure for the reaction of the piperidines and
piperazines with 1-(3-bromo-propylcarbamoyl)
-6-(3,4-difluoro-phenyl)-4-methyl-2-oxo-1,6-dihydro-
pyrimidine-5-carboxylic acid methyl ester:
The amine (0.15 mmol) .was added to a solution of
1 - ( 3 - b r o m o -
- propylcarbamoyl)-6-(3,4-difluorophenyl)-4-methyl-2-oxo-1
6-di-hydropyrimidine-5-carboxylic acid methyl ester (43.0
mg, 0.100 mmol) in anhydrous acetone (10 mL), followed by
NaHC03 ( 41 mg, 0 . 3 mmol ) and KI ( 16 mg, 0 . 1 mmol ) . The
resulting suspension was heated to reflux for 10 h and
then cooled to room temperature. The solvent was removed
in vacuo and the residue was purified by flash column
chromatography (EtOAc, followed by EtOAc/MeOH, 9/1). The
product was then dissolved in 2 mL of chloroform, acetone
or EtOAc and HC1 in Et~O (1 M, 0.5 mL) was added at room
temperature. The solvent was removed in vacuo, giving the
desired compound as an HCl salt.
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-187-
Example 1
-1,2,3,6-TETRAHYDRO-1-{N-[4-(3,-ACETAMIDO)-PHENYL-PIPER
IDIN-1- YL]PROPYL}CARBOXAMIDO-4-METHOXYMETHYL-
6-(3,4-DIFLUORO-PHENYL)-2- OXOPYRIMIDINE-5-CARBOXYLIC ACID
METHYL ESTER: ESMS, 612.25 (M+1); 1H NMR 8 1.76-1.87 (m,
6H), 2.03-2.13 (m, 2H), 2.18 (s, 3H), 2.49 (t, J=6.9 Hz,
3H), 3.10 (d, J=11.1 Hz, 2H), 3.30-3.42 (m, 2H), 3.45 (s,
3H), 3.71 (s, 3H), 4.68 (s, 2H), 6.68 (s, 1H), 6.96 (d,
J=7.5 Hz, 1H), 7.04-7.11 (m, 2H), 7.16-7.26 (m, 2H), 7.34
(d, J=6.3 Hz, 1H), 7.45 (s, 1H), 7.94 (s, 1H), 8.98 (t,
J=5.4 Hz, 1H) .
Example 2
M E T H Y L
3-[(3-4-[3-(ACETYLAMINO)PHENYL]-1,2,3,6-TETRAHYDRO-1-PYR-
IDINYLPROPYL)AMINO]CARBONYL-4-(3,4-DIFLUOROPHENYL)-6-(ME
THOXY-METHYL)-2-OXO-1,2,3,4-TETRAHYDRO-5-PYRIMIDINE-
CARBOXYLATE: 1H NMR88.90 (t, 1 H, J=3.6 Hz), 7.75 (s, 1
H) , 7 .50-7 . 00 (m, 8 H) , 6. 68 (s, 1 H) , 6.03 (br s, 1 H) ,
4 . 67 (s, 2 H) , 3.71 (s, 3 H) , 3.47 (s, 3 H) , 3.38 (ABm, 2
H) , 3 .16 (m, 2 H) , 2.71 (t, 2 H, J =5. 4 Hz) , 2.56 (m, 4
H), 2.35-1.90 (br, 2 H), 2.17 (s, 3 H), 1.82 (p, 2 H,
J=7.2 Hz); ESMS, 612.25 (M+1).
Example 3
(1)-1,2,3,6-TETRAHYDRO-1-{N-[3-(4-O-ACETYL)-4-PHENYLPIPE
RIDIN-1- YL]PROPYL}CARBOXAMIDO-5-METHOXYCARBONYL-
4-METHOXYMETHYL-6-(3,4- DIFLUOROPHENYL)-2-OXOPYRIMIDINE:
4-Acetyl-1-(3-aminopropyl)- 4-phenylpiperidine (190 mg,
0.687 mmol) was added to a stirring solution of
5-methoxycarbonyl-4-methoxymethyl- 1,2,3,6-tetra-
hydro-2-oxo-6-(3,4-difluorophenyl)-1-[(4-nitrophenyloxy)
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-188-
carbon-yl]pyrimidine ('281 mg, 0.573 mmol) in dry
dichloromethane (3 mL) and THF (4 mL). The reaction
mixture was stirred at room temperature for 12 h. The
reaction mixture was quenched with aqueous 6 N HC1. The
reaction mixture was concentrated to a small volume,
partitioned between dichloromethane and water (100 mL
each), the mixture was adjusted to pH 8 by addition of
Na~C03, the layers were separated, and the aqueous layer
was extracted with dichloromethane (3 x 30 mL). The
combined organic extracts were dried (Na~S04) and the
product was chromatographed, giving the desired product.
The HC1 salt was prepared by the addition of 1 N HC1 in
ether to a solution of the product in CH~C1~. The
precipitated salt was filtered, washed with ether and
d r i a d i n ' v a c a o , g i v i n g
(1)-1,2,3,6-tetrahydro-1-{N-[3-(4-0-acetyl)-4
phenylpiperidin-1-yl]propyl}carboxamido-5-methoxycarbony
1-4- methoxymethyl-6-(3,4-difluorophenyl)-2-oxopyrimidine
(170 mg, 47 0) as the hydrochloride salt: (C31H36N9F~0~ + HCl
+ 0. 6 CH~C1.,) ; mp 82-84 °C.
Example 4
Benzyl ester precursor to the product of Example 4:
(+)-1,2,3,6-TETRAHYDRO-1-{N-[4-(BENZO-4',5'(H)FURAN)PIPE
RIDIN-1- YL]PROPYL}-CARBOXAMIDO-4-ETHYL-6-
(3,4-DIFLUOROPHENYL)-2-OXO- PYRIMIDINE-5-CARBOXYLIC ACID
PHENYLMETHYL ESTER: 1H NMR87.60-7.00 (m, 12 H), 6.85 (br,
1 H), 6.62 (s, 1 H), 5.10 (ABq, 2 H), 5.67 (s, 2 H), 4.03
(br, 1 H), 4.01 (s, 3 H)~, 3.40 (apparent q, 2 H, J=6.8
Hz), 3.20-1.60 (m, 12 H), 2.86 (q, 2 H, J=2.5 Hz), 1.19
(t, 3 H, J=7.5 Hz) .
(+)-1,2,3,6-TETRAHYDRO-1-{N-[4-(BENZO-4',5'(H)FURAN)PIPE
R I D I N - 1 - Y L ] P R O P Y L } -
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-189-
CARBOXAMIDO-4-ETHYL-6-(3,4-DIFLUOROPHENYL)-
2-OXO- PYRIMIDINE-5 CARBOXYLIC ACID HYDROCHLORIDE: '-H NMR
58.95 (br s, 1 H), 8.22 (br s, 1 H), 7.40-6.95 (m, 7 H),
6.95 (s, 1 H), 6.63 (s, 1 H), 5.10-4.95 (m, 2 H),
3.40-3.20 (m, 4 H), 3.10-2.80 (m, 4 H), 2.55-2.20 (m, 1
H), 2.15 (m, 1 H), 1.85 (m, 2 H), 1.55-1.30 (m, 4 H), 1.20
( t, 3 H, J=7 . 6 Hz ) ; Anal . Calc . For C~9H3~N9OSF2 + HCl + 1 . 5
H..O: C, 56.36; H, 5.87; N, 8.06. Found: C, 56.72; H, 6.11;
N, 7.61.
Example 5
1,2,3,4-TETRAHYDRO-1-OXO-2-NAPHTHACETIC ACID METHYL ESTER:
Under argon, a.-tetralone (5.00 g, 34.2 mmol) in dry THF
(300 mL) was treated with LDA in THF (2 M, 18.8 mL) at -78
°C. The solution was stirred at -78 °C for 1 h. Methyl
bromoacetate (15.7 g, 0.103 mole) was then added to the
solution, the mixture was stirred overnight and allowed to
warm to room temperature.. The solvent was evaporated and
the residue was dissolved into CHCl~ (300 mL), washed with
water and saturated brine, and then dried over Na~S09.
After filtration and removal of solvent, the residue was
vacuum distilled. The product, a colorless oil (7.21 g,
96.5x) was collected at 180 °C/1 mm Hg; 1H NMR (400 Mhz) 8
1.98 (m, 1H), 2.25 (m, 1H), 2.44 (m, 1H), 2.90-3.20 (m,
4H), 3.73 (s, 3H), 7.10-8.10 (m, 4H); EI mass spectrum M+
at m/z 218.
1-HYDROXY-2-(2-HYDROXYETHYL)-1,2,3,4-TETRAHYDRONAPHTHALE
NE: A solution of 1,2,3,4-tetrahydro-1-oxo-naphthacetic
acid methyl ester (6.15 g, 28.2 mmol) in THF (150 mL) was
treated with LiAlH4 (2.82 g, 70.5 mmol) and then the
reaction mixture was heated at reflux temperature for 5 h.
The suspension was cooled to 0 °C and quenched by addition
of solid Na~S09~10 H.,O. The mixture was stirred at room
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-190-
temperature for 4 hrs. The solid was removed by
filtration and concentration of the filtrate in vacuo gave
a yellow oil (5.33 g, 98.30); 1H NMR indicated the
formation of an isomeric mixture. EI mass spectrum M+ at
m/z 192. The mixture was directly used in next reaction
without further purification.
2-(2-HYDROXYETHYL)-1,2,3,,4-TETRAHYDRO-1-OXO-NAPHTHALENE:
A solution of isomeric mixture of
1 - h y d r o x y 1 - 2 - ( 2 - h y d r o x y a t h y 1 ) -
1,2,3,4-tetrahydronaphthalene (3.00 g, 15.6 mmol) in CH~C1
(100 mL) was treated with MnO~ (20.4 g, 0.234 mole). The
suspension was stirred at room temperature for 16 h and
the solids were removed by filtration. Concentration of
the filtrate in vacuo gave a brown oil, which was further
purified by flash chromatography (MeOH/ CHC13 , 5/95),
giving a yellow oil (2.00 g, 67.40): 1H NMR 81.76 (m, 1H),
1. 98 (m, 1H) , 2.21 (m, 2H) , 2.57 (br, 1H) , 2.70 (m, 2H) ,
3.20 (m, 2H), 3.82 (m, 2H), 7.00-8.20 (m, 4H); CI mass
spectrum (M+1)+ at m/z 191.
2-(2-BROMOETHYL)-1,2,3,4-TETRAHYDRO-1-OXONAPHTHALENE: A
solution of 2-(2-hydroxethyl)-1,2,3,4-tetrahydro-
1-oxo-naphthalene (2.00 g, 10.5 mmol) in CH~C1~ (100 mL)
was treated with PBr3 (948 mg, 3.50 mmol) at 0 °C. The
mixture was stirred at room temperature for 72 h and then
poured onto 100 g of ice. The organic layer was
separated, washed with aqueous 10o KZC03 solution, H~O,
saturated NaCl and dried over Na~S04. After filtration and
removal of the solvent, the residue was purified by
chromatography (EtOAc/hexane, 1/10), giving a yellow oil
(1.18 g, 44.4 0) ; 1H NMR81.49 (m, 2 H) , 2.24 (m, 1H) , 2. 60
(m, 1H), 2.75 (m, 1H), 3.03 (m, 2H), 3.64 (m, 2H),
7.10-8.10 (m, 4H); EIMS M+ m/z 223, M/M+2=l: 1.
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-191-
2-[2-(4-BENZAMINO-1-PIPERIDYL)ETHYL]-1,2,3,4-TETRAHYDRO-
1-0X0- NAPHTHALENE: A mixture of 2-(2-bromoethyl)-1,2,3,4-
tetrahydro-1-oxonaphthalene (1.18 g, 4.66 mmol),
4-benzamidopiperidine (952 mg, 4.66 mmol) and K~CO: (1.29
g, 9.32 mmol) in acetone (200 mL) was stirred at room
temperature for 48 h. The solids were removed by
filtration. Concentration of filtrate in vacuo gave a
yellow solid which was purified by chromatography (MeOH:
CHC13, 5/95). The product was recrystallized from an
EtOAc/hexane mixture, giving a white powder (268 mg,
15. 3 0 ) ; mp 158-159 °C; 1H NMR ~ 1 . 53 (m, 2H) , 1 . 67 (m, 1H) ,
1.91 (m, 1H), 2.02 (m, 2H), 2.21 (m, 4H), 2.50 (m, 3H),
2.95 (m, 4H), 4.01 (m, 1H), 5.95 (d, J=8.0 Hz, 1H),
7.20-8.10 (m, 9H); CI MS (M+1) +m/z 377; Anal. Calcd for
C~~H_"N_O_: C, 76.55; H. 7.51; N, 7.44. Found: C, 76.28; H,
7.46; N, 7.37.
Example 6
M E T H Y L
4-(2,1,3-BENZOXADIAZOL-5-YL)-3-[(1-[4-(DIBUTYLAMINO)-
BENZYL]-4-PIPERIDYLMETHYL)AMINO]CARBONYL-6-METHYL-2-OXO-
1,2,3,4- TETRAHYDRO-5-PYRIMIDINECARBOXYLATE: 1H NMR ~ 7.72
(dd, 1 H, J=0. 6, 9. 6 Hz) , 7.70-7.50 (m, 2 H) , 7 . 11 (d, 2
H, J=8.7 Hz), 6.59 (d, 2 H, J=8.7 Hz), 5.90 (s, 1 H), 3.94
(s, 3 H), 3.63 (s, 2h), 3.24 (t, 4 H, J=7.8 Hz), 2.80 (m,
2 H) , 2.49 (d, 2 H, J=6..3 Hz) , 2.38 (s, 3 H) , 2.90-1.00
(m, 5 H), 1.54 (p, 4 H, J= 7.8 Hz), 1.35 (sextet, 4 H,
J=7 . 8 Hz ) , 0 . 94 ( t, 6 H, J=7 . 8 Hz ) .
Example 7
(+)-1,2,3,6-TETRAHYDRO-1-{N-[4-(N'-ETHYL)-N-BENZIMIDAZOL
Y L - .
PIPERIDIN-1YL]PROPYL}CARBOXAMIDO-4-METHYL-6-(3,4-DIFLUOR
OPHENYL)- 2-OXOPYRIMIDINE HYDROCHLORIDE: 1H NMRb 8.95 (t,
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-192-
1 H, J=3. 6 Hz) , 7. 61 (b, 7. 60-6.95 (m, H) , 6.
1 H) , 7 69
(s, 1 H), 4.36 (m, 1 H), 3.94 2 H, J=7.2 Hz), 3.72 (s,
(q,
3 H), 3.42 (ABm, 4 H), 3.30 (m 2 H, 4.76 (m, H), 2.43
, 4
(s, 3 H), 2.13 (m, 2 H), 1.77 (m, 4 H), 1.33 (t, 3
H,
J=7.2 Hz).
Example 8
6-(BENZOFURAZAN-5-YL)-1,2,3,6-TETRAHYDRO-5-METHOXYCARBON
YL-4- METHYL-2-OXO-1-{N-[3-(4-PHENYLPIPERIDIN-1-YL)
PROPYL]}CARBOXAMIDO-PYRIMIDINE: A solution of 6-(benzo-
f a r a z a n - 5 - y 1 ) - 1 , 6 - d i h y d r o - 2 -
methoxy-5-methoxycarbonyl-4-methyl-1-{N-[3-(4-phenylpipe
ridin-1- yl)propyl]}carboxamidopyrimidine in MeOH was
treated with 6 N HC1 at 0 °C. The solution was stirred at
room temperature for 2 h and the MeOH was removed in
v a c a o . 6 - (.B a n z o f a r a z a n - 5 - y 1 ) -
1,2,3,6-tetrahydro-5-methoxycarbonyl
- 4 - m a t h y 1 - 2 - o x o - 1 - { N - [ 3 - ( 4 -
phenylpiperidin-1-yl)propyl]}carboxamidopyrimidine
hydrochloride was obtained as a white powder: mp 134-137
''C .
Example 9
4-(3-METHOXY)-PHENYL PIPER IDINE:HC1
salt;
mp
150-154
"C;
~H NMR 8 2.04 (s, br, 2H) 2.25 (s, 2H) , 2.80 (s, br,
, br,
1H), 3.09 (s, br, 2H), 3. 66 2H), 3,78 (s, 3H), 6.79
(s,
(s, br, 3H), 7.23 (s, 1H), 9.41 (s, 1H). Anal. Calcd.
br,
For C1_H~aNOCl + 0.30 CH~Cl.,. C, 58.34;H, 7.40; N, 5.53.
Found: C, 58.30; H, 7.71; N,
5.35.
(+)-1,2,3,6-TETRAHYDRO-1-N-[4-(3-METHOXY)-PHENYL}-PIPERI
DIN-1- YL]-PROPYL-CARBOXAMIDO-4- METHOXYMETHYL-6- (3,4-
DIFLUOROPHENYL)- 2-OXOPYRIMIDINE-5-CARBOXYLIC ACID METHYL
ESTER: mp 80-84 °C; [a]I, _ +94.7, (c = 0.25, MeOH); =H NMR
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-193-
X1.74-1.84 (m, 6H), 1.99-2.09 (m, 2H), 2.38-2.51 (m, 3H),
3.03 (d, J=11.1 Hz, 2H), 3.24-3.43 (m, 2H), 3.48 (s, 3H),
3.71 (s, 3H), 3.80 (s, 3H), 4.72 (s, 2H), 6.68 (s, 1H),
6.72-6.84 (m, 3H), 7,05-7.11 (m, 2H), 7.15-7.27 (m, 2H),
7.72 (s, 1H), 8.84 (t, J--..5.4 Hz, 1H). Anal. Calcd. For
Cj~,H~.,NQ06F=C1: C, 57.8; H, 6.0; N, 9Ø Found: C, 57.61;
H, 6.57; N, 6.97.
Example 10
(+)-1,2,3,6-TETRAHYDRO-1-{N-j4-(3,-ACETAMIDO)-PHENYL-PIP
ERIDIN-1-YL]PROPYL}CARBOXAMIDO-4-METHOXYMETHYL-6-(3,4-DI
FLUORO-PHENYL)-2- OXOPYRIMIDINE-5-CARBOXYLIC ACID METHYL
ESTER: mp 135-138 °C; [a.] ~, - +105.5, (c - 0.11, MeOH) ;
ESMS, 614.25 (M+1); 1H NMR 8 1.76-1.87 (m, 6H), 2.03-2.13
(m, 2H), 2.18 (s, 3H), 2.49 (t, J=6.9 Hz, 3H), 3.10 (d,
J=11.1 Hz, 2H), 3.30-3.42 (m, 2H), 3.46 (s, 3H), 3.71 (s,
3H) , 4. 68 (s, 2H) , 6.68 (s, 1H) , 6.96 (d, J=7.5 Hz, 1H) ,
7.04-7.11 (m, 2H), 7.16-7.26 (m, 2H), 7.34 (d, J=6.3 Hz,
1H), 7.45 (s, 1H), 7.94 (s, 1H), 8.97 (t, J=5.4 Hz, 1H);
ESMS, M+1 614.25
The compound of Example 10 may also be prepared via
hydrogenation of the compoun of example 2 (H., balloon
method, methanol, Pd/C, overnight). A synthetic path
analogous to the latter route (Scheme 11) was used in the
preparation of the tritiated analog, which in turn, was
used as a radioligand in the MCH pharmacological assays.
Example 12
3-(4-PHENYLPIPERIDTN-1-YL)PROPIONITRILE: Acrylonitrile
(3.1 mL, 44 mmol, 2.5 eq) was added to a solution of
4-phenylpiperidine (3.00 g, 18.0 mmol) in EtOH (40 mL) and
the mixture was stirred at room temperature for 1.5 h.
The volatiles were removed, giving 3.80 g of the desired
product (brown oil, 990).
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-194-
3-(4-PHENYLPIPERIDIN-1-YL)PROPYLAMINE: A solution of BH,
in THF (1.0 M, 83.0 mL, 83.0 mmol, 3.5 eq) was added to a
stirring solution of 3-(4-phenylpiperidin-1-yl)-
propionitrile (5.10 g, 24.0 mmol) in anhydrous THF (20 mL)
under argon at room temperature. The mixture was heated
at reflux temperature for 4.5 hours and then cooled to
room temperature. Aqueous 6 N HC1 (130 mL) was added and
stirring was continued for 2 hours at 50-70 °C. The
mixture was basified to pH 9 by addition of aqueous 6 N
NaOH and extracted with EtOAc (100 mL) and CH~Cl~ (3 x 100
mL). The combined organic extracts were dried over
magnesium sulfate and concentrated. The residue was
dissolved in CH~C1~ (20 mL) and treated with HC1 in ether
(1.0 M, 50 mL). The solvents were removed, ether (250 mL)
was added, the mixture was filtered, and the filter cake
was washed with ether. Water (60 mL) was added to the
resulting white solid, 1 N NaOH was added until pH 10-11
was reached, and then the aqueous phase was extracted with
CH.,C1~ (3 X 50 mL). The combined extracts were dried over
magnesium sulfate and the solvents were evaporated, giving
the desired product (4.50 g, 870).
6-(3,4-DIFLOUROPHENYL)-1,~2,3,6-TETRAHYDRO-5-METHOXYCARBO
N Y L - 4 -
METHYL-2-OXO-1-{N-[3-(4-PHENYLPIPERIDIN-1-YL)PROPYL]}
CARBOXAMIDO-PYRIMIDINE: A solution of
6-(3,4-difluorophenyl)-1,6-dihydro- 2-methoxy-5-methoxy
carbonyl-4-methyl-1-{N-[3-(4-phenyl-piperidin-
1-yl)propyl]}carboxamidopyrimidine (100 mg, 0.185 mmol, mp
- 43-45 °C) in MeOH (5 mL) was treated with aqueous 6 N HC1
(1.5 mL) at 0 °C. The solution was stirred at room
temperature for 2 hrs and MeOH was removed in vacuo.
6-(3,4-Diflourophenyl)- 1,2,3,6-tetrahydro-
5-methoxycarbonyl-4-methyl-2-oxo-1-{N-[3-(4-
phenylpiperidin-1-yl)propyl]}carboxamidopyrimidine
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-l95-
hydrochloride was obtained as a white powder (89 mg, 860).
mp 133-136 °C.
Example 12
3-{(3,4,5-TRIFLUOROPHENYL)METHYLENE}-2,4-PENTANEDIONE: A
stirring mixture of 3,4,5-trifluorobenzaldehyde (4.2 g,
26.2 mmol), 2,4-pentanedione (2.62 g, 26.2 mmol),
piperidine (0.430 g, 5 mmol) in benzene (150 mL) was
heated at reflux temperature (equipped with a Dean-Stark
trap) for 8 h. The benzene was evaporated, the yellow
oily residue, 2-{(3,4,5-trifluorophenyl)-
methylene}-2,4-pentanedione, was used in the next step
without further purification.
6-(3,4,5-TRIFLUOROPHENYL)-1,6-DIHYDRO-2-METHOXY-5-ACETYL
-4- METHYLPYRIMIDINE: A stirring mixture of 2-{(3,4,5-
trifluoro-phenyl)methylene}-2,4-pentanedione (26.2 mmol),
O-methylisourea hydrogen sulfate (3.22 g, 39.3 mmol), and
NaHC03 (6.60 g, 78.6 mmol) in EtOH (400 mL) was heated at
95-100 °C for 6 h. The mixture was filtered, the solid
residue was washed with ethanol (100 mL). The solvent was
evaporated from the combined filtrates and the crude
product was purified by flash column chromatography
(EtOAc/hexane, 9/1 to 4/1), giving the desired product as
an oil (2.80 g, 36%).
6-(3,4,5-TRIFLUOROPHENYL)-1,6-DIHYDRO-2-METHOXY-5-ACETYL
-4- METHYL-1-[(4-NITROPHENYLOXY)CARBONYL]PYRIMIDINE:
4-Nitrophenyl chloroformate (1.886 g, 9.38 mmol) was added
to a solution of 6-(3,4,5-trifluorophenyl)-1,6-dihydro-2-
methoxy-5-acetyl-4- methylpyrimidine (2.80 g, 9.38 mmol)
and pyridine (10 mL) in CH.,C1_ (200 mL) at 0-5 °C and then
the mixture was allowed to warm to room temperature.
After 12 h, the solvent was evaporated and the residue was
purified by flash chromatography (CH~Clz/EtOAc, 9/1 to
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-196-
20/3), giving the desired product as a white powder (4.0
g, 92 0 ) .
6-(3,4,5-TRIFLUOROPHENYL)-1,2,3,6-TETRAHYDRO-2-OXO-5-ACE
TYL-4- METHYL-1-[(4-NITROPHENYLOXY)CARBONYL]PYRIMIDINE:
Aqueous 6 N aqueous HCl (4 mL) was added to a stirring
s o 1 a t i o n o f
6-(3,4,5-trifluorophenyl)-1,6-dihydro-2-methoxy-
5 - a c a t y 1 - 4
methyl-1-[(4-nitrophenyloxy)carbonyl]pyrimidine (4.0 g,
8.63 mmol) in THF (100 mL) at 0-5 °C, and the mixture was
allowed to warm to room temperature. After 2 h, the
solvent was evaporated and the product was dried under
vacuum, giving the desired product as a pure single
component which was used in the next step without further
purification (3.88 g, 1000).
(+)- 1,2,3,6- TETRA HYDRO-1-{N-[4- (4-FLUOROPHENYL)-
PIPERIDINE- 1-YL]- PROPYL} CARBOXAMIDO- 5- ACETYL- 2-
OXO-6-( 3,4 ,5-TRI FLUORO PHENYL)- 4- METHYL PYRIMIDINE
HYDROCHLORIDE: 1H NMR~ 7.20-6.86 (m, 6 H), 6.64 (s, 1 H),
5.56 (s, 1 H), 3.70-3.80 (m, 2 H), 3.43-3.35 (m, 2 H),
3.19-2.98 (m, 2 H), 2.40 (s, 3 H), 2.28 (s, 3 H),
2.50-1.60 (m, 8 H).
Example 13
N1-[4-([4-(DIBUTYLAMINO)BENZYL]AMINOMETHYL)CYCLOHEXYL]-1
-NAPHTH-AMIDE: 1H NMR88.26 (dd, 1 H, J=2.1, 7.2 Hz), 7.87
(m, 2 H), 7.51 (m, 2 H), 7.40 (apparent t, 1 H, J=7.8 Hz),
7.17 (d, 1 H, J=8.7 Hz), 6.61 (d, 2 H, J=8.7 Hz), 5.94 (d,
1 H, J=8, 1 Hz) , 4 .04 (m, 1 H) , 3.76 (m, 1 H) , 3. 63 (m, 2
H), 3.21 (t, 4 H, J=7.6 Hz average), 2.53 (d, 2 H, J=6.7
Hz), 2.10, ABm, 4 H), 1.55 (p, 4 H, J=7.7 Hz average),
1.34 (sept, 4 H, J=7.6 Hz average), 1.17 (m, 4 H), 0.95
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-197-
(t, 6 H, J=7.6 Hz average).
Example 14
(+)-1,2,3,6-TETRAHYDRO-1-{N-[4-(1-NAPHTHYL)-PIPERIDIN-1-
Y L ] P R 0 P - Y L } C A R B O X A M I D O - 4 -
METHOXYMETHYL-6-(3,4-DIFLUOROPHENYL)
-2-OXO-PYRIMIDINE-5-CARBOXYLIC ACID METHYL ESTER: mp
168-172 "C; [a]~, - +94.7, (c - 0.25, MeOH) ; 1H NMR b
1.75-1.84 (m, 2H), 1.87-2.01 (m, 4H), 2.14-2.28 (m, 2H),
2.47 (t, J=7.2 Hz, 2H), 3.10 (d, J=I1.I Hz, 2H), 3.28-3.45
(m, 3H), 3.48 (s, 3H), 3.71 (s, 3H), 4.68 (s, 2H), 6.70
(s, 1H), 7.05-7.12 (m, 2H), 7.16-7.24 (m, 1H), 7.42-7.54
(m, 4H), 7.69-7.75 (m, 2H), 7.85 (d, J=11.4 Hz, 1H), 8.09
(d, J=11.1 Hz, 1H), 8.91 (t, J=5.4 Hz, 1H).
Example 15
4-(5-FLUORO-2-METHOXY)PHENYL PIPERIDINE: mp 254-258 "C; 1H
NMR 81.53-1.68 (m, 2H), 1.79 (d, J=11.7 Hz, 2H), 2.12 (dt,
J=2 . 1 Hz, J=11 .7 Hz, 1H) , 2 .77 (dt, J=1 . 8 Hz, J=12 . 3 Hz,
1H), 2.90-3.05 (m, 1H), 3.10-3.22 (m, 2H), 3.68 (s, 1H),
3.79 (s, 3H), 6.72-6.93 (m, 3H). Anal. Calcd. For
C,,H,,NOFCl + 0.14 CH~Cl~: C, 56.60; H, 6.76; N, 5.44.
Found: C, 56.60; H, 6.92; N, 5.28.
(+)-1,2,3,6-TETRAHYDRO-1-{N-[4-(5-FLUORO-2-METHOXY)PHENY
LPIPERI-DIN-1-YL]PROPYL}CARBOXAMIDO-4- METHOXYMETHYL-
6-(3,4-DIFLUORO-PHENYL)-2-OXOPYRIMIDINE-5-CARBOXYLIC ACID
METHYL ESTER: 1H NMR 8 8 . 93 ( t, 1 H, J=5 . 4 Hz ) , 7 . 7 6 (br, 1
H), 7.30-6.69 (m, 7 H), 4.69 (s, 2 H), 3.79 (s, 3 H), 3.71
(s, 3 H), 3.48 (s, 3 H), 3.38 (m, 2 H), 3.10-2.80 (m, 3
H), 2.42 (t, 2 H, J=7.2 Hz), 2.07 (dt, 2 H, J=3.0, 8.4
Hz), 2.00-1.60 (m, 6 H).
Example 16
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-198-
(+)-1,2,3,6-TETRAHYDRO-1-{N-[4-HYDROXY-4-(2-PYRIDYI)-PIP
ERIDIN-1-YL]PROPYL}CARBOXAMIDO-4- METHOXYMETHYL-6-(3,4-
DIFLUOROPHENYL)-2- OXOPYRIMIDINE-5-CARBOXYLIC ACID METHYL
ESTER: mp 132-135 °C; [a,] n = +94 .7, (c = 0.25, MeOH) ; 1H NMR
81.47 (d, J=11.7 Hz, 2H), 1.74-1.85 (m, 2H), 2.43-2.63 (m,
9H), 2.87 (d, J=10.2 Hz, 2H), 3.30-3.47 (m, 2H), 3.49 (s,
3H) , 3.71 (s, 3H) , 4.69 (s, 2H) , 6. 69 (s, 1H) , 7.04-7.21
(m, 4H), 7.49 (dd, J=0.6 Hz, J=6.9 Hz, 1H), 7.72 (s, br,
1H), 8.36 (dd, J=1.2, 4.8 Hz, 1H), 8.89 (t, J=5.4 Hz, 1H).
Example 17
1-(3-AMINOPROPYL)-4-[2-PYRIDYL]PYRIDINIUM BROMIDE
HYDROBROMIDE: A solution of 2,4'-dipyridyl (25.0 g, 160
mmol) and 3-bromopropyl-amine hydrobromide (35.0 g, 160
mmol) in DMF (60 mL) was heated at 90-95 °C for 10 h.
After cooling to room temperature, anhydrous ether (500
mL) was added to the mixture, the resulting white solid
was filtered, washed with Et.,O and dried, giving
1-(3-aminopropyl)-4-[2-pyridyl]pyridinium bromide
hydrobromide ( 60 g, 100 0 ) ) . '-H NMR (DMSO-d6) 8 2 . 35-2 . 44 (m,
2 H), 3.08-3.13 (m, 2 H), 4.76-4.81 (m, 2 H), 7.58 (dd,
J=4.8 Hz, J=7.5 Hz, 1 H), 8.03 (dt, J=1.8 Hz, J=7.8 Hz, 1
H), 8.32 (d, J=7.8 Hz, 1 H), 8.77-8.81 (m, 3 H), 9.12 (d,
J=6.3 Hz, 2 H) . Anal. Calcd. for C1~H1°N3Br + HBr + 0.5 H.,O:
C, 40.65; H, 4.72; N, 10.94. Found: C, 40.83; H, 4.37; N,
11.05.
3-(3',6'-DIHYDRO-2'-H-[2,4']BIPYRIDINYL-1'-YL)-PROPYLAMI
NE: NaBH4 (2 g, 53 mmol) in small portions was added to a
solution of 1-(3-aminopropyl)-4-[2-pyridyl]pyridinium
bromide hydrobromide (6 g, 16 mmol) in MeOH (150 mL) at
0-5 °C over a period of 2 h. The reaction mixture was
stirred overnight at room temperature and then the solvent
was evaporated. The residue was suspended in ether (200
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-199-
mL) and treated with aqueous 50o NaOH solution (100 mL).
The ether layer was separated and the aqueous layer was
extracted with additional ether (2 X 50 mL). The combined
ether extracts were dried over potassium carbonate and the
s o 1 v a n t w a s r a m o v a d , g i v i n g
3-(3',6'-dihydro-2'-H-[2,4']bipyridinyl-
1'-y1)- propylamine (3.48 g) as an oil. The crude product
was used in the next step immediately without further
purification.
3-AMINOPROPYL-4-(2-PYRIDYL)PIPERIDINE: A suspension of
3-(3',6'-dihydro-2'-H-[2,4']bipyridinyl-1'-yl)-propylamine
(3.48 g crude, 15.9 mmol) and Pearlman's catalyst (1.0 g)
in MeOH (40 mL) was hydrogenated under 120 psi for 10 h,
after which the reaction mixture was filtered through a
pad of Celite and the solvent was removed. The residue
was purified by column chromatography over silica gel (30
g) [Note: If a large excess of silica gel is used the
recovery of the product will be very low]
(CH=Cl=/methanol/2M NH3 in MeOH, 90/8/4 to 90/40/40). The
product was obtained as a pale yellow oil (3.21 g, 910).
~H NMR b (CD30D) 1.50-1. 99 (m, 10 H) , 2.02-2.06 (m, 2 H) ,
2 . 37-2 .75 (m, 3 H) , 3. 02-3 . 06 (br m, 2 H) , 7 . 05-7 . 09 (m,
4 H), 7.16 (dt, J=0.9 Hz, J=8.7 Hz, 1 H), 8.48 (dd, J=0.9
Hz, J=4.2 Hz, 1 H).
Part II
(+)-6-(3,4-DIFLUOROPHENYL)-1-{N-[4-(2-PYRIDYL)PIPERIDIN-
1-YL]-PROPYL]}CARBOXAMIDO-5-METHOXYCARBONYL-4-
METHOXYMETHYL-2-OXO-1,2,3,6-TETRAHYDROPYRIMIDINE
DIHYDROCHLORIDE
5-METHOXYCARBONYL-4-METHOXYMETHYL-1,2,3,6-TETRAHYDRO-2-O
XO-6- (3,4-DIFLUOROPHENYL)-PYRIMIDINE: Copper(I) oxide
(5.06 g, 0.035 mole) and acetic acid (2.05 mL) were added
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-200-
sequentially to a stirring solution of methyl
4-methoxyacetoacetate (50.0 g, 0.351 mol),
3,4-difluorobenzaldehyde .(51.4 g, 0.351 mmol), and urea
(31.6 g, 0.527 mole) in THF (300 mL) at room temperature,
followed by dropwise addition of boron trifluoride diethyl
etherate (56.0 mL, 0.456 mole). The mixture was stirred
at reflux temperature for 8 h, whereupon TLC (1/1
EtOAc/hexanes) indicated completion of the reaction. The
reaction mixture was cooled and poured into a mixture of
ice and sodium bicarbonate (100 g) and the resulting
mixture was filtered through Celite. The Celite pad was
washed with dichloromethane (400 mL). The organic layer
was separated from the filtrate and the aqueous layer was
extracted with more dichloromethane (3 X 300 mL). The
combined organic extracts were dried (sodium sulfate) and
the solvent was evaporated. The crude product was
purified by flash chromatography (ethyl acetate/hexanes,
1/l;then ethyl acetate), giving the desired product as a
pale yellow foam. The foam was triturated with hexanes,
giving a white powder ( 103 . 3 g, 94 0 ) . 1H NMR b 3 . 47 6 ( s,
3H), 3.651 (s, 3H), 4.653 (s, 2H), 5.39 (s, 1H), 6.60 (br
s, 1H, NH), 7.00-7.20 (m, 3H), 7.72 (br s, 1H, NH).
(+)-5-METHOXYCARBONYL-4-METHOXYMETHYL-1,2,3,6-TETRAHYDRO
-2-OXO-6-(3,4-DIFLUOROPHENYL)-PYRIMIDINE: The racemic
intermediate 5-methoxycarbonyl-4-methoxymethyl-1,2,3,6-
tetrahydro-2-oxo-6- (3,4-difluorophenyl)pyrimidine was
resolved by chiral HPLC [Chiralcel OD 20 X 250 mm
#369-703-30604; lambda 254 nm; hexanes/ethanol 90/10 ; 85
mg per injection; retention time of the desired
enantiomer: 16.94 min., the first enantiomer peak to
a 1 a t a ] , g i v i n g
(+)-5-methoxycarbonyl-4-methoxymethyl-1,2,3,6-
tetrahydro-2-oxo-6-(3,4-difluorophenyl)-pyrimidine (40-42
wto isolation of the desired enantiomer from the
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-201-
racemate); [a]D = +83.8 (c = 0.5, chloroform).
(+)-5-METHOXYCARBONYL-4-METHOXYMETHYL-1,2,3,6-TETRAHYDRO
-2-OXO-6-(3,4-DIFLUOROPHENYL)-1-[(4-NITROPHENYLOXY)CARBO
NYL]PYRIMIDINE: A solution of lithium
hexamethyldisilazide in THF (1M, 18.0 mL, 18.0 mmol) was
added over 2-3 min. to a solution of
(+)-5-methoxycarbonyl-4-methoxymethyl-
1,2,3,6-tetrahydro-2-oxo-6-(3,4-difluorophenyl)-pyrimidine
(1.98 g, 6.34 mmol) in anhydrous THF (20 mL) at -78 °C
under argon atmosphere and the mixture was stirred for 10
min. The resulting solution was added over 6 min., aria a
cannula, to a stirred solution of 4-nitrophenyl
chloroformate (4.47 g, 22.2 mmol) in THF (20 mL) at -78 °C.
The mixture was stirred for an additional 10 min. and the
mixture was poured onto ice (50 g) and extracted with
chloroform (2 X 50 mL). The combined extracts were dried
(sodium sulfate) and the solvent evaporated. The residue
was purified by flash chromatography (hexanes/ethyl
acetate, 4/1 to 3.5/1), giving the product as a yellow
syrup, which on trituration with hexanes became a white
powder (2.40 g, 790) . 1H NMRcS 3.52 (s, 3H) , 3.74 (s, 3H) ,
4.65-4.80 (q, J=16.5 Hz, 2H), 6.32 (s, 1H), 7.10-7.30 (m,
4H), 7.36 (d, J=9 Hz, 2H), 8.27 (d, J=9 Hz, 2H).
(+)-6-(3,4-DIFLUOROPHENYL)-1-{N-[4-(2-PYRIDYL)PIPERIDIN-
1 - Y L ] -
PROPYL]}CARBOXAMIDO-5-METHOXYCARBONYL-4-METHOXYMETHYL-
2-OXO- 1,2,3,6-TETRAHYDROPYRIMIDINE DIHYDROCHLORIDE: A
solution of (+)-5-methoxycarbonyl-4-methoxymethyl-1,2,3,6-
tetrahydro-2-oxo-6-(3,4-difluorophenyl)-1-[(4-nitropheny
loxy)carbonyl]pyrimidine (2.38 g, ~5 mmol),
3-aminopropyl-4-(2-pyridyl)piperidine (1.21 g, 5.5 mmol)
in THF (20 mL) was stirred at room temperature for 12 h.
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-202-
The solvent was evaporated and the residue was
re-dissolved in ethyl acetate (100 mL). The resulting
solution was washed with ice-cold 1 N NaOH (4 X 50 mL) ,
brine (2 X 50 mL) and dried over potassium carbonate. The
solvent was evaporated in vacuo and the residue was
purified by flash chromatography (dichloromethane/MeOH/2
M ammonia in MeOH, 980/10/10 to 940/30/30 ), giving a
clean fraction of the desired product (2.45 g, 880) as a
foam and a slightly ~ impure fraction ( 0 . 30 g, 10 0 ) . 1H NMR
cS1.60-2.00 (m, 6H), 2.05-2.15 (m, 2H), 2.38-2.43 (br t,
2H), 2.65-2.80 (m, 1H), 3.05-3.06 (br d, 2H), 3.30-3.45
(m, 2H) , 3. 48 (s, 3H) , 3.704 (s, 3H) , 4 . 68 (s, 2H) , 6. ~8
(s, 1H), 7.05-7.20 (m, 5H), 7.58-7.63 (dt, 1H), 7.70 (s,
1H, NH), 8.50-8.52 (dd, 1H), 8.88 (br t, 1H).
The HCl salt was prepared by treatment of a solution
of the free base in ether with 1 N HC1 in ether. The
white powder was dried under reduced pressure: 1H NMR b
2.05-2.20 (m, 4H), 2.77-2.88 (m, 2H), 3.00-3.20 (m, 4H),
3. 35-3. 47 (m, 2H) , 3. 47 (s, 3H) , 3. 64-3. 70 (m, 2H) , 3. 71
(s, 3H), 4.05 (br t, 1H), 4.67 (s, 2H), 6.59 (s, 1H),
7 . 05-7.20 (m, 3H) , 7. 79 (t, 1H) , 8 . 00 (d, 1H) , 8. 43 (dt,
1H), 8.96 (br t, 1H, NH), 12.4 (br s, 1H). m.p. 188-191 °C;
[a]I, - +141.13 (c - 0.265, MeOH); Anal. Calcd. for
C,rH~,N,O,F~Cl + 0.6 H~O:C, 52.36; H, 5.84; N, 10.90. Found:
C, 52.24; H, 5.96; N, 10.80. (Note: NMR analysis of this
product did not show the presence of any water. However,
it was noted by the lab that performed the elemental
analysis that this sample gains weight during handling by
absorbing water from the atmosphere).
Example 18
(1) -1, 2, 3, 6-TETRAHYDRO-1-{N- [4- (ISOBENZOFL1RAN) PIPERIDINE
-1-YL]-PROPYL}CARBOXAMIDO-5-METHOXYCARBONYL-2-OXO-6-(3,4-
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-203-
BENZOFURAZAN)- 4-METHYLPYRIMIDINE HYDROCHLORIDE
4-(3,4-BENZOFURAZAN)-6-METHYL-2-OXO-3-{[3-(4-SPIRO[ISOBE
N Z O -
FURAN-1(3H),4'-PIPERIDINE]PROPYL}-1,2,3,4-TETRAHYDROPYRI
MIDINE-5-CARBOXYLIC ACID METHYL ESTER
1-(3-Aminopropyl)-4- spiro[iso-benzofuran-1
(3H),4'-piperidine] (0.028 g, 0.110 mmol) was added to
(~) -6- (benzofurazan) -1, 6-dihydro-
2-methoxy- 5-methoxycarbonyl-4-methyl-1-(4-nitrophenoxy)
carbonylpyrimidine (0.047 ,g, 0.100 mmol) in dry
dichloromethane (10 mL) and the solution was stirred at
room temperature for 24 h. Aquesous 6 N HC1 (2 mL) was
added to the reaction mixture which was stirred for
another 1 h. The reaction mixture was basified with
aqueous 10o KOH solution (pH - 9) and extracted into
dichloromethane (3 x 10 mL). The organic layer was dried
over sodium sulfate, filtered and concentrated. The crude
product was purified by flash chromatography (EtOAc/ MeOH,
4.5/0.5), giving the desired product (42.0 mg, 73 0) as
a syrup: ~H NMRb1.76-1.81 (m, 7 H), 1.94-2.04 (m, 6 H),
2.32-2.48 (m, 1 H), 2.83 (d, J=20.6 Hz, 2 H), 3.36-3.43
(m, 2 H), 3.75 (s, 3 H), 5.05 (s, 2 H), 6.83 (s, 1 H),
7 . 07-7 .27 (m, 4 H) , 7. 54 (d, J=9.5 Hz, 1 H) , 7. 69 (s, 1
H), 7.78 (d, J=9.5 Hz, 1 H), 8.85 (d, J=5.2 Hz, 1 H).
HC1 in ether (1 N, 5 mL) was added to the free base (0.041
g, 0.073 mmol) in dichloromethane (4 mL), and the solution
was concentrated under reduced pressure. The product was
recrystallized from ether, giving the hydrochloride salt
as a pale yellow solid (42.0 mg, 96 0); mp 180-182 °C;
Anal. Calcd. for C~sH34N60~C1 + 0.5 moles H20: C, 57.47; H,
5.65; N, 13.87. Found: C, 57.42; H, 5.71; N, 13.70.
Example 19
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-204-
2-(3,4-DIFLUOROPHENYL)4,5-DIHYDROIMIDAZOLE-1-CARBOXYLIC
A C I D
{3-[4-PHENYL-4-(4-BROMO-5-METHYLTHIOPNEN-2-YL)]-PROPYL}-
AMIDE: Anal. Calcd. for C~"H3~N90,C1F3 + HC1 + 1.5 H.O: C,
55.26; H, 6.03; N, 8.59. Found: C, 55.29; H, 5.95; N,
8.39.
Example 20
4-(3,4-DIFLUORPHENYL)-6-METHYL-2-OXO-3-{[3-(4-SPIRO[ISOB
ENZO-FURAN-1(3H),4'-PIPERIDINE]PROPYL}-1,2,3,4-
TETRAHYDROPYRIMIDINE-5-CARBOXYLIC ACID METHYL ESTER
For the preparation of the ether piperidine precursor of
the compound of Example 20,refer to W.E.Parham et a1, J.
Org. Chem. (1976) 41, 2268.
1-TERT-BUTOXYCARBONYL-3-(4-SPIRO[ISOBENZOFURAN-1(3H),4'-
PIPERIDINE])PROPYLAMINE: N-(tert-utoxycarbonyl)-3-bromo-
propylamine (0.772 g, 3.2.7 mmol) and potassium carbonate
(0.904 g, 6.54 mmol) were added to a stirring solution of
the amine (0.566 g, 3.27 mmol) in dioxane ( 20 mL) and the
reaction mixture was heated at reflux temperature for 24
h. The reaction mixture was cooled to room temperature,
concentrated and partitioned between chloroform (40 mL)
and water (5 mL). The organic layer was dried over sodium
sulfate, filtered and concentrated. The crude product was
purified by column chromatography (ethyl acetate/
methanol, 4.510.5), giving the desired product (0.856 g,
79 0) as a colorless oil; 1H NMR81.45 (s, 9 H), 1.63-2.04
(m, 6 H) , 2. 33-2 .52 (m, 4 H) , 2 . 87 (d, J=11 . 0 Hz, 2 H) ,
3.2 (br s, 2 H), 5.07 (s, 2 H), 5.6 (br s, 1 H), 7.13-7.28
(m, 4 H) .
3 - ( 4 - S P I R O [ I S 0 B E N Z O -
FURAN-1(3H),4'-PIPERIDINE])PROPYLAMINE: Trifluoroacetic
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-205-
acid (1 mL) was added to 1-tert-butoxycarbonyl
3-(4-spiro[isobenzo-furan-1(3H),4'-
piperidine])propylamine (0.500 g, 1.51 mmol) in
dichloromethane (5 mL) and the solution was stirred at
room temperature for 1 h. The reaction mixture was
concentrated, neutralized with 10 o KOH solution and
extracted into dichloromethane (25 mL). The organic layer
was dried over sodium sulfate, filtered and concentrated,
giving the desired amine (0.340 g, 980) which was used in
the subsequent step without further purification.
4-(3,4-DIFLUORPHENYL)-6-METHYL-2-OXO-3-{[3-(4-SPIRO[ISOB
ENZO-FURAN-1(3H),4'-PIPERIDINE]PROPYL}-1,2,3,4-
TETRAHYDROPYRIMIDINE-5-CARBOXYLIC ACID METHYL ESTER:
3-(4-spiro[isobenzo-furan-1(3H),4'-piperidine])propylamine
(0.0319 g, 0.123 mmol) was added to
(~)-6-(3,4-Difluorophenyl)-1,6-dihydro-
2-methoxy-5-methoxycarbonyl-4-methyl-1-(4-nitrophenoxy)c
arbonylpyrimidine (0.052 g, 0.112 mmol) in dry
dichloromethane (10 mL) and the solution was stirred at
room temperature for 24 h. Aqueous 6 N HCl (2 mL) was
added and the reaction mixture was stirred for an
additional 1 h. After neutralization with 10o aqueous KOH
solution, the reaction mixture was extracted with
dichloromethane (3 x 10 mL). The organic layer was dried
over sodium sulfate, filtered and concentrated. The crude
product was purified by flash chromatography (EtOAc/ MeOH,
4.5/0.5), giving the desired product (0.040 g, 64 0) as a
syrup; 1H-NMR 8 1.73-1.78 (m, 7 H), 1.93-2.04 (m, 2 H),
2.33-2.48 (m" 6 H), 2.83 (d, J=11.8 Hz, 2 H), 3.35-3.41
(m,~ 2 H), 3.71 (s, 3 H), 5.06 (s, 2 H), 6.75 (s, 1 H),
7.04-7.26 (m, 7 H), 8.82 (t, J=5.1 Hz, 1 H).
A solution of 1 N HC1 in ether (5 mL) was added to the
free base (0.040 g, 0.072 mmol) in dichloromethane (4 mL)
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-206-
and the solution was concentrated in vacuo. The product
was recrystallized from ether, giving the dihydrochloride
as a pale yellow solid (0.042 g, 99 0); mp 178-182 ~C;
Anal. Calcd. for C;,yH3~F~N40~,C1= + 0.6 H.,O: C, 57.87; H, 5.73,
N 9.31. Found: C, 58.11; H 5.90; N 8.95.
Example 21
1,2,3,6-TETRAHYDRO-1-{N-[4-(DIHYDROINDENE)-1-YL}PROPYL}C
ARBOXAMIDO-5-METHOXYCARBONYL- 2-0X0-6-(3,4-BENZOFURAZAN)-
4-METHYLPYRIMID-INE
For the preparation of the indane piperidine precursor of
the compound of Example 21, refer to M.S.Chambers J. Med.
Chem. (1992) 35,2033.
N-(tert-butoxycarbonyl)3-(4-spiro[isobenzo-furan-1(3H),4'-
piperidine])propylamine(1.10 g, 4.64 mmol) and potassium
carbonate (1.17 g, 8.44 mmol) were added to a stirring
solution of the amine (0.790 g, 4.22 mmol) in dioxane (20
ml), and the resulting solution was heated at reflux
temperature for 24 h. The reaction mixture was cooled to
room temperature, concentrated and partitioned between
chloroform (40 mL) and water (5 mL). The organic layer
was dried over sodium sulfate, filtered and concentrated.
The crude product was purified by column chromatography
(ethyl acetate/ methanol, 4.5/0.5), giving the desired
product (0.886 g, 61 %) as a colorless oil; 1H NMRB 1.46
(s, 9 H) , 1 .55 (d, J = 11 .3 Hz, 2 H) , 1. 69 (t, J = 6.3 Hz,
2 H) , 1. 88-2 . 47 (m, 6 H) , 2 . 47 (t, J = 6.3 Hz, 2 H) , 2 . 88
(t, J = 3.3 Hz, 4 H), 3.23 (d, J = 5.6 Hz, 2 H), 5.85 (br
s, 1 H) , 7 .18 (s, 4 H) .
Trifluoroacetic acid (1 ml) was added to
1-tert-butoxycarbonyl-3-(4-spiro[isobenzo-
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-207-
furan-1(3H),4'-piperidine])propylamine(0.180 g, 0.52 mmol)
in dichloromethane (5 ml)' and the resulting solution was
stirred at room temperature for 1 hour. The solution was
concentrated, neutralized with loo KOH solution and
extracted into dichloromethane (25 ml). The organic layer
was dried over sodium sulfate, filtered and concentrated,
giving propylamine (0.156 g, 1000) which was used in the
subsequent step without further purification.
(~)-4-(3,4-BENZOFURAZAN)-6-METHYL-2-OXO-3-{SPIRO[1H-INDA
NE-1,4'-PIPERIDINE]PROPYL}-1,2,3,4-TETRAHYDROPYRIMIDINE-
5-CARBOXYLIC ACID METHYL ESTER HYDROCHLORIDE: To
(~)-4-(3,4-benzofurazan)-1,6- dihydro-2-methoxy-
5-methoxycarbonyl-4-methyl-1-(4-nitrophenoxy)
carbonylpyrimidine (0.059 g, 0.126 mmol) in dry
d i c h 1 o r o m a t h~a n a ( 1 0 m L ) ,
1-(3-aminopropyl)spiro[1H-indane-1,4'- piperidine] (0.062
g, 0.252 mmol) was added and the solution was stirred at
room temperature for 24 h. The reaction mixture was
stirred for another 1 h after addition of 2 mL of 6N HC1.
The reaction mixture was basified with 10% aqueous KOH
solution (pH = 9) and extracted with dichloromethane (3 x
10 mL). The combined organic extracts were dried over
sodium sulfate, filtered and concentrated. The crude
product was purified by flash chromatography (EtOAc/ MeOH,
4.5/0.5), giving 0.070 g (1000) of the desired product as
a syrup: 1H NMR81.51 (d, J=12.5 Hz, 2 H), 1.76-2.08 (m,
4 H), 2.12 (t, J=10.3 Hz, 2 H), 2.45 (s, 5 H), 2.86-2.91
(m, 4 H), 3.30-3.45 (m, 2 H), 3.75 (s, 3 H), 6.83 (s, 1
H) , 7 . 02 (br s, 1 H) , 7 . 0~ (m, 4 H) , 7 .54 (d, J=9 . 6 Hz, 1
H), 7.69 (s, 1 H), 7.78 (d, J=9.2 Hz, 1 H), 8.84, (t,
J=5.2 Hz, 1 H) .
To the free base (0.070 g, 0.125 mmol) in 4 mL of
dichloromethane, 5 mL of 1 N HC1 in ether was added, and
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-208-
the solution was concentrated under reduced pressure.
Recrystallization from ether gave 0.088 g (100 ~) of
(~)-4-(3,4-benzofurazan)-6-methyl-2-oxo-3-{spiro[1H-inda
n a -
1,4'-piperidine]propyl}-1,2,3,4-tetrahydropyrimidine-5-c
arboxylic acid methyl ester hydrochloride as a white
solid: m.p. 155-157 °C; Anal. Calcd. for C3oH36NE0,C1: C,
57.12; H, 5.76; N, 13.33. Found: C, 57.40; H, 5.96; N,
13.02.
Example 22
(+)-1,2,3,6-TETRAHYDRO-1-{N-[4-(BENZO-4',5'(H)FURAN)PIPE
R I D I N - 1 - Y L ] P R 0 P Y L } C A R B 0 X A M I D 0 - 4 - E T H Y L -
6-(3,4-DIFLUOROPHENYL)-
2-OXO- PYRIMIDINE-5-CARBOXAMIDE HYDROCHLORIDE: DMAP~ ECD
(0.250 mmol, 0.050 g) was added to a stirred mixture of
(+)-1,2,3,6-tetra-hydro-1-{N-[4-(benzo-4',5'(h)furan)-
piperidin-1-yl]propyl}carbox-amido-4-ethyl-6-(3,4-
difluorophenyl)-2-oxo-pyrimidine-5-carboxyl-is acid
hydrochloride (0.100 mmol, 0.055 g) and
N-methylmorpholine (0.330 mL) in dry dichloromethane (10
mL). The resulting mixture was stirred at room
temperature for 1 h and quenched with NH3. The reaction
mixture was stirred at room temperature overnight,
concentrated and chromatographed, giving the desired
product. The HC1 salt was prepared by the addition of HCl
in ether to a solution of the product in dichloromethane,
followed by evaporation of the solvents. Anal. Calc. For
C.,4Hi3N~09 F~ + HCl + 0.7 CHCli . C, 52.96; H, 5.29; N, 9.40.
Found: C, 52.81; H, 5.69; N, 8.97.
Example 23
(1)-1,2,3,6-TETRAHYDRO-1-{N-[4-(3,4-DIHYDRO-2-OXOSPIRO-
NAPHTHALENE-1(2H))-PIPERIDINE-1-YL]PROPYL}CARBOXAMIDO-5-
METHOXYCARBONYL-2- OXO-6-(3,4-BENZOFURAZAN)-4-
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-209-
METHYLPYRIMIDINE HYDROCHLORIDE
1-(3-TERT-BUTOXYCARBONYLAMINOPROPYL)SPIRO[ISOCHROMAN-3,4
'PIPERIDIN]-1-ONE: To a stirred solution of
spiro[piperidine-4,1'-tetralin] To a stirred solution of
spiro[isochroman-3,4'-piperidin]-1-one (K.Hashigaki et a1.
Chem.Pharm.Bull. (1984) 32, 3568.) (0.587 g, 2.58 mmol)
in dioxane (20 mL) , N-
(tert
butoxycarbonyl)-3-bromopropylamine (0.615 g, 2.84 mmol)
and potassium carbonate (0.714 g, 5.17 mmol) were added
and the solution was refluxed for 24 h. The reaction
mixture was cooled to room temperature, concentrated and
partitioned between 40 mL chloroform and 5 mL water. The
organic layer was dried over sodium sulfate, filtered and
concentrated. The crude product was purified by column
chromatography (ethyl acetate/ methanol, 4.5/0.5) to yield
0.465 g (47 0) of the desired product as a colorless oil;
-'H NMRB 1.45 (s, 9 H) , 1. 64-2.18 (m, 7 H) , 2. 45-2. 84 (m, 6
H), 3.19-3.95 (m, 4 H), 6.01 (br s, 1 H), 7.13-7.26 (m, 3
H) , 7.42 (d, J=7.7 H) .
Step B. 1-(3-AMINOPROPYL)SPIRO[ISOCHROMAN-3,4'PIPERIDIN]-
1-ONE: To 1-(3-tert-Butoxycarbonylaminopropyl)-
spiro[isochroman-3,4'-piperidin]-1-one (0.144 g, 0.375
mmol) in 5 mL of dichloromethane, 1 mL of trifluoroacetic
acid was added and the solution stirred at room
temperature for l h. The solution was concentrated,
neutralized with 10 o KOH solution and extracted into 25
mL of dichloromethane. The organic layer was dried over
sodium sulfate, filtered and concentrated, giving 0.110 g
(1000) of the product which was used as such for the
subsequent step.
(~)-4-(3,4-BENZOFURAZAN)-6-METHYL-2-OXO-3-{(SPIRO[ISOCHR
OMAN- 3,4'-PIPERIDIN]-1-ONE)PROPYL}-1,2,3,4-
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-210-
TETRAHYDROPYRIMIDINE-5- CARBOXYL-IC ACID METHYL ESTER: To
(~)-4-(3,4-Benzofurazan)-1,6- dihydro-2-methoxy-5-methoxy
carbonyl-4-methyl-1-(4-nitrophenoxy)-carbonylpyrimidine
(40.0 mg, 0.0865 mmol) in 10 mL of dry dichloromethane,
spiro[isochroman-3,4'piperidin]-1-one (44.0 mg, 0.173
mmol) was added and the solution was stirred at room
temperature for 24 h. The reaction mixture was stirred
for another 1 h after addition of 2 mL of 6N HCl. The
reaction mixture was basified with loo aqueous KOH
solution (pH = 9) and extracted into dichloromethane (3 x
' 10 mL). The organic layer was dried over sodium sulfate,
filtered and concentrated. The crude product was purified
by flash chromatography .(EtOAc/ MeOH, 4.5/0.5), giving
50.0 mg (1000) of the desired product as a syrup: 1H NMR
b'1.67-2.13 (m, 8 H), 2.45 (m, 5 H), 2.70 (t, J=7.4 Hz, 2
H), 2.72-2.75 (m, 2 H), 3.19 (t, J=7.4 Hz, 2 H), 3.34-3.45
(m, 2 H), 3.75 (s, 3 H), 6.82 (s, 1 H), 6.87 (s, 1 H),
7.13-7.44 (m, 3 H), 7.54 (d, J=9.6 Hz, 1 H), 7.43 (d,
J=7 . 4 Hz, 1 H) , 7. 69 (s, 1 H) , 7.79 (d, J=9. 6 Hz, 1 H) ,
8.87 (t, J=5.2 Hz, 1 H).
To the free base (50.0 mg, 0.084 mmol) in 4 mL of
dichloromethane, 5 mL of 1 N HCl in ether was added, and
the solution concentrated under reduced pressure.
Recrystallization from ether gave 30.0 mg (86 0) of the
product as a white solid: m.p. 165-167 °C; Anal. Calcd.
for C3,H3EN60sCl + 1.5 H~O:~ C, 57.81; H, 5.95. Found: C,
57.75; H, 5.91.
Example 24
(1)-1,2,3,6-TETRAHYDRO-1-{N-[4-(3,4-DIHYDRO-2-OXOSPIRO-
NAPHTHALENE-1(2H))-PIPERIDINE-1-YL]PROPYL}CARBOXAMIDO-5-
METHOXY-CARBONYL-2- OXO-6-(3,4-DIFLUOROPHENYL)-
4-METHYLPYRIMIDINE
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-211-
(-1-)-4-(3,4-DIFLUOROPHENYL)-6-METHYL-2-OXO-3-{(SPIRO[ISOC
HROMAN- 3,4'PIPERIDIN]-1-ONE)PROPYL}-1,2,3,4-
TETRAHYDROPYRIMIDINE-5- CARBOXYLIC ACID METHYL ESTER: To
(~)-4-(3,4-Difluorophenyl)- 1,6-dihydro-2-methoxy-5-
methoxycarbonyl-4-methyl-1-(4-nitrophen-
oxy)carbonylpyrimidine (40.0 mg, 0.0865 mmol) in 10 mL of
dry dichloromethane, spiro[isochroman-3,4'piperidin]-1-one
(44.0 mg, 0.173 mmol) was added and the solution was
stirred at room temperature for 24 h. The reaction
mixture was stirred for another 1 h after addition of 2 mL
of 6N HCl. The reaction mixture was basified with 100
aqueous KOH solution (pH - 9) and extracted into
dichloromethane (3 x 10 mL). The organic layer was dried
over sodium sulfate, filtered and concentrated. The crude
product was purified by flash chromatography (EtOAc/ MeOH,
4.5/0.5), giving 45.0 mg (900) of
(~)-4-(3,4-difluorophenyl)- 6-methyl-2-oxo-3-
{(spiro[isochroman-3,4'piperidin]-1-one)propyl}-1,2,3,4-
tetrahydropyrimi-dine-5-carboxylic acid methyl ester as a
syrup; 1H NMR 8 1.75-1.94 (m, 9H), 2.05-2.13 (m, 4 H),
2.36-2.41 (m, 5 H), 2.70 (t, J=7.35 Hz, 2 H), 2.77 (m, 2
Hl, 3.19 (t, J=7.4 Hz, 2 H), 3.39-3.43 (m, 2 H), 6.69 (s,
1 H) , 7 .04-7 .45 (m, 8 H) , 8.82 (t, J=5.2 Hz, 1 H) .
To the free base (45.0 g, 0.077 mmol) in 4 mL of
dichloromethane, 5 mL of 1 N HC1 in ether was added, and
the solution was concentrated in vacuo. Recrystallization
f r om ether gave 0 . 050 g ( 100 0 ) of
(~)-4-(3,4-difluorophenyl)-6-
methyl-2-oxo-3-{(spiro-[isochroman-3,4'piperidin]-
1-one)propyl}-1,2,3,4-tetrahydro-pyrimidine-5-carboxylic
acid methyl ester hydrochloride as a white solid: m.p.
150-152 °C; Anal. Calcd. for CjIH3HF~N90C1 + 2 HzO: C, 56.49;
H,5.96. Found: C, 56.40; H, 5.95.
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-212-
Example 25
5-[(Z)-1-(1-ETHYL-2,2,4-TRIMETHYL-1,2-DIHYDRO-6-QUINOLIN
YL)-METHYLIDENE]-2-THIOXO-1,3-THIAZOLAN-4-ONE
Example 26
1-[BIS(4-FLUOROPHENYL)METHYL]-4-(3-PHENYL-2-PROPENYL)PIP
ERAZINE
Example 27
4-[(4-IMIDAZO[1,2-A]PYRIDIN-2-YLPHENYL)IMINO]METHYL-5-ME
THYL-1,3-BENZENEDIOL
Example 28
1-[3-(4-CHLOROBENZOYL)]PROPYL-4-BENZAMIDOPIPERIDINE
P r a p a r a t i o n o f
1-[3-(4-chlorobenzoyl)propyl]-4-benzamidopiperidine
1-[3-(4-CHLOROBENZOYL)PROPYL]-4-BENZAMIDOPIPERIDINE: A
mixture of 3-(4-chlorobenzol)propyl bromide (640 mg, 2.45
mmol), 4-benzamidopiperidine (500 mg, 2.45 mmol) and K.,C03
(1.01 g, 7.34 mmol) in 50 m1 of acetone was heated at
reflux temperature for 48 h. The cooled reaction mixture
was filtered to remove the solids, concentrated in vacuo,
giving a yellow solid, which was purified by
chromatography (MeOH/CHCl." 5/95). The product (320 mg ,
33.90) was isolated as a white powder: 1H NMR 8 1.46 (dq,
J1=1.0 Hz, J2=8.4 Hz, 2H), 1.90-2.10 (m, 4H), 2.16 (m,
2H), 2.43 (t, J=6.9 Hz, 2H), 2.80-2.90 (m, 2H), 2.97 (t,
J=6.9 Hz, 2H), 3.97 (m, 1H), 5.92 (d, J=7.8 Hz, 1H, N-H),
7.40-8.00 (m, 9H). The product was converted to the HCl
salt and recrystallized from MeOH/Et~O, m.p. 243-244 °C;
Anal. Calcd for C~~H~,C1N~0~ + HC1 + H~O: C, 60.15; H, 6.37;
N, 6. 37; Found: C, 60. 18; . H, 6. 34; N, 6.29.
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-213-
Example 29
4-[4-(4-CHLOROPHENYL)-4-HYDROXY-1-PIPERIDINYL]-1-(4-CHLO
ROPHEN-YL)-1-BUTANONE
Example 30
N-METHYL-8-[4-(4-FLUOROPHENYL)-4-OXOBUTYL]-1-PHENYL-1,3,
8-TRI-AZASPIRO-[4.5]DECAN-4-ONE
Example 31
1H-1,2,3-BENZOTRIAZOL-1-YL (2-NITROPHENYL) SULFONE
Example 32
(1)-1,2,3,6-TETRAHYDRO-1-{N-[4-(DIHYDROINDENE)-1-YL}PROP
Y L } -
CARBOXAMIDO-5-METHOXYCARBONYL-2-OXO-6-(3,4-DIFLUORO)-4-M
ETHYL-PYRIMIDINE
1-(3-TERT-BUTOXYCARBONYLAMINOPROPYL)SPIRO[1H-INDANE-1,4'-
PIPERIDINE]: To a stirred solution of spiro[1H-indane-
1,4'-piperidine] (M.S.Chambers et a1. J. Med. Chem.
(1992) 35, 2033.) (0.790 g, 4.22 mmol) in dioxane (20 mL),
N-(tert-butoxy-carbonyl),-3-bromopropylamine (1.1 g, 4.64
mmol) and potassium carbonate (1.17 g, 8.44 mmol) were
added and the resulting solution was heated at reflux
temperature for 24 h. The reaction mixture was cooled to
room temperature, concentrated and partitioned between 40
mL of chloroform and 5 mL of water. The organic layer was
dried over sodium sulfate, filtered and concentrated. The
crude product was purified by column chromatography (ethyl
acetate/ methanol, 4.5/0.5) to yield 0.886 g (61 0) of the
required product as a colorless oil: 1H NMR 8 1.46 (s, 9
H), 1.55 (d, J=11.3 Hz, 2 H), 1.69 (t, J=6.3 Hz, 2 H),
1.88-2.47 (m, 6 H), 2.47 (t, J=6.3 Hz, 2 H), 2.88 (t,
J=3.3 Hz, 4 H), 3.23 (d, J=5.6 Hz, 2 H), 5.85 (br s, 1 H),
7.18 (s, 4 H).
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-214-
1-(3-AMINOPROPYL)SPIRO[1H-INDANE-1,4'-PIPERIDINE]: To
l-(3-tert- Butoxycarbonylaminopropyl)spiro[1H-indane-1,4'-
piperidine] (0.180 g, 0.52 mmol) in 5 mL of
dichloromethane, 1 mL of trifluoroacetic acid was added
and the solution stirred at room temperature for 1 h. The
solution was concentrated, neutralized with 10 o KOH
solution and extracted into 25 mL of dichloromethane. The
organic layer was dried over sodium sulfate, filtered and
concentrated, giving 0.156 g (100x) of the product which
was used as such for the subsequent step.
(~)-4-(3,4-DIFLUORO)-6-METHYL-2-OXO-3-{SPIRO[1H-INDANE-1
4'-PIPERIDINE]PROPYL}-1,2,3,4-TETRAHYDROPYRIMIDINE-5-CA
RBOXYLIC ACID METHYL ESTER: To
(~)-4-(3,4-difluoro)1,6-dihydro-
2-methoxy- 5-methoxycarbonyl- 4-methyl-1-
(4-nitrophenoxy)carbonylpyrimidine (50.0 g, 0.108 mmol) in
10 mL of dry dichloromethane, 1-(3-
aminopropyl)spiro[1H-indane-1,4'-piperidine] (53.0 mg,
0.216 mmol) was added and the solution was stirred at room
temperature for 24 h. The reaction mixture was stirred
for another 1 h after addition of 2 mL of 6N HCl. The
reaction mixture was basified with 10o aqueous KOH
solution (pH = 9) and extracted into dichloromethane (3 x
10 mL). The organic layer was dried over sodium sulfate,
filtered and concentrated. The crude product was purified
by flash chromatography (EtOAc/ MeOH, 4.5/0.5), giving
60.0 mg (1000) of the product as a syrup: 1H NMR X1.52 (d,
J=13.2 Hz, 2 H), 1.70-2.07 (m, 8 H), 2.12 (t, J=10.3 Hz,
2 H) , 2. 42 (s, 4 H) , 2. 86-2.91 (m, 3 H) , 3.32-3. 43 (m, 2
H), 3.72 (s, 3 H), 6.71 (s, 1 H), 6.81 (br s, 1 H),
7.04-7.19 (m, 7 H), 8.82 (t, J=5.2 Hz, 1 H).
To the free base (0.060 g, 0.108 mmol) in 4 mL of
dichloromethane, 5 mL of 1 N HC1 in ether was added, and
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-215-
the solution was concentrated under reduced pressure.
Recrystallization from ether gave 0.070 g (1000) of the
product as a white solid; m.p. 150-153 °C; Anal. Calcd. for
C,~,HjEF=N406C1: C, 54.86; H,~5.53; N, 8.54. Found: C, 54.96;
H, 5.57; N, 8.27.
Example 33
(+)-1,2,3,6-TETRAHYDRO-1-{N-[4-(3,4,5-TRIFLUORO)-PHENYL-
1 0 P I P E R - I D I N - 1 - Y L ] P R O P Y L } C A R B 0 X A M I D 0 - 4 -
M E T H 0 X Y M E T H Y L - 6 - ( 3 , 4 -
DIFLUOROPHENYL)-2-OXOPYRIMIDINE-5-CARBOXYLIC ACID METHYL
ESTER: mp °C; [a]D - +123.0, (c - 0.15, MeOH) ; 1H NMR ~
1.70-1.82 6H),1.97-2.08 (m, 2H), 2.40(t, J=6.9 Hz,
(m,
2H), 2.74-2.87 (m, 1H), 3.01 (d, J=11.1Hz, 2H), 3.29-3.40
(m, 2H), 3.49 (s, 3H), 3.71 (s, 3H), 4.69(s, 2H), 6.68
(s, 1H), 6.88-6.95 (m, 2H), 7.05-7.11 (m, 2H), 7.15-7.22
(m, 1H) , 7 (s, 1H) 8. (t, J=5.4 Hz,
.71 , 90 1H)
.
Example 34
(+)-1,2,3,6-TETRAHYDRO-1-{N-[2-(S)-METHYL)-4-(2-NITROPHE
N Y ) -
PIPERAZIN-1YL]PROPYL}-CARBOXAMIDO-4-METHYL-6-(3,4-DIFLUO
ROPHEN-YL)-2-OXO-PYRIMIDINE
(S)-(+)-3-METHYL-1-(2-NITROPHENYL)-PIPERAZINE: To a
solution of 2-bromonitrobenzene (0.600 g, 3.00 mmol) in
1,4-dioxane (15 mL) was added (S)-(+)-2-methylpiperazine
(0.500 g, 0.500 mmol) and powdered K~C03 (15.0 mmol, 1.50
g) and the resulting suspension was heated at reflux for
10 h. After the suspension was cooled, it was filtered
through a sintered glass funnel and the solvent was
removed in vacuo. The resulting residue was purified by
column chromatography (1/1 hexane/EtOAc followed by 4/1
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-21~-
E t 0 A c / M a 0 H ) , g i v i n g
(S)-(+)-3-methyl-1-(2-nitrophenyl)-piperazine as an orange
oil (0.53 g, 800).
(+)-1,2,3,6-TETRAHYDRO-1-{N-[2-(S)-METHYL)-4-(2-NITROPHE
NYL)PIPERAZIN-lYL]PROPYL}-CARBOXAMIDO-4-METHYL-6-(3,4-DI
FLUOROPHENYL)-2-OXO-PYRIMIDINE: To a solution of (+)-1-
( 3 - b r o m o - p r o p y 1 c a r b a m o y 1 ) -
6-(3,4-difluorophenyl)-4-methyl-2-oxo-1,6-dihydro-pyrimi
dine-5- carboxylic acid methyl ester (0.200 g, 0.500 mmol)
and (S)-(+)-3-methyl-1-(2-nitrophenyl)-piperazine (0.170
g, 0.750 mmol) in 20 mL of anhydrous acetone was added
powdered K~C03 (0.34 g, 3.5 mmol) and KI (0.07 g, 0.5 mmo1)
and the resulting suspension was heated at reflux
temperature for 10 h. TLC indicated a new spot for the
product (Rf - 0.3, 3/0.5 EtOAc/MeOH) and mostly the
starting material. The suspension was cooled, filtered
and the solvent was evaporated and the residue was
purified by column chromatography (EtOAc/MeOH, 5/1).
( + ) - 1 , 2 , 3 , ~ -
Tetrahydro-1-{N-[2-(S)-methyl)-4-(2-nitrophenyl)piperazi
n - 1 -~ y 1 ] -
propyl}-carboxamido-4-methyl-6-(3,4-difluorophenyl)-
2-oxo-pyr-imidine was obtained as yellow oil (0.030 g, 100
yield). The HCl salt was prepared by the addition of HCl
in ether to a solution of the product in dichloromethane,
followed by evaporation of the solvents; mp 150-153 "C;
[a] I, = 58 .3 (c = 0.3, MeOH~) ; 1H NMR (CD30D) d 1. 04 (d, J=6. 0
Hz, 3 H), 1.71-1.78 (m, 2 H), 2.33-2.49 (m, 3 H), 2.42 (s,
3 H), 2.55-2.92 (m, 5 H), 3.00-3.10 (m, 3 H), 3.34 -3.42
(m, 2 H), 3.72 (s, 3 H), 6.71 (s, 1 H), 7.01-7.32 (m, 6
H) , 7 . 46 (dt, J=0.7 Hz, J=8. 4 Hz, 1 H) , 7.74 (dd, J=1 .5,
8.4 Hz, 1 H), 8.82 (t, J=3.9 Hz, 1 H). Anal calcd. for
C~riH3~N6F~06 + 0.20 CH~Cl~ . C, 52.92; H, 5.26; N, 13.13.
Found: C, 52.84; H, 5.68; N, 12.94.
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-217-
Example 35
1,2,3,6-TETRAHYDRO-1{N-[4-(2'-METHYL-PHENYL)PIPERAZIN-1-
Y L ] _
PROPYL}-CARBOXAMIDO-4-METHYL-6-(3,4-DIFLUOROPHENYL)-2-OXO
PYRIMIDINE: The amine used was 4-(2'-methyl-phenyl)
piperazine. 1H NMR 8 1.75-1.80 (m, 2 H), 2.29 (s, 3 H),
2.42 (s, 3 H), 2.41-2.48 (m, 2 H), 2.58-2.62 (m, 4 H),
2.91-2.97 (m, 4 H), 3.35 -3.42 (m, 2 H), 3.72 (s, 3 H),
x.71 (s, 1 H), 6.97-7.26 (m, 8 H), 8.81 (t, J=3.9 Hz, 1
H). The product was dissolved in ether and 1 N HC1 in
ether was added. The ether was evaporated, giving the
dihydrochloride salt; mp 66-71 °C. Anal calcd. for
C,~Hj~,N~F~O4 C1~ + 1.75 acetone: C, 55.73; H, 6.40; N, 9.78.
Found: C, 56.16; H, 6.29; N, 10.06.
Example 36
(+)-1,2,3,6-TETRAHYDRO-5-METHOXYCARBONYL-4-METHOXYMETHYL
-2-OXO-1-{N-[3-(4-METHYL-4-PHENYL PIPERIDINE-1-YL]PROPYL}-
6-(3,4- DIFLUOROPHENYL) PYRIMIDINE: Hygroscopic; [a,]L, _ +
82.1(c = 0.31, MeOH); 1H NMR X1.14 (s, 3 H), 1.61-1.72 (m,
4 H), 2.03-2.08 (m, 2 H), 2.25 (t, J=7.2 Hz, 2 H),
2.30-2.42 (m, 4 H), 3.19-3.31 (m, 2 H), 3.40 (s, 3 H),
3.63 (s, 3 H), 4.60 (s, 2 H), 6.60 (s, 1 H), 6.97-7.29 (m,
8 H) , 7. 63 (br s, 1 H) , '8 .78 (t, J=5.7 Hz, 1 H) . Anal
calcd. for C3oH3~Nq0,F.,C1 + CH.,C1., . C, 53.80; H, 5.68; N,
8.10. Found: C, 53.79; H, 6.03; N, 7.83.
EXAMPhE 37
5-(5-BUTYL-2-THIENYL)PYRIDO[2,3-d]PYRIMIDINE-
2,4,7 (1H,3H,8H)-
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-218-
Example 38
METHYL (4S)-3-[({3-[4-(3-AMINOPHENYL)-1-
PIPERIDINYL]PROPYL}AMINO)CARBONYL]-4-(3,4-
DTFLUOROPHENYL)-6-(METHOXYMETHYL)-2-0X0-1,2,3,4-
TETRAHYDRO-5-PYRIMIDINECARBOXYLATE: 1H NMR (400 MHz,
CDC13) 8 7.80 (s, 1H), 7.22-7.02 (m, 2H), 6.95 (t, 2H,
J=8.7 Hz), 6.63-6.44 (m, 4H), 4.56 (ABq, 2H), 3.62 (s,
3H), 3.33 (s, 3H), 3.32 (m, 4H), 2.96 (br s, 2H), 2.34
(t, 2H, J=7.5 Hz), 2.11-1.94 (m, 3H), 1.81-1.64 (m, 4H);
ESMS m/e: 572.3 (M + H)+.
Example 39
The product was obtainea according to the method
described for Example 40.
METHYL (4S)-4-(3,4-DIFLUOROPHENYL)-3-({[3-(4-{3-
[(METHOXYACETYL)AMINO]PHENYL}-1-
PIPERIDINYL)PROPYL]AMINO}CARBONYL)-6-(METHOXYMETHYL)-2-
OXO-1,2,3,4-TETRAHYDRO-5-PYRIMIDINECARBOXYLATE; 15.6 mg
(69o yield); 1H NMR (400 MHz, CDC13) 8 9.01 (s, 1H), 8.25
(s, 1H), 7.60 (s, 1H), 7.37 (d, 1H, J=7.2 Hz), 7.30-7.05
(m, 5H) , 7.02 (d, 1H, J=8.0 Hz) , 6.71 (s, 1H) , 4.70 (s,
2H), 4.03 (s, 2H), 3.73 (s, 3H), 3.53 (s, 3H), 3.4'~ (s,
3H), 3.42-3.33 (m, 2H), 3.08 (br s, 2H), 2.49 (br s,
2H), 2.20 (s, 2H), 2.07 ~(br s, 1H), 1.97-1.75 (m, 4H);
ESMS m/e: 644.3 (M + H)+
Example 40
METHYL (4S)-4-(3,4-DIFLUOROPHENYL)-3-({[3-(4-{3-[(3,3-
DTMETHYLBUTANOYL)AMINO]PHENYL}-1-
PTPERIDINYL)PROPYL]AMINO}CARBONYL)-6-(METHOXYMETHYL)-2-
OXO-1,2,3,4-TETRAHYDRO-5-PYRIMIDINECARBOXYLATE
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-219-
To the 20 ml vial was added methyl (4S)-3-[({3-[4-(3-
aminophenyl)-1-piperidinyl]propyl}amino)carbonyl]-4-
(3,4-difluorophenyl)-6-(methoxymethyl)-2-oxo-1,2,3,4-
tetrahydro-5-pyrimidinecarboxylate (0.035 mmol), an acid
chloride or sulfonyl chloride (1.5 eq), N,N-.
diisopropylethylamine (5 eq) and dichloromethane (2 ml)
at room temperature. The reaction mixture was stirred at
room temperature for 24 h, at which time 'the TLC
analysis indicated the reaction was completed. The
reaction mixture was concentrated to a small volume and
purified by preparative TLC (silica, 2000 microns, 95:5
- dichloromethane . methanol with 10 of isopropylamine)
to give 5.6ymg of methyl (4S)-4-(3,4-difluorophenyl)-3-
({[3-(4-{3-[(3,3-dimethylbutanoyl)amino]phenyl}-1-
piperidinyl)propyl]amino}carbonyl)-6-(methoxymethyl)-2-
oxo-1,2,3,4-tetrahydro-5-pyrimidinecarboxylate: 24.60
yield; 1H NMR (400 MHz, CDC13) 8 7.50 (s, 1H), 7.26 (d,
1H, J=8 .3 Hz) , 7 . 15-7.02 (m, 5H) , 6. 88 (d, 1H, J=8 .3
Hz), 6.55 (s, 1H), 4.56 (ABq, 2H), 3.62 (s, 3H), 3.32
(s, 3H), 3.25 (t, 4H, J=9.0 Hz), 2.99 (d, 2H, J=10.8
Hz), 2.49-2.37 (m, 3H), 2.08 (t, 2H, J=11.7 Hz), 1.78-
1.65 (m, 14H); ESMS m/e: 670.4 (M + H)+.
Example 41
The product was obtained according to the method
described for methyl (4S)-4-(3,4-difluorophenyl)-3-({[3-
(4-{3-[(3,3-dimethylbutanoyl)amino]phenyl}-1-
piperidinyl)propyl]amino}carbonyl)-6-(methoxymethyl)-2-
oxo-1,2,3,4-tetrahydro-5-pyrimidinecarboxylate.
METHYL (4S)-4-(3,4-DIFLUOROPHENYL)-6-(METHOXYMETHYL)-2-
OXO-3-{[(3-{4-[3-(PROPIONYLAMINO)PHENYL]-1-
PIPERIDINYL}PROPYL)AMINO]CARBONYL}-1,2,3,4-TETRAHYDRO-5-
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-220-
PYRIMIDINECARBOXYLATE: 9.9 mg (45o yield) b 1H NMR (400
MHz, CDC13) S 7.36 (s, 1H), 7.28 (d, 1H, J=8.0 Hz), 7.16-
7.02 (m, 5H), 6.86 (d, 1H, J=7.6 Hz), 6.54 (s, 1H), 4.56
(ABq, 2H), 3.62 (s, 3H), 3.32 (s, 3H), 3.27-3.19 (m,
4H) , 2 . 95 (d, 2H, J=10.3. Hz) , 2 , 41 (m, 1H) , 2.34 (t, 2H,
J=7.7 Hz), 2.28 (q, 2H, J=7.6 Hz), 2.01 (t, 2H, J=11.1
Hz), 1.73-1.64 (m, 8H); ESMS m/e: 628.4 (M + H)~
Example 42
The product was obtained according to the method
described for methyl (4S)-4-(3,4-difluorophenyl)-3-({[3-
(4-{3-[(3,3°dimethylbutano.yl)amino]phenyl}-1-
piperidinyl)propyl]amino}carbonyl)-6-(methoxymethyl)-2-
oxo-1,2,3,4-tetrahydro-5-pyrimidinecarboxylate.
METHYL (4S)-4-(3,4-DIFLUOROPHENYL)-6-(METHOXYMETHYL)-3-
({[3-(4-{3-[(3-METHYLBUTANOYL)AMINO]PHENYL}-1-
PIPERIDINYL)PROPYL]AMINO}CARBONYL)-2-OXO-1,2,3,4-
TETRAHYDRO-5-PYRIMIDINECARBOXYLATE: 10.4 mg (45o yield)
8 zH NMR (400 MHz, CDC13) 8 7.35 (s, 1H) , 7 .28 (d, 1H,
J=7.9 Hz), 7.16-7.03 (m, 5H), 6.88 (d, 1H, J=7.4 Hz),
6.56 (s, 1H) , 4.56 (ABq, 2H) , 3. 62 (s, 3H) , 3.32 (s,,~
3H), 3.25 (t, 4H, J=6.7 Hz), 2.98 (d, 2H, J=11.1 Hz),
2.43 (m, 1H), 2.38 (t, 2H, J=7.5 Hz), 1.13 (d, 2H, J=7.5
Hz), 2.10-2.01 (m, 2H), 1.75-1.64 (m, 6H), 0.91 (d, 6H,
J=5.8 Hz); ESMS m/e: 656.4 (M + H)+
Example 43
The product was obtained according to the method
described for methyl (4S)-4-(3,4-difluorophenyl)-3-({[3-
(4-{3-[(3,3-dimethylbutanoyl)amino]phenyl}-1-
piperidinyl)propyl]amino}carbonyl)-6-(methoxymethyl)-2-
oxo-1,2,3,4-tetrahydro-5-pyrimidinecarboxylate.
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-221-
METHYL (4S)-4-(3,4-DIFLUOROPHENYL)-3-{[(3-{4-[3-
(ISOBUTYRYLAMINO)PHENYL]-1-
PIPERIDINYL}PROPYL)AMINO]CARBONYL}-6-(METHOXYMETHYL)-2-
OXO-1,2,3,4-TETRAHYDRO-5-PYRIMIDINECARBOXYLATE: 16.4 mg
(73 o yield) 8 1H NMR (400 MHz, CDC13) 8 7.37 (s, 1H) ,
7.28 (d, 1H, J=7.3 Hz), 7.16-7.01 (m, 5H), 6.88 (d, 2H,
J=7.3 Hz), 6.54 (s, 1H), 4.56 (ABq, 2H), 3.62 (s, 3H),
3.32 (s, 3H), 3.25 (t, 2H, J=6.8 Hz), 3.23-3.18 (m, 2H),
3.03 (d, 2H, J=11.7 Hz), 2.57-2.48 (m, 1H), 2.43 (t, 2H,
J=8.0 Hz), 2.14 (t, 2H, J=9.4 Hz), 1.8-1.65 (m, 5H),
1.09 (d, 6H, J=6.3 Hz); ESMS m/e: 642.4 (M + H)+
Example 44
The product was obtained according to the method
described for methyl (4S)-4-(3,4-difluorophenyl)-3-({[3-
(4-{3-[(3,3-dimethylbutanoyl)amino]phenyl}-1-
piperidinyl)propyl]amino}carbonyl)-6-(methoxymethyl)-2-
oxo-1,2,3,4-tetrahydro-5-pyrimidinecarboxylate.
METHYL (4S)-3-{[(3'{4-[3-(BUTYRYLAMINO)PHENYL]-1-
PIPERIDINYL}PROPYL)AMINO]CARBONYL}-4-(3,4-
DIFLUOROPHENYL)-6-(METHOXYMETHYL)-2-OXO-1,2,3,4-
TETRAHYDRO-5-PYRIMIDINECARBOXYLATE: 14.7 mg (65.50
yield) 8 1H NMR (400 MHz, CDC13) b 7.38 (s, 1H), 7.26 (s,
1H), 7.17-6.99 (m, 5H), 6.87 (s, 1H), 6.55 (s, 1H), 4.56
(ABq, 2H), 3.63 (s, 3H), 3.33 (s, 3H), 3.28-3.17 (n~,
6H), 3.0 (br s, 2H), 2.51-2.36 (m, 3H), 2.25 (t, 2H,
J=5.0 Hz), 2.10 (br s, 2H), 1.8-1.56 (m, 6H), 0.90 (t,
3H, J=5.0 Hz); ESMS m/e: 642.4 (M + H)+,
Example 45
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-222-
(4R) -N- (3-{4- [3- (BUTYRYLAMINO) PHENYL] -1-
PIPERIDINYL}PROPYL)-4-(3,4-DIFLUOROPHENYL)-6-
(METHOXYMETHYL)-2-OXO-1,2,3,4-TETRAHYDRO-5-
PYRIMIDINECARBOXAMIDE
Method:
(4R) -4- (3, 4-difluorophenyl) -6- (methoxymethyl) -2-oxo-
1,2,3,4-tetrahydro-5-pyrimidinecarboxylic acid: A
stirred mixture of one mole equivalent of methyl (4R)-4-
(3,4-difluorophenyl)-6-(methoxymethyl)-2-oxo-1,2,3,4-
tetrahydro-5-pyrimidinecarboxylate (10.0 g, 32.0 mmo1)
and lithium hydroxide (2 equivalents, 1.53 g, 64.0 mol)
in H20-THF (2:1, 300 mL) was heated at reflux temperature
for 1 h. The reaction mixture was concentrated,
dissolved in water, washed with ethyl acetate and
acidified (1 N HC1) to pH 3-4 (pH paper). The
precipitated product was collected; washed with water
and dried under reduced pressure to give the desired
product in 90o yield.
(4R) -4- (3, 4-DIFLUOROPHENYL) -6- (METHOXYMETHYL) -N- [3- (4-
~.
(3-NITROPHENYL)-3,6-DIHYDRO-1(2H)-PYRIDINYL)PROPYL}-2-
OXO-1,2,3,4-TETRAHYDRO-5-PYRIMIDINECARBOXAMIDE: A
solution of (4R) -4- (3, 4-difluorophenyl) -6-
(methoxymethyl)-2-oxo-1,2,3,4-tetrahydro-5-
pyrimidinecarboxylic acid (1.2 eq), EDC (1.5 Eq.), N-
methylmorpholine (2.0 Eq.) in dichloromethane was
stirred at room temperature for 15 minutes, followed by
addition of 3- (4- (3-nitrophenyl) -3, 6-dihydro-1 (2H) -
pyridinyl)-1-propanamine (1.0 eq.) to the reaction
mixture. The resulting solution was stirred for 18
hours, concentrated and chromatographed on silica to
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-223-
give (4R)-4-(3,4-difluorophenyl)-6-(methoxymethyl)-N-[3-
( 4- ( 3-nitrophenyl ) -3, 6-dihydro-1 ( 2H) -pyridinyl ) propyl ] -
2-oxo-1,2,3,4-tetrahydro-5-pyrimidinecarboxamide.
(4R)-N-{3-[4-(3-AMINOPHENYL)-1-PIPERIDINYL]PROPYL}-4-
(3,4-DIFLUOROPHENYL)-6-(METHOXYMETHYL)-2-OXO-1,2,3,4-
TETRAHYDRO-5-PYRIMIDINECARBOXAMIDE: A mixture of (4R)-4-
(3,4-difluorophenyl)-6-(methoxymethyl)-N-[3-(4-(3-
nitrophenyl)-3,6-dihydro-1(2H)-pyridinyl)propyl]-2-oxo-
1,2,3,4-tetrahydro-5-pyrimidinecarboxamide, 10o Pd/C in
ethanol was hydrogenated (balloon method) for 2 days.
The reaction mixture was filtered through Celite 545,
washed with ethanol and concentrated to give the desired
product.
(4R) -N- (3-{ 4- [3- (BUTYRYLAMINO) PHENYL] -1-
PIPERIDINYL}PROPYL)-4-(3,4-DIFLUOROPHENYL)-6-
(METHOXYMETHYL)-2-OXO-1,2,3,4-TETRAHYDRO-5-
PYRIMIDINECARBOXAMIDE: Into a 20 mL vial was.added(4R)-
N-{3-[4-(3-aminophenyl)-1-piperidinyl]propyl}-4-(3,4-
difluorophenyl)-6-(methoxymethyl)-2-oxo-1,2,3,4-
tetrahydro-5-pyrimidinecarboxamide (0.040 mmol), acid
chloride (1.5 eq) and N,N-diisopropylethylamine (5"Of~eq)
in 2.0 mL of dichloromethane at room temperature. After
24 hrs, the reaction mixture was concentrated in vacuo
and purified by preparative TLC (silica, 2000 microns,
95:5 = dichloromethane . methanol with to of
isopropylamine) to give 9.2 mg (45o yield) of the
desired product: 1H NMR 0400 MHz, CD30D) $ 7.49 (s, 1H) ,
7.25 (d, 1H, J=7.6 Hz), 7.20-7.02 (m, 5H), 6.91 (d, 1H,
J=8 Hz), 5.29 (s, IH), 4.24 (ABq, 2H), 3.30 and 3.24
(two s, 3H), 3.46-3.12 (m, partially hidden by three s,
4H), 2.74 (br s, 4H), 2.25 (t, 2H, J=8.2 Hz), 2.04-1.69
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-224-
(m, 7H), 1.63 (sextet, 2H, J=7.4 Hz), 0.91 (t, 3H, 7.4
Hz); ESMS m/e: 584.4 (M + H)+.
Example 46
The product was obtained according to the method
described for (4R)-N-(3-{4-[3-(butyrylamino)phenyl]-1-
piperidinyl}propyl)-4-(3,4-difluorophenyl)-6-
(methoxymethyl)-2-oxo-1,2,3,4-tetrahydro-5-
pyrimidinecarboxamide.
(4R)-4-(3,4-DIFLUOROPHENYL)-6-(METHOXYMETHYL)-2-OXO-N-
(3-{4-[3-(PROPIONYLAMINO)PHENYL]-1-PIPERIDINYL}PROPYL)-
1,2,3,4-TETRAHYDRO-5-PYRIMIDINECARBOXAMIDE: 5.6 mg
(24. 6o yield) ; 1H NMR (400 MHz, CD30D) ~ 7.56 (s, 1H) ,
7.35 (d, 1H, J=6.9 Hz), 7.3-7.03 (m, 4H), 7.17 (br s,
1H), 6.99 (d, 1H, J.=7.0 Hz), 5.45 (s, 1H), 4.33 (ABq,
2H), 3.41 (s, 3H), 3,37-3.23 (m, partially hidden, 4H),
2.8 (br s, 4H), 2.39 (d, 2H, J=9.3 Hz), 2.14-1.78 (m,
7H), 1.21 (t, 3H, J=7.6 Hz); ESMS m/e: 570.4 (M + H)+.
Example 47
The product was obtained according to the method
f'
described for (4R) -N- (3-{4- [3- (butyrylamino) phenyl]-'=1-
piperidinyl}propyl)-4-(3,4-difluorophenyl)-6-
(methoxymethyl)-2-oxo-1,2,3,4-tetrahydro-5-
pyrimidinecarboxamide.
(4R)-4-(3,4-DIFLUOROPHENYL)-6-(METHOXYMETHYL)-N-[3-(4-
{3-[(3-METHYLBUTANOYL)AMINO]PHENYL}-1-
PIPERIDINYL)PROPYL]-2-OXO-1,2,3,4-TETRAHYDRO-5-
PYRIMIDINECARBOXAMIDE: 11.1 mg (46o yield); 1H NMR (400
MHz, CD30D) 8 7.81 (d, 1H, J=8.5 Hz) , 7. 6 (s, 1H) , 7.55 (s,
1H), 7.36 (br s, 1 H), 7.31-7.17 (m, 3H), 7.01 (t, 1H,
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-225-
J=6.7 Hz) 6.64-6.61 (m, lH), 5.45 (br s, 1H), 4.32 (ABq,
2H), 3.94 and 3.87 (two s, 3H), 3.42-3.12 (m, partially
hidden, 2H), 3.1 (br s, 2H), 3.0 (t, 2H, J=11.1 Hz),
2.79-2.57 (m, 4H), 2.27-1.73 (m, 8H), 1.19 and 1.01 (two
d, 6H, J=6.6 Hz); ESMS m/e: 598.4 (M + H)+,
Example 48
The product was obtained according to the method
described for (4R)-N-(3-{4-[3-(butyrylamino)phenyl],-1-
piperidinyl}propyl)-4-(3,4-difluorophenyl)-6-
(methoxymethyl)-2-oxo-1,2,3,4-tetrahydro-5-
pyrimidinecarboxamide.
(4R)-4-(3,4-DIFLUOROPHENYL)-6-(METHOXYMETHYL)-N-[3-(4-
{3-[(2-METHYLBUTANOYL)AMINO]PHENYL}-1-
PIPERIDINYL)PROPYL]-2-OXO-1,2,3,4-TETRAHYDRO-5-
PYRIMIDINECARBOXAMIDE: 6.7 mg (28o yield); 1H NMR (400
MHz, CD30D) 8 7.59 (s, 1H), 7.35 (br s, 1H), 7.3-7.2 (m,
3H), 7.17 (br s, 1H), 7.01 (d, 1H, J=6.8 Hz), 5.45 (s,
1H), 4.33 (ABq, 2H), 3.39 (s, 3H), 3.29 (m, 2H), 2.84
(br s, 4H), 2.42 (m, 1H), 2.14-1.78 (m, 9H), 1,7 (m,
1H) , 1 .49 (m, 1H) , 1.20 (d, 3H, J=6.7 Hz) , 0. 95 (t, 3H,
J=6.6 Hz); ESMS m/e: 598.4 (M + H)+.
Example 49
The product was obtained according to the method
described for (4R)-N-(3-{4-[3-(butyrylamino)phenyl]-1-
piperidinyl}propyl)-4-(3,4-difluorophenyl)-6-
(methoxymethyl)-2-oxo-1,2,3,4-tetrahydro-5-
pyrimidinecarboxamide.
(4R) -4- (3, 4-DIFLUOROPHENYL) -N- [3- (4-{3- [ (3, 3-
DIMETHYLBUTANOYL)AMINO]PHENYL}-1-PIPERIDINYL)PROPYL]-6-
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-226-
(METHOXYMETHYL)-2-OXO-1,2,3,4-TETRAHYDRO-5-
PYRIMIDINECARBOXAMIDE: 1.1 mg (4.4o yield); ~H NMR (400
MHz, CD30D) b 7.6-6.91 (m, 7H), 5.43 (s, 1H),~ 4.31 (ABq,
2H), 3,40 (s, 3H), 3.27-1.26 (m, 17 H), 1.09 (s, 9H);
ESMS m/e: 612.4 (M + H)+.
Example 50
The product was obtained according to the method
described for (4R)-N-(3-{4-[3-(butyrylamino)phenyl]-1-
piperidinyl}propyl)-4-(3,4-difluorophenyl)-6-
'(inethoxymethyl)-2-oxo-1,2,3,4-tetrahydro-5-
pyrimidinecarboxamide.
( 4 R ) -4 - ( 3 , 4 -DI FLUOROPHENYL ) -N- ( 3- { 4 - [ 3-
(ISOBUTYRYLAMINO)PHENYL]-1-PIPERIDINYL}PROPYL)-6-
(METHOXYMETHYL)-2-OXO-1,2,3,4-TETRAHYDRO-5-
PYRIMIDINECARBOXAMIDE: 12.7 mg (54a yield); 1H NMR (400
MHz, CD30D) 8 7.59(s, 1H), 7.36 (d, 1H, J=8.6 Hz), 7.31-
7.07 (m, 4H), 7.01 (d, 1H, J=6.5 Hz), 5.39 (s, 1H), 4.34
(ABq, 2H), 3.35 (s, 3H), 3.33-3.19 (m, partially hidden,
2H), 3.08-2.72 (m, 4H), 2.63 (t, 2H, J=7.2 Hz), 2.14-
1.82 (m, 8H), 1.19 (d, 6H, J=6.9 Hz); ESMS m/e: 584.4 (M
+ H) ~'.
Example 51
The synthetic method is the same as described for~the
synthesis of (4S)-N-(3-{4-[3-(acetylamino)phenyl]-1-
piperidinyl}propyl)-4-(3,5-difluorophenyl)-2-oxo-1,3-
oxazolidine-3-carboxamide.
5-ACETYL-N-(3-{4-[3-(ACETYLAMINO)PHENYL]-1-
PIPERIDINYL}PROPYL)-4-METHYL-2-OXO-6-(3,4,5-
TRIFLUOROPHENYL)-3,6-DIHYDRO-1(2H)-
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-227-
PYRIMTDINECARBOXAMIDE: 14.5 mg (46o yield); 1H NMR (400
MHz, CDC13) 8 9.56 (s, 1H) , 9.20 (s, 1 H) , 8.21 (s, 1H) ,
7.52 (s, 1H), 7.18 (t, 1H, J=7.8 Hz), 7.07-6.75 (m, 5H),
3.59-3.37 (m, 1H), 3.48-3.38 (m, 1H), 3.08 (br s, 2H),
2.57-2.39 (m, 5H), 2.25 (s, 3H), 2.21 (s, 3H), 2.19-1.59
(m, 9H); ESMS m/e: 586.3 (M + H)+; Anal. Calc. for
C30H34F3N5~9'~O. 1CHC13: C, 60.50; H, 5.75; N, 11.72. Found:
C, 60.59; H, 5.40; N, 11.73.
Example 52
The synthetic method is the same as described for the
synthesis of (4S) -N- (3-{4- [3- (acetylamino) phenyl] -1-
piperidinyl}propyl)-4-(3,5-difluorophenyl)-2-oxo-1,3-
oxazolidine-3-carboxamide.
BENZYL 3-{[(3-{4-[3-(ACETYLAMINO)PHENYL]-1-
PIPERIDINYL}PROPYL)AMINO]CARBONYL}-4-(2,4-
DIFLUOROPHENYL)-6-ETHYL-2-OXO-1,2,3,4-TETRAHYDRO-5-
PYRIMIDINECARBOXYLATE: 14.8 mg (41o yield); 1H NMR (400
MHz, CDC13) 8 9.05 (br s, 1H) , 8.14 (s, 1H) , 7.47 (s,
1H) , 7 .37-7 .21 (m, 8H) , 7 . 18 (t, 1H, J=7 .7 Hz) , 6. 94 (d,
1H, J=6.9 Hz), 6.87 (d, 1H, J=7.4 Hz), 6.7-6.62 (m, 3H),
E
5.09 (q, 2H, J=17.8 Hz), 3.48-3.24 (m, 2H), 3.04 (ABq,
2H), 2.88-2.71 (m, 2H), 2.52-2.39 (m, 2H), 2.19 (s, 3H),
2.17-1.88 (m, 3H), 1.77-1.58 (m, 3H), 1.19 (t, 3H, J=7.5
Hz); ESMS m/e: 674.4 (M + H)+.
Example 53
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-228-
The synthetic method is the same as described for the
synthesis of (4S)-N-(3-{4-[3-(acetylamino)phenyl]-1-
piperidinyl}propyl)-4-(3,5-difluorophenyl)-2-oxo-1,3-
oxazolidine-3-carboxamide.
N-(3-{4-[3-(ACETYLAMINO)PHENYL]-1-PIPERIDINYL}PROPYL)-4-
(1,3-BENZODIOXOL-5-YL)-2;5-DIOXO-1,2,5,7-
TETRAHYDROFURO[3,4-D]PYRIMIDINE-3(4H)-CARBOXAMIDE: 8.75
mg (28o yield); 1H NMR (400 MHz, CDC13) 8 9.81 (s, 1H'),
8 . 14 (s, 1H) , 7 .53 (s, .1H) . 7 .21 (t, 1H, J=7'.7 Hz) , 6. 99
(d, 1H, J=7 .7 Hz) , 6. 91-6.7 (m, 4H) , 6. 42 (s, 1H) , 5. 9
(s, 2H), 4.75 (s, 2H), 3.61-3.5 (m, 1H), 3.37-3.27 (m,
1H), 3.08 (br s, 2H), 2.56-2.40 (m, 3H), 2.18 (s, 3H),
2.16-1.85 (m, 4H), 1.78-1.6 (m, 5H); ESMS m/e: 576.3 (M
+ H)~.
Example 54
The synthetic method is the same as described for the
synthesis of ( 4S) -N- (3-{ 4- [3- (acetyl amino) phenyl] -1-
piperidinyl}propyl)-4-(3;5-difluorophenyl)-2-oxo-1,3-
oxazolidine-3-carboxamide.
i
METHYL 1-{[(3-{4-[3-(ACETYLAMINO)PHENYL]-1-
PIPERIDINYL}PROPYL)AMINO]CARBONYL}-2-[(4-
METHOXYBENZYL)SULFANYL]-4-METHYL-6-(4-NITROPHENYL)--1,6-
DIHYDRO-5-PYRIMIDINECARBOXYLATE: 10.1 mg (26o yield); 1H
NMR (400 MHz, CDC13) 8 8.02 (d, 2H, J=7.5 Hz), 7.53 (br
s, 1H), 7.44-7.27 (m, 6H), 7.14 (d, 2H, J=8.5 Hz), 6.99
(d, 1H, J=7 . 6 ~Hz) , 6.75 (d, 2H, J=8.5 Hz) , 6.2 (s, 1H) ,
4.23 (ABq, 2H), 3.78 (s, 3H), 3.7 (s, 3H), 3.58-3.48 (m,
1H) 3.37-3.26 (m, 2H), 3.04 (m, 2H), 2.61-2.43 (m, 3H),
2.41 (s, 3H), 2.16 (s, 3H), 2.15-1.64 (m, 8H); ESMS m/e:
729.3 (M + H)~.
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-229-
Example 55
The synthetic method is the same as described for the
synthesis of (4S)-N-(3-{4-[3-(acetylamino)phenyl]-1-
piperidinyl}propyl)-4-(3,5-difluorophenyl)-2-oxo-1,3-
oxazolidine-3-carboxamide.
N-(3-{4-[3-(ACETYLAMINO)PHENYL]-1-PIPERIDINYL}PROPYL)-4-
(2,1,3-BENZOXADIAZOL-5-YL)-2,5-DIOXO-1,2,5,7-
TETRAI-iYDROFURO[3, 4-D] PYRIMIDINE-3 (4H)-CARBOXAMIDE: 7.7
mg (12o yield); 1H NMR (400 MHz, CDC13) 8 7.97-6.83 (m,
7H) , 6.49 (s, 1H) , 5.51 (s, 1H) , 3.43-2.02 (m, 17 H) ,
1.82 (s, 3H); ESMS m/e: 574.3 (M + H)+.
Example 56
The synthetic method is the same as described for the
synthesis of (4S)-N-(3-{4-[3-(acetylamino)phenyl]-1-
piperidinyl}propyl)-4-(3,5-difluorophenyl)-2-oxo-1,3-
oxazolidine-3-carboxamide.
METHYL (4S)-3-{[(3-{4-[3-(ACETYLAMINO)PHENYL]-1-
PIPERIDINYL}PROPYL)AMINO]CARBONYL}-4-(3,4-
DIFLUOROPHENYL)-6-METHYL-2-OXO-1,2,3,4-TETRAHYDRO-5-
PYRIMIDINECARBOXYLATE: 16.6 mg (52o yield); 1H NMR (400
MHz, CDC13) ~ 9.55 (br s, 1H), 9.07 (s, 1H), 8.19 (s,
1H), 7.54 (s, 1H), 7.25-6.98 (m, 4H), 6,95 (d, 1H, J=8.0
Hz) , 6.81 (d, 1H, J=7.5 Hz) , 6. 69 (s, 1H) , 3.70 (s, 3H) ,
3.57-3.34 (m, 2H), 3.06 (t, 2H, J=11.6 Hz), 2.47 (t, 2H,
J=8.1 Hz), 2.42 (s, 3H), 2.20 (s, 3H), 2.18-1.61 (m,
9H); ESMS m/e: 584.3 (M + H)+; Anal. Calc. for
C30H35F2N5~'~O.25CHC13: C, 59.23; H, 5.79; N, 11.42. Found:
C, 59.61; H, 5.31; N, 11.48.
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-230-
Peptide. Synthesis:
Abbreviations: Fmoc: 9-Fluorenyloxycarbonyl-; Trityl:
triphenylmethyl-; tBu-. tertiary butyl ester; OtBu-.
tertiary butyl ether; Ng: N-guanidinyl; Nin: N-Indole;
MBHA . methylbenzhydlamine; DMF: N,N-dimethylformamide;
NMP: N-Methylpyrrolidinone; DIEA: diisopripylethyl amine;
TFA: trifluoroacetic acid.
Small scale peptide syntheses were performed either
manually, by using a sintered glass column with argon
pressure to remove solvents and reagents, or by using an
Advanced ChemTech 396-900'0 automated peptide synthesizer
(Advanced ChemTech, Louisville, KY). Large scale peptide
syntheses were performed on a CS Bio 536 (CS Bio Inc., San
Carlos, CA). Fmoc-Alanine-OH, Fmoc-Cysteine(Trityl)-OH,
Fmoc-Aspartic acid(tBu)-OH, Fmoc-Glutamic acid(tBu)-OH,
Fmoc-Phenylalanine-OH, Fmoc-Glycine-OH,
Fmoc-Histidine(Trityl)-OH, Fmoc-Isoleucine-OH,
Fmoc-Lysine(Boc)-OH, Fmoc-Leucine-OH, Fmoc-Methionine-OH,
Fmoc-Asparagine(Trityl)-OH, Fmoc-Proline-OH,
Fmoc-Glutamine(Trityl)-OH, Fmoc-Arginine(Ng-2,2,4,6,7
-Pentamethyldihydrobenzofuran-5-sulfonyl)-OH,
Fmoc-Serine(OtBu-OH, Fmoc-Threonine(OtBu)-OH,
Fmoc-Valine-OH, Fmoc-Tryptophan(NinBoc)-OH,
Fmoc-Tyrosine(OtBu)-OH, Fmoc-Cyclohexylalanine-OH, and
Fmoc-Norleucine , Fmoc -0-benzyl-phosphotyrosine were used
as protected amino acids. Any corresponding D-amino acids
had the same side-chain protecting groups, with the
exception of Fmoc-D-Arginine, which had a
Ng-2,2,5,7,8-pentamethylchroman-6-sulfonyl protecting
group.
Peptides with C-terminal amides were synthesized on solid
phase using Rink amide-MBHA resin. The Fmoc group of the
Rink Amide MBHA resin was removed by treatment with 30 0
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-231-
piperidine in DMF for 5 and 30 minutes respectively.
After washing with DMF (3 times), methanol (2 times) and
DMF/NMP (3 times), the appropriate Fmoc-protected amino
acid (4 eq.) was coupled for 2 hours with HBTU or HATU
(4eq.) as the activating agent and DIEA (8eq.) as the
base. In manual syntheses, the ninhydrin test was used to
test for complete coupling of the amino acids. The Fmoc
groups were removed by treatment with 30o piperidine in
DMF for 5 and 30 minutes respectively. After washing with
DMF (3 times), methanol (2 times) and DMF/NMP (3 times),
the next Fmoc-protected amino acid (4 eq.) was coupled for
2 hours with HBTU or HATU (4eq.) as the activating agent
and DIEA (8eq.) as the base. This process of coupling and
deprotection of the Fmoc group was continued until the
desired peptide was assembled on the resin. The N-terminal
Fmoc group was removed by treatment with 30o piperidine in
DMF for 5 and 30 minutes respectively. After washing with
DMF (3 times), methanol (2 times), the resins) was vacuum
dried for 2 hours. Cleavage of the peptide-on-resin and
removal of the side chain protecting groups was achieved
by treating with TFA . ethanedithiol . thioanisole:
m-cresol . water . triisopropylsilane . phenol,
78/5/3/3/3/5/3 (5 mL per 100 mg resin) for 2.5-3 hours.
The cleavage cocktail containing the peptide was filtered
into a round bottom flask and the volatile liquids were
removed by rotary evaporation at 30-40 °C. The. peptides
were precipitated with anhydrous ether, collected on a
medium-pore sintered glass funnel by vacuum filtration,
washed with ether and vacuum dried.
Peptides with C-terminal acids were synthesized using
2-ehlorotrityl chloride resin. The first amino acid was
attached to the resin by dissolving 0.6-l.2eq. of the
appropriate Fmoc-protected amino acid described above in
dichloromethane (a minimal amount of DMF was added to
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-232-
facilitate the dissolution, if necessary). To this was
added DIEA (4 eq. Relative to the Fmoc-amino acid) and the
solution was added to the resin and shaken for 30-120
minutes. The solvents and the excess reagents were
drained and the resin was washed with dichloromethane /
methanol / DIEA (17/2/1). (3 times), dichloromethane (3
times), DMF (2 times), dichloromethane (2 times), and
vacuum dried. The process of deprotection of the Fmoc
group and coupling the appropriate Fmoc-protected amino
acid was continued as described above, until the desired,
fully protected peptide was assembled on the resin. .The
process for removal of the final Fmoc group and the
cleavage and deprotection of the peptides was the same as
described above for the peptides with C-terminal amides.
Purification of the peptides was achieved by preparative
high performance column chromatography (HPLC), using a
reverse-phase C-18 column (25 x 250mm) (Primesphere or
Vydac) with a gradient of.acetonitrile (0.1o TFA) in water
(0.1o TFA). The general gradient was from 100-90%
acetonitrile in water over 40 minutes. The fractions
corresponding to each peak on the HPLC trace was
collected, freeze dried and analyzed by electrospray mass
spectrometery. The fraction having the correct mass
spectral data corresponding to the desired peptide was
then further analyzed by amino acid analysis, if
necessary. All purified peptides were tested for
homogeneity by analytical HPLC using conditions similar to
that described above, but by using a 2.5x250 mm analytical
column, and generally were found to have >95o purity.
References:
See our published dihydropyrimidinone and oxazolidinone
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-233-
patents as references for the synthesis of the templates
and the piperidines.
Also, for the synthesis of the aminopropyl piperidines and
the templates, see:
Lagu, Bharat, et al., Design and synthesis of novel ala
adrenoceptor-selective antagonists. 3. Approaches to
eliminate opioid agonist metabolites by using substituted
phenylpiperazine side chains. J. Med. Chem. (1999),
42(23), 4794-4803. CODEN: JMCMAR ISSN:0022-2623. CAN
132:78527 AN 1999:680975 CAPLUS
Dhar, T. G. Murali, et al., Design and Synthesis of Novel
a,,: Adrenoceptor-Selective Antagonists. 2. Approaches To
Eliminate Opioid Agonist Metabolites via Modification of
Linker and 4-Methoxycarbonyl-4-phenylpiperidine Moiety.
J. Med. Chem. (1999), 42(23), 4778-4793. CODEN:
JMCMAR ISSN:0022-2623. CAN 132:18483 AN 1999:680971
CAPLUS
Nagarathnam, Dhanapalan, et al., Design and Synthesis of
Novel ocla Adrenoceptor-Selective Antagonists. 1.
Structure-Activity Relationship in Dihydropyrimidinones.
J. Med. Chem. (1999), 42(23), 4764-4777. CODEN:
JMCMAR ISSN:0022-2623. CAN 132:18482 AN 1999:680967
CAPLUS
along, Wai C., et al., Design and Synthesis of Novel a,la
Adrenoceptor-Selective Antagonists. 4. Structure-Activity
Relationship in the Dihydropyrimidine Series. J. Med.
Chem. (1999), 42(23), 4804-4813. CODEN: JMCMAR
ISSN:0022-2623. CAN 132:30317 AN 1999:680947 CAPLUS
Marzabadi, Mohammad R., et al., Design and synthesis of
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-234-
novel dihydropyridine alpha-1A antagonists. Bioorg.
Med. Chem. Lett. (1999), 9(19), 2843-2848. CODEN:
BMCLE8 ISSN:0960-894X. CAN 132:44482 AN 1999:662323
CAPLUS
Wong, Wai C., et al., Alpha-1a adrenoceptor selective
antagonists as novel agents for treating benign prostatic
hyperplasia. Book of Abstracts, 217th ACS National
Meeting, Anaheim, Calif., March 21-25 (1999),
MEDI-156. CODEN: 67GHA6 AN 1999:92669 CAPLUS
Nagarathnam, D., et al., Design, synthesis and evaluation
of dihydropyrimidinones as alpha-1a selective antagonists:
7. Modification of the piperidine moiety into
4-aminocyclohexane; identification and structure-activity
relationship of SNAP 6991 analogs. Book of Abstracts,
217th ACS National Meeting, Anaheim, Calif., March 21-25
(1999), MEDI-110. CODEN: 67GHA6 AN 1999:92024
CAPLUS
Lagu, Bharat, et al., Heterocyclic substituted
oxazolidinones for use as selective antagonists for human
a 1A receptors. PCT Int. Appl. (1998), 258 pp.
CODEN: PIXXD2 WO 9857940 Al 19981223 CAN 130:81508
AN 1999:9823 CAPLUS
Wong, Wai C., et al., Preparation of
piperidinylpropylaminocarbonyldihydropyrimidones and
related compounds as selective adrenergic a 1A receptor
antagonists. PCT Int. Appl. (1998), 314 pp.
CODEN: PIXXD2 WO 9851311 A2 19981119 CAN 130:25077
AN 1998:764290 CAPLUS
Nagarathnam, Dhanapalan, et al., Design and synthesis of
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-235-
novel ala adrenoceptor-selective dihydropyridine antagonists
for the treatment of benign prostatic hyperplasia. J.
Med. Chem. (1998), 41(26), 5320-5333. CODEN: JMCMAR
ISSN:0022-2623. CAN 130:110137 AN 1998:742998 CAPLUS
For the general procedure for Pd coupling of vinyl
triflate and bononic acids or tributyl tin reagents: See,
Wuston, Wise Synthesis 1991, 993)
(For Typical References, See:Schroeter, G. Ber. (1909)
42, 3356; and Allen, C.F.H.; Bell, A. Org. Syn. Coll. Vol.
3, (1955) 846) .
For the preparation of the ether N-[4-(benzo-4',5'[H]
furanpiperidine refer to W.E.Parham et al, J. Org. Chem.
(1976) 41, 2268.
For the preparation of the ether piperidine precursor of
Example 20, refer to W.E.Parham et al, J. Org. Chem.
' (1976) 41, 2268.
For the preparation of the indane piperidine precursor of
Example 21, refer to M.S.Chambers J. Med. Chem. (1992) 35,
2033.
For the preparation of the piperidine precursor of Example
23, (K.Hashigaki et al. Chem.Pharm.Bull. (1984) 32,
3568.)
For the preparation of the piperidine precursor of Example
32, spiro[1H-indane-1,4'-piperidine], refer to
M.S.Chambers et al. J. Med. Chem. (1992) 35, 2033.)
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-236
L
z_
zZ
a \ ~ o
w x
2s E-' o ~--o
a
p \ O
Gr U
Z-m U
Z m ~ Z
c
p m I
tA
H
U U
m
H = n~. m
U
N Q Z
p C E. O / i
o ~ ~ ~ o > cc
m.~ Z-CO \ Z fL
c~.~ a~n ! \'-~ ~o
~.o Z m \ ~ O
m~ z
..
O ~, z
ri O -~~ _ I
m 2v1 ~ x Z n
a.
z
U
~ U ~ Q.'
O~Z-m
/ \ I O
J
D=
d
_z Z
O m H-
C
m
U
Z O~Z-m
/J1
c
m
~ ~ U
n
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-237
N
Z
47
O
U
O Z
Q
N
z
U
S \
Z
O
U
O
U U
p U
N
Z =
Q ~ ~ CV
a
w
0
~ U X/
X/ Z
Cz~
.. .. C C
0
r
z
z
Xr
CZ~
C ~ cV
x a
.m N U Z a
U Z a x ' a~
m o U o ~ ~
oY ~ E~N z
O CL ~~ T
V of Y l~ ~ c' ~ X
._ ._ . :.
cc Z
Z
CX~ ~X~ z.
:.1
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-238
m
N
O U
O
a
0 0
m
I
m /
H
W
W
O
Lt,
E
00 .
m
V o
-o .o
x ~ I
z
~ U
M
Z
Z
U
I 1
z /
I
m
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-239
v
O Z ~Z
o~ o
/ \
N N
N
ac a~ cr ac o r~ ac ccZ
b,,
...,
A
U Z=
O~ O
Z
-J
~fLS N ~c~ O N
°
W Z Z
O O c
_ ~ °~ °_
Z
.. d; ~ \ z~ ~ ~ z=
m _~_ _~_~ N
x
Z
o~
Z=
~o
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-240-
Z
Z
Z-s(
~Z=
O
c~ ~ z ~ O o~
Z=
O 'N
fp
0
O O
O
A ~ ~ Z
z
N
U
U
T
r
....
W
Z x o
O z w .~
N
-O ~ OO.~
N ~,,, O~ O ~ ~ O
O ~ z ~ ~~z aN
0 I ~rI \
O p Wr ~ x
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-241
Z ~ O
O~ O Z
b
_ °',~ \ z~ . / \
_ _
b o~~ O
0
O~ O
b
o ~ \ z
a
o O ,a~
.r.,
O
a~
m
. N
~° O ~ ~ w°
Z ~ ~ o
N N 0
.Q ~ U
U
O ~ ~ ~'~ v
O~ O ~ ~ 0 0
0
Z-~ .= t5
Z ~ ~ ~ ~ a
~s i ~ a
O ~ + '~
'i . -,,.~ -,.~ J
O
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-242
a
i /~\
/\
.: __
N
U U
_ ~ _ ~-Z
o J
111 ~ N
U
U
'.
c
C
,d O
-O
/\ /
m \~ ,c
o ~ - ~~ z
N
'~' ~ C
.,.~ U ~,.,
U
J
a
m
L
U U
. . " ~ ,..
I '
m
c J m_ c
O = _ O
/ \~ / \
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-243
N
=,U
Z
\ \
/ /
Z Z
Z ' Z O
_' I \ \
m
/ /
ri
Z O
Z
N - ~ \
y,a Z . / Z
O Z
Z
1
U
O
m
Z
Z
I
U
O
m
N
V /
Z
y~ = z o
z
1
U
O
m
Z
Z N
1
U
O
m
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-244
O
Z
Z=
C
_
Z
O
..
Z
O
,~-I ..,
.
. U
LL _
Z x
O
U
m
'r1 4)
m
'O
II
f~ O
.., r"~
I Ca
m
v 0
-i
UI O u
c~
N Z r0
N
U
I , it
Z
c~ ~ ~
O O
O O
Z
O
Z = ~ r-1
O ro ~
~ c x
~
z"~
~
O z
~ ~
a
.
O ~
o
~
.
. .r., .r.,
~
-~ -~ -~ -~
>
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-245
:>
'> O
.>
m >
Z
O
uN Z
Z2
Z
O N
O
C
N
z ~/
-' o
.a . . z~
-~.i o z
o~ o
~ z
N
O
N
N
N
. _ '~ V E ,~
N O U
_._ ~ U y
11 = v U
L
O z N U7
a ro ?~
Z
_ z= w
s~ w
U
O ro
~ ai
O ~ E N m
Z _ f~ ~ E
r, O C S-a
.. p ~ ro W N
O v
. . ,~ Z ~ -E O y x
3 U
4) - U N
N
v S~ >, s'r ~ p p
CJ O C y ?~ O v
Z ~, u~ ,~ G N ri ~ Z
O~ O ~ ~ O x a ~ Z ~
C + z 'O ~ ~ ~ ~ C Z ~j
-'i L ~.i ..~ .J ~..1
n, z
O z= ~ ~ z ~ z a '°
O ~ a . ~ ~ z . ;~u
O . .a
..i ..., K
o O -., -a -a -.~ » > > -.~ x
m'
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-246
~O ~O
Z Z
\ / ~ \ /
O
ri
~d
Z z
b
m
~d
Z ~ Z
E1
O Z
/ Z ~ O u' \ / Z
O LO z O~O
b O l ~ O \
° 1 r
=J 4
x
w
~o z ~o
o z z Z
\/ + \/
x _
N
Z Z Z
Z O Z
u- O~ O ~ O~ O ti O~ O
m - Z-~ _... Z--~ _ Z-.(C
" \ / Z ~- \ / Z u' \ /
O~O O~O O~-O
O
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-247
~O a
s
= Z a~
U
..C
N
c0
N
C
N
O
~C
~, _ ' U
/ \ z ~z / \ ~ coo
Z2
O
O
_ _ N z~ ~ o
/ \ ~z
o
g
O o z a~
'° ~ »-'''. o °
o
c0 s
X O U N
~ O Q ~ .C
'O ~ C~ O c!W'
I \ o a .c U c
o c
/ N ~' ~' ~ Z .n.
c O Z .c
'o z ~ E- a~ ~ ai 'Q
_ O ~ E ~ i~ y
E E
Q \ / o
s ~ .c o Q
z z / \ ~ Q ~ 0 0
0 0
O >. _° '~ s o
D Q~ (n C ~C .O_ U ,C
O n p- T
C
/ \
~ Q
'C ?, ~ O O
Z I o -c ~ .~ c~
C E O O C ;r
(n '~ z O O d ~ ~ fl. Z
CV z ~ c~ .D (~ U -O
N Z
N
t
U
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-248
~.
0
N 'b
O CC
Z Z j,
o O~ O
z-~ o
i o~ ~ a' z = o
a' z = '°
0
w o - m'
U
:b ~ o
U
H
cz. N ~O
i
N z O
Z fx ,
U i
w 0
o N U
L~
Q z=
c
O~ O ~ ,
O O x
,z
_M
O O ~ '
a~ U z ,
.n x
U '
N
4w
II
L
Q
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-249
Scheme 14: Synthesis of Substituted Dihyropyrimidinones and Reverse
DihydropyrimidinoneS
N02 ~ N02
reagent 1
N
BOC ~ NH2
F 1. base, p-nitrophenyl- F
F chloroformate I F
2. reagent 1
3. H2, Pd/C
O 4. acylate or O O
~O NH sulfonylate ~O N~N~N
H H
O H O O H O I j N.
i i
From chiral
chromatography
F F
~ F 1. LiOH, heat F
2. EDC, reagent 1
O 3. H2, Pd/C O
~O NH 4. acylate or HN . NON H
sulfonylate ,~ ~ H N, ,l
N O O N I ~ X
i0 H H O~ ~~~ O
From chiral
chromatography
EDC = ethyl dimethylaminopropyl carbodiimide hydrochloride
X = C, S(=O)
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-250-
Table 1
Rb (aM)
EXAl~LE No. STRUCTURE
hMCHl
F
F
\I
1 t') O ~ 4 2
~O I N NON
N~O ~ I N II
,O \ O
F
\ F
I
2 O ~ 18
~O I N NON
i0 N~O / I \ N II
O
F
\ F
O ( ~ OII
~O I N~N~~N / ~ 201
N_ 'O
O
~O O
F
F
\I
4 O ~ 187
O I N NON
N_ 'O O
I
N \
O ~ 258
\ N O
I/
N-O
~ ,N
I~
6 O O 92
N~N , I N
/~N
N O
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-251-
EX,AI~LE No . STRUCTURE
~cxl
F
F
O ~ I OII
~O I N~N~N . O 41
N_ 'O v _N'
N-
N-O
~ ,N
I /
8 O ~ 88
~O I ~ NON
N O
F
/ F
O ~ I O
9 ~ 35
~O I N NON
N~O / I Ow
~O
F
/ F
O \ I O
(+) \ ~ 0.3
O I N NON
~N~O / I N "
i0 ~ O
F
F
I
11 O
331
\O I ~ NON
N O
CA 02384358 2002-03-05
WO 02/02744 -252- PCT/USO1/21350
Kb (aM)
EXA1~LE No . ST~~T~ hMCHl
- F
F \ F
O I ~ O
12 ~ 29
I N NON
N~O I \
F
,,,.
13 \ I O N' v . N ( ~ N 284
\ I
F
F
\ I
14 O ~ 2
~O I N NON
N'~o
,O \
F
F
I
O \ OII
15 ~O N~N~N 289
N ~O ~ F
O \ I
_I
F
F
I
o ~ o
16 ~ 329
\O I ~ N~N . :
N O O N /
,O
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-253-
s~vc~ ~ tnrs)
hrscxi
F
F
O I / O
17 II 373
~O I N~N~N
~N~O /
i0 N
N-O
N
i
I
18 O / OII 1
~O I N~N~N
NI '_O O
F
/ F
O \ ( O
19 ~ 7
~0 I N NON
N~O / I
~O
F
F
~ F
I /
20 O ~ 5
O I ~ NON
N O O
N-O
~ ,N .
I
21 O / OIf 2g
~O I N~N~N
N~O
F
/ F
I
22 O ~ 40
N I ~ NON
N O O
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-254-
~ac~r~~ rto . s~~cwx~ ~' ( ars )
hrscAl
_ N_O
N
O I ~ O
23 I' 68
~O I ~N~N~N \
N ~0
O
F
\ F
24 O ~ O
II 102
~O I N~N~N
N_ 'O
O
O
25 ~S~ \ I \ 126
N
S
F
26 N V 260
~J
F
O
27 / N ~ - / ~ / O 279
~N ~ ~ N
O N O
28 \ N~ ~ 60
CI I / \ I
O O
29 ~ \ N ' / CI
CI
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-255-
~XAMPI~~ No. STAUCTUR~
hMC81
O
F ~ ~ O
N~
3 0 N~_~J 4 7 9
N
O,
N+ O_ .
31 ~ N= N
7
S-N
O
F
F
I
32 O ~ OII 67
~O I N~N~N
_N- 'O
F
F
( O
33 ~O I N~N~N 12
~N~O , I F
~O
F
F
F
F
O ~ I O
34 I' 182
O N~N~N~ O:N*.O'
I N~p ow''~ IN
~I
F
F
I O
35 276
~O I N~N~N
N_ 'O ~N
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-256-
EXAMPLE No. STRUCTURE
hMCHl
F
F
36 O ~ 406
~O I N NON
N- '-O
,O
37 -\ 162
O \ S
N
O' _N- _N- 'O
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-257-
General Methods. . All reactions (except for those done
by parallel synthesis reaction arrays) were performed
under an Argon atmosphere and the reagents, neat or in
appropriate solvents, were transferred to the reaction
vessel via syringe and cannula techniques. The parallel
synthesis reaction arrays were performed in vials
(without an inert atmosphere) using J-KEM heating
shakers (Saint Louis, MO). Anhydrous solvents were
purchased from Aldrich Chemical Company and used as
received. The examples described in the patent were
'named using ACD/Name program (version 2.51, Advanced
Chemistry Development Inc., Toronto, Ontario, M5H2L3,
Canada). Unless otherwise noted, the 1H spectra were
recorded at 300 and 400 MHz (QE Plus and Briiker
respectively) with tetramethylsilane as internal
standard. s = singlet; d = doublet; t = triplet; q =
quartet; p = pentet; sext; sept; br = broad; m =
multiplet. Elemental analyses were performed by
Robertson Microlit Laboratories, Inc. Unless otherwise
noted, mass spectra were obtained using low-resolution
electrospray (ESMS) and MH+ is reported. Thin-layer
chromatography (TLC) was carried out on glass plates
precoated with silica gel 60 FZSn (0.25 mm, EM
Separations Tech.). Preparative thin-layer
chromatography was carried out on glass sheets precoated
with silica gel GF (2 mm, Analtech). Flash column'
chromatography was performed on Merck silica gel 60 (230
- 400 mesh). Melting points (mp) were determined in
open capillary tubes on a Mel-Temp apparatus and are
uncorrected.
Piperidine Side Chain Intermediates
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-258-
TERT-BUTYL 4-([(TRIFLUOROMETHYL)SULFONYL]OXY}-1,2,3,6-
TETRAHYDRO-1-PYRIDINECARBOXYLATE:
n-Butyl lithium (17.6 mL, 44.2 mmol, 2.5 M in hexanes)
was added to a solution of diisopropyl amine (96.2 mL,
44.2 mmol) in 40 mL of dry THF at 0 °C and stirred for 20
minutes. The reaction mixture was cooled to -78 °C and
tert-butyl 4-oxo-1-p.iperidinecarboxylate (Aldrich
Chemical Company, 40.0 mmol) in THF (40 mL) was added
dropwise to the reaction mixture and stirred for 30
minutes. Tf2NPh (42.0 mmol, 15.0 g) in THF (40 mL) was
added dropwise to the reaction mixture and stirred at °C
overnight. The reaction mixture was concentrated in
vacuo, re-dissolved in hexanes:EtOAc (9:1), passed
through a plug of alumina and the alumina plug was
washed with hexanes:EtOAc (9:1). The combined extracts
were concentrated to yield 16.5 g of the desired product
that was contaminated with some starting Tf~NPh.
1H NMR (400 MHz, 400 MHz, CDC13) 8 5.77 (s, 1 H) , 4 .05
(dm, 2 H, J=3. 0 Hz) , 3. 63 (t, 2 H, J=5.7 Hz) , 2. 45 (m, 2
H) , 1.47 (s, 9 H) .
TERT-BUTYL 4-[3-(AMINO)PHENYL]-1,2,3,6-TETRAHYDRO-1-
PYRIDINECARBOXYLATE:
A mixture of 2 M aqueous Na?C03 solution ( 4 . 2 mL ) , tert-
butyl 4-{[(trifluoromethyl)sulfonyl]oxy}-1,2,3,6-
tetrahydro-1-pyridine-carboxylate (0.500 g, 1.51' mmol),
3-aminophenylboronic acid hemisulfate (0.393 g, 2.11
mmol), lithium chloride (0.191 g, 4.50 mmol) and
tetrakis-triphenylphosphine palladium (0) (0.080 g,
0.075 mmol) in dimethoxyethane (5 mL) was heated at
reflux temperature for 3 hours, under an inert
atmosphere (an initial degassing of the mixture is
recommended to prevent the formation of
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-259-
triphenylphosphine oxide). The organic layer of the
cooled reaction mixture was separated and the aqueous
layer was washed with ethyl acetate (3X). The combined
organic extracts were dried and concentrated in vacuo.
The crude product was chromatograghed (silica,
hexanes:EtOAc:dichloromethane (6:1:1) with 1% added
isopropylamine to protect the BOC group from hydrolysis)
to give 0.330 g of the desired product in 81o yield:
1H NMR (400 MHz, CDC13) b 7.12 (t, 1H, J= 7. 60 Hz) , 6.78
(d, 1H, J= 8.4 Hz), 6.69 (t, 1H, J= 2.0 Hz), 6.59 (dd,
1H, J= 2.2, 8.0 Hz), 6.01 (m, 1H), 4.10 - 4.01 (d, 2H,
J= 2.4 Hz),: 3.61 (t, 2H, J= 5.6 Hz), 2.52 - 2.46 (m,
2H), 1.49 (s, 9H); ESMS m/e . 275.2 (M + H)+.
Anal. Calc. for C16Ha4N202: C, 70.04; H, 8.08; N, 10.21.
Found: C, 69.78; H, 7.80; N, 9.92
TERT-BUTYL 4-[3-(AMINO)PHENYL]-1-PIPERIDINECARBOXYLATE
A mixture of 3.10 g of tert-butyl 4-(3-aminophenyl)-
1,2,3,6-tetrahydropyridine-1-carboxylate (11.3 mmol) and
1.0 g of 10o PdIC in 200 mL of ethanol was hydrogenated
at room temperature using the balloon method for 2 days.
The reaction mixture was.filtered and washed with
ethanol. The combined ethanol extracts were
concentrated in vacuo and the residue was
chromatographed on silica (dichloromethane: methanol
95:5 with 1o isopropylamine added to protect the BOC
group from hydrolysis) to give 2.63 g of the desired
product ( 8 4 0 ) .
TERT-BUTYL 4-[3-(ACETYLAMINO)PHENYL]-1,2,3,6-TETRAHYDRO-
1-PYRIDINECARBOXYLATE: A mixture of saturated of
aqueous Na2CO3 solution (25 mL), tert-butyl 4-
{[(trifluoromethyl)sulfonyl]oxy}-1.,2,3,6-tetrahydro-1-
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-260-
pyridine-carboxylate (20~ mmol), 3-acetamidophenylboronic
acid (30 mmol) and tetrakis-triphenylphosphine palladium
(0) (1.15 g) and dimethoxyethane (40 mL) was heated at
reflux temperature overnight. The organic layer of the
cooled reaction mixture was separated and the aqueous
. layer was washed with ethyl acetate (3X). The combined
organic extracts were dried and concentrated in vacuo.
The crude product was chromatograghed, giving the
desired product: 1H NMR (CDC13) 8 8.11 (br s, 1 H) , 7.57
(br s, 1 H) , 7.41 (br d , 1 H, J=7.8 Hz) , 7.25 (apparent
t, 1 H, J=7. 8 Hz) , 7 .08 (br d, 1 H, J=7.8 Hz) , 5. 99 (br
s, 1 H) , 4.03 (br m, 2 H, J=2.7 Hz) , 3.59 (t, 2 H, J=5.7
Hz) , 2.46 (m, 2 H, ) , 2.16 (s, 3 H) , 1.49 (s, 9 H) .
Nl-[3-(1,2,3,6-TETRAHYDRO-4-PYRIDINYL)PHENYL]ACETAMIDE:
A solution of 4 M HC1 in dioxane (10 mL) was added to
tert-butyl 4-[3-(acetylamino)phenyl]-1,2,3,6-tetrahydro-
1-pyridinecarboxylate (8.25 mmol) in dichloromethane (30
mL). The reaction mixture was stirred at room
temperature overnight, concentrated in vacuo, giving the
desired product as the hydrochloride salt (2.1 g): 1H NMR
(CDC13) b 7.41-7.00 (m, 4 H), 6.10 (br, 1 H), 3.55 (m, 2
H) , 3. 16 (t, 2 H, J = 5.7 Hz) , 2.44 (m, 2 H) , 2. 19~ (s, 3
H) .
TERT-BUTYL N-(3-BROMOPROPYL)CARBAMATE: Prepared from 3-
bromopropylamine hydrobromide and BOC~O in the presence
of base in dichloromethane, 9.89 mmol: ~H NMR (CDC13) 8
5. 07 (br, 1 H) , 3.31 (t, 2 H, J=6. 6 Hz) , 3. 12 (apparent
br q, 2 H, J=6. 0 Hz) , 1. 92 (p, 2 H, J=6. 6 Hz) , 1 .30 (s,
9H) .
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-261-
TERT-BUTYL N-(3-{4-[3-(ACETYLAMINO)PHENYL]-1,2,3,6-
TETRAHYDRO-1-PYRIDINYL}PROPYL)CARBAMATE: A solution of
N1-[3-(1,2,3,6-tetrahydro-4-
pyridinyl)phenyl]acetamide.HCi (8.24 mmol), tert-butyl
N-(3-bromopropyl)carbamate and potassium carbonate (33
mmol) in dry dioxane (30 mL) was heated at reflux
temperature overnight. The solids were removed by
filtration, the solution was concentrated in 'racuo and
the product was chromatograghed, giving the desired
product (110 mg).
TERT-BUTYL N-(3-4-[3-(ACETYLAMINO)PHENYL]-1,2,3,6-
TETRAHYDRO-1-PYRIDINYLPROPYL) CARBAMA,TE: 1H NMR (CDC13) 8
7.65 (s, 1 H), 6.98 (s, 1 H), 7.45 (d, 1 H, J=7.8 Hz),
7.16 (apparent t, 1 H, J=7.8 Hz), 7.10 (d, 1 H, J=7.8
Hz) , 6.02 (s, 1 H) , 5.23 (b, 1 H) , 3.40 (b, 2 H) , 3.30-
1.80 (m, 10 H) , 2.18 (s, 3 H) , 1.45 (s, 9 H) .
Nl-{3-[1-(3-AMINOPROPYL)-1,2,3,6-TETRAHYDRO-4-
PYRIDINYL]PHENYL}ACETAMIDE: A 1:1 solution of TFA:CH~C12
(5 mL) was added to tert-butyl N-(3-{4-[3-
(acetylamino)phenyl]-1,2,3,x-tetrahydro-1-
pyridinyl}propel)carbamate in dichloromethane (5 mL).
The resulting solution was stirred at room temperature
for 1-3 days, saturated NaHC03 was added until pH > 6,
the organic layer was separated, and dried in~ vacuo,
giving the desired product (45 mg):
N1-{3-[1-(3-AMINOPROPYL)-1,2,3,6-TETRAHYDRO-4-
PYRIDINYL]PHENYL}ACETAMIDE: From N1-{3-[1-(3-
aminopropyl)-1,2,3,6-tetrahydro-4-
pyridinyl]phenyl}acetamide and acid (TFA or HC1),
followed by basification of the resulting salt: 1H NMR
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-262-
(CDC13) S 7 . 68 (br, 1 7 , 35 (dm,1 H, J=7. 8 7 .
H) , Hz ) , 25
(apparent .t, 1 H, J=7.8 Hz), 7.15 (dm, 1 H, J=7.8Hz),
6.12 (m, 1 H), 3.22 (m, 2 H), 3.03 (t, 2 H, J=7.3 Hz),
2.78 (t, . 2 H, J=5.5 Hz) 2.70-2.50 (m, 4 H) , 2.10(s,
, 3
H) , 1. 87 (p, 2 H, J=7.3 z) .
H
TERT-BUTYL 4-[3-(ACETYLAMINO)PHENYL]-1-
PIPERIDINECARBOXYLATE: ~A mixture tert-butyl 4-[3-
(acetylamino)phenyl]-1,2,3,6-tetrahydro-1-
pyridinecarboxylate (710 mg) and 5o Pd/C (100 mg) in
. EtOH (20 mL) was hydrogenated (balloon technique) at
room temperature overnight, The reaction mixture was
passed through a pad of Celite 545 and the pad of Celite
was washed with ethanol. The combined ethanol extracts
were concentrated and chromatograghed, giving the
desired product (660 mg) : 1H NMR (CDC13) 8 7.80 (s, 1 H) ,
7.41-7.20 (m, 3 H), 6.94 (d, 1 H, J=7.5 Hz), 4.21 (m, 2
H), 2.75 (m, 2 H), 2.62 (m, 1 H), 2.16 (s, 3 H), 1:78
(m, 2 H) , 1.56 (m, 2 H) , 1. 48 (s, 9 H) .
iVl-[3-(4-PIPERIDYL)PHENYL]ACETAMIDE: A solution of HCl
in dioxane (4N, 5 mL) ,was added to tert-butyl 4-[3-
s
(acetylamino)phenyl]-1-piperidinecarboxylate (660 mg)
in dry dichloromethane (15 mL). The reaction mixture
was stirred at room temperature overnight arid
concentrated in vacuo, giving the desired product (550
mg) : mp 102-104 °C; 1H NMR (CDC13) 8 2.02 (d, J=13.2 Hz,
2H), 2.11-2.45 (m, 5H), 2.67-2.77 (m, 1H), 3.00-3.10 (m,
2H), 3.51 (d, J=10.5 Hz, 2H), 6.94 (d, J=7.5 Hz, 1H),
7.20-7.46 (m, 3H), 7.60 (s, 1H); Anal. Calcd. For
C13Hz9N20C1+0.86 CHZC12: C, 50.78; H, 6.37; N, 8.55. Found:
C, 50.80; H, 7.55; N, 7.01.
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-263-
TERT-BUTYL
N-(3-{4-[3-
(ACETYLAMINO)PHENYL]PIPERIDINO}PROPYL)CARBAMATE: A
solution of N1-[.3-(4-piperidyl)phenyl]acetamide (550 mg,
0.210 mmol), tert-butyl N-(3-bromopropyl)carbamate (550
mg, 0.230 mmol) , K2C03 (1.10 g, 0.890 mmol) ,
diisopropylethyl amine (1.50 mL) and a few crystals of
KI in dioxane (20 mL) was heated at reflux temperature
for 2 days. The precipitated salts were removed by
filtration, concentrated in vacuo and the crude product
was chromatographed, giving the desired product (340
mg) : 1H NMR (CDC13) ~ 8.15 (s, 1 H) , 7.47-7.44 (m, 2 H) ,
7.22 (t, 1 oH, J=7.8 Hz), 6.94 (d, 1 H, J=7.8 Hz), 5.53
(b, 1 H) , 3.23 (b, 6 H) , 2.80-1. 60 (m, 9 H) , 2.20 (s, 3
H) , 1. 45 (s, 9 H) .
' N1-{3-[1-(3-AMINOPROPYL)-4-PIPERIDYL]PHENYL}ACETAMIDE:
TFA (1.0 mL) was added to a solution of tert-butyl N-(3-
(4-[3-(acetylamino)phenyl]piperidino}propyl)carbamate
(340 mg) in dry dichloromethane (10 mL) and stirred at
room temperature for 5 h. A 10% aqweous solution of KOH
was added to the reaction mixture until pH > 6 and then
the dichloromethane was .removed in vacuo. The aqueous
layer was frozen and lyophilized to give a solid,' which
was extracted with methanol. Removal of the solvent
gave the desired product (120 mg) as an oil: 1H NMR
(CDC13) 8 7.23-7.16 (apparent t, 1H, J=7.5 Hz), 6.95-6.92
(m, 1H), 3.03-2.99 (m, 2H), 2.77-2.73 (t, 2H, J - 6.6
Hz), 2.50-1.60 (m, 10 H), 2.13 (s, 3 H).
TERT-BUTYL 4-(3-NITROPHENYL)-3,6-DIHYDRO-1(2H)-
PYRIDINECARBOXYLATE
1H NMR (400 MHz, 400 MHz, CDC13) 8 8.23 (s, 1H), 8.11 (d,
1H, J=8.0 Hz), 7.69 (d, 1H, J=8.0 Hz), 7.51 (t, 1H,
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-264-
J=8.0 Hz), 6.20 (m, 1H), 4.17-4.08 (m, 2H), 3.67 (t, 2H,
J=5.6 Hz), 2.61-2.52 (m,~2H), 1.50 (s, 9H); ESMS m/e .
249. 1 (M + H - C4H$) ~.
1,2,3,6-TETRAHYDRO-4-(3-NITROPHENYL)PYRIDINE: Into a
stirred solution of 5.00 g (16.0 mmol) of tent-butyl
1,2,3,6-tetrahydro-4-(3-nitrophenyl)pyridine-1-
carboxylate in 100 ml of 1,4-dioxane at 0°C was bubbled
HC1 gas for 10 minutes. The reaction mixture was
allowed to warm to room temperature and the bubbling of
the HCl gas,was continued for an additional 1 hour. The
solvent was removed in Vacuo, the residue was dissolved
in 50 mL of water and was neutralized by the addition of
KOH pellets. The aqueous solution was extracted with 3
X 80 mL of dichloromethane and the combined organic
extracts were dried (MgSOQ), filtered and concentrated in
vacuo. The residue was purified by column
chromatography (silica, 9 . 1 ,dichloromethane .
methanol + 1o isopropyl amine) to afford 2.85 g (87.50
yield) of the desired product: 1H NMR (400 MHz, 400 MHz,
CDC13) 8 8.24 (s, 1H), 8.09 (d, 1H, J=8.4 Hz), 7.71 (d,
1H, J=8.0 Hz), 7.49 (t, 1H, J=8.0 Hz), 6.35-6.25 (m,
1H), 3.58 (apparent q, 2H, J=3.0 Hz), 3.14 (t, 2H, J=5.6
Hz), 2.54-2.46 (m, 2H).
TERT-BUTYL 3- (4- (3-NITROPHENYL) -3, 6-DIHYDRO-1 (2H) -
PYRIDINYL)PROPYLCARBAMATE:A mixture of 2.80 g (14.0
mmol) of 1,2,3,6-tetrahydro-4-(3-nitrophenyl)pyridine,
3.60 g (15.0 mmol) of tent-butyl N-(3-
bromopropyl) carbamate, 11. 6 g (84.0 mmol) of K2C03, 14 . 6
mL (84.0 mmol) of diisopropylethylamine and 0.78 g (2.00
mmol) of tetrabutylammonium iodide in 250 mL of 1,4-
dioxane was heated at reflux temperature for 14 hours.
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-265-
The reaction mixture was filtered and the filtrate was
dried (MgS04), concentrated in vacuo and the residue was
purified by column chromatography (silica, 9:1,
dichloromethane: methanol + 1o isopropyl amine) to
afford 4.35 g (85.70 yield) of the desired product: 1H
NMR (400 MHz, 400 MHz, CDC13) 8 8.24 (t, 1H, J=1.9 Hz),
8.09 (dd, 1H, J=1.9, 8.0 Hz), 7.70 (apparent d, 1H,
J=8.0 Hz), 7.49 (t, 1H, J=8.0 Hz), 6.23 (m, 1H), 3.29-
3.18 (m, 4H), 2.75 (t, 2H, J=5.6 Hz), 2.64-2.54 (m, 4H),
1.82-1.70 (m, 2H), 1.44 (s, 9H); ESMS m/e . 362.2 (M +
H)+.
3-(4-(3-NITROPHENYL)-3,6-DIHYDRO-1(2H)-PYRIDINYL)-1-
PROPANAMINE: Into a stirred solution of 4.35 (12.0 mmol)
of tart-butyl 3-(4-(3-nitrophenyl)-3,6-dihydro-1(2H)-
pyridinyl)propylcarbamate in 100 ml of 1,4-dioxane at
0°C was bubbled HC1 gas for 10 minutes. The reaction
mixture was allowed to warm to room temperature and the
bubbling was continued for an additional 1 hour. The
solvent was removed in vacuo, the residue was dissolved
in 50 mL of water and was neutralized by the addition of
KOH pellets. The aqueous solution was extracted with 3
X 80 mL of dichloromethane, the combined organic
extracts were dried (MgSOq), filtered and concentrated in
~ vacuo. The residue was purified by column
chromatography (silica, 9 . 1 ,dichloromethane
methanol + 1o isopropyl amine) to afford 3.05 g (97.0o
yield) of the desired product: 1H NMR (400 MHz, 400 MHz,
CDC13) 8 8.24 (t, 1H, J=1.8 Hz), 8.09 (dd, 1H, J=1.8, 8.2
Hz), 7.69 (dd, 1H, J=1.8, 8.2 Hz), 7.48 (t, 1H, J=8.2
Hz) , 6.24 (m, 1H) , 3.21 (d, 2H, J=3. 6 Hz) , 2.84 (t, 2H,
J=6.6 Hz), 2.75 (t, 2H, J=5.8 Hz), 2.64-2.54 (m, 4H),
1.76 (m, 2H); ESMS m/e . 262.2 (M + H)~; Anal. Calc.
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-2 6 6-
for C14H19N302 (0.06 CHC13) : C, 62.90; H, 7.16; N, 15.65.
Found: C, 63.20; H, 7.16; N, 15.65.
METHYL (4S)-3-[((3-[4-(3-AMINOPHENYL)-1-
PIPERIDINYI~] PROPYL}AMINO) CARBONYL] -4- (3, 4-
DIFLUOROPHENYL)-6-(METHOXYMETHYL)-2-OXO-1,2,3,4-
TETRAHYDRO-5-PYRIMIDINECARBOXYLATE: A mixture of 3.02 g
(6.33 mmol) 5-methyl 1-(4-nitrophenyl) (6S)-6-(3,4-
difluorophenyl)-4-(methoxymethyl)-2-oxo-3,6-dihydro-
1,5(2H)-pyrimidinedicarboxylate, 1.50 g (5.80 mmol) of
3-(4-(3-nitrophenyl)-3,6-dihydro-1(2H)-pyridinyl)-1-
. propanamine, 7.94 g (75.5 mmol) of KZC03 and 1.00 mL of
methanol in°200 mL dichloromethane (under argon) was
stirred at room temperature for 1 hour. The reaction
mixture was filtered and concentrated in vacuo. The
residue was dissolved in 100 mL of ethyl acetate and
washed 3 X 50 mL of 5o aqueous NaOH solution, the
organic layer was dried (MgS04) and concentrated in
vacuo. The residue was dissolved in 100 mL of anhydrous
ethanol containing 0.50 g ~Oo Pd/C and the reaction
mixture was stirred under a hydrogen balloon for 24
hours. The reaction mixture was passed through a column
of Celite 545 filtering agent, washed with ethanol, the
filtrate was dried (MgS04) and concentrated in vacuo.
The residue was purified by column chromatography
(silica, 9.5 . 0.5 ,dichloromethane . methanol + 1o
isopropyl amine) to afford 1.65 g (52.0o yield) of the
desired product.
TERT-BUTYL 4-[3-(ISOBUTYRYLAMINO)PHENYL]-3,6-DIHYDRO-
1(2H)-PYRIDINECARBOXYLATE: Into a solution of 4.00 g
(16.0 mmol) of tert-butyl 4-(3-aminophenyl)-3,6-dihydro-
1(2H)-pyridinecarboxylate and 5.60 mL (32.0 mmol) of
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-267-
diisopropylethylamine in 100 mL.dichloromethane was
slowly added 1.90 mL (19.0 mmol) of isobutyryl chloride.
The reaction mixture was stirred at room temperature for
2 hours, washed with water, dried (MgS04), and
concentrated in vacuo. The residue was purified by
column chromatography (silica, 50 . 46 . 3 . 1, hexanes
. dichloromethane . methanol , isopropyl amine) to
afford 2.90 g (52.0o yield) of the desired product: 1H
NMR (400 MHz, CDC13) 8 7.69 (s, 1 H), 7.34 (d, 1 H, J=7.8
Hz), 7.27 (t, 1H, J=7.8 Hz), 7.11 (d, 1H, J=7.8 Hz),
6.04 (s, 1H), 4.05 (s, 2H), 3.62 (apparent t, 2 H, J=4.9
Hz) , 2 .51 (m, 3H) , 1. 49 (s, 9H) , 1.25 (d, 6H, J=7. 4 Hz) ;
ESMS m/e: 345.5 (M + H)+. Anal. Calc. for
CzoH~$N203+0 . 17 5 CHC13 : C, 6 6 . 3 3 ; H, 7 . 7 7 ; N, 7 . 67 . Found
C, 66.20; H, 7.41; N, 7.88
TERT-BUTYL 4- [3- (ISOBUTYRYLAMINO) PHENYL] -1-
PIPERIDINECARBOXYLATE: A mixture of 2.90 g (8.40 mmol)
of tert-butyl 4-[3-(isobutyrylamino)phenyl]-3,6-dihydro-
1(2H)-pyridinecarboxylate and 0.80 g of 10o yield Pd/C
in 100 mL of ethanol was stirred under a hydrogen
balloon for 24 hours. The reaction mixture was passed
through a column of Celite 545 filtering agent, the
filtrate was dried (MgS04) and concentrated in vacuc.
The residue was purified by column chromatography
(silica, 9.5 . 0.5 ,dichloromethane . methanol + 10
isopropyl amine) to afford 2.40 g (84.0o yield) of the
desired product: 1H NMR (400 MHz, 400 MHz, CDC13) b 7.49-
7 . 44 (m, 2H) , 7.24 (t, 1H, J=7. 6 Hz) , 6. 93 (d, 1H, J=7 . 6
Hz), 4.20-4.10 (m, 2H), 2.86-2.45 (m, 4H), 1.86-1.75 (m,
4H) , 1.48 (s, 9H) , 1.24 (d, 6H, J=6.8 Hz) ; ESMS m/e
345.2 (M + H)+; Anal. Calc. for C2oH3oN203+0.3H20: C,
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-268-
68.27; H, 8.77; N, 7.96. Found:,C, 68.25; H, 8.54; N,
7.84.
2-METHYL-N-[3-(4-PIPERIDINYL)PHENYL]PROPANAMIDE: Into a
stirred solution of 2.20 (6.50 mmol) of tert-butyl 4-[3-
(isobutyrylamino)phenyl]-1-piperidinecarboxylate in 100
ml of 1,4-dioxane at 0 °C was bubbled HCl gas for 10
minutes. The reaction mixture was allowed to warm to
room temperature and the bubbling of the HCl gas was
continued for 1 hour. The solvent was removed in vacuo,
the residue was dissolved in 50 mL of water and was
neutralized by the addition of KOH pellets. The aqueous
solution was extracted with 3 X 80 mL of
dichloromethane, the combined organic extracts were
dried (MgS04), filtered and concentrated in vacuo. The
residue was purified by column chromatography (silica, 9
. 1 ,dichloromethane . methanol + 1o isopropyl amine) to
afford 0.700 g (46.0o yield) of the desired product: 1H
.. NMR (400 MHz, 400 MHz, CDC13) 8 7.47 (s, 1H) ,. 7.40 (d,
1H, J=7.8 Hz), 7.24 (t, 1H, J=7.8 Hz), 7.00 (d, 1H,
J=7.8 Hz), 3.23-3.14 (m, 5H), 2.82-2.57 (m, 4H), 1.20
(d, 6H, J=6.8 Hz); ESMS m/e . 247.2 (M + H)+;
The hydrochloride salt was used for the combustion
analysis: Anal. Calc. for C15HZ~N20+HCl+0.15 CHC13: C,
60.51; H, 7.76; N, 9.32. Found: C, 60.57; H, 7.83; N,
8.88.
3-(4-PIPERIDINYL)ANILINE: 1H NMR (400 MHz, 400 MHz,
CDC13) 8 7.01 (t, 1H, J=7..6 Hz), 6.62-6.54 (m, 3H), 3.16
(br d, 2H, J=10.3 Hz), 2.75 (dt, 2H, J=2.7, 12.3 Hz),
2.56 (tt, 1H, J=3.6, 12.3 Hz), 1.81 (br d, 2H, J=12.3
Hz), 1.65 (dq, 2H, J=4.0, 12.3 Hz); ESMS m/e . 177.2 (M
+ H) +.
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-269-
TERT-BUTYL 4- (4-NITROPHENYI~) -3, 6-DIHYDRO-1 (2H) -
PYRIDINECARBOXYhATE: To a 25-mL RB flask, equipped with
a condensor, was added tert-butyl 4-
{[(trifluoromethyl)sulfonyl]oxy}-3,6-dihydro-1(2H)-
pyridinecarboxylate (1.0 g), 4-nitrophenylboronic acid
(0.71 g), sodium carbonate (0.430 mL of 2M solution),
lithium chloride (0.382 g),
tetrakis(triphenylphosphine)- palladium (0) (0.173 g)
l0 and ethylene glycol dimethyl ether (10 mL). The
reaction mixture was flushed with Argon three times,
then the reaction mixture was heated to 100 °C for 3 hrs.
After cooling to room temperature, the reaction mixture
was diluted with methylene chloride (30 mL) and water
(30 mL) and the organic layer was separated. The
aqueous layer was extracted with methylene chloride
(3x20 mL) and the combined organic extracts were washed
with sat NH4C1 (20 mL) and brine (20 mL), dried over
MgS04 and concentrated under reduced pressure. The
residue was purified by chromatography (6:1=hexane: ethyl
acetate with 1% NH3) to afford the product (0.55 g,
59.9%) as a yellow oil. The compound is not stable at
room temperature and should be used as prompt as
practical: 1H NMR (400 MHz, 400 MHz, CDC13) 8 8.20 (d,
2H, J=8.6 Hz), 7.51 (d, 2H, J=8.6 Hz), 6.24 (m, 1H),
4.13 (m, 2H), 3.67 (apparent t, 2H, J=5.5 Hz), 2.55 (m,
2H) , 1.49 (s, 9H) .
4-(4-NITROPHENYI~)-1,2,3,6-TETRAHYDROPYRIDINE:
4-(4-Nitrophenyl)-1,2,3,6-tetrahydropyridine was
prepared by a similar procedure to that used for the
preparation of 2-methyl-N-[3-(4-
piperidinyl)phenyl]propanamide using HC1 gas and tert-
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-270-
Butyl 4-(4-Nitrophenyl)-3,6-dihydro-1(2H)-
pyridinecarboxylate (l30 mg) in dioxane (5.0 mL) at room
temperature. The reaction mixture was concentrated in
vacuo to give the crude product (69.8 mg) that used in
the next reaction without further purification.
Oxazolidinone Intermediates:
AMINO-(3,5-DIFLUOROPHENYL)-ACETONITRILE.
Through a solution of 3,5-difluorobenzaldehyde (25.0 g,
0.176~mo1) in MeOH (500 mL) in a round bottom flask, was
bubbled ammonia gas for two hours at room temperature.
The flask was then cooled to 0 °C and trimethylsilyl
cyanide was then added slowly. The reaction mixture was
stirred for 2 h, at which time TLC analysis indicated
that the reaction was complete (Rf = 0.35, 3:2
hexane/EtOAc). The solvent was removed in vacuo and the
residue was subjected to flash column chromatography on
silica gel to obtain the desired product.
AMINO-(3,5-DIFLUOROPHENYL)-ACETIC ACID METHYL ESTER.
Into a well-stirred solution of amino-(3,5-
difluorophenyl)-acetonitrile (22.0 g, 0.130 mol), a
solution of HCl in MeOH (200 mL) was added at room
temperature. The resulting yellow solution was stirred
at room temperature for 10 h and was heated at reflux
temperature for 1.5 h. After cooling, the solvent was
removed in vacuo and the resulting yellow solid was
dissolved in water (200 mL). The aqueous solution was
then carefully basified with 20o NaOH solution to pH 9.
The aqueous layer was extracted with CHZC12 (3 x 100 mL).
The organic layer was separated and dried over Na2S04,
filtered and the solvent was removed in vacuo to obtain
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-271-
the desired product which was used in the next step
without purification.
2-AMINO-2-(3,5-DIFLUOROPHENYL)-ETHANOL.
Into a well-stirred suspension of LiAlH4 (4.7 g, 0.125
mol) in THF (120 mL) in a 3-necked round bottom flask
fitted with a condenser and a dropping funnel, was added
a solution of amino-(3,5-difluorophenyl)-acetic acid
methyl ester (10.0 g, 0.05 mol) in THF (100 mL) dropwise
at 0 °C. The resulting greenish brown suspension was
heated at reflux temperature for 2 h. The reaction
mixture was cooled to 0 °C and then carefully quenched
sequentially with 5 mL of water, 5 mL of 3N NaOH
followed by 15 mL of water. The resulting suspension
was filtered through a fritted glass funnel. To the
filter cake was added 100 mL Et~O and the suspension was
heated at reflux temperature for 20 min. The suspension
was filtered and the combined filtrates were dried over
MgS09, filtered and the solvent was removed in vacuo. 2-
Amino-2-(3,5-difluorophenyl)-ethanol was obtained as a
yellow glassy syrup which was used in the next step
without further purification.
[1-(3,4-DIFLUOROPHENYL)-2-HYDROXY-ETHYL]-CARBAMIC ACID-
TERT-BUTYL ESTER.
Into a solution of 2-amino-2-(3,4-difluorophenyl)-
ethanol (8.6 g, 49.7 mmol) in CHC13 (150 mL) at 0 °C was
added a solution of di-tert-butyl dicarbonate (11.4 g,
52.0 mmol) in CHC13 (50 mL) in one portion and the
resulting solution was stirred overnight at room
temperature. The solvent was removed in vacuo and the
residue was subjected to column chromatography on silica
gel (2:1 hexane-EtOAc followed by EtOAc) to obtain [1-
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-272-
(3,4-difluorophenyl)-2-hydroxy-ethyl]-carbamic acid-
tert-butyl ester as a white solid (10.0 g, 74o yield).
(+)-4-(3,4-DIFLUOROPHENYL)-OXAZOLIDIN-2-ONE.
Into a well-stirred suspension of NaH (1.1 g, 45.8 mmo1)
in THF (40 mL) at R.T. was added a solution of [1-(3,4-
difluorophenyl)-2-hydroxy-ethyl]-carbamic acid-tert-
butyl ester (5.0 g, 18.3 mmol) in THF (20 mL) via a
dropping funnel at room temperature. The resulting
suspension was stirred for 3 h and then quenched
carefully with 10 mL of water. The biphasic mixture was
extracted with 100 mL of Et~O, washed with brine,
filtered and the solvent was removed in vacuo. The
gummy residue thus obtained was purified by column
chromatography over silica gel (Rf = 0.15, 3:2 hexane-
EtOAc) to obtain 4-(3,5-difluorophenyl)-oxazolidin-2-one
as a white flaky solid (2.8 g, 77o yield). M.P. 81-83
°C; 1H NMR (300 MHz, CDC13) 8 4.13 (dd, J=6.6 Hz, J=8.7
Hz, 1 H) , 4 . 73 (t, J=8. 7 Hz, 1 H) , 4 . 94 (dd, J=6. 6 Hz,
J=8.7 Hz, 1 H), 6.08 (br s, 1 H), 7.03-7.23 (m, 3 H).
The enantiomers were separated on a Chiralcel OD (20 x
250 mm) using 80o hexane/20o isopropyl alcohol as the
eluting system at 12.0 mL/min (U.V. 254 nm). The
retention times for the two isomers were 16.19 min'and
20.08 min respectively.
4-NITROPHENYL (4S)-4-(3,4-DIFLUOROPHENYL)-2-OXO-1,3-
OXAZOLIDINE-3-CARBOXYLATE: Into a suspension of NaH
(0.14 g, 5.30 mmol) in 20 mL of anhydrous THF under
argon, a solution of (+)-4-(3,5-difluorophenyl)-
oxazolidin-2-one (0.88 g; 4.42 mmol) in THF was added
dropwise (dropping funnel). The resulting suspension
was stirred at room temperature for 30 min. This
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-273-
suspension was then added dropwise via cannula into
another round bottom flask containing a solution of 4-
nitrophenylchloroformate (1.11 g, 5.30 mmol) in 25 mL of
THF and cooled at -78 °C over a period of 15 min. The
stirring was continued for 2 h after which the solvent
was removed and the residue was purified by column
chromatography on silica gel with 1:1 hexane/CH~Cl~
followed by CH2C12 (Rf= 0:4, CH2C12) to obtain the desired
product as a white solid (1.55 g, 86o yield).
Similarly, following the above procedure, 4-.(3,5-
trifluorophenyl)-2-oxo-oxazolidine-3-carboxylic acid-4-
nitro-phenyl ester and 4-(3,4,5-trifluorophenyl)-2-oxo-
oxazolidine-3-carboxylic acid-4-nitro-phenyl ester were
obtained. The oxazolidinone enantiomers were resolved
4
on a chiracel OD column (as in the previous example) and
the 4-nitro-phenyl esters were prepared using 4-
nitrophenyl chloroformate.
4-NITROPHENYL (4S)-4-(3,5-DIFLUOROPHENYL)-2-OXO-1,3-
OXAZOLIDINE-3-CARBOXYLATE: 1H NMR (400 MHz, CDC13) 8 8.26
(d, 2H, J= 9.3 Hz), 7.33 - 6.81 (m, 5H), 5.41 (dd, 1H,
J=4 . l, 8.7 Hz) , 4. 81 (t, .1H, J=9.3 Hz) , 4 .33 (dd, 1H,,
E
J=4 . 1, 9 . 3 Hz ) ; Anal . Calc . for Cl6HioF2N20s+0 .. 2Et0Ac : C,
52.84; H, 3.06; N, 7.34. Found: C, 53.26; H, 2.83; N,
7.73
4-NITROPHENYL (4S)-2-OXO-4-(3,4,5-TRIFLUOROPHENYL)-1,3-
OXAZOLIDINE-3-CARBOXYLATE: 1H NMR (400 MHz, CDC13) 8 8.27
(d, 2H, J=9.0 Hz), 7.31 (d, 2H, J=9.0 Hz), 7.11-7.02 (m,
2H), 5.37 (dd, 1H, J=4.1, 9.0 Hz), 4.81 (apparent t, 1H,
J=9.0 Hz), 4.33 (dd, 1H, J=4.1, 9.0 Hz); Anal. Calc. for
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-274-
C16H9F3N2O6: C, 50.27; H, 2.37; N, 7.33. Found: C, 50.56;
H, 2.50; N, 7.49.
1-(3,4-DIFLUOROPHENYL)-2-METHYL-2-HYDROXYPROPYLAMINE.
Into a well-stirred solution of methyl 2-amino-2-(3,4-
difluorophenyl)acetate (10.5 g, 52.19 mmol) in anhydrous
ether (200 mL) at 0 °C a solution of methylmagnesium
bromide (3 M, 87 mL, 261 mmol) in ether was added over
minutes. The reaction mixture was stirred at 0 °C for
10 2.5 h and allowed to warm to room temperature. After 12
h, the reaction mixture was carefully poured onto a
. mixture of ice (300 g) and saturated aqueous ammonium
chloride (50 g). The ether layer was separated and the
aqueous layer was extracted with more ether (4 X 200
mL). The combined extracts were dried with magnesium
sulfate and the solvent evaporated. The crude product
was purified by column chromatography on silica gel
using chloroform/methanol/2M ammonia in methanol
(1000:20:10, 1000:40:20, 1000:80:40) as the eluent to
give the product as an oil (6.5 g, 62o yield). The 1H-
NMR and MS confirmed this to be the desired product.
4-(3,4-DIFLUOROPHENYL)-5;5-DI METHYL-2-OXO-OXAZOLIDIN~.
A mixture of 1-(3,4-difluorophenyl)-2-methyl-2-
hydroxypropylamine (3.OO~g, 14.9 mmol) and
carbonyldiimidazole (2.418 g, 14.9 mmol) in
dichloromethane (150 mL) was heated at reflux
temperature for 36 h and the solvent evaporated. The
residue was purified by column chromatography on silica
gel using chloroform/ethyl acetate (9:1) to give the
product as a viscous oil which solidified on standing
(1.80 g, 50o yield).
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-275-
4-(3,4-DIFLUOROPHENYL)-5,5-DIMETHYL-2-OXO-3-(4-
NITROPHENYLOXYCARBONYL)OXAZOLIDINE. .
Into a stirred suspension of sodium hydride (60%
suspension in paraffin 203 mg, 1.4 eq.) in THF (20 mL)
at 0 °C, a solution of 4-(3,4-difluorophenyl)~-5,5-
dimethyl-2-oxo-oxazolidine (870 mg, 3.622 mmol) in THF
(5 mL) was added followed by stirring for 30 minutes.
This suspension was added to a solution of 4-nitrophenyl
chloroformate (950 mg, 4.71 mmol) in THF (20 mL) at -78
°C under argon and the stirring was continued for 2 h. It
was slowly warmed to room temperature and after 4 h the
solvent was evaporated. The residue was mixed with
dichloromethane (150 mL), washed with 0.05 N sodium
h droxide 3 X 10 mL
y ( ), and dried (sodium sulfate). The
solvent was evaporated and the residue was purified by
column chromatography on silica gel using
chloroform/ethyl acetate (9:1) as the eluent to give the
product as a white powder (860 mg, 59o yield).
4-NITROPHENYL 4-(3,4-DIFLUOROPHENYL)-5,5-DI METHYL-2-OXO-
1,3-OXAZOLIDINE-3-CARBOXYLATE: 1H NMR (400 MHz, CDC13) S
8.24 (d, 2H, J=9 Hz), 7.29 - 6.97 (m, 5H), 5.04 (s, 1H),
1. 09 (s, 6H) ; Anal. Calc. for C18H14F~N206+0.2 o H20: C,f
54.61; H, 3.67; N, 7.08. Found: C, 54.89; H, 3.59;1 N,
7.41.
a. BENZHYDRYLINDENE-(3,4-DIFLUORO-BENZYL)-AMINE
Into a solution of 3,4-difluorobenzylamine (9.8 g, 69
mmol) and benzophenone (13.0 g, 71.0 mmol) in toluene
(200 mL) was added a catalytic amount of BF3.OEt2 and the
resulting solution was heated at reflux temperature for
12 h. The reaction mixture was concentrated in 'racuo,
yielding an oil (21 g, >950), which was characterized by
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-276-
NMR analysis and subjected to the following reaction
without any further purification. 1H NMR (CDC13) ~ 4.57
(s, 2H), 7.80-6.80 (m, 13H).
b. 1-(BEN~HYDRYLIDEN-AMINO)-1-(3,4-DIFLUORO-PHENYL)-
PROPAN-2-OL.
Into a solution of the benzhydrylindene-(3,4-difluoro-
benzyl)-amine (21 g, 69 mmol) in 250 ml of dry THF was
added tert-butyllithium (1.7 M, 60 ml) dropwise and the
resulting solution was stirred at -78 °C for 0.5 h. To
the solution was added acetaldehyde (10 ml, 180 mmol) in
100 ml of THF and the solution was stirred at -78 °C for
2 h and 25 °C for 1 h. The reaction mixture was quenched
by addition of brine. The reaction mixture was diluted
with 500 ml of Et~O and washed with brine. The organic
layer was dried over Na~S04 and concentrated in vacuo to
give an oil, which was taken to the next step without
any further purification. 1H NMR (CDC13) ~ 1.04 (d, 3H),
2.77 (broad s. 1H), 4.08(m, 1H), 4.15 (d, 1H), 7.80-6.80
(m, 13H) .
c. 1-AMINO-1-(3,4-DIFLUORO-PHENYL)-PROPAN-2-OL
A solution of crude product from the previous procedure
and MeONH2.HCl (10 g, 120 mmol) was diluted in 200 inl of
MeOH and stirred for 12 h. The reaction mixture was
concentrated in vacuo, yielding an oily residue, which
was re-dissolved in 200 ml of EtOAc and washed with
brine. The organic layer was concentrated in vacuo to
produce an oily mixture, which was subjected to column
chromatography (5o NH3 saturated MeOH/CHC13) to yield the
desired product (8.8 g, 68o yield from 3,4-
difluorobenzylamine) as a mixture of diastereomers. 1H
NMR (CDC13) (~ 4:1 mixture of the diastereomers) b 1.02
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-277-
(d, J=6.0 Hz, 3 H), 1.04 (d, J=6.3 Hz, 3 H), 2.10 (br, 6
H), 3.56-3.69 (m, 2 H), 3.88-3.92 (m, 2 H), 7.02-7.17
(m, 6 H) .
d. [1-(3,4-DIFLUOROPHENYL)-2-HYDROXY-PROPYL]-CARBAMIC
ACID-TERT-BUTYL ESTER
Into a solution of 1-amino-1-(3,4-difluorophenyl)-
propan-2-of (13.1 g, 70.1 mmol) in CHC13 (150 mL) at 0 °C
was added a solution of di-tert-butyl dicarbonate (19.3
g, 87.6 mmol) in CHC13~(50 mL) in one portion and the
resulting solution was stirred overnight at room
temperature. The solvent was removed in vacuo and the
residue was, subjected to column chromatography on silica
gel (2:1 hexane-EtOAc followed by EtOAc) to obtain [1-
(3,4-difluorophenyl)-2-hydroxy-propyl]-carbamic acid-
tert-butyl ester as a viscous oil (18.4 g, 91% yield). 1H
NMR (CDC13) (~ 4:1 mixture of the diastereomers) 5 1.05
(d, J=6.6 Hz, 3 H), 1.25 (d, J=6.0 Hz, 3 H), 1.41 (br,
H), 3.92-4.19 (br, 2 H), 4.45-4.60 (m, 2 H), 5.41-
20 5.49 (br, 2 H), 7.02-7.17 (m, 6 H).
e. 4-(3,4-DIFLUOROPHENYL)-5-METHYL-OXAZOLIDIN-2-ONE
Into a well-stirred solution of [1-(3,4-difluorophenyl)-
f
2-hydroxy-propyl]-carbamic acid-tert-butyl ester (0.43
g, 1.5 mmol) THF (20 mL) was added 95o NaH (0.09 g, 3.8
mmol) at room temperature. When the reaction was
carried out on a larger (> 5 g) scale, 1.0 equivalEnt of
KH and 1.5 eq. of NaH was used as the base. The
resulting suspension was stirred for 3 h at about 35 °C
(warm water bath) and then quenched carefully with ice.
The biphasic mixture was extracted with 100 mL of EtOAc,
washed with brine, dried over Na2SOQ, filtered and the
solvent was removed in vacuo. The two diastereomers
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-278-
were separated by column chromatography over silica gel
(First isomer: 0.16 g, Rf = 0.6, 3:1 hexane-EtOAc; second
isomer: 0.18 g, Rf = 0.5, 3:1 hexane-EtOAc). NOE
experiment suggested that the first diastereomer had the
methyl and the aryl group in trans configuration while
the second diastereomer had cis relationship between the
two groups.
The 1H NMR spectrum for the trans diastereomers is as
follows. 1H NMR (CDC13) b 1.49 (d, J = 6.0 Hz, 3H), 4.37
(dq, J = 6.0 Hz, J = 7.2 Hz, 1H), 4.45 (d, J = 7.2 Hz,
1H) , 6. 63 (br s, 1H) , 7 . 08-7 .28 (m, 3H) .
The 1H NMR spectrum for the cis diastereomers is as
follows . 1H aNMR (CDC13) 5 0 . 96 (d, J = 6. 6 Hz, 3H) , 4 . 91
(d, J = 8.1 Hz, 1H), 4.99 (dq, J = 6.6 Hz, J = 8.1 Hz,
1H), 6.63 (br s, 1H), 7.08-7.28 (m, 3H).
Enantiomers of the diastereomers were separated by HPLC
by using a Chiralcel OD column (20 x 250 mm) with 800
hexane/20o isopropyl alcohol/ 0,1 o diethylamine as the
eluting system (12 mL/min) under isocratic conditions
(U. V. 254 nM).
f. 4-(3,4-DIFLUOROPHENYL)-5-METHYL-2-OXO-OXAZOLIDINEf3-
CARBOXYLIC ACID-4-NITRO-PHENYL ESTER
Into a solution of 4-(3,4-difluorophenyl)-5-methyl-
oxazolidin-2-one (0.97 g, 4.55 mmol) in 60 mL THF'was
added a solution of n-butyllithium in hexane (3.06 mmol,
4.9 mmol) dropwise via a syringe under argon atmosphere
at -78 °C. The resulting yellow solution was stirred at
-78 °C for 40 min. This solution was then added dropwise
via a cannula into another round bottom flask containing
a solution of 4-nitrophenylchloroformate (1.03 g, 5.1
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-279-
mmol) in 60 mL of THF, cooled a.t -78 °C, over a period of
15 min. After five minutes, the flask was removed from
the cooling bath and stirring was continued for 1 h. The
reaction mixture was quenched by adding ice and it was
extracted with EtOAc. The organic extracts were washed
with brine and the organic layer was dried over Na2S04.
The solvent was removed after filtration and the residue
was purified by column chromatography on silica gel with
1:1 hexane/CH2C12 followed by CH~C1~ (Rf= 0.4, CH2C1~) to
give the desired product.
The relative configurations of the cis and trans isomers
were assigned on the basis of 1H NMR analysis of the
respective p-nitrophenyloxycarbonyl derivatives. For
the trans isomer, an NOE was observed between the
protons of the C-5 methyl group and the proton at C-4.
No NOE was observed between the protons at the C-4 and
C-5 positions of this isomer, which was thus assigned
traps stereochemistry. For the cis isomer, no NOE was
observed between the protons of the C-5 methyl group and
the proton at C-4. However, a NOE was observed between
the protons at the C-4 and C-5 positions, leading us to
assign this isomer cis stereochemistry. The vicinal
coupling constants of the C-4 protons of cis (J = 7.8
Hz) and traps (J = 5.1 Hz) are also consistent with the
values reported for similar oxazolidinones, and were
thus helpful in making the stereochemical assignments
(Dondoni, A.; Perrone, D.; Semola, T. Synthesis 1995,
181) .
In order to assign the absolute configurations at the
stereogenic centers of the oxazolidinone rings, a new
synthetic route was designed which employed an
enantiomerically pure substrate derived from the chiral
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-280-
pool. Commercially available (S)-(+)-methyl lactate was
converted into its pyrrolidine amide according to the
method of Martin et a1 (Martin, R.; Pascual, 0.; Romea,
P.; Rovira, R.; Urpi, F.; Vilarrasa, J. Tetrahedron
Lett. 1997, 38, 1633). Following the protection of the
hydroxy group of (2S)-1-oxo-1-(1-pyrrolidinyl)-2-
propanol to a TBDMS group, treatment of tert-
butyl(dimethyl)silyl (1S)-1-methyl-2-oxo-2-(1-
pyrrolidinyl)ethyl ether with 3,4-difluorophenyllithium
yielded (2S)-2-{[tert-butyl(dimethyl)silyljoxy}-1-(3,4-
difluorophenyl)-1-propanone as the sole product, which
was then converted to (2S)-2-{[tert-
butyl(dimethyl)silyl]oxy}-1-(3,4-difluorophenyl)-1-
propanone oxime. Reduction of the (2S)-2-{[tert-
butyl(dimethyl)silyl]oxy}-1-(3,4-difluorophenyl)-1-
propanone oxime with LiAlH4, N-acylation, and base
induced cyclization provided oxazolidinone
diastereomers, which were separated by flash column
chromatography. The enantiomeric purity of these
isomers was confirmed by chiral HPLC analysis and their
relative configurations were assigned by comparison of
their 1H NMR spectra with those of the racemic isomers.
As the absolute configuration at C-5 of the lactic acid
f
derived oxazolidinone described above is (S), the C-4
center in traps compounds also has the (S)
configuration, Accordingly, the absolute configurations
for the stereogenic centers in the cis compounds are
assigned accordingly (4R,SS).
4-NITROPHENYL (4S,5R)-4-(3,4-DIFLUOROPHENYL)-5-METHYL-2
OXO-1,3-OXAZOLIDINE-3-CARBOXYLATE: 1H NMR (400 MHz,
CDC13) 8 8.25 (d, 2H, J=8.8 Hz), 7.30 - 6.99 (m, 5H),
5.35 (d, 1H, J=7.7 Hz), 5.07 (apparent quintet, 1H),
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-281-
1.17 (d, 3H, J=6.5 Hz); Anal. Calc. for
C17H12F2N~O6+O.5H20: C, 52.72; H, 3.38; N, 7.23. Found: C,
53.09; H, 3.19; N, 7.50.
(+)-2-AMINO-3-(3,4-DIFLUORO)-PHENYL-PROPAN-1-OL: (+)-
3,4-difluorophenyl alanine (1.0 g, 5.0 mmol) was added
in small portions to a stirring suspension of LiAIHQ
(0.480 g, 12.5 mmol) in THF (30 mL) at 0 °C. The
resulting gray suspension was then heated at reflux for
2 h. The reaction mixture was cooled to 0 °C and then
carefully quenched sequentially with water (0.5 mL), 3 N
NaOH (0.5 mL), and water (1.50 mL). The resulting
suspension was filtered through a fritted glass funnel.
Ether (50 mL) was added to the filter cake and the
suspension was heated at reflux temperature for 20 min.
The suspension was filtered and was combined with the
previous filtrate. The combined organics were dried
over MgS04, filtered and the solvent was removed in
vacuo. 2-Amino-3-(3,4-difluoro)-phenyl-propan-1-of was
obtained as a white solid (0.500 g, 1000) which was used
in the next step without further purification.
(+)-[1-(3,4-DIFLUOROBENZYL)-2-HYDROXY-ETHYL]-CARBAMIC
ACID-TERT-BUTYL ESTER: A solution of di-tern-butyl
dicarbonate (0.640 g, 2.90 mmol) in CHC13 (10 mL) was
added in one portion to a solution of (+)-2-amino-3-
(3,4-difluoro)-phenyl-propan-1-of (0.500 g,. 2.62 mmol)
in CHC13 (20 mL) at 0 °C and the resulting solution was
stirred overnight at room temperature. The solvent was
removed in vacuo and the residue was chromatographed
(2:1 hexane-EtOAc, followed by EtOAc), giving (+)-[1-
(3,4-difluorobenzyl)-2-hydroxy-ethyl]-carbamic acid-
tert-butyl ester as a white solid (0.640 g, 99%).
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-282-
(+)-4-(3,4-DIFLUORO-BENZYL)-OXAZOLIDIN-2-ONE: A solution
of (-I-) - [1- (3, 4-dif~uorobenzyl) -2-hydroxy-ethyl] -carbamic
acid-tert-butyl ester (1.00 g, 4.00 mmol) in THF (10 mL)
was added via a dropping funnel to a stirring suspension
of 95o NaH (0.12 g, 5.0 mmol) in THF (20 mL) at room
temperature. The resulting suspension was stirred for 3
h and then quenched carefully with water (10 mL). The
biphasic mixture was extracted with EtzO (50 mL), washed
with brine, filtered and the solvent was removed in
vacuo. The resulting gummy residue was purified by
column chromatography (Rf - 0.25, 3:2 hexane-EtOAc), to
give the desired product as a white solid (0.320 g,
760) .
(+)-4-(3,4-DIFLUORO-BENZYL)-OXAZOLIDIN-2-ONE-3-
CARBOXYLIC ACID-4-NITRO-PHENYL ESTER: A solution of (+)-
4-(3,4-difluoro-benzyl)-oxazolidin-2-one (0.210 g, 1.0
mmol) in THF (10 mL) was added dropwise via a dropping
funnel to a stirring suspension of NaH (30.0 mg, 1.30
mmo1) in anhydrous THF (10 mL) under argon. The
resulting suspension was stirred at room temperature for
min. This suspension was then added dropwise via
f
cannula to a solution of 4-nitrophenylchloroformate
25 (0.300 g, 1.50 mmol) in THF (20 mL) at -78 °C over 15
min. Stirring was continued for 2 h after which the
solvent was removed and the residue was purified by
column chromatography (1:1 hexane/CH~C12, followed by
CH~C12; Rf= 0. 4, CH2C12) , to give the desired product as a
30 yellow solid (0.350 g, 820).
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-283-
Similarly, 4-nitrophenyl 4-(4-fluorobenzyl)-2-oxo-1,3-
oxazolidine-3-carboxylate was obtained from the
corresponding p-fluorophenyl alanine:
4-NITROPHENYL 4-(4-FLUOROBENZYL)-2-OXO-1,3-OXAZOLIDINE-
3-CARBOXYLATE: 1H NMR (400 MHz, CDC13) $ 8.32 (d, 2H,
J=9.3 Hz), 7.42 (d, 2H, J=8.9 Hz), 7.24-6.99.(m, 4H),
4.69 - 4.59 (m, 1H), 4.35 (t, 1H, J=8.6 Hz), 4.23 (dd,
1H, J=2.7, 9.3 Hz), 3.37 (dd, 1H, J=3.8, 13.6 Hz), 2.94
(dd, 1H, J=9.3, 13.6 Hz) ; Anal. Calc. for C1~H13FN206: C,
56.67; H, 3.64; N, 7.77. Found: C, 56.94; H, 3.76; N,
7.71.
2-[6-(4-PHENYL-1-PIPERIDINYL)HEXYL]-1H-ISOINDOLE-
1,3(2H)-DIONE: To the 500 ml RB-flask was added 4-
phenylpiperidine hydrochloride (5 g, 25 mmol), N-(6-
bromohexyl)phthalimide (15.5 g, 50 mmol), N,N-
diisopropylethylamine (21.8' ml, 125 mmol),
tetrabutylammonium iodide (0.2 g), and dioxane (250 ml)
at room temperature. The reaction mixture was stirred
at 100 oC for 72 h. The solvent was removed in vacuo and
the crude product was purified by flash chromatography
(98:2 = Chloroform . 2N ammonia in methanol) to afford
7.67 g of the desired product (77o yield): iH NMR ('400
MHz, CDC13) 8 7.78-7.79 (m, 2H), 7.74-7.65 (m, 2H), 7.32-
7.14 (m, 5H), 3.69 (t, 2H, J=7.35 Hz), 3.06 (d, 2I~,
J=11.0 Hz), 2.49 (quintet, 1H, J=7.6 Hz), 2.36 (t, 2H,
J=7.6 Hz), 2.02 (t, 2H, J=12.5 Hz), 1.82 (br s, 4H),
1.69 (t, 2H, J=6.3 Hz), 1.54 (br s, 2H), 1.37 (br s,
4H); ESMS m/e: 391.3 (M + H)+; Anal. Calc. for
C~SH3oN~02+0.2H20: C, 76.19; H, 7.77: N, 7.11. Found: C,
76.14; H, 7.38; N, 7.13.
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-284-
General procedure for the Preparation of the substituted
4- [4- (3-aminophenyl) -1-piperidinyl] -1- (phenyl) -1-
butanones:
A mixture of 4-(3-aminophenyl)piperidine (2.0 mmol), 2.4
mmol of the appropriate substituted phenyl butyryl
chloride, 3.0 mmol of K2C03, and 10 mg of 18-crown-6 in 5
mL of toluene were heated at 110 °C for 2.5 days. The
reaction mixture was concentrated and chromatographed on
silica (5o methanol in dichloromethane) to give the
desired compound:
4-[4-(3-AMINOPHENYL)-1-PIPERIDINYL]-1-(4-PHENOXYPHENYL)-
1-BUTANONE:,305 mg; ESMS m/e . 415.4 (M + H)+.
4-[4-(3-AMINOPHENYL)-1-PIPERIDINYL]-1-(4-CHLOROPHENYL)-
1-BUTANONE: 500 mg; Anal. Calc for C21HZSC1N~0+0.3H20: C,
69.62; H, 7.12; N, 7.73. Found: C, 69.63; H, 7.34; N,
7.60; ESMS m/e . 357.3 (M + H)+.
4-[4-(3-AMINOPHENYL)-1-PIPERIDINYL]-1-PHENYL-1-BUTANONE:
250 mg; Anal. Calc for C21H26N20+0.2H~0: C, 77.36; H,
8.16; N, 8.59. Found: C, 77.55; H, 8.12; N, 8.75; ESMS
m/e . 323.3 (M + H)+
4-[4-(3-AMINOPHENYL)-1-PIPERIDINYL]-1-(2,4-
DIMETHOXYPHENYL)-1-BUTANONE: 330 mg; Anal. Calc for
C=3H3oN203+0.5H20: C, 70.56; H, 7.98; N, 7.16. Found: C,
70.69; H, 7.87; N, 6.99; ESMS m/e . 383.3 (M + H)+
General Procedure for the Acylation or Sulfonylation of
the Substituted 4-[4-(3-Aminophenyl)-1-piperidinyl]-1-
(4-phenyl)-1-butanones:
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-285-
A mixture of 1 equivalent of a substituted 4-[4-(3-
aminophenyl)-1-piperidinyl]-1-(4-phenyl)-1-butanone, 1.5
equivalent of an acid chloride or a sulfonyl chloride,
and 5 equivalents of diisopropylethylamine, in
dichloromethane was stirred at room temperature for two
days. The reaction mixture was applied to a preparative
TLC plate and eluted with dichloromethane: methanol
(15:1, containing 1% isopropyl amine) to give the
desired product.
General procedure for the Preparation of the substituted
4-N- (3-{ 1- [4- (phenyl) -4-oxobutyl~ -4--
piperidinyl}phenyljacetamides:
A mixture of N-[3-(4-piperidinyl)phenyl]acetamide (1.0
eq) and an aryl substituted chlorobutyrophenbne (2.0
eq) , KZC03 (5.0 eq) , diisopropylethylamine (3. 0 eq) and
tetrabutylammonium iodide (cat. 5-100) in dioxane (0.5
to 1.0 M) were heated at reflux temperature for 16 h.
The reaction mixture was filtered and concentrated in
vacu~. The crude product was chromatographed using
silica preparative TLC (chloroform . methanol containing
0.5o isopropyl amine) to give the desired product.
Example 57
N-(3-(1-[4-(3,4-DIMETHYLPHENYL)-4-OXOBUTYL]-4-
PIPERIDINYL}PHENYL)ACETAMIDE:1H NMR (CDC13) 8 7.75 (s,
1H), 7.71 (d, 1H, J=7.6 Hz), 7.45 (d, 2H, J=7.2 Hz),
7.35 (s, 1H) , 7.26-7.22 (m, 2H) , 6.93 (d, 1H; J=7 . 6 Hz) ,
3.24-3.21 (m, 2H), 3.04 (t, 2H, J=7.0 Hz), 2.67-2.63 (m,
2H), 2.59-2.48 (m, 1H), 2.32 (s, 6H), 2.30-2.27 (m, 2H),
2. I8 (s, 3H), 2.14-2.06 (m, 2H), 2.00-1.80 (m, 4H); ESMS
m/e . 393.3 (M + H)+.
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-286-
Example 58
N-(3-{1-[4-(3,4-DIMETHYLPHENYL)-4-OXOBUTYL]-4-
PIPERIDINYL}PHENYL)-2-METHYLPROPANAMIDE: A mixture of
0.0500 g (0.200 mmol) of 2-methyl-N-[3-(4-
piperidinyl)phenyl]propanamide, 0.100 g (0.480 mmol) of
4-chloro-3',4'-dimethylbutyrophenone, 0.080 g (0.600
mmol) of KZC03 and 0.090 g (0.600 mmol) of NaI in 5 mL of
DMF was heated at reflux temperature for 18 hours. The
reaction mixture was filtered, the filtrate was poured
into 5 mL of water and washed with 3 X 5 mL of ethyl
acetate. The combined organic extracts were dried
(MgS04), concentrated in vacuo and purified by
preparative TLC (silica; 9.5 . 0.5, dichloromethane .
methanol + 1% isopropyl amine) to afford 0.067 g (80.0o
yield) of the desired product:lH NMR (400 MHz, CDC13)
7 .72 (d, 1H, J=8.0 Hz) , 7 . 44 (s, 1H) , 7.38 (d, 1H, J=8 . 0
Hz), 7.23-7.20 (m, 2H), 7.16 (s, 1H), 6.95 (d, 1H, J=6.8
Hz), 3.13-3.11 (m, 2H), 3.02 (t, 2H, J=7.0 Hz), 2.56-
2.40 (m, 4H), 2.32 (s, 6H), 2.17-2.15 (m, 2H), 2.04-1.78
(m, 6H) , 1 .25 (d, 6H, J=6. 8 Hz) ; ESMS m/e . 421.3 (M +
H)+.
Example 59
N-(3-{1-[4-(3,4-DIMETHYLPHENYL)-4-OXOBUTYL]-4-
PIPERIDINYL}PHENYL)CYCLOHEXANECARBOXAMIDE: 1H NMR (400
MHz, CDC13) 8 7.80-6.81 (m, 7H), 3.41-3.00 (m, 4H)~, 2.95-
2.41 (m, 4H), 2.32 (s, 6H), 2.22-1.05 (m, 18H); ESMS m/e
461.4 (M + H)+.
Example 60
N-(3-{1-[4-(3,4-DIMETHYLPHENYL)-4-OXOBUTYL]-4-
PIPERIDINYL}PHENYL)-2-PHENYLACETAMIDE: 1H NMR (400 MHz,
CDC13) 8 7.85-7.65 (m, 2H), 7.45-6.92 (m, 10H), 3.76 (s,
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-287-
2H), 3.10-2.90 (m, 4H), 2.50-2.35 (m, 3H), 2.32 (s, 6H),
2.10-1.85 (m, 4H), 1.80-1.60 (m, 4H); ESMS m/e . 469.4
(M + H)+.
Example 61
N- (3-{ 1- [4- (3, 4-DIMETHYLPHENYL) -4-OXOBUTYL] -4-
PIPERIDINYL}PHENYL)-2-(3-METHOXYPHENYL)ACETAMIDE: 1H NMR
(400 MHz, CDC13) 8 7.76-7.65 (m, 2H), 7.38-7.12 (m, 6H),
6.95-6.80 (m, 3H), 3.82 (s, 3H), 3.70 (s, 2H), 3.10-2.90
(m, 4H), 2.50-2.38 (m, 3H), 2.32 (s, 6H), 2.10-1.85 (m,
4H), 1.80 -1.60 (m, 4H); ESMS m/e . 499.4 (M + H)+.
Example 62
N- (3-{ 1- [4- (3, 4-DIMETHYLPHENYL) -4-OXOBUTYL] -4-
PIPERIDINYL}PHENYL)-2-METHOXYACETAMIDE: 1H NMR (400 MHz,
CDC13) 8 7.80-7.75 (m, 2H), 7.50-7.38 (m, 2H), 7.34-6.90
(m, 3H), 4.00 (s, 2H), 3.51 (s, 3H), 3.30-2.95 (m, 4H),
2.70-2.50 (m, 3H), 2.32 (s, 6H), 2.15 -1.80 (m, 8H);
ESMS m/e . 423.3 (M + H)+.
Example 63
N- (3-{ 1- [4- (3, 4-DIMETHYLPHENYL) -4-OXOBUTYL] -4-
. PIPERIDINYL}PHENYL)METHANESULFONAMIDE: 1H NMR (400 MHz,
CDC13) b 7.82-7.10 (m, 7H), 3.41 (s, 3H), 3.40-2.85 (m,
4H), 2.82-2.35 (m, 5H), 2.32 (s, 6H), 2.22-1.80 (m, 6H);
ESMS m/e . 429.3 (M + H)+.
Example 64
N-(3-{1-[4-(3,4-DIMETHYLPHENYL)-4-OXOBUTYL]-4-
PIPERIDINYL}PHENYL)ETHANESULFONAMIDE: 1H NMR (400 MHz,
CDC13) 8 7.75 (s, 1H), 7.71 (d, 1H, J=7.6 Hz), 7.30-7.09
(m, 4H), 7.02 (d, 1H, J=7.2 Hz), 3.36-3.05 (m, 6H),
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-288-
2.77-2.52 (m, 3H), 2.32 (s, 6H), 2.15-1.82 (m, 8H), 1.37
(t, 3H, J=7.4 Hz); ESMS m/e . 443.3 (M + H)+
Example 65
N-(3-{1-[4-(4-CHLOROPHENYL)-4-OXOBUTYL]-4-
PIPERIDINYL}PHENYL)ACETAMIDE: 1H NMR (400 MHz, CDC13) cS
7.92 (d, 2H, J=8.8 Hz), 7.55-7.40 (m, 3H), 7.35 (s, 1H),
7.22 (t, 1H, J=8.0 Hz), 6.92 (d, 1H, J=8.0 Hz), 3.30-
3.27 (m, 2H) , 3.09 (t, 2Fi, J=7. 0 Hz) , 2.76-2.39 (m, 5H) ,
2.20 (s, 3H), 2.17-1.85 (m, 6H); ESMS m/e . 399.3 (M +
H) +,
Example 66
N-(3-{1-[4-(4-CHLOROPHENYL)-4-OXOBUTYL]-4-
PIPERIDINYL}PHENYL)-2-METHYLPROPANAMIDE: 1H NMR (400 MHz,
CDC13) 8 7.93 (d, 2H, J=8.6 Hz), 7.45 (d, 2H, J=8.6 Hz),
7 . 39 (d, 1H, J=7 .2 Hz) , 7 .32 (s, 1H) , 7.24 (t, 1H, J=7 . 8
Hz), 6.94 (d, 1H, J=8.4 Hz), 3.21-3.18 (m, 2H), 3.05 (t,
2H, J=7.0 Hz), 2.64-2.51 (m, 4H), 2.28-1.86 (m, 8H),
1.26 (d, 6H, J=6.8 Hz); ESMS m/e . 427.3 (M + H)+.
Example 67
N-(3-{1-[~-(4-CHLOROPHENYL)-4-OXOBUTYL]-4-
f.
PIPERIDINYL}PHENYL)CYCLOHEXANECARBOXAMIDE: 1H NMR ('400
MHz, CDC13) ~ 7.93 (d, 2H, J=8.4 Hz), 7.55-7.19 (m, 5H),
6. 93 (d, 1H, J=7. 6 Hz) , 3.25-3. 00 (m, 4H) , 2. 65-2.,45 (m,
4H), 2.30-1.50 (m, 18H); ESMS m/e . 467.3 (M + H)+.
Example 68
N-(3-{1-[4-(4-CHLOROPHENYL)-4-OXOBUTYL]-4-
PIPERIDINYL}PHENYL)-2-PHENYLACETAMIDE: 1H NMR (400 MHz,
CDC13) S 7.92 (d, 2H, J=8.4 Hz), 7.46-7.26 (m, 9H), 7.20
(t, 1H, J=7.6 Hz) , 6.92 (d, 1H, J=7. 6 Hz) , 3.75 (s, 2H) ,
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-289-
3.15-3.13 (m, 2H), 3.03 (t, 2H,~J=7.0 Hz), 2.64-2.46 (m,
3H), 2.22-1.60 (m, 8H); ESMS m/e . 475.3 (M + H)+.
Example 69
N-(3-{1-[4-(4-CHLOROPHENYL)-4-OXOBUTYL]-4-
PIPERIDINYL}PHENYL)-2-(3-METHOXYPHENYL)ACETAMIDE: 1H NMR
(400 MHz, CDC13) 8 7.92 (d, 2H, J=8.4 Hz), 7.44 (d, 2H;
J=8.4 Hz) 7.38 (s, 1H), 7.35-7.25 (m, 3H), 7:19 (t, 1H,
J=7.8 Hz), 6.94-6.86 (m, 3H), 3.81 (s, 3H), 3.72 (s,
2H), 3.12-3.09 (m, 2H), 3.02 (t, 2H, J=6.8 Hz), 2.57-
2.44 (m, 3H), 2.20-1.60 (m, 8H); ESMS m/e . 505.3 (M +
H)+.
Example 70
N-(3-{1-[4-(4-CHLOROPHENYL)-4-OXOBUTYL]-4-
PIPERIDINYL}PHENYL)-2-METHOXYACETAMIDE: 1H NMR (400 MHz,
CDC13) 8 7.93 (d, 2H, J=8.4 Hz), 7.50-7.25 (m, 5H), 6.98
(d, 1H, J=7.8 Hz), 4.01 (s, 2H), 3.57 (s, 3H), 3.30-3.15
(m, 2H), 3.06 (t, 2H, J=6.8 Hz), 2.70-2.50 (m, 3H),
2.35-1.80 (m, 8H); ESMS m/e . 429.3 (M + H)+.
Example 71
N-(3-{1-[4-(4-CHLOROPHENYL)-4-OXOBUTYL]-4-
PIPERIDINYL}PHENYL)METHANESULFONAMIDE: 1H NMR (400 MHz,
CDC13) b 7.95-6.96 (m, 8H), 3.48 (s, 3H), 3.28-2.90 (m,
6H), 2.80-2.57 (m, 3H), 2.38-1.86 (m, 6H); ESMS m/e .
435.2 (M + H)+.
Example 72
N-(3-{1-[4-(4-CHLOROPHENYL)-4-OXOBUTYL]-4-
PIPERIDINYL}PHENYL)ETHANESULFONAMIDE: 1H NMR (400 MHz,
CDC13) 8 7.93 (d, 2H, J=8.2 Hz), 7.45 (d, 2H, J=8.2 Hz),
7.30-7.08 (m, 3H), 6.99 (d, 1H, J=7.6 Hz), 3.26-3.02 (m,
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-290-
6H), 2.69-2.45 (m,~ 3H), 2.32-1.75 (m, 8H), 1.36 (t, 3H,
J=7.4 Hz); ESMS m/e . 449.3 (M + H)+.
Example 73
N-{3-[1-(4-OXO-4-PHENYLBUTYL)-4-
PIPERIDINYL]PHENYL}ACETAMIDE: 1H NMR (400 MHz, CDC13)
8.10-6.80 (m, 9H), 3.40-2.95 (m, 4H), 2.85-2.20 (m, 3H),
2.19 (s, 3H), 2.15-1.70 (m, 8H); ESMS m/e . 365.3 (M +
H)+.
Example 74
2-METHYL-N-{3-[1-(4-OXO-4-PHENYLBUTYL)-4-
PIPERIDINYL}PHENYL}PROPANAMIDE: 1H NMR (400 MHz, CDC13)
7.99 (d, 2H, J=7.4 Hz), 7.57 (t, 1H, J=7.4 Hz), 7.48 (t,
2H, J=7.4 Hz), 7.45-7.20 (m, 2H), 7.24 (t, 1H, J=8.0
Hz), 6.94 (d, 1H, 8.0 Hz), 3.24-3.21 (m, 2H), 3.09 (t,
2H, J=7.0 Hz), 2.57-2.25~(m, 4H), 2.31-1.84 (m, 8H),
1.26 (d, 6H, J=7.2 Hz); ESMS m/e . 393.3 (M + H)+.
Example 75
N-{3-[1-(4-OXO-4-PHENYLBUTYL)-4-PIPERIDINYL]PHENYL}-2-
PHENYLACETAMIDE: 1H NMR (400 MHz, CDC13) 8 7.98 (d, 2H,
J=7 . 6 Hz) , 7 . 65-7 . 15 (m, 11H) , 6. 92 (d, 2H, J=7 .2 Hz.) ,
3.74 (s, 2H), 3.20-2.95 (m, 4H), 2.65-2.40 (m, 3H),
2.25-1.70 (m, 8H); ESMS m/e . 441.3 (M + H)+.
Example 76
2-(3-METHOXYPHENYL)-N-{3-[1-(4-OXO-4-PHENYLBUTYL)-4-
PIPERIDINYLjPHENYL}ACETAMIDE: 1H NMR (400 MHz, CDC13) ~ ,
7.98 (d, 2H, J=7.6 Hz), 7.56 (t, 1H, J=7.62 Hz), 7.46
(t, 2H, J=7.6 Hz), 7.40 (s, 1H), 7.37-7.26 (m, 2H), 7.19
(t, 1H, J=7.8 Hz), 6.94-6.86 (m, 3H), 3.81 (s, 3H), 3.71
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-291-
(s, 3H), 3.12-3.03 (m, 4H), 2.57-2.44 (m, 3H), 2.16-1.77
(m, 8H); ESMS m/e . 471.3 (M + H)+.
Example 77
N-(3-{1-[4-(2,4-DIMETHOXYPHENYL)-4-OXOBUTYL]-4-
PIPERIDINYL}PHENYL)ACETAMIDE: 1H NMR (400 MHz, CDC13) $
7.82 (d, 1H, J=8.8 Hz), 7.54 (d, 1H, J=7.6 Hz), 7.33 (s,
1H) , 7.22 (t, 1H, J=7. 6 fiz) , 6. 93 (d, 1H, J=7.6 Hz) ,
6.53 (d, 1H, J=8.8 Hz), 6.46 (s, 1H), 3.90 (s, 3H), 3.86
(s, 3H), 3.48-3.27 (m, 2H), 3.05 (t, 2H, J=6.8 Hz),
2.90-2.68 (m, 2H), 2.65-2.38 (m, 3H), 2.25 (s, 3H),
2.18-1.80 (m, 6H); ESMS m/e . 425.3 (M + H)+.
Example 78
N- (3-{ 1- [4- (2, 4-DIMETHOXYPHENYL) -4-OXOBUTYL] -4-
PIPERIDINYL}PHENYL)-2-METHYLPROPANAMIDE: 1H NMR (400 MHz,
CDCl3) 8 7.98 (d, 1H, J=8.6 7.41-7.37 (m, 2H), 7.24
Hz),
(t, 1H, J=7 .8 Hz) , 6.96 (d, 1H, J=7 .8 Hz) 6.54 (d, 1H,
,
J=8.6 Hz), 6.46 (s, 1H), 3.89 , 3H), 3.86(s, 3H),
(s
3.11-3.08 (m, 2H), 2.98 (t, 2H, J=7.2 Hz), 2.53-2.46
(m,
4H), 2.13-1.79 (m, 8H), 1.25 6H, J=6.8 Hz); ESMS
(d, m/e
453.3 (M + H)+.
Example 79
N-(3-{1-[4-(2,4-DIMETHOXYPHENYL)-4-OXOBUTYL]-4-
PIPERIDINYL}PHENYL)-2-PHENYLACETAMIDE: 1H NMR (400 MHz,
CDC13) 8 7.85 (m, 12H), 3.89 (s, 3H), 3.86 (s, 3H), 3.74
(s, 2H), 3.22-2.90 (m, 4H), 2.64-2.40 (m, 3H), 2.25-1.70
(m, 8H); ESMS m/e . 501.3 (M + H)+.
Example 80
N-(3-{1-[4 -(2,4-DIMETHOXYPHENYL)-4-OXOBUTYL]-4-
PIPERIDINYL}PHENYL)-2-(3-METHOXYPHENYL)ACETAMIDE: 1H NMR
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-292-
(400 MHz, CDC13) 8 7.82 (d, 1H, J=8.8 Hz) , 7.48-7 .15 (m,
5H), 6.95-6.80 (m, 3H), 6.58-6.45 (m, 2H), 3.89 (s, 3H),
3.86 (s, 3H), 3.81 (s, 3H), 3.72 (s, 2H), 3.25-2.95 (m,
4H), 2.65-2.40 (m, 3H), 2.30-1.95 (m, 4H), 1.93-1.72 (m,
4H); ESMS m/e . 531.3 (M + H)+.
Example 81
N-(3-{1-[4-OXO-4-(4-PHENOXYPHENYL)BUTYL]-4-
PIPERIDINYL}PHENYL)ACETAMIDE: 1H NMR (400 MHz, CDC13) 8
8.15-6.75 (m, 13H), 3.30-2.80 (m, 4H), 2.75-2.10 (m,
5H), 2.03 (s, 3H), 2.00-1.60 (m, 6H); ESMS m/e . 457.3
(M + H)+.
Example 82 '
2-METHYL-N-(3-{1-[4-OXO-4-(4-PHENOXYPHENYL)BUTYL]-4-
PIPERIDINYL}PHENYL)PROPANAMIDE: 1H NMR (400 MHz, CDC13) 8
7.96 (d, 2H, J=8.8 Hz), 7.43-7.15 (m, 6H), 7.10-6.93 (m,
5H), 3.42-2.95 (m, 4H), 2.80-2.45 (m, 4H),' 2.20-1.80 (m,
8H), 1.14 (d, 6H, J=6.8 Hz); ESMS m/e . 485.4 (M + H)+.
Example 83
2- (3-METHOXYPHENYL) -N- (3-{ 1- [4-OXO-4- (4-
PHENOXYPHENYL)BUTYL]-4-PIPERIDINYL}PHENYL)ACETAMIDE: 1H
NMR (400 MHz, CDC13) b 7 . 97 (d, 2H, J=8.8 Hz) , 7 . 41-:~'. 18
(m, 7H), 7.08-6.99 (m, 5H), 6.94-6.87 (m, 3H), 3.82 (s,
3H), 3.70 (s, 2H), 3.10-2.95 (m, 4H), 2.55-2.40 (m, 3H),
2.15-1.95 (m, 4H), 1.81-1.70 (m, 4H); ESMS m/e . 563.4
(M + H)+.
Example 84
N'-(3-{1-[4-(4-CHLOROPHENYL)-4-OXOBUTYL]-4-
PIPERIDINYL}PHENYL)-N,N-DIMETHYLSULE'AMIDE: 1H NMR (400
MHz, CDC13) 8 7.93 (d, 2H, J=8.8 Hz), 7.44 (d, 2H, J=8.8
Hz), 7.27 (s, 1H), 7.25-7.10 (m, 2H), 6.94 (d, 1H, J=7.6
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-293-
Hz), 3.30-3.10 (m, 2H), 3.04 (t, 2H, J=6.8 Hz), 2.83 (s,
6H), 2.68-2.45 (m, 3H), 2.30-1.75 (m, 8H); ESMS m/e .
464.3 (M + H)+.
Example 85
N-(3-{1-[4-OXO-4-(2-THIENYL)BUTYL]-4-
PIPERIDINYL}PHENYL)ACETAMIDE: 1H NMR (400 MHz, CDC13) 8
7.90-6.78 (m, 7H), 3.22-2.88 (m, 4H), 2.69-2.25 (m, 5H),
2.02 (s, 3H), 2.00-1.64 (m, 6H); ESMS m/e . 371.2 (M +
H)+.
Example 86
N-(3-{1-[4-(4-ISOPROPYLPHENYL)-4-OXOBUTYL]-4-
PIPERIDINYL}PHENYL)ACETAMIDE: 1H NMR (400 MHz, CDC13)
8.00-6.78 (m, 8H), 3.15-2.98 (m, 4H), 2.77-2.15 (m, 4H),
2.03 (s, 3H) , 2.00-1. 62 (m, 8H) , 0. 927 (d, 6H, J=6. 0
Hz); ESMS m/e . 407.3 (M + H)+.
Example 87
N- (3-{ 1- [4- (4-METHYLPHENYL) -4-OXOBUTYL] -4-
PIPERIDINYL}PHENYL)ACETAMIDE: ~H NMR (400 MHz, CDC13) 8
7.90-6.80 (m, 8H), 3.10-2.45 (m, 7H), 2.32 (S, 3H), 2.02
(s, 3H), 2.01-1.68 (m, 8H); ESMS m/e . 379.3 (M + H)~.
Example 88
N-(3-{1-[4-(4-BROMOPHENYL)-4-OXOBUTYL]-4-
PIPERIDINYL}PHENYL)ACETAMIDE: 1H NMR (400 MHz, CDC13) 8
7.90-6.80 (m, 8H), 3.30-3.05 (m, 4H), 2.70-2.45 (m, 3H),
2.05 (s, 3H), 1.98-1.65 (m, 8H); ESMS m/e . 444.0 (M +
H)+.
EXAMPLE 89
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-294-
N-(3-{1-[4-(3,4-DIMETHYLPHENYL)-4-OXOBUTYL]-4-
PIPERIDINYL}PHENYL)-2-PROPANESULFONAMIDE: 1H NMR (400
MHz, CDC13) 8 7.75 (s, 1H), 7.71 (d, 1H, J=7.6 Hz), 7.27-
7.00 (m, 5H), 3.32-3.24 (m, 3H), 3.10-3.02 (m, 2H),
2.78-2.50 (m, 3H), 2.32 (s, 6H), 2.19-1.84 (m, 8H), 1.39
(d, 6H, J=6.8 Hz); ESMS m/e . 457.4 (M + H)+.
Example 90
N-(3-{1-[4-OXO-4-(4-PHENOXYPHENYL)BUTYL]-4-
PIPERIDINYL}PHENYL)-2-PROPANESULFONAMIDE: 1H NMR (400
MHz, CDC13) 8 7.97 (d, 2H, J=7.6 Hz), 7.44 (t, 2H, J=7.6
Hz), 7.27-7.00 (m, 9H), 3.35-2.96 (m, 5H), 2.69-2.45 (m,
3H), 2.14-1:79 (m, 8H), 1.39 (d, 6H, J=6.8 Hz); ESMS m/e
. 521.4 (M + H)+.
Example 91
N-(3-{1-[3-(4-CHLOROPHENYL)-3-METHOXYPROPYL]-4-
PIPERIDINYL}PHENYL)-2-METHYLPROPANAMIDE
A mixture of 3-methoxy-3-(p-chlorophenyl)-1-
chloropropane (27.4 mg, 0.125 mmol), 2-methyl-N-[3-(4-
piperidinyl)phenyl]propanamide (28.3 mg, 0.125 mmol),
diisopropylethylamine (0.50 mL) and catalytic amount of
tetrabutylammonium iodide in dioxane (2.0 mL) was
stirred at 90 °C for 72 hrs. The reaction mixture was
concentrated to a small volume and chromatographed using
preparative TLC plates [2.50 of NH3 (2.0 M in methanol)
in CHC13] gave N- ( 3- { 1- [ 3- ( 4-chlorophenyl ) -3-
methoxypropyl]-4-piperidinyl}phenyl)-2-methylpropanamide
(39.5 mg, 73.80 yield) as a thick oil: 1H NMR 8 7.48 (S,
1 H), 7.34-7.3 (m, 2H), 7.25 (m, 4H), 6.96 (d, 1H, J=7.4
Hz), 4.20 (apparent dd, 1H, J=5.9, 7.6 Hz), 3.2 (s, 3H),
3.04 (d, 1H, J=10.1 Hz), 2.99 (d, 1H, J=10.1 Hz), 2.49
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-295-
(h, 4H, J=6.6 Hz), 2.20-2.10 (m, 4H), 1.82 (m, 4H), 1.25
(d, 6H, J=7.1 Hz); ESMS m/e: 429.4 (M + H)+.
Example 92
N-(3-{1-(6-(1,3-DIOXO-1,3-DIHYDRO-2H-ISOINDOL-2-
YL)HEXYL]-4-PIPERIDINYL}PHENYL)-2-METHYLPROPANAMIDE: The
synthetic method is the same as described for 2-[6-(4-
phenyl-1-piperidinyl)hexyl]-1H-isoindole-1,3(2H)-dione.
N-(3-{1-[6-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-
yl)hexyl]-4-piperidinyl}phenyl)-2-methylpropanamide: 506
mg (56% yield); 1H NMR (400 MHz, CDC13) 8 7.86-7.80 (m,
2H), 7.73-7.68 (m, 2H), 7.44 (s, 1H), 7.37 (d, 1H, J=8.3
Hz), 7.22 (t, 1H, J=7.7 Hz), 6.96 (d, 1H, J=7.7 Hz),
3.69 (t, 2H, J=7.2 Hz), 3.01 (apparent d, 2H, J=11.3
Hz), 2.58-2.40 (m, 2H), 2.33 (m, 2H) 1.98 (dt, 2H,
J=3.2, 11.3 Hz), 1.84-1.64 (m, 4H), 1.51 (q, 2H, J=7.1
Hz), 1.43-1.30 (m, 6H), 1.24 (d, 6H, J=6.8 Hz); ESMS
m/e: 476.4 (M + H)+.
Example 93
N- { 3- [ 1- ( 3-METHOXY-3-PHENYLPROPYL) -4-
PIPERIDINYL]PHENYL}-2-METHYLPROPANAMIDE
A mixture of 3-methoxy-3-phenyl-1-chloropropane (23.1
mg, 0.126 mmol), 2-methyl-N-[3-(4- ,
piperidinyl)phenyl]propanamide (28.3 mg, 0.126 mmol),
diisopropylethylamine (0.50 mL) and catalytic amount of
tetrabutylammonium iodide in dioxane (2.0 mL) was
stirred at 90 °C for 72 hrs. Chromatography using silica
preparative TLC plates [2.50 of NH3 (2.0 M in methanol)
in CHC13] gave N-{3-[1-(3-methoxy-3-phenylpropyl)-4-
piperidinyl]phenyl}-2-methylpropanamide (45.4 mg, 91.20
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-296-
yield) as a thick oil: 1H NMR (400 MHz, CDC13) b 7.45
(S, 1 H), 7.34-7.25 (m, 5H), 7.25 (m, 2H), 6.96 (d, 1H,
J=7.4 Hz), 4.20 (apparent dd, 1H, J=5.9, 7.6 Hz), 3.2
(s, 3H), 3.04 (d, 1H, J=10,1 Hz), 2.99 (d, 1H,
J=10.1Hz), 2.49 (apparent sept, partially hidden, 4H,
J=6.6 Hz), 2.3-2.1(m, 4H), 1.82 (m, 4H), 1.25 (d, 6H,
J=7.1 Hz); ESMS m/e: 395.4 (M + H)+.
Example 94
N-(3-{1-[4-(1,3-DIOXO-1,3-DIHYDRO-2H-ISOINDOL-2-
YL)BUTYL]-4-PIPERIDINYL}PHENYL)-2-METHYLPROPANAMIDE: The
synthetic method is the same as described for 2-[6-(4-
phenyl-1-piperidinyl)hexyl]-1H-isoindole-1,3(2H)-dione.
N-(3-{1-[4-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-
yl)butyl]-4-piperidinyl}phenyl)-2-methylpropanamide: 664
mg (74o yield); 1H NMR (400 MHz, CDC13) 8 7.87-7.78 (m,
2H), 7.76-7.64 (m, 2H), 7.47 (s, 1H), 7.39 (d, lH, J=7.6
Hz ) , 7 . 21 ( t, 1H, J=8 . 1 Hz ) , 6 . 94 ( d, 1H, J=7 . 6 Hz ) ,
3.72 (t, 2H, J=6.8 Hz), 3.37-3.22 (m, 2H), 3.0 (apparent
d, 2H, J=10.7 Hz), 2.75 (q, 2H, J=7.0 Hz), 2.64-2.33 (m,
4H), 1.99 (dt, 2H, J=2.6, 11.7 Hz), 1.86-1.65 (m, 2H),
1.63-1.50 (m, 2H), 1.23 and 1,21 (two d, 6H, J=5.5 Hz);
ESMS m/e: 448.4 (M + H)+; Anal. Calc. for
C2~H34N3C1O3+O.4H20: C, 66.'02; H, 7.14; N, 8.55. Found: C,
66.07; H, 6.78; N, 8.65.
Example 95
N-(3-{1-[4-(1,3-DIOXO-1,3-DIHYDRO-2H-ISOINDOL-2-
YL)BUTYL]-4-PIPERIDINYL}PHENYL)-2-METHYLPROPANAMIDE: The
synthetic method is the same as described for 2-[6-(4-
phenyl-1-piperidinyl)hexyl]-1H-isoindole-1,3(2H)-dione.
N-(3-{1-[5-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-
yl)pentyl]-4-piperidinyl}phenyl)-2-methylpropanamide:
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-297-
614 mg (64o yield); 1H NMR (400 MHz, CDC13) 8 7.87-7.8
(m, 2H) , 7 .76-7. 68 (m, 2H) , 7 . 48 (s, 1H) , 7 . 41 (d, 1H,
J=7.6 Hz), 7.21 (t, 1H, J=7.6 Hz), 6.95 (d, 1H, J=7.6
Hz), 3.69 (t, 2H, J=7.2 Hz), 3.39-3.28 (m, 2H), 3.02
(apparent d, 2H, J=11.6 Hz), 2.78 (q, 2H, J=7.2 Hz),
2.64-2.52 (m, 1H), 2.52-2.40 (m, 1H), 2.40-2.31 (m, 2H),
2.01 (dt, 2H, J=3.7, 11.1 Hz), 1.85-1.64 (m, 2H), 1.58
(q, 2H, J=7.6 Hz), 1.45-1.32 (m, 2H), 1.23 (d, 6H, J=6.9
Hz); ESMS m/e: 462.4 (M + H)*; Anal. Calc. for
1O CZBH36N3C1O3: C, 67.52; H, 7.29; N, 8.44. Found: C, 67.04;
H, 7.06; N, 8.38.
Example 96 ,
2-METHYL-N-{3-[1-(4-PHENYLBUTYL)-4-
PIPERIDINYL]PHENYL}PROPANAMIDE
A mixture of 2-methyl-N-[3-(4-
piperidinyl)phenyl]propanamide (28.3 mg, 0.100 mmol), 4-
phenyl-1-chlorobutane (21.1 mg, 0.125 mmol),
diisopropylethylamine (0.50 mL), catalytic amount of
tetrabutylammonium iodide and dioxane (2.0 mL) was
heated at reflux temperature for 3 days. The reaction
mixture was concentrated and chromatographed using
preparative TLC plates [2.50 of NH3 (2.0 M in methanol)
in CHC13] afforded the product, 2-methyl-N-{3-[1-(4'-
phenylbutyl)-4-piperidinyl]phenyl}propanamide (9.50 mg,
25.10 yield) as a thick oil: 1H NMR 8 7.37 (s, 1H), 7.29
(apparent d, 1H, J=7.9 Hz), 7.18 (m, 3H), 7.11 (m, 3H),
6.90 (apparent d, 1H, J=7.9 Hz), 3.02 (d, 2H, J=6.8 Hz),
2.41 (m, 4H, partially hidden), 2.01 (m, 2H), 1.78 (m,
4H) , 1.57 (m, 4H) , 1. 18 (d, 6H, J=7 .7 Hz) ; ESMS m/e:
379.4 (M + H)+.
Example 97
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-298-
N-(3-{1-[3-(1,3-DIOXO-1,3-DIHYDRO-2H-ISOINDOL-2-
YL)PROPYL]-4-PIPERIDINYL}PHENYL)-2-METHYLPROPANAMIDE:
The synthetic method is the same as described for 2-[6-
(4-phenyl-1-piperidinyl)hexyl]-1H-isoindole-1,3(2H)-
dione.
N-(3-{1-[3-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-
yl)propyl]-4-piperidinyl}phenyl)-2-methylpropanamide:
810 mg (93o yield); 1H NMR (400 MHz, CDC13) 8 7.87-7.82
(m, 2H), 7.73-7.68 (m, 2H), 7.57 (s, 1H), 7.36 (d, 1H,
J=8.5 Hz), 7.18 (t, 1H, J=7.7 Hz), 6.79 (d, 1H, J=7.1
Hz), 3.78 (t, 2H, J=6.8 Hz), 3.06 (quintet, 2H, J=6 Hz),
2.95 (apparent d, 2H, J=12.2 Hz), 2.58-2.31 (m, 4H),
1.96-1.83 (m, 2H), 1.70 (apparent d, 2H, J=12.1 Hz),
1.52 (dt, 2H, J=3.5, 12.5 Hz) , 1.03 (d, 6H, J=6.5 Hz) ;
ESMS m/e: 434.4 (M + H)+.
Example 98
N-(3-{1-[(3S)-3-HYDROXY-3-PHENYLPROPYL]-4-
PIPERIDINYL}PHENYL)-2-METHYLPROPANAMIDE
A mixture of (S)-(-)-3-chloro-1-phenyl-1-propanol (0.426
g, 2.50 mmol, 99oee), 2-methyl-N-[3-(4-
piperidinyl)phenyl]propanamide (0.565 g, 2.00 mmol),
diisopropylethylamine (1.29 g, 10.0 mmol), dioxane (5.0
mL) and catalytic amount of tetrabutylammonium iodide
was stirred at 90 °C for 72 his. Chromatography using
silica preparative TLC plates [2.50 of NH3 (2.0 M in
methanol) in CHC13] gave the desired product (306 mg,
39.3 o yield) as a thick oil: 1H NMR (400 MHz, CDC13) 8
7.46 (S, 1 H), 7.42 (d, 4H, J=8.1 Hz), 7.35 (m, 1 H),
7.30 (d, 1 H, J=8.0 Hz), 7.23 (t, 1H, J=8.1 Hz), 7.12
(s, 1H), 6.96 (apparent dd, 1H, J=8.O Hz), 5.0 (apparent
dd, 1H, J=4.4, 8.3 Hz), 3.18 (apparent dd, 2H, J=2.5,
12.5 Hz), 2.74 (m, 2 H), 2.50 (m, 2H), 2.3-2.1 (m, 6H),
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-299-
1.8 (m, 2H), 1.25 (d, 6H, J=7.1 Hz); ESMS m/e: 389.2 (M
+ H)+.
Example 99
N- (3-{ 1- [3-METHOXY-3- (4-METHYLPHENYL) PROPYL] -4-
PIPERIDINYL}PHENYL)-2-METHYLPROPANAMIDE
A mixture of 3-methoxy-3-(p-tolyl)-1-chloropropane
(24.9 mg, 0.126 mmol), 2rmethyl-N-[3-(4-
piperidinyl)phenyl]propanamide (28.3 mg, 0.126 mmol),
diisopropylethylamine (0.50 mL) and catalytic amount of
tetrabutylammonium iodide in dioxane (2.0 mL) was
stirred at 90 °C for 72 hrs. Chromatography using silica
preparative'TLC plates [2.50 of NH3 (2.0 M in methanol)
in CHC13] gave the desired product (10.9 mg, 21.2 0
yield) as a thick oil: 1H NMR (400~MHz, CDC13) 8 7.44
(s, 1 H), 7.38 (m, 1H), 7.3-7.1 (m, 5 H), 6.96 (d, 1H,
J=7.4 Hz), 4.18 (apparent dd, 1H, J=5.6, 7.9 Hz), 3.24
(d, 1H, J=8 .2 Hz) , 3.2 (s, 3H) , 3.11 (m, 2H, J=10. 1Hz) ,
2.49 (m, 4H), 2.35 (s, 3H), 2.3-2.1(m, 3H), 1.92 (d,
4H), 1.25 (d, 6H, J=7.1 Hz); ESMS m/e: 409.4 (M + H)+.
Example 100
N-{3-[1-(3-ISOPROPOXY-3-PHENYLPROPYL)-4-
PIPERIDINYL]PHENYL}-2-METHYLPROPANAMIDE
A mixture of 3-isopropyl-3'-phenyl-1-chloropropane (26.6
mg, 0 . 12 6 mmol ) , 2-methyl-N- [ 3- ( 4-
piperidinyl)phenyl]propanamide (28.3 mg, 0.126 mmol),
diisopropylethylamine (0.50 mL) and catalytic amount of
tetrabutylammonium iodide in dioxane (2.0 mL) was
stirred at 90 °C for 72 hrs. Chromatography using silica
preparative TLC plates [2.50 of NH3 (2.0 M in methanol)
in CHC13] gave the desired product (14.1 mg, 26.50 yield)
as a thick oil: 1H NMR (400 MHz, CDC13) ~ 7.46 (s, 1H),
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-300-
7.43-7.37 (m, 2H), 7.33 (m, 3H), 7.23 (m, 2H), 6.95 (d,
1H, J=8.4 Hz), 4.46 (apparent dd, 1H, J=5.0, 8.3 Hz),
3.49 (apparent sept, 1H, J=7.1 Hz), 3.10 (s, 2H)~ 2.70
(m, 2H), 2.52 (apparent sept, partially hidden, 4H,
J=6.6 Hz), 2.30-2.10 (m, 2H), 1.90-1.80 (d, 4H), 1.25
(d, 6H, J=7.1 Hz) , 1.15 (d, 3H, J=6.4 Hz) , 1.08 (d, 3H,
J=6.4 Hz); ESMS m/e: 423.4 (M + H)~.
Example 101
N-(3-{1-[4,4-BIS(4-FLUOROPHENYL)BUTYL]-4'
PIPERIDINYL}PHENYL)-2-METHYLPROPANAMIDE
A mixture of 4,4-bis(4-fluoro-phenyl)-1-chloro-butane
(39.0 mg, 0:126 mmol), 2-methyl-N-[3-(4-
piperidinyl)phenyl]propanamide (28.3 mg, 0.126 mmol),
diisopropylethylamine (0.50 mL) and catalytic amount of
tetrabutylammonium iodide in dioxane (2.0 mL) was
stirred at 90 °C for 72 hrs. Chromatography using silica
preparative 2'LC plates [2.50 of NH3 (2.0 M in methanol)
in CHC13] gave the desired product (15.9 mg, 25.2 0
yield) as a thick oil: 1H NMR (400 MHz, CDC13) 8 8.02 (s,
1H), 7.41 (s, 1H), 7.3-7.15 (m, 4H), 7.10 (m, 3H), 6.89
(apparent t, 5H), 3.81 (t, 1H, J=7.8 Hz), 3.30 (s, 1H),
2. 91 (d, 1H, J=12, 5 Hz) , ~2 . 80 (m, 1H) , 2. 40 (m, 2H) ,.f
2.31 (t, 1H, J=8.0 Hz), 1.93 (apparent q, 3H, J=8.0 Hz),
1.72 (m, 3H), 1.40 (m, 2H), 1.20 (m, 2H), 1.15 (d, 6H,
J=8.1 Hz); ESMS m/e: 491.4 (M + H)+
EXAMPLE 102
N-{3-[1-(3-METHOXYBENZYL)-4-PIPERIDINYL]PHENYL}-2-
METHYLPROPANAMIDE
A mixture of 2-methyl-N-[3-(4-
piperidinyl)phenyl]propanamide (28.3 mg, 0.100 mmol), 3-
methoxybenzyl chloride (19.6 mg, 0.125 mmol),
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-30l-
diisopropylethylamine (0.50 mL), catalytic amount of
tetrabutylammonium iodide and dioxane (2.0 mL).
Chromatography using silica preparative TLC plates [2.5o
of NH3 (2.0 M in methanol) in CHC13] afforded the desired
product (10.2 mg, 27.90 yield) as a yellow solid: 1H NMR
(400 MHz, CDC13) ~ 7.46 (s, 1H), 7.35 (apparent d, 1H,
J=8.3 Hz), 7.27-7.21 (m, 2H), 6.95 (apparent t, 3H,
J=6.9 Hz), 6.82 (apparent dd, 1H, J=2.4, 8.3 Hz), 3.84
(m, 3H), 3.56 (s, 2H), 3.05 (d, 2H, J=10.5 Hz), 2.51
(apparent sept, partially hidden, 4H, J=7.2 Hz), 2.13
(apparent t, 2H, J=9.7 Hz), 1.88 (m, 2H), 1.25 (d, 6H,
J=6.7 Hz); ESMS m/e: 367.3 (M + H)+.
Example 103
N-(3-(1-[3,5-BIS(TRIFLUOROMETHYL)BENZYL]-4-
PIPERIDINYL}PHENYL)-2-METHYLPROPANAMIDE
A mixture of 2-methyl-N-[3-(4-
piperidinyl)phenyl]propanamide (28.3 mg, 0.100 mmol),
3,5-bis(trifluoromethyl)benzyl bromide (38.4 mg, 0.125
mmol), diisopropylethylamine (0.50 mL), catalytic amount
of tetrabutylammonium iodide and dioxane (2.0 mL).
Chromatography using silica preparative TLC plates [2.50
of NH3 (2.0 M in methanol) in CHC13] gave the desired
product (12.2 mg, 25.80 yield) as a thick oil: ~H NMR
(400 MHz, CDC13) 8 7.83 (s, 2H), 7.77 (s, 1H), 7.53 (s,
1H), 7.30-7.21 (m, 2H), 7.16 (s, 1H), 6.98 (apparent d,
1H, J=7.6 Hz), 3.62 (s, 2H), 2.94 (d, 2H, J=9.4 Hz),
2.51 (apparent sept, partially hidden, 2H, J=6.6 Hz),
2.14 (m, 2H), 1.82 (m, 4H), 1.25 (d, 6H, J=6.6 Hz); ESMS
m/e: 473.2 (M + H)+.
Example 104
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-302-
N- (3-{ 1- [ (3R) -3- (3, 4-DIMETHOXYPHENOXY) -3-PHENYLPROPYL] -
4-PIPERIDINYL}PHENYL)-2-METHYLPROPANAMIDE
Method A
4-{[(1R)-3- chloro-1-phenylpropyl]oxy}-1,2-
dimethoxybenzene:
A mixture of 3,4-dimethoxyphenol (4.07 g, 26.4 mmol),
(S)-(-)-3-chloro-phenyl-1-propanol (4.50 g, 26.4 mmol,
99oee, Aldrich Chemical Co.), triphenylphosphine (6.92
g, 26.4 mmol) and diethyl azodicarboxylate (4.59 g, 26.4
mmol) in THF (110 mL) was stirred at room temperature
for 24 h. The reaction mixture was concentrated in
vacuo.
At this point, the residue can either be washed with
pentane (x3) and the combined pentane extracts were
concentrated and chromatographed (silica with hexanes-
EtOAc 8:1 as the eluent) to give the desired product (as
described as a general procedure by: Srebnik, M.;
Ramachandran, P.V.; Brown, H.C. J. Org. Chem. 1988, .53,
2916-2920). This procedure was performed on a smaller
scale reaction and only a 40o yield of the product was
realized.
Alternatively, on a larger scale (26.4 mmol), the cr.~ide
product was triturated with a small amount of
dichloromethane and the precipitated triphenylphosphine
oxide was filtered. The filtrate was concentrated and
the crude product was chromatographed to give the
desired product as a thick yellow oil (7.30 g, 88.9
yield) : 1H NMR (400 MHz, CDC13) b 7.39-7.32 (m, 4H) , 7.20
(m, 1H) , 6. 64 (d, 1H, J=8 .7 Hz) , 6.51 (d, 1H, J=2.7 Hz) ,
6.30 (dd, 1H, J=2.7, 8.7 Hz), 5.27 (apparent dd, 1H,
J=4.5, 8.7 Hz), 3.79 (s,~3H), 3.77 (s, 3H), 3.61 (m,
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-303-
1H), 2.45 (m, 1 H), 2.20 (m, 1H), 1.80 (s, 1H); ESMS
m/e: 307.11 (M+H)+.
N- (3-{ 1- [ (3R) -3- (3, 4-DIMETHOXYPHENOXY) -3-PHENYLPROPYL] -
4-PIPERIDINYL}PHENYL)-2-METHYLPROPANAMIDE: A mixture of
potassium carbonate (321 mg, 2.32 mmol), sodium iodide
(522 mg, 3.48 mmol), 2-methyl-N-[3-(4-
piperidinyl)phenyl]propanamide (570 mg, 2.32 mmol) and
4-{[(1R)-3-chloro-1-phenylpropyl]oxy}-1,2-
dimethoxybenzene (712 mg, 2.32 mmol) in DMF (5.0 mL) was
stirred at 100 °C for 3 hrs, at which time TLC indicated
that the reaction was complete. The reaction mixture
was poured into water (50 mL) and the aqueous layer was
extracted with methylene chloride (3x30 mL). The
combined organic extracts were washed with brine (30
mL), dried over MgSOQ and concentrated under reduced
pressure. The crude product was purified by Prep-TLC
plates [2.50 of NH3 (2.0 M in methanol) in CHC13] to
afford the product (970 mg, 90.10) as a thick oil.
Method B
Into a 25-mL RB-flask was added triphenylphosphine (9.80
mg, 0.0375 mmol), diethyl azodicarboxylate (5.22 mg,E.
0.0300 mmol.), N-(3-{1-[(3S)-3-hydroxy-3-phenylpropyl]-4-
piperidinyl}phenyl)-2-methylpropanamide (9.53 mg, 0.0250
mmol), 3,4-dimethoxyphenol (7.70 mg, 0.050 mmol) and THF
(1.0 mL) at room temperature. The reaction mixture was
stirred at room temperature overnight (16 hrs). The
solvent was removed under reduced pressure and the
residue was purified by preparative TLC plates [2.50 of
NH3 (2.0 M in methanol) in CHC13] to afford the desired
product (4.4 mg, 34.1 o yield) as a thick oil: 1H NMR
(400 MHz, CDC13) 8 7.46 (s, 1 H), 7.40-7.30 (m, 4H),
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-304-
7.25 (m, 3H), 6.97 (d, 1H, J=7.8 Hz), 6.64 (d, 1H, J=9.1
Hz) , 6.51 (d, 1H, J=2. 6 Hz) , 6.29 (d, 1H, J=2. 6; 9. 1
Hz), 5.20 (apparent dd, 1H, J=4.4, 8.5 Hz), 3.80 (s,
3H), 3.77 (s, 3H), 3.23 (m, 2H), 2.77 (m, 2 H), 2.5 (m,
2H), 2.3-2.1(m, 6H), 1.80 (m, 2H), 1.25 (d, 6H, J=7.9
Hz); ESMS m/e: 517.4 (M + H)+.
Example 105
2-METHYL-N- (3-{ 1- [ (3S) -3-PHENOXY-3-PHENYLPROPYL} -4-
PIPERIDINYL}PHENYL)PROPANAMIDE
A mixture of N-(3-{1-[(3R)-3-hydroxy-3-phenylpropyl]-4-
piperidinyl}phenyl)-2-methylpropanamide (9.53 mg, 0.0250
mmol), phenol (4.70 mg, 0.050 mmol), triphenylphosphine
(9.80 mg, 0.0375 mmol) and diethyl azodicarboxylate
(5.22 mg, 0.0300 mmol) in THF (1.0 mL) was stirred at
room temperature for 3 days. Chromatography using
silica preparative TLC plates [2.5o of NH3 (2.0 M in
methanol) in CHC13] gave the desired product (2.7 mg,
23.6 o yield) as a thick oil: 1H NMR 8 7.46 (s, 2H),
7.40-7.30 (m, 4H), 7.25 (m, 3 H), 7.20 (m, 2H), 6.97
(apparent d,~lH, J=7.4 Hz), 6.89 (apparent tt, 1H,
J=0.8, 7.6 Hz), 6.84 (apparent dt, 1H, J=0.8, 8.0 Hz),
5.20 (apparent dd, 1H, J=4.4, 8.5 Hz), 3.35 (m, 2H),f
2.91 (m, 2H), 2.60 (m, 2H), 2.30-2.10 (m, 6H), 1,90 (m,
2H), 1.25 (d, 6H, J=7.9 Hz); ESMS m/e: 457.4 (M + H)+;
Example 106
N-(3-{1-[(3S)-3-(4-METHOXYPHENOXY)-3-PHENYLPROPYL]-4-
PIPERIDINYL}PHENYL)-2-METHYLPROPANAMIDE
A mixture of N-(3-{1-[(3R)-3-hydroxy-3-phenylpropyl]-4-
piperidinyl}phenyl)-2-methylpropanamide (9.53 mg, 0.0250
mmol), 4-methoxyphenol (6.20 mg, 0.050 mmol),
triphenylphosphine (9.80 mg, 0.0375 mmol) and diethyl
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-305-
azodicarboxylate (5.2 mg, 0.0300 mmol) in THF (1.0 mL)
was stirred at room temperature for 3 days.
Chromatography using silica preparative TLC plates [2.50
of NH3 (2.0 M in methanol) in CHC13] gave the desired
product (4.6 mg, 37.9 o yield) as a thick oil. 1H NMR
(400 MHz, CDC13) 8 7.38-7.14 (m, 8H), 6.90 (apparent d,
1H, J=7.7 Hz), 6.72-6.46 (m, 4H), 5.09 (apparent dd, 1H,
J=4.8, 8.1 Hz), 3.64 (s, 3H), 3.18 (m, 2H), 2.73 (m,
2H), 2.50 (m, 2H), 2.37-1.72 (m, 8H), 1.25 (d, 6H, J=7.4
Hz); ESMS m/e: 487.4 (M + H)+.
Example 107
N-(3-{1-[(3S)-3-(3-CHLOROPHENOXY)-3-PHENYLPROPYL]-4-
PIPERIDINYL}PHENYL)-2-METHYLPROPANAMIDE A mixture
of N-(3-{1-[(3R)-3-hydroxy-3-phenylpropyl]-4-
piperidinyl}phenyl)-2-methylpropanarnide (9.53 mg, 0.0250
mmol), 3-chlorophenol (6.40 mg, 0.050 mmol),
triphenylphosphine (9.80 mg, 0.0375 mmol) and diethyl
azodicarboxylate (5.22 mg, 0.0300 mmol) in THF (1.0 mL)
was stirred at room temperature for 3 days.
Chromatography using silica preparative TLC plates [2.50
of NH3 (2.0 M in methanol) in CHC13] gave the desired
product (4.9 mg, 40.0 o yield) as a thick oil: 1H NMI~.
(400 MHz, CDC13) 8 7.39 (s, 1H), 7.35-7.10 (m, 7H), 7.02
(t, 1H, J=8.0 Hz), 6.90 (d, 1H, J=7.6 Hz), 6.84-6.75 (m,
2H), 6.65 (m, 1H), 5.09 (apparent dd, 1H, J=4.99,,8.1
Hz), 3.10 (m, 2H), 2.60 (m, 2H), 2.50 (m, 2H), 2.30-1.70
(m, 8H) , 1.18 (d, 6H, J=6.8 Hz) ; ESMS m/e: 491.4 (M +
H)+.
Example 108
N-(3-{1-[(3S)-3-(4-CHLOROPHENOXY)-3-PHENYLPROPYL]-4-
PIPERIDINYL}PHENYL)-2-METHYLPROPANAMIDE
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-306-
A mixture of N-(3-{1-[(3R)-3-hydroxy-3-phenylpropyl]-4-
piperidinyl}phenyl)-2-methylpropanamide (9.53 mg, 0.0250
mmol), 4-chlorophenol (6.40 mg, 0.050 mmol),
triphenylphosphine (9.80 mg, 0.0375 mmol) and diethyl
azodicarboxylate (5.22 mg, 0.0300 mmol) in THF (1.0 mL)
was stirred at room temperature for 3 days.
Chromatography using silica preparative TLC plates [2.50
of NH3 (2.0 M in methanol) in CHC13] gave the desired
product (3.3 mg, 26.9 o yield) as a thick oil: 1H NMR 8
7.36 (s, 1H), 7.35-7.22 (m, 7H), 7.12 (m, 2H), 6.97
(apparent d, 1H, J=7 .2 Hz) , 6.77 (m, 2H) , 5.23 (m, 1H) ,
. 3.18 (m, 2H), 2.70 (m, 2H), 2.50 (m, 2H), 2.40-1.80 (m,
8H), 1.25 (d, 6H, J=6.8 Hz); ESMS m/e: 491.4 (M + H)*.
Example 109
2-METHYL-N- [3- (1-{ (3S) -3-PHENYL-3- [4-
(TRIFLUOROMETHYL) PHENOXY] PROPYL}-4-
PIPERIDINYL)PHENYL]PROPANAMIDE
A mixture of N-(3-{1-[(3R)-3-hydroxy-3-phenylpropyl]-4-
piperidinyl}phenyl)-2-methylpropanamide (9.53 mg, 0.0250
mmol), 4-trifluoromethylphenol (8.100 mg, 0.050 mmol),
triphenylphosphine (9.8 mg, 0.0375 mmol) and. diethyl
azodicarboxylate (5.22 mg, 0.0300 mmol) in THF (1.0 mL)
was stirred at room temperature for 3 days. '
Chromatography using silica preparative TLC plates [2.5%
of NH3 (2.0 M in methanol) in CHC13] gave the desired
product (5.10 mg, 38.9 % yield) as a thick oil: 1H NMR 8
8.06 (s, 1H), 7.49 (s, 1H), 7.44 (apparent d, 2H, J=.6
Hz), 7.38-7.30 (m, 4H), 7.30-7.20 (m, 3H), 6.96
(apparent d, 1H, J=7.6.Hz), 6.91 (apparent d, 2H, J=8.6
Hz), 5.34 (m, 1H), 3.19 (m, 2H), 2.72 (m, 2H), 2.53 (m,
2H), 2.40-1.80 (m, 8H), 1.25 (d, 6H, J=6.8 Hz); ESMS
m/e: 525.4 (M + H)+.
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-307-
Example 1~0
N-(3-{1-[(3R)-3-(2,5-DIFLUOROPHENOXY)-3-PHENYLPROPYL]-4-
PIPERIDINYL}PHENYL)-2-METHYLPROPANAMIDE
A mixture of N-(3-{1-[(3R)-3-hydroxy-3-phenylpropyl]-4-
piperidinyl}phenyl)-2-methylpropanamide (9.53 mg, 0.0250
mmol), 2,5-difluorophenol (6.50 mg, 0.050 mmol),
triphenylphosphine (9.80 mg, 0.0375 mmol) and diethyl
azodicarboxylate (5.22 mg, 0.0300 mmol) in THF (1.0 mL)
was stirred at room temperature for 3 days.
Chromatography using silica preparative TLC plates [2.5%
of NH3 (2.0 M in methanol) in CHC13] gave the desired
product (3.60 mg, 29.3 o yield) as a thick oil: 1H NMR 8
7.46 (s, 1H), 7.40-7.32 (m, 4H), 7.31-7.20 (m, 2H), 7.17
(s, 1H), 7.01-6.92 (m, 2H), 6.65-6.42 (m, 2H), 5.27 (m,
1H), 3.13 (m, 2H), 2.64 (m, 2H), 2.51 (m, 2H), 2.28-1.80
(m, 8 H), 1.25 (d, 6H, J=7.1 Hz); ESMS m/e: 493.4 (M +
H)+.
Example 111
N-(3-{1-((3R)-3-(3,4-DICHLOROPHENOXY)-3-PHENYLPROPYL]-4-
PIPERIDINYL}PHENYL)-2-METHYLPROPANAMIDE
A mixture of N-(3-{1-[(3S)-3-hydroxy-3-phenylpropyl]~t4-
piperidinyl}phenyl)-2-methylpropanamide (9.53 mg, 0.0250
mmol), 3,4-dichlorophenol (8.20 mg, 0.050 mmol),
triphenylphosphine (9.80 mg, 0.0375 mmol) and diethyl
azodicarboxylate (5.22 mg, 0.0300 mmol) in THF (1.0 mL)
was stirred at room temperature for 3 days.
Chromatography using silica preparative TLC plates [2.50
of NH3 (2,0 M in methanol) in CHC13] gave the desired
product (5.20 mg, 39.7 o yield) as a thick oil: 1H NMR S
7.70-7.63 (m, 2H), 7.55 (m, 1H), 7.47-7.43 (m, 3H),
7.40-7.19 (m, 3H), 7.00-6.50 (m, 2H), 6.69 (dd, 1H,
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-308-
J=2.2, 8.8 Hz), 5.25 (m, 1H), 3.20 (m, 2H), 2.70 (m,
2H), 2.53 (m, 2H), 2.40-2.20 (m, 4H), 2.10-1.80 (m, 4H),
1 .25 (d, 6H, J=7 . 1 Hz) ; ESMS m/e: 525. 4 (M +' H) i~.
Example 112
2-METHYL-N-(3-(1-[(3R)-3-PHENOXY-3-PHENYLPROPYL]-4-
PIPERIDINYL}PHENYL)PROPANAMIDE
A mixture of N-(3-{1-[(3S)-3-hydroxy-3-phenylpropyl]-4-
piperidinyl}phenyl)-2-methylpropanamide (9.53 mg, 0.0250
mmol), phenol (4.70 mg, 0.050 mmol), triphenylphosphine
(9.80 mg, 0.0375 mmol) and diethyl azodicarboxylate
(5.22 mg, 0.0300 mmol) in THF (1.0 mL) was stirred at
room temperature for 3 days. Chromatography using
silica preparative TLC plates [2.50 of NH3 (2.0 M in
methanol) in CHC13] gave the desired product (4.1 mg,
36.0 o yield) as a thick oil: 1H NMR (400 MHz, CDC13) 8
7.45 (s, 1H), 7.40-7.15 (m, 10H), 6.97 (d, 1H, J=7.6
Hz), 6.88-6.82 (m, 2H), 5.26 (m, 1H), 3.18 (m, 2H), 2.75
(m, 2H), 2.53 (m, 2H), 2.40-2.10 (m, 4H), 2.10-1.80 (m,
4H), 1.25 (d, 6H, J=6.9 Hz); ESMS m/e: 457.4 (M + H)+.
Example 113
N-(3-(1-[(3R)-3-HYDROXY-3-PHENYLPROPYL]-4-
PIPERIDINYL}PHENYL)-2-METHYLPROPANAMIDE
Method A
Into a 25-mL RB-flask was added (R)-(+)-3-chloro-1-
phenyl-1-propanol (0.545 g, 3.19 mmol, 99oee, Aldrich
Chemical Co.), 2-methyl-N-[3-(4-
piperidinyl)phenyl]propanamide (0.748 g, 3.04 mmol),
potassium carbonate (0.420 g, 3.04 mmol) and sodium.
iodide (0.684 g, 4.56 mmol) and DMF (6.0 mL) at room
temperature. After stirring at 100 °C for 3 hrs, the TLC
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-309-
showed the reaction was complete. The reaction mixture
was poured into water (50 mL) and the aqueous layer was
extracted with methylene.chloride (3x20 mL). The
combined organic extracts were washed with brine (20
mL), dried over Na~SOQ and concentrated under reduced
pressure. The residue was purified by flash
chromatography (1:1= hexane: ethyl acetate with 1%
isopropylamine) to afford the desired product (1.09 g,
94.3 % yield) as light-yellow solid: 1H NMR (400 MHz,
CDC13) 8 8.10 (s, 1H), 7.46-7.35 (m, 6H), 7.27 (m, 2H),
6.98 (apparent d, 1H, J=7.6 Hz), 5.02 (apparent dd, 1H,
J=4.4, 8.1 Hz), 3.18 (apparent dd, 2H, J=2.5, 12.5 Hz),
2 .74 (m, 2 H) , 2.50 (m, 2H) , 2.30-2 . 10 (m, 6H) , 1 . 80 (m,
2H), 1.25 (d, 6H, J=7.1 Hz); ESMS m/e: 381.2 (M + H)+.
The hydrochloric salt was prepared by addition of a
slight excess of 1 N HCl.in ether (1.2 eq.) to a
solution of the free base in dichloromethane. The
solvent was removed under reduced pressure, the residue
was washed with ether and dried under reduced pressure:
Anal. Calc. for C24H~2Nz0~+HCl+0.8H~0: C, 66.82; H, 8.08;
N, 6.49; Cl, 8.22. Found: C, 66.90; H, 7.78; N, 6.63;
C1, 8.52.
Method B
Into a 25-mL RB-flask was added (R)-(+)-3-chloro-1-
phenyl-1-propanol (0.426 g, 2.50 mmol), 2-methyl-N-[3-
(4-piperidinyl)phenyl]propanamide (0.565 g, 2.00 mmol),
diisopropylethylamine (1.29 g, 10.0 mmol), dioxane (5.0
mL) and catalytic amount of tetrabutylammonium iodide at
room temperature. After stirring at 90 °C for 72 hrs,
the reaction mixture was poured into water (50 mL) and
the aqueous layer was extracted with methylene chloride
(3x20 mL). The combined organic extracts were washed
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-310-
with brine (20 mL), dried over Na2S04 and concentrated
under reduced pressure. The residue was purified by
preparative TLC plates
(1:5:100=isopropylamine:methanol:ethyl acetate) to
afford the desired product (0.260 g, 34.2 o yield) as
light-yellow solid.
Example 114
N-(3-{1-[(3S)-3-(4-cyanophenoxy)-3-phenylpropyl]-4-
piperidinyl}phenyl)-2-methylpropanamide
A mixture of N-(3-{1-[(3R)-3-hydroxy-3-phenylpropyl]-4-
piperidinyl}phenyl)-2-methylpropanamide (5.20 mg, 0.0137
mmol), 4-cyanophenol (100 mg), triphenylphosphine (30.0
mg, 0.115 mmol) and diethyl azodicarboxylate (7.42 mg,
0.0426 mmol) in THF (0.50 mL) was stirred at room
temperature for 3 days. Chromatography using silica
preparative TLC plates [2.50 of NH3 (2.0 M in methanol)
in CHC13] gave the desired product (4.70 mg, 71.3
yield) as a thick oil: 1H NMR (400 MHz, CDC13) 8 7.54
(m, 2H), 7.48 (d, 2H, J=$.4 Hz), 7.30-7.20 (m, 3H), 7.20
(m, 3H), 6.97 (apparent d, 1H, J=8.4 Hz), 6.92 (apparent
d, 2H, J=8.4 Hz), 5.36 (apparent dd, 1H, J=3.9, 7.6 Hz),
3.12 (m, 2H), 2.61 (m, 2H), 2.53 (apparent sept,
partially hidden, 2H, J=7.6 Hz), 2.30-2.10 (m, 6H), 1.82
(m, 2H) , 1.25 (d, 6H, J=6.8 Hz) ; ESMS m/e: 482.2 (Ni +
H)~.
Example 115
N-(3-(1-[(3S)-3-(4-FLUOROPHENOXY)-3-PHENYLPROPYL]-4-
PIPERIDINYL}PHENYL)-2-METHYLPROPANAMIDE
A mixture of N-(3-{1-[(3R)-3-hydroxy-3-phenylpropyl]-4-
piperidinyl}phenyl)-2-methylpropanamide (5.20 mg, 0.0137
mmol), 4-fluorophenol (100 mg), triphenylphosphine (30.0
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-311-
mg, 0.115 mmol) and diethyl azodicarboxylate (7.42 mg,
0.0426 mmol) in THF (0.50 mL) was stirred at room
temperature for 3 days. Chromatography using silica
preparative TLC plates [2.50 of NH3 (2.0 M in methanol)
in CHC13] gave the desired product (4.20 mg, 64.70 yield)
as a thick oil: 1H NMR (400 MHz, CDC13) 8 7.40 (m, 2H) ,
7.30-7.20 (m, 5H), 7.20 (m, 3H), 6.97 (apparent d, 1H,
J=7 . 7 Hz) , 6. 87 (m, 1H) , 6.76 (m, 1H) , 5.26 (apparent
dd, 1H, J=4.0, 8.1 Hz), 3.09 (m, 2H), 2.66 (m, 2H), 2.51
(m, 2H) , 2 . 3-2 . 1 (m, 6H) , 1 . 82 (m, 2H) , 1 .25 (d, 6H,
overlapped); ESMS m/e: 475.2 (M + H)+.
Example 116,
N- (3-( 1- [ (3S) -3- (4-BROMOPHENOXY) -3-PHENYLPROPYL] -4-
PIPERIDINYL}PHENYL)-2-METHYLPROPANAMIDE
A mixture of N-(3-{1-[(3R)-3-hydroxy-3-phenylpropyl]-4-
piperidinyl}phenyl)-2-methylpropanamide (5.20 mg, 0.0137
mmol), 4-bromophenol (100 mg), triphenylphosphine (30.0
mg, 0.115 mmol) and diethyl azodicarboxylate (7.42 mg,
0.0426 mmol) in THF (0.50 mL) was stirred at room
temperature for 3 days. Chromatography using silica
preparative TLC plates [2.50 of NH3 (2.0 M in methanol)
in CHC13] the desired product (0.70 mg, 9.6o yield) as a
f
thick oil: 1H NMR (400 MHz, CDC13) 8 8.06 (s, 1H), 7.48
(m, 2H), 7.30-7.20 (m, 5H), 7.20 (m, 3H), 6.97 (apparent
d, 1H, J=8.5 Hz), 6.73 (apparent d, 2H, J=8.5 Hz), 5.22
(apparent dd, 1H, J=4.9, 7.8 Hz), 3.15 (m, 2H), 2.65 (m,
2H), 2.51 (apparent sept, partially hidden, 2H, J=7.6
Hz), 2.30-2.10 (m, 6H), 1.82 (m, 2H), 1.25 (d, 6H, J=6.8
Hz); ESMS m/e: 535.1 (M + H)+.
Example 117
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-312-
N-(3-{1-[(3S)-3-(3-METHOXYPHENOXY)-3-PHENYLPROPYL]-4-
PIPERIDINYL}PHENYL)-2-METHYLPROPANAMIDE
A mixture of N-(3-{1-[(3R)-3-hydroxy-3-phenylpropyl]-4-
piperidinyl}phenyl)-2-methylpropanamide (5.20 mg, 0.0137
mmol), 3-methoxyphenol (100 mg), triphenylphosphine
(30.0 mg, 0.115 mmol) and diethyl azodicarboxylate (7.42
mg, 0.0426 mmol) in THF (0.50 mL) was stirred at room
temperature for 3 days. Chromatography using silica
preparative TLC plates [2.50 of NH3 (2.0 M in methanol)
in CHC13] gave the desired product (3.1 mg, 46.6 o yield)
as a thick oil: 1H NMR (400 MHz, CDC13) b 7.47 (d, 1H,
J=6.7 Hz), 7.42 (s, 1H), 7.3-7.20 (m, 3H), 7.20 (m, 3H),
7.07 (t, 1H, J=8.4 Hz) , 6. 97 (apparent d, 1H, J=6.7 Hz) ,
6.40 (m, 3H), 5.27 (apparent dd, 1H, J=5.3, 8.0 Hz),
3.74 (s, 3H) , 3.38 (m, .2H) , 2. 93 (m, 2H) , 2. 61 (s, 1H) ,
2.53 (apparent sept, partially hidden, 1H, J=6.5 Hz),
2 . 30-2 . 10 (m, 6H) , 1 . 82 (m, 2H) , 1 . 25 (d, 6H, J=6. 9 Hz ) ;
ESMS m/e: 487 . 3 (M + H) +.
Example 118
N-(3-{1-[(3S)-3-(4-CYANO-2-METHOXYPHENOXY)-3-
PHENYLPROPYL]-4-PIPERIDINYL}PHENYL)-2-METHYLPROPANAMIDE
A mixture of N-(3-{1-[(3R)-3-hydroxy-3-phenylpropyl]-4-
f
piperidinyl}phenyl)-2-methylpropanamide (5.20 mg, 0.0137
mmol), 2-methoxy-4-cyanophenol (100 mg),
triphenylphosphine (30.0 mg, 0.115 mmol) and diethyl
azodicarboxylate (7.42 mg, 0.0426 mmol) in THF (0.50 mL)
was stirred at room temperature for 3 days.
Chromatography using silica preparative TLC plates [2.50
of NH3 (2.0 M in methanol) in CHC13] gave the desired
product (5.50 mg, 76.5 o yield) as a thick oil: 1H NMR
(400 MHz, CDC13) 8 7.51 (s, 1H), 7.38 (s, 1H), 7.37 (d,
2H, J=2.4 Hz), 7.20 (m, 4H), 7.10 (d, 1H, J=2.4 Hz),
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-313-
7.08 (s, 1H), 6.99 (apparent d, 1H, J=8.3 Hz), 6.76
(apparent d, 1H, J=8.3 Hz), 5.43 (apparent dd, 1H,
J=5.1, 8.0 Hz), 3.91 (s, 3H), 3.34 (m, 2H), 2.63 (m,
2H), 2.63 (s, 1H), 2.53 '(apparent sept, partially
hidden, 1H, J=7.7 Hz), 2.30-2.10 (m, 6H), 1.82 (m, 2H),
1.28 (d, 6H, J=6.8 Hz); ESMS m/e: 512.2 (M + H)+.
Example 119
N- (3-{ 1- [ (3S) -3- (5-ACETYL-2-METHOXYPHENOXY) -3-
PHENYLPROPYL]-4-PIPERIDINYL}PHENYL)-2-METHYLPROPANAMIDE
A mixture of N-(3-~1-[(3R)-3-hydroxy-3-phenylpropyl]-4-
piperidinyl}phenyl)-2-methylpropanamide (5.20 mg, 0.0137
mmol), 2-methoxy-5-acetylphenol (100 mg),
triphenylphosphine (30.0 mg, 0.115 mmol) and diethyl
azodicarboxylate (7.42 mg, 0.0426 mmol) in THF (0.50 mL)
was stirred at room temperature for 3 days.
Chromatography using silica preparative TLC plates [2.50
of NH3 (2.0 M in methanol) in CHC13] gave the desired
product (1.60 mg, 22.2 o yield) as a thick oil: 1H NMR
(400 MHz, CDC13) 8 7.52 (d, 2H, J=2.4 Hz) , 7 .,3-7 .2 (m,
5H), 7.20 (m, 3H); 6.97 (apparent d, 1H, J=6.7 Hz), 6.69
(apparent d, 1H, J=8.0 Hz), 5.47 (apparent dd, 1H,
J=4 .3, 7 . 8 Hz) , 3. 95 (s, .3H) , 3 .38 (m, 2H) , 2 . 93 (m, .
f
2H), 2.61 (s, 1H), 2.53 (apparent sept, partially
hidden, 1H, J=7.6 Hz), 2.50 (s, 3H), 2.30-2.10 (m, 6H),
1.82 (m, 2H), 1.25 (d, 6H, J=6.8 Hz); ESMS m/e: 529.6 (M
+ H)+.
Example 120
N-(3-{1-[(3R)-3-(2-ACETYLPHENOXY)-3-PHENYLPROPYL]-4-
PIPERTDINYL}PHENYL)-2-METHYLPROPANAMIDE
A mixture of N-(3-{1-[(3S)-3-hydroxy-3-phenylpropyl]-4-
piperidinyl}phenyl)-2-methylpropanamide (5.2 mg, 0.0137
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-314-
mmol), 2-acetylphenol (100 mg), triphenylphosphine (30.0
mg, 0.115 mmol) and diethyl azodicarboxylate (7.42 mg,
0.0426 mmol) in THF (0.50 mL) was stirred at room
temperature for 3 days. Chromatography using silica
preparative TLC plates [2.50 of NH3 (2.0 M in methanol)
in CHC13] gave the desired product (1.70 mg, 24.9 0
yield) as a thick oil: 1H NMR (400 MHz, CDC13) 8 7.65 (m,
1H), 7.55 (s, 1H), 7.30-7.20 (m, 5H), 7.20 (m, 3H), 6.97
(m, 2H), 6.76 (apparent d, 1H), 5.49 (apparent dd, 1H,
J=4.3, 8.0 Hz), 3.38 (m, 2H), 2.93 (m, 2H), 2.71 (s,
3H), 2.60 (s, 1H), 2.53 (apparent sept, partially
hidden, 1H, J=7.6 Hz), 2.30-2.10 (m, 6H), 1.82 (m, 2H),
1.25 (d, 6H; J=6.9 Hz) ; ESMS m/e: 498.8 (M+) .
Example 121
N- [3- (1-{ (3R) -3- [2-FLUORO-5- (TRIFLUOROMETHYL) PHENOXY] -3-
PHENYLPROPYL}-4-PIPERIDINYL)PHENYL]-2-METHYLPROPANAMIDE
A mixture of N-(3-{1-[(3S)-3-hydroxy-3-phenylpropyl]-4-
piperidinyl}phenyl)-2-methylpropanamide (5.20 mg, 0.0137
mmol), 2-fluoro-5-trifluoromethylphenol (100 mg),
triphenylphosphine (30.0 mg, 0.115 mmol) and diethyl
azodicarboxylate (7.42 mg, 0.0426 mmol) in THF (0.50 mL)
was stirred at room temperature for 3 days.
Chromatography using silica preparative TLC plates [2.50
of NH3 (2.0 M in methanol) in CHC13] gave the desired
product (2.50 mg, 33.7 o yield) as a thick oil: 1H NMR
(400 MHz, CDC13) 8 8.07 (s, 1H), 7.67 (m, 1H), 7.54 (m,
1H), 7.45 (m, 2H), 7.30-7.10 (m, 6H), 7.14 (d, 1H, J=7.4
Hz), 6.97 (apparent d, 1H, J=7.7 Hz), 5.37 (apparent dd,
1H, J=5.0, 8.5 Hz), 3.4 (m, 2H), 2.8 (m, 2H), 2.6 (s,
1H), 2.53 (apparent sept, partially hidden, 1H, J=7.4
Hz), 2.30-2.10 (m, 6H), 1.80 (m, 2H), 1.25 (d, 6H, J=7.1
Hz, overlapped); ESMS m/e: 542.6 (M+), 543.54 (M + H)+.
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-315-
Example 122
N- [3- (1-~ (3S) -3- [2-FLUORO-5- (TRIFLUOROMETHYL) PHENOXY] -3-
PHENYLPROPYL}-4-PIPERIDTNYL)PHENYL]-2-METHYLPROPANAMIDE
A mixture of N-(3-{1-[(3R)-3-hydroxy-3-phenylpropyl]-4-
piperidinyl}phenyl)-2-methylpropanamide (5.20 mg, 0.0137
mmol), 2-fluoro-5-trifluoromethylphenol (100 mg),
triphenylphosphine (30.0 mg, 0.115 mmol) and diethyl
azodicarboxylate (7.42 mg, 0.0426 mmol) in THF (0.50 mL)
was stirred at room temperature for 3 days.
Chromatography using silica preparative TLC plates [2.50
of NH3 (2.0 M in methanol) in CHC13] gave the desired
product (3.00 mg, 40.40 yield) as a thick oil: 1H NMR
(400 MHz, CDC13) S 8.06 (s, 1H), 7.67 (m, 2H)~, 7.55 (m,
2H), 7.50-7.40 (m, 3H), 7.30-7.10 (m, 3H), 7.17 (d, 1H,
J=8.9 Hz), 7.07 (apparent d, 1H, J=6.7 Hz), 6.97
(apparent d, 1H, J=7.8 Hz), 5.37 (apparent dd, 1H,
J=4.2, 8.1 Hz), 3,37 (m, 2H), 2.93 (m, 2H), 2.63 (s,
1H), 2.50 (apparent sept, partially hidden, 1H, J=7.9
Hz), 2.30-2.10 (m, 6H), 1.85 (m, 2H), 1.25 (d, 6H, J=6.9
Hz); ESMS m/e: 542.7 (M + H)+.
Example 123
N-(3-{1-[(3S)-3-(2,5-DIFLUOROPHENOXY)-3-PHENYLPROPYL]-4-
PIPERIDINYL}PHENYL)-2-METHYLPROPANAMIDE
A mixture of N-(3-{1-[(3R)-3-hydroxy-3-phenylpropyl]-4-
piperidinyl}phenyl)-2-methylpropanamide (5.20 mg, 0.0137
mmol), 2,5-difluorophenol (100 mg), triphenylphosphine
(30.0 mg, 0.115 mmol) and diethyl azodicarboxylate (7.42
mg, 0.0426 mmol) in THF (0.50 mL) was stirred at room
temperature for 3 days. Chromatography using silica
preparative TLC plates [2.50 of NH3 (2.0 M in methanol)
in CHC13] gave the desired product (2.70 mg, 40.1 0
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-316-
yield) as a thick oil: 1H NMR (400 MHz, CDC13) 8 7.46 (s,
1H), 7.40-7.30 (m, 4H), 7.20 (m, 2H), 7.17 (s, 1H), 6.97
(m, 2H), 6.58 (m, 1H), 6.51 (m, 1H), 5.27 (apparent dd,
1H, J=5.1, 8.2 Hz), 3.13 (apparent d, J=9.7 Hz, 2H),
2.64 (m, 2H), 2.51 (m, 2H), 2.34 (apparent sept,
partially hidden, J=7.1 Hz, 1H), 2.17 (m, 3H), 1.90-1.80
(m, 4H), 1.25 (d, 6H, J=7.1 Hz); ESMS m/e: 493.1 (M +
H)+.
Example 124
N- (3-{1-[ (3R) -3- (3-CHLOROPHENOXY) -3-PHENYLPROPYL] -4-
PIPERIDINYL}PHENYL)-2-METHYLPROPANAMIDE
A mixture of N-(3-{1-[(3S)-3-hydroxy-3-phenylpropyl]-4-
piperidinyl}phenyl)-2-methylpropanamide (5.20 mg, 0.0137
mmol), 3-chlorophenol (100 mg), triphenylphosphine (30.0
mg, 0.115 mmol) and diethyl azodicarboxylate (7.42 mg,
0.0426 mmol) in THF (0.50 mL) was stirred at room
temperature for 3 days. Chromatography using silica
preparative TLC plates [2.50 of NH3 (2.0 M in methanol)
in CHC13] gave the desired product (2.4 mg, 35.80 yield)
as a thick oil: 1H NMR (400 MHz, CDC13) 8 7.30 (m, 2H),
7.30-7.20 (m, 3H), 7.20 (m, 3H), 6.90 (apparent d, 1H,
J=7.7 Hz), 6.71 (apparent d, 1H, J=2.9 Hz), 6.69
(apparent t, 1H, J=2.9 Hz), 6.67 (apparent t, 1H, J=2.9
Hz), 6.65 (apparent d; 1H, J=2.9 Hz), 5.09 (apparent dd,
1H, J=4.8, 8.1 Hz), 3.18 (m, 2H), 2.73 (m, 2H), 2:50
(apparent sept, partially hidden, 2H, J=7.1 Hz), 2.30-
2.10 (m, 6H), 1.89 (m, 2H), 1.25 (d, 6H, overlapped);
ESMS m/e: 491.1 (M + H)+.
Example 125
(1S)-3-{4-[3-(ISOBUTYRYLAMINO)PHENYL]-1-PIPERIDINYL}-1-
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-317-
Into a 25-mL RB-flask was added N-(3-{1-[(3S)-3-hydroxy-
3-phenylpropyl]-4-piperidinyl}phenyl)-2-
methylpropanamide (5.20 mg, 0.0137 mmol), 1-
naphthalenecarbonyl chloride (100 mg),
diisopropylethylamine (0.30 mL) in THF (0.50 mL) at room
temperature. After stirring for 16 hrs at room
temperature, the reaction mixture was concentrated under
reduced pressure. The residue was purified using
preparative TLC plates [2.5o of NH3 (2.0 M in methanol)
in CHC13] gave the desired product (4.70 mg, 71.3 0
yield) as a thick oil: 1H NMR (400 MHz, CDC13) ~ 8.90 (d,
1H, J=8.9 Hz), 8.28 (apparent dd, 1H, J=1.5, 7.2 Hz),
8.03 (d, 1H; J=8.7 Hz), 7.88 (dm, 2H, J=8.7 Hz), 7.60-
7.48 (m, 7H), 7.40-7.32 (m, 3H), 7.25 (m, 1H), 6.90
(apparent d, 1H, J=7.4 Hz), 6.18 (apparent dd, 1H,
J=5.7, 7.8 Hz), 3.42 (m, 2H), 2.84 (m, 2H), 2.53 (m,
2H), 2.44 (apparent sept, partially hidden, 4H, J=7.5
Hz), 2.30-2.10 (m, 2H), i.82 (m, 2H), 1.25 (d, 6H, J=6.8
Hz); ESMS m/e: 535.6 (M + H)+.
Example 126
N-(3-{1-[(3S)-3-(3-ACETYLPHENOXY)-3-PHENYLPROPYL]-4-
PIPERIDINYI,}PHENYL) -2-METHYLPROPANAMIDE
A mixture of N-(3-{1-[(3R)-3-hydroxy-3-phenylpropyZ]-4-
piperidinyl}phenyl)-2-methylpropanamide (5.20 mg, 0.0137
mmol), 2-acetylphenol (100 mg), triphenylphosphine (30.0
mg, 0.115 mmol) and diethyl azodicarboxylate (7.42 mg,
0.0426 mmol) in THF (0.50 mL) was stirred at room
temperature for 3 days. Chromatography using silica
preparative TLC plates [2.50 of NH3 (2.0 M in methanol)
in CHC13] gave the desired product (1.50 mg, 22.0o yield)
as a thick oil: 1H NMR (400 MHz, CDC13) c~ 7. 65 (m, 1H) ,
7.55 (s, 1H), 7.30-7.20 (m, 5H), 7.20 (m, 3H), 6.97 (m,
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-318-
2H), 6.76 (apparent d, 1H), 5.49 (apparent dd, 1H,
J=4.3, 8.0 Hz), 3.38 (m, 2H), 2.93 (m, 2H), 2.75 (s,
3H), 2.53 (apparent sept, partially hidden, 2H, J=7.6
Hz), 2.30-2.10 (m, 6H), 1.92 (m, 2H), 1.25 (d, 6H, J=6.9
Hz); ESMS m/e: 498.81 (M+), 499.6 (M + H)+.
Example 127
N-(3-{1-[(3S)-3-(2-FLUORQPHENOXY)-3-PHENYLPROPYL]-4-
PIPERIDINYLjPHENYL)-2-METHYLPROPANAMIDE
A mixture of N-(3-{1-[(3R)-3-hydroxy-3-phenylpropyl]-4-
piperidinyl}phenyl)-2-methylpropanamide (5.20 mg, 0.0137
mmol), 2-fluorophenol (100 mg), triphenylphosphine (30.0
mg, 0.115 mmol) and diethyl azodicarboxylate (7.42 mg,
0.0426 mmol) in THF (0.50 mL) was stirred at room
temperature for 3 days. Chromatography using silica
preparative TLC plates [2.5% of NH3 (2.0 M in methanol)
in CHC13] gave the desired product (3.5 mg, 53.90 yield)
as a thick oil: 1H NMR (400 MHz, CDC13) S 8.07 (s, 1H),
7.65 (m, 1H), 7.41 (s, 1H), 7.40-7.10 (m, 5H), 7.05 (m,
2H), 6.97 (apparent d, 1H, J=8.7 Hz), 6.86 (m, 2H), 6.79
(apparent dt, 1H, J=2.4,,7.9 Hz), 5.31 (apparent dd, 1H,
J=4.5, 8.0 Hz), 3.39 (m, 2H), 2.97 (m, 2H), 2.53
(apparent sept, partially hidden, 2H, J=7.5 Hz), 2.3f2.1
(m, 6H) , 1. 92 (m, 2H) , 1.25 (d, 6H, J=6.7 Hz) ; ESMS m/e:
475.7 (M + H)+.
Example 128
(4S) -N- (3-{4-[3- (ACETYLAMINO) PHENYL] -1-
PIPERIDINYL)PROPYL)-4-(3,5-DIFLUOROPHENYL)-2-OXO-1,3-
OXAZOLIDINE-3-CARBOXAMIDE
Method:
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-319-
Into a 20 ml vial was added N1-{3-[1-(aminopropyl)-
1,2,3,6-tetrahydro-4-pyridinyl]phenyl}acetamide (15 mg,
0.054 mmol), 4-(3,5-Difluorophenyl)-2-oxo-oxazolidine-3-
carboxylic acid-4-nitro-phenyl ester (39.3 mg, 1.08
mmol, 2 eq) and dichloromethane with 0.60 of Methanol (3
ml) at room temperature. After stirring at room
temperature for 3 hrs, the reaction mixture was
filtered, and purified by preparative silica TLC (19:1 =
chloroform . methanol) to afford the desired product
(18 .3 mg, 68% yield) ; 1H NMR (400 MHz, CDC13) S 8.09 (br
s, 1H), 7.40 (d, 1H, J=8.0 Hz), 7.36-7.28 (m, 2H), 7.24
(t, 1H, J=8.0 Hz), 6.99 (d, 1H, J=8.0 Hz), 6.86-6.82 (m,
2H), 5.41 (dd, 1H, J=4.1, 9.0 Hz), 4.72 (t, 1H, J=9.0
Hz), 4.22 (dd, 1H, J=3.9, 9.1 Hz), 3.42-3,29 (m, 2H),
3.02 (d, 2H J=11.1 Hz), 2.52-2.38 (m, 3H), 2.16 (s, 3H),
2.08-1.98 (m, 2H), 1.86-1.70 (m, 6H); ESMS m/e: 501.2 (M
+ H)+; Anal. Calc. for C~6H3pF~N4O4+O.5H20: C, 60.64; H,
6.18; N, 10.88. Found: C, 60.67; H, 5.79; N, 10.86.
Example 129
The synthetic method is the same as described for the
synthesis of (4S)-N-(3-{4-[3-(acetylamino)phenyl]-1-
piperidinyl}propyl)-4-(3,.5-difluorophenyl)-2-oxo-1,3-
oxazolidine-3-carboxamide.
(4S) -N- (3-( 4- [3- (ACETYLAMINO) PHENYL] -1-
PIPERIDINYL}PROPYL)-2-OXO-4-(3,4,5-TRIFLUOROPHENYL)-1,3-
OXAZOLIDINE-3-CARBOXAMIDE: 18.8 mg (67o yield); 1H NMR
(400 MHz, CDC13) 8 8.09 (br s, 1H), 7.41-7.20 (m, 3H),
7.02-6.91 (m, 3H), 5.37 (dd, 1H, J=3.8, 8.9 Hz), 4.71
(t, 1H, J=9 Hz), 4.21 (dd, 1H, J=4, 9.3 Hz), 3.43-3.27
(m, 2H), 3.02 (d, 2H, J=11.0 Hz), 2.53-2.37 (m, 3H),
2.16 (s, 3H), 2.08-1.97 (m, 2H), 1.85-1.69 (m, 6H); ESMS
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-320-
m/e: 519.2 (M + H)+; Anal. Calc. for C26H2gF3N4O~+O.5H20:
C, 59.20; H, 5.73; N, 10:62. Found: C, 59.40; H, 5.35;
N, 10 . 65 .
Example 130
The synthetic method is the same as described for the
synthesis of (4S)-N-(3-{4-[3-(acetylamino)phenyl]-1-
piperidinyl}propyl)-4-(3,5-difluorophenyl)-2-oxo-1,3-
oxazolidine-3-carboxamide.
N- (3-{ 4- [3- (ACETYLAMINO) PHENYL] -1-PIPERIDINYL) PROPYL) -4-
(3,4-DIFLUOROPHENYL)-5,5-DI METHYL-2-OXO-1,3-OXAZOLIDINE-
3-CARBOXAMIDE: 19.6 mg (68o yield); 1H NMR (400 MHz,
CDC13) b 8.18 (t, 1H, J=5.9 Hz), 7.41 (d, 1H, J=8.8 Hz),
7.33 (s, 1H), 7.27-7.14 {m, 2H), 7.02-6.88 (m, 3H), 5.04
(s, 1H), 3.34 (qm, 2H, J=6.3 Hz), 3.02 (dm, 2H, J=10.9
Hz), 2.53-2.38 (m, 3H), 2.16 (s, 3H), 2.07-1.96 (m, 2H),
1.87-1.69 (m, 6H), 1.62 (s, 3H), 1.02 (s, 3H); ESMS m/e:
529.3 (M + H)+; Anal. Calc. for C~8H34F~N404: C, 63.62; H,
6.48; N, 10.60. Found: C, 63.15; H, 6.27; N, 10.48.
Example 131
The synthetic method is the same as described for the
synthesis of (4S)-N-(3-{4-[3-(acetylamino)phenyl]-1-
piperidinyl}propyl)-4-(3,5-difluorophenyl)-2-oxo-1,3-
oxazolidine-3-carboxamide.
(4S, 5R) -N- (3-{ 4- [3- (ACETYLAMINO) PHENYL] -1-
PIPERIDINYL)PROPYL)-4-(3,4-DIFLUOROPHENYL)-5-METHYL-2-
OXO-1,3-OXAZOLIDINE-3-CARBOXAMIDE: 20.5 mg (74o yield);
1H NMR (400 MHz, CDC13) 8 8.14 (t, 1H, J=5.5 Hz) , 7 . 40
(d, 1H, J=7.8 Hz), 7.37-6.89 (m, 6H), 5.35 (d, 1H, J=7.5
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-321-
Hz), 5.02-4.93 (m, 1H), 3.41-3.25 (m, 2H), 3.02 (d, 2H,
J=10.8 Hz), 2.53-2.37 (m, 3H), 2.16 (s, 3H), 2.07 (m,
2H), 1.89-1.68 (m, 6H); 1.04 (d, 3H, J=6.4 Hz); ESMS
m/e: 515.3 (M + H)~; Anal. Calc. for C2~H32F~N4Og+O.5H20:
C, 61.94; H, 6.35; N, 10.70, Found: C, 61.90; H, 6.13;
N, 10.64.
Example 132
The synthetic method is the same as described for the
synthesis of (4S)-N-(3-{4-[3-(acetylamino)phenyl]-1-
piperidinyl}propyl)-4-(3,5-difluorophenyl)-2-oxo-1,3-
oxazolidine-3-carboxamide.
N-(3-(4-[3-(ACETYLAMINO)PHENYL]-1-PIPERIDINYL)PROPYL)-4-
(4-FLUOROBENZYL)-2-OXO-1,3-OXAZOLIDINE-3-CARBOXAMIDE:
17.4 mg (65o yield); 1H NMR (400 MHz, CDC13) 8 8.08 (t,
1H, J=5.6 Hz), 7.4 (d, 1H, J=7.2 Hz), 7.34 (s, 1H),
7.28-7.14 (m, 3H), 7,05-6.95 (m, 3H), 4.69-4.60 (m, 1H),
4.26 (t, 1H, J=8.8 Hz), 4.15 (dd, 1H, J=3.2, 9 Hz), 3.43
(q, 2H, J=6.2 Hz), 3.3 (dm 1H, J=13.6 Hz), 3.04 (dm, 2H,
J=11 Hz), 2.87 (dd, 1H, J=9.3, 14.4 Hz), 2.53-2.42 (m,
3H), 2.16 (s, 3H), 2,09-1.99 (m, 2H), 1.87-1.65 (m, 6H);
f
ESMS m/e: 497,3 (M + H)+; Anal. Calc. for
C~~H33FN404+0.5H20: C, 64.14; H, 6.78; N, 11.08. Found: C,
64.26; H, 6.39; N, 11.12.
Example 133
2-METHYL-N- (3-{ 1- [ (3R) -3- (2-NITROPHENOXY) -3-
PHENYLPROPYL]-4-PIPERIDINYL)PHENYL)PROPANAMIDE
A mixture of N-(3-{1-[(3S)-3-hydroxy-3-phenylpropyl]-4-
piperidinyl}phenyl)-2-methylpropanamide (5.20 mg, 0.0137
mmol), 2-nitrophenol (100 mg), triphenylphosphine (30.0
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-322-
mg, 0.115 mmol) and diethyl azodicarboxylate (7.42 mg,
0.0426 mmol) in THF (0.50 mL) was stirred at room
temperature for 3 days. Chromatography using silica
preparative TLC plates [2.50 of NH3 (2.0 M in methanol)
in CHC13] gave the desired product (2.37 mg, 34.50 yield)
as a thick oil: 1H NMR (400 MHz, CDC13) 8 7.84 (d, 1H),
7.90 (m, 1H), 7.45 (m 1H), 7.30-7.20 (m, 5H), 7.20 (m,
2H), 6.98 (m, 2H), 6.89 (apparent d, 1H, J=7.7 Hz), 5.62
(apparent dd, 1H, J=4.1, 8.9 Hz), 3.10 (m, 2H), 2.60 (m,
2H), 2.53 (m, 2H), 2.30-2.10 (m, 6H), 1.90 (m, 2H), 1.25
(d, 6H, overlapped); ESMS m/e: 502.3 (M + H)~.
Example 134'
N-(3-(1-[(3S)-3-([1,1'-BIPHENYL]-4-YLOXY)-3-
PHENYLPROPYL]-4-PIPERIDINYL}PHENYL)-2-METHYLPROPANAMIDE
A mixture of N-(3-{1-[(3R)-3-hydroxy-3-phenylpropyl]-4-
piperidinyl}phenyl)-2-methylpropanamide (5.20 mg, 0.0137
mmol), 4-phenylphenol (100 mg), triphenylphosphine (30.0
mg, 0.115 mmol) and diethyl azodicarboxylate (7.42 mg,
0.0426 mmol) in THF (0.50 mL) was stirred at room
temperature for 3 days. Chromatography using silica
preparative TLC plates [2.50 of NH3 (2.0 M in methanol)
in CHC13] gave the desired product (3.00 mg, 41.20 y.~eld)
as a thick oil: 1H NMR (400 MHz, CDC13) b 8.06 (s, 1H),
7.48 (m, 2H), 7.40-7.30 (m, 8H), 7.30-7.25 (m, 4H), 6.97
(apparent d, 1H, J=7.6 Hz), 6.91 (apparent d, 2H,~J=8.7
Hz), 5.34 (apparent dd, 1H, J=4.4, 8.0 Hz), 3.40 (m,
2H), 2.98 (m, 2H), 2.53 (apparent sept, partially
hidden, 1H, J=8.1 Hz), 2.44 (m, 1H), 2.30-2.10 (m, 6H),
1.93 (d, 2H), 1.26 (d, 6H, J=6.9 Hz); ESMS m/e: 533.4 (M
+ H)+.
Example 135
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-323-
2-METHYL-N- (3-{ 1- [ (3R) -3- (3-NITROPHENOXY) -3-
PHENYLPROPYL] -
4-PIPERIDINYL}PHENYL)PROPANAMIDE
A mixture of N-(3-{1-[(3S)-3-hydroxy-3-phenylpropyl.]-4-
piperidinyl}phenyl)-2-methylpropanamide (5.20 mg, 0.0137
mmol), 3-nitrophenol (100 mg), triphenylphosphine (30.0
mg, 0.115 mmol) and diethyl azodicarboxylate (7.42 mg,
0.0426 mmol) in THF (0.50 mL) was stirred at room
temperature for 3 days. Chromatography using silica
preparative TLC plates [2.50 of NH3 (2.0 M in methanol)
in CHC13] gave the desired product (2.80 mg, 40.8 0
yield) as a thick oil: 1H NMR (400 MHz, CDC13) b 7.76
(dm, 1H), 7;71 (t, 1H, J=1.8 Hz), 7.50-7.40 (m, 2H),
7.40-7.25 (m, 7H), 7.17 (apparent dd, 1H, J=2.4, 8.2),
6.97 (apparent d, 1H, J=7.7 Hz), 5.45 (apparent dd, 1H,
J=5.0, 8.1 Hz), 3.45 (m, 2H), 2.89 (m, 2H), 2.53
(apparent sept, partially hidden, 2H, J=8.3 Hz), 2.30-
2.10 (m, 6H), 1.92 (m, 2H), 1.25 (d, 6H, J=6.8 Hz); ESMS
m/e: 502.3 (M + H)+.
Example 136
N-(3-{1-[(3S)-3-(2-ETHOXYPHENOXY)-3-PHENYLPROPYL]-4-
PIPERIDINYL}PHENYL)-2-METHYLPROPANAMIDE
A mixture of N-(3-{1-[(3R)-3-hydroxy-3-phenylpropyl]-4-
piperidinyl}phenyl)-2-methylpropanamide (5.20 mg, 0.0137
mmol), 2-ethoxyphenol (100 mg), triphenylphosphine (30.0
mg, 0.115 mmol) and diethyl azodicarboxylate (7.42 mg,
0.0426 mmol) in THF (0.50 mL) was stirred at room
temperature for 3 days. Chromatography using silica
preparative TLC plates [2.5o of NH3 (2.0 M in methanol)
in CHC13] gave the desired product (1.16 mg, 15.50 yield)
as a thick oil: 1H NMR (400 MHz, CDC13) 8 8.06 (s, 1H),
7.52 (s, 1H), 7.40-7.33 (m, 4H), 7.30-7.20 (m, 3H), 6.97
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-324-
(apparent d, 1H, J=7.7 Hz), 6.88 (m, 2H), 6.68 (m, 2H),
5.21 (m, 1H), 4.11 (q, 2H, J=7.3 Hz), 3.37 (m, 2H), 2.71
(m, 2H), 2.53 (apparent sept, partially hidden, 2H,
J=7.6 Hz), 2.30-2.10 (m, 6H), 1.89 (m, 2H), 1.49 (t, 3H,
J=7.3 Hz), 1.25 (d, 6H, J=6.8 Hz); ESMS m/e: 501.4 (M +
H)+_
Example 137
2-METHYL-N- (3-( 1- [ (3S) -3- (1-NAPHTHYLOXY) -3-
PHENYLPROPYL]-4-PIPERIDINYL}PHENYL)PROPANAMIDE
A mixture of N-(3-{1-[(3R)-3-hydroxy-3-phenylpropyl]-4-
piperidinyl}phenyl)-2-methylpropanamide (5.20 mg, 0.0137
mmol), 1-naphthol (100 mg), triphenylphosphine (30.0 mg,
0.115 mmol) and diethyl azodicarboxylate (7.42 mg,
0.0426 mmol) in THF (0.50 mL) was stirred at room
temperature for 3 days. 'Chromatography using silica
preparative TLC plates [2.50 of NH3 (2.0 M in methanol)
in CHC13] gave the desired product (4.30 mg, 66.20 yield)
as a thick oil: 1H NMR (400 MHz, CDC13) 8 8.06 (s, 1H) ,
7 . 72 (d, 1H, J=8.5 Hz) , 7 .59 (d, 1H, J=8 .5 Hz) , 7 .5 (m,
2H), 7.45-7.30 (m, 6H), 7.25 (m, 3H), 7.17 (apparent dd,
1H, J=2.6, 9.0 Hz), 7.01 (apparent d, 1H, J=2.6 Hz),
6.97 (apparent d, 1H, J=7.9 Hz), 5.46 (apparent dd, 1H,
J=4.5, 8.1 Hz), 3.12 (m, 2H), 2.61 (m, 2H), 2.53
(apparent sept, partially hidden, 2H, J=7.9 Hz), 2.30-
2 . 10 (m, 6H) , 1. 90 (m, 2H) , 1 .25 (d, 6H, J=7 .3 Hz,
overlapped); ESMS m/e: 507.2 (M + H)+.
Example 138
N-(3-{1-[(3S)-3-(1,3-DIOXO-1,3-DIHYDRO-2H-ISOINDOL-2-
YL)-3-PHENYLPROPYL]-4-PIPERIDINYL}PHENYL)-2-
METHYLPROPANAMIDE
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-325-
Step 1:
2-[(1S)-3-CHLORO-1-PHENYLPROPYL]-1H-ISOINDOLE-1,3(2H)-
DIONE:
A mixture of phthalimide.(0.147 g, 1.0 mmol), (R)-(+)-3-
chloro-phenyl-1-propanol (0.171 g, 1.0 mmol),
triphenylphosphine (0.262 g, 1.0 mmol), diethyl
azodicarboxylate (0.174 g, 1.0 mmol) in 5.0 mL of THF
was stirred at room temperature for 24 h. The reaction
mixture was concentrated in Vacuo. The residue was
washed with pentane (x3) and the combined pentane
extracts were concentrated and chromatographed (silica=
with hexanes-EtOAc 8:1 as the eluent) to give the
desired product (as described as a general procedure by:
Srebnik, M.; Ramachandran, P.V.; Brown, H.C. J. Org.
Chem. 1988, 53, 2916-2920) afforded the desired product
(0.121 g, 50.2 0) as a yellow solid: 1H NMR (400 MHz,
CDC13) ~ 7.82 (apparent dd, 2H, J=2.9 Hz), 7.70 (apparent
dd, 2H, J=2.9 Hz), 7.56 (m, 2H), 7.39-7.27 (m, 3H), 5.64
(apparent dd, 1H, J=7.0, 9.2 Hz), 3.57 (m, 2H), 3.05 (m,
1H), 2.82 (apparent sept, 1H, J=7.0 Hz); ESMS m/e:
300.13 (M+H)+.
Step 2:
N-(3-(1-[(3S)-3-(1,3-DIOXO-1,3-DIHYDRO-2H-ISOINDOL-2-
YL)-3-PHENYLPROPYL]-4-PIPERIDINYL}PHENYL)-2-
METHYLPROPANAMIDE: A mixture of potassium carbonate
(29.2 mg, 0.211 mmol), sodium iodide (47.5~mg, 0.317
mmol), 2-methyl-N-[3-(4-piperidinyl)phenyl]propanamide
(51.8 mg, 0.211 mmol) 2-[(1S)-3-chloro-1-phenylpropyl]-
1H-isoindole-l, 3 (2H) -dione
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-326-
(63.1 mg, 0.211 mmol) in DMF (5.0 mL) was stirred at
100 °C for 3 hrs, at which time TLC indicated that the
reaction was complete. The reaction mixture was poured
into water (50 mL) and the aqueous layer was extracted
with methylene chloride (3x30 mL). The combined organic
extracts were washed with brine (30 mL), dried over MgS04
and concentrated under reduced pressure. The crude
product was purified by Prep-TLC plates [2.50 of NH3 (2.0
M in methanol) in CHC13]
to give the desired product (74.1 mg, 77.1 0) as a thick
oil: 1H NMR (400 MHz, CDC13) 8 7.83 (apparent dd, 2H,
J=2.9 Hz), 7.69 (apparent dd, 2H, J=2.9 Hz), 7.56
( apparent dt, 3H, J=2 . 9, 7 . 3 Hz ) , 7 . 33 (m, 4'H) , 7 . 21 ( t,
1H, J=7.8 Hz), 7.09 (s, 1H), 6.81 (apparent d, 1H, J=7.8
Hz) , 5.49 (apparent dd, 1H, J=5.5, 9.5 Hz) , 2.98 (d, 1H,
J=9.5 Hz), 2.87 (m, 2H), 2.50 (apparent sept, 1H, J=6.7
Hz) , 2 . 40-2.35 (m, 4H) , 1 . 94 (m, 2H) , 1 .70-1.50 (m, 4H) ,
1.25 (d, 6H, J=7.9 Hz); ESMS m/e: 510.37 (M+H)+.
Example 139
2-METHYL-N- (3-{ 1- [ (3S) -3- (4-PHENOXYPHENOXY) -3-
PHENYLPROPYL]-4-PIPERIDINYL}PHENYL)PROPANAMIDE
STEP 1:
4-{[(1S)-3-CHLORO-1-PHENYLPROPYL]OXY}-(4-
PHENOXY)BENZENE:
A mixture of 4-phenoxyphenol (1.86 g, 10.0 mmol), (S)-(-
-3-chloro-phenyl-1-propanol (1.70 g, 10.0 mmol),
triphenylphosphine (2.62 g, 10.0 mmol), diethyl
azodicarboxylate (1.57 mL, 10.0 mmol) in 5.0 mL of THF
was stirred at room temperature for 24 h. The reaction
mixture was concentrated in Vacuo. The residue was
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
. -327-
washed with pentane (x3) and the combined pentane
extracts were concentrated and chromatographed (silica
with hexanes-EtOAc 97:3 as the eluent) to give the
desired product (as described as a general procedure by:
Srebnik, M.; Ramachandran, P.V.; Brown, H.C. J. Ora.
Chem. 1988, 53, 2916-2920) afforded the desired product
as a thick oil which solidified on standing (2.51 g,
75.7 0) : 1H NMR (400 MHz, CDCl3) 8 7.4-7.23 (m, 7H) , 7.03
(apparent t, 1H, J=7.3 Hz), 6.91 (apparent dm, 2H, J=7.8
Hz), 6.93 (apparent q, 4H, J=7.8 Hz), 5.31 {apparent dd,
1H, J=4.5, 8.6 Hz), 3.82 (m, 1H), 3.62 (apparent
quintet, 1H, J=5. 6 Hz) , 2.47 (m, 1H) , 2.20 (m, 1H) .
Step 2:
2-METHYL-N- (3-{ 1- [ (3S) -3- (4-PHENOXYPHENOXY) -3-
PHENYLPROPYL]-4-PIPERIDINYL}PHENYL)PROPANAMIDE: A
mixture of 2-methyl-N-[3-(4-
piperidinyl)phenyl]propanamide (65.5 mg, 0.266 mmol), 4-
{[(1S)-3-chloro-1-phenylpropyl]oxy}-(4-phenoxy)benzene
(0.100 mg, 0.296 mmol), potassium carbonate {40.9 mg,
0.296 mmol) and sodium iodide (67.0 mg, 0.444 mmol) in
DMF (1.0 mL) at 100 °C for 3 hours. The reaction mixture
was poured into water (50 mL) and the aqueous layer was
extracted with methylene chloride (3x30 mL). The
combined organic extracts were washed with brine (30
mL), dried over MgS04 and concentrated under reduced
pressure, The crude product was purified by Prep-TLC
plates [2.50 of NH3 (2.0 M in methanol) in CHC13] to give
the desired product {0.109 g, 74.6 0) as a thick oil: 1H
NMR (400 MHz, CDC13) 8 7.48 (s, 1H), 7.40-7.30 (m, 4H),
7.20-7.10 (m, 6 H), 7.09 (s, 1H), 6.99 (apparent d, 1H,
J=7.8 Hz), 6.98 (apparent t, 1H, J=7.8 Hz), 6.93
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-328-
(apparent d, 2H, J=8.4 Hz) , 6.84 (m, 2H) , 5.20 (apparent
dd, IH, J=4.4, 8.5 Hz) , 3. 03 (m, 2H) , 2.51 (m, 4H) , 2.24
(apparent sept, 1H, J=7.8 Hz), 2.20-2,10 (m, 3H), 1.90
(m, 4H), 1.25 (d, 6H, J=7.9 Hz); ESMS m/e: 549.41 (M+H)+;
Anal. Calc. for C3gHqON203- C~ 78.80; H, 7.35; N, 5.11.
Found: C, 78.58; H, 7.48; N, 5.09.
Example 140
N- (4-( 1- [ (3R) -3- (3, 4-DIMETHOXYPHENOXY) -3-PHENYLPROPYL] -
4-PIPERIDINYL}PHENYL)-2-METHYLPROPANAMIDE
Step 1:
1- [ (3R) -3- (3, 4-DIMETHOXYPHENOXY) -3-PHENYLPROPYL] -4- (4-
NITROPHENYL)-1,2,3,6-TETRAHYDROPYRIDINE:
A-mixture of potassium carbonate (24.0 mg', 0.174 mmol),
sodium iodide (39.0 mg,~0.260 mmol), 4-(4-nitrophenyl)-
1,2,3,6-tetrahydropyridine (35.4 mg, 0.174 mmol) and 4-
{[(1R)-3-chloro-1-phenylpropyl]oxy}-1,2-dimethoxybenzene
(53.4 mg, 0.174 mmol) in DMF (0.5 mL) was stirred at 100
°C for 3 hrs, at which time TLC indicated that the
reaction was complete. The reaction mixture was poured
into water (5.0 mL) and the aqueous layer was extracted
with methylene chloride (3x30 mL). The combined organic
extracts were washed with brine (30 mL), dried over MgS04
and concentrated under reduced pressure. The. crude
product was purified by Prep-TLC plates
[1:1=hexane:ethyl acetate with 1o NH3] afforded the
product ( 63 . 1 mg, 7 6 . 6 0 ) as a yellow oil . The product
was used in next reaction without further purification.
S tep 2
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-329-
4-{1-[(3R)-3-(3,4-DIMETHOXYPHENOXY)-3-PHENYLPROPYL]-4-
PIPERIDINYL}ANILINE: A 25-mL RB flask, equipped with a
hydrogen-filled balloon, was charged with 1-[(3R)-3-
(3,4-dimethoxyphenoxy)-3-phenylpropyl]-4-(4-
nitrophenyl)-1,2,3,6-tetrahydropyridine (63.0 mg, 0.133
mmol), Palladium on Carbon (5.0 mol-eqo, 0.00665 mmol,
7.04 mg) and ethanol (2.0 mL) at room temperature.
After 1 hr the reaction mixture was filtered through a
plug of Celite 545 and concentrated under reduced
pressure. The crude product (54.1 mg, 89.40) was used
in next reaction without further purification.
STEP 3:
N- (4-{ 1- [ (3R) -3- (3, 4-DIMETHOXYPHENOXY) -3-PHENYLPROPYL] -
4-PIPERIDINYL}PHENYL)-2-METHYLPROPANAMIDE: A mixture of
4-{1-[(3R)-3-(3,4-dimethoxyphenoxy)-3-phenylpropyl]-4-
piperidinyl}aniline (5.31 mg, 0.0119 mmol), isobutyryl
chloride (2.08 mg, 0.019 mmol), N,N-
diisopropylethylamine (8.40 mg, 0.0650 mmol) in
methylene chloride (1.0 mL) was stirred at room
temperature for 24 hours. The reaction mixture was
concentrated and chromatographed using a preparative TLC
f
plate [2.50 of NH3 (2.0 M in methanol) in CHC13] to~ give
the product (3.5 mg, 56.5 0) as a thick oil: 1H NMR (400
MHz, CDC13) 8 7.38 (d, 1H, J=8.6 Hz), 7.30-7.20 (m, 4H),
7.20(m, 1H), 7.11 (d, 2H, J=8.6 Hz), 7.04 (s, 1H), 6.57
(d, 1H, J=8.3 Hz) , 6.44 (d, 1H, J=2. 6 Hz) , 6.22 (dd, 1H,
J=2,6, 8.3 Hz), 5.09 (apparent dd, 1H, J=4.4, 8.1 Hz),
3.72 (s, 3H), 3.70 (s, 3H), 3.08 (m, 2H), 2.57 (m, 2 H),
2.43 (apparent sept, partially hidden, 2H, J=6.8 Hz),
2.30-2.10 (m, 6H), 1.80 (m, 2H), 1.25 (d, 6H, J=7.9 Hz);
ESMS m/e: 517.3 (M+H)+.
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-330-
Example 141
N-(3-{1-[(3S)-3-(3-ACETYLPHENOXY)-3-PHENYLPROPYL]-4-
PIPERIDINYL}PHENYL)-2-METHYLPROPANAMIDE
Into a 25-mL RB-flask was added triphenylphosphine (9.80
mg, 0.0375 mmol), diethyl azodicarboxylate (5.22 mg,
0.0300 mmol), N-(3-{1-[(3R)-3-hydroxy-3-phenylpropyl]-4-
piperidinyl}phenyl)-2-methylpropanamide (9.53 mg, 0.0250
mmol), 3-hydroxyacetophenone (100 mg) and THF (1.0 mL)
at room temperature. The reaction mixture was stirred
at room temperature overnight (16 hrs). The solvent was
removed under reduced pressure and the residue was
purified by preparative TLC plates [2.50 of NH3 (2.0 M in
methanol) in CHC13] to afford the desired product (2.73
mg, 39 . 9 0 ) as a thick oil : 1H NMR 8 7 . 70-7 . 64 (m, 2H) ,
7.54 (m, 2H), 7.49-7.44 (m, 6H), 7.25 (m, 1H), 7.05 (d,
1H, J=8.3 Hz), 6.96 (apparent d, 1H, J=7.7 Hz), 5.34
2 0 ( apparent dd, 1H, J=4 . 8 , 8 . 2 Hz ) , 3 . 15 (m, 2H ) , 2 . 67 (m,
2H), 2.52 (s, 3H), 2.53 (apparent sept, partially
hidden, 2H, J=7.6 Hz), 2.30-2.10 (m, 6H), 1.89' (m, 2H),
1.25 (d, 6H, J=6.9 Hz); ESMS m/e: 499.4 (M + H)+.
30
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-331-
Scheme A. Synthesis of tert-Butyl 4-(3-aminophenyl)-1-piperidinecarboxylate
F
O OS~ F
O ~O
a ~ b
N
N
O~O
NH2 I ~ NH2
i
OHO
O O
a, n-BuLi, diisopropylamine, THF, PhN(Tf)2, -78 °C to room temperature,
81%
b. 3-aminophenylboronic acid hemisulfate, LiCI, tetrakis-triphenylphosphine
-palladium (0), Na2C03, DME-HBO, reflux, 81%
c. 10% Pd/C, ethanol, H2, room temperature, balloon method, 84%
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-332
N
O
Z _
Q. ~ X=O
o X_-O er Z Z
E =Z
o ~ ~ Z_Ct
U ~ ~ Z-~
Z-m ch
U
c
o
Z
c
U ~ \ ~ Z-m N
U
o x U ~ o
o
o ~ o
o r
N X
O ~ c ~ o
a~ o ~ a~ c D
s z ~ c O ~ o
c a L o ci
o c ca O ~ co O
c
o_ 3 ca ~ o
p ~ 'a o Z _ ~
U O o Z ~ z j ~r Z
Q ~ -oc ~ ~ m m . ' = c°
C ' U V O C ~ U U
~ s o U ~ ~ ~ ai ai ~ X ~ ~ a U_
o a ~ o ai O
s d ~ N O V -° -°- ,~ ~ ~ c ~ .~ t n
CJ) ~ ~ Z N ~~ Q. .c ~~ N N a .- t ~ ~ X
N. -a = X w U ~ ~ CC N U N
0 / ~ ~ OC Z I OC o o = I ~ o' o'
~i ai
r cV ri ~'
Z = N
Z N Z
O ~ Z-m .-
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-333
OC DC
X=O X-O
=Z ~ =Z
Z
'
c
0
o~
c~
c x U
o
Q 3 0 ~
~ o
U t-
L
_ N O m j c~
O
C coO d
c
co O
c U ~
N ' U
s o_ 3 ca o ~ ~ L
c a~ ~ z 'o o Z
Z U
~ o ~ ~ Z p ~ z
a _ " Z ~ CO ~ o
i
,C ~ c ~ ti N V V
a U
U O
U
U U U ~ d3 V U - S
LU N
Q Z ai ~-.~ U d o ~ ~ U
Oj ~
'
C~j r '~ .C~ Q N Z3 'D O
'~D ~
~
~
CD ~ N N v1 Z ~ -C .~
D. .c
o ~ ~ ~ X - N p~ 0~ X
U _
0 0 ~ Z OC o OC
= o
_
N c7 V N ~ ~' O
O Q cn
ti
' - n
X
E r~ E
c~
o ~ o
U U
Q
Z-OD
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-334
O
=Z
cn G
..
z ~O
z
y O
° U
0
u°, o .
o a~
n ° Z
G x u: ~ O
cn ~ ~ x ~
° a~ ~ ~ o I
c~c ai ~'' '°
o t c O v ~ O
U
E o_ ca o
s
E o
>,
U_ z z Y LL
U ~ H
Qj ~ V ... .
U 'a LLI
O U
Cn L ~ ~ L m = \
r,; V ~ X m O OI ~
O L
V ~ \ ~ ~ U ~ ~ / O
.C .N = _ ~ O
V
(n r N
Z
N
N
Z
U \
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-335
Scheme C2. Specific Examples of the Syntheses of the MCH Antagonists
HO ~' / \ /
diisopropylethylamine O N\--~~
O
\ / THF, -
~/ ~ / 7 -
~CI \ / O
O retention of the absolute
stereochemistry
/ \
HO CI 1. diethylazodicarboxylate . O O N \ /
THF, 4-phenylphenol, PPh3 \ / NH
\ / 2. DMF, heat, K2C03, KI \ / 8 O
commercially HN ~ / ~- inversion of sterochemistry
available HN O
i
HO CI 1, diethylazodicarboxylate O
_ THF, phthalimide, PPh3 O N N \ /
\ / 2. DMF, heat, K2C03, KI NH
HN ~ / \ / 9 O
HN O inversion of sterochemistry
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-336
O O
=z
z
U O
O
O = Z Z
_~ ~ ,,~~/
~ \
p . Z O
X
7
C
a ~
C
O o
v- ~ i
(p ~L m
N
'~O f0 O U .C
X
U a °' Z
~E ° O O
Z Z U .N ~ '~ / \
~U .- CV c~ ~t 'O
O
O j
r Q I _U
C~ C~ Z N '° °
Q ~ ~ ~ z_m o = a~ o
s O ~ :d
V U ~ U W X __
Z
(n ~ ~' U
~ a
m .S m
o c'v U
2 I U
r N C~ ~t
N
N
Z
U
Z-m
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-337
O
zx
/ \
0
z
Q
z
U U Oi"
O' / \
o ~ ~ ~_~ \ /
O O O O _
0
c o
T
_~ ~ Z
o ~ O
N p UJ 'o
n, ~ U ~j .o a~
N w L C
~ Z D_ U L
LLJ 'a
V ~C z ~ ~ O
L
U ~ N o
2 U Z ,~ .c
U
r N Crl
N
D
Q7
O
U
N U
Z / \ / Z-m
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-338
Scheme E: General Synthesis of the MCH Antagonists
N a
O R i~~ N
R~~~cl + \ / ,o ~ \ / o
y 2 N X 3 N-X
R2 'R2
O - O
R1%~CI .~ N \ / ~ Ri'' a uN \ /
NH2 5 NH2
~O ~ ~ R2COCI b JO _
Ri' v v N \ / ,.~ R2S02C1 ~ R~~ N \ /
O
~NH2 6 N-X-R2
a. dioxane, diisopropylethylamine, Bu4Nl, reflux
or DMF, ICi, Na2C03, 90-100 °C
or toluene, 110 °C, 18-crown-6
b. diisopyropylethylamine, dichloromethane
X = S(=O), C
R1 = Aromatic, substituted aromatic or heterocyclic
R2 = aliphatic oraromatic
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-339-
z
z O I ~ Z O
O o
Z o Z
i\ Z
O
o /
v
o ~~' °~~~ \
p ~ \ ~ i
zJ i
Q
s
U m
0
~' o
o ~ ~ v,
c~
a~ ~
r ~E ai p= ~ ~ ~~,~ = s
c >, ~ ~ .~ o .E ~ .~ .E
__ ~ .. ~ .~ o
O cn Y ~ ~ D ~ ~ U = O U
'- ~tO O V O
O Q O Qj Q LL ~- O ~C O
ai U
U' L o Z ~ o ~ .S v~ ca ~ u~
ii CC ~ o m ~ o
d
E O
°' O
t
L
Z
\ s o \ Z E
c ~ / o.
Q c
Z a> c
p L
C' o Z o
Z
U L
I -' o L
0
m p ~ \
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
--340-
Scheme G. General Synthesis of the MCH Antagonists
R~ \ ~ w
~ o
HO CI i
O; CI N CI
DEAD, Ph3P, O
THF, R-phOH or or
\ /
\ /
phthalimide
H-N \ ~ R ~ \
,O
N-X,R O N \
O
N-
diisopropylethylamine \ / R
or Na2C03;
Bu4Nl, or KI;
dioxane, toluene, or
or DMF; heat
O
i
o. N N \ l
,,O
--~N
\ / R
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-341-
Scheme H: Synthesis of Oxazolidinones
Ar b Ar
ArCHO c
NC~NH2 ~ Me02C~NH2
O
Ar d Ar
a
HON -~ HO~ -~ O~NH f
H2 NHtBoc
Ar
O O
O~NH + O~NH
U
~Ar .~Ar
O N02 O O
O O
O NH --. ~ ~ \ I h -. O~N~N~N
O N O
~.( H
Ar ~Ar . _ Ar I \
\/NH
a. NH3, then TMS-CN; b. NCI in MeOH (room temperature to reflux);
c. LAN, THF, reflux; d. (BOC)20, chloroform; e. NaH, THF; f. Chiralcel OD
column
g. NaH, p-nitrophenyl chloroformate, THF;
h. an amine such as N-{3-[1-(3-aminopropyl)-4-piperidinyl]phenyl}acetamide
Ar = 3,4-difluorophenyl, 3,5-difluorophenyl or 3,4,5-trifluorophenyl
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-342
u- / \ z !Z-
/ I
~O
c
0
Z \
-a
z
o. z
o -
z= ~ o
o /I L
U \ ~ :p
CO ~ ~~ U c~C
Y O , ~ ~ V
(0
E ~ O O ~ c
y ~ ~ U
N N
_ ~ ,C Q
u' c~0 G
N ~ C 'O
(U ~i
u. a ai fl.
O u. .o °' ~t
..
cu O Z I E o 0
\
~ o L
t i ~ O~ . .co v .E
O _ ~ ~ cc
O s o. V
r
0 0
E '~
ca a Z
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-343
-° a~
y E
0 0
o c
n
c
a~ a~
o Z ~ U o ..Q
Z
U ~
a ..
O ~ v
c~
o -o
z= / ~ m m c
>. o
O Z \ Q o. Q
O ~ N o °up c_
.. . _. O N
_ ~ ~ ~ . _
O .O.
p O~ to Q
L
a~
~° E o a
c L
0 0
N = O V O
O .Q
O z ~ LL
p LL ~ ~ O Ch
O ~ ~ U O ..'.. i
LL \
Z N_ ~ Z
_ (O
u- p ~ N ~ (~
U s
.c _~ a z ~n
"- U ~% ~ . c~a
,- c
~' ~ O o'
0
Z / ~ ~ ~ U
J ~ ~ n
\ m 2 = LL
~/ ..:. f- N =
~,,.,
O " '~ L a~
z
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-344-
Scheme K: Synthesis Oxazolidinones from Amino Acids
O
Ar a Ar b, c O~NH d
~OH
H2N COOH H2N
Ar
O O
O O / N02 ' O~N~N.'~/~N
h H
O N O
R
Ar F (H) \ /
F
a. LAH, THF; b. (BOC)20, CHCI3; c. NaH, THF; d. p-nitrophenylchloroformate,
NaH, THF;
h. an amine such as N-{3-[1-(3-aminopropyl)-4-piperidinyl]phenyl}acetamide
Ar = aromatic such as 4-fluorophenyl or 3,4-difluorophenyl
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-345-
Scheme L: Determination of the Absolute Stereochemistry of the Di-Substituted
Oxazolidinones
Using Lactic Acid Derivatives
O
O ~ O '~'~
i a b I N c
~O > ~N ~ \.~O ~
OH OH ~ S~
O HO~ N
F I F NH2
\~O I ~ ~ \ O 'l~ -a> ~ F
Si\ F Si\ ~ F OH ~ F
F F F
\ F ~ \ F ~ \ F
h > ~,, + ,,,
'.O NH ,.O NH , .~ NH
a. pyrrolidine, methanol, heat; b. t-butyldimethylsilyl chloride; c. LAH,
ether, reflux
d. (BOC)20, chloroform; e. NaH, THF; h. silica gel chromatography
For more details, See: Lagu, B.; Wetzel, J. M.; Forray, C.; Patane, M. A.;
Bock, M. G.
"Determination of the Relative and Absoiute Stereochemistry of a Potent a1 A
Selective
Adrenoceptor Antagonist" Bioorg. Med. Chem. Lett. 2000, 10, 2705.
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-346-
Table 1 (Continued)
EXAMPLE No. , STRUCTURE Ki (nM)
rMCH1
_ F
F
O ~0
38 ~ N 1.34
\O . N NON
I ~\ N
I N o W II
I ~o ~ ,
F
F
I
0 ~0
39 ~ ~ ~ 3.33
0 ~ N N N
N"0 ~ N~0/
/0 ~ / 00
I F I~
F
0 ~0
40 j ~ ~ ~ ~ 2.72
I 0 ~ N N N
0 ~ N
I /~ ' ~ ~ I
F
1
o / o ~ 0.04
41 \o I ~ NON I
I N I
N 0
I /~
I
F i
I ~F I
1 ~ ~ I
0 / 0
42 ~ ~ ~, ~ 0.6
0 ~ . N H N
~ N
N ~0
/p ' -
I
i F
\ F
p I / O~~
43 , \p I # N~N~N i 0.23
I
N
i N ~O \
I /O I / O I
I F
\ F
I I
O ~O
44 I ~ ~ 0.09
~0 N N ~N
N
I N O \ I
/O I ~ O I
i II
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
Table 1
-347-
F -
F
_ ~ / p a
45 N - NON ~ 14.69
~ ~ N
O "N
O~ ~ / 0 F
i1
L
F
F
/
46 l ° 8.1 s
N . ~ NON
~ \ N
O~N
i
F - L
F
I I \ I.
/ o
47 I ~ NON ~ 34,28
O N ~ ~ ~ N
II I i
0
I I
F I
f
F
0
\ N
48 ~ N : ~ N~~N 22.15
O~N
1 O\ ~ / O
I
F
~F
r1 //
4g ° 225.47
N . ~ NON
~ N
O "N
0~ /
F
F ,I
C Ii
50 ~ N . I NON CHI ~j 13.74
pi 'N \ N~CH~ i
1 00
O~CH~ /
F
F ~ F
51 ~ N~N~N ~~ 0.79
i
I
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-348-
Table 1
t W
I I ~ F
0
52 I I ~ o I ~ NON o~ ~ 0.81
N o ~N
J o 0
53 I o o o~ 50.76
t N~N~./'~N N I
o I ~ ~
N o I ,
O N O
1
j ~ / ~I
I N~N~/'~N o ~' 29.87
54
O
S
N
4 / Oi
I
i
N ~O~ V
,N
55 O N~N~N O~ 203.74
o I I
N ~0 I /
I
t
I F
~ F
I 0
5s ~ o ~ ~N p~ 0.26
~p~N N \ N
N ~p , /
I N
57 ~ / \ ~ ~ 90
O N ~O
I
N
I
58 ~ / ~ 3.9
N
0 0
N
59 / \ \ ~ 7s8
N
O O
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-349-
Table 1
i
i
i N \ /
60 ; / \ N \ / 357
P
0 O
I
p~l~
N f
61 j ~ \ ~ ~ ~ ~ ~ 14.2
~~~~\ N I
'=J 0 O I
i
N p i
62 f / ~ \ / ~ ~I 274
i N
I p ~~O I
I I
I
63 \ / ~ I ' 1000
i / \ . N II I
0 0
I i
_ I
N \ ~ 0
64 ' ~ \ N,SI-o ~ 627
o '
_ i
I N
65 , c~ ~ ~ N / ~ 69
! o ''~o
I
N
66 ,, \ ~ 2.8
CI ~ \ N
I 0 0
N
67 ~ \ / 197
\ N I
CI
O O
i
i
N
68 ~ ~ ~ 84
I c~ ~ ~ N \ /
i o 0
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-350-
Table 1
I
69 , " \ / \ / t 11.9
°' / \ "-~~
0 0 0-
I
N 0
70 ~ ~ ~ 167
C1 N y
I 0 0
i
N
I ~ ~ i
71 ~Cl ~ ~ N-~~ ~ 720
0
01
i
i
i N i
I ~ ~ o
72 ~ ci ~ ~ N_sl~ i 272
II
f
N
73 i ~ ~ N ~~ 342
I
N \
74 ~ ~ ~ 29.5
I N
0 0
I
75 r ~ / ~ 506
N \ / ,
I, 0 0
j
- j
76 ~ / - I
\ ~ j 21
o °
i
I
77 I o " ~ / 6 0
/ \ ~- 3
0 "o I
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-351
Table 1
I 0- N
78 l \ / ~ 52
9 0 ~ \ N
I / 0
;:
i 0 N \
79 p / \ N ~ l h 1036
/ ~/ p p ,
I Ii
o N \ I o_ I
80 i p / ~ U \ / i 67
I U
/ o p
II
81 \ / ~ / ~ 463
\ p p I
N
82 1 \ / \ / 192
p / \
0 0
83 ~ \ / N \ / 91
p / ~ N \ /
0 0
I
I
i
N
84 ' ° 511
\ p N II N~ !l
0
I I
I
N
654
s o
i p I
i
N
86
~ p 382
i '-N
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-352-
Table 1
h
N h
a
87 ' ~ ~ ~ ~ c ~ 362
I N
4 O L:
i ~I
a
I
I
88 I Br j ~ N ~ ~ ~ h, 160
0 '
n
\
89 ~ ~N ~ ~ 615
, \ / p
N-s-C 1i
b .,
!\ / o i
i o / \ iI
90 . _ ~ 651
N~ \ /
O
N_S,
_ h
j 0 N \
91 ~ - o N j 11.5
\ /
cL
j o
i \ /
92 ~ N~~N , 62
I
I ~ 0
_. O N \ / ,I
93 ~ _ N ~ 29.1
i
\ ~ N \ l I
94 ~ ~ N N ~ 18.2
I
0 0
I
0
95 / \ N~° I 11.8
N N
O
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-353-
'f-able 1
\ /
_ 96 ~ / ~ N 50
o~
i
II
J ~ \ o ~' I.
97 ~ \ ~ ~ 946
N~N
l
o ,
I'
o N \ / i!
98 i N ~ 118
\ / o ji
i 1.
/ 'i
o N \ /
g9 I - N f 12
I \ / ° i
I
I
11.5
100 ; ~ I
A \ / o~ I
I
\ /
101 F / \ ~ \ o~ 1.6
--F
N
102 ~ \ / N 187
N \
F
103 FF ~ ~ ° N ~ 52
F
I
I _
i
I / \
104 i o N \ / 6.7
N
\ /
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-354-
Table 1
° N \ /
105 I ~~ 7.1
~ N !
I \ / 0
I
i 0-
i /~ _ G
106 i ° N \ / ~! 3.9
\ / ° N
c1
/ \ t
107 I ° N \ / ~ 3.1
\ / o
I
~ a
I I
108 j ° N \ / ~, 3.8
N i
\ / °
F F
I F
109 ~ o N ~ / 7.1
N
O
I
F / ~ F
I
110 ~ o N ~ ~ 4.9
N .I
i \ / O
i
CI CI
/ \
111 ; °- N \ / 5
I N
\ / °
i / \
I O, N
112 ; \ / 22.3
N
i
0 N
113 f N 16.6
~ ~ 0 I
i
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-355-
Table 1
N
f
I
_ 114 ~ o N ~ ~ l 2.01
o N
I
F
1 / \ n
115 ' ° N \ / h 12.9
N
I \ / o~ t
n
Br
/ \
116 ~ ° N \ / ~ 0.923
_ f;
l, N
I \ / O ~i
I O
~ l
117 ~ o
/ II 13.6
a
o N
o r \
118 ~ o N ~ ~ ~ 12.8
\ / ° N
I
119 ~ ° ~, N 22.4
I I ~ ~ N
I / o
r ° /
120 ' ~ N ~ / ' 14.8
j~
/ o
1
F F i
F / ~ F
I
121 ~ °, N \ /
17
l N
\ / O
F -
i ~ F I
F
I O'
122 , \ N F 3.3
I ~ w N
l I ~ o
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-356-
Table 1
I
o F
123 ( \ N k 5.9
N
I ~ ~ o
i
I/ \
N
124 °- \ / ~I 9.3
N
\ / o ~i
\ /-
' / II
o -
125 ° N \ / ~ 32.5
\ / o~
0
/ f
i
126 ; ' 50
N
i / I ~ N 11 Ii
' ' ° I
F /
O N
127 ~ - \ ~N ~ 6.6
\o
F F 'I
O
128 ' ~N ~N ~N °~ ~ 31.4
O--~ N
O I \
F
F~ F
129 ~- ~ o~ 22.3
\ N N'~N
O N
I --~'o I \
I /
F
/ F
130 ' ~ ~ o~ ~ 48.6
N N
~N
Q
F
I
131 = o
,,.~N~ ~ o~ 11.8
0_~~
N
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-357-
Table 1
of
i
o a
132 ~ N ~ ~ N o W 44.6
O N 'w.
i O ~ r
f ° / \
j p~+ -
°. N \ / I
133 ~ 25.7
I N t.
I
\ / ° I
r
i I~
/ \ "r
I
1 I
i / \
134 ~ p N ~ / I' 22.2
N i
I
l ~ / O )I
O. ~i
O=N'
i / \ I
135 j o N ~ / ~ 19.4
N
I I
~ / v
o
I - I
136 ~ N \ / j 14.3
j \ f o N f
I I
/ \ \ I
I
137 , ° N \ / 377
_ N
i
,'I
t ' ~ j
I
i o I
138 ~ o N N \ / 0 11.2
N
\ I
139 ~ / _ N--~ 48.1
\ /
1
I
O- I
I, G
1 O W ~ O-
i40 j - i 121
W N ~ ~ NH i
i O
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-358-
Table 1
i ~ ~ 0
0 - \
141 ~ I ~ N ~ ~ ~ 3.2
j
i 0
f G
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-359-
- In Vivo Models
Materials and Methods
1. Effects on MCH-Stimulated Food Intake
To determine if an MCH1 antagonist could attenuate MCH-
stimulated food intake, the effect of an i.p, dose of
Compound 10 on food intake induced by intracerebral
ventricularly administered MCH was measured.
Animals
Adult male albino Wistar rats (Charles River Laboratories,
NY) were housed individually and maintained on a 12h light
dark cycle and given free access to Purina rat cho-a and
water. Rats were pretreated with chlorpromazine (3 mg/kg,
i.p.) and anesthesized with Ketamine HC1 (120 mg/kg,
i.m.). A stainless steel cannula (22 gauge, Plastics One,
Roanoke, VA) was implanted stereotaxically (Kopf
Instrumetns, Tujunda, CA) aimed at the third ventricle
using the following coordinates: incisor bar (+5 mm), 3.0
mm posterior to Bregma, 1.5 mm lateral and angled 10°
towards the sagittal suture, and 9 mm from the top of the
skull. The cannula was secured to the skull by 4 anchor
screws with dental acrylic. Animals were allowed 10 days
to recover before testing began.
Testing Paradigm
Rats were habituated to the testing paradigm over several
days in which the food bin was removed from the home cage,
and preweighed food pellets were placed on the floor of
the animal's cage at 3-6 hours into the light cycle.
Animals were considered to have met a baseline criterion
of minimal food intake (<1 g over 2 hours) after 2
consecutive days. Rats were then administered vehicle
(artificial CSF, 5 u1, 1 u1/15 sec) into the third
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-360-
ventricle via a stainless steel internal cannula (28-
gauge, Plastics One) connected to a Hamilton microsyringe
by polyethylene tubing. Food was introduced on the flocr
of the cage immediately after injection and intake was
assessed 30, 60 and 120 min after. After verifying low
levels of intake following vehicle administration, MCH (3
nmol, 5 u1) was microinjected into the third ventricle and
food intake assessed as above. Subgroups of these rats
were then tested with the following pairs of injections in
counterbalanced order with a minimum of 4 days elapsing
between injection conditions: a) DMSO (10, i.p.) 10 min
prior to MCH (third ventricle, 3 nmol, 5 u1, n=11), b)
Compound 10 (1 mg/kg, i.p.) 10 min before MCH (third
ventricle, 3 nmol, 5 u1, n=8), and c) Compound 10 (10
mg/kg, i.p.) 10 min before MCH (third ventricle, 3 nmol,
5 u1, n=6). Food was introduced immediately after the
second injection and intake assessed as above.
2. Effects of MCH1 Antagonists on BodSr Weight
Male Long Evans rats (Charles River) weighing 180-200
grams at the start of experiments were housed in pairs
(osmotic minipump experiment) or groups of four (i.p.
injections) on a 12 hour light/dark cycle with free access
to food and water.
For studies involving .osmotic minipumps, rats were
anesthesized with isoflurane (Aerrane, Baxter
Pharmaceutical) and an osmotic mimpump (model 2ML2, Alzet,
Palo Alto, CA) filled with either vehicle (20 o DMSO),
Compound 10 (19.2 mg/ml in 20 o DMSO) or d-fenfluramine
(Sigma, St. Louis MO; 11.5 mg/ml in 20% DMSO) was
implanted subcutaneously into the mid scalpular region.
At these concentrations, rats received continuous
infusions of 10 mg/kg/day of Compound 10 or 6 mg/kg/day of
d-fenfluramine.
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-361-
For studies involving i.p. injections, drugs were
administered twice daily; once 1 hour before the dark
cycle and once 2 hours after lights on. All rats were
weighed daily after the morning injection. Overall
results were analyzed by two-way ANOVA, data for each time
point were analyzed by one-way ANOVA followed by post hoc
Student-Newman-Keuls test.
3. Effects of MCH1 Antagonists on Consumption ofSweetened
Condensed Milk
Male Sprague Dawley rats (Charles River) weighing 180-200
grams at the start of experiments were housed in groups of
four on a 12 hour light/dark cycle with free access to
food and water. For 7 days, rats were weighed, placed in
individual cages and allowed to drink sweetened condensed
milk (Nestle, diluted 1:3 with water) for 20 min 2-5 hours
into the light cycle. The amount of milk consumed was
determined by weighing the milk bottle before and after
each drinking bout. On the test day, rats received i.p.
injections of Compound 10 (3, 10 or 30 mg/kg in 0.01 0
lactic acid), vehicle (0.01 0 lactic acid) of d-
fenfluramine (3 mg/kg in 0.01 0 lactic acid) 30 min prior
to exposure to milk. The amount of milk consumed on the
test day (in mls milk/ kg body weight) was compared to the
baseline consumption for each rat determined on the
previous 3 days. Data was analyzed using a two-tailed
unpaired t-test.
4. Forced Swim Test (FST)
The procedure used in this study was similar to that
previously described (Porsolt, et al., 1978), except the
water depth (30 cm in this procedure). The greater depth
in this test prevented the rats from supporting themselves
by touching the bottom of the cylinder with ~ their feet .
Swim sessions were conducted by placing rats in individual
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-362-
plexiglass cylinders (46 cm tall x 20 cm in diameter)
containing 23-25°C water 30 cm deep (Porsolt, et al. used
a depth of only 15 cm; also, see Detke, et al., 1995).
Two swim tests were conducted always between 1200 and 1800
hours: an initial 15-min pretest followed 24 h later by a
5-minute test. Drug treatments were administered 30
minutes before the 5-minute test period. All other test
sessions were conducted between 1300 to 1700 hours.
Following all swim sessions, rats were removed from the
cylinders, dried with paper towels and placed in a heated
cage for 15 minutes and returned to their home cages. All
test sessions were videotaped using a Panasonic color
video camera and recorder for scoring later.
Animals
Male Sprague-Dawley rats (laconic Farms, NY) were used in
all experiments. Rats were housed in pairs and maintained
on a 12:12-h light-dark cycle. Rats were handled for 5
minutes each day for 5 days prior to behavioral testing.
Behavioral Scoring
The rat's behavior was rated at 5 second intervals during
the 5 minute test as one of the following:
1. Immobility- rat remained floating in the water
without struggling and was only making those movements
necessary to keep its head above water;
2. Climbing - rat was making active movements with
its forepaws in and out of the water, usually directed
against the walls;
3. Swimming - rat 'was making active swimming
motions, more than necessary to merely maintain its head
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-363-
above water, e.g. moving around in the cylinder.; and
4. Diving - entire body of the rat was submerged.
All of the behavior scoring was done by a single rater,
who was blind to the treatment condition.
Drua Administration
Animals were randomly assigned to receive a single i.p.
administration of Compound 10 (3, 10 or 30 mg/kg,
dissolved in 50 lactic acid), fluoxetine (10 mg/kg,
dissolved in distilled water) or vehicle (equal mixture of
5% lactic acid and distilled water) 30 minutes before the
start of the 5 minute test period. All injections were
given using 1 cc tuberculin syringe with 26 3/8 gauge
needles (Becton-Dickinson, VWR Scientific, Bridgeport,
NJ). The volume of injection was 1 ml/kg.
The effect of 10 mg/kg of fluoxetine was utilized in the
FST as a positive control.
Data Anal~rsis
The forced swim test data (immobility, swimming; climbing,
diving) were subjected toga randomized, one-way ANOVA and
post hoc tests conducted using the Student-Newman-Keuls
test. The data were analyzed using the GBSTAT program,
version 6.5 (Dynamics Microsystems, Inc., Silver Spring,
MD, 1997). All data are presented as means ~ S.E.M.
5. Social Interaction Test (SIT)
Rats were allowed to acclimate to the animal care facility
for 5 days and were housed singly for 5 days prior to
testing. Animals were handled for 5 minutes per day. The
design and procedure for the Social Interaction Test was
carried out as previously described by Kennett, et al.
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-364-
(1997). On the test day, weight matched pairs of rats (~
5o), unfamiliar to each other, were given identical
treatments and returned to their home cages. Animals were
randomly divided into 5 treatment groups, with 5 pairs per
group, and were given one of the following i.p.
treatments: Compound 10 (3, 10 or 30 mg/kg), vehicle (1
ml/kg) or chlordiazepoxide (5 mg/kg). Dosing was 1 hour
prior to testing. Rats were subsequently placed in a white
perspex test box or arena (54 x 37 x 26 cm), whose floor
was divided up into 24 equal squares, for 15 minutes. An
air conditioner was used to generate background noise and
to keep the room at approximately 74°F. All sessions were
videotaped using a JVC camcorder (model GR-SZ1, Elmwood
Park, NJ) with either TDK~ (HG ultimate brand) or Sony 30
minute videocassettes. All sessions were conducted
between 1:00 - 4:30 P.M. Active social interaction,
defined as grooming, sniffing, biting, boxing, wrestling,
following and crawling over or under, was scored using a
stopwatch (Sportsline model no. 226, 1/100 sec.
discriminability). The number of episodes of rearing
(animal completely raises up its body on its hind limbs),
grooming (licking, biting, scratching of body), and face
washing (i.e. hands are moved repeatedly over face), and
number of squares crossed were scored. Passive social
interaction (animals are lying beside or on top of each
other) was not scored. All behaviors were assessed later
by an observer who was blind as to the treatment of each
pair. At the end of each test, the box was thoroughly
wiped with moistened paper towels.
Animals
Male albino Sprague-Dawley rats (laconic Farms, NY) were
housed in pairs under a 12 hr light dark cycle (lights on
at 0700 hrs.) with free access to food and water.
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-365-
Drua Administration
Compound 10 was dissolved in 50 lactic acid.
Chlordiazepoxide (purchased from Sigma Chemical Co., St.
Louis, MO) was dissolved in distilled water. The vehicle
was an equal mixture of 50 lactic acid and distilled
water. All drug solutions were made up 10 minutes prior to
injection and the solutions were discarded.
Data Anal~~sis
The social interaction data (time interacting, rearing and
squares crossed) were subjected to a randomized, one-way
ANOVA and post hoc tests conducted using the Student-
Newman-Keuls test. The data were subjected to a test of
normality (Shapiro-Wilk test). The data were analyzed
using the GBSTAT program, version 6.5 (Dynamics
Microsystems, Inc., Silver Spring, MD, 1997). All data
are presented as means ~ S.E.M.
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-366-
Results and Discussion
Cloning and Sequencing
Discovery of an Expressed Seauence Tag (EST) F07228 in
GENEML Homologous to FB4la
A BLAST search of GENEMBL with a Synaptic Pharmaceutical
Corporation proprietary sequence, FB4la, resulted in the
identification of an EST (accession number F07228) with a
high degree of homology to FB4la and somatostatin, opiate
and galanin receptors.
Construction and Screening of a Human Hippocampal cDNA
Library
A human hippocampal cDNA library containing a total of 2.2
xl0e~independent clones with a mean insert size of 3.0 kb
was prepared in the expression vector pEXJ.BS. The library
was plated on agar plates (ampicillin selection) and
glycerol stocks for 450 pools of 5000 independent clones
were prepared. Primary glycerol stocks were also grouped
together in groups of approximately 10 to create
superpools.
Cloning of the full-length sequence of MCHl
Glycerol stocks of the superpools and primary pools from
the human hippocampal cDNA library were screened by PCR
with F07228 specific primers T579 and T580. One positive
primary pool 490, was successively divided into subpools,
amplified in LB medium overnight and screened by PCR using
primers T579 and T580. One positive subpool, 490-4-10-23
was plated on agar plates (ampicillin selection), and
colonies were transferred to nitrocellulose membranes
(Schleicher and Schuell, Keene, NH). Filters were
hybridized for two days under high stringency conditions
with 10~ cpmlml of a j='P-labeled cDNA probe, T581,
designed against the F07228 EST sequence. Filters were
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-367-
washed and apposed to Biomax MS film (Kodak). Seven
positive colonies were picked, streaked on LB-AMP plates,
and grown overnight. Two individual colonies from each of
the original seven were picked and subj ected to vector-
s anchored PCR using the following primer pairs: T95, T580
and T94, T579. One positive colony, Gl, was amplified
overnight in TB and processed for plasmid purification.
This plasmid was designated TL230 and sequenced on both
strands. Nucleotide and peptide sequence analysis were
performed with GCG programs (Genetics Computer Group,
Madison, WI). A HindIII- KpnI fragment of TL230 was
subcloned into the mammalian expression vector pEXJ, and
named TL231. The largest open reading frame in this
construct contains 1266 nucleotides (Figure 1), which is
predicted to encode a protein of 422 amino acids (Figure
2). There are three in=frame methionines in the amino
terminus which could result in a protein of 422, 417 or
353 amino acids. Hydropathy analysis of the protein is
consistent with a putative topography of seven
transmembrane domains, indicative of the G protein-coupled
receptor family (Figure 3). TL231 has been named MCH1.
Database analysis of the sequence of MCH1 revealed that it
was most similar to somatostatin receptors. Further
database analysis revealed a Genbank submission (accession
number AF008650, deposited on October 1, 1997) which
appears to be the rat homologue of TL231. AF008650 is 69
nucleotides shorter than MCH1 at the 5'end, and predicts
a different initiating methionine. Figures 4 and 5
illustrate the nucleotide~and amino acid sequence for the
rat MCH1 receptor, respectively.
Inositol phosphate response of MCH1-transfected cells
The expression vector (pEXJ) containing the MCHl cDNA was
transfected by electroporation into Cos-7 cells in
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-368-
combination with an expression vector (pEXJ) containing
the Gals subunit. After plating and labeling with [3H] -myo-
inositol, the transfectants were challenged with a ligand
library that included, among other things, melanin
concentrating hormone (MCH) (10 uM final concentration)
and then assayed for inosi.tol phosphate (IP) formation. In
five out of the seven screens, cells transfected with MCH1
(with Gal6) gave an approximately 1.4-fold increase in IP
production as compared to cells transfected with GalE alone
when challenged with MCH.
Subsequent experiments demonstrated that 10 uM MCH was
able to stimulate IP release 3.4-fold over basal levels in
Cos-7 cells transfected with MCH1 alone, suggesting that
this receptor couples through the G9 signaling pathway.
The IP response was shown to be dose-dependent to MCH with
an EC,p value of 9 . 3 ~ 1 . 7 nM (n=2 ) and an Ema:: of
approximately 400% basal (404 ~ 72) (figure 6).
Several additional compounds were tested for their ability
to activate MCH1. No dose-responsiveness of inositol
phosphate formation could be detected in Cos-7 cells
transfected with MCH1 when challenged with somatostatin,
haloperidol, or dynorphin A1-13, discounting the
possibility that MCH1 encodes a somatostatin-like or
opioid-like or sigma-like GPCR subtype (Figure 7)
Microphysiometricresponse of MCH1-transfected cells to
MCH
CHO cells were transiently transfected with MCH1 using
lipofectant, challenged with increasing concentrations of
MCH or Phel3, Tyrl9-MCH, and subsequently monitored for
changes in extracellular acidification rates. Both
ligands produced a dose-dependent increase in
acidification rate with an EC,~ value of 8.6 nM for MCH and
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-369-
51.8 nM for Phel3,Tyrlg-MCH. Neither native CHO cells or
mock (pEXJ) transfected CHO cells exhibited a change in
acidification rate when exposed to MCH or Phel3, Tyrl4-MCH
(Figure 8).
Transcriptional response of MCH1-transfected cells
Cos-7 cells were transiently transfected with MCH1 and a
c-fos-~i-gal reporter construct by the DEAE-dextran method.
The cells were challenged with assorted drugs, including
MCH, and transcriptional activity measured by colorimetric
assay of ~-galactosidase protein expression. Initial
single dose challenges with MCH at a concentration of 10
~M stimulated c-fos-regulated transcriptional activity
approximately 3.9-fold over cells challenged with medium
only. Cells transfected with only the c-fos-(3-gal
construct showed no response to MCH. Subsequent
experimentation showed the transcription activation
response to be dose-dependent to MCH with an EC,o value of
11~ nM (Figure 9) .
Binding of ~lzsl ~ phel3 , T~rrl9-MCH in MCH1-transfected cells
Membranes harvested from Cos-7 cells transfected with MCH1
by the DEAF-dextran method exhibited specific binding for
[1=jI] Phel3-Tyrlg-MCH (about 80 fmol/mg membrane protein)
over mock-transfected cells (about 20 fmol/mg membrane
protein) at 0.1 nM radioligand concentration. Specific
['-'='I ] Phel'-Tyrlg-MCH binding was about 7 0 0 of total binding
at a radioligand concentration of 0.1 nM (Figure 10).
hocalization of mRNA encoding human MCH1 receptors
RT-PCR was used to assess the presence of MCH1 receptor
encoding message in mRNA samples isolated from a variety
of human tissues (Table 1, Figure 11). After
amplification, PCR reactions were size fractionated on 100
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-370-
polyacrylamide gels, and stained with SYBR Green I.
Images were analyzed using a Molecular Dynamics Storm 860
workstation. The amplified band corresponding to MCH1
receptor (490 base pairs) is indicated (arrow). RT-PCR
analysis indicates the distribution of mRNA encoding human
MCH1 receptor is widespread throughout all tissues
assayed, including both central nervous system tissue and
peripheral organs. This widespread distribution implies
broad regulatory functions that involve nervous system as
well as endocrine mechanisms.
Table 1. Distribution of mRNA coding for human MCH1
receptors.
Region human Potential applications
MCH
1
liver +++ Diabetes
kidney +++ Hypertension, Electrolyte
balance
lung +++ Respiratory disorders, asthma
heart +++ Cardiovascular indications
small intestine +++ Gastrointestinal disorders
striated muscle +++ Musculoskeletal disorders
pituitary +++ Endocrine/neuroendocrine
regulation
whole brain +++
amygdala +++ Depression, phobias, anxiety,
mood disorders
cerebral cortex +++ Sensory and motor
integration, cognition
hippocampus +++ Cognition/memory
hypothalamus +++ appetite/obesity,
neuroendocrine regulation
spinal cord +++ Analgesia, sensory modulation
and transmission
cerebellum +++ Motor coordination
thalamus +++ sensory integration
substantia +++ Modulation of dopaminergic
nigra function. Modulation of motor
coordination.
caudate-putamen +++ Modulation of dopaminergic
function
fetal brain +++ Developmental disorders
fetal lung +++ Developmental disorders
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-371-
fetal kidney ++~ Developmental disorders
(fetal liver I +++ Developmental disorders
The cloning of the gene encoding the human MCH1 receptor
has provided the means to explore its physiological role
by pharmacological characterization, and by Northern and
in situ mapping of its mRNA distribution. Further, the
availability of the DNA encoding the human MCHl receptor
will facilitate the development of antibodies and
antisense technologies useful in defining the functions of
the gene products in vivo. Antisense oligonucleotides
which target mRNA molecules to selectively block
translation of the gene products in vivo have been used
successfully to relate the expression of a single gene
with its functional sequelae. Thus, the cloning of this
receptor gene provides the means to explore its
physiological role in the nervous system and elsewhere,
and may thereby help to elucidate structure/function
relationships within the GFCR superfamily.
The presence of three different potential starting colons
in the cDNA sequence of TL231 opens the question of which
of the possible transcripts yields an active MCH receptor.
In order to establish whether a transcript of the first
and second starting colons of TL231 encode a functional
human MCH receptor, methionines 6 and 70 of TL231 were
mutated to alanine (construct 8114; See Figure 12). The
third methionine at position 70 was also mutated to an
alanine (construct 8106; See Figure 12). Transfections of
TL231, 8106 or 8114 into COS-7 cells all resulted in MCH-
mediated increases of intracellular calcium, as measured
by a fluorescent intensity plate reader in cells loaded
with the calcium dye fluo-3 (FLIPR, Molecular Devices).
As shown in Table 2, COS-7 cells transfected with TL231,
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-372-
8106, 8114 and B0120 showed dose-related mobilization of
intracellular calcium when exposed to increasing
concentrations of MCH with similar maximal responses and
EC50 values. These data demonstrate that transcripts
starting at the first and/or second and third methionine
of TL231 encode a functional human MCH receptor.
Table 2.
Transfected Response to Melanin
Construct Concentrating
Hormone*
EC50 (nM) Max. Response (RFU**)
TL231 60,12 3,535, 14,000
8114 98, 9 2,267, 1,550
8106 85, 55 4642, 2000
B0120 12, 3.5 30,000, 25,000
-
*Results from two independent experiments
** RFU = relative fluorescence units
Discovery of MCH1 Receptor Antaqonists
The intracellular calcium response to MCH in COS-7 cells
transfected with MCH1 was used as an assay to identify
MCH1 receptor antagonists. Compounds of known chemical
structure were added at a concentration of 1 mM to COS-7
cells expressing MCH1 loaded with the calcium indicator
fluo-3, and the fluorescence intensity was measured in the
absence and presence of 500 nM MCH. MCH1 antagonist
compounds were identified by their ability to inhibit the
MCH-elicited response. The identified compounds were then
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-373-
tested at 12 different concentrations (between 1e-4 to 3e-
M) to determine the dose that inhibited the response of
500 nM MCH by 500 (IC50). From the IC50 values, the
antagonist potency (Kb)was derived using the Cheng-Prussof
5 correction (Lazareno and Birdsall, 1993). Table 3
exemplifies compounds that were found to have a Kb lower
than 500 nM.
Among the compounds tested, Compound 10 was identified as
10 the most potent antagonist of the human MCH1 receptor. The
antagonism of Compound 10 was further characterized with
inositol phosphate response in Cos-7 cells transfected
with the human MCH1 receptor. As shown in Figure 16, in
the presence of 1, 3, and 10 nM of Compound 10 parallel
displacement of the dose-response curves for MCH were
observed, suggesting the presence of a competitive
antagonist. The Schild analysis of the dose-response
yielded a pA2 - 9.24 with a slope close to unity. This
value correlates closely with the Kb = 0.3 nM determined
using the intracellular calcium mobilization assay.
Given the high affinity of Compound 10 for the MCHl
receptor, a tritiated analog of this compound was
synthesized. [3H]Compound 10 was tested for its ability to
bind to membrane preparations of cells expressing the
human MCH1 receptor. As shown in Figure 17, addition of
increasing concentrations of [3H]Compound 10 in the
absence (Total) and presence of 10 mM Compound 10
(Nonspecific) resulted in saturable specific binding to
membrane preparations of Cos-7 cells transfected with
MCH1. The Scatchard analysis of the binding data estimated
a Kd = 0.18 nM for [3H]Compound 10 and maximum number of
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-374-
binding sites (Bmax) - 870 fmol/mg protein (see inset of
Figure 17). In competition binding assays using membrane
preparations of Cos-7 cells transfected with MCH1,
Compound 10 and MCH completely displaced the specific
binding of [3H]Compound 10 with IC50's of 0.33 and 511 nM
respectively (Figure 18). In non-transfected Cos-7 cells
the binding of [3H]Compound 10 was not displaced by MCH or
unlabeled Compound 10 up to 10 mM. These data together
demonstrate that [3H]Compound 10 is a specific and high
affinity radioligand for the MCH1 receptor.
As described in the Background of the Invention, compounds
that block the effects of MCH on its receptor can
potentially be used for the treatment of eating disorders
and obesity. The study of the regulation of body weight
and food intake point towards an important role for
hypothalamic circuits and their neurotransmitters together
with circulating metabolic signals, such as leptin, in
energy homeostasis (Elmquist et al., 1999). Hypothalamic
neurons that mediate appetite-driving (orexigenic) effects
include those that use neuropeptide Y, MCH, galanin, and
orexin as transmitters. Conversely, neural elements that
mediate orexigenic signals include among others those that
use serotonin (5HT), alpha-MSH, and CART (cocaine and
amphetamine regulated transcript) as transmitters. Recent
advances in the molecular cloning of the receptors for
some of these transmitter molecules, together with the
characterization of their pharmacological properties, has
enabled the identification of numerous potential targets
for therapeutic intervention. In the case of NPY, the
evidence suggests that both NYP1 and NPY5 receptors are
involved in mediating the orexigenic effects of NPY (Inui,
1999). The antiorexigenic effects of alpha-MSH are
mediated by the MC4 receptor (Fan et al, 1997). In
addition, an important role for the antiorexigenic effects
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-375-
of serotoninergic agonists was suggested by the obese
phenotype of mice with targeted deletion of the 5HT2C
receptor gene (Nonogaki, 1998). However, the interaction
between orexigenic and anorexigenic pathways in the
hypothalamus displays considerable redundancy typical of
other biological control mechanisms (Kalra et al., 1999).
This complexity suggests that the design of development of
drugs that target multiple orexigenic receptors might
result in an effective therapeutic modality that could
restore the imbalance of energy homeostasis that results
in obesity. One such approach could involve the
administration of a combination of antagonists of the MCH1
receptor such as those described above together with NPYl,
NPY5, or galanin receptor antagonists. An alternative
approach is to design a single molecule that antagonizes
the orexigenic effects of one or more of MCH, NPY, and
galanin by binding to one or more of MCH1, NPY1, NPY5, or
galanin receptors. However, in either case the compounds)
should be free of antagonist activity at the MC-4 or 5HT2C
receptor, since antagonizing these receptors could result
in increased food intake and obesity (Fan et al., 1997).
The design of such compounds can be optimized by
determining their binding affinity at the recombinant
MCHl, NPY1, NPY2, Gall, Gal2, Gala, 5HT2C, and MC-4
receptors. The methods to obtain the cDNA of the
receptor, express said receptors in heterologous systems,
and carry out assays to determine binding affinity are
described in the following publications: human NPY1
(Larhammar et al., 1992), human NPY5 (U.S. Patent No.
5,602,024, the disclosure of which is hereby incorporated
by reference in its entirety into this application), human
Gall (Habert-Ortoli et al., 1994), human Gal2 (Smith et
al., 1997), human Gal3 (Smith et al., 1998), rat 5HT2C
(Julius et al., 1988), and human MC-4 (Gantz et al.,
1993). Additionally, the compounds would optimally not
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-376-
bind at the following receptors due to possible side
effects: human H1 histamine, human H2 histamine, human
alpha-lA adrenergic, human alpha-1D adrenergic, human
alpha-2A, human alpha-2B adrenergic, human alpha-2C
adrenergic, human dopamine D1, D2, D3, D5 receptors and
the (3-adrenoceptor. Binding studies for the ~i-
adrenoceptor may be performed according to the method of
Riva and Creese, 1989. Binding assays for the remainder
of the receptors may be carried out according to the
procedures described in U.S. Patent No. 5,780,485, the
disclosure of which is hereby incorporated by reference in
its entirety into this application.
As further described in the Background of the Invention,
compounds that block the effects of MCH on the MCH1
receptor can potentially be used for the treatment of
depression and anxiety. Biogenic amine transmitter
molecules that mediate neuronal signals are currently
known in the art and include among others serotonin (5HT),
norepinephrine (NE), and dopamine (DA). Recent advances in
the molecular studies of the mechanisms for these
transmitter molecules, together with the characterization
of their pharmacological properties, has enabled the
identification of numerous potential targets for
therapeutic intervention. Inhibitors of the 5HT, NE and DA
transporter systems, and inhibitors of the enzyme,
monoamine oxidase, have been widely studied and are known
to enhance the action of biogenic amine neurotransmitters.
The resultant clinically effective antidepressant drugs
are known today as TCAs, SSRIs and MAOIs. (Tatsumi et al.,
1997; Iversen, 2000).
In the case of MCH, the evidence presented in this
invention suggests that GPCR-targeted molecules that bind
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-377-
to and antagonize the MCH1 receptor may be used for the
treatment of depression andlor anxiety disorders. However,
the MCH1 antagonists) should be free of activity at 5HT,
NE and DA transporters. Furthermore, the MCH1
antagonists) should not inhibit the enzymatic activity of
monoamine oxidase A (MAO) or monoamine oxidase B (MAOg)
present in the brain (i.e. central MAO). The design of
such compounds can be optimized by determining their
binding affinity at the 5HT, NE and DA transporters in
tissue assays. The design of such compounds can be further
optimized by determining their. interaction with central
MAO and central MAOB.
Additionally, the MCH1 antagonists) would optimally not
bind at the following receptors due to possible side
effects : human H1 histamine; human H~ histamine; human ala
adrenergic, human alB adrenergic, human a1D adrenergic,
human a~A adrenergic, human a~B adrenergic, and human a~~
adrenergic; human dopamine D1, D.,, D3, D9, and D~; and the
human 5HT1A, human 5HTla, human 5HT1L" human 5HT1E, human
5HT1F, human 5HTZA, rat 5HTL~, human 5HT4, human 5HT~, and
human 5HT7 receptors.
Radioliaand Binding Assays and Enzymatic Assays
The methods to obtain the cDNA of the receptors, express
said receptors in heterologous systems, and carry out
assays to determine binding affinity are described as
follows.
Human 5HTlg,~ 5HTln. 5HT1E~, 5HT1F, and 5HT~ Receptors: The cell
lysates of LM(tk) clonal cell line stably transfected with
the genes encoding each of these 5HT receptorsubtypes were
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-378-
prepared as described above. Cell membranes were suspended
in 50mM TrisHCl buffer (pH 7.4 at 37°C) containing l0 mM
MgCl2, 0.2 mM EDTA, 10 M pargyline, and 0.1o ascorbate.
The affinities of compounds were determined in equilibrium
competition binding assays by incubation for 30 minutes at
37 ''C in the presence of 5 nM ['HJserotonin. Nonspecific
binding was determined in the presence of 10 ~,M serotonin.
The bound radioligand was separated by filtration through
GF/B filters using a cell harvester.
Human 5HTzA Receptor : The coding sequence of the human 5HTnA
receptor was obtained from a human brain cortex cDNA
library, and cloned into the cloning site of pCEXV3
eukaryotic expression vector. This construct was
transfected into COS7 cells by the DEAF dextran method
(Cullen, 1987). Cells were harvested after 72 hours and
lysed by sonication in 5 mM TrisHCl, 5 mM EDTA, pH 7.5.
The cell lysates were subjected to centrifugation at 1000
rpm for 5 minutes at 4°C, and the supernatant was subjected
to centrifugation at 30,000 x g for 20 minutes at 4°C. The
pellet was suspended in 50 mM TrisHCl buffer (pH 7.7 at
room temperature) containing 10 mM MgS04, 0.5 mM EDTA, and
0.1o ascorbate. The affinity of compounds at 5HT~A
receptors were determined in equilibrium competition
binding assays using ['H]ketanserin (1 nM). Nonspecific
binding was defined by the addition of 10 ~,M mianserin.
The bound radioligand was separated by filtration through
GF/B filters using a cell~harvester.
5HTla Rece tp or: The cDNA corresponding to the 5HT~, receptor
open reading frames and variable noncoding 5' and
3'regions, was cloned into the eukaryotic expression
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-379-
vector pCEXV3. These constructs were transfected
transiently into COS7 cells by the DEAEdextran method
(Cullen, 1987), and harvested after 72 hours. Radiol.igand
binding assays were performed as described above for the
5HT~,~ receptor, except that 3H80HDPAT was used as the
radioligand and nonspecific binding was determined by the
addition of 10 ~,M mianserin.
Other 5HT Receptors: Other serotonin receptor binding
assays were performed according to published methods: rat
5HT.,~ receptor (Julius et al., 1988); and 5HT6 (Monsma, et
al., 1993). The binding assays using the 5HT9 receptor were
performed according to the procedures described in U.S.
Patent No. 5,766,879, the disclosure of which is hereby
incorporated by reference in its entirety into this
application.
Other receptors: Cell membranes expressing human dopamine
D, , D~, D9 and rat D3 receptors were purchased through
BioSignal, Inc. (Montreal, Canada). Binding assays using
the histamine H1 receptor; dopamine receptors; and a,lA, a.lB,
and a~adrenergic receptors may be carried out according to
the procedures described in U.S. Patent No. 5,780,485, the
disclosure of which is hereby incorporated by reference in
its entirety into this application. Binding assays using
the dopamine D, receptor may be carried out according to
the procedures described in U.S. Patent IVo. 5,882,855, the
disclosure of which is hereby incorporated by reference in
its entirety into this application. Binding assays for the
human az~, adrenergic receptor may be carried out according
to the procedures described in U.S. Patent No. 6,156,518,
the disclosure of which is hereby incorporated by
reference in its entirety into this application.
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-380-
The methods to determine binding affinity at native
transporters are described in the following publications:
5HT transporter and NE transporter (Owens et al., 1997),
and DA transporter (Javitch et al, 1984).
The methods to determine activity at monoamine oxidase
enzymes (for example, central MAOP and MAOB) are described
by Otsuka and Kobayashi, 1964.
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-381
U ~ m h ao 0 o h of o h o10 00 0 0
N ~ ~ ~ ~,.~L(1N O M d~ O CQO O 01 ~ O M
[i ', tI1l0~ O h O ~ tllO O O O C~ ~ O O
_ _ ~ _ ..o . . o . _ o _ o _
lf1 .,,i01N II1.-WI1O1l.nLf1dW--It11~ N 111u'1
~i x N M c-Iv-Vn M N n M ~ n M n N
4-I
b1
M ~ O O O O O O O Lf1O O O O O O O O
(Y, ~ O O O O O O O 01 O O O O O O O ~ O
a ~ 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 o
0 0 0 0 0 0 0 . 0 0 0 0 0 0 0 ~ o
a
r4" ~ n n n n n n n N n n n n n n n 'nn
N ~ O O M O O O O r-IO O O O O O O O
O O O O O O O N O O O O O O O h O
~ O O lDO O O O 01 O O O O O O O N O
O O ~ O O O O ~ O O O O O O O h O
h ~ tI1lI1N Lf1U1LC1Lf1d~ t!1LI1Lf1tI1Lf1Lf1(I1~ Lfl
n n ~rn n n n ~ n n n n n n n ' n
U
N
S-1 ri ~ O O O O O O O h O O O O O O O N O
(l,'~ O O O O O O O Ll1O O O O O O O lflO
', O O O O O O O O O O O O O O O N Q
x o 0 0 0 0 0 0 . 0 0 0 0 0 0 0 . o
U f~ H ulu,u,ar m ur,ul,~ u,~r,m .mn m n ~ ~r,
~ n n n n n n n ~ n n n n n n n ~ n
~ ~ O O O O L(1 ~ O O O O O O O O O
O O O O h q O O O O O O O Q O
U1 '~ ~ O O ~ O O O M O O O O O O O O O
0 o z o o . Z h o 0 0 0 0 0 0 0 0
O H u1ul ul tn~ y t1tmn tm.n ~nunu1u1
x n n n n ~r n n n n n n n n n
U
1~
U
N
_ ~-I ~ ~ O O ~o O o h O O O O O O O ~ O
O O h O O O O O O O O Q O
U '~ ' O O ~ O O O ~ ~ O O O O O O O O O
N ~ O O j . O O 'Z,~ O O O O O O O ~ O
LflLf1 h L(lLf1 ~ Lt1LC1UlIllLC11r>n~ tt1
n N n n ~ n n n n n n n ~ n
U
~
O e-i
~
Qt ~.., ,"t," M ~0N h O 01diO1
ri U ~' v-1N II1h OI~ N N O N ~OCO lDh 00h
O c-Id~ cr~ ~ e-1i-4N N N d~
ri r-~
O t31
O 00~ O 0101N l0 c-1COt!1h d~ l0h M O
r-I~-1~ N v-iN N N M N N ~-IM
ro
a
0
a
N
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-382-
~ o t~aoo ~- 000 o a~
N ~ 00N ~ Lf1O cr1~ O1c~1O
tftL~l0O 00 CO t~O 00Lf1 ~ O
Il1~ 01riN ll1tIl01~ d~lf11I1Lf1
LI x N ~-IM v-In M c'~1N n N
<i
r~
1'n~ O O O O O O O O ~ O Lft
O O O O O O O O O O'1 ~ O
a ,r o 0 0 0 0 0 0 0 ~ o 0
aG o 0 0 0 0 0 0 0 ' o ~ o
~ ~r,~,~r,~r,~ ~r,~
,~ n n n n n n n n n N ~y U
x
07 N ~ O O O O O O cr1O ~ O r1
O O O O O O O O N O N
a ,~ 0 0 0 0 0 0 ~oo ~ o o,
0 0 0 0 0 0 . o ' o ~ O
(' .H t11LClt11Ll1111111N tf1~ IIlc~
n n n n n n ~ n n ~
'~ U
r1 ~ O O O O O O O O N O L~ p U
o O o O O O O O ~o O tn
U ~",o o 0 o 0 0 0 o N o o .,~ O
N O O O D O O O O O
t11lIlLf7Lf)LllIllLfltIW-I Lf1c-I
n n n n n n n n ~ n ~ m U
~
' R~
U ~ _
~ O O O O O ~ O
~1 ~ '~~' Z O O '~ U
c-1 ~ w ~ O O O O O ~.., O ~ Cu' r
,. ~"., L!1tIlLC7LflL(1 LClLfll0' r-I
~r n n n n n n n ~ '" O
a "
O O O ~DO O ~ O ~
O O O i~O Z O O
O O O O O .~~.., O O p lD J
a LC1t11U W~!I1 ~(' ~ 1.1 1
n n n N n ~ ~ n ~
n
* -. 3 N
' ~ N ~-1d o M
'-1 x ~" ~ M ~ lD~ ~ ~ M L~ ttllp x
v o ~ ,~ M ~r V
U
m
.l-1p,~ --. _~ 01
O ''~', i M m n N ~ N ~ N .~"., N
x ~ ~ _,~ ~c
U ~ ~, ~ o000
~J -~ O c-iN 4-I O
.,~ W
~
O ' O 01COO r1 N V~d~M 01l0 r1
~ .-~~ c~N c-1 r-1N '~ .tJL31
~ U -~ ~ -~I
P4 ~ O
U *
,
r~
C-~
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-383
m
r '1 r CO MO due' ~ C~O
M O1~ ~ ~ ~ M Q ~ O N
:
~ ~ ~ z M O z ~ N
I
N N M r ~ N r ~ ~ O C r O C
Q Y O~d ~ O O N ~ r M ~
(p N N
r r r
C ~ p ~ I ~ C ~ ~ ~
~
r, N O ~ T , M N f O O d W0~ O 1
I I f r O a0~ M
CD ' I
Cfl
CO
~ ~ 1 C M O
Z '. pp~ M r In~ ~ N r ~ Q 00 O N 1 O Q M N O
(~N h M I f~ ~ Z C I CO Z
~ O M I
C
L ~ ~ ~ O ~ D M N M d' N 00I~
' '
'
M Cpr inI~ !.(7 N ~ ~ N ~ ~ N
Y ~ I~ d'~ O d M f~ r r O r' [w
I~rl00 ~ I ~ r
I N ~ I r
N
~
'~ Q)m f~ M 00O Ln p C~OO V~'N r M (MD COO
O
G O ~ r CO~ O [v O ~ O Q ~ COp 1~ ~
O i ~
I~r In O I~~ O O ~ O z ~ M In~ p z M p 00
O .
~ CDN
Y N N N ~ INM C~ /~ T /~ O ~ ~ N 0
/v
r_
C~M ~ O ~ NO~~ N '-~ ~ ~ 0r00M ~ r N
~
~
M
r M N O O O ~ N r O O ~ ~ O M
~ I
O
~
00
Y N l N N
I
C
7
00O O r N M I~ O O O r N M d'LOCD f~00
' ' i ' ' . ~
'V' '
~
In
CO
'
'
M M V <hV ~ ~ ~t~ t17tf~t1~LIB11~1.nLf~In47
C
~
V
U
U
M
(u
ccS
H
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-384
z ~ ~ ~ z T N z
~
z z o~ z z N r z ~ z z r z z z r
z r ~ N
D D ~ D O crJr r D D (~ ~ O D
Z z O z z z ~ O z ~ Z z Z D z z z ~ Z z
I ~ ~ z z N Z
z
r r ~ ~ ~ ' i
N
i ' i i
D D COD D D M N D r '~D D O N D O D D a D
1 ~ I N
O j
~
z z ~ z z z ip o z ~ ~~z z~ zz! ~ z ~ z~~ z T z
11 N ~ O N p p ~ ~ p ~ O N ~ ..OT p M f
l 'N I N
N Or ~ CD N r N ~ ~ y N N ~ N ~ OrCO
~ ' i j I I ( tn
i ' ~ ~ ; ~ ~ ~ I
' I i ~ I
I ~ r
~
' i 1 i
I i r p O r
i r ~'n D ~ 0 O ~ ' n O ~
p N ' ~ I ~ C~ I ~ f~
I I I CO
O Ch .
In C~O GOc0 CDO CO O I~ f~ r I~r i I~O 00
(D O I I . ' I~
I~ n (~
l '
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-385
vi
L
O
Q
U
U
L
U
L
(_
L
Q
r
_d
Q
O
- ~ ~ ~ ~ ~ 0 00O ~ ~
~
~
~
p ~ 00 C~ O O
Z Z Z Z Z O r r .
tnr ~ T N r ct~ ~O~
_ n
~
C
Ll~ 0 s~ 0 0 O > O M 0 ~ C~ d-f~ O
' ~
Z Z Z Z Z Z Z Z Z n ~ O N Z Z O chZ O
I
N N ~ ~ ~ N T C~
r r
~
N ~ ~ D D D D ~ ~ I t~ p ~ O O t7~ ~ ~ y N D O
I ~ I ~
~
~ Z I Z Z Z Z Z ~ ~ ~ ~ Z Z ~ ~ Z
Z : i
i T m p
i
Q
O 1
~
0 N r, r ~ N N O ~ r ~ N '~N ~ O O O N ~ O ~ N
O T Lf~00 COI LnI , '~
CD
O I r r O O 00 r ~ I r ,-r
lb r ~ ~ l~ M I ~ ~ I ' N r r ~ r r r I
r r ~ ~ r
~ ~
I l I! I i ) I i I
~
.
r I I I
U ~
I O r N C
N C~ ~tinCSJI~GO O O r N C~~ Ln(flT~ COO O i O O O
O
O ~ ~ ~ O O O ~ O O O O O O O O O O
r r ~ r r
T
L
U
M
O
c~3
H
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-386
L
0
Y
U
N
L
U
L
U
G
N
L
Q
T
Q
Q
G
3
~ ~
.C O r InN r I~tI~ p M r ~ O O M N O ~. r ~ N r
Cp
'a ~'(O ~ N 00N ~ O M r r lOV'N ~ r O M N
; N
r r M r N r r ~ M N ~' N M 1~ ~ O ll7N N' T
N
r r
r~
Z
G
O ~hO M O O M
N O O
O m ~ M O ~ ' M M O ue O ~
Qj C ~ O ~ N CO ~ p ~ C d r N I~
O O t ~ '
t
M M r N r N r ~ ~ l(7~ I~O N N CDr~M N M lL7l~
r
n
i
S
r ~ N d'r N LO O O N r O CpM r N M ~ ~
I I O)
I~- ~ 'C'07 M COM p O CO N COT CpT M M M O (p r
~ O
~ r N r O r ~ r M N N M I~M M r r ~. ~
r
Q.
0
r p r ODr ~ ~ M COr 07 N CD00 ~ 40~-M O)C~~ O
C 7 ~ CV COO N O M N N ~ N CO
( I ~i~ >n
f~CY lMM I I , r . tijO CO
j ~ <f' N r N r ~ r r N I wj M
~ I r- I
~
I O i y
I ;
I
,
U ~ I ~ I
~
!nCO I~COO r N M V'LO t0f~00 O r M d'Lf)CD
O ~ ~ l ' l O i f~
N
O O O O O r ~r rlr r r r r,r N~NiNI N N N N
r I ~ N
r r r r r r r T r r T r r ~ r r r r r
T I r r I r
r
1r
Y
Y
m
~C
N
Cn
C
C_
m
U
M
N
H
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-387
L
0
a
a~
U
L
U_
L
C
L
.
r
1?
a
u7 r M ~ ~ I~T N o ~ D p p N
~
c ' c~oc~~M N p ~ T ~ cNOZ Z Z Z
r
C
_
p N N ~ ~ ~ O 0 D D D O r
c _ 0 a Z Z Z Z
0 0
M
,M CDr N ~ d'L~ ~ ~
~
~
C
c0
7
t ~ d'r r V'
In Inr ~t InfwCO d'M ~ O D D V
V d tnO d' ' ,
; ~ ~ ~1M
0 r r O m r ~ M N COZ Z Z Z N
V M T d'
~
E
n
0
~ ~
D ~ M (O00 COf~N d:C~7~ N r r N
C r N COr d'InN O ~ ~ r 00N wj
' M T'
CLS M N ~ r V N N r r r ~
1
1
00 O O r- N M ~ LOCflI~ N ~ O r
N N M M M M M M M M M O ~ d'
M
r r r r r r r r r r r r r r
( ~
Y_
a>
_
c
i~
c
-o
c
m
ti
M
c~
H
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-388
U
U
N
b
I
f y -~ r1
n x ~ M z ~ z z
~ N
z z z -?-
O O
A x ~ ~ z N z z
~
U ~-tI W -1 U
N N ~ .
N ~ G~
x ~ * z ~ z z
z
x ~ ~ z ; z z
O
U ~ -~ N . O
x ~ z ~ z ~
~ ~
n
~ , . a
o
z
*
o z ~ o
n
-~ ~ v ~ * ~ ~'
N
~ ~
z N ~ ~ z
.~,
1
~ '1 ~r1~'M L\N t~o ~ ~~ ~ x,~'COr-Ic'~1f''1
( O ~j ,~ ~ M v-1v-IO M
J
1 '~ , N LI1l0N ~
~
Z71 S]a Ol J.J
'~ C~ CO
M ro~ Ej '~
~ ~ ~ ~ ~ ~ ~ ~ ~ o
o
x c o ~ o ' ~ N
n
, ~ ,-Id~d~~ ~ x.,
~
~
-w M tIlO~
.,"I~-,, LC1L~cY1~ .~ .~ ~ ~ ~ ~ 01N ~-1
x tW-1 N
O O '~ ~-d' N r-IO N O O '~
~ -w00
(<i e-I ~ (d O ''Ii ' o M d~ l0
J-~ ~ x .,~-,~ O .!J , ~i
~ ~-I ~i
~ . ('!1~ l0~ ~ '.O
, O ~ Ul
~-
b
M O O 0100 O
O O 01COO ~ O W ~-1c-Ir-iN
W c- W c1N r1
-1
O
V
V N
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-389-
AUTORADIOGRAPHIC DISTRIBUTION OF MCH1 RECEPTOR BINDING
SITES IN THE RAT CNS
Telencephalon
A low density of MCH1 receptor binding sites was detected
in the cerebral cortex with slightly increased binding in
the superficial layers. The septal nuclei (Figure 20A, C),
claustrum (C1) (Figure 20A, B), ventral and horizontal
limbs of the diagonal band, and piriform cortex (Pir)
likewise contained a low density of MCH1 receptor binding
sites (Figures 20A, A-F; 20B, G and H).
Some of the highest MCH1 receptor binding in the rat CNS
was observed in the basal ganglia and the olfactory
tubercle (Tu) (Figure 20A, B). The caudate-putamen (CPu)
and core of the accumbens nucleus (AcbC) displayed dense
labeling of MCH1 receptors while a very intense labeling
was present in the shell of the accumbens nucleus (Acbsh)
(Figure 20A, B). The globus pallidus (GP) was unlabeled.
The subthalamic nuclei (STh), part of the basal ganglia
circuit, was moderately labeled (Figures 20A, F).
The amygdala and extended amygdala displayed a moderately
low labeling with slightly higher radioligand binding
observed in the bed nucleus of the stria terminalis (BSTM)
(Figure 20A, C), the basolateral (BLA) and lateral
amygdaloid nuclei (LA) (Figures 20A, D and F).
Diencephalon
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-390-
In general, MCH1 receptor binding was weak throughout the
diencephalon. In the thalamus there was a slight increase
in binding intensity in the paraventricular (PVA),
centromedial, and anterodorsal thalamic nuclei (AD)(Figure
20A, D). In the epithalamus the medial habenular nucleus
(MHb) contained MCH1 receptor binding sites (Figure 20B,
G). Throughout the hypothalamus there was a uniformly weak
binding signal (Figures 20A, C-H; 20B, G and H). There was
a slight increase in MCH1 binding intensity in the
ventromedial hypothalmus (VMH) and in the medial mammillary
nucleus (MM) (Figures 20A, E; 20B H).
MCH1 receptor binding was moderate in the induseum griseum
(IG) (Figure 20A, B) and in Ammon's horn of the hippocampal
formation (CA1, CA2, CA3) (Figures 20A, E and F). MCH1
binding sites were present in the stratum oriens (so) and
stratum radiatum (sr) of field CA1, and in the stratum
oriens of field CA3. Moderate binding was observed in the
molecular layer of the dentate gyrus and in the
pre/parasubiculum (Figures 20A, E and H).
Mesencephalon
Overall, MCH1 receptor binding in the mesencephalon was
very weak. A slight increase in binding intensity was
evident in the periaqueductal gray (PAG) and in the pontine
nuclei (Pn) (Figures 20B, I and J). Moderate binding was
observed in the superior colliculus (SC) and the dorsal
raphe nucleus (DR) (Figures 20B, I and J).
Rhombencephalon fPons/Medulla)
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-391-
The highest density of MCH1 receptor binding sites in the
rhombencephalon was seen in the locus coeruleus (LC)
(Figure 20B, L). There was consistently low MCH1 receptor
binding throughout the pons and medulla (Figures 20B, K and
L). Slightly higher binding was detected in the inferior
colliculus (IC), the dorsal tegmental nuclei (DTN) and
parabrachial nuclei (PB) (Figure 20B, K) and the lateral
superior olive (LSO) (Figure 20B, L).
Spinal cord
MCH1 receptor binding sites appeared to be uniformly
distributed throughout the dorsal and ventral horns of the
spinal cord (Figure 20B, M). Binding density was slightly
increased in the superficial dorsal horn.
Table 4
The distribution of MCH1 receptor binding sites in the rat
CNS using Receptor Autoradiography with 0.l.nM [3H]Compound
10 in the presence of 1 ,uM prazosin and 100 ,uM dopamine.
The strength of [3H] Compound 10 (MCH1) labeling intensity
for the various rat brain regions was graded as absent (
weak (+), moderate (++), heavy (+++), or intense
( ++++ ) .
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-392-
Region Density of Potential
MCH1 receptor Application
binding sites
Olfactory System Modulation of
olfactory
sensation
Anterior olfactory n. +
Olfactory tubercle +++
Islands of Calleja, +++
major
Telencephalon Cognition
Claustrum ++ Visual
attention
Dorsal endopiriform n. + Olfactory
information
processing
Basal Ganglia
Globus pallidus
Caudate-putamen +++ Sensory/motor
integration
Accumbens n., shell ++++ Treatment of
drug addiction.
This region is
particularly
sensitive to
psychoactive
drugs.
Accumbens n., core +++ Treatment of
schizophrenia,
anxiety and/or
depression.
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-393-
Region Density of ~ Potential
MCH1 receptor Application
binding sites
Medial septal n. + Cognitive
enhancement via
cholinergic
system
Septohippocampal n. +
Amygdala Modulation of
endocrine
functions and
integrated
behaviors such
as defense,
ingestion,
reproduction,
and learning.
Treatment of
anxiety and/or
depression.
Central amygdaloid n. + Fear and
anxiety
Basolateral amygdaloid + Olfaction
n.
Bed n. Of the stria ++ Modulation of
terminalis the limbic
system.
Treatment of
anxiety and/or
depression.
Anterior cortical n. + Olfaction
Diencephalon
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-394-
Region Density of Potential
MCH1 receptor Application
binding sites
Thalamus Analgesia/
Modulation of
sensory
information
Paraventricular n. + Modulation of
motor and
behavioral
responses to
pain
Centromedial n. + Modulation of
motor and
behavioral
responses to
pain
Anterodorsal n. + Modulation of
motor
information to
the cerebral
cortex/ eye
movement
Reticular n. + Alertness/sedat
ion
Mediodorsal n.
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-395-
Region Density of Potential
MCH1 receptor Application
binding sites
Hypothalamus + Regualation of
endocrine
function,
reproductive
behaviors, and
appetite/obesit
y. Treatment of
anxiety and/or
depression.
Hippocampal formation Cognition/memor
y consolidation
and retention
CAl ++
CA2 ++
CA3 ++
Pre/parasubiculum ++ Modulation of
memory
aquisition
Mesencephalon
Superior colliculus ++ Modulation of
visual
information/
spatial
localization
Pontine n. +
Periaqueductal gray + Analgesia
Substantia nigra +
Interpeduncular n. ++ Analgesia
Caudal linear raphe n. +
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-396-
Region Density of Potential
MCHl receptor Application
binding sites
Locus coeruleus ++ Modulation of
NA transmission
Cerebellum
Spinal cord
Dorsal horn + Nociception/Ana
lgesia
Ventral horn + Spinal reflex
Discussion
> The anatomical distribution of the MCH1 receptor in the rat
CNS was determined by receptor autoradiography using
[='H]Compound 10 at 0.1 nM in the presence of 100 ,uM
dopamine and 1 ,uM prazosin to directly visualize the
receptor (Figure 19 A). Nonspecific binding was determined
by including 10 ,uM unlabeled Compound 10 in the incubation
buffer. The specific binding of [3H]Compound 10 was
approximately 95% (Figure.l9 B).
The results suggest that the MCHl receptor is widely
distributed in the rat CNS. MCH1 receptors are abundantly
expressed in the basal ganglia and moderately expressed in
the hippocampus and locus coeruleus. Weak MCH1 expression
was observed throughout the diencephalon, mesencephalon and
rhombencephalon. The spinal cord exhibited low expression
of the MCH1 receptor in the dorsal and ventral horns.
MCH-like immunoreactivity (MCH-LI) has been described in
the rat CNS (Skofitsch, G. et a1. 1985; Zamir, et al.,
1986; Bittencourt et al~. 1992). MCH-LI was detected
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-397-
throughout the entire brain, including the neocortex,
striatum, amygdala, hippocampus, diencephalon,
mesencephalon, and mylencephalon. Only the cerebellar
cortex did not contain MCH-LI. MCH cell bodies were
located in the hypothalamus, in the olfactory bulb
spreading caudally to the anterior amygdaloid area, and in
the region of the paramedian pontine reticular formation.
The diencephalon contained the highest concentration of
MCH-positive cell bodies and an extensive fiber network.
Telencephalic areas received a dense MCH immunoreactive
fiber network. Sparse MCH positive fibers were seen in the
neocortex, hippocampus, olfactory tubercle, caudate-
putamen, nucleus accumbens, thalamus,and the medulla and
the spinal cord.
Recently with the cloning of the MCHl,receptor (SLC-1)
(Saito, et al., 1999; Chambers, et al., 1999) the tissue
localization for MCH1 mRNA has been revealed. MCH1 mRNA
was localized to a variety of brain regions involved
including olfactory regions, the hippocampus, basal
ganglia, hypothalamus, amygdala, and locus coeruleus.
There was a particularly robust expression of mRNA in the
accumbens nucleus which is involved in behavioral
reinforcement. Subsequently, using receptor selective
antibodies the MCH1 (SLC-1) receptor protein distribution
was found to concordant with the distribution of the MCHl
mRNA in the rat CNS (Hervieu, et al., 2000). The
distribution of MCH1 binding sites using [3H] Compound 10
herein reported parallels the distribution of both xeceptor
mRNA and protein expression. The extensive distribution of
MCH1 receptor binding sites throughout the rat CNS is not
surprising because MCH cells in the lateral hypothalamus
and zona incerta project widely throughout the brain.
CA 02384358 2002-03-05
WO 02/02744 PCT/USO1/21350
-398-
Potential Application
MCH has been associated with regulation of food intake and
feeding behavior (Qu, et al., 1996; Rossi, et al., 1997;
Shimada, et al., 1998), the control of goal oriented
behaviors, general arousal or stress responses (Jezova, et
a1.,1992) and the regulation of fluid. homeostasis (for
review, Bernardis, et a1. 1993).
The anatomical distribution of MCHl receptor binding sites
is consistent with a role for the MCH receptor in the
regulation of food intake, thirst, and the reinforcement of
feeding behaviors. MCH1 receptor binding sites were
evident in the ventromedial, dorsomedial, and arcuate
nuclei which are areas that are recognized to be involved
in food intake, suggesting that the MCH1 receptor mediates
the orexigenic effects of MCH. MCH1 binding sites were
present in regions involving the regulation of fluid
homeostasis, the lateral hypothalamus and the zona incerta.
As already stated, the MCH1. binding sites are widely
distributed throughout the brain. The extensive
localization of MCH1 receptors in the neocortex and the
lateral hypothalamus supports a functional role for the
MCH1 receptor in general arousal.
MCH has been shown to increase ACTH release in v.ivo and to
have a stimulatory effect on the hypothalamic-pituitary-
adrenal gland axis (HPA). The site of action of MCH is
currently unknown, however one possible target are CRF
neurones located throughout the hypothalamus and the bed
DEMANDES OU BREVETS VOLUMINEUX
LA PRESENTE PARTIE DE CETTE DEMANDE OU CE BREVETS
COMPRI~:ND PLUS D'UN TOME.
CECI EST L,E TOME 1 DE 2
NOTE: Pour les tomes additionels, veillez contacter 1e Bureau Canadien des
Brevets.
JUMBO APPLICATIONS / PATENTS
THIS SECTION OF THE APPLICATION / PATENT CONTAINS MORE
THAN ONE VOLUME.
THIS IS VOLUME 1 OF 2
NOTE: For additional valumes please contact the Canadian Patent Office.
