Note: Descriptions are shown in the official language in which they were submitted.
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
HUMAN 7TM PROTEIN RECEPTORS AND POLYNUCLEOTIDES ENCODING THE SAME
The present invention claims priority to U.S. Provisional
Applications Ser. Nos. 60/153,366, filed 9/10/99 and
60/165,510, filed 11/15/99 which are herein incorporated by
reference in their entirety.
1. INTRODUCTION
The present invention relates to the discovery,
identification and characterization of novel human
polynucleotides that encode proteins and membrane associated
receptors. The invention encompasses the described
polynucleotides, host cell expression systems, the encoded
proteins, fusion proteins, polypeptides and peptides,
antibodies to the encoded proteins and peptides, and
genetically engineered animals that lack the disclosed genes,
or over express the disclosed sequences, or antagonists and
agonists of the proteins, and other compounds that modulate
the expression or activity of the proteins encoded by the
disclosed genes that can be used for diagnosis, drug
screening, clinical trial monitoring, and/or the treatment of
physiological or behavioral disorders.
2. BACKGROUND OF THE INVENTION
Membrane receptor proteins are integral components of the
mechanism through which cells sense their surroundings,
regulate cellular functions, and maintain physiological
homeostasis. Accordingly, membrane receptor proteins are
often involved in signal transduction pathways that control
cell physiology, chemical communication, and gene expression.
A particularly relevant class of membrane receptors are those
typically characterized by the presence of 7 conserved
transmembrane domains that are interconnected by nonconserved
hydrophilic loops. Such, "7TM receptors" include a
superfamily of receptors known as G-protein coupled receptors
(GPCRs). GPCRs are typically involved in signal transduction
pathways involving G-proteins. As such, the GPCR family
1
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
includes many receptors that are known to serve as drug
targets for therapeutic agents.
3. SUMMARY OF THE INVENTION
The present invention relates to the discovery,
identification and characterization of nucleotides that encode
novel GPCRs, and the corresponding amino acid sequences of the
novel GPCRs. The GPCRs described for the first time herein,
are transmembrane proteins that span the cellular membrane and
are involved in signal transduction after ligand binding. The
described GPCRs have structural motifs found in the 7TM
receptor family. The GPCR mRNA transcripts are expressed,
inter alia, in placenta, lung, kidney, liver, and pancreas,
cells, among others. The novel human GPCRs described herein,
encode proteins of 1,250, 1,221, 718, 1,112, 1,249, 1,220,
717, 1,111, 1,250, 1,221, 718, 1,112, 541, 512, 8, 403, 1,222,
1,193, 690, 1,084, 1,221, 1,192, 689, 1,083, 1,222, 1,193,
690, 1,084, and 1,192 amino acids in length (see SEQ ID NOS:
2, 4, 6, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34,
36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, and 58
respectively). The described GPCRs have the characteristic
seven transmembrane regions (of about 20-30 amino acids), as
well as several predicted cytoplasmic domains. As evidenced
by the alternative 5' regions, and splice junctions of the
open reading frames presented in the Sequence Listing, the
transcription of the described novel GPCRs can apparently
initiate from one of several different promoters present
within the genome. Depending on which promoter is used, the
described novel GPCRs (NGPCRs) can have one of several
distinct amino acid sequences at or near the amino terminal
region of the protein.
Additionally contemplated are murine homologs of the
described NGPCRs and corresponding "knockout" ES cells that
are produced using conventional methods (see, for example, PCT
Applic. No. PCT/US98/03243, filed February 20, 1998, herein
incorporated by reference). Accordingly, an additional aspect
of the present invention includes knockout cells and animals
2
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
,having genetically engineered mutations in the genes)
encoding the presently described NGPCRs.
The invention encompasses the nucleotides presented in
the Sequence Listing, host cells expressing such nucleotides,
the expression products of such nucleotides, and: (a)
nucleotides that encode mammalian homologs of the described
NGPCRs, including the specifically described human NGPCRs, and
the human NGPCR gene products; (b) nucleotides that encode one
or more portions of the NGPCRs that correspond to functional
domains, and the polypeptide products specified by such
nucleotide sequences, including but not limited to the novel
regions of the described extracellular domains) (ECD), one or
more transmembrane domains) (TM) first disclosed herein, and
the cytoplasmic domains) (CD); (c) isolated nucleotides that
encode mutants, engineered or naturally occurring, of the
described NGPCRs in which all or a part of at least one of the
domains is deleted or altered, and the polypeptide products
specified by such nucleotide sequences, including but not
limited to soluble receptors in which all or a portion of the
TM is deleted, and nonfunctional receptors in which all or a
portion of the CD is deleted; (d) nucleotides that encode
fusion proteins containing the coding region from an NGPCR, or
one of its domains (e.g., an extracellular domain) fused to
another peptide or polypeptide.
The invention also encompasses agonists and antagonists
of the NGPCRs, including small molecules, large molecules,
mutant NGPCR proteins, or portions thereof that compete with
the native NGPCR, and antibodies, as well as nucleotide
sequences that can be used to inhibit the expression of the
described NGPCR (e.g., antisense and ribozyme molecules, and
gene or regulatory sequence replacement constructs) or to
enhance the expression of the described NGPCR gene (e. g.,
expression constructs that place the described gene under the
control of a strong promoter system), and transgenic animals
that express a NGPCR transgene or "knock-outs" that do not
express a functional NGPCR.
3
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
Further, the present invention also relates to methods
for the use of the described NGPCR gene and/or NGPCR gene
products for the identification of compounds that modulate,
i.e., act as agonists or antagonists, of NGPCR gene expression
and or NGPCR gene product activity. Such compounds can be
used as therapeutic agents for the treatment of various
symptomatic representations of biological disorders or
imbalances.
4. DESCRIPTION OF THE SEQUENCE LISTING AND FIGURES
The Sequence Listing provides the polynucleotide
sequences of the described NGPCRs, and the amino acid
sequences encoded thereby.
5. DETAILED DESCRIPTION OF THE INVENTION
The human NGPCRs described for the first time herein are
novel proteins that are expressed, inter alia, in placenta,
lung, liver, pancreas, spinal cord, spleen, thymus, lymph
node, adrenal gland, stomach, salivary gland, stomach, mammary
gland, thyroid, heart, brain, testis, kidney, adipose,
esophagus, rectum, pericardium, trachea, and gene trapped
human cells. In view of the tissues that may express the
NGPCRs, the described human NGPCRs may be important targets
for the therapeutic treatment of, inter alia, diabetes,
abnormal body weight or obesity, atherosclerosis, heart
disease, abnormal blood pressure, cancer, and any associated
symptoms.
The described NGPCRs are transmembrane proteins that fall
within the 7TM family of receptors. As with other GPCRs,
signal transduction is triggered when a ligand binds to the
receptor. Interfering with the binding of the natural ligand,
or neutralizing or removing the ligand, or interference with
its binding to a NGPCR will effect NGPCR mediated signal
transduction. Because of their biological significance,
7TM proteins, and particularly GPCRs, have been subjected to
intense scientific and commercial scrutiny (see, for example,
U.S. Applic. Ser. Nos. 08/820,521, filed March 19, 1997, and
4
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
08/833,226, filed April 17, 1997 both of which are herein
incorporated by reference in their entirety).
The invention encompasses the use of the described NGPCR
nucleotides, NGPCR proteins and peptides as antagonists that
inhibit receptor activity or expression, or agonists that
activate receptor activity or increase its expression in the
diagnosis and treatment of disease. The invention also
encompasses the use of antibodies and anti-idiotypic
antibodies (including Fab fragments), preferably humanized
monoclonal antibodies, or binding fragments, domains, or
fusion proteins thereof which bind to NGPCR nucleotides,
proteins or peptides and act as therapeutic NGPCR agonists or
antagonists.
In particular, the invention described in the subsections
below encompasses NGPCR polypeptides or peptides corresponding
to functional domains of NGPCR (e. g., ECD, TM or CD), mutated,
truncated or deleted NGPCRs (e. g., NGPCRs missing one or more
functional domains or portions thereof, such as, oECD, ATM
and/or OCD), NGPCR fusion proteins (e.g., a NGPCR or a
functional domain of a NGPCR, such as the ECD, fused to an
unrelated protein or peptide such as an immunoglobulin
constant region, i.e., IgFc), nucleotide sequences encoding
such products, and host cell expression systems that can
produce such NGPCR products.
The invention also encompasses compounds or nucleotide
constructs that inhibit expression of a NGPCR gene
(transcription factor inhibitors, antisense and ribozyme
molecules, or gene or regulatory sequence replacement
constructs), or promote expression of a NGPCR (e. g.,
expression constructs in which NGPCR coding sequences are
operatively associated with expression control elements such
as promoters, promoter/enhancers, etc.). The invention also
relates to host cells and animals genetically engineered to
express the human NGPCRs (or mutants thereof) or to inhibit or
"knockout" expression of the animal's endogenous NGPCR genes.
The NGPCR proteins or peptides, NGPCR fusion proteins,
NGPCR nucleotide sequences, antibodies, antagonists and
5
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
agonists can be useful for the detection of mutant NGPCRs or
inappropriately expressed NGPCRs for the diagnosis of disease.
The NGPCR proteins or peptides, NGPCR fusion proteins, NGPCR
nucleotide sequences, host cell expression systems,
antibodies, antagonists, agonists and genetically engineered
cells and animals can be used for screening for drugs (or high
throughput screening of combinatorial libraries) effective in
the treatment of the symptomatic or phenotypic manifestations
resulting from perturbation of the normal function of a NGPCR
in the body. The use of engineered host cells and/or animals
can offer an advantage in that such systems allow not only for
the identification of compounds that bind to an ECD of a
NGPCR, but can also identify compounds that affect the signal
transduced by an activated NGPCR.
One feature of the described NGPCR proteins is that the
7TM region of the protein is typically present at the C-
terminal portion of a protein (for example, beginning at about
amino acid 710 of SEQ ID N0: 2) that can incorporate a large
upstream open reading frame that is substantially similar to a
variety of other proteins such as bone morphogenic protein,
several proteases, etc. Given that, in lower organisms, ORFs
encoding receptor ligands can be linked to the ORF encoding
the cognate receptor, it is possible that the presently
described upstream ORF encodes a product (or cleavage product)
that can serve as a receptor ligand in the body. Accordingly,
an additional embodiment of the present invention includes
soluble protein products or ligands that are encoded by at
least a portion of the described novel polynucleotide
sequences.
Finally, the NGPCR protein products (especially soluble
derivatives such as peptides corresponding to a NGPCR ECD, the
upstream ORF, or truncated polypeptides lacking one or more TM
domains) and fusion protein products (especially NGPCR-Ig
fusion proteins, i.e., fusions of a NGPCR, or a domain of a
NGPCR, e.g., ECD, ATM to an IgFc), antibodies and anti-
idiotypic antibodies (including Fab fragments), antagonists or
agonists (including compounds that modulate signal
6
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
transduction which may act on downstream targets in a NGPCR-
mediated signal transduction pathway) can be used for therapy
of such diseases. For example, the administration of an
effective amount of soluble NGPCR ECD, ATM, or an ECD-IgFc
fusion protein or an anti-idiotypic antibody (or its Fab) that
mimics the NGPCR ECD would "mop up" or "neutralize" the
endogenous NGPCR ligand, and prevent or reduce binding and
receptor activation. Nucleotide constructs encoding such
NGPCR products can be used to genetically engineer host cells
to express such products in vivo; these genetically engineered
cells function as "bioreactors" in the body delivering a
continuous supply of a NGPCR, a NGPCR peptide, soluble ECD or
ATM or a NGPCR fusion protein that will "mop up" or neutralize
a NGPCR ligand. Nucleotide constructs encoding functional
NGPCRs, mutant NGPCRs, as well as antisense and ribozyme
molecules can be used in "gene therapy" approaches for the
modulation of NGPCR expression. Thus, the invention also
encompasses pharmaceutical formulations and methods for
treating biological disorders.
Various aspects of the invention are described in greater
detail in the subsections below.
5.1 NGPCR POLYNUCLEOTIDES
The cDNA sequences and deduced amino acid sequences of
the described human proteins are presented in the Sequence
Listing.
The NGPCR polynucleotides of the present invention include:
(a) the human DNA sequences presented in the Sequence Listing
and additionally contemplate any nucleotide sequence encoding
a contiguous and functional NGPCR open reading frame (ORF)
that hybridizes to a complement of the DNA sequences presented
in the Sequence Listing under highly stringent conditions,
e.g., hybridization to filter-bound DNA in 0.5 M NaHP04, 70
sodium dodecyl sulfate (SDS), 1 mM EDTA at 65°C, and washing
in 0.lxSSC/0.1o SDS at 68°C (Ausubel F.M. et al., eds., 1989,
Current Protocols in Molecular Biology, Vol. I, Green
Publishing Associates, Inc., and John Wiley & sons, Inc., New
7
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
York, at p. 2.10.3) and encodes a functionally equivalent gene
product. Additionally contemplated are any nucleotide
sequences that hybridize to the complement of the DNA
sequences that encode and express an amino acid sequence
presented in the Sequence Listing under moderately stringent
conditions, e.g., washing in 0.2xSSC/0.1% SDS at 42°C (Ausubel
et al., 1989, supra), yet which still encode a functionally
equivalent NGPCR gene product. Functional equivalents of
NGPCR include naturally occurring NGPCRs present in other
species, and mutant NGPCRs whether naturally occurring or
engineered (by site directed mutagenesis, gene shuffling,
directed evolution as described in, for example, U.S. Patent
No. 5,837,458, herein incorporated by reference). The
invention also includes degenerate variants of the disclosed
sequences.
Additionally contemplated are polynucleotides encoding
NGPCR ORFs, or their functional equivalents, encoded by
polynucleotide sequences that are about 99, 95, 90, or about
85 percent similar or identical to corresponding regions of
the nucleotide sequences of the Sequence Listing (as measured
by BLAST sequence comparison analysis using, for example, the
GCG sequence analysis package (Madison, Wisconsin) using
standard default settings).
The invention also includes nucleic acid molecules,
preferably DNA molecules, that hybridize to, and are therefore
the complements of, the described NGPCR nucleotide sequences.
Such hybridization conditions may be highly stringent or less
highly stringent, as described above. In instances wherein
the nucleic acid molecules are deoxyoligonucleotides ("DNA
oligos"), such molecules (and particularly about 16 to about
100 base long, about 20 to about 80, or about 34 to about 45
base long, or any variation or combination of sizes
represented therein incorporating a contiguous region of
sequence first disclosed in the present Sequence Listing, can
be used in conjunction with the polymerase chain reaction
(PCR) to screen libraries, isolate clones, and prepare cloning
and sequencing templates, etc. Alternatively, such NGPCR
8
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
oligonucleotides can be used as hybridization probes for
screening libraries, and assessing gene expression patterns
(particularly using a micro array or high-throughput "chip"
format). Additionally, a series of the described NGPCR
oligonucleotide sequences, or the complements thereof, can be
used to represent all or a portion of the described NGPCR
encoding nucleotides. The oligonucleotides, typically between
about 16 to about 40 (or any whole number within the stated
range) nucleotides in length can partially overlap each other
and/or a NGPCR sequence may be represented using
oligonucleotides that do not overlap. Accordingly, the
described NGPCR polynucleotide sequences shall typically
comprise at least about two or three distinct oligonucleotide
sequences of at least about 18, and preferably about 25,
nucleotides in length that are each first disclosed in the
described Sequence Listing. Such oligonucleotide sequences
can begin at any nucleotide present within a sequence in the
Sequence Listing and proceed in either a sense (5'-to-3')
orientation vis-a-vis the described sequence or in an
antisense orientation.
For oligonucleotides probes, highly stringent conditions
may refer, e.g., to washing in 6xSSC/0.05% sodium
pyrophosphate at 37°C (for 14-base oligos), 48°C (for 17-base
oligos), 55°C (for 20-base oligos), and 60°C (for 23-base
oligos). These nucleic acid molecules may encode or act as
NGPCR antisense molecules, useful, for example, in NGPCR gene
regulation (for and/or as antisense primers in amplification
reactions of NGPCR gene nucleic acid sequences). With respect
to NGPCR gene regulation, such techniques can be used to
regulate biological functions. Further, such sequences may be
used as part of ribozyme and/or triple helix sequences, also
useful for NGPCR gene regulation.
Additionally, the antisense oligonucleotides may comprise
at least one modified base moiety which is selected from the
group including but not limited to 5-fluorouracil,
5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine,
xantine, 4-acetylcytosine, 5-(carboxyhydroxylmethyl) uracil,
9
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
5-carboxymethylaminomethyl-2-thiouridine,
5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-
galactosylqueosine, inosine, N6-isopentenyladenine,
1-methylguanine, 1-methylinosine, 2,2-dimethylguanine,
2-methyladenine, 2-methylguanine, 3-methylcytosine,
5-methylcytosine, N6-adenine, 7-methylguanine,
5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil,
beta-D-mannosylqueosine, 5'-methoxycarboxymethyluracil,
5-methoxyuracil, 2-methylthio-N6-isopentenyladenine, uracil-5-
oxyacetic acid (v), wybutoxosine, pseudouracil, queosine,
2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil,
4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid
methylester, uracil-5-oxyacetic acid (v), 5-methyl-
2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl) uracil, (acp3)w,
and 2,6-diaminopurine.
The antisense oligonucleotide may also comprise at least
one modified sugar moiety selected from the group including
but not limited to arabinose, 2-fluoroarabinose, xylulose, and
hexose.
In yet another embodiment, the antisense oligonucleotide
comprises at least one modified phosphate backbone selected
from the group consisting of a phosphorothioate, a
phosphorodithioate, a phosphoramidothioate, a phosphoramidate,
a phosphordiamidate, a methylphosphonate, an alkyl
phosphotriester, and a formacetal or analog thereof.
In yet another embodiment, the antisense oligonucleotide
is an a-anomeric oligonucleotide. An a-anomeric
oligonucleotide forms specific double-stranded hybrids with
complementary RNA in which, contrary to the usual (3-units, the
strands run parallel to each other (Gautier et al., 1987,
Nucl. Acids Res. 15:6625-6641). The oligonucleotide is a 2'-0-
methylribonucleotide (moue et al., 1987, Nucl. Acids Res.
15:6131-6148), or a chimeric RNA-DNA analogue ( moue et al.,
1987, FEBS Lett. 215:327-330).
Oligonucleotides of the invention may be synthesized by
standard methods known in the art, e.g. by use of an automated
DNA synthesizer (such as are commercially available from
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
Biosearch, Applied Biosystems, etc.). As examples,
phosphorothioate oligonucleotides may be synthesized by the
method of Stein et al. (1988, Nucl. Acids Res. 16:3209),
methylphosphonate oligonucleotides can be prepared by use of
controlled pore glass polymer supports (Sarin et al., 1988,
Proc. Natl. Acad. Sci. U.S.A. 85:7448-7451), etc.
Low stringency conditions are well known to those of
skill in the art, and will vary predictably depending on the
specific organisms from which the library and the labeled
sequences are derived. For guidance regarding such conditions
see, for example, Sambrook et al., 1989, Molecular Cloning, A
Laboratory Manual (and periodic updates thereof), Cold Springs
Harbor Press, N.Y.; and Ausubel et al., 1989, Current
Protocols in Molecular Biology, Green Publishing Associates
and Wiley Interscience, N.Y. Alternatively, suitably labeled
NGPCR nucleotide probes can be used to screen a human genomic
library using appropriately stringent conditions or by PCR.
The identification and characterization of human genomic
clones is helpful for identifying polymorphisms, determining
the genomic structure of a given locus/allele, and designing
diagnostic tests. For example, sequences derived from regions
adjacent to the intron/exon boundaries of the human gene can
be used to design primers for use in amplification assays to
detect mutations within the exons, introns, splice sites
(e.g., splice acceptor and/or donor sites), etc., that can be
used in diagnostics and pharmacogenomics.
Further, a NGPCR gene homolog may be isolated from
nucleic acid from the organism of interest by performing PCR
using two degenerate oligonucleotide primer pools designed on
the basis of amino acid sequences within the NGPCR gene
product disclosed herein. The template for the reaction may
be total RNA, mRNA, and/or cDNA obtained by reverse
transcription of mRNA prepared from, for example, human or
non-human cell lines or tissue, such as brain, known or
suspected to express a NGPCR gene allele.
The PCR product can be subcloned and sequenced to ensure
that the amplified sequences represent the sequence of the
11
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
desired NGPCR gene. The PCR fragment can then be used to
isolate a full length cDNA clone by a variety of methods. For
example, the amplified fragment may be labeled and used to
screen a cDNA library, such as a bacteriophage cDNA library.
Alternatively, the labeled fragment may be used to isolate
genomic clones via the screening of a genomic library.
PCR technology can also be utilized to isolate full
length cDNA sequences. For example, RNA maybe isolated,
following standard procedures, from an appropriate cellular or
tissue source (i.e., one known, or suspected, to express a
NGPCR gene, such as, for example, brain tissue). A reverse
transcription (RT) reaction may be performed on the RNA using
an oligonucleotide primer specific for the most 5' end of the
amplified fragment for the priming of first strand synthesis.
The resulting RNA/DNA hybrid may then be "tailed" using a
standard terminal transferase reaction, the hybrid may be
digested with RNase H, and second strand synthesis may then be
primed with a complementary primer. Thus, cDNA sequences
upstream of the amplified fragment may easily be isolated.
For a review of cloning strategies which may be used, see
e.g., Sambrook et al., 1989, supra.
A cDNA of a mutant NGPCR gene can be isolated, for
example, by using PCR. In this case, the first cDNA strand
may be synthesized by hybridizing an oligo-dT oligonucleotide
to mRNA isolated from tissue known or suspected to be
expressed in an individual putatively carrying a mutant NGPCR
allele, and by extending the new strand with reverse
transcriptase. The second strand of the cDNA is then
synthesized using an oligonucleotide that hybridizes
specifically to the 5' end of the normal gene. Using these
two primers, the product is then amplified via PCR, optionally
cloned into a suitable vector, and subjected to DNA sequence
analysis through methods well known to those of skill in the
art. By comparing the DNA sequence of the mutant NGPCR allele
to that of the normal NGPCR allele, the mutations)
responsible for the loss or alteration of function of the
mutant NGPCR gene product can be ascertained.
12
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
Alternatively, a genomic library can be constructed using
DNA obtained from an individual suspected of or known to carry
the mutant NGPCR allele, or a cDNA library can be constructed
using RNA from a tissue known, or suspected, to express the
mutant NGPCR allele. A normal NGPCR gene, or any suitable
fragment thereof, can then be labeled and used as a probe to
identify the corresponding mutant NGPCR allele in such
libraries. Clones containing the mutant NGPCR gene sequences
may then be purified and subjected to sequence analysis
according to methods well known to those of skill in the art.
Additionally, an expression library can be constructed
utilizing cDNA synthesized from, for example, RNA isolated
from a tissue known, or suspected, to express a mutant NGPCR
allele in an individual suspected of or known to carry such a
mutant allele. In this manner, gene products made by the
putatively mutant tissue may be expressed and screened using
standard antibody screening techniques in conjunction with
antibodies raised against the normal NGPCR gene product, as
described, below, in Section 5.3. (For screening techniques,
see, for example, Harlow, E. and Lane, eds., 1988,
"Antibodies: A Laboratory Manual", Cold Spring Harbor Press,
Cold Spring Harbor.)
Additionally, screening can be accomplished by screening
with labeled NGPCR fusion proteins, such as, for example,
alkaline phosphatase-NGPCR (AP-NGPCR) or NGPCR-AP fusion
proteins. In cases where a NGPCR mutation results in an
expressed gene product with altered function (e.g., as a
result of a missense or a frameshift mutation), a polyclonal
set of antibodies to NGPCR are likely to cross-react with the
mutant NGPCR gene product. Library clones detected via their
reaction with such labeled antibodies can be purified and
subjected to sequence analysis according to methods well known
to those of skill in the art.
The invention also encompasses nucleotide sequences that
encode mutant NGPCRs, peptide fragments of the NGPCRs,
truncated NGPCRs, and NGPCR fusion proteins. These include,
but are not limited to nucleotide sequences encoding mutant
13
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
NGPCRs described in section 5.2 infra; polypeptides or
peptides corresponding to one or more ECD, TM and/or CD
domains of the NGPCR or portions of these domains; truncated
NGPCRs in which one or two of the domains is deleted, e.g., a
soluble NGPCR lacking the TM or both the TM and CD regions, or
a truncated, nonfunctional NGPCR lacking all or a portion of
a, for example, CD region. Nucleotides encoding fusion
proteins may include, but are not limited to, full length
NGPCR sequences, truncated NGPCRs, or nucleotides encoding
peptide fragments of NGPCR fused to an unrelated protein or
peptide, such as for example, a transmembrane sequence, which
anchors the NGPCR ECD to the cell membrane; an Ig Fc domain
which increases the stability and half life of the resulting
fusion protein (e.g., NGPCR-Ig) in the bloodstream; or an
enzyme, fluorescent protein, luminescent protein which can be
used as a marker.
The invention also encompasses (a) DNA vectors that
contain any of the foregoing NGPCR coding sequences and/or
their complements (i.e., antisense); (b) DNA expression
vectors that contain any of the foregoing NGPCR coding
sequences operatively associated with a regulatory element
that directs the expression of the coding sequences; and
(c) genetically engineered host cells that contain any of the
foregoing NGPCR coding sequences operatively associated with a
regulatory element that directs the expression of the coding
sequences in the host cell. As used herein, regulatory
elements include but are not limited to inducible and non-
inducible promoters, enhancers, operators and other elements
known to those skilled in the art that drive and regulate
expression. Such regulatory elements include but are not
limited to the human cytomegalovirus (hCMV) immediate early
gene, regulatable, viral promoters (particularly retroviral
LTR promoters), the early or late promoters of SV40
adenovirus, the lac system, the trp system, the TAC system,
the TRC system, the major operator and promoter regions of
phage A, the control regions of fd coat protein, the promoter
for 3-phosphoglycerate kinase (PGK), the promoters of acid
14
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
phosphatase, and the promoters of the yeast a-mating factors.
Vectors incorporating foreign regulatory elements can also be
used in conjunction with gene targeting technology to induce
or activate the expression of endogenous NGPCRs by gene
activation of the introduction of suitable transcription
factors.
Additionally contemplated uses for the described
sequences include the engineering of constitutively "on"
variants for use in cell assays and genetically engineered
animals using the methods and applications described in U.S.
Patent Applications Ser Nos. 60/110,906, 60/106,300,
60/094,879, and 60/121,851 all of which are herein
incorporated by reference in their entirety.
5.2 NGPCR PROTEINS AND POLYPEPTIDES
NGPCR proteins, polypeptides and peptide fragments,
mutated, truncated or deleted forms of the NGPCR and/or NGPCR
fusion proteins can be prepared for a variety of uses,
including but not limited to use as agonist or antagonist, for
the generation of antibodies, as reagents in diagnostic
assays, the identification of other cellular gene products
related to a NGPCR, as reagents in assays for screening for
compounds that can be as pharmaceutical reagents useful in the
therapeutic treatment of mental, biological, or medical
disorders and disease.
The Sequence Listing discloses the amino acid sequences
encoded by the described NGPCR genes. The NGPCRs have
initiator methionines in DNA sequence contexts consistent with
translation initiation sites, followed by hydrophobic signal
sequences typical of membrane associated proteins. The
sequence data presented herein indicate that alternatively
spliced forms of the NGPCRs exist (which may or may not be
tissue specific).
The NGPCR amino acid sequences of the invention include
the nucleotide and amino acid sequences presented in the
Sequence Listing as well as analogues and derivatives thereof.
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
Further, corresponding NGPCR homologues from other species are
encompassed by the invention. In fact, any NGPCR protein
encoded by the NGPCR nucleotides described in Section 5.1,
above, is within the scope of the invention, as are any novel
polynucleotide sequences encoding all or any novel portion of
an amino acid sequence presented in the Sequence Listing. The
degenerate nature of the genetic code is well known, and,
accordingly, each amino acid presented in the Sequence
Listing, is generically representative of the well known
nucleic acid "triplet" codon, or in many cases codons, that
can encode the amino acid. As such, as contemplated herein,
the amino acid sequences presented in the Sequence Listing,
when taken together with the genetic code (see, for example,
Table 4-1 at page 109 of "Molecular Cell Biology", 1986, J.
Darnell et al. eds., Scientific American Books, New York, NY,
herein incorporated by reference) are generically
representative of all the various permutations and
combinations of nucleic acid sequences that can encode such
amino acid sequences.
The invention also encompasses proteins that are
functionally equivalent to the NGPCR encoded by the nucleotide
sequences described in Section 5.1, as judged by any of a
number of criteria, including but not limited to the ability
to bind a ligand for NGPCR, the ability to effect an identical
or complementary signal transduction pathway, a change in
cellular metabolism (e. g., ion flux, tyrosine
phosphorylation, etc.) or change in phenotype when the NGPCR
equivalent is present in an appropriate cell type (such as the
amelioration, prevention or delay of a biochemical,
biophysical, or overt phenotype. Such functionally equivalent
NGPCR proteins include but are not limited to additions or
substitutions of amino acid residues within the amino acid
sequence encoded by the NGPCR nucleotide sequences described
above, in Section 5.1, but which result in a silent change,
thus producing a functionally equivalent gene product. Amino
acid substitutions may be made on the basis of similarity in
polarity, charge, solubility, hydrophobicity, hydrophilicity,
16
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
and/or the amphipathic nature of the residues involved. For
example, nonpolar (hydrophobic) amino acids include alanine,
leucine, isoleucine, valine, proline, phenylalanine,
tryptophan, and methionine; polar neutral amino acids include
glycine, serine, threonine, cysteine, tyrosine, asparagine,
and glutamine; positively charged (basic) amino acids include
arginine, lysine, and histidine; and negatively charged
(acidic) amino acids include aspartic acid and glutamic acid.
While random mutations can be made in NGPCR DNA (using
random mutagenesis techniques well known to those skilled in
the art) and the resulting mutant NGPCRs tested for activity,
site-directed mutations of the NGPCR coding sequence can be
engineered (using site-directed mutagenesis techniques well
known to those skilled in the art) to generate mutant NGPCRs
with increased function, e.g., higher binding affinity for the
target ligand, and/or greater signaling capacity; or decreased
function, and/or decreased signal transduction capacity. One
starting point for such analysis is by aligning the disclosed
human sequences with corresponding gene/protein sequences
from, for example, other mammals in order to identify amino
acid sequence motifs that are conserved between different
species. Non-conservative changes can be engineered at
variable positions to alter function, signal transduction
capability, or both. Alternatively, where alteration of
function is desired, deletion or non-conservative alterations
of the conserved regions (i.e., identical amino acids) can be
engineered. For example, deletion or non-conservative
alterations (substitutions or insertions) of the various
conserved transmembrane domains.
Other mutations to the NGPCR coding sequence can be made
to generate NGPCRs that are better suited for expression,
scale up, etc. in the host cells chosen. For example,
cysteine residues can be deleted or substituted with another
amino acid in order to eliminate disulfide bridges; N-linked
glycosylation sites can be altered or eliminated to achieve,
for example, expression of a homogeneous product that is more
easily recovered and purified from yeast hosts which are known
17
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
to hyperglycosylate N-linked sites. To this end, a variety of
amino acid substitutions at one or both of the first or third
amino acid positions of any one or more of the glycosylation
recognition sequences which occur in the ECD (N-X-S or N-X-T),
and/or an amino acid deletion at the second position of any
one or more such recognition sequences in the ECD will prevent
glycosylation of the NGPCR at the modified tripeptide
sequence. (See, e.g., Miyajima et al., 1986, EMBO J.
5(6):1193-1197).
Peptides corresponding to one or more domains of the
NGPCR (e. g., ECD, TM, CD, etc.), truncated or deleted NGPCRs
(e. g., NGPCR in which a ECD, TM and/or CD is deleted) as well
as fusion proteins in which a full length NGPCR, a NGPCR
peptide, or truncated NGPCR is fused to an unrelated protein,
are also within the scope of the invention and can be designed
on the basis of the presently disclosed NGPCR nucleotide and
NGPCR amino acid sequences. Such fusion proteins include but
are not limited to IgFc fusions which stabilize the NGPCR
protein or peptide and prolong half-life in vivo; or fusions
to any amino acid sequence that allows the fusion protein to
be anchored to the cell membrane, allowing an ECD to be
exhibited on the cell surface; or fusions to an enzyme,
fluorescent protein, or luminescent protein which provide a
marker function.
While the NGPCR polypeptides and peptides can be
chemically synthesized (e. g., see Creighton, 1983, Proteins:
Structures and Molecular Principles, W.H. Freeman & Co.,
N.Y.), large polypeptides derived from a NGPCR and full length
NGPCRs can be advantageously produced by recombinant DNA
technology using techniques well known in the art for
expressing nucleic acid containing NGPCR gene sequences and/or
coding sequences. Such methods can be used to construct
expression vectors containing a NGPCR nucleotide sequences
described in Section 5.1 and appropriate transcriptional and
translational control signals. These methods include, for
example, in vitro recombinant DNA techniques, synthetic
techniques, and in vivo genetic recombination. See, for
18
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
example, the techniques described in Sambrook et al., 1989,
supra, and Ausubel et al., 1989, supra. Alternatively, RNA
corresponding to all or a portion of a transcript encoded by a
NGPCR nucleotide sequence may be chemically synthesized using,
for example, synthesizers. See, for example, the techniques
described in "Oligonucleotide Synthesis", 1984, Gait, M.J.
ed., IRL Press, Oxford, which is incorporated by reference
herein in its entirety.
A variety of host-expression vector systems may be
utilized to express a NGPCR nucleotide sequences of the
invention. Where the NGPCR peptide or polypeptide is a
soluble derivative (e.g., NGPCR peptides corresponding to an
ECD; truncated or deleted NGPCR in which a TM and/or CD are
deleted) the peptide or polypeptide can be recovered from the
culture, i.e., from the host cell in cases where the NGPCR
peptide or polypeptide is not secreted, and from the culture
media in cases where the NGPCR peptide or polypeptide is
secreted by the cells. However, such expression systems also
encompass engineered host cells that express a NGPCR, or
functional equivalent, in situ, i.e., anchored in the cell
membrane. Purification or enrichment of NGPCR from such
expression systems can be accomplished using appropriate
detergents and lipid micelles and methods well known to those
skilled in the art. However, such engineered host cells
themselves may be used in situations where it is important not
only to retain the structural and functional characteristics
of the NGPCR, but to assess biological activity, e.g., in drug
screening assays.
Expression systems that can be used for purposes of the
invention include, but are not limited to, microorganisms such
as bacteria (e. g., E. coli, B. subtilis) transformed with
recombinant bacteriophage DNA, plasmid DNA or cosmid DNA
expression vectors containing NGPCR nucleotide sequences;
yeast (e. g., Saccharomyces, Pichia) transformed with
recombinant yeast expression vectors containing NGPCR
nucleotide sequences; insect cell systems infected with
recombinant virus expression vectors (e. g., baculovirus)
19
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
containing NGPCR sequences; plant cell systems infected with
recombinant virus expression vectors (e. g., cauliflower mosaic
virus, CaMV; tobacco mosaic virus, TMV) or transformed with
recombinant plasmid expression vectors (e. g., Ti plasmid)
containing NGPCR nucleotide sequences; or mammalian cell
systems (e. g., COS, CHO, BHK, 293, 3T3) harboring recombinant
expression constructs containing promoters derived from the
genome of mammalian cells (e.g., metallothionein promoter) or
from mammalian viruses (e. g., the adenovirus late promoter;
the vaccinia virus 7.5K promoter).
In bacterial systems, a number of expression vectors may
be advantageously selected depending upon the use intended for
the NGPCR gene product being expressed. For example, when a
large quantity of such a protein is to be produced, for the
generation of pharmaceutical compositions of NGPCR protein or
for raising antibodies to a NGPCR protein, for example,
vectors that direct the expression of high levels of fusion
protein products that are readily purified may be desirable.
Such vectors include, but are not limited, to the E. coli
expression vector pUR278 (Ruther et al., 1983, EMBO J.
2:1791), in which a NGPCR coding sequence may be ligated
individually into the vector in frame with the lacZ coding
region so that a fusion protein is produced; pIN vectors
(Inouye & Inouye, 1985, Nucleic Acids Res. 13:3101-3109; Van
Heeke & Schuster, 1989, J. Biol. Chem. 264:5503-5509); and the
like. pGEX vectors may also be used to express foreign
polypeptides as fusion proteins with glutathione S-transferase
(GST). In general, such fusion proteins are soluble and can
easily be purified from lysed cells by adsorption to
glutathione-agarose beads followed by elution in the presence
of free glutathione. The PGEX vectors are designed to include
thrombin or factor Xa protease cleavage sites so that the
cloned target gene product can be released from the GST
moiety.
In an insect system, Autographa californica nuclear
polyhidrosis virus (AcNPV) is used as a vector to express
foreign genes. The virus grows in Spodoptera frugiperda
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
cells. A NGPCR gene coding sequence may be cloned
individually into non-essential regions (for example the
polyhedrin gene) of the virus and placed under control of an
AcNPV promoter (for example the polyhedrin promoter).
Successful insertion of NGPCR gene coding sequence will result
in inactivation of the polyhedrin gene and production of non-
occluded recombinant virus (i.e., virus lacking the
proteinaceous coat coded for by the polyhedrin gene). These
recombinant viruses are then used to infect Spodoptera
frugiperda cells in which the inserted gene is expressed
(e. g., see Smith et al., 1983, J. Virol. 46: 584; Smith, U.S.
Patent No. 4,215,051).
In mammalian host cells, a number of viral-based
expression systems may be utilized. In cases where an
adenovirus is used as an expression vector, the NGPCR
nucleotide sequence of interest may be ligated to an
adenovirus transcription/translation control complex, e.g.,
the late promoter and tripartite leader sequence. This
chimeric gene may then be inserted in the adenovirus genome by
in vitro or in vivo recombination. Insertion in a non-
essential region of the viral genome (e.g., region E1 or E3)
will result in a recombinant virus that is viable and capable
of expressing a NGPCR gene product in infected hosts (e. g.,
See Logan & Shenk, 1984, Proc. Natl. Acad. Sci. USA 81:3655-
3659). Specific initiation signals may also be required for
efficient translation of inserted NGPCR nucleotide sequences.
These signals include the ATG initiation codon and adjacent
sequences. In cases where an entire NGPCR gene or cDNA,
including its own initiation codon and adjacent sequences, is
inserted into the appropriate expression vector, no additional
translational control signals may be needed. However, in
cases where only a portion of a NGPCR coding sequence is
inserted, exogenous translational control signals, including,
perhaps, the ATG initiation codon, must be provided.
Furthermore, the initiation codon must be in phase with the
reading frame of the desired coding sequence to ensure
translation of the entire insert. These exogenous
21
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
translational control signals and initiation codons can be of
a variety of origins, both natural and synthetic. The
efficiency of expression may be enhanced by the inclusion of
appropriate transcription enhancer elements, transcription
terminators, etc. (See Bittner et al., 1987, Methods in
Enzymol. 153:516-544).
In addition, a host cell strain may be chosen that
modulates the expression of the inserted sequences, or
modifies and processes the gene product in the specific
fashion desired. Such modifications (e.g., glycosylation) and
processing (e.g., cleavage) of protein products may be
important for the function of the protein. Different host
cells have characteristic and specific mechanisms for the
post-translational processing and modification of proteins and
gene products. Appropriate cell lines or host systems can be
chosen to ensure the correct modification and processing of
the foreign protein expressed. To this end, eukaryotic host
cells which possess the cellular machinery for proper
processing of the primary transcript, glycosylation, and
phosphorylation of the gene product may be used. Such
mammalian host cells include, but are not limited to, CHO,
VERO, BHK, HeLa, COS, MDCK, 293, 3T3, WI38, and in particular,
choroid plexus cell lines.
For long-term, high-yield production of recombinant
proteins, stable expression is preferred. For example, cell
lines which stably express the NGPCR sequences described above
may be engineered. Rather than using expression vectors which
contain viral origins of replication, host cells can be
transformed with DNA controlled by appropriate expression
control elements (e. g., promoter, enhancer sequences,
transcription terminators, polyadenylation sites, etc.), and a
selectable marker. Following the introduction of the foreign
DNA, engineered cells may be allowed to grow for 1-2 days in
an enriched media, and then are switched to a selective media.
The selectable marker in the recombinant plasmid confers
resistance to the selection and allows cells to stably
integrate the plasmid into their chromosomes and grow to form
22
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
foci which in turn can be cloned and expanded into cell lines.
This method may advantageously be used to engineer cell lines
which express the NGPCR gene product. Such engineered cell
lines may be particularly useful in screening and evaluation
of compounds that affect the endogenous activity of the NGPCR
gene product.
A number of selection systems may be used, including but
not limited to the herpes simplex virus thymidine kinase
(Wigler, et al., 1977, Cell 11:223), hypoxanthine-guanine
phosphoribosyltransferase (Szybalska & Szybalski, 1962, Proc.
Natl. Acad. Sci. USA 48:2026), and adenine
phosphoribosyltransferase (Lowy, et al., 1980, Cell 22:817)
genes can be employed in tk-, hgprt- or aprt- cells,
respectively. Also, antimetabolite resistance can be used as
the basis of selection for the following genes: dhfr, which
confers resistance to methotrexate (Wigler, et al., 1980,
Natl. Acad. Sci. USA 77:3567; 0'Hare, et al., 1981, Proc.
Natl. Acad. Sci. USA 78:1527); gpt, which confers resistance
to mycophenolic acid (Mulligan & Berg, 1981, Proc. Natl. Acad.
Sci. USA 78:2072); neo, which confers resistance to the
aminoglycoside G-418 (Colberre-Garapin, et al., 1981, J. Mol.
Biol. 150:1); and hygro, which confers resistance to
hygromycin (Santerre, et al., 1984, Gene 30:147).
Alternatively, any fusion protein may be readily purified
by utilizing an antibody specific for the fusion protein being
expressed. For example, a system described by Janknecht et
al. allows for the ready purification of non-denatured fusion
proteins expressed in human cell lines (Janknecht, et al.,
1991, Proc. Natl. Acad. Sci. USA 88: 8972-8976). In this
system, the gene of interest is subcloned into a vaccinia
recombination plasmid such that the gene's open reading frame
is translationally fused to an amino-terminal tag consisting
of six histidine residues. Extracts from cells infected with
recombinant vaccinia virus are loaded onto Ni2+ nitriloacetic
acid-agarose columns and histidine-tagged proteins are
selectively eluted with imidazole-containing buffers.
NGPCR gene products can also be expressed in transgenic
23
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
animals. Animals of any species, including, but not limited
to, worms, mice, rats, rabbits, guinea pigs, pigs, micro-pigs,
birds, goats, and non-human primates, e.g., baboons, monkeys,
and chimpanzees may be used to generate NGPCR transgenic
animals.
Any technique known in the art may be used to introduce a
NGPCR transgene into animals to produce the founder lines of
transgenic animals. Such techniques include, but are not
limited to pronuclear microinjection (Hoppe, P.C. and Wagner,
T.E., 1989, U.S. Pat. No. 4,873,191); retrovirus mediated gene
transfer into germ lines (Van der Putten et al., 1985, Proc.
Natl. Acad. Sci., USA 82:6148-6152); gene targeting in
embryonic stem cells (Thompson et al., 1989, Cell 56:313-321);
electroporation of embryos (Lo, 1983, Mol Cell. Biol. 3:1803-
1814); and sperm-mediated gene transfer (Lavitrano et al.,
1989, Cell 57:717-723); etc. For a review of such techniques,
see Gordon, 1989, Transgenic Animals, Intl. Rev. Cytol.
115:171-229, which is incorporated by reference herein in its
entirety.
The present invention provides for transgenic animals
that carry the NGPCR transgene in all their cells, as well as
animals which carry the transgene in some, but not all their
cells, i.e., mosaic animals or somatic cell transgenic
animals. The transgene may be integrated as a single
transgene or in concatamers, e.g., head-to-head tandems or
head-to-tail tandems. The transgene may also be selectively
introduced into and activated in a particular cell type by
following, for example, the teaching of Lasko et al., 1992,
Proc. Natl. Acad. Sci. USA 89:6232-6236. The regulatory
sequences required for such a cell-type specific activation
will depend upon the particular cell type of interest, and
will be apparent to those of skill in the art.
When it is desired that the NGPCR gene transgene be
integrated into the chromosomal site of the endogenous NGPCR
gene, gene targeting is preferred. Briefly, when such a
technique is to be utilized, vectors containing some
nucleotide sequences homologous to the endogenous NGPCR gene
24
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
are designed for the purpose of integrating, via homologous
recombination with chromosomal sequences, into and disrupting
the function of the nucleotide sequence of the endogenous
NGPCR gene (i.e., "knockout" animals).
The transgene may also be selectively introduced into a
particular cell type, thus inactivating the endogenous NGPCR
gene in only that cell type, by following, for example, the
teaching of Gu et al., 1994, Science, 265:103-106. The
regulatory sequences required for such a cell-type specific
inactivation will depend upon the particular cell type of
interest, and will be apparent to those of skill in the art.
Once transgenic animals have been generated, the
expression of the recombinant NGPCR gene may be assayed
utilizing standard techniques. Initial screening may be
accomplished by Southern blot analysis or PCR techniques to
analyze animal tissues to assay whether integration of the
transgene has taken place. The level of mRNA expression of
the transgene in the tissues of the transgenic animals may
also be assessed using techniques which include but are not
limited to Northern blot analysis of tissue samples obtained
from the animal, in situ hybridization analysis, and RT-PCR.
Samples of NGPCR gene-expressing tissue, may also be evaluated
immunocytochemically using antibodies specific for the NGPCR
transgene product.
5.3 ANTIBODIES TO NGPCR PROTEINS
Antibodies that specifically recognize one or more
epitopes of a NGPCR, or epitopes of conserved variants of a
NGPCR, or peptide fragments of a NGPCR are also encompassed by
the invention. Such antibodies include but are not limited to
polyclonal antibodies, monoclonal antibodies (mAbs), humanized
or chimeric antibodies, single chain antibodies, Fab
fragments, F(ab')2 fragments, fragments produced by a Fab
expression library, anti-idiotypic (anti-Id) antibodies, and
epitope-binding fragments of any of the above.
The antibodies of the invention may be used, for example,
in the detection of NGPCR in a biological sample and may,
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
therefore, be utilized as part of a diagnostic or prognostic
technique whereby patients may be tested for abnormal amounts
of NGPCR. Such antibodies may also be utilized in conjunction
with, for example, compound screening schemes, as described,
below, in Section 5.5, for the evaluation of the effect of
test compounds on expression and/or activity of a NGPCR gene
product. Additionally, such antibodies can be used in
conjunction gene therapy to, for example, evaluate the normal
and/or engineered NGPCR-expressing cells prior to their
introduction into the patient. Such antibodies may
additionally be used as a method for the inhibition of
abnormal NGPCR activity. Thus, such antibodies may,
therefore, be utilized as part of weight disorder treatment
methods.
For the production of antibodies, various host animals
may be immunized by injection with the NGPCR, an NGPCR peptide
(e.g., one corresponding the a functional domain of the
receptor, such as an ECD, TM or CD), truncated NGPCR
polypeptides (NGPCR in which one or more domains, e.g., a TM
or CD, has been deleted), functional equivalents of the NGPCR
or mutants of the NGPCR. Such host animals may include but
are not limited to rabbits, mice, and rats, to name but a few.
Various adjuvants may be used to increase the immunological
response, depending on the host species, including but not
limited to Freund's adjuvant (complete and incomplete),
mineral salts such as aluminum hydroxide or aluminum
phosphate, surface active substances such as lysolecithin,
pluronic polyols, polyanions, peptides, oil emulsions, and
potentially useful human adjuvants such as BCG (bacille
Calmette-Guerin) and Corynebacterium parvum. Alternatively,
the immune response could be enhanced by combination and or
coupling with molecules such as keyhole limpet hemocyanin,
tetanus toxoid, diptheria toxoid, ovalbumin, cholera toxoin
or fragments thereof. Polyclonal antibodies are heterogeneous
populations of antibody molecules derived from the sera of the
immunized animals.
26
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
Monoclonal antibodies, which are homogeneous populations
of antibodies to a particular antigen, may be obtained by any
technique which provides for the production of antibody
molecules by continuous cell lines in culture. These include,
but are not limited to, the hybridoma technique of Kohler and
Milstein, (1975, Nature 256:495-497; and U.S. Patent No.
4,376,110), the human B-cell hybridoma technique (Kosbor et
al., 1983, Immunology Today 4:72; Cole et al., 1983, Proc.
Natl. Acad. Sci. USA 80:2026-2030), and the EBV-hybridoma
technique (Cole et al., 1985, Monoclonal Antibodies And Cancer
Therapy, Alan R. Liss, Inc., pp. 77-96). Such antibodies may
be of any immunoglobulin class including IgG, IgM, IgE, IgA,
IgD and any subclass thereof. The hybridoma producing the mAb
of this invention may be cultivated in vitro or in vivo.
Production of high titers of mAbs in vivo makes this the
presently preferred method of production.
In addition, techniques developed for the production of
"chimeric antibodies" (Morrison et al., 1984, Proc. Natl.
Acad. Sci., 81:6851-6855; Neuber.ger et al., 1984, Nature,
312:604-608; Takeda et al., 1985, Nature, 314:452-454) by
splicing the genes from a mouse antibody molecule of
appropriate antigen specificity together with genes from a
human antibody molecule of appropriate biological activity can
be used (see U.S. Patents Nos. 6,075,181 and 5,877,397 which
are herein incorporated by reference in their entirety). A
chimeric antibody is a molecule in which different portions
are derived from different animal species, such as those
having a variable region derived from a murine mAb and a human
immunoglobulin constant region.
Alternatively, techniques described for the production of
single chain antibodies (U. S. Patent 4,946,778; Bird, 1988,
Science 242:423-426; Huston et al., 1988, Proc. Natl. Acad.
Sci. USA 85:5879-5883; and Ward et al., 1989, Nature 334:544-
546) can be adapted to produce single chain antibodies against
NGPCR gene products. Single chain antibodies are formed by
linking the heavy and light chain fragments of the Fv region
27
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
via an amino acid bridge, resulting in a single chain
polypeptide.
Antibody fragments which recognize specific epitopes may
be generated by known techniques. For example, such fragments
include but are not limited to: the F(ab')2 fragments which can
be produced by pepsin digestion of the antibody molecule and
the Fab fragments which can be generated by reducing the
disulfide bridges of the F(ab')2 fragments. Alternatively, Fab
expression libraries may be constructed (Huse et al., 1989,
Science, 246:1275-1281) to allow rapid and easy identification
of monoclonal Fab fragments with the desired specificity.
Antibodies to a NGPCR can, in turn, be ut.i generate anti-
idiotype antibodies that "mimic" a given NGPCR, using
techniques well known to those skilled in the art. (See,
e.g., Greenspan & Bona, 1993, FASEB J 7(5):437-444; and
Nissinoff, 1991, J. Immunol. 147(8):2429-2438). For example
antibodies which bind to a NGPCR ECD and competitively inhibit
the binding of a ligand of NGPCR can be used to generate anti-
idiotypes that "mimic" a NGPCR ECD and, therefore, bind and
neutralize a ligand. Such neutralizing anti-idiotypes or Fab
fragments of such anti-idiotypes can be used in therapeutic
regimens involving the NGPCR signaling pathway.
5.4 DIAGNOSIS OF ABNORMALITIES RELATED TO A NGPCR
A variety of methods can be employed for the diagnostic
and prognostic evaluation of disorders related to NGPCR
function, and for the identification of subjects having a
predisposition to such disorders.
Such methods may, for example, utilize reagents such as
the NGPCR nucleotide sequences described in Section 5.1, and
NGPCR antibodies, as described, in Section 5.3. Specifically,
such reagents may be used, for example, for: (1) the detection
of the presence of NGPCR gene mutations, or the detection of
either over- or under-expression of NGPCR mRNA relative to a
given phenotype; (2) the detection of either an over- or an
under-abundance of NGPCR gene product relative to a given
phenotype; and (3) the detection of perturbations or
28
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
abnormalities in the signal transduction pathway mediated by
NGPCR.
The methods described herein may be performed, for
example, by utilizing pre-packaged diagnostic kits comprising
at least one specific NGPCR nucleotide sequence or NGPCR
antibody reagent described herein, which may be conveniently
used, e.g., in clinical settings, to diagnose patients
exhibiting body weight disorder abnormalities.
For the detection of NGPCR mutations, any nucleated cell
can be used as a starting source for genomic nucleic acid.
For the detection of NGPCR gene expression or NGPCR gene
products, any cell type or tissue in which the NGPCR gene is
expressed, such as, for example, brain or adipose cells, may
be utilized.
Nucleic acid-based detection techniques are described,
below, in Section 5.4.1. Peptide detection techniques are
described, below, in Section 5.4.2.
5.4.1 DETECTION OF NGPCR NUCLEOTIDES AND TRANSCRIPTS
Mutations within a NGPCR gene can be detected by
utilizing a number of techniques. Nucleic acid from any
nucleated cell can be used as the starting point for such
assay techniques, and may be isolated according to standard
nucleic acid preparation procedures which are well known to
those of skill in the art.
DNA may be used in hybridization or amplification assays
of biological samples to detect abnormalities involving NGPCR
gene structure, including point mutations, insertions,
deletions and chromosomal rearrangements. Such assays may
include, but are not limited to, Southern analyses, single
stranded conformational polymorphism analyses (SSCP), and PCR
analyses.
Such diagnostic methods for the detection of NGPCR gene-
specific mutations can involve for example, contacting and
incubating nucleic acids including recombinant DNA molecules,
cloned genes or degenerate variants thereof, obtained from a
sample, e.g., derived from a patient sample or other
29
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
appropriate cellular source, with one or more labeled nucleic
acid reagents including recombinant DNA molecules, cloned
genes or degenerate variants thereof, as described in Section
5.1, under conditions favorable for the specific annealing of
these reagents to their complementary sequences within a given
NGPCR gene. Preferably, the lengths of these nucleic acid
reagents are at least 15 to 30 nucleotides. After incubation,
all non-annealed nucleic acids are removed from the nucleic
acid:NGPCR molecule hybrid. The presence of nucleic acids
which have hybridized, if any such molecules exist, is then
detected. Using such a detection scheme, the nucleic acid
from the cell type or tissue of interest can be immobilized,
for example, to a solid support such as a membrane, or a
plastic surface such as that on a microtiter plate or
polystyrene beads. In this case, after incubation, non-
annealed, labeled nucleic acid reagents of the type described
in Section 5.1 are easily removed. Detection of the
remaining, annealed, labeled NGPCR nucleic acid reagents is
accomplished using standard techniques well-known to those in
the art. The NGPCR gene sequences to which the nucleic acid
reagents have annealed can be compared to the annealing
pattern expected from a normal NGPCR gene sequence in order to
determine whether a NGPCR gene mutation is present.
Alternative diagnostic methods for the detection of NGPCR
gene specific nucleic acid molecules, in patient samples or
other appropriate cell sources, may involve their
amplification, e.g., by PCR (the experimental embodiment set
forth in Mullis, K.B., 1987, U.S. Patent No. 4,683,202),
followed by the detection of the amplified molecules using
techniques well known to those of skill in the art. The
resulting amplified sequences can be compared to those which
would be expected if the nucleic acid being amplified
contained only normal copies of a NGPCR gene in order to
determine whether a NGPCR gene mutation exists.
Additionally, well-known genotyping techniques can be
performed to identify individuals carrying NGPCR gene
mutations. Such techniques include, for example, the use of
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
restriction fragment length polymorphisms (RFLPs), which
involve sequence variations in one of the recognition sites
for the specific restriction enzyme used.
Additionally, improved methods for analyzing DNA
polymorphisms which can be utilized for the identification of
NGPCR gene mutations have been described which capitalize on
the presence of variable numbers of short, tandemly repeated
DNA sequences between the restriction enzyme sites. For
example, Weber (U. S. Pat. No. 5,075,217, which is incorporated
herein by reference in its entirety) describes a DNA marker
based on length polymorphisms in blocks of (dC-dA)n-(dG-dT)n
short tandem repeats. The average separation of (dC-dA)n-(dG-
dT)n blocks is estimated to be 30,000-60,000 bp. Markers
which are so closely spaced exhibit a high frequency co-
inheritance, and are extremely useful in the identification of
genetic mutations, such as, for example, mutations within a
given NGPCR gene, and the diagnosis of diseases and disorders
related to NGPCR mutations.
Also, Caskey et al. (U.S. Pat. No. 5,364,759, which is
incorporated herein by reference in its entirety) describe a
DNA profiling assay for detecting short tri and tetra
nucleotide repeat sequences. The process includes extracting
the DNA of interest, such as the NGPCR gene, amplifying the
extracted DNA, and labeling the repeat sequences to form a
genotypic map of the individual's DNA.
The level of NGPCR gene expression can also be assayed by
detecting and measuring NGPCR transcription. For example, RNA
from a cell type or tissue known, or suspected to express the
NGPCR gene, such as brain, may be isolated and tested
utilizing hybridization or PCR techniques such as are
described, above. The isolated cells can be derived from cell
culture or from a patient. The analysis of cells taken from
culture may be a necessary step in the assessment of cells to
be used as part of a cell-based gene therapy technique or,
alternatively, to test the effect of compounds on the
expression of a NGPCR gene. Such analyses may reveal both
quantitative and qualitative aspects of the expression pattern
31
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
of the NGPCR gene, including activation or inactivation of
NGPCR gene expression.
In one embodiment of such a detection scheme, cDNAs are
synthesized from the RNAs of interest (e. g., by reverse
transcription of the RNA molecule into cDNA). A sequence
within the cDNA is then used as the template for a nucleic
acid amplification reaction, such as a PCR amplification
reaction, or the like. The nucleic acid reagents used as
synthesis initiation reagents (e. g., primers) in the reverse
transcription and nucleic acid amplification steps of this
method are chosen from among the NGPCR nucleic acid reagents
described in Section 5.1. The preferred lengths of such
nucleic acid reagents are at least 9-30 nucleotides. For
detection of the amplified product, the nucleic acid
amplification may be performed using radioactively or non-
radioactively labeled nucleotides. Alternatively, enough
amplified product may be made such that the product may be
visualized by standard ethidium bromide staining, by utilizing
any other suitable nucleic acid staining method, or by
sequencing.
Additionally, it is possible to perform such NGPCR gene
expression assays "in situ", i.e., directly upon tissue
sections (fixed and/or frozen) of patient tissue obtained from
biopsies or resections, such that no nucleic acid purification
is necessary. Nucleic acid reagents such as those described
in Section 5.1 may be used as probes and/or primers for such
in situ procedures (See, for example, Nuovo, G.J., 1992, "PCR
In Situ Hybridization: Protocols And Applications", Raven
Press, NY).
Alternatively,~if a sufficient quantity of the
appropriate cells can be obtained, standard Northern analysis
can be performed to determine the level of mRNA expression of
the NGPCR gene.
32
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
5.4.2 DETECTION OF NGPCR GENE PRODUCTS
Antibodies directed against wild type or mutant NGPCR
gene products or conserved variants or peptide fragments
thereof, which are discussed, above, in Section 5.3, may also
be used as diagnostics and prognostics, as described herein.
Such diagnostic methods, may be used to detect abnormalities
in the level of NGPCR gene expression, or abnormalities in the
structure and/or temporal, tissue, cellular, or subcellular
location of the NGPCR, and may be performed in vivo or in
vitro, such as, for example, on biopsy tissue.
For example, antibodies directed to epitopes of the NGPCR
ECD can be used in vivo to detect the pattern and level of
expression of the NGPCR in the body. Such antibodies can be
labeled, e.g., with a radio-opaque or other appropriate
compound and injected into a subject in order to visualize
binding to the NGPCR expressed in the body using methods such
as X-rays, CAT-scans, or MRI. Labeled antibody fragments,
e.g., the Fab or single chain antibody comprising the smallest
portion of the antigen binding region, are preferred for this
purpose to promote crossing the blood-brain barrier and permit
labeling NGPCRs expressed in the brain.
Additionally, any NGPCR fusion protein or NGPCR
conjugated protein whose presence can be detected, can be
administered. For example, NGPCR fusion or conjugated
proteins labeled with a radio-opaque or other appropriate
compound can be administered and visualized in vivo, as
discussed, above for labeled antibodies. Further such NGPCR
fusion proteins as alkaline phosphatase-NGPCR (AP-NGPCR) or
NGPCR-AP fusion proteins can be utilized for in vitro
diagnostic procedures.
Alternatively, immunoassays or fusion protein detection
assays, as described above, can be utilized on biopsy and
autopsy samples in vitro to permit assessment of the
expression pattern of the NGPCR. Such assays are not confined
to the use of antibodies that define a NGPCR ECD, but can
include the use of antibodies directed to epitopes of any of
the domains of a NGPCR, e.g., the ECD, the TM and/or CD. The
33
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
use of each or all of these labeled antibodies will yield
useful information regarding translation and intracellular
transport of the NGPCR to the cell surface, and can identify
defects in processing.
The tissue or cell type to be analyzed will generally
include those which are known, or suspected, to express a
NGPCR gene, such as, for example, brain cells. The protein
isolation methods employed herein may, for example, be such as
those described in Harlow and Lane (Harlow, E. and Lane, D.,
1988, "Antibodies: A Laboratory Manual", Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, New York), which is
incorporated herein by reference in its entirety. The
isolated cells can be derived from cell culture or from a
patient. The analysis of cells taken from culture may be a
necessary step in the assessment of cells that could be used
as part of a cell-based gene therapy technique or,
alternatively, to test the effect of compounds on the
expression of a NGPCR gene.
For example, antibodies, or fragments of antibodies, such
as those described, above, in Section 5.3, useful in the
present invention may be used to quantitatively or
qualitatively detect the presence of NGPCR gene products or
conserved variants or peptide fragments thereof. This can be
accomplished, for example, by immunofluorescence techniques
employing a fluorescently labeled antibody (see below, this
Section) coupled with light microscopic, flow cytometric, or
fluorimetric detection. Such techniques are especially
preferred if such NGPCR gene products are expressed on the
cell surface.
The antibodies (or fragments thereof) or NGPCR fusion or
conjugated proteins useful in the present invention may,
additionally, be employed histologically, as in
immunofluorescence, immunoelectron microscopy or non-immuno
assays, for in situ detection of NGPCR gene products or
conserved variants or peptide fragments thereof, or for NGPCR
binding (in the case of labeled NGPCR ligand fusion protein).
34
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
In situ detection may be accomplished by removing a
histological specimen from a patient, and applying thereto a
labeled antibody or fusion protein of the present invention.
The antibody (or fragment) or fusion protein is preferably
applied by overlaying the labeled antibody (or fragment) onto
a biological sample. Through the use of such a procedure, it
is possible to determine not only the presence of the NGPCR
gene product, or conserved variants or peptide fragments, or
NGPCR binding, but also its distribution in the examined
tissue. Using the present invention, those of ordinary skill
will readily perceive that any of a wide variety of
histological methods (such as staining procedures) can be
modified in order to achieve such in situ detection.
Immunoassays and non-immunoassays for NGPCR gene products
or conserved variants or peptide fragments thereof will
typically comprise incubating a sample, such as a biological
fluid, a tissue extract, freshly harvested cells, or lysates
of cells which have been incubated in cell culture, in the
presence of a detestably labeled antibody capable of
identifying NGPCR gene products or conserved variants or
peptide fragments thereof, and detecting the bound antibody by
any of a number of techniques well-known in the art.
The biological sample may be brought in contact with and
immobilized onto a solid phase support or carrier such as
nitrocellulose, or other solid support which is capable of
immobilizing cells, cell particles or soluble proteins. The
support may then be washed with suitable buffers followed by,
treatment with the detestably labeled NGPCR antibody or NGPCR
ligand fusion protein. The solid phase support may then be
washed with the buffer a second time to remove unbound
antibody or fusion protein. The amount of bound label on
solid support may then be detected by conventional means.
By "solid phase support or carrier" is intended any
support capable of binding an antigen or an antibody. Well-
known supports or carriers include glass, polystyrene,
polypropylene, polyethylene, dextran, nylon, amylases, natural
and modified celluloses, polyacrylamides, gabbros, and
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
magnetite. The nature of the carrier can be either soluble to
some extent or insoluble for the purposes of the present
invention. The support material may have virtually any
possible structural configuration so long as the coupled
molecule is capable of binding to an antigen or antibody.
Thus, the support configuration may be spherical, as in a
bead, or cylindrical, as in the inside surface of a test tube,
or the external surface of a rod. Alternatively, the surface
may be flat such as a sheet, test strip, etc. Preferred
supports include polystyrene beads. Those skilled in the art
will know many other suitable carriers for binding antibody or
antigen, or will be able to ascertain the same by use of
routine experimentation.
The binding activity of a given lot of NGPCR antibody or
NGPCR ligand fusion protein may be determined according to
well known methods. Those skilled in the art will be able to
determine operative and optimal assay conditions for each
determination by employing routine experimentation.
With respect to antibodies, one of the ways in which the
NGPCR antibody can be detestably labeled is by linking the
same to an enzyme and use in an enzyme immunoassay (EIA)
(Voller, A., "The Enzyme Linked Immunosorbent Assay (ELISA)",
1978, Diagnostic Horizons 2:1-7, Microbiological Associates
Quarterly Publication, Walkersville, MD); Voller, A. et al.,
1978, J. Clin. Pathol. 31:507-520; Butler, J.E., 1981, Meth.
Enzymol. 73:482-523; Maggio, E. (ed.), 1980, Enzyme
Immunoassay, CRC Press, Boca Raton, FL,; Ishikawa, E. et al.,
(eds.), 1981, Enzyme Immunoassay, Kgaku Shoin, Tokyo). The
enzyme that is bound to the antibody will react with an
appropriate substrate, preferably a chromogenic substrate, in
such a manner as to produce a chemical moiety which can be
detected, for example, by spectrophotometric, fluorimetric or
by visual means. Enzymes which can be used to detestably
label the antibody include, but are not limited to, malate
dehydrogenase, staphylococcal nuclease, delta-5-steroid
isomerase, yeast alcohol dehydrogenase, alpha-
glycerophosphate, dehydrogenase, triose phosphate isomerase,
36
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
horseradish peroxidase, alkaline phosphatase, asparaginase,
glucose oxidase, beta-gala.ctosidase, ribonuclease, urease,
catalase, glucose-6-phosphate dehydrogenase, glucoamylase and
acetylcholinesterase. The detection can be accomplished by
colorimetric methods which employ a chromogenic substrate for
the enzyme. Detection may also be accomplished by visual
comparison of the extent of enzymatic reaction of a substrate
in comparison with similarly prepared standards.
Detection may also be accomplished using any of a variety
of other immunoassays. For example, by radioactively labeling
the antibodies or antibody fragments, it is possible to detect
NGPCR through the use of a radioimmunoassay (RIA) (see, for
example, Weintraub, B., Principles of Radioimmunoassays,
Seventh Training Course on Radioligand Assay Techniques, The
Endocrine Society, March, 1986, which is incorporated by
reference herein). The radioactive isotope can be detected by
such means as the use of a gamma counter or a scintillation
counter or by autoradiography.
It is also possible to label the antibody with a
fluorescent compound. When the fluorescently labeled antibody
is exposed to light of the proper wave length, its presence
can then be detected due to fluorescence. Among the most
commonly used fluorescent labeling compounds are fluorescein
isothiocyanate, rhodamine, phycoerythrin, phycocyanin,
allophycocyanin, o-phthaldehyde and fluorescamine.
The antibody can also be detestably labeled using
fluorescence emitting metals such as lszEu, or others of the
lanthanide series. These metals can be attached to the
antibody using such metal chelating groups as
diethylenetriaminepentacetic acid (DTPA) or
ethylenediaminetetraacetic acid (EDTA).
The antibody also can be detestably labeled by coupling
it to a chemiluminescent compound. The presence of the
chemiluminescent-tagged antibody is then determined by
detecting the presence of luminescence that arises during the
course of a chemical reaction. Examples of particularly
useful chemiluminescent labeling compounds are luminol,
37
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
isoluminol, theromatic acridinium ester, imidazole, acridinium
salt and oxalate ester.
Likewise, a bioluminescent compound may be used to label
the antibody of the present invention. Bioluminescence is a
type of chemiluminescence found in biological systems in,
which a catalytic protein increases the efficiency of the
chemiluminescent reaction. The presence of a bioluminescent
protein is determined by detecting the presence of
luminescence. Important bioluminescent compounds for purposes
of labeling are luciferin, luciferase and aequorin.
5.5 SCREENING ASSAYS FOR COMPOUNDS THAT
MODULATE NGPCR EXPRESSION OR ACTIVITY
The following assays are designed to identify compounds
that interact with (e.g., bind to) NGPCRs (including, but not
limited to an ECD or CD of a NGPCR), compounds that interact
with (e. g., bind to) intracellular proteins that interact with
NGPCR (including but not limited to the TM and CD of NGPCR),
compounds that interfere with the interaction of NGPCR with
transmembrane or intracellular proteins involved in NGPCR-
mediated signal transduction, and to compounds which modulate
the activity of NGPCR gene (i.e., modulate the level of NGPCR
gene expression) or modulate the level of NGPCR. Assays may
additionally be utilized which identify compounds which bind
to NGPCR gene regulatory sequences (e. g., promoter sequences)
and which may modulate NGPCR gene expression. See e.g.,
Platt, K.A., 1994, J. Biol. Chem. 269:28558-28562, which is
incorporated herein by reference in its entirety.
The compounds which may be screened in accordance with
the invention include but are not limited to peptides,
antibodies and fragments thereof, and other organic compounds
(e.g., peptidomimetics) that bind to an ECD of a NGPCR and
either mimic the activity triggered by the natural ligand
(i.e., agonists) or inhibit the activity triggered by the
natural ligand (i.e., antagonists); as well as peptides,
antibodies or fragments thereof, and other organic compounds
38
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
that mimic the ECD of the NGPCR (or a portion thereof) and
bind to and "neutralize" natural ligand.
Such compounds can include, but are not limited to,
peptides such as, for example, soluble peptides, including but
not limited to members of random peptide libraries; (see,
e.g., Lam, K.S. et al., 1991, Nature 354:82-84; Houghten, R.
et al., 1991, Nature 354:84-86), and combinatorial chemistry-
derived molecular library made of D- and/or L- configuration
amino acids, phosphopeptides (including, but not limited to
members of random or partially degenerate, directed
phosphopeptide libraries; see, e.g., Songyang, Z. et al.,
1993, Cell 72:767-778), antibodies (including, but not limited
to, polyclonal, monoclonal, humanized, anti-idiotypic,
chimeric or single chain antibodies, and FAb, F(ab')2 and FAb
expression library fragments, and epitope-binding fragments
thereof), and small organic or inorganic molecules.
Other compounds that can be screened in accordance with
the invention include but are not limited to small organic
molecules that are able to cross the blood-brain barrier, gain
entry into an appropriate cell (e. g., in the choroid plexus,
the hypothalamus, etc.) and affect the expression of a NGPCR
gene or some other gene involved in the NGPCR signal
transduction pathway (e. g., by interacting with the regulatory
region or transcription factors involved in gene expression);
or such compounds that affect the activity of the NGPCR (e. g.,
by inhibiting or enhancing the enzymatic activity of a CD) or
the activity of some other intracellular factor involved in
the NGPCR signal transduction pathway.
Computer modeling and searching technologies permit
identification of compounds, or the improvement of already
identified compounds, that can modulate NGPCR expression or
activity. Having identified such a compound or composition,
the active sites or regions are identified. Such active sites
might typically be ligand binding sites. The active site can
be identified using methods known in the art including, for
example, from the amino acid sequences of peptides, from the
nucleotide sequences of nucleic acids, or from study of
39
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
complexes of the relevant compound or composition with its
natural ligand. In the latter case, chemical or X-ray
crystallographic methods can be used to find the active site
by finding where on the factor the complexed ligand is found.
Next, the three-dimensional geometric structure of the
active site is determined. This can be done by known methods,
including X-ray crystallography, which can determine a
complete molecular structure. On the other hand, solid,or
liquid phase NMR can be used to determine certain intra-
molecular distances. Any other experimental method of
structure determination can be used to obtain partial or
complete geometric structures. The geometric structures may
be measured with a complexed ligand, natural or artificial,
which may increase the accuracy of the active site structure
determined.
If an incomplete or insufficiently accurate structure is
determined, the methods of computer based numerical modeling
can be used to complete the structure or improve its accuracy.
Any recognized modeling method may be used, including
parameterized models specific to particular biopolymers such
as proteins or nucleic acids, molecular dynamics models based
on computing molecular motions, statistical mechanics models
based on thermal ensembles, or combined models. For most
types of models, standard molecular force fields, representing
the forces between constituent atoms and groups, are
necessary, and can be selected from force fields known in
physical chemistry. The incomplete or less accurate
experimental structures can serve as constraints on the
complete and more accurate structures computed by these
modeling methods.
Finally, having determined the structure of the active
site, either experimentally, by modeling, or by a combination,
candidate modulating compounds can be identified by searching
databases containing compounds along with information on their
molecular structure. Such a search seeks compounds having
structures that match the determined active site structure and
that interact with the groups defining the active site. Such
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
a search can be manual, but is preferably computer assisted.
These compounds found from this search are potential NGPCR
modulating compounds.
Alternatively, these methods can be used to identify
improved modulating compounds from an already known modulating
compound or ligand. The composition of the known compound can
be modified and the structural effects of modification can be
determined using the experimental and computer modeling
methods described above applied to the new composition. The
altered structure is then compared to the active site
structure of the compound to determine if an improved fit or
interaction results. In this manner systematic variations in
composition, such as by varying side groups, can be quickly
evaluated to obtain modified modulating compounds or ligands
of improved specificity or activity.
Further experimental and computer modeling methods useful
to identify modulating compounds based upon identification of
the active sites of a NGPCR, and related transduction and
transcription factors will be apparent to those of skill in
the art.
Examples of molecular modeling systems are the CHARMm and
QUANTA programs (Polygen Corporation, Waltham, MA). CHARMm
performs the energy minimization and molecular dynamics
functions. QUANTA performs the construction, graphic modeling
25' and analysis of molecular structure. QUANTA allows
interactive construction, modification, visualization, and
analysis of the behavior of molecules with each other.
A number of articles review computer modeling of drugs
interactive with specific proteins, such as Rotivinen, et al.,
1988, Acta Pharmaceutical Fennica 97:159-166; Ripka, New
Scientist 54-57 (June 16, 1988); McKinaly and Rossmann, 1989,
Annu. Rev. Pharmacol. Toxiciol. 29:111-122; Perry and Davies,
OSAR: Quantitative Structure-Activity Relationships in Drug
Design pp. 189-193 (Alan R. Liss, Inc. 1989); Lewis and Dean,
1989 Proc. R. Soc. Lond. 236:125-140 and 141-162; and, with
respect to a model receptor for nucleic acid components,
Askew, et al., 1989, J. Am. Chem. Soc. 111:1082-1090. Other
41
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
computer programs that screen and graphically depict chemicals
are available from companies such as BioDesign, Inc.
(Pasadena, CA.), Allelix, Inc. (Mississauga, Ontario, Canada),
and Hypercube, Inc. (Cambridge, Ontario). Although these are
primarily designed for application to drugs specific to
particular proteins, they can be adapted to design of drugs
specific to regions of DNA or RNA, once that region is
identified.
Although described above with reference to design and
generation of compounds which could alter binding, one could
also screen libraries of known compounds, including natural
products or synthetic chemicals, and biologically active
materials, including proteins, for compounds which are
inhibitors or activators.
Cell-based systems can also be used to identify compounds
that bind NGPCRs as well as assess the altered activity
associated with such binding in living cells. One tool of
particular interest for such assays is green fluorescent
protein which is described, inter alia, in U.S. Patent No.
5,625,048, herein incorporated by reference. Cells that may
be used in such cellular assays include, but are not limited
to, leukocytes, or cell lines derived from leukocytes,
lymphocytes, stem cells, including embryonic stem cells, and
the like. In addition, expression host cells (e.g., B95
cells, COS cells, CHO cells, OMK cells, fibroblasts, Sf9
cells) genetically engineered to express a functional NGPCR of
interest and to respond to activation by the test, or natural,
ligand, as measured by a chemical or phenotypic change, or
induction of another host cell gene, can be used as an end
point in the assay.
Compounds identified via assays such as those described
herein may be useful, for example, in elaborating the
biological function of a NGPCR gene product. Such compounds
can be administered to a patient at therapeutically effective
doses to treat any of a variety of physiological or mental
disorders. A therapeutically effective dose refers to that
amount of the compound sufficient to result in any
42
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
amelioration, impediment, prevention, or alteration of any
biological or overt symptom.
Toxicity and therapeutic efficacy of such compounds can
be determined by standard pharmaceutical procedures in cell
cultures or experimental animals, e.g., for determining the
LDSO (the dose lethal to 50~ of the population) and the EDSo
(the dose therapeutically effective in 500 of the population).
The dose ratio between toxic and therapeutic effects is the
therapeutic index and it can be expressed as the ratio
LDso/EDso. Compounds which exhibit large therapeutic indices
are preferred. While compounds that exhibit toxic side
effects may be used, care should be taken to design a delivery
system that targets such compounds to the site of affected
tissue in order to minimize potential damage to uninfected
cells and, thereby, reduce side effects.
The data obtained from the cell culture assays and animal
studies can be used in formulating a range of dosage for use
in humans. The dosage of such compounds lies preferably
within a range of circulating concentrations that include the
EDSO with little or no toxicity. The dosage may vary within
this range depending upon the dosage form employed and the
route of administration utilized. For any compound used in
the method of the invention, the therapeutically effective
dose can be estimated initially from cell culture assays. A
dose may be formulated in animal models to achieve a
circulating plasma concentration range that includes the ICso
(i.e., the concentration of the test compound which achieves a
half-maximal inhibition of symptoms) as determined in cell
culture. Such information can be used to more accurately
determine useful doses in humans. Levels in plasma may be
measured, for example, by high performance liquid
chromatography.
Pharmaceutical compositions for use in accordance with
the present invention may be formulated in conventional manner
using one or more physiologically acceptable carriers or
excipients. Thus, the compounds and their physiologically
acceptable salts and solvates may be formulated for
43
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
administration by inhalation or insufflation (either through
the mouth or the nose) or oral, buccal, parenteral,
intracranial, intrathecal, or rectal administration.
For oral administration, the pharmaceutical compositions
may take the form of, for example, tablets or capsules
prepared by conventional means with pharmaceutically
acceptable excipients such as binding agents (e. g.,
pregelatinised maize starch, polyvinylpyrrolidone or
hydroxypropyl methylcellulose); fillers (e. g., lactose,
microcrystalline cellulose or calcium hydrogen phosphate);
lubricants (e. g., magnesium stearate, talc or silica);
disintegrants (e. g., potato starch or sodium starch
glycolate); or wetting agents (e. g., sodium lauryl sulphate).
The tablets may be coated by methods well known in the art.
Liquid preparations for oral administration may take the form
of, for example, solutions, syrups or suspensions, or they may
be presented as a dry product for constitution with water or
other suitable vehicle before use. Such liquid preparations
may be prepared by conventional means with pharmaceutically
acceptable additives such as suspending agents (e. g., sorbitol
syrup, cellulose derivatives or hydrogenated edible fats);
emulsifying agents (e. g., lecithin or acacia); non-aqueous
vehicles (e.g., almond oil, oily esters, ethyl alcohol or
fractionated vegetable oils); and preservatives (e. g., methyl
or propyl-p-hydroxybenzoates or sorbic acid). The
preparations may also contain buffer salts, flavoring,
coloring and sweetening agents as appropriate.
Preparations for oral administration may be suitably
formulated to give controlled release of the active compound.
For buccal administration the compositions may take the
form of tablets or lozenges formulated in conventional manner.
For administration by inhalation, the compounds for use
according to the present invention are conveniently delivered
in the form of an aerosol spray presentation from pressurized
packs or a nebulizer, with the use of a suitable propellant,
e.g., dichlorodifluoromethane, trichlorofluoromethane,
dichlorotetrafluoroethane, carbon dioxide or other suitable
44
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
gas. In the case of a pressurized aerosol the dosage unit may
be determined by providing a valve to deliver a metered
amount. Capsules and cartridges of e.g. gelatin for use in an
inhaler or insufflator may be formulated containing a powder
mix of the compound and a suitable powder base such as lactose
or starch.
The compounds may be formulated for parenteral
administration by injection, e.g., by bolus injection or
continuous infusion. Formulations for injection may be
presented in unit dosage form, e.g., in ampoules or in multi-
dose containers, with an added preservative. The compositions
may take such forms as suspensions, solutions or emulsions in
oily or aqueous vehicles, and may contain formulatory agents
such as suspending, stabilizing and/or dispersing agents.
Alternatively, the active ingredient may be in powder form for
constitution with a suitable vehicle, e.g., sterile pyrogen-
free water, before use.
The compounds may also be formulated in rectal
compositions such as suppositories or retention enemas, e.g.,
containing conventional suppository bases such as cocoa butter
or other glycerides.
In addition to the formulations described previously, the
compounds may also be formulated as a depot preparation. Such
long acting formulations may be administered by implantation
(for example subcutaneously or intramuscularly) or by
intramuscular injection. Thus, for example, the compounds may
be formulated with suitable polymeric or hydrophobic materials
(for example as an emulsion in an acceptable oil) or ion
exchange resins, or as sparingly soluble derivatives, for
example, as a sparingly soluble salt.
The compositions may, if desired, be presented in a pack
or dispenser device which may contain one or more unit dosage
forms containing the active ingredient. The pack may for
example comprise metal or plastic foil, such as a blister
pack. The pack or dispenser device may be accompanied by
instructions for administration.
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
5.5.1 IN VITRO SCREENING ASSAYS FOR
COMPOUNDS THAT BIND TO NGPCRs
In vitro systems may be designed to identify compounds
capable of interacting with (e. g., binding to) NGPCR
(including, but not limited to, a ECD or CD of NGPCR).
Compounds identified may be useful, for example, in modulating
the activity of wild type and/or mutant NGPCR gene products;
may be useful in elaborating the biological function of the
NGPCR; may be utilized in screens for identifying compounds
that disrupt normal NGPCR interactions; or may in themselves
disrupt such interactions.
The principle of the assays used to identify compounds
that bind to the NGPCR involves preparing a reaction mixture
of the NGPCR and the test compound under conditions and for a
time sufficient to allow the two components to interact and
bind, thus forming a complex which can be removed and/or
detected in the reaction mixture. The NGPCR species used can
vary depending upon the goal of the screening assay. For
example, where agonists of the natural ligand are sought, the
full length NGPCR, or a soluble truncated NGPCR, e.g., in
which the TM and/or CD is deleted from the molecule, a peptide
corresponding to a ECD or a fusion protein containing one or
more NGPCR ECD fused to a protein or polypeptide that affords
advantages in the assay system (e.g., labeling, isolation of
the resulting complex, etc.) can be utilized. Where compounds
that interact with the cytoplasmic domain are sought to be
identified, peptides corresponding to the NGPCR CD and fusion
proteins containing the NGPCR CD can be used.
The screening assays can be conducted in a variety of
ways. For example, one method to conduct such an assay would
involve anchoring the NGPCR protein, polypeptide, peptide or
fusion protein or the test substance onto a solid phase and
detecting NGPCR/test compound complexes anchored on the solid
phase at the end of the reaction. In one embodiment of such a
method, the NGPCR reactant may be anchored onto a solid
surface, and the test compound, which is not anchored, may be
labeled, either directly or indirectly.
46
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
In practice, microtiter plates may conveniently be
utilized as the solid phase. The anchored component may be
immobilized by non-covalent or covalent attachments. Non-
covalent attachment may be accomplished by simply coating the
solid surface with a solution of the protein and drying.
Alternatively, an immobilized antibody, preferably a
monoclonal antibody, specific for the protein to be
immobilized may be used to anchor the protein to the solid
surface. The surfaces may be prepared in advance and stored.
In order to conduct the assay, the nonimmobilized
component is added to the coated surface containing the
anchored component. After the reaction is complete, unreacted
components are removed (e. g., by washing) under conditions
such that any complexes formed will remain immobilized on the
solid surface. The detection of complexes anchored on the
solid surface can be accomplished in a number of ways. Where
the previously nonimmobilized component is pre-labeled, the
detection of label immobilized on the surface indicates that
complexes were formed. Where the previously nonimmobilized
component is not pre-labeled, an indirect label can be used to
detect complexes anchored on the surface; e.g., using a
labeled antibody specific for the previously nonimmobilized
component (the antibody, in turn, may be directly labeled or
indirectly labeled with a labeled anti-Ig antibody).
Alternatively, a reaction can be conducted in a liquid
phase, the reaction products separated from unreacted
components, and complexes detected; e.g., using an immobilized
antibody specific for a NGPCR protein, polypeptide, peptide or
fusion protein or the test compound to anchor any complexes
formed in solution, and a labeled antibody specific for the
other component of the possible complex to detect anchored
complexes.
Alternatively, cell-based assays can be used to identify
compounds that interact with NGPCR. To this end, cell lines
that express a NGPCR, or cell lines (e.g., COS cells, CHO
cells, fibroblasts, etc.) that have been genetically
engineered to express a NGPCR (e.g., by transfection or
47
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
transduction of NGPCR DNA) can be used. Interaction of the
test compound with, for example, a ECD of a NGPCR expressed by
the host cell can be determined by comparison or competition
with native ligand.
5.5.2 ASSAYS FOR INTRACELLULAR PROTEINS
THAT INTERACT WITH NGPCRs
Any method suitable for detecting protein-protein
interactions can be employed for identifying transmembrane
proteins or intracellular proteins that interact with a NGPCR.
Among the traditional methods which may be employed are
co-immunoprecipitation, crosslinking and co-purification
through gradients or chromatographic columns of cell lysates
or proteins obtained from cell lysates and a NGPCR to identify
proteins in the lysate that interact with the NGPCR. For
these assays, the NGPCR component used can be a full length
NGPCR, a soluble derivative lacking the membrane-anchoring
region (e. g., a truncated NGPCR in which a TM is deleted
resulting in a truncated molecule containing a ECD fused to a
CD), a peptide corresponding to a CD or a fusion protein
containing a CD of a NGPCR. Once isolated, such an
intracellular protein can be identified and can, in turn, be
used, in conjunction with standard techniques, to identify
proteins with which it interacts. For example, at least a
portion of the amino acid sequence of an intracellular protein
which interacts with a NGPCR can be ascertained using
techniques well known to those of skill in the art, such as
via the Edman degradation technique. (See, e.g., Creighton,
1983, "Proteins: Structures and Molecular Principles", W.H.
Freeman & Co., N.Y., pp.34-49). The amino acid sequence
obtained may be used as a guide for the generation of
oligonucleotide mixtures that can be used to screen for gene
sequences encoding such intracellular proteins. Screening may
be accomplished, for example, by standard hybridization or PCR
techniques. Techniques for the generation of oligonucleotide
mixtures and the screening are well-known. (See, e.g.,
Ausubel, supra, and PCR Protocols: A Guide to Methods and
48
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
Applications, 1990, Innis, M. et al., eds. Academic Press,
Inc., New York).
Additionally, methods may be employed which result in the
simultaneous identification of genes which encode the
transmembrane or intracellular proteins interacting with
NGPCR. These methods include, for example, probing
expression, libraries, in a manner similar to the well known
technique of antibody probing of l~gtll libraries, using
labeled NGPCR protein, or an NGPCR polypeptide, peptide or
fusion protein, e.g., an NGPCR polypeptide or NGPCR domain
fused to a marker (e. g., an enzyme, fluor, luminescent
protein, or dye), or an Ig-Fc domain.
One method which detects protein interactions in vivo,
the two-hybrid system, is described in detail for illustration
only and not by way of limitation. One version of this system
has been described (Chien et al., 1991, Proc. Natl. Acad. Sci.
USA, 88:9578-9582) and is commercially available from Clontech
(Palo Alto, CA).
Briefly, utilizing such a system, plasmids are
constructed that encode two hybrid proteins: one plasmid
consists of nucleotides encoding the DNA-binding domain of a
transcription activator protein fused to a NGPCR nucleotide
sequence encoding NGPCR, an NGPCR polypeptide, peptide or
fusion protein, and the other plasmid consists of nucleotides
encoding the transcription activator protein's activation
domain fused to a cDNA encoding an unknown protein which has
been recombined into this plasmid as part of a cDNA library.
The DNA-binding domain fusion plasmid and the cDNA library are
transformed into a strain of the yeast Saccharomyces
cerevisiae that contains a reporter gene (e. g., HBS or lacZ)
whose regulatory region contains the transcription activator's
binding site. Either hybrid protein alone cannot activate
transcription of the reporter gene: the DNA-binding domain
hybrid cannot because it does not provide activation function
and the activation domain hybrid cannot because it cannot
localize to the activator's binding sites. Interaction of the
two hybrid proteins reconstitutes the functional activator
49
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
protein and results in expression of the reporter gene, which
is detected by an assay for the reporter gene product.
The two-hybrid system or related methodology may be used
to screen activation domain libraries for proteins that
interact with the "bait" gene product. By way of example, and
not by way of limitation, a NGPCR may be used as the bait gene
product. Total genomic or cDNA sequences are fused to the DNA
encoding an activation domain. This library and a plasmid
encoding a hybrid of a bait NGPCR gene product fused to'the
DNA-binding domain are cotransformed into a yeast reporter
strain, and the resulting transformants are screened for those
that express the reporter gene. For example, and not by way
of limitation, a bait NGPCR gene sequence, such as the open
reading frame of a NGPCR (or a domain of a NGPCR) can be
cloned into a vector such that it is translationally fused to
the DNA encoding the DNA-binding domain of the GAL4 protein.
These colonies are purified and the library plasmids
responsible for reporter gene expression are isolated. DNA
sequencing is then used to identify the proteins encoded by
the library plasmids.
A cDNA library of the cell line from which proteins that
interact with bait NGPCR gene product are to be detected can
be made using methods routinely practiced in the art.
According to the particular system described herein, for
example, the cDNA fragments can be inserted into a vector such
that they are translationally fused to the transcriptional
activation domain of GAL4. This library can be co-transformed
along with the bait NGPCR gene-GAL4 fusion plasmid into a
yeast strain which contains a lacZ gene driven by a promoter
which contains GAL4 activation sequence. A cDNA encoded
protein, fused to GAL4 transcriptional activation domain, that
interacts with bait NGPCR gene product will reconstitute an
active GAL4 protein and thereby drive expression of the HIS3
gene. Colonies which express HIS3 can be detected by their
growth on petri dishes containing semi-solid agar based media
lacking histidine. The cDNA can then be purified from these
strains, and used to produce and isolate the bait NGPCR gene-
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
interacting protein using techniques routinely practiced in
the art.
5.5.3 ASSAYS FOR COMPOUNDS THAT INTERFERE
WITH NGPCR/INTRACELLULAR OR NGPCR/
TRANSMEMBRANE MACROMOLECULE INTERACTION
The macromolecules that interact with the NGPCR are
referred to, for purposes of this discussion, as "binding
partners". These binding partners are likely to be involved
in the NGPCR signal transduction pathway. Therefore, it is
desirable to identify compounds that interfere with or disrupt
the interaction of such binding partners which may be useful
in regulating the activity of a NGPCR and controlling
disorders associated with NGPCR activity.
The basic principle of the assay systems used to identify
compounds that interfere with the interaction between a NGPCR
and its binding partner or partners involves preparing a
reaction mixture containing NGPCR protein, polypeptide,
peptide or fusion protein as described in Sections 5.5.1 and
5.5.2 above, and the binding partner under conditions and for
a time sufficient to allow the two to interact and bind, thus
forming a complex. In order to test a compound for inhibitory
activity, the reaction mixture is prepared in the presence and
absence of the test compound. The test compound may be
initially included in the reaction mixture, or may be added at
a time subsequent to the addition of the NGPCR moiety and its
binding partner. Control reaction mixtures are incubated
without the test compound or with a placebo. The formation of
any complexes between the NGPCR moiety and the binding partner
is then detected. The formation of a complex in the control
reaction, but not in the reaction mixture containing the test
compound, indicates that the compound interferes with the
interaction of the NGPCR and the interactive binding partner.
Additionally, complex formation within reaction mixtures
containing the test compound and normal NGPCR protein may also
be compared to complex formation within reaction mixtures
containing the test compound and a mutant NGPCR. This
comparison may be important in those cases wherein it is
51
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
desirable to identify compounds that specifically disrupt
interactions of mutant, or mutated, NGPCRs but not normal
NGPCRs.
The assay for compounds that interfere with the
interaction of the NGPCR and binding partners can be conducted
in a heterogeneous or homogeneous format. Heterogeneous
assays involve anchoring either the NGPCR moiety product or
the binding partner onto a solid phase and detecting complexes
anchored on the solid phase at the end of the reaction. In
homogeneous assays, the entire reaction is carried out in a
liquid phase. In either approach, the order of addition of
reactants can be varied to obtain different information about
the compounds being tested. For example, test compounds that
interfere with the interaction by competition can be
identified by conducting the reaction in the presence of the
test substance; i.e., by adding the test substance to the
reaction mixture prior to, or simultaneously with, a NGPCR
moiety and interactive binding partner. Alternatively, test
compounds that disrupt preformed complexes, e.g. compounds
with higher binding constants that displace one of the
components from the complex, can be tested by adding the test
compound to the reaction mixture after complexes have been
formed. The various formats are described briefly below.
In a heterogeneous assay system, either a NGPCR moiety or
an interactive binding partner, is anchored onto a solid
surface, while the non-anchored species is labeled, either
directly or indirectly. In practice, microtiter plates are
conveniently utilized. The anchored species may be
immobilized by non-covalent or covalent attachments. Non-
covalent attachment may be accomplished simply by coating the
solid surface with a solution of the NGPCR gene product or
binding partner and drying. Alternatively, an immobilized
antibody specific for the species to be anchored may be used
to anchor the species to the solid surface. The surfaces may
be prepared in advance and stored.
In order to conduct the assay, the partner of the
immobilized species is exposed to the coated surface with or
52
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
without the test compound. After the reaction is complete,
unreacted components are removed (e.g., by washing) and any
complexes formed will remain immobilized on the solid surface.
The detection of complexes anchored on the solid surface can
be accomplished in a number of ways. Where the non-
immobilized species is pre-labeled, the detection of label
immobilized on the surface indicates that complexes were
formed. Where the non-immobilized species is not pre-labeled,
an indirect label can be used to detect complexes anchored on
the surface; e.g., using a labeled antibody specific for the
initially non-immobilized species (the antibody, in turn, may
be directly labeled or indirectly labeled with a labeled anti-
Ig antibody). Depending upon the order of addition of
reaction components, test compounds which inhibit complex
formation or which disrupt preformed complexes can be
detected.
Alternatively, the reaction can~be conducted in a liquid
phase in the presence or absence of the test compound, the
reaction products separated from unreacted components, and
complexes detected; e.g., using an immobilized antibody
specific for one of the binding components to anchor any
complexes formed in solution, and a labeled antibody specific
for the other partner to detect anchored complexes. Again,
depending upon the order of addition of reactants to the
liquid phase, test compounds which inhibit complex or which
disrupt preformed complexes can be identified.
In an alternate embodiment of the invention, a
homogeneous assay can be used. In this approach, a preformed
complex of a NGPCR moiety and an interactive binding partner
is prepared in which either the NGPCR or its binding partners
is labeled, but the signal generated by the label is quenched
due to formation of the complex (see, e.g., U.S. Patent
No. 4,109,496 by Rubenstein which utilizes this approach for
immunoassays). The addition of a test substance that competes
with and displaces one of the species from the preformed
complex will result in the generation of a signal above
background. In this way, test substances which disrupt
53
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
NGPCR/intracellular binding partner interaction can be
identified.
In a particular embodiment, a NGPCR fusion can be
prepared for immobilization. For example, a NGPCR or a
peptide fragment, e.g., corresponding to a CD, can be fused to
a glutathione-S-transferase (GST) gene using a fusion vector,
such as pGEX-5X-1, in such a manner that its binding activity
is maintained in the resulting fusion protein. The
interactive binding partner can be purified and used to raise
a monoclonal antibody, using methods routinely practiced in
the art and described above, in Section 5.3. This antibody
can be labeled with the radioactive isotope lzsl, for example,
by methods routinely practiced in the art. In a heterogeneous
assay, e.g., the GST-NGPCR fusion protein can be anchored to
glutathione-agarose beads. The interactive binding partner
can then be added in the presence or absence of the test
compound in a manner that allows interaction and binding to
occur. At the end of the reaction period, unbound material
can be washed away, and the labeled monoclonal antibody can be
added to the system and allowed to bind to the complexed
components. The interaction between a NGPCR gene product and
the interactive binding partner can be detected by measuring
the amount of radioactivity that remains associated with the
glutathione-agarose beads. A successful inhibition of the
interaction by the test compound will result in a decrease in
measured radioactivity.
Alternatively, the GST-NGPCR fusion protein and the
interactive binding partner can be mixed together in liquid in
the absence of the solid glutathione-agarose beads. The test
compound can be added either during or after the species are
allowed to interact. This mixture can then be added to the
glutathione-agarose beads and unbound material is washed away.
Again the extent of inhibition of the NGPCR/binding partner
interaction can be detected by adding the labeled antibody and
measuring the radioactivity associated with the beads.
In another embodiment of the invention, these same
techniques can be employed using peptide fragments that
54
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
correspond to the binding domains of a NGPCR and/or the
interactive or binding partner (in cases where the binding
partner is a protein), in place of one or both of the full
length proteins. Any number of methods routinely practiced in
the art can be used to identify and isolate the binding sites.
These methods include, but are not limited to, mutagenesis of
the gene encoding one of the proteins and screening for
disruption of binding in a co-immunoprecipitation assay.
Compensatory mutations in the gene encoding the second species
in the complex can then be selected. Sequence analysis of the
genes encoding the respective proteins will reveal the
mutations that correspond to the region of the protein
involved in interactive binding. Alternatively, one protein
can be anchored to a solid surface using methods described
above, and allowed to interact with and bind to its labeled
binding partner, which has been treated with a proteolytic
enzyme, such as trypsin. After washing, a relatively short,
labeled peptide comprising the binding domain may remain
associated with the solid material, which can be isolated and
identified by amino acid sequencing. Also, once the gene
coding for the intracellular binding partner is obtained,
short gene segments can be engineered to express peptide
fragments of the protein, which can then be tested for binding
activity and purified or synthesized.
For example, and not by way of limitation, a NGPCR gene
product can be anchored to a solid material as described,
above, by making a GST-NGPCR fusion protein and allowing it to
bind to glutathione agarose beads. The interactive binding
partner can be labeled with a radioactive isotope, such as 355,
and cleaved with a proteolytic enzyme such as trypsin.
Cleavage products can then be added to the anchored GST-NGPCR
fusion protein and allowed to bind. After washing away
unbound peptides, labeled bound material, representing the
intracellular binding partner binding domain, can be eluted,
purified, and analyzed for amino acid sequence by well-known
methods. Peptides so identified can be produced synthetically
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
or fused to appropriate facilitative proteins using
recombinant DNA technology.
The present invention is not to be limited in scope by
the specific embodiments described herein, which are intended
as single illustrations of individual aspects of the
invention, and functionally equivalent methods and components
are within the scope of the invention. Indeed, various
modifications of the invention, in addition to those shown and
described herein will become apparent to those skilled in the
art from the foregoing description and accompanying drawings.
Such modifications are intended to fall within the scope of
the appended claims. All of the cited references,
publications, patents and patent applications are herein
incorporated by reference in their entirety.
20
30
56
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
SEQUENCE LISTING
<110> Turner, C. Alexander Jr.
Nehls, Michael
Friedrich, Glenn
Scoville, John
Zambrowicz, Brian
Sands, Arthur T.
<120> Novel Human 7TM Proteins and Receptors and
Polynucleotides Encoding the Same
<130> LEX-0041-PCT
<150> US 60/153,366
<151> 1999-09-10
<150> US 60/165,510
<151> 1999-11-15
<160> 59
<170> FastSEQ for Windows Version 4.0
<210> 1
<211> 3753
<212> DNA
<213> homo sapiens
<400>
1
atgtttcgctcagatcgaatgtggagctgccattggaaatggaagcccagtcctctcctg 60
ttcttatttgctttatatatcatgtgtgttcctcactcagcagtgtggggatgtgccaac 120
tgccgagtggttttgtccaacccttctgggacctttacttctccatgctaccctaacgac 180
tacccaaacagccaggcttgcatgtggacgctccgagcccccaccggttatatcattcag 240
ataacatttaacgactttgacattgaagaagctcccaattgcatttatgactcattatcc 300
cttgataatggagagagccagactaaattttgtggagcaactgccaaaggcctatcattt 360
aactcaagtgcgaatgagatgcatgtgtccttttcaagtgactttagcatccagaagaaa 420
ggtttcaatgccagctacatcagagttgccgtgtccttaaggaatcaaaaggtcatttta 480
ccccagacatcagatgcttaccaggtatctgttgcaaaaagcatctctattccagagctc 540
agtgctttcacactctgctttgaagcaaccaaagttggccatgaagacagtgattggaca 600
gctttctcctactcaaatgcatccttcacacaattgctcagttttggaaaggccaagagt 660
ggctactttctatccatttctgattcaaaatgtttgttgaataatgcattacctgtcaaa 720
gaaaaagaagacatttttgcagaaagctttgaacagctctgccttgtttggaataattct 780
ttgggctctattggtgtaaatttcaaaagaaactatgaaacagttccatgtgattctacc 840
attagtaaagttattcctgggaatgggaaattgttgttgggctccaatcaaaatgaaatt 900
gtctctctaaaaggggacatttataactttcgactttggaattttaccatgaatgccaaa 960
atcctctccaacctcagctgtaatgtgaaagggaatgtagtcgactggcaaaatgacttc 1020
tggaatatcccaaacctagctctgaaagctgaaagcaacctaagctgtggttcctacctg 1080
atcccgctcccagcagcagaactggccagctgtgcagacctggggaccctctgtcaagct 1140
actgtaaactctcctagtactacaccacccactgtcaccactaacatgcctgttactaac 1200
agaatcgataaacaaaggaatgatggaattatctatagaatatccgtagtgattcagaac 1260
atccttcgtcaccctgaggtaaaagtacagagcaaggtggcagaatggctcaattcaacc 1320
ttccaaaattggaactacacggtttatgtcgttaatatcagttttcacctgagtgctgga 1380
gaggacaagattaaagtcaagagaagccttgaggatgagccaaggttggtgctttgggcc 1440
cttctagtttacaatgctaccaacaatactaatttagaaggaaaaatcattcagcagaag 1500
ctcctaaaaaataatgagtccttggatgaaggcttgaggctacatacagtgaatgtgaga 1560
caactgggtcattgtcttgccatggaggaacccaaaggctactactggccatctatccaa 1620
ccttctgaatacgttcttccttgtccagacaagcctggcttttctgcttctcggatatgt 1680
ttttacaatgctaccaacccattggtaacctactggggacctgttgatatctccaactgt 1740
ttaaaagaagcaaatgaagttgctaaccagattttaaatttaactgctgatgggcagaac 1800
ttaacctcagccaatattaccaacattgtggaacaggtcaaaagaattgtgaataaagaa 1860
gaaaacattgatataacacttggctcaactctaatgaatatattttctaatatcttaagc 1920
1 / 87
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
agttcagacagtgacttgcttgagtcatcttctgaagctttaaaaacaattgatgaattg 1980
gccttcaagatagacctaaatagcacatcacatgtgaatattacaactcggaacttggct 2040
ctcagcgtatcatccctgttaccagggacaaatgcaatttcaaattttagcattggtctt 2100
ccaagcaataatgaatcgtatttccagatggattttgagagtggacaagtggatccactg 2160
gcatctgtaattttgcctccaaacttacttgagaatttaagtccagaagattctgtatta 2220
gttagaagagcacagtttactttcttcaacaaaactggacttttccaggatgtaggaccc 2280
caaagaaaaactttagtgagttatgtgatggcgtgcagtattggaaacattactatccag 2340
aatctgaaggatcctgttcaaataaaaatcaaacatacaagaactcaggaagtgcatcat 2400
cccatctgtgccttctgggatctgaacaaaaacaaaagttttggaggatggaacacgtca 2460
ggatgtgttgcacacagagattcagatgcaagtgagacagtctgcctgtgtaaccacttc 2520
acacactttggagttctgatggaccttccaagaagtgcctcacagttagatgcaagaaac 2580
actaaagtcctcactttcatcagctatattgggtgtggaatatctgctattttttcagca 2640
gcaactctcctgacatatgttgcttttgagaaattgcgaagggattatccctccaaaatc 2700
ttgatgaacctgagcacagccctgctgttcctgaatctcctcttcctcctagatggctgg 2760
atcacctccttcaatgtggatggactttgcattgctgttgcagtcctgttgcatttcttc 2820
cttctggcaacctttacctggatggggctagaagcaattcacatgtacattgctctagtt 2880
aaagtatttaacacttacattcgccgatacattctaaaattctgcatcattggctggggt 2940
ttgcctgccttagtggtgtcagttgttctagcgagcagaaacaacaatgaagtctatgga 3000
aaagaaagttatgggaaagaaaaaggtgatgaattctgttggattcaagatccagtcata 3060
ttttatgtgacctgtgctgggtattttggagtcatgttttttctgaacattgccatgttc 3120
attgtggtaatggtgcagatctgtgggaggaatggcaagagaagcaaccggaccctgaga 3180
gaagaagtgttaaggaacctgcgcagtgtggttagcttgacctttctgttgggcatgaca 3240
tggggttttgcattctttgcctggggacccttaaatatccccttcatgtacctcttctcc 3300
atcttcaattcattacaaggcttatttatattcatcttccactgtgctatgaaggagaat 3360
gttcagaaacagtggcggcggcatctctgctgtggtagatttcggttagcagataactca 3420
gattggagtaagacagctaccaatatcatcaagaaaagttctgataatctaggaaaatct 3480
ttgtcttcaagctccattggttccaactcaacctatcttacatccaaatctaaatccagc 3540
tctaccacctatttcaaaaggaatagccacacagacagtgcttccatggacaagtccttg 3600
tcaaaactggcccatgctgatggagatcaaacatcaatcatccctgtccatcaggtcatt 3660
gataaggtcaagggttattgcaatgctcattcagacaacttctataaaaatattatcatg 3720
tcagacaccttcagccacagcacaaagttttaa 3753
<210> 2
<211> 1250
<212> PRT
<213> homo Sapiens
<400> 2
Met Phe Arg Ser Asp Arg Met Trp Ser Cys His Trp Lys Trp Lys Pro
1 5 10 ~ 15
Ser Pro Leu Leu Phe Leu Phe Ala Leu Tyr Ile Met Cys Val Pro His
20 25 30
Ser Ala Val Trp Gly Cys Ala Asn Cys Arg Val Val Leu Ser Asn Pro
35 40 45
Ser Gly Thr Phe Thr Ser Pro Cys Tyr Pro Asn Asp Tyr Pro Asn Ser
50 55 60
Gln Ala Cys Met Trp Thr Leu Arg Ala Pro Thr Gly Tyr Ile Ile Gln
65 70 75 80
Ile Thr Phe Asn Asp Phe Asp Ile Glu Glu Ala Pro Asn Cys Ile Tyr
85 90 95
Asp Ser Leu Ser Leu Asp Asn Gly Glu Ser Gln Thr Lys Phe Cys Gly
100 105 110
Ala Thr Ala Lys Gly Leu Ser Phe Asn Ser Ser Ala Asn Glu Met His
115 120 125
Val Ser Phe Ser Ser Asp Phe Ser Ile Gln Lys Lys Gly Phe Asn Ala
130 135 140
Ser Tyr Ile Arg Val Ala Val Ser Leu Arg Asn Gln Lys Val Ile Leu
145 150 155 160
Pro Gln Thr Ser Asp Ala Tyr Gln Val Ser Val Ala Lys Ser Ile Ser
165 170 175
Ile Pro Glu Leu Ser Ala Phe Thr Leu Cys Phe Glu Ala Thr Lys Val
180 185 190
Gly His Glu Asp Ser Asp Trp Thr Ala Phe Ser Tyr Ser Asn Ala Ser
2 / 87
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
195 200 205
Phe Thr Gln Leu Leu Ser Phe Gly Lys Ala Lys Ser Gly Tyr Phe Leu
210 215 220
Ser Ile Ser Asp Ser Lys Cys Leu Leu Asn Asn Ala Leu Pro Val Lys
225 230 235 240
Glu Lys Glu Asp Ile Phe Ala Glu Ser Phe Glu Gln Leu Cys Leu Val
245 250 255
Trp Asn Asn Ser Leu Gly Ser Ile Gly Val Asn Phe Lys Arg Asn Tyr
260 265 270
Glu Thr Val Pro Cys Asp Ser Thr Ile Ser Lys Val Ile Pro Gly Asn
275 280 285
Gly Lys Leu Leu Leu Gly Ser Asn Gln Asn Glu Ile Val Ser Leu Lys
290 295 300
Gly Asp Ile Tyr Asn Phe Arg Leu Trp Asn Phe Thr Met Asn Ala Lys
305 310 315 320
Ile Leu Ser Asn Leu Ser Cys Asn Val Lys Gly Asn Val Val Asp Trp
325 330 335
Gln Asn Asp Phe Trp Asn Ile Pro Asn Leu Ala Leu Lys Ala Glu Ser
340 345 350
Asn Leu Ser Cys Gly Ser Tyr Leu Ile Pro Leu Pro Ala Ala Glu Leu
355 360 365
Ala Ser Cys Ala Asp Leu Gly Thr Leu Cys Gln Ala Thr Val Asn Ser
370 375 380
Pro Ser Thr Thr Pro Pro Thr Val Thr Thr Asn Met Pro Val Thr Asn
385 390 395 400
Arg Ile Asp Lys Gln Arg Asn Asp Gly Ile Ile Tyr Arg Ile Ser Val
405 410 415
Val Ile Gln Asn Ile Leu Arg His Pro Glu Val Lys Val Gln Ser Lys
420 425 430
Val Ala Glu Trp Leu Asn Ser Thr Phe Gln Asn Trp Asn Tyr Thr Val
435 440 445
Tyr Val Val Asn Ile Ser Phe His Leu Ser Ala Gly Glu Asp Lys Ile
450 455 460
Lys Val Lys Arg Ser Leu Glu Asp Glu Pro Arg Leu Val Leu Trp Ala
465 470 475 480
Leu Leu Val Tyr Asn Ala Thr Asn Asn Thr Asn Leu Glu Gly Lys Ile
485 490 495
Ile Gln Gln Lys Leu Leu Lys Asn Asn Glu Ser Leu Asp Glu Gly Leu
500 505 510
Arg Leu His Thr Val Asn Val Arg Gln Leu Gly His Cys Leu Ala Met
515 520 525
Glu Glu Pro Lys Gly Tyr Tyr Trp Pro Ser Ile Gln Pro Ser Glu Tyr
530 535 540
Val Leu Pro Cys Pro Asp Lys Pro Gly Phe Ser Ala Ser Arg Ile Cys
545 550 555 560
Phe Tyr Asn Ala Thr Asn Pro Leu Val Thr Tyr Trp Gly Pro Val Asp
565 570 575
Ile Ser Asn Cys Leu Lys Glu Ala Asn Glu Val Ala Asn Gln Ile Leu
580 585 590
Asn Leu Thr Ala Asp Gly Gln Asn Leu Thr Ser Ala Asn Ile Thr Asn
595 600 605
Ile Val Glu Gln Val Lys Arg Ile Val Asn Lys Glu Glu Asn Ile Asp
610 615 620
Ile Thr Leu Gly Ser Thr Leu Met Asn Ile Phe Ser Asn Ile Leu Ser
625 630 635 640
Ser Ser Asp Ser Asp Leu Leu Glu Ser Ser Ser Glu Ala Leu Lys Thr
645 650 655
Ile Asp Glu Leu Ala Phe Lys Ile Asp Leu Asn Ser Thr Ser His Val
660 665 670
Asn Ile Thr Thr Arg Asn Leu Ala Leu Ser Val Ser Ser Leu Leu Pro
675 680 685
Gly Thr Asn Ala Ile Ser Asn Phe Ser Ile Gly Leu Pro Ser Asn Asn
690 695 700
3 / 87
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
Glu Ser Tyr Phe Gln Met Asp Phe Glu Ser Gly Gln Val Asp Pro Leu
705 710 715 720
Ala Ser Val Ile Leu Pro Pro Asn Leu Leu Glu Asn Leu Ser Pro Glu
725 730 735
Asp Ser Val Leu Val Arg Arg Ala Gln Phe Thr Phe Phe Asn Lys Thr
740 745 750
Gly Leu Phe Gln Asp Val Gly Pro Gln Arg Lys Thr Leu Val Ser Tyr
755 760 765
Val Met Ala Cys Ser Ile Gly Asn Ile Thr Ile Gln Asn Leu Lys Asp
770 775 780
Pro Val Gln Ile Lys Ile Lys His Thr Arg Thr Gln Glu Val His His
785 790 795 800
Pro Ile Cys Ala Phe Trp Asp Leu Asn Lys Asn Lys Ser Phe Gly Gly
805 810 815
Trp Asn Thr Ser Gly Cys Val Ala His Arg Asp Ser Asp Ala Ser Glu
820 825 830
Thr Val Cys Leu Cys Asn His Phe Thr His Phe Gly Val Leu Met Asp
835 840 845
Leu Pro Arg Ser Ala Ser Gln Leu Asp Ala Arg Asn Thr Lys Val Leu
850 855 860
Thr Phe Ile Ser Tyr Ile Gly Cys Gly Ile Ser Ala Ile Phe Ser Ala
865 870 875 880
Ala Thr Leu Leu Thr Tyr Val Ala Phe Glu Lys Leu Arg Arg Asp Tyr
885 890 895
Pro Ser Lys Ile Leu Met Asn Leu Ser Thr Ala Leu Leu Phe Leu Asn
900 905 910
Leu Leu Phe Leu Leu Asp Gly Trp Ile Thr Ser Phe Asn Val Asp Gly
915 920 925
Leu Cys Ile Ala Val Ala Val Leu Leu His Phe Phe Leu Leu Ala Thr
930 935 940
Phe Thr Trp Met Gly Leu Glu Ala Ile His Met Tyr Ile Ala Leu Val
945 950 955 960
Lys Val Phe Asn Thr Tyr Ile Arg Arg Tyr Ile Leu Lys Phe Cys Ile
965 970 975
Ile Gly Trp Gly Leu Pro Ala Leu Val Val Ser Val Val Leu Ala Ser
980 985 990
Arg Asn Asn Asn Glu Val Tyr Gly Lys Glu Ser Tyr Gly Lys Glu Lys
995 1000 1005
Gly Asp Glu Phe Cys Trp Ile Gln Asp Pro Val Ile Phe Tyr Val Thr
1010 1015 1020
Cys Ala Gly Tyr Phe Gly Val Met Phe Phe Leu Asn Ile Ala Met Phe
1025 1030 1035 1040
Ile Val Val Met Val Gln Ile Cys Gly Arg Asn Gly Lys Arg Ser Asn
1045 1050 1055
Arg Thr Leu Arg Glu Glu Val Leu Arg Asn Leu Arg Ser Val Val Ser
1060 1065 1070
Leu Thr Phe Leu Leu Gly Met Thr Trp Gly Phe Ala Phe Phe Ala Trp
1075 1080 1085
Gly Pro Leu Asn Ile Pro Phe Met Tyr Leu Phe Ser Ile Phe Asn Ser
1090 1095 1100
Leu Gln Gly Leu Phe Ile Phe Ile Phe His Cys Ala Met Lys Glu Asn
1105 1110 1115 1120
Val Gln Lys Gln Trp Arg Arg His Leu Cys Cys Gly Arg Phe Arg Leu
1125 1130 1135
Ala Asp Asn Ser Asp Trp Ser Lys Thr Ala Thr Asn Ile Ile Lys Lys
1140 1145 1150
Ser Ser Asp Asn Leu Gly Lys Ser Leu Ser Ser Ser Ser Ile Gly Ser
1155 1160 1165
Asn Ser Thr Tyr Leu Thr Ser Lys Ser Lys Ser Ser Ser Thr Thr Tyr
1170 1175 1180
Phe Lys Arg Asn Ser His Thr Asp Ser Ala Ser Met Asp Lys Ser Leu
1185 1190 1195 1200
Ser Lys Leu Ala His Ala Asp Gly Asp Gln Thr Ser Ile Ile Pro Val
4 / 87
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
1205 1210 1215
His Gln Val Ile Asp Lys Val Lys Gly Tyr Cys Asn Ala His Ser Asp
1220 1225 1230
Asn Phe Tyr Lys Asn Ile Ile Met Ser Asp Thr Phe Ser His Ser Thr
1235 1240 1245
Lys Phe
1250
<210> 3
<211> 3666
<212> DNA
<213> homo sapiens
<400>
3
atgtttcgctcagatcgaatgtggagctgccattggaaatggaagcccagtcctctcctg 60
ttcttatttgctttatatatcatgtgtgttcctcactcagcagtgtggggatgtgccaac 120
tgccgagtggttttgtccaacccttctgggacctttacttctccatgctaccctaacgac 180
tacccaaacagccaggcttgcatgtggacgctccgagcccccaccggttatatcattcag 240
ataacatttaacgactttgacattgaagaagctcccaattgcatttatgactcattatcc 300
cttgataatggagagagccagactaaattttgtggagcaactgccaaaggcctatcattt 360
aactcaagtgcgaatgagatgcatgtgtccttttcaagtgactttagcatccagaagaaa 420
ggtttcaatgccagctacatcagagttgccgtgtccttaaggaatcaaaaggtcatttta 480
ccccagacatcagatgcttaccaggtatctgttgcaaaaagcatctctattccagagctc 540
agtgctttcacactctgctttgaagcaaccaaagttggccatgaagacagtgattggaca 600
gctttctcctactcaaatgcatccttcacacaattgctcagttttggaaaggccaagagt 660
ggctactttctatccatttctgattcaaaatgtttgttgaataatgcattacctgtcaaa 720
gaaaaagaagacatttttgcagaaagctttgaacagctctgccttgtttggaataattct 780
ttgggctctattggtgtaaatttcaaaagaaactatgaaacagttccatgtgattctacc 840
attagtaaagttattcctgggaatgggaaattgttgttgggctccaatcaaaatgaaatt 900
gtctctctaaaaggggacatttataactttcgactttggaattttaccatgaatgccaaa 960
atcctctccaacctcagctgtaatgtgaaagggaatgtagtcgactggcaaaatgacttc 1020
tggaatatcccaaacctagctctgaaagctgaaagcaacctaagctgtggttcctacctg 1080
atcccgctcccagcagcagaactggccagctgtgcagacctggggaccctctgtcaagct 1140
actgtaaactctcctagtactacaccacccactgtcaccactaacatgcctgttactaac 1200
agaatcgataaacaaaggaatgatggaattatctatagaatatccgtagtgattcagaac 1260
atccttcgtcaccctgaggtaaaagtacagagcaaggtggcagaatggctcaattcaacc 1320
ttccaaaattggaactacacggtttatgtcgttaatatcagttttcacctgagtgctgga 1380
gaggacaagattaaagtcaagagaagccttgaggatgagccaaggttggtgctttgggcc 1440
cttctagtttacaatgctaccaacaatactaatttagaaggaaaaatcattcagcagaag 1500
ctcctaaaaaataatgagtccttggatgaaggcttgaggctacatacagtgaatgtgaga 1560
caactgggtcattgtcttgccatggaggaacccaaaggctactactggccatctatccaa 1620
ccttctgaatacgttcttccttgtccagacaagcctggcttttctgcttctcggatatgt 1680
ttttacaatgctaccaacccattggtaacctactggggacctgttgatatctccaactgt 1740
ttaaaagaagcaaatgaagttgctaaccagattttaaatttaactgctgatgggcagaac 1800
ttaacctcagccaatattaccaacattgtggaacaggtcaaaagaattgtgaataaagaa 1860
gaaaacattgatataacacttggctcaactctaatgaatatattttctaatatcttaagc 1920
agttcagacagtgacttgcttgagtcatcttctgaagctttaaaaacaattgatgaattg 1980
gccttcaagatagacctaaatagcacatcacatgtgaatattacaactcggaacttggct 2040
ctcagcgtatcatccctgttaccagggacaaatgcaatttcaaattttagcattggtctt 2100
ccaagcaataatgaatcgtatttccagatggattttgagagtggacaagtggatccactg 2160
gcatctgtaattttgcctccaaacttacttgagaatttaagtccagaagattctgtatta 2220
gttagaagagcacagtttactttcttcaacaaaactggacttttccaggatgtaggaccc 2280
caaagaaaaactttagtgagttatgtgatggcgtgcagtattggaaacattactatccag 2340
aatctgaaggatcctgttcaaataaaaatcaaacatacaagaactcaggaagtgcatcat 2400
cccatctgtgccttctgggatctgaacaaaaacaaaagttttggaggatggaacacgtca 2460
ggatgtgttgcacacagagattcagatgcaagtgagacagtctgcctgtgtaaccacttc 2520
acacactttggagttctgatggaccttccaagaagtgcctcacagttagatgcaagaaac 2580
actaaagtcctcactttcatcagctatattgggtgtggaatatctgctattttttcagca 2640
gcaactctcctgacatatgttgcttttgagaaattgcgaagggattatccctccaaaatc 2700
ttgatgaacctgagcacagccctgctgttcctgaatctcctcttcctcctagatggctgg 2760
atcacctccttcaatgtggatggactttgcattgctgttgcagtcctgttgcatttcttc 2820
cttctggcaacctttacctggatggggctagaagcaattcacatgtacattgctctagtt 2880
aaagtatttaacacttacattcgccgatacattctaaaattctgcatcattggctggggt 2940
5 / 87
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
ttgcctgccttagtggtgtcagttgttctagcgagcagaaacaacaatgaagtctatgga3000
aaagaaagttatgggaaagaaaaaggtgatgaattctgttggattcaagatccagtcata3060
ttttatgtgacctgtgctgggtattttggagtcatgttttttctgaacattgccatgttc3120
attgtggtaatggtgcagatctgtgggaggaatggcaagagaagcaaccggaccctgaga3180
gaagaagtgttaaggaacctgcgcagtgtggttagcttgacctttctgttgggcatgaca3240
tggggttttgcattctttgcctggggacccttaaatatccccttcatgtacctcttctcc3300
atcttcaattcattacaaggcttatttatattcatcttccactgtgctatgaaggagaat3360
gttcagaaacagtggcggcggcatctctgctgtggtagatttcggttagcagataactca3420
gattggagtaagacagctaccaatatcatcaagaaaagttctgataatctaggaaaatct3480
ttgtcttcaagctccattggttccaactcaacctatcttacatccaaatctaaatccagc3540
tctaccacctatttcaaaaggaatagccacacagataatgtctcctatgagcattccttc3600
aacaaaagtggatcactcagacagtgcttccatggacaagtccttgtcaaaactggccca3660
tgctga 3666
<210> 4
<211> 1221
<212> PRT
<213> homo Sapiens
<400> 4
Met Phe Arg Ser Asp Arg Met Trp Ser Cys His Trp Lys Trp Lys Pro
1 5 10 15
Ser Pro Leu Leu Phe Leu Phe Ala Leu Tyr Ile Met Cys Val Pro His
20 25 30
Ser Ala Val Trp Gly Cys Ala Asn Cys Arg Val Val Leu Ser Asn Pro
35 40 45
Ser Gly Thr Phe Thr Ser Pro Cys Tyr Pro Asn Asp Tyr Pro Asn Ser
50 55 60
Gln Ala Cys Met Trp Thr Leu Arg Ala Pro Thr Gly Tyr Ile Ile Gln
65 70 75 80
Ile Thr Phe Asn Asp Phe Asp Ile Glu Glu Ala Pro Asn Cys Ile Tyr
85 90 95
Asp Ser Leu Ser Leu Asp Asn Gly Glu Ser Gln Thr Lys Phe Cys Gly
100 105 110
Ala Thr Ala Lys Gly Leu Ser Phe Asn Ser Ser Ala Asn Glu Met His
115 120 125
Val Ser Phe Ser Ser Asp Phe Ser Ile Gln Lys Lys Gly Phe Asn Ala
130 135 140
Ser Tyr Ile Arg Val Ala Val Ser Leu Arg Asn Gln Lys Val Ile Leu
145 150 155 160
Pro Gln Thr Ser Asp Ala Tyr Gln Val Ser Val Ala Lys Ser Ile Ser
165 170 175
Ile Pro Glu Leu Ser Ala Phe Thr Leu Cys Phe Glu Ala Thr Lys Val
180 185 190
Gly His Glu Asp Ser Asp Trp Thr Ala Phe Ser Tyr Ser Asn Ala Ser
195 200 205
Phe Thr Gln Leu Leu Ser Phe Gly Lys Ala Lys Ser Gly Tyr Phe Leu
210 215 220
Ser Ile Ser Asp Ser Lys Cys Leu Leu Asn Asn Ala Leu Pro Val Lys
225 230 235 240
Glu Lys Glu Asp Ile Phe Ala Glu Ser Phe Glu Gln Leu Cys Leu Val
245 250 255
Trp Asn Asn Ser Leu Gly Ser Ile Gly Val Asn Phe Lys Arg Asn Tyr
260 265 270
Glu Thr Val Pro Cys Asp Ser Thr Ile Ser Lys Val Ile Pro Gly Asn
275 280 285
Gly Lys Leu Leu Leu Gly Ser Asn Gln Asn Glu Ile Val Ser Leu Lys
290 295 300
Gly Asp Ile Tyr Asn Phe Arg Leu Trp Asn Phe Thr Met Asn Ala Lys
305 310 315 320
Ile Leu Ser Asn Leu Ser Cys Asn Val Lys Gly Asn Val Val Asp Trp
325 330 335
Gln Asn Asp Phe Trp Asn Ile Pro Asn Leu Ala Leu Lys Ala Glu Ser
6 / 87
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
340 345 350
Asn Leu Ser Cys Gly Ser Tyr Leu Ile Pro Leu Pro Ala Ala Glu Leu
355 360 365
Ala Ser Cys Ala Asp Leu Gly Thr Leu Cys Gln Ala Thr Val Asn Ser
370 375 380
Pro Ser Thr Thr Pro Pro Thr Val Thr Thr Asn Met Pro Val Thr Asn
385 390 395 400
Arg Ile Asp Lys Gln Arg Asn Asp Gly Ile Ile Tyr Arg Ile Ser Val
405 410 415
Val Ile Gln Asn Ile Leu Arg His Pro Glu Val Lys Val Gln Ser Lys
420 425 430
Val Ala Glu Trp Leu Asn Ser Thr Phe Gln Asn Trp Asn Tyr Thr Val
435 440 445
Tyr Val Val Asn Ile Ser Phe His Leu Ser Ala Gly Glu Asp Lys Ile
450 455 460
Lys Val Lys Arg Ser Leu Glu Asp Glu Pro Arg Leu Val Leu Trp Ala
465 470 475 480
Leu Leu Val Tyr Asn Ala Thr Asn Asn Thr Asn Leu Glu Gly Lys Ile
485 490 495
Ile Gln Gln Lys Leu Leu Lys Asn Asn Glu Ser Leu Asp Glu Gly Leu
500 505 510
Arg Leu His Thr Val Asn Val Arg Gln Leu Gly His Cys Leu Ala Met
515 520 525
Glu Glu Pro Lys Gly Tyr Tyr Trp Pro Ser Ile Gln Pro Ser Glu Tyr
530 535 540
Val Leu Pro Cys Pro Asp Lys Pro Gly Phe Ser Ala Ser Arg Ile Cys
545 550 555 560
Phe Tyr Asn Ala Thr Asn Pro Leu Val Thr Tyr Trp Gly Pro Val Asp
565 570 575
Ile Ser Asn Cys Leu Lys Glu Ala Asn Glu Val Ala Asn Gln Ile Leu
580 585 590
Asn Leu Thr Ala Asp Gly Gln Asn Leu Thr Ser Ala Asn Ile Thr Asn
595 600 605
Ile Val Glu Gln Val Lys Arg Ile Val Asn Lys Glu Glu Asn Ile Asp
610 615 620
Ile Thr Leu Gly Ser Thr Leu Met Asn Ile Phe Ser Asn Ile Leu Ser
625 630 635 640
Ser Ser Asp Ser Asp Leu Leu Glu Ser Ser Ser Glu Ala Leu Lys Thr
645 650 655
Ile Asp Glu Leu Ala Phe Lys Ile Asp Leu Asn Ser Thr Ser His Val
660 665 670
Asn Ile Thr Thr Arg Asn Leu Ala Leu Ser Val Ser Ser Leu Leu Pro
675 680 685
Gly Thr Asn Ala Ile Ser Asn Phe Ser Ile Gly Leu Pro Ser Asn Asn
690 695 700
Glu Ser Tyr Phe Gln Met Asp Phe Glu Ser Gly Gln Val Asp Pro Leu
705 710 715 720
Ala Ser Val Ile Leu Pro Pro Asn Leu Leu Glu Asn Leu Ser Pro Glu
725 730 735
Asp Ser Val Leu Val Arg Arg Ala Gln Phe Thr Phe Phe Asn Lys Thr
740 745 750
Gly Leu Phe Gln Asp Val Gly Pro Gln Arg Lys Thr Leu Val Ser Tyr
755 760 765
Val Met Ala Cys Ser Ile Gly Asn Ile Thr Ile Gln Asn Leu Lys Asp
770 775 780
Pro Val Gln Ile Lys Ile Lys His Thr Arg Thr Gln Glu Val His His
785 790 795 800
Pro Ile Cys Ala Phe Trp Asp Leu Asn Lys Asn Lys Ser Phe Gly Gly
805 810 815
Trp Asn Thr Ser Gly Cys Val Ala His Arg Asp Ser Asp Ala Ser Glu
820 825 830
Thr Val Cys Leu Cys Asn His Phe Thr His Phe Gly Val Leu Met Asp
835 840 845
7 / 87
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
Leu Pro Arg Ser Ala Ser Gln Leu Asp Ala Arg Asn Thr Lys Val Leu
850 855 860
Thr Phe Ile Ser Tyr Ile Gly Cys Gly Ile Ser Ala Ile Phe Ser Ala
865 870 875 880'
Ala Thr Leu Leu Thr Tyr Val Ala Phe Glu Lys Leu Arg Arg Asp Tyr
885 890 895
Pro Ser Lys Ile Leu Met Asn Leu Ser Thr Ala Leu Leu Phe Leu Asn
900 905 910
Leu Leu Phe Leu Leu Asp Gly Trp Ile Thr Ser Phe Asn Val Asp Gly
915 920 925
Leu Cys Ile Ala Val Ala Val Leu Leu His Phe Phe Leu Leu Ala Thr
930 935 940
Phe Thr Trp Met Gly Leu Glu Ala Ile His Met Tyr Ile Ala Leu Val
945 950 955 960
Lys Val Phe Asn Thr Tyr Ile Arg Arg Tyr Ile Leu Lys Phe Cys Ile
965 970 975
Ile Gly Trp Gly Leu Pro Ala Leu Val Val Ser Val Val Leu Ala Ser
980 985 990
Arg Asn Asn Asn Glu Val Tyr Gly Lys Glu Ser Tyr Gly Lys Glu Lys
995 1000 1005
Gly Asp Glu Phe Cys Trp Ile Gln Asp Pro Val Ile Phe Tyr Val Thr
1010 1015 1020
Cys Ala Gly Tyr Phe Gly Val Met Phe Phe Leu Asn Ile Ala Met Phe
1025 1030 1035 1040
Ile Val Val Met Val Gln Ile Cys Gly Arg Asn Gly Lys Arg Ser Asn
1045 1050 1055
Arg Thr Leu Arg Glu Glu Val Leu Arg Asn Leu Arg Ser Val Val Ser
1060 1065 1070
Leu Thr Phe Leu Leu Gly Met Thr Trp Gly Phe Ala Phe Phe Ala Trp
1075 1080 1085
Gly Pro Leu Asn Ile Pro Phe Met Tyr Leu Phe Ser Ile Phe Asn Ser
1090 1095 1100
Leu Gln Gly Leu Phe Ile Phe Ile Phe His Cys Ala Met Lys Glu Asn
1105 1110 1115 1120
Val Gln Lys Gln Trp Arg Arg His Leu Cys Cys Gly Arg Phe Arg Leu
1125 1130 1135
Ala Asp Asn Ser Asp Trp Ser Lys Thr Ala Thr Asn Ile Ile Lys Lys
1140 1145 1150
Ser Ser Asp Asn Leu Gly Lys Ser Leu Ser Ser Ser Ser Ile Gly Ser
1155 1160 1165
Asn Ser Thr Tyr Leu Thr Ser Lys Ser Lys Ser Ser Ser Thr Thr Tyr
1170 1175 1180
Phe Lys Arg Asn Ser His Thr Asp Asn Val Ser Tyr Glu His Ser Phe
1185 1190 1195 1200
Asn Lys Ser Gly Ser Leu Arg Gln Cys Phe His Gly Gln Val Leu Val
1205 1210 1215
Lys Thr Gly Pro Cys
1220
<210> 5
<211> 2157
<212> DNA
<213> homo Sapiens
<400> 5
atgtttcgct cagatcgaat gtggagctgc cattggaaat ggaagcccag tcctctcctg 60
ttcttatttg ctttatatat catgtgtgtt cctcactcag cagtgtgggg atgtgccaac 120
tgccgagtgg ttttgtccaa cccttctggg acctttactt ctccatgcta ccctaacgac 180
tacccaaaca gccaggcttg catgtggacg ctccgagccc ccaccggtta tatcattcag 240
ataacattta acgactttga cattgaagaa gctcccaatt gcatttatga ctcattatcc 300
cttgataatg gagagagcca gactaaattt tgtggagcaa ctgccaaagg cctatcattt 360
aactcaagtg cgaatgagat gcatgtgtcc ttttcaagtg actttagcat ccagaagaaa 420
ggtttcaatg ccagctacat cagagttgcc gtgtccttaa ggaatcaaaa ggtcatttta 480
8 / 87
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
ccccagacatcagatgcttaccaggtatctgttgcaaaaagcatctctattccagagctc 540
agtgctttcacactctgctttgaagcaaccaaagttggccatgaagacagtgattggaca 600
gctttctcctactcaaatgcatccttcacacaattgctcagttttggaaaggccaagagt 660
ggctactttctatccatttctgattcaaaatgtttgttgaataatgcattacctgtcaaa 720
gaaaaagaagacatttttgcagaaagctttgaacagctctgccttgtttggaataattct 780
ttgggctctattggtgtaaatttcaaaagaaactatgaaacagttccatgtgattctacc 840
attagtaaagttattcctgggaatgggaaattgttgttgggctccaatcaaaatgaaatt 900
gtctctctaaaaggggacatttataactttcgactttggaattttaccatgaatgccaaa 960
atcctctccaacctcagctgtaatgtgaaagggaatgtagtcgactggcaaaatgacttc 1020
tggaatatcccaaacctagctctgaaagctgaaagcaacctaagctgtggttcctacctg 1080
atcccgctcccagcagcagaactggccagctgtgcagacctggggaccctctgtcaagct 1140
actgtaaactctcctagtactacaccacccactgtcaccactaacatgcctgttactaac 1200
agaatcgataaacaaaggaatgatggaattatctatagaatatccgtagtgattcagaac 1260
atccttcgtcaccctgaggtaaaagtacagagcaaggtggcagaatggctcaattcaacc 1320
ttccaaaattggaactacacggtttatgtcgttaatatcagttttcacctgagtgctgga 1380
gaggacaagattaaagtcaagagaagccttgaggatgagccaaggttggtgctttgggcc 1440
cttctagtttacaatgctaccaacaatactaatttagaaggaaaaatcattcagcagaag 1500
ctcctaaaaaataatgagtccttggatgaaggcttgaggctacatacagtgaatgtgaga 1560
caactgggtcattgtcttgccatggaggaacccaaaggctactactggccatctatccaa 1620
ccttctgaatacgttcttccttgtccagacaagcctggcttttctgcttctcggatatgt 1680
ttttacaatgctaccaacccattggtaacctactggggacctgttgatatctccaactgt 1740
ttaaaagaagcaaatgaagttgctaaccagattttaaatttaactgctgatgggcagaac 1800
ttaacctcagccaatattaccaacattgtggaacaggtcaaaagaattgtgaataaagaa 1860
gaaaacattgatataacacttggctcaactctaatgaatatattttctaatatcttaagc 1920
agttcagacagtgacttgcttgagtcatcttctgaagctttaaaaacaattgatgaattg 1980
gccttcaagatagacctaaatagcacatcacatgtgaatattacaactcggaacttggct 2040
ctcagcgtatcatccctgttaccagggacaaatgcaatttcaaattttagcattggtctt 2100
ccaagcaataatgaatcgtatttccaggtaatgagccagtggtttctttcattttaa 2157
<210> 6
<211> 718
<212> PRT
<213> homo sapiens
<400> 6
Met Phe Arg Ser Asp Arg Met Trp Ser Cys His Trp Lys Trp Lys Pro
1 5 10 15
Ser Pro Leu Leu Phe Leu Phe Ala Leu Tyr Ile Met Cys Val Pro His
20 25 30
Ser Ala Val Trp Gly Cys Ala Asn Cys Arg Val Val Leu Ser Asn Pro
35 40 45
Ser Gly Thr Phe Thr Ser Pro Cys Tyr Pro Asn Asp Tyr Pro Asn Ser
50 55 60
Gln Ala Cys Met Trp Thr Leu Arg Ala Pro Thr Gly Tyr Ile Ile Gln
65 70 75 80
Ile Thr Phe Asn Asp Phe Asp Ile Glu Glu Ala Pro Asn Cys Ile Tyr
85 90 95
Asp Ser Leu Ser Leu Asp Asn Gly Glu Ser Gln Thr Lys.Phe Cys Gly
100 105 110
Ala Thr Ala Lys Gly Leu Ser Phe Asn Ser Ser Ala Asn Glu Met His
115 120 125
Val Ser Phe Ser Ser Asp Phe Ser Ile Gln Lys Lys Gly Phe Asn Ala
130 135 140
Ser Tyr Ile Arg Val Ala Val Ser Leu Arg Asn Gln Lys Val Ile Leu
145 150 155 160
Pro Gln Thr Ser Asp Ala Tyr Gln Val Ser Val Ala Lys Ser Ile Ser
165 170 175
Ile Pro Glu Leu Ser Ala Phe Thr Leu Cys Phe Glu Ala Thr Lys Val
180 185 190
Gly His Glu Asp Ser Asp Trp Thr Ala Phe Ser Tyr Ser Asn Ala Ser
195 200 205
Phe Thr Gln Leu Leu Ser Phe Gly Lys Ala Lys Ser Gly Tyr Phe Leu
210 215 220
9 / 87
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
Ser Ile Ser Asp Ser Lys Cys Leu Leu Asn Asn Ala Leu Pro Val Lys
225 230 235 240
Glu Lys Glu Asp Ile Phe Ala Glu Ser Phe Glu Gln Leu Cys Leu Val
245 250 255
Trp Asn Asn Ser Leu Gly Ser Ile Gly Val Asn Phe Lys Arg Asn Tyr
260 265 270
Glu Thr Val Pro Cys Asp Ser Thr Ile Ser Lys Val Ile Pro Gly Asn
275 280 285
Gly Lys Leu Leu Leu Gly Ser Asn Gln Asn Glu Ile Val Ser Leu Lys
290 295 300
Gly Asp Ile Tyr Asn Phe Arg Leu Trp Asn Phe Thr Met Asn Ala Lys
305 310 315 320
Ile Leu Ser Asn Leu Ser Cys Asn Val Lys Gly Asn Val Val Asp Trp
325 330 335
Gln Asn Asp Phe Trp Asn Ile Pro Asn Leu Ala Leu Lys Ala Glu Ser
340 345 350
Asn Leu Ser Cys Gly Ser Tyr Leu Ile Pro Leu Pro Ala Ala Glu Leu
355 360 365
Ala Ser Cys Ala Asp Leu Gly Thr Leu Cys Gln Ala Thr Val Asn Ser
370 375 380
Pro Ser Thr Thr Pro Pro Thr Val Thr Thr Asn Met Pro Val Thr Asn
385 390 395 400
Arg Ile Asp Lys Gln Arg Asn Asp Gly Ile Ile Tyr Arg Ile Ser Val
405 410 415
Val Ile Gln Asn Ile Leu Arg His Pro Glu Val Lys Val Gln Ser Lys
420 425 430
Val Ala Glu Trp Leu Asn Ser Thr Phe Gln Asn Trp Asn Tyr Thr Val
435 440 445
Tyr Val Val Asn Ile Ser Phe His Leu Ser Ala Gly Glu Asp Lys Ile
450 455 460
Lys Val Lys Arg Ser Leu Glu Asp Glu Pro Arg Leu Val Leu Trp Ala
465 470 475 480
Leu Leu Val Tyr Asn Ala Thr Asn Asn Thr Asn Leu Glu Gly Lys Ile
485 490 495
Ile Gln Gln Lys Leu Leu Lys Asn Asn Glu Ser Leu Asp Glu Gly Leu
500 505 510
Arg Leu His Thr Val Asn Val Arg Gln Leu Gly His Cys Leu Ala Met
515 520 525
Glu Glu Pro Lys Gly Tyr Tyr Trp Pro Ser Ile Gln Pro Ser Glu Tyr
530 535 540
Val Leu Pro Cys Pro Asp Lys Pro Gly Phe Ser Ala Ser Arg Ile Cys
545 550 555 560
Phe Tyr Asn Ala Thr Asn Pro Leu Val Thr Tyr Trp Gly Pro Val Asp
565 570 575
Ile Ser Asn Cys Leu Lys Glu Ala Asn Glu Val Ala Asn Gln Ile Leu
580 585 590
Asn Leu Thr Ala Asp Gly Gln Asn Leu Thr Ser Ala Asn Ile Thr Asn
595 600 605
Ile Val Glu Gln Val Lys Arg Ile Val Asn Lys Glu Glu Asn Ile Asp
610 615 620
Ile Thr Leu Gly Ser Thr Leu Met Asn Ile Phe Ser Asn Ile Leu Ser
625 630 635 640
Ser Ser Asp Ser Asp Leu Leu Glu Ser Ser Ser Glu Ala Leu Lys Thr
645 650 655
Ile Asp Glu Leu Ala Phe Lys Ile Asp Leu Asn Ser Thr Ser His Val
660 665 670
Asn Ile Thr Thr Arg Asn Leu Ala Leu Ser Val Ser Ser Leu Leu Pro
675 680 685
Gly Thr Asn Ala Ile Ser Asn Phe Ser Ile Gly Leu Pro Ser Asn Asn
690 695 700
Glu Ser Tyr Phe Gln Val Met Ser Gln Trp Phe Leu Ser Phe
705 710 715
/ 87
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
<210> 7
<211> 3339
<212> DNA
<213> homo Sapiens
<400>
7
atgtttcgctcagatcgaatgtggagctgccattggaaatggaagcccagtcctctcctg 60
ttcttatttgctttatatatcatgtgtgttcctcactcagcagtgtggggatgtgccaac 120
tgccgagtggttttgtccaacccttctgggacctttacttctccatgctaccctaacgac 180
tacccaaacagccaggcttgcatgtggacgctccgagcccccaccggttatatcattcag 240
ataacatttaacgactttgacattgaagaagctcccaattgcatttatgactcattatcc 300
cttgataatggagagagccagactaaattttgtggagcaactgccaaaggcctatcattt 360
aactcaagtgcgaatgagatgcatgtgtccttttcaagtgactttagcatccagaagaaa 420
ggtttcaatgccagctacatcagagttgccgtgtccttaaggaatcaaaaggtcatttta 480
ccccagacatcagatgcttaccaggtatctgttgcaaaaagcatctctattccagagctc 540
agtgctttcacactctgctttgaagcaaccaaagttggccatgaagacagtgattggaca 600
gctttctcctactcaaatgcatccttcacacaattgctcagttttggaaaggccaagagt 660
ggctactttctatccatttctgattcaaaatgtttgttgaataatgcattacctgtcaaa 720
gaaaaagaagacatttttgcagaaagctttgaacagctctgccttgtttggaataattct 780
ttgggctctattggtgtaaatttcaaaagaaactatgaaacagttccatgtgattctacc 840
attagtaaagttattcctgggaatgggaaattgttgttgggctccaatcaaaatgaaatt 900
gtctctctaaaaggggacatttataactttcgactttggaattttaccatgaatgccaaa 960
atcctctccaacctcagctgtaatgtgaaagggaatgtagtcgactggcaaaatgacttc 1020
tggaatatcccaaacctagctctgaaagctgaaagcaacctaagctgtggttcctacctg 1080
atcccgctcccagcagcagaactggccagctgtgcagacctggggaccctctgtcaagct 1140
actgtaaactctcctagtactacaccacccactgtcaccactaacatgcctgttactaac 1200
agaatcgataaacaaaggaatgatggaattatctatagaatatccgtagtgattcagaac 1260
atccttcgtcaccctgaggtaaaagtacagagcaaggtggcagaatggctcaattcaacc 1320
ttccaaaattggaactacacggtttatgtcgttaatatcagttttcacctgagtgctgga 1380
gaggacaagattaaagtcaagagaagccttgaggatgagccaaggttggtgctttgggcc 1440
cttctagtttacaatgctaccaacaatactaatttagaaggaaaaatcattcagcagaag 1500
ctcctaaaaaataatgagtccttggatgaaggcttgaggctacatacagtgaatgtgaga 1560
caactgggtcattgtcttgccatggaggaacccaaaggctactactggccatctatccaa 1620
ccttctgaatacgttcttccttgtccagacaagcctggcttttctgcttctcggatatgt 1680
ttttacaatgctaccaacccattggtaacctactggggacctgttgatatctccaactgt 1740
ttaaaagaagcaaatgaagttgctaaccagattttaaatttaactgctgatgggcagaac 1800
ttaacctcagccaatattaccaacattgtggaacaggtcaaaagaattgtgaataaagaa 1860
gaaaacattgatataacacttggctcaactctaatgaatatattttctaatatcttaagc 1920
agttcagacagtgacttgcttgagtcatcttctgaagctttaaaaacaattgatgaattg 1980
gccttcaagatagacctaaatagcacatcacatgtgaatattacaactcggaacttggct 2040
ctcagcgtatcatccctgttaccagggacaaatgcaatttcaaattttagcattggtctt 2100
ccaagcaataatgaatcgtatttccagatggattttgagagtggacaagtggatccactg 2160
gcatctgtaattttgcctccaaacttacttgagaatttaagtccagaagattctgtatta 2220
gttagaagagcacagtttactttcttcaacaaaactggacttttccaggatgtaggaccc 2280
caaagaaaaactttagtgagttatgtgatggcgtgcagtattggaaacattactatccag 2340
aatctgaaggatcctgttcaaataaaaatcaaacatacaagaactcaggaagtgcatcat 2400
cccatctgtgccttctgggatctgaacaaaaacaaaagttttggaggatggaacacgtca 2460
ggatgtgttgcacacagagattcagatgcaagtgagacagtctgcctgtgtaaccacttc 2520
acacactttggagttctgatggaccttccaagaagtgcctcacagttagatgcaagaaac 2580
actaaagtcctcactttcatcagctatattgggtgtggaatatctgctattttttcagca 2640
gcaactctcctgacatatgttgcttttgagaaattgcgaagggattatccctccaaaatc 2700
ttgatgaacctgagcacagccctgctgttcctgaatctcctcttcctcctagatggctgg 2760
atcacctccttcaatgtggatggactttgcattgctgttgcagtcctgttgcatttcttc 2820
cttctggcaacctttacctggatggggctagaagcaattcacatgtacattgctctagtt 2880
aaagtatttaacacttacattcgccgatacattctaaaattctgcatcattggctggggt 2940
ttgcctgccttagtggtgtcagttgttctagcgagcagaaacaacaatgaagtctatgga 3000
aaagaaagttatgggaaagaaaaaggtgatgaattctgttggattcaagatccagtcata 3060
ttttatgtgacctgtgctgggtattttggagtcatgttttttctgaacattgccatgttc 3120
attgtggtaatggtgcagatctgtgggaggaatggcaagagaagcaaccggaccctgaga 3180
gaagaagtgttaaggaacctgcgcagtgtggttagcttgacctttctgttgggcatgaca 3240
tggggttttgcattctttgcctggggacccttaaatatccccttcatgtacctcttctcc 3300
atcttcaattcattacaaggtaagataaattgtacatga 3339
11 / 87
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
<210> 8
<211> 1112
<212> PRT
<213> homo sapiens
<400> 8
Met Phe Arg Ser Asp Arg Met Trp Ser Cys His Trp Lys Trp Lys Pro
1 5 10 15
Ser Pro Leu Leu Phe Leu Phe Ala Leu Tyr Ile Met Cys Val Pro His
20 25 30
Ser Ala Val Trp Gly Cys Ala Asn Cys Arg Val Val Leu Ser Asn Pro
35 40 45
Ser Gly Thr Phe Thr Ser Pro Cys Tyr Pro Asn Asp Tyr Pro Asn Ser
50 55 60
Gln Ala Cys Met Trp Thr Leu Arg Ala Pro Thr Gly Tyr Ile Ile Gln
65 70 75 80
Ile Thr Phe Asn Asp Phe Asp Ile Glu Glu Ala Pro Asn Cys Ile Tyr
85 90 95
Asp Ser Leu Ser Leu Asp Asn Gly Glu Ser Gln Thr Lys Phe Cys Gly
100 105 110
Ala Thr Ala Lys Gly Leu Ser Phe Asn Ser Ser Ala Asn Glu Met His
115 120 125
Val Ser Phe Ser Ser Asp Phe Ser Ile Gln Lys Lys Gly Phe Asn Ala
130 135 140
Ser Tyr Ile Arg Val Ala Val Ser Leu Arg Asn Gln Lys Val Ile Leu
145 150 155 160
Pro Gln Thr Ser Asp Ala Tyr Gln Val Ser Val Ala Lys Ser Ile Ser
165 170 175
Ile Pro Glu Leu Ser Ala Phe Thr Leu Cys Phe Glu Ala Thr Lys Val
180 185 190
Gly His Glu Asp Ser Asp Trp Thr Ala Phe Ser Tyr Ser Asn Ala Ser
195 200 205
Phe Thr Gln Leu Leu Ser Phe Gly Lys Ala Lys Ser Gly Tyr Phe Leu
210 215 220
Ser Ile Ser Asp Ser Lys Cys Leu Leu Asn Asn Ala Leu Pro Val Lys
225 230 235 240
Glu Lys Glu Asp Ile Phe Ala Glu Ser Phe Glu Gln Leu Cys Leu Val
245 250 255
Trp Asn Asn Ser Leu Gly Ser Ile Gly Val Asn Phe Lys Arg Asn Tyr
260 265 270
Glu Thr Val Pro Cys Asp Ser Thr Ile Ser Lys Val Ile Pro Gly Asn
275 280 285
Gly Lys Leu Leu Leu Gly Ser Asn Gln Asn Glu Ile Val Ser Leu Lys
290 295 300
Gly Asp Ile Tyr Asn Phe Arg Leu Trp Asn Phe Thr Met Asn Ala Lys
305 310 315 320
Ile Leu Ser Asn Leu Ser Cys Asn Val Lys Gly Asn Val Val Asp Trp
325 330 335
Gln Asn Asp Phe Trp Asn Ile Pro Asn Leu Ala Leu Lys Ala Glu Ser
340 345 350
Asn Leu Ser Cys Gly Ser Tyr Leu Ile Pro Leu Pro Ala Ala Glu Leu
355 360 365
Ala Ser Cys Ala Asp Leu Gly Thr Leu Cys Gln Ala Thr Val Asn Ser
370 375 380
Pro Ser Thr Thr Pro Pro Thr Val Thr Thr Asn Met Pro Val Thr Asn
385 390 395 400
Arg Ile Asp Lys Gln Arg Asn Asp Gly Ile Ile Tyr Arg Ile Ser Val
405 410 415
Val Ile Gln Asn Ile Leu Arg His Pro Glu Val Lys Val Gln Ser Lys
420 425 430
Val Ala Glu Trp Leu Asn Ser Thr Phe Gln Asn Trp Asn Tyr Thr Val
435 440 445
Tyr Val Val Asn Ile Ser Phe His Leu Ser Ala Gly Glu Asp Lys Ile
12 / 87
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
450 455 460
Lys Val Lys Arg Ser Leu Glu Asp Glu Pro Arg Leu Val Leu Trp Ala
465 470 475 480
Leu Leu Val Tyr Asn Ala Thr Asn Asn Thr Asn Leu Glu Gly Lys Ile
485 490 495
Ile Gln Gln Lys Leu Leu Lys Asn Asn Glu Ser Leu Asp Glu Gly Leu
500 505 510
Arg Leu His Thr Val Asn Val Arg Gln Leu Gly His Cys Leu Ala Met
515 520 525
Glu Glu Pro Lys Gly Tyr Tyr Trp Pro Ser Ile Gln Pro Ser Glu Tyr
530 535 540
Val Leu Pro Cys Pro Asp Lys Pro Gly Phe Ser Ala Ser Arg Ile Cys
545 550 555 560
Phe Tyr Asn Ala Thr Asn Pro Leu Val Thr Tyr Trp Gly Pro Val Asp
565 570 575
Ile Ser Asn Cys Leu Lys Glu Ala Asn Glu Val Ala Asn Gln Ile Leu
580 585 590
Asn Leu Thr Ala Asp Gly Gln Asn Leu Thr Ser Ala Asn Ile Thr Asn
595 600 605
Ile Val Glu Gln Val Lys Arg Ile Val Asn Lys Glu Glu Asn Ile Asp
610 615 620
Ile Thr Leu Gly Ser Thr Leu Met Asn Ile Phe Ser Asn Ile Leu Ser
625 630 635 640
Ser Ser Asp Ser Asp Leu Leu Glu Ser Ser Ser Glu Ala Leu Lys Thr
645 650 655
Ile Asp Glu Leu Ala Phe Lys Ile Asp Leu Asn Ser Thr Ser His Val
660 665 670
Asn Ile Thr Thr Arg Asn Leu Ala Leu Ser Val Ser Ser Leu Leu Pro
675 680 685
Gly Thr Asn Ala Ile Ser Asn Phe Ser Ile Gly Leu Pro Ser Asn Asn
690 695 700
Glu Ser Tyr Phe Gln Met Asp Phe Glu Ser Gly Gln Val Asp Pro Leu
705 710 715 720
Ala Ser Val Ile Leu Pro Pro Asn Leu Leu Glu Asn Leu Ser Pro Glu
725 730 735
Asp Ser Val Leu Val Arg Arg Ala Gln Phe Thr Phe Phe Asn Lys Thr
740 745 750
Gly Leu Phe Gln Asp Val Gly Pro Gln Arg Lys Thr Leu Val Ser Tyr
755 760 765
Val Met Ala Cys Ser Ile Gly Asn Ile Thr Ile Gln Asn Leu Lys Asp
770 775 780
Pro Val Gln Ile Lys Ile Lys His Thr Arg Thr Gln Glu Val His His
785 790 795 800
Pro Ile Cys Ala Phe Trp Asp Leu Asn Lys Asn Lys Ser Phe Gly Gly
805 810 815
Trp Asn Thr Ser Gly Cys Val Ala His Arg Asp Ser Asp Ala Ser Glu
820 825 830
Thr Val Cys Leu Cys Asn His Phe Thr His Phe Gly Val Leu Met Asp
835 840 845
Leu Pro Arg Ser Ala Ser Gln Leu Asp Ala Arg Asn Thr Lys Val Leu
850 855 860
Thr Phe Ile Ser Tyr Ile Gly Cys Gly Ile Ser Ala Ile Phe Ser Ala
865 870 875 880
Ala Thr Leu Leu Thr Tyr Val Ala Phe Glu Lys Leu Arg Arg Asp Tyr
885 890 895
Pro Ser Lys Ile Leu Met Asn Leu Ser Thr Ala Leu Leu Phe Leu Asn
900 905 910
Leu Leu Phe Leu Leu Asp Gly Trp Ile Thr Ser Phe Asn Val Asp Gly
915 920 925
Leu Cys Ile Ala Val Ala Val Leu Leu His Phe Phe Leu Leu Ala Thr
930 935 940
Phe Thr Trp Met Gly Leu Glu Ala Ile His Met Tyr Ile Ala Leu Val
945 950 955 960
13 / 87
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
Lys Val Phe Asn Thr Tyr Ile Arg Arg Tyr Ile Leu Lys Phe Cys Ile
965 970 975
Ile Gly Trp Gly Leu Pro Ala Leu Val Val Ser Val Val Leu Ala Ser
980 985 990
Arg Asn Asn Asn Glu Val Tyr Gly Lys Glu Ser Tyr Gly Lys Glu Lys
995 1000 1005
Gly Asp Glu Phe Cys Trp Ile Gln Asp Pro Val Ile Phe Tyr Val Thr
1010 1015 1020
Cys Ala Gly Tyr Phe Gly Val Met Phe Phe Leu Asn,Ile Ala Met Phe
1025 1030 1035 1040
Ile Val Val Met Val Gln Ile Cys Gly Arg Asn Gly Lys Arg Ser Asn
1045 1050 1055
Arg Thr Leu Arg Glu Glu Val Leu Arg Asn Leu Arg Ser Val Val Ser
1060 1065 1070
Leu Thr Phe Leu Leu Gly Met Thr Trp Gly Phe Ala Phe Phe Ala Trp
1075 1080 1085
Gly Pro Leu Asn Ile Pro Phe Met Tyr Leu Phe Ser Ile Phe Asn Ser
1090 1095 1100
Leu Gln Gly Lys Ile Asn Cys Thr
1105 1110
<210> 9
<211> 3750
<212> DNA
<213> homo sapiens
<400>
9
atgtttcgctcagatcgaatgtggagctgccattggaaatggaagcccagtcctctcctg 60
ttcttatttgctttatatatcatgtgtgttcctcactcagtgtggggatgtgccaactgc 120
cgagtggttttgtccaacccttctgggacctttacttctccatgctaccctaacgactac 180
ccaaacagccaggcttgcatgtggacgctccgagcccccaccggttatatcattcagata 240
acatttaacgactttgacattgaagaagctcccaattgcatttatgactcattatccctt 300
gataatggagagagccagactaaattttgtggagcaactgccaaaggcctatcatttaac 360
tcaagtgcgaatgagatgcatgtgtccttttcaagtgactttagcatccagaagaaaggt 420
ttcaatgccagctacatcagagttgccgtgtccttaaggaatcaaaaggtcattttaccc 480
cagacatcagatgcttaccaggtatctgttgcaaaaagcatctctattccagagctcagt 540
gctttcacactctgctttgaagcaaccaaagttggccatgaagacagtgattggacagct 600
ttctcctactcaaatgcatccttcacacaattgctcagttttggaaaggccaagagtggc 660
tactttctatccatttctgattcaaaatgtttgttgaataatgcattacctgtcaaagaa 720
aaagaagacatttttgcagaaagctttgaacagctctgccttgtttggaataattctttg 780
ggctctattggtgtaaatttcaaaagaaactatgaaacagttccatgtgattctaccatt 840
agtaaagttattcctgggaatgggaaattgttgttgggctccaatcaaaatgaaattgtc 900
tctctaaaaggggacatttataactttcgactttggaattttaccatgaatgccaaaatc 960
ctctccaacctcagctgtaatgtgaaagggaatgtagtcgactggcaaaatgacttctgg 1020
aatatcccaaacctagctctgaaagctgaaagcaacctaagctgtggttcctacctgatc 1080
ccgctcccagcagcagaactggccagctgtgcagacctggggaccctctgtcaagctact 1140
gtaaactctcctagtactacaccacccactgtcaccactaacatgcctgttactaacaga 1200
atcgataaacaaaggaatgatggaattatctatagaatatccgtagtgattcagaacatc 1260
cttcgtcaccctgaggtaaaagtacagagcaaggtggcagaatggctcaattcaaccttc 1320
caaaattggaactacacggtttatgtcgttaatatcagttttcacctgagtgctggagag 1380
gacaagattaaagtcaagagaagccttgaggatgagccaaggttggtgctttgggccctt 1440
ctagtttacaatgctaccaacaatactaatttagaaggaaaaatcattcagcagaagctc 1500
ctaaaaaataatgagtccttggatgaaggcttgaggctacatacagtgaatgtgagacaa 1560
ctgggtcattgtcttgccatggaggaacccaaaggctactactggccatctatccaacct 1620
tctgaatacgttcttccttgtccagacaagcctggcttttctgcttctcggatatgtttt 1680
tacaatgctaccaacccattggtaacctactggggacctgttgatatctccaactgttta 1740
aaagaagcaaatgaagttgctaaccagattttaaatttaactgctgatgggcagaactta 1800
acctcagccaatattaccaacattgtggaacaggtcaaaagaattgtgaataaagaagaa 1860
aacattgatataacacttggctcaactctaatgaatatattttctaatatcttaagcagt 1920
tcagacagtgacttgcttgagtcatcttctgaagctttaaaaacaattgatgaattggcc 1980
ttcaagatagacctaaatagcacatcacatgtgaatattacaactcggaacttggctctc 2040
agcgtatcatccctgttaccagggacaaatgcaatttcaaattttagcattggtcttcca 2100
agcaataatgaatcgtatttccagatggattttgagagtggacaagtggatccactggca 2160
14 / 87
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
tctgtaattttgcctccaaacttacttgagaatttaagtccagaagattctgtattagtt 2220
agaagagcacagtttactttcttcaacaaaactggacttttccaggatgtaggaccccaa 2280
agaaaaactttagtgagttatgtgatggcgtgcagtattggaaacattactatccagaat 2340
ctgaaggatcctgttcaaataaaaatcaaacatacaagaactcaggaagtgcatcatccc 2400
atctgtgccttctgggatctgaacaaaaacaaaagttttggaggatggaacacgtcagga 2460
tgtgttgcacacagagattcagatgcaagtgagacagtctgcctgtgtaaccacttcaca 2520
cactttggagttctgatggaccttccaagaagtgcctcacagttagatgcaagaaacact 2580
aaagtcctcactttcatcagctatattgggtgtggaatatctgctattttttcagcagca 2640
actctcctgacatatgttgcttttgagaaattgcgaagggattatccctccaaaatcttg 2700
atgaacctgagcacagccctgctgttcctgaatctcctcttcctcctagatggctggatc 2760
acctccttcaatgtggatggactttgcattgctgttgcagtcctgttgcatttcttcctt 2820
ctggcaacctttacctggatggggctagaagcaattcacatgtacattgctctagttaaa 2880
gtatttaacacttacattcgccgatacattctaaaattctgcatcattggctggggtttg 2940
cctgccttagtggtgtcagttgttctagcgagcagaaacaacaatgaagtctatggaaaa 3000
gaaagttatgggaaagaaaaaggtgatgaattctgttggattcaagatccagtcatattt 3060
tatgtgacctgtgctgggtattttggagtcatgttttttctgaacattgccatgttcatt 3120
gtggtaatggtgcagatctgtgggaggaatggcaagagaagcaaccggaccctgagagaa 3180
gaagtgttaaggaacctgcgcagtgtggttagcttgacctttctgttgggcatgacatgg 3240
ggttttgcattctttgcctggggacccttaaatatccccttcatgtacctcttctccatc 3300
ttcaattcattacaaggcttatttatattcatcttccactgtgctatgaaggagaatgtt 3360
cagaaacagtggcggcggcatctctgctgtggtagatttcggttagcagataactcagat 3420
tggagtaagacagctaccaatatcatcaagaaaagttctgataatctaggaaaatctttg 3480
tcttcaagctccattggttccaactcaacctatcttacatccaaatctaaatccagctct 3540
accacctatttcaaaaggaatagccacacagacagtgcttccatggacaagtccttgtca 3600
aaactggcccatgctgatggagatcaaacatcaatcatccctgtccatcaggtcattgat 3660
aaggtcaagggttattgcaatgctcattcagacaacttctataaaaatattatcatgtca 3720
gacaccttcagccacagcacaaagttttaa 3750
<210> 10
<211> 1249
<212> PRT
<213> homo Sapiens
<400> 10
Met Phe Arg Ser Asp Arg Met Trp Ser Cys His Trp Lys Trp Lys Pro
1 5 10 15
Ser Pro Leu Leu Phe Leu Phe Ala Leu Tyr Ile Met Cys Val Pro His
20 25 30
Ser Val Trp Gly Cys Ala Asn Cys Arg Val Val Leu Ser Asn Pro Ser
35 40 45
Gly Thr Phe Thr Ser Pro Cys Tyr Pro Asn Asp Tyr Pro Asn Ser Gln
50 55 60
Ala Cys Met Trp Thr Leu Arg Ala Pro Thr Gly Tyr Ile Ile Gln Ile
65 70 75 80
Thr Phe Asn Asp Phe Asp Ile Glu Glu Ala Pro Asn Cys Ile Tyr Asp
85 90 95
Ser Leu Ser Leu Asp Asn Gly Glu Ser Gln Thr Lys Phe Cys Gly Ala
100 105 110
Thr Ala Lys Gly Leu Ser Phe Asn Ser Ser Ala Asn Glu Met His Val
115 120 125
Ser Phe Ser Ser Asp Phe Ser Ile Gln Lys Lys Gly Phe Asn Ala Ser
130 135 140
Tyr Ile Arg Val Ala Val Ser Leu Arg Asn Gln Lys Val Ile Leu Pro
145 150 155 160
Gln Thr Ser Asp Ala Tyr Gln Val Ser Val Ala Lys Ser Ile Ser Ile
165 170 175
Pro Glu Leu Ser Ala Phe Thr Leu Cys Phe Glu Ala Thr Lys Val Gly
180 185 190
His Glu Asp Ser Asp Trp Thr Ala Phe Ser Tyr Ser Asn Ala Ser Phe
195 200 205
Thr Gln Leu Leu Ser Phe Gly Lys Ala Lys Ser Gly Tyr Phe Leu Ser
210 215 220
Ile Ser Asp Ser Lys Cys Leu Leu Asn Asn Ala Leu Pro Val Lys Glu
15 / 87
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
225 230 235 240
Lys Glu Asp Ile Phe Ala Glu Ser Phe Glu Gln Leu Cys Leu Val Trp
245 250 255
Asn Asn Ser Leu Gly Ser Ile Gly Val Asn Phe Lys Arg Asn Tyr Glu
260 265 270
Thr Val Pro Cys Asp Ser Thr Ile Ser Lys Val Ile Pro Gly Asn Gly
275 280 285
Lys Leu Leu Leu Gly Ser Asn Gln Asn Glu Ile Val Ser Leu Lys Gly
290 295 300
Asp Ile Tyr Asn Phe Arg Leu Trp Asn Phe Thr Met Asn Ala Lys Ile
305 310 315 320
Leu Ser Asn Leu Ser Cys Asn Val Lys Gly Asn Val Val Asp Trp Gln
325 330 335
Asn Asp Phe Trp Asn Ile Pro Asn Leu Ala Leu Lys Ala Glu Ser Asn
340 345 350
Leu Ser Cys Gly Ser Tyr Leu Ile Pro Leu Pro Ala Ala Glu Leu Ala
355 360 365
Ser Cys Ala Asp Leu Gly Thr Leu Cys Gln Ala Thr Val Asn Ser Pro
370 375 380
Ser Thr Thr Pro Pro Thr Val Thr Thr Asn Met Pro Val Thr Asn Arg
385 390 395 400
Ile Asp Lys Gln Arg Asn Asp Gly Ile Ile Tyr Arg Ile Ser Val Val
405 410 415
Ile Gln Asn Ile Leu Arg His Pro Glu Val Lys Val Gln Ser Lys Val
420 425 430
Ala Glu Trp Leu Asn Ser Thr Phe Gln Asn Trp Asn Tyr Thr Val Tyr
435 440 445
Val Val Asn Ile Ser Phe His Leu Ser Ala Gly Glu Asp Lys Ile Lys
450 455 460
Val Lys Arg Ser Leu Glu Asp Glu Pro Arg Leu Val Leu Trp Ala Leu
465 470 475 480
Leu Val Tyr Asn Ala Thr Asn Asn Thr Asn Leu Glu Gly Lys Ile Ile
485 490 495
Gln Gln Lys Leu Leu Lys Asn Asn Glu Ser Leu Asp Glu Gly Leu Arg
500 505 510
Leu His Thr Val Asn Val Arg Gln Leu Gly His Cys Leu Ala Met Glu
515 520 525
Glu Pro Lys Gly Tyr Tyr Trp Pro Ser Ile Gln Pro Ser Glu Tyr Val
530 535 540
Leu Pro Cys Pro Asp Lys Pro Gly Phe Ser Ala Ser Arg Ile Cys Phe
545 550 555 560
Tyr Asn Ala Thr Asn Pro Leu Val Thr Tyr Trp Gly Pro Val Asp Ile
565 570 575
Ser Asn Cys Leu Lys Glu Ala Asn Glu Val Ala Asn Gln Ile Leu Asn
580 585 590
Leu Thr Ala Asp Gly Gln Asn Leu Thr Ser Ala Asn Ile Thr Asn Ile
595 600 605
Val Glu Gln Val Lys Arg Ile Val Asn Lys Glu Glu Asn Ile Asp Ile
610 615 620
Thr Leu Gly Ser Thr Leu Met Asn Ile Phe Ser Asn Ile Leu Ser Ser
625 630 635 640
Ser Asp Ser Asp Leu Leu Glu Ser Ser Ser Glu Ala Leu Lys Thr Ile
645 650 655
Asp Glu Leu Ala Phe Lys Ile Asp Leu Asn Ser Thr Ser His Val Asn
660 665 670
Ile Thr Thr Arg Asn Leu Ala Leu Ser Val Ser Ser Leu Leu Pro Gly
675 680 685
Thr Asn Ala Ile Ser Asn Phe Ser Ile Gly Leu Pro Ser Asn Asn Glu
690 695 700
Ser Tyr Phe Gln Met Asp Phe Glu Ser Gly Gln Val Asp Pro Leu Ala
705 710 715 720
Ser Val Ile Leu Pro Pro Asn Leu Leu Glu Asn Leu Ser Pro Glu Asp
725 730 735
16 / 87
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
Ser Val Leu Val Arg Arg Ala Gln Phe Thr Phe Phe Asn Lys Thr Gly
740 745 750
Leu Phe Gln Asp Val Gly Pro Gln Arg Lys Thr Leu Val Ser Tyr Val
755 760 765
Met Ala Cys Ser Ile Gly Asn Ile Thr Ile Gln Asn Leu Lys Asp Pro
770 775 780
Val Gln Ile Lys Ile Lys His Thr Arg Thr Gln Glu Val His His Pro
785 790 795 800
Ile Cys Ala Phe Trp Asp Leu Asn Lys Asn Lys Ser Phe Gly Gly Trp
805 810 815
Asn Thr Ser Gly Cys Val Ala His Arg Asp Ser Asp Ala Ser Glu Thr
820 825 830
Val Cys Leu Cys Asn His Phe Thr His Phe Gly Val Leu Met Asp Leu
835 840 845
Pro Arg Ser Ala Ser Gln Leu Asp Ala Arg Asn Thr Lys Val Leu Thr
850 855 860
Phe Ile Ser Tyr Ile Gly Cys Gly Ile Ser Ala Ile Phe Ser Ala Ala
865 870 875 880
Thr Leu Leu Thr Tyr Val Ala Phe Glu Lys Leu Arg Arg Asp Tyr Pro
885 890 895
Ser Lys Ile Leu Met Asn Leu Ser Thr Ala Leu Leu Phe Leu Asn Leu
900 905 910
Leu Phe Leu Leu Asp Gly Trp Ile Thr Ser Phe Asn Val Asp Gly Leu
915 920 925
Cys Ile Ala Val Ala Val Leu Leu His Phe Phe Leu Leu Ala Thr Phe
930 935 940
Thr Trp Met Gly Leu Glu Ala Ile His Met Tyr Ile Ala Leu Val Lys
945 950 955 960
Val Phe Asn Thr Tyr Ile Arg Arg Tyr Ile Leu Lys Phe Cys Ile Ile
965 970 975
Gly Trp Gly Leu Pro Ala Leu Val Val Ser Val Val Leu Ala Ser Arg
980 985 990
Asn Asn Asn Glu Val Tyr Gly Lys Glu Ser Tyr Gly Lys Glu Lys Gly
995 1000 1005
Asp Glu Phe Cys Trp Ile Gln Asp Pro Val Ile Phe Tyr Val Thr Cys
1010 1015 1020
Ala Gly Tyr Phe Gly Val Met Phe Phe Leu Asn Ile Ala Met Phe Ile
1025 1030 1035 1040
Val Val Met Val Gln Ile Cys Gly Arg Asn Gly Lys Arg Ser Asn Arg
1045 1050 1055
Thr Leu Arg Glu Glu Val Leu Arg Asn Leu Arg Ser Val Val Ser Leu
1060 1065 1070
Thr Phe Leu Leu Gly Met Thr Trp Gly Phe Ala Phe Phe Ala Trp Gly
1075 1080 1085
Pro Leu Asn Ile Pro Phe Met Tyr Leu Phe Ser Ile Phe Asn Ser Leu
1090 1095 1100
Gln Gly Leu Phe Ile Phe Ile Phe His Cys Ala Met Lys Glu Asn Val
1105 1110 1115 1120
Gln Lys Gln Trp Arg Arg His Leu Cys Cys Gly Arg Phe Arg Leu Ala
1125 1130 1135
Asp Asn Ser Asp Trp Ser Lys Thr Ala Thr Asn Ile Ile Lys Lys Ser
1140 1145 1150
Ser Asp Asn Leu Gly Lys Ser Leu Ser Ser Ser Ser Ile Gly Ser Asn
1155 1160 1165
Ser Thr Tyr Leu Thr Ser Lys Ser Lys Ser Ser Ser Thr Thr Tyr Phe
1170 1175 1180
Lys Arg Asn Ser His Thr Asp Ser Ala Ser Met Asp Lys Ser Leu Ser
1185 1190 1195 1200
Lys Leu Ala His Ala Asp Gly Asp Gln Thr Ser Ile Ile Pro Val His
1205 1210 1215
Gln Val Ile Asp Lys Val Lys Gly Tyr Cys Asn Ala His Ser Asp Asn
1220 1225 1230
Phe Tyr Lys Asn Ile Ile Met Ser Asp Thr Phe Ser His Ser Thr Lys
17 / 87
tcagacagtgacttgcttgagtcatcttctgaagctttaaaaacaattgatgaattggcc 19
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
Phe
1235 1240 1245
<210> 11
<211> 3663
<212> DNA
<213> homo sapiens
<400>
11
atgtttcgctcagatcgaatgtggagctgccattggaaatggaagcccagtcctctcctg 60
ttcttatttgctttatatatcatgtgtgttcctcactcagtgtggggatgtgccaactgc 120
cgagtggttttgtccaacccttctgggacctttacttctccatgctaccctaacgactac 180
ccaaacagccaggcttgcatgtggacgctccgagcccccaccggttatatcattcagata 240
acatttaacgactttgacattgaagaagctcccaattgcatttatgactcattatccctt 300
gataatggagagagccagactaaattttgtggagcaactgccaaaggcctatcatttaac 360
tcaagtgcgaatgagatgcatgtgtccttttcaagtgactttagcatccagaagaaaggt 420
ttcaatgccagctacatcagagttgccgtgtccttaaggaatcaaaaggtcattttaccc 480
cagacatcagatgcttaccaggtatctgttgcaaaaagcatctctattccagagctcagt 540
gctttcacactctgctttgaagcaaccaaagttggccatgaagacagtgattggacagct 600
ttctcctactcaaatgcatccttcacacaattgctcagttttggaaaggccaagagtggc 660
tactttctatccatttctgattcaaaatgtttgttgaataatgcattacctgtcaaagaa 720
aaagaagacatttttgcagaaagctttgaacagctctgccttgtttggaataattctttg 780
ggctctattggtgtaaatttcaaaagaaactatgaaacagttccatgtgattctaccatt 840
agtaaagttattcctgggaatgggaaattgttgttgggctccaatcaaaatgaaattgtc 900
tctctaaaaggggacatttataactttcgactttggaattttaccatgaatgccaaaatc 960
ctctccaacctcagctgtaatgtgaaagggaatgtagtcgactggcaaaatgacttctgg 1020
aatatcccaaacctagctctgaaagctgaaagcaacctaagctgtggttcctacctgatc 1080
ccgctcccagcagcagaactggccagctgtgcagacctggggaccctctgtcaagctact 1140
gtaaactctcctagtactacaccacccactgtcaccactaacatgcctgttactaacaga 1200
atcgataaacaaaggaatgatggaattatctatagaatatccgtagtgattcagaacatc 1260
cttcgtcaccctgaggtaaaagtacagagcaaggtggcagaatggctcaattcaaccttc 1320
caaaattggaactacacggtttatgtcgttaatatcagttttcacctgagtgctggagag 1380
gacaagattaaagtcaagagaagccttgaggatgagccaaggttggtgctttgggccctt 1440
ctagtttacaatgctaccaacaatactaatttagaaggaaaaatcattcagcagaagctc 1500
ctaaaaaataatgagtccttggatgaaggcttgaggctacatacagtgaatgtgagacaa 1560
ctgggtcattgtcttgccatggaggaacccaaaggctactactggccatctatccaacct 1620
tctgaatacgttcttccttgtccagacaagcctggcttttctgcttctcggatatgtttt 1680
tacaatgctaccaacccattggtaacctactggggacctgttgatatctccaactgttta 1740
aaagaagcaaatgaagttgctaaccagattttaaatttaactgctgatgggcagaactta 1800
acctcagccaatattaccaacattgtggaacaggtcaaaagaattgtgaataaagaagaa 1860
aacattgatataacacttggctcaactctaatgaatatattttctaatatcttaagcagt 1920
tcagacagtgacttgcttgagtcatcttctgaagctttaaaaacaattgatgaattggcc 1980
ttcaagatagacctaaatagcacatcacatgtgaatattacaactcggaacttggctctc 2040
agcgtatcatccctgttaccagggacaaatgcaatttcaaattttagcattggtcttcca 2100
agcaataatgaatcgtatttccagatggattttgagagtggacaagtggatccactggca 2160
tctgtaattttgcctccaaacttacttgagaatttaagtccagaagattctgtattagtt 2220
agaagagcacagtttactttcttcaacaaaactggacttttccaggatgtaggaccccaa 2280
agaaaaactttagtgagttatgtgatggcgtgcagtattggaaacattactatccagaat 2340
ctgaaggatcctgttcaaataaaaatcaaacatacaagaactcaggaagtgcatcatccc 2400
atctgtgccttctgggatctgaacaaaaacaaaagttttggaggatggaacacgtcagga 2460
tgtgttgcacacagagattcagatgcaagtgagacagtctgcctgtgtaaccacttcaca 2520
cactttggagttctgatggaccttccaagaagtgcctcacagttagatgcaagaaacact 2580
aaagtcctcactttcatcagctatattgggtgtggaatatctgctattttttcagcagca 2640
actctcctgacatatgttgcttttgagaaattgcgaagggattatccctccaaaatcttg 2700
atgaacctgagcacagccctgctgttcctgaatctcctcttcctcctagatggctggatc 2760
acctccttcaatgtggatggactttgcattgctgttgcagtcctgttgcatttcttcctt 2820
ctggcaacctttacctggatggggctagaagcaattcacatgtacattgctctagttaaa 2880
gtatttaacacttacattcgccgatacattctaaaattctgcatcattggctggggtttg 2940
cctgccttagtggtgtcagttgttctagcgagcagaaacaacaatgaagtctatggaaaa 3000
gaaagttatgggaaagaaaaaggtgatgaattctgttggattcaagatccagtcatattt 3060
tatgtgacctgtgctgggtattttggagtcatgttttttctgaacattgccatgttcatt 3120
gtggtaatggtgcagatctgtgggaggaatggcaagagaagcaaccggaccctgagagaa 3180
18 / 87
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
gaagtgttaaggaacctgcgcagtgtggttagcttgacctttctgttgggcatgacatgg 3240
ggttttgcattctttgcctggggacccttaaatatccccttcatgtacctcttctccatc 3300
ttcaattcattacaaggcttatttatattcatcttccactgtgctatgaaggagaatgtt 3360
cagaaacagtggcggcggcatctctgctgtggtagatttcggttagcagataactcagat 3420
tggagtaagacagctaccaatatcatcaagaaaagttctgataatctaggaaaatctttg 3480
tcttcaagctccattggttccaactcaacctatcttacatccaaatctaaatccagctct 3540
accacctatttcaaaaggaatagccacacagataatgtctcctatgagcattccttcaac 3600
aaaagtggatcactcagacagtgcttccatggacaagtccttgtcaaaactggcccatgc 3660
tga 3663
<210> 12
<211> 1220
<212> PRT
<213> homo sapiens
<400> 12
Met Phe Arg Ser Asp Arg Met Trp Ser Cys His Trp Lys Trp Lys Pro
1 5 10 15
Ser Pro Leu Leu Phe Leu Phe Ala Leu Tyr Ile Met Cys Val Pro His
20 25 30
Ser Val Trp Gly Cys Ala Asn Cys Arg Val Val Leu Ser Asn Pro Ser
35 40 .45
Gly Thr Phe Thr Ser Pro Cys Tyr Pro Asn Asp Tyr Pro Asn Ser Gln
50 55 60
Ala Cys Met Trp Thr Leu Arg Ala Pro Thr Gly Tyr Ile Ile Gln Ile
65 70 75 80
Thr Phe Asn Asp Phe Asp Ile Glu Glu Ala Pro Asn Cys Ile Tyr Asp
85 90 95
Ser Leu Ser Leu Asp Asn Gly Glu Ser Gln Thr Lys Phe Cys Gly Ala
100 105 110
Thr Ala Lys Gly Leu Ser Phe Asn Ser Ser Ala Asn Glu Met His Val
115 120 125
Ser Phe Ser Ser Asp Phe Ser Ile Gln Lys Lys Gly Phe Asn Ala Ser
130 135 140
Tyr Ile Arg Val Ala Val Ser Leu Arg Asn Gln Lys Val Ile Leu Pro
145 150 155 160
Gln Thr Ser Asp Ala Tyr Gln Val Ser Val Ala Lys Ser Ile Ser Ile
165 170 175
Pro Glu Leu Ser Ala Phe Thr Leu Cys Phe Glu Ala Thr Lys Val Gly
180 185 190
His Glu Asp Ser Asp Trp Thr Ala Phe Ser Tyr Ser Asn Ala Ser Phe
195 200 205
Thr Gln Leu Leu Ser Phe Gly Lys Ala Lys Ser Gly Tyr Phe Leu Ser
210 215 220
Ile Ser Asp Ser Lys Cys Leu Leu Asn Asn Ala Leu Pro Val Lys Glu
225 230 235 240
Lys Glu Asp Ile Phe Ala Glu Ser Phe Glu Gln Leu Cys Leu Val Trp
245 250 255
Asn Asn Ser Leu Gly Ser Ile Gly Val Asn Phe Lys Arg Asn Tyr Glu
260 265 270
Thr Val Pro Cys Asp Ser Thr Ile Ser Lys Val Ile Pro Gly Asn Gly
275 280 285
Lys Leu Leu Leu Gly Ser Asn Gln Asn Glu Ile Val Ser Leu Lys Gly
290 295 300
Asp Ile Tyr Asn Phe Arg Leu Trp Asn Phe Thr Met Asn Ala Lys Ile
305 310 315 320
Leu Ser Asn Leu Ser Cys Asn Val Lys Gly Asn Val Val Asp Trp Gln
325 330 335
Asn Asp Phe Trp Asn Ile Pro Asn Leu Ala Leu Lys Ala Glu Ser Asn
340 345 350
Leu Ser Cys Gly Ser Tyr Leu Ile Pro Leu Pro Ala Ala Glu Leu Ala
355 360 365
Ser Cys Ala Asp Leu Gly Thr Leu Cys Gln Ala Thr Val Asn Ser Pro
19 / 87
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
370 375 380
Ser Thr Thr Pro Pro Thr Val Thr Thr Asn Met Pro Val Thr Asn Arg
385 390 395 400
Ile Asp Lys Gln Arg Asn Asp Gly Ile Ile Tyr Arg Ile Ser Val Val
405 410 415
Ile Gln Asn Ile Leu Arg His Pro Glu Val Lys Val Gln Ser Lys Val
420 425 430
Ala Glu Trp Leu Asn Ser Thr Phe Gln Asn Trp Asn Tyr Thr Val Tyr
435 440 445
Val Val Asn Ile Ser Phe His Leu Ser Ala Gly Glu Asp Lys Ile Lys
450 455 460
Val Lys Arg Ser Leu Glu Asp Glu Pro Arg Leu Val Leu Trp Ala Leu
465 470 475 480
Leu Val Tyr Asn Ala Thr Asn Asn Thr Asn Leu Glu Gly Lys Ile Ile
485 490 495
Gln Gln Lys Leu Leu Lys Asn Asn Glu Ser Leu Asp Glu Gly Leu Arg
500 505 510
Leu His Thr Val Asn Val Arg Gln Leu Gly His Cys Leu Ala Met Glu
515 520 525
Glu Pro Lys Gly Tyr Tyr Trp Pro Ser Ile Gln Pro Ser Glu Tyr Val
530 535 540
Leu Pro Cys Pro Asp Lys Pro Gly Phe Ser Ala Ser Arg Ile Cys Phe
545 550 555 560
Tyr Asn Ala Thr Asn Pro Leu Val Thr Tyr Trp Gly Pro Val Asp Ile
565 570 575
Ser Asn Cys Leu Lys Glu Ala Asn Glu Val Ala Asn Gln Ile Leu Asn
580 585 590
Leu Thr Ala Asp Gly Gln Asn Leu Thr Ser Ala Asn Ile Thr Asn Ile
595 600 605
Val Glu Gln Val Lys Arg Ile Val Asn Lys Glu Glu Asn Ile Asp Ile
610 615 620
Thr Leu Gly Ser Thr Leu Met Asn Ile Phe Ser Asn Ile Leu Ser Ser
625 630 635 640
Ser Asp Ser Asp Leu Leu Glu Ser Ser Ser Glu Ala Leu Lys Thr Ile
645 650 655
Asp Glu Leu Ala Phe Lys Ile Asp Leu Asn Ser Thr Ser His Val Asn
660 665 670
Ile Thr Thr Arg Asn Leu Ala Leu Ser Val Ser Ser Leu Leu Pro Gly
675 680 685
Thr Asn Ala Ile Ser Asn Phe Ser Ile Gly Leu Pro Ser Asn Asn Glu
690 695 700
Ser Tyr Phe Gln Met Asp Phe Glu Ser Gly Gln Val Asp Pro Leu Ala
705 710 715 720
Ser Val Ile Leu Pro Pro Asn Leu Leu Glu Asn Leu Ser Pro Glu Asp
725 730 735
Ser Val Leu Val Arg Arg Ala Gln Phe Thr Phe Phe Asn Lys Thr Gly
740 745 750
Leu Phe Gln Asp Val Gly Pro Gln Arg Lys Thr Leu Val Ser Tyr Val
755 760 765
Met Ala Cys Ser Ile Gly Asn Ile Thr Ile Gln Asn Leu Lys Asp Pro
770 775 780
Val Gln Ile Lys Ile Lys His Thr Arg Thr Gln Glu Val His His Pro
785 790 795 800
Ile Cys Ala Phe Trp Asp Leu Asn Lys Asn Lys Ser Phe Gly Gly Trp
805 810 815
Asn Thr Ser Gly Cys Val Ala His Arg Asp Ser Asp Ala Ser Glu Thr
820 825 830
Val Cys Leu Cys Asn His Phe Thr His Phe Gly Val Leu Met Asp Leu
835 840 845
Pro Arg Ser Ala Ser Gln Leu Asp Ala Arg Asn Thr Lys Val Leu Thr
850 855 860
Phe Ile Ser Tyr Ile Gly Cys Gly Ile Ser Ala Ile Phe Ser Ala Ala
865 870 875 880
20 ~/ 87
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
Thr Leu Leu Thr Tyr Val Ala Phe Glu Lys Leu Arg Arg Asp Tyr Pro
885 890 895
Ser Lys Ile Leu Met Asn Leu Ser Thr Ala Leu Leu Phe Leu Asn Leu
900 905 910
Leu Phe Leu Leu Asp Gly Trp Ile Thr Ser Phe Asn Val Asp Gly Leu
915 920 925
Cys Ile Ala Val Ala Val Leu Leu His Phe Phe Leu Leu Ala Thr Phe
930 935 940
Thr Trp Met Gly Leu Glu Ala Ile His Met Tyr Ile Ala Leu Val Lys
945 950 955 960
Val Phe Asn Thr Tyr Ile Arg Arg Tyr Ile Leu Lys Phe Cys Ile Ile
965 970 975
Gly Trp Gly Leu Pro Ala Leu Val Val Ser Val Val Leu Ala Ser Arg
980 985 990
Asn Asn Asn Glu Val Tyr Gly Lys Glu Ser Tyr Gly Lys Glu Lys Gly
995 1000 1005
Asp Glu Phe Cys Trp Ile Gln Asp Pro Val Ile Phe Tyr Val Thr Cys
1010 1015 1020
Ala Gly Tyr Phe Gly Val Met Phe Phe Leu Asn Ile Ala Met Phe Ile
1025 1030 1035 1040
Val Val Met Val Gln Ile Cys Gly Arg Asn Gly Lys Arg Ser Asn Arg
1045 1050 1055
Thr Leu Arg Glu Glu Val Leu Arg Asn Leu Arg Ser Val Val Ser Leu
1060 1065 1070
Thr Phe Leu Leu Gly Met Thr Trp Gly Phe Ala Phe Phe Ala Trp Gly
1075 1080 1085
Pro Leu Asn Ile Pro Phe Met Tyr Leu Phe Ser Ile Phe Asn Ser Leu
1090 1095 1100
Gln Gly Leu Phe Ile Phe Ile Phe His Cys Ala Met Lys Glu Asn Val
1105 1110 1115 1120
Gln Lys Gln Trp Arg Arg His Leu Cys Cys Gly Arg Phe Arg Leu Ala
1125 1130 1135
Asp Asn Ser Asp Trp Ser Lys Thr Ala Thr Asn Ile Ile Lys Lys Ser
1140 1145 1150
Ser Asp Asn Leu Gly Lys Ser Leu Ser Ser Ser Ser Ile Gly Ser Asn
1155 1160 1165
Ser Thr Tyr Leu Thr Ser Lys Ser Lys Ser Ser Ser Thr Thr Tyr Phe
1170 1175 1180
Lys Arg Asn Ser His Thr Asp Asn Val Ser Tyr Glu His Ser Phe Asn
1185 1190 1195 1200
Lys Ser Gly Ser Leu Arg Gln Cys Phe His Gly Gln Val Leu Val Lys
1205 1210 1215
Thr Gly Pro Cys
1220
<210> 13
<211> 2154
<212> DNA
<213> homo sapiens
<400> 13
atgtttcgctcagatcgaatgtggagctgccattggaaatggaagcccagtcctctcctg 60
ttcttatttgctttatatatcatgtgtgttcctcactcagtgtggggatgtgccaactgc 120
cgagtggttttgtccaacccttctgggacctttacttctccatgctaccctaacgactac 180
ccaaacagccaggcttgcatgtggacgctccgagcccccaccggttatatcattcagata 240
acatttaacgactttgacattgaagaagctcccaattgcatttatgactcattatccctt 300
gataatggagagagccagactaaattttgtggagcaactgccaaaggcctatcatttaac 360
tcaagtgcgaatgagatgcatgtgtccttttcaagtgactttagcatccagaagaaaggt 420
ttcaatgccagctacatcagagttgccgtgtccttaaggaatcaaaaggtcattttaccc 480
cagacatcagatgcttaccaggtatctgttgcaaaaagcatctctattccagagctcagt 540
gctttcacactctgctttgaagcaaccaaagttggccatgaagacagtgattggacagct 600
ttctcctactcaaatgcatccttcacacaattgctcagttttggaaaggccaagagtggc 660
tactttctatccatttctgattcaaaatgtttgttgaataatgcattacctgtcaaagaa 720
21 / 87
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
aaagaagacatttttgcagaaagctttgaacagctctgccttgtttggaataattctttg 780
ggctctattggtgtaaatttcaaaagaaactatgaaacagttccatgtgattctaccatt 840
agtaaagttattcctgggaatgggaaattgttgttgggctccaatcaaaatgaaattgtc 900
tctctaaaaggggacatttataactttcgactttggaattttaccatgaatgccaaaatc 960
ctctccaacctcagctgtaatgtgaaagggaatgtagtcgactggcaaaatgacttctgg 1020
aatatcccaaacctagctctgaaagctgaaagcaacctaagctgtggttcctacctgatc 1080
ccgctcccagcagcagaactggccagctgtgcagacctggggaccctctgtcaagctact 1140
gtaaactctcctagtactacaccacccactgtcaccactaacatgcctgttactaacaga 1200
atcgataaacaaaggaatgatggaattatctatagaatatccgtagtgattcagaacatc 1260
cttcgtcaccctgaggtaaaagtacagagcaaggtggcagaatggctcaattcaaccttc 1320
caaaattggaactacacggtttatgtcgttaatatcagttttcacctgagtgctggagag 1380
gacaagattaaagtcaagagaagccttgaggatgagccaaggttggtgctttgggccctt 1440
ctagtttacaatgctaccaacaatactaatttagaaggaaaaatcattcagcagaagctc 1500
ctaaaaaataatgagtccttggatgaaggcttgaggctacatacagtgaatgtgagacaa 1560
ctgggtcattgtcttgccatggaggaacccaaaggctactactggccatctatccaacct 1620
tctgaatacgttcttccttgtccagacaagcctggcttttctgcttctcggatatgtttt 1680
tacaatgctaccaacccattggtaacctactggggacctgttgatatctccaactgttta 1740
aaagaagcaaatgaagttgctaaccagattttaaatttaactgctgatgggcagaactta 1800
acctcagccaatattaccaacattgtggaacaggtcaaaagaattgtgaataaagaagaa 1860
aacattgatataacacttggctcaactctaatgaatatattttctaatatcttaagcagt 1920
tcagacagtgacttgcttgagtcatcttctgaagctttaaaaacaattgatgaattggcc 1980
ttcaagatagacctaaatagcacatcacatgtgaatattacaactcggaacttggctctc 2040
agcgtatcatccctgttaccagggacaaatgcaatttcaaattttagcattggtcttcca 2100
agcaataatgaatcgtatttccaggtaatgagccagtggtttctttcattttaa 2154
<210> 14
<211> 717
<212> PRT
<213> homo Sapiens
<400> 14
Met Phe Arg Ser Asp Arg Met Trp Ser Cys His Trp Lys Trp Lys Pro
1 5 10 15
Ser Pro Leu Leu Phe Leu Phe Ala Leu Tyr Ile Met Cys Val Pro His
20 25 30
Ser Val Trp Gly Cys Ala Asn Cys Arg Val Val Leu Ser Asn Pro Ser
35 40 45
Gly Thr Phe Thr Ser Pro Cys Tyr Pro Asn Asp Tyr Pro Asn Ser Gln
50 55 60
Ala Cys Met Trp Thr Leu Arg Ala Pro Thr Gly Tyr Ile Ile Gln Ile
65 70 75 80
Thr Phe Asn Asp Phe Asp Ile Glu Glu Ala Pro Asn Cys Ile Tyr Asp
85 90 95
Ser Leu Ser Leu Asp Asn Gly Glu Ser Gln Thr Lys Phe Cys Gly Ala
100 105 110
Thr Ala Lys Gly Leu Ser Phe Asn Ser Ser Ala Asn Glu Met His Val
115 120 125
Ser Phe Ser Ser Asp Phe Ser Ile Gln Lys Lys Gly Phe Asn Ala Ser
130 135 140
Tyr Ile Arg Val Ala Val Ser Leu Arg Asn Gln Lys Val Ile Leu Pro
145 150 155 160
Gln Thr Ser Asp Ala Tyr Gln Val Ser Val Ala Lys Ser Ile Ser Ile
165 170 175
Pro Glu Leu Ser Ala Phe Thr Leu Cys Phe Glu Ala Thr Lys Val Gly
180 185 190
His Glu Asp Ser Asp Trp Thr Ala Phe Ser Tyr Ser Asn Ala Ser Phe
195 200 205
Thr Gln Leu Leu Ser Phe Gly Lys Ala Lys Ser Gly Tyr Phe Leu Ser
210 215 220
Ile Ser Asp Ser Lys Cys Leu Leu Asn Asn Ala Leu Pro Val Lys Glu
225 230 235 240
Lys Glu Asp Ile Phe Ala Glu Ser Phe Glu Gln Leu Cys Leu Val Trp
245 250 255
22 / 87
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
Asn Asn Ser Leu Gly Ser Ile Gly Val Asn Phe Lys Arg Asn Tyr Glu
260 265 270
Thr Val Pro Cys Asp Ser Thr Ile Ser Lys Val Ile Pro Gly Asn Gly
275 280 285
Lys Leu Leu Leu Gly Ser Asn Gln Asn Glu Ile Val Ser Leu Lys Gly
290 295 300
Asp Ile Tyr Asn Phe Arg Leu Trp Asn Phe Thr Met Asn Ala Lys Ile
305 310 315 320
Leu Ser Asn Leu Ser Cys Asn Val Lys Gly Asn Val Val Asp Trp Gln
325 330 335
Asn Asp Phe Trp Asn Ile Pro Asn Leu Ala Leu Lys Ala Glu Ser Asn
340 345 350
Leu Ser Cys Gly Ser Tyr Leu Ile Pro Leu Pro Ala Ala Glu Leu Ala
355 360 365
Ser Cys Ala Asp Leu Gly Thr Leu Cys Gln Ala Thr Val Asn Ser Pro
370 375 380
Ser Thr Thr Pro Pro Thr Val Thr Thr Asn Met Pro Val Thr Asn Arg
385 390 395 400
Ile Asp Lys Gln Arg Asn Asp Gly Ile Ile Tyr Arg Ile Ser Val Val
405 410 415
Ile Gln Asn Ile Leu Arg His Pro Glu Val Lys Val Gln Ser Lys Val
420 425 430
Ala Glu Trp Leu Asn Ser Thr Phe Gln Asn Trp Asn Tyr Thr Val Tyr
435 440 445
Val Val Asn Ile Ser Phe His Leu Ser Ala Gly Glu Asp Lys Ile Lys
450 455 460
Val Lys Arg Ser Leu Glu Asp Glu Pro Arg Leu Val Leu Trp Ala Leu
465 470 475 480
Leu Val Tyr Asn Ala Thr Asn Asn Thr Asn Leu Glu Gly Lys Ile Ile
485 490 495
Gln Gln Lys Leu Leu Lys Asn Asn Glu Ser Leu Asp Glu.Gly Leu Arg
500 505 510
Leu His Thr Val Asn Val Arg Gln Leu Gly His Cys Leu Ala Met Glu
515 520 525
Glu Pro Lys Gly Tyr Tyr Trp Pro Ser Ile Gln Pro Ser Glu Tyr Val
530 535 540
Leu Pro Cys Pro Asp Lys Pro Gly Phe Ser Ala Ser Arg Ile Cys Phe
545 550 555 560
Tyr Asn Ala Thr Asn Pro Leu Val Thr Tyr Trp Gly Pro Val Asp Ile
565 ' 570 575
Ser Asn Cys Leu Lys Glu Ala Asn Glu Val Ala Asn Gln Ile Leu Asn
580 585 590
Leu Thr Ala Asp Gly Gln Asn Leu Thr Ser Ala Asn Ile Thr Asn Ile
595 600 605
Val Glu Gln Val Lys Arg Ile Val Asn Lys Glu Glu Asn Ile Asp Ile
610 615 620
Thr Leu Gly Ser Thr Leu Met Asn Ile Phe Ser Asn Ile Leu Ser Ser
625 630 635 640
Ser Asp Ser Asp Leu Leu Glu Ser Ser Ser Glu Ala Leu Lys Thr Ile
645 650 655
Asp Glu Leu Ala Phe Lys Ile Asp Leu Asn Ser Thr Ser His Val Asn
660 665 670
Ile Thr Thr Arg Asn Leu Ala Leu Ser Val Ser Ser Leu Leu Pro Gly
675 680 685
Thr Asn Ala Ile Ser Asn Phe Ser Ile Gly Leu Pro Ser Asn Asn Glu
690 695 700
Ser Tyr Phe Gln Val Met Ser Gln Trp Phe Leu Ser Phe
705 710 715
<210> 15
<211> 3336
<212> DNA
<213> homo Sapiens
23 / 87
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
<400>
15
atgtttcgctcagatcgaatgtggagctgccattggaaatggaagcccagtcctctcctg 60
ttcttatttgctttatatatcatgtgtgttcctcactcagtgtggggatgtgccaactgc 120
cgagtggttttgtccaacccttctgggacctttacttctccatgctaccctaacgactac 180
ccaaacagccaggcttgcatgtggacgctccgagcccccaccggttatatcattcagata 240
acatttaacgactttgacattgaagaagctcccaattgcatttatgactcattatccctt 300
gataatggagagagccagactaaattttgtggagcaactgccaaaggcctatcatttaac 360
tcaagtgcgaatgagatgcatgtgtccttttcaagtgactttagcatccagaagaaaggt 420
ttcaatgccagctacatcagagttgccgtgtccttaaggaatcaaaaggtcattttaccc 480
cagacatcagatgcttaccaggtatctgttgcaaaaagcatctctattccagagctcagt 540
gctttcacactctgctttgaagcaaccaaagttggccatgaagacagtgattggacagct 600
ttctcctactcaaatgcatccttcacacaattgctcagttttggaaaggccaagagtggc 660
tactttctatccatttctgattcaaaatgtttgttgaataatgcattacctgtcaaagaa 720
aaagaagacatttttgcagaaagctttgaacagctctgccttgtttggaataattctttg 780
ggctctattggtgtaaatttcaaaagaaactatgaaacagttccatgtgattctaccatt 840
agtaaagttattcctgggaatgggaaattgttgttgggctccaatcaaaatgaaattgtc 900
tctctaaaaggggacatttataactttcgactttggaattttaccatgaatgccaaaatc 960
ctctccaacctcagctgtaatgtgaaagggaatgtagtcgactggcaaaatgacttctgg 1020
aatatcccaaacctagctctgaaagctgaaagcaacctaagctgtggttcctacctgatc 1080
ccgctcccagcagcagaactggccagctgtgcagacctggggaccctctgtcaagctact 1140
gtaaactctcctagtactacaccacccactgtcaccactaacatgcctgttactaacaga 1200
atcgataaacaaaggaatgatggaattatctatagaatatccgtagtgattcagaacatc 1260
cttcgtcaccctgaggtaaaagtacagagcaaggtggcagaatggctcaattcaaccttc 1320
caaaattggaactacacggtttatgtcgttaatatcagttttcacctgagtgctggagag 1380
gacaagattaaagtcaagagaagccttgaggatgagccaaggttggtgctttgggccctt 1440
ctagtttacaatgctaccaacaatactaatttagaaggaaaaatcattcagcagaagctc 1500
ctaaaaaataatgagtccttggatgaaggcttgaggctacatacagtgaatgtgagacaa 1560
ctgggtcattgtcttgccatggaggaacccaaaggctactactggccatctatccaacct 1620
tctgaatacgttcttccttgtccagacaagcctggcttttctgcttctcggatatgtttt 1680
tacaatgctaccaacccattggtaacctactggggacctgttgatatctccaactgttta 1740
aaagaagcaaatgaagttgctaaccagattttaaatttaactgctgatgggcagaactta 1800
acctcagccaatattaccaacattgtggaacaggtcaaaagaattgtgaataaagaagaa 1860
aacattgatataacacttggctcaactctaatgaatatattttctaatatcttaagcagt 1920
tcagacagtgacttgcttgagtcatcttctgaagctttaaaaacaattgatgaattggcc 1980
ttcaagatagacctaaatagcacatcacatgtgaatattacaactcggaacttggctctc 2040
agcgtatcatccctgttaccagggacaaatgcaatttcaaattttagcattggtcttcca 2100
agcaataatgaatcgtatttccagatggattttgagagtggacaagtggatccactggca 2160
tctgtaattttgcctccaaacttacttgagaatttaagtccagaagattctgtattagtt 2220
agaagagcacagtttactttcttcaacaaaactggacttttccaggatgtaggaccccaa 2280
agaaaaactttagtgagttatgtgatggcgtgcagtattggaaacattactatccagaat 2340
ctgaaggatcctgttcaaataaaaatcaaacatacaagaactcaggaagtgcatcatccc 2400
atctgtgccttctgggatctgaacaaaaacaaaagttttggaggatggaacacgtcagga 2460
tgtgttgcacacagagattcagatgcaagtgagacagtctgcctgtgtaaccacttcaca 2520
cactttggagttctgatggaccttccaagaagtgcctcacagttagatgcaagaaacact 2580
aaagtcctcactttcatcagctatattgggtgtggaatatctgctattttttcagcagca 2640
actctcctgacatatgttgcttttgagaaattgcgaagggattatccctccaaaatcttg 2700
atgaacctgagcacagccctgctgttcctgaatctcctcttcctcctagatggctggatc 2760
acctccttcaatgtggatggactttgcattgctgttgcagtcctgttgcatttcttcctt 2820
ctggcaacctttacctggatggggctagaagcaattcacatgtacattgctctagttaaa 2880
gtatttaacacttacattcgccgatacattctaaaattctgcatcattggctggggtttg 2940
cctgccttagtggtgtcagttgttctagcgagcagaaacaacaatgaagtctatggaaaa 3000
gaaagttatgggaaagaaaaaggtgatgaattctgttggattcaagatccagtcatattt 3060
tatgtgacctgtgctgggtattttggagtcatgttttttctgaacattgccatgttcatt 3120
gtggtaatggtgcagatctgtgggaggaatggcaagagaagcaaccggaccctgagagaa 3180
gaagtgttaaggaacctgcgcagtgtggttagcttgacctttctgttgggcatgacatgg 3240
ggttttgcattctttgcctggggacccttaaatatccccttcatgtacctcttctccatc 3300
ttcaattcattacaaggtaagataaattgtacatga 3336
<210> 16
<211> 1111
<212> PRT
<213> homo Sapiens
24 / 87
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
<400> 16
Met Phe Arg Ser Asp Arg Met Trp Ser Cys His Trp Lys Trp Lys Pro
1 5 10 15
Ser Pro Leu Leu Phe Leu Phe Ala Leu Tyr Ile Met Cys Val Pro His
20 25 30
Ser Val Trp Gly Cys Ala Asn Cys Arg Val Val Leu Ser Asn Pro Ser
35 40 45
Gly Thr Phe Thr Ser Pro Cys Tyr Pro Asn Asp Tyr Pro Asn Ser Gln
50 55 60
Ala Cys Met Trp Thr Leu Arg Ala Pro Thr Gly Tyr Ile Ile Gln Ile
65 70 75 80
Thr Phe Asn Asp Phe Asp Ile Glu Glu Ala Pro Asn Cys Ile Tyr Asp
85 90 95
Ser Leu Ser Leu Asp Asn Gly Glu Ser Gln Thr Lys Phe Cys Gly Ala
100 105 110
Thr Ala Lys Gly Leu Ser Phe Asn Ser Ser Ala Asn Glu Met His Val
115 120 125
Ser Phe Ser Ser Asp Phe Ser Ile Gln Lys Lys Gly Phe Asn Ala Ser
130 135 140
Tyr Ile Arg Val Ala Val Ser Leu Arg Asn Gln Lys Val Ile Leu Pro
145 150 155 160
Gln Thr Ser Asp Ala Tyr Gln Val Ser Val Ala Lys Ser Ile Ser Ile
165 170 175
Pro Glu Leu Ser Ala Phe Thr Leu Cys Phe Glu Ala Thr Lys Val Gly
180 185 190
His Glu Asp Ser Asp Trp Thr Ala Phe Ser Tyr Ser Asn Ala Ser Phe
195 200 205
Thr Gln Leu Leu Ser Phe Gly Lys Ala Lys Ser Gly Tyr Phe Leu Ser
210 215 220
Ile Ser Asp Ser Lys Cys Leu Leu Asn Asn Ala Leu Pro Val Lys Glu
225 230 235 240
Lys Glu Asp Ile Phe Ala Glu Ser Phe Glu Gln Leu Cys Leu Val Trp
245 250 255
Asn Asn Ser Leu Gly Ser Ile Gly Val Asn Phe Lys Arg Asn Tyr Glu
260 265 270
Thr Val Pro Cys Asp Ser Thr Ile Ser Lys Val Ile Pro Gly Asn Gly
275 280 285
Lys Leu Leu Leu Gly Ser Asn Gln Asn Glu Ile Val Ser Leu Lys Gly
290 295 300
Asp Ile Tyr Asn Phe Arg Leu Trp Asn Phe Thr Met Asn Ala Lys Ile
305 310 315 320
Leu Ser Asn Leu Ser Cys Asn Val Lys Gly Asn Val Val Asp Trp Gln
325 330 335
Asn Asp Phe Trp Asn Ile Pro Asn Leu Ala Leu Lys Ala Glu Ser Asn
340 345 350
Leu Ser Cys Gly Ser Tyr Leu Ile Pro Leu Pro Ala Ala Glu Leu Ala
355 360 365
Ser Cys Ala Asp Leu Gly Thr Leu Cys Gln Ala Thr Val Asn Ser Pro
370 375 380
Ser Thr Thr Pro Pro Thr Val Thr Thr Asn Met Pro Val Thr Asn Arg
385 390 395 400
Ile Asp Lys Gln Arg Asn Asp Gly Ile Ile Tyr Arg Ile Ser Val Val
405 410 415
Ile Gln Asn Ile Leu Arg His Pro Glu Val Lys Val Gln Ser Lys Val
420 425 430
Ala Glu Trp Leu Asn Ser Thr Phe Gln Asn Trp Asn Tyr Thr Val Tyr
435 440 445
Val Val Asn Ile Ser Phe His Leu Ser Ala Gly Glu Asp Lys Ile Lys
450 455 460
Val Lys Arg Ser Leu Glu Asp Glu Pro Arg Leu Val Leu Trp Ala Leu
465 470 475 480
Leu Val Tyr Asn Ala Thr Asn Asn Thr Asn Leu Glu Gly Lys Ile Ile
485 490 495
25 / 87
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
Gln Gln Lys Leu Leu Lys Asn Asn Glu Ser Leu Asp Glu Gly Leu Arg
500 505 510
Leu His Thr Val Asn Val Arg Gln Leu Gly His Cys Leu Ala Met Glu
515 520 525
Glu Pro Lys Gly Tyr Tyr Trp Pro Ser Ile Gln Pro Ser Glu Tyr Val
530 535 540
Leu Pro Cys Pro Asp Lys Pro Gly Phe Ser Ala Ser Arg Ile Cys Phe
545 550 555 560
Tyr Asn Ala Thr Asn Pro Leu Val Thr Tyr Trp Gly Pro Val Asp Ile
565 570 575
Ser Asn Cys Leu Lys Glu Ala Asn Glu Val Ala Asn Gln Ile Leu Asn
580 585 590
Leu Thr Ala Asp Gly Gln Asn Leu Thr Ser Ala Asn Ile Thr Asn Ile
595 600 605
Val Glu Gln Val Lys Arg Ile Val Asn Lys Glu Glu Asn Ile Asp Ile
610 615 620
Thr Leu Gly Ser Thr Leu Met Asn Ile Phe Ser Asn Ile Leu Ser Ser
625 630 635 640
Ser Asp Ser Asp Leu Leu Glu Ser Ser Ser Glu Ala Leu Lys Thr Ile
645 650 655
Asp Glu Leu Ala Phe Lys Ile Asp Leu Asn Ser Thr Ser His Val Asn
660 665 670
Ile Thr Thr Arg Asn Leu Ala Leu Ser Val Ser Ser Leu Leu Pro Gly
675 680 685
Thr Asn Ala Ile Ser Asn Phe Ser Ile Gly Leu Pro Ser Asn Asn Glu
690 695 700
Ser Tyr Phe Gln Met Asp Phe Glu Ser Gly Gln Val Asp Pro Leu Ala
705 710 715 720
Ser Val Ile Leu Pro Pro Asn Leu Leu Glu Asn Leu Ser Pro Glu Asp
725 730 735
Ser Val Leu Val Arg Arg Ala Gln Phe Thr Phe Phe Asn Lys Thr Gly
740 745 750
Leu Phe Gln Asp Val Gly Pro Gln Arg Lys Thr Leu Val Ser Tyr Val
755 760 765
Met Ala Cys Ser Ile Gly Asn Ile Thr Ile Gln Asn Leu Lys Asp Pro
770 775 780
Val Gln Ile Lys Ile Lys His Thr Arg Thr Gln Glu Val His His Pro
785 790 795 800
Ile Cys Ala Phe Trp Asp Leu Asn Lys Asn Lys Ser Phe Gly Gly Trp
805 810 815
Asn Thr Ser Gly Cys Val Ala His Arg Asp Ser Asp Ala Ser Glu Thr
820 825 830
Val Cys Leu Cys Asn His Phe Thr His Phe Gly Val Leu Met Asp Leu
835 840 845
Pro Arg Ser Ala Ser Gln Leu Asp Ala Arg Asn Thr Lys Val Leu Thr
850 855 860
Phe Ile Ser Tyr Ile Gly Cys Gly Ile Ser Ala Ile Phe Ser Ala Ala
865 870 875 880
Thr Leu Leu Thr Tyr Val Ala Phe Glu Lys Leu Arg Arg Asp Tyr Pro
885 890 895
Ser Lys Ile Leu Met Asn Leu Ser Thr Ala Leu Leu Phe Leu Asn Leu
900 905 910
Leu Phe Leu Leu Asp Gly Trp Ile Thr Ser Phe Asn Val Asp Gly Leu
915 920 925
Cys Ile Ala Val Ala Val Leu Leu His Phe Phe Leu Leu Ala Thr Phe
930 935 940
Thr Trp Met Gly Leu Glu Ala Ile His Met Tyr Ile Ala Leu Val Lys
945 950 955 960
Val Phe Asn Thr Tyr Ile Arg Arg Tyr Ile Leu Lys Phe Cys Ile Ile
965 970 975
Gly Trp Gly Leu Pro Ala Leu Val Val Ser Val Val Leu Ala Ser Arg
980 985 990
Asn Asn Asn Glu Val Tyr Gly Lys Glu Ser Tyr Gly Lys Glu Lys Gly
26 / 87
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
995 1000 1005
Asp Glu Phe Cys Trp Ile Gln Asp Pro Val Ile Phe Tyr Val Thr Cys
1010 1015 1020
Ala Gly Tyr Phe Gly Val Met Phe Phe Leu Asn Ile Ala Met Phe Ile
1025 1030 1035 1040
Val Val Met Val Gln Ile Cys Gly Arg Asn Gly Lys Arg Ser Asn Arg
1045 1050 1055
Thr Leu Arg Glu Glu Val Leu Arg Asn Leu Arg Ser Val Val Ser Leu
1060 1065 1070
Thr Phe Leu Leu Gly Met Thr Trp Gly Phe Ala Phe Phe Ala Trp Gly
1075 1080 1085
Pro Leu Asn Ile Pro Phe Met Tyr Leu Phe Ser Ile Phe Asn Ser Leu
1090 1095 1100
Gln Gly Lys Ile Asn Cys Thr
1105 1110
<210> 17
<211> 3753
<212> DNA
<213> homo sapiens
<400>
17
atgatgtttcgctcagatcgaatgtggagctgccattggaaatggaagcccagtcctctc 60
ctgttcttatttgctttatatatcatgtgtgttcctcactcagtgtggggatgtgccaac 120
tgccgagtggttttgtccaacccttctgggacctttacttctccatgctaccctaacgac 180
tacccaaacagccaggcttgcatgtggacgctccgagcccccaccggttatatcattcag 240
ataacatttaacgactttgacattgaagaagctcccaattgcatttatgactcattatcc 300
cttgataatggagagagccagactaaattttgtggagcaactgccaaaggcctatcattt 360
aactcaagtgcgaatgagatgcatgtgtccttttcaagtgactttagcatccagaagaaa 420
ggtttcaatgccagctacatcagagttgccgtgtccttaaggaatcaaaaggtcatttta 480
ccccagacatcagatgcttaccaggtatctgttgcaaaaagcatctctattccagagctc,540
agtgctttcacactctgctttgaagcaaccaaagttggccatgaagacagtgattggaca 600
gctttctcctactcaaatgcatccttcacacaattgctcagttttggaaaggccaagagt 660
ggctactttctatccatttctgattcaaaatgtttgttgaataatgcattacctgtcaaa 720
gaaaaagaagacatttttgcagaaagctttgaacagctctgccttgtttggaataattct 780
ttgggctctattggtgtaaatttcaaaagaaactatgaaacagttccatgtgattctacc 840
attagtaaagttattcctgggaatgggaaattgttgttgggctccaatcaaaatgaaatt 900
gtctctctaaaaggggacatttataactttcgactttggaattttaccatgaatgccaaa 960
atcctctccaacctcagctgtaatgtgaaagggaatgtagtcgactggcaaaatgacttc 1020
tggaatatcccaaacctagctctgaaagctgaaagcaacctaagctgtggttcctacctg 1080
atcccgctcccagcagcagaactggccagctgtgcagacctggggaccctctgtcaagct 1140
actgtaaactctcctagtactacaccacccactgtcaccactaacatgcctgttactaac 1200
agaatcgataaacaaaggaatgatggaattatctatagaatatccgtagtgattcagaac 1260
atccttcgtcaccctgaggtaaaagtacagagcaaggtggcagaatggctcaattcaacc 1320
ttccaaaattggaactacacggtttatgtcgttaatatcagttttcacctgagtgctgga 1380
gaggacaagattaaagtcaagagaagccttgaggatgagccaaggttggtgctttgggcc 1440
cttctagtttacaatgctaccaacaatactaatttagaaggaaaaatcattcagcagaag 1500
ctcctaaaaaataatgagtccttggatgaaggcttgaggctacatacagtgaatgtgaga 1560
caactgggtcattgtcttgccatggaggaacccaaaggctactactggccatctatccaa 1620
ccttctgaatacgttcttccttgtccagacaagcctggcttttctgcttctcggatatgt 1680
ttttacaatgctaccaacccattggtaacctactggggacctgttgatatctccaactgt 1740
ttaaaagaagcaaatgaagttgctaaccagattttaaatttaactgctgatgggcagaac 1800
ttaacctcagccaatattaccaacattgtggaacaggtcaaaagaattgtgaataaagaa 1860
gaaaacattgatataacacttggctcaactctaatgaatatattttctaatatcttaagc 1920
agttcagacagtgacttgcttgagtcatcttctgaagctttaaaaacaattgatgaattg 1980
gccttcaagatagacctaaatagcacatcacatgtgaatattacaactcggaacttggct 2040
ctcagcgtatcatccctgttaccagggacaaatgcaatttcaaattttagcattggtctt 2100
ccaagcaataatgaatcgtatttccagatggattttgagagtggacaagtggatccactg 2160
gcatctgtaattttgcctccaaacttacttgagaatttaagtccagaagattctgtatta 2220
gttagaagagcacagtttactttcttcaacaaaactggacttttccaggatgtaggaccc 2280
caaagaaaaactttagtgagttatgtgatggcgtgcagtattggaaacattactatccag 2340
aatctgaaggatcctgttcaaataaaaatcaaacatacaagaactcaggaagtgcatcat 2400
cccatctgtgccttctgggatctgaacaaaaacaaaagttttggaggatggaacacgtca 2460
27 / 87
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
ggatgtgttgcacacagagattcagatgcaagtgagacagtctgcctgtgtaaccacttc 2520
acacactttggagttctgatggaccttccaagaagtgcctcacagttagatgcaagaaac 2580
actaaagtcctcactttcatcagctatattgggtgtggaatatctgctattttttcagca 2640
gcaactctcctgacatatgttgcttttgagaaattgcgaagggattatccctccaaaatc 2700
ttgatgaacctgagcacagccctgctgttcctgaatctcctcttcctcctagatggctgg 2760
atcacctccttcaatgtggatggactttgcattgctgttgcagtcctgttgcatttcttc 2820
cttctggcaacctttacctggatggggctagaagcaattcacatgtacattgctctagtt 2880
aaagtatttaacacttacattcgccgatacattctaaaattctgcatcattggctggggt 2940
ttgcctgccttagtggtgtcagttgttctagcgagcagaaacaacaatgaagtctatgga 3000
aaagaaagttatgggaaagaaaaaggtgatgaattctgttggattcaagatccagtcata 3060
ttttatgtgacctgtgctgggtattttggagtcatgttttttctgaacattgccatgttc 3120
attgtggtaatggtgcagatctgtgggaggaatggcaagagaagcaaccggaccctgaga 3180
gaagaagtgttaaggaacctgcgcagtgtggttagcttgacctttctgttgggcatgaca 3240
tggggttttgcattctttgcctggggacccttaaatatccccttcatgtacctcttctcc 3300
atcttcaattcattacaaggcttatttatattcatcttccactgtgctatgaaggagaat 3360
gttcagaaacagtggcggcggcatctctgctgtggtagatttcggttagcagataactca 3420
gattggagtaagacagctaccaatatcatcaagaaaagttctgataatctaggaaaatct 3480
ttgtcttcaagctccattggttccaactcaacctatcttacatccaaatctaaatccagc 3540
tctaccacctatttcaaaaggaatagccacacagacagtgcttccatggacaagtccttg 3600
tcaaaactggcccatgctgatggagatcaaacatcaatcatccctgtccatcaggtcatt 3660
gataaggtcaagggttattgcaatgctcattcagacaacttctataaaaatattatcatg 3720
tcagacaccttcagccacagcacaaagttttaa 3753
<210> 18
<211> 1250
<212> PRT
<213> homo sapiens
<400> 18
Met Met Phe Arg Ser Asp Arg Met Trp Ser Cys His Trp Lys Trp Lys
1 5 10 15
Pro Ser Pro Leu Leu Phe Leu Phe Ala Leu Tyr Ile Met Cys Val Pro
20 25 30
His Ser Val Trp Gly Cys Ala Asn Cys Arg Val Val Leu Ser Asn Pro
35 40 45
Ser Gly Thr Phe Thr Ser Pro Cys Tyr Pro Asn Asp Tyr Pro Asn Ser
50 55 60
Gln Ala Cys Met Trp Thr Leu Arg Ala Pro Thr Gly Tyr Ile Ile Gln
65 70 75 80
Ile Thr Phe Asn Asp Phe Asp Ile Glu Glu Ala Pro Asn Cys Ile Tyr
85 90 95
Asp Ser Leu Ser Leu Asp Asn Gly Glu Ser Gln Thr Lys Phe Cys Gly
100 105 110
Ala Thr Ala Lys Gly Leu Ser Phe Asn Ser Ser Ala Asn Glu Met His
115 120 125
Val Ser Phe Ser Ser Asp Phe Ser Ile Gln Lys Lys Gly Phe Asn Ala
130 135 140
Ser Tyr Ile Arg Val Ala Val Ser Leu Arg Asn Gln Lys Val Ile Leu
145 150 155 160
Pro Gln Thr Ser Asp Ala Tyr Gln Val Ser Val Ala Lys Ser Ile Ser
165 170 175
Ile Pro Glu Leu Ser Ala Phe Thr Leu Cys Phe Glu Ala Thr Lys Val
180 185 190
Gly His Glu Asp Ser Asp Trp Thr Ala Phe Ser Tyr Ser Asn Ala Ser
195 200 205
Phe Thr Gln Leu Leu Ser Phe Gly Lys Ala Lys Ser Gly Tyr Phe Leu
210 215 220
Ser Ile Ser Asp Ser Lys Cys Leu Leu Asn Asn Ala Leu Pro Val Lys
225 230 235 240
Glu Lys Glu Asp Ile Phe Ala Glu Ser Phe Glu Gln Leu Cys Leu Val
245 250 255
Trp Asn Asn Ser Leu Gly Ser Ile Gly Val Asn Phe Lys Arg Asn Tyr
260 265 270
28 / 87
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
Glu Thr Val Pro Cys Asp Ser Thr Ile Ser Lys Val Ile Pro Gly Asn
275 280 285
Gly Lys Leu Leu Leu Gly Ser Asn Gln Asn Glu Ile Val Ser Leu Lys
290 295 300
Gly Asp Ile Tyr Asn Phe Arg Leu Trp Asn Phe Thr Met Asn Ala Lys
305 310 315 320
Ile Leu Ser Asn Leu Ser Cys Asn Val Lys Gly Asn Val Val Asp Trp
325 330 335
Gln Asn Asp Phe Trp Asn Ile Pro Asn Leu Ala Leu Lys Ala Glu Ser
340 345 350
Asn Leu Ser Cys Gly Ser Tyr Leu Ile Pro Leu Pro Ala Ala Glu Leu
355 360 365
Ala Ser Cys Ala Asp Leu Gly Thr Leu Cys Gln Ala Thr Val Asn Ser
370 375 380
Pro Ser Thr Thr Pro Pro Thr Val Thr Thr Asn Met Pro Val Thr Asn
385 390 395 400
Arg Ile Asp Lys Gln Arg Asn Asp Gly Ile Ile Tyr Arg Ile Ser Val
405 410 415
Val Ile Gln Asn Ile Leu Arg His Pro Glu Val Lys Val Gln Ser Lys
420 425 430
Val Ala Glu Trp Leu Asn Ser Thr Phe Gln Asn Trp Asn Tyr Thr Val
435 440 445
Tyr Val Val Asn Ile Ser Phe His Leu Ser Ala Gly Glu Asp Lys Ile
450 455 460
Lys Val Lys Arg Ser Leu Glu Asp Glu Pro Arg Leu Val Leu Trp Ala
465 470 475 480
Leu Leu Val Tyr Asn Ala Thr Asn Asn Thr Asn Leu Glu Gly Lys Ile
485 490 495
Ile Gln Gln Lys Leu Leu Lys Asn Asn Glu Ser Leu Asp Glu Gly Leu
500 505 510
Arg Leu His Thr Val Asn Val Arg Gln Leu Gly His Cys Leu Ala Met
515 520 525
Glu Glu Pro Lys Gly Tyr Tyr Trp Pro Ser Ile Gln Pro Ser Glu Tyr
530 535 540
Val Leu Pro Cys Pro Asp Lys Pro Gly Phe Ser Ala Ser Arg Ile Cys
545 550 555 560
Phe Tyr Asn Ala Thr Asn Pro Leu Val Thr Tyr Trp Gly Pro Val Asp
565 570 575
Ile Ser Asn Cys Leu Lys Glu Ala Asn Glu Val Ala Asn Gln Ile Leu
580 585 590
Asn Leu Thr Ala Asp Gly Gln Asn Leu Thr Ser Ala Asn Ile Thr Asn
595 600 605
Ile Val Glu Gln Val Lys Arg Ile Val Asn Lys Glu Glu Asn Ile Asp
610 615 620
Ile Thr Leu Gly Ser Thr Leu Met Asn Ile Phe Ser Asn Ile Leu Ser
625 630 635 640
Ser Ser Asp Ser Asp Leu Leu Glu Ser Ser Ser Glu Ala Leu Lys Thr
645 650 655
Ile Asp Glu Leu Ala Phe Lys Ile Asp Leu Asn Ser Thr Ser His Val
660 665 670
Asn Ile Thr Thr Arg Asn Leu Ala Leu Ser Val Ser Ser Leu Leu Pro
675 680 685
Gly Thr Asn Ala Ile Ser Asn Phe Ser Ile Gly Leu Pro Ser Asn Asn
690 695 700
Glu Ser Tyr Phe Gln Met Asp Phe Glu Ser Gly Gln Val Asp Pro Leu
705 710 715 720
Ala Ser Val Ile Leu Pro Pro Asn Leu Leu Glu Asn Leu Ser Pro Glu
725 730 735
Asp Ser Val Leu Val Arg Arg Ala Gln Phe Thr Phe Phe Asn Lys Thr
740 745 750
Gly Leu Phe Gln Asp Val Gly Pro Gln Arg Lys Thr Leu Val Ser Tyr
755 760 765
Val Met Ala Cys Ser Ile Gly Asn Ile Thr Ile Gln Asn Leu Lys Asp
29 / 87
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
770 775 780
Pro Val Gln Ile Lys Ile Lys His Thr Arg Thr Gln Glu Val His His
785 790 795 800
Pro Ile Cys Ala Phe Trp Asp Leu Asn Lys Asn Lys Ser Phe Gly Gly
805 810 815
Trp Asn Thr Ser Gly Cys Val Ala His Arg Asp Ser Asp Ala Ser Glu
820 825 830
Thr Val Cys Leu Cys Asn His Phe Thr His Phe Gly Val Leu Met Asp
835 840 845
Leu Pro Arg Ser Ala Ser Gln Leu Asp Ala Arg Asn Thr Lys Val Leu
850 855 860
Thr Phe Ile Ser Tyr Ile Gly Cys Gly Ile Ser Ala Ile Phe Ser Ala
865 870 875 880
Ala Thr Leu Leu Thr Tyr Val Ala Phe Glu Lys Leu Arg Arg Asp Tyr
885 890 895
Pro Ser Lys Ile Leu Met Asn Leu Ser Thr Ala Leu Leu Phe Leu Asn
900 905 910
Leu Leu Phe Leu Leu Asp Gly Trp Ile Thr Ser Phe Asn Val Asp Gly
915 920 925
Leu Cys Ile Ala Val Ala Val Leu Leu His Phe Phe Leu Leu Ala Thr
930 935 940
Phe Thr Trp Met Gly Leu Glu Ala Ile His Met Tyr Ile Ala Leu Val
945 950 955 960
Lys Val Phe Asn Thr Tyr Ile Arg Arg Tyr Ile Leu Lys Phe Cys Ile
965 970 975
Ile Gly Trp Gly Leu Pro Ala Leu Val Val Ser Val Val Leu Ala Ser
980 985 990
Arg Asn Asn Asn Glu Val Tyr Gly Lys Glu Ser Tyr Gly Lys Glu Lys
995 1000 1005
Gly Asp Glu Phe Cys Trp Ile Gln Asp Pro Val Ile Phe Tyr Val Thr
1010 1015 1020
Cys Ala Gly Tyr Phe Gly Val Met Phe Phe Leu Asn Ile Ala Met Phe
1025 1030 1035 1040
Ile Val Val Met Val Gln Ile Cys Gly Arg Asn Gly Lys Arg Ser Asn
1045 1050 1055
Arg Thr Leu Arg Glu Glu Val Leu Arg Asn Leu Arg Ser Val Val Ser
1060 1065 1070
Leu Thr Phe Leu Leu Gly Met Thr Trp Gly Phe Ala Phe Phe Ala Trp
1075 1080 1085
Gly Pro Leu Asn Ile Pro Phe Met Tyr Leu Phe Ser Ile Phe Asn Ser
1090 1095 1100
Leu Gln Gly Leu Phe Ile Phe Ile Phe His Cys Ala Met Lys Glu Asn
1105 1110 1115 1120
Val Gln Lys Gln Trp Arg Arg His Leu Cys Cys Gly Arg Phe Arg Leu
1125 1130 1135
Ala Asp Asn Ser Asp Trp Ser Lys Thr Ala Thr Asn Ile Ile Lys Lys
1140 1145 1150
Ser Ser Asp Asn Leu Gly Lys Ser Leu Ser Ser Ser Ser Ile Gly Ser
1155 1160 1165
Asn Ser Thr Tyr Leu Thr Ser Lys Ser Lys Ser Ser Ser Thr Thr Tyr
1170 1175 1180
Phe Lys Arg Asn Ser His Thr Asp Ser Ala Ser Met Asp Lys Ser Leu
1185 1190 1195 1200
Ser Lys Leu Ala His Ala Asp Gly Asp Gln Thr Ser Ile Ile Pro Val
1205 1210 1215
His Gln Val Ile Asp Lys Val Lys Gly Tyr Cys Asn Ala His Ser Asp
1220 1225 1230
Asn Phe Tyr Lys Asn Ile Ile Met Ser Asp Thr Phe Ser His Ser Thr
1235 1240 1245
Lys Phe
1250
<210> 19
30 / 87
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
<211> 3666
<212> DNA
<213> homo sapiens
<400>
19
atgatgtttcgctcagatcgaatgtggagctgccattggaaatggaagcccagtcctctc 60
ctgttcttatttgctttatatatcatgtgtgttcctcactcagtgtggggatgtgccaac 120
tgccgagtggttttgtccaacccttctgggacctttacttctccatgctaccctaacgac 180
tacccaaacagccaggcttgcatgtggacgctccgagcccccaccggttatatcattcag 240
ataacatttaacgactttgacattgaagaagctcccaattgcatttatgactcattatcc 300
cttgataatggagagagccagactaaattttgtggagcaactgccaaaggcctatcattt 360
aactcaagtgcgaatgagatgcatgtgtccttttcaagtgactttagcatccagaagaaa 420
ggtttcaatgccagctacatcagagttgccgtgtccttaaggaatcaaaaggtcatttta 480
ccccagacatcagatgcttaccaggtatctgttgcaaaaagcatctctattccagagctc 540
agtgctttcacactctgctttgaagcaaccaaagttggccatgaagacagtgattggaca 600
gctttctcctactcaaatgcatccttcacacaattgctcagttttggaaaggccaagagt 660
ggctactttctatccatttctgattcaaaatgtttgttgaataatgcattacctgtcaaa 720
gaaaaagaagacatttttgcagaaagctttgaacagctctgccttgtttggaataattct 780
ttgggctctattggtgtaaatttcaaaagaaactatgaaacagttccatgtgattctacc 840
attagtaaagttattcctgggaatgggaaattgttgttgggctccaatcaaaatgaaatt 900
gtctctctaaaaggggacatttataactttcgactttggaattttaccatgaatgccaaa 960
atcctctccaacctcagctgtaatgtgaaagggaatgtagtcgactggcaaaatgacttc 1020
tggaatatcccaaacctagctctgaaagctgaaagcaacctaagctgtggttcctacctg 1080
atcccgctcccagcagcagaactggccagctgtgcagacctggggaccctctgtcaagct 1140
actgtaaactctcctagtactacaccacccactgtcaccactaacatgcctgttactaac 1200
agaatcgataaacaaaggaatgatggaattatctatagaatatccgtagtgattcagaac 1260
atccttcgtcaccctgaggtaaaagtacagagcaaggtggcagaatggctcaattcaacc 1320
ttccaaaattggaactacacggtttatgtcgttaatatcagttttcacctgagtgctgga 1380
gaggacaagattaaagtcaagagaagccttgaggatgagccaaggttggtgctttgggcc 1440
cttctagtttacaatgctaccaacaatactaatttagaaggaaaaatcattcagcagaag 1500
ctcctaaaaaataatgagtccttggatgaaggcttgaggctacatacagtgaatgtgaga 1560
caactgggtcattgtcttgccatggaggaacccaaaggctactactggccatctatccaa 1620
ccttctgaatacgttcttccttgtccagacaagcctggcttttctgcttctcggatatgt 1680
ttttacaatgctaccaacccattggtaacctactggggacctgttgatatctccaactgt 1740
ttaaaagaagcaaatgaagttgctaaccagattttaaatttaactgctgatgggcagaac 1800
ttaacctcagccaatattaccaacattgtggaacaggtcaaaagaattgtgaataaagaa 1860
gaaaacattgatataacacttggctcaactctaatgaatatattttctaatatcttaagc 1920
agttcagacagtgacttgcttgagtcatcttctgaagctttaaaaacaattgatgaattg 1980
gccttcaagatagacctaaatagcacatcacatgtgaatattacaactcggaacttggct 2040
ctcagcgtatcatccctgttaccagggacaaatgcaatttcaaattttagcattggtctt 2100
ccaagcaataatgaatcgtatttccagatggattttgagagtggacaagtggatccactg 2160
gcatctgtaattttgcctccaaacttacttgagaatttaagtccagaagattctgtatta 2220
gttagaagagcacagtttactttcttcaacaaaactggacttttccaggatgtaggaccc 2280
caaagaaaaactttagtgagttatgtgatggcgtgcagtattggaaacattactatccag 2340
aatctgaaggatcctgttcaaataaaaatcaaacatacaagaactcaggaagtgcatcat 2400
cccatctgtgccttctgggatctgaacaaaaacaaaagttttggaggatggaacacgtca 2460
ggatgtgttgcacacagagattcagatgcaagtgagacagtctgcctgtgtaaccacttc 2520
acacactttggagttctgatggaccttccaagaagtgcctcacagttagatgcaagaaac 2580
actaaagtcctcactttcatcagctatattgggtgtggaatatctgctattttttcagca 2640
gcaactctcctgacatatgttgcttttgagaaattgcgaagggattatccctccaaaatc 2700
ttgatgaacctgagcacagccctgctgttcctgaatctcctcttcctcctagatggctgg 2760
atcacctccttcaatgtggatggactttgcattgctgttgcagtcctgttgcatttcttc 2820
cttctggcaacctttacctggatggggctagaagcaattcacatgtacattgctctagtt 2880
aaagtatttaacacttacattcgccgatacattctaaaattctgcatcattggctggggt 2940
ttgcctgccttagtggtgtcagttgttctagcgagcagaaacaacaatgaagtctatgga 3000
aaagaaagttatgggaaagaaaaaggtgatgaattctgttggattcaagatccagtcata 3060
ttttatgtgacctgtgctgggtattttggagtcatgttttttctgaacattgccatgttc 3120
attgtggtaatggtgcagatctgtgggaggaatggcaagagaagcaaccggaccctgaga 3180
gaagaagtgttaaggaacctgcgcagtgtggttagcttgacctttctgttgggcatgaca 3240
tggggttttgcattctttgcctggggacccttaaatatccccttcatgtacctcttctcc 3300
atcttcaattcattacaaggcttatttatattcatcttccactgtgctatgaaggagaat 3360
gttcagaaacagtggcggcggcatctctgctgtggtagatttcggttagcagataactca 3420
gattggagtaagacagctaccaatatcatcaagaaaagttctgataatctaggaaaatct 3480
31 / 87
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
ttgtcttcaa gctccattgg ttccaactca acctatctta catccaaatc taaatccagc 3540
tctaccacct atttcaaaag gaatagccac acagataatg tctcctatga gcattccttc 3600
aacaaaagtg gatcactcag acagtgcttc catggacaag tccttgtcaa aactggccca 3660
tgctga 3666
<210> 20
<211> 1221
<212> PRT
<213> homo sapiens
<400> 20
Met Met Phe Arg Ser Asp Arg Met Trp Ser Cys His Trp Lys Trp Lys
1 5 10 15
Pro Ser Pro Leu Leu Phe Leu Phe Ala Leu Tyr Ile Met Cys Val Pro
20 25 30
His Ser Val Trp Gly Cys Ala Asn Cys Arg Val Val Leu Ser Asn Pro
35 40 45
Ser Gly Thr Phe Thr Ser Pro Cys Tyr Pro Asn Asp Tyr Pro Asn Ser
50 55 60
Gln Ala Cys Met Trp Thr Leu Arg Ala Pro Thr Gly Tyr Ile Ile Gln
65 70 75 80
Ile Thr Phe Asn Asp Phe Asp Ile Glu Glu Ala Pro Asn Cys Ile Tyr
85 90 95
Asp Ser Leu Ser Leu Asp Asn Gly Glu Ser Gln Thr Lys Phe Cys Gly
100 105 110
Ala Thr Ala Lys Gly Leu Ser Phe Asn Ser Ser Ala Asn Glu Met His
115 120 125
Val Ser Phe Ser Ser Asp Phe Ser Ile Gln Lys Lys Gly Phe Asn Ala
130 135 140
Ser Tyr Ile Arg Val Ala Val Ser Leu Arg Asn Gln Lys Val Ile Leu
145 150 155 160
Pro Gln Thr Ser Asp Ala Tyr Gln Val Ser Val Ala Lys Ser Ile Ser
165 170 175
Ile Pro Glu Leu Ser Ala Phe Thr Leu Cys Phe Glu Ala Thr Lys Val
180 185 190
Gly His Glu Asp Ser Asp Trp Thr Ala Phe Ser Tyr Ser Asn Ala Ser
195 200 205
Phe Thr Gln Leu Leu Ser Phe Gly Lys Ala Lys Ser Gly Tyr Phe Leu
210 215 220
Ser Ile Ser Asp Ser Lys Cys Leu Leu Asn Asn Ala Leu Pro Val Lys
225 230 235 240
Glu Lys Glu Asp Ile Phe Ala Glu Ser Phe Glu Gln Leu Cys Leu Val
245 250 255
Trp Asn Asn Ser Leu Gly Ser Ile Gly Val Asn Phe Lys Arg Asn Tyr
260 265 270
Glu Thr Val Pro Cys Asp Ser Thr Ile Ser Lys Val Ile Pro Gly Asn
275 280 285
Gly Lys Leu Leu Leu Gly Ser Asn Gln Asn Glu Ile Val Ser Leu Lys
290 295 300
Gly Asp Ile Tyr Asn Phe Arg Leu Trp Asn Phe Thr Met Asn Ala Lys
305 310 315 320
Ile Leu Ser Asn Leu Ser Cys Asn Val Lys Gly Asn Val Val Asp Trp
325 330 335
Gln Asn Asp Phe Trp Asn Ile Pro Asn Leu Ala Leu Lys Ala Glu Ser
340 345 350
Asn Leu Ser Cys Gly Ser Tyr Leu Ile Pro Leu Pro Ala Ala Glu Leu
355 360 365
Ala Ser Cys Ala Asp Leu Gly Thr Leu Cys Gln Ala Thr Val Asn Ser
370 375 380
Pro Ser Thr Thr Pro Pro Thr Val Thr Thr Asn Met Pro Val Thr Asn
385 390 395 400
Arg Ile Asp Lys Gln Arg Asn Asp Gly Ile Ile Tyr Arg Ile Ser Val
405 410 415
32 / 87
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
Val Ile Gln Asn Ile Leu Arg His Pro Glu Val Lys Val Gln Ser Lys
420 425 430
Val Ala Glu Trp Leu Asn Ser Thr Phe Gln Asn Trp Asn Tyr Thr Val
435 440 445
Tyr Val Val Asn Ile Ser Phe His Leu Ser Ala Gly Glu Asp Lys Ile
450 455 460
Lys Val Lys Arg Ser Leu Glu Asp Glu Pro Arg Leu Val Leu Trp Ala
465 470 475 480
Leu Leu Val Tyr Asn Ala Thr Asn Asn Thr Asn Leu Glu Gly Lys Ile
485 490 495
Ile Gln Gln Lys Leu Leu Lys Asn Asn Glu Ser Leu Asp Glu Gly Leu
500 505 510
Arg Leu His Thr Val Asn Val Arg Gln Leu Gly His Cys Leu Ala Met
515 520 525
Glu Glu Pro Lys Gly Tyr Tyr Trp Pro Ser Ile Gln Pro Ser Glu Tyr
530 535 540
Val Leu Pro Cys Pro Asp Lys Pro Gly Phe Ser Ala Ser Arg Ile Cys
545 550 555 560
Phe Tyr Asn Ala Thr Asn Pro Leu Val Thr Tyr Trp Gly Pro Val Asp
565 570 575
Ile Ser Asn Cys Leu Lys Glu Ala Asn Glu Val Ala Asn Gln Ile Leu
580 585 590
Asn Leu Thr Ala Asp Gly Gln Asn Leu Thr Ser Ala Asn Ile Thr Asn
595 600 605
Ile Val Glu Gln Val Lys Arg Ile Val Asn Lys Glu Glu Asn Ile Asp
610 615 620
Ile Thr Leu Gly Ser Thr Leu Met Asn Ile Phe Ser Asn Ile Leu Ser
625 630 635 640
Ser Ser Asp Ser Asp Leu Leu Glu Ser Ser Ser Glu Ala Leu Lys Thr
645 650 655
Ile Asp Glu Leu Ala Phe Lys Ile Asp Leu Asn Ser Thr Ser His Val
660 665 670
Asn Ile Thr Thr Arg Asn Leu Ala Leu Ser Val Ser Ser Leu Leu Pro
675 680 685
Gly Thr Asn Ala Ile Ser Asn Phe Ser Ile Gly Leu Pro Ser Asn Asn
690 695 700
Glu Ser Tyr Phe Gln Met Asp Phe Glu Ser Gly Gln Val Asp Pro Leu
705 710 715 720
Ala Ser Val Ile Leu Pro Pro Asn Leu Leu Glu Asn Leu Ser Pro Glu
725 730 735
Asp Ser Val Leu Val Arg Arg Ala Gln Phe Thr Phe Phe Asn Lys Thr
740 745 750
Gly Leu Phe Gln Asp Val Gly Pro Gln Arg Lys Thr Leu Val Ser Tyr
755 760 765
Val Met Ala Cys Ser Ile Gly Asn Ile Thr Ile Gln Asn Leu Lys Asp
770 775 780
Pro Val Gln Ile Lys Ile Lys His Thr Arg Thr Gln Glu Val His His
785 790 795 800
Pro Ile Cys Ala Phe Trp Asp Leu Asn Lys Asn Lys Ser Phe Gly Gly
805 810 815
Trp Asn Thr Ser Gly Cys Val Ala His Arg Asp Ser Asp Ala Ser Glu
820 825 830
Thr Val Cys Leu Cys Asn His Phe Thr His Phe Gly Va1 Leu Met Asp
835 840 845
Leu Pro Arg Ser Ala Ser Gln Leu Asp Ala Arg Asn Thr Lys Val Leu
850 855 860
Thr Phe Ile Ser Tyr Ile Gly Cys Gly Ile Ser Ala Ile Phe Ser Ala
865 870 875 880
Ala Thr Leu Leu Thr Tyr Val Ala Phe Glu Lys Leu Arg Arg Asp Tyr
885 890 895
Pro Ser Lys Ile Leu Met Asn Leu Ser Thr Ala Leu Leu Phe Leu Asn
900 905 910
Leu Leu Phe Leu Leu Asp Gly Trp Ile Thr Ser Phe Asn Val Asp Gly
33 / 87
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
915 920 925
Leu Cys Ile Ala Val Ala Val Leu Leu His Phe Phe Leu Leu Ala Thr
930 935 940
Phe Thr Trp Met Gly Leu Glu Ala Ile His Met Tyr Ile Ala Leu Val
945 950 955 960
Lys Val Phe Asn Thr Tyr Ile Arg Arg Tyr Ile Leu Lys Phe Cys Ile
965 970 975
Ile Gly Trp Gly Leu Pro Ala Leu Val Val Ser Val Val Leu Ala Ser
980 985 990
Arg Asn Asn Asn Glu Val Tyr Gly Lys Glu Ser Tyr Gly Lys Glu Lys
995 1000 1005
Gly Asp Glu Phe Cys Trp Ile Gln Asp Pro Val Ile Phe Tyr Val Thr
1010 1015 1020
Cys Ala Gly Tyr Phe Gly Val Met Phe Phe Leu Asn Ile Ala Met Phe
1025 1030 1035 1040
Ile Val Val Met Val Gln Ile Cys Gly Arg Asn Gly Lys Arg Ser Asn
1045 1050 1055
Arg Thr Leu Arg Glu Glu Val Leu Arg Asn Leu Arg Ser Val Val Ser
1060 1065 1070
Leu Thr Phe Leu Leu Gly Met Thr Trp Gly Phe Ala Phe Phe Ala Trp
1075 1080 1085
Gly Pro Leu Asn Ile Pro Phe Met Tyr Leu Phe Ser Ile Phe Asn Ser
1090 1095 1100
Leu Gln Gly Leu Phe Ile Phe Ile Phe His Cys Ala Met Lys Glu Asn
1105 1110 1115 1120
Val Gln Lys Gln Trp Arg Arg His Leu Cys Cys Gly Arg Phe Arg Leu
1125 1130 1135
Ala Asp Asn Ser Asp Trp Ser Lys Thr Ala Thr Asn Ile Ile Lys Lys
1140 1145 1150
Ser Ser Asp Asn Leu Gly Lys Ser Leu Ser Ser Ser Ser Ile Gly Ser
1155 1160 1165
Asn Ser Thr Tyr Leu Thr Ser Lys Ser Lys Ser Ser Ser Thr Thr Tyr
1170 1175 1180
Phe Lys Arg Asn Ser His Thr Asp Asn Val Ser Tyr Glu His Ser Phe
1185 1190 1195 1200
Asn Lys Ser Gly Ser Leu Arg Gln Cys Phe His Gly Gln Val Leu Val
1205 1210 1215
Lys Thr Gly Pro Cys
1220
<210> 21
<211> 2157
<212> DNA
<213> homo Sapiens
<400> 21
atgatgtttcgctcagatcgaatgtggagctgccattggaaatggaagcccagtcctctc 60
ctgttcttatttgctttatatatcatgtgtgttcctcactcagtgtggggatgtgccaac 120
tgccgagtggttttgtccaacccttctgggacctttacttctccatgctaccctaacgac 180
tacccaaacagccaggcttgcatgtggacgctccgagcccccaccggttatatcattcag 240
ataacatttaacgactttgacattgaagaagctcccaattgcatttatgactcattatcc 300
cttgataatggagagagccagactaaattttgtggagcaactgccaaaggcctatcattt 360
aactcaagtgcgaatgagatgcatgtgtccttttcaagtgactttagcatccagaagaaa 420
ggtttcaatgccagctacatcagagttgccgtgtccttaaggaatcaaaaggtcatttta 480
ccccagacatcagatgcttaccaggtatctgttgcaaaaagcatctctattccagagctc 540
agtgctttcacactctgctttgaagcaaccaaagttggccatgaagacagtgattggaca 600
gctttctcctactcaaatgcatccttcacacaattgctcagttttggaaaggccaagagt 660
ggctactttctatccatttctgattcaaaatgtttgttgaataatgcattacctgtcaaa 720
gaaaaagaagacatttttgcagaaagctttgaacagctctgccttgtttggaataattct 780
ttgggctctattggtgtaaatttcaaaagaaactatgaaacagttccatgtgattctacc 840
attagtaaagttattcctgggaatgggaaattgttgttgggctccaatcaaaatgaaatt 900
gtctctctaaaaggggacatttataactttcgactttggaattttaccatgaatgccaaa 960
atcctctccaacctcagctgtaatgtgaaagggaatgtagtcgactggcaaaatgacttc 1020
34 / 87
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
tggaatatcccaaacctagctctgaaagctgaaagcaacctaagctgtggttcctacctg 1080
atcccgctcccagcagcagaactggccagctgtgcagacctggggaccctctgtcaagct 1140
actgtaaactctcctagtactacaccacccactgtcaccactaacatgcctgttactaac 1200
agaatcgataaacaaaggaatgatggaattatctatagaatatccgtagtgattcagaac 1260
atccttcgtcaccctgaggtaaaagtacagagcaaggtggcagaatggctcaattcaacc 1320
ttccaaaattggaactacacggtttatgtcgttaatatcagttttcacctgagtgctgga 1380
gaggacaagattaaagtcaagagaagccttgaggatgagccaaggttggtgctttgggcc 1440
cttctagtttacaatgctaccaacaatactaatttagaaggaaaaatcattcagcagaag 1500
ctcctaaaaaataatgagtccttggatgaaggcttgaggctacatacagtgaatgtgaga 1560
caactgggtcattgtcttgccatggaggaacccaaaggctactactggccatctatccaa 1620
ccttctgaatacgttcttccttgtccagacaagcctggcttttctgcttctcggatatgt 1680
ttttacaatgctaccaacccattggtaacctactggggacctgttgatatctccaactgt 1740
ttaaaagaagcaaatgaagttgctaaccagattttaaatttaactgctgatgggcagaac 1800
ttaacctcagccaatattaccaacattgtggaacaggtcaaaagaattgtgaataaagaa 1860
gaaaacattgatataacacttggctcaactctaatgaatatattttctaatatcttaagc 1920
agttcagacagtgacttgcttgagtcatcttctgaagctttaaaaacaattgatgaattg 1980
gccttcaagatagacctaaatagcacatcacatgtgaatattacaactcggaacttggct 2040
ctcagcgtatcatccctgttaccagggacaaatgcaatttcaaattttagcattggtctt 2100
ccaagcaataatgaatcgtatttccaggtaatgagccagtggtttctttcattttaa 2157
<210> 22
<211> 718
<212> PRT
<213> homo sapiens
<400> 22
Met Met Phe Arg Ser Asp Arg Met Trp Ser Cys His Trp Lys Trp Lys
1 5 10 15
Pro Ser Pro Leu Leu Phe Leu Phe Ala Leu Tyr Ile Met Cys Val Pro
20 25 30
His Ser Val Trp Gly Cys Ala Asn Cys Arg Val Val Leu Ser Asn Pro
35 40 45
Ser Gly Thr Phe Thr Ser Pro Cys Tyr Pro Asn Asp Tyr Pro Asn Ser
50 55 60
Gln Ala Cys Met Trp Thr Leu Arg Ala Pro Thr Gly Tyr Ile Ile Gln
65 70 75 80
Ile Thr Phe Asn Asp Phe Asp Ile Glu Glu Ala Pro Asn Cys Ile Tyr
85 90 95
Asp Ser Leu Ser Leu Asp Asn Gly Glu Ser Gln Thr Lys Phe Cys Gly
100 105 110
Ala Thr Ala Lys Gly Leu Ser Phe Asn Ser Ser Ala Asn Glu Met His
115 120 125
Val Ser Phe Ser Ser Asp Phe Ser Ile Gln Lys Lys Gly Phe Asn Ala
130 135 140
Ser Tyr Ile Arg Val Ala Val Ser Leu Arg Asn Gln Lys Val Ile Leu
145 150 155 160
Pro Gln Thr Ser Asp Ala Tyr Gln Val Ser Val Ala Lys Ser Ile Ser
165 170 175
Ile Pro Glu Leu Ser Ala Phe Thr Leu Cys Phe Glu Ala Thr Lys Val
180 185 190
Gly His Glu Asp Ser Asp Trp Thr Ala Phe Ser Tyr Ser Asn Ala Ser
195 200 205
Phe Thr Gln Leu Leu Ser Phe Gly Lys Ala Lys Ser Gly Tyr Phe Leu
210 215 220
Ser Ile Ser Asp Ser Lys Cys Leu Leu Asn Asn Ala Leu Pro Val Lys
225 230 235 240
Glu Lys Glu Asp Ile Phe Ala Glu Ser Phe Glu Gln Leu Cys Leu Val
245 250 255
Trp Asn Asn Ser Leu Gly Ser Ile Gly Val Asn Phe Lys Arg Asn Tyr
260 265 270
Glu Thr Val Pro Cys Asp Ser Thr Ile Ser Lys Val Ile Pro Gly Asn
275 280 285
Gly Lys Leu Leu Leu Gly Ser Asn Gln Asn Glu Ile Val Ser Leu Lys
35 / 87
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
290 295 300
Gly Asp Ile Tyr Asn Phe Arg Leu Trp Asn Phe Thr Met Asn Ala Lys
305 310 315 320
Ile Leu Ser Asn Leu Ser Cys Asn Val Lys Gly Asn Val Val Asp Trp
325 330 335
Gln Asn Asp Phe Trp Asn Ile Pro Asn Leu Ala Leu Lys Ala Glu Ser
340 345 350
Asn Leu Ser Cys Gly Ser Tyr Leu Ile Pro Leu Pro Ala Ala Glu Leu
355 360 365
Ala Ser Cys Ala Asp Leu Gly Thr Leu Cys Gln Ala Thr Val Asn Ser
370 375 380
Pro Ser Thr Thr Pro Pro Thr Val Thr Thr Asn Met Pro Val Thr Asn
385 390 395 400
Arg Ile Asp Lys Gln Arg Asn Asp Gly Ile Ile Tyr Arg Ile Ser Val
405 410 415
Val Ile Gln Asn Ile Leu Arg His Pro Glu Val Lys Val Gln Ser Lys
420 425 430
Val Ala Glu Trp Leu Asn Ser Thr Phe Gln Asn Trp Asn Tyr Thr Val
435 440 445
Tyr Val Val Asn Ile Ser Phe His Leu Ser Ala Gly Glu Asp Lys Ile
450 455 460
Lys Val Lys Arg Ser Leu Glu Asp Glu Pro Arg Leu Val Leu Trp Ala
465 470 475 480
Leu Leu Val Tyr Asn Ala Thr Asn Asn Thr Asn Leu Glu Gly Lys Ile
485 490 495
Ile Gln Gln Lys Leu Leu Lys Asn Asn Glu Ser Leu Asp Glu Gly Leu
500 505 510
Arg Leu His Thr Val Asn Val Arg Gln Leu Gly His Cys Leu Ala Met
515 520 525
Glu Glu Pro Lys Gly Tyr Tyr Trp Pro Ser Ile Gln Pro Ser Glu Tyr
530 535 540
Val Leu Pro Cys Pro Asp Lys Pro Gly Phe Ser Ala Ser Arg Ile Cys
545 550 555 560
Phe Tyr Asn Ala Thr Asn Pro Leu Val Thr Tyr Trp Gly Pro Val Asp
565 570 575
Ile Ser Asn Cys Leu Lys Glu Ala Asn Glu Val Ala Asn Gln Ile Leu
580 585 590
Asn Leu Thr Ala Asp Gly Gln Asn Leu Thr Ser Ala Asn Ile Thr Asn
595 600 605
Ile Val Glu Gln Val Lys Arg Ile Val Asn Lys Glu Glu Asn Ile Asp
610 615 620
Ile Thr Leu Gly Ser Thr Leu Met Asn Ile Phe Ser Asn Ile Leu Ser
625 630 635 640
Ser Ser Asp Ser Asp Leu Leu Glu Ser Ser Ser Glu Ala Leu Lys Thr
645 650 655
Ile Asp Glu Leu Ala Phe Lys Ile Asp Leu Asn Ser Thr Ser His Val
660 665 670
Asn Ile Thr Thr Arg Asn Leu Ala Leu Ser Val Ser Ser Leu Leu Pro
675 680 685
Gly Thr Asn Ala Ile Ser Asn Phe Ser Ile Gly Leu Pro Ser Asn Asn
690 695 700
Glu Ser Tyr Phe Gln Val Met Ser Gln Trp Phe Leu Ser Phe
705 710 715
<210> 23
<211> 3339
<212> DNA
<213> homo sapiens
<400> 23
atgatgtttc gctcagatcg aatgtggagc tgccattgga aatggaagcc cagtcctctc 60
ctgttcttat ttgctttata tatcatgtgt gttcctcact cagtgtgggg atgtgccaac 120
tgccgagtgg ttttgtccaa cccttctggg acctttactt ctccatgcta ccctaacgac 180
36 / 87
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
tacccaaacagccaggcttgcatgtggacgctccgagcccccaccggttatatcattcag240
ataacatttaacgactttgacattgaagaagctcccaattgcatttatgactcattatcc300
cttgataatggagagagccagactaaattttgtggagcaactgccaaaggcctatcattt360
aactcaagtgcgaatgagatgcatgtgtccttttcaagtgactttagcatccagaagaaa420
ggtttcaatgccagctacatcagagttgccgtgtccttaaggaatcaaaaggtcatttta480
ccccagacatcagatgcttaccaggtatctgttgcaaaaagcatctctattccagagctc540
agtgctttcacactctgctttgaagcaaccaaagttggccatgaagacagtgattggaca600
gctttctcctactcaaatgcatccttcacacaattgctcagttttggaaaggccaagagt660
ggctactttctatccatttctgattcaaaatgtttgttgaataatgcattacctgtcaaa720
gaaaaagaagacatttttgcagaaagctttgaacagctctgccttgtttggaataattct780
ttgggctctattggtgtaaatttcaaaagaaactatgaaacagttccatgtgattctacc840
attagtaaagttattcctgggaatgggaaattgttgttgggctccaatcaaaatgaaatt900
gtctctctaaaaggggacatttataactttcgactttggaattttaccatgaatgccaaa960
atcctctccaacctcagctgtaatgtgaaagggaatgtagtcgactggcaaaatgacttc1020
tggaatatcccaaacctagctctgaaagctgaaagcaacctaagctgtggttcctacctg1080
atcccgctcccagcagcagaactggccagctgtgcagacctggggaccctctgtcaagct1140
actgtaaactctcctagtactacaccacccactgtcaccactaacatgcctgttactaac1200
agaatcgataaacaaaggaatgatggaattatctatagaatatccgtagtgattcagaac1260
atccttcgtcaccctgaggtaaaagtacagagcaaggtggcagaatggctcaattcaacc1320
ttccaaaattggaactacacggtttatgtcgttaatatcagttttcacctgagtgctgga1380
gaggacaagattaaagtcaagagaagccttgaggatgagccaaggttggtgctttgggcc1440
cttctagtttacaatgctaccaacaatactaatttagaaggaaaaatcattcagcagaag1500
ctcctaaaaaataatgagtccttggatgaaggcttgaggctacatacagtgaatgtgaga1560
caactgggtcattgtcttgccatggaggaacccaaaggctactactggccatctatccaa1620
ccttctgaatacgttcttccttgtccagacaagcctggcttttctgcttctcggatatgt1680
ttttacaatgctaccaacccattggtaacctactggggacctgttgatatctccaactgt1740
ttaaaagaagcaaatgaagttgctaaccagattttaaatttaactgctgatgggcagaac1800
ttaacctcagccaatattaccaacattgtggaacaggtcaaaagaattgtgaataaagaa1860
gaaaacattgatataacacttggctcaactctaatgaatatattttctaatatcttaagc1920
agttcagacagtgacttgcttgagtcatcttctgaagctttaaaaacaattgatgaattg1980
gccttcaagatagacctaaatagcacatcacatgtgaatattacaactcggaacttggct2040
ctcagcgtatcatccctgttaccagggacaaatgcaatttcaaattttagcattggtctt2100
ccaagcaataatgaatcgtatttccagatggattttgagagtggacaagtggatccactg2160
gcatctgtaattttgcctccaaacttacttgagaatttaagtccagaagattctgtatta2220
gttagaagagcacagtttactttcttcaacaaaactggacttttccaggatgtaggaccc2280
caaagaaaaactttagtgagttatgtgatggcgtgcagtattggaaacattactatccag2340
aatctgaaggatcctgttcaaataaaaatcaaacatacaagaactcaggaagtgcatcat2400
cccatctgtgccttctgggatctgaacaaaaacaaaagttttggaggatggaacacgtca2460
ggatgtgttgcacacagagattcagatgcaagtgagacagtctgcctgtgtaaccacttc2520
acacactttggagttctgatggaccttccaagaagtgcctcacagttagatgcaagaaac2580
actaaagtcctcactttcatcagctatattgggtgtggaatatctgctattttttcagca2640
gcaactctcctgacatatgttgcttttgagaaattgcgaagggattatccctccaaaatc2700
ttgatgaacctgagcacagccctgctgttcctgaatctcctcttcctcctagatggctgg2760
atcacctccttcaatgtggatggactttgcattgctgttgcagtcctgttgcatttcttc2820
cttctggcaacctttacctggatggggctagaagcaattcacatgtacattgctctagtt2880
aaagtatttaacacttacattcgccgatacattctaaaattctgcatcattggctggggt2940
ttgcctgccttagtggtgtcagttgttctagcgagcagaaacaacaatgaagtctatgga3000
aaagaaagttatgggaaagaaaaaggtgatgaattctgttggattcaagatccagtcata3060
ttttatgtgacctgtgctgggtattttggagtcatgttttttctgaacattgccatgttc3120
attgtggtaatggtgcagatctgtgggaggaatggcaagagaagcaaccggaccctgaga3180
gaagaagtgttaaggaacctgcgcagtgtggttagcttgacctttctgttgggcatgaca3240
tggggttttgcattctttgcctggggacccttaaatatccccttcatgtacctcttctcc3300
atcttcaattcattacaaggtaagataaattgtacatga 3339
<210> 24
<211> 1112
<212> PRT
<213> homo sapiens
<400> 24
Met Met Phe Arg Ser Asp Arg Met Trp Ser Cys His Trp Lys Trp Lys
1 5 10 15
Pro Ser Pro Leu Leu Phe Leu Phe Ala Leu Tyr Ile Met Cys Val Pro
37 / 87
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
20 25 30
His Ser Val Trp Gly Cys Ala Asn Cys Arg Val Val Leu Ser Asn Pro
35 40 45
Ser Gly Thr Phe Thr Ser Pro Cys Tyr Pro Asn Asp Tyr Pro Asn Ser
50 55 60
Gln Ala Cys Met Trp Thr Leu Arg Ala Pro Thr Gly Tyr Ile Ile Gln
65 70 75 80
Ile Thr Phe Asn Asp Phe Asp Ile Glu Glu Ala Pro Asn Cys Ile Tyr
85 90 95
Asp Ser Leu Ser Leu Asp Asn Gly Glu Ser Gln Thr Lys Phe Cys Gly
100 105 110
Ala Thr Ala Lys Gly Leu Ser Phe Asn Ser Ser Ala Asn Glu Met His
115 120 125
Val Ser Phe Ser Ser Asp Phe Ser Ile Gln Lys Lys Gly Phe Asn Ala
130 135 140
Ser Tyr Ile Arg Val Ala Val Ser Leu Arg Asn Gln Lys Val Ile Leu
145 150 155 160
Pro Gln Thr Ser Asp Ala Tyr Gln Val Ser Val Ala Lys Ser Ile Ser
165 170 175
Ile Pro Glu Leu Ser Ala Phe Thr Leu Cys Phe Glu Ala Thr Lys Val
180 185 190
Gly His Glu Asp Ser Asp Trp Thr Ala Phe Ser Tyr Ser Asn Ala Ser
195 200 205
Phe Thr Gln Leu Leu Ser Phe Gly Lys Ala Lys Ser Gly Tyr Phe Leu
210 215 220
Ser Ile Ser Asp Ser Lys Cys Leu Leu Asn Asn Ala Leu Pro Val Lys
225 230 235 240
Glu Lys Glu Asp Ile Phe Ala Glu Ser Phe Glu Gln Leu Cys Leu Val
245 250 255
Trp Asn Asn Ser Leu Gly Ser Ile Gly Val Asn Phe Lys Arg Asn Tyr
260 265 270
Glu Thr Val Pro Cys Asp Ser Thr Ile Ser Lys Val Ile Pro Gly Asn
275 280 285
Gly Lys Leu Leu Leu Gly Ser Asn Gln Asn Glu Ile Val Ser Leu Lys
290 295 300
Gly Asp Ile Tyr Asn Phe Arg Leu Trp Asn Phe Thr Met Asn Ala Lys
305 310 315 320
Ile Leu Ser Asn Leu Ser Cys Asn Val Lys Gly Asn Val Val Asp Trp
325 330 335
Gln Asn Asp Phe Trp Asn Ile Pro Asn Leu Ala Leu Lys Ala Glu Ser
340 345 350
Asn Leu Ser Cys Gly Ser Tyr Leu Ile Pro Leu Pro Ala Ala Glu Leu
355 360 365
Ala Ser Cys Ala Asp Leu Gly Thr Leu Cys Gln Ala Thr Val Asn Ser
370 375 380
Pro Ser Thr Thr Pro Pro Thr Val Thr Thr Asn Met Pro Val Thr Asn
385 390 395 400
Arg Ile Asp Lys Gln Arg Asn Asp Gly Ile Ile Tyr Arg Ile Ser Val
405 410 415
Val Ile Gln Asn Ile Leu Arg His Pro Glu Val Lys Val Gln Ser Lys
420 425 430
Val Ala Glu Trp Leu Asn Ser Thr Phe Gln Asn Trp Asn Tyr Thr Val
435 440 445
Tyr Val Val Asn Ile Ser Phe His Leu Ser Ala Gly Glu Asp Lys Ile
450 455 460
Lys Val Lys Arg Ser Leu Glu Asp Glu Pro Arg Leu Val Leu Trp Ala
465 470 475 480
Leu Leu Val Tyr Asn Ala Thr Asn Asn Thr Asn Leu Glu Gly Lys Ile
485 490 495
Ile Gln Gln Lys Leu Leu Lys Asn Asn Glu Ser Leu Asp Glu Gly Leu
500 505 510
Arg Leu His Thr Val Asn Val Arg Gln Leu Gly His Cys Leu Ala Met
515 520 525
38 / 87
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
Glu Glu Pro Lys Gly Tyr Tyr Trp Pro Ser Ile Gln Pro Ser Glu Tyr
530 535 540
Val Leu Pro Cys Pro Asp Lys Pro Gly Phe Ser Ala Ser Arg Ile Cys
545 550 555 560
Phe Tyr Asn Ala Thr Asn Pro Leu Val Thr Tyr Trp Gly Pro Val Asp
565 570 575
Ile Ser Asn Cys Leu Lys Glu Ala Asn Glu Val Ala Asn Gln Ile Leu
580 585 590
Asn Leu Thr Ala Asp Gly Gln Asn Leu Thr Ser Ala Asn Ile Thr Asn
595 600 605
Ile Val Glu Gln Val Lys Arg Ile Val Asn Lys Glu Glu Asn Ile Asp
610 615 620
Ile Thr Leu Gly Ser Thr Leu Met Asn Ile Phe Ser Asn Ile Leu Ser
625 630 635 640
Ser Ser Asp Ser Asp Leu Leu Glu Ser Ser Ser Glu Ala Leu Lys Thr
645 650 655
Ile Asp Glu Leu Ala Phe Lys Ile Asp Leu Asn Ser Thr Ser His Val
660 665 670
Asn Ile Thr Thr Arg Asn Leu Ala Leu Ser Val Ser Ser Leu Leu Pro
675 680 685
Gly Thr Asn Ala Ile Ser Asn Phe Ser Ile Gly Leu Pro Ser Asn Asn
690 695 700
Glu Ser Tyr Phe Gln Met Asp Phe Glu Ser Gly Gln Val Asp Pro Leu
705 710 715 720
Ala Ser Val Ile Leu Pro Pro Asn Leu Leu Glu Asn Leu Ser Pro Glu
725 730 735
Asp Ser Val Leu Val Arg Arg Ala Gln Phe Thr Phe Phe Asn Lys Thr
740 745 750
Gly Leu Phe Gln Asp Val Gly Pro Gln Arg Lys Thr Leu Val Ser Tyr
755 760 765
Val Met Ala Cys Ser Ile Gly Asn Ile Thr Ile Gln Asn Leu Lys Asp
770 775 780
Pro Val Gln Ile Lys Ile Lys His Thr Arg Thr Gln Glu Val His His
785 790 795 800
Pro Ile Cys Ala Phe Trp Asp Leu Asn Lys Asn Lys Ser Phe Gly Gly
805 810 815
Trp Asn Thr Ser Gly Cys Val Ala His Arg Asp Ser Asp Ala Ser Glu
820 825 830
Thr Val Cys Leu Cys Asn His Phe Thr His Phe Gly Val Leu Met Asp
835 840 845
Leu Pro Arg Ser Ala Ser Gln Leu Asp Ala Arg Asn Thr Lys Val Leu
850 855 860
Thr Phe Ile Ser Tyr Ile Gly Cys Gly Ile Ser Ala Ile Phe Ser Ala
865 870 875 880
Ala Thr Leu Leu Thr Tyr Val Ala Phe Glu Lys Leu Arg Arg Asp Tyr
885 890 895
Pro Ser Lys Ile Leu Met Asn Leu Ser Thr Ala Leu Leu Phe Leu Asn
900 905 910
Leu Leu Phe Leu Leu Asp Gly Trp Ile Thr Ser Phe Asn Val Asp Gly
915 920 925
Leu Cys Ile Ala Val Ala Val Leu Leu His Phe Phe Leu Leu Ala Thr
930 935 940
Phe Thr Trp Met Gly Leu Glu Ala Ile His Met Tyr Ile Ala Leu Val
945 950 955 960
Lys Val Phe Asn Thr Tyr Ile Arg Arg Tyr Ile Leu Lys Phe Cys Ile
965 970 975
Ile Gly Trp Gly Leu Pro Ala Leu Val Val Ser Val Val Leu Ala Ser
980 985 990
Arg Asn Asn Asn Glu Val Tyr Gly Lys Glu Ser Tyr Gly Lys Glu Lys
995 1000 1005
Gly Asp Glu Phe Cys Trp Ile Gln Asp Pro Val Ile Phe Tyr Val Thr
1010 1015 1020
Cys Ala Gly Tyr Phe Gly Val Met Phe Phe Leu Asn Ile Ala Met Phe
39 / 87
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
1025 1030 1035 1040
Ile Val Val Met Val Gln Ile Cys Gly Arg Asn Gly Lys Arg Ser Asn
1045 1050 1055
Arg Thr Leu Arg Glu Glu Val Leu Arg Asn Leu Arg Ser Val Val Ser
1060 1065 1070
Leu Thr Phe Leu Leu Gly Met Thr Trp Gly Phe Ala Phe Phe Ala Trp
1075 1080 1085
Gly Pro Leu Asn Ile Pro Phe Met Tyr Leu Phe Ser Ile Phe Asn Ser
1090 1095 1100
Leu Gln Gly Lys Ile Asn Cys Thr
1105 1110
<210> 25
<211> 1626
<212> DNA
<213> homo Sapiens
<400>
25
atggattttgagagtggacaagtggatccactggcatctgtaattttgcctccaaactta 60
cttgagaatttaagtccagaagattctgtattagttagaagagcacagtttactttcttc 120
aacaaaactggacttttccaggatgtaggaccccaaagaaaaactttagtgagttatgtg 180
atggcgtgcagtattggaaacattactatccagaatctgaaggatcctgttcaaataaaa 240
atcaaacatacaagaactcaggaagtgcatcatcccatctgtgccttctgggatctgaac 300
aaaaacaaaagttttggaggatggaacacgtcaggatgtgttgcacacagagattcagat 360
gcaagtgagacagtctgcctgtgtaaccacttcacacactttggagttctgatggacctt 420
ccaagaagtgcctcacagttagatgcaagaaacactaaagtcctcactttcatcagctat 480
attgggtgtggaatatctgctattttttcagcagcaactctcctgacatatgttgctttt 540
gagaaattgcgaagggattatccctccaaaatcttgatgaacctgagcacagccctgctg 600
ttcctgaatctcctcttcctcctagatggctggatcacctccttcaatgtggatggactt 660
tgcattgctgttgcagtcctgttgcatttcttccttctggcaacctttacctggatgggg 720
ctagaagcaattcacatgtacattgctctagttaaagtatttaacacttacattcgccga 780
tacattctaaaattctgcatcattggctggggtttgcctgccttagtggtgtcagttgtt 840
ctagcgagcagaaacaacaatgaagtctatggaaaagaaagttatgggaaagaaaaaggt 900
gatgaattctgttggattcaagatccagtcatattttatgtgacctgtgctgggtatttt 960
ggagtcatgttttttctgaacattgccatgttcattgtggtaatggtgcagatctgtggg 1020
aggaatggcaagagaagcaaccggaccctgagagaagaagtgttaaggaacctgcgcagt 1080
gtggttagcttgacctttctgttgggcatgacatggggttttgcattctttgcctgggga 1140
cccttaaatatccccttcatgtacctcttctccatcttcaattcattacaaggcttattt 1200
atattcatcttccactgtgctatgaaggagaatgttcagaaacagtggcggcggcatctc 1260
tgctgtggtagatttcggttagcagataactcagattggagtaagacagctaccaatatc 1320
atcaagaaaagttctgataatctaggaaaatctttgtcttcaagctccattggttccaac 1380
tcaacctatcttacatccaaatctaaatccagctctaccacctatttcaaaaggaatagc 1440
cacacagacagtgcttccatggacaagtccttgtcaaaactggcccatgctgatggagat 1500
caaacatcaatcatcectgtccatcaggtcattgataaggtcaagggttattgcaatgct 1560
cattcagacaacttctataaaaatattatcatgtcagacaccttcagccacagcacaaag 1620
ttttaa 1626
<210> 26
<211> 541
<212> PRT
<213> homo Sapiens
<400> 26
Met Asp Phe Glu Ser Gly Gln Val Asp Pro Leu Ala Ser Val Ile Leu
1 5 10 15
Pro Pro Asn Leu Leu Glu Asn Leu Ser Pro Glu Asp Ser Val Leu Val
20 25 30
Arg Arg Ala Gln Phe Thr Phe Phe Asn Lys Thr Gly Leu Phe Gln Asp
35 40 45
Val Gly Pro Gln Arg Lys Thr Leu Val Ser Tyr Val Met Ala Cys Ser
50 55 60
Ile Gly Asn Ile Thr Ile Gln Asn Leu Lys Asp Pro Val Gln Ile Lys
65 70 75 80
40 / 87
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
Ile Lys His Thr Arg Thr Gln Glu Val His His Pro Ile Cys Ala Phe
85 90 95
Trp Asp Leu Asn Lys Asn Lys Ser Phe Gly Gly Trp Asn Thr Ser Gly
100 105 110
Cys Val Ala His Arg Asp Ser Asp Ala Ser Glu Thr Val Cys Leu Cys
115 120 125
Asn His Phe Thr His Phe Gly Val Leu Met Asp Leu Pro Arg Ser Ala
130 135 140
Ser Gln Leu Asp Ala Arg Asn Thr Lys Val Leu Thr Phe Ile Ser Tyr
145 150 155 160
Ile Gly Cys Gly Ile Ser Ala Ile Phe Ser Ala Ala Thr Leu Leu Thr
165 170 175
Tyr Val Ala Phe Glu Lys Leu Arg Arg Asp Tyr Pro Ser Lys Ile Leu
180 185 190
Met Asn Leu Ser Thr Ala Leu Leu Phe Leu Asn Leu Leu Phe Leu Leu
195 200 205
Asp Gly Trp Ile Thr Ser Phe Asn Val Asp Gly Leu Cys Ile Ala Val
210 215 220
Ala Val Leu Leu His Phe Phe Leu Leu Ala Thr Phe Thr Trp Met Gly
225 230 235 240
Leu Glu Ala Ile His Met Tyr Ile Ala Leu Val Lys Val Phe Asn Thr
245 250 255
Tyr Ile Arg Arg Tyr Ile Leu Lys Phe Cys Ile Ile Gly Trp Gly Leu
260 265 270
Pro Ala Leu Val Val Ser Val Val Leu Ala Ser Arg Asn Asn Asn Glu
275 280 285
Val Tyr Gly Lys Glu Ser Tyr Gly Lys Glu Lys Gly Asp Glu Phe Cys
290 295 300
Trp Ile Gln Asp Pro Val Ile Phe Tyr Val Thr Cys Ala Gly Tyr Phe
305 310 315 320
Gly Val Met Phe Phe Leu Asn Ile Ala Met Phe Ile Val Val Met Val
325 330 335
Gln Ile Cys Gly Arg Asn Gly Lys Arg Ser Asn Arg Thr Leu Arg Glu
340 345 350
Glu Val Leu Arg Asn Leu Arg Ser Val Val Ser Leu Thr Phe Leu Leu
355 360 365
Gly Met Thr Trp Gly Phe Ala Phe Phe Ala Trp Gly Pro Leu Asn Ile
370 375 380
Pro Phe Met Tyr Leu Phe Ser Ile Phe Asn Ser Leu Gln Gly Leu Phe
385 390 395 400
Ile Phe Ile Phe His Cys Ala Met Lys Glu Asn Val Gln Lys Gln Trp
405 410 415
Arg Arg His Leu Cys Cys Gly Arg Phe Arg Leu Ala Asp Asn Ser Asp
420 425 430
Trp Ser Lys Thr Ala Thr Asn Ile Ile Lys Lys Ser Ser Asp Asn Leu
435 440 445
Gly Lys Ser Leu Ser Ser Ser Ser Ile Gly Ser Asn Ser Thr Tyr Leu
450 455 460
Thr Ser Lys Ser Lys Ser Ser Ser Thr Thr Tyr Phe Lys Arg Asn Ser
465 470 475 480
His Thr Asp Ser Ala Ser Met Asp Lys Ser Leu Ser Lys Leu Ala His
485 490 495
Ala Asp Gly Asp Gln Thr Ser Ile Ile Pro Val His Gln Val Ile Asp
500 505 510
Lys Val Lys Gly Tyr Cys Asn Ala His Ser Asp Asn Phe Tyr Lys Asn
515 520 525
Ile Ile Met Ser Asp Thr Phe Ser His Ser Thr Lys Phe
530 535 540
<210> 27
<211> 1539
<212> DNA
<213> homo sapiens
41 / 87
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
<400> 27
atggattttgagagtggacaagtggatccactggcatctgtaattttgcctccaaactta 60
cttgagaatttaagtccagaagattctgtattagttagaagagcacagtttactttcttc 120
aacaaaactggacttttccaggatgtaggaccccaaagaaaaactttagtgagttatgtg 180
atggcgtgcagtattggaaacattactatccagaatctgaaggatcctgttcaaataaaa 240
atcaaacatacaagaactcaggaagtgcatcatcccatctgtgccttctgggatctgaac 300
aaaaacaaaagttttggaggatggaacacgtcaggatgtgttgcacacagagattcagat 360
gcaagtgagacagtctgcctgtgtaaccacttcacacactttggagttctgatggacctt 420
ccaagaagtgcctcacagttagatgcaagaaacactaaagtcctcactttcatcagctat 480
attgggtgtggaatatctgctattttttcagcagcaactctcctgacatatgttgctttt 540
gagaaattgcgaagggattatccctccaaaatcttgatgaacctgagcacagccctgctg 600
ttcctgaatctcctcttcctcctagatggctggatcacctccttcaatgtggatggactt 660
tgcattgctgttgcagtcctgttgcatttcttccttctggcaacctttacctggatgggg 720
ctagaagcaattcacatgtacattgctctagttaaagtatttaacacttacattcgccga 780
tacattctaaaattctgcatcattggctggggtttgcctgccttagtggtgtcagttgtt 840
ctagcgagcagaaacaacaatgaagtctatggaaaagaaagttatgggaaagaaaaaggt 900
gatgaattctgttggattcaagatccagtcatattttatgtgacctgtgctgggtatttt 960
ggagtcatgttttttctgaacattgccatgttcattgtggtaatggtgcagatctgtggg 1020
aggaatggcaagagaagcaaccggaccctgagagaagaagtgttaaggaacctgcgcagt 1080
gtggttagcttgacctttctgttgggcatgacatggggttttgcattctttgcctgggga 1140
cccttaaatatccccttcatgtacctcttctccatcttcaattcattacaaggcttattt 1200
atattcatcttccactgtgctatgaaggagaatgttcagaaacagtggcggcggcatctc 1260
tgctgtggtagatttcggttagcagataactcagattggagtaagacagctaccaatatc 1320
atcaagaaaagttctgataatctaggaaaatctttgtcttcaagctccattggttccaac 1380
tcaacctatcttacatccaaatctaaatccagctctaccacctatttcaaaaggaatagc 1440
cacacagataatgtctcctatgagcattccttcaacaaaagtggatcactcagacagtgc 1500
ttccatggacaagtccttgtcaaaactggcccatgctga 1539
<210> 28
<211> 512
<212> PRT
<213> homo Sapiens
<400> 28
Met Asp Phe Glu Ser Gly Gln Val Asp Pro Leu Ala Ser Val Ile Leu
1 5 10 15
Pro Pro Asn Leu Leu Glu Asn Leu Ser Pro Glu Asp Ser Val Leu Val
20 25 30
Arg Arg Ala Gln Phe Thr Phe Phe Asn Lys Thr Gly Leu Phe Gln Asp
35 40 45
Val Gly Pro Gln Arg Lys Thr Leu Val Ser Tyr Val Met Ala Cys Ser
50 55 60
Ile Gly Asn Ile Thr Ile Gln Asn Leu Lys Asp Pro Val Gln Ile Lys
65 70 75 80
Ile Lys His Thr Arg Thr Gln Glu Val His His Pro Ile Cys Ala Phe
85 90 95
Trp Asp Leu Asn Lys Asn Lys Ser Phe Gly Gly Trp Asn Thr Ser Gly
100 105 110
Cys Val Ala His Arg Asp Ser Asp Ala Ser Glu Thr Val Cys Leu Cys
115 120 125
Asn His Phe Thr His Phe Gly Val Leu Met Asp Leu Pro Arg Ser Ala
130 135 140
Ser Gln Leu Asp Ala Arg Asn Thr Lys Val Leu Thr Phe Ile Ser Tyr
145 150 155 160
Ile Gly Cys Gly Ile Ser Ala Ile Phe Ser Ala Ala Thr Leu Leu Thr
165 170 175
Tyr Val Ala Phe Glu Lys Leu Arg Arg Asp Tyr Pro Ser Lys Ile Leu
180 185 190
Met Asn Leu Ser Thr Ala Leu Leu Phe Leu Asn Leu Leu Phe Leu Leu
195 200 205
Asp Gly Trp Ile Thr Ser Phe Asn Val Asp Gly Leu Cys Ile Ala Val
210 215 220
Ala Val Leu Leu His Phe Phe Leu Leu Ala Thr Phe Thr Trp Met Gly
42 / 87
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
225 230 235 240
Leu Glu Ala Ile His Met Tyr Ile Ala Leu Val Lys Val Phe Asn Thr
245 250 255
Tyr Ile Arg Arg Tyr Ile Leu Lys Phe Cys Ile Ile Gly Trp Gly Leu
260 265 270
Pro Ala Leu Val Val Ser Val Val Leu Ala Ser Arg Asn Asn Asn Glu
275 280 285
Val Tyr Gly Lys Glu Ser Tyr Gly Lys Glu Lys Gly Asp Glu Phe Cys
290 295 300
Trp Ile Gln Asp Pro Val Ile Phe Tyr Val Thr Cys Ala Gly Tyr Phe
305 310 315 320
Gly Val Met Phe Phe Leu Asn Ile Ala Met Phe Ile Val Val Met Val
325 330 335
Gln Ile Cys Gly Arg Asn Gly Lys Arg Ser Asn Arg Thr Leu Arg Glu
340 345 350
Glu Val Leu Arg Asn Leu Arg Ser Val Val Ser Leu Thr Phe Leu Leu
355 360 365
Gly Met Thr Trp Gly Phe Ala Phe Phe Ala Trp Gly Pro Leu Asn Ile
370 375 380
Pro Phe Met Tyr Leu Phe Ser Ile Phe Asn Ser Leu Gln Gly Leu Phe
385 390 395 400
Ile Phe Ile Phe His Cys Ala Met Lys Glu Asn Val Gln Lys Gln Trp
405 410 415
Arg Arg His Leu Cys Cys Gly Arg Phe Arg Leu Ala Asp Asn Ser Asp
420 425 430
Trp Ser Lys Thr Ala Thr Asn Ile Ile Lys Lys Ser Ser Asp Asn Leu
435 440 445
Gly Lys Ser Leu Ser Ser Ser Ser Ile Gly Ser Asn Ser Thr Tyr Leu
450 455 460
Thr Ser Lys Ser Lys Ser Ser Ser Thr Thr Tyr Phe Lys Arg Asn Ser
465 470 475 480
His Thr Asp Asn Val Ser Tyr Glu His Ser Phe Asn Lys Ser Gly Ser
485 490 495
Leu Arg Gln Cys Phe His Gly Gln Val Leu Val Lys Thr Gly Pro Cys
500 505 510
<210> 29
<211> 27
<212> DNA
<213> homo Sapiens
<400> 29
atgagccagt ggtttctttc attttaa 27
<210> 30
<211> 8
<212> PRT
<213> homo Sapiens
<400> 30
Met Ser Gln Trp Phe Leu Ser Phe
1 5
<210> 31
<211> 1212
<212> DNA
<213> homo Sapiens
<400> 31
atggattttg agagtggaca agtggatcca ctggcatctg taattttgcc tccaaactta 60
cttgagaatt taagtccaga agattctgta ttagttagaa gagcacagtt tactttcttc 120
aacaaaactg gacttttcca ggatgtagga ccccaaagaa aaactttagt gagttatgtg 180
atggcgtgca gtattggaaa cattactatc cagaatctga aggatcctgt tcaaataaaa 240
43 / 87
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
atcaaacatacaagaactcaggaagtgcatcatcccatctgtgccttctgggatctgaac 300
aaaaacaaaagttttggaggatggaacacgtcaggatgtgttgcacacagagattcagat 360
gcaagtgagacagtctgcctgtgtaaccacttcacacactttggagttctgatggacctt 420
ccaagaagtgcctcacagttagatgcaagaaacactaaagtcctcactttcatcagctat 480
attgggtgtggaatatctgctattttttcagcagcaactctcctgacatatgttgctttt 540
gagaaattgcgaagggattatccctccaaaatcttgatgaacctgagcacagccctgctg 600
ttcctgaatctcctcttcctcctagatggctggatcacctccttcaatgtggatggactt 660
tgcattgctgt.tgcagtcctgttgcatttcttccttctggcaacctttacctggatgggg 720
ctagaagcaattcacatgtacattgctctagttaaagtatttaacacttacattcgccga 780
tacattctaaaattctgcatcattggctggggtttgcctgccttagtggtgtcagttgtt 840
ctagcgagcagaaacaacaatgaagtctatggaaaagaaagttatgggaaagaaaaaggt 900
gatgaattctgttggattcaagatccagtcatattttatgtgacctgtgctgggtatttt 960
ggagtcatgttttttctgaacattgccatgttcattgtggtaatggtgcagatctgtggg 1020
aggaatggcaagagaagcaaccggaccctgagagaagaagtgttaaggaacctgcgcagt 1080
gtggttagcttgacctttctgttgggcatgacatggggttttgcattctttgcctgggga 1140
cccttaaatatccccttcatgtacctcttctccatcttcaattcattacaaggtaagata 1200
aattgtacatga 1212
<210> 32
<211> 403
<212> PRT
<213> homo Sapiens
<400> 32
Met Asp Phe Glu Ser Gly Gln Val Asp Pro Leu Ala Ser Val Ile Leu
1 5 10 15
Pro Pro Asn Leu Leu Glu Asn Leu Ser Pro Glu Asp Ser Val Leu Val
20 25 30
Arg Arg Ala Gln Phe Thr Phe Phe Asn Lys Thr Gly Leu Phe Gln Asp
35 40 45
Val Gly Pro Gln Arg Lys Thr Leu Val Ser Tyr Val Met Ala Cys Ser
50 55 60
Ile Gly Asn Ile Thr Ile Gln Asn Leu Lys Asp Pro Val Gln Ile Lys
65 70 75 80
Ile Lys His Thr Arg Thr Gln Glu Val His His Pro Ile Cys Ala Phe
85 90 95
Trp Asp Leu Asn Lys Asn Lys Ser Phe Gly Gly Trp Asn Thr Ser Gly
100 105 110
Cys Val Ala His Arg Asp Ser Asp Ala Ser Glu Thr Val Cys Leu Cys
115 120 125
Asn His Phe Thr His Phe Gly Val Leu Met Asp Leu Pro Arg Ser Ala
130 135 140
Ser Gln Leu Asp Ala Arg Asn Thr Lys Val Leu Thr Phe Ile Ser Tyr
145 150 155 160
Ile Gly Cys Gly Ile Ser Ala Ile Phe Ser Ala Ala Thr Leu Leu Thr
165 170 175
Tyr Val Ala Phe Glu Lys Leu Arg Arg Asp Tyr Pro Ser Lys Ile Leu
180 185 190
Met Asn Leu Ser Thr Ala Leu Leu Phe Leu Asn Leu Leu Phe Leu Leu
195 200 205
Asp Gly Trp Ile Thr Ser Phe Asn Val Asp Gly Leu Cys Ile Ala Val
210 215 220
Ala Val Leu Leu His Phe Phe Leu Leu Ala Thr Phe Thr Trp Met Gly
225 230 235 240
Leu Glu Ala Ile His Met Tyr Ile Ala Leu Val Lys Val Phe Asn Thr
245 250 255
Tyr Ile Arg Arg Tyr Ile Leu Lys Phe Cys Ile Ile Gly Trp Gly Leu
260 265 270
Pro Ala Leu Val Val Ser Val Val Leu Ala Ser Arg Asn Asn Asn Glu
275 280 285
Val Tyr Gly Lys Glu Ser Tyr Gly Lys Glu Lys Gly Asp Glu Phe Cys
290 295 300
Trp Ile Gln Asp Pro Val Ile Phe Tyr Val Thr Cys Ala Gly Tyr Phe
44 / 87
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
305 310 315 320
Gly Val Met Phe Phe Leu Asn Ile Ala Met Phe Ile Val Val Met Val
325 330 335
Gln Ile Cys Gly Arg Asn Gly Lys Arg Ser Asn Arg Thr Leu Arg Glu
340 345 350
Glu Val Leu Arg Asn Leu Arg Ser Val Val Ser Leu Thr Phe Leu Leu
355 360 365
Gly Met Thr Trp Gly Phe Ala Phe Phe Ala Trp Gly Pro Leu Asn Ile
370 375 380
Pro Phe Met Tyr Leu Phe Ser Ile Phe Asn Ser Leu Gln Gly Lys Ile
385 390 395 400
Asn Cys Thr
<210> 33
<211> 3669
<212> DNA
<213> homo Sapiens
<400>
33
atgtttcgctcagatcgaatgtggagctgccattggaaatggaagcccagtcctctcctg 60
ttcttatttgctttatatatcatgtgtgttcctcactcagcagtgtggggatgtgccaac 120
tgccgagtggttttgtccaacccttctgggacctttacttctccatgctaccctaacgac 180
tacccaaacagccaggcttgcatgtggacgctccgagcccccaccggttatatcattcag 240
ataacatttaacgactttgacattgaagaagctcccaattgcatttatgactcattatcc 300
cttgataatggagagagccagactaaattttgtggagcaactgccaaaggcctatcattt 360
aactcaagtgcgaatgagatgcatgtgtccttttcaagtgactttagcatccagaagaaa 420
ggtttcaatgccagctacatcagagttgccgtgtccttaaggaatcaaaaggtcatttta 480
ccccagacatcagatgcttaccaggtatctgttgcaaaaagcatctctattccagagctc 540
agtgctttcacactctgctttgaagcaaccaaagttggccatgaagacagtgattggaca 600
gctttctcctactcaaatgcatccttcacacaattgctcagttttggaaaggccaagagt 660
ggctactttctatccatttctgattcaaaatgtttgttgaataatgcattacctgtcaaa 720
gaaaaagaagacatttttgcagaaagctttgaacagctctgccttgtttggaataattct 780
ttgggctctattggtgtaaatttcaaaagaaactatgaaacagttccatgtgattctacc 840
attagtaaagttattcctgggaatgggaaattgttgttgggctccaatcaaaatgaaatt 900
gtctctctaaaaggggacatttataactttcgactttggaattttaccatgaatgccaaa 960
atcctctccaacctcagctgtaatgtgaaagggaatgtagtcgactggcaaaatgacttc 1020
tggaatatcccaaacctagctctgaaagctgaaagcaacctaagctgtggttcctacctg 1080
atcccgctcccagcagcagaactggccagctgtgcagacctggggaccctctgtcaagat 1140
ggaattatctatagaatatccgtagtgattcagaacatccttcgtcaccctgaggtaaaa 1200
gtacagagcaaggtggcagaatggctcaattcaaccttccaaaattggaactacacggtt 1260
tatgtcgttaatatcagttttcacctgagtgctggagaggacaagattaaagtcaagaga 1320
agccttgaggatgagccaaggttggtgctttgggcccttctagtttacaatgctaccaac 1380
aatactaatttagaaggaaaaatcattcagcagaagctcctaaaaaataatgagtccttg 1440
gatgaaggcttgaggctacatacagtgaatgtgagacaactgggtcattgtcttgccatg 1500
gaggaacccaaaggctactactggccatctatccaaccttctgaatacgttcttccttgt 1560
ccagacaagcctggcttttctgcttctcggatatgtttttacaatgctaccaacccattg 1620
gtaacctactggggacctgttgatatctccaactgtttaaaagaagcaaatgaagttgct 1680
aaccagattttaaatttaactgctgatgggcagaacttaacctcagccaatattaccaac 1740
attgtggaacaggtcaaaagaattgtgaataaagaagaaaacattgatataacacttggc 1800
tcaactctaatgaatatattttctaatatcttaagcagttcagacagtgacttgcttgag 1860
tcatcttctgaagctttaaaaacaattgatgaattggccttcaagatagacctaaatagc 1920
acatcacatgtgaatattacaactcggaacttggctctcagcgtatcatccctgttacca 1980
gggacaaatgcaatttcaaattttagcattggtcttccaagcaataatgaatcgtatttc 2040
cagatggattttgagagtggacaagtggatccactggcatctgtaattttgcctccaaac 2100
ttacttgagaattt.aagtccagaagattctgtattagttagaagagcacagtttactttc 2160
ttcaacaaaactggacttttccaggatgtaggaccccaaagaaaaactttagtgagttat 2220
gtgatggcgtgcagtattggaaacattactatccagaatctgaaggatcctgttcaaata 2280
aaaatcaaacatacaagaactcaggaagtgcatcatcccatctgtgccttctgggatctg 2340
aacaaaaacaaaagttttggaggatggaacacgtcaggatgtgttgcacacagagattca 2400
gatgcaagtgagacagtctgcctgtgtaaccacttcacacactttggagttctgatggac 2460
cttccaagaagtgcctcacagttagatgcaagaaacactaaagtcctcactttcatcagc 2520
tatattgggtgtggaatatctgctattttttcagcagcaactctcctgacatatgttgct 2580
45 / 87
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
tttgagaaattgcgaagggattatccctccaaaatcttgatgaacctgagcacagccctg 2640
ctgttcctgaatctcctcttcctcctagatggctggatcacctccttcaatgtggatgga 2700
ctttgcattgctgttgcagtcctgttgcatttcttccttctggcaacctttacctggatg 2760
gggctagaagcaattcacatgtacattgctctagttaaagtatttaacacttacattcgc 2820
cgatacattctaaaattctgcatcattggctggggtttgcctgccttagtggtgtcagtt 2880
gttctagcgagcagaaacaacaatgaagtctatggaaaagaaagttatgggaaagaaaaa 2940
ggtgatgaattctgttggattcaagatccagtcatattttatgtgacctgtgctgggtat 3000
tttggagtcatgttttttctgaacattgccatgttcattgtggtaatggtgcagatctgt 3060
gggaggaatggcaagagaagcaaccggaccctgagagaagaagtgttaaggaacctgcgc 3120
agtgtggttagcttgacctttctgttgggcatgacatggggttttgcattctttgcctgg 3180
ggacccttaaatatccccttcatgtacctcttctccatcttcaattcattacaaggctta 3240
tttatattcatcttccactgtgctatgaaggagaatgttcagaaacagtggcggcggcat 3300
ctctgctgtggtagatttcggttagcagataactcagattggagtaagacagctaccaat 3360
atcatcaagaaaagttctgataatctaggaaaatctttgtcttcaagctccattggttcc 3420
aactcaacctatcttacatccaaatctaaatccagctctaccacctatttcaaaaggaat 3480
agccacacagacagtgcttccatggacaagtccttgtcaaaactggcccatgctgatgga 3540
gatcaaacatcaatcatccctgtccatcaggtcattgataaggtcaagggttattgcaat 3600
gctcattcagacaacttctataaaaatatt~atcatgtcagacaccttcagccacagcaca 3660
aagttttaa 3669
<210> 34
<211> 1222
<212> PRT
<213> homo Sapiens
<400> 34
Met Phe Arg Ser Asp Arg Met Trp Ser Cys His Trp Lys Trp Lys Pro
1 5 10 15
Ser Pro Leu Leu Phe Leu Phe Ala Leu Tyr Ile Met Cys Val Pro His
20 25 30
Ser Ala Val Trp Gly Cys Ala Asn Cys Arg Val Val Leu Ser Asn Pro
35 40 45
Ser Gly Thr Phe Thr Ser Pro Cys Tyr Pro Asn Asp Tyr Pro Asn Ser
50 55 60
Gln Ala Cys Met Trp Thr Leu Arg Ala Pro Thr Gly Tyr Ile Ile Gln
65 70 75 80
Ile Thr Phe Asn Asp Phe Asp Ile Glu Glu Ala Pro Asn Cys Ile Tyr
85 90 95
Asp Ser Leu Ser Leu Asp Asn Gly Glu Ser Gln Thr Lys Phe Cys Gly
100 105 110
Ala Thr Ala Lys Gly Leu Ser Phe Asn Ser Ser Ala Asn Glu Met His
115 120 125
Val Ser Phe Ser Ser Asp Phe Ser Ile Gln Lys Lys Gly Phe Asn Ala
130 135 140
Ser Tyr Ile Arg Val Ala Val Ser Leu Arg Asn Gln Lys Val Ile Leu
145 150 155 160
Pro Gln Thr Ser Asp Ala Tyr Gln Val Ser Val Ala Lys Ser Ile Ser
165 170 175
Ile Pro Glu Leu Ser Ala Phe Thr Leu Cys Phe Glu Ala Thr Lys Val
180 185 190
Gly His Glu Asp Ser Asp Trp Thr Ala Phe Ser Tyr Ser Asn Ala Ser
195 200 205
Phe Thr Gln Leu Leu Ser Phe Gly Lys Ala Lys Ser Gly Tyr Phe Leu
210 215 220
Ser Ile Ser Asp Ser Lys Cys Leu Leu Asn Asn Ala Leu Pro Val Lys
225 230 235 240
Glu Lys Glu Asp Ile Phe Ala Glu Ser Phe Glu Gln Leu Cys Leu Val
245 250 255
Trp Asn Asn Ser Leu Gly Ser Ile Gly Val Asn Phe Lys Arg Asn Tyr
260 265 270
Glu Thr Val Pro Cys Asp Ser Thr Ile Ser Lys Val Ile Pro Gly Asn
275 280 285
Gly Lys Leu Leu Leu Gly Ser Asn Gln Asn Glu Ile Val Ser Leu Lys
46 / 87
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
290 295 300
Gly Asp Ile Tyr Asn Phe Arg Leu Trp Asn Phe Thr Met Asn Ala Lys
305 310 315 320
Ile Leu Ser Asn Leu Ser Cys Asn Val Lys Gly Asn Val Val Asp Trp
325 330 335
Gln Asn Asp Phe Trp Asn Ile Pro Asn Leu Ala Leu Lys Ala Glu Ser
340 345 350
Asn Leu Ser Cys Gly Ser Tyr Leu Ile Pro Leu Pro Ala Ala Glu Leu
355 360 365
Ala Ser Cys Ala Asp Leu Gly Thr Leu Cys Gln Asp Gly Ile Ile Tyr
370 375 380
Arg Ile Ser Val Val Ile Gln Asn Ile Leu Arg His Pro Glu Val Lys
385 390 395 400
Val Gln Ser Lys Val Ala Glu Trp Leu Asn Ser Thr Phe Gln Asn Trp
405 410 415
Asn Tyr Thr Val Tyr Val Val Asn Ile Ser Phe His Leu Ser Ala Gly
420 425 430
Glu Asp Lys Ile Lys Val Lys Arg Ser Leu Glu Asp Glu Pro Arg Leu
435 440 445
Val Leu Trp Ala Leu Leu Val Tyr Asn Ala Thr Asn Asn Thr Asn Leu
450 455 460
Glu Gly Lys Ile Ile Gln Gln Lys Leu Leu Lys Asn Asn Glu Ser Leu
465 470 475 480
Asp Glu Gly Leu Arg Leu His Thr Val Asn Val Arg Gln Leu Gly His
485 490 495
Cys Leu Ala Met Glu Glu Pro Lys Gly Tyr Tyr Trp Pro Ser Ile Gln
500 505 510
Pro Ser Glu Tyr Val Leu Pro Cys Pro Asp Lys Pro Gly Phe Ser Ala
515 520 525
Ser Arg Ile Cys Phe Tyr Asn Ala Thr Asn Pro Leu Val Thr Tyr Trp
530 535 540
Gly Pro Val Asp Ile Ser Asn Cys Leu Lys Glu Ala Asn Glu Val Ala
545 550 555 560
Asn Gln Ile Leu Asn Leu Thr Ala Asp Gly Gln Asn Leu Thr Ser Ala
565 570 575
Asn Ile Thr Asn Ile Val Glu Gln Val Lys Arg Ile Val Asn Lys Glu
580 585 590
Glu Asn Ile Asp Ile Thr Leu Gly Ser Thr Leu Met Asn Ile Phe Ser
595 600 605
Asn Ile Leu Ser Ser Ser Asp Ser Asp Leu Leu Glu Ser Ser Ser Glu
610 615 620
Ala Leu Lys Thr Ile Asp Glu Leu Ala Phe Lys Ile Asp Leu Asn Ser
625 630 635 640
Thr Ser His Val Asn Ile Thr Thr Arg Asn Leu Ala Leu Ser Val Ser
645 650 655
Ser Leu Leu Pro Gly Thr Asn Ala Ile Ser Asn Phe Ser Ile Gly Leu
660 665 670
Pro Ser Asn Asn Glu Ser Tyr Phe Gln Met Asp Phe Glu Ser Gly Gln
675 680 685
Val Asp Pro Leu Ala Ser Val Ile Leu Pro Pro Asn Leu Leu Glu Asn
690 695 700
Leu Ser Pro Glu Asp Ser Val Leu Val Arg Arg Ala Gln Phe Thr Phe
705 710 715 720
Phe Asn Lys Thr Gly Leu Phe Gln Asp Val Gly Pro Gln Arg Lys Thr
725 730 735
Leu Val Ser Tyr Val Met Ala Cys Ser Ile Gly Asn Ile Thr Ile Gln
740 745 750
Asn Leu Lys Asp Pro Val Gln Ile Lys Ile Lys His Thr Arg Thr Gln
755 760 765
Glu Val His His Pro Ile Cys Ala Phe Trp Asp Leu Asn Lys Asn Lys
770 775 ~ 780
Ser Phe Gly Gly Trp Asn Thr Ser Gly Cys Val Ala His Arg Asp Ser
785 790 795 800
47 / 87
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
Asp Ala Ser Glu Thr Val Cys Leu Cys Asn His Phe Thr His Phe Gly
805 810 815
Val Leu Met Asp Leu Pro Arg Ser Ala Ser Gln Leu Asp Ala Arg Asn
820 825 830
Thr Lys Val Leu Thr Phe Ile Ser Tyr Ile Gly Cys Gly Ile Ser Ala
835 840 845
Ile Phe Ser Ala Ala Thr Leu Leu Thr Tyr Val Ala Phe Glu Lys Leu
850 855 860
Arg Arg Asp Tyr Pro Ser Lys Ile Leu Met Asn Leu Ser Thr Ala Leu
865 870 875 880
Leu Phe Leu Asn Leu Leu Phe Leu Leu Asp Gly Trp Ile Thr Ser Phe
885 890 895
Asn Val Asp Gly Leu Cys Ile Ala Val Ala Val Leu Leu His Phe Phe
900 905 910
Leu Leu Ala Thr Phe Thr Trp Met Gly Leu Glu Ala Ile His Met Tyr
915 920 925
Ile Ala Leu Val Lys Val Phe Asn Thr Tyr Ile Arg Arg Tyr Ile Leu
930 935 940
Lys Phe Cys Ile Ile Gly Trp Gly Leu Pro Ala Leu Val Val Ser Val
945 950 955 960
Val Leu Ala Ser Arg Asn Asn Asn Glu Val Tyr Gly Lys Glu Ser Tyr
965 970 975
Gly Lys Glu Lys Gly Asp Glu Phe Cys Trp Ile Gln Asp Pro Val Ile
980 985 990
Phe Tyr Val Thr Cys Ala Gly Tyr Phe Gly Val Met Phe Phe Leu Asn
995 1000 1005
Ile Ala Met Phe Ile Val Val Met Val Gln Ile Cys Gly Arg Asn Gly
1010 1015 1020
Lys Arg Ser Asn Arg Thr Leu Arg Glu Glu Val Leu Arg Asn Leu Arg
1025 1030 1035 1040
Ser Val Val Ser Leu Thr Phe Leu Leu Gly Met Thr Trp Gly Phe Ala
1045 1050 1055
Phe Phe Ala Trp Gly Pro Leu Asn Ile Pro Phe Met Tyr Leu Phe Ser
1060 1065 1070
Ile Phe Asn Ser Leu Gln Gly Leu Phe Ile Phe Ile Phe His Cys Ala
1075 1080 1085
Met Lys Glu Asn Val Gln Lys Gln Trp Arg Arg His Leu Cys Cys Gly
1090 1095 1100
Arg Phe Arg Leu Ala Asp Asn Ser Asp Trp Ser Lys Thr Ala Thr Asn
1105 1110 1115 1120
Ile Ile Lys Lys Ser Ser Asp Asn Leu Gly Lys Ser Leu Ser Ser Ser
1125 1130 1135
Ser Ile Gly Ser Asn Ser Thr Tyr Leu Thr Ser Lys Ser Lys Ser Ser
1140 1145 1150
Ser Thr Thr Tyr Phe Lys Arg Asn Ser His Thr Asp Ser Ala Ser Met
1155 1160 1165
Asp Lys Ser Leu Ser Lys Leu Ala His Ala Asp Gly Asp Gln Thr Ser
1170 1175 1180
Ile Ile Pro Val His Gln Val Ile Asp Lys Val Lys Gly Tyr Cys Asn
1185 1190 1195 1200
Ala His Ser Asp Asn Phe Tyr Lys Asn Ile Ile Met Ser Asp Thr Phe
1205 1210 1215
Ser His Ser Thr Lys Phe
1220
<210> 35
<211> 3582
<212> DNA
<213> homo sapiens
<400> 35
atgtttcgct cagatcgaat gtggagctgc cattggaaat ggaagcccag tcctctcctg 60
ttcttatttg ctttatatat catgtgtgtt cctcactcag cagtgtgggg atgtgccaac 120
48 / 87
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
tgccgagtggttttgtccaacccttctgggacctttacttctccatgctaccctaacgac 180
tacccaaacagccaggcttgcatgtggacgctccgagcccccaccggttatatcattcag 240
ataacatttaacgactttgacattgaagaagctcccaattgcatttatgactcattatcc 300
cttgataatggagagagccagactaaattttgtggagcaactgccaaaggcctatcattt 360
aactcaagtgcgaatgagatgcatgtgtccttttcaagtgactttagcatccagaagaaa 420
ggtttcaatgccagctacatcagagttgccgtgtccttaaggaatcaaaaggtcatttta 480
ccccagacatcagatgcttaccaggtatctgttgcaaaaagcatctctattccagagctc 540
agtgctttcacactctgctttgaagcaaccaaagttggccatgaagacagtgattggaca 600
gctttctcctactcaaatgcatccttcacacaattgctcagttttggaaaggccaagagt 660
ggctactttctatccatttctgattcaaaatgtttgttgaataatgcattacctgtcaaa 720
gaaaaagaagacatttttgcagaaagctttgaacagctctgccttgtttggaataattct 780
ttgggctctattggtgtaaatttcaaaagaaactatgaaacagttccatgtgattctacc 840
attagtaaagttattcctgggaatgggaaattgttgttgggctccaatcaaaatgaaatt 900
gtctctctaaaaggggacatttataactttcgactttggaattttaccatgaatgccaaa 960
atcctctccaacctcagctgtaatgtgaaagggaatgtagtcgactggcaaaatgacttc 1020
tggaatatcccaaacctagctctgaaagctgaaagcaacctaagctgtggttcctacctg 1080
atcccgctcccagcagcagaactggccagctgtgcagacctggggaccctctgtcaagat 1140
ggaattatctatagaatatccgtagtgattcagaacatccttcgtcaccctgaggtaaaa 1200
gtacagagcaaggtggcagaatggctcaattcaaccttccaaaattggaactacacggtt 1260
tatgtcgttaatatcagttttcacctgagtgctggagaggacaagattaaagtcaagaga 1320
agccttgaggatgagccaaggttggtgctttgggcccttctagtttacaatgctaccaac 1380
aatactaatttagaaggaaaaatcattcagcagaagctcctaaaaaataatgagtccttg 1440
gatgaaggcttgaggctacatacagtgaatgtgagacaactgggtcattgtcttgccatg 1500
gaggaacccaaaggctactactggccatctatccaaccttctgaatacgttcttccttgt 1560
ccagacaagcctggcttttctgcttctcggatatgtttttacaatgctaccaacccattg 1620
gtaacctactggggacctgttgatatctccaactgtttaaaagaagcaaatgaagttgct 1680
aaccagattttaaatttaactgctgatgggcagaacttaacctcagccaatattaccaac 1740
attgtggaacaggtcaaaagaattgtgaataaagaagaaaacattgatataacacttggc 1800
tcaactctaatgaatatattttctaatatcttaagcagttcagacagtgacttgcttgag 1860
tcatcttctgaagctttaaaaacaattgatgaattggccttcaagatagacctaaatagc 1920
acatcacatgtgaatattacaactcggaacttggctctcagcgtatcatccctgttacca 1980
gggacaaatgcaatttcaaattttagcattggtcttccaagcaataatgaatcgtatttc 2040
cagatggattttgagagtggacaagtggatccactggcatctgtaattttgcctccaaac 2100
ttacttgagaatttaagtccagaagattctgtattagttagaagagcacagtttactttc 2160
ttcaacaaaactggacttttccaggatgtaggaccccaaagaaaaactttagtgagttat 2220
gtgatggcgtgcagtattggaaacattactatccagaatctgaaggatcctgttcaaata 2280
aaaatcaaacatacaagaactcaggaagtgcatcatcccatctgtgccttctgggatctg 2340
aacaaaaacaaaagttttggaggatggaacacgtcaggatgtgttgcacacagagattca 2400
gatgcaagtgagacagtctgcctgtgtaaccacttcacacactttggagttctgatggac 2460
cttccaagaagtgcctcacagttagatgcaagaaacactaaagtcctcactttcatcagc 2520
tatattgggtgtggaatatctgctattttttcagcagcaactctcctgacatatgttgct 2580
tttgagaaattgcgaagggattatccctccaaaatcttgatgaacctgagcacagccctg 2640
ctgttcctgaatctcctcttcctcctagatggctggatcacctccttcaatgtggatgga 2700
ctttgcattgctgttgcagtcctgttgcatttcttccttctggcaacctttacctggatg 2760
gggctagaagcaattcacatgtacattgctctagttaaagtatttaacacttacattcgc 2820
cgatacattctaaaattctgcatcattggctggggtttgcctgccttagtggtgtcagtt 2880
gttctagcgagcagaaacaacaatgaagtctatggaaaagaaagttatgggaaagaaaaa 2940
ggtgatgaattctgttggattcaagatccagtcatattttatgtgacctgtgctgggtat 3000
tttggagtcatgttttttctgaacattgccatgttcattgtggtaatggtgcagatctgt 3060
gggaggaatggcaagagaagcaaccggaccctgagagaagaagtgttaaggaacctgcgc 3120
agtgtggttagcttgacctttctgttgggcatgacatggggttttgcattctttgcctgg 3180
ggacccttaaatatccccttcatgtacctcttctccatcttcaattcattacaaggctta 3240
tttatattcatcttccactgtgctatgaaggagaatgttcagaaacagtggcggcggcat 3300
ctctgctgtggtagatttcggttagcagataactcagattggagtaagacagctaccaat 3360
atcatcaagaaaagttctgataatctaggaaaatctttgtcttcaagctccattggttcc 3420
aactcaacctatcttacatccaaatctaaatccagctctaccacctatttcaaaaggaat 3480
agccacacagataatgtctcctatgagcattccttcaacaaaagtggatcactcagacag 3540
tgcttccatggacaagtccttgtcaaaactggcccatgctga 3582
<210> 36
<211> 1193
<212> PRT
<213> homo Sapiens
49 / 87
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
<400> 36
Met Phe Arg Ser Asp Arg Met Trp Ser Cys His Trp Lys Trp Lys Pro
1 5 10 15
Ser Pro Leu Leu Phe Leu Phe Ala Leu Tyr Ile Met Cys Val Pro His
20 25 30
Ser Ala Val Trp Gly Cys Ala Asn Cys Arg Val Val Leu Ser Asn Pro
35 40 45
Ser Gly Thr Phe Thr Ser Pro Cys Tyr Pro Asn Asp Tyr Pro Asn Ser
50 55 60
Gln Ala Cys Met Trp Thr Leu Arg Ala Pro Thr Gly Tyr Ile Ile Gln
65 70 75 80
Ile Thr Phe Asn Asp Phe Asp Ile Glu Glu Ala Pro Asn Cys Ile Tyr
85 90 95
Asp Ser Leu Ser Leu Asp Asn Gly Glu Ser Gln Thr Lys Phe Cys Gly
100 105 110
Ala Thr Ala Lys Gly Leu Ser Phe Asn Ser Ser Ala Asn Glu Met His
115 120 125
Val Ser Phe Ser Ser Asp Phe Ser Ile Gln Lys Lys Gly Phe Asn Ala
130 135 140
Ser Tyr Ile Arg Val Ala Val Ser Leu Arg Asn Gln Lys Val Ile Leu
145 150 155 160
Pro Gln Thr Ser Asp Ala Tyr Gln Val Ser Val Ala Lys Ser Ile Ser
165 170 175
Ile Pro Glu Leu Ser Ala Phe Thr Leu Cys Phe Glu Ala Thr Lys Val
180 185 190
Gly His Glu Asp Ser Asp Trp Thr Ala Phe Ser Tyr Ser Asn Ala Ser
195 200 205
Phe Thr Gln Leu Leu Ser Phe Gly Lys Ala Lys Ser Gly Tyr Phe Leu
210 215 220
Ser Ile Ser Asp Ser Lys Cys Leu Leu Asn Asn Ala Leu Pro Val Lys
225 230 235 240
Glu Lys Glu Asp Ile Phe Ala Glu Ser Phe Glu Gln Leu Cys Leu Val
245 250 255
Trp Asn Asn Ser Leu Gly Ser Ile Gly Val Asn Phe Lys Arg Asn Tyr
260 265 270
Glu Thr Val Pro Cys Asp Ser Thr Ile Ser Lys Val Ile Pro Gly Asn
275 280 285
Gly Lys Leu Leu Leu Gly Ser Asn Gln Asn Glu Ile Val Ser Leu Lys
290 295 300
Gly Asp Ile Tyr Asn Phe Arg Leu Trp Asn Phe Thr Met Asn Ala Lys
305 310 315 320
Ile Leu Ser Asn Leu Ser Cys Asn Val Lys Gly Asn Val Val Asp Trp
325 330 335
Gln Asn Asp Phe Trp Asn Ile Pro Asn Leu Ala Leu Lys Ala Glu Ser
340 345 350
Asn Leu Ser Cys Gly Ser Tyr Leu Ile Pro Leu Pro Ala Ala Glu Leu
355 360 365
Ala Ser Cys Ala Asp Leu Gly Thr Leu Cys Gln Asp Gly Ile Ile Tyr
370 ~ 375 380
Arg Ile Ser Val Val Ile Gln Asn Ile Leu Arg His Pro Glu Val Lys
385 390 395 400
Val Gln Ser Lys Val Ala Glu Trp Leu Asn Ser Thr Phe Gln Asn Trp
405 410 415
Asn Tyr Thr Val Tyr Val Val Asn Ile Ser Phe His Leu Ser Ala Gly
420 425 430
Glu Asp Lys Ile Lys Val Lys Arg Ser Leu Glu Asp Glu Pro Arg Leu
435 440 445
Val Leu Trp Ala Leu Leu Val Tyr Asn Ala Thr Asn Asn Thr Asn Leu
450 455 460
Glu Gly Lys Ile Ile Gln Gln Lys Leu Leu Lys Asn Asn Glu Ser Leu
465 470 475 480
Asp Glu Gly Leu Arg Leu His Thr Val Asn Val Arg Gln Leu Gly His
485 490 495
50 / 87
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
Cys Leu Ala Met Glu Glu Pro Lys Gly Tyr Tyr Trp Pro Ser Ile Gln
500 505 510
Pro Ser Glu Tyr Val Leu Pro Cys Pro Asp Lys Pro Gly Phe Ser Ala
515 520 525
Ser Arg Ile Cys Phe Tyr Asn Ala Thr Asn Pro Leu Val Thr Tyr Trp
530 535 540
Gly Pro Val Asp Ile Ser Asn Cys Leu Lys Glu Ala Asn Glu Val Ala
545 550 555 560
Asn Gln Ile Leu Asn Leu Thr Ala Asp Gly Gln Asn Leu Thr Ser Ala
565 570 575
Asn Ile Thr Asn Ile Val Glu Gln Val Lys Arg Ile Val Asn Lys Glu
580 585 590
Glu Asn Ile Asp Ile Thr Leu Gly Ser Thr Leu Met Asn Ile Phe Ser
595 600 605
Asn Ile Leu Ser Ser Ser Asp Ser Asp Leu Leu Glu Ser Ser Ser Glu
610 615 620
Ala Leu Lys Thr Ile Asp Glu Leu Ala Phe Lys Ile Asp Leu Asn Ser
625 630 635 640
Thr Ser His Val Asn Ile Thr Thr Arg Asn Leu Ala Leu Ser Val Ser
645 650 655
Ser Leu Leu Pro Gly Thr Asn Ala Ile Ser Asn Phe Ser Ile Gly Leu
660 665 670
Pro Ser Asn Asn Glu Ser Tyr Phe Gln Met Asp Phe Glu Ser Gly Gln
675 680 685
Val Asp Pro Leu Ala Ser Val Ile Leu Pro Pro Asn Leu Leu Glu Asn
690 695 700
Leu Ser Pro Glu Asp Ser Val Leu Val Arg Arg Ala Gln Phe Thr Phe
705 710 715 720
Phe Asn Lys Thr Gly Leu Phe Gln Asp Val Gly Pro Gln Arg Lys Thr
725 730 735
Leu Val Ser Tyr Val Met Ala Cys Ser Ile Gly Asn Ile Thr Ile Gln
740 745 750
Asn Leu Lys Asp Pro Val Gln Ile Lys Ile Lys His Thr Arg Thr Gln
755 760 765
Glu Val His His Pro Ile Cys Ala Phe Trp Asp Leu Asn Lys Asn Lys
770 775 780
Ser Phe Gly Gly Trp Asn Thr Ser Gly Cys Val Ala His Arg Asp Ser
785 790 795 800
Asp Ala Ser Glu Thr Val Cys Leu Cys Asn His Phe Thr His Phe Gly
805 810 815
Val Leu Met Asp Leu Pro Arg Ser Ala Ser Gln Leu Asp Ala Arg Asn
820 825 830
Thr Lys Val Leu Thr Phe Ile Ser Tyr Ile Gly Cys Gly Ile Ser Ala
835 840 845
Ile Phe Ser Ala Ala Thr Leu Leu Thr Tyr Val Ala Phe Glu Lys Leu
850 855 860
Arg Arg Asp Tyr Pro Ser Lys Ile Leu Met Asn Leu Ser Thr Ala Leu
865 870 875 880
Leu Phe Leu Asn Leu Leu Phe Leu Leu Asp Gly Trp Ile Thr Ser Phe
885 890 895
Asn Val Asp Gly Leu Cys Ile Ala Val Ala Val Leu Leu His Phe Phe
900 905 910
Leu Leu Ala Thr Phe Thr Trp Met Gly Leu Glu Ala Ile His Met Tyr
.915 920 925
Ile Ala Leu Val Lys Val Phe Asn Thr Tyr Ile Arg Arg Tyr Ile Leu
930 935 940
Lys Phe Cys Ile Ile Gly Trp Gly Leu Pro Ala Leu Val Val Ser Val
945 950 955 960
Val Leu Ala Ser Arg Asn Asn Asn Glu Val Tyr Gly Lys Glu Ser Tyr
965 970 975
Gly Lys Glu Lys Gly Asp Glu Phe Cys Trp Ile Gln Asp Pro Val Ile
980 985 990
Phe Tyr Val Thr Cys Ala Gly Tyr Phe Gly Val Met Phe Phe Leu Asn
51 / 87
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
995 1000 1005
Ile Ala Met Phe Ile Val Val Met Val Gln Ile Cys Gly Arg Asn Gly
1010 1015 1020
Lys Arg Ser Asn Arg Thr Leu Arg Glu Glu Val Leu Arg Asn Leu Arg
1025 1030 1035 1040
Ser Val Val Ser Leu Thr Phe Leu Leu Gly Met Thr Trp Gly Phe Ala
1045 1050 1055
Phe Phe Ala Trp Gly Pro Leu Asn Ile Pro Phe Met Tyr Leu Phe Ser
1060 1065 1070
Ile Phe Asn Ser Leu Gln Gly Leu Phe Ile Phe Ile Phe His Cys Ala
1075 1080 1085
Met Lys Glu Asn Val Gln Lys Gln Trp Arg Arg His Leu Cys Cys Gly
1090 1095 1100
Arg Phe Arg Leu Ala Asp Asn Ser Asp Trp Ser Lys Thr Ala Thr Asn
1105 1110 1115 1120
Ile Ile Lys Lys Ser Ser Asp Asn Leu Gly Lys Ser Leu Ser Ser Ser
1125 1130 1135
Ser Ile Gly Ser Asn Ser Thr Tyr Leu Thr Ser Lys Ser Lys Ser Ser
1140 1145 1150
Ser Thr Thr Tyr Phe Lys Arg Asn Ser His Thr Asp Asn Val Ser Tyr
1155 1160 1165
Glu His Ser Phe Asn Lys Ser Gly Ser Leu Arg Gln Cys Phe His Gly
1170 1175 1180
Gln Val Leu Val Lys Thr Gly Pro Cys
1185 1190
<210> 37
<211> 2073
<212> DNA
<213> homo Sapiens
<400> 37
atgtttcgctcagatcgaatgtggagctgccattggaaatggaagcccagtcctctcctg 60
ttcttatttgctttatatatcatgtgtgttcctcactcagcagtgtggggatgtgccaac 120
tgccgagtggttttgtccaacccttctgggacctttacttctccatgctaccctaacgac 180
tacccaaacagccaggcttgcatgtggacgctccgagcccccaccggttatatcattcag 240
ataacatttaacgactttgacattgaagaagctcccaattgcatttatgactcattatcc 300
cttgataatggagagagccagactaaattttgtggagcaactgccaaaggcctatcattt 360
aactcaagtgcgaatgagatgcatgtgtccttttcaagtgactttagcatccagaagaaa 420
ggtttcaatgccagctacatcagagttgccgtgtccttaaggaatcaaaaggtcatttta 480
ccccagacatcagatgcttaccaggtatctgttgcaaaaagcatctctattccagagctc 540
agtgctttcacactctgctttgaagcaaccaaagttggccatgaagacagtgattggaca 600
gctttctcctactcaaatgcatccttcacacaattgctcagttttggaaaggccaagagt 660
ggctactttctatccatttctgattcaaaatgtttgttgaataatgcattacctgtcaaa 720
gaaaaagaagacatttttgcagaaagctttgaacagctctgccttgtttggaataattct 780
ttgggctctattggtgtaaatttcaaaagaaactatgaaacagttccatgtgattctacc 840
attagtaaagttattcctgggaatgggaaattgttgttgggctccaatcaaaatgaaatt 900
gtctctctaaaaggggacatttataactttcgactttggaattttaccatgaatgccaaa 960
atcctctccaacctcagctgtaatgtgaaagggaatgtagtcgactggcaaaatgacttc 1020
tggaatatcccaaacctagctctgaaagctgaaagcaacctaagctgtggttcctacctg 1080
atcccgctcccagcagcagaactggccagctgtgcagacctggggaccctctgtcaagat 1140
ggaattatctatagaatatccgtagtgattcagaacatccttcgtcaccctgaggtaaaa 1200
gtacagagcaaggtggcagaatggctcaattcaaccttccaaaattggaactacacggtt 1260
tatgtcgttaatatcagttttcacctgagtgctggagaggacaagattaaagtcaagaga 1320
agccttgaggatgagccaaggttggtgctttgggcccttctagtttacaatgctaccaac 1380
aatactaatttagaaggaaaaatcattcagcagaagctcctaaaaaataatgagtccttg 1440
gatgaaggcttgaggctacatacagtgaatgtgagacaactgggtcattgtcttgccatg 1500
gaggaacccaaaggctactactggccatctatccaaccttctgaatacgttcttccttgt 1560
ccagacaagcctggcttttctgcttctcggatatgtttttacaatgctaccaacccattg 1620
gtaacctactggggacctgttgatatctccaactgtttaaaagaagcaaatgaagttgct 1680
aaccagattttaaatttaactgctgatgggcagaacttaacctcagccaatattaccaac 1740
attgtggaacaggtcaaaagaattgtgaataaagaagaaaacattgatataacacttggc 1800
tcaactctaatgaatatattttctaatatcttaagcagttcagacagtgacttgcttgag 1860
52 / 87
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
tcatcttctg aagctttaaa aacaattgat gaattggcct tcaagataga cctaaatagc 1920
acatcacatg tgaatattac aactcggaac ttggctctca gcgtatcatc cctgttacca 1980
gggacaaatg caatttcaaa ttttagcatt ggtcttccaa gcaataatga atcgtatttc 2040
caggtaatga gccagtggtt tctttcattt taa 2073
<210> 38
<211> 690
<212> PRT
<213> homo Sapiens
<400> 38
Met Phe Arg Ser Asp Arg Met Trp Ser Cys His Trp Lys Trp Lys Pro
1 5 10 15
Ser Pro Leu Leu Phe Leu Phe Ala Leu Tyr Ile Met Cys Val Pro His
20 25 30
Ser Ala Val Trp Gly Cys Ala Asn Cys Arg Val Val Leu Ser Asn Pro
35 40 45
Ser Gly Thr Phe Thr Ser Pro Cys Tyr Pro Asn Asp Tyr Pro Asn Ser
50 55 60
Gln Ala Cys Met Trp Thr Leu Arg Ala Pro Thr Gly Tyr Ile Ile Gln
65 70 75 80
Ile Thr Phe Asn Asp Phe Asp Ile Glu Glu Ala Pro Asn Cys Ile Tyr
85 90 95
Asp Ser Leu Ser Leu Asp Asn Gly Glu Ser Gln Thr Lys Phe Cys Gly
100 105 110
Ala Thr Ala Lys Gly Leu Ser Phe Asn Ser Ser Ala Asn Glu Met His
115 120 125
Val Ser Phe Ser Ser Asp Phe Ser Ile Gln Lys Lys Gly Phe Asn Ala
130 135 140
Ser Tyr Ile Arg Val Ala Val Ser Leu Arg Asn Gln Lys Val Ile Leu
145 150 155 160
Pro Gln Thr Ser Asp Ala Tyr Gln Val Ser Val Ala Lys Ser Ile Ser
165 170 175
Ile Pro Glu Leu Ser Ala Phe Thr Leu Cys Phe Glu Ala Thr Lys Val
180 185 190
Gly His Glu Asp Ser Asp Trp Thr Ala Phe Ser Tyr Ser Asn Ala Ser
195 200 205
Phe Thr Gln Leu Leu Ser Phe Gly Lys Ala Lys Ser Gly Tyr Phe Leu
210 215 220
Ser Ile Ser Asp Ser Lys Cys Leu Leu Asn Asn Ala Leu Pro Val Lys
225 230 235 240
Glu Lys Glu Asp Ile Phe Ala Glu Ser Phe Glu Gln Leu Cys Leu Val
245 250 255
Trp Asn Asn Ser Leu Gly Ser Ile Gly Val Asn Phe Lys Arg Asn Tyr
260 265 270
Glu Thr Val Pro Cys Asp Ser Thr Ile Ser Lys Val Ile Pro Gly Asn
275 280 285
Gly Lys Leu Leu Leu Gly Ser Asn Gln Asn Glu Ile Val Ser Leu Lys
290 295 300
Gly Asp Ile Tyr Asn Phe Arg Leu Trp Asn Phe Thr Met Asn Ala Lys
305 310 315 320
Ile Leu Ser Asn Leu Ser Cys Asn Val Lys Gly Asn Val Val Asp Trp
325 330 335
Gln Asn Asp Phe Trp Asn Ile Pro Asn Leu Ala Leu Lys Ala Glu Ser
340 345 350
Asn Leu Ser Cys Gly Ser Tyr Leu Ile Pro Leu Pro Ala Ala Glu Leu
355 360 365
Ala Ser Cys Ala Asp Leu Gly Thr Leu Cys Gln Asp Gly Ile Ile Tyr
370 375 380
Arg Ile Ser Val Val Ile Gln Asn Ile Leu Arg His Pro Glu Val Lys
385 390 395 400
Val Gln Ser Lys Val Ala Glu Trp Leu Asn Ser Thr Phe Gln Asn Trp
405 410 415
53 / 87
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
Asn Tyr Thr Val Tyr Val Val Asn Ile Ser Phe His Leu Ser Ala Gly
420 425 430
Glu Asp Lys Ile Lys Val Lys Arg Ser Leu Glu Asp Glu Pro Arg Leu
435 440 445
Val Leu Trp Ala Leu Leu Val Tyr Asn Ala Thr Asn Asn Thr Asn Leu
450 455 460
Glu Gly Lys Ile Ile Gln Gln Lys Leu Leu Lys Asn Asn Glu Ser Leu
465 470 475 480
Asp Glu Gly Leu Arg Leu His Thr Val Asn Val Arg Gln Leu Gly His
485 490 495
Cys Leu Ala Met Glu Glu Pro Lys Gly Tyr Tyr Trp Pro Ser Ile Gln
500 505 510
Pro Ser Glu Tyr Val Leu Pro Cys Pro Asp Lys Pro Gly Phe Ser Ala
515 520 525
Ser Arg Ile Cys Phe Tyr Asn Ala Thr Asn Pro Leu Val Thr Tyr Trp
530 535 540
Gly Pro Val Asp Ile Ser Asn Cys Leu Lys Glu Ala Asn Glu Val Ala
545 550 555 560
Asn Gln Ile Leu Asn Leu Thr Ala Asp Gly Gln Asn Leu Thr Ser Ala
565 570 575
Asn Ile Thr Asn Ile Val Glu Gln Val Lys Arg Ile Val Asn Lys Glu
580 585 590
Glu Asn Ile Asp Ile Thr Leu Gly Ser Thr Leu Met Asn Ile Phe Ser
595 600 605
Asn Ile Leu Ser Ser Ser Asp Ser Asp Leu Leu Glu Ser Ser Ser Glu
610 615 620
Ala Leu Lys Thr Ile Asp Glu Leu Ala Phe Lys Ile Asp Leu Asn Ser
625 630 635 640
Thr Ser His Val Asn Ile Thr Thr Arg Asn Leu Ala Leu Ser Val Ser
645 650 655
Ser Leu Leu Pro Gly Thr Asn Ala Ile Ser Asn Phe Ser Ile Gly Leu
660 665 670
Pro Ser Asn Asn Glu Ser Tyr Phe Gln Val Met Ser Gln Trp Phe Leu
675 680 685
Ser Phe
690
<210> 39
<211> 3255
<212> DNA
<213> homo sapiens
<400>
39
atgtttcgctcagatcgaatgtggagctgccattggaaatggaagcccagtcctctcctg60
ttcttatttgctttatatatcatgtgtgttcctcactcagcagtgtggggatgtgccaac120
tgccgagtggttttgtccaacccttctgggacctttacttctccatgctaccctaacgac180
tacccaaacagccaggcttgcatgtggacgctccgagcccccaccggttatatcattcag240
ataacatttaacgactttgacattgaagaagctcccaattgcatttatgactcattatcc300
cttgataatggagagagccagactaaattttgtggagcaactgccaaaggcctatcattt360
aactcaagtgcgaatgagatgcatgtgtccttttcaagtgactttagcatccagaagaaa420
ggtttcaatgccagctacatcagagttgccgtgtccttaaggaatcaaaaggtcatttta480
ccccagacatcagatgcttaccaggtatctgttgcaaaaagcatctctattccagagctc540
agtgctttcacactctgctttgaagcaaccaaagttggccatgaagacagtgattggaca600
gctttctcctactcaaatgcatccttcacacaattgctcagttttggaaaggccaagagt660
ggctactttctatccatttctgattcaaaatgtttgttgaataatgcattacctgtcaaa720
gaaaaagaagacatttttgcagaaagctttgaacagctctgccttgtttggaataattct780
ttgggctctattggtgtaaatttcaaaagaaactatgaaacagttccatgtgattctacc840
attagtaaagttattcctgggaatgggaaattgttgttgggctccaatcaaaatgaaatt900
gtctctctaaaaggggacatttataactttcgactttggaattttaccatgaatgccaaa960
atcctctccaacctcagctgtaatgtgaaagggaatgtagtcgactggcaaaatgacttc1020
tggaatatcccaaacctagctctgaaagctgaaagcaacctaagctgtggttcctacctg1080
atcccgctcccagcagcagaactggccagctgtgcagacctggggaccctctgtcaagat1140
ggaattatctatagaatatccgtagtgattcagaacatccttcgtcaccctgaggtaaaa1200
54 / 87
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
gtacagagcaaggtggcagaatggctcaattcaaccttccaaaattggaactacacggtt 1260
tatgtcgttaatatcagttttcacctgagtgctggagaggacaagattaaagtcaagaga 1320
agccttgaggatgagccaaggttggtgctttgggcccttctagtttacaatgctaccaac 1380
aatactaatttagaaggaaaaatcattcagcagaagctcctaaaaaataatgagtccttg 1440
gatgaaggcttgaggctacatacagtgaatgtgagacaactgggtcattgtcttgccatg 1500
gaggaacccaaaggctactactggccatctatccaaccttctgaatacgttcttccttgt 1560
ccagacaagcctggcttttctgcttctcggatatgtttttacaatgctaccaacccattg 1620
gtaacctactggggacctgttgatatctccaactgtttaaaagaagcaaatgaagttgct 1680
aaccagattttaaatttaactgctgatgggcagaacttaacctcagccaatattaccaac 1740
attgtggaacaggtcaaaagaattgtgaataaagaagaaaacattgatataacacttggc 1800
tcaactctaatgaatatattttctaatatcttaagcagttcagacagtgacttgcttgag 1860
tcatcttctgaagctttaaaaacaattgatgaattggccttcaagatagacctaaatagc 1920
acatcacatgtgaatattacaactcggaacttggctctcagcgtatcatccctgttacca 1980
gggacaaatgcaatttcaaattttagcattggtcttccaagcaataatgaatcgtatttc 2040
cagatggattttgagagtggacaagtggatccactggcatctgtaattttgcctccaaac 2100
ttacttgagaatttaagtccagaagattctgtattagttagaagagcacagtttactttc 2160
ttcaacaaaactggacttttccaggatgtaggaccccaaagaaaaactttagtgagttat 2220
gtgatggcgtgcagtattggaaacattactatccagaatctgaaggatcctgttcaaata 2280
aaaatcaaacatacaagaactcaggaagtgcatcatcccatctgtgccttctgggatctg 2340
aacaaaaacaaaagttttggaggatggaacacgtcaggatgtgttgcacacagagattca 2400
gatgcaagtgagacagtctgcctgtgtaaccacttcacacactttggagttctgatggac 2460
cttccaagaagtgcctcacagttagatgcaagaaacactaaagtcctcactttcatcagc 2520
tatattgggtgtggaatatctgctattttttcagcagcaactctcctgacatatgttgct 2580
tttgagaaattgcgaagggattatccctccaaaatcttgatgaacctgagcacagccctg 2640
ctgttcctgaatctcctcttcctcctagatggctggatcacctccttcaatgtggatgga 2700
ctttgcattgctgttgcagtcctgttgcatttcttccttctggcaacctttacctggatg 2760
gggctagaagcaattcacatgtacattgctctagttaaagtatttaacacttacattcgc 2820
cgatacattctaaaattctgcatcattggctggggtttgcctgccttagtggtgtcagtt 2880
gttctagcgagcagaaacaacaatgaagtctatggaaaagaaagttatgggaaagaaaaa 2940
ggtgatgaattctgttggattcaagatccagtcatattttatgtgacctgtgctgggtat 3000
tttggagtcatgttttttctgaacattgccatgttcattgtggtaatggtgcagatctgt 3060
gggaggaatggcaagagaagcaaccggaccctgagagaagaagtgttaaggaacctgcgc 3120
agtgtggttagcttgacctttctgttgggcatgacatggggttttgcattctttgcctgg 3180
ggacccttaaatatccccttcatgtacctcttctccatcttcaattcattacaaggtaag 3240
ataaattgtacatga 3255
<210> 40
<211> 1084
<212> PRT
<213> homo sapiens
<400> 40
Met Phe Arg Ser Asp Arg Met Trp Ser Cys His Trp Lys Trp Lys Pro
1 5 10 15
Ser Pro Leu Leu Phe Leu Phe Ala Leu Tyr Ile Met Cys Val Pro His
20 25 30
Ser Ala Val Trp Gly Cys Ala Asn Cys Arg Val Val Leu Ser Asn Pro
35 40 45
Ser Gly Thr Phe Thr Ser Pro Cys Tyr Pro Asn Asp Tyr Pro Asn Ser
50 55 60
Gln Ala Cys Met Trp Thr Leu Arg Ala Pro Thr Gly Tyr Ile Ile Gln
65 70 75 80
Ile Thr Phe Asn Asp Phe Asp Ile Glu Glu Ala Pro Asn Cys Ile Tyr
85 90 95
Asp Ser Leu Ser Leu Asp Asn Gly Glu Ser Gln Thr Lys Phe Cys Gly
100 105 110
Ala Thr Ala Lys Gly Leu Ser Phe Asn Ser Ser Ala Asn Glu Met His
115 120 125
Val Ser Phe Ser Ser Asp Phe Ser Ile Gln Lys Lys Gly Phe Asn Ala
130 135 140
Ser Tyr Ile Arg Val Ala Val Ser Leu Arg Asn Gln Lys Val Ile Leu
145 150 155 160
Pro Gln Thr Ser Asp Ala Tyr Gln Val Ser Val Ala Lys Ser Ile Ser
55 / 87
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
165 170 175
Ile Pro Glu Leu Ser Ala Phe Thr Leu Cys Phe Glu Ala Thr Lys Val
180 185 190
Gly His Glu Asp Ser Asp Trp Thr Ala Phe Ser Tyr Ser Asn Ala Ser
195 200 205
Phe Thr Gln Leu Leu Ser Phe Gly Lys Ala Lys Ser Gly Tyr Phe Leu
210 215 220
Ser Ile Ser Asp Ser Lys Cys Leu Leu Asn Asn Ala Leu Pro Val Lys
225 230 235 240
Glu Lys Glu Asp Ile Phe Ala Glu Ser Phe Glu Gln Leu Cys Leu Val
245 250 255
Trp Asn Asn Ser Leu Gly Ser Ile Gly Val Asn Phe Lys Arg Asn Tyr
260 265 270
Glu Thr Val Pro Cys Asp Ser Thr Ile Ser Lys Val Ile Pro Gly Asn
275 280 285
Gly Lys Leu Leu Leu Gly Ser Asn Gln Asn Glu Ile Val Ser Leu Lys
290 295 300
Gly Asp Ile Tyr Asn Phe Arg Leu Trp Asn Phe Thr Met Asn Ala Lys
305 310 315 320
Ile Leu Ser Asn Leu Ser Cys Asn Val Lys Gly Asn Val Val Asp Trp
325 330 335
Gln Asn Asp Phe Trp Asn Ile Pro Asn Leu Ala Leu Lys Ala Glu Ser
340 345 350
Asn Leu Ser Cys Gly Ser Tyr Leu Ile Pro Leu Pro Ala Ala Glu Leu
355 360 365
Ala Ser Cys Ala Asp Leu Gly Thr Leu Cys Gln Asp Gly Ile Ile Tyr
370 375 380
Arg Ile Ser Val Val Ile Gln Asn Ile Leu Arg His Pro Glu Val Lys
385 390 395 400
Val Gln Ser Lys Val Ala Glu Trp Leu Asn Ser Thr Phe Gln Asn Trp
405 410 415
Asn Tyr Thr Val Tyr Val Val Asn Ile Ser Phe His Leu Ser Ala Gly
420 425 430
Glu Asp Lys Ile Lys Val Lys Arg Ser Leu Glu Asp Glu Pro Arg Leu
435 440 445
Val Leu Trp Ala Leu Leu Val Tyr Asn Ala Thr Asn Asn Thr Asn Leu
450 455' 460
Glu Gly Lys Ile Ile Gln Gln Lys Leu Leu Lys Asn Asn Glu Ser Leu
465 470 475 480
Asp Glu Gly Leu Arg Leu Ibis Thr Val Asn Val Arg Gln Leu Gly His
485 490 495
Cys Leu Ala Met Glu Glu Pro Lys Gly Tyr Tyr Trp Pro Ser Ile Gln
500 505 510
Pro Ser Glu Tyr Val Leu Pro Cys Pro Asp Lys Pro Gly Phe Ser Ala
515 520 525
Ser Arg Ile Cys Phe Tyr Asn Ala Thr Asn Pro Leu Val Thr Tyr Trp
530 535 540
Gly Pro Val Asp Ile Ser Asn Cys Leu Lys Glu Ala Asn Glu Val Ala
545 550 555 560
Asn Gln Ile Leu Asn Leu Thr Ala Asp Gly Gln Asn Leu Thr Ser Ala
565 570 575
Asn Ile Thr Asn Ile Val Glu Gln Val Lys Arg Ile Val Asn Lys Glu
580 585 590
Glu Asn Ile Asp Ile Thr Leu Gly Ser Thr Leu Met Asn Ile Phe Ser
595 600 605
Asn Ile Leu Ser Ser Ser Asp Ser Asp Leu Leu Glu Ser Ser Ser Glu
610 615 620
Ala Leu Lys Thr Ile Asp Glu Leu Ala Phe Lys Ile Asp Leu Asn Ser
625 630 635 640
Thr Ser His Val Asn Ile Thr Thr Arg Asn Leu Ala Leu Ser Val Ser
645 650 655
Ser Leu Leu Pro Gly Thr Asn Ala Ile Ser Asn Phe Ser Ile Gly Leu
660 665 670
56 / 87
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
Pro Ser Asn Asn Glu Ser Tyr Phe Gln Met Asp Phe Glu Ser Gly Gln
675 680 685
Val Asp Pro Leu Ala Ser Val Ile Leu Pro Pro Asn Leu Leu Glu Asn
690 695 700
Leu Ser Pro Glu Asp Ser Val Leu Val Arg Arg Ala Gln Phe Thr Phe
705 710 715 720
Phe Asn Lys Thr Gly Leu Phe Gln Asp Val Gly Pro Gln Arg Lys Thr
725 730 735
Leu Val Ser Tyr Val Met Ala Cys Ser Ile Gly Asn Ile Thr Ile Gln
740 745 750
Asn Leu Lys Asp Pro Val Gln Ile Lys Ile Lys His Thr Arg Thr Gln
755 760 765
Glu Val His His Pro Ile Cys Ala Phe Trp Asp Leu Asn Lys Asn Lys
770 775 780
Ser Phe Gly Gly Trp Asn Thr Ser Gly Cys Val Ala His Arg Asp Ser
785 790 795 800
Asp Ala Ser Glu Thr Val Cys Leu Cys Asn His Phe Thr His Phe Gly
805 810 815
Val Leu Met Asp Leu Pro Arg Ser Ala Ser Gln Leu Asp Ala Arg Asn
820 825 830
Thr Lys Val Leu Thr Phe Ile Ser Tyr Ile Gly Cys Gly Ile Ser Ala
835 840 845
Ile Phe Ser Ala Ala Thr Leu Leu Thr Tyr Val Ala Phe Glu Lys Leu
850 855 860
Arg Arg Asp Tyr Pro Ser Lys Ile Leu Met Asn Leu Ser Thr Ala Leu
865 870 875 880
Leu Phe Leu Asn Leu Leu Phe Leu Leu Asp Gly Trp Ile Thr Ser Phe
885 890 895
Asn Val Asp Gly Leu Cys Ile Ala Val Ala Val Leu Leu His Phe Phe
900 905 910
Leu Leu Ala Thr Phe Thr Trp Met Gly Leu Glu Ala Ile His Met Tyr
915 920 925
Ile Ala Leu Val Lys Val Phe Asn Thr Tyr Ile Arg Arg Tyr Ile Leu
930 935 940
Lys Phe Cys Ile Ile Gly Trp Gly Leu Pro Ala Leu Val Val Ser Val
945 950 955 960
Val Leu Ala Ser Arg Asn Asn Asn Glu Val Tyr Gly Lys Glu Ser Tyr
965 970 975
Gly Lys Glu Lys Gly Asp Glu Phe Cys Trp Ile Gln Asp Pro Val Ile
980 985 990
Phe Tyr Val Thr Cys Ala Gly Tyr Phe Gly Val Met Phe Phe Leu Asn
995 1000 1005
Ile Ala Met Phe Ile Val Val Met Val Gln Ile Cys Gly Arg Asn Gly
1010 1015 1020
Lys Arg Ser Asn Arg Thr Leu Arg Glu Glu Val Leu Arg Asn Leu Arg
1025 1030 1035 1040
Ser Val Val Ser Leu Thr Phe Leu Leu Gly Met Thr Trp Gly Phe Ala
1045 1050 1055
Phe Phe Ala Trp Gly Pro Leu Asn Ile Pro Phe Met Tyr Leu Phe Ser
1060 1065 1070
Ile Phe Asn Ser Leu Gln Gly Lys Ile Asn Cys Thr
1075 1080
<210> 41
<211> 3666
<212> DNA
<213> homo sapiens
<400>
41
atgtttcgctcagatcgaatgtggagctgccattggaaatggaagcccagtcctctcctg 60
ttcttatttgctttatatatcatgtgtgttcctcactcagtgtggggatgtgccaactgc 120
cgagtggttttgtccaacccttctgggacctttacttctccatgctaccctaacgactac 180
ccaaacagccaggcttgcatgtggacgctccgagcccccaccggttatatcattcagata 240
57 / 87
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
acatttaacgactttgacattgaagaagctcccaattgcatttatgactcattatccctt 300
gataatggagagagccagactaaattttgtggagcaactgccaaaggcctatcatttaac 360
tcaagtgcgaatgagatgcatgtgtccttttcaagtgactttagcatccagaagaaaggt 420
ttcaatgccagctacatcagagttgccgtgtccttaaggaatcaaaaggtcattttaccc 480
cagacatcagatgcttaccaggtatctgttgcaaaaagcatctctattccagagctcagt 540
gctttcacactctgctttgaagcaaccaaagttggccatgaagacagtgattggacagct 600
ttctcctactcaaatgcatccttcacacaattgctcagttttggaaaggccaagagtggc 660
tactttctatccatttctgattcaaaatgtttgttgaataatgcattacctgtcaaagaa 720
aaagaagacatttttgcagaaagctttgaacagctctgccttgtttggaataattctttg 780
ggctctattggtgtaaatttcaaaagaaactatgaaacagttccatgtgattctaccatt 840
agtaaagttattcctgggaatgggaaattgttgttgggctccaatcaaaatgaaattgtc 900
tctctaaaaggggacatttataactttcgactttggaattttaccatgaatgccaaaatc 960
ctctccaacctcagctgtaatgtgaaagggaatgtagtcgactggcaaaatgacttctgg 1020
aatatcccaaacctagctctgaaagctgaaagcaacctaagctgtggttcctacctgatc 1080
ccgctcccagcagcagaactggccagctgtgcagacctggggaccctctgtcaagatgga 1140
attatctatagaatatccgtagtgattcagaacatccttcgtcaccctgaggtaaaagta 1200
cagagcaaggtggcagaatggctcaattcaaccttccaaaattggaactacacggtttat 1260
gtcgttaatatcagttttcacctgagtgctggagaggacaagattaaagtcaagagaagc 1320
cttgaggatgagccaaggttggtgctttgggcccttctagtttacaatgctaccaacaat 1380
actaatttagaaggaaaaatcattcagcagaagctcctaaaaaataatgagtccttggat 1440
gaaggcttgaggctacatacagtgaatgtgagacaactgggtcattgtcttgccatggag 1500
gaacccaaaggctactactggccatctatccaaccttctgaatacgttcttccttgtcca 1560
gacaagcctggcttttctgcttctcggatatgtttttacaatgctaccaacccattggta 1620
acctactggggacctgttgatatctccaactgtttaaaagaagcaaatgaagttgctaac 1680
cagattttaaatttaactgctgatgggcagaacttaacctcagccaatattaccaacatt 1740
gtggaacaggtcaaaagaattgtgaataaagaagaaaacattgatataacacttggctca 1800
actctaatgaatatattttctaatatcttaagcagttcagacagtgacttgcttgagtca 1860
tcttctgaagctttaaaaacaattgatgaattggccttcaagatagacctaaatagcaca 1920
tcacatgtgaatattacaactcggaacttggctctcagcgtatcatccctgttaccaggg 1980
acaaatgcaatttcaaattttagcattggtcttccaagcaataatgaatcgtatttccag 2040
atggattttgagagtggacaagtggatccactggcatctgtaattttgcctccaaactta 2100
cttgagaatttaagtccagaagattctgtattagttagaagagcacagtttactttcttc 2160
aacaaaactggacttttccaggatgtaggaccccaaagaaaaactttagtgagttatgtg 2220
atggcgtgcagtattggaaacattactatccagaatctgaaggatcctgttcaaataaaa 2280
atcaaacatacaagaactcaggaagtgcatcatcccatctgtgccttctgggatctgaac 2340
aaaaacaaaagttttggaggatggaacacgtcaggatgtgttgcacacagagattcagat 2400
gcaagtgagacagtctgcctgtgtaaccacttcacacactttggagttctgatggacctt 2460
ccaagaagtgcctcacagttagatgcaagaaacactaaagtcctcactttcatcagctat 2520
attgggtgtggaatatctgctattttttcagcagcaactctcctgacatatgttgctttt 2580
gagaaattgcgaagggattatccctccaaaatcttgatgaacctgagcacagccctgctg 2640
ttcctgaatctcctcttcctcctagatggctggatcacctccttcaatgtggatggactt 2700
tgcattgctgttgcagtcctgttgcatttcttccttctggcaacctttacctggatgggg 2760
ctagaagcaattcacatgtacattgctctagttaaagtatttaacacttacattcgccga 2820
tacattctaaaattctgcatcattggctggggtttgcctgccttagtggtgtcagttgtt 2880
ctagcgagcagaaacaacaatgaagtctatggaaaagaaagttatgggaaagaaaaaggt 2940
gatgaattctgttggattcaagatccagtcatattttatgtgacctgtgctgggtatttt 3000
ggagtcatgttttttctgaacattgccatgttcattgtggtaatggtgcagatctgtggg 3060
aggaatggcaagagaagcaaccggaccctgagagaagaagtgttaaggaacctgcgcagt 3120
gtggttagcttgacctttctgttgggcatgacatggggttttgcattctttgcctgggga 3180
cccttaaatatccccttcatgtacctcttctccatcttcaattcattacaaggcttattt 3240
atattcatcttccactgtgctatgaaggagaatgttcagaaacagtggcggcggcatctc 3300
tgctgtggtagatttcggttagcagataactcagattggagtaagacagctaccaatatc 3360
atcaagaaaagttctgataatctaggaaaatctttgtcttcaagctccattggttccaac 3420
tcaacctatcttacatccaaatctaaatccagctctaccacctatttcaaaaggaatagc 3480
cacacagacagtgcttccatggacaagtccttgtcaaaactggcccatgctgatggagat 3540
caaacatcaatcatccctgtccatcaggtcattgataaggtcaagggttattgcaatgct 3600
cattcagacaacttctataaaaatattatcatgtcagacaccttcagccacagcacaaag 3660
ttttaa 3666
<210> 42
<211> 1221
<212> PRT
<213> homo sapiens
58 / 87
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
<400> 42
Met Phe Arg Ser Asp Arg Met Trp Ser Cys His Trp Lys Trp Lys Pro
1 5 10 15
Ser Pro Leu Leu Phe Leu Phe Ala Leu Tyr Ile Met Cys Val Pro His
20 25 30
Ser Val Trp Gly Cys Ala Asn Cys Arg Val Val Leu Ser Asn Pro Ser
35 40 45
Gly Thr Phe Thr Ser Pro Cys Tyr Pro Asn Asp Tyr Pro Asn Ser Gln
50 55 60
Ala Cys Met Trp Thr Leu Arg Ala Pro Thr Gly Tyr Ile Ile Gln Ile
65 70 75 80
Thr Phe Asn Asp Phe Asp Ile Glu Glu Ala Pro Asn Cys Ile Tyr Asp
85 90 95
Ser Leu Ser Leu Asp Asn Gly Glu Ser Gln Thr Lys Phe Cys Gly Ala
100 105 110
Thr Ala Lys Gly Leu Ser Phe Asn Ser Ser Ala Asn Glu Met His Val
115 120 125
Ser Phe Ser Ser Asp Phe Ser Ile Gln Lys Lys Gly Phe Asn Ala Ser
130 135 140
Tyr Ile Arg Val Ala Val Ser Leu Arg Asn Gln Lys Val Ile Leu Pro
145 150 155 160
Gln Thr Ser Asp Ala Tyr Gln Val Ser Val Ala Lys Ser Ile Ser Ile
165 170 175
Pro Glu Leu Ser Ala Phe Thr Leu Cys Phe Glu Ala Thr Lys Val Gly
180 185 190
His Glu Asp Ser Asp Trp Thr Ala Phe Ser Tyr Ser Asn Ala Ser Phe
195 200 205
Thr Gln Leu Leu Ser Phe Gly Lys Ala Lys Ser Gly Tyr Phe Leu Ser
210 215 220
Ile Ser Asp Ser Lys Cys Leu Leu Asn Asn Ala Leu Pro Val Lys Glu
225 230 235 240
Lys Glu Asp Ile Phe Ala Glu Ser Phe Glu Gln Leu Cys Leu Val Trp
245 250 255
Asn Asn Ser Leu Gly Ser Ile Gly Val Asn Phe Lys Arg Asn Tyr Glu
260 265 270
Thr Val Pro Cys Asp Ser Thr Ile Ser Lys Val Ile Pro Gly Asn Gly
275 280 285
Lys Leu Leu Leu Gly Ser Asn Gln Asn Glu Ile Val Ser Leu Lys Gly
290 295 300
Asp Ile Tyr Asn Phe Arg Leu Trp Asn Phe Thr Met Asn Ala Lys Ile
305 310 315 320
Leu Ser Asn Leu Ser Cys Asn Val Lys Gly Asn Val Val Asp Trp Gln
325 330 335
Asn Asp Phe Trp Asn Ile Pro Asn Leu Ala Leu Lys Ala Glu Ser Asn
340 345 350
Leu Ser Cys Gly Ser Tyr Leu Ile Pro Leu Pro Ala Ala Glu Leu Ala
355 360 365
Ser Cys Ala Asp Leu Gly Thr Leu Cys Gln Asp Gly Ile Ile Tyr Arg
370 375 380
Ile Ser Val Val Ile Gln Asn Ile Leu Arg His Pro Glu Val Lys Val
385 390 395 400
Gln Ser Lys Val Ala Glu Trp Leu Asn Ser Thr Phe Gln Asn Trp Asn
405 410 415
Tyr Thr Val Tyr Val Val Asn Ile Ser Phe His Leu Ser Ala Gly Glu
420 425 430
Asp Lys Ile Lys Val Lys Arg Ser Leu Glu Asp Glu Pro Arg Leu Val
435 440 445
Leu Trp Ala Leu Leu Val Tyr Asn Ala Thr Asn Asn Thr Asn Leu Glu
450 455 460
Gly Lys Ile Ile Gln Gln Lys Leu Leu Lys Asn Asn Glu Ser Leu Asp
465 470 475 480
Glu Gly Leu Arg Leu His Thr Val Asn Val Arg Gln Leu Gly His Cys
485 490 495
59 / 87
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
Leu Ala Met Glu Glu Pro Lys Gly Tyr Tyr Trp Pro Ser Ile Gln Pro
500 505 510
Ser Glu Tyr Val Leu Pro Cys Pro Asp Lys Pro Gly Phe Ser Ala Ser
515 520 525
Arg Ile Cys Phe Tyr Asn Ala Thr Asn Pro Leu Val Thr Tyr Trp Gly
530 535 540
Pro Val Asp Ile Ser Asn Cys Leu Lys Glu Ala Asn Glu Val Ala Asn
545 550 555 560
Gln Ile Leu Asn Leu Thr Ala Asp Gly Gln Asn Leu Thr Ser Ala Asn
565 570 575
Ile Thr Asn Ile Val Glu Gln Val Lys Arg Ile Val Asn Lys Glu Glu
580 585 590
Asn Ile Asp Ile Thr Leu Gly Ser Thr Leu Met Asn Ile Phe Ser Asn
595 600 605
Ile Leu Ser Ser Ser Asp Ser Asp Leu Leu Glu Ser Ser Ser Glu Ala
610 615 620
Leu Lys Thr Ile Asp Glu Leu Ala Phe Lys Ile Asp Leu Asn Ser Thr
625 630 635 640
Ser His Val Asn Ile Thr Thr Arg Asn Leu Ala Leu Ser Val Ser Ser
645 650 655
Leu Leu Pro Gly Thr Asn Ala Ile Ser Asn Phe Ser Ile Gly Leu Pro
660 665 670
Ser Asn Asn Glu Ser Tyr Phe Gln Met Asp Phe Glu Ser Gly Gln Val
675 680 685
Asp Pro Leu Ala Ser Val Ile Leu Pro Pro Asn Leu Leu Glu Asn Leu
690 695 700
Ser Pro Glu Asp Ser Val Leu Val Arg Arg Ala Gln Phe Thr Phe Phe
705 710 715 720
Asn Lys Thr Gly Leu Phe Gln Asp Val Gly Pro Gln Arg Lys Thr Leu
725 730 735
Val Ser Tyr Val Met Ala Cys Ser Ile Gly Asn Ile Thr Ile Gln Asn
740 745 750
Leu Lys Asp Pro Val Gln Ile Lys Ile Lys His Thr Arg Thr Gln Glu
755 760 765
Val His His Pro Ile Cys Ala Phe Trp Asp Leu Asn Lys Asn Lys Ser
770 775 780
Phe Gly Gly Trp Asn Thr Ser Gly Cys Val Ala His Arg Asp Ser Asp
785 790 795 800
Ala Ser Glu Thr Val Cys Leu Cys Asn His Phe Thr His Phe Gly Val
805 810 815
Leu Met Asp Leu Pro Arg Ser Ala Ser Gln Leu Asp Ala Arg Asn Thr
820 825 830
Lys Val Leu Thr Phe Ile Ser Tyr Ile Gly Cys Gly Ile Ser Ala Ile
835 840 845
Phe Ser Ala Ala Thr Leu Leu Thr Tyr Val Ala Phe Glu Lys Leu Arg
850 855 860
Arg Asp Tyr Pro Ser Lys Ile Leu Met Asn Leu Ser Thr Ala Leu Leu
865 870 875 880
Phe Leu Asn Leu Leu Phe Leu Leu Asp Gly Trp Ile Thr Ser Phe Asn
885 890 895
Val Asp Gly Leu Cys Ile Ala Val Ala Val Leu Leu His Phe Phe Leu
900 905 910
Leu Ala Thr Phe Thr Trp Met Gly Leu Glu Ala Ile His Met Tyr Ile
915 920 925
Ala Leu Val Lys Val Phe Asn Thr Tyr Ile Arg Arg Tyr Ile Leu Lys
930 935 940
Phe Cys Ile Ile Gly Trp Gly Leu Pro Ala Leu Val Val Ser Val Val
945 950 955 960
Leu Ala Ser Arg Asn Asn Asn Glu Val Tyr Gly Lys Glu Ser Tyr Gly
965 970 975
Lys Glu Lys Gly Asp Glu Phe Cys Trp Ile Gln Asp Pro Val Ile Phe
980 985 990
Tyr Val Thr Cys Ala Gly Tyr Phe Gly Val Met Phe Phe Leu Asn Ile
60 / 87
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
995 1000 1005
Ala Met Phe Ile Val Val Met Val Gln Ile Cys Gly Arg Asn Gly Lys
1010 1015 1020
Arg Ser Asn Arg Thr Leu Arg Glu Glu Val Leu Arg Asn Leu Arg Ser
1025 1030 1035 1040
Val Val Ser Leu Thr Phe Leu Leu Gly Met Thr Trp Gly Phe Ala Phe
1045 1050 1055
Phe Ala Trp Gly Pro Leu Asn Ile Pro Phe Met Tyr Leu Phe Ser Ile
1060 1065 1070
Phe Asn Ser Leu Gln Gly Leu Phe Ile Phe Ile Phe His Cys Ala Met
1075 1080 1085
Lys Glu Asn Val Gln Lys Gln Trp Arg Arg His Leu Cys Cys Gly Arg
1090 1095 1100
Phe Arg Leu Ala Asp Asn Ser Asp Trp Ser Lys Thr Ala Thr Asn Ile
1105 1110 1115 1120
Ile Lys Lys Ser Ser Asp Asn Leu Gly Lys Ser Leu Ser Ser Ser Ser
1125 1130 1135
Ile Gly Ser Asn Ser Thr Tyr Leu Thr Ser Lys Ser Lys Ser Ser Ser
1140 1145 1150
Thr Thr Tyr Phe Lys Arg Asn Ser His Thr Asp Ser Ala Ser Met Asp
1155 1160 1165
Lys Ser Leu Ser Lys Leu Ala His Ala Asp Gly Asp Gln Thr Ser Ile
1170 1175 1180
Ile Pro Val His Gln Val Ile Asp Lys Val Lys Gly Tyr Cys Asn Ala
1185 1190 1195 1200
His Ser Asp Asn Phe Tyr Lys Asn Ile Ile Met Ser Asp Thr Phe Ser
1205 1210 1215
His Ser Thr Lys Phe
1220
<210> 43
<211> 3579
<212> DNA
<213> homo sapiens
<400> 43
atgtttcgctcagatcgaatgtggagctgccattggaaatggaagcccagtcctctcctg 60
ttcttatttgctttatatatcatgtgtgttcctcactcagtgtggggatgtgccaactgc 120
cgagtggttttgtccaacccttctgggacctttacttctccatgctaccctaacgactac 180
ccaaacagccaggcttgcatgtggacgctccgagcccccaccggttatatcattcagata 240
acatttaacgactttgacattgaagaagctcccaattgcatttatgactcattatccctt 300
gataatggagagagccagactaaattttgtggagcaactgccaaaggcctatcatttaac 360
tcaagtgcgaatgagatgcatgtgtccttttcaagtgactttagcatccagaagaaaggt 420
ttcaatgccagctacatcagagttgccgtgtccttaaggaatcaaaaggtcattttaccc 480
cagacatcagatgcttaccaggtatctgttgcaaaaagcatctctattccagagctcagt 540
gctttcacactctgctttgaagcaaccaaagttggccatgaagacagtgattggacagct 600
ttctcctactcaaatgcatccttcacacaattgctcagttttggaaaggccaagagtggc 660
tactttctatccatttctgattcaaaatgtttgttgaataatgcattacctgtcaaagaa 720
aaagaagacatttttgcagaaagctttgaacagctctgccttgtttggaataattctttg 780
ggctctattggtgtaaatttcaaaagaaactatgaaacagttccatgtgattctaccatt 840
agtaaagttattcctgggaatgggaaattgttgttgggctccaatcaaaatgaaattgtc 900
tctctaaaaggggacatttataactttcgactttggaattttaccatgaatgccaaaatc 960
ctctccaacctcagctgtaatgtgaaagggaatgtagtcgactggcaaaatgacttctgg 1020
aatatcccaaacctagctctgaaagctgaaagcaacctaagctgtggttcctacctgatc 1080
ccgctcccagcagcagaactggccagctgtgcagacctggggaccctctgtcaagatgga 1140
attatctatagaatatccgtagtgattcagaacatccttcgtcaccctgaggtaaaagta 1200
cagagcaaggtggcagaatggctcaattcaaccttccaaaattggaactacacggtttat 1260
gtcgttaatatcagttttcacctgagtgctggagaggacaagattaaagtcaagagaagc 1320
cttgaggatgagccaaggttggtgctttgggcccttctagtttacaatgctaccaacaat 1380
actaatttagaaggaaaaatcattcagcagaagctcctaaaaaataatgagtccttggat 1440
gaaggcttgaggctacatacagtgaatgtgagacaactgggtcattgtcttgccatggag 1500
gaacccaaaggctactactggccatctatccaaccttctgaatacgttcttccttgtcca 1560
gacaagcctggcttttctgcttctcggatatgtttttacaatgctaccaacccattggta 1620
61 / 87
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
acctactggggacctgttgatatctccaactgtttaaaagaagcaaatgaagttgctaac 1680
cagattttaaatttaactgctgatgggcagaacttaacctcagccaatattaccaacatt 1740
gtggaacaggtcaaaagaattgtgaataaagaagaaaacattgatataacacttggctca 1800
actctaatgaatatattttctaatatcttaagcagttcagacagtgacttgcttgagtca 1860
tcttctgaagctttaaaaacaattgatgaattggccttcaagatagacctaaatagcaca 1920
tcacatgtgaatattacaactcggaacttggctctcagcgtatcatccctgttaccaggg 1980
acaaatgcaatttcaaattttagcattggtcttccaagcaataatgaatcgtatttccag 2040
atggattttgagagtggacaagtggatccactggcatctgtaattttgcctccaaactta 2100
cttgagaatttaagtccagaagattctgtattagttagaagagcacagtttactttcttc 2160
aacaaaactggacttttccaggatgtaggaccccaaagaaaaactttagtgagttatgtg 2220
atggcgtgcagtattggaaacattactatccagaatctgaaggatcctgttcaaataaaa 2280
atcaaacatacaagaactcaggaagtgcatcatcccatctgtgccttctgggatctgaac 2340
aaaaacaaaagttttggaggatggaacacgtcaggatgtgttgcacacagagattcagat 2400
gcaagtgagacagtctgcctgtgtaaccacttcacacactttggagttctgatggacctt 2460
ccaagaagtgcctcacagttagatgcaagaaacactaaagtcctcactttcatcagctat 2520
attgggtgtggaatatctgctattttttcagcagcaactctcctgacatatgttgctttt 2580
gagaaattgcgaagggattatccctccaaaatcttgatgaacctgagcacagccctgctg 2640
ttcctgaatctcctcttcctcctagatggctggatcacctccttcaatgtggatggactt 2700
tgcattgctgttgcagtcctgttgcatttcttccttctggcaacctttacctggatgggg 2760
ctagaagcaattcacatgtacattgctctagttaaagtatttaacacttacattcgccga 2820
tacattctaaaattctgcatcattggctggggtttgcctgccttagtggtgtcagttgtt 2880
ctagcgagcagaaacaacaatgaagtctatggaaaagaaagttatgggaaagaaaaaggt 2940
gatgaattctgttggattcaagatccagtcatattttatgtgacctgtgctgggtatttt 3000
ggagtcatgttttttctgaacattgccatgttcattgtggtaatggtgcagatctgtggg 3060
aggaatggcaagagaagcaaccggaccctgagagaagaagtgttaaggaacctgcgcagt 3120
gtggttagcttgacctttctgttgggcatgacatggggttttgcattctttgcctgggga 3180
cccttaaatatccccttcatgtacctcttctccatcttcaattcattacaaggcttattt 3240
atattcatcttccactgtgctatgaaggagaatgttcagaaacagtggcggcggcatctc 3300
tgctgtggtagatttcggttagcagataactcagattggagtaagacagctaccaatatc 3360
atcaagaaaagttctgataatctaggaaaatctttgtcttcaagctccattggttccaac 3420
tcaacctatcttacatccaaatctaaatccagctctaccacctatttcaaaaggaatagc 3480
cacacagataatgtctcctatgagcattccttcaacaaaagtggatcactcagacagtgc 3540
ttccatggacaagtccttgtcaaaactggcccatgctga 3579
<210> 44
<211> 1192
<212> PRT
<213> homo sapiens
<400> 44
Met Phe Arg Ser Asp Arg Met Trp Ser Cys His Trp Lys Trp Lys Pro
1 5 10 15
Ser Pro Leu Leu Phe Leu Phe Ala Leu Tyr Ile Met Cys Val Pro His
20 25 30
Ser Val Trp Gly Cys Ala Asn Cys Arg Val Val Leu Ser Asn Pro Ser
35 40 45
Gly Thr Phe Thr Ser Pro Cys Tyr Pro Asn Asp Tyr Pro Asn Ser Gln
50 55 60
Ala Cys Met Trp Thr Leu Arg Ala Pro Thr Gly Tyr Ile Ile Gln Ile
65 70 75 80
Thr Phe Asn Asp Phe Asp Ile Glu Glu Ala Pro Asn Cys Ile Tyr Asp
85 90 95
Ser Leu Ser Leu Asp Asn Gly Glu Ser Gln Thr Lys Phe Cys Gly Ala
100 105 110
Thr Ala Lys Gly Leu Ser Phe Asn Ser Ser Ala Asn Glu Met His Val
115 120 125
Ser Phe Ser Ser Asp Phe Ser Ile Gln Lys Lys Gly Phe Asn Ala Ser
130 135 140
Tyr Ile Arg Val Ala Val Ser Leu Arg Asn Gln Lys Val Ile Leu Pro
145 150 155 160
Gln Thr Ser Asp Ala Tyr Gln Val Ser Val Ala Lys Ser Ile Ser Ile
165 170 175
Pro Glu Leu Ser Ala Phe Thr Leu Cys Phe Glu Ala Thr Lys Val Gly
62 / 87
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
180 185 190
His Glu Asp Ser Asp Trp Thr Ala Phe Ser Tyr Ser Asn Ala Ser Phe
195 200 205
Thr Gln Leu Leu Ser Phe Gly Lys Ala Lys Ser Gly Tyr Phe Leu Ser
210 215 220
Ile Ser Asp Ser Lys Cys Leu Leu Asn Asn Ala Leu Pro Val Lys Glu
225 230 235 240
Lys Glu Asp Ile Phe Ala Glu Ser Phe Glu Gln Leu Cys Leu Val Trp
245 250 255
Asn Asn Ser Leu Gly Ser Ile Gly Val Asn Phe Lys Arg Asn Tyr Glu
260 265 270
Thr Val Pro Cys Asp Ser Thr Ile Ser Lys Val Ile Pro Gly Asn Gly
275 280 285
Lys Leu Leu Leu Gly Ser Asn Gln Asn Glu Ile Val Ser Leu Lys Gly
290 295 300
Asp Ile Tyr Asn Phe Arg Leu Trp Asn Phe Thr Met Asn Ala Lys Ile
305 310 315 320
Leu Ser Asn Leu Ser Cys Asn Val Lys Gly Asn Val Val Asp Trp Gln
325 330 335
Asn Asp Phe Trp Asn Ile Pro Asn Leu Ala Leu Lys Ala Glu Ser Asn
340 345 350
Leu Ser Cys Gly Ser Tyr Leu Ile Pro Leu Pro Ala Ala Glu Leu Ala
355 360 365
Ser Cys Ala Asp Leu Gly Thr Leu Cys Gln Asp Gly Ile Ile Tyr Arg
370 375 380
Ile Ser Val Val Ile Gln Asn Ile Leu Arg His Pro Glu Val Lys Val
385 390 395 400
Gln Ser Lys Val Ala Glu Trp Leu Asn Ser Thr Phe Gln Asn Trp Asn
405 410 415
Tyr Thr Val Tyr Val Val Asn Ile Ser Phe His Leu Ser Ala Gly Glu
420 425 430
Asp Lys Ile Lys Val Lys Arg Ser Leu Glu Asp Glu Pro Arg Leu Val
435 440 445
Leu Trp Ala Leu Leu Val Tyr Asn Ala Thr Asn Asn Thr Asn Leu Glu
450 455 460
Gly Lys Ile Ile Gln Gln Lys Leu Leu Lys Asn Asn Glu Ser Leu Asp
465 470 475 480
Glu Gly Leu Arg Leu His Thr Val Asn Val Arg Gln Leu Gly His Cys
485 490 495
Leu Ala Met Glu Glu Pro Lys Gly Tyr Tyr Trp Pro Ser Ile Gln Pro
500 505 510
Ser Glu Tyr Val Leu Pro Cys Pro Asp Lys Pro Gly Phe Ser Ala Ser
515 ' 520 525
Arg Ile Cys Phe Tyr Asn Ala Thr Asn Pro Leu Val Thr Tyr Trp Gly
530 535 540
Pro Val Asp Ile Ser Asn Cys Leu Lys Glu Ala Asn Glu Val Ala Asn
545 550 555 560
Gln Ile Leu Asn Leu Thr Ala Asp Gly Gln Asn Leu Thr Ser Ala Asn
565 570 575
Ile Thr Asn Ile Val Glu Gln Val Lys Arg Ile Val Asn Lys Glu Glu
580 585 590
Asn Ile Asp Ile Thr Leu Gly Ser Thr Leu Met Asn Ile Phe Ser Asn
595 600 605
Ile Leu Ser Ser Ser Asp Ser Asp Leu Leu Glu Ser Ser Ser Glu Ala
610 615 620
Leu Lys Thr Ile Asp Glu Leu Ala Phe Lys Ile Asp Leu Asn Ser Thr
625 630 635 640
Ser His Val Asn Ile Thr Thr Arg Asn Leu Ala Leu Ser Val Ser Ser
645 650 655
Leu Leu Pro Gly Thr Asn Ala Ile Ser Asn Phe Ser Ile Gly Leu Pro
660 665 670
Ser Asn Asn Glu Ser Tyr Phe Gln Met Asp Phe Glu Ser Gly Gln Val
675 680 685
63 / 87
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
Asp Pro Leu Ala Ser Val Ile Leu Pro Pro Asn Leu Leu Glu Asn Leu
690 695 700
Ser Pro Glu Asp Ser Val Leu Val Arg Arg Ala Gln Phe Thr Phe Phe
705 710 715 720
Asn Lys Thr Gly Leu Phe Gln Asp Val Gly Pro Gln Arg Lys Thr Leu
725 730 735
Val Ser Tyr Val Met Ala Cys Ser Ile Gly Asn Ile Thr Ile Gln Asn
740 745 750
Leu Lys Asp Pro Val Gln Ile Lys Ile Lys His Thr Arg Thr Gln Glu
755 760 765
Val His His Pro Ile Cys Ala Phe Trp Asp Leu Asn Lys Asn Lys Ser
770 775 780
Phe Gly Gly Trp Asn Thr Ser Gly Cys Val Ala His Arg Asp Ser Asp
785 790 795 800
Ala Ser Glu Thr Val Cys Leu Cys Asn His Phe Thr His Phe Gly Val
805 810 815
Leu Met Asp Leu Pro Arg Ser Ala Ser Gln Leu Asp Ala Arg Asn Thr
820 825 830
Lys Val Leu Thr Phe Ile Ser Tyr Ile Gly Cys Gly Ile Ser Ala Ile
835 840 845
Phe Ser Ala Ala Thr Leu Leu Thr Tyr Val Ala Phe Glu Lys Leu Arg
850 855 860
Arg Asp Tyr Pro Ser Lys Ile Leu Met Asn Leu Ser Thr Ala Leu Leu
865 870 875 880
Phe Leu Asn Leu Leu Phe Leu Leu Asp Gly Trp Ile Thr Ser Phe Asn
885 890 895
Val Asp Gly Leu Cys Ile Ala Val Ala Val Leu Leu His Phe Phe Leu
900 905 910
Leu Ala Thr Phe Thr Trp Met Gly Leu Glu Ala Ile His Met Tyr Ile
915 920 925
Ala Leu Val Lys Val Phe Asn Thr Tyr Ile Arg Arg Tyr Ile Leu Lys
930 935 940
Phe Cys Ile Ile Gly Trp Gly Leu Pro Ala Leu Val Val Ser Val Val.
945 950 955 960
Leu Ala Ser Arg Asn Asn Asn Glu Val Tyr Gly Lys Glu Ser Tyr Gly
965 970 975
Lys Glu Lys Gly Asp Glu Phe Cys Trp Ile Gln Asp Pro Val Ile Phe
980 985 990
Tyr Val Thr Cys Ala Gly Tyr Phe Gly Val Met Phe Phe Leu Asn Ile
995 1000 1005
Ala Met Phe Ile Val Val Met Val Gln Ile Cys Gly Arg Asn Gly Lys
1010 1015 1020
Arg Ser Asn Arg Thr Leu Arg Glu Glu Val Leu Arg Asn Leu Arg Ser
1025 1030 1035 1040
Val Val Ser Leu Thr Phe Leu Leu Gly Met Thr Trp Gly Phe Ala Phe
1045 1050 1055
Phe Ala Trp Gly Pro Leu Asn Ile Pro Phe Met Tyr Leu Phe Ser Ile
1060 1065 1070
Phe Asn Ser Leu Gln Gly Leu Phe Ile Phe Ile Phe His Cys Ala Met
1075 1080 1085
Lys Glu Asn Val Gln Lys Gln Trp Arg Arg His Leu Cys Cys Gly Arg
1090 1095 1100
Phe Arg Leu Ala Asp Asn Ser Asp Trp Ser Lys Thr Ala Thr Asn Ile
1105 1110 1115 1120
Ile Lys Lys Ser Ser Asp Asn Leu Gly Lys Ser Leu Ser Ser Ser Ser
1125 1130 1135
Ile Gly Ser Asn Ser Thr Tyr Leu Thr Ser Lys Ser Lys Ser Ser Ser
1140 1145 1150
Thr Thr Tyr Phe Lys Arg Asn Ser His Thr Asp Asn Val Ser Tyr Glu
1155 1160 1165
His Ser Phe Asn Lys Ser Gly Ser Leu Arg Gln Cys Phe His Gly Gln
1170 1175 1180
Val Leu Val Lys Thr Gly Pro Cys
64 / 87
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
1185 1190
<210> 45
<211> 2070
<212> DNA
<213> homo sapiens
<400> 45
atgtttcgctcagatcgaatgtggagctgccattggaaatggaagcccagtcctctcctg 60
ttcttatttgctttatatatcatgtgtgttcctcactcagtgtggggatgtgccaactgc 120
cgagtggttttgtccaacccttctgggacctttacttctccatgctaccctaacgactac 180
ccaaacagccaggcttgcatgtggacgctccgagcccccaccggttatatcattcagata 240
acatttaacgactttgacattgaagaagctcccaattgcatttatgactcattatccctt 300
gataatggagagagccagactaaattttgtggagcaactgccaaaggcctatcatttaac 360
tcaagtgcgaatgagatgcatgtgtccttttcaagtgactttagcatccagaagaaaggt 420
ttcaatgccagctacatcagagttgccgtgtccttaaggaatcaaaaggtcattttaccc 480
cagacatcagatgcttaccaggtatctgttgcaaaaagcatctctattccagagctcagt 540
gctttcacactctgctttgaagcaaccaaagttggccatgaagacagtgattggacagct 600
ttctcctactcaaatgcatccttcacacaattgctcagttttggaaaggccaagagtggc 660
tactttctatccatttctgattcaaaatgtttgttgaataatgcattacctgtcaaagaa 720
aaagaagacatttttgcagaaagctttgaacagctctgccttgtttggaataattctttg 780
ggctctattggtgtaaatttcaaaagaaactatgaaacagttccatgtgattctaccatt 840
agtaaagttattcctgggaatgggaaattgttgttgggctccaatcaaaatgaaattgtc 900
tctctaaaaggggacatttataactttcgactttggaattttaccatgaatgccaaaatc 960
ctctccaacctcagctgtaatgtgaaagggaatgtagtcgactggcaaaatgacttctgg 1020
aatatcccaaacctagctctgaaagctgaaagcaacctaagctgtggttcctacctgatc 1080
ccgctcccagcagcagaactggccagctgtgcagacctggggaccctctgtcaagatgga 1140
attatctatagaatatccgtagtgattcagaacatccttcgtcaccctgaggtaaaagta 1200
cagagcaaggtggcagaatggctcaattcaaccttccaaaattggaactacacggtttat 1260
gtcgttaatatcagttttcacctgagtgctggagaggacaagattaaagtcaagagaagc 1320
cttgaggatgagccaaggttggtgctttgggcccttctagtttacaatgctaccaacaat 1380
actaatttagaaggaaaaatcattcagcagaagctcctaaaaaataatgagtccttggat 1440
gaaggcttgaggctacatacagtgaatgtgagacaactgggtcattgtcttgccatggag 1500
gaacccaaaggctactactggccatctatccaaccttctgaatacgttcttccttgtcca 1560
gacaagcctggcttttctgcttctcggatatgtttttacaatgctaccaacccattggta 1620
acctactggggacctgttgatatctccaactgtttaaaagaagcaaatgaagttgctaac 1680
cagattttaaatttaactgctgatgggcagaacttaacctcagccaatattaccaacatt 1740
gtggaacaggtcaaaagaattgtgaataaagaagaaaacattgatataacacttggctca 1800
actctaatgaatatattttctaatatcttaagcagttcagacagtgacttgcttgagtca 1860
tcttctgaagctttaaaaacaattgatgaattggccttcaagatagacctaaatagcaca 1920
tcacatgtgaatattacaactcggaacttggctctcagcgtatcatccctgttaccaggg 1980
acaaatgcaatttcaaattttagcattggtcttccaagcaataatgaatcgtatttccag 2040
gtaatgagccagtggtttctttcattttaa 2070
<210> 46
<211> 689
<212> PRT
<213> homo sapiens
<400> 46
Met Phe Arg Ser Asp Arg Met Trp Ser Cys His Trp Lys Trp Lys Pro
1 5 10 15
Ser Pro Leu Leu Phe Leu Phe Ala Leu Tyr Ile Met Cys Val Pro His
20 25 30
Ser Val Trp Gly Cys Ala Asn Cys Arg Val Val Leu Ser Asn Pro Ser
35 40 45
Gly Thr Phe Thr Ser Pro Cys Tyr Pro Asn Asp Tyr Pro Asn Ser Gln
50 55 60
Ala Cys Met Trp Thr Leu Arg Ala Pro Thr Gly Tyr Ile Ile Gln Ile
65 70 75 80
Thr Phe Asn Asp Phe Asp Ile Glu Glu Ala Pro Asn Cys Ile Tyr Asp
85 90 95
Ser Leu Ser Leu Asp Asn Gly Glu Ser Gln Thr Lys Phe Cys Gly Ala
65 / 87
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
100 105 110
Thr Ala Lys Gly Leu Ser Phe Asn Ser Ser Ala Asn Glu Met His Val
115 120 125
Ser Phe Ser Ser Asp Phe Ser Ile Gln Lys Lys Gly Phe Asn Ala Ser
130 135 140
Tyr Ile Arg Val Ala Val Ser Leu Arg Asn Gln Lys Val Ile Leu Pro
145 150 155 160
Gln Thr Ser Asp Ala Tyr Gln Val Ser Val Ala Lys Ser Ile Ser Ile
165 170 175
Pro Glu Leu Ser Ala Phe Thr Leu Cys Phe Glu Ala Thr Lys Val Gly
180 185 190
His Glu Asp Ser Asp Trp Thr Ala Phe Ser Tyr Ser Asn Ala Ser Phe
195 200 205
Thr Gln Leu Leu Ser Phe Gly Lys Ala Lys Ser Gly Tyr Phe Leu Ser
210 215 220
Ile Ser Asp Ser Lys Cys Leu Leu Asn Asn Ala Leu Pro Val Lys Glu
225 230 235 240
Lys Glu Asp Ile Phe Ala Glu Ser Phe Glu Gln Leu Cys Leu Val Trp
245 250 255
Asn Asn Ser Leu Gly Ser Ile Gly Val Asn Phe Lys Arg Asn Tyr Glu
260 265 270
Thr Val Pro Cys Asp Ser Thr Ile Ser Lys Val Ile Pro Gly Asn Gly
275 280 285
Lys Leu Leu Leu Gly Ser Asn Gln Asn Glu Ile Val Ser Leu Lys Gly
290 295 300
Asp Ile Tyr Asn Phe Arg Leu Trp Asn Phe Thr Met Asn Ala Lys Ile
305 310 315 320
Leu Ser Asn Leu Ser Cys Asn Val Lys Gly Asn Val Val Asp Trp Gln
325 330 335
Asn Asp Phe Trp Asn Ile Pro Asn Leu Ala Leu Lys Ala Glu Ser Asn
340 345 350
Leu Ser Cys Gly Ser Tyr Leu Ile Pro Leu Pro Ala Ala Glu Leu Ala
355 360 365
Ser Cys Ala Asp Leu Gly Thr Leu Cys Gln Asp Gly Ile Ile Tyr Arg
370 375 380
Ile Ser Val Val Ile Gln Asn Ile Leu Arg His Pro Glu Val Lys Val
385 390 395 400
Gln Ser Lys Val Ala Glu Trp Leu Asn Ser Thr Phe Gln Asn Trp Asn
405 410 415
Tyr Thr Val Tyr Val Val Asn Ile Ser Phe His Leu Ser Ala Gly Glu
420 425 430
Asp Lys Ile Lys Val Lys Arg Ser Leu Glu Asp Glu Pro Arg Leu Val
435 440 445
Leu Trp Ala Leu Leu Val Tyr Asn Ala Thr Asn Asn Thr Asn Leu Glu
450 455 460
Gly Lys Ile Ile Gln Gln Lys Leu Leu Lys Asn Asn Glu Ser Leu Asp
465 470 475 480
Glu Gly Leu Arg Leu His Thr Val Asn Val Arg Gln Leu Gly His Cys
485 490 495
Leu Ala Met Glu Glu Pro Lys Gly Tyr Tyr Trp Pro Ser Ile Gln Pro
500 505 510
Ser Glu Tyr Val Leu Pro Cys Pro Asp Lys Pro Gly Phe Ser Ala Ser
515 520 525
Arg Ile Cys Phe Tyr Asn Ala Thr Asn Pro Leu Val Thr Tyr Trp Gly
530 535 540
Pro Val Asp Ile Ser Asn Cys Leu Lys Glu Ala Asn Glu Val Ala Asn
545 550 555 560
Gln Ile Leu Asn Leu Thr Ala Asp Gly Gln Asn Leu Thr Ser Ala Asn
565 570 575
Ile Thr Asn Ile Val Glu Gln Val Lys Arg Ile Val Asn Lys Glu Glu
580 585 590
Asn Ile Asp Ile Thr Leu Gly Ser Thr Leu Met Asn Ile Phe Ser Asn
595 600 605
66 / 87
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
Ile Leu Ser Ser Ser Asp Ser Asp Leu Leu Glu Ser Ser Ser Glu Ala
610 615 620
Leu Lys Thr Ile Asp Glu Leu Ala Phe Lys Ile Asp Leu Asn Ser Thr
625 630 635 640
Ser His Val Asn Ile Thr Thr Arg Asn Leu Ala Leu Ser Val Ser Ser
645 650 655
Leu Leu Pro Gly Thr Asn Ala Ile Ser Asn Phe Ser Ile Gly Leu Pro
660 665 670
Ser Asn Asn Glu Ser Tyr Phe Gln Val Met Ser Gln Trp Phe Leu Ser
675 680 685
Phe
<210> 47
<211> 3252
<212> DNA
<213> homo Sapiens
<400>
47
atgtttcgctcagatcgaatgtggagctgccattggaaatggaagcccagtcctctcctg 60
ttcttatttgctttatatatcatgtgtgttcctcactcagtgtggggatgtgccaactgc 120
cgagtggttttgtccaacccttctgggacctttacttctccatgctaccctaacgactac 180
ccaaacagccaggcttgcatgtggacgctccgagcccccaccggttatatcattcagata 240
acatttaacgactttgacattgaagaagctcccaattgcatttatgactcattatccctt 300
gataatggagagagccagactaaattttgtggagcaactgccaaaggcctatcatttaac 360
tcaagtgcgaatgagatgcatgtgtccttttcaagtgactttagcatccagaagaaaggt 420
ttcaatgccagctacatcagagttgccgtgtccttaaggaatcaaaaggtcattttaccc 480
cagacatcagatgcttaccaggtatctgttgcaaaaagcatctctattccagagctcagt 540
gctttcacactctgctttgaagcaaccaaagttggccatgaagacagtgattggacagct 600
ttctcctactcaaatgcatccttcacacaattgctcagttttggaaaggccaagagtggc 660
tactttctatccatttctgattcaaaatgtttgttgaataatgcattacctgtcaaagaa 720
aaagaagacatttttgcagaaagctttgaacagctctgccttgtttggaataattctttg 780
ggctctattggtgtaaatttcaaaagaaactatgaaacagttccatgtgattctaccatt 840
agtaaagttattcctgggaatgggaaattgttgttgggctccaatcaaaatgaaattgtc 900
tctctaaaaggggacatttataactttcgactttggaattttaccatgaatgccaaaatc 960
ctctccaacctcagctgtaatgtgaaagggaatgtagtcgactggcaaaatgacttctgg 1020
aatatcccaaacctagctctgaaagctgaaagcaacctaagctgtggttcctacctgatc 1080
ccgctcccagcagcagaactggccagctgtgcagacctggggaccctctgtcaagatgga 1140
attatctatagaatatccgtagtgattcagaacatccttcgtcaccctgaggtaaaagta 1200
cagagcaaggtggcagaatggctcaattcaaccttccaaaattggaactacacggtttat 1260
gtcgttaatatcagttttcacctgagtgctggagaggacaagattaaagtcaagagaagc 1320
cttgaggatgagccaaggttggtgctttgggcccttctagtttacaatgctaccaacaat 1380
actaatttagaaggaaaaatcattcagcagaagctcctaaaaaataatgagtccttggat 1440
gaaggcttgaggctacatacagtgaatgtgagacaactgggtcattgtcttgccatggag 1500
gaacccaaaggctactactggccatctatccaaccttctgaatacgttcttccttgtcca 1560
gacaagcctggcttttctgcttctcggatatgtttttacaatgctaccaacccattggta 1620
acctactggggacctgttgatatctccaactgtttaaaagaagcaaatgaagttgctaac 1680
cagattttaaatttaactgctgatgggcagaacttaacctcagccaatattaccaacatt 1740
gtggaacaggtcaaaagaattgtgaataaagaagaaaacattgatataacacttggctca 1800
actctaatgaatatattttctaatatcttaagcagttcagacagtgacttgcttgagtca 1860
tcttctgaagctttaaaaacaattgatgaattggccttcaagatagacctaaatagcaca 1920
tcacatgtgaatattacaactcggaacttggctctcagcgtatcatccctgttaccaggg 1980
acaaatgcaatttcaaattttagcattggtcttccaagcaataatgaatcgtatttccag 2040
atggattttgagagtggacaagtggatccactggcatctgtaattttgcctccaaactta 2100
cttgagaatttaagtccagaagattctgtattagttagaagagcacagtttactttcttc 2160
aacaaaactggacttttccaggatgtaggaccccaaagaaaaactttagtgagttatgtg 2220
atggcgtgcagtattggaaacattactatccagaatctgaaggatcctgttcaaataaaa 2280
atcaaacatacaagaactcaggaagtgcatcatcccatctgtgccttctgggatctgaac 2340
aaaaacaaaagttttggaggatggaacacgtcaggatgtgttgcacacagagattcagat 2400
gcaagtgagacagtctgcctgtgtaaccacttcacacactttggagttctgatggacctt 2460
ccaagaagtgcctcacagttagatgcaagaaacactaaagtcctcactttcatcagctat 2520
attgggtgtggaatatctgctattttttcagcagcaactctcctgacatatgttgctttt 2580
gagaaattgcgaagggattatccctccaaaatcttgatgaacctgagcacagccctgctg 2640
67 / 87
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
ttcctgaatctcctcttcctcctagatggctggatcacctccttcaatgtggatggactt2700
tgcattgctgttgcagtcctgttgcatttcttccttctggcaacctttacctggatgggg2760
ctagaagcaattcacatgtacattgctctagttaaagtatttaacacttacattcgccga2820
tacattctaaaattctgcatcattggctggggtttgcctgccttagtggtgtcagttgtt2880
ctagcgagcagaaacaacaatgaagtctatggaaaagaaagttatgggaaagaaaaaggt2940
gatgaattctgttggattcaagatccagtcatattttatgtgacctgtgctgggtatttt3000
ggagtcatgttttttctgaacattgccatgttcattgtggtaatggtgcagatctgtggg3060
aggaatggcaagagaagcaaccggaccctgagagaagaagtgttaaggaacctgcgcagt3120
gtggttagcttgacctttctgttgggcatgacatggggttttgcattctttgcctgggga3180
cccttaaatatccccttcatgtacctcttctccatcttcaattcattacaaggtaagata3240
aattgtacatga 3252
<210> 48
<211> 1083
<212> PRT
<213> homo Sapiens
<400> 48
Met Phe Arg Ser Asp Arg Met Trp Ser Cys His Trp Lys Trp Lys Pro
1 5 10 15
Ser Pro Leu Leu Phe Leu Phe Ala Leu Tyr Ile Met Cys Val Pro His
20 25 30
Ser Val Trp Gly Cys Ala Asn Cys Arg Val Val Leu Ser Asn Pro Ser
35 40 45
Gly Thr Phe Thr Ser Pro Cys Tyr Pro Asn Asp Tyr Pro Asn Ser Gln
50 55 60
Ala Cys Met Trp Thr Leu Arg Ala Pro Thr Gly Tyr Ile Ile Gln Ile
65 70 75 80
Thr Phe Asn Asp Phe Asp Ile Glu Glu Ala Pro Asn Cys Ile Tyr Asp
85 90 95
Ser Leu Ser Leu Asp Asn Gly Glu Ser Gln Thr Lys Phe Cys Gly Ala
100 105 110
Thr Ala Lys Gly Leu Ser Phe Asn Ser Ser Ala Asn Glu Met His Val
115 120 125
Ser Phe Ser Ser Asp Phe Ser Ile Gln Lys Lys Gly Phe Asn Ala Ser
130 135 140
Tyr Ile Arg Val Ala Val Ser Leu Arg Asn Gln Lys Val Ile Leu Pro
145 150 155 160
Gln Thr Ser Asp Ala Tyr Gln Val Ser Val Ala Lys Ser Ile Ser Ile
165 170 175
Pro Glu Leu Ser Ala Phe Thr Leu Cys Phe Glu Ala Thr Lys Val Gly
180 185 190
His Glu Asp Ser Asp Trp Thr Ala Phe Ser Tyr Ser Asn Ala Ser Phe
195 200 205
Thr Gln Leu Leu Ser Phe Gly Lys Ala Lys Ser Gly Tyr Phe Leu Ser
210 215 220
Ile Ser Asp Ser Lys Cys Leu Leu Asn Asn Ala Leu Pro Val Lys Glu
225 230 235 240
Lys Glu Asp Ile Phe Ala Glu Ser Phe Glu Gln Leu Cys Leu Val Trp
245 250 255
Asn Asn Ser Leu Gly Ser Ile Gly Val Asn Phe Lys Arg Asn Tyr Glu
260 265 270
Thr Val Pro Cys Asp Ser Thr Ile Ser Lys Val Ile Pro Gly Asn Gly
275 280 285
Lys Leu Leu Leu Gly Ser Asn Gln Asn Glu Ile Val Ser Leu Lys Gly
290 295 300
Asp Ile Tyr Asn Phe Arg Leu Trp Asn Phe Thr Met Asn Ala Lys Ile
305 310 315 320
Leu Ser Asn Leu Ser Cys Asn Val Lys Gly Asn Val Val Asp Trp Gln
325 330 335
Asn Asp Phe Trp Asn Ile Pro Asn Leu Ala Leu Lys Ala Glu Ser Asn
340 345 350
Leu Ser Cys Gly Ser Tyr Leu Ile Pro Leu Pro Ala Ala Glu Leu Ala
68 / 87
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
355 360 365
Ser Cys Ala Asp Leu Gly Thr Leu Cys Gln Asp Gly Ile Ile Tyr Arg
370 375 380
Ile Ser Val Val Ile Gln Asn Ile Leu Arg His Pro Glu Val Lys Val
385 390 395 400
Gln Ser Lys Val Ala Glu Trp Leu Asn Ser Thr Phe Gln Asn Trp Asn
405 410 415
Tyr Thr Val Tyr Val Val Asn Ile Ser Phe His Leu Ser Ala Gly Glu
420 425 430
Asp Lys Ile Lys Val Lys Arg Ser Leu Glu Asp Glu Pro Arg Leu Val
435 440 445
Leu Trp Ala Leu Leu Val Tyr Asn Ala Thr Asn Asn Thr Asn Leu Glu
450 455 460
Gly Lys Ile Ile Gln Gln Lys Leu Leu Lys Asn Asn Glu Ser Leu Asp
465 470 475 480
Glu Gly Leu Arg Leu His Thr Val Asn Val Arg Gln Leu Gly His Cys
485 490 495
Leu Ala Met Glu Glu Pro Lys Gly Tyr Tyr Trp Pro Ser Ile Gln Pro
500 505 510
Ser Glu Tyr Val Leu Pro Cys Pro Asp Lys Pro Gly Phe Ser Ala Ser
515 520 525
Arg Ile Cys Phe Tyr Asn Ala Thr Asn Pro Leu Val Thr Tyr Trp Gly
530 535 540
Pro Val Asp Ile Ser Asn Cys Leu Lys Glu Ala Asn Glu Val Ala Asn
545 550 555 560
Gln Ile Leu Asn Leu Thr Ala Asp Gly Gln Asn Leu Thr Ser Ala Asn
565 570 575
Ile Thr Asn Ile Val Glu Gln Val Lys Arg Ile Val Asn Lys Glu Glu
580 585 590
Asn Ile Asp Ile Thr Leu Gly Ser Thr Leu Met Asn Ile Phe Ser Asn
595 600 605
Ile Leu Ser Ser Ser Asp Ser Asp Leu Leu Glu Ser Ser Ser Glu Ala
610 615 620
Leu Lys Thr Ile Asp Glu Leu Ala Phe Lys Ile Asp Leu Asn Ser Thr
625 630 635 640
Ser His Val Asn Ile Thr Thr Arg Asn Leu Ala Leu Ser Val Ser Ser
645 650 655
Leu Leu Pro Gly Thr Asn Ala Ile Ser Asn Phe Ser Ile Gly Leu Pro
660 665 670
Ser Asn Asn Glu Ser Tyr Phe Gln Met Asp Phe Glu Ser Gly Gln Val
675 680 685
Asp Pro Leu Ala Ser Val Ile Leu Pro Pro Asn Leu Leu Glu Asn Leu
690 695 700
Ser Pro Glu Asp Ser Val Leu Val Arg Arg Ala Gln Phe Thr Phe Phe
705 710 715 720
Asn Lys Thr Gly Leu Phe Gln Asp Val Gly Pro Gln Arg Lys Thr Leu
725 730 735
Val Ser Tyr Val Met Ala Cys Ser Ile Gly Asn Ile Thr Ile Gln Asn
740 745 750
Leu Lys Asp Pro Val Gln Ile Lys Ile Lys His Thr Arg Thr Gln Glu
755 760 765
Val His His Pro Ile Cys Ala Phe Trp Asp Leu Asn Lys Asn Lys Ser
770 775 780
Phe Gly Gly Trp Asn Thr Ser Gly Cys Val Ala His Arg Asp Ser Asp
785 790 795 800
Ala Ser Glu Thr Val Cys Leu Cys Asn His Phe Thr His Phe Gly Val
805 810 815
Leu Met Asp Leu Pro Arg Ser Ala Ser Gln Leu Asp Ala Arg Asn Thr
820 825 830
Lys Val Leu Thr Phe Ile Ser Tyr Ile Gly Cys Gly Ile Ser Ala Ile
835 840 845
Phe Ser Ala Ala Thr Leu Leu Thr Tyr Val Ala Phe Glu Lys Leu Arg
850 855 860
69 / 87
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
Arg Asp Tyr Pro Ser Lys Ile Leu Met Asn Leu Ser Thr Ala Leu Leu
865 870 875 880
Phe Leu Asn Leu Leu Phe Leu Leu Asp Gly Trp Ile Thr Ser Phe Asn
885 890 895
Val Asp Gly Leu Cys Ile Ala Val Ala Val Leu Leu His Phe Phe Leu
900 905 910
Leu Ala Thr Phe Thr Trp Met Gly Leu Glu Ala Ile His Met Tyr Ile
915 920 925
Ala Leu Val Lys Val Phe Asn Thr Tyr Ile Arg Arg Tyr Ile Leu Lys
930 935 940
Phe Cys Ile Ile Gly Trp Gly Leu Pro Ala Leu Val Val Ser Val Val
945 950 955 960
Leu Ala Ser Arg Asn Asn Asn Glu Val Tyr Gly Lys Glu Ser Tyr Gly
965 970 975
Lys Glu Lys Gly Asp Glu Phe Cys Trp Ile Gln Asp Pro Val Ile Phe
980 985 990
Tyr Val Thr Cys Ala Gly Tyr Phe Gly Val Met Phe Phe Leu Asn Ile
995 1000 1005
Ala Met Phe Ile Val Val Met Val Gln Ile Cys Gly Arg Asn Gly Lys
1010 1015 1020
Arg Ser Asn Arg Thr Leu Arg Glu Glu Val Leu Arg Asn Leu Arg Ser
1025 1030 1035 1040
Val Val Ser Leu Thr Phe Leu Leu Gly Met Thr Trp Gly Phe Ala Phe
1045 1050 1055
Phe Ala Trp Gly Pro Leu Asn Ile Pro Phe Met Tyr Leu Phe Ser Ile
1060 1065 1070
Phe Asn Ser Leu Gln Gly Lys Ile Asn Cys Thr
1075 1080
<210> 49
<211> 3669
<212> DNA
<213> homo sapiens
<400>
49
atgatgtttcgctcagatcgaatgtggagctgccattggaaatggaagcccagtcctctc 60
ctgttcttatttgctttatatatcatgtgtgttcctcactcagtgtggggatgtgccaac 120
tgccgagtggttttgtccaacccttctgggacctttacttctccatgctaccctaacgac 180
tacccaaacagccaggcttgcatgtggacgctccgagcccccaccggttatatcattcag 240
ataacatttaacgactttgacattgaagaagctcccaattgcatttatgactcattatcc 300
cttgataatggagagagccagactaaattttgtggagcaactgccaaaggcctatcattt 360
aactcaagtgcgaatgagatgcatgtgtccttttcaagtgactttagcatccagaagaaa 420
ggtttcaatgccagctacatcagagttgccgtgtccttaaggaatcaaaaggtcatttta 480
ccccagacatcagatgcttaccaggtatctgttgcaaaaagcatctctattccagagctc 540
agtgctttcacactctgctttgaagcaaccaaagttggccatgaagacagtgattggaca 600
gctttctcctactcaaatgcatccttcacacaattgctcagttttggaaaggccaagagt 660
ggctactttctatccatttctgattcaaaatgtttgttgaataatgcattacctgtcaaa 720
gaaaaagaagacatttttgcagaaagctttgaacagctctgccttgtttggaataattct 780
ttgggctctattggtgtaaatttcaaaagaaactatgaaacagttccatgtgattctacc 840
attagtaaagttattcctgggaatgggaaattgttgttgggctccaatcaaaatgaaatt 900
gtctctctaaaaggggacatttataactttcgactttggaattttaccatgaatgccaaa 960
atcctctccaacctcagctgtaatgtgaaagggaatgtagtcgactggcaaaatgacttc 1020
tggaatatcccaaacctagctctgaaagctgaaagcaacctaagctgtggttcctacctg 1080
atcccgctcccagcagcagaactggccagctgtgcagacctggggaccctctgtcaagat 1140
ggaattatctatagaatatccgtagtgattcagaacatccttcgtcaccctgaggtaaaa 1200
gtacagagcaaggtggcagaatggctcaattcaaccttccaaaattggaactacacggtt 1260
tatgtcgttaatatcagttttcacctgagtgctggagaggacaagattaaagtcaagaga 1320
agccttgaggatgagccaaggttggtgctttgggcccttctagtttacaatgctaccaac 1380
aatactaatttagaaggaaaaatcattcagcagaagctcctaaaaaataatgagtccttg 1440
gatgaaggcttgaggctacatacagtgaatgtgagacaactgggtcattgtcttgccatg 1500
gaggaacccaaaggctactactggccatctatccaaccttctgaatacgttcttccttgt 1560
ccagacaagcctggcttttctgcttctcggatatgtttttacaatgctaccaacccattg 1620
gtaacctactggggacctgttgatatctccaactgtttaaaagaagcaaatgaagttgct 1680
70 / 87
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
aaccagattttaaatttaactgctgatgggcagaacttaacctcagccaatattaccaac 1740
attgtggaacaggtcaaaagaattgtgaataaagaagaaaacattgatataacacttggc 1800
tcaactctaatgaatatattttctaatatcttaagcagttcagacagtgacttgcttgag 1860
tcatcttctgaagctttaaaaacaattgatgaattggccttcaagatagacctaaatagc 1920
acatcacatgtgaatattacaactcggaacttggctctcagcgtatcatccctgttacca 1980
gggacaaatgcaatttcaaattttagcattggtcttccaagcaataatgaatcgtatttc 2040
cagatggattttgagagtggacaagtggatccactggcatctgtaattttgcctccaaac 2100
ttacttgagaatttaagtccagaagattctgtattagttagaagagcacagtttactttc 2160
ttcaacaaaactggacttttccaggatgtaggaccccaaagaaaaactttagtgagttat 2220
gtgatggcgtgcagtattggaaacattactatccagaatctgaaggatcctgttcaaata 2280
aaaatcaaacatacaagaactcaggaagtgcatcatcccatctgtgccttctgggatctg 2340
aacaaaaacaaaagttttggaggatggaacacgtcaggatgtgttgcacacagagattca 2400
gatgcaagtgagacagtctgcctgtgtaaccacttcacacactttggagttctgatggac 2460
cttccaagaagtgcctcacagttagatgcaagaaacactaaagtcctcactttcatcagc 2520
tatattgggtgtggaatatctgctattttttcagcagcaactctcctgacatatgttgct 2580
tttgagaaattgcgaagggattatccctccaaaatcttgatgaacctgagcacagccctg 2640
ctgttcctgaatctcctcttcctcctagatggctggatcacctccttcaatgtggatgga 2700
ctttgcattgctgttgcagtcctgttgcatttcttccttctggcaacctttacctggatg 2760
gggctagaagcaattcacatgtacattgctctagttaaagtatttaacacttacattcgc 2820
cgatacattctaaaattctgcatcattggctggggtttgcctgccttagtggtgtcagtt 2880
gttctagcgagcagaaacaacaatgaagtctatggaaaagaaagttatgggaaagaaaaa 2940
ggtgatgaattctgttggattcaagatccagtcatattttatgtgacctgtgctgggtat 3000
tttggagtcatgttttttctgaacattgccatgttcattgtggtaatggtgcagatctgt 3060
gggaggaatggcaagagaagcaaccggaccctgagagaagaagtgttaaggaacctgcgc 3120
agtgtggttagcttgacctttctgttgggcatgacatggggttttgcattctttgcctgg 3180
ggacccttaaatatccccttcatgtacctcttctccatcttcaattcatt'acaaggctta 3240
tttatattcatcttccactgtgctatgaaggagaatgttcagaaacagtggcggcggcat 3300
ctctgctgtggtagatttcggttagcagataactcagattggagtaagacagctaccaat 3360
atcatcaagaaaagttctgataatctaggaaaatctttgtcttcaagctccattggttcc 3420
aactcaacctatcttacatccaaatctaaatccagctctaccacctatttcaaaaggaat 3480
agccacacagacagtgcttccatggacaagtccttgtcaaaactggcccatgctgatgga 3540
gatcaaacatcaatcatccctgtccatcaggtcattgataaggtcaagggttattgcaat 3600
gctcattcagacaacttctataaaaatattatcatgtcagacaccttcagccacagcaca 3660
aagttttaa 3669
<210> 50
<211> 1222
<212> PRT
<213> homo Sapiens
<400> 50
Met Met Phe Arg Ser Asp Arg Met Trp Ser Cys His Trp Lys Trp Lys
1 5 10 15
Pro Ser Pro Leu Leu Phe Leu Phe Ala Leu Tyr Ile Met Cys Val Pro
20 25 30
His Ser Val Trp Gly Cys Ala Asn Cys Arg Val Val Leu Ser Asn Pro
35 40 45
Ser Gly Thr Phe Thr Ser Pro Cys Tyr Pro Asn Asp Tyr Pro Asn Ser
50 55 60
Gln Ala Cys Met Trp Thr Leu Arg Ala Pro Thr Gly Tyr Ile Ile Gln
65 70 75 80
Ile Thr Phe Asn Asp Phe Asp Ile Glu Glu Ala Pro Asn Cys Ile Tyr
85 90 95
Asp Ser Leu Ser Leu Asp Asn Gly Glu Ser Gln Thr Lys Phe Cys Gly
100 105 110
Ala Thr Ala Lys Gly Leu Ser Phe Asn Ser Ser Ala Asn Glu Met His
115 120 125
Val Ser Phe Ser Ser Asp Phe Ser Ile Gln Lys Lys Gly Phe Asn Ala
130 135 140
Ser Tyr Ile Arg Val Ala Val Ser Leu Arg Asn Gln Lys Val Ile Leu
145 150 155 160
Pro Gln Thr Ser Asp Ala Tyr Gln Val Ser Val Ala Lys Ser Ile Ser
165 170 175
71 / 87
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
Ile Pro Glu Leu Ser Ala Phe Thr Leu Cys Phe Glu Ala Thr Lys Val
180 185 190
Gly His Glu Asp Ser Asp Trp Thr Ala Phe Ser Tyr Ser Asn Ala Ser
195 200 205
Phe Thr Gln Leu Leu Ser Phe Gly Lys Ala Lys Ser Gly Tyr Phe Leu
210 215 220
Ser Ile Ser Asp Ser Lys Cys Leu Leu Asn Asn Ala Leu Pro Val Lys
225 230 235 240
Glu Lys Glu Asp Ile Phe Ala Glu Ser Phe Glu Gln Leu Cys Leu Val
245 250 255
Trp Asn Asn Ser Leu Gly Ser Ile Gly Val Asn Phe Lys Arg Asn Tyr
260 265 270
Glu Thr Val Pro Cys Asp Ser Thr Ile Ser Lys Val Ile Pro Gly Asn
275 280 285
Gly Lys Leu Leu Leu Gly Ser Asn Gln Asn Glu Ile Val Ser Leu Lys
290 295 300
Gly Asp Ile Tyr Asn Phe Arg Leu Trp Asn Phe Thr Met Asn Ala Lys
305 310 315 320
Ile Leu Ser Asn Leu Ser Cys Asn Val Lys Gly Asn Val Val Asp Trp
325 330 335
Gln Asn Asp Phe Trp Asn Ile Pro Asn Leu Ala Leu Lys Ala Glu Ser
340 345 350
Asn Leu Ser Cys Gly Ser Tyr Leu Ile Pro Leu Pro Ala Ala Glu Leu
355 360 365
Ala Ser Cys Ala Asp Leu Gly Thr Leu Cys Gln Asp Gly Ile Ile Tyr
370 375 380
Arg Ile Ser Val Val Ile Gln Asn Ile Leu Arg His Pro Glu Val Lys
385 390 395 400
Val Gln Ser Lys Val Ala Glu Trp Leu Asn Ser Thr Phe Gln Asn Trp
405 410 415
Asn Tyr Thr Val Tyr Val Val Asn Ile Ser Phe His Leu Ser Ala Gly
420 425 430
Glu Asp Lys Ile Lys Val Lys Arg Ser Leu Glu Asp Glu Pro Arg Leu
435 440 445
Val Leu Trp Ala Leu Leu Val Tyr Asn Ala Thr Asn Asn Thr Asn Leu
450 455 460
Glu Gly Lys Ile Ile Gln Gln Lys Leu Leu Lys Asn Asn Glu Ser Leu
465 470 475 480
Asp Glu Gly Leu Arg Leu His Thr Val Asn Val Arg Gln Leu Gly His
485 490 495
Cys Leu Ala Met Glu Glu Pro Lys Gly Tyr Tyr Trp Pro Ser Ile Gln
500 505 510
Pro Ser Glu Tyr Val Leu Pro Cys Pro Asp Lys Pro Gly Phe Ser Ala
515 520 525
Ser Arg Ile Cys Phe Tyr Asn Ala Thr Asn Pro Leu Val Thr Tyr Trp
530 535 540
Gly Pro Val Asp Ile Ser Asn Cys Leu Lys Glu Ala Asn Glu Val Ala
545 550 555 560
Asn Gln Ile Leu Asn Leu Thr Ala Asp Gly Gln Asn Leu Thr Ser Ala
565 570 575
Asn Ile Thr Asn Ile Val Glu Gln Val Lys Arg Ile Val Asn Lys Glu
580 585 590
Glu Asn Ile Asp Ile Thr Leu Gly Ser Thr Leu Met Asn Ile Phe Ser
595 600 605
Asn Ile Leu Ser Ser Ser Asp Ser Asp Leu Leu Glu Ser Ser Ser Glu
610 615 620
Ala Leu Lys Thr Ile Asp Glu Leu Ala Phe Lys Ile Asp Leu Asn Ser
625 630 635 640
Thr Ser His Val Asn Ile Thr Thr Arg Asn Leu Ala Leu Ser Val Ser
645 650 655
Ser Leu Leu Pro Gly Thr Asn Ala Ile Ser Asn Phe Ser Ile Gly Leu
660 665 670
Pro Ser Asn Asn Glu Ser Tyr Phe Gln Met Asp Phe Glu Ser Gly Gln
72 / 87
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
675 680 685
Val Asp Pro Leu Ala Ser Val Ile Leu Pro Pro Asn Leu Leu Glu Asn
690 695 700
Leu Ser Pro Glu Asp Ser Val Leu Val Arg Arg Ala Gln Phe Thr Phe
705 710 715 720
Phe Asn Lys Thr Gly Leu Phe Gln Asp Val Gly Pro Gln Arg Lys Thr
725 730 735
Leu Val Ser Tyr Val Met Ala Cys Ser Ile Gly Asn Ile Thr Ile Gln
740 745 750
Asn Leu Lys Asp Pro Val Gln Ile Lys Ile Lys His Thr Arg Thr Gln
755 760 765
Glu Val His His Pro Ile Cys Ala Phe Trp Asp Leu Asn Lys Asn Lys
770 775 780
Ser Phe Gly Gly Trp Asn Thr Ser Gly Cys Val Ala His Arg Asp Ser
785 790 795 800
Asp Ala Ser Glu Thr Val Cys Leu Cys Asn His Phe Thr His Phe Gly
805 810 815
Val Leu Met Asp Leu Pro Arg Ser Ala Ser Gln Leu Asp Ala Arg Asn
820 825 830
Thr Lys Val Leu Thr Phe Ile Ser Tyr Ile Gly Cys Gly Ile Ser Ala
835 840 845
Ile Phe Ser Ala Ala Thr Leu Leu Thr Tyr Val Ala Phe Glu Lys Leu
850 855 860
Arg Arg Asp Tyr Pro Ser Lys Ile Leu Met Asn Leu Ser Thr Ala Leu
865 870 875 880
Leu Phe Leu Asn Leu Leu Phe Leu Leu Asp Gly Trp Ile Thr Ser Phe
885 890 895
Asn Val Asp Gly Leu Cys Ile Ala Val Ala Val Leu Leu His Phe Phe
900 905 910
Leu Leu Ala Thr Phe Thr Trp Met Gly Leu Glu Ala Ile His Met Tyr
915 920 925
Ile Ala Leu Val Lys Val Phe Asn Thr Tyr Ile Arg Arg Tyr Ile Leu
930 935 940
Lys Phe Cys Ile Ile Gly Trp Gly Leu Pro Ala Leu Val Val Ser Val
945 950 955 960
Val Leu Ala Ser Arg Asn Asn Asn Glu Val Tyr Gly Lys Glu Ser Tyr
965 970 975
Gly Lys Glu Lys Gly Asp Glu Phe Cys Trp Ile Gln Asp Pro Val Ile
980 985 990
Phe Tyr Val Thr Cys Ala Gly Tyr Phe Gly Val Met Phe Phe Leu Asn
995 1000 1005
Ile Ala Met Phe Ile Val Val Met Val Gln Ile Cys Gly Arg Asn Gly
1010 1015 1020
Lys Arg Ser Asn Arg Thr Leu Arg Glu Glu Val Leu Arg Asn Leu Arg
1025 1030 1035 1040
Ser Val Val Ser Leu Thr Phe Leu Leu Gly Met Thr Trp Gly Phe Ala
1045 1050 1055
Phe Phe Ala Trp Gly Pro Leu Asn Ile Pro Phe Met Tyr Leu Phe Ser
1060 1065 1070
Ile Phe Asn Ser Leu Gln Gly Leu Phe Ile Phe Ile Phe His Cys Ala
1075 1080 1085
Met Lys Glu Asn Val Gln Lys Gln Trp Arg Arg His Leu Cys Cys Gly
1090 1095 1100
Arg Phe Arg Leu Ala Asp Asn Ser Asp Trp Ser Lys Thr Ala Thr Asn
1105 1110 1115 1120
Ile Ile Lys Lys Ser Ser Asp Asn Leu Gly Lys Ser Leu Ser Ser Ser
1125 1130 1135
Ser Ile Gly Ser Asn Ser Thr Tyr Leu Thr Ser Lys Ser Lys Ser Ser
1140 1145 1150
Ser Thr Thr Tyr Phe Lys Arg Asn Ser His Thr Asp Ser Ala Ser Met
1155 1160 1165
Asp Lys Ser Leu Ser Lys Leu Ala His Ala Asp Gly Asp Gln Thr Ser
1170 1175 1180
73 / 87
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
Ile Ile Pro Val His Gln Val Ile Asp Lys Val Lys Gly Tyr Cys Asn
1185 1190 1195 1200
Ala His Ser Asp Asn Phe Tyr Lys Asn Ile Ile Met Ser Asp Thr Phe
1205 1210 1215
Ser His Ser Thr Lys Phe
1220
<210> 51
<211> 3582
<212> DNA
<213> homo Sapiens
<400>
51
atgatgtttcgctcagatcgaatgtggagctgccattggaaatggaagcccagtcctctc 60
ctgttcttatttgctttatatatcatgtgtgttcctcactcagtgtggggatgtgccaac 120
tgccgagtggttttgtccaacccttctgggacctttacttctccatgctaccctaacgac 180
tacccaaacagccaggcttgcatgtggacgctccgagcccccaccggttatatcattcag 240
ataacatttaacgactttgacattgaagaagctcccaattgcatttatgactcattatcc 300
cttgataatggagagagccagactaaattttgtggagcaactgccaaaggcctatcattt 360
aactcaagtgcgaatgagatgcatgtgtccttttcaagtgactttagcatccagaagaaa 420
ggtttcaatgccagctacatcagagttgccgtgtccttaaggaatcaaaaggtcatttta 480
ccccagacatcagatgcttaccaggtatctgttgcaaaaagcatctctattccagagctc 540
agtgctttcacactctgctttgaagcaaccaaagttggccatgaagacagtgattggaca 600
gctttctcctactcaaatgcatccttcacacaattgctcagttttggaaaggccaagagt 660
ggctactttctatccatttctgattcaaaatgtttgttgaataatgcattacctgtcaaa 720
gaaaaagaagacatttttgcagaaagctttgaacagctctgccttgtttggaataattct 780
ttgggctctattggtgtaaatttcaaaagaaactatgaaacagttccatgtgattctacc 840
attagtaaagttattcctgggaatgggaaattgttgttgggctccaatcaaaatgaaatt 900
gtctctctaaaaggggacatttataactttcgactttggaattttaccatgaatgccaaa 960
atcctctccaacctcagctgtaatgtgaaagggaatgtagtcgactggcaaaatgacttc 1020
tggaatatcccaaacctagctctgaaagctgaaagcaacctaagctgtggttcctacctg 1080
atcccgctcccagcagcagaactggccagctgtgcagacctggggaccctctgtcaagat 1140
ggaattatctatagaatatccgtagtgattcagaacatccttcgtcaccctgaggtaaaa 1200
gtacagagcaaggtggcagaatggctcaattcaaccttccaaaattggaactacacggtt 1260
tatgtcgttaatatcagttttcacctgagtgctggagaggacaagattaaagtcaagaga 1320
agccttgaggatgagccaaggttggtgctttgggcccttctagtttacaatgctaccaac 1380
aatactaatttagaaggaaaaatcattcagcagaagctcctaaaaaataatgagtccttg 1440
gatgaaggcttgaggctacatacagtgaatgtgagacaactgggtcattgtcttgccatg 1500
gaggaacccaaaggctactactggccatctatccaaccttctgaatacgttcttccttgt 1560
ccagacaagcctggcttttctgcttctcggatatgtttttacaatgctaccaacccattg 1620
gtaacctactggggacctgttgatatctccaactgtttaaaagaagcaaatgaagttgct 1680
aaccagattttaaatttaactgctgatgggcagaacttaacctcagccaatattaccaac 1740
attgtggaacaggtcaaaagaattgtgaataaagaagaaaacattgatataacacttggc 1800
tcaactctaatgaatatattttctaatatcttaagcagttcagacagtgacttgcttgag 1860
tcatcttctgaagctttaaaaacaattgatgaattggccttcaagatagacctaaatagc 1920
acatcacatgtgaatattacaactcggaacttggctctcagcgtatcatccctgttacca 1980
gggacaaatgcaatttcaaattttagcattggtcttccaagcaataatgaatcgtatttc 2040
cagatggattttgagagtggacaagtggatccactggcatctgtaattttgcctccaaac 2100
ttacttgagaatttaagtccagaagattctgtattagttagaagagcacagtttactttc 2160
ttcaacaaaactggacttttccaggatgtaggaccccaaagaaaaactttagtgagttat 2220
gtgatggcgtgcagtattggaaacattactatccagaatctgaaggatcctgttcaaata 2280
aaaatcaaacatacaagaactcaggaagtgcatcatcccatctgtgccttctgggatctg 2340
aacaaaaacaaaagttttggaggatggaacacgtcaggatgtgttgcacacagagattca 2400
gatgcaagtgagacagtctgcctgtgtaaccacttcacacactttggagttctgatggac 2460
cttccaagaagtgcctcacagttagatgcaagaaacactaaagtcctcactttcatcagc 2520
tatattgggtgtggaatatctgctattttttcagcagcaactctcctgacatatgttgct 2580
tttgagaaattgcgaagggattatccctccaaaatcttgatgaacctgagcacagccctg 2640
ctgttcctgaatctcctcttcctcctagatggctggatcacctccttcaatgtggatgga 2700
ctttgcattgctgttgcagtcctgttgcatttcttccttctggcaacctttacctggatg 2760
gggctagaagcaattcacatgtacattgctctagttaaagtatttaacacttacattcgc 2820
cgatacattctaaaattctgcatcattggctggggtttgcctgccttagtggtgtcagtt 2880
gttctagcgagcagaaacaacaatgaagtctatggaaaagaaagttatgggaaagaaaaa 2940
ggtgatgaattctgttggat~tcaagatccagtcatattttatgtgacctgtgctgggtat 3000
74 / 87
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
tttggagtcatgttttttctgaacattgccatgttcattgtggtaatggtgcagatctgt 3060
gggaggaatggcaagagaagcaaccggaccctgagagaagaagtgttaaggaacctgcgc 3120
agtgtggttagcttgacctttctgttgggcatgacatggggttttgcattctttgcctgg 3180
ggacccttaaatatccccttcatgtacctcttctccatcttcaattcattacaaggctta 3240
tttatattcatcttccactgtgctatgaaggagaatgttcagaaacagtggcggcggcat 3300
ctctgctgtggtagatttcggttagcagataactcagattggagtaagacagctaccaat 3360
atcatcaagaaaagttctgataatctaggaaaatctttgtcttcaagctccattggttcc 3420
aactcaacctatcttacatccaaatctaaatccagctctaccacctatttcaaaaggaat 3480
agccacacagataatgtctcctatgagcattccttcaacaaaagtggatcactcagacag 3540
tgcttccatggacaagtccttgtcaaaactggcccatgctga 3582
<210> 52
<211> 1193
<212> PRT
<213> homo Sapiens
<400> 52
Met Met Phe Arg Ser Asp Arg Met Trp Ser Cys His Trp Lys Trp Lys
1 5 10 15
Pro Ser Pro Leu Leu Phe Leu Phe Ala Leu Tyr Ile Met Cys Val Pro
20 25 30
His Ser Val Trp Gly Cys Ala Asn Cys Arg Val Val Leu Ser Asn Pro
35 40 45
Ser Gly Thr Phe Thr Ser Pro Cys Tyr Pro Asn Asp Tyr Pro Asn Ser
50 55 60
Gln Ala Cys Met Trp Thr Leu Arg Ala Pro Thr Gly Tyr Ile Ile Gln
65 70 75 80
Ile Thr Phe Asn Asp Phe Asp Ile Glu Glu Ala Pro Asn Cys Ile Tyr
85 90 95
Asp Ser Leu Ser Leu Asp Asn Gly Glu Ser Gln Thr Lys Phe Cys Gly
100 105 110
Ala Thr Ala Lys Gly Leu Ser Phe Asn Ser Ser Ala Asn Glu Met His
115 120 125
Val Ser Phe Ser Ser Asp Phe Ser Ile Gln Lys Lys Gly Phe Asn Ala
130 135 140
Ser Tyr Ile Arg Val Ala Val Ser Leu Arg Asn Gln Lys Val Ile Leu
145 150 155 160
Pro Gln Thr Ser Asp Ala Tyr Gln Val Ser Val Ala Lys Ser Ile Ser
165 170 175
Ile Pro Glu Leu Ser Ala Phe Thr Leu Cys Phe Glu Ala Thr Lys Val
180 185 190
Gly His Glu Asp Ser Asp Trp Thr Ala Phe Ser Tyr Ser Asn Ala Ser
195 200 205
Phe Thr Gln Leu Leu Ser Phe Gly Lys Ala Lys Ser Gly Tyr Phe Leu
210 215 220
Ser Ile Ser Asp Ser Lys Cys Leu Leu Asn Asn Ala Leu Pro Val Lys
225 230 235 240
Glu Lys Glu Asp Ile Phe Ala Glu Ser Phe Glu Gln Leu Cys Leu Val
245 250 255
Trp Asn Asn Ser Leu Gly Ser Ile Gly Val Asn Phe Lys Arg Asn Tyr
260 265 270
Glu Thr Val Pro Cys Asp Ser Thr Ile Ser Lys Val Ile Pro Gly Asn
275 280 285
Gly Lys Leu Leu Leu Gly Ser Asn Gln Asn Glu Ile Val Ser Leu Lys
290 295 300
Gly Asp Ile Tyr Asn Phe Arg Leu Trp Asn Phe Thr Met Asn Ala Lys
305 310 315 320
Ile Leu Ser Asn Leu Ser Cys Asn Val Lys Gly Asn Val Val Asp Trp
325 330 335
Gln Asn Asp Phe Trp Asn Ile Pro Asn Leu Ala Leu Lys Ala Glu Ser
340 345 350
Asn Leu Ser Cys Gly Ser Tyr Leu Ile Pro Leu Pro Ala Ala Glu Leu
355 360 365
75 / 87
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
Ala Ser Cys Ala Asp Leu Gly Thr Leu Cys Gln Asp Gly Ile Ile Tyr
370 375 380
Arg Ile Ser Val Val Ile Gln Asn Ile Leu Arg His Pro Glu Val Lys
385 390 395 400
Val Gln Ser Lys Val Ala Glu Trp Leu Asn Ser Thr Phe Gln Asn Trp
405 410 415
Asn Tyr Thr Val Tyr Val Val Asn Ile Ser Phe His Leu Ser Ala Gly
420 425 430
Glu Asp Lys Ile Lys Val Lys Arg Ser Leu Glu Asp Glu Pro Arg Leu
435 440 445
Val Leu Trp Ala Leu Leu Val Tyr Asn Ala Thr Asn Asn Thr Asn Leu
450 455 460
Glu Gly Lys Ile Ile Gln Gln Lys Leu Leu Lys Asn Asn Glu Ser Leu
465 470 475 480
Asp Glu Gly Leu Arg Leu His Thr Val Asn Val Arg Gln Leu Gly His
485 490 495
Cys Leu Ala Met Glu Glu Pro Lys Gly Tyr Tyr Trp Pro Ser Ile Gln
500 505 510
Pro Ser Glu Tyr Val Leu Pro Cys Pro Asp Lys Pro Gly Phe Ser Ala
515 520 525
Ser Arg Ile Cys Phe Tyr Asn Ala Thr Asn Pro Leu Val Thr Tyr Trp
530 535 540
Gly Pro Val Asp Ile Ser Asn Cys Leu Lys Glu Ala Asn Glu Val Ala
545 550 555 560
Asn Gln Ile Leu Asn Leu Thr Ala Asp Gly Gln Asn Leu Thr Ser Ala
565 570 575
Asn Ile Thr Asn Ile Val Glu Gln Val Lys Arg Ile Val Asn Lys Glu
580 585 590
Glu Asn Ile Asp Ile Thr Leu Gly Ser Thr Leu Met Asn Ile Phe Ser
595 600 605
Asn Ile Leu Ser Ser Ser Asp Ser Asp Leu Leu Glu Ser Ser Ser Glu
610 615 620
Ala Leu Lys Thr Ile Asp Glu Leu Ala Phe Lys Ile Asp Leu Asn Ser
625 630 635 640
Thr Ser His Val Asn Ile Thr Thr Arg Asn Leu Ala Leu Ser Val Ser
645 650 655
Ser Leu Leu Pro Gly Thr Asn Ala Ile Ser Asn Phe Ser Ile Gly Leu
660 665 670
Pro Ser Asn Asn Glu Ser Tyr Phe Gln Met Asp Phe Glu Ser Gly Gln
675 680 685
Val Asp Pro Leu Ala Ser Val Ile Leu Pro Pro Asn Leu Leu Glu Asn
690 695 700
Leu Ser Pro Glu Asp Ser Val Leu Val Arg Arg Ala Gln Phe Thr Phe
705 710 715 720
Phe Asn Lys Thr Gly Leu Phe Gln Asp Val Gly Pro Gln Arg Lys Thr
725 730 735
Leu Val Ser Tyr Val Met Ala Cys Ser Ile Gly Asn Ile Thr Ile Gln
740 745 750
Asn Leu Lys Asp Pro Val Gln Ile Lys Ile Lys His Thr Arg Thr Gln
755 760 765
Glu Val His His Pro Ile Cys Ala Phe Trp Asp Leu Asn Lys Asn Lys
770 775 780
Ser Phe Gly Gly Trp Asn Thr Ser Gly Cys Val Ala His Arg Asp Ser
785 790 795 800
Asp Ala Ser Glu Thr Val Cys Leu Cys Asn His Phe Thr His Phe Gly
805 810 815
Val Leu Met Asp Leu Pro Arg Ser Ala Ser Gln Leu Asp Ala Arg Asn
820 825 830
Thr Lys Val Leu Thr Phe Ile Ser Tyr Ile Gly Cys Gly Ile Ser Ala
835 840 845
Ile Phe Ser Ala Ala Thr Leu Leu Thr Tyr Val Ala Phe Glu Lys Leu
850 855 860
Arg Arg Asp Tyr Pro Ser Lys Ile Leu Met Asn Leu Ser Thr Ala Leu
76 / 87
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
865 870 875 880
Leu Phe Leu Asn Leu Leu Phe Leu Leu Asp Gly Trp Ile Thr Ser Phe
885 890 895
Asn Val Asp Gly Leu Cys Ile Ala Val Ala Val Leu Leu His Phe Phe
900 905 910
Leu Leu Ala Thr Phe Thr Trp Met Gly Leu Glu Ala Ile His Met Tyr
915 920 925
Ile Ala Leu Val Lys Val Phe Asn Thr Tyr Ile Arg Arg Tyr Ile Leu
930 935 940
Lys Phe Cys Ile Ile Gly Trp Gly Leu Pro Ala Leu Val Val Ser Val
945 950 955 960
Val Leu Ala Ser Arg Asn Asn Asn Glu Val Tyr Gly Lys Glu Ser Tyr
965 970 975
Gly Lys Glu Lys Gly Asp Glu Phe Cys Trp Ile Gln Asp Pro Val Ile
980 985 990
Phe Tyr Val Thr Cys Ala Gly Tyr Phe Gly Val Met Phe Phe Leu Asn
995 1000 1005
Ile Ala Met Phe Ile Val Val Met Val Gln Ile Cys Gly Arg Asn Gly
1010 1015 1020
Lys Arg Ser Asn Arg Thr Leu Arg Glu Glu Val Leu Arg Asn Leu Arg
1025 1030 1035 1040
Ser Val Val Ser Leu Thr Phe Leu Leu Gly Met Thr Trp Gly Phe Ala
1045 1050 1055
Phe Phe Ala Trp Gly Pro Leu Asn Ile Pro Phe Met Tyr Leu Phe Ser
1060 1065 1070
Ile Phe Asn Ser Leu Gln Gly Leu Phe Ile Phe Ile Phe His Cys Ala
1075 1080 1085
Met Lys Glu Asn Val Gln Lys Gln Trp Arg Arg His Leu Cys Cys Gly
1090 1095 1100
Arg Phe Arg Leu Ala Asp Asn Ser Asp Trp Ser Lys Thr Ala Thr Asn
1105 1110 1115 1120
Ile Ile Lys Lys Ser Ser Asp Asn Leu Gly Lys Ser Leu Ser Ser Ser
1125 1130 1135
Ser Ile Gly Ser Asn Ser Thr Tyr Leu Thr Ser Lys Ser Lys Ser Ser
1140 1145 1150
Ser Thr Thr Tyr Phe Lys Arg Asn Ser His Thr Asp Asn Val Ser Tyr
1155 1160 1165
Glu His Ser Phe Asn Lys Ser Gly Ser Leu Arg Gln Cys Phe His Gly
1170 1175 1180
Gln Val Leu Val Lys Thr Gly Pro Cys
1185 1190
<210> 53
<211> 2073
<212> DNA
<213> homo sapiens
<400>
53
atgatgtttcgctcagatcgaatgtggagctgccattggaaatggaagcccagtcctctc 60
ctgttcttatttgctttatatatcatgtgtgttcctcactcagtgtggggatgtgccaac 120
tgccgagtggttttgtccaacccttctgggacctttacttctccatgctaccctaacgac 180
tacccaaacagccaggcttgcatgtggacgctccgagcccccaccggttatatcattcag 240
ataacatttaacgactttgacattgaagaagctcccaattgcatttatgactcattatcc 300
cttgataatggagagagccagactaaattttgtggagcaactgccaaaggcctatcattt 360
aactcaagtgcgaatgagatgcatgtgtccttttcaagtgactttagcatccagaagaaa 420
ggtttcaatgccagctacatcagagttgccgtgtccttaaggaatcaaaaggtcatttta 480
ccccagacatcagatgcttaccaggtatctgttgcaaaaagcatctctattccagagctc 540
agtgctttcacactctgctttgaagcaaccaaagttggccatgaagacagtgattggaca 600
gctttctcctactcaaatgcatccttcacacaattgctcagttttggaaaggccaagagt 660
ggctactttctatccatttctgattcaaaatgtttgttgaataatgcattacctgtcaaa 720
gaaaaagaagacatttttgcagaaagctttgaacagctctgccttgtttggaataattct 780
ttgggctctattggtgtaaatttcaaaagaaactatgaaacagttccatgtgattctacc 840
attagtaaagttattcctgggaatgggaaattgttgttgggctccaatcaaaatgaaatt 900
77 / 87
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
gtctctctaaaaggggacatttataactttcgactttggaattttaccatgaatgccaaa 960
atcctctccaacctcagctgtaatgtgaaagggaatgtagtcgactggcaaaatgacttc 1020
tggaatatcccaaacctagctctgaaagctgaaagcaacctaagctgtggttcctacctg 1080
atcccgctcccagcagcagaactggccagctgtgcagacctggggaccctctgtcaagat 1140
ggaattatctatagaatatccgtagtgattcagaacatccttcgtcaccctgaggtaaaa 1200
gtacagagcaaggtggcagaatggctcaattcaaccttccaaaattggaactacacggtt 1260
tatgtcgttaatatcagttttcacctgagtgctggagaggacaagattaaagtcaagaga 1320
agccttgaggatgagccaaggttggtgctttgggcccttctagtttacaatgctaccaac 1380
aatactaatttagaaggaaaaatcattcagcagaagctcctaaaaaataatgagtccttg 1440
gatgaaggcttgaggctacatacagtgaatgtgagacaactgggtcattgtcttgccatg 1500
gaggaacccaaaggctactactggccatctatccaaccttctgaatacgttcttccttgt 1560
ccagacaagcctggcttttctgcttctcggatatgtttttacaatgctaccaacccattg 1620
gtaacctactggggacctgttgatatctccaactgtttaaaagaagcaaatgaagttgct 1680
aaccagattttaaatttaactgctgatgggcagaacttaacctcagccaatattaccaac 1740
attgtggaacaggtcaaaagaattgtgaataaagaagaaaacattgatataacacttggc 1800
tcaactctaatgaatatattttctaatatcttaagcagttcagacagtgacttgcttgag 1860
tcatcttctgaagctttaaaaacaattgatgaattggccttcaagatagacctaaatagc 1920
acatcacatgtgaatattacaactcggaacttggctctcagcgtatcatccctgttacca 1980
gggacaaatgcaatttcaaattttagcattggtcttccaagcaataatgaatcgtatttc 2040
caggtaatgagccagtggtttctttcattttaa 2073
<210> 54
<211> 690
<212> PRT
<213> homo sapiens
<400> 54
Met Met Phe Arg Ser Asp Arg Met Trp Ser Cys His Trp Lys Trp Lys
1 5 10 15
Pro Ser Pro Leu Leu Phe Leu Phe Ala Leu Tyr Ile Met Cys Val Pro
20 25 30
His Ser Val Trp Gly Cys Ala Asn Cys Arg Val Val Leu Ser Asn Pro
35 40 45
Ser Gly Thr Phe Thr Ser Pro Cys Tyr Pro Asn Asp Tyr Pro Asn Ser
50 55 60
Gln Ala Cys Met Trp Thr Leu Arg Ala Pro Thr Gly Tyr Ile Ile Gln
65 70 75 80
Ile Thr Phe Asn Asp Phe Asp Ile Glu Glu Ala Pro Asn Cys Ile Tyr
85 90 95
Asp Ser Leu Ser Leu Asp Asn Gly Glu Ser Gln Thr Lys Phe Cys Gly
100 105 110
Ala Thr Ala Lys Gly Leu Ser Phe Asn Ser Ser Ala Asn Glu Met His
115 120 125
Val Ser Phe Ser Ser Asp Phe Ser Ile Gln Lys Lys Gly Phe Asn Ala
130 135 140
Ser Tyr Ile Arg Val Ala Val Ser Leu Arg Asn Gln Lys Val Ile Leu
145 150 155 160
Pro Gln Thr Ser Asp Ala Tyr Gln Val Ser Val Ala Lys Ser Ile Ser
165 170 175
Ile Pro Glu Leu Ser Ala Phe Thr Leu Cys Phe Glu Ala Thr Lys Val
180 185 190
Gly His Glu Asp Ser Asp Trp Thr Ala Phe Ser Tyr Ser Asn Ala Ser
195 200 205
Phe Thr Gln Leu Leu Ser Phe Gly Lys Ala Lys Ser Gly Tyr Phe Leu
210 215 220
Ser Ile Ser Asp Ser Lys Cys Leu Leu Asn Asn Ala Leu Pro Val Lys
225 230 235 240
Glu Lys Glu Asp Ile Phe Ala Glu Ser Phe Glu Gln Leu Cys Leu Val
245 250 255
Trp Asn Asn Ser Leu Gly Ser Ile Gly Val Asn Phe Lys Arg Asn Tyr
260 265 270
Glu Thr Val Pro Cys Asp Ser Thr Ile Ser Lys Val Ile Pro Gly Asn
275 280 285
78 / 87
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
Gly Lys Leu Leu Leu Gly Ser Asn Gln Asn Glu Ile Val Ser Leu Lys
290 295 300
Gly Asp Ile Tyr Asn Phe Arg Leu Trp Asn Phe Thr Met Asn Ala Lys
305 310 315 ' 320
Ile Leu Ser Asn Leu Ser Cys Asn Val Lys Gly Asn Val Val Asp Trp
325 330 335
Gln Asn Asp Phe Trp Asn Ile Pro Asn Leu Ala Leu Lys Ala Glu Ser
340 345 350
Asn Leu Ser Cys Gly Ser Tyr Leu Ile Pro Leu Pro Ala Ala Glu Leu
355 360 365
Ala Ser Cys Ala Asp Leu Gly Thr Leu Cys Gln Asp Gly Ile Ile Tyr
370 375 380
Arg Ile Ser Val Val Ile Gln Asn Ile Leu Arg His Pro Glu Val Lys
385 390 395 400
Val Gln Ser Lys Val Ala Glu Trp Leu Asn Ser Thr Phe Gln Asn Trp
405 410 415
Asn Tyr Thr Val Tyr Val Val Asn Ile Ser Phe His Leu Ser Ala Gly
420 425 430
Glu Asp Lys Ile Lys Val Lys Arg Ser Leu Glu Asp Glu Pro Arg Leu
435 440 445
Val Leu Trp Ala Leu Leu Val Tyr Asn Ala Thr Asn Asn Thr Asn Leu
450 455 460
Glu Gly Lys Ile Ile Gln Gln Lys Leu Leu Lys Asn Asn Glu Ser Leu
465 470 475 480
Asp Glu Gly Leu Arg Leu His Thr Val Asn Val Arg Gln Leu Gly His
485 490 495
Cys Leu Ala Met Glu Glu Pro Lys Gly Tyr Tyr Trp Pro Ser Ile Gln
500 505 510
Pro Ser Glu Tyr Val Leu Pro Cys Pro Asp Lys Pro Gly Phe Ser Ala
515 520 525
Ser Arg Ile Cys Phe Tyr Asn Ala Thr Asn Pro Leu Val Thr Tyr Trp
530 535 540
Gly Pro Val Asp Ile Ser Asn Cys Leu Lys Glu Ala Asn Glu Val Ala
545 550 555 560
Asn Gln Ile Leu Asn Leu Thr Ala Asp Gly Gln Asn Leu Thr Ser Ala
565 570 575
Asn Ile Thr Asn Ile Val Glu Gln Val Lys Arg Ile Val Asn Lys Glu
580 585 590
Glu Asn Ile Asp Ile Thr Leu Gly Ser Thr Leu Met Asn Ile Phe Ser
595 600 605
Asn Ile Leu Ser Ser Ser Asp Ser Asp Leu Leu Glu Ser Ser Ser Glu
610 615 620
Ala Leu Lys Thr Ile Asp Glu Leu Ala Phe Lys Ile Asp Leu Asn Ser
625 630 635 640
Thr Ser His Val Asn Ile Thr Thr Arg Asn Leu Ala Leu Ser Val Ser
645 650 655
Ser Leu Leu Pro Gly Thr Asn Ala Ile Ser Asn Phe Ser Ile Gly Leu
660 665 670
Pro Ser Asn Asn Glu Ser Tyr Phe Gln Val Met Ser Gln Trp Phe Leu
675 680 685
Ser Phe
690
<210> 55
<211> 3255
<212> DNA
<213> homo sapiens
<400> 55
atgatgtttc gctcagatcg aatgtggagc tgccattgga aatggaagcc cagtcctctc 60
ctgttcttat ttgctttata tatcatgtgt gttcctcact cagtgtgggg atgtgccaac 120
tgccgagtgg ttttgtccaa cccttctggg acctttactt ctccatgcta ccctaacgac 180
tacccaaaca gccaggcttg catgtggacg ctccgagccc ccaccggtta tatcattcag 240
79 / 87
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
ataacatttaacgactttgacattgaagaagctcccaattgcatttatgactcattatcc 300
cttgataatggagagagccagactaaattttgtggagcaactgccaaaggcctatcattt 360
aactcaagtgcgaatgagatgcatgtgtccttttcaagtgactttagcatccagaagaaa 420
ggtttcaatgccagctacatcagagttgccgtgtccttaaggaatcaaaaggtcatttta 480
ccccagacatcagatgcttaccaggtatctgttgcaaaaagcatctctattccagagctc 540
agtgctttcacactctgctttgaagcaaccaaagttggccatgaagacagtgattggaca 600
gctttctcctactcaaatgcatccttcacacaattgctcagttttggaaaggccaagagt 660
ggctactttctatccatttctgattcaaaatgtttgttgaataatgcattacctgtcaaa 720
gaaaaagaagacatttttgcagaaagctttgaacagctctgccttgtttggaataattct 780
ttgggctctattggtgtaaatttcaaaagaaactatgaaacagttccatgtgattctacc 840
attagtaaagttattcctgggaatgggaaattgttgttgggctccaatcaaaatgaaatt 900
gtctctctaaaaggggacatttataactttcgactttggaattttaccatgaatgccaaa 960
atcctctccaacctcagctgtaatgtgaaagggaatgtagtcgactggcaaaatgacttc 1020
tggaatatcccaaacctagctctgaaagctgaaagcaacctaagctgtggttcctacctg 1080
atcccgctcccagcagcagaactggccagctgtgcagacctggggaccctctgtcaagat 1140
ggaattatctatagaatatccgtagtgattcagaacatccttcgtcaccctgaggtaaaa 1200
gtacagagcaaggtggcagaatggctcaattcaaccttccaaaattggaactacacggtt 1260
tatgtcgttaatatcagttttcacctgagtgctggagaggacaagattaaagtcaagaga 1320
agccttgaggatgagccaaggttggtgctttgggcccttctagtttacaatgctaccaac 1380
aatactaatttagaaggaaaaatcattcagcagaagctcctaaaaaataatgagtccttg 1440
gatgaaggcttgaggctacatacagtgaatgtgagacaactgggtcattgtcttgccatg 1500
gaggaacccaaaggctactactggccatctatccaaccttctgaatacgttcttccttgt 1560
ccagacaagcctggcttttctgcttctcggatatgtttttacaatgctaccaacccattg 1620
gtaacctactggggacctgttgatatctccaactgtttaaaagaagcaaatgaagttgct 1680
aaccagattttaaatttaactgctgatgggcagaacttaacctcagccaatattaccaac 1740
attgtggaacaggtcaaaagaattgtgaataaagaagaaaacattgatataacacttggc 1800
tcaactctaatgaatatattttctaatatcttaagcagttcagacagtgacttgcttgag 1860
tcatcttctgaagctttaaaaacaattgatgaattggccttcaagatagacctaaatagc 1920
acatcacatgtgaatattacaactcggaacttggctctcagcgtatcatccctgttacca 1980
gggacaaatgcaatttcaaattttagcattggtcttccaagcaataatgaatcgtatttc 2040
cagatggattttgagagtggacaagtggatccactggcatctgtaattttgcctccaaac 2100
ttacttgagaatttaagtccagaagattctgtattagttagaagagcacagtttactttc 2160
ttcaacaaaactggacttttccaggatgtaggaccccaaagaaaaactttagtgagttat 2220
gtgatggcgtgcagtattggaaacattactatccagaatctgaaggatcctgttcaaata 2280
aaaatcaaacatacaagaactcaggaagtgcatcatcccatctgtgccttctgggatctg 2340
aacaaaaacaaaagttttggaggatggaacacgtcaggatgtgttgcacacagagattca 2400
gatgcaagtgagacagtctgcctgtgtaaccacttcacacactttggagttctgatggac 2460
cttccaagaagtgcctcacagttagatgcaagaaacactaaagtcctcactttcatcagc 2520
tatattgggtgtggaatatctgctattttttcagcagcaactctcctgacatatgttgct 2580
tttgagaaattgcgaagggattatccctccaaaatcttgatgaacctgagcacagccctg 2640
ctgttcctgaatctcctcttcctcctagatggctggatcacctccttcaatgtggatgga 2700
ctttgcattgctgttgcagtcctgttgcatttcttccttctggcaacctttacctggatg 2760
gggctagaagcaattcacatgtacattgctctagttaaagtatttaacacttacattcgc 2820
cgatacattctaaaattctgcatcattggctggggtttgcctgccttagtggtgtcagtt 2880
gttctagcgagcagaaacaacaatgaagtctatggaaaagaaagttatgggaaagaaaaa 2940
ggtgatgaattctgttggattcaagatccagtcatattttatgtgacctgtgctgggtat 3000
tttggagtcatgttttttctgaacattgccatgttcattgtggtaatggtgcagatctgt 3060
gggaggaatggcaagagaagcaaccggaccctgagagaagaagtgttaaggaacctgcgc 3120
agtgtggttagcttgacctttctgttgggcatgacatggggttttgcattctttgcctgg 3180
ggacccttaaatatccccttcatgtacctcttctccatcttcaattcattacaaggtaag 3240
ataaattgtacatga 3255
<210> 56
<211> 1084
<212> PRT
<213> homo Sapiens
<400> 56
Met Met Phe Arg Ser Asp Arg Met Trp Ser Cys His Trp Lys Trp Lys
1 5 10 15
Pro Ser Pro Leu Leu Phe Leu Phe Ala Leu Tyr Ile Met Cys Val Pro
20 25 30
His Ser Val Trp Gly Cys Ala Asn Cys Arg Val Val Leu Ser Asn Pro
80 / 87
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
35 40 45
Ser Gly Thr Phe Thr Ser Pro Cys Tyr Pro Asn Asp Tyr Pro Asn Ser
50 55 60
Gln Ala Cys Met Trp Thr Leu Arg Ala Pro Thr Gly Tyr Ile Ile Gln
65 70 75 80
Ile Thr Phe Asn Asp Phe Asp Ile Glu Glu Ala Pro Asn Cys Ile Tyr
85 90 95
Asp Ser Leu Ser Leu Asp Asn Gly Glu Ser Gln Thr Lys Phe Cys Gly
100 105 110
Ala Thr Ala Lys Gly Leu Ser Phe Asn Ser Ser Ala Asn Glu Met His
115 120 125
Val Ser Phe Ser Ser Asp Phe Ser Ile Gln Lys Lys Gly Phe Asn Ala
130 135 140
Ser Tyr Ile Arg Val Ala Val Ser Leu Arg Asn Gln Lys Val Ile Leu
145 150 155 160
Pro Gln Thr Ser Asp Ala Tyr Gln Val Ser Val Ala Lys Ser Ile Ser
165 170 175
Ile Pro Glu Leu Ser Ala Phe Thr Leu Cys Phe Glu Ala Thr Lys Val
180 185 190
Gly His Glu Asp Ser Asp Trp Thr Ala Phe Ser Tyr Ser Asn Ala Ser
195 200 205
Phe Thr Gln Leu Leu Ser Phe Gly Lys Ala Lys Ser Gly Tyr Phe Leu
210 215 220
Ser Ile Ser Asp Ser Lys Cys Leu Leu Asn Asn Ala Leu Pro Val Lys
225 230 235 240
Glu Lys Glu Asp Ile Phe Ala Glu Ser Phe Glu Gln Leu Cys Leu Val
245 250 255
Trp Asn Asn Ser Leu Gly Ser Ile Gly Val Asn Phe Lys Arg Asn Tyr
260 265 270
Glu Thr Val Pro Cys Asp Ser Thr Ile Ser Lys Val Ile Pro Gly Asn
275 280 285
Gly Lys Leu Leu Leu Gly Ser Asn Gln Asn Glu Ile Val Ser Leu Lys
290 295 300
Gly Asp Ile Tyr Asn Phe Arg Leu Trp Asn Phe Thr Met Asn Ala Lys
305 310 315 320
Ile Leu Ser Asn Leu Ser Cys Asn Val Lys Gly Asn Val Val Asp_Trp
325 330 335
Gln Asn Asp Phe Trp Asn Ile Pro Asn Leu Ala Leu Lys Ala Glu Ser
340 345 350
Asn Leu Ser Cys Gly Ser Tyr Leu Ile Pro Leu Pro Ala Ala Glu Leu
355 360 365
Ala Ser Cys Ala Asp Leu Gly Thr Leu Cys Gln Asp Gly Ile Ile Tyr
370 375 380
Arg Ile Ser Val Val Ile Gln Asn Ile Leu Arg His Pro Glu Val Lys
385 390 395 400
Val Gln Ser Lys Val Ala Glu Trp Leu Asn Ser Thr Phe Gln Asn Trp
405 410 415
Asn Tyr Thr Val Tyr Val Val Asn Ile Ser Phe His Leu Ser Ala Gly
420 425 430
Glu Asp Lys Ile Lys Val Lys Arg Ser Leu Glu Asp Glu Pro Arg Leu
435 440 445
Val Leu Trp Ala Leu Leu Val Tyr Asn Ala Thr Asn Asn Thr Asn Leu
450 455 460
Glu Gly Lys Ile Ile Gln Gln Lys Leu Leu Lys Asn Asn Glu Ser Leu
465 470 475 480
Asp Glu Gly Leu Arg Leu His Thr Val Asn Val Arg Gln Leu Gly His
485 490 495
Cys Leu Ala Met Glu Glu Pro Lys Gly Tyr Tyr Trp Pro Ser Ile Gln
500 505 510
Pro Ser Glu Tyr Val Leu Pro Cys Pro Asp Lys Pro Gly Phe Ser Ala
515 520 525
Ser Arg Ile Cys Phe Tyr Asn Ala Thr Asn Pro Leu Val Thr Tyr Trp
530 535 540
81 / 87
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
Gly Pro Val Asp Ile Ser Asn Cys Leu Lys Glu Ala Asn Glu Val Ala
545 550 555 560
Asn Gln Ile Leu Asn Leu Thr Ala Asp Gly Gln Asn Leu Thr Ser Ala
565 570 575
Asn Ile Thr Asn Ile Val Glu Gln Val Lys Arg Ile Val Asn Lys Glu
580 585 590
Glu Asn Ile Asp Ile Thr Leu Gly Ser Thr Leu Met Asn Ile Phe Ser
595 600 605
Asn Ile Leu Ser Ser Ser Asp Ser Asp Leu Leu Glu Ser Ser Ser Glu
610 615 620
Ala Leu Lys Thr Ile Asp Glu Leu Ala Phe Lys Ile Asp Leu Asn Ser
625 630 635 640
Thr Ser His Val Asn Ile Thr Thr Arg Asn Leu Ala Leu Ser Val Ser
645 650 655
Ser Leu Leu Pro Gly Thr Asn Ala Ile Ser Asn Phe Ser Ile Gly Leu
660 665 670
Pro Ser Asn Asn Glu Ser Tyr Phe Gln Met Asp Phe Glu Ser Gly Gln
675 680 685
Val Asp Pro Leu Ala Ser Val Ile Leu Pro Pro Asn Leu Leu Glu Asn
690 695 700
Leu Ser Pro Glu Asp Ser Val Leu Val Arg Arg Ala Gln Phe Thr Phe
705 710 715 720
Phe Asn Lys Thr Gly Leu Phe Gln Asp Val Gly Pro Gln Arg Lys Thr
725 730 ~ 735
Leu Val Ser Tyr Val Met Ala Cys Ser Ile Gly Asn Ile Thr Ile Gln
740 745 750
Asn Leu Lys Asp Pro Val Gln Ile Lys Ile Lys His Thr Arg Thr Gln
755 760 765
Glu Val His His Pro Ile Cys Ala Phe Trp Asp Leu Asn Lys Asn Lys
770 775 780
Ser Phe Gly Gly Trp Asn Thr Ser Gly Cys Val Ala His Arg Asp Ser
785 790 795 800
Asp Ala Ser Glu Thr Val Cys Leu Cys Asn His Phe Thr His Phe Gly
805 810 815
Val Leu Met Asp Leu Pro Arg Ser Ala Ser Gln Leu Asp Ala Arg Asn
820 825 830
Thr Lys Val Leu Thr Phe Ile Ser Tyr Ile Gly Cys Gly Ile Ser Ala
835 840 845
Ile Phe Ser Ala Ala Thr Leu Leu Thr Tyr Val Ala Phe Glu Lys Leu
850 855 860
Arg Arg Asp Tyr Pro Ser Lys Ile Leu Met Asn Leu Ser Thr Ala Leu
865 870 875 880
Leu Phe Leu Asn Leu Leu Phe Leu Leu Asp Gly Trp Ile Thr Ser Phe
885 890 895
Asn Val Asp Gly Leu Cys Ile Ala Val Ala Val Leu Leu His Phe Phe
900 905 910
Leu Leu Ala Thr Phe Thr Trp Met Gly Leu Glu Ala Ile His Met Tyr
915 920 925
Ile Ala Leu Val Lys Val Phe Asn Thr Tyr Ile Arg Arg Tyr Ile Leu
930 935 940
Lys Phe Cys Ile Ile Gly Trp Gly Leu Pro Ala Leu Val Val Ser Val
945 950 955 960
Val Leu Ala Ser Arg Asn Asn Asn Glu Val Tyr Gly Lys Glu Ser Tyr
965 970 975
Gly Lys Glu Lys Gly Asp Glu Phe Cys Trp Ile Gln Asp Pro Val Ile
980 985 990
Phe Tyr Val Thr Cys Ala Gly Tyr Phe Gly Val Met Phe Phe Leu Asn
995 1000 1005
Ile Ala Met Phe Ile Val Val Met Val Gln Ile Cys Gly Arg Asn Gly
1010 1015 1020
Lys Arg Ser Asn Arg Thr Leu Arg Glu Glu Val Leu Arg Asn Leu Arg
1025 1030 1035 1040
Ser Val Val Ser Leu Thr Phe Leu Leu Gly Met Thr Trp Gly Phe Ala
82 / 87
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
1045 1050 1055
Phe Phe Ala Trp Gly Pro Leu Asn Ile Pro Phe Met Tyr Leu Phe Ser
1060 1065 1070
Ile Phe Asn Ser Leu Gln Gly Lys Ile Asn Cys Thr
1075 1080
<210> 57
<211> 3579
<212> DNA
<213> homo Sapiens
<400>
57
atgtttcgctcagatcgaatgtggagctgccattggaaatggaagcccagtcctctcctg 60
ttcttatttgctttatatatcatgtgtgttcctcactcagtgtggggatgtgccaactgc 120
cgagtggttttgtccaacccttctgggacctttacttctccatgctaccctaacgactac 180
ccaaacagccaggcttgcatgtggacgctccgagcccccaccggttatatcattcagata 240
acatttaacgactttgacattgaagaagctcccaattgcatttatgactcattatccctt 300
gataatggagagagccagactaaattttgtggagcaactgccaaaggcctatcatttaac 360
tcaagtgcgaatgagatgcatgtgtccttttcaagtgactttagcatccagaagaaaggt 420
ttcaatgccagctacatcagagttgccgtgtccttaaggaatcaaaaggtcattttaccc 480
cagacatcagatgcttaccaggtatctgttgcaaaaagcatctctattccagagctcagt 540
gctttcacactctgctttgaagcaaccaaagttggccatgaagacagtgattggacagct 600
ttctcctactcaaatgcatccttcacacaattgctcagttttggaaaggccaagagtggc 660
tactttctatccatttctgattcaaaatgtttgttgaataatgcattacctgtcaaagaa 720
aaagaagacatttttgcagaaagctttgaacagctctgccttgtttggaataattctttg 780
ggctctattggtgtaaatttcaaaagaaactatgaaacagttccatgtgattctaccatt 840
agtaaagttattcctgggaatgggaaattgttgttgggctccaatcaaaatgaaattgtc 900
tctctaaaaggggacatttataactttcgactttggaattttaccatgaatgccaaaatc 960
ctctccaacctcagctgtaatgtgaaagggaatgtagtcgactggcaaaatgacttctgg 1020
aatatcccaaacctagctctgaaagctgaaagcaacctaagctgtggttcctacctgatc 1080
ccgctcccagcagcagaactggccagctgtgcagacctggggaccctctgtcaagatgga 1140
attatctatagaatatccgtagtgattcagaacatccttcgtcaccctgaggtaaaagta 1200
cagagcaaggtggcagaatggctcaattcaaccttccaaaattggaactacacggtttat 1260
gtcgttaatatcagttttcacctgagtgctggagaggacaagattaaagtcaagagaagc 1320
cttgaggatgagccaaggttggtgctttgggcccttctagtttacaatgctaccaacaat 1380
actaatttagaaggaaaaatcattcagcagaagctcctaaaaaataatgagtccttggat 1440
gaaggcttgaggctacatacagtgaatgtgagacaactgggtcattgtcttgccatggag 1500
gaacccaaaggctactactggccatctatccaaccttctgaatacgttcttccttgtcca 1560
gacaagcctggcttttctgcttctcggatatgtttttacaatgctaccaacccattggta 1620
acctactggggacctgttgatatctccaactgtttaaaagaagcaaatgaagttgctaac 1680
cagattttaaatttaactgctgatgggcagaacttaacctcagccaatattaccaacatt 1740
gtggaacaggtcaaaagaattgtgaataaagaagaaaacattgatataacacttggctca 1800
actctaatgaatatattttctaatatcttaagcagttcagacagtgacttgcttgagtca 1860
tcttctgaagctttaaaaacaattgatgaattggccttcaagatagacctaaatagcaca 1920
tcacatgtgaatattacaactcggaacttggctctcagcgtatcatccctgttaccaggg 1980
acaaatgcaatttcaaattttagcattggtcttccaagcaataatgaatcgtatttccag 2040
atggattttgagagtggacaagtggatccactggcatctgtaattttgcctccaaactta 2100
cttgagaatttaagtccagaagattctgtattagttagaagagcacagtttactttcttc 2160
aacaaaactggacttttccaggatgtaggaccccaaagaaaaactttagtgagttatgtg 2220
atggcgtgcagtattggaaacattactatccagaatctgaaggatcctgttcaaataaaa 2280
atcaaacatacaagaactcaggaagtgcatcatcccatctgtgccttctgggatctgaac 2340
aaaaacaaaagttttggaggatggaacacgtcaggatgtgttgcacacagagattcagat 2400
gcaagtgagacagtctgcctgtgtaaccacttcacacactttggagttctgatggacctt 2460
ccaagaagtgcctcacagttagatgcaagaaacactaaagtcctcactttcatcagctat 2520
attgggtgtggaatatctgctattttttcagcagcaactctcctgacatatgttgctttt 2580
gagaaattgcgaagggattatccctccaaaatcttgatgaacctgagcacagccctgctg 2640
ttcctgaatctcctcttcctcctagatggctggatcacctccttcaatgtggatggactt 2700
tgcattgctgttgcagtcctgttgcatttcttccttctggcaacctttacctggatgggg 2760
ctagaagcaattcacatgtacattgctctagttaaagtatttaacacttacattcgccga 2820
tacattctaaaattctgcatcattggctggggtttgcctgccttagtggtgtcagttgtt 2880
ctagcgagcagaaacaacaatgaagtctatggaaaagaaagttatgggaaagaaaaaggt 2940
gatgaattctgttggattcaagatccagtcatattttatgtgacctgtgctgggtatttt 3000
ggagtcatgttttttctgaacattgccatgttcattgtggtaatggtgcagatctgtggg 3060
83 / 87
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
aggaatggcaagagaagcaaccggaccctgagagaagaagtgttaaggaacctgcgcagt 3120
gtggttagcttgacctttctgttgggcatgacatggggttttgcattctttgcctgggga 3180
cccttaaatatccccttcatgtacctcttctccatcttcaattcattacaaggcttattt 3240
atattcatcttccactgtgctatgaaggagaatgttcagaaacagtggcggcggcatctc 3300
tgctgtggtagatttcggttagcagataactcagattggagtaagacagctaccaatatc 3360
atcaagaaaagttctgataatctaggaaaatctttgtcttcaagctccattggttccaac 3420
tcaacctatcttacatccaaatctaaatccagctctaccacctatttcaaaaggaatagc 3480
cacacagataatgtctcctatgagcattccttcaacaaaagtggatcactcagacagtgc 3540
ttccatggacaagtccttgtcaaaactggcccatgctga 3579
<210> 58
<211> 1192
<212> PRT
<213> homo sapiens
<400> 58
Met Phe Arg Ser Asp Arg Met Trp Ser Cys His Trp Lys Trp Lys Pro
1 5 10 15
Ser Pro Leu Leu Phe Leu Phe Ala Leu Tyr Ile Met Cys Val Pro His
20 25 30
Ser Val Trp Gly Cys Ala Asn Cys Arg Val Val Leu Ser Asn Pro Ser
35 40 45
Gly Thr Phe Thr Ser Pro Cys Tyr Pro Asn Asp Tyr Pro Asn Ser Gln
50 55 60
Ala Cys Met Trp Thr Leu Arg Ala Pro Thr Gly Tyr Ile Ile Gln Ile
65 70 75 80
Thr Phe Asn Asp Phe Asp Ile Glu Glu Ala Pro Asn Cys Ile Tyr Asp
85 90 95
Ser Leu Ser Leu Asp Asn Gly Glu Ser Gln Thr Lys Phe Cys Gly Ala
100 105 110
Thr Ala Lys Gly Leu Ser Phe Asn Ser Ser Ala Asn Glu Met His Val
115 120 125
Ser Phe Ser Ser Asp Phe Ser Ile Gln Lys Lys Gly Phe Asn Ala Ser
130 135 140
Tyr Ile Arg Val Ala Val Ser Leu Arg Asn Gln Lys Val Ile Leu Pro
145 150 155 160
Gln Thr Ser Asp Ala Tyr Gln Val Ser Val Ala Lys Ser Ile Ser Ile
165 170 175
Pro Glu Leu Ser Ala Phe Thr Leu Cys Phe Glu Ala Thr Lys Val Gly
180 185 190
His Glu Asp Ser Asp Trp Thr Ala Phe Ser Tyr Ser Asn Ala Ser Phe
195 200 205
Thr Gln Leu Leu Ser Phe Gly Lys Ala Lys Ser Gly Tyr Phe Leu Ser
210 215 220
Ile Ser Asp Ser Lys Cys Leu Leu Asn Asn Ala Leu Pro Val Lys Glu
225 230 235 240
Lys Glu Asp Ile Phe Ala Glu Ser Phe Glu Gln Leu Cys Leu Val Trp
245 250 255
Asn Asn Ser Leu Gly Ser Ile Gly Val Asn Phe Lys Arg Asn Tyr Glu
260 265 270
Thr Val Pro Cys Asp Ser Thr Ile Ser Lys Val Ile Pro Gly Asn Gly
275 280 285
Lys Leu Leu Leu Gly Ser Asn Gln Asn Glu Ile Val Ser Leu Lys Gly
290 295 300
Asp Ile Tyr Asn Phe Arg Leu Trp Asn Phe Thr Met Asn Ala Lys Ile
305 310 315 320
Leu Ser Asn Leu Ser Cys Asn Val Lys Gly Asn Val Val Asp Trp Gln
325 330 335
Asn Asp Phe Trp Asn Ile Pro Asn Leu Ala Leu Lys Ala Glu Ser Asn
340 345 350
Leu Ser Cys Gly Ser Tyr Leu Ile Pro Leu Pro Ala Ala Glu Leu Ala
355 360 365
Ser Cys Ala Asp Leu Gly Thr Leu Cys Gln Asp Gly Ile Ile Tyr Arg
84 / 87
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
370 375 380
Ile Ser Val Val Ile Gln Asn Ile Leu Arg His Pro Glu Val Lys Val
385 390 395 400
Gln Ser Lys Val Ala Glu Trp Leu Asn Ser Thr Phe Gln Asn Trp Asn
405 410 415
Tyr Thr Val Tyr Val Val Asn Ile Ser Phe His Leu Ser Ala Gly Glu
420 425 430
Asp Lys Ile Lys Val Lys Arg Ser Leu Glu Asp Glu Pro Arg Leu Val
435 440 445
Leu Trp Ala Leu Leu Val Tyr Asn Ala Thr Asn Asn Thr Asn Leu Glu
450 455 460
Gly Lys Ile Ile Gln Gln Lys Leu Leu Lys Asn Asn Glu Ser Leu Asp
465 470 475 480
Glu Gly Leu Arg Leu His Thr Val Asn Val Arg Gln Leu Gly His Cys
485 490 495
Leu Ala Met Glu Glu Pro Lys Gly Tyr Tyr Trp Pro Ser Ile Gln Pro
500 505 510
Ser Glu Tyr Val Leu Pro Cys Pro Asp Lys Pro Gly Phe Ser Ala Ser
515 520 525
Arg Ile Cys Phe Tyr Asn Ala Thr Asn Pro Leu Val Thr Tyr Trp Gly
530 535 540
Pro Val Asp Ile Ser Asn Cys Leu Lys Glu Ala Asn Glu Val Ala Asn
545 550 555 560
Gln Ile Leu Asn Leu Thr Ala Asp Gly Gln Asn Leu Thr Ser Ala Asn
565 570 575
Ile Thr Asn Ile Val Glu Gln Val Lys Arg Ile Val Asn Lys Glu Glu
580 585 590
Asn Ile Asp Ile Thr Leu Gly Ser Thr Leu Met Asn Ile Phe Ser Asn
595 600 605
Ile Leu Ser Ser Ser Asp Ser Asp Leu Leu Glu Ser Ser Ser Glu Ala
610 615 620
Leu Lys Thr Ile Asp Glu Leu Ala Phe Lys Ile Asp Leu Asn Ser Thr
625 630 635 640
Ser His Val Asn Ile Thr Thr Arg Asn Leu Ala Leu Ser Val Ser Ser
645 650 655
Leu Leu Pro Gly Thr Asn Ala Ile Ser Asn Phe Ser Ile Gly Leu Pro
660 665 670
Ser Asn Asn Glu Ser Tyr Phe Gln Met Asp Phe Glu Ser Gly Gln Val
675 680 685
Asp Pro Leu Ala Ser Val Ile Leu Pro Pro Asn Leu Leu Glu Asn Leu
690 695 700
Ser Pro Glu Asp Ser Val Leu Val Arg Arg Ala Gln Phe Thr Phe Phe
705 710 715 720
Asn Lys Thr Gly Leu Phe Gln Asp Val Gly Pro Gln Arg Lys Thr Leu
725 730 735
Val Ser Tyr Val Met Ala Cys Ser Ile Gly Asn Ile Thr Ile Gln Asn
740 745 750
Leu Lys Asp Pro Val Gln Ile Lys Ile Lys His Thr Arg Thr Gln Glu
755 760 765
Val His His Pro Ile Cys Ala Phe Trp Asp Leu Asn Lys Asn Lys Ser
770 775 780
Phe Gly Gly Trp Asn Thr Ser Gly Cys Val Ala His Arg Asp Ser Asp
785 790 795 800
Ala Ser Glu Thr Val Cys Leu Cys Asn His Phe Thr His Phe Gly Val
805 810 815
Leu Met Asp Leu Pro Arg Ser Ala Ser Gln Leu Asp Ala Arg Asn Thr
820 825 830
Lys Val Leu Thr Phe Ile Ser Tyr Ile Gly Cys Gly Ile Ser Ala Ile
835 840 845
Phe Ser Ala Ala Thr Leu Leu Thr Tyr Val Ala Phe Glu Lys Leu Arg
850 855 860
Arg Asp Tyr Pro Ser Lys Ile Leu Met Asn Leu Ser Thr Ala Leu Leu
865 870 875 880
85 / 87
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
Phe Leu Asn Leu Leu Phe Leu Leu Asp Gly Trp Ile Thr Ser Phe Asn
885 890 895
Val Asp Gly Leu Cys Ile Ala Val Ala Val Leu Leu His Phe Phe Leu
900 905 910
Leu Ala Thr Phe Thr Trp Met Gly Leu Glu Ala Ile His Met Tyr Ile
915 920 925
Ala Leu Val Lys Val Phe Asn Thr Tyr Ile Arg Arg Tyr Ile Leu Lys
930 935 940
Phe Cys Ile Ile Gly Trp Gly Leu Pro Ala Leu Val Val Ser Val Val
945 950 955 960
Leu Ala Ser Arg Asn Asn Asn Glu Val Tyr Gly Lys Glu Ser Tyr Gly
965 970 975
Lys Glu Lys Gly Asp Glu Phe Cys Trp Ile Gln Asp Pro Val Ile Phe
980 985 990
Tyr Val Thr Cys Ala Gly Tyr Phe Gly Val Met Phe Phe Leu Asn Ile
995 1000 1005
Ala Met Phe Ile Val Val Met Val Gln Ile Cys Gly Arg Asn Gly Lys
1010 1015 1020
Arg Ser Asn Arg Thr Leu Arg Glu Glu Val Leu Arg Asn Leu Arg Ser
1025 1030 1035 1040
Val Val Ser Leu Thr Phe Leu Leu Gly Met Thr Trp Gly Phe Ala Phe
1045 1050 1055
Phe Ala Trp Gly Pro Leu Asn Ile Pro Phe Met Tyr Leu Phe Ser Ile
1060 1065 1070
Phe Asn Ser Leu Gln Gly Leu Phe Ile Phe Ile Phe His Cys Ala Met
1075 1080 1085
Lys Glu Asn Val Gln Lys Gln Trp Arg Arg His Leu Cys Cys Gly Arg
1090 1095 1100
Phe Arg Leu Ala Asp Asn Ser Asp Trp Ser Lys Thr Ala Thr Asn Ile
1105 1110 1115 1120
Ile Lys Lys Ser Ser Asp Asn Leu Gly Lys Ser Leu Ser Ser Ser Ser
1125 1130 1135
Ile Gly Ser Asn Ser Thr Tyr Leu Thr Ser Lys Ser Lys Ser Ser Ser
1140 1145 1150
Thr Thr Tyr Phe Lys Arg Asn Ser His Thr Asp Asn Val Ser Tyr Glu
1155 1160 1165
His Ser Phe Asn Lys Ser Gly Ser Leu Arg Gln Cys Phe His Gly Gln
1170 1175 1180
Val Leu Val Lys Thr Gly Pro Cys
1185 1190
<210> 59
<211> 4446
<212> DNA
<213> homo Sapiens
<400> 59
ttgcgccgtcgggaaagcccatgaactctccagaaacggcgtaaaggagggtcccgccgc 60
ggcgcagggctggggcgcctgggttccccctgggtggagcagcggcagcagagcgggaaa 120
gtggtggaggatgatcttgcggccaaaggggacctcggcgcagtaatgtcaacataatta 180
aacaaggagtaacaggcaccgctcctcagtccaaaggcctggccctgccaagaaggcgct 240
ctccggaatcaacacctgggggcttggaaggatgtttcgctcagatcgaatgtggagctg 300
ccattggaaatggaagcccagtcctctcctgttcttatttgctttatatatcatgtgtgt 360
tcctcactcagtgtggggatgtgccaactgccgagtggttttgtccaacccttctgggac 420
ctttacttctccatgctaccctaacgactacccaaacagccaggcttgcatgtggacgct 480
ccgagcccccaccggttatatcattcagataacatttaacgactttgacattgaagaagc 540
tcccaattgcatttatgactcattatcccttgataatggagagagccagactaaattttg 600
tggagcaactgccaaaggcctatcatttaactcaagtgcgaatgagatgcatgtgtcctt 660
ttcaagtgactttagcatccagaagaaaggtttcaatgccagctacatcagagttgccgt 720
gtccttaaggaatcaaaaggtcattttaccccagacatcagatgcttaccaggtatctgt 780
tgcaaaaagcatctctattccagagctcagtgctttcacactctgctttgaagcaaccaa 840
agttggccatgaagacagtgattggacagctttctcctactcaaatgcatccttcacaca 900
attgctcagttttggaaaggccaagagtggctactttctatccatttctgattcaaaatg 960
86 / 87
CA 02384634 2002-03-08
WO 01/18207 PCT/US00/24591
tttgttgaataatgcattacctgtcaaagaaaaagaagacatttttgcagaaagctttga1020
acagctctgccttgtttggaataattctttgggctctattggtgtaaatttcaaaagaaa1080
ctatgaaacagttccatgtgattctaccattagtaaagttattcctgggaatgggaaatt1140
gttgttgggctccaatcaaaatgaaattgtctctctaaaaggggacatttataactttcg1200
actttggaattttaccatgaatgccaaaatcctctccaacctcagctgtaatgtgaaagg1260
gaatgtagtcgactggcaaaatgacttctggaatatcccaaacctagctctgaaagctga1320
aagcaacctaagctgtggttcctacctgatcccgctcccagcagcagaactggccagctg1380
tgcagacctggggaccctctgtcaagatggaattatctatagaatatccgtagtgattca1440
gaacatccttcgtcaccctgaggtaaaagtacagagcaaggtggcagaatggctcaattc1500
aaccttccaaaattggaactacacggtttatgtcgttaatatcagttttcacctgagtgc1560
tggagaggacaagattaaagtcaagagaagccttgaggatgagccaaggttggtgctttg1620
ggcccttctagtttacaatgctaccaacaatactaatttagaaggaaaaatcattcagca1680
gaagctcctaaaaaataatgagtccttggatgaaggcttgaggctacatacagtgaatgt1740
gagacaactgggtcattgtcttgccatggaggaacccaaaggctactactggccatctat1800
ccaaccttctgaatacgttcttccttgtccagacaagcctggcttttctgcttctcggat1860
atgtttttacaatgctaccaacccattggtaacctactggggacctgttgatatctccaa1920
ctgtttaaaagaagcaaatgaagttgctaaccagattttaaatttaactgctgatgggca1980
gaacttaacctcagccaatattaccaacattgtggaacaggtcaaaagaattgtgaataa2040
agaagaaaacattgatataacacttggctcaactctaatgaatatattttctaatatctt2100
aagcagttcagacagtgacttgcttgagtcatcttctgaagctttaaaaacaattgatga2160
attggccttcaagatagacctaaatagcacatcacatgtgaatattacaactcggaactt2220
ggctctcagcgtatcatccctgttaccagggacaaatgcaatttcaaattttagcattgg2280
tcttccaagcaataatgaatcgtatttccagatggattttgagagtggacaagtggatcc2340
actggcatctgtaattttgcctccaaacttacttgagaatttaagtccagaagattctgt2400
attagttagaagagcacagtttactttcttcaacaaaactggacttttccaggatgtagg2460
accccaaagaaaaactttagtgagttatgtgatggcgtgcagtattggaaacattactat2520
ccagaatctgaaggatcctgttcaaataaaaatcaaacatacaagaactcaggaagtgca2580
tcatcccatctgtgccttctgggatctgaacaaaaacaaaagttttggaggatggaacac2640
gtcaggatgtgttgcacacagagattcagatgcaagtgagacagtctgcctgtgtaacca2700
cttcacacactttggagttctgatggaccttccaagaagtgcctcacagttagatgcaag2760
aaacactaaagtcctcactttcatcagctatattgggtgtggaatatctgctattttttc2820
agcagcaactctcctgacatatgttgcttttgagaaattgcgaagggattatccctccaa2880
aatcttgatgaacctgagcacagccctgctgttcctgaatctcctcttcctcctagatgg2940
ctggatcacctccttcaatgtggatggactttgcattgctgttgcagtcctgttgcattt3000
cttccttctggcaacctttacctggatggggctagaagcaattcacatgtacattgctct3060
agttaaagtatttaacacttacattcgccgatacattctaaaattctgcatcattggctg3120
gggtttgcctgccttagtggtgtcagttgttctagcgagcagaaacaacaatgaagtcta3180
tggaaaagaaagttatgggaaagaaaaaggtgatgaattctgttggattcaagatccagt3240
catattttatgtgacctgtgctgggtattttggagtcatgttttttctgaacattgccat3300
gttcattgtggtaatggtgcagatctgtgggaggaatggcaagagaagcaaccggaccct3360
gagagaagaagtgttaaggaacctgcgcagtgtggttagcttgacctttctgttgggcat3420
gacatggggttttgcattctttgcctggggacccttaaatatccccttcatgtacctctt3480
ctccatcttcaattcattacaaggcttatttatattcatcttccactgtgctatgaagga3540
gaatgttcagaaacagtggcggcggcatctctgctgtggtagatttcggttagcagataa3600
ctcagattggagtaagacagctaccaatatcatcaagaaaagttctgataatctaggaaa3660
atctttgtcttcaagctccattggttccaactcaacctatcttacatccaaatctaaatc3720
cagctctaccacctatttcaaaaggaatagccacacagataatgtctcctatgagcattc3780
cttcaacaaaagtggatcactcagacagtgcttccatggacaagtccttgtcaaaactgg3840
cccatgctgatggagatcaaacatcaatcatccctgtccatcaggtcattgataaggtca3900
agggttattgcaatgctcattcagacaacttctataaaaatattatcatgtcagacacct3960
tcagccacagcacaaagttttaatgtctttaagaaaaagaaatcaatctgcagaaatgtg4020
aagatttgcaagcagtgtaaactgcaactagtgatgtaaatgtgctattacctaggtaac4080
tgcatatatataaggaatgtattttgttaagaaggcttttgtgaaattcagaatttttct4140
ttttaatatatttcttccatggaagagttgtcatcactaaaacttcagtactgagagtaa4200
catgactcagtagccacagaagctatgatttgtaaaatatataattgaatcagagtaatc4260
ataatgcaggggagacattcaaattagagacaagggagaagcaatgctgaggaagaccct4320
agatagagctcattttactccacctaatcgttatatctggatatacccattttctgcatc4380
ttctttctcaacaataaaaaatgtaactattttgaatgcccacaaaaaaaaaaaaaaaaa4440
aaaaaa 4446
87 / 87
