Note: Descriptions are shown in the official language in which they were submitted.
CA 02388612 2002-05-O1
WO 01/32673 PCT/US00/30190
SEQUENCES ENCODING HUMAN NEOPLASTIC MARKER
CROSS REFERENCE TO RELATED APPLICATIONS
This application claims priority from United States Provisional Application
No.
60/162,644, filed November 1, 1999.
ACKNOWLEDGMENT OF FEDERAL RESEARCH SUPPORT
This invention was made, at least in part, with funding from the National
Institutes of
Health Accordingly, the United States Government has certain rights in this
invention.
BACKGROUND OF THE INVENTION
The field of this invention is the area of molecular biology, in particular,
as related to
the molecular biology of neoplastic and diseased cells, as specifically
related to a cell surface
marker for neoplastic and certain other diseased cell states.
Because cancer and certain viral, protozoan and parasite infections pose a
significant
threat to human health and because such infections result in significant
economic costs, there
is a long-felt need in the art for an effective, economical and technically
simple system in
which to assay for or model for inhibitors of the aforementioned disease
states.
SUMMARY OF TIDE INVENTION
An object of the present invention is to provide a recombinant plasma membrane
NADH oxidase/thiol interchange protein (termed tNOX herein) and its coding
sequence. The
full length protein has an amino acid sequence as given in SEQ ID N0:2, and
the truncated
tNOX protein has the amino acid sequence given in SEQ ID N0:2, amino acids 220-
610.
CA 02388612 2002-05-O1
WO 01/32673 PCT/US00/30190
The full length sequence has a specifically exemplified coding sequence as
given in SEQ ID
NO:1, nucleotides 23-1852, and the truncated protein has an amino acid
sequence as given at
nucleotides 680-1852 of SEQ ID NO:1. Also within the scope of the present
invention are
coding sequences which are synonymous with those specifically exemplified
sequences. Also
S contemplated within the present invention are sequences which encode a
neoplastic cell
surface marker and which coding sequences hybridize under stringent conditions
to the
specifically exemplified full length or partial sequence. The cell surface
tNOX is
characteristic of neoplastic conditions and certain viral and other infections
(e.g., HIV). The
recombinant tNOX protein is useful in preparing antigen for use in generation
of monoclonal
antibodies or antisera for diagnosis of cancer, other neoplastic conditions,
and certain
infectious disease states.
Within the scope of the present invention are non-naturally occurring
recombinant
DNA molecules comprising a portion encoding an NADH oxidase/protein disulfide-
thiol
interchange polypeptide, said portion consisting essentially of a nucleotide
sequence selected
from the group consisting of SEQ ID NO:I, nucleotides 23 to 1852; SEQ ID NO:1,
nucleotides 680 to 1852; and. a sequence which hybridizes under stringent
conditions to one
of the foregoing sequences and wherein said hybridizing sequence encodes a
neoplastic
marker protein of the cell surface having NADH oxidase/protein disulfide-thiol
interchange
activity. These recombinant DNA molecules can include sequences where the
encoded
polypeptide consists essentially of an amino acid sequence of SEQ ID N0:2,
amino acids 1
to 610 or amino acids 220 to 610. The portion encoding the specified
polypeptide can further
contain a translation termination codon (TGA, TAA or TAG) immediately
downstream of
nucleotide 1852 of SEQ ID NO:1 Also provided herein are methods for
recombinantly
producing a NADH oxidase/protein disulfide-thiol interchange active
polypeptide in a host
cell (bacterial, yeast, mammalian) using the recombinant DNA molecules
provided herein.
The present invention further provides a method for determining neoplasia in a
mammal, said method comprising the steps of detecting the presence, in a
biological sample
from a mammal, of a ribonucleic acid molecule encoding a NADH oxidase/protein
disulfide
thiol interchange protein associated with neoplastic cells as compared to a
ribonucleic acid
2
CA 02388612 2002-05-O1
WO 01/32673 PCT/US00/30190
molecule encoding a NADH oxidase associated with normal cells, wherein the
step of
detecting is carried out using hybridization under stringent conditions or
using a polymerase
chain reaction in which a perfect match of primer to template is required,
where a
hybridization probe or primer consists essentially consists essentially of at
least 15
S consecutive nucleotides of a nucleotide sequence as given in SEQ ID NO:1 and
correlating
the result obtained with said sample in step (a), where the presence of the
ribonucleic acid
molecule in the biological sample is indicative of the presence of neoplasia.
The method
encompasses the use of hybridization probes which consist essentially of a
nucleotide
sequence as given in SEQ ID NO:1, nucleotides 680-1852, nucleotides 23 to 1852
or a
portion thereof where there is a detectable difference in the results obtained
with normal cells
as compaxed to neoplastic cells or virus infected cells.
The present invention enables the generation of antibody preparations,
especially
using recombinant tNOX or truncated tNOX or an antigenic peptide derived in
sequence from
tNOX, which specifically binds to an antibody selected from the group
consisting of a protein
characterized by an amino acid sequence as given in SEQ ID N0:2, amino acids 1-
610, a
protein characterized by an amino acid sequence as given in SEQ ID N0:220-610
or a protein
characterized by an amino acid sequence as given in SEQ ID N0:16. These
antibody
preparations are useful in detecting tNOX in blood or serum from a patient or
animal with a
neoplastic condition such as cancer, or cells or tissue which are neoplastic
or virus infected.
Expressing the tNOX of the present invention in a host cell, for example, a
mammalian host cell, results in a faster growth rate of the recombinant host
cell and a
significant increase in recombinant cell volume.
Northern blot analyses indicate that the described cDNA is expressed in HeLa
cells
(human cervical carcinoma) and malignant BT-20 human mammary adenocarcinoma
cells.
The availability of the cDNA makes possible rapid further testing of the
specificity of
expression in a variety of normal and malignant cells and tissues.
CA 02388612 2002-05-O1
WO 01/32673 PCT/US00/30190
The deduced amino acid sequence of the encoded protein showed homology over
part
of its length with the deduced amino acid sequence of a cDNA encoding a
protein detected by
the K1 antibody from an ovarian carcinoma (OVCAR-3) cell line [Chang and
Pastan (1994)
Int. J. Cancer 57:90-97]. The DNA is probably identical to that isolated by
Chang and
Pastan although their sequence contains two errors that generated an incorrect
reading frame.
Based on preliminary studies with OVCAR-3 cells, the MAB 12.1 used in the
expression
screening does not appear to react selectively with an antigen preferentially
expressed by
OVCAR-3 cells nor do any of the properties of tNOX parallel those of the K1
antigen of
OVCAR-3 cells.
To study the biological function of tNOX, the tNOX cDNA was subcloned into a
pcDNA3.1 expression vector with HindIII and BamHI restriction sites.
Subsequently, COS
cells were transfected with tNOX using calcium phosphate transfection and DMSO
shock.
tNOX overexpression was evaluated on the basis of enzymatic activity and
Western blot
analysis. Peptide antibody against tNOX recognized expressed proteins with the
molecular
1 S weights of 34 and 48 kDa. Growth rates determined by image enhanced light
microscopy of
the tNOX-transfected cells were 2- to 3-fold greater than with vector alone.
The larger cell
diameter led to a 4- to 5-fold increase in cell volume. A larger cell surface
of the transfected
cells was confirmed by electron microscopy. As expected, transfected COS cells
were more
susceptible to tNOX inhibitors, such as capsaicin and epigallocatechin gallate
(EGCg), with
the ECSO of growth inhibition being shifted by 1 to 2 orders of magnitude to
lower drug
concentrations. Thus, tNOX function is in cell enlargement and is believed
important in
sustaining the uncontrolled growth of cancer cells.
BRIEF DESCRIPTION OF THE DRAWINGS
Fig. 1 summarizes the results of restriction mapping the tNOX cDNA clones.
Fig. 2 diagrammatically illustrates the intron-exon organization of the gene
encoding
human tNOX. Closed boxes in the genomic DNA map represent the identified
protein-
coding exons. The tNOX gene is at the Xq25-26 chromosomal locus. At least nine
exons
have been identified within the partial genomic information available (Bird,
1999).
4
CA 02388612 2002-05-O1
WO 01/32673 PCT/US00/30190
Fig. 3 is a hydropathy plot prepared using the deduced amino acid sequence of
tNOX
and the algorithm of Kyte and Doolittle, 1982. One strongly hydrophobic region
extending
from amino acids 535-558 of SEQ ID N0:2 was identified.
Fig. 4 shows the results of Western blot analysis of OVCAR-3 cells using
antisera
raised in a rabbit which was immunized with recombinant tNOX. Following
separation on
12% SDS-PAGE, proteins were electroblotted to nitrocellulose and incubated
overnight at
4°C with 1:250 diluted polyclonal antibody to tNOX. Detection was with
alkaline
phosphatase-conjugated antibody diluted 1:5000 followed by incubation with NBT-
BCIP.
All fractions were prepared according Chang and Pastan (1994). Lane 1,
Membrane pellet
after octylglucoside solubilization. Lane 2, Supernatant after octylglucoside
solubilization.
Arrows indicate immunoreactive unprocessed tNOX (72 kDa) and processed tNOX
(34
kDa). The regions of the gel corresponding to APK1 (29 kD) and mesothelin (40
kD) lack
immunoreactive material.
Fig. SA-SC show the periodic variation in the rate of oxidation of NADH as a
function
of time over 100 min, with 5 maxima. Fig. 5A: the enzyme source was a crude
preparation
from bacterial cells expressing the tNOX cDNA from a HeLa library induced to
express the
protein by the addition of IPTG. Fig. 5B: The crude preparation was as in Fig.
5A except
that the expression of the tNOX cDNA cloned under the regulatory control of
the lac
promoter was not induced. Fig. SC: The crude preparation was as in Fig. 5A
except that the
activities were measured as a function of time. The solid curve shows
oxidation of NADH as
measured in Fir. 5A. The dotted curve shows the cleavage of a dithiopyridine
(DTP)
substrate as a measure of protein disulfide-thiol interchange.
Fig. 6 shows overexpression of tNOX in COS cells as determined after sodium
dodecyl sulfate-polyacrylamide gel electrophoresis. The first two lanes (from
left) are the
results of Ponceau staining (lane 1, tNOX cDNA cloned into the pcDNA3.1
expression vector
and transfected and expressed in COS cells; lane 2, vector without insert).
The remaining
5
CA 02388612 2002-05-O1
WO 01/32673 PCT/US00/30190
lanes are the results of Western blotting with tNOX-specific antibody and
detection (lane 3,
tNOX cDNA; lane 4, vector without insert).
Fig. 7 graphically illustrates that the diameters of transfected COS cells
were greater
(approximately two times greater than those of untransfected COS cells).
Fig. 8 compares periodic changes in rates of cell enlargement (growth) of COS
cells
transfected with vector without insert (upper curve) and COS cells transfected
with vector
containing the tNOX cDNA insert (lower curve). The tNOX cDNA-transfected COS
cells
enlarge at about twice the rate of the control cells.
Fig. 9 shows that the COS cells transfected with the tNOX cDNA were more
susceptible to capsaicin, which is a known anticancer agent and tNOX
inhibitor.
Fig. 10 demonstrates that COS cells transfected with the tNOX cDNA were more
susceptible to epigallocatechin gallate (EGCg), the principal anticancer
constituent of green
tea.
DETAILED DESCRIPTION OF THE INVENTION
Abbreviations used herein for amino acids are standard in the art: X or Xaa
represents
an amino acid residue that has not yet been identified but may be any amino
acid residue
including but not limited to phosphorylated tyrosine, threonine or serine, as
well as cysteine
or a glycosylated amino acid residue. The abbreviations for amino acid
residues as used
herein are as follows: A, Ala, alanine; V, Val, valine; L, Leu, leucine; I,
Ile, isoleucine; P,
Pro, proline; F, Phe, phenylalanine; W, Trp, tryptophan; M, Met, methionine;
G, Gly, glycine;
S, Ser, serine; T, Thr, threonine; C, Cys, cysteine; Y, Tyr, tyrosine; N, Asn,
asparagine; Q,
Gln, glutamine; D, Asp, aspartic acid; E, Glu, glutamic acid; K, Lys, lysine;
R, Arg, arginine;
and H, His, histidine.
Additional abbreviations used herein include Mes, 2-(N-
morpholino)ethanesulfonic
acid; DMSO, dimethylsulfoxide; tNOX, cancer-associated and drug- (capsaicin-)
responsive
6
CA 02388612 2002-05-O1
WO 01/32673 PCT/US00/30190
cell surface NADH oxidase; ttNOX, truncated tNOX; CNOX, constitutive and drug-
unresponsive cell surface NADH oxidase; SDS-PAGE, sodium dodecylsulfate-
polyacrylamide gel electrophoresis; capsaicin, 8-methyl-N-vanillyl-6-
noneamide; LY181984,
N-(4-methylphenylsulfonyl)-N'-(4-chlorophenly)urea; LY181985, N-(4-
methylphenylsulfonyl)-N'-(4-phenyl)urea; EGCg, (-)-epigallocatechin gallate.
As used herein, neoplasia describes a disease state of a human or an animal in
which
there are cells and/or tissues which proliferate abnormally. Neoplastic
conditions include, but
are not limited to, cancers, sarcomas, tumors, leukemias, lymphomas, and the
like. The cell
surface NADH oxidase/protein disulfide-thiol interchange protein of the
present invention
characterizes neoplastic cells and tissue as well as virus-infected cells (for
example, human
immunodeficiency virus, feline immunodeficiency virus, etc).
The cell surface marker which is characteristic of diseased cells is described
in U.S.
Patent No. 5,605,810, issued February 25, 1997, which is incorporated by
reference herein,
and in several scientific publications of which D. James Morre is sole author
or a coauthor.
1 S This NADH oxidase/thiol interchange protein is found in the plasma
membrane of neoplastic
cells and cells infected with viruses, especially retroviruses and protozoan
parasites. This
protein is termed tNOX herein (tumor NADH oxidase). The cell surface tNOX
protein is
shed into serum and urine in cancer patients, but purification is relatively
difficult. Therefore,
it was a goal of the present work to obtain a cDNA clone encoding tNOX for use
in
recombinant production of the tNOX protein and for use of the tNOX coding
sequences or
portions thereof in probes and primers for the detection of tNOX transcripts
or genomic
sequences.
Immunological screening of a HeLa cell cDNA library using a tNOX-specific
monoclonal antibody generated five clones. Restriction digestions were
consistent with the
derivation of all five clones from a single primary phage clone. That all five
were inserts of
different lengths of the same DNA was confirmed by automated nucleotide
sequencing. The
largest clone contained a 3.8-kb insert and an open reading frame of 1,830-by
(from
nucleotide 23-1852 in SEQ ID NO:1).
7
CA 02388612 2002-05-O1
WO 01/32673 PCT/US00/30190
The full length cDNA yielded an open reading frame for a deduced amino acid
sequence for a protein of 610 amino acids, with a predicted molecular weight
of 70.1 kDa
(Table 1). It contains a typical Kozak sequence (AXXATG) which facilitates
translational
expression (Kozak, 1987) at nucleotide 20. The initiator methionine at
nucleotide 23 is
followed at FS by a sequence of 12 hydrophobic residues that serves as a
signal sequence for
membrane association. The termination codon at nucleotide 1853 is followed by
a typical
polyadenylation signal (AATAAA) at nucleotide 3625. Based on available genomic
information (Bird, 1999), tNOX cDNA is comprised of multiple exons (at least
nine) in just
the N-terminal portion of the full-length precursor (Fig 2).
The C-terminal portion of the derived amino acid sequence corresponded to the
mature, processed MW of 34 kDa (ca 33.5 kDa from serum) as documented in
previous
studies (Morre et al., ? 995a, 1996a; Chueh et al., 1997; del Castillo
Olivares et al., 1998).
Several potential functional motifs required of tNOX were contained in this
portion of the
protein as follows: The sequence E394-E-M-T-E forms a putative quinone binding
site with
4 of 5 amino acids conserved (Table 2). The C505-X-X-X-X-C510 motif represents
a
potential active site for the protein disulfide-thiol interchange activity
based on site-directed
mutagenesis (Table 3). Also representing a potential active site for protein
disulfide-thiol
interchange activity from site-directed mutagenesis and from inhibition of
activity by antisera
to a C-X-X-X-X-X-C-containing peptide (LAILPACATPATCNPD) is C569-X-X-X-X-X-
C575 (amino acids 569-575 of SEQ ID N0:2).
The sequence T590-G-V-G-A-S-L (amino acids 590-595 of SEQ ID N0:2) together
with E605 forms a putative binding site for the adenine portion of NADH with 5
of 7 amino
acids conserved with known mitochondrial adenine-binding proteins (Leblanc et
al, 1995).
The H546-V-H motif conserved in periplastic copper oxidases together with
His467 form a
potential copper binding ligand. In addition, the H546-V-H-E-F-G motif (amino
acids 546-
551 of SEQ ID N0:2) is conserved in both human and chicken superoxide
dismutase where it
provides a putative copper-binding site (Shining et al., 1996). Copper
analyses by atomic
absorption spectroscopy revealed at least 1 mole copper per 34 kDa processed
tNOX subunit
of the protein purified from sera of cancer patients.
8
CA 02388612 2002-05-O1
WO 01/32673 PCT/US00/30190
Potential N-glycosylation sites (NXS/T) were at positions 138, 358, 418 and
525.
Potential O-glycosylation sites include a threonine at amino acid 38, a
threonine at amino acid
71, a serine at amino acid 35 and a serine at amino acid 240.
tNOX is a membrane-associated protein. Three putative signal sequences and
cleavage sites near the N-terminus were identified as involved in membrane
targeting. The
second signal sequence near M220 would yield a 45.6 kDa protein containing all
of the above
identified functional motifs. The third potential signal sequence near M314
would result in a
34 kDa protein. In vitro translation of the cDNA of truncated tNOX starting at
M220 using a
rabbit reticulocyte lysate in the presence and absence of dog pancreatic
microsomal
membranes showed no indication of membrane insertion or apparent change in
molecular
weight of the in vitro translated product indicative of membrane-dependent
processing. The
truncated tNOX is encoded in SEQ ID NO:1, nucleotides 680-1852.
tNOX is a non-lipid-linked, extrinsic protein of the external plasma membrane
surface
(Morre, 1995). It is released from membranes by incubation at pH 5 (del
Castillo et al.,
1998). 'The hydropathy plot of the derived amino acid sequence of tNOX does
not predict
membrane-spanning domains (Fig 3).
Because the deduced amino acid sequence of the tNOX protein (Table 1) showed
homology over part of its length with the deduced amino acid sequence of a
cDNA previously
designated as APK1 antigen (from K357 to T610 of tNOX, amino acids 357-610 of
SEQ ID
N0:2) (Chang and Pastan, 1994), the question arose, are tNOX and the K1
antigen the same
proteins? The APK1 antigen cDNA sequence was obtained originally by expression
cloning
using a K1 antibody produced from the ovarian carcinoma cell line (OVCAR-3) as
immunogen. A portion of the cDNA of tNOX appears to be the same as that
isolated by
Chang and Pastan except that their sequence contained one extra T at
nucleotide 929 and one
less G at nucleotide 1092 (at the nucleotide 83 and 247 of their sequence).
These differences
generated an incorrect reading frame. The two errors were confirmed by Sugano
et al. (2000).
The monoclonal antibody used for cDNA screening did not react with the K1
antigen
expressed by OVCAR-3 cells nor do any of the properties of tNOX parallel those
of the K1
9
CA 02388612 2002-05-O1
WO 01/32673 PCT/US00/30190
antigen. The non-identity of tNOX and K1 antigen is consistent with a
subsequent
identification of the CAK1 protein as the protein reactive with the K1
antibody (Chang et al.,
1992; Chang and Pastan, 1994).
Neither the cell surface- or serum-derived nor the expressed tNOX share
significant
characteristics with the K-1 antigen. A high titer polyclonal antibody to the
recombinant
tNOX reacted with unprocessed (70 kDa) and processed (34 kDa) forms of tNOX
expressed
by OVCAR cells but failed to show any reactivity in portions of the gel
corresponding to
molecular weights of 30 kDa (APK1 antigen) or 40 kDa (CAKl) either in
detergent
solubilized (Fig. 4) or unsolubilized fractions. The CAK1 protein is expressed
primarily in
cell lines of mesothelial origin (Chang et al., 1992) and is anchored in the
membrane by a
glycosidic phosphatdyl-inositol (GPI) anchor. By contrast, tNOX lacks a GPI
anchor.
The expression of the tNOX cDNA in E. coli resulted in several forms of tNOX
including a truncated 46 kDa beginning at M220 (ttNOX), 46 kDa histidine-
tagged ttNOX
and 34 kDa truncated tNOX beginning at 6327. The entire sequence of the
subcloned cDNA
expressed in E. coli was confirmed by resequencing. tNOX proteins were
identified by
reaction with the tNOX-specific monoclonal antibody (Fig 5). The apparent
molecular
weight of the ttNOX of 48 kDa on SDS-PAGE was consistent with the calculated
molecular
weight from the deduced amino acid sequence of 46 kDa. The molecular weight of
the
truncated tNOX beginning at 6327 was 42 kDa on SDS-PAGE. Direct amino acid
sequencing has revealed that the expressed protein purified from bacterial
extract matched the
deduced amino acid sequence. The induced bacterial extract exhibited a NADH
oxidase
activity with a 23 min period (arrows in Fig. 6A). Both the induced bacterial
extracts when
measured in the presence of 1 or 100 ~M capsaicin (open circles in Fig. 6A and
Fig. 7) or the
uninduced extracts (Fig. 6B) had no periodic activity. The addition of 1 pM
antitumor
sulfonylurea LY181984 also completely inhibited the activity.
Illustrated in Fig. 7 is a second unique feature of the cell surface tNOX
activity
whereby the maximum rates of the two activities associated with the cloned and
expressed
protein, the hydroquinone (NADH) oxidase activity and the protein disulfide-
thiol
CA 02388612 2002-05-O1
WO 01/32673 PCT/US00/30190
interchange (dithiodipyridine cleavage), alternate. As the rate of oxidation
of NADH
declines, the rate of DTDP cleavage increases, so that DTDP cleavage is at a
maximum when
NADH oxidation is at a minimum. Both had approximately the same period length
of 23
mm.
Peptide antisera against the tNOX C-terminus recognized expressed a truncated
protein species (produced in recombinant COS-1 cells) with a molecular weight
48 kDa on
SDS-PAGE (Fig 8). Also present were two peptides of lower M~. Growth rates
determined
by image enhanced light microscopy of the ttNOX-transfected cells were about 2-
fold greater
than with vector alone (Fig 9). The increased growth rate also was reflected
in increased cell
size. At confluency, the mean cell diameter of tNOX-transfected COS cells was
about 30 ~m
whereas the average cell diameter of COS cells transfected with vector alone
was about 20
~m (Fig. 10). The larger cell diameter resulted in a 4- to 5-fold increase in
cell volume. An
increased cell surface of the transfected cells was confirmed by electron
microscopy. In
keeping with the characteristic drug responsiveness of the oxidative activity
that defines
tNOX and the close relationship of tNOX activity to the enlargement phase of
cell growth
(Pogue et al., 2000), growth of tNOX cDNA-transfected COS cells exhibited a 10-
to 100-
fold greater susceptibility to tNOX inhibitors compared to cells transfected
with vector alone
(Table 3). tNOX inhibitors included capsaicin, (-)-epigallocatechin gallate
(EGCg),
adriamycin, and the active antitumor sulfonylurea, LY181984 (N-(4-
methylphenylsulfonyl)-
N'-(4-chlorophenyl)urea) (Table 4). With all four inhibitors, the EC50 of
growth inhibition
was shifted by 1 to 2 orders of magnitude to lower drug concentrations as a
result of tNOX
cDNA-transfection. The inactive antitumor sulfonylurea, LY181985 (N-(4-
methylphenylsulfony-1~T'-(4-phenyl)urea) which differs from LY181984 by a
single chlorine
did not inhibit with either cells transfected with tNOX cDNA or with control
cells transfected
with vector alone. Similarly, the growth response to the non-tNOX inhibitor
methotrexate, an
antifolate, was unaffected by tNOX cDNA transfection.
The conclusion that the recombinant tNOX protein and the 34 kD NOX protein
isolated from sera represent the same protein derives, in part, from the
collective properties
that define the two proteins. These include two different enzymatic
activities, hydroquinone
11
antigen. The non-identity of tN
CA 02388612 2002-05-O1
WO 01/32673 PCT/US00/30190
(NADH) oxidation and protein disulfide-thiol interchange (Figs. 6 and 7),
together with an
alternation of these two activities to generate a period length of 22 min
(Figs. 6 and 7, Table
3). Additionally, the activities of both proteins respond to the same series
of quinone site
inhibitors and antitumor drugs in situ as well as in solution (Tables3 and 4).
It is the latter
property that defines tNOX and distinguishes tNOX from other NOX proteins
lacking drug
responsiveness.
As previously demonstrated (Chueh et al., 1997; del Castillo et al., 1998),
the
correctly folded and active NOX proteins are blocked to direct sequencing and
to N-terminal
sequencing and/or enzymatic or chemical cleavage. However, a direct sequence
link between
the monoclonal antibody antigen employed in the cloning and amino acid
sequence deduced
for the 34 kD processed NOX form from the cell surface has come from protein
purification
studies. An incompletely processed 38.5 kD protein that cross-reacted with the
monoclonal
antibody and was converted to the 34 kD form upon digestion with proteinase K
has been
isolated from the HeLa cell surface. The 38.5 kD protein yielded a partial N-
terminal
, sequence which was consistent with that of the deduced amino acid sequence
of tNOX as
presented in SEQ ID N0:2.
A further characteristic of NOX proteins is that the two activities, NADH
oxidation
and protein disulfide-thiol interchange, alternate every 12 min to generate a
regular pattern of
oscillations with a temperature compensated and entrainable period length of
ca 24 min (Fig.
7). Compared to CNOX with a precise 22 min period length (Pogue et al., 2000),
ttNOX had
a shorter period of 23 min. Mutant ttNOX proteins with different cysteine to
alanine
replacements were expressed in E. coli. Of these, CSOSA and C569A no longer
exhibited
NADH oxidase activity. The four other cysteine mutants retained NADH oxidase
activity but
the period lengths were changed (Table 3). For C575A and C602A, the period
length for both
NADH oxidation and protein disulfide-thiol interchange was increased to 36
min. For
CS 10A and C558A, the period length to 39 min.
Our work identified an unusual NADH oxidase activity of the cell surface and
plasma
membrane of plant and animal cells. While the physiological function of the
oxidative
12
CA 02388612 2002-05-O1
WO 01/32673 PCT/US00/30190
portion of the NOX cycle is that of a hydroquinone oxidase (Kishi et al.,
1999), the oxidation
of external NADH provides a convenient measure of the enzymatic activity.
Interest in these
proteins derives not only from their plasma membrane location but also from
their potential
roles as time-keeping proteins (Wang et al., 1998) and a relationship between
the oscillatory
enzymatic activity and the enlargement phase of cell growth (Morre, 1998;
Pogue et al.,
2000). The NOX proteins are unique in that they exhibit two different
activities,
hydroquinone oxidation and protein disulfide-thiol interchange. The two
activities alternate
(Morre, 1998; Sun et al., 2000) to generate the ca 24 min period.
While several NOX forms may exist, this first NOX form to be cloned and
identified
is the cancer-specific form designated tNOX. tNOX differs from the
constitutive CNOX
form present in both cancer and non-cancer tissues in its sensitivity to
several anticancer
drugs and to thiol reagents. The response of tNOX activity to the quinone site
inhibitor
capsaicin was used to guide purification of the processed tNOX protein from
sera of cancer
patients, as the basis for the monoclonal antibody selection and eventually to
confirm the
1 S identity of the cloned cDNA based on complete capsaicin-inhibition of the
activity of the
bacterially expressed protein (Fig. 6).
The monoclonal antibody to the capsaicin-inhibited NADH oxidase from sera of
cancer patients unequivocally identified a single cDNA sequence encoding the
antigen. The
sequence was one previously attributed to a cytosolic protein, the APK1
antigen (Chang and
Pastan, 1994). The APK1 antigen was considered to be the antigen recognized by
a
monoclonal antibody designated K1 that was produced by hybridoma cells from
mice
immunized with ovarian carcinoma (OVCAR-3) cells. The longest cDNA of the
study of
Chang and Pastan (1994) contained 2,444-by with a 789-by open reading frame
that encoded
a protein of 30.5 kDa. The cDNA isolated by Chang and Pastan, despite missing
and extra
bases that generated a different reading frame from ours, was most likely
identical to tNOX
cDNA.
The protein reactive with the K1 antibody was originally identified as CAK1
(Chang
et al., 1992). CAK1 is a membrane-bound protein with a molecular weight of 40
kDa,
13
CA 02388612 2002-05-O1
WO 01/32673 PCT/US00/30190
whereas the expressed APK1 gene product generated a soluble cytosolic protein
(Chang and
Pastan, 1994). CAKl is expressed in ovarian cancers and mesotheliomas as well
as in normal
mesothelial cells. It appears to be a differentiation antigen that is
expressed on cancers
derived from mesothelium, such as epithelioid type mesotheliomas and ovarian
cancers. It is a
protein very distinct from tNOX. Using the monoclonal antibody K1, they
eventually isolated
a 2,138-by cDNA that encoded CAK1 (Chang and Pastan, 1996). The cDNA had an
1,884-
bp open reading frame encoding a 69 kDa protein. The 69 kDa precursor was
processed to the
40 kDa form and the protein was named mesothelin because it was characteristic
of
mesothelial cells. When the cDNA was transfected into COS and NIH3T3 cells,
the antigen
was found on the cell surface and could be released by treatment with
phosphatidylinositol-
specific phospholipase C. tNOX is not anchored at the plasma membrane by a GPI
linkage
nor is it released by treatment with a phosphatidylinositol-specific
phospholipase C.
Mesothelin (CAK1), while associated with the cell membrane via a glycosyl-
phosphatidylinositol tail, is not shed into the sera of cancer patients nor
does it appear in
conditioned medium supporting the growth of cultured cells (Chang and Pastan,
1994). ~As
described earlier, tNOX has been isolated both from culture media by the
growth of HeLa
cells (Wilkinson et al, 1996) and from sera of cancer patients (Chueh et al.,
1997).
Furthermore, no protein sequence homology was found between CAK1 and tNOX.
In previous experiments, we had successfully photoaffinity-labeled the tNOX
protein
by [32P]NAD(H), indicating that it contained a NADH binding site. NOX activity
also
responds to adenine nucleotides (Moue, 1998b). The typical adenine nucleotide
binding
sequence motif (G-X-G-X-X-Gl with downstream remote acidic amino acid residues
D or E
(Yano et al., 1997) is represented most closely by T589-G-V-G-A-S-L (amino
acids 589-595
of SEQ ID N0:2) and E605 near the C-terminus. This sequence resembles closely
the
sequence T-G-V-G-A-G-V-G (SEQ ID N0:3) from mitochondrial ATP synthase protein
9
from Chondous crispus (Leblanc et al., 1995).
The NOX protein binds the antitumor sulfonylurea LY181984 (Moue et al., 1995c)
and activity is inhibited or stimulated depending on the redox environment of
the protein
(Moue et al., 1998b). Reduced coenzyme Q is readily oxidized by the protein
(Kishi et al.,
14
CA 02388612 2002-05-O1
WO 01/32673 PCT/US00/30190
1999) and other substances such as capsaicin and adriamycin which inhibit the
activity are
considered to occupy quinone sites. Ubiquinone protects against the binding
and activity
inhibition by the sulfonylurea LY181984. Thus, the presence in the tNOX
sequence of a
motif indicative of quinone binding as well as binding of sulfonylureas and
other molecules
known to occupy quinone sites, was sought.
A site with a methionine-histidine pair has been suggested to be the quinone
binding site of
pyruvate oxidase (Grabau and Cronan, 1986) by analogy with several quinone
binding
proteins of the photosystem II complex of chloroplasts. All known urea and
sulfonylyrea
herbicide inhibitors of photosystem II are directed to such sites (Duke,
1990). Based on these
considerations, a preliminary consensus sequence for the amino acids
surrounding the
charged residues critical to sulfonylurea and quinone-binding site was
determined to be A-M-
H-G (SEQ ID N0:4) or a closely related sequence (Table 2). Apparently arginine
can
substitute for the critical histidine. For example, the putative quinone-
binding site of the D1
protein of a cyanobacterium (Syneclaococcus), contains the sequence E-T-M-R-E
(SEQ ID
N0:5). A sequence similar to E-T-M-R-E sequence is present in the NADH
ubiquinone
dehydrogenase of chloroplasts. Serum albumins also bind sulfonylureas and
their putative
sulfonylurea binding sites are included in Table I as well. We found a
sequence E-M-T-E
(amino acids 395-398 of SEQ ID N0:2) as a potential quinone site having
neither H nor R in
the 4th position but still with considerable similarity to other putative
quinone and/or
sulfonylurea-binding sites. The correctness of identification of this E-M-T-E
sequence as
the drug binding site is supported by findings from the mutation M396A, which
retains
NADH oxidase activity but lost inhibition by capsaicin (Table II).
The first demonstrations of the thiol interchange activity for the tNOX
protein used as
the principal criterion, the restoration of activity to reduced, denatured and
oxidized
(scrambled) yeast RNase through reduction, refolding under non-denaturing
conditions and
reoxidation to form a correci secondary structure stabilized by internal
disulfide bonds (Moue
et al., 1997c). The restoration of activity to scrambled yeast RNase was
similar to that
catalyzed by protein disulfide isomerases of the endoplasmic reticulum
(Freedman, 1989) but
was clearly due to an activity of a different protein. The activity was not
altered by the
presence of two different antisera to protein disulfide isomerases (Moue et
al., 1997c). One
CA 02388612 2002-05-O1
WO 01/32673 PCT/US00/30190
was mouse monoclonal antibody (SPA-891) from StressGen Biotechnologies to
protein
disulfide isomerase from bovine liver (cross-reactive with PDI from human,
monkey, rat,
mouse and hamster cell lines). The other was a peptide antibody of our own
derivation
directed to the characteristic C-X-X-C motif common to most, if not all,
members of the
protein disulfide isomerase family of proteins (Sharrosh and Dixon, 1991 ) but
absent from
tNOX. A C-X-X-C motif is present as well in thioredoxin reductase and related
proteins
where it appears to catalyze the transfer of electrons in conjunction with
bound flavin (Russet
and Model, 1988; Ohnishi et al., 1995). In addition to lacking C-X-X-C, tNOX
does not
appear to contain bound flavin nor is its activity dependent upon addition of
flavin (FAD or
FMN). Thus, the protein disulfide-thiol interchange catalyzed by tNOX appears
to be distinct
from that of classic protein disulfide isomerases or thioredoxin reductases.
The redox active disulfide of thioredoxin reductase from the malaria parasite
Plasmodium falciparum, however, was in a motif C88-X-X-X-X-C93 (Gilberger et
al., 1997)
similar to those found in tNOX. This motif together with a downstream His509
was shown to
be a putative proton donor/acceptor. A second C535-X-X-X-X-C540 motif in the
same
protein was crucially involved in substrate coordination and/or electron
transfer (Gilberger et
al., 1998). As suggested by the site directed mutagenesis results for tNOX,
four of the eight
cysteines present in truncated tNOX may be functionally paired. Results from
site-directed
mutagenesis (Table II) show that CSOSA and C569A mutations exhibit loss of
both NADH
oxidase and protein disulfide thiol interchange activities (manuscript in
preparation). Thus,
these two motifs, C505-X-X-X-X-C510 and C569-X-X-X-X-X-C575, alone or together
with
downstream histidines, might serve as part of the tNOX active site. tNOX was
tested early
for thioredoxin reductase activity and none was found. Despite the fact that
tNOX lacks the
two C-X-X-X-X-C motifs characteristic of flavoproteins, the sequence C505-A-S-
R-L-C510
(amino acids 505-510 of SEQ ID N0:2) or the sequence C569-T-S-D-V-E-C575
(amino acids
569-575 of SEQ ID N0:2) might represent potential protein disulfide-thiol
interchange
motifs.
The remaining four cysteine mutations analyzed thus far exhibit ah altered
period
length for the oscillations in tNOX activity (Table II) where both NADH
oxidation and
16
CA 02388612 2002-05-O1
WO 01/32673 PCT/US00/30190
protein disulfide thiol interchange appear to be affected in parallel. The
period length was
increased from 23 min to 36 min for C575A and C602A whereas for C510A and
C558A, the
period length was increased to 36 min. Of potential interest is the
observation that the 6-
amino acid motif M588-T-G-V-G-A (amino acids 588-593 of SEQ ID N0:2) of tNOX
is
shared with the Drosophila melanogaster clock period protein (Kliman and Hey,
1993).
At least under certain conditions, the tNOX protein catalyzes the transfer of
electrons
and protons to molecular oxygen. Oxygen uptake by plasma membranes prepared
from HeLa
cells is inhibited by the antitumor sulfonylurea LY181984 with approximately
the same dose
response (see Morre et al., 1998a) as other aspects of tNOX activity (see also
Morre et al.,
1998a). Therefore, we assume that tNOX and NOX proteins in general bind
oxygen. The
minimum requirement for an oxygen site would appear to be a metal together
with
appropriate covalent interactions such as hydrogen bonding (MacBeth et al.,
2000). There are
no indications that they might form a cluster with a typical motif for a [4Fe-
4S] cluster
binding site (C-X-X-C-X-X-C) and a remote cysteine followed by a proline. tNOX
does
contain a conserved copper site, which could provide the basis for oxygen
binding.
The expression of truncated tNOX in E. coli and COS cells has confirmed that
the
cloned cDNA indeed exhibits fully the characteristics of the tNOX protein. All
forms of
tNOX (including the truncated and processed forms) were recognized by the tNOX-
specific
monoclonal antibody used in expression cloning. In addition, the expressed
protein exhibited
both enzymatic activities associated with NOX proteins (Figs. 6 and 7).
Overexpression of
the tNOX proteins in COS cells stably transfected with the tNOX cDNA imparted
tNOX-
specific characteristics to the COS cells. The tNOX cDNA-transfected cells
exhibited a 1.5
to 2-fold increase in cell size compared to control cells (3- to 5-fold
increase in cell volume)
- and one to two log orders increase in sensitivity to tNOX-inhibitory drugs
including
capsaicin, (-)-epigallocatechin gallate (EGCg), adriamycin and the antitumor
sulfonylureas
(Table III). EGCg is the principal catechin responsible for the effects of
green tea and green
tea extracts on cancer prevention and on growth of cancer cells in culture
(Chang, 2000). As
is characteristic of other NOX inhibitors, EGCg inhibits the activity of tNOX
but is largely
without effect on the constitutive CNOX (Moue et al., 2000).
17
CA 02388612 2002-05-O1
WO 01/32673 PCT/US00/30190
Taken together, the findings discussed herein confirm the molecular cloning
and
expression of the tNOX protein. The availability of the cDNA and the expressed
protein will
greatly facilitate future studies of the potential contribution of tNOX to
unregulated growth
and loss of differentiated characteristics linked to cancer.
Primary screening of the commercially available HeLa cell cDNA library was
performed by selecting from a total of sixteen 150-mm plates. Five positive
clones (clone 1,
2, 4, 5 and 6; clone 3 was concluded to be false positive at secondary
screening) were
identified and further purified through at least three rounds of screening.
Subsequently, in
vivo excision was performed rather than subcloning because of its convenience
and speed.
Clone 1 contained the longest DNA insert with approximately 3,900-by while
clone 5
contained the shortest DNA insert with about 2,000-by (Fig. 1). Several
restriction
endonucleases were utilized to determine the restriction sites (Fig. 1 ). The
Uni-Zap XR
library used in this study was constructed with EcoRI and XhoI double
digestion. However,
the digestion with EcoRI or XhoI alone demonstrated that there were both an
internal EcoRI
site and an XhoI site near the 5' end of antisense strand in clone 1, clone 2
and clone 4. The
lack of the internal EcoRI and XhoI sites in both clone 5 and clone 6
indicated that the DNA
inserts in these two clones were further downstream with shorter 3' ends. In
addition, all of
the five clones contained internal BamHI and XbaI sites. The double digestion
of these two
enzymes of each clone all produced a small (ca. 400 bp) segment of DNA. This
phenomenon verified that those sites were identical in all five clones. The
restriction
mapping revealed that the five independent clones were identical except for
the different
lengths of DNA inserts. Since clone 1 contained the longest DNA insert, it was
chosen for
complete DNA sequencing. The rest of the four clones were sent for one round
of automated
sequencing. DNA sequences of all five clones were examined in the GenBank to
seek
identity or relatedness with other known genes. A computer-assisted search
revealed that all
five clones were similar to a DNA sequence designated as APK1 antigen [Chang
and Pastan
(1994) supra]. When all five of our clones were compared with the nucleotide
sequence of
APK1 antigen, two possible differences were observed in positions 83 and 246
of the APK1
antigen sequence. These two differences caused a shift in the open reading
frame and in the
deduced amino acid sequence.
18
CA 02388612 2002-05-O1
WO 01/32673 PCT/US00/30190
The nucleotide sequence encoding human tNOX, recombinant human tNOX protein
and recombinant cells which express recombinant human tNOX can be used in the
production
of recombinant tNOX for use in cancer diagnostic protocols and as a target for
(screening)
new anticancer drugs.
S It is understood by the skilled artisan that there can be limited numbers of
amino acid
substitutions in a plasma membrane NADH oxidase protein without significantly
affecting
function, and that nonexemplified plasma membrane NADH oxidase of neoplastic
mammalian cells, virus- or parasite-infected mammalian cells or capsaicin-
responsive plant
plasma membrane NADH oxidase proteins can have some amino acid sequence
divergence
from the specifically exemplified amino acid sequence. Such naturally
occurring variants can
be identified, e.g., by hybridization to the exemplified coding sequence (or a
portion thereof
capable of specific hybridization to human tNOX sequences) under conditions
appropriate to
detect at least about 70% nucleotide sequence homology, preferably about 80%,
more
preferably about 90% or 95-100% sequence homology. Preferably the encoded tNOX
has at
least about 90% amino acid sequence identity to the exemplified tNOX amino
acid sequence.
In examining nonexemplified sequences, demonstration of the characteristic
plasma
membrane NADH oxidase and protein thiol interchange activities and the
sensitivity of those
activities to inhibitors such as capsaicin allows one of ordinary skill in the
art to confirm that
a functional protein is produced.
Also within the scope of the present invention are isolated nucleic acid
molecules
comprising nucleotide sequences encode tNOX proteins and which hybridize under
stringent
conditions to a nucleic acid molecule comprising the nucleic acid sequence of
SEQ ID NO:1
or a sequence corresponding to nucleotides 23 to 1852 thereof. DNA molecules
with at least
85% nucleotide sequence identity to a specifically exemplified tNOX coding
sequence
sequence of the present invention are identified by hybridization under
stringent conditions
using a probe as set forth herein. Stringent conditions involve hybridization
at a temperature
between 65 and 68C in aqueous solution (5 x SSC, 5 x Denhardt's solution, 1%
sodium
dodecyl sulfate) or at about 42C in 50% formamide solution, with washes in 0.2
x SSC, 0.1%
sodium dodecyl sulfate at room temperature, for example. The ability of a
sequence related to
19
CA 02388612 2002-05-O1
WO 01/32673 PCT/US00/30190
the specifically exemplified tNOX sequence of the present invention are
readily tested by one
of ordinary skill in the art.
As used in the present context, percent homology or percent sequence identity
of two
nucleic acid molecules is determined using the algorithm of Karlin and
Altschul (1990) Proc.
Natl. Acad. Sci. USA 87, 2264-2268, modified as described in Karlin and
Altschul (1993)
Proc. Natl. Acad Sci. USA 90, 5873-5877. Such an algorithm is incorporated
into the
NBLAST and XBLAST programs of Altschul et al. (1990) J. Mol. Biol. 215, 402-
410.
BLAST nucleotide searches are performed with the NBLAST program, scor = 100,
wordlength = 12, to obtain nucleotide sequences homologous to the nucleotide
sequences of
the present invention. BLAST protein searches are performed with the XBLAST
program,
score = 50, wordlength = 3, to obtain amino acid sequences homologous to a
reference
polypeptide sequence. To obtain gapped alignments for comparison purposes,
Gapped
BLAST is utilized as described in Altschul et al. (1997) Nucl. Acids Res. 25,
3389-3402/
When using BLAST and Gapped BLAST programs, the default parameters of the
respective
programs (XBLAST and NBLAST) are used. Gaps introduced to optimize alignments
are
treated as mismatches in calculating identity. See, e.g.,
http://www.ncbi.nlm.~ov.
It is well known in the biological arts that certain amino acid substitutions
can be
made in protein sequences without affecting the function of the protein.
Generally,
conservative amino acids are tolerated without affecting protein function.
Similar amino
acids can be those that are similar in size and/or charge properties; for
example, aspartate and
glutamate and isoleucine and valine are both pairs of similar amino acids.
Similarity between
amino acid pairs has been assessed in the art in a number of ways. For
example, Dayhoff et
al. [(1978) In: Atlas ofProtein Sequence and Structure, Volume 5, Supplement
3, Chapter 22,
pp. 345-352], which is incorporated by reference herein, provides frequency
tables for amino
acid substitutions which can be employed as a measure of amino acid
similarity. Dayhoff et
al.'s frequency tables are based on comparisons of amino acid sequences for
proteins having
the same function from a variety of evolutionarily different sources. The art
provides
methods for determining tNOX activity, including its characteristic response
to certain
inhibitors (capsaicin, adriamycin, quassinoids, etc).
CA 02388612 2002-05-O1
WO 01/32673 PCT/US00/30190
A polynucleotide or fragment thereof is substantially homologous (or
substantially
similar) to another polynucleotide if, when optimally aligned (with
appropriate nucleotide
insertions or deletions) with another polynucleotide, there is nucleotide
sequence identity for
approximately 60% of the nucleotide bases, usually approximately 70%, more
usually about
80%, preferably about 90%, and more preferably about 95% to 100% of the
nucleotide bases.
Alternatively, substantial homology (or similarity) exists when a
polynucleotide or
fragment thereof will hybridize to another polynucleotide under selective
hybridization
conditions. Selectivity of hybridization exists under hybridization conditions
which allow
one to distinguish the target polynucleotide of interest from other
polynucleotides. Typically,
selective hybridization will occl~r when there is approximately 55% similarity
over a stretch
of about 14 nucleotides, preferably approximately 65%, more preferably
approximately 75%,
and most preferably approximately 90%. See Kanehisa [(1984) Nucl. Acids Res.
12:203-
213]. The length of homology comparison, as described, may be over longer
stretches, and in
certain embodiments will often be over a stretch of about 17 to 20
nucleotides, and preferably
about 36 or more nucleotides. The hybridization of polynucleotides is affected
by such
conditions as salt concentration, temperature or organic solvents, in addition
to the base
composition, length of the complementary strands, and the number of nucleotide
base
mismatches between the hybridizing polynucleotides, as will be readily
appreciated by those
skilled in the art. However, the combination of parameters is much more
important than the
measure of any single parameter [Wetmur and Davidson (1968) J. Mol. Biol.
31:349-370].
An isolated or substantially pure polynucleotide is a polynucleotide which is
substantially separated from other polynucleotide sequences which naturally
accompany a
native tNOX protein coding sequence: The term embraces a polynucleotide
sequence which
has been removed from its naturally occurring environment, and includes
recombinant or
cloned DNA isolates, chemically synthesized analogues and analogues
biologically
synthesized by heterologous systems.
A polynucleotide is said to encode a polypeptide if, in its native state or
when
manipulated by methods known to those skilled in the art, it can be
transcribed and/or
21
CA 02388612 2002-05-O1
WO 01/32673 PCT/US00/30190
translated to produce the polypeptide of a fragment thereof. The antisense
strand of such a
polynucleotide is also said to encode the sequence. The assay methods
described hereinbelow
allow the confirmation that an active tNOX protein with intact response
patterns to inhibitors
of authentic tNOX is produced upon expression of the coding sequence disclosed
herein in a
recombinant host cell.
A nucleotide sequence is operably linked when it is placed into a functional
relationship with another nucleotide sequence. For instance, a promoter is
operably linked to
a coding sequence if the promoter affects its transcription or expression.
Generally, operably
linked means that the sequences being linked are contiguous and, where
necessary to join two
protein coding regions, contiguous and in reading frame. However, it is well
known that
certain genetic elements, such as enhancers, may be operably linked even at a
distance, i.e.,
even if not contiguous.
The term non-naturally occurring or recombinant nucleic acid molecule refers
to a
polynucleotide which is made by the combination of two otherwise separated
segments of a
sequence accomplished by the artificial manipulation of isolated segments of
polynucleotides
by genetic engineering techniques or by chemical synthesis. In so doing one
may join
together polynucleotide segments of desired functions to generate a desired
combination of
functions.
Polynucleotide probes include an isolated polynucleotide attached to a label
or
reporter molecule and may be used to identify and isolate other tNOX protein
coding
sequences. Probes comprising synthetic oligonucleotides or other
polynucleotides may be
derived from naturally occurring or recombinant single- or double-stranded
nucleic acids or
be chemically synthesized. They may be used in polymerase chain reactions as
well as in
hybridizations. Polynucleotide probes may be labeled by any of the methods
known in the
art, e.g., random hexamer labeling, nick translation, or the Klenow fill-in
reaction.
Oligonucleotides or polynucleotide primers useful in PCR are readily
understood and
accessible to the skilled artisan using the sequence information provided
herein taken with
what is well known to the art.
22
CA 02388612 2002-05-O1
WO 01/32673 PCT/US00/30190
Large amounts of the polynucleotides may be produced by replication in a
suitable
host cell. Natural or synthetic DNA fragments coding for a tNOX protein
incorporated into
recombinant polynucleotide constructs, typically DNA constructs, capable of
introduction
into and replication in a prokaryotic or eukaryotic cell, desirably a yeast
cell, and preferably a
Saccharomyces cerevi.siae cell are provided by the present invention. Usually
the construct
will be suitable for replication in a unicellular host, such as yeast or
bacteria, but a
multicellular eukaryotic host may also be appropriate, with or without
integration within the
genome of the host cells. Commonly used prokaryotic hosts include strains of
Escherichia
coli, although other prokaryotes, such as Bacillus subtilis or Pseudomonas may
also be used.
Yeasts suitable for the present invention include species of Saccharomyces and
Pichia, e.g.,
Pichia pastoris. Mammalian (e.g., CHO or COS cells) or other eukaryotic host
cells include
filamentous fungi, plant, insect, amphibian and avian species. Such factors as
ease of
manipulation, ability to appropriately glycosylate expressed proteins, degree
and control of
protein expression, ease of purification of expressed proteins away from
cellular
contaminants, or other factors may determine the choice of the host cell.
Vectors suitable for
use in the foregoing host cells are well known to the art and are widely
available in research
laboratories as well as through commerce.
The polynucleotides may also be produced by chemical synthesis, e.g., by the
phosphoramidite method described by Beaucage and Caruthers [(1981) Tetra.
Letts.
22:1859-1862] or the triester method according to Matteuci et al. [(1981) J.
Am. Chem. Soc.
103:3185], and may be performed on commercial automated oligonucleotide
synthesizers. A
double-stranded fragment may be obtained from the single stranded product of
chemical
synthesis either by synthesizing the complementary strand and annealing the
strand together
under appropriate conditions or by adding the complementary strand using DNA
tNOX
protein with an appropriate primer sequence.
DNA constructs prepared for introduction into a prokaryotic or eukaryotic host
cell
typically comprise a replication system (i.e. vector) recognized by the host,
including the
intended DNA fragment encoding the desired polypeptide, and preferably also
include
transcription and translational initiation regulatory sequences operably
linked to the tNOX
23
CA 02388612 2002-05-O1
WO 01/32673 PCT/US00/30190
protein-encoding segment. Expression systems (expression vectors) may include,
for
example, an origin of replication or autonomously replicating sequence (ARS)
and expression
control sequences, a promoter, an enhancer and necessary processing
information sites, such
as ribosome-binding sites, RNA splice sites, polyadenylation sites,
transcriptional terminator
sequences, and mRNA stabilizing sequences. Signal peptides may also be
included where
appropriate from secreted polypeptides of the same or related species, which
allow the protein
to cross and/or lodge in cell membranes or be secreted from the cell.
An appropriate promoter and other necessary vector sequences will be selected
so as
to be functional in the host. Examples of workable combinations of cell lines
and expression
vectors are described in Sambrook et al. [(1989) vide infra; Ausubel et al.
(Eds.) (1992)
Current Protocols in Molecular Biology, Greene Publishing and Wiley
Interscience, New
York] and Metzger et al. [(1988) Nature 334:31-36]. Many useful vectors for
expression in
bacteria, yeast, mammalian, insect, plant or other cells are well known in the
art and may be
obtained from such vendors as Stratagene, New England Biolabs, Promega, and
others. In
addition, the construct may be joined to an amplifiable gene (e.g., DHFR) so
that multiple
copies of the gene may be made. For appropriate enhancer and other expression
control
sequences, see also Enhancers and Eukaryotic Gene Expression, Cold Spring
Harbor Press,
NY (1983). While such expression vectors may replicate autonomously, they may
less
preferably replicate by being inserted into the genome of the host cell.
Expression and cloning vectors desirably contain a selectable marker, that is,
a gene
encoding a protein necessary for the survival or growth of a host cell
transformed with the
vector. Although such a marker gene may be carried on another polynucleotide
sequence co-
introduced into the host cell, it is most often contained on the cloning
vector. Only those host
cells into which the marker gene has been introduced will survive and/or grow
under selective
conditions. Typical selection genes encode proteins that (a) confer resistance
to antibiotics or
other toxic substances, e.g., ampicillin, neomycin, methotrexate, etc.; (b)
complement
auxotrophic deficiencies; or (c) supply critical nutrients not available from
complex media.
The choice of the proper selectable marker will depend on the host cell;
appropriate markers
for different hosts are known in the art.
24
CA 02388612 2002-05-O1
WO 01/32673 PCT/US00/30190
The coding sequence and the deduced amino acid sequence for the tNOX are
provided
ir_ Table 1. See also SEQ ID NO:1 and SEQ ID N0:2.
A combination of restriction endonuclease cutting and site-directed
mutagenesis via
PCR using an oligonucleotide containing a desired restriction site for cloning
(one not present
in coding sequence), a ribosome binding site, a translation initiation codon
(ATG) and the
codons for the first amino acids of tNOX can be employed to engineer tNOX for
recombinant
expression. Site-directed mutagenesis strategy is described, for example, in
Boone et al.
[(1990) Proc. Natl. Acad. Sci. USA 87:2800-2804], with modifications for use
with PCR as
readily understood by the skilled artisan.
The skilled artisan understands that it may be advantageous to modify the
exemplified
tNOX coding sequence for improved expression in a particular recombinant host
cell. Such
modifications, which can be carried out without the expense of undue
experimentation using
the present disclosure taken together with knowledge and techniques readily
accessible in the
art, can include adapting codon usage so that the modified tNOX protein coding
sequence has
1 S codon usage substantially like that known for the target host cell. Such
modifications can be
effected by chemical synthesis of a coding sequence synonymous with the
exemplified coding
sequence or by oligonucleotide site-directed mutagenesis of selected portions
of the coding
sequence.
Compositions and immunogenic preparations, including vaccine compositions,
comprising substantially purified recombinant tNOX virus or an immunogenic
peptide having
an amino acid sequence derived therefrom and a suitable carrier therefor are
provided by the
present invention. Alternatively, hydrophilic regions of the tNOX can be
identified by the
skilled artisan, and peptide antigens can be synthesized and conjugated to a
suitable carrier
protein (e.g., bovine serum albumin or keyhole limpet hemocyanin) if needed
for use in
vaccines or in raising polyclonal or monoclonal antibodies specific for the
exemplified tNOX.
Immunogenic compositions are those which result in specific antibody
production when
injected into a human or an animal. The vaccine preparations comprise an
immunogenic
amount of the exemplified tNOX or an immunogenic fragments) thereof. Such
vaccines may
CA 02388612 2002-05-O1
WO 01/32673 PCT/US00/30190
comprise tNOX, alone or in combination with another protein or other
immunogen. By
"immunogenic amount" is meant an amount capable of eliciting the production of
antibodies
directed against the exemplified tNOX in an individual or animal to which the
vaccine has
been administered.
Immunogenic carriers can be used to enhance the immunogenicity of the tNOX or
peptides derived in sequence therefrom. Such carriers include but are not
limited to proteins
and polysaccharides, liposomes, and bacterial cells and membranes. Protein
carriers may be
joined to the tNOX protein or peptides derived therefrom to form fusion
proteins by
recombinant or synthetic means or by chemical coupling. Useful carriers and
means of
coupling such carriers to polypeptide antigens are known in the art.
Preferred fusion proteins which are effective for stimulating an immune
response,
especially when administered orally (e.g., in food or water) include those
fusion proteins with
a cholera toxin fragment, or so-called LTB fusion. These methods are described
in Dougan et
al. [(1990) Biochem. Soc. Trans. 18:746-748] and Elson et al. [(1984) J.
Immunol. 132:2736-
2741].
The immunogenic compositions and/or vaccines may be formulated by any of the
means known in the art. They are typically prepared as injectables, either as
liquid solutions
or suspensions. Solid forms suitable for solution in, or suspension in, liquid
prior to injection
may also be prepared. The preparation may also, for example, be emulsified, or
the
protein(s)/peptide(s) encapsulated in liposomes.
The active immunogenic ingredients are often mixed with excipients or carriers
which
are pharmaceutically acceptable and compatible with the active ingredient.
Suitable
excipients include but are not limited to water, saline, dextrose, glycerol,
ethanol, or the like
and combinations thereof. The concentration of the immunogenic polypeptide in
injectable
formulations is usually in the .range of 0.2 to 5 mg/ml.
26
CA 02388612 2002-05-O1
WO 01/32673 PCT/US00/30190
In addition, if desired, the vaccines may contain minor amounts of auxiliary
substances such as wetting or emulsifying agents, pH buffering agents, and/or
adjuvants
which enhance the effectiveness of the vaccine. Examples of adjuvants which
may be
effective include but are not limited to: aluminum hydroxide; N-acetyl-muramyl-
L-threonyl-
D-isoglutamine (thr-MDP); N-acetyl-nor-muramyl-L-alanyl-D-isoglutamine (CGP
11637,
referred to as nor-MDP); N-acetylmuramyl-L-alanyl-D-isoglutaminyl-L-alanine-2-
(1'-2'-
dipalmitoyl-sn-glycero-3-hydroxyphosphoryloxy)-ethylamine (CGP 19835A,
referred to as
MTP-PE); and RIBI, which contains three components extracted from bacteria,
monophosphoryl lipid A, trehalose dimycolate and cell wall skeleton
(MPL+TDM+CWS) in
a 2% squalene/Tween 80 emulsion. The effectiveness of an adjuvant may be
determined by
measuring the amount of antibodies directed against the immunogen resulting
from
administration of the immunogen in vaccines which are also comprised of the
various
adjuvants. Such additional formulations and modes of administration as are
known in the art
may also be used.
tNOX as exemplified herein and/or epitopic fragments or peptides of sequences
derived therefrom or from other tNOX proteins having primary structure similar
(more than
90% identity) to the exemplified tNOX protein may be formulated into vaccines
as neutral or
salt forms. Pharmaceutically acceptable salts include but are not limited to
the acid addition
salts (formed with fret; amino Groups of the peptide) which are formed with
inorganic acids,
e.g., hydrochloric acid or phosphoric acids; and organic acids, e.g., acetic,
oxalic, tartaric, or
malefic acid. Salts formed with the free carboxyl groups may also be derived
from inorganic
bases, e.g., sodium, potassium, ammonium, calcium, or ferric hydroxides, and
organic bases,
e.g., isopropylamine, trimethylamine, 2-ethylamino-ethanol, histidine, and
procaine.
Multiantigenic peptides having amino acid sequences derived from the
exemplified
tNOX for use in immunogenic compositions are synthesized as described in
Briand et al.
[(1992) J. Immunol. Methods 156:255-265].
The immunogenic compositions or vaccines are administered in a manner
compatible
with the dosage formulation, and in such amount as will be prophylactically
and/or
27
CA 02388612 2002-05-O1
WO 01/32673 PCT/US00/30190
therapeutically effective. The quantity to be administered, which is generally
in the range of
about 100 to 1,000 ~g of protein per dose, more generally in the range of
about 5 to 500 ~g of
protein per dose, depends on the subject to be treated, the capacity of the
individual's immune
system to synthesize antibodies, and the degree of protection desired. Precise
amounts of the
active ingredient required to be administered may depend on the judgment of
the veterinarian,
physician or doctor of dental medicine and may be peculiar to each individual,
but such a
determination is within the skill of such a practitioner. Especially for
poultry, immunogenic
compositions can be administered orally via food or water preparations
comprising an
effective amount of the proteins) and/or peptide(s), and these immunogenic
compositions
may be formulated in liposomes as known to the art.
The vaccine or other immunogenic composition may be given in a single dose or
multiple dose schedule. A multiple dose schedule is one in which a primary
course of
vaccination may include 1 to 10 or more separate doses, followed by other
doses administered
at subsequent time intervals as required to maintain and or reinforce the
immune response,
e.g., at 1 to 4 months for a second dose, and if needed, a subsequent doses)
after several
months.
Antibodies specific for the plasma membrane tNOX and the shed forms in the
urine
and serum of cancer patients and animals with neoplastic disorders are useful,
for example, as
probes for screening DNA expression libraries or for detecting or diagnosing a
neoplastic
disorder in a sample from a human or animal. Desirably the antibodies (or
second antibodies
which are specific for the antibody which recognizes tNOX) are labeled by
joining, either
covalently or noncovalently, a substance which provides a detectable signal.
Suitable labels
include but are not limited to radionuclides, enzymes, substrates, cofactors,
inhibitors,
fluorescent agents, chemiluminescent agents, magnetic particles and the like.
United States
Patents describing the use of such labels include,but are not limited to,Nos.
3,817,837;
3,850,752; 3,939,350; 3,996,345; 4,277,437; 4,275,149; and 4,366,241.
Antibodies useful in
diagnostic and screening assays can be prepared using a peptide antigen whose
sequence is
derived from all or a part of SEQ ID N0:2, for example, SEQ ID N0:16, the full
length
protein or a protein corresponding to amino acids 220-610.
28
CA 02388612 2002-05-O1
WO 01/32673 PCT/US00/30190
All references cited herein are hereby incorporated by reference in their
entirety to the
extent that they are not inconsistent with the present disclosure.
Except as noted hereafter, standard techniques for peptide synthesis, cloning,
DNA
isolation, amplification and purification, for enzymatic reactions involving
DNA ligase, DNA
tNOX protein, restriction endonucleases and the like, and various separation
techniques are
those known and commonly employed by those skilled in the art. A number of
standard
techniques are described in Sambrook et al. (1989) Molecular Cloning, Second
Edition, Cold
Spring Harbor Laboratory, Plainview, New York; Maniatis et al. (1982)
Molecular Cloning,
Cold Spring Harbor Laboratory, Plainview, New York; Wu (ed.) (1993) Meth.
Enzymol. 218,
Part I; Wu (ed.) (1979) Meth Enzymol. 68; Wu et al. (eds.) (1983) Meth.
Enzymol. 100 and
101; Grossman and Moldave (eds.) Meth. Enzymol. 65; Miller (ed.) (1972)
Experiments in
Molecular Genetics, Cold spring Harbor Laboratory, Cold Spring Harbor, New
York, Old and
Primrose (1981) Principles of Gene Manipulation, University of California
Press, Berkeley;
Schleif and Wensink (1982) Practical Methods in Molecular Biology; Glover
(ed.) (1985)
DNA Cloning Vol. I and II, IRL Press, Oxford, UK; Hames and Higgins (eds.)
(1985) Nucleic
Acid Hybridization, IRL Press, Oxford, UK; Setlow and Hollaender (1979)
Genetic
Engineering: Principles and Methods, Vols. 1-4, Plenum Press, New York.
Abbreviations
and nomenclature, where employed, are deemed standard in the field and
commonly used in
professional journals such as those cited herein.
The foregoing discussion and the following examples illustrate but are not
intended to
limit the invention. The skilled artisan will understand that alternative
methods may be used
to implement the invention.
EXAMPLES
Example 1. Materials and Bacterial Cultures.
The antigen of the monoclonal antibody was isolated as previously described
[Chueh
et al. (1997)]. Peroxidase-conjugated goat anti-mouse IgG (Jackson
ImmunoResearch
Laboratories, West Grove, PA) was used to form an antigen-antibody-antibody-AP
color
complex. E coli strains XLl-blue and SOLR, a Uni-Zap XR HeLa cell cDNA
library, helper
29
CA 02388612 2002-05-O1
WO 01/32673 PCT/US00/30190
phage and expression vector pETI l were purchased from Stratagene (La Jolla,
Ca). Luria-
Bertani broth (LB broth) media and agar were supplied by DIFCO (Detroit, MI).
DNA
markers, restriction endonucleases and the plasmid DNA purification kit were
purchased
from Promega (Madison, WI). The mammalian expression system including
expression
vector pcDNA3.1 was purchased from Invitrogen (Carlsbad, CA). Unless indicated
otherwise, all chemicals were purchased from Sigma Chemical Co. (St. Louis,
MO).
The recA- E. coli host strain, XL1-blue, was first streaked on a 100 mm LB-
tetracycline (12.5 pg/ml) agar plate, followed by overnight incubation at
37°C. One isolated
colony was picked up by a sterile wire loop and then inoculated in LB-media at
37°C. The
plate was wrapped in Parafilm and placed in a 4°C refrigerator until
the next streaking.
Fifty ml of LB broth was supplemented with 0.2% (v/v) maltose and 10 mM MgS04
in a sterile flask. The cells were grown overnight with gentle shaking at
37°C. At day 2,
liquid culture was centrifuged in a sterile conical tube for 15 minutes at
4,000 rpm, followed
by removal of the media from the cell pellet. The pellet was resuspended
gently in 1 S ml of
10 mM MgS04 solution. Subsequently, cells were diluted to an OD6oo of 0.5 with
10 mM
MgS04 for later use. For every experiment, a new streak plate was used.
Example 2. Generation of Monoclonal Antibody
The antigen utilized for the generation of the monoclonal antibody was
isolated and
characterized from pooled sera of cancer patients (Chueh et al., 1997). The
fraction
containing a ca 34 kDa protein with capsaicin-inhibited tNOX activity was
concentrated with
a Centricon (Amicon, MA) followed by washing with PBS three times to remove
excess salts.
The monoclonal antibody and hybridomas were generated in the Monoclonal
Antibody
Facility of the Purdue Cancer Center following standard protocols (Schook,
1987). Two
BALB/c mice were immunized with tNOX protein mixed with complete Freund's
adjuvant
and boosted three times at 3-week intervals. Hybridomas were screened both by
enzymatic
activity assay and Western blot analysis. Antisera-generating clones with the
following
characteristics were selected: ability to block completely drug responsive NOX
activity of
cancer cells and sera of cancer patients, to immunoprecipitate the protein
with capsaicin-
CA 02388612 2002-05-O1
WO 01/32673 PCT/US00/30190
inhibited NADH oxidase activity from the surface of cancer cells and of sera
pooled from
cancer patients, having no effect on the NADH oxidase activity of sera from
healthy
volunteers and reactive with a 34 kDa cell surface protein of HeLa cells and
sera of cancer
patients.
Example 3. Isolation of the cDNA Clones.
The HeLa Uni-Zap cDNA library was first screened as described [Sambrook et al.
(1989) supra] at approximately 50,000 plaque-forming units per 150 mm plate
using
monoclonal ascites (1:100 dilution) and peroxidase-conjugated goat anti-mouse
IgG
(1:50,000 dilution). Five positive plaques were isolated from a total of about
8 x 105 total
plaques screened and the bacteriophages were purified to homogeneity 'ny at
least three
rounds of screening and selection. In vivo excision of the positive phage
clones with
ExAssist helper phage (M13) was then performed according to the protocol from
Stratagene
to convert the Uni-Zap plasmids to pBluescript phagemids. The circularized
phagemid DNAs
were extracted by utilizing Wizard Plus miniprep DNA purification kits
according to the
1 S manufacturer's recommendations (Promega, Madison, WI). Restriction enzyme
mapping
using ExoRI, XhoI, and BamHI showed that all five clones were identical in
origin. The
tNOX insert was sequenced using T3' and T7 primers. the complete nucleotide
sequence of
cDNA clone 1 was obtained using the gene walking technique and 10 17 by
synthetic primers
(DNA Sequencing Service, Tufts University, Boston, MA). Searches within the
NCBI/GenBank database were with nucleotide sequence and deduced amino acid
sequence
information for the longest open reading frame uncovered.
Example 4. DNA Agarose Electrophoresis.
A 1.2% agarose gel was prepared by adding 0.9 g of agarose into 75 ml of TBE
buffer
(10 .8 g Tris, S.5 g boric acid and 0.93 g NazEDTA.2Hz0 brought to 1 liter
with distilled
deionized water) and heated until all agarose was completely dissolved. TBE
buffer was
filtered before use. Ethidium bromide was added to the gel solution at a final
concentration
of 0.5 ~.g/ml solution before the gel solution was cast. Immediately, the
mixture was poured
onto the cast and a comb was placed in the proper position. The gel was cast
at least for 30
minutes before electrophoresis. The comb was removed and the gel was placed
into the
31
CA 02388612 2002-05-O1
WO 01/32673 PCT/US00/30190
electrophoresis system and TBE buffer was added until the gel was covered by
buffer.
Markers and DNA samples were mixed with loading buffer and pipetted into
separate wells.
The electrophoresis was performed at 90 V for approximately 1.5 hours.
Example 5. Sequencing Analysis and Restriction Mapping.
S Several restriction endonucleases (EcoRI, XhoI, BamHI, XbaI, KpnI and SaII)
were
utilized to determine restriction sites. The digestion was performed according
to the protocol
provided by Promega (Madison, WI). Eleven p1 of HzO, 2 p1 of l Ox reaction
buffer, 2 p1 of 1
~g/pl of BSA, 4 p1 of DNA and 1 p1 of the respective restriction endonuclease
were mixed by
pipetting into an eppendorf tube and centrifuging for several seconds. The
mixture was
incubated at the optimum temperature for three to four hours dependent on the
enzyme.
Subsequently, agarose electrophoresis was performed after each digestion. The
DNA
sequence was first analyzed by automated sequencing using T3 and T7 primers.
The
complete nucleotide sequence was determined on both DNA strands. The gene
walking was
performed by using 10 17-by synthetic primers. The nucleotide sequences of all
five clones
and the deduced amino-acid sequence of clone 1 were analyzed for homology
using BLAST
and Pedro program against GenBank.
Example 6. Expression of tNOX and histidine-tagged tNOX proteins in bacteria
tNOX cDNA from clone 1 was expressed in E. coli either as a truncated form
(ttNOX)
(beginning at M220), as a fusion protein with six histidine residues (ttNOX-
his) fused to the
amino terminus of ttNOX, or as a processed tNOX (beginning at G327). First,
the open
reading frame of ttNOX DNA and nucleotides of 3'-untranslated region were
amplified by
PCR, digested with NdeI and BamHI followed by ligation into the protein
expression vector
pET-1 1b. All primers were synthesized by the Laboratory for Macromolecular
Structure
(Purdue University, IN). Primers for PCR amplification of ttNOX were 5'--
GAGTGTAAACAGCATATGCTAGCCAGA-3' (forward, SEQ ID N0:6) and
5'TTTCTATGCTTGTCCAACACATAT-3' (reverse, SEQ ID N0:7). Primers for processed
form of tNOX were 5'-GGAGATATACATATGGGAATTCTCATTCAA-3' (forward, SEQ
ID N0:8) and 5'-TTTCTATGCTTGTCCAACACATAT-3' (reverse, SEQ ID N0:9).
Primers for histidine-tagged ttNOX were 5'-
32
CA 02388612 2002-05-O1
WO 01/32673 PCT/US00/30190
GATATACATATGCATCATCATCATCATCATCTAGCCAGAGAGGAGCGCCAT-3'
(forward, SEQ ID NO:10) and 5'-TTTCTATGCTTGTCCAACACATAT-3' (reverse, SEQ
ID NO:11 ). The forward primer was designed to incorporate six histidine
residues to the
amino terminus of tNOX protein. The amplification performed was with an
initiation step of
94C for 90 sec, followed by 90 sec o.f denaturation at 94C, 90 sec of
annealing at SSC, and 90
sec of extension at 72C for 29 cycles.
E. coli [8L21 (DE3)] were transfected and grown in LB medium containing
ampicillin (100 ~g/ml) for 16 hr at 25C and harvested. DNA sequences of the
ligation
products were confirmed by DNA sequencing. Expressions of all forms of tNOX
were
confirmed by SDS-PAGE with silver staining and immunoblotting. Immunoblot
analysis was
with anti-tNOX monoclonal antibody. Detection used alkaline phosphate
conjugated anti-
mouse antibody.
Example 7. Expression of ttNOX in COS cells
Transient transfection of COS cells were with pcDNA3.1 (Invitrogen) and a
Calcium
Phosphate Transfection Kit (Invitrogen, Carlsbad, CA) according to the
manufacturer's
protocol. ttNOX cDl~TA was first amplified by PCR using primers 5'-
TGGGAGTGTAAACAGCGTATG-3' (forward; SEQ ID N0:12) and 5'-
TTTCTATGCTTGTCCAACACATAT-3' (reverse, SEQ ID N0:13). The PCR product was
then amplified using primers 5'-AAACTTAAGCTTTGGGAGTGT-3' (forward, SEQ ID
N0:14) and 5'-TTTCTATGCTTGTCCAACACATAT-3' (reverse, SEQ ID NO:15) to
construct a HindIII site at 5'end of the nontemplate strand. The product was
double digested
using HindIII and BamHI enzymes. The digested products were separated on an
agarose gel
and extracted using a DNA Extraction Kit (Qiagen, Valencia, CA). The DNA was
then
ligated into a pcDNA3.1 vector that contains a cytomegalovirus enhancer-
promoter for high
levels of expression. For propagation of the plasmid DNA, the ligation product
was used to
transform XL-1 blue competent cells using heat pulse technique (Sambrook et
al., 1989,
supra). The positive clones were identified by PCR. The resulting plasmid was
then used to
transfect COS cells.
33
CA 02388612 2002-05-O1
WO 01/32673 PCT/US00/30190
COS-1 cells (African monkey kidney cell line), were plated one day prior to
transfection at 4 x 105 cells per 100-mm dish. Thirty-six ~l of 2 M CaCl2 and
30 ~g of
pcDNA3.1 or pcDNA3.1-tNOX in 300 ~l sterile H20 were slowly added dropwise
into 300
p1 of 2 X Hepes Buffered Saline (HBS) at room temperature for 30 min. The
transfection
mixtures then were added dropwise to the media to the cells and incubated
overnight at 37C.
After overnight exposure to the DNA precipitate, the cells were washed twice
with PBS and 3
ml of DMSO were added for 2.5 min. The DMSO then was removed and cells were
fed with
fresh media for 2-3 days. tNOX expression was evaluated on the basis of
enzymatic activity
and Western blot analysis. For selection of stable transfectants, antibiotic
6418 sulfate was
used (Invitrogen, Carlsbad, CA). After the COS cells were transfected with the
tNOX cDNA
expression plasmid, 0.5mg/ml of 6418 sulfate was added into the media twice a
week and the
cultures were maintained until colonies 2 to 3 mm in diameter were formed. A
total of three
colonies were selected and trypsinized individually and then transferred into
wells of a 24-
well plate and then into a 35 mm petri dish. Cells were harvested at 80%
confluency.
Transfections were confirmed by immunoblotting.
Example 8. N-terminal amino acid sequencing of expressed tNOX
For partial amino acid sequencing, recombinant tNOX protein from the
recombinant
E. coli extract were precipitated with 20% ammonium sulfate, electrophoresed
on 12% SDS-
PAGE and transferred to poly(vinylidene difluoride) membranes. Proteins were
stained with
Coomassie blue, and protein bands were excised and then sequenced by automated
Edman
degradation (Applied Biosystems, Procise 492) by the Laboratory for
Macromolecular
Structure, Purdue University.
Example 9. Generation of peptide antisera
Peptide antisera to the tNOX terminus containing the putative adenine binding
site
KQEMTGVGASLEKRW (SEQ ID N0:16) were generated in rabbits using standard
technology by Covance Research Products Inc. (Dever, PA). The antisera were
diluted 1:300
before use.
Example 10. Generation of polyclonal antisera
34
CA 02388612 2002-05-O1
WO 01/32673 PCT/US00/30190
The recombinant truncated tNOX from the recombinant E. coli extract was
precipitated with 20% ammonium sulfate and the solubilize proteins were
resolved on a 12
SDS-PAGE and stained with Coomassie blue. The tNOX protein bands were excised
and
chopped into fine pieces. The protein then was mixed with 0.5 ml complete
Freund's
adjuvant and injected into two rabbits. Three boosts of antigen in incomplete
Freund's
adjuvant were given in three weeks interval. The antisera were diluted 1: 300
before use.
Example 11. RNA Isolation and Northern Analyses.
Total RNA was prepared from HeLa (or other cells) using the guanidinium method
described by Ausubel et al. (1992), Current Protocols in Molecular Biology,
Wiley
Interscience, New York, NY. Denatured RNA was transferred to nitrocellulose
membranes
for hybridization and autoradiography essentially as described in Sambrook et
al. [(1989)
supra].
mRNA is isolated from biological samples, biopsy material, tumor tissue or the
like
and resolved using gel electrophoresis. Suitable conditions include 1.2%
agarose and 2.2
moles/liter formaldehyde. mRNA sizes are estimated by comparison to marker
molecules,
such as the 0.28 to 6.58 kb markers available commercially, for example, from
Promega,
Madison, WLLanes containing marker molecules are stained with ethidium bromide
and
photographed with UV illumination. Transfer of RNA molecules from the gel to
nitrocellulose filters is accomplished as described by Maniatis et al. (1982)
supra. Blots are
prehybridized at 42C for 2 h with 50% formamide, 5 x SSPE, 2 x Denhardt's
solution, and
0.1 % sodium dodecyl sulfate (SDS). Denatured radiolabeled or other labeled
probe nucleic
acid is added directly to the prehybridization fluid and the incubation is
continuous for an
additional 16-24 h. The blots are then washed for 20 min at room temperature
in 1 x SSC,
0.1% SDS, followed by three washes of 20 min each at 68C in 0.2 X SSC, 0.1%
SDS. The
labeled probe is then visualized according to the label used. Where the label
is radioactive,
autoradiography can be used.
Samples for use in nucleic acid-based diagnostic methods include 15-25 ml
peripheral
blood specimens For biopsy or other tumor tissue specimens, the tissue or
biopsy sample is
CA 02388612 2002-05-O1
WO 01/32673 PCT/US00/30190
frozen in liquid nitrogen immediately after collection. Ground tissue or cells
from blood are
dissolved in guanidinium thiocyanate, left for 15 min at SOC and then
centrifuged at 3000
rpm at 5 min. The supernatant is layered aver cesium chloride and centrifuged.
The RNA
pellet is dissolved in diethylpyrocarbonate. About 2 mg RNA are used for cDNA
synthesis
using commercially available reagents according to the supplier's instructions
(e.g.,
Promega). PCR can be carried out using commercially available reagents and
primers
specific for the tNOX mRNA. The integrity of RNA samples is confirmed using an
irrelevant gene product, for Example glyceraldehyde phosphate 3 dehydrogenase,
the
sequence of which is well known.
Example 12. Mutagenic oligonucleotides and site-directed mutagenesis
Eight sets of oligonucleotides were designed to replace amino acid residues
potentially involved in tNOX activity by site-directed mutagenesis according
to Braman et al.
(1996). Cysteine codons corresponding to C505, C510, C558, C569, C575, and
C602, were
replaced by alanine codons. The coding sequence was independently modified to
replace a
methionine of the putative drug binding site with an alanine (M396A). The tNOX
coding
sequence was independently modified to replace a glycine in the potential
adenine binding
site with a valine (G592V). Oligonucleotides were as follows: CSOSA: S'-
GAAAAGGAAAGCGCCGCTTCTAGGCTGTGTGCC-3' (forward, SEQ ID N0:17), 5'-
GGCACACAGTCCCTAGAAGCGGCGCTTTCCTTTTC-3' (reverse, SEQ ID N0:18);
CS 10A: 5'-GCTTCTAGGCTGGCCGCCTCAAACCAGGATAGCG-3' (forward, SEQ ID
N0:19), 5'-CGCTATCCTGGTTTGAGGCGGCCAGCCTAGAAGC-3' (reverse, SEQ ID
N0:20); C558A: 5'-GCAAGCATTGAATACATCGCTTCCTACTTGCACCGTCTTG-3'
(forward, SEQ ID N0:21), 5'-
CAAGACGGTGCAAGTAGGAAGCGATGTATTCAATGCTTGC-3' (reverse, SEQ ID
N0:22); C569A: 5'-CGTCTTGATAATAAGATCGCCACCAGCGATGTGGAGTG -3'
(forward, SEQ ID N0:23), 5'-
CACTCCACATCGCTGGTGGCGATCTTATTATCAAGACG -3' (reverse, SEQ ID
N0:24); C575A: 5'-CCAGCGATGTGGAGGCCCTCATGGGTAGAC:TCC-3' (forward,
SEQ ID N0:25), 5'-GGAGTCTACCCATGAGGGCCTCCACATCGCTGG-3' (reverse,
SEQ ID N0:26); C602A: 5'-
36
CA 02388612 2002-05-O1
WO 01/32673 PCT/US00/30190
GAAAAGAAGATGGAAATTCGCTGGCTTCGAGGGCTTGAAG-3' (forward, SEQ ID
N0:27), 5'-CTTCAAGCCCTCGAAGCCAGCGAATTTCCATCTCTTTTC-3'(reverse, SEQ
ID N0:28); M396A: 5'-
GTCTGATGATGAAATAGAAGAAGCGACAGAAACAAAAGAAACTGAGG-3'
(forward, SEQ ID N0:29), 5'-
CCTCAGTTTCTTTTGTTTCTGTCGCTTCTTCTATTTCATCATCAGAC-3' (reverse,
SEQ ID N0:30); G592V: 5'-
CAGGAAATGACTGGAGTTGTGGCCAGCCTGGAAAAGAG-3' (forward, SEQ ID
N0:31 ), 5'-CTCTTTTCCAGGCTGGCCACAACTCCAGTCATTTCCTG-3' (reverse, SEQ
ID N0:32).
For the site-directed mutagenesis, the high fidelity thermostable Pfu DNA
polymerase, low cycle number, and primers designed only to copy the parental
strand in a
linear fashion were used to minimize unwanted second site mutations. Double-
stranded,
super-coiled expression plasmid pETI ItNOX (40 ng) and mutagenic sense and
antisense
primers (100 ng) were employed in a 50-~1 reaction mixture containing
deoxyribonucleotides,
buffer, and Pfu DNA polymerase according to the manufacturer's protocol
(Stratagene, La
Jolla, CA). The cycling parameters were 95C for 30 sec, SSC for 1 min, and 68C
for 12.8
min for a total of 16 cycles. The linear amplification product was treated
with endonuclease
DpnI (10 units/~l) for 1 h to eliminate the parental template. Subsequently,
an aliquot of 4 ~l
of this reaction mixture containing the double-nicked mutated plasmid was used
for the
transformation of supercompetent E. coli XL-1 Blue cells (Stratagene). All
mutants were
analyzed by DNA sequencing to confirm that the correct replacements were
achieved
37
CA 02388612 2002-05-O1
WO 01/32673 PCT/US00/30190
References
Bird, C. (1999) Direct submission of human DNA sequence from clone 875H3 (part
of APK1
antigen), GenBank Accession no. AL049733.
Braman et al. (1996) Meth. Mol. Biol. 57, 31-44.
Bridge et al. (2000) Biochim. Biophys. Acta 1463, 448-458.
Bruno, M. et al. (1992) Biochem J. 24:625-628.
Chang, K. and Pastan, I. (1994) Int. J. Cancer 57:90-97.
Chang, J. (2000) Biochem. Pharmacol. 59, 211-219.
Chang, K. and Pastan. I. ( 1994) Int. J. Cancer 57, 90-97.
i0 Chang, K. and Pastan, I. (1996) Proc. Natl. Acad. Sci. USA 93, 136-140.
Chang et al. (1992) Cancer Res. 52, 181-186.
Chueh, P.J. et al. (1997) Arch. Biochem. Biophys. 342, 38-47
Dai, S. et al. (1997) Mol. Cell. Biochem. 166:101-109
DeHahn et al. (1997) Biochim. Biophys. Acta 1328, 99-108.
del Castillo-Olivares et al. (1998) Arch. Biochem. Biophys. 358, 125-140.
Duke, S. O. (1990) Environ. Health Perspectives 87, 263.
Freedman, R. B. (1989) Cell 57, 1069-1072.
Gilberger et al. (1997) J. Biol. Chem. 272, 29584-29589.
Gilberger et al. (1998) FEBS Lett. 425, 407-410.
Grabau, C. and Cronan, J. E. (1986) Nucleic Acids Res. 14, 5449.
Hanahan and Meselson (1980) Using Antibodies in Immunolo~ical Screening,
Kim et al. (1997) Biochim. Biophys. Acta 1324, 171-181.
Kishi et al. (1999) Biochim. Biophys. Acta 1412, 66-77.
Kliman, R. M. and Hey, J. (1993) Genetics 133, 375-387.
Kozak, M. (1987) Nucleic Acids Res. 15, 8125-8148.
Kyte, J. and Doolittle, R. F. (1982) J. Mol. Biol. 157, 105-132 .
Leblanc et al. (1995) J. Mol. Biol. 250, 484-495.
MacBeth et al. (2000) Science 289, 938-941.
Morre, D.J. and Brightman, A.O. (1991) J. Bioenerg. and Biomem. 23:469-489
Morre, D.J. et al.(1995a) Biochim. Biophys. Acta 1236:237-243
38
CA 02388612 2002-05-O1
WO 01/32673 PCT/US00/30190
Morre, D.J. et al. (1995b) Biochim. Biophys. Acta 1240:11-17
Morre, D.J. et al. (1995c) Proc. Natl. Acad. Sci. USA 92:1831-1835
Morre, D. J. (1995) Biochim. Biophys. Acta 1240, 201-208.
Morre, D. J. (1998) in Plasma Membrane Redox Systems and their role in
Biological Stress
and Disease. NADH oxidase: A multifunctional ectoprotein of the eukarotic cell
surface.
(Asard, E., Berczi, A., and Caubergs, R. J., eds.) Kluwer Academic Publishers,
Dordrecht, pp.
121-156.
Morre, D. J. ( 1998b) Mol. Cell. Biochem. 187, 41-46.
Morre, D. J., and Morre, D. M. (1995) J. Bioenerg. Biomembr. 27, 137-144.
Morre, D. J., and Reust, T. (1997) J. Bioenerg. Biomembr. 29, 281-289.
Morre et al. (1995b) Protoplasma 184, 203-208.
Morre et al. (1996a) Biochim. Biophys. Acta 1280, 197-206.
Morre et al. (1997a) Arch. Biochem. Biophys. 342, 224-230.
Morre et al. (1997b) J. Bioenerg. Biomemb. 29, 269-280.
Morre et al. (1997c) Biochim. Biophys. Acta 1325, 117-125.
Morre et al. (1998) J. Bioenerg. Biomemb. 30, 477-487.
Morre et al. (1998a) Biochim. Biophys. Acta 1369, 185-192.
Morre et al. (1999) Mol. Cell. Biochem. 200, 7-13.
Morre et al. (2000) Biochem. Pharmacol. 60, 937-946.
Ohnishi et al. (1995) J. Biol. Chem. 270, 5812-5817.
Pogue et al. (2000) Biochim. Biophys. Acta 14662, 1-8.
Russet, M. and Model, P. (1988) J. Biol. Chem. 263, 9015-9019.
Schook, L. B. (1987) Immunology Series, Vol. 3, pp99-101. Marcel Dekker. Inc.
Sharrosh, B. S., and Dixon, R. A. (1991) Proc. Natl. Acad Sci. USA 88, 10941-
10945.
Shining et al. (1996) Eur. J. Biochem. 237, 433-439.
Sugano et al. (2000) Direct submission of cDNA sequence to GenBank database.
(Accession
no. AK000353)
Sun et al. (2000) Biochim. Biophys. Acta 14665, 1-12.
Wang et al. (1998) FASEB J. 12, A519.
Wilkinson et al. (1996) Arch. Biochem. Biophys. 336, 275-282.
Yano et al. (1997) J. Biol. Chem. 272, 4201-4211
39
CA 02388612 2002-05-O1
WO 01/32673 PCT/US00/30190
Table 1. Nucleotide and deduced amino acid sequences of the tNOX-cDNA. The
first
translation indicated is at nucleotides 23-2S (ATG) with termination at 18SS-
1857 (TAA).
Putative signal peptides are underlined and the signal peptide cleavage site
are indicated by
arrows. The putative quinone binding sequence, E394EMTE, is indicated by long
dash-dot
S dot line. The copper binding site HS46VH and down stream H467 are shown by
asterisks.
The possible adenine (NADH) binding sequence, TS89GVGASL, is indicated by a
dashed
line.
1
GTTCACAGTTGAGGACCACACAATGCAAAGAGATTTTAGATGGCTGTGGGTCTACGAAATAGGCTATGCAGCCGA
1O TAACAGTAGAACTCTG
1 M Q R D F R W L W V Y E I G Y A A D N S R T L
92
AACGTGGATTCCACTGCAATGACACTACCTATGTCTGATCCAACTGCATGGGCCACAGCAATGAATAATCTTGGA
ATGGCACCGCTGGGA
IS 24 N V D S T A M T L P M S D P T A W A T A M N N L G M A P L G
182
ATTGCCGGACAACCAATTTTACCTGACTTTGATCCTGCTCTTGGAATGATGACTGGAATTCCACCAATAACTCCA
ATGATGCCTGGTTTG
54 I A G Q P I L P D F D P A L G M M T G I P P I T P M M P G L
20 272
GGAATAGTACCTCCACCAATTCCTCCAGATATGCCAGTAGTAAAAGAGATCATACACTGTAAAAGCTGCACGCTC
TTCCCTCCAAATCCA
84 G I V P P P I P P D M P V V K E I I H C K S C T L F P P N P
362
2S AATCTCCCACCTCCTGCAACCCGAGAAAGACCACCAGGATGCAAAACAGTATTTGTGGGTGGTCTGCCTGAAAAT
GGGACAGAGCAAATC
114 N L P P P A T R E R P P G C K T V F V G G L P E N G T E Q I
452
ATTGTGGAAGTTTTCGAGCAGTGTGGAGAGATCATTGCCATTCGCAAGAGCAAGAAGAACTTCTGCCACATTCGC
3O TTTGCTGAGGAGTAC
144 I V E V F E Q C G E I I A I R K S K K N F C H I R F A E E Y
542
ATGGTGGACAAAGCCCTGTATCTGTCTGGTTACCGCATTCGCCTGGGCTCTAGTACTGACAAGAAGGACACAGGC
AGACTCCACGTTGAT
3S 174 M V D K A L Y L S G Y R I R L G S S T D K K D T G R L H V D
632
TTCGCACAGGCTCGAGATGACCTGTATGAGTGGGAGTGTAAACAGCGTATGCTAGCCAGAGAGGAGCGCCATCGT
AGAAGAA'rGGAAGAA
CA 02388612 2002-05-O1
WO 01/32673 PCT/US00/30190
204 F A Q A R D D L Y E W E C K Q R M L A R E E R H R R R M E E
722
GAAAGATTGCGTCCACCATCTCCACCCCCAGTGGTCCACTATTCAGATCATGAATGCAGCATTGTTGCTGAAAAA
TTAAAAGATGATTCC
S 234 E R L R P P S P P P V V H Y S D H E C S I V A E K L K D D S
812
AAATTCTCAGAAGCTGTACAGACCTTGCTTACCTGGATAGAGCGAGGAGAGGTCAACCGTCGTAGCGCCAATAAC
TTCTACTCCATGATC
264 K F S E A V Q T L L T W I E R G E V N R R S A N N F Y S M I
1~ 902
CAGTCGGCCAACAGCCATGTCCGCCGCCTGGTGAACGAGAAAGCTGCCCATGAGAAAGATATGGAAGAAGCAAAG
GAGAAGTTCAAGCAG
294 Q S A N S H V R R L V N E K A A H E K D M E E A K E K F K Q
992
IS GCCCTTTCTGGAATTCTCATTCAATTTGAGCAGATAGTGGCTGTGTACCATTCCGCCTCCAAGCAGAAGGCATGG
GACCACTTCACAAAA
324 A L S G I L I Q F E Q I V A V Y H S A S K Q K A W D H F T K
1082
GCCCAGCGGAAGAACATCAGCGTGTGGTGCAAACAAGCTGAGGAAATTCGCAACATTCATAATGATGAATTAATG
ZO GGAATCAGGCGAGAA
354 A Q R K N I S V W C K Q A E E I R N I H N D E L M G I R R E
1172
GAAGAAATGGAAATGTCTGATGATGAAATAGAAGAAATGACAGAAACAAAAGAAACTGAGGAATCAGCCTTAGTA
TCACAGGCAGAAGCT
ZS 384 E E M E M S D D E I E E M T E T K E T E E S A L V S Q A E A
1262
CTGAAGGAAGAAAATGACAGCCTCCGTTGGCAGCTCGATGCCTACCGGAATGAAGTAGAACTGCTCAAGCAAGAA
CAAGGCAAAGTCCAC
414 L K E E N D S L R W Q L D A Y R N E V E L L K Q E Q G K V H
30 1352
AGAGAAGATGACCCTAACAAAGAACAGCAGCTGAAACTCCTGCAACAAGCCCTGCAAGGAATGCAACAGCATCTA
CTCAAAGTCCAAGAG
444 R E D D P N K E Q Q L K L L Q Q A L Q G M Q Q H L L K V Q E
1442
3S GAATACAAAAAGAAAGAAGCTGAACTTGAAAAACTCAAAGATGACAAGTTACAGGTGGAAAAAATGTTGGAAAAT
CTTAAAGAAAAGGAA
474 E Y K K K E A E L E K L K D D K L Q V E K M L E N L K E K E
1532
AGCTGTGCTTCTAGGCTGTGTGCCTCAAACCAGGATAGCGAATACCCTCTTGAGAAGACCATGAACAGCAGTCCT
4O ATCAAATCTGAACGT
504 S C A S R L C A S N Q D S E Y P L E K T M N S S P I K S E R
41
CA 02388612 2002-05-O1
WO 01/32673 PCT/US00/30190
1622
GAAGCACTGCTAGTGGGGATTATCTCCACATTCCTTCATGTTCACCCATTTGGAGCAAGCATTGAATACATCTGT
TCCTACTTGCACCGT
534 E A L L V G I I S T F L H* V* H* P F G A S I E Y I C S Y L H R
S 1712
CTTGATAATAAGATCTGCACCAGCGATGTGGAGTGTCTCATGGGTAGACTCCAGCATACCTTCAAGCAGGAAATG
ACTGGAGTTGGAGCC
564 L D N K I C T S D V E C L M G R L Q H T F K Q E M T G V G A
1802
IO AGCCTGGAAAAGAGATGGAAATTCTGTGGCTTCGAGGGCTTGAAGCTGACCTAAATCTCTTTGCCTAACAACTTG
GGATCCTGAAGATAA
594 S L E K R W K F C G F E G L K L T Stop
1892
ATATGTGTTGGACAAGCATAGAAAGTGATTTATATTTTTAATGGTTTTCAAGTGGAAGTTCCTTTGAATTTGTCA
1S GTTCATTCCTGGAAA
1982
ATCTTTTGAGTTAAAATAAGGATCCTAGGACAGCACCTCGAACTACAGGCCCTAAAGAGAAATTGCCTCAAACCA
CAAGTGCTGTAACTT
2072
2O CCTCCCCTTTCTGTCAATTGGTTGTCTTTAAATATTGCAAAAGTCCTGATGCTAAACAGTATTTGGAGTGTTTTC
AGTGTCTGTACTACT
2162
GTTGTACACCTTGGTATTTTTTTAAACACTGTTAACTGAAATGTTTTGATGATTTTATGTGATTTGTGTTTCTAA
ACTTCTCTTTACATT
2S 2252
AATGTTGTTACTGGTGAAAGGCATGAGAGCAGCACTAAGTCCTCTGTGTAACTGCCATTGTCTTTCCAATCCCCA
GTAGACCAGTAAATA
2342
AATAACACATCAGTGTCTTCTAGAAGGTGCCTGACCAGGTTCACCTTTTAAACGACAAAGCATGGTTTGTGGCTT
3O TTTGCAAAATTACTA
2432
TGAACCAAAAGTTGACAAATGTTCCAAAGTTATTTTCTCTAACATATCACATTAAAGATCTGTTTCAGAATTGTA
AAAAGTACATCTAGA
2522
3S TGTGTTTACAGAAAGCAAGTATCCAGTATGACTGGCATGTGTTCATGCTATTCAGAATCACTTGTAAATAGTCTG
CTTTTAAAGGAGGGC
2612
ATGTTCAGTTTTCTGTGAATTAAAATATGCTCATGTGTGGGCACACACGCACAAACACACACACGCACGCACACA
GTGGCAGAAGGGATT
4O 2702
TATATTAATATTCTTTCCCCTCTGGCCTTCTTACAGTCTGTTGGTCCCTTTGCTTCTGTTGTCAGTGTGTTGAAT
TGCAAACCGAGTACT
42
CA 02388612 2002-05-O1
WO 01/32673 PCT/US00/30190
2792
GCTGTAAATACTATGTTTACTTCATGCTGAATGTTTGCAAAGACTTGATATAAGTATTAATAGTAATGAATCAAT
GAATAAATAATGAGC
2882
S TAGGGTTTGTGAGGCTTTCTACAAATAGGTCAGCTCCACCTGGAGTGCGAATTGCCAGAGACACCTTGGTAGTGC
CCATCGGCAAATCGC
2972
AATGGCAGCATGTGAGTGGACCATTCAGAAACTTCTGCTTGGTGGAAAGTAAACAGAGAGGATGGAGGTTTGGGG
CGAATGTCCTGAGGC
3062
AGAGATGGTCTTTATTGTGTGTGGTGGTGGTTGTGGTATTTATAATAATGCAAGCATACCCTCCCTTGAGTCTCA
ATTGAAGATAAAAGA
3152
ATGTACTGAGCAAGCAAAGCCAATGGAGAGTATTTCACAAAAATACTTTGTAAATGAGATGCCAGTAGTGTTCAA
IS AGTTGTATTTTTAAA
3242
AGATAAATATTCCTTTTTATACCTCAGTTTTGTGTCCTGTTTTTTAATGACTTACGCTCTAAGTAATCCATTAGT
AGTTATCTCAGTCCC
3332
ZO TCCCTTTGGGTTACTAGAATGTTGGAAAAAGATGCCAAGTCTGTCTTGACAACTGGAAACAGGGTTCCACAGCAG
CCCATTCGTGCTGAA
3422
AACTGGCTTCCCCCCTGAAGCACCCTGCTGTGGCACCAGCAGGAAGCTCAGGTTAATTTTACACTAGCTTGCTCA
CTGATGCATCTCTCA
2S 3512
TCAATGCTACGGAAGGCTTTGATTCATCAGTCTCGGGCTCTTGGAATACCTAATTTTAATAATATCTATGAAATC
AAGGGAAACTTTCCA
3602
TTTACAGTTATTTCTTGTTTAAATAAACTAAATTAATTTTTAGGGGAGAGCAGTAGGAAAAAGAGCTAATGCATG
3O CGGGGTTTAATACCT
3692
AGGTGATGGGTTGAGGTGCAGCAAAACCACCATGGCACACGTTCACCTATGTAACAAACCTGCACATCCTGCACA
TGTACCCCGGAACTT
3782 ACTTAAAA
43
CA 02388612 2002-05-O1
WO 01/32673 PCT/US00/30190
Table 2. Comparison of amino acid sequences within the known quinone and
sulfonylurea
binding sites of several proteins.
PROTEIN SEQUENCE
QB-protein+ S A M H G
L/M-subunit+ L A M H G
Acetolactate synthetase (Tobacco)+*L G M H G
Pyruvate oxidase+ A T M H W
Preliminary consensus X A M H G
D,-Synechococcus E T M R F
NADH (ubiquinone) dehydrogenase G E M R E
Bovine serum albumin E T M R E
Human serum albumin A T L R E
Acetolactate synthetase (Brassica)E D L R E
1
Binds quinone
* Binds sulfonylurea
44
CA 02388612 2002-05-O1
WO 01/32673 PCT/US00/30190
Table 3. Effect of site-directed mutagenesis of ttNOX on NADH oxidase enzyme
activity,
period length and inhibition by capsaicin.
Mutation+ Enzymatic activityPeriod lengthComplete inhibition by 1
~M capsaicin
None + 23 min +
S CSOSA -
CS 10A + 39 min +
C558A +~ 39 min +
C569A
C575A + 36 min +
C602A + 36 min +
M396A + 23 min -
G502A
+Resequencing confirmed the expected DNA sequences for each of the indicated
amino acid
replacements.
CA 02388612 2002-05-O1
WO 01/32673 PCT/US00/30190
Table 4. Response of COS cells stably transfected with tNOX cDNA to targeted
drugs.
Drug ECso
Nontransfected tNOX
Capsaicin 13 1.3
GCg 10 0.1
driamycin 0.3 0.04
Y181984 (active) 20 3
Y 1819845 (inactivel > 100 > 100
ethotrexate 1 1
Capsaicin, 8-methyl-N vanillyl-6-noneamide
EGCg, epigallocatechin gallate
LY181984, N (4-methylphenylsulfonyl-N')-4-chlorophenylurea
LY181985, N (4-methylphenylsulfonyl-N')-4-phenylurea
46
CA 02388612 2002-05-O1
WO 01/32673 PCT/US00/30190
SEQUENCE LISTING
<110> Purdue Research Foundation
<120> Sequences Encoding Human Neoplastic Marker
<130> 85-99 WO
<140> unassigned
<141> 2000-11-O1
<150> US 60/162,644
<151> 1999-11-O1
<160> 32
<170> PatentIn Ver. 2.0
<210> 1
<211> 3789
<212> DNA
<213> Homo Sapiens
<220>
<221> CDS
<222> (23)..(1852)
<400> 1
gttcacagtt gaggaccaca ca atg caa aga gat ttt aga tgg ctg tgg gtc 52
Met Gln Arg Asp Phe Arg Trp Leu Trp Val
1 5 10
tac gaa ata ggc tat gca gcc gat aac agt aga act ctg aac gtg gat 100
Tyr Glu Ile Gly Tyr Ala Ala Asp Asn Ser Arg Thr Leu Asn Val Asp
15 20 25
tcc act gca atg aca cta cct atg tct gat cca act gca tgg gcc aca 148
Ser Thr Ala Met Thr Leu Pro Met Ser Asp Pro Thr Ala Trp Ala Thr
30 35 40
gca atg aat aat ctt gga atg gca ccg ctg gga att gcc gga caa cca 196
Ala Met Asn Asn Leu Gly Met Ala Pro Leu Gly Ile Ala Gly Gln Pro
45 50 55
att tta cet gac ttt gat cct get ctt gga atg atg act gga att cca 244
Ile Leu Pro Asp Phe Asp Pro Ala Leu Gly Met Met Thr Gly Ile Pro
60 65 70
cca ata act cca atg atg cct ggt ttg gga ata gta cct cca cca att 292
Pro Ile Thr Pro Met Met Pro Gly Leu Gly Ile Val Pro Pro Pro Ile
75 80 85 90
1
CA 02388612 2002-05-O1
WO 01/32673 PCT/US00/30190
cct cca gat atg cca gta gta aaa gag atc ata cac tgt aaa agc tgc 340
Pro Pro Asp Met Pro Val Val Lys Glu Ile Ile His Cys Lys Ser Cys
95 100 105
acg ctc ttc cct cca aat cca aat ctc cca cct cct gca acc cga gaa 388
Thr Leu Phe Pro Pro Asn Pro Asn Leu Pro Pro Pro Ala Thr Arg Glu
:L10 115 120
aga cca cca gga tgc aaa aca gta ttt gtg ggt ggt ctg cct gaa aat 436
Arg Pro Pro Gly Cys Lys Thr Val Phe Val Gly Gly Leu Pro Glu Asn
125 130 135
ggg aca gag caa atc att gtg gaa gtt ttc gag cag tgt gga gag atc 484
Gly Thr Glu Gln Ile Ile Val Glu Val Phe Glu Gln Cys Gly Glu Ile
140 145 150
att gcc att cgc aag agc aag aag aac ttc tgc cac att cgc ttt get 532
Ile Ala Ile Arg Lys Ser Lys Lys Asn Phe Cys His Ile Arg Phe Ala
155 160 165 170
gag gag tac atg gtg gac aaa gcc ctg tat ctg tct ggt tac cgc att 580
Glu Glu Tyr Met Val Asp Lys Ala Leu Tyr Leu Ser Gly Tyr Arg Ile
175 180 185
cgc ctg ggc tct agt act gac aag aag gac aca ggc aga ctc cac gtt 628
Arg Leu Gly Ser Ser Thr Asp Lys Lys Asp Thr Gly Arg Leu His Val
190 195 200
gat ttc gca cag get cga gat gac ctg tat gag tgg gag tgt aaa cag 676
Asp Phe Ala Gln Ala Arg Asp Asp Leu Tyr Glu Trp Glu Cys Lys Gln
205 210 215
cgt atg cta gcc aga gag gag cgc cat cgt aga aga atg gaa gaa gaa 724
Arg Met Leu Ala Arg Glu Glu Arg His Arg Arg Arg Met Glu Glu Glu
220 225 230
aga ttg cgt cca cca tct cca ccc cca gtg gtc cac tat tca gat cat 772
Arg Leu Arg Pro Pro Ser Pro Pro Pro Val Val His Tyr Ser Asp His
235 240 245 250
gaa tgc agc att gtt get gaa aaa tta aaa gat gat tcc aaa ttc tca 820
Glu Cys Ser Ile Val Ala Glu Lys Leu Lys Asp Asp Ser Lys Phe Ser
255 260 265
gaa get gta cag ace ttg ctt acc tgg ata gag cga gga gag gtc aac 868
Glu Ala Val Gln Thr Leu Leu Thr Trp Ile Glu Arg Gly Glu Val Asn
270 275 280
cgt cgt agc gcc aat aac ttc tac tcc atg atc cag tcg gcc aac agc 916
Arg Arg Ser Ala Asn Asn Phe Tyr Ser Met Ile Gln Ser Ala Asn Ser
285 290 295
cat gte cgc egc ctg gtg aac gag aaa get gcc cat gag aaa gat atg 964
His Val Arg Arg Leu Val Asn Glu Lys Ala Ala His Glu Lys Asp Met
300 305 310
2
CA 02388612 2002-05-O1
WO 01/32673 PCT/US00/30190
gaa gaa gca aag gag aag ttc aag cag gcc ctt tct gga att ctc att 1012
Glu Glu Ala Lys Glu Lys Phe Lys Gln Ala Leu Ser Gly Ile Leu Ile
315 320 325 330
caa ttt gag cag ata gtg get gtg tac cat tcc gcc tcc aag cag aag 1060
Gln Phe Glu Gln Ile Val Ala Val Tyr His Ser Ala Ser Lys Gln Lys
335 340 345
gca tgg gac cac ttc aca aaa gcc cag cgg aag aac atc agc gtg tgg 1108
Ala Trp Asp His Phe Thr Lys Ala Gln Arg Lys Asn Ile Ser Val Trp
350 355 360
tgc aaa caa get gag gaa att cgc aac att cat aat gat gaa tta atg 1156
Cys Lys Gln Ala Glu Glu Ile Arg Asn Ile His Asn Asp Glu Leu Met
365 370 375
gga atc agg cga gaa gaa gaa atg gaa atg tct gat gat gaa ata gaa 1204
Gly Ile Arg Arg Glu Glu Glu Met Glu Met Ser Asp Asp Glu Ile Glu
380 385 390
gaa atg aca gaa aca aaa gaa act gag gaa tca gcc tta gta tca cag 1252
Glu Met Thr Glu Thr Lys Glu Thr Glu Glu Ser Ala Leu Val Ser Gln
395 400 405 410
gca gaa get ctg aag gaa gaa aat gac agc ctc cgt tgg cag ctc gat 1300
Ala Glu Ala Leu Lys Glu Glu Asn Asp Ser Leu Arg Trp Gln Leu Asp
415 420 425
gcc tac cgg aat gaa gta gaa ctg ctc aag caa gaa caa ggc aaa gtc 1348
Ala Tyr Arg Asn Glu Val Glu Leu Leu Lys Gln Glu Gln Gly Lys Val
430 435 440
cac aga gaa gat gac cct aac aaa gaa cag cag ctg a.aa ctc ctg caa 1396
His Arg Glu Asp Asp Pro Asn Lys Glu Gln Gln Leu Lys Leu Leu Gln
445 450 455
caa gcc ctg caa gga atg caa cag cat cta ctc aaa gtc caa gag gaa 1444
Gln Ala Leu Gln Gly Met Gln Gln His Leu Leu Lys Val Gln Glu Glu
460 465 470
tac aaa aag aaa gaa get gaa ctt gaa aaa ctc aaa gat gac aag tta 1492
Tyr Lys Lys Lys Glu Ala Glu Leu Glu Lys Leu Lys Asp Asp Lys Leu
475 480 485 490
cag gtg gaa aaa atg ttg gaa aat ctt aaa gaa aag gaa agc tgt get 1540
Gln Val Glu Lys Met Leu Glu Asn Leu Lys Glu Lys Glu Ser Cys Ala
495 500 505
tct agg ctg tgt gcc tca aac cag gat agc gaa tac cct ctt gag aag 1588
Ser Arg Leu Cys Ala Ser Asn Gln Asp Ser Glu Tyr Pro Leu Glu Lys
510 515 520
acc atg aac agc agt cct atc aaa tct gaa cgt gaa gca ctg cta gtg 1636
Thr Met Asn Ser Ser Pro Ile Lys Ser Glu Arg Glu Ala Leu Leu Val
525 530 535
3
CA 02388612 2002-05-O1
WO 01/32673 PCT/US00/30190
ggg att atc tcc aca ttc ctt cat gtt cac cca ttt gga gca agc att 1684
Gly Ile Ile Ser Thr Phe Leu His Val His Pro Phe Gly Ala Ser Ile
540 545 550
gaa tac atc tgt tcc tac ttg cac cgt ctt gat aat aag atc tgc acc 1732
Glu Tyr Ile Cys Ser Tyr Leu His Arg Leu Asp Asn Lys Ile Cys Thr
555 560 565 570
agc gat gtg gag tgt ctc atg ggt aga ctc cag cat acc ttc aag cag 1780
Ser Asp Val Glu Cys Leu Met Gly Arg Leu Gln His Thr Phe Lys Gln
575 580 585
gaa atg act gga gtt gga gcc agc ctg gaa aag aga tgg aaa ttc tgt 1828
Glu Met Thr Gly Val Gly Ala Ser Leu Glu Lys Arg Trp Lys Phe Cys
590 595 600
ggc ttc gag ggc ttg aag ctg acc taaatctctt tgcctaacaa cttgggatcc 1882
Gly Phe Glu Gly Leu Lys Leu Thr
605 610
tgaagataaa tatgtgttgg acaagcatag aaagtgattt atatttttaa tggttttcaa 1942
gtggaagttc ctttgaattt gtcagttcat tcctggaaaa tcttttgagt taaaataagg 2002
atcctaggac agcacctcga actacaggcc ctaaagagaa attgcctcaa accacaagtg 2062
ctgtaacttc ctcccctttc tgtcaattgg ttgtctttaa atattgcaaa agtcctgatg 2122
ctaaacagta tttggagtgt tttcagtgtc tgtactactg ttgtacacct tggtattttt 2182
ttaaacactg ttaactgaaa tgttttgatg attttatgtg atttgtgttt ctaaacttct 2242
ctttacatta atgttgttac tggtgaaagg catgagagca gcactaagtc ctctgtgtaa 2302
ctgccattgt ctttccaatc cccagtagac cagtaaataa ataacacatc agtgtcttct 2362
agaaggtgcc tgaccaggtt caccttttaa acgacaaagc atggtttgtg gctttttgca 2422
aaattactat gaaccaaaag ttgacaaatg ttccaaagtt attttctcta acat.atcaca 2482
ttaaagatct gtttcagaat tgtaaaaagt acatctagat gtgtttacag aaagcaagta 2542
tccagtatga ctggcatgtg ttcatgctat tcagaatcac ttgtaaatag tctgctttta 2602
aaggagggca tgttcagttt tctgtgaatt aaaatatgct catgtgtggg cacacacgca 2662
caaacacaca cacgcacgca cacagtggca gaagggattt atattaatat tctttcccct 2722
ctggccttct tacagtctgt tggtcccttt gcttctgttg tcagtgtgtt gaattgcaaa 2782
ccgagtactg ctgtaaatac tatgtttact tcatgctgaa tgtttgcaaa gacttgatat 2842
aagtattaat agtaatgaat caatgaataa ataatgagct agggtttgtg aggctttcta 2902
caaataggtc agctccacct ggagtgcgaa ttgccagaga caccttggta gtgcccatcg 2962
4
CA 02388612 2002-05-O1
WO 01/32673 PCT/US00/30190
gcaaatcgca atggcagcat gtgagtggac cattcagaaa cttctgcttg gtggaaagta 3022
aacagagagg atggaggttt ggggcgaatg tcctgaggca gagatggtct ttattgtgtg 3082
tggtggtggt tgtggtattt ataataatgc aagcataccc tcccttgagt ctcaattgaa 3142
gataaaagaa tgtactgagc aagcaaagcc aatggagagt atttcacaaa aatactttgt 3202
aaatgagatg ccagtagtgt tcaaagttgt atttttaaaa gataaatatt cctttttata 3262
cctcagtttt gtgtcctgtt ttttaatgac ttacgctcta agtaatccat tagtagttat 3322
ctcagtccct ccctttgggt tactagaatg ttggaaaaag atgccaagtc tgtcttgaca 3382
actggaaaca gggttccaca gcagcccatt cgtgctgaaa actggcttcc cccctgaagc 3442
accctgctgt ggcaccagca ggaagctcag gttaatttta cactagcttg ctcactgatg 3502
catctctcat caatgctacg gaaggctttg attcatcagt ctcgggctct tggaatacct 3562
aattttaata atatctatga aatcaaggga aactttccat ttacagttat ttcttgttta 3622
aataaactaa attaattttt aggggagagc agtaggaaaa agagctaatg catgcggggt 3682
ttaataccta ggtgatgggt tgaggtgcag caaaaccacc atggcacacg ttcacctatg 3742
taacaaacct gcacatcctg cacatgtacc ccggaactta cttaaaa 3789
<210> 2
<211> 610
<212> PRT
<213> Homo Sapiens
<400> 2
Met Gln Arg Asp Phe Arg Trp Leu Trp Val Tyr Glu Ile Gly Tyr Ala
1 5 10 15
Ala Asp Asn Ser Arg Thr Leu Asn Val Asp Ser Thr Ala Met Thr Leu
20 25 30
Pro Met Ser Asp Pro Thr Ala Trp Ala Thr Ala Met Asn Asn Leu Gly
35 40 45
Met Ala Pro Leu Gly Ile Ala Gly Gln Pro Ile Leu Pro Asp Phe Asp
50 55 60
Pro Ala Leu Gly Met Met Thr Gly Ile Pro Pro Ile Thr Pro Met Met
65 70 75 80
Pro Gly Leu Gly Ile Val Pro Pro Pro Ile Pro Pro Asp Met Pro Val
85 90 95
Val Lys Glu Ile Ile His Cys Lys Ser Cys Thr Leu Phe Pro Pro Asn
100 105 110
CA 02388612 2002-05-O1
WO 01/32673 PCT/US00/30190
Pro Asn Leu Pro Pro Pro Ala Thr Arg Glu Arg Pro Pro Gly Cys Lys
115 120 125
Thr Val Phe Val Gly Gly Leu Pro Glu Asn Gly Thr Glu Gln Ile Ile
130 135 140
Val Glu Val Phe Glu Gln Cys Gly Glu Ile Ile Ala Ile Arg Lys Ser
145 150 155 160
Lys Lys Asn Phe Cys His Ile Arg Phe Ala Glu Glu Tyr Met Val Asp
165 170 175
Lys Ala Leu Tyr Leu Ser Gly Tyr Arg Ile Arg Leu Gly Ser Ser Thr
180 185 190
Asp Lys Lys Asp Thr Gly Arg Leu His Val Asp Phe Ala Gln Ala Arg
195 200 205
Asp Asp Leu Tyr Glu Trp Glu Cys Lys Gln Arg Met Leu Ala Arg Glu
210 215 220
Glu Arg His Arg Arg Arg Met Glu Glu Glu Arg Leu Arg Pro Pro Ser
225 230 235 240
Pro Pro Pro Val Val His Tyr Ser Asp His Glu Cys Ser Ile Val Ala
245 250 255
Glu Lys Leu Lys Asp Asp Ser Lys Phe Ser Glu Ala Val Gln Thr Leu
260 265 270
Leu Thr Trp Ile Glu Arg Gly Glu Val Asn Arg Arg Ser Ala Asn Asn
275 280 285
Phe Tyr Ser Met Ile Gln Ser Ala Asn Ser His Val Arg Arg Leu Val
290 295 300
Asn Glu Lys Ala Ala His Glu Lys Asp Met Glu Glu Ala Lys Glu Lys
305 310 315 320
Phe Lys Gln Ala Leu Ser Gly Ile Leu Ile Gln Phe Glu Gln Ile. Val
325 330 335
Ala Val Tyr His Ser Ala Ser Lys Gln Lys Ala Trp Asp His Phe Thr
340 345 350
Lys Ala Gln Arg Lys Asn Ile Ser Val Trp Cys Lys Gln Ala Glu Glu
355 360 365
Ile Arg Asn Ile His Asn Asp Glu Leu Met Gly Ile Arg Arg Glu Glu
370 375 380
Glu Met Glu Met Ser Asp Asp Glu Ile Glu Glu Met Thr Glu Thr Lys
385 390 395 400
6
CA 02388612 2002-05-O1
WO 01/32673 PCT/US00/30190
Glu Thr Glu Glu Ser Ala Leu Val Ser Gln Ala Glu Ala Leu Lys Glu
405 410 415
Glu Asn Asp Ser Leu Arg Trp Gln Leu Asp Ala Tyr Arg Asn Glu Val
420 425 430
Glu Leu Leu Lys Gln Glu Gln Gly Lys Val His Arg Glu Asp Asp Pro
435 440 445
Asn Lys Glu Gln Gln Leu Lys Leu Leu Gln Gln Ala Leu Gln Gly Met
450 455 460
Gln Gln His Leu Leu Lys Val Gln Glu Glu Tyr Lys Lys Lys Glu Ala
465 470 475 480
Glu Leu Glu Lys Leu Lys Asp Asp Lys Leu Gln Val Glu Lys Met Leu
485 490 495
Glu Asn Leu Lys Glu Lys Glu Ser Cys Ala Ser Arg Leu Cys Ala Ser
500 505 510
Asn Gln Asp Ser Glu Tyr Pro Leu Glu Lys Thr Met Asn Ser Ser Pro
515 520 525
Ile Lys Ser Glu Arg Glu Ala Leu Leu Val Gly Ile Ile Ser Thr Phe
530 535 540
Leu His Val His Pro Phe Gly Ala Ser Ile Glu Tyr Ile Cys Ser Tyr
545 550 555 560
Leu His Arg Leu Asp Asn Lys Ile Cys Thr Ser Asp Val Glu Cys Leu
565 570 575
Met Gly Arg Leu Gln His Thr Phe Lys Gln Glu Met Thr Gly Val Gly
580 585 590
Ala Ser Leu Glu Lys Arg Trp Lys Phe Cys Gly Phe Glu Gly Leu Lys
595 600 605
Leu Thr
610
<210> 3
<211> 8
<212> PRT
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: partial
sequence of Chondous crispus mitochondrial ATP
synthase protein 9.
7
CA 02388612 2002-05-O1
WO 01/32673 PCT/US00/30190
<400> 3
Thr Gly Val Gly Ala Gly Val Gly
1 5
<210> 4
<211> 4
<212> PRT
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: partial amino
acid sequence surrounding sulfonylurea and quinone
binding site in photosystem II.
<400> 4
Ala Met His Gly
1
<210> 5
<211> 5
<212> PRT
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: partial amino
acid sequence of Synechococcus D1 protein.
<400> 5
Glu Thr Met Arg Glu
1 5
<210> 6
<211> 27
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:oligonucleotide
useful as primer.
<400> 6
gagtgtaaac agcatatgct agccaga 27
<210> 7
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:oligonucleotide
useful as primer, for example.
8
CA 02388612 2002-05-O1
WO 01/32673 PCT/US00/30190
<400> 7
tttctatgct tgtccaacac atat 24
<210> 8
<211> 30
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:oligonucleotide
useful as primer, for example.
<400> 8
ggagatatac atatgggaat tctcattcaa 30
<210> 9
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:oligonucleotide
useful as primer, for example.
<400> 9
tttctatgct tgtccaacac atat 24
<210> 10
<211> 51
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:oligonucleotide
useful as primer, for example.
<400> 10
gatatacata tgcatcatca tcatcatcat ctagccagag aggagcgcca t 51
<210> 11
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:oligonucleotide
useful as primer, for example.
<400> 11
tttctatgct tgtccaacac atat 24
9
CA 02388612 2002-05-O1
WO 01/32673 PCT/US00/30190
<210> 12
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:oligonucleotide
useful as primer, for example.
<400> 12
tgggagtgta aacagcgtat g 21
<210> 13
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:oligonucleotide
useful as primer, for example.
<400> 13
tttctatgct tgtccaacac atat 24
<210> 14
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:oligonucleotide
useful as primer, for example.
<400> 14
aaacttaagc tttgggagtg t 21
<210> 15
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:oligonucleotide
useful as primer, for example.
<400> 15
tttctatgct tgtccaacac atat 24
CA 02388612 2002-05-O1
WO 01/32673 PCT/US00/30190
<210> 16
<211> 11
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:oligonucleotide
useful as primer, for example.
<400> 16
kmtgvgaskr w 11
<210> 17
<211> 33
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:oligonucleotide
useful as primer, for example.
<400> 17
gaaaaggaaa gcgccgcttc taggctgtgt gcc ~ 33
<210> 18
<211> 35
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:oligonucleotide
useful as primer, for example.
<400> 18
ggcacacagt ccctagaagc ggcgctttcc ttttc 35
<210> 19
<211> 34
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:oligonucleotide
useful as primer, for example.
<400> 19
gcttctaggc tggccgcctc aaaccaggat agcg 34
11
CA 02388612 2002-05-O1
WO 01/32673 PCT/US00/30190
<210> 20
<211> 34
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:oligonucleotide
useful as primer, for example.
<400> 20
cgctatcctg gtttgaggcg gccagcctag aagc 34
<210> 21
<211> 40
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:oligonucleotide
useful as primer, for example.
<400> 21
gcaagcattg aatacatcgc ttcctacttg caccgtcttg 40
<210> 22
<211> 40
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:oligonucleotide
useful as primer, for example.
<400> 22
caagacggtg caagtaggaa gcgatgtatt caatgcttgc 40
<210> 23
<211> 38
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:oligonucleotide
useful as primer, for example.
<400> 23
cgtcttgata ataagatcgc caccagcgat gtggagtg 38
12
CA 02388612 2002-05-O1
WO 01/32673 PCT/US00/30190
<210> 24
<211> 38
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:oligonucleotide
useful as primer, for example.
<400> 24
cactccacat cgctggtggc gatcttatta tcaagacg 38
<210> 25
<211> 33
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:oligonucleotide
useful as primer, for example.
<400> 25
ccagcgatgt ggaggccctc atgggtagac tcc 33
<210> 26
<211> 33
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:oligonucleotide
useful as primer, for example.
<400> 26
ggagtctacc catgagggcc tccacatcgc tgg 33
<210> 27
<211> 40
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:oligonucleotide
useful as primer, for example.
<400> 27
gaaaagaaga tggaaattcg ctggcttcga gggcttgaag 40
13
CA 02388612 2002-05-O1
WO 01/32673 PCT/US00/30190
<210> 28
<211> 39
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:oligonucleotide
useful as primer, for example.
<400> 28
cttcaagccc tcgaagccag cgaatttcca tctcttttc 39
<210> 29
<211> 47
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:oligonucleotide
useful as primer, for example.
<400> 29
gtctgatgat gaaatagaag aagcgacaga aacaaaagaa actgagg 47
<210> 30
<211> 47
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:oligonucleotide
useful as primer, for example.
<400> 30
cctcagtttc ttttgtttct gtcgcttctt ctatttcatc atcagac 47
<210> 31
<211> 38
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:oligonucleotide
useful as primer, for example.
<400> 31
caggaaatga ctggagttgt ggccagcctg gaaaagag 38
14
CA 02388612 2002-05-O1
WO 01/32673 PCT/US00/30190
<210> 32
<211> 38
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:oligonucleotide
useful as primer, for example.
<400> 32
ctcttttcca ggctggccac aactccagtc atttcctg 38
