Note: Descriptions are shown in the official language in which they were submitted.
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
REGULATION OF GENE EXPRESSION BY NEUROLEPTIC AGENTS
(MBHB Case No. 99,022-B)
This application claims priority of U.S. Provisional Application No.
60/161,379,
filed October 26, 1999 and U.S. Provisional Application No. 60/186,918, filed
on March
3, 2000. Both applications are hereby incorporated by reference.
BACKGROUND OF THE INVENTION
Schizophrenia and dopamine rectors. Midbrain dopamine neurons have been
shown to play an important role in normal and diseased brain functions. For
example,
many psychiatric disorders are associated with overactive dopaminergic
activity in the
meso-striatal dopamine system which refers to both the nigro-striatal dopamine
pathway
(neurons linking the substantia nigra to the striatum), and the meso-limbic
dopamine
pathway (neurons linking the ventral tegmental area to limbic regions, such as
amygdala,
olfactory tubercle and the nucleus accumbens, which is often considered a
ventral
extension of the striatum). Additionally, it is known that Parkinson's Disease
is caused
by the degeneration of dopamine neurons of the r_igro-striatal pathway.
Neurolentic antipsychotic) dru~~s. Neuroleptic drugs, such as haloperidol and
clozapine, are widely used in the long-term treatment of various psychiatric
disorders,
including schizophrenia. The antipsychotic effects o.f neuroleptic drugs are
generally
attributed to blockade of D2 receptors in the meso-limbic dopamine system
(M.;tzler et
al., Schizophrenia Bull., 2, 19-76 (1976)). fhe best evidence for this comes
from the
excellent correlation observed between the therapeutic potency of neuroleptics
~uul their
affinity for binding to the DZ receptor (Seeman et a.1., Curr. Cnn. tYeacrol.
And
Neurosurg., G, 602-608 (1993); Creese et al., Srience, 192, 481-483 (1976);
Perou:ka et
al., Am. J. Psych., 137, 1518-1522 (1980); Dutch, et al., Schizophren. Res.,
4, 121-156
(1991); Seeman. P., S~mapse 1, 133-152 (1987)). Ahhough neuroleptic drugs have
affinity for other neurotransmitter receptors in th., brain, such as
musL.arinic
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
acetylcholine, S-HT, alpha-adrenergic and histamine receptors, no correlation
to clinical
efficacy has been observed with these receptors (Peroutka et al., Am. J.
Psych. (1980);
Richelson et al., Eur. J. Pharm., 103, 197-204 (1984)).
Studies demonstrate that dopamine receptors become blocked to a level of 70%
after only a few hours of neuroleptic treatment (Sedval et al., Arch. Gen.
Psych., 43, 995-
1006 (1986)). This blockade has been shown to lead to a compensatory increase
in
dopamine receptor number and supersensitivity of the unblocked receptors (Clow
et al.,
Psychopharm., 69, 227-233 (1980); Rupniak et al., Life Sci., 32, 2289-2311
(1983);
Rogue et al., Eur. J. Pharm., 207, 165-169 (1991)). Furthermore, the short-
term effects
of dopamine antagonists on the brain are well known and include such effects
as an
increase in dopamine synthesis and catabolism, an increase in the firing rate
of dopamine
neurons resulting from the inhibition of pre-synaptic dopamine autoreceptors
(Grace et
al., J. Pharm. Exp. Ther., 238, 1092-1100 (1986), and a potentiation of cyclic
AMP
formation resulting from the blockade of post-synaptic dopamine receptors
(Rupniak et
al., Psychopharm., 84, 519-521 (1984)).
Side a ects of neuroleptic dYZIPS. In addition to their antipsychotic actions,
neuroleptics can cause a series of mild to severe side effects. Some of these
side-effects
result from the dirty nature of neuroleptic drugs, including hypotension and
tachycardia,
which results from alpha-adrenergic receptor blockade, and dry mouth and
blurred vision,
which results from the blockade of muscarinic acetylcholine receptors. The
predominant
and most undesirable effects that accompany neuroleptic treatment are the long-
lasting
motor deficits referred to as extrapyramidal side effects (Marsden et al.,
Psychol. Med.,
10, 55-72 (1980)). Extrapyramidal side effects are associated with the
blockade of
dopamine receptors in the dorsal striatum (Moore et al., Clin.
Neuropharmacol., 12, 167-
184 (1989) and include such motor deficits as dystonias (muscle spasms),
akathisias
(motor restlessness), Parkinson's-like symptoms and Tardive Dyskinesia.
Roughly 20%
of patients taking antipsychotics demonstrate Parkinson's-like symptoms, the
blockade of
dopamine D2 receptors in the striatum being functionally equivalent to the
degeneration
of nigro-striatal dopamine neurons seen in Parkinson's Disease. Tardive
Dyskinesia is a
2
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
syndrome of abnormal involuntary movements that afflicts roughly 25% of
patients on
neuroleptic treatment (Jeste et al., Psychopharmacol., 106, 154-160 (1992)).
The danger
of this side effect is that it can be potentially irreversible, that is,
patients can still have
symptoms of Tardive Dyskinesia long after the antipsychotic has been
discontinued.
This implicates an epigenetic component to the effects of chronic neuroleptic
treatment.
Interestingly, "typical" neuroleptics, such as haloperidol and fluphenazine,
have a
much higher propensity for causing extrapyramidal side effects than "atypical"
neuroleptic drugs, such as clozapine, which rarely causes these types of
effects.
Although clozapine differs from haloperidol in its pharmalogical profile, the
specific
mechanism leading to the lack of motor side effects is unclear. Since
clozapine has high
affinity for other neurotransmitter receptors, such as muscarinic, adrenergic
and serotonin
receptors, it is possible that the antipsychotic actions of clozapine are
partly due to
blockade of these other receptors, which may restore proper balance of the
dopamine
input and output pathways of the basal ganglia.
Genetics and genes involved in neuropsychiatric disorders. In the general
population, the risk for developing a psychiatric disorder is approximately 1-
2% (Maier,
W., and Schwab, S., Molecular genetics of schizophrenia. Current Opinion in
Psychiatry
11:19-25 (1998); Kendler, K.S., Twin studies ofpsychiatric illness: current
status and
future directions. Arch Gen Psychiatry 50:9095-915 (1993)). However, this risk
increases to 10% or 40% if one or both parents, respectively, have the
disease.
Concordance in monozygotic and dizygotic twins remains only as high 40-50%
(Maier
and Schwab (1998)). While there is undoubtedly a genetic component to the
transmission of psychiatric disorders, the lack of full concordance in
dizygotic twins
indicates that there are other envirorunental factors that contribute (Maier
and Schwab
(1998); Kendler (1993)). A current challenge in genetic research on mental
illnesses is
the identification of mutations conferring susceptibility to, or genes
associated with
therapeutics for, such disorders. One approach addressing the latter is to
identify genes
whose expression is altered during the process of drug treatment.
3
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
Expression of immediate early genes resulting~from acute neuroleptic
treatment.
Despite the immediate occupancy of dopamine receptors, neuroleptic drugs have
a
delayed onset of clinical action, which often can be up to several weeks.
Further, as
discussed above, neuroleptic drugs are characterized by their ability to cause
late and
long-lasting motor deficits. The distinct temporal discrepancy which exists
between
dopamine receptor occupancy and the onset of therapeutic and extrapyramidal
side
effects, suggests that additional molecular changes in the brain occur
downstream from
dopamine receptor blockade. In an attempt to identify the downstream molecular
mechanisms, studies have focused on dopamine-receptor regulation of individual
target
genes in the striatum and nucleus accumbens.
For example, several studies have demonstrated that acute treatment with
antipsychotic drugs causes induction of several immediate-early genes (Nguyen
et al,
Proc. Natl. Acad. Sci., 89, 4270-4274 (1992); MacGibbon et al., Mol. Brain.
Res. 23, 21-
32 (1994); Robertson et al., Neuro. Sci., 46, 315-328 (1992); Dragunow et al.,
Neuro.
Sci., 37, 287-294 (1990); Miller J. Neurochem., 54, 1453-1455 (1990)). Some
immediate
early gene proteins (IEGPs) act as transcription factors by binding to
specific DNA
sequences and regulating gene transcription. Thus, IEGPs can link receptor-
mediated
signalling effects to long-term genomic activity. Recent studies have shown
that
haloperidol, a typical neuroleptic, induces the expression c-Fos in the rat
striatum and
nucleus accumbens, whereas, clozapine, an atypical neuroleptic, induces c-Fos
in the
nucleus accumbens only (Nguyen et al., Proc. Natl. Acad. Sci. (1992);
MacGibbon et al.,
Mol. Brain Res. (1994); Robertson et al., Neurosci. (1992)). Haloperidol has
also been
shown to induce expression of other IEGPs, such as FosB, Jung, JunD and
Krox24, in
the striatum and nucleus accumbens (Rogue et al., Brain Res. Bull. 29, 469-472
(1992);
Marsden et al., Psych. Med. (1980); Moore et al., Clin. Neuropharmacol.
(1989)). In
contrast, clozapine has been shown to induce Krox24 and Jung in the nucleus
accumbens
only (Nguyen et al. (1992); MacGibbon et al. (1994)). These results suggest
that
clozapine's lower tendency to cause extrapyramidal side effects, compared to
"typical"
neuroleptics, may be associated with its failure to induce IEGPs in the
striatum.
4
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
The appearance of immediate early genes after acute treatment with
neuroleptics
likely precedes a number of other molecular changes responsible for the
delayed adaptive
changes that occur with drug treatment in the striatum.
S Chan,~es induced by chronic neuroleptic treatment. Chronic treatment with
neuroleptic drugs has also been shown to cause changes in the expression of
certain
neuropeptides and neurotransmitter receptors. In distinct regions of the
striatum, both
neurotensin and enkephalin are upregulated after chronic (7 - 28 days)
treatment with
haloperidol, while levels of protachykinin mRNA are decreased (Merchant et
al., J.
Pharm. Exp. Ther., 271, 460-471 (1994); Delfs et al., J. Neurochem., 63, 777-
780 (1994);
Angulo et al., Neurosci. Lett. 113, 217-221 (1990)). In contrast, chronic
clozapine
treatment results in a decrease in enkephalin mRNA levels and only small
changes in the
expression of neurotensin and tachykinin (Merchant et al. (1994); Mercugliano
et al.,
Neurosci. Lett., 136, 10-15 (1992); Angulo et al. (1990)). These differences
suggest that
neuropeptides may play a role in the motor deficits that result from treatment
with typical
neuroleptics.
Researchers have also demonstrated the regulation of genes associated with
glutaminergic neurotransmission. For example, a decrease in mRNA expression of
the
glutamate transporter, GLT-1, was observed in the striatum after 30 days of
haloperidol
treatment, but not after clozapine exposure (Schneider et al., Neuroreport.,
9, 133-136
(1998)). Similar treatment with haloperidol also resulted in an increase in
the N-methyl-
D-aspartate (NMDA) receptor subunits, NR1 and NR2, whereas clozapine treatment
resulted in a lesser induction (Riva et al., Mol. Brain. Res. 50, 136-142
(1997)).
In addition, pathological and structural changes in the striatum have been
observed after chronic drug treatment. Studies using experimental animals have
detected
a reduction in the size and number of striatal neurons and neuronal processes,
as well as
decreases in striatal neuronal density following chronic treatment with
haloperidol
(Christensen et al., Acta. Psych. Scand., 46, 14-23 (1970), Jeste et al.,
Psychopharm.,
106, 154-160 (1992); Mahadik et al., Biol. Psych., 24, 199-217 (1988); Nielson
et. al.,
5
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
Psychopharm., 59-85-89 (1978). These studies imply that neuroleptics may have
a
neurotoxic effect on the striatum which could account for the ensuing
neuroleptic-
induced side effects.
Although the above studies have examined the expression of a few individual
target genes, there has been no comprehensive study of the effects of
neuroleptics on
gene expression over time in the striatum and nucleus accumbens, brain regions
considered to be critically involved in the actions of neuroleptic drugs.
Thus, the number
and identity of the genes which are differentially expressed following acute
and chronic
treatment with neuroleptics in these tissues remains unknown. Further, there
has been no
comprehensive examination of the differences between the striatal mRNA
expression
induced by typical neuroleptics and the expression induced by atypical
neuroleptics.
Such a comparative study would identify the genes that regulate the
antipsychotic actions
of neuroleptics versus those responsible for the unwanted side effects
associated with
these drugs. This information would advance the development of an
antipsychotic
therapy that would target specific actions of neuroleptic drugs or,
alternatively, would
selectively block proteins causing the motor side effects.
In addition, a systematic characterization would allow the identification of
genes
that contribute to neuropathologies associated with neuropsychiatric
disorders, such as
psychoses, bipolar disorder, and addiction-related behavior. This information
can reveal
pathways for the mechanism of actions of antipsychotic drugs, as well as
provide insight
regarding the underlying basis of psychiatric dysfunction. Specifically, the
identification
of potentially harmful gene products is important to identify molecules that
could be
useful as diagnostic markers indicating neuropathology. Additionally, the
identification
of potentially harmful gene products is important to identify molecules that
could be
amenable to pharmaceutical intervention. A systematic characterization would
also allow
the identification of beneficial molecules that contribute to conditions of
neuroprotection.
Such identification of beneficial products could lead to the development of
pharmaceutical agents useful in the treatment of neuropsychiatric disorders.
Furthermore, the identification of harmful and beneficial products may lead to
new lines
6
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
of study towards the amelioration of symptoms associated with neuropsychiatric
disorders.
Studies have been performed using the PCR-based Total Gene Expression
Analysis (TOGA) method to analyze the expression patterns of thousands of
genes and
compare expression patterns among time courses following clozapine drug
treatment.
Genes regulated by clozapine treatment were examined in haloperidol-treated
animals for
a comparative analysis.
SUMMARY OF THE INVENTION
Studies have been performed using the PCR-based Total Gene Expression
Analysis (TOGA) method to analyze the expression patterns of thousands of
genes and
compare expression patterns among time courses following clozapine drug
treatment.
Genes regulated by clozapine treatment were examined in haloperidol-treated
animals for
a comparative analysis. TOGA analysis has identified several genes that are
altered in
their expression in response to clozapine and/or haloperidol administration in
mouse
brain. In particular, the TOGA system has been used to examine how gene
expression in
the striatum and nucleus accumbens is regulated by an atypical neuroleptic
agent, such as
clozapine. These studies have identified proteins and genes which are
regulated by the
treatment of atypical drugs. Further, these studies have identified at least
one gene which
is differentially regulated by typical and atypical drugs.
The studies have also examined the pattern of expression of neuroleptic-
regulated
genes in various regions of the brain. Among other things, these studies are
useful to
determine the genes specifically associated with anti-psychotic activity
versus those
associated with extrapyramidal side effects, which information advances the
development
of improved antipsychotic therapies. The identified neuroleptic-regulated
molecules are
useful in therapeutic and diagnostic applications in the treatment of various
neuropsychiatric disorders, such as psychoses, bipolar disorder, and addiction-
related
behavior. Such molecules are also useful as probes as described by their size,
partial
7
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
nucleotide sequence and characteristic regulation pattern associated with
neuroleptic
administration.
The present invention provides novel polynucleotides and the encoded
polypeptides. Moreover, the present invention relates to vectors, host cells,
antibodies,
and recombinant methods for producing the polynucleotides and the
polypeptides. One
embodiment of the invention provides an isolated nucleic acid molecule
comprising a
polynucleotide chosen from the group consisting of SEQ ID NO:1, SEQ ID N0:2,
SEQ
ID N0:3, SEQ ID N0:4, SEQ ID NO:S, SEQ ID N0:6, SEQ ID N0:7, SEQ ID N0:8,
SEQ ID N0:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID N0:12, SEQ ID N0:13, SEQ
ID N0:14, SEQ ID NO:15, SEQ m N0:16, SEQ ID N0:17, SEQ ID N0:18, SEQ ID
N0:19, SEQ ID NO: 49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID N0:52, SEQ ID NO:
57, SEQ ID N0:58, SEQ ID N0:59, SEQ ID N0:60, SEQ ID N0:61, SEQ ID N0:62,
SEQ ID N0:63, SEQ ID N0:64, SEQ ID N0:65, SEQ ID N0:66, SEQ ID N0:67, SEQ
1 S ID N0:68, SEQ ID N0:69, SEQ ID N0:70, SEQ ID N0:71, SEQ ID N0:72 and SEQ
ID
N0:107. Also provided is an isolated nucleic acid molecule comprising a
polynucleotide
at least 95% identical to any one of these isolated nucleic acid molecules and
an isolated
nucleic acid molecule at least ten bases in length that is hybridizable to any
one of these
isolated nucleic acid molecules under string.;nt conditions. Any one of these
isolated
nucleic acid molecules can comprise sequential nucleotide deletions from
either the 5'-
terminus or the 3'-terminus. Further provided is a recombinant vector
comprising any
one of these isolated nucleic acid molecules and a recombinant host cell
comprising any
one of these isolated nucleic acid molecules. Also provided is the gene
corresponding to
the cDNA sequence of any one of these isolated nucleic acids.
Another embodiment of the invention provides an isolated polypeptide encoded
by a polynucleotide chosen from the group consisting of SEQ ID NO:1, SEQ ID
N0:2,
SEQ ID N0:3, SEQ ID N0:4, SEQ ID NO:S, SEQ ID N0:6, SEQ ID N0:7, SEQ ID
N0:8, SEQ ID N0:9, SEQ ID 110:10, SEQ ID NO:11, SEQ ID N0:12, SEQ ID N0:13,
SEQ ID N0:14, SEQ ID NO:1 S, SEQ ID N0:16, SEQ ID N0:17, SEQ ID N0:18. SEQ
ID N0:19, SEQ ID NO: 49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID N0:52, SEQ ID
8
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
NO: 57, SEQ ID N0:58, SEQ ID N0:59, SEQ ID N0:60, SEQ ID N0:61, SEQ ID
N0:62, SEQ ID N0:63, SEQ ID N0:64, SEQ ID N0:65, SEQ ID N0:66, SEQ ID
N0:67, SEQ ID N0:68, SEQ ID N0:69, SEQ ID N0:70, SEQ ID N0:71, SEQ ID
N0:72 and SEQ ID N0:107. Also provided is an isolated nucleic acid molecule
encoding any of these polypeptides, an isolated nucleic acid molecule encoding
a
fragment of any of these polypeptides, an isolated nucleic acid molecule
encoding a
polypeptide epitope of any of these polypeptides, and an isolated nucleic acid
encoding a
species homologue of any of these polypeptides. Another embodiment of the
invention
provides an isolated polypeptide of SEQ ID NO: 109. Another embodiment of the
invention provides an isolated polypeptide of SEQ ID NO: 110. Preferably, any
one of
these polypeptides has biological activity. Optionally, any one of the
isolated
polypeptides comprises sequential amino acid deletions from either the C-
terminus or the
N-terminus. Further provided is a recombinant host cell that expresses any one
of these
isolated polypeptides.
Yet another embodiment of the invention comprises an isolated antibody that
binds specifically to an isolated polypeptide encoded by a polynucleotide
chosen from the
group consisting of SEQ ID NO:1, SEQ ID N0:2, SEQ ID N0:3, SEQ ID N0:4, SEQ
ID NO:S, SEQ ID N0:6, SEQ ID N0:7, SEQ ID N0:8, SEQ ID N0:9, SEQ ID NO:10,
SEQ ID NO:11, SEQ ID N0:12, SEQ ID N0:13, SEQ ID N0:14, SEQ >D NO:15, SEQ
ID N0:16, SEQ ID N0:17, SEQ ID N0:18, SEQ ID N0:19, SEQ ID NO: 49, SEQ ID
NO:50, SEQ ID NO:S1, SEQ ID N0:52, SEQ ID NO: 57, SEQ ID N0:58, SEQ ID
N0:59, SEQ ID N0:60, SEQ ID N0:61, SEQ ID N0:62, SEQ ID N0:63, SEQ ID
N0:64, SEQ ID N0:65, SEQ ID N0:66, SEQ ID N0:67, SEQ ID N0:68, SEQ ID
N0:69, SEQ ID N0:70, SEQ ID N0:71, SEQ ID N0:72 and SEQ ID N0:107. Yet
another embodiment of the invention comprises an isolated antibody that binds
specifically to an isolated polypeptide of SEQ ID NO: 109. Yet another
embodiment of
the invention comprises an isolated antibody that binds specifically to an
isolated
polypeptide of SEQ ID NO: 110. The isolated antibody can be a monoclonal
antibody or
a polyclonal antibody.
9
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
Another embodiment of the invention provides a method for preventing,
treating,
modulating, or ameliorating a medical condition, such as a neuropsychiatric
disorder,
comprising administering to a mammalian subject a therapeutically effective
amount of a
polypeptide of the invention or a polynucleotide of the invention. In one
preferred
embodiment, a method for preventing, treating, modulating or ameliorating
schizophrenia
is provided. In another preferred embodiment, a method for preventing,
treating,
modulating or ameliorating bipolar disorder is provided. In yet another
embodiment, a
method for preventing, treating, modulating or ameliorating addiction-related
behavior is
provided.
A further embodiment of the invention provides an isolated antibody that binds
specifically to the isolated polypeptide of the invention. A preferred
embodiment of the
invention provides a method for preventing, treating, modulating, or
ameliorating a
medical condition, such as a neuropsychiatric disorder, comprising
administering to a
mammalian subject a therapeutically effective amount of the antibody. In one
preferred
embodiment, a method for preventing, treating, modulating or ameliorating
schizophrenia
is provided. In another preferred embodiment, a method for preventing,
treating,
modulating or ameliorating bipolar disorders is provided. In yet another
embodiment, a
method for preventing, treating, modulating or ameliorating addiction-related
behavior is
provided.
An additional embodiment of the invention provides a method of diagnosing a
pathological condition or a susceptibility to a pathological condition in a
subject. The
method comprises determining the presence or absence of a mutation in a
polynucleotide
of the invention. A pathological condition or a susceptibility to a
pathological condition,
such as a neuropsychiatric disorder, is diagnosed based on the presence or
absence of the
mutation. In one preferred embodiment, a method for diagnosing schizophrenia
is
provided. In another preferred embodiment, a method for diagnosing bipolar
disorders is
provided. In yet another embodiment, a method for preventing, treating,
modulating or
ameliorating addiction-related behavior is provided.
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
Even another embodiment of the invention provides a method of diagnosing a
pathological condition or a susceptibility to a pathological condition, such
as a
neuropsychiatric disorder, in a subject. Especially preferred embodiments
include
methods of diagnosing schizophrenia and bipolar disorders. The method
comprises
detecting an alteration in expression of a polypeptide encoded by the
polynucleotide of
the invention, wherein the presence of an alteration in expression of the
polypeptide is
indicative of the pathological condition or susceptibility to the pathological
condition.
The alteration in expression can be an increase in the amount of expression or
a decrease
in the amount of expression. In a preferred embodiment a first biological
sample is
obtained from a patient suspected of having a neuropsychiatric disorder, for
example,
schizophrenia, bipolar disorder, or addiction-related behavior, and a second
sample from
a suitable comparable control source is obtained. The amount of at least one
polypeptide
encoded by a polynucleotide of the invention is determined in the first and
second
sample. The amount of the polypeptide in the first and second samples is
determined. A
patient is diagnosed as having a neuropsychiatric disorder if the amount of
the
polypeptide in the first sample is greater than or less than the amount of the
polypeptide
in the second sample.
Another embodiment of the invention provides a method for identifying a
binding
partner to a polypeptide of the invention. A polypeptide of the invention is
contacted
with a binding partner and it is determined whether the binding partner
effects an activity
of the polypeptide.
Yet another embodiment of the invention is a method of identifying an activity
of
an expressed polypeptide in a biological assay. A polypeptide of the invention
is
expressed in a cell and isolated. The expressed polypeptide is tested for an
activity in a
biological assay and the activity of the expressed polypeptide is identified
based on the
test results.
Still another embodiment of the invention provides a substantially pure
isolated
DNA molecule suitable for use as a probe for genes regulated in
neuropsychiatric
11
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
disorders, chosen from the group consisting of the DNA molecules shown in ~ of
SEQ ID
NO:I, SEQ ID N0:2, SEQ ID NO:3, SEQ ID N0:4, SEQ ID NO:S, SEQ ID N0:6, SEQ
ID N0:7, SEQ ID N0:8, SEQ ID N0:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID
N0:12, SEQ ID N0:13, SEQ ID N0:14, SEQ ID NO:15, SEQ ID N0:16, SEQ ID
N0:17, SEQ ID N0:18, SEQ ID N0:19, SEQ ID NO: 49, SEQ ID NO:SO, SEQ ID
NO:51, SEQ ID N0:52, SEQ ID NO: 57, SEQ ID N0:58, SEQ ID N0:59, SEQ ID
N0:60, SEQ ID N0:61, SEQ ID N0:62, SEQ ID N0:63, SEQ ID N0:64, SEQ ID
N0:65, SEQ ID N0:66, SEQ ID N0:67, SEQ ID N0:68, SEQ ID N0:69, SEQ ID
N0:70, SEQ ID N0:71, SEQ ID N0:72 and SEQ ID N0:107.
Even another embodiment of the invention provides a kit for detecting the
presence of a polypeptide of the invention in a mammalian tissue sample. The
kit
comprises a first antibody which immunoreacts with a mammalian protein encoded
by a
gene corresponding to the polynucleotide of the invention or with a
polypeptide encoded
by the polynucleotide in an amount sufficient for at least one assay and
suitable
packaging material. The kit can further comprise a second antibody that binds
to the first
antibody. The second antibody can be labeled with enzymes, radioisotopes,
fluorescent
compounds, colloidal metals, chemiluminescent compounds, phosphorescent
compounds,
or bioluminescent compounds.
Another embodiment of the invention provides a kit for detecting the presence
of
genes encoding a protein comprising a polynucleotide of the invention, or
fragment
thereof having at least 10 contiguous bases, in an amount sufficient for at
least one assay,
and suitable packaging material.
Yet another embodiment of the invention provides a method for detecting the
presence of a nucleic acid encoding a protein in a mammalian tissue sample. A
polynucleotide of the invention or fragment thereof havinb at least 10
contiguous bases is
hybridized with the nucleic acid of the sar.-iple. The presence of the
hybridization product
is detected.
12
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
BRIEF DESCRIPTION OF THE DRAWINGS
These and other features, aspects, and advantages of the present invention
will
become better understood with reference to the following description, appended
claims,
and accompanying drawings where:
Figure 1 is a graphical representation of the results of TOGA analysis using a
5'
PCR primer with parsing bases AGTA, showing PCR products produced from mRNA
extracted from the striatum/nucleus accumbens of mice treated with 7.5 mg/kg
of
clozapine for the following durations: control (no clozapine), 45 minutes, 7
hours, 5
days, 12 days, and 14 days, where the vertical index line indicates a PCR
product of
about 106 b.p. that is present in the control sample and enriched in the
clozapine-treated
samples;
Figure 2A-C is a graphical representation of a more detailed analysis of the
106
by PCR product indicated in Figure 1. The upper panel (Figure 2A) shows the
PCR
product generated with the clone specific primer (SEQ ID NO: 28) and the
fluoresecnt
labeled universal 3' PCR primer (SEQ ID NO: 23). Figure 2B shows the PCR
products
produced in the original TOGA reaction using a 5' PCR primer, C-G-A-C-G-G-T-A-
T-C-
G-G-A-G-T-A (SEQ ID NO: 94), and the fluvresecnt labeled universal 3' PCR
primer
(SEQ ID NO: 23). In the bottom panel (Figure 2C), the traces from the top
panel and
middle panels are overlaid, demonstrating that the PCR product produced using
an
extended primer based on the cloned sequence is the same length as the
original PCR
product;
Figure 3 is a graphical representation of the results of TOGA analysis using a
5'
PCR primer with parsing bases CACC, showing PCR products produced from mRNA
extracted from the striatum/nucleus accumbens of mice treated with 7.5 mg/kg
of
clozapine for the following durations: control (no clozapine), 45 minutes, 7
hours, 5
days, 12 days, and 14 days, where the vertical index line indicates a PCR
product of
13
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
about 201 b.p. that is present in the control sample and increasingly enriched
over time in
the clozapine-treated samples;
Figure 4 shows a Northern Blot analysis of clone CLZ_5 (CACC 201), where an
agarose gel containing poly A enriched mRNA from the striatum/nucleus
accumbens of
mice treated with clozapine as well as size standards was blotted after
electrophoresis and
probed with radiolabelled CLZ 5. Mice were treated with clozapine (7.5 mg/kg)
for the
following time durations before mRNA extraction: control (no clozapine), 45
minutes, 7
hours, 5 days, 12 days, and 14 days;
Figure 5 shows a Northern Blot analysis of clone CLZ_5 (CACC 201), where an
agarose gel containing poly A enriched mRNA from the striatum/nucleus
accumbens of
mice treated with haloperidol as well as size standards was blotted after
electrophoresis
and probed with radiolabelled CLZ_5. Mice were treated with haloperidol (4
mg/kg) for
1 S the following time durations before mRNA extraction: control (no
haloperidol), 45
minutes, 7 hours, 10 days, and 14 days;
Figure 6 is a graphical representation comparing the results of the TOGA
analysis
of clone CLZ_5 shown in Fig. 3 and the Northern Blot analysis of clone CLZ 5
shown in
Figure 4;
Figure 7A-C is an in situ hybridization analysis using an antisense cRNA probe
directed against the 3' end of CLZ 5, showing the pattern of CLZ 5 mRNA
expression
in mouse anterior brain (7A), midbrain (7B), and posterior brain (7C), where
CLZ_5 is
expressed in scattered glial cells and white matter tracts;
Figure 8A-I is an in situ hybridization analyses, using an antisense cRNA
probe
directed against the 3' end of CLZ_5, showing CLZ_S mRNA expression in mouse
anterior brain (8A-C), midbrain (8D-F), and posterior brain (8G-I) in saline-
treated mice
(top row), mice treated with clozapine for 5 days (middle row), and mice
treated with
14
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
clozapine for 14 days (bottom row), where the clozapine treatment induces
expression in
the glial cells;
Figure 9A-H shows a darkfield photomicrograph of various brain regions,
including the corpus callosum (cc, Fig. 9A, E); caudate putamen (CPu, Fig. 9B,
F);
anterior commissure (aca, Fig. 9C, G); and globus pallidus (GP, Fig. 9D, H) in
control
(9A-D) and clozapine-treated (9E-H) animals;
Figure 1 OA-D shows a darkfield photomicrograph in the internal capsule (ic)
(10A, B) and a brightfield view of the optic tract (opt) (10C, D) from control
(10A, C)
and clozapine-treated (10B, D) animals;
Figure 11A-H shows GFAP and apoD co-localization in the striatum (11A, B, D,
E) and optic tract (11C, F) of control saline (11A, B, C) and clozapine-
treated animals
(11D, E, F), with thick arrows designating the co-localization of GFAP and
apoD mRNA
and thin arrows designating the expression of apoD only; 11 G-H shows apoD
immunohistochemistry with an anti-human apoD primary antibody (Novocastra,
Newcastle, UK) in the optic tract of control saline (11G) and clozapine-
treated animals
(11H).
Figure 12 shows a Northern Blot analysis of clone CLZ 5, where an agarose gel
containing poly A enriched mRNA from cultured glial cells treated with
clozapine as
well as size standards was blotted after electrophoresis and probed with
radiolabelled
CLZ 5. Cultured glial cells were treated with different concentrations of
clozapine for
different lengths of time before mRNA extraction as follows: A= control (no
clozapine),
B= 100 nM clozapine, 1 day, C= 1 p,M clozapine, 1 day, D= 100 nM clozapine, 1
week,
E= 1 pM clozapine, 1 week;
Figure 13 is a graphical representation of the results of TOGA analysis using
a 5'
PCR primer with parsing bases TTGT, showing PCR products produced from mRNA
extracted from the striatum/nucleus accumbens of mice treated with 7.5 mg/kg
clozapine
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
as follows: control (no clozapine), 45 minutes, 7 hours, 5 days, 12 days, and
14 days,
where the vertical index line indicates a PCR product of about 266 b.p. that
is present in
the control sample, is down-regulated within 45 minutes in the clozapine-
treated sample,
and remains down-regulated for 14 days in the presence of clozapine;
Figure 14 is a graphical representation of the results of TOGA analysis using
a S'
PCR primer with parsing bases TTGT, showing PCR products produced from mRNA
extracted from the brain of morphine-treated mice as follows: control striatum
(PS),
acutely treated striatum (AS), withdrawal striatum (WS), control amygdala
(PA), acutely
treated amygdala (AA), chronically treated amygdala (TA), and withdrawal
amygdala
(WA), where the vertical index line indicates a PCR product of about 266 b.p.
that is
more abundant in control striatum than control amygdala and is differentially
regulated
by morphine in striatum versus amygdala;
Figure 15 shows a Northern Blot analysis of clone CLZ 40 (TTGT 266), where
an agarose gel containing poly A enriched mRNA from the striatum/nucleus
accumbens
of clozapine-treated mice as well as size standards was blotted after
electrophoresis and
probed with radiolabelled CLZ 40. Mice were treated with clozapine (7.5 mg/kg)
for the
following time durations before mRNA extraction: control (no clozapine), 45
minutes, 7
hours, 5 days, 12 days, and 14 days;
Figure 16 is a graphical representation comparing the results of the TOGA
analysis of clone CLZ 40 shown in Fig. 13 and the Northern Blot analysis of
clone
CLZ 40 shown in Figure 15;
Figure 17A-B is an in situ hybridization analysis, showing clone CLZ 40 mRNA
expression in mouse brain using an antisense cRNA probe directed against the
3' end of
CLZ 40, where 17A shows expression in the nucleus accumbens (Acb) and pyriform
cortex (Pir) and 17B shows expression in the dentate gyrus (DG);
16
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
Figure 18 is a graphical representation of the results of TOGA analysis using
a S'
PCR primer with parsing bases TATT, showing PCR products produced from mRNA
extracted from the striatum/nucleus accumbens of mice treated with 7.5 mg/kg
clozapine
as follows: control (no clozapine), 45 minutes, 7 hours, 5 days, 12 days, and
14 days,
where the vertical index line indicates a PCR product of about 89 b.p. that is
present in
the control sample and is differentially regulated by clozapine treatment over
time.
Figure 19 shows the consensus sequence from the cluster of the following 4
sequences: AI415388: Soares mouse p3NMFI9.5 Mus musculus cDNA clone
IMAGE:350746 3', mRNA sequence; AI841003: UI-M-AMO-ado-e-04-0-ULsI
NIH BMAP MAM Mus musculus cDNA clone UI-M-AMO-ado-e-04-0-UI 3', mRNA
sequence; AI413353: Soares mouse embryo NbME13.5 14.5 Mus musculus cDNA
1MAGE:356159 3', mRNA sequence; AI425991: Soares mouse embryo NbME13.5 14.5
Mus musculus cDNA IMAGE:426077 3', mRNA sequence.
Figure 20 shows the sequence of the EST AF006196: Mus musculus
metalloprotease-disintegrin MDC 15 mRNA, complete cds.
Figure Z I shows the the consensus sequence from the cluster of the following
3
sequences: C86593: Mus musculus fertilized egg cDNA 3'-end sequence, clone
J0229E09 3', mRNA sequence; AI428410: Life Tech mouse embryo 13 Sdpc 10666014
Mus musculus cDNA clone IMAGE.:553802 3', mRNA sequence; AI561814: Stratagene
mouse skin (#937313) Mus musculus cDIvTA clone 1MAGE:1227449 3', mRNA
sequence.
Figure 22 is a graphical representation of a Northern Blot analysis of clone
CLZ 44 (ACGG 352), where an agarose gel containing poly A enriched mRNA from
the
striatum/nucleus accumbens of clozapine-treated mice as well as size standards
was
blotted after electrophoresis and probed with radiolabelled CLZ 44. Mice were
treated
with clozapine (7.5 mg/kg), haloperidol (4 mglkg), or ketanserin (4 mg/kg) for
two weeks
before mRNA extraction.
17
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
Figure 23 is a graphical representation of a Northern Blot analysis of clone
CLZ_38 (TGCA 109), where an agarose gel containing poly A enriched mRNA from
the
striatum/nucleus accumbens of clozapine-treated mice as well as size standards
was
blotted after electrophoresis and probed with radiolabelled CLZ 38. Mice were
treated
with clozapine (7.5 mg/kg) for the following time durations before mRNA
extraction:
control (no clozapine), 45 minutes, 7 hours, 5 days, 12 days, and 14 days;
Figure 24A-B is an in situ hybridization analysis using an antisense cRNA
probe
directed against the 3' end of CLZ_16, showing the pattern of CLZ_16 mRNA
expression in coronal sections through hemispheres in mouse brain. Figure 24A
shows
dense labelling in the cortex and surrounding the hippocampal formation as
well as
moderate labelling in the dorsal thalamus and posterior brain. Figure 24B
shows uniform
labelling throughout;
Figure 25A-B is an in situ hybridization analysis using an antisense cRNA
probe
directed against the 3' end of CLZ 17, showing the pattern of CLZ_17 mRNA
expression in a coronal section through the hemispheres (25A) and cross
section through
the midbrain (25B) in mouse brain;
Figure 26A-B is an in situ hybridization analysis using an antisense cRNA
probe
directed against the 3' end of CLZ 24, showing the pattern of CLZ 24 mRNA
expression in a coronal section through the hemispheres (26A) and cross
section through
the brainstem (26B) in mouse brain;
Figure 27A-B is an in situ hybridization analysis using an antisense cRNA
probe
directed against the 3' end of CLZ 26, showing the pattern of CLZ 26 mRNA
expression in a coronal section of the hemispheres at the level of hippocampal
formation
(27A) and coronal section of the hemispheres at the level of striatum (27B) in
mouse
brain;
18
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
Figure 28A-B is an in situ hybridization analysis using an antisense cRNA
probe
directed against the 3' end of CLZ 28, showing the pattern of CLZ_28 mRNA
expression in a coronal section through the hemispheres at the level of
hippocampus
(28A) and coronal section through the posterior region of hemispheres (28B) in
mouse
brain;
Figure 29A-B is an in situ hybridization analysis using an antisense cRNA
probe
directed against the 3' end of CLZ 3, showing the pattern of CLZ 3 mRNA
expression
in a coronal section through the hemispheres at level of hippocampus (29A) and
cross
section through midbrain (29B) in mouse brain;
Figure 30A-B is an in situ hybridization analysis using an antisense cRNA
probe
directed against the 3' end of CLZ 34, showing the pattern of CLZ_34 mRNA
expression in a coronal section through the hemispheres at the level of
hippocampus
(30A) and cross section through the midbrain (30B) in mouse brain;
Figure 31A-C is an in situ hybridization analysis using an antisense cRNA
probe
directed against the 3' end of CLZ_43, showing the pattern of CLZ 43 mRNA
expression in coronal sections of the hemispheres showing labelling in the
striatum
(31A), labelling in the cortex (31B), and intense labelling in the striatum
(31C) in mouse
brain;
Figure 32A-B is an in situ hybridization analysis using an antisense cRNA
probe
directed against the 3' end of CLZ 44, showing the pattern of CLZ 44 mRNA
expression in a coronal section showing labelling in the hippocampus,
hypothalamus, and
temporal cortex (32A) and coronal section showing cortical labelling (32B) in
mouse
brain;
Figure 33A-B is an in situ hybridization analysis using an antisense cRNA
probe
directed against the 3' end of CLZ 64, showing the pattern of CLZ_64 mRNA
expression in different coronal sections of the hemispheres in mouse brain.
19
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
Definitions
The following definitions are provided to facilitate understanding of certain
terms
used throughout this specification.
In the present invention, "isolated" refers to material removed from its
original
environment (e.g., the natural environment if it is naturally occurring), and
thus is altered
"by the hand of man" from its natural state. For example, an isolated
polynucleotide
could be part of a vector or a composition of matter, or could be contained
within a cell,
and still be "isolated" because that vector, composition of matter, or
particular cell is not
the original environment of the polynucleotide.
In the present invention, a "secreted" protein refers to those proteins
capable of
being directed to the ER, secretory vesicles, or the extracellular space as a
result of a
signal sequence, as well as those proteins released into the extracellular
space without
necessarily containing a signal sequence. If the secreted protein is released
into the
extracellular space, the secreted protein can undergo extracellular processing
to produce a
"mature" protein. Release into the extracellular space can occur by many
mechanisms,
including exocytosis and proteolytic cleavage.
As used herein, a "polynucleotide" refers to a molecule having a nucleic acid
sequence contained in SEQ ID NOs: 1-19; 49-52; 57-72 and 107. For example, the
polynucleotide can contain all or part of the nucleotide sequence of the full
length cDNA
sequence, including the 5' and 3' untranslated sequences, the coding region,
with or
without the signal sequence, the secreted protein coding region, as well as
fragments,
epitopes, domains, and variants of the nucleic acid sequence. Moreover, as
used herein, a
"polypeptide" refers to a molecule having the translated amino acid sequence
generated
from the polynucleotide as broadly defined.
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
A "polynucleotide" of the present invention also includes those
polynucleotides
capable of hybridizing, under stringent hybridization conditions, to sequences
contained
in SEQ ID NOs: 1-19; 49-52; 57-72 and 107, or the complement thereof, or the
cDNA.
"Stringent hybridization conditions" refers to an overnight incubation at
42° C in a
solution comprising 50% formamide, Sx SSC (750 mM NaCI, 75 mM sodium citrate),
50
mM sodium phosphate (pH 7.6), Sx Denhardt's solution, 10% dextran sulfate, and
20
~g/ml denatured, sheared salmon sperm DNA, followed by washing the filters in
O.lx
SSC at about 65°C.
Also contemplated are nucleic acid molecules that hybridize to the
polynucleotides of the present invention at lower stringency hybridization
conditions.
Changes in the stringency of hybridization and signal detection are primarily
accomplished through the manipulation of formamide concentration (lower
percentages
of formarnide result in lowered stringency); salt conditions, or temperature.
For example,
lower stringency conditions include an overnight incubation at 37°C in
a solution
comprising 6X SSPE (20X SSPE = 3M NaCI; 0.2M NaHzP04; 0.02M EDTA, pH 7.4),
0.5% SDS, 30% formamide, 100 ug/ml salmon sperm blocking DNA;
followed by washes at 50°C with 1XSSPE, 0.1% SDS. In addition, to
achieve even
lower stringency, washes performed following stringent hybridization can be
done at
higher salt concentrations (e.g. 5X SSC).
Note that variations in the above conditions may be accomplished through the
inclusion and/or substitution of alternate blocking reagents used to suppress
background
in hybridization experiments. Typical blocking reagents include Denhardt's
reagent,
BLOTTO, heparin, denatured salmon sperm DNA, and commercially available
proprietary formulations. The inclusion of specific blocking reagents may
require
modification of the hybridization conditions described above, due to problems
with
compatibility.
Of course, a polynucleotide which hybridizes only to polyA+ sequences (such as
any 3' terminal polyA+ tract of a cDNA shown in the sequence listing), or to a
21
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
complementary stretch of T (or I~ residues, would not be included in the
definition of
"polynucleotide," since such a polynucleotide would hybridize to any nucleic
acid
molecule containing a poly (A) stretch or the complement thereof (e.g.,
practically any
double-stranded cDNA clone).
A polynucleotide of the present invention can be composed of any
polyribonucleotide or polydeoxribonucleotide, which may be unmodified RNA or
DNA
or modified RNA or DNA. For example, polynucleotides can be composed of single-
and double-stranded DNA, DNA that is a mixture of single- and double-stranded
regions,
single- and double-stranded RNA, and RNA that is mixture of single- and double-
stranded regions, hybrid molecules comprising DNA and RNA that may be single-
stranded or, more typically, double-stranded or a mixture of single- and
double-stranded
regions. In addition, the polynucleotide can be composed of triple-stranded
regions
comprising RNA or DNA or both RNA and DNA. A polynucleotide may also contain
one or more modified bases or DNA or RNA backbones modified for stability or
for
other reasons. "Modified" bases include, for example, tritylated bases and
unusual bases
such as inosine. A variety of modifications can be made to DNA and RNA; thus,
"polynucleotide" embraces chemically, enzyrnatically, or metabolically
modified forms.
The polypeptide of the present invention can be composed of amino acids joined
to each other by peptide bonds or modified peptide bonds, i.e., peptide
isosteres, and may
contain amino acids other than the 20 gene-encoded amino acids. The
polypeptides may
be modified by either natural processes, such as posttranslational processing,
or by
chemical modification techniques which are well known in the art. Such
modifications
are well described in basic texts and in more detailed monographs, as well as
in a
voluminous research literature. Modifications can occur anywhere in a
polypeptide,
including the peptide backbone, the amino acid side-chains and the amino or
carboxyl
termini. It will be appreciated that the same type of modification may be
present in the
same or varying degrees at several sites in a given polypeptide. Alsa, a given
polypeptide may contain many types of modifications. Polypeptides may be
branched,
for example, as a result of ubiquitination, and they may be cyclic, with or
without
22
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
branching. Cyclic, branched, and branched cyclic polypeptides may result from
posttranslation natural processes or may be made by synthetic methods.
Modifications
include acetylation, acylation, ADP-ribosylation, amidation, covalent
attachment of
flavin, covalent attachment of a heme moiety, covalent attachment of a
nucleotide or
nucleotide derivative, covalent attachment of a lipid or lipid derivative,
covalent
attachment of phosphotidylinositol, cross-linking, cyclization, disulfide bond
formation,
demethylation, formation of covalent cross-links, formation of cysteine,
formation of
pyroglutamate, formulation, gamma-carboxylation, glycosylation, GPI anchor
formation,
hydroxylation, iodination, methylation, myristoylation, oxidation, pegylation,
proteolytic
processing, phosphorylation, prenylation, racemization, selenoylation,
sulfation, transfer-
RNA mediated addition of amino acids to proteins such as arginylation, and
ubiquitination. (See, e.g., T. E. Creighton, Proteins - Structure And
Molecular
Properties, 2nd Ed., W. H. Freeman and Company, New York (1993); B. C.
Johnson,
Ed., Posttranslational Covalent Modification Of Proteins, Academic Press, New
York,
pgs. 1-12 (1983); Seifter et al., Meth. Enzymol, 182:626-646 (1990); Rattan et
al., Ann.
N. Y. Acad. Sci. 663:48-62 (1992)).
"A polypeptide having biological activity" refers to polypeptides exhibiting
activity similar, but not necessarily identical to, an activity of a
polypeptide of the present
invention, including mature forms, as measured in a particular biological
assay, with or
without dose dependency. In the case where dose dependency does exist, it need
not be
identical to that of the polypeptide, but rather substantially similar to the
dose-
dependence in a given activity as compared to the polypeptide of the present
invention
(i.e., the candidate polypeptide will exhibit greater activity or not more
than about 25-fold
less and, preferably, not more than about tenfold less activity, and most
preferably, not
more than about three-fold less activity relative to the polypeptide of the
present
invention).
The translated amino acid sequence, beginning with the methionine, is
identified
although other reading frames can also be easily translated using known
molecular
23
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
biology techniques. The polypeptides produced by the translation of these
alternative
open reading frames are specifically contemplated by the present invention.
SEQ ID NOs: 1-19; 49-52; 57-72 and 107 and the translations of SEQ ID NOs: 1-
19; 49-52; 57-72 and 107 are sufficiently accurate and otherwise suitable for
a variety of
uses well known in the art and described further below. These probes will also
hybridize
to nucleic acid molecules in biological samples, thereby enabling a variety of
forensic
and diagnostic methods of the invention. Similarly, polypeptides identified
from the
translations of SEQ ID NOs: 1-19; 49-52; 57-72 and 107 may be used to generate
antibodies which bind specifically to the secreted proteins encoded by the
cDNA clones
identified.
Nevertheless, DNA sequences generated by sequencing reactions can contain
sequencing errors. The errors exist as misidentified nucleotides, or as
insertions or
deletions of nucleotides in the generated DNA sequence. The erroneously
inserted or
deleted nucleotides cause frame shifts in the reading frames of the predicted
amino acid
sequence. In these cases, the predicted amino acid sequence diverges from the
actual
amino acid sequence, even though the generated DNA sequence may be greater
than
99.9% identical to the actual DNA sequence (for example, one base insertion or
deletion
in an open reading frame of over 1000 bases).
The present invention also relates to the genes corresponding to SEQ ID NOs: 1-
19; 49-52; 57-72 and 107, and translations of SEQ ID NOs: 1-19; 49-52; 57-72
and 107.
The corresponding gene can be isolated in accordance with known methods using
the
sequence information disclosed herein. Such methods include preparing probes
or
primers from the disclosed sequence and identifying or amplifying the
corresponding
gene from appropriate sources of genomic material.
Also provided in the present invention are species homologues. Species
homologues may be isolated and identified by making suitable probes or primers
from
the sequences provided herein and screening a suitable nucleic acid source for
the desired
homologue.
24
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
The polypeptides of the invention can be prepared in any suitable maser. Such
polypeptides include isolated naturally occurring polypeptides, recombinantly
produced
polypeptides, synthetically produced polypeptides, or polypeptides produced by
a
combination of these methods. Means for preparing such polypeptides are well
understood in the art.
The polypeptides may be in the form of the secreted protein, including the
mature
form, or may be a part of a larger protein, such as a fusion protein (see
below). It is often
advantageous to include an additional amino acid sequence which contains
secretory or
leader sequences, pro-sequences, sequences which aid in purification, such as
multiple
histidine residues, or an additional sequence for stability during recombinant
production.
The polypeptides of the present invention are preferably provided in an
isolated
form, and preferably are substantially purified. A recombinantly produced
version of a
polypeptide, including the secreted polypeptide, can be substantially purified
by the one-
step method described in Smith and Johnson, Gene 67:31-40 (1988). Polypeptides
of the
invention also can be purified from natural or recombinant sources using
antibodies of
the invention raised against the secreted protein in methods which are well
known in the
art.
Signal Sequences
Methods for predicting whether a protein has a signal sequence, as well as the
cleavage point for that sequence, are available. For instance, the method of
McGeoch
uses the information from a short N~-terminal charged region and a subsequent
uncharged
region of the complete (uncleaved) protein (Virus Res., 3:271-286 (1985)). The
method
of von Heinje uses the information from the residues surrounding the cleavage
site,
typically residues -13 to +2, where +1 indicates the amino terminus of the
secreted
protein (Nucleic Acids Res., 14:4683-4690 (1986)). Therefore, from a deduced
amino
acid sequence, a signal sequence and mature sequence can be identified.
In the present case, the deduced amino acid sequence of the secreted
polypeptide
was analyzed by a computer program called Signal P (Nielsen et al., Protein
Engineering,
10:1-6 (1997), which predicts the cellular location of a protein based on the
amino acid
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
sequence. As part of this computational prediction of localization, the
methods of
McGeoch and von Heinje are incorporated.
As one of ordinary skill would appreciate, however, cleavage sites sometimes
vary from organism to organism and cannot be predicted with absolute
certainty.
Accordingly, the present invention provides secreted polypeptides having a
sequence
corresponding to the translations of SEQ. ID NOs: 1-19 which have an N-
terminus
beginning within 5 residues (i.e., + or - 5 residues) of the predicted
cleavage point.
Similarly, it is also recognized that in some cases, cleavage of the signal
sequence from a
secreted protein is not entirely uniform, resulting in more than one secreted
species.
These polypeptides, and the polynucleotides encoding such polypeptides, are
contemplated by the present invention.
Moreover, the signal sequence identified by the above analysis may not
necessarily predict the naturally occurring signal sequence. For example, the
naturally
occurnng signal sequence may be further upstream from the predicted signal
sequence.
However, it is likely that the predicted signal sequence will be capable of
directing the
secreted protein to the ER. These polypeptides, and the polynucleotides
encoding such
polypeptides, are contemplated by the present invention.
Polynucleotide and Polypeptide Variants
"Variant" refers to a polynucleotide or polypeptide differing from the
polynucleotide or polypeptide of the present invention, but retaining
essential properties
thereof. Generally, variants are overall closely similar, and, in many
regions, identical to
the polynucleotide or polypeptide of the present invention.
"Identity" per se has an art-recognized meaning and can be calculated using
published techniques. (See, e.g., Lesk, A.M., Ed., Computational Molecular
Biology,
Oxford University Press, New York, (1988); Smith, D.W., Ed, Biocomputing:
Informatics And Genome Projects, Academic Press, New York, (1993); Griffin,
A.M.,
and Griffin, H.G., Eds., Computer Analysis Of Sequence Data, Part I, Humana
Press,
New Jersey, (1994); von Heinje, G., Sequence Analysis In Molecular Biology,
Academic
26
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
Press, (1987); and Gribskov, M. and Devereux, J., Eds., Sequence Analysis
Primer, M
Stockton Press, New York, (1991 )). While there exists a number of methods to
measure
identity between two polynucleotide or polypeptide sequences, the term
"identity" is well
known to skilled artisans. (See, e.g., Carillo, H., and Lipton, D., SIAM.I.
Applied Math.,
48:1073 (1988)). Methods commonly employed to determine identity or similarity
between two sequences include, but are not limited to, those disclosed in
Martin J.
Bishop, ed., "Guide to Huge Computers," Academic Press, San Diego, (1994), and
Carillo, H., and Lipton, D., SIAM J. Applied Math, 48:1073 (1988)). Methods
for
aligning polynucleotides or polypeptides are codified in computer programs,
including
the GCG program package (Devereux, J., et al., Nuc. Acids Res. 12(1):387
(1984)),
BLASTP, BLASTN, FASTA (Atschul, S.F. et al., J. Molec. Biol., 215:403 (1990),
Bestfit program (Wisconsin Sequence Analysis Package, Version 8 for Unix,
Genetics
Computer Group, University Research Park, 575 Science Drive, Madison, WI 53711
(using the local homology algorithm of Smith and Waterman, Advances in Applied
Mathematics 2:482-489 (1981)).
When using any of the sequence alignment programs to determine whether a
particular sequence is, for instance, 95% identical to a reference sequence,
the parameters
are set so that the percentage of identity is calculated over the full length
of the reference
polynucleotide and that gaps in identity of up to 5% of the total number of
nucleotides in
the reference polynucleotide are allowed.
A preferred method for determining the best overall match between a query
sequence (a sequence of the present invention) and a subject sequence, also
referred to as
a global sequence alignment, can be determined using the FASTDB computer
program
based on the algorithm of Brutlag et al. (Comp. App. Biosci., 6:237-245
(1990)) The
term "sequence" includes nucleotide and amino acid sequences. In a sequence
alignment
the query and subject sequences are either both nucleotide sequences or both
amino acid
sequences. The result of said global sequence alignment is in percent
identity. Preferred
parameters used in a FASTDB search of a DNA sequence to calculate percent
identity
are: Matrix=Unitary, k-tuple=4, Mismatch Penalty=l, Joining Penalty=30,
Randomization
Group Length=0, and Cutoff Score=1, Gap Penalty=5, Gap Size Penalty 0.05, and
Window Size=500 or query sequence length in nucleotide bases, whichever is
shorter.
27
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
Preferred parameters employed to calculate percent identity and similarity of
an amino
acid alignment are: Matrix=PAM 150, k-tuple=2, Mismatch Penalty=1, Joining
Penalty=20, Randomization Group Length=0, Cutoff Score=1, Gap Penalty=5, Gap
Size
Penalty=0.05, and Window Size=500 or query sequence length in amino acid
residues,
whichever is shorter.
As an illustration, a polynucleotide having a nucleotide sequence of at least
95%
"identity" to a sequence contained in SEQ ID NOs: 1-19; 49-52; 57-72 and 107
means
that the polynucleotide is identical to a sequence contained in SEQ ID NOs: 1-
19; 49-52;
57-72 and 107 or the cDNA except that the polynucleotide sequence may include
up to
five point mutations per each 100 nucleotides of the total length (not just
within a given
100 nucleotide stretch). In other words, to obtain a polynucleotide having a
nucleotide
sequence at least 95% identical to SEQ ID NOs: 1-19; 49-52; 57-72 and 107, up
to 5% of
the nucleotides in the sequence contained in SEQ ID NOs: 1-19; 49-52; 57-72
and 107 or
the cDNA can be deleted, inserted, or substituted with other nucleotides.
These changes
may occur anywhere throughout the polynucleotide.
Further embodiments of the present invention include polynucleotides having at
least 80% identity, more preferably at least 90% identity, and most preferably
at least
95%, 96%, 97%, 98% or 99% identity to a sequence contained in SEQ ID NOs: 1-
19; 49-
52; 57-72 and 107. Of course, due to the degeneracy of the genetic code, one
of ordinary
skill in the art will immediately recognize that a large number of the
polynucleotides
having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity will encode a
polypeptide identical to an amino acid sequence contained in the translations
of SEQ ID
NOs: 1-19; 49-52; 57-72 and 107.
Similarly, by a polypeptide having an amino acid sequence having at least, for
example, 95% "identity" to a reference polypeptide, is intended that the amino
acid
sequence of the polypeptide is identical to the reference polypeptide except
that the
polypeptide sequence may include up to five amino acid alterations per each
100 amino
acids of the total length of the reference polypeptide. In other words, to
obtain a
polypeptide having an amino acid sequence at least 95% identical to a
reference amino
acid sequence, up to 5% of the amino acid residues in the reference sequence
may be
28
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
deleted or substituted with another amino acid, or a number of amino acids up
to 5% of
the total amino acid residues in the reference sequence may be inserted into
the reference
sequence. These alterations of the reference sequence may occur at the amino
or carboxy
terminal positions of the reference amino acid sequence or anywhere between
those
terminal positions, interspersed either individually among residues in the
reference
sequence or in one or more contiguous groups within the reference sequence.
Further embodiments of the present invention include polypeptides having at
least
80% identity, more preferably at least 85% identity, more preferably at least
90%
identity, and most preferably at least 95%, 96%, 97%, 98% or 99% identity to
an amino
acid sequence contained in translations of SEQ ID NOs: 1-19; 49-52; 57-72 and
107.
Preferably, the above polypeptides should exhibit at least one biological
activity of the
protein.
In a preferred embodiment, polypeptides of the present invention include
polypeptides having at least 90% similarity, more preferably at least 95%
similarity, and
still more preferably at least 96%, 97%, 98%, or 99% similarity to an amino
acid
sequence contained in translations of SEQ ID NOs: 1-19; 49-52; 57-72 and 107.
The variants may contain alterations in the coding regions, non-coding
regions, or
both. Especially preferred are polynucleotide variants containing alterations
which
produce silent substitutions, additions, or deletions, but do not alter the
properties or
activities of the encoded polypeptide. Nucleotide variants produced by silent
substitutions due to the degeneracy of the genetic code are preferred.
Moreover, variants
in which 5-10, 1-5, or 1-2 amino acids are substituted, deleted, or added in
any
combination are also preferred. Polynucleotide variants can be produced for a
variety of
reasons. For instance, a polynucleotide vaxiant may be produced to optimize
codon
expression for a particular host, i.e., codons in the human mRNA may be
changed to
those preferred by a bacterial host such as E. coli).
Naturally occurnng variants are called "allelic variants," and refer to one of
several alternate forms of a gene occupying a given locus on a chromosome of
an
organism (Lewin, B., Ed., Genes II, Tohn Wiley & Sons, New York (1985)). These
29
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
allelic variants can vary at either the polynucleotide and/or polypeptide
level.
Alternatively, non-naturally occurring variants may be produced by mutagenesis
techniques or by direct synthesis.
S Using known methods of protein engineering and recombinant DNA technology,
variants may be generated to improve or alter the characteristics of the
polypeptides of
the present invention. For instance, one or more amino acids can be deleted
from the N-
terminus or C-terminus of the secreted protein without substantial loss of
biological
function. Ron et al., reported variant KGF proteins having heparin binding
activity even
after deleting 3, 8, or 27 amino-terminal amino acid residues (J. Biol. Chem.,
268: 2984-
2988 (1993)). Similarly, interferon gamma exhibited up to ten times higher
activity after
deleting 8-10 amino acid residues from the carboxy terminus of this protein
(Dobeli et al.,
J. Biotechnology, 7:199-216 (1988)).
1 S Moreover, ample evidence demonstrates that variants often retain a
biological
activity similar to that of the naturally occurring protein. For example,
Gayle et al.,
conducted extensive mutational analysis of human cytokine IL-1 a (J. Biol.
Chem.,
268:22105-22111 (1993)). They used random mutagenesis to generate over 3,500
individual IL-1 a mutants that averaged 2.S amino acid changes per variant
over the
entire length of the molecule. Multiple mutations were examined at every
possible amino
acid position. The investigators concluded that "[m]ost of the molecule could
be altered
with little effect on either [binding or biological activity]." (See Gayle et
al., (1993),
Abstract.) In fact, only 23 unique amino acid sequences, out of more than
3,500
nucleotide sequences examined, produced a protein that significantly differed
in activity
2S from wild-type.
Furthermore, even if deleting one or more amino acids from the N-terminus or C-
terminus of a polypeptide results in modification or loss of one or more
biological
functions, other biological activities may still be retained. For example, the
ability of a
deletion variant to induce and/or to bind antibodies which recognize the
secreted form
will likely be retained when less than the majority of the residues of the
secreted form are
removed from the N-terminus or C-terminus. Whether a particular polypeptide
lacking
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
N- or C-terminal residues of a protein retains such immunogenic activities can
readily be
determined by routine methods described herein and otherwise known in the art.
Thus, the invention further includes polypeptide variants which show
substantial
biological activity. Such variants include deletions, insertions, inversions,
repeats, and
substitutions selected according to general rules known in the art so as have
little effect
on activity. For example, guidance concerning how to make phenotypically
silent amino
acid substitutions is provided in Bowie, et al., Science, 247:1306-1310
(1990), wherein
the authors indicate that there are two main strategies for studying the
tolerance of an
amino acid sequence to change.
The first strategy exploits the tolerance of amino acid substitutions by
natural
selection during the process of evolution. By comparing amino acid sequences
in
different species, conserved amino acids can be identified. These conserved
amino acids
1 S are likely important for protein function. In contrast, the amino acid
positions where
substitutions have been tolerated by natural selection indicates that these
positions are not
critical for protein function. Thus, positions tolerating amino acid
substitution could be
modified while still maintaining biological activity of the protein.
The second strategy uses genetic engineering to introduce amino acid changes
at
specific positions of a cloned gene to identify regions critical for protein
function. For
example, site directed mutagenesis or alanine-scanning mutagenesis (the
introduction of
single alanine mutations at every residue in the molecule) can be used
(Cunningham and
Wells, Science, 244:1081-1085 (1989)). The resulting mutant molecules can then
be
tested for biological activity.
According to Bowie et al., these two strategies have revealed that proteins
are
surprisingly tolerant of amino acid substitutions. The authors further
indicate which
amino acid changes are likely to be permissive at certain amino acid positions
in the
protein. For example, most buried (within the tertiary structure of the
protein) amino acid
residues require nonpolar side chains, whereas few features of surface side
chains are
generally conserved. Moreover, tolerated conservative amino acid substitutions
involve
replacement of the aliphatic or hydrophobic amino acids Ala, Val, Leu and Ile;
31
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
replacement of the hydroxyl residues Ser and Thr; replacement of the acidic
residues Asp
and Glu; replacement of the amide residues Asn and Gln, replacement of the
basic
residues Lys, Arg, and His; replacement of the aromatic residues Phe, Tyr, and
Trp; and
replacement of the small-sized amino acids Ala, Ser, Thr, Met, and Gly.
Besides conservative amino acid substitution, variants of the present
invention
include (i) substitutions with one or more of the non-conserved amino acid
residues,
where the substituted amino acid residues may or may not be one encoded by the
genetic
code, or (ii) substitution with one or more of amino acid residues having a
substituent
group, or (iii) fusion of the mature polypeptide with another compound, such
as a
compound to increase the stability and/or solubility of the polypeptide (for
example,
polyethylene glycol), or (iv) fusion of the polypeptide with additional amino
acids, such
as an IgG Fc fusion region peptide, or leader or secretory sequence, or a
sequence
facilitating purification. Such variant polypeptides are deemed to be within
the scope of
those skilled in the art from the teachings herein.
For example, polypeptide variants containing amino acid substitutions of
charged
amino acids with other charged or neutral amino acids may produce proteins
with
improved characteristics, such as decreased aggregation. As known, aggregation
of
pharmaceutical formulations both reduces activity and increases clearance due
to the
aggregate's immunogenic activity (see, e.g., Pinckard et al., Clin. Exp.
Immunol., 2:331-
340 (1967); Robbins et al., Diabetes, 36: 838-845 (1987); Cleland et al.,
Crit. Rev.
Therapeutic Drug Carrier Systems, 10:307-377 (1993)).
Polynucleotide and Polypeptide Fragments
In the present invention, a "polynucleotide fragment" refers to a short
polynucleotide having a nucleic acid sequence contained in that shown in SEQ
ID NOs:
1-19; 49-52; 57-72 and 107. The short nucleotide fragments are preferably at
least about
15 nt, and more preferably at least about 20 nt, still more preferably at
least about 30 nt,
and even more preferably, at least about 40 nt in length. A fragment "at least
20 nt in
length," for example, is intended to include 20 or more contiguous bases from
the cDNA
sequence contained in that shown in SEQ ID NOs: 1-19; 49-52; 57-72 and 107.
These
32
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
nucleotide fragments are useful as diagnostic probes and primers as discussed
herein. Of
course, larger fragments (e.g., S0, 150, and more nucleotides) are preferred.
Moreover, representative examples of polynucleotide fragments of the
invention,
include, for example, fragments having a sequence from about nucleotide number
1-50,
51-100, 101-150, 151-200, 201-250, 251-300, 301-350, 351-400, 401-450, to the
end of
SEQ ID NOs: 1-19; 49-52; 57-72 and 107. In this context "about" includes the
particularly recited ranges, larger or smaller by several (5, 4, 3, 2, or 1)
nucleotides, at
either terminus or at both termini. Preferably, these fragments encode a
polypeptide
which has biological activity.
In the present invention, a "polypeptide fragment" refers to a short amino
acid
sequence contained in the translations of SEQ ID NOs: 1-19; 49-52; 57-72 and
107.
Protein fragments may be "free-standing," or comprised within a larger
polypeptide of
which the fragment forms a part or region, most preferably as a single
continuous region.
Representative examples of polypeptide fragments of the invention, include,
for example,
fragments from about amino acid number 1-20, 21-40, 41-60, or 61 to the end of
the
coding region. Moreover, polypeptide fragments can be about 20, 30, 40, 50 or
60,
amino acids in length. In this context "about" includes the particularly
recited ranges,
larger or smaller by several (5, 4, 3, 2, or 1) amino acids, at either extreme
or at both
extremes.
Preferred polypeptide fragments include the secreted protein as well as the
mature
form. Further preferred polypeptide fragments include the secreted protein or
the mature
form having a continuous series of deleted residues from the amino or the
carboxy
terminus, or bath. For example, any number of amino acids, ranging from 1-60,
can be
deleted from the amino terminus of either the secreted polypeptide or the
mature form.
Similarly, any number of amino acids, ranging from 1-30, can be deleted from
the
carboxy terminus of the secreted protein or mature form. Furthermore, any
combination
of the above amino and carboxy terminus deletions are preferred. Similarly,
polynucleotide fragments encoding these polypeptide fragments are also
preferred.
33
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
Also preferred are polypeptide and polynucleotide fragments characterized by
structural or functional domains, such as fragments that comprise alpha-helix
and alpha-
helix forming regions, beta-sheet and beta-sheet-forming regions, turn and
turn-forming
regions, coil and coil-forming regions, hydrophilic regions, hydrophobic
regions, alpha
amphipathic regions, beta amphipathic regions, flexible regions, surface-
forming regions,
substrate binding region, and high antigenic index regions. Polypeptide
fragments of the
translations of SEQ ID NOs: 1-19; 49-52; 57-72 and 107 falling within
conserved
domains are specifically contemplated by the present invention. Moreover,
polynucleotide fragments encoding these domains are also contemplated.
Other preferred fragments are biologically active fragments. Biologically
active
fragments are those exhibiting activity similar, but not necessarily
identical, to an activity
of the polypeptide of the present invention. The biological activity of the
fragments may
include an improved desired activity, or a decreased undesirable activity.
Epitopes & Antibodies
In the present invention, "epitopes" refer to polypeptide fragments having
antigenic or immunogenic activity in an animal, especially in a human. A
preferred
embodiment of the present invention relates to a polypeptide fragment
comprising an
epitope, as well as the polynucleotide encoding this fragment. A region of a
protein
molecule to which an antibody can bind is defined as an "antigenic epitope."
In contrast,
an "immunogenic epitope" is defined as a part of a protein that elicits an
antibody
response (see, e.g., Geysen et al., Proc. Natl. Acad. Sci. USA, 81:3998-4002
(1983)).
Fragments which function as epitopes may be produced by any conventional
means (see, e.g., Houghten, R. A., Proc. Natl. Acad. Sci. USA, 82:5131-5135
(1985),
further described in U.S. Patent No. 4,631,211).
In the present invention, antigenic epitopes preferably contain a sequence of
at
least seven, more preferably at least nine, and most preferably between about
15 to about
30 amino acids. Antigenic epitopes are useful to raise antibodies, including
monoclonal
antibodies, that specifically bind the epitope. (See, for instance, Wilson et
al., Cell,
37:767-778 (1984); Sutcliffe, J. G. et al., Science, 219:660-666 (1983)).
34
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
Similarly, immunogenic epitopes can be used to induce antibodies according to
methods well known in the art. (See, e.g., Sutcliffe et al., supra; Wilson et
al., supra;
Chow, M. et al., Proc. Natl. Acad. Sci., USA 82:910-914; and Bittle, F. J, et
al., J. Gen.
virol., 66:2347-2354 (1985)). A preferred immunogenic epitope includes the
secreted
protein. The immunogenic epitopes may be presented together with a carrier
protein,
such as an albumin, to an animal system (such as rabbit or mouse) or, if it is
long enough
(at least about 25 amino acids), without a carrier. However, immunogenic
epitopes
comprising as few as 8 to 10 amino acids have been shown to be sufficient to
raise
antibodies capable of binding to, at the very least, linear epitopes in a
denatured
polypeptide (e.g., in Western blotting.)
As used herein, the term "antibody" (Ab) or "monoclonal antibody" (Mab) is
meant to include intact molecules as well as antibody fragments (such as, for
example,
1 S Fab and F(ab')2 fragments) which are capable of specifically binding to
protein. Fab and
F(ab')2 fragments lack the Fc fragment of intact antibody, clear more rapidly
from the
circulation, and may have less non-specific tissue binding than an intact
antibody (Wahl
et al., J. Nucl. Med., 24:316-325 (1983)). Thus, these fragments are
preferred, as well as
the products of a FAB or other immunoglobulin expression library. Moreover,
antibodies
of the present invention include chimeric, single chain, and humanized
antibodies.
Additional embodiments include chimeric antibodies, e.g., humanized versions
of
marine monoclonal antibodies. Such humanized antibodies may be prepared by
known
techniques, and offer the advantage of reduced immunogenicity when the
antibodies are
administered to humans. In one embodiment, a humanized monoclonal antibody
comprises the variable region of a marine antibody (or just the antigen
binding site
thereof) and a constant region derived from a human antibody. Alternatively, a
humanized antibody fragment may comprise the antigen binding site of a marine
monoclonal antibody and a variable region fragment (lacking the antigen-
binding site)
derived from a human antibody. Procedures for the production of chimeric and
further
engineered monoclonal antibodies include those described in Riechmann et al.
(Nature,
332:323, 1988), Liu et al. (PNAS, 84:3439, 1987), Larrick et al.
(BiolTechnology, 7:934,
1989), and Winter and Harris (TIPS, 14:139, May, 1993).
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
One method for producing a human antibody comprises immunizing a non-human
animal, such as a transgenic mouse, with a polypeptide translated from a
nucleotide
sequence chosen from SEQ ID NOs: 1-19; 49-52; 57-72 and 107, whereby
antibodies
directed against the polypeptide translated from a nucleotide sequence chosen
from SEQ
ID NOs: 1-19; 49-52; 57-72 and 107 are generated in said animal. Procedures
have been
developed for generating human antibodies in non-human animals. The antibodies
may
be partially human, or preferably completely human. Non-human animals (such as
transgenic mice) into which genetic material encoding one or more human
immunoglobulin chains has been introduced may be employed. Such transgenic
mice
may be genetically altered in a variety of ways. The genetic manipulation may
result in
human immunoglobulin polypeptide chains replacing endogenous immunoglobulin
chains in at least some (preferably virtually all) antibodies produced by the
animal upon
immunization. Antibodies produced by immunizing transgenic animals with a
polypeptide translated from a nucleotide sequence chosen from SEQ ID NOs: 1-
19; 49-
52; 57-72 and 107 are provided herein.
Mice in which one or more endogenous immunoglobulin genes are inactivated by
various means have been prepared. Human immunoglobulin genes have been
introduced
into the mice to replace the inactivated mouse genes. Antibodies produced in
the animals
incorporate human immunoglobulin polypeptide chains encoded by the human
genetic
material introduced into the animal. Examples of techniques for production and
use of
such transgenic animals are described in U.S. Patent Nos. 5,814,318;
5,569,825; and
5,545,806, which are incorporated by reference herein.
Monoclonal antibodies may be produced by conventional procedures, e.g., by
immortalizing spleen cells harvested from the transgenic animal after
completion of the
immunization schedule. The spleen cells may be fused with myeloma cells to
produce
hybridomas by conventional procedures.
36
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
A method for producing a hybridoma cell line comprises immunizing such a
transgenic animal with an immunogen comprising at least seven contiguous amino
acid
residues of a polypeptide translated from a nucleotide sequence chosen from
SEQ ID
NOs: 1-19; 49-52; 57-72 and 107; harvesting spleen cells from the immunized
animal;
fusing the harvested spleen cells to a myeloma cell line, thereby generating
hybridoma
cells; and identifying a hybridoma cell line that produces a monoclonal
antibody that
binds a polypeptide translated from a nucleotide sequence chosen from SEQ ID
NOs: 1-
19; 49-52; 57-72 and 107. Such hybridoma cell lines, and mosclonal antibodies
produced
therefrom, are encompassed by the present invention. Monoclonal antibodies
secreted by
the hybridoma cell line are purified by conventional techniques.
Antibodies may be employed in an in vitro procedure, or administered in vivo
to
inhibit biological activity induced by a polypeptide translated from a
nucleotide sequence
chosen from SEQ ID NOs: 1-19; 49-52; 57-72 and 107. Disorders caused or
exacerbated
(directly or indirectly) by the interaction of such polypeptides of the
present invention
with cell surface receptors thus may be treated. A therapeutic method involves
in vivo
administration of a blocking antibody to a mammal in an amount effective for
reducing a
biological activity induced by a polypeptide translated from a nucleotide
sequence chosen
from SEQ ID NOs: 1-19; 49-52; 57-72 and 107. For example, chronic
administration of
neuroleptics can cause unwanted side effects. Administration of an antibody
derived
from the identified polynucleotides might block the signaling that causes
these side
effects. Alternatively, an antibody derived from the identified
polynucleotides might
selectively block proteins causing motor side effects.
Also provided herein are conjugates comprising a detectable (e.g., diagnostic)
or
therapeutic agent, attached to an antibody directed against a polypeptide
translated from a
nucleotide sequence chosen from SEQ ID NOs: 1-19; 49-52; 57-72 and 107.
Examples
of such agents are well known, and include but are not limited to diagnostic
radionuclides, therapeutic radionuclides, and cytotoxic drugs. The conjugates
find use in
in vitro or in vivo procedures.
37
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
Fusion Proteins
Any polypeptide of the present invention can be used to generate fusion
proteins.
For example, the polypeptide of the present invention, when fused to a second
protein,
can be used as an antigenic tag. Antibodies raised against the polypeptide of
the present
invention can be used to indirectly detect the second protein by binding to
the
polypeptide. Moreover, because secreted proteins target cellular locations
based on
trafficking signals, the polypeptides of the present invention can be used as
targeting
molecules once fused to other proteins.
Examples of domains that can be fused to polypeptides of the present invention
include not only heterologous signal sequences, but also other heterologous
functional
regions. The fusion does not necessarily need to be direct, but may occur
through linker
sequences.
Moreover, fusion proteins may also be engineered to improve characteristics of
the polypeptide of the present invention. For instance, a region of additional
amino acids,
particularly charged amino acids, may be added to the N-terminus of the
polypeptide to
improve stability and persistence during purification from the host cell or
subsequent
handling and storage. Also, peptide moieties may be added to the polypeptide
to
facilitate purification. Such regions may be removed prior to final
preparation of the
polypeptide. The addition of peptide moieties to facilitate handling of
polypeptides are
familiar and routine techniques in the art.
In addition, polypeptides of the present invention, including fragments, and
specifically epitopes, can be combined with parts of the constant domain of
immunoglobulins (IgG), resulting in chimeric polypeptides. These fusion
proteins
facilitate purification and show an increased half life in vivo. One reported
example
describes chimeric proteins consisting of the first two domains of the human
CD4-
polypeptide and various domains of the constant regions of the heavy or light
chains of
mammalian immunoglobulins (see, EP A 394,827; Traunecker et al., Nature,
331:84-86
(1988)). Fusion proteins having disulfide-linked dimeric structures (due to
the IgG) can
also be more efficient in binding and neutralizing other molecules, than the
monomeric
38
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
secreted protein or protein fragment alone (Fountoulakis et al., J. Biochem.
270:3958-
3964 (1995)).
Similarly, EP-A-0 464 533 (Canadian counterpart 2045869) discloses fusion
proteins comprising various portions of constant region of immunoglobulin
molecules
together with another human protein or part thereof. In many cases, the Fc
part in a
fusion protein is beneficial in therapy and diagnosis, and thus can result in,
for example,
improved pharmacokinetic properties (see, e.g., EP-A 0 232 262.)
Alternatively, deleting
the Fc part after the fusion protein has been expressed, detected, and
purified, would be
desired. For example, the Fc portion may hinder therapy and diagnosis if the
fusion
protein is used as an antigen for immunizations. In drug discovery, for
example, human
proteins, such as hIL-S, have been fused with Fc portions for the purpose of
high-
throughput screening assays to identify antagonists of hIL-5 (see, D. Bennett
et al., .I.
Molecular Recognition, 8:52-58 (1995); K. Johanson et al., J. Biol. Chem.,
270:9459-
9471 (1995)).
Moreover, the polypeptides of the present invention can be fused to marker
sequences, such as a peptide which facilitates purification of the fused
polypeptide. In
preferred embodiments, the marker amino acid sequence is a hexa-histidine
peptide, such
as the tag provided in a pQE vector (QIAGEN, Inc., 9259 Eton Avenue,
Chatsworth, CA,
91311), among others, many of which are commercially available. As described
in Gentz
et al, for instance, hexa-histidine provides for convenient purification of
the fusion
protein (Proc. Natl. Acad. Sci. USA, 86:821-824 (1989)). Another peptide tag
useful
for purification, the "HA" tag, corresponds to an epitope derived from the
influenza
hemagglutinin protein (Wilson et al., Cell, 37:767 (1984)). Other fusion
proteins may
use the ability of the polypeptides of the present invention to target the
delivery of a
biologically active peptide. This might include focused delivery of a toxin to
tumor cells,
or a growth factor to stem cells.
Thus, any of these above fusions can be engineered using the polynucleotides
or the polypeptides of the present invention.
39
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
Vectors, Host Cells, and Protein Production
The present invention also relates to vectors containing the polynucleotide of
the
present invention, host cells, and the production of polypeptides by
recombinant
techniques. The vector may be, for example, a phage, plasmid, viral, or
retroviral vector.
Retroviral vectors may be replication competent or replication defective. In
the latter
case, viral propagation generally will occur only in complementing host cells.
The polynucleotides may be joined to a vector containing a selectable marker
for
propagation in a host. Generally, a plasmid vector is introduced in a
precipitate, such
as a calcium phosphate precipitate, or in a complex with a charged lipid. If
the vector is a
virus, it may be packaged in vitro using an appropriate packaging cell line
and then
transduced into host cells.
The polynucleotide insert should be operatively linked to an appropriate
promoter, such as the phage lambda PL promoter, the E. coli lac, trp, phoA and
tac
promoters, the SV40 early and late promoters and promoters of retroviral LTRs,
to name
a few. Other suitable promoters will be known to the skilled artisan. The
expression
constructs will further contain sites for transcription initiation,
termination, and, in the
transcribed region, a ribosome binding site for translation. The coding
portion of the
transcripts expressed by the constructs will preferably include a translation
initiating
codon at the beginning and a termination codon (UAA, UGA or UAG) appropriately
positioned at the end of the polypeptide to be translated.
As indicated, the expression vectors will preferably include at least one
selectable
marker. Such markers include dihydrofolate reductase, 6418 or neomycin
resistance for
eukaryotic cell culture and tetracycline, kanamycin or ampicillin resistance
genes for
culturing in E. coli and other bacteria. Representative examples of
appropriate hosts
include, but are not limited to, bacterial cells, such as E. coli,
Streptomyces and
Salmonella typhimurium cells; fungal cells, such as yeast cells; insect cells
such as
Drosophila S2 and Spodoptera Sf7 cells; animal cells such as CHO, COS, 293,
Bowes
melanoma cells and plant cells. Appropriate culture mediums and conditions for
the
above-described host cells are known in the art.
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
Among vectors preferred for use in bacteria include pQE70, pQE60 and pQE-9,
available from QIAGEN, Inc.; pBluescript vectors, Phagescript vectors, pNHBA,
PNHl6a, pNHl8A, pNH46A, available from Stratagene Cloning Systems, Inc.; and
ptrc99a, pKK223-3, pKK233-3, pDR540, pRITS available from Pharmacia Biotech,
Inc.
Among preferred eukaryotic vectors are pWLNEO, pSV2CAT, pOG44, pXTI and pSG
available from Stratagene; and pSVK3, pBPV, pMSG and pSVL available from
Pharmacia. Other suitable vectors will be readily apparent to the skilled
artisan.
Introduction of the construct into the host cell can be effected by calcium
phosphate transfection, DEAF-dextran mediated transfection, cationic lipid-
mediated
transfection, electroporation, transduction, infection, or other methods. Such
methods are
described in many standard laboratory manuals, such as Davis et al., Basic
Methods In
Molecular Biology, (1986). It is specifically contemplated that the
polypeptides of the
present invention may in fact be expressed by a host cell lacking a
recombinant vector.
Currently no specific diagnostic markers exist that can be used to prevent or
delay
psychotic episodes of schizophrenia. The polynucleotides of the present
invention can be
used as chromosome markers for diagnosis for schizophrenia. A polypeptide of
this
invention can be recovered and purified from recombinant cell cultures by well-
known
methods including ammonium sulfate or ethanol precipitation, acid extraction,
anion or
cation exchange chromatography, phosphocellulose chromatography, hydrophobic
interaction chromatography, affinity chromatography, hydroxylapatite
chromatography
and lectin chromatography. Most preferably, high performance liquid
chromatography
("HPLC") is employed for purification.
Polypeptides of the present invention, and preferably the secreted form, can
also
be recovered from: products purified from natural sources, including bodily
fluids, tissues
and cells, whether directly isolated or cultured; products of chemical
synthetic
procedures; and products produced by recombinant techniques from a prokaryotic
or
eukaryotic host, including, for example, bacterial, yeast, higher plant,
insect, and
mammalian cells. Depending upon the host employed in a recombinant production
procedure, the polypeptides of the present invention may be glycosylated or
may be non-
glycosylated. In addition, polypeptides of the invention may also include an
initial
41
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
modified methionine residue, in some cases as a result of host-mediated
processes. Thus,
it is well known in the art that the N-terminal methionine encoded by the
translation
initiation codon generally is removed with high efficiency from any protein
after
translation in all eukaryotic cells. While the N-terminal methionine on most
proteins also
S is efficiently removed in most prokaryotes, for some proteins, this
prokaryotic removal
process is inefficient, depending on the nature of the amino acid to which the
N-terminal
methionine is covalently linked.
Uses of the Polynucleotides
Each of the polynucleotides identified herein can be used in numerous ways as
reagents. The following description should be considered exemplary and
utilizes known
techniques.
The polynucleotides of the present invention are useful for chromosome
identification. There exists an ongoing need to identify new chromosome
markers, since
few chromosome marking reagents, based on actual sequence data (repeat
polymorphisms), are presently available. Each polynucleotide of the present
invention
can be used as a chromosome marker.
Briefly, sequences can be mapped to chromosomes by preparing PCR primers
(preferably 1 S-25 bp) from the sequences shown in SEQ ID NOs: 1-19; 49-52; 57-
72 and
107. Primers can be selected using computer analysis so that primers do not
span more
than one predicted exon in the genomic DNA. These primers are then used for
PCR
screening of somatic cell hybrids containing individual human chromosomes.
Only those
hybrids containing the human gene corresponding to the SEQ ID NOs: 1-19; 49-
52; 57-
72 and 107 will yield an amplified fragment.
Similarly, somatic hybrids provide a rapid method of PCR mapping the
polynucleotides to particular chromosomes. Three or more clones can be
assigned per
day using a single thermal cycler. Moreover, sublocalization of the
polynucleotides can
be achieved with panels of specific chromosome fragments. Other gene mapping
strategies that can be used include in situ hybridization, prescreening with
labeled flow-
42
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
sorted chromosomes, and preselection by hybridization to construct chromosome
specific-cDNA libraries.
Precise chromosomal location of the polynucleotides can also be achieved using
fluorescence in situ hybridization (FISH) of a metaphase chromosomal spread.
This
technique uses polynucleotides as short as S00 or 600 bases; however,
polynucleotides
2,000-4,000 by are preferred. For a review of this technique, see Verma et
al., Human
Chromosomes: a Manual of Basic Techniques, Pergamon Press, New York (1988).
For chromosome mapping, the polynucleotides can be used individually (to mark
a single chromosome or a single site on that chromosome) or in panels (for
marking
multiple sites and/or multiple chromosomes). Preferred polynucleotides
correspond to
the noncoding regions of the cDNAs because the coding sequences are more
likely
conserved within gene families, thus increasing the chance of cross
hybridization during
chromosomal mapping.
Once a polynucleotide has been mapped to a precise chromosomal location, the
physical position of the polynucleotide can be used in linkage analysis.
Linkage analysis
establishes coinheritance between a chromosomal location and presentation of a
particular disease . Disease mapping data are found, for example in V.
McKusick,
Mendelian Inheritance in Man (available on line through Johns Hopkins
University
Welch Medical Library) Assuming one megabase mapping resolution and one gene
per
20 kb, a cDNA precisely localized to a chromosomal region associated with the
disease
could be one of 50-500 potential causative genes.
Thus, once coinheritance is established, differences in the polynucleotide and
the corresponding gene between affected and unaffected individuals can be
examined.
The polynucleotides of SEQ ID NOs: 1-19; 49-52; 57-72 and 107 can be used for
this
analysis of individual humans.
First, visible structural alterations in the chromosomes, such as deletions or
translocations, are examined in chromosome spreads or by PCR. If no structural
alterations exist, the presence of point mutations are ascertained. Mutations
observed in
43
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
some or all affected individuals, but not in normal individuals, indicates
that the mutation
may cause the disease. However, complete sequencing of the polypeptide and the
corresponding gene from several normal individuals is required to distinguish
the
mutation from a polymorphism. If a new polymorphism is identified, this
polymorphic
polypeptide can be used for further linkage analysis.
Furthermore, increased or decreased expression of the gene in affected
individuals
as compared to unaffected individuals can be assessed using polynucleotides of
the
present invention. Any of these alterations (altered expression, chromosomal
rearrangement, or mutation) can be used as a diagnostic or prognostic marker.
In addition to the foregoing, a polynucleotide can be used to control gene
expression through triple helix formation or antisense DNA or RNA. Both
methods rely
on binding of the polynucleotide to DNA or RNA. For these techniques,
preferred
polynucleotides are usually 20 to 40 bases in length and complementary to
either the
region of the gene involved in transcription (see, Lee et al., Nucl. Acids
Res., 6:3073
(1979); Cooney et al., Science, 241:456 (1988); and Dervan et al., Science,
251:1360
(1991) for discussion of triple helix formation) or to the mRNA itself (see,
Okano, J.
Neurochem., 56:560 (1991) and Oligodeoxy-nucleotides as Antisense Inhibitors
of Gene
Expression, CRC Press, Boca Raton, FL (1988) for a discussion of antisense
technique.)
Triple helix formation optimally results in a shut-off of RNA transcription
from DNA,
while antisense RNA hybridization blocks translation of an mRNA molecule into
polypeptide. Both techniques are effective in model systems, and the
information
disclosed herein can be used to design antisense or triple helix
polynucleotides in an
effort to treat disease.
Polynucleotides of the present invention are also useful in gene therapy. One
goal
of gene therapy is to insert a normal gene into an organism having a defective
gene, in an
effort to correct the genetic defect. The polynucleotides disclosed in the
present
invention offer a means of targeting such genetic defects in a highly accurate
manner.
Another goal is to insert a new gene that was not present in the host genome,
thereby
producing a new trait in the host cell.
44
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
The polynucleotides are also useful for identifying individuals from minute
biological samples. The United States military, for example, is considering
the use of
restriction fragment length polymorphism (RFLP) for identification of its
personnel. In
this technique, an individual's genomic DNA is digested with one or more
restriction
enzymes, and probed on a Southern blot to yield unique bands for identifying
personnel.
This method does not suffer from the current limitations of "Dog Tags" which
can be
lost, switched, or stolen, making positive identification difficult. The
polynucleotides of
the present invention can be used as additional DNA markers for RFLP.
The polynucleotides of the present invention can also be used as an
alternative to
RFLP, by determining the actual base-by-base DNA sequence of selected portions
of an
individual's genome. These sequences can be used to prepare PCR primers for
amplifying and isolating such selected DNA, which can then be sequenced. Using
this
technique, individuals can be identified because each individual will have a
unique set of
DNA sequences. Once an unique ID database is established for an individual,
positive
identification of that individual, living or dead, can be made from extremely
small tissue
samples.
Forensic biology also benefits from using DNA-based identification techniques
as
disclosed herein. DNA sequences taken from very small biological samples such
as
tissues, e.g., hair or skin, or body fluids, e.g., blood, saliva, semen, etc.,
can be amplified
using PCR. In one prior art technique, gene sequences amplified from
polymorphic loci,
such as DQa class II HLA gene, are used in forensic biology to identify
individuals
(Erlich, H., PCR Technology, Freeman and Co. (1992)). Once these specific
polymorphic loci are amplified, they are digested with one or more restriction
enzymes,
yielding an identifying set of bands on a Southern blot probed with DNA
corresponding
to the DQa class H HLA gene. Similarly, polynucleotides of the present
invention can be
used as polymorphic markers for forensic purposes.
There is also a need for reagents capable of identifying the source of a
particular
tissue. Such need arises, for example, in forensics when presented with tissue
of
unknown origin. Appropriate reagents can comprise, for example, DNA probes or
primers specific to particular tissue prepared from the sequences of the
present invention.
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
Panels of such reagents can identify tissue by species and/or by organ type.
In a similar
fashion, these reagents can be used to screen tissue cultures for
contamination.
In the very least, the polynucleotides of the present invention can be used as
molecular weight markers on Southern gels, as diagnostic probes for the
presence of a
specific mRNA in a particular cell type, as a probe to "subtract-out" known
sequences in
the process of discovering novel polynucleotides, for selecting and making
oligomers for
attachment to a "gene chip" or other support, to raise anti-DNA antibodies
using DNA
immunization techniques, and as an antigen to elicit an immune response.
Uses of the Polypeptides
Each of the polypeptides identified herein can be used in numerous ways. The
following description should be considered exemplary and utilizes known
techniques.
A polypeptide of the present invention can be used to assay protein levels in
a
biological sample using antibody-based techniques. For example, protein
expression in
tissues can be studied with classical immunohistological methods (Jalkanen,
M., et al., J.
Cell. Biol., 101:976-985 (1985); Jalkanen, M., et al., J. Cell . Biol.,
105:3087-3096
(1987)). Other antibody-based methods useful for detecting protein gene
expression
include immunoassays, such as the enzyme linked immunosorbent assay (ELISA)
and the
radioimmunoassay (RIA). Suitable antibody assay labels are known in the art
and
include enzyme labels, such as, glucose oxidase, and radioisotopes, such as
iodine (lzsh
lz~I), carbon (14C), sulfur (355), tritium (3H), indium (azIn), and technetium
(99mTC), and
fluorescent labels, such as fluorescein and rhodamine, and biotin.
In addition to assaying secreted protein levels in a biological sample,
proteins can
also be detected in vivo by imaging. Antibody labels or markers for in vivo
imaging of protein include those detectable by X-radiography, NMR or ESR. For
X-
radiography, suitable labels include radioisotopes such as barium or cesium,
which emit
detectable radiation but are not overtly harmful to the subject. Suitable
markers for NMR
and ESR include those with a detectable characteristic spin, such as
deuterium, which
may be incorporated into the antibody by labeling of nutrients for the
relevant hybridoma.
46
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
A protein-specific antibody or antibody fragment which has been labeled with
an appropriate detectable imaging moiety, such as a radioisotope (for example,
1311, 112In,
99mTC), a radio-opaque substance, or a material detectable by nuclear magnetic
resonance,
is introduced (for example, parenterally, subcutaneously, or
intraperitoneally) into the
mammal. It will be understood in the art that the size of the subject and the
imaging
system used will determine the quantity of imaging moiety needed to produce
diagnostic
images. In the case of a radioisotope moiety, for a human subject, the
quantity of
radioactivity injected will normally range from about S to 20 millicuries of
99"'Tc. The
labeled antibody or antibody fragment will then preferentially accumulate at
the location
of cells which contain the specific protein. In vivo tumor imaging is
described in S.W.
Burchiel et al., "Immunopharmacokinetics of Radiolabeled Antibodies and Their
Fragments" (Chapter 13 in Tumor Imaging: The Radiochemical Detection of
Cancer,
S.W. Burchiel and B. A. Rhodes, Eds., Masson Publishing Inc. (1982)).
1 S Thus, the invention provides a diagnostic method of a disorder, which
involves (a)
assaying the expression of a polypeptide of the present invention in cells or
body fluid of
an individual; (b) comparing the level of gene expression with a standard gene
expression
level, whereby an increase or decrease in the assayed polypeptide gene
expression level
compared to the standard expression level is indicative of a disorder.
Psychiatric
disorders and treatment of psychiatric disorders with neuroleptics, including
schizophrenia, are associated with a dysregulation of neurotransmitter and/or
neuropeptide levels that can result in the up- or down regulation of
polynucleotides and
polypeptides. These changes can be diagnosed or monitored by assaying changes
in
polypeptide levels in tissue or fluids such as CSF, blook, or in fecal
samples.
Moreover, polypeptides of the present invention can be used to treat disease.
For example, patients can be administered a polypeptide of the present
invention in an
effort to replace absent or decreased levels of the polypeptide (e.g.,
insulin), to
supplement absent or decreased levels of a different polypeptide (e.g.,
hemoglobin S for
hemoglobin B), to inhibit the activity of a polypeptide (e.g., an oncogene),
to activate the
activity of a polypeptide (e.g., by binding to a receptor), to reduce the
activity of a
membrane bound receptor by competing with it for free ligand (e.g., soluble
TNF
47
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
receptors used in reducing inflammation), or to bring about a desired response
(e.g.,
blood vessel growth).
Similarly, antibodies directed to a polypeptide of the present invention can
also be
S used to treat disease. For example, administration of an antibody directed
to a
polypeptide of the present invention can bind and reduce overproduction of the
polypeptide. Similarly, administration of an antibody can activate the
polypeptide, such
as by binding to a polypeptide bound to a membrane (receptor). Polypeptides
can also be
used as antigens to trigger immune responses.
Local production of neurotransmitters and neuropeptides modulates many aspects
of neuronal function. For example, in schizophrenia overactive
neurotransmitter activity
is thought to be basis for the psychotic behavior. Administration of an
antibody to an
overproduced polypeptide can be used to modulate neuronal responses in
psychiatric
disorders such as schizophrenia.
At the very least, the polypeptides of the present invention can be used as
molecular weight markers on SDS-PAGE gels or on molecular sieve gel filtration
columns using methods well known to those of skill in the art. Polypeptides
can also be
used to raise antibodies, which in turn are used to measure protein expression
from a
recombinant cell, as a way of assessing transformation of the host cell.
Moreover, the
polypeptides of the present invention can be used to test the following
biological
activities.
Biological Activities
The polynucleotides and polypeptides of the present invention can be used in
assays to test for one or more biological activities. If these polynucleotides
and
polypeptides do exhibit activity in a particular assay, it is likely that
these molecules may
be involved in the diseases associated with the biological activity. Thus, the
polynucleotides and polypeptides could be used to treat the associated
disease.
Nervous Svstem Activity
48
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
A polypeptide or polynucleotide of the present invention may be useful in
treating
deficiencies or disorders of the central nervous system or peripheral nervous
system, by
activating or inhibiting the proliferation, differentiation, or mobilization
(chemotaxis) of
neuroblasts, stem cells or glial cells. A polypeptide or polynucleotide of the
present
S invention may be useful in treating deficiencies or disorders of the central
nervous system
or peripheral nervous system, by activating or inhibiting the mechanisms of
synaptic
transmission, synthesis, metabolism and inactivation of neural transmitters,
neuromodulators and trophic factors, expression and incorporation of enzymes,
structural
proteins, membrane channels and receptors in neurons and glial cells, or
altering neural
membrane compositions.
The etiology of these deficiencies or disorders may be genetic, somatic (such
as
cancer or some autoimmune disorders), acquired (e.g., by chemotherapy or
toxins), or
infectious. Moreover, a polynucleotide or polypeptide of the present invention
can be
used as a marker or detector of a particular nervous system disease or
disorder. The
disorder or disease can be any of Alzheimer's disease, Pick's disease,
Binswanger's
disease, other senile dementia, Parkinson's disease, parkinsonism, obsessive
compulsive
disorders, epilepsy, encephalopathy, ischemia, alcohol addiction, drug
addiction,
schizophrenia, amyotrophic lateral sclerosis, multiple sclerosis, depression,
and bipolar
manic-depressive disorder. Alternatively, the polypeptide or polynucleotide of
the
present invention can be used to study circadian variation, aging, or long-
term
potentiation, the latter affecting the hippocampus. Additionally, particularly
with
reference to mltNA species occurring in particular structures within the
central nervous
system, the polypeptide or polynucleotide of the present invention can be used
to study
brain regions that are known to be involved in complex behaviors, such as
learning and
memory, emotion, drug addiction, glutamate neurotoxicity, feeding behavior,
olfaction,
viral infection, vision, and movement disorders.
Immune Activity
A polypeptide or polynucleotide of the present invention may be useful in
treating
deficiencies or disorders of the immune system, by activating or inhibiting
the
49
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
proliferation, differentiation, or mobilization (chemotaxis) of immune cells.
Immune cells
develop through a process called hematopoiesis, producing myeloid (platelets,
red blood
cells, neutrophils, and macrophages) and lymphoid (B and T lymphocytes) cells
from
pluripotent stem cells. The etiology of these immune deficiencies or disorders
may be
genetic, somatic, such as cancer or some autoimmune disorders, acquired (e.g.,
by
chemotherapy or toxins), or infectious. Moreover, a polynucleotide or
polypeptide of the
present invention can be used as a marker or detector of a particular immune
system
disease or disorder.
A polynucleotide or polypeptide of the present invention may be useful in
treating
or detecting deficiencies or disorders of hematopoietic cells. A polypeptide
or
polynucleotide of the present invention could be used to increase
differentiation and
proliferation of hematopoietic cells, including the pluripotent stem cells, in
an effort to
treat those disorders associated with a decrease in certain (or many) types
hematopoietic
cells. Examples of immunologic deficiency syndromes include, but are not
limited to:
blood protein disorders (e.g. agammaglobulinemia, dysgammaglobulinemia),
ataxia
telangiectasia, common variable immunodeficiency, Di George's Syndrome, HIV
infection, HTLV-BLV infection, leukocyte adhesion deficiency syndrome,
lymphopenia,
phagocyte bactericidal dysfunction, severe combined immunodeficiency (SCIDs),
Wiskott-Aldrich Disorder, anemia, thrombocytopenia, or hemoglobinuria.
Moreover, a polypeptide or polynucleotide of the present invention could also
be used to modulate hemostatic (the stopping of bleeding) or thrombolytic
activity (clot
formation). For example, by increasing hemostatic or thrombolytic activity, a
polynucleotide or polypeptide of the present invention could be used to treat
blood
coagulation disorders (e.g., afibrinogenemia, factor deficiencies), blood
platelet disorders
(e.g. thrombocytopenia), or wounds resulting from trauma, surgery, or other
causes.
Alternatively, a polynucleotide or polypeptide of the present invention that
can decrease
hemostatic or thrombolytic activity could be used to inhibit or dissolve
clotting. These
molecules could be important in the treatment of heart attacks (infarction),
strokes, or
scarnng.
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
A polynucleotide or polypeptide of the present invention may also be useful in
treating or detecting autoimmune disorders. Many autoimmune disorders result
from
inappropriate recognition of self as foreign material by immune cells. This
inappropriate
recognition results in an immune response leading to the destruction of the
host tissue.
Therefore, the administration of a polypeptide or polynucleotide of the
present invention
that inhibits an immune response, particularly the proliferation,
differentiation, or
chemotaxis of T-cells or in some ways results in the induction of tolerance,
may be an
effective therapy in preventing autoimmune disorders.
Examples of autoimmune disorders that can be treated or detected by the
present
invention include, but are not limited to: Addison's Disease, hemolytic
anemia,
antiphospholipid syndrome, rheumatoid arthritis, dermatitis, allergic
encephalomyelitis,
glomerulonephritis, Goodpasture's Syndrome, Graves' Disease, Multiple
Sclerosis,
Myasthenia Gravis, Neuritis, Ophthalmia, Bullous Pemphigoid, Pemphigus,
Polyendocrinopathies, Purpura, Reiter's Disease, Stiff Man Syndrome,
Autoimmune
Thyroiditis, Systemic Lupus Erythematosus, Autoimmune Pulmonary Inflammation,
Guillain-Barre Syndrome, insulin dependent diabetes mellitis, and autoimmune
inflammatory eye disease. Schizophrenia has several aspects that suggest an
autoimmune
component to the disease process. Patients with schizophrenia exhibit
immunological
abnormalities including hypersecretion of cytokines, presence of antinuclear,
anticytoplasmic and antiphospholipid antibodies and a decreased ratio of
CD4+/CD8+
cells.
Similarly, allergic reactions and conditions, such as asthma (particularly
allergic
asthma) or other respiratory problems, may also be treated by a polypeptide or
polynucleotide of the present invention. Moreover, these molecules can be used
to treat
anaphylaxis, hypersensitivity to an antigenic molecule, or blood group
incompatibility.
A polynucleotide or polypeptide of the present invention may also be used to
treat
and/or prevent organ rejection or graft-versus-host disease (GVHD). Organ
rejection
occurs by host immune cell destruction of the transplanted tissue through an
immune
response. Similarly, an immune response is also involved in GVHD, but, in this
case, the
foreign transplanted immune cells destroy the host tissues. The administration
of a
51
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
polypeptide or polynucleotide of the present invention that inhibits an immune
response,
particularly the proliferation, differentiation, or chemotaxis of T-cells, may
be an
effective therapy in preventing organ rejection or GVHD.
S Similarly, a polypeptide or polynucleotide of the present invention may also
be
used to modulate inflammation. For example, the polypeptide or polynucleotide
may
inhibit the proliferation and differentiation of cells involved in an
inflammatory response.
These molecules can be used to treat inflammatory conditions, both chronic and
acute
conditions, including inflammation associated with infection (e.g., septic
shock, sepsis, or
systemic inflammatory response syndrome (SIRS)), ischemia-reperfusion injury,
endotoxin lethality, arthritis, complement-mediated hyperacute rejection,
nephritis,
cytokine or chemokine induced lung injury, inflammatory bowel disease, Crohn's
disease,
or resulting from over production of cytokines (e.g., TNF or IL-1).
Hyperproliferative Disorders
A polypeptide or polynucleotide can be used to treat or detect
hyperproliferative
disorders, including neoplasms. A polypeptide or polynucleotide of the present
invention
may inhibit the proliferation of the disorder through direct or indirect
interactions.
Alternatively, a polypeptide or polynucleotide of the present invention may
proliferate
other cells which can inhibit the hyperproliferative disorder.
For example, by increasing an immune response, particularly increasing
antigenic
qualities of the hyperproliferative disorder or by proliferating,
differentiating, or
mobilizing T-cells, hyperproliferative disorders can be treated. This immune
response
may be increased by either enhancing an existing immune response, or by
initiating a
new immune response. Alternatively, decreasing an immune response may also be
a
method of treating hyperproliferative disorders, such as a chemotherapeutic
agent.
Examples of hyperproliferative disorders that can be treated or detected by a
polynucleotide or polypeptide of the present invention include, but are not
limited to
neoplasms located in the: abdomen, bone, breast, digestive system, liver,
pancreas,
peritoneum, endocrine glands (adrenal, parathyroid, pituitary, testicles,
ovary, thymus,
52
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
thyroid), eye, head and neck, nervous (central and peripheral), lymphatic
system, pelvic
region, skin, soft tissue, spleen, thoracic region, and urogenital system.
Similarly, other hyperproliferative disorders can also be treated or detected
by a
polynucleotide or polypeptide of the present invention. Examples of such
hyperproliferative disorders include, but are not limited to:
hypergammaglobulinemia,
lymphoproliferative disorders, paraproteinemias, purpura, sarcoidosis, Sezary
Syndrome,
Waldenstron's Macroglobulinemia, Gaucher's Disease, histiocytosis, and any
other
hyperproliferative disease, besides neoplasia, located in an organ system
listed above.
Infectious Disease
A polypeptide or polynucleotide of the present invention can be used to treat
or
detect infectious agents. For example, by increasing the immune response,
particularly
increasing the proliferation and differentiation of B and/or T cells,
infectious diseases
may be treated. The immune response may be increased by either enhancing an
existing
immune response, or by initiating a new immune response. Alternatively, the
polypeptide or polynucleotide of the present invention may also directly
inhibit the
infectious agent, without necessarily eliciting an immune response. In the
case of
schizophrenia, where infectious agents may contribute to the pathology,
treatment of
patients with a polypeptide or polynucleotide of the present invention might
act as a
vaccine to trigger a more efficient immune response, altering the course of
disease.
Viruses are one example of an infectious agent that can cause disease or
symptoms that can be treated or detected by a polynucleotide or polypeptide of
the
present invention. Examples of viruses, include, but are not limited to the
following
DNA and RNA viral families: Arbovirus, Adenoviridae, Arenaviridae,
Arterivirus,
Birnaviridae, Bunyaviridae, Caliciviridae, Circoviridae, Coronaviridae,
Flaviviridae,
Hepadnaviridae (Hepatitis), Herpesviridae (such as, Cytomegalovirus, Herpes
Simplex,
Herpes Zoster), Mononegavirus (e.g., Paramyxoviridae, Morbillivirus,
Rhabdoviridae),
Orthomyxoviridae (e.g., Influenza), Papovaviridae, Parvoviridae,
Picornaviridae,
Poxviridae (such as Smallpox or Vaccinia), Reoviridae (e.g., Rotavirus),
Retroviridae
(HTLV-I, HTLV-II, Lentivirus), and Togaviridae (e.g., Rubivirus). Viruses
falling
within these families can cause a variety of diseases or symptoms, including,
but not
53
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
limited to: arthritis, bronchiollitis, encephalitis, eye infections (e.g.,
conjunctivitis,
keratitis), chronic fatigue syndrome, hepatitis (A, B, C, E, Chronic Active,
Delta),
meningitis, opportunistic infections (e.g., AIDS), pneumonia, Burkitt's
Lymphoma,
chickenpox, hemorrhagic fever, Measles, Mumps, Parainfluenza, Rabies, the
common
cold, Polio, leukemia, Rubella, sexually transmitted diseases, skin diseases
(e.g.,
Kaposi's, warts), and viremia. A polypeptide or polynucleotide of the present
invention
can be used to treat or detect any of these symptoms or diseases.
Similarly, bacterial or fungal agents that can cause disease or symptoms and
that
can be treated or detected by a polynucleotide or polypeptide of the present
invention
include, but not limited to, the following Gram-Negative and Gram-positive
bacterial
families and fungi: Actinomycetales (e.g., Corynebacterium, Mycobacterium,
Norcardia),
Aspergillosis, Bacillaceae (e.g., Anthrax, Clostridium), Bacteroidaceae,
Blastomycosis,
Bordetella, Borrelia, Brucellosis, Candidiasis, Campylobacter,
Coccidioidomycosis,
Cryptococcosis, Dermatocycoses, Enterobacteriaceae (Klebsielia, Salmonella,
Serratia,
Yersinia), Erysipelothrix, Helicobacter, Legionellosis, Leptospirosis,
Listeria,
Mycoplasmatales, Neisseriaceae (e.g., Acinetobacter, Gonorrhea, Menigococcal),
Pasteurellacea Infections (e.g., Actinobacillus, Heamophilus, Pasteurella),
Pseudomonas,
Rickettsiaceae, Chlamydiaceae, Syphilis, and Staphylococcal. These bacterial
or fungal
families can cause the following diseases or symptoms, including, but not
limited to:
bacteremia, endocarditis, eye infections (conjunctivitis, tuberculosis,
uveitis), gingivitis,
opportunistic infections (e.g., AIDS related infections), paronychia,
prosthesis-related
infections, Reiter's Disease, respiratory tract infections, such as Whooping
Cough or
Empyema, sepsis, Lyme Disease, Cat-Scratch Disease, Dysentery, Paratyphoid
Fever,
food poisoning, Typhoid, pneumonia, Gonorrhea, meningitis, Chlamydia,
Syphilis,
Diphtheria, Leprosy, Paratuberculosis, Tuberculosis, Lupus, Botulism,
gangrene, tetanus,
impetigo, Rheumatic Fever, Scarlet Fever, sexually transmitted diseases, skin
diseases
(e.g., cellulitis, dermatocycoses), toxemia, urinary tract infections, wound
infections. A
polypeptide or polynucleotide of the present invention can be used to treat or
detect any
of these symptoms or diseases.
Moreover, parasitic agents causing disease or symptoms that can be treated or
detected by a polynucleotide or polypeptide of the present invention include,
but not
54
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
limited to, the following families: Amebiasis, Babesiosis, Coccidiosis,
Cryptosporidiosis,
Dientamoebiasis, Dourine, Ectoparasitic, Giardiasis, Helminthiasis,
Leishmaniasis,
Theileriasis, Toxoplasmosis, Trypanosomiasis, and Trichomonas. These parasites
can
cause a variety of diseases or symptoms, including, but not limited to:
Scabies,
Trombiculiasis, eye infections, intestinal disease (e.g., dysentery,
giardiasis), liver
disease, lung disease, opportunistic infections (e.g., AIDS related), Malaria,
pregnancy
complications, and toxoplasmosis. A polypeptide or polynucleotide of the
present
invention can be used to treat or detect any of these symptoms or diseases.
Preferably, treatment using a polypeptide or polynucleotide of the present
invention could either be by administering an effective amount of a
polypeptide to the
patient, or by removing cells from the patient, supplying the cells with a
polynucleotide
of the present invention, and returning the engineered cells to the patient
(ex vivo
therapy). Moreover, the polypeptide or polynucleotide of the present invention
can be
1 S used as an antigen in a vaccine to raise an immune response against
infectious disease.
Regeneration
A polynucleotide or polypeptide of the present invention can be used to
differentiate, proliferate, and attract cells, leading to the regeneration of
tissues (see,
Science, 276:59-87 (1997)). The regeneration of tissues could be used to
repair, replace,
or protect tissue damaged by congenital defects, trauma (wounds, burns,
incisions, or
ulcers), age, disease (e.g. osteoporosis, osteocarthritis, periodontal
disease, liver failure),
surgery, including cosmetic plastic surgery, fibrosis, reperfusion injury, or
systemic
cytokine damage.
Tissues that could be regenerated using the present invention include organs
(e.g.,
pancreas, liver, intestine, kidney, skin, endothelium), muscle (smooth,
skeletal or
cardiac), vascular (including vascular endothelium), nervous, hematopoietic,
and skeletal
(bone, cartilage, tendon, and ligament) tissue. Preferably, regeneration
occurs without or
decreased scarnng. Regeneration also may include angiogenesis.
Moreover, a polynucleotide or polypeptide of the present invention may
increase
regeneration of tissues difficult to heal. For example, increased
tendon/ligament
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
regeneration would quicken recovery time after damage. A polynucleotide or
polypeptide of the present invention could also be used prophylactically in an
effort to
avoid damage. Specific diseases that could be treated include of tendinitis,
carpal tunnel
syndrome, and other tendon or ligament defects. A further example of tissue
regeneration of non-healing wounds includes pressure ulcers, ulcers associated
with
vascular insufficiency, surgical, and traumatic wounds.
Similarly, nerve and brain tissue could also be regenerated by using a
polynucleotide or polypeptide of the present invention to proliferate and
differentiate
nerve cells. Diseases that could be treated using this method include central
and
peripheral nervous system diseases, neuropathies, or mechanical and traumatic
disorders
(e.g., spinal cord disorders, head trauma, cerebrovascular disease, and
stroke).
Specifically, diseases associated with peripheral nerve injuries, peripheral
neuropathy
(e.g., resulting from chemotherapy or other medical therapies), localized
neuropathies,
and central nervous system diseases (e.g., Alzheimer's disease,
Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis, and
Shy-Drager
syndrome), could all be treated using the polynucleotide or polypeptide of the
present
invention.
Chemotaxis
A polynucleotide or polypeptide of the present invention may have chemotaxis
activity. A chemotaxic molecule attracts or mobilizes cells (e.g., monocytes,
fibroblasts,
neutrophils, T-cells, mast cells, eosinophils, epithelial and/or endothelial
cells) to a
particular site in the body, such as inflammation, infection, or site of
hyperproliferation.
The mobilized cells can then fight off and/or heal the particular trauma or
abnormality.
A polynucleotide or polypeptide of the present invention may increase
chemotaxic activity of particular cells. These chemotactic molecules can then
be used to
treat inflammation, infection, hyperproliferative disorders, or any immune
system
disorder by increasing the number of cells targeted to a particular location
in the body.
For example, chemotaxic molecules can be used to treat wounds and other trauma
to
tissues by attracting immune cells to the injured location. Chemotactic
molecules of the
present invention can also attract fibroblasts, which can be used to treat
wounds.
56
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
It is also contemplated that a polynucleotide or polypeptide of the present
invention may inhibit chemotactic activity. These molecules could also be used
to treat
disorders. Thus, a polynucleotide or polypeptide of the present invention
could be used
as an inhibitor of chemotaxis.
Binding Activity
A polypeptide of the present invention may be used to screen for molecules
that
bind to the polypeptide or for molecules to which the polypeptide binds. The
binding
of the polypeptide and the molecule may activate (i.e., an agonist), increase,
inhibit (i.e.,
an antagonist), or decrease activity of the polypeptide or the molecule bound.
Examples
of such molecules include antibodies, oligonucleotides, proteins (e.g.,
receptors),or small
molecules.
Preferably, the molecule is closely related to the natural ligand of the
polypeptide, e.g., a fragment of the ligand, or a natural substrate, a ligand,
a structural or
functional mimetic (see, Coligan et al., Current Protocols in Immunology,
1(2), Chapter 5
(1991)). Similarly, the molecule can be closely related to the natural
receptor to which
the polypeptide binds, or at least, a fragment of the receptor capable of
being bound by
the polypeptide (e.g., an active site). In either case, the molecule can be
rationally
designed using known techniques.
Preferably, the screening for these molecules involves producing appropriate
cells
which express the polypeptide, either as a secreted protein or on the cell
membrane.
Preferred cells include cells from mammals, yeast, Drosophila, or E. coli.
Cells
expressing the polypeptide (or cell membrane containing the expressed
polypeptide) are
then preferably contacted with a test compound potentially containing the
molecule to
observe binding, stimulation, or inhibition of activity of either the
polypeptide or the
molecule.
The assay may simply test binding of a candidate compound to the polypeptide,
wherein binding is detected by a label, or in an assay involving competition
with a
57
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
labeled competitor. Further, the assay may test whether the candidate compound
results
in a signal generated by binding to the polypeptide.
Alternatively, the assay can be carried out using cell-free preparations,
polypeptide/molecule affixed to a solid support, chemical libraries, or
natural product
mixtures. The assay may also simply comprise the steps of mixing a candidate
compound with a solution containing a polypeptide, measuring
polypeptide/molecule
activity or binding, and comparing the polypeptide/molecule activity or
binding to a
standard.
Preferably, an ELISA assay can measure polypeptide level or activity in a
sample
(e.g., biological sample) using a monoclonal or polyclonal antibody. The
antibody can
measure polypeptide level or activity by either binding, directly or
indirectly, to the
polypeptide or by competing with the polypeptide for a substrate.
All of these above assays can be used as diagnostic or prognostic markers. The
molecules discovered using these assays can be used to treat disease or to
bring about a
particular result in a patient (e.g., blood vessel growth) by activating or
inhibiting the
polypeptide/molecule. Moreover, the assays can discover agents which may
inhibit or
enhance the production of the polypeptide from suitably manipulated cells or
tissues.
Therefore, the invention includes a method of identifying compounds which
bind to a polypeptide of the invention comprising the steps o~ (a) incubating
a candidate
binding compound with a polypeptide of the invention; and (b) determining if
binding
has occurred. Moreover, the invention includes a method of identifying
agonists/antagonists comprising the steps o~ (a) incubating a candidate
compound with a
polypeptide of the invention, (b) assaying a biological activity, and (c)
determining if a
biological activity of the polypeptide has been altered.
Other Activities
A polypeptide or polynucleotide of the present invention may also increase or
decrease the differentiation or proliferation of embryonic stem cells,
besides, as discussed
above, hematopoietic lineage.
58
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
A polypeptide or polynucleotide of the present invention may also be used to
modulate mammalian characteristics, such as body height, weight, hair color,
eye color,
skin, percentage of adipose tissue, pigmentation, size, and shape (e.g.,
cosmetic surgery).
Similarly, a polypeptide or polynucleotide of the present invention may be
used to
modulate mammalian metabolism affecting catabolism, anabolism, processing,
utilization, and storage of energy.
A polypeptide or polynucleotide of the present invention may be used to change
a
mammal's mental state or physical state by influencing biorhythms, circadian
rhythms,
depression (including depressive disorders), tendency for violence, tolerance
for pain, the
response to opiates and opioids, tolerance to opiates and opioids, withdrawal
from opiates
and opioids, reproductive capabilities (preferably by activin or inhibin-like
activity),
hormonal or endocrine levels, appetite, libido, memory, stress, or other
cognitive
qualities.
A polypeptide or polynucleotide of the present invention may also be used as a
food additive or preservative, such as to increase or decrease storage
capabilities, fat
content, lipid, protein, carbohydrate, vitamins, minerals, cofactors or other
nutritional
components.
Other Preferred Embodiments
Where a polynucleotide of the invention is down-regulated and exacerbates a
pathological condition, such as psychosis or other neuropsychiatric disorders,
the
expression of the polynucleotide can be increased or the level of the intact
polypeptide
product can be increased in order to treat, prevent, ameliorate, or modulate
the
pathological condition. This can be accomplished by, for example,
administering a
polynucleotide or polypeptide of the invention to the mammalian subject.
A polynucleotide of the invention can be administered to a mammalian subject
by
a recombinant expression vector comprising the polynucleotide. A mammalian
subject
can be a human, baboon, chimpanzee, macaque, cow, horse, sheep, pig, horse,
dog, cat,
rabbit, guinea pig, rat or mouse. Preferably, the recombinant vector comprises
a
59
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
polynucleotide shown in SEQ ID NOs: 1-19; 49-52; 57-72 and 107 or a
polynucleotide
which is at least 98% identical to a nucleic acid sequence shown in SEQ ID
NOs: 1-19;
49-52; 57-72 and 107. Also, preferably, the recombinant vector comprises a
variant
polynucleotide that is at least 80%, 90%, or 95% identical to a polynucleotide
comprising
SEQ ID NOs: 1-19; 49-52; 57-72 and 107.
The administration of a polynucleotide or recombinant expression vector of the
invention to a mammalian subject can be used to express a polynucleotide in
said subject
for the treatment of, for example, psychosis or other neuropsychiatric
disorder.
Expression of a polynucleotide in target cells, including but not limited to
cells of the
striatum and nucleus accumbens, would effect greater production of the encoded
polypeptide. In some cases where the encoded polypeptide is a nuclear protein,
the
regulation of other genes may be secondarily up- or down-regulated.
1 S There are available to one skilled in the art multiple viral and non-viral
methods
suitable for introduction of a nucleic acid molecule into a target cell, as
described above.
In addition, a naked polynucleotide can be administered to target cells.
Polynucleotides
and recombinant expression vectors of the invention can be administered as a
pharmaceutical composition. Such a composition comprises an effective amount
of a
polynucleotide or recombinant expression vector, and a pharmaceutically
acceptable
formulation agent selected for suitability with the mode of administration.
Suitable
formulation materials preferably are non-toxic to recipients at the
concentrations
employed and can modify, maintain, or preserve, for example, the pH,
osmolarity,
viscosity, clarity, color, isotonicity, odor, sterility, stability, rate of
dissolution or release,
adsorption, or penetration of the composition. See Remington's Pharmaceutical
Sciences
(18th Ed., A.R. Gennaro, ed., Mack Publishing Company 1990).
The pharmaceutically active compounds (i.e., a polynucleotide or a vector) can
be
processed in accordance with conventional methods of pharmacy to produce
medicinal
agents for administration to patients, including humans and other mammals.
Thus, the
pharmaceutical composition comprising a polynucleotide or a recombinant
expression
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
vector may be made up in a solid form (including granules, powders or
suppositories) or
in a liquid form (e.g., solutions, suspensions, or emulsions).
The dosage regimen for treating a disease with a composition comprising a
S polynucleotide or expression vector is based on a variety of factors,
including the type or
severity of the psychosis or other neuropsychiatric disorders, the age,
weight, sex,
medical condition of the patient, the route of administration, and the
particular compound
employed. Thus, the dosage regimen may vary widely, but can be determined
routinely
using standard methods. A typical dosage may range from about 0.1 mg/kg to
about 100
mg/kg or more, depending on the factors mentioned above.
The frequency of dosing will depend upon the pharmacokinetic parameters of the
polynucleotide or vector in the formulation being used. Typically, a clinician
will
administer the composition until a dosage is reached that achieves the desired
effect. The
1 S composition may therefore be administered as a single dose, as two or more
doses (which
may or may not contain the same amount of the desired molecule) over time, or
as a
continuous infusion via implantation device or catheter. Further refinement of
the
appropriate dosage is routinely made by those of ordinary skill in the art and
is within the
ambit of tasks routinely performed by them. Appropriate dosages may be
ascertained
through use of appropriate dose-response data.
The cells of a mammalian subject may be transfected in vivo, ex vivo, or in
vitro.
Administration of a polynucleotide or a recombinant vector containing a
polynucleotide
to a target cell in vivo may be accomplished using any of a variety of
techniques well
known to those skilled in the art. For example, U.S. Patent No. 5,672,344
describes an in
vivo viral-mediated gene transfer system involving a recombinant neurotrophic
HSV-1
vector. The above-described compositions of polynucleotides and recombinant
vectors
can be transfected in vivo by oral, buccal, parenteral, rectal, or topical
administration as
well as by inhalation spray. The term "parenteral" as used herein includes,
subcutaneous,
intravenous, intramuscular, intrasternal, infusion techniques or
intraperitoneally.
61
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
While the nucleic acids and/or vectors of the invention can be administered as
the
sole active pharmaceutical agent, they can also be used in combination with
one or more
vectors of the invention or other agents. When administered as a combination,
the
therapeutic agents can be formulated as separate compositions that are given
at the same
time or different times, or the therapeutic agents can be given as a single
composition.
Another delivery system for polynucleotides of the invention is a "non-viral"
delivery system. Techniques that have been used or proposed for gene therapy
include
DNA-ligand complexes, adenovirus-ligand-DNA complexes, direct injection of
DNA,
CaP04 precipitation, gene gun techniques, electroporation, lipofection, and
colloidal
dispersion (Mulligan, R., (1993) Science, 260 (5110):926-32 (1993)). Any of
these
methods are widely available to one skilled in the art and would be suitable
for use Zn the
present invention. Other suitable methods are available to one skilled in the
art, and it is
to be understood that the present invention may be accomplished using any of
the
1 S available methods of transfection. Several such methodologies have been
utilized by
those skilled in the art with varying success (Mulligan, R., (1993) Science,
260
(5110):926-32 (1993)).
Where a polynucleotide of the invention is up-regulated and exacerbates a
pathological condition in a mammalian subject, such as psychosis or other
neuropsychiatric disorders, the expression of the polynucleotide can be
blocked or
reduced or the level of the intact polypeptide product can be reduced in order
to treat,
prevent, ameliorate, or modulate the pathological condition. This can be
accomplished
by, for example, the use of antisense oligonucleotides or ribozymes.
Alternatively, drugs
or antibodies that bind to and inactivate the polypeptide product can be used.
62
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
Antisense oligonucleotides are nucleotide sequences which are complementary to
a specific DNA or RNA sequence. Once introduced into a cell, the complementary
nucleotides combine with natural sequences produced by the cell to form
complexes and
block either transcription or translation. Preferably, an antisense
oligonucleotide is at
least 11 nucleotides in length, but can be at least 12, 15, 20, 25, 30, 35,
40, 45, or 50 or
more nucleotides long. Longer sequences also can be used. Antisense
oligonucleotide
molecules can be provided in a DNA construct and introduced into a cell as
described
above to decrease the level of gene products of the invention in the cell.
Antisense oligonucleotides can be deoxyribonucleotides, ribonucleotides, or a
combination of both. Oligonucleotides can be synthesized manually or by an
automated
synthesizer, by covalently linking the 5' end of one nucleotide with the 3'
end of another
nucleotide with non-phosphodiester internucleotide linkages such
alkylphosphonates,
15' phosphorothioates, phosphorodithioates, alkylphosphonothioates,
alkylphosphonates,
phosphoramidates, phosphate esters, carbamates, acetamidate, carboxymethyl
esters,
carbonates, and phosphate triesters. See Brown, (1994) Meth. Mol. Biol., 20:1-
8;
Sonveaux, (1994) Meth. Mol. Biol., 26:1-72; Uhlmann et al., (1990) Chem. Rev.,
90:543-
583.
Modifications of gene expression can be obtained by designing antisense
oligonucleotides which will form duplexes to the control, 5', or regulatory
regions of a
gene of the invention. Oligonucleotides derived from the transcription
initiation site, e.g.,
between positions -10 and +10 from the start site, are preferred. Similarly,
inhibition can
be achieved using "triple helix" base-pairing methodology. Triple helix
pairing is useful
because it causes inhibition of the ability of the double helix to open
sufficiently for the
binding of polymerases, transcription factors, or chaperons. Therapeutic
advances using
triplex DNA have been described in the literature (e.g., Gee et al., in Huber
& Carr,
MOLECULAR AND IMMUNOLOGIC APPROACHES, Futura Publishing Co., Mt. Kisco, N.Y.,
1994). An antisense oligonucleotide also can be designed to block translation
of mRNA
by preventing the transcript from binding to ribosomes.
63
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
Precise complementarity is not required for successful complex formation
between an antisense oligonucleotide and the complementary sequence of a
polynucleotide. Antisense oligonucleotides which comprise, for example, 2, 3,
4, or S or
more stretches of contiguous nucleotides which are precisely complementary to
a
polynucleotide, each separated by a stretch of contiguous nucleotides which
are not
complementary to adjacent nucleotides, can provide sufficient targeting
specificity for
mRNA. Preferably, each stretch of complementary contiguous nucleotides is at
least 4,
5, 6, 7, or 8 or more nucleotides in length. Non-complementary intervening
sequences
are preferably 1, 2, 3, or 4 nucleotides in length. One skilled in the art can
easily use the
calculated melting point of an antisense-sense pair to determine the degree of
mismatching which will be tolerated between a particular antisense
oligonucleotide and a
particular polynucleotide sequence.
Antisense oligonucleotides can be modified without affecting their ability to
hybridize to a polynucleotide of the invention. These modifications can be
internal or at
one or both ends of the antisense molecule. For example, internucleoside
phosphate
linkages can be modified by adding cholesteryl or diamine moieties with
varying
numbers of carbon residues between the amino groups and terminal ribose.
Modified
bases and/or sugars, such as arabinose instead of ribose, or a 3', 5'-
substituted
oligonucleotide in which the 3' hydroxyl group or the 5' phosphate group are
substituted,
also can be employed in a modified antisense oligonucleotide. These modified
oligonucleotides can be prepared by methods well known in the art. See, e.g.,
Agrawal et
al., (1992) Trends Biotechnol., 10:152-158; Uhlmann et al., (1990) Chem. Rev.,
90:543-
584; LJhlmann et al., (1987) Tetrahedron. Lett., 215:3539-3542.
64
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
Ribozymes are RNA molecules with catalytic activity. See, e.g., Cech, (1987)
Science, 236:1532-1539; Cech, (1990) Ann. Rev. Biochem., 59:543-568; Cech,
(1992)
Curr. Opin. Struct. Biol., 2:605-609; Couture & Stinchcomb, (1996) Trends
Genet.,
12:510-515. Ribozymes can be used to inhibit gene function by cleaving an RNA
sequence, as is known in the art (e.g., Haseloff et al., U.S. Patent
5,641,673). The
mechanism of ribozyme action involves sequence-specific hybridization of the
ribozyme
molecule to complementary target RNA, followed by endonucleolytic cleavage.
Examples include engineered hammerhead motif ribozyme molecules that can
specifically and efficiently catalyze endonucleolytic cleavage of specific
nucleotide
sequences.
The coding sequence of a polynucleotide of the invention can be used to
generate
ribozymes which will specifically bind to mRNA transcribed from the
polynucleotide.
Methods of designing and constructing ribozymes which can cleave RNA molecules
in
trans in a highly sequence specific manner have been developed and described
in the art
(see Haseloff et al. (1988) Nature, 334:585-591). For example, the cleavage
activity of
ribozymes can be targeted to specific RNAs by engineering a discrete
"hybridization"
region into the ribozyme. The hybridization region contains a sequence
complementary
to the target RNA and thus specifically hybridizes with the target (see, e.g.,
Gerlach et al.,
EP 321,201).
Specific ribozyme cleavage sites within a RNA target can be identified by
scanning the target molecule for ribozyme cleavage sites which include the
following
sequences: GUA, GUU, and GUC. Once identified, short RNA sequences of between
15
and 20 ribonucleotides corresponding to the region of the target RNA
containing the
cleavage site can be evaluated for secondary structural features which may
render the
target inoperable. Suitability of candidate RNA targets also can be evaluated
by testing
accessibility to hybridization with complementary oligonucleotides using
ribonuclease
protection assays. The nucleotide sequences shown in SEQ ID NOs: 1-19; 49-52;
57-72
and 107 and their complements provide sources of suitable hybridization region
sequences. Longer complementary sequences can be used to increase the affinity
of the
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
hybridization sequence for the target. The hybridizing and cleavage regions of
the
ribozyme can be integrally related such that upon hybridizing to the target
RNA through
the complementary regions, the catalytic region of the ribozyme can cleave the
target.
S Ribozymes can be introduced into cells as part of a DNA construct.
Mechanical
methods, such as microinjection, liposome-mediated transfection,
electroporation, or
calcium phosphate precipitation, can be used to introduce a ribozyme-
containing DNA
construct into cells in which it is desired to decrease polynucleotide
expression.
Alternatively, if it is desired that the cells stably retain the DNA
construct, the construct
can be supplied on a plasmid and maintained as a separate element or
integrated into the
genome of the cells, as is known in the art. A ribozyme-encoding DNA construct
can
include transcriptional regulatory elements, such as a promoter element, an
enhancer or
UAS element, and a transcriptional terminator signal, for controlling
transcription of
ribozymes in the cells.
As taught in Haseloff et al., U.S. Patent 5,641,673, ribozymes can be
engineered
so that ribozyme expression will occur in response to factors which induce
expression of
a target gene. Ribozymes also can be engineered to provide an additional level
of
regulation, so that destruction of mRNA occurs only when both a ribozyme and a
target
gene are induced in the cells.
Production of Diagnostic Tests
Pathological conditions or susceptibility to pathological conditions, such as
psychosis or other neuropsychiatric disorders, can be diagnosed using methods
of the
invention. Testing for expression of a polynucleotide of the invention or for
the presence
of the polynucleotide product can correlate with the severity of the condition
and can also
indicate appropriate treatment. For example, the presence or absence of a
mutation in a
polynucleotide of the invention can be determined and a pathological condition
or a
susceptibility to a pathological condition is diagnosed based on the presence
or absence
of the mutation. Further, an alteration in expression of a polypeptide encoded
by a
polynucleotide of the invention can be detected, where the presence of an
alteration in
66
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
expression of the polypeptide is indicative of the pathological condition or
susceptibility
to the pathological condition. The alteration in expression can be an increase
in the
amount of expression or a decrease in the amount of expression.
S As an additional method of diagnosis, a first biological sample from a
patient
suspected of having a pathological condition, such as psychosis or addiction-
related
behavior, is obtained along with a second sample from a suitable comparable
control
source. A biological sample can comprise saliva, blood, cerebrospinal fluid,
amniotic
fluid, urine, feces, or tissue, such as gastrointestinal tissue. A suitable
control source can
be obtained from one or more mammalian subjects that do not have the
pathological
condition. For example, the average concentrations and distribution of a
polynucleotide
or polypeptide of the invention can be determined from biological samples
taken from a
representative population of mammalian subjects, wherein the mammalian
subjects are
the same species as the subject from which the test sample was obtained. The
amount of
1 S at least one polypeptide encoded by a polynucleotide of the invention is
determined in the
first and second sample. The amounts of the polypeptide in the first and
second samples
are compared. A patient is diagnosed as having a pathological condition if the
amount of
the polypeptide in the first sample falls in the range of samples taken from a
representative group of patients with the pathological condition.
Other preferred embodiments of the claimed invention include an isolated
nucleic
acid molecule comprising a nucleotide sequence which is at least 80%,
preferably at least
85%, more preferably at least 90%, most preferably at least 95% identical to a
sequence
of at least about 50 contiguous nucleotides in the nucleotide sequence of SEQ
ID NOs: 1-
19; 49-52; 57-72 and 107.
Also preferred is a nucleic acid molecule wherein said sequence of contiguous
nucleotides is included in the nucleotide sequence of SEQ ID NOs: 1-19; 49-52;
57-72
and 107 in the range of positions beginning with the nucleotide at about the
position of
the S' nucleotide of the clone sequence and ending with the nucleotide at
about the
position of the 3' nucleotide of the clone sequence.
67
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
Also preferred is a nucleic acid molecule wherein said sequence of contiguous
nucleotides is included in the nucleotide sequence of SEQ 1D NOs: 1-19; 49-52;
57-72
and 107 in the range of positions beginning with the nucleotide at about the
position of
the S' nucleotide of the start codon and ending with the nucleotide at about
the position of
the 3' nucleotide of the clone sequence as defined for SEQ ID NOs: 1-19; 49-
52; 57-72
and 107.
Similarly preferred is a nucleic acid molecule wherein said sequence of
contiguous nucleotides is included in the nucleotide sequence of SEQ ID NOs: 1-
19; 49-
52; 57-72 and 107 in the range of positions beginning with the nucleotide at
about the
position of the 5' nucleotide of the first amino acid of the signal peptide
and ending with
the nucleotide at about the position of the 3' nucleotide of the clone
sequence as defined
for SEQ ID NOs: 1-19; 49-52; 57-72 and 107.
Also preferred is an isolated nucleic acid molecule comprising a nucleotide
sequence which is at least 95% identical to a sequence of at least about 150
contiguous
nucleotides in the nucleotide sequence of SEQ ID NOs: 1-19; 49-52; 57-72 and
107.
Further preferred is an isolated nucleic acid molecule comprising a nucleotide
sequence which is at least 95% identical to a sequence of at least about 500
contiguous
nucleotides in the nucleotide sequence of SEQ ID NOs: 1-19; 49-52; 57-72 and
107.
A further preferred embodiment is a nucleic acid molecule comprising a
nucleotide sequence which is at least 95% identical to the nucleotide sequence
of SEQ ID
NOs: 1-19; 49-52; 57-72 and 107 beginning with the nucleotide at about the
position of
the 5' nucleotide of the first amino acid of the signal peptide and ending
with the
nucleotide at about the position of the 3' nucleotide of the clone sequence as
defined for
SEQ ID NOs: 1-19; 49-52; 57-72 and 107.
A further preferred embodiment is an isolated nucleic acid molecule comprising
a
nucleotide sequence which is at least 95% identical to the complete nucleotide
sequence
of SEQ ID NOs: 1-19; 49-52; 57-72 and 107. In another embodiment, the present
invention provides a method for detecting in a biological sample a nucleic
acid molecule
68
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
comprising a nucleotide sequence which is at least 95% identical to a complete
nucleotide sequence chosen from the group consisting of SEQ ID NOs: 1-19; 49-
52; 57-
72 and 107, which method comprises the steps of comparing a nucleotide
sequence of at
least one nucleic acid molecule in said sample with a sequence selected from
said group
and determining whether the sequence of said nucleic acid molecule in said
sample is at
least 95% identical to said selected sequence.
Also preferred is an isolated nucleic acid molecule which hybridizes under
stringent hybridization conditions to a nucleic acid molecule, wherein said
nucleic acid
molecule which hybridizes does not hybridize under stringent hybridization
conditions to
a nucleic acid molecule having a nucleotide sequence consisting of only A
residues or of
only T residues.
A further preferred embodiment is a method for detecting in a biological
sample a
nucleic acid molecule comprising a nucleotide sequence which is at least 95%
identical to
a sequence of at least 50 contiguous nucleotides in a sequence selected from
the group
consisting o~ a nucleotide sequence of SEQ ID NOs: 1-19; 49-52; 57-72 and 107,
which
method comprises the steps of comparing a nucleotide sequence of at least one
nucleic
acid molecule in said sample with a sequence selected from said group and
determining
whether the sequence of said nucleic acid molecule in said sample is at least
95%
identical to said selected sequence.
Also preferred is the above method wherein said step of comparing sequences
comprises determining the extent of nucleic acid hybridization between nucleic
acid
molecules in said sample and a nucleic acid molecule comprising said sequence
selected
from said group. Similarly, also preferred is the above method wherein said
step of
comparing sequences is performed by comparing the nucleotide sequence
determined
from a nucleic acid molecule in said sample with said sequence selected from
said group.
The nucleic acid molecules can comprise DNA molecules or RNA molecules.
69
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
A further preferred embodiment is a method for identifying the species, tissue
or
cell type of a biological sample which method comprises a step of detecting
nucleic acid
molecules in said sample, if any, comprising a nucleotide sequence that is at
least 95%
identical to a sequence of at least SO contiguous nucleotides in a sequence
selected from
the group consisting of: a nucleotide sequence of SEQ ID NOs: 1-19; 49-52; 57-
72 and
107.
Also preferred is a method for diagnosing in a subject a pathological
condition
associated with abnormal structure or expression of a gene, which method
comprises a
step of detecting in a biological sample obtained from said subject nucleic
acid
molecules, if any, comprising a nucleotide sequence that is at least 95%
identical to a
sequence of at least 50 contiguous nucleotides in a sequence selected from the
group
consisting of. a nucleotide sequence of SEQ ID NOs: 1-19; 49-52; 57-72 and
107.
The method for diagnosing a pathological condition can comprise a step of
detecting nucleic acid molecules comprising a nucleotide sequence in a panel
of at least
two nucleotide sequences, wherein at least one sequence in said panel is at
least 95%
identical to a sequence of at least 50 contiguous nucleotides in a sequence
selected from
said group.
Also preferred is a composition of matter comprising isolated nucleic acid
molecules wherein the nucleotide sequences of said nucleic acid molecules
comprise a
panel of at least two nucleotide sequences, wherein at least one sequence in
said panel is
at least 95% identical to a sequence of at least 50 contiguous nucleotides in
a sequence
selected from the group consisting of a nucleotide sequence of SEQ ID NOs: 1-
19; 49-
52; 57-72 and 107. The nucleic acid molecules can comprise DNA molecules or
RNA
molecules.
Also preferred is an isolated polypeptide comprising an amino acid sequence at
least 90% identical to a sequence of at least about 10 contiguous amino acids
in an amino
acid sequence translated from SEQ ID NOs: 1-19; 49-52; 57-72 and 107.
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
Also preferred is a polypeptide, wherein said sequence of contiguous amino
acids is included in acids in an amino acid sequence translated from SEQ ID
NOs: 1-19;
49-52; 57-72 and 107, in the range of positions beginning with the residue at
about the
position of the first amino acid of the secreted portion and ending with the
residue at
about the last amino acid of the open reading frame.
Also preferred is an isolated polypeptide comprising an amino acid sequence at
least 95% identical to a sequence of at least about 30 contiguous amino acids
in an amino
acid sequence translated from SEQ ID NOs: 1-19; 49-52; 57-72 and 107.
Further preferred is an isolated polypeptide comprising an amino acid sequence
at
least 95% identical to a sequence of at least about 100 contiguous amino acids
in an
amino acid sequence translated from SEQ ID NOs: 1-19; 49-52; 57-72 and 107.
Further preferred is an isolated polypeptide comprising an amino acid sequence
at
least 95% identical to acids in an amino acid sequence translated from SEQ ID
NOs: 1-
19; 49-52; 57-72 and 107.
Further preferred is a method for detecting in a biological sample a
polypeptide
comprising an amino acid sequence which is at least 90% identical to a
sequence of at
least 10 contiguous amino acids in a sequence selected from the group
consisting of
amino acid sequences translated from SEQ ID NOs: 1-19; 49-52; 57-72 and 107,
which
method comprises a step of comparing an amino acid sequence of at least one
polypeptide molecule in said sample with a sequence selected from said group
and
determining whether the sequence of said polypeptide molecule in said sample
is at least
90% identical to said sequence of at least 10 contiguous amino acids.
Also preferred is the above method wherein said step of comparing an amino
acid
sequence of at least one polypeptide molecule in said sample with a sequence
selected
from said group comprises determining the extent of specific binding of
polypeptides in
said sample to an antibody which binds specifically to a polypeptide
comprising an
amino acid sequence that is at least 90% identical to a sequence of at least
10 contiguous
71
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
amino acids in a sequence selected from the group consisting of amino acid
sequences
translated from SEQ ID NOs: 1-19; 49-52; 57-72 and 107.
Also preferred is the above method wherein said step of comparing sequences is
performed by comparing the amino acid sequence determined from a polypeptide
molecule in said sample with said sequence selected from said group.
Also preferred is a method for identifying the species, tissue or cell type of
a
biological sample which method comprises a step of detecting polypeptide
molecules in
said sample, if any, comprising an amino acid sequence that is at least 90%
identical to a
sequence of at least 10 contiguous amino acids in a sequence selected from the
group
consisting of amino acid sequences translated from SEQ ID NOs: 1-19; 49-52; 57-
72 and
107.
Also preferred is the above method for identifying the species, tissue or cell
type
of a biological sample, which method comprises a step of detecting polypeptide
molecules comprising an amino acid sequence in a panel of at least two amino
acid
sequences, wherein at least one sequence in said panel is at least 90%
identical to a
sequence of at least 10 contiguous amino acids in a sequence selected from the
above
group.
Also preferred is a method for diagnosing in a subject a pathological
condition
associated with abnormal structure or expression of a gene, which method
comprises a
step of detecting in a biological sample obtained from said subject
polypeptide molecules
comprising an amino acid sequence in a panel of at least two amino acid
sequences,
wherein at least one sequence in said panel is at least 90% identical to a
sequence of at
least 10 contiguous amino acids in a sequence selected from the group
consisting of
amino acid sequences translated from SEQ ID NOs: 1-19; 49-52; 57-72 and 107.
In any of these methods, the step of detecting said polypeptide molecules
includes
using an antibody.
72
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
Also preferred is an isolated nucleic acid molecule comprising a nucleotide
sequence which is at least 95% identical to a nucleotide sequence encoding a
polypeptide
wherein said polypeptide comprises an amino acid sequence that is at least 90%
identical
to a sequence of at least 10 contiguous amino acids in a sequence selected
from the group
consisting of amino acid sequences translated from SEQ ID NOs: 1-19; 49-52; 57-
72 and
107.
Also preferred is an isolated nucleic acid molecule, wherein said nucleotide
sequence encoding a polypeptide has been optimized for expression of said
polypeptide
in a prokaryotic host.
Also preferred is an isolated nucleic acid molecule, wherein said nucleotide
sequence encodes a polypeptide comprising an amino acid sequence selected from
the
group consisting of amino acid sequences translated from SEQ ID NOs: 1-19; 49-
52; 57-
72 and 107.
Further preferred is a method of making a recombinant vector comprising
inserting any of the above isolated nucleic acid molecule into a vector. Also
preferred is
the recombinant vector produced by this method. Also preferred is a method of
making a
recombinant host cell comprising introducing the vector into a host cell, as
well as the
recombinant host cell produced by this method.
Also preferred is a method of making an isolated polypeptide comprising
culturing this recombinant host cell under conditions such that said
polypeptide is
expressed and recovering said polypeptide. Also preferred is this method of
making an
isolated polypeptide, wherein said recombinant host cell is a eukaryotic cell
and said
polypeptide is a secreted portion of a human secreted protein comprising an
amino acid
sequence selected from the group consisting of amino acid sequences translated
from
SEQ ID NOs: 1-19; 49-52; 57-72 and 107. The isolated polypeptide produced by
this
method is also preferred.
Also preferred is a method of treatment of an individual in need of an
increased
level of a secreted protein activity, which method comprises administering to
such an
73
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
individual a pharmaceutical composition comprising an amount of an isolated
polypeptide, polynucleotide, or antibody of the claimed invention effective to
increase
the level of said protein activity in said individual.
The present invention also includes a diagnostic system, preferably in kit
form, for
assaying for the presence of the polypeptide of the present invention in a
body sample,
such brain tissue, cell suspensions or tissue sections, or body fluid samples
such as CSF,
blood, plasma or serum, where it is desirable to detect the presence, and
preferably the
amount, of the polypeptide of this invention in the sample according to the
diagnostic
methods described herein.
In a related embodiment, a nucleic acid molecule can be used as a probe (an
oligonucleotide) to detect the presence of a polynucleotide of the present
invention, or a
gene corresponding to a polynucleotide of the present invention, or a mRNA in
a cell that
is diagnostic for the presence or expression of a polypeptide of the present
invention in
the cell. The nucleic acid molecule probes can be of a variety of lengths from
at least
about 10, suitably about 10 to about 5000 nucleotides long, although they will
typically
be about 20 to 500 nucleotides in length. Hybridization methods are extremely
well
known in the art and will not be described further here.
In a related embodiment, detection of genes corresponding to the
polynucleotides
of the present invention can be conducted by primer extension reactions such
as the
polymerase chain reaction (PCR). To that end, PCR primers are utilized in
pairs, as is
well known, based on the nucleotide sequence of the gene to be detected.
Preferably the
nucleotide sequence is a portion of the nucleotide sequence of a
polynucleotide of the
present invention. Particularly preferred PCR primers can be derived from any
portion of
a DNA sequence encoding a polypeptide of the present invention, but are
preferentially
from regions which are not conserved in other cellular proteins.
Preferred PCR primer pairs useful for detecting the genes corresponding to the
polynucleotides of the present invention and expression of these genes are
described in
74
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
the Examples, including the corresponding Tables. Nucleotide primers from the
corresponding region of the polypeptides of the present invention described
herein are
readily prepared and used as PCR primers for detection of the presence or
expression of
the corresponding gene in any of a variety of tissues.
The diagnostic system includes, in an amount sufficient to perform at least
one
assay, a subject polypeptide of the present invention, a subject antibody or
monoclonal
antibody, and/or a subject nucleic acid molecule probe of the present
invention, as a
separately packaged reagent.
In another embodiment, a diagnostic system, preferably in kit form, is
contemplated for assaying for the presence of the polypeptide of the present
invention or
an antibody immunoreactive with the polypeptide of the present invention in a
body fluid
sample such as for monitoring the fate of therapeutically administered the
polypeptide of
the present invention or an antibody immunoreactive with the polypeptide of
the present
invention. The system includes, in an amount sufficient for at least one
assay, a
polypeptide of the present invention and/or a subject antibody as a separately
packaged
immunochemical reagent.
Instructions for use of the packaged reagents) are also typically included.
As used herein, the term "package" refers to a solid matrix or material such
as
glass, plastic (e.g., polyethylene, polypropylene or polycarbonate), paper,
foil and the like
capable of holding within fixed limits a polypeptide, polyclonal antibody or
monoclonal
antibody of the present invention. Thus, for example, a package can be a glass
vial used
to contain milligram quantities of a contemplated polypeptide or antibody or
it can be a
microtiter plate well to which microgram quantities of a contemplated
polypeptide or
antibody have been operatively affixed, i.e., linked so as to be capable of
being
immunologically bound by an antibody or antigen, respectively.
75
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
"Instructions for use" typically include a tangible expression describing the
reagent concentration or at least one assay method parameter such as the
relative amounts
of reagent and sample to be admixed, maintenance time periods for reagent/
sample
admixtures, temperature, buffer conditions and the like.
A diagnostic system of the present invention preferably also includes a label
or
indicating means capable of signaling the formation of an immunocomplex
containing a
polypeptide or antibody molecule of the present invention.
The word "complex" as used herein refers to the product of a specific binding
reaction such as an antibody-antigen or receptor-ligand reaction. Exemplary
complexes
are immunoreaction products.
As used herein, the terms "label" and "indicating means" in their various
grammatical forms refer to single atoms and molecules that are either directly
or
indirectly involved in the production of a detectable signal to indicate the
presence of a
complex. Any label or indicating means can be linked to or incorporated in an
expressed
protein, polypeptide, or antibody molecule that is part of an antibody or
monoclonal
antibody composition of the present invention, or used separately, and those
atoms or
molecules can be used alone or in conjunction with additional reagents. Such
labels are
themselves well-known in clinical diagnostic chemistry and constitute a part
of this
invention only insofar as they are utilized with otherwise novel proteins
methods and/or
systems.
The labeling means can be a fluorescent labeling agent that chemically binds
to
antibodies or antigens without denaturing them to form a fluorochrome (dye)
that is a
useful immunofluorescent tracer. Suitable fluorescent labeling agents are
fluorochromes
such as fluorescein isocyanate (FIC), fluorescein isothiocyante (FITC), 5-
dimethylamine-
1-naphthalenesulfonyl chloride (DANSC), tetramethylrhodamine isothiocyanate
(TRITC), lissamine, rhodamine 8200 sulphonyl chloride (RB 200 SC) and the
like. A
description of immunofluorescence analysis techniques is found in DeLuca,
76
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
"Immunofluorescence Analysis", in Antibody As a Tool, Marchalonis, et al.,
Eds., John
Wiley & Sons, Ltd., pp. 189-231 (1982), which is incorporated herein by
reference.
Other suitable labeling agents are known to those skilled in the art.
In preferred embodiments, the indicating group is an enzyme, such as
horseradish
peroxidase (HRP), glucose oxidase, or the like. In such cases where the
principal
indicating group is an enzyme such as HRP or glucose oxidase, additional
reagents are
required to visualize the fact that a receptor-ligand complex (immunoreactant)
has
formed. Such additional reagents for HRP include hydrogen peroxide and an
oxidation
dye precursor such as diaminobenzidine. An additional reagent useful with
glucose
oxidase is 2,2'-amino-di-(3-ethyl-benzthiazoline-G-sulfonic acid) (ABTS).
Radioactive elements are also useful labeling agents and are used
illustratively
herein. An exemplary radiolabeling agent is a radioactive element that
produces gamma
ray emissions. Elements which themselves emit gamma rays, such as 124l, l2sh
l2ah ls2l
and SICr represent one class of gamma ray emission-producing radioactive
element
indicating groups. Particularly preferred is l2sI. Another group of useful
labeling means
are those elements such as 11C, 18F, 150 and 13N which themselves emit
positrons. The
positrons so emitted produce gamma rays upon encounters with electrons present
in the
animal's body. Also useful is a beta emitter, such 111 indium or 3H.
The linking of labels, i.e., labeling of, polypeptides and proteins is well
known in
the art. For instance, antibody molecules produced by a hybridoma can be
labeled by
metabolic incorporation of radioisotope-containing amino acids provided as a
component
in the culture medium (see, e.g., Galfre et al., Meth. Enzymol., 73:3-46
(1981)). The
techniques of protein conjugation or coupling through activated functional
groups are
particularly applicable (see, e.g.,Aurameas, et al., Scand. J. Immunol., Vol.
8 Suppl. 7:7-
23 (1978); Rodwell et al., Biotech., 3:889-894 (1984); and U.S. Pat. No.
4,493,795).
The diagnostic systems can also include, preferably as a separate package, a
specific binding agent. A "specific binding agent" is a molecular entity
capable of
77
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
selectively binding a reagent species of the present invention or a complex
containing
such a species, but is not itself a polypeptide or antibody molecule
composition of the
present invention. Exemplary specific binding agents are second antibody
molecules,
complement proteins or fragments thereof, S. aureus protein A, and the like.
Preferably
the specific binding agent binds the reagent species when that species is
present as part of
a complex.
In preferred embodiments, the specific binding agent is labeled. However, when
the diagnostic system includes a specific binding agent that is not labeled,
the agent is
typically used as an amplifying means or reagent. In these embodiments, the
labeled
specific binding agent is capable of specifically binding the amplifying means
when the
amplifying means is bound to a reagent species-containing complex.
The diagnostic kits of the present invention can be used in an "ELISA" format
to
detect the quantity of the polypeptide of the present invention in a sample.
"ELISA"
refers to an enzyme-linked immunosorbent assay that employs an antibody or
antigen
bound to a solid phase and an enzyme-antigen or enzyme-antibody conjugate to
detect
and quantify the amount of an antigen present in a sample. A description of
the ELISA
technique is found in Sites et al., Basic and Clinical Immunology, 4th Ed.,
Lange Medical
Publications, Los Altos, CA (1982) and in U.S. Patents No. 3,654,090; No.
3,850,752;
and No. 4,016,043, which are all incorporated herein by reference.
Thus, in some embodiments, an polypeptide of the present invention, an
antibody
or a monoclonal antibody of the present invention can be affixed to a solid
matrix to form
a solid support that comprises a package in the subject diagnostic systems.
A reagent is typically affixed to a solid matrix by adsorption from an aqueous
medium although other modes of affixation applicable to proteins and
polypeptides can
be used that are well known to those skilled in the art. Exemplary adsorption
methods
are described herein.
78
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
Useful solid matrices are also well known in the art. Such materials are water
insoluble and include the cross-linked dextran available under the trademark
SEPHADEX from Pharmacia Fine Chemicals (Piscataway, NJ); agarose; beads of
polystyrene beads about 1 micron (gym) to about 5 millimeters (mm) in diameter
available
from several suppliers, e.g., Abbott Laboratories of North Chicago, IL;
polyvinyl
chloride, polystyrene, cross-linked polyacrylamide, nitrocellulose- or nylon-
based webs
such as sheets, strips or paddles; or tubes, plates or the wells of a
microtiter plate such as
those made from polystyrene or polyvinylchloride.
The reagent species, labeled specific binding agent or amplifying reagent of
any
diagnostic system described herein can be provided in solution, as a liquid
dispersion or
as a substantially dry power, e.g., in lyophilized form. Where the indicating
means is an
enzyme, the enzyme's substrate can also be provided in a separate package of a
system.
A solid support such as the before-described microtiter plate and one or more
buffers can
also be included as separately packaged elements in this diagnostic assay
system.
The packaging materials discussed herein in relation to diagnostic systems are
those customarily utilized in diagnostic systems.
Having generally described the invention, the same will be more readily
understood by reference to the following examples, which are provided by way
of
illustration and are not intended as limiting.
EXAMPLE 1
Identification and Characterization of Polynucleotides
Regulated by Neuroleptic Drugs
Male C57B1/6J mice (20-28 g) were housed in groups of four on a standard 12/12
hour light-dark cycle with ad libitum access to standard laboratory chow and
tap water.
For the experimental paradigms, mice were divided into groups of 25 and
subjected to the
following treatments:
79
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
Control pups: Mice received a single injection of sterile saline (0.1 ml
volume),
or no injection, and were sacrificed after 45 minutes.
Acute neuroleptic treatment: Mice received a single intraperitoneal injection
of
the atypical neuroleptic clozapine (7.5 mg/kg). Animals were sacrificed after
45 minutes.
Chronic neuroleptic treatment: Mice received daily subcutaneous injections of
clozapine (7.5 mg/kg) for time periods of 5 days to 2 weeks.
All animals were sacrificed in their cages with COZ at the indicated times.
Brains
were rapidly removed and placed on ice. The striatum, including the nucleus
accumbens,
were dissected out and placed in ice-cold phosphate-buffered saline.
Isolated RNA was analyzed using a method of simultaneous sequence-specific
identification of mRNAs known as TOGA (TOtal Gene expression Analysis)
described
in Sutcliffe et al. Proc. Natl. Acad. Sci. USA, 97(5):1976-1981 (2000);
International
published application WO 026406; U.S. Patent No. 5,459,037; U.S. Patent No.
5,807,680; U.S. Patent No. 6,030,784; U.S. Patent No. 6,096,503 and U.S.
Patent
6,110,680, hereby incorporated herein by reference. Preferably, prior to the
application
of the TOGA technique, the isolated RNA was enriched to form a starting polyA-
containing mRNA population by methods known in the art. In a preferred
embodiment,
the TOGA method further comprised an additional PCR step performed using four
S'
PCR primers in four separate reactions and cDNA templates prepared from a
population
of antisense cRNAs. A final PCR step that used 256 5' PCR primers in separate
reactions
produced PCR products that were cDNA fragments that corresponded to the 3'-
region of
the starting mRNA population. The produced PCR products were then identified
by: a)
the initial 5' sequence comprising the sequence remainder of the recognition
site of the
restriction endonuclease used to cut and isolate the 3' region plus the
sequence of the
preferably four parsing bases immediately 3' to the remainder of the
recognition site,
preferably the sequence of the entire fragment, and b) the length of the
fragment. These
two parameters, sequence and fragment length, were used to compare the
obtained PCR
products to a database of known polynucleotide sequences. Since the length of
the
obtained PCR products includes known vector sequences at the S' and 3' ends of
the
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
insert, the sequence of the insert provided in the sequence listing is shorter
than the
fragment length that forms part of the digital address.
The method yields Digital Sequence Tags (DSTs), that is, polynucleotides that
are
expressed sequence tags of the 3' end of mRNAs. DSTs that showed changes in
relative
levels as a result of clozapine treatment were selected for further study. The
intensities of
the laser-induced fluorescence of the labeled PCR products were compared
across
samples isolated from the striatum/nucleus accumbens of mice treated with
clozapine for
45 minutes, 7 hours, 5 days, 12 days, or 14 days.
In general, double-stranded cDNA is generated from poly(A)-enriched
cytoplasmic RNA extracted from the tissue samples of interest using an
equimolar
mixture or set of all 48 5'-biotinylated anchor primers to initiate reverse
transcription.
One such suitable set is G-A-A-T-T-C-A-A-C-T-G-G-A-A-G-C-G-G-C-C-G-C-A-G-G-
A-A-T-T-T-T-T-T-T-T-T-T-T-T-T-T-T-T-T-T-V-N-N (SEQ ID NO: 20), where V is A,
C or G and N is A, C, G or T. One member of this mixture of 48 anchor primers
initiates
synthesis at a fixed position at the 3' end of all copies of each mRNA species
in the
sample, thereby defining a 3' endpoint for each species, resulting in
biotinylated double
stranded cDNA.
Each biotinylated double stranded cDNA sample was cleaved with the restriction
endonuclease MsnI, which recognizes the sequence CCGG. The resulting fragments
of
cDNA corresponding to the 3' region of the starting mRNA were then isolated by
capture
of the biotinylated cDNA fragments on a streptavidin-coated substrate.
Suitable
streptavidin-coated substrates include microtitre plates, PCR tubes,
polystyrene beads,
paramagnetic polymer beads and paramagnetic porous glass particles. A
preferred
streptavidin-coated substrate is a suspension of paramagnetic polymer beads
(Dynal, Inc.,
Lake Success, NY).
After washing the streptavidin-coated substrate and captured biotinylated cDNA
fragments, the cDNA fragment product was released by digestion with NotI,
which
81
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
cleaves at an 8-nucleotide sequence within the anchor primers but rarely
within the
mRNA-derived portion of the cDNAs. The 3' MspI-NotI fragments, which are of
uniform length for each mRNA species, were directionally ligated into CIaI-
NotI-
cleaved plasmid pBC SK+ (Stratagene, La Jolla, CA) in an antisense orientation
with
respect to the vector's T3 promoter, and the product used to transform
Escherichia coli
SURE cells (Stratagene). The ligation regenerates the NotI site, but not the
MspI site,
leaving CGG as the first 3 bases of the 5' end of all PCR products obtained.
Each library
contained in excess of 5 x 105 recombinants to ensure a high likelihood that
the 3' ends of
all mRNAs with concentrations of 0.001% or greater were multiply represented.
Plasmid
preps (Qiagen) were made from the cDNA library of each sample under study.
An aliquot of each library was digested with MsnI, which effects linearization
by
cleavage at several sites within the parent vector while leaving the 3' cDNA
inserts and
their flanking sequences, including the T3 promoter, intact. The product was
incubated
with T3 RNA polymerase (MEGAscript kit, Ambion) to generate antisense cRNA
transcripts of the cloned inserts containing known vector sequences abutting
the MspI
and NotI sites from the original cDNAs.
At this stage, each of the cRNA preparations was processed in a three-step
fashion. In step one, 250ng of cRNA was converted to first-strand cDNA using
the 5' RT
primer (A-G-G-T-C-G-A-C-G-G-T-A-T-C-G-G, (SEQ ID NO: 21). In step two, 400 pg
of cDNA product was used as PCR template in four separate reactions with each
of the
four 5' PCR primers of the form G-G-T-C-G-A-C-G-G-T-A-T-C-G-G-N (SEQ ID NO:
22), each paired with a "universal" 3' PCR primer G-A-G-C-T-C-C-A-C-C-G-C-G-G-
T
(SEQ ID NO: 23) to yield four sets of PCR reaction products ("N1 reaction
products").
In step three, the product of each subpool was further divided into 64
subsubpools
(2ng in 201) for the second PCR reaction. This PCR reaction comprised adding
100 ng
of the fluoresceinated "universal" 3' PCR primer (SEQ ID NO: 23) conjugated to
6-FAM
and 100 ng of the appropriate 5' PCR primer of the form C-G-A-C-G-G-T-A-T-C-G-
G-
N-N-N-N (SEQ ID NO: 24), and using a program that included an armealing step
at a
82
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
temperature X slightly above the Tm of each 5' PCR primer to minimize
artifactual
mispriming and promote high fidelity copying. Each polymerase chain reaction
step was
performed in the presence of TaqStart antibody (Clonetech).
The products ("N4 reaction products") from the final polymerase chain reaction
step for each of the tissue samples were resolved on a series of denaturing
DNA
sequencing gels using the automated ABI Prizm 377 sequencer. Data were
collected
using the GeneScan software package (ABI) and normalized for amplitude and
migration.
Complete execution of this series of reactions generated 64 product subpools
for each of
the four pools established by the 5' PCR primers of the first PCR reaction,
for a total of
256 product subpools for the entire S' PCR primer set of the second PCR
reaction.
The mRNA samples from each timepoint as described above were analyzed.
Table 1 is a summary of the expression levels of 495 mRNAs determined from
cDNA.
1 S These cDNA molecules are identified by their digital address, that is, a
partial S' terminus
nucleotide sequence coupled with the length of the molecule, as well as the
relative
amount of the molecule produced at different time intervals after treatment.
The 5'
terminus partial nucleotide sequence is determined by the recognition site for
MspI (CC
GG) and the nucleotide sequence of the parsing bases of the 5' PCR primer used
in the
final PCR step. The digital address length of the fragment was determined by
interpolation on a standard curve and, as such, may vary ~ 1-2 b.p. from the
actual length
as determined by sequencing.
For example, the entry in Table 1 that describes a DNA molecule identified by
the
digital address MspI AGTA, is further characterized as having a 5' terminus
partial
nucleotide sequence of CGGAGTA and a digital address length of 106 b.p. The
DNA
molecule identified as MsnI AGTA 106 is further described as being expressed
at
increasing levels after both acute and chronic treatment with clozapine (see
Fig. 1 ).
Additionally, the DNA molecule identified as MsnI AGTA 106 is described by its
nucleotide sequence, which coresponds with SEQ ID NO: 1.
83
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
Similarly, the other DNA molecules identified in Table 1 by their MspI digital
addresses are further characterized by: 1) the level of gene expression in the
striatum/nucleus accumbens of mice without clozapine treatment (control), 2)
the level of
gene expression in the striatum/nucleus accumbens of mice treated with
clozapine for 45
minutes, 3) the level of gene expression in the striatum/nucleus accumbens of
mice
treated with clozapine for 7 hours, 4) the level of gene expression in the
striatum/nucleus
accumbens of mice treated with clozapine for 5 days, S) the level of gene
expression in
the striatum/nucleus accumbens of mice treated with clozapine for 12 days, 6)
the level
of gene expression in the striatum/nucleus accumbens of mice treated with
clozapine for
14 days.
Some products, which were also differentially represented, appeared to migrate
in
positions that suggest that the products were novel based on comparison to
data extracted
from GenBank. The sequences of such products were determined by one of two
methods: cloning or direct sequencing of the PCR products.
Additionally, several of the isolated clones were further characterized as
shown in
Table 2 and their nucleotide sequences are provided as SEQ ID NOs: 1-19; 49-
52; 57-72
and 107 in the Sequence Listing below.
The sequences of SEQ ID NOs: 1-19; 49-52; 57-72 and 107 have had the MsnI
site found in the native state of the corresponding RNA indicated by the
addition of a "C"
to the 5' of the sequence. As noted above, the ligation of the sequence into a
vector does
not regenerate the MspI site; the experimentally determined sequence reported
herein has
C-G-G as the first bases of the 5' end.
The data shown in Figure 1 were generated with a 5'-PCR primer (C-G-A-C-G-
G-T-A-T-C-G-G-A-G-T-A; SEQ ID NO: 94) paired with the "universal" 3' primer
(SEQ
ID NO: 23) labeled with 6-carboxyfluorescein (6FAM, ABI) at the 5' terminus.
PCR
reaction products were resolved by gel electrophoresis on 4.5% acrylamide gels
and
fluorescence data acquired on ABI377 automated sequencers. Data were analyzed
using
84
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
GeneScan software (Perkin-Elmer). The sequences of the PCR products were
determined
using standard techniques.
The results of TOGA analysis using a S' PCR primer with parsing bases AGTA
(SEQ ID NO.: 94) are shown in Figure 1, which shows the PCR products produced
from
mRNA isolated from the striatum/nucleus accumbens of mice treated with
clozapine for
various lengths of time as described above. The vertical index line indicates
a PCR
product of about 106 b.p. that is present in control cells, and whose
expression increases
when the striatum/nucleus accumbens of mice are treated with clozapine for 45
minutes,
7 hours, 5 days, 12 days, and 14 days.
Cloning DSTs Without A Candidate Match and Verification of the Cloned DSTs
Using
Extended TOGA Method
In suitable cases, the PCR product was isolated, cloned into a TOPO vector
(Invitrogen) and sequenced on both strands. The database matches for each
cloned DST
sequence are listed in Table 2. In order to verify that the cloned product
corresponds to
the TOGA peak of interest, the extended TOGA assay was performed for each DST.
PCR primers were designed based on the determined sequences and PCR was
performed
using the N1 PCR reaction products as a substrate. Oligonucleotides were
synthesized
with the sequence G-A-T-C-G-A-A-T-C extended at the 3' end with a partial MspI
site
(C-G-G), and an additional 18 adjacent nucleotides from the determined
sequence of the
cloned PCR product or DST. For example, for the PCR product with the digital
address
MspI AGTA 106 (SEQ ID NO: 1), the 5' PCR primer was G-A-T-C-G-A-A-T-C-C-G-G-
A-G-T-A-C-A-G-T-G-A-C-T-T-T-G-A-G-T (SEQ ID NO: 28). This 5' PCR primer was
paired with the fluorescent labeled universal 3' PCR primer (SEQ ID NO: 23) in
a PCR
reaction using the PCR N1 reaction product as substrate.
The length of the PCR product generated with the clone specific primer (SEQ ID
NO: 28) was compared to the length of the original PCR product that was
produced in the
TOGA reaction as shown in Figure 2. For CLZ 3 (SEQ ID NO: 1), the upper panel
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
(Figure 2A) shows the PCR product generated with the clone specific primer
(SEQ ID
NO: 28) and the fluorescent labeled universal 3' PCR primer (SEQ ID NO: 23).
Figure
2B shows the PCR products produced in the original TOGA reaction using a 5'
PCR
primer C-G-A-C-G-G-T-A-T-C-G-G-A-G-T-A (SEQ ID NO: 94), and the fluorescent
labeled universal 3' PCR primer. In the bottom panel (Figure 2C), the traces
from the top
and middle panels are overlaid, demonstrating that the PCR product produced
using an
extended primer based on the cloned sequence is the same length as the
original PCR
product. Other DST clones verified using this method include cases (CLZ_5, SEQ
ID
NO: 2; CLZ 8, SEQ ID NO: 3; CLZ_10, SEQ ID NO: 4; CLZ-12, SEQ ID NO: 5;
CLZ-15, SEQ ID NO: 6; CLZ_24, SEQ ID NO: 7; CLZ 33, SEQ ID NO: 8; CLZ_34,
SEQ ID NO: 9; CLZ_37, SEQ ID NO: 10; CLZ 38, SEQ ID NO: 11; CLZ 40, SEQ ID
NO: 12, CLZ_6, SEQ ID NO: 14; CLZ_16, SEQ ID NO: 15; CLZ_22, SEQ ID NO: 16;
CLZ 32, SEQ ID NO: 17; CLZ_36, SEQ 117 NO: 18; CLZ_42, SEQ ID NO: 19;
CLZ_18, SEQ ID NO: 57; CLZ 43, SEQ ID NO: 58; CLZ 44, SEQ B7 NO: 59;
CLZ 47, SEQ ID NO: 60; CLZ 48, SEQ ID NO: 61; CLZ 49, SEQ ID NO: 62;
CLZ S0, SEQ ID NO: 63; CLZ 51, SEQ ID NO: 64; CLZ_52, SEQ ID NO: 65;
CLZ_56, SEQ ID NO: 67; CLZ_57, SEQ ID NO: 68; CLZ_60, SEQ ID NO: 69, and
CLZ 64, SEQ ID NO: 70). Table 3 contains primers generated from each of the
cloned
DSTs used in such studies.
Direct Sequencing of TOGA Generated PCR products and Verification by Extended
TOGA Method
In other cases, the TOGA PCR product was sequenced using a modification of a
direct sequencing methodology (Innis et al., Proc. Nat'l. Acad. Sci., 85: 9436-
9440
(1988)).
PCR products corresponding to DSTs were gel purified and PCR amplified again
to incorporate sequencing primers at 5' and 3' ends. The sequence addition was
accomplished through 5' and 3' ds-primers containing M13 sequencing primer
sequences
(M13 forward and M13 reverse respectively) at their 5' ends, followed by a
linker
86
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
sequence and a sequence complementary to the DST ends. Using the Clontech Taq
Start
antibody system, a master mix containing all components except the gel
purified PCR
product template was prepared, which contained sterile H20, l OX PCR II
buffer, IOmM
dNTP, 25 mM MgCl2, AmpliTaq/Antibody mix (1.1 p,g/pl Taq antibody, 5 U/pl
AmpliTaq), 100 ng/pl of 5' ds-primer (5' TCC CAG TCA CGA CGT TGT AAA ACG
ACG GCT CAT ATG AAT TAG GTG ACC GAC GGT ATC GG 3', SEQ ID NO: 89),
and 100 ng/pl of 3' ds-primer (5' CAG CGG ATA ACA ATT TCA CAC AGG GAG
CTC CAC CGC GGT GGC GGC C 3', SEQ ID NO: 90). After addition of the PCR
template, PCR was performed using the following program: 94°C, 4
minutes and 25
cycles of 94°C, 20 seconds; 65°C, 20 seconds; 72°C, 20
seconds; and 72°C 4 minutes.
The resulting amplified adapted PCR product was gel purified as described
above.
The purified ds-extended PCR product was sequenced using a standard protocol
for ABI 3700 sequencing. Briefly, triplicate reactions in forward and reverse
orientation
(6 total reactions) were prepared, each reaction containing 5 p1 of gel
purified ds-
extended NS PCR product as template. In addition, the sequencing reactions
contained 2
p1 2.5X sequencing buffer, 2 p1 Big Dye Terminator mix, 1 p1 of either the 5'
sequencing
primer (5' CCC AGT CAC GAC GTT GTA AAA CG 3', SEQ ID NO: 91), or the 3'
sequencing primer (5' TTT TTT TTT TTT TTT TTT V 3', where V=A, C, or G, SEQ ID
NO: 92) in a total volume of 10 p1.
In an alternate embodiment, the 3' sequencing primer was the sequence 5' GGT
GGC GGC CGC AGG AAT TTT TTT TTT TTT TTT TT 3', (SEQ ID NO: 93). PCR
was performed using the following thermal cycling program: 96°C, 2
minutes and 29
cycles of 96°C, 1 S seconds; 50°C, 1 S seconds; 60°C, 4
minutes.
The sequences for (CLZ 62, SEQ ID NO: 71 and CLZ 65, SEQ ID NO: 72) were
determined by this method. Table 2 contains the database matches for the
sequences
determined by this method.
87
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
In order to verify that the sequences determined by direct sequencing derive
from
the PCR product of interest, PCR primers were designed based on the sequences
determined by direct sequencing, and PCR reactions were performed using the N1
TOGA
PCR reaction products as substrate, as described above fo'r the sequences
cloned into the
TOPO vector. In short, oligonucleotides were synthesized with the sequence G-A-
T-C-
G-A-A-T-C extended at the 3' end with a partial MspI site (C-G-G) and an
additional 18
nucleotides adjacent to the partial MspI site from the sequence determined by
direct
sequencing. The 5' PCR primers were paired with the fluorescent labeled
universal 3'
PCR primer (SEQ ID NO: 23) in PCR reactions with the N1 TOGA PCR reaction
product as template. The lengths of these PCR products were compared to the
length of
the PCR products of interest. Table 3 contains the sequences of the primers
used in these
studies.
Verification of a Candidate Match Zlsing Extended TOGA Method
In four cases, CLZ-17, (SEQ ID NO: 49); CLZ_26, (SEQ ID NO: 50); CLZ 28,
(SEQ ID NO: S1); and CLZ_ 58 (SEQ ID NO: 52) the sequences listed for the TOGA
PCR products were derived from candidate matches to sequences present in
available
Genbank, EST, or proprietary databases. Table 4 lists the candidate matches
for each by
accession number of the Genbank entry or by the accession numbers of a set of
computer-assembled ESTs used to create a consensus sequence.
To determine whether the TOGA PCR products of interest were derived from the
sequence of the candidate match, PCR primers were designed with the sequence G-
A-T-
C-G-A-A-T-C extended at the 3' end with a partial MspI site (C-G-G), and an
additional
18 nucleotides adjacent to the terminal MspI site in the candidate match
sequence. Each
extended primer is combined with the fluorescent labeled universal 3' PCR
primer (SEQ
ID NO: 23) in a PCR reaction with the product of the first TOGA PCR reaction
(N1
reaction products) as the template. The PCR products obtained using an
extended primer
and the universal 3' primer were compared to products obtained using the
original TOGA
PCR primers. Primers designed for such studies are shown in Table 4 along with
the
accession numbers of sequences used to derive the primer sequences.
88
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
EXAMPLE 2
Characterization of CLZ 5 (apoD)
Another example of TOGA analysis is shown in Figure 3. In Figure 3, a peak at
about 201 is indicated, identified by digital address MsnI CACC 201 when a 5'
PCR
primer (SEQ ID NO: 25) was paired with SEQ ID NO: 23 to produce the panel of
PCR
products. The PCR product was cloned and sequenced as described in Example 1.
To
verify the identity of the isolated clone (SEQ ID NO: 2), oligonucleotides
were
synthesized corresponding to the 5' PCR primer in the second PCR step for each
candidate extended at the 3' end with an additional 12-15 nucleotides from the
cloned
sequence. In this case the 5' PCR primer was G-A-T-C-G-A-A-T-C-C-G-G-C-A-C-C-T-
A-C-T-G-G-A-T-C-C-T-G-G (SEQ ID NO: 29). This 5' PCR primer were paired with
the fluorescently labeled 3' PCR primer (SEQ >D NO: 23) in PCRs using the cDNA
produced in the first PCR reaction as substrate.
As shown in Tables 2 and 3, the CLZ 5 clone (CACC 201) described above
corresponds with GenBank sequence X82648, which is identified as a mouse
apolipoprotein D (apoD) sequence. Other corresponding apoD GenBank sequences
include L39123 (mouse), X55572 (rat), NM_001647 (human). Northern Blot
analyses
were performed to determine the effect of clozapine and haloperidol on apoD
expression
in mouse striatum/nucleus accumbens. Also, in situ hybridization analyses were
performed to determine the pattern of apoD expression in control and clozapine-
treated
mouse striatum/nucleus accumbens.
Male C57B1/6J mice (20-28 g) were housed in groups of four on a standard 12/12
hour light-dark cycle with ad libitum access to standard laboratory chow and
tap water.
The same experimental paradigm used in Example 1 was used for the Northern
Blot
analyses. Briefly, the control group mice received a single injection of
sterile saline (0.1
ml volume), or no injection, and were sacrificed after 45 minutes. The mice
subjected to
acute neuroleptic treatment were given a single intraperitoneal injection of
the typical
neuroleptic, haloperidol, (4 mg/kg) or the atypical neuroleptic, clozapine
(7.5 mg/kg) and
89
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
sacrificed after 45 minutes or 7 hours, as described in Example 1. The mice
subjected to
chronic neuroleptic treatment received daily subcutaneous injections of
haloperidol (4
mg/kg) for 10 days or 14 days, or received daily inj ections of clozapine (7.5
mglkg) for 5
days, 12 days or 14 days. All animals were sacrificed in their cages with COZ
at the
indicated times. Brains were rapidly removed and placed on ice. The striatum,
including
the nucleus accumbens, were dissected out and placed in ice-cold phosphate-
buffered
saline. The cytoplasmic RNA was isolated by phenol:chloroform extraction of
the
homogenized tissue according to the method described in Schibler et al., .l.
Mol. Bio.,
142, 93-116 (1980). Poly A enriched mRNA was prepared from cytoplasmic RNA
using
well-known methods of oligo dT chromatography.
Shown in Fig. 4, Northern Blot analysis was performed using 2 ~g poly A
enriched mRNA extracted from the striatum/nucleus accumbens of control mice
and
clozapine-treated mice. The mRNA transcripts were fractionated by
electrophoresis on a
1.5% agarose gel containing formaldehyde, transferred to a biotrans membrane
by the
method of Thomas (Thomas, P. S., Proc. Natl. Acad. Sci., 77,5201-5215 (1980)),
and
prehybridized for 30 minutes in Expresshyb (Clonetech). A 160 by insert of CLZ
5 (25-
100 ng) was labeled with [a 32P]-d CTP by oligonucleotide labeling to specific
activities
of approximately SxlOg cpm/p.g, added to the prehybridization solution and
incubated for
1 hour. Filters were washed to high stringency (0.2 X SSC) (1 X SSC: 0.015 M
NaCI
and 0.001 S M Na citrate) at 68°C then exposed to Kodak X-AR film
(Eastman Kodak,
Rochester, NY) for up to 1 week. Densitrometry analysis on Northern blots was
performed by ImageQuant software.
As can be seen in Fig. 4, a 900 by mRNA was detected in control and clozapine-
treated mice which corresponds with the apoD gene. The apoD mRNA expression is
progressively up-regulated with clozapine treatment over the two-week time
course. It is
possible that clozapine may mediate its antipsychotic effect through the
regulation of
apoD. Alternatively, apoD may be co-regulated by clozapine, in parallel with
the
mechanism of the clozapine therapeutic effects, and can serve as an indicator
of clozapine
bioactive levels.
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
Shown in Fig. S, Northern Blot analysis was performed using mRNA extracted
from the striatum/nucleus accumbens of control mice and haloperidol-treated
mice using
the above-described method and the same 32P-radiolabelled probe. A 900 by mRNA
was
detected in control and haloperidol-treated mice which corresponds with the
apoD gene.
Interestingly, apoD mRNA expression is slightly down-regulated with acute and
chronic
haloperidol treatment. These results reveal that clozapine and haloperidol
have a
differential effect on apoD expression.
Figure 6 is a graphical representation comparing the results of the clozapine
treatment TOGA analysis of clone CLZ 5 (CACC 201) shown in Fig. 4 and the
clozapine treatment Northern Blot analysis of clone CLZ 5 shown in Figure 5.
The
Northern Blot was imaged using a phosphoimager to determine the amount of apoD
mRNA in each clozapine-treated sample relative to the amount of mRNA in the
control
sample. As can be seen, the clozapine treatment TOGA analysis shows
correlation with
the clozapine treatment Northern Blot analysis.
Figure 7A-C shows an in situ hybridization analysis, demonstrating the apoD
expression in mouse brain. The in situ hybridization was performed on free-
floating
sections (25 pM thick) as described (Thomas et al., J. Neurosci. Res., 52, 118-
124
(1998)). Coronal sections were hybridized at 55°C for 16 hours with an
35S-labeled,
single-stranded 160 by antisense cRNA probe of CLZ 5 at 10' cpm/ml. The probe
was
synthesized from the 3'-ended cDNA TOGA clone CLZ-5 using the Maxiscript
Transcription Kit (Ambion, Austin, TX). Excess probe was removed by washing
with 2
X SSC (I X SSC = 0.015 M NaCI/0.0015 M Na citrate) containing 14 mM (3-
mercaptoethanol (30 minutes), followed by incubation with 4 pg/ml ribonuclease
in 0.5
M NaCI/0.05 M EDTA/0.05 M Tris-HCI, pH 7.5, for 1 hour at 37°C. High
stringency
washes were carried out at 55°C for 2 hours in 0.5 X SSC/50%
formamide/0.01 M (3-
mercaptoethanol, and then at 68°C for 1 hour in 0.1 X SSC/0.01 M (3-
mercaptoethanol/0.5% sarkosyl. Slices were mounted onto gelatin-coated slides
and
dehydrated with ethanol and chloroform before autoradiography. Slides were
exposed
91
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
for 1-4 days on Kodak X-AR film and then dipped in Ilford K-5 emulsion. After
4
weeks, slides were developed with Kodak D 19 developer, fixed, and
counterstained with
Richardson's blue stain.
Fig. 7A shows CLZ-5 (apoD) mRNA expression in mouse anterior brain, 7B
shows apoD mRNA expression in midbrain and 7C shows apoD expression in
posterior
brain. In all brain sections apoD is expressed by astroglial cells, pial
cells, perivascular
fibroblasts and scattered neurons. This is consistent with previous studies
examining the
expression of apoD in mice, rabbits and humans (Yoshida et al., DNA and Cell
Biology,
15, 873-882 (1996); Provost et al., J. Lipid Res., 32, 1959-1970 (1991);
Navarro et al.,
Neurosci. Lett., 254, 17-20 (1998).
The Northern blot results (Figures 4 and 6) indicated that apoD was induced by
clozapine in the striatum of mouse brain. To investigate additional sites of
apoD
induction, in situ hybridization analysis was performed on brains from saline-
and
clozapine-treated mice. Figure 8A-I presents an in situ hybridization
analysis, showing
clone CLZ_5 (apoD) mRNA expression in mouse anterior (8A-C), mid (8D-F), and
posterior (8G-I) brain following saline treatment (top row) or clozapine
treatment (7.5
mg/kg) for 5 days (middle row) and 14 days (bottom row), using previously
described
methods. Animals were sacrificed by intracardial perfusion with 4%
paraformaldehyde
and the brains removed, post-fixed for 12 hours, cryoprotected with 30%
sucrose and
rapidly frozen at -70°C. At low magnification, increases in apoD mRNA
were observed
at both five days and two weeks of clozapine treatment in the striatum,
cortex, globus
pallidus (GP), and thalamus. Increases in apoD expression were also detected
in white
matter tracts, predominantly the corpus callosum (cc), anterior commissure,
internal
capsule (ic) and optic tract (opt). At high magnification, it was evident that
the increased
apoD hybridization signal in the striatum, globus pallidus, and thalamus of
the drug-
treated animals was primarily due to an increase in the number of cells
expressing
detectable apoD, although some cells with higher apoD expression were also
observed.
92
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
Using a monoclonal antibody directed against full-length apoD,
immunohistochemistry analyses were performed to evaluate changes in apoD
protein
expression in response to clozapine. Increase in protein expression correlated
well with
increases in mRNA expression (data not shown). Combined in situ hybridization
and
immunohistochemical studies demonstrated that increases in apoD levels were
localized
primarily to neurons and astrocytes of the striatum and oligodendrocytes in
various white
matter tracts throughout the brain.
Figure 9A-H shows a darkfield photomicrograph demonstrating upregulated apoD
mRNA expression in various brain regions, including the corpus callosum (cc,
Fig. 9A,
E); caudate putamen (CPu, Fig. 9B, 7F); anterior commissure (ace, Fig. 9C,
9G); and
globus pallidus (GP, Fig. 9D, 9H). In situ hybridizations were perfomed as
described
above, using an antisense 35S-labeled apoD riboprobe on brains from control
(Fig. 9A-D)
and clozapine-treated (Fig. 9E-H) animals. The observed upregulation of apoD
was due
to an increase in the amount of apoD expressed per cell.
Figure 1 OA, B shows a darkfield photomicrograph demonstrating upregulated
apoD mRNA expression in the internal capsule (ic). Figure IOC, D shows a
brightfield
view of the optic tract (opt) demonstrating upregulation of apoD expression in
oligodendrocytes. In situ hybridizations were perfomed as described above,
using an
antisense 35S-labeled apoD riboprobe on brains from control (10A, C) and
clozapine-
treated ( l OB, D) animals. As shown in Fig. l OD, the cells prominently
expressing apoD
in the optic tract have a box-like morphology and are lined up in a serial
array,
presumably along axonal tracts. Such features are characteristic of
oligodendrocytes,
which synthesize the insulating myelin coating of nerve fibers. In situ
hybridization
experiments performed on brains from haloperidol-treated mice did not reveal
substantial
increases in apoD expression in gray or white matter regions (data not shown).
White matter tracts comprise nerve fiber bundles connecting different regions
of
the brain. The predominant cells in these regions are astrocytes and
oligodendrocytes,
both of which have been shown to express apoD (Boyles et al., JLipid Res
31:2243-2256
93
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
(1990); Navarro et al., Neurosci Lett 254:17-20 (1995); Provost et al., JLipid
Res 32
(1991)). To determine which cell types are responsible for the increase in
apoD signal,
co-localization studies were performed using a 355-labeled apoD riboprobe in
combination with either an antibody specific for an astrocyte marker, glial
fibrillary
acidic protein (GFAP), or an antibody specific for an oligodendrocyte marker,
2', 3'-
cyclic nucleotide 3'-phosphodiesterase (CNP) (Boehringer Mannheim, Germany).
The
immunoreaction was detected with Vectastain ABC TM kit (Vector Laboratory,
Inc.,
Burlingame, CA) according to the manufacturer's instructions.
Free floating brain sections were incubated with blocking solution (4% bovine
serum albumin in 0.1% Triton X-100/PBS) for 2 hours at room temperature,
followed by
incubation with anti-GFAP or anti-CNP antiserum (dilution 1:500) in blocking
solution
for 16-20 hours at 4°C. Sections were then washed with 0.1% Triton X-
100/PBS and
incubated with secondary biotinylated antibody (1:200 dilution in blocking
solution) for 2
hours at room temperature. The sections were then washed with 0.1% Triton X-
100/PBS,
incubated for 1 hour with ABC reagent (1:1 in blocking solution) and finally
washed with
0.1% Triton X-100/PBS. Enzymatic development was performed in 0.05%
diaminobenzene in PBS containing 0.003% hydrogen peroxide for 3-5 minutes.
Fig. 11 shows sections of striatum and optic tract in control and clozapine-
treated
animals. Thick arrows indicate the co-localization of GFAP and apoD, while
thin arrows
indicate the expression of apoD alone. Fig. 11A, B shows that in untreated
striatum,
many GFAP-positive cells in both gray and white matter regions are positive
for apoD.
Fig. 11D, E shows that in brain from clozapine-treated animals, an increase in
the amount
of apoD was observed in a small subset of GFAP-positive cells in the striatum.
Additionally, there was an increase in the number of non-GFAP-positive cells
expressing
apoD in the striatum, as well as the globus pallidus and thalamus which are
presumptively neurons, based on size and morphology.
Fig. 11 C, F shows GFAP and apoD co-localization in the optic tract in control
(11C) and clozapine-treated (11F) animals. While some astrocytes express apoD
mRNA,
94
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
the cells responsible for the predominant apoD transcript upregulation did not
label with
GFAP and thus are likely oligodendrocytes. In other white matter regions, such
as the
corpus callosum, anterior commissure and internal capsule, the non-GFAP
expressing
cells that express apoD are likely to be oligodendrocytes as well, although
expression in
microglia can not be ruled out. Fig. 11 G, H shows apoD immunohistochemistry
with an
anti-human apoD primary antibody (Novocastra, Newcastle, UK) in the optic
tract of
control saline (11G) and clozapine-treated animals (11H).
Co-localization studies performed using anti-CNP antibody showed CNP
immunoreactivity in white matter tracts throughout the CNS which correlated
with areas
of apoD mRNA hybridization signals, indicating the expression of apoD in
oligodendrocytes. However, within the gray matter regions of the striatum,
there was no
co-localization consistent with the neuronal accumulation of apoD (data not
shown).
Figure 12 shows a Northern Blot analysis of clone CLZ 5 expression in cultured
glial cells treated with clozapine (100 nM and 1 pM) for 1 day or 7 days.
Glial cell
cultures were produced from postnatal (day 2) rats. The cells were treated
with different
concentrations of clozapine for different lengths of time before mRNA
extraction as
follows: A= control (no clozapine), B= 100 nM clozapine, 1 day, C= 1 pM
clozapine, 1
day, D= 100 nM clozapine, 1 week, E= 1 ~M clozapine, 1 week. 20 pg of total
cytoplasmic RNA from glial cell cultures were electrroproresed on a 1.5%
agarose gel
containing formaldehyde, blotted, and probed as previously described.
Interestingly,
apoD mRNA levels were down-regulated in mixed glial cell cultures treated with
clozapine (both 100 nM and 1 pM) for 1 week, suggesting that perhaps neurons
and glia
display different mechanisms for apoD regulation.
TOGA methodology, Northern blot analyses, and in situ hybridization studies
have demonstrated an increase in apoD mRNA expression in both white and gray
matter
regions of mouse brain in response to chronic clozapine administration.
Colocalization
studies, combining in situ hybridization and imunohistochemistry methods have
revealed
that apoD mRNA levels are increased in both neurons and glial cells with
clozapine
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
administration. The evidence indicates that the glial cells responsible for
the most
dramatic increases in apoD expression are primarily oligodendrocytes, but a
subset of
astrocytes also have increased apoD expression after clozapine treatment. In
contrast,
TOGA, Northern blot and in situ hybridization analyses showed that apoD
expression
was not affected by haloperidol treatment.
In addition to the mouse studies described above which show that apoD is
regulated by chronic antipsychotic drug administration, studies using
schizophrenic and
bipolar human subjects showed that apoD expression is increased in the
prefrontal cortex
of such patients. The combined results suggest that apoD is a marker for
neuropathology
associated with psychiatric disorders and therefore can be used to target
abnormalities in
specific anatomical brain regions.
ApoD was initially identified as a constituent of plasma high-density
lipoproteins
(HDLs), which also contain phospholipids, cholesterol and fatty acids
(McConathy et al.,
Fed. Eur. Biochem. Soc. Lett., 37: 178 (1973)). In the blood, apoD is thought
to play a
role in reverse cholesterol transport, the removal of excess cholesterol from
tissues to the
liver for catabolism (Oram et al., J. Lipid. Res., 37: (1996)). In addition to
abundant
expression in human serum, apoD is major protein component in cyst fluid from
women
with human breast cystic disease (Balbin et al., Biochem. .1., 271: 803
(1990)) and also is
widely expressed in numerous tissues, including liver, kidney, intestine,
spleen and brain
(Drayna et al., J. Biol. Chem., 261: (1986)). In the CNS of humans, as in
other species
(Provost et al., J. Lipid Res., 32: (1991); Seguin et al., Mol. Brain Res.,
30: 242 (1995);
Smith et al., J. Lipid Res., 31: 995 (1990)), apoD is expressed primarily in
glial cells, pial
cells, perivascular cells, and some neuronal populations (Navarro et al.,
Neurosci. Lett.,
254: 17 (1995); Kalman et al., Neurol. Res., 22: 330 (2000)). The
physiological role for
apoD within the CNS is not known, however, it has been shown to bind several
hydrophobic ligands, including sterols and steroid hormones (Dilley et al.,
Breast Canc.
Res. Treat., 16: 253 (1990); Lea, O. A., Steroids, 52: 337 (1988)) suggesting
a role in
extracellular lipid transport in the brain. ApoD has also been shown to bind
arachidonic
acid Morais-Cabral et al., FEBS Lett., 366: 53 (1995)) implicating it in
functions
96
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
associated with cell membrane remodeling and prostaglandin synthesis. In the
regenerating sciatic nerve, a process that involves massive membrane
degradation and
lipid release, apoD concentrations are increased S00-fold (Boyles et al., J.
Biol. Chem.,
265: 17805 (1990)). Recent reports have also demonstrated an increase in apoD
expression in rat brain after experimental and chemical lesioning of the
entorhinal cortex
and hippocampus, respectively (Ong et al., Neurosci., 79:359 (1997); Terisse
et al., Mol.
Brain Res.,70: 26 (1999)). Additionally, in humans, apoD accumulates in the
cerebrospinal fluid and hippocampi of patients with Alzheimer's, and other
neurological
diseases (Terisse et al., J. Neurochem., 71: 1643 (1998)). Hence, apoD may be
functioning during pathological situations or its expression may represent an
effort to
compensate for neuropathology associated with such insults.
The pattern of apoD expression in the brain suggests that apoD may play an
important role in psychotic disease. It is widely believed that imbalances in
basal ganglia
circuitry contribute to psychotic behaviors and that blockade of specific
receptors in these
regions is responsible for neuroleptic action. The neuronal increases in apoD
mRNA
expression observed in neurons of the striatum and globus pallidus are
consistent with
this hypothesis.
In addition, the apoD induction observed in the internal capsule is of
particular
interest. The internal capsule consists of massive nerve fibers connecting the
thalamus to
the cortex and is an area of convergence for the fiber tracts running
transversely through
the striatum. The thalamus is a relay station for virtually all information
passing to the
cortex and coordinated cortico-thalamic activity is essential for normal
consciousness.
Recent theories have associated psychotic behavior with disruptions in cortico-
thalamic
oscillations. An upregulation of apoD expression in the internal capsule may
play a role
in restoring the proper balance of neuronal communication.
In addition, abnormal lipid neurochemistry resulting from abnormal lipid
transport or metabolism has been associated with psychotic disease, such as
schizophrenia (Walker et al., Br. J. Psych., 174, 101-104 (1999)). Relating
impaired
97
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
cholesterol metabolism with psychotic disease, a number of reports have
described
psychoses as an initial manifestation of Neimann-Pick Disease, type C (Campo,
et al.,
Develop. Med. and Child Neurol., 40, 126-129 (1998); Shulman, et al.,
Neurology, 45,
1739-1743 (1995); Turpin, et al., Dev. Neurosci., 13, 304-306 (1991)), which
is an
autosomal recessive disease associated with abnormal cholesterol metabolism
(Yoshida
et al., DNA and Cell Biology, 15, 873-882 (1996)). Further reports have
suggested that
myelin dysfunction may cause mental illness. Given that the majority of
cholesterol in
the brain is incorporated into myelin, abnormal cholesterol metabolism may
result in
myelin dysfunction. Myelin acts as an insulator along nerve axons allowing for
the rapid
propagation of action potentials along nerve fibers. Molecular abnormalities
of myelin
may result in the dysregulated neural connectivity that has been hypothesized
to be
causative in mental illnesses (Weickert, et al., Schizophrenia Bull., 24, 303-
316 (1998)).
While the physiological function of apoD in the CNS is not clear, several
lines of
evidence suggest a role for apoD as a vehicle for extracellular lipid
transport and lipid
movement, particularly cholesterol, in the nervous system. ApoD is a
constituent of
plasma high-density lipoproteins (HDLs), which also contain phospholipids,
cholesterol
and fatty acids. While not much is known about HDL compared to the other
plasma
lipoproteins, LDL and VLDL, it is widely believed that HDLs protect against
cardiovascular disease by removing excess cholesterol from cells of arterial
walls. This
removal involves the direct interaction of HDL lipoproteins with plasma
membrane
domains and subsequent transport to the liver for catabolism (Gram, et al., J.
Lipid Res.,
37, 2473-2491 (1996)). Additionally, apoD is synthesized and secreted by
cultured
astrocytes, which secretion has been shown to increase in the presence of
cholesterol
derivatives (Patel, et al., Neuroreport 6, 653-657 (1995)). Further, it has
also been
demonstrated that apoD levels are increased in Niemann Pick Disease, type C,
which is
associated with elevated levels of cholesterol. These studies provide evidence
of a
functionally significant role for apoD in cholesterol transport in the CNS.
In addition to the studies correlating cholesterol levels and psychotic
behavior,
other studies have found a correlation between cholesterol levels and
treatment with
98
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
neuroleptics. For example, reports dating back to 1960 have demonstrated an
increase in
the serum cholesterol of patients treated with conventional neuroleptics, such
as
chlorpromazine and haloperidol (Spivak et al., Clin. Neuropharm., 22, 98-101
(1999).
Fleischhacker et al., Pharmacopsychiatry, 19, 111-114 (1986); Clark et al.,
Clin. Pharm.
and Therapeutics, 11, 883-889 (1970)). However similar increases are not
observed with
the newer, atypical antipsychotics, such as fluperlapine and clozapine (Spivak
et al., Clin.
Neuropharm., 22, 98-101 (1999). Fleischhacker et al., Pharmacopsychiatry, 19,
111-114
(1986); Boston, et al., Biol. Psych., 40, 542-543 (1996)). Interestingly, the
present results
reveal that clozapine and haloperidol have a differential effect on apoD
expression, which
may account for the observed differences in cholesterol regulation. While the
mechanism
for these cholesterol changes is not known, the present data suggest that
neuroleptic-
induced changes in apoD expression combined with the ability of apoD to bind
cholesterol may provide an explanation for the neuroleptic-induced changes in
cholesterol levels.
In addition to studies relating to cholesterol movement, reports have focused
on
the link between disrupted phospholipid and fatty acid metabolism and
psychiatric
disorders (for a review see Horrobin, et al., Prostaglandins, Leukotrienes and
Essential
Fatty Acids, 60, 141-167 (1999)). For example, numerous studies have reported
differences in levels of total membrane phospholipid content, fatty acid
levels,
cholesterol levels and cholesteryl esters in fibroblasts and/or frontal cortex
of
schizophrenics (Keshavan et al., .JPsychiatry Res., 49, 89-95 (1993); Mahadik
et al.,
Schizophrenia Res. 13, 239-247 (1994); Sengupta et al., Biochem. Med., 25, 267-
275
(1981); Stevens, Schizophr. Bull., 6, 60-61 (1972)). Membrane phospholipids
act as
precursors in numerous signaling systems (e.g., inositol phosphates,
arachidonic acid,
platelet activation factors, and eicosaniods) and comprise the membrane
environment for
neurotransmitter-mediated signal transduction. Thus, altered membrane
phospholipid
metabolism could have significant consequences for neuronal communication,
resulting
in behavioral abnormalities.
99
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
Alterations in plasma membrane structure and function may result from the
altered content and distribution of membrane lipids and fatty acids, such as
arachidonic
acid. Arachidonic acid is released by the action of numerous phospholipase
enzymes,
primarily phospholipase A2, and is a substrate for prostglandins and
leukotriene
synthesis. While the molecular mechanisms underlying abnormalities in the
complex
system of phospolipid biochemistry are not known, several groups have
demonstrated an
increase in phospholipase A2 activity in the plasma and brains of
schizophrenic patients
(Gattaz et al., Biol. Psychiatry., 22, 421-426 (1987); Ross et al., Arch. Gen.
Psychiatry.,
54, 487-494 (1997); Ross et al., Brain Research, 821, 407-413 (1999)). In
addition,
plasma phospholipase A2 levels have been shown to be decreased after
neuroleptic
therapy (Gattaz et al., Biol. Psychiatry, 22, 421-426 (1987)). Other molecular
candidates
implicated in psychotic disease include phospholipase C enzymes, diacyl
glycerol
kinases, and inositol phosphates (Horrobin et al., Prostaglandins,
Leukotrienes and
Essential Fatty Acids, 60, 141-167 (1999)).
Interestingly, in addition to binding cholesterol, apoD has been shown to
specifically bind arachidonic acid. ApoD is an atypical apolipoprotein in that
it does not
share sequence homology with other apolipoproteins (Weech et al., Prog. Lipid
Res., 30,
259-266 (1991)) but, rather, is a member of the lipocalin superfamily of
proteins, which
function in the transport of small hydrophobic molecules, including sterols,
steroid
hormones, and arachidonic acid (Balbin et al., Biochem. J., 271, 803-807
(1990); Dilley
et al., Breast CancerRes. Treat., 16, 253-260 (1990); Lea, Steroids, 52, 337-
338 (1988);
Boyles et al., J. Lipid Res., 31, 2243-2256 (1990)). As a lipid binding
protein, apoD can
affect fatty acid composition, cholesterol levels and membrane phospholipids,
all of
which will affect plasma membrane composition and structure. Also, since apoD
specifically binds cholesterol, arachidonic acid and other lipids, alterations
in the levels
of apoD can affect lipid metabolism and signal transduction by affecting
substrate
availability for these pathways.
Further implicating the role of apoD in psychosis is the observation that apoD
may have a chromosomal linkage with schizophrenia. The chromosomal location of
100
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
apoD is 3q26. Genetic studies have implicated a potential association between
schizophrenia and chromosome 3q, however the linkage is relatively
inconsistent
(reviewed by Maier, et al., Curr. Opin. Psych., 11, 19-25 (1998)).
Northern blot analysis on striata from haloperidol-treated mice did not reveal
similar increases in apoD expression as clozapine. Schizophrenia is a
heterogeneous
disorder encompassing many subtypes. The observed differences in clinical
efficacy
between clozapine and haloperidol may reflect different subtypes of
schizophrenia that
are associated with different pathways or mechanisms. Thus, regulation of apoD
may
represent a unique mechanism of action for clozapine.
In this regard, a serotonin sub-type such as SHT2a and SHT2~ may provide a
pharmacological mechanism for clozapine's effect on apoD expression.
Preliminary
results demonstrate that treatment with ketanserin and mesulergine, SHT2~z~
and SHT2
selective antagonists respectively, results in an apparent upregulation of
apoD mRNA
expression in mouse brain. It is known that the striatum expresses a number of
SHT
receptor subtypes, including the SHT2~, which subtype may mediate clozapine's
effect on
apoD expression. In contrast, cultured glial cells or astrocytes do not appear
to express
SHT2~ receptors. Thus the downregulation observed in these cells may reflect
actions at a
different SHT subtype, such as SHTZa, or a different receptor. Additionally,
in
hypertension studies, ketanserin has been associated with a decrease in total
cholesterol
levels and an upregulation of another apolipoprotein, apo A1 (Loschiavo, et
al., Int. J.
Clin. Pharmacol. Ther. Toxicol., 28, 455-457 (1990)). The similar effects
observed by
both ketanserin and clozapine suggest that they may be working through the
same
receptor subtype(s).
The finding that apoD mRNA levels are increased by clozapine links
apolipoproteins and the mechanism of action of neuroleptic drugs. The proposed
role of
apoD in CNS lipid transport, combined with the recent evidence that
schizophrenia and
other neuropsychiatric illnesses are accompanied by abnormalities in lipid
metabolism,
suggest that apoD could play an important role in the action of clozapine.
101
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
EXAMPLE 3
Characterization of CLZ 40
Male C57B1/6J mice (20-28 g) were housed as previously described in Example
1. The same experimental paradigm used in Example 1 for clozapine treatment
was used
for the various analyses described below. Briefly, in the clozapine studies,
the control
group mice received a single injection of sterile saline (0.1 ml volume), or
no injection,
and were sacrificed after 45 minutes. The mice subjected to acute clozapine
treatment
were given a single intraperitoneal injection of clozapine (7.5 mg/kg) and
sacrificed after
45 minutes or 7 hours, as described in Example 1. The mice subjected to
chronic
clozapine treatment received daily subcutaneous injections of clozapine (7.5
mg/kg) for 5
days, 12 days or 14 days. All animals were sacrificed in their cages with C02
at the
indicated times. Brains were rapidly removed and placed on ice. The striatum,
including
the nucleus accumbens, were dissected out and placed in ice-cold phosphate-
buffered
saline. The mRNA was prepared according to the method described in Example 2.
For the morphine studies, male C57B1/6J mice (20-28 g) were housed as
previously described in Example 1 and divided into the following groups:
1) a control group, in which the mice were subcutaneusly implanted with one
placebo pellet upon halothane anaesthesia;
2) an acute morphine group, in which the mice received a morphine
intraperitoneal
injection of 10 mg/kg;
3) a chronic or tolerant group, in which mice were rendered drug-tolerant and
dependent by means of subcutaneous implantation of a single pellet containing
75 mg of
morphine free base for 3 days; and
4) a withdrawal group, in which the mice rendered tolerant to morphine were
injected intraperitoneally with naltrexone 1 mg/kg. Animals were sacrificed in
their cages
with COZ at 72 hours after placebo or morphine pellet implantation, or 4 hours
a$er single
injection of morphine, or 4 hours after administration of naltrexone to
morphine-tolerant
mice. Their brains were rapidly removed. The striatum, including the nucleus
accumbens,
102
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
and block of tissues containing the amygdala complex were dissected under
microscope and
collected in ice-cold RNA extraction buffer.
The TOGA data shown in Figures 13 and 14 were generated with a 5'-PCR
primer (C-G-A-C-G-G-T-A-T-C-G-G-T-T-G-T; SEQ ID NO: 26) paired with the
"universal" 3' primer (SEQ ID NO: 23) labeled with 6-carboxyfluorescein (6FAM,
ABI)
at the 5' terminus. PCR reaction products were resolved by gel electrophoresis
on 4.5%
acrylamide gels and fluorescence data acquired on ABI377 automated sequencers.
Data
were analyzed using GeneScan software (Perkin-Elmer).
The results of TOGA analysis using a 5' PCR primer with parsing bases C-G-A-
C-G-G-T-A-T-C-G-G-T-T-G-T (SEQ ID NO: 26) are shown in Figs. 13 and 14, which
show PCR products produced from mRNA isolated from the striatum/nucleus
accumbens
of mice treated with clozapine (Fig. 13) or morphine (Fig. 14). In Fig. 13,
the vertical
index line indicates a PCR product of about 266 b.p. that is present in
control cells, and
whose expression decreases in the striatum/nucleus accumbens of mice treated
with
clozapine for 45 minutes, 7 hours, S days, 12 days, and 14 days. The down-
regulation of
CLZ_40 occurs as early as 45 minutes following clozapine treatment and remains
downregulated for at least 14 days.
In Fig. 14, the vertical index line indicates a PCR product of about 266 b.p.
that is
present in control cells, and whose expression differentially regulated in
control striatum
(PS), acutely treated striatum (AS), withdrawal striatum (WS), control
amygdala (PA),
acutely treated amygdala (AA), chronically treated amygdala (TA), and
withdrawal
amygdala (WA). The expression of CLZ 40 product is greater in striatum than in
amygdala. Further, CLZ 40 displays chronic-specific or withdrawal-specific
regulation
in both of these brain regions. In striatum, CLZ 40 is downregulated in
withdrawal
striatum but not acutely treated striatum. In amygdala, CLZ 40 is slightly
upregulated in
acutely treated amygdala and increasingly upregulated in chronically treated
amygdala
and withdrawal amygdala.
103
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
Shown in Fig. 15, Northern Blot analysis was performed using mRNA extracted
from the striatum/nucleus accumbens of control mice and clozapine-treated
mice.
Briefly, an agarose gel containing 2pg of poly A enriched mRNA as well as size
standards was electrophoresed on a 1.5% agarose gel containing formaldehyde,
transferred to a biotrans membrane, and prehybridized for 30 minutes in
Expresshyb
(Clonetech). An 265 by insert of CLZ 40 (25-100 ng) was labeled with [a,-3zP]-
d CTP
by oligonucleotide labeling to specific activities of approximately SxlOg
cpm/~g and
added to the prehybridization solution and incubated 1 hour. Filters were
washed to high
stringency (0.2 X SSC) (1 X SSC: 0.015 M NaCI and 0.0015 M Na citrate) at
68°C then
exposed to Kodak X-AR film (Eastman Kodak, Rochester, NY) for up to 1 week. As
shown in Fig. 15, a 9-12 Kb transcript was detected in control and clozapine-
treated mice
which decreases dramatically after 45 minutes with clozapine treatment and
remains
down-regulated for at least 14 days.
Figure 16 is a graphical representation comparing the results of the clozapine
treatment TOGA analysis of clone CLZ 40 shown in Fig. 13 and the clozapine
treatment
Northern Blot analysis of clone CLZ_40 shown in Figure 15. The Northern Blot
was
imaged using a phosphoimager to determine the amount of CLZ 40 mRNA in each
clozapine-treated sample relative to the amount of mRNA in the control sample.
As can
be seen, the clozapine treatment TOGA analysis shows correlation with the
clozapine
treatment Northern Blot analysis.
Figure 17A-B is an in situ hybridization analysis, demonstrating CLZ 40 mRNA
expression in the mouse brain. In situ hybridization was performed on free-
floating
sections (25 p.M thick). Coronal sections were hybridized at 55°C for
16 hour with an
3sS_labeled, single-stranded antisense cRNA probe of CLZ 40 at 10' cpm/ml. The
probe
was synthesized from the 3'-ended cDNA TOGA clone using the Maxiscript
Transcription Kit (Ambion, Austin, TX). Excess probe was removed by washing
with 2
X SSC (I X SSC = 0.015 M NaCI/0.0015 M Na citrate) containing 14 mM (3-
mercaptoethanol (30 minutes), followed by incubation with 4 ~g/ml ribonuclease
in 0.5
M NaCI/0.05 M EDTA/0.05 M Tris-HCI, pH 7.5, for 1 hour at 37°C. High
stringency
104
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
washes were carried out at 55°C for 2 hours in 0.5 X SSC/50%
formamide/0.01 M (3-
mercaptoethanol, and then at 68°C for 1 hour in 0.1 X SSC/0.01 M (3-
mercaptoethanol/0.5% sarkosyl. Slices were mounted onto gelatin-coated slides
and
dehydrated with ethanol and chloroform before autoradiography. Slides were
exposed
for 1-4 days to Kodak X-AR film and then dipped in Ilford K-S emulsion. After
4 weeks,
slides were developed with Kodak D19 developer, fixed, and counterstained with
Richardson's blue stain. Interestingly, CLZ_40 mRNA is specifically expressed
in the
nucleus accumbens and pyriform cortex (Fig. 17A), and dentate gyrus (Fig.
17B), but is
not detected in any other brain regions.
At present, CLZ_40 (SEQ ID NO: 12) is of unknown identity. However, the
CLZ 40 DST has been PCR amplified and the extended sequence clone of CLZ 40
(SEQ ID NO: 13) matches an EST in the GenBank database (AI509550) as shown in
Table 4. The observation that CLZ 40 is down-regulated with clozapine
treatment
suggests a potential association with the therapeutic effects of clozapine.
Furthermore, its
highly unique gene expression pattern is like no other gene identified to
date, and its
presence in the nucleus accumbens may implicate CLZ 40 in a number of
fimctional
roles associated with this structure, namely limbic/mental behavior and
addiction.
Addiction to opiates and other drugs of abuse is a chronic disease of the
brain,
most likely resulting from molecular and cellular adaptations of specific
neurons to
repeated exposure to opiates (Leshner, A., Science, 278, 45-47 (1997)). An
important
neural substrate implicated in the opioid reinforcement and addiction is the
mesolimbic
system, notably the nucleus accumbens (Everitt, et al, Ann. N. Y. Acad. Sci.,
877, 412-438
(1999)). All highly addictive drugs, such as opiates, cocaine and
amphetamines, produce
adaptations in the neural circuitry of the nucleus accumbens, but the precise
relationships
are unknown. The molecular neuroadaptation which takes place in this structure
may
offer important insight into the mechanisms of drug addiction. CLZ_40 is a
likely
candidate for involvement in such mechanisms due to its specific expression in
the
nucleus accumbens. Elucidation of the biology underlying psychoses and
addiction is
105
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
key to understanding the underlying causes of such disorders and may lead to
the
development of more effective treatments, including anti-addiction
medications.
Furthermore, the behavioral mechanisms associated with addiction reflect
mechanisms of learning and memory (White, N., Addiction, 91, 921-949 (1996)).
The
hippocampal system has long been associated with learning and memory,
including forms
of conditional associative learning (Sziklas, et al., Hippocampus, 8, 131-137
(1998)),
which is the form of learning associated with addiction (Di Chiara, et al.,
Ann. N. Y. Acad.
Sci., 877, 461-85 (1999)). The expression of CLZ 40 in the hippocampus
suggests that
this gene may provide a link with such learning processes.
106
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
TABLE
1
Seq Clone Digital Control45 7 Hour5 Day 12 14 Day
ID ID Address minutes Day
(Mspl)
AAAA 276 314 189 183 299 292 227
AAAG 91 18 27 34 52 60 35
AAAG 446 135 127 219 245 529 210
AAAG 449 135 173 219 245 775 210
AACA 109 31 17 85 54 51 72
AACA 117 38 30 45 39 72 118
AACA 137 355 205 163 129 111 186
AACA 307 56 58 65 55 134 64
AACG 375 633 450 420 528 968 1015
AACG 498 717 221 349 438 1647 1392
AACT 85 481 139 145 108 281 580
AACT 112 297 162 391 538 330 555
AACT 392 176 267 427 303 296 315
AAGA 309 22 19 42 91 61 36
AAGA 324 37 15 12 83 31 46
AAGC 446 284 212 155 249 318 338
AAGC 498 456 369 309 495 735 862
AAGG 270 169 191 176 243 283 265
AAGG 457 191 129 152 228 269 320
AAGG 497 265 164 208 432 390 512
AAGT 282 75 73 82 84 204 105
AATA 90 47 46 39 74 115 65
60 CLZ 47 AATA 136 817 555 589 297 245 397
AATA 194 70 81 70 133 181 112
AATC 352 108 108 128 144 631 140
AATC 499 49 32 43 67 75 67
AATT 425 38 30 38 37 64 45
ACAA 80 92 67 109 319 353 110
ACAA 122 58 95 107 46 818 98
ACAA 239 117 45 133 49 217 137
ACAC 145 313 365 296 277 750 631
ACAC 273 163 169 262 274 800 338
ACAG 81 167 81 57 137 314 253
ACAG 270 117 94 117 93 236 213
ACAG 296 32 34 71 47 89 62
ACAG 413 39 43 52 43 88 81
ACAG 437 25 20 41 22 55 41
ACAT 94 91 151 149 91 340 195
ACCA 109 318 505 352 289 189 200
107
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
ACCA 418 33 28 46 40 65 39
ACCA 422 28 23 44 39 51 39
ACCC 394 32 55 40 38 162 37
ACCC 493 54 42 57 48 93 69
ACCG 90 181 155 184 217 382 208
ACCG 220 169 113 262 189 335 247
ACCG 489 33 30 28 44 63 41
ACCT 119 117 121 47 86 300 164
ACCT 490 78 76 57 120 165 133
ACGA 77 567 133 109 72 1143 1079
ACGA 92 61 56 56 76 195 63
ACGA 292 349 247 165 190 306 148
ACGC 78 243 31 51 236 2323 1676
ACGC 118 1026 737 849 292 442 513
ACGC 210 243 284 293 343 682 735
ACGC 284 27 50 60 195 159 94
ACGC 474 50 91 87 107 190 131
ACGG 264 140 108 117 115 294 172
ACGG 335 245 104 102 110 131 159
59 CLZ 44 ACGG 352 171 407 428 538 683 553
ACGG 382 37 53 113 154 141 103
ACGG 406 114 233 267 217 219 211
ACTA 88 28 37 33 29 219 41
ACTA 199 38 84 48 120 365 66
ACTC 88 64 30 71 124 108 81
ACTC 105 54 121 172 155 352 294
ACTG 266 23 35 116 35 87 44
ACTG 468 148 80 53 74 58 68
ACTT 436 490 549 450 494 435 504
AGAR 104 86 210 143 63 39 106
AGAR 196 62 75 43 85 172 97
AGAR 462 42 29 25 27 64 42
AGAC 410 362 307 538 530 918 442
AGAT 79 41 73 50 64 193 70
AGAT 251 622 622 746 691 562 696
AGAT 295 294 252 263 281 303 263
AGAT 456 603 525 571 639 588 559
AGCA 177 21 38 46 64 163 100
AGCC 295 661 444 517 421 360 475
AGCC 468 112 99 110 165 145 146
AGCG 202 385 349 433 339 334 334
AGCT 95 162 963 1168 2493 3990 1420
~AGCT 260 89 78 58 296 86 294
108
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
AGGA 426 365 532 720 670 896 802
AGGC 104 46 86 169 163 642 339
AGGG 177 739 251 249 210 174 408
AGGG 242 165 110 192 222 376 293
AGGG 492 35 48 33 46 98 75
AGGG 498 50 47 69 79 155 111
AGGT 99 55 36 55 80 83 61
AGGT 103 29 27 31 50 84 38
AGGT 119 835 719 808 518 466 643
1 CLZ AGTA 106 657 1677 1883 894 832 1282
3
AGTC 97 297 229 215 158 111 180
AGTC 178 519 351 238 263 353 269
AGTC 410 65 93 107 85 175 156
AGTG 498 532 851 1476 1209 2196 1092
AGTT 378 48 33 61 40 68 56
ATAA 183 428 319 426 353 915 583
ATAA 225 17 40 39 49 128 82
ATAG 94 52 98 63 343 469 76
ATAG 108 1111 995 933 833 713 869
ATAG 402 495 416 472 546 535 482
ATAT 140 37 20 44 53 45 57
ATCA 90 423 666 451 172 379 180
ATCA 199 774 588 493 335 336 352
ATCT 99 59 43 56 35 125 67
ATCT 392 139 176 287 262 569 226
ATGA 162 91 95 127 239 191 262
ATGC 78 138 91 111 190 466 148
ATGC 124 317 884 743 403 164 317
ATGC 236 15 23 76 7 54 119
ATGC 344 153 108 131 187 217 185
ATGG 96 118 231 173 115 113 305
ATGG 365 15 26 22 25 63 29
ATGT 378 28 47 90 54 108 80
ATGT 383 26 61 78 40 136 63
ATTA 256 36 29 27 46 61 81
ATTA 259 48 54 55 65 75 106
ATTG 88 100 147 147 262 318 114
ATTG 485 22 27 27 26 100 29
ATTT 186 87 60 58 64 190 122
ATTT 189 99 79 74 85 209 127
ATTT 313 79 49 94 86 511 197
ATTT 499 62 80 78 61 265 114
CAAA 423 398 255 395 302 506 434
109
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
CAAC 471 87 67 99 85 134 104
CAAC 474 93 77 109 85 151 128
CART 319 23 18 22 16 66 30
CACA 253 771 716 598 626 684 579
CACA 348 847 303 241 181 316 342
CACA 374 205 116 308 211 262 175
CACC 98 241 553 402 143 68 363
2 CLZ_5 CACC 201 382 653 727 782 775 903
14 CLZ 6 CACT 169 1576 1400 727 987 933 909
CAGA 119 388 129 217 102 115 119
65 CLZ 52 CAGA 146 737 728 643 511 354 332
CAGA 157 927 820 422 943 533 893
CAGA 214 118 94 79 129 229 163
CAGC 247 508 1511 557 483 531 527
CAGG 129 647 536 588 592 571 493
CATA 172 534 482 447 494 863 625
3 CLZ 8 CATC 98 94 333 253 141 76 212
CATC 135 350 483 606 403 299 464
CATG 78 78 58 56 98 126 217
CATG 197 406 401 421 474 427 318
64 CLZ 51 CATG 247 1740 1436 2195 3089 2713 4020
CATT 420 194 114 155 122 259 214
CATT 429 119 89 96 105 198 141
CATT 432 127 101 106 104 229 157
CCAC 404 28 12 23 37 51 93
CCAG 87 58 29 28 115 100 229
4 CLZ 10 CCAG 104 211 309 353 154 153 262
CCAT 119 122 38 91 35 113 179
CCAT 133 57 45 66 59 95 100
CCAT 296 16 34 7 8 80 56
CCAT 440 56 76 86 104 83 97
CCCC 123 474 860 910 628 277 698
CCCG 243 163 654 354 120 146 129
CCCG 277 218 282 257 310 660 337
CCCG 283 298 261 421 250 779 323
CCCG 454 84 69 115 90 140 102
CCCT 119 107 76 104 146 176 132
CCGC 88 32 231 134 82 843 226
CCGC 93 197 52 18 743 462 367
CCGC 118 2960 2515 1919 1789 1038 540
CCGC 309 153 126 94 78 164 156
CCGG 89 201 406 535 612 446 377
61 CLZ 48 CCGG 94 176 705 527 578 482 702
110
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
CCGG 249 563 188 384 393 295 487
CCGG 263 535 275 183 219 309 161
CCGT 169 363 246 408 247 559 398
CLZ_12 CCGT 172 765 511 343 347 407 174
63 CLZ CCGT 293 88 57 65 52 426 251
50
CCGT 350 82 24 91 37 52 100
CCTA 110 174 342 363 204 214 195
CCTA 379 80 89 170 105 192 217
CCTC 382 72 83 88 66 105 110
CCTG 99 283 93 245 1081 319 379
CCTG 130 1413 1995 1550 934 1004 1180
CCTT 104 304 533 768 344 288 0
CGAA 101 66 225 382 71 130 305
CGAC 76 71 45 704 87 174 1047
CGAC 148 1008 1239 1016 884 1043 999
CGAC 480 556 498 421 605 1183 913
CGAC 490 317 250 225 282 531 473
CGAG 273 212 98 136 89 96 136
CGAG 450 122 122 101 173 230 181
CGAT 78 322 85 178 293 484 420
CGAT 95 42 40 62 80 94 50
CGAT 98 48 62 67 68 124 52
CGAT 105 97 59 45 199 206 151
CGAT 268 770 202 374 593 519 478
CGAT 496 170 164 127 196 147 146
CGCA 88 592 249 355 696 542 854
CGCA 334 1071 1923 1725 1333 1445 1438
CGCA 472 218 306 294 365 312 406
CGCG 82 61 115 148 377 254 133
CGCG 85 32 115 60 275 248 133
CGCG 111 49 236 266 826 778 323
CGCG 371 27 37 72 44 101 56
CGCT 118 905 634 948 855 668 542
CGCT 341 22 29 39 11 62 23
CGGC 87 66 89 149 216 198 150
CGGC 110 311 620 1099 292 124 687
CGGG 85 259 928 777 314 252 437
CGGG 102 35 35 175 93 365 99
CGGG 109 34 28 63 65 112 96
CGGG 135 100 203 120 91 434 537
CGGG 402 116 116 170 205 226 178
CGGG 490 59 69 116 116 142 100
CGGT 142 207 147 171 201 301 322
111
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
6 CLZ CGGT 217 174 116 130 91 87 83
15
CGGT 476 46 30 29 41 60 53
CGTC 342 71 87 121 79 393 92
CGTG 124 346 240 174 115 144 168
CGTG 234 346 131 129 105 71 119
CGTG 306 796 1334 1296 1163 1164 1114
CGTT 81 42 91 35 129 186 74
CGTT 245 169 161 216 168 402 185
CTAA 268 125 133 121 157 151 201
58 CLZ CTAA 461 120 131 146 185 397 220
43
CTAC 93 90 73 124 101 146 106
CTAC 359 184 161 249 238 357 258
CTAG 91 48 29 64 113 142 175
CTAG 97 360 331 395 116 102 537
15 CLZ CTAG 171 412 247 167 119 181 142
16
CTAT 190 61 41 67 59 89 74
49 CLZ CTCA 206 567 522 466 306 370 239
17
CTCA 313 39 19 47 36 51 55
CTCG 140 90 94 293 259 663 605
CTCG 218 1262 450 734 340 124 208
CTCG 331 59 28 84 49 88 104
CTCG 490 352 257 320 376 616 504
CTCG 498 258 152 234 315 597 488
CTCT 137 503 422 462 762 965 828
CTCT 142 1146 797 1258 1620 1881 1685
CTGA 115 29 30 42 30 130 55
62 CLZ CTGA 450 127 173 228 279 258 265
49
CTGC 116 0 449 479 212 188 0
57 CLZ CTGC 320 0 60 83 99 104 0
18
CTGG 84 102 54 62 90 117 126
CTGG 183 269 195 328 321 308 1166
CTTA 86 49 24 69 48 73 52
CTTA 132 58 45 58 60 97 58
CTTA 378 297 350 416 443 747 450
CTTA 494 31 24 39 24 56 44
CTTA 499 10 29 45 42 69 52
CTTC 77 26 30 49 58 64 45
CTTG 83 792 397 700 601 967 1173
CTTG 176 119 75 200 187 192 229
GAAC 78 35 17 117 36 36 51
GAAG 93 122 348 230 116 116 183
GAAG 148 552 569 635 454 343 560
GAAG 196 363 237 448 ~ 1223 1350
447
112
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
GAAG 223 44 31 51 63 71 101
GAAG 226 44 31 51 62 71 81
GAAG 231 18 15 30 31 71 85
GACG 79 26 20 38 47 57 62
GACG 97 597 409 195 127 214 160
GACG 423 187 294 260 280 377 377
GACT 155 117 111 137 201 241 147
GAGG 103 136 175 399 79 90 139
GAGG 248 227 82 85 120 112 117
GAGT 367 302 382 345 369 355 326
GATA 345 15 33 31 50 94 30
GATC 95 81 170 177 112 67 130
GATC 356 34 35 67 48 108 42
GATG 300 375 310 202 280 270 293
GATT 91 50 18 32 41 40 55
GCAA 90 211 210 261 303 206 194
GCAA 269 222 90 150 140 218 237
GCAC 92 63 82 119 59 416 266
GCAC 186 282 238 186 308 203 156
GCAT 121 229 260 229 149 166 222
GCAT 439 19 25 28 34 57 35
GCCA 112 189 312 216 134 102 213
GCCA 240 49 47 22 27 119 68
GCCC 79 60 42 40 62 89 101
GCCC 121 62 42 39 57 96 212
GCCC 294 695 144 403 428 422 469
67 CLZ GCCC 324 202 648 578 521 512 802
56
GCCG 139 57 36 128 115 146 87
GCCG 144 78 39 71 52 101 139
GCCT 84 122 68 102 166 150 165
GCCT 118 403 671 853 366 337 489
GCCT 126 561 294 305 328 188 246
GCGA 180 235 1349 636 733 1018 1159
GCGA 293 1031 312 375 643 332 335
68 CLZ GCGC 325 35 61 60 75 104 95
57
GCGG 77 65 79 91 73 193 78
GCGG 127 51 50 52 107 161 130
GCGG 254 413 167 190 231 214 251
GCGG 269 842 133 372 326 480 586
GCGG 471 93 130 112 129 149 147
GCGT 140 117 55 78 115 189 159
GCGT 168 701 465 504 599 429 405
GCGT 309 498 282 77 186 71 139
113
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
GCTA 109 388 639 619 320 267 550
GCTA 132 990 829 1198 735 669 968
GCTA 223 898 532 586 525 812 522
16 CLZ 22 GCTA 292 444 169 168 171 182 154
GCTC 174 100 26 34 57 109 114
GCTC 202 785 866 512 626 949 593
GCTC 326 752 666 793 862 890 1479
GCTG 78 103 116 427 446 587 312
GCTG 120 1694 2136 2033 1141 1119 1652
GCTG 172 31 31 116 154 114 74
GCTT 233 43 20 62 23 51 63
GGAA 434 49 114 93 142 230 125
GGAC 231 683 585 478 510 254 236
GGAC 472 62 50 62 68 112 120
GGAG 221 423 239 203 217 250 248
GGAG 372 836 772 775 1052 913 641
GGAT 223 1048 1430 1425 1632 944 1461
GGCA 305 155 124 206 194 280 164
7 CLZ 24 GGCA 393 303 544 393 608 725 842
GGCC 113 334 371 479 204 175 240
GGCC 134 838 720 633 537 668 608
GGCC 324 114 115 211 157 238 301
GGCC 418 40 12 32 28 26 52
GGCG 113 235 158 129 129 130 101
GGCG 136 97 61 76 59 125 145
GGCG 315 292 238 445 464 495 366
50 CLZ_26 GGCT 129 491 544 423 199 169 321
69 CLZ 60 GGCT 169 467 563 335 704 1233 1055
GGCT 176 127 173 164 410 407 230
GGGA 172 91 97 67 144 112 183
GGGA 377 307 157 252 269 263 255
GGGC 214 59 62 85 66 252 255
GGGC 286 27 23 34 29 60 71
GGGG 81 670 1443 1269 1095 2164 1645
GGGT 91 63 68 104 267 143 91
GGTA 128 265 198 142 124 153 146
GGTA 184 1209 969 875 1109 836 941
51 CLZ 28 GGTA 257 1016 872 549 492 539 422
GGTG 139 992 884 936 801 733 811
GGTT 100 12 17 35 32 41 94
GTAA 257 86 36 105 119 75 98
GTAC 107 815 975 1034 821 751 1057
TAG 1244 260 237 294 349 1736 282
I14
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
GTAG 459 113 137 168 239 351 199
GTAG 459 113 137 168 239 351 199
GTAG 471 75 68 76 103 172 99
GTCC 87 448 256 218 325 193 176
GTCC 124 111 443 155 139 104 160
GTCC 187 1253 1031 1066 1018 891 778
GTCC 413 28 29 42 35 61 42
GTCG 176 55 58 79 190 130 126
GTCG 228 3085 2559 3211 3000 3470 3051
GTCT 84 19 28 30 43 128 35
GTGC 87 58 106 159 316 867 410
GTGG 125 1407 1734 1004 1276 1047 1475
GTGG 147 821 314 343 174 188 188
GTGG 458 45 22 41 35 26 33
GTTC 491 90 236 206 175 240 176
GTTG 93 156 129 90 93 150 88
GTTG 114 20 37 44 58 75 78
GTTG 378 66 35 74 59 80 73
GTTT 260 49 24 33 42 56 49
GTTT 336 37 42 40 36 139 126
GTTT 339 31 37 40 34 156 108
GTTT 495 36 23 34 54 58 50
TAAA 84 27 25 46 37 60 37
TAAC 114 38 32 50 48 65 41
TAAC 222 411 367 454 384 216 229
TAAC 450 678 538 407 452 753 669
TAAG 386 210 334 126 421 702 301
TACA 119 42 49 73 98 111 103
TACA 129 282 242 227 197 206 180
TACA 200 801 493 438 442 477 324
TACC 99 132 141 88 51 18 102
TACC 129 185 160 327 486 457 247
TACC 169 122 72 83 103 179 255
TACC 344 88 71 89 79 104 183
17 CLZ TACG 274 181 206 160 187 255 578
32
TACT 151 94 34 53 44 97 132
8 CLZ TACT 188 184 278 1200 581 339 347
33
TACT 386 36 50 70 56 104 88
TAGA 125 41 88 152 95 195 106
TAGA 134 286 263 214 194 146 152
TAGA 242 32 9 26 37 142 51
TAGC 186 1357 1306 1263 1125 959 889
TAGC 411 56 68 76 76 142 123
115
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
TAGC 415 50 60 40 66 127 87
TAGC 464 183 184 166 133 129 106
TAGG 250 461 166 238 189 306 257
TAGT 81 213 160 178 286 473 369
TAGT 97 271 144 246 309 537 299
TATA 98 115 183 488 127 99 230
TATA 382 37 36 49 44 113 39
72 CLZ TATC 159 434 327 334 404 701 2760
65
TATC 262 119 154 204 168 826 154
71 CLZ TATG 290 135 103 59 121 37 52
62
TATG 446 201 229 389 325 462 328
9 CLZ TATT 89 156 623 509 129 186 314
34
TATT 112 50 38 182 101 122 50
TATT 119 43 16 25 52 40 43
TATT 230 403 42 24 31 35 103
TATT 272 59 43 59 57 131 88
TATT 354 44 36 63 42 147 99
TCAA 447 44 38 39 26 85 49
TCAC 134 836 1637 842 57 1228 1047
TCAC 212 777 567 742 688 573 552
TCAC 289 1707 1138 1116 842 943 1123
TCAG 84 56 68 205 125 148 108
TCAT 88 88 145 178 409 401 430
18 CLZ_36 TCAT 349 2478 380 1155 1425 903 1832
70 CLZ TCAT 391 314 216 421 391 554 699
64
TCAT 473 45 22 38 39 53 47
TCCA 106 150 71 193 91 179 385
TCCA 222 400 303 362 613 787 616
TCCA 435 68 78 56 57 241 71
TCCA 439 54 78 56 61 174 71
CLZ TCCC 97 381 1687 1532 720 673 1083
37
TCCC 148 1050 865 963 700 639 685
TCCG 120 0 832 774 566 649 653
TCCG 185 0 311 292 223 206 259
TCCT 98 577 621 882 925 1258 1741
TCCT 144 492 551 427 580 313 410
TCCT 166 740 488 588 605 421 473
TCCT 275 72 20 77 52 108 133
TCGA 255 533 263 431 473 614 575
TCGA 370 167 148 178 194 215 229
TCGC 196 229 155 214 97 412 311
TCGC 328 465 545 856 482 674 773
TCGT 326 32 32 95 33 ~ ~ 34
116
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
TCTA 80 49 65 184 75 563 231
TCTA 217 39 50 160 325 212 84
TCTC 143 341 256 203 262 229 141
TCTT 155 93 80 96 91 252 110
TGAA 240 542 390 530 667 552 540
TGAC 193 1029 566 798 752 902 1048
19 CLZ TGAC 328 194 216 199 314 475 303
42
TGAT 97 45 44 23 72 158 85
TGAT 138 608 468 542 442 467 498
11 CLZ TGCA 109 339 554 561 473 736 395
38
TGCA 185 137 83 67 160 382 346
TGCC 163 271 347 93 330 958 407
TGCC 185 1164 1680 573 1081 1145 992
TGCC 343 604 628 832 675 889 1068
TGCG 77 188 156 495 125 366 403
TGCG 111 36 50 76 225 167 155
TGGA 93 173 157 202 253 545 240
TGGA 108 1941 294 2077 1692 1853 2640
TGGA 154 823 1504 1481 1370 1122 673
TGGA 277 50 23 54 56 103 93
TGGA 308 31 32 52 51 149 84
TGGC 105 634 538 630 818 1092 669
TGGC 113 377 259 371 510 524 415
TGGC 160 156 213 282 223 460 320
TGGC 266 468 451 365 280 207 270
TGGC 276 73 81 59 81 251 274
TGGC 494 98 43 27 58 88 122
TGGG 93 33 65 48 55 228 583
TGGG 271 241 591 580 426 642 607
TGGT 103 76 25 97 93 132 236
TGGT 114 339 537 421 221 204 231
TGGT 122 119 145 180 135 341 182
TGGT 158 465 286 403 324 267 348
TGGT 330 666 673 726 770 701 753
TGTA 121 1021 1596 1727 1052 696 1206
TGTA 169 1562 681 624 801 880 753
TGTC 84 160 250 216 410 510 399
TGTC 109 711 704 686 276 149 466
TGTG 315 71 56 83 35 125 73
TGTG 393 430 313 425 528 419 664
TGTG 450 573 554 698 819 1166 654
TGTT 114 335 752 657 875 794 838
~TGTT 119 703 1167 993 1666 1824 1251
117
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
TGTT 453 138 226 333 307 324 287
TTAA 88 149 109 181 377 239 326
TTAA 194 369 115 230 262 391 313
TTAA 312 335 177 159 199 136 167
TTAC 174 287 294 137 192 196 180
TTAG 104 52 51 54 44 112 65
TTAT 106 41 22 50 232 53 44
TTAT 338 486 777 852 875 816 884
TTCC 96 97 140 133 130 370 135
TTCC 104 51 31 109 67 94 78
TTGA 117 20 28 34 38 63 60
TTGC 119 57 52 67 73 117 75
TTGC 299 151 114 68 60 65 59
TTGG 209 704 1160 894 921 857 1215
TTGG 466 60 47 46 71 103 68
12 CLZ 40 TTGT 266 200 52 75 82 67 115
TTGT 302 38 33 72 48 69 79
TTGT 483 53 87 120 110 140 60
TTTA 249 174 32 103 46 55 85
TTTC 85 31 44 34 89 369 100
TTTC 107 50 37 20 65 91 68
TTTC 118 633 721 715 303 257 483
TTTC 153 188 168 113 141 142 270
TTTC 171 663 642 709 704 801 589
TTTC 226 26 31 22 63 63 86
TTTC 277 566 324 375 327 381 278
118
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
d
b
...
w
0
a~
r
a
b ~~ O ~n O
O _ t_~
N N 00 M M ~D
O ~ O~D W O N N ~~ N
0~1 ~ ~ O ~ N O O
..,
O
y b0
U
'~ it
z
b
..,
°
r
a
H ~k ~ ~ ~ d' ~ ~ ~ M
~ a i i i i i i i i
A 2 -
an
0
r
O O O
a ° O O 01 V1 00 O
N
W ~ ~ d ~ ~ d ,~b
o.~oNO Ad °>~,~ "~°'' d VU
H ~Ua ~ ~ _ ~ ~ ~ d ~ ~_ ~' Vii;
~ U M U I-1 y
~~o a
o
y .~ C3~ O ~ ~ ~ U d S~. _ ~ ~ U
O " °' a. "' ~ '.' ~ o ~ ~ >, ~ d
V ~.0~1 ~~.p~"z~.-~,°~ ~~1~G0 Orb-.~N
d ~ ~ ° ~ ~ ~~ ~ ~ ~ ~ .o ° ° one ~ 00
a .~~." .~~n~°Z~.~~ ~~M~ u,O ~ b
~, .~ ~a~ d d ~ . ~o ~ ~ _~ .~ ~ .~ U ~ouo
d ~~ o 0
vU! y al ø~ ~ ~ ~1. ~ U ~ U ~ ~ M n
~n
~ b ~ ~ o v~ o o~~ ~ d ~ ~ ~ ~ ~ ~ ,~,,/ o~'0 0
A ~ U ~ ~ ~ ~ W ~ U ~ ~~ ~ ~ ~ ~~Qi O .~,.
M
O O 00 O
m ~. N p~ ~' ~-~ N M
d d U U C~.7 CU.7
Ca d ~ d U U U U U C7
O N ~n
a NI NINI NI NI NI NI
c~
r
° a as a a a a
U U U U U U U U
c
a~
C/~ .~ N M <t ~n ~ t~
119
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
a~
b
..,
0
a
a
b ~
O., O ~ ~O
~t
I I I I I
~ N OWn N t"n
O ~ ~ ~ O ~ ~ ~. ~ N N
A
O
...
w
O y
a b
~ e~
a
~d
...
v
O
a~
a
o .~ ~n oo a' .
.-. N
~ .-M-, M ~t ~t N ~ ~~
C/~ a' I I I I I t I I
A ~ ~ .~ ..~ .-~ .~ M .-r t/7
d0
O
0 0 0
o O ~ O O O O1 ~O C~ O~
O 'S.,~' .~ U
N
U ~ M ~O N
.a N ~ ~ ~ dD N
V ~ !~ p y N ' p ~ ~ ~ ~ ~ N N
N >,O ~ ~ ~ rrr U U U 0 ~ ~ U .b U
'b M r~ ~ ~ ~ z ~ V
o 'n
~ N w~j ~ ~ ~ O ~ ~ ~, ONO N ~ ~ U O ~ O n C/~
O r~ U ~ ~ N , ~ U V1 ~ N ,-, v~ U
..r ~ ~ N ø, ~ U ~ O O_1 y c~ .~ ~ ~ U a
y N.~.~- pO,fl O~ OM ~~~ U~ ~ ~ p~O N ~ "~ V1
a U U ~' ~ U m-, U O c~ y ~ ,~ O p~ t1 O
v ~ d '~ p., ~D w r.~ b cn ~ O ~ '~ ~. p ~ ~ i.N. .N-,
C~J ~ ~U V V U ~ ~ h. ~p ~~ y ~ ~ ~, ~ ~ .U
~~ ~~~;~~ ~ fw-~~~~ ~~ ~z ~ ~ ~.~ ~~~°
O ~ p ~ V ~ N O ~ U ~ ~h U
G ,~ 'n O U U O O y ; ~,~ ~' ~ ~ 7 O
N ~ O ~ .~ c~ c~i .~ ~ M
f'-i <n d ~ a f-~ ~ ~ 0~0 w d O H ~ cn ø~ ~ y ~" w ~ O [~ m
A ~ ~ ~ Ra ~ ~ ~ C~ ~ ~ ~ C/~ ~ ~ ~ U c~ i.U. U ~ ~ W 'W,r
N
0~0 O~ f~ O ~ ~ Ir o1
v' ,.~ 00 O~ ~' N ~' '-' N
Fd-~~U ~~U UCU,7
A
a NI NI NI NI NI NI NI NI
0
0
U U U U U U U U U
ar
v~ oo vv
120
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
d
b
0
a~
~.
a
b~
G7 Cl~ O~ '~ M d'
C1 O .-. .-, .-i
pp vp ~ ~ N M M ~ Ov ~ I i
O ~ ~ I ~ C1 O ~~ I ~ N M
L .~ N M N O~ ~ 00 ~ ~ M
N
.b
O y
U O
C~
z
...
°
v~ oo ,~ ~ vc oo t~
A ~ .~ ~., 01 I~ t~ 0W1 ~~ N Ov
N N N N M N 00 ~ M
C/~ a' ~ I I I I I I I I I
A ~ 00 ~ ~ rr ~ ~ ~
O
~r
0
\° \° \° \° \° \ \° \°
\°
l~ ~ 00 l~ Ov o0 ~ I~ O
o ~~I O~ 01 ~ O~ 01 01 O~ O~ ~
i~ ~ M
., ~ O
O ~ U ~ ~ ~ ~ U
c~ Ov ~ ~ ~ N
z
w ~, d o~C~~,~~, ~Z~,b~~ ~ ~d A as
~," ~ .~ ~ ~ ~~ ~.~, a, NI ~ u1 w ~, ca
U ~ .~ t~.OV ~ p~ ~~ U' C~ N N ~ ~' ~ C/~
d ~, O U ~ r; ~ ~C N ~ O ~~ ~ d ~ ~ ,~ ~ C!~
_ t~ v~ N ~ U wr
b j~ ~ (~j O ~ O ~ ~ ~ O ~ N d
w. ' pp ~~ .-, ~ w
O ~ V1 ~. O I ~ ~" ~O O~
O ~' V O ~ r-.i c7 ~ U ~ p ~
~ ~~''"'U°d ~' o ~~ o o~ .~ rio
~odw~~°' ~ ~~~ ~O' s~~N a~ o on~
a ~ cc i .fl ~ a~ w ~ o ~ ~ ono o ~ i ~ ,~ ~ .fl ~ ~ M
d ~ ~ ~, U ~ ~ ~s o tn z r° o ~, z ~ w ~ o ~ N ~ ~ o o°',
:~_,"~a °~'o ~.~ ~d N~ od ~~p~~M ° ~~'~.M~''~I~ ~°a
x x
p ~ ~ U ~ p ~ ~ U l~ p ~ ~ O ~ ~ 00
O ~ ~ ~ O Wn ~, ~ oho ~ ~ ~ ~ O ~ ~ ~ ~ y ~ ~"~ ~ m
iG pp OU,~~ ~ 00v p~~p 0 ~(7a ~ 0 ~ '~ N O
.G ~, ~ ~"O~O_' ~O~~"v1~O~~, ~a ~ O'U ~
cn a~ cn o ~. .'~, E"'i U E'~ ~ O E., v F-, v~ ~ U v ~. ~ ø' E'~ I ~ t1.
0 o b o ~ o o v~ ~ v~ o ~ v~ ~ v~ o ~ ~ o ~ ~ vWr o
a ~ ~~~ox ~~~~~~.~~W~w~ ~x~ ~~~d~
~ °
G~ ~ N M M O ~ M ~.~ p\ due'
~b ~ d U Cd.7 H ~ U ~ U E~-
A d ~ E-' E-' E-~ U U d ~ U U
A
NI NI ~I NI NI ~I NI NI NI
b
° a a a a a a a a a
U U U U U U U U U U
a~ t~ 00 ov t~ oo v, o ~-~ N
rn ~ ~ ~ ~n v~ we vc
121
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
a~
b
..,
0
a
a
° ~ ~G ~D o ~ v, 00
... ~ N ~t ~ ~ N N
~ G7 M O~ M I ~ N
I '~ d I ~ I I
As~.o~,~,'z~°N°
b
...
°
a
z
b
..,
w
0
a
(~ O V1 00 M 01
N ~ N N ~ N
v~ p' I I ~ I I I I
a~~ ~ z~ ~ M
0
0
0 o_dsss
.b o
ate, ~ Z
a
b M
r,
a '~ o
a~ a~
3 ao ~ ~ .~ o ~ o, ° W O
d
°'° C~ o ~ E'-' C7
:~C7 ~z ~ ~ W v.-,>d .-.MO
f~ 0 i--i ~ v~ \O ~ ~ W ~ o°0 N ~ N U' H A'" U
~' c~ "" m oo U m
vl O O ~ ~ ~ (~ ~ ~ M Pi U I
d ~ 3 ~ i ....~ o ~ ~, ~ o ~ ~ ~ ~ CW.7
du' ~~ ~ ~ ~ ~ >, ~ ~~ ~ ~ ~ ao o ~nl~ P~,
~ r% ~ '~ ,-. ~' ~ w
a ~~ o ~ ~ oo ~ o a o w ~ ~ ~ ~ d ~ ~ _
a ~~~~,~,n o~'~,° ~d~ o~oo z3E~~"..'
0o upq a~ ~ .o ° z ~ c~ o ~ ~-1 ri
00 ~ ,-, 0 00 ~ N ~ .~ ~ ° ~ ~ ..~. N ~ v W W U ~..
c ~ >, ~ a o '~ ~ ° ° o N ~
~~~oCW7W od~,~ o~ oU ~'~~~ ~ ~0~.;,0
~ME'' ~d> ~ NE"'w ~ ~~ ~H
A W ~ ~ W ~ ~ ~ ° ~ N W o 0 0 ~..~ N W o 0
Zx .....w vx~U...v~ ~'~pCn,...
~_t' N N ~_
w s°'. p" H C7 d U U E-~ N
~'o~C7E-~C7UC7UH
Ad~UUUCU.7CU7C~7E-d~
NI NI NI NI NI NI
° a a as a a a
U U U U U U U U
A
a~
a~ M ~ t~ 00 a\
122
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
as
ono
a
~.
d
b
0
a
6''n
o I I I
O C~/~ ~" C~1
A ~ M ~ M
.,r
O y
47
v b
p t~
d
b
...
O
a>
~.
v
o0 d' N
,~ M M O
M M ._' U
I I I
.~. ~ ~-~ ~--w N
U
o d
~.
0
° o 0 o z
II
d
z
A
U N
a .~ O ~ N
O 'r ~ . ,~~, U ~ d' O
U ~ N '~ U
d, O ~' O y~ ~ C/~
O o .b
N O N ,~Z, ~ p.
n 4~ ~
U ~ xM
dW w.o~Uvo °.~
a ~~ ~ a~~_Oc~n'~~; W
d ~ ~ U ar ~ ~ ~ II
~ oo E"'
~ f3, O
~ z ~ W R; °' ~I W
6''nd NA~IdO U
° >, E ~ z
o °b~ ~3~~
a x~~~~~xw~~
a,
M .-r
O H
y
~ 'b H
A~~ H
A
b NI NI
° a a
U U U
a~
O N
123
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
a'
a~
0o O~ O ~~ N M ~t v1
N N M M M M M M
d H U C7 d H
C7 U F~ r;~ C7 d
U E-,
H H H d ~ d
U d d E-' d d U
d c~.7 c~.7 cd7 d H U
E-~ E-~ E-~ c7 d ~ E-,
dCU.7 E..., UU~ CU7
w d H d ~ c7 c7 ~ U
UU Cd.7 HE~-~~ Hr
'~ E-~ U E-~ d C7 C7 U U
U U U U U C~.7 Ed-~
W C7 C7 C7 C7 C7 C7 C7 C7
U U U U U U U U
d d d d d d d d
U U U U U U U U
M Cd7 Cd7 Cd7 Cd7 Cd7 Cd7 Cd7 C7
W
U
M ~ ~ d U.
H ~., o ~ ~ ~ .a d ~ -~~- p! U
~* ~. ~ ~o ~ , ~ z g , ~, ~ a_; b
o ~ ~ ~ ~ ~ _ o °'
~'" I' '~" U r' U ~U d .r by .~
,~ ~., . w--i vy, _ v~ a cd ~ ~. ~-, U
v~ 01 ~ O ~ ~, , ~-! O G~ ~ U N ~ U
O , pp O
' "" ~ ~
U ~ '~ ~ ~' .-r ~ '~ U ~ Cs' cd , U ~ ~ N
,x v~ ø, ~ O .-~ ~O ~ O ~ ~ ~ c~ .-~-r U O cn ~ ~ C
Q.~ ~ y.p ~'z pip ~ ~~N ~~~OD OZdNU '~ <n
~ ~~I~~v~ ~o~,~'.oc°~ ~ on~l~oo ~
y ~ N .~ ~ ~ ~ ' V ~ ~ ~ ~ ~~ ~ b ,N-, ~ V ~ ~ ~ rV O
o ~ I~ ~ N ~ C7 ~
O _ a' V1 U U
CC OU ObD~00~~Vw~.-M.~~v~Wn~~OO.V M(~
A ~d ~ ~ ~~~,~Idd~,W a~ ~ ~ s
~U ~ ~ ~ v ~ ~ ~ ~ Qi ~ .y"., ~.Wr N N
i,
b ~O .-. eY N I~ ~''~ 00
O O 00 O n
~' N 01 ~'' .~ N M o0
d d U U C~.7 C7 d
U U U U U C7 E
A
O N ~n ~ M
o MI NI ~I I ~I ~I NI MI
V U U U U U U U U
124
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
vo t~ 00 0, o .~ N
M M M M d'
U
H E", C~.7 ~ d C7 U
d ~ C7 C7 d
d H
C7 U H~ d C7 ~ U
c7 C7 E-~ U d d c7
c~7 U H ~ C~7 cU7 d
w d c7 ~ ~ ~ U Cd,7
H U d E-~ ~ c7 d
d UCU7~d Ed-~U
E-~ E-~ H ~ U U C7
W
U U U U U U U
d d d d d d d
~ Cd.7 Cd7 Cd7 Cd,7 Cd7 Cd.7 Cd.7
U U U U U U U
Cd7 Cd7 Cd7 C7 Cd7 C7 C7
b
O
U ~ ~ ~ d ~; N ~
M N b ~" ~ vi r~-. tOn ~-,
O ~ by ~ b "
a ~ ~,~ ~ ~ z ~~ ~; ~'
...,
3 O ~ ~ M ~ U ,~,,
N U .~ cd ~ y
V A ~ U ° O ~ ~ fn U ~ U O ~ O ~ C/~
H
v N ~ ~ ~ V ~ UO ~ G" N N ~ U ~ v O" ~ ~ N
O ~ ~ ~ ~ '~ ~ Cn ~ ~ v ~ b ~ Q, ~'
d0
Sn ~ A ~ ~ ~ , v ~. ~ on
~ ~ O U ° ~ ~ ~..a U ''-~' c~
z ~ v~ v~ O . ~, ~n
~fil ,~~d°~i°tnz.~ ~v~~..~U~°
.b ~ ~ ~;
W Vj O U M U U U ~ r., V U '-'
-f. ~ ~, ~ ~ ~ ~ U "~ ~"'" ~ ~ ,~ ~ ~ O ~ '~, ~' by ~
,_~ ~ .T'~, 00 [~ U U ~ N O_1 .t", [-i U ~ ~ S3. ~ V ~ ~ O [-i
~ O'~W~.o ~ O O'~~ W ~~ 0 0~ -f.~, ~ ~(~l a~
A-i ~ twr L1~ U v~ ~ Gh f3w.r W r ~ U c~ cW r W r U
U
i»
~
'b ~--I
Ca 01 ~p G~ ~~ N
0~0 01 O"" N ~ ~-~ N
U d E-~ H c7 d
,. ~ U U ~ U d E-
A Ed-~ EU-~ F~-~ ~ U U CU.7
l~ oo O vG N
o MI MI MI ~I ~I ~I NI
V U U U U U U U
125
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
d
d d C7 ~ c7
d
H H ~ ~ ~ U d
c7 U ~ d d U C7
U H ~ d d td7
CU,7 U d C7 ~ E-~ C7 H
d U d d H H U U
C7 H U U d ~ d C'7
d U C.d7 E~-~ H U ~ U
E-~ H E-~ U U d ~ U
W
U U U U U U U U
d d d d d d d d
U U U U U U U U
0
o Cd7 Cd7 c7 Cd7 Cd7 Cd7 C7 C7
C
0
U ~ ~ ~'' .. o ~ d
N
O ~ O_1 N ~ C
° _ ~ .~ U ~ ~ b ~ W 4r .-~-n ~ U
p~ ~U~~'-'z~I~'~'~~r,N
O U ~~ O .~ ~ ~ ~ O '-' ~ ~,' ~ ~ U ~ ON1 ~ U
vyp ~ ~D .~ ~ M
V ~~ ~ N p ~ p U ~ ~ O U
.~..~-''~''~ cU~p,U o ~ ~ ~'~~ ~d o U ov
_ ..N
a p~_ ~~d~ ~'"" ~~H v ~A.~W ~ ~°.'~..., a~ o
~_ov°~ ~ o °d ~ ~ ~'U ° W°.b.°~~
C/7 c~1 r~. ° p, U cd ~ ~-
N ~ ~ ~ ~ '-' ~ ~ ~ ~"' y M ~ 00
y ~ ~ U ~D ~ d ' ~ ° 1..: U it V ~ V ° ~ .4: r.~ ~O
~~ ''~
U N °~ ~ d ~ ~ U I~ O~ U M v~ ~ ~ ~ ~ ~ "C1 U
° ~ °o °U °~ ~~~'_',o'r', ~ ~.~ oWo
~ °' ° >,°i~~(~~ of ~E~~~~d~ °~~d~ya~
H
o bo°~o~vW'v~ .~~o~ d~_ ~o ~ a
~ ~ ~ x ~ x ~ ~ ~ o.~ W ~ W ~ ~ O'~ ~ x
d
~,
~o ~
b ~
00 ° ... N vc
,r N M M M ~ M '-'
G~
~~U d d C7 ~ ~ H c7
A H H E~-~ U U d ~ U
MI MI ~I ~I ~I ~I ~I ~I
_O
V U U U U U U U U
126
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
00 Ov O ~ N M ~f
(~ (~ 00 00 00 00 00 00
H d U ~ d d ~ U
H ~ U U
d H d H H d
C7 U EU-~ U d ~ d d
d C7 c7 C7 d d ~ H
d H H H H H
UC~,7C~7UUU U H
b d W 7 d U U H
U U U U CU.7 CU.7 C~7 E-d~
W
U U U U U U U U
d ~ d ~ d d d d
..
U U U U U U U U
'-i C7 Cd7 Cd7 Cd7 Cd7 C7 C7 Cd7
b
0
o 0
o .° .° ~ ° Z
a ~ ~ ~ ~~ ~ ~~ ~A
o ~.lx ~~ ~z ~ ~ ~o > ~ ~~MoW
cA~ ~~° ~ ~x ~ ~ rij~w~
a ,~~ o o~ ~ ~.c ~.° wao N~S~'°~
00 ~d,-.~.~,'r, a,~ ~ o U ~o pd
~~°zM o ~~ v.~ oz~ ~ ~o b~ ~w
.~ ~ o~nA ~ ~ ~ ~n ~ o
C .b p m c/1 ~ M ~ O by
~' C/~ ~ ,--m '~ ic~i. l~ O pq '~'''
o ~ ~ oo ~ °° o y d W ~" ~ ''
a. ~~ ~ o. N w °z""' oUU~~° ~z~rH ~
~' ~ o (~ ~ t. ~ M p ~ ~ ~ ~ ~ ~ N o ~ ~ ~ w U M
~ U N ~ "" r~'n ~ ~' c~ ~ O '~ m ~ ,~ ~ N yn p xi (3a O~
p ~ w ~ ~w~-1 O ~ZJ"' p ~M pr.~~~ ~ I~ "E",C/~N
A ~' d ~ ~ (~ ~ O U' w 0O d ~ ~ ~"' ~ ~ O ".., a~ ~ ~ N U .~ ~ M
~~w ~~aw ~~az x~°°w ~ ~d o
.. '. :c ~, .r w ~ .~ x ~ o .. ~, v~ ~ W w
b~
b~
~ N N
~ N N '~ M M .~ N
A E~- U d d U U CU.7 d
U U U U C7 C7 C7 E
A
O~ O ~-~ N ~O I~ O N
o I I I I I I ~I ~I
V U U U U U U U U
127
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
00 00
d H
d
H
H
U H
~.
U U
w C7 d
H U
U d
E-~ E
W C7 C7
C7 c7
U U
U U
d d
d d F''
C7 C7
U U
o d d a'
C7 C7 cn
o b
U °'
w ~., -~ a
a ~ ,~ ,-, ~ N ~ c~ ~ w
c c~ ~ a» ~ O ~ aW
cn o
~ cv o vo E-' ~ ~ ~..-: w
a ~ ~ ~ ~ ~ d U
d U w ° ~ F-~ ~ " o
°d~~~ ~~°I
a ~ ~ z U ~ :x
oAWx~
bDd ~ N U O O
A o ° °° ~ ~ ~ U ~ °
E'' ~ ~O~M ~ ~.
° o ~ b v~
x ~x ~~~~.,w~'.~~
L
b~
o~
Ow
~r M .-w
... ~ ~
A H H
o NI NI
V U U
128
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
C7 C7
C7
U
C7
a
U
C~7 C7
a
H
d
~o d U
U
W ~ C7
U U
H '~~.
d0 d0
az az
x
Ha ~a
c~
W ~ . v_,
Q ~ o U
A a~ i .n ~ a ~ a
d d '~ a o
z " o ~ ~. '~ '~
V
A
o ~d "~W~.~ ~'?o, V?~ :boo
U ~ z y MV_1 Mt~ . 01
vp W ~ y0
O ~ ~ v1 N O
'Lj v1 ~ ~ Cl d ~ M ~ ~ O. LTr
o ~ a; M
o U ~ c7 C7
d a, o ... o
a d ~ ~° °z ~'
.- ~ ~,M oA ~a~ ~aN ~
~w ~~d ~z~ ~z~ ~ ~.
_'~~ ~ ~~ ~Ad
"O O ~ ~ ~ O ., ~ ~ U ~ ~ U :3 U
d ~,i
d N ~ ~~~ ~~M UUU NUN~a
o ~ o o ~ ~ ~ ~ o ~ o~ o ~ c ~
G7 U W v~ Ud ~~o w ~ ~ v~ ~
~o o~
0
N
H
sue. O. a
Ad~~ c~7
~_
_O N~ N~
U U U
A
a'
o
129
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
a a
U
~
C. d
7
U
U
U C7
d d
C7
a
~
C U
.7
d U
H H
d
U U
U U
E~ E
d d
~ ~
~ ~
z z
d
p ~ ~ ~ ~ O
.,
I~ N
~
O W N ~ N
d ~ o ~ N o
v b ~; ~.
~ ~c
~. M d o
w
~ b W M M
V A 0
O b-0 ~
pM ~ M ~
b p
N
N O O ~ ~k i."'
N
~ W ~' ~. ~c
~
.~ , ~ W N
N "fl o~p
~.
p
O ~ ,
C7
~o ~dN ~ p~
O
A
a
~
U U V" N ~"~ Ud
H 0
~ U ~ ~ N U
~ U
a~ ~ ~ H
v,
w ~ z~ ~~
~
U
W
n o0
~n v,
N N
d U
H H
C7 d
N ~1
~
N N~
a a
U U
''r N
V7 V~
130
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
m
a :?
0
z
'w ~~
o
~ ~,
~
0
a ~ ~ a
0
N
M c~ C7 N
' G7 00
~
~
-I ~ z
.b I
L
O
y 00
;b
M ,
N W
a~
a
H
C
0
x
.~ l~ N O
cd O
N v~
~/ ~ O
x o
0
0
N
W L
w .. z~
a ~
C O ~r U
O O ~ O Vi
U .~ .~
d ~ oN
~z .. ~a
s
v~ E
U W
~
Q ~ ~a ~ ~
o
'"' ~ ~ CJ N ~
~ ~ v~n1
~
~"'. ~ .- N ~
, Q1
O M ~ N
U O
Q O
y--i
V7 U
~
V7
Q
.,
~ ~
c.
aio H
~
~,
. N Ad'. C7
E
CD
b
N
A
H
y b N
I I
~
N U ~
N
U U U W
v~
a~
N C/~ M
131
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
EXAMPLE 4
Characterization of CLZ 34
Male C57B1/6J mice (20-28 g) were housed as previously described in
Example 1. The same experimental paradigm used in Example 1 for clozapine
treatment was used for the TOGA analyses described below.
The TOGA data shown in Figure 18 was generated with a 5'-PCR primer (C-
G-A-C-G-G-T-A-T-C-G-G-T-A-T-T; SEQ ID NO: 27) paired with the "universal" 3'
primer (SEQ ID NO: 23) labeled with 6-carboxyfluorescein (6FAM, ABI) at the 5'
terminus. PCR reaction products were resolved by gel electrophoresis on 4.5%
acrylamide gels and fluorescence data acquired on ABI377 automated sequencers.
1 S Data were analyzed using GeneScan software (Perkin-Elmer).
The results of TOGA analysis using a 5' PCR primer with parsing bases C-G-
A-C-G-G-T-A-T-C-G-G-T-A-T-T (SEQ ID NO: 27) are shown in Figure 18, which
shows PCR products produced from mRNA isolated from the striatum/nucleus
accumbens of mice treated with clozapine for various lengths of time as
described in
Example 1. In Fig. 18, the vertical index line indicates a PCR product of
about 89
b.p. that is present in control cells, and whose expression in the
striatum/nucleus
accumbens of mice treated with clozapine is differntially regulated with acute
treatment versus chronic treatment. CLZ 34 is upregulated with clozapine
treatment
at 45 minutes and 7 hours, but decreases to control level by day 5 and remains
at
about control level for as long as 12 days, showing a slight increase at day
14. In situ
analysis performed using CLZ_34 as a probe revealed that CLZ_34 is expressed
ubiquitously throughout the brain (data not shown).
CLZ 34 corresponds with GenBank sequence U08262, which is identified as
a rat N-methyl-D-aspartate receptor/NMDAR1-2a subunit (NMDAR1). The
NMDAR1 receptor is a glutamate receptor involved in the processes underlying
learning and memory. In addition, numerous studies show that blockade of
glutamate
actions by noncompetitive (e.g. MK801 and dextromethorphan) and competitive
(e.g.
132
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
LY274614) NMDA receptor antagonists blocks or reduces the development of
morphine tolerance following long term opiate administration (Trujillo et al.,
Science,
251, 85-87, (1991); Elliott et al., Pain, 56, 69-75 (1994); Wiesenfeld-Hallin,
Z.,
Neuropsychopharm., 13, 347-56 (1995)). The early change in the level of
expression
of CLZ 34 which has high homology with an NMDA receptor is interesting in view
of the ability of NMDA antagonists to block the development of tolerance to
opioids.
EXAMPLE S
Figure 19 shows the consensus sequence from the computer generated
assembly of the following 4 sequences AI415388: Soares mouse p3NMF19.5 Mus
musculus cDNA clone IMAGE:350746 3', mRNA sequence; AI841003: UI-M-AMO-
ado-e-04-0-ULsI NIH BMAP MAM Mus musculus cDNA clone UI-M-AMO-ado-e-
04-0-UI 3', mRNA sequence; AI413353: Soares mouse embryo NbME13.5 14.5 Mus
musculus cDNA IMAGE:356159 3', mRNA sequence; AI425991: Soares mouse
embryo NbME13.5 14.5 Mus musculus cDNA IMAGE:426077 3', mRNA sequence.
(SEQ ID NO: 53)
Figure 20 shows the sequence of the EST AF006196: Mus musculus
metalloprotease-disintegrin MDC15 mRNA, complete cds. (SEQ ID NO: 54)
Figure 21 shows the consensus sequence from the computer generated
assembly of the following 3 sequences: C86593: Mus musculus fertilized egg
cDNA
3'-end sequence, clone J0229E09 3', mRNA sequence; AI428410: Life Tech mouse
embryo 13 Sdpc 10666014 Mus musculus cDNA clone IMAGE:553802 3', mRNA
sequence; AI561814: Stratagene mouse skin (#937313) Mus musculus cDNA clone
IMAGE:1227449 3', mRNA sequence. (SEQ ID NO: 55).
EXAMPLE 6
Characterization of CLZ 44
Male C57B1/6J mice (20-28 g) were housed as previously described in
Example 1. The same experimental paradigm used in Example 1 for clozapine
treatment was used for the TOGA analyses. The TOGA data was generated with a
5'-
PCR primer (C-G-A-C-G-G-T-A-T-C-G-G-A-C-G-G; SEQ ID N0:96) paired with
133
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
the "universal" 3' primer (SEQ ID NO: 23) labeled with 6-carboxyfluorescein
(6FAM, ABI) at the 5' terminus. PCR reaction products were resolved by gel
electrophoresis on 4.5% acrylamide gels and fluorescence data acquired on
ABI377
automated sequencers. Data were analyzed using GeneScan software (Perkin-
Elmer).
S
As shown in Table 1, the results of TOGA analysis indicate that CLZ 44 is
slightly up-regulated by clozapine treatment. Tables 2 and 3 show that CLZ 44
is an
EST isolated from mouse kidney. In further characterization of CLZ 44,
northern
blot analyses were performed to determine the pattern of expression in the
striatum/nucleus accumbens after 2 weeks of treatment of control mice,
clozapine-
treated mice, haloperidol-treated mice, and ketanserin-treated mice (Figure
22).
Ketanserin is a SHTz~zo - selective antagonist, and is used to determine
serotonorgic
involvement in these drug effects.
Briefly, an agarose gel containing 2~g of poly A enriched mRNA as well as
size standards was electrophoresed on a 1.5% agarose gel containing
formaldehyde,
transferred to a biotrans membrane, and prehybridized for 30 minutes in
Expresshyb
(Clonetech). A CLZ 44 insert (25-100 ng) was labeled with [a, 3zP]-d CTP by
oligonucleotide labeling to specific activities of approximately SxlOg cpm/~g
and
added to the prehybridization solution and incubated 1 hour. Filters were
washed to
high stringency (0.2 X SSC) (1 X SSC: 0.015 M NaCI and 0.0015 M Na citrate) at
68°C then exposed to Kodak X-AR film (Eastman Kodak, Rochester, NY) for
up to 1
week. Figure 22 is a graphical representation of the described northern blot
analyses.
As shown, after 2 weeks of treatment, CLZ 44 was up-regulated with haloperidol
and
ketanserin, but not clozapine. This suggests that both dopamines D2 and
SHTz,e,izc
receptors are involved in CLZ 44 expression regulation. The lack of effect of
clozapine may indicate that antagonism at other receptors (i.e. SHT3, D4, D1)
may
override the effects of D2, SHTz receptors.
EXAMPLE 7
Characterization of CLZ 38
Male C57B1/6J mice (20-28 g) were housed as previously described in
Example 1. The same experimental paradigm used in Example 1 for clozapine
134
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
treatment was used for the TOGA analyses. The TOGA data was generated with a
S'-
PCR primer (C-G-A-C-G-G-T-A-T-C-G-G-T-G-C-A; SEQ ID NO: 97) paired with
the "universal" 3' primer (SEQ ID NO: 23) labeled with 6-carboxyfluorescein
(6FAM, ABI) at the 5' terminus. PCR reaction products were resolved by gel
S electrophoresis on 4.5% acrylamide gels and fluorescence data acquired on
ABI377
automated sequencers. Data were analyzed using GeneScan software (Perkin-
Elmer).
Tables 2 and 3 show that CLZ_38 is an oligodendrocyte-specific protein
mRNA. In further characterization of CLZ 38, northern blot analyses were
performed to determine the pattern of expression in the striatum/nucleus
accumbens
of control miceand mice treated with clozapine for 45 minutes, 7 hours, S
days, and 2
weeks (Figure 23).
Briefly, an agarose gel containing 2pg of poly A enriched mRNA as well as
size standards was electrophoresed on a 1.5% agarose gel containing
formaldehyde,
transferred to a biotrans membrane, and prehybridized for 30 minutes in
Expresshyb
(Clonetech). A CLZ_38 insert (25-100 ng) was labeled with [a-32P]-d CTP by
oligonucleotide labeling to specific activities of approximately SxlOg cpm/pg
and
added to the prehybridization solution and incubated 1 hour. Filters were
washed to
high stringency (0.2 X SSC) (1 X SSC: 0.015 M NaCI and 0.0015 M Na citrate) at
68°C then exposed to Kodak X-AR film (Eastman Kodak, Rochester, NY) for
up to 1
week. Figure 23 is a graphical representation of the described northern blot
analyses.
As shown, the pattern of CLZ 38 expression in clozapine-treated animals was
similar
to the pattern observed with TOGA analysis.
EXAMPLE 8
Characterization of CLZ 16
Male C57B1/6J mice (20-28 g) were housed as previously described in
Example 1. The same experimental paradigm used in Example 1 for clozapine
treatment was used for the TOGA analyses. The TOGA data was generated with a
5'-
PCR primer (C-G-A-C-G-G-T-A-T-C-G-G-C-T-A-G; SEQ ID NO: 97) paired with
the "universal" 3' primer (SEQ ID NO: 23) labeled with 6-carboxyfluorescein
(6FAM, ABI) at the 5' terminus. PCR reaction products were resolved by gel
135
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
electrophoresis on 4.5% acrylamide gels and fluorescence data acquired on
ABI377
automated sequencers. Data were analyzed using GeneScan software (Perkin-
Elmer).
As shown in Table 1, the results of TOGA analysis indicate that CLZ-16 is
slightly down-regulated by clozapine treatment. Tables 2 and 3 show that
CLZ_16 is
an arm-repeat protein. In further characterization of CLZ_16, in situ
hybridization
analysis using an antisense cRNA probe directed against the 3' end of CLZ_16
were
performed to show the pattern of CLZ-16 mRNA expression in mouse anterior
brain
(24B) and posterior brain (24A). Control mice and mice treated with 7.5 mglkg
clozapine were sacrificed after two weeks. In situ hybridization was performed
on
free-floating sections (25 ~,M thick). Coronal sections were hybridized at
55°C for 16
hour with an 35S-labeled, single-stranded antisense cRNA probe of CLZ_16 at
10'
cpm/ml.
The probe was synthesized from the 3'-ended cDNA TOGA clone using the
Maxiscript Transcription Kit (Ambion, Austin, TX). Excess probe was removed by
washing with 2 X SSC (I X SSC = 0.015 M NaCI/0.0015 M Na citrate) containing
14
mM (3-mercaptoethanol (30 minutes), followed by incubation with 4 p,g/ml
ribonuclease in 0.5 M NaCI/0.05 M EDTA/0.05 M Tris-HCI, pH 7.5, for 1 hour at
37°
C. High stringency washes were carned out at 55°C for 2 hours in 0.5 X
SSC/50%
formamide/0.01 M (3-mercaptoethanol, and then at 68°C for 1 hour in 0.1
X SSC/0.01
M ~i-mercaptoethanol/0.5% sarkosyl. Slices were mounted onto gelatin-coated
slides
and dehydrated with ethanol and chloroform before autoradiography. Slides were
exposed for 1-4 days to Kodak X-AR film and then dipped in Ilford K-5
emulsion.
After 4 weeks, slides were developed with Kodak D 19 developer, fixed, and
counterstained with Richardson's blue stain.
As shown in Figure 24A and B, CLZ-16 mRNA is expressed ubiquitously
throughout mouse brain. Figure 24A shows dense labelling in the cortex and
surrounding the hippocampal formation as well as moderate labelling in the
dorsal
thalamus and posterior brain. Figure 24B shows uniform labelling throughout.
136
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
EXAMPLE 9
Characterization of CLZ 17
Male C57B1/6J mice (20-28 g) were housed as previously described in
Example 1. The same experimental paradigm used in Example 1 for clozapine
treatment was used for the TOGA analyses. The TOGA data was generated with a
5'-
PCR primer (C-G-A-C-G-G-T-A-T-C-G-G-C-T-C-A; SEQ ID NO: 99) paired with
the "universal" 3' primer (SEQ ID NO: 23) labeled with 6-carboxyfluorescein
(6FAM, ABI) at the 5' terminus. PCR reaction products were resolved by gel
electrophoresis on 4.5% acrylamide gels and fluorescence data acquired on
ABI377
automated sequencers. Data were analyzed using GeneScan software (Perkin-
Elmer).
As shown in Table 1, the results of TOGA analysis indicate that CLZ_17 is
slightly down-regulated by clozapine treatment. Table 4 shows that CLZ_17
matches
several ESTs isolated from mouse tissue. In further characterization of
CLZ_17, in
situ hybridization analysis using an antisense cRNA probe directed against the
3' end
of CLZ_17 were performed to show the pattern of CLZ_17 mRNA expression in
mouse sections from anterior (25B) and posterior regions of the brain (25A).
In situ hybridization was performed on free-floating sections (25 pM thick)
taken from control mice and mice treated with 7.5 mg/kg clozapine for 2 weeks.
Coronal sections were hybridized at 55°C for 16 hour with an 35S-
labeled, single-
stranded antisense cRNA probe of CLZ_17 at 10' cpm/ml. The probe was
synthesized from the 3'-ended cDNA TOGA clone using the Maxiscript
Transcription
Kit (Ambion, Austin, TX). Excess probe was removed by washing as previously
described in Example 8. Slices were mounted onto gelatin-coated slides and
dehydrated with ethanol and chloroform before autoradiography. Slides were
exposed for 1-4 days to Kodak X-AR film and then dipped in Ilford K-5
emulsion.
After 4 weeks, slides were developed with Kodak D19 developer, fixed, and
counterstained with Richardson's blue stain.
Figure 25A-B shows an in situ hybridization analysis using an antisense
cRNA probe directed against the 3' end of CLZ-17, showing the pattern of CLZ-
17
mRNA expression in a coronal sections from posterior (25A) and anterior (25B)
137
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
regions of mouse brain. As shown, CLZ-17 mRNA is expressed in the cortex,
hippocampus, striatum, and amygdala.
EXAMPLE 10
Characterization of CLZ 24
Male C57B1/6J mice (20-28 g) were housed as previously described in
Example 1. The same experimental paradigm used in Example 1 for clozapine
treatment was used for the TOGA analyses. The TOGA data was generated with a
5'-
PCR primer (C-G-A-C-G-G-T-A-T-C-G-G-G-G-C-A; SEQ ID NO: 100) paired with
the "universal" 3' primer (SEQ ID NO: 23) labeled with 6-carboxyfluorescein
(6FAM, ABI) at the 5' terminus. PCR reaction products were resolved by gel
electrophoresis on 4.5% acrylamide gels and fluorescence data acquired on
ABI377
automated sequencers. Data were analyzed using GeneScan software (Perkin-
Elmer).
As shown in Table 1, the results of TOGA analysis indicate that CLZ 24 is
up-regulated by clozapine treatment. Tables 2 and 3 show that CLZ_24 is an EST
isolated from rat tissue. In further characterization of CLZ_24, in situ
hybridization
analysis using an antisense cRNA probe directed against the 3' end of CLZ 24
were
performed to show the pattern of CLZ 24 mRNA expression in mouse anterior
brain
(26B) and posterior brain (26A)
In situ hybridization was performed on free-floating sections (25 ~M thick)
obtained from comtrol mica nd mice treated with 7.5 mg/kg clozapine for 2
weeks.
Coronal sections were hybridized at 55°C for 16 hour with an 35S-
labeled, single-
stranded antisense cRNA probe of CLZ_24 at 10' cpm/ml. The probe was
synthesized from the 3'-ended cDNA TOGA clone using the Maxiscript
Transcription
Kit (Ambion, Austin, TX). Excess probe was removed by washing as previously
described in Example 8. Slices were mounted onto gelatin-coated slides and
dehydrated with ethanol and chloroform before autoradiography. Slides were
exposed for 1-4 days to Kodak X-AR film and then dipped in Ilford K-5
emulsion.
After 4 weeks, slides were developed with Kodak D19 developer, fixed, and
counterstained with Richardson's blue stain.
138
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
Figure 26A-B shows an in situ hybridization analysis using an antisense
cRNA probe directed against the 3' end of CLZ 24, showing the pattern of CLZ
24
mRNA expression in a coronal section through the hemispheres (26A) and cross
section through the brainstem (26B) in mouse brain. As shown, CLZ_24 mRNA is
ubiquitously expressed in the cortex.
EXAMPLE 11
Characterization of CLZ 26
Male C57B1/6J mice (20-28 g) were housed as previously described in
Example 1. The same experimental paradigm used in Example 1 for clozapine
treatment was used for the TOGA analyses. The TOGA data was generated with a
5'-
PCR primer (C-G-A-C-G-G-T-A-T-C-G-G-G-G-C-T; SEQ ID NO: 101) paired with
the "universal" 3' primer (SEQ ID NO: 23) labeled with 6-carboxyfluorescein
(6FAM, ABI) at the 5' terminus. PCR reaction products were resolved by gel
electrophoresis on 4.5% acrylamide gels and fluorescence data acquired on
ABI377
automated sequencers. Data were analyzed using GeneScan software (Perkin-
Eliner).
As shown in Table 1, the results of TOGA analysis indicate that CLZ 26 is
slightly down-regulated by clozapine treatment. Table 4 shows that CLZ_26 is a
metalloprotease-disintegrin MDC15 mRNA. In further characterization of CLZ 26,
in situ hybridization analysis using an antisense cRNA probe directed against
the 3'
end of CLZ 26 were performed to show the pattern of CLZ 26 mRNA expression in
mouse anterior brain (27B) and posterior brain (27A).
In situ hybridization was performed on free-floating coronal sections (25 ~,M
thick) with an 35S-labeled, single-stranded antisense cRNA probe of CLZ_26
using
the methods described in the above examples.
Figure 27A-B is an in situ hybridization analysis using an antisense cRNA
probe directed against the 3' end of CLZ 26, showing the pattern of CLZ 26
mRNA
expression in a coronal section of the hemispheres at the level of hippocampal
139
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
formation (27A) and coronal section of the hemispheres at the level of
striatum (27B)
in mouse brain. As shown, CLZ 26 mRNA is ubiquitously expressed in the cortex.
EXAMPLE 12
Characterization of CLZ 28
Male C57B1/6J mice (20-28 g) were housed as previously described in
Example 1. The same experimental paradigm used in Example 1 for clozapine
treatment was used for the TOGA analyses. The TOGA data was generated with a
5'-
PCR primer (C-G-A-C-G-G-T-A-T-C-G-G-G-G-T-A; SEQ ID NO: 102) paired with
the "universal" 3' primer (SEQ ID NO: 23) labeled with 6-carboxyfluorescein
(6FAM, ABI) at the 5' terminus. PCR reaction products were resolved by gel
electrophoresis on 4.5% acrylamide gels and fluorescence data acquired on
ABI377
automated sequencers. Data were analyzed using GeneScan software (Perkin-
Elmer).
As shown in Table 1, the results of TOGA analysis indicate that CLZ 28 is
down-regulated by clozapine treatment. Table 4 shows that CLZ_28 matches
several
ESTs isolated from mouse tissue. In further characterization of CLZ 28, in
situ
hybridization analysis using an antisense cRNA probe directed against the 3'
end of
CLZ_28 were performed to show the pattern of CLZ_28 mRNA expression in mouse
anterior brain (28B) and posterior brain (28A).
In situ hybridization was performed on free-floating coronal sections (25 ~,M
thick) with an 35S-labeled, single-stranded antisense cRNA probe of CLZ 28
using
the methods described in the above examples.
Figure 28A-B is an in situ hybridization analysis using an antisense cRNA
probe directed against the 3' end of CLZ 28, showing the pattern of CLZ_28
mRNA
expression in a coronal section through the hemispheres at the level of
hippocampus
(28A) and coronal section through the posterior region of hemispheres (28B) in
mouse brain. As shown in Figure 28A and B, CLZ 28 mRNA is expressed
ubiquitously in the cortex.
140
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
EXAMPLE 13
Characterization of CLZ 3
Male C57B1/6J mice (20-28 g) were housed as previously described in
Example 1. The same experimental paradigm used in Example 1 for clozapine
treatment was used for the TOGA analyses. The TOGA data was generated with a
S'-
PCR primer (C-G-A-C-G-G-T-A-T-C-G-G-A-G-T-A; SEQ ID NO: 94) paired with
the "universal" 3' primer (SEQ ID NO: 23) labeled with 6-carboxyfluorescein
(6FAM, ABI) at the 5' terminus. PCR reaction products were resolved by gel
electrophoresis on 4.5% acrylamide gels and fluorescence data acquired on
ABI377
automated sequencers. Data were analyzed using GeneScan software (Perkin-
Elmer).
As shown in Table 1, the results of TOGA analysis indicate that CLZ_3 is up-
regulated by clozapine treatment. Tables 2 and 3 show that CLZ 3 is a serine
protease HTRA mRNA. In further characterization of CLZ 3, in situ
hybridization
analysis using an antisense cRNA probe directed against the 3' end of CLZ 3
were
performed to show the pattern of CLZ_3 mRNA expression in mouse anterior brain
(29B) and posterior brain (29A).
In situ hybridization was performed on free-floating coronal sections (25 ~M
thick) with an 35S-labeled, single-stranded antisense cRNA probe of CLZ 3
using the
methods described in the above examples.
Figure 29A-B is an in situ hybridization analysis using an antisense cRNA
probe directed against the 3' end of CLZ_3, showing the pattern of CLZ_3 mRNA
expression in a coronal section through the hemispheres at level of
hippocampus
(29A) and cross section through midbrain (29B) in mouse brain. As shown in
Figure
29A and B, CLZ 3 mRNA is expressed in the cortex, thalamus, hippocampus,
striatum, and amygdala.
EXAMPLE 14
Characterization of CLZ 34
Male C57B1/6J mice (20-28 g) were housed as previously described in
Example 1. The same experimental paradigm used in Example 1 for clozapine
141
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
treatment was used for the TOGA analyses. The TOGA data was generated with a
5'-
PCR primer (C-G-A-C-G-G-T-A-T-C-G-G-T-A-T-T; SEQ ID NO: 103) paired with
the "universal" 3' primer (SEQ ID NO: 23) labeled with 6-carboxyfluorescein
(6FAM, ABI) at the 5' terminus. PCR reaction products were resolved by gel
electrophoresis on 4.5% acrylamide gels and fluorescence data acquired on
ABI377
automated sequencers. Data were analyzed using GeneScan software (Perkin-
Elmer).
As shown in Table l, the results of TOGA analysis indicate that CLZ 34 is
up-regulated by clozapine treatment. Tables 2 and 3 show that CLZ 34 is an N-
methyl-D-aspartate receptor NMDARI-2a subunit mRNA. In further
characterization
of CLZ 34, in situ hybridization analysis using an antisense cRNA probe
directed
against the 3' end of CLZ_34 were performed to show the pattern of CLZ 34 mRNA
expression in mouse anterior brain (30B) and posterior brain (30A).
In situ hybridization was performed on free-floating coronal sections (25 ~.M
thick) with an 35S-labeled, single-stranded antisense cRNA probe of CLZ 34
using
the methods described in the above examples.
Figure 30A-B is an in situ hybridization analysis using an antisense cRNA
probe directed against the 3' end of CLZ 34, showing the pattern of CLZ 34
mRNA
expression in a coronal section through the hemispheres at the level of
hippocampus
(30A) and cross section through the midbrain (30B) in mouse brain. As shown in
Figure 30A and B, CLZ_34 mRNA is ubiquitously expressed.
EXAMPLE 1 S
Characterization of CLZ 43
Male C57B1/6J mice (20-28 g) were housed as previously described in
Example 1. The same experimental paradigm used in Example 1 for clozapine
treatment was used for the TOGA analyses. The TOGA data was generated with a
5'-
PCR primer (C-G-A-C-G-G-T-A-T-C-G-G-C-T-A-A; SEQ ID NO: 104) paired with
the "universal" 3' primer (SEQ ID NO: 23) labeled with 6-carboxyfluorescein
(6FAM, ABI) at the 5' terminus. PCR reaction products were resolved by gel
142
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
electrophoresis on 4.5% acrylamide gels and fluorescence data acquired on
ABI377
automated sequencers. Data were analyzed using GeneScan software (Perkin-
Elmer).
As shown in Table 1, the results of TOGA analysis indicate that CLZ 43 is
up-regulated by clozapine treatment. Tables 2 and 3 show that CLZ_43 matches
an
EST isolated from mouse tissue that matches oxysterol binding protein family
member. In further characterization of CLZ_43, in situ hybridization analysis
using
an antisense cRNA probe directed against the 3' end of CLZ_43 were performed
to
show the pattern of CLZ 43 mRNA expression in mouse anterior brain (31 C),
midbrain (31A), and posterior brain (31B).
In situ hybridization was performed on free-floating coronal sections (25 pM
thick) with an 35S-labeled, single-stranded antisense cRNA probe of CLZ 43
using
the methods described in the above examples.
Figure 31A-C is an in situ hybridization analysis using an antisense cRNA
probe directed against the 3' end of CLZ_43, showing the pattern of CLZ_43
mRNA
expression in coronal sections of the hemispheres showing in the cortex, and
intense
lebelling in the striatum (31A-C) in mouse brain. Comparison with brain
sections
obtained from control mice showed that CLZ 43 expression is increased
approximately 10-fold by chronic treatment (2 weeks) with clozapine.
Following the cloning of the mouse DST CLZ_43, a BLAST analysis was
performed. A human homology was identified as a 5556 b.p. GenBank entry
(AB040884, also known as KIAA1451). An oligonucleotide was chosen from this
sequence and used to isolate the remaining 5' end of the human gene from an
adult
human brain cDNA plasmid library. Using the method described below, a 1717
b.p.
cDNA clone (SEQ ID N0:103) was isolated that overlaps the human sequence. This
clone provides an additional (novel) S 12 b.p. at the 5' end of the GenBank
entry.
Sequence analysis suggests the position of the methionine start codon for the
open
reading frame is at base 562 of the 1717 b.p. clone (SEQ ID NO: 108). The open
reading frame of the 1717 b.p. clone encodes a 385 amino acid peptide (SEQ ID
NO:
108, SEQ ID NO: 109).
143
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
The following methods were used to isolate the 1717 b.p. cDNA clone. The
target pool was a cDNA plasmid library created from adult human brain RNA. The
oligonucleotide sequence used for hybridization was 5' - AAC AAG TCC GTC CTG
GCA TGG-3' (SEQ ID N0:88). The clone was isolated using the methods prescribed
by the manufacturer of the GeneTrapper kit (Life Technologies, Inc.). Capture
oligonucleotide were prepared by end-labeling the oligonucleotide with biotin-
14-
dCTP using terminal deoxynucloetidyl transferase. The cDNA plasmid pool was
converted from double-stranded cDNA to single-stranded cDNA through the
specific
action of GeneII protein and exonuclease III. The single-stranded cDNA pool
was
combined with the end-labelled oligonucleotide and hybridization was allowed
to
occur at room temperature for 30 minutes. The reaction was then mixed with
strepavidin-coated magnetic beads. The single-stranded cDNA plasmids that
hybridized to the oligonucleotide were purified using a magnet to retain the
magnetic
beads in the reaction tube while all of the unbound components were washed
away.
The single-stranded plasmid DNA was released from the oligonucleotide and
repaired
back into a double-stranded plasmid using a fresh sample of the capture
oligonucleotide and DNA polymerise. The repaired plasmids were transformed
into
bacteria and plated on an agar plate. The following day, bacterial colonies
were
individually picked and grown overnight. Plasmid DNA was prepared from these
mini-preparations and subj ected to sequence analysis.
Homology matches with a human genome database have identified 7 exons
spread across more than 22,000 b.p. Further it has been determined that CLZ 43
maps to chromosome 12, which is not a chromosome previously linked to
schizophrenia. The sequence data reveals that the open reading frame encodes a
protein of 472 amino acids (SEQ ID NO: 110). Comparison with protein databases
indicate that the protein is novel and is a member of a class of proteins that
binds
lipids, especially oxysterols.
The observation that, of thousands of proteins expressed by the striatum, apoD
and a novel oxysterol binding protein are among the few modulated by
neuroleptic
drugs strengthens the hypothesis that schizophrenia is a disease of brain
sterol
homeostasis, and thus may have etiologies as diverse as atherosclerosis. The
brain
has by far more cholesterol and 24S-hydroxysterol than any organ other than
the
144
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
adrenal glands, and the special importance of the membrane activities of
neurons and
their myelinating cells are self evident. The lipid bilayer of the membrane is
made up
of glycerolphopholipids and cholesterol, and variations in composition and
hydrocarbon chain saturation state determine membrane order and fluidity.
These
S properties affect the binding of extrinsic membrane proteins and, thus,
second
messenger signaling. As we have shown previously, a large percentage of the
mRNAs highly enriched in the striatum encode proteins that regulate second
messenger signaling along the inner membrane. Thus, a panneural or
panorganismic
disruption in lipid metabolism might manifest first as a striatal disease. As
of now,
this is a somewhat impressionistic concept. Working out the nature of the
neuroleptic
drug effects on membrane properties may bring the issue into greater focus.
EXAMPLE 16
Characterization of CLZ 44
Male C57B1/6J mice (20-28 g) were housed as previously described in
Example 1. The same experimental paradigm used in Example 1 for clozapine
treatment was used for the TOGA analyses. The TOGA data was generated with a
5'-
PCR primer (C-G-A-C-G-G-T-A-T-C-G-G-A-C-G-G; SEQ ID NO: 105) paired with
the "universal" 3' primer (SEQ ID NO: 23) labeled with 6-carboxyfluorescein
(6FAM, ABI) at the 5' terminus. PCR reaction products were resolved by gel
electrophoresis on 4.5% acrylamide gels and fluorescence data acquired on
ABI377
automated sequencers. Data were analyzed using GeneScan software (Perkin-
Elmer).
As shown in Table 1, the results of TOGA analysis indicate that CLZ 44 is
up-regulated by clozapine treatment. Tables 2 and 3 show that CLZ_44 matches
an
EST isolated from mouse tissue. In further characterization of CLZ_44, in situ
hybridization analysis using an antisense cRNA probe directed against the 3'
end of
CLZ_44 were performed to show the pattern of CLZ 44 mRNA expression in mouse
anterior brain (32A) and posterior brain (32B).
In situ hybridization was performed on free-floating coronal sections (25 pM
thick) with an 35S-labeled, single-stranded antisense cRNA probe of CLZ 44
using
the methods described in the above examples.
145
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
Figure 32A-B is an in situ hybridization analysis using an antisense cRNA
probe directed against the 3' end of CLZ 44, showing the pattern of CLZ 44
mRNA
expression in a coronal section showing labelling in the hippocampus,
hypothalamus,
and temporal cortex (32A) and coronal section showing cortical labelling (32B)
in
mouse brain.
EXAMPLE 17
Characterization of CLZ 64
Male C57B1/6J mice (20-28 g) were housed as previously described in
Example 1. The same experimental paradigm used in Example 1 for clozapine
treatment was used for the TOGA analyses. The TOGA data was generated with a
5'
PCR primer (C-G-A-C-G-G-T-A-T-C-G-G-T-C-A-T; SEQ ID NO: 106) paired with
the "universal" 3' primer (SEQ ID NO: 23) labeled with 6-carboxyfluorescein
(6FAM, ABI) at the 5' terminus. PCR reaction products were resolved by gel
electrophoresis on 4.5% acrylamide gels and fluorescence data acquired on
ABI377
automated sequencers. Data were analyzed using GeneScan software (Perkin-
Elmer).
As shown in Table 1, the results of TOGA analysis indicate that CLZ_64 is
up-regulated by chronic clozapine treatment. Tables 2 and 3 show that CLZ_64
matches an EST isolated from mouse tissue and shares homolgy with
mitochondrial
enoyl-CoA hydratase mRNA. In further characterization of CLZ_64, in situ
hybridization analysis using an antisense cRNA probe directed against the 3'
end of
CLZ 64 were performed to show the pattern of CLZ 64 mRNA expression in mouse
anterior brain (33B) and mid-brain (33A).
In situ hybridization was performed on free-floating coronal sections (25 pM
thick) with an 35S-labeled, single-stranded antisense cRNA probe of CLZ 64
using
the methods described in the above examples.
Figure 33A-B is an in situ hybridization analysis using an antisense cRNA
probe directed against the 3' end of CLZ 64, showing the pattern of CLZ_64
mRNA
expression in different coronal sections of the hemispheres in mouse brain. As
shown
in Figure 33A and B, CLZ_64 mRNA is ubiquitously expressed.
146
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
SEQUENCE LISTING
<110> Thomas, Elizabeth A
$ Sutcliffe, J. Gregor
Pribyl, Thomas M
Hilbush, Brian S
Hasel, Karl W
<120> Regulation of Gene
Expression by Neuroleptic
Agents
<130> 99-022-B
<140>
1$ <141> 2000-10-26
<150> 60/161,379
<151> 1999-10-26
<150> 60/186,918
<151> 2000-03-03
<160> 110
2$ <170> PatentIn Ver. 2.0
<210> 1
<211> 54
<212> DNA
<213> Mus musculus
<400> 1
cggagtacag tgactttgag tttcagctattaaaatactt cttcatacga aaaa 54
3$ <210> 2
<211> 150
<212> DNA
<213> Mus musculus
<400> 2
cggcacccta ctggatcctg gccaccgattatgaaaacta tgccctcgtg tactcctgca
60
ccaccttctt ctggctcttc catgtggattttgtttggat tcttggaaga aatccttatc
120
tccctccaga aacaataacc tacctaaaaa150
4$ <210> 3
<211> 48
<212> DNA
<213> Mus musculus
$0 <400> 3
cggcatccag ctggatgtca gagccaataaagatacatgc actaaaaa 48
<210> 4
<211> 55
$$ <212> DNA
<213> Mus musculus
1
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
<400> 4
cggccagagtctgattagggctttgctcttaagcaaaactgtttacagggaaaaa 55
<210> 5
<211> 121
<212> DNA
<213> Mus
musculus
<400> 5
cggccgtggcggacaacgagaaattggacaaccaacggctcaagaattttaagaacaaag
60
gccgtgacttggagactatgagaagacaacgaaatgaagttgtagttgaattaaggaaaa
120
a 121
<210> 6
<211> 166
<212> DNA
<213> Mus
musculus
<400> 6
cggcggtggccatcagactctgagacagagagccaatctcacattcaagtgttcaccaac
60
cactgacgtgtttttatttccttctatatgattttaagatgtgttttctgcattctgtat
120
agaaacatatcaaactaaataaaagcagtgtctttattaccaaaaa 166
<210> ~
<211> 343
<212> DNA
<213> Mus
musculus
<400> ~
cggggcaaggagcaccagaagaacagcagccaacggccaggagcgggcaccatggttctg
60
ctgcagcgggagctggctcaggaagacagcctcaacaagctggctctccagtatggctgc
120
aaacactcagagtgattaacagtggcaaagtaagttggaaagcgtttctggaatcgctct
180
tttctcccgcattgaaacagtctgtttcccgctgttgactccatgctatatacatgctat
240
atacatgctgtatacatgctatatacatgctatatagtacatgctataatcatgctatat
300
actggcagaagctttcaccaagcttgcatcagctacacaaaaa 343
<210> 8
<211> 138
<212> DNA
<213> Mus
musculus
<400> 8
cggtactccgctctgatcatcggcatggcatacggcgccaagcgctacactcaagatgac
60
4$ agcattctcaagtgaggcgtcagcgagcttgcttttctctagtcgttgagaacgaataaa
120
gcttcattgtgagaaaaa 138
<210> 9
<211> 39
SO <212> DNA
<213> Mus
musculus
<400> 9
cggtattcagtggtgatgcctaaaggaatgtcagaaaaa 39
<210> 10
<211> 45
2
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
<212> DNA
<213> Mus musculus
<400> 10
S cggtccctgc cgctcaataa acatgaactg aacaaacaac aaaaa 45
<210> 11
<211> 56
<212> DNA
<213> Mus musculus
<400> 11
cggtgcattt gttcaggtaa aatctgtgca ataaaataac aaactgtctc caaaaa 56
1S 210> 12
<211> 212
<212> DNA
<213> Mus musculus
<400> 12
cggttgtggt tcagtggcaa ggcggttcag cacgtatcca acgtagatga gaccctaggt 60
tcagtctcca tccagcactg ggggctgggt gggatgtgac ttagtctgta tgttgggaac 120
aggaaaaaac tccataaggt gagcaaaaca gtattgtttt caattgaaat ggttggttgg 180
ttggttgttt tgcttgtcta aagccgcaaa as 212
2S
<210> 13
<211> 1156
<212> DNA
<213> Mus musculus
<400> 13
ttcggcagaggctcaatcgccaataaatgcatttccctgttaaatgaatggctaattagg60
tttatttttaccggtttggtgttgggccattgattttggtctcactaactagagtctcca120
cttccctacaaattaggtagtttaaaaaataaccttccaggcctccgaggttaatttata180
3S ttttaatgagtattaatagtcttcatgtcttcaagcattttcgctagagcatgtaaagta240
aaacacatccaatttttcttgtcttgacatacacgtggagatgttaacgaaaagagattc300
tgtatattttacctacttttctcccagccacttgttcaggttaatgagagatttttgagg360
tactaattgctttttatagacaaaccttttaactttgtatatataaaatatacacgtact420
cttggtgttcttttacaaaagctattaagtaggtgtaactaatactatgaagtagttttt480
ttaaactagcttttaaaaggtaaggccttttcagtgtggatgcagcatggtgagtgatga540
ttgtggatgcagttaactttgaaaatttgggtccctgtacctttgtgacaggttgtttta600
aaatagagactaatatttcaacttaatttcaaatgtattctgaaaaacttattatattag660
aaagtatgtntaaattcatttttaaaatgggggggtgggagatgccccatggactaagca720
ttttttgcctttgcggagaacctaagttcggttccaccatccacatcaggtagctaaaaa780
4S ccaccagaccctcggggctccacagacccacacatacatgtaattaaaagtgaaatgtga840
ctgaaaacttgctaggaagtttctttggatcaaatagtctttgaaatgtataggcttcca900
gtttaacatggtatgccctcttttgggtaccctttaaggaatagaagccggttgtggttc960
agtggcaagtcggttcagcacgtatccaacgtagatgagaccctaggttcagtctccatc1020
cagcactgggggctgggtgggatgtgacttagtctgtttgttgggaacaggaaaaaactc1080
SO cataaggtgagcaaaacagtattgttttcaattgaaatggttggttggttggttgttttg1140
cttgtctaaagccact 1156
<210> 14
<211> 118
SS <212> DNA
3
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
<213> Mus musculus
<400> 14
cggcacttgg gaggcagaga caggtggatg tctgagttta gagccagcct ggtctacaga 60
gtgaattcca gtctaggaag gtctacatag agaaatcctg tctcaaacaa aacaaaaa 118
<210> 15
<211> 122
<212> DNA
<213> Mus musculus
<400> 15
cggctagcag cagaaacgtc tcagggacag cacatgggca cagacgagtt ggacgggctg 60
ctctgcgggg agaccaacgg caaagacaca gagagttctg ggtgctgggg caagaagaaa 120
as 122
<210> 16
<211> 290
<212> DNA
<213> Mus musculus
<400> 16
cgggctagaacgccagccagaagaagcgctcgatctcggtctagaacgccagccaggaga60
2$ gggaggtcacgatccagaacaccagcacgacgacgatctcgaagtagaagtcttgtgaga120
cgtggaagatctcactctagaacaccacaaagaagaggacgatctggctcatcctcagag180
aggaagaacaaatctagaacatctcagaggagaagcagatccaactcaagcccagaaaaa240
<210>
17
<211>
220
<212>
DNA
<213> musculus
Mus
<400>
17
cggtacgatgctgtgacaattaagattgatcctgaattggagaaaaaattgaaagtgaat60
aaaataactttagagtcagagtatgagaggctgttatgtttattgtgcagacaatgataa120
tccaccagagaagtattgccacaagcaagccgtccaagtacaatcacagacagcgactct180
acacaaggaacagagaatgaagtcagagggcacacaaaaa 220
<210>
18
<211>
319
<212>
DNA
<213> musculus
Mus
<400>
18
cggtcatcgcagctgtcaatggttatgctcttggtgggggttgtgaacttgccatgatgt60
gtgatatcatctatgctggcgagaaagcccagttcggacagccagaaatcctcctgggga120
ccatcccaggtgctggaggcactcagagactcacccgagcagtcggcaaatcgctagcaa180
tggagatggtcctcactggtgaccgcatctcagctcaggatgcaaagcaggcaggtcttg240
taagcaagatttttcctgttgaaaaactggttgaagaagccatccaatgtgcagaaaaa 319
<210>
19
<211>
279
<212>
DNA
$$ <213> musculus
Mus
<400> 19
4
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
cggtgacaga cagaagagga ttgtacagaggagctctttgacttcttgca tgcacgggac
60
cactgtgtgg cccacaagct ccttaaaaacttgaagtaaatgtgcagatt cgtcctcctc
120
agccctgttt ttgggaatca ggggcgagttccttgtggttctggacgtcg gtgtctgatg
180
gagtgagttc tcgagaacat cactgactccggcggtagcttctcttctgt gtgactagca
240
S gtgacttcat cttaataaac tgatctgcaaacccaaaaa279
<210> 20
<211> 48
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of ArtificialSequence:
cDNA
anchor
primer
IS
<400> 20
gaattcaact ggaagcggcc gcaggaattttttttttttttttttvnn 48
<210> 21
<211> 16
<212> DNA
<213> Artificial Sequence
<220>
2$ <223> Description of ArtificialSequence:RT primer
5'
<400> 21
aggtcgacgg tatcgg 16
<210> 22
<211> 16
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of ArtificialSequence:PCR primer
5'
<400> 22
ggtcgacggt atcggn 16
<210> 23
<211> 15
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of ArtificialSequence:
universal
3'
PCR primer
SO <400> 23
gagctccacc gcggt 15
<210> 24
<211> 16
<212> DNA
<213> Artificial Sequence
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
<220>
<223> Description of ArtificialSequence: 5' PCR primer
<400> 24
cgacggtatc ggnnnn 16
<210> 25
<211> 16
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of ArtificialSequence: 5' PCR primer
with parsing bases C-A-C-C
<900> 25
cgacggtatc ggcacc 16
<210> 26
<211> 16
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of ArtificialSequence: 5' PCR primer
with parsing bases T-T-G-T
<400> 26
cgacggtatc ggttgt 16
<210> 27
<211> 16
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of ArtificialSequence: 5' PCR primer
with parsing bases T-A-T-T
<400> 27
cgacggtatc ggtatt 16
<210> 28
<211> 30
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of ArtificialSequence: Extended-TOGA
primer for CLZ 3 clone
<400> 28
gatcgaatcc ggagtacagt gactttgagt 30
<210> 29
<211> 30
<212> DNA
6
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
<213> Artificial Sequence
<220>
<223> Description of Artificial Extended-TOGA
Sequence:
$ primer for CLZ_5 clone
<400> 29
gatcgaatcc ggcaccctac tggatcctgg 30
<210> 30
<211> 30
<212> DNA
<213> Artificial Sequence
1$ <220>
<223> Description of Artificial Extended-TOGA
Sequence:
primer for CLZ-8 clone
<400> 30
gatcgaatcc ggcatccagc tggatgtcag 30
<210> 31
<211> 30
<212> DNA
2$ <213> Artificial Sequence
<220>
<223> Description of Artificial Extended-TOGA
Sequence:
primer for CLZ-10 clone
<400> 31
gatcgaatcc ggccagagtc tgattagggc 30
<210> 32
3$ <211> 30
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Extended-TOGA
Sequence:
primer for CLZ 12 clone
<400> 32
gatcgaatcc ggccgtggcg gacaacgaga 30
4$
<210> 33
<211> 30
<212> DNA
<213> Artificial Sequence
$0
<220>
<223> Description of Artificial Extended-TOGA
Sequence:
primer for CLZ 15 clone
$$ <400> 33
gatcgaatcc ggcggtggcc atcagactct 30
7
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
<210> 34
<211> 30
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:Extended-TOGA
primer for CLZ_24 clone
<400> 34
gatcgaatcc ggggcaagga gcaccagaag 30
<210> 35
<211> 30
IS <212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:Extended-TOGA
primer for CLZ-33 clone
<400> 35
gatcgaatcc ggtactccgc tctgatcatc 30
<210> 36
<211> 30
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:Extended-TOGA
primer for CLZ-34 clone
<400> 36
gatcgaatcc ggtattcagt ggtgatgcct 30
<210> 37
<211> 30
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:Extended-TOGA
primer for CLZ_37 clone
<400> 37
gatcgaatcc ggtccctgcc gctcaataaa 30
<210> 38
$0 <211> 30
<212> DNA
<213> Artificial Sequence
<220>
5$ <223> Description of Artificial Sequence:Extended-TOGA
primer for CLZ 38 clone
g
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
<400> 38
gatcgaatcc ggtgcatttg ttcaggtaaa 30
<210> 39
$ <211> 30
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Extended-TOGA
Sequence:
primer for CLZ_40 clone
<400> 39
gatcgaatcc ggttgtggtt cagtggcaag 30
1$
<210> 40
<211> 30
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Extended-TOGA
Sequence:
primer for CLZ-6 clone
2$
<400> 40
gatcgaatcc ggcacttggg aggcagagac 30
<210> 41
<211> 30
<212> DNA
<213> Artificial Sequence
<220>
3$ <223> Description of Artificial Extended-TOGA
Sequence:
primer for CLZ 16 clone
<400> 41
gatcgaatcc ggctagcagc agaaacgtct 30
<210> 42
<211> 30
<212> DNA
4$ <213> Artificial Sequence
<220>
<223> Description of Artificial Extended-TOGA
Sequence:
primer for CLZ_22 clone
$0
<400> 42
gatcgaatcc gggctagaac gccagccaga 30
<210> 43
$$ <211> 30
<212> DNA
<213> Artificial Sequence
9
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
<220>
<223> Description of Artificial Extended-TOGA
Sequence:
primer for CLZ-32 clone
$
<400> 43
gatcgaatcc ggtacgatgc tgtgacaatt 30
<210> 44
<211> 30
<212> DNA
<213> Artificial Sequence
<220>
1$ <223> Description of Artificial Extended-TOGA
Sequence:
primer for CLZ-36 clone
<400> 44
gatcgaatcc ggtcatcgca gctgtcaatg 30
<210> 45
<211> 30
<212> DNA
<213> Artificial Sequence
2$
<220>
<223> Description of Artificial Extended-TOGA
Sequence:
primer for CLZ-42 clone
<400> 45
gatcgaatcc ggtgacagac agaagaggat 30
<210> 46
<211> 30
3$ <212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Extended-TOGA
Sequence:
primer for CLZ 17 clone
<400> 46
gatcgaatcc ggctcagcac ttggcagctg 30
4$ <210> 47
<211> 30
<212> DNA
<213> Artificial Sequence
$0 <220>
<223> Description of Artificial Extended-TOGA
Sequence:
primer for CLZ-26 clone
<400> 47
$$ gatcgaatcc ggggctggag taggtggcgg 30
<210> 48
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
<211> 30
<212> DNA
<213> Artificial Sequence
$ <220>
<223> Description
of Artificial Sequence:
Extended-TOGA
primer for CLZ- 28 clone
<400> 48
10gatcgaatcc ggggtagggacacccctgta 30
<210> 49
<211> 155
<212> DNA
1$<213> Mus musculus
<400> 49
cggctcagca cttggcagctgtcccgtgcg gggactcagt ccaactctgt 60
gtttgctttt
cttcttggcc aaagcatgtgccactaagct gtcctggagg acattgtctt 120
tatgaaacac
20acctggaata aaaccacttcttacatgtcc aaaaa 155
<210> 50
<211> 80
<212> DNA
2$<213> Mus musculus
<400> 50
cggggctgga gtaggtggcg gaaggacatg gacactgtct atctctgctc tgttgtaata 60
aatgtgagat cttggaaaaa 80
<210> 51
<211> 206
<212> DNA
3$ <213> Mus musculus
<400> 51
cggggtaggg acacccctgt atcatagtgg aggttggagc tggcaaatgg gaagagcttc 60
taataatcac tttgggctgg gaaccttatt tattggtagt gttaggtcag agggcagkak 120
gcggagacaa ggttgtggca cctgctgatg cagctcctct ttattttgct ttttacttgg 180
gaaataaatg gatttagcca taaaaa 206
<210> 52
<211> 206
4$ <212> DNA
<213> Mus musculus
<400> 52
$0 cgggatccca cgagggccac cagcccaggg gctcctgccc acccgccctt gggactaaaa 60
ttcggctttg taggagcggg tttggggaag tctggataga gactggacaa aggagtgtgg 120
ccacagtgag aagtggatag cgccacagct gcggcgatgg actcgttcat aggaataaaa 180
tcttgctaac agcaaatgag caaaaa 206
$$ <210> 53
<211> 537
<212> DNA
11
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
<213> Mus musculus
<400> 53
$ cagtttccct gcacctctgg ctctcaccag catcctctca gctgttctgt gccaaatacg 60
tctgcaccca tgggttcagc acaggggccc ctcacctcgg tgactaagct tcgcccacct 120
tgttacgatg tcttatatat atacacactg ctatttacag acctggcctt ggatcctgtg 180
accctctggg aagagtcctg ccaaagtcca ggacagcatt ggggctaagg cagaggcttt 240
tctctagagg cttgggccct gtcccaacgt ggactttggg gctaggaacc tgggcttctc 300
tctgtgaatg taaggacagc tactcagaga gccttgatgg gggcctctcc ccatttcctg 360
tggtcagacc cggctcagca cttggcagct gtcccgtgcg gggactcagt ccaactctgt 420
gtttgctttt cttcttggcc aaagcatgtg ccactaagct gtcctggagg acattgtctt 480
tatgaaacac acctggaata aaaccacttc ttacatgtcc aaaanaaaaa aaaaaaa 537
1$ <210> 54
<211> 2833
<212> DNA
<213> Mus musculus
<400> 54
agctggtgtccggcggggccgtggctgctcctccacgcgtagccccgcacctgctgcccc60
agtccagcccggagctccgcggccatgcggctggcgctgctctgggctctgggactcctg120
ggcgcgggcagccctcggccctccccgccgctgccaaatataggaggcactgaggaagag180
2$ cagcaagccagcccagagaggacgctgagtggatccatggagagccgggttgttcaggac240
agccccccaatgagcctagcagacgtgcttcagactggtttacctgaggccctgaggatt300
tccttggagctggacagtgagagtcatgtcctggagcttctacaaaatagagatctaatc360
cctggccgcccaactctggtgtggtaccagcctgatggcacccgaatggtcagcgagggc420
tacagtctagaaaactgctgctaccgaggacgagtgcagggccaccccagctcctgggtg480
tccctctgtgcctgctctgggatcagggggctcattgtcctgtccccagagagaggctat540
acactggagctgggccctggggaccttcagcgtcctgtcatttctcggatccaagaccac600
ctgttgctgggccacacctgtgccccaagctggcatgcctctgtgcccactcgggcagga660
ccagacctccttctggaacagcatcacgctcacaggcttaagcgagatgtagtaacagag720
acgaaaattgtggagttggtgattgtggctgataattcagaggtcagaaagtaccctgac780
3$ ttccaacaactgctgaaccggacactagaagcggctctcttgctagacacgttcttccag840
cccttgaatgtccgggtagcccttgtgggcctagaggcatggacccagcacaacctgata900
gaaatgagctccaacccagctgtcctgctagacaacttcctccgctggcgccggacagac960
ttgctgcctcgactgccccatgacagtgcccaactggtgactgtaacttccttctctggt1020
cccatggtgggcatggccattcagaattccatctgttcccctgacttctccggaggtgtg1080
aatatggaccactccacaagcatcttaggcgttgcctcctcgattgcccatgaattgggc1140
cacagtctgggtttggaccatgattctcccgggcacagctgtccctgtccaggtccagcc1200
ccggctaagagctgcatcatggaggcctccacagacttcctaccaggtttgaacttcagc1260
aactgcagccgacaggccctggaaaaggccctcctggaaggaatgggcagctgcctcttc1320
gaacggcaacccagcctggcccctatgtcctctttgtgtggaaatatgtttgtggacccc1380
4$ ggagagcagtgtgactgtggcttcccagatgaatgcactgatccctgctgtgaccatttc1440
acctgccagctgaggccaggagcgcagtgtgcatctgatggaccctgttgtcaaaactgc1500
aagttgcacccagctggttggctgtgccgccctcccacagacgattgtgatctgcctgag1560
ttctgcccaggagatagctctcagtgcccgtctgacatcagacttggggacggtgagcct1620
tgtgctagtggagaggctgtgtgtatgcatgggcgctgtgcctcctatgcccggcagtgc1680
$0 cagtcactttggggacccggggcccagcctgctgcgccactttgcctccaaacagccaac1740
actcggggtaatgcctttgggagctgtgggcgcagccctggtggtagctacatgccttgt1800
gcccctagagatgtcatgtgtgggcaactgcagtgccagtggggtaggagccagcctctg1860
ttgggctcagtccaagatcggctctcggaggtcctggaagccaacgggacacagttaaac1920
tgcagctgggtggacctggacctgggcaatgatgtggcccagcctcttctggctctgcct1980
$$ ggcactgcctgtggtcctggcctggtgtgcatcggccaccgatgccagcccgtggatctc2040
ctgggagcacaggaatgtcgaagaaaatgccacggccatggggtctgtgacagcagcggg2100
cactgccgctgtgaagagggctgggcacctccagactgcatgacccagctcaaagcaacc2160
12
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
agctccctga ccacaggcct gctcctcagc ctcctgttgt tattggtcct cgtactactt 2220
ggtgccagct actggcaccg tgcccgcctg catcagcggc tctgccagct taagggatcc 2280
agctgccaat atagggcacc ccaatcctgt cctcctgaac gaccaggacc tccacagcgg 2340
gcacagcaga tgacaggcac taagtctcag gggcctacca aacccccacc cccaagaaag 2400
$ ccactgcctg ccaacccaca gggccagcac ccaccaggtg acctgcctgg cccaggagat 2460
ggaagcttgc cgctggtggt gccctccagg ccagctccac caccccctgc agcatcttcg 2520
ctctacctct gacctctgga gatttggctg cctccttctc aagctctaag actcaaagaa 2580
atggaacctc tgccccaaac actagagaag caggagaaca gacaatctgg tgtccagccc 2640
taaagaacca ccaggcgctg ttaagcaata cctggggacg cactaaaata gctgcagcgg 2700
gatgctgggg aggggccgaa gccggggctg gagtaggtgg cggaaggaca tggacactgt 2760
ctatctctgc tctgttgtaa taaatgtgag atcttggaaa aaaaaaaaaa aaaaaaaaaa 2820
aaaaaaaaaa aaa 2833
<210> 55
<211> 596
<212> DNA
<213> Mus musculus
<400> 55
tggcagtgct aagcagcact ctaccagtga atttaccccc acactccctg cctttttcnt 60
ttgtgtggtt gaatcctggg gatggnaacc cagggnacag cagtccccag atcaactccc 120
atcttctcag aggcacttta gggcmrtggg gctgggcagc acttcatggg tcctcaggca 180
gttggggcta actgcctcag gaaggcatcc cactttggag ggcttccatc tttttgaggc 240
actttgggac agggaaagtg ggtaccattc tctcaggcct tatgacaatt ggggtaacta 300
cgccaagcag gacagaggct gctggggcag ggtggccttc ccctcccccg gtgtacatat 360
tgtacctgtg tactattttg tatataccgg ggtagggaca cccctgtatc atagtggagg 420
ttggagctgg caaatgggaa gagcttctaa taatcacttt gggctgggaa ccttatttat 480
tggtagtgtt aggtcagagg gcagkakgcg gagacaaggt tgtggcacct gctgatgcag 540
ctcctcttta ttttgctttt tacttgggaa ataaatggat ttagccataa aaaaaa 596
<210> 56
<211> 1603
<212> DNA
<213> Mus musculus
<400> 56
cctcctcttacttctttttctccttctacttctcctcttctttcttctcctctttttctt60
cttcctcctcctccctctcctcccccatccccctgccccattgatgtgttattattgggg120
gggctggagcagtaaaaaaagaaggaggaaaaaaagagcggggctcggcagggagagctt180
gagcgcgaggttgaccggcggcggcagcggccgcgatggaagaacttacggcgttcgtct240
ccaagtcttttgaccagaaagtgaaggagaagaaggaggccatcacgtaccgggaggtgc300
tagagagcgggccgctgcgcggggccaaagagcccggttgcgtcgagccgggccgcgacg360
4$ accgcagcagcccggcagtccgggcggccggcggaggcggcggcgcgggaggaggcggag420
gcggaggcggaggaggcggaggaggtgctggaggaggaggagcaggcggaggagctggag480
gagggcgctctcccgtccgggagctggacatgggagccgcggagcggagcagggagcccg540
gcagcccgcggctgacggaggtgtcccctgaactgaaggatcgcaaagacgatgcgaaag600
ggatggaggacgaaggccagaccaaaatcaagcagaggcgaagtcggaccaattttaccc660
$0 tggaacaactcaacgagctggagaggcttttcgatgagacccactatccagacgctttca720
tgcgcgaggaattgagccagcgactggggctctctgaggcccgagtacaggtttggtttc780
aaaatcgaagagctaagtgtagaaaacaggaaaatcaacttcacaaaggtgtccttatag840
gagccgctagccagtttgaagcttgtagagttgcaccctatgtcaacgtaggtgctttaa900
ggatgccatttcagcaggatagtcattgcaacgtgacgcccttgtcctttcaggttcagg960
55 cgcagctgcagctggacagcgccgtggcgcacgcgcaccaccacctgcatccgcacctgg1020
ccgcgcacgcgccttacatgatgttcccggcaccgcccttcggactgccgctggccacgc1080
13
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
tggccgcgga ctcggcctcg gccgcctcgg tggtggccgc tgccgccgcc gccaagacca 1140
ccagcaagaa ctccagcatc gcggatctca gactgaaagc taaaaagcac gcggccgccc 1200
tgggtctgtg acgccggcgc cagcgccacg gtcggtggag cctcctaagc ggcgcgatcc 1260
tgcacgccct ccgcgaccgg cttctcccgc acccgcttct gaccgtcgcc caggcctgtc 1320
$ ccttccccgc tgactgccgc cttttctttc tgcaccctgg atccccaggg cgggactctg 1380
cgctggaccc gggatcccac gagggccacc agcccagggg ctcctgccca cccgcccttg 1440
ggactaaaat tcggctttgt aggagcgggt ttggggaagt ctggatagag actggacaaa 1500
ggagtgtggc cacagtgaga agtggatagc gccacagctg cggcgatgga ctcgttcata 1560
ggaataaaat cttgctaaca gcaaatgagc aaaaaaaaaa aaa 1603
<210> 57
<211> 271
<212> DNA
<213> Mus musculus
1$
<400>
57
cggctgcaggtgagggctggtttgtaacgaattctctctgccctcttaagctgaggaagc60
tggagtaggtctcatttgccctgtagttgcgatctctgatggctggggagcatctttcct120
catgtttgctgtgtatctgcttcagagacttcagggtgtttgcccawwrrgttgtctgac180
cttttattatgaaggtttacaagtttgttatgcattctagataaaagttcctttgtgtca240
gatgaatcacataaaaattttcctccaaaaa 271
<210>
58
<211>
411
2$ <212>
DNA
<213>
Mus musculus
<400>
58
cggctaatattgataatctttatttgaaaaaatgtcatgaaccatttgaatgatgagcca60
cagaacctcagttgaatttatttccacttttggcatgttaaatatagatttaattttaag120
tacttcaattaatgggtttataaagtcaagcactagcattggtcagttttgtatgatagg180
atgtaagtgtgttctcacctgcagtgtaaatacagcacactgtagaattctcttaaggtg240
catagtaaatgtatagatagtcacaggcggttttgtaatgtatacatttctaatctatta300
ttcctaacctgtcatgtttgcagagagaaaagaatttttctaatgatctgtaaaattatg360
3$ ttaacttctacaagtaggtattctaaataaacttttttaaaagaccaaaaa 411
<210>
59
<211>
295
<212>
DNA
<213> musculus
Mus
<400>
59
cggacggtgtaccccgaggatcgccccaggtggagggaaagatccaggaccaggtcgcgc60
agcaggagtagaaccccatttcgcctgtgtgagaaagatcgaatggagctactagaaata120
4$ gcaaaagccaacgcagcaaaagctctgggaacagccaacttcgacttgccagcaagtctc180
cgagccaaggaggcaagccaggggacagctgtttccagcagtgggccaaaggtggagcat240
tcagaaaagcagactgaagatacaactaaaaataccagtgaaaagtcttctacac 295
<210>
60
$0 <211>
84
<212>
DNA
<213> musculus
Mus
$$
<400> 60
cggaatactg aggaggaagg acccaagtac aagtccaaag tttcattaaa aggcaataga 60
gaaagtgatg gatttagaga aaaa 84
14
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
<210> 61
<211> 42
<212> DNA
<213> Mus musculus
<400> 61
15
cggccggcat gaaataaaac atttaaatag tgctggcaaa as 42
<210> 62
<211> 397
<212> DNA
<213> Mus musculus
<400> 62
cggctgacaa cagactttaa tgtaattgtg caagcactga gcaaatctaa ggcaaaactc 60
atggaagtca gtgcagacaa aactaaaatt agaagatcac caagcagacc actccctgaa 120
gtgacggatg agtataagaa tgatgtaaaa aacagatctg tttatattaa aggtttccca 180
actgacgcca cccttgatga tataaaagaa tggctagacg ataaaggcca aatactgaat 240
attcaaatga gaagaacatt acacaaaaca tttaaggggt caatatttgc tgtgtttgat 300
agtattcagt ctgcaaagaa gtttgtggag atccctggcc agaagtacaa agacactaac 360
ctgctaatac tctttaagga agattacttt gcaaaaa 397
<210> 63
<211> 240
<212> DNA
<213> Mus musculus
<400> 63
cggccgtggt ggcgcacacc attaatccca gcactcagga ggcagaggca ggcggatttc 60
tgagttcgag gccagcctgg tctacagagt gagttccagg acagccaggg ctacacagag 120
aaaccctgtc ttgaagaaac aaaaaggtta ggctagtatt tggagaaaga agattagaaa 180
atggaagtga aagacgaaga agacatacag gaaggtgaag aaaaagctgt tagagaaaaa 240
<210> 64
<211> 196
<212> DNA
<213> Mus musculus
<900> 64
cggcatgggt ggtcttcatc ctggccgata gctgcagaac tgatgtgaat gtaccttcat 60
ttgctctgac actgcatggc acagtggcag gattgcacat ccctagagta gaggctttca 120
agcaaagctg cctcccccgt cttgatttcc tgttgatttc tattctataa ttgaacaggc 180
atttctgtgg caaaaa 196
<210> 65
<211> 95
<212> DNA
<213> Mus musculus
$$ <400> 65
cggcagacct agctcagctt gatggggtgt gacaactgca attagaggca agccgcctgc 60
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
tgcccccaga gcattaagag caaattggag aaaaa 95
<210> 66
<211> 343
$ <212> DNA
<213> Mus musculus
<400> 66
cggggcaagg agcaccagaa gaacagcagc caacggccag gagcaggcac catggttctg 60
ctgcagcggg agctggctca ggaagacagc ctcaacaagc tggctctcca gtatggctgc 120
aaacactcag agtgattaac agtggcaaag taagttggaa agcgtttctg gaatcgctct 180
tttctcccgc attgaaacag tctgtttccc gctgttgact ccatgctata tacatgctat 240
atacatgctg tatacatgct atatacatgc tatatagtac atgctataat catgctatat 300
1$ actggcagaa gctttcacca agcttgcatc agctacacaa aaa 343
<210> 67
<211> 273
<212> DNA
<213> Mus musculus
<400> 67
cgggccccat caatttcacc atgttcctca ccatgtttgg ggagaagcta aacggcactg 60
2$ accccgagga cgtcatcaga aacgccttcg cttgctttga tgaggaagcc acaggcacca 120
tccaggagga ttacctgagg gagcccctga ccaccatggg cgaccgcttc acagacgagg 180
aagtggatga gctgtacaga gaggccccca ttgacaaaaa ggggaacttc aactacattg 240
agttcacacg catcctgaag cacggcgcaa aaa 273
<210> 68
<211> 273
<212> DNA
3$ <213> Mus musculus
<400> 68
cgggcgccat caatttcacc atgttcctca ccatgtttgg ggagaagcta aacggcactg 60
accccgagga cgtcatcaga aacgccttcg cttgctttga tgaggaagcc acaggcacca 120
tccaggagga ttacctgagg gagctgctga ccaccatggg cgaccgcttc acagacgagg 180
aagtggatga gctgtacaga gaggccccca ttgacgaaaa ggggaacttc aactacattg 240
agttcacacg catcctgaag cacggcgcaa aaa 273
4$ <210> 69
<211> 115
<212> DNA
<213> Mus musculus
$0 <400> 69
cggggctcaa agacaagggt tcgagtcccg ctcctgccca cgcccactgc attcgggctt 60
cagtttttcc ttctctgaaa tggggacgtg gataaaatca tcttcaaagc aaaaa 115
$$ <210> 70
<211> 335
<212> DNA
16
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
<213> Mus musculus
<400> 70
$ cggtcatcgc agctgtcaat ggttatgctc ttggtggggg ttgtgaactt gccatgatgt 60
gtgatatcat ctatgctggc gagaaagccc agttcggaca gccagaaatc ctcctgggga 120
ccatcccagg tgctggaggc actcagagac tcacccgagc agtcggcaaa tcgctagcaa 180
tggagatggt cctcactggt gaccacatct cagctcagga tgcaaagcag gcaggtcttg 240
taagcaagat ttttcctgtt gaaaaactgg ttgaagaagc catccaatgt gcagaaaaaa 300
ttgccagcaa ttctaaagtc gtagtagcca tggcg 335
<210> 71
<211> 240
<212> DNA
1$ <213> Mus musculus
<400> 71
cggtatgtgg gtagagtggt ccattcgttt gatggcacga aggaagcagc agctgctttg 60
gttgacttgg gcctttatat aggatttaat ggttgctctc tgaaaactga agctaacttg 120
gaagttctga agtcaatacc tagtgaaaaa ctaatgattg agacagatgc accttggtgt 180
ggagttaaaa gtacacatgc tggatcaaaa tacataaacc cttgggtttc cctccaaaaa 240
<210> 72
<211> 107
2$ <212> DNA
<213> Mus musculus
<400> 72
cggtatccac agtaaaattg tgagtagctt aatctgttta tctccattac aattcctctg 60
caactatttt ccttgatgtt gtaataaaaa ggaggtagga tgaaaaa 107
<210> 73
<211> 30
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Extended-TOGA
primer for CLZ 18 clone
<400> 73
4$
$0
gatcgaatcc ggctgcaggt gagggctggt 30
<210> 74
<211> 30
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Extended-TOGA
primer for CLZ 43 clone
$$ <400> 74
17
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
gatcgaatcc ggctaatatt gataatcttt 30
<210> 75
<211> 30
$ <212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Extended-TOGA
Sequence:
primer for CLZ-44 clone
<400> 75
gatcgaatcc ggacggtgta ccccgaggat 30
<210> 76
<211> 30
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Extended-TOGA
Sequence:
primer for CLZ 47 clone
<400> 76
gatcgaatcc ggaatactga ggaggaagga 30
<210> 77
<211> 30
<212> DNA
<213> Artificial Sequence
<220>
3$ <223> Description of Artificial Extended-TOGA
Sequence:
primer for CLZ 98 clone
<400> 77
gatcgaatccg gccggcatg aaataaaaca 30
<210> 78
<211> 30
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Extended-TOGA
Sequence:
primer for CLZ_49 clone
<900> 78
gatcgaatcc ggctgacaac agactttaat 30
$$ <210> 79
<211> 30
<212> DNA
18
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:Extended-TOGA
primer for CLZ 50 clone
<400> 79
gatcgaatcc ggccgtggtg gcgcacacca 30
<210> 80
<211> 30
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:Extended-TOGA
primer for CLZ-51 clone
<400> 80
gatcgaatcc ggcatgggtg gtcttcatcc 30
<210> 81
<211> 30
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:Extended-TOGA
primer for CLZ 52 clone
<400> 81
gatcgaatcc ggcagaccta gctcagcttg 30
<210> 82
<211> 30
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:Extended-TOGA
primer for CLZ_56 clone
<400> 82
gatcgaatcc gggccccatc aatttcacca 30
<210> 83
<211> 30
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:Extended-TOGA
primer for CLZ 57 clone
19
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
<400> 83
gatcgaatcc gggcgccatc aatttcacca 30
<210> 84
<211> 30
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Extended-TOGA
Sequence:
primer for CLZ-60 clone
<400> 84
gatcgaatcc ggggctcaaa gacaagggtt 85
<210> 85
<211> 30
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Extended-TOGA
Sequence:
primer for CLZ-62 clone
<400> 84
gatcgaatcc ggtatgtggg tagagtggtc 30
<210> 86
<211> 30
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Extended-TOGA
Sequence:
primer for CLZ_69 clone
<400> 86
gatcgaatcc ggtcatcgca gctgtcaatg 30
<210> 87
<211> 30
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Extended-TOGA
Sequence:
primer for CLZ 65 clone
<400> 87
gatcgaatcc ggtatccaca gtaaaattgt 30
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
<210> 88
<211> 21
$ <212> DNA
<213> Artificial Sequence
<223> Description of Artificial Sequence: probe for screening human brain
library
<900> 88
aacaagtccg tcctggcatg g 21
<210> 89
<211> 59
<212> DNA
<213> Artificial Sequence
<223> Description of ArtificialSequence:adapter primer direct
5' for
sequencing
<400> 89
tcccagtcac gacgttgtaa aacgacggctcatatgaattaggtgaccga cggtatcgg 59
<210> 90
<211> 46
<212> DNA
<213> Artificial Sequence
<223> Description of ArtificialSequence:adapter primer direct
3' for
sequencing
<400> 90
cagcggataa caatttcaca cagggagctccaccgcggtggcggcc 46
<210> 91
<211> 23
<212> DNA
<213> Artificial Sequence
4$ <223> Description of ArtificialSequence:sequencing primerfor direct
5'
sequencing
<400> 91
cccagtcacg acgttgtaaa acg 23
<210> 92
<211> 19
<212> DNA
5$ <213> Artificial Sequence
21
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
<223> Description of Artificial Sequence: 3' sequencing primer for direct
sequencing
<400> 92
tttttttttt ttttttttv 19
<210> 93
<211> 35
<212> DNA
<213> Artificial Sequence
<223> Description of Artificial Sequence: 3' sequencing primer for direct
sequencing
1$
<400> 93
ggtggcggcc gcaggaattt tttttttttt ttttt 35
<210> 94
<211> 16
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: 5' PCR primer
with parsing bases A-G-T-A
<400> 94
cgacggtatc ggagta
<210> 95
<211> 30
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Extended TOGA primer for CLZ-58
<400> 95
gatcgaatcc gggatcccac gagggccacc 30
<210> 96
<211> 16
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: 5'PCR primer for CLZ-44 with
parsing bases A-C-G-G
<400> 96
cgacggtatc ggacgg 16
22
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
<210> 97
<211> 16
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of ArtificialSequence:5'PCR primer for CLZ-38
with
parsing bases T-G-C-A
<400> 97
cgacggtatc ggtgca 16
<210> 98
<211> 16
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of ArtificialSequence:5'PCR primer for CLZ-16
with
parsing bases C-T-A-G
<400> 98
cgacggtatc ggctag 16
<210> 99
<211> 16
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of ArtificialSequence:5'PCR primer for CLZ-17
with
parsing bases C-T-C-A
<400> 99
cgacggtatc ggctca 16
<210> 100
<211> 16
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of ArtificialSequence:5'PCR primer for CLZ
24 with
parsing bases G-G-C-A
<400> 100
cgacggtatc ggggca 16
<210> 101
<211> 16
<212> DNA
<213> Artificial Sequence
23
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
<220>
<223> Description of Artificial Sequence: 5'PCR primer for CLZ-26 with
parsing bases G-G-C-T
$ <400> 101
cgacggtatc ggggct 16
<210> 102
<211> 16
<212> DNA
<213> Artificial Sequence
<220>
1$ <223> Description of ArtificialSequence:5'PCR primer for CLZ-28
with
parsing bases G-G-T-A
<400> 102
cgacggtatc ggggta 16
<210> 103
<211> 16
<212> DNA
2$ <213> Artificial Sequence
<220>
<223> Description of ArtificialSequence:5'PCR primer for CLZ_34
with
parsing bases T-A-T-T
<400> 103
cgacggtatc ggtatt 16
3$ <210> 104
<211> 16
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of ArtificialSequence:5'PCR primer for CLZ_43
with
parsing bases C-T-A-A
<400> 104
4$
cgacggtatc ggctaa 16
<210> 105
<211> 16
$0 <212> DNA
<213> Artificial Sequence
<220>
<223> Description of ArtificialSequence:5'PCR primer for CLZ-44
with
$$ parsing bases A-C-G-G
<400> 105
24
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
cgacggtatc ggacgg 16
<210> 106
$ <211> 16
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: 5'PCR primer for CLZ-64 with
parsing bases T-C-A-T
<400> 106
1$ cgacggtatc ggtcat 16
<210> 107
<211> 1717
<212> DNA
<213> Homo sapiens
<400> 107
gatattttaaaaattgcatacatatgaaatatattgggatttacaaacaactaaacacat60
2$ atactcacataaataccaatatattctattaaatttaaagtttacattttcttcaagctt120
gattttgaagtaggatattgcttgatgtcattgccaggtgcaaagttgcaaggaaacgtg180
agtttataactttgttattgccagtgcatcatagaagtaaatgtagtataaaataatagg240
ctataatatttttgtagtggatctcttgtatatattgttcactttgatgtctttttcagc300
tacccttttttacctaagttttatagctatagattttattattattttttgtttccacat360
ttaaagaatgcttggagtagtcctgagaagagttcatattttcaacattagctggcttgt420
ttacatatctgtctgaaataaatataatgttttggtaattttcattaattgataaaggca480
ggtgaggcttctcaaacagaaactgtatctgaagaaaacaaaagccttatctggacacta540
ttgaaacaagtccgtcctggcatggacctatccaaggtggttctgcctacatttattttg600
gaaccccgttctttcctggataaactttcagattactactatcatgcagatttcctatct660
3$ gaggcagctcttgaagaaaatccttatttccgtttgaagaaagtagtgaaatggtatttg720
tcaggattctataaaaagccaaagggactgaagaaaccttataatcctatacttggcgag780
actttccgttgtttatggattcatcccagaacaaacagcaaaactttttatattgctgaa840
caggtgtcccatcatccaccaatatctgccttttatgttagtaatcgaaaagatggattt900
tgccttagcggtagtatcctggctaagtctaagttttatggaaactcattatctgcaata960
ttagagggagaagcacggttaactttcttgaatagaggtgaagattatgtaatgacaatg1020
ccatacgctcattgtaaaggaattctttatggtacaatgacactggagcttggtggaaca1080
gtcaatattacatgtcaaaaaactggatacagtgcaatacttgaatttaaactaaagcca1140
ttcctagggagtagtgactgtgttaatcaaatatcagggaaacttaaactgggaaaagaa1200
gtcctagctactttggaaggtcattgggatagtgaagtttttattactgataaaaagact1260
4$ gataattcagaggttttctggaatccaacacctgayattaagcaatggagattaataagg1320
cacactgtaaaatttgaagaacagggagattttgaatcagagaaactctggcaacgggta1380
actcgagccataaatgccaaagaccaaactgaagctacccaagagaagtatgttttggaa1440
gaagctcaaagacaagctgccagggatcggaaaacaaaaaatgaagagtggtcttgcaaa1500
ttatttgaacttgatccactcacaggagaatggcattacaagtttgcagatacccgacca1560
$0 tgggacccacttaatgatatgatacagtttgaaaaagatggtgttattcagaccaaagtg1620
aaacatcgtactccaatggttagcgtccccaaaatgaaacataagccaaccaggcaacag1680
aagaaagtagcaaaaggctattcctccccagaaccgg 1717
$$ <210> 108
<211> 1717
2$
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
<212> DNA
<213> Homo sapiens
<220>
<221> CDS
<222> (562)..(1716)
<400> 108
gatattttaaaaattgcatacatatgaaatatattgggatttacaaacaactaaacacat60
atactcacataaataccaatatattctattaaatttaaagtttacattttcttcaagctt120
gattttgaagtaggatattgcttgatgtcattgccaggtgcaaagttgcaaggaaacgtg180
agtttataactttgttattgccagtgcatcatagaagtaaatgtagtataaaataatagg240
ctataatatttttgtagtggatctcttgtatatattgttcactttgatgtctttttcagc300
tacccttttttacctaagttttatagctatagattttattattattttttgtttccacat360
ttaaagaatgcttggagtagtcctgagaagagttcatattttcaacattagctggcttgt420
ttacatatctgtctgaaataaatataatgttttggtaattttcattaattgataaaggca480
ggtgaggcttctcaaacagaaactgtatctgaagaaaacaaaagccttatctggacacta540
ttgaaacaagtccgtcctggc atg cta tcc gtg gtt cct aca 591
gac aag ctg
Met Asp Leu Ser Val Val Pro Thr
Lys Leu
1 5 to
ttt attttggaa ccccgttct ttcctggat aaactt tcagattac tac 639
Phe IleLeuGlu ProArgSer PheLeuAsp LysLeu SerAspTyr Tyr
15 20 25
tat catgcagat ttcctatct gaggcaget cttgaa gaaaatcct tat 687
Tyr HisAlaAsp PheLeuSer GluAlaAla LeuGlu GluAsnPro Tyr
30 35 40
ttc cgtttgaag aaagtagtg aaatggtat ttgtca ggattctat aaa 735
Phe ArgLeuLys LysValVal LysTrpTyr LeuSer GlyPheTyr Lys
45 50 55
aag ccaaaggga ctgaagaaa ccttataat cctata cttggcgag act 783
Lys ProLysGly LeuLysLys ProTyrAsn ProIle LeuGlyGlu Thr
60 65 70
ttc cgt tgt tta tgg att cat ccc aga aca aac agc aaa act ttt tat 831
Phe Arg Cys Leu Trp Ile His Pro Arg Thr Asn Ser Lys Thr Phe Tyr
75 80 85 90
att get gaa cag gtg tcc cat cat cca cca ata tct gcc ttt tat gtt 879
Ile Ala Glu Gln Val Ser His His Pro Pro Ile Ser Ala Phe Tyr Val
95 100 105
agt aat cga aaa gat gga ttt tgc ctt agc ggt agt atc ctg get aag 927
Ser Asn Arg Lys Asp Gly Phe Cys Leu Ser Gly Ser Ile Leu Ala Lys
26
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
110 115 120
tct aagttt tatggaaac tcattatctgca atatta gagggagaagca 975
Ser LysPhe TyrGlyAsn SerLeuSerAla IleLeu GluGlyGluAla
$ 125 130 135
cgg ttaact ttcttgaat agaggtgaagat tatgta atgacaatgcca 1023
Arg LeuThr PheLeuAsn ArgGlyGluAsp TyrVal MetThrMetPro
140 195 150
tac getcat tgtaaagga attctttatggt acaatg acactggagctt 1071
Tyr AlaHis CysLysGly IleLeuTyrGly ThrMet ThrLeuGluLeu
155 160 165 170
1$ggt ggaaca gtcaatatt acatgtcaaaaa actgga tacagtgcaata 1119
Gly GlyThr ValAsnIle ThrCysGlnLys ThrGly TyrSerAlaIle
175 180 185
ctt gaattt aaactaaag ccattcctaggg agtagt gactgtgttaat 1167
20Leu GluPhe LysLeuLys ProPheLeuGly SerSer AspCysValAsn
190 195 200
caa atatca gggaaactt aaactgggaaaa gaagtc ctagetactttg 1215
Gln IleSer GlyLysLeu LysLeuGlyLys GluVal LeuAlaThrLeu
2$ 205 210 215
gaa ggtcat tgggatagt gaagtttttatt actgat aaaaagactgat 1263
Glu GlyHis TrpAspSer GluValPheIle ThrAsp LysLysThrAsp
220 225 230
30
aat tcagag gttttctgg aatccaacacct gayatt aagcaatggaga 1311
Asn SerGlu ValPheTrp AsnProThrPro AspIle LysGlnTrpArg
235 240 245 250
3$tta ataagg cacactgta aaatttgaagaa caggga gattttgaatca 1359
Leu IleArg HisThrVal LysPheGluGlu GlnGly AspPheGluSer
255 260 265
gag aaa ctc tgg caa cgg gta act cga gcc ata aat gcc aaa gac caa 1407
40 Glu Lys Leu Trp Gln Arg Val Thr Arg Ala Ile Asn Ala Lys Asp Gln
270 275 280
act gaa get acc caa gag aag tat gtt ttg gaa gaa get caa aga caa 1455
Thr GluAla ThrGlnGlu LysTyrVal LeuGluGlu AlaGlnArg Gln
4$ 285 290 295
get gccagg gatcggaaa acaaaaaat gaagagtgg tcttgcaaa tta 1503
Ala AlaArg AspArgLys ThrLysAsn GluGluTrp SerCysLys Leu
300 305 310
$0
ttt gaactt gatccactc acaggagaa tggcattac aagtttgca gat 1551
Phe GluLeu AspProLeu ThrGlyGlu TrpHisTyr LysPheAla Asp
315 320 325 330
$$ acc cgacca tgggaccca cttaatgat atgatacag tttgaaaaa gat 1599
Thr ArgPro TrpAspPro LeuAsnAsp MetIleGln PheGluLys Asp
335 340 345
27
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
ggt gtt att cag acc aaa gtg aaa cat cgt act cca atg gtt agc gtc 1647
Gly Val Ile Gln Thr Lys Val Lys His Arg Thr Pro Met Val Ser Val
350 355 360
ccc aaa atg aaa cat aag cca acc agg caa cag aag aaa gta gca aaa 1695
Pro Lys Met Lys His Lys Pro Thr Arg Gln Gln Lys Lys Val Ala Lys
365 370 375
ggc tat tcc tcc cca gaa ccg g 1717
Gly Tyr Ser Ser Pro Glu Pro
380 385
1$ <210> 109
<211> 385
<212> PRT
<213> Homo sapiens
2$ <400> 109
Met Asp Leu Ser Lys Val Val Leu Pro Thr Phe Ile Leu Glu Pro Arg
1 5 10 15
Ser Phe Leu Asp Lys Leu Ser Asp Tyr Tyr Tyr His Ala Asp Phe Leu
20 25 30
3$ Ser Glu Ala Ala Leu Glu Glu Asn Pro Tyr Phe Arg Leu Lys Lys Val
40 45
Val Lys Trp Tyr Leu Ser Gly Phe Tyr Lys Lys Pro Lys Gly Leu Lys
50 55 60
4$
$0
Lys Pro Tyr Asn Pro Ile Leu Gly Glu Thr Phe Arg Cys Leu Trp Ile
65 70 75 80
His Pro Arg Thr Asn Ser Lys Thr Phe Tyr Ile Ala Glu Gln Val Ser
85 90 95
His His Pro Pro Ile Ser Ala Phe Tyr Val Ser Asn Arg Lys Asp Gly
100 105 110
$$ Phe Cys Leu Ser Gly Ser Ile Leu Ala Lys Ser Lys Phe Tyr Gly Asn
115 120 125
28
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
Ser Leu Ser Ala Ile Leu Glu Gly Glu Ala Arg Leu Thr Phe Leu Asn
130 135 140
Arg Gly Glu Asp Tyr Val Met Thr Met Pro Tyr Ala His Cys Lys Gly
145 150 155 160
Ile Leu Tyr Gly Thr Met Thr Leu Glu Leu Gly Gly Thr Val Asn Ile
165 170 175
Thr Cys Gln Lys Thr Gly Tyr Ser Ala Ile Leu Glu Phe Lys Leu Lys
1$ 180 185 190
2$
Pro Phe Leu Gly Ser Ser Asp Cys Val Asn Gln Ile Ser Gly Lys Leu
195 200 205
Lys Leu Gly Lys Glu Val Leu Ala Thr Leu Glu Gly His Trp Asp Ser
210 215 220
Glu Val Phe Ile Thr Asp Lys Lys Thr Asp Asn Ser Glu Val Phe Trp
225 230 235 240
Asn Pro Thr Pro Asp Ile Lys Gln Trp Arg Leu Ile Arg His Thr Val
245 250 255
Lys Phe Glu Glu Gln Gly Asp Phe Glu Ser Glu Lys Leu Trp Gln Arg
3$ 260 265 270
4$
Val Thr Arg Ala Ile Asn Ala Lys Asp Gln Thr Glu Ala Thr Gln Glu
275 280 285
Lys Tyr Val Leu Glu Glu Ala Gln Arg Gln Ala Ala Arg Asp Arg Lys
290 295 300
Thr Lys Asn Glu Glu Trp Ser Cys Lys Leu Phe Glu Leu Asp Pro Leu
305 310 315 320
$0 Thr Gly Glu Trp His Tyr Lys Phe Ala Asp Thr Arg Pro Trp Asp Pro
325 330 335
Leu Asn Asp Met Ile Gln Phe Glu Lys Asp Gly Val Ile Gln Thr Lys
$$ 340 395 350
29
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
Val Lys His Arg Thr Pro Met Val Ser Val Pro Lys Met Lys His Lys
355 360 365
$ Pro Thr Arg Gln Gln Lys Lys Val Ala Lys Gly Tyr Ser Ser Pro Glu
370 375 380
Pro
385
<210> 110
1$ <211> 472
<212> PRT
<213> Homo sapiens
<400> 110
2$ Met AspLeuSer LysValVal LeuPro ThrPheIle LeuGluPro Arg
1 5 10 15
Ser PheLeuAsp LysLeuSer AspTyr TyrTyrHis AlaAspPhe Leu
20 25 30
Ser GluAlaAla LeuGluGlu AsnPro TyrPheArg LeuLysLys Val
35 40 45
Val LysTrpTyr LeuSerGly PheTyr LysLysPro LysGlyLeu Lys
3$ 50 55 60
Lys ProTyrAsn ProIleLeu GlyGlu ThrPheArg CysLeuTrp Ile
65 70 75 80
His ProArgThr AsnSerLys ThrPhe TyrIleAla GluGlnVal Ser
85 90 95
His HisProPro IleSerAla PheTyr ValSerAsn ArgLysAsp Gly
100 105 110
4$
Phe CysLeuSer GlySerIle LeuAla LysSerLys PheTyrGly Asn
115 120 125
Ser LeuSerAla IleLeuGlu GlyGlu AlaArgLeu ThrPheLeu Asn
$0 130 135 140
Arg GlyGluAsp TyrValMet ThrMet ProTyrAla HisCysLys Gly
145 150 155 160
$$ Ile LeuTyrGly ThrMetThr LeuGlu LeuGlyGly ThrValAsn Ile
165 170 175
CA 02389110 2002-04-26
WO 01/30972 PCT/US00/29690
Thr CysGlnLys ThrGlyTyr SerAla IleLeuGlu PheLysLeu Lys
180 185 190
Pro PheLeuGly SerSerAsp CysVal AsnGlnIle SerGlyLys Leu
$ 195 200 205
Lys LeuGlyLys GluValLeu AlaThr LeuGluGly HisTrpAsp Ser
210 215 220
Glu ValPheIle ThrAspLys LysThr AspAsnSer GluValPhe Trp
225 230 235 240
Asn ProThrPro AspIleLys GlnTrp ArgLeuIle ArgHisThr Val
245 250 255
1$
Lys PheGluGlu GlnGlyAsp PheGlu SerGluLys LeuTrpGln Arg
260 265 270
Val ThrArgAla IleAsnAla LysAsp GlnThrGlu AlaThrGln Glu
275 280 285
Lys TyrValLeu GluGluAla GlnArg GlnAlaAla ArgAspArg Lys
290 295 300
2$ Thr LysAsnGlu GluTrpSer CysLys LeuPheGlu LeuAspPro Leu
305 310 315 320
Thr GlyGluTrp HisTyrLys PheAla AspThrArg ProTrpAsp Pro
325 330 335
Leu AsnAspMet IleGlnPhe GluLys AspGlyVal IleGlnThr Lys
340 345 350
Val LysHisArg ThrProMet ValSer ValProLys MetLysHis Lys
3$ 355 360 365
Pro ThrArgGln GlnLysLys ValAla LysGlyTyr SerSerPro Glu
370 375 380
Pro AspIleGln AspSerSer GlySer GluAlaGln SerValLys Pro
385 390 395 400
Ser ThrArgArg LysLysGly IleGlu LeuGlyAsp IleGlnSer Ser
405 410 415
4$
Ile GluSerIle LysGlnThr GlnGlu GluIleLys ArgAsnIle Met
420 425 430
Ala LeuArgAsn HisLeuVal SerSer ThrProAla ThrAspTyr Phe
$0 435 440 445
Leu GlnGlnLys AspTyrPhe IleIle PheLeuLeu IleLeuLeu Gln
450 455 460
$$ Val IleIleAsn PheMetPhe Lys
465 470
31
