Note: Descriptions are shown in the official language in which they were submitted.
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
Description
NOVEL CRIB PROTEIN ZMSE1
BACKGROUND OF THE INVENTION
The Ras family of proteins is comprised of small GTPases that are
subdivided into several sub-families known to be involved in diverse cellular
actions,
1 o such as cell proliferation, differentiation and apoptosis. Moreover, Ras
is a known
oncogene, and the Ras protein is implicated in oncogenic cell transformation
through
complex signaling pathways that employ an increasing number of downstream
effectors. Some of these effectors are included in Ras sub-families, such as,
for
example, the Rho subfamily of small GTPases.
The Rho family proteins are implicated in regulating diverse cellular
processes as well. One prominent Rho activity comprises effecting actin
cytoskeletal
organization. Such activities include regulating cell shape, cell attachment
and
adhesion, cell motility and invasion, cell-cell interactions, cell
proliferation,
differentiation and apoptosis. For example, Racl, RhoA and Cdc42 are all
implicated
2 0 in promoting cell motility and invasion. As such, these proteins may be
involved in
promoting motility, invasiveness and metastasis of tumor cells. In addition,
disassembly of actin stress fibers is associated with malignant
transformation.
Moreover, another prominent and distinct Rho activity includes activation of
signaling
cascades that enhance gene expression through the induction of various
transcription
2 5 factors, resulting in cell proliferation, cell cycle progression,
differentiation and
apoptosis. For Example, the Rho proteins Rac 1 and Cdc42 activate Jun NH2-
terminal
kinases (JNKs), which in turn activate Jun, ATF-2 and Elk-1 nuclear
transcription
factors. Rho family proteins can also activate NFoB and SRF transcription
factors.
Virally transduced and mutated versions of cellular Fos, Jun, and NFoB were
originally
3 0 identified as potent retroviral oncogenes implicated in various tumors and
cancerous
states (Bishop, J.M., Cell 64:235-238, 1991). Thus, Rho family mediated
changes in
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
2
gene expression likely contribute to their proliferative actions, and play a
role in cell
transformation and cancer. Moreover, several Rho family proteins have been
shown to
be important for Ras transforming activity. For reference, see Zohn, LM. et
al.,
Oncogene 17:1415-1438, 1998; Maruta, H. et al., Microsc. Res. Tech. 47:61-66,
1999;
Aspenstrom, P. her. Cell. Res. 246:20-25, 1999; Banyard, J. and Zetter, B.R.,
Cancer
and Metast. Rev. 17:449-458, 1999; and, Michiels, F. and Collard, J.G.,
Biochem Soc.
Symp. 65:125-146, 1999.
In addition, several effector proteins are known to bind Rho family
members, such as Cdc42 and Rac. The effectors that bind Cdc42/Rac have a
consensus
binding motif designated the Cdc42/Rac Interactive Binding (CRIB) motif
(Burbelo,
P.D. et al., J. Biol. Chem. 270:29071-29074, 1995). These effectors show GTP-
dependent interaction with Cdc42 and/or Racl, and may or may not show kinase
activity. For Example, the Cdc42 effector, MSE55 is a non-kinase effector that
specifically binds Cdc42 in a GTP-dependent manner, is localized to membrane
ruffles,
and induces long actin-based protrusions or cellular extensions in fibroblast
cells
(Burbelo, P.D. et al., Proc. Natl. Acad. Sci. USA 96:9083-9088, 1999). For
other
references on Cdc2/Rac and their effects on membrane ruffling, actin stress
fibers,
lamellipodia and the like, see, for example, Ridley, A.J. et al., Cell 70:401-
410, 1992;
and Nobes, C.D., and Hall, A. Cell 81:53-62, 1995. Other CRIB proteins are
2 0 implicated in human disease, such as the Wiskott-Aldrich Syndrome, which
is an X-
linked recessive disorder characterized by thrombocytopenia, recurrent
infections due to
defective T- and B-cell function, and eczema. The CRIB protein Wiskott-Aldrich
Syndrome Protein (WASP) is mutated in this disease, and it is also a Cdc42
effector
(Symons, M. et al., Cell 84:723-734, 1996). Because these CRIB proteins
influence
2 5 members of the Rho family of proteins, these effectors may also play a
role in cell
proliferation, transformation, motility and metastasis. For reference, see
Zohn, LM. et
al., supra..
Considering the importance of this family of proteins, there is a
continuing need to discover new Ras and Rho family members and their effector
3 0 proteins that modulate the cytoskeleton, actin polymerization, cell
motility and
invasion, and the like, and affect proliferation, differentiation,
transformation,
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
3
metastasis and apoptotic pathways. The in vivo activities of both inducers and
inhibitors of these pathways illustrate the enormous clinical potential of,
and need for,
such novel proteins, their agonists and antagonists, for example, in cancer
therapy. The
present invention addresses this need by providing such polypeptides for these
and
other uses that should be apparent to those skilled in the art from the
teachings herein.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 is a hydrophobicity plot of zmsel using a Hopp/Woods
hydrophilicity profile based on a sliding six-residue window, with buried G,
S, and T
residues and exposed H, Y, and W residues ignored.
Figure 2 is an alignment of human zmsel (zmsel) (SEQ 1D N0:2), and
mouse zmsel (MUZMSE) (SEQ >D N0:5).
DESCRIPTION OF THE INVENTION
In one aspect, the present invention provides an isolated polynucleotide
that encodes a zmsel polypeptide comprising a sequence of amino acid residues
that is
at least 90% identical to an amino acid sequence selected from the group
consisting of:
(a) the amino acid sequence as shown in SEQ >D N0:2 from amino acid number 1
(Met), to amino acid number 147 (Ala); (b) the amino acid sequence as shown in
SEQ .,
2 0 ID N0:2 from amino acid number 148 (Asn), to amino acid number 336 (Ser);
(c) the
amino acid sequence as shown in SEQ ID N0:2 from amino acid number 148 (Asn),
to
amino acid number 356 (Ser); and (d) the amino acid sequence as shown in SEQ
>D
N0:2 from amino acid number 1 (Met), to amino acid number 356 (Val), wherein
the
amino acid percent identity is determined using a FASTA program with ktup=1,
gap
2 5 opening penalty=10, gap extension penalty=1, and substitution
matrix=BLOSUM62,
with other parameters set as default. In one embodiment, the isolated
polynucleotide
disclosed above is selected from the group consisting of: (a) a polynucleotide
sequence
as shown in SEQ ID NO:l from nucleotide 199 to nucleotide 639; (b) a
polynucleotide
sequence as shown in SEQ ID NO:1 from nucleotide 640 to nucleotide 1206; (c) a
3 0 polynucleotide sequence as shown in SEQ ID NO:1 from nucleotide 640 to
nucleotide
1266; and (d) a polynucleotide sequence as shown in SEQ ID NO:1 from
nucleotide
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
4
199 to nucleotide 1266. In another embodiment, the isolated polynucleotide
disclosed
above comprises nucleotide 1 to nucleotide 1068 of SEQ ID N0:3. In another
embodiment, the isolated polynucleotide disclosed above encodes a polypeptide
that
comprises a sequence of amino acid residues selected from the group consisting
of: (a)
the amino acid sequence as shown in SEQ ID N0:2 from amino acid number 1
(Met),
to amino acid number 147 (Ala); (b) the amino acid sequence as shown in SEQ ID
N0:2 from amino acid number 148 (Asn), to amino acid number 336 (Ser); (c) the
amino acid sequence as shown in SEQ ID N0:2 from amino acid number 148 (Asn),
to
amino acid number 356 (Ser); and (d) the amino acid sequence as shown in SEQ
ID
N0:2 from amino acid number 1 (Met), to amino acid number 356 (Val).
In a second aspect, the present invention provides an expression vector
comprising the following operably linked elements: a transcription promoter; a
DNA
segment encoding a zmsel polypeptide as shown in SEQ ID N0:2 from amino acid
number 1 (Met), to amino acid number 356 (Val); and a transcription
terminator,
wherein the promoter is operably linked to the DNA segment, and the DNA
segment is
operably linked to the transcription terminator.
In a third aspect, the present invention provides an expression vector as
disclosed above, further comprising a secretory signal sequence operably
linked to the
DNA segment.
2 0 In a fourth aspect, the present invention provides a cultured cell
comprising an expression vector as disclosed above, wherein the cell expresses
a
polypeptide encoded by the DNA segment.
In another aspect, the present invention provides a DNA construct
encoding a fusion protein, the DNA construct comprising: a first DNA segment
2 5 encoding a polypeptide comprising a sequence of amino acid residues
selected from the
group consisting of: (a) the amino acid sequence as shown in SEQ ID N0:2 from
amino acid number 1 (Met), to amino acid number 147 (Ala); (b) the amino acid
sequence as shown in SEQ ID N0:2 from amino acid number 148 (Asn), to amino
acid
number 336 (Ser); (c) the amino acid sequence as shown in SEQ ID N0:2 from
amino
3 0 acid number 148 (Asn), to amino acid number 356 (Ser); (d) the amino acid
sequence
as shown in SEQ ID N0:2 from amino acid number 337 (Arg), to amino acid number
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
356 (Ser); and (e) the amino acid sequence as shown in SEQ >D N0:2 from amino
acid
number 1 (Met), to amino acid number 356 (Val); and at least one other DNA
segment
encoding an additional polypeptide, wherein the first and other DNA segments
are
connected in-frame; and wherein the first and other DNA segments encode the
fusion
5 protein.
In another aspect, the present invention provides an expression vector
comprising the following operably linked elements: a transcription promoter; a
DNA
construct encoding a fusion protein as disclosed above; and a transcription
terminator,
wherein the promoter is operably linked to the DNA construct, and the DNA
construct
is operably linked to the transcription terminator.
In another aspect, the present invention provides a cultured cell
comprising an expression vector as disclosed above, wherein the cell expresses
a
polypeptide encoded by the DNA construct.
In another aspect, the present invention provides a method of producing
a fusion protein comprising: culturing a cell as disclosed above; and
isolating the
polypeptide produced by the cell.
In another aspect, the present invention provides an isolated polypeptide
comprising a sequence of amino acid residues that is at least 90% identical to
an amino
acid sequence selected from the group consisting of: (a) the amino acid
sequence as
2 0 shown in SEQ m N0:2 from amino acid number 1 (Met), to amino acid number
147
(Ala); (b) the amino acid sequence as shown in SEQ m N0:2 from amino acid
number
148 (Asn), to amino acid number 336 (Ser); (c) the amino acid sequence as
shown in
SEQ >D N0:2 from amino acid number 148 (Asn), to amino acid number 356 (Ser);
and (d) the amino acid sequence as shown in SEQ m N0:2 from amino acid number
1
(Met), to amino acid number 356 (Val), wherein the amino acid percent identity
is
determined using a FASTA program with ktup=1, gap opening penalty=10, gap
extension penalty=1, and substitution matrix=BLOSUM62, with other parameters
set as
default. In one embodiment, the isolated polypeptide disclosed above comprises
a
sequence of amino acid residues selected from the group consisting of: (a) the
amino
3 0 acid sequence as shown in SEQ >D N0:2 from amino acid number 1 (Met), to
amino
acid number 147 (Ala); (b) the amino acid sequence as shown in SEQ >D N0:2
from
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
6
amino acid number 148 (Asn), to amino acid number 336 (Ser); (c) the amino
acid
sequence as shown in SEQ >D N0:2 from amino acid number 148 (Asn), to amino
acid
number 356 (Ser); and (d) the amino acid sequence as shown in SEQ ID N0:2 from
amino acid number 1 (Met), to amino acid number 356 (Val).
In another aspect, the present invention provides a method of producing
a zmsel polypeptide comprising: culturing a cell as disclosed above; and
isolating the
zmse 1 polypeptide produced by the cell.
In another aspect, the present invention provides a method of producing
an antibody to zmsel polypeptide comprising: inoculating an animal with a
polypeptide
1 o selected from the group consisting of: (a) a polypeptide consisting of 13
to 343 amino
acids, wherein the polypeptide is identical to a contiguous sequence of amino
acids in
SEQ >D N0:2 from amino acid number 1 (Met) to amino acid number 356 (Val); (b)
a
polypeptide as disclosed above; (c) a polypeptide consisting of the amino acid
sequence
of SEQ >D N0:2 from amino acid number 337 (Arg) to amino acid number 356
(Val);
(d) a polypeptide consisting of the amino acid sequence of SEQ ID N0:2 from
amino
acid number 96 (Glu) to amino acid number 101 (Asp); (e) a polypeptide
consisting of
the amino acid sequence of SEQ m N0:2 from amino acid number 226 (Asp) to
amino
acid number 231 (Asp); (f) a polypeptide consisting of the amino acid sequence
of SEQ
>D N0:2 from amino acid number 346 (Met) to amino acid number 351 (Glu); (g) a
2 0 polypeptide consisting of the amino acid sequence of SEQ m N0:2 from amino
acid
number 360 (Arg) to amino acid number 365 (Glu); (h) a polypeptide consisting
of the
amino acid sequence of SEQ >D N0:2 from amino acid number 347 (Asp) to amino
acid number 352 (Asp); and (i) a polypeptide consisting of the amino acid
sequence of
SEQ 1D N0:2 from amino acid number 348 (Glu) to amino acid number 353 (Glu);
and
2 5 wherein the polypeptide elicits an immune response in the animal to
produce the
antibody; and isolating the antibody from the animal.
In another aspect, the present invention provides an antibody produced
by the method disclosed above, which binds to a zmsel polypeptide. In one
embodiment, the antibody disclosed above is a monoclonal antibody. In another
aspect,
3 0 the present invention provides an antibody which specifically binds to a
polypeptide as
disclosed above.
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
7
In another aspect, the present invention provides An antibody which
specifically binds to a polypeptide disclosed above.
In another aspect, the present invention provides a method of detecting,
in a test sample, the presence of a modulator of zmsel protein activity,
comprising:
culturing a cell into which has been introduced an expression vector as
disclosed above,
wherein the cell expresses the zmsel protein encoded by the DNA segment in the
presence and absence of a test sample; and comparing levels of activity of
zmsel in the
presence and absence of a test sample, by a biological or biochemical assay;
and
determining from the comparison, the presence of modulator of zmsel activity
in the
test sample.
In another aspect, the present invention provides a method for detecting
a genetic abnormality in a patient, comprising: obtaining a genetic sample
from a
patient; producing a first reaction product by incubating the genetic sample
with a
polynucleotide comprising at least 14 contiguous nucleotides of SEQ m NO:1 or
the
complement of SEQ 1D NO:1, under conditions wherein said polynucleotide will
hybridize to complementary polynucleotide sequence; visualizing the first
reaction
product; and comparing said first reaction product to a control reaction
product from a
wild type patient, wherein a difference between said first reaction product
and said
control reaction product is indicative of a genetic abnormality in the
patient.
2 0 In another aspect, the present invention provides a method for detecting
a cancer in a patient, comprising: obtaining a tissue or biological sample
from a
patient; incubating the tissue or biological sample with an antibody of claim
19 under
conditions wherein the antibody binds to its complementary polypeptide in the
tissue or
biological sample; visualizing the antibody bound in the tissue or biological
sample;
2 5 and comparing levels of antibody bound in the tissue or biological sample
from the
patient to a normal control tissue or biological sample, wherein an increase
or decrease
in the level of antibody bound to the patient tissue or biological sample
relative to the
normal control tissue or biological sample is indicative of a cancer in the
patient.
In another aspect, the present invention provides a method for detecting
3 0 a cancer in a patient, comprising: obtaining a tissue or biological sample
from a
patient; labeling a polynucleotide comprising at least 14 contiguous
nucleotides of SEQ
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
8
1D NO:1 or the complement of SEQ ID NO:1; incubating the tissue or biological
sample with under conditions wherein the polynucleotide will hybridize to
complementary polynucleotide sequence; visualizing the labeled polynucleotide
in the
tissue or biological sample; and comparing the level of labeled polynucleotide
hybridization in the tissue or biological sample from the patient to a normal
control
tissue or biological sample, wherein an increase or decrease in the labeled
polynucleotide hybridization to the patient tissue or biological sample
relative to the
normal control tissue or biological sample is indicative of a cancer in the
patient.
Within another aspect, the present invention provides a transgenic
mouse, wherein the mouse over-expresses residue 1 (Met) to residue 356 (Val)
of SEQ
ID N0:2) or residue 1 (Met) to residue 349 (Val) of SEQ ID N0:5. In one
embodiment, the transgenic mouse disclosed above expresses residue 1 (Met) to
residue
356 (Val) of SEQ ID N0:2) or residue 1 (Met) to residue 349 (Val) of SEQ ID
N0:5
using a tissue-specific or tissue-restricted promoter. In another embodiment,
the
transgenic mouse disclosed above expresses residue 1 (Met) to residue 356
(Val) of
SEQ 1D N0:2) or residue 1 (Met) to residue 349 (Val) of SEQ ID N0:5 using an
epithelial-specific, colon-specific, or ovary-specific promoter. In another
embodiment,
the transgenic mouse disclosed above does not expresses residue 1 (Met) to
residue 349
(Val) of SEQ ID N0:5, relative to a normal mouse.
2 0 These and other aspects of the invention will become evident upon
reference to the following detailed description of the invention and attached
drawings.
Prior to setting forth the invention in detail, it may be helpful to the
understanding thereof to define the following terms:
The term "affinity tag" is used herein to denote a polypeptide segment
2 5 that can be attached to a second polypeptide to provide for purification
or detection of
the second polypeptide or provide sites for attachment of the second
polypeptide to a
substrate. In principal, any peptide or protein for which an antibody or other
specific
binding agent is available can be used as an affinity tag. Affinity tags
include a poly
histidine tract, protein A (Nilsson et al., EMBO J. 4:1075, 1985; Nilsson et
al., Methods
30 Enzymol. 198:3, 1991), glutathione S transferase (Smith and Johnson, Gene
67:31,
1988), Glu-Glu affinity tag (Grussenmeyer et al., Proc. Natl. Acad. Sci. USA
82:7952-
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
9
4, 1985), substance P, FIagTM peptide (Hopp et al., Biotechnology 6:1204-10,
1988),
streptavidin binding peptide, or other antigenic epitope or binding domain.
See, in
general, Ford et al., Protein Expression and Purification 2: 95-107, 1991.
DNAs
encoding affinity tags are available from commercial suppliers (e.g.,
Pharmacia
Biotech, Piscataway, NJ).
The term "allelic variant" is used herein to denote any of two or more
alternative forms of a gene occupying the same chromosomal locus. Allelic
variation
arises naturally through mutation, and may result in phenotypic polymorphism
within
populations. Gene mutations can be silent (no change in the encoded
polypeptide) or
may encode polypeptides having altered amino acid sequence. The term allelic
variant
is also used herein to denote a protein encoded by an allelic variant of a
gene.
The terms "amino-terminal" (also, "N-Terminal") and "carboxyl-
terminal" (also "C-terminal") are used herein to denote positions within
polypeptides.
Where the context allows, these terms are used with reference to a particular
sequence
or portion of a polypeptide to denote proximity or relative position. For
example, a
certain sequence positioned carboxyl-terminal to a reference sequence within a
polypeptide is located proximal to the carboxyl terminus of the reference
sequence, but
is not necessarily at the carboxyl terminus of the complete polypeptide.
The term "complement/anti-complement pair" denotes non-identical
2 0 moieties that form a non-covalently associated, stable pair under
appropriate conditions.
For instance, biotin and avidin (or streptavidin) are prototypical members of
a
complement/anti-complement pair. Other exemplary complement/anti-complement
pairs include receptor/ligand pairs, antibody/antigen (or hapten or epitope)
pairs,
sense/antisense polynucleotide pairs, and the like. Where subsequent
dissociation of
2 5 the complement/anti-complement pair is desirable, the complement/anti-
complement
pair preferably has a binding affinity of <109 M-1.
The term "complements of a polynucleotide molecule" denotes a
polynucleotide molecule having a complementary base sequence and reverse
orientation
as compared to a reference sequence. For example, the sequence 5' ATGCACGGG 3'
3 0 is complementary to 5' CCCGTGCAT 3'.
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
The term "contig" denotes a polynucleotide that has a contiguous stretch
of identical or complementary sequence to another polynucleotide. Contiguous
sequences are said to "overlap" a given stretch of polynucleotide sequence
either in
their entirety or along a partial stretch of the polynucleotide. For example,
5 representative contigs to the polynucleotide sequence 5'-ATGGAGCTT-3' are 5'-
AGCTTgagt-3' and 3'-tcgacTACC-5'.
The term "degenerate nucleotide sequence" denotes a sequence of
nucleotides that includes one or more degenerate codons (as compared to a
reference
polynucleotide molecule that encodes a polypeptide). Degenerate codons contain
10 different triplets of nucleotides, but encode the same amino acid residue
(i.e., GAU and
GAC triplets each encode Asp).
The term "expression vector" is used to denote a DNA molecule, linear
or circular, that comprises a segment encoding a polypeptide of interest
operably linked
to additional segments that provide for its transcription. Such additional
segments
include promoter and terminator sequences, and may also include one or more
origins
of replication, one or more selectable markers, an enhancer, a polyadenylation
signal,
etc. Expression vectors are generally derived from plasmid or viral DNA, or
may
contain elements of both.
The term "isolated", when applied to a polynucleotide, denotes that the
2 0 polynucleotide has been removed from its natural genetic milieu and is
thus free of
other extraneous or unwanted coding sequences, and is in a form suitable for
use within
genetically engineered protein production systems. Such isolated molecules are
those
that are separated from their natural environment and include cDNA and genomic
clones. Isolated DNA molecules of the present invention are free of other
genes with
2 5 which they are ordinarily associated, but may include naturally occurring
5' and 3'
untranslated regions such as promoters and terminators. The identification of
associated regions will be evident to one of ordinary skill in the art (see
for example,
Dynan and Tijan, Nature 316:774-78, 1985).
An "isolated" polypeptide or protein is a polypeptide or protein that is
3 0 found in a condition other than its native environment, such as apart from
blood and
animal tissue. In a preferred form, the isolated polypeptide is substantially
free of other
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
11
polypeptides, particularly other polypeptides of animal origin. It is
preferred to provide
the polypeptides in a highly purified form, i.e. greater than 95% pure, more
preferably
greater than 99% pure. When used in this context, the term "isolated" does not
exclude
the presence of the same polypeptide in alternative physical forms, such as
dimers or
alternatively glycosylated or derivatized forms.
The term "operably linked", when referring to DNA segments, indicates
that the segments are arranged so that they function in concert for their
intended
purposes, e.g., transcription initiates in the promoter and proceeds through
the coding
segment to the terminator.
The term "ortholog" denotes a polypeptide or protein obtained from one
species that is the functional counterpart of a polypeptide or protein from a
different
species. Sequence differences among orthologs are the result of speciation.
"Paralogs" are distinct but structurally related proteins made by an
organism. Paralogs are believed to arise through gene duplication. For
example, a
globin, (3-globin, and myoglobin are paralogs of each other.
A "polynucleotide" is a single- or double-stranded polymer of
deoxyribonucleotide or ribonucleotide bases read from the 5' to the 3' end.
Polynucleotides include RNA and DNA, and may be isolated from natural sources,
synthesized in vitro, or prepared from a combination of natural and synthetic
molecules.
2 0 Sizes of polynucleotides are expressed as base pairs (abbreviated "bp"),
nucleotides
("nt"), or kilobases ("kb"). Where the context allows, the latter two terms
may describe
polynucleotides that are single-stranded or double-stranded. When the term is
applied
to double-stranded molecules it is used to denote overall length and will be
understood
to be equivalent to the term "base pairs". It will be recognized by those
skilled in the
2 5 art that the two strands of a double-stranded polynucleotide may differ
slightly in length
and that the ends thereof may be staggered as a result of enzymatic cleavage;
thus all
nucleotides within a double-stranded polynucleotide molecule may not be
paired.
A "polypeptide" is a polymer of amino acid residues joined by peptide
bonds, whether produced naturally or synthetically. Polypeptides of less than
about 10
3 0 amino acid residues are commonly referred to as "peptides".
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
12
The term "promoter" is used herein for its art-recognized meaning to
denote a portion of a gene containing DNA sequences that provide for the
binding of
RNA polymerase and initiation of transcription. Promoter sequences are
commonly,
but not always, found in the 5' non-coding regions of genes.
A "protein" is a macromolecule comprising one or more polypeptide
chains. A protein may also comprise non-peptidic components, such as
carbohydrate
groups. Carbohydrates and other non-peptidic substituents may be added to a
protein
by the cell in which the protein is produced, and will vary with the type of
cell.
Proteins are defined herein in terms of their amino acid backbone structures;
substituents such as carbohydrate groups are generally not specified, but may
be present
nonetheless.
The term "receptor" denotes a cell-associated protein that binds to a
bioactive molecule (i.e., a ligand) and mediates the effect of the ligand on
the cell.
Membrane-bound receptors are characterized by a mufti-peptide structure, for
example,
comprising an extracellular ligand-binding domain and an intracellular
effector domain
that is typically involved in signal transduction. Binding of ligand to
receptor results in
a conformational change in the receptor that causes an interaction between the
effector
domain and other molecules) in the cell. This interaction in turn leads to an
alteration
in the metabolism of the cell. Metabolic events that are linked to receptor-
ligand
2 0 interactions include gene transcription, phosphorylation,
dephosphorylation, increases
in cyclic AMP production, mobilization of cellular calcium, mobilization of
membrane
lipids, cell adhesion, hydrolysis of inositol lipids and hydrolysis of
phospholipids. In
general, receptors can be membrane bound, cytosolic or nuclear; monomeric
(e.g.,
thyroid stimulating hormone receptor, beta-adrenergic receptor) or multimeric
(e.g.,
2 5 PDGF receptor, growth hormone receptor, IL-3 receptor, GM-CSF receptor, G-
CSF
receptor, erythropoietin receptor and IL,-6 receptor).
The term "secretory signal sequence" denotes a DNA sequence that
encodes a polypeptide (a "secretory peptide") that, as a component of a larger
polypeptide, directs the larger polypeptide through a secretory pathway of a
cell in
3 0 which it is synthesized. The larger polypeptide is commonly cleaved to
remove the
secretory peptide during transit through the secretory pathway.
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
13
The term "splice variant" is used herein to denote alternative forms of
RNA transcribed from a gene. Splice variation arises naturally through use of
alternative splicing sites within a transcribed RNA molecule, or less commonly
between separately transcribed RNA molecules, and may result in several mRNAs
transcribed from the same gene. Splice variants may encode polypeptides having
altered amino acid sequence. The term splice variant is also used herein to
denote a
protein encoded by a splice variant of an mRNA transcribed from a gene.
Molecular weights and lengths of polymers determined by imprecise
analytical methods (e.g., gel electrophoresis) will be understood to be
approximate
values. When such a value is expressed as "about" X or "approximately" X, the
stated
value of X will be understood to be accurate to ~10%.
All references cited herein are incorporated by reference in their entirety.
The present invention is based in part upon the discovery of a novel
DNA sequence that encodes a protein having a CRIB motif (Burbelo, P.D. et al.,
J.
Biol. Chem. 270:29071-29074, 1995). The polypeptide has been designated zmsel.
The novel zmse 1 was found and its corresponding cDNA was sequenced. The novel
polypeptide encoded by the cDNA showed limited homology with MSE55 (Bahou,
W.F., et al., J. Biol. Chem. 267:13986-13992, 1994; Burbelo, P.D. et al.,
Proc. Natl.
Acad. Sci. USA 96:9083-9088, 1999). The zmsel polynucleotide sequence encodes
the
entire coding sequence of the predicted protein. Zmsel is a novel protein that
may be
involved in regulating actin polymerization and resulting structures,
cytoskeletal
organization, proliferation, cell transformation, motility, cell invasion;
metastasis,
transport or secretion, tissue contractility, involved in an apoptotic
cellular pathway, or
2 5 the like.
The sequence of the zmsel polypeptide was deduced from a single clone
that contained its corresponding polynucleotide sequence. The clone was
obtained
from a human K562 cell (ATCC Cat. No. CCL 243) library. Other libraries that
might
also be searched for such sequences include tumor cell and tissue libraries
PBLs, testis,
3 0 gastrointestinal, prostate, lung, adrenal gland, and the like.
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
14
The nucleotide sequence of a representative human zmsel-encoding
DNA is described in SEQ D) NO:1, and its deduced 356 residue amino acid
sequence is
described in SEQ D) N0:2. In its entirety, the human zmsel polypeptide (SEQ ID
N0:2) represents a full-length polypeptide segment (residue 1 (Met) to 356
(Val) of
SEQ ID N0:2). The domains and structural features of the zmsel polypeptide are
further described below.
Analysis of the zmse 1 polypeptide encoded by the DNA sequence of
SEQ m NO:1 revealed an open reading frame encoding 356 amino acids (SEQ ID
N0:2) comprising a mature polypeptide. Zmsel contains a CRIB motif (SEQ ID
N0:6)
comprising amino acid residue number 27 (lle) to amino acid residue number 41
(Gly)
of SEQ ~ N0:2. This CRIB motif is conserved and identical in both the human
and
murine forms of zmsel (see, Figure 1; and, amino acid residue number 27 (Ile)
to
amino acid residue number 41 (Gly) of SEQ ID N0:2 and SEQ >D NO:S), suggesting
that a minor sequence difference therein could affect the binding of this
effector with its
target. For example, amino acid mutations in the CRIB motif of MSE55 and a
single
point mutation in the CRIB motif of WASP decrease or abolish Cdc42 binding and
hence the biological activity associated therewith (See, Burbelo, P.D. et al.,
Proc. Natl.
Acad. Sci. USA supra.; and Miki, H. et al., Nature 391:93-96, 1998). However,
sequences outside the CRIB motif are also important for the activity of these
effector
proteins (See, Zohn, LM. et al., Onco ene 17:1415-1438, 1998). Moreover, zmsel
contains a highly conserved N-terminal domain of approximately 150 amino acid
residues (residues 1 (Met) to 147 (Ala) of SEQ ID N0:2; and residues 1 (Met)
to 145
(Ala) of SEQ D) NO:S); and a more variable C-terminal domain of approximately
180
amino acid residues compressing residues 148 (Asn) to 336 (Ser) of SEQ m N0:2,
and
2 5 residues 146 (Asp) to 329 (Pro) of SEQ ID NO:S); and a highly conserved C-
terminal
tail comprising residues 337 (Arg) to 356 (Val) of SEQ >D N0:2, and 329 (Arg)
to 350
(Val) of SEQ ID NO:S. Moreover zmsel contains several phosphorylation sites
that are
conserved between the human and mouse polypeptides, and are shown in SEQ TD
N0:2
as follows: SerZ95-A1a296-~'g297~ Ser86-Lys87-Arggg; Ser,4-LyslS-Argi6; Ser,os-
Leu,o6-
3 0 Arg,o7; SerBO-Argg~-Lysg2; and Thr3o3-Thr3o4-Arg3os. The corresponding
mouse
phosphorylation sites can be determined with reference to Figure 2 and SEQ D)
NO:S.
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
As zmse 1 is likely involved in signal transduction, some or all of these
phosphorylation
sites may be essential for zmsel activity. Those skilled in the art will
recognize that
these domain boundaries are approximate, and are based on alignments with
known
proteins and predictions of protein folding. The corresponding polynucleotides
5 encoding the zmse 1 polypeptide regions, domains, motifs, residues and
sequences
described above are as shown in SEQ ID NO:1 (human zmsel) and SEQ >D N0:4
(mouse zmse 1 ).
The presence of conserved motifs, such as the CRIB motif, and low
variance motifs generally correlates with or defines important structural
regions in
10 proteins. Regions of low variance (e.g., hydrophobic clusters) are
generally present in
regions of structural importance (Sheppard, P. et al., su ra. . Such regions
of low
variance often contain rare or infrequent amino acids, such as Tryptophan. The
regions
flanking and between such conserved and low variance motifs may be more
variable,
but are often functionally significant because they may relate to or define
important
15 structures and activities such as guanosine nucleotide binding domains,
activation
domains, biological and enzymatic activity, signal transduction, cell-cell
interaction,
tissue or intracellular localization domains and the like. For example,
alignment of
zmsel with related polypeptides, for example MSE55, and the presence of a
conserved
CRIB motif supports that the correlating structural and functional domains of
zmsel are
2 0 significant in determining that zmsel is a Rho family effector.
The regions of conserved amino acid residues in zmsel, described
above, can be used as tools to identify new family members. For instance,
reverse
transcription-polymerase chain reaction (RT-PCR) can be used to amplify
sequences
encoding the conserved regions from RNA obtained from a variety of tissue
sources or
cell lines. In particular, highly degenerate primers designed from the zmsel
sequences
are useful for this purpose. Designing and using such degenerate primers may
be
readily performed by one of skill in the art.
The present invention also provides polynucleotide molecules, including
DNA and RNA molecules, that encode the zmsel polypeptides disclosed herein.
Those
3 0 skilled in the art will readily recognize that, in view of the degeneracy
of the genetic
code, considerable sequence variation is possible among these polynucleotide
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
16
molecules. SEQ ff~ N0:3 is a degenerate DNA sequence that encompasses all DNAs
that encode the human zmsel polypeptide of SEQ 1D N0:2. Those skilled in the
art
will recognize that the degenerate sequence of SEQ 1D N0:3 also provides all
RNA
sequences encoding SEQ >D N0:2 by substituting U for T. Thus, zmsel
polypeptide-
encoding polynucleotides comprising nucleotide 1 to nucleotide 1068 of SEQ 1D
N0:3
and their RNA equivalents are contemplated by the present invention. Table 1
sets
forth the one-letter codes used within SEQ >D N0:3 to denote degenerate
nucleotide
positions. "Resolutions" are the nucleotides denoted by a code letter.
"Complement"
indicates the code for the complementary nucleotide(s). For example, the code
Y
denotes either C or T, and its complement R denotes A or G, A being
complementary to
T, and G being complementary to C.
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
17
TABLE 1
NucleotideResolution Complement Resolution
A A T T
C C G G
G G C C
T T A A
R A~G Y C~T
Y C~T R A~G
M A~C K G~T
K G~T M A~C
S CMG S C~G
W A~T W A~T
H A~C~T D A~G~T
B C~G~T V A~C~G
V A~C~G B C~G~T
D A~G~T H A~C~T
N A~C~G~T N A~C~G~T
The degenerate codons used in SEQ >D N0:3, encompassing all possible
codons for a given amino acid, are set forth in Table 2.
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
18
TABLE 2
One
Amino Letter Codons Degenerate
Acid Code Codon
Cys C TGC TGT TGY
Ser S AGC AGT TCA TCC TCG TCT WSN
Thr T ACA ACC ACG ACT ACN
Pro P CCA CCC CCG CCT CCN
Ala A GCA GCC GCG GCT GCN
Gly G GGA GGC GGG GGT GGN
Asn N AAC AAT AAY
Asp D GAC GAT GAY
Glu E GAA GAG GAR
Gln Q CAA CAG CAR
His H CAC CAT CAY
Arg R AGA AGG CGA CGC CGG CGT MGN
Lys K AAA AAG AAR
Met M ATG ATG
Ile I ATA ATC ATT ATH
Leu L CTA CTC CTG CTT TTA TTG YTN
Val V GTA GTC GTG GTT GTN
Phe F TTC TTT TTY
Tyr Y TAC TAT TAY
Trp W TGG TGG
Ter . TAA TAG TGA TRR
Asn~AspB RAY
Glu~GlnZ SAR
Any X NNN
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
19
One of ordinary skill in the art will appreciate that some ambiguity is
introduced in determining a degenerate codon, representative of all possible
codons
encoding each amino acid. For example, the degenerate codon for serine (WSN)
can, in
some circumstances, encode arginine (AGR), and the degenerate codon for
arginine
(MGN) can, in some circumstances, encode serine (AGY). A similar relationship
exists
between codons encoding phenylalanine and leucine. Thus, some polynucleotides
encompassed by the degenerate sequence may encode variant amino acid
sequences, but
one of ordinary skill in the art can easily identify such variant sequences by
reference to
the amino acid sequence of SEQ 1D N0:2. Variant sequences can be readily
tested for
functionality as described herein.
One of ordinary skill in the art will also appreciate that different species
can exhibit "preferential codon usage." In general, see, Grantham, et al.,
Nuc. Acids
Res. 8:1893-912, 1980; Haas, et al. Curr. Biol. 6:315-24, 1996; Wain-Hobson,
et al.,
Gene 13:355-64, 1981; Grosjean and Fiers, Gene 18:199-209, 1982; Holm, Nuc.
Acids
Res. 14:3075-87, 1986; Ikemura, J. Mol. Biol. 158:573-97, 1982. As used
herein, the
term "preferential codon usage" or "preferential codons" is a term of art
referring to
protein translation codons that are most frequently used in cells of a certain
species,
thus favoring one or a few representatives of the possible codons encoding
each amino
acid (See Table 2). For example, the amino acid Threonine (Thr) may be encoded
by
2 0 ACA, ACC, ACG, or ACT, but in mammalian cells ACC is the most commonly
used
codon; in other species, for example, insect cells, yeast, viruses or
bacteria, different
Thr codons may be preferential. Preferential codons for a particular species
can be
introduced into the polynucleotides of the present invention by a variety of
methods
known in the art. Introduction of preferential codon sequences into
recombinant DNA
2 5 can, for example, enhance production of the protein by making protein
translation more
efficient within a particular cell type or species. Therefore, the degenerate
codon
sequence disclosed in SEQ ID N0:3 serves as a template for optimizing
expression of
polynucleotides in various cell types and species commonly used in the art and
disclosed herein. Sequences containing preferential codons can be tested and
optimized
3 0 for expression in various species, and tested for functionality as
disclosed herein.
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
Within preferred embodiments of the invention the isolated
polynucleotides will hybridize to similar sized regions of SEQ ID NO:1, or a
sequence
complementary thereto, under stringent conditions. In general, stringent
conditions are
selected to be about 5°C lower than the thermal melting point (Tm) for
the specific
5 sequence at a defined ionic strength and pH. The Tm is the temperature
(under defined
ionic strength and pH) at which 50% of the target sequence hybridizes to a
perfectly
matched probe. Numerous equations for calculating Tm are known in the art, and
are
specific for DNA, RNA and DNA-RNA hybrids and polynucleotide probe sequences
of
varying length (see, for example, Sambrook et al., Molecular Cloning: A
Laboratory
to Manual, Second Edition (Cold Spring Harbor Press 1989); Ausubel et al.,
(eds.),
Current Protocols in Molecular Biolo~y (John Wiley and Sons, Inc. 1987);
Berger and
Kimmel (eds.), Guide to Molecular Cloning Techniques, (Academic Press, Inc.
1987);
and Wetmur, Crit. Rev. Biochem. Mol. Biol. 26:227, 1990). Sequence analysis
software such as OLIGO 6.0 (LSR; Long Lake, MN) and Primer Premier 4.0
(Premier
15 Biosoft International; Palo Alto, CA), as well as sites on the Internet,
are available tools
for analyzing a given sequence and calculating Tm based on user defined
criteria. Such
programs can also analyze a given sequence under defined conditions and
identify
suitable probe sequences. Typically, hybridization of longer polynucleotide
sequences
(e.g., >50 base pairs) is performed at temperatures of about 20-25°C
below the
2 0 calculated Tm. For smaller probes (e.g., <50 base pairs) hybridization is
typically
carried out at the Tm or 5-10°C below. This allows for the maximum rate
of
hybridization for DNA-DNA and DNA-RNA hybrids. Higher degrees of stringency at
lower temperatures can be achieved with the addition of formamide which
reduces the
Tm of the hybrid about 1 °C for each 1 % formamide in the buffer
solution. Suitable
2 5 stringent hybridization conditions are equivalent to about a 5 h to
overnight incubation
at about 42°C in a solution comprising: about 40-50% formamide, up to
about 6X
SSC, about SX Denhardt's solution, zero up to about 10% dextran sulfate, and
about
10-20 pg/ml denatured commercially-available carrier DNA. Generally, such
stringent
conditions include temperatures of 20-70°C and a hybridization buffer
containing up to
3 0 6x SSC and 0-50% formamide; hybridization is then followed by washing
filters in up
to about 2X SSC. For example, a suitable wash stringency is equivalent to O.1X
SSC to
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
21
2X SSC, 0.1% SDS, at 55°C to 65°C. Different degrees of
stringency can be used
during hybridization and washing to achieve maximum specific binding to the
target
sequence. Typically, the washes following hybridization are performed at
increasing
degrees of stringency to remove non-hybridized polynucleotide probes from
hybridized
complexes. Stringent hybridization and wash conditions depend on the length of
the
probe, reflected in the Tm, hybridization and wash solutions used, and are
routinely
determined empirically and experimentally by one of skill in the art.
As previously noted, the isolated polynucleotides of the present
invention include DNA and RNA. Methods for preparing DNA and RNA are well
l0 known in the art. In general, RNA is isolated from a tissue or cell that
produces large
amounts of zmsel RNA. Such tissues and cells are identified by Northern
blotting
(Thomas, Proc. Natl. Acad. Sci. USA 77:5201, 1980), and include intestinal
tissues,
prostate, ovary, testis, spleen, pancreas, heart, skeletal muscle and the
like. Total RNA
can be prepared using guanidinium isothiocyanate extraction followed by
isolation by
centrifugation in a CsCI gradient (Chirgwin et al., Biochemistry 18:52-94,
1979). Poly
(A)+ RNA is prepared from total RNA using the method of Aviv and Leder (Proc.
Natl.
Acad. Sci. USA 69:1408-12, 1972). Complementary DNA (cDNA) is prepared from
poly(A)+ RNA using known methods. In the alternative, genomic DNA can be
isolated. Polynucleotides encoding zmse 1 polypeptides are then identified and
isolated
2 0 by, for example, hybridization or PCR.
A full-length clone encoding zmsel can be obtained by conventional
cloning procedures. Complementary DNA (cDNA) clones are preferred, although
for
some applications (e.g., expression in transgenic animals) it may be
preferable to use a
genomic clone, or to modify a cDNA clone to include at least one genomic
intron.
2 5 Methods for preparing cDNA and genomic clones are well known and within
the level
of ordinary skill in the art, and include the use of the sequence disclosed
herein, or parts
thereof, for probing or priming a library. Expression libraries can be probed
with
antibodies to zmsel, ligand fragments, or other specific binding partners.
Zmsel polynucleotide sequences disclosed herein can also be used as
3 0 probes or primers to clone 5' non-coding regions of a zmse 1 gene. In view
of the
tissue-specific expression observed for zmse 1 by Northern blotting, this gene
region
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
22
may provide for expression in many cell and tissue types. Promoter elements
from a
zmsel gene could thus be used to direct the ubiquitous expression of
heterologous
genes in, for example, transgenic animals or patients treated with gene
therapy.
Cloning of 5' flanking sequences also facilitates production of zmsel proteins
by "gene
activation" as disclosed in U.S. Patent No. 5,641,670. Briefly, expression of
an
endogenous zmsel gene in a cell is altered by introducing into the zmsel locus
a DNA
construct comprising at least a targeting sequence, a regulatory sequence, an
exon, and
an unpaired splice donor site. The targeting sequence is a zmsel 5' non-coding
sequence that permits homologous recombination of the construct with the
endogenous
zmsel locus, whereby the sequences within the construct become operably linked
with
the endogenous zmsel coding sequence. In this way, an endogenous zmsel
promoter
can be replaced or supplemented with other regulatory sequences to provide
enhanced,
tissue-specific, or otherwise regulated expression.
The polynucleotides of the present invention can also be synthesized
using DNA synthesis machines. If chemically synthesized double stranded DNA is
required for an application such as the synthesis of a DNA or a DNA fragment,
then
each complementary strand is made separately, for example via the
phosphoramidite
method known in the art. The production of short polynucleotides (60 to 80 bp)
is
technically straightforward and can be accomplished by synthesizing the
2 o complementary strands and then annealing them. However, for producing
longer
polynucleotides (longer than about 300 bp), special strategies are usually
employed.
For example, synthetic DNAs (double-stranded) are assembled in modular form
from
single-stranded fragments that are from 20 to 100 nucleotides in length. One
method
for building a synthetic DNA involves producing a set of overlapping,
complementary
2 5 oligonucleotides. Each internal section of the DNA has complementary 3'
and 5'
terminal extensions designed to base pair precisely with an adjacent section.
After the
DNA is assembled, the process is completed by ligating the nicks along the
backbones
of the two strands. In addition to the protein coding sequence, synthetic DNAs
can be
designed with terminal sequences that facilitate insertion into a restriction
endonuclease
3 0 site of a cloning vector. Alternative ways to prepare a full-length DNA
are also known
in the art. See Glick and Pasternak, Molecular Biotechnology, Principles &
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
23
Applications of Recombinant DNA, (ASM Press, Washington, D.C. 1994); Itakura
et
al., Annu. Rev. Biochem. 53: 323-56, 1984 and Climie et al., Proc. Natl. Acad.
Sci.
USA 87:633-7, 1990.
The present invention further provides counterpart polypeptides and
polynucleotides from other species (orthologs). These species include, but are
not
limited to mammalian, avian, amphibian, reptile, fish, insect and other
vertebrate and
invertebrate species. Of particular interest are zmsel polypeptides from other
mammalian species, including murine, porcine, ovine, bovine, canine, feline,
equine,
and other primate polypeptides. Orthologs of human zmsel can be cloned using
information and compositions provided by the present invention in combination
with
conventional cloning techniques. For example, a cDNA can be cloned using mRNA
obtained from a tissue or cell type that expresses zmsel as disclosed herein.
Suitable
sources of mRNA can be identified by probing Northern blots with probes
designed
from the sequences disclosed herein. A library is then prepared from mRNA of a
positive tissue or cell line. A zmsel-encoding cDNA can then be isolated by a
variety
of methods, such as by probing with a complete or partial human cDNA or with
one or
more sets of degenerate probes based on the disclosed sequences. A cDNA can
also be
cloned using the polymerase chain reaction, or PCR (Mullis, U.S. Patent No.
4,683,202), using primers designed from the representative human zmsel
sequence
2 0 disclosed herein. Within an additional method, the cDNA library can be
used to
transform or transfect host cells, and expression of the cDNA of interest can
be detected
with an antibody to zmsel polypeptide. Similar techniques can also be applied
to the
isolation of genomic clones.
A polynucleotide sequence for the mouse ortholog of human zmsel has
2 5 been identified and cloned and is shown in SEQ ID N0:4 and the
corresponding amino
acid sequence shown in SEQ ID NO:S. Analysis of the mouse zmsel polypeptide
encoded by the DNA sequence of SEQ ID N0:4 revealed an open reading frame
encoding 349 amino acids (SEQ ID NO:S) comprising a CRIB motif, N-terminal
domain, C-terminal domain, and C-terminal tail as described above. A
comparison of
3 0 the human and mouse amino acid sequences reveals that both the human and
orthologous polypeptides contain corresponding structural features described
above
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
24
(See, Figure 2). There is about 78% identity between the mouse and human amino
acid
sequences over the entire amino acid sequence corresponding to SEQ >D N0:2 and
SEQ ID NO:S. There is about 100% identity over the CRIB motif corresponding to
amino acid residue 27 (lle) to amino acid residue 41 (Gly) of SEQ ID N0:2 and
SEQ
ID NO:S. There is about 91 % identity a between the mouse and human zmse 1
sequences over the conserved N-terminal domain corresponding to residues 1
(Met) to
147 (Ala) of SEQ ID N0:2; and residues 1 (Met) to 145 (Ala) of SEQ >D NO:S.
There
is about 73% identity a between the mouse and human zmsel sequences over the
variable C-terminal domain corresponding to residues 148 (Asn) to 336 (Ser) of
SEQ
>D N0:2, and residues 146 (Asp) to 329 (Pro) of SEQ >D NO:S). There is about
95%
identity a between the mouse and human zmsel sequences over the conserved C-
terminal tail corresponding to residues 337 (Arg) to 356 (Val) of SEQ >D N0:2,
and
330 (Arg) to 349 (Val) of SEQ ID NO:S. The above percent identities were
determined
using a FASTA program with ktup=l, gap opening penalty=12, gap extension
penalty=2, and substitution matrix=BLOSUM62, with other parameters set as
default.
The corresponding polynucleotides encoding the mouse zmsel polypeptide
regions,
domains, motifs, residues and sequences described above are as shown in SEQ ID
N0:4.
Those skilled in the art will recognize that the sequence disclosed in
2o SEQ ID NO:I represents a single allele of human zmsel and that allelic
variation and
alternative splicing are expected to occur. Allelic variants of this sequence
can be
cloned by probing cDNA or genomic libraries from different individuals
according to
standard procedures. Allelic variants of the DNA sequence shown in SEQ ID
NO:I,
including those containing silent mutations and those in which mutations
result in
2 5 amino acid sequence changes, are within the scope of the present
invention, as are
proteins which are allelic variants of SEQ 117 N0:2. cDNAs generated from
alternatively spliced mRNAs, which retain the properties of the zmsel
polypeptide are
included within the scope of the present invention, as are polypeptides
encoded by such
cDNAs and mRNAs. Allelic variants and splice variants of these sequences can
be
3 0 cloned by probing cDNA or genomic libraries from different individuals or
tissues
according to standard procedures known in the art.
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
The present invention also provides isolated zmsel polypeptides that are
substantially similar to the polypeptides of SEQ >T7 N0:2 and their orthologs.
The term
"substantially similar" is used herein to denote polypeptides having 70%,
preferably
80%, more preferably at least 85%, sequence identity to the sequences shown in
SEQ
5 >D N0:2 or their orthologs. Such polypeptides will more preferably be at
least 90%
identical, and most preferably 95% or more identical to SEQ 1D N0:2 or its
orthologs.)
Percent sequence identity is determined by conventional methods. See, for
example,
Altschul et al., Bull. Math. Bio. 48: 603-16, 1986 and Henikoff and Henikoff,
Proc.
Natl. Acad. Sci. USA 89:10915-9, 1992. Briefly, two amino acid sequences are
aligned
10 to optimize the alignment scores using a gap opening penalty of 10, a gap
extension
penalty of 1, and the "blosum 62" scoring matrix of Henikoff and Henikoff
ibid.) as
shown in Table 3 (amino acids are indicated by the standard one-letter codes).
The
percent identity is then calculated as:
Total number of identical matches
15 x 100
[length of the longer sequence plus the
number of gaps introduced into the longer
sequence in order to align the two sequences]
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
26
H N M
r1 I
N L(1 N N O
I I
d' r-i M N N
I I
G4 C~ r1 r1 d~ M N
I I I I
G4 l4 d~ N N H M ri
I I I
In O N ~-1 r1 ri r1 r1
I I I I I
rY, Ll7 f-1 M r1 O r1 M N N
I I I I I I I
d~ N N O M N H N r1 H
I I I I I I
H d' N M r1 O M N r1 M r1 M
I I I I I I
,T, OD M M r1 N r1 N ~-1 N N N M
I I I I I I I I I I
~ N d' d' N M M N O N N M M
I I I 1 I I I I I I I
W Ill N O M M r~ N M r1 O r1 M N N
1 I I I I I I I I I
Or Ill N N O M N H O M r1 O r1 N c-i N
I I I I I I 1 I I
U O1 M d' M M r1 ri M ri N M r-1 r1 N N r-I
I I I I I I I I I I I I I I I
l0 M O N r1 H M d~ r1 M M r1 O r1 ~ M M
I I I I I I I I I I I I I
l0 H M O O O r1 M M O N M N r1 O ~ N M
I I I I I I I I I
(Y, II) O N M r1 O N O M N N r1 M N r1 H M N M
I I I I I I I I I I I I I
d~ r1 N N O r1 r1 O N r1 H r1 H N ri ~-1 O M N O
I I I I I I I I I I I I I I
r~ rx z a U a w L7 ~'., H I~ x ~ G4 W CJl [-~ 3 ,'~i
M
r~
H
111 O II) O
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
27
Sequence identity of polynucleotide molecules is determined by similar methods
using
a ratio as disclosed above.
Those skilled in the art appreciate that there are many established
algorithms available to align two amino acid sequences. The "FASTA" similarity
search algorithm of Pearson and Lipman is a suitable protein alignment method
for
examining the level of identity shared by an amino acid sequence disclosed
herein and
the amino acid sequence of a putative variant zmsel. The FASTA algorithm is
described by Pearson and Lipman, Proc. Nat'1 Acad. Sci. USA 85:2444, 1988; and
by
Pearson, Meth. Enzymol. 183:63, 1990.
Briefly, FASTA first characterizes sequence similarity by identifying
regions shared by the query sequence (e.g., SEQ ID N0:2) and a test sequence
that have
either the highest density of identities (if the ktup variable is 1) or pairs
of identities (if
ktup=2), without considering conservative amino acid substitutions,
insertions, or
deletions. The ten regions with the highest density of identities are then
rescored by
comparing the similarity of all paired amino acids using an amino acid
substitution
matrix, and the ends of the regions are "trimmed" to include only those
residues that
contribute to the highest score. If there are several regions with scores
greater than the
"cutoff" value (calculated by a predetermined formula based upon the length of
the
sequence and the ktup value), then the trimmed initial regions are examined to
2 0 determine whether the regions can be joined to form an approximate
alignment with
gaps. Finally, the highest scoring regions of the two amino acid sequences are
aligned
using a modification of the Needleman-Wunsch-Sellers algorithm (Needleman and
Wunsch, J. Mol. Biol. 48:444, 1970; Sellers, SIAM J. Appl. Math. 26:787,
1974),
which allows for amino acid insertions and deletions. Preferred parameters for
FASTA
2 5 analysis are: ktup=l, gap opening penalty=10, gap extension penalty=1, and
substitution matrix=BLOSUM62. These parameters can be introduced into a FASTA
program by modifying the scoring matrix file ("SMATR1X"), as explained in
Appendix
2 of Pearson, Meth. Enzymol., supra..
FASTA can also be used to determine the sequence identity of nucleic
3 0 acid molecules using a ratio as disclosed above. For nucleotide sequence
comparisons,
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
28
the ktup value can range between one to six, preferably from three to six,
most
preferably three, with other FASTA program parameters set as default.
The BLOSUM62 table (Table 3) is an amino acid substitution matrix
derived from about 2,000 local multiple alignments of protein sequence
segments,
representing highly conserved regions of more than 500 groups of related
proteins
(Henikoff and Henikoff, Proc. Nat'1 Acad. Sci. USA 89:10915, 1992).
Accordingly,
the BLOSUM62 substitution frequencies can be used to define conservative amino
acid
substitutions that may be introduced into the amino acid sequences of the
present
invention. Although it is possible to design amino acid substitutions based
solely upon
chemical properties (as discussed below), the language "conservative amino
acid
substitution" preferably refers to a substitution represented by a BLOSUM62
value of
greater than -1. For example, an amino acid substitution is conservative if
the
substitution is characterized by a BLOSUM62 value of 0, 1, 2, or 3. According
to this
system, preferred conservative amino acid substitutions are characterized by a
BLOSUM62 value of at least 1 (e.g., 1, 2 or 3), while more preferred
conservative
amino acid substitutions are characterized by a BLOSUM62 value of at least 2
(e.g., 2
or 3).
Variant zmsel polypeptides or substantially similar zmsel polypeptides
are characterized as having one or more amino acid substitutions, deletions or
additions.
2 0 These changes are preferably of a minor nature, that is conservative amino
acid
substitutions (see Table 4) and other substitutions that do not significantly
affect the
folding or activity of the polypeptide; small deletions, typically of one to
about 30
amino acids; and amino- or carboxyl-terminal extensions, such as an amino-
terminal
methionine residue, a small linker peptide of up to about 20-25 residues, or
an affinity
2 5 tag. The present invention thus includes polypeptides of from about 330 to
about 385
amino acid residues that comprise a sequence that is at least 90%, preferably
at least
95%, and more preferably 99% or more identical to the corresponding region of
SEQ
>D N0:2. Polypeptides comprising affinity tags can further comprise a
proteolytic
cleavage site between the zmsel polypeptide and the affinity tag. Preferred
such sites
3 o include thrombin cleavage sites and factor Xa cleavage sites.
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
29
Table 4
Conservative amino acid substitutions
Basic: arginine
lysine
histidine
Acidic: glutamic acid
aspartic acid
Polar: glutamine
asparagine
Hydrophobic: leucine
isoleucine
valine
Aromatic: phenylalanine
tryptophan
tyrosine
Small: glycine
alanine
serine
threonine
methionine
2 5 The present invention further provides a variety of other polypeptide
fusions and related multimeric proteins comprising one or more polypeptide
fusions.
For example, a zmsel polypeptide can be prepared as a fusion to a dimerizing
protein
as disclosed in U.S. Patents Nos. 5,155,027 and 5,567,584. Preferred
dimerizing
proteins in this regard include immunoglobulin constant region domains.
Immunoglobulin-zmsel polypeptide fusions can be expressed in genetically
engineered
cells to produce a variety of multimeric zmsel analogs. Auxiliary domains can
be
fused to zmse 1 polypeptides to target them to specific cells, tissues, or
macromolecules
(e.g., collagen). For example, a zmsel polypeptide or protein could be
targeted to a
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
predetermined cell type by fusing a zmse 1 polypeptide to a ligand that
specifically
binds to a receptor on the surface of the target cell. In this way,
polypeptides and
proteins can be targeted for therapeutic or diagnostic purposes. A zmsel
polypeptide
can be fused to two or more moieties, such as an affinity tag for purification
and a
5 targeting domain. Polypeptide fusions can also comprise one or more cleavage
sites,
particularly between domains. See, Tuan et al., Connective Tissue Research
34:1-9,
1996.
The proteins of the present invention can also comprise non-naturally
occurring amino acid residues. Non-naturally occurring amino acids include,
without
10 limitation, traps-3-methylproline, 2,4-methanoproline, cis-4-
hydroxyproline, traps-4-
hydroxyproline, N methylglycine, allo-threonine, methylthreonine,
hydroxyethylcysteine, hydroxyethylhomocysteine, nitroglutamine, homoglutamine,
pipecolic acid, thiazolidine carboxylic acid, dehydroproline, 3- and 4-
methylproline,
3,3-dimethylproline, tert-leucine, norvaline, 2-azaphenylalanine, 3-
azaphenylalanine, 4-
15 azaphenylalanine, and 4-fluorophenylalanine. Several methods are known in
the art for
incorporating non-naturally occurring amino acid residues into proteins. For
example,
an in vitro system can be employed wherein nonsense mutations are suppressed
using
chemically aminoacylated suppressor tRNAs. Methods for synthesizing amino
acids
and aminoacylating tRNA are known in the art. Transcription and translation of
2 0 plasmids containing nonsense mutations is carried out in a cell-free
system comprising
an E. coli S30 extract and commercially available enzymes and other reagents.
Proteins
are purified by chromatography. See, for example, Robertson et al., J. Am.
Chem. Soc.
113:2722, 1991; Ellman et al., Methods Enzymol. 202:301, 1991; Chung et al.,
Science
259:806-9, 1993; and Chung et al., Proc. Natl. Acad. Sci. USA 90:10145-9,
1993). In a
2 5 second method, translation is carried out in Xenopus oocytes by
microinjection of
mutated mRNA and chemically aminoacylated suppressor tRNAs (Turcatti et al.,
J.
Biol. Chem. 271:19991-8, 1996). Within a third method, E. coli cells are
cultured in
the absence of a natural amino acid that is to be replaced (e.g.,
phenylalanine) and in the
presence of the desired non-naturally occurring amino acids) (e.g., 2-
azaphenylalanine,
3 0 3-azaphenylalanine, 4-azaphenylalanine, or 4-fluorophenylalanine). The non-
naturally
occurring amino acid is incorporated into the protein in place of its natural
counterpart.
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
31
See, Koide et al., Biochem. 33:7470-6, 1994. Naturally occurring amino acid
residues
can be converted to non-naturally occurring species by in vitro chemical
modification.
Chemical modification can be combined with site-directed mutagenesis to
further
expand the range of substitutions (Wynn and Richards, Protein Sci. 2:395-403,
1993).
A limited number of non-conservative amino acids, amino acids that are
not encoded by the genetic code, non-naturally occurring amino acids, and
unnatural
amino acids may be substituted for zmsel amino acid residues.
Essential amino acids in the polypeptides of the present invention can be
identified according to procedures known in the art, such as site-directed
mutagenesis
or alanine-scanning mutagenesis (Cunningham and Wells, Science 244: 1081-5,
1989;
Bass et al., Proc. Natl. Acad. Sci. USA 88:4498-502, 1991). In the latter
technique,
single alanine mutations are introduced at every residue in the molecule, and
the
resultant mutant molecules are tested for biological activity as disclosed
below to
identify amino acid residues that are critical to the activity of the
molecule. See also,
Hilton et al., J. Biol. Chem. 271:4699-708, 1996. Sites of ligand-receptor or
other
biochemical interaction can also be determined by physical analysis of
structure, as
determined by such techniques as nuclear magnetic resonance, crystallography,
electron
diffraction or photoaffinity labeling, in conjunction with mutation of
putative contact
site amino acids. See, for example, de Vos et al., Science 255:306-12, 1992;
Smith et
2 0 al., J. Mol. Biol. 224:899-904, 1992; Wlodaver et al., FEBS Lett. 309:59-
64, 1992. The
identities of essential amino acids can also be inferred from analysis of
homologies with
related phosphodiesterases.
Determining amino acid residues that are within regions or domains that
are critical to maintaining structural integrity is within the skill of one in
the art. Within
these regions one can determine specific residues that will be more or less
tolerant of
change and maintain the overall tertiary structure of the molecule. Methods
for
analyzing sequence structure include, but are not limited to, alignment of
multiple
sequences with high amino acid or nucleotide identity and computer analysis
using
available software (e.g., the Insight II~ viewer and homology modeling tools;
MSI, San
3 0 Diego, CA), secondary structure propensities, binary patterns,
complementary packing
and buried polar interactions (Barton, Current Opin. Struct. Biol. 5:372-376,
1995 and
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
32
Cordes et al., Current Opin. Struct. Biol. 6:3-10, 1996). In general, when
designing
modifications to molecules or identifying specific fragments determination of
structure
will be accompanied by evaluating activity of modified molecules.
Amino acid sequence changes are made in zmsel polypeptides so as to
minimize disruption of higher order structure essential to biological
activity. For
example, when the zmsel polypeptide comprises one or more helices, changes in
amino
acid residues will be made so as not to disrupt the helix geometry and other
components
of the molecule where changes in conformation abate some critical function,
for
example, binding of the molecule to its binding partners, or enzymatic
function. The
effects of amino acid sequence changes can be predicted by, for example,
computer
modeling as disclosed above or determined by analysis of crystal structure
(see, e.g.,
Lapthorn et al., Nat. Struct. Biol. 2:266-268, 1995). Other techniques that
are well
known in the art compare folding of a variant protein to a standard molecule
(e.g., the
native protein). For example, comparison of the cysteine pattern in a variant
and
standard molecules can be made. Mass spectrometry and chemical modification
using
reduction and alkylation provide methods for determining cysteine residues
which are
associated with disulfide bonds or are free of such associations (Bean et al.,
Anal.
Biochem. 201:216-226, 1992; Gray, Protein Sci. 2:1732-1748, 1993; and
Patterson et
al., Anal. Chem. 66:3727-3732, 1994). It is generally believed that if a
modified
2 0 molecule does not have the same disulfide bonding pattern as the standard
molecule
folding would be affected. Another well known and accepted method for
measuring
folding is circular dichrosism (CD). Measuring and comparing the CD spectra
generated by a modified molecule and standard molecule is routine (Johnson,
Proteins
7:205-214, 1990). Crystallography is another well known method for analyzing
folding
2 5 and structure. Nuclear magnetic resonance (NMR), digestive peptide mapping
and
epitope mapping are also known methods for analyzing folding and structural
similarities between proteins and polypeptides (Schaanan et al., Science
257:961-964,
1992).
A Hopp/Woods hydrophilicity profile of the zmsel protein sequence as
3 0 shown in SEQ ID N0:2 can be generated (Hopp et al., Proc. Natl. Acad.
Sci.78:3824-
3828, 1981; Hopp, J. Immun. Meth. 88:1-18, 1986 and Triquier et al., Protein
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
33
Engineering 11:153-169, 1998). The profile is based on a sliding six-residue
window.
Buried G, S, and T residues' and exposed H, Y, and W residues were ignored
(See,
Figure 1). For example, in zmsel, hydrophilic regions include: (1) amino acid
number
96 (Glu) to amino acid number 101 (Asp) of SEQ ID N0:2; (2) amino acid number
226
(Asp) to amino acid number 231 (Asp) of SEQ >D N0:2; (3) amino acid number 346
(Met) to amino acid number 351 (Glu) of SEQ >D N0:2; (4) amino acid number 347
(Asp) to amino acid number 352 (Asp) of SEQ >D N0:2; and (5) amino acid number
348 (Glu) to amino acid number 353 (Glu) of SEQ >D N0:2.
Those skilled in the art will recognize that hydrophilicity or
hydrophobicity is taken into account when designing modifications in the amino
acid
sequence of a zmsel polypeptide, so as not to disrupt the overall structural
and
biological profile. Of particular interest for replacement are hydrophobic
residues
selected from the group consisting of Val, Leu and lle or the group consisting
of Met,
Gly, Ser, Ala, Tyr and Trp; for example, residues tolerant of substitution
could include
such residues as shown in SEQ ID NO: 2. Cysteine residues will be relatively
intolerant of substitution.
The identities of essential amino acids can also be inferred from analysis
of sequence similarity between known phosphodiesterase family members with
zmsel.
Using methods such as "FASTA" analysis described previously, regions of high
2 0 similarity are identified within a family of proteins and used to analyze
amino acid
sequence for conserved regions. An alternative approach to identifying a
variant zmse 1
polynucleotide on the basis of structure is to determine whether a nucleic
acid molecule
encoding a potential variant zmsel polynucleotide can hybridize to a nucleic
acid
molecule having the nucleotide sequence of SEQ ID NO:1, as discussed above.
2 5 Other methods of identifying essential amino acids in the polypeptides
of the present invention are procedures known in the art, such as site-
directed
mutagenesis or alanine-scanning mutagenesis (Cunningham and Wells, Science
244:1081, 1989; Bass et al., Proc. Natl Acad. Sci. USA 88:4498, 1991; Coombs
and
Corey, "Site-Directed Mutagenesis and Protein Engineering," in Proteins:
Analysis and
3 0 Design, Angeletti (ed.), Academic Press, Inc., pp. 259-311, 1998). In the
latter
technique, single alanine mutations are introduced at every residue in the
molecule, and
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
34
the resultant mutant molecules are tested for biological activity as disclosed
below to
identify amino acid residues that are critical to the activity of the
molecule. See also,
Hilton et al., J. Biol. Chem. 271:4699, 1996.
The present invention also includes functional fragments of zmsel
polypeptides and nucleic acid molecules encoding such functional fragments. A
"functional" zmse 1 or fragment thereof defined herein is characterized by its
proliferative or differentiating activity, by its ability to induce or inhibit
specialized cell
functions, or by its ability to bind specifically to an anti-zmsel antibody or
zmsel
substrate or binding partner (either soluble or immobilized).
Routine deletion analyses of nucleic acid molecules can be performed to
obtain functional fragments of a nucleic acid molecule that encodes a zmsel
polypeptide. As an illustration, DNA molecules having the nucleotide sequence
of
SEQ ID NO:1 or fragments thereof, can be digested with Ba131 nuclease to
obtain a
series of nested deletions. These DNA fragments are then inserted into
expression
vectors in proper reading frame, and the expressed polypeptides are isolated
and tested
for zmsel activity, or for the ability to bind anti-zmsel antibodies or zmsel
substrate or
binding partner. One alternative to exonuclease digestion is to use
oligonucleotide
directed mutagenesis to introduce deletions or stop codons to specify
production of a
desired zmse 1 fragment. Alternatively, particular fragments of a zmse 1
polynucleotide
2 0 can be synthesized using the polymerase chain reaction.
Standard methods for identifying functional domains are well-known to
those of skill in the art. For example, studies on the truncation at either or
both termini
of interferons have been summarized by Horisberger and Di Marco, Pharmac.
Ther.
66:507, 1995. Moreover, standard techniques for functional analysis of
proteins are
2 5 described by, for example, Treuter et al., Molec. Gen. Genet. 240:113,
1993; Content et
al., "Expression and preliminary deletion analysis of the 42 kDa 2-SA
synthetase
induced by human interferon," in Biological Interferon Systems, Proceedings of
ISIR-TNO Meeti~ on Interferon Systems, Cantell (ed.), Nijhoff, pp. 65-72,
1987;
Herschman, "The EGF Receptor," in Control of Animal Cell Proliferation 1
Boynton et
3 0 al. (eds.), Academic Press, pp. 169-199, 1985; Coumailleau et al., J.
Biol. Chem.
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
270:29270, 1995; Fukunaga et al., J. Biol. Chem. 270:25291, 1995; Yamaguchi et
al.,
Biochem. Pharmacol. 50:1295, 1995; and Meisel et al., Plant Molec. Biol. 30:1,
1996.
In addition, the proteins of the present invention (or polypeptide
fragments thereof) can be joined to other bioactive molecules, particularly
other CRIB
5 proteins or Rho effectors, to provide multi-functional molecules. For
example, one or
more domains or sub-fragments from zmsel can be joined to other CRIB proteins
to
enhance their biological properties or efficiency of production.
The present invention thus provides a series of novel, hybrid molecules
in which a segment comprising one or more of the domains or motifs of zmsel is
fused
10 to another polypeptide. Fusion is preferably done by splicing at the DNA
level to allow
expression of chimeric molecules in recombinant production systems. The
resultant
molecules are then assayed for such properties as improved solubility,
improved
stability, prolonged clearance half life, improved expression and secretion
levels, and
pharmacodynamics. Such hybrid molecules may further comprise additional amino
15 acid residues (e.g. a polypeptide linker) between the component proteins or
polypeptides.
Multiple amino acid substitutions can be made and tested using known
methods of mutagenesis and screening, such as those disclosed by Reidhaar-
Olson and
Sauer (Science 241:53-7, 1988) or Bowie and Sauer (Proc. Natl. Acad. Sci. USA
2 0 86:2152-6, 1989). Briefly, these authors disclose methods for
simultaneously
randomizing two or more positions in a polypeptide, selecting for functional
polypeptide, and then sequencing the mutagenized polypeptides to determine the
spectrum of allowable substitutions at each position. Other methods that can
be used
include phage display (e.g., Lowman et al., Biochem. 30:10832-7, 1991; Ladner
et al.,
2 5 U.S. Patent No. 5,223,409; Huse, WIPO Publication WO 92/06204) and region-
directed mutagenesis (Derbyshire et al., Gene 46:145, 1986; Ner et al., DNA
7:127,
1988).
Variants of the disclosed zmsel DNA and polypeptide sequences can be
generated through DNA shuffling as disclosed by Stemmer, Nature 370:389-91,
1994,
3 0 Stemmer, Proc. Natl. Acad. Sci. USA 91:10747-51, 1994 and WIPO Publication
WO
97/20078. Briefly, variant DNAs are generated by in vitro homologous
recombination
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
36
by random fragmentation of a parent DNA followed by reassembly using PCR,
resulting in randomly introduced point mutations. This technique can be
modified by
using a family of parent DNAs, such as allelic variants or DNAs from different
species,
to introduce additional variability into the process. Selection or screening
for the
desired activity, followed by additional iterations of mutagenesis and assay
provides for
rapid "evolution" of sequences by selecting for desirable mutations while
simultaneously selecting against detrimental changes.
Mutagenesis methods as disclosed herein can be combined with high-
throughput, automated screening methods to detect activity of cloned,
mutagenized
1 o polypeptides in host cells. Mutagenized DNA molecules that encode active
polypeptides (e.g., those with CRIB protein activity, that induce signal
transduction,
that exhibit Cdc42/Rac or other Rho protein binding, that bind anti-zmsel
antibodies,
and the like) can be recovered from the host cells and rapidly sequenced.
These
methods allow the rapid determination of the importance of individual amino
acid
residues in a polypeptide of interest, and can be applied to polypeptides of
unknown
structure.
Using the methods discussed herein, one of ordinary skill in the art can
identify and/or prepare a variety of polypeptide fragments or variants of SEQ
ID N0:2
or that retain, for example, CRIB protein-like properties, protein binding
activity,
2 0 cytoskeletal rearranging activity, proliferation, induction of actin
polymerization, cell
motility or invasion, cell-cell communication, or signal transduction activity
of the
wild-type zmsel protein. For example, using the methods described herein, one
could
identify a substrate binding domain in addition to the CRIB domain on zmsel;
heterodimeric and homodimeric binding domains; guanosine nucleotide binding
2 5 domains; other enzymatically active domains; other functional or
structural domains; or
other domains important for protein-protein interactions, biological activity,
or signal
transduction. Such polypeptides may also include additional polypeptide
segments,
such as affinity tags, as generally disclosed herein.
For any zmsel polypeptide, including variants and fusion proteins, one
3 0 of ordinary skill in the art can readily generate a fully degenerate
polynucleotide
sequence encoding that variant using the information set forth in Tables 1 and
2 above.
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
37
The zmsel polypeptides of the present invention, including full-length
polypeptides, biologically active fragments, and fusion polypeptides, can be
produced
in genetically engineered host cells according to conventional techniques.
Suitable host
cells are those cell types that can be transformed or transfected with
exogenous DNA
and grown in culture, and include bacteria, fungal cells, and cultured higher
eukaryotic
cells. Eukaryotic cells, particularly cultured cells of multicellular
organisms, are
preferred. Techniques for manipulating cloned DNA molecules and introducing
exogenous DNA into a variety of host cells are disclosed by Sambrook et al.,
Molecular
Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory Press,
Cold
Spring Harbor, NY, 1989, and Ausubel et al., eds., Current Protocols in
Molecular
Biolo~y, John Wiley and Sons, Inc., NY, 1987.
In general, a DNA sequence encoding a zmsel polypeptide is operably
linked to other genetic elements required for its expression, generally
including a
transcription promoter and terminator, within an expression vector. The vector
will
also commonly contain one or more selectable markers and one or more origins
of
replication, although those skilled in the art will recognize that within
certain systems
selectable markers may be provided on separate vectors, and replication of the
exogenous DNA may be provided by integration into the host cell genome.
Selection
2 0 of promoters, terminators, selectable markers, vectors and other elements
is a matter of
routine design within the level of ordinary skill in the art. Many such
elements are
described in the literature and are available through commercial suppliers.
To direct a zmsel polypeptide into the secretory pathway of a host cell, a
secretory signal sequence (also known as a leader sequence, prepro sequence or
pre
2 5 sequence) is provided in the expression vector. The secretory signal
sequence may be
derived from any secreted protein (e.g., t-PA) or synthesized de novo. The
secretory
signal sequence is operably linked to the zmsel DNA sequence, i.e., the two
sequences
are joined in the correct reading frame and positioned to direct the newly
synthesized
polypeptide into the secretory pathway of the host cell. Secretory signal
sequences are
3 0 commonly positioned 5' to the DNA sequence encoding the polypeptide of
interest,
although certain secretory signal sequences may be positioned elsewhere in the
DNA
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
38
sequence of interest (see, e.g., Welch et al., U.S. Patent No. 5,037,743;
Holland et al.,
U.S. Patent No. 5,143,830).
Cultured mammalian cells are suitable hosts within the present
invention. Methods for introducing exogenous DNA into mammalian host cells
include
calcium phosphate-mediated transfection (Wigler et al., Cell 14:725, 1978;
Corsaro and
Pearson, Somatic Cell Genetics 7:603, 1981: Graham and Van der Eb, Virolo~y
52:456,
1973), electroporation (Neumann et al., EMBO J. 1:841-5, 1982), DEAF-dextran
mediated transfection (Ausubel et al., ibid.), and liposome-mediated
transfection
(Hawley-Nelson et al., Focus 15:73, 1993; Ciccarone et al., Focus 15:80, 1993,
and
viral vectors (Miller and Rosman, BioTechniques 7:980-90, 1989; Wang and
Finer,
Nature Med. 2:714-6, 1996). The production of recombinant polypeptides in
cultured
mammalian cells is disclosed, for example, by Levinson et al., U.S. Patent No.
4,713,339; Hagen et al., U.S. Patent No. 4,784,950; Palmiter et al., U.S.
Patent No.
4,579,821; and Ringold, U.S. Patent No. 4,656,134. Suitable cultured mammalian
cells
include the COS-1 (ATCC No. CRL 1650), COS-7 (ATCC No. CRL 1651), BHK
(ATCC No. CRL 1632), BHK 570 (ATCC No. CRL 10314), 293 (ATCC No. CRL
1573; Graham et al., J. Gen. Virol. 36:59-72, 1977), NIH 3T3 fibroblasts (ATCC
No.
CRL-1658), Rat2 cells (ATCC No. CRL-1764), and Chinese hamster ovary (e.g. CHO-
K1; ATCC No. CCL 61) cell lines. Additional suitable cell lines are known in
the art
2 o and available from public depositories such as the American Type Culture
Collection,
Manassas, VA. In general, strong transcription promoters are preferred, such
as
promoters from SV-40 or cytomegalovirus. See, e.g., U.S. Patent No. 4,956,288.
Other
suitable promoters include those from metallothionein genes (U.S. Patent Nos.
4,579,821 and 4,601,978) and the adenovirus major late promoter.
2 5 Drug selection is generally used to select for cultured mammalian cells
into which foreign DNA has been inserted. Such cells are commonly referred to
as
"transfectants". Cells that have been cultured in the presence of the
selective agent and
are able to pass the gene of interest to their progeny are referred to as
"stable
transfectants." A preferred selectable marker is a gene encoding resistance to
the
3 0 antibiotic neomycin. Selection is carried out in the presence of a
neomycin-type drug,
such as G-418 or the like. Selection systems can also be used to increase the
expression
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
39
level of the gene of interest, a process referred to as "amplification."
Amplification is
carried out by culturing transfectants in the presence of a low level of the
selective
agent and then increasing the amount of selective agent to select for cells
that produce
high levels of the products of the introduced genes. A preferred amplifiable
selectable
marker is dihydrofolate reductase, which confers resistance to methotrexate.
Other
drug resistance genes (e.g. hygromycin resistance, multi-drug resistance,
puromycin
acetyltransferase) can also be used. Alternative markers that introduce an
altered
phenotype, such as green fluorescent protein, or cell surface proteins such as
CD4,
CDB, Class I MHC, placental alkaline phosphatase may be used to sort
transfected cells
from untransfected cells by such means as FACS sorting or magnetic bead
separation
technology.
Other higher eukaryotic cells can also be used as hosts, including plant
cells, insect cells and avian cells. The use of Agrobacterium rhizogenes as a
vector for
expressing genes in plant cells has been reviewed by Sinkar et al., J. Biosci.
(Ban ate)
11:47-58, 1987. Transformation of insect cells and production of foreign
polypeptides
therein is disclosed by Guarino et al., U.S. Patent No. 5,162,222 and WIPO
publication
WO 94/06463. Insect cells can be infected with recombinant baculovirus,
commonly
derived from Autographa californica nuclear polyhedrosis virus (AcNPV). See,
King,
L.A. and Possee, R.D., The Baculovirus Expression System: A Laboratory Guide,
2 0 London, Chapman & Hall; O'Reilly, D.R. et al., Baculovirus Expression
Vectors: A
Laboratory Manual, New York, Oxford University Press., 1994; and, Richardson,
C. D.,
Ed., Baculovirus Expression Protocols. Methods in Molecular Biology, Totowa,
NJ,
Humana Press, 1995. The second method of making recombinant baculovirus
utilizes a
transposon-based system described by Luckow (Luckow, V.A, et al., J Virol
67:4566-
2 5 79, 1993). This system is sold in the Bac-to-Bac kit (Life Technologies,
Rockville,
MD). This system utilizes a transfer vector, pFastBaclT"~ (Life Technologies)
containing a Tn7 transposon to move the DNA encoding the zmsel polypeptide
into a
baculovirus genome maintained in E. coli as a large plasmid called a "bacmid."
The
pFastBaclT"" transfer vector utilizes the AcNPV polyhedrin promoter to drive
the
30 expression of the gene of interest, in this case zmsel. However,
pFastBaclT~" can be
modified to a considerable degree. The polyhedrin promoter can be removed and
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
substituted with the baculovirus basic protein promoter (also known as Pcor,
p6.9 or
MP promoter) which is expressed earlier in the baculovirus infection, and has
been
shown to be advantageous for expressing secreted proteins. See, Hill-Perkins,
M.S. and
Possee, R.D., J. Gen. Virol. 71:971-6, 1990; Bonning, B.C. et al., J. Gen.
Virol.
5 75:1551-6, 1994; and, Chazenbalk, G.D., and Rapoport, B., J. Biol. Chem.
270:1543-9,
1995. In such transfer vector constructs, a short or long version of the basic
protein
promoter can be used. Moreover, transfer vectors can be constructed which
replace the
native zmsel secretory signal sequences with secretory signal sequences
derived from
insect proteins. For example, a secretory signal sequence from Ecdysteroid
10 Glucosyltransferase (EGT), honey bee Melittin (Invitrogen, Carlsbad, CA),
or
baculovirus gp67 (PharMingen, San Diego, CA) can be used in constructs to
replace the
native zmsel secretory signal sequence. In addition, transfer vectors can
include an in-
frame fusion with DNA encoding an epitope tag at the C- or N-terminus of the
expressed zmsel polypeptide, for example, a Glu-Glu epitope tag (Grussenmeyer,
T. et
15 al., Proc. Natl. Acad. Sci. 82:7952-4, 1985). Using a technique known in
the art, a
transfer vector containing zmsel is transformed into E. coli, and screened for
bacmids
which contain an interrupted lacZ gene indicative of recombinant baculovirus.
The
bacmid DNA containing the recombinant baculovirus genome is isolated, using
common techniques, and used to transfect Spodoptera frugiperda cells, e.g. Sf9
cells.
20 Recombinant virus that expresses zmsel is subsequently produced.
Recombinant viral
stocks are made by methods commonly used the art.
The recombinant virus is used to infect host cells, typically a cell line
derived from the fall armyworm, Spodoptera frugiperda. See, in general, Glick
and
Pasternak, Molecular Biotechnolo~y: Principles and Applications of Recombinant
2 5 DNA, ASM Press, Washington, D.C., 1994. Another suitable cell line is the
High
FiveOT"" cell line (Invitrogen) derived from Trichoplusia ni (U.S. Patent
No.5,300,435).
Commercially available serum-free media are used to grow and maintain the
cells.
Suitable media are Sf900 I1T"" (Life Technologies) or ESF 921T"" (Expression
Systems)
for the Sf9 cells; and Ex-ce11O405T"" (JRH Biosciences, Lenexa, KS) or Express
3 0 FiveOT"~ (Life Technologies) for the T. ni cells. The cells are grown up
from an
inoculation density of approximately 2-5 x 105 cells to a density of 1-2 x 106
cells at
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
41
which time a recombinant viral stock is added at a multiplicity of infection
(MOB of
0.1 to 10, more typically near 3. Procedures used are generally described in
available
laboratory manuals (King, L. A. and Possee, R.D., ibid.; O'Reilly, D.R. et
al., ibid.;
Richardson, C. D., ibid.). Subsequent purification of the zmsel polypeptide
from the
supernatant can be achieved using methods described herein.
Fungal cells, including yeast cells, can also be used within the present
invention. Yeast species of particular interest in this regard include
Saccharomyces
cerevisiae, Pichia pastoris, and Pichia methanolica. Methods for transforming
S.
cerevisiae cells with exogenous DNA and producing recombinant polypeptides
therefrom are disclosed by, for example, Kawasaki, U.S. Patent No. 4,599,311;
Kawasaki et al., U.S. Patent No. 4,931,373; Brake, U.S. Patent No. 4,870,008;
Welch et
al., U.S. Patent No. 5,037,743; and Murray et al., U.S. Patent No. 4,845,075.
Transformed cells are selected by phenotype determined by the selectable
marker,
commonly drug resistance or the ability to grow in the absence of a particular
nutrient
(e.g., leucine). A preferred vector system for use in Saccharomyces cerevisiae
is the
POTI vector system disclosed by Kawasaki et al. (U.S. Patent No. 4,931,373),
which
allows transformed cells to be selected by growth in glucose-containing media.
Suitable promoters and terminators for use in yeast include those from
glycolytic
enzyme genes (see, e.g., Kawasaki, U.S. Patent No. 4,599,311; Kingsman et al.,
U.S.
2 0 Patent No. 4,615,974; and Bitter, U.S. Patent No. 4,977,092) and alcohol
dehydrogenase genes. See also U.S. Patents Nos. 4,990,446; 5,063,154;
5,139,936 and
4,661,454. Transformation systems for other yeasts, including Hansenula
polymorpha,
Schizosaccharomyces pombe, Kluyveromyces lactis, Kluyveromyces fragilis,
Ustilago
maydis, Pichia pastoris, Pichia methanolica, Pichia guillermondii and Candida
2 5 maltosa are known in the art. See, for example, Gleeson et al., J. Gen.
Microbiol.
132:3459-65, 1986 and Cregg, U.S. Patent No. 4,882,279. Aspergillus cells may
be
utilized according to the methods of McKnight et al., U.S. Patent No.
4,935,349.
Methods for transforming Acremonium chrysogenum are disclosed by Sumino et
al.,
U.S. Patent No. 5,162,228. Methods for transforming Neurospora are disclosed
by
3 0 Lambowitz, U.S. Patent No. 4,486,533.
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
42
The use of Pichia methanolica as host for the production of recombinant
proteins is disclosed in WIPO Publications WO 97/17450, WO 97/17451, WO
98/02536, and WO 98/02565. DNA molecules for use in transforming P.
methanolica
will commonly be prepared as double-stranded, circular plasmids, which are
preferably
linearized prior to transformation. For polypeptide production in P.
methanolica, it is
preferred that the promoter and terminator in the plasmid be that of a P.
methanolica
gene, such as a P. methanolica alcohol utilization gene (AUGI or AUG2). Other
useful
promoters include those of the dihydroxyacetone synthase (DHAS), formate
dehydrogenase (FMD), and catalase (CAT) genes. To facilitate integration of
the DNA
into the host chromosome, it is preferred to have the entire expression
segment of the
plasmid flanked at both ends by host DNA sequences. A preferred selectable
marker
for use in Pichia methanolica is a P. methanolica ADE2 gene, which encodes
phosphoribosyl-5-aminoimidazole carboxylase (AIRC; EC 4.1.1.21), which allows
ade2 host cells to grow in the absence of adenine. For large-scale, industrial
processes
where it is desirable to minimize the use of methanol, it is preferred to use
host cells in
which both methanol utilization genes (AUGl and AUG2) are deleted. For
production
of secreted proteins, host cells deficient in vacuolar protease genes (PEP4
and PRBI )
are preferred. Electroporation is used to facilitate the introduction of a
plasmid
containing DNA encoding a polypeptide of interest into P. methanolica cells.
It is
2 0 preferred to transform P. methanolica cells by electroporation using an
exponentially
decaying, pulsed electric field having a field strength of from 2.5 to 4.5
kV/cm,
preferably about 3.75 kV/cm, and a time constant (t) of from 1 to 40
milliseconds, most
preferably about 20 milliseconds.
Prokaryotic host cells, including strains of the bacteria Escherichia coli,
2 5 Bacillus and other genera are also useful host cells within the present
invention.
Techniques for transforming these hosts and expressing foreign DNA sequences
cloned
therein are well known in the art (see, e.g., Sambrook et al., ibid.). When
expressing a
zmsel polypeptide in bacteria such as E. coli, the polypeptide may be retained
in the
cytoplasm, typically as insoluble granules, or may be directed to the
periplasmic space
3 0 by a bacterial secretion sequence. In the former case, the cells are
lysed, and the
granules are recovered and denatured using, for example, guanidine
isothiocyanate or
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
43
urea. The denatured polypeptide can then be refolded and dimerized by diluting
the
denaturant, such as by dialysis against a solution of urea and a combination
of reduced
and oxidized glutathione, followed by dialysis against a buffered saline
solution. In the
latter case, the polypeptide can be recovered from the periplasmic space in a
soluble
and functional form by disrupting the cells (by, for example, sonication or
osmotic
shock) to release the contents of the periplasmic space and recovering the
protein,
thereby obviating the need for denaturation and refolding.
Transformed or transfected host cells are cultured according to
conventional procedures in a culture medium containing nutrients and other
components required for the growth of the chosen host cells. A variety of
suitable
media, including defined media and complex media, are known in the art and
generally
include a carbon source, a nitrogen source, essential amino acids, vitamins
and
minerals. Media may also contain such components as growth factors or serum,
as
required. The growth medium will generally select for cells containing the
exogenously
added DNA by, for example, drug selection or deficiency in an essential
nutrient which
is complemented by the selectable marker carried on the expression vector or
co-
transfected into the host cell. P. methanolica cells are cultured in a medium
comprising
adequate sources of carbon, nitrogen and trace nutrients at a temperature of
about 25°C
to 35°C. Liquid cultures are provided with sufficient aeration by
conventional means,
2 0 such as shaking of small flasks or sparging of fermentors. A preferred
culture medium
for P. metharcolica is YEPD (2% D-glucose, 2% BactoT~''' Peptone (Difco
Laboratories,
Detroit, MI), 1% BactoTM yeast extract (Difco Laboratories), 0.004% adenine
and
0.006% L-leucine).
It is preferred to purify the polypeptides of the present invention to
>_80% purity, more preferably to >_90% purity, even more preferably >_95%
purity, and
particularly preferred is a pharmaceutically pure state, that is greater than
99.9% pure
with respect to contaminating macromolecules, particularly other proteins and
nucleic
acids, and free of infectious and pyrogenic agents. Preferably, a purified
polypeptide is
substantially free of other polypeptides, particularly other polypeptides of
animal origin.
Expressed recombinant zmsel polypeptides (or chimeric zmsel
polypeptides) can be purified using fractionation and/or conventional
purification
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
44
methods and media. For example, the zmsel polypeptides of the present
invention can
be purified using glutathione affinity chromatography followed by isopropyl-1-
thio-(3-
D-galactopyranoside, such as that applied to other CRIB proteins (Burbelo,
P.D. et al.,
J. Biol. Chem. 270:29071-29074, 1995). Moreover, other conventional
purification
methods can be used. Ammonium sulfate precipitation and acid or chaotrope
extraction
may be used for fractionation of samples. Exemplary purification steps may
include
hydroxyapatite, size exclusion, FPLC and reverse-phase high performance liquid
chromatography. Suitable chromatographic media include derivatized dextrans,
agarose, cellulose, polyacrylamide, specialty silicas, and the like. PEI,
DEAE, QAE
and Q derivatives are preferred. Exemplary chromatographic media include those
media
derivatized with phenyl, butyl, or octyl groups, such as Phenyl-Sepharose FF
(Pharmacia), Toyopearl butyl 650 (Toso Haas, Montgomeryville, PA), Octyl-
Sepharose
(Pharmacia) and the like; or polyacrylic resins, such as Amberchrom CG 71
(Toso
Haas) and the like. Suitable solid supports include glass beads, silica-based
resins,
cellulosic resins, agarose beads, cross-linked agarose beads, polystyrene
beads, cross-
linked polyacrylamide resins and the like that are insoluble under the
conditions in
which they are to be used. These supports may be modified with reactive groups
that
allow attachment of proteins by amino groups, carboxyl groups, sulfhydryl
groups,
hydroxyl groups and/or carbohydrate moieties. Examples of coupling chemistries
2 0 include cyanogen bromide activation, N-hydroxysuccinimide activation,
epoxide
activation, sulfhydryl activation, hydrazide activation, and carboxyl and
amino
derivatives for carbodiimide coupling chemistries. These and other solid media
are
well known and widely used in the art, and are available from commercial
suppliers.
Methods for binding receptor polypeptides, or anti-complementary polypeptides,
to
2 5 support media are well known in the art. Selection of a particular method
is a matter of
routine design and is determined in part by the properties of the chosen
support. See,
for example, Affinity Chromatography: Principles & Methods, Pharmacia LKB
Biotechnology, Uppsala, Sweden, 1988.
The polypeptides of the present invention can be isolated by exploitation
3 0 of their structural or biochemical properties. For example, immobilized
metal ion
adsorption (IMAC) chromatography can be used to purify histidine-rich
proteins,
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
including those comprising polyhistidine tags. Briefly, a gel is first charged
with
divalent metal ions to form a chelate (Sulkowski, Trends in Biochem. 3:1-7,
1985).
Histidine-rich proteins will be adsorbed to this matrix with differing
affinities,
depending upon the metal ion used, and will be eluted by competitive elution,
lowering
5 the pH, or use of strong chelating agents. Other methods of purification
include
purification of glycosylated proteins by lectin affinity chromatography and
ion
exchange chromatography (Methods in Enzymol., Vol. 182, "Guide to Protein
Purification", M. Deutscher, (ed.), Acad. Press, San Diego, 1990, pp.529-39).
Within
additional embodiments of the invention, a fusion of the polypeptide of
interest and an
10 affinity tag (e.g., maltose-binding protein, an immunoglobulin domain) may
be
constructed to facilitate purification. Moreover purification methods used to
purify
mammalian, or other eukaryotic CRIB polypeptides can be used to purify human
zmsel
polypeptides. See, for example, Burbelo, P.D. et al., supra..
Moreover, using methods described in the art, polypeptide fusions, or
15 hybrid zmsel proteins, are constructed using regions or domains of the
inventive zmsel
in combination with those of other Rho effector family proteins (e.g. MSE55,
PAK,
WASP, other CRIB proteins, and the like), or heterologous proteins (Sambrook
et al.,
ibid.; Altschul et al., ibid.; Picard, Cur. Opin. Biology, 5:511-5, 1994, and
references
therein). These methods allow the determination of the biological importance
of larger
2 0 domains or regions in a polypeptide of interest. Such hybrids may alter
reaction
kinetics, binding, constrict or expand the substrate specificity, alter
activity in
cytoskeletal reorganization or gene transcription in a cell, alter
cytoskeletal organization
and cell motility, transformation, or invasiveness, or alter tissue and
cellular
localization of a polypeptide, and can be applied to polypeptides of unknown
structure.
2 5 Fusion proteins can be prepared by methods known to those skilled in
the art by preparing each component of the fusion protein and chemically
conjugating
them. Alternatively, a polynucleotide encoding various components of the
fusion
protein in the proper reading frame can be generated using known techniques
and
expressed by the methods described herein. For example, part or all of a
domains)
3 0 conferring a structural or biological function may be swapped between zmse
1 of the
present invention with the functionally equivalent domains) from another
family
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
46
member. Such domains include, but are not limited to, the CRIB motif, the N-
terminal
domain, C-terminal domain, or C-terminal tail. Such fusion proteins would be
expected to have a biological functional profile that is the same or similar
to
polypeptides of the present invention or other known Rho effector family
proteins (e.g.
binding Cdc42, GTP hydrolysis or binding, increasing or decreasing actin
polymerization, cell motility, or transformation, and the like) depending on
the fusion
constructed. Moreover, such fusion proteins may exhibit other properties as
disclosed
herein.
Standard molecular biological and cloning techniques can be used to
swap the equivalent domains between the zmsel polypeptide and those
polypeptides to
which they are fused. Generally, a DNA segment that encodes a domain of
interest,
e.g., a zmsel active polypeptide or motif described herein, is operably linked
in frame
to at least one other DNA segment encoding an additional polypeptide and
inserted into
an appropriate expression vector, as described herein. Generally DNA
constructs are
made such that the several DNA segments that encode the corresponding regions
of a
polypeptide are operably linked in frame to make a single construct that
encodes the
entire fusion protein, or a functional portion thereof. For example, a DNA
construct
would encode from N-terminus to C-terminus a fusion protein comprising a
signal
polypeptide followed by a full length or mature polypeptide; or a DNA
construct would
2 0 encode from N-terminus to C-terminus a fusion protein comprising an N-
terminal
domain containing a CRIB motif and a C-terminal domain; or a DNA construct
would
encode from N-terminus to C-terminus a fusion protein comprising an N-terminal
domain containing a CRIB motif; or, for example, any of the above as
interchanged
with equivalent regions from another protein. Such fusion proteins can be
expressed,
2 5 isolated, and assayed for activity as described herein.
Zmsel polypeptides or fragments thereof may also be prepared through
chemical synthesis. Zmsel polypeptides may be monomers or multimers;
glycosylated
or non-glycosylated; pegylated or non-pegylated; and may or may not include an
initial
methionine amino acid residue.
3 0 Polypeptides of the present invention can also be synthesized by
exclusive solid phase synthesis, partial solid phase methods, fragment
condensation or
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
47
classical solution synthesis. Methods for synthesizing polypeptides are well
known in
the art. See, for example, Merrifield, J. Am. Chem. Soc. 85:2149, 1963; Kaiser
et al.,
Anal. Biochem. 34:595, 1970. After the entire synthesis of the desired peptide
on a
solid support, the peptide-resin is with a reagent which cleaves the
polypeptide from the
resin and removes most of the side-chain protecting groups. Such methods are
well
established in the art.
The activity of molecules of the present invention can be measured using
a variety of assays that measure actin polymerization, GTP binding or
hydrolysis,
proliferation, cell motility and invasion, metastasis or other CRIB/Rho
effector protein
activity. Of particular interest are assays that measure changes in cell
proliferation,
transformation, adhesion, gene expression, apoptosis, generation of nucleotide
monophosphates, cell motility and invasion, metastasis, actin stress fiber
production,
filopodia, lamellipodia, membrane ruffling and others. Moreover CRIB/Rho
effector
protein activity can be measured using protein or antibody binding assays,
scintillation
proximity assay (SPA) technology described herein; cAMP assays described
herein; as
well as other assays described herein. Such assays are well known in the art,
and many
are described in further detail below.
As a CRIB protein zmsel can affect cytoskeletal reorganization, cell-cell
interaction and motility and hence can affect tissues that contract. Moreover,
zmsel is
expressed in contractile tissues. For example contractile tissues in which
zmsel is
expressed include testis, prostate, heart and skeletal muscle. The effects of
zmsel
polypeptide, its antagonists and agonists, on tissue contractility can be
measured in
vitro using a tensiometer with or without electrical field stimulation. Such
assays are
known in the art and can be applied to tissue samples, such as aortic rings,
muscle
2 5 tissue, and other contractile tissue samples, as well as to organ systems,
such as atria,
and can be used to determine whether zmsel polypeptide, its agonists or
antagonists,
enhance or depress contractility. Molecules of the present invention are hence
useful
for treating dysfunction associated with contractile tissues or can be used to
suppress or
enhance contractility in vivo. As such, molecules of the present invention
have utility
3 0 in treating cardiovascular disease, muscle relaxants or stimulants,
infertility, in vitro
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
48
fertilization, birth control, treating impotence or other male reproductive
dysfunction, as
well as inducing birth.
The effect of the zmsel polypeptides, antagonists and agonists of the
present invention on contractility of tissues including skeletal and smooth
muscle
tissues, testis, heart, and the like, can be measured in a tensiometer that
measures
contractility and relaxation in tissues. See, Dainty et al., J. Pharmacol.
100:767, 1990;
Rhee et al., Neurotox. 16: 179, 1995; Anderson, M.B., Endocrinol. 114:364-368,
1984;
and Downing, S.J. and Sherwood, O.D, Endocrinol. 116:1206-1214, 1985. For
example, measuring vasodilatation of aortic rings is well known in the art.
Briefly,
aortic rings are taken from 4 month old Sprague Dawley rats and placed in a
buffer
solution, such as modified Krebs solution (118.5 mM NaCI, 4.6 mM KCI, 1.2 mM
MgS04.7H20, 1.2 mM KHZPO4, 2.5 mM CaC12.2H20, 24.8 mM NaHC03 and 10 mM
glucose). One of skill in the art would recognize that this method can be used
with
other animals, such as rabbits, other rat strains, Guinea pigs, and the like.
The rings are
then attached to an isometric force transducer (Radnoti Inc., Monrovia, CA)
and the
data recorded with a Ponemah physiology platform (could Instrument systems,
Inc.,
Valley View, OH) and placed in an oxygenated (95% OZ, 5% C02) tissue bath
containing the buffer solution. The tissues are adjusted to 1 gram resting
tension and
allowed to stabilize for about one hour before testing. The integrity of the
rings can be
2 0 tested with norepinepherin (Sigma Co., St. Louis, MO) and Carbachol, a
muscarinic
acetylcholine agonist (Sigma Co.). After integrity is checked, the rings are
washed
three times with fresh buffer and allowed to rest for about one hour. To test
a sample
for vasodilatation, or relaxation of the aortic ring tissue, the rings are
contracted to two
grams tension and allowed to stabilize for fifteen minutes. A zmsel
polypeptide,
2 5 antagonist or agonist sample is then added to l, 2 or 3 of the 4 baths,
without flushing,
and tension on the rings recorded and compared to the control rings containing
buffer
only. Enhancement or relaxation of contractility by zmsel polypeptides, their
agonists
and antagonists is directly measured by this method, and it can be applied to
other
contractile tissues such as skeletal and smooth muscle tissue,
gastrointestinal tissues,
3 0 uterus, prostate, and testis.
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
49
The activity of molecules of the present invention can be measured using
a variety of assays that measure stimulation of gastrointestinal cell
contractility,
modulation of nutrient uptake and/or secretion of digestive enzymes. Of
particular
interest are changes in contractility of smooth muscle cells, for example, the
contractile
response of segments of mammalian duodenum or other gastrointestinal smooth
muscles tissue (Depoortere et al., J. Gastrointestinal Motility 1:150-159,
1989,
incorporated herein by reference). An exemplary in vivo assay uses an
ultrasonic
micrometer to measure the dimensional changes radially between commissures and
longitudinally to the plane of the valve base (Hansen et al., Society of
Thoracic
Surgeons 60:5384-390, 1995).
Gastric motility is generally measured in the clinical setting as the time
required for gastric emptying and subsequent transit time through the
gastrointestinal
tract. Gastric emptying scans are well known to those skilled in the art, and
briefly,
comprise use of an oral contrast agent, such as barium, or a radiolabeled
meal. Solids
and liquids can be measured independently. A test food or liquid is
radiolabeled with
an isotope (e.g. 99"'Tc), and after ingestion or administration, transit time
through the
gastrointestinal tract and gastric emptying are measured by visualization
using gamma
cameras (Meyer et al., Am. J. Di_ .g Dis. 21:296, 1976; Collins et al., Gut
24:1117, 1983;
Maughan et al., Diabet. Med. 13 9 Supp. 5:S6-10, 1996 and Horowitz et al.,
Arch.
Intern. Med. 145:1467-1472, 1985). These studies may be performed before and
after
the administration of a promotility agent to quantify the efficacy of the
drug.
An in vivo approach for assaying proteins of the present invention
involves viral delivery systems. Exemplary viruses for this purpose include
adenovirus,
herpesvirus, retroviruses, vaccinia virus, and adeno-associated virus (AAV).
2 5 Adenovirus, a double-stranded DNA virus, is currently the best studied
gene transfer
vector for delivery of heterologous nucleic acid (for review, see T.C. Becker
et al.,
Meth. Cell Biol. 43:161-89, 1994; and J.T. Douglas and D.T. Curiel, Science &
Medicine 4:44-53, 1997). The adenovirus system offers several advantages: (i)
adenovirus can accommodate relatively large DNA inserts; (ii) can be grown to
high-
3 0 titer; (iii) infect a broad range of mammalian cell types; and (iv) can be
used with many
different promoters including ubiquitous, tissue specific, and regulatable
promoters.
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
Also, because adenoviruses are stable in the bloodstream, they can be
administered by
intravenous injection.
Using adenovirus vectors where portions of the adenovirus genome are
deleted, inserts are incorporated into the viral DNA by direct ligation or by
homologous
5 recombination with a co-transfected plasmid. In an exemplary system, the
essential E1
gene has been deleted from the viral vector, and the virus will not replicate
unless the
E1 gene is provided by the host cell (the human 293 cell line is exemplary).
When
intravenously administered to intact animals, adenovirus primarily targets the
liver. If
the adenoviral delivery system has an E1 gene deletion, the virus cannot
replicate in the
10 host cells. However, the host's tissue (e.g., liver) will express and
process (and, if a
secretory signal sequence is present, secrete) the heterologous protein.
Secreted
proteins will enter the circulation in the highly vascularized liver, and
effects on the
infected animal can be determined.
Moreover, adenoviral vectors containing various deletions of viral genes
15 can be used in an attempt to reduce or eliminate immune responses to the
vector. Such
adenoviruses are E1 deleted, and in addition contain deletions of E2A or E4
(Lusky, M.
et al., J. Virol. 72:2022-2032, 1998; Raper, S.E. et al., Human Gene Therapy
9:671-
679, 1998). In addition, deletion of E2b is reported to reduce immune
responses
(Amalfitano, A. et al., J. Virol. 72:926-933, 1998). Moreover, by deleting the
entire
2 0 adenovirus genome, very large inserts of heterologous DNA can be
accommodated.
Generation of so called "gutless" adenoviruses where all viral genes are
deleted are
particularly advantageous for insertion of large inserts of heterologous DNA.
For
review, see Yeh, P. and Perricaudet, M., FASEB J. 11:615-623, 1997.
The adenovirus system can also be used for protein production in vitro.
2 5 By culturing adenovirus-infected non-293 cells under conditions where the
cells are not
rapidly dividing, the cells can produce proteins for extended periods of time.
For
instance, BHK cells are grown to confluence in cell factories, then exposed to
the
adenoviral vector encoding the secreted protein of interest. The cells are
then grown
under serum-free conditions, which allows infected cells to survive for
several weeks
3 0 without significant cell division. Alternatively, adenovirus vector
infected 293 cells can
be grown as adherent cells or in suspension culture at relatively high cell
density to
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
51
produce significant amounts of protein (See Gamier et al., Cytotechnol. 15:145-
55,
1994). With either protocol, an expressed, secreted heterologous protein can
be
repeatedly isolated from the cell culture supernatant, lysate, or membrane
fractions
depending on the disposition of the expressed protein in the cell. Within the
infected
293 cell production protocol, non-secreted proteins may also be effectively
obtained.
Moreover, the activity and effect of zmsel on tumor progression and
metastasis can be measured in vivo. Several syngeneic mouse models have been
developed to study the influence of polypeptides, compounds or other
treatments on
tumor progression. In these models, tumor cells passaged in culture are
implanted into
mice of the same strain as the tumor donor. The cells will develop into tumors
having
similar characteristics in the recipient mice, and metastasis will also occur
in some of
the models. Appropriate tumor models for our studies include the Lewis lung
carcinoma (ATCC No. CRL-1642) and B 16 melanoma (ATCC No. CRL-6323),
amongst others. These are both commonly used tumor lines, syngeneic to the
C57BL6
mouse, that are readily cultured and manipulated in vitro. Tumors resulting
from
implantation of either of these cell lines are capable of metastasis to the
lung in
C57BL6 mice. The Lewis lung carcinoma model has recently been used in mice to
identify an inhibitor of angiogenesis (O'Reilly MS, et al. Cell 79: 315-
328,1994).
C57BL6/J mice are treated with an experimental agent either through daily
injection of
2 0 recombinant protein, agonist or antagonist or a one time injection of
recombinant
adenovirus. Three days following this treatment, 105 to 106 cells are
implanted under
the dorsal skin. Alternatively, the cells themselves may be infected with
recombinant
adenovirus, such as one expressing zmsel, before implantation so that the
protein is
synthesized at the tumor site or intracellularly, rather than systemically.
The mice
2 5 normally develop visible tumors within 5 days. The tumors are allowed to
grow for a
period of up to 3 weeks, during which time they may reach a size of 1500 -
1800 mm3
in the control treated group. Tumor size and body weight are carefully
monitored
throughout the experiment. At the time of sacrifice, the tumor is removed and
weighed
along with the lungs and the liver. The lung weight has been shown to.
correlate well
3 0 with metastatic tumor burden. As an additional measure, lung surface
metastases are
counted. The resected tumor, lungs and liver are prepared for
histopathological
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
52
examination, immunohistochemistry, and in situ hybridization, using methods
known in
the art and described herein. The influence of the expressed polypeptide in
question,
e.g., zmsel, on the ability of the tumor to recruit vasculature and undergo
metastasis
can thus be assessed. In addition, aside from using adenovirus, the implanted
cells can
. be transiently transfected with zmse 1. Use of stable zmse 1 transfectants
as well as use
of induceable promoters to activate zmsel expression in vivo are known in the
art and
can be used in this system to assess zmsel induction of metastasis. For
general
reference see, O'Reilly MS, et al. Cell 79:315-328, 1994; and Rusciano D, et
al.
Murine Models of Liver Metastasis. Invasion Metastasis 14:349-361, 1995.
The activation of zmsel polypeptide can be measured by a silicon-based
biosensor microphysiometer which measures the extracellular acidification rate
or
proton excretion associated with zmsel activation and subsequent physiologic
cellular
responses. An exemplary device is the CytosensorT"' Microphysiometer
manufactured
by Molecular Devices, Sunnyvale, CA. A variety of cellular responses, such as
cell
proliferation, signal transduction, ion transport, energy production,
inflammatory
response, regulatory and receptor activation, and the like, can be measured by
this
method. See, for example, McConnell, H.M. et al., Science 257:1906-1912, 1992;
Pitchford, S. et al., Meth. Enz.~ 228:84-108, 1997; Arimilli, S. et al., J.
Iminunol.
Meth. 212:49-59, 1998; Van Liefde, I. Et al., Eur. J. Pharmacol. 346:87-95,
1998. The
2 0 microphysiometer can be used for assaying adherent or non-adherent
eukaryotic or
prokaryotic cells. By measuring extracellular acidification changes in cell
media over
time, the microphysiometer directly measures cellular responses to various
stimuli,
including agonists, ligands, or antagonists of the zmsel polypeptide.
Preferably, the
microphysiometer is used to measure responses of a zmsel-expressing eukaryotic
cell,
2 5 compared to a control eukaryotic cell that does not express zmse 1
polypeptide. Zmse 1-
expressing eukaryotic cells comprise cells into which zmsel has been
transfected, as
described herein, creating a cell that is responsive to zmsel-modulating
stimuli; or cells
naturally expressing zmsel. Differences, measured by a change in extracellular
acidification, for example, an increase or diminution in the response of cells
expressing
30 zmsel, relative to a control, are a direct measurement of zmsel-modulated
cellular
responses. Moreover, such zmsel-modulated responses can be assayed under a
variety
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
53
of stimuli. Also, using the microphysiometer, there is provided a method of
identifying
agonists and antagonists of zmsel polypeptide, comprising providing cells
expressing a
zmse 1 polypeptide, culturing a first portion of the cells in the absence of a
test
compound, culturing a second portion of the cells in the presence of a test
compound,
and detecting a change, for example, an increase or diminution, in a cellular
response of
the second portion of the cells as compared to the first portion of the cells.
The change
in cellular response is shown as a measurable change extracellular
acidification rate.
Antagonists and agonists, including the natural effectors or binding partners
of zmsel
polypeptide, can be rapidly identified using this method.
In view of the protein family of which zmsel is a member, agonists
(including the natural ligand/ substrate/ cofactor/ etc.) and antagonists have
enormous
potential in both in vitro and in vivo applications. Compounds identified as
zmsel
agonists and antagonists are useful for modulating tumor cell motility,
invasion, and
metastasis, modulating actin polymerization and cytoskeletal reorganization,
gene
transcription, modulating contractility of various tissues as described
herein,
modulating proliferation (e.g., of cancerous cells), modulating digestion,
modulating
heart conditions, modulating testicular function and fertility, and the like
in vitro and in
vivo. For example, zmsel and agonist or antagonist compounds are useful as
components of defined cell culture media, and may be used alone or in
combination
2 0 with other cytokines and hormones to replace serum that is commonly used
in cell
culture. Agonists or antagonists are thus useful in specifically promoting the
growth
and/or development of cell lineages in culture. Alternatively, zmse 1
polypeptides and
zmsel agonist or antagonist polypeptides are useful as a research reagent,
such as for
the expansion of cell lines, or useful as an amino acid source for cell
culture.
2 5 The activity of molecules of the present invention can be measured using
a variety of assays that measure proliferation and/or differentiation of
specific cell
types, chemotaxis, adhesion, changes in ion channel influx, pH flux,
regulation of
second messenger levels and neurotransmitter release, cell motility, protein
binding,
apoptosis, or the like. Such assays are well known in the art. See, for
example, in
3 0 "Basic & Clinical Endocrinology Ser., Vol. 3," Cytochemical Bioassays:
Techniques &
Applications, Chayen; Chayen, Bitensky, eds., Dekker, New York, 1983.
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
54
The activity of molecules of the present invention can also be measured
using a variety of assays that measure, for example, signal transduction upon
binding a
ligand or substrate, or antibody binding to the outside of an intact cell and
stimulating
the signal transduction pathway of zmse 1. For example, zmse 1 polypeptides,
complementary binding polypeptides, or anti-zmsel antibodies can be labeled
and
tested for specific and saturating binding to specific substrates, cell lines
or cells.
Identification of positive cells to which zmsel polypeptides, complementary
binding
polypeptides, or anti-zmsel antibodies binds can be achieved by injecting a
radioactively or fluorescently-labeled zmse 1 polypeptide, polypeptide
fragments,
complementary binding polypeptides, or anti-zmse 1 antibodies and using art-
recognized immunohistochemistry methods to visualize a cell or tissue in vivo
where
zmsel binds or is expressed. After identification of bound positive cells,
activity can be
tested for zmsel-mediated activation of a signal transduction pathway using
methods
known in the art. For instance, vector constructs containing a reporter (e.g.
SRE-
luciferase, STAT-luciferase, thyroid hormone response element (THRE)-
luciferase,
SV40 promoter-luciferase or the like) can be introduced into the positive cell
lines
expressing zmsel; such cell lines, when exposed to conditioned media
containing
secreted zmsel activating proteins will demonstrate zmsel-mediated signal
transduction activity through activation of the measurable reporter. Such
assays are
2 0 well known in the art. Specific assays include, but are not limited to,
bioassays
measuring signal transduction.
The activity of molecules of the present invention can also be measured
using a variety of assays that measure, for example, cell motility, adhesion
and invasion
in vitro and metastasis in vivo. Such assays are known in the art. For
example, motility
2 5 assays in NIH 3T3 cells, mouse keratinocytes, and epithelial cells are
described in
Takiashi, K. et al., Mol. Cell Biol. 13:72-79, 1993; Takiashi, K. et al.,
Onco~ene 5:273-
278, 1994; Ridley, A.J. et al., Mol. Cell Biol. 15:1110-1122, 1995; and Keely,
P.J. et
al., Nature 360:632-636, 1997. For review and application of in vitro invasion
assays;
for example, using hepatoma or lymphoma cells invasion through mesothelial or
3 0 fibroblast cell monolayers, phagokenesis and wound healing assays. For
example, see
Yoshioka, K. et al., FEBS Lett. 372:25-28, 1995; Wang, W.Z., and Ron D.
Science
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
272:1347-1349, 1996; Habets, G. Cell 77:537-549, 1994; and Michiels, F. et
al., Nature
375:338-340, 1995; Michiels, F. and Collard, J.G., Biochem. Soc. Symp. 65:215-
146,
1999; and Keely, P.J. su ra.. Moreover, in vivo metastasis assays can be used
to assess
zmsel polypeptide, expression, agonist or antagonist activity in vivo in mice
5 (Verschueren, H. Eur. J. Cell Biol. 73:182-187, 1997). Cell adhesion can be
assessed
by the adherence or non-adherence of normally adherent cell lines to cell
culture dishes,
amongst other assays known in the art.
Moreover, the activity of molecules of the present invention can also be
measured using a variety of assays that measure cytoskeletal reorganization.
Such
10 assays are well known in the art. For example, effects of zmsel on membrane
ruffling
can be assessed in Swiss 3T3 cells (Ridley, A.J. Cell 70:401-410, 1992). Actin
polymerization and cytoskeletal rearrangement including assessment of actin
stress
fibers, focal complexes, lamellipodia and filopodia, can be assessed by
various means
including immunofluorescence, and time-lapse imaging amongst other known
methods
15 (Symons, M. et al., Cell 84:723-734, 1996; Nobes, C.D., and Hall, A., Cell
81:53-62,
1995; Burbelo, P.D. et al., Proc. Natl. Acad. Sci. USA 96:9083-9088, 1999;
Aspenstrom, P. Exper. Cell. Res. 246:20-25, 1999; Gallo, G., and Letourneau,
P.C.,
Current Biol. 8:880-R82, 1998; and Miki, H. et al., Nature 391:93-96, 1998).
Moreover, the activity of molecules of the present invention can also be
2 0 measured using a variety of assays that measure protein binding. For
example, the
zmsel polypeptides of the present invention can be assessed for their ability
to bind
Rho family proteins, such as Cdc42, Rac and Rho, in filter binding assays with
GST-
rhoGAP as a positive control (Burbelo, P.D. et al., J. Biol. Chem. 270:29071-
29074,
1995; and Lancaster, C.A. et al., J. Biol. Chem. 269:1137-1142, 1994.
Moreover,
2 5 guanine nucleotide dependence of such binding can also be determined using
a
glutathione-agarose bead assay or other method known in the art (for example,
see
Burbelo, P.D. et al., supra.; and Burbelo, P.D. et al., Proc. Natl. Acad. Sci.
USA
96:9083-9088, 1999). Moreover, GTP hydrolysis can be measured as a product of
zmasel activity. Such assays are known in the art.
30 Zmsel can also be used to identify modulators (e.g, agonists or
antagonists) of its activity. Test compounds are added to the assays disclosed
herein. to
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
56
identify compounds that inhibit or stimulate the activity of zmsel. In
addition to those
assays disclosed herein, samples can be tested for inhibition/stimulation of
zmsel
activity within a variety of assays designed to measure zmsel binding,
dimerization,
heterodimerization, DNA binding or the stimulation/inhibition of zmsel-
dependent
cellular responses. For example, zmsel-expressing cell lines can be
transfected with a
reporter gene construct that is responsive to a zmsel-stimulated cellular
pathway.
Reporter gene constructs of this type are known in the art, and will generally
comprise a
zmsel-DNA response element operably linked to a gene encoding an assay
detectable
protein, such as luciferase. DNA response elements can include, but are not
limited to,
cyclic AMP response elements (CRE), hormone response elements (HRE) insulin
response element (IRE) (Nasrin et al., Proc. Natl. Acad. Sci. USA 87:5273-7,
1990) and
serum response elements (SRE) (Shaw et al. Cell 56: 563-72, 1989). Cyclic AMP
response elements are reviewed in Roestler et al., J. Biol. Chem. 263:9063-6;
1988 and
Habener, Molec. Endocrinol. 4:1087-94; 1990. Hormone response elements are
reviewed in Beato, Cell 56:335-44; 1989. Candidate compounds, solutions,
mixtures or
extracts or conditioned media from various cell types are tested for the
ability to
enhance the activity of zmsel signal transduction as evidenced by an increase
in zmsel
stimulation of reporter gene expression. Assays of this type will detect
compounds that
directly stimulate zmsel signal transduction activity through binding the
upstream
receptor or by otherwise stimulating part of the signal cascade in which zmsel
is
involved. As such, there is provided a method of identifying agonists of zmsel
polypeptide, comprising providing cells expressing zmsel responsive to a zmsel
pathway, culturing a first portion of the cells in the absence of a test
compound,
culturing a second portion of the cells in the presence of a test compound,
and detecting
2 5 a increase in a cellular response of the second portion of the cells as
compared to the
first portion of the cells. Moreover a third cell, containing the reporter
gene construct
described above, but not expressing zmsel polypeptide, can be used as a
control cell to
assess non-specific, or non-zmsel-mediated, stimulation of the reporter.
Agonists are
useful to stimulate or increase zmse 1 polypeptide function.
3 0 Moreover, 'compounds or other samples can be tested for direct blocking
of zmsel binding to another protein or substrate, e.g., a heterodimer
described below,
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
57
using zmsel tagged with a detectable label (e.g., ~25I, biotin, horseradish
peroxidase,
FITC, and the like). Within assays of this type, the ability of a test sample
to inhibit the
binding of labeled zmsel to the other protein or substrate is indicative of
inhibitory
activity, which can be confirmed through secondary assays. Proteins used
within
binding assays may be cellular proteins or isolated, immobilized proteins.
Zmse 1 activation can be detected by: ( 1 ) measurement of adenylate
cyclase activity (Salomon et al., Anal. Biochem. 58:541-48, 1974; Alvarez and
Daniels,
Anal. Biochem. 187:98-103, 1990); (2) measurement of change in intracellular
cAMP
levels using conventional radioimmunoassay methods (Steiner et al., J. Biol.
Chem.
247:1106-13, 1972; Harper and Brooker, J. Cyc. Nucl. Res. 1:207-18, 1975); or
(3)
through use of a cAMP scintillation proximity assay (SPA) method (Amersham
Corp.,
Arlington Heights, IL). These methods provide sensitivity and accuracy.
An alternative assay system involves selection of polypeptides that are
able to induce expression of a cyclic AMP response element (CRE)-luciferase
reporter
gene, as a consequence of elevated cAMP levels, in cells expressing a zmsel
polypeptide, but not in cells lacking zmsel expression, analogous to such
assays
employing calcitonin receptor as described in U.S. patent No. 5,622,839, U.S.
Patent
No. 5,674,689, and U.S. patent No. 5,674,981.
In addition, polypeptides of the present invention can be assayed and
used for their ability to modify inflammation. As zmsel may induce cell
migration
and/or affect contractility in tissues, it may be involved in migration of
inflammatory
cells. Methods to determine proinflammatory and anti-inflammatory qualities of
zmsel
polypeptide, its agonists or antagonists, are known in the art and discussed
herein. For
example, suppression of cAMP production is an indication of anti-inflammatory
effects
(Nihei, Y., et al., Arch. Dermatol. Res., 287:546-552, 1995). Suppression of
cAMP and
inhibition of ICAM and HLA-Dr induced by IFN-y in keratinocytes can be used to
assess inhibition of inflammation. Alternatively, enhancement of cAMP
production
and induction of ICAM and HLA-Dr in this system can be an measurement of
proinflammatory effects of a protein. As a member of a signal transduction
cascade,
3 0 zmsel, likewise can exhibit similar inflammatory effects, and may exert
these effects in
tissues in which it is expressed, or indirectly in other tissues. For example,
zmsel is
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
58
expressed in the heart and skeletal muscle, and can be useful in promoting
wound
healing in this tissue, or exhibit anti-bacterial or anti-viral effects.
Moreover, zmsel, its
agonists or antagonists can be useful in treatment of inflammatory heart or
cardiovascular conditions, muscle inflammation, inflammation during and after
surgery,
arthritis, asthma, inflammatory bowel disease, diverticulitis, and the like.
Moreover,
direct measurement of zmsel polypeptide and anti-zmsel antibodies can be
useful in
diagnosing inflammatory diseases such as reperfusion ischemia, inflammatory
bowel
disease, diverticulitis, asthma, pelvic inflammatory disease (PID), psoriasis,
arthritis,
melanoma, and other inflammatory diseases. Moreover zmsel antagonists can be
useful in treatment of myocarditis, atherosclerosis, pelvic inflammatory
disease, (PID),
psoriasis, arthritis, eczema, scleroderma, and other inflammatory diseases.
As such, zmsel polypeptide, agonists or its antagonists, have potential
uses in inflammatory diseases such as asthma and arthritis. For example, if
zmsel is
proinflammatory, antagonists would be valuable in asthma therapy or other anti-
inflammatory therapies where migration of lymphocytes is damaging. In
addition,
zmsel can serve other important roles in lung function, for instance,
bronchodilation,
tissue elasticity, recruitment of lymphocytes in lung infection and damage.
Assays to
assess the activity of zmsel in lung cells are discussed in Laberge, S. et
al., Am. J.
Respir. Cell Mol. Biol. 17:193-202, 1997; Rumsaeng, V. et al., J. Immunol.,
159:2904-
2 0 2910, 1997; and Schluesener, H.J. et al., J. Neurosci. Res. 44:606-611,
1996. Methods
to determine proinflammatory and antiinflammatory qualities of zmsel its
agonists or
its antagonists are known in the art. Moreover, other molecular biological,
immunological, and biochemical techniques known in the art and disclosed
herein can
be used to determine zmsel activity and to isolate agonists and antagonists.
2 5 The activity of molecules of the present invention may be measured
using a variety of assays that, for example, measure neogenesis or hyperplasia
(i.e.,
proliferation) of cardiac or other cells based on the potential effects of
activity of zmse 1
in those tissues. Additional activities likely associated with the
polypeptides of the
present invention include proliferation of endothelial cells, cardiomyocytes,
fibroblasts,
3 0 skeletal myocytes directly or indirectly through other growth factors;
action as a
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
59
chemotaxic factor for endothelial cells, fibroblasts and/or phagocytic cells;
osteogenic
factor; and factor for expanding mesenchymal stem cell and precursor
populations.
Proliferation can be measured in vitro using cultured cells or in vivo by
administering molecules of the present invention to the appropriate animal
model.
Generally, proliferative effects are seen as an increase in cell number, and
may include
inhibition of apoptosis as well as stimulation of mitogenesis. Cultured cells
for use in
these assays include cardiac fibroblasts, cardiac myocytes, skeletal myocytes,
and
human umbilical vein endothelial cells from primary cultures, among other cell
types.
Suitable established cell lines include: NIH 3T3 fibroblasts (ATCC No. CRL-
1658),
CHH-1 chum heart cells (ATCC No. CRL-1680), H9c2 rat heart myoblasts (ATCC No.
CRL-1446), Shionogi mammary carcinoma cells (Tanaka et al., Proc. Natl. Acad.
Sci.
89:8928-8932, 1992), and LNCap.FGC adenocarcinoma cells (ATCC No. CRL-1740.)
Assays measuring cell proliferation are well known in the art. For example,
assays
measuring proliferation include such assays as chemosensitivity to neutral red
dye
(Cavanaugh et al., Investi~ational New Dru:g_s 8:347-354, 1990), incorporation
of
radiolabeled nucleotides (Cook et al., Analytical Biochem. 179:1-7, 1989),
incorporation of 5-bromo-2'-deoxyuridine (BrdU) in the DNA of proliferating
cells
(Porstmann et al., J. Immunol. Methods 82:169-179, 1985), and use of
tetrazolium salts
(Mosmann, J. Immunol. Methods 65:55-63, 1983; Alley et al., Cancer Res. 48:589-
601,
2 0 1988; Marshall et al., Growth Rep. 5:69-84, 1995; and Scudiero et al.,
Cancer Res.
48:4827-4833, 1988).
Differentiation is a progressive and dynamic process, beginning with
pluripotent stem cells and ending with terminally differentiated cells.
Pluripotent stem
cells that can regenerate without commitment to a lineage express a set of
2 5 differentiation markers that are lost when commitment to a cell lineage is
made.
Progenitor cells express a set of differentiation markers that may or may not
continue to
be expressed as the cells progress down the cell lineage pathway toward
maturation.
Differentiation markers that are expressed exclusively by mature cells are
usually
functional properties such as cell products, enzymes to produce cell products,
and
3 0 receptors. The stage of a cell population's differentiation is monitored
by identification
of markers present in the cell population. Myocytes, osteoblasts, adipocytes,
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
chrondrocytes, fibroblasts and reticular cells are believed to originate from
a common
mesenchymal stem cell (Owen et al., Ciba Fdn. Sym~ 136:42-46, 1988). Markers
for
mesenchymal stem cells have not been well identified (Owen et al., J. of Cell
Sci.
87:731-738, 1987), so identification is usually made at the progenitor and
mature cell
5 stages. The novel polypeptides of the present invention may be useful for
studies to
isolate mesenchymal stem cells and myocyte or other progenitor cells, both in
vivo and
ex vivo.
There is evidence to suggest that factors that stimulate specific cell types
down a pathway towards terminal differentiation or dedifferentiation affect
the entire
10 cell population originating from a common precursor or stem cell. Thus, the
present
invention includes stimulating or inhibiting the proliferation of myocytes,
smooth
muscle cells, osteoblasts, adipocytes, chrondrocytes and endothelial cells.
Molecules of
the present invention for example, may while stimulating proliferation or
differentiation
of cardiac myocytes, inhibit proliferation or differentiation of adipocytes,
by virtue of
15 the affect on their common precursor/stem cells. Thus molecules of the
present
invention may have use in inhibiting chondrosarcomas, atherosclerosis,
restenosis and
obesity.
Assays measuring differentiation include, for example, measuring cell
markers associated with stage-specific expression of a tissue, enzymatic
activity,
2 0 functional activity or morphological changes (Watt, FASEB, 5:281-284,
1991; Francis,
Differentiation 57:63-75, 1994; Raes, Adv. Anim. Cell Biol. Technol.
Bioprocesses,
161-171, 1989; all incorporated herein by reference). Alternatively, zmsel
polypeptide
itself can serve as an additional cell-surface marker associated with stage-
specific
expression of a tissue. As such, direct measurement of zmsel polypeptide, or
its loss of
2 5 expression in a tissue as it differentiates, can serve as a marker for
differentiation of
tissues.
Similarly, direct measurement of zmsel polypeptide, or its loss of
expression in a tissue can be determined in a tissue or cells as they undergo
tumor
progression. As the Ras and Rho family, and their effectors are involved with
increases
3 0 in invasiveness and motility of cells, the gain or loss of expression of
zmesl in a pre-
cancerous or cancerous condition, in comparison to normal tissue, can serve as
a
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
61
diagnostic for transformation, invasion and metastasis in tumor progression.
As such,
knowledge of a tumor's stage of progression or metastasis will aid the
physician in
choosing the most proper therapy, or aggressiveness of treatment, for a given
individual
cancer patient. Methods of measuring gain and loss of expression (of either
mRNA or
protein) are well known in the art and described herein and can be applied to
zmsel
expression. For example, appearance or disappearance of polypeptides that
regulate
cell motility can be used to aid diagnosis and prognosis of prostate cancer
(Banyard, J.
and Zetter, B.R., Cancer and Metast. Rev. 17:449-458, 1999). As an effector of
cell
motility, zmsel gain or loss of expression may serve as a diagnostic for
prostate and
other cancers.
Zmsel can also be used to identify inhibitors (antagonists) of its activity.
Test compounds are added to the assays disclosed herein to identify compounds
that
inhibit the activity of zmsel. In addition to those assays disclosed herein,
samples can
be tested for inhibition of zmsel activity within a variety of assays designed
to measure
receptor binding or the stimulation/inhibition of zmsel-dependent cellular
responses.
For example, zmsel-expressing cell lines can be transfected with a reporter
gene
construct that is responsive to a zmsel-stimulated cellular pathway. Reporter
gene
constructs of this type are known in the art, and will generally comprise a
zmsel-DNA
response element operably linked to a gene encoding an assayable protein, such
as
2 0 luciferase. DNA response elements can include, but are not limited to,
cyclic AMP
response elements (CRE), hormone response elements (HRE) insulin response
element
(IRE) (Nasrin et al., Proc. Natl. Acad. Sci. USA 87:5273-7, 1990) and serum
response
elements (SRE) (Shaw et al. Cell 56: 563-72, 1989). Cyclic AMP response
elements
are reviewed in Roestler et al., J. Biol. Chem. 263:9063-6; 1988 and Habener,
Molec.
2 5 Endocrinol. 4:1087-94; 1990. Hormone response elements are reviewed in
Beato, Cell
56:335-44; 1989. Candidate compounds, solutions, mixtures or extracts are
tested for
the ability to inhibit the activity of zmsel on the target cells as evidenced
by a decrease
in zmsel stimulation of reporter gene expression. Assays of this type will
detect
compounds that directly block effectors that bind zmsel (or proteins to which
zmsel is
3 0 an effector), as well as compounds that block processes in the cellular
pathway
upstream or subsequent to receptor-ligand binding. In the alternative,
compounds or
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
62
other samples can be tested for direct blocking of zmsel binding to receptor
using
zmsel tagged with a detectable label (e.g., ~25I, biotin, horseradish
peroxidase, FITC,
and the like). Within assays of this type, the ability of a test sample to
inhibit the
binding of labeled zmsel to the receptor is indicative of inhibitory activity,
which can
be confirmed through secondary assays. Receptors used within binding assays
may be
cellular receptors or isolated, immobilized receptors.
A role for zmsel in the induction of cell motility suggests a role in
spermatogenesis, a process that is remarkably similar to the development of
blood cells
(hematopoiesis). Briefly, spermatogonia undergo a maturation process similar
to the
differentiation of hematopoietic stem cells. Moreover, in view of cell
motility effects,
zmsel polypeptides, agonists and antagonists have enormous potential in both
in vitro
and in vivo applications. For example, cell motility and polypeptides
associated
therewith have been implicated as a critical determinants in prostate cancer
metastasis
(Banyard, J. and Zetter, B.R., Cancer and Metast. Rev. 17:449-458, 1999). As
an
effector of cell motility, zmsel may serve as a diagnostic for such cancers,
and
zmselpolypeptides, agonists and antagonists have therapeutic potential to
treat such
diseases. Zmsel polypeptides, agonists and antagonists may also prove useful
in
modulating spermatogenesis and thus aid in overcoming infertility, or as
therapeutics or
diagnostics for male reproductive cancers such as prostate and testicular
cancers.
2 0 Antagonists are useful as research reagents for characterizing sites of
ligand-receptor
interaction. In vivo, zmsel polypeptides, agonists or antagonists may find
application
in the treatment of male infertility, reproductive cancers, or as a male
contraceptive
agents.
The zmsel polypeptides, antagonists of agonists, of the present
2 5 invention can also modulate sperm capacitation. Before reaching the oocyte
or egg and
initiating an egg-sperm interaction, the sperm must be activated. The sperm
undergo a
gradual capacitation, lasting up to 3 or 4 hours in vitro, during which the
plasma
membrane of the sperm head and the outer acrosomal membrane fuse to form
vesicles
that facilitate the release of acrosomal enzymes. The acrosomal membrane
surrounds
3 0 the acrosome or acrosomal cap which is located at the anterior end of the
nucleus in the
sperm head. In order for the sperm to fertilize egg the sperm must penetrate
the oocyte.
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
63
To enable this process the sperm must undergo acrosomal exocytosis, also known
as the
acrosomal reaction, and release the acrosomal enzymes in the vicinity of the
oocyte.
These enzymes enable the sperm to penetrate the various oocyte layers, (the
cumulus
oophorus, the corona radiata and the zona pellucida). The released acrosomal
enzymes
include hyaluronidase and proacrosin, in addition to other enzymes such as
proteases.
During the acrosomal reaction, proacrosin is converted to acrosin, the active
form of the
enzyme, which is required for and must occur before binding and penetration of
the
zona pellucida is possible. A combination of the acrosomal lytic enzymes and
sperm
tail movements allow the sperm to penetrate the oocyte layers. Numerous sperm
must
reach the egg and release acrosomal enzymes before the egg can finally be
fertilized.
Only one sperm will successfully bind to, penetrate and fertilize the egg,
after which the
zona hardens so that no other sperm can penetrate the egg (Zaneveld, in Male
Infertility
Chapter 11, Comhaire (Ed.), Chapman & Hall, London, 1996). Peptide hormones,
such
as insulin homologs are associated with sperm activation and egg-sperm
interaction.
For instance, capacitated sperm incubated with relaxin show an increased
percentage of
progressively motile sperm, increased zona penetration rates, and increased
percentage
of viable acrosome-reacted sperm (Carrell et al., Endocr. Res. 21:697-707,
1995).
Similarity of the zmsel polypeptide structure to signal transduction molecules
and the
potential of zmsel effects on indirectly effecting cell-cell interaction in
the testis,
prostate and uterus suggests that the zmsel polypeptides described herein play
a role in
these and other reproductive processes.
Accordingly, proteins of the present invention can have applications in
enhancing fertilization during assisted reproduction in humans and in animals.
Such
assisted reproduction methods are known in the art and include artificial
insemination,
2 5 in vitro fertilization, embryo transfer and gamete intrafallopian
transfer. Such methods
are useful for assisting men and women who have physiological or metabolic
disorders
preventing natural conception or can be used to enhance in vitro
fertilization. Such
methods are also used in animal breeding programs, such as for livestock
breeding and
could be used as methods for the creation of transgenic animals. Proteins of
the present
3 0 invention can be combined with sperm, an egg or an egg-sperm mixture prior
to
fertilization of the egg. In some species, sperm capacitate spontaneously
during in vitro
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
64
fertilization procedures, but normally sperm capacitate over an extended
period of time
both in vivo and in vitro. It is advantageous to increase sperm activation
during such
procedures to enhance the likelihood of successful fertilization. The washed
sperm or
sperm removed from the seminal plasma used in such assisted reproduction
methods
has been shown to have altered reproductive functions, in particular, reduced
motility
and zona interaction. To enhance fertilization during assisted reproduction
methods
sperm is capacitated using exogenously added compounds. Suspension of the
sperm in
seminal plasma from normal subjects or in a "capacitation media" containing a
cocktail
of compounds known to activate sperm, such as caffeine, dibutyl cyclic
adenosine
monophosphate (dbcAMP) or theophylline, have resulted in improved reproductive
function of the sperm, in particular, sperm motility and zonae penetration
(Park et al.,
Am. J. Obstet. Gynecol. 158:974-9, 1988; Vandevoort et al., Mol. Repro.
Develop.
37:299-304, 1993; Vandevoort and Overstreet, J. Androl. 16:327-33, 1995). The
presence of immunoreactive relaxin in vivo and in association with
cryopreserved
semen, was shown to significantly increase sperm motility (Juang et al., Anim.
Reprod.
Sci. 20:21-9, 1989; Juang et al., Anim. Reprod. Sci. 22:47-53, 1990). Porcine
relaxin
stimulated sperm motility in cryopreserved human sperm (Colon et al., Fertil.
Steril.
46:1133-39, 1986; Lessing et al., Fertil. Steril. 44:406-9, 1985) and
preserved ability of
washed human sperm to penetrate cervical mucus in vitro (Brenner et al.,
Fertil. Steril.
2 0 42:92-6, 1984). Polypeptides of the present invention can used in such
methods to
enhance viability of cryopreserved sperm, enhance sperm motility and enhance
fertilization, particularly in association with methods of assisted
reproduction.
A zmsel polypeptide can be expressed as a fusion with an
immunoglobulin heavy chain constant region, typically an Fc fragment, which
contains
2 5 two constant region domains and lacks the variable region. Methods for
preparing such
fusions are disclosed in U.S. Patents Nos. 5,155,027 and 5,567,584. Such
fusions are
typically secreted as multimeric molecules wherein the Fc portions are
disulfide bonded
to each other and two non-Ig polypeptides are arrayed in closed proximity to
each other.
Fusions of this type can be used to affinity purify ligand or binding
partners, as an in
3 0 vitro assay tool, or a zmse 1 ligand antagonist. For use in assays, the
chimeras are
bound to a support via the Fc region and used in an ELISA format.
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
A zmsel polypeptide can also be used for purification of ligand,
biomolecular substrates, or other proteins or antibodies that bind it. The
zmsel
polypeptide or a polypeptide fragment containing the zmsel CRIB motif can be
used.
The polypeptide is immobilized on a solid support, such as beads of agarose,
cross-
5 linked agarose, glass, cellulosic resins, silica-based resins, polystyrene,
cross-linked
polyacrylamide, or like materials that are stable under the conditions of use.
Methods
for linking polypeptides to solid supports are known in the art, and include
amine
chemistry, cyanogen bromide activation, N-hydroxysuccinimide activation,
epoxide
activation, sulfhydryl activation, and hydrazide activation. The resulting
medium will
10 generally be configured in the form of a column, and fluids containing
ligand, cell
lysates, membrane preparations, or lipid preparations, are passed through the
column
one or more times to allow ligand to bind to the receptor polypeptide. The
ligand is
then eluted using changes in salt concentration, chaotropic agents (guanidine
HCl), or
pH to disrupt ligand-receptor binding.
15 An assay system that uses a ligand-binding receptor (or an antibody, one
member of a complement/ anti-complement pair) or a binding fragment thereof,
and a
commercially available biosensor instrument (BIAcore, Pharmacia Biosensor,
Piscataway, NJ) may be advantageously employed. Such receptor, antibody,
member of
a complement/anti-complement pair or fragment is immobilized onto the surface
of a
2 o receptor chip. Use of this instrument is disclosed by Karlsson, J.
Immunol. Methods
145:229-40, 1991 and Cunningham and Wells, J. Mol. Biol. 234:554-63, 1993. A
receptor, antibody, member or fragment is covalently attached, using amine or
sulfhydryl chemistry, to dextran fibers that are attached to gold film within
the flow
cell. A test sample is passed through the cell. If a ligand, epitope, or
opposite member
25 of the complement/anti-complement pair is present in the sample, it will
bind to the
immobilized receptor, antibody or member, respectively, causing a change in
the
refractive index of the medium, which is detected as a change in surface
plasmon
resonance of the gold film. This system allows the determination of on- and
off-rates,
from which binding affinity can be calculated, and assessment of stoichiometry
of
3 0 binding.
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
66
Ligand-binding receptor polypeptides can also be used within other
assay systems known in the art. Such systems include Scatchard analysis for
determination of binding affinity (see Scatchard, Ann. NY Acad. Sci. 51: 660-
72, 1949)
and calorimetric assays (Cunningham et al., Science 253:545-48, 1991;
Cunningham et
al., Science 245:821-25, 1991).
Zmsel polypeptides can also be used to prepare antibodies that bind to
zmsel epitopes, peptides or polypeptides. The zmsel polypeptide or a fragment
thereof
serves as an antigen (immunogen) to inoculate an animal and elicit an immune
response. One of skill in the art would recognize that antigenic, epitope-
bearing
polypeptides contain a sequence of at least 6, preferably at least 9, and more
preferably
at least 15 to about 30 contiguous amino acid residues of a zmsel polypeptide
(e.g.,
SEQ m N0:2). Polypeptides comprising a larger portion of a zmsel polypeptide,
i.e.,
from 30 to 10 residues up to the entire length of the amino acid sequence are
included.
Antigens or immunogenic epitopes can also include attached tags, adjuvants and
carriers, as described herein. Suitable antigens include the zmsel polypeptide
encoded
by SEQ >D N0:2 from amino acid number 1 (Met) to amino acid number 356 (Val),
or
a contiguous 13 to 343 amino acid fragment thereof. Other suitable antigens
include the
CRIB motif, N-terminal domain, variable C-terminal domain, and C-terminal tail
as
2 0 disclosed herein. Preferred peptides to use as antigens are hydrophilic
peptides such as
those predicted by one of skill in the art from a hydrophobicity plot,
determined, for
example, from a Hopp/Woods hydrophilicity profile based on a sliding six-
residue
window, with buried G, S, and T residues and exposed H, Y, and W residues
ignored
(See, Figure 1). Zmsel hydrophilic peptides include peptides comprising amino
acid
2 5 sequences selected from the group consisting of: ( 1 ) amino acid number
96 (Glu) to
amino acid number 101 (Asp) of SEQ ID N0:2; (2) amino acid number 226 (Asp) to
amino acid number 231 (Asp) of SEQ >D N0:2; (3) amino acid number 346 (Met) to
amino acid number 351 (Glu) of SEQ >D N0:2; (4) amino acid number 347 (Asp) to
amino acid number 352 (Asp) of SEQ >D N0:2; and (5) amino acid number 348
(Glu)
3 0 to amino acid number 353 (Glu) of SEQ >D N0:2. Antibodies from an immune
response generated by inoculation of an animal with these antigens can be
isolated and
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
67
purified as described herein. Methods for preparing and isolating polyclonal
and
monoclonal antibodies are well known in the art. See, for example, Current
Protocols
in Immunolo~y, Cooligan, et al. (eds.), National Institutes of Health, John
Wiley and
Sons, Inc., 1995; Sambrook et al., Molecular Cloning: A Laboratory Manual,
Second
Edition, Cold Spring Harbor, NY, 1989; and Hurrell, J. G. R., Ed., Monoclonal
Hybridoma Antibodies: Techniques and Applications, CRC Press, Inc., Boca
Raton,
FL, 1982.
As would be evident to one of ordinary skill in the art, polyclonal
antibodies can be generated from inoculating a variety of warm-blooded animals
such
as horses, cows, goats, sheep, dogs, chickens, rabbits, mice, and rats with a
zmsel
polypeptide or a fragment thereof. The immunogenicity of a zmsel polypeptide
may be
increased through the use of an adjuvant, such as alum (aluminum hydroxide) or
Freund's complete or incomplete adjuvant. Polypeptides useful for immunization
also
include fusion polypeptides, such as fusions of zmsel or a portion thereof
with an
immunoglobulin polypeptide or with maltose binding protein. The polypeptide
immunogen may be a full-length molecule or a portion thereof. If the
polypeptide
portion is "hapten-like", such portion may be advantageously joined or linked
to a
macromolecular carrier (such as keyhole limpet hemocyanin (KLH), bovine serum
albumin (BSA) or tetanus toxoid) for immunization.
As used herein,-the term "antibodies" includes polyclonal antibodies,
affinity-purified polyclonal antibodies, monoclonal antibodies, and antigen-
binding
fragments, such as F(ab')2 and Fab proteolytic fragments. Genetically
engineered intact
antibodies or fragments, such as chimeric antibodies, Fv fragments, single
chain
antibodies and the like, as well as synthetic antigen-binding peptides and
polypeptides,
2 5 are also included. Non-human antibodies may be humanized by grafting non-
human
CDRs onto human framework and constant regions, or by incorporating the entire
non-
human variable domains (optionally "cloaking" them with a human-like surface
by
replacement of exposed residues, wherein the result is a "veneered" antibody).
In some
instances, humanized antibodies may retain non-human residues within the human
3 0 variable region framework domains to enhance proper binding
characteristics. Through
humanizing antibodies, biological half life may be increased, and the
potential for
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
68
adverse immune reactions upon administration to humans is reduced. Moreover,
human antibodies can be produced in transgenic, non-human animals that have
been
engineered to contain human immunoglobulin genes as disclosed in WIPO
Publication
WO 98/24893. It is preferred that the endogenous immunoglobulin genes in these
animals be inactivated or eliminated, such as by homologous recombination.
Antibodies are considered to be specifically binding if: 1) they exhibit a
threshold level of binding activity, and 2) they do not significantly cross-
react with
known related polypeptide molecules. A threshold level of binding is
determined if
anti-zmse 1 antibodies herein bind to a zmse 1 polypeptide, peptide or epitope
with an
affinity at least 10-fold greater than the binding affinity to control (non-
zmsel)
polypeptide. It is preferred that the antibodies exhibit a binding affinity
(Ka) of 106 M
1 or greater, preferably 107 M 1 or greater, more preferably 108 M 1 or
greater, and
most preferably 109 M 1 or greater. The binding affinity of an antibody can be
readily
determined by one of ordinary skill in the art, for example, by Scatchard
analysis
(Scatchard, G., Ann. NY Acad. Sci. 51: 660-672, 1949).
Whether anti-zmsel antibodies do not significantly cross-react with
known related polypeptide molecules is shown, for example, by the antibody
detecting
zmsel polypeptide but not known related polypeptides using a standard Western
blot
analysis (Ausubel et al., ibid.). Examples of known related polypeptides are
those
2 0 disclosed in the prior art, such as known orthologs, and paralogs, and
similar known
members of a protein family, Screening can also be done using non-human zmsel,
and
zmse 1 mutant polypeptides. Moreover, antibodies can be "screened against"
known
related polypeptides, to isolate a population that specifically binds to the
zmsel
polypeptides. For example, antibodies raised to zmsel are adsorbed to related
polypeptides adhered to insoluble matrix; antibodies specific to zmsel will
flow
through the matrix under the proper buffer conditions. Screening allows
isolation of
polyclonal and monoclonal antibodies non-crossreactive to known closely
related
polypeptides (Antibodies: A Laboratory Manual, Harlow and Lane (eds.), Cold
Spring
Harbor Laboratory Press, 1988; Current Protocols in Immunology, Cooligan, et
al.
3 0 (eds.), National Institutes of Health, John Wiley and Sons, Inc., 1995).
Screening and
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
69
isolation of specific antibodies is well known in the art. See, Fundamental
Immunology, Paul (eds.), Raven Press, 1993; Getzoff et al., Adv. in Immunol.
43: 1-
98, 1988; Monoclonal Antibodies: Principles and Practice, Goding, J.W. (eds.),
Academic Press Ltd., 1996; Benjamin et al., Ann. Rev. Immunol. 2: 67-101,
1984.
Specifically binding anti-zmsel antibodies can be detected by a number of
methods in
the art, and disclosed below.
A variety of assays known to those skilled in the art can be utilized to
detect antibodies which bind to zmsel proteins or polypeptides. Exemplary
assays are
described in detail in Antibodies: A Laboratory Manual, Harlow and Lane
(Eds.), Cold
Spring Harbor Laboratory Press, 1988. Representative examples of such assays
include: concurrent immunoelectrophoresis, radioimmunoassay, radioimmuno-
precipitation, enzyme-linked immunosorbent assay (ELISA), dot blot or Western
blot
assay, inhibition or competition assay, and sandwich assay. In addition,
antibodies can
be screened for binding to wild-type versus mutant zmse 1 protein or
polypeptide.
Alternative techniques for generating or selecting antibodies useful
herein include in vitro exposure of lymphocytes to zmsel protein or peptide,
and
selection of antibody display libraries in phage or similar vectors (for
instance, through
use of immobilized or labeled zmsel protein or peptide). Genes encoding
polypeptides
having potential zmsel polypeptide binding domains can be obtained by
screening
2 0 random peptide libraries displayed on phage (phage display) or on
bacteria, such as E.
coli. Nucleotide sequences encoding the polypeptides can be obtained in a
number of
ways, such as through random mutagenesis and random polynucleotide synthesis.
These random peptide display libraries can be used to screen for peptides
which interact
with a known target which can be a protein or polypeptide, such as a ligand or
receptor,
2 5 a biological or synthetic macromolecule, or organic or inorganic
substances.
Techniques for creating and screening such random peptide display libraries
are known
in the art (Ladner et al., US Patent NO. 5,223,409; Ladner et al., US Patent
NO.
4,946,778; Ladner et al., US Patent NO. 5,403,484 and Ladner et al., US Patent
NO.
5,571,698) and random peptide display libraries and kits for screening such
libraries are
3 0 available commercially, for instance from Clontech (Palo Alto, CA),
Invitrogen Inc.
(San Diego, CA), New England Biolabs, Inc. (Beverly, MA) and Pharmacia LKB
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
Biotechnology Inc. (Piscataway, NJ). Random peptide display libraries can be
screened
using the zmsel sequences disclosed herein to identify proteins which bind to
zmsel.
These "binding polypeptides" which interact with zmsel polypeptides can be
used for
tagging cells; for isolating homolog polypeptides by affinity purification;
they can be
5 directly or indirectly conjugated to drugs, toxins, radionuclides and the
like. These
binding polypeptides can also be used in analytical methods such as for
screening
expression libraries and neutralizing activity, e.g., for blocking interaction
between
ligand and receptor. The binding polypeptides can also be used for diagnostic
assays
for determining circulating levels of zmsel polypeptides; for detecting or
quantitating
10 soluble zmsel polypeptides as marker of underlying pathology or disease.
These
binding polypeptides can also act as zmsel "antagonists" to block zmsel
binding and
signal transduction in vitro and in vivo. These anti-zmsel binding
polypeptides would
be useful for inhibiting zmsel activity or protein-binding.
Antibodies to zmsel may be used for tagging cells that express zmsel;
15 for isolating zmsel by affinity purification; for diagnostic assays for
determining
circulating levels of zmse 1 polypeptides; for detecting or quantitating
soluble zmse 1 as
marker of underlying pathology or disease; in analytical methods employing
FACS; for
screening expression libraries; for generating anti-idiotypic antibodies; and
as
neutralizing antibodies or as antagonists to block zmsel activity in vitro and
in vivo.
2 0 Suitable direct tags or labels include radionuclides, enzymes, substrates,
cofactors,
inhibitors, fluorescent markers, chemiluminescent markers, magnetic particles
and the
like; indirect tags or labels may feature use of biotin-avidin or other
complement/anti-
complement pairs as intermediates. Antibodies herein may also be directly or
indirectly
conjugated to drugs, toxins, radionuclides and the like, and these conjugates
used for in
25 vivo diagnostic or therapeutic applications. Moreover, antibodies to zmsel
or
fragments thereof may be used in vitro to detect denatured zmsel or fragments
thereof
in assays, for example, Western Blots or other assays known in the art.
Antibodies or polypeptides herein can also be directly or indirectly
3 0 conjugated to drugs, toxins, radionuclides and the like, and these
conjugates used for irc
vivo diagnostic or therapeutic applications. For instance, polypeptides or
antibodies of
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
71
the present invention can be used to identify or treat tissues or organs that
express a
corresponding anti-complementary molecule (receptor or antigen, respectively,
for
instance). More specifically, zmsel polypeptides or anti-zmsel antibodies, or
bioactive
fragments or portions thereof, can be coupled to detectable or cytotoxic
molecules and
delivered to a mammal having cells, tissues or organs that express the anti-
complementary molecule.
Suitable detectable molecules may be directly or indirectly attached to
the polypeptide or antibody, and include radionuclides, enzymes, substrates,
cofactors,
inhibitors, fluorescent markers, chemiluminescent markers, magnetic particles
and the
like. Suitable cytotoxic molecules may be directly or indirectly attached to
the
polypeptide or antibody, and include bacterial or plant toxins (for instance,
diphtheria
toxin, Pseudomonas exotoxin, ricin, abrin and the like), as well as
therapeutic
radionuclides, such as iodine-131, rhenium-188 or yttrium-90 (either directly
attached
to the polypeptide or antibody, or indirectly attached through means of a
chelating
moiety, for instance). Polypeptides or antibodies may also be conjugated to
cytotoxic
drugs, such as adriamycin. For indirect attachment of a detectable or
cytotoxic
molecule, the detectable or cytotoxic molecule can be conjugated with a member
of a
complementary/ anticomplementary pair, where the other member is bound to the
polypeptide or antibody portion. For these purposes, biotin/streptavidin is an
2 0 exemplary complementary/ anticomplementary pair.
In another embodiment, polypeptide-toxin fusion proteins or antibody-
toxin fusion proteins can be used for targeted cell or tissue inhibition or
ablation (for
instance, to treat cancer cells or tissues). Alternatively, if the polypeptide
has multiple
functional domains (i.e., an activation domain or a ligand binding domain,
plus a
2 5 targeting domain), a fusion protein including only the targeting domain
may be suitable
for directing a detectable molecule, a cytotoxic molecule or a complementary
molecule
to a cell or tissue type of interest. In instances where the domain only
fusion protein
includes a complementary molecule, the anti-complementary molecule can be
conjugated to a detectable or cytotoxic molecule. Such domain-complementary
3 0 molecule fusion proteins thus represent a generic targeting vehicle for
cell/tissue-
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
72
specific delivery of generic anti-complementary-detectable/ cytotoxic molecule
conjugates.
In another embodiment, zmsel-cytokine fusion proteins or antibody
cytokine fusion proteins can be used for enhancing in vivo killing of target
tissues (for
example, blood, bone marrow or other cancers), if the zmsel polypeptide or
anti-zmsel
antibody targets the hyperproliferative blood or bone marrow cell (See,
generally,
Hornick et al., Blood 89:4437-47, 1997). Hornick et al. described fusion
proteins that
enable targeting of a cytokine to a desired site of action, thereby providing
an elevated
local concentration of cytokine. Suitable zmse 1 polypeptides or anti-zmse 1
antibodies
can target an undesirable cell or tissue (i.e., a tumor or a leukemia), and
the fused
cytokine mediate improved target cell lysis by effector cells. Suitable
cytokines for this
purpose include interleukin 2 and granulocyte-macrophage colony-stimulating
factor
(GM-CSF), for instance.
In yet another embodiment, if the zmse 1 polypeptide or anti- zmse 1
antibody targets vascular cells or tissues, such polypeptide or antibody may
be
conjugated with a radionuclide, and particularly with a beta-emitting
radionuclide, to
reduce restenosis. Such therapeutic approach poses less danger to clinicians
who
administer the radioactive therapy. For instance, iridium-192 impregnated
ribbons
placed into stented vessels of patients until the required radiation dose was
delivered
2 0 showed decreased tissue growth in the vessel and greater luminal diameter
than the
control group, which received placebo ribbons. Further, revascularisation and
stent
thrombosis were significantly lower in the treatment group. Similar results
are
predicted with targeting of a bioactive conjugate containing a radionuclide,
as described
herein.
2 5 The bioactive polypeptide or antibody conjugates described herein can
be delivered intravenously, intraarterially or intraductally, or may be
introduced locally
at the intended site of action.
The polypeptides, antagonists, agonists, nucleic acid antibodies of the
present invention can be used in treatment of disorders associated with
cancer,
3 0 metastasis, vasoconstriction, heart arrhythmia, heart inflammation,
congestive heart
disease, muscle spasms and fatigue, inflammation, testicular function,
fertility, birth
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
73
control, and the like. The molecules of the present invention can be used to
modulate
contractility or inflammation or to treat or prevent development of
pathological
conditions in diverse tissues. In particular, certain syndromes/diseases may
be
amenable to such diagnosis, treatment or prevention.
Diagnostic methods of the present invention involve the detection of
zmsel polypeptides in the serum or tissue biopsy of a patient undergoing
analysis of
heart, spleen, testicular or muscle function or evaluation for possible
cancers. Such
polypeptides can be detected using immunoassay techniques and antibodies,
described
herein, that are capable of recognizing polypeptide epitopes. More
specifically, the
present invention contemplates methods for detecting zmsel polypeptides
comprising:
exposing a test sample potentially containing zmsel polypeptides to an
antibody attached to a solid support, wherein said antibody binds to a first
epitope of a
zmse 1 polypeptide;
washing the immobilized antibody-polypeptide to remove unbound
contaminants;
exposing, the immobilized antibody-polypeptide to a second antibody
directed to a second epitope of a zmsel polypeptide, wherein the second
antibody is
associated with a detectable label; and
detecting the detectable label. Altered levels of zmsel polypeptides in a
2 o test sample, such as serum sweat, saliva, biopsy, tumor biopsy, and the
like, can be
monitored as an indication of heart, spleen, testicular or muscle function or
of cancer,
invasion or metastasis or other disease, when compared against a normal
control.
Additional methods using probes or primers derived, for example, from
the nucleotide sequences disclosed herein can also be used to detect zmsel
expression
2 5 in a patient sample, such as a blood, saliva, sweat, tissue sample, or the
like. For
example, probes can be hybridized to tumor tissues and the hybridized complex
detected by in situ hybridization. Zmsel sequences can also be detected by PCR
amplification using cDNA generated by reverse translation of sample mRNA as a
template (PCR Primer A Laboratory Manual, Dieffenbach and Dveksler, eds., Cold
3 0 Spring Harbor Press, 1995). When compared with a normal control, both
increases or
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
74
decreases of zmsel expression in a patient sample, relative to that of a
control, can be
monitored and used as an indicator or diagnostic for disease.
Polynucleotides encoding zmsel polypeptides are useful within gene
therapy applications where it is desired to increase or inhibit zmsel
activity. For
example, in disease states where cell migration or motility is impaired or
deficient,
introduction of a zmsel gene could be used as a therapeutic. If a mammal has a
mutated or absent zmsel gene, the zmsel gene can be introduced into the cells
of the
mammal. In one embodiment, a gene encoding a zmsel polypeptide is introduced
in
vivo in a viral vector. Such vectors include an attenuated or defective DNA
virus, such
as, but not limited to, herpes simplex virus (HSV), retroviruses,
papillomavirus, Epstein
Barr virus (EBV), adenovirus, adeno-associated virus (AAV), and the like.
Defective
viruses, which entirely or almost entirely lack viral genes, are preferred. A
defective
virus is not infective after introduction into a cell. Use of defective viral
vectors allows
for administration to cells in a specific, localized area, without concern
that the vector
can infect other cells. Examples of particular vectors include, but are not
limited to, a
defective herpes simplex virus 1 (HSV1) vector (Kaplitt et al., Molec. Cell.
Neurosci.
2:320-30, 1991); an attenuated adenovirus vector, such as the vector described
by
Stratford-Perricaudet et al., J. Clin. Invest. 90:626-30, 1992; and a
defective adeno
associated virus vector (Samulski et al., J. Virol. 61:3096-101, 1987;
Samulski et al., J.
2 0 Virol. 63:3822-8, 1989).
In another embodiment, a zmsel gene can be introduced in a retroviral
vector, e.g., as described in Anderson et al., U.S. Patent No. 5,399,346; Mann
et al. Cell
33:153, 1983; Temin et al., U.S. Patent No. 4,650,764; Temin et al., U.S.
Patent No.
4,980,289; Markowitz et al., J. Virol. 62:1120, 1988; Temin et al., U.S.
Patent No.
5,124,263; International Patent Publication No. WO 95/07358, published March
16,
1995 by Dougherty et al.; and Kuo et al., Blood 82:845, 1993. Alternatively,
the vector
can be introduced by lipofection in vivo using liposomes. Synthetic cationic
lipids can
be used to prepare liposomes for in vivo transfection of a gene encoding a
marker
(Felgner et al., Proc. Natl. Acad. Sci. USA 84:7413-7, 1987; Mackey et al.,
Proc. Natl.
3 0 Acad. Sci. USA 85:8027-31, 1988). The use of lipofection to introduce
exogenous
genes into specific organs in vivo has certain practical advantages. Molecular
targeting
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
of liposomes to specific cells represents one area of benefit. More
particularly,
directing transfection to particular cells represents one area of benefit. For
instance,
directing transfection to particular cell types would be particularly
advantageous in a
tissue with cellular heterogeneity, such as the pancreas, liver, kidney, and
brain. Lipids
5 may be chemically coupled to other molecules for the purpose of targeting.
Targeted
peptides (e.g., hormones or neurotransmitters), proteins such as antibodies,
or non-
peptide molecules can be coupled to liposomes chemically.
It is possible to remove the target cells from the body; to introduce the
vector as a naked DNA plasmid; and then to re-implant the transformed cells
into the
10 body. Naked DNA vectors for gene therapy can be introduced into the desired
host
cells by methods known in the art, e.g., transfection, electroporation,
microinjection,
transduction, cell fusion, DEAE dextran, calcium phosphate precipitation, use
of a gene
gun or use of a DNA vector transporter. See, e.g., Wu et al., J. Biol. Chem.
267:963-7,
1992; Wu et al., J. Biol. Chem. 263:14621-4, 1988.
15 Antisense methodology can be used to inhibit zmsel gene transcription,
such as to inhibit cell proliferation in vivo. Polynucleotides that are
complementary to a
segment of a zmsel-encoding polynucleotide (e.g., a polynucleotide as set
forth in SEQ
>D NO:1) are designed to bind to zmsel-encoding mRNA and to inhibit
translation of
such mRNA. Such antisense polynucleotides are used to inhibit expression of
zmsel
2 0 polypeptide-encoding genes in cell culture or in a subject.
'The present invention also provides reagents which will find use in
diagnostic applications. For example, the zmse 1 gene, a probe comprising zmse
1 DNA
or RNA or a subsequence thereof can be used to determine if the zmsel gene is
present
on chromosome 17 or if a mutation has occurred. Zmse 1 is located at the
17q24. l
2 5 region of chromosome 17 (see, Example 3). Detectable chromosomal
aberrations at the
zmsel gene locus include, but are not limited to, aneuploidy, gene copy number
changes, translocations, insertions, deletions, restriction site changes and
rearrangements. Such aberrations can be detected using polynucleotides of the
present
invention by employing molecular genetic techniques, such as restriction
fragment
3 0 length polymorphism (RFLP) analysis, short tandem repeat (STR) analysis
employing
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
76
PCR techniques, and other genetic linkage analysis techniques known in the art
(Sambrook et al., ibid.; Ausubel et. al., ibid.; Marian, Chest 108:255-65,
1995).
The precise knowledge of a gene's position can be useful for a number
of purposes, including: 1) determining if a sequence is part of an existing
contig and
obtaining additional surrounding genetic sequences in various forms, such as
YACs,
BACs or cDNA clones; 2) providing a possible candidate gene for an inheritable
disease which shows linkage to the same chromosomal region; and 3) cross-
referencing
model organisms, such as mouse, which may aid in determining what function a
particular gene might have.
1 o The zmse 1 gene is located at the 17q24.1 region of chromosome 17.
Several genes of known function map to this region. Moreover, one of skill in
the art
would recognize that the 7q24 region is involved in several cancers, and that
translocations, loss of heterogeneity (LOH) and other chromosomal
abnormalities are
often found in cancers. Thus, a marker in the 17q24.1 locus, such as provided
by the
polynucleotides of the present invention, would be useful in detecting
translocations,
aneuploidy, rearrangements, LOH other chromosomal abnormalities involving this
region that are present in cancers. For example, zmsel polynucleotide probes
can be
used to detect abnormalities or genotypes associated with the cancer
susceptibility
marker BRCA1, localized to 17q21, which is associated with breast, ovarian and
2 0 prostate cancers (Hall, J.M. et al., Science 250:1684-1689, 1990). Zmsel
is localized
to the 17q24.1, is likely a Rho family effector, and could also be directly
involved in
breast cancer or other tumors. Moreover, there is evidence for cancer
resulting from
mutations in the 17q24 region: the somatostatin receptor 2 gene (17q24) may be
associated with cancers, such as small cell lung cancer (Zhang, C.-Y. et al.,
Biochem.
2 5 Biophys. Res. Commun. 210:805-815, 1995); and esophageal cancers (Hennies,
H.-C.
et al., Genomics 29:537-540, 1995).
Moreover, zmsel polynucleotide probes can be used to detect
abnormalities or genotypes associated with pituitary and placental human
growth
hormone (GH), which maps to the 17q22-q24 region of chromosome 17. Mutations
3 0 and deletions in the GH gene can create GH deficiencies and other diseases
in humans,
and such a diagnostic could assist physicians in determining the type of GH
disease and
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
77
appropriate associated therapy. As such, use of inventive anti-zmsel
antibodies,
polynucleotides, and polypeptides can be used for the detection of zmsel
polypeptide,
mRNA or anti-zmsel antibodies, thus serving as markers and be directly used
for
detecting or diagnosing growth hormone deficiencies or cancers using methods
known
in the art and described herein. For example, zmsel can be used to detect
abnormalities
or genotypes associated with the cyclin-dependent kinase 3 (CDK3) gene,
involved in
controlling cell cycle and intracellular signaling, maps to 17q22-qter, and is
likely
involved in human cancer (Bullrich, F. et al., Cancer Res. 55:1199-1205,
1995).
Moreover, Zmsel polynucleotide probes can be used to detect abnormalities or
genotypes associated with dipeptidyl carboxypeptidase 1 (DCP1) (17q23), also
known
as Angiotensin I Converting Enzyme (ACED, such as those that are implicated in
heart
disease, hypertension and male infertility (for example., see, Arbustini, E.
et al., Brit.
Heart J. 74:584-591, 1995; Cambien, F. et al., Nature 359:641-644, 1992; and
Hagaman, J.R. et al., Proc. Natl. Acad. Sci. 95:2552-2557. 1998). Further,
zmsel
polynucleotide probes can be used to detect abnormalities or genotypes
associated with
chromosome 17q24 deletions and translocations associated with human diseases,
such
as in the myeloperoxidase locus (17q23.1), or in cancers. Moreover, amongst
other
genetic loci, those for myeloperoxidase deficiency, (17q23.1), loci associated
with
cataracts (17q24), defects in sodium channel voltage-gated type 2 (resulting
in several
different syndromes) (17q23.1-q25.3), all manifest themselves in human disease
states
as well as map to this region of the human genome. See the Online Mendellian
Inheritance of Man (OMIM) gene map, and references therein, for this region of
chromosome 17 on a publicly available WWW server
(http://www3.ncbi.nlm.nih.gov/htbin-post/Omim/getmap?chromosome=17q24.1). All
2 5 of these serve as possible candidate genes for an inheritable disease
which show linkage
to the same chromosomal region as the zmsel gene. Thus, zmsel polynucleotide
probes
can be used to detect abnormalities or genotypes associated with these
defects.
Similarly, defects in the zmsel gene itself may result in a heritable
human disease state. Molecules of the present invention, such as the
polypeptides,
3 0 antagonists, agonists, polynucleotides and antibodies of the present
invention would aid
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
78
in the detection, diagnosis prevention, and treatment associated with a zmsel
genetic
defect.
A diagnostic could assist physicians in determining the type of disease
and appropriate associated therapy, or assistance in genetic counseling or
diagnosing
cancer. As such, the inventive anti-zmse 1 antibodies, polynucleotides, and
polypeptides can be used for the detection of zmsel polypeptide, mRNA or anti-
zmsel
antibodies, thus serving as markers and be directly used for detecting or
genetic
diseases or cancers, as described herein, using methods known in the art and
described
herein. Further, zmse 1 polynucleotide probes can be used to detect
abnormalities or
genotypes associated with chromosome 17q24.1 deletions and translocations
associated
with human diseases, such as those described above, or other translocations
involved
with malignant progression of tumors or other 17q24.1 mutations, which are
expected
to be involved in chromosome rearrangements in malignancy; or in other
cancers.
Similarly, zmsel polynucleotide probes can be used to detect abnormalities or
genotypes associated with chromosome 17q24.1 trisomy and chromosome loss
associated with human diseases or spontaneous abortion. Thus, zmsel
polynucleotide
probes can be used to detect abnormalities or genotypes associated with these
defects.
As discussed above, defects in the zmsel gene itself may result in a
heritable human disease state. Molecules of the present invention, such as the
2 0 polypeptides, antagonists, agonists, polynucleotides and antibodies of the
present
invention would aid in the detection, diagnosis prevention, and treatment
associated
with a zmse 1 genetic defect. In addition, zmse 1 polynucleotide probes can be
used to
detect allelic differences between diseased or non-diseased individuals at the
zmsel
chromosomal locus. As such, the zmsel sequences can be used as diagnostics in
2 5 forensic DNA profiling.
In general, the diagnostic methods used in genetic linkage analysis, to
detect a genetic abnormality or aberration in a patient, are known in the art.
Analytical
probes will be generally at least 20 nt in length, although somewhat shorter
probes can
be used (e.g., 14-17 nt). PCR primers are at least 5 nt in length, preferably
15 or more,
3 0 more preferably 20-30 nt. For gross analysis of genes, or chromosomal DNA,
a zmsel
polynucleotide probe may comprise an entire exon or more. Exons are readily
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
79
determined by one of skill in the art by comparing zmsel sequences (SEQ >17
NO:1)
with the human genomic DNA for zmsel (Genbank Accession No. AC026091). In
general, the diagnostic methods used in genetic linkage analysis, to detect a
genetic
abnormality or aberration in a patient, are known in the art. Most diagnostic
methods
comprise the steps of (a) obtaining a genetic sample from a potentially
diseased patient,
diseased patient or potential non-diseased carrier of a recessive disease
allele; (b)
producing a first reaction product by incubating the genetic sample with a
zmsel
polynucleotide probe wherein the polynucleotide will hybridize to
complementary
polynucleotide sequence, such as in RFLP analysis or by incubating the genetic
sample
with sense and antisense primers in a PCR reaction under appropriate PCR
reaction
conditions; (iii) Visualizing the first reaction product by gel
electrophoresis and/or other
known method such as visualizing the first reaction product with a zmsel
polynucleotide probe wherein the polynucleotide will hybridize to the
complementary
polynucleotide sequence of the first reaction; and (iv) comparing the
visualized first
reaction product to a second control reaction product of a genetic sample from
wild type
patient. A difference between the first reaction product and the control
reaction product
is indicative of a genetic abnormality in the diseased or potentially diseased
patient, or
the presence of a heterozygous recessive carrier phenotype for a non-diseased
patient,
or the presence of a genetic defect in a tumor from a diseased patient, or the
presence of
2 0 a genetic abnormality in a fetus or pre-implantation embryo. For example,
a difference
in restriction fragment pattern, length of PCR products, length of repetitive
sequences at
the zmsel genetic locus, and the like, are indicative of a genetic
abnormality, genetic
aberration, or allelic difference in comparison to the normal wild type
control. Controls
can be from unaffected family members, or unrelated individuals, depending on
the test
2 5 and availability of samples. Genetic samples for use within the present
invention
include genomic DNA, mRNA, and cDNA isolated form any tissue or other
biological
sample from a patient, such as but not limited to, blood, saliva, semen,
embryonic cells,
amniotic fluid, and the like. The polynucleotide probe or primer can be RNA or
DNA,
and will comprise a portion of SEQ m NO:1, the complement of SEQ >D NO:1, or
an
3 0 RNA equivalent thereof. Such methods of showing genetic linkage analysis
to human
disease phenotypes are well known in the art. For reference to PCR based
methods in
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
diagnostics see see, generally, Mathew (ed.), Protocols in Human Molecular
Genetics
(Humana Press, Inc. 1991), White (ed.), PCR Protocols: Current Methods and
Applications (Humana Press, Inc. 1993), Cotter (ed.), Molecular Diagnosis of
Cancer
(Humana Press, Inc. 1996), Hanausek and Walaszek (eds.), Tumor Marker
Protocols
5 (Humana Press, Inc. 1998), Lo (ed.), Clinical Applications of PCR (Humana
Press, Inc.
1998), and Meltzer (ed.), PCR in Bioanalysis (Humana Press, Inc. 1998)).
Mutations associated with the zmsel locus can be detected using nucleic
acid molecules of the present invention by employing standard methods for
direct
mutation analysis, such as restriction fragment length polymorphism analysis,
short
10 tandem repeat analysis employing PCR techniques, amplification-refractory
mutation
system analysis, single-strand conformation polymorphism detection, RNase
cleavage
methods, denaturing gradient gel electrophoresis, fluorescence-assisted
mismatch
analysis, and other genetic analysis techniques known in the art (see, for
example,
Mathew (ed.), Protocols in Human Molecular Genetics (Humana Press, Inc. 1991),
15 Marian, Chest 108:255 (1995), Coleman and Tsongalis, Molecular Diagnostics
(Human Press, Inc. 1996), Elles (ed.) Molecular Diagnosis of Genetic Diseases
(Humana Press, Inc. 1996), Landegren (ed.), Laboratory Protocols for Mutation
Detection (Oxford University Press 1996), Birren et al. (eds.), Genome
Analysis, Vol. 2:
Detecting Genes (Cold Spring Harbor Laboratory Press 1998), Dracopoli et al.
(eds.),
2 0 Current Protocols in Human Genetics (John Wiley & Sons 1998), and Richards
and
Ward, "Molecular Diagnostic Testing," in Principles of Molecular Medicine,
pages 83-
88 (Humana Press, Inc. 1998)). Direct analysis of an zmsel gene for a mutation
can be
performed using a subject's genomic DNA. Methods for amplifying genomic DNA,
obtained for example from peripheral blood lymphocytes, are well-known to
those of
25 skill in the art (see, for example, Dracopoli et al. (eds.), Current
Protocols in Human
Genetics, at pages 7.1.6 to 7.1.7 (John Wiley & Sons 1998)).
Mice engineered to express the zmsel gene, referred to as "transgenic
mice," and mice that exhibit a complete absence of zmse 1 gene function,
referred to as
"knockout mice," may also be generated (Snouwaert et al., Science 257:1083,
1992;
3 0 Lowell et al., Nature 366:740-42, 1993; Capecchi, M.R., Science 244: 1288-
1292,
1989; Palmiter, R.D. et al. Annu Rev Genet. 20: 465-499, 1986). For example,
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
81
transgenic mice that over-express zmsel, either ubiquitously or under a tissue-
specific
or tissue-restricted promoter can be used to ask whether over-expression
causes a
phenotype. For example, over-expression of a wild-type zmse 1 polypeptide,
polypeptide fragment or a mutant thereof may alter normal cellular processes,
resulting
in a phenotype that identifies a tissue in which zmsel expression is
functionally
relevant and may indicate a therapeutic target for the zmsel, its agonists or
antagonists.
For example, a preferred transgenic mouse to engineer is one that over-
expresses the
full length human zmsel polypeptide (residue 1 (Met) to residue 356 (Val) of
SEQ ID
N0:2); or more preferably the full length mouse zmsel polypeptide (residue 1
(Met) to
residue 349 (Val) of SEQ >D NO:S). Preferred tissue-specific or tissue-
restricted
promoters include lymphoid-restricted, epithelial-specific, colon-specific,
ovary-
specific and skin-restricted promoters. Moreover, such over-expression may
result in a
phenotype that shows similarity with human diseases. Similarly, knockout zmsel
mice
can be used to determine where zmsel is absolutely required in vivo. A
transgenic
mouse that is a knockout mouse would not expresses residue 1 (Met) to residue
349
(Val) of SEQ ID NO:S, because they would exhibit a complete absence of
endogenous
zmsel gene function. The phenotype of knockout mice is predictive of the in
vivo
effects of that a zmsel antagonist, such as those described herein, may have.
The
murine zmsel mRNA, and cDNA is isolated (SEQ >D N0:4) and can be used to
isolate
mouse zmsel genomic DNA (Genbank Accession No. AC026091) , which are
subsequently used to generate knockout mice. These transgenic and knockout
mice
may be employed to study the zmsel gene and the protein encoded thereby in an
in vivo
system, and can be used as in vivo models for corresponding human or animal
diseases
(such as those in commercially viable animal populations). The mouse models of
the
present invention are particularly relevant as tumor models for the study of
cancer
biology and progression. Such models are useful in the development and
efficacy of
therapeutic molecules used in human cancers. Because increases in zmsel
expression,
as well as decreases in zmsel expression are associated with specific human
cancers,
both transgenic mice and knockout mice would serve as useful animal models for
3 0 cancer. Moreover, in a preferred embodiment, zmse 1 transgenic mouse can
serve as an
animal model for specific tumors, particularly colon cancer, ovarian cancer,
leukemia or
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
82
melanoma. Moreover, transgenic mice expression of zmsel antisense
polynucleotides
or ribozymes directed against zmsel, described herein, can be used analogously
to
transgenic mice described above.
The invention is further illustrated by the following non-limiting
examples.
EXAMPLES
Example 1
Isolation and Cloning of the Human Zmsel
A. Using an EST Seguence to Obtain Full-length human zmsel
Scanning of a translated human cDNA database resulted in
identification of an expressed sequence tag (EST) sequence which was used to
identify
a human full length cDNA from a K562 cDNA library prepared in house (K562
cells;
ATCC No. CCL-243).
Confirmation of the full length human cDNA sequence was made by
sequence analyses of the cDNA from which the EST originated. This cDNA was
contained in a plasmid. The human zmsel cDNA clone was sequenced using the
following primers: ZC18489 (SEQ ID N0:21) , ZC18106 (SEQ ID N0:22), ZC18438
(SEQ ID N0:23), ZC 18165 (SEQ ID N0:24), ZC 18214 (SEQ ID N0:25), ZC 18275
(SEQ ID N0:26), ZC18213 (SEQ ID N0:27), ZC18285 (SEQ ID N0:28), ZC18388
(SEQ >D N0:29), ZC 18105 (SEQ >D N0:30), ZC 18452 (SEQ ID N0:31 ), and vector
primers ZC6,768 (SEQ ID N0:17), and ZC694. (SEQ ID N0:18). Sequencing results
2 5 indicated a 3076 by insert with a 1068 by open reading frame beginning
with an
initiating Met and ending with a stop signal. The sequence analyses revealed
that the
cDNA encompassed the entire coding region of the DNA encoding human zmsel. The
cDNA sequence is shown in SEQ ID NO:1 and the corresponding deduced
polypeptide
sequence is shown in SEQ ID N0:2.
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
83
Example 2
Tissue Distribution of zmsel in Human Tissues
A. Human tissue blots probed with a human zmsel probe
Northern blot analysis was performed using Human Multiple Tissue
Blots (MTN I, MTN II, and MTN III) (Clontech, Palo Alto, Ca). A full length
human
zmsel probe, based directly on the zmsel cDNA (Example 1) was generated by
PCR.
The PCR fragment was gel purified using QIAquick gel extraction kit (Qiagen,
Santa
Clarita, Ca.). The probe was radioactively labeled with 32P using the
Rediprime II
DNA Labeling system (Amersham, UK) according to Manufacturer's specifications.
The probe was purified using a Nuctrap push column (Stratagene cloning system,
La
Jolla, Ca). Expresshyb (Clontech) solution was used for the hybridizing
solution for the
blots. Hybridization took place overnight at 65°C. The blots were then
washed 4X in
2X SCC and 0.05% SDS at RT, followed by two washes in O.1X SSC and 0.1% SDS at
50°C. One transcript size was detected at approximately 3.6 kb. Signal
intensity was
ubiquitous for those tissues tested.
A Dot Blot was also performed using Human RNA Master BlotsT""
(Clontech). The methods and conditions for the Dot Blot were the same as for
the
Multiple Tissue Blots disclosed above. Again, signal intensity was ubiquitous
for those
tissues tested.
Example 3
Chromosomal Assignment and Placement of Human Zmsel
Zmsel was mapped to human chromosome 17 using the commercially
available version of the "Stanford G3 Radiation Hybrid Mapping Panel"
(Research
2 5 Genetics, Inc., Huntsville, AL). The "Stanford G3 RH Panel" contains DNAs
from each
of 83 radiation hybrid clones of the whole human genome, plus two control DNAs
(the
RM donor and the A3 recipient). A publicly available WWW server (http://shgc-
www.stanford.edu) allows chromosomal localization of markers.
For the mapping of Zmsel with the "Stanford G3 RH Panel", 20 ~,1
3 0 reactions were set up in a 96-well microtiter plate (Stratagene, La Jolla,
CA) and used in
a "RoboCycler Gradient 96" thermal cycler (Stratagene). Each of the 85 PCR
reactions
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
84
consisted of 2 ~ul lOX KlenTaq PCR reaction buffer (CLONTECH Laboratories,
Inc.,
Palo Alto, CA), 1.6 ~,l dNTPs mix (2.5 mM each, PERKIN-ELMER, Foster City,
CA), 1
~.1 sense primer, ZC18,859 (SEQ ID N0:7), 1 ~1 antisense primer, ZC18,860 (SEQ
ll~
N0:8), 2 ~,1 "RediLoad" (Research Genetics, Inc., Huntsville, AL), 0.4 ~,1 SOX
Advantage KlenTaq Polymerase Mix (Clontech Laboratories, Inc.), 25 ng of DNA
from
an individual hybrid clone or control and ddH20 for a total volume of 20 ~1.
The
reactions were overlaid with an equal amount of mineral oil and sealed. The
PCR cycler
conditions were as follows: an initial 1 cycle 5 minute denaturation at 94oC,
35 cycles of
a 45 seconds denaturation at 94oC, 45 seconds annealing at 66°C and 1
minute and 15
seconds extension at 72oC, followed by a final 1 cycle extension of 7 minutes
at 72oC.
The reactions were separated by electrophoresis on a 2% agarose gel.
The results showed linkage of Zmsel to the human chromosome 17
framework marker SHGC-11717 with a LOD score of 15.36 and at a distance of
8.98
cR_10000 from the marker. The use of surrounding genes/markers positions Zmsel
in the
17q24.3-q25 chromosomal region.
Example 4
Isolation and Cloning of Murine zmsel
Extension of EST Sequence
2 0 Scanning of a translated DNA database using a protein sequence
consisting of the translated open reading frame of human zmsel as a query
resulted in
identification of EST1166173, a murine expressed sequence tag (EST) found to
be an
ortholog of the human zmse 1 (Example 1 ) (SEQ ID NO: l ; SEQ ID N0:2). The
mouse
ortholog was designated muzmse 1.
2 5 Confirmation of the EST sequence was made by sequence analyses of
the cDNA from which the EST originated. This cDNA was contained in a plasmid.
The mouse zmsel cDNA clone was sequenced using the following primers: ZC19,115
(SEQ ID N0:9) ,ZC 19,119 (SEQ ID NO:10), ZC 19,190 (SEQ ID NO:11 ), ZC 19,191
(SEQ ID N0:12), ZC19,192 (SEQ ID N0:13), ZC19,193 (SEQ B7 N0:14), ZC19,278
3 0 (SEQ ID NO:15), ZC 19,270 (SEQ ID N0:16), and vector primers ZC6,768 (SEQ
ID
N0:17), and ZC694. (SEQ ID N0:18). Sequencing results indicated a 2925 by
insert
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
with a 1050 by open reading frame beginning with an initiating Met and ending
with a
stop signal. The sequence analyses revealed that the cDNA encompassed the
entire
coding region of the DNA encoding muzmsel. The cDNA sequence is shown in SEQ
ID N0:4 and the corresponding deduced polypeptide sequence is shown in SEQ ID
5 NO:S.
Example 5
Generation of Unta~~ed zmsel Recombinant Adenovirus
A. Preparation of DNA construct for Qeneration of Adenovirus
10 The protein coding region of murine zmse 1 was used to generate
recombinant adenovirus. The 1050 by mouse zmsel cDNA was released from the
TG12-8 vector (Example 6) using FseI and AscI enzymes. The cDNA was isolated
on
a 1 % low melt SeaPlaque GTGTM (FMC, Rockland, ME) gel and was then excised
from
the gel and the gel slice melted at 70°C, extracted twice with an equal
volume of Tris
15 buffered phenol, and EtOH precipitated. The DNA was resuspended in 10 p.1
H20.
The zmse 1 cDNA was cloned into the FseI-AscI sites of pAdTrack
CMV (He, T-C. et al., PNAS 95:2509-2514, 1998) in which the native polylinker
was
replaced with FseI, EcoRV, and AscI sites. Ligation was performed using the
Fast-
LinkTM DNA ligation and screening kit (Epicentre Technologies, Madison, WI).
In
2 0 order to linearize the plasmid, approximately 5 pg of the pAdTrackTM CMV
mouse
zmse 1 plasmid was digested with PmeI. Approximately 1 p.g of the linearized
plasmid
was cotransformed with 200 ng of supercoiled pAdEasyTM (He et al., su ra. into
BJS 183 cells. The co-transformation was done using a Bio-Rad Gene Pulser at
2.SkV,
200 ohms and 25 pF. The entire co-transformation was plated on 4 LB plates
2 5 containing 25 p.g/ml kanamycin. The smallest colonies were picked and
expanded in
LB/kanamycin and recombinant adenovirus DNA identified by standard DNA
miniprep
procedures. Digestion of the recombinant adenovirus DNA with FseI-AscI
confirmed
the presence of zmsel. The recombinant adenovirus miniprep DNA was transformed
into DH10B competent cells and DNA prepared using a Qiagen maxi prep kit as
per kit
3 0 instructions.
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
86
B. Transfection of 293A Cells with Recombinant DNA
Approximately 5 ~,g of recombinant adenoviral DNA was digested with
PacI enzyme (New England Biolabs) for 3 hours at 37°C in a reaction
volume of 100 ~.1
containing 20-30U of PacI. The digested DNA was extracted twice with an equal
volume of phenol/chloroform and precipitated with ethanol. The DNA pellet was
resuspended in 10 p.1 distilled water. A T25 flask of QBI-293A cells (Quantum
Biotechnologies, Inc. Montreal, Qc. Canada), inoculated the day before and
grown to
60-70% confluence, were transfected with the PacI digested DNA. The PacI-
digested
DNA was diluted up to a total volume of 50 ~l with sterile HBS (150mM NaCI,
20mM
HEPES). In a separate tube, 20 ~l DOTAP (Boerhinger Mannheim, 1 mg/ml) was
diluted to a total volume of 100 p.1 with HBS. The DNA was added to the DOTAP,
mixed gently by pipeting up and down, and left at room temperature for 15
minutes.
The media was removed from the 293A cells and washed with 5 ml serum-free
MEMalpha (Gibco BRL) containing 1mM Sodium Pyruvate (GibcoBRL), 0.1 mM
MEM non-essential amino acids (GibcoBRL) and 25mM HEPES buffer (GibcoBRL).
5 ml of serum-free MEM was added to the 293A cells and held at 37°C .
The
DNA/lipid mixture was added drop-wise to the T25 flask of 293A cells, mixed
gently
and incubated at 37°C for 4 hours. After 4 h the media containing the
DNA/lipid
mixture was aspirated off and replaced with 5 ml complete MEM containing 5%
fetal
2 0 bovine serum. The transfected cells were monitored for Green Fluorescent
Protein
(GFP) expression and formation of foci, i.e., viral plaques.
Seven days after transfection of 293A cells with the recombinant
adenoviral DNA, the cells expressed the GFP protein and started to form foci.
These
foci are viral "plaques" and the crude viral lysate was collected by using a
cell scraper
2 5 to detach all of the 293A cells. The lysate was transferred to a 50 ml
conical tube. To
release most of the virus particles from the cells, three freeze/thaw cycles
were done in
a dry ice/ethanol bath and a 37° water bath.
C. Amplification of Recombinant Adenovirus (rAdV)
30 The crude lysate was amplified (Primary (1°) amplification) to
obtain a
working "stock" of zmsel rAdV lysate. Ten lOcm plates of nearly confluent (80-
90%)
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
87
293A cells were set up 20 hours previously, 200 ~,1 of crude rAdV lysate added
to each
lOcm plate and monitored for 48 to 72 hours looking for CPE under the white
light
microscope and expression of GFP under the fluorescent microscope. When all of
the
293A cells showed CPE (Cytopathic Effect) this 1° stock lysate was
collected and
freeze/thaw cycles performed as described under Crude rAdV Lysate.
Secondary (2°) Amplification of zmsel rAdV was obtained as
follows:
Twenty l5cm tissue culture dishes of 293A cells were prepared so that the
cells were
80-90% confluent. All but 20 mls of 5%MEM media was removed and each dish was
inoculated with 300-500 p1 1° amplified rAdv lysate. After 48 hours the
293A cells
were lysed from virus production and this lysate was collected into 250 ml
polypropylene centrifuge bottles and the rAdV purified.
D. AdV/cDNA Purification
NP-40 detergent was added to a final concentration of 0.5% to the
bottles of crude lysate in order to lyse all cells. Bottles were placed on a
rotating
platform for 10 min. agitating as fast as possible without the bottles falling
over. The
debris was pelleted by centrifugation at 20,000 X G for 15 minutes. The
supernatant
was transferred to 250 ml polycarbonate centrifuge bottles and 0.5 volumes of
20%PEG8000/2.SM NaCI solution added. The bottles were shaken overnight on ice.
2 0 The bottles were centrifuged at 20,000 X G for 15 minutes and supernatant
discarded
into a bleach solution. The white precipitate in two vertical lines along the
wall of the
bottle on either side of the spin mark is the precipitated virus/PEG. Using a
sterile cell
scraper, the precipitate from 2 bottles was resuspended in 2.5 ml PBS. The
virus
solution was placed in 2 ml microcentrifuge tubes and centrifuged at 14,000 X
G in the
2 5 microfuge for 10 minutes to remove any additional cell debris. The
supernatant from
the 2 ml microcentrifuge tubes was transferred into a 15 ml polypropylene
snapcap tube
and adjusted to a density of 1.34 g/ml with cesium chloride (CsCI). The volume
of the
virus solution was estimated and 0.55 g/ml of CsCI added. The CsCI was
dissolved
and 1 ml of this solution weighed 1.34 g. The solution was transferred
polycarbonate
3 0 thick-walled centrifuge tubes 3.2 ml (Beckman #362305) and spin at 80,000
rpm
(348,000 X G) for 3-4 hours at 25°C in a Beckman Optima TLX
microultracentrifuge
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
88
with the TLA-100.4 rotor. The virus formed a white band. Using wide-bore
pipette
tips, the virus band was collected.
The virus from the gradient has a large amount of CsCI which must be
removed before it can be used on cells. Pharmacia PD-10 columns prepacked with
Sephadex G-25M (Pharmacia) were used to desalt the virus preparation. The
column
was equilibrated with 20 ml of PBS. The virus was loaded and allowed it to run
into
the column. 5 ml of PBS was added to the column and fractions of 8-10 drops
collected. The optical densities of 1:50 dilutions of each fraction was
determined at
260 nm on a spectrophotometer. A clear absorbance peak was present between
fractions 7-12. These fractions were pooled and the optical density (OD) of a
1:25
dilution determined. A formula is used to convert OD into virus concentration:
(OD at
260nm)(25)(1.1 x 1012) = virions/ml. The OD of a 1:25 dilution of the zmsel
rAdV
was 0.164, giving a virus concentration of 4.5 X 1012 virions/ml.
To store the virus, glycerol was added to the purified virus to a final
concentration of 15%, mixed gently but effectively, and stored in aliquots at -
80°C .
E. Tissue Culture Infectious Dose at 50% CPE (TCm 50) Viral Titration Assay
A protocol developed by Quantum Biotechnologies, Inc. (Montreal, Qc.
Canada) was followed to measure recombinant virus infectivity. Briefly, two 96-
well
tissue culture plates were seeded with 1X104 293A cells per well in MEM
containing
2% fetal bovine serum for each recombinant virus to be assayed. After 24 hours
10
fold dilutions of each virus from 1X10 2 to 1X10 14 were made in MEM
containing
2% fetal bovine serum. 100 ~,1 of each dilution was placed in each of 20
wells. After 5
days at 37°C , wells were read either positive or negative for
Cytopathic Effect (CPE)
2 5 and a value for "Plaque Forming Units/ml" (PFU) is calculated.
TCID50 formulation used was as per Quantum Biotechnologies, Inc.,
above. The titer (T) is determined from a plate where virus used is diluted
from 10 2 to
10 14, and read 5 days after the infection. At each dilution a ratio (R) of
positive wells
for CPE per the total number of wells is determined.
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
89
To Calculate titer of the undiluted virus sample: the factor, "F" = 1+d(S-
0.5); where "S" is the sum of the ratios (R); and "d" is LoglO of the dilution
series, for
example, "d" is equal to 1 for a ten-fold dilution series. The titer of the
undiluted
sample is T = 10(1+F) = TC~50/ml. To convert TCID50/ml to pfu/ml, 0.7 is
subtracted from the exponent in the calculation for titer (T).
The murine zmse 1 adenovirus had a titer of 7.1 X 1010 pfu/ml.
Example 6
Generation of Construct for Transgenic Expression of Mouse zmsel (muzmsel)
Oligonucleotides were designed to generate a PCR fragment containing
a consensus Kozak sequence and the mouse zmsel coding region. These
oligonucleotides were designed with an FseI site at the 5' end and an AscI
site at the 3'
end to facilitate cloning into pTGl2-8, our standard transgenic vector. PMT12-
8
contains the mouse MT-1 promoter and a 5' rat insulin II intron upstream of
the FseI
site.
PCR reactions were carried out with 200 ng mouse zmsel template
(Example 4) and oligonucleotides ZC19,514 (SEQ ID N0:19) and ZC19,515 (SEQ ID
N0:20). PCR reaction conditions were as follows: one cycle at 95°C for
5 minutes;
followed by 15 cycles at 95°C for 1 min., 58°C for 1 min., and
72°C for 1.0 min.;
2 0 followed by 72°C for 7 min.; followed by a 4°C soak. PCR
products were separated
by agarose gel electrophoresis and purified using a QiaQuickT"~ (Qiagen) gel
extraction
kit. The isolated, 1050 bp, DNA fragment was digested with FseI and AscI
(Boerhinger-Mannheim), phenol/chloroform extracted, ethanol precipitated,
resuspended in TE, and ligated into pTGl2-8 that was previously digested with
FseI
and AscI. The pTGl2-8 plasmid, designed for expression of a gene of interest
in
transgenic mice, contains an expression cassette flanked by 10 kb of MT-1 5'
DNA and
7 kb of MT-1 3' DNA. The expression cassette comprises the MT-1 promoter, the
rat
insulin II intron, a polylinker for the insertion of the desired clone, and
the human
growth hormone poly A sequence.
3 0 About one microliter of the ligation reaction was electroporated into
DH10B ElectroMaxT"" competent cells (GIBCO BRL, Gaithersburg, MD) according to
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
manufacturer's direction and plated onto LB plates containing 100 ~.g/ml
ampicillin,
and incubated overnight. Colonies were picked and grown in LB media containing
100
~.g/ml ampicillin. Miniprep DNA was prepared from the picked clones and
screened
for the zmsel insert by restriction digestion with EcoRI, and subsequent
agarose gel
5 electrophoresis. Maxipreps of the correct pTG-zmsel construct were
performed. A
positive clone was sequenced to verify thar the sequence was correct. A SaII
fragment
containing with 5' and 3' flanking sequences, the MT-1 promoter, the rat
insulin II
intron, zmsel cDNA and the human growth hormone poly A sequence are prepared
and
to be used for microinjection into fertilized murine oocytes.
10 Qiagen Maxi Prep protocol (Qiagen) was used as per manufacturer'.s
instruction to generate mumse 1 DNA to use for further subcloning, for
example, into
adenovirus vectors described above (Example 5).
Example 7
15 Expression of zmsel in Cancer Tissues Using NCI60 Cancer Microarray
A. Determination of genes having correlated expression with zmsel
Gene expression profile information for zmsel was obtained from
oligonucleotide and cDNA microarrays. Microarrays show the mRNA expression
level
of a large number of genes across a large number of cell types or cells
exposed to
2 0 various conditions, or cells in various replication steps, depending on
the experiment.
Because all of the information for all of the genes on any given microarray is
obtained
from the same biological experiment, and all biological experiments employing
the
same microarray provide results on the same set of genes, it is possible to
compare the
mRNA expression patterns of different genes to each other, as well as the
expression
2 5 pattern of a given gene in various tissues, cell lines, or cancers.
Briefly, microarray experiments are conducted by extracting the mRNA
from reference tissues(s) or cell lines) and from experimental sample tissues)
or cell
line(s). The reference mRNA is reverse transcribed to cDNA in a reaction along
with a
fluorescent dye label. The sample mRNA is likewise reverse transcribed to
cDNA, but
3 0 in the presence of a dye label with a different emission wavelength from
the reference.
The two cDNA samples are then mixed and hybridized to the microarray. The
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
91
microarray itself has thousands of unlabeled cDNA clones covalently bound as
spots
(also called 'features') on its surface. The labeled cDNAs then bind to their
respective
microarray spots. If a particular gene is transcribed at a higher level in the
experimental
sample relative to the reference, then the spot will fluoresce to a greater
degree in the
experimental sample dye wavelength channel. Conversely, if the gene in the
experimental sample is down regulated, then the wavelength channel of the
reference
dye will be stronger. Finally, the microarrays are scanned at the wavelengths
of both
dyes and the results for each spot are recorded and stored electronically.
Large numbers
of microarray experiments are typically done together using the same reference
cDNA,
but varying the experimental conditions, cell lines, tissues, time points, and
the like.
Raw and/or processed microarray expression information was obtained
from a subscription data set that was electronically downloaded. Publicly
available,
purchased, or in-house custom designed software can be used to analyze the
microarray
data (E.g., the publicly available NCI60 Cancer Microarray Project (Stanford
University, Palo Alto, CA) world-wide-web resource http://genome-
www.stanford/nci60/search.shtml). Prior to analysis, spots were examined to
exclude
experimental artifacts (dust spots, substrate imperfections, incomplete or
uneven
hybridization washes, etc.) and absorbence was adjusted to take into account
background fluorescence of the microarray substrate at both wavelengths. Very
weak
2 0 and very strong signals beyond the linear range response of the microarray
reader were
likewise excluded from analysis. Analyses were typically done on the ratio of
the
absorbance intensities of the reference and sample wavelength channels for
each spot.
These absorbance ratios were normalized to log base 2. Microarray information
for
zmsel was found in Ross et al. using a 'NCI60' microarray (Ross, DT et al.,
Nature
2 5 Genet. 24:227-235, 2000). The reference mRNA was composed of a mixture of
equal
quantities of mRNA from HL-60, K562, NCI-H226, COLO 205, SNB-19, LOX-IMVI,
OVCAR-3, OVCAR-4, CAKI-l, PC-3, MCF7, and Hs578T cells. See, Ross et al.
supra. for details of this method.
A cDNA clone corresponding to the 3' end of zmsel cDNA (and
3 0 corresponding mRNA was included on the 'NCI60' microarray chip set (Ross
et al.
su ra. . The zmsel cDNA clone (IMAGE clone 486682; Incyte Pharmaceuticals,
Palo
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
92
Alto, CA; Genbank Accession No.'s AA044169 and AA044269) corresponds to zmse 1
nucleotide positions 2435 to 3076 of SEQ .ID NO:1. This chip set contained
9702
additional cloned cDNAs. Ross et al: performed 68 hybridization experiments
with this
chip set against 60 cancer cell lines. The data from the NCI60 microarray was
purchased through the SUTECHTM Microarray Expression Database Subscription
Program from Stanford Sequencing and Technology Center's Technology
Development
Group, (Stanford University, Palo Alto, CA)
(http://otl.stanford.edu/tech/sutech.html).
Analysis was done by obtaining the Pearson correlation (R) between all
pairs of spots in the entire set of microarray experiments. The Pearson
correlation
comprises a value from 1 to -1. A value of 1 shows that the expression in the
two
compared spots are positively correlated (both either are increased or
decreased). A
value of -1 shows that the expression in the two compared spots are negatively
correlated (when one goes up, the other goes down, or visa versa). A value of
0 shows
that the items are not correlated over the range of experiments. Although
values
between 0 and 1, or 0 and -1 can be considered positively or negatively
correlated
respectively, in the current analysis, correlations greater than 0.5 or less
than -0.5 were
considered to be significant. A similar analysis was performed by Ross et al,
supra..
Their results were also queried electronically by the NCI60 Cancer Microarray
Project
(Stanford University, Palo Alto, CA) world-wide-web resource (http://genome-
www.stanford/nci60/search.shtml). Thus genes potentially co-regulated or
coexpressed
with zmse 1 were evaluated.
Table 5 shows the results of correlated cDNA clones in the NCI60
microarray that have a Pearson's R correlation of expression greater than 0.5
or less
than -0.5 with a zmsel expression. Expressed genes are indexed by their
accession
2 5 number, and the corresponding protein, if known, is described.
Our analysis of the data showed that zmsel had correlated expression
(Pearson's R < -0.5 or > 0.5) with 39 other cDNA clones (Table 5). The clones
having
correlated expression with zmse 1 included cytoskeletal, cell cycle control,
and other
genes. For example, Zmsel was coexpressed with epithelial cytoskeletal
proteins such
3 0 as paxillin, uroplakin, and zonaula occludens protein. It also showed co-
expression
with the nucleotide metabolism gene, cytosolic hydroxymethyltransferase, and a
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
93
negative correlation with adenylosuccinate lyase. Examination of the results
obtained
by our analysis, in conjunction with the results obtained from Stanford
Genomic
Resources (Stanford University, Palo Alto, CA) (http://genome-
www.stanford.edu/)
reveals that zmsel is coexpressed with several cytoskeletal and cell junction
genes:
cytoskeletal protein (HCYT), tight junction (zonula occludens) protein ZO-1,
L1M
domain protein (CLP), syndecan-1, SH3 binding protein, amphiglycan, and
paxillin.
These results showing that zmsel is co-expressed with cytoskeletal proteins
strongly
reinforces that zmse 1 is involved in cytoskeletal organization as described
herein.
Additionally, zmsel expression is correlated with cytosolic serine
hydroxymethyltransferase and cdc2Ll, and anti-correlated with adenylosuccinate
lyase,
DNA-directed polymerase II, and cdc25A. These results likewise suggest that
zmsel
has a role in cell cycle control and cancer.
Table 5.
Genbank Accession Pearson's Description
No. R
W46185 0.623538 unknown
W30779-N94432 0.621390 cytoskeletal protein (HCYT)
879559-879560 0.592573 tight junction (zonula occludens)
protein
ZO-1
AA053648-AA053259 0.557682 cytosolic serine hydroxymethyltransferase
N47464-N47465 0.549652 unknown '
899701-899596 0.545722 unknown
W81425 0.543336 LIM domain protein (CLP)
801486-800830 0.532809 syndecan-1
W94188-W74616 0.524556 breast tumor-associated protein
AA031793-AA031660 0.524266 serine/threonine kinase, NEK4a
AA024925-AA024819 0.522498 protein tyrosine phosphatase,
LAR
T39472-T40608 0.519872 SH3 binding protein
853149-853062 0.518507 unknown
AA043212-AA043213 0.517950 HREV 107-like protein
809663-809550 0.512873 amphiglycan
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
94
N50356-N51577 0.512019 unknown
W31174-N98734 0.510772 unknown
AA047159-AA047298 0.509458 unknown
W73440-W73379 0.509449 unknown
H24396 0.507807 unknown
AA034388-AA034389 0.507472 immunogenic prostate tumor protein
AA011515-AA011682 0.504750 unknown
W44684-W44685 0.504525 maguk p55 subfamily member 3
(mpp3
protein)
AA040884-AA040885 0.503192 calcyclin
W38993-N93209 0.502568 T84 colon carcinoma cell IL-lbeta
regulated
HSCC1
AA004976-AA004863 0.500155 Na,K-ATPase beta subunit (ATP1B)
N77727-N58359 -0.501752 RNA-associated protein-8 (RNAAP-8)
N41802-N32849 -0.508249 unknown
W95242-W95124 -0.508527 neuroblastoma apoptosis-related
RNA
binding protein (NAPOR-1)
W24524-N92340 -0.511351 MLC-1V/Sb isoform
AA052965 -0.511973 bone marrow protein BM034
AA057262-AA058707 -0.513009 unknown
AA043037-AA042937 -0.513606 unknown
H59306-H59260 -0.518568 cdc25A
N80399-N67978 -0.527630 unknown
W79319-W79419 -0.533025 DNA-directed polymerase II
AA010077 -0.542907 unknown
H99588 -0.548033 lymphoid nuclear protein (LAF-4)
W92381-W92325 -0.573708 adenylosuccinate lyase (ADSL)
B. Determination of zmsel expression in cell and tissue types, and cancers
Zmsel expression in the microarray hybridization data described above
was also analyzed for expression in various tissue types and cancers. Table 6
shows the
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
Ratio of expression of zmsel relative to the reference standard. The ratio of
expression
is another was to view the data. For each spot on the microarray, the ratio of
fluorescence of the reference and sample wavelengths is a measure of the level
of
induction or repression of the test sample relative to the control (Ratio =
[sample
5 fluorescence/control reference fluorescence]). If there is no change in mRNA
expression level of a given gene in the control and test samples, then the
ratio for the
corresponding spot will be 1. If the sample expression is induced in the test
sample
then the ratio of fluorescence for that spot will be greater than l; if it is
repressed then
the ratio will be less than 1. The results indicated that zmsel is up-
regulated in colon
10 cancer cell lines, and ovarian cancer cell lines. This data also indicated
a down-
regulation of zmsel in leukemia and melanoma cancer cell lines. Prostate, CNS,
renal,
breast, and non small cell lung cancer cell lines generally showed mixed or
weak
changes in zmsel expression relative to the control level. Zmsel expression
was
highest in the LOX-1MVI (melanoma cell line), HOP-92 (non-small cell lung
15 carcinoma cell line), BC2 (clinical sample of a lymph node metastasis of
breast cancer),
and COL0205 (colon cancer cell line). Zmsel expression was lowest in the CCRF-
CEM, RPMI-8226, MOLT-4 (leukemia cell lines), and the M-14 (melanoma cell
line).
These results show that a zmsel increase or decrease in expression is
correlated with
certain human cancers. As such, detection of zmsel expression increase or
decrease
2 0 can be used as a diagnostic for human cancers. Moreover, in a preferred
embodiment,
zmsel can serve as a marker for certain tissue-specific tumors particularly
colon cancer,
ovarian cancer, leukemia or melanoma. Use of polynucleotides, polypeptides,
and
antibodies of the present invention for such diagnostic purposes are known in
the art,
and disclosed herein.
Table 6
Cell Line Description Ratio of Zmsel expression
or to reference
Tissue
HS 578T breast cancer cell 0.51
line
MDA-N breast cancer cell 0.59
line
MDA-MB-435 breast cancer cell 0.63
line
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
96
BT-549 breast cancer cell 0.8
line
MDA-MB-231 breast cancer cell 0.96
line
MCF7 breast cancer cell 1.15
line
T-47D breast cancer cell 1.57
line
MCF7 breast cancer cell 0.78
line
MCF7 breast cancer cell 1.13
line
BC2 breast cancer lymph1
node
metastasis
BC 16 breast cancer tissue1.08
biopsy
BC2 breast cancer tissue2.47
biopsy
Normal Breastbreast tissue biopsy,1.57
normal
SF-539 CNS cancer cell 0.7
line
SF-295 CNS cancer cell 1
line
SF-268 CNS cancer cell 1.03
line
SNB-19 CNS cancer cell 1.15
line
U251 CNS cancer cell 1.22
line
SW-620 colon cancer cell 0.83
line
HCT-15 colon cancer cell 1.02
line
KM12 colon cancer cell 1.19
line
HCT-116 colon cancer cell 1.38
line
HCC-2998 colon cancer cell 1.42
line
COL0205 colon cancer cell 3.1
line
HT-29 colon cancer cell 1.13
line
MOLT-4 leukemia cell line 0.16
RPMI-8226 leukemia cell line 0.35
CCRF-CEM leukemia cell line 0.43
HL-60 leukemia cell line 0.52
K-562 leukemia cell line 0.53
SR leukemia cell line 0.98
K562 leukemia cell line 0.61
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
97
K562 leukemia cell line 0.62
M-14 melanoma cell line 0.27
SK-MEL-2 melanoma cell line 0.62
SK-MEL-5 melanoma cell line 0.7
SK-MEL-28 melanoma cell line 0.71
UACC-257 melanoma cell line 0.71
UACC-62 melanoma cell line 0.77
MALME-3M melanoma cell line 0.89
LOXIMVI melanoma cell line 1.86
NCI-H23 non-small cell lung0.53
cancer
(NSCLC) cell line
NCI-H322 NSCLC cell line 0.69
EKVX NSCLC cell line 0.74
NCI-H522 NSCLC cell line 0.82
NCI-H460 NSCLC cell line 1
A549 NSCLC cell line 1.08
HOP-62 NSCLC cell line 1.12
NCI-H226 NSCLC cell line 1.29
HOP-92 NSCLC cell line 2.31
OVCAR-4 ovarian cancer cell0.73
line
OVCAR-3 ovarian cancer cell1.04
line
OVCAR-8 ovarian cancer cell1.04
line
OVCAR-5 ovarian cancer cell1.35
line
IGROV1 ovarian cancer cell1.39
line
SK-OV-3 ovarian cancer cell1.49
line
DU-145 prostate cancer 1.1
cell line
PC-3 prostate cancer 1.19
cell line
UO-31 renal cancer cell 0.61
line
RXF-393 renal cancer cell 0.81
line
SNB-75 renal cancer cell 1
line
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
98
786-0 renal cancer cell 1.06
line
SN12C renal cancer cell 1.06
line
CAKI-1 renal cancer cell 1.09
line
ACHN renal cancer cell 1.17
line
A498 renal cancer cell 1.34
line
TK-10 renal cancer cell 1.38
line
ADR-RES unknown 1.28
From the foregoing, it will be appreciated that, although specific
embodiments of the invention have been described herein for purposes of
illustration,
various modifications may be made without deviating from the spirit and scope
of the
invention. Accordingly, the invention is not limited except as by the appended
claims.
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
1
SEQUENCE LISTING
<110> ZymoGenetics, Inc.
<120> NOUEL CRIB PROTEIN ZMSEl
<130> 99-76PC
<150> US 09/438,564
<151> 1999-11-10
<160> 31
<170> FastSEQ for Windows Version 3.0
<210>1
<211>3076
<212>DNA
<213>Homo sapiens
<220>
<221> CDS
<222> (199)...(1266)
<400> 1
gacaggggcc gccagcccct ccgccgcgcg gagcccacga aggggacagc gcagccggcc 60
cagagctcgg gtctccgggg accgagcctt atgatctcct cattgcgtcc ccctctgccc 120
actggacttg gacttcagat ctgaccccag acctgccggc tacctcggga gggcccacct 180
ccccgcccat ccagcaag atg cca atc ctc aag caa ctg gtg.tcc agc tcg 231
Met Pro Ile Leu Lys Gln Leu Ual Ser Ser Ser
1 5 10
gtg cac tcc aag cgc cgt tcc cga gcg gac ctc acg gcc gag atg atc 279
Ual His Ser Lys Arg Arg Ser Arg Ala Asp Leu Thr Ala Glu Met Ile
15 20 25
agc gcc ccg ctg ggc gac ttc cgc cac acc atg cac gtt ggc cgg gcc 327
Ser Ala Pro Leu Gly Asp Phe Arg Nis Thr Met His Ual Gly Arg Ala
30 35 40
gga gac gcc ttt ggg gac acc tcc ttc ctc aat agc aag get ggc gag 375
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
2
Gly Asp Ala Phe Gly Asp Thr Ser Phe Leu Asn Ser Lys Ala Gly Glu
45 50 55
ccc gac ggc gag tcc ttg gac gaa cag ccc tct tct tca tct tcc aaa 423
Pro Asp Gly Glu Ser Leu Asp Glu Gln Pro Ser Ser Ser Ser Ser Lys
60 65 70 75
cgc agt ctc ctg tcc agg aag ttc cgg ggc agc aag cgg tca cag tcg 471
Arg Ser Leu Leu Ser Arg Lys Phe Arg Gly Ser Lys Arg Ser Gln Ser
80 85 90
gtg acc agg ggg gag cgg gag cag cgt gac atg ctg ggc tcc ctg cgg 519
Val Thr Arg Gly Glu Arg Glu Gln Arg Asp Met Leu Gly Ser Leu Arg
95 100 105
gac tcg gcc ctg ttt gtc aag aat gcc atg tcc ctg ccc cag ctc aat 567
Asp Ser Ala Leu Phe Ual Lys Asn Ala Met Ser Leu Pro Gln Leu Asn
110 115 120
gag aag gag gcc gcg gag aag ggc acc agt aag ctg ccc aag agc ctg 615
Glu Lys Glu Ala Ala Glu Lys Gly Thr Ser Lys Leu Pro Lys Ser Leu
125 130 135
tca tcc agc ccc gtg aag aag gcc aat gac ggg gag ggc ggc gat gag 663
Ser Ser Ser Pro Ual Lys Lys Ala Asn Asp Gly Glu Gly Gly Asp Glu
140 145 150 155
gag gcg ggc acg gag gag gca gtg ccc cgt cgg aat ggg gcc gcg ggt 711
Glu Ala Gly Thr Glu Glu Ala Ual Pro Arg Arg Asn Gly Ala Ala Gly
160 165 170
cca cat tcc cct gac ccc ctc ctc gat gag cag gcc ttt ggg gat ctg 759
Pro His Ser Pro Asp Pro Leu Leu Asp Glu Gln Ala Phe Gly Asp Leu
175 180 185
aca gat ctg cct gtc gtg ccc aag gcc acg tac ggg ctg aag cat gcg 807
Thr Asp Leu Pro Ual Ual Pro Lys Ala Thr Tyr Gly Leu Lys His Ala
190 195 200
gag tcc atc atg tcc ttc cac atc gac ctg ggg ccc tcc atg ctg ggt 855
Glu Ser Ile Met Ser Phe His Ile Asp Leu Gly Pro Ser Met Leu Gly
205 210 215
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
3
gac gtc ctc agc atc atg gac aag gag gag tgg gac ccc gag gag ggg 903
Asp Val Leu Ser Ile Met Asp Lys Glu Glu Trp Asp Pro Glu Glu Gly
220 225 230 235
gag ggt ggt tac cat ggc gat gag ggc gcc get ggc acc atc acc cag 951
Glu Gly Gly Tyr His Gly Asp Glu Gly Ala Ala Gly Thr Ile Thr Gln
240 245 250
get ccc ccg tac gcc gtg gcg gcc cct ccc ctg gca agg cag gaa ggc 999
Ala Pro Pro Tyr Ala Val Ala Ala Pro Pro Leu Ala Arg Gln Glu Gly
255 260 265
aag get ggc cca gac ttg ccc tcc ctc ccc tcc cat get ctg gag gat 1047
Lys Ala Gly Pro Asp Leu Pro Ser Leu Pro Ser His Ala Leu Glu Asp
270 275 280
gag ggg tgg gca gca gcg gcc ccc agc ccc ggc tca gcc cgc agc atg 1095
Glu Gly Trp Ala Ala Ala Ala Pro Ser Pro Gly Ser Ala Arg Ser Met
285 290 295
ggc agc cac acc aca cgg gac agc agc tcc ctc tcc agc tgc acc tca 1143
Gly Ser His Thr Thr Arg,Asp Ser Ser Ser Leu Ser Ser Cys Thr Ser
300 305 310 315
ggc atc ctg gag gag cgc agc cct gcc ttc cgg ggg ccg gac agg gcc 1191
Gly Ile Leu Glu Glu Arg Ser Pro Ala Phe Arg Gly Pro Asp Arg Ala
320 325 330
cgg get get gtc tca aga cag cca gac aag gag ttc tcc ttc atg gat 1239
Arg Ala Ala Val Ser Arg Gln Pro Asp Lys Glu Phe Ser Phe Met Asp
335 340 345
gag gag gag gag gat gaa atc cgt gtg tgaggcggac agtgggtggc 1286
Glu Glu Glu Glu Asp Glu Ile Arg Val
350 355
caccgggagctcttggctgcatcttctccctgcccccaccccactatgacctttgaccct1346
acggcgcaggggcagccaggacccttgattcagaccatggaccctggaccttgtagatga1406
gggacactggcctggccctcgggtcttcggaggacgtagggggctggcatgggtgccgac1466
tggctgcctgacttcatcatgctccctgcacttaggctgcgtgggacaagggctgtgttg1526
tcacagcaggaataggttttcctctgttggcctccctttcctccaccctggcctcaaatg1586
gatgccagatgccaaccccagttctggccacgtacagccagcgggtcagcccagaggcag1646
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
4
cctcagctccagggctaaggactctcggctcccattttctctgctggcgtttctgctgtg1706
cccagcagtggctgctggggaagcagctgcagcaggagggagacggtcttgcctctcagc1766
ccctccctgccccaccccagctcctgccctggaaatctggagccccttggagctgagctg1826
gacggggggccagctgcgagcatgtgcactaaacgcagccctttccaggggaagagaaca1886
ggatggagaatggaaggaaagccccccaggcttcgtgaattgcaagaagggacccttcca1946
ggatgacactaggaacagggctagggcactcgctcagtccctaggggcttgtttgttctt2006
tattattgtgtttaaatccttatagagcaatatcaggatggtgttaataggtctgcctca2066
gaatgagaatcaatccttttagaaaacctttatactaagcctcctcttcgaaattcacag2126
tggcgattagcggactggagtctggtggcgattagcggactggagtctggggacatccgt2186
ggcaaagacaccagctcaactttagtgcttcccaactttatttagaatgacatggggtgg2246
gtgtctggtgtgtgtgttttccctacgcacctcccatagctattaacaactgaggaaggc2306
cagtgcagaatatttttggagaacgattttttttttaaataatatatcattcctatgggg2366
ggaaagccttttttttctttttggctgagttattccctccctcccctcaataccctcagt2426
actgactacttccctttcttttctcaggcctccccccaccgacttttgaggccagggttg2486
gccagatttagcaaaaccaaaacagagtgctgagttaaacgcaaatttcaggtaaacaaa2546
agataattttctagcattaatatgccccacgcaatatttggaacacttatgtgaaaaatg2606
atttgtttttctgaaattcacgtttctctctgagtcctgtaactgtccccgaggggattg2666
agcagaagctcgggtatgagccctgaggttgactgccggttatttttctgtcctgggaac2726
agcctgacccacctccctgtctccatgtagccagtgaggggagggggagacacagaacca2786
accacagccaggggcgtccccatggcgactgtggcccggcccctcctctcttgcctgact-2846
ctcctctcttgcctgactctagacactaacttagttccaggttcggtgccctgttggtgc2906
tcctgtttccaatagcttaggtcccatggtgggggaggaacctcaggggctatgcagccc2966
ccgccagctgccctcgaatcccgtccaggccaattccagattctaaactgatttttttca3026
tgatattgtcaaaacagtgaggaaacattaaaaaaaaaagccctaaagca 3076
<210>2
<211>356
<212>PRT
<213>Homo Sapiens
<400> 2
Met Pro Ile Leu Lys Gln Leu Val Ser Ser Ser Val His Ser Lys Arg
1 5 10 15
Arg Ser Arg Ala Asp Leu Thr Ala Glu Met Ile Ser Ala Pro Leu Gly
20 25 30
Asp Phe Arg His Thr Met His Val Gly Arg Ala Gly Asp Ala Phe Gly
35 40 45
Asp Thr Ser Phe Leu Asn Ser Lys Ala Gly Glu Pro Asp Gly Glu Ser
50 55 60
Leu Asp Glu Gln Pro Ser Ser Ser Ser Ser Lys Arg Ser Leu Leu Ser
65 70 75 80
Arg Lys Phe Arg Gly Ser Lys Arg Ser Gln Ser Val Thr Arg Gly Glu
85 90 95
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
Arg Glu Gln Arg Asp Met Leu Gly Ser Leu Arg Asp Ser Ala Leu Phe
100 105 110
Ual Lys Asn Ala Met Ser Leu Pro Gln Leu Asn Glu Lys Glu Ala Ala
115 120 125
Glu Lys Gly Thr Ser Lys Leu Pro Lys Ser Leu Ser Ser Ser Pro Ual
130 135 140
Lys Lys Ala Asn Asp Gly Glu Gly Gly Asp Glu Glu Ala Gly Thr Glu
145 150 155 160
Glu Ala Ual Pro Arg Arg Asn Gly Ala Ala Gly Pro His Ser Pro Asp
165 170 175
Pro Leu Leu Asp Glu Gln Ala Phe Gly Asp Leu Thr Asp Leu Pro Ual
180 185 190
Ual Pro Lys Ala Thr Tyr Gly Leu Lys His Ala Glu Ser Ile Met Ser
195 200 205
Phe His Ile Asp Leu Gly Pro Ser Met Leu Gly Asp Ual Leu Ser Ile
210 215 220
Met Asp Lys Glu Glu Trp Asp Pro Glu Glu Gly Glu Gly Gly Tyr His
225 230 235 240
Gly Asp Glu Gly Ala Ala Gly Thr Ile Thr Gln Ala Pro Pro Tyr Ala
245 250 255
Ual Ala Ala Pro Pro Leu Ala Arg Gln Glu Gly Lys Ala Gly Pro Asp
260 265 270
Leu Pro Ser Leu Pro Ser His Ala Leu Glu Asp Glu Gly Trp Ala Ala
275 280 285
Ala Ala Pro Ser Pro Gly Ser Ala Arg Ser Met Gly Ser His Thr Thr
290 295 300
Arg Asp Ser Ser Ser Leu Ser Ser Cys Thr Ser Gly Ile Leu Glu Glu
305 310 315 320
Arg Ser Pro Ala Phe Arg Gly Pro Asp Arg Ala Arg Ala Ala Ual Ser
325 330 335
Arg Gln Pro Asp Lys Glu Phe Ser Phe Met Asp Glu Glu Glu Glu Asp
340 345 350
Glu Ile Arg Ual
355
<210> 3
<211> 1068
<212> DNA
<213> Artificial Sequence
<220>
<223> Degenerate polynucleotide seuence for human zmsel
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
6
<221> misc_feature
<222> (1). .(1068)
<223> n = A,T,C or G
<400> 3
atgccnathytnaarcarytngtnwsnwsnwsngtncaywsnaarmgnmgnwsnmgngcn60
gayytnacngcngaratgathwsngcnccnytnggngayttymgncayacnatgcaygtn120
ggnmgngcnggngaygcnttyggngayacnwsnttyytnaaywsnaargcnggngarccn180
gayggngarwsnytngaygarcarccnwsnwsnwsnwsnwsnaarmgnwsnytnytnwsn240
mgnaarttymgnggnwsnaarmgnwsncarwsngtnacnmgnggngarmgngarcarmgn300
gayatgytnggnwsnytnmgngaywsngcnytnttygtnaaraaygcnatgwsnytnccn360
carytnaaygaraargargcngcngaraarggnacnwsnaarytnccnaarwsnytnwsn420
wsnwsnccngtnaaraargcnaaygayggngarggnggngaygargargcnggnacngar480
gargcngtnccnmgnmgnaayggngcngcnggnccncaywsnccngayccnytnytngay540
garcargcnttyggngayytnacngayytnccngtngtnccnaargcnacntayggnytn600
aarcaygcngarwsnathatgwsnttycayathgayytnggnccnwsnatgytnggngay660
gtnytnwsnathatggayaargargartgggayccngargarggngarggnggntaycay720
ggngaygarggngcngcnggnacnathacncargcnccnccntaygcngtngcngcnccn780
ccnytngcnmgncargarggnaargcnggnccngayytnccnwsnytnccnwsncaygcn840
ytngargaygarggntgggcngcngcngcnccnwsnccnggnwsngcnmgnwsnatgggn900
wsncayacnacnmgngaywsnwsnwsnytnwsnwsntgyacnwsnggnathytngargar960
mgnwsnccngcnttymgnggnccngaymgngcnmgngcngcngtnwsnmgncarccngay1020
aargarttywsnttyatggaygargargargargaygarathmgngtn 1068
<210>4
<211>2868
<212>DNA
<213>Mus musculus
<220>
<221> CDS
<222> (173)...(1219)
<400> 4
cgaggcgcca agcacaccga ggggagcgta cagccgcacc tggtctgcgc tcggggagct 60
ggggaccgag ccctctgatt gccctgtcta ccctttgcat tgctggactt cagatctgac 120
cccatacctg cctgttgcct tgggagtgcc cagctccccc gcagccagca cg atg ccc 178
Met Pro
1
att ctc aaa cag ctg gtg tcc agc tct gtg aac tcg aag cgc cgc tca 226
Ile Leu Lys G.ln Leu Val Ser Ser Ser Val Asn Ser Lys Arg Arg Ser
10 15
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
7
cgt gcg gac ctc aca gcc gag atg atc agt gcc ccg ctg ggt gac ttc 274
Arg Ala Asp Leu Thr Ala Glu Met Ile Ser Ala Pro Leu Gly Asp Phe
20 25 30
cgc cac acc atg cat gtg ggc cgg get ggg gac gcc ttt ggg gac acc 322
Arg His Thr Met His Val Gly Arg Ala Gly Asp Ala Phe Gly Asp Thr
35 40 45 50
tcc ttc ctc act agc aag gcc agg gag gca gac gac gag tcc ctg gat 370
Ser Phe Leu Thr Ser Lys Ala Arg Glu Ala Asp Asp Glu Ser Leu Asp
55 60 65
gag cag gcc tcc get tcc aag ctc agc ctc ctg tcc agg aag ttc cgg 418
Glu Gln Ala Ser Ala Ser Lys Leu Ser Leu Leu Ser Arg Lys Phe Arg
70 75 80
ggc agc aaa cgt tca cag tcc gtg acc aga ggg gac cgg gag cag aga 466
Gly Ser Lys Arg Ser Gln Ser Val Thr Arg Gly Asp Arg Glu Gln Arg
85 90 95
gac atg ctg ggc tcc ctg cgg gac tca gca ctg ttt gtc aag aat gcc 514
Asp Met Leu Gly Ser Leu Arg Asp Ser Ala Leu Phe Val Lys Asn Ala
100 105 . 110
atg tcc ctg cct cag ctc aat gag aag gaa gcc gcg gag aag gac tcg 562
Met Ser Leu Pro Gln Leu Asn Glu Lys Glu Ala Ala Glu Lys Asp Ser
115 120 125 130
agc aag ctg ccc aag agc ctg tcg tcc agc cct gtg aag aag gca gac 610
Ser Lys Leu Pro Lys Ser Leu Ser Ser Ser Pro Val Lys Lys Ala Asp
135 140 145
get aga gat ggt ggc ccg aag agt ccc cat cgg aac ggg gcc aca ggc 658
Ala Arg Asp Gly Gly Pro Lys Ser Pro His Arg Asn Gly Ala Thr Gly
150 155 160
ccc aac tca cct gac cca ctc ctt gac gag cag gcc ttt ggg gac ctg 706
Pro Asn Ser Pro Asp Pro Leu Leu Asp Glu Gln Ala Phe Gly Asp Leu
165 170 175
atg gat ctg ccc atc atg ccc aaa gtc agc tac ggg ctg aag cat gca 754
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
8
Met Asp Leu Pro Ile Met Pro Lys Val Ser Tyr Gly Leu Lys His Ala
180 185 190
gag tcg atc ctg tcc ttc cac atc gac ctg ggg cct tcc atg ctg gga 802
Glu Ser Ile Leu Ser Phe His Ile Asp Leu Gly Pro Ser Met Leu Gly
195 200 205 210
gat gtt ctc agc atc atg gac aag gac cag tgg ggc tca gag gag gag 850
Asp Val Leu Ser Ile Met Asp Lys Asp Gln Trp Gly Ser Glu Glu Glu
215 220 225
gag gaa get ggc ggg tac cgt gac aag gaa ggc ccc agc agc att gtc 898
Glu Glu Ala Gly Gly Tyr Arg Asp Lys Glu Gly Pro Ser Ser Ile Val
230 235 240
cag gca ccc cct gtg ctg gag gtg gtt cct cct cta ggg aga cag gaa 946
Gln Ala Pro Pro Val Leu Glu Ual Val Pro Pro Leu Gly Arg Gln Glu
245 250 255
agc aag gcc agc tgg gac cag gcc tct atg ctg ccc ccc cac get gtg 994
Ser Lys Ala Ser Trp Asp Gln Ala Ser Met Leu Pro Pro His Ala Val
260 265 270
gag gat gac gga tgg gcg gtg gta gcc ccc agc ccc agc tca gca cgc 1042
Glu Asp Asp Gly Trp Ala Val Val Ala Pro Ser Pro Ser Ser Ala Arg
275 280 285 290
agt gtg ggc agc cac acc acg cgg gac agc agc tcc ctg tcc agc tac 1090
Ser Val Gly Ser His Thr Thr Arg Asp Ser Ser Ser Leu Ser Ser Tyr
295 300 305
acc tca ggc gtc ctt gag gag cgc agc cca get ttc aga ggc cca gac 1138
Thr Ser Gly Val Leu Glu Glu Arg Ser Pro Ala Phe Arg Gly Pro Asp
310 315 320
agg gtg gca get get ccc cca agg cag cca gac aag gaa ttc tgc ttc 1186
Arg Val Ala Ala Ala Pro Pro Arg Gln Pro Asp Lys Glu Phe Cys Phe
325 330 335
atg gat gag gag gag gaa gat gag atc cga gtt tgaggctgga ccgaaagttg 1239
Met Asp Glu Glu Glu Glu Asp Glu Ile Arg Val
340 345
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
9
aaagtcgccttcacatctctgggctgcatcttttccctgctgctgctgccgccttctcta1299
tgacctttgaccttactctgtaggtgcagctaagaggctcattggagtagaccctggacc1359
tcagggattggggtgccagagaagtaaagtagcaggggcactggcgcctggtggcctgac1419
tctgacctaaccttccttaccgcaccagcctgggacggatccgagccccagcgggaagcc1479
attctcttccgggccctttgctctcagcctggcctcagatggatgccagatgttagtttg1539
agttgctgccgcaatggcagggaagccaggtgtgggcttctctccaaggtcatggacact1599
tggctcccttctgttcaccttgtgtctgcagcctacccaggagatatatgcagcaggagg1659
caggggtgctcacgtgtttgagctcctccttcttccacctctggctcctcactgaagcct1719
ggtgttctttggggttcagctgaagccaggggacagcctcaactattacactaaatgcag1779
cctgtcccagaggctgcatcccaggacaggatggggcacagaaggaacgaacaccccctg1839
cttctagcttcttgggttctcaagacactaggaacaggaaaggggccagctctgcccatg1899
ggtgtgtttgttccttgttactatgttttaaacctgaatagagcactgccaaaatcccct1959
gccaggagactagtgaccgtcttggtggctgagtgactgttatctcacctgaatctggtg2019
tacagaccctgcccaggttggactgtggcagggcagccaccaccagtgtttgtcccggaa2079
cccccacctccatagctgttagtggctgaaggagggctgtgtaagaaaagttctggaata2139
cgatgcttaaatgatacattattccctggggtgtgagctgcgctttggctagttagtggc2199
ctctccttgggctctgggccaggcctcgcaaaaacacaaaacaagatgggactgtatttg2259
attggaattccaggggttttttgtttgtttgtttttggctttttgggatacggtctcact2319
ctgtagcccaagctggcctcaagctcatagcgagcctcccttaccctaggagcttcggtt2379
gcaagtgtgcaccactgctcctggctgttttgttcttctgaaagctgttttgctcagctc2439
ctgtaactctacccagaacgctagtagaggcaggggcctgagccctgggggtggtagctc2499
attactttcctatgctgggagcaggctgacctgctccctggtctagcacagccagtggga2559
atctggggagagagcaagctagattacaagcagagtctggccagatggtggccagccatg2619
ggctgctgtgcttccagaggccaccctcctagattcagaccctgaagtgctcactgggcc2679
cctgactggtgctcctacgcaggtaggcagtgactgagctacagagctgtgtctctggcc2739
agcagtacacacacaacacacacacacccctctcctaaatctacctggttggttctaaac2799
tctaaactttgtatttttttccatgacattgaaaaagcagtaagaaaacattaaaatttc2859
ctcctaaca 2868
<210>5
<211>349
<212>PRT
<213>Mus musculus
<400> 5
Met Pro Ile Leu Lys Gln Leu Val Ser Ser Ser Val Asn Ser Lys Arg
1 5 10 15
Arg Ser Arg Ala Asp Leu Thr Ala Glu Met Ile Ser Ala Pro Leu Gly
20 25 30
Asp Phe Arg His Thr Met His Val Gly Arg Ala Gly Asp Ala Phe Gly
35 40 45
Asp Thr Ser Phe Leu Thr Ser Lys Ala Arg Glu Ala Asp Asp Glu Ser
50 55 60
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
Leu Asp Glu Gln Ala Ser Ala Ser Lys Leu Ser Leu Leu Ser Arg Lys
65 70 75 80
Phe Arg Gly Ser Lys Arg Ser Gln Ser Val Thr Arg Gly Asp Arg Glu
85 90 95
Gln Arg Asp Met Leu Gly Ser Leu Arg Asp Ser Ala Leu Phe Val Lys
100 105 110
Asn Ala Met Ser Leu Pro Gln Leu Asn Glu Lys Glu Ala Ala Glu Lys
115 120 125
Asp Ser Ser Lys Leu Pro Lys Ser Leu Ser Ser Ser Pro Val Lys Lys
130 135 140
Ala Asp Ala Arg Asp Gly Gly Pro Lys Ser Pro His Arg Asn Gly Ala
145 150 155 160
Thr Gly Pro Asn Ser Pro Asp Pro Leu Leu Asp Glu Gln Ala Phe Gly
165 170 175
Asp Leu Met Asp Leu Pro Ile Met Pro Lys Val Ser Tyr Gly Leu Lys
180 185 190
His Ala Glu Ser Ile Leu Ser Phe His Ile Asp Leu Gly Pro Ser Met
195 200 205
Leu Gly Asp Val Leu Ser Ile Met Asp Lys Asp Gln Trp Gly Ser Glu
210 215 220
Glu Glu Glu Glu Ala Gly Gly Tyr Arg Asp Lys Glu Gly Pro Ser Ser
225 230 235 240
Ile Val Gln Ala Pro Pro Val Leu Glu Val Val Pro Pro Leu Gly Arg
245 250 255
Gln Glu Ser Lys Ala Ser Trp Asp Gln Ala Ser Met Leu Pro Pro His
260 265 270
Ala Val Glu Asp Asp Gly Trp Ala Val Val Ala Pro Ser Pro Ser Ser
275 280 285
Ala Arg Ser Val Gly Ser His Thr Thr Arg Asp Ser Ser Ser Leu Ser
290 295 300
Ser Tyr Thr Ser Gly Val Leu Glu Glu Arg Ser Pro Ala Phe Arg Gly
305 310 315 320
Pro Asp Arg Val Ala Ala Ala Pro Pro Arg Gln Pro Asp Lys Glu Phe
325 330 335
Cys Phe Met Asp Glu Glu Glu Glu Asp Glu Ile Arg Val
340 345
<210> 6
<211> 16
<212> PRT
<213> Artificial Sequence
<220>
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
11
<223> Consensus CRIB motif (Bubelo, PD et al..
J.Biol.Chem. 270:29071-29074, p. 29073. 1995)
<221> VARIANT
<222> (1)...(16)
<223> Xaa = Any Amino Acid
<400> 6
Ile Ser Xaa Pro Xaa Xaa Xaa Xaa Phe Xaa His Xaa Xaa His Ual Gly
1 5 10 15
<210> 7
<211> 18
<212> DNA
<213> Artificial Sequence
<220>
<223> Oligonucleotide primer ZC18859
<400> 7
ggggcagcaa gcggtcac 18
<210> 8
<211> 18
<212> DNA
<213> Artificial Sequence
<220>
<223> Oligonucleotide primer ZC18860
<400> 8
tccgcggcct ccttctca 18
<210> 9
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Oligonucleotide primer ZC19115
<400> 9
tgcccaagag cctgtcgtcc 20
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
12
<210> 10
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Oligonucleotide primer ZC19119
<400> 10
ctggctgtgc tagaccaggg 20
<210> 11
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Oligonucleotide primer ZC19190
<400> 11
acggtcacta gtctcctggc 20
<210> 12
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Oligonucleotide primer ZC19191
<400> 12
gctttcagag gcccagacag 20
<210> 13
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Oligonucleotide primer ZC19192
<400> 13
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
13
tcgtcaagga gtgggtcagg 20
<210> 14
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Oligonucleotide primer ZC19193
<400> 14
gatacggtct cactctgtag 20
<210> 15
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Oligonucleotide primer ZC19278
<400> 15
acagagtaag gtcaaaggtc 20
<210> 16
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Oligonucleotide primer ZC19270
<400> 16
aggctgcatc ccaggacagg 20
<210> 17
<211> 25
<212> DNA
<213> Artificial Sequence
<220>
<223> Oligonucleotide primer ZC6768
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
14
<400> 17
gcaattaacc ctcactaaag ggaac 25
<210> 18
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Oligonucleotide primer ZC694
<400> 18
taatacgact cactataggg 20
<210> 19
<211> 32
<212> DNA
<213> Artificial Sequence
<220>
<223> Oligonucleotide primer ZC19514
<400> 19
gcgcgcggcc ggccaccatg cccattctca as 32
<210> 20
<211> 32
<212> DNA
<213> Artificial Sequence
<220>
<223> Oligonucleotide primer ZC19515
<400> 20
gcgcgcggcg cgcctcaaac tcggatctca tc 32
<210> 21
<211> 19
<212> DNA
<213> Artificial Sequence
<220>
<223> Oligonucleotide primer ZC18489
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
<400> 21
tcatcgccat ggtaaccac 19
<210> 22
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Oligonucleotide primer ZC18106
<400> 22
aaacgcagtc tcctgtccag 20
<210> 23
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Oligonucleotide primer ZC18438
<400> 23
gcatttgagc tcaaacctcc 20
<210> 24
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> Oligonucleotide primer ZC18165
<400> 24
aagcatgcgg agtccatcat g 21
<210> 25
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
16
<223> Oligonucleotide primer ZC18214
<400> 25
tgctgtctca agacagccag 20
<210> 26
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Oligonucleotide primer ZC18275
<400> 26
ttagtgcaca tgctcgcagc 20
<210> 27
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> Oligonucleotide primer ZC18213
<400> 27
tattctgcac tggccttcct c 21
<210> 28
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Oligonucleotide primer ZC18285
<400> 28
tggcctcaaa tggatgccag 20
<210> 29
<211> 20
<212> DNA
<213> Artificial Sequence
CA 02390491 2002-05-07
WO 01/34803 PCT/US00/30945
17
<220>
<223> Oligonucleotide primer ZC18388
<400> 29
tgttaatagg tctgcctcag 20
<210> 30
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> Oligonucleotide primer ZC18105
<400> 30
agtcaacctc agggctcata c 21
<210> 31
<211> 19
<212> DNA
<213> Artificial Sequence
<220>
<223> Oligonucleotide primer ZC18452
<400> 31
agagtgctga gttaaacgc 19
