Note: Descriptions are shown in the official language in which they were submitted.
CA 02391084 2002-05-10
WO 01/36624 PCT/EP00/11197
HIGH ORDER NUCLEIC ACID BASED STRUCTURES
The present invention relates to nucleic acid based molecular structures that
bind
to other molecular entities, especially entities other than nucleic acids
s themselves. In particular, the invention relates to nucleic acid based
molecular
structures with pharmaceutical activity through binding to specific molecular
targets and thereby influencing disease states. The invention also relates to
nucleic acid based molecular structures with diagnostic utility.
to There is a great desire to provide compositions of matter that are able to
specifically alter the activity of particular proteins or modulate the
expression of
particular gene products. In particular there is a desire for molecules able
to form
specific binding interactions with other molecules and especially for such
molecules to exhibit specific binding within the in vivo milieu.
~5
Against these desires, methodologies have been developed to enable the
creation of libraries of classes of molecules from which to select such
compositions of matter. A pertinent example is the exquisite specificity of
binding
found in the antibody molecule and several significant technologies now exist
for
~o the development of monoclonal antibodies and recombinant derivatives
thereof.
These have provided a number of therapeutic drugs and many diagnostic and
research tools. All such products are protein molecules and as such can only
be
NrvuuCcu usinC~ bIOIv~ivai S'y'StemS. Alternative Whully SyritilCii~ uiiiding
molecules have been produced. These are molecules selected from a diverse
?s library of similar or variant molecules of the same chemical class, and in
general
selected using a screening system providing a surrogate of the desired
therapeutic target or some aspect of its activity. The screening of vast
chemical
libraries of small molecules has been a classical route to the development of
conventional small molecule pharmaceuticals but libraries of synthetic
peptides
~o and synthetic nucleic acid molecules are now also screened for potentially
useful
therapeutics.
For libraries of nucleic acids, the technical approach has in general been the
use
of single-stranded RNA or DNA molecules of defined unit length. The basis of
WO 01/36624 - 2 - PCT/EP00/11197
binding to a target molecule is not pre-configured and may be dependent on
secondary structure formation within the DNA (or RNA) molecule itself
facilitating
binding to the other molecular entity (Bock L.C. et al 1992 Nature 355: 564-
566;
Kubrik, M.F. et al 1994 Nucleic Acids Res. 22: 2619-2626). The creation of
s nucleic acid molecules containing pre-configured tracts of secondary (or
high
order) structure for therapeutic and diagnostic utility has not been
previously
attempted, and is the object of the present invention.
The present invention relates to novel high order nucleic acid structures and
to
io novel uses of such structures.
Several types of high order nucleic acid structures are known in the prior
art.
One type of such nucleic acids are termed aptamers and differ from the
molecules of the present invention in respect of their size, manufacture and
is topological complexity. Methods involving either in vitro evolution or
selection
from vast random library pools have been applied to the development of both
RNA and DNA aptamers. RNA molecules capable of facilitating enzymatic
process such as polynucleotide kinase activity have been evolved by iterative
cycles of selection (Lorsch J.R. & Szostak J.W. 1994 Nature 371: 31-36), and
2o short single stranded DNA molecules have been selected capable of highly
specific inhibition of human phospholipase Az (Bennett C.F et al 1994 Nucleic
Acids Res. 22: 3202-3209). Others have independently developed either RNA or
DNA based aptamers capable of binding and inhibiting some of the functions of
human thrombin (Bock L.C. et al 1992 Nature 355: 564-566; Kubrik, M.F. et al
2s 1994 Nucleic Acids Res. 22: 2619-2626).
Other types of high order nucleic acid structures include "branched-DNA"
(Horn,
T. & Urdea, M. S. 1989, Nucleic-Acids-Res. 17: 6959-6967) whereby one or more
regions of a DNA molecule ("probe") which hybridizes to a complememtary
~o nucleic acid molecule can themselves be subjected to hybridization to other
DNA
molecules in order to amplify the amount of DNA associated with the DNA probe.
However, the complexes described by Horn and Urdea (ibid) are linearly
extended whereby newly hybridized nucleic acid molecules are not designed to
hybridise to molecules previously annealed but to other incoming new molecules
CA 02391084 2002-05-10
WO 01/36624 - 3 - PCT/EP00/11197
to form branched-DNA structures. Indeed, such complexes are simply designed
to form as many branches as possible in order to provide more points for
annealing of a signaling nucleic acid probe.
s Other geometric structures afforded by the base-pairing properties of
nucleic
acids have been exploited in the fields of material science and nanotechnology
(Aliviatos, A.P. et al 1996, Nature 382:609-611; Mao C. et al 2000, Nature
407:
493-496; Yurke, B. et al 2000, Nature 406: 605-608). Elegant technical methods
for the manufacture and analysis of high order nucleic acid based structures
to including quadrilaterals, cubes octahedra and triangular motifs multiply
connected
into a lattice have been described (Chen J. et al 1989, J. Am.Chem. Soc. 111:
6402-6407; Zhang et al 1994, J. Am. Chem. Soc. 116:1661-1669; US. Pat. No
5,278051; US. Pat. No 5,468,851; US. Pat. No 5,386,020 & US. Pat. No
6,072,044). The geometric objects are closed structures fabricated using
iterative
Is processes involving restriction enzymes and DNA ligation. Nodal points in
the
figures may be fixed by cross-over junction between stands to give a rigid
form,
or more flexible branches achieved by cross-annealing disparate stands. The
prior art does not include geometric structures which are not closed (i.e.
ends
ligated). The prior art does not include geometric structures which include
2o regions of modified nucleic acids and does not include geometric nucleic
acid
structures conjugated to other molecular entities. The prior art does not
include
the use of libraries of randomised or semi-randomised nucleic acid structures.
In relation to novel uses of high order nucleic acid structures, it is
recognised that
2s exploitation of "low order" nucleic acids as therapeutic and diagnostic
molecules
per se is known in the art. In particular there are many examples of nucleic
acid
molecules with potential and or actual therapeutic activity. These operate
either
as antisense molecules, triplex reagents or as RNA molecules with
endoribonuclease activity ("ribozymes"). In all of these guises, the modality
of the
~o therapeutic nucleic acid is as a modulator of protein expression by a
mechanism
of action that reduces or blocks protein translation. The specificity of
target
binding in all of these cases is nucleic acid to nucleic acid. These features
(translation modulation, nucleic acid to nucleic acid binding) are in contrast
to the
modality of the present invention. A distinctive and inventive feature of the
CA 02391084 2002-05-10
WO 01/36624 - 4 - PCT/EP00/11197
present invention is the use of a high-order nucleic acid structure with
binding
activity to a target molecule.
Other "low order" nucleic acid structures, especially Aptamers, have been
tested
s as therapeutic and diagnostic molecules. Certain other nucleic acid
molecules,
especially ribozymes, have been identified as having enzymatic activities with
potential pharmaceutical importance. For closed geometric structures,
pharmaceutical utility has not been considered although US. Pat No 5,278,051
speculates possible utility as solubilising agents or controlled release
vehicles for
to small molecule therapeutics.
A first aspect of the present invention relates to novel high order nucleic
acid
based structures, particularly open geometric structures. Furthermore, the
invention also relates to the utility of such structures as pharmaceutical
and/or
Is diagnostic agents. The invention also relates to high order nucleic acid
based
structures including nucleotides with modifications. The invention also
relates to
high order nucleic acid based structures including regions of randomised or
semi-
randomised nucleotides. The invention also relates to high order nucleic acid
based structures conjugated to other molecular entities such as proteins.
Structures of the present invention exploit the Watson-Crick base pairing
rules in
engineering regions of double stranded structure. Single-stranded nucleic acid
molecules have the ability to anneal (hybridise) to other single-stranded
molecules by virtue of complementarity between the bases. Whilst such base
2s annealing of two single-stranded molecules usually leads to a linear double-
stranded molecule, other structures can be produced for example hairpin loops
where one molecule has internal base-pair complementarity and circles where
both ends of each single-stranded molecule have mutual complementarity. With
strategic design of single-stranded nucleic acid sequences, individual
molecules
~o can be designed which can simultaneously anneal to two or more other
molecules and if, in turn, these other molecules can also anneal to further
molecules including molecules already involved in annealing, then complexes of
nucleic acids can be formed.
CA 02391084 2002-05-10
WO 01/36624 - 5 - PCT/EP00/11197
The overall dimensions and topology of the double stranded DNA molecule are
well understood. Double stranded DNA is quite flexible and the helix is able
to
adopt a number of conformations differing in the angle of rotation between
adjacent base pairs along the helix. Naturally occurring single stranded
nucleic
s acid molecules such as RNA adopt preferred conformations in solution. The
conformation is dictated by base-pairing interactions within the same molecule
leading to the production of a stabilised structure composed of double
stranded
stems and single stranded loops. The molecules will adopt the conformation of
lowest energy and this structure for a known sequence of RNA is capable of
to prediction by computational approaches (Jaeger J.A. et al 1989
Proc.NatI.Acad.
Sci USA 86: 7706-7710). Attempts have been made to produce predictive
software for DNA folding and have shown some success (Nielsen D.A. et al 1995
Nucleic Acids Res. 23: 2287-2291). Dimensional comparison between nucleic
acid and protein molecules illustrates the very significant difference in
structural
is arrangement between these two classes of molecule, but also support the
concept underlying the present invention. A typical globular protein such as
myoglobin with molecular weight 17kDa has a size in its longest dimension of
3nm. A larger globular protein such a bovine serum albumin with molecular
weight 68kDa is 5nm in its longest dimension (Cohen C., in Wolstenholme
2o G.E.W. & O'Connor M. (eds), Ciba Foundation Symposium, London, J & A
Churchill, 1966). The diameter of the double stranded helix is in itself 2nm
and
DNA strands of a small number of base pairs such as 100, would achieve a
contour length approaching 30nm. Thus although the density of DNA or any
other nucleic acid molecule is much less than a typical protein, the topology
the
2s DNA molecule, even in its most structured native form as a double helix,
could
readily cover large parts of the exposed surface of almost any protein
molecule:
In particular if the topology of the usually monofilament DNA were so altered,
the
DNA could occupy a large area of space in a manner more akin to a much higher
density protein molecule. It can be recognised that assembly of nucleic acid
~o structures composed of multiple interconnected strands each of only short
(<50)
nucleotide tracts can readily result in structures with overall dimensions in
the
range 10-500 nm. It is a particular objective of the present invention to
provide
for such a formulation of nucleic acid molecule.
CA 02391084 2002-05-10
WO 01/36624 - 6 - PCT/EP00/11197
Structures of the present invention are based on the creation of DNA or RNA
molecules with secondary structures formed as a result of the interaction of
two
or more molecules of nucleic acid or, alternatively, as a result of
interaction of
different defined segments within individual molecules of nucleic acid. In the
s present invention, the informational content of DNA or RNA is exploited not
as a
coding entity for expression of a therapeutic protein, nor as a blocking
entity for
nucleic acid metabolism and gene expression (anti-sense) but to direct
assembly
of a molecular structure of particular shape in three-dimensions.
to The present invention includes nucleic acid molecules, particularly
synthetic DNA
molecules, which form three-dimensional (non-planar) molecular structures by
specific base pairing within the molecules in the set. Specifically, the DNA
molecules are designed to have 1 or more regions of sequence ("domains") that
can anneal to other molecules in the set ultimately to form a composite three-
Is dimensional nucleic acid structure. Under this scheme, an approximate
cuboid
structure can be formed by the self-annealing of 6 synthetic DNA molecules
each
containing 4 domains of complimentarity whereby each molecule interacts with 4
other molecules and whereby each molecule acts effectively like an individual
side of a 6-faced cube. The structure is open (not covalently closed),
flexible and
?o in particular further embodiments amenable to modification by the addition
of
other functional or structural groups.
In one high order nucleic acid based structure of the present invention, there
are
provided nucleic acid molecules each comprising 2 or more domains of self-
2s complementary sequence enabling the nucleic acid molecule to fold upon
itself
and to interact with each other to form a particular three-dimensional
molecular
structure via specific base-pairing events. For certain applications, it is
recognised that chemical instability of unmodified DNA molecules has been a
significant problem for uses such as therapeutic. Several approaches are now
~o available for protecting DNA molecules from degradation by enzymatic
attack.
These generally include the use of modified phosphodiester backbones
(methylphosphonate, phosphorothioate, peptide nucleic acids) or capping 5' and
or 3' termini using phosphoramedite, phosphorothioate or phosphorodithioate
linkages. It is a particular objective of the present invention to exploit
modified or
CA 02391084 2002-05-10
WO 01/36624 ~ - PCT/EP00/11197
non-natural nucleic acids in the high order nucleic acid based structures.
Moreover a particularly desired feature is the increased flexibility in
binding
specificity achieved by use of mixed chemistry and alternative non-natural
nucleic
acid backbones.
The nucleic acid sub-units of a high order nucleic acid structure of the
present
invention may be homotypic or heterologous in nature, for example DNA
containing tracts of RNA. It is known that tracts of RNA within a DNA helix
alter
the coiling in solution (Wang, A. et al, 1982 Nature, 299: 601-04). The
ability to
to offer conformational diversity within a localised tract of nucleic acid may
be
significant in altering binding specificity to the target protein, and this
phenomenon is known in the art where the binding specificity a thrombin
aptamer
was dependent on a short tract of highly ordered tertiary structure (Griffin,
L. et al
1993 Gene 137:25-31 ). Additionally, non-natural phosphate backbone analogues
is may be exploited to enhance stability and also alter the binding
specificity to the
desired target protein. Latham et al (Latham, J.A. et al 1994 Nucleic-Acids-
Res.
22: 2817-22) provide an example whereby the modified nucleotide, 5-(1-
pentynyl)-2'-deoxyuridine was used in place of thymidine in a pool of random
oligonucleotides. The present invention includes molecules composed of tracts
?o of single stranded nucleic acid, interspersed with tracts of double
stranded
structure, and other chimeric molecules synthesised to contain different
chemical
sub-structure but joined exploiting conventional base-pairing rules. Such
structures may also combine molecules of DNA and RNA.
2s Higher order molecular structures of the present invention are assembled
from
individual or multiple nucleic acid molecules according to any scheme present
in
the art and may include synthetic nucleic acid species or fragments from much
larger molecules such as recombinant plasmids. The structures may be built
following self-folding (auto-assembly) or facilitated folding of a single
linear
~o molecule of DNA. Facilitated folding may be mediated by proteinacious
entities
(enzymes such as ligase, topoisomerase, endonuclease, polymerase) or via
interaction with non-protein physiochemical conditions (pH, temperature, ionic
conditions). Alternatively and or in combination with the above, the molecule
may
be assembled by interaction with molecules bound to a solid matrix, or whist
the
CA 02391084 2002-05-10
WO 01/36624 - 8 - PCT/EP00/11197
DNA undergoing folding into a higher order structure is tethered or anchored
in
space during all or part of the assembly process.
A second aspect of the present invention is the provision of libraries of
nucleic
s acid molecules formed to contain a range of semi-random molecules some of
which may possess a desired topology capable of interacting in a specific
manner
with a target molecule. Included in this aspect of the invention are libraries
of
nucleic acid molecules featuring a guide framework to facilitate assembly of a
common structural sub-unit. Within each sub-unit a randomised tract of
to sequence is incorporated maximising library diversity and potential
functional
utility with respect to activity in a selective binding assay. In the second
aspect of
the present invention, an embodiment whereby a library formed from mixtures of
n separate populations (sets) of synthetic DNA molecules (sub-units) is
exploited.
In this aspect, the population size of the synthetic nucleic acid sub-units is
large
is and dictated by the degree of randomisation present within a variable
segment of
the sub-unit. Further sub-unit diversity is inbuilt in other embodiments by
variation of the positioning of the variable domain, variation in the number
of
variable domains (by interspersion with tracts of fixed sequence) and
variation in
the length of any given variable domain. It is preferred that n separate
population
20 of sub-unit are mixed in a single cycle of annealing to create a library of
multiple
nucleic acid structures and individual sequence diversity. It will be obvious
that
other embodiments may include multiple cycles of annealing and multiple values
of the whole integer number n.. A particular feature of the library under this
scheme is the ability to modulate the degree of complexity of inter-subunit
2s interaction by judicious design and placement of the complementary or guide
sequence tract.
A third aspect of the present invention is the novel utility of high order
nucleic acid
based structures, especially for pharmaceutical and diagnostic use. In this
3o aspect, these structures are capable of binding to a specific target
molecule,
commonly a protein or proteinaceous target molecule. Where the preferred
embodiment encompasses a single protein target, further embodiments are
envisaged whereby the target is a protein complex comprised of multiple
protein
sub-units such as a cell surface receptor, collectively bound by a molecule of
the
CA 02391084 2002-05-10
WO 01/36624 9 - PCT/EP00/11197
first aspect of the invention. Other embodiments of the third aspect include
the
binding to a cellular target or cell species identified by an ability to bind
a
molecule of the first aspect. Further embodiments include binding to a target
or
target complex containing non-protein components for example carbohydrate or
s lipid components of the cell and in particular of the cell surface. Protein,
carbohydrate and lipid entities and or complexes thereof may be disease
specific
entities or present as normal components of a tissue or cell. The target or
target
complex would include viral particles or viral derived components such as
capsid
proteins or host derived components of the viral coat. The target or target
to complexes may include metallic ions or other inorganic chemicals or
chemical
groups in their composition and may be naturally occurring or introduced by
treatments with exogenous agents. Target receptors may include those such as
the IL-2 receptor or other cytokine receptors such as receptors for IL-3, M-
CSF,
GM-CSF and numerous others. Equally, surface molecules such as the IgE
is receptor whereby blockade of IgE binding together with blockade of a cross-
linking activation event at the receptor would be a highly desired outcome.
Other
surface molecules including members of the cluster differentiation (CD
antigens)
series are desired targets for disease modulation and in particular in respect
of
diseases of auto-immune component.
The invention is designed to have particular widespread application in the
field of
therapeutic molecules. Molecular structures of the invention are desired to
agonise or antagonise particular receptors or enzymatic processes for
therapeutic
benefit whilst contributing none of the disadvantages of conventional protein
2s therapeutics such as immunogenicity. The invention therefore extends to a
method for treating or preventing a disease or condition, the method
comprising
administering to a subject an effective amount of the molecular structure. The
invention also extends to the use of such structures in in vivo and in vitro
diagnosis.
~o
A fourth aspect of the present invention comprises high order nucleic acid
based
structures with modified nucleotides included in the structures. Separate from
or
in addition to the diversity imposed by the above second aspect, it is
particularly
desired to impose diversity by the derivitisation of the sub-units of the
library and
CA 02391084 2002-05-10
WO 01/36624 - 1 ~ - PCT/EP00/11197
or by the inclusion of modified bases during their synthesis (thiolated bases,
biotinylated bases, epsilon-amino derivatised bases etc.). Thus, a highly
diverse
library with diversity at the both the level of sequence composition and
sequence
length is obtained. Such parameters can be fixed within defined limits for
s different libraries and different target applications. The high order
nucleic acid
structures will also contain modified nucleotides capable of conferring
particular
desired properties to the structure additional to features providing stability
or
binding modulation as above. Such additional desired modifications may be
embodied under the first or second aspects of the invention and include the
use
to of hydrophobic tracts, the inclusion of psoralen or acridine groups,
linking
haptenic group such as biotin or linking to different charged side chains such
as
amino groups or carboxyl groups to provide facilitated binding to a particular
target molecule. In a further preferred embodiment, such groups may act as
points for attachment of other molecules such as further nucleic acid
molecules or
is proteins such as an antibody or an enzyme.
A desired feature of molecules of the invention will be high stability in
vitro and in
vivo. The chemical composition of the nucleic acid structures is highly
influential
but also the physical size of the molecule requires control to minimise shear
2o damage in solution and maximise functional utility in vivo. For this
reason, the
preference of the invention is for multi-chain nucleic acid structures
constructed
from generally small (<80mer) sub-units. Alternatively, the exploitation of a
structure composed of larger sub-units (>80mer) may be desired and equally
fall
into the scope of the present invention.
2s
A fifth aspect of the present invention comprises high order nucleic acid
based
structures attached to other molecular entities. In particular, this aspect
includes
nucleic acids attached at one or more specific sites to one or more specific
sites
on the other molecular entity whereby specific attachment to the nucleic acid
is
~o facilitated by modified nucleotides as in the fourth aspect of the
invention. In
particular, this aspect comprises high order nucleic acid based structures
attached to pharmaceutically or diagnostically relevant molecular entities
whereby
the nucleic acid binds to specific molecular targets relating to disease and
the
attached molecular entity is then used to combat or detect the disease.
CA 02391084 2002-05-10
WO 01/36624 - 11 ~ PCT/EP00/11197
Pharmaceutically relevant entities will include cytokines, Fc portions of
antibodies, other antibody-related entities, toxins, enzymes, drugs and pro-
drugs,
receptor agonists or antagonists, receptor molecules themselves (especially
ligand binding domains), radioisotopes, pharmaceutically active nucleic acids,
s drug transport vesicles such as liposomes, live or attenuated
microorganisms,
light activatable moieties, and other molecular entities which induce a
vaccination
effect. Diagnostically relevant entities will particularly include
radioisotopes, light
activatable moieties such as those producing a chemiluminescent signal,
fluorochromes, enzymes, and signal transport vesicles such as beads.
to
To sum up, the invention comprises the following objects:
~ A three-dimensional poly-nucleic acid structure, composed of multiple
interconnected strands of nucleic acid molecules or segments thereof by
specific base pairing interaction of two or more molecules, characterized in
is that the structure is not covalently closed.
~ A corresponding poly-nucleic acid structure, characterized in that the
structure
is formed by two or more nucleic acid molecule strands.
~ A corresponding poly-nucleic acid structure, characterized in that the
structure
is formed by three or more nucleic acid molecule strands.
20 ~ A corresponding poly-nucleic acid structure, characterized in that said
structure is a cube or has essentially the form of a cube.
~ A corresponding poly-nucleic acid structure, wherein the cuboid structure is
formed by six nucleic acid molecule strands, wherein each molecule strand
acts like an individual side of the 6-faced cube.
2s ~ A corresponding poly-nucleic acid structure, wherein each nucleic
sequence
comprises two or more domains that can anneal to other molecules in the set.
~ A corresponding poly-nucleic acid structure, wherein each nucleic sequence
comprises four domains.
~ A corresponding poly-nucleic acid structure, wherein said structure includes
~o nucleic acid molecules which are composed of tracts of single stranded
nucleic acid, interspersed with tracts of double stranded structure.
~ A corresponding poly-nucleic acid structure according to any of the claims 1
-
8, wherein each nucleic acid strand has less than 80, preferably less than 50,
nucleotides.
CA 02391084 2002-05-10
WO 01/36624 - 12 - PCT/EP00/11197
~ A corresponding poly-nucleic acid structure, wherein said structure has the
assembly (A1+B1+C1)+(A2+B2+C2) as depicted in Figure 1.
~ A poly-nucleic acid structure as defined above, wherein said structure
contains sub-units which are composed of a variable randomized sequence
s tracts in order to get semi-random molecules or segments thereof capable of
interacting with a target molecule.
~ A three-dimensional poly-nucleic acid structure containing sub-units which
are
composed of multiple interconnected strands of nucleic acid molecules or
segments thereof by specific base pairing interaction of two or more
to molecules, wherein said structure is covalently closed and contains sub-
units
which are composed of a variable randomized sequence tracts in order to get
semi-random molecules or segments thereof capable of interacting with a
target molecule.
~ A poly-nucleic acid structure as defined above, wherein the sequence
is composition and sequence length is variable.
~ A corresponding poly-nucleic acid structure, wherein the variable sequence
composition is achieved by a one or more modifications of nucleotides within
the sequence.
~ A poly-nucleic acid structure as defined above, wherein said structure
2o contains sites or groups of nucleic acids which can bind or attach to
another
molecule or a solid matrix.
~ A corresponding poly-nucleic acid structure, wherein said other molecule is
a
protein, an enzyme, a lipoprotein, a glycosylated protein, an immunglobuline
or a fragment thereof.
zs ~ A corresponding poly-nucleic acid structure, wherein said other molecule
is a
nucleic acid.
~ A corresponding poly-nucleic acid structure, wherein said molecule is
pharmaceutically effective.
~ A pharmaceutical composition comprising a poly-nucleic acid structure as
3o defined above and in the claims optionally together with suitable carriers,
excipients and diluents and / or other pharmaceutically effective compounds.
~ Use of a corresponding poly-nucleic acid structure as diagnostic agent.
CA 02391084 2002-05-10
CA 02391084 2002-05-10
WO 01/36624 - 13 - PCT/EP00/11197
~ Use of a poly-nucleic acid structure as defined above for the provision of a
library for affecting a diversity of specifically randomized topologies in
order to
obtain different functionalities and / or activities.
s BRIEF DESCRIPTION OF THE DRAWINGS
FIGURE 1
Depiction of the step-wise assembly of an open cuboid nucleic acid structure
from
six individual single stranded molecules given as A~, A2, B~, B2, C, and C2.
to Assembly proceeds via conventional antiparallel base pairing between
nucleic
acid molecules. Dimeric intermediates formed between molecules B~ and C~,
also B2 and CZ are shown. Trimeric structures formed between molecules A~, B~
and C~ also A2, B2 and C2 are shown. Assembly of the cuboid structure is
achieved by association of the two trimeric moieties and is depicted as
molecule
15 (A~+B~+C~)+(A2+B2+C2).
FIGURE 2
Sequence of oligonucleotide sub-units IL2R-1 and IL2R-2 comprising DNA
structure with binding activity to IL-2 receptor.
FIGURE 3
Sequence of oligonucleotide sub-units TB-R1 and TB-R2 comprising DNA
structure with binding activity to human thrombin.
2s EXAMPLES
The invention is illustrated by the following examples which should not be
considered to be limiting in scope.
3o EXAMPLE 1
Method for inhibition of an IL2-dependant cell line using a DNA structure
selected
from a DNA structure library.
WO 01/36624 - 14 - PCT/EP00/11197
Two libraries of synthetic DNA molecules, each of comprising a region of
randomised sequence were synthesised.
Library A comprised molecules of structure:
5'AGTCCCAAGCTGGCT(N)~3CTCCATCGTGAAGTCAGCCAGCTTTGGACT
Library B comprised molecules of structure:
to 5'GACTTCACGATGGAGGTCAGAATGTGAATA(N)IOTATTCACATTCTGAC
These sequences were designed to facilitate cross-annealing and represent sub-
units of a structure library formed by mixing and cross-annealing of different
sub-
units according to the scheme of the present invention.
Oligonucleotide (sub-unit) libraries were synthesised with phosphorothioate
linkages to maximise stability in the presence of serum factors and purified
by
HPLC. Purified oligonucleotides were obtained from GenoSys Biotechnologies
(Cambridge, UK). A DNA structure library was assembled using a single cycle of
2o cross-annealing. Sub-unit libraries A and B were denatured, mixed and
annealed
at a temperature of 37°C in a solution of 50mM Tris pH 7.4, 100mM NaCI,
5mM
EDTA. Mixing of sub-unit libraries A and B was conducted at equimolar
concentration (1 DM). In other experiments mixing was conducted using
different
molar ratios. Assembly of the subunits was verified by gel electrophoresis.
The DNA structure library was screened for structures able to bind the extra
cellular domain of the IL-2 receptor (IL2R). This was conducted using soluble
recombinant IL2R prepared according to published methods (Meidel, M.C. et al
1988 Biochem. Biophys. Res. Common. 154: 372-379; Meidel, M. C. et al 1989,
~o J. Biol. Chem. 264: 21097-21105). Recombinant IL2R was covalently bound to
surface activated magnetic beads using protocols recommended by the supplier
(Bangs Labs, Fishers, IN, USA). The IL2R-beads were used as an affinity
surface to select binding structures from the DNA structure library. IL2R-
beads
were reacted with the library under a number of experimental conditions
including
CA 02391084 2002-05-10
WO 01/36624 - 15 - PCT/EP00/11197
the presence of chaotrophic salts in control reactions. The library (DNA)
concentration was approximately 100nmol in annealing solution as above.
Binding molecules were recovered by polymerase chain reaction (PCR) directly
from the beads following extensive washing cycles with a solution of 75mM
s Tris.HCL, 200mM NaCI, 0.5% N-octylglucoside pH8Ø The PCR was conducted
using the primer PRA1 (5'-AGTCCCAAGCTGGCT) to recover the library A
component using standard reagent systems and conditions. In separate
reactions, primers PRB1 (5'GACTTCACGATGGAG) and PRB2
(5'GTCAGAATGTGAATA) were used to recover the library B component. The
to PCR products were cloned and sequenced using standard reagent systems and
procedures.
A number of sequences were recovered and identified as originating from sub-
unit library A and sub-unit library B. Of these one pair was synthesised using
is phosphorothioate chemistry as before. Oligonucleotides IL2-R1 and IL2-R2
(sequences provided in Figure 2) were purified and assembled as previously,
and
used in a cellular assay for IL-2 antagonism.
TALL-104 (ATCC# CRL-11386) is a human T-cell leukaemia cell line. The cells
2o grow in suspension culture and require IL-2 for optimal growth. The cells
may be
grown for short period without IL-2 but their growth is significantly reduced.
Cells
were grown in Iscoves modified Dulbeccos medium (Life Technologies, Paisley,
UK) with 50-100u/ml recombinant human IL-2 (Life Technologies, Paisley, UK)
and supplemented with 10% (v/v) heat inactivated foetal calf serum. Cells were
2s cultured in an atmosphere of 8-10% C02. Dilutions of the annealed IL2-
R1/IL2-
R2 DNA preparation and a control DNA sample containing random sequence of
identical contour length were prepared in culture medium containing IL-2. A
parallel dilution series was prepared using medium lacking IL-2. The dilution
series ranged from 50~M DNA to 390nM DNA. Assays were performed using
~o sub-confluent TALL-104 cells plated the preceding day in 96 well micro-
titre
dishes. Cells were collected by centrifugation, washed with pre-warmed
(37°C)
phosphate buffered saline and the DNA containing medium added for 48hours.
Treatments were carried out in quadruplicate. Proliferation was assessed at
the
end of the 48hour period in a colourimetric assay using a commercially
available
CA 02391084 2002-05-10
WO 01/36624 - 16 - PCT/EP00/11197
tetrazolium compound and following instructions provided by the supplier
(Promega, Southampton, UK). Microtitre plates were read at 540nm.
The results showed that the annealed DNA preparation inhibited growth of the
s TALL-104 cell line under conditions where individual synthetic
oligonucleotides
IL2-R1 and IL2-R2 were inactive.
EXAMPLE 2
Method for selection of a DNA structure binding to human thrombin.
to
The library described in example 1 was used to select for a DNA structure able
to
bind to human thrombin. The library was screened using a human thrombin
preparation (Sigma, Poole, UK) linked to surface activated magnetic beads as
per
example 1. Thrombin-beads were reacted with the DNA structure library as per
Is example 1 except the post binding wash was conducted in a solution of 20mM
Tris acetate, pH7.4, 140mM NaCI, 5mM KCI, 1 mM MgCl2. Binding molecules
were recovered directly from the beads by PCR using reactions and primer sets
as for example 1. The PCR products were cloned and sequenced using standard
reagent systems and procedures.
A number of sequences were recovered and identified as originating from sub-
unit library A and sub-unit library B. Of these, one pair was synthesised
using
phosphorothioate chemistry as before. Oligonucleotides TB-R1 and TB-R2
(sequences provided in Figure 3) were purified and assembled. The TB-R1/TB-
2s R2 complex was used in a thrombin inhibition assay. Clotting time was
measured
using a fibrometer at 37°C and adult human plasma freshly prepared from
a
healthy donor. The extent of thrombin inhibition was determined using a
thrombin
standard curve plotting clotting time versus thrombin concentration. Clotting
time
was measured over three logs of DNA structure in the assay.
~o
The results showed inhibition or' clotting activity in the presence of the TB-
R1/TB-
R2 DNA complex.
CA 02391084 2002-05-10
WO 01/36624 - 1 ~ - PCT/EP00/11197
EXAMPLE 3
Method for the selection of DNA structures binding to recombinant soluble CD4.
The library described in example 1 was used to select for a DNA structure able
to
s bind to a recombinant soluble CD4 (rsCD4) preparation. The DNA structure
library was screened using a CD4 preparation (BioDesign, Saco, ME, USA)
immobilised to activated magnetic beads as previously. Library screening,
washing and selection by PCR was as described for example 2. A single
oligonucleotide pair originating from the A and the B sub-unit libraries was
to synthesised and assembled. The structure was used to inhibit binding of
anti-
CD4 monoclonal RPAT4 (Serotech, Abingdon, UK) in an enzyme linked immuno
absorbant assay (ELISA).
96 well ELISA plates were coated overnight with a 0.2mg/ml solution of rsCD4
in
coating buffer (0.05M carbonate-bicarbonate buffer pH9.0) at 4°C.
Plates were
is washed extensively using TBS-T (tris-buffered saline pH8.0 .05% (v/v) Tween
20)
and test and control DNA structures were diluted (1:2) across the plate in TBS
from a starting concentration of 100~M. The plates were incubated for 40
minutes at 37°C and washed with TBS. A 100ng/ml preparation of antibody
RPAT4 in PBS was added to the plate and incubated for 40 minutes at
37°C.
2o Plates were washed and the bound RPAT4 detected using a alkaline phosphtase
labelled sheep anti-mouse preparation (Sigma, Poole, UK) and Sigma Fast OPD
(Sigma, Poole, UK) as a colour substrate. In some assays, the DNA was co-
incubated with the RPAT4 monoclonal. Colour intensity was read using a plate
reader and signal compared between test and control wells. The results showed
2s significant inhibition of RPAT4 binding to rsCD4 in the presence of the DNA
structure.
CA 02391084 2002-05-10
