Note: Descriptions are shown in the official language in which they were submitted.
CA 02393844 2002-06-05
WO 01/44280 PCT/US00/33123
METHODS AND COMPOSITIONS FOR THE
MANUFACTURE OF REPLICATION INCOMPETENT
ADENOVIRUS
s
Background of the Invention
Field of the Invention
to The present invention relates to complementing cell lines for the
production of replication incompetent viruses, which significantly reduce or
eliminate the presence of replication competent viruses. In particular, the
present
invention relates to complementing cell lines for the production of
replication
incompetent adenoviruses (Ad), which significantly reduce or eliminate the
15 presence of replication competent Ad (RCA) and can serve for. the large
scale
production of infectious replication incompetent adenovirus particles that may
be
used for the treatment of human patients as, for example, i.n gene therapy. As
well the invention relates to a method for the large scale production of
infectious
recombinant replication incompetent virus particles, in particular replication
20 incompetent adenovirus particles, harboring an exogenous sequence of
interest
and to a stock of infectious replication incompetent virus particles, in
particular
replication incompetent adenovirus particles, which is free from replication
competent virus particles, in particular RCA. The invention further relates to
nucleic acid complementation elements and to recombinant vectors comprising
25 such nucleic acid molecules for transfecting a eukaryotic cell line which
significantly reduce the presence of RCA and to a method therefor. In
addition,
the present invention relates to an assay for detecting the presence of
replication
competent virus particles, in particular RCA, in a stock of infectious
replication
incompetent virus particles, in particular replication incompetent adenovirus
30 particles, which employs a real time quantitative PCR assay with a
sensitivity
level to detect one replication competent virus particle per >_ 10~
replication
CA 02393844 2002-06-05
WO 01/44280 PCT/US00/33123
-2-
incompetent virus particles. The invention further relates to a method of
detecting the presence of replication competent virus particles, in particular
RCA,
in a stock of infectious replication incompetent virus particles, involving
utilization of such an assay, and a kit which supplies the components
necessary
to perform the assay.
Related Art
Therapeutic strategies in various disease states include nonspecific
t o measures to mitigate or eliminate a cell dysfunction and prevent cell
death,
replacement of a missing or malfunctioning protein, introduction of functional
nucleic acids (RNA or DNA) into cells to replace a mutated gene and
introduction
of novel genetic constructs to alter a cellular function. Advances in
recombinant
DNA technology have had a major impact on each of these therapeutic
possibilities and nucleic acid transfer appears to be a promising modality.
Viral vectors permit the expression of exogenous genes in eukaryotic
cells, and thereby enable the production of proteins which may require post-
translational modifications unique to animal cells. Gene therapy vectors
derived
from viruses require various modifications to eliminate their disease-causing
2o potential, yet retain their ability to: 1) replicate under controlled
conditions for
preparation of viral stocks during manufacturing; and 2) to infect and deliver
the
desired therapeutic gene to the diseased cell. Elimination of the disease-
causing
potential of viral vectors is normally achieved by deleting a subset of
genetic
elements from the viral genome to prevent independent viral replication in
patients. To manufacture these vectors, they are commonly propagated in
producer cells (or packaging cells) engineered to complement the replication
incompetent virus by expressing the subset of genetic elements deleted from
the
viral genome. A number of animal viruses have been employed as viral vectors,
including, adenoviruses, adeno-associated viruses, retroviruses, lentiviruses,
herpesviruses, poxviruses, alphaviruses, and picornaviruses.
CA 02393844 2002-06-05
WO 01/44280 PCT/US00/33123
-3-
The following characteristics of adenovirus (Ad) make it an attractive tool
for gene transfer or immunization: ( 1 ) the structure of the adenovirus
genome is
well characterized; (2) large portions of viral DNA can be substituted by
foreign
sequences; (3) the recombinant variants are relatively stable; (4) the
recombinant
virus can be grown at high titer; (5) no known human malignancy is associated
with adenovirus; and (6) the use of attenuated wild-type adenovirus as a
vaccine
is safe.
Generally, such replication-incompetent Ad vectors are constructed by
inserting the gene of interest in place of, or in the middle of, essential
viral
to sequences such as those found at the E1 locus (Berkner, BioTechniques 6:616-
629 (1988); Graham et al., Methods in Molecular Biology, 7:109-128, Ed: Murcy,
The Human Press Inc. (1991)). This deletion or insertional inactivation of
essential viral genes results in crippling the ability of Ad to replicate,
hence the
term replication-incompetent Ad. In order to propagate such vectors in cell
culture they must be provided with the deleted element, (e.g., the E1 proteins
in
the case of an E1 deleted vector).
The elucidation of the nucleotide sequence of many Ad subtypes has
enabled a precise characterization of the genomic organization thereof. The
nucleotide sequence of human adenovirus type 5 (Ad5) is available from
GenBank under accession number M73260. In simplistic terms the adenovirus
genome comprises: (1) two inverted terminal repeats (ITRs) at each end (5' and
3') which are essential for viral replication; (2) the early region 1 (E1)
containing
the E 1 A and E 1 B regions, both indispensable for replication, and
polypeptide IX
(pIX) which is essential for packaging of full-length viral DNA and forms a
component of the viral capsid; (3) the E2, E3 and E4 regions, with E3 being
dispensable for replication (reviewed in Acsadi et al., J. Mol. Med. 73:165-
180
(1995)); and (4) the late regions L1 through L5 which mainly encode virion
proteins and are all dispensable for replication (The Adenoviruses, Ed. Harold
Ginsberg, 1984, Plenum Press, NY).
CA 02393844 2002-06-05
WO 01/44280 PCT/US00/33123
-4-
Human Ad serotypes 2 and 5 have been used as vectors for efficient
introduction of genes into several cell types both in vitro and in vivo
(reviewed
in Trapnell et al., Current Opinion Biotech. 5: 617-625 (1994); and Acsadi et
al.,
J. Mol. Med. 73:165-180 (1995)). Several factors need to be taken into
consideration during the generation of Ad recombinants, among which is the
impaired growth characteristics of some of the recombinants ( Imler et al.,
Gene
Ther. 2:263-268 (1995); Massie et al., BioTechnol. 13:602-608 (1995); and
Schaack et al., J. virol. 69: 3920-3923 (1995)). These characteristics
complicate
the screening, propagation and production of high quality recombinant viral
1 o stocks with high titers (more than 10" pfu/ml). Critical issues relating
to the
characterization of such Ad vectors for gene therapy have been reviewed in
relation to clinical trials of the cystic fibrosis gene therapy (Engelhardt et
al.,
Nature Genetics 4:27-34 (1993); Zabner et al., Cell 75:207-216 (1993); Boucher
et al., Hum. Gene Ther. 5:615-639 (1994); Mittereder et al., Hum. Gene
Ther. 5:717-729 (1994); and Wilmot et al., Human Gene Ther. 7:301-318
(1996)). Potential sites for the insertion of a gene of interest in the
recombinant
Ad vectors comprise the E1 region, the E4 region, the E1 and E3 regions (i.e.
E1/E3-deleted Ad recombinants), the E1 and E4 regions, or the region between
the end of the E4 and the beginning of the 3' ITR sequences.
As alluded to above, E3-deleted recombinants are replication competent.
E I -and/or E4-deleted recombinants, however, are unable to replicate and the
missing gene products are provided in traps by an E1-complementing cell line
such as 293 (Graham et al., J. Gen. Virol. 36:59-72 (1977); Lochmuller et al.,
Hum. Gene Ther. 5:1485-1491 (1994)) or 911 (Fallaux et al., Hum. Gene Ther. 7:
215-222 (1996)), and E4-complementing cell line such as W 162 (Weinberg, D.,
and Ketner, G., Proc. Natl. Acad. Sci. USA 80:5383-5386 (1983)), or an E1/E4
complementing cell line such as IGRP2 (Yeh, P., et al., J. Virol. 70:559-565
(1996)). The 293 cells were established in the 1970s by stable transfection of
diploid human embryonic kidney cells with sheared human Ad5 DNA. The cell
line was originally constructed in the course of a study on the transforming
CA 02393844 2002-06-05
WO 01/44280 PCT/US00/33123
-5-
potential of the EI genes of Ad. Recently, Graham and colleagues mapped the
cellular-Ad5 DNA junctions in the chromosome of 293 cells and showed the
presence of contiguous Ad5 sequences from the left end of the Ad5 genome to
nucleotide (nt) position 4137 (Louis et al., Virology 233: 423-429 (1997)). A
second E1 complementing cell line, 911, was derived from diploid human
embryonic retinoblast (HER) cells and harbors nt 80-5788 of the human Ad5
genome (Fallaux et al., Hum. Gene Ther. 7: 215-222 (1996); also described in.
WO 97/00326, published January 3, 1997; ECACC No. 95062101).
The maximum deletion of approximately 3.0 kb in the E1 region of E1-
1 o deleted Ad vectors leaves intact the ITR sequence, the packaging signal at
the left
end of the adenovirus DNA (nt 188-358) and the pIX coding region (starting at
nt 3511). The E1 deletion, combined with a useful secondary deletion of a 1.9
kb
Xba I fragment (79 and 85 mu) in the nonessential E3 gene, allows for
inserting
approximately 7 kb of foreign DNA sequences in this first-generation
recombinant. Extensions of the deletion in the E3 regions further increase the
insert capacity to 8 kb, which meets the size requirements for most of the
gene
therapeutics (Bett et al., Proc. Natl. Acad. Sci. 91:8802-8806 (1994)).
Unfortunately, it has been documented that replication competent
adenovirus (RCA), also termed "revenant" adenovirus, can spontaneously appear
2o during infection and replication of the E1- or E1/E3-deleted recombinant Ad
in
293 or 911 cells. RCA is produced in the E1 complementing cells through the
acquisition of the E1 region ("complementation element") contained in the
cells
by the process of homologous recombination. RCA is formed at a very low
frequency, but the E1-positive revenants seem to have a growth advantage with
respect to their E 1-negative counterpane. The newly generated replication-
competent Ad eventually outgrows the original replication-deficient Ad in
large
scale preparations (Lochmuller et al., Hum. Gene Ther. 5: 1485-1491 (1994)).
The presence of these revenants could thus jeopardize the safety of human gene
therapy trials, especially when one considers the number of infectious viral
3o panicles required in certain applications.
CA 02393844 2002-06-05
WO 01/44280 PCT/US00/33123
-6-
Experiments performed with mouse muscle have taught the use of 2x109
virus particles to transduce more than 80% of the muscle fibers. Since a human
muscle is approximately 2500 times larger, that would translate the use of
approximately 10'z-10'3 viral particles to inject a single human muscle in
order
to achieve similar transduction rates. Assuming the presence of as little as
1/10
particles of E1+ revenant RCA in the stock, 10" replication-competent viral
particles would be injected into the patient's muscle tissue. It is clear that
such
an approach would fail to satisfy regulatory agencies.
The presence of homologous nucleotide sequences in the Ad vector
l0 overlapping the same sequences in the complementation element is
responsible
for homologous recombination and subsequent RCA production. 293 cells have
significant overlapping homology with most, if not. all, currently available
E1
deleted Ad vectors. Indeed, 293 cells have been deemed not suitable for large
scale production of clinical grade material since batches are frequently
contaminated with unacceptably high levels of replication competent adenovirus
(RCA) arising through recombination (Imler et al., Gene Ther. 3: 75-84
(1994)).
It should be stressed that the same authors have reported failure of numerous
attempts to construct stable and efficient E1-complementing cell lines,
confirming
that such an endeavor is therefore not a trivial task.
In an attempt to solve the problem of RCA generation Imler et al.
produced an E1-complementing cell line by stably transforming human lung
A549 cells with E1 sequences containing the Ela, Elb and pIX regions (Imler et
al., 1996, Gene Ther. 3: 75-84). A549 E1-complimenting cell lines were
obtained which express high levels of Ela RNA and protein. Strikingly,
however, the authors were unable to detect Elb protein expression in any of
the
A549 clones analyzed regardless of high level Elb RNA production from the
clones. It is also reported therein that the A549 clones, testing positive for
infection with E1-deleted Ad vectors, showed a transformed phenotype and that
the amplification yields therewith were significantly lower than those
obtained
3o with 293 cells. Furthermore, the constructs used by Imler et al. in this
work
CA 02393844 2002-06-05
WO 01/44280 PCT/US00/33123
_7_
contained a significant overlap of approximately 700 by between the
complementing element and the defective adenovirus vector at the 3' end of the
E 1 region. It follows that this overlap significantly increases the
probability of
homologous recombination and hence of the production of E1+ revenant RCA.
A disclosure of defective Ad vectors for the expression of exogenous
nucleotide
sequences in a host cell or organism, as well as vectors for the construction
of El-
complementing cell lines, along the same lines is also found in Imler et al.,
W094/28152. However, this document fails to give an assessment of the yield
of production of recombinant Ad by the complementing cell line, of the
1 o expression of the different adenovirus transcripts and proteins by the
complementing cell line, and very importantly of the presence or absence of
RCA
during the production process leading to the generation of a stock of
defective Ad
harboring the exogenous sequence of interest. It should be noted that
W094/28152 claims to diminish the problem of RCA production by deleting the
~ 5 5' ITR (a non-substantiated declaration).
An alternative system for reducing the risk of RCA formation during
production of E1-deleted Ad vectors is described in Massie, US 5,891,690. The
patent discloses an E1-complementing cell line having a stably integrated E1
complementation element comprising a portion of the Ad5 E1 region covering the
2o E 1 a gene and the E 1 b gene under the control of the human beta actin
promoter,
and lacking the 5' ITR, the packaging sequence, and the Ela promoter. A
specific
cell line described and claimed by Massie, designated BMAdEI-220-8 (ATCC
accession number CRL-12407) contains nt 532 - 3525 of AdS, which includes
E 1 a, the E 1 b promoter, and a portion of the E 1 b gene. However, the E 1
deleted
25 Ad disclosed in the patent contains a deletion of Ad5 nt 455-3333 and thus
preserves a sequence overlap of 192 by at the 3' end of the E1 complementation
element. Furthermore, the complementation element in this cell line does not
encode the 3' end of the E 1 b gene, coding for the 3' exon of the E 1 b 8.3
kDa
polypeptide. The BMAdEI-220-8 cell and related lines described by Massie
30 produce titers of E1 deleted Ad similar to those obtained on 293 cells.
However,
CA 02393844 2002-06-05
WO 01/44280 PCT/US00/33123
_g_
no assessment of RCA generation on the claimed cell line is disclosed in the
patent, and the presence of 3' overlap between vector DNA and the
complementation element in the cell line described by the patent would suggest
that RCA generation still remains a possibility.
An El-packaging cell line termed "PER.C6" (ECACC NO. 96022940)
has been described in the art (WO 97/00326, published on January 3, 1997;
Fallaux et al. Hum. Gene Ther. 9: 1909-1917 (1998)). The PER.C6 and related
cell lines described in the WO 97/00326 publication were derived from diploid
HER cells stably transfected with a plasmid construct containing nt 459 - 3510
l o of human AdS, corresponding to coding sequences for E 1 a and E 1 b, under
the
control of human phosphoglycerate kinase promoter. The cell line expresses Ad5
E 1 a and the two large E 1 b proteins, but it does not express the complete E
1 b 8.3
kDa protein as the second exon of the mRNA encoding this protein is
transcribed
from Ad5 nt 3595-3609. Prevention of RCA formation by the use of this cell
line during propagation of E1-deleted Ad vectors requires the use of matching
E1-deleted vectors which lack Ad5 nucleotides 459-3510, and such vectors are
disclosed in the WO 97/00326 application. Unfortunately, however, as existing
E1-deleted Ad vectors undergoing clinical testing contain various 5' and 3'
boundaries at their E1 deletion, it would be time consuming and expensive to
2o reengineer and reproduce safety and efficacy studies on each of the many
therapeutic adenovirus-based medicines currently making their way through the
regulatory approval process.
Compounding the problem of RCA generation is the lack of a reliable
assay to screen large-scale rAd virus preparations for the presence of RCA.
The
current assay is a cell-based biological assay (Hehir, K., et al., J. Virol.
70:8459-
8467 (1996)). This assay has a limit of detection of 1 RCA per 109 rAd pfu.
Clinical doses for rAd are in the range of 10'Z - 10'~ vector particles
(~10'°-10"
rAd pfu), and takes 6 weeks to complete, making the current assay unworkable
for routine quality control (QC) and product release testing due to the time,
and
3o the excessively large number of cells that would be required at this level.
The
CA 02393844 2002-06-05
WO 01/44280 PCT/US00/33123
-9-
assay is limited by the cellular toxicity associated with the virion particle.
The
maximum MOI tolerated by non-E1 complementing cells (such as A549) is 10
pfu/cell, so very large numbers of cells are required to test for the presence
of
RCA. While it is theoretically possible to increase the number of cells to
accommodate testing for RCA at higher sensitivity, this approach becomes
impractical. Testing a single proposed dose of therapeutic product (10'3
particles,
approximately 2x10" pfu) using this approach would require 2 x 10'°
cells,
corresponding to approximately 1000 ( 175 cmz) flasks, including controls.
RCA derived from El-deleted rAd obtain their E1 gene from the helper
1o cells. Therefore the presence of E1-coding sequences in the viral DNA
isolated
from purified preparations of rAd can be a measure for the presence of RCA in
the preparation. Polymerase chain reactions have the potential to detect these
sequences rapidly and reproducibly with high sensitivity. There exists a small
amount of literature describing attempts at developing conventional gel-based
~ 5 PCR RCA assays (Zhang, W., et al., Biot~chniques 18:444-447 (1995); Dion,
L.,
et al., J. Virol.Meth. 56:99-107 (1996)). Each of these reports suffers from a
lack
of sensitivity in the PCR analysis, with limits of sensitivity somewhere
between
5,000 and 5,000,000 copies of the E1 target. In fact, the primer pair that had
a
sensitivity of 50,000 copies of target was demonstrated to detect one pfu of
wild
2o type Ad virus in 109 pfu of E1-deleted virus (Zhang, et al., ibid.).
Thus, there exists a need in the art for innovative approaches to large
scale production of existing adenovirus vectors, and for the creation of
alternative
complementing cell lines that enable efficient production of safe, high
quality,
high titer adenovirus vectors without expensive and time consuming efforts
25 directed at reengineering of the vectors themselves. Similarly, there
exists a need
in the art for a rapid, sensitive, and reproducible assay to detect RCA in
high-titer
rAd virus preparations.
CA 02393844 2002-06-05
WO 01/44280 PCT/US00/33123
-10-
Summary of the Invention
The present invention provides an improvement to currently available
complementing elements and cell lines in that it provides stable complementing
cell lines which encode and express adenovirus gene products, but which do not
contain overlapping homology with adenovirus vectors. These complementation
elements and cell lines are flexible in that they do not require the use of a
limited
subset of matched vectors in order to avoid RCA formation.
In one embodiment the present invention provides an isolated nucleic acid
molecule comprising a polynucleotide which encodes at least 5 contiguous amino
acids of a naturally-occurring adenovirus polypeptide, wherein the sequence of
the polynucleotide is not a naturally occurring adenovirus nucleotide
sequence.
In another embodiment the present invention provides an isolated nucleic
acid molecule comprising a polynucleotide encoding at least 5 contiguous amino
acids of a naturally-occurring adenovirus polypeptide wherein the sequence of
the
polynucleotide is less than 97%, but at least 60%, identical to a naturally
occurring adenovirus nucleotide sequence.
In yet another embodiment the present invention provides an isolated
nucleic acid molecule comprising a polynucleotide encoding at least 5
contiguous
2o amino acids of a naturally-occurring adenovirus polypeptide wherein the
polynucleotide will not hybridize to a naturally occurring adenovirus genome.
Other embodiments of the invention provide a complementation element
comprising a nucleic acid molecule of the invention, a vector comprising a
nucleic acid molecule of the invention, the use of a vector of the invention
to
generate a complementing cell line, and a complementing cell line stably
transfected with a nucleic acid molecule of the invention.
In still another embodiment the invention provides a system for producing
adenovirus vectors, comprising: (a) a complementing cell of the invention; and
(b) an adenovirus vector having a nucleotide sequence which is not homologous
to the complementation element, but in certain embodiments, would be
CA 02393844 2002-06-05
WO 01/44280 PCT/US00/33123
-11-
homologous to at least a portion of the complementing element contained in the
cell but for the degeneracy of the genetic code.
It is another object of the invention to provide a method for producing
RCA-free stocks of recombinant adenovirus vectors.
In yet another object of the invention is provided an assay for detecting
the presence of replication competent virus, in particular, RCA, in a
production
stock of replication incompetent virus, particularly replication incompetent
adenovirus, comprising: (a) subjecting a sample of the production stock to
polymerase chain reaction (PCR) amplification to amplify a region of the
genome
to of the replication competent virus which is deleted from the genome of the
replication incompetent virus, thus forming a replication competent virus-
specific
double-stranded amplicon if such replication competent virus is present; (b)
allowing the PCR reaction sample to hybridize with a signaling hybridization
probe complementary to the replication competent virus-specific amplicon,
thereby emitting a signal which is detectable only upon hybridization of the
signaling hybridization probe to the replication competent virus-specific
amplicon, or the genome of said replication competent virus; and (c) detecting
the
presence or absence of the signal. Other aspects of the assay include control
PCR
reactions which allow determination, in real time, of the relative quantities
of
replication competent virus and replication incompetent virus present in the
production stock.
The invention further relates to a method of detecting the presence of
replication competent virus in a production stock of replication incompetent
virus, comprising the utilization of the above assay, and a kit which provides
instructions, PCR primers and signaling probes for performing the assay.
Other aspects and advantages of the invention will be readily apparent
from the following detailed description of the invention.
CA 02393844 2002-06-05
WO 01/44280 PCT/US00/33123
-12-
Brief Description of the Drawings
Fi ure 1 is a schematic diagram of the modified E1 complementation
element generated by the method of Example 1. The first line (Wt Ad5) shows
the location of the E1 region in wild-type (wt) adenovirus type-5 (Ad5) DNA.
The second line (Wt E1 region) is an enlargement of the wild-type E1 and pIX
genes, showing the nt numbers corresponding to the translational start and
stop
of the E 1 a and pIX proteins, respectively. The third line is a schematic of
the
modified E1 complementation element aligned with wild-type E1 in line 2.
Heterologous constitutive promoter (e.g. PGK) is shown as "prm" and the
polyadenylation signal (e.g. from bovine growth hormone or SV40) is shown as
"pA". The darkened region between nt 3311 and 3609 at the 3' end of the Elb
coding sequences in the complementation element represents the silent
mutations
designed to prevent homologous recombination between E1 sequences in the
vector and E1 sequences in the complementing cell line. The fourth line shows
a schematic representation of an El-deleted Ad5 vector expressing human (3-
interferon as an example. As can be seen from the schematic, this vector,
which
is currently undergoing safety testing in human patients suffering from
cancer,
contains a large stretch of sequences from the 3' portion of the E 1 b gene.
Fi ure 2 shows the nucleotide sequence from nt 3309-3614 of the
complementation element constructed according to Example 1 and Example 7.
The wild-type Ad5 DNA sequence is shown in codon triplets. Single letter
designation for amino acids is shown immediately above the first nt of each
wild-
type codon. Silent nucleotide substitutions introduced into the
complementation
element pQBI-pgk-E 1.1 according to Example 1 (A) and Example 7 are shown as
italicized letters immediately below the nucleotide replaced in the wild-type
Ad5
sequence (this complementation element includes all the substitutions shown
below the wild-type sequence, including those that are underlined, and those
that
are boxed). Silent nucleotide substitutions introduced into the
complementation
element pQBI-pgk-E 1.2 according to Example 1 (B) and Example 7 are shown as
CA 02393844 2002-06-05
WO 01/44280 PCT/US00/33123
-13-
boxed italicized letters immediately below the nucleotide replaced in the wild-
type Ad5 sequence from nucleotides. Silent nucleotide substitutions introduced
into the complementation element pQBI-pgk-E 1.3 according to Example 1 (C)
and Example 7 are shown as underlined italicized letters immediately below the
nucleotide replaced in the wild-type Ad5 sequence from nucleotides. The
boundaries of the wild type Elb intron are shown as downward arrows. The
arrow marked SD is the splice donor site and the arrow marked SA is the splice
acceptor site. The bold face letters within the intron represent the TATA box
within the pIX promoter. The italicized sequence below the intron is the
sequence of the SV40 late region intron used to replace the wild-type Elb
intron
in each of the three complementation elements, as described in Example 1 and
Example 7. Asterisks represent the translational stop codons of either the 55-
or
8.3 kDa Elb proteins. BgIII refers to a restriction site in wild-type AdS.
is Detailed Description of the Invention
The present invention provides a method and system of producing
replication-incompetent virus vectors which are free of replication competent
virus, as well as nucleic acid molecules, complementation elements, vectors,
and
complementing cell lines useful in this method. In preferred embodiments, the
present invention provides a method and system of producing replication-
incompetent Ad in the absence of RCA, as well as nucleic acid molecules,
complementation elements, vectors, and complementing cell lines useful in this
method. Further, the present invention provides a method for screening large-
scale replication-incompetent virus preparations, preferably rAd preparations,
for
the presence of replication-competent virus particles. The preferred Ad
vectors
are particularly well suited for use in delivering genes to a mammal, because
these Ad vector preparations are free of contaminating RCA. Furthermore, the
preferred Ad-complementing cell lines of the present invention are
particularly
well suited for production of Ad for preclinical and clinical use, as they are
CA 02393844 2002-06-05
WO 01/44280 PCT/US00/33123
-14-
readily adapted to growth in adherent or suspension cultures, as well as
growth
in serum free media using techniques well known to those of skill in the art.
The
serum-free-media adapted complementing cell lines harboring the constructs
described herein are encompassed by the present invention.
The present invention accomplishes large scale production of RCA-free
stocks of adenovirus vectors, as well as replication competent virus-free
stocks
of a variety of viral vectors through a novel strategy for the elimination of
sequence homology between a complementation element contained in the
production cell and the adenovirus vector. The strategy takes advantage of the
1o degeneracy in the genetic code allowing for the creation of novel nucleic
acid
molecules which encode wild-type viral proteins yet lack sufficient sequence
homology with the corresponding wild-type viral nucleic acid sequences to
allow
for homologous recombination leading to replication-competent virus
production.
Definitions and General Technigues
Unless otherwise defined, all technical and scientific terms used herein
have the meaning as commonly understood by one of ordinary skill in the art to
which this invention belongs. The practice of the present invention employs,
unless otherwise indicated, conventional techniques of chemistry, molecular
biology, microbiology, recombinant DNA technology, genetics, virology and
immunology. See, e.g., Sambrook et al., 1989, Molecular Cloning: A Laboratory
Manual, Cold Spring Harbor Press, Cold Spring Harbor, NY (which is
incorporated herein by reference in its entirety).
A nucleic acid molecule "comprising" a polynucleotide means that the
nucleic acid molecule includes the polynucleotide but may also include other
polynucleotides, e.g., a nucleic acid molecule comprising a polynucleotide
which
encodes insulin may have additional polynucleotides 5', 3' or interspersed
between those which are necessary to encode insulin such as an expression
CA 02393844 2002-06-05
WO 01/44280 PCT/US00/33123
-15-
control region, an untranslated region(s), an intron, and/or a polynucleotide
which
encodes a fusion protein.
A "transgene" is a nucleic acid molecule that is to be delivered or
transferred to a mammalian cell. A transgene may encode a protein, peptide or
polypeptide that is useful as a marker, reporter or therapeutic molecule. The
transgene may also encode a protein, polypeptide or peptide that is useful for
protein production, diagnostic assays or for any transient or stable gene
transfer
in vitro or in vivo. Alternatively, a transgene may not encode a protein but
rather
be used as a sense or antisense molecule, ribozyme or other regulatory nucleic
acid molecule used to modulate replication, transcription or translation of a
nucleic acid molecule to which it is complementary or to target a
complementary
mRNA for degradation.
"Expression control sequences" are polynucleotide regions that regulate
the expression of a gene by being operably associated with the gene of
interest.
"Operably associated" polynucleotides include both expression control
sequences that are contiguous, i.e., act in cis, with the gene of interest and
expression control sequences that act in traps or at a distance, to control
the gene
of interest. Expression control sequences include appropriate transcription
initiation, termination, promoter and enhancer sequences; efficient RNA
2o processing signals such as splicing and polyadenylation signals; sequences
that
stabilize cytoplasmic mRNA; sequences that enhance protein stability; and when
desired, sequences that enhance protein secretion.
A "transgene cassette" is a nucleic acid molecule comprising a transgene
operably associated with expression control sequences.
A "virus genome" is the nucleic acid molecule backbone of a virus
particle. The virus genome may contain point mutations, deletions or
insertions
of nucleotides. The virus genome may further comprise a foreign gene. A
"native" or "naturally-occurring" virus genome is one which is isolated from a
wild type virus growing in a natural animal host. Although a "naturally
3o occurring" virus genome may be kept and propagated in a laboratory, it has
not
CA 02393844 2002-06-05
WO 01/44280 PCT/US00/33123
-16-
been intentionally manipulated by, e.g., genetic manipulations, mutagenesis,
multiple tissue culture passage, or multiple passage in a non-native animal
host
or in eggs.
A "virus" is an encapsidated and/or enveloped virus genome capable of
binding to an animal cell and delivering the virus genome to the cell, either
to the
cytoplasm or 'to the nucleus, depending on the virus. The term "virus"
encompasses both recombinant and non-recombinant viruses. The term "virus"
also encompasses both wild type and mutant viruses. Preferred viruses are
those
originally derived from mammalian cells, and even more preferred viruses are
1o those of human origin.
A "recombinant virus" is a virus which contains one or more genes that
are foreign to the wild type virus. Recombinant viruses include, without
limitation, those that include a foreign gene such as the human VEGF gene, as
well as viruses that comprise other viral genomes.
An "viral vector" is a recombinant virus comprising one or more foreign
genes, wherein the viral vector is capable of binding to an animal cell and
delivering the foreign gene to the cell.
An "adenovirus genome" is the nucleic acid molecule backbone of an
adenovirus particle. The adenovirus genome may contain point mutations,
deletions or insertions of nucleotides. The adenovirus genome may further
comprise a foreign gene. A "native" or "naturally-occurring" adenovirus genome
is one which is isolated from a wild type adenovirus growing in a natural
animal
host. Although a "naturally occurring" adenovirus genome may be kept and
propagated in a laboratory, it has not been intentionally manipulated by,
e.g.,
genetic manipulations, mutagenesis, multiple tissue culture passage, or
multiple
passage in a non-native animal host or in eggs.
An "adenovirus" is an encapsidated adenovirus genome capable of
binding to an animal cell and delivering the adenovirus genome to the cell's
nucleus. The term "adenovirus" encompasses both recombinant and non-
3o recombinant adenoviruses. The term "adenovirus" also encompasses both wild
CA 02393844 2002-06-05
WO 01/44280 PCT/US00/33123
-17-
type and mutant adenoviruses. Preferred adenoviruses are those originally
derived from mammalian cells, and even more preferred adenoviruses are those
of human origin.
A "recombinant adenovirus" is an adenovirus which contains one or more
genes that are foreign to a wild type adenovirus. Recombinant adenoviruses
include, without limitation, those that include a foreign gene such as the
human
VEGF gene, as well as adenoviruses that comprise other viral genomes such as
the adeno-associated viral (AAV) genome or portions thereof, e.g., hybrid
Ad/AAV viruses described elsewhere herein.
t 0 An "adenovirus vector" is a recombinant adenovirus comprising one or
more foreign genes, wherein the adenovirus vector is capable of binding to an
animal cell and delivering the foreign gene to the cell's nucleus.
A "locus" is a site within a virus genome wherein a particular gene
normally resides. For instance, the "adenovirus E1 locus" is the site at which
the
E1 genes reside in the adenovirus genome. If a foreign gene or nucleic acid
molecule is inserted into a locus, it may either replace the gene that
naturally
resides there or it may be inserted at the site within or next to the gene
that
naturally resides there.
An "adenovirus complementation element" is a nucleic acid molecule
which when introduced into a suitable cell by transformation or transfection
(producing a complementation cell) is capable of supporting the replication of
otherwise replication-incompetent adenovirus. It is important to note that the
protein encoded by the complementation element can be a portion of a complete
protein (protein fragment) so long as the complementing activity of the
complete
protein is substantially supplied by the protein fragment.
By "stringent hybridization conditions" is intended 16 hour incubation at
42°C in a solution comprising: 50% formamide, SX SSC (750 mM NaCI, 75
mM
trisodium citrate), 50 mM sodium phosphate (pH7.6), SX Denhardt's solution,
10% dextran sulfate, and 20 ~ g/ml denatured, sheared salmon sperm DNA,
3o followed by washing in O.1X SSC at about 65°C. By "conditions of low
CA 02393844 2002-06-05
WO 01/44280 PCT/US00/33123
-18-
stringency" is intended 16 hour incubation at 42°C in a solution
comprising: 50%
formamide, SX SSC (750 mM NaCI, 75 mM trisodium citrate), 50 mM sodium
phosphate (pH7.6), SX Denhardt's solution, 10% dextran sulfate, and 20 pg/ml
denatured, sheared salmon sperm DNA, followed by washing in 1X SSC,
preferably in 3X SSC, even more preferably in SX SSC at about 65°C,
preferably
at about 42°C, even more preferably at about 37°C.
By a polynucleotide less than, for example, 90% "identical" to a reference
polynucleotide (e.g. a wild type, native, or naturally-occurring adenovirus
polynucleotide) is intended that the nucleotide sequence is identical to the
to reference sequence except that the polynucleotide sequence must include an
average of ten or more point mutations per each 100 nucleotides of the
reference
nucleotide sequence. As a practical matter, whether any particular nucleic
acid
molecule is less than, e.g., 95%, 90%, 80% or 70% identical to, a reference
nucleotide sequence shown can be determined conventionally using known
computer programs such as the Bestfit program using default parameters
(Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer
Group, University Research Park, 575 Science Drive, Madison, Wis. 53711).
Bestfit uses the local homology algorithm of Smith and Waterman (Advances in
Applied Mathematics 2: 482-489, 1981 ) to find the best segment of homology
2o between two sequences. Once Bestfit determines the most optimal alignment
between two nucleotide sequences it is then a simple determination to count
the
number of base changes necessary to transform the nucleotide sequence into the
reference nucleotide sequence.
"RCA-free" according to the present invention means less than about 1,
pfu of replication competent adenovirus (RCA) in approximately 109 preferably
10'°, 10"' 10'2, or 10'3 pfu of an rAd preparation.
The term "a" or "an" entity, refers to one or more of that entity; for
example, "a nucleic acid molecule," is understood to represent one or more
nucleic acid molecules. As such, the terms "a" (or "an"), "one or more," and
"at
least one" can be used interchangeably herein.
CA 02393844 2002-06-05
WO 01/44280 PCT/US00/33123
-19-
Construction of Complementing Cell Lines
Target Cells
Target cells, or host cells, which may be recombinantly engineered to
complement replication-incompetent recombinant adenovirus, or other
replication-incompetent virus, may be selected from any mammalian species
including, without limitation, human diploid cells such as MRC-5, WI-38, HER,
HEL, HEK, A549 and human aneuploid cells such as HeLa. Cells isolated from
other mammalian species are also useful, for example, primate cells, rodent
cells
or other cells commonly used in biological laboratories. Among such primate
cell types are diploid Vero, CV-l and FRhL cells. The selection of the
mammalian species providing the cells, as well as their euploid type, is not a
limitation of this invention; nor is the type of mammalian cell, i.e.,
fibroblast,
hepatocyte, tumor cell, etc.
In one preferable embodiment the WI-38 or MRC-5 cell is used as the
target cell. These lines, and WI-38 in particular, have been used for many
years
in vaccine production. They have a long safety record suggesting that no
harmful
adventitious agents are resident in these cell lines. Thus, the WI-38 or MRC-5
2o cell is a preferable choice for production of recombinant adenovirus to be
used
in a clinical setting.
Adenovirus Nucleic Acid Molecules and Complementation Elements
Suitably, the packaging cells are stably transformed or transfected with
a complementation element comprising a nucleic acid molecule carrying, at a
minimum, nucleotide sequences encoding one or more functional adenovirus
proteins which are absent from or are not functionally encoded by the
replication-
defective adenovirus vector of choice. It is known in the art that the
adenovirus
loci El, E2a and E40RF6 are essential for viral replication. Accordingly, the
complementation element contains nucleotide sequences encoding one or more
adenovirus proteins, preferably one or more essential adenovirus proteins,
even
CA 02393844 2002-06-05
WO 01/44280 PCT/US00/33123
-20-
more preferably one or more proteins encoded by the E1 locus and most
preferably all of the proteins encoded by the Ad5 El locus including the Ad5
8.3
kDa Elb protein.
As a means of avoiding homology with the recombinant Ad vector and
concomitantly reducing the likelihood of homologous recombination leading to
RCA production, the complementation element of the present invention contains
a non-naturally occurring adenovirus nucleotide sequence.
Thus, in one embodiment, the invention provides an isolated nucleic acid
molecule comprising a polynucleotide which encodes at least 5 contiguous amino
acids of a naturally-occurring adenovirus polypeptide, wherein the sequence of
said polynucleotide is not a naturally-occurnng adenovirus nucleotide
sequence.
What is meant by "not a naturally-occurring adenovirus sequence" is a
nucleotide
sequence which is not a native adenovirus sequence, i.e., it is not the exact
nucleotide sequence which encodes the at least five amino acids in a native
adenovirus genome, but because of the degeneracy of the genetic code, it
encodes
the same 5 amino acids. Since the genetic code is well known it would be
routine
for one of skill in the art to contemplate any number of nucleotide sequences
(literally thousands upon thousands) which are non-naturally occurring but
which
code for a known adenovirus amino acid sequence. Such a list could be computer
2o generated but will not be presented herein in the interest of economy.
According to this embodiment, an isolated nucleic acid molecule is
provided comprising a polynucleotide which encodes at least five amino acids
of
a naturally-occurring polypeptide from any adenovirus, including, but not
limited
to, a polypeptide from a human adenovirus, an avian adenovirus, a bovine
adenovirus, a feline adenovirus, a canine adenovirus, a marine or other rodent
adenovirus, a fish adenovirus, a porcine adenovirus, a caprine adenovirus, an
ovine adenovirus, an equine adenovirus, or a simian adenovirus, but where the
polynucleotide sequence is not a naturally-occurring adenovirus nucleotide
sequence. Nucleotide and amino acid sequences derived from each of these
3o categories of adenoviruses can be obtained through GenBank.
CA 02393844 2002-06-05
WO 01/44280 PCT/US00/33123
-21-
In a preferred embodiment of the invention, an isolated nucleic acid
molecule is provided comprising a polynucleotide which encodes at least five
amino acids of a naturally-occurring polypeptide from one of the known human
adenovirus types 1-46, but where the polynucleotide sequence is not a
naturally-
s occurring human adenovirus nucleotide sequence. All human adenovirus types
1-46 are available from the American Type Culture Collection (ATCC), 10801
University Boulevard, Manassass, VA 20110-2209; and the nucleotide and amino
acid sequences for can be obtained through GenBank.
In a more preferred embodiment of the invention, a nucleic acid molecule
is provided comprising a polynucleotide which encodes at least 5 amino acids
of
a naturally occurring Ad5 or human adenovirus type 2 (Ad2) polypeptide, but
where the polynucleotide sequence is not a naturally-occurring human Ad5 or
Ad2 nucleotide sequence. The complete nucleotide sequences of Ad2 and Ad5
are available from GenBank, see e.g., GenBank accession no. M73260 for the
1 s human adenovirus type s sequence, and JO 1917 for the human adenovirus
type
2 sequence.
A non-naturally occurring polynucleotide sequence as referred to above
may encode as few as 5 contiguous amino acids of a naturally occurring
adenovirus polypeptide. A non-naturally occurring polynucleotide sequence
2o preferably encodes at least 6 contiguous amino acids of a naturally
occurring
adenovirus polypeptide, more preferably at least 7, 8, 9, 10, 15, 20, 25, 30,
35, 40,
45, 50, 75, 100, 150, 200, 250, 300, 400, or 500 contiguous amino acids of a
naturally occurring adenovirus polypeptide and most preferably the
polynucleotide sequence encodes an entire adenovirus polypeptide.
2s A naturally occurring adenovirus polypeptide as referred to above is any
adenovirus polypeptide, preferably an essential adenovirus polypeptide, more
preferably an El, E2 or E4 polypeptide, even more preferably an E1
polypeptide,
and most preferably an Ad5 E 1 b polypeptide selected from the group
consisting
of the 5 5 kDa E 1 b polypeptide, the 21 kDa E 1 b polypeptide, and the 8.3
kDa E 1 b
3o polypeptide.
CA 02393844 2002-06-05
WO 01/44280 PCT/US00/33123
-22-
A non-naturally occurring polynucleotide sequence as referred to above
may contain as few as three (3) nucleotide substitutions, preferably it
contains at
least 4, S, 6, 7, 8, 9, 10, 11, 12, 13, 14, 1 S, 20, 25, 30, 40, 50, 60, 75,
100, 125,
150, 175, 200, 250, 300, or more nucleotide substitutions, each as compared to
a corresponding native adenovirus nucleotide sequence, preferably as compared
to a native human adenovirus sequence, and even more preferably as compared
to a native Ad5 nucleotide sequence.
In another embodiment, an isolated nucleic acid molecule is provided
comprising a polynucleotide which encodes at least 5 contiguous amino acids of
a naturally-occurring adenovirus polypeptide, where the polynucleotide will
not
hybridize to a naturally occurring adenovirus genome under stringent
conditions.
Preferably, such a polynucleotide will not hybridize to a naturally occurring
human adenovirus genome under stringent conditions. More preferably, such a
polynucleotide will not hybridize to a naturally occurring Ad5 genome under
stringent conditions. A preferred embodiment provides an isolated nucleic acid
molecule comprising a polynucleotide which encodes at least 5 contiguous amino
acids of a naturally-occurring adenovirus polypeptide, where the
polynucleotide
will not hybridize to a naturally occurring adenovirus genome under conditions
of low stringency. Preferably, such a polynucleotide will not hybridize to a
naturally occurring human adenovirus genome under conditions of low
stringency. Most preferably, such a polynucleotide will not hybridize to a
naturally occurring Ad5 genome under conditions of low stringency.
Two general approaches have been used to study the sequence similarlity
requirements for DNA recombination in mammalian cells. One is to measure the
rate of recombination as a function of the length of identical nucleotides
shared
between two polynucleotides. As one of ordinary skill in the art would readily
appreciate, sequence "identity" in this context refers to double stranded
polynucleotides, and contemplates interactions between the complementary
single
stranded components of one or more double stranded polynucleotides. Using this
approach, it has been shown that in mammalian cells the rate of intra-
CA 02393844 2002-06-05
WO 01/44280 PCT/US00/33123
-23-
chromosomal recombination between two closely matched sequences drops off
sharply when the length of complete sequence identity is reduced from 295 to
200
by (Liskay, R., et al., Genetics 115:161-167 (1987)). Alternatively, the
effect of
nucleotide mismatches on the rate of recombination can be measured. Using this
strategy, it has been determined that intra-chromosomal recombination in
mammalian cells . between two linked sequences which are 81 % identical was
reduced over 1000-fold relative to recombination between sequences displaying
near perfect identity (Waldman, A. et u1., Proc. Natl. Acad. Sci. U.S.A.
84:5340-
5344 (1987)) and that synergistically large decreases in recombination can
result
from relatively small changes in degree of sequence identity (Lukacsovich, T.
et
al., Genetics, 151:1559-1568 (1999)). It has been shown that efficient extra-
chromosomal recombination in mammalian cells requires a length of identical
nucleotides of about 200 by (Rubnitz, J. et al., Mol. Cell. Biol. 4:2253-2258
(1984)).
~ 5 While not being bound by theory, it is believed by the inventors that as
few as 3 base pair substitutions evenly dispersed in 100 nucleotides of coding
sequence will significantly reduce homologous recombination. Accordingly,
another embodiment of the invention provides an isolated nucleic acid molecule
comprising a polynucleotide, where the sequence of the polynucleotide is at
least
about 60% identical to, but is less than about 97% identical to a naturally
occurring adenovirus polynucleotide sequence of the same length. Preferably
the
polynucleotide sequence is at least about 60% identical to, but is less than
about
96%, 95%, 94%, 93%, 92%, 91%, 90%, 85%, 80%, 75%, 70% or 65% identical
to a naturally occurring adenovirus polynucleotide sequence of the same
length,
preferably a human adenovirus, more preferably AdS. Preferably, the
polynucleotide sequence identity is reduced through the introduction of silent
mutations of nucleotides at degenerate positions within codons such that the
translational coding capacity of the nucleotide sequence is not altered. More
preferably the polynucleotide encodes at least 5, preferably at least 6, 7, 8,
9, 10,
11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 50, 60, 75, 100, 125, 150,
175,
CA 02393844 2002-06-05
WO 01/44280 PCT/US00/33123
-24-
200, 250, or 300, contiguous amino acids of a naturally-occurring adenovirus
polypeptide.
Optimally, such silent mutations are evenly dispersed across the full
length of the polynucleotide. Accordingly, in one embodiment a silent mutation
is present at least once in every ten contiguous codons, preferably at least
one
silent mutation is present in every 9, 8, 7, 6, 5, 4 or 3 contiguous codons.
In a
related embodiment, the polynucleotide sequence contains fewer than 200
contiguous nucleotides of wild-type adenovirus sequence, preferably fewer than
150, 125, 100, 75, 60, 50, 40, 30, 25, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11,
10, 9,
8, 7 or 6 contiguous nucleotides of wild-type adenovirus sequence. Most
preferably the nucleotide sequence contains as little sequence identity with
the
corresponding wild-type adenovirus sequence as possible (i. e. most fully
degenerate) yet retains the translational coding capacity of the wild-type
adenovirus sequence.
In certain embodiments, it is preferred that the polynucleotide encode
polypeptides capable of complementing an RCA defective in the Ad E1 proteins.
A preferred example of this embodiment provides an isolated nucleic acid
molecule comprising a polynucleotide, where the sequence of the polynucleotide
is at least about 60% identical to, but is less than about 97% identical to a
2o naturally occurring Ad5 polynucleotide comprising nucleotides 1 to 198 of
SEQ
ID N0:20, or nucleotides 287 to 301 of SEQ ID N0:20. Preferably the
polynucleotide sequence is at least about 60% identical to, but is less than
about
96%, 95%, 94%, 93%, 92%, 91%, 90%, 85%, 80%, 75%, 70% or 65%. identical
to a naturally occurring Ad5 polynucleotide comprising nucleotides 1 to 198 of
SEQ ID N0:20, or nucleotides 287 to 301 of SEQ ID N0:20. Preferably, the
polynucleotide sequence identity is reduced through the introduction of silent
mutations of nucleotides at degenerate positions within codons such that the
translational coding capacity of the nucleotide sequence is not altered. More
preferably the polynucleotide encodes at least 5, preferably at least 6, 7, 8,
9, 10,
CA 02393844 2002-06-05
WO 01/44280 PCT/US00/33123
-25-
11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 50, 60, 75, 100, 125, 150,
175,
200, 250, or 300, contiguous amino acids of an Ad5 El polypeptide.
Optimally, such silent mutations are evenly dispersed across the full
length of the polynucleotide. Accordingly, in one embodiment a silent mutation
is present at least once in every ten contiguous codons of the polynucleotide
comprising nucleotides 1 to 198 of SEQ ID N0:20, preferably at least one
silent
mutation is present in every 9, 8, 7, 6, 5, 4 or 3 contiguous codons of the
polynucleotide comprising nucleotides 1 to 198 of SEQ ID N0:20. In another
embodiment a silent mutation is present at least once in 1, 2, 3, 4, or 5 of
the
contiguous codons of the polynucleotide comprising nucleotides 287 to 301 of
SEQ ID N0:20. In a related embodiment, the polynucleotide sequence contains
fewer than 200 contiguous nucleotides of wild-type adenovirus sequence,
preferably fewer than 150, 125, 100, 75, 60, 50, 40, 30, 25, 20, 19, 18, 17,
16, 15,
14, 13, 12, 11, 10, 9, 8, 7 or 6 contiguous nucleotides of wild-type
adenovirus
t 5 sequence. Most preferably the nucleotide sequence contains as little
sequence
identity with the corresponding wild-type adenovirus sequence as possible (i.
e.
most fully degenerate) yet retains the translational coding capacity of the
wild-
type adenovirus sequence.
In another desirable embodiment, the invention provides a nucleic acid
2o molecule comprising a polynucleotide which encodes at least 5 contiguous
amino
acids of a naturally-occurring adenovirus polypeptide, wherein the codons
encoding the naturally-occurring adenovirus polypeptide are known to be
preferential for translation in a given eukaryotic cell, preferably a
mammalian
cell, more preferably preferential for translation in a human cell, and even
more
25 preferably preferential for translation in a human WI-38 or MRC-5 cell.
Methods to choose codons which will preferentially be translated in a
given species are well known to those of skill in the art. For example, to
choose
codons which are preferentially utilized in human cells, a codon usage table
for
sequenced human DNA is used. A suitable table for human codon usage is
30 shown as Table 1. The amino acid to be encoded is found in the first
column, and
CA 02393844 2002-06-05
WO 01/44280 PCT/US00/33123
-26-
the codon for that amino acid which has the highest fraction of usage in the
species is chosen. For example, the skilled artisan, in order to optimize the
expression of a nucleotide sequence encoding the amino acid valine in humans
would utilize the codon GTG, which is used 48% of the time in human genes.
Table 1
Homo Sapiens
[gbpri~:
17625
CDS's
(8707603
codons)
AmAcid Codon Number ~ /1000 Fraction ..
Gly GGG 144066.00 16.54 0.25
Gly GGA 143152.00 16.44 0.25
Gly GGT 94776.00 10.88 0.16
Gly GGC 201492.00 23.14 0.35
Glu GAG 353389.00 40.58 0.59
Glu GAA 248945.00 28.59 0.41
Asp GAT 193421.00 22.21 0.46
Asp GAC 230499.00 26.47 0.54
Val GTG 255326.00 29.32 0.48
Val GTA 59454.00 6.83 0.11
Val GTT 93237.00 10.71 0.17
Val GTC 128872.00 19.80 0.24
Ala GCG 66830.00 7.67 0.11
Ala GCA 135692.00 15.58 0.22
Ala GCT 160540.00 18.44 0.26
Ala GCC 249413.00 28.64 0.41
Arg AGG 96943.00 11.13 0.20
Arg AGA 97769.00 11.23 0.20
Ser AGT 101784.00 11.69 0.15
Ser AGC 168393.00 19.34 0.24
Lys AAG 288839.00 33.17 0.58
Lys AAA 205438.00 23.59 0.42
Asn AAT 146576.00 16.83 0.45
Asn AAC 176150.00 20.23 0.55
Met ATG 193713.00 22.25 1.00
Ile ATA 60712.00 6.97 0.15
Ile ATT 137003.00 15.73 0.35
Ile ATC 194225.00 22.31 0.50
Thr ACG 56070.00 6.44 0.12
Thr ACA 128130.00 14.71 0.27
Thr ACT 110775.00 12.72 0.24
Thr ACC 173197.00 19.89 0.37
Trp TGG 112968.00 12.97 1.00
End TGA 11388.00 1.31 0.51
Cys TGT 84611.00 9.72 0.99
Cys TGC 107993.00 12.40 0.56
End TAG 4674.00 0.54 0.21
End TAA 6912.00 0.74 0.29
CA 02393844 2002-06-05
WO 01/44280 PCT/US00/33123
-27-
Tyr TAT 105741.00 12.14 0.93
Tyr TAC 192002.00 16.31 0.57
Leu TTG 104842.00 12.04 0.12
Leu TTA 60542.00 6.95 0.07
Phe TTT 149711.00 16.62 0.49
Phe TTC 180549.00 20.73 0.56
Ser TCG 39565.00 4.54 0.06
Ser TCA 99242.00 11.40 0.14
Ser TCT 126354.00 14.51 0.18
Ser TCC 153781.00 17.66 0.22
Arg CGG 100931.00 11.59 0.21
Arg CGA 53982.00 6.20 0.11
Arg CGT 40995.00 4.71 0.08
Arg CGC 95930.00 11.02 0.20
Gln CAG 299873.00 34.44 0.75
'
Gln CAA 102442.00 11.76 0.25
His CAT 88133.00 10.12 0.41
His CAC 129455.00 14.87 0.59
Leu CTG 348202.00 39.99 0.41
Leu CTA 58998.00 6.78 0.07
Leu CTT 108127.00 12.42 0.13
Leu CTC 168315.00 19.33 0.20
Pro CCG 61627.00 7.08 0.12
Pro CCA 143936.00 16.53 0.27
Pro CCT 149994.00 17.23 0.28
Pro CCC 176517.00 20.27 0.33
Coding GC 52.75%
1st
letter
GC
56.12%
2nd
letter
GC
42.36%
3rd
letter
GC
59.77%
Genetic
code
1:
Standard
Similar tables are available for other species and are available, e.g., on the
Internet at < http://www.kazusa.or.jp/codon > (visited April 10, 2000).
In a particularly preferred embodiment, the invention comprises a nucleic
acid molecule comprising at least 20 contiguous nucleotides of the sequence
shown as nucleotides 1 to 198 of SEQ ID NO:1, preferably at least 30, 40, 50
or
100 contiguous nucleotides of the sequence shown as nucleotides 1 to 198 SEQ
ID NO:1, more preferably the entire sequence shown as SEQ ID NO:1. SEQ ID
NO:1 corresponds to a region of the E1 locus of Ad5 extending from about
nucleotide 3309 to about nucleotide 3614 of the complete Ad5 genome (GertBank
Accession No. M73260, fragment depicted herein as SEQ ID N0:20), and
encodes for C-terminus of the E 1 b 55 kD protein and the 3' exon of the 8.3
kD
Elb protein. Construction of the complementation element is described in
Example 1 (A) and Example 7. The sequence was modified to contain all possible
CA 02393844 2002-06-05
WO 01/44280 PCT/US00/33123
-28-
silent mutations in the coding regions, as shown in Figure 2. Where possible,
the
base substitutions were chosen to correspond to the most frequently used
codons
in the human codon usage table shown in Table 1.
In another preferred embodiment, the invention comprises a nucleic acid
molecule comprising at least 20 contiguous nucleotides of the sequence shown
as nucleotides 1 to 198 of SEQ ID N0:18, preferably at least 30, 40, 50 or 100
contiguous nucleotides of the sequence shown as nucleotides 1 to 198 SEQ ID
N0:18, more preferably the entire sequence shown as SEQ ID N0:18. SEQ ID
N0:18 also corresponds to a region of the EI locus of Ad5 extending from about
1 o nucleotide 3309 to about nucleotide 3614 of the complete Ad5 genome
(GenBank
Accession No. M73260, fragment depicted herein as SEQ ID N0:20).
Construction of the complementation element is described in Example 1 (C) and
Example 7. The sequence was modified to contain silent mutations evenly
spaced at about 15 nucleotides apart, as shown by the underlined nucleotide
substitutions in in Figure 2. Where possible, the base substitutions were
chosen
to correspond to the most frequently used codons in the human codon usage
table
shown in Table 1.
In yet another embodiment of the invention, a nucleic acid molecule is
provided which comprises a sequence selected from the group consisting o~ (a)
2o nucleotides 1 to 198 of SEQ ID NO:1; (b) nucleotides 298 to 312 of SEQ ID
NO:1; and (c) nucleotides 1 to 315 of SEQ ID NO:1.
In yet embodiment of the invention, a nucleic acid molecule is provided
which comprises a sequence selected from the group consisting of: (a)
nucleotides 1 to 198 of SEQ ID N0:18; (b) nucleotides 298 to 312 of SEQ ID
N0:18; and (c) nucleotides 1 to 315 of SEQ ID N0:18.
In yet another embodiment of the invention, a nucleic acid molecule is
provided which comprises a sequence selected from the group consisting o~ (a)
nucleotides 298 to 312 of SEQ ID N0:19; and (b) nucleotides 1 to 315 of SEQ
ID N0:19. SEQ ID N0:19 also corresponds to a region of the El locus of Ad5
extending from about nucleotide 3309 to about nucleotide 3614 of the complete
CA 02393844 2002-06-05
WO 01/44280 PCT/US00/33123
-29-
Ad5 genome (GenBank Accession No. M73260, fragment depicted herein as
SEQ ID N0:20). Construction of the complementation element is described in
Example 1 (B) and Example 7. The sequence was has the wild-type Ad5 sequence
in the 55 kD coding region, but has all the possible base substitutions in the
3'
exon of the 8.3 kD coding region, as shown by the boxed nucleotide
substitutions
in Figure 2. Where possible, the base substitutions were chosen to correspond
to
the most frequently used codons in the human codon usage table shown in Table
1.
In another embodiment, the invention provides a complementation
element which encodes an essential adenovirus protein wherein the
complementation element comprises a nucleic acid molecule described herein.
Preferably the complementation element comprises an Ad E1 locus, more
preferably a human Ad E1 locus, even more preferably an Ad5 E1 locus.
Another way to reduce or eliminate homologous recombination leading
to RCA is to substitute one or more heterologous introns for naturally-
occurring
adenovirus introns. The genome structure of the adenovirus, including the
location of naturally occurring introns, is well known (see, The Adenoviruses,
Ed.
Harold Ginsberg, 1984, Plenum Press, NY, for a review). The particular
heterologous intron used in this embodiment of the invention is not deemed
critical to the invention and is therefore not limiting, however, several
examples
of heterologous introns are provided below for the convenience of the reader.
Introns for use in the invention include the SV40 late region intron, the SV40
T
intron, the human cytomegalovirus immediate early intron-A, immunoglobulin
introns, and many others well known to those of skill in the art. In addition,
a
heterologous intron can be a hybrid of one or more heterologous and/or native
adenovirus introns. For example, a hybrid intron which contains 5' and 3'
splice
sites, as well as central branch sites, from different intervening sequences,
or
which are engineered to be consensus splice donor and splice acceptor sites.
Such
consensus splice sites are disclosed in P.C.T. Publication No. WO 99/29848,
which is incorporated herein by reference in its entirety. Thus, the nucleic
acid
CA 02393844 2002-06-05
WO 01/44280 PCT/US00/33123
-3 0-
molecule of the invention and the complementation element of the invention may
further comprise a heterologous intron and/or splice sites with or without a
non-
naturally occurring coding sequence as described above.
As described above, a complementation element which encodes all of the
E 1 proteins is a preferred embodiment of the present invention. Figure 1
shows
a diagrammatic representation of a portion of a representative E 1
complementation element constructed according to the method of Example 1.
Preferably, E1 complementation elements according to the invention lack
adenovirus sequences 5' of the E 1 region, preferably excluding the native E 1
a
promoter since some first generation adenovirus vectors contain part or all of
the
Ela promoter. The E1 complementation element of the invention preferably
does not comprise more than 14 contiguous nucleotides of wild-type Ad
nucleotide sequence corresponding to the region from about nt 3,000 to 4,300
of
the Ad5 genome, preferably from about nt 3,300 to about 3,700 of the Ad5
genome and most preferably between about nt 3,400 and 3,500.
As will be appreciated by those of skill in the art, the adenovirus vector
also may advantageously be modified by alternative codon usage and/or through
the replacement of wild-type introns for heterologous introns. As stated
elsewhere herein, alteration of vector sequences is less preferable than
alteration
of sequences in production materials (such as the packaging line) since the
vector
itself forms part of the therapeutic drug and any modification of the drug
itself
would require extensive preclinical and clinical testing for safety and
efficacy.
Modification of the adenovirus vector is nonetheless useful, for example, an
adenovirus vector may be used as a helper virus in the production of AAV. See,
for example, US Patent No. 5,871,982, incorporated herein by reference in its
entirety.
CA 02393844 2002-06-05
WO 01/44280 PCT/US00/33123
-31-
Regulatory Elements anrl Vectors
The complementation element may be in any form which effects the
stable transfer of the nucleic acid molecule to the target cell and expression
of the
encoded protein by the target cell. Most suitably, the complementation element
is carried in a vector. It may be stably integrated into the host cell
chromosome
or exist as an episomal, extra-chromosomal element (see, e.g., Caravokyri, et
al.,
J. Virol., 69:6627-6633 (1995)). A "vector" includes, without limitation, any
construct which can carry and transfer genetic information, such as a plasmid,
a
phage, a transposon, a cosmid, a chromosome, a virus, a virion, a replicon,
and
a messenger RNA. Preferred vectors include chromosomal, episomal and virus-
derived vectors e.g., vectors derived from bacterial plasmids, from
bacteriophage,
from yeast episomes, and from yeast chromosomal elements; from insect viruses
such as baculoviruses, from papova viruses such as SV40, from pox viruses such
as vaccinia viruses and fowl pox viruses, from adenoviruses, from
herpesviruses
such as herpes simplex virus, bovine herpesvirus and pseudorabies virus, and
from retroviruses; and vectors derived from combinations thereof, such as
those
derived from plasmid and bacteriophage genetic elements, such as cosmids and
phagemids. Generally, any vector suitable to maintain, propagate or express
polynucleotides or to express a polypeptide in a host may be used for
expression
in this regard. In one particularly suitable embodiment, the complementation
element is placed in a plasmid vector.
The present invention also relates to vectors which include any of the
isolated nucleic acid molecules of the present invention, e.g., a nucleic acid
molecule comprising a polynucleotide which encodes at least 5 contiguous amino
acids of a naturally-occurring adenovirus polypeptide, wherein the sequence of
said polynucleotide is not a naturally-occurring adenovirus nucleotide
sequence;
and to host cells comprising the vectors. Such vectors and host cells are
useful
for, e.g., amplification of a complementation element, construction of a
CA 02393844 2002-06-05
WO 01/44280 PCT/US00/33123
-32-
complementation element, expression of complementation polypeptides, and
propagation of replication defective viruses.
Vectors may be introduced into host cells using well known techniques
such as infection, transduction, transfection, transvection, lipofection,
electroporation, microinjection, particle bombardment, and transformation.
Generally, a plasmid vector is introduced into a cell by calcium phosphate
transfection, DEAE-dextran mediated transfection, cationic lipid-mediated
transfection, or electroporation. If the vector is a virus, it may be packaged
in
vitro using an appropriate packaging cell line and then transduced into host
cells.
Such methods are described in many standard laboratory manuals, such as Davis
et al., Basic Methods in Molecular Biology (1986).
Nucleic acid molecules of the present invention may be joined to a vector
containing a selectable marker for propagation in a host. Such markers include
dihydrofolate reductase, tetracycline resistance, hygromycin resistance, or
neomycin resistance for eukaryotic cell culture and tetracycline,
chloramphenicol,
or ampicillin resistance genes for culturing in E. coli and other bacteria. In
certain
preferred embodiments in this regard, the vectors provide for specific
expression,
which may be inducible and/or cell type-specific. As indicated, vectors will
preferably include at least one selectable marker. Particularly preferred
among
such vectors are those inducible by environmental factors that are easy to
manipulate, such as temperature and nutrient additives.
The nucleic acid molecule should be operably associated with an
appropriate promoter, such as prokaryotic promoters, e.g., the phage lambda PL
and PR promoters as well as other bacteriophage promoters such as T3, T7,
T7/lac, SP6, SPO1, the E. coli lacI, lacZ, gpt, trp, trc, oxy pro, ompllpp,
rrnB,
and tac promoters, and eukaryotic promoters, e.g., metallothionein, such as
the
mouse metallothionein-I promoter, alpha-mating factor, actin, heat shock,
tissue
specific promoters such as lymphokine-inducible promoters, Pichia alcohol
oxidase, alphvirus subgenomic promoter, human cytomegalovirus immediate
3o early promoter, with or without intron A, the HSV thymidine kinase
promoter,
CA 02393844 2002-06-05
WO 01/44280 PCT/US00/33123
-33-
the SV40 early and late promoters, and promoters of retroviral LTRs such as
from
Rous Sarcoma virus. the early and late SV40 promoters, the promoters -of
retroviral LTRs, such as those of the Rous sarcoma virus (RSV). Other suitable
promoters will be known to the skilled artisan.
Transcription of a nucleic acid molecule of the present invention by
higher eukaryotes may be increased by inserting an enhancer sequence into the
vector. Enhancers are cis-acting elements of DNA, usually about from 10 to 300
bp, that act to increase transcriptional activity of a promoter in a given
host cell-
type. Examples of enhancers include the SV40 enhancer, which is located on the
late side of the replication origin at by 100 to 270, the cytomegalovirus
early
promoter enhancer, the polyoma enhancer on the late side of the replication
origin, and adenovirus enhancers.
In general, expression constructs will contain sites for transcription,
initiation and termination, and, in the transcribed region, a ribosome binding
site
for translation. The coding portion of the mature transcripts expressed by the
constructs will include a translation initiating AUG codon at the beginning
and
a termination codon (LJAA, UGA or UAG) appropriately positioned at the end of
the polypeptide to be translated.
Representative examples of appropriate hosts for amplification of the
nucleic acid molecules of the invention include bacterial cells, such as E.
coli,
Streptomyces and Salmonella typhimurium cells; fungal cells, such as
Saccharomyces and Pichia cells; insect cells such as Drosophila S2 and
Spodoptera Sft7 cells; animal cells such as CHO, COS, BHK, and Bowes
melanoma cells; and plant cells. Appropriate culture media and conditions for
the
above-described host cells are known in the art.
Among vectors preferred for use in bacteria include pQE70, pQE60 and
pQE-9, available from Qiagen; pBS vectors, Phagescript vectors, Bluescript
vectors, pNHBA, pNHl6a, pNHl8A, pNH46A, available from Stratagene; and
ptrc99a, pKK223-3, pKK233-3, pDR540, pRITS available from Pharmacia.
3o Among preferred eukaryotic vectors are pWLNEO, pSV2CAT, pOG44, pXTI
CA 02393844 2002-06-05
WO 01/44280 PCT/US00/33123
-34-
and pSG available from Stratagene; and pSVK3, pBPV, pMSG and pSVL
available from Pharmacia. Other suitable vectors will be readily apparent to
the
skilled artisan.
Once the desired nucleic acid molecule (complementation element) is
engineered, it may be transferred to the target host cell by any suitable
method.
Such methods include, for example, transfection, electroporation, liposome
delivery, membrane fusion techniques, high velocity DNA-coated pellets, viral
infection and protoplast fusion. Thereafter, cells are cultured according to
standard methods and, optionally, seeded in media containing an antibiotic to
select for cells containing the cells expressing the resistance gene. After a
period
of selection, the resistant colonies are isolated, expanded, and screened for
expression of the encoded adenovirus protein. See, Sambrook et al, supra.
Alternatively, the newly created complementing cells are infected with
recombinant E1-deleted adenovirus carrying a reporter gene, such as the E.
coli
(3-galactosidase gene, and selected on the basis of their ability to
complement
replication-incompetent adenovirus replication.
Systems for the Production of RCA free Adenovirus
2o The invention provides combinations of adenovirus vectors and
complementing producer cell lines, collectively "systems". Most broadly, the
invention encompasses a system for the production of adenovirus particles
comprising: (a) a recombinant replication-incompetent adenovirus vector; and
(b) a complementing cell which encodes those essential gene products which are
not expressed by the replication-incompetent adenovirus vector, but which is
incapable of homologous recombination with the replication-incompetent
adenovirus vector.
Preferably, the invention provides producer complementing cell lines
which may be combined with those replication-incompetent adenovirus vectors
with genomes containing partial fragments of essential genes, even though
those
genes are not expressed. These adenovirus vectors have posed special problems,
CA 02393844 2002-06-05
WO 01/44280 PCT/US00/33123
-35-
because the standard complementing cell lines, in order to provide the needed
essential gene product, must necessarily contain significant overlapping
coding
regions with the vector. Accordingly, preferred complementing cell lines of
the
present invention comprise a polynucleotide at least 15 nucleotides in length
encoding at least 5 contiguous amino acids of a naturally-occurring adenovirus
polypeptide, where a coding region encoding the same amino acids is contained
on the replication-incompetent adenovirus vector. However, due to the
degeneracy of the genetic code, the sequence of the polynucleotide in the
complementing cell line is not the naturally-occurring adenovirus nucleotide
sequence found in the adenovirus genome. Preferably the complementing cell
line
comprises a polynucleotide at least 20, 25, 30, 40, 50, 60, 75, 100, 150, 200,
250,
500, or 1,000 nucleotides in length, encoding at least 6, 7, 8, 9, 10, 15, 20,
25, 30,
35, 40, 45, 50, 75, 100, 150, 200, 250, 300, or 330 amino acids of a naturally
occurring adenovirus polypeptide, where a coding region encoding one or more
of the same amino acids is contained on the replication-incompetent adenovirus
vector, but, due to the degeneracy of the genetic code, the sequence of the
polynucleotide in the complementing cell line is not the naturally-occurring
adenovirus nucleotide sequence found in the adenovirus genome.
Preferably the sequence of the polynucleotide in the complementing cell
line and the sequence of the replication-incompetent adenovirus genome,
although encoding at least 5 identical consecutive amino acids, are less than
97%,
95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55% or 50% identical to one
another. Also, preferably the sequence of the polynucleotide in the
complementing cell line and the sequence of the replication-incompetent
adenovirus genome which encode at least 5 identical consecutive amino acids
are
incapable of hybridizing to one another at stringent conditions. More
preferably
the two sequences will not hybridize at conditions of low stringency.
It is important to point out here that systems of the invention are not
limited to cells or viral vectors comprising non-naturally occurring
nucleotide
sequences which encode wild-type adenovirus polypeptide sequences. There is
CA 02393844 2002-06-05
WO 01/44280 PCT/US00/33123
-36-
significant nucleotide sequence variation between different strains of
adenovirus.
Thus, matched complementation elements and vectors may contain naturally
occurring adenovirus sequences which would be identical but for the degeneracy
of the genetic code.
In one preferred embodiment the vector has only naturally occurring
adenovirus sequences and homology with the complementation
element/complementing cell line is reduced by the introduction into the
complementation element/complementing cell line of a polynucleotide with non
adenovirus nucleic acid sequence, but which nonetheless provides the coding
region for a naturally-occurring adenovirus polypeptide.
In another embodiment, the complementation elemenbcomplementing cell
line has only naturally occurring adenovirus sequences and homology is reduced
by the introduction into the vector of a polynucleotide with non-adenovirus
nucleic acid sequence, but which nonetheless provides the coding region for a
naturally-occurring adenovirus polypeptide. Alternatively in this embodiment,
the polynucleotide with the non-adenovirus nucleic acid sequence need not
provide coding region for a naturally occurring adenovirus polypeptide, if
that
polypeptide is provided in traps by the complementing cell line.
The polynucleotide with a non-adenovirus nucleotide sequence contained
2o in either the vector or the cell line of a system herein may be any non-
adenovirus
sequence described elsewhere herein. Likewise, the system may comprise any
combination of cell and vector described elsewhere herein which: (a) can be
used
together to produce replication-incompetent adenovirus particles; and (b)
would
have overlapping sequence identity but for the degeneracy of the genetic code.
In any of the systems described herein, the complementing cell line or the
replication incompetent vector may also comprise a heterologous intron in
place
of a naturally-occurring adenovirus intron, where the heterologous intron may
further comprise heterologous consensus splice donor and splice acceptor
regions.
In a preferred embodiment, the system of the invention comprises: (a) a
complementing cell comprising a polynucleotide encoding the 55 kDa E 1 b
CA 02393844 2002-06-05
WO 01/44280 PCT/US00/33123
-37-
protein of AdS, at least 50 contiguous nucleotides of which is non-adenovirus
sequence; and (b) an adenovirus vector containing at least 50 contiguous
nucleotides of wild-type Ad5 sequence between nucleotides 3311 and 3614.
Also preferred is a system comprising (a) a complementing cell line
comprising a polynucleotide having the sequence of SEQ ID NO:1, SEQ ID
N0:18, or SEQ ID N0:19; and (b) an adenovirus vector containing at least 50
contiguous nucleotides of wild-type Ad5 sequence between nucleotides 3311 and
3614.
Use of the Complementing Cells
The complementing cells of the invention are useful for a variety of
purposes. Most suitably, the cells are used in high yield production of
recombinant replication-incompetent adenovirus vectors (i. e. adenovirus
particles) in the absence of detectable RCA.
Replication and Packaging of Replication IncompetentAd Vectors
In a preferred embodiment, the present invention provides a method of
2o packaging of an Ad vector deleted of E1, E2, and/or E4 (collectively
"replication-
deficient rAd" or "replication-incompetent rAd"), containing a transgene, into
an
adenovirus particle useful for delivery of the transgene to a host cell. In a
preferred embodiment, the replication deficient rAd vector contains all
adenovirus genes necessary to produce and package an infectious adenovirus
particle when replicated in the presence of complementing proteins, e.g., such
as
are supplied by the cell lines of the invention. Preferred vectors for use in
this
aspect of the invention are: (a) the first-generation Ad vector which contains
defects in both the E 1 a and E 1 b sequences, and most desirably, is deleted
of all
or most of the sequences encoding these proteins; (b) the second-generation Ad
vector which contains defects in the E 1 a, E 1 b and E2a sequences; (c) the
third-
CA 02393844 2002-06-05
WO 01/44280 PCT/US00/33123
-38-
generation Ad vector which contains defects in the E l and E4 sequence, and
most
desirably is deleted of all or most of the sequence encoding these proteins;
and
(d) the fourth-generation Ad vector which is completely devoid of all viral
genes.
At a minimum, the E1-deleted vector to be packaged contains adenovirus
5' and 3' cis-elements necessary for replication and packaging, a transgene,
and
a pIX gene or a functional fragment thereof. The vector further contains
regulatory sequences which permit expression of the encoded transgene product
in a host cell, which regulatory sequences are operably associated with the
transgene. Also included in the vector are regulatory sequences operably
associated with other gene products, e.g., the pIX gene, carried by the
vector.
Thus, a method of producing recombinant replication-incompetent
adenovirus particles is provided comprising the steps of: (a) infecting or
transfecting a complementing cell line of the invention with a replication
incompetent adenovirus vector; and (b) purifying the adenovirus particles.
~ 5 Compositions comprising substantially pure preparations of adenovirus
particles
produced by the above-described method are also provided. It is not necessary
that the complementation element/complementing cell line and the replication
incompetent adenovirus vector contain any related sequences whatsoever,
however, and advantage of the present invention is that existing adenovirus
2o vectors, which do contain related sequences, e.g. in the El locus, are
suitable for
use in the present invention. Accordingly, in certain preferred embodiments,
the
replication incompetent adenovirus vector comprises at least 15 consecutive
nucleotides which, but for the degeneracy of the genetic code, would be
identical
to at least 15 consecutive nucleotides in the complementation
25 element/complementing cell line.
Adenovirus Elements. The replication incompetent vector to be packaged
includes, at a minimum, adenovirus cis-acting 5' and 3' inverted terminal
repeat
(ITR) sequences of an adenovirus (which function as origins of replication)
and
3o the native 5' packaging/enhancer domain. These are 5' and 3' cis-elements
CA 02393844 2002-06-05
WO 01/44280 PCT/US00/33123
-39-
necessary for packaging linear Ad genomes and further contain the enhancer
elements for the E1 promoter.
The E1-deleted vector to be packaged into a viral particle is further
engineered so that it expresses the pIX gene product. Most suitably, the pIX
gene
is intact, containing the native promoter and encoding the full length
protein.
According to Babiss and Vales, J. Virol. 65:598-605 (1991), the native pIX
promoter begins at Ad5 nucleotide 3525, which overlaps with the.El region by
about 86 nucleotides (see Figure 2). However, where desired, the native pIX
promoter may be substituted by another desired promoter. Alternatively,
sequences encoding a functional fragment of pIX may be selected for use in the
vector. In yet another alternative embodiment, the native sequences encoding
pIX or a functional fragment thereof may be modified to enhance expression.
For
example, the native sequences may be modified, e.g., by site-directed
mutagenesis or another suitable technique. to insert optimized codons to
enhance
~ 5 expression in a selected host cell. Suitable codons to utilize for any
given host
cell may be determined by use of a codon usage table for the species of the
cell
line, for example a human codon usage table as shown in Table 1, supra.
In a suitable embodiment, the adenovirus sequences in the E 1-deleted
vector include the 5' and 3' cis-elements, functional E2 and E4 regions,
2o intermediate genes IX and IXa, and late genes L1 through L5. However, the
El-
deleted vector may be readily engineered by one of skill in the art; taking
into
consideration the minimum sequences required, and is not limited to these
exemplary embodiments.
The vector is constructed such that the transgene and the sequences
25 encoding pIX are located downstream of the 5' ITRs and upstream of the 3'
ITRs.
The transgene is a heterologous polynucleotide, which encodes a polypeptide,
protein, or other product, of interest. The transgene is operably associated
with
regulatory components in a manner which permits transgene transcription.
CA 02393844 2002-06-05
WO 01/44280 PCT/US00/33123
-40-
Transgene. The composition of the transgene will depend upon the use
to which the resulting adenovirus vector~will be put. For example, one type of
transgene is a reporter gene, which upon expression produces a detectable
signal.
Such reporter genes include without limitation, polynucleotides encoding (3-
lactamase, (3-galactosidase, alkaline phosphatase, thymidine kinase, green
fluorescent protein (GFP), chloramphenicol acetyltransferase (CAT), and
luciferase. Other transgenes of interest include membrane bound proteins
including, for example, CD2, CD4, CDB, the influenza hemagglutinin protein,
and others well known in the art, to which high affinity antibodies directed
thereto exist or can be produced by conventional means, and fusion proteins
comprising a membrane bound protein appropriately fused to an antigen tag
domain from, among others, hemagglutinin or Myc.
Desirably, however, the transgene is a non-marker sequence encoding a
product which is useful in biology and medicine, such as proteins, peptides,
t5 antisense nucleic acids (e.g. RNAs), enzymes, or catalytic RNAs. The
transgene
may be used to correct or ameliorate gene deficiencies, which may include
deficiencies in which normal genes are expressed at less than normal levels or
deficiencies in which the functional gene product is not expressed.
A preferred type of transgene sequence encodes a therapeutic protein or
polypeptide which is expressed in a host cell. Suitable therapeutic proteins
or
polypeptides include, but are not limited to granulocyte macrophage colony
stimulating factor (GM-CSF), granulocyte colony stimulating factor (G-CSF),
macrophage colony stimulating factor (M-CSF), colony stimulating factor (CSF),
interleukin 2 (IL-2), interleukin-3 (IL-3), interleukin 4 (IL-4), interleukin
5 (IL-
5), interleukin 6 (IL-6), interleukin 7 (IL-7), interleukin 8 (IL-8),
interleukin 10
(IL-10), interleukin 12 (IL-12), interleukin 15 (IL-15), interleukin 18 (IL-
18),
interferon alpha (IFNa), interferon beta (IFN(3), interferon gamma (IFNy),
interferon omega (IFNw), interferon tau (IFNT), interferon gamma inducing
factor
I (IGIF), transforming growth factor beta (TGF-(3), RANTES (regulated upon
activation, normal T-cell expressed and presumably secreted), macrophage
CA 02393844 2002-06-05
WO 01/44280 PCT/US00/33123
-41-
inflammatory proteins (e.g., MIP-1 alpha and MIP-1 beta), Leishmania
elongation initiating factor (LEIF), platelet derived growth factor (PDGF),
TNF,
growth factors, e.g., epidermal growth factor (EGF), vascular endothelial
growth
factor (VEGF), fibroblast growth factor, (FGF), nerve growth factor (NGF),
brain
derived neurotrophic factor (BDNF), neurotrophin-2 (NT-2), neurotrophin-3 (NT-
3), neurotrophin-4 (NT-4), neurotrophin-5 (NT- 5), glial cell line-derived
neurotrophic factor (GDNF), ciliary neurotrophic factor (CNTF), erythropoietin
(EPO), and insulin.
The invention further includes using multiple transgenes, e.g., to correct
1 o or ameliorate a gene defect caused by a combination or proteins or by a
multisubunit protein. In certain situations, a different transgene may be used
to
encode each subunit of a protein, or to encode different peptides or proteins.
This
is desirable when the size of the DNA encoding the protein subunit is large,
e.g.,
for an immunoglobulin, the platelet-derived growth factor (PDGF), or a
dystrophin protein. In order for a cell to produce the multisubunit protein,
the cell
is infected with separate recombinant viruses containing each of the different
subunits. Alternatively, different subunits of a protein may be encoded by the
same transgene. In this case, a single transgene includes a polynucleotide
encoding all of the subunits, with the DNA for each subunit separated by an
2o internal ribozyme entry site (IRES). This is desirable when the size of the
polynucleotide encoding all of the subunits is small, e.g., the total length
of the
polynucleotide encoding all of the subunits and the IRES is less than about
five
kb. Other useful gene products include, non-naturally occurring polypeptides,
such as chimeric or hybrid polypeptides having a non-naturally occurring amino
acid sequence containing insertions, deletions or amino acid substitutions.
For
example, single-chain engineered immunoglobulins could be useful in certain
immunocompromised patients. Other types of non-naturally occurring gene
sequences include antisense molecules and catalytic nucleic acids, such as
ribozymes, which could be used to reduce overexpression of a gene. However,
CA 02393844 2002-06-05
WO 01/44280 PCT/US00/33123
-42-
the selected transgene may encode any product desirable for study. The
selection
of the transgene sequence is not a limitation of this invention.
Expression Control Seguences. In addition to the major elements
identified above for the adenovirus vector (e.g. the adenovirus sequences and
the
transgene), the adenovirus vector also includes conventional control elements
necessary to drive expression of the transgene in a host cell containing the
transgene. Thus the vector contains a selected promoter which is linked to the
transgene and located, in operable association with the transgene, between the
1 o viral sequences of the vector. Suitable promoters may be readily selected
from
among constitutive and inducible promoters. Selection of these and other
common vector elements are conventional and many such sequences are
available. See, e.g., Sambrook et al., and references cited therein; see also
the
general description of vector elements above.
Examples of constitutive promoters include, without limitation, the
retroviral Rous sarcoma virus (RSV) LTR promoter (optionally with the RSV
enhancer), the cytomegalovirus (CMV) promoter (optionally with the CMV
enhancer) (see, e.g., Boshart et al., Cell 41:521-530 (1985)), the SV40
promoter,
the dihydrofolate reductase promoter, the (3-actin promoter, the
phosphoglycerol
kinase (PGK) promoter, and the EF 1 a promoter. Inducible promoters are
regulated by exogenously supplied compounds, including, the zinc-inducible
sheep metallothionine (MT) promoter, the dexamethasone (Dex)-inducible mouse
mammary tumor virus (MMTV) promoter, the T7 polymerase promoter system
(WO 98/10088); the ecdysone insect promoter (No et al., Proc. Natl. Acad. Sci.
USA, 93: 3346-3351 (1996)), the tetracycline-repressible system (Gossen et
al.,
Proc. Natl. Acad. Sci. USA, 89: 5547-5551 (1992)), the tetracycline-inducible
system (Gossen et al., Science 268: 1766-1769 (1995); Harvey et al., Curr.
Opin.
Chem. Biol. 2:512-518 (1998)), the RU48 pQBI-pgK-E1.1 6-inducible system
(Wang et al., Nat. Biotech. IS: 239-243 (1997); Wang et al., Gene Ther. 4: 432-
CA 02393844 2002-06-05
WO 01/44280 PCT/US00/33123
-43-
441 (1997)) and the rapamycin-inducible system (Magari et al., .l. Clin.
Invest.
100: 2865-2872 (1997)).
Otl:erAd Vector Elements. The vector carrying the Ad ITRs flanking the
transgene and regulatory sequences (e.g., promoters, polyA sequences, etc.)
may
be in any form which transfers these components to the host cell. Heterologous
expression control elements optionally present in this vector include
sequences
providing signals required for efficient polyadenylation of the RNA
transcript,
and introns with functional splice donor and acceptor sites. Common
polyadenylation (polyA) sequences which are employed in the vectors useful in
this invention are derived from the papovavirus SV40 or the bovine growth
hormone (BGH) gene. The polyA sequence is generally inserted 3' to, and in
operable associatiomvith, the transgene sequences. A vector useful in the
present
invention may also contain an intron, desirably located between the
promoter/enhancer sequence and the transgene, to promote mRNA stability
following transcription. One possible intron sequence is also derived from
SV40,
and is referred to as the SV40 T intron sequence. Selection of these and other
common vector elements are conventional and many such sequences are available
in the art. See, e.g., Sambrook et al., and references cited therein at, for
example,
pages 3.18-3.26 and 16.17-16.27.
Co-Transfection ofAdenovirus Sequences. Preferably, the replication-
deficient Ad vector contains all functional adenovirus sequences required for
packaging and replication upon infection of the corresponding complementing
cell line of the invention. More preferably, however, a cell line of the
invention
which has been stably transfected to supply additional required adenovirus
functions is utilized. In one embodiment, these functions may be supplied by
co-
transfection of an E1-complementing cell line with one or more nucleic acid
molecules capable of directing expression of the required adenovirus function.
As will be evident to those of skill in the art, where co-transfection is
used, RCA
CA 02393844 2002-06-05
WO 01/44280 PCT/US00/33123
-44-
formation can be reduced or eliminated by minimizing overlapping homology
between the Ad vector and the co-transfecting plasmid. This can be
accomplished through modification of codon usage and/or the use of
heterologous
introns or splice sites, in either the complementing nucleic acid molecule
(which
supplies the essential Ad functions not supplied by either the vector or the
cell)
and/or modified codon usage or heterologous introns or splice sites in the Ad
vector itself.
For example, a vector deleted of El' and having a defective E2 region may
be complemented in E1 complementing cell lines of the invention by transiently
or stably transfecting into the cells a nucleic acid molecule (e.g., a
plasmid)
expressing required E2 functions (e.g. E2a). As another example, a vector
lacking E1 through E4 functions may be complemented in E1 complementing cell
lines of the invention by transiently or stably transfecting the cells with a
nucleic
acid molecule expressing functional E2, E3 and E4 (e.g. E40RF6). Construction
1 s of these nucleic acid molecules, as well as isolation of stable
transfectant cell
lines, is within the skill of those in the art.
Suitably, a selected recombinant vector, as described above, is introduced
into El complementing cells from a cell line of the invention using
conventional
techniques, such as the transfection techniques known in the art (see, for
example,
2o Kozarsky et al., Som. Cell and Molec. Genet. 19(5): 449-458 (1993)).
Thereafter, recombinant El-deleted adenoviruses are isolated and purified
following transfection. Purification methods are well known to those of skill
in
the art and may be readily selected. For example, the viruses may be subjected
to plaque purification and the lysates subjected to density gradient
centrifugation
25 to obtain purified virus.
Ampl fcation of Recombinant Adenoviruses. The complementing cell
lines of the invention (or derivatives thereof) may be used to amplify
recombinant
Ad. Suitably, the recombinant Ad will have been isolated and purified from
3o cellular debris and other viral materials prior to use in this method. This
is
CA 02393844 2002-06-05
WO 01/44280 PCT/US00/33123
-45-
particularly desirable where the rAd to be amplified is produced by methods
other
than those of the present invention. Suitable purification methods, e.g.,
plaque
purification, are well known to those of skill in the art.
A culture, or preferably, a suspension of cells from a complementing cell
line of the invention is infected with the rAd using conventional methods. A
suitable multiplicity of infection (MOI) may be readily selected. However, an
MOI in the range of about 0.1 to about 100 plaque forming units (pfu) per
cell,
about 0.5 to about 20 pfu/cell, and/or about 1 to about 5 pfu/cell, is
desirable.
The cells are then cultured under conditions which permit cell growth and
1 o replication of the rAd in the presence of the Ad proteins expressed by the
cell line
of the invention. Suitably, the viruses are subjected to continuous passages
for
up to 5, 10, or 20 passages. However, where desired, the viruses may be
subjected to fewer, or more passages.
The cells are subjected to two to three rounds of freeze-thawing, the
resulting lysate is subjected to centrifugation to remove cellular debris, and
the
supernatant is collected. Conventional purification techniques such as density
gradient centrifugation or column chromatography are used to concentrate the
rAd, and to purify it from the cellular proteins in the lysate.
Advantageously,
however, the method of the invention through use of the cell lines of the
invention avoids the problem of contaminating RCA which plague conventional
production techniques. Verification of the absence of RCA is determined by
methods described in more detail below.
RecombinantAdenovirus Particles Produced by Metlzods of Invention
The recombinant adenoviruses produced according to the present
invention are suitable for a variety of uses and are particularly suitable for
in vivo
uses, as the present invention permits these adenoviruses to be produced in
serum-free media, and in the absence of detectable RCA. Thus, the adenoviruses
CA 02393844 2002-06-05
WO 01/44280 PCT/US00/33123
-46-
produced according to the invention are substantially free of contamination
with
RCA.
In one embodiment, E 1-deleted viruses have been deemed suitable for
applications in which transient transgene expression is therapeutic (e.g., p53
gene
transfer in cancer, ~3-interferon gene transfer in cancer, PDGF gene transfer
in
wound healing, and vascular endothelial growth factor (VEGF) gene transfer in
vascular diseases of the heart and limbs). However, the E1-deleted
adenoviruses
are not limited to use where transient transgene expression is desired.
Suitable doses of E1-deleted adenoviruses may be readily determined by
l0 one of skill in the art, depending upon the condition being treated, the
health, age
and weight of the veterinary or human patient, and other related factors.
However, generally, a suitable dose may be in the range of about 10~ to about
10'g
virus particles per dose, preferably about 10'° to about 10", about 10"
to about
10'6, about 10'2 to about 10'5, about 10'3 to about 10" viral particles per
dose, for
an adult human having weight of about 80 kg. Even more preferred doses include
about 109 about 10'° about 10" about 10'2 about 10'3 about 10'°
about 10'5
> > > > > > >
about 10'6, about 10", and about 10'~ virus particles per dose for an adult
human
having a weight of about 80 kg. This dose may be suspended in about 0.01 mL
to about 100 mL of a physiologically compatible carrier and delivered by any
suitable means. Suitable delivery means include but are not limited to, by
injection, either intramuscularly, subcutaneously, intravenously; by catheter
infusion into, for example, the heart or lungs, or by topical application
during
surgery. The dose may be repeated, as needed or desired, daily, weekly,
monthly,
or at other selected intervals.
A Rapid, Quantitative, PCR-based Assay to Detect RCA With Increased
Sensitivity (>IO-'° RCAIrAd pfu).
The present invention further provides an assay to detect replication
competent viruses in production stocks of replication incompetent viruses.
Specifically the present invention provides an assay to detect RCA in a
CA 02393844 2002-06-05
WO 01/44280 PCT/US00/33123
-47-
production stock of replication incompetent adenovirus. The invention further
provides a method to detect replication competent viruses, particularly RCA,
in
production stocks of replication incompetent viruses, particularly replication
incompetent adenoviruses, utilizing the assay of the present invention. Also
provided are kits containing the necessary instructions and reagents to
perform
the assay.
The assay is based on the premise that E1-defective replication
incompetent adenoviruses, such as those described herein, lack some or all of
the
E 1 locus. The E 1-encoded gene products are provided by a complementing cel l
line of the present invention. Therefore, in a virus preparation sufficiently
purified from the host cell DNA, presence of the E 1 locus is indicative of
RCA.
In a preferred embodiment, a PCR-based assay using a signaling probe, the
signal of which is detectable and quantifiable in real time during the PCR
assay,
is utilized to determine the presence the E1 region in the virus preparation.
In
certain preferred embodiments, the assay utilizes Molecular Beacon technology
(U.S. Patent No. 5,925,517) and/or TaqManTM technology (U.S. Patent No.
5,538,848) to measure a signal generated during a PCR-based assay. U.S.
Patents
5,538,848 and 5,925,517 are incorporated herein by reference in their
entireties.
In general, a large-scale preparation of replication incompetent virus is
subjected to DNAse treatment to eliminate or minimize host cell DNA, the virus
particles are further purified by standard methods, the virus particles are
lysed,
and the virus genomes are subjected to PCR. For DNA viruses, standard PCR
utilizing a heat stable DNA polymerise, such as Taq polymerise or Pfu
polymerise. For RNA viruses such as retroviruses, RT-PCR is used, which
includes a first amplification reaction with reverse transcriptase, and
subsequent
amplification reactions as with regular PCR. These techniques are well known
to those of ordinary skill in the art, and can be found, e.g., in references
such as
Sambrook et al., supra.
The PCR reaction, in addition to the standard forward and reverse primers
used to amplify the amplicon, also contains at least one signaling
hybridization
CA 02393844 2002-06-05
WO 01/44280 PCT/US00/33123
-48-
probe for detection of the amplicon. Upon hybridization of the signaling
hybridization probe to the amplicon, a detectable signal, preferably a
fluorescent
signal, is released, allowing measurement of the quantity of the amplicon in
real
time, during the course of the PCR reaction.
One suitable embodiment provides an assay for detecting the presence of
replication competent virus in a production stock of replication incompetent
virus
comprising subjecting a sample of the virus production stock to polymerase
chain
reaction amplification with a forward primer and a reverse primer which
amplify
a region of the genome of said replication competent virus which is deleted
from
1 o the genome of said replication incompetent virus, such that in the
presence of said
replication competent virus,. a replication competent virus-specific double-
stranded amplicon is formed; further allowing the sample to hybridize with a
first
signaling hybridization probe complementary to at least one strand of the
replication competent virus-specific amplicon, where hybridization with the
first
signaling hybridization probe occurs under specified conditions at or below a
specified detection temperature, thereby emitting a first signal, where the
first
signal is detectable only upon hybridization of the probe to the replication
competent virus-specific amplicon, or the genome of said replication competent
virus; and detecting the presence or absence of the first signal. The first
signal
is detectable during the PCR reaction, in real time, and the intensity of the
first
signal correlates with the amount of the replication competent virus-specific
amplicon produced during the PCR reaction.
In this embodiment, the replication incompetent virus production stock
is preferably a replication incompetent adenovirus stock, and the replication
competent virus-specific amplicon is preferably amplified from a gene product
which is deleted from the replication incompetent adenovirus. Suitable regions
from which to amplify the replication competent virus-specific amplicon
include
the E1 region, the E2 region, or the E4 region (e.g., E40RF6), are described
herein. Preferably the replication competent virus-specific amplicon is
amplified
from the E I region.
CA 02393844 2002-06-05
WO 01/44280 PCT/US00/33123
-49-
As one of ordinary skill in the art will readily appreciate from the
embodiments described above, a complementing cell line of the present
invention
contains a polynucleotide which encodes the gene products necessary to produce
replication incompetent virus particles, and that this polynucleotide, if not
sufficiently degraded by DNAse treatment as discussed above, would likely be
amplified with the forward and reverse oligonucleotide primers used to produce
the replication competent virus-specific amplicon. Accordingly a preferred
assay
of the present invention further provides a control reaction to measure the
presence of host cell DNA, comprising subjecting a sample of the virus
to production stock to polymerase chain reaction amplification with a forward
oligonucleotide primer and a reverse oligonucleotide primer which amplify a
region of the host cell genome, such that in the presence of host cell DNA, a
host
cell-specific double-stranded amplicon is formed, further allowing the sample
to
hybridize with a second signaling hybridization probe complementary to at
least
one strand of the resulting host cell-specific double-stranded amplicon,
wherein
hybridization with the signaling hybridization probe occurs under specified
conditions at or below a specified detection temperature, thereby emitting a
second signal which is distinguishable from the first signal, discussed above,
where the second signal is detectable only upon hybridization to the host cell-
2o specific amplicon, or the host cell DNA; and detecting the presence or
absence
of the second signal. The second signal, like the first signal, is detectable
during
the PCR reaction, in real time, and the intensity of the second signal
correlates
with the amount of the replication competent virus-specific amplicon produced
during the PCR reaction. The presence of the second signal indicates the
presence of host cell DNA and thereby invalidates the assay in which the
replication competent virus specific amplicon is detected.
The cell-specific amplicon can be amplified from any suitable cellular
gene. A suitable cellular gene would be one that does not appear in the virus
genome. Preferred genes from which to amplify the cell-specific amplicon are
3o those which exist in multiple copies in the cellular genome, thus allowing
for
CA 02393844 2002-06-05
WO 01/44280 PCT/US00/33123
-50-
greater sensitivity. Particularly preferred genes from which to amplify the
cell-
specific amplicon are include (3-actin and GAPDH. Most preferred is to amplify
the cell specific amplicon from the (3-actin gene.
In a particularly preferred embodiment, amplification of the replication
competent virus-specific amplicon and the cell-specific amplicon are carried
out
simultaneously in the same reaction tube, using a technique called
multiplexing,
discussed in more detail infra. Multiplexing is the amplification and analysis
of
two or more target sequences in the same PCR reaction, and is accomplished
through the use of signaling hybridization probes, the signals of which are
readily
t 0 distinguishable by a detection instrument monitoring the reaction. A
suitable
detection instrument is an ABI Prisui~ 7700 Unit, available from PE
Biosystems.
Preferred signaling hybridization probes of the present invention are
Molecular Beacons (see U.S. Patent No 5,925,517; and Tyagi, S., and Kramer,
F., Nature Biotech. 14:303-308 (1996), the disclosure of which is incorporated
herein by reference in its entirety). Molecular Beacons are hairpin-shaped
molecules with an internally quenched fluorophore whose fluorescence is
restored
when they bind to a target nucleic acid. They are designed in such a way that
the
loop portion of the molecule is a probe sequence complementary to a target
nucleic acid molecule, e.g., a replication competent virus-specific amplicon
of the
present invention. The stem is formed by the annealing of complementary arm
sequences on the ends of the probe sequence. A fluorescent moiety is attached
to
the end of one arm and a quenching moiety is attached to the end of the other
arm. The stem keeps these two moieties in close proximity to each other,
causing
the fluorescence of the fluorophore to be quenched by energy transfer. Since
the
quencher moiety is a non-fluorescent chromophore and emits the energy that it
receives from the fluorophore as heat, the probe is unable to fluoresce. When
the
probe encounters a target molecule, it forms a hybrid that is longer and more
stable than the stem and its rigidity and length preclude the simultaneous
existence of the stem hybrid. Thus, the Molecular Beacon undergoes a
3o spontaneous conformational reorganization that forces the stem apart, and
causes
CA 02393844 2002-06-05
WO 01/44280 PCT/US00/33123
-51-
the fluorophore and the quencher to move away from each other, leading to the
restoration of fluorescence which can be detected by standard methods known to
those of skill in the art.
Thus, in a preferred embodiment, the detection assay of the present
invention utilizes a first, and preferably also a second, signaling
hybridization
probe, also referred to herein as a first Molecular Beacon and a second
Molecular
Beacon, each comprising a single-stranded polynucleotide complementary to at
least one strand of the replication competent virus-specific amplicon, having
a 5'
terminus and a 3' terminus, with a pair of oligonucleotide arms flanking the
complementary polynucleotide, consisting of a 5' arm sequence covalently
linked
to said 5' terminus and a 3' arm sequence covalently linked to said 3'
terminus,
where the pair of oligonucleotide arms form a stem duplex having a melting
temperature above a specified detection temperature under specified assay
conditions, but below the melting temperature of a duplex formed between the
signaling hybridization probe and the complementary region of its respective
amplicon (i.e. either the replication competent virus-specific amplicon or the
cell-
specific amplicon); and on each probe, a interacting label pair, comprising a
fluorescent molecule conjugated to the 5' arm sequence, and a quenching
molecule conjugated to the 3'arm sequence which, upon the formation of a stem
2o duplex between said 5' arm and said 3' arm, is in sufficiently close
proximity to
quench the signal from the fluorescent molecule, wherein under the assay
conditions at the detection temperature and in the presence of its respective
amplicon, hybridization of the probe sequence to the amplicon occurs in
preference to the formation of said stem duplex, sufficiently separating the
fluorescent molecule from said quenching molecule, thereby allowing a
fluorescent signal to be detected.
Suitable assay conditions and detection temperatures are determined
based on the melting temperatures, nucleotide compositions, and lengths of the
various primers and probes, as will be appreciated by one of ordinary skill in
the
art. One example of a set of suitable conditions is disclosed in Example 5,
infra.
CA 02393844 2002-06-05
WO 01/44280 PCT/US00/33123
-52-
In preferred embodiments, the first signaling hybridization probe and the
second signaling hybridization probe comprise distinct fluorescent molecules
attached to their 5' ends, allowing two distinct fluorescent signals to be
detected
in a single reaction tube.
A wide variety of fluorescent molecules are suitable for use in the present
invention. Suitable molecules include, but are not limited to 6-
carboxyfluorescein (6-FAM), tetrachloro-6-carboxyfluorescein (TET), 2,7,-
dimethoxy-4,5-dichloro-6-carboxyfluorescein (JOE), hexachloro-6-
carboxyfluorescein (HEX), 5-carboxyfluorescein (5-FAM), 6-carboXyrhodamine
(R110), N, N'- Diethyl-2',7'-dimethyl-6-carboxyrhodamine (R6G), NED, 6-
carboxytetramethylrhodamine (TAMRA), 6-carboxyrhodamine (ROX), VIC,4,4-
difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacene (BODIPY FL), [5-[(3,5-
diphenyl-2H-pyrrol-2-ylidene-KN)methyl]-1 H-pyrrole-2-propanoato-KN 1 ]
difluoroborate hydrogen (BODIPY 530/550), [N-[1-[4-[[3-[(2,3-dihydro -2-oxo-
1H-benzimidazol-4-yl)oxy]-2-hydroxypropyl]amino]-4-methylcyclohexyl] -1-
methylethyl]-5-[[5-(4-methoxyphenyl)-2H-pyrrol-2-ylidene-KN]methyl] -2,4-
dimethyl -1H-pyrrole-3-propanamidato-KN1]difluoroboron (BODIPY
TMR),difluoro[5- 5-(2-thienyl)-2H-pyrrol-2-ylidene-xN]methyl]-1H-pyrrole-2-
propanoato-KN1 ]-borate hydrogen (BODIPY 558/568), difluoro[5-[[5-[(lE~-2-
2o phenylethenyl] -2H-pyrrol-2-ylidene-KN]methyl]-1H-pyrrole-2-propanoato-
KN1]borate hydrogen (BODIPY 564/570), difluoro[5-[[5-(1H-pyrrol-2-yl)-2H-
pyrrol-2-ylidene-KN] methyl]-1H-pyrrole-2-propanoato-KN1]borate hydrogen
(BODIPY 576/589), difluoro[5-[[5-[(lE,3E~-4-phenyl-1,3-butadienyl]-2H-pyrrol-
2-ylidene-oN]methyl]-1H-pyrrole-2-propanoato-kNl]borate hydrogen (BODIPY
581/591), difluoro[6-[[[4-[2-[2- [[S-(2-thienyl)-1H-pyrrol-2-yl-KN]methylene]-
2H-pyrrol-S-yl-KN]ethenyl]phenoxy] acetyl]amino]hexanoato]borate hydrogen
(BODIPY 630/650), 1,3,6-Pyrenetrisulfonic acid, 8-[2-[[2-
[(chloroacetyl)amino]ethyl]amino]-2-oxoethoxy]-, trisodium salt (Cascade Blue,
N-[4-[[4-(diethylamino)phenyl] [4-(ethylamino)-1-naphthalenyl] methylene]- 2,5-
cyclohexadien-1-ylidene]-N-ethylethanaminium molybdatetungstatephosphate
CA 02393844 2002-06-05
WO 01/44280 PCT/US00/33123
-53-
(Cascade Blue), 2-[5-[1-[6-[(2,5-dioxo-1-pyrrolidinyl)oxy]-6-oxohexyl]-1,3-
dihydro-3,3-dimethyl-5-sulfo-2H-indol-2-ylidene]-1,3-pentadienyl]-1-ethyl- 3,3-
dimethyl-5-sulfo-3H-indolium inner salt (Cy5), 5-[(2-aminoethyl)amino]-1-
naphthalenesulfonic acid (Edans), 7-nitrobenz-2-oxa-1,3-diazole (NBD), 2',7'-
difluorofluorescein (Oregon Green 488), and Sulforhodamine 101 sulfonyl
chloride (Texas Red). Preferred fluorescent molecules include 6-
carboxyfluorescein (6-FAM), and VIC.
Similarly, a wide variety of quencher molecules are suitable for use in the
present invention. Note that a particular quencher molecule can quench a
variety
of different fluorescent molecules. Therefore, a single quencher molecule can
be
selected to incorporate into the first and second signaling probes. Suitable
quencher molecules include, but are not limited to (4-(4'-
dimethylaminophenylazo)benzoic acid) succinimidyl ester (DABCYL), 4-
(dimethylamine)azo benzene sulfonic acid (DABSYL), 1-dimethoxytrityloxy-3-
~ 5 [O-(N-4'-sulfonyl-4-(dimethylamino)-azobenzene)-3-aminopropyl]-propyl-2-O-
succinoyl-long chain alkylamino-CPG (DABSYL-CPG), 9-(2-(4-
carboxypiperidine-1-sulfonyl)-3,6-dimethyl-3,6-diphenyl)xanthylium (QSYTM),
6-carboxytetramethylrhodamine (TAMRA), and TAMRA-NHS-Ester.
Preferred quencher molecules include DABCYL and TAMRA.
20 Fluorescent molecules and quencher molecules are available
commercially in forms which can be attached to an existing probe by
straightforward chemical protocols known to those of ordinary skill in the
art, and
often supplied by the manufacturer. Alternatively, certain of these molecules
are
available covalently linked to nucleotides which can be incorporated directly
into
25 an oligonucleotide probe during its synthesis.
Construction of suitable Molecular Beacon probes utilizes concepts which
are well understood by those of ordinary skill in the art. The Molecular
Beacon
probe region should be 15 to 33 nucleotides long, with a melting temperature
that
is 7-10° C higher than the PCR annealing temperature. The melting
temperature
30 of the probe-target hybrid can be predicted using the percent GC rule,
where for
CA 02393844 2002-06-05
WO 01/44280 PCT/US00/33123
-54-
an oligonucleotide of about 50 or fewer bases, T,n=4(G+C)+2(A+T), where G+C
is the total number of G and C nucleotides in the chain, and A+T is the total
number of A and T nucleotides in the chain. The prediction should be made for
the probe sequence alone before adding the arm sequences. After selecting a
probe sequence, two complementary arm sequences should be added, one on each
side of the probe sequence. The stem sequences should not be complementary to
the target sequence. This stem region of the Molecular Beacon should be 5 to 7
by long, with the GC content at 70-80%. The length, sequence and GC content
of the stem should be chosen such that the melting temperature is 7-10
°C higher
than the annealing temperature of the PCR primers. A 5 by stem will melt at 55-
60 °C, a 6 by stem at 60-65 °C, and a 7 by stem at 65-70
°C. Since the G
nucleotide may act as a quencher, it is best to avoid designing a Molecular
Beacon with a G directly adjacent to the fluorescent dye (typically at the 5'
end
of the stem sequence).
~ 5 The sequence of the Molecular Beacon and forward and reverse PCR
primers should be designed so that there are no regions of complementarity,
which may cause the Molecular Beacon to bind to primers and increase
background. It is important to design the Molecular Beacon in an area where
there is minimal secondary structure formation of the target. This will help
prevent the template from preferentially annealing to itself faster than to
the
Molecular Beacon. It is recommended to design the Molecular Beacon such that
it binds at or near the center of the amplicon. The distance between the 3'-
end of
the upstream primer and the 5'-end of the Molecular Beacon (stem) should be
greater than 6 nucleotides.
Although for the PCR reactions described above Molecular Beacons are
the preferred choice for the first and second signaling probes, other
signaling
probes may be used. For example, TaqManTM probes, described in more detail
below, are a suitable choice for the first and/or second signaling probes.
Other
suitable signaling probes include ScorpionsTM primers (Whitcombe et al.,
Nature
3o Biotech. 17:804-807 (1999)), and the primers or probes described in Lee et
al.,
CA 02393844 2002-06-05
WO 01/44280 PCT/US00/33123
-55-
Biotechniques 27:342-349 (1999); and Brownie et al., Nucleic Acids Research
25:3235-3241 (1997). Molecular Beacon probes are preferred over TaqManT"'
probes because they allow the use of larger amplicons, and more flexibility
with
the reaction conditions. Although TaqMan probes allow single copy sensitivity
of amplicon detection they are limited to amplicons of less than approximately
150 bp. Molecular Beacons, while achieving the same level of sensitivity and
efficiency of amplification, do not suffer from this size limitation.
In a detection assay of the present invention, forward and reverse PCR
primers are chosen to produce as large a replication competent virus-specific
amplicon as possible. First, the larger amplicon size will increase the
probability
that DNAse treatment of host cell DNA will sufficiently remove contaminating
cellular DNA in the purified batches of replication incompetent viruses,
because
the cellular DNA (which will contain a copy of the complementation regions
required for propagation of the replication incompetent virus particles, and
thus
would result in false positives if not sufficiently removed) will only need to
be
degraded to a size smaller than the amplicon size. Second, the larger
replication
competent virus-specific amplicon will decrease the chance of obtaining false-
positive results which are the result of those recombination events between
the
replication incompetent virus vector DNA and the complementation region in the
complementing cell which do not lead to the generation of replication
competent
virus (e.g., a recombination of only minor parts of the complementation
region).
It is possible and likely that recombination could generate viruses containing
only a portion of the cellular complementing DNA, yet these viruses would not
be replication competent. If one targets only a small portion of the
replication
competent virus-specific genes in the assay, and this small region appears in
this
type of recombinant, replication-incompetent virus, one would score this as a
replication competent virus, which would be a false positive.
On the other hand, a Molecular Beacon is an internal probe which must
compete with the opposite strand of the amplicon for binding to its
complementary target. Therefore, having a shorter amplicon allows the
CA 02393844 2002-06-05
WO 01/44280 PCT/US00/33123
-56-
Molecular Beacon to compete more efficiently for binding to its target and,
therefore, produces better results during Molecular Beacon PCR experiments.
One of ordinary skill in the art will understand the need to balance the
advantages
of a larger amplicon in an assay according to the present invention, with the
advantages of a smaller amplicon to produce optimal results. Choice of an
optimal amplicon size requires only routine experimentation, and is well
within
the capabilities of one of ordinary skill in the art.
Suitable sizes for amplicons used in an assay of the present invention
range from about 50 base pairs in length to about 2000 base pairs in length.
1o Preferable amplicons are about 100 bp, about 150 bp, about 200 bp, about
300 bp,
about 400 bp, about 500 bp, about 600 bp, about 700 bp, about 800 by about 900
bp, about 1000 bp, about 1250 bp, about 1500 bp, about 1750 by or about 2000
by in length. More preferable amplicons are about 1000 to about 1500 by in
length.
Accordingly, a series of Molecular Beacon/primer sets of increasing size
are designed and the set with the largest sized amplicon that retains
acceptable
sensitivity is chosen for use in the detection assay. In the case of detection
of
RCA, the ideal first Molecular Beacon/primer set would be one that amplifies
the
entire E 1 a/B 1 b coding region present in the complementing cell line, and
2o maintains sensitivity. This Molecular Beacon/primer combination would yield
the lowest possible number of false-positive results in this PCR-based RCA
assay.
In a particularly preferred embodiment, an RCA-specific amplicon is
amplified from RCA or complementing host cell DNA with forward
oligonucleotide primer 5'-GGTTTCTATGCCAAACCTTGT-3' (SEQ ID N0:12)
and reverse oligonucleotide primer 5'-AACATCACTGAGGAGCAGTTCT-3'
(SEQ ID N0:13). The first signaling hybridization probe/Molecular Beacon has
the sequence 5'- GCAGCGAAGAAACCCATCTGAGCGGGCTGC-3' (SEQ ID
N0:14). The fluorescent molecule covalently linked to the 5' end of SEQ ID
3o N0:14 is 6-carboxyfluorescein (6-FAM), and the quencher covalently linked
to
CA 02393844 2002-06-05
WO 01/44280 PCT/US00/33123
-5 7-
the 3' end of SEQ ID N0:14 is 4-(dimethylamine)azo benzene sulfonic acid
(DABSYL). A preferred cell-specific (3-actin amplicon is amplified from a
complementing host cell DNA with oligonucleotide primers, and detected with
a second signaling hybridization probe/Molecular Beacon purchased from
Stratagene, Catalog No. 200570.
Reaction conditions for a PCR assay of the present invention include
conventional PCR conditions and reagents which must be optimized for any
particular set of oligonucleotide primers and probes, as one of ordinary skill
in the
art will readily understand. Suitable reagents are commercially available. An
1o annealing temperature should be chosen at which the Molecular Beacon will
bind
efficiently to its complementary target, if present, and at which the
Molecular
Beacon will adopt a stem-loop conformation if it is not bound to target.
One particularly preferred detection assay of the present invention
provides relative quantitation of replication competent virus vs. total virus
present
in the replication incompetent virus production stock. A suitable assay allows
the
detection of one (1) replication competent virus per 109 or more replication
incompetent virus. Preferably, the assay will detect 1 replication competent
virus
per 10'° or more replication incompetent virus. More preferably, the
assay will
detect 1 replication competent virus per 10", 10'2, or more replication
2o incompetent virus. Most preferably the assay will detect 1 replication
competent
virus per 10'~ or more replication incompetent virus.
In order to provide relative quantitation, this particularly preferred
detection assay provides measurement of the amount of replication competent
virus in a virus production stock of replication incompetent virus relative to
a
measurement of the amount of total virus present in the virus production
stock.
The results are plotted as the number of replication competent virus particles
present in the virus production stock relative to the number of total virus
particles
present in the virus production stock.
Accordingly, this particularly preferred embodiment, which incorporates
the detection assays provided above, further provides subjecting a sample of
the
CA 02393844 2002-06-05
WO 01/44280 PCT/US00/33123
-58-
virus production stock to polymerise chain reaction amplification with a
forward
oligonucleotide primer and a reverse oligonucleotide primer which amplify a
region of the virus genome which is common to both replication competent and
replication incompetent viruses, such that a virus-specific double-stranded
s amplicon is formed; allowing the sample to hybridize with a third signaling
hybridization probe complementary to at least one strand of the virus-specific
amplicon, where hybridization with said third signaling hybridization probe
occurs under specified conditions at or below a specified detection
temperature,
thereby emitting a third signal, and where the third signal is detectable only
upon
hybridization to the virus-specific amplicon, or a virus genome; and detecting
the
presence or absence of the third signal.
Because the relative quantity of virus-specific amplicons in the virus
production stock will be much higher than the quantities of either replication
competent virus-specific amplicons, or cell-specific amplicons, this third PCR
reaction is carried out separately from the PCR reactions discussed above. The
reaction may be carried out with a Molecular Beacon probe similar to those
discussed in detail above, or it may be carried out using a TaqManTM probe
(described in U.S. Patent No. 5,538,848, which is incorporated herein by
reference in its entirety). The PCR reaction is carried out using a nucleic
acid
polymerise having 5' to 3' nuclease activity, and the third signaling
hybridization
probe comprises a fluorescent molecule and a quencher molecule which quenches
the fluorescence of the fluorescent molecule in a linear, single-stranded
conformation. Upon hybridization of the third signaling hybridization probe
with
the virus-specific amplicon, the nucleic acid polymerise digests the third
2s signaling hybridization probe, thereby separating the fluorescent molecule
from
the quencher molecule, allowing detection.
The virus specific amplicon contemplated in this embodiment may be
amplified from any suitable portion of the virus genome which is common to
both
the replication incompetent virus, and the replication competent virus. In the
case
of E1-deleted replication incompetent adenovirus, the virus specific amplicon
CA 02393844 2002-06-05
WO 01/44280 PCT/US00/33123
-59-
may be amplified from any adenovirus genomic region except E1. Suitable
regions include, but are not limited to the E4 region, the E2 regions, the pIX
region, and any of the LI-LS regions. The E3 region may also be used, but this
is less preferred, since the E3 region is deleted from many replication
incompetent adenoviruses. A preferred region from which to amplify a virus-
specific amplicon is the E4 region.
The following examples are provided to illustrate the production of an E1
complementing cell line of the invention and its use in producing E1-deleted
adenovirus which are free of detectable RCA. These examples do not limit the
to scope of the invention. One skilled in the art will appreciate that
although
specific reagents and conditions are outlined in the following examples,
modifications can be made which are meant to be encompassed by the spirit and
scope of the invention.
~ s Examples
Example 1
(A). Construction of an EI Complementation Element and
Vector pQBI pgk-El.l
pQBI-pgk-E1.1 is a shuttle plasmid which contains a nucleotide sequence
capable of complementing E1-deleted adenovirus vectors. It contains a
complementation element encoding all of the Ad5 E 1 a and E 1 b proteins
including the 8.3 kDa Elb protein. The complementation element is designed
such that it comprises a non-naturally occurring nucleotide sequence in its 3'
most end (the region from nucleotides 3309 to 3609). This region is modified
such that it encodes wild-type Elb but does not contain sufficient homology
with
the corresponding wild-type sequences in an Ad vector to allow for homologous
recombination. In this way, a cell line transfected with such a
complementation
element and used to replicate E1-deleted Ad would not be expected to generate
CA 02393844 2002-06-05
WO 01/44280 PCT/US00/33123
-60-
RCA even if the Ad vector contained wild-type sequences in the region spanning
nucleotides 3309 to 3609. The modifications made to the El sequences are
shown in Figure 2 as the italicized bases below the wild-type sequence and the
nucleotide sequence used to replace the wild-type sequence from nt 3309 to
3614
is shown immediately below as SEQ ID NO:1.
SGQ ID NO: I
GTCTTCGATA TGACGATGAA GATCTGGAAA GTCCTCCGCT ATGACGAAAC GCGGACGCGC 60
TGTCGCCCTT GTGAATGCGG GGGCAAGCAC ATCCGCAATC AACCCGTCAT GCTCGACGTC 120
1O ACGGAAGAAC TCCGCCCTGA CCATCTCGTC CTCGCTTGTA CGCGGGCCGA ATTCGGGTCC 180
TCCGACGAGG ACACCGACTG A_GTAAGTTTA GTCTTTTTGT CTTTTATTTC AGGTCCCGGA 240
TCCGGTGGTG GTGCAAATCA AAGAF1CTGCT CCTCAGTGAT GTTGCCTTTA CTTCTA_GCAA 300
CCCCCCCCCC CCTGAGC 317
Nucleotides 1 to 201 of SEQ ID NO:1 are the final 67 codons (including
a stop codon) of the novel sequence encoding Ad5 Elb 55 kDa protein (bold).
The polypeptide encoded by nucleotides 1 to 201 is designated as SEQ ID N0:2.
Nucleotide 202 is the splice donor for the 22S Elb RNA of Ad5
(underlined).
Nucleotides 203 to 296 of SEQ ID NO:1 are the modified SV40 late
region intron.
Nucleotide 297 is the splice acceptor for the 22S Elb RNA of Ad5
(underlined).
Nucleotides 298 to 315 of SEQ ID NO:1 are the final 6 codons (including
a stop codon) of the novel sequence encoding Ad5 E 1 b 8.3 kDa protein (bold).
The polypeptide encoded by nucleotides 298 to 315 is designated SEQ ID N0:3.
Plasmid pSLI 180-E1 which contains the entire El loci of Ad5 was kindly
provided by Dr. J. Wilson of the University of Pennsylvania. The silent
mutations shown in Figure 2 between 3309 and 3327 are introduced to pSL1180-
E1 by first generating a nucleic acid fragment comprising the mutations
through
the use of the polymerase chain reaction (PCR) and the two oligonucleotide
primers set out below:
CA 02393844 2002-06-05
WO 01/44280 PCT/US00/33123
-61-
HC#40 5'-ATGAATGTTGTACAGGTGGC-3' (SEQ ID N0:4); and
HC#415'-TGACAGATCTTCATCGTCATATCGAAGACCCCGTTCAGGTTCACCTT-3'
(SEQ ID N0:5).
The resulting PCR product of about 1 kb is digested with BgIII and BsrGI and
cloned back into the BgIII-BsrGI sites of pSL 1180-El . This results in a
plasmid
designated "pSL1180-E1-BgIII". Six separate synthetic oligonucleotides,
containing the additional silent mutations and the SV40 intron shown in Figure
2, are annealed, filled in with the Klenow fragment of DNA polymerise I, and
l0 ligated by the method described in J. Virol. 70:4646 (1996), which is
incorporated herein by reference. These six oligonucleotides are as follows:
HC#42, 5'-ATGAAGATCTGGAAAGTCCTCCGCTATGACGAAA
CGCGGACGCGCTGTCGCCCTTGTGAATGCGGGGGCA-3' (SEQ ID N0:6);
HC#43, 5'-TCAGGGCGGAGTTCTTCCGTGACGTCGAGCATGACGGGT
TGATTGCGGATGTGCTTGCCCCCGCATTCAC-3' (SEQ ID N0:7);
HC#44,5'-AGAACTCCGCCCTGACCATCTCGTCCTCGCTTGTACGCGGGC
CGAATTCGGGTCCTCCGACGAGGACACC -3' (SEQ ID N0:8);
HC#45, 5'-ACCACCGGATCCGGGACCTGAAATAAAAGACAAAAAGAC
TAAACTTACCTCAGTCGGTGTCCTCGTCGGA-3' (SEQ ID NO:9);
HC#46,5'-CCCGGATCCGGTGGTGGTGCAAATCAAAGAACTGCTCCT
CAGTGATGTTGCCTTTACTTCTAGCAACCCC-3' (SEQ ID NO:10); and
HC#47, 5'-CGTCGTCGACTCAGGGGGGGGGGGGTTGCTAGAAGT-3'(SEQ ID
NO:11 ).
CA 02393844 2002-06-05
WO 01/44280 PCT/US00/33123
-62-
The ligated oligonucleotides are digested with BgIII and SaII and ligated into
the
BgIII and SaII sites of pSL1180-E1-Bglll to create a plasmid designated
"pSL1180-E1-BgIII-SaIL" pSL1180-E1-BgIII-SaII is digested with BstBI
(Klenow filled-in) and SpeI to isolate the modified E1 complementation element
which comprises the modified sequence shown in SEQ ID NO:1. The fragment
is ligated to the ApaI (Klenow filled in) and XbaI sites of pQBI-pgk-dl
(derived
from pQBI-pgk, Quantum Biotechnologies, Inc.) to create pQBI-pgk-E1.1 which
operably associates the PGK promoter to the modified E1 fragment. The pQBI-
pgk-E1.1 plasmid is sequenced to verify the presence of the introduced
modifications.
(B) Construction of an EI Complementation Element and
Vector pQBI pgk-E1.2
pQBI-pgk-E1.2 is another shuttle plasmid which contains a nucleotide
sequence capable of complementing E1-deleted adenovirus vectors. It also
contains a complementation element encoding all of the Ad5 E 1 a and E 1 b
proteins including the 8.3 kDa Elb protein. The complementation element is
designed such that it comprises a non-naturally occurring nucleotide sequence
in
its 3' most end (the region from nucleotides 3510 to 3609). In this way, a
cell line
transfected with such a complementation element and used to replicate E1-
deleted
Ad would not be expected to generate RCA even if the Ad vector contained
wildtype sequences in the region spanning nucleotides 3510 to 3609. The
modifications made to the E1 sequences in pQBI-pgk-E1.2 are shown
diagrammatically as the boxed nucleotide substitutions in Figure 2 and the
nucleotide sequence used to replace the wild-type sequence from nt 3309 to
3614
is shown immediately below as SEQ ID N0:19.
CA 02393844 2002-06-05
WO 01/44280 PCT/US00/33123
-63-
SEQ ID N0:19
GTGTTTGACA TGACCATGAA GATCTGGAAG GTGCTGAGGT ACGATGAGAC CCGCACCAGG 60
TGCAGACCCT GCGAGTGTGG CGGTAAACAT ATTAGGAACC AGCCTGTGAT GCTGGATGTG 120
ACCGAGGAGC TGAGGCCCGA TCACTTGGTG CTGGCCTGCA CCCGCGCTGA GTTTGGCTCT 180
S AGCGATGAAG ATACAGATTG AGTAAGTTTA GTCTTTTTGT CTTTTATTTC AGGTCCCGGA 290
TCCGGTGGTG GTGCAAATCA AAGAACTGCT CCTCAGTGAT GTTGCCTTTA CTTCTA_GCAA 300
CCCCCCCCCC CCTGAGC 317
Nucleotides 1 to 201 of SEQ ID N0:19 are the final 67 codons (including
a stop codon) of the naturally-occurring sequence encoding Ad5 E1b 55 kDa
protein (double underlined). The polypeptide encoded by nucleotides 1 to 201
of SEQ ID N0:19 is represented as SEQ ID N0:2.
Nucleotide 202 of SEQ ID N0:19 is the splice donor for the 22S Elb
RNA of Ad5 (single underlined).
15 Nucleotides 203 to 296 of SEQ ID N0:19 are the modified SV40 late
region intron.
Nucleotide 297 of SEQ ID N0:19 is the splice acceptor for the 22S Elb
RNA of Ad5 (single underlined).
Nucleotides 298 to 315 of SEQ ID N0:19 are the final 6 codons
20 (including a stop codon) of the novel sequence encoding Ad5 Elb 8.3 kDa
protein (bold). The polypeptide encoded by nucleotides 298 to 315 of SEQ ID
N0:19 is represented as SEQ ID N0:3.
Plasmid pQBI-pgk-E 1.2 is prepared from starting plasmid pSL 1180-
E 1 using standard techniques similar to those used in (A). The pQBI-pgk-E 1.2
25 plasmid is sequenced to verify the presence of the introduced
modifications.
(C) Construction of an EI Complementation Element and
Vector pQBl-pgk-E1.3
30 pQBI-pgk-E1.3 is a shuttle plasmid which contains a nucleotide sequence
capable of complementing EI-deleted adenovirus vectors. It contains a
complementation element encoding all of the E 1 a and E 1 b proteins including
the
8.3 kDa Elb protein. The complementation element is designed such that it
comprises a non-naturally occurring nucleotide sequence in its 3' most end
(the
CA 02393844 2002-06-05
WO 01/44280 PCT/US00/33123
-64-
region from nucleotides 3309 to 3609). This region has been modified similarly
to pQBI-pgk-E1.1, except that that it contains fewer nucleotide substitutions
(shown underlined in Figure 2), which are spaced out at about one substitution
every 15 nucleotides. The modifications made to the El sequences in pQBI-pgk-
E1.3 are shown diagrammatically in Figure 2 and the nucleotide sequence used
to replace the wild-type sequence from nt 3309 to 3614 is shown immediately
below as SEQ ID N0:18.
to
SEO ID N0:18
GTCTTTGACA TGACGATGAA GATCTGGAAA GTGCTGAGGT ACGACGAGAC CCGCACCAGC 60
TGCAGACCCT GCGAATGTGG CGGTAAACAC ATTAGGAACC AGCCCGTGAT GCTGGATGTC 120
ACCGAGGAGC TGAGCCCCGA TCACTTGGTC CTGGCCTGCA CCCGGGCTGA GTTTGGCTCC 180
AGCGATGAAG ATACCGATTG A_GTAAGTTTA GTCTTTTTGT CTTTTATTTC AGGTCCCGGA 240
TCCGGTGGTG GTGCAAATCA AAGAACTGCT CCTCAGTGAT GTTGCCTTTA CTTCTA_GCAG 300
CCGCCGCCCC CATGAGC 317
Nucleotides 1 to 201 of SEQ ID N0:18 are the final 67 codons (including
a stop codon) of the novel sequence encoding Ad5 E 1 b 55 kDa protein (bold).
The polypeptide encoded by nucleotides 1 to 201 of SEQ ID N0:18 is
represented by SEQ ID N0:2.
Nucleotide 202 is the splice donor for the 22S Elb RNA of Ad5
(underlined).
Nucleotides 203 to 296 of SEQ ID NO:1 are the modified SV40 late
region mtron.
Nucleotide 297 is the splice acceptor for the 22S Elb RNA of Ad5
(underlined).
Nucleotides 298 to 315 of SEQ ID NO:1 are the final 6 codons (including
a stop codon) of the novel sequence encoding Ad5 Elb 8.3 kDa protein (bold).
3o The polypeptide encoded by nucleotides 298 to 315 is represented by SEQ ID
N0:3.
Plasmid pQBI-pgk-E1.3 is prepared from starting plasmid pSL1180-
Elusing standard techniques'similar to those used in Example 1(A). The pQBI-
CA 02393844 2002-06-05
WO 01/44280 PCT/US00/33123
-65-
pgk-E1.3 plasmid is sequenced to verify the presence of the introduced
modifications.
Example 2
Functional test of pQBI pgk-El.l pQBl pgk-EL2, and pQBl pgk-E1.3
plasmids for EI expression
To determine whether plasmids pQBI-pgk-E1.1, pQBI-pgk-E1.2, and
pQBI-pgk-E1.3, produced as described in Example 7, could complement E1-
deleted adenovirus replication, monolayers of HeLa cells in 6-well plates were
transiently-transfected with the plasmid DNAs using Lipofectamine (available
from Life Technologies, Inc., Gaithersburg, MD) according to the
manufacturer's
instructions. An E1-deleted recombinant adenovirus containing a green
fluorescent protein (GFP) -expression cassette in its E1-region was then added
to
the cells (0.1 pfu/cell). The next day the monolayers were washed extensively
to
remove un-adsorbed virus particles. At 48 hours post-transfection/infection
the
cells were harvested, extracts was made, and the presence of E1-deleted
adenovirus was detected by infecting 293 cells (the standard E1-complementing
cell line) with serial dilutions of the crude HeLa cell extracts. At 24 hours
post-
infection, the 293 cells were examined for the expression of GFP, which would
be synthesized by the viruses produced in the HeLa cells only if the
transiently
transfected plasmid constructs expressed functional E1 gene products. The
extent
of E1-deleted Ad replication in this assay is directly proportional to the
number
of GFP expressing 293 cells. This can be directly compared between cells
transfected with the complementation plasmids pQBI-pgk-E1.1, pQBI-pgk-E1.2,
and pQBI-pgk-E1.3, pQBI-pgk-dl (negative control), and a plasmid containing
wild-type Ad5 E1 as positive control.
The cells transiently transfected with pQBI-pgk-E1.1 yielded
approximately 2x105 transducing units from approximately 7x105 initially
transiently transfected HeLa cells; the cells transiently transfected with
pQBI-
CA 02393844 2002-06-05
WO 01/44280 PCT/US00/33123
-66-
pgk-E1.2 yielded approximately 5x104 transducing units from approximately
7x105 initially transiently transfected HeLa cells; and the cells transiently
transfected with pQBI-pgk-E 1.3 yielded approximately 9x 10~ transducing units
from approximately 7x 105 initially transiently transfected HeLa cells. This
result
indicates that each of the three plasmids were complementing E1-deleted
adenovirus as expected. The plasmid with the greatest number of silent
nucleotide substitutions, i.e., pQBI-pgk-El.l, appeared to be the most
efficient
at complementing the E1-deleted adenovirus vector.
Example 3
Generation of Stable El-Complementing Cell Lines
The target cell lines WI-38 and MRC-5 were transfected with plasmid
pQBI-pgk-E1.1 to establish a permanent stably-transfected E1-complementing
cell line as follows. The cells were grown on 6-cm dishes and co-transfected
with
10 pg of pQBI-pgk-E1.1 and 1 ~g of pIRESlneo using standard procedures
(Wang et al., 1995). The transfected cells were split 1:20 in fresh medium 24
hours after transfection. Following attachment of the cells to the culture
plate,
6418 was added to the most optimal selection concentration previously tested
for
2o WI-38 and MRC-5 cells according to standard procedures. 6418 was
replenished
in the growth medium once every 3 ~ 4 days until sizable colonies are formed.
Well-formed colonies were picked, expanded and characterized.
Each cell clone is examined for the expression of E1 gene products using
Western blot analysis. Separately, each clone is tested for its ability to
support
the growth of an El-deleted Ad recombinant as described above. This functional
virus-complementation assay is performed in 24-well plates to test the cell
clones
shortly after their availability. The clones that produce the highest titer of
El
deleted adenovirus are further characterized. This characterization includes
Southern blotting of chromosomal DNA to obtain an estimate of transgene copy
3o number and a detailed restriction analysis to characterize the nature of
the inserted
DNA (e.g., concatameric, multiple insert, etc.).
CA 02393844 2002-06-05
WO 01/44280 PCT/US00/33123
-67-
To determine the levels of RCA, if any, produced by passaging of E 1-
deleted Ad in the E1 complementing cell lines, standard RCA assays are
performed as described (J. Virol. 1996, 70: 8459). Briefly, preparations of E1-
deleted adenoviruses are used to inoculate non-complementing cells (A549
cells).
The infected cells are cultured for approximately 14 days. In the absence of
CPE, extracts are prepared from the inoculated cells and passaged onto fresh
cells. Culturing of cells is continued for an additional 14 days. Evidence for
growth of adenoviruses in these cultures is assessed by visual inspection,
looking
for viral plaques, or more general viral-induced CPE in the cultures. This
type
of biological amplification assay has a sensitivity of approximately 1-3 pfu
of
RCA in approximately 10'° pfu of EI-deleted Ad.
Example 4
DNase Treatment and Purification of Production Stocks of Replication
Incompetent Adenovirus
Production stocks of replication incompetent adenovirus are produced in
an E1-complementing cell line as described in Example 3. The cells are
infected
using standard virological procedures and the infection is allowed to proceed
to
2o maximum cytopathic effect. The infected cells are then subjected to two to
three
rounds of freeze-thawing, the resulting lysate is subjected to centrifugation
to
remove cellular debris, and the supernatant, containing the adenovirus
particles,
is collected. The virus particles are further purified by standard methods,
e.g.,
HPLC, column chromatography or density gradient centrifugation. The
concentration of the production stock is estimated by plaque assay on the
complementing cell line, and a sample of the production stock equivalent to
about
10'3 pfu is taken to be assayed for replication competent virus. The remainder
of
the production stock is frozen pending further formulation. The sample is
adjusted to about 2 mM Mg++, and about 50 to about 5000 units/ml of DNAse I
3o is added to degrade non-encapsidated, contaminating cellular DNA. The DNAse
digestion is incubated at about 37 °C for about 1 to about 24 hours, or
until
CA 02393844 2002-06-05
WO 01/44280 PCT/US00/33123
-68-
contaminating cellular DNA is no longer amplifiable in the PCR detection
assays
discussed below. Following DNAse digestion, the virus particles in the sample
to be tested are lysed, e.g., by the use of a mild detergent.
Example 5
PCR Assay to Detect Replication Competent Adenovirus in a Production
Stock of Replication Incompetent Adenovirus
The production stock of replication incompetent adenovirus is assayed for
the presence of replication competent virus by measuring three parameters on
the
sample of virus DNA prepared as described in Example 4. The sample is
estimated to contain more than 10'3 copies of adenovirus DNA. A small aliquot
(containing approximately 105 copies of Ad DNA) is removed to precisely
measure total adenovirus DNA copies. The DNA sample is PCR amplified using
forward primer 5'-ATGACACGCATACTCGGAGCT-3' (SEQ ID NO:15) and
reverse primer 5'-GCCGCCCATGCAACAA-3' (SEQ ID N0:16), primers which
were designed to amplify a 67-by fragment of the Ad5 E4 region extending from
nucleotide 34884 to nucleotide 34995 of the Ad5 complete genome (GenBank
Accession No. M73260). A TaqManTM PCR reaction is carried out using PCR
2o reagent available from PE/Applied Biosystems (Part Number 402823), and
according to the manufacturer's protocol. The TaqManT"' probe is designed to
be
specific for the Ad5 E4 gene, is added to the reaction according to the
manufacturer's instructions. The probe has the sequence 5'-
TGCTAACCAGCGTAGCCCCGATGT-3' (SEQ ID N0:17) and is labeled with
the fluorescent molecule VIC on the 5' end and the quencher molecule 6-
carboxytetramethylrhodamine (TAMRA) on the 3' end. The PCR reaction is
carried out in a thermocycler capable of real-time measurement of
fluorescence,
e.g., an ABI Prism 7700 Sequence Detection System available from PE/Applied
Biosystems. The reaction is monitored for an increase in fluorescence
intensity
over time, and the results are correlated to a standard curve. The results are
expressed as the number of viral DNA copies present in 50 u1 PCR sample.
CA 02393844 2002-06-05
WO 01/44280 PCT/US00/33123
-69-
The remaining viral DNA sample is distributed into wells of 96 well
plates at 1 microgram per well. The 96 well plate format of this assay lends
itself
to large batch size. 10" copies of the adenovirus genome is approximately 4
micrograms of DNA which would require only 4 wells of the 96-well plate, while
10'3 copies would require approximately 4 plates which is easily accommodated.
Amplification and detection of both the E 1 and (3-actin genes are carried out
in
each well simultaneously using multiplex technology. Three additional wells on
each 96-well plate are spiked with 1-2 copies of E1-containing DNA, and 1-2
copies of actin-containing DNA. These controls ensure that if target DNA is
to present in one of the test wells at a low copy number it would be
detectable.
The PCR and Molecular Beacon detections are carried out using standard
reagents and methods, which can be found, e.g., in the Instruction Manuals
provided with the SentinelTM Molecular Beacon PCR Core Reagent Kit and
SentinelTM Molecular Beacon (3-Actin Detection Kit, both available from
Stratagene (Catalog Nos. 600500, and 200570, respectively, manuals available
on line at http://www.strata~ene.com/manuals/index.shtm) (visited April 7,
2000). The PCR primers for the E1 complementation element are forward
oligonucleotide primer 5'-GGTTTCTATGCCAAACCTTGT-3' (SEQ ID N0:12)
and reverse oligonucleotide primer 5'-AACATCACTGAGGAGCAGTTCT-3'
(SEQ ID N0:13), which amplify a region of the Ad5 E1 complementation
element extending from about nucleotide 886 in the Ela region of the complete
Ad5 genome (GenBank Accession No. M73260) to within the heterologous
intron derived from SV40 (i.e., from about nucleotide 262 to about nucleotide
283 in SEQ ID NO:1, SEQ ID N0:18, and SEQ ID N0:19). A PCR
amplification with these primers, using any of the three complementation
elements produced as described in Example 1 A as template, produces an
amplicon of about 2.6 kb. Alternatively, both the forward and reverse primers
could be suitably derived from human adenovirus sequences in the E1 region.
The
E1 Molecular Beacon probe has the sequence 5'-
3o GCAGCGAAGAAACCCATCTGAGCGGGCTGC-3' (SEQ ID N0:12). The
CA 02393844 2002-06-05
WO 01/44280 PCT/US00/33123
-70-
fluorescent molecule covalently linked to the 5' end of SEQ ID N0:12 is VIC,
and the quencher covalently linked to the 3' end of SEQ DI N0:12 is 4-
(dimethylamine)azo benzene sulfonic acid (DABSYL). The region of the E1
Molecular Beacon probe which is complementary to the Elb gene is underlined,
and this region hybridizes to a region of the Ad5 E1 gene extending from about
nucleotide 2026 to about nucleotide 2045 of the complete Ad5 genome (GenBank
Accession No. M73260). The portions of the 5' and 3' arms which form the
hairpin in the absence of a complementary sequence are shown in bold. The
Molecular Beacon for E1 detection contains VIC covalently linked to the 5'
arm,
and the quencher molecule DABCYL covalently linked to the 3' arm. The PCR
primers Molecular Beacon for the detection of (3-actin are purchased from
Stratagene, and used according to the manufacturer's instructions. The (3-
actin
probe contains the fluorescent molecule 6-carboxyfluorescein (6-FAM)
covalently linked to the 5' arm and the quencher molecule DABCYL covalently
linked to the 3' arm.
The amplification and detection reactions are carried out in the 96-well
plate format using a thermocycler capable of simultaneous detection and
measurement of fluorescence emissions at several different wave lengths, e.g.,
an
ABI PRISM 7700 unit. The reaction starts with a two-minute denaturation step
at 95 °C, which is followed by about 40 cycles of amplfication, each
having a 30-
second denaturation step at 95 °C, a one-minute annealling step at
about 50-60
°C, and a 30-second extension step at 72 °C. The thermocycler is
set to detect
and report fluorescence during the annealling/extension step of each cycle.
The
results are displayed as an amplification plot, which measures the intensity
of
fluorescence of each of the fluorescent molecules as a function of the number
of
cycles completed in the PCR reaction.
It is essential to co-amplify and measure each of these DNA sequences in
the entire DNA sample in order to ensure that any signal detected for E1 DNA
is
in fact from a RCA rather than a very small amount of cellular DNA that might
be in the final DNA preparation. For instance, 50 pg of viral DNA is tested as
CA 02393844 2002-06-05
WO 01/44280 PCT/US00/33123
-71-
described above in 50 wells of a 96 well plate and a signal for E1 DNA is
detected in one of the wells, it is imperative to ascertain that the signal
originated
from viral rather than cellular DNA. This is accomplished by measuring a
cellular gene, in this case, [3-actin, in the same 50 ~g (50 wells) of viral
DNA.
The data collected in the TaqMan E4 PCR reaction and the Molecular
Beacon amplification/detection reactions is combined to determine the number
of replication competent adenovirus genomes present per 10'3 replication
incompetent adenovirus genomes. The criteria for the presence of RCA using
this
assay will be the lack of a signal for (3-actin DNA (as an indication that all
non-
to encapsidated DNA has been removed from the sample), and any level of
detection of the targeted E1 DNA sequence. If both (3-actin and E1 DNA are
detected in the assay, the assay will not be valid, and the analysis will need
to be
performed on a new sample of the production stock of replication incompetent
adenovirus, which will be subjected to additional DNAse digestion as described
in Example 4
CA 02393844 2002-06-05
WO 01/44280 PCT/US00/33123
-72-
Example 6
Hybrid Selection to Enrich for Virus DNA in Samples taken from
Production Stocks ofReplication IncompetentAdenovirus.
If the presence of cellular DNA poses a problem in the assay, a hybrid
selection approach is used to enrich the sample for virus DNA. In order to
enrich
the preparation of viral DNA for the presence of DNA genomes derived from
RCA, the genomes are selected for using hybrid-selection (Jagus, R. Meth.
Enzymol. 152:567-572 (1987)). Bacterial plasmids containing the E1 gene and
the (3-actin gene are immobilized onto membrane filters. These filters are
used to
hybridize the final purified viral DNA genome sample, prepared as described in
Example 4. Cellular DNA and DNA from RCA hybridizes to the E1 DNA in the
plasmid on the filter, while DNA from the vast majority of the virus (E1-
deleted
rAd) will not hybridize and will be washed away after hybridization.
Hybridized
cellular DNA and DNA from RCA is eluted from the filters by heating, the
eluted
DNA is collected and ethanol precipitated. This cellular gene hybrid-
selection,
decreases the chances of obtaining false-positive results (i.e., a signal for
E1 that
would be from cellular rather than viral DNA). In order to avoid contamination
with small amounts of the sequences immobilized on the filter, the fragment of
E1 DNA which is cloned into the plasmid is smaller than the amplicon used in
the
PCR assay. Accordingly, it does not contain the binding sites for the PCR
primers, and hence is not amplified.
Exrcmple 7
Construction of EI Complementation Elements and Vectors pQBI pgk-El.l,
pQBI pgk-E1.3, and pQBl pgk-E1.3
Shuttle plasmids pQBI-pgk-EI.I, pQBI-pgk-E1.3, and pQBI-pgk-E1.3,
3o as described above in Example 1, were constructed by the following method.
(a) Production of pQBI pgk-E1.2.
The 5' portion of the SV40 intron as shown in Figure 2 (i.e., nucleotides
202 to 243 of SEQ ID NO: l, SEQ ID N0:18, or SEQ ID N0:19) was introduced
CA 02393844 2002-06-05
WO 01/44280 PCT/US00/33123
-73-
10
into plasmid pSL1180-E1 as follows. A nucleic acid fragment comprising a
portion of the El gene and part of the SV40 intron was generated through the
use
of the polymerase chain reaction (PCR) using pSLI 180-E1 as template, and the
two oligonucleotide primers set out below:
HC#40 5'-ATGAATGTTGTACAGGTGGC-3' (SEQ ID N0:4); and
HC#48 5'-CCACCGGATC CGGGACCTGA AATAAAAGAC
AAAAAGACTA AACTTACCTC ATCTGTATC TTCATCG-3'(SEQ ID
N0:21).
BamHI and BsrGI and cloned into the BamHI-BsrGI sites of pSL1180-
E1. The resulting plasmid was designated pSL1180-E1-BamHI (#99). Plasmid
pSL 1180-E 1-BamHI was then digested with HindIII to remove about 2.3-kb of
the upstream portion of the EI gene. The remaining plasmid was religated, in
order to eliminate an upstream SaII site located at the beginning of the E1
fragment, resulting in pSLI 180-El-BamHI-dl (#104).
The portion of the SV40 intron downstream of the BamHI site and the
final 6 codons (including the stop codon) of the 8kD Elb protein with silent
mutations, i. e., nucleotides 244 to 3 I 5 of SEQ ID N0:19, was introduced
into
2o pSL1180-E1-BamHI-dl as follows. The following complementary
oligonucleotides were annealed:
HC#49 5'-GATCCGGTGG TGGTGCAAAT CAAAGAACTG
CTCCTCAGTG GATGTTGCCT TTACTTCTAG CAACCCCCCC
CCCCCTGAG-3' (SEQ ID N0:22), and
HC#50 5'-TCGACTCAGG GGGGGGGGGG TTGCTAGAAG
TAAAGGCAAC ATCCACTGAG GAGCAGTTCT TTGATTTGCA
CCACCACCG-3' (SEQ ID N0:23).
Annealing of these oligonucleotides results in a BamHI cohesive end on the 5'
terminus and a SaII cohesive end on the 3' terminus. pSL1180-E1-BamHI-dl
(#104) was digested by BamHI and SaII and ligated with the annealed
oligonucleotides to create pSLI 180-E1-BamHI-dl-SaII(#106). Sequence
CA 02393844 2002-06-05
WO 01/44280 PCT/US00/33123
-74-
analysis showed that the sequence was correct.
Plasmid pSL1180-El-BamHI-dl-SaII(#106) was then digested with
HindIII and ligated with the about 2.3-kb HindIII fragment from pSL1180-El to
reconstruct the whole E1 fragment. This manipulation resulted in pSL1180-E1
BamHI-SaII (#109).
Plasmid pQBI-pgk-dl was derived from pQBI-pgk, available from
Quantum Biotechnologies, Inc., by digestion with PstI and self ligation to
remove
the Ad TPL, GFP, and Neo genes, resulting in pQBI-pgk-dl(#107).
Plasmid pQBI-pgk-dl(#107) was digested by BgIII, followed by a fill-in
1o reaction with Klenow, and was then digested with XhoI to obtain an about
570-by
fragment containing the pgk promoter. This fragment was then ligated into
pSL1180-E1-BamHI-SaII(#109) digested with SpeI, filled in with Klenow and
then digested with XhoI, to create pQBI-pgk-E1.2-dlpA(#116).
Plasmid pQBI-pgk-E1.2-dlpA(#116) was then digested by BsrGI and SaII
to obtain a fragment of about 1377 by containing the portion of the E1 gene
PCR
amplified as above, the SV40 intron, and the final 6 codons (including the
stop
codon) of the 8kD Elb protein with silent mutations. A second sample of pQBI-
pgk-E1.2-dlpA (#116) was digested with BstBI, subjected to a fill-in reaction
with Klenow, and then digested with BsrGI, to obtain the plasmid backbone
fragment of about 5459 bp. Plasmid pQBI-pgk-dl(#107) was digested by XhoI
and PvuII to obtain the BGH poly-adenylation sequence. These three fragments
were ligated to create pQBI-pgk-E 1.2(# 121 ), the final construct of E 1.2.
The
region of pQBI-pgk-E 1.2 extending from about 19 nucleotides before the BgIII
site shown in Fig. 2, and extending to the end of the sequence shown in Fig. 2
is
depicted herein as SEQ ID N0:19.
(b) Production of pQBl pgk-l.l.
A nucleic acid molecule which incorporates the silent mutations
extending from about nucleotide 20 to about nucleotide 243 of SEQ ID NO:1 was
created by annealing three overlapping sets of complementary nucleotides. The
oligonucleotide pairs are as follows:
CA 02393844 2002-06-05
WO 01/44280 PCT/US00/33123
-75-
HC#52 5'-GATCTGGAAA GTCCTCCGCT ATGACGAAAC
GCGGACGCGC TGTCGCCCTT GTGAATGCGG
GGGCAAGCAC ATCCG-3' (SEQ ID N0:25), and
HC#53 S'-GATTGCGGAT GTGCTTGCCC CCGCATTCAC
AAGGGCGACA GCGCGTCCGC GTTTCGTCAT
AGCGGAGGAC TTTCCA-3' (SEQ ID N0:26);
HC#54 5'-CAATCAACCC GTCATGCTCG ACGTCACGGA
AGAACTCCGC CCTGACCATC TCGTCCTCGC
TTGTACGCGG GCCGA-3' (SEQ ID N0:27), and
HC#55 5'-CGAATTCGGC CCGCGTACAA GCGAGGACGA
GATGGTCAGG GCGGAGTTCT TCCGTGACGT
t s CGAGCATGAC GGGTT-3' (SEQ ID N0:28); and
HC#56 5'-ATTCGGGTCC TCCGACGAGG ACACCGACTG
AGGTAAGTTT AGTCTTTTTG TCTTTTATTT
CAGGTCCCG-3' (SEQ ID N0:29), and
HC#57 5'-GATCCGGGAC CTGAAATAAA AGACAAAAAG
ACTAAACTTA CCTCAGTCGG TGTCCTCGTC
GGAGGACC-3' (SEQ ID N0:30).
The annealed nucleic acid molecule was ligated into plasmid pQBI-pgk-
E1.2(#121) which had been digested with BgIII and BamHI, to create pQBI-pgk-
E1.1-oligo(# 122).
The silent mutations shown in the first 18 nucleotides of Figure 2 (i. e,
nucleotides 1 to 18 of SEQ ID NO:1 were introduced into pQBI-pgk-E1.1-
oligo(#122) by generating a nucleic acid fragment comprising the mutations
through the use of the polymerase chain reaction (PCR) using pSL1180-E1 as
template, and the two oligonucleotide primers set out below:
HC#40 5'-ATGAATGTTGTACAGGT GGC-3' (SEQ ID N0:4); and
HC#51 5'-TGACAGATCT TCATCGTCAT ATCGAAGACC CCGTTCAGGT
TCACCTT-3' (SEQ ID N0:24, BgIII site underlined).
The resulting PCR product of about 1 kb was digested with BgIII and
BsrGI and cloned into the BgIII-BsrGI sites ofpQBI-pgk-E1.1-oligo(#122). The
CA 02393844 2002-06-05
WO 01/44280 PCT/US00/33123
-76-
resulting plasmid was designated pQBI-pgk-El.l(#123), the final construct of
E1.1. The region of pQBI-pgk-E1.1 extending from about 19 nucleotides before
the BgIII site shown in Fig. 2, and extending to the end of the sequence shown
in
Fig. 2, is depicted herein as SEQ ID NO:1.
(c) Production of pQBI pgk-E1.3.
The single underlined silent mutation shown in the first 18 nucleotides of
Figure 2, i. e, at nucleotide 15 of SEQ ID N0:18, was introduced into pQBI-pgk-
E1.1-oligo(#122) by generating a nucleic acid fragment comprising the mutation
through the use of the polymerase chain reaction (PCR) using pSL1180-E1 as
template, and the two oligonucleotide primers set out below:
HC#40 5'-ATGAATGTTGTACAGGTGGC-3' (SEQ ID N0:4); and
HC#58 5'-TTCCAGATCT TCATCGTCAT GTCAAAGACC
CCGTTCAGGT TCACCTT-3' (SEQ ID N0:31, BgIII site underlined).
The resulting PCR product of about 1 kb was digested with BgIII and
BsrGI and cloned into the BgIII-BsrGI sites of pQBI-pgk-E1.1-oligo(#122). The
resulting plasmid was designated pQBI-pgk-E1.3-PCR(#125).
A nucleic acid molecule which incorporates the silent mutations
2o extending from about nucleotide 20 to about nucleotide 278 of SEQ ID N0:18
was created by annealing four overlapping sets of complementary nucleotides.
The oligonucleotide pairs are as follows:
HC#59 5'-GATCTGGAAA GTGCTGAGGT ACGACGAGAC
CCGCACCAGC TGCAGACCCT GCGAATGTGG CGGTAAACAC
ATTAGGAACC AGCCC-3' (SEQ ID N0:32), and
HC#60 5'-CATCACGGGC TGGTTCCTAA TGTGTTTACC
GCCACATTCG CAGGG1'CTGC AGCTGGTGCG GGTCTCGTCG
TACCTCAGCA CTTTCCA-3' (SEQ ID N0:33);
HC#61 5'-GTGATGCTGG ATGTCACCGA GGAGCTGAGC
CCCGATCACT TGGTCCTGGC CTGCACCCGG GCTGAGTTTG
GCTCCAGCGA TGAAG-3' (SEQ ID N0:34), and
HC#62 5'-CGGTATCTTC ATCGCTGGAG CCAAACTCAG
CA 02393844 2002-06-05
WO 01/44280 PCT/US00/33123
_77_
CCCGGGTGCA GGCCAGGACC AAGTGATCGG GGCTCAGCTC
CTCGGTGACA TCCAG-3' (SEQ ID N0:35);
HC#63 5'-ATACCGATTG AGGTAAGTTT AGTCTTTTTG
s TCTTTTATTT CAGGTCCCGG ATCCGGTGGT GGTGCAAATC
AAAGAACTGC TCCTC-3' (SEQ ID N0:36), and
HC#64 5'-TCCACTGAGG AGCAGTTCTT TGATTTGCAC
CACCACCGGA TCCGGGACCT GAAATAAAAG ACAAAAAGAC
1o TAAACTTACC TCAAT-3'(SEQ ID N0:37); and
HC#65 5'-AGTGGATGTTGCCT TTACTTCTAGCAGCCGCCGCCCC
ATGAGTCGAGCATGCATCTAGAGGGCC-3'(SEQ ID N0:38), and
1 s HC#66 5'-CTCTAGATGCATGCTCGACTCATGGGGGCGGCGCTGCTA
GAAGTAAAGGCAACA-3' (SEQ. ID N0:39).
The annealed nucleic acid molecule was ligated into pQBI-pgk-E1.3-
PCR(#125) which had been digested with BgIII and ApaI, to create pQBI-pgk-
2o E1.3(#127), the final construct of E1.3. The region of pQBI-pgk-E1.3
extending from about 19 nucleotides before the BgIII site shown in Fig. 2, and
extending to the end of the sequence shown in Fig. 2, is depicted herein as
SEQ ID N0:18.
All three versions of E 1 construct have been sequenced to verify the
25 the PCR-amplified and oligo modified regions.
***
All publications cited in this specification are hereby incorporated herein
3o by reference. While the invention has been described with reference to a
particularly preferred embodiment, it will be appreciated that modifications
can
be made without departing from the spirit of the invention. Such modifications
are intended to fall within the scope of the appended claims.
