Note: Descriptions are shown in the official language in which they were submitted.
CA 02396674 2003-11-14
COMPOSITIONS AND METHODS INVOLVING AN ESSENTIAL
STAPHYLOCOCCUS AUREUS GENE AND ITS ENCODED PROTEIN
FIELD OF THE INVENTION
The invention relates to bacterial and bacteriophage genes.
BACKGROUND OF THE INVENTION
The Staphylococci make up a medically important genera of microbes known to
cause
several types of diseases in humans. S. aureus is a Gram positive organism
which can be found
on the skin of healthy human hosts. It is responsible for a large number of
bacteremias, where its
portal of entry can be the skin, lungs, urinary tract or infected
intravascular devices (Steinberg et
al., ( 1996) ) Clin. Infect. Dis. 23: 255-259; Rtbder et al., ( 1999) Arch.
Intern. Med. 159: 462-
469). It can cause fatal endocarditis or damage to the heart and, due to its
exotoxin, can cause
death via "Toxic Shock" (Frimodt-Miller et al., (1997) Clin. Microbiol.
Infect. 3: 297-305;
Sanabria et al., (1990) Arch. Intern. Med. 150: 1305-1309).
Only S. aureus and Staphylococcus epidermidis, of the nineteen species of
Staphylococcus described in Bergey's Manual (1992), have significant
interactions with humans.
They are among the normal flora of humans, and are found on nasal passages,
skin and mucous
membranes. S. aureus, when pathogenic in humans, can cause a number of
suppurative (pus-
forming) infections, as well as food poisoning, endocarditis, and toxic shock
syndrome.
S. aureus causes superficial skin lesions, such as boils, styes arid
furunculosis; more
serious infections include pneumonia, mastitis, phlebitis, meningitis, and
urinary tract infections,
in addition to osteomyelitis and endocarditis. S. aureus is also a major cause
of hospital
acquired (nosocomial) infection of surgical wounds and infections associated
with inserted and
implanted medical devices. Lastly, S. aureus causes food poisoning through the
release of
enterotoxins into food, and toxic shock syndrome through the release of
superantigens into the
blood stream. S. aureus also secretes two types of toxin with superantigen
activity: 1)
enterotoxins, of which there are six antigenic types (named SE-A, B, C, D, E
and G) and 2) toxic
shock syndrome toxin (TSST-1).
S. aureus has been successfully treated with the penicillin derivative
Methicillin in the
past, but is now becoming increasingly resistant (MRSA - Methicillin Resistant
S. aureus) to this
antibiotic (Harbath et al., (1998) Arch. Intern. Med. 158: 182-189.). For
example, S. aureus
endocarditis mortality can range from 26-45°l0, and combined 13-
lactam/aminoglycoside therapy
is proving increasingly ineffective in disease eradication (Rider et al.,
(1999) Arch. Intern. Med.
CA 02396674 2003-11-14
2
159: 462-469). However, MRSA infections continue to be sensitive to treatment
with
vancomycin, which is the drug of last resort. Infections caused by MRSA have
been increasing
in children and adults; isolates have been found in 97% of all large,
university-based teaching
hospitals in the United States. Since 1996, three cases of vancomycin
resistant S, aureus have
been reported. This new strain represents a particularly dangerous development
of an aggressive
bacterial pathogen which does not respond to any known antibiotic. The
emergence of resistance
to vancomycin has the potential to result in untreatable (and thus fatal) S.
aureus infections.
It is no longer uncommon to isolate S. aureus strains which are resistant to
most of the
standard antibiotics, and thus there is an unmet medical need and demand for
new anti-microbial
agents, vaccines, drug screening methods, and diagnostic tests for this
organism.
SUMMARY OF THE INVENTION
The present invention relates to DnaI and DnaI-related proteins, in particular
S. aureus
DnaI polypeptides and dnaI polynucleotides, recombinant materials and methods
for their
production. The invention also relates to a pair of interacting proteins, a
growth-inhibitory (or
inhibitor) bacteriophage 77 ORF 104 gene product that interacts with the S.
aureus DnaI
polypeptide, the interacting regions of the S. aureus DnaI related protein and
the protein encoded
by the S. aureus bacteriophage 77 ORF 104, forming the basis for screening
assays. It also
relates to polynucleotides and polypeptides of a multiprotein complex believed
to be involved in
initiation of DNA replication containing DnaI as a subunit, and also may
include DnaC and
related proteins, as well as variants of them. In another aspect, the
invention relates to methods
for using such polypeptides and polynucleotides, including treatment of
microbial diseases,
amongst others. In a further aspect, the invention relates to methods for
identifying agonists and
antagonists using the materials provided by the invention, and for treating
microbial infections
and conditions associated with such infections with the identified agonist or
antagonist
compounds. In a still further aspect, the invention relates to diagnostic
assays for detecting
diseases associated with microbial infections and conditions associated with
such infections,
such as assays for detecting DnaI expression or activity.
The invention encompasses a method for identifying a compound that binds a
DnaI
polypeptide, the method comprising the steps of:
- contacting a first polypeptide with a candidate compound in the presence of
a second
polypeptide, wherein the first polypeptide comprises at least 75% identity
andlor at least
85% similarity over 50 or more amino acids to the amino acid sequence of SEQ
ID
NO: 2, and wherein the second polypeptide binds specifically to the first
polypeptide;
CA 02396674 2003-11-14
3
- determining wherein the candidate compound reduces the binding; and
- selecting a candidate compound reducing the binding.
Preferably, the first polypeptide is selected from the group consisting of SEQ
ID NO: 2, SEQ ID
NO: 16, and SEQ ID NO: 18.
The invention encompasses also a method of identifying a compound that is
active on a
polypeptide comprising the amino acid sequence of SEQ m NO: 16. The method
comprises
contacting a candidate compound with the polypeptide, and detecting binding of
the candidate
compound to the polypeptide, wherein detection of binding is indicative that
the compound is
active on the polypeptide.
The invention also relates to a method of identifying a compound that binds a
polypeptide comprising the amino acid sequence of SEQ ID NO: 2 or a fragment
thereof, the
method comprising: contacting a candidate compound with the polypeptide, and
detecting
binding of the candidate compound to the polypeptide, wherein detection of
binding is indicative
that said compound is active on the polypeptide.
In one embodiment, the step of detecting comprises the step of measuring the
binding of
a candidate compound, wherein the compound is directly or indirectly
detectably labeled, to the
polypeptide.
In another embodiment, the step of detecting comprises measurement by phage
display.
In another embodiment, the step of detecting comprises measurement by surface
plasmon
resonance.
In another embodiment, the step of detecting comprises measurement by FRET.
In another embodiment, the step of detecting comprises measurement of
fluorescence
polarization changes.
In another embodiment, the step of detecting comprises a scintillation
proximity assay.
In another embodiment, the step of detecting comprises a biosensor assay.
In another embodiment, the active compound is selected from the group
consisting of a
small molecule, a peptidomimetic compound, and a fragment or derivative of a
bacteriophage
inhibitor protein.
In another embodiment, the active compound is a peptide synthesized by a
recombinant
expression system and purified, or artificially synthesized.
The invention also encompasses a method of identifying a compound that is
active on a
polypeptide comprising the amino acid sequence of SEQ ID NO: 16, the method
comprising the
steps of contacting a first and a second polypeptide in the presence and
absence of a candidate
compound, wherein the first polypeptide comprises the amino acid sequence of
SEQ ID NO: 16
CA 02396674 2003-11-14
4
or a fragment or variant thereof that specifically binds phage 770RF104 and
the second
polypeptide comprises phage ?7 ORF 104 or a domain thereof that specifically
binds a
polypeptide of SEQ ID NO: 16, and detecting the binding of the first and
second polypeptides to
each other, wherein a decrease in the binding of the first and the second
polypeptides in the
presence of the candidate compound relative to the binding in the absence of
the candidate
compound identifies the candidate compound as a compound that is active on a
polypeptide
comprising the amino acid sequence of SEQ 1D NO: 16.
The invention also relates to a method of identifying a compound that binds a
polypeptide comprising the amino acid sequence of SEQ D7 NO: 2, the method
comprising the
steps of:
contacting a first and a second polypeptide in the presence and absence of a
candidate
compound, wherein the first polypeptide comprises the amino acid sequence of
SEQ 1D NO: 2 or
a fragment thereof that specifically binds phage 770RF104, and wherein the
second polypeptide
comprises phage 770RF104 or a domain thereof that specifically binds the first
polypeptide; and
detecting the binding of the first and the second polypeptides to each other;
wherein a decrease in the binding of the first and the second polypeptides in
the presence of the
candidate compound relative to the binding in the absence of the candidate
compound identifies
the candidate compound as a compound that binds a polypeptide comprising the
amino acid
sequence of SEQ m NO: 2.
In one embodiment, the first or the second polypeptide is directly or
indirectly detectably
labeled.
In another embodiment, the step of detecting comprises measurement by phage
display.
In another embodiment, the step of detecting comprises measurement by surface
plasmon
resonance.
In another embodiment, the step of detecting comprises measurement by FRET.
In another embodiment, the step of detecting comprises measurement of
fluorescence
polarization changes.
In another embodiment, the step of detecting comprises a scintillation
proximity assay.
In another embodiment, the step of detecting comprises a biosensor assay.
The invention further encompasses an agonist or an antagonist of the activity
of a DnaI
polypeptide or a gene encoding the polypeptide. The invention further
encompasses an
antagonist of the activity of a DnaI polypeptide, wherein the DnaI polypeptide
comprises at least
50% identity and/or at least 65% similarity to the amino acid of sequence of
SEQ ID NO: 2, and
wherein the antagonist binds said DnaI polypeptide. According to another
related aspect, the
CA 02396674 2003-11-14
S
invention encompasses an antibacterial agent having a bactericidal or
bacteriostatic effect on
Staphylococcus aureus, this antibacterial agent binding to a polypeptide
comprising at least 50
contiguous amino acids of SEQ ID NO: 2. The invention also encompasses
antibacterial
compositions comprising such an antibacterial agent and in vitro methods for
inhibiting a
bacterium, comprising contacting the bacterium with such an antibacterial
agent
The invention further encompasses a method of identifying a compound that is
active on
a DnaI polypeptide, comprising the steps of contacting a candidate compound
with cells
expressing a polypeptide comprising SEQ ID NO: 16 and detecting DnaI activity
in the cells,
wherein a decrease in activity relative to DnaI activity in cells not
contacted with a candidate
compound is indicative of inhibition of DnaI activity.
More particularly, the invention encompasses a method of identifying an
inhibitor of
DnaI, the method comprising the steps of: contacting a candidate compound with
cells
expressing a polypeptide comprising SEQ ID NO: 2 or a fragment thereof; and
detecting DnaI
activity and/or expression in these cells; wherein a decrease in activity
and/or expression relative
to Dnal activity or expression in cells not contacted with the candidate
compound is indicative
that the candidate inhibits DnaI.
The invention further encompasses a method of making an antibacterial
compound,
comprising the steps of: a) determining whether a candidate compound is active
on a polypeptide
comprising the amino acid sequence of SEQ ID NO: 16 or a gene encoding the
polypeptide; and
b) synthesizing or purifying the candidate compound in an amount sufficient to
provide a
therapeutic effect when administered to an organism infected by a bacterium
naturally producing
a polypeptide comprising the amino acid sequence of SEQ ID NO: 16.
More particularly, the invention further encompasses a method of obtaining an
antibacterial compound, comprising the steps of:
providing a candidate compound;
determining whether the candidate compound binds a polypeptide comprising the
amino
acid sequence of SEQ >D NO: 2 or a fragment thereof, or binds a polynucleotide
encoding said
polypeptide; and
synthesizing or purifying the candidate compound in an amount sufficient to
provide a
therapeutic effect when administered to an organism infected by a bacterium
naturally producing
said polypeptide.
In one embodiment, the candidate compound is selected from the group
consisting of a
small molecule, a peptidomimetic compound, and a fragment or derivative of a
bacteriophage
inhibitor protein.
CA 02396674 2003-11-14
6
In one embodiment, the candidate compound is a peptide synthesized by a
recombinant
expression system and purified, or artificially synthesized.
The invention further encompasses a method for inhibiting a bacterium,
comprising
contacting the bacterium with a compound active on a polypeptide comprising
the amino acid
sequence of SEQ 1D NO: 16 or a gene encoding the polypeptide.
In one embodiment, the step of contacting is performed in vitro.
In another embodiment, the step of contacting is performed in vivo in an
animal.
In another embodiment, the compound is selected from the group consisting of a
small
molecule, a peptidomimetic compound, and a fragment or derivative of a
bacteriophage inhibitor
protein.
In another embodiment, the compound is a peptide synthesized by a recombinant
expression system and purified, or is artificially synthesized.
In a preferred embodiment, the method of the invention consists of an in vitro
method for
inhibiting a bacterium, comprising contacting the bacterium with an inhibitor
that binds a
polypeptide comprising the amino acid sequence of SEQ 1D NO: 2 or a fragment
thereof, or with
an inhibitor that binds a polynucleotide encoding said polypeptide.
In another preferred embodiment, the method of the invention consists of a
method for
inhibiting a bacterium, comprising contacting the bacterium with an inhibitor
decreasing the
activity or the expression of Staphylococcus aureus DnaI, with the proviso
that the method is not
carried out in vivo.
The invention further encompasses a method for treating a bacterial infection
in an
animal suffering from an infection, comprising administering to the animal a
therapeutically
effective amount of a compound active on a polypeptide comprising the amino
acid sequence of
SEQ ID NO: 16 or a gene encoding the polypeptide. The animal is preferably,
but not
necessarily a mammal, more preferably a human.
In one embodiment, the compound is selected from the group consisting of a
small
molecule, a peptidomimetic compound, and a bacteriophage inhibitor protein.
The invention further encompasses a method of prophylactic treatment to
prevent
bacterial infection comprising contacting an indwelling device with a compound
active on a
polypeptide comprising the amino acid sequence of SEQ ID NO: 16 before its
implantation into
a mammal, such contacting being sufficient to prevent S. aureus infection at
the site of
implantation.
The invention further encompasses a method of prophylactic treatment to
prevent
infection of an animal by a bacterium comprising administering to the animal a
compound that
CA 02396674 2003-11-14
7
is active on a polypeptide comprising the amino acid sequence of SEQ ID NO: 16
or a gene
encoding the polypeptide in an amount sufficient to reduce adhesion of the
bacterium tv a tissue
surface of the mammal.
The invention further encompasses a method of diagnosing in an individual an
infection
with Staphylococcus aureus, comprising: determining the presence in the
individual of a
polypeptide comprising the amino acid sequence of SEQ ID NO: 2 or a fragment
thereof, such as
SEQ ID NO: 16.
In one embodiment, the determining step comprises contacting a biological
sample of the
individual with an antibody specific for an epitope present on a polypeptide
comprising the
amino acid sequence of SEQ ID NO: 16.
The invention further encompasses a method of diagnosing in an individual an
infection
with Staphylococcus aureus, comprising determining the presence in the
individual of a nucleic
acid sequence encoding a polypeptide comprising the amino acid sequence of SEQ
ID NO: 2 or
a fragment thereof, such as SEQ ID NO: 16.
In one embodiment, the determining step comprises contacting a nucleic acid
sample of
said individual with an isolated, purified or enriched nucleic acid probe of
at least 15 nucleotides
in length that hybridizes under stringent hybridization conditions with the
sequence of SEQ 1D
NO: 1, or with the complement thereof.
The invention further encompasses an isolated, purified or enriched
polynucleotide
comprising a nucleotide sequence that has at least 55% identity to the
sequence of SEQ ID NO:
1, or the complement of said nucleotide sequence.
The invention further encompasses an isolated, purified or enriched
polynucleotide
consisting of nucleotides 448-942 of SEQ ID NO: 1, herein referred to as SEQ
ID NO: 17,
comprising a nucleotide sequence encoding the polypeptide of SEQ ID NO: 16 or
the
complement of such nucleotide sequence.
The invention further encompasses an isolated, purified or enriched
polynucleotide
consisting of the sequence of SEQ ID NO: 17.
The invention further encompasses an isolated polypeptide comprising the amino
acid of
sequence of SEQ ID NO: 2. Preferably, the isolated polypeptide consists of the
amino acid of
sequence of SEQ ID NO: 2.
The invention further encompasses an isolated, purified or enriched
polypeptide having at
least 55% identity to the amino acid sequence of SEQ ID NO: 16.
CA 02396674 2003-11-14
g
The invention further encompasses an isolated, purified or enriched
polypeptide of at
least 50 amino acids in length having at least 50 % identity to the amino acid
sequence of SEQ
ID NO: 16.
The invention further encompasses an isolated, purified or enriched
polypeptide having at
least 70% similarity to the amino acid sequence of SEQ >D NO: 16.
The invention further encompasses an isolated, purified or enriched
polypeptide of at
least 20 amino acids in length having at least 60% similarity to the amino
acid sequence of SEQ
ID NO: 16.
The invention further encompasses an isolated polypeptide comprising the amino
acid
sequence of SEQ ID NO: 16.
The invention further encompasses an isolated polypeptide consisting of the
amino acid
sequence of SEQ ID NO: 16.
The invention further encompasses an isolated, purified or enriched antibody
specific for
a polypeptide comprising SEQ ID NO: 16.
The invention further encompasses an isolated and purified DnaI polypeptide
comprising
at least 50% identity, preferably at least 60% identity, and more preferably
at least 70% identity,
to the amino acid of sequence of SEQ ID NO: 2, the polypeptide having an
activity selected from
the group consisting of:
a) directly interacting with bacteriophage 77 ORF 104 protein or a DnaI-
binding
fragment thereof in a manner that results in at least 10 fold reduction of 3 H-
thymidine incorporation in a bacterial DNA replication assay relative to 3 H-
thymidine incorporation in an assay lacking bacteriophage 77 ORF 104 protein
or
a DnaI-binding fragment thereof;
b) directly interacting with bacteriophage 77 ORF 104 protein or a DnaI-
binding
fragment thereof in a manner that results in at least 10% inhibition of
plasmid
replication by bacteriophage 77 ORF 104 protein or a DnaI-binding fragment in
a
plasmid replication assay; and
c) aids in the loading of S. aureus DnaC helicase onto replicative primosomes.
The invention further encompasses an isolated and purified DnaI polypeptide
comprising
SEQ m NO: 2 or at least one fragment thereof, this fragment having an activity
selected from
the group consisting of:
a) directly interacting with bacteriophage 77 ORF 104 protein or a DnaI-
binding
fragment thereof in a manner that results in at least 10 fold reduction of 3 H-
thymidine incorporation in a bacterial DNA replication assay relative to 3 H-
CA 02396674 2003-11-14
9
thymidine incorporation in an assay lacking bacteriophage 77 ORF 104 protein
or
a DnaI-binding fragment thereof;
b) directly interacting with bacteriophage 77 ORF 104 protein or a DnaI-
binding
fragment thereof in a manner that results in at least 10% inhibition of
plasmid
replication by bacteriophage 77 ORF 104 protein or a DnaI-binding fragment in
a
plasmid replication assay; and
c) aids in the loading of S. aureus DnaC helicase onto replicative primosomes.
The invention further encompasses a composition comprising two polypeptides, a
bacteriophage 77 ORF 104 polypeptide and a polypeptide comprising the amino
acid sequence
of SEQ ID NO: 2, or a fragment or a variant thereof, that specifically binds
phage 77 ORF 104
polypeptide.
The invention further encompasses a composition comprising a first nucleic
acid
encoding bacteriophage 77 ORF 104 polypeptide and a second nucleic acid
encoding a
polypeptide bound by the 77 ORF 104 polypeptide. In one embodiment, the
composition
comprises a nucleic acid encoding bacteriophage 77 ORF 104 and a nucleic acid
comprising
SEQ 117 NO: 17 or a variant thereof that encodes a polypeptide that
specifically binds
bacteriophage 77 ORF 104 polypeptide.
The invention further encompasses phage-related polynucleotides. More
particularly, the
invention encompasses an isolated, purified, or enriched polynucleotide at
least 15 nucleotides in
length, this polynucleotide comprising at least a portion of Staphylococcus
aureus bacteriophage
77. The invention encompasses also isolated, purified, or enriched
polynucleotides comprising at
least 10 contiguous nucleotides as set forth in SEQ ID NO: 4; and isolated,
purified or enriched
polynucleotides having at least 50%, at least 75%, or at least 95% identity
with the nucleic acid
sequence of SEQ ID NO: 4. Preferably, the polynucleotide consists of the
nucleic acid sequence of
SEQ ID NO: 4. Recombinant vectors comprising at least one polynucleotide as
defined above,
and recombinant cell comprising such vectors, are further within the scope of
the invention.
The invention also encompasses phage-related polypeptides. More particularly,
the
invention encompasses an isolated, purified, or enriched polypeptide
comprising at least a
portion of an antimicrobial protein, wherein said polypeptide is encoded by
Staphylococcus
aureus bacteriophage 77. Preferably, the polypeptide comprises at least 10
contiguous amino
acid residues of the antimicrobial protein. The invention encompasses also
isolated, purified or
enriched polypeptides comprising at least 10 contiguous amino acids as set
forth in SEQ ID NO: 5.
The invention further encompasses isolated, purified, or enriched polypeptides
having
having at least 50%, at least 75%, or at least 95% identity with the amino
acid sequence of SEQ ID
CA 02396674 2003-11-14
9A
NO: 5. Polypeptide having at least 65% similarity or at least 85% similarity
with the amino acid
sequence of SEQ m NO: 5 are also covered by the invention. Preferably, the
polypeptide consists of
the amino acid sequence of SEQ ID NO: 5.
Further features and advantages of the invention will become more fully
apparent in the
following description of the embodiments and drawings thereof, and from the
claims.
BRIEF DESCRIPTION OF THE DRAWINGS
Fig. 1 shows the nucleotide (A; SEQ ID NO: 1) and amino acid (B; SEQ ID NO: 2)
sequences of S. aureus DnaI.
Fig. 2 shows the complete nucleotide sequence of the S. aureus bacteriophage
77 genome
(SEQ ID NO: 3).
Fig. 3 shows an ORF map of the S. aureus bacteriophage 77 genome.
Fig. 4 shows the nucleotide (A; SEQ ID NO: 4) and the amino acid (B; SEQ ID
NO: 5)
sequences of S. aureus bacteriophage 77 ORF 104.
Fig. 5 shows the predicted tryptic peptide masses of the ORF (SEQ ID NOs: 10-
13)
identified in the University of Oklahoma S aureus genomic database that
closely matches the
tryptic peptide profile of the polypeptide bound by 770RF104.
Fig. 6 shows alignments of B. subtilis DnaC sequences with the homologous
sequences
from S. aureus. A) shows an alignment of B. subtilis dnaC polynucleotide
sequence (SEQ ID
NO: 6) with the homologous S. aureus dnaC polynucleotide sequence (SEQ ID NO:
7) identified
by BLAST searching the S. aureus database at http://www.tigr.org with the B.
subtilis dnaC
sequence. B) shows an alignment of B. subtilis DnaC amino acid sequence (SEQ.
ID NO: 8) with
the predicted amino acid sequence of the polypeptide (SEQ ID NO: 9) encoded by
the S. aureus
dnaC polynucleotide sequence shown in Fig. 6A.
Fig. 7 shows the killing potential of bacteriophage 77 ORF 104 and the
expression vector
used to induce its expression in S. aureus: A) Schematic diagram of expression
vector pT/ORF
used to induce expression of 770RF104 in S. aureus cells; B) Results of a
screen to assess the
killing potential of 770RF104 when expressed in S. aureus grown on semi-solid
support media;
and C) Results showing the inhibitory potential of 770RF104 when expressed in
S. aureus in
liquid media.
Fig. 8 shows affinity chromatography using GST and GST/ORF104 as ligands with
the S.
aureus extract prepared by French pressure cell lysis and sonication. Eluates
from affinity
columns containing the GST and GST/ORF104 ligands at 0, 0.1, 0.5, 1.0, and 2.0
mg/ml resin
were resolved by 12.5% SDS-PAGE. Proteins were visualized by silver staining.
Micro-columns
CA 02396674 2003-11-14
9B
were eluted with: A) ACB containing 1 M NaCI; B) 250 mM NaCl; C) I% Triton X-
IOOTM; and
D) 1 % SDS. Each molecular weight marker (Mr) is approximately 100 ng. The
lanes labeled
ACB indicate eluates from a 2.0 mg/ml ligand column loaded only with ACB
buffer containing
75 mM NaCI. The arrows indicate bands specifically interacting with
GST/ORF104.
Fig. 9 shows affinity chromatography with GST and GST/ORF104 as Iigands with
the S.
aureus extract prepared by lysis with lysostaphin digestion and sonication.
Eluates from affinity
columns containing the GST and GST ORF104 ligands at 0, 0.1, 0.5, 1.0, and 2.0
mg/ml resin
were resolved by 12.5% SDS-PAGE. Micro-columns were sequentially eluted with
75 mM ACB
containing 1 % Triton X- I OOTM, 250 mM NaCI, I M NaCI ACB, and 1 % SDS. The
elution
I O profile obtained with 1 % SDS is shown. Each molecular weight marker (Mr)
is approximately
100 ng. The lanes labeled ACB indicate eluates from a 2.0 mg/ml ligand column
loaded only
with ACB buffer containing 75 mM NaCI. Lanes labeled C and L are corresponding
elutions
from columns containing GST and GST/ORF104 at 2.0 mg/ml from Figure 8. The
arrow
indicates a polypeptide specifically interacting with GST/ORF104.
Fig. 10 shows affinity chromatography with ORF104 (GST removed) as ligand with
the
S. aureus extract prepared by lysis with lysostaphin digestion and sonication
(Lys extract) and
French pressure cell and sonication (FP/S extract). Eluates from affinity
columns containing the
ORF104 ligand at 0, 0.1, 0.5, 1.0, and 2.0 mg/ml resin were resolved by 12.5%
SDS-PAGE and
the gel was stained with silver nitrate. Micro-columns were sequentially
eluted with: ACB
containing I% Triton X-100TM; 250 mM NaCI; 1M NaCI; and 1% SDS. The elution
profile
obtained with 1 % SDS is shown. Each molecular weight marker (Mr) is
approximately 100 ng.
The lanes labeled ACB indicate eluates from a 2.0 mg/ml ligand column loaded
only with ACB
buffer containing 75 mM NaCl. The arrow indicates a polypeptide specifically
interacting with
GST/ORF 104.
Fig. I 1 shows results of a tryptic peptide mass spectrum analysis showing
relatedness
between the interacting protein eluted with Triton X-100TM (indicated by arrow
in Fig. 8C) and
the interacting protein eluted with I% SDS (indicated by arrow in Fig. 8D). Of
note are the
tryptic peptides having monoisotopic MH+ masses of 1351.8, 1412.7, and 1617.8
Da.
Fig. 12 shows the results of yeast two hybrid analyses designed to test the
interaction of
S. aureus DnaI and 77 ORF 104. A) Construction of the yeast pGADT7 vector
expressing the
polypeptide Gal4 activation domain (GAD) fused to the S. aureus DnaI. B)
Construction of the
yeast pGBKT7 vector expressing the polypeptide Gal4 DNA binding domain (GBK)
fused to
phage 77 ORF104. 77 ORF 104 and DnaI were also cloned into pGADT7 and pGBKT7,
respectively (not shown). C) Yeast two-hybrid assay. D) Yeasts were co-
transformed, as
CA 02396674 2003-11-14
9C
indicated (No 1 to 6), in the presence or in the absence of control vectors.
pGADT7-T and
pGBKT7-53 (NO 1) are positive control for protein:protein interaction and pCLI
(NO 4) is an
active Gal4 transcription factor. Co-transformants were plated in parallel on
yeast synthetic
medium (SD) supplemented with amino acid drop-out lacking tryptophan and
leucine (TL
minus) and on SD supplemented with amino acid drop-out lacking tryptophan,
histidine, adenine
and leucine (THAL minus). Co-transformants harboring 77 ORF104 polypeptide
only grew on
selective THAL minus media in the presence of DnaI (NO 5 and 6). E) Results of
the
luminescent ~3-galactosidase enzymatic assays with protein extracts from the
same co-
transformants (NO 1 to 6).
Fig. 13 shows inhibition of S. aureus DNA synthesis by bacteriophage 77 ORF
104
protein.
Fig 14 shows the interaction between partial proteolysis fragments of DnaI and
ORF 104
from S. aureus bacteriophage 77. Partial proteolytic fragments generated by A)
endoproteinase
GIuC or B) chymotrypsin were subjected to affinity chromatography using
columns containing
either 0 or 2.0 mg/ml of 770RF104 protein. Partial proteolytic fragments
interacting with the
770RF104 and not the control column were excised for peptide mapping. Lanes
are indicated as
Mr, molecular weight markers; L, load; FT, flowthrough; 1, 1 M NaCI elution;
2, 1 % SDS
elution; ACB, affinity chromatography buffer. The interacting bands excised
for peptide
mapping are indicated according to the apparent Mr by SDS-PAGE, bands not
interacting are
indicated with (-). C) List of identified DnaI proteolytic fragments
interacting with 77 ORF 104.
Partial proteolytic fragments interacting with 770RF104 were purified by
reverse phase,
analyzed with MALDI-TOF, and the observed high molecular weight fragments
mapped to the
corresponding amino acid sequence of SEQ ID NO: 2. The minimal domain of DnaI
interacting
with 77 ORF 104 as determined by partial proteolysis with chymotrypsin is
amino acids 131 to
313 and with endoproteinase Glu-C is amino acids I 19 to 313 of SEQ ID NO: 2.
Fig. I S shows the amino acid sequence of the DnaI fragments tested in yeast
two-hybrid
system for interaction with 770RF104. SEQ ID NO: 16 contains the amino acids
150 to 313 of
SEQ ID NO: 2 and SEQ LD NO: 17 contains the corresponding nucleotides 448 to
942 of SEQ
ID NO: 1. SEQ ID NO: 18 contains the amino acids 64 to 313 of SEQ ID NO: 2.
Figs. 16A and 16B show the results of the yeast two-hybrid analysis that were
designed
to test the interaction between fragments of DnaI and 77 ORF 104. Fragments of
S. aureus DnaI
were cloned into pGADT7 vector. Yeasts were co-transformed with the plasmids
indicated from
No 1 to 6 (Fig. 16A). pGBKLam and 77pGADORF13 are control vectors driving the
expression
of non-interacting proteins. Co-transformants were plated in parallel on THAL
minus SD
CA 02396674 2003-11-14
9D
medium and on TL minus SD medium. Co-transformants bearing 770RF104 only grew
on
selective THAL minus media in the presence of DnaI or DnaI fragments (No 1, 3
and 5).
Fig. 16B: Representation of fragments of DnaI interacting with 770RF104. The
minimal domain
of DnaI interacting with 77 ORF 104 as determined by yeast two-hybrid analysis
is amino acids
150 to 313.
CA 02396674 2003-11-14
DESCRIPTION OF THE INVENTION
The invention is based on the discovery of an essential gene and its encoded
polypeptide
in S. aureus and portions thereof useful in screening, diagnostics, and
therapeutics. The
invention also relates to S. aureus DnaI polypeptides and polynucleotides as
described in greater
5 detail below, and to a pair of polynucleoddes encoding a pair of interacting
polypeptides, and the
pair of polypeptides themselves, or interacting domains thereof, where the
pair includes a S.
aureus DnaI polypeptide and a 77 ORF 104 polypeptide. Also, the invention
relates to
polynucleotides and polypeptides of a protein complex, thought to be involved
in initiation of
DNA replication, containing DnaI and DnaC related proteins, as well as their
variants. In
10 particular, the invention relates to polypeptides and polynucleotides of a
DnaI of S. aureus,
which is related by amino acid sequence homology to B. subtilis DnaI
polypeptide. The
invention relates especially to DnaI having the nucleotide and amino acid
sequences disclosed as
SEQ ID NO: 1 and SEQ ID NO: 2, respectively. The sequences presented as SEQ
ll~ NOs: 1 and
2 represent an exemplification of the invention, since those of ordinary skill
will recognize that
such sequences can be usefully employed in polynucleotides in general,
including
ribopolynucleotides.
We have used the methodology of two previous inventions (U.S. Patent 6,376,652
and
international PCT application WO 00/32825) to identify and characterize an
essential
polynucleotide and polypeptide sequence from S. aureus. Thus, the present
invention provides
polynucleotide and polypeptide sequences isolated from S. aureus that can be
used in a drug
screening assay to identify compounds with anti-microbial activity. The
polynucleotide and
polypeptide sequences can be isolated using a method similar to those
described herein, or using
another method. In addition, such polynucleotide and polypeptide sequences can
be chemically
synthesized.
Definitions
The phrase "active on", with reference to a particular cellular target, such
as the product
of a particular gene, means that the target is an important part of a cellular
pathway which
includes that target and that an agent or compound acts on that pathway. Thus,
in some cases the
agent or compound may act on a component upstream or downstream of the stated
target,
including a regulator of that pathway or a component of that pathway. In
general, an
antibacterial agent is active on an essential cellular function, often on a
product of an essential
gene.
As used herein, the terms "inhibit", "inhibition", 'inhibitory", and
"inhibitor" all refer to a
function of reducing a biological activity or function. Such reduction in
activity or function can,
CA 02396674 2002-06-17
WO 01/46383 PCT/US00/35180
11
for example, be in connection with a cellular component (e.g., an enzyme), or
in connection with
a cellular process (e.g., synthesis of a particular protein), or in connection
with an overall process
of a cell (e.g., cell growth). In reference to cell growth, the inhibitory
effects may be
bacteriocidal (killing of bacterial cells) or bacteriostatic (i.e. - stopping
or at least slowing
bacterial cell growth). The latter slows or prevents cell growth such that
fewer cells of the strain
are produced relative to uninhibited cells over a given time period. From a
molecular standpoint,
such inhibition may equate with a reduction in the level of, or elimination
of, the transcription
and/or translation of a specific bacterial target(s), or reduction or
elimination of activity of a
particular target biomolecule.
As used herein, the term "DnaI polypeptide" refers to a polypeptide
encompassing S.
aureus DnaI (SEQ ID NO: 2) or an active domain of S. aureus DnaI. As used
herein, the term
"active domain of S. aureus DnaI" is a polypeptide fragment or portion of S.
aureus DnaI that
retains an activity of S. aureus DnaI. The term "DnaI polypeptide" is meant to
encompass S
aureus DnaI or an active domain of S. aureus DnaI that is fused to another,
non-DnaI
polypeptide sequence.
"DnaI activity" is defined as one or more of the following:
A) The activity of a polypeptide having the S. aureus DnaI sequence provided
herein, a
fragment or analog thereof or a protein comprising a S. au~eus DnaI
polypeptide that directly
interacts with bacteriophage 77 ORF 104 protein or a DnaI-binding fragment
thereof in a manner
that results in at least a 10-fold reduction of 3H-thymidine incorporation in
a bacterial DNA
replication assay relative to 3H-thymidine incorporation in an assay lacking
bacteriophage 77
ORF 104 or a DnaI-binding fragment thereof.
To assay for DnaI activity by 3H-thymidine incorporation, the level of
radiolabeled
thymidine incorporation into DNA is measured in S. aureus cells expressing an
arsenite-
inducible 77 ORF104 construct in the presence or absence of 5 ~M sodium
arsenite. Samples
(0.5 ml) are withdrawn from cultures at appropriate time intervals and mixed
with 4.5 ~1 of
labeling solution (0.2 p,Ci/ml of 3H-thymidine (73 Ci/mmol, NEN Life Science
Products, Inc.)
and 70 pmol of unlabeled thymidine). After 15 minutes of reaction,
incorporation is stopped by
adding 5 ~1 of 0.2% NaN3 and 5 ~1 of 30 pg/ml unlabeled thymidine. Samples are
precipitated
with 10% (w/v) trichloroacetic acid and filtered through glass fiber filters
(GF-C, Whatman).
The results are expressed as 3H -thymidine counts incorporated, normalized to
the OD of the
culture.
CA 02396674 2003-11-14
12
B) The activity of a polypeptide having the S. aureus DNA sequence provided
herein, or
a fragment or analog thereof, or a protein comprising a S. aureus DnaI
polypeptide that is
necessary for at least a 10% inhibition of plasmid replication by
bacteriophage 77 ORF 104
protein in the plasmid DNA replication assay. This assay is as follows, the
plasmid pC 194
replicates in S. aureus by a rolling circle mechanism. The single-stranded
origin, sso, of pC194
is involved in the synthesis of the lagging strand of DNA. The plasmid
pADG6406 is a
derivative of pC194 lacking sso. The absence of sso leads to the accumulation
of single-stranded
plasmid DNA. The single stranded initiation site, ssiA, is located on the
lagging strand of pAM
1, and is a site for replicative primosome assembly. SsiA was inserted into
plasmid pADG6406.
S. aureus cells carrying plasmids are grown to mid-log phase and their total
DNA is extracted
and analyzed by Southern hybridization using 32P-labeled plasmid DNA as probe.
The presence
of pADG6406 with ssiA is associated with a decrease in the ratio of single-
stranded to double-
stranded plasmid DNA compared to the ratio in cells bearing the same plasmid
lacking the ssiA
insert. This system is used to measure the effect of 77 ORF 104 expression on
single-stranded
DNA synthesis. A plasmid containing 77 ORF 104 under an arsenite-inducible
promoter is
transformed into S. aureus harboring pADG6406. The ratio of single-stranded to
double-
stranded DNA of pADG6406 is measured in the presence and absence of sodium
arsenite. An
increase in the ratio of single-stranded to double-stranded DNA of 10% or more
in the presence
of 77 ORF 104 indicates an effect on DnaI activity.
C) The activity of a polypeptide having the S. aureus sequence provided
herein, a
fragment or analog thereof, or a protein comprising a S. aureus DnaI
polypeptide in the loading
of S. aureus DnaC helicase onto replicative primosomes. The following helicase
assay can be
adapted from an in vitro assay with SPP1 phage G38P (DnaA), G39P (DnaI) and
G40P (DnaC)
polypeptides (Ayora et al., 1999, J. Mol. Biol. 288: 71-85) Helicases are
capable of unwinding
DNA with a 5' to 3' unwinding polarity. To determine the role of S. aureus
DnaI on the helicase
unwinding activity, an annealed substrate with a 3' single-stranded (ss) DNA
tail (preformed
fork) is incubated with a constant quantity of purified DnaC helicase and
increasing amounts of
either purified DnaI, DnaA or preformed DnaA-DnaI complex. The reaction
mixture is subjected
to conditions that support helicase activity. The reaction contains 50 mM
NaCI, 1 mM ATP, 50
p,g/ml BSA and 0.24 nM 32P-labeled oligomer annealed to M13 ssDNA offered as
substrate. The
DNA molecule in the reaction mixture is analyzed for whether it is converted
to single-stranded
(ss) DNA. The reaction is stopped by the addition of 5 ~,1 of stopping
solution ( 100 mM EDTA,
2°70 (w/v) SDS in DNA loading buffer (Sambrook et al., (1989).
Molecular cloning: A laboratory
manual. Cold Spring Harbor Laboratory, New York. Cold Spring Harbor Laboratory
Press) and
CA 02396674 2003-11-14
13
subsequently loaded onto a 10% non-denaturing PAGE gel. The gel is run and
dried prior to
autoradiography. The ratio of the oligo released from the M 13 ssDNA is
evaluated.
D) The binding or interaction of a polypeptide comprising the amino acid
sequence of
SEQ ID NO: 16, provided herein, to bacteriophage 77 ORF 104 protein or a
portion thereof
capable of binding a polypeptide comprising the amino acid sequence of SEQ ID
NO. 16. The
interaction or binding of a polypeptide comprising the amino acid sequence of
SEQ m NO. 16
and a binding portion of bacteriophage 77 ORF 104 may be between isolated
polypeptides
consisting essentially of the sequence necessary for binding, or,
alternatively, the respective
polypeptide sequence may be comprised within a larger polypeptide. A number of
methods,
useful in the invention, to measure the binding of bacteriophage 77 ORF 104 to
a polypeptide
comprising the amino acid sequence of SEQ ID NO: 16 are described below. For
example,
Phage display is a powerful quantitative assay to measure protein:protein
interaction using
colorimetric ELISA (enzyme-linked immunosorbent assay). Surface plasmon
resonance assays
can be used as a quantitative method to measure binding between two molecules
by the change
in mass near an immobilized sensor caused by the binding of one protein from
the aqueous phase
to a second immobilized on the sensor. An additional useful binding assay is
Fluorescence
Resonance Energy Transfer (FRET), in which the close proximity of two
fluorophores, each
bound to a separate molecule, causes the excitation spectrum of one
fluorophore to overlap with
the excitation spectrum of the second, and thus dual fluorescence following
excitation of only
one fluorophore is indicative of binding. An additional assay useful in the
present invention is
fluorescence polarization, in which the quantifiable polarization value for a
given fluorescently-
tagged molecule is altered upon binding to a second molecule. A scintillation
proximity assay
can also be used to measure binding of a polypeptide comprising the amino acid
sequence of
SEQ ID NO: 16 and bacteriophage 770RF104, in which the emmitance of
radioactive particles
is altered upon binding. Additionally, binding can be evaluated by a Bio
Sensor assay, which is
based on the ability of the sensor to register changes in admittance induced
by ion-channel
modulation following binding. A further assay which can be used to measure the
binding of a
polypeptide comprising the amino acid sequence of SEQ ID NO: 16 and
bacteriophage 77 ORF
104 is the yeast two hybrid assay, in which the binding of the two
polypeptides within the
context of two fusion proteins expressed in yeast cells, permits the
expression of reporter
molecules which, in turn produces a measurable, or detectable signal.
The activity of the dnaI gene is defined as the expression of an RNA encoding
a S.
aureus DnaI polypeptide according to the invention.
CA 02396674 2002-06-17
WO 01/46383 PCT/US00/35180
14
As used herein, the term "polynucleotide encoding a polypeptide" or equivalent
language
encompasses polynucleotides that include a sequence encoding a polypeptide of
the invention,
particularly a bacterial polypeptide and more particularly a polypeptide of S.
aureus DnaI protein
having an amino acid sequence set out in Fig. 1, SEQ ID NO: 2. The term also
encompasses
polynucleotides that include a single continuous region or discontinuous
regions encoding the
polypeptide (for example, polynucleotides interrupted by integrated phage, an
integrated
insertion sequence, an integrated vector sequence, an integrated transposon
sequence, or due to
RNA editing or genomic DNA reorganization) together with additional regions
that also may
contain coding and/or non-coding sequences.
As used herein, the term "dnaI gene" is meant to encompass a polynucleotide
encoding a
S. aureus DnaI polypeptide. Any additional nucleotide sequences necessary to
direct
transcription of RNA encoding a S. aureus DnaI polypeptide, either in a cell
or in vitro, will be
termed "regulatory sequences", which include but are not limited to
transcriptional promoters
and enhancers, and transcription terminators.
As used herein, the term "ORF 104" or "phage 77 ORF 104" or "770RF 104"
encompasses a polynucleotide having the sequence provided in Fig. 4 (SEQ ID
No: 4), which
encodes a gene product known as the 77 ORF 104 gene product.
As used herein, the term "polynucleotide(s)" generally refers to any
polyribonucleotide or
poly-deoxyribonucleotide, which may be unmodified RNA or DNA or modified RNA
or DNA.
"Polynucleotide(s)" include, without limitation, single- and double-stranded
DNA, DNA that is a
mixture of single- and double-stranded regions or single-, double- and triple-
stranded regions,
single- and double-stranded RNA, and RNA that is mixture of single- and double-
stranded
regions, hybrid molecules comprising DNA and RNA that may be single-stranded
or, more
typically, double-stranded, or triple-stranded regions, or a mixture of single-
and double-stranded
regions. In addition, "polynucleotide" as used herein refers to triple-
stranded regions comprising
RNA or DNA or both RNA and DNA. The strands in such regions may be from the
same
molecule or from different molecules. The regions may include all of one or
more of the
molecules, but more typically involve only a region of some of the molecules.
One of the
molecules of a triple-helical region often is an oligonucleotide. As used
herein, the term
"polynucleotide(s)"also includes DNAs or RNAs as described above that contain
one or more
modified bases. Thus, DNAs or RNAs with backbones modified for stability or
for other reasons
are "polynucleotide(s)" as that term is intended herein. Moreover, DNAs or
RNAs comprising
unusual bases, such as inosine, or modified bases, such as tritylated bases,
to name just two
examples, axe polynucleotides as the term is used herein. It will be
appreciated that a great
CA 02396674 2002-06-17
WO 01/46383 PCT/US00/35180
variety of modifications have been made to DNA and RNA that serve many useful
purposes
known to those of skill in the art. The term "polynucleotide(s)" as it is
employed herein
embraces such chemically, enzymatically or metabolically modified forms of
polynucleotides, as
well as the chemical forms of DNA and RNA characteristic of viruses and cells,
including, for '
5 example, simple and complex cells. "Polynucleotide(s)" also embraces short
polynucleotides
often referred to as oligonucleotide(s).
As used herein, the term "polypeptide(s)" refers to any peptide or protein
comprising two
or more amino acids joined to each other by peptide bonds or modified peptide
bonds.
"Polypeptide(s)" refers to both short chains, commonly referred to as
peptides, oligopeptides and
10 oligomers and to longer chains generally referred to as proteins.
Polypeptides may contain amino
acids other than the 20 gene-encoded amino acids. "Polypeptide(s)" include
those modified
either by natural processes, such as processing and other post-translational
modifications, but
also by chemical modification techniques. Such modifications are well
described in basic texts
and in more detailed monographs, as well as in a voluminous research
literature, and they are
15 well known to those of skill in the art. It will be appreciated that the
same type of modification
may be present in the same or varying degree at several sites in a given
polypeptide. Also, a
given polypeptide may contain many types of modifications. Modifications can
occur anywhere
in a polypeptide, including the peptide backbone, the amino acid side-chains,
and the amino or
carboxyl termini. Modifications include, for example, acetylation, acylation,
ADP-ribosylation,
amidation, covalent attachment of flavin, covalent attachment of a heme
moiety, covalent
attachment of a nucleotide or nucleotide derivative, covalent attachment of a
lipid or lipid
derivative, covalent attachment of phosphotidylinositol, cross-linking,
cyclization, disulfide bond
formation, demethylation, formation of cysteine, formation of pyroglutamate,
fonnylation,
gamma-carboxylation, GPI anchor formation, hydroxylation, iodination,
methylation,
myristoylation, oxidation, proteolytic processing, phosphorylation,
prenylation, racemization,
glycosylation, lipid attachment, sulfation, gamma-carboxylation of glutamic
acid residues,
hydroxylation, selenoylation, sulfation and transfer-RNA mediated addition of
amino acids to
proteins, such as arginylation, and ubiquitination. See, for instance:
PROTEINS - STRUCTURE
AND MOLECULAR PROPERTIES, 2nd Ed., T. E. Creighton, W. H. Freeman and Company,
New York (1993); Wold, F., Posttranslational Protein Modifications:
Perspectives and Prospects,
pgs. 1-12 in POSTTRANSLATIONAL COVALENT MODIFICATION OF PROTEINS, B. C.
Johnson, Ed., Academic Press, New York (1983); Seifter et al., Meth. Enzymol.
182:626-646
(1990); and Rattan et al., Protein Synthesis: Posttranslational Modifications
and Aging, Ann.
N.Y. Acad. Sci. 663: 48-62(1992). Polypeptides may be branched or cyclic, with
or without
CA 02396674 2002-06-17
WO 01/46383 PCT/US00/35180
16
branching. Cyclic, branched and branched circular polypeptides may result from
post-
translational natural processes and may be made by entirely synthetic methods,
as well.
As used herein, the term "variant(s)" refers to a polynucleotide or
polypeptide that differs
from a reference polynucleotide or polypeptide, respectively, but retains one
or more of the
biological activities of DnaI as described herein. A typical variant of a
polynucleotide differs in
nucleotide sequence from another, reference polynucleotide. Changes in the
nucleotide sequence
of the variant may or may not alter the amino acid sequence of a polypeptide
encoded by the
reference polynucleotide. Nucleotide changes may result in amino acid
substitutions, additions,
deletions, and truncations in the polypeptide encoded by the reference
sequence, or in the
formation of fusion proteins, as discussed below. A typical variant of a
polypeptide differs in
amino acid sequence from another, reference polypeptide. Generally,
differences are limited so
that the sequences of the reference polypeptide and the variant are closely
similar overall and, in
many regions, identical. A variant and reference polypeptide may differ in
amino acid sequence
by one or more substitutions, additions, deletions in any combination. A
substituted or inserted
amino acid residue may or may not be one encoded by the genetic code. The
present invention
also includes variants of each of the polypeptides of the invention, that is
polypeptides that vary
from the referents by conservative amino acid substitutions whereby a residue
is substituted by
another with like characteristics. Typically, such substitutions are among
Val, Leu and 11e;
among Ser and Thr; among the acidic residues Asp and Glu; and among the basic
residues Lys
and Arg; or aromatic residues Phe and Tyr. Particularly preferred are variants
in which 1-10, 1-5,
1-3, 2-3, or 1 amino acid or amino acids are substituted, deleted, or added in
any combination. A
variant of a polynucleotide or polypeptide may be a naturally occurring such
as an allelic variant,
or it may be a variant that is not known to occur naturally. Non-naturally
occurring variants of
polynucleotides and polypeptides may be made by mutagenesis techniques, by
direct synthesis,
, and by other recombinant methods known to skilled artisans.
As uses herein, the term "fragment", when used in reference to a polypeptide,
is a variant
polypeptide having an amino acid sequence that is entirely the same as part
but not all of the
amino acid sequence of DnaI polypeptide according to the invention. As with S.
aureus DnaI
polypeptides, fragments may be "free-standing" ("consisting off'), or
comprised within a larger
polypeptide of which they form a part or region, most preferably as a single
continuous region in
a single larger polypeptide.
The term "isolated", when used in reference to a nucleic acid means that a
naturally
occurring sequence has been removed from its normal cellular (e.g.,
chromosomal) environment
or is synthesized in a non-natural environment (e.g., artificially
synthesized). Thus, the sequence
CA 02396674 2002-06-17
WO 01/46383 PCT/US00/35180
17
may be in a cell-free solution or placed in a different cellular environment.
The term does not
imply that the sequence is the only nucleotide chain present, but that it is
essentially free (about
90-95% pure at least) of non-nucleotide material naturally associated with it,
and thus is
distinguished from isolated chromosomes.
The term "enriched", when used in reference to a polynucleotide means that the
specific
DNA or RNA sequence constitutes a significantly higher fraction (2-5 fold) of
the total DNA or
RNA present in the cells or solution of interest than in normal or diseased
cells or in cells from
which the sequence was originally taken. This could be caused by a person by
preferential
reduction in the amount of other DNA or RNA present, or by a preferential
increase in the
amount of the specific DNA or RNA sequence, or by a combination of the two.
However, it
should be noted that enriched does not imply that there are no other DNA or
RNA sequences
present, just that the relative amount of the sequence of interest has been
significantly increased.
As used herein, the term "significantly higher fraction" indicates that the
level of
enrichment is useful to the person making such an enrichment and indicates an
increase
enrichment relative to other nucleic acids of at least about 2-fold, or 5- to
10-fold or even more.
The term also does not imply that there is no DNA or RNA from other sources.
The other source
DNA may, for example, comprise DNA from a yeast or bacterial genome, or a
cloning vector
such as pUC 19. This term distinguishes from naturally occurring events, such
as viral infection,
or tumor type growths, in which the level of one mRNA may be naturally
increased relative to
other species of mRNA. That is, the term is meant to cover only those
situations in which a
person has intervened to elevate the proportion of the desired nucleic acid.
As used herein, the term "purified" in reference to nucleic acid does not
require absolute
purity (such as a homogeneous preparation). Instead, it represents an
indication that the
sequence is relatively more pure than in the natural environment (compared to
the natural level,
~5 this level should be at least 2-5 fold greater, e.g., in terms of mg/mL).
Individual clones isolated
from a genomic or cDNA library may be purified to electrophoretic homogeneity.
The claimed
DNA molecules obtained from these clones could be obtained directly from total
DNA or from
total RNA. cDNA clones are not naturally occurring, but rather are preferably
obtained via
manipulation of a partially purified naturally occurring substance (messenger
RNA). The
construction of a cDNA library from mRNA involves the creation of a synthetic
substance
(cDNA) and pure individual cDNA clones can be isolated from the synthetic
library by clonal
selection of the cells carrying the cDNA library. Thus, the process which
includes the
construction of a cDNA library from mRNA and isolation of distinct cDNA clones
yields an
approximately 106-fold purification of the native message over its proportion
in naturally
CA 02396674 2002-06-17
WO 01/46383 PCT/US00/35180
18
occurring cells. Thus, purification of at least one order of magnitude,
preferably two or three
orders, and more preferably four or five orders of magnitude is expressly
contemplated. A
genomic library can be used in the same way and yields the same approximate
levels of
purification.
The terms "isolated", "enriched", and "purified" used with respect to nucleic
acids,
above, may similarly be used to denote the relative purity and abundance of
polypeptides. These,
too, may be stored in, grown in, screened in, and selected from libraries
using biochemical
techniques familiar in the art. Such polypeptides may be natural, synthetic or
chimeric and may
be extracted using any of a variety of methods, such as antibody
immunoprecipitation, other
"tagging" techniques, conventional chromatography and/or electrophoretic
methods. Some of the
above utilize the corresponding nucleic acid sequence.
As used herein, the term "complement" when used in reference to a given
polynucleotide
sequence refers to a sequence of nucleotides which can form a double-stranded
heteroduplex in
which every nucleotide in the sequence of nucleotides is base-paired by
hydrogen bonding to a
nucleotide opposite it in the heteroduplex with the given polynucleotide
sequence. The term
may refer to a DNA or an RNA sequence that is the complement of another RNA or
DNA
sequence. As used herein, the term "hybridizes" refers to the formation of a
hydrogen-bonded
heteroduplex between two nucleic acid molecules. Generally, a given nucleic
acid molecule will
hybridize with its complement, or with a molecule that is sufficiently
complementary to the
given molecule to permit formation of a hydrogen-bonded heteroduplex between
the two
molecules.
As used herein, the term "probe" refers to a polynucleotide of at least 15
nucleotides (nt),
20 nt, 30 nt, 40 nt, 50 nt, 75 nt, 100 nt, 200 nt, 500 nt, 1000 nt, and even
up to 5000 to 10,000 nt
in length.
"Identity" and "similarity," as used herein and as known in the art, are
relationships
between two or more polypeptide sequences or two or more polynucleotide
sequences, as the
case may be, as determined by comparing the sequences.
Amino acid or nucleotide sequence "identity" and "similarity" are determined
from an
optimal global alignment between the two sequences being compared. An optimal
global
alignment is achieved using, for example, the Needleman - Wunsch algorithm
(Needleman and
Wunsch, 1970, J. Mol. Biol. 48:443-453). "Identity" means that an amino acid
or nucleotide at a
particular position in a first polypeptide or polynucleotide is identical to a
corresponding amino
acid or nucleotide in a second polypeptide or polynucleotide that is in an
optimal global
alignment with the first polypeptide or polynucleotide. In contrast to
identity, "similarity"
CA 02396674 2002-06-17
WO 01/46383 PCT/US00/35180
19
encompasses amino acids that are conservative substitutions. A "conservative"
substitution is
any substitution that has a positive score in the blosum62 substitution matrix
(Hentikoff and
Hentikoff, 1992, Proc. Natl. Acad. Sci. USA S9: 10915-10919). By the statement
"sequence A is
n% similar to sequence B" is meant that n% of the positions of an optimal
global alignment
between sequences A and B consists of conservative substitutions. By the
statement "sequence
A is n% identical to sequence B" is meant that n% of the positions of an
optimal global
alignment between sequences A and B consists of identical residues or
nucleotides. Optimal
global alignments in this disclosure used the following parameters in the
Needleman-Wunsch
alignment algorithm:
For polypeptides:
Substitution matrix: blosum62.
Gap scoring function: -A -B*LG, where A=11 (the gap penalty), B=1 (the gap
length penalty) and LG is the length of the gap.
For nucleotide sequences:
Substitution matrix: 10 for matches, 0 for mismatches.
Gap scoring function: -A -B*LG where A=50 (the gap penalty), B=3 (the gap
length penalty) and LG is the length of the gap.
Typical conservative substitutions are among Met, Val, Leu and 11e; among Ser
and Thr;
among the residues Asp, Glu and Asn; among the residues Gln, Lys and Arg; or
aromatic
residues Phe and Tyr. In calculating the degree (most often as a percentage)
of similarity
between two polypeptide sequences, one considers the number of positions at
which identity or
similarity is observed between corresponding amino acid residues in the two
polypeptide
sequences in relation to the entire lengths of the two molecules being
compared.
As used herein, the term "antibody" is meant to encompass constructions using
the
binding (variable) region of such an antibody, and other antibody
modifications. Thus, an
antibody useful in the invention mad comprise a whole antibody, an antibody
fragment, a
polyfunctional antibody aggregate, or in general a substance comprising one or
more specific
binding sites from an antibody. The antibody fragment may be a fragment such
as an Fv, Fab or
F(ab')2 fragment or a derivative thereof, such as a single chain Fv fragment.
The antibody or
antibody fragment may be non-recombinant, recombinant or humanized. The
antibody may be
of an immunoglobulin isotype, e.g., IgG, IgM, and so forth. In addition, an
aggregate, polymer,
derivative and conjugate of an immunoglobulin or a fragment thereof can be
used where
appropriate. Neutralizing antibodies are especially useful according to the
invention for
diagnostics, therapeutics and methods of drug screening and drug design.
CA 02396674 2002-06-17
WO 01/46383 PCT/US00/35180
As used herein, the term "specific for an epitope present on a S. aureus DnaI
polypeptide", when used in reference to an antibody, means that the antibody
recognizes and
binds an antigenic determinant present on a S. aureus DnaI polypeptide
according to the
invention.
5 As used herein, the term "antigenically equivalent derivative(s)"
encompasses a
polypeptide, polynucleotide, or the equivalent of either which will be
specifically recognized by
certain antibodies which, when raised to the protein, polypeptide or
polynucleotide according to
the invention, interferes with the immediate physical interaction between
pathogen and
mammalian host.
10 As used herein, the term "essential", when used in connection with a gene
or gene
product, means that the host cannot survive without, or is significantly
growth compromised, in
the absence or depletion of functional product. An "essential gene" is thus
one that encodes a
product that is beneficial, or preferably necessary, for cellular growth in
vitro in a medium
appropriate for growth of a strain having a wild-type allele corresponding to
the particular gene
15 in question. Therefore, if an essential gene is inactivated or inhibited,
that cell will grow
significantly more slowly than a wild-type strain or even not at all.
Preferably, growth of a strain
in which such a gene has been inactivated will be less than 20%, more
preferably less than 10%,
most preferably less than 5% of the growth rate of the wild-type, or the rate
will be zero, in the
growth medium. Preferably, in the absence of activity provided by a product of
the gene, the cell
20 will not grow at all or will be non-viable, at least under culture
conditions similar to normal in
vivo growth conditions. For example, absence of the biological activity of
certain enzymes
involved in bacterial cell wall synthesis can result in the lysis of cells
under normal osmotic
conditions, even though protoplasts can be maintained under controlled osmotic
conditions.
Preferably, but not necessarily, if such a gene is inhibited, e.g., with an
antibacterial agent or a
phage product, the growth rate of the inhibited bacteria will be less than
50%, more preferably
less than 30%, still more preferably less than 20%, and most preferably less
than 10% of the
growth rate of the uninhibited bacteria. As recognized by those skilled in the
art, the degree of
growth inhibition will generally depend upon the concentration of the
inhibitory agent. In the
context of the invention, essential genes are generally the preferred targets
of antimicrobial
agents. Essential genes can encode "target" molecules directly or can encode a
product involved
in the production, modification, or maintenance of a target molecule.
As used herein, "target" refers to a biomolecule or complex of biomolecules
that can be
acted on by an exogenous agent or compound, thereby modulating, preferably
inhibiting, growth
CA 02396674 2002-06-17
WO 01/46383 PCT/US00/35180
21
or viability of a bacterial cell. A target may be a nucleic acid sequence or
molecule, or a
polypeptide or a region of a polypeptide.
As used herein, the term "signal that is generated by activation or inhibition
of a S.
aureus DnaI polypeptide" refers to the measurable indicator of DnaI activity
in an assay of DnaI
activity. For example, 3H-thymidine DNA incorporation, plasmid replication,
helicase loading,
or simply signal resulting for binding of 770RF104 to a DnaI polypeptide.
As used herein, the term "standard", used in reference to polypeptide
activity, means the
amount of activity observed or detected (directly or indirectly) in a given
assay performed in the
absence of a candidate compound. A "standard" serves as a reference to
determine the effect,
positive or negative, of a candidate compound on polypeptide activity.
A "candidate compound" as used herein, is any compound with a potential to
modulate
the expression or activity of a S. aureus DnaI polypeptide.
As used herein, the term "increase in activity" refers to an enhanced level of
measurable
activity of a polypeptide in a given assay in the presence of a candidate
compound relative to the
measurable level of activity in the absence of a candidate compound. Activity
is considered
increased according to the invention if it is at least 10% greater, 20%
greater, 50% greater, 75%
greater, 100% greater or more, up to 2-fold, 5-fold, 10-fold, 20-fold, 50-
fold, 100-fold or more
than in the absence of a candidate compound.
As used herein, the term "decrease in activity" refers to a reduced level of
measurable
activity of a polypeptide in a given assay in the presence of a candidate
compound relative to the
measurable level of activity in the absence of a candidate compound. Activity
is considered
decreased according to the invention if it is at least 10% less, preferably
15% less, 20% less, 50%
less, 75% less, or even 100% less (i.e., no activity) than that observed in
the absence of a
candidate compound.
As used herein, the term "conditions that permit their interaction", when used
in
reference to a S. aureus DnaI polypeptide and a candidate compound means that
the two entities
are placed together, whether both in solution or with one immobilized or
restricted in some way
and the other in solution, wherein the parameters (e.g., salt, detergent,
protein or candidate
compound concentration, temperature, and redox potential, among others) of the
solution are
such that the S. aureus DnaI polypeptide and the candidate compound may
physically associate.
Conditions that permit protein:candidate interaction include, for example, the
conditions
described herein for Phage display, Surface Plasmon Resonance and FRET assays.
As used herein, the term "detectable change in a measurable parameter of DnaI"
refers to
an alteration in a quantifiable characteristic of a S. aureus DnaI
polypeptide.
CA 02396674 2002-06-17
WO 01/46383 PCT/US00/35180
22
As used herein, the term "agonist" refers to an agent or compound that
enhances or
increases the activity of a S. aureus DnaI polypeptide or polynucleotide. An
agonist may be
directly active on a S. au~eus DnaI polypeptide or polynucleotide, or it may
be active on one or
more constituents in a pathway that leads to enhanced or increased activity of
a S. aureus DnaI
polypeptide or polynucleotide.
As used herein, the term "antagonist" refers to an agent or compound that
reduces or
decreases the activity of a S. aureus DnaI polypeptide or polynucleotide. An
antagonist may be
directly active on a S. aureus DnaI polypeptide or polynucleotide, or it may
be active on one or
more constituents in a pathway that leads to reduced or decreased activity of
a S. au~eus DnaI
polypeptide or polynucleotide.
As used herein, the term "antibacterial agent" or "antibacterial compound"
refers to an
agent or compound that has a bacteriocidal or bacteriostatic effect on one or
more bacterial
strains, preferably such an agent or compound is bacteriocidal or
bacteriostatic on at least S.
au~eus.
As used herein, the term "synthesizing" refers to a process of chemically
synthesizing a
compound.
As used in the context of treating a bacterial infection a "therapeutically
effective
amount", "pharmaceutically effective amount" or "amount sufficient to provide
a therapeutic
effect" indicates an amount of an antibacterial agent which has a therapeutic
effect. This
generally refers to the inhibition, to some extent, of the normal cellular
functioning of bacterial
cells required for continued bacterial infection. Further, as used herein, a
therapeutically
effective amount means an amount of an antibacterial agent that produces the
desired therapeutic
effect as judged by clinical trial results and/or animal models. This amount
can be routinely
determined by one skilled in the art and will vary depending on several
factors, such as the
particular bacterial strain involved and the particular antibacterial agent
used. In the same
context, an "amount sufficient to reduce adhesion" of a bacterium to a tissue
or tissue surface
indicates an amount of an antibacterial agent that is effective for
prophylactically preventing or
reducing the extent of bacterial infection of the given tissue or tissue
surface.
As used herein, a "tissue" refers to an aggregation of cells of one or more
cell types
which together perform one or more specific functions in an organism. As used
herein, a "tissue
surface" refers to that portion of a tissue that forms a boundary between a
given tissue and other
tissues or the surroundings of the tissue. A tissue surface may refer to an
external surface of an
animal, for example the skin or cornea, or, alternatively, the term may refer
to a surface that is
CA 02396674 2002-06-17
WO 01/46383 PCT/US00/35180
23
either internal, for example, the lining of the gut, or to a surface that is
exposed to the outside
surroundings of the animal only as the result of an injury or a surgical
procedure.
As used herein, the term "measuring the binding of a candidate compound"
refers to the
use of an assay permitting the quantitation of the amount of a candidate
compound physically
associated with a S. aureus DnaI polypeptide.
As used herein, the term "directly or indirectly detectably labeled" refers to
the
attachment of a moiety to a candidate compound that renders the candidate
compound either
directly detectable (e.g., an isotope or a fluorophore) or indirectly
detectable (e.g., an enzyme
activity, allowing detection in the presence of an appropriate substrate, or a
specific antigen or
other marker allowing detection by addition of an antibody or other specific
indicator).
As used herein, the term "small molecule" refers to compounds having molecular
mass of
less than 3000 Daltons, preferably less than 2000 or 1500, still more
preferably less than 1000,
and most preferably less than 600 Daltons. Preferably but not necessarily, a
small molecule is
not an oligopeptide.
As used herein, the term "mimetic" refers to a compound that can be natural,
synthetic, or
chimeric and is structurally and functionally related to a reference compound.
In terms of the
present invention, a "peptidomimetic," for example, is a non-peptide compound
that mimics the
activity-related aspects of the 3-dimensional structure of a peptide or
polypeptide, for example a
compound that mimics the structure of a peptide or active portion of a phage-
or bacterial ORF-
encoded polypeptide.
As used herein, the term "bacteriophage inhibitor protein" refers to a protein
encoded by
a bacteriophage nucleic acid sequence, which inhibits bacterial function in a
host bacterium.
Thus, it is a bacteria-inhibiting phage product. The term "bacteriophage
inhibitor protein"
encompasses a fragment, derivative, or active portion of a bacteriophage
inhibitor protein.
As used herein, the term "active portion" refers to an epitope, a catalytic or
regulatory
domain, or a fragment of a bacteriophage inhibitor protein that is responsible
for, or a significant
factor in, bacterial target inhibition. The active portion preferably may be
removed from its
contiguous sequences and, in isolation, still effect inhibition.
As used herein, the term "treating a bacterial infection" refers to a process
whereby the
growth and/or metabolic activity of a bacterium or bacterial population in a
host, preferably a
mammal, more preferably a human, is inhibited or ablated.
As used herein, the term "bacterium" refers to a single bacterial strain and
includes a
single cell and a plurality or population of cells of that strain unless
clearly indicated to the
contrary. In reference to bacteria or bacteriophage, the term "strain" refers
to bacteria or phage
CA 02396674 2002-06-17
WO 01/46383 PCT/US00/35180
24
having a particular genetic content. The genetic content includes genomic
content as well as
recombinant vectors. Thus, for example, two otherwise identical bacterial
cells would represent
different strains if each contained a vector, e.g., a plasmid, with different
inserts.
As used herein, the term "diagnosing" refers to the identification of an
organism or strain
of an organism responsible for a bacterial infection.
As used herein, the term "infection with Staphylococcus aureus" refers to the
presence,
growth or proliferation of cells of a S. aureus strain within, or on a surface
of, an animal, such as
a mammal, preferably a human.
As used herein, the term "bacteriophage 77 ORF 104-encoded polypeptide" refers
to a
polypeptide encoded by SEQ ID NO: 4 or to a fragment or derivative thereof
encompassing an
active portion of a bacteriophage 77 ORF 104-encoded polypeptide of sequence
disclosed in
SEQ ID NO: 5.
As used herein, the term "DnaC" refers to a polypeptide of SEQ ID NO: 9,
including that
encoded by a polynucleotide of SEQ ID NO: 7 or to a fragment or derivative of
such polypeptide
encompassing an active portion of S. aureus DnaC. In this context, an active
portion of S.
aureus DnaC refers to that fragment or portion of S. aureus DnaC that
interacts with or is part of
a complex including S. au~eus DnaI or a fragment or derivative of S. au~eus
DnaI.
As used herein, the term "polypeptide complex" refers to a combination of two
or more
polypeptides in a physical association with each other. It is preferred that
such a physical
association be required for some aspect of the activity of one or more of the
polypeptides in such
a polypeptide complex.
As used herein, the term "physical association" refers to an interaction
between two
moieties involving contact between the two moieties.
As used herein, the term "bodily material(s)" means any material derived from
an
individual or from an organism infecting, infesting or inhabiting an
individual, including but not
limited to, cells, tissues and waste, such as, bone, blood, serum,
cerebrospinal fluid, semen,
saliva, muscle, cartilage, organ tissue, skin, urine, stool or autopsy
materials.
As used herein, the term "disease(s)" means any disease caused by or related
to infection
by a bacterium, including, for example, otitis media, conjunctivitis,
pneumonia, bacteremia,
meningitis, sinusitis, pleural empyema and endocarditis, and most particularly
meningitis, such
as for example infection of cerebrospinal fluid.
As used herein, the term "fusion protein(s)" refers to a protein encoded by a
gene
comprising amino acid coding sequences from two or more separate proteins
fused in frame such
that the protein comprises fused amino acid sequences from the separate
proteins.
CA 02396674 2002-06-17
WO 01/46383 PCT/US00/35180
As used herein, the term "host cell(s)" is a cell which has been transformed
or
transfected, or is capable of transformation or transfection by an exogenous
polynucleotide
sequence.
As used herein, the term "immunologically equivalent derivative(s)"
encompasses a
5 polypeptide, polynucleotide, or the equivalent of either which when used in
a suitable
formulation to raise antibodies in a vertebrate, results in antibodies that
act to interfere with the
immediate physical interaction between pathogen and mammalian host.
As used herein, the term "immunospecific" means that characteristic of an
antibody
whereby it possesses substantially greater affinity for the polypeptides of
the invention or the
10 polynucleotides of the invention than its affinity for other related
polypeptides or polynucleotides
respectively, particularly those polypeptides and polynucleotides in the prior
art.
As used herein, the term "individual(s)" means a multicellular eukaryote,
including, but
not limited to a metazoan, a mammal, an ovid, a bovid, a simian, a primate,
and a human.
As used herein, the term "Organism(s)" means a (i) prokaryote, including but
not limited
15 to, a member of the genus Streptococcus, Staphylococcus, Bordetella,
Corynebacterium,
Mycobacterium, Neisseria, Haemophilus, Actinomycetes, Streptomycetes,
Nocardia,
Enterobacter, Yersinia, Fancisella, Pasturella, Moraxella, Acinetobacter,
Erysipelothrix,
Branhamella, Actinobacillus, Streptobacillus, Listeria, Calymmatobacterium,
Brucella, Bacillus,
Clostridium, Treponema, Escherichia, Salmonella, Kleibsiella, Vibrio, Proteus,
Erwinia,
20 Borrelia, Leptospira, Spirillum, Campylobacter, Shigella, Legionella,
Pseudomonas, Aeromonas,
Rickettsia, Chlamydia, Borrelia and Mycoplasma, and further including, but not
limited to, a
member of the species or group, Group A Streptococcus, Group B Streptococcus,
Group C
Streptococcus, Group D Streptococcus, Group G Streptococcus, Streptococcus
pneumoniae,
Streptococcus pyogenes, Streptococcus agalactiae, Streptococcus faecalis,
Streptococcus
25 faecium, Streptococcus durans, Neisseria gonorrheae, Neisseria
meningitidis, Staphylococcus
aureus, Staphylococcus epidermidis, Corynebacterium diptheriae, Gardnerella
vaginalis,
Mycobacterium tuberculosis, Mycobacterium bovis, Mycobacterium ulcerans,
Mycobacterium
leprae, Actinomyctes israelii, Listeria monocytogenes, Bordetella pertusis,
Bordatella
parapertusis, Bordetella bronchiseptica, Escherichia coli, Shigella
dysenteriae, Haemophilus
influenzae, Haemophilus aegyptius, Haemophilus parainfluenzae, Haemophilus
ducreyi,
Bordetella, Salmonella typhi, Citrobacter freundii, Proteus mirabilis, Proteus
vulgaris, Yersinia
pestis, Kleibsiella pneumoniae, Serratia marcessens, Serratia liquefaciens,
Vibrio cholera,
Shigella dysenteric, Shigella flexneri, Pseudomonas aeruginosa, Franscisella
tularensis, Brucella
abortis, Bacillus anthracis, Bacillus cereus, Clostridium perfringens,
Clostridium tetani,
CA 02396674 2002-06-17
WO 01/46383 PCT/US00/35180
26
Clostridium botulinum, Treponema pallidum, Rickettsia rickettsii and Chlamydia
trachomitis,
(ii) an archaeon, including but not limited to Archaebacter, and (iii) a
unicellular or filamenous
eukaryote, including but not limited to, a protozoan, a fungus, a member of
the genus
Saccharomyces, Kluveromyces, or Candida, and a member of the species
Saccharomyces
ceriviseae, Kluveromyces lactis, or Candida albicans.
As used herein, the term "recombinant expression system(s)" refers to a system
in which
vectors comprising sequences encoding polypeptides of the invention or
portions thereof, or
polynucleotides of the invention are introduced or transformed into a host
cell or host cell lysate
for the production of the polynucleotides and polypeptides of the invention.
As used herein, the term "artificially synthesized" when used in reference to
a peptide,
polypeptide or polynucleotide means that the amino acid or nucleotide subunits
were chemically
joined in vitro without the use of cells or polymerizing enzymes. The
chemistry of
polynucleotide and peptide synthesis is well known in the art.
In addition to the standard single and triple letter representations for amino
acids, the
term "X" or "Xaa" may also be used in describing certain polypeptides of the
invention. "X" and
"Xaa" mean that any of the twenty naturally occurring amino acids may appear
at such a
designated position in the polypeptide sequence.
As used herein, the term "specifically binding" in the context of the
interaction of two
polypeptides means that the two polypeptides physically interact via discrete
regions or domains
on the polypeptides, wherein the interaction is dependent upon the amino acid
sequences of the
interacting domains. Generally, the equilibrium binding concentration of a
polypeptide that
specifically binds another is in the range of about 1 p.M or lower, preferably
100 nM or lower, 10
nM or lower, 1 nM or lower, 100 pM or lower, and even 10 pM or lower.
As used herein, the term "decrease in the binding" refers to a drop in the
signal that is
generated by the physical association between two polypeptides under one set
of conditions
relative to the signal under another set of reference conditions. The signal
is decreased if it is at
least 10% lower than the level under reference conditions, and preferably 20%,
40%, 50%, 75%,
90%, 95% or even as much as 100% lower (i.e., no detectable interaction).
As used herein, the term "detectable marker", when used in the context of a
yeast two-
hybrid assay, refers to a polypeptide that confers a trait upon a cell
expressing that polypeptide
that signals the presence or amount of that polypeptide expressed. Detectable
markers are
encoded on plasmids that may exist episomally or may be integrated into the
genome of a host
cell. Detectable markers include, but are not limited to, polypeptides
encoding enzymes
allowing colorimetric or fluorescent detection (e.g., E. coli LacZ, which
catalyzes the conversion
CA 02396674 2002-06-17
WO 01/46383 PCT/US00/35180
27
of the substrate analog X-gal to generate a blue color), polypeptides encoding
enzymes
conferring antibiotic resistance, and polypeptides encoding enzymes conferring
the ability of a
yeast strain to grow on medium lacking a given component (i.e., critical for
the relief of
auxotrophy).
As used herein, the term "results in the expression of a detectable marker"
means that the
interaction of factors necessary to permit the expression of a detectable
marker (e.g., two-hybrid
transactivation domain and DNA binding domain fusion proteins) causes the
transactivation and
translation of detectable levels of a detectable marker. A "detectable level"
is that level of
expression that can be differentiated from background expression occurring in
the substantial
absence of one or more factors or conditions necessary for marker expression.
Detectable levels
will vary depending upon the nature of the detectable marker, but will
generally consist of levels
at least about 10% or more greater than the background level of a given
marker.
As used herein, the term "decrease in the expression" refers to a drop in the
expression of
a detectable marker under one set of conditions relative to the expression
under another set of
reference conditions. The expression of a detectable marker is decreased if it
is at least 10%
lower than the level under reference conditions, and preferably 20%, 40%, 50%,
75%, 90%, 95%
or even as much as 100% lower (i.e., not expressed).
How to Identify a S. aureus dnaI sequence:
Using methodology described in detail in Example 1 and 2, a S. aureus
polypeptide that
specifically bound the bacterial growth inhibitory 77 phage ORF 104 protein
was isolated.
Briefly, the 770RF 104 protein was used as a ligand in an affinity
chromatography binding step
with S. aureus protein extract. The selected S. aureus interacting polypeptide
was purified and
further analyzed by tryptic digestion and mass spectrometry. The sequence of a
tryptic peptide of
the S. au~eus polypeptide, GHVPENVTDNDR (SEQ ID NO: 10), was used to BLAST
search
the S. aureus nucleotide sequence in the University of Oklahoma S. aureus
genomic database at
http://www.genome.ou.edu/staph.html. One sequence contig of 4850 nucleotides
in length
(Contig 981), when converted into amino acid sequence, contained within it the
similar amino
acid sequence GHVPELYVDNNR (SEQ ID NO: 11; Fig. 5). This tentative
identification of the
candidate protein was then conErmed upon ih silico tryptic digestion of the
open reading frame
found in the contig (Fig. 5). The obtained PSD/CID spectra for tryptic
peptides with
monoisotopic MH+ masses of 1351.8, 1412.7, and 1617.8 Da were similar to the
predicted
PSD/CID fragmentation patterns of the tryptic peptides with monoisotopic MH+
masses of
1351.8 and 1617.8 Da found in the contig's +3 open reading frame (Fig. 5).
CA 02396674 2002-06-17
WO 01/46383 PCT/US00/35180
28
Comparison of the ORF of the S. aureus contig that encodes a tryptic peptide
similar to
that identified in the S. aureus phage 77 ORF 104 binding studies with all
other sequences in the
public domain databases revealed that the ORF is related to the DnaI protein
from Bacillus
subtilis (Table 1) a protein implicated in chromosome replication. No other
significant similarity
was found with any other protein in publicly accessible databases. The degree
of relatedness of
the identified ORF to the B. subtilis DnaI protein shows 41% identity and 63%
similarity (Table
1).
Many genes of B. subtilis involved in DNA replication have been identified
through the
isolation of thermosensitive mutants. One of these, dnaI2, affected an unknown
step of
chromosome replication at the restrictive temperature (Karamata, D. and Gross,
J.D. (1970) Mol.
Gene. Genet. 108, 277-287). The gene was mapped around 250° on the B
subtilis chromosome
and resides immediately downstream of the dnaB gene on the B. subtilis
chromosome (Bruand,
C. and Ehrlich, S.D. (1995) Microbiology 141, 1199-1200). The dnaI2 mutation
has been
characterized and resides within the dnaI gene and consists of a G to A
substitution at nucleotide
position 922 (Fig. 1; SEQ ID NO: 1) resulting in a glycine to glutamate change
at position 307
(Fig. 1; SEQ ID NO: 2) (Bruand, C. and Ehrlich, S.D. (1995) Microbiology 141,
1199-1200).
DnaC has been genetically identified to be the major component DNA helicase of
chromosome replication (Sakamoto, Y., Nakai, S., Moriya, S., Yoshikawa, H.,
and Ogasawara,
N. (1995) Microbiology 141, 641-644) and is thought to unwind duplex DNA
progressively and
allow for binding of the DNA polymerase III holoenzyme necessary for priming
and DNA
synthesis. One possible function of DnaI is as a helicase loader, being
responsible for
transferring DnaC helicase to the oriC. The product of the dnaC and dnaI genes
are required for
chromosome replication and are all essential for DNA replication in B.
subtilis (Ceglowski, P.,
Lurz, R., Alonso, J.C.J. (1993) Mol. Biol. 236, 1324-1340).
Databases were searched for S. aureus genes which may be related to the B.
subtilis dnaC
gene. Utilizing the B. subtilis amino acid sequence for DnaC (Accession Number
P37469), a
BLAST search was performed of the Staphylococcus database at
http://www.tigr.org and
revealed the presence of an ORF within the S. aureus genome encoding a related
protein. The
nucleotide sequence and corresponding protein sequence are presented in Fig.
6A (SEQ ID NO:
7) and Fig. 6B (SEQ ID NO: 9), respectively.
Identification of the surface of interaction on DnaI
This invention relates, in part, to a specific interaction between a growth-
inhibitory
protein encoded by the Staphylococcus aureus bacteriophage 77 genome and an
essential S.
aureus protein. This interaction forms the basis for drug screening assays.
More specifically, the
CA 02396674 2002-06-17
WO 01/46383 PCT/US00/35180
29
invention relates to the interacting regions of the protein encoded by the S.
au~eus bacteriophage
77 and the S. au~eus DnaI proteins, forming the basis for screening assays.
The invention
provides a method for the identification of DnaI polypeptide fragments that
are involved in said
interaction between DnaI and ORF 104 from bacteriophage 77. Several approaches
and
techniques known to those skilled in the art can be used to identify and to
characterize fragments
of the DnaI interacting with 77 ORF 104. These 'fragments may include, for
example, truncation
polypeptides having a portion of an amino acid sequence of the proteins, or
variants thereof, such
as a continuous series of residues that includes an amino- and/or carboxyl-
terminal amino acid
sequence for DnaI.
A, Affinity ChromatographX
Partial proteolysis of proteins in solution is one method to delineate the
domain
boundaries in mufti-domain proteins. By subjecting proteins to limited
digestion, the most
accessible cleavage sites are preferentially hydrolyzed. These cleavage sites
preferentially reside
in less structured regions which include loops and highly mobile areas typical
of the joining
amino acids between highly structured domains. For this analysis, a purred
recombinant DnaI
polypeptide (including a fragment of DnaI either purified from a previous
protease digestion or
expressed from a recombinant nucleic acid vector as a. fragment) can be
subjected to partial
proteolysis. The proteolysis can be performed with low concentrations of
proteases, including,
but not limited to trypsin, chymotrypsin, endoproteinase Glu-C, and Asp-N with
a DnaI
polypetide in solution, resulting in the generation of defined proteolytic
products as observed by
SDS-PAGE. An acceptable concentration and reaction time is defined by the near
complete
conversion of the full-length protein to stable proteolytic products. The
partial proteolytic
fragments are then subjected to affinity chromatography with immobilized 77
ORF 104 to
determine the region of the DnaI polypeptide containing the 77 ORF 104 binding
site. Interacting
domains are identified by mass spectrometry to determine the masses of both
the intact fragment
and the series of fragments from a tryptic digest to identify the amino acid
residues contained
within the partial proteolytic fragment. Using both sets of data, the amino
acid sequence of the
partial proteolytic fragment can be precisely determined.
Bl Yeast two-hybrid analvsis
The interaction between 77 ORF 104 and portions of the DnaI polypeptide can
also be
assessed i~z vivo using the yeast two hybrid system. To do this, bacteriophage
77 ORF 104 is
fused to the DNA binding domain of the yeast transcriptional transactivator
Gal4, and different
portions of the DnaI polypeptide are fused to the carboxyl terminus of the
Gal4 activation
CA 02396674 2002-06-17
WO 01/46383 PCT/US00/35180
domain. The two plasmids bearing such constructs can be introduced
sequentially, or in
combination, into a yeast cell line, for example AH109 (Clontech
Laboratories), previously
engineered to contain chromosomally-integrated copies of E. coli lacZ and the
selectable HIS3
and ADE2 genes. The lacZ, HIS, and ADE2 reporter genes, each driven by a
promoter containing
5 Gal4 binding sites, are used for measuring protein-protein interactions. If
the two recombinant
proteins interact within the yeast cell, the resulting protein:protein complex
activates
transcription from promoters containing Gal4 binding sites. Expression of
HIS3, and ADE2
genes is manifested by relief of histidine and adenine auxotrophy. As
described in the examples
below, full length DnaI, as well as DnaI fragments, was found to interact with
bacteriophage 77
10 ORF 104 fusion polypeptides using this system.
Further elucidation of the bacteriophage 77 ORF 104 interacting domain of DnaI
can be
carried out by first subjecting the full length DnaI polypeptide to deletional
mutagenesis, the
methods of which are known to those of skill in the art. The mutated DnaI
polypeptides can then
be subjected to yeast two hybrid analysis as described above, to further
narrow those amino acid
15 sequences or polypeptide fragments, for example, those within SEQ ID NO:
16, that are required
for the binding of DnaI to bacteriophage 77 ORF 104.
~, aureus DnaI poly~entides
In one aspect of the invention there are provided polypeptides of S. aureus
referred to
herein as "DnaI" and "DnaI polypeptides" as well as biologically,
diagnostically,
20 prophylactically, clinically or therapeutically useful variants thereof,
and compositions
comprising the same.
Among the particularly preferred embodiments of the invention are variants of
S. aureus
DnaI polypeptides encoded by naturally occurring alleles of the dnaI gene. The
present invention
provides for an isolated polypeptide which comprises or consists of (a) an
amino acid sequence
25 which has at least 50% identity, preferably at least 80% identity, more
preferably at least 90%,
yet more preferably at least 95%, most preferably at least 97-99% or exact
identity, to that of
SEQ ID N0:2 over the entire length of SEQ ID NO: 2 or b) an amino acid
sequence that has at
least 70% similarity, at least 80%~ similarity, at least 90% similarity, at
least 95% similarity, at
least 97-99% similarity or even 100% similarity over the entire length of SEQ
ID NO: 2.
30 The polypeptides of the invention include a polypeptide of Fig. 1 (SEQ ID
NO: 2) (in
particular the mature polypeptide) as well as polypeptides and fragments,
particularly those
which have the biological activity of DnaI, and also those which have at least
50% identity over
20, 40, 50 or more amino acids to a polypeptide of SEQ ID NO: 2 or the
relevant portion,
preferably at least 60%, 70%, or 80% identity, more preferably at least 90%
identity to a
CA 02396674 2002-06-17
WO 01/46383 PCT/US00/35180
31
polypeptide of SEQ ID NO: 2 and more preferably at least 90% identity to a
polypeptide of
SEQ ID NO: 2 and still more preferably at least 95% identity to a polypeptide
of SEQ ID NO: 2
and yet still more preferably at least 99% identity to a polypeptide of SEQ ID
NO: 2.
The polypeptides of the invention also include a polypeptide or protein
fragment that has
at least 60%, 70%, 80% or 90% similarity, 95% similarity or even 97-99%
similarity over 10, 20,
25, 30 or more amino acids to a polypeptide of SEQ ID NO: 2. It is preferred
that a polypeptide
of the invention has at least 60% similarity to a polypeptide of SEQ ID NO: 2
over at least 20
amino acids.
It is most preferred that a polypeptide of the invention is derived from S.
aureus,
however, it may be obtained from other organisms of the same taxonomic genus.
A polypeptide
of the invention may also be obtained, for example, from organisms of the same
taxonomic
family or order.
Fragments of DnaI also are included in the invention. These fragments may
include, for
example, truncation polypeptides having a portion of an amino acid sequence of
Fig. 1 (SEQ ID
NO: 2), or variants thereof, such as a continuous series of residues that
includes an amino- and/or
carboxyl-terminal amino acid sequence. Degradation forms of the polypeptides
of the invention
produced by or in a host cell, particularly S aureus, are also preferred.
Further preferred are
fragments characterized by structural or functional attributes such as
fragments that comprise
alpha-helix and alpha-helix-forming regions, beta-sheet and beta-sheet-forming
regions, turn and
turn-forming regions, coil and coil-forming regions, hydrophilic regions,
hydrophobic regions,
alpha amphipathic regions, beta amphipathic regions, flexible regions, surface-
forming regions,
substrate binding region, and high antigenic index regions: Fragments of Dnal
may be expressed
as fusion proteins with other proteins or protein fragments.
Preferred fragments also include an isolated polypeptide comprising an amino
acid
sequence having at least 20, 30, 40, 50, or 100 contiguous amino acids from
the amino acid
sequence of SEQ ID NO: 2.
Also preferred are biologically "active" fragments which are those fragments
that
mediate activities of S. aureus DnaI, including those with a similar activity
or an improved
activity, or with a decreased undesirable activity. Also included are those
fragments that are
antigenic or immunogenic in an animal, especially in a human. Particularly
preferred are
fragments comprising domains that confer a function essential for viability of
S. au~eus.
Fragments of the polypeptides of the invention may be employed for producing
the
corresponding full-length polypeptide by peptide synthesis; therefore, these
variants may be
employed as intermediates for producing the full-length polypeptides of the
invention.
CA 02396674 2002-06-17
WO 01/46383 PCT/US00/35180
32
S. aureus Polynucleotides
It is an object of the invention to provide polynucleotides that encode DnaI
polypeptides,
particularly polynucleotides that encode the polypeptide herein designated S.
aureus DnaI.
In one aspect of the invention a polynucleotide is provided that comprises a
region
encoding a S. au~eus DnaI polypeptide, the polynucleotide comprising a
sequence set out in
SEQ ID NO: 1. Such a polynucleotide encodes a full length DnaI gene, or a
variant thereof. It is
contemplated that this full-length gene is essential to the growth and/or
survival of an organism
which possesses it, such as S. au~eus.
As a further aspect of the invention there are provided isolated nucleic acid
molecules
encoding and/or expressing a fragment of a full-length DnaI polypeptide,
particularly a S. aureus
DnaI polypeptide or a variant thereof. Further embodiments of the invention
include
biologically, diagnostically, prophylactically, clinically or therapeutically
useful polynucleotides
and polypeptides, and variants thereof, and compositions comprising the same.
A polynucleotide of the invention is obtained using S aureus cells as starting
material,
the nucleotide sequence information disclosed in SEQ ID NO: 1, and standard
cloning and
screening methods, such as those for cloning and sequencing chromosomal DNA
fragments from
bacteria. For example, to obtain a polynucleotide sequence of the invention,
such as the
polynucleotide sequence disclosed as in SEQ ID NO: 1, a library of clones of
chromosomal
DNA of S. aureus in E. coli or another suitable host is probed with a
radiolabeled
oligonucleotide, preferably a 17-mer or longer, derived from a partial
sequence. Clones carrying
DNA identical to that of the probe can be distinguished using stringent
hybridization conditions.
As herein used, the terms "stringent conditions" and "stringent hybridization
conditions" mean
hybridization occurring only if there is at least 95% and preferably at least
97% identity between
the sequences. A specific example of stringent hybridization conditions is of
a overnight
incubation of a hybridization support (e.g., a nylon or nitrocellulose
membrane at 42°C in a
solution comprising: 1 X 106 cpm/ml labeled probe, 50% formamide, Sx SSC
(150mM NaCI,
lSmM trisodium citrate), 50 mM sodium phosphate (pH7.6), Sx Denhardt's
solution, 10%
dextran sulfate, and 20 micrograms/ml of denatured, sheared salmon sperm DNA,
followed by
washing the hybridization support in O.lx SSC at about 65°C.
Hybridization and wash conditions
are well known to those skilled in the art and are exemplified in Sambrook, et
al., Molecular
Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor, N.Y.,
(1989), particularly
Chapter 11 therein. Solution hybridization may also be used with the
polynucleotide sequences
provided by the invention. By sequencing the individual clones thus identified
by hybridization,
it is possible to confirm the identity of the clone.
CA 02396674 2002-06-17
WO 01/46383 PCT/US00/35180
33
Alternatively, an amplification process can be utilized to isolate the
polynucleotide. In
this approach, the sequence disclosed as SEQ ID NO: 1 is targeted by two
oligonucleotides, one
identical to a sequence on the coding DNA strand at or upstream of the ATG
initiation codon and
the other which anneals to the opposite strand at or downstream of the stop
codon. Priming from
these oligonucleotides in a polymerase chain reaction yields a full length
gene coding sequence.
Such suitable techniques are described by Maniatis, T., Fritsch, E.F. and
Sambrook,
MOLECULAR CLONING: A LABORATORY MANUAL, 2"d Edition, Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, N.Y. (1989).
In a further aspect, the present invention provides for an isolated
polynucleotide
comprising or consisting of (a) a polynucleotide sequence which has at least
60% identity,
preferably at least 70% identity, more preferably at least 80% identity, more
preferably at least
90% identity, yet more preferably at least 95%, most preferably at least 97-
99% or exact identity,
to that of SEQ ID NO: 1 over the entire length of SEQ ID NO: 1; (b) a
polynucleotide sequence
encoding a polypeptide which has at least 50% identity, preferably at least
60% identity, more
preferably at least 70% identity, more preferably at least 80% identity, more
preferably at least
90%, yet more preferably at least 95%, most preferably at least 97-99% or
exact identity to SEQ
ID N0:2 over the entire length of SEQ ID N0:2; or the complement of a sequence
of (a) or (b)
above.
The invention provides a polynucleotide sequence identical over its entire
length to the
coding sequence of SEQ ID NO: 1. Also provided by the invention is a coding
sequence for a
mature polypeptide or a fragment thereof (Including, for example, a fragment
encoding a
polypeptide of SEQ ID NO: 16), by itself as well as a coding sequence for a
mature polypeptide
or a fragment in reading frame with another coding sequence, such as a
sequence encoding a
leader or secretory sequence, a pre-, or pro-, or prepro-protein sequence. The
polynucleotide of
the invention may also contain at least one non-coding sequence, including fox
example, but not
limited to at least one non-coding 5' and 3' sequence, such as the transcribed
but non-translated
sequences, termination signals (such as rho-dependent and rho-independent
termination signals),
ribosome binding sites, Kozak sequences, sequences that stabilize or
destabilize mRNAs,
introns, and polyadenylation signals. The polynucleotide sequence may also
comprise additional
coding sequence encoding additional amino acids. For example, a marker
sequence that
facilitates purification of the fused polypeptide can be encoded. In certain
embodiments of the
invention, the marker sequence is a hexa-histidine peptide, as provided in the
pQE vector
(Qiagen, Inc.) and described in Gentz et al., Proc. Natl. Acad. Sci. 86: 821-
824 (1989), or an HA
peptide tag (Wilson et al., Cell 37: 767 (1984), both of which may be useful
in purifying
CA 02396674 2002-06-17
WO 01/46383 PCT/US00/35180
34
polypeptide sequences fused to them. Polynucleotides of the invention also
include, but are not
limited to, polynucleotides comprising a structural gene and its naturally
associated sequences
that control gene expression.
It is most preferred that a polynucleotide of the invention is derived from
Staphylococcus
au~eus, however, it may also be obtained from other organisms of the same
taxonomic genus. A
polynucleotide of the invention may also be obtained, for example, from
organisms of the same
taxonomic family or order.
Further preferred embodiments are polynucleotides encoding S. au~eus dnaI
variants that
have the amino acid sequence of S au~eus DnaI polypeptide of SEQ ID NO: 2 in
which several,
a few, 5 to 10, 1 to 5, 1 to 3, 2, 1 or no amino acid residues are
substituted, modified, deleted
andlor added, in any combination. Especially preferred among these
polynucleotides are those
encoding silent nucleotide alterations that do not alter the coding sequence
or activities of S.
au~eus DnaI polypeptides they encode.
Preferred embodiments are polynucleotides encoding polypeptides that retain
substantially the same biological function or activity as the mature
polypeptide encoded by a
DNA of SEQ ID NO: 1.
In accordance with certain preferred embodiments of this invention there are
provided
polynucleotides that hybridize, particularly under stringent conditions, to S.
aureus dnaI
polynucleotide sequences, such as those polynucleotides in Fig. 1.
The polynucleotides of the invention are useful as hybridization probes for
RNA, cDNA
and genomic DNA to isolate full-length cDNAs and genomic clones encoding genes
that have a
high degree of sequence identity to the dnaI gene. Such probes generally will
comprise at least
15 to about 100 residues or base pairs, although such probes will preferably
have about 20 to 50
nucleotide residues or base pairs. Particularly preferred probes are about 20
to about 30
nucleotide residues or base pairs in length.
A coding region of a related dnaI gene from a bacterial species other than S.
aureus may
be isolated by screening a library using a DNA sequence provided in SEQ ID NO:
1 to
synthesize an oligonucleotide probe. A labeled oligonucleotide having a
sequence
complementary to that of a gene of the invention is then used to screen a
library of cDNA,
genomic DNA or mRNA to determine to which members) of the library the probe
hybridizes.
There are several methods available and well known to those skilled in the art
to obtain
full-length DNAs, or extend short DNAs, for example those based on the method
of Rapid
Amplification of cDNA ends (RACE) (see, for example, Frohman, et al., PNAS USA
85: 8998-
9002, 1988). Recent modifications of the technique, exemplified by the
MARATHON TM
CA 02396674 2002-06-17
WO 01/46383 PCT/US00/35180
technology (Clontech Laboratories Inc.) for example, have significantly
simplified the search for
longer cDNAs. In the MARATHON TM technology, cDNAs are prepared from mRNA
extracted from a chosen cell and an'adaptor' sequence is ligated onto each
end. Nucleic acid
amplification by PCR is then carried out to amplify the "missing" 5' end of
the DNA using a
5 combination of gene specific and adaptor specific oligonucleotide primers.
The PCR reaction is
then repeated using "nested" primers, that is, primers designed to anneal
within the amplified
product (typically an adaptor-specific primer that anneals further 3' in the
adaptor sequence and a
gene-specific primer that anneals further 5' in the selected gene sequence).
The products of this
reaction can then be analyzed by DNA sequencing and a full-length DNA
constructed either by
10 joining the product directly to the existing DNA to give a complete
sequence, or by carrying out
a separate full-length PCR using the new sequence information for the design
of the 5' primer.
The polynucleotides and polypeptides of the invention may be employed, for
example, as
research reagents and materials for discovery of treatments of and diagnostics
for diseases,
particularly human diseases, as further discussed herein relating to
polynucleotide assays.
15 The polynucleotides of the invention that are oligonucleotides derived from
a sequence of
SEQ ID NO:1 are useful for the design of PCR primers in reactions to determine
whether or not
the polynucleotides identified herein in whole or in part are transcribed in
bacteria in infected
tissue. That is, the polynucleotides of the invention are useful for diagnosis
of infection with a
bacterial strain carrying those sequences. It is recognized that such
sequences also have utility in
20 diagnosis of the stage of infection and type of infection the pathogen has
attained.
The invention also provides polynucleotides that encode a polypeptide that is
the mature
protein plus additional amino or carboxyl-terminal amino acids, or amino acids
interior to the
mature polypeptide. Such sequences may play a role in processing of a protein
from precursor to
a mature form, may allow protein transports may lengthen or shorten protein
half life or may
25 facilitate manipulation of a protein for assay or production, among other
things. As generally is
the case in vivo, the additional amino acids may be processed away from the
mature protein by
cellular enzymes.
A precursor protein, having a mature form of the polypeptide fused to one or
more
prosequences may be an inactive form of the polypeptide. When prosequences are
removed such
30 inactive precursors generally are activated. Some or all of the
prosequences may be removed
before activation. Generally, such precursors axe called proproteins.
A polynucleotide of the invention thus may encode a mature protein, a mature
protein
plus a leader sequence (which may be referred to as a preprotein), a precursor
of a mature protein
having one or more prosequences that are not the leader sequences of a
preprotein, or a
CA 02396674 2002-06-17
WO 01/46383 PCT/US00/35180
36
preproprotein, which is a precursor to a proprotein, having a leader sequence
and one or more
prosequences, which generally are removed during processing steps that produce
active and
mature forms of the polypeptide.
In addition to the standard A, G, C, T/U representations for nucleotides, the
term "N"
may also be used in describing certain polynucleotides of the invention. "N"
means that any of
the four DNA or RNA nucleotides may appear at such a designated position in
the DNA or RNA
sequence, except it is preferred that N is not a nucleotide that when taken in
combination with
adjacent nucleotide positions, read in the correct reading frame, would have
the effect of
generating a premature termination codon in such reading frame.
For each and every polynucleotide of the invention there is also provided a
polynucleotide complementary to it.
Vectors. Host Cells. and Expression S s_, t~ ems
The invention also relates to vectors that comprise a polynucleotide or
polynucleotides of
the invention, host cells that are genetically engineered with vectors of the
invention and the
production of polypeptides of the invention by recombinant techniques. Cell-
free translation
systems can also be employed to produce such proteins using RNAs derived from
the DNA
constructs of the invention
Recombinant DnaI polypeptides of the present invention may be prepared by
processes
well known to those skilled in the art from genetically engineered host cells
comprising
expression systems. Accordingly, in a further aspect, the present invention
relates to expression
systems that comprise a dnaI polynucleotide or polynucleotides of the present
invention, to host
cells which are genetically engineered with such expression systems, and to
the production of
polypeptides of the invention by recombinant techniques.
For recombinant production of DnaI polypeptides of the invention, host cells
can be
genetically engineered to incorporate expression systems or portions thereof
or polynucleotides
of the invention. Representative examples of appropriate hosts include
bacterial cells (Gram
positive and Gram negative), fungal cells, insect cells, animal cells and
plant cells.
Polynucleotides are introduced to bacteria by standard chemical treatment
protocols, such as the
induction of competence to take up DNA by treatment with calcium chloride
(Sambrook et al.,
supra). Introduction of polynucleotides into fungal (e.g., yeast) host cells
is effected, if desired,
by standard chemical methods, such as lithium acetate - mediated
transformation.
A great variety of expression systems are useful to produce DnaI polypeptides
of the
invention. Such vectors include among others, chromosomal-, episomal- and
virus-derived
vectors. For example, vectors derived from bacterial plasmids, from
bacteriophages, from
CA 02396674 2002-06-17
WO 01/46383 PCT/US00/35180
37
transposons, from yeast episomes, from insertion elements, from yeast
chromosomal elements,
from viruses, and from vectors derived from combinations thereof, are useful
in the invention.
DnaI polypeptides of the invention are recovered and purified from recombinant
cell
cultures by well-known methods including ammonium sulfate or ethanol
precipitation, acid or
urea extraction, anion or cation exchange chromatography, phosphocellulose
chromatography,
hydrophobic interaction chromatography, affinity chromatography,
hydroxylapatite
chromatography, and lectin chromatography. Well known techniques for refolding
may be
employed to regenerate an active conformation when the DnaI polypeptide is
denatured during
isolation and/or purification.
Dia nostic. Pro n~ostic. Serotyping. and Mutation Assays
This invention is also related to the use of dnaI polynucleotides and
polypeptides of the
invention for use as diagnostic reagents. Detection of S. aureus dnaI
polynucleotides and/or
polypeptides in a eukaryote, particularly a mammal, and especially a human,
will provide a
diagnostic method for diagnosis of disease, staging of disease or response of
an infectious
organism to drugs. Eukaryotes, particularly mammals, and especially humans,
particularly those
infected or suspected to be infected with an organism comprising the S aureus
dnaI gene or
protein, may be detected at the nucleic acid or amino acid level by a variety
of well known
techniques as well as by methods provided herein.
Polypeptides and polynucleotides for prognosis, diagnosis or other analysis
may be
obtained from a putatively infected and/or infected individual's bodily
materials. Polynucleotides
from any of these sources, particularly DNA or RNA, may be used directly for
detection or may
be amplified enzymatically by using PCR or any other amplification technique
prior to analysis.
RNA, particularly mRNA, cDNA and genomic DNA may also be used in the same
ways. Using
amplification, characterization of the species and strain of infectious or
resident organism present
in an individual, may be made by an analysis of the genotype of a selected
polynucleotide of the
organism. Deletions and insertions can be detected by a change in size of the
amplified product
in comparison to a genotype of a reference sequence selected from a related
organism, preferably
a different species of the.same genus or a different strain of the same
species. Point mutations
can be identified by hybridizing amplified DNA to labeled dnaI polynucleotide
sequences.
Perfectly or significantly matched sequences can be distinguished from
imperfectly or more
significantly mismatched duplexes by DNase or RNase digestion, for DNA or RNA
respectively,
or by detecting differences in melting temperatures or renaturation kinetics.
Polynucleotide
sequence differences may also be detected by alterations in the
electrophoretic mobility of
polynucleotide fragments in gels as compared to a reference sequence. This may
be carried out
CA 02396674 2002-06-17
WO 01/46383 PCT/US00/35180
38
with or without denaturing agents. Polynucleotide differences may also be
detected by direct
DNA or RNA sequencing. See, for example, Myers et al, (1985) Science 230,
1242. Sequence
changes at specific locations also may be revealed by nuclease protection
assays, such as RNase,
V 1 and S 1 protection assay or a chemical cleavage method. See, for example,
Cotton et al.,
(1985) Proc. Natl. Acad. Sci., USA 85, 4397-4401.
In another embodiment, an array of oligonucleotide probes comprising dnaI
nucleotide
sequence or fragments thereof can be constructed to conduct efficient
screening of, for example,
genetic mutations, serotype, taxonomic classification or identification. Array
technology
methods are well known and have general applicability and can be used to
address a variety of
questions in molecular genetics including gene expression, genetic linkage,
and genetic
variability (see, for example, Chee et al., (1996) Science 274, 610).
Thus in another aspect, the present invention relates to a diagnostic kit
which comprises:
(a) a polynucleotide of the present invention, preferably the nucleotide
sequence of SEQ ID NO:
1, or a fragment thereof ; (b) a nucleotide sequence complementary to that of
(a); (c) a
polypeptide of the present invention, preferably the polypeptide of SEQ ID
N0:2 or a fragment
thereof; or (d) an antibody to a polypeptide of the present invention,
preferably to the
polypeptide of SEQ ID N0:2.
It will be appreciated that in any such kit, (a), (b), (c) or (d) may comprise
a substantial
component. Such a kit will be of use in diagnosing a disease or susceptibility
to a disease, among
others.
This invention also relates to the use of dnaI polynucleotides of the present
invention as
diagnostic reagents. Detection of a mutated form of a polynucleotide of the
invention, preferably,
SEQ ID NO: l, which is associated with a disease or pathogenicity will provide
a diagnostic tool
that can add to, or define, a diagnosis of a disease, a prognosis of a course
of disease, a
determination of a stage of disease, or a susceptibility to a disease, which
results from under-
expression, over-expression or altered expression of the polynucleotide.
Organisms, particularly
infectious organisms, carrying mutations in such polynucleotide may be
detected at the
polynucleotide level by a variety of techniques, such as those described
elsewhere herein.
The dnaI nucleotide sequences of the present invention are also valuable for
organism
chromosome identification. The sequence is specifically targeted to, and can
hybridize with, a
particular location on an organism's chromosome, particularly to a S. aureus
chromosome. The
mapping of relevant sequences to chromosomes according to the present
invention may be an
important step in correlating those sequences with pathogenic potential and/or
an ecological
niche of an organism andlor drug resistance of an organism, as well as the
essentiality of the
CA 02396674 2002-06-17
WO 01/46383 PCT/US00/35180
39
gene to the organism. Once a sequence has been mapped to a precise chromosomal
location, the
physical position of the sequence on the chromosome can be correlated with
genetic map data.
Such data may be found on-line in a sequence database. The relationship
between genes and
diseases that have been mapped to the same chromosomal region are then
identified through
known genetic methods, for example, through linkage analysis (coinheritance of
physically
adjacent genes) or mating studies, such as by conjugation.
The differences in a polynucleotide and/or polypeptide sequence between
organisms
possessing a first phenotype and organisms possessing a different, second
different phenotype
can also be determined. If a mutation is observed in some or all organisms
possessing the first
phenotype but not in any organisms possessing the second phenotype, then the
mutation is likely
to be the causative agent of the first phenotype.
Polypeptides and polynucleotides for prognosis, diagnosis or other analysis
may be
obtained from a putatively infected and/or infected individual's bodily
materials. Particularly
DNA or polynucleotides, from any of these sources may be used directly for
detection or may be
amplified enzymatically using PCR or other amplification technique with
oligonucleotide
amplification primers derived from the polynucleotide sequence of S. aureus
dna 1. RNA,
particularly mRNA, or RNA reverse transcribed to cDNA, is also useful for
diagnostics.
Following amplification of a S au~eus dnaI - related polynucleotide from a
sample,
characterization of the species and strain of infecting or resident organism
is made by an analysis
of the amplified polynucleotide relative to one or more reference
polynucleotides or sequences
relative to a standard from a related organism (i.e. a known strain of S.
aureus).
Point mutations can be identified by hybridizing amplified DNA to known dnaI
polynucleotide sequences and by detecting differences in melting temperatures
or renaturation
kinetics. Perfectly or significantly matched sequences can be distinguished
from imperfectly or
more significantly mismatched duplexes by RNase protection or S1 nuclease
mapping. (See, for
example, Cotton et al., (1988) Proc. Natl. Acad. Sci. USA 85:4397-4401).
Polynucleotide
sequence differences may also be detected by alterations in the
electrophoretic mobility of
polynucleotide fragments in gels as compared to a reference sequence. This may
be carried out
with or without denaturing agents. Polynucleotide differences may also be
detected by direct
DNA or RNA sequencing. See, for example, Myers et al, (1985) Science 230,
1242. Sequence
changes at specific locations also may be revealed by nuclease protection
assays, such as RNase,
V 1 and S 1 protection assay or a chemical cleavage method.(Cotton et al.,
1988 Supra).
In another embodiment, an array of oligonucleotide probes comprising dnaI
nucleotide
sequence or fragments thereof can be constructed to conduct efficient
screening of, for example,
CA 02396674 2002-06-17
WO 01/46383 PCT/US00/35180
genetic mutations, serotype, taxonomic classification or identification. Array
technology
methods are well known and have general applicability and can be used to
address a variety of
questions in molecular genetics including gene expression, genetic linkage,
and genetic
variability (see, for example, Chee et al., (1996) Science 274, 610).
S In another aspect, the present invention relates to a diagnostic kit which
comprises: (a) a
polynucleotide of the present invention, preferably the nucleotide sequence of
SEQ ID NO: 1, or
a fragment thereof; (b) a nucleotide sequence complementary to that of (a);
(c) a polypeptide of
the present invention, preferably the polypeptide of SEQ ID N0:2 or a fragment
thereof; or (d)
an antibody to a polypeptide of the present invention, preferably to the
polypeptide of SEQ ID
10 N0:2. Such a kit will be of use in diagnosing a disease or susceptibility
to a disease, among
other uses.
The invention further provides a process for diagnosing bacterial infections
such as those
caused by S. aureus, the process comprising determining from a sample derived
from an
individual, such as a bodily material, an increased level of expression of a
polynucleotide having
15 a sequence disclosed in SEQ ID NO: 1 relative to a sample taken from a non-
diseased individual.
Increased or decreased expression of a dnaI polynucleotide can be measured
using any one of the
methods well known in the art for the quantitation of polynucleotides, such
as, for example,
PCR, RT-PCR, RNase protection, Northern blotting and other hybridization
methods, and
spectrometry.
20 In addition, a diagnostic assay in accordance with the invention for
detecting over-
expression of DnaI polypeptide compared to normal control tissue samples may
be used to detect
the presence of an infection, for example. Assay techniques that can be used
to determine levels
of a S. aureus DnaI polypeptide, in a sample derived from a host, such as a
bodily material, are
well-known to those of skill in the art. Such assay methods include
radioimmunoassays,
25 competitive-binding assays, Western Blot analysis, antibody sandwich
assays, antibody detection
and ELISA assays.
Griddin~ and Polynucleotide Subtraction of S. aureus Genomic Sequences
The dnaI polynucleotides of the invention may be used as components of
polynucleotide
arrays, preferably high density arrays or grids. These high density arrays are
particularly useful
30 for diagnostic and prognostic purposes. For example, a set of spots each
comprising a different
gene, and further comprising a polynucleotide or polynucleotides of the
invention, may be used
for probing, such as hybridization or nucleic acid amplification, using a
probe obtained or
derived from a bodily sample, to determine the presence a particular
polynucleotide sequence or
related sequence in an individual.
CA 02396674 2003-11-14
41
Antibodies Specific for S. aureus Peptides or PolYpeptides
The DnaI polypeptides and polynucleotides of the invention or variants
thereof, or cells
expressing them are useful as immunogens to produce antibodies immunospecific
for such
polypeptides or polynucleotides, respectively.
In certain preferred embodiments of the invention there are provided
antibodies against S.
aureus DnaI polypeptides or polynucleotides encoding them. Antibodies against
DnaI-
polypeptide or dnaI-polynucleotide are useful for treatment of infections,
particularly bacterial
infections.
Antibodies generated against the polypeptides or polynucleotides of the
invention are
obtained by administering the polypeptides and/or polynucleotides of the
invention or epitope-
bearing fragments of either or both, analogues of either or both, or cells
expressing either or
both, to an animal, preferably a nonhuman, using routine protocols. For
preparation of
monoclonal antibodies, any technique known in the art that provides antibodies
produced by
continuous cell line cultures is useful. Examples include various techniques,
such as those in
Kohler, G. and Milstein, C., Nature 256: 495-497 (1975); Kozbor et al.,
Immunology Today 4:
72 (1983); and Cole et al., pg. 77-96 in MONOCLONAL ANTIBODIES AND CANCER
THERAPY, Alan R. Liss, Inc. (1985).
Techniques for the production of single chain antibodies (U.S. Patent No.
4,946,778) can
be adapted to produce single chain antibodies to polypeptides or
polynucleotides of this
invention. Also, transgenic mice, or other mammals, are useful to express
humanized antibodies
immunospecific to the polypeptides or polynucleotides of the invention.
When antibodies are administered therapeutically, the antibody or variant
thereof is
preferably modified to make it less immunogenic in the individual. For
example, if the individual
is human the antibody is most preferably "humanized," where the
complementarity determining
region or regions of the hybridoma-derived antibody has been transplanted into
a human
monoclonal antibody, for example as described in Jones et al. (1986), Nature
321, 522-525 or
Tempest et al., (1991) Biotechnology 9, 266-273.
Alternatively, phage display technology is useful to select antibody genes
with binding
activities towards a DnaI polypeptide of the invention. In one approach,
antibody fragments
specific for S. aureus DnaI are selected from an immune library of antibody
genes expressed as
fusions with coat protein of filamentous phage. Alternatively, naive libraries
are screened by
phage display techniques to identify genes encoding antibodies specific for
DnaI or from naive
libraries (McCafferty, et al., (1990), Nature 348, 552-554; Marks, et al.,
(1992) Biotechnology
10, 779-783; a recent reference is de Haard et al. (1999) J Biol Chem 274:
18218-18230). The
CA 02396674 2002-06-17
WO 01/46383 PCT/US00/35180
42
ability to recover, for various targets, antibodies with subnanomolar
affinities obviates the need
for immunization. The affinity of these antibodies can also be improved by,
for example, chain
shuffling (Clackson et al., (1991) Nature 352: 628).
The above-described antibodies may be employed to isolate or to identify
clones
expressing the polypeptides or polynucleotides of the invention, for example
to purify the
polypeptides or polynucleotides by immunoaffinity chromatography.
A variant polypeptide or polynucleotide of the invention, such as an
antigenically or
immunologically equivalent derivative or a fusion protein of the polypeptide
is also useful as an
antigen to immunize a mouse or other animal such as a rat or chicken. A fused
protein provides
stability to the polypeptide acting as a carrier, or acts as an adjuvant or
both. Alternatively, the
antigen is associated, for example by conjugation, with an immunogenic carrier
protein, such as
bovine serum albumin, keyhole limpet haemocyanin or tetanus toxoid.
Alternatively, when
antibodies are to be administered therapeutically, alternatively a multiple
antigenic polypeptide
comprising multiple copies of the polypeptide, or an antigenically or
immunologically equivalent
polypeptide thereof may be sufficiently antigenic to improve immunogenicity so
as to obviate
the use of a carrier.
In accordance with an aspect of the invention, there is provided the use of a
dnaI
polynucleotide of the invention for therapeutic or prophylactic purposes, in
particular genetic
immunization. The use of a dnaI polynucleotide of the invention in genetic
immunization
preferably employs a suitable delivery method such as direct injection of
plasmid DNA into
muscles (Wolff et al., Hum Mol Genet (1992) 1: 363, Manthorpe et al., Hum.
Gene Ther. (1983)
4: 419), delivery of DNA complexed with specific protein carriers (Wu et al.,
J. Biol. Chem.
(1989) 264: 16985), coprecipitation of DNA with calcium phosphate (Benvenisty
& Reshef,
PNAS USA, (1986) 83: 9551), encapsulation of DNA in various forms of liposomes
(Kaneda et
al., Science (1989) 243: 375), particle bombardment (Tang et al., Nature
(1992) 356:152,
Eisenbraun et al., DNA Cell Biol (1993) 12: 791) or in vivo infection using
cloned retroviral
vectors (Seeger et al., PNAS USA (1984) 81: 5849).
Antagonists and Agonists: Assays and Molecules
The invention is based in part on the discovery that DnaI is a target for the
bacteria phage
770RF104 inhibitory factor. Applicants have recognized the utility of the
interaction in the
development of antibacterial agents. Specifically, the inventors have
recognized that 1) DnaI is a
critical target for bacterial inhibition; 2) 770RF 104 or derivatives or
functional mimetics thereof
are useful for inhibiting bacterial growth; and 3) the interaction between
dnaI and of S. aureus
and 770RF104 may be used as a target for the screening and rational design of
drugs or
CA 02396674 2002-06-17
WO 01/46383 PCT/US00/35180
43
antibacterial agents. In addition to methods of directly inhibiting DnaI
activity, methods of
inhibiting DnaI expression are also attractive for antibacterial activity.
In several embodiments of the invention, there are provided methods for
identifying
compounds which bind to or otherwise interact with and inhibit or activate an
activity or
expression of a polypeptide and/or polynucleotide of the invention comprising:
contacting a
polypeptide andlor polynucleotide of the invention with a compound to be
screened under
conditions to permit binding to or other interaction between the compound and
the polypeptide
and/or polynucleotide to assess the binding to or other interaction with the
compound, such
binding or interaction preferably being associated with a second component
capable of providing
a detectable signal in response to the binding or interaction of the
polypeptide and/or
polynucleotide with the compound; and determining whether the compound binds
to or
otherwise interacts with and activates or inhibits an activity or expression
of the polypeptide
and/or polynucleotide by detecting the presence or absence of a signal
generated from the
binding or interaction of the compound with the polypeptide and/or
polynucleotide.
Potential antagonists include, among others, small organic molecules,
peptides,
polypeptides and antibodies that bind to a polynucleotide and/or polypeptide
of the invention and
thereby inhibit or extinguish its activity or expression. Potential
antagonists also may be small
organic molecules, a peptide, a polypeptide such as a closely related protein
or antibody that
binds the same sites on a binding molecule, such as a binding molecule,
without inducing dnaI-
induced activities, thereby preventing the action or expression of S. aureus
DnaI polypeptides
and/or polynucleotides by excluding S. aureus DnaI polypeptides and/or
polynucleotides from
binding.
Potential antagonists also include a small molecule that binds to and occupies
the binding
site of the polypeptide thereby preventing binding to cellular binding
molecules, such that
normal biological activity is prevented. Examples of small molecules include
but are not limited
to small organic molecules, peptides or peptide-like molecules. Other
potential antagonists
include antisense molecules (see Okano, (1991) J. Neurochem. 56, 560; see also
OLIGODEOXYNUCLEOTIDES AS ANTISENSE INHIBITORS OF GENE EXPRESSION,
CRC Press, Boca Raton, FL (1988), for a description of these molecules).
Preferred potential
antagonists include compounds related to and variants of 770RF104 and of DnaI.
Other
examples of potential polypeptide antagonists include antibodies or, in some
cases,
oligonucleotides or proteins which are closely related to the ligands,
substrates, receptors,
enzymes, etc., as the case may be, of the polypeptide, e.g., a fragment of the
ligands, substrates,
CA 02396674 2002-06-17
WO 01/46383 PCT/US00/35180
44
receptors, enzymes, etc.; or small molecules which bind to the polypeptide of
the present
invention but do not elicit a response, so that the activity of the
polypeptide is prevented.
Compounds may be identified from a variety of sources, for example, cells,
cell-free
preparations, chemical libraries, and natural product mixtures. These
substrates and ligands may
be natural substrates and ligands or may be structural or functional mimetics.
See, e.g., Coligan
et al., Current Protocols in Immunology 1(2): Chapter 5 (1991). Peptide
modulators can also be
selected by screening large random libraries of all possible peptides of a
certain length.
Compounds could also be derived from the polypeptide sequence of 770RF104
itself.
Peptide fragments representing small overlapping fragments or peptides
spanning the entire
amino acid sequence of the protein can be used to perform extensive screens.
Fragments of
770RF104 can be produced by proteolytic digestion of the full-length protein
as described'
above. Alternatively, suitable 770RF104-derived peptide or polypeptide
fragments
representative of the complete sequence of the protein can be chemically
synthesized. For
instance, in the multi-pin approach, peptides are simultaneously synthesized
by the assembly of
small quantities of peptides on plastic pins derivatized with an ester linker
based on glycolate
and 4-(hydroxymethyl) benzoate (Maeji et al. (1991) Pept Res, 4:142-6).
Certain of the polypeptides of the invention are biomimetics, functional
mimetics of the
natural S. aureus DnaI polypeptide. These functional mimetics are useful for,
among other
things, antagonizing the activity of S. aureus DnaI polypeptide or as an
antigen or immunogen in
a manner described above. Functional mimetics of the polypeptides of the
invention include but
are not limited to truncated polypeptides. For example, preferred functional
mimetics include a
polypeptide comprising the polypeptide sequence set forth in SEQ ID NO: 2
lacking 20, 30, 40,
50, 60, 70 or ~0 amino- or carboxy-terminal amino acid residues, including
fusion proteins
comprising one or more of these truncated sequences. Polynucleotides encoding
each of these
functional mimetics may be used as expression cassettes to express each
mimetic polypeptide. It
is preferred that these cassettes comprise 5' and 3' restriction sites to
allow for a convenient
means to ligate the cassettes together when desired. It is further preferred
that these cassettes
comprise gene expression signals known in the art or described elsewhere
herein.
Screening Assays According to the Invention
It is desirable to devise screening methods to identify compounds which
stimulate or
which inhibit the function of the DnaI polypeptide or polynucleotide of the
invention.
Accordingly, the present invention provides for a method of screening
compounds to identify
those that modulate the function of a polypeptide or polynucleotide of the
invention. In general,
CA 02396674 2002-06-17
WO 01/46383 PCT/US00/35180
antagonists may be employed for therapeutic and prophylactic purposes. It is
contemplated that
an agonist of DnaI may be useful, for example, to enhance the growth rate of
bacteria in a sample
being cultured for diagnostic or other purposes.
Screening methods generally fall into two broad categories: those that assay
binding of
5 candidate compounds; and those that assay a functional aspect of the target.
a) Binding Assays
There are a number of methods of examining binding of a candidate compound to
a
protein target such as DnaI. Screening methods that measure the binding of a
candidate
compound to the DnaI polypeptide or polynucleotide, or to cells or supports
bearing the
10 polypeptide or a fusion protein comprising the polypeptide, by means of a
label directly or
indirectly associated with the candidate compound, are useful in the
invention.
The screening method may involve competition for binding of a labeled
competitor such
as 770RF104 or a fragment that is competent to bind DnaI.
i) Phage display
15 Phage display is a powerful assay to measure protein:protein interaction.
In this scheme,
proteins or peptides are expressed as fusions with coat proteins or tail
proteins of filamentous
bacteriophage. A comprehensive monograph on this subject is Phage Display of
Peptides and
Proteins. A Laboratory Manual edited by Kay et al. (1996) Academic Press. For
phages in the Ff
family that include M13 and fd, gene III protein and gene VIII protein are the
most commonly-
20 used partners for fusion with foreign protein or peptides. Phagemids are
vectors containing
origins of replication both for plasmids and for bacteriophage. Phagemids
encoding fusions to
the gene III or gene VIII can be rescued from their bacterial hosts with
helper phage, resulting in
the display of the foreign sequences on the coat or at the tip of the
recombinant phage.
In the simplest assay, purified recombinant DnaI protein, or a fragment of
DnaI, for
25 example comprising the amino acid sequence of SEQ ID NO: 16, could be
immobilized in the
wells of a microtitre plate and incubated with phages displaying 770RF 104 in
fusion with the
gene III protein. Washing steps are performed to remove unbound phages and
bound phages are
detected with monoclonal antibodies directed against phage coat protein (gene
VIII protein).
Color development by means of an enzyme-linked secondary antibody allows
quantitative
30 detection of bound fusion protein. Screening for inhibitors is performed by
the incubation of the
compound with the immobilized target before the addition of phages. The
presence of an
inhibitor will specifically reduce the signal in a dose-dependent manner
relative to controls
without inhibitor.
CA 02396674 2003-11-14
46
ii) Surface plasmon resonance
Another powerful assay to screen for inhibitors of a for protein: protein
interaction is
surface plasmon resonance. Surface plasmon resonance is a quantitative method
that measures
binding between two (or more) molecules by the change in mass near the sensor
surface caused
by the binding of one protein or other biomolecule from the aqueous phase to a
second protein or
biomolecule immobilized on the sensor. This change in mass is measured as
resonance units
versus time after injection or removal of the second protein or biomolecule
and is measured
using a Biacore Biosensor (Biacore AB). DnaI could be immobilized on a sensor
chip (for
example, research grade CM5 chip; Biacore AB) using a covalent linkage method
(e.g. amine
coupling in 10 mM sodium acetate [pH 4.5]). A blank surface is prepared by
activating and
inactivating a sensor chip without protein immobilization. The binding of
770RF104 to DnaI, or
a fragment of Dnal, for example comprising the amino acid sequence of SEQ ID
NO: 16, is
measured by injecting purified 770RF104 over the chip surface. Measurements
are performed at
room temperature. Conditions used for the assay (i.e., those permitting
binding) are as follows:
25 mM HEPES-KOH (pH 7.6), 150 mM sodium chloride, 15°1o glycerol, 1 mM
dithiothreitol,
and 0.001 % Tween 20 with a flow rate of 10 ul/min. Preincubation of the
sensor chip with
candidate inhibitors will predictably decrease the interaction between
770RF104 and DnaI. A
decrease in 770RF104 binding is indicative of competitive binding by the
candidate compound.
iii) Fluorescence Resonance Energy Transfer (FRET)
Another method of measuring inhibition of binding of two proteins uses
fluorescence resonance
energy transfer (FRET; de Angelis, Physiol Genomics. 1999 Aug 31; 1(2):93-9).
FRET is a
quantum mechanical phenomenon that occurs between a fluorescence donor (D) and
a
fluorescence acceptor (A) in close proximity (usually < 100 A of separation.)
if the emission
spectrum of D overlaps with the excitation spectrum of A. Variants of the
green fluorescent
protein (GFP) from the jellyfish Aequorea victoria are fused to a polypeptide
or protein and
serve as D-A pairs in a FRET scheme to measure protein-protein interaction.
Cyan (CFP: D)
and yellow (YFP: A) fluorescence proteins are linked with DnaI polypeptide, or
a fragment of
DnaI, for example comprising the amino acid sequence of SEQ ID NO: 16, and
770RF104
protein respectively. Under optimal proximity, interaction between DnaI, or a
fragment of DnaI,
for example comprising the amino acid sequence of SEQ ID NO: 16 and ?7ORF104
causes a
decrease in intensity of CFP concomitant with an increase in YFP fluorescence.
The addition of a candidate modulator to the mixture of appropriately labeled
DnaI and
770RF104 protein, will result in an inhibition of energy transfer evidenced
by, for example, a
CA 02396674 2003-11-14
47
decease in YFP fluorescence at a given concentration of 770RF104 relative to a
sample without
the candidate inhibitor.
iv) Fluorescence polarization
In addition to the surface plasmon resonance and FRET methods, fluorescence
polarization
measurement is useful to quantitate protein-protein binding. The fluorescence
polarization value
for a fluorescently-tagged molecule depends on the rotational correlation time
or tumbling rate.
Protein complexes, such as those formed by S. aureus DnaI polypeptide, or a
fragment of DnaI,
for example comprising the amino acid sequence of SEQ ID NO: 16 associating
with a
fluorescently labeled polypeptide (e.g., 770RF104 or a binding fragment
thereof), have higher
polarization values than a fluorescently labeled monomeric protein. Inclusion
of a candidate
inhibitor of the DnaI interaction results in a decrease in fluorescence
polarization relative to a
mixture without the candidate inhibitor if the candidate inhibitor disrupts or
inhibits the
interaction of DnaI with its polypeptide binding partner. It is preferred that
this method be used
to characterize small molecules that disrupt the formation of polypeptide or
protein complexes.
v) Scintillation Proximity Assay
A scintillation proximity assay may be used to characterize the interaction
between a S.
aureus DnaI polypeptide, or a fragment of DnaI polypeptide, for example
comprising the amino
acid sequence of SEQ ID NO: 16 and another polypeptide. For the assay, S.
aureus DnaI
polypepdde can be covalently coupled to beads. Addition of radio-labeled
770RF104 results in
binding where the radioactive source molecule is in close proximity to the
scintillation fluid.
Thus, signal is emitted upon 770RF104 polypeptide binding, and compounds that
prevent
association between S. aureus DnaI polypeptide and 770RF104 diminish the
scintillation signal.
vi) Bio Sensor Assay
ICS biosensors have been described by AMBRI (Australian Membrane Biotechnology
Research Institute's web site). In this technology, the self-association of
macromolecules such
as DnaI, or a fragment of DnaI, for example comprising the amino acid sequence
of SEQ ID NO:
16, and bacteriophage 77 ORF 104, is coupled to the closing of gramacidin-
facilitated ion
channels in suspended membrane bilayers and hence to a measurable change in
the admittance
(similar to impedence) of the biosensor. This approach is linear over six
order of magnitude of
admittance change and is ideally suited for large scale, high through-put
screening of small
molecule combinatorial libraries.
It is important to note that in assays of protein-protein interaction, it is
possible that a
modulator of the interaction need not necessarily interact directly with the
domains) of the
proteins that physically interact. It is also possible that a modulator will
interact at a location
CA 02396674 2003-11-14
48
removed from the site of protein-protein interaction and cause, for example, a
conformational
change in the DnaI polypeptide. Modulators (inhibitors or agonists) that act
in this manner are of
interest since the change they induce may modify the activity of the DnaI
polypeptide.
b. Assays of DnaI Functional Activity.
i) Assay for DNA replication, 3H-thymidine incorporation
To measure the effect of 7701RF104 expression on S. aureus.DNA replication,
the level
of radiolabeled thymidine incorporation into DNA is measured in the presence
or in the absence
of sodium arsenite (5uM). Samples (0.5 ml) are withdrawn from the cultures at
appropriate time
intervals and mixed to 4.5 u1 of labeling solution (0.2 uCi/ml of 3H-thymidine
(73 Ci/mmol,
NEN Life Science Products, Inc) and 70 pmol of cold thymidine). After 15 min
of reaction,
incorporation is stopped by adding solution containing 0.2% NaN3 and 1 mM cold
thymidine.
Samples are precipitated with 10% w/v trichloroacetic acid and filtered
through glass fiber filters
(GF-C, Whatman). The results are expressed as 3H-thymidine counts incorporated
normalized to
OD culture.
The assay is performed in the presence of varying concentrations of candidate
inhibitors
in place of 77 012F104 to screen for inhibitors. At least a 10-fold reduction
in 3H-thymidine
incorporation in the presence of 77 ORF104 or other inhibitor indicates a
reduction in DnaI
activity.
ii) Plasmid replication
The plasmid pC194 replicates in S. aureus by rolling circle mechanism. The
single
stranded origin, sso of the pC194 is involved in the synthesis of the lagging
DNA strand. The
plasmid pADG6406 is a derivative of pC 194 lacking sso. The absence of sso
leads the
accumulation of plasmid single-stranded DNA. The single-stranded (ss)
initiation site, ssiA, is
located on the lagging strand of pAM 1 and is a site for primosome assembly.
SsiA was inserted
into plasmid pADG6404. S aureus harboring plasmids are grown to mid-log phase
and their
total DNA is extracted and analyzed by Southern hybridization, using 32P-
labeled plasmid DNA
as probe. The presence of pADG6406 with ssiA is associated to a decrease in
the ratio of ss to
double stranded (ds) DNA compared to that of the plasmid without ssiA. This
system is used to
measure the effect of 7701tF104 or a candidate inhibitor polypeptide
expression on ss DNA
synthesis. In an assay, a plasmid containing 7701RF104 or a candidate
inhibitor polypeptide
coding sequence under an arsenite inducible promotor is introduced into a S
aureus strain
harboring pADG6406. The ratio of ss to ds DNA of pADG6406 is measured in the
presence or
in the absence of sodium arsenite (5 uM). An increase in the ratio of ss to ds
DNA ( 10% or
more) indicates an effect of the candidate modulator. In another aspect, the
present invention
CA 02396674 2003-11-14
49
relates to a screening kit for identifying agonists, antagonists, ligands,
receptors, substrates,
enzymes, etc. for a polypeptide and/or polynucleotide of the present
invention; or compounds
which decrease or enhance the production of such polypeptides and/or
polynucleotides, which
comprises: (a) a polypeptide and/or a polynucleotide of the present invention;
(b) a recombinant
cell expressing a polypeptide and/or polynucleotide of the present invention;
(c) a cell membrane
expressing a polypeptide and/or polynucleotide of the present invention; or
(d) antibody to a
polypeptide and/or polynucleotide of the present invention; which polypeptide
is preferably that
of SEQ ID NO: 2, and which polynucleotide is preferably that of SEQ )D NO: 1.
It will be appreciated that in any such kit, (a), (b), (c) or (d) may comprise
a substantial
component.
It will be readily appreciated by the skilled artisan that a polypeptide
and/or
polynucleotide of the present invention may also be used in a method for the
structure-based
design of an agonist, antagonist or inhibitor of the polypeptide and/or
polynucleotide, by: (a)
determining in the first instance the three-dimensional structure of the
polypeptide and/or
polynucleotide, or complexes thereof; (b) deducing the three-dimensional
structure for the likely
reactive site(s), binding sites) or motifs) of an agonist, antagonist or
inhibitor; (c) synthesizing
candidate compounds that are predicted to bind to or react with the deduced
binding site(s),
reactive site(s), and/or motif(s); and (d) testing whether the candidate
compounds are indeed
agonists, antagonists or inhibitors. It will be further appreciated that this
will normally be an
iterative process, and this iterative process may be performed using automated
and computer-
controlled steps.
Each of the polynucleotide sequences provided herein may be used in the
discovery and
development of antibacterial compounds. The encoded protein, upon expression,
can be used as a
target for the screening of antibacterial drugs. Additionally, the
polynucleotide sequences
encoding the amino terminal regions of the encoded protein or Shine-Dalgarno
or other
translation facilitating sequences of the respective mRNA can be used to
construct antisense
sequences to control the expression of the coding sequence of interest.
The invention also provides the use of the polypeptide, polynucleotide,
agonist or
antagonist of the invention to interfere with the initial physical interaction
between a pathogen or
pathogens and a eukaryotic, preferably mammalian, host that is responsible for
sequelae of
infection. In particular, the molecules of the invention may be used: in the
prevention of
adhesion of bacteria, in particular Gram positive and/or Gram negative
bacteria, to eukaryotic,
preferably mammalian, extracellular matrix proteins on in-dwelling devices or
to extracellular
matrix proteins in wounds; to block bacterial adhesion between eukaryotic,
preferably
CA 02396674 2002-06-17
WO 01/46383 PCT/US00/35180
mammalian, extracellular matrix proteins and bacterial DnaI proteins that
mediate tissue damage
and/or; to block the normal progression of pathogenesis in infections
initiated other than by the
implantation of in-dwelling devices or by other surgical techniques.
In accordance with yet another aspect of the invention, there are provided
dnaI
5 antagonists, preferably bacteriostatic or bacteriocidal antagonists.
The antagonists of the invention may be employed, for instance, to prevent,
inhibit and/or
treat diseases.
Comnosition~ kits and administration
In a further aspect of the invention there are provided compositions
comprising a dnaI
10 polynucleotide and/or a S. aureus DnaI polypeptide for administration to a
cell or to a
multicellular organism.
The present invention provides for pharmaceutical compositions comprising a
therapeutically effective amount of a polypeptide and/or polynucleotide, such
as the soluble form
of a polypeptide and/or polynucleotide of the present invention, antagonist
peptide or small
15 molecule compound, in combination with a pharmaceutically acceptable
carrier or excipient.
Such carriers include, but are not limited to, saline, buffered saline,
dextrose, water, glycerol,
ethanol, and combinations thereof. The pharmaceutical compositions may be
administered in
any effective, convenient manner including, for instance, administration by
topical, oral, anal,
vaginal, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal
or intradermal
20 routes among others.
In therapy or as a prophylactic, the active agent may be administered to an
individual as
an injectable composition, for example as a sterile aqueous dispersion,
preferably isotonic.
Alternatively the composition may be formulated for topical application for
example in
the form of ointments, creams, lotions, eye ointments, eye drops, ear drops,
mouthwash,
25 impregnated dressings and sutures and aerosols, and may contain appropriate
conventional
additives, including, for example, preservatives, solvents to assist drug
penetration, and
emollients in ointments and creams. Such topical formulations may also contain
compatible
conventional carriers, for example cream or ointment bases, and ethanol or
oleyl alcohol for
lotions. Such carriers may constitute from about 1% to about 9~% by weight of
the formulation;
30 more usually they will constitute up to about ~0% by weight of the
formulation. Alternative
means for systemic administration include transmucosal and transdermal
administration using
penetrants such as bile salts or fusidic acids or other detergents. In
addition, if a polypeptide or
other compounds of the present invention can be formulated in an enteric or an
encapsulated
CA 02396674 2002-06-17
WO 01/46383 PCT/US00/35180
51
formulation, oral administration may also be possible. Administration of these
compounds may
also be topical and/or localized, in the form of salves, pastes, gels, and the
like.
For administration to mammals, and particularly humans, it is expected that
the daily
dosage level of the active agent will be from 0.01 mg/kg to 10 mg/kg,
typically around 1 mg/kg.
The physician in any event will determine the actual dosage which will be most
suitable for an
individual and will vary with the age, weight and response of the particular
individual. The
above dosages are exemplary of the average case. There can, of course, be
individual instances
where higher or lower dosage ranges are merited, and such are within the scope
of this invention.
As used herein, the term "in-dwelling device" refers to surgical implants,
prosthetic
devices and catheters, i.e., devices that are introduced to the body of an
individual and remain in
position for an extended time. Such devices include, but are not limited to,
artificial joints, heart
valves, pacemakers, vascular grafts, vascular catheters, cerebrospinal fluid
shunts, urinary
catheters, continuous ambulatory peritoneal dialysis (CAPD) catheters.
The composition of the invention may be administered by injection to achieve a
systemic
effect against relevant bacteria shortly before insertion of an in-dwelling
device. Treatment may
be continued after surgery during the in-body time of the device. In addition,
the composition
could also be used to broaden perioperative cover for any surgical technique
to prevent bacterial
wound infections, especially S aureus wound infections.
Many orthopedic surgeons consider that humans with prosthetic joints should be
considered for antibiotic prophylaxis before dental treatment that could
produce a bacteremia.
Deep infection is a serious complication sometimes leading to loss of the
prosthetic joint and is
accompanied by significant morbidity and mortality. It may therefore be
possible to extend the
use of the active agent as a replacement for prophylactic antibiotics in this
situation.
In addition to the therapy described above, the compositions of this invention
may be
used generally as a wound treatment agent to prevent adhesion of bacteria to
matrix proteins
exposed in wound tissue and for prophylactic use in dental treatment as an
alternative to, or in
conjunction with, antibiotic prophylaxis.
Alternatively, the composition of the invention may be used to bathe an
indwelling
device immediately before insertion. The active agent will preferably be
present at a
concentration of 1 mg/ml to lOmg/ml for bathing of wounds or indwelling
devices.
A vaccine composition is conveniently in injectable form. Conventional
adjuvants may
be employed to enhance the immune response. A suitable unit dose for
vaccination is 0.5-5
microgram/kg of antigen, and such dose is preferably administered 1-3 times
and with an interval
of 1-3 weeks. With the indicated dose range, no adverse toxicological effects
will be observed
CA 02396674 2002-06-17
WO 01/46383 PCT/US00/35180
52
with the compounds of the invention which would preclude their administration
to suitable
individuals.
Seduence Databases. Seduences in a_ Tangible Medium. and A1 orig thms
Polynucleotide and polypeptide sequences form a valuable information resource
with
which to determine their 2- and 3-dimensional structures as well as to
identify further sequences
of similar homology. These approaches are most easily facilitated by storing
the sequence in a
computer readable medium and then using the stored data in a known
macromolecular structure
program or to search a sequence database using well known searching tools,
such as GCC.
The polynucleotide and polypeptide sequences of the invention are particularly
useful as
components in databases useful for search analyses as well as in sequence
analysis algorithms.
As used in this section entitled "Sequence Databases, Sequences in a Tangible
Medium, and
Algoritluns," and in claims related to this section, the terms "polynucleotide
of the invention"
and "polynucleotide sequence of the invention" mean any detectable chemical or
physical
characteristic of a polynucleotide of the invention that is or may be reduced
to or stored in a
tangible medium, preferably a computer readable form. For example,
chromatographic scan data
or peak data, photographic data or scan data therefrom, called bases, and mass
spectrographic
data. As used in this section entitled Databases and Algorithms and in claims
related thereto, the
terms "polypeptide of the invention" and "polypeptide sequence of the
invention" mean any
detectable chemical or physical characteristic of a polypeptide of the
invention that is or may be
reduced to or stored in a tangible medium, preferably a computer readable
form. For example,
chromatographic scan data or peak data, photographic data or scan data
therefrom, and mass
spectrographic data.
The invention provides a computer readable medium having stored thereon
polypeptide
sequences of the invention and/or polynucleotide sequences of the invention.
The computer
readable medium can be any composition of matter used to store information or
data, including,
for example, commercially available floppy disks, tapes, chips, hard drives,
compact disks, and
video disks.
In a preferred embodiment of the invention there is provided a computer
readable
medium having stored thereon a member selected from the group consisting of: a
poiynucleotide
comprising the sequence of SEQ ID NO: 1 or SEQ ID NO: 17; a polypeptide
comprising the
sequence of SEQ ID NO: 2 or SEQ ID NO: 16; a set of polynucleotide sequences
wherein at
least one of said sequences comprises the sequence of SEQ ID NO: 1 or SEQ ID
NO: 17: a set of
polypeptide sequences wherein at least one of said sequences comprises the
sequence of SEQ ID
NO: 2 or SEQ ID NO: 16; a data set representing a polynucleotide sequence
comprising the
CA 02396674 2003-12-08
53
sequence of SEQ ID NO: 1 or SEQ 1D NO: 17; a data set representing a
polynucleotide sequence
encoding a polypeptide sequence comprising the sequence of SEQ ID NO: 2 or SEQ
ID NO: 16;
a polynucleotide comprising the sequence of SEQ 1D NO: 1 or SEQ 1D NO: 17; a
polypeptide
comprising the sequence of SEQ ID NO: 2 or SEQ ID NO: 16; a set of
polynucleotide sequences
wherein at least one of said sequences comprises the sequence of SEQ ID NO: 1
or SEQ ID NO:
17; a set of polypeptide sequences wherein at least one of said sequences
comprises the sequence
of SEQ ID NO: 2 or SEQ ID NO: 16; a data set representing a polynucleotide
sequence
comprising the sequence of SEQ >D NO: 1 or SEQ ID NO: 17; a data set
representing a
polynucleotide sequence encoding a polypeptide sequence comprising the
sequence of SEQ ID
NO: 2 or SEQ ID NO: 16.
EXAMPLES
Example 1
Identification of the inhibitory ORF 104 from Staphylococcus aureus
bacteriophage 77.
The S. aureus propagating strain 77 (PS 77) was used as a host to propagate
its respective
phage 77 (ACTT #27699-B 1 ). The phage was propagated using the agar layer
method described
by Swanstorm and Adams (Swanstrom et al. (1951) Proc. Soc. Exptl. Biol. & Med.
78: 372-
375). Phage DNA was prepared from the purified phages as described in Sambrook
et al. (1989)
Molecular Cloning: A Laboratory Manual, 2°d Edition, Cold Spring Harbor
Laboratory Press,
Cold Spring Harbor, NY. Blunt-ended sonicated phage DNA fragments were cloned
into the
pKSII vector (Stratagene). Recombinant clones were sequenced on an ABI 377-36
automated
sequencer. To ensure co-linearity of the sequence data and the genome, all
regions of the phage
genome were sequenced at least once from both directions on two separate
clones. Sequence
contigs were assembled using Sequencher 3.1 software (GeneCodes) (Fig. 2). An
implementation of the publically available program SEQUIN, available for
download at
ftp://negi.nlm.nih.gov/sequin/, was used on phage genome sequence to identify
all putative ORFs
larger than 33 codons (Fig. 3).
The 770RF104 (SEQ 1D NO: 4) was amplified by polymerase chain reaction (PCR)
from
phage genomic DNA (Fig. 4). For PCR amplification, the sense strand primer
starts at the
initiation codon and is preceded by a BamHI restriction site; the antisense
strand starts at the last
codon (excluding the stop codon) and is preceded by a SaII restriction site.
The PCR product was
gel purified and digested with BamHI and SaII. The digested PCR product was
then ligated into
BamHI- and SaII-digested pT vector (Fig. 7A), and used to transform S. aureus
strain RN4220
CA 02396674 2003-12-08
54
(Kreiswirth et al. (1983) Nature 305: 709-712). Selection of recombinant
clones was performed
on Luria-Bertani (LB) agar plates containing 30 p.g/ml of kanamycin.
Sodium arsenite (NaAs02) was used to induce gene expression from the ars
promoter/operator. The effect of expression of phage 77 ORFs on bacterial cell
growth was then
evaluated in functional assays on solid medium and in liquid medium. As shown
in Fig. 7B, the
induction of expression of phage 770RF104 by plating transformants on semi-
solid medium
containing 5 ~,M sodium arsenite results in the inhibition of bacterial growth
on solid medium
compared to plating in the absence of inducer or plating of control non-
inhibitory ORF (phage 77
ORF 19) transformants. As shown in Fig. 7C, the density of the culture, as
assessed by colony
forming units (CFU), for S. aureus clones harboring the 770RF104 increased
over time under
non-induced conditions. Similar growth rates were also observed with
transformants harboring a
non-inhibitory ORF (labeled as 'non killer' on the graphs) under both induced
and non-induced
conditions. At 4 h following induction, the expression of 770RF104 is
cytocidal resulting in a
0.5 log reduction in the number of CFU compared to the number of CFU initially
present in the
same culture.
Example 2
Identification of a S. aureus protein targeted by bacteriophage 77 ORF 104.
To identify S. aureus proteins that interact with the bacterial growth
inhibitory
Staphylococcus bacteriophage 77 ORF 104, a GST-fusion of ORF 104 was generated
and the
recombinant protein purified and utilized to make a GST/ORF104 affinity
column. Cellular
extracts prepared from S. aureus cells were incubated with the affinity
matrix, washed with
increasing salt concentrations and different detergents, and the protein
elution profile of the
washes assessed by SDS-polyacrylamide gel electrophoresis. A protein of
molecular mass ~ 40
kDa was specifically eluted from the affinity matrix. Eluted proteins were
further characterized
to determine the identity of the interacting protein and to validate the
interaction of the protein
with 770RF104 as described in detail below.
A. Generation of GST/ORF 104 recombinant protein.
Bacteriophage 770RF104 was sub-cloned into pGEX 4T-1 (Pharmacia), an
expression
vector containing the GST moiety. The gene encoding ORF1.04 was obtained by
digestion of
pT/ORF104 (Fig. 7A) with BamHl and Sall. The DNA fragment containing ORF104
was gel
purified by QiaQuickTM spin column (Qiagen) and ligated into pGEX 4T-1 (which
had been
previously digested with BamHl and Sall) to generate pGEX 4T/ORF104.
Recombinant
CA 02396674 2003-12-08
expression vectors were identified by restriction enzyme analysis of plasmid
minipreps, large-
scale DNA preparations were performed with Qiagen columns, and the resulting
plasmid was
sequenced. Test expressions in E. coli DH5 cells containing the expression
plasmids were
performed to identify optimal protein expression conditions. E. coli DH5 cells
containing the
pGEX 4T/ORF104 were grown in Luria-Bertani Broth at 37°C to an OD6oo of
0.4 to 0.6 and
induced with 1 mM IPTG at 30°C for 4 hrs.
B. Fusion rp otein purification.
Cells containing GST/ORF104 fusion protein were suspended in 20 ml lysis
buffer/liter
10 of cell culture with GST lysis buffer (20 mM Hepes pH 7.2, 500 mM NaCI, 10
% glycerol, 1
mM DTT, 1mM EDTA, 1mM benzamidine, and 1 PMSF) and lysed by French Pressure
cell
followed by three bursts of twenty seconds with an ultra-sonicator at
4°C. Triton X-100TM was
added to the lysate to a final concentration of 0.1 % and mixed for 30 minutes
at 4°C. The lysate
was centrifuged at 4°C for 30 minutes at 10 000 rpm in a Sorval SS34
rotor. The supernatant
15 was applied to a 4 ml glutathione SepharoseTM column pre-equilibrated with
lysis buffer and
allowed to flow by gravity. The column was washed with 10 column volumes of
lysis buffer and
eluted in 1.5 ml fractions with GST elution buffer (20 mM Hepes pH 8.0, 500 mM
NaCI, 10 %
glycerol, 1 mM DTT, O.ImM EDTA, and 25 mM reduced glutathione). The fractions
were
analyzed by 12.5% SDS-PAGE (Laemmli) and visualized by staining with Coomassie
Brilliant
20 Blue 8250 stain to assess the amount of eluted GST/ORF104 protein.
GST/ORF104 (12 mg) was dialyzed overnight against 20 mM Hepes pH 7.5, 150 mM
NaCI, 10% glycerol, 1 mM DTT, 0.1 mM EDTA, made up to 2.5 mM CaCl2 and
digested with
bovine thrombin at a mass ratio of 1:10 (thrombin: GST ORF104) for 2.5 hrs at
28°C to cleave
the GST domain from the ORF104 domain. The digestion was stopped by the
addition of 1 mM
25 PMSF, 1 mM benzamidine and NaCI to a 1M final concentration. The digested
protein was
applied to a one ml glutathione sepharose column and flow-through fractions of
1 ml were
collected. The fractions were analyzed by 12% SDS-PAGE (Tricine) and
visualized by staining
with Coomassie Brilliant Blue 8250 stain to determine which fractions contain
bacterially
expressed ORF104 lacking the GST tag.
C. Affinity column preparation.
GST and GST/ORF104 fusion protein were dialyzed overnight against Affinity
Chromatography Buffer (ACB; 20 mM Hepes pH 7.5, 10 % glycerol, 1 mM DTT, and 1
mM
EDTA) containing 1 M NaCI. ORF104 protein obtained from thrombin digestion of
CA 02396674 2003-12-08
GST/ORF104 was used without dialysis. Protein concentrations were determined
by Bio-Rad
Protein Assay and crosslinked to Affigel lOTM resin (Bio-Rad) at protein/resin
concentrations of
0, 0.1, 0.5, 1.0, and 2.0 mg/ml. The crosslinked resin was sequentially
incubated in the presence
of ethanolamine, and bovine serum albumin (BSA) prior to column packing and
equilibration
with ACB containing 75 mM NaCI.
D. S. aureus extract preparation.
Two extracts were prepared from S. aureus cell pellets. One lysate was
prepared by
French Pressure cell followed by sonication and the other by a lysostaphin
digestion followed by
sonication. The French Pressure cell prepared lysate was prepared by
suspending 3g of frozen S.
aureus cells in ACB containing 500 mM NaCI, 1 mM PMSF, and 1 mM benzamidine.
The
suspended cells were subjected to three passes through the French Pressure
cell followed by 3
sonication bursts of 20 seconds each, made up to 0.1 % Triton X-100TM, stirred
for 30 minutes,
and centrifuged at 50 000 rpm for 3 hrs in a Ti70 fixed angle Beckman rotor.
The efficiency of
cell lysis was low and the resulting lysate (7 ml) contained 2.4 mg/ml
protein. The cell pellet
after the French Pressure cell lysis was subjected to cryogenic grinding in
liquid nitrogen in the
same buffer with a mortar and pestle. The lysate was made up to 0.1% Triton X-
100TM, stirred
for 30 minutes, and centrifuged at 50 000 rpm for 3 hrs in a Ti70 fixed angle
Beckman rotor
yielding a lysate (10 ml) containing 2.0 mg/ml protein. The cell lysates were
found to be similar
by SDS PAGE and were pooled, concentrated to 8 ml, and dialyzed overnight in a
3000 Mr
dialysis membrane against affinity chromatography containing 1 mM PMSF, 1 mM
benzamidine, and 75 mM NaCI. The dialyzed protein extract was removed from the
dialysis
tubing, centrifuged at 10 000 rpm in a Sorval SS34 rotor for 1 hr, and assayed
for protein content
(Bio-Rad Protein Assay) and salt concentration (conductivity meter).
The second lysate was prepared by lysostaphin digestion followed by
sonication. A
S. aureus cell pellet (2.9g) was suspended in 8 ml of 20 mM Hepes pH 7.5, 150
mM NaCI, 10%
glycerol, 1 mM DTT, 1 mM PMSF, 1 mM benzamidine, and 1000 units of
lysostaphin. The cell
suspension was incubated at 37°C for 30 minutes, cooled to 4°C,
and made up to a final
concentration of 1 mM EDTA and 500 mM NaCI. The lysate was sonicated on ice
using three
bursts of 20 seconds each. The lysate was made up to 0.1% Triton X-100TM,
stirred for 30
minutes, and centrifuged at 50 000 rpm for 3 hrs in a Ti70 fixed angle Beckman
rotor. The
supernatant was removed and dialyzed overnight in a 3000 Mr dialysis membrane
against ACB
containing 75 mM NaCI, 1mM benzamidine, and 1 mM PMSF. The dialyzed protein
extract
was removed from the dialysis tubing, centrifuged at 10 000 rpm in a Sorval
SS34 rotor for 1 hr,
CA 02396674 2003-11-14
57
and assayed for protein content (utilizing the Bio-RadTM Protein Assay) and
salt concentration
(utilizing a conductivity meter). Aliquots of the extracts were frozen at
70°C.
E. Aff_ initv chromatography.
S. aureus extract (400 ~1) was applied to 40 ~1 columns containing 0, 0.1.
0.5. 1.0, and
2.0 mg/ml ligand and ACB containing 75 mM NaCI (400 ~1) was applied to an
additional
column containing 2.0 mg/ml ligand. The columns were washed with ACB
containing 75 mM
NaCI (400 p,1) and sequentially eluted with ACB containing 1% Triton X-100TM
and 75 mM
NaCI (160 ~.1), ACB containing 250 mM NaCI (160 p.1), ACB containing 1M NaCI
(160 p,1), and
1% SDS (160 p1). 40 p,1 of each eluate was resolved by 16 cm 12.5% SDS-PAGE
(Laemmli)
and the eluted proteins were visualized by silver stain.
F. Identification of S. aureus DnaI homology as an ORF104 interactins rotein
Proteins at approximately 38 kDa were observed specifically in the eluants
from the
GST/ORF104 and ORF104 (GST removed) columns obtained from ACB containing 75 mM
NaCI and 1% Triton X-100TM, and 1% SDS (Figs. 8-10; eluting protein indicated
by an arrow).
These bands were excised from the SDS-PAGE gels and prepared for tryptic
peptide mass
determination by MALDI-ToF mass spectrometry (Qin, J., et al. (1997) Anal.
Chem. 69, 3995
4001). High quality mass spectra were obtained (Fig. 11). The candidate
proteins observed in
the two eluants were identical as determined by the masses of the tryptic
peptides (Fig. 11 ). Post-
Source Decay (PSD) coupled with Collision-Induced Decay (CID) was used to
obtain
fragmentation spectra of tryptic peptides having monoisotopic MH+ masses of
1351.8, 1412.7,
and 1617.8 Da. The fragment masses were used to search all public domain
databases resulting
in no identification. The PSD/CID spectra obtained for the peptide having a
monoisotopic MH+
mass of 1412.7 were then interpreted to obtain a peptide sequence GHVPENVTDNDR
(SEQ ID
NO: 19), which was used to BLAST search the S. aureus nucleotide sequence
database on the
web site of the University of Oklahoma's Advanced Center for Genome
Technology's. One
nucleotide sequence, Contig 981, in reading frame +3 encoded the similar amino
acid sequence
GHVPELYVDNNR (SEQ ID NO: 11). This tentative identification of the candidate
protein was
then confirmed upon conceptual translation and in silico tryptic digestion of
the open reading
frame found in Contig 981. Furthermore, the obtained PSD/CID spectra for
tryptic peptides with
monoisotopic MH+ masses of 1351.8 and 1617.8 Da were similar to the predicted
PSD/CID
fragmentation patterns of the tryptic peptides
CA 02396674 2002-06-17
WO 01/46383 PCT/US00/35180
58
with monoisotopic MH+ masses of 1351.8 and 1617.8 Da found in the Contig 981
open reading
frame. Comparison of the Contig 981 open reading frame with all other
sequences in the public
domain databases revealed that Contig 981 is a homologue of Bacillus subtilis
DnaI, a protein
involved in origin-dependent DNA replication (42% identity and 62% similarity)
(Table 1).
G. Yeast two-h rid confirmation of DnaI and ORF 104 interaction.
To validate the identification of the S. au~eus dnaI homolog as an interacting
partner of
bacteriophage 77 ORF 104, the interaction was assessed in vivo in the yeast
two-hybrid system.
As shown in Fig. 12B, bacteriophage 770RF104 was fused either to the carboxyl
terminus of the
yeast Gal4 DNA binding (pGBKT7, Clontech Laboratories) or activation (pGADT7,
Clontech
Laboratories) domains (pGBK770RF104 and pGAD770RF104, respectively). The
polynucleotide sequence of the DnaI homologue was obtained from the S. au~eus
genomic DNA
by PCR utilizing oligonucleotide primers that targeted the translation
initiation and termination
codons of the dnaI gene (SEQ ID NO: 1). As shown in Fig. 12A, the sense strand
primer targets
the initiation codon and is preceded by an EcoRI restriction site (5'-gaattc-
3'); the antisense
oligonucleotide targets the stop codon and is preceded by a BamHI restriction
site (5'-ggatcc-3').
The PCR product was purified using the Qiagen PCR purification kit and
digested with EcoRI
and BamHL The digested PCR product was ligated to EcoRI and BamHI digested
pGADT7
vector (pGAD dnaI). A similar strategy was used for the cloning of DnaI into
pGBKT7 vector
(pGBK dnaI).
As shown in Fig. 12D, the pGAD and pGBK plasmids bearing different combination
of
constructs (as indicated in NO 1 to 6) were introduced into a yeast strain
(AH109, Clontech
Laboratories), previously engineered to contain chromosomally-integrated
copies of E. coli lacZ
and the selectable HIS3 and ADE2 genes. Co-transformants were plated in
parallel on yeast
synthetic medium (SD) supplemented with amino acid drop-out lacking tryptophan
and leucine
(TL minus) and on SD supplemented with amino acid drop-out lacking tryptophan,
histidine,
adenine and leucine (THAL minus). Co-transformants harboring the 77 ORF104
polypeptide
only grew on selective THAL minus media in the presence of DnaI (right Petri,
NO 5 and 6).
Induction of the reporter HIS3 and ADE2 genes is dependent upon the
interaction of dnaI with
770RF104 proteins since when either plasmid is introduced into yeast host
cells with the control
plasmid (pGBKT7-53 orpGADT7-T), no reporter expression is observed (NO 2 and
3).
pGADT7-T and pGBKT7-53 are positive control for protein:protein interaction
(NO 1) and
pCLl is an active Gal4 transcription factor (NO 4). Interaction of DnaI and
770RF104 is also
demonstrated by the presence of luminescent (3-galactosidase activity in
770RF104-DnaI co-
CA 02396674 2002-06-17
WO 01/46383 PCT/US00/35180
59
transformants (Fig.12E: NO 5 and 6). These results are consistent with the
interpretation that the
S. aureus DnaI homologue identified herein is the host target of bacteriophage
770RF104.
Example 3
Identification of the surface of interaction on S. aureus DnaI.
To identify the specific domain of S. au~eus DnaI which participates in the
interaction
with bacteriophage 770RF104, recombinant DnaI protein was subjected to partial
proteolytic
digestion and applied to an affinity column containing 770RF104. Partial
proteolytic fragments
of DnaI interacting with the 770RF104 were then analyzed by SDS-PAGE and mass
spectrometry, and subsequently characterized by yeast two-hybrid assay to
validate the
interaction of the DnaI sub-fragment with 77 ORF 104 as described in detail
below.
A. Sub-Cloning of Dnal into a bacterial inducible expression system
Full-length Dnal, was amplified from S. aureus genomic DNA using the
polymerase
chain reaction (PCR). For PCR amplification of DnaI, the sense strand primer
targets the
initiation codon and is preceded by a BamHI restriction site (5'-ggatcc-3');
the antisense
oligonucleotide targets the stop codon and is preceded by a SaII restriction
site (5'-gtcgac-3')
(SEQ ID NO: 1). The digested PCR product was purified using the Qiagen PCR
purification kit,
ligated into BamHI and Sah digested pGEX-6P-1 vector (# 27-4597, Amersham
Pharmacia
Biotech), and used to transform E. coli strain BL21. The sequence integrity of
DnaI polypeptides
fused to GST was verified directly by DNA sequencing.
Expression of the GST-DnaI recombinant protein from the plasmid pGEX-6P-1-DnaI
was induced by the addition of 0.5 mM IPTG to a 6 liter culture at ODsoo ~0.5.
The protein was
expressed at 30°C for 3h, the cells were harvested by centrifugation
and stored as a cell pellet at
-70°C. The frozen cell pellet was thawed, resuspended in Buffer 1 (20
mM HEPES pH 7.3, 500
mM NaCI, 10% glycerol, 1 mM DTT, and 1 mM EDTA) containing 1 mM PMSF and'1 mM
benzamidine, and lysed in a French pressure cell followed by three sonication
bursts of 20
seconds each at 4°C. The cell lysate was centrifuged at 4°C for
30 minutes at 10 000 rpm. The
supernatant was applied to a 6 ml glutathione sepharose column equilibrated
with Buffer 1,
washed with 60 ml of Buffer 1 containing 1 mM PMSF and 1 mM benzamidine, and
eluted in 6
ml fractions with Buffer 1 containing 50 mM reduced glutathione. Fractions
were analyzed by
12% SDS-PAGE and visualized by Coommassie Brilliant Blue R-250 staining.
B. Cleavage and removal of GST fusion and partial proteolysis of DnaI
Elution fraction 5 containing 7.0 mg GST-DnaI was dialyzed against Buffer 2
(20 mM
HEPES pH 7.5, 150 mM NaCI, 10% glycerol, and 1 mM DTT) and subjected to
digestion with
CA 02396674 2003-11-14
40 Units precision protease (Amersham Pharmacia Biotech) at 25°C for 4
hrs. The digested
GST-DnaI was applied to a 1 ml glutathione sepharose column equilibrated with
Buffer 2, the
flow-through collected, and eluted with Buffer 1 containing 25 mM reduced
glutathione.
Fractions were analyzed by 12% SDS-PAGE and visualized by Coommassie Brilliant
BIueTM
5 R-250 staining.
The flow-through fraction, containing DnaI, was dialyzed against buffer 2 and
subjected
to proteolytic digestion in reactions containing the protease/DnaI mass ratio
of 1:500 (w/w) of
chymotrypsin or 1:50 (w/w) of endoproteinase Glu-C for 2h at room temperature.
The partial
proteolysis products obtained from chymotrypsin and endoproteinase Glu-C
digestion were used
10 for affinity chromatography. The proteolytic digestion was stopped by the
addition of 1 mM
PMSF and 1 mM benzamidine and analyzed by SDS-PAGE (one tenth of reaction used
for
analysis).
C Affinit c~hromato,graphy between immobilized 77 ORF 104 and DnaI proteolytic
fragments
770RF104 protein was cross-linked to Affigel IOTM (BioRad) followed by
blocking of
15 the remaining active sites with ethanolamine and the non-specific sites
with BSA. The columns
were equilibrated with ACB containing 1 M NaCI, and ACB containing 100 mM
NaCI. The
partial proteolytic digests were diluted to a final volume of 120 ~.I with ACB
containing 100 mM
and purified BSA was added to a final concentration of 0.1 mg/ml. The partial
proteolytic
reaction was split into three fractions, of which 50 u1 was applied to a
column containing
20 770RF104 crosslinked at 2.0 mg/ml, 50 u1 was applied to a column containing
no ligand, and 10
u1 was retained for SDS-PAGE. The columns were washed with 10 column volumes
of ACB
containing 100 mM NaCI, 4 column volumes of ACB containing 100 mM NaCI and 1 %
Triton X-100TM, and eluted sequentially with 4 column volumes ACB containing 1
M NaCI and
1 % SDS.
25 The flow-through and eluates were precipitated with trichloroacetic acid
(TCA) and
washed with an equal volume of cold (-70 °C) acetone. The TCA-
precipitated samples were
subjected to 15% SDS-PAGE, and the protein visualized by silver staining (Fig.
14 A and B).
D Identification of DnaI partial proteolytic fr~ments interactin~,,with 77 ORF
104
The interacting proteolytic fragments were excised, digested by trypsin, and
analyzed by
30 mass spectrometry. The peptides contained within each of the interacting
proteolytic fragments
were analyzed by MALDI-ToF mass spectrometry resulting in the determination of
the general
region of DnaI for each partial proteolytic peptide. The amino and carboxy
terminal ends of the
partial proteolytic fragments were determined for several fragments by the
acquisition of mass
spectrometry data of the unfractionated proteolytic digest followed by mapping
the observed
CA 02396674 2002-06-17
WO 01/46383 PCT/US00/35180
61
mass onto the full length DnaI sequence. Partial proteolytic DnaI fragments
interacting with the
77 ORF 104 are presented in Fig. 14C.
E. Sub-Cloning of DnaI fragments into yeast inducible expression system
The interaction between 770RF 104 and portions of the DnaI polypeptide was
also assessed in
vivo in the yeast two-hybrid system. Two portions of the polynucleotide
sequence of DnaI were
amplified by PCR from S. aureus genomic DNA by utilizing appropriate pairs of
oligonucleotides (Fig. 15). The portion extending from amino acid residues 64
to 313 was
obtained with the two following oligonucleotides: the sense strand (with an
EcoRI cloning site)
5'- ccggaattc TATAAAGATCAACAAAAAC-3', SEQ ID NO: 12 and the antisense strand
(with
a BamHI cloning site) 5'- cgcggatccTCAATTGTTTCTGAAATT- 3', SEQ ID NO: 13.
The polynucleotide sequence encoding amino acids 150-313 of SEQ ID NO: 2
corresponds to
nucleotides 448 to 942 of SEQ ID NO: 1 and is herein designated SEQ ID NO: 17.
The portion
extending from amino acid residues 150 to 313 was obtained with the two
following
oligonucleotides: the sense strand (with an EcoRI cloning site) 5'-
ccggaattcGCAGCAGATGATATTTGT -3', SEQ ID NO: l4and the antisense strand (with a
BamHI cloning site) 5'- cgcggatccTCAATTGTTTCTGAAATT -3', SEQ ID NO: I5. The
digested PCR products were gel purified, ligated into EcoRI- and BamHI-
digested pGADT7 prey
vector, and used to transform E, coli strain DH10(3. The sequence integrity of
the cloned
products was verified directly by DNA sequencing.
As shown in Fig. 16 different combinaison of bait and prey vectors (as
indicated in NO 1
to 6) was introduced into AH109 yeast cells. Portions of DnaI extending from
amino acids
residues 64 to 313 (herein referred to as SEQ ID NO: 18) as well as from 150
to 313 (herein
referred to as SEQ ID NO: 16) were both found to interact with bacteriophage
770RF104 since
the introduction of appropriate plasmids into host yeast cells resulted in
their growth on THAL
minus SD medium (NO 1 and 3). Induction of these reporter genes is dependent
upon the
interaction between DnaI-related polypeptides and 77 ORF 104 since the
introduction of control
plasmids expressing non-interacting protein partners (pGBKLam: NO 2 and 4 or
77pGADORFl3: NO 6) did not result in reporter gene expression (Fig. 16A).
OTHER EMBODIMENTS
Other embodiments are within the following claims.
CA 02396674 2005-11-29
f
SEQUENCE LISTING
<110> Targanta Therapeutics Inc.
<120> Compositions and methods involving an essential Staphylococcus Aureus
gene and
its encoded protein
<130> SAU-R1-CAw21-34
<140> CA 2,396,674
<141> 21-12-2000
<150> PCT/uS00/35180
<151> 21-12-2000
<150> us 09/470,512
<151> 22-12-1999
<160> 19
<170> PatentIn version 3.1
<210> 1
<211> 94Z
<212> DNA
<213> Staphylococcus aureus
<400>
1
atgggaggaggacagtcaataatgaagcaatttaaaagtataattaacacgtcgcaggac60
tttgaaaaaagaatagaaaagataaaaaaagaagtaatcaatgacccagatgttaagcaa120
tttttggaagcgcatcgagctgaattaacgaatgctatgattgatgaagacttaaatgtg180
ttacaagagtataaagatcaacaaaaacattatgacggtcataaatttgctgattgtcca240
aatttcgtaaaggggcatgtgcctgagttatatgttgataataaccgaattaaaatacgc300
tatttacaatgcccatgtaaaatcaagtacgacgaagaacgctttgaagctgagctaatt360
acatctcatcatatgcaacgagatactttaaatgccaaattgaaagatatttatatgaat420
CA 02396674 2005-11-29
c
- 2 -
catcgagaccgtcttgatgtagctatggcagcagatgatatttgtacagcaataactaat 480
ggggaacaagtgaaaggcctttacctttatggtccatttgggacaggtaaatcttttatt 540
ctaggtgcaattgcgaatcagctcaaatctaagaaggtacgttcgacaattatttattta 600
ccggaatttattagaacattaaaaggtggctttaaagatggttcttttgaaaagaaatta 660
catcgcgtaagagaagcaaacattttaatgcttgatgatattggggctgaagaagtgact 720
ccatgggtgagagatgaggtaattggacctttgctacattatcgaatggttcatgaatta 780
ccaacattctttagttctaattttgactatagtgaattggaacatcatttagcgatgact 840
cgtgatggtgaagagaagactaaagcagcacgtattattgaacgtgtcaaatctttgtca 900
acaccatactttttatcaggagaaaatttcagaaacaattga 942
<210> 2
<211> 313
<212> PRT
<213> Staphylococcus aureus
<400> 2
Met Gly Gly Gly Gln Ser Ile Met Lys Gln Phe Lys Ser Ile Ile Asn
1 5 10 15
Thr Ser Gln Asp Phe Glu Lys Arg Ile Glu Lys Ile Lys Lys Glu Val
20 25 30
Ile Asn Asp Pro Asp Val Lys Gln Phe Leu Glu Ala His Arg Ala Glu
35 40 45
Leu Thr Asn Ala Met Ile Asp Glu Asp Leu Asn Val Leu Gln Glu Tyr
50 55 60
Lys Asp Gln Gln Lys His Tyr Asp Gly His Lys Phe Ala Asp Cys Pro
65 70 75 80
Asn Phe Val Lys Gly His Val Pro Glu Leu Tyr Val Asp Asn Asn Arg
85 90 95
Ile Lys Ile Arg Tyr Leu Gln Cys Pro Cys Lys Ile Lys Tyr Asp Glu
100 105 110
Glu Arg Phe Glu Ala Glu Leu Ile Thr Ser His His Met Gln Arg Asp
115 120 125
Thr Leu Asn Ala Lys Leu Lys Asp Ile Tyr Met Asn His Arg Asp Arg
130 135 140
Leu Asp Val Ala Met Ala Ala Asp Asp Ile Cys Thr Ala Ile Thr Asn
CA 02396674 2005-11-29
r
- 3 -
145 150 155 160
Gly Glu Gln Val Lys Gly Leu Tyr Leu Tyr Gly Pro Phe Gly Thr Gly
165 170 175
Lys Ser Phe Ile Leu Gly Ala Ile Ala Asn Gln Leu Lys Ser Lys Lys
180 185 190
Val Arg Ser Thr Ile Ile Tyr Leu Pro Glu Phe Ile Arg Thr Leu Lys
195 200 205
Gly Gly Phe Lys Asp Gly Ser Phe Glu Lys Lys Leu His Arg Val Arg
210 215 220
Glu Ala Asn Ile Leu Met Leu Asp Asp Ile Gly Ala Glu Glu Val Thr
225 230 235 240
Pro Trp Val Arg Asp Glu Val Ile Gly Pro Leu Leu His Tyr Arg Met
245 250 255
Val His Glu Leu Pro Thr Phe Phe Ser Ser Asn Phe Asp Tyr Ser Glu
260 265 270
Leu Glu His His Leu Ala Met Thr Arg Asp Gly Glu Glu Lys Thr Lys
275 280 285
Ala Ala Arg Ile Ile Glu Arg Val Lys Ser Leu Ser Thr Pro Tyr Phe
290 295 300
Leu Ser Gly Glu Asn Phe Arg Asn Asn
305 310
<210>
3
<211>
41708
<212>
DNA
<213> aureus
Staphylococcus
<400>
3
gatcaaaatacttggggaacggttagggagtaaacttcgcgataattttaaaaattcatg60
tataacccccctcttataaccattttaaggcaggtgatgaaatggagattatagtcgatg120
aaaatttagtgcttaaagaaaaagaaaggctacaagtattatataaagacatacctagca180
ataaattaaaagtagttgatggtttaattattcaagcagcaaggctacgtgtaatgcttg240
attacatgtgggaagacataaaagaaaaaggtgattatgatttatttactcaatctgaaa300
aggcgccaccatatgaaagggaaagaccagtagccaaactatttaatgctagagatgctg360
catatcaaaaaataatcaaacaattatcggatttattgcccgaagagaaagaagacacag420
aaacgccatctgatgattacctatgattagtaataaatacgttgatgaatatataaattt480
CA 02396674 2005-11-29
- 4 -
gtggaaacaaggaaagataattttaaataaagaaagaattgatctctttaattatctaca540
aaaacatatatattcacgagatgatgtatattttgatgaacagaaaatcgaggattgtat600
caaatttattgaaaaatggtattttccaacattaccatttcaaaggtttatcatagctaa660
tatatttcttatagataaaaatacagatgaagctttctttacagaatttgctattttcat720
gggacgtggaggcgggaaaaacggtctaataagtgctattagtgattttctttctacgcc780
cttacacggagttaaagaatatcacatctccattgttgctaatagtgaagatcaagcaaa840
aacatcgtttgatgaaatcagaaccgttttaatggataacaaacgaaataagacgggtaa900
aacgccaaaagctccttatgaagttagtaaagcaaaaataataaaccgtgcaactaaatc960
ggttattcgatataacacatcaaacacaaaaaccaaagacggtggacgtgaggggtgtgt1020
tatttttgatgaaattcattatttctttggtcctgaaatggtaaacgtcaaacgtggtgg1080
attaggtaaaaagaaaaatagaagaacgttttatataagtactgatggttttgttagaga1140
gggttatatcgatgcaatgaagcacaaaattgcaagtgtattaagtggcaaggttaaaaa1200
tagtagattgtttgctttttattgtaagttagacgatccaaaagaagttgatgacagaca1260
gacgtgggaaaaggcgaacccaatgttacataaaccgttatcagaatacgctaaaacact1320
gctaagcacgattgaagaagaatataacgatttaccattcaaccgttcaaataagcccga1380
attcatgactaagcgaatgaatttgcctgaagttgaccttgaaaaagtaatagcaccatg1440
gaaagaaatactagcgactaatagagagataccaaatttagataatcaaatgtgtattgg1500
tggtttagactttgcaaacattcgagattttgcaagtgtagggctattattccgaaaaaa1560
cgatgattacatttggttaggacattcgtttgtaagacaagggtttttggatgatgtcaa1620
attagaacctcctattaaagaatgggaaaaaatgggattattgaccattgtcgatgatga1680
tgtcattgaaattgaatatatagttgattggtttttaaaggctagagaaaaatatgggct1740
tgaaaaagtcatagctgataattatagaactgatattgtaagacgtgcgtttgaggatgc1800
tggcataaaacttgaagtacttagaaatccaaaagcaatacatggattacttgcaccacg1860
tatcgatacaatgtttgcgaaacataacgtaatatatggagacaatcctttgatgcgttg1920
gtttactaataatgttgctgtaaaaatcaagccggatggaaataaagagtatatcaaaaa1980
agatgaagtcagacgtaaaacggatggattcatggcttttgttcacgcattatatagagc2040
agacgatatagtagacaaagacatgtctaaagcgcttgatgcattaatgagtatagattt2100
ctaatagaggaggtgagacatgagtattctagaaaagatatttaaaactaggaaagatat2160
aacatatatgcttgatttagatatgatagaagatctatcacaacaagcgtatgtgaaacg2220
CA 02396674 2005-11-29
_ 5 _
tttagcgattgatagttgtattgaatttgttgcgcgagctgtcgctcaaagtcattttaa2280
agtattggaaggtaatagaattcaaaagaatgatgtttactacaagttaaatataaaacc2340
aaatactgacttatcaagcgatagtttttggcaacaagttatatataaactaatttatga2400
taacgaggttttaatcgtagtaagtgacagcaaagaattacttatcgcagatagctttta2460
cagagaagagtacgctttgtatgatgatatattcaaagatgtaacggttaaagattatac2520
ttatcaacgtactttcacaatgcaagaggtcatatatttaaagtacaacaacaataaagt2580
gacacactttgtagaaagtctattcgaagattacgggaaaatattcggaagaatgatagg2640
tgcacaattaaaaaactatcaaataagagggattttgaaatctgcctctagcgcatatga2700
cgaaaagaatatagaaaaattacaagcgttcacaaataaattattcaatacttttaataa2760
aaatcaactagcaatcgcgcctttgatagaaggttttgattatgaggaattatctaatgg2820
tggtaagaatagtaacatgcctttttctgaattgagtgagctaatgagagatgcaataaa2880
aaatgttgcgttgatgattggtatacctccaggtttgatttacggagaaacagctgattt2940
ggaaaaaaacacgcttgtatttgagaagttctgtttaacacctttattaaaaaagattca3000
gaacgaattaaacgcgaaactcataacacaaagcatgtatttgaaagatacaagaataga3060
aattgtcggtgtgaataaaaaagacccacttcaatatgctgaagcaattgacaaacttgt3120
aagttctggttcatttacaaggaatgaggtgcggattatgttaggtgaagaaccatcaga3180
caatcctgaattagacgaatacctgattactaaaaactacgaaaaagctaacagtggtga3240
aaatgatgaaaaagaaaaagatgaaaacactttgaaaggtggtgatgaagatgaaagcgg3300
agattaaaggcgtcatcgtttccaacgaagataaatgggtttacgaaatgcttggtatgg3360
attcgacttgtcctaaagatgttttaacacaactagaatttagtgatgaagatgttgata3420
ttataattaactcaaatggtggtaacctagtagctggtagtgaaatatatacacatttaa3480
gagctcataaaggcaaagtgaatgttcgtatcacagcaatagcagcaagtgcggcatcgc3540
ttatcgcaatggctggtgaccacatcgaaatgagtccggttgctagaatgatgattcaca3600
atccttcaagtattgcgcaaggagaagtgaaagatctaaatcatgctgcagaaacattag3660
aacatgttggtcaaataatggctgaggcatatgcggttagagctggtaaaaacaaacaag3720
aacttatagaaatgatggctaaggaaacgtggctaaatgctgatgaagccattgaacaag3780
gttttgcggatagtaaaatgtttgaaaacgacaatatgcaaattgtagcaagcgatacac3840
aagtgttatcgaaagatgtattaaatcgtgtaacagctttggtaagtaaaacgccagagg3900
ttaacattgatattgacgcaatagcaaataaagtaattgaaaaaataaatatgaaagaaa3960
CA 02396674 2005-11-29
- 6 -
aggaatcagaaatcgatgttgcagatagtaaattatcagcaaatggattttcaagattcc4020
ttttttaatacaaaaataggaggtcataaaatgactataaatttatcggaaacattcgca4080
aatgcgaaaaacgaatttattaatgcagtaaacaacggtgaaccgcaagaaagacaaaat4140
gaattgtacggtgacatgattaaccaactatttgaagaaactaaattacaagcaaaagca4200
gaagctgaaagagtttctagtttacctaaatcagcacaaactttgagtgcaaaccaaaga4260
aatttctttatggatatcaataagagtgttggatataaagaagaaaaacttttaccagaa4320
gaaacaattgatagaatcttcgaagatttaacaacgaatcatccattattagctgactta4380
ggtattaaaaatgctggtttgcgtttgaagttcttaaaatccgaaacttctggcgtggct4440
gtttggggtaaaatctatggtgaaattaaaggtcaattagatgctgcgttcagtgaagaa4500
acagcaattcaaaataaattgacagcgtttgttgttttaccaaaagatttaaatgatttt4560
ggtcctgcgtggattgaaagatttgttcgtgttcaaatcgaagaagcatttgcagtggcg4620
cttgaaactgcgttcttaaaaggtactggtaaagaccaaccgattggcttaaaccgtcaa4680
gtacaaaaaggtgtatcggtaactgatggtgcttatccagagaaagaagaacaaggtacg4740
cttacatttgctaatccgcgcgctacggttaatgaattgacgcaagtgtttaaataccac4800
tcaactaacgagaaaggtaaatcagtagcggttaaaggtaatgtaacaatggttgttaat4860
ccgtccgatgcttttgaggttcaagcacagtatacacatttaaatgcaaatggcgtatat4920
gttactgctttaccatttaatttgaatgttattgagtctacagttcaagaagcaggtaag4980
gttttaacgtacgttaaaggtctatatgatggttatttagctggtggtattaatgttcag5040
aaatttaaagaaacacttgcgttagatgatatggatttatacactgcaaaacaatttgct5100
tacggcaaagcgaaagataataaagttgctgctgtttggaaattagatttaaaaggacat5160
aaaccagctttagaagataccgaagaaacactataaaattttatgaggtgataaaatggt5220
gaaatttaaagttgttagagaatttaaagacatagagcacaatcaacacaagtacaaagt5280
aggggagttgtatccagctgaagggtataacaatcctcgtgttgaattgttgacaaatca5340
aatcaaaaataagtacgacaaagtttatatcgtacctttagataagctgacaaaacaaga5400
attattagaactatgcgaatcattacaaaaaaaagcgtctagttcaatggttaaaagtga5460
aatcatcgacttattgaatggtgaagacaatgacgattgatgatttgcttgtcaaattta5520
aatcacttgaaaagattgaccataattcagaggatgagtacttaaagcagttgttaaaaa5580
tgtcgtacgagcgtataaaaaatcagtgcggagtttttgaattagagaatttaataggtc5640
aagaattgatacttatacgcgctagatatgcttatcaagatttattagaacacttcaacg5700
CA 02396674 2005-11-29
_ 7 _
acaattacagacctgaaataatagatttttcgttatctctaatggaggtatcagaagatg5760
aagaaagtgtttaagaaacctagaattacaactaaacgtttaaatacgcgtgttcatttt5820
tataagtatactgaaaataatggtccagaagctggagaaaaagaagaaaaattattatat5880
agctgttgggcgagtattgatggtgtctggttacgtgaattagaacaagctatctcaaac5940
ggaacgcaaaatgacattaaattgtatattcgtgatccgcaaggtgattatttacccagt6000
gaagaacattatcttgaaattgaatcaagatatttcaaaaatcgtttgaatataaagcaa6060
gtatcaccagatttggataataaagactttattatgattcgcggaggatatagttcatga6120
gtgtgaaagtgacaggtgataaagcattagaaagagaattagaaaaacattttggcataa6180
aagagatggtaaaagttcaagataaggcgttaatagctggtgctaaggtaattgttgaag6240
aaataaaaaaacaactcaaaccttcagaagactcaggagcactgattagtgagattggtc6300
gtactgaacctgaatggataaaggggaaacgtactgttacaattaggtggcgtgggcctt6360
ttgaacgatttagaatagtacatttaattgaaaatggtcatgttgagaaaaagtcaggaa6420
aatttgtaaaacctaaagctatgggtgggattaatagagcaataagacaagggcaaaata6480
agtattttgagacgctaaaaagggagttgaaaaaattgtgattgatattttgtacaaagt6540
tcatgaagtgattagtcaagacagaattattagagagcacgtaaatatcaataatattaa6600
gttcaataaataccctaatgtaaaagatactgatgtaccttttattgttattgacgatat6660
cgacgacccaatacctacaacttatactgacggagatgagtgtgcatatagttatattgt6720
ccaaatagatgtttttgttaagtacaatgatgaatataatgcgagaatcataagaaataa6780
gatatctaatcgcattcaaaagttattatggtctgaactaaaaatgggaaatgtttcaaa6840
tggaaaaccggaatatatagaagaatttaaaacatatagaagctctcgcgtttacgaggg6900
cattttttataaggaggaaaattaaatggcagtaaaacatgcaagtgcgccaaaggcgta6960
tattaacattactggtttaggtttcgctaaattaacgaaagaaggcgcggaattaaaata7020
tagtgatattacaaaaacaagaggattacaaaaaattggtgttgaaactggtggagaact7080
aaaaacagcttatgctgatggcggtccaattgaatcagggaatacagacggagaaggtaa7140
aatctcattacaaatgcatgcgttccctaaagagattcgcaaaattgtttttaatgaaga7200
ttatgatgaagatggcgtttacgaagagaaacaaggtaaacaaaacaattacgtagctgt7260
atggttcagacaagagcgtaaagacggtacatttagaacagttttattacctaaagttat7320
gtttacaaatcctaaaatcgatggagaaacggctgagaaagattgggatttctcaagtga7380
agaggttgaaggtgaggcacttttccctttagttgataataaaaagtcagtacgtaagta7440
CA 02396674 2005-11-29
tatctttgattcagctaacatgacaaatcatgatggagacggtgaaaaaggcgaagaggc7500
tttcttaaagaaaattttaggcgaagaatatactggaaacgtgacagagggtaacgaaga7560
aactttgtaacaaaaccggcttcatcggaaactgcggtaaagtcggttaatataccagat7620
agcattaaaacacttaaagttggcgacacatacgatttaaatgttgtagtagagccatct7680
aatcaaagtaagttattgaaatacacaacagatcaaacgaatattgtatcaatcaatagt7740
gatggtcaagttactgcggaagcacaaggcattgctacggttaaagcaacagttggtaat7800
atgagtgacactataacaataaatgtagaagcataagagggggcaacccctctattttat7860
ttgaaaataaggagagtattataaaatggcaaaattaaaacgtaacattattcaattagt7920
agaagatccaaaagcaaatgaaattaaattacaaacgtacttaacaccacacttcatttc7980
atttgaaattgtatacgaagcaatggatttaatcgatgatattgaggacgaaaatagcac8040
gatgaagccaagagaaatcgctgacagattgatggatatggttgtaaaaatttacgataa8100
ccaattcacagttaaagacctaaaagaacgtatgcatgcacctgatggaatgaatgcact8160
tcgtgaacaagtgattttcattactcaaggtcaacaaactgaggaaactagaaattttat8220
ccagaacatgaaataaagcctgaagatttaacatataaagcaatgttgaaaaatatggat8280
actctcatgatggacttaattgaaaatggtaaagacgctaacgaagttttaaaaatgcca8340
tttcattatgtgctttccatatatcaaaataaaaataatgacatttctgaagaaaaagca8400
gaggctttaattgatgcattttaaccttaaccgtttggttagggttatttttttgaactt8460
ttttagaaaggaggtaaaaaatgggagaaagaataaaaggtttatctataggtttggatt8520
tagatgcagcaaatttaaatagatcatttgcagaaatcaaacgaaactttaaaactttaa8580
attctgacttaaaattaacaggcaacaacttcaaatataccgaaaaatcaactgatagtt8640
acaaacaaaggattaaagaacttgatggaactatcacaggttataagaaaaacgttgatg8700
atttagccaagcaatatgacaaggtatctcaagaacagggcgaaaacagtgcagaagctc8760
aaaagttacgacaagaatataacaaacaagcaaatgagctgaattatttagaaagagaat8820
tacaaaaaacatcagccgaatttgaagagttcaaaaaagctcaagttgaagctcaaagaa8880
tggcagaaagtggctggggaaaaaccagtaaagtttttgaaagtatgggacctaaattaa8940
caaaaatgggtgatggtttaaaatccattggtaaaggtttgatgattggtgtaactgcac9000
ctgttttaggtattgcagcagcatcaggaaaagcttttgcagaagttgataaaggtttag9060
atactgttactcaagcaacaggcgcaacaggcagtgaattaaaaaaattgcagaactcat9120
ttaaagatgtttatggcaattttccagcagatgctgaaactgttggtggagttttaggag9180
CA 02396674 2005-11-29
_ g _
aagttaatac aaggttaggt tttacaggta aagaacttga aaatgccaca gagtcattct 9240
tgaaattcag tcatataaca ggttctgacg gtgtgcaagc cgtacagtta attacccgtg 9300
caatgggcga tgcaggtatc gaagcaagtg aatatcaaag tgttttggat atggtagcaa 9360
aagcggcgca agctagtggg ataagtgttg atacattagc tgatagtatt actaaatacg 9420
gcgctccaat gagagctatg ggctttgaga tgaaagaatc aattgcttta ttctctcaat 9480
gggaaaagtc aggcgttaat actgaaatag cattcagtgg tttgaaaaaa gctatatcaa 9540
attggggtaa agctggtaaa aacccaagag aagaatttaa gaagacatta gcagaaattg 9600
aaaagacgcc ggatatagct agcgcaacaa gtttagcgat tgaagcattt ggtgcaaagg 9660
caggtcctga tttagcagac gctattaaag gtggtcgctt tagttatcaa gaatttttaa 9720
aaactattga agattcccaa ggcacagtaa accaaacatt taaagattct gaaagtggct 9780
ccgaaagatt taaagtagca atgaataaat taaaattagt aggtgctgat gtatgggctt 9840
ctattgaaag tgcgtttgct cccgtaatgg aagaattaat caaaaagcta tctatagcgg 9900
ttgattggtt ttccaattta agtgatggtt ctaaaagatc aattgttatt ttcagtggta 9960
ttgctgctgc aattggtcct gtagtttttg ggttaggtgc atttataagt acaattggca 10020
atgcagtaac tgtattagct ccattgttag ctagtattgc aaaggctggt ggattgatta 10080
gttttttatc gactaaagta cctatattag gaactgtctt cacagcttta actggtccaa 10140
ttggcattgt attaggtgta ttggctggtt tagcagtcgc atttacaatt gcttataaga 10200
aatctgaaac atttagaaat tttgttaatg gtgcaattga aagtgttaaa caaacattta 10260
gtaattttat tcaatttatt caacctttcg ttgattctgt taaaaacatc tttaaacaag 10320
cgatatcagc aatagttgat ttcgcaaaag atatttggag tcaaatcaat ggattcttta 10380
atgaaaacgg aatttccatt gttcaagcac ttcaaaatat atgcaacttt attaaagcga 10440
tatttgaatt tattttaaat tttgtaatta aaccaattat gttcgcgatt tggcaagtga 10500
tgcaatttat ttggccggcg gttaaagcct tgattgtcag tacttgggag aacataaaag 10560
gtgtaataca aggtgcttta aatatcatac ttggcttgat taagttcttc tcaagtttat 10620
tcgttggtga ttggcgagga gtttgggacg ccgttgtgat gattcttaaa ggagcagttc 10680
aattaatttg gaatttagtt caattatggt ttgtaggtaa aatacttggt gttgttaggt 10740
actttggcgg gttgctaaaa ggattgatag caggaatttg ggacgtaata agaagtatat 10800
tcagtaaatc tttatcagca atttggaatg caacaaaaag tatttttgga tttttattta 10860
atagcgtaaa atcaattttc acaaatatga aaaattggtt atctaatact tggagcagta 10920
CA 02396674 2005-11-29
- 10 -
tccgtacgaa tacaatagga aaagcgcagt cattatttag tggcgtcaaa tcaaaattta 10980
ctaatttatg gaatgcgacg aaagaaattt ttagtaattt aagaaattgg atgtcaaata 11040
tttggaattc cattaaagat aatacggtag gaattgcaag ccgtttatgg agtaaggtac 11100
gtggaatttt cacaaatatg cgcgatggct tgagttccat tatagataag attaaaagtc 11160
atatcggcgg tatggtaagc gctattaaaa aaggacttaa taaattaatc gacggtttaa 11220
actgggtcgg tggtaagttg ggaatggata aaatacctaa gttacacact ggtacagagc 11280
acacacatac tactacaaga ttagttaaga acggtaagat tgcacgtgac acattcgcta 11340
cagttgggga taagggacgc ggaaatggtc caaatggttt tagaaatgaa atgattgaat 11400
tccctaacgg taaacgtgta atcacaccta atacagatac taccgcttat ttacctaaag 11460
gctcaaaagt atacaacggt gcacaaactt attcaatgtt aaacggaacg cttccaagat 11520
ttagtttagg tactatgtgg aaagatatta aatctggtgc atcatcggca tttaactgga 11580
caaaagataa aataggtaaa ggtaccaaat ggcttggcga taaagttggc gatgttttag 11640
attttatgga aaatccaggc aaacttttaa attatatact tgaagctttt ggaattgatt 11700
tcaattcttt aactaaaggt atgggaattg caggcgacat aacaaaagct gcatggtcta 11760
agattaagaa aagtgctact gattggataa aagaaaattt agaagctatg ggcggtggcg 11820
atttagtcgg cggaatatta gaccctgaca aaattaatta tcattatgga cgtaccgcag 11880
cttataccgc tgcaactgga agaccatttc atgaaggtgt cgattttcca tttgtatatc 11940
aagaagttag aacgccgatg ggtggcagac ttacaagaat gccatttatg tctggtggtt 12000
atggtaatta tgtaaaaatt actagtggcg ttatcgatat gctatttgcg catttgaaaa 12060
actttagcaa atcaccacct agtggcacga tggtaaagcc cggtgatgtt gttggtttaa 12120
ctggtaatac cggatttagt acaggaccac atttacattt tgaaatgagg agaaatggac 12180
gacattttga ccctgaacca tatttaagga atgctaagaa aaaaggaaga ttatcaatag 12240
gtggtggcgg tgctacttct ggaagtggcg caacttatgc cagtcgagta atccgacaag 12300
cgcaaagtat tttaggtggt cgttataaag gtaaatggat tcatgaccaa atgatgcgcg 12360
ttgcaaaacg tgaaagtaac taccagtcaa atgcagtgaa taactgggat ataaatgctc 12420
aaagaggaga cccatcaaga ggattattcc aaatcatcgg ctcaactttt agagcaaacg 12480
ctaaacgtgg atatactaac tttaataatc cagtacatca aggtatctca gcaatgcagt 12540
acattgttag acgatatggt tggggtggtt ttaaacgtgc tggtgattac gcatatgcta 12600
caggtggaaa agtttttgat ggttggtata acttaggtga agacggtcat ccagaatgga 12660
CA 02396674 2005-11-29
- 11 -
ttattccaac agatccagct cgtagaaatg atgcaatgaa gattttgcat tatgcagcag 12720
cagaagtaag agggaaaaaa gcgagtaaaa ataagcgtcc tagccaatta tcagacttaa 12780
acgggtttga tgatcctagc ttattattga aaatgattga acaacagcaa caacaaatag 12840
ctttattact gaaaatagca caatctaacg atgtgattgc agataaagat tatcagccga 12900
ttattgacga atacgctttt gataaaaagg tgaacgcgtc tatagaaaag cgagaaaggc 12960
aagaatcaac aaaagtaaag tttagaaaag gaggaattgc tattcaatga tagacactat 13020
taaagtgaac aacaaaacaa ttccttggtt gtatgtcgaa agagggtttg aaataccctc 13080
ttttaattat gttttaaaaa cagaaaatgt agatggacgt tcggggtcta tatataaagg 13140
gcgtaggctt gaatcttata gttttgatat acctttggtg gtacgtaatg actatttatc 13200
tcacaacggc attaaaacac atgatgacgt cttgaatgaa ttagtaaagt tttttaacta 13260
cgaggaacaa gttaaattac aattcaaatc taaagattgg tactggaacg cttatttcga 13320
aggaccaata aagctgcaca aagaatttac aatacctgtt aagttcacta tcaaagtagt 13380
actaacagac ccttacaaat attcagtaac aggaaataaa aatactgcga tttcagacca 13440
agtttcagtt gtaaatagtg ggactgctga cactccttta attgttgaag cccgagcaat 13500
taaaccatct agttacttta tgattactaa aaatgatgaa gattatttta tggttggtga 13560
tgatgaggta accaaagaag ttaaggatta catgcctcct gtttatcata gtgagtttcg 13620
tgatttcaaa ggttggacta agatgattac tgaagatatt ccaagtaatg acttaggtgg 13680
taaggtcggc ggtgactttg tgatatccaa tcttggcgaa ggatataaag caactaattt 13740
tcctgatgca aaaggttggg ttggtgctgg cacgaaacga gggctcccta aagcgatgac 13800
agattttcaa attacctata aatgtattgt tgaacaaaaa ggtaaaggtg ccggaagaac 13860
agcacaacat atttatgata gtgatggtaa gttacttgct tctattggtt atgaaaataa 13920
atatcatgat agaaaaatag gacatattgt tgttacgttg tataaccaaa aaggagaccc 13980
caaaaagata tacgactatc agaataaacc gataatgtat aacttggaca gaatcgttgt 14040
ttatatgcgg ctcagaagag taggtaataa attttctatt aaaacttgga aatttgatca 14100
cattaaagac ccagatagac gtaaacctat tgatatggat gagaaagagt ggatagatgg 14160
cggtaagttt tatcagcgtc cagcttctat catagctgtc tatagtgcga agtataacgg 14220
ttataagtgg atggagatga atgggttagg ttcattcaat acggagattc taccgaaacc 14280
gaaaggcgca agggatgtca ttatacaaaa aggtgattta gtaaaaatag atatgcaagc 14340
aaaaagtgtt gtcatcaatg aggaaccaat gttgagcgag aaatcgtttg gaagtaatta 14400
CA 02396674 2005-11-29
- 12 -
tttcaatgtt gattctgggt acagtgaatt aatcatacaa cctgaaaacg tctttgatac 14460
gacggttaaa tggcaagata gatatttata gaaaggagat gagagtgtga tacatgtttt 14520
agattttaac gacaagatta tagatttcct ttctactgat gacccttcct tagttagagc 14580
gattcataaa cgtaatgtta atgacaattc agaaatgctt gaactgctca tatcatcaga 14640
aagagctgaa aagttccgtg aacgacatcg tgttattata agggattcaa acaaacaatg 14700
gcgtgaattt attattaact gggttcaaga tacgatggac ggctacacag agatagaatg 14760
tatagcgtct tatcttgctg atataacaac agctaaaccg tatgcaccag gcaaatttga 14820
gaaaaagaca acttcagaag cattgaaaga tgtgttgagc gatacaggtt gggaagtttc 14880
tgaacaaacc gaatacgatg gcttacgtac tacgtcatgg acttcttatc aaactagata 14940
tgaagtttta aagcaattat gtacaaccta taaaatggtt ttagattttt atattgagct 15000
tagctctaat accgtcaaag gtagatatgt agtactcaaa aagaaaaaca gcttattcaa 15060
aggtaaagaa attgaatatg gtaaagattt agtcgggtta actaggaaga ttgatatgtc 15120
agaaatcaaa acagcattaa ttgctgtggg acctgaaaat gacaaaggga agcgtttaga 15180
gctagttgtg acagatgacg aagcgcaaag tcaattcaac ctacctatgc gctatatttg 15240
ggggatatat gaaccacaat cagatgatca aaatatgaat gaaacacgat taagttcttt 15300
agccaaaaca gagttaaata aacgtaagtc ggcagttatg tcatatgaga ttacttctac 15360
tgatttggaa gttacgtatc cgcacgagat tatatcaatt ggcgatacag tcagagtaaa 15420
acatagagat tttaacccgc cattgtatgt agaggcagaa gttattgctg aagaatataa 15480
cataatttca gaaaatagca catatacatt cggtcaacct aaagagttca aagaatcaga 15540
attacgagaa gagtttaaca agcgattgaa cataatacat caaaagttaa acgataatat 15600
tagcaatatc aacactatag ttaaagatgt tgtagatggt gaattagaat actttgaacg 15660
caaaatacac aaaagtgata caccgccaga aaatccagtc aatgatatgc tttggtatga 15720
tacaagtaac cctgatgttg ctgtcttgcg tagatattgg aatggtcgat ggattgaagc 15780
aacaccaaat gatgttgaaa aattaggtgg tataacaaga gagaaagcgc tattcagtga 15840
attaaacaat atttttatta atttatctat acaacacgct agtcttttgt cagaagctac 15900
agaattactg aatagcgagt acttagtaga taatgatttg aaagcggact tacaagcaag 15960
tttagacgct gtgattgatg tttataatca aattaaaaat aatttagaat ctatgacacc 16020
cgaaactgca acgattggtc ggttggtaga tacacaagct ttatttcttg agtatagaaa 16080
gaaattacaa gatgtttata cagatgtaga agatgtcaaa atcgccattt cagatagatt 16140
CA 02396674 2005-11-29
- 13 -
taaattatta cagtcacaat acactgatga aaaatataaa gaagcgttgg aaataatagc 16200
aacaaaattt ggtttaacgg tgaatgaaga tttgcagtta gtcggagaac ctaatgttgt 16260
taaatcagct attgaagcag ctagagaatc cacaaaagaa caattacgtg actatgtaaa 16320
aacatcggac tataaaacag acaaagacgg tattgttgaa cgtttagata ctgctgaagc 16380
tgagagaacg actttaaaag gtgaaatcaa agataaagtt acgttaaacg aatatcgaaa 16440
cggattggaa gaacaaaaac aatatactga tgaccagtta agtgatttgt ccaataatcc 16500
tgagattaaa gcaagtattg aacaagcaaa tcaagaagcg caagaagctt taaaatcata 16560
cattgatgct caagatgatc ttaaagagaa ggaatcgcaa gcgtatgctg atggtaaaat 16620
ttcggaagaa gagcaacgcg ctatacaaga tgctcaagct aaacttgaag aggcaaaaca 16680
aaacgcagaa ctaaaggcta gaaacgctga aaagaaagct aatgcttata cagacaacaa 16740
ggtcaaagaa agcacagatg cacagaggaa aacattgact cgctatggtt ctcaaattat 16800
acaaaatggt aaggaaatca aattaagaac tactaaagaa gagtttaatg caaccaatcg 16860
tacactttca aatatattaa acgagattgt tcaaaatgtt acagatggaa caacaatcag 16920
atatgatgat aacggagtgg ctcaagcttt gaatgtgggg ccacgtggta ttagattaaa 16980
tgctgataaa attgatatta acggtaatag agaaataaac cttcttatcc aaaatatgcg 17040
agataaagta gataaaaccg atattgtcaa cagtcttaat ttatcaagag agggtcttga 17100
tatcaatgtt aatagaattg gaattaaagg cggtgacaat aacagatatg ttcaaataca 17160
gaatgattct attgaactag gtggtattgt gcaacgtact tggagaggga aacgttcaac 17220
agacgatatt tttacgcgac tgaaagacgg tcacctaaga tttagaaata acaccgctgg 17280
cggttcactt tatatgtcac attttggtat ttcgacttat attgatggtg aaggtgaaga 17340
cggtggttca tctggtacga ttcaatggtg ggataaaact tacagtgata gtggcatgaa 17400
tggtataaca atcaattcct atggtggtgt cgttgcacta acgtcagata ataatcgggt 17460
tgttctggag tcttacgctt catcgaatat caaaagcaaa caggcaccgg tgtatttata 17520
tccaaacaca gacaaagtgc ctggattaaa ccgatttgca ttcacgctgt ctaatgcaga 17580
taatgcttat tcgagtgacg gttatattat gtttggttct gatgagaact atgattacgg 17640
tgcgggtatc aggttttcta aagaaagaaa taaaggtctt gttcaaattg ttaatggacg 17700
atatgcaaca ggtggagata caacaatcga agcagggtat ggcaaattta atatgctgaa 17760
acgacgtgat ggtaataggt atattcatat acagagtaca gacctactgt ctgtaggttc 17820
agatgatgca ggagatagga tagcttctaa ctcaatttat agacgtactt attcggccgc 17880
CA 02396674 2005-11-29
- 14 -
agctaatttg catattactt ctgctggcac aattgggcgt tcgacatcag cgcgtaaata 17940
caagttatct atcgaaaatc aatataacga tagagatgaa caactggaac attcaaaagc 18000
tattcttaac ttacctatta gaacgtggtt tgataaagct gagtctgaaa ttttagctag 18060
agagctgaga gaagatagaa aattatcgga agacacctat aaacttgata gatacgtagg 18120
tttgattgct gaagaggtgg agaatttagg attaaaagag tttgtcacgt atgatgacaa 18180
aggagaaatt gaaggtatag cgtatgatcg tctatggatt catcttatcc ctgttatcaa 18240
agaacaacaa ctaagaatca agaaattgga ggagtcaaag aatgcaggat aacaaacaag 18300
gattacaagc taatcctgaa tatacaattc attatttatc acaggaaatt atgaggttaa 18360
cacaagaaaa cgcgatgtta aaagcgtata tacaagaaaa taaagaaaat caacaatgtg 18420
ctgaggaaga gtaatcctta gcactatttt tatacaaaaa tttaaggagg tcatttaatt 18480
atggcaaaag aaattatcaa caatacagaa aggtttattt tagtacaaat cgacaaagaa 18540
ggtacagaac gtgtagtata tcaagatttc acaggaagtt ttacaacttc tgaaatggtt 18600
aaccatgctc aagattttaa atctgaagaa aacgctaaga aaattgcgga gacgttaaat 18660
ttgttatatc aattaactaa caaaaaacaa cgtgtgaaag tagttaaaga agtagttgaa 18720
agatcagatt tatctccaga ggtaacagtt aacactgaaa cagtatgaaa agctatgagt 18780
tagatactca tagtctttat tcttttagaa agcgggtgta ctgaattggg gtggttcaaa 18840
aaacacgaac atgaatggcg catcagaagg ttagaagaga atgataaaac aatgctcagc 18900
acactcaacg aaattaaatt aggtcaaaaa acccaagagc aagttaacat taaattagat 18960
aaaaccttag atgctattca aaaagaaaga gaaatagatg aaaagaataa gaaagaaaat 19020
gataagaaca tacgtgatat gaaaatgtgg gtgcttggtt tagttgggac aatatttggg 19080
tcgctaatta tagcattatt gcgtatgctt atgggcatat aagagaggtg attaccatgt 19140
tcggattaaa ttttggagct tcgctgtgga cgtgtttctg gtttggtaag tgtaagtaat 19200
agttaagagt cagtgcttcg gcactggctt tttattttgg ataaaaggag caaacaaatg 19260
gatgcaaaag taataacaag atacatcgta ttgatcttag cattagtaaa tcaattctta 19320
gcgaacaaag gtattagccc aattccagta gacgatgaaa ctatatcatc aataatactt 19380
actgtagtcg ctttatatac aacgtataaa gacaatccaa catctcaaga aggtaaatgg 19440
gcaaatcaaa aattaaagaa atataaagct gaaaataagt atagaaaagc aacagggcaa 19500
gcgccaatta aagaagtaat gacacctacg aatatgaacg acacaaatga tttagggtag 19560
gtggttgata tatgttaatg acaaaaaatc aagcagaaaa atggtttgac aattcattag 19620
CA 02396674 2005-11-29
- 15 -
ggaaacaatt caacccagat ggttggtatg gatttcagtg ttatgattac gccaatatgt 19680
tctttatgtt agcgacaggc gaaaggctgc aaggtttata tgcttataat atcccgtttg 19740
ataataaagc aaagattgaa aaatatggtc aaataattaa aaactatgac agctttttac 19800
cgcaaaagtt ggatattgtc gttttcccgt caaagtatgg tggcggagct ggacacgttg 19860
aaattgttga gagcgcaaat ttaaatactt tcacatcatt tggtcaaaac tggaacggta 19920
aaggttggac taatggcgtt gcgcaacctg gttggggtcc tgaaactgtg acaagacatg 19980
ttcattatta tgacaatcca atgtatttta ttaggttaaa cttccctaac aacttaagcg 20040
ttggcaataa agctaaaggt attattaagc aagcgactac aaaaaaagag gcagtaatta 20100
aacctaaaaa aattatgctt gtagccggtc atggttataa cgatcctgga gcagtaggaa 20160
acggaacaaa cgaacgcgat tttatacgta aatatataac gcctaatatc gctaagtatt 20220
taagacatgc aggacatgaa gttgcattat acggtggctc aagtcaatca caagatatgt 20280
atcaagatac tgcatacggt gttaatgtag gcaataaaaa agattatggc ttatattggg 20340
ttaaatcaca ggggtatgac attgttctag aaatacattt agacgcagca ggagaaagcg 20400
caagtggtgg gcatgttatt atctcaagtc aattcaatgc agatactatt gataaaagta 20460
tacaagatgt tattaaaaat aacttaggac aaataagagg tgtgacacct cgtaatgatt 20520
tactaaatgt taatgtatca gcagaaataa atataaatta tcgtttatct gaattaggtt 20580
ttattactaa taaaaatgat atggattgga ttaagaaaaa ctatgacttg tattctaaat 20640
taatagccgg tgcgattcat ggtaagccta taggtggttt ggtagctggt aatgttaaaa 20700
catcagctaa aaacaaaaaa aatccaccag tgccagcagg ttatacactc gataagaata 20760
atgtccctta taaaaaagaa caaggcaatt acacagtagc taatgttaaa ggtaataatg 20820
taagagacgg ttattcaact aattcaagaa ttacaggggt attacccaac aacacaacaa 20880
ttacgtatga cggtgcatat tgtattaatg gttatagatg gattacttat attgctaata 20940
gtggacaacg tcgttatata gcgacaggag aggtagacaa ggcaggtaat agaataagta 21000
gttttggtaa gtttagcacg atttagtatt tacttagaat aaaaattttg ctacattaat 21060
tatagggaat cttacagtta ttaaataact atttggatgg atgttaatat tcctatacac 21120
tttttaacat ttctctcaag atttaaatgt agataacagg caggtacttc ggtacttgcc 21180
tattttttta tgttatagct agccttcggg ctagtttttt gttatgatgt gttacacatg 21240
catcaactat ttacatctat ccttgttcac ccaagcatgt cactggatgt tttttcttgc 21300
gatagagagc atagttttca tactactccc cgtagtatat atgactttag cattcccgta 21360
CA 02396674 2005-11-29
- 16 -
taacagttta cggggtgctt ttatgttata attgctttta tatagtagga gtgaactata 21420
tagccgggca gaggccatgt atctgactgt tggtcccaca ggagacatct tccttgtcat 21480
cactcgatac atatatctta acaacataga aatgttacat tcgctataac cgtatcttaa 21540
tcgatacggt tatatttatt cccctacaac caacaaaacc acagatccta ttaatttagg 21600
attgtggtta ttttttgcgt ttttttgggg caaaaaaagg gcagattatt tgaaaaaggg 21660
caaacgcttg tggaaaagct aaaaggttaa aaatgacaaa aaccttgata caacagtgtt 21720
tttggacgct cgtgtacgtt agagaatgac cggtttacca tcatacaagg gtgggattaa 21780
cttgtgttaa aaagccttta atatcagttg ttacaaagga tttgtagcgt ctttaaaaat 21840
aaaaaagggc agaaaaaggg cagatacctt ttagtacaca agtttttcta atttttgctc 21900
taactctctg tccattttct ctgttacatg tgtatacacc tttatagtcg ttttttcatc 21960
tgtatgtcct actcttttca taattgcttt taacgatata ttcatttccg ccaataaact 22020
tatgtgtgta tgccttagtg tgtgagtagt aactttttta tttatattta atgattctgc 22080
agctgaggac aatcgtttgt ttatcctact gccttgcata ggatttcctt ggcaagttgt 22140
gaatataaac cctctatcaa catagcttgg ttcccattgt tgcatctttt tattttctaa 22200
cattattttt ttcaatacat ttgctatcct tgaattgatg gcgatttttc ttcttgaacc 22260
tgcggtctta gtagtatctt tgtgaccaaa tccagcatta catttgattc tgtgaatagt 22320
gccattaata gcgatcgttt tatttttgag gtcaacatct ttaacttgga gagctaataa 22380
ctcacctatg cgcatacctg ttaaagcttg aacttctaca gccccagcaa ctaaaatacg 22440
agctctatac tgcatgttat tatcgttcag tataaaatcg cgtatctgta ttacctgttc 22500
catctctaaa tagttataca ttttcgcttc ttctttttct atatcttcta tcgtcttact 22560
cttctttggt agtgtgacgc tatttaatat gtgttcgttt ggataattgt aaaatttaac 22620
ggcgtattta atagcttctt tcatatgtcc aagttgacgc tttacctgat ttgcagaata 22680
tacgtttgat aatttgttaa taaatgtttg catgtacttt gtatcaattt tgtttaaaag 22740
taaattttga gaactgttct ttttgatgtt tttgattctt gttttcaaat tatcaagcgt 22800
cgttacttta aagccagatg tttttatatg atattcaagc cattcatcta ataacgcgtg 22860
aaaagtcaaa gtttttaatt cgcttgacga cttgttgttt agtttttctt ttattttttc 22920
ttctaaacga aacattgcct ctttttgcga ttgctttgta ttcttattca agacaacact 22980
tacacgtttc catttatctg tatacggatc tttgtatttc tcgtagtatc tatacttcgt 23040
ttcattgttc ttatttttaa atttttcaaa ccacatttta catccctcct caaaattggc 23100
CA 02396674 2005-11-29
- 17 -
aaaaaataat aagggtaggc gggctaccca tgaaaattgt ataaaaaaag acgcctgtat 23160
aaaatacaga cgccacttat aattataaga ttacatggtt aattaccaaa aatggtaacg 23220
aatatatacg tgttttaaag gataaacctt taatatatta aaattatatc atcttatatc 23280
agggatctgc aatatattat tattaattct atttatcagt aacataatat ccgaagaatc 23340
tattactgga tttttaattt tttggggtaa aacttttctt atgcgaaact tactaatcgg 23400
ctggaaagaa tttatgcaag cgtaactatt accttttaat ttttttacct tatcaattgc 23460
tgatactatg ttattaatgt ttctgtcaat tttatttaat ttattttcaa tttctaaact 23520
atcagatata aattcaataa aataatcttt agtgatgaat tctgtgttgt ttttttggta 23580
ttttttatcg aaaacttctt ttaatatagc, tgaattattt tgcgcgctaa ttaaatttaa 23640
aaacaatctt aaataatact cccatttcaa atcaaaattc atctttaaat actttttgtt 23700
ttctttagag gataagggaa taacatttac tatatcctcc gtattagaat catttttatt 23760
catcactatt gcaaagtgtg aattagaaaa ttctttatta acgtttatac cgaaatctac 23820
aaaaactatt tctccttgtt taaactttgg ataaaaacct ttatggtttt tttcaccttc 23880
aaatctcttg agtaaatagt gaatatctga atctaacttt ttaaattttg gatttccaga 23940
agtttttaat ttattaatgc gtttttctat attatgcgtc atcatttctc ctttattctc 24000
gctcacactc tcaccaccat tcaacgtcta cacttgtagg cgttttttga ttagtaaaat 24060
cataatgaat cttctttggt taacttatcg ccatctattt tttgtgaaat aaattccaag 24120
tatttacgcg cattatgtga cgataaatct ttaggtaact cataagtgaa tggttgatta 24180
ccactagtta aaacttcata tactatagtt tcttttttta ttttgcaatt agttattttc 24240
attataaact ccttttaaac actgctgaaa tagacgtctt tttcaaataa gcatgattaa 24300
tactttaatt ctttaatcca catatattta aaagtgaggt agtaggtaat aaatataaga 24360
cttaaagtta agattgcttt tttcatgtca atttctcctt tgtttatatt tatattaaag 24420
cgctaaatat acgttattaa tcacaataca actttgccca ttactttaat atcactaaac 24480
gaagcgactt tgatatcatc atacttcgga tttagagata ccaaattaat atagtcttcg 24540
catatatcta cacgcttgat aagacttact ccatctaata caacgagtgc aattgtacca 24600
tctttaatag aatcttcttt cttaataaaa gcgtatgttc cttgttttaa cataggttcc 24660
attgaatcac cattaactaa aatacaaaaa tcagcatttg atggcgtttc gtcttcttta 24720
aaaaatactt cttcatgcaa tatgtcatca tataattctt ctcctatgcc agcaccagtt 24780
gcaccacatg caatatacga tactagttta gactctttat attcatctat agaagtgact 24840
CA 02396674 2005-11-29
- 18 -
ttattctgtt catctaattg ctcatttgca tagttaagta cgttttcttg gcggggaggt 24900
gtgagttgag aaaatatgtt attgattttt gacattatcg tttcatcttg acgttcttcg 24960
tcaggaactc gataagaatc tacatcatac cccataagcc acgcttcacc gacatttaaa 25020
gttttagata ataagaataa tttatgttgg tctggagaag accttccatt aacatactgg 25080
gataagtgac tttttgacat tttaatattc aattcttttt gaaagggttt cgacttttct 25140
agaatatcta cttgacgcaa gttcctatct ttcataattt gttttaatct ttcagaagtg 25200
ttttgcattg gtaatgcctc cttgaaattc attatatagg aagggaaata aaaatcaata 25260
caaaagttca acttttttaa ctttttgtgt tgacattgtt caaaattggg gttatagtta 25320
ttatagttca aatgtttgaa cttaggaggt gattatttga atactaatac aacttttgat 25380
ttttcgttat tgaacggtaa gatagtcgaa gtgtactcga cacaatttaa ctttgctata 25440
gctttaggtg tatcagaaag aactttgtct ttgaagttga acaacaaagt accatggaaa 25500
acaacagaca ttattaaagc ttgtaagtta ttgggaatac ctataaaaga tgttcacaaa 25560
tattttttta aacagaaagt tcaaatgttt gaacttaata agtaaaggag gcataacaca 25620
tgcaagaacg agaaaaggtt aataaaagta acacatcttc aaatgaagca tcaaaacctt 25680
ttaggacaaa ttgaagctta cgacaaaacg cttaaagaaa taaagtacac tcgagacctt 25740
tacaacaaac acctaagcat gaacaacgaa gacgcattcg ctggtttgga aatggtagag 25800
gatgaaatta ctaaaaagct acgaagtgct atcaaagagt tccaaaaagt agtgaaagcg 25860
ttagacaagc ttaacggtgt tgaaagcgat aacaaagtta ctgatttaac agagtggcgg 25920
aaagtgaatc agtaacattc acttcttaat ataaccacgc ttatcaacat ccacattgag 25980
cagatgtgag cgagagctgg cgatgatatg agccgcgttt aaatacattc gatagtcatt 26040
gcgataaccg tctgctgaat gtgggtgttg aggaaaaagg aggatactca aatgcaagca 26100
ttacaaacat ttaattttaa agagctacca gtaagaacag tagaaattga aaacgaacct 26160
tattttgtag gaaaagatat tgctgagatt ttaggatatg caagatcaaa caatgccatt 26220
agaaatcatg ttgatagcga ggacaagctg acgcaccaat ttagtgcatc aggtcaaaac 26280
agaaatatga tcattatcaa cgaatcagga ttatacagtc taatcttcga tgcttctaaa 26340
caaagcaaaa acgaaaaaat tagagaaacc gctagaaaat tcaaacgctg ggtaacatca 26400
gatgtcctac cagctattcg caaacacggt atatacgcaa cagacaatgt aattgaacaa 26460
acattaaaag atccagacta catcattaca gtgttgactg agtataagaa agaaaaagag 26520
caaaacttac ttttacaaca gcaagtagaa gttaacaaac caaaagtatt attcgctgac 26580
CA 02396674 2005-11-29
- 19 -
tcggtagctg gtagtgataa ttcaatactt gttggagaac tagcgaaaat acttaaacaa 26640
aacggtgttg atataggaca aaacagattg ttcaaatggt taagaaataa tggatatctc 26700
attaaaaaga gtggagaaag ttataactta ccaactcaaa agagtatgga tctaaaaatc 26760
ttggatatca aaaaacgaat aattaataat ccagatggtt caagtaaagt atcacgtaca 26820
ccaaaagtaa caggcaaagg acaacaatac tttgttaata agtttttagg agaaaaacaa 26880
acatcttaaa aggaggaaca caatggaaca aatcacatta accaaagaag agttgaaaga 26940
aattatagca aaagaagtta gagaggctat aaatggcaag aaaccaatca gttcaggttc 27000
aattttcagt aaagtaagaa tcaataatga cgatttagaa gaaatcaata aaaaactcaa 27060
tttcgcaaaa gatttgtcgc taggaagatt gaggaagctc aatcatccga ttccgctaaa 27120
aaagtatcag catggcttcg aatcaattca tcaaaaagct tatgtacaag atgttcatga 27180
ccatattaga aaattaacat tatcaatttt tggagtgaca cttaattcag acttgagtga 27240
aagtgaatac aacctagcag caaaagttta tcgagaaatc aaaaactatt atttatacat 27300
ctatgaaaag agagtttcag aattaactat cgatgatttc gaataaagga ggaacaacaa 27360
atgttacaaa aatttagaat tgcgaaagaa aaaaataaat taaaactcaa attactcaag 27420
catgctagtt actgtttaga aagaaacaac aaccctgaac tgttgcgagc agttgcagag 27480
ttgttgaaaa aggttagcta aattcaacgg taaggatttg ccctgcctcc acacttagag 27540
tttgagatcc aacaaacaca taagttttag tagggtctag aaaaaatgtt tcgatttcct 27600
cttttgtaac agtttcaatt ccttcatatc ctggaaaaac aattttcttt aaatccgaaa 27660
catgtttttt tgaaccatcc tttaaagtaa ctagaagttt catacttatc acctccttag 27720
gttgataaca acattataca cgaaaggagc ataaacaata tgcaagcatt acaaacaaat 27780
tcgaacatcg gagaaatgtt caatattcaa gaaaaagaaa atggagaaat cgcaatcagc 27840
ggtcgagaac ttcatcaagc attagaagtt aagacagcat ataaagattg gtttccaaga 27900
atgcttaaat acggatttga agaaaataca gattacacag ctatcgctca aaaaagagca 27960
acagctcaag gcaatatgac tcactatatt gaccacgcac tcacactaga cactgcaaaa 28020
gaaatcgcaa tgattcaacg tagtgaacct ggcaaacgtg caagacaata tttcatccaa 28080
gttgaaaaag catggaacag cccagaaatg attatgcaac gtgctttaaa aattgctaac 28140
aacacaatca atcaattaga aacaaagatt gcacgtgaca aaccaaaaat tgtatttgca 28200
gatgcagtag ctactactaa gacatcaatt ttagttggag agttagcaaa gatcattaaa 28260
caaaacggta taaacatcgg gcaacgcaga ttgtttgagt ggttacgtca aaacggattc 28320
CA 02396674 2005-11-29
- 20 -
cttattaaac gcaagggtgt ggattataac atgcctacac agtattcaat ggaacgtgag 28380
ttattcgaaa ttaaagaaac atcaatcaca cattcggacg gtcacacatc aattagtaag 28440
acgccaaaag taacaggtaa aggacaacaa tactttgtta acaagttttt aggagaaaaa 28500
caaacaactt aataggagga attacaaatg aacgcactat acaaaacaac cctcctcatc 28560
acaatggcag ttgtgacgtg gaaggtttgg aagattgaga agcacactag aaaacctgtg 28620
attagtagca gggcgttgag tgactatcta aacaacaaat ctttaaccat accgaaagat 28680
gctgaaaatt ctactgaatc tgctcgtcgc cttttgaagt tcgccgaaca aactattagc 28740
aaataacaac attatacacg aaaggaaaga tagaaatgcc aaaaatcata gtaccaccaa 28800
caccagaaaa cacatataga ggcgaagaaa aatttgtgaa aaagttatac gcaacaccta 28860
cacaaatcca tcaattgttt ggagtatgta gaagtacagt atacaactgg ttgaaatatt 28920
accgcaaaga taatttaggt gtagaaaatt tatacattga ttattcacca acaggcactc 28980
tgattaatat ttctaaattg gaagagtatt tgatcagaaa gcataaaaaa tggtattagg 29040
aggatattaa atgagcaaca tttataaaag ctacctagta gcagtattat gcttcacagt 29100
cttagcgatt gtacttatgc cgtttctata cttcactaca gcatggtcaa ttgcgggatt 29160
cgcaagtatc gcaacattca tgtactacaa agaatgcttt ttcaaagaat aaaaaaactg 29220
ctacttgttg gagcaagtaa cagtatcaaa cacttaagaa aaaattcatg ttcaatataa 29280
aacgaaaaac ggaggaagtc aagatgtatt acgaaatagg cgaaatcata cgcaaaaata 29340
ttcatgttaa cggattcgat tttaagctat tcattttaaa aggtcatatg ggcatatcaa 29400
tacaagttaa agatatgaac aacgtaccaa ttaaacatgc ttatgtcgta gatgagaatg 29460
acttagatat ggcatcagac ttatttaacc aagcaataga tgaatggatt gaagagaaca 29520
cagacgaaca ggacagacta attaacttag tcatgaaatg gtaggaggtc gctatgaagc 29580
agactgtaac ttatatcatt cgtcataggg atatgccaat ttatataact aacaaaccaa 29640
ctgataacaa ttcagatatt agttactcca caaatagaaa tagagctagg gagtttaacg 29700
gtatggaaga agcgagtatc aatatggatt atcacaaagc aatcaagaaa acagtgacag 29760
aaactattga gtacgaggag gtagaacatg actgaggaaa aacaagaacc acaagaaaaa 29820
gtaagcatac tcaaaaaact aaagataaat aatatcgctg agaaaaataa aaggaaattc 29880
tataaatttg cagtatacgg aaaaattggc tcaggaaaaa ccacgtttgc tacaagagat 29940
aaagacgctt tcgtcattga cattaacgaa ggtggaacaa cggttactga cgaaggatca 30000
gacgtagaaa tcgagaacta tcaacacttt gtttatgttg taaatttttt acctcaaatt 30060
CA 02396674 2005-11-29
- 21 -
ttacaggaga tgagagaaaa cggacaagaa atcaatgttg tagttattga aactattcaa 30120
aaacttagag atatgacatt gaatgatgtg atgaaaaata agtctaaaaa accaacgttt 30180
aatgattggg gagaagttgc tgaacgaatt gtcagtatgt acagattaat aggaaaactt 30240
caagaagaat acaaattcca ctttgttatt acaggtcatg aaggtatcaa caaagataaa 30300
gatgatgaag gtagcactat caaccctact atcactattg aagcgcaaga acaaattaaa 30360
aaagctatta cttctcaaag tgatgtgtta gctagggcaa tgattgaaga atttgatgat 30420
aacggagaaa agaaagctag atatattcta aacgctgaac cttctaatac gtttgaaaca 30480
aagattagac attcaccttc aataacaatt aacaataaga aatttgcaaa tcctagcatt 30540
acggacgtag tagaagcaat tagaaatgga aactaaaaat taattaaaag gacggtattt 30600
aattatgaaa atcacaggac aagcgcaatt tactaaagaa acaaatcaag aaaagtttta 30660
taacggctca gcagggtttc aagctggaga attcacagtg aaagttaaaa atattgaatt 30720
caatgataga gaaaatagat atttcacaat cgtatttgaa aatgatgaag gcaaacaata 30780
taaacataat caatttgtac cgccgtataa atatgatttc caagaaaaac aattgattga 30840
attagttact cgattaggta ttaagttaaa tcttcctagc ttagattttg ataccaatga 30900
tcttattggt aagttttgtc acttggtatt gaaatggaaa ttcaatgaag atgaaggtaa 30960
gtattttacg gatttttcat ttattaaacc ttacaaaaag ggcgatgatg ttgttaacaa 31020
acctattccg aagacagata agcaaaaagc tgaagaaaat aacggggcac aacaacaaac 31080
atcaatgtct caacaaagca atccatttga aagcagtggc caatttggat atgacgacca 31140
agatttagcg ttttaaggtg tggtttaaat gcaatacatt acaagatacc agaaagataa 31200
cgacggtact tattccgtcg ttgctactgg tgttgaactt gaacaaagtc acattgactt 31260
actagaaaac ggatatccac taaaagcaga agtagaggtt ccggacaata aaaaactatc 31320
tatagaacaa cgcaaaaaaa tattcgcaat gtgtagagat atagaacttc actggggcga 31380
accagtagaa tcaactagaa aattattaca aacagaattg gaaattatga aaggttatga 31440
agaaatcagt ctgcgcgact gttctatgaa agttgcaagg gagttaatag aactgattat 31500
agcgtttatg tttcatcatc aaatacctat gagtgtagaa acgagtaagt tgttaagcga 31560
agataaagcg ttattatatt gggctacaat caaccgcaac tgtgtaatat gcggaaagcc 31620
tcacgcagac ctggcacatt atgaagcagt cggcagaggc atgaacagaa acaaaatgaa 31680
ccactatgac aaacatgtat tagcgttatg tcgcgaacat cacaacgagc aacatgcgat 31740
tggcgttaag tcgtttgatg ataaatacca cttgcatgac tcgtggataa aagttgatga 31800
CA 02396674 2005-11-29
- 22 -
gaggctcaat aaaatgttga aaggagagaa aaaggaatga atagactaag aataataaaa 31860
atagcactcc taatcgtcat cttggcggaa gagattagaa atgctatgca tgctgtaaaa 31920
gtggagaaaa ttttaaaatc tccgtttagt taatacaggt ttttacaaaa gctttaccat 31980
aggcggacaa actaattgag ccttttttga tgtctattac ccaggggctg taatgtaact 32040
ttaatacttc aaattcaatg ccagaaagtt tacttattgt ttctaggttg tgtcctgact 32100
ttaacattct tttaacaaat tctaatcccg aaacaaatct ttgtttttct ataatcttat 32160
taaagtgatt taaaaactga ggagcataaa acttattata aattcctttt tttgttaagt 32220
aagacatgtc aaaagtttca tttaaaaccc ctaaccttac taggttatta attgaaattt 32280
cggttgattc tatatctaac ggagagtctt ttattaacgt gtccgatata ttcataccgt 32340
cattctttgg gtttaaaacc gctctatatt taacggcagg atgtacttcg tgattcttta 32400
aatgttttaa aagaatagca tcatttgggg ataattgttt aattatttca acaaatgaat 32460
ggtgggttaa tgagtttttt ctgtcatcca tagatgatgc tattagtttt gcgaacatat 32520
tacttaaagt tttttcacta atgtaaaact ttgaagcttc tagagcagga cctagaagag 32580
aaaattgtgg ttcttgtaaa ttatttttag gtacagaaga tatttctttt ttaaattgtt 32640
ctttgaattt ttcaaattct acttctcttt gataaataac tttatccaca taaaggtgga 32700
atttcccaaa gacaagttcc caagttttag agaatgtttc tacaggccct tttgatgcgc 32760
cttcaataat tttatcaata cctttaccta aaataggatc cataattatt cacccccaat 32820
ctaacgcaat agcgataata aaattatacc agaaaggaga atcaacatga ctgaccaacc 32880
aagttactac tcaataatta cagcaaatgt cagatacgat aaccgactta ctgacagcga 32940
aaagttactt tttgcagaaa taacatcttt aagtaacaaa tacggatact gcacagcaag 33000
taatggttac tttgcaactt tatacaacgt tgttaaggaa actatatctc gtagaatttc 33060
gaaccttacc aactttggtt atctaaaaat cgaaattatc aaagaaggta atgaagttaa 33120
acaaaggaag atgtacccct tgacgcaaac gtcaatacct attgacgcaa aaatcaatac 33180
ccctattgat aattctgtca atacccctat tgacgcaaat gtcaaagaga atattacaag 33240
tattaataat acaagtaata acaatataaa tagaatagat atattgtcgg gcaacccgac 33300
agcatcttct ataccctata aagaaattat cgattactta aacaaaaaag cgggcaagca 33360
ttttaaacac aatacagcta aaacaaaaga ttttattaaa gcaagatgga atcaagattt 33420
taggttggag gattttaaaa aggtgattga tatcaaaaca gctgagtggc taaacacgga 33480
tagcgataaa taccttagac cagaaacact ttttggcagt aaatttgagg ggtacctcaa 33540
CA 02396674 2005-11-29
- 23 -
tcaaaaaata caaccaactg gcacggatca attggaacgc atgaagtacg acgaaagtta 33600
ttgggattag ggggatatta tgaaaccact attcagcgaa aagataaacg aaagcttgaa 33660
aaaatatcaa cctactcatg tcgaaaaagg attgaaatgt gagagatgtg gaagtgaata 33720
cgacttatat aagtttgctc ctactaaaaa acacccgaat ggttacgagt ataaagacgg 33780
ttgcaaatgt gaaatctatg aggaatataa gcgaaacaag caacggaaga taaacaacat 33840
attcaatcaa tcaaacgtta atccgtcttt aagagatgca acagtcaaaa actacaagcc 33900
acaaaatgaa aaacaagtac acgctaaaca aacagcaata gagtacgtac aaggcttctc 33960
tacaaaagaa ccaaaatcat taatattgca aggttcatac ggaactggta aaagccacct 34020
agcatacgct atcgcaaaag cagtcaaagc taaagggcat acggttgctt ttatgcacat 34080
accaatgttg atggatcgta tcaaagcgac atacaacaaa aatgcagtag agactacaga 34140
cgagctagtc agattgctaa gtgatattga tttacttgta ctagatgata tgggtgtaga 34200
aaacacagag cacactttaa ataaactttt cagcattgtt gataacagag taggtaaaaa 34260
caacatcttt acaactaact ttagtgataa agaactaaat caaaatatga actggcaacg 34320
tataaattcg agaatgaaaa aaagagcaag aaaagtaaga gtaatcggag acgatttcag 34380
ggagcgagat gcatggtaac caaagaattt ttaaaaacta aacttgagtg ttcagatatg 34440
tacgctcaga aactcataga tgaggcacag ggcgatgaaa ataggttgta cgacctattt 34500
atccaaaaac ttgcagaacg tcatacacgc cccgctatcg tcgaatatta aggagtgtta 34560
aaaatgccga aagaaaaata ttacttatac cgagaagatg gcacagaaga tattaaggtc 34620
atcaagtata aagacaacgt aaatgaggtt tattcgctca caggagccca tttcagcgac 34680
gaaaagaaaa ttatgactga tagtgaccta aaacgattca aaggcgctca cgggcttcta 34740
tatgagcaag aattaggttt acaagcaacg atatttgata tttagaggtg gacgatgagt 34800
aaatacaacg ctaagaaagt tgagtacaaa ggaattgtat ttgatagcaa agtagagtgt 34860
gaatattacc aatatttaga aagtaatatg aatggcacta attatgatca tatcgaaata 34920
caaccgaaat tcgaattatt accaaaacta gataaacaac gaaagattga atatattgca 34980
gacttcgcgt tatatctcga tggcaaactg attgaagtta tcgacattaa aggtatgcca 35040
accgaagtag caaaacttaa agctaagatt ttcagacata aatacagaaa cataaaactc 35100
aattggatat gtaaagcgcc taagtataca ggtaaaacat ggattacgta cgaggaatta 35160
attaaagcaa gacgagaacg caaaagagaa atgaagtgat ctaatgcaac aacaagcata 35220
tataaatgca acgattgata taaggatacc tacagaagtt gaatatcagc attttgatga 35280
CA 02396674 2005-11-29
- 24 -
tgtggataaa gaaaaagaag cgctggcaga ttacttatat aacaatcctg acgaaatact 35340
agagtatgac aatttaaaaa ttagaaacgt aaatgtagag gtggaataaa tgggcagtgt 35400
tgtaatcatt aataataaac catataaatt taacaatttt gaaaaaagaa ataatggcaa 35460
agcgtgggat aaatgctgga attgtttcta aacgtgttag aggttgttgg gagttttcag 35520
aagctttaga cgcgccttat ggcatgcacc taaaagaata tagagaaatg aaacaaatgg 35580
aaaagattaa acaagcgaga ctcgaacgtg aattggaaag agagcgaaag aaagaggctg 35640
agctacgtaa gaagaagcca catttgttta atgtacctca aaaacattca cgtgatccgt 35700
actggttcga tgtcacttat aaccaaatgt tcaagaaatg gagtgaagca taatgagcat 35760
aatcagtaac agaaaagtag atatgaacaa aacgcaagac aacgttaagc aacctgcgca 35820
ttacacatac ggcgacattg aaattataga ttttattgaa caagttacgg cacagtaccc 35880
accacaatta gcattcgcaa taggtaatgc aattaaatac ttgtctagag caccgttaaa 35940
gaatggtcat gaggatttag caaaggcgaa gttttacgtc gatagagtat ttgacttgtg 36000
ggagtgatga ccatgacaga tagcggacgt aaagaatact taaaacattt tttcggctct 36060
aagagatatc tgtatcagga taacgaacga gtggcacata tccatgtagt aaatggcact 36120
tattactttc acggtcatat cgtgccaggt tggcaaggtg tgaaaaagac atttgataca 36180
gcggaagagc ttgaaacata tataaagcaa agtgatttgg aatatgagga acagaagcaa 36240
ctaactttat tttaaaaggg cggaaacaat gaaaatcaaa attgaaaaag aaatgaattt 36300
acctgaactt atccaatggg cttgggataa ccccaagtta tcaggtaata aaagattcta 36360
ttcaaatgat gttgagcgca actgttttgt gacttttcat gttgatagca tcttatgtaa 36420
tgtgactgga tatgtatcaa ttaacgataa atttactgtt caagaggaga tataacaatg 36480
aaaatcaaag ttaaaaaaga aatgagatta gatgaattaa ttaaatgggc gcgagaaaat 36540
ccggatctat cacaaggaaa aatatttttt tcaacaggat ttagtgatgg attcgttcgt 36600
tttcatccaa atacaaataa gtgttcgacg tcaagtttta ttccaattga tatccccttc 36660
atagttgata ttgaaaaaga agtaacggaa gagactaagg ttgataggtt gattgaatta 36720
ttcgagattc aagaaggaga ctataactct acactatatg agaacactag tataaaagaa 36780
tgtttatatg gcagatgtgt gcctaccaaa gcattctaca tcttaaacga tgacctaact 36840
atgacgttaa tctggaaaga tggggagttg ctagtatgat gttgaaattt aaagcttggg 36900
ataaagataa aaaagttatg agtattattg acgaaatcga ttttaatagt gggtacattt 36960
tgatttcaac aggttataaa agtttcaatg aagtaaaact attacaatac acaggattta 37020
CA 02396674 2005-11-29
- 25 -
aagatgtgca cggtgtggag atttatgaag gggatattgt tcaagattgt tattcgagag 37080
aagtaagttt tatcgagttt aaagaaggag ccttttatat aacttttagc aatgtaactg 37140
aattactaag tgaaaatgac gatattattg aaattgttgg aaatattttt gaaaatgaga 37200
tgctattgga ggttatgaga tgacgttcac cttatcagat gaacaatata aaaatctttg 37260
tactaactct aacaagttat tagataaact tcacaaagca ttaaaagatc gtgaagagta 37320
caagaagcaa cgagatgagc ttattgggga tatagcgaag ttacgagatt gtaacaaaga 37380
tctagagaag aaagcaagcg catgggatag gtattgcaag agcgttgaaa aagatttaat 37440
aaacgaattc ggtaacgatg atgaaagagt taaattcgga atggaattaa acaataaaat 37500
ttttatggag gatgacacaa atgaataatc gcgaaaaaat cgaacagtcc gttattagtg 37560
ctagtgcgta taacggtaat gacacagagg ggttgctaaa agagattgag gacgtgtata 37620
agaaagcgca agcgtttgat gaaatacttg agggaatgac aaatgctatt caacattcag 37680
ttaaagaagg tattgaactt gatgaagcag tagggattat ggcaggtcaa gttgtctata 37740
aatatgagga ggaataggaa aatgactaac acattacaag taaaactatt atcaaaaaat 37800
gctagaatgc ccgaacgaaa tcataagacg gatgcaggtt atgacatatt ctcagctgaa 37860
actgtcgtac tcgaaccaca agaaaaagca gtgatcaaaa cagatgtagc tgtgagtata 37920
ccagagggct atgtcggact attaactagt cgtagtggtg taagtagtaa aacgtattta 37980
gtgattgaaa caggcaagat agacgcggga tatcatggca atttagggat taatatcaag 38040
aatgatgaag aacgtgatgg aatacccttt ttatatgatg atatagacgc tgaattagaa 38100
gatggattaa taagcatttt agatataaaa ggtaactatg tacaagatgg aagaggcata 38160
agaagagttt accaaatcaa caaaggcgat aaactagctc aattggttat cgtgcctata 38220
tggacaccgg aactaaagca agtggaggaa ttcgaaagtg tttcagaacg tggagcaaaa 38280
ggcttcggaa gtagcggagt gtaaagacat cttagatcga gttaaggagg ttttggggaa 38340
gtgacgcaat acttagtcac aacattcaaa gattcaacag gacgaccaca tgaacatatt 38400
actgtggcta gagataatca gacgtttaca gttattgagg cagagagtaa agaagaagcg 38460
aaagagaagt acgaggcaca agttaaaaga gatgcagtta ttaaagtggg tcagttgtat 38520
gaaaatataa gggagtgtgg gaaatgacgg atgttaaaat taaaactatt tcaggtggag 38580
tttattttgt aaaaacagct gaaccttttg aaaaatatgt tgaaagaatg acgagtttta 38640
atggttatat ttacgcaagt actataatca agaaaccaac gtatattaaa acagatacga 38700
ttgaatcaat cacacttatt gaggagcatg ggaaatgaat cagctgagaa ttttattaca 38760
CA 02396674 2005-11-29
- 26 -
tgacggtagt agtttgatat tacatgaaga tgaattattt aacgaaatag tatttgtttt 38820
ggacaatttt agaaatgatg atgactattt aacgatagaa aaagattatg gcagagaact 38880
tgtattgaac aaaggttata tagttgggat caatgttgag gaggcagatg atgattaaca 38940
tacctaaaat gaaattcccg aaaaagtaca ctgaaataat caaaaaatat aaaaataaag 39000
cacctgaaga aaaggctaag attgaagatg attttattaa agaaattaaa gataaagaca 39060
gtgaatttta cagtcctacg atggctaata tgaatgaata tgaattaagg gctatgttaa 39120
gaatgatgcc tagtttaatt gatactggag atgacaatga tgattaaaaa acttaaaaat 39180
atggatgggt tcgacatctt tattgttgga atactgtcat tattcggtat attcgcattg 39240
ctacttgtta tcacattgcc tatctataca gtggctagtt accaacacaa agaattacat 39300
caaggaacta ttacagataa atataacaag agacaagata aagaagacaa gttctatatt 39360
gtattagaca acaaacaagt cattgaaaat tccgacttat tattcaaaaa gaaatttgat 39420
agcgcagata tacaagctag gttaaaagta ggcgataagg tagaagttaa aacaatcggt 39480
tatagaatac actttttaaa tttatatccg gtcttatacg aagtaaagaa ggtagataaa 39540
caatgattaa acaaatacta agactattat tcttactagc aatgtatgag ttaggtaagt 39600
atgtaactga gcaagtgtat attatgatga cggctaatga tgatgtagag gcgccgagtg 39660
attacgtctt tcgagcggag gtgagtgaat aatgagaata tttatttatg atttgatcgt 39720
tttgctgttt gctttcttaa tatccatata tattattgat gatggagtga taataaatgc 39780
attaggaatt tttggtatgt ataaaattat agattccttt tcagaaaata ttataaagag 39840
gtagataaaa atgaacgagc aaataatagg aagcatatat actttagcag gaggtgttgt 39900
gctttattca gttaaagaga tttttaggta ttttacagat tctaacttac aacgtaaaaa 39960
aatcaattta gaacaaatat atccgatata tttagattgt tttaaaaagg ctaaaaagat 40020
gattggagct tatattattc caacagaaca gcatgaattt ttagattttt ttgatattga 40080
agtctttaat aatttagata agcaaagtaa aaaagcgtat gaaaatgtta ttggatttag 40140
acaaatgatt aatttatcaa atagagttaa ggcaatggaa gattttaaga tgagtttcaa 40200
caatgaattt agtacaaatc agattttttt taatccttct tttgttatgg aaacaattgc 40260
tattataaat gaatatcaaa aagatatatc ttatttaaaa aatataatta ataaaatgaa 40320
tgaaaataga gcttataatc atattgatag ttttatcact tcagagtacc gacgaaaaat 40380
aaacgattat aatctttatc ttgataaatt tgaagaacag tttagtcaaa agtttaaaat 40440
aaacagaact tcgataaaag aaagaattat tattaattta aacaagagga gatttaaatg 40500
CA 02396674 2005-11-29
_ 27 _
atgtggatta ctatgactat tgtatttgct atattgctat tagtttgtat cagtattaat 40560
agtgatcgtg caagagagat acaagcactt agatatatga atgattatct acttgatgaa 40620
gtagttaaaa ctaaagggta caacgggtta gaagaataca ggattgaatt gaagcgaatg 40680
aataacgata ttaaaaagta atttatatta tcggaggtat tgcattgaat gataaagatt 40740
gagaaacacg atatcaaaaa gcttgaagaa tacattcagc acatcgataa ctatcgaaga 40800
gagttgaaga tgcgagaata tgaattactt gaaagtcatg aaccagataa tgcgggagct 40860
ggcaaaagta atttgccggg taacccgatt gaacgatgtg caataaagaa gtttagtgat 40920
aacaggtaca atacattaag aaatatagtt aacggtgtag atagattgat aggtgaaagt 40980
gatgaggata cgcttgagtt attaaggttt agatattggg attgtcctat tggttgttat 41040
gaatgggaag atatagcaca ttactttggt acaagtaaga caagtatatt acgtagaagg 41100
aatgcactga tcgataagtt agcaaagtat attggttatg tgtagcggac ttttacccta 41160
tgtaagtccg cattaaaaca gtttattatg ttagtatcag attaatattt aaagttatta 41220
aatgctaata cgacgcatga acaagaggcg catcactatg tgatgtgtct ttttatttat 41280
gaggtatgaa catgttcaaa ctaattgtaa atacattact acacatcaag tatagatgag 41340
tcttgatact acttaagtta tataaggtga aacattatga tgactaaaga cgaacgtata 41400
cgattctata agtctaaaga atggcaaata acaagaaaaa gagtgctaga aagagataat 41460
tatgaatgtc aacaatgtaa gagagacggc aagttaacga catatgacaa aagcaagcgt 41520
aagtcgttgg atgtagatca tatattatcg ctagaacatc atccggagtt tgctcatgac 41580
ttaaacaatt tagaaacact gtgtattaaa tgtcacaaca aaaaagaaaa gagatttata 41640
aaaaaagaaa ataaatggaa agacgaaaaa tggtaaatac ccccgggtca aaaaaatcaa 41700
aagcgatc 41708
<210> 4
<211> 159
<212> DNA
<213> Staphylococcus aureus
<400> 4
atggtaacca aagaattttt aaaaactaaa cttgagtgtt cagatatgta cgctcagaaa 60
ctcatagatg aggcacaggg cgatgaaaat aggttgtacg acctatttat ccaaaaactt 120
gcagaacgtc atacacgccc cgctatcgtc gaatattaa 159
CA 02396674 2005-11-29
- 28 -
<210> 5
<211> 52
<212> PRT
<213> staphylococcus aureus
<400> 5
Met val Thr Lys Glu Phe Leu Lys Thr Lys Leu Glu Cys Ser Asp Met
1 5 10 15
Tyr Ala Gln Lys Leu Ile Asp Glu Ala Gln Gly Asp Glu Asn Arg Leu
20 25 30
Tyr Asp Leu Phe Ile Gln Lys Leu Ala Glu Arg His Thr Arg Pro Ala
35 40 45
Ile val Glu Tyr
<210>
6
<211>
1362
<212>
DNA
<213>
Bacillus
subtilis
<400>
6
atgacagaccttctgaatgaccggcttcctccgcaaaatatagaagccgaacaagccgtg60
ttaggcgctatttttttacagccgtctgctttaacactggcttcagaagtattgattcca120
gatgatttctatagaatgtcccaccaaaaaatctataatgcgatgctggtgctcggtgac180
cgaggtgaaccggttgatctggtgacagttacatcagagcttgcgaacacagacctgctg240
gaagaagtaggcggtatttcatatttgacagatatcgcaaactcggtgccgacagcggct300
aacatagaatattacgcgaaaatcgttgaggaaaaatcgattcttcgccgattaatcaga360
actgcgacaacgattgctcaagacgggtatacccgtgaggatgaggtcgaggatttactc420
agtgaagcggaaaaaacgattatggaagtggcacagcgcaaaaacacgagtgccttccaa480
aatattaaggacgtccttgtccagacctatgataatatcgaacagctttacaatcgaaaa540
ggtgatatcacgggaattccaacagggtttacggagcttgaccggatgactgcgggtttc600
cagcgcaacgacttgatcattgtggctgcccgtccttcagtagggaaaacagcctttgcc660
ctgaacatcgcacaaaacgtggcgacgaagaccgatgagagcgtagcgattttcagtctt720
CA 02396674 2005-11-29
_ 29 _
gagatgggtgccgagcagctcgttatgcgtatgctctgtgccgagggaaatatcaatgcc780
cagaatctccgtacaggtaacctgaccgaagaggattggggcaagctgacgatggcaatg840
ggaagcctatcgaacagcgggatttacatcgatgatacaccgggtattcgagtgagtgaa900
atccgtgccaagtgccgccgcttgaagcaggaaagcgggctgggcatgattttgatcgat960
tacctgcaattgattcagggaagcggtcgttcaaaggacaaccgtcagcaggaagtatct1020
gaaatttcccgtgaactgaagtcgattgcgagggagctgcaagtccctgttatcgcgctt1080
tctcagctttccaggggtgttgagcagcgtcaggataaacgtccgatgatgtctgatatc1140
cgggaatcaggaagtatcgagcaggacgcggatattgtcgcgttcctttatcgtgatgac1200
tactatgacaaagaaaccgagaataaaaatattatcgaaattattatcgccaaacagcgt1260
aacggcccggtaggaaccgtgtctcttgcgttcgtaaaagaatacaacaaattcgtcaac1320
ctggaacggcgttttgatgacgcaggcgttccgcccggcgca 1362
<210> 7
<211> 1401
<212> DNA
<213> Staphylococcus aureus
<400>
7
atggatagaatgtatgagcaaaatcaaatgccgcataacaatgaagctgaacagtctgtc60
ttaggttcaattattatagatccagaattgattaatactactcaggaagttttgcttcct120
gagtcgttttataggggtgcccatcaacatattttccgtgcaatgatgcacttaaatgaa180
gataataaagaaattgatgttgtaacattgatggatcaattatcgacggaaggtacgttg240
aatgaagcgggtggcccgcaatatcttgcagagttatctacaaatgtaccaacgacgcga300
aatgttcagtattatactgatatcgtttctaagcatgcattaaaacgtagattgattcaa360
actgcagatagtattgccaatgatggatataatgatgaacttgaactagatgcgatttta420
agtgatgcagaacgtcgaattttagagctatcatcttctcgtgaaagcgatggctttaaa480
gacattcgagacgtcttaggacaagtgtatgaaacagctgaagagcttgatcaaaatagt540
ggtcaaacaccaggtatacctacaggatatcgagatttagaccaaatgacagcagggttc600
aaccgaaatgatttaattatccttgcagcgcgtccatctgtaggtaagactgcgttcgca660
cttaatattgcacaaaaagttgcaacgcatgaagatatgtatacagttggtattttctcg720
ctagagatgggtgctgatcagttagccacacgtatgatttgtagttctggaaatgttgac780
CA 02396674 2005-11-29
- 30 -
tcaaaccgcttaagaacgggtactatgactgaggaagattggagtcgttttactatagcg840
gtaggtaaattatcacgtacgaagatttttattgatgatacaccgggtattcgaattaat900
gatttacgttctaaatgtcgtcgattaaagcaagaacatggcttagacatgattgtgatt960
gactacttacagttgattcaaggtagtggttcacgtgcgtccgataacagacaacaggaa1020
gtttctgaaatctctcgtacattaaaagcattagcccgtgaattagaatgtccagttatc1080
gcattaagtcagttatctcgtggtgttgaacaacgacaagataaacgtccaatgatgagt1140
gatattcgtgaatctggttcgattgagcaagatgccgatatcgttgcattcttataccgt1200
gatgattactataaccgtggcggcgatgaagatgatgacgatgatggtggtttcgagcca1260
caaacgaatgatgaaaacggtgaaattgaaattatcattgctaagcaacgtaacggtcca1320
acaggcacagttaagttacattttatgaaacaatataataaatttaccgatatcgattat1380
gcacatgcagatatgatgtaa 1401
<210> 8
<211> 454
<212> PRT
<213> Bacillus subtilis
<400> 8
Met Thr Asp Leu Leu Asn Asp Arg Leu Pro Pro Gln Asn Ile Glu Ala
1 5 10 15
Glu Gln Ala Val Leu Gly Ala Ile Phe Leu Gln Pro Ser Ala Leu Thr
20 25 30
Leu Ala Ser Glu Val Leu Ile Pro Asp Asp Phe Tyr Arg Met Ser His
35 40 45
Gln Lys Ile Tyr Asn Ala Met Leu Val Leu Gly Asp Arg Gly Glu Pro
50 55 60
Val Asp Leu Val Thr Val Thr Ser Glu Leu Ala Asn Thr Asp Leu Leu
65 70 75 80
Glu Glu Val Gly Gly Ile Ser Tyr Leu Thr Asp Ile Ala Asn Ser Val
85 90 95
Pro Thr Ala Ala Asn Ile Glu Tyr Tyr Ala Lys Ile Val Glu Glu Lys
100 105 110
Ser Ile Leu Arg Arg Leu Ile Arg Thr Ala Thr Thr Ile Ala Gln Asp
115 120 125
Gly Tyr Thr Arg Glu Asp Glu Val Glu Asp Leu Leu Ser Glu Ala Glu
CA 02396674 2005-11-29
- 31
130 135 140
Lys Thr Ile Met Glu Val Ala Gln Arg Lys Asn Thr Ser Ala Phe Gln
145 150 155 160
Asn Ile Lys Asp Val Leu Val Gln Thr Tyr Asp Asn Ile Glu Gln Leu
165 170 175
Tyr Asn Arg Lys Gly Asp Ile Thr Gly Ile Pr0 Thr Gly Phe Thr G1U
180 185 190
Leu Asp Arg Met Thr Ala Gly Phe Gln Arg Asn Asp Leu Ile Ile Val
195 200 205
Ala Ala Arg Pro Ser Val Gly Lys Thr Ala Phe Ala Leu Asn Ile Ala
210 215 220
Gln Asn Val Ala Thr Lys Thr Asp Glu Ser Val Ala Ile Phe Ser Leu
225 230 235 240
Glu Met Gly Ala Glu Gln Leu Val Met Arg Met Leu Cys Ala Glu Gly
245 250 255
Asn Ile Asn Ala Gln A5n Leu Arg Thr Gly Asn Leu Thr Glu Glu Asp
260 265 270
Trp Gly Lys Leu Thr Met Ala Met Gly Ser Leu Ser Asn Ser Gly Ile
275 280 285
Tyr Ile Asp Asp Thr Pro Gly Ile Arg Val Ser Glu Ile Arg Ala Lys
290 295 300
Cys Arg Arg Leu Lys Gln Glu Ser Gly Leu Gly Met Ile Leu Ile Asp
305 310 315 320
Tyr Leu Gln Leu Ile Gln Gly Ser Gly Arg Ser Lys Asp Asn Arg Gln
325 330 335
Gln Glu Val Ser Glu Ile Ser Arg Glu Leu Lys Ser Ile Ala Arg Glu
340 345 350
Leu Gln Val Pro Val Ile Ala Leu Ser Gln Leu Ser Arg Gly Val Glu
355 360 365
Gln Arg Gln Asp Lys Arg Pro Met Met Ser Asp Ile Arg Glu Ser Gly
370 375 380
Ser Ile Glu Gln Asp Ala Asp Ile Val Ala Phe Leu Tyr Arg Asp Asp
385 390 395 400
Tyr Tyr Asp Lys Glu Thr Glu Asn Lys Asn Ile Ile Glu Ile Ile Ile
405 410 415
Ala Lys Gln Arg Asn Gly Pro Val Gly Thr Val Ser Leu Ala Phe Val
420 425 430
Lys Glu Tyr Asn Lys Phe Val Asn Leu Glu Arg Arg Phe Asp Asp Ala
435 440 445
CA 02396674 2005-11-29
- 32 -
Gly Val Pro Pro Gly Ala
450
<210> 9
<211> 466
<212> PRT
<213> Staphylococcus aureus
<400> 9
Met Asp Arg Met Tyr Glu Gln Asn Gln Met Pro His Asn Asn Glu Ala
1 5 10 15
Glu Gln Ser Val Leu Gly Ser Ile Ile Ile Asp Pro Glu Leu Ile Asn
20 25 30
Thr Thr Gln Glu Val Leu Leu Pro Glu Ser Phe Tyr Arg Gly Ala His
35 40 45
Gln His Ile Phe Arg Ala Met Met His Leu Asn Glu Asp Asn Lys Glu
50 55 60
Ile Asp Val Val Thr Leu Met Asp Gln Leu Ser Thr Glu Gly Thr Leu
65 70 75 80
Asn Glu Ala Gly Gly Pro Gln Tyr Leu Ala Glu Leu Ser Thr Asn Val
85 90 95
Pro Thr Thr Arg Asn Val Gln Tyr Tyr Thr Asp Ile Val Ser Lys His
100 105 110
Ala Leu Lys Arg Arg Leu Ile Gln Thr Ala Asp Ser Ile Ala Asn Asp
115 120 125
Gly Tyr Asn Asp Glu Leu Glu Leu Asp Ala Ile Leu Ser Asp Ala Glu
130 135 140
Arg Arg Ile Leu Glu Leu Ser Ser Ser Arg Glu Ser Asp Gly Phe Lys
145 150 155 160
Asp Ile Arg Asp Val Leu Gly Gln Val Tyr Glu Thr Ala Glu Glu Leu
165 170 175
Asp Gln Asn Ser Gly Gln Thr Pro Gly Ile Pro Thr Gly Tyr Arg Asp
180 185 190
Leu Asp Gln Met Thr Ala Gly Phe Asn Arg Asn Asp Leu Ile Ile Leu
195 200 205
Ala Ala Arg Pro Ser Val Gly Lys Thr Ala Phe Ala Leu Asn Ile Ala
210 215 220
Gln Lys Val Ala Thr His Glu Asp Met Tyr Thr Val Gly Ile Phe Ser
CA 02396674 2005-11-29
- 33 -
225 230 235 240
Leu Glu Met Gly Ala Asp Gln Leu Ala Thr Arg Met Ile Cys Ser Ser
245 250 255
Gly Asn Val Asp Ser Asn Arg Leu Arg Thr Gly Thr Met Thr Glu Glu
260 265 270
Asp Trp Ser Arg Phe Thr Ile Ala Val Gly Lys Leu Ser Arg Thr Lys
275 280 285
Ile Phe Ile Asp Asp Thr Pro Gly Ile Arg Ile Asn Asp Leu Arg Ser
290 295 300
Lys cys Arg Arg Leu Lys Gln Glu His Gly Leu Asp Met Ile Val Ile
305 310 315 320
Asp Tyr Leu Gln Leu Ile Gln Gly Ser Gly Ser Arg Ala Ser Asp Asn
325 330 335
Arg Gln Gln Glu Val Ser Glu Ile Ser Arg Thr Leu Lys Ala Leu Ala
340 345 350
Arg Glu Leu Glu cys Pro Val Ile Ala Leu Ser Gln Leu Ser Arg Gly
355 360 365
Val Glu Gln Arg Gln Asp Lys Arg Pro Met Met Ser Asp Ile Arg Glu
370 375 380
Ser Gly Ser Ile Glu Gln Asp Ala Asp Ile Val Ala Phe Leu Tyr Arg
385 390 395 400
Asp Asp Tyr Tyr Asn Arg Gly Gly Asp Glu Asp Asp Asp Asp Asp Gly
405 410 415
Gly Phe Glu Pro Gln Thr Asn Asp Glu Asn Gly Glu Ile Glu Ile Ile
420 425 430
Ile Ala Lys Gln Arg Asn Gly Pro Thr Gly Thr Val Lys Leu His Phe
435 440 445
Met Lys Gln Tyr Asn Lys Phe Thr Asp Ile Asp Tyr Ala His Ala Asp
450 455 460
Met Met
465
<210> 10
<211> 313
<212> PRT
<213> Staphylococcus aureus
<400> 10
CA 02396674 2005-11-29
- 34 -
Met Gly Gly Gly Gln Ser Ile Met Lys Gln Phe Lys Ser Ile Ile Asn
1 5 10 15
Thr Ser Gln Asp Phe Glu Lys Arg Ile Glu Lys Ile Lys Lys Glu Val
20 25 30
Ile Asn Asp Pro Asp Val Lys Gln Phe Leu Glu Ala His Arg Ala Glu
35 40 45
Leu Thr Asn Ala Met Ile Asp Glu Asp Leu Asn Val Leu Gln Glu Tyr
50 55 60
Lys Asp Gln Gln Lys His Tyr Asp Gly His Lys Phe Ala Asp Cys Pro
65 70 75 80
Asn Phe Val Lys Gly His Val Pro Glu Leu Tyr Val Asp Asn Asn Arg
85 90 95
Leu Lys Ile Arg Tyr Leu Gln Cys Pro Cys Lys Ile Lys Tyr Asp Glu
100 105 110
Glu Arg Phe Glu Ala Glu Leu Ile Thr Ser His Asn Met Gln Arg Asp
115 120 125
Thr Leu Asn Ala Lys Leu Lys Asp Leu Tyr Met Asn His Arg Asp Arg
130 135 140
Leu Asp Val Ala Met Ala Ala Asp Asp Ile Cys Thr Ala Ile Thr Asn
145 150 155 160
Gly Glu Gln Val Lys Gly Leu Tyr Leu Tyr Gly Pro Phe Gly Thr Gly
165 170 175
Lys Ser Phe Leu Leu Gly Ala Ile Ala Asn Gln Leu Lys Ser Lys Lys
180 185 190
Val Arg Ser Thr Ile Ile Tyr Leu Pro Glu Phe Ile Arg Thr Leu Lys
195 200 205
Gly Gly Phe Lys Asp Gly Ser Phe Glu Lys Lys Leu His Arg Val Arg
210 215 220
Glu Ala Asn Ile Leu Met Leu Asp Asp Ile Gly Ala Glu Glu Val Thr
225 230 235 240
Pro Trp Val Arg Asp Glu Val Ile Gly Pro Leu Leu His Tyr Arg Met
245 250 255
Val His Glu Leu Pro Thr Phe Phe Ser Ser Asn Phe Asp Tyr Ser Glu
260 265 270
Leu Glu His His Leu Ala Met Thr Arg Asp Gly Glu Glu Lys Thr Lys
275 280 285
Ala Ala Arg Ile Ile Glu Arg Val Lys Ser Leu Ser Thr Pro Tyr Phe
290 295 300
Leu Ser Gly Glu Asn Phe Arg Asn Asn
CA 02396674 2005-11-29
305 310
<210> 11
<211> 12
<212> PRT
- 35 -
<213> staphylococcus aureus
<220>
<221> misc_feature
<223> predicted tryptic peptide
<400> 11
Gly His Val Pro Glu Leu Tyr Val Asp Asn Asn Arg
1 5 10
<210> 12
<211> 11
<212> PRT
<213> Staphylococcus aureus
<220>
<221> misc_feature
<223> predicted tryptic peptide
<400> 12
ser Thr Ile zle Tyr Leu Pro Glu Phe zle Arg
1 5 10
<210> 13
<211> 14
<212> PRT
<213> staphylococcus aureus
<220>
<221> misc_feature
<223> predicted tryptic peptide
CA 02396674 2005-11-29
<400> 13
- 36 -
Ser Leu Ser Thr Pro Tyr Phe Leu Ser Gly Glu Asn Phe Arg
1 5 10
<210> 14
<211> 280
<212> PRT
<213> Bacillus subtilis
<400> 14
Asp Gln Asp Val Gln Ala Phe Leu Lys Glu Asn Glu Glu Val Ile Asp
1 5 10 15
Gln Lys Met Ile Glu Lys Ser Leu Asn Lys Leu Tyr Glu Tyr Ile Glu
20 25 30
Gln Ser Lys Asn Cys Ser Tyr Cys Ser Glu Asp Glu Asn Cys Asn Asn
35 40 45
Leu Leu Glu Gly Tyr His Pro Lys Leu Val Val Asn Gly Arg Ser Ile
50 55 60
Asp Ile Glu Tyr Tyr Glu Cys Pro Val Lys Arg Lys Leu Asp Gln Gln
65 70 75 80
Lys Lys Gln Gln Ser Leu Met Lys Ser Met Tyr Ile Gln Gln Asp Leu
85 90 95
Leu Gly Ala Thr Phe Gln Gln Val Asp Ile Ser Asp Pro Ser Arg Leu
100 105 110
Ala Met Phe Gln His Val Thr Asp Phe Leu Lys Ser Tyr Asn Glu Thr
115 120 125
Gly Lys Gly Lys Gly Leu Tyr Leu Tyr Gly Lys Phe Gly Val Gly Lys
130 135 140
Thr Phe Met Leu Ala Ala Ile Ala Asn Glu Leu Ala Glu Lys Glu Tyr
145 150 155 160
Ser Ser Met Ile Val Tyr Val Pro Glu Phe Val Arg Glu Leu Lys Asn
165 170 175
Ser Leu Gln Asp Gln Thr Leu Glu Glu Lys Leu Asn Met Val Lys Thr
180 185 190
Thr Pro Val Leu Met Leu Asp Asp Ile Gly Ala Glu Ser Met Thr Ser
195 200 205
Trp Val Arg Asp Glu Val Ile Gly Thr Val Leu Gln His Arg Met Ser
210 215 220
CA 02396674 2005-11-29
- 37 -
Gln Gln Leu Pro Thr Phe Phe Ser Ser Asn Phe Ser Pro Asp Glu Leu
225 230 235 240
Lys His His Phe Thr Tyr Ser Gln Arg Gly Glu Lys Glu Glu Val Lys
245 250 255
Ala Ala Arg Leu Met Glu Arg Ile Leu Tyr Leu Ala Ala Pro Ile Arg
260 265 270
Leu Asp Gly Glu Asn Arg Arg His
275 280
<210>
15
<211>
278
<212> PRT
<213> Bacillus halodurans
<400>
15
ProHisValGlnLeu PheLeuGlu GluHisPro SerLeuSer ProIle
1 5 10 15
ThrLeuGluGlnGly LeuSerLys LeuTyrGlu TyrGlnLys GluGln
20 25 30
SerHisCysAlaHis CysProGly LeuGlnLys CysProAsn LeuMet
35 40 45
LysGlyTyrGlnPro ThrLeuTyr ValGluArg AspSerLeu GluLeu
50 55 60
SerTyrSerProCys ProLeuLys GluGluGlu GluArgGlu LysLys
65 70 75 80
LysArgSerLeuIle ArgSerLeu TyrIlePro LysGluIle LeuGlu
85 90 95
AlaLysPheAspAsp ValGluSer GluProGly ArgSerIle AlaSer
100 105 110
HisArgAlaLeuGlu PheAlaLeu SerAlaLys ProGlyGlu AspGly
115 120 125
MetGlyLeuTyrLeu TyrGlyLys PheGlyVal GlyLysThr PheLeu
130 135 140
MetGlyAlaIleAla AsnGluLeu LysAspArg GlyIleAsp SerThr
145 150 155 160
IleValTyrValPro AspPhePhe ArgGluLeu LysGlnSer IleGly
165 170 175
AspGlyThrPheGln GlnLysLeu AspPheVal LysAsnAla GlnVal
180 185 190
CA 02396674 2005-11-29
- 38 -
Leu Ile Phe Asp Asp Ile Gly Ala Glu Thr Met Thr Ser Trp Val Arg
195 200 205
Asp Asp Val Leu Gly Val Ile Leu Gln Tyr Arg Ile Met Glu Lys Leu
210 215 220
Pro Thr Leu Phe Thr Ser Asn Tyr Asp Tyr Asp Glu Leu Glu Glu His
225 230 235 240
Leu Ala Tyr Asn Asp Lys Ser Gly Thr Glu Leu Leu Lys Ala Lys Arg
245 250 255
Val Met Glu Arg Ile Arg His Tyr Thr Val Ser Val Met Val Gln Gly
260 265 270
Gln Asn Arg Arg Glu His
275
<210> 16
<211> 164
<212> PRT
<213> Staphylococcus
aureus
<400> 16
AlaAlaAsp AspIle cysThrAla IleThrAsnGly GluGlnVal Lys
1 5 10 15
GlyLeuTyr LeuTyr GlyProPhe GlyThrGlyLys SerPheIle Leu
20 25 30
GlyAlaIle AlaAsn GlnLeuLys SerLysLysVal ArgSerThr Ile
35 40 45
IleTyrLeu ProGlu PheIleArg ThrLeuLysGly GlyPheLys Asp
50 55 60
GlySerPhe GluLys LysLeuHis ArgValArgGlu AlaAsnIle Leu
65 70 75 80
MetLeuAsp AspIle GlyAlaGlu GluValThrPro TrpValArg Asp
85 90 95
GluValIle GlyPro LeuLeuHis TyrArgMetVal HisGluLeu Pro
100 105 110
ThrPhePhe SerSer AsnPheAsp TyrSerGluLeu GluHisHis Leu
115 120 125
AlaMetThr ArgAsp GlyGluGlu LysThrLysAla AlaArgIle Ile
130 135 140
GluArgVal LysSer LeuSerThr ProTyrPheLeu SerGlyGlu Asn
CA 02396674 2005-11-29
- 39 -
145 150 155 160
Phe Arg Asn Asn
<210> 17
<211> 495
<212> DNA
<213> Staphylococcus aureus
<400>
17
gcagcagatgatatttgtacagcaataactaatggggaacaagtgaaaggcctttacctt 60
tatggtccatttgggacaggtaaatcttttattctaggtgcaattgcgaatcagctcaaa 120
tctaagaaggtacgttcgacaattatttatttaccggaatttattagaacattaaaaggt 180
ggctttaaagatggttcttttgaaaagaaattacatcgcgtaagagaagcaaacatttta 240
atgcttgatgatattggggctgaagaagtgactccatgggtgagagatgaggtaattgga 300
cctttgctacattatcgaatggttcatgaattaccaacattctttagttctaattttgac 360
tatagtgaattggaacatcatttagcgatgactcgtgatggtgaagagaagactaaagca 420
gcacgtattattgaacgtgtcaaatctttgtcaacaccatactttttatcaggagaaaat 480
ttcagaaacaattga 495
<210>18
<211>250
<212>PRT
<213>Staphylococcus
aureus
<400>18
Tyr Lys Asp Gln Gln Lys His Tyr Asp Gly His Lys Phe Ala Asp Cys
1 5 10 15
Pro Asn Phe Val Lys Gly His Val Pro Glu Leu Tyr Val Asp Asn Asn
20 25 30
Arg Ile Lys Ile Arg Tyr Leu Gln Cys Pro Cys Lys Ile Lys Tyr Asp
35 40 45
Glu Glu Arg Phe Glu Ala Glu Leu Ile Thr Ser His His Met Gln Arg
50 55 60
Asp Thr Leu Asn Ala Lys Leu Lys Asp Ile Tyr Met Asn His Arg Asp
65 70 75 80
CA 02396674 2005-11-29
- 40 -
Arg Leu Asp Val Ala Met Ala Ala Asp Asp Ile cys Thr Ala Ile Thr
85 90 95
Asn Gly Glu Gln Val Lys Gly Leu Tyr Leu Tyr Gly Pro Phe Gly Thr
100 105 110
Gly Lys Ser Phe Ile Leu Gly Ala Ile Ala Asn Gln Leu Lys Ser Lys
115 120 125
Lys Val Arg Ser Thr Ile Ile Tyr Leu Pro Glu Phe Ile Arg Thr Leu
130 135 140
Lys Gly Gly Phe Lys Asp Gly Ser Phe Glu Lys Lys Leu His Arg Val
145 150 155 160
Arg Glu Ala~Asn Ile Leu Met Leu Asp Asp Ile Gly Ala Glu Glu Val
165 170 175
Thr Pro Trp Val Arg Asp Glu Val Ile Gly Pro Leu Leu His Tyr Arg
180 185 190
Met Val His Glu Leu Pro Thr Phe Phe Ser Ser Asn Phe Asp Tyr Ser
195 200 205
Glu Leu Glu His His Leu Ala Met Thr Arg Asp Gly Glu Glu Lys Thr
210 215 220
Lys Ala Ala Arg Ile Ile Glu Arg Val Lys Ser Leu Ser Thr Pro Tyr
225 230 235 240
Phe Leu Ser Gly Glu Asn Phe Arg Asn Asn
245 250
<210> 19
<211> 12
<212> PRT
<213> staphylococcus aureus
<400> 19
Gly His Val Pro Glu Asn Val Thr Asp Asn Asp Arg
1 5 10
