Note: Descriptions are shown in the official language in which they were submitted.
CA 02401716 2002-08-29
WO 01/64240 PCT/USO1/06294
METHODS FOR PROMOTING PRODUCTION OF MYELIN
BY SCHWANN CELLS
BACKGROUND OF THE INVENTION
l0 The peripheral nervous system (PNS) serves as a bridge between the
environment and the central nervous system (CNS). The PNS is comprised of
primary
afferent neurons, which sends information from sensory receptors to the CNS,
somatic
motor neurons, which transmit electrical stimuli from the CNS to voluntary
muscles, and
autonomic motor neurons, which transmit electrical stimuli to cardiac muscle,
smooth
muscle or glands. A neuron generally has a cell body, and an axon, which is a
long nerve
cell process extending from the cell body that is capable of rapidly
conducting nerve
impulses over long distances so as to deliver signals to cells. The axons of
many
vertebrate neurons are insulated by a myelin sheath, which greatly increases
the rate at
which an axon can conduct an action potential. Schwann cells are responsible
for
2o myelinating nerve cells in the peripheral nervous system. The Schwann cells
wrap layer
upon layer of their own plasma membrane in a tight spiral around the axon
thereby
insulating the axonal membrane so that almost no current leaks across it.
Unmyelinated
axons in the PNS are nonetheless embedded in Schwann cells although they are
not
ensheathed by myelin.
A number of neuropathies of the PNS are associated with demyelination
or failure of the Schwann cells to properly ensheath the axons of the PNS.
They are
diabetic neuropathy, Guillain-Barre' disease (acute demyelinating
polyneuropathy),
chronic inflammatory demyelinating polyradiculoneuropathy (CIPD), and HIV
inflammatory demyelinating disease. Also axon damage due to physical trauma
may
result in demyelination of the PNS. Thus, there is a need to discover agents
that can be
used to promote the production of myelin by Schwann cells.
CA 02401716 2002-08-29
WO 01/64240 PCT/USO1/06294
2
DESCRIPTION OF THE INVENTION
The present invention fills this need by providing for a method for
. promoting production of myelin or P zero protein by Schwann cell comprising
bringing a
Zcyto7 polypeptide or IL-17 into contact with Schwann cells. Examples of
Zcyto7
polypeptides are the polypeptides of SEQ ID NOs: 2, 7, and 9-28.
Preferably, the mammal treated will be a human and the Zcyto7 will be of
to the human allotypes. Preferably, the Zcyto7 will be administered in an
amount of about
0.1 to 100 micrograms (~,g) per kilogram of body weight.
The teachings of all of the references cited in the present specification are
incorporated in their entirety herein by reference.
Definitions
The term "effective amount" as used herein regarding the effective
amount of Zcyto7 administered in accordance with the present invention means
an
2o amount of Zcyto7 that causes increased expression of myelin by Schwann
cells. The
effective amount of Zcyto7 or IL-17 to be administered is from 0.1 p,g to lmg
of Zcyto7
or IL,-17 per kilogram of body weight per day. More preferably, the effective
amount is
from 1 p,g to 500 p,g of Zcyto7 or IL-17 per kilogram of body weight. Zcyto7
should be
administered daily until the symptoms of neuropathy dissipate.
The term "allelic variant" denotes any of two or more alternative forms of
a gene occupying the same chromosomal locus. Allelic variation arises
naturally through
mutation, and may result in phenotypic polymorphism within populations. Gene
mutations can be silent (no change in the encoded polypeptide) or may encode
3o polypeptides having altered amino acid sequence. The term allelic variant
is also used
herein to denote a protein encoded by an allelic variant of a gene.
Zcyto7 and a method for making Zcyto7 polypeptides have been disclosed
in International Patent Application No. PCT/US98/08212, Publication No. WO
98/49310.
CA 02401716 2002-08-29
WO 01/64240 PCT/USO1/06294
3
Introduction
The present invention is based upon the discovery that Zcyto7 or IL-17
can induce the production of myelin by Schwann cells. The present invention is
also
based upon the discovery that Zcyto7 can induce the production of protein zero
by
Schwann Cells. Protein zero is a major structural protein of peripheral
myelin, and and is
a homophilic immunoglobulin cell adhesion molecule, which mediates adhesion of
Schwann cell membranes as they enwrap axons and generate compact myelin,
Spiryda L.
B., .T. Neurosci, Res. 54: 137-146 (1998).
The axons of many vertebrate neurons are insulated by a myelin sheath,
which greatly increases the rate at which an axon can conduct an action
potential.
Schwann cells, which are supporting or glial cells, form myelin in the
peripheral nerves.
The Schwann cells wrap layer upon layer of their own plasma membrane in a
tight spiral
around the axon, thereby insulating the axonal membrane so that almost no
current leaks
across it. The sheath is interrupted at regularly spaced intervals called the
'nodes of
Ranvier', where almost all the Na+ channels in the axon are concentrated.
Because the
ensheathed portions of the axon membrane are so well insulated, a
depolarization of the
membrane at one node almost immediately spreads passively to the next node.
Thus, an
action potential propagates along a myelinated axon by jumping from node to
node, a
process called salutatory conduction. This type of conduction has two main
advantages:
action potentials travel faster, and metabolic energy is conserved because the
active
excitation is confined to the small regions of axonal plasma membrane at nodes
of
Ranvier. Conduction in myelinated axons is characterized by a rapid electronic
conduction (because of the decreased time constant for conduction) with little
decrement
(because of the increased length constant) between the nodes of Ranvier. Only
at the
nodes is the action potential regenerated. A myelination of an axon increases
electronic
conduction velocity by sevenfold.
3o Myelinated axons are also more efficient metabolically than
nonmyelinated axons. The sodium-potassium pump extrudes the sodium that enters
and
re-accumulates the potassium that leaves the cell during action potentials. In
a
myelinated axon, ionic currents are restricted to the small fraction of the
membrane
surface at the nodes of Ranvier. For this reason fewer Na+ and K+ ions
traverse a unit
area of membrane, and less ion pumping is required to maintain Na+ and K+
gradients.
CA 02401716 2002-08-29
WO 01/64240 PCT/USO1/06294
4
The present invention is a method for inducing the expression of myelin
or Protein zero by Schwann cells. Thus, Zcyto7 can be administered to treat a
number of
demyelinating PNS neuropathies, or to induce the production of myelin around
regenerating peripheral nerve cells that have been injured by trauma.
Those skilled in the art will recognize that the sequences disclosed in
SEQ ID NOS: 1, and 2 represent a single allele of the human Zcyto7. One can
clone
allelic variants of these sequences by probing cDNA or genomic libraries from
different
individuals according to standard procedures.
Acute Demyelinating Polyneuropathy
An example of a demyelinating disease of the PNS is acute demyelinating
polyneuropathy. This acute inflammatory polyneuropathy, also known as Guillain-
Barre'
syndrome (GBS), occurs in all parts of the world and in all seasons. It
affects children
and adults of all ages and both sexes. A mild respiratory or gastrointestinal
infection
precedes the neuritic symptoms by 1 to 3 weeks in about 60 percent of the
patients. Other
less common antecedent events include surgical procedures, viral exanthems and
other
viral illnesses such as cytomegalovirus, Epstein-Barn virus, human
immunodeficiency
2o virus (HIV), bacterial infections, e.g., Mycoplasma pneumoniae, Lyme
disease and
particularly Campylobacter jejuni, and lymphoma, particularly Hodgkin's
disease.
Symptomatology
The major clinical manifestation of GBS is weakness, which evolves,
more or less symmetrically, over a period of several days or a week or two.
Proximal as
well as distal muscles of the limbs are involved, usually the lower
extremities before the
upper trunk, intercostals, neck, and cranial muscles are affected later. The
weakness can
progress to total motor paralysis with death from respiratory failure within a
few days.
3o More than half of the patients complain of pain and an aching discomfort in
the muscles,
mainly those of the hips, thighs, and back. Paresthesias (tingling, burning,
numbness) are
also a frequent and early symptom but tend to be evanescent; occasionally they
are
absent throughout the illness. The most important laboratory aids are the
cerebrospinal
fluid (CSF) examination and electrodiagnostic studies. An increase in CSF
protein is
probably due to widespread inflammatory disease of the nerve roots. In a few
patients
(10 percent or less), the CSF protein values are normal throughout the
illness.
CA 02401716 2002-08-29
WO 01/64240 PCT/USO1/06294
Electrodiagnostic studies may be normal early in the illness. Then there
occurs a reduction in conduction velocity or conduction block in motor
neurons.
Prolonged distal latencies and abnormal F responses (with affection of
proximal parts of
nerves) are other diagnostic findings.
Treatment
Most of the evidence suggests that the clinical manifestations of this
disorder are the result of a cell-mediated immunologic reaction directed at
peripheral
nerves. In general administration of Zcyto7 should begin upon diagnosis of the
disease at
the dosages listed below. However, treatment with Zcyto7 may be delayed until
the
underlying inflammatory condition has subsided. Plasma exchange or intravenous
administration of immunoglobulin can be employed to alleviate the inflammatory
condition. For best results this should be done within two weeks of onset of
symptoms.
The usual plasma exchange regimen removes 200 to 250 mL/kg in four to six
treatments
on alternate days. The usual replacement fluid is saline and 5 percent
albumin.
Alternatively immunoglobulin can be administered at 0.4g/kg/day for 5
consecutive .
days. Zcyto7 can be administered at the onset of the disease, during treatment
to alleviate
the inflammatory process or after the treatment. Administration of Zcyto7
should be
continued on a regular basis, at least 1-3 times a week until full neurologic
recovery by
the patient.
In chronic inflammatory demyelinating polyradiculoneuropathy, other
immunosuppressants and plasmapheresis can be used to alleviate the
inflammatory
condition and Zcyto7 can be administered to promote remyelination.
Diabetic Neuropathies
Zcyto7 can also be used to promote myelination expression in Schwann
cells to treat diabetic neuropathies. The demyelination that occurs in
diabetes mellitus is
believed to be caused by ischernia. The patient should be administered Zcyto7
1 to 3
times a week at the dosages listed below.
CA 02401716 2002-08-29
WO 01/64240 PCT/USO1/06294
6
Use of Zcyto7 to Promote Re-myelination of.Peripheral Neurons Injured by
Trauma
Unlike the central nervous system the neurons of the PNS have the ability
to regenerate or repair themselves after injury caused by trauma. After an
axon of the
PNS is lost through trauma, the proximal stump of the damaged axon develops
sprouts.
In the PNS these sprouts elongate and grow along the path of the original
nerve if this
route is available. The Schwann cells in the distal stumps of the nerve not
only survive
the degeneration of the neuron, but they also proliferate and form rows along
the course
previously taken by the axons. Growth cones of the sprouting axons find their
way along
the rows of Schwann cells and may eventually reinnervate the original
peripheral target
structures. The Schwann cells then remyelinate the axons. To expedite the
generation of
the myelin sheath around the newly formed axon, Zcyto7 can be administered,
preferably
every one to three days until it becomes apparent the nerve is regenerated by
means of
the appropriate neurological test.
Modes of Administration
2o For pharmaceutical use, the proteins of the present invention are
formulated for parenteral, particularly intravenous or subcutaneous, delivery
according to
conventional methods. Intravenous administration will be by bolus injection or
infusion
over a typical period of one to several hours. In general, pharmaceutical
formulations
will include a Zcyto7 protein in combination with a pharmaceutically
acceptable vehicle,
such as saline, buffered saline, 5% dextrose in water or the like.
Formulations may
further include one or more excipients, preservatives, solubilizers, buffering
agents,
albumin to prevent protein loss on vial surfaces, etc. Methods of formulation
are well
known in the art and are disclosed, for example, in Remington: The Science aid
Practice
of Pharmacy, Gennaro, ed., (Mack Publishing Co., Easton, PA, 19th ed., 1995).
Therapeutic doses will generally be in the range of 0.1 to 100 ~.g/kg of
patient weight per
day, preferably 0.5-20 ~.g/kg per day, with the exact dose determined by the
clinician
according to accepted standards determination of dose is within the level of
ordinary
skill in the art. The proteins may be administered for acute treatment, over
one week or
less, often over a period of one to three days or may be used in chronic
treatment, over
several months or years.
CA 02401716 2002-08-29
WO 01/64240 PCT/USO1/06294
7
Nucleic Acid-based Therapeutic Treatment
Zcyto7 can be also administered by means of gene therapy. In one
embodiment, a gene encoding a Zcyto7 polypeptide is introduced in vivo in a
viral
vector. Such vectors include an attenuated or defective DNA virus, such as but
not
limited to herpes simplex virus (HSV), papillomavirus, Epstein Barr virus
(EBV),
adenovirus, adeno-associated virus (AAV), and the like. Defective viruses,
which
entirely or almost entirely lack viral genes, are preferred. A defective virus
is not
infective after introduction into a cell. Use of defective viral vectors
allows for
administration to cells in a specific, localized area, without concern that
the vector can
infect other cells. Examples of particular vectors include, but are not
limited to, a
defective herpes virus 1 (HSV1) vector [Kaplitt et al., Molec. Cell.
Neurosci.2: 320-330
(1991)], an attenuated adenovirus vector, such as the vector described by
Stratford-
Perricaudet et al., J. Clin. Invest. 90 :626-630 (1992), and a defective adeno-
associated
virus vector [Samulski et al., J. Virol., 61:3096-3101 (1987); Samulski et al.
J. Virol.,
63:3822-3828 (1989)].
In another embodiment, the gene can be introduced in a retroviral vector,
2o e.g., as described in Anderson et al., U.S. Patent No. 5,399,346; Mann et
al., Cell,
33:153 (1983); Temin et al., U.S. Patent No. 4,650,764; Temin et al., U.S.
Patent No.
4,980,289; Markowitz et al., J. Virol. 62:1120 (1988); Temin et al., U.S.
Patent No.
5,124,263; International Patent Publication No. WO 95/07358, published March
16,
1995 by Dougherty et al. and Blood, 82:845 (1993).
Alternatively, the vector can be introduced by lipofection irc vivo using
liposomes. Synthetic cationic lipids can be used to prepare liposomes for in
vivo
transfection of a gene encoding a marker [Felgner et al., Proc. Natl. Acad.
Sci. USA,
84:7413-7417 (1987); see Mackey et al., Proc. Natl. Acad. Sci. USA, 85:8027-
8031
(1988)]. The use of lipofection to introduce exogenous genes into specific
organs in vivo
has certain practical advantages. Molecular targeting of liposomes to specific
cells
represents one area of benefit. It is clear that directing transfection to
particular cells
represents one area of benefit. It is clear that directing transfection to
particular cell
types would be particularly advantageous in a tissue with cellular
heterogeneity, such as
the pancreas, liver, kidney, and brain. Lipids may be chemically coupled to
other
molecules for the purpose of targeting. Targeted peptides, e.g., hormones or
CA 02401716 2002-08-29
WO 01/64240 PCT/USO1/06294
8
neurotransmitters, and proteins such as,vantibodies, or non-peptide molecules
could be
coupled to liposomes chemically.
It is possible to remove the cells from the body and introduce the vector
as a naked DNA plasmid and then re-implant the transformed cells into the
body. Naked
DNA vector for gene therapy can be introduced into the desired host cells by
methods
known in the art, e.g., transfection, electroporation, microinjection,
transduction, cell
fusion, DEAE dextran, calcium phosphate precipitation, use of a gene gun or
use of a
DNA vector transporter [see, e.g., Wu et al., J. Biol. Chern., 267:963-967
(1992); Wu et
to al., J. Biol. Chem., 263:14621-14624 (1988)].
Example 1
Clonin o~ f Zcyto7
Zcyto7 was identified from expressed sequence tag (EST) 582069 (SEQ
ID NO: 3) by its homology to Interleukin-17. The EST582069 cDNA clone was
obtained
from the IMAGET"" consortium Lawrence Livermore National Laboratory through
Genome Systems, Inc. The cDNA was supplied as an agar stab containing E. coli
transfected with the plasmid having the cDNA of interest and then streaked out
on an LB
100 ~,g/ml arnpicillin and 100 ~,g/ml methicillin plate. The cDNA insert in
EST582069
was sequenced. The insert was determined to be 717 base pairs long with a 180
amino
acid open reading frame and a 22 amino acid signal peptide.
Example 2
Construction of Zcyto7 Expression Vectors
A 473 by Zcyto7 PCR DNA fragment was generated with 1 ~,l of a
dilution of the EST582069 plasmid prep of Example 2 and 20 picomoles (pm) of
primer
SEQ ll~ NO: 4 and 20 pm primer SEQ ID NO: 5. The digested reaction mixture was
electrophoresed on a 1 % TBE gel; the DNA band was excised with a razor blade
and the
DNA was extracted from the gel with the Qiaquick« Gel Extraction Kit (Qiagen).
The
excised DNA was subcloned into plasmid nfpzp9, which had been cut with Bam and
Xho. Nfpzp9 is a mammalian cell expression vector comprising an expression
cassette
containing the mouse metallothionein-1 promoter, a sequence encoding the
tissue
plasminogen activator (TPA) leader, then multiple restriction sites. These
were followed
by the human growth hormone terminator, an E. coli origin of replication and a
mammalian selectable marker expression unit containing the SV40 promoter,
enhancer
CA 02401716 2002-08-29
WO 01/64240 PCT/USO1/06294
9
and origin of replication, a dihydrofolate reductase gene (DHFR) and the SV40
terminator.
Zcyto7 was purified by means of affinity chromatography using anti-
Zcyto7 antibodies.
Example 3
Cloning of Murine Zc t~o7
to Mouse Zcyto7 was identified from an expressed sequence tag (EST)
660242 (SEQ m NO: 8) by its homology to human Zcyto7. EST660242 cDNA clone
was obtained from the IMAGE consortium Lawrence Livermore National Laboratory
through Genome Systems, Inc. The cDNA was supplied as an agar stab containing
E.
coli transfected with the plasmid having the cDNA of interest and then
streaked out on
an LB 100 ~.g/ml ampicillin, 25 ~,g/ml methicillin plate. The cDNA insert in
EST660242
was sequenced. The insert was determined to be 785 base pairs with an open
reading
frame of 180 amino acids and a putative 20 amino acid signal peptide. The
sequences are
defined by SEQ m NO: 7 and SEQ m NO: 6.
2o Example 4
Induction of Myelin Expression b~yto7
OBJECT
The object of the present experiment was to determine if Zcyto7 could
induce the expression of myelin by Schwann cells.
TEST SYSTEM
Primary Schwann cell cultures and dorsal root ganglia (DRG)-Schwann
cell co-cultures were established. Rat primary Schwann cells were isolated as
described
by Einheber et al., J. Cell Biol. 123:1223-1236 (1994). Schwann cells were
grown in 100
mm poly-L-lysine coated plates in Dulbecco's modified Eagles medium (DMEM)
supplemented with 10% fetal bovine serum (FBS), pituitary extract (lmg/ml) and
10 ~.tM
forskolin; up to 80-90% confluency.
Dissociated neuronal cultures from normal rats were established as
described by HIeitinan et al., Tissue culture methods for the study of
myelination, in
Culturing Nerve Cells, Banker and Goslin, Eds, pp. 338-378(MIT Press,
Cambridge,
MA, 1992). Briefly, DRG were dissected out from the rats, treated with 0.25%
trypsin,
CA 02401716 2002-08-29
WO 01/64240 PCT/USO1/06294
mechanically dissociated, washed, and resuspended in L15 medium with 10% fetal
calf
serum. The neurons were plated onto 12-mm glass coverslips coated with
ammoniated
rat tail collagen (Biomedical Technologies, Inc.) for microscopic evaluation.
Starting one
day following the dissection, cultures were treated over a 2-week period with
three
5 cycles of 5-fluorodeoxyuridine and uridine (both at 10 ~,M) in standard
medium to assure
a pure neuronal population. Standard medium consisted of minimum essential
medium
(MEM) supplemented with 10% FBS, 2mM glutamine, 0.4% glucose, and 50ng/ml (3-
nerve growth factor ((3-NGB).
1o Myelinating co-cultures were established by seeding the purified neurons
with rat primary Schwann cells as described Einheber, et al., id.
TEST ARTICLE AND FORMULATION METHODS
Four solutions of Zcyto7, A258F, A258G, A275F and A311F, were
analyzed all of which had been expressed in Baby Hamster Kidney (BHK) cells.
Solution
A258F contained human Zcyto7 at a concentration of 0.603 mg/ml of phosphate
buffered
saline (PBS) at pH 6Ø Solution A258G contained human Zcyto7 at a
concentration of
0.089 mg/ml of PBS + 0.1 % BSA at a pH of 6Ø Solution A311 contained human
2o Zcyto7 that had been dimerized by fusing an Immunoglobulin (Ig) Fc portion
to the
carboxy terminus of the polypeptide; the concentration of the Zcyto7 fusion
protein was
at 0.45 mg/ml of PBS at pH 7Ø Solution A275F contained murine Zcyto7 at a
concentration of lmg/ml of PBS at pH 6Ø A control of PBS was also tested.
Also tested
was a solution of IL-17 at a concentration of 50 ~ug/ml of PBS, pH 7Ø
A solution of progesterone (Sigma) at a concentration of 1 mg/ml of
ethanol was also prepared.
METHODS
EXPERI1VVIENT 1
EFFECT OF ZCYT07 IN PURE SCWANN CELLS
The effect of Zcyto7 was tested in pure Schwann cell culture and in a co-
culture of DRG and Schwann cells. Primary Schwann cells were grown to 80-90%
confluency in 100mm plates as described above. 12 h before treatment media was
changed to 10 ml of N2 (defined medium) with or without 1 ~M progesterone. The
Zcyto7 solutions were added as 1.1 ml of lOX solution in N2 media, and cells
were
CA 02401716 2002-08-29
WO 01/64240 PCT/USO1/06294
11
incubated for 48 hours (h). Cells were washed once with Hanks balanced salt
solution
(HBSS). The cell suspension was frozen on dry ice, thawed, pelleted and
resuspended in
100 ~.1 of lysis buffer, 125 mM tris (hydroxymethyl) aminomethane HCl (iris
HCl)
pH7.0, 15% sucrose, 4% sodium dodecyl sulfate (SDS), 10 mM
ethylenediaminetetraacetic acid (EDTA). Lysates were boiled for. 5 minutes
(min) on a
water bath and cooled on ice. The protein concentration was determined using 4
~,1 in a
BioRad BCA assay. Each sample was then supplemented with dithiothreitol (DTT)
to a
final concentration of 10 mM phenylmethylsulfonyl fluoride (PMSF) - to 2 mM,
pepstatin and leupeptin - to 10 ~,g/ml.
l0
60 ~,g of protein from each sample were separated on 4-12% Tris-Glycin
NOVEX gels at 125 V constant for 1.5 h. Each gel contained vehicle control,
vehicle
supplemented with progesterone control, and randomly chosen samples from
treatment
groups. Transfer to poly (vinylidine difluoride) (PVFD) membrane was carried
out
according to the NOVEX electrotransfer protocol, at 25 V, for 40 min.
Membranes were
rinsed with tris buffered saline (TBS) for 3 min, and blocked with TBS/0.1%
TWEEN-
2012% BSA for 1 h. Membranes were then incubated with 1:1000 dilution of anti-
MBP
mouse monoclonal IgG (Boehringer, Mannheim) in TBS/0.1% TWEEN-20, 0.5% BSA
overnight, at 4°C. After washing 4 times for 30 min with TBS/0.1% TWEEN-
20,
2o membranes were incubated with anti-mouse horseradish peroxidase conjugate
(1:20,000
dilution in TBS/0.1 % TWEEN-20, incubated with SUPERSIGNAL chemiluminescent
HRP substrate (Pierce Chemical Co., Rockford,1LL,) and exposed to Kodak X-Ray
film
for 15-20 min.
Density of myelin basic protein (MBP) bands was measured on LYNX
Densitometer (Applied Imaging) with ILLUMA System and expressed as percent
progesterone-induced control MBP.
EXPERIMENT 2
3o PRODUCTION OF MYELIN 7N DRG-SCHWANN CELL (DRG-SC)
CO-CULTURES
After establishing the myelinating co-cultures, Schwann cells were
allowed to proliferate for one week attached to the neurons. The medium was
then
changed to 15% arid 50 ~,g/ml ascorbate was added to promote basal lamina
formation
and to initiate myelination. The effect of the Zcyto7 was evaluated for 3.5
weeks in the
presence of ascorbate, with the medium changed every two days. Cultures were
then
CA 02401716 2002-08-29
WO 01/64240 PCT/USO1/06294
12
fixed in 3.7% formaldehyde for 10 minutes and made permeable in 100% methanol
for
15 minutes at -20°C. Following with PBS having 3% BSA, the samples were
incubated
with mouse anti-MBP antibody (Boehringer-Mannheim) overnight, washed and
incubated with Cy3-labeled anti-mouse IgG. Samples were washed, mounted in
VECTASHIELD and examined by epifluorescence with a Zeiss AXIOSKOP
microscope.
Myelin production was quantitatively and qualitatively evaluated, and
myelin density was determined for each of the five replicates per condition.
Six
to representative regions in each sample were captured using a low-level light
COHUE
digital camera, and the density of fluorescent signal determined using the
National
Institutes of Health (NIFi) Scion Image. The mean and standard deviation of
myelin
density was calculated for each group and converted to a percentage by
dividing by the
density seen in the appropriate control culture. Morphometric measurements
were carried
Z5 out using double blind analysis.
EXPERllVIENTAL DESIGN
In experiment 1, the effect of the 4 different solutions of Zcyto7 on MBP
20 accumulation was evaluated in pure Schwann cell cultures, with and without
progesterone pretreatment. Solution A275F was evaluated in experiment 1 at 1
ng/ml,
ng/ml, 100 ng/ml and 1 ~.g/ml.
Four controls were included in each experiment: test vehicle alone,
25 vehicle supplemented with progesterone, vehicle supplemented with IL-17,
and vehicle
supplemented with progesterone and IL-17 [See J. Immunol,150:5445-5456
(1993)].
Three replicates were set up per each condition.
Solution A258F was chosen on the basis of the results of experiment 1
3o was evaluated in experiment 2 for myelin formation in DRG-Schwann co-
cultures.
Concentrations of A258F of 1 ng/ml, 10 ng/ml, and 100 ng/ml were tested
without the addition of progesterone, and a sample having a concentration of
100 ng/ml
with the addition of progesterone was tested. Five controls were included:
test vehicle
35 alone, vehicle supplemented with ascorbate, vehicle supplemented
with~ascorbate plus
progesterone and vehicle supplemented with ascorbate plus IL17, at 10 ng/ml
and 100
ng/ml.
CA 02401716 2002-08-29
WO 01/64240 PCT/USO1/06294
13
RESULTS
Table 1 shows the mean induction ~ standard deviation (SD) for each
solution of Zcyto7. Treatment of pure Schwann cell cultures with Zcyto7 no
matter from
which solution resulted in various degrees of MBP induction. The best results
were
obtained with solution A258F. It induced MBP accumulation in dose-dependent
manner,
with maximal effect at 100 ng/ml. In contrast to the other compounds, culture-
to-culture
variability was minimal.
1o Pretreatment of the Schwann cell cultures with progesterone appears to
mediate the induction of MBP in all cases. However, even in the absence of
progesterone
pretreatment, solutions A2,58F, A258G and A275F significantly induced MBP
accumulation at 100 ng/ml.
CA 02401716 2002-08-29
WO 01/64240 PCT/USO1/06294
14
Table 1. Mean MBP induction after treatment with Zcyto7 (as percent of
progesterone
induction)
TREATMENT A275 F A311 F A258 F A258 G
Media 53.1 15.49 56.49 7.85 36.87 34.92 6.667 2.667
Prog+lng/ml 48.77 45.44 187.20 90.33117.00 15.83
Prog+1 Ong/ml121.00 78.16208.80 87.13187.20 18.43
Prog+100ng/ml278.00 95.43296.20190.30265.90 32.09152 19.38
Prog+l~,g/ml 280.80 62.95302.40222.20174.30 25.59
Prog+IL-17 214.50103.80180.60123.80199.3023.21
lng/ml 102.40 21.33150.50 86.6581.47 7.75
lOng/ml 123.40 50.34120.10157.3041.59 32.29
100ng/ml 210.60 9708 223.30 39.27117.00 42.89210115.20
1 ~,g/ml 170.90 49.63210.20 73.93152.80 27.95
Table 2. MBP signal density in various DRG-Schwann cell co-culture treatment
groups
Treatment MBP Signal Density (mean SD)
Ascorbic acid (AA) + vehicle 13.31 1.92
AA + IL-17 lOng/ml 11.65 0.78
AA + IL-17 100ng/ml 100ng/ml
AA + A258F lng/ml ~ 20.04 8.55
AA + A258F l0ng/ml 47.74 23.60
AA + A258F 100ng/ml ' 74.74 19.22
Vehicle 3.949 1.88
Table 3 Mean MBP induction after treatment with IL-17 (as percent of
progesterone
induction)
IL-17 I 398.40~104.90 I 290.40 ~51.42 I 423.50 ~31.34
CA 02401716 2002-08-29
WO 01/64240 PCT/USO1/06294
Example 5
Induction of the Expression of Protein Zero by Zcyto7
The present example shows that Zcyto7 induces Schwann cells to
5 produce Protein Zero.
Material and Methods
Primary Schwann cells were prepared as described above using 1-day
10 old CD rat neonates. Schwann cells were grown in DMEM, 10% fetal bovine
serum
(FBS), plus bovine pituitary extract (PEX) at 20 p,g/ml and Forskolin at 2p.M.
The cells
were weaned down to a low serum medium ("Li" medium with 1% FBS added to it).
Li
medium was comprised of DMEM/F12, 10 p,g/ml tranferrin, 5 ~,g/ml insulin, 2 nM
progesterone, 2 ~.tM Forskolin, 20 p,g/ml PEX, and 20 ng/ml Heregulin-beta-1
(R & D
15 Systems).
The Schwann cells were grown to confluency in the low serum growth
medium on poly-L-lysine-coated 10 cm tissue culture dishes. The cell medium
was
changed to N2 medium + 1 i.tM progesterone with either Forskolin (Calbiochem)
(10
2o p.M and 25 ~.tM) or 100 ng/ml of human Zcyto7. Control medium was Schwann
cells in
NZ + 1 pM progesterone for the whole time. Cells were harvested and placed in
lysis
buffer (125 mM Tris HCl, pH 7.0, 15% sucrose, 4% SDS, 10 mM EDTA, plus added
Roche Complete-EDTA-free, protease inhibitor cocktail).
Western Blot Anal,
Protein concentrations of cell lysates were determined by Pierce BCA
protein assay (Pierce Chemical Co., Rockford, Illinois). Forty micrograms of
each cell
lysate sample was run on a 4-12% Tris-Glycine gel (Novex) at 125 V for 1 hour
30
3o minutes, and transferred onto a PVDF membrane in a Hoeffer unit a 550 mAmps
for 1
hour. Mouse monoclonal antibody to protein zero was used at 1:1000 dilution (1
~,g/ml
final concentration) to probe the blot. A Vectastain biotin/streptavidin-HRP
2°d
antibody system was used for amplication. The blot was developed with Pierce
SuperSignal West Pico chemiluminescent substrate and scanned on a Boehringer-
Mannheim Lumi-Irnager.
CA 02401716 2002-08-29
WO 01/64240 PCT/USO1/06294
16
Results:
The results indicate that 100 ng/ml of human Zcyto7 induces the
expression of protein zero by primary rat Schwann cells. Values calculated by
the
LumiAnalyst program showed induction of protein zero by Zcyto7 to be increased
over
the control cell culture medium. Designating the amount of P zero protein in
the band
for the media control as 100%, the relative percentage for human Zcyto7-
treated
Schwann cells was 173%. The positive control of Forskolin also showed an
induction
of P zero protein having a relative percentage of P zero protein of 199% at 10
~,t,M, and
30% at 25 ~.M relative to the cell culture control medium.
Example 6
Hybridization Studies
The expression of myelin basic protein and protein zero was also
determined by measuring the mRNA levels that encode myelin basic protein and
protein zero. The results showed that the mRNA that encodes for myelin basic
protein
and the mRNA that encodes for protein zero were upregulated by Zcyto7.
CA 02401716 2002-08-29
WO 01/64240 PCT/USO1/06294
1
SEQUENCE..LISTING
<110> ZymoGenetics. Inc.
<120> Method for~Promoting Production of
Myelin by Schwann Cells w
<130> 00-15PC
<150> 09/515,223
<151> 2000-02-29
<160> 28
<170> FastSEQ for Windows Version 3.0
<210>1
<211>736
<212>DNA
<213>Homo sapiens
<220>
<221> CDS
<222> (57)...(596)
<400> 1
gaattcggca cgaggaggcg ggcagcagct gcaggctgac cttgcagctt ggcgga atg 59
Met
1
gac tgg cct cac aac ctg ctg ttt ctt ctt acc att tcc atc ttc ctg 107
Asp Trp Pro His Asn Leu Leu Phe Leu Leu Thr Ile Ser Ile Phe Leu
10 15
ggg ctg ggc cag ccc agg agc ccc aaa agc aag agg aag ggg caa ggg 155
Gly Leu Gly Gln Pro Arg Ser Pro Lys Ser Lys Arg Lys Gly Gln Gly
20 25 30
cgg cct ggg-ccc ctg gcc cct ggc cct cac cag gtg cca ctg gac ctg 203
Arg Pro Gly Pro Leu Ala Pro Gly Pro His Gln Ual Pro Leu Asp Leu
35 40 45
CA 02401716 2002-08-29
WO 01/64240 PCT/USO1/06294
2
gtg tca cgg atg aaa ccg tat gcc cgc atg gag gag tat gag agg aac 251
Ual Ser Arg Met Lys Pro Tyr Ala Arg Met..Glu Glu Tyr Glu Arg Asn
50 55 . &0 65
atc gag gag atg gtg gcc cag ctg agg aac agc tca gag ctg gcc cag 299
Ile Glu Glu Met Ual Ala Gln Leu Arg Asn Ser Ser Glu Leu Ala Gln
70 75 80
aga aag tgt gag gtc aac ttg cag ctg tgg atg tcc aac aag agg agc 347
Arg Lys Cys Glu Ual Asn Leu Gln Leu Trp Met Ser Asn Lys Arg Ser
85 90 95
ctg tct ccc tgg ggc tac agc atc aac cac gac ccc agc cgt atc ccc 395
Leu Ser Pro Trp Gly Tyr Ser Ile Asn His Asp Pro Ser Arg Ile Pro
100 105 110
gtg gac ctg ccg gag gca cgg tgc ctg tgt ctg ggc tgt gtg aac ccc 443
Ual Asp Leu Pro Glu Ala Arg Cys Leu Cys Leu Gly Cys Ual Asn Pro
115 120 125
ttc acc atg cag gag gac cgc agc atg gtg agc gtg ccg gtg ttc agc 491
Phe Thr Met Gln Glu Asp Arg Ser Met Ual Ser Ual Pro Ual Phe Ser
130 135 140 145
cag gtt cct gtg cgc cgc cgc ctc tgc ccg cca ccg ccc cgc aca ggg 539
Gln Ual Pro Ual Arg Arg Arg Leu Cys Pro Pro Pro Pro Arg Thr Gly
150 155 160
cct tgc cgc cag cgc gca gtc atg gag acc atc get gtg ggc tgc acc I 587
Pro Cys Arg Gln Arg Ala Ual Met Glu Thr Ile Ala Ual Gly Cys Thr
165 170 175
tgc atc ttc tgaatcacct ggcccagaag ccaggccagc agcccgagac 636
Cys Ile Phe
180
catcctcctt gcacctttgt gccaagaaag gcctatgaaa agtaaacact gacttttgaa 696
agccagaaaa aaaaaaaaaa aaaaaaattc ctgcggccgc 736
<210> -2
<211> 180
<212> PRT
<213> Homo sapiens
CA 02401716 2002-08-29
WO 01/64240 PCT/USO1/06294
3
<400> 2
Met Asp Trp Pro His Asn Leu Leu Phe Leu ~Leu Thr Ile Ser Ile Phe
1 5 10 15
Leu Gly Leu Gly Gln Pro Arg Ser Pro Lys Ser Lys Arg Lys Gly Gln
20 25 30
Gly Arg Pro Gly Pro Leu Ala Pro Gly Pro His Gln Ual Pro Leu Asp
35 40 45
Leu Ual Ser Arg Met Lys Pro Tyr Ala Arg Met Glu Glu Tyr Glu Arg
50 55 60
Asn Ile Glu Glu Met Ual Ala Gln Leu Arg Asn Ser Ser Glu Leu Ala
65 70 75 80
Gln Arg Lys Cys Glu Val Asn Leu Gln Leu Trp Met Ser Asn Lys Arg
85 90 95
Ser Leu Ser Pro Trp Gly Tyr Ser Ile Asn His Asp Pro Ser Arg Ile
100 105 110
Pro Ual Asp Leu Pro Glu Ala Arg Cys Leu Cys Leu Gly Cys Ual Asn
115 120 125
Pro Phe Thr Met Gln Glu Asp Arg Ser Met Ual Ser Ual Pro Ual Phe
130 135 140
Ser Gln Ual Pro Ual Arg Arg Arg Leu Cys Pro Pro Pro Pro Arg Thr
145 150 155 160
Gly Pro Cys Arg Gln Arg Ala Ual Met Glu Thr Ile Ala Ual Gly Cys
165 170 175
Thr Cys Ile Phe
180
<210>3
<211>397
<212>DNA
<213>Homo sapiens
<400>
3
aggcgggcanagctgcaggctgaccttgcagcttggcggaatggactggcctcacaacct 60
gctgtttcttcttaccatttccatcttcctggggctgggcagccaggagccccaaaagca 120
agaggaaggggcaagggcggcctgggcccntggcctggcctcaccaggtgccactggacc 180
tggtgtcacggatgaaaccgtatgcccgcatggaggagtatgagagg~aacatcgaggaga 240
tggtggcccagctgaggaacagctcanaagctggcccagagaaagtgtgaggtcaacttg 300
cagctgtggatgtccaacaagaaggagcctgtctcccttggggctacaagcatcaaccac 360
cgaccccagccgtatccccgtgggaccttgccgggac 397
<210> 4
<211> 18
CA 02401716 2002-08-29
WO 01/64240 PCT/USO1/06294
4
<212> DNA
<213> Homo Sapiens
<400> 4
ttaccatttc catcttcc 1g
<210>5
<211>18
<212>DNA
<213>Homo sapiens
<400> 5
cccttcctct tgcttttg 1g
<210>6
<211>692.
<212>DNA
<213>Homo Sapiens
<220>
<221> CDS
<222> (50)...(589)
<400> 6
ggggttcctg gcgggtggca gctgcgggcc tgccgcctga cttggtggg atg gac tgg 58
Met Asp Trp
1
ccg cac agc.ctg ctc ttc ctc ctg gcc atc tcc atc ttc ctg gcg cca 106
Pro His Ser Leu Leu Phe Leu Leu Ala Ile Ser Ile Phe Leu Ala Pro
10 15
agc cac ccc cgg aac acc aaa ggc aaa aga aaa ggg caa ggg agg ccc 154
Ser His Pro Arg Asn Thr Lys Gly Lys Arg Lys Gly Gln Gly Arg Pro
20 25 30 35
agt ccc ttg gcc cct ggg cct cat cag gtg ccg ctg gac-ctg gtg tct 202
Ser Pro Leu Ala Pro Gly Pro His Gln Ual Pro Leu Asp Leu Ual Ser
40 45 50
cga gta aag ccc tac get cga atg gaa gag tat gag cgg aac ctt ggg 250
Arg Val Lys Pro Tyr Ala Arg Met Glu Glu Tyr Glu Arg Asn Leu Gly
55 60 65
CA 02401716 2002-08-29
WO 01/64240 PCT/USO1/06294
gag atg gtg gcc cag ctg agg aac agc tcc..gag cca gcc aag aag aaa 298
Glu Met Ual Ala Gln Leu Arg Asn Ser Ser Glu Pro Ala Lys Lys Lys
70 75 80
tgt gaa gtc aat cta cag ctg tgg ttg tcc aac aag agg agc ctg tcc 346
Cys Glu Ual Asn Leu Gln Leu Trp Leu Ser Asn Lys Arg Ser Leu Ser
85 90 95
cca tgg ggc tac agc atc aac cac gac ccc agc cgc atc cct gcg gac 394
Pro Trp Gly Tyr Ser Ile Asn His Asp Pro Ser Arg Ile Pro Ala Asp
100 105 110 115
ttg ccc gag gcg cgg tgc cta tgt ttg ggt tgc gtg aat ccc ttc acc 442
Leu Pro Glu Ala Arg Cys Leu Cys Leu Gly Cys Val Asn Pro Phe Thr
120 125 130
atg cag gag gac cgt agc atg gtg agc gtg cca gtg ttc agc cag gtg 490
Met Gln Glu Asp Arg Ser Met Val Ser Ual Pro Val Phe Ser Gln Val
135 140 145
ccg gtg cgc cgc cgc ctc tgt cct caa cct cct cgc cct ggg ccc tgc 538
Pro Val Arg Arg Arg Leu Cys Pro Gln Pro Pro Arg Pro Gly Pro Cys
150 155 160
cgc cag cgt gtc gtc atg gag acc atc get gtg ggt tgc acc tgc atc 586
Arg Gln Arg Ual Val Met Glu Thr Ile Ala Val Gly Cys Thr Cys Ile
165 170 175
ttc tgagccaacc accaacccgg tggcctctgc aacaaccctc cctccctgca 639
cccactgtga ccctcaaggc tgataaacag taaacgctgt tctttgtaaa gga 692
<210>7
<211>179
<212>PRT
<213>Homo sapiens
<400> 7
Met Asp Trp Pro His Ser Leu Leu Phe Leu Leu Ala Ile Ser Ile Phe
1 - 5 10 15
Leu Ala Pro Ser His Pro Arg Asn Thr Lys Gly Lys Arg Lys Gly Gln
20 25 30
CA 02401716 2002-08-29
WO 01/64240 PCT/USO1/06294
6
Gly Arg Pro Ser Pro Leu Ala Pro Gly Pro His Gln Val Pro Leu Asp
35 40 . 45
Leu Val Ser Arg Val Lys Pro Tyr Ala Arg Met Glu Glu Tyr Glu Arg
50 55 60
Asn Leu Gly Glu Met Val Ala Gln Leu Arg Asn Ser Ser Glu Pro Ala
65 70 75 80
Lys Lys Lys Cys Glu Val Asn Leu Gln Leu Trp Leu Ser Asn Lys Arg
85 90 g5
Ser Leu Ser Pro Trp Gly Tyr Ser Ile Asn His Asp Pro Ser Arg Ile
100 105 110
Pro Ala Asp Leu Pro Glu Ala Arg Cys Leu Cys Leu Gly Cys Val Asn
115 120 125
Pro Phe Thr Met Gln Glu Asp Arg Ser Met Val Ser Val Pro Ual Phe
130 135 140
Ser Gln Val Pro Val Arg Arg Arg Leu Cys Pro Gln Pro Pro Arg Pro
145 150 155 160
Gly Pro Cys Arg Gln Arg Val Ual Met Glu Thr Ile Ala Val Gly Cys
165 170 175
Thr Cys Ile
<210>8
<211>497
<212>DNA
<213>Homo sapiens
<400>
8
ggggttcctggcgggtggcagctgcgggcctgccgcctgacttggtgggatggactggcc 60
gcacagcctgctcttcctcctggccatctccatcttcctggcgccaagccacccccggaa 120
caccaaaggcaaaagaaaagggcaagggaggcccagtcccttggcccctgggctcatcag 180
gtgccgctggacctggtgtctcgagtaaagccctacgctcgaatggaagagtatgagcgg 240
aaccttggggagatggtggcccagctgaggaacagctccgagccagccaagaagaaatgt 300
gaagtcaatctacagctgtggttgtccaacaagaggagcctgtccccatggggctacagc 360
atcaaccacgaccccagccgcatccctgcggacttgcccgaggcgcggtgcctatgtttg 420
ggttgcgtgaatcccttcaccatgcaggaggaccgtagcatggtgagcgtgccagtgttc 480
agccaggtgccggtgcg 497
<210> 9
<211> 160
<212> PRT
<213>-Homo sapiens
<400> 9
CA 02401716 2002-08-29
WO 01/64240 PCT/USO1/06294
7
Gln Pro Arg Ser Pro Lys Ser Lys Arg Lys Gly Gln Gly Arg Pro Gly
1 5 10 . 15
Pro Leu Ala Pro Gly Pro His Gln Val Pro Leu Asp Leu Ual Ser Arg
20 25 30
Met Lys Pro Tyr Ala Arg Met Glu Glu Tyr Glu Arg Asn Ile Glu Glu
35 40 45
Met Val Ala Gln Leu Arg Asn Ser Ser Glu Leu Ala Gln Arg Lys Cys
50 55 60
Glu Val Asn Leu Gln Leu Trp Met Ser Asn Lys Arg Ser Leu Ser Pro
65 70 75 80
Trp Gly Tyr Ser Ile Asn His Asp Pro Ser Arg Ile Pro Val Asp Leu
85 90 95
Pro Glu Ala Arg Cys Leu Cys Leu Gly Cys Val Asn Pro Phe Thr Met
100 105 110
Gln Glu Asp Arg Ser Met Val Ser Ual Pro Val Phe Ser Gln Val Pro
115 120 125
Ual Arg Arg Arg Leu Cys Pro Pro Pro Pro Arg Thr Gly Pro Cys Arg
130 135 140
Gln Arg Ala Ual Met Glu Thr Ile Ala Val Gly Cys Thr Cys Ile Phe
145 150 155 160
<210>10
<211>160
<212>PRT
<213>Homo sapiens
<400> 10
Gln Pro Arg Ala Pro Lys Ser Lys Arg Lys Gly Gln Gly Arg Pro Gly
1 5 10 15
Pro Leu Ala Pro Gly Pro His Gln Ual Pro Leu Asp Leu Val Ser Arg
20 25 30
Met Lys Pro Tyr Ala Arg Met Glu Glu Tyr Glu Arg Asn Ile Glu Glu
35 40 45
Met Val Ala Gln Leu Arg Asn Ser Ser Glu Leu Ala Gln Arg Lys Cys
50 55 60
Glu Ual Asn Leu Gln Leu Trp Met Ser Asn Lys Arg Ser Leu Ser Pro
65 70 75 80
Trp Gly Tyr Ser Ile Asn His Asp Pro Ser Arg Ile Pro Val Asp Leu
85 90 95
Pro Glu Ala-Arg Cys Leu Cys Leu Gly Cys Val Asn Pro Phe Thr Met
100 ~ 105 110
Gln Glu Asp Arg Ser Met Val Ser Val Pro Ual Phe Ser Gln Val Pro
115 120 125
CA 02401716 2002-08-29
WO 01/64240 PCT/USO1/06294
8
Val Arg Arg Arg Leu Cys Pro Pro Pro Pro Arg Thr Gly Pro Cys Arg
130 135 140
Gln Arg Ala Val Met Glu Thr Ile Ala Ual Gly Cys Thr Cys Ile Phe
145 150 155 160
<210>11
<211>160
<212>PRT
<213>Homo Sapiens
<400> 11
Gln Pro Arg Ser Pro Lys Ala Lys Arg Lys Gly Gln Gly Arg Pro Gly
1 5 10 15
Pro Leu Ala Pro Gly Pro His Gln Ual Pro Leu Asp Leu Val Ser Arg
20 25 30
Met Lys Pro Tyr Ala Arg Met Glu Glu Tyr Glu Arg Asn Ile Glu Glu
35 ~ 40 45
Met Val Ala Gln Leu Arg Asn Ser Ser Glu Leu Ala Gln Arg Lys Cys
50 55 60
Glu Val Asn Leu Gln Leu Trp Met Ser Asn Lys Arg Ser Leu Ser Pro
65 70 75 80
Trp Gly Tyr Ser Ile Asn His Asp Pro Ser Arg Ile Pro Val Asp Leu
85 90 95
Pro Glu Ala Arg Cys Leu Cys Leu Gly Cys Ual Asn Pro Phe Thr Met
100 105 110
Gln Glu Asp Arg Ser Met Val Ser Val Pro Val Phe Ser Gln Val Pro
115 120 125
Val Arg Arg Arg Leu Cys Pro Pro Pro Pro Arg Thr Gly Pro Cys Arg
130 135 140
Gln Arg Ala Ual Met Glu Thr Ile Ala Val Gly Cys Thr Cys Ile Phe
145 150 155 160
<210>12
<211>160
<212>PRT
<213>Homo sapiens
<400> 12
Gln Pro Arg Ser Pro Lys Ser Lys Arg Lys Gly Gln Gly Arg Pro Ala
1 - 5 10 15
Pro Leu Ala Pro Gly Pro His Gln Val Pro Leu Asp Leu Ual Ser Arg
20 25 30
CA 02401716 2002-08-29
WO 01/64240 PCT/USO1/06294
9
Met Lys Pro Tyr Ala Arg Met Glu Glu Tyr Glu Arg Asn Ile Glu Glu
35 40 . 45
Met Val Ala Gln Leu Arg Asn Ser Ser Glu Leu Ala Gln Arg Lys Cys
50 55 60
Glu Val Asn Leu Gln Leu Trp Met Ser Asn Lys Arg Ser Leu Ser Pro
65 70 ~ 75 80
Trp Gly Tyr Ser Ile Asn His Asp Pro Ser Arg Ile Pro Val Asp Leu
85 90 95
Pro Glu Ala Arg Cys Leu Cys Leu Gly Cys Val Asn Pro Phe Thr Met
100 105 110
Gln Glu Asp Arg Ser Met Val Ser Val Pro Ual Phe Ser Gln Ual Pro
115 120 125
Val Arg Arg Arg Leu Cys Pro Pro Pro Pro Arg Thr Gly Pro Cys Arg
130 135 140
Gln Arg Ala Ual Met Glu Thr Ile Ala Val Gly Cys Thr Cys Ile Phe
145 150 155 160
<210>13
<211>160
<212>PRT
<213>Homo sapiens
<400> 13
Gln Pro Arg Ser Pro Lys Ser Lys Arg Lys Gly Gln Gly Arg Pro Gly
1 5 10 15
Pro Leu Ala Pro Gly Pro His Gln Ual Pro Leu Asp Leu Ual Ala Arg
20 25 30
Met Lys Pro Tyr Ala Arg Met Glu Glu Tyr Glu Arg Asn Ile Glu Glu
35 40 45
Met Ual Ala Gln Leu Arg Asn Ser Ser Glu Leu Ala Gln Arg Lys Cys
50 55 60
Glu Val Asn Leu Gln Leu Trp Met Ser Asn Lys Arg Ser Leu Ser Pro
65 70 75 80
Trp Gly Tyr Ser Ile Asn His Asp Pro Ser Arg Ile Pro Ual Asp Leu
85 90 95
Pro Glu Ala Arg Cys Leu Cys Leu Gly Cys Val Asn Pro Phe Thr Met
100 105 - - 110
Gln Glu Asp Arg Ser Met Val Ser Ual Pro Ual Phe Ser Gln Val Pro
115 120 125
Val Arg Arg.Arg Leu Cys Pro Pro Pro Pro Arg Thr Gly Pro Cys Arg
130 ~ 135 140
Gln Arg Ala Val Met Glu Thr Ile Ala Ual Gly Cys Thr Cys Ile Phe
145 150 155 160
CA 02401716 2002-08-29
WO 01/64240 PCT/USO1/06294
<210>14
<211>160
<212>PRT
<213>Homo sapiens
<400> 14
Gln Pro Arg Ser Pro Lys Ser Lys Arg Lys Gly Gln Gly Arg Pro Gly
1 5 10 15
Pro Leu Ala Pro Gly Pro His Gln Ual Pro Leu Asp Leu Val Ser Arg
25 30
Met Lys Pro Tyr Ala Arg Met Glu Glu Tyr Glu Arg Asn Ile Glu Glu
35 40 45
Met Val Ala Gln Leu Arg Asn Ser Ser Glu Leu Ala Gln Arg Lys Cys
50 55 60
Glu Val Asn Leu Gln Leu Trp Met Ser Asn Lys Arg Ser Leu Ser Pro
65 70 75 80
Trp Gly Tyr Ser Ile Asn His Asp Pro Ser Arg Ile Pro Val Asp Leu
85 90 95
Pro Glu Ala Arg Cys Leu Cys Leu Gly Cys Ual Asn Pro Phe Thr Met
100 105 110
Gln Glu Asp Arg Ser Met Val Ser Val Pro Ual Phe Ser Gln Ual Pro
115 120 125
Val Arg Arg Arg Leu Cys Pro Pro Pro Pro Arg Thr Gly Pro Cys Arg
130 135 140
Gln Arg Val Ual Met Glu Thr Ile Ala Val G1y Cys Thr Cys Ile Phe
145 150 155 160
<210>15
<211>160
<212>PRT
<213>Homo sapiens
<400> 15
Gln Pro Arg Ser Pro Lys Ser Lys Arg Lys Gly Gln Gly Arg Pro Gly
1 5 10 15
Pro Leu Ala Pro Gly Pro His Gln Val Pro Leu Asp Leu~Val Ser Arg
20 . 25 30
Met Lys Pro Tyr Ala Arg Met Glu Glu Tyr Glu Arg Asn Ile Glu Glu
35 40 45
Met Val Ala Gln Leu Arg Asn Ser Ser Glu Leu Ala Gln Arg Lys Cys
50 55 60
CA 02401716 2002-08-29
WO 01/64240 PCT/USO1/06294
11
Glu Ual Asn Leu Gln Leu Trp Met Ser Asn Lys Arg Ser Leu Ser Pro
65 70 ..75 80
Trp Gly Tyr Ser Ile Asn His Asp Pro Ser Arg Ile Pro Val Asp Leu
85 90 95
Pro Glu Ala Arg Cys Leu Cys Leu Gly Cys Ual Asn Pro Phe Thr Met
100 105 110
Gln Glu Asp Arg Ser Met Val Ser Val Pro Val Phe Ser Gln Val Pro
115 120 125
Ual Arg Arg Arg Leu Cys Pro Pro Pro Pro Arg Thr Gly Pro Cys Arg
130 135 140
Gln Arg Leu Val Met Glu Thr Ile Ala Ual Gly Cys Thr Cys Ile Phe
145 150 155 160
<210> 16
<211> 160
<212> PRT
<213> Nomo sapiens
<400> 16
Gln Pro Arg Ser Pro Lys Ser Lys Arg Lys Gly Gln Gly Arg Pro Gly
1 5 10 15
Pro Leu Ala Pro Gly Pro His Gln Val Pro Leu Asp Leu Val Ser Arg
20 25 30
Met Lys Pro Tyr Ala Arg Met Glu Glu Tyr Glu Arg Asn Ile Glu Glu
35 40 45
Met Ual Ala Gln Leu Arg Asn Ser Ser Glu Leu Ala Gln Arg Lys Cys
50 55 60
Glu Ual Asn Leu Gln Leu Trp Met Ser Asn Lys Arg Ser Leu Ser Pro
65 70 75 80
Trp Gly Tyr Ser Ile Asn His Asp Pro Ser Arg Ile Pro Ual Asp Leu
85 90 95
Pro Glu Ala Arg Cys Leu Cys Leu Gly Cys Val Asn Pro Phe Thr Met
100 105 110
Gln Glu Asp Arg Ser Met Val Ser Ual Pro Ual Phe Ser Gln Val Pro
115 120 125
Ual Arg Arg Arg Leu Cys Pro Pro Pro Pro Arg Thr Gly Pro Cys Arg
130 135 140
Gln Arg Phe Val Met Glu Thr Ile Ala Val Gly Cys Thr Cys Ile Phe
145 150 155 160
<210> 17
<211> 160
<212> PRT
CA 02401716 2002-08-29
WO 01/64240 PCT/USO1/06294
12
<213> Homo Sapiens
<400> 17
Gln Pro Arg Ser Pro Lys Ser Lys Arg Lys Gly Gln Gly Arg Pro Gly
1 5 10 15
Pro Leu Ala Pro Gly Pro His Gln Ual Pro Leu Asp Leu Ual Gly Arg
20 25 30
Met Lys Pro Tyr Ala Arg Met Glu Glu Tyr Glu Arg Asn Ile Glu Glu
35 40 45
Met Val Ala Gln Leu Arg Asn Ser Ser Glu Leu Ala Gln Arg Lys Cys
50 55 60
Glu Ual Asn Leu Gln Leu Trp Met Ser Asn Lys Arg Ser Leu Ser Pro
65 70 75 80
Trp Gly Tyr Ser Ile Asn His Asp Pro Ser Arg Ile Pro Val Asp Leu
85 90 95
Pro Glu Ala Arg Cys Leu Cys Leu Gly Cys Ual Asn Pro Phe Thr Met
100 105 110
Gln Glu Asp Arg Ser Met Val Ser Val Pro Ual Phe Ser Gln Ual Pro
115 120 125
Val Arg Arg Arg Leu Cys Pro Pro Pro Pro Arg Thr Gly Pro Cys Arg
130 135 140
Gln Arg Ala Val Met Glu Thr Ile Ala Val Gly Cys Thr Cys Ile Phe
145 150 155 160
<210>18
<211>160
<212>PRT
<213>Homo Sapiens
<400> 18
Gln Pro Arg Ser Pro Lys Ser Lys Arg Lys Gly Gln Gly Arg Pro Ser
1 5 10 15
Pro Leu Ala Pro Gly Pro His Gln Val Pro Leu Asp Leu Val Ser Arg
20 25 30
Met Lys Pro Tyr Ala Arg Met Glu Glu Tyr Glu Arg Asn Ile Glu Glu
35 40 45
Met Ual Ala Gln Leu Arg Asn Ser Ser Glu Leu Ala Gl~n Arg Lys Cys
50 55 60
Glu Val Asn Leu Gln Leu Trp Met Ser Asn Lys Arg Ser Leu Ser Pro
65 _ 70 75 80
Trp Gly Tyr Ser Il~e Asn Nis Asp Pro Ser Arg Ile Pro Val Asp Leu
85 90 95
CA 02401716 2002-08-29
WO 01/64240 PCT/USO1/06294
13
Pro Glu Ala Arg Cys Leu Cys Leu Gly Cys Val Asn Pro Phe Thr Met
100 105 . 110
Gln Glu Asp Arg Ser_Met Val Ser Val Pro Val Phe Ser Gln Ual Pro
115 120 125
Val Arg Arg Arg Leu Cys Pro Pro Pro Pro Arg Thr Gly Pro Cys Arg
I30 135 I40
Gln Arg Ala Val Met Glu Thr Ile Ala Val Gly Cys Thr Cys Ile Phe
145 ' 150 155 160
<210>19
<211>160
<212>PRT
<213>Homo sapiens
<400> 19
Gln Pro Arg Ser Pro Lys Val Lys Arg Lys Gly Gln Gly Arg Pro Gly
1 5 10 15
Pro Leu Ala Pro Gly Pro His Gln Val Pro Leu Asp Leu Val Ser Arg
20 25 30
Met Lys Pro Tyr Ala Arg Met Glu Glu Tyr Glu Arg Asn Ile Glu Glu
35 40 45
Met Val Ala Gln Leu Arg Asn Ser Ser Glu Leu Ala Gln Arg Lys Cys
50 55 60
Glu Val Asn Leu Gln Leu Trp Met Ser Asn Lys Arg Ser Leu Ser Pro
65 70 75 80
Trp Gly Tyr Ser Ile Asn His Asp Pro Ser Arg Ile Pro Ual Asp Leu
85 90 95
Pro Glu Ala Arg Cys Leu Cys Leu Gly Cys Ual Asn Pro Phe Thr Met
100 105 110
Gln Glu Asp Arg Ser Met Val Ser Ual Pro Val Phe Ser Gln Val Pro
115 120 125
Val Arg Arg Arg Leu Cys Pro Pro Pro Pro Arg Thr Gly Pro Cys Arg
130 135 140
Gln Arg Ala Val Met Glu Thr Ile Ala Val Gly Cys Thr Cys Ile Phe
145 150 155 160
<210> 20
<211> 160
<212> PRT
<213>-Homo sapiens
<400> 20
CA 02401716 2002-08-29
WO 01/64240 PCT/USO1/06294
14
Gln Pro Arg Ual Pro Lys Ser Lys Arg Lys Gly Gln Gly Arg Pro Gly
1 5 10 . 15
Pro Leu Ala Pro Gly Pro His Gln Ual Pro Leu Asp Leu Ual Ser Arg
20 25 30
Met Lys Pro Tyr Ala Arg Met Glu Glu T,yr Glu Arg Asn Ile Glu Glu
35 40 ' 45
Met Ual Ala Gln Leu Arg Asn Ser Ser Glu Leu Ala Gln Arg Lys Cys
50 55 60
Glu Ual Asn Leu Gln Leu Trp Met Ser Asn Lys Arg Ser Leu Ser Pro
65 70 75 80
Trp Gly Tyr Ser Ile Asn His Asp Pro Ser Arg Ile Pro Ual Asp Leu
85 90 95
Pro Glu Ala Arg~Cys Leu Cys Leu Gly Cys Val Asn Pro Phe Thr Met
100 105 110
Gln Glu Asp Arg Ser Met Val Ser Ual Pro Ual Phe Ser Gln Val Pro
115 120 125
Ual Arg Arg Arg Leu Cys Pro Pro Pro Pro Arg Thr Gly Pro Cys Arg
130 135 140
Gln Arg Ala Ual Met Glu Thr Ile Ala Ual Gly Cys Thr Cys Ile Phe
145 150 155 160
<210>21
<211>158
<212>PRT
<213>Homo Sapiens
<400> 21
Arg Ser Pro Lys Ser Lys Arg Lys Gly Gln Gly Arg Pro Gly Pro Leu
1 5 10 15
Ala Pro Gly Pro His Gln Ual Pro Leu Asp Leu Val Ser Arg Met Lys
20 25 30
Pro Tyr Ala Arg Met Glu Glu Tyr Glu Arg Asn Ile Glu Glu Met Ual
35 40 45
Ala Gln Leu Arg Asn Ser Ser Glu Leu Ala Gln Arg Lys Cys Glu Ual
50 55 60
Asn Leu Gln Leu Trp Met Ser Asn Lys Arg Ser Leu Ser Pro Trp Gly
65 ~ 70 75 80
Tyr Ser Ile Asn His Asp Pro Ser Arg Ile Pro Ual Asp Leu Pro Glu
85 90 95
Ala Arg Cys-Leu Cys Leu Gly Cys Ual Asn Pro Phe Thr Met Gln Glu
100 105 110
Asp Arg Ser Met Ual Ser Val Pro Ual Phe Ser Gln Ual Pro Ual Arg
115 120 125
CA 02401716 2002-08-29
WO 01/64240 PCT/USO1/06294
I5
Arg Arg Leu Cys Pro Pro Pro Pro Arg Thr GIy Pro Cys Arg Gln Arg
130 135 . 140
Ala Ual Met Glu Thr Ile Ala Ual Gly Cys Thr Cys Ile Phe
145 150 155
<210>22
<211>154
<212>PRT
<213>Homo Sapiens
<400> 22
Ser Lys Arg Lys Gly Gln Gly Arg Pro Gly Pro Leu Ala Pro Gly Pro
1 5 10 15
His Gln Ual Pro Leu Asp Leu Ual Ser Arg Met Lys Pro Tyr Ala Arg
20 25 ~ 30
Met Glu Glu Tyr Glu Arg Asn Ile Glu Glu Met Ual Ala Gln Leu Arg
35 40 45
Asn Ser Ser Glu Leu Ala Gln Arg Lys Cys Glu Ual Asn Leu Gln Leu
50 55 60
Trp Met Ser Asn Lys Arg Ser Leu Ser Pro Trp Gly Tyr Ser Ile Asn
65 70 75 80
His Asp Pro Ser Arg Ile Pro Ual Asp Leu Pro Glu Ala Arg Cys Leu
85 90 95
Cys Leu Gly Cys Ual Asn Pro Phe Thr Met Gln Glu Asp Arg Ser Met
100 105 110
Ual Ser Ual Pro Ual Phe Ser Gln Ual Pro Ual Arg Arg Arg Leu Cys
115 120 125
Pro Pro Pro Pro Arg Thr Gly Pro Cys Arg Gln Arg Ala Ual Met Glu
130 135 140
Thr Ile Ala Ual Gly Cys Thr Cys Ile Phe
145 150
<210>23
<211>151
<212>PRT
<213>Homo sapiens
<400> 23
Lys Gly Gln Gly Arg Pro Gly Pro Leu Ala Pro Gly Pro His Gln Ual
1 - 5 10 ~ 15
Pro Leu Asp Leu Ual Ser Arg Met Lys Pro Tyr Ala Arg Met Glu Glu
20 25 30
CA 02401716 2002-08-29
WO 01/64240 PCT/USO1/06294
16
Tyr Glu Arg Asn Ile Glu Glu Met Val Ala Gln Leu Arg Asn Ser Ser
35 40 45
Glu Leu Ala Gln Arg Lys Cys Glu Val Asn Leu Gln Leu Trp Met Ser
50 55 60
Asn Lys Arg Ser Leu Ser Pro Trp Gly Tyr Ser Ile Asn His Asp Pro
65 70 ' 75 ~ 80
Ser Arg Ile Pro Val Asp Leu Pro Glu Ala Arg Cys Leu Cys Leu Gly
85 90 95
Cys Val Asn Pro Phe Thr Met Gln Glu Asp Arg Ser Met Val Ser Val
100 105 110
Pro Val Phe Ser Gln Ual Pro Ual Arg Arg Arg Leu Cys Pro Pro Pro
115 120 125
Pro Arg Thr Gly Pro Cys Arg Gln Arg Ala Val Met Glu Thr Ile Ala
130 135 140
Val Gly Cys Thr Cys Ile Phe
145 150
<210>24
<211>160
<212>PRT
<213>Homo sapiens
<400> 24
His Pro Arg Asn Thr Lys Gly Lys Arg Lys Gly Gln Gly Arg Pro Ser
1 5 10 15
Pro Leu Ala Pro Gly Pro His Gln Ual Pro Leu Asp Leu Val Ser Arg
20 25 30
Val Lys Pro Tyr Ala Arg Met Glu Glu Tyr Glu Arg Asn Leu Gly Glu
35 40 45
Met Val Ala Gln Leu Arg Asn Ser Ser Glu Pro Ala Lys Lys Lys Cys
50 55 60
Glu Val Asn Leu Gln Leu Trp Leu Ser Asn Lys Arg Ser Leu Ser Pro
65 70 75 80
Trp Gly Tyr Ser Ile Asn His Asp Pro Ser Arg Ile Pro Ala Asp Leu
85 90 95
Pro Glu Ala Arg Cys Leu Cys Leu Gly Cys Val Asn Pro Phe Thr Met
100 105 - ~ 110
Gln Glu Asp Arg Ser Met Val Ser Val Pro Val Phe Ser Gln Val Pro
115 120 125
Val Arg Arg-Arg Leu Cys Pro Gln Pro Pro Arg Pro Gly Pro Cys Arg
130 ~ 135 140
Gln Arg Val Ual Met Glu Thr Ile Ala Ual Gly Cys Thr Cys Ile Phe
145 150 155 160
CA 02401716 2002-08-29
WO 01/64240 PCT/USO1/06294
17
<210>25
<211>158
<212>PRT
<213>Homo Sapiens
<400> 25
Arg Asn Thr Lys Gly Lys Arg Lys Gly Gln Gly Arg Pro Ser Pro Leu
1 5 10 15
Ala Pro Gly Pro His Gln Val Pro Leu Asp Leu Val Ser Arg Val Lys
20 25 30
Pro Tyr Ala Arg Met Glu Glu Tyr Glu Arg Asn Leu Gly Glu Met Val
35 40 45
Ala Gln Leu Arg Asn Ser Ser Glu Pro Ala Lys Lys Lys Cys Glu Val
50 55 60
Asn Leu Gln Leu Trp Leu Ser Asn Lys Arg Ser Leu Ser Pro Trp Gly
65 70 75 80
Tyr Ser Ile Asn His Asp Pro Ser Arg Ile Pro Ala Asp Leu Pro Glu
85 90 95
Ala Arg Cys Leu Cys Leu Gly Cys Ual Asn Pro Phe Thr Met Gln Glu
100 105 ~ 110
Asp Arg Ser Met Ual Ser Val Pro Ual Phe Ser Gln Ual Pro Ual Arg
115 120 125
Arg Arg Leu Cys Pro Gln Pro Pro Arg Pro Gly Pro Cys Arg Gln Arg
130 135 140
Val Ual Met Glu Thr Ile Ala Ual Gly Cys Thr Cys Ile Phe
145 150 155
<210> 26
<211> 153
<212> PRT
<213> Homo sapiens
<400> 26
Lys Arg Lys Gly Gln Gly Arg Pro Gly Pro Leu Ala Pro Gly Pro His
1 5 10 15
Gln Ual Pro Leu Asp Leu Ual Ser Arg Met Lys Pro Tyr~Ala Arg Met
20 25 30
Glu Glu Tyr Glu Arg Asn Ile Glu Glu Met Val Ala Gln Leu Arg Asn
35 - 40 45
Ser Ser Glu Leu Ala Gln Arg Lys Cys Glu Ual Asn Leu Gln Leu Trp
50 55 60
CA 02401716 2002-08-29
WO 01/64240 PCT/USO1/06294
18
Met Ser Asn Lys Arg Ser Leu Ser Pro Trp Gly Tyr Ser Ile Asn His
65 70 ..75 80
Asp Pro Ser Arg Ile Pro Ual Asp Leu Pro Glu Ala Arg Cys Leu Cys
85 90 95
Leu Gly Cys Val Asn Pro Phe Thr Met Gln Glu Asp Arg Ser Met Ual
100 105 ~ 110
Ser Ual Pro Val Phe Ser Gln Val Pro Ual Arg Arg Arg Leu Cys Pro
115 120 125
Pro Pro Pro Arg Thr Gly Pro Cys Arg Gln Arg Ala Val Met Glu Thr
130 135 140
Ile Ala Ual Gly Cys Thr Cys Ile Phe
145 150
<210>27
<211>1.28
<212>PRT
<213>Homo sapiens
<400> 27
Met Lys Pro Tyr Ala Arg Met Glu Glu Tyr Glu Arg Asn Ile Glu Glu
1 5 10 15
Met Val Ala Gln Leu Arg Asn Ser Ser Glu Leu Ala Gln Arg Lys Cys
20 25 30
Glu Val Asn Leu Gln Leu Trp Met Ser Asn Lys Arg Ser Leu Ser Pro
35 40 45
Trp Gly Tyr Ser Ile Asn His Asp Pro Ser Arg Ile Pro Ual Asp Leu
50 55 60
Pro Glu Ala Arg Cys Leu Cys Leu Gly Cys Val Asn Pro Phe Thr Met
65 70 75 80
Gln Glu Asp Arg Ser Met Ual Ser Val Pro Val Phe Ser Gln~Va1 Pro
85 - 90 95
Val Arg Arg Arg Leu Cys Pro Pro Pro Pro Arg Thr Gly Pro Cys Arg
100 105 110
Gin Arg Ala Ual Met Giu Thr Ile Aia Val Gly Cys Thr Cys Ile Phe
115 120 125
<210> 28
<211> 157
<212> PRT
<213>-Homo sapiens
<400> 28
CA 02401716 2002-08-29
WO 01/64240 PCT/USO1/06294
19
Arg Ser Pro Lys Ser Lys Arg Lys Gly Gln Gly Arg Pro Giy Pro Leu
1 5 10 . 15
Ala Pro Gly Pro His Gln Val Pro Leu Asp Leu Val Ser Arg Met Lys
20 25 30
Pro Tyr Ala Arg Met Glu Glu Tyr Glu Arg Asn Ile Glu Glu Met Val
35 40 ~ 45
Ala Gln Leu Arg Asn Ser Ser Glu Leu Ala Gln Arg Lys Cys Glu Val
50 55 60
Asn Leu Gln Leu Trp Met Ser Asn Lys Arg Ser Leu Ser Pro Trp Gly
65 70 75 80
Tyr Ser Ile Asn His Asp Pro Ser Arg Ile Pro Val Asp Leu Pro Glu
85 90 ~ 95
Ala Arg Cys Leu Cys Leu Gly Cys Ual Asn Pro Phe Thr Met Gln Glu
100 105 110
Asp Arg Ser Met Val Ser Val Pro Val Phe Ser Gln Val Pro Ual Arg
115 120 125
Arg Arg Leu Cys Pro Pro Pro Pro Arg Thr G1y Pro Cys Arg Gln Arg
130 135 140
Ala Val Met Glu Thr Ile Ala Val Gly Cys Thr Cys Ile
145 150 155
