Note: Descriptions are shown in the official language in which they were submitted.
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-1-
IF1206, A NOVEL INTERFERON-INDUCED POLYPEPTIDE, AND
NUCLEIC ACIDS ENCODING THE SAME
RELATED APPLICATIONS
This application claims priority to U.S. provisional application Serial No.
60/188,716 filed 03/13/2000.
BACKGROUND
Obesity and Metabolic Disorders
Obesity is the most prevalent metabolic disorder in the United States
affecting on the order of 35% of adults at an estimated cost of 300,000 lives
and $70 billion in direct and indirect costs. As an epidemic, it is growing
due to
the increase in the number of children who can be considered overweight or
obese. Obesity is defined as an excess of body fat, frequently resulting in a
significant impairment of health. Obesity results when adipocyte size or
number in a person's body increases to levels that may result in one or more
of a number of physical and psychological disorders. A normal-sized person
has between 30 and 35 billion fat cells. When a person gains weight, these fat
cells increase in size at first and later in number. Obesity is influenced by
genetic, metabolic, biochemical, psychological, and behavioral factors. As
such, obesity is a complex disorder that must be addressed on several fronts
to achieve a lasting positive clinical outcome (ADAReport, 1997; Perusse and
Bouchard, 1999; Pi-Sunjer and Panel, 1998).
Obese individuals are prone to ailments including: type II diabetes
mellitus (NIDDM), hypertension, coronary heart disease,
hypercholesterolemia, osteoarthritis, gallstones, cancers of the reproductive
organs, and sleep apnea. Sleep apnea is episodes of not breathing during
sleep that correlates with higher incidence of stroke and heart attack, two
other factors contributing to obesity-linked morbidity and mortality among the
clinically obese (ADAReport, 1997; Pi-Sunjer and Panel, 1998).
There are several well-established treatment modes ranging from non-
pharmaceutical to pharmaceutical clinical intervention. Non-pharmaceutical
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-2-
intervention includes diet, exercise, psychiatric treatment, and surgical
treatments to reduce food consumption or remove fat (i.e: liposuction).
Appetite suppressants and energy expenditure/nutrient-modifying agents
represent the focus of pharmacological intervention. Dexfenfluramine
(REDUXX~') and sibutramine (MERIDIA~) are members of the first class and
beta3-adrenergic agonists and orlistat (XENICAL~) are representative of the
latter (Dunlop and Rosenzweig-Lipson, 1998).
Animal models have provided strong evidence that genetic make-up is
influential in the determining the nature and extent of obesity. 40-80% of
variation in body mass index (BMI, a measure of obesity correlating weight
and height) can be attributed to genetic factors (Bouchard, 1995; Pi-Sunjer
and Panel, 1998). While human obesity does not generally follow a
Mendelian inheritance pattern (Weigle and Kuijper, 1996), there are several
rodent models that do (Spiegelman and Flier, 1996; Weigle and Kuijper,
1996). As human obesity is a complex trait, it is not surprising that single
mutations in rodents might not explain the etiology of obesity in all humans
although there are examples of humans with genetic lesions analogous to
those found in rodents (Clement et a1.,_1998; Montague et al., 1997).
Interestingly, there are animal models for complex phenotypes, such as
hypertension and stroke, which are obese, too. This suggests that these
animals may represent a more telling model for understanding the
complexities of human obesity (Pomp, 1997; Van Zwieten et al., 1996; Wexler
et al., 1980).
There are several rodent models of obesity that result in the inheritance
of a single genetic lesion. Monogenetic obesity syndromes in mice that are
well characterized but rarely, if ever, observed in humans include: obese
(ob),
aberrant termination of the translation of the satiety factor leptin.
Mutations of
the leptin receptor result in the obese diabetic mouse (db) phenotype. Agouti
(A'') is a coat color mutant that is obese. Normally only expressed in the
skin,
in the mutant animals it is ubiquitously expressed and may antagonize the
binding of melanocyte stimulating hormone (MSH). MSH is derived from
adrenocorticotropic hormone (ACTH) a major pituitary hormone that results
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-3-
from the proteolytic processing of the pro-hormone proopiomelanocortin
(POMC). The fat phenotype is the consequence of a mutation in the
hypothalamic pro-hormone converting enzyme carboxypeptidase E. The least
well-characterized obese mouse mutant is tub. tub encodes a cytosolic
protein that may influence the processing of hypothalamic neuropeptide
hormones such as neuropeptide Y (NPY, an appetite stimulating hormone)
and POMC (Aron et al., 1997; Guan et al., 1998; Spiegelman and Flier, 1996;
Weigle and Kuijper, 1996). Recently, a POMC knockout mouse was reported
that has a phenotype analogous to several mouse models for obesity,
particularly that of Ay. The POMC knockout has early onset obesity and has
yellow hair color as well as adrenal insufficiency due to the apparent
morphological absence of their adrenal gland. As there is no detectable
corticosterone in these animals and corticosterones increase food intake, it
is
surprising that they are obese. The obese phenotype can be treated with a-
MSH, a peptide hormone derived from POMC (Yaswen et al., 1999).
Other animal models include fa/fa (fatty) rats, which bear many
similarities to the ob/ob and db/db mice, discussed above. One difference is
that, while fa/fa rats are very sensitive to cold, their capacity for non-
shivering
thermogenesis is normal. It is well established that thermogenesis and
metabolism are closely coupled endocrinologically. Torpor, a condition
analogous to hibernation and lethargy, seems to play a larger part in the
maintenance of obesity in fa/fa rats than in the mice mutants. Further,
several
desert rodents, such as the spiny mouse, do not become obese in their
natural habitats, but do become so when fed on standard laboratory feed
(Tartaglia, 5,861,485, 1999).
Adipose Tissues
Brown Adipose Tissue (BAT), also known as multilocular adipose
tissue, is so called because of the its color due to the large number of
capillaries and mitochondria in the cells making up this tissue. BAT is
primarily found in the shoulder region and flanks of human embryo and
newborn infant, it then disappears in the first months of life. In animals,
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-4-
particularly hibernating animals and rodents, it is more abundant. BAT has
features of an endocrine organ; it is vascularized by capillaries and it
receives
direct sympathetic innervation. Sympathetic neurotransmission leads to the
release of the catecholamines noradrenaline and adrenaline resulting in the
activation of a hormone-sensitive lipase. This results in the hydrolysis of
triglycerides that are converted to fatty acids and glycerol leading to an
increase in oxygen consumption and heat production by uncoupling of the
mitochondria) proton gradient from the formation of ATP via the activity of
uncoupling proteins (UCPs; (Gura, 1998). BAT stimulation by catecholamines
results in non-shivering thermogenesis (Junqueira et al., 0-8385-0590-2,
1998; Palou et al., 1998; Schrauwen et al., 1999).
Evidence of BAT as an endocrine organ comes from the work of
Himms-Hagen done in the late 1960's. The conclusion that BAT is an
endocrine organ comes from the observations that age and temperature
acclimation affect the degree to which glucose carbon is incorporated into the
lipids of BAT, an indication of metabolic activity under non-shivering
thermogenic conditions (Himms-Hagen, 1969a). In addition, experiments
involving the removal of BAT from rats acclimated to different temperatures
and the effects upon enhanced calorigenic response to catecholamines lead
to the following observations (1) removal of interscapular BAT (IBAT) from
cold-acclimated rats has no immediate effect on the calorigenic response of
rats to catecholamines. The significance being that BAT is not the organ
directly responsive to this stimulus. (2) With time (days), there is a
progressive loss of the enhanced catecholamines response by rats that have
had IBAT removed, suggesting that BAT is responsible for the long-term
maintenance of the catecholamines-induced thermogenic response.
Interestingly, the ability of IBAT to maintain the enhanced response
correlated
with the duration of exposure to cold. This suggests that BAT has short term
and long-term effects on acclimation. With long-term cold acclimation there
may be a proliferation of BAT into regions, other than that occupied by IBAT,
thus maintaining the catecholamines response (Himms-Hagen, 1969b). Other
work showing that transplantation of IBAT from cold-acclimated animals into
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-5-
those raised in the warm can confer a thermogenic response under condition
that normally would not support the endocrine nature of BAT.
The role of this endocrine organ in the maintenance of body weight as
well as thermogenesis was demonstrated by the ablation of BAT in a
transgenic mouse model using a BAT-specific promoter (UCP1) controlling
the expression of diphtheria toxin during the development of this tissue.
Animals were found to be unable to maintain core body temperature when
exposed to the cold and obesity develops in the absence of hyperphagia. The
significance of this latter observation is that in the absence of BAT the mice
have increased metabolic efficiency. That is to say, in the absence of BAT
and UCP, there is a net accumulation of energy stored in the form of fat.
Finally, in the case of one strain of mice with only a transient ablation of
BAT,
the metabolic defect is ameliorated with the reemergence of BAT (Friedman,
1993; Lowell et al., 1993). These data taken together support the contention
that BAT is an endocrine organ with an indirect but pivotal role in the
metabolic status of organisms in which it is observed.
Endocrine organs regulate metabolism and in doing so, perforce, must
regulate gene expression. Only a small set of genes have been shown to
involved in metabolism related to brown adipose tissue as an endocrine tissue
(Charon et al., 1995; Collins et al., 1999; Denjean et al., 1999; Foellmi-
Adams
et al., 1996; Savontaus et al., 1998). Regardless of the mechanism of BAT-
mediated non-shivering thermogenesis, genes modulated in response to
mouse husbandry below the thermal neutral zone of these animals represent
important markers of metabolic response, or lack thereof, potential drug
targets for metabolic disorders, and/or in the case of secreted/integral
membrane proteins drugs themselves.
Interferons
Interferons (IFNs) are a part of the group of intercellular messenger
proteins known as cytokines. IFNa is the product of a multigene family of at
least 16 members, whereas IFN(i is the product of a single gene. a- and (3-
IFNs are also known as type I IFNs. Type I IFNs are produced in a variety of
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-6-
cell types. Biosynthesis of type I IFNs is stimulated by viruses and other
pathogens and by various cytokines and growth factors. IFNy, also known as
type II IFN, is produced in T-cells and natural killer cells. Biosynthesis of
type
II IFN is stimulated by antigens to which the organism has been sensitized.
Both a- and 8-IFNs are immunomodulators and anti-inflammatory agents,
activating macrophages, T-cells and natural killer cells.
IFNs are part of the body's natural defense to viruses and tumors.
They exert these defenses by affecting the function of the immune system
and by direct action on pathogens and tumor cells. IFNs mediate these
multiple effects in part by inducing the synthesis of many cellular proteins.
Some interferon-inducible (1F1) genes are induced equally well by a-, (i-, and
y-IFNs. Other IFI genes are preferentially induced by the type I or by the
type.
II IFNs. _
The various proteins produced by IFI genes possess antitumor,
15. antiviral and immunomodulatory functions. The expression of tumor antigens
by cancer cells is increased in the presence of IFNa, thus rendering the
cancer cells more susceptible to immune rejection. The IFI proteins
synthesized in response to viral infections are known to inhibit viral
functions ,
such as cell penetration, uncoating, RNA and protein synthesis, assembly and
release (Hardman et al., 1996). Type II IFN stimulates expression of major
histocompatibility complex (MHC) proteins. For this reason it is thus used in
immune response enhancement (De Maeyer and De Maeyer-Guignard, 1998;
Janeway and Travers, 1997).
Interferons may be grouped into three categories. IFNa (leukocyte)
interferon is made by white blood cells; IFN(i (fibroblast) interteron is made
by
skin cells; and IFNy (immune) interferon is made by lymphocytes after
stimulation by antigen. Host response to infection includes changes in
metabolic state, for example the regulation of hepatic fatty acid
biosynthesis.
In response to IFNa fatty acid biosynthesis is stimulated, but the mechanism
appears to be different from that of other cytokines such as interleukin-1 (IL-
1)
and tumor necrosis factor (TNF) since only treatment with the former in
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-7-
conjunction with either one of the two later cytokines can stimulate
lipogenesis. IL-1 and TNF cannot act synergistically with each other, but can
do so with IFNa (Grunfeld and Feingold, 1992). However, there is an older
observation that TNF can affect the thermogenic activity of BAT, the core
temperature, the rate of food intake and body weight, and resting oxygen
consumption of rats. In this work there seems to be a less robust response to
IFNy (Coombes et al., 1987).
In addition to changes in fatty acid metabolism and biosynthesis that
might be induced by treatment with IFNs and/or other cytokines, it has been
observed that treatments can induce the expression of inducible nitric oxide
synthase (iNOS) when mice or cell lines (NIH 3T3L1) are treated with multiple
cytokines such as IFNy, TNFa, and bacterial endotoxin lipopolysaccharide
(LPS) together. Alone, these agents do not induce the expression of iNOS
(Kaput et al., 1999).
Interestingly, IFNa and IFN~ have been shown to affect the
composition of BAT in suckling mice. Morphological changes included
reduction in the number and size of mitochondria as well as the inclusions in
the cristae. In addition, there was a change in the total amounts of lipids in
the BAT and a reduction in the thickness of white adipose tissue in treated
animals. The changes described were analagous to those observed in older
animals (Sbarbati et al., 1995). The response of BAT in rats treated with TNF,
and a much-reduced response to INFy treatment, was limited to juveniles;
adult rats were less responsive to treatment .(Coombes et al., 1987).
These observations suggest that IFNs or more specifically, interferon-
modulated genes may play a role in the composition and distribution of BAT
and WAT. If so, then these IFNresponsive genes may represent targets or
agents of therapeutic intervention in metabolic disease, if not excellent
markers for the assessment of such compounds.
IFNinduced genes in mice cluster on chromosome 1 in the region 95.2
cM from the centromere in close proximity to the erythroid a-spectrin locus
and the serum amyloid P-component locus. This region corresponds to
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
_$-
human 1 q21-23. The genes that form the interferon-inducible gene cluster
contain canonical seven acid repeat regions as well as conserved non-coding
regions in the promotor regions. These genes appear to have evolved
because of gene duplication then subsequently diverged. There are many
known interferon-inducible genes, the founding members of the mouse 200
series genes are 201, 202abc, 203, 204, and 205/D3. The p202 and p204
gene has been localized to the cytoplasm and nucleus of cells. Constitutive
over-expression of p202 in transfected cells inhibits cell growth. p202 binds
the cell growth regulatory retinoblastoma protein (pRb) in vitro and in vivo.
The 202 protein is a 52kD phosphoprotein that can bind to the pRb as well as
a number of other transcription factors such as c-Jun, c-Fos, NFKB, and AP-1
(Min et al., 1996). The 72kD gene product of the 204 gene is also a
phosphoprotein (Choubey and Lengyel, 1992; Choubey and Lengyel, 1993;
Choubey et al., 1989; Tannenbaum et al., 1993; Wang et al., 1999).
A human IFI gene known as 6-16 encodes an mRNA that is highly
induced by type I IFNs in a variety of human cells (Kelly et al., 1986). After
induction, 6-16 mRNA constitutes as much as 0.1 % of the total cellular
mRNA. The 6-16 mRNA is present at only very low levels in the absence of
type I IFN, and is only weakly induced by type II IFN.
The 6-16 mRNA encodes a hydrophobic protein of 130 amino acids.
The first 20 to 23 amino acids comprise a putative signal peptide. Protein 6-
16 has at least two predicted transmembrane regions culminating in a
negatively charged C-terminus.
The p27 gene encodes a protein with 41 % amino acid sequence
identity to the 6-16 protein. The p27 gene is expressed in some breast tumor
cell lines and in a gastric cancer cell line. In other breast tumor cell
lines, in
the HeLa cervical cancer cell line, and in fetal lung fibroblasts, p27
expression
occurs only upon a-IFN induction. In one breast tumor cell line, p27 is
independently induced by estradiol and by IFN (Rasmussen et al., 1993).
Expression of p27 was analyzed in 21 primary invasive breast
carcinomas, 1 breast cancer bone metastasis, and 3 breast fibroadenomas.
High levels of p27 were found in about one-half of the primary carcinomas
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
_g_
and in the bone metastasis, but not in the fibroadenomas. These
observations suggest that certain breast tumors may produce high levels of,
or have increased sensitivity to, type I IFN as compared to other breast
tumors (Rasmussen et al., 1993). In addition, the p27 gene is expressed at
significant levels in normal tissues including colon, stomach and lung, but
not
expressed in placenta, kidney, liver or skin (Rasmussen et al., 1993).
The small IFI gene products may contribute to viral resistance. A
hepatitis-C virus (HCV)-induced gene, 130-51, was isolated from a cDNA
library prepared from chimpanzee liver during the acute phase of the
infection.
The protein product of this gene has 97% identity to the human 6-16 protein
(Kato et al., 1992). The investigators suggest that HCV infection actively
induces IFN expression, which in turn induces expression of IFI genes
including 130-51. IFI genes may be important in viral infections, such as in
hepatitis, including hepatoxicity induced by inflammation.
The IFI proteins synthesized in response to viral infections are known
to inhibit viral functions such as penetration, uncoating, RNA or protein
synthesis, assembly or release. The 130-51 protein may inhibit one or more
of these functions in HCV. A particular virus may be inhibited in multiple
functions by IFI proteins. In addition, the principle inhibitory effect
exerted by
IFI proteins differs among the virus families (Hardman et al., 1996).
The IFI proteins of the invention may provide the basis for clinical
diagnosis of diseases associated with their induction. These proteins may be
useful in the diagnosis and treatment of tumors, viral infections,
inflammation,
or conditions associated with impaired immunity. Furthermore, these proteins
may be used for investigations of the control of gene expression by IFNs and
other cytokines in normal and diseased cells.
In murine models of inflammatory bowel disease, systemic
administration of interleukin (IL)-12 and IL-18 to wild-type BALB/c mice
induces liver injury and intestinal inflammation. The nature of the injury and
the induced hepatotoxcicity includes prominent intestinal mucosal
inflammation and fatty liver, leading to piloerection, bloody diarrhoea, and
weight loss. IL-12 and IL-18 induce striking elevations in serum levels of
IFNy
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-10-
that would be expected to result in the expression of interferon-induced
genes. The major symptoms of IL-12- and IL-18-induced toxicity are similar to
those found in endotoxin-induced septic shock. TNF-a knockout mice induce
intestinal mucosal inflammation. Furthermore, they have diffuse and dense
infiltration of small fat droplets in their hepatocytes associated with an
increase in serum levels of liver enzymes representing the fatty liver
(steatosis). Fatty liver is dependent upon IFNy that may induce the expression
of interferon-induced genes in the liver and other tissues, thereby affecting
the
metabolism of fatty acids (Chikano et al., 2000; Nakamura et al., 2000).
Although obesity-related fatty livers are vulnerable to damage from
endotoxin, the involved mechanisms remain obscure. (Guebre-Xabier et al.,
2000) determined if immunologic priming might be involved in this process by
determining if fatty livers resemble normal livers that have been sensitized
to
endotoxin damage by Propionibacterium acnes infection. The latter induces
interleukin (IL)-12 and -18, causing a selective reduction of CD4+NK T cells,
diminished IL-4 production, deficient production of T-helper type 2 (Th-2)
cytokines (e.g., IL-10), and excessive production of Th-1 cytokines (e.g.,
interteron-y). Liver and spleen lymphocyte populations and hepatic cytokine
production were compared in genetically obese, ob/ob mice (a model for
obesity-related fatty liver) and lean mice. Obese mice have a selective
reduction of hepatic CD4+NK T cells. Serum IL-18 is also increased basally,
and the hepatic mRNA levels of IL-18 and -12 are greater after endotoxin
challenge. Thus, up-regulation of IL-18 and IL-12 in fatty livers may reduce
hepatic CD4+NK T cells. In addition, mononuclear cells from fatty livers have
decreased expression of the adhesion molecule, leukocyte factor antigen-1
(LFA-1), which is necessary for the hepatic accumulation of CD4+NK T cells.
Consistent with reduced numbers of hepatic CD4+NK T cells, mononuclear
cells from fatty livers produce less IL-4. Furthermore, after endotoxin
treatment, hepatic induction of IL-10 is inhibited, while that of IFNy is
enhanced. Thus, fatty livers have inherent immunologic alterations that may
predispose them to damage from endotoxin and other insults that induce a
proinflammatory cytokine response.
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-11-
The role of the IFN-inducible p204 as growth regulator has been
investigated by transfecting an expression vector constitutively expressing
p204 into several cell lines. Like pRB and p107, p204 is a potent growth
inhibitor in sensitive cells, as demonstrated by cell focus assays. Since
stable
transfectants of sensitive lines constitutively overexpressing p204 cannot be
established in vitro, investigators have used an inducible promoter to express
p204. It has been shown that proliferation of B6MEF fibroblasts lacking
endogenous p204 is strongly inhibited by transient p204 expression in the
nucleus. p204 delays G1 progression into the S-phase and cells accumulate
with a DNA content equivalent to cells arrested in late G1. The role of p204
in
the control of cell growth in vivo has been investigated by generating _
transgenic mice in which the IFI204 gene was constitutively expressed in all
tissues. The over expression of the p204 transgene is compatible with
embryo development up to the four-cell stage in an in vitro follow-up of 4.5
days. However, no viable animals with an intact copy of the transgene were
obtained, suggesting that high and constitutive levels of p204 expression can
impair normal embryo development. These findings indicate that p204 plays a
negative role in growth regulation and provide new information about the
molecular mechanisms exploited by IFNs to inhibit cell proliferation (Lembo et
al., 1998). Mutations affecting the expression of interferon-induced proteins
may play a role in controlling cellular proliferation as observed in cancer as
well as in cellular differentiation. For example, the human interferon induced
protein IF116 has been found to play a role in hematopoiesis. 1F116 is
expressed in CD34+ and monocytoid daughter cells, but is rapidly and
markedly down-regulated at the corresponding stages of polymorphonuclear
anderythroid development. This differential expression of IFI 16 in myeloid
precursor subpopulations and its perceived molecular properties are
consistent with a possible role in regulating myelopoiesis (Dawson et al.,
1998; Landolfo et al., 1998).
Cancer Cachexia
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-12-
Cachexia is a wasting phenomenon observed in almost half of cancer
patients. Cachexia is a result of tumor-induced distant metabolic changes
disproportionate to tumor burden. Weight loss by cancer patients is most
prevalent in those with pancreatic and gastric cancers, but is not limited to
these cancers. Cachexia-induced weight loss may lead to respiratory
distress, a major contributing factor to mortality among cancer patients as
metabolic changes lead to loss of adipose tissue and skeletal muscle mass,
particularly as respiratory muscle is affected. Knowledge about the
mechanisms of cachexia may lead to better therapeutic and clinical
interventions that complement chemotherapy (DeWys et al., 1980; Tisdale,
1999).
INFy prevents cancer cachexia in a mouse model, perhaps by the
down regulation of the enzyme lipoprotein lipase and/or the up regulation of
triglyceride lipase. In such a case, the IFNy mediated modulation of these
genes andlor other indirect regulation of their activity would require the
activity
of signal transduction and/or transcription factors (Mori et al., 1996x;
Tisdale,
1999). Interleukin-12's (IL-12) activity in preventing cachexia in a murine
model is at least in part due to the ability of IL-12 to down regulate the
expression of IL-6 and INF-y (Mori et al., 1996b).
Understanding the mechanisms involved in INF-induced gene
expression increases the usefulness of animal models for cachexia.
Understanding of such models is instrumental in the development of effective
therapy. Interferon-induced genes act as markers for INF activities, for
example in the case of genes that are modulated in response to thermogenic
conditions that are known to affect metabolic status. Genes modulated under
these conditions, as well as with IFN treatment, make it possible to dissect
the
roles of multiple proteins in complex pathways that are specific for adipose
tissues (WAT and BAT) and skeletal muscle by monitoring the modulation of .
INF-affected genes.
SUMMARY
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-13-
The invention is based in part upon the discovery of novel nucleic acid
sequences encoding novel polypeptides. Nucleic acids encoding the
polypeptides disclosed in the invention, and derivatives and fragments
thereof, will hereinafter be collectively designated as "1F1206" nucleic acid
or
polypeptide sequences.
In one aspect, the invention provides an isolated IFI206 nucleic acid
molecule encoding an IF1206 polypeptide that includes a nucleic acid
sequence that has identity to the nucleic acids disclosed in SEQ ID NOS:1 or
3. In some embodiments, the IFI206 nucleic acid molecule can hybridize
under stringent conditions to a nucleic acid sequence complementary to a
nucleic acid molecule that includes a protein-coding sequence of an IFI206
sequence. The invention also includes an isolated nucleic acid that encodes
an IF1206 polypeptide, or a fragment, homolog, analog or derivative thereof.
For example, the nucleic acid can encode a polypeptide at least 80% identical
to a polypeptide comprising the amino acid sequences of SEQ ID NOS:2, 4 or
15. The nucleic acid can be, for example, a genomic DNA fragment or a
cDNA molecule that includes the nucleic acid sequence of any of SEQ ID
NOS: 2, 4 or 15.
Also included in the invention is an oligonucleotide, e.g., an
oligonucleotide which includes at least 6 contiguous nucleotides of an IFI206
nucleic acid (e.g., SEQ ID NOS:1 or 3) or a complement of said
oligonucleotide.
Also included in the invention are substantially purified IF1206 (SEQ ID
N0:2, 4 or 15). In some embodiments, the IF1206 include an amino acid
sequence that is substantially identical to the amino acid sequence of a
human IF1206.
The invention also features antibodies that immunoselectively-bind
IF1206.
In another aspect, the invention includes pharmaceutical compositions
that include therapeutically- or prophylactically-effective amounts of a
therapeutic and a pharmaceutically-acceptable carrier. The therapeutic can
be, e.g., an IF1206, an IF1206, or an antibody specific for an IF1206. In a
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-14-
further aspect, the invention includes a kit containing, in one or more
containers, a therapeutically- or prophylactically-effective amount of this
pharmaceutical composition.
In a further aspect, the invention includes a method of producing a
polypeptide by culturing a cell that includes an IFI206, under conditions
allowing for expression of the IF1206 encoded by the DNA. If desired, the
IF1206 can then be recovered.
In another aspect, the invention includes a method of detecting the
presence of an IF1206 in a sample. In the method, a sample is contacted with
a compound that selectively binds to the polypeptide under conditions
allowing for formation of a complex between the polypeptide and the
compound. The complex is detected, if present, thereby identifying the IF1206
within the sample.
The invention also includes methods to identify specific cell or tissue
types based on their expression of an IF1206.
Also included in the invention is a method of detecting the presence of
an IF1206 molecule in a sample by contacting the sample with an IF1206
probe or primer, and detecting whether the nucleic acid probe or primer bound
to an IFI206 molecule in the sample.
In a further aspect, the invention provides a method for modulating the
activity of an IF1206 by contacting a cell sample that includes the IF1206
with a
compound that binds to the IF1206 in an amount sufficient to modulate the
activity of said polypeptide. The compound can be, e.g., a small molecule,
such as a nucleic acid, peptide, polypeptide, peptidomimetic, carbohydrate,
lipid or other organic (carbon containing) or inorganic molecule, as further
described herein.
Also within the scope of the invention is the use of therapeutics in the
manufacture of a medicament for treating or preventing disorders or
syndromes related to obesity, including, e.g., type II diabetes mellitus
(NIDDM), hypertension, coronary heart disease, hypercholesterolemia,
osteoarthritis, gallstones, cancers of the reproductive organs, and sleep
apnea, as well as those directly related to interferons, such as metabolic
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-15-
disorders, tumors, viral infections, inflammation, cancer (including renal,
bladder and ovarian carcinomas, leukemias, and Kaposi's sarcoma), cancer
cachexia, infections by viruses or other pathogens (such as HCV and
leishmania), and conditions associated with inflammation or immune
impairment such as rheumatoid and osteoarthritis and Acquired
Immunodeficiency Syndrome (AIDS). The Therapeutic can be, e.g., an
IFI206, an IF1206, or an IF1206 -specific antibody, or biologically-active
derivatives or fragments thereof.
The invention further includes a method for screening for a modulator
of disorders or syndromes including, e.g.,. type II diabetes mellitus (NIDDM),
hypertension, coronary heart disease, hypercholesterolemia, osteoarthritis,
gallstones, cancers of the reproductive organs, and sleep apnea, as well as
those directly related to interferons, such as metabolic disorders, tumors,
viral
infections, inflammation, cancer, cancer cachexia, infections by viruses or
other pathogens, and conditions associated with inflammation or immune
impairment such as rheumatoid and osteoarthritis and Acquired '
Immunodeficiency Syndrome (AIDS). The method includes contacting a test
compound with an IF1206 and determining if the test compound binds to the
IF1206. Binding of the test compound to the IF1206 indicates the test
compound is a modulator of activity, or of latency or predisposition to the
aforementioned disorders or syndromes.
Also within the scope of the invention is a method for screening for a
modulator of activity, or of latency or predisposition to disorders or
syndromes
including, e.g., type II diabetes mellitus (NIDDM), hypertension, coronary
heart disease, hypercholesterolemia, osteoarthritis, gallstones, cancers of
the
reproductive organs, and sleep apnea, as well as those directly related to
interferons, such as metabolic disorders, tumors, viral infections,
inflammation, cancer, cancer cachexia, infections by, viruses or other
pathogens, and conditions associated with inflammation or immune
impairment such as rheumatoid and osteoarthritis and Acquired
Immunodeficiency Syndrome (AIDS), by administering a test compound to a
test animal at increased risk for the aforementioned disorders or syndromes.
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-16-
The test animal expresses a recombinant polypeptide encoded by an IFI206.
Expression or activity of IF1206 is then measured in the test animal, as is
expression or activity of the protein in a control animal which recombinantly-
expresses I F1206 and is not at increased risk for the disorder or syndrome.
Next, the expression of IF1206 in both the test animal and the control animal
is
compared. A change in the activity of IF1206 in the test animal relative to
the
control animal indicates the test compound is a modulator of latency of the
disorder or syndrome.
In yet another aspect, the invention includes a method for determining
the presence of or predisposition to a disease associated with altered levels
of
an IF1206, an IF1206, or both, in a subject (e.g., a human subject). The
method includes measuring the amount of the IF1206 in a test sample from
the subject and comparing the amount of the polypeptide in the test sample to
the amount of the IF1206 present in a control sample. An alteration in the
level of the IF1206 in the test sample as compared to the control sample
indicates the presence of or predisposition to a disease in the subject.
Preferably, the predisposition includes, e.g., Type II diabetes mellitus
(NIDDM), hypertension, coronary heart disease, hypercholesterolemia,
osteoarthritis, gallstones, cancers of the reproductive organs, and sleep
apnea, as well as those directly related to interferons, such as metabolic
disorders. Also, the expression levels of the new polypeptides of the
invention can be used in a method to screen for various cancers.
In a further aspect, the invention includes a method of treating or
preventing a pathological condition associated with a disorder in a mammal by
administering to the subject an IF1206, an IFI206, or an IF1206 -specific
antibody to a subject (e.g., a human subject), in an amount sufficient to
alleviate or prevent the pathological condition. In preferred embodiments, the
disorder, includes, e.g., Type II diabetes mellitus (NIDDM), hypertension,
coronary heart disease, hypercholesterolemia, osteoarthritis, gallstones,
cancers of the reproductive organs, and sleep apnea, as well as those directly
related to interferons, such as metabolic disorders.
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-17-
In yet another aspect, the invention can be used in a method to identity
the cellular components that interact with the IFI206 and polypeptides,
including cellular receptors and downstream effectors, by any one of a
number of techniques commonly employed in the art. These include but are
not limited to the finro-hybrid system, affinity purification, co-
precipitation with
Abs or other specific-interacting molecules.
Although methods and materials similar or equivalent to those
described herein can be used in the practice or testing of the present
invention, suitable methods and materials are described below.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG 1 shows Global Sequence Similarity (GCG:GAP) (A), Multiple
Alignment Analysis (BeStFlt (Genetics computer Group_(GCG), 1999))
demonstrating the relationship between SEQ_ID_NO 2 and SEQ_ID_NO 4
(B) and PHYLIP Protein Distance Analysis. Neighbor-Joining/UPGMA
method version 3.572c, tree is unrooted and negative branch lenghts are
allowed. (C) Partial ClustalW analysis (Thompson, et al., Nucleic Acids
Research, 22(22):4673-4680) of SEQ_ID_NO 2 and SEQ_ID_NO_3 and
proteins encoded by of mouse and human genes encoding polypeptides of
interferon-induced genes (AIM2, GENBANK-ID:AF024714; GENBANK-
ID:HUMIF116~acc:M63838; IF116B, GENBANK-ID:AF208043; IF1202,
GENBANK-ID:MUSINA202~acc:M31418; IF1202B, GENBANK-ID:AF140672;
IF1204, GENBANK-ID:MUSINA204~acc:M31419; IF1205D3, GENBANK-
ID:MUSLPSINDA~acc:M74123; IF13, GENBANK-ID:AF022371;MNDA,
GENBANK-ID:HUMMCNDA~acc:M81750). (B) and (C) demonstrate the
relationship between SEQ_ID_NO 2 and SEQ_ID_NO 4 and protein
sequences to known interferon-induced genes.
FIG 2 shows hydrophobicity plots ((GCG), 1999) for IF1206 (A; SEQ ID
N0:1) and its naturally occurring variant (B; SEQ ID N0:3); the X axis
reflects
amino acid position, and the positive Y axis, hydrophobicity.
FIG 3 shows the radiation hybrid map of IF1206 (SEQ ID N0:2/SEQ ID
N0:4) as generated using Auto-RHMAPPER (Stein et al., 1995).
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-18-
FIG 4 shows DOTPLOT and COMPARE analysis of polypeptide
sequence from IF1206 variants.
FIG 5 shows that IF1206 variants are primarily expressed in WAT, BAT,
skeletal muscle, and to a much lesser extent in cardiac muscle.
FIG 6 shows the modulation of expression of the IFI206's expression
during the development of NIH3T3LI cells in culture. Expression of IF1206
family members is variable during maturation of mouse NIH3T3L1 pre-
ad ipocytes.
1 O DETAILED DESCRIPTION
The inventors have identified a gene and polypeptide that is expressed
in response to interferon stimulation, IF1206.
Definitions
Unless defined otherwise, all technical and scientific terms have the
same meaning as is commonly understood by one of skill in the art to which
this invention belongs. The definitions below are presented for clarity.
The recommendations of (Demerec et al., 1966) where these are
relevant to genetics are adapted herein. To distinguish between genes (and
related nucleic acids) and the proteins that they encode, the abbreviations
for
genes are indicated by italicized (or underlined) text while abbreviations for
the proteins start with a capital letter and are not italicized. Thus, IFI206
or
IF1206 refers to the nucleotide sequence that encodes IF1206.
"Isolated," when referred to a molecule, refers to a molecule that has
been identified and separated and/or recovered from a component of its
natural environment. Contaminant components of its natural environment are
materials that interfere with diagnostic or therapeutic use.
"Container" is used broadly to mean any receptacle for holding material
or reagent. Containers may be fabricated of glass, plastic, ceramic, metal, or
any other material that can hold reagents. Acceptable materials will not react
adversely with the contents.
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-19-
1. Nucleic acid-related definitions
(a) control sequences
Control sequence are DNA sequences that enable the expression of an
operably-linked coding sequence in a particular host organism. Prokaryotic
control sequences include promoters, operator sequences, and ribosome ,
binding sites. Eukaryotic cells utilize promoters, polyadenylation signals,
and
enhancers.
(b) operably-linked
Nucleic acid is operably-linked when it is placed into a functional
relationship with another nucleic acid sequence. For example, a promoter or
enhancer is operably-linked to a coding sequence if it affects the
transcription
of the sequence, or a ribosome-binding site is operably-linked to a coding
sequence if positioned to facilitate translation. Generally, "operably-linked"
means that the DNA sequences being linked are contiguous, and, in the case
of a secretory leader, contiguous and in reading phase. However, enhancers
do not have to be contiguous. Linking is accomplished by conventional
recombinant DNA methods.
(c) isolated nucleic acids
An isolated nucleic acid molecule is purified from the setting in which it.
is found in nature and is separated from at least one contaminant nucleic acid
molecule. Isolated IFI206 molecules are distinguished from the specific
IF1206 molecule, as it exists in cells. However, an isolated IFI206 molecule
includes IFI206 molecules contained in cells that ordinarily express the
IF1206
where, for example, the nucleic acid molecule is in a chromosomal location
different from that of natural cells.
2. Protein-related definitions
(a) purified polypeptide
When the molecule is a purified polypeptide, the polypeptide will be
purified (1 ) to obtain at least 15 residues of N-terminal or internal amino
acid
sequence using a sequenator, or (2) to homogeneity by SDS-PAGE under
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-20-
non-reducing or reducing conditions using Coomassie blue or silver stain.
Isolated polypeptides include those expressed heterologously in genetically-
engineered cells or expressed in vitro, since at least one component of the
IF1206 natural environment will not be present. Ordinarily, isolated
polypeptides are prepared by at least one purification step.
(b) active polypeptide
An active IF1206 or IF1206 fragment retains a biological and/or an
immunological activity of native or naturally-occurring IF1206. Immunological
activity refers to the ability to induce the production of an antibody against
an
antigenic epitope possessed by a native IF1206; biological activity refers to
a
function, either inhibitory or stimulatory, caused by a native IF1206 that
excludes immunological activity. A biological activity of IF1206 includes, for
example, binding of nucleic acids, such as binding mRNA expressed in BAT.
(c) Abs
Antibody may be single anti-IF1206 monoclonal Abs (including agonist,
antagonist, and neutralizing Abs), anti-IF1206 antibody compositions with
polyepitopic specificity, single chain anti-IF1206 Abs, and fragments of anti-
IF1206 Abs. A "monoclonal antibody" refers to an antibody obtained from a
population of substantially homogeneous Abs, i.e., the individual Abs
comprising the population are identical except for naturally-occurring
mutations that may be present in minor amounts
(d) epitope tags
An epitope tagged polypeptide refers to a chimeric polypeptide fused to
a "tag polypeptide". Such tags provide epitopes against which Abs can be
made or are available, but do not interfere with polypeptide activity. To
reduce anti-tag antibody reactivity with endogenous epitopes, the tag
polypeptide is preferably unique. Suitable tag polypeptides generally have at
least six amino acid residues and usually between about 8 and 50 amino acid
residues, preferably between 8 and 20.amino acid residues). Examples of
epitope tag sequences include HA from Influenza A virus and FLAG.
1F1206
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-21-
The invention is based, in part, upon the discovery of novel nucleic acid
sequences that encode novel polypeptides, particularly interferon-inducible
proteins. The nucleic acids, and their encoded polypeptides, are collectively
designated herein as "1F1206".
The novel IFI206 of the invention include the nucleic acids whose
sequences are provided in Tables 1 and 3, or a fragment thereof. The
invention also includes a mutant or variant IFI206, any of whose bases may
be changed from the corresponding base shown in Tables 1 and 3 while still
encoding a protein that maintains the activities and physiological functions
of
the IF1206 fragment, or a fragment of such a nucleic acid. The invention
further includes nucleic acids whose sequences are complementary to those
just described, including complementary nucleic acid fragments. The
invention additionally includes nucleic acids or nucleic acid fragments, or .
complements thereto, whose structures include chemical modifications. Such
modifications include, by way of nonlimiting example, modified bases, and
nucleic acids whose sugar phosphate backbones are modified or derivatized.
These modifications are carried out at least in part to enhance the chemical
stability of the modified nucleic acid, such that they may be used, for
example,
as anti-sense binding nucleic acids in therapeutic applications in a subject.
In
the mutant or variant nucleic acids, and their complements, up to 20% or
more of the bases may be so changed.
The novel IF1206 of the invention include the protein fragments whose
sequences are provided in Tables 2, 4 and 5 inclusive. The invention also
includes an IF1206 mutant or variant protein, any of whose residues may be
changed from the corresponding residue shown in Tables 2, 4 and 5 while still
encoding a protein that maintains its native activities and physiological
functions, or a functional fragment thereof. In the mutant or variant IF1206,
up
to 20% or more of the residues may be so changed. The invention further
encompasses Abs and antibody fragments, such as Fab or (Fab)2, that bind
immunospecifically to any of the IF1206 of the invention.
The IF1206 nucleic acid (Table 1 ) comprises a start codon at
nucleotides 290-292 (bold, underline); a stop codon at nucleotides 1708-1710
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-22-
(bold, dash underline), and a putative polyadenylation site at nucleotides
1770-1777 (bold, double-underlined).
Table 1. 1F1206 nucleotide fragment (SEQ ID N0:1 ).
cgattcgaattcggccacactggccggatcctctagagatccctcgacctcgacccacgc~60
gtccgagcacagtgagagacacccagtgctgctcaagaagtgaaacaactctgagagtat120
cctaaccactggtgtcttcctttataccccatttttcactttctcagttactgaattatc180
tgcctacctactcaaaccaagcaggccacttctgttgttgaagatctcagcacctgtaca240
ttgctgccgaaattccagggagtataaccaacaacttgaaagatggagaa~aatataag 300
agacttgttctgctggaaggacttgaatgtatcaataagcatcaattcaatttatttaag360
tcattgatggtcaaagatttaaatctggaagaagacaaccaagagaaatataccacgttt420
cagattgctaacatgatggtaaagaaatttccagctgatgctggattggacaaactgatc480
aacttttgtgaacgtgtaccaactcttaaaaaacgtgctgaaattcttaaaaaagagaga540
tcagaagtaacaggagaaacatcactggaaataaataggcaagaagcaagtcctgcaaca600
cctacatcaactacaagccacatgttagcatctgaaagaggcaagacttccacaaccacc660
actgagacccaggaagagacttccacagcccagtcggggacttccacagctcacgcgggg720
acttctacagcaccggcggggactttcacaactcagaaaagaaaaagtaggagagaagaa780
gagactggagtgaaaaagagcaaggcgtctaaggaaccagatcagcctccctgttgtgaa840
gaacccacagccaggtgccagtcaccaatactccacagctcatcttcagcttcatctaac900
attccttcagctacgaaccaaaaaccacaaccccagaaccagaacattcccagaggtgct960
gttctccactcagagcccctgacagtgatggtgctcactgcaacagacccgtttgaatat1020
gaatcaccagaacatgaagtaaagaacatgtttcatgctacagtggctacagtgagccag1080
tatttccatgtgaaagttttcaacatcaacttgaaagagaagttcacaaaaaagaatttt1140
atcatcatatccaattactttgagagcaaaggcatcctggagatcaatgagacttcctct1200
gtgttaaaggctgatcctgaccaaatgattgaagtgcccaacaatattatcagaaatgca1260
aatgccagtcctaagatctgtgatattcaaaagggtacttctggagcagtgttctatgga1320
gtgtttacattacacaagaaaaaagtgaaaacacagaacacaagctatgaaataaaagat1380
ggttcaggaagtatagaagtggaggggagtggacaatggcacaacatcaactgtaaggaa1440
ggagataagctccacctcttctgctttcacctgaaaagagaaagaggacaaccaaagtta1500
gtgtgtggagaccacagtttcgtcaagatcaaggtcaccaaggctgggaaaaaaaaggaa1560
gcatcaactgtcctgtcaagcacaaaaaatgaagaagaaaataattacccaaaagatgga1620
attaaggtagagatgccagactattcacgtctaaatgacagctttagtagtatatccaag1680
catttaataaccttcatacctgatttc,~g~ttttgtattttcatttgaaaaaatttctta1740
ttgttctgtttttctatgaass~aaaatttgatttaatttctctactgtaaaaataataa1800
acatgtctttttaaagggacatcaaaaaaaaagaaggagggaggggagggggttggtata1860
agaaaaaccggggcggccg 1879
A polypeptide encoded by SEQ ID N0:1 is presented in Table 2. The
polypeptide described in SEQ ID N0:1 is likely nuclear, PSORT predicts
nuclear localization to nucleus with certainty = 0.8800, to the microbody
(peroxisome) with certainty=0.3000, to the mitochondrial matrix space with
certainty=0.1000 and to the lysosome (lumen) with certainty=0.1000 (Nakai and
Fiorton, 1999) . ProDom (Protein Domain Database) analysis demonstrates
that SEQ ID N0:1 is an IFI protein of the class described by prdm: 3409 p36
(8) if16(2) ifi4(2) ifi2(2) // protein interferon induction interferon-
activatable
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-23-
myeloid differentiation repeat y-interferon=inducible IFI-16 interferon-
inducible
p=1.2e-82 (Altschul et al., 1990).
Table 2. 1F1206 polypeptide sequence (SEQ ID N0:2).
Met Glu Asn Glu Tyr Lys Arg Leu Val Leu Leu Glu Gly Leu Glu Cys
1 5 10 15
Ile Asn Lys His Gln Phe Asn Leu Phe Lys Ser Leu Met Val Lys Asp
20 25 30
Leu Asn Leu Glu Glu Asp Asn Gln Glu Lys Tyr Thr Thr Phe Gln Ile
35 40 45
Ala Asn Met Met Val Lys Lys Phe Pro Ala Asp Ala Gly Leu Asp Lys
50 55 60
Leu Ile Asn Phe Cys Glu Arg Val Pro Thr Leu Lys Lys Arg Ala Glu
65 70 75 80
Ile Leu Lys Lys Glu Arg Ser Glu Val Thr Gly Glu Thr Ser Leu Glu
85 90 95
Ile Asn Arg Gln Glu Ala 5er Pro Ala Thr Pro Thr Ser Thr Thr Ser
100 105 110
His Met Leu Ala Ser Glu Arg Gly Lys Thr Ser Thr Thr Thr Thr Glu
115 120 125
Thr Gln Glu Glu Thr Ser Thr Ala Gln Ser Gly Thr Ser Thr Ala His
130 135 140
Ala Gly Thr Ser Thr Ala Pro Ala Gly Thr Phe Thr Thr Gln Lys Arg
145 150 155 160
Lys Ser Arg Arg Glu Glu Glu Thr Gly Val Lys Lys Ser Lys Ala Ser
165 170 175
Lys Glu Pro Asp Gln Pro Pro Cys Cys Glu Glu Pro Thr Ala Arg Cys
180 185 190
Gln Ser Pro Ile Leu His Ser Ser Ser Ser Ala Ser Ser Asn Ile Pro
195 200 205
Ser Ala Thr Asn Gln Lys Pro Gln Pro Gln Asn Gln Asn Ile Pro Arg
210 215 220
Gly Ala Val Leu His Ser Glu Pro Leu Thr Val Met Val Leu Thr Ala
225 230 235 240
Thr Asp Pro Phe Glu Tyr Glu Ser Pro Glu His Glu Val Lys Asn Met
245 250 255
Phe His Ala Thr Val Ala Thr Val Ser Gln Tyr Phe His Val Lys Val
260 265 270
Phe Asn Ile Asn Leu Lys Glu Lys Phe Thr Lys Lys Asn Phe Ile Ile
275 280 285
Ile Ser Asn Tyr Phe Glu Ser Lys Gly Ile Leu Glu Ile Asn Glu Thr
290 295 300
Ser Ser Val Leu Lys Ala Asp Pro Asp Gln Met Ile Glu Val Pro Asn
305 310 315 320
Asn Ile Ile Arg Asn Ala Asn Ala Ser Pro Lys Ile Cys Asp Ile Gln
325 330 335
Lys Gly Thr Ser Gly Ala Val Phe Tyr Gly Val Phe Thr Leu His Lys
340 345 350
Lys Lys Val Lys Thr Gln Asn Thr Ser Tyr Glu Ile Lys Asp Gly Ser
355 360 365
Gly Ser Ile Glu Val Glu Gly Ser Gly Gln Trp His Asn Ile Asn Cys
370 375 380
Lys Glu Gly Asp Lys Leu His Leu Phe Cys Phe His Leu Lys Arg Glu
385 390 395 400
Arg Gly Gln Pro Lys Leu Val Cys Gly Asp His Ser Phe Val Lys Ile
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-24-
405 910 415
Lys Val Thr Lys Ala Gly Lys Lys Lys Glu Ala Ser Thr Val Leu Ser
420 425 430
.. Ser Thr Lys.Asn Glu Glu Glu Asn Asn T~yr Pro Lys~Asp Gly ~Ile-Lys
435 440 445
Val Glu Met Pro Asp Tyr Ser Arg Leu Asn Asp Ser Phe Ser Ser Ile
450 955 460
Ser Lys His Leu Ile Thr Phe Ile Pro Asp Phe
465 970 975
Table 3 presents an analysis of the physical.characteristics of SEQ ID
N0:2 (Pace et al., 1995). The SEQ ID N0:2 polypeptide consists of 475
amino acids with a calculated molecular weight of 53095.5 Daltons and a
predicted isoelectric point of 8.18 ((GCG), 1999). The conditions at which
this analysis is valid are: pH 6.5, 6.0 M guanidium hydrochloride, 0.02 M
phosphate buffer.
Table 3 Amino acid composition, molecular weight, and structural
analysis of SEQIDN0:2
The naturally-occuring variant of interferon-inducible polypeptide 206
(1F1206) nucleic acid (SEQ ID N0:3, Table 4) comprises a. start codon at
nucleotides 290-292 (bold, underline); a stop codon at nucleotides 1708-1710
(bold, dash underline), and a putative polyadenylation site at nucleotides
1770-1777 (bold, double-underlined).
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-25-
Table 4 IF1206b nucleotide fragment, a naturally-occuring variant (SEQ
ID N0:3)
cgattcgaattcggccacactggccggatcctctagagatccctcgacctcgacccacgc60
gtccgagcacagtgagagacacccagtgctgctcaagaagtgaaacaactctgagagtat120
cctaaccactggtgtcttcctttataccccatttttcactttctcagttactgaattatc180
tgcctacctactcaaaccaagcaggccacttctgttgttgaagatctcagcacctgtaca240
ttgctgccgaaattccagggagtataaccaacaacttgaaagatggagaa 300
taaatataag
agacttgttctgctggaaggacttgaatgtatcaataagcatcaattcaatttatttaag360
tcattgatggtcaaagatttaaatctggaagaagacaaccaagagaaatataccacgttt420
cagattgctaacatgatggtaaagaaatttccagctgatgctggattggacaaactgatc480
aacttttgtgaacgtgtaccaactcttaaaaaacgtgctgaaattcttaaaaaagagaga540
tcagaagtaacaggagaaacatcactggaaataaataggcaagaagcaagtcctgcaaca600
cctacatcaactacaagccacatgttagcatctgaaagaggcgagacttccacaacccag660
gaagagacttccacagcccagtccgggccttcgacagctcctgcgcggactttaacagcc720
cagaaaagaaaaagtaggagagaagaagagactggagtgaaaaagagcaaggcgtctaag780
gaaccagatcagcctccctgttgtgaagaacccacagccaggtgccagtcaccaatactc840
cacagctcatcttcagcttcatctaacattccttcagctacgaaccaaaaaccacaaccc900
cagaaccagaacattcccagaggtgctgttctccactcagagcccctgacagtgatggtg960
ctcactgcaacagacccgtttgaatatgaatcaccagaacatgaagtaaagaacatgttt1020
catgctacagtggctacagtgagccagtatttccatgtgaaagttttcaacatcaacttg1080
aaagagaagttcacaaaaaagaattttatcatcatatccaattactttgagagcaaaggc1140
atcctggagatcaatgagacttcctctgtgttaaaggctgatcctgaccaaatgattgaa1200
gtgcccaacaatattatcagaaatgcaaatgccagtcctaagatctgtgatattcaaaag1260
ggtacttctggagcagtgttctatggagtgtttacattacacaagaaaaaagtgaaaaca1320
cagaacacaagctatgaaataaaagatggttcaggaagtatagaagtggaggggagtgga1380
caatggcacaacatcaactgtaaggaaggagataagctccacctcttctgctttcacctg1440
aaaagagaaagaggacaaccaaagttagtgtgtggagaccacagtttcgtcaagatcaag1500
gtcaccaaggctgggaaaaaaaaggaagcatcaactgtcctgtcaagcacaaaaaatgaa1560
gaagaaaataattacccaaaagatggaattaaggtagagatgccagactatcacgtctaa1620
a~gacagctttagtagtatatccaagcatttaataaccttcatacctgatttctgatttt1680
gtattttcatttgaaaaaatttcttattgttctgtttttctatgaaaataaaatttgatt1740
taatttctctactgtaaaaa.taataaaca~ agggacatcaaaaaaaaaga1800
gtctttttaa
aggagggaggggagggggttggtataagaaaaaccggggc 1840
A polypeptide encoded by SEQ ID N0:3 is presented in Table 5. The
polypeptide described in SEQ ID N0:3 is likely nuclear, PSORT predicts
nuclear localization to nucleus with certainty = 0.8800, to the microbody
(peroxisome) with certainty=0.3000, to the mitochondrial matrix space with
certainty=0.1000 and to the lysosome (lumen) with certainty=0.1000, (Nakai
and Horton, 1999) . ProDom (Protein Domain Database) analysis
demonstrates that SEQ ID N0:3 is an IFI protein of the class described by
~rdm: 3409 p36 (8~ if16(2) ifi4(2) ifi2(2) // protein interferon induction
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-26-
interferon-activatable myeloid differentiation repeat ~r-interferon-inducible
IFI-
16 interferon-inducible p=2.7e-83 LAltschul et al., 1990).
Table 5 IF1206b, a naturally-occuring variant polypeptide sequence (SEQ ID
N0:4)
Met Glu Asn Glu Tyr Lys Arg Leu Val Leu Leu Glu Gly Leu Glu Cars
1 5 10 15
Ile Asn Lys His Gln Phe Asn Leu Phe Lys Ser Leu Met Val Lys Asp
20 25 30
Leu Asn Leu Glu Glu Asp Asn Gln Glu Lys Tyr Thr Thr Phe Gln Ile
35 40 45
Ala Asn Met Met Val Lys Lys Phe Pro Ala Asp Ala Gly Leu Asp Lys
50 55 60
Leu Ile Asn Phe Cps Glu Arg Val Pro T'hr Leu Lys Lys Arg Ala Glu
65 70 75 80
Ile Leu Lys Lys Glu Arg Ser Glu Val Thr Gly Glu Thr Ser Leu Glu
85 90 95
Ile Asn Arg Gln Glu Ala Ser Pro Ala Thr Pro Thr Ser Thr Thr Ser
100 105 110
His Met Leu Ala Ser Glu Arg Gly Glu Thr Ser Thr Thr Gln Glu Glu
115 120 , 125
Thr Ser Thr Ala Gln Ser Gly Pro Ser Thr Ala Pro Ala Arg Thr Leu
130 135 140
Thr Ala Gln Lys Arg Lys Ser Arg Arg Glu Glu Glu Thr Gly Val Lys
145 150 155 ' 160
Lys Ser Lys Ala Ser Lys Glu Pro Asp Gln Pro Pro Cars Cps Glu Glu
165 170 175
Pro Thr Ala Arg Cars Gln Ser Pro Ile Leu His Ser Ser Ser Ser Ala
180 185 190
Ser Ser Asn Ile Pro Ser Ala Thr Asn Gln Lys Pro Gln Pro Gln Asn
195 200 205
Gln Asn Ile Pro Arg Gly Ala Val Leu His Ser Glu Pro Leu Thr Val
210 215 220
Met Val Leu Thr Ala Thr Asp Pro Phe Glu Tyr Glu Ser Pro Glu His
225 230 235 240
Glu Val Lys Asn Met Phe His Ala Thr Val Ala Thr Val Ser Gln Tyr
245 250 255
Phe His Val Lys Val Phe Asn Ile Asn Leu Lys Glu Lys Phe Thr Lys
260 265 270
Lys Asn Phe Ile Ile Ile Ser Asn Tyr Phe Glu Ser Lys Gly Ile Leu
275 280 285
Glu Ile Asn Glu Thr Ser Ser Val Leu Lys Ala Asp Pro Asp Gln Met
290 295 300
Ile Glu Val Pro Asn Asn Ile Ile Arg Asn Ala Asn Ala Ser Pro Lys
305 310 315 320
Ile Cps Asp Ile Gln Lys Gly Thr Ser Gly Ala Val Phe Tyr Gly Val
325 330 335
Phe Thr Leu His Lys Lys Lys Val Lys Thr Gln Asn Thr Ser Tyr Glu
340 345 350
Ile Lys Asp Gly Ser Gly Ser Ile Glu Val Glu Gly Ser Gly Gln Trp
355 360 365
His Asn Ile Asn Cps Lys Glu Gly Asp Lys Leu His Leu Phe Cars Phe
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-27-
370 375 380
His Leu Lys Arg Glu Arg Gly Gln Pro Lys Leu Val Cps Gly Asp His
385 390 395 400 '
Ser Phe Val Lys Ile Lys Val Thr Lys Ala Gly Lys Lys Lys Glu Ala
405 410 415
Ser Thr Val Leu Ser Ser Thr Lys Asn Glu Glu Glu Asn Asn err Pro
420 425 430
Lys Asp Gly Ile Lys Val Glu Met Pro Asp 'I~rr His Val
435 440 445
Table 6 presents an analysis of the physical characteristics of SEQ ID
N0:4 (Pace et al., 1995). The SEQ ID N0:4 polypeptide consists of 445
amino acids with a calculated molecular weight of 49899.1 Daltons and a
predicted isoelectric point of 8.17 ((GCG), 1999). The conditions at which
this
analysis is valid are: pH 6.5, 6.0 M guanidium hydrochloride, 0.02 M
phosphate buffer.
Table 6 Amino acid composition, molecular weight, and structural
analysis of SEQIDN0:4
Values assuming all Cys
residues appear as half
cystines
,;:::::::::::::::::::::::::~:::::8::::::::::::::::;::::
................................................................~
~ 279 nm 2 ~ 282
................................................................:::::::::::::::
::::::::::~.::::::::::::::::::::::::0 nm : ;
276 nm '278 ;
nm ;'
. ................................................
'..Extinction Coefficient
::........................::................................................168
00
19030 18708 i 18245 . 17690
..
.. ~ ~ :: .
. :: '
............. .........................:
:~........................:........................:
.........................
.................................................;.........................
...............................................................................
............ .........................:.......................Ø337
Optical Densit ..........................Ø366 0..355 .
........................:
y ,.......................:~ .... .
0 .375
: 381 .. 0
Values assuming no Cys
residues appear as half
cystines:
::............. ..... .. .... ~ _ . ..
.. 76 nm 278 nm ~ 279 nm 280 282 nm
2 nm
.. ... .. . ._ ... .... . s ......... . ...
"............:.........~.......................~...~...........,:..............
..........i;........................... ...... ...
Extinction Coefficient ... .....
,:.........................
;: ;:18200 .,~........................,:........................
18450 f 17765 ..16400
17210 ,
: .
.. .
,.
.................................:::::::::::::::::::::::::::::::;;:::::::::::::
::::::::::::;::::::::::::::::::::::::: :::::::::::::::::::::::::
;::::::::::::::::::::::::;
.................................. .. :::::::::::::::::::::::,
Optical Density 0 , . ;:
................................................................:~...... 370
:: ;' 0.329
........ 365 U 0 _356........v:........................
'..................:0.345_......
~ 0~..................: ...... :......
The cDNA sequence encoding mouse IF1206c (SEQ ID N0:14) derived
from a mouse brown adipose tissue (BAT) cDNA library is shown in Table 7.
Start codon "ATG" (bold, underlined) and stop codon "TAG" (bold, dash
underlined), and the putative polyadenylation sites are (bold, double-
underlined) are indicated. The cDNA clone was obtained from the library
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-28-
upon PCR amplification cloning methods utilizing specific oligos, followed by
further identification of positive clones via common analysis employing a 32P-
labeled probe:
SEQ ID N0:16 (IF1206.snr1 PCR oligo):
CATCATGTTAGCAATCTGAAACGTGGTATATTTCT
SEQ ID N0:17 (IF1206.snf1 PCR oligo):
GTAAAGAAATTTCCAGCTGATGCTGGATTGG
SEQ ID N0:18 (IF1206.p1 probe):
CTTCCTGGGTTGCGGAAGTCTCGCCTCTTTCAGATG
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-29-
Table 7 IF1206c nucleotide fragment, a naturally-occuring variant (SEQ
ID N0:14)
agcacagtgagagacacccagtgctgctcaagaagtgaaacaactctgagagtatcctaa60
ccactggtgtcttcctttataccccatttttcactttctcagttactgaattatctgcct120
acctactcaaaccaagcaggccacttctgttgttgaagatctcagcacctgtacattgct180
gccgaaattccagggagtataaccaacaacttgaaaaatggagaatgaatataagagact240
tgttctgctggaaggacttgaatgtatcaataagcatcaattcaatttatttaagtcatt300
gatggtcaaagatttaaatctggaagaagacaaccaagagaaatataccacgtttcagat360
tgctaacatgatggtaaagaaatttccagctgatgctggattggacaaactgatcaactt420
ttgtgaacgtgtaccaactcttaaaaaacgtgcagaaattcttaaaaaagagagatcaga480
agtaacaggagaaacatcactggaaataaataggcaagaagcaggtcctgcaacacctac540
atcaactacaagccacatgttagcatctgaaagaggcgagacttccgcaacccaggaaga600
gacttccacaggccagaaaaggaagccaggtggagagattaggtctgtctcccagccaag660
gccagtcaggaaccagaggggagctgggctggcaaggaaaggttggggtgtgctggctga720
aggagagaaaggagagaaaggagagaaaggaaagaaggaaggagagaaagaaagaaagaa780
agaaaggaaggaaggaaggaaggaagaaagaaaaagaaagaaagaaagaaagaaagaaag890
aaagaaagaaagaaagaaagaaagaaagaaagaaagaaagacagaccacaggtttgtcat900
cttcagcctccaggtttgtcatcttcagcctccaggtttgtcatcttcagcctccaggtt960
tgtcatcttcagcctccaggtttgtcatcttcagcctccaggtttgtcatcttcagcctc1020
caggtttgtcatcttcagcctccaggtttgtcatcttcagcctccaggtttgtcatcttc1080
agcctccaggtttgtcatcttcagcctccacaggtttgtcatcttcagcctccaggtagg1140
tggggtaggctctggctctgtgtcctgcctttac~agactagcacaccagcaaaccaaatt1200
cccatctcgtcagagtagcagtaagggcaagcccaggggggtagtgtgccacccagtgac1260
ccattgatccttgggtaatggtcctctctgtccataaggctcaggagtcacagaaggtcc1320
agctatctcaaccccacactcttgggaacacctccccgcctttttagaacagtaagttct1380
ctgtggcctcatgctgttctgagagccccttggtgctgccacttctccctgtgctctctc1440
attcccttctgcttcctgcacatctgctgaacccacgtcatttccggtactgcctagtta1500
gtcctggaaaaaactctcttggccattggcaggaatcagtgtagaaaagtttgcaggaca1560
tccctggctttccagagcatgcagaatcagtgtagctcatgacactgtcagacactttag1620
acacgagagaaattcttaagagacctacgcctttgacctctcagatggcacggccgctgt1680
acacagggaagtgttcactttccttgagacgggaagctggcttcaggttcctatggaata1740
gagttttctttccttattcccttttcacctaacagttttgctcttcagacagctgcccat1800
tccctaagcctcgcctagaaaccataacacagatgtacctagatgaatgagccaagcaac1860
tgagaaacagcaaggaaactggaaggcttgaggtgggaatatgaaggtcaagacaagaat1920
tagggagctgaaaagatggctcatcagttgactgctcttccagaggtcctgagttcaatt1980
cccagcaaccacatgatggctcgcaaccatctataataggatccacacactcttctggtg2040
tgtctgaagacagctacagtgtactcataataaataaagtaaataaatttaaaaaaaaaa2100
aaaaaatggagaatgaat 2118
Table 8 shows the polypeptide sequence (SEQ ID N0:15) of the open
reading frame of the polynucleotide sequence shown in Table 7.
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-30-
Table 8 IF1206c, a naturally-occuring variant polypeptide sequence
(SEQ ID N0:15)
Met Glu Asn Glu Tyr Lys Arg Leu Val Leu Leu Glu Gly Leu Glu Cys
1 5 10 15
Ile Asn Lys His Gln Phe Asn Leu Phe Lys Ser Leu Met Val Lys Asp
20 25 30
Leu Asn Leu Glu Glu Asp Asn Gln Glu Lys Tyr Thr Thr Phe Gln Ile
35 40 45
Ala Asn Met Met Val Lys Lys Phe Pro Ala Asp Ala Gly Leu Asp Lys
50 55 60
Leu Ile Asn Phe Cys Glu Arg Val Pro Thr Leu Lys Lys Arg Ala Glu
65 70 75 80
Ile Leu Lys Lys Glu Arg Ser Glu Val Thr Gly Glu Thr Ser Leu Glu
85 90 95
Ile Asn Arg Gln Glu Ala Gly Pro Ala Thr Pro Thr Ser Thr Thr Ser
100 105 110
His Met Leu Ala Ser Glu Arg Gly Glu Thr Ser Ala Thr Gln Glu Glu
115 120 125
Thr Ser Thr Gly Gln Lys Arg Lys Pro Gly Gly Glu Ile Arg Ser Val
130 135 140
Ser Gln Pro Arg Pro Val Arg Asn Gln Arg Gly Ala Gly Leu Ala Arg
145 150 155 160
Lys Gly Trp Gly Val Leu Ala Glu Gly Glu Lys Gly Glu Lys Gly Glu
165 170 175
Lys Gly Lys Lys Glu Gly Glu Lys Glu Arg Lys Lys Glu Arg Lys Glu
180 185 190
Gly Arg Lys Glu Glu Arg Lys Arg Lys Lys Glu Arg Lys Lys Glu Arg
195 200 205
Lys Lys Glu Arg Lys Lys Glu Arg Lys Lys Glu Arg Lys Thr Asp His
210 215 220
Arg Phe Val Ile Phe Ser Leu Gln Val Cars His Leu Gln Pro Pro Gly
225 230 235 240
Leu Ser Ser Ser Ala Ser Arg Phe Val Ile Phe Ser Leu Gln Val Cps
245 250 255
His Leu Gln Pro Pro Gly Leu Ser Ser Ser Ala Ser Arg Phe Val Ile
260 265 270
Phe Ser Leu Gln Val Cars His Leu Gln Pro Pro Gly Leu Ser Ser Ser
275 280 285
Ala Ser Arg Phe Val Ile Phe Ser Leu His Arg Phe Val Ile Phe Ser
290 295 300
Leu Gln Val Gly Gly Val'Gly Ser Gly Ser Val Ser Cars Leu
305 310 315
Table 9 presents an analysis of the physical characteristics of SEQ ID
N0:15 (Pace et al., 1995). The SEQ ID N0:15 polypeptide consists of 318
amino acids with a calculated molecular weight of 35984.1 Daltons and a
predicted isoelectric point of 10.67 ((GCG), 1999). The conditions at which
this analysis is valid are: pH 6.5, 6.0 M guanidium hydrochloride, 0.02 M
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-31-
phosphate buffer. 1F1206 function may be assigned by analyzing protein
similarity.
Table 9 Amino acid composition, molecular weight, and structural
analysis of SEQIDN0:15
.......................
..........:.....:..::::::................:............:::.:.......:.:...:....:.
::::. ..............::...:...::.:
::::.................::.........:::::.::...:................._._._....:........
.:.. .....:.....:.::.
""Values'assuming aIL.Cys.residues appear .as'half.cystines ...... ....... ..
:...........................................................................s.~
...........................................................;...................
....."........................:
.. .. . . ,
. . .. .
'27 m " 278 nm ; 279 nm...280.nm....282.nm..'
:::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
;:::::::::::::::::::::::: ,::::::::::::::::::::::::,
.........................:.:8 :..::............."...:::.............::....
. 8781 . 610 .. 8300
Extinction Coefficient 8735 ~ 8710.......
~:..............................................'
Optical Densit .....................~w0.243~......~, 0.244.. .... .Ø242 ~' 0
' 0w
..........................................y...................
~........................~~.........................:~.~....~.~...._~239
::.....:231
Values assuming no Cys residues appear as half cystines
... ..:. ......:.. .. 276 nm.. 278..nm ~ 279 nm 280 nm . 282 nm
..................................................................,...:........
............,:......................::..............:.........::.:............:
...........".:.::....................:
Extinction Coefficient 8300 ' 8350 ' 8250 8000
................................................................:.'............
............: '_.8400.......... ~........................: .........
..............:,.......................
............~........................~........................"................
........;,........................,,........................,..................
.....;;........................,
.~ Optical Density 0.231 0.233 0.232 0.229 .222
' ;. . . .. ~~ 0
The invention also includes polypeptides having 80-100%, including
81, 82, 83, 84, 85, 86, 87, 88, 89, 89.2, 90, 91, 92, 93, 94, 95, 96, 97, 98
and
99%, sequence identity to SEQ ID NOS: 2, 4, and 15, excluding those
polypeptides that are identical to SEQ ID NOS:22 and 24, preferably
excluding those polypeptides having 80-100%, including 81, 82, 83, 84, 85,
86, 87, 88, 89, 89.2, 90, 91, 92, 93, 94, 95, 96, 97, 98 and 99%, sequence
identity to SEQ ID NOS:22 and 24. The invention also includes nucleotides
encoding these polypeptides. SEQ ID N0:22 corresponds to IF1204, and
SEQ ID N0:24 corresponds to IF1205D3. SEQ ID N0:21 and SEQ ID N0:23
are the corresponding nucleotide sequences.
One method, using the EMOTIF database (Huang and Brutlag, 2001;
Nevill-Manning et al., 1998), assesses IF1206 polypeptide sequence against a
database of protein motifs (consensus sequences, consensi) that correspond
to evolutionarily and/or functionally conserved regions of proteins. Such an
approach mines databases of known protein motifs, generates new protein
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-32-
motifs, or tests new motifs against databases of known proteins such as
SwissProt.
One such motif tested against SwissProt using EMOTIF-Scan identifies
a number of interferon-induced genes, matches IF1206, and a number of
proteins that have in common the ability to bind RNA or DNA. Of particular
note, is the identification of the fly SUS gene, a mRNA binding protein
(Voelker et al., 1991 ), the yeast mRNA binding protien RNA15 (Minvielle-
Sebastia et al., 1994), among other nucleotide binding proteins such as the
mouse ribosomal binding protein L6 also known as HTLV-I tax responsive
element binding protein 107 (TAXREB107) which binds to DNA (Morita et al.,
1993).
Table 10 shows the consensus sequence for IFI-induced genes from
human and mouse that were generated using the software EMOTIF (Huang
and Brutlag, 2001; Nevill-Manning et al., 1998) and represented in the single
letter abbreviation for amino acids. Residues in []'s indicate that any of
those
amino acids may be used at that position; a "." Indicates that any amino
acid-or no amino acid-may occupy this position in the motif.
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-33-
Table 10 Consensus motifs
SEQ ID Consensus sequence Probability'ide t fying2~3
NO
M[FYWLI]HATVA[TAS].(STKR][QE][FYW]1 in 102' IFI proteins
[F [HRKFYW]V KRMLI]V[FYLI]
7 [F HATVA ST] ND IFI proteins
M..[EKQ]YK.[ILV][ILV]LL.G[FLY][DE].[ILM
8 ..[FLY]..[FILMV]K.[FLY][ILMV]..[DE][FL1 in 10Z' IFI proteins
.[ILV]
IFI proteins,
poly-
nucleotide-
[FLY]..[FILMV]K.[FLY][ILMV]..[DE][FLY].(IND binding
LV] protiens,
nucleotide
binding
proteins
[KQR]E.Y..[FILMY][KQR][ILV)[AST][DN].
M..KF...[AS].L.KLI.[FILMY].[EKQ].[ILMV]..1 in 1022 IFI proteins
L[EKQR]......L[KR .E[KR
IFI proteins,
11 [KQR]E.Y..[FILMV](KQR][ILV][AST][DN]ND mYloido--
genic
glycoproteins
IFI proteins,
Poly-
nucleotide-
12 T.[TGVS][TASE][QKAER][KR][RK][KRVN]ND binding
..[EQKRIL]....K proteins,
nucleotide-
binding
proteins
13 C[KREQ].G[DESTNQ][KRTS][LIV].LND IFI proteins
'Probability
of matching
a random
sequence,
using
emotif
maker
calculation
of
requency
of hits
to SwissProt.
ND,
not
done.
ZUtility
determined
by identification
of proteins
in SwissProt
using
search
engine
and allowing
a single
mis-match.
3Mis-matches
allowable
and
still
capable
of identifying
IFI
proteins
in SwissProt
using
emotif
scan.
The nucleic acids and proteins of the invention are potentially useful in
the treatment of Type II diabetes mellitus (NIDDM), hypertension, coronary
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-34-
heart disease, hypercholesterolemia, osteoarthritis, gallstones, reproductive
organ cancers, fatty liver, viral infections, inflammation, allergies,
steatosis,
hepatoxicity, inflammary bowel disease, septic shock, and related conditions
and sleep apnea, as well as those directly related to interferons, such as
metabolic disorders.
The IFI206 and proteins of the invention are useful in potential
therapeutic applications implicated in Type II diabetes mellitus (NIDDM),
hypertension, coronary heart disease, hypercholesterolemia, osteoarthritis,
gallstones, cancers of the reproductive organs, and sleep apnea, as well as
those directly related to interferons, such as metabolic disorders. For
example, a cDNA encoding IF1206 may be useful in gene therapy, and IF1206
protein may be useful when administered to a subject in need thereof. The
novel nucleic acid encoding IF1206, and the IFI206 protein of the invention,
or
fragments thereof, may further be useful in diagnostic applications, wherein
the presence or amount of the nucleic acid or the protein are to be assessed.
These materials are further useful in the generation of Abs that bind
immunospecifically to the novel substances of the invention for use in
therapeutic or diagnostic methods.
IF1206 polynucleotides
One aspect of the invention pertains to isolated nucleic acid molecules.
that encode IF1206 or biologically-active portions thereof. Also included in
the
invention are nucleic acid fragments sufficient for use as hybridization
probes
to identify IF1206-encoding nucleic acids (e.g., IFI206 mRNAs) and fragments
for use as polymerase chain reaction (PCR) primers for the amplification
and/or mutation of IF1206 molecules. A "nucleic acid molecule" includes DNA
molecules (e.g., cDNA or genomic DNA), RNA molecules (e.g., mRNA),
analogs of the DNA or RNA generated using nucleotide analogs, and
derivatives, fragments and homologs. The nucleic acid molecule may be
single-stranded or double-stranded, but preferably comprises double-stranded
DNA.
probes
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-35-
Probes are nucleic acid sequences of variable length, preferably
between at least about 10 nucleotides (nt), 100 nt, or many (e.g., 6,000 nt)
depending on the specific use. Probes are used to detect identical, similar,
or
complementary nucleic acid sequences. Longer length probes can be
obtained from a natural or recombinant source, are highly specific, and much
slower to hybridize than shorter-length oligomer probes. Probes may be
single- or double-stranded and designed to have specificity in PCR,
membrane-based hybridization technologies, or ELISA-like technologies.
Probes are substantially purified oligonucleotides that will hybridize under
stringent conditions to at least optimally12, 25, 50, 100, 150, 200, 250, 300,
350 or 400 consecutive sense strand nucleotide sequence of SEQ ID NOS:1 '
or 3; or an anti-sense strand nucleotide sequence of SEQ ID NOS:1 or 3; or of
a naturally occurring mutant of SEQ ID NOS:1 or 3.
The full- or partial length native sequence IFI206 may be used to "pull
out" similar (homologous) sequences (Ausubel et al., 1987; Sambrook, 1989),
such as: (1 ) full-length or fragments of IF1206 cDNA from a cDNA library from
any species (e.g. human, murine, feline, canine, bacterial, viral, retroviral,
yeast), (2) from cells or tissues, (3) variants within a species, and (4)
homologues and variants from other species. To find related sequences that
may encode related genes, the probe may be designed to encode unique
sequences or degenerate sequences. Sequences may also be genomic
sequences including promoters, enhancer elements and introns of native
sequence IFI206.
For example, IFI206 coding region in another species may be isolated
using such probes. A probe of about 40 bases is designed, based on IFI206,
and made. To detect hybridizations, probes are labeled using, for example,
radionuclides such as 32P or 35S, or enzymatic labels such as alkaline
phosphatase coupled to the probe via avidin-biotin systems. Labeled probes
are used to detect nucleic acids having a complementary sequence to that of
IFI206 in libraries of cDNA, genomic DNA or mRNA of a desired species.
Such probes can be used as a part of a diagnostic test kit for
identifying cells or tissues which mis-express an IF1206, such as by
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-36-
measuring a level of an IFI206 in a sample of cells from a subject e.g.,
detecting IF1206 mRNA levels or determining whether a genomic IFI206 has
been mutated or deleted.
2. isolated nucleic acid
An isolated nucleic acid molecule is separated from other nucleic acid
molecules which are present in the natural source of the nucleic acid.
Preferably, an isolated nucleic acid is free of sequences that naturally flank
the nucleic acid (i.e., sequences located at the 5'- and 3'-termini of the
nucleic
acid) in the genomic DNA of the organism from which the nucleic acid is
derived. For example, in various embodiments, isolated IFI206 molecules can
contain less than about 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb or 0.1 kb of
nucleotide sequences which naturally flank the nucleic acid molecule in
genomic DNA of the cell/tissue from which the nucleic acid is derived (e.g.,
brain, heart, liver, spleen, etc.). Moreover, an isolated nucleic acid
molecule,
such as a cDNA molecule, can be substantially free of.other cellular material
or culture medium when produced by recombinant techniques, or of chemical
precursors or other chemicals when chemically synthesized.
A nucleic acid molecule of the invention, e.g., a nucleic acid molecule
having the nucleotide sequence of SEQ ID NOS: 2, 4 or 15, or a complement
of this aforementioned nucleotide sequence, can be isolated using standard
molecular biology techniques and the provided sequence information. Using
all or a portion of the nucleic acid sequence of SEQ ID NOS: 2, 4 or 15 as a
hybridization probe, IFI206 molecules can be isolated using standard
hybridization and cloning techniques (Ausubel et al., 1987; Sambrook, 1989).
PCR amplification techniques can be used to amplify IFI206 using
cDNA, mRNA or alternatively, genomic DNA, as a template and appropriate
oligonucleotide primers. Such nucleic acids can be cloned into an appropriate
vector and characterized by DNA sequence analysis. Furthermore,
oligonucleotides corresponding to IFI206 sequences can be prepared by
standard synthetic techniques, e.g., an automated DNA synthesizer.
3. oligonucleotide
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-37-
An oligonucleotide comprises a series of linked nucleotide residues,
which oligonucleotide has a sufficient number of nucleotide bases to be used
in a PCR reaction or other application. A short oligonucleotide sequence may
be based on, or designed from, a genomic or cDNA sequence and is used to
amplify, confirm, or reveal the presence of an identical, similar or
complementary DNA or RNA in a particular cell or tissue. Oligonucleotides
comprise portions of a nucleic acid sequence having about 10 nt, 50 nt, or
100 nt in length, preferably about 15 nt to 30 nt in length. In one embodiment
of the invention, an oligonucleotide comprising a nucleic acid molecule less
than 100 nt in length would further comprise at least 6 contiguous nucleotides
of SEQ ID NOS:1 or 3, or a complement thereof. Oligonucleotides may be
chemically synthesized and may also be used as probes.
4. complementary nucleic acid sequences; binding
In another embodiment, an isolated nucleic acid molecule of the
invention comprises a nucleic acid molecule that is a complement of the
nucleotide sequence shown in SEQ ID NOS: 2, 4 or 15, or a portion of this
nucleotide sequence (e.g., a fragment that can be used as a probe or primer
or a fragment encoding a biologically-active portion of an IF1206). A nucleic
acid molecule that is complementary to the nucleotide sequence shown in
SEQ ID NOS:1 or 3, is one that is sufficiently complementary to the nucleotide
sequence shown in SEQ ID NOS:1 or 3, that it can hydrogen bond with little
or no mismatches to the nucleotide sequence shown in SEQ ID NOS:1 or 3,
thereby forming a stable duplex.
"Complementary" refers to Watson-Crick or Hoogsteen base pairing
between nucleotides units of a nucleic acid molecule, and the term "binding"
means the physical or chemical interaction between two polypeptides or
compounds or associated polypeptides or compounds or combinations
thereof. Binding includes ionic, non-ionic, van der Waals, hydrophobic
interactions, and the like. A physical interaction can be either direct or
indirect. Indirect interactions may be through or due to the effects of
another
polypeptide or compound. Direct binding refers to interactions that do not
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-38-
take place through, or due to, the effect of another polypeptide or compound,
but instead are without other substantial chemical intermediates.
Nucleic acid fragments are at least 6 (contiguous) nucleic acids or at
least 4 (contiguous) amino acids, a length sufficient to allow for specific
hybridization in the case of nucleic acids or for specific recognition of an
epitope in the case of amino acids, respectively, and are at most some portion
less than a full-length sequence. Fragments may be derived from any
contiguous portion of a nucleic acid or amino acid sequence of choice.
5. derivatives, and analogs
Derivatives are nucleic acid sequences or amino acid sequences
formed from the native compounds either directly or by modification or partial
substitution. Analogs are nucleic acid sequences or amino acid sequences
that have a structure similar to, but not identical to, the native compound
but
differ from it in respect to certain components or side chains. Analogs may be
synthetic or from a different evolutionary origin and may have a similar or
opposite metabolic activity compared to wild type. Homologs are nucleic acid
sequences or amino acid sequences of a particular gene that are derived from
different species.
Derivatives and analogs may be full length or other than full length, if
the derivative or analog contains a modified nucleic acid or amino acid, as
described below. Derivatives or analogs of the nucleic acids or proteins of
the
invention include, but are not limited to, molecules comprising regions that
are
substantially homologous to the nucleic acids or proteins of the invention, in
various embodiments, by at least about 70%, 80%, or 95% identity (with a
preferred identity of 80-95%) over a nucleic acid or amino acid sequence of
identical size or when compared to an aligned sequence in which the
alignment is done by a computer homology program known in the art, or
whose encoding nucleic acid is capable of hybridizing to the complement of a
sequence encoding the aforementioned proteins under stringent, moderately
stringent, or low stringent conditions (Ausubel et al., 1987).
6. homology
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-39-
A "homologous nucleic acid sequence" or "homologous amino acid
sequence," or variations thereof, refer to sequences characterized by a
homology at the nucleotide level or amino acid level as discussed above.
Homologous nucleotide sequences encode those sequences coding for
isoforms of IF1206. Isoforms can be expressed in different tissues of the
same organism as a result of, for example, alternative splicing of RNA.
Alternatively, different genes can encode isoforms. In the invention,
homologous nucleotide sequences include nucleotide sequences encoding for
an IF1206 of species other than humans, including, but not limited to:
vertebrates, and thus can include, e.g., frog, mouse, rat, rabbit, dog, cat
cow,
horse, and other organisms. Homologous nucleotide sequences also include,
but are not limited to, naturally occurring allelic variations and mutations
of the
nucleotide sequences set forth herein. A homologous nucleotide sequence
does not, however, include the exact nucleotide sequence encoding human
IF1206. Homologous nucleic acid sequences include those nucleic acid
sequences that encode conservative amino acid substitutions (see below) in
SEQ ID NOS:2, 4 or 15, as well as a polypeptide possessing IF1206 biologicaE
activity. Various biological activities of the IF1206 are described below.
7. open reading frames
The open reading frame (ORF) of an IFI206 gene encodes IF1206. An
ORF is a nucleotide sequence that has a start codon (ATG) and terminates
with one of the three "stop" codons (TAA, TAG, or TGA). In this invention,
however, an ORF may be any part of a coding sequence that may or may not
comprise a start codon and a stop codon. To achieve a unique sequence,
preferable IFI206 ORFs encode at least 50 amino acids.
1F1206 polypeptides
1. mature
An IF1206 can encode a mature IF1206. A "mature" form of a
polypeptide or protein disclosed in the present invention is the product of a
naturally occurring polypeptide or precursor form or proprotein. The
naturally'
occurring polypeptide, precursor or proprotein includes, by way of nonlimiting
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-40-
example, the full-length gene product, encoded by the corresponding gene.
Alternatively, it may be defined as the polypeptide, precursor or proprotein
encoded by an open reading frame described herein. The product "mature"
form arises, again by way of nonlimiting example, as a result of one or more
naturally occurring processing steps as they may take place within the cell,
or
host cell, in which the gene product arises. Examples of such processing
steps leading to a "mature" form of a polypeptide or protein include the
cleavage of the N-terminal methionine residue encoded by the initiation codon
of an open reading frame, or the proteolytic cleavage of a signal peptide or
leader sequence. Thus a mature form arising from a precursor polypeptide or
protein that has residues 1 to N, where residue 1 is the N-terminal
methionine,
would have residues 2 through N remaining after removal of the N-terminal
methionine. Alternatively, a mature form arising from a precursor polypeptide
or protein having residues 1 to N, in which an N-terminal signal sequence
from residue 1 to residue M is cleaved, would have the residues from residue
M+1 to residue N remaining. Further as used herein, a "mature" form of a
polypeptide or protein may arise from a step of post-translational
modification
other than a proteolytic cleavage event. Such additional processes include,
by way of non-limiting example, glycosylation, myristoylation or
phosphorylation. In general, a mature polypeptide or protein may result from
the operation of only one of these processes, or a combination of any of them.
2. active
An active IF1206 polypeptide or IF1206 polypeptide fragment retains a
biological and/or an immunological activity similar, but not necessarily
identical, to an activity of a naturally-occuring (wild-type) IF1206
polypeptide of
the invention, including mature forms. A particular biological assay, with or
without dose dependency, can be used to determine IF1206 activity. A nucleic
acid fragment encoding a biologically-active portion of IF1206 can be prepared
by isolating a portion of SEQ ID NOS: 2, 4 or 15 that encodes a polypeptide
having an IF1206 biological activity (the biological activities of the IF1206
are
described below), expressing the encoded portion of IF1206 (e.g., by
recombinant expression in vitro) and assessing the activity of the encoded
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-41-
portion of IF1206. Immunological activity refers to the ability to induce the
production of an antibody against an antigenic epitope possessed by a native
IF1206; biological activity refers to a function, either inhibitory or
stimulatory,
caused by a native IF1206 that excludes immunological activity.
IF1206 nucleic acid variants and hybridization
1. variant polynucleotides, genes and recombinant genes
The invention further encompasses nucleic acid molecules that differ
from the nucleotide sequences shown in SEQ ID NOS:1 or 3 due to
degeneracy of the genetic code and thus encode the same IF1206 as that
encoded by the nucleotide sequences shown in SEQ ID NO NOS: 1 or 3. An
isolated nucleic acid molecule of the invention has a nucleotide sequence
encoding a protein having an amino acid sequence shown in SEQ ID NOS:2,
4or15.
In addition to the IFI206 sequences shown in SEQ ID NOS:2, 4 or 15,
DNA sequence polymorphisms that change the amino acid sequences of the
IF1206 may exist within a population. For example, allelic variation among
individuals will exhibit genetic polymorphism in IFI206. The terms "gene" and
"recombinant gene" refer to nucleic acid molecules comprising an open
reading frame (ORF) encoding IF1206, preferably a vertebrate IF1206. Such
natural allelic variations can typically result in 1-5% variance in IFI206.
Any
and all such nucleotide variations and resulting amino acid polymorphisms in
the IF1206, which are the result of natural allelic variation and that do not
alter
the functional activity of the IF1206 are within the scope of the invention.
Moreover, IFI206 from other species that have a nucleotide sequence
that differs from the human sequence of SEQ ID NOS:1 or 3, are
contemplated. Nucleic acid molecules corresponding to natural allelic
variants and homologues of the IFI206 cDNAs of the invention can be isolated
based on their homology to the IFI206 of SEQ ID NOS:1 or 3 using cDNA-
derived probes to hybridize to homologous IFI206 sequences under stringent
conditions.
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-42-
"1F1206 variant polynucleotide" or "1F1206 variant nucleic acid
sequence" means a nucleic acid molecule which encodes an active IF1206
that (1) has at least about 80% nucleic acid sequence identity with a
nucleotide acid sequence encoding a full-length native IF1206, (2) a full-
length
native IF1206 lacking the signal peptide, (3) an extracellular domain of an
IF1206, with or without the signal peptide, or (4) any other fragment of a
full-
length IF1206. Ordinarily, an IF1206 variant polynucleotide will have at least
about 80% nucleic acid sequence identity, more preferably at least about
81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%,
94%, 95%, 96%, 97%, 98% nucleic acid sequence identity and yet more
preferably at least about 99% nucleic acid sequence identity with the nucleic
acid sequence encoding a full-length native IF1206. An IF1206 variant
polynucleotide may encode full-length native IF1206 lacking the signal
peptide,
an extracellular domain of an IF1206, with or without the signal sequence, or
any other fragment of a full-length IF1206. Variants do not encompass the
native nucleotide sequence.
Ordinarily, IF1206 variant polynucleotides are at least about 30
nucleotides in length, often at least about 60, 90, 120, 150, 180, 210, 240,
270, 300, 450, 600 nucleotides in length, more often at least about 900
nucleotides in length, or more.
"Percent (%) nucleic acid sequence identity" with respect to IF1206-
encoding nucleic acid sequences identified herein is defined as the
percentage of nucleotides in a candidate sequence that are identical with the
nucleotides in the IFI206 sequence of interest, after aligning the sequences
and introducing gaps, if necessary, to achieve the maximum percent
sequence identity. Alignment for purposes of determining % nucleic acid
sequence identity can be achieved in various ways that are within the skill in
the art, for instance, using publicly available computer software such as
BLAST, BLAST-2, ALIGN or Megalign (DNASTAR) software. Those skilled in
the art can determine appropriate parameters for measuring alignment,
including any algorithms needed to achieve maximal alignment over the full
length of the sequences being compared.
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-43-
When nucleotide sequences are aligned, the % nucleic acid sequence
identity of a given nucleic acid sequence C to, with, or against a given
nucleic
acid sequence D (which can alternatively be phrased as a given nucleic acid
sequence C that has or comprises a certain % nucleic acid sequence identity
to, with, or against a given nucleic acid sequence D) can be calculated as
follows:
%nucleic acid sequence identity - W~Z ~ 100
where
W is the number of nucleotides cored as identical matches by the
sequence alignment program's or algorithm's alignment of C and D
and
Z is the total number of nucleotides in D.
When the length of nucleic acid sequence C is not equal to the length
of nucleic acid sequence D, the % nucleic acid sequence identity of C to D
will
not equal the % nucleic acid sequence identity of D to C.
2. Stringency
Homologs (i.e., nucleic acids encoding IF1206 derived from species
other than human) or other related sequences (e.g., paralogs) can be
obtained by low, moderate or high stringency hybridization with all or a
portion
of the particular human sequence as a probe using methods well known in the
art for nucleic acid hybridization and cloning.
The specificity of single stranded DNA to hybridize complementary
fragments is determined by the "stringency" of the reaction conditions.
Hybridization stringency increases as the propensity to form DNA duplexes
decreases. In nucleic acid hybridization reactions, the stringency can be
chosen to either favor specific hybridizations (high stringency), which can be
used to identify, for example, full-length clones from a library. Less-
specific
hybridizations (low stringency) can be used to identify related, but not
exact,
DNA molecules (homologous, but not identical) or segments.
DNA duplexes are stabilized by: (1 ) the number of complementary
base pairs, (2) the type of base pairs, (3) salt concentration (ionic
strength) of
the reaction mixture, (4) the temperature of the reaction, and (5) the
presence
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-44-
of certain organic solvents, such as formamide which decreases DNA duplex
stability. In general, the longer the probe, the higher the temperature
required
for proper annealing. A common approach is to vary the temperature: higher
relative temperatures result in more stringent reaction conditions. (Ausubel
et
al., 1987) provide an excellent explanation of stringency of hybridization
reactions.
To hybridize under "stringent conditions" describes hybridization
protocols in which nucleotide sequences at least 60% homologous to each
other remain hybridized. Generally, stringent conditions are selected to be
about 5°C lower than the thermal melting point (Tm) for the specific
sequence
at a defined ionic strength and pH. The Tm is the temperature (under defined
ionic strength, pH and nucleic acid concentration) at which 50% of the probes
complementary to the target sequence hybridize to the target sequence at
equilibrium. Since the target sequences are generally present at excess, at
Tm, 50% of the probes are occupied at equilibrium.
(a) high stringency
"Stringent hybridization conditions" conditions enable a probe, primer
or oligonucleotide to hybridize only to its target sequence. Stringent
conditions are sequence-dependent and will differ. Stringent conditions
comprise: (1 ) low ionic strength and high temperature washes (e.g. 15 mM
sodium chloride, 1.5 mM sodium citrate, 0.1 % sodium dodecyl sulfate at
50°C); (2) a denaturing agent during hybridization (e.g. 50% (v/v)
formamide,
0.1 % bovine serum albumin, 0.1 % Ficoll, 0.1 % polyvinylpyrrolidone, 50mM
sodium phosphate buffer (pH 6.5; 750 mM sodium chloride, 75 mM sodium
citrate at 42°C); or (3) 50% formamide. Washes typically also comprise
5X
SSC (0.75 M NaCI, 75 mM sodium citrate), 50 mM sodium phosphate (pH
6.8), 0.1 % sodium pyrophosphate, 5 x Denhardt's solution, sonicated salmon
sperm DNA (50 Ng/ml), 0.1 % SDS, and 10% dextran sulfate at 42°C, with
washes at 42°C in 0.2 x SSC (sodium chloride/sodium citrate) and 50%
formamide at 55°C, followed by a high-stringency wash consisting of 0.1
x
SSC containing EDTA at 55°C. Preferably, the conditions are such
that
sequences at least about 65%, 70%, 75%, 85%, 90%, 95%, 98%, or 99%
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-45-
homologous to each other typically remain hybridized to each other. These
conditions are presented as examples and are not meant to be limiting.
(b) moderate stringency
"Moderately stringent conditions" use washing solutions and
hybridization conditions that are less stringent (Sambrook, 1989), such that a
polynucleotide will hybridize to the entire, fragments, derivatives or analogs
of
SEQ ID NOS:1 or 3. One example comprises hybridization in 6X SSC, 5X
Denhardt's solution, 0.5% SDS and 100 mg/ml denatured salmon sperm DNA
at 55°C, followed by one or more washes in 1X SSC, 0.1% SDS at
37°C.
The temperature, ionic strength, etc., can be adjusted to accommodate
experimental factors such as probe length. Other moderate stringency
conditions are described in (Ausubel et al., 1987; Kriegler, 1990).
(c) low stringency
"Low stringent conditions" use washing solutions and hybridization
conditions that are less stringent than those for moderate stringency
(Sambrook, 1989), such that a polynucleotide will hybridize to the entire,
fragments, derivatives or analogs of SEQ ID NOS:1 or 3. A non-limiting
example of low stringency hybridization conditions are hybridization in 35%
formamide, 5X SSC, 50 mM Tris-HCI (pH 7.5), 5 mM EDTA, 0.02% PVP,
0.02% Ficoll, 0.2% BSA, 100 mg/ml denatured salmon sperm DNA, 10%
(wt/vol) dextran sulfate at 40°C, followed by one or more washes in 2X
SSC,
mM Tris-HCI (pH 7.4), 5 mM EDTA, and 0.1 % SDS at 50°C. Other
conditions of low stringency, such as those for cross-species hybridizations
are described in (Ausubel et al., 1987; Kriegler, 1990; Shilo and Weinberg,
25 1981).
3. Conservative mutations
In addition to naturally-occurring allelic variants of IFI206, changes can
be introduced by mutation into SEQ ID NO NOS:1 or 3 sequences that incur
alterations in the amino acid sequences of the encoded IF1206 that do not
alter IF1206 function. For example, nucleotide substitutions leading to amino
acid substitutions at "non-essential" amino acid residues can be made in the
sequence of SEQ ID NOS:2, 4 or 15. A "non-essential" amino acid residue is
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-46-
a residue that can be altered from the wild-type sequences of the IF1206
without altering their biological activity, whereas an "essential" amino acid
residue is required for such biological activity. For example, amino acid
residues that are conserved among the IF1206 of the invention are predicted
to be particularly non-amenable to alteration. Amino acids for which
conservative substitutions can be made are well-known in the art.
Useful conservative substitutions are shown in Table 6, "Preferred
substitutions." Conservative substitutions whereby an amino acid of one class
is replaced with another amino acid of the same type fall within the scope of
the subject invention so long as the substitution does not materially alter
the
biological activity of the compound. If such substitutions result in a change
in
biological activity, then more substantial changes, indicated in Table 7 as
exemplary are introduced and the products screened for IF1206 polypeptide
biological activity.
Table A Preferred substitutions
Original residueExemplary substitutionsPreferred
substitutions
Ala A Val, Leu, Ile Val
Arg (R) Lys, Gln, Asn Lys
Asn N) Gln, His, Lys, Arg Gln
Asp (D) Glu Glu
Cys (C) Ser Ser
Gln Q Asn Asn
Glu (E) Asp Asp
GI G Pro, Ala Ala
His (H) Asn, Gln, Lys, Arg Arg
Ile (I) Leu, Val, Met, Ala, Leu
Phe,
Norleucine
Leu (L) Norleucine, Ile, Val,Ile
Met, Ala,
Phe
Lys (K) Arg, Gln, Asn Arg
Met M Leu, Phe, Ile Leu
Phe (F) Leu, Val, Ile, Ala, Leu
Tyr
Pro P Ala Ala
Ser(S) Thr Thr
Thr (T) Ser Ser
Tr W T r, Phe T r
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-47-
Tyr (Y) Trp, Phe, Thr, Ser Phe
Val (V) Ile, Leu, Met, Phe, Leu
Ala,
Norleucine
Non-conservative substitutions that effect (1 ) the structure of the
polypeptide backbone, such as a ~i-sheet or a-helical conformation, (2) the
charge or (3) hydrophobicity, or (4) the bulk of the side chain of the target
site
can modify IF1206 polypeptide function or immunological identity. Residues
are divided into groups based on common side-chain properties as denoted in
Table B. Non-conservative substitutions entail exchanging a member of one
of these classes for another class. Substitutions may be introduced into
conservative substitution sites or more preferably into non-conserved sites.
Table B Amino acid classes
Class Amino acids
hydro hobic Norleucine, Met, Ala,
Val, Leu, Ile
neutral h drophilic Cys, Ser, Thr
acidic As , Glu
basic Asn, Gln, His, Lys, Arg
disru t chain conformationGI , Pro
aromatic Tr , Tyr, Phe
The variant polypeptides can be made using methods known in the art
such as oligonucleotide-mediated (site-directed) mutagenesis, alanine
scanning, and PCR mutagenesis. Site-directed mutagenesis (Carter, 1986;
Zoller and Smith, 1987), cassette mutagenesis, restriction selection
mutagenesis (Wells et al., 1985) or other known techniques can be performed
on the cloned DNA to produce the IF1206 variant DNA (Ausubel et al., 1987;
Sambrook, 1989).
In one embodiment, the isolated nucleic acid molecule comprises a
nucleotide sequence encoding a protein, wherein the protein comprises an
amino acid sequence at least about 45%, preferably 60%, more preferably
70%, 80%, 90%, and most preferably about 95% homologous to SEQ ID
NOS:2, 4 or 15.
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-48-
A mutant IF1206 can be assayed for blocking adipocyte differentiation
in vitro.
4. Anti-sense nucleic acids
Using antisense and sense IF1206 oligonucleotides cari prevent IF1206
polypeptide expression. These oligonucleotides bind to target nucleic acid
sequences, forming duplexes that block transcription or translation of the
target sequence by enhancing degradation of the duplexes, terminating
prematurely transcription or translation, or by other means.
Antisense or sense oligonucleotides are singe-stranded nucleic acids,
either RNA or DNA, which can bind target IFI206 mRNA (sense) or IFI206
DNA (antisense) sequences. Anti-sense nucleic acids can be designed
according to Watson and Crick or Hoogsteen base pairing rules. The anti-
sense nucleic acid molecule can be complementary to the entire coding
region of IFI206 mRNA, but more preferably, to only a portion of the coding or
noncoding region of IFI206 mRNA. For example, the anti-sense
oligonucleotide can be complementary to the region surrounding the
translation start site of IFI206 mRNA. Antisense or sense oligonucleotides
may comprise a fragment of the IF1206 DNA coding region of at least about
14 nucleotides, preferably from about 14 to 30 nucleotides. In general,
antisense RNA or DNA molecules can comprise at least 5, 10, 15, 20, 25, 30,
35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 bases in length or
more.
Among others, (Stein and Cohen, 1988; van der Krol et al., 1988a) describe
methods to derive antisense or a sense oligonucleotides from a given cDNA
sequence.
Examples of modified nucleotides that can be used to generate the
anti-sense nucleic acid include: 5-fluorouracil, 5-bromouracil, 5-
chlorouracil, 5-
iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5-
(carboxyhydroxylmethyl) uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-
carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine,
inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-
dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-
methylcytosine, N6-adenine, 7-methylguanine, 5-methylaminomethyluracil, 5-
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-49-
methoxyaminomethyl-2-thiouracil, beta-D-mannosylqueosine, 5'-
methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N6-
isopentenyladenine, uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil,
queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-
methyluracil, uracil-5-oxyacetic acid methylester, uracil-5-oxyacetic acid
(v), 5-
methyl-2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl) uracil, (acp3)w, and 2,6-
diaminopurine. Alternatively, the anti-sense nucleic acid can be produced
biologically using an expression vector into which a nucleic acid has been
sub-cloned in an anti-sense orientation such that the transcribed RNA will be
complementary to a target nucleic acid of interest.
To introduce antisense or sense oligonucleotides into target cells (cells
containing the target nucleic acid sequence), any gene transfer method may
be used. Examples of gene transfer methods include (1 ) biological, such as
gene transfer vectors like Epstein-Ban- virus or conjugating the exogenous
DNA to a ligand-binding molecule, (2) physical, such as electroporation and
injection, and (3) chemical, such as CaPOa precipitation and oligonucleotide-
lipid complexes.
An antisense or sense oligonucleotide is inserted into a suitable gene
transfer retroviral vector. A cell containing the target nucleic acid sequence
is
'20 contacted with the recombinant retroviral vector, either in vivo or ex
vivo.
Examples of suitable retroviral vectors include those derived from the murine
retrovirus M-MuLV, N2 (a retrovirus derived from M-MuLV), or the double
copy vectors designated DCTSA, DCTSB and DCTSC (WO 90/13641, 1990).
To achieve sufficient nucleic acid molecule transcription, vector constructs
in
which the transcription of the anti-sense nucleic acid molecule is controlled
by
a strong pol II or pol III promoter are preferred.
To specify target cells in a mixed population of cells cell surface
receptors that are specific to the target cells can be exploited. Antisense
and
sense oligonucleotides are conjugated to a ligand-binding molecule, as
described in (WO 91 /04753, 1991 ). Ligands are chosen for receptors that are
specific to the target cells. Examples of suitable ligand-binding molecules
include cell surface receptors, growth factors, cytokines, or other ligands
that
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-50-
bind to cell surtace receptors or molecules. Preferably, conjugation of the
ligand-binding molecule does not substantially interfere with the ability of
the
receptors or molecule to bind the ligand-binding molecule conjugate, or block
entry of the sense or antisense oligonucleotide or its conjugated version into
the cell.
Liposomes efficiently transfer sense or an antisense oligonucleotide to
cells (WO 90/10448, 1990). The sense or antisense oligonucleotide-lipid
complex is preferably dissociated within the cell by an endogenous lipase.
The anti-sense nucleic acid molecule of the invention may be an x-
anomeric nucleic acid molecule. An a-anomeric nucleic acid molecule forms
specific double-stranded hybrids with complementary RNA in which, contrary
to the usual a-units, the strands run parallel to each other (Gautier et al.,
1987). The anti-sense nucleic acid molecule can also comprise a 2'-0-
methylribonucleotide (Inoue et al., 1987x) or a chimeric RNA-DNA analogue
(Inoue et al., 1987b).
In one embodiment, an anti-sense nucleic acid of the invention is a
ribozyme. Ribozymes are catalytic RNA molecules with ribonuclease activity
that are capable of cleaving a single-stranded nucleic acid, such as an mRNA,
to which they have a complementary region. Thus, ribozymes, such as
hammerhead ribozymes (Haseloff and Gerlach, 1988) can be used to
catalytically cleave IFI206 mRNA transcripts and thus inhibit translation. A '
ribozyme specific for an IF1206-encoding nucleic acid can be designed based
on the nucleotide sequence of an IFI206 cDNA (i.e., SEQ ID NOS:1 or 3). For
example, a derivative of a Tetrahymena L-19 IVS RNA can be constructed in
which the nucleotide sequence of the active site is complementary to the
nucleotide sequence to be cleaved in an IF1206-encoding mRNA (Cech et al.,
U.S. Patent No. 5,116,742, 1992; Cech et al., U.S. Patent No. 4,987,071,
1991 ). 1F1206 mRNA can also be used to select a catalytic RNA having a
specific ribonuclease activity from a pool of RNA molecules (Bartel and
Szostak, 1993).
Alternatively, IFI206 expression can be inhibited by targeting nucleotide
sequences complementary to the regulatory region of the IFI206 (e.g., the
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-51-
IF1206 promoter and/or enhancers) to form triple helical structures that
prevent transcription of the IFI206 in target cells (Helene, 1991; Helene et
al.,
1992; Maher, 1992).
Modifications of antisense and sense oligonucleotides can augment
their effectiveness. Modified sugar-phosphodiester bonds or other sugar
linkages (WO 91/06629, 1991), increase in vivo stability by conferring
resistance to endogenous nucleases without disrupting binding specificity to
target sequences. Other modifications can increase the affinities of the
oligonucleotides for their targets, such as covalently linked organic moieties
(WO 90/10448, 1990) or poly-(L)-lysine. Other attachments modify binding
specificities of the oligonucleotides for their targets, including metal
complexes 'or intercalating (e.g. ellipticine) and alkylating agents.
For example, the deoxyribose phosphate backbone of the nucleic acids
can be modified to generate peptide nucleic acids (Hyrup and Nielsen, 1996).
"Peptide nucleic acids" or "PNAs" refer to nucleic acid mimics (e.g., DNA
mimics) in that the deoxyribose phosphate backbone is replaced by a
pseudopeptide backbone and only the four natural nucleobases are retained.
The neutral backbone of PNAs allows for specific hybridization to DNA and
RNA under conditions of low ionic strength. The synthesis of PNA oligomers
can be performed using standard solid phase peptide synthesis protocols
(Hyrup and Nielsen, 1996; Perry-O'Keefe et al., 1996).
PNAs of IF1206 can be used in therapeutic and diagnostic applications.
For example, PNAs can be used as anti-sense or antigene agents for
sequence-specific modulation of gene expression by inducing transcription or~
translation arrest or inhibiting replication. 1F1206 PNAs may also be used in
the analysis of single base pair mutations (e.g., PNA directed PCR clamping;
as artificial restriction enzymes when used in combination with other
enzymes, e.g., S, nucleases (Hyrup and Nielsen, 1996); or as probes or
primers for DNA sequence and hybridization (Hyrup and Nielsen, 1996; Perry-
O'Keefe et al., 1996).
PNAs of IF1206 can be modified to enhance their stability or cellular
uptake. Lipophilic or other helper groups may be attached to PNAs, PNA-
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-52-
DNA dimmers formed, or the use of liposomes or other drug delivery
techniques. For example, PNA-DNA chimeras can be generated that may
combine the advantageous properties of PNA and DNA. Such chimeras allow
DNA recognition enzymes (e.g., RNase H and DNA polymerises) to interact
with the DNA portion while the PNA portion provides high binding affinity and
specificity. PNA-DNA chimeras can be linked using linkers of appropriate
lengths selected in terms of base stacking, number of bonds befinreen the
nucleobases, and orientation (Hyrup and Nielsen, 1996). The synthesis of
PNA-DNA chimeras can be performed (Finn et al., 1996; Hyrup and Nielsen,
1996). For example, a DNA chain can be synthesized on a solid support
using standard phosphoramidite coupling chemistry, and modified nucleoside
analogs, e.g., 5'-(4-methoxytrityl)amino-5'-deoxy-thymidine phosphoramidite,
can be used between the PNA and the 5' end of DNA (Finn et al., 1996; Hyrup
and Nielsen, 1996). PNA monomers are then coupled in a stepwise manner
to produce a chimeric molecule with a 5' PNA segment and a 3' DNA segment
(Finn et al., 1996). Alternatively, chimeric molecules can be synthesized with
a 5' DNA segment and a 3' PNA segment (Petersen et al., 1976).
The oligonucleotide may include other appended groups such as
peptides (e.g., for targeting host cell receptors in vivo), or agents
facilitating
transport across the cell membrane (Lemaitre et al., 1987; Letsinger et al.,
1989) or PCT Publication No. W088/09810) or the blood-brain barrier (e.g.,
PCT Publication No. WO 89/10134). In addition, oligonucleotides can be
modified with hybridization-triggered cleavage agents (van der Krol et al.,
1988b) or intercalating agents (Zon, 1988). The oligonucleotide may be
conjugated to another molecule, e.g., a peptide, a hybridization triggered
cross-linking agent, a transport agent, a hybridization-triggered cleavage
agent, and the like.
1F1206 polypeptides
One aspect of the invention pertains to isolated IF1206, and
biologically-active portions derivatives, fragments, analogs or homologs
thereof. Also provided are polypeptide fragments suitable for use as
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-53-
immunogens to raise anti-IF1206 Abs. In one embodiment, native IF1206 can
be isolated from cells or tissue sources by an appropriate purification scheme
using standard protein purification techniques. In another embodiment,
IF1206 are produced by recombinant DNA techniques. Alternative to
recombinant expression, an IF1206 or polypeptide can be synthesized
chemically using standard peptide synthesis techniques.
1. Polypeptides
An IF1206 polypeptide includes the amino acid sequence of IF1206
whose sequences are provided in SEQ ID NOS:2, 4 or 15. The invention also
includes a mutant or variant protein any of whose residues may be changed
from the corresponding residues shown in SEQ ID NOS:2, 4 or 15, while still
encoding a protein that maintains its IF1206 activities and physiological
functions, or a functional fragment thereof.
2. Variant IF1206 polypeptides
In general, an IF1206 variant that preserves IFI206-like function and
includes any variant in which residues at a particular position in the
sequence
have been substituted by other amino acids, and further includes the
possibility of inserting an additional residue or residues between finro
residues
of the parent protein as well as the possibility of deleting one or more
residues
from the parent sequence. Any amino acid substitution, insertion, or deletion
is encompassed by the invention. In favorable circumstances, the substitution
is a conservative substitution as defined above.
"1F1206 polypeptide variant" means an active IF1206 polypeptide having
at least: (1 ) about 80% amino acid sequence identity with a full-length
native
sequence IF1206 polypeptide sequence, (2) a IF1206 polypeptide sequence
lacking the signal peptide, (3) an extracellular domain of a IF1206
polypeptide,
with or without the signal peptide, or (4) any other fragment of a full-length
1F1206 polypeptide sequence. For example, IF1206 polypeptide variants
include IF1206 polypeptides wherein one or more amino acid residues are
added or deleted at the N- or C- terminus of the full-length native amino acid
sequence. A IF1206 polypeptide variant will have at least about 80% amino
acid sequence identity, preferably at least about 81 % amino acid sequence
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-54-
identity, more preferably at least about 82%, 83%, 84%, 85%, 86%, 87%,
88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98% amino aCld
sequence identity and most preferably at least about 99% amino acid
sequence identity with a full-length native sequence IF1206 polypeptide
sequence. A IF1206 polypeptide variant may have a sequence lacking the
signal peptide, an extracellular domain of a IF1206 polypeptide, with or
without
the signal peptide, or any other fragment of a full-length IF1206 polypeptide
sequence. Ordinarily, IF1206 variant polypeptides are at least about 10 amino
acids in length, often at least about 20 amino acids in length, more often at
least about 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, or 300 amino acids in
length, or more.
"Percent (%) amino acid sequence identity" is defined as the
percentage of amino acid residues that are identical with amino acid residues
in the disclosed IF1206 polypeptide sequence in a candidate sequence when
the two sequences are aligned. To determine % amino acid identity,
sequences are aligned and if necessary, gaps are introduced to achieve the
maximum % sequence identity; conservative substitutions are not considered
as part of the sequence identity. Amino acid sequence alignment procedures
to determine percent identity are well known to those of skill in the art.
Often
publicly available computer software such as BLAST, BLAST2, ALIGN2 or
Megalign (DNASTAR) software is used to align peptide sequences. Those
skilled in the art can determine appropriate parameters for measuring
alignment, including any algorithms needed to achieve maximal alignment
over the full length of the sequences being compared.
When amino acid sequences are aligned, the % amino acid sequence
identity of a given amino acid sequence A to, with, or against a given amino
acid sequence B (which can alternatively be phrased as a given amino acid
sequence A that has or comprises a certain % amino acid sequence identity
to, with, or against a given amino acid sequence B) can be calculated as:
%amino acid sequence identity - ~ ~ 100
where
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-55-
X is the number of amino acid residues scored as identical matches by
the sequence alignment program's or algorithm's alignment of A and B
and
Y is the total number of amino acid residues in B.
If the length of amino acid sequence A is not equal to the length of
amino acid sequence B, the % amino acid sequence identity of A to B will not
equal the % amino acid sequence identity of B to A.
3. Isolatedlpurified polypeptides
An "isolated" or "purified" polypeptide, protein or biologically active
fragment is separated and/or recovered from a component of its natural
environment. Contaminant components include materials that would typically
interfere with diagnostic or therapeutic uses for the polypeptide, and may
include enzymes, hormones, and other proteinaceous or non-proteinaceous
materials. Preferably, the polypeptide is purified to a sufficient degree to
obtain at least 15 residues of N-terminal or internal amino acid sequence. To
be substantially isolated, preparations having less than 30% by dry weight of
non-IF1206 contaminating material (contaminants), more preferably less than
20%, 10% and most preferably less than 5% contaminants. An isolated,
recombinantly-produced IF1206 or biologically active portion is preferably
substantially free of culture medium, i.e., culture medium represents less
than
20%, more preferably less than about 10%, and most preferably less than
about 5% of the volume of the IF1206 preparation. Examples of contaminants
include cell debris, culture media, and substances used and produced during
in vitro synthesis of IF1206.
4. Biologically active
Biologically active portions of IF1206 include peptides comprising amino
acid sequences sufficiently homologous to or derived from the amino acid
sequences of the IF1206 (SEQ ID NOS:2 or 4) that include fewer amino acids
than the full-length IF1206, and exhibit at least one activity of an IF1206.
Biologically active portions comprise a domain or motif with at least one
activity of native IF1206. A biologically active portion of an IFI206 can be a
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-56-
polypeptide that is, for example, 10, 25, 50, 100 or more amino acid residues
in length. Other biologically active portions, in which other regions of the
protein are deleted, can be prepared by recombinant techniques and
evaluated for one or more of the functional activities of a native IF1206.
Biologically active portions of IF1206 may have an amino acid
sequence shown in SEQ ID NOS:2 or4, or substantially homologous to SEQ
ID NOS:2 or 4, and retains the functional activity of the protein of SEQ ID
NOS:2 or 4, yet differs in amino acid sequence due to natural allelic
variation
or mutagenesis. Other biologically active IF1206 may comprise an amino acid
sequence at least 45% homologous to the amino acid sequence of SEQ ID
NOS:2 or 4, and retains the functional activity of native IF1206.
5. Determining homology between two or more sequences
"1F1206 variant" means an active IF1206 having at least: (1 ) about 80%
amino acid sequence identity with a full-length native sequence IF1206
sequence, (2) an IF1206 sequence lacking the signal peptide, (3) an
extracellular domain of an IF1206, with or without the signal peptide, or (4)
any
other fragment of a full-length IF1206 sequence. For example, IF1206 variants
include IF1206 wherein one or more amino acid residues are added or deleted
at the N- or C- terminus of the full-length native amino acid sequence. An
IF1206 variant will have at least about 80% amino acid sequence identity,
preferably at least about 81 % amino acid sequence identity, more preferably
at least about 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%,
93%, 94%, 95%, 96%, 97%, 98% amino acid sequence identity and most
preferably at least about 99% amino acid sequence identity with a full-length
native sequence IF1206 sequence. An IF1206 variant may have a sequence
lacking the signal peptide, an extracellular domain of an IF1206, with or
without the signal peptide, or any other fragment of a full-length IF1206
sequence. Ordinarily, IF1206 variant polypeptides are at least about 10 amino
acids in length, often at least about 20 amino acids in length, more often at
least about 30, 40, 50, 60, 70, 80, 90, 1.00, 150, 200, or 300 amino acids in
length, or more. ' .
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-57-
"Percent (%) amino acid sequence identity" is defined as the
percentage of amino acid residues that are identical with amino acid residues
in the disclosed IF1206 sequence in a candidate sequence when the two
sequences are aligned. To determine % amino acid identity, sequences are
aligned and if necessary, gaps are introduced to achieve the maximum
sequence identity; conservative substitutions are not considered as part of
the
sequence identity. Amino acid sequence alignment procedures to determine
percent identity are well known to those of skill in the art. Often publicly
available computer software such as BLAST, BLAST2, ALIGN2 or Megalign
(DNASTAR) software is used to align peptide sequences. Those skilled in the
art can determine appropriate parameters for measuring alignment, including
any algorithms needed to achieve maximal alignment over the full length of
the sequences being compared.
When amino acid sequences are aligned, the % amino acid sequence
identity of a given amino acid sequence A to, with, or against a given amino
acid sequence B (which can alternatively be phrased as a given amino acid
sequence A that has or comprises a certain % amino acid sequence identity
to, with, or against a given amino acid sequence B) can be calculated as:
%amino acid sequence identity - ~ ~ 1 ~0
where
X is the number of amino acid residues scored as identical matches by
the sequence alignment program's or algorithm's alignment of A and B
and
Y is the total number of amino acid residues in B.
If the length of amino acid sequence A is not equal to the length of
amino acid sequence B, the % amino acid sequence identity of A to B will not
equal the % amino acid sequence identity of B to A.
6. Chimeric and fusion proteins
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-58-
Fusion polypeptides are useful in expression studies, cell-localization,
bioassays, and IF1206 purification. An IF1206 "chimeric protein" or "fusion
protein" comprises IF1206 fused to a non-IF1206 polypeptide. A non-IF1206
polypeptide is not substantially homologous to IF1206 (SEQ ID NOS:2 or 4).
An IF1206 fusion protein may include any portion to the entire IF1206,
including any number of the biologically active portions. 1F1206 may be fused
to the C-terminus of the GST (glutathione S-transferase) sequences. Such
fusion proteins facilitate the purification of recombinant IF1206. In certain
host cells, (e.g. mammalian), heterologous signal sequences fusions may
ameliorate IF1206 expression and/or secretion. Additional exemplary fusions
are presented in Table C.
Other fusion partners can adapt IF1206 therapeutically. Fusions with
members of the immunoglobulin (1g) protein family are useful in therapies that
inhibit IF1206 ligand or substrate interactions, consequently suppressing
IF1206-mediated signal transduction in vivo. Such fusions, incorporated into
pharmaceutical compositions, may be used to treat proliferative and
differentiation disorders, as well as modulating cell survival. IF1206-Ig
fusion
polypeptides can also be used as immunogens to produce anti-IF1206 Abs in
a subject, to purify IF1206 ligands, and to screen for molecules that inhibit
interactions of IF1206 with other molecules.
Fusion proteins can be easily created using recombinant methods. A
nucleic acid encoding IF1206 can be fused in-frame with a non-IF1206
encoding nucleic acid, to the IF1206 NHZ- or COO- -terminus, or internally.
Fusion genes may also be synthesized by conventional techniques, including
automated DNA synthesizers. PCR amplification using anchor primers that
give rise to complementary overhangs between two consecutive gene
fragments that can subsequently be annealed and reamplified to generate a
chimeric gene sequence (Ausubel et al., 198,7) is also useful. Many vectors
are commercially available that facilitate sub-cloning IFI206 in-frame to a
fusion moiety.
Table C Useful non-IFI206 fusion polypeptides
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-59-
Reporter in vitro in vivo Notes Reference
Human growthRadioimmuno- none Expensive, (Selden
et al.,
hormone assay insensitive,1986)
(hGH) narrow linear
range.
(3-glucu- Colorimetric,colorimetricsensitive, (Gallagher,
ronidase fluorescent, (histo- broad linear1992) ,
or
(GUS) chemi- chemical range, non-
luminescent staining iostopic.
with
X- luc
Green Fluorescent fluorescent can be used(Chalfie
et al.,
fluorescent in live 1994)
cells;
protein resists
(GFP) photo-
and related bleaching
molecules
(RFP, BFP,
IF1206,
etc.)
Luciferase bioluminsecentBio- protein (de Wet
is et al.,
(firefly) luminescent unstable, 1987)
difficult
to
reproduce,
signal is
brief
ChlorampheniChromato- none Expensive (Gorman
, et
coal graphy, radioactiveal., 1982)
acetyltransferadifferential substrates,
se (CAT) extraction, time-
fluorescent, consuming,
or
immunoassay insensitive,
narrow linear
range
(3-galacto-colorimetric,colorimetricsensitive, (Alam and
sidase fluorescence,(histochemicalbroad linearCook, 1990)
chemi- staining range; some
with
luminscence X-gal), bio-cells have
luminescent high
in
live cells endogenous
activity
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-60-
Secrete colorimetric,none Chem- (Berger et
al.,
alkaline bioluminescent, iluminscence1988)
phosphatase chemi- assay is
(SEAP) luminescent sensitive
and
broad linear
range; some
cells have
endogenouse
alkaline
phosphatase
activity
Therapeutic applications of IF1206
1. Agonists and antagonists
"Antagonist" includes any molecule that partially or fully blocks, inhibits,
or neutralizes a biological activity of endogenous IF1206. Similarly,
"agonisY'
includes any molecule that mimics a biological activity of endogenous IF1206.
Molecules that can act as agonists or antagonists include Abs or antibody
fragments, fragments or variants of endogenous IF1206, peptides, antisense
oligonucleotides, small organic molecules, etc.
2. Identifying antagonists and agonists
To assay for antagonists, IF1206 is added to, or expressed in, a cell
along with the compound to be screened for a particular activity. If the
compound inhibits the activity of interest in the presence of the IF1206, that
compound is an antagonist to the IF1206; if IF1206 activity is enhanced, the
compound is an agonist.
(a) Specific examples of potential antagonists and agonist
Any molecule that alters IF1206 cellular effects is a candidate
antagonist or agonist. Screening techniques well known to those skilled in the
art can identify these molecules. Examples of antagonists and agonists
include: (1) small organic and inorganic compounds, (2) small peptides, (3)
Abs and derivatives, (4) polypeptides closely related to IF1206, (5) antisense
DNA and RNA, (6) ribozymes, (7) triple DNA helices and (8) nucleic acid
aptamers.
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-61-
Small molecules that bind to the IF1206 active site or other relevant part
of the polypeptide and inhibit the biological activity of the IF1206 are
antagonists. Examples of small molecule antagonists include small peptides,
peptide-like molecules, preferably soluble, and synthetic non-peptidyl organic
or inorganic compounds. These same molecules, if they enhance IF1206
activity, are examples of agonists.
Almost any antibody that affects IF1206's function is a candidate
antagonist, and occasionally, agonist. Examples of antibody antagonists
include polyclonal, monoclonal, single-chain, anti-idiotypic, chimeric Abs, or
humanized versions of such Abs or fragments. Abs may be from any species
in which an immune response can be raised. Humanized Abs are also
contemplated.
Alternatively, a potential antagonist or agonist may be a closely related
protein, for example, a mutated form of the IF1206 that recognizes an IF1206-
interacting protein but imparts no effect, thereby competitively inhibiting
IF1206
action. Alternatively, a mutated IF1206 may be constitutively activated and
may act as an agonist.
Antisense RNA or DNA constructs can be effective antagonists.
Antisense RNA or DNA molecules block function by inhibiting translation by
hybridizing to targeted mRNA. Antisense technology can be used to control
gene expression through triple-helix formation or antisense DNA or RNA, both
of which depend on polynucleotide binding to DNA or RNA. For example, the
5' coding portion of the IFI206 sequence is used to design an antisense RNA
oligonucleotide of from about 10 to 40 base pairs in length. A DNA
oligonucleotide is designed to be complementary to a region of the gene
involved in transcription (triple helix) (Beat and Dervan, 1991; Cooney et
al.,
1988; Lee et al., 1979), thereby preventing transcription and the production
of
the IF1206. The antisense RNA oligonucleotide hybridizes to the mRNA in
vivo and blocks translation of the mRNA molecule into the IF1206 (antisense)
(Cohen, 1989; Okano et al., 1991 ). These oligonucleotides can also be
delivered to cells such that the antisense RNA or DNA may be expressed in
vivo to inhibit production of the IF1206. When antisense DNA is used,
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-62-
oligodeoxyribonucleotides derived from the translation-initiation site, e.g.,
between about -10 and +10 positions of the target gene nucleotide sequence,
are preferred.
Ribozymes are enzymatic RNA molecules capable of catalyzing the
specific cleavage of RNA. Ribozymes act by sequence-specific hybridization
to the complementary target RNA, followed by endonucleolytic cleavage.
Specific ribozyme cleavage sites within a potential RNA target can be
identified by known techniques (WO 97/33551, 1997; Rossi, 1994).
To inhibit transcription, triple-helix nucleic acids that are single-
stranded and comprise deoxynucleotides are useful antagonists. These
oligonucleotides are designed such that triple-helix formation via Hoogsteen
base-pairing rules is promoted, generally requiring stretches of purines or
pyrimidines (WO 97/33551, 1997).
Because an IF1206 activity may include nucleic acid binding, such as
BAT mRNA, molecules that compete for IF1206 nucleic acid binding sites)
can be effective intracellular competitors. Aptamers are short oligonucleotide
sequences that can be used to recognize and specifically bind almost any
molecule. The systematic evolution of ligands by exponential enrichment
(SELEX) process (Ausubel et al., 1987; Ellington and Szostak, 1990; Tuerk
and Gold, 1990) is powerful and can be used to find such aptamers.
Aptamers have many diagnostic and clinical uses; almost any use in which an
antibody has been used clinically or diagnostically, aptamers too may be
used. In addition, are cheaper to make once they have been identified, and
can be easily applied in a variety of formats, including administration in
pharmaceutical compositions, in bioassays, and diagnostic tests (Jayasena,
1999).
Anti-IF1206 Abs
The invention encompasses Abs and antibody fragments, such as Fab
or (Fab)2, that bind immunospecifically to any IF1206 epitopes.
"Antibody" (Ab) comprises single Abs directed against IF1206 (anti-
IF1206 Ab; including agonist, antagonist, and neutralizing Abs), anti-IF1206
Ab
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-63-
compositions with poly-epitope specificity, single chain anti-IF1206 Abs, and
fragments of anti-IF1206 Abs. A "monoclonal antibody" is obtained from a
population of substantially homogeneous Abs, i.e., the individual Abs
comprising the population are identical except for possible naturally-
occurring
mutations that may be present in minor amounts. Exemplary Abs include
polyclonal (pAb), monoclonal (mAb), humanized, bi-specific (bsAb), and
heteroconjugate Abs.
1. Polyclonal Abs (pAbs)
Polyclonal Abs can be raised in a mammalian host, for example, by
one or more injections of an immunogen and, if desired, an adjuvant.
Typically, the immunogen and/or adjuvant are injected in the mammal by
multiple subcutaneous or intraperitoneal injections. The immunogen may
include IF1206 or a fusion protein. Examples of adjuvants include Freund's
complete and monophosphoryl Lipid A synthetic-trehalose dicorynomycolate
(MPL-TDM). To improve the immune response, an immunogen may be
conjugated to a protein that is immunogenic in the host, such as keyhole
limpet hemocyanin (KLH), serum albumin, bovine thyroglobulin, and soybean
trypsin inhibitor. Protocols for antibody production are described by (Ausubel
et al., 1987; Harlow and Lane, 1988). Alternatively, pAbs may be made in
chickens, producing IgY molecules (Schade et al., 1996).
2. Monoclonal Abs (mAbs)
Anti-IF1206 mAbs may be prepared using hybridoma methods (Milstein
and Cuello, 1983). Hybridoma methods comprise at least four steps: (1 )
immunizing a host, or lymphocytes from a host; (2) harvesting the mAb
secreting (or potentially secreting) lymphocytes, (3) fusing the lymphocytes
to
immortalized cells, and (4) selecting those cells that secrete the desired
(anti-
IF1206) mAb.
A mouse, rat, guinea pig, hamster, or other appropriate host is
immunized to elicit lymphocytes that produce or are capable of producing Abs
that will specifically bind to the immunogen. Alternatively, the lymphocytes
may be immunized in vitro. If human cells are desired, peripheral blood
lymphocytes (PBLs) are generally used; however, spleen cells or lymphocytes
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-64-
from other mammalian sources are preferred. The immunogen typically
includes IF1206 or a fusion protein.
The lymphocytes are then fused with an immortalized cell line to form
hybridoma cells, facilitated by a fusing agent such as polyethylene glycol
(coding, 1996). Rodent, bovine, or human myeloma cells immortalized by
transformation may be used, or rat or mouse myeloma cell lines. Because
pure populations of hybridoma cells and not unfused immortalized cells are
preferred, the cells after fusion are grown in a suitable medium that contains
one or more substances that inhibit the growth or survival of unfused,
immortalized cells. A common technique uses parental cells that lack the
enzyme hypoxanthine guanine phosphoribosyl transferase (HGPRT or
HPRT). In this case, hypoxanthine, aminopterin and thymidine are added to '
the medium (HAT medium) to prevent the growth of HGPRT-deficient cells
while permitting hybridomas to grow.
Preferred immortalized cells fuse efficiently, can be isolated from mixed
populations by selecting in a medium such as HAT, and support stable and
high-level expression of antibody after fusion. Preferred immortalized cell
lines are murine myeloma lines, available from the American Type Culture
Collection (Manassas, VA). Human myeloma and mouse-human
heteromyeloma cell lines also have been described for the production of
human mAbs (Kozbor et al., 1984; Schook, 1987).
Because hybridoma cells secrete antibody extracellularly, the culture
media can be assayed for the presence of mAbs directed against IF1206 (anti-
IF1206 mAbs). Immunoprecipitation or in vitro binding assays, such as radio
immunoassay (RIA) or enzyme-linked immunoabsorbent assay (ELISA),
measure the binding specificity of mAbs (Harlow and Lane, 1988; Harlow and
Lane, 1999), including Scatchard analysis (Munson and Rodbard, 1980).
Anti-IF1206 mAb secreting hybridoma cells may be isolated as single
clones by limiting dilution procedures and sub-cultured (coding, 1996).
Suitable culture media include Dulbecco's Modified Eagle's Medium, RPMI-
1640, or if desired, a protein-free or -reduced or serum-free medium (e.g.,
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-65-
Ultra DOMA PF or HL-1; Biowhittaker; Walkersville, MD). The hybridoma
cells may also be grown in vivo as ascites.
The mAbs may be isolated or purified from the culture medium or
ascites fluid by conventional Ig purification procedures such as protein A-
Sepharose, hydroxylapatite chromatography, gel electrophoresis, dialysis,
ammonium sulfate precipitation or affinity chromatography (Harlow and Lane,
1988; Harlow and Lane, 1999).
The mAbs may also be made by recombinant methods (U.S. Patent
No. 4166452, 1979). DNA encoding anti-IF1206 mAbs can be readily isolated
and sequenced using conventional procedures, e.g., using oligonucleotide
probes that specifically bind to murine heavy and light antibody chain genes,
to probe preferably DNA isolated from anti-IF1206-secreting mAb hybridoma
cell lines. Once isolated, the isolated DNA fragments are sub-cloned into
expression vectors that are then transfected into host cells such as simian
COS-7 cells, Chinese hamster ovary (CHO) cells, or myeloma cells that do
not otherwise produce Ig protein, to express mAbs. The isolated DNA
fragments can be modified, for example, by substituting the coding sequence
for human heavy and light chain constant domains in place of the homologous
murine sequences (U.S. Patent No. 4816567, 1989; Morrison et al., 1987), or
by fusing the Ig coding sequence to all or part of the coding sequence for a
non-Ig polypeptide. Such a non-Ig polypeptide can be substituted for the
constant domains of an antibody, or can be substituted for the variable
domains of one antigen-combining site to create a chimeric bivalent antibody.
3. Monovalent Abs
The Abs may be monovalent Abs that consequently do not cross-link
with each other. For example, one method involves recombinant expression
of Ig light chain and modified heavy chain. Heavy chain truncations generally
at any point in the F~ region will prevent heavy chain cross-linking.
Alternatively, the relevant cysteine residues are substituted with another
amino acid residue or are deleted, preventing crosslinking. In vitro methods
are also suitable for preparing monovalent Abs. Abs can be digested to
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-66-
produce fragments, such as Fab fragments (Harlow and Lane, 1988; Harlow
and Lane, 1999).
4. Humanized and human Abs
Anti-IF1206 Abs may further comprise humanized or human Abs.
Humanized forms of non-human Abs are chimeric Igs, Ig chains or fragments
(such as F", Fab, Fab', F~ab~~z or other antigen-binding subsequences of Abs)
that contain minimal sequence derived from non-human Ig.
Generally, a humanized antibody has one or more amino acid residues
introduced from a non-human source. These non-human amino acid residues
are often referred to as "import" residues, which are typically taken from an
"import" variable domain. Humanization is accomplished by substituting
rodent CDRs or CDR sequences for the corresponding sequences of a
human antibody (Jones et al., 1986; Riechmann et al., 1988; Verhoeyen et al.,
1988). Such "humanized" Abs are chimeric Abs (U.S. Patent No. 4816567,
1989), wherein substantially less than an intact human variable domain has
been substituted by the corresponding sequence from a non-human species.
In practice, humanized Abs are typically human Abs in which some CDR
residues and possibly some FR residues are substituted by residues from
analogous sites in rodent Abs. Humanized Abs include human Igs (recipient
antibody) in which residues from a complementary determining region (CDR)
of the recipient are replaced by residues from a CDR of a non-human species
(donor antibody) such as mouse, rat or rabbit, having the desired specificity,
affinity and capacity. In some instances, corresponding non-human residues
replace F" framework residues of the human Ig. Humanized Abs may
comprise residues that are found neither in the recipient antibody nor in the
imported CDR or framework sequences. In general, the humanized antibody
comprises substantially all of at least one, and typically two, variable
domains,
in which most if not all of the CDR regions correspond to those of a non-
human Ig and most if not all of the FR regions are those of a human Ig
consensus sequence. The humanized antibody optimally also comprises at
least a portion of an Ig constant region (F~), typically that of a human Ig
(Jones et al., 1986; Presta, 1992; Riechmann et al., 1988).
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-67-
Human Abs can also be produced using various techniques, including
phage display libraries (Hoogenboom et al., 1991; Marks et al., 1991) and the
preparation of human mAbs (Boerner et al., 1991; Reisfeld and Sell, 1985).
Similarly, introducing human Ig genes into transgenic animals in which the
endogenous Ig genes have been partially or completely inactivated can be
exploited to synthesize human Abs. Upon challenge, human antibody
production is observed, which closely resembles that seen in humans in all
respects, including gene rearrangement, assembly, and antibody repertoire
(U.S. Patent No. 5545807, 1996; U.S. Patent No. 5545806, 1996; U.S. Patent
No. 5569825, 1996; U.S. Patent No. 5633425, 1997; U.S. Patent No.
5661016, 1997; U.S. Patent No. 5625126, 1997; Fishwild et al., 1996;
Lonberg and Huszar, 1995; Lonberg et al., 1994; Marks et al., 1992).
5. Bi-specific mAbs
Bi-specific Abs are monoclonal, preferably human or humanized, that
have binding specificities for at least two different antigens. For example, a
binding specificity is IF1206; the other is for any antigen of choice,
preferably a
cell-surface protein or receptor or receptor subunit.
Traditionally, the recombinant production of bi-specific Abs is based on
the co-expression of two Ig heavy-chain/light-chain pairs, where the two
heavy chains have different specificities (Milstein and Cuello, 1983). Because
of the random assortment of Ig heavy and light chains, the resulting
hybridomas (quadromas) produce a potential mixture of ten different antibody
molecules, of which only one has the desired bi-specific structure. The
desired antibody can be purified using affinity chromatography or other
techniques (WO 93/08829, 1993; Traunecker et al., 1991 ).
To manufacture a bi-specific antibody (Suresh et al., 1986), variable
domains with the desired antibody-antigen combining sites are fused to Ig
constant domain sequences. The fusion is preferably with an Ig heavy-chain
constant domain, comprising at least part of the hinge, CH2, and CH3
regions. Preferably, the first heavy-chain constant region (CH1) containing
the site necessary for light-chain binding is in at least one of the fusions.
DNAs encoding the Ig heavy-chain fusions and, if desired, the Ig light chain,
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-68-
are inserted into separate expression vectors and are co-transfected into a
suitable host organism.
The interface between a pair of antibody molecules can be engineered
to maximize the percentage of heterodimers that are recovered from
~ recombinant cell culture (WO 96/27011, 1996). The preferred interface
comprises at least part of the CH3 region of an antibody constant domain. In
this method, one or more small amino acid side chains from the intertace of
the first antibody molecule are replaced with larger side chains (e.g.
tyrosine
or tryptophan). Compensatory "cavities" of identical or similar size to the
large
side chains) are created on the interface of the second antibody molecule by
replacing large amino acid side chains with smaller ones (e.g. alanine or
threonine). This mechanism increases the yield of the heterodimer over
unwanted end products such as homodimers.
Bi-specific Abs can be prepared as full length Abs or antibody
fragments (e.g. F~ab~~2 bi-specific Abs). One technique to generate bi-
specific
Abs exploits chemical linkage. Intact Abs can be proteolytically cleaved to
generate F~ab')z fragments (Brennan et al., 1985). Fragments are reduced with
a dithiol complexing agent, such as sodium arsenite, to stabilize vicinal
dithiols and prevent intermolecular disulfide formation. The generated Fab
fragments are then converted to thionitrobenzoate (TNB) derivatives. One of
the Fab~-TNB derivatives is then reconverted to the Fab~-thiol by reduction
with
mercaptoethylamine and is mixed with an equimolar amount of the other Fab'-
TNB derivative to form the bi-specific antibody. The produced bi-specific Abs
can be used as agents for the selective immobilization of enzymes.
Fab~ fragments may be directly recovered from E. coli and chemically
coupled to form bi-specific Abs. For example, fully humanized bi-specific
F(ab')2 Abs can be produced (Shalaby et al., 1992). Each Fab~ fragment is
separately secreted from E. coli and directly coupled chemically in vitro,
forming the bi-specific antibody.
Various techniques for making and isolating bi-specific antibody
fragments directly from recombinant cell culture have also been described.
For example, leucine zipper motifs can be exploited (Kostelny et al., 1992).
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-69-
Peptides from the Fos and Jun proteins are linked to the Fab~ portions of two
different Abs by gene fusion. The antibody homodimers are reduced at the
hinge region to form monomers and then re-oxidized to form antibody
heterodimers. This method can also produce antibody homodimers. The
"diabody" technology (Holliger et al., 1993) provides an alternative method to
generate bi-specific antibody fragments. The fragments comprise a heavy-
chain variable domain (VH) connected to a light-chain variable domain (V~) by
a linker that is too short to allow pairing between the two domains on the
same chain. The VH and V~ domains of one fragment are forced to pair with
the complementary V~ and VH domains of another fragment, forming two
antigen-binding sites. Another strategy for making bi-specific antibody
fragments is the use of single-chain F~ (sF") dimers (Gruber et al., 1994).
Abs
with more than two valencies are also contemplated, such as tri-specific Abs
(Tutt et al., 1991 ).
Exemplary bi-specific Abs may bind to two different epitopes on a given
IF1206. Alternatively, cellular defense mechanisms can be restricted to a
particular cell expressing the particular IF1206: an anti-IF1206 arm may be .
combined with an arm that binds to a leukocyte triggering molecule, such as a
T-cell receptor molecule (e.g. CD2, CD3, CD28, or B7), or to F~ receptors for
IgG (F~yR), such as F~yRI (CD64), F~yRll (CD32) and F~yRlll (CD16). Bi-
specific Abs may also be used to target cytotoxic agents to cells that express
a particular IF1206. These Abs possess an IF1206-binding arm and an arm
that binds a cytotoxic agent or a radionuclide chelator.
6. Heteroconjugate Abs
Heteroconjugate Abs, consisting of two covalently joined Abs, have
been proposed to target immune system cells to unwanted cells (4,676,980,
1987) and for treatment of human immunodeficiency virus (HIV) infection (WO
91 /00360, 1991; WO 92/20373, 1992). Abs prepared in vitro using synthetic
protein chemistry methods, including those involving cross-linking agents, are
contemplated. For example, immunotoxins may be constructed using a
disulfide exchange reaction or by forming a thioether bond. Examples of
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-70-
suitable reagents include iminothiolate and methyl-4-mercaptobutyrimidate
(4,676,980, 1987).
7. Immunoconjugates
Immunoconjugates may comprise an antibody conjugated to a
cytotoxic agent such as a chemotherapeutic agent, toxin (e.g., an
enzymatically active toxin or fragment of bacterial, fungal, plant, or animal
origin), or a radioactive isotope (i.e., a radioconjugate).
Useful enzymatically-active toxins and fragments include Diphtheria A
chain, non-binding active fragments of Diphtheria toxin, exotoxin A chain
from'
Pseudomonas aeruginosa, ricin A chain, abrin A chain, modeccin A chain, a-
sarcin, Aleurites fordii proteins, Dianthin proteins, Phytolaca americana
proteins, Momordica charantia inhibitor, curcin, crotin, Sapaonaria
officinalis
inhibitor, gelonin, mitogellin, restrictocin, phenomycin, enomycin, and the
tricothecenes. A variety of radionuclides are available for the production of
radioconjugated Abs, such as 2'2 Bi, '3' I, '3' In, 9~Y, and '$6Re.
Conjugates of the antibody and cytotoxic agent are made using a
variety of bi-functional protein-coupling agents, such as N-succinimidyl-3-(2-
pyridyldithiol) propionate (SPDP), iminothiolane (IT), bi-functional
derivatives
of imidoesters (such as dimethyl adipimidate HCI), active esters (such as
disuccinimidyl suberate), aldehydes (such as glutareldehyde), bis-azido
compounds (such as bis (p-azidobenzoyl) hexanediamine), bis-diazonium
derivatives (such as bis-(p-diazoniumbenzoyl)-ethylenediamine),
diisocyanates (such as tolyene 2,6- diisocyanate), and bis-active fluorine
compounds (such as 1,5-difluoro-2,4-dinitrobenzene). For example, a ricin
immunotoxin can be prepared (Vitetta et al., 1987). '4C-labeled 1-
isothiocyanatobenzyl-3-methyldiethylene triaminepentaacetic acid (MX-DTPA)
is an exemplary chelating agent for conjugating radionuclide to antibody (WO
94/11026, 1994).
In another embodiment, the antibody may be conjugated to a "receptor"
(such as streptavidin) for utilization in tumor pre-targeting wherein the
antibody-receptor conjugate is administered to the patient, followed by
removal of unbound conjugate from the circulation using a clearing agent and
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-71-
then administration of a streptavidin "ligand" (e.g., biotin) that is
conjugated to
a cytotoxic agent (e.g., a radionuclide).
8. ~ffector function engineering
The antibody can be modified to enhance its effectiveness in treating a
disease, such as cancer. For example, cysteine residues) may be introduced
into the F~ region, thereby allowing interchain disulfide bond formation in
this
region. Such homodimeric Abs may have improved internalization capability
and/or increased complement-mediated cell killing and antibody-dependent
cellular cytotoxicity (ADCC) (Caron et al., 1992; Shopes, 1992). Homodimeric
Abs with enhanced anti-tumor activity can be prepared using hetero-
bifunctional cross-linkers (Wolff et al., 1993). Alternatively, an antibody
engineered with dual F~ regions may have enhanced complement lysis
(Stevenson et al., 1989).
9. Immunoliposomes
Liposomes containing the antibody may also be formulated (U.S.
Patent No. 4485045, 1984; U.S. Patent No. 4544545, 1985; U.S. Patent No.
5013556, 1991; Eppstein et al., 1985; Hwang et al., 1980). Useful liposomes
can be generated by a reverse-phase evaporation method with a lipid
composition comprising phosphatidylcholine, cholesterol, and PEG-
derivatized phosphatidylethanolamine (PEG- PE). Such preparations are
extruded through filters of defined pore size to yield liposomes with a
desired
diameter. Fab~ fragments of the antibody can be conjugated to the liposomes
(Martin and Papahadjopoulos, 1982) via a disulfide-interchange reaction. A
chemotherapeutic agent, such as Doxorubicin, may also be contained in the
liposome (Gabizon et al., 1989). Other useful liposomes with different
compositions are contemplated.
10. Diagnostic applications of Abs directed against IFI206
Anti-IF1206 Abs can be used to localize and/or quantitate IF1206 (e.g.,
for use in measuring levels of IF1206 within tissue samples or for use in
diagnostic methods, etc.). Anti-IF1206 epitope Abs can be utilized as
pharmacologically-active compounds.
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-72-
Anti-IF1206 Abs can be used to isolate IF1206 by standard techniques,
such as immunoaffinity chromatography or immunoprecipitation. These
approaches facilitate purifying endogenous IF1206 antigen-containing
polypeptides from cells and tissues. These approaches, as well as others,
can be used to detect IF1206 in a sample to evaluate the abundance and
pattern of expression of the antigenic protein. Anti-IF1206 Abs can be used to
monitor protein levels in tissues as part of a clinical testing procedure; for
example, to determine the efficacy of a given treatment regimen. Coupling
the antibody to a detectable substance (label) allows detection of Ab-antigen
complexes. Classes of labels include fluorescent, luminescent,
bioluminescent, and radioactive materials, enzymes and prosthetic groups.
Useful labels include horseradish peroxidase, alkaline phosphatase, (3-
galactosidase, acetylcholinesterase, streptavidin/biotin, avidin/biotin,
umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine,
dichlorotriazinylamine fluorescein, dansyl chloride, phycoerythrin, luminol,
luciferase, luciferin, aequorin, and'25I, '3' I, ssS or 3H.
11. Antibody therapeutics .
Abs of the invention, including polyclonal, monoclonal, humanized and
fully human Abs, can be used therapeutically. Such agents will generally be
employed to treat or prevent a disease or pathology in a subject. An antibody
preparation, preferably one having high antigen specificity and affinity
generally mediates an effect by binding the target epitope(s). Generally,
administration of such Abs may mediate one of two effects: (1) the antibody
may prevent ligand binding, eliminating endogenous ligand binding and
subsequent signal transduction, or (2) the antibody elicits a physiological
result by binding an effector site on the target molecule, initiating signal
transduction.
A therapeutically effective amount of an antibody relates generally to
the amount needed to achieve a therapeutic objective, epitope binding
affinity,
administration rate, and depletion rate of the antibody from a subject.
Common ranges for therapeutically effective doses may be, as a nonlimiting .
example, from about 0.1 mg/kg body weight to about 50 mg/kg body weight.
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-73-
Dosing frequencies may range, for example, from twice daily to once a week.
12. Pharmaceutical compositions of Abs
Anti-IF1206 Abs, as well as other IF1206 interacting molecules (such as
aptamers) identified in other assays, can be administered in pharmaceutical
compositions to treat various disorders. Principles and considerations
involved in preparing such compositions, as well as guidance in the choice of
components can be found in (de Boer, 1994; Gennaro, 2000; Lee, 1990).
Because IF1206 is intracellular, Abs that are internalized are preferred
when whole Abs are used as inhibitors. Liposomes may also be used as a
delivery vehicle for intracellular introduction. Where antibody fragments are
used, the smallest inhibitory fragment that specifically binds to the epitope
is
preferred. For example, peptide molecules can be designed that bind a
preferred epitope based on the variable-region sequences of a useful
antibody. Such peptides can be synthesized chemically and/or produced by
recombinant DNA technology (Marasco et al., 1993). Formulations may also
contain more than one active compound for a particular treatment, preferably
those with activities that do not adversely affect each other. The composition
may comprise an agent that enhances function, such as a cytotoxic agent,
cytokine, chemotherapeutic agent, or growth-inhibitory agent.
The active ingredients can also be entrapped in microcapsules
prepared by coacervation techniques or by interfacial polymerization; for
example, hydroxymethylcellulose or gelatin-microcapsules and poly-
(methylmethacrylate) microcapsules, respectively, in colloidal drug delivery
systems (for example, liposomes, albumin microspheres, microemulsions,
nano-particles, and nanocapsules) or in macroemulsions.
The formulations to be used for in vivo administration are highly
preferred to be sterile. This is readily accomplished by filtration through
sterile
filtration membranes or any of a number of techniques.
Sustained-release preparations may also be prepared, such as semi-
permeable matrices of solid hydrophobic polymers containing the antibody,
which matrices are in the form of shaped articles, e.g., films, or
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-74-
microcapsules. Examples of sustained-release matrices include polyesters,
hydrogels (for example, poly(2-hydroxyethyl-methacrylate), or
poly(vinylalcohol)), polylactides (Boswell and Scribner, U.S. Patent No.
3,773,919, 1973), copolymers of L-glutamic acid and y ethyl-L-glutamate, non-
degradable ethylene-vinyl acetate, degradable lactic acid-glycolic acid
copolymers such as injectable microspheres composed of lactic acid-glycolic
acid copolymer, and poly-D-(-)-3-hydroxybutyric acid. While polymers such
as ethylene-vinyl acetate and lactic acid-glycolic acid enable release of
molecules for over 100 days, certain hydrogels release proteins for shorter
time periods and may be preferred.
IFI206 recombinant expression vectors and host cells
Vectors are tools used to shuttle DNA between host cells or as a
means to express a nucleotide sequence. Some vectors function only in
prokaryotes, while others function in both prokaryotes and eukaryotes,
enabling large-scale DNA preparation from prokaryotes for expression in
eukaryotes. Inserting the DNA of interest, such as IF1206 nucleotide
sequence or a fragment, is accomplished by ligation techniques and/or mating
protocols well-known to the skilled artisan. Such DNA is inserted such that
its
integration does not disrupt any necessary components of the vector. In the
case of vectors that are used to express the inserted DNA protein, the
introduced DNA is operably-linked to the vector elements that govern its
transcription and translation.
Vectors can be divided into two general classes: Cloning vectors are
replicating plasmid or phage with regions that are non-essential for
propagation in an appropriate host cell, and into which foreign DNA can be
inserted; the foreign DNA is replicated and propagated as if it were a
component of the vector. An expression vector (such as a plasmid, yeast, or
animal virus genome) is used to introduce foreign genetic material into a host
cell or tissue in order to transcribe and translate the foreign DNA. In
expression vectors, the introduced DNA is operably-linked to elements, such
as promoters, that signal to the host cell to transcribe the inserted DNA.
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-75-
Some promoters are exceptionally useful, such as inducible promoters that
control gene transcription in response to specific factors. Operably-linking
IFI206 or anti-sense construct to an inducible promoter can control the
expression of IFI206 or fragments, or anti-sense constructs. Examples of
classic inducible promoters include those that are responsive to a-interferon,
heat-shock, heavy metal ions, and steroids such as glucocorticoids (Kaufman,
1990) and tetracycline. Other desirable inducible promoters include those
that are not endogenous to the cells in which the construct is being
introduced, but, however, is responsive in those cells when the induction
agent is exogenously supplied.
Vectors have many difference manifestations. A "plasmid" is a circular
double stranded DNA molecule into which additional DNA segments can be
introduced. Viral vectors can accept additional DNA segments into the viral
genome. Certain vectors are capable of autonomous replication in a host cell
(e.g., bacterial vectors having a bacterial origin of replication and episomal
mammalian vectors). Other vectors (e.g., non-episomal mammalian vectors)
are integrated into the genome of a host cell upon introduction into the host
cell, and thereby are replicated along with the host genome. In general,
useful expression vectors are often plasmids. However, other forms of
expression vectors, such as viral vectors (e.g., replication defective
retroviruses, adenoviruses and adeno-associated viruses) are contemplated.
Recombinant expression vectors that comprise IFI206 (or fragments)
regulate IFI206 transcription by exploiting one or more host cell-responsive
(or
that can be manipulated in vitro) regulatory sequences that is operably-linked
to IFI206. "Operably-linked" indicates that a nucleotide sequence of interest
is
linked to regulatory sequences such that expression of the nucleotide
sequence is achieved.
Vectors can be introduced in a variety of organisms and/or cells (Table
D). Alternatively, the vectors can be transcribed and translated in vitro, for
example using T7 promoter regulatory sequences and T7 polymerase.
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-76-
Table D Examples of hosts for cloning or expression
Organisms Examples Sources and
References*
Prokaryotes
E. coli
K 12 strain MM294 ATCC 31,446
X1776 ATCC 31,537
W3110 ATCC 27,325
K5 772 ATCC 53,635
Enterobacter
Erwinia
Klebsiella
EnterobacteriaceaeProteus
Salmonella (S.
tyhpimurium)
Serratia (S. marcescans)
Shigella
Bacilli (B. subtilis
and 8.
licheniformis)
Pseudomonas (P.
aeruginosa)
Streptomyces
Eukaryotes
Yeasts Saccharomyces cerevisiae
Schizosaccharomyces
pombe
Kluyveromyces (Fleer et al., 1991)
K. lactis MW98-8C, (de Louvencourt
et al., ,
CBS683, CBS4574 1983)
K. fragilis ATCC 12,424
K. bulgaricus ATCC 16,045
K. wickeramii ATCC 24,178
K. waltii ATCC 56,500
K, drosophilarum ATCC 36,906
K. thermotolerans
K. marxianus; yarrowiaEPO 402226, 1990
Pichia pastoris (Sreekrishna et
al.,
1988
Candida
Trichoderma reesia
Neurospora crassa (Case et al., 1979)
Torulopsis
Rhodotorula
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-77-
Table D Examples of hosts for cloning or expression
Organisms Examples Sources and
References*
Schwanniomyces (S.
occidentalis)
Neurospora
Penicillium
F Tolypocladium (WO 91/00357, 1991)
Fil
t
i
ung
ous
amen
Aspergillus (A. nidulansIYelton, 1984 #229;
and A. niger) Kelly, 1985 #219;
Tilburn, 1983 #227
I ~rosophila S2
ll
rt
b
t
nve Spodoptera Sf9
e
e ce
s
ra
Chinese Hamster Ovary
(CHO)
Vertebrate cellssimian COS
COS-7 - ATCC CRL 1651
HEK 293
*Unreferenced
cells are generally
available from
American Type
Culture
Collection (Manassas,
VA).
Vector choice is dictated by the organism or cells being used and the
desired fate of the vector. Vectors may replicate once in the target cells, or
may be "suicide" vectors. In general, vectors comprise signal sequences,
origins of replication, marker genes, enhancer elements, promoters, and
transcription termination sequences. The choice of these elements depends
on the organisms in which the vector will be used and are easily determined.
Some of these elements may be conditional, such as an inducible or
conditional promoter that is turned "on" when conditions are appropriate.
Examples of inducible promoters include those that are tissue-specific, which
relegate expression to certain cell types, steroid-responsive, or heat-shock
reactive. Some bacterial repression systems, such as the lac operon, have
been exploited in mammalian cells and transgenic animals (Fleck et al., 1992;
Wyborski et al., 1996; Wyborski and Short, 1991 ). Vectors often use a
selectable marker to facilitate identifying those cells that have incorporated
the vector. Many selectable markers are well known in the art for the use with
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-78-
prokaryotes, usually antibiotio-resistance genes or the use of autotrophy and
auxotrophy mutants.
Using antisense and sense IF1206 oligonucleotides can prevent IF1206~
polypeptide expression. These oligonucleotides bind to target nucleic acid
sequences, forming duplexes that block transcription or translation of the
target sequence by enhancing degradation of the duplexes, terminating
prematurely transcription or translation, or by other means.
Antisense or sense oligonucleotides are singe-stranded nucleic acids,
either RNA or DNA, which can bind target IF1206 mRNA (sense) or IF1206
DNA (antisense) sequences. According to the present invention, antisense or
sense oligonucleotides comprise a fragment of the IF1206 DNA coding region
of at least about 14 nucleotides, preferably from about 14 to 30 nucleotides.
In general, antisense RNA or DNA molecules can comprise at least 5, 10, 15,
20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 bases in
length or more. Among others, (Stein and Cohen, 1988; van der Krol et al.,
1988a) describe methods to derive antisense or a sense oligonucleotides
from a given cDNA sequence.
Modifications of antisense and sense oligonucleotides can augment
their effectiveness. Modified sugar-phosphodiester bonds or other sugar
linkages (WO 91/06629, 1991), increase in vivo stability by conferring
resistance to endogenous nucleases without disrupting binding specificity to
target sequences. Other modifications can increase the affinities of the
oligonucleotides for their targets, such as covalently linked organic moieties
(WO 90/10448, 1990) or poly-(L)-lysine. Other attachments modify binding
specificities of the oligonucleotides for their targets, including metal
complexes or intercalating (e.g. ellipticine) and alkylating agents.
To introduce antisense or sense oligonucleotides into target cells (cells
containing the target nucleic acid sequence), any gene transfer method may
be used and are well known to those of skill in the art. Examples of gene
transfer methods include 1 ) biological, such as gene transfer vectors like
Epstein-Barr virus or conjugating the exogenous DNA to a ligand-binding
molecule (WO 91/04753, 1991), 2) physical, such as electroporation, and 3)
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
_79-
chemical, such as CaP04 precipitation and oligonucleotide-lipid complexes
(WO 90/10448, 1990).
The terms "host cell" and "recombinant host cell" are used
interchangeably. Such terms refer not only to a particular subject cell but
also
to the progeny or potential progeny of such a cell. Because certain
modifications may occur in succeeding generations due to either mutation or
environmental influences, such progeny may not, in fact, be identical to the
parent cell, but are still included within the scope of the term.
Methods of eukaryotic cell transfection and prokaryotic cell
transformation are well known in the art. The choice of host cell will dictate
the preferred technique for introducing the nucleic acid of interest. Table
##,
which is not meant to be limiting, summarizes many of the known techniques
in the art. Introduction of nucleic acids into an organism may also be done
with ex vivo techniques that use an in vitro method of transfection, as well
as
established genetic techniques, if any, for that particular organism.
Table E Methods to introduce nucleic acid into cells
Cells Methods References Notes
(Cohen et al., 1972;
ProkaryotesCalcium chlorideHanahan, 1983; Mandel
b and Hi a, 1970
t
i
(
ac
er
a)
Electroporation(Shigekawa and Dower,
1988
Eukaryotes
N-(2-
Hydroxyethyl)piperazine-
N'-(2-ethanesulfonicCells may
acid be
(HEPES) buffered shocked" with
saline
solution (Chen and glycerol or
Okayama, 1988; dimethylsulfoxid
Mammalian Calcium Graham and van der a (DMSO) to
Eb,
cells phosphate 1973; Wigler et increase
al.,
transfection 1978)
transfection
efficiency
BES (N,N-bis(2-
(Ausubel et
hydroxyethyl)-2- al.,
1987).
aminoethanesulfonic
acid) buffered solution
(Ishiura et al.,
1982
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-80-
Table E Methods to introduce nucleic acid into cells
Cells Methods References Notes
Most useful
for
transient,
but not
stable,
Diethylaminoethyl(Fujita et al., transfections
1986;
.
(DEAE)-DextranLopata et al., 1984;
Chloroquine
can
transfection Selden et al., 1986)be used to
increase
efficiency.
(Neumann et al., Especially
1982; useful
ElectroporationPotter, 1988; Potterfor hard-to-
et
al., 1984; Wong transfect
and
Neumann, 1982) lymphoc tes.
Cationic lipid(Elroy-Stein and Applicable
Moss, to
1990; Felgner et both in vivo
reagent al., and
1 gg7; Rose et al.,in vitro
transfection 1991;
Whitt et al., 1990)transfection.
Production exemplified
by (Cepko et al.,
1984;
Miller and Buttimore,Lengthy process,
1986; Pear et al., many packaging
1993)
Infection in vitro lines available
and in at
Retroviral vivo: (Austin and ATCC.
Cepko, 1990; BodineApplicable
et to
al., 1991; Fekete both in vivo
and and
Cepko, 1993; Lemischkain vitro
et al., 1986; Turnertransfection.
et
al., 1990; Williams
et al.,
1984)
(Chaney et al.,
1986;
Polybrene Kawai and Nishizawa,.
1984
Can be used
to
establish cell
Microinjection(Capecchi, 1980) lines carrying
integrated
copies
of IF1206 DNA
se uences.
(Rassoulzadegan
et al.,
Protoplast 1 g82; Sandri-Goldin
fusion et
al., 1981; Schaffner,
1980
(Luckow, 1991; Miller,Useful for
Insect Baculovirus in vitro
cells
lggg; O'Reilly et production
(in vitro)systems al., of
1 g92
proteins with
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
_81 _
Table E Methods to introduce nucleic acid into cells
Cells Methods References Notes
eukaryotic
modifications.
Electroporation(Becker and Guarente,
1991 )
Lithium acetate(Gietz et al., 1998;
Ito et
Yeast al., 1983)
Spheroplast (Beggs Laborious,
1978; Hinnen et can
fusion , produce
1978)
al.
, aneu loids.
(Bechtold and Pelletier,
Agrobacterium 1998; Escudero and
transformationHohn, 1997; Hansen
and Chilton, 1999;
Touraev and al.,
1997)
Biolistics (Finer et al., 1999;
(microprojectiles)Hansen and Chilton,
1999; Shillito,
1999
(Fromm et al., 1985;
Ou-
Lee et al., 1986;
Rhodes
Plant cellsElectroporationet al., 1988; Saunders
et
(general (protoplasts) al., 1989)
reference: May be combined
with
liposomes (Trick
(Hansen and al.,
and
1997)
W
h
rig
t,
polyethylene
1999))
glycol (PEG) (Shillito, 1999)
treatment
May be combined
with
Liposomes electroporation
(Trick
and al., 1997
in plants (Leduc and al.,
1996;
microin'ectionZhou and al., 1983
Seed imbibition(Trick and al.,
1997)
Laser beam (Hoffman, 1996
Silicon carbide(Thompson and al.,
whiskers 1995)
Vectors often use a selectable marker to facilitate identifying those
cells that have incorporated the vector. Many selectable markers are well
known in the art for the use with prokaryotes, usually antibiotio-resistance
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
_82_
genes or the use of autotrophy and auxotrophy mutants. Table F lists often-
used selectable markers for mammalian cell transfection.
Table F Useful selectable markers for eukaryote cell transfection
Selection Reference
Selectable Marker Action
Conversion
of Xyl-
Media includes A to Xyl-ATP, (Kaufman
9-Vii-
Adenosine D-xylofuranosyl which incorporateset al.,
deaminase (ADA) adenine (Xyl-A) into nucleic 1 gg6)
acids,
killing cells.
ADA
detoxifies
MTX competitive
inhibitor of
DHFR.
In absence (Simonsen
of
Methotrexate exogenous
Dihydrofolate (MTX) and
reductase (DHFR)and dialyzed purines, cellsLevinson,
serum
(purine-free require DHFR, 1 gg3)
media) a
necessary enzyme
in purine
biosynthesis.
6418, an
aminoglycoside
Aminoglycoside
detoxified (Southern
phosphotransferase by APH,
6418 interferes and Berg,
("APH" with
"neo"
, ribosomal function1982)
,
"G418")
and consequently,
translation.
Hygromycin-B,
an
aminocyclitol
Hygromycin-B- detoxified
by HPH, (Palmer
et
phosphotransferasehygromycin-B disrupts protein1987)
al.
(HPH) translocation ,
and
promotes
mistranslation.
Forward selectionForward:
(TK+): Media Aminopterin
(HAT) forces
incorporates cells to synthesze
Thymidine kinaseaminopterin. dTTP from (Littlefield
,
(TK) Reverse selectionthymidine, 1 g64)
a
(TK-): Media pathway requiring
incorporates TK.
5-
bromodeoxyuridineReverse: TK
(BrdU). phosphorylates
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-83-
Table F Useful selectable markers for eukaryote cell transfection
Selection Reference
Selectable Marker Action
BrdU, which
incorporates
into
nucleic acids,
killing cells.
A host cell of the invention, such as a prokaryotic or eukaryotic host
cell in culture, can be used to produce IF1206. Accordingly, the invention
provides methods for producing IF1206 using the host cells of the invention.
In one embodiment, the method comprises culturing the host cell of the
invention (into which a recombinant expression vector encoding IF1206 has
been introduced) in a suitable medium, such that IF1206 is produced. In
another embodiment, the method further comprises isolating IF1206 from the
medium or the host cell.
Transgenic IF1206 animals
Transgenic animals are useful for studying the function andlor activity
of IFI206 and for identifying and/or evaluating modulators of IF1206 activity.
"Transgenic animals" are non-human animals, preferably mammals, more
preferably a rodents such as rats or mice, in which one or more of the cells
include a transgene. Other transgenic animals include primates, sheep, dogs,
cows, goats, chickens, amphibians, etc. A "transgene" is exogenous DNA
that is integrated into the genome of a cell from which a transgenic animal
develops, and that remains in the genome of the mature animal. Transgenes
preferably direct the expression of an encoded gene product in one or more
cell types or tissues of the transgenic animal with the purpose of preventing
expression of a naturally encoded gene product in one or more cell types or
tissues (a "knockout" transgenic animal), or serving as a marker or indicator
of an integration, chromosomal location, or region of recombination (e.g.
crelloxP mice). A "homologous recombinant animal" is a non-human animal,
such as a rodent, in which endogenous IFI206 has been altered by an
exogenous DNA molecule that recombines homologously with endogenous
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-84-
IF1206 in a (e.g. embryonic) cell prior to development the animal. Host cells
with exogenous IF1206 can be used to produce non-human transgenic
animals, such as fertilized oocytes or embryonic stem cells into which IFI206-
coding sequences have been introduced. Such host cells can then be used to
create non-human transgenic animals or homologous recombinant animals.
1. Approaches to transgenic animal production
A transgenic animal can be created by introducing IFI206 into the male
pronuclei of a fertilized oocyte (e.g., by microinjection, retroviral
infection) and
allowing the oocyte to develop in a pseudopregnant female foster animal
(pffa). The IFI206 cDNA sequences.(SEQ ID N0:1) can be introduced as a
transgene into the genome of a non-human animal. Alternatively, a
homologue of IF1206, such as the naturally-occuring variant of IF1206 (SEQ ID
N0:3), can be used as a transgene. Intronic sequences and polyadenylation
signals can also be included in the transgene to increase transgene
expression. Tissue-specific regulatory sequences can be operably-linked to
the IFI206 transgene to direct expression of IFI206 to particular cells.
Methods for generating transgenic animals via embryo manipulation and
microinjection, particularly animals such as mice, have become conventional
in the art, e.g. (Evans et al., U.S. Patent No. 4,870,009, 1989; Hogan,
0879693843, 1994; Leder and Stewart, U.S. Patent No. 4,736,866, 1988;
Wagner and Hoppe, US Patent No. 4,873,191, 1989). Other non-mice
transgenic animals may be made by similar methods. A transgenic founder
animal, which can be used to breed additional transgenic animals, can be
identified based upon the presence of the transgene in its genome and/or
expression of the transgene mRNA in tissues or cells of the animals.
Transgenic (e.g. IFI206) animals can be bred to other transgenic animals
carrying other transgenes.
2. Vectors for transgenic animal production
To create a homologous recombinant animal, a vector containing at
least a portion of IFI206 into which a deletion, addition or substitution has
been introduced to thereby alter, e.g., functionally disrupt, IFI206. 1F1206
can
be a murine gene (SEQ ID N0:1 ), or other IFI206 homologue, such as the
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-85-
naturally occurring variant (SEQ ID N0:3). In one approach, a knockout
vector functionally disrupts the endogenous IFI206 gene upon homologous
recombination, and thus a non-functional IF1206 protein, if any, is expressed.
Alternatively, the vector can be designed such that, upon homologous
recombination, the endogenous IFI206 is mutated or otherwise altered but still
encodes functional protein (e.g., the upstream regulatory region can be
altered to thereby alter the expression of endogenous IF1206). In this type of
homologous recombination vector, the altered portion of the IFI206 is flanked
at its 5'- and 3'-termini by additional nucleic acid of the IFI206 to allow
for
homologous recombination to occur between the exogenous IFI206 carried by
the vector and an endogenous IFI206 in an embryonic stem cell. The
additional flanking IF1206 nucleic acid is sufficient to engender homologous .
recombination with endogenous IF1206. Typically, several kilobases of
flanking DNA (both at the 5'- and 3'-termini) are included in the vector
(Thomas and Capecchi, 1987). The vector is then introduced into an
embryonic stem cell line (e.g., by electroporation), and cells in which the
introduced IF1206 has homologously-recombined with the endogenous IFI206
are selected (Li et al., 1992).
3. Introduction of IF1206 transgene cells during development
Selected cells are then injected into a blastocyst of an animal (e.g., a
mouse) to form aggregation chimeras (Bradley, 1987). A chimeric embryo
can then be implanted into a suitable pffa and the embryo brought to term.
Progeny harboring the homologously-recombined DNA in their germ cells can
be used to breed animals in which all cells of the animal contain the
homologously-recombined DNA by germline transmission of the transgene.
Methods for constructing homologous recombination vectors and homologous
recombinant animals are described (Berns et al., WO 93/04169, 1993;
Bradley, 1991; Kucherlapati et al., WO 91 /01140, 1991; Le Mouellic and
Brullet, WO 90/11354, 1990).
Alternatively, transgenic animals that contain selected systems that
allow for regulated expression of the transgene can be produced. An
example of such a system is the crelloxP recombinase system of
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-86-
bacteriophage P1 (Lakso et al., 1992). Another recombinase system is the
FLP recombinase system of Saccharomyces cerevisiae (O'Gorman et al.,
1991 ). If a crelloxP recombinase system is used to regulate expression of the
transgene, animals containing transgenes encoding both the Cre
recombinase and a selected protein are required. Such animals can be
produced as "double" transgenic animals, by mating an animal containing a
transgene encoding a selected protein to another containing a transgene
encoding a recombinase.
Clones of transgenic animals can also be produced (Wilmut et al.,
1997). In brief, a cell from a transgenic animal can be isolated and induced
to
exit the growth cycle and enter Go phase. The quiescent cell can then be
fused to an enucleated oocyte from an animal of the same species from which
the quiescent cell is isolated. The reconstructed oocyte is then cultured to
develop to a morula or blastocyte and then transferred to a pffa. The
offspring
borne of this female foster animal will be a clone of the "parent" transgenic
animal.
Pharmaceutical compositions
The IFI206 nucleic acid molecules, IF1206 polypeptides, and anti-
IF1206 Abs (active compounds) of the invention, and derivatives, fragments,
analogs and homologs thereof, can be incorporated into pharmaceutical
compositions. Such compositions typically comprise the nucleic acid
molecule, protein, or antibody and a pharmaceutically acceptable carrier. A
"pharmaceutically acceptable carrier" includes any and all solvents,
dispersion
media, coatings, antibacterial and antifungal agents, isotonic and absorption
delaying agents, and the like, compatible with pharmaceutical administration
(Gennaro, 2000). Preferred examples of such carriers or diluents include, but
are not limited to, water, saline, finger's solutions, dextrose solution, and
5%
human serum albumin. Liposomes and non-aqueous vehicles such as fixed
oils may also be used. Except when a conventional media or agent is
incompatible with an active compound, use of these compositions is
contemplated. Supplementary active compounds can also be incorporated ,
into the compositions.
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
_87_
1. General considerations
A pharmaceutical composition of the invention is formulated to be
compatible with its intended route of administration, including intravenous,
intradermal, subcutaneous, oral (e.g., inhalation), transdermal (i.e.,
topical),
transmucosal, and rectal administration. Solutions or suspensions used for
parenteral, intradermal, or subcutaneous application can include: a sterile
diluent such as water for injection, saline solution, fixed oils, polyethylene
glycols, glycerine, propylene glycol or other synthetic solvents;
antibacterial
agents such as benzyl alcohol or methyl parabens; antioxidants such as
ascorbic acid or sodium bisulfite; chelating agents such as
ethylenediaminetetraacetic acid (EDTA); buffers such as acetates, citrates or
phosphates, and agents for the adjustment of tonicity such as sodium chloride
or dextrose. The pH can be adjusted with acids or bases, such as
hydrochloric acid or sodium hydroxide. The parenteral preparation can be
enclosed in ampoules, disposable syringes or multiple dose vials made of
glass or plastic.
2. Injectable formulations
Pharmaceutical compositions suitable for injection include sterile
aqueous solutions (where water soluble) or dispersions and sterile powders
for the extemporaneous preparation of sterile injectable solutions or
dispersion. For intravenous administration, suitable carriers include
physiological saline, bacteriostatic water, CREMOPHOR EL~° (BASF,
Parsippany, N.J.) or phosphate buffered saline (PBS). In all cases, the
composition must be sterile and should be fluid so as to be administered
using a syringe. Such compositions should be stable during manufacture and
storage and must be preserved against contamination from microorganisms
such as bacteria and fungi. The carrier can be a solvent or dispersion
medium containing, for example, water, ethanol, polyol (such as glycerol,
propylene glycol, and liquid polyethylene glycol), and suitable mixtures.
Proper fluidity can be maintained, for example, by using a coating such as
lecithin, by maintaining the required particle size in the case of dispersion
and
by using surfactants. Various antibacterial and antifungal agents, for
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
_88_
example, parabens, chlorobutanol, phenol, ascorbic acid, and thimerosal, can
contain microorganism contamination. Isotonic agents, for example, sugars,
polyalcohols such as manitol, sorbitol, and sodium chloride can be included in
the composition. Compositions that can delay absorption include agents such
as aluminum monostearate and gelatin.
Sterile injectable solutions can be prepared by incorporating the active
compound (e.g., an IF1206 or anti-IF1206 antibody) in the required amount in
an appropriate solvent with one or a combination of ingredients as required,
followed by sterilization. Generally, dispersions are prepared by
incorporating
the active compound into a sterile vehicle that contains a basic dispersion
medium, and the other required ingredients as discussed. Sterile powders for
the preparation of sterile injectable solutions, methods of preparation
include
vacuum drying and freeze-drying that yield a powder containing the active
ingredient and any desired ingredient from a sterile solutions.
3. Oral compositions
Oral compositions generally include an inert diluent or an edible carrier.
They can be enclosed in gelatin capsules or compressed into tablets. For the
purpose of oral therapeutic administration, the active compound can be
incorporated with excipients aid used in the form of tablets, troches, or
capsules. Oral compositions can also be prepared using a fluid carrier for use
as a mouthwash, wherein the compound in the fluid carrier is applied orally.
Pharmaceutically compatible binding agents, and/or adjuvant materials can be
included. Tablets, pills, capsules, troches and the like can contain any of
the
following ingredients, or compounds of a similar nature: a binder such as
microcrystalline cellulose, gum tragacanth or gelatin; an excipient such as
starch or lactose, a disintegrating agent such as alginic acid, PRIMOGEL, or
corn starch; a lubricant such as magnesium stearate or STEROTES; a glidant
such as colloidal silicon dioxide; a sweetening agent such as sucrose or
saccharin; or a flavoring agent such as peppermint, methyl salicylate, or
orange flavoring.
4. Compositions for inhalation
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
_89_
For administration by inhalation, the compounds are delivered as an
aerosol spray from a a nebulizer or a pressurized container that contains a
suitable propellant, e.g., a gas such as carbon dioxide.
5. Systemic administration
Systemic administration can also be transmucosal or transdermal. For
transmucosal or transdermal administration, penetrants that can permeate the
target barriers) are selected. Transmucosal penetrants include, detergents,
bile salts, and fusidic acid derivatives. Nasal sprays or suppositories can be
used for transmucosal administration. For transdermal administration, the
active compounds are formulated into ointments, salves, gels, or creams.
The compounds can also be prepared in the form of suppositories
(e.g., with bases such as cocoa butter and other glycerides) or retention
enemas for rectal delivery.
6. Carriers
In one embodiment, the active compounds are prepared with carriers
that protect the compound against rapid elimination from the body, such as a
controlled release formulation, including implants and microencapsulated
delivery systems. Biodegradable, biocompatible polymers can be used, such
as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen,
polyorthoesters, and polylactic acid. Such materials can be obtained
commercially from ALZA Corporation (Mountain View, CA) and NOVA
Pharmaceuticals, Inc. (Lake Elsinore, CA), or prepared by one of skill in the
art. Liposomal suspensions can also be used as pharmaceutically acceptable
carriers. These can be prepared according to methods known to those skilled
in the art, such as in (Eppstein et al., US Patent No. 4,522,811, 1985).
7. Unit dosage
Oral formulations or parenteral compositions in unit dosage form can
be created to facilitate administration and dosage uniformity. Unit dosage
form refers to physically discrete units suited as single dosages for the
subject
to be treated, containing a therapeutically effective quantity of active
compound in association with the required pharmaceutical carrier. The
specification for the unit dosage forms of the invention are dictated by, and
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-90-
directly dependent on, the unique characteristics of the active compound and
the particular desired therapeutic effect, and the inherent limitations of
compounding the active compound.
8. Gene therapy compositions
The nucleic acid molecules of the invention can be inserted into vectors
and used as gene therapy vectors. Gene therapy vectors can be delivered to
a subject by, for example, intravenous injection, local administration (Nabel
and Nabel, US Patent No. 5,328,470, 1994), or by stereotactic injection (Chen
et al., 1994). The pharmaceutical preparation of a gene therapy vector can
include an acceptable diluent, or can comprise a slow release matrix in which
the gene delivery vehicle is imbedded. Alternatively, where the complete
gene delivery vector can be produced intact from recombinant cells, e.g.,
retroviral vectors, the pharmaceutical preparation can include one or more
cells that produce the gene delivery system.
9. Kits for pharmaceutical compositions
The pharmaceutical compositions can be included in a kit, container,
pack, or dispenser together with instructions for administration. When the
invention is supplied as a kit, the different components of the composition
may
be packaged in separate containers and admixed immediately before use.
Such packaging of the components separately may permit long-term storage
without losing the active components' functions.
Kits may also include reagents in separate containers that facilitate the
execution of a specific test, such as diagnostic tests or tissue typing. For
example, IFI206 DNA templates and suitable primers may be supplied for
. internal controls.
(a) Containers or vessels
The reagents included in the kits can be supplied in containers of any
sort such that the life of the different components are preserved, and are not
adsorbed or altered by the materials of the container. For example, sealed
glass ampules may contain lyophilized luciferase or buffer that have been
packaged under a neutral, non-reacting gas, such as nitrogen. Ampoules
may consist of any suitable material, such as glass, organic polymers, such
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-91-
as polycarbonate, polystyrene, etc., ceramic, metal or any other material
typically employed to hold reagents. Other examples of suitable containers
include simple bottles that may be fabricated from similar substances as
ampules, and envelopes, that may consist of foil-lined interiors, such as
aluminum or an alloy. Other containers include test tubes, vials, flasks,
bottles, syringes, or the like. Containers may have a sterile access port,
such
as a bottle having a stopper that can be pierced by a hypodermic injection
needle. Other containers may have two compartments that are separated by
a readily removable membrane that upon removal permits the components to
mix. Removable membranes may be glass, plastic, rubber, etc.
(b) Instructional materials
Kits may also be supplied with instructional materials. Instructions may
be printed on paper or other substrate, and/or may be supplied as an
electronic-readable medium, such as a floppy disc, CD-ROM, DVD-ROM, Zip
disc, video tape, audio tape, etc. Detailed instructions may not be physically
associated with the kit; instead, a user may be directed to an Internet web
site
specified by the manufacturer or distributor of the kit, or supplied as
electronic
mail.
Screening and detection methods
The isolated nucleic acid molecules of the invention can be used to
express IF1206 (e.g., via a recombinant expression vector in a host cell in
gene therapy applications), to detect IFI206 mRNA (e.g., in a biological
sample) or a genetic lesion in an IFI206, and to modulate IF1206 activity, as
described below. In addition, IF1206 polypeptides can be used to screen
drugs or compounds that modulate the IF1206 activity or expression as well as
to treat disorders characterized by insufficient or excessive production of
IF1206 or production of IF1206 forms that have decreased or aberrant activity
compared to IF1206 wild-type protein, or modulate biological function that
involve IF1206 (e.g. obesity). In addition, the anti-IF1206 Abs of the
invention
can be used to detect and isolate IF1206 and modulate IF1206 activity.
1. Screening assays
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-92-
The invention provides a method (screening assay) for identifying
modalities, i.e., candidate or test compounds or agents (e.g., peptides,
peptidomimetics, small molecules or other drugs), foods, combinations
thereof, etc., that effect IF1206, a stimulatory or inhibitory effect,
inlcuding
translation, transcription, activity or copies of the gene in cells. The
invention
also includes compounds identified in screening assays.
Testing for compounds that increase or decrease IF1206 activity are
desirable. A compound may modulate IF1206 activity by affecting: (1 ) the
number of copies of the gene in the cell (amplifiers and deamplifiers); (2)
increasing or decreasing transcription of the IFI206 (transcription up-
regulators and down-regulators); (3) by increasing or decreasing the
translation of IFI206 mRNA into protein (translation up-regulators and down-
regulators); or (4) by increasing or decreasing the activity of IF1206 itself
(agonists and antagonists).
(a) effects of compounds
To identify compounds that affect IF1206 at the DNA, RNA and protein
levels, cells or organisms are contacted\ with a candidate compound and the
corresponding change in IF1206 DNA, RNA or protein is assessed (Ausubel et
al., 1987). For DNA amplifiers and deamplifiers, the amount of IFI206 DNA is
measured, for those compounds that are transcription up-regulators and
down-regulators the amount of IF1206 mRNA is determined; for translational
up- and down-regulators, the amount of IF1206 polypeptides is measured.
Compounds that are agonists or antagonists may be identified by contacting
cells or organisms with the compound, and then measuring, for example,
adipocyte differentiation in vitro.
In one embodiment, many assays for screening candidate or test
compounds that bind to or modulate the activity of IFI206 or polypeptide or
biologically-active portion are available. Ttest compounds can be obtained
using any of the numerous approaches in combinatorial library methods,
including: biological libraries; spatially addressable parallel solid phase or
solution phase libraries; synthetic library methods requiring deconvolution;
the
"one-bead one-compound" library method; and synthetic library methods
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-93-
using affinity chromatography selection. The biological library approach is
limited to peptides, while the other four approaches encompass peptide,
non-peptide oligomer or small molecule libraries of compounds (Lam, 1997).
(b) small molecules
A "small molecule" refers to a composition that has a molecular weight
of less than about 5 kD and most preferably less than about 4 kD. Small
molecules can be, nucleic acids, peptides, polypeptides, peptidomimetics,
carbohydrates, lipids or other organic or inorganic molecules. Libraries of
chemical and/or biological mixtures, such as fungal, bacterial, or algal
extracts, are known in the art and can be screened with any of the assays of
the invention. Examples of methods for the synthesis of molecular libraries
can be found in: (Carell et al., 1994x; Carell et al., 1994b; Cho et al.,
1993;
DeWitt et al., 1993; Gallop et al., 1994; Zuckermann et al., 1994).
Libraries of compounds may be presented in solution (Houghten et al.,
1992) or on beads (Lam et al., 1991 ), on chips (Fodor et al., 1993),
bacteria,
spores (Ladner et al., US Patent No. 5,223,409, 1993), plasmids (Cull et al.,
1992) or on phage (Cwirla et al., 1990; Devlin et al., 1990; Felici et al.,
1991;
Ladner et al., US Patent No. 5,223,409, 1993; Scott and Smith, 1990). A cell-
free assay comprises contacting IF1206 or biologically-active fragment with a
known compound that binds IF1206 to form an assay mixture, contacting the
assay mixture with a test compound, and determining the ability of the test
compound to interact with IF1206, where determining the ability of the test
compound to interact with IF1206 comprises determining the ability of the
IF1206 to preferentially bind to or modulate the activity of an IFI206 target
molecule.
(c) cell-free assays
The cell-free assays of the invention may be used with both soluble or
a membrane-bound forms of IF1206. In the case of cell-free assays
comprising the membrane-bound form, a solubilizing agent to maintain IF1206
in solution. Examples of such solubilizing agents include non-ionic detergents
such as n-octylglucoside, n-dodecylglucoside, n-dodecylmaltoside, octanoyl-
N-methylglucamide, decanoyl-N-methylglucamide, TRITON~ X-100 and
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-94-
others from the TRITON~ series, THESIT~, Isotridecypoly(ethylene glycol
ether)n, N-dodecyl--N,N-dimethyl-3-ammonio-1-propane sulfonate, 3-(3-
cholamidopropyl) dimethylamminiol-1-propane sulfonate (CHAPS), or 3-(3-
cholamidopropyl)dimethylamminiol-2-hydroxy-1-propane sulfonate
(CHAPSO).
(d) immobilization of target molecules to facilitate screening
In more than one embodiment of the assay methods, immobilizing
either IF1206 or its partner molecules can facilitate separation of complexed
from uncomplexed forms of one or both of the proteins, as well as to
accommodate high throughput assays. Binding of a test compound to IF1206,
or interaction of IF1206 with a target molecule in the presence and absence of
a candidate compound, can be accomplished in any vessel suitable for
containing the reactants, such as microtiter plates, test tubes, and
micro-centrifuge tubes. A fusion protein can be provided that adds a domain .
that allows one or both of the proteins to be bound to a matrix. For example,
GST-IF1206 fusion proteins or GST-target fusion proteins can be adsorbed
onto glutathione sepharose beads (SIGMA Chemical, St. Louis, MO) or
glutathione derivatized microtiter plates that are then combined with the test
compound or the test compound and either the non-adsorbed target protein or
IF1206, and the mixture is incubated under conditions conducive to complex
formation (e.g., at physiological conditions for salt and pH). Following
incubation, the beads or microtiter plate wells are washed to remove any
unbound components, the matrix immobilized in the case of beads, complex
determined either directly or indirectly, for example, as described.
Alternatively, the complexes can be dissociated from the matrix, and the level
of IF1206 binding or activity determined using standard techniques.
Other techniques for immobilizing proteins on matrices can also be
used in screening assays. Either IF1206 or its target molecule can be
immobilized using biotin-avidin or biotin-streptavidin systems. Biotinylation
can be accomplished using many reagents, such as biotin-NHS
(N-hydroxy-succinimide; PIERCE Chemicals, Rockford, IL), and immobilized
in wells of streptavidin-coated 96 well plates (PIERCE Chemical).
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-95-
Alternatively, Abs reactive with I F1206 or target molecules, but which do not
interfere with binding of the IF1206 to its target molecule, can be
derivatized to
the wells of the plate, and unbound target or IF1206 trapped in the wells by
antibody conjugation. Methods for detecting such complexes, in addition to
those described for the GST-immobilized complexes, include
immunodetection of complexes using Abs reactive with IF1206 or its target, as
well as enzyme-linked assays that rely on detecting an enzymatic activity
associated with the IF1206 or target molecule.
(e) scn?ens to identify modulators
Modulators of IF1206 expression can be identified in a method where a
cell is contacted with a candidate compound and the expression of IF1206
mRNA or protein in the cell is determined. The expression level of IFI206
mRNA or protein in the presence of the candidate compound is compared to
IF1206 mRNA or protein levels in the absence of the candidate compound.
The candidate compound can then be identified as a modulator of IF1206
mRNA or protein expression based upon this comparison. For example,
when expression of IF1206 mRNA or protein is greater (i.e., statistically ,
significant) in the presence of the candidate compound than in its absence,
the candidate compound is identified as a stimulator of IF1206 mRNA or
protein expression. Alternatively, when expression of IF1206 mRNA or protein
is less (statistically significant) in the presence of the candidate compound
than in its absence, the candidate compound is identified as an inhibitor of
IF1206 mRNA or protein expression. The level of IF1206 mRNA or protein
expression in the cells can be determined by methods described for detecting
IF1206 mRNA or protein.
(i) hybrid assays
In yet another aspect of the invention, IF1206 can be used as "bait" in
two-hybrid or three hybrid assays [Saifer, 1994 #38; Zervos, 1993 #382;
Madura, 1993 #383; Bartel, 1993 #384; Iwabuchi, 1993 #385; Brent, 1994
#386] to identify other proteins that bind or interact with IF1206 (F1206-
binding
proteins (IF1206-bps)) and modulate IF1206 activity. Such IF1206-bps are also
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-96-
likely to be involved in the propagation of signals by the IF1206 as, for
example, upstream or downstream elements of an IF1206 pathway.
The two-hybrid system is based on the modular nature of most
transcription factors, which consist of separable DNA-binding and activation
domains. Briefly, the assay utilizes two different DNA constructs. In one
construct, the gene that codes for IF1206 is fused to a gene encoding the DNA
binding domain of a known transcription factor (e.g., GAL4). The other '
construct, a DNA sequence from a library of DNA sequences that encodes an
unidentified protein ("prey" or "sample") is fused to a gene that codes for
the
activation domain of the known transcription factor. If the "bait" and the
"prey"
proteins are able to interact in vivo, forming an IF1206-dependent complex,
the DNA-binding and activation domains of the transcription factor are brought
into close proximity. This proximity allows transcription of a reporter gene
(e.g., LacZ) that is operably-linked to a transcriptional regulatory site
responsive to the transcription factor. Expression of the reporter gene can be
detected, and cell colonies containing the functional transcription factor can
be isolated and used to obtain the cloned gene that encodes the IF1206-
interacting protein.
The invention further pertains to novel agents identified by the
aforementioned screening assays and uses thereof for treatments as
described herein.
2. Detection assays
Portions or fragments of IFI206 cDNA sequences identified herein (and
the complete IFI206 gene sequences) are useful in themselves. By way of
non-limiting example, these sequences can be used to: (1 ) identify an
individual from a minute biological sample (tissue typing); and (2) aid in
forensic identification of a biological sample.
(a) Tissue typing
The IF1206 sequences of the invention can be used to identify
individuals from minute biological samples. In this technique, an individual's
genomic DNA is digested with one or more restriction enzymes and probed on
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
_97_
a Southern blot to yield unique bands. The sequences of the invention are
useful as additional DNA markers for "restriction fragment length
polymorphisms" (RFLP; (Smulson et al., US Patent No. 5,272,057, 1993)).
Furthermore, the IFI206 sequences can be used to determine the
actual base-by-base DNA sequence of targeted portions of an individual's
genome. 1F1206 sequences can be used to prepare two PCR primers from
the 5'- and 3'-termini of the sequences that can then be used to amplify an
the
corresponding sequences from an individual's genome and then sequence the
amplified fragment.
Panels of corresponding DNA sequences from individuals can provide .
unique individual identifications, as each individual will have a unique set
of
such DNA sequences due to allelic differences. The sequences of the
invention can be used to obtain such identification sequences from individuals
and from tissue. The IFI206 sequences of the invention uniquely represent
portions of an individual's genome. Allelic variation occurs to some degree in
the coding regions of these sequences, and to a greater degree in the
noncoding regions. The allelic variation between individual humans occurs
with a frequency of about once ever 500 bases. Much of the allelic variation
is due to single nucleotide polymorphisms (SNPs), which include RFLPs.
Each of the sequences described herein can, to some degree, be used
as a standard against which DNA from an individual can be compared for
identification purposes. Because greater numbers of polymorphisms occur in
noncoding regions, fewer sequences are necessary to differentiate
individuals. Noncoding sequences can positively identify individuals with a '
panel of 10 to 1,000 primers that each yield a noncoding amplified sequence
of 100 bases. If predicted coding sequences, such as those in SEQ ID NOS:1
or 3 are used, a more appropriate number of primers for positive individual
identification would be 500-2,000.
Predictive medicine
The invention also pertains to the field of predictive medicine in which
diagnostic assays, prognostic assays, pharmacogenomics, and monitoring
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
_98_
clinical trials are used for prognostic (predictive) purposes to treat an
individual prophylactically. Accordingly, one aspect of the invention relates
to
diagnostic assays for determining IF1206 and/or nucleic acid expression as
well as IF1206 activity, in the context of a biological sample (e.g., blood,
serum, cells, tissue) to determine whether an individual is afflicted with a
disease or disorder, or is at risk of developing a disorder, associated with
aberrant IF1206 expression or activity, including obesity. The invention also
provides for prognostic (or predictive) assays for determining whether an
individual is at risk of developing a disorder associated with IF1206, nucleic
acid expression or activity. For example, mutations in IFI206 can be assayed
in a biological sample. Such assays can be used for prognostic or predictive
purpose to prophylactically treat an individual prior to the onset of a
disorder
characterized by or associated with IF1206, nucleic acid expression, or
biological activity.
Another aspect of the invention provides methods for determining
IF1206 activity, or nucleic acid expression, in an individual to select
appropriate therapeutic or prophylactic agents for that individual (referred
to
herein as "pharmacogenomics"). Pharmacogenomics allows for the selection
of modalities (e.g., drugs, foods) for therapeutic or prophylactic treatment
of
an individual based on the individual's genotype (e.g., the individual's
genotype to determine the individual's ability to respond to a particular
agent).
Another aspect of the invention pertains to monitoring the influence of
modalities (e.g., drugs, foods) on the expression or activity of IF1206 in
clinical
trials.
1. Diagnostic assays
An exemplary method for detecting the presence or absence of IF1206
in a biological sample involves obtaining a biological sample from a subject
and contacting the biological sample with a compound or an agent capable of
detecting IF1206 or IFI206 nucleic acid (e.g., mRNA, genomic DNA) such that
the presence of IF1206 is confirmed in the sample. An agent for detecting
IFI206 mRNA or genomic DNA is a labeled nucleic acid probe that can
hybridize to IFI206 mRNA or genomic DNA. The nucleic acid probe can be,
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
_99_
for example, a full-length IF1206 nucleic acid, such as the nucleic acid of
SEQ
ID NOS: 1 or 3, or a portion thereof, such as an oligonucleotide of at least
15,
30, 50, 100, 250 or 500 nucleotides in length and sufficient to specifically
hybridize under stringent conditions to IFI206 mRNA or genomic DNA.
An agent for detecting IF1206 polypeptide is an antibody capable of
binding to IF1206, preferably an antibody with a detectable label. Abs can be
polyclonal, or more preferably, monoclonal. An intact antibody, or a fragment
(e.g., Fab or F(ab')2) can be used. A labeled probe or antibody is coupled
(i.e.,
physically linking) to a detectable substance, as well as indirect detection
of
the probe or antibody by reactivity with another reagent that is directly
labeled.
Examples of indirect labeling include detection of a primary antibody using a
fluorescently-labeled secondary antibody and end-labeling of a DNA probe
with biotin such that it can be detected with fluorescently-labeled
streptavidin.
The term "biological sample" includes tissues, cells and biological fluids
isolated from a subject, as well as tissues, cells and fluids present within a
subject. The detection method of the invention can be used to detect IFI206
mRNA, protein, or genomic DNA in a biological sample in vitro as well as in
vivo. For example, in vitro techniques for detection of IFI206 mRNA include
Northern hybridizations and in situ hybridizations. In vitro techniques for
detection of IF1206 polypeptide include enzyme linked immunosorbent assays
(ELISAs), Western blots, immunoprecipitations, and immunofluorescence. In
vitro techniques for detection of IFI206 genomic DNA include Southern
hybridizations and fluorescence in situ hybridization (FISH). Furthermore, in
vivo techniques for detecting IF1206 include introducing into a subject a
labeled anti-IF1206 antibody. For example, the antibody can be labeled with a
radioactive marker whose presence and location in a subject can be detected
by standard imaging techniques.
In one embodiment, the biological sample from the subject contains
protein molecules, and/or mRNA molecules, and/or genomic DNA molecules.
A prefen-ed biological sample is blood.
In another embodiment, the methods further involve obtaining a
biological sample from a subject to provide a control, contacting the sample
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-100-
with a compound or agent to detect IFI206, mRNA, or genomic DNA, and
comparing the presence of IFI206, mRNA or genomic DNA in the control
sample with the presence of IF1206, mRNA or genomic DNA in the test
sample.
The invention also encompasses kits for detecting IF1206 in a biological
sample. For example, the kit can comprise: a labeled compound or agent
capable of detecting IF1206 or IFI206 mRNA in a sample; reagent and/or
equipment for determining the amount of IF1206 in the sample; and reagent
and/or equipment for comparing the amount of IF1206 in the sample with a
standard. The compound or agent can be packaged in a suitable container.
The kit can further comprise instructions for using the kit to detect IF1206
or
nucleic acid.
2. Prognostic assays
The diagnostic methods described herein can furthermore be utilized to
identify subjects having or at risk of developing a disease or disorder
associated with aberrant IF1206 expression or activity. For example, the
assays described herein, can be used to identify a subject having or at risk
of
developing a disorder associated with IF1206, nucleic acid expression or
activity. Alternatively, the prognostic assays can be used to identify a
subject
having or at risk for developing a disease or disorder. Tthe invention
provides
a method for identifying a disease or disorder associated with aberrant
IF1206~
expression or activity in which a test sample is obtained from a subject and
IF1206 or nucleic acid (e.g., mRNA, genomic DNA) is detected. A test sample
is a biological sample obtained from a subject. For example, a test sample
can be a biological fluid (e.g., serum), cell sample, or tissue.
Pognostic assays can be used to determine whether a subject can be
administered a modality (e.g., an agonist, antagonist, peptidomimetic,
protein,
peptide, nucleic acid, small molecule, food, etc.) to treat a disease or
disorder
associated with aberrant IF1206 expression or activity. Such methods can be
used to determine whether a subject can be effectively treated with an agent
for a disorder. The invention provides methods for determining whether a
subject can be effectively treated with an agent for a disorder associated
with
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-101-
aberrant IF1206 expression or activity in which a test sample is obtained and
IF1206 or nucleic acid is detected (e.g., where the presence of IF1206 or
nucleic acid is diagnostic for a subject that can be administered the agent to
treat a disorder associated with aberrant IFI206 expression or activity).
The methods of the invention can also be used to detect genetic
lesions in an IFI206 to determine if a subject with the genetic lesion is at
risk
for a disorder characterized by aberrant cell proliferation, differentiation
or
obesity. Methods include detecting, in a sample from the subject, the
presence or absence of a genetic lesion_characterized by at an alteration
affecting the integrity of a gene encoding an IF1206 polypeptide, or the mis-
'
expression of IFI206. Such genetic lesions can be detected by ascertaining:
(1 ) a deletion of one or more nucleotides from IFI206; (2) an addition of one
or
more nucleotides to IFI206; (3) a substitution of one or more nucleotides in
IF1206, (4) a chromosomal rearrangement of an IF1206 gene; (5) an alteration
in the level of a IFI206 mRNA transcripts, (6) aberrant modification of an
IFI206, such as a change genomic DNA methylation, (7) the presence of a
non-wild-type splicing pattern of an IFI206 mRNA transcript, (8) a non-wild-
type level of IFI206, (9) allelic loss of IFI206, and/or (10) inappropriate
post-
translational modification of IF1206 polypeptide. There are a large number of
known assay techniques that can be used to detect lesions in IFI206. Any
biological sample containing nucleated cells may be used.
In certain embodiments, lesion detection may use a probe/primer in a
polymerase chain reaction (PCR) (e.g., (Mullis, US Patent No. 4,683,202,
1987; Mullis et al., US Patent No. 4,683,195, 1987), such as anchor PCR or
rapid amplification of cDNA ends (RACE) PCR, or, alternatively, in a ligation
chain reaction (LCR) (e.g., (Landegren et al., 1988; Nakazawa et al., 1994),
the latter is particularly useful for detecting point mutations in IFI206-
genes
(Abravaya et al., 1995). This method may include collecting a sample from a
patient, isolating nucleic acids from the sample, contacting the nucleic acids
with one or more primers that specifically hybridize to IFI206 under
conditions
such that hybridization and amplification of the IFI206 (if present) occurs,
and
detecting the presence or absence of an amplification product, or detecting
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-102-
the size of the amplification product and comparing the length to a control
sample. It is anticipated that PCR and/or LCR may be desirable to use as a
preliminary amplification step in conjunction with any of the techniques used
for detecting mutations described herein.
Alternative amplification methods include: self sustained sequence
replication (Guatelli et al., 1990), transcriptional amplification system
(Kwoh et
al., 1989); Q(i Replicase (Lizardi et al., 1988), or any other nucleic acid
amplification method, followed by the detection of the amplified molecules
using techniques well known to those of skill in the art. These detection
schemes are especially useful for the detection of nucleic acid molecules
present in low abundance.
Mutations in IFI206 from a sample can be identified by alterations in
restriction enzyme cleavage patterns. For example, sample and control DNA'
is isolated, amplified (optionally), digested with one or more restriction
endonucleases, and fragment length sizes are determined by gel
electrophoresis and compared. Differences in fragment length sizes between
sample and control DNA indicates mutations in the sample DNA. Moreover,
the use of sequence specific ribozymes can be used to score for the presence
of specific mutations by development or loss of a ribozyme cleavage site.
Hybridizing a sample and control nucleic acids, e.g., DNA or RNA, to
high-density arrays containing hundreds or thousands of oligonucleotides
probes, can identify genetic mutations in IFI206 (Cronin et al., 1996; Kozal
et
al., 1996). For example, genetic mutations in IFI206 can be identified in two-
dimensional arrays containing light-generated DNA probes as described in
Cronin, et al., supra. Briefly, a first hybridization array of probes can be
used
to scan through long stretches of DNA in a sample and control to identify base
changes between the sequences by making linear arrays of sequential
overlapping probes. This step allows the identification of point mutations.
This is followed by a second hybridization array that allows the
characterization of specific mutations by using smaller, specialized probe
arrays complementary to all variants or mutations detected. Each mutation
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-103-
array is composed of parallel probe sets, one complementary to the wild-type
gene and the other complementary to the mutant gene.
In yet another embodiment, any of a variety of sequencing reactions
known in the art can be used to directly sequence the IFI206 and detect
mutations by comparing the sequence of the sample IF1206-with the
corresponding wild-type (control) sequence. Examples of sequencing
reactions include those based on classic techniques (Maxam and Gilbert,
1977; Sanger et al., 1977). Any of a variety of automated sequencing
procedures can be used when performing diagnostic assays (Naeve et al.,
1995) including sequencing by mass spectrometry (Cohen et al., 1996; Griffin
and Griffin, 1993; Koster, W094/16101, 1994).
Other methods for detecting mutations in the IFI206 include those in
which protection from cleavage agents is used to detect mismatched bases in
RNA/RNA or RNA/DNA heteroduplexes (Myers et al., 1985). In general, the
technique of "mismatch cleavage" starts by providing heteroduplexes formed
by hybridizing (labeled) RNA or DNA containing the wild-type IF1206
sequence with potentially mutant RNA or DNA obtained from a sample. The
double-stranded duplexes are treated with an agent that cleaves single-
stranded regions of the duplex such as those that arise from base pair
mismatches between the control and sample strands. For instance,
RNA/DNA duplexes can be treated with RNase and DNA/DNA hybrids treated
with S, nuclease to enzymatically digest the mismatched regions. In other
embodiments, either DNA/DNA or RNA/DNA duplexes can be treated with
hydroxylamine or osmium tetroxide and with piperidine in order to digest
mismatched regions. The digested material is then separated by size on
denaturing polyacrylamide gels to determine the mutation site (Grompe et al.,
1989; Saleeba and Cotton, 1993). The control DNA or RNA can be labeled
for detection.
Mismatch cleavage reactions may employ one or more proteins that
recognize mismatched base pairs in double-stranded DNA (DNA mismatch .
repair) in defined systems for detecting and mapping point mutations in IFI206
cDNAs obtained from samples of cells. For example, the mutt enzyme of E.
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-104-
coli cleaves A at G/A mismatches and the thymidine DNA glycosylase from
HeLa cells cleaves T at G!T mismatches (Hsu et al., 1994). According to an
exemplary embodiment, a probe based on a wild-type IFI206 sequence is
hybridized to a cDNA or other DNA product from a test cell(s), The duplex is
treated with a DNA mismatch repair enzyme, and the cleavage products, if
any, can be detected from electrophoresis protocols or the like (Modrich et
al.,
US Patent No. 5,459,039, 1995).
Electrophoretic mobility alterations can be used to identify mutations in
IF1206. For example, single strand conformation polymorphism (SSCP) may
be used to detect differences in electrophoretic mobility befinreen mutant and
wild type nucleic acids (Cotton, 1993; Hayashi, 1992; Orita et al., 1989).
Single-stranded DNA fragments of sample and control IFI206 nucleic acids
are denatured and then renatured. The secondary structure of single-
stranded nucleic acids varies according to sequence; the resulting alteration
in electrophoretic mobility allows detection of even a single base change. The
DNA fragments may be labeled or detected with labeled probes. The
sensitivity of the assay may be enhanced by using RNA (rather than DNA), in
which the secondary structure is more sensitive to a sequence changes. The
subject method may use heteroduplex analysis to separate double stranded
heteroduplex molecules on the basis of changes in electrophoretic mobility
(Keen et al., 1991).
The migration of mutant or wild-type fragments can be assayed using
denaturing gradient gel electrophoresis (DGGE; (Myers et al., 1985). In
DGGE, DNA is modified to prevent complete denaturation, for example by
adding a GC clamp of approximately 40 by of high-melting GC-rich DNA by
PCR. A temperature gradient may also be used in place of a denaturing
gradient to identify differences in the mobility of control and sample DNA
(Rossiter and Caskey, 1990).
Examples of other techniques for detecting point mutations include, but
are not limited to, selective oligonucleotide hybridization, selective
amplification, or selective primer extension. For example, oligonucleotide
primers may be prepared in which the known mutation is placed centrally and
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-105-
then hybridized to target DNA under conditions that permit hybridization only
if
a perfect match is found (Saiki et al., 1986; Saiki et al., 1989). Such allele-
specific oligonucleotides are hybridized to PCR-amplified target DNA or a
number of different mutations when the oligonucleotides are attached to the
hybridizing membrane and hybridized with labeled target DNA.
Alternatively, allele specific amplification technology that depends on
selective PCR amplification may be used. Oligonucleotide primers for specific
amplifications may carry the mutation of interest in the center of the
molecule
(so that amplification depends on differential hybridization (Gibbs et al.,
1989))
or at the extreme 3'-terminus of one primer where, under appropriate
conditions, mismatch can prevent, or reduce polymerise extension (Prosser,
1993). Novel restriction site in the region of the mutation may be introduced
to create cleavage-based detection (Gasparini et al., 1992). Certain
amplification may also be performed using Taq ligase for amplification
(Barany, 1991 ). In such cases, ligation occurs only if there is a perfect
match
at the 3'-terminus of the 5' sequence, allowing detection of a known mutation
by scoring for amplification.
The described methods may be performed, for example, by using
pre-packaged kits comprising at least one probe (nucleic acid or antibody)
that may be conveniently used, for example, in clinical settings to diagnose
patients exhibiting symptoms or family history of a disease or illness
involving
IF1206.
Furthermore, any cell type or tissue in which IF1206 is expressed may ,
be utilized in the prognostic assays described herein.
3. Pharmacogenomics
Agents, or modulators that have a stimulatory or inhibitory effect on
IF1206 activity or expression, as identified by a screening assay can be
administered to individuals to treat, prophylactically or therapeutically,
disorders, including obesity. In conjunction with such treatment, the
pharmacogenomics (i.e., the study of the relationship between a subject's
genotype and the subject's response to a foreign modality, such as a food,
compound or drug) may be considered. Metabolic differences of therapeutics
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-106-
can lead to severe toxicity or therapeutic failure by altering the relation
between dose and blood concentration of the pharmacologically active drug.
Thus, the pharmacogenomics of the individual permits the selection of
effective agents (e.g., drugs) for prophylactic or therapeutic treatments
based
on a consideration of the individual's genotype. Pharmacogenomics can
further be used to determine appropriate dosages and therapeutic regimens.
Accordingly, the activity of IF1206, expression of IFI206 nucleic acid, or
IF1206
mutations) in an individual can be determined to guide the selection of
appropriate agents) for therapeutic or prophylactic treatment.
Pharmacogenomics deals with clinically significant hereditary variations
in the response to modalities due to altered modality disposition and abnormal
action in affected persons (Eichelbaum and Evert, 1996; Linder et al., 1997).
In general, two pharmacogenetic conditions can be differentiated: (1 ) genetic
conditions transmitted as a single factor altering the interaction of a
modality
with the body (altered drug action) or (2) genetic conditions transmitted as
single factors altering the way the body acts on a modality (altered drug
metabolism). These pharmacogenetic conditions can occur either as rare
defects or as nucleic acid polymorphisms. For example, glucose-6-phosphate
dehydrogenase (G6PD) deficiency is a common inherited enzymopathy in
which the main clinical complication is hemolysis after ingestion of oxidant
drugs (anti-malarials, sulfonamides, analgesics, nitrofurans) and consumption
of fava beans.
As an illustrative embodiment, the activity of drug metabolizing
enzymes is a major determinant of both the intensity and duration of drug
action. The discovery of genetic polymorphisms of drug metabolizing
enzymes (e.g., N-acetyltransferase 2 (NAT 2) and cytochrome P450 enzymes
CYP2D6 and CYP2C19) explains the phenomena of some patients who show
exaggerated drug response and/or serious toxicity after taking the standard
and safe dose of a drug. These polymorphisms are expressed in two
phenotypes in the population, the extensive metabolizer (EM) and poor
metabolizer (PM). The prevalence of PM is different among different
populations. For example, the CYP2D6 gene is highly polymorphic and
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-107-
several mutations have been identified in PM, which all lead to the absence of
functional CYP2D6. Poor metabolizers due to mutant CYP2D6 and CYP2C19
frequently experience exaggerated drug responses and side effects when
they receive standard doses. If a metabolite is the active therapeutic moiety,
PM shows no therapeutic response, as demonstrated for the analgesic effect
of codeine mediated by its CYP2D6-formed metabolite morphine. At the other
extreme are the so-called ultra-rapid metabolizers who are unresponsive to
standard doses. Recently, the molecular basis of ultra-rapid metabolism has
been identified to be due to CYP2D6 gene amplification.
The activity of IF1206, expression of IFI206 nucleic acid, or mutation
content of IF1206 in an individual can be determined to select appropriate
agents) for therapeutic or prophylactic treatment of the individual. In
addition,
pharmacogenetic studies can be used to apply genotyping of polymorphic
alleles encoding drug-metabolizing enzymes to the identification of an
individual's drug responsiveness phenotype. This knowledge, when applied
to dosing or drug selection, can avoid adverse reactions or therapeutic
failure
and thus enhance therapeutic or prophylactic efficiency when treating a
subject with an IF1206 modulator, such as a modulator identified by one of the
described exemplary screening assays.
4. Monitoring effects during clinical trials
Monitoring the influence of agents (e.g., drugs, compounds) on the
expression or activity of IF1206 (e.g., the ability to modulate aberrant cell
proliferation and/or differentiation) can be applied not only in basic drug
screening, but also in clinical trials. For example, the effectiveness of an
agent determined by a screening assay to increase IFI206 expression, protein
levels, or up-regulate IF1206 activity can be monitored in clinical trails of
subjects exhibiting decreased IFI206 expression, protein levels, or down-
regulated IF1206 activity. Alternatively, the effectiveness of an agent
determined to decrease IF1206 expression, protein levels, or down-regulate
IF1206 activity, can be monitored in clinical trails of subjects exhibiting
increased IFI206 expression, protein levels, or up-regulated IF1206 activity.
In
such clinical trials, the expression or activity of IF1206 and, preferably,
other
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-108-
genes that have been implicated in, for example, obesity can be used as a
"read out" or markers for a particular cell's responsiveness.
For example, genes, including IFI206, that are modulated in cells by
treatment with a modality (e.g., food, compound, drug or small molecule) can
be identified. To study the effect of agents on cellular proliferation
disorders,
for example, in a clinical trial, cells can be isolated and RNA prepared and
analyzed for the levels of expression of IFI206 and other genes implicated in
.
the disorder. The gene expression pattern can be quantified by Northern blot
analysis, nuclear run-on or RT-PCR experiments, or by measuring the amount
of protein, or by measuring the activity level of IF1206 or other gene
products.
In this manner, the gene expression pattern itself can serve as a marker,
indicative of the cellular physiological response to the agent. Accordingly,
this
response state may be determined before, and at various points during,
treatment of the individual with the agent.
The invention provides a method for monitoring the effectiveness of
treatment of a subject with an agent (e.g., an agonist, antagonist, protein,
peptide, peptidomimetic, nucleic acid, small molecule, food or other drug
candidate identified by the screening assays described herein) comprising the
steps of (1 ) obtaining a pre-administration sample from a subject; (2)
detecting the level of expression of an IF1206, mRNA, or genomic DNA in the.
preadministration sample; (3) obtaining one or more post-administration
samples from the subject; (4) detecting the level of expression or activity of
the IF1206, mRNA, or genomic DNA in the post-administration samples; (5)
comparing the level of expression or activity of the IF1206, mRNA, or genomic
DNA in the pre-administration sample with the IF1206, mRNA, or genomic
DNA in the post administration sample or samples; and (6) altering the
administration of the agent to the subject~accordingly. For example,
increased administration of the agent may be desirable to increase the
expression or activity of IF1206 to higher levels than detected, i.e., to
increase
the effectiveness of the agent. Alternatively, decreased administration of the
agent may be desirable to decrease expression or activity of IF1206 to lower
levels than detected, i.e., to decrease the effectiveness of the agent.
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-109-
5. Methods of treatment
The invention provides for both prophylactic and therapeutic methods
of treating a subject at risk of (or susceptible to) a disorder or having a
disorder associated with aberrant IF1206 expression or activity. The disorders
include obesity. Furthermore, these same methods of treatment may be used
to induce weight loss, or enhance weight loss, by changing the level of
expression or activity of IF1206.
6. Disease and disorders
Diseases and disorders that are characterized by increased IF1206
levels or biological activity may be treated with therapeutics that antagonize
.
(i.e., reduce or inhibit) activity. Antognists may be administered in a
therapeutic or prophylactic manner. Therapeutics that. may be used include:
(1 ) IF1206 peptides, or analogs, derivatives, fragments or homologs thereof;
(2) Abs to an IF1206 peptide; (3) IF1206 nucleic acids; (4) administration of
antisense nucleic acid and nucleic acids that are "dysfunctional" (i.e., due
to a
heterologous insertion within the coding sequences) that are used to eliminate
endogenous function of by homologous recombination (Capecchi, 1989); or
(5) modulators (i.e., inhibitors, agonists and antagonists, including
additional
peptide mimetic of the invention or Abs specific to IF1206) that alter the
interaction between IF1206 and its binding partner.
Diseases and disorders that are characterized by decreased IF1206
levels or biological activity may be treated with therapeutics that increase
(i.e.,
are agonists to) activity. Therapeutics that upregulate activity may be
administered therapeutically or prophylactically. Therapeutics that may be
used include peptides, or analogs, derivatives, fragments or homologs
thereof; or an agonist that increases bioavailability.
Similary, the same therapeutics used to treat diseases and disorders
may also be used to decrease obesity or induce weight gain.
Increased or decreased levels can be readily detected by quantifying
peptide and/or RNA, by obtaining a patient tissue sample (e.g., from biopsy
tissue) and assaying in vitro for RNA or peptide levels, structure and/or
activity of the expressed peptides (or IFI206 mRNAs). Methods include, but
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-110-
are not limited to, immunoassays (e.g., by Western blot analysis,
immunoprecipitation followed by sodium dodecyl sulfate (SDS)
polyacrylamide gel electrophoresis, immunocytochemistry, etc.) and/or
hybridization assays to detect expression of mRNAs (e.g., Northern assays,
dot blots, in situ hybridization, and the like).
7. Prophylactic methods
The invention provides a method for preventing, in a subject, a disease
or condition associated with an aben-ant IF1206 expression or activity, by
administering an agent that modulates IF1206 expression or at least one
IF1206 activity. Subjects at risk for a disease that is caused or contributed
to
by aberrant IF1206 expression or activity can be identified by, for example,
any or a combination of diagnostic or prognostic assays. Administration of a
prophylactic agent can occur prior to the manifestation of symptoms
characteristic of the IF1206 aberrancy, such that a disease or disorder is
prevented or, alternatively, delayed in its progression. Depending on the type
of IF1206 aberrancy, for example, an IF1206 agonist or IF1206 antagonist can
be used to treat the subject. The appropriate agent can be determined based
on screening assays.
8. Therapeutic methods
Another aspect of the invention pertains to methods of modulating
IF1206 expression or activity for therapeutic purposes. The modulatory
method of the invention involves contacting a cell with an agent that
modulates one or more of the activities of IF1206 activity associated with the
cell. An agent that modulates IF1206 activity can be a nucleic acid or a
protein, a naturally occurring cognate ligand of IFI206, a peptide, an IF1206
peptidomimetic, or other small molecule. The agent may stimulate IF1206
activity. Examples of such stimulatory agents include active IF1206 and a .
1F1206 nucleic acid molecule that has been introduced into the cell. In
another
embodiment, the agent inhibits IF1206 activity. Examples of inhibitory agents
include antisense IFI206 nucleic acids and anti-IF1206 Abs. Modulatory
methods can be performed in vitro (e.g., by.culturing the cell with the agent)
or, alternatively, in vivo (e.g., by administering the agent to a subject). As
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-111-
such, the invention provides methods of treating an individual afflicted with
a
disease or disorder characterized by aberrant expression or activity of an
IF1206 or nucleic acid molecule. In one embodiment, the method involves
administering an agent (e.g., an agent identified by a screening assay), or
combination of agents that modulates (e.g., up-regulates or down-regulates)
IF1206 expression or activity. In another embodiment, the method involves
administering an IF1206 or nucleic acid molecule as therapy to compensate
for reduced or aberrant IF1206 expression or activity.
Stimulation of IF1206 activity is desirable in situations in which IF1206 is
abnormally down-regulated and/or in which increased IF1206 activity is likely
to have a beneficial effect. One example of such a situation is where a
subject
has a disorder characterized by aberrant cell proliferation and/or
differentiation (e.g., cancer or immune associated disorders). Another
example of such a situation is obesity.
9. Determination of the biological effect of the therapeutic
Suitable in vitro or in vivo assays can be performed to determine the
effect of a specific therapeutic and whether its administration is indicated
for
treatment of the affected tissue.
In various specific embodiments, in vitro assays may be performed with
representative cells of the types) involved in the patient's disorder, to
determine if a given therapeutic exerts the desired effect upon the cell
type(s).
Modalities for use in therapy may be tested in suitable animal model systems
including, but not limited to rats, mice, chicken, cows, monkeys, rabbits, and
the like, prior to testing in human subjects. Similarly, for in vivo testing,
any of
the animal model system known in the art may be used prior to administration
to human subjects.
10. Prophylactic and therapeutic uses of the compositions of the
in vention
IF1206 nucleic acids and proteins are useful in potential prophylactic
and therapeutic applications implicated in a variety of disorders including,
but
not limited to obesity.
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-112-
As an example, a cDNA encoding IF1206 may be useful in gene
therapy, and the protein may be useful when administered to a subject in
need thereof. By way of non-limiting example, the compositions of the
invention will have efficacy for treatment of patients suffering from
infertility.
IFI206 nucleic acids, or fragments thereof, may also be useful in
diagnostic applications, wherein the presence or amount of the nucleic acid or
the protein is to be assessed. A further use could be as an anti-bacterial
molecule (i.e.,-some peptides have been found to possess anti-bacterial
properties). These materials are further useful in the generation of Abs that
immunospecifically bind to the novel substances of the invention for use in
therapeutic or diagnostic methods.
Examples
1. cDNA library construction
The KIDNNOT05 cDNA library was constructed from tissue removed
from a female infant kidney with anoxia (lot #RU95-04-0274; International
Institute of Advanced Medicine, Exton Pa.). The frozen tissue was
immediately homogenized and cells lysed with a Brinkmann Homogenizer
Polytron PT-3000 (Brinkmann Instruments Inc., Westbury N.Y.) in a
guanidinium isothiocyanate solution. Lysates were then loaded on a 5.7 M
CsCI cushion and ultracentrifuged in a SW28 swinging bucket rotor for 18
hours at 25,000 rpm at ambient temperature. The RNA was extracted once
with acid phenol at pH 4.0 and precipitated with 0.3 M sodium acetate and 2.5
volumes of ethanol, resuspended in DEPC-treated water and DNAse treated
for 25 min at 37°C. The reaction was stopped with an equal volume of pH
8.0
phenol, and the RNA was as above. The RNA was isolated using the Qiagen
Oligotex kit (QIAGEN Inc, Chatsworth Calif.) and used to construct the cDNA
library.
The RNA was handled according to the recommended protocols in the
Superscript Plasmid System for cDNA Synthesis and Plasmid Cloning
(catalog #18248-013; Gibco/BRL). cDNAs were fractionated on a Sepharose
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-113-
CL4B column (catalog #275105, Pharmacia), and those cDNAs exceeding
400 by were ligated into pSport I. The plasmid pSport I was subsequently
transformed into DHSa.TM. competent cells (Cat. #18258-012, Gibco/BRL).
2. Isolation and sequencing of cDNA clones
Plasmid DNA was released from the cells and purified using the
Miniprep Kit (Catalogue # 77468; Advanced Genetic Technologies
Corporation, Gaithersburg Md.). This kit consists of a 96 well block with
reagents for 960 purifications. The recommended protocol was employed
except for the following changes: 1 ) the 96 wells were each filled with only
1
ml of sterile Terrific Broth (Catalog # 22711, LIFE TECHNOLOGIES.TM.,
Gaithersburg Md.) with carbenicillin at 25 mg/L and glycerol at 0.4%; 2) the
bacteria were cultured for 24 hours after the wells were inoculated and then
lysed with 60 NI of lysis buffer; 3) a centrifugation step employing the
Beckman GS-6R @2900 rpm for 5 min was performed before the contents of
the block were added to the primary filter plate; and 4) the optional step of
adding isopropanol to TRIS buffer was not routinely performed. After the last
step in the protocol, samples were transferred to a Beckman 96-well block for
storage.
The cDNAs were sequenced by the method of Sanger F and AR
Coulson (1975; J Mol Biol 94:441 f), using a Hamilton Micro Lab 2200
(Hamilton, Reno Nev.) in combination with four Pettier Thermal Cyclers
(PTC200 from MJ Research, Watertown Mass.) and Applied Biosystems 377
or 373 DNA Sequencing Systems (Perkin Elmer), and reading frame was
determined.
3. Homologies with cDNA clones and deduced proteins
Each cDNA was compared to sequences in GenBank using a search
algorithm developed by Applied Biosystems and incorporated into the
INHERIT- 670 Sequence Analysis System. In this algorithm, Pattern
Specification Language (TRW Inc, Los Angeles Calif.) was used to determine
regions of homology. The three parameters that determine how the sequence
comparisons run were window size, window offset, and error tolerance. Using
a combination of these three parameters, the DNA database was searched for
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-114-
sequences containing regions of homology to the query sequence, and the
appropriate sequences were scored with an initial value. Subsequently, these
homologous regions were examined using dot matrix homology plots to
distinguish regions of homology from chance matches. Smith-Waterman
alignments were used to display the results of the homology search.
Peptide and protein sequence homologies were ascertained using the
INHERIT.TM. 670 Sequence Analysis System in a way similar to that used in
DNA sequence homologies. Pattern Specification Language and parameter
windows were used to search protein databases for sequences containing
regions of homology which were scored with an initial value. Dot-matrix
homology plots were examined to distinguish regions of significant homology
from chance matches.
BLAST, which stands for Basic Local Alignment Search Tool (Altschul
S F (1993) J Mol Evol 36:290-300; Altschul, S F et al (1990) J Mol Biol
215:403-10), was used to search for local sequence alignments. BLAST
produces alignments of both nucleotide and amino acid sequences to
determine sequence similarity. Because of the local nature of the alignments,
BLAST is especially useful in determining exact matches or in identifying
homologs. BLAST is useful for matches which do not contain gaps. The
fundamental unit of BLAST algorithm output is the High-scoring Segment Pair
(HSP)
An HSP consists of two sequence fragments of arbitrary but equal
lengths whose alignment is locally maximal and for which the alignment score
meets or exceeds a threshold or cutoff score set by the user. The BLAST
approach is to look for HSPs between a query sequence and a database
sequence, to evaluate the statistical significance of any matches found, and
to
report only those matches which satisfy the user-selected threshold of
significance. The parameter E establishes the statistically significant
threshold for reporting database sequence matches. E is interpreted as the
upper bound of the expected frequency of chance occurrence of an HSP (or
set of HSPS) within the context of the entire database search. Any database
sequence whose match satisfies E is reported in the program output.
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-115-
4. Northern analyses
Northern analysis is a laboratory technique used to detect the presence
of a transcript of a gene and involves the hybridization of a labeled
nucleotide.
sequence to a membrane on which RNAs from a particular cell type or tissue
have been bound (Sambrook et al. supra).
Analogous computer techniques use BLAST (Altschul SF 1993 and
1990, supra) to search for identical or related molecules in nucleotide
databases such as GenBank. This analysis is much faster than multiple,
membrane-based hybridizations. In addition, the sensitivity of the computer
search can be modified to determine whether any particular match is
categorized as exact or homologous.
~' The basis of the search is the product score which is defined as:
<figref>EQU1</figref> and it takes into account both the degree of similarity between two
sequences and the length of the sequence match. For example, with a
product score of 40, the match will be exact within a 1-2% error; and at 70,
the
match will be exact. Homologous molecules are usually identified by
selecting those which show product scores between 15 and 40, although
lower scores may identify related molecules.
The results of the search are reported as a list of libraries in which the
full length sequence, or parts thereof, is represented, the abundance of the
sequence, and the percent abundance. Abundance directly reflects the
number of times a particular transcript is present in a cDNA library, and
percent abundance is abundance divided by the total number of sequences
examined in the library.
5. Real-time quantitative PCR analysis (TaqMan system) to
quantify mouse IFI206 abundance
Total RNA preparations from liver or pulverized SKM of individual mice
were made (Ultraspec reagent; Biotecx Laboratories, Houston TX) and
assayed for mRNA abundance using quantitative real-time reverse-
transcriptase PCR (RT-~PCR) following digestion of samples with DNAse per
manufacturers instructions (GIBCO BRL, Grand Island NY). This system
employed primers and probes specific to murine IFI206. 18S primers/probe
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-116-
were purchased from Perkin-Elmer Applied Biosystems (Foster City, CA).
Reactions and detection were carried out using a Model 7700 Sequence
Detector and TaqMan reagents (PE Applied Biosystems; Boston, MA) in a
volume of 50 ~,L and containing: 100 ng RNA, 3 mM MgCl2, reaction Buffer A
(1X), 12.5 U MuLV reverse transcriptase, 1.25 U TaqGold, forward and
reverse primers (0.01 O.D. ea.), and 0.1wM probe (Note: 18S analyses
employed 240 pg RNA, 5.5 mM MgCl2, and 0.05 ~.M probe/primer). Cycling
conditions were: 50°C 15 min and 95°C 10 min, followed by 40
cycles of 95°C
sec and 60°C 1 min. 18S mRNA abundance was used as a loading
10 control, and all values reported herein represent 18S-corrected values.
TaaMan Oligo Seguences:
SEQ ID N0:19
15 <mulFlhlog.for1 >TGGAAATAAATAGGCAAGAAAGCA
SEQ ID N0:20
<mulFlhlog.rev1 >TCTCGCCTTCTTTCAGATGTAACA
SEQ ID N0:5
<mulFlhlog.probe1 >TCCTGCACACCTACATCAACTACAAGCCAC
Examples 6 and 7 are prophetic:
6. Extension of IFI206 to full length or to recover regulatory
elements
The nucleic acid sequence encoding full length IF1206 (SEQ ID N0:2)
is used to design oligonucleotide primers for extending a partial nucleotide
sequence to full length or for obtaining 5' sequences from genomic libraries.
One primer is synthesized to initiate extension in the antisense direction
(XLR) and the other is synthesized to extend sequence in the sense direction
(XLF). Primers allow the extension of the known IF1206 nucleotide sequence
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-117-
"outward" generating amplicons containing new, unknown nucleotide
sequence for the region of interest The initial primers are designed from the
cDNA using OLIGO® 4.06 Primer Analysis Software (National
Biosciences), or another appropriate program, to be 22-30 nucleotides in
length, to have a GC content of 50% or more, and to anneal to the target
sequence at temperatures about 68°-72°C Any stretch of
nucleotides
which would result in hairpin structures and primer-primer dimerizations is
avoided.
The original, selected cDNA libraries, or a human genomic library are
used to extend the sequence; the latter is most useful to obtain 5' upstream
regions. If more extension is necessary or desired, additional sets of primers
are designed to further extend the known region.
By following the instructions for the XL-PCR kit (Perkin Elmer) and
thoroughly mixing the enzyme and reaction mix, high fidelity amplification is
obtained. Beginning with 40 pmol of each primer and the recommended
concentrations of all other components of the kit, PCR is performed using the
Pettier Thermal Cycler (PTC200; MJ Research, Watertown Mass.) and the
following parameters:
Step 1 94°C for 1 min (initial denaturation)
Step 2 65°C for 1 min
Step 3 68°C for 6 min
Step 4 94°C for 15 sec
Step 5 65°C for 1 min
Step 6 68°C for 7 mih
Step 7 Repeat step 4-6 for 15 additional cycles
Step 8 94°C for 15 sec
Step 9 65°C for 1 min
Step 10 68°C for 7:15 min
Step 11 Repeat step 8-10 for 12 cycles
Step 12 72°C for 8 min
Step 13 4°C (and holding)
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-118-
A 5-10 NI aliquot of the reaction mixture is analyzed by electrophoresis
on a low concentration (about 0.6-0.8%) agarose mini-gel to determine which
reactions were successful in extending the sequence. Bands thought to
contain the largest products were selected and cut out of the gel. Further
purification involves using a commercial gel extraction method such as
QIAQuick.TM. (QIAGEN Inc). After recovery of the DNA, Klenow enzyme
was used to trim single-stranded, nucleotide overhangs creating blunt ends
which facilitate religation and cloning.
After ethanol precipitation, the products are redissolved in 13 NI of
ligation buffer, 1 NI T4-DNA ligase (15 units) and 1 NI T4 polynucleotide
kinase
are added, and the mixture is incubated at room temperature for 2-3 hours or
overnight at 16°C Competent E. coli cells (in 40 NI of appropriate
media) are
transformed with 3 NI of ligation mixture and cultured in 80 NI of SOC medium
(Sambrook J et al, supra). After incubation for one hour at 37°C, the
whole
transformation mixture is plated on Luria Bertani (LB)-agar (Sambrook J et al,
supra) containing 2×Carb. The following day, several colonies are
randomly picked from each plate and cultured in 150 NI of liquid
LB/2×Carb medium placed in an individual well of an appropriate,
commercially-available, sterile 96-well microtiter plate. The following day, 5
NI
of each overnight culture is transfer-ed into a non-sterile 96-well plate and
after dilution 1:10 with water, 5 NI of each sample is transferred into a PCR
array.
For PCR amplification, 18 NI of concentrated PCR reaction mix
(3.3×) containing 4 units of rTth DNA polymerise, a vector primer and
one or both of the gene specific primers used for the extension reaction are
added to each well. Amplification is performed using the following
conditions:.
Step 1 94°C for 60 sec
Step 2 94°C for 20 sec
Step 3 55°C for 30 sec
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-119-
Step 4 72°C for 90 sec
Step 5 Repeat steps 2-4 for an additional 29 cycles
Step 6 72°C for 180 sec
Step 7 4°C (and holding)
Aliquots of the PCR reactions are run on agarose gels together with
molecular weight markers. The sizes of the PCR products are compared to
the original partial cDNAs, and appropriate clones are selected, ligated into
plasmid and sequenced.
7: Labeling and use of hybridization probes
Hybridization probes derived from SEQ ID N0:2 are employed to
screen cDNAs, genomic DNAs or mRNAs. Although the labeling of
oligonucleotides, consisting of about 20 base-pairs, is specifically
described,
essentially the same procedure is used with larger cDNA fragments.
Oligonucleotides are designed using state-of-the-art software such as OLIGO
4.06 (National Biosciences), labeled by combining 50 pmol of each oligomer
and 250 mCi of y adenosine triphosphate (Amersham, Chicago IIL) and T4
polynucleotide kinase (DuPont NEN; Boston Mass.). The labeled
oligonucleotides are substantially purified with Sephadex G-25 super fine
resin column (Pharmacia). A portion containing l0<sup>7</sup> counts per minute of
each of the sense and antisense oligonucleotides is used in a typical
membrane based hybridization analysis of human genomic DNA digested with
one of the following endonucleases (Ase I, Bgl II, Eco RI, Pst I, Xba 1, or
Pvu
II; DuPont NEN).
The DNA from each digest is fractionated on a 0.7 percent agarose gel
and transferred to nylon membranes (Nytran Plus, Schleicher & Schuell,
Durham N.H.). Hybridization is carried out for 16 hours at 40°C To
remove
nonspecific signals, blots are sequentially washed at room temperature under
increasingly stringent conditions up to 0.1 ×saline sodium citrate and
0.5% sodium dodecyl sulfate. After XOMAT AR.TM. film (Kodak, Rochester
N.Y.) is exposed to the blots in a Phosphoimager cassette (Molecular
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-120-
Dynamics, Sunnyvale Calif.) for several hours, hybridization patterns are
compared visually.
EQUIVALENTS
Although particular embodiments have been disclosed herein in detail,
this has been done by way of example for purposes of illustration only, and is
not intended to be limiting with respect to the scope of the appended claims
that follow. In particular, it is contemplated by the inventors that various
substitutions, alterations, and modifications may be made to the invention
without departing from the spirit and scope of the invention as defined by the
claims. The choice of nucleic acid starting material, clone of interest, or
library type is believed to be a matter of routine for a person of ordinary
skill in
the art with knowledge of the embodiments described herein. Other aspects,
advantages, and modifications considered to be within the scope of the
following claims.
References
U.S. Patent No. 4166452. Apparatus for testing human responses to stimuli.
1979.
U.S. Patent No. 4485045. Synthetic phosphatidyl cholines useful in forming
liposomes. 1984.
U.S. Patent No. 4544545. Liposomes containing modified cholesterol for
organ targeting. 1985.
4,676,980. Target specific cross-linked heteroantibodies. 1987.
U.S. Patent No. 4816567. Recombinant immunoglobin preparations. 1989.
WO 90/10448. Covalent conjugates of lipid and oligonucleotide. 1990.
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-121-
WO 90/13641. Stably transformed eucaryotic cells comprisng a foreign
transcribable DNA under the control of a pol III promoter. 1990.
EPO 402226. Transformation vectors for yeast Yarrowia. 1990.
WO 91/00360. Bispecific reagents for AIDS therapy. 1991.
WO 91/04753. Conjugates of antisense oligonucleotides and therapeutic
uses thereof. 1991.
U.S. Patent No. 5013556. Liposomes with enhanced circulation time. 1991.
WO 91/00357. New strain with filamentous fungi mutants, process for the
production of recombinant proteins using said strain, and strains and
proteins. 1991.
WO 91/06629. Oligonucleotide analogs with novel linkages. 1991.
WO 92/20373. Heteroconjugate antibodies for treatment of HIV infection.
1992.
WO 93/08829. Compositions that mediate killing of HIV-infected cells. 1993.
WO 94/11026. Therapeutic application of chimeric and radiolabeled
antibodies to human B lymphocyte restricted differentiation antigen for
treatment of B cells. 1994.
WO 96/27011. A method for making heteromultimeric polypeptides. 1996.
U.S. Patent No. 5545807. Production of antibodies from transgenic animals.
1996.
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-122-
U.S. Patent No. 5545806. Ransgenic <sic> non-human animals for
producing heterologous antibodies. 1996.
U.S. Patent No. 5569825. Transgenic non-human animals capable of
producing heterologous antibodies of various isotypes. 1996.
WO 97/33551. Compositions and methods for the diagnosis, prevention, and
treatment of neoplastic cell growth and proliferation. 1997.
U.S. Patent No. 5633425. Transgenic non-human animals capable of
producing heterologous antibodies. 1997.
U.S. Patent No. 5661016. Transgenic non-human animals capable of
producing heterologous antibodies of various isotypes. 1997.
U.S. Patent No. 5625126. Transgenic non-human animals for producing
heterologous antibodies. 1997.
(GCG), G.C.G. 1999. Wisconsin Package: SeqLab, SeqWeb, Madison,
Wisconsin.
Abravaya, K., J.J. Carrino, S. Muldoon, and H.H. Lee. 1995. Detection of point
mutations with a modified ligase chain reaction (Gap- LCR). Nucleic
Acids Res. 23:675-82.
ADAReport. 1997. Position of the American Dietetic Association: weight
management. J Am Diet Assoc. 97:71-4.
Alam, J., and J.L. Cook. 1990. Reporter genes: Application to the study of
mammalian gene transcription. Anal. Biochem. 188:245-254.
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-123-
Altschul, S.F., W. Gish, W. Miller, E.W. Myers, et al. 1990. Basic local
alignment search tool. J Mol Biol. 215:403-10.
Aron, D., J. Findling, and J. Tyrell. 1997. Hypothalamus & Pituitary. In Basic
&
Clinical Endocrinology. F. Greenspan and G. Strewler, editors.
Appleton & Lange, Stamford, CT. 95-156.
Austin, C.P., and C.L. Cepko. 1990. Cellular migration patterns in the
developing mouse cerebral cortex. Development. 110:713-732.
Ausubel, F.M., R. Brent, R.E. Kingston, D.D. Moore, et al. 1987. Current
protocols in molecular biology. John Wiley & Sons, New York.
Barany, F. 1991. Genetic disease detection and DNA amplification using
cloned thermostable ligase. Proc Natl Acad Sci U S A. 88:189-93.
Bartel, D.P., and J.W. Szostak. 1993. Isolation of new ribozymes from a large
pool of random sequences [see comment]. Science. 261:1411-8.
Beal, P.A., and P.B. Dervan. 1991. Second structural motif for recognition of
DNA by oligonucleotide- directed triple-helix formation. Science.
251:1360-3.
Bechtold, N., and G. Pelletier. 1998. In planta Agrobacterium-mediated
transformation of adult Arabidopsis thaliana plants by vacuum
infiltration. Methods Mol Biol. 82:259-66.
Becker, D.M., and L. Guarente. 1991. High-efficiency transformation of yeast
by electroporation. Methods Enzymol. 194:182-187.
Beggs, J.D. 1978. Transformation of yeast by a replicating hybrid plasmid.
Nature. 275:104-109.
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-124-
Berger, J., J. Hauber, R. Hauber, R. Geiger, et al. 1988. Secreted placental
alkaline phosphatase: A powerful new qunatitative indicator of gene
expression in eukaryotic cells. Gene. 66:1-10.
WO 93/04169. GENE TARGETING IN ANIMAL CELLS USING ISOGENIC
DNA CONSTRUCTS. 1993.
Bodine, D.M., K.T. McDonagh, N.E. Seidel, and A.W. Nienhuis. 1991. Survival
and retrovirus infection of murine hematopoietic stem cells in vitro:
effects of 5-FU and method of infection. Exp. Hematol. 19:206-212.
Boerner, P., R. Lafond, W.Z. Lu, P. Grams, et al. 1991. Production of antigen-
specific human monoclonal antibodies from in vitro-primed human
splenocytes. J Immunol. 147:86-95.
U.S. Patent No. 3,773,91'9. Polylactide-drug mixtures. 1973.
Bouchard, C. 1995. Genetics of obesity: an update on molecular markers. Int
J Obes Relat Metab Disord. 19 Suppl 3:S10-3.
Bradley. 1987. Teratocarcinomas and Embryonic Stem Cells: A Practical
Approach. Oxford University Press, Inc., Oxford. 268 pp.
Bradley, A. 1991. Modifying the mammalian genome by gene targeting. Curr
Opin 8iotechnol. 2:823-9.
Brennan, M., P.F. Davison, and H. Paulus. 1985. Preparation of bispecific
antibodies by chemical recombination of monoclonal immunoglobulin
G1 fragments. Science. 229:81-3.
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-125-
Capecchi, M.R. 1980. High efficiency transformation by direct microinjection
of DNA into cultured mammalian cells. Cell. 22:479.
Capecchi, M.R. 1989. Altering the genome by homologous recombination.
Science. 244:1288-92.
Carell, T., E.A. Wintner, and J. Rebek Jr. 1994a. A novel procedure for the
synthesis of libraries containing small organic molecules. Angewandte
Chemie International Edition. 33:2059-2061.
Carell, T., E.A. Wintner, and J. Rebek Jr. 1994b. A solution phase screening
procedure for the isolation of active compounds from a molecular
library. Angewandte Chemie International Edition. 33:2061-2064.
Caron, P.C., W. Laird, M.S. Co, N.M. Avdalovic, et al. 1992. Engineered
humanized dimeric forms of IgG are more effective antibodies. J Exp
Med. 176:1191-5.
Carter, P. 1986. Site-directed mutagenesis. Biochem J. 237:1-7.
Case, M.E., M. Schweizer, S.R. Kushner, and N.H. Giles. 1979. Efficient
transformation of Neurospora crassa by utilizing hybrid plasmid DNA.
Proc Natl Acad Sci U S A. 76:5259-63.
U.S. Patent No. 5,116,742. RNA ribozyme restriction endoribonucleases and
methods. 1992.
U.S. Patent No. 4,987,071. RNA ribozyme polymerises, dephosphorylases,
restriction endoribonucleases and methods. 1991.
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-126-
Cepko, C.L., B.E. Roberts, and R.E. Mulligan. 1984. Construction and
applications of a highly transmissible murine retrovirus shuttle vector.
Cell. 37:1053-1062.
Chalfie, M., Y. tu, G. Euskirchen, W.W. Ward, et al. 1994. Green fluorescent
protein as a marker for gene expression. Science. 263:802-805.
Chaney, W.G., D.R. Howard, J.W. Pollard, S. Sallustio, et al. 1986. High-
frequency transfection of CHO cells using Polybrene. Somatic Cell Mol.
Genet. 12:237.
Charon, C., S. Krief, F. Diot-Dupuy, A.D. Strosberg, et al. 1995. Early
alterations in the brown adipose tissue adenylate cyclase system of
pre-obese Zucker rat fa/fa pups: decreased G-proteins and beta 3-
adrenoceptor activities. Biochem J. 312:781-8.
Chen, C., and H. Okayama. 1988. Calcium phosphate-mediated gene
transfer: A highly efficient system for stably transforming cells with
plasmid DNA. BioTechniques. 6:632-638.
Chen, S.H., H. D. Shine, J.C. Goodman, R.G. Grossman, et al. 1994. Gene
therapy for brain tumors: regression of experimental gliomas by
adenovirus-mediated gene transfer in vivo. Proc Natl Acad Sci U S A.
91:3054-7.
Chikano, S., K. Sawada, T. Shimoyama, S.I. Kashiwamura, et al. 2000. IL-18
and IL-12 induce intestinal inflammation and fatty liver in mice in an
IFN-gamma dependent manner. Gut. 47:779-86.
Cho, C.Y., E.J. Moran, S.R. Cherry, J.C. Stephans, et al. 1993. An unnatural
biopolymer. Science. 261:1303-5.
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-127-
Choubey, D., and P. Lengyel. 1992. Interferon action: nucleolar and
nucleoplasmic localization of the interferon-inducible 72-kD protein that
is encoded by the Ifi 204 gene from the gene 200 cluster. J Cell Biol.
116:1333-41.
Choubey, D., and P. Lengyel. 1993. Interferon action: cytoplasmic and
nuclear localization of the interferon-inducible 52-kD protein that is
encoded by the Ifi 200 gene from the gene 200 cluster. J Interferon
Res. 13:43-52.
Choubey, D., J. Snoddy, V. Chaturvedi, E. Toniato, et al. 1989. Interferons as
gene activators. Indications for repeated gene duplication during the
evolution of a cluster of interferon-activatable genes on murine
chromosome 1. J Biol Chem. 264:17182-9.
Clement, K., C. Vaisse, N. Lahlou, S. Cabrol, et al. 1998. A mutation in the
human leptin receptor gene causes obesity and pituitary dysfunction
[see comments]. Nature. 392:398-401.
Cohen, A.S., D.L. Smisek, and B.H. Wang. 1996. Emerging technologies for
sequencing antisense oligonucleotides: capillary electrophoresis and
mass spectrometry. Adv Chromatogr. 36:127-62.
Cohen, J.S. 1989. Oligodeoxynucleotides: Antisense inhibitors of gene
expression. CRC Press, Boca Raton, FL. 255 pp.
Cohen, S.M.N., A.C.Y. Chang, and L. Hsu. 1972. Nonchromosomal antibiotic
resistance in bacteria: Genetic transformation of Escherichia coli by R-
factor DNA. Proc. Natl. Acad. Sci. USA. 69:2110.
Collins, S., K.W. Daniel, and E.M. Rohlfs. 1999. Depressed expression of
adipocyte beta-adrenergic receptors is a common feature of congenital
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-128-
and diet-induced obesity in rodents. Int J Obes Relat Metab Disord.
23:669-77. . . .. . . . .. . . , .
Coombes, R.C., N.J. Rothwell, P. Shah, and M.J. Stock. 1987. Changes in
thermogenesis and brown fat activity in response to tumour necrosis
factor in the rat. Biosci Rep. 7:791-9.
Cooney, M., G. Czemuszewicz, E.H. Postel, S.J. Flint, et al. 1988. Site-
specific oligonucleotide binding represses transcription of the human o-
myc gene in vitro. Science. 241:456-9.
Cotton, R.G. 1993. Current methods of mutation detection. Mutat Res.
285:125-44.
Cronin, M.T., R.V. Fucini, S.M. Kim, R.S. Masino, et al. 1996. Cystic fibrosis
mutation detection by hybridization to light-generated DNA probe
arrays. Hum Mutat. 7:244-55.
Cull, M.G., J.F. Miller, and P.J. Schatz. 1992. Screening for receptor ligands
using large libraries of peptides linked to the C terminus of the lac
repressor. Proc Natl Acad Sci U S A. 89:1865-9.
Cwirla, S.E., E.A. Peters, R.W. Barrett, and W.J. Dower. 1990. Peptides on
phage: a vast library of peptides for identifying ligands. Proc Natl Acad
Sci U S A. 87:6378-82.
Dawson, M.J., N.J. Elwood, R.W. Johnstone, and J.A. Trapani. 1998. The
IFN-inducible nucleoprotein IFI 16 is expressed in cells of the
monocyte lineage, but is rapidly and markedly down-regulated in other
myeloid precursor populations. J Leukoc Biol. 64:546-54.
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-129-
de Boer, A.G. 1994. Drug absorption enhancement: Concepts, possibilities,
limitations and trends. Harwood Academic Publishers, Langhome, PA.
de Louvencourt, L., H. Fukuhara, H. Heslot, and M. Wesolowski. 1983.
Transformation of Kluyveromyces lactis by killer plasmid DNA. J
Bacteriol. 154:737-42.
De Maeyer, E., and J. De Maeyer-Guignard. 1998. Type I interferons. Int Rev
Immunol. 17:53-73.
de Wet, J.R., K.V. Wood, M. DeLuca, D.R. Helinski, et al. 1987. Sturcture and
expression in mammalian cells. Mol. Cell Biol. 7:725-737.
Demerec, M., E.A. Adelberg, A.J. Clark, and P.E. Hartman. 1966. A proposal
for a uniform nomenclature in bacterial genetics. Genetics. 54:61-76.
Denjean, F., J. Lachuer, A. Geloen, F. Cohen-Adad, et al. 1999. Differential
regulation of uncoupling protein-1, -2 and -3 gene expression by
sympathetic innervation in brown adipose tissue of thermoneutral or
cold-exposed rats. FEBS Lett. 444:181-5.
Devlin, J.J., L.C. Panganiban, and P.E. Devlin. 1990. Random peptide
libraries: a source of specific protein binding molecules. Science.
249:404-6.
DeWitt, S.H., J.S. Kiely, C.J. Stankovic, M.C. Schroeder, et al. 1993.
"Diversomers": an approach to nonpeptide, nonoligomeric chemical
diversity. Proc Natl Acad Sci U S A. 90:6909-13.
DeWys, W.D., C. Begg, P.T. Lavin, P.R. Band, et al. 1980. Prognostic effect
of weight loss prior to chemotherapy in cancer patients. Eastern
Cooperative Oncology Group. Am J Med. 69:491-7.
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-130-
Dunlop, J., and S. Rosenzweig-Lipson. 1998. Therapeutic approaches to
obesity. Exp. Opin. Ther. Patents. 8:1683-1694.
Eichelbaum, M., and B. Evert. 1996. Influence of pharmacogenetics on drug
disposition and response. Clin Exp Pharmacol Physiol. 23:983-5.
Ellington, A.D., and J.W. Szostak. 1990. In vitro selection of RNA molecules
that bind specific ligands. Nature. 346:818-22.
Elroy-Stein, O., and B. Moss. 1990. Cytoplasmic expression system based on
constitutive synthesis of bacteriophage T7 RNA polymerase in
mammalian cells. Proc. Natl. Acad. Sci. USA. 87:6743-6747.
US Patent No. 4,522,811. Serial injection of muramyldipeptides and
liposomes enhances the anti-infective activity of muramyldipeptides
Serial injection of muramyldipeptides and~liposomes enhances the anti-
infective activity of muramyldipeptides. 1985.
Eppstein, D.A., Y.V. Marsh, M. van der Pas, P.L. Felgner, et al. 1985.
Biological activity of liposome-encapsulated murine interferon gamma
is mediated by a cell membrane receptor. Proc Natl Acad Sci U S A.
82:3688-92.
Escudero, J., and B. Hohn. 1997. Transfer and integration of T-DNA without
cell injury in the host plant. Plant Cell. 9:2135-2142.
U.S. Patent No. 4,870,009. Method of obtaining gene product through the
generation of transgenic animals. 1989.
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-131-
Fekete, D.M., and C.L. Cepko. 1993. Retroviral infection coupled with tissue
transplantation limits gene transfer in the chick embryo. Proc. Natl.
Acad. Sci. USA. 90:2350-2354.
Felgner, P.L., T.R. Gadek, M. Holm, R. Roman, et al. 1987. Lipofectin: A
highly efficient, lipid-mediated DNA/transfection procedure. Proc. Natl.
Acad. Sci. USA. 84:7413-7417.
Felici, F., L. Castagnoli, A. Musacchio, R. Jappelli, et al. 1991. Selection
of
antibody ligands from a large library of oligopeptides expressed on a
multivalent exposition vector. J Mol Biol. 222:301-10.
Fieck, A., D.L. Wyborski, and J.M. Short. 1992. Modifications of the E.coli
Lac
repressor for expression in eukaryotic cells: effects of nuclear signal
sequences on protein activity and nuclear accumulation. Nucleic Acids
Res. 20:1785-91.
Finer, J.J., K.R. Finer, and T. Ponappa. 1999. Particle bombardment-
mediated transformation. Current Topics in microbiology and
immunology. 240:59-80.
Finn, P.J., N.J. Gibson, R. Fallon, A. Hamilton, et al. 1996. Synthesis and
properties of DNA-PNA chimeric oligomers. Nucleic Acids Res.
24:3357-63.
Fishwild, D.M., S.L. O'Donnell, T. Bengoechea, D.V. Hudson, et al. 1996.
High-avidity human IgG kappa monoclonal antibodies from a novel
strain of minilocus transgenic mice [see comments]. Nat Biotechnol.
14:845-51.
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-132-
Fleer, R., P. Yeh, N. Amellal, I. Maury, et al. 1991. Stable multicopy vectors
for high-level secretion of recombinant human serum albumin by
Kluyveromyces yeasts. Biotechnology (N Y). 9:968-75.
Fodor, S.P., R.P. Rava, X.C. Huang, A.C. Pease, et al. 1993. Multiplexed
biochemical assays with biological chips. Nature. 364:555-6.
Foellmi-Adams, L.A., B.M. Wyse, D. Hen-on, J. Nedergaard, et al. 1996.
Induction of uncoupling protein in brown adipose tissue. Synergy
between norepinephrine and pioglitazone, an insulin-sensitizing agent.
Biochem Pharmacol. 52:693-701.
Friedman, J.M. 1993. Obesity. Brown fat and yellow mice [news; comment].
Nature. 366: 720-1.
Fromm, M., L.P. Taylor, and V. Walbot. 1985. Expression of genes transferred
into monocot and dicot plant cells by electroporation. Proc. Natl. Acad.
Sci. USA. 82:5824-5828.
Fujita, T., H. Shubiya, T. Ohashi, K. Yamanishi, et al. 1986. Regulation of
human interleukin-2 gene: Functional DNA sequences in the 5'
flanking region for the gene expression in activated T lymphocytes.
Cell. 46:401-407.
Gabizon, A., R. Shiota, and D. Papahadjopoulos. 1989. Pharmacokinetics and
tissue distribution of doxorubicin encapsulated in stable liposomes with
long circulation times. J Natl Cancer Inst. 81:1484-8.
Gallagher, S.R. 1992. GUS protocols: Using the GUS gene as a reporter of
gene expression. Academic Press, San Diego, CA.
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-133-
Gallop, M.A., R.W. Barrett, W.J. Dower, S.P. Fodor, et al. 1994. Applications
of.combinatorial technologies to drug discovery. 1. Background and
peptide combinatorial libraries. J Med Chem. 37:1233-51.
Gasparini, P., A. Bonizzato, M. Dognini, and P.F. Pignatti. 1992. Restriction
site generating-polymerise chain reaction (RG-PCR) for the probeless
detection of hidden genetic variation: application to the study of some
common cystic fibrosis mutations. Mol Cell Probes. 6:1-7.
Gautier, C., F. Morvan, B. Rayner, T. Huynh-Dinh, et al. 1987. Alpha-DNA. IV:
Alpha-anomeric and beta-anomeric tetrathymidylates covalently linked
to intercalating oxazolopyridocarbazole. Synthesis, physicochemical
properties and poly (rA) binding. Nucleic Acids Res. 15:6625-41.
Genetics Computer Group_(GCG). 1999. Wisconsin Package. Wisconsin
Package, SeqLabO, SeqWeb~, Madison, Wisc.
Gennaro, A.R. 2000. Remington: The science and practice of pharmacy.
Lippincott, Williams & Wilkins, Philadelphia, PA.
Gibbs, R.A., P.N. Nguyen, and C.T. Caskey. 1989. Detection of single DNA
base differences by competitive oligonucleotide priming. Nucleic Acids
Res. 17:2437-48.
Gietz, R.D., R.A. Woods, P. Manivasakam, and R.H. Schiestl. 1998. Growth
and transformation of Saccharomyces cerevisiae. In Cells: A
laboratory manual. Vol. I. D. Spector, R. Goldman, and L. Leinwand,
editors. Cold Spring Harbor Press, Cold Spring Harbor, NY.
Goding, J.W. 1996. Monoclonal antibodies: Principles and Practice.
Academic Press, San Diego. 492 pp.
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-134-
Gorman, C.M., L.F. Moffat, and B.H. Howard. 1982. Recombinant genomes
which express chloramphenicol acetyltransferase in mammalian cells.
Mol. Cell. Biol. 2:1044-1051.
Graham, F.L., and A.J. van der Eb. 1973. A new technique for the assay of
infectivity of human adenovirus 5 DNA. Virology. 52:456-.
Griffin, H.G., and A.M. Griffin. 1993. DNA sequencing. Recent innovations
and future trends. ApplBiochem Biotechnol. 38:147-59.
Grompe, M., D.M. Muzny, and C.T. Caskey. 1989. Scanning detection of
mutations in human omithine transcarbamoylase by chemical
mismatch cleavage. Proc Natl Acad Sci U S A. 86:5888-92.
Gruber, M., B.A. Schodin, E.R. Wilson, and D.M. Kranz. 1994. Efficient tumor
cell lysis mediated by a bispecific single chain antibody expressed in
Escherichia coli. J Immunol. 152:5368-74.
Grunfeld, C., and K.R. Feingold. 1992. Tumor necrosis factor, interleukin, and
interferon induced changes in lipid metabolism as part of host defense.
Proc Soc Exp Biol Med. 200:224-7.
Guan, X.M., H. Yu, and L.H. Van der Ploeg. 1998. Evidence of altered
hypothalamic pro-opiomelanocortin/ neuropeptide Y mRNA expression
in tubby mice. Brain Res Mol Brain Res. 59:273-9.
Guatelli, J.C., K.M. Whitfield, D.Y. Kwoh, K.J. Barringer, et al. 1990.
Isothermal, in vitro amplification of nucleic acids by a multienzyme
reaction modeled after retroviral replication. Proc Natl Acad Sci U S A.
87:1874-8.
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-135-
Guebre-Xabier, M., S. Yang, H.A. Lin, R. Schwenk, et al. 2000. Altered
hepatic lymphocyte subpopulations in obesity-related murine fatty
livers: potential mechanism for sensitization to liver damage.
Hepatology. 31:633-640.
Gura, T. 1998. Uncoupling proteins provide new clue to obesity's causes
[news]. Science. 280:1369-70.
Hanahan, D. 1983. Studies on transformation of Escherichia coli with
plasmids. J. Mol. Biol. 166:557-580.
Hansen, G., and M.-D. Chilton. 1999. Lessons in gene transfer to plants by a
gifted microbe. Curr. Top. Microbiol. Immunol. 240:21-57.
Hansen, G., and M.S. Wright. 1999. Recent advances in the transformation of
plants. Trends Plant Sci. 4:226-231.
Hardman, J., A. Gilman, and L. Limbird. 1996. Goodman &Gilman's The
pharmacological basis of therapeutics. McGraw-Hill, New York. 1905
pp.
Harlow, E., and D. Lane. 1988. Antibodies: A laboratory manual. Cold Spring
Harbor Laboratory Press, Cold Spring Harbor. 726 pp.
Harlow, E., and D. Lane. 1999. Using antibodies: A laboratory manual. Cold
Spring Harbor Laboratory PRess, Cold Spring Harbor, New York.
Haseloff, J., and W.L. Gerlach. 1988. Simple RNA enzymes with new and
highly specific endoribonuclease activities. Nature. 334:585-91.
Hayashi, K. 1992. PCR-SSCP: A method for detection of mutations. Genetic
and Analytical Technipues Applications. 9:73-79.
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-136-
Helene, C. 1991. The anti-gene strategy: control of gene expression by
triplex-forming- oligonucleotides. Anticancer Drug Des. 6:569-84.
Helene, C., N.T. Thuong, and A. Harel-Bellan. 1992. Control of gene
expression by triple helix-forming oligonucleotides. The antigene
strategy. Ann N Y Acad Sci. 660:27-36.
Himms-Hagen, J. 1969a. The effect of age and cold acclimation on the
metabolism of brown adipose tissue in cold-exposed rats. Can J
Biochem. 47:251-6.
Himms-Hagen, J. 1969b. The role of brown adipose tissue in the calorigenic
effect of adrenaline and noradrenaline in cold-acclimated rats. J
Physiol (Lond). 205:393-403.
Hinnen, A., J.B. Hicks, and G.R. Fink. 1978. Transformation of yeast. Proc.
Natl. Acad. Sci. USA. 75:1929-1933.
Hoffman, F. 1996. Laser microbeams for the manipulation of plant cells and
subcellular structures. Plant Sci. 113:1-11.
Hogan, B., Beddington, R., Costantini, F., Lacy, E. 1994. Manipulating the
Mouse Embryo: A Laboratory Manual. Cold Spring Harbor Laboratory
Press. 500 pp.
Holliger, P., T. Prospero, and G. Winter. 1993. "Diabodies": small bivalent
and
bispecific antibody fragments. Proc Natl Acad Sci U S A. 90:6444-8.
Hoogenboom, H.R., A.D. Griffiths, K.S. Johnson, D.J. Chiswell, et al. 1991.
Multi-subunit proteins on the surface of filamentous phage:
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-137-
methodologies for displaying antibody (Fab) heavy and light chains.
Nucleic Acids Res. 19:4133-7.
Houghten, R.A., J.R. Appel, S.E. Blondelle, J.H. Cuervo, et al. 1992. The use
of synthetic peptide combinatorial libraries for the identification of
bioactive peptides. Biotechnipues. 13:412-21.
Hsu, I.C., Q. Yang, M.W. Kahng, and J.F. Xu. 1994. Detection of DNA point
mutations with DNA mismatch repair enzymes. Carcinogenesis.
15:1657-62.
Huang, J.Y., and D.L. Brutlag. 2001. The EMOTIF database. NucIeicAcids
Res. 29:202-4.
Hwang, K.J., K.F. Luk, and P.L. Beaumier. 1980. Hepatic uptake and
degradation of unilamellar sphingomyelin/cholesterol liposomes: a
kinetic study. Proc Natl Acad Sci U S A. 77:4030-4.
Hyrup, B., and P.E. Nielsen. 1996. Peptide nucleic acids (PNA): synthesis,
properties and potential applications. Bioorg Med Chem. 4:5-23.
Inoue, H., Y. Hayase, A. Imura, S. Iwai, et al. 1987a. Synthesis and
hybridization studies on two complementary nona(2'-O-
methyl)ribonucleotides. NucIeicAcids Res. 15:6131-48.
Inoue, H., Y. Hayase, S. Iwai, and E. Ohtsuka. 1987b. Sequence-dependent
hydrolysis of RNA using modified oligonucleotide splints and RNase H.
FEBS Lett. 215:327-30.
Ishiura, M., S. Hirose, T. Uchida, Y. Hamada, et al. 1982. Phage particle-
mediated gene transfer to cultured mammalian cells. Molecular and
Cellular Biology. 2:607-616.
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-138-
Ito, H., Y. Fukuda, K. Murata, and A. Kimura. 1983. Transformation of intact
yeast cells treated with alkali cations. J. Bacteriol. 153:163-168.
Janeway, C., and P. Travers. 1997. Immunobiology : the immune system in
health and disease. Current Biology ;
Garland Pub., London ; San Francisco
New York. 1 v. (various pagings).
Jayasena, S.D. 1999. Aptamers: an emerging class of molecules that rival
antibodies in diagnostics. Clin Chem. 45:1628-50.
Jones, P.T., P.H. Dear, J. Foote, M.S. Neuberger, et al. 1986. Replacing the
complementarity-determining regions in a human antibody with those
from a mouse. Nature. 321:522-5.
Junqueira, L.C., J. Carneiro, and R.O. Kelly. 1998. Basic Histology. Appleton
& Lange, Stamford. 494 pp.
Kapur, S., B. Marcotte, and A. Marette. 1999. Mechanism of adipose tissue
iNOS induction in endotoxemia. Am J Physiol. 276:E635-41.
Kato, T., M. Esumi, S. Yamashita, K. Abe, et al. 1992. Interferon-inducible
gene expression in chimpanzee liver infected with hepatitis C virus.
Virology. 190:856-60.
Kaufman, R.J. 1990. Vectors used for expression in mammalian cells.
Methods Enzymol. 185:487-511.
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-139-
Kaufman, R.J., P. Murtha, D.E. Ingolia, C.-Y. Yeung, et al. 1986. Selection
and amplification of heterologous genes encoding adenosine
deaminase in mammalian cells. Proc. Natl. Acad. Sci. USA. 83:3136-
3140.
Kawai, S., and M. Nishizawa. 1984. New procedure for DNA transfection with
polycation and dimethyl sulfoxide. MoL Cell. Biol. 4:1172.
Keen, J., D. Lester, C. Inglehearn, A. Curtis, et al. 1991. Rapid detection of
single base mismatches as heteroduplexes on Hydrolink gels. Trends
Genet. 7:5.
Kelly, J.M., A.C. Porter, Y. Chernajovsky, C.S. Gilbert, et al. 1986.
Characterization of a human gene inducible by alpha- and beta-
interferons and its expression in mouse cells. Embo J. 5:1601-6.
Kostelny, S.A., M.S. Cole, and J.Y. Tso. 1992. Formation of a bispecific
antibody by the use of leucine zippers. J Immunol. 148:1547-53.
W094/16101. DNA SEQUENCING BY MASS SPECTROMETRY. 1994.
Kozal, M.J., N. Shah, N. Shen, R. Yang, et al. 1996. Extensive polymorphisms
observed in HIV-1 Glade B protease gene using high-density
oligonucleotide arrays. Nat Med. 2:753-9.
Kozbor, D., P. Tripputi, J.C. Roder, and C.M. Croce. 1984. A human hybrid
myeloma for production of human monoclonal antibodies. J Immunol.
133:3001-5.
Kriegler, M. 1990. Gene transfer and expression: A laboratory manual.
Stockton Press, New York. 242 pp.
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-140-
WO 91/01140. HOMOLOGOUS RECOMBINATION FOR UNIVERSAL
DONOR CELLS AND CHIMERIC MAMMALIAN HOSTS. 1991.
Kwoh, D.Y., G.R. Davis, K.M. Whitfield, H.L. Chappelle, et al. 1989.
Transcription-based amplification system and detection of amplified
human immunodeficiency virus type 1 with a bead-based sandwich
hybridization format. Proc Natl Acad Sci U S A. 86:1173-7.
US Patent No. 5,223,409. Directed evolution of novel binding proteins. 1993.
Lakso, M., B. Sauer, B. Mosinger, E.J. Lee, et al. 1992. Targeted oncogene
activation by site-specific recombination in transgenic mice. Proc Natl
Acad Sci U S A. 89:6232-6.
Lam, K.S. 1997. Application of combinatorial library methods in cancer
research and drug discovery. Anticancer Drug Design. 12:145-167.
Lam, K.S., S.E. Salmon, E.M. Hersh, V.J. Hruby, et al. 1991. General method
for rapid synthesis of multicomponent peptide mixtures. Nature.
354:82-84.
Landegren, U., R. Kaiser, J. Sanders, and L. Hood. 1988. A ligase-mediated
gene detection technique. Science. 241:1077-80.
Landolfo, S., M. Gariglio, G. Gribaudo, and D. Lembo. 1998. The Ifi 200
genes: an emerging family of IFN-inducible genes. Biochimie. 80:721-
8.
WO 90/11354. Process for the specific replacement of a copy of a gene
present in the receiver genome via the integration of a gene. 1990.
U.S. Patent No. 4,736,866. Transgenic non-human animals. 1988.
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-141-
Leduc, N., and e. al. 1996. Isolated maize zygotes mimic in vivo embryogenic
development and express microinjected genes when cultured in vitro.
Dev. Biol. 10:190-203.
Lee, J.S., D.A. Johnson, and A.R. Morgan. 1979. Complexes formed by
(pyrimidine)n . (purine)n DNAs on lowering the pH are three-stranded.
Nucleic Acids Res. 6:3073-91.
Lee, V.H.L. 1990. Peptide and protein drug delivery. Marcel Dekker, New
York, NY.
Lemaitre, M., B. Bayard, and B. Lebleu. 1987. Specific antiviral activity of a
poly(L-lysine)-conjugated oligodeoxyribonucleotide sequence
complementary to vesicular stomatitis virus N protein mRNA initiation
site. Proc Natl Acad Sci U S A. 84:648-52.
Lembo, M., C. Sacchi, C. Zappador, G. Bellomo, et al. 1998. Inhibition of cell
proliferation by the interferon-inducible 204 gene, a member of the Ifi
200 cluster. Oncogene. 16:1543-51.
Lemischka, I.R., D.H. Raulet, and R.C. Mulligan. 1986. Developmental
potential and dynamic behavior of hematopoietic stem cells. Cell.
45:917-927.
Letsinger, R.L., G.R. Zhang, D. K. Sun, T. Ikeuchi, et al. 1989. Cholesteryl-
conjugated oligonucleotides: synthesis, properties, and activity as
inhibitors of replication of human immunodeficiency virus in cell culture.
Proc Natl Acad Sci U S A. 86:6553-6.
Li, E., T.H. Bestor, and R. Jaenisch. 1992. Targeted mutation of the DNA
methyltransferase gene results in embryonic lethality. Cell. 69:915-26.
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-142-
Linder, M.W., R.A. Prough, and R. Valdes. 1997. Pharmacogenetics: a
laboratory tool for optimizing therapeutic efficiency. Clin Chem. 43:254-
66.
Littlefield, J.W. 1964. Selection of hybrids from matings of fibroblasts in
vitro
and their presumed recombinants. Science. 145:709-710.
Lizardi, P.M., C.E. Guerra, H. Lomeli, I. Tussle-Luna, et al. 1988.
Exponential
amplification of recombinant-RNA hybridization probes. Biotechnology.
6:1197-1202.
Lonberg, N., and D. Huszar. 1995. Human antibodies from transgenic mice.
Int Rev Immunol. 13:65-93.
Lonberg, N., L.D. Taylor, F.A. Harding, M. Trounstine, et al. 1994. Antigen-
specific human antibodies from mice comprising four distinct genetic
modifications (see comments]. Nature. 368:856-9.
Lopata, M.A., D.W. Cleveland, and B. Sollner-Webb. 1984. High-level
expression of a chloramphenicol acetyltransferase gene by
DEAEdextran-mediated DNA traansfection couled with a
dimethylsulfoxide or glycerol shock treatment. Nucleic Acids Research.
12:5707.
Lowell, B.B., S.S. V, A. Hamann, J.A. Lawitts, et al. 1993. Development of ,
obesity in transgenic mice after genetic ablation of brown adipose
tissue [see comments]. Nature. 366:740-2.
Luckow, V.A. 1991. Cloning and expression of heterologous genes in insect
cells with baculovirus vectors. In Recombinant DNA technology and
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-143-
applications. A. Prokop, R.K. Bajpai, and C. Ho, editors. McGraw-Hill,
New York. 97-152.
Maher, L.J. 1992. DNA triple-helix formation: an approach to artificial gene
repressors? Bioessays. 14:807-15.
Mandel, M., and A. Higa. 1970. Calcium-dependent bacteriophage DNA
infection. J. Mol. biol. 53:159-162.
Marasco, W.A., W.A. Haseltine, and S.Y. Chen. 1993. Design, intracellular
expression, and activity of a human anti-human immunodeficiency
virus type 1 gp120 single-chain antibody. Proc Natl Acad Sci U S A.
90:7889-93.
Marks, J.D., A.D. Griffiths, M. Malmqvist, T.P. Clackson, et al. 1992. By-
passing immunization: building high affinity human antibodies by chain
shuffling. Biotechnology (N Y). 10:779-83.
Marks, J.D., H.R. Hoogenboom, T.P. Bonnert, J. McCafferty, et al. 1991. By-
passing immunization. Human antibodies from V-gene libraries
displayed on phage. J Mol Biol. 222:581-97.
Martin, F.J., and D. Papahadjopoulos. 1982. Irreversible coupling of
immunoglobulin fragments to preformed vesicles. An improved method
for liposome targeting. J Biol Chem. 257:286-8.
Maxam, A.M., and W. Gilbert. 1977. A new method for sequencing DNA. Proc
Natl Acad Sci U S A. 74:560-4.
Miller, A.D., and C. Buttimore. 1986. Redesign of retrovirus packaging cell
lines to avoid recombination leading to helper virus production. Mol.
Cell biol. 6:2895-2902.
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-144-
Miller, L. K. 1988. Baculoviruses as gene expression vectors. Annu. Rev.
Microbiol. 42:177-199.
Milstein, C., and A.C. Cuello. 1983. Hybrid hybridomas and their use in
immunohistochemistry. Nature. 305:537-40.
Min, W., S. Ghosh, and P. Lengyel. 1996. The interferon-inducible p202
protein as a modulator of transcription: inhibition of NF-kappa B, o-Fos,
and c-Jun activities. Mol Cell Biol. 16:359-68.
Minvielle-Sebastia, L., P.J. Preker, and W. Kelley. 1994. RNA14 and RNA15
proteins as components of a yeast pre-mRNA 3'-end processing factor.
Science. 266:1702-5.
US Patent No. 5,459,039. Methods for mapping genetic mutations. 1995.
Montague, C.T., I.S. Farooqi, J.P. Whitehead, M.A. Soos, et al. 1997.
Congenital leptin deficiency is associated with severe early-onset
obesity in humans. Nature. 387:903-8.
Mori, K., K. Fujimoto-Ouchi, T. Ishikawa, F. Sekiguchi, et al. 1996a. Murine
interleukin-12 prevents the development of cancer cachexia in a
murine model. Int J Cancer. 67:849-55.
Mori, K., K. Fujimoto-Ouchi, T. Ishikawa, F. Sekiguchi, et al. 1996b. Murine
interleukin-12 prevents the development of cancer cachexia in a
murine model. Int J Cancer. 67:849-55.
Morita, T., T. Sato, H. Nyunoya, A. Tsujimoto, et al. 1993. Isolation of a
cDNA
clone encoding DNA-binding protein (TAXREB107) that binds
specifically to domain C of the tax-responsive enhancer element in the
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-145-
long terminal repeat of human T-cell leukemia virus type I. AIDS Res
Hum Retroviruses. 9:115-21.
Morrison, S.L., L. Wims, S. Wallick, L. Tan, et al. 1987. Genetically
engineered antibody molecules and their application. Ann N YAcad
Sci. 507:187-98.
US Patent No. 4,683,202. Process for amplifying nucleic acid sequences.
1987.
US Patent No. 4,683,195. Process for amplifying, detecting, and/or cloning
nucleic acid sequences. 1987.
Munson, P.J., and D. Rodbard. 1980. Ligand: a versatile computerized
approach for characterization of ligand-binding systems. Anal Biochem.
107:220-39.
Myers, R.M., Z. Larin, and T. Maniatis. 1985. Detection of single base
substitutions by ribonuclease cleavage at mismatches in RNA:DNA
duplexes. Science. 230:1242-6.
US Patent No. 5,328,470. Treatment of diseases by site-specific instillation
of
cells or site-specific transformation of cells and kits therefor. 1994.
Naeve, C.W., G.A. Buck, R.L. Niece, R.T. Pon, et al. 1995. Accuracy of
automated DNA sequencing: a multi-laboratory comparison of
sequencing results. Biotechnipues. 19:448-53.
Nakai, K., and P. Horton. 1999. PSORT: a program for detecting sorting
signals in proteins and predicting their subcellular localization. Trends
Biochem Sci. 24:34-6.
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-146-
Nakamura, S., T. Otani, Y. Ijiri, R. Motoda, et al. 2000. IFN-gamma-dependent
and -independent mechanisms in adverse effects caused by
concomitant administration of IL-18 and IL-12. J Immunol. 164:3330-6.
Nakazawa, H., D. English, P.L. Randell, K. Nakazawa, et al. 1994. UV and
skin cancer: specific p53 gene mutation in normal skin as a biologically
relevant exposure measurement. Proc Natl Acad Sci U S A. 91:360-4.
Neumann, E., M. Schaefer-Ridder, Y. Wang, and P.H. Hofschneider. 1982.
Gene transfer into mouse lyoma cells by electroporation in high electric
fields. EM80 J. 1:841-845.
Nevill-Manning, C.G., T.D. Wu, and D.L. Brutlag. 1998. Highly specific protein
sequence motifs for genome analysis. Proc Natl Acad Sci U S A.
95:5865-71.
O'Gorman, S., D.T. Fox, and G.M. Wahl. 1991. Recombinase-mediated gene
activation and site-specific integration in mammalian cells. Science.
251:1351-5.
Okano, H., J. Aruga, T. Nakagawa, C. Shiota, et al. 1991. Myelin basic protein
gene and the function of antisense RNA in its repression in myelin-
deficient mutant mouse. J Neurochem. 56:560-7.
O'Reilly, D.R., L.K. Miller, and V.A. Luckow. 1992. Baculovirus expression
vectors. W.H. Freeman and Company, New York. .
Orita, M., H. Iwahana, H. Kanazawa, K. Hayashi, et al. 1989. Detection of
polymorphisms of human DNA by gel electrophoresis as single-strand
conformation polymorphisms. Proc Natl Acad Sci U S A. 86:2766-70.
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-147-
Ou-Lee, T.M., R. Turgeon, and R. Wu. 1986. Uptake and expression of a
foreign gene linked to either a plant virus or Drosophila promoter in
protoplasts of rice, wheat and sorghum. Proc. Natl. Acad. Sci. USA.
83:6815-6819.
Pace, C.N., F. Vajdos, L. Fee, G. Grimsley, et al. 1995. How to measure and
predict the molar absorption coefficient of a protein. Protein Sci.
4:2411-23.
Palmer, T.D., R.A. Hock, W.R.A. osborne, and A.D. Miller. 1987. Efficient
retrovirus-mediated transfer and expression of a human adenosine
deaminase gene in diploid skin fibroblasts from an adenosie-deficient
human. Proc. Natl. Acad. Sci. USA. 84:1055-1059.
Palou, A., C. Pico, M.L. Bonet, and P. Oliver. 1998. The uncoupling protein,
thermogenin. Int J Biochem Cell Biol. 30:7-11.
Pear, W., G. Nolan, M. Scott, and D. Baltimore. 1993. Production of high-titer
helper-free retroviruses by transient transfection. Proc. Natl. Acad. Sci.
USA. 90:8392-8396.
Perry-O'Keefe, H., X.W. Yao, J.M. Coull, M. Fuchs, et al. 1996. Peptide
nucleic acid pre-gel hybridization: an alternative to southern
hybridization. Proc Natl Acad Sci U S A. 93:14670-5.
Perusse, L., and C. Bouchard. 1999. Role of genetic factors in childhood
obesity and in susceptibility to dietary variations. Ann Med. 31 Suppl
1:19-25.
Petersen, K.H., D.K. Jensen, M. Egholm, O. Buchardt, et al. 1976. A PNA-
DNA linker synthesis of N-((4,4'-dimethoxytrityloxy)ehtyl)-N-(thymin-1-
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-148-
ylacetyl)glycine. Biorganic and Medicianl Chemistry Letters. 5:1119-
1124.
Pi-Sunjer, F., and N.O.E.I.E. Panel. 1998. Clinical Guidelines on the
Identification, Evaluation, and Treatment of Overweight and Obesity in
Adults-The Evidence Report. National Institutes of Health.
Pomp, D. 1997. Genetic dissection of obesity in polygenic animal models.
Behav Genet. 27:285-306.
Potter, H. 1988. Electroporation in biology: Methods, applications" and
instrumentation. Analytical Biochemistry. 174:361-373.
Potter, H., L. Weir, and P. Leder. 1984. Enhancer-dependent expression of
human kappa immunoglobulin genes introduced into mouse pre-B
lymphocytes by electroporation. Proc. NatL Acad. Sci. USA. 81:7161-
7165.
Presta, L.G. 1992. Antibody engineering. Curr Opin Biotechnol. 3:394-8.
Prosser, J. 1993. Detecting single-base mutations. Trends Biotechnol.
11:238-46.
Rasmussen, U.B., C. Wolf, M.G. Mattei, M.P. Chenard, et al. 1993.
Identification of a new interferon-alpha-inducible gene (p27) on human
chromosome 14q32 and its expression in breast carcinoma. Cancer
Res. 53:4096-101.
Rassoulzadegan, M., B. Binetruy, and F. Cuzin. 1982. High frequency of gene
transfer after fusion befinreen bacteria and eukaryotic cells. Nature.
295:257.
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-149-
Reisfeld, R.A., and S. Sell. ~~1985. Monoclonal antibodies and cancer therapy:
Proceedings of the Roche-UCLA symposium held in Park City, Utah,
January 26-February 2, 1985. Alan R. Liss, New York. 609 pp.
Rhodes, C.A., D.A. Pierce, I.J. Mettler, D. Mascarenhas, et al. 1988.
Genetically transformed maize plants from protoplasts. Science.
240:204-207.
Riechmann, L., M. Clark, H. Waldmann, and G. Winter. 1988. Reshaping
human antibodies for therapy. Nature. 332:323-7.
Rose, J.K., L. Buonocore, and M. Whitt. 1991. A new cationic liposome
reagent mediating nearly quantitative transfection of animal cells.
BioTechniques. 10:520-525.
Rossi, J.J. 1994. Practical ribozymes. Making ribozymes work in cells. Curr
Biol. 4:469-71.
Rossiter, B.J., and C.T. Caskey. 1990. Molecular scanning methods of
mutation detection. J Biol Chem. 265:12753-6.
Saiki, R.K., T.L. Bugawan, G.T. Horn, K.B. Mullis, et al. 1986. Analysis of
enzymatically amplified beta-globin and HLA-DQ alpha DNA with
allele-specific oligonucleotide probes. Nature. 324:163-6.
Saiki, R.K., P.S. Walsh, C.H. Levenson, and H.A. Erlich. 1989. Genetic
analysis of amplified DNA with immobilized sequence-specific
oligonucleotide probes. Proc Natl Acad Sci U S A. 86:6230-4.
Saleeba, J.A., and R.G. Cotton. 1993. Chemical cleavage of mismatch to
detect mutations. Methods Enzymol. 217:286-95.
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-150-
Sambrook, J. 1989. Molecular cloning: a laboratory manual. Cold Spring
Harbor Laboratory, Cold Spring Harbor.
Sandri-Goldin, R.M., A.L. Goldin, J.C. Glorioso, and M. Levine. 1981. High-
frequency transfer of cloned herpes simjplex virus type I sequences to
mammalian cells by protoplast fusion. Mol. Cell. Biol. 1:7453-752.
Sanger, F., S. Nicklen, and A.R. Coulson. 1977. DNA sequencing with chain-
terminating inhibitors. Proc Natl Acad Sci U S A. 74:5463-7.
Saunders, J.A., B.F. Matthews, and P.D. Miller. 1989. Plant gene transfer
using electrofusion and electroporation. In Electroporation and
electrofusion in cell biology. E. Neumann, A.E. Sowers, and C.A.
Jordan, editors. Plenum Press, New York. 343-354.
Savontaus, E., J. Rouru, O. Boss, R. Huupponen, et al. 1998. Differential
regulation of uncoupling proteins by chronic treatments with beta 3-
adrenergic agonist BRL 35135 and metformin in obese fa/fa Zucker
rats. 8iochem Biophys Res Commun. 246:899-904.
Sbarbati, A., F. Leclercq, F. Osculati, and I. Gresser. 1995. Interteron
alpha/beta-induced abnormalities in adipocytes of suckling mice. Biol
Cell. 83:163-7.
Schade, R., C. Staak, C. Hendriksen, M. Erhard, et al. 1996. The production
of avian (egg yold) antibodies: IgY. The report and recommendations
of ECVAM workshop. Alternatives to Laboratory Animals (ATLA).
24:925-934.
Schaffner, W. 1980. Direct transfer of cloned genes from bacteria to
mammalian cells. Proc. Natl. Acad. Sci. USA. 77:2163.
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-151-
Schook, L.B. 1987. Monoclonal antibody production techniques and
applications. Marcel Dekker, Inc., New York. 336 pp.
Schrauwen, P., K. Walder, and E. Ravussin. 1999. Human uncoupling
proteins and obesity. Obes Res. 7:97-105.
Scott, J.K., and G.P. Smith. 1990. Searching for peptide ligands with an
epitope library. Science. 249:386-90.
Selden, R.F., K. Burke-Howie, M.E. Rowe, H.M. Goodman, et al. 1986.
Human growth hormone as a reporter gene in regulation studies
employing transient gene expression. Molecular and Cellular Biololgy.
6:3173-3179.
Shalaby, M.R., H.M. Shepard, L. Presta, M.L. Rodrigues, et al. 1992.
Development of humanized bispecific antibodies reactive with cytotoxic
lymphocytes and tumor cells overexpressing the HER2 protooncogene.
J Exp Med. 175:217-25.
Shigekawa, K., and W.J. Dower. 1988. Electroporation of eukaryotes and
prokaryotes: A general approach to the introduction of macomolecules
into cells. BioTechnipues. 6:742-751.
Shillito, R. 1999. Methods of genetic transformations: Electroporation and
polyethylene glycol treatment. In Molecular improvement of cereal
crop. I. Vasil, editor. Kluwer, Dordrecht, The Netherlands. 9-20.
Shilo, B.Z., and R.A. Weinberg. 1981. DNA sequences homologous to
vertebrate oncogenes are conserved in Drosophila melanogaster. Proc
Natl Acad Sci U S A. 78:6789-92.
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-152-
Shopes, B. 1992. A genetically engineered human IgG mutant with enhanced
cytolytic activity. J Immunol. 148:2918-22.
Simonsen, C.C., and A. D. Levinson. 1983. Isolation and expression of an
altered mouse dihydrofolate reductase cDNA. Proc. Natl. Acid. Sci.
USA. 80:2495-2499.
US Patent No. 5,272,057. Method of detecting a predisposition to cancer by
the use of restriction fragment length polymorphism of the gene for
human poly (ADP-ribose) polymerise. 1993.
Southern, P.J., and P. Berg. 1982. Transformation of mammalian cells to
antibiotic resistanced with a bacterial gene under control of the SV40
early region promoter. J. Mol. Appl. Gen. 1:327-341.
Spiegelman, B.M., and J.S. Flier. 1996. Adipogenesis and obesity: rounding
out the big picture. Cell. 87:377-89.
Sreekrishna, K., R.H. Potenz, J.A. Cruze, W.R. McCombie, et al. 1988. High
level expression of heterologous proteins in methylotrophic yeast
Pichia pastoris. J Basic Microbiol. 28:265-78.
Stein, C.A., and J.S. Cohen. 1988. Oligodeoxynucleotides as inhibitors of
gene expression: a review. Cancer Res. 48:2659-68.
Stein, L., L. Kruglyak, D. Slonim, and E. Lander. 1995. RHMAPPER,
unpublished software. Whitehead Institute/Massachusetts Institute of
Technology Center for Genome Research, Cambridge, MA.
Stevenson, G.T., A. Pindar, and C.J. Slide. 1989. A chimeric antibody with
dual Fc regions (bisFabFc) prepared by manipulations at the IgG
hinge. Anticancer Drug Des. 3:219-30.
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-153-
Suresh, M.R., A.C. Cuello, and C. Milstein. 1986. Bispecific monoclonal
antibodies from hybrid hybridomas. Methods Enzymol. 121:210-28.
Tannenbaum, C.S., J. Major, Y. Ohmori, and T.A. Hamilton. 1993. A
lipopolysaccharide-inducible macrophage gene (D3) is a new member
of an interferon-inducible gene cluster and is selectively expressed in
mononuclear phagocytes. J Leukoc Biol. 53:563-8.
5,861,485. Polypeptides involved in body weight disorders, including obesity.'
1999.
Thomas, K.R., and M.R. Capecchi. 1987. Site-directed mutagenesis by gene
targeting in mouse embryo-derived stem cells. Cell. 51:503-12.
Thompson, J.A., and e. al. 1995. Maize transformation utilizing silicon
carbide
whiskers: A review. Euphytica. 85:75-80.
Tisdale, M.J. 1999. Wasting in cancer. J Nutr. 129:243S-246S.
Touraev, A., and e. al. 1997. Plant male germ line transformation. Plant J.
12:949-956.
Traunecker, A., F. Oliveri, and K. Karjalainen. 1991. Myeloma based
expression system for production of large mammalian proteins. Trends
Biotechnol. 9:109-13.
Trick, H.N., and e. al. 1997. Recent advances in soybean transformation.
Plant Tissue Cult. Biotechnol. 3:9-26.
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-154-
Tuerk, C., and L. Gold. 1990. Systematic evolution of ligands by exponential
enrichment: RNA ligands to bacteriophage T4 DNA polymerise.
Science. 249: 505-10.
Turner, D.L., E.Y. Snyder, and C.L. Cepko. 1990. Lineage-independent
determinationh of cell type in the embryonic mouse retina. Neuron.
4:833-845.
Tutt, A., G.T. Stevenson, and M.J. Glennie. 1991. Trispecific F(ab')3
derivatives that use cooperative signaling via the TCR/CD3 complex
and CD2 to activate and redirect resting cytotoxic T cells. J Immunol.
147:60-9.
van der Krol, A.R., J.N. Mol, and A.R. Stuitje. 1988b. Modulation of
eukaryotic
gene expression by complementary RNA or DNA sequences.
Biotechniques. 6:958-76.
van der Krol, A.R., J.N. Mol, and A.R. Stuitje. 1988x. Modulation of
eukaryotic
gene expression by complementary RNA or DNA sequences.
Biotechniques. 6:958-76.
Van Zwieten, P.A., K. L. Kim, A.J. Pijl, M.G. Hendriks, et al. 1996.
Hypertensive diabetic rats in pharmacological studies. Pharmacol Res.
33:95-105.
Verhoeyen, M., C. Milstein, and G. Winter. 1988. Reshaping human
antibodies: grafting an antilysozyme activity. Science. 239:1534-6.
Vitetta, E.S., R.J. Fulton, R.D. May, M. Till, et al. 1987. Redesigning
nature's
poisons to create anti-tumor reagents. Science. 238:1098-104.
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-155-
Voelker, R.A., W. Gibson, J.P. Graves, J.F. Sterling, et al. 1991. The
Drosophila suppressor of sable gene encodes a polypeptide with
regions similar to those of RNA-binding proteins. Mol Cell Biol. 11:894-
905.
US Patent No. 4,873,191. Genetic transformation of zygotes. 1989.
Wang, H., G. Chatterjee, J.J. Meyer, C.J. Liu, et al. 1999. Characteristics of
three homologous 202 genes (Ifi202a, Ifi202b, and Ifi202c) from the
murine interferon-activatable gene 200 cluster. Genomics. 60:281-94.
Weigle, D.S., and J.L. Kuijper. 1996. Obesity genes and the regulation of
body fat content. Bioessays. 18:867-74.
Wells, J.A., M. Vasser, and D.B. Powers. 1985. Cassette mutagenesis: an
efficient method for generation of multiple mutations at defined sites.
Gene. 34:315-23.
Wexler, B.C., S.G. lams, and J.P. McMurtry. 1980. Pathophysiological
differences between obese and non-obese spontaneously hypertensive
rats. Br J Exp Pathol. 61:195-207.
Whitt, M.A., L. Buonocore, J.K. Rose, V. Ciccarone, et al. 1990. TransfectACE
reagent promotes transient transfection frequencies greater than 90%.
Focus. 13:8-12.
Wigler, M., A. Pellicer, S. Silversttein, and R. Axel. 1978. Biochemical
transfer
of single-copy eucaryotic genes using total cellular DNA as donor. Cell.
14:725.
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-156-
Williams, D.A., I.R. Lemischka, D.G. Nathan, and R.C. Mulligan. 1984.
Introduction of a new genetic material into pluripotent haematopoietic
stem cells of the mouse. Nature. 310:476-480.
Wilmut, I., A.E. Schnieke, J. McWhir, A.J. Kind, et al. 1997. Viable offspring
derived from fetal and adult mammalian cells. Nature. 385:810-3.
Wolff, E.A., G.J. Schreiber, W. L. Cosand, and H.V. Raff. 1993. Monoclonal
antibody homodimers: enhanced antitumor activity in nude mice.
Cancer Res. 53:2560-5.
Wong, T.K., and E. Neumann. 1982. Electric field mediated gene transfer.
Biochemical and Biophysical Research Communications. 107:584-587.
Wyborski, D.L., L.C. DuCoeur, and J.M. Short. 1996. Parameters affecting the
use of the lac repressor system in eukaryotic cells and transgenic
animals. Environ Mol Mutagen. 28:447-58.
Wyborski, D.L., and J.M. Short. 1991. Analysis of inducers of the E.coli lac
repressor system in mammalian cells and whole animals. Nucleic Acids
Res. 19:4647-53.
Yaswen, L., N. Diehl, M.B. Brennan, and U. Hochgeschwender. 1999. Obesity
in the mouse model of pro-opiomelanocortin deficiency responds to
peripheral melanocortin. Nat Med. 5:1066-1070.
Zhou, G., and et al. 1983. Introduction of exogenous DNA into cotton
embryos. Methods Enzymol. 101:433-481.
Zoller, M.J., and M. Smith. 1987. Oligonucleotide-directed mutagenesis: a
simple method using two oligonucleotide primers and a single-stranded
DNA template. Methods Enzymol. 154:329-50.
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
-157-
Zon, G. 1988. Oligonucleotide analogues as potential chemotherapeutic
agents. Pharm Res. 5:539-49.
Zuckermann, R.N., E.J. Martin, D.C. Spellmeyer, G.B. Stauber, et al. 1994.
Discovery of nanomolar ligands for 7-transmembrane G-protein-
coupled receptors from a diverse N-(substituted)glycine peptoid library.
J Med Chem. 37:2678-85.
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
1
SEQUENCE LISTING
<110> Lewin, David
Adams, Sean
15
<120> IF1206, A NOVEL INTERFERON-INDUCED POLYPEPTIDE, AND
NUCLEIC ACIDS ENCODING THE SAME
<130> 10716/32
<160> 24
<170> PatentIn version 3.0
<210> 1
<211> 1879
<212> DNA
<213> . Interferon inducible polypeptide 206 (IFI206) nucleic acid
sequence (mouse)
<400> 1
cgattcgaat tcggccacactggccggatcctctagagatccctcgacctcgacccacgc60
gtccgagcac agtgagagacacccagtgctgctcaagaagtgaaacaactctgagagtat120
cctaaccact ggtgtcttcctttataccccatttttcactttctcagttactgaattatc180
tgcctaccta ctcaaaccaagcaggccacttctgttgttgaagatctcagcacctgtaca240
ttgctgccga aattccagggagtataaccaacaacttgaaagatggagaatgaatataag300
agacttgttc tgctggaaggacttgaatgtatcaataagcatca.attcaatttatttaag360
tcattgatgg tcaaagatttaaatctggaagaagacaaccaagagaaatataccacgttt420
cagattgcta acatgatggtaaagaaatttccagctgatgctggattggacaaactgatc480
aacttttgtg aacgtgtaccaactcttaaaaaacgtgctgaaattcttaaaaaagagaga540
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
2
tcagaagtaa atcactggaaataaataggcaagaagcaagtcctgcaaca600
caggagaaac
cctacatcaa ctacaagccacatgttagcatctgaaagaggcaagacttccacaaccacc660
actgagaccc aggaagagacttccacagcccagtcggggacttccacagctcacgcgggg720
acttctacag caccggcggggactttcacaactcagaaaagaaaaagtaggagagaagaa780
gagactggag tgaaaaagagcaaggcgtctaaggaaccagatcagcctccctgttgtgaa840
gaacccacag ccaggtgccagtcaccaatactccacagctcatcttcagcttcatctaac900
attccttcag ctacgaaccaaaaaccacaaccccagaaccagaacattcccagaggtgct960
gttctccact cagagcccctgacagtgatggtgctcactgcaacagacccgtttgaatat1020
gaatcaccag aacatgaagtaaagaacatgtttcatgctacagtggctacagtgagccag1080
tatttccatg tgaaagttttcaacatcaacttgaaagagaagttcacaaaaaagaatttt1140
atcatcatat ccaattactttgagagcaaaggcatcctggagatcaatgagacttcctct1200
gtgttaaagg ctgatcctgaccaaatgattgaagtgcccaacaatattatcagaaatgca1260
aatgccagtc ctaagatctgtgatattcaaaagggtacttctggagcagtgttctatgga1320
gtgtttacat tacacaagaaaaaagtgaaaacacagaacacaagctatgaaataaaagat1380
ggttcaggaa gtatagaagtggaggggagtggacaatggcacaacatcaactgtaaggaa1440
ggagataagc tccacctcttctgctttcacctgaaaagagaaagaggacaaccaaagtta1500
gtgtgtggag accacagtttcgtcaagatcaaggtcaccaaggctgggaaaaaaaaggaa1560
gcatcaactg tcctgtcaagcacaaaaaatgaagaagaaaataattacccaaaagatgga1620
attaaggtag agatgccagactattcacgtctaaatgacagctttagtagtatatccaag1680
catttaataa ccttcatacctgatttctgattttgtattttcatttgaaaaaatttctta1740
ttgttctgtt tttctatgaaaataaaatttgatttaatttctctactgtaaaaataataa1800
acatgtcttt ttaaagggacatcaaaaaaaaagaaggagggaggggagggggttggtata1860
agaaaaaccg gggcggccg 1879
<210> 2
<211> 475
<212> PRT
<213> Interferon
inducible
polypeptide
IFI206 (mouse)
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
3
<400> 2
Met Glu Asn Glu 'I~rr Lys Arg Leu Leu Glu LeuGlu
Leu Val Gly Cars
1 5 10 15
Ile Asn Lys His Gln Phe Asn Lys Ser Leu ValLys
Leu Phe Met Asp
20 25 30
Leu Asn Leu Glu Glu Asp Asn Lys err Thr PheGln
Gln Glu Thr Ile
35 40 45
Ala Asn Met Met Val Lys Lys Ala Asp Ala LeuAsp
Phe Pro Gly Lys
50 55 60
Leu Ile Asn Phe Cps Glu Arg Thr Leu Lys ArgAla
Val Pro Lys Glu
65 70 75 80
Ile Leu Lys Lys Glu Arg Ser Thr Gly Glu SerLeu
Glu Val Thr Glu
85 90 95
Ile Asn Arg Gln Glu Ala Ser Thr Pro Thr Thr'I'hr
Pro Ala Ser Ser
100 105 110
His Met Leu Ala Ser Glu Arg Thr Ser Thr ThrThr
Gly Lys Thr Glu
115 120 125
Thr Gln Glu Glu Thr Ser Thr Ser Gly Thr ThrAla
Ala Gln Ser His
130 135 140
Ala Gly Thr Ser 'rhr Ala Pro T'hr Phe Thr GlnLys
Ala Gly Thr Arg
145 150 155 160
Lys Ser Arg Arg Glu Glu Glu Val Lys Lys LysAla
Thr Gly Ser Ser
165 170 175
Lys Glu Pro Asp Gln Pro Pro Glu Glu Pro AlaArg
Cys Cars Thr Cys
180 185 190
Gln Ser Pro Ile Leu His Ser Ser Ala Ser AsnIle
Ser Ser Ser Pro
195 200 205
Ser Ala Thr Asn Gln Lys Pro Gln Asn Gln IlePro
Gln Pro Asn Arg
210 215 220
Gly Ala Val Leu His Ser Glu Thr Val Met LeuThr
Pro Leu Val Ala
225 230 235 240
Thr Asp Pro Phe Glu Tyr Glu Glu His Glu LysAsn
Ser Pro Val Met
245 250 255
Phe His Ala Thr Val Ala Thr Gln 'I~rr ValLys
Val Ser Phe His Val
260 265 270
Phe Asn Ile Asn Leu Lys Glu Thr Lys Lys PheIle
Lys Phe Asn Ile
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
4
275 280 285
Ile Ser Asn Tyr Phe Glu Ser Lys Gly GluIle Asn Thr
Ile Leu Glu
290 295 300
Ser Ser Val Leu Lys Ala Asp Pro Asp IleGlu Val Asn
Gln Met Pro
305 310 315 320
Asn Ile Ile Arg Asn Ala Asn Ala Ser IleCps Asp Gln
Pro Lys Ile
325 330 335
Lys Gly Thr Ser Gly Ala Val Phe Tyr PheThr Leu Lys
Gly Val His
340 345 350
Lys Lys Val Lys Thr Gln Asn Thr Ser IleLys Asp Ser
Tyr Glu Gly
355 360 365
Gly Ser Ile Glu Val Glu Gly Ser Gly HisAsn Ile Cars
Gln Trp Asn
370 375 380
Lys Glu Gly Asp Lys Leu His Leu Phe HisLeu Lys Glu
Cars Phe Arg
385 390 395 400
Arg Gly Gln Pro Lys Leu Val Cys Gly SerPhe Val Ile
Asp His Lys
405 410 415
Lys Val Thr Lys Ala Gly Lys Lys Lys SerThr Val Ser
Glu Ala Leu
420 425 430
Ser Thr Lys Asn Glu Glu Glu Asn Asn LysAsp Gly Lys
Tyr Pro Ile
435 440 445
Val Glu Met Pro Asp Tyr Ser Arg Leu SerPhe Ser Ile
Asn Asp Ser
450 455 460
Ser Lys His Leu Ile Thr Phe Ile Pro
Asp Phe
465 470 475
<210> 3
<211> 1840
<212> DNA
<213> Interferon-inducible polypeptidevariant
206 (IFI206b)
nucleic
acid sequence (mouse)
<400> 3
cgattcgaat tcggccacac tggccggatc ctctagagat ccctcgacct cgacccacgc 60
gtccgagcac agtgagagac acccagtgct gctcaagaag tgaaacaact ctgagagtat 120
cctaaccact ggtgtcttcc tttatacccc atttttcact ttctcagtta ctgaattatc 180
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
tgcctaccta ctcaaaccaa tctgttgttgaagatctcagcacctgtaca240
gcaggccact
ttgctgccga aattccagggagtataaccaacaacttgaaagatggagaatgaatataag300
5 agacttgttc tgctggaaggacttgaatgtatcaataagcatcaattcaatttatttaag360
tcattgatgg tcaaagatttaaatctggaagaagacaaccaagagaaatataccacgttt420
cagattgcta acatgatggtaaagaaatttccagctgatgctggattggacaaactgatc480
aacttttgtg aacgtgtaccaactcttaaaaaacgtgctgaaattcttaaaaaagagaga540
tcagaagtaa caggagaaacatcactggaaataaataggcaagaagcaagtcctgcaaca600
cctacatcaa ctacaagccacatgttagcatctgaaagaggcgagacttccacaacccag660
gaagagactt ccacagccca gtccgggcct tcgacagctc ctgcgcggac tttaacagcc 720
cagaaaagaa agaagaagagactggagtgaaaaagagcaa ggcgtctaag780
aaagtaggag
gaaccagatc agcctccctgttgtgaagaacccacagccaggtgccagtc accaatactc840
cacagctcat cttcagcttcatctaacattccttcagctacgaaccaaaa accacaaccc900
cagaaccaga acattcccagaggtgctgttctccactcagagcccctgac agtgatggtg960
ctcactgcaa cagacccgtttgaatatgaatcaccagaacatgaagtaaa gaacatgttt1020
catgctacag tggctacagtgagccagtatttccatgtgaaagttttcaa catcaacttg1080
aaagagaagt tcacaaaaaagaattttatcatcatatccaattactttga gagcaaaggc1140
atcctggaga tcaatgagacttcctctgtgttaaaggctgatcctgacca aatgattgaa1200
gtgcccaaca atattatcagaaatgcaaatgccagtcctaagatctgtga tattcaaaag1260
ggtacttctg gagcagtgttctatggagtgtttacattacacaagaaaaa agtgaaaaca1320
cagaacacaa gctatgaaataaaagatggttcaggaagtatagaagtgga ggggagtgga1380
caatggcaca acatcaactgtaaggaaggagataagctccacctcttctg ctttcacctg1440
aaaagagaaa gaggacaaccaaagttagtgtgtggagaccacagtttcgt caagatcaag1500
gtcaccaagg ctgggaaaaaaaaggaagcatcaactgtcctgtcaagcac aaaaaatgaa1560
gaagaaaata attacccaaaagatggaattaaggtagagatgccagacta tcacgtctaa1620
atgacagctt tagtagtatatccaagcatttaataaccttcatacctgat ttctgatttt1680
gtattttcat ttgaaaaaatttcttattgttctgtttttctatgaaaata aaatttgatt1740
taatttctct actgtaaaaataataaacatgtctttttaaagggacatca aaaaaaaaga1800
aggagggagg ggagggggttggtataagaaaaaccggggc 1840
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
6
<210> 4
<211> 445
<212> PRT
<213> Interferon inducible polypeptide IFI206 variant (IFI206b)
<400> 4
Met Glu Asn Glu Tyr Lys Arg Leu'Val Leu Leu Glu Gly Leu Glu Cps
1 5 10 15
Ile Asn Lys His Gln Phe Asn Leu Phe Lys Ser Leu Met Val Lys Asp
25 30
20 Leu Asn Leu Glu Glu Asp Asn Gln Glu Lys Tyr Thr Thr Phe Gln Ile
35 40 45
Ala Asn Met Met Val Lys Lys Phe Pro Ala Asp Ala Gly Leu Asp Lys
50 55 60
Leu Ile Asn Phe Cars Glu Arg Val Pro Thr Leu Lys Lys Arg Ala Glu
65 70 75 80
Ile Leu Lys Lys Glu Arg Ser Glu Val Thr Gly Glu Thr Ser Leu Glu
85 90 95
Ile Asn Arg Gln Glu Ala Ser Pro Ala Thr Pro Thr Ser Thr Thr Ser
100 105 110
His Met Leu Ala Ser Glu Arg Gly Glu Thr Ser Thr Thr Gln Glu Glu
115 120 125
Thr Ser Thr Ala Gln Ser Gly Pro Ser Thr Ala Pro Ala Arg Thr Leu
130 135 140
Thr Ala Gln Lys Arg Lys Ser Arg Arg Glu Glu Glu Thr Gly Val Lys
145 150 155 160
Lys Ser Lys Ala Ser Lys Glu Pro Asp Gln Pro Pro Cars Cars Glu Glu
16s 170 175
Pro Thr Ala Arg Cars Gln Ser Pro Ile Leu His Ser Ser Ser Ser Ala
180 185 190
Ser Ser Asn Ile Pro Ser Ala Thr Asn Gln Lys Pro Gln Pro Gln Asn
195 200 205
Gln Asn Ile Pro Arg Gly Ala Val Leu His Ser Glu Pro Leu Thr Val
210 215 220
Met Val Leu Thr Ala Thr Asp Pro Phe Glu Tyr Glu Ser Pro Glu His
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
7
225 230 235 240
Glu Val Lys Asn Met Phe His Ala Thr Val Ala Thr Val Ser Gln Tyr
245 250 255
Phe His Val Lys Val Phe Asn Ile Asn Leu Lys Glu Lys Phe Thr Lys
260 265 270
Lys Asn Phe Ile Ile Ile Ser Asn Tyr Phe Glu Ser Lys Gly Ile Leu
275 280 285
Glu Ile Asn Glu Thr Ser Ser Val Leu Lys Ala Asp Pro Asp Gln Met
290 295 300
Ile Glu Val Pro Asn Asn Ile Ile Arg Asn Ala Asn Ala Ser Pro Lys
305 310 315 320
Ile Cps Asp Ile Gln Lys Gly Thr Ser Gly Ala Val Phe Tyr Gly Val
325 330 335
Phe Thr Leu His Lys Lys Lys Val Lys Thr Gln Asn Thr Ser Tyr Glu
340 345 350
Ile Lys Asp Gly Ser Gly Ser Ile Glu Val Glu Gly Ser Gly Gln Trp
355 360 365
His Asn Ile Asn Cars Lys Glu Gly Asp Lys Leu His Leu Phe Cps Phe
370 375 380
His Leu Lys Arg Glu Arg Gly Gln Pro Lys Leu Val C'ys Gly Asp His
385 390 395 400'
Ser Phe Val Lys Ile Lys Val Thr Lys Ala Gly Lys Lys Lys Glu Ala
405 410 415
Ser Thr Val Leu Ser Ser Thr Lys Asn Glu Glu Glu Asn Asn Tyr Pro
420 425 430
Lys Asp Gly Ile Lys Val Glu Met Pro Asp Tyr His Val
435 440 445
<210> 5
<211> 30
<212> DNA
<213> muIFIhlog.probel
<400> 5
tcctgcacac ctacatcaac tacaagccac 30
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
8
<210> 6
<211> 18
<212> PRT
<213> IFI motif
<220>
<221> X
<222> (2) . . (2)
<223> Phe, Tyr, Trp, Leu, or Ile
<220>
<221> X
<222> (8) . . (8)
<223> Thr, Ala, Ser
<220>
<221> X
<222> (9) . . (9)
<223> Any
<220>
<221> X
<222> (10) .. (10)
<223> Ser, Thr, Lys, or Arg
<220>
<221> X
<222> (11) .. (11)
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
9
<223> Glu or Gln
<220>
<221> X
<222> (12) .. (12)
<223> Phe, Tyr, or Txp
<220>
<221> X
<222> (13) .. (13)
<223> Phe, Tyr, or Trp
<220>
<221> X
<222> (14) .. (14)
<223> His, Arg, Lys, Phe, Tyr, or Trp
<220>
<221> X
<222> (16) .. (16)
<223> Lys, Arg, Met, Leu, or Ile
<220>
<zzl> x
<2zz> (la) . . (1s)
<223> Phe, Tyr, Leu, or Ile
<400> 6
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
Met Xaa His Ala Thr Val Ala Xaa Xaa Xaa Xaa Xaa Xaa Xaa Val Xaa
1 5 10 15
Val Xaa
5
<210> 7
<211> 7
10
<212> PRT
<213> IFI motif
<220>
<221> X
<222> (1)..(1)
<223> Phe or Tyr
<220>
<221> X
<222> (7)..(7)
<223> Ser or Thr
<400> 7
Xaa His Ala Thr Val Ala Xaa
1 5
<210> s
<211> 35
<212> PRT
<213> IFI motif
<220>
<221> X
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
11
<222> (2)..(2)
<223> Any
<220>
<221> X
<222> (3)..(3)
<223> Any
<220>
<221> X
<222> (4) . . (4)
<223> Glu, Lys, or
Gln
<220>
<221> X
<222> (7) . . (7)
<223> Any
<220>
<221> X
<222> (8)..(8)
<223> Ile, Leu, or
Val
<220>
<221> X
<222> (9)..(9)
<223> Ile, Leu, or
Val
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
12
<220>
<221> X
<222> (12) .. (12)
<223> Any
<z2o>
<221> X
<222> (14) .. (14)
<223> Phe, Leu, or Tyr
<220>
<221> X
<222> (15) .. (15)
<223> Asp or Glu
<220>
<221> X
<222> (16) .. (16)
<223> Any
<220>
<221> X
<222> (17) .. (17)
<223> Ile, Leu, Met or Val
<220>
<221> X
<222> (18) .. (18)
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
13
<223> Any
<2zo>
<221> X
<222> (19)..(19)
<223> Any
<220>
<221> X
<222> (20) .. (20)
<223> Any
<220>
<221> X
<222> (21) .. (21)
<223> Any
<220>
<221> X
<222> (22) .. (22)
<223> Phe, Leu or err
<220>
<221> X
<222> (23) .. (23)
<223> Any
<220>
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
14
<221> X
<222> (24) . . (24)
<223> Any
<220>
<221> X
<222> (25) .. (25)
<223> Phe, Ile, Leu, Met, or Val
<220>
<221> X
<222> (27) .. (27)
<223> Any
<220>
<z21> x
<222> (28) .. (28)
<223> Phe, Leu, or 'I~rr
<220>
<221> X
<222> (29) .. (29)
<223> Ile, Leu, Met, or Val
<220>
<221> X
<222> (30) .. (30)
<223> Any
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
<220>
5 <221> X
<222> (31) .. (31)
<223> Any
<220>
<221> X
<222> (32) .. (32)
<223> Asp or Glu
<220>
<221> x
<222> (33) .. (33)
<223> Phe, Leu, or T~rr
<220>
<221> x
<222> (34) .. (34)
<223> Any
<220>
<221> x
<222> (35) . . (35)
<223> Ile, Leu, or Val
<400> s
Met Xaa Xaa Xaa Xaa Tyr Lys Xaa Xaa Xaa Leu Leu Xaa Gly Xaa Xaa
1 5 10 15
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
16
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Lys Xaa Xaa Xaa Xaa Xaa Xaa
20 25 30
xaa xaa Xaa
<210> 9
10 <211> 14
<212> PRT
<213> IFI motif
15
<220>
20 <221> X
<222> (1) . . (1)
<223> Phe, Leu, or Tyr
<220>
<221> X
<222> (2)..(2)
<223> Any
<220>
<221> X
<222> (3)..(3)
<223> Any
<220>
<z21> x
<222> (4) . . (4)
<223> Phe, Ile, Leu, Met, or Val
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
17
<z2o>
<221> X
<222> (6)..(6)
<223> Any
<220>
<221> X
<222> (7)..(7)
<223> Phe, Leu, or 'I~r
<220>
<221> x
<222> (8) . . (8)
<223> Ile, Leu, Met, or Val
<220>
<221> X
<222> (9) . . (9)
<223> Any
<220>
<221> X
<222> (10) .. (10)
<223> Any
<220>
<221> X
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
18
<222> (11) .. (11)
<223> Asp or Glu
<220>
<221> X
<222> (12) .. (12)
<223> Phe, Leu, or Tyr
<220>
<221> X
<222> (13) .. (13)
<223> Any
<220>
<221> X
<222> (14) .. (14)
<223> Ile, Leu, or Val
<400> 9
Xaa Xaa Xaa Xaa Lys Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
1 s to
<210> to
<211> 48
<212> PRT
<213> IFI motif
<220>
<221> X
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
19
<222> (1) . . (1)
<223> Lys, Gln, or Arg
<220>
<221> X
<222> (5)..(5)
<223> Any
<220>
<221> X
<222> (6)..(6)
<223> Any
<220>
<221> X
<222> (7) . . (7)
<223> Phe, Ile, Leu, Met,
or Val
<220>
<221> X
<222> (8) . . (8)
<223> Lys, Gln or Arg
<220>
<221> X
<222> (9) . . (9)
<223> Ile, Leu, or Val
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
<220>
<221> X
5 <222> (10) . . (10)
<223> Ala, Ser, or Thr
<220>
<221> X
<222> (11) . . (11)
<223> Asp or Asn
<220>
<221> X
<222> (12) .. (12)
<223> Any
<220>
<221> X
<222> (14) .. (14)
<223> Any
<220>
<221> X
<222> (15) .. (15)
<223> Any
<220>
<221> X
<222> (18)..(18)
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
21
<223> Any
<220>
<221> X
<222> (19) .. (19)
<223> Any
<220>
<221> X
<222> (20) .. (20)
<223> Any
<220>
<221> X
<222> ~ (21) .. (21)
<223> Ala or Ser
<220>
<221> X
<222> (22) .. (22)
<223> Any
<2zo>
<221> X
<222> (24) .. (24)
<223> Any
<220>
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
22
<221> X
<222> (28) .. (28)
<223> Any
<220>
<221> X
<222> (29) .. (29)
<223> Phe, Ile, Leu, Met, or Val
<220>
<221> X
<222> (30) . . (30)
<223> Any
<220>
<221> X
<222> (31) . . (31)
<223> Glu, Lys, or Gln
<220>
<221> X
<222> (32) .. (32)
<223> Any
<220>
<221> X
<222> (33) .. (33)
<223> Ile, Leu, Met or Val
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
23
<220>
<221> X
<222> (34) .. (34)
<223> Any
<220>
<z21> x
<222> (35) .. (35)
<223> Any
<220>
<221> x
<222> (37) .. (37)
<223> Glu, Lys, Gln or Arg
<220>
<221> X
<222> (38) . . (38)
<223> Any
<zzo>
<221> x
<222> (39) .. (39)
<223> Any
<220>
<221> x
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
24
<222> (40) .. (40)
<223> Any
<220>
<221> X
<222> (41) .. (41)
<223> Any
<220>
<221> X
<222> (42) .. (42)
<223> Any
<220>
<221> X
<222> (43) .. (43)
<223> Any
<220>
<221> X
<222> (45) .. (45)
<223> Lys or Arg
<zzo>
<221> x
<222> (46) .. (46)
<223> Any
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
<220>
<221> X
5 <222> (48) .. (48)
<223> Lys or Arg
<220>
<221> X
<222> (3) . . (3)
<223> Any
<400> 10
Xaa Glu Xaa Tyr Xaa Xaa XaaXaa Xaa Xaa Xaa Xaa
Xaa Xaa Met Lys
1 5 10 15
Phe Xaa Xaa Xaa Xaa Leu LysLeu Ile Xaa Xaa Xaa
Xaa Xaa Xaa Xaa
20 25 30
Xaa Xaa Xaa Leu Xaa Xaa XaaXaa Xaa Leu Xaa Glu
Xaa Xaa Xaa Xaa
35 40 45
<210> 11
<211> 11
<212> PRT
<213> IFI motif
<220>
<221> X
<222> (1) . . (1)
<223> Lys, Gln, or
Arg
<220>
<221> X
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
26
<222> (3) . . (3)
<223> Any
<220>
<221> X
<222> (5)..(5)
<223> Any
<220>
<221> X
<222> (6)..(6)
<223> Any
<220>
<221> X
<222> (7)..(7)
<223> Phe, Ile, Leu, Met or Val
<220>
<221> X
<222> (8) . . (8)
<223> Lys, Gln, or Arg
<220>
<221> X
<222> (9) . . (9)
<223> Ile, Leu or Val
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
27
<z2o>
<221> X
<222> (10) .. (10)
<223> Ala, Ser, or Thr
<z2o>
<221> X
<222> (11) . . (11)
<223> Asp or Asn
<400> 11
Xaa Glu Xaa Tyr Xaa Xaa Xaa Xaa Xaa Xaa Xaa
1 5 10
<210> 12
<211> 18
<212> PRT
<213> IFI motif
<220>
<221> X
<222> (2) . . (2)
<223> Any
<220>
<221> X
<222> (3) . . (3)
<223> Thr, Gly, Val, or Ser
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
28
<220>
<221> X
<222> (4) . . (4)
<223> Thr, Ala, Ser, or Glu
<220>
<221> X
<222> (5) . . (5)
<223> Gln, Lys, Ala, Glu, or Arg
<220>
<221> X
<222> (6) . . (6)
<223> Lys or Arg
<220>
<221> X
<222> (7)..(7)
<223> Arg or Lys
<220>
<221> X
<222> (8)..(8)
<223> Lys, Arg, Val, or Asn
<220>
<221> X
<222> (9) . . (9)
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
29
<223> Any
<220>
<221> X
<222> (10) .. (10)
<223> Any
<220>
<221> X
<222> (11) .. (11)
<223> Any
<220>
<221> X
<222> (12) .. (12)
<223> Any
<220>
<221> X
<222> (13) .. (13)
<223> Glu, Gln, Lys, Arg, Ile or Leu
<220>
<221> X
<222> (14)..(14)
<223> Any
<220>
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
<221> X
<222> (15) .. (15)
5 <223> Any
<220>
<221> x
<222> (16) .. (16)
<223> Any
<220>
<221> X
<222> (17) .. (17)
<223> Any
<400> 12
Thr Xaa Xaa Xaa Xaa Xaa Xaa xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
1 5 10 15
Xaa Lys
<210> 13
<211> 9
<212> PRT
<213> IFI motif
<220>
<221> X
<222> (2)..(2)
<223> Lys, Arg, Glu
or Gln
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
31
<220>
<221> X
<222> (3)..(3)
<223> Any
<220>
<221> X
<222> (5) . . (5)
<223> Asp, Glu, Ser, Thr, Asn, or Gln
<220>
<221> X
<222> (6) . . (6)
<223> Lys, Arg, Thr, or Ser
<220>
<221> X
<222> (7) . . (7)
<223> Leu, Ile, or Val
<220>
<221> X
<222> (8) . . (8)
<223> Any
<400> 13
Cys Xaa Xaa Gly Xaa Xaa Xaa Xaa Leu
1 5
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
32
<210> 14
<211> 2118
< 212 > DIdA
<213> Interferon inducible polypeptide 206 variant (IFI206c) nucleotide
sequence (mouse)
<400> 14
agcacagtga gagacacccagtgctgctcaagaagtgaaacaactctgagagtatcctaa60
ccactggtgt cttcctttataccccatttttcactttctcagttactgaattatctgcct120
acctactcaa accaagcaggccacttctgttgttgaagatctcagcacctgtacattgct180
gccgaaattc cagggagtataaccaacaacttgaaaaatggagaatgaatataagagact240
tgttctgctg gaaggacttgaatgtatcaataagcatcaattcaatttatttaagtcatt300
gatggtcaaa gatttaaatctggaagaagacaaccaagagaaatataccacgtttcagat360
tgctaacatg atggtaaagaaatttccagctgatgctggattggacaaactgatcaactt420
ttgtgaacgt gtaccaactcttaaaaaacgtgcagaaattcttaaaaaagagagatcaga480
agtaacagga gaaacatcactggaaataaataggcaagaagcaggtcctgcaacacctac540
atcaactaca agccacatgttagcatctgaaagaggcgagacttccgcaacccaggaaga600
gacttccaca ggccagaaaaggaagccaggtggagagattaggtctgtctcccagccaag660
gccagtcagg aaccagaggggagctgggctggcaaggaaaggttggggtgtgctggctga720.
aggagagaaa ggagagaaaggagagaaaggaaagaaggaaggagagaaagaaagaaagaa780
agaaaggaag gaaggaaggaaggaagaaagaaaaagaaagaaagaaagaaagaaagaaag840
aaagaaagaa agaaagaaagaaagaaagaaagaaagaaagacagaccacaggtttgtcat900
CttCagCCtC CaggtttgtCatCttCagCCtccaggtttgtcatcttcagcctccaggtt960
tgtcatcttc agcctccaggtttgtcatcttcagcctccaggtttgtcatcttcagcctc1020
caggtttgtc atcttcagcctccaggtttgtcatcttcagcctccaggtttgtcatcttc1080
agcctccagg tttgtcatcttcagcctccacaggtttgtcatcttcagcctccaggtagg1140
tggggtaggc tctggctctgtgtcctgcctttagagactagcacaccagcaaaccaaatt1200
cccatctcgt cagagtagcagtaagggcaagcccaggggggtagtgtgccacccagtgac1260
ccattgatcc ttgggtaatggtcctctctgtccataaggctcaggagtcacagaaggtcc1320
i
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
33
agctatctca accccacactcttgggaacacctccccgcctttttagaacagtaagttct1380
ctgtggcctc atgctgttctgagagccccttggtgctgccacttctccctgtgctctctc1440
attcccttct gcttcctgcacatctgctgaacccacgtcatttccggtactgcctagtta1500
gtcctggaaa aaactctcttggccattggcaggaatcagtgtagaaaagtttgcaggaca1560
tccctggctt tccagagcatgcagaatcagtgtagctcatgacactgtcagacactttag1620
acacgagaga aattcttaagagacctacgcctttgacctctcagatggcacggccgctgt1680
acacagggaa gtgttcactttccttgagacgggaagctggcttcaggttcctatggaata1740
gagttttctt tccttattcccttttcacctaacagttttgctcttcagacagctgcccat1800
tccctaagcc tcgcctagaaaccataacacagatgtacctagatgaatgagccaagcaac1860
tgagaaacag caaggaaactggaaggcttgaggtgggaatatgaaggtcaagacaagaat1920
tagggagctg aaaagatggctcatcagttgactgctcttccagaggtcctgagttcaatt1980
cccagcaacc acatgatggctcgcaaccatctataataggatccacacactcttctggtg2040
tgtctgaaga cagctacagtgtactcataataaataaagtaaataaatttaaaaaaaaaa2100
aaaaaatgga gaatgaat 2118
<210> 15
<211> 318
<212> PRT
<213> Interferon inducible polypeptide 206 variant (IFI206c) (mouse)
<400> 15
Met Glu Asn Glu Tyr Lys Arg Leu Val Leu Leu Glu Gly Leu Glu Cps
1 5 10 15
Ile Asn Lys His Gln Phe Asn Leu Phe Lys Ser Leu Met Val Lys Asp
20 25 30
Leu Asn Leu Glu Glu Asp Asn Gln Glu Lys Tyr Thr Thr Phe Gln Ile
35 40 45
Ala Asn Met Met Val Lys Lys Phe Pro Ala Asp Ala Gly Leu Asp Lys
50 55 60
Leu Ile Asn Phe Cps Glu Arg Val Pro Thr Leu Lys Lys Arg Ala Glu
65 70 75 80
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
34
Ile Leu Lys Lys Glu Arg Ser Glu Val
Thr Gly Glu Thr Ser Leu Glu
85 90 95
Ile Asn Arg Gln Glu Ala Gly Pro Ala Thr Ser Thr Thr Ser
Thr Pro
loo l05 llo
His Met Leu Ala Ser Glu Arg Gly Glu Ala Thr Gln Glu Glu
Thr Ser
115 120 125
Thr Ser Thr Gly Gln Lys Arg Lys Pro Glu Ile Arg Ser Val
Gly Gly
130 135 140
Ser Gln Pro Arg Pro Val Arg Asn Gln Ala Gly Leu Ala Arg
Arg Gly
145 150 155 160
Lys Gly Trp Gly Val Leu Ala Glu Gly Gly Glu Lys Gly Glu
Glu Lys
165 170 175
Lys Gly Lys Lys Glu Gly Glu Lys Glu Lys Glu Arg Lys Glu
Arg Lys
180 185 190
Gly Arg Lys Glu Glu Arg Lys Arg Lys Arg Lys Lys Glu Arg
Lys Glu
195 200 205
Lys Lys Glu Arg Lys Lys Glu Arg Lys Arg Lys Thr Asp His
Lys Glu
210 215 220
Arg Phe Val Ile Phe Ser Leu Gln Val Leu Gln Pro Pro Gly
Cars His
225 230 235 240
Leu Ser Ser Ser Ala Ser Arg Phe Val Ser Leu Gln Val Cys
Ile Phe
245 250 255
His Leu Gln Pro Pro Gly Leu Ser Ser Ser Arg Phe Val Ile
Ser Ala
260 265 270
Phe Ser Leu Gln Val Cars His Leu Gln Gly Leu Ser Ser Ser
Pro Pro
275 280 285
Ala Ser Arg Phe Val Ile Phe Ser Leu Phe Val Ile Phe Ser
His Arg
290 295 300
Leu Gln Val Gly Gly Val Gly Ser Gly Ser Cys Leu
Ser Val
305 310 315
<210> 16 ,
<211> 35
<212> DNA
<213> IFI206.snr1 PCR oligo)
'
<400> 16
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
catcatgtta gcaatctgaa acgtggtata tttet 35
<210> 17
5
<211> 31
<212> DNA
<213> IFI206.snr1 PCR oligo)
<400> 17
15 gtaaagaaat ttccagctga tgctggattg g 31
<210> 18
20 <211> 36
<212> DNA
<213> IFI206.p1 probe
<400> la
cttcctgggt tgcggaagtc tcgcctcttt cagatg 36
<210> 19
<211> 24
<212> DNA
<213> muIFIhlog.forl
<400> 19
tggaaataaa taggcaagaa agca 24
<210> 20
<211> 24
<212> DNA
<213> muIFIhlog.revl
<400> 20
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
36
tctcgccttc tttcagatgt aaca 24
<210> 21
<211> 2353
<212> DNA
<213> Interferon (IFI204)
inducible
polypeptide
204
<400> 21
tttctcattt actgacttatctgcctacctactcaagccaagcaggccacttcttgaccc60
ggtgaaggtc tcaggatctgtacatcactgcagaaatatccaggaaggctcagcaacaac120
ttcaaagatg gtgaatgaatacaagagaattgttctgctgagaggacttgaatgtatcaa180
taagcattat tttagcttatttaagtcattgctggccagagatttaaatctggaaagaga240
caaccaagag caatacaccacgattcagattgctaacatgatggaagagaaatttccagc300
tgattctgga ttgggcaaactgattgagttttgtgaagaagtaccagctcttagaaaacg360
agctgaaatt cttaaaaaagagagatcagaagtaacaggagaaacatcactggaaaaaaa420
tggtcaagaa gcaggtcctgcaacacctacatcaactacaagccacatgttagcatctga480
aagaggcgag acttctgcaacccaggaagagacttccacagctcaggcggggacttccac540
agctcaggcg aggacttccacagctcaggcgaggacttccacagctcaggcgaggacttc600
cacagctcag gcgaggacttccacagctcaggcggggacttccacagcccagaaaagaaa660
aagtatgaga gaagaagagactggagtgaaaaagagcaaggcggctaaggaaccagatca720
gcctccctgt tgtgaagaacccacagccatgtgccagtcaccaatactccacagctcatc780
ttcggcttca tctaacattccttcggctaagaaccaaaaatcacaaccccagaatcagaa840
tattcccaga ggtgctgttctccactcagagcccctgacagtgatggtgctcactgcaac900
agacccattt gaatatgaatcaccagaacatgaagtaaagaacatgcttcatgctacagt960
ggctacagtg agccagtatttccatgtgaaagttttcaacatcaacttgaaagaaaagtt1020
cacaaaaaag aattttatcatcatatccaattactttgagagcaaaggcatcctggagat1080
caatgagact tcctctgtgttagaggctgctcctgaccaaatgattgaagtgcccaacag1140
tattatcaga aatgcaaatg.ccagtcctaagatctgtgatattcaaaagggtacttctgg1200
agcagtgttc tatggagtgtttacattacacaagaaaacagtgaaccgaaagaacacaat1260
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
37
ctatgaaata caggaagcatagaagtggtggggagtggaa 1320
aaagatggtt aatggcacaa
catcaactgc aaggaaggagataaactccacctcttctgctttcacctgaaaacaattga1380
caggcaacca aagttagtgtgtggagaacacagtttcatcaagatatcaaagagaggaaa1440
tgtaccaaag gagcctgctaaggaagaagatcaccatcatggtcccaaacaagtgatggt1500
gctgaaagta acagaaccatttacatatgacctgaaagaggataaaagaatgtttcatgc1560
taccgtggct actgaaactgagttcttcagagtgaaggtttttgacacagctctaaagag1620
caagttcatc ccaagaaatatcattgccatatcagattattttgggtgcaatgggtttct1680
ggagatatac agagcttcctgtgtctctgatgtgaacgttaatccaagaatggttatctc1740
aaatacactg agacaaagagctaatgcaactcctaaaatttcttatcttttctcacaagc1800
aagggggaca tttgtgagtggagagtacttagtaaataagaaaacggagaggaataaatt1860
catttactat ggaattggagatgatacagggaaaatggaagtggtggtttatggaagact1920
caccaatgtc aggtgtgaaccaggcagtaaactaagacttgtctgctttgaattgacttc1980
cactgaagat gggtggcagctgaggtctgtaaggcacagttacatgcaggtcatcaatgc2040
tagaaagtga aggaaagccactcaacccagactcagtcgggagaacctctctggaaccat2100
acttctgaaa acctgaatgccaatgatatttttttgtggagataagattcaattacagaa2160
aataaatgtg tagaagcctattgaaatatcagtcctataaagattatctcttaattctag2220
gaaatggtat tttcttatatctttacacattt~tctatatctaaattcatttgttgtctct2280
ataacttcta taactgttcaatttgcaatttttatgcctaaaacttataaaaataaattc2340
acacaatttc tgt 2353
<210> 22
<211> 640
<212> PRT
<213> Interferon inducible protein 204 (IFI204)
<400> 22
Met Val Asn Glu Tyr Lys Arg Ile val Leu Leu Arg Gly Leu Glu Cps
1 5 10 15
Ile Asn Lys His Tyr Phe Ser Leu Phe Lys Ser Leu Leu Ala Arg Asp
20 25 30
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
38
Leu Asn Leu Glu Arg Asp Asn ThrIle Ile
Gln Glu Gln Gln
Tyr Thr
35 40 45
Ala Asn Met Met Glu Glu Lys Ala Asp GlyLeu Lys
Phe Pro Ser Gly
50 55 60
Leu Ile Glu Phe Cars Glu Glu Ala Leu LysArg Glu
Val Pro Arg Ala
65 70 75 80
'
Ile Leu Lys Lys Glu Arg Ser Thr Gly ThrSer Glu
Glu Val Glu Leu
85 90 95
Lys Asn Gly Gln Glu Ala Gly Thr Pro SerThr Ser
Pro Ala Thr Thr
loo l05 llo
His Met Leu Ala Ser Glu Arg Thr Ser ThrGln Glu
Gly Glu Ala Glu
115 120 125
Thr Ser Thr Ala Gln Ala Gly Thr Ala AlaArg Ser
Thr Ser Gln Thr
130 135 140
Thr Ala Gln Ala Arg Thr Ser Gln Ala ThrSer Ala
Thr Ala Arg Thr
145 150 155 160
Gln Ala Arg Thr Ser Thr Ala Gly Thr ThrAla Lys
Gln Ala Ser Gln
165 170 175
Arg Lys Ser Met Arg Glu Glu Gly Val LysSer Ala
Glu Thr Lys Lys
180 1s5 190
Ala Lys Glu Pro Asp Gln Pro Cys Glu ProThr Met
Pro Cys Glu Ala
195 200 205
cys Gln Ser Pro Ile Leu His Ser Ser SerSer Ile
Ser Ser Ala Asn
210 215 220
Pro Ser Ala Lys Asn'Gln Lys Pro Gln GlnAsn Pro
Ser Gln Asn Ile
225 230 235 240
Arg Gly Ala Val Leu His Ser Leu Thr MetVal Thr
Glu Pro Val Leu
245 250 255
Ala Thr Asp Pro Phe Glu 'I~rr Pro Glu GluVal Asn
Glu Ser His Lys
260 265 270
Met Leu His Ala Thr Val Ala Ser Gln PheHis Lys
Thr Val 'I~rr Val
275 280 285
Val Phe Asn Ile Asn Leu Lys Phe Thr LysAsn Ile
Glu Lys Lys Phe
290 295 300
Ile Ile Ser Asn Tyr Phe Glu Gly Ile GluIle Glu
Ser Lys Leu Asn
305 310 315 320
Thr Ser Ser Val Leu Glu Ala Asp Gln IleGlu Pro
Ala Pro Met Val
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
39
325 330 335
Asn Ser Ile Ile Arg Asn Ala Asn Pro Ile Cars Ile
Ala Ser Lys Asp
340 345 350
'
Gln Lys Gly Thr Ser Gly Ala Val Gly Phe Thr His
Phe Tyr Val Leu
355 360 365
Lys Lys Thr Val Asn Arg Lys Asn Tyr Ile Lys Gly
Thr Ile Glu Asp
370 375 380
Ser Gly Ser Ile Glu Val Val Gly Lys His Asn Asn
Ser Gly Trp Ile
385 390 395 400
Cars Lys Glu Gly Asp Lys Leu His Cps His Leu Thr
Leu Phe Phe Lys
405 410 415
Ile Asp Arg Gln Pro Lys Leu Val Glu Ser Phe Lys
Cys Gly His Ile
420 ' 425 430
Ile Ser Lys Arg Gly Asn Val Pro Pro Lys Glu Asp
Lys Glu Ala Glu
435 440 445
His His His Gly Pro Lys Gln Val Leu Val Thr Pro
Met Val Lys Glu
450 455 460
Phe Thr Tyr Asp Leu Lys Glu Asp Met ~:is Ala Val
Lys Arg Phe Thr
465 470 475 480
Ala Thr Glu Thr Glu Phe Phe Arg Val Asp Thr Leu
Val Lys Phe Ala
485 490 495
Lys Ser Lys Phe Ile Pro Arg Asn Ala Ser Asp Phe
Ile Ile Ile Tyr
500 505 510
Gly Cars Asn Gly Phe Leu Glu Ala Cars Val Asp
Ile Tyr Arg Ser Ser
515 520 525
Val Asn Val Asn Pro Arg Met Val Asn Leu Arg Arg
Ile Ser Thr Gln
530 535 540
Ala Asn Ala Thr Pro Lys Ile Ser Phe Gln Ala Gly
Tyr Leu Ser Arg
545 550 555 560
Thr Phe Val Ser Gly Glu Tyr Leu Lys Thr Glu Asn
Val Asn Lys Arg
565 570 575
Lys Phe Ile Tyr Tyr Gly Ile Gly Thr Lys Met Val
Asp Asp Gly Glu
580 585 590
Val Val Tyr Gly Arg Leu Thr Asn Cars Pro Gly Lys
Val Arg Glu Ser
595 600 605
Leu Arg Leu Val Cars Phe Glu Thr Asp Gly Gln
Leu Thr Ser Glu Trp
610 615 620
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
Leu Arg Ser Val Arg His Ser 'I~r Met Gln Val Ile Asn Ala Arg Lys
625 630 635 640
<210> 23
5
<211> 1623
<212> DNA
10 <213> Interferon-inducible polypeptide 205D3 (IFI205D3)
<400> 23
15 cctgcctacc tactcaagccaagcaggccacttcttgacccggtgaaggtctcaggatct60
gtacatcact gcagaaatatccaggaaggctcagcaacaacttcaaagatggtgaatgaa120
tacaagagaa ttgttctgctgagaggacttgaatgtatcaataagcattattttagctta180
20
tttaagtcat tgctggccagagatttaaatctggaaagagacaaccaagagcaatacacc240
acgattcaga ttgctaacatgatggaagagaaatttccagctgattctggattgggcaaa300
25 ctgattgagt tttgtgaagaagtaccagctcttagaaaacgagctgaaattcttaaaaaa360
gagagatcag aagtaacaggagaaacatcactggaaaaaaatggtcaagaagcaggtcct420
gcaacaccta catcaactacaagccacatgttagcatctgaaagaggcgagacttctgca480
30
acccaggaag agacttccacagctcaggcggggacttccacagctcaggcggggacttcc540
acagctcagg cggggacttccacagcccagaaaagaaaaagtatgagagaagaagagact600
35 ggagtgaaaa agagcaaggcggctaaggaaccagatcagcctccctgttgtgaagaaccc660
acagccatgt gccagtcaccaatactccacagctcatcttcggcttcatctaacattctt720
tcggctaaga accaaaaatcacaaccccagaaccagaacattcccagaggtgctgttctc780
40
cactcagagc ccctgacagtgatggtgctcactgcaacagacccgtttgaatatgaatca840
ccagaacatg aagtaaagaacatgtttcatgctacagtggctacagtgagccagtatttc900
catgtgaaag ttttcaacatcgatttgaaagagaagttcacaaaaaataattttatcacc960
atatccaatt actttgagagcaaaggcatcctggagatcaatgagacttcctctgtgtta1020
gaggctgctc ctaaacaaatgattgaagtgcccaactgtattaccagaaatgcaaatgcc1080
agtcctaaga tctgtgatattcaaaagggtacttctggaacagtgttctatggagtgttt1140
acattacaca agaaaaaagtgaaaacacagaacacaagctatgaaataaaagatggttca1200
ggaaggatag aagttgtggggagtggacaatggcacaacatcaactgtaaggaaggagat1260,
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
41
aagctccacc tcttctgctt tcacctgaaaagagaaagaggacaaccaaa 1320
gttagtgtgt
ggagaccaca gtttcgtcaa ggtcaccaaggctgggaaaaaaaaagaagcatcaactgtc1380
cagtgaagca caaaaaatga agaagaaaatgattacccaaaagttggaattaaggtagag1440
atgccaaaat agaaatgtca cctctaaatgacagctttagtagtatatccaaccattgat1500
taatcttcat acctgatttc tgattttgtgttttcatttgaaaaattcttattgttctgt1560
ttttctatga aaataaaatt tgatttcatttctctactgtaaaaataataaacatgtctt1620
ttt 1623
<210> 24
<211> 425
<212> PRT
<213> Interferon inducible protein 205D3 (IFI 205D3)
<400> 24
Met Val Asn Glu Tyr Lys Arg Ile Leu Leu Arg LeuGlu
Val Gly Cars
1 5 10 15
Ile Asn Lys His Tyr Phe Ser Leu Lys Ser Leu AlaArg
Phe Leu Asp
20 25 30
Leu Asn Leu Glu Arg Asp Asn Gln Gln Tyr Thr IleGln
Glu Thr Ile
35 40 45
Ala Asn Met Met Glu Glu Lys Phe Ala Asp Ser LeuGly
Pro Gly Lys
50 55 60
Leu Ile Glu Phe Cps Glu Glu Val Ala Leu Arg ArgAla
Pro Lys Glu
65 70 75 80
Ile Leu Lys Lys Glu Arg Ser Glu Thr Gly Glu SerLeu
Val Thr Glu
85 90 95
Lys Asn Gly Gln Glu Ala Gly Pro Thr Pro Thr ThrThr
Ala Ser Ser
100 105 110
His Met Leu Ala Ser Glu Arg Gly Thr Ser Ala GlnGlu
Glu Thr Glu
115 120 125
Thr Ser Thr Ala Gln Ala Gly Thr Thr Ala Gln GlyThr
Ser Ala Ser
130 135 140
Thr Ala Gln Ala Gly Thr Ser Thr Gln Lys Arg SerMet
Ala Lys Arg
145 150 155 160
CA 02402877 2002-09-17
WO 01/68830 PCT/USO1/08333
42
Glu Glu Glu Thr Ala Ala Asp
Gly Val Lys Lys Glu
Lys Ser Lys Pro
165 170 175
Gln Pro Pro Cps Cars Glu Glu AlaMet Cys Ser Ile
Pro Thr Gln Pro
180 185 190
Leu His Ser Ser Ser Ser Ala AsnIle Leu Ala Asn
Ser Ser Ser Lys
195 200 205
Gln Lys Ser Gln Pro Gln Asn IlePro Arg Ala Leu
Gln Asn Gly Val
210 215 220
His Ser Glu Pro Leu Thr Val LeuThr Ala Asp Phe
Met Val Thr Pro
225 230 235 240
Glu Tyr Glu Ser Pro Glu His LysAsn Met His Thr
Glu Val Phe Ala
245 250 255
Val Ala Thr Val Ser Gln Tyr ValLys Val Asn Asp
Phe His Phe Ile
260 265 270
Leu Lys Glu Lys Phe Thr Lys PheIle Thr Ser Tyr
Asn Asn Ile Asn
275 280 285
Phe Glu Ser Lys Gly Ile Leu AsnGlu Thr Ser Leu
Glu Ile Ser Val
290 295 300
Glu Ala Ala Pro Lys Gln Met ValPro Asn Ile Arg
Ile Glu Cuss Thr
305 310 315 320
Asn Ala Asn Ala Ser Pro Lys AspIle Gln Gly Ser
Ile Cps Lys Thr
325 330 335
Gly Thr Val Phe Tyr Gly Val LeuHis Lys Lys Lys
Phe Thr Lys Val
340 345 350
Thr Gln Asn Thr Ser Tyr Glu AspGly Ser Arg Glu
Ile Lys Gly Ile .
355 360 365
Val Val Gly Ser Gly Gln Tzp IleAsn Cars Glu Asp
His Asn Lys Gly
370 375 380
Lys Leu His Leu Phe Cys Phe LysArg Glu Gly Pro
His Leu Arg Gln
385 390 395 400
Lys Leu Val Cys Gly Asp His ValLys Val Lys Gly
Ser Phe Thr Ala
405 410 415
Lys Lys Lys Glu Ala Ser Thr
Val Gln
420 425
