Note: Descriptions are shown in the official language in which they were submitted.
CA 02409705 2002-11-15
WO 01/87921 PCT/USO1/15464
GENE RESPONSIBLE FOR STARGARDT-LIKE
DOMINANT MACULAR DYSTROPHY
FIELD OF THE INVENTION
This invention relates to the gene responsible for causing Stargardt-like
dominant macular dystrophy, and to assays which use this gene or the protein
encoded
by it, and to methods of treating this condition by administering the protein.
BACKGROUND
Macular dystrophy is a term applied to a heterogeneous group of
diseases that collectively are the cause of severe visual loss in a large
number of
people. A common characteristic of macular dystrophy is a progressive loss of
central
vision resulting from the degeneration of photoreceptor cells in the retinal
macula. In
many forms of macular dystrophy, the end stage of the disease results in legal
blindness. More than 20 types of macular dystrophy are known: e.g., age-
related
macular dystrophy, Stargardt-like dominant macular dystrophy, recessive
Stargardt's
disease, atypical vitelliform macular dystrophy (VMD1), Usher Syndrome Type
1B,
autosomal dominant neovascular inflammatory vitreoretinopathy, familial
exudative
vitreoretinopathy, and Best's macular dystrophy (also known as hereditary
macular
dystrophy or Best's vitelliform macular dystrophy (VMD2). For a review of the
macular dystrophies, see Sullivan & Daiger, 1996, Mol. Med. Today 2:380-386.
Stargardt-like dominant macular dystrophy (also called autosomal
dominant macular atrophy) is a juvenile-onset macular degeneration. Patients
afflicted with this disease generally have normal vision as young children,
but during
childhood, visual loss begins, which rapidly progresses to legal blindness.
Clinically
it is characterized by the presence of an atrophic macular lesion with sharp
borders
and is often associated with yellow fundus flecks. The pathological features
seen in
Stargardt-like dominant macular dystrophy are in many ways similar to the
features
seen in age-related macular dystrophy (AMD), the leading cause of blindness in
older
patients in the developed world.
AMD is an extraordinarily difficult disease to study genetically, since
by the time patients are diagnosed, their parents are usually no longer living
and their
children are still asymptomatic. Thus, family studies which have led fo the
discovery
-1-
CA 02409705 2002-11-15
WO 01/87921 PCT/USO1/15464
of the genetic basis of many other diseases have not been practical for age-
related
macular dystrophy. As there are currently no widely effective treatments for
AMD, it
is hoped that study of Stargardt-like dominant macular dystrophy, and in
particular the
discovery of the underlying genetic cause of Stargardt-like dominant macular
dystrophy, will shed light on age-related macular dystrophy as well. A
significant
proportion of the AMD cases is caused by recessive mutations in the recessive
Stargardt disease gene. (Allikmets, et al 1997 Science 277:1805-1807).
It seems reasonable to suggest that mutations within the disease gene
responsible for Stargardt-like dominant macular dystrophy which closely
resembles
the recessive Stargardt disease may be responsible for the significant
proportion of
AMD cases. It would be desirable to characterize the gene responsible for this
disease
in order to have a better understanding of this disease and to elucidate its
potential
role in other forms of macular degeneration.
'DETAILED DESCRIPITON OF THE INVENTION
In accordance with this invention, a mutant gene responsible for
autosomal dominant Stargardt-like macular dystrophy has been identified and
sequenced. Additionally, the normal allelic form of this gene has also been
identified
and sequenced.
A new gene, presently designated "ELF" (for Elongation of Fatty
Acids), is potentially involved in the elongation pathway for the synthesis of
decosahexaenoic fatty acid (DHA), a critical component in retinas. The mutant
version of this gene contains a 5-base pair deletion which causes a frameshift
mutation. The resultant mutated protein does not function in the DHA pathway,
resulting in retinal dysfunction.
Thus one aspect of this invention is a nucleic acid encoding the normal
form of ELF protein, which is free from associated nucleic acids. In preferred
embodiments, the nucleic acid sequence is a DNA, and in more preferred
embodiments it is a cDNA.
Another aspect of this invention is a nucleic acid encoding a mutant
form of ELF, which is free from associated nucleic acids. In preferred
embodiments,
the nucleic acid is a DNA, and in more preferred embodiments, it is a cDNA.
_2_
CA 02409705 2002-11-15
WO 01/87921 PCT/USO1/15464
Another aspect of this invention are the novel proteins, normal ELF
and its mutant form, free from associated proteins. Also part of this
invention are
fragments of these proteins which retain at least one biological activity.
A further aspect for this invention is a method of treating individuals
who suffer from Stargardt-like macular dystrophy comprising administering to
the
individual an effective amount of ELF protein. The ELF protein may be in a
pharmaceutically acceptable carrier, and it may be administered in the form of
eyedrops or other ophthalmic preparation.
Another aspect of this invention is a method of treating individuals
who suffer from Stargardt-like macular dystrophy comprising introducing a
nucleic
acid encoding the ELF protein into the individual. This gene therapy approach
may
involve the use of viral vectors, such as adenovirus, or it may involve the
use of
plasmid DNA.
Yet another aspect of this invention are assays to identify if an
individual is at risk for Stargardt-like macular dystrophy comprising
determining if
the individual's DNA contains a gene for a mutant form of ELF.
Another aspect of this invention is the use of ELF gene's 5' regulatory
region for targeting the expression of genes specifically to photoreceptor
cells of the
retina for gene therapy of macular degeneration.
Another aspect of this invention is the use of mouse ELF DNA or
mouse ELF protein corresponding to the normal or mutant form of human ELF for
generating an animal model (knock-out or transgenic) that can be used for
testing the
anti-AMD compounds.
A further aspect of this invention are methods of producing long chain
fatty acids using DNA encoding ELF or using ELF protein.
BRIEF DESCRIPTION OF THE DRAWINGS
FIGURE 1 is the protein for normal human ELF protein (SEQ.ll~.NO.
1). The underlined amino acids represent 5 putative transmembrane segments.
The
~ motif between predicted membrane spanning regions 2 and 3 that is
characteristic of dioxy iron cluster proteins is double underlined. The
protein
fragment deleted in patients with Stargardt-like macular dystrophy is shown in
italics.
The cytosolic carboxy-terminal dilysine motif responsible for the retrieval of
trans-
-3-
CA 02409705 2002-11-15
WO 01/87921 PCT/USO1/15464
membrane proteins from cis-Golgi to the endoplasmic reticulum is shown in bold
italics.
FIGURE 2 is the protein for mutant human ELF protein which causes
Stargardt-like dominant macular dystrophy (SEQ.ID.NO. 2). Underlined amino
acids
represent four of five putative transmembrane segments; the fragment of the
fifth
transmembrane segment that is common for normal and mutant alleles of the
protein
is highlighted by the dotted line. The HXNHH motif between predicted membrane
spanning regions 2 and 3 that is characteristic of dioxy iron cluster proteins
is double
underlined. The protein fragment generated by the 5-by deletion in patients
with
Stargardt-like macular dystrophy is shown in italics.
FIGURE 3 is normal human ELF cDNA (SEQ.ID.NO. 3) and the
amino acid sequence (SEQ.ID.NO.1) of the human ELF protein. Underlined
nucleotides in bold encompassing base pairs 797- 801 represent the deletion
found in
patients with dominant Stargardt-like macular dystrophy. The protein fragment
deleted in patients with Stargardt-like macular dystrophy is shown in bold
underline
FIGURE 4 is mutant human ELF cDNA (SEQ.ID.NO. 4) and the
amino acid sequence (SEQ.ID.NO. 2) of the human mutant ELF protein. The region
of the protein encompassing amino acids 264-271 (bold underlined) represent a
fragment generated as a result of the 5-base pair deletion in patients with
dominant
Stargardt-like macular dystrophy.
FIGURE 5 is the protein for normal mouse ELF protein (SEQ.ID.NO.
5). Underlined amino acids represent 5 putative transmembrane segments. The
HXXHH motif between predicted membrane spanning regions 2 and 3 that is
characteristic of dioxy iron cluster proteins is double underlined. The
protein
25. fragment similar to the human ELF fragment deleted in patients with
Stargardt-like
macular dystrophy is shown in italics. Cytosolic carboxy-terminal dilysine
motif
responsible for the retrieval of transmembrane proteins from cis-Golgi to the
endoplasmic reticulum is shown in bold italics.
FIGURE 6 is mouse cDNA for ELF (SEQ.ID.NOS. 6) and the amino
acid sequence (SEQ.ID.N0.:5) of the mouse ELF protein.
FIGURE 7 shows the genomic DNA sequence of the ELF gene
(SEQ.ID.N0.:8). Underlined nucleotides in capitals represent exons. Initiating
ATG
codon in exon 1 and terminating TAA codon in exon 6 are shown in bold italics.
The
-4-
CA 02409705 2002-11-15
WO 01/87921 PCT/USO1/15464
exact lengths of the gaps between the exons are unknown; these gaps are
presented as
runs of ten bold n as a convenience only.
FTGURE 8 shows the pairwise comparison of human and mouse ELF
proteins. The upper amino acid sequence shown is the human ELF protein
(SEQ.ll7.N0. 1). The lower amino acid sequence shown is the mouse ELF protein
(SEQ.ID.NO. 5). The two proteins are highly identical which indicates they are
true
orthologues. Both proteins share the cytosolic carboxy-terminal dilysine motif
responsible for the retrieval of transmembrane proteins from cis-Golgi to the
endoplasmic reticulurn (two lysines are located at -3 and -5 positions with
respect to
the carboxyl terminus).
FIGURE 9 depicts the sequence alignment of the human ELF protein
(SEQ.1D.N0. 1) and its two yeast homologues, Elo2p (SEQ.ID.NO. 8) and Elo3p
(SEQ.ID.NO. 9) from Oh et a1.,1997 J. Biol. Cl2em 272:17376-17384. The degree
of
homology is high enough to assign the function of elongation of fatty acids to
the
human ELF protein.
FIGURE 10 depicts the enzymatic conversions involved in the linoleic
acid (n-3) and alpha=linolenic acid (n-6) pathways of essential fatty acid
synthesis,
including three elongation steps required of the biosynthesis of DHA
FIGURE 11 shows a Kyte-Doolittle hydropathy plot of human ELF.
Numbers 1 to 5 mark putative transmembrane segments. The hydropathy plot and
membrane topology of human ELF (SEQ.ID.NO. Dare similar to those proposed for
its two yeast homologues, Elo2p (SEQ.ID.NO. 8) and Elo3p (SEQ.ID.NO. 9),
experimentally shown to be involved in elongation of fatty acids.
FIGURE 12 shows association (segregation) of the 5 base pair deletion
within the ELF gene with the disease phenotype in the family with dominant
Stargardt-like macular dystrophy. The figure shows the structure of this
pedigree and
four sequencing runs (boxed) of PCR fragments that represent exon 6 and
adjacent
intronic regions of the human ELF gene (SEQ.ID.NOS.:10, 11, 12, and 13). From
left
~to right, the runs are from A40 (father, unaffected with Stargardt-like
dominant
macular dystrophy), A4 (mother, affected with Stargardt-like dominant macular
dystrophy), A430 (son of A4 and A40, unaffected with Stargardt-like dominant
macular dystrophy), A43 (daughter of A4 and A40, affected with Stargardt-like
dominant macular dystrophy). Reading the boxed chromatograms from left to
right,
-5-
CA 02409705 2002-11-15
WO 01/87921 PCT/USO1/15464
the 5-base pair deletion shows up as appearance of double peaks starting from
position 7 in the case of patients A4 and A43.
FIGURES 13A and 13B show the result of in situ hybridization of the
human ELF mRNA in rhesus monkey retina. FIGURE 13A shows specific
expression in the inner segments of photoreceptor cells with the antisense
probe.
Probe signal is indicated by the arrow; retinal layers are visualized with
propidium
iodide counterstain. FIGURE 13B shows the hybridization with the sense control
probe (sense probe is not complementary to the ELF mRNA). Retinal layers are
marked as RPE, retinal pigment epithelium; OS, outer segments of
photoreceptors; IS,
inner segments of photoreceptors; ONL, outer nuclear layer; OPL, outer
plexiform
layer; INL, inner nuclear layer; IPL, inner plexiform layer; GCL, ganglion
cell layer.
PhumGL1/HR2 is a hybridization probe that represents a fragment of the human
normal ELF cDNA (SEQ.ID.NO. 4). with coordinates 561-771.
FIGURE 14 shows the expression pattern of the ELF gene in 10 human
tissue plus retinal pigment epithelium-derived cell line ARPE19, as determined
by
RT-PCR amplification with 17 cycles. The expression is detected in human
retina
only.
FIGURE 15 shows the expression pattern of the human ELF gene in
human tissues as determined by Northern blot hybridization. The expression is
prominent in the human retina; the hybridization signal is also seen in the
human
brain. ELF mRNA exists in two different species, similar to what was reported
for its
only mammal relative, the Cig30 gene (Tvrdik et al 1999, J. Biol. ehem.
274:26387.-
26392).
FIGURE 16 shows the 5'-regulatory region of human ELF gene. The
initiating ATG codon in the first exon is shown in bold. Sequence elements
that are
common to mammalian RNA polymerase II promoters (CAAT box at position 1657
and four GC boxes at positions 1446, 1513, 1585, and 1744) are shown in bold
and
underlined.
As used through the specification and claims, the following definitions apply:
"Free from associated nucleic acids" means the nucleic acid is not
covalently linked to a nucleic acid which is naturally linked to in an
individual's
chromosome.
-6-
CA 02409705 2002-11-15
WO 01/87921 PCT/USO1/15464
"Free from associated proteins" means the ELF protein is not located in
its native cell membrane; or in the case of the mutant allele, the mutant ELF
is not
located in .the retinal cytoplasm where it normally is found.
This invention relates to the identification and characterization of the
mutant allele responsible for Stargardt-like macular dystrophy. The
designation of the
gene is EFL (for Elongation of Fatty Acids).
Essential fatty acids (EFAs) are polyunsaturated fatty acids that cannot
be manufactured by mammals, yet are required for a number of important
biochemical
processes, and thus must be supplied in the diet. The most important dietary
EFAs
are linoleic acid and alpha-linolenic acid (ALA). These two EFAs undergo a
number
of biosynthetic reactions that convert them into various other EFAs. FIGURE 10
depicts the biosynthetic reactions involving the two groups of EFAs, the n-6
EFAs
(linoleic acid derivatives) and the n-3 EFAs (ALA derivatives). EFAs are
formed
from linoleic acid and ALA by a series of alternating reactions involving the
removal
of two hydrogens coupled with the insertion of an additional double bond
(desaturation) and the lengthening of the fatty acid chain by the addition of
two
carbons (chain elongation). The end product of the ALA pathway is
docosahexaenoic
acid (DHA).
Decosahexaenoic fatty acid (DHA) is a highly polyunsaturated, long-
chain fatty acid, which has six double bonds and is 22 carbons in length
[indicated as
22:6 (n-3), where the first number indicates chain length, the second number
indicates
the number of double bonds, and "n-3" indicates the position of the first
double bond
as its relates to the terminal methyl group]. DHA is a critical component of
membranes in vertebrate retina, comprising up to 50% of all fatty acids in
photoreceptor cells. While not wishing to be bound by theory, it appears the
normal
allele of ELF is involved in one of the elongation steps during DHA synthesis.
Bioinformatic analysis revealed a weak but significant homology
between ELF and a group of two yeast proteins (Elo2p and Elo3p), whose
function are
also the elongation of fatty acids. The Kyte-Doolittle algorithm (FIGURE 11)
predicts that ELF has a transmembrane organization involving five
transmembrane
regions which is similar to the reported transmembrane organization of Elo2p
and
Elo3p. The Elo2p and Elo3p proteins are necessary for the synthesis of very
long
chain fatty acids of up to 24 and 26 carbon atoms, respectively (Oh et al.
1997, J. Biol.
_7_
CA 02409705 2002-11-15
WO 01/87921 PCT/USO1/15464
Cl2em. 272:17376-17384, which is hereby incorporated by reference). It seems
that
human ELF protein is responsible for the biosynthesis of DHA, as it requires
the
elongation up to 24 carbon atoms with subsequent chain shortening (beta-
peroxidation) to 22 carbon atoms.
The mutant (i.e. disease-causing allele) of ELF contains a 5 by deletion
starting at by 797. This results in a frameshift mutation from this position
through the
remainder of the C-terminus. The mutation removes the C-terminal region of the
ELF
protein which is reasonably conserved between human and mouse (see FIGURE 8).
Evolutionary conservation indicates functional significance of the protein
region
removed as a result of the frameshift mutation. In addition, the frameshift
mutation
removes the targeting signal in the C-terminus which is the same sequence as
those
known to be responsible for targeting proteins to the endoplasmic reticulum
(Gaynor
et x1.1994 J. Cell Biol. 127:653-665 and Schroder et x1.1995 J. Cell
Bio1.131:895-912,
both of which are incorporated by reference). This would prevent ELF protein
from
trafficking to the site of biosynthesis of very long chain fatty acids
(membranes of the
endoplasmic reticulum) Thus, deficiencies in the biosynthesis of DHA or other
retina-specific fatty acids with very long chain resulting from mutations in
ELF would
predictably lead to retinal dysfunction.
There are additional observations which indicate that the genes of this
invention are involved in Stargardt-like macular dystrophy. First of all, the
mutant
(disease-causing allelic form) has been identified in three independent
families with
Stargardt-like macular dystrophy. Secondly, the gene maps to the genetically
defined
region on human chromosome 6q14, which has been identified with Stargardt-like
macular dystrophy. The ELF gene maps to the PAC clone dJ94c4 which is located
in
close vicinity of the genetic marker D6S460. The maximum reported lod score
for
D6S460 was 9.3, which is a clear indication of genetic proximity of this
marker to the
disease locus (Edwards et x1.1999, Am. J. Ophthal. 127:426-435.) Further, this
gene
was found to be exclusively expressed in the retina, specifically, in the
photoreceptor
cells (see FIGURES 13, 14, and 15).
Nucleic acids
Thus, one aspect of this invention are nucleic acids which encode
either the normal allele or the mutant allele of ELF; these nucleic acids may
be free
from associated nucleic acids. Preferably the source of the nucleic acids is a
human;
_g_
CA 02409705 2002-11-15
WO 01/87921 PCT/USO1/15464
although this invention includes other mammalian forms, such as mouse, rat,
pig,
monkey and rabbit. Genes encoding ELF from a non-human mammal can be obtained
by using the human DNA as a probe in libraries of the retina using standard
biotechnological techniques, and one aspect of this invention is a method of
isolating
a non-human nucleic acid encoding an ELF protein comprising probing a retinal
library of a non-human mammal. The probe is preferably from the human or mouse
DNA,
As used throughout the specification and claims, the term "gene"
specifically refers to the protein-encoding portion of the gene, i.e. the
structural gene,
and specifically does not include regulatory elements such as promoters,
enhancers,
transcription termination regions and the like. The gene may be a cDNA or it
may be
an isolated form of genomic DNA. As used herein, "isolated" means that the DNA
is
physically separated from the DNA which it is normally covalently attached to
in the
chromosome. This includes DNA with a heterologous promoter and DNA which has
its native regulatory sequences, but is not present in its native chromosome.
The ELF genes of this invention (both allelic forms) may have their
own regulatory sequences operatively linked, or one may, using known
biotechnology
techniques, operatively linked heterologous regulatory regions: Such
regulatory
regions are well known, and include such promoters as the CMV promoter, rod-
specific promoter of the rodopsin gene, retinal pigment epithelium-specific
promoters
of bestrophin or RPE65 genes. Commercially available mammalian expression
vectors which are suitable for the expression of human ELF DNA include, but
are not
limited to: pMClneo (Stratagene), pSGS (Stratagene), pcDNAI and pcDNAIamp,
pcDNA3, pcDNA3.1, pCR3.1 (Invitrogen), EBO-pSV2-neo (ATCC 37593), pBPV-
1(8-2) (ATCC 37110), pdBPV-MMTneo(342-12) (ATCC 37224), pRSVgpt (ATCC
37199), pRSVneo (ATCC 37198), and pSV2-dhfr (ATCC 37146).
The ELF genes (regardless of species and allelic form) and operatively
linked regulatory regions (an "ELF expression cassette) may be placed in a
vector for
transfer into a host cell. Vectors which are preferred include plasmids and,
to a lesser
degree, viral vectors. The choice of vector will often be dependent upon the
host cell
chosen. Cells which are preferred host cells include but are not limited to:
ARPE-19,
RPE-J, Y79, L cells L-M(TK-) (ATCC CCL 1.3), L cells L-M (ATCC CCL 1.2), 293
(ATCC CRL 1573), Raji (ATCC CCL 86), CV-1 (ATCC CCL 70), COS-1 (ATCC
CRL 1650), COS-7 (ATCC CRL 1651), CHO-Kl (ATCC CCL 61), 3T3 (ATCC CCL
-9-
CA 02409705 2002-11-15
WO 01/87921 PCT/USO1/15464
92), NIH/3T3 (ATCC CRL 1658), HeLa (ATCC CCL 2), C127I (ATCC CRL 1616),
BS-C-1 (ATCC CCL 26) and MRC-5 (ATCC CCL 171).
A further aspect of this invention is a method of making an ELF
protein (either a mutant or normal allelic form) comprising culturing a host
cell
comprising an ELF expression cassette, and recovering ELF protein.
Alternatively a
ELF gene may be integrated into a chromosome of the host cell, rather than
being
located on a vector. The resultant ELF-expressing cell lines (comprising a
heterologous ELF gene, whether on a vector or in a host's chromosome) make up
yet
another aspect of this invention.
ELF Protein
Another aspect for this invention is an allelic form of ELF protein
(normal or mutant) which is free from associated proteins. In a preferred
embodiment
the protein is mammalian, and in more preferred embodiments, the protein is a
human
form.
Still another aspect of this invention is a method for treating,
preventing or lessening the severity of Stargardt-like macular degeneration
comprising
administering the normal allelic form of ELF to an individual at risk of the
disease or
who manifests the symptoms of the disease. The normal allelic form of ELF is
preferably recombinantly produced. The normal ELF can substitute for the
defective
ELF made by these individuals, and perform the normal transporting function.
The
administration of the ELF protein is preferably in the form of a
pharmaceutical
composition comprising pharmaceutically acceptable diluents, excipients, and
optionally stabilizers or preservatives. A typical pharmaceutical composition
comprises 0.1 to 95°Io protein and is administered once, twice or three
times daily.
The pharmaceutical composition is preferably in the form of eyedrops,
solutions or
suspensions for subretinal and intravitreal injections, or slow release
pellets.
Still another aspect of this invention is a method for ifz vitro bio-
synthesis of fatty acids with a very long chain, for example DHA. Biosynthesis
of
DHA involves several elongation and desaturation steps (see FIGURE 10).
We have previously identified and patented a retina-specific delta 6
desaturase called CYBSRP (US Provisional Application Serial No. 60/103,760;
PCT/US99/23253, which is hereby incorporated by reference). CYB5RP is
homologous to a delta 6 desaturase from Borago oficifZalis. Both CYBSRP and
this
-10-
CA 02409705 2002-11-15
WO 01/87921 PCT/USO1/15464
Borago delta 6 desaturase, unlike desaturases from higher plants, are unusual
in
containing a cytochrome b5-like domain fused to their N-termini (Sayanova et
al.,
1997, Proc. Natl. Acad. Sci. USA 94:4211-4216; hereinafter "Sayanova", which
is
hereby incorporated by reference). The Borago desaturase has been expressed in
transgenic tobacco, resulting in high levels of delta 6 desaturated fatty
acids in the
transgenic tobacco leaves, including high levels of y-linolenic acid (GLA)
(Sayanova).
Similarly, CYBSRP, expressed in transgenic plants (e.g., tobacco) is expected
to
provide a valuable source of GLA. Co-expression of the ELF cDNA in the same
plant
would predictably couple elongation and desaturation steps required for the
production of DHA. Thus, CYBSRP and ELF DNA, co-expressed in transgenic
plants, is expected to provide a valuable source of the important nutrient-
docosahexaenoeic acid (DHA). The protocols for expression of foreign genes in
plants are well developed and reported in the literature (Sayanova).
Animal model
Another aspect of this invention is the use of mouse ELF DNA or
mouse ELF protein corresponding to the normal or mutant form of human ELF for
generating an animal model (knock-out or transgenic) that can be used for
testing anti-
AMD compounds. Oligonucleotide primers designed from the mouse cDNA
sequence (SEQ.>D.NOS. 6) can be used to PCR amplify a fragment of the mouse
ELF
gene from the DNA of 129-strain embryonic stem cells (DNA of the 129Sv/J
lambda
genomic library is available from Stratagen). This genomic fragment can be
used to
generate a construct that will, upon electroporation into the 129-strain ES
cells,
generate a null mutation (targeted disruption) of the ELF gene. ES clones that
have
undergone homologous recombination with the construct can be injected into
C57BL/6 blastocysts. Injected blastocytes can be transplanted into the uterus
of
pseudopregnant female mice. Their progeny can be selected for the germline
transmission of the disrupted ELF gene and bred with 129SVEV females. The
animals with heterozygous disruption of the mouse ELF gene can be bred to
homozygosity.
The art of constructing the knock-out and transgenic mouse models is
well-described in the literature and exemplified in Weng et al., 1999 Cell
98:13-23,
which is hereby incorporated by reference.
-11-
CA 02409705 2002-11-15
WO 01/87921 PCT/USO1/15464
Assays for mutant forms
Another aspect of this invention is an assay to identify individuals who
are at risk for developing the symptoms of Stargardt-like macular dystrophy.
The
children of a person who has this disease are at risk, as the disease is
inherited in a
dominant-Mendelian fashion. Thus, if one parent does not have the disease, and
the
second parent is a heterozygous afflicted patient, the children have a 50%
probability
of developing the disease. As the children begin life with normal eyesight,
there is
time to intervene with protein therapy to reduce the severity, delay onset, or
even
completely prevent the symptoms from developing.
One assay in accordance with this invention is a labeled nucleic acid
probe which spans the portion of the nucleic acid just 5'to the area where the
mutant
deletion occurs, and includes base pairs after the deletion, which include the
frameshift mutation. Referring to the normal allele (SEQ.>D.NO. 3), a probe
would
be of any convenient length, preferably about 15 to 35 by in length, more
preferably at
least about 25-30 base pairs in length. It would include a desired number of
base pairs
up to 796, skip 797-801, and resume at 802. The probe can be constructed so
that it
would hybridize to the sense strand, or alternatively so that hybridization
occurs with
the anti-sense strand. A typical probe would thus comprise (where the
superscripted
numeral correspond to base pair positions according to the normal allele):
C790 T791
T792 T793 0794 T795 T796 0802 T803 A804 0805 A806.T807 T808 0809
(SEQ.>D.NO. 14). The probe may contain additional 5' and or 3'-terminus base
pairs
which are essentially identical to those in the normal allele, so that the
length of the
probe is at least 15 by long, and preferably at least 25 by long.
Generally the probe includes a detection means, such as a detectable label.
Such
labels, including radiolabels or fluorescent labels are well known in the art.
In an alternative embodiment, the probe would include base pairs
which would hybridize to the normal allelic form of the ELF gene, but would
not
hybridize to the mutant form.
Another embodiment of this invention is a method of determining if an
individual is at risk of developing Stargardt-like macular dystrophy
comprising
obtaining a sample of the ELF protein produced by the individual, and
determining
whether it is the normal or mutant form. This is preferably done by
determining if an
antibody specific for the normal allele of the ELF protein binds to the
protein
-12-
CA 02409705 2002-11-15
WO 01/87921 PCT/USO1/15464
produced by the individual. In an alternate embodiment of this assay, the
antibody is
specific for the mutant form of ELF.
The antibodies of these assays may be polyclonal antibodies or
monoclonal antibodies. The antibodies can be raised against the C-terminal
peptide
which is different in normal and mutant ELF proteins. The antibodies can be
raised
against the allele-specific synthetic C-terminal peptides that are coupled to
suitable
carriers, e.g., serum albumin or keyhole limpet hemocyanin, by methods well
known
in the art. Methods of identifying suitable antigenic fragments of a protein
are known
in the art. See, e.g., Hopp & Woods, 1981, Proc. Natl. Acad. Sci. 78:3824-
3828; and
Jameson & Wolf, 1988, CABIOS (Computer Applications in the Biosciences) 4:181-
186, both of which are hereby incorporated by reference.
For the production of polyclonal antibodies, ELF protein or an
antigenic fragment, coupled to a suitable carrier, is injected on a periodic
basis into an
appropriate non-human host animal such as, e.g., rabbits, sheep, goats, rats,
mice.
The animals are bled periodically and sera obtained are tested for the
presence of
antibodies to the injected antigen. The injections can be intramuscular,
intraperitoneal, subcutaneous, and the like, and can be accompanied with
adjuvant.
For the production of monoclonal antibodies, ELF protein or an
antigenic fragment, coupled to a suitable carrier, is injected into an
appropriate non-
human host animal as above for the production of polyclonal antibodies. In the
case
of monoclonal antibodies, the animal is generally a mouse. The animal's spleen
cells
are then immortalized, often by fusion with a myeloma cell, as described in
T~ohler &
Milstein, 1975, Nature 256:495-497. For a fuller description of the production
of
monoclonal antibodies, see Antibodies: A Laboratory Manual, Harlow & Lane,
eds.,
Cold Spring Harbor Laboratory Press, 1988.
Normal and mutant ELF proteins differ in size (normal ELF is 41
amino acid longer which translates in the 4 kiloDalton difference on the SDS-
PAGE).
Such a difference can be easily detected, so antibodies against the common
parts of
the two proteins can be used on Western blots to detect the presence of the
mutant
ELF.
Gene therauy
Gene therapy may be used to introduce ELF polypeptides into the cells
of target organs, e.g., the photoreceptor cells, pigmented epithelium of the
retina or
-13-
CA 02409705 2002-11-15
WO 01/87921 PCT/USO1/15464
other parts of the retina. Nucleotides encoding ELF polypeptides can be
ligated into
viral vectors which mediate transfer of the nucleotides by infection of
recipient cells.
Suitable viral vectors include retrovirus, adenovirus, adeno-associated virus,
herpes
virus, vaccinia virus, and polio virus based vectors. Alternatively,
nucleotides
encoding ELF polypeptides can be transferred into cells for gene therapy by
non-viral
techniques including receptor-mediated targeted transfer using ligand-
nucleotide
conjugates, lipofection, membrane fusion, or direct microinjection. These
procedures
and variations thereof are suitable for ex vivo as well as if2 vivo gene
therapy. Gene
therapy with ELF polypeptides will be particularly useful for the treatment of
diseases
where it is beneficial to elevate ELF activity.
Promoter/5-regulatory region of the ELF gene can be used in suitable
viral and non-viral vectors to target the expression of other genes
specifically in the
photoreceptor cells of the human retina, due to the unique photoreceptor cell
specificity of the ELF gene transcription. FIGURE 16 shows the promoter for
human
ELF.
The following non-limiting Examples are presented to better illustrate
the invention.
EXAMPLE 1
Identification of the ELF gene and cDNA cloning
Identification of the PAC (P1 Artificial Chromosome) clone containing the ELF
gene
Genetics mapping clearly demonstrated the linkage of the autosomal
dominant Stargardt-like macular dystrophy gene to the genetics markers on
human
chromosome 6q14 ( Edwards et al., 1999 Am. J. Ophthal»aol. 127: 426-435;
Griesinger et al., 2000 Inv. Ophthamol.Vis. Sci. 41: 248-255; Stone et
a1.1994, Arch.
Oplathalmol.l 12: 765-772; each of which is incorporated by reference). The
highest
lod-score in the three papers cited above was reported by Edwards et al. for
the
genetic marker D6S460. The DNA sequence for D6S460 is available from the
public
DNA database (GenBank accession number 224323).
DNA sequence from D6S460 was compared with GenBank database
entries using the BLASTN algorithm. This comparison revealed that D6S460 is
contained within the DNA sequence of PAC dJ75K24 (GenBank accession number
AL035700).
-14-
CA 02409705 2002-11-15
WO 01/87921 PCT/USO1/15464
The analysis of the physical map of human chromosome 6 available
from the web site of The Sanger Centre (http://www.sanger.ac.uk/HGP/Chr6/
revealed that dJ75K24 overlaps with another PAC clone dJ159 Gl which in turn
overlaps with PAC dI92C4. These three PAC clones were chosen for the detailed
bioinformatic analysis.
While complete DNA sequences were available for PACs 75k24 and
159619 (GenBank accession numbers AL035700 and AL078462, respectively), the
database entry for PACs 92c4 represented 11 unordered DNA pieces generated in
Phase 1 High Throughput Genome Sequence Project (HTGS phase 1) - GenBank
accession number AL132875. DNA sequences of PACs 75k24, 159619, as well as
the DNA sequences of 11 fragments from PAC 92c4 were compared with GenBank
database entries using the BLASTN and BLASTX algorithms.
This comparison revealed the presence of two potential axons in PAC
92c4 whose DNA sequences, when translated, demonstrated significant homology
with the members of the yeast ELO family known to be involved in elongation of
fatty
acids. Based on this homology, the novel human gene found in PAC 92s4 was
designated ELF (Elongation of Fatty Acids); the two potential axons within PAC
92c4
were later defined as axons 2 and 4 of the human ELF gene (see FIGURE 7)
cDNA seduencin~, identification additional axons and exon/intron organization
of the
ELF ene. The DNA sequence of the cDNA fragment that matches axons 2 and 4
was deduced from the genomic sequence of PAC 94c2. To identify additional
exon(s)
that may be located between axons 2 and 4, forward and reverse PCR primers
from
these axons of the ELF gene were synthesized and used to PCR amplify ELF cDNA
fragments from human retina "Marathon-ready" cDNA (Clontech, Palo Alto, CA).
In
this RT-PCR experiment forward primer from ex2 (63exDLl: GTG TGG AAA ATT
GGC CTC TG) (SEQ.ID.NO. 15) was paired with a reverse primer from ex4
(63exERl: GTC CTC CTG CAA CCC AGT TA) (SEQ.lD.NO. 16). A 50 ~,l PCR
reaction was performed using the Taq Gold DNA polymerase (Perkin Elmer,
Norwalk, CT) in the reaction buffer supplied by the manufacturer with the
addition of
dNTPs, primers, and approximately 0.5 ng of human retina cDNA. Cycling
conditions were as follows: 1) 94°C for 10 min; 2) 94°C for 30
sec; 3) 72°C for 2 min
(decrease this temperature by 1.1°C per cycle); 4) 72°C for 2
min; 5)6o to step 2
-15-
CA 02409705 2002-11-15
WO 01/87921 PCT/USO1/15464
fifteen more times; 6) 94°C for 30 sec; 7) 55°C for 2 min; 8)
72°C for 2 min; 9) Go to
step 6 twenty four more times; 10). 72°C for 7 min; and 11) 4°C.
The PCR product was electrophoresed on a 2°7o agarose gel and DNA
band was excised, purified and subjected to sequence analysis with the same
primers
that were used for PCR amplification. DNA sequence analysis was performed
using
the ABI PRISMTM dye terminator cycle sequencing ready reaction kit with
AmpliTaq DNA polymerase, FS (Perkin Elmer, Norwalk, CT). Following linear
amplification in a Perkin-Elmer 9600, the extension products were purified and
analyzed on an ABI PRISM 377 automated sequencer (Perkin Elmer, Norwalk, CT).
The assembly of the DNA sequence results of this PCR .product
revealed that there is an additional axon between axons 2 and 4; it was later
designated axon 3. This finding defined the order of the axons in ELF cDNA
fragment as 5'- ex2-ex3-ex4-3'. Comparison of the DNA sequence of axon 3 with
the
DNA sequence of PAC 92c4 confirmed its location between axons 2 and 4 and
revealed the description of intronic sequences flanking this axon.
The DNA sequence of axon 4 was compared with the EST database
using the BlastN algorithm in an attempt to identify additional cDNA
sequences. This
analysis identified a mouse skin EST (GenBank accession number AA791133) with
very high degree of similarity to axon 4 of the human ELF gene. The DNA
sequence
of the mouse skin EST AA791133 was compared with the genomic sequence of PAC
92c4. Despite the differences between the mouse and human sequences caused by
evolutionary divergence, this analysis was able to reveal two additional human
axons
with PAC 94c4; there were later called axons 5 and 6. This finding defined the
order
of the axons in ELF cDNA as 5'- ex2-ex3-ex4-ex5-ex6-3'.
To verify the exonic composition of the cDNA that relied at the
moment on identification of axons within the genomic sequence, forward and
reverse
PCR primers from known axons of the ELF gene were synthesized and used to PCR
amplify CG1CE cDNA fragments from human retina "Marathon-ready" cDNA
(Clontech, Palo Alto, CA). In these RT-PCR experiments forward primer from ex2
(63exDL1: GTG TGG AAA ATT GGC CTC TG)(SEQ.ID.NO. 15) was paired with a
reverse primer from ex6 (63exHRl: CAT GGC TGT TTT TCC AGC TT) (SEQ.ID.
NO. 17). Forward primer from ex5 (63exGLl: CCC AGT TGA ATT CCT TTA TCC
-16-
CA 02409705 2002-11-15
WO 01/87921 PCT/USO1/15464
A) (SEQ.>D.NO. 18) was paired with a reverse primer from ex6 (63exH Right: GTC
AAC AAC AGT TAA GGC CCA) (SEQ.ID.N0.19).
A 50 ~,1 PCR reaction was performed using the Taq Gold DNA
polymerase (Perkin Elmer, Norwalk, CT) in the reaction buffer supplied by the
manufacturer with the addition of dNTPs, primers, and approximately 0.5 ng of
human retina cDNA. PCR products were electrophoresed on a 2% agarose gel and
DNA bands were excised, purified and subjected to sequence analysis with the
same
primers that were used for PCR amplification. The assembly of the DNA sequence
results of these PCR products confirmed the cDNA sequence assembled from ELF
exons and corrected the sequencing errors present in the database entry for
PAC
92c4.
Identification of the 5' of the ELF cDNA
RACE is an established protocol for the analysis of cDNA ends. This
procedure was performed using the Marathon RACE template from human retina,
purchased from Clontech (Palo Alto, CA). cDNA primer from exon 2 (63exDRl:
AGG TTA AGC AAA ACC ATC CCA) (SEQ.)D.NO. 20) in combination with a
cDNA adaptor primer AP 1 (CCA TCC TAA TAC GAC TCA CTA TAG GGC )
(SEQ.ID.N0.:21) were used in 5' RACE.
After the initial PCR amplification, a nested PCR reaction was
performed using nested adaptor primer AP2 (ACT CAC TAT AGG GCT CGA GCG
GC) (SEQ.ID.N0.:22) and gene specific primer 63exDR2 (AGG TTC TCG GTC
CTT CAT CC) (SEQ.ID.N0.:23). The PCR product was separated from the
unincorporated dNTP's and primers using Qiagen, QIAquick PCR purification spin
columns using standard protocols and resuspended in 30 ~,1 of water. The
products
were analyzed on ABI 377 sequencers according to standard protocols. The PCR
fragment obtained in the 5'RACE reaction was assembled into a contig with the
ELF
cDNA fragment covering exons 2 to 6; the DNA sequence of the resulted cDNA
encodes a full-length ELF protein; the order of the exons in ELF cDNA was
defined
as 5'- ex 1-ex2-ex3-ex4-ex5-ex6-3'
Comparison of the DNA sequences obtained from RT-PCR fragments
with genomic sequence obtained from PAC 92c4 was performed using the program
Crossmatch. This analysis determined Exact sequence of exon/intron boundaries
within the ELF gene for all 6 exons. The splice signals in all introns
conforms to
-17-
CA 02409705 2002-11-15
WO 01/87921 PCT/USO1/15464
published consensus sequences. Description of the flanking intronic sequences
for
each of the exons allowed the design of PCR primers for amplification of the
ELF
gene exons from the DNA of affected and nonaffected individuals from families
with
Stargardt-like dominant macular dystrophy.
EXAMPLE 2
Star~ardt-like dominant macular d sy trophy is associated with the 5-by
deletion in the
evolutionary conserved region of the ELF _gene
Genomic DNA from the patients and control individuals from three
pedigrees having dominant Stargardt-like macular dystrophy (families A, C, and
D)
was amplified by PCR using the following primer pair:
63exH Left (GAA GAT GCC GAT GTT GTT AAA AG) (SEQ.m.N0.:24)
63exH_Right (GTC AAC AAC AGT TAA GGC CCA) (SEQ.ID.NO. 19)
This primer pair amplifies a genomic fragment that contains exon 6 and an
adjacent
intronic region.
PCR products produced using the primer sets mentioned above were
amplified in 50 p,1 reactions consisting of Perkin-Elmer 10 x PCR Buffer, 200
mM
dNTP's, 0.5 u1 of Taq Gold (Perkin-Elmer Corp., Foster City, CA), 50 ng of
patient
DNA and 0.2 ~,M of forward and reverse primers. Cycling conditions were as
follows: 1) 94°C for 10 min; 2) 94°C for 30 sec; 3) 72°C
for 2 min (decrease this
temperature by 1.1°C per cycle); 4) 72°C for 2 min; 5) Go to
step 2 fifteen more
times; 6) 94°C for 30 sec. 7) 55°C for 2 min; 8) 72°C for
2 min; 9) Go to step 6
twenty four more times; 10) 72°C for 7 min; and 11) 4°C.
Products obtained from this PCR amplification were analyzed on 2%
agarose gels and excised fragments from the gels were purified using Qiagen
QIAquick spin columns and sequenced using ABI dye-terminator sequencing kits.
The products were analyzed on ABI 377 sequencers according to standard
protocols.
The results of this experiment in four individuals from family A is
shown in FIGURE 12. The figure shows a small branch of this pedigree and four
sequencing runs (boxed) of PCR fragments that represent exon 6 and adjacent
intronic
regions of the human ELF gene. From left to right, the runs are from A40
(father,
unaffected with Stargardt-like dominant macular dystrophy), A4 (mother,
affected
with Stargardt-like dominant macular dystrophy), A430 (son of A4 and A40,
unaffected with Stargardt-like dominant macular dystrophy), A43 (daughter of
A4 and
-18-
CA 02409705 2002-11-15
WO 01/87921 PCT/USO1/15464
A40, affected with Stargardt-like dominant macular dystrophy). Reading the
boxed
chromatograms from left to right, the 5-base pair deletion shows up as
appearance of
double peaks starting from position 7 in the case of patients A4 and A43. This
disease mutation was not found upon sequencing of 50 normal unrelated
individuals
(100 chromosomes) of North American descent.
EXAMPLE 3.
Expression studies of the ELF gene
RT-PCR
RT-PCR experiments were performed on "quick-clone" human cDNA
samples available from Clontech, Palo Alto, CA. ARPE-19 cDNA was prepared
according to standard protocols. cDNA samples from heart, brain, placenta,
lung,
liver, skeletal muscle, kidney, pancreas; retina, testis, and human retinal
pigment
epithelium cell line ARPE-19 were amplified with primers 63exGL1 (CCC AGT
TGA ATT CCT TTA TCC A) (SEQ.ID.NO. 18) and 63exHRI (CAT GGC TGT TTT
TCC AGC TT) (SEQ.ID.NO. 17) in the following PCR conditions: 1) 94°C
for 10
min; 2) 94°C for 30 sec; 3) 72°C for 2 min (decrease this
temperature by 1.1°C per
cycle); 4) 72°C for 2 min; 5) Go to step 2 fifteen more times; 6)
94°C for 30 sec; 7)
55°C for 2 min; 8) 72°C for 2 min; 9) Go to step 6 seventeen
more times; 10) 72°C
for 7 min; and 11) 4°C.
The ELF gene was found to be expressed in human retina only
(FIGURE. 14).
-19-
CA 02409705 2002-11-15
WO 01/87921 PCT/USO1/15464
Northern Blot Analysis
Northern blots containing poly(A+)-RNA from different human tissues
were purchased from Clontech, Palo Alto, CA. The blot contained human heart,
brain
placenta, lung, liver, skeletal muscle, kidney, and pancreas poly(A+)-RNA. A
custom-made blot containing human retina, brain, and ARPE-19 poly(A+)-RNA
was ordered from FRP Grating. Primers 63exDLl (GTG TGG AAA ATT GGC
CTC TG) (SEQ.m.NO. 15) and 63exHR1 (CAT GGC TGT TTT TCC AGC TT)
(SEQ.)D.N0.17) were used to amplify a PCR product from the "quick-clone" human
retina cDNA available from Clontech, Palo Alto, CA. This product was purified
on
an agarose gel, and used as a probe in Northern blot hybridization. The probe
was
labeled by random priming with the Amersham Rediprime kit (Arlington Heights,
lL)
in the presence of 50-100 ~,Ci of 3000 Ci/mmole [alpha 32P]dCTP (Dupont/NEN,
Boston, MA). Unincorporated nucleotides were removed with a ProbeQuant G-50
spin column (Pharmacia/Biotech, Piscataway, NJ). The radiolabeled probe at a
concentration of greater than 1 x 106 cpm/ml in rapid hybridization buffer
(Clontech,
Palo Alto, CA) was incubated overnight at 65°C. The blots were washed
by two 15
min incubations in 2X SSC, 0.1% SDS (prepared from 20X SSC and 20 % SDS stock
solutions, Fisher, Pittsburgh, PA) at room temperature, followed by two 15 min
incubations in 1X SSC, 0.1% SDS at room temperature, and two 30 min
incubations
in O.1X SSC, 0.1% SDS at 60°C. Autoradiography of the blots was done to
visualize
the bands that specifically hybridized to the radiolabeled probe.
The probe hybridized to an mRNA transcript that is uniquely expressed
in the human retina (see Figure 15). Weaker hybridization signal is also seen
in the
human brain. ELF mRNA exists in two different species, similar to what was
reported
for its only mammal relative, the Cig30 gene (Tvrdik et al., J. Biol. Chem.,
1999,
274:26387-26392; which is hereby incorporated by reference).
In situ hybridization
Primers 63exGL1 (CCC AGT TGA ATT CCT TTA TCC A)
(SEQ.m.NO. 18) and 63exHR1 (CAT GGC TGT TTT TCC AGC TT) (SEQ.m.NO.
17) were used to amplify a PCR product from the "quick-clone" human retina
cDNA
available from Clontech, Palo Alto, CA. This product was subcloned into the
pCR-
Script vector (Stratagene) giving the plasmid called phumGLl/HR2. This plasmid
-20-
CA 02409705 2002-11-15
WO 01/87921 PCT/USO1/15464
served as a hybridization probe and represented a fragment of the human normal
ELF
cDNA with coordinates 561-771. In situ hybridization was earned out on
sections of
rhesus monkey retina according to standard protocols. Specific expression is
seen in
the inner segments of photoreceptor cells with the antisense probe (left
panel). Probe
signal is seen in blue color; retinal layers are visualized with propidium
iodide
counterstain (red). Right panel shows the hybridization with the sense control
probe
(sense probe is not complementary to the ELF mRNA). Retinal layers are marked
as
RPE, retinal pigment epithelium; OS, outer segments of photoreceptors; IS,
inner
segments of photoreceptors; ONL, outer nuclear layer; OPL, outer plexiform
layer;
INL, inner nuclear layer; TPL, inner plexiform layer; GCL, ganglion cell
layer.
-21-
CA 02409705 2002-11-15
WO 01/87921 PCT/USO1/15464
SEQUENCE LISTING
<110> Merck & Co., Inc.
Johns Hopkins University School of Medicine
<120> GENE RESPONSIBLE FOR STARGARD-LIKE
DOMINANT MACULAR DYSTROPHY
<130> 20678 PCT
<150> 60/204,990
<151> 2000-05-16
<160> 24
<170> FastSEQ for Windows Version 4.0
<210> 1
<211> 314
<212> PRT
<213> Human
<400> 1
Met Gly Leu Leu Asp Ser Glu Pro Gly Ser Val Leu Asn Val Val Ser
1 5 10 15
Thr Ala Leu Asn Asp Thr Val Glu Phe Tyr Arg Trp Thr Trp Ser Ile
20 25 30
Ala Asp Lys Arg Val Glu Asn Trp Pro Leu Met Gln Ser Pro Trp Pro
35 40 45
Thr Leu Ser Ile Ser Thr Leu Tyr Leu Leu Phe Val Trp Leu Gly Pro
50 55 60
Lys Trp Met Lys Asp Arg Glu Pro Phe Gln Met Arg Leu Val Leu Ile
65 70 75 80
Ile Tyr Asn Phe Gly Met Val Leu Leu Asn Leu Phe Ile Phe Arg Glu
85 90 95
Leu Phe Met Gly Ser Tyr Asn Ala Gly Tyr Ser Tyr Ile Cys Gln Ser
100 105 110
Val Asp Tyr Ser Asn Asn Val His Glu Val Arg Ile Ala Ala Ala Leu
115 120 125
Trp Trp Tyr Phe Val Ser Lys Gly Val Glu Tyr Leu Asp Thr Val Phe
130 135 140
Phe Ile Leu Arg Lys Lys Asn Asn Gln Val Ser Phe Leu His Val Tyr
145 150 155 160
His His Cys Thr Met Phe Thr Leu Trp Trp Ile Gly Ile Lys Trp Val
165 170 175
Ala Gly Gly Gln Ala Phe Phe Gly Ala Gln Leu Asn Ser Phe Ile His
180 185 190
Val Ile Met Tyr Ser Tyr Tyr Gly Leu Thr Ala Phe Gly Pro Trp Ile
195 200 205
G1n Lys Tyr Leu Trp Trp Lys Arg Tyr Leu Thr Met Leu Gln Leu Ile
210 215 220
Gln Phe His Val Thr Ile Gly His Thr Ala Leu Ser Leu Tyr Thr Asp
225 230 235 240
Cys Pro Phe Pro Lys Trp Met His Trp Ala Leu Ile Ala Tyr Ala Ile
245 250 255
Ser Phe Ile Phe Leu Phe Leu Asn Phe Tyr Ile Arg Thr Tyr Lys Glu
260 265 270
Pro Lys Lys Pro Lys Ala Gly Lys Thr Ala Met Asn Gly Ile Ser Ala
275 280 285
Asn Gly Val Ser Lys Ser Glu Lys Gln Leu Met Ile Glu Asn Gly Lys
290 295 300
-1-
CA 02409705 2002-11-15
WO 01/87921 PCT/USO1/15464
Lys Gln Lys Asn Gly Lys Ala Lys Gly Asp
305 310
<210> 2
<211> 271
<212> PRT
<213> Human
<400> 2
Met Gly Leu Leu Asp Ser Glu Pro Gly Ser Val Leu Asn Val Val Ser
1 5 10 15
Thr Ala Leu Asn Asp Thr Val Glu Phe Tyr Arg Trp Thr Trp Ser Ile
20 25 30
Ala Asp Lys Arg Val Glu Asn Trp Pro Leu Met Gln Ser Pro Trp Pro
35 40 45
Thr Leu Ser Ile Ser Thr Leu Tyr Leu Leu Phe Val Trp Leu Gly Pro
50 55 60
Lys Trp Met Lys Asp Arg Glu Pro Phe Gln Met Arg Leu Val Leu Ile
65 70 75 80
Ile Tyr Asn Phe Gly Met Val Leu Leu Asn Leu Phe Ile Phe Arg Glu
85 90 95
Leu Phe Met Gly Ser Tyr Asn Ala Gly Tyr Ser Tyr Ile Cys Gln Ser
100 105 110
Val Asp Tyr Ser Asn Asn Val His Glu Val Arg Ile Ala Ala Ala Leu
115 120 125
Trp Trp Tyr Phe Val Ser Lys Gly Val Glu Tyr Leu Asp Thr Val Phe
130 135 140
Phe Ile Leu Arg Lys Lys Asn Asn Gln Val Ser Phe Leu His Val Tyr
145 150 15S 160
His His Cys Thr Met Phe Thr Leu Trp Trp Ile Gly Ile Lys Trp Val
165 170 175
Ala Gly Gly Gln Ala Phe Phe Gly Ala Gln Leu Asn Ser Phe Ile His
180 185 190
Val Ile Met Tyr Ser Tyr Tyr Gly Leu Thr Ala Phe Gly Pro Trp Ile
195 200 205
Gln Lys Tyr Leu Trp Trp Lys Arg Tyr Leu Thr Met Leu Gln Leu Ile
210 215 220
Gln Phe His Val Thr Ile Gly His Thr Ala Leu Ser Leu Tyr Thr Asp
225 230 235 240
Cys Pro Phe Pro Lys Trp Met His Trp Ala Leu Ile Ala Tyr Ala Ile
245 250 255
Ser Phe Ile Phe Leu Phe Leu Leu His Ser Asp Ile Gln Arg Ala
260 265 270
<210> 3
<211> 972
<212> DNA
<213> Human
<400>
3
cgccgcgatggggctcctggactcggagccgggtagtgtcctaaacgtagtgtccacggc60
actcaacgacacggtagagttctaccgctggacctggtccatcgcagataagcgtgtgga120
aaattggcctctgatgcagtctccttggcctacactaagtataagcactctttatctcct180
gtttgtgtggctgggtccaaaatggatgaaggaccgagaaccttttcagatgcgtctagt240
gctcattatctataattttgggatggttttgcttaacctctttatcttcagagagttatt300
catgggatcatataatgcgggatatagctatatttgccagagtgtggattattctaataa360
tgttcatgaagtcaggatagctgctgctctgtggtggtactttgtatctaaaggagttga420
gtatttggacacagtgttttttattctgagaaagaaaaacaaccaagtttctttccttca480
tgtgtatcatcactgtacgatgtttaccttgtggtggattggaattaagtgggttgcagg540
aggacaagcattttttggagcccagttgaattcctttatccatgtgattatgtactcata600
ctatgggttaactgcatttggcccatggattcagaaatatctttggtggaaacgatacct660
gactatgttgcaactgattcaattccatgtgaccattgggcacacggcactgtctcttta720
-2-
CA 02409705 2002-11-15
WO 01/87921 PCT/USO1/15464
cactgactgccccttccccaaatggatgcactgggctctaattgcctatgcaatcagctt 780
catatttctctttcttaacttctacattcggacatacaaagagcctaagaaaccaaaagc 840
tggaaaaacagccatgaatggtatttcagcaaatggtgtgagcaaatcagaaaaacaact 900
catgatagaaaatggaaaaaagcagaaaaatggaaaagcaaaaggagattaaattgaact 960
gggccttaactg 972
<210>
4
<211>
967
<212>
DNA
<213>
Human
<400>
4
cgccgcgatggggctcctggactcggagccgggtagtgtcctaaacgtagtgtccacggc 60
actcaacgacacggtagagttctaccgctggacctggtccatcgcagataagcgtgtgga 120
aaattggcctctgatgcagtctccttggcctacactaagtataagcactctttatctcct 180
gtttgtgtggctgggtccaaaatggatgaaggaccgagaaccttttcagatgcgtctagt 240
gctcattatctataattttgggatggttttgcttaacctctttatcttcagagagttatt 300
catgggatcatataatgcgggatatagctatatttgccagagtgtggattattctaataa 360
tgttcatgaagtcaggatagctgctgctctgtggtggtactttgtatctaaaggagttga 420
gtatttggacacagtgttttttattctgagaaagaaaaacaaccaagtttctttccttca 480
tgtgtatcatcactgtacgatgtttaccttgtggtggattggaattaagtgggttgcagg 540
aggacaagcattttttggagcccagttgaattcctttatccatgtgattatgtactcata 600
ctatgggttaactgcatttggcccatggattcagaaatatctttggtggaaacgatacct 660
gactatgttgcaactgattcaattccatgtgaccattgggcacacggcactgtctcttta 720
cactgactgccccttccccaaatggatgcactgggctctaattgcctatgcaatcagctt 780
catatttctctttcttctacattcggacatacaaagagcctaagaaaccaaaagctggaa 840
aaacagccatgaatggtatttcagcaaatggtgtgagcaaatcagaaaaacaactcatga 900
tagaaaatggaaaaaagcagaaaaatggaaaagcaaaaggagattaaattgaactgggcc 960
ttaactg 967
<210>
<211>
312
<212>
PRT
<213> musculus
Mus
<400> 5
Met Gly Leu Leu Asp Ser Glu Pro Gly Ser Val Leu Asn Ala Met Ser
1 5 10 15
Thr Ala Phe Asn Asp Thr Val Glu Phe Tyr Arg Trp Thr Trp Thr Ile
20 25 30
Ala Asp Lys Arg Val Ala Asp Trp Pro Leu Met Gln Ser Pro Trp Pro
35 40 45
Thr Ile Ser Ile Ser Thr Leu Tyr Leu Leu Phe Val Trp Leu Gly Pro
50 55 60
Lys Trp Met Lys Asp Arg Glu Pro Phe Gln Met Arg Leu Val Leu Ile
65 70 75 80
Ile Tyr Asn Phe Gly Met Val Leu Leu Asn Leu Phe Ile Phe Arg Glu
85 90 95
Leu Phe Met Gly Ser Tyr Asn Ala Gly Tyr Ser Tyr Ile Cys Gln Ser
100 105 110
Val Asp Tyr Ser Asn Asp Val Asn Glu Val Arg Ile Ala Ala Ala Leu
115 120 125
Trp Trp Tyr Phe Val Ser Lys Gly Val Glu Tyr Leu Asp Thr Val Phe
130 135 140
Phe Ile Leu Arg Lys Lys Asn Asn Gln Val Ser Phe Leu His Val Tyr
145 150 155 160
His His Cys Thr Met Phe Thr Leu Trp Trp Ile Gly Ile Lys Trp Val
165 170 175
Ala Gly Gly Gln Ala Phe Phe Gly Ala Gln Met Asn Ser Phe Ile His
180 185 190
Val Ile Met Tyr Ser Tyr Tyr Gly Leu Thr Ala Phe Gly Pro Trp Ile
195 200 205
-3-
CA 02409705 2002-11-15
WO 01/87921 PCT/USO1/15464
Gln Lys Tyr Leu Trp Trp Lys Arg Tyr Leu Thr Met Leu Gln Leu Val
210 215 220
Gln Phe His Val Thr Ile Gly His Thr Ala Leu Ser Leu Tyr Thr Asp
225 230 235 240
Cys Pro Phe Pro Lys Trp Met His Trp Ala Leu Ile Ala Tyr Ala Ile
245 250 255
Ser Phe Ile Phe Leu Phe Leu Asn Phe Tyr Thr Arg Thr Tyr Asn Glu
260 265 270
Pro Lys Gln Ser Lys Thr Gly Lys Thr Ala Thr Asn Gly Ile Ser Ser
275 280 285
Asn Gly Val Asn Lys Ser Glu Lys Ala Leu Glu Asn Gly Lys Pro Gln
290 295 300
Lys Asn Gly Lys Pro Lys Gly Glu
305 310
<210> 6
<211> 1292
<212> DNA
<213> Mus musculus
<400>
6
cagtcgcccacggtccatcggagcctctcttctcgcccgcttgtcgtacctctcctcgcc 60
aagatggggctgctggactcagagcccggcagcgtcctgaacgcgatgtccacggcattc 120
aacgacaccgtggagttctatcgctggacctggaccattgcagataaacgtgtagcagac 180
tggccgctgatgcagtctccatggccaacgataagcataagcacgctctatctcctgttc 240
gtgtggctgggtccaaagtggatgaaagaccgcgagccgttccaaatgcgcttagtactc 300
ataatctataattttggcatggttttgcttaaccttttcatcttcagagagctattcatg 360
ggatcatacaacgcaggatacagctatatttgccagtcagtggattattctaatgatgtt 420
aatgaagtcaggatagcggcggccctgtggtggtattttgtatcgaaaggcgttgagtat 480
ttggacacagtgttttttatcctgaggaagaaaaacaaccaagtctccttccttcacgtg 540
taccaccactgcaccatgttcactctgtggtggattggaatcaagtgggtggctggaggc 600
caagcgtttttcggggcccagatgaactctttcatccacgtgatcatgtactcctactat 660
gggctgactgcgttcggcccctggatccagaaatatctttggtggaagcgatacctgacc 720
atgctgcagctggtccagttccacgtgaccatcggacacacagcactgtctctctacacc 780
gactgccccttccccaagtggatgcactgggctctgatcgcctacgccatcagcttcatc 840
ttcctcttcctcaacttctacactcggacatacaatgagccgaagcagtcaaaaaccgga 900
aagacggccacgaatggtatctcatcgaacggcgtgaataaatcagagaaagcgttagaa 960
aacgggaaaccccagaaaaacgggaagccaaaaggagagtaaattgaactgggccttaac 1020
cggtagacagtgaggaaactcctgtgtcattttaaaaagttcaggggcaacagaagcaga 1080
gggtctgggctggggagaaaggcagatagggtctttgcccttcagactgagtaaaacttt 1140
tcaatatatggtacccagatgttttatttatgaagtttttattttaaaagtttttttttt 1200
attaacccttcatgttgtccaaaaccaaagcaacccccaatgtggaccttgggagccttt 1260
tctctgttaacattccgccttgggcaatgggg 1292
<210>
7
<211>
2445
<212>
DNA
<213>
Human
<220>
<223> N indicates gaps between exons; gap whose lengths
are unknown.
<400>
7
gccgccaccgcctccggggtcagccctctctctgggtctccgctttctcctgccgccagc 60
gcccgctcatcgccgcgatggggctcctggactcggagccgggtagtgtcctaaacgtag 120
tgtccacggcactcaacgacacggtagagttctaccgctggacctggtccatcgcaggta 180
aagccgctgacttccccatcctcgctcggtcccccgcggggggtcaccggcccctggtct 240
cgcagctcccgggcccggccccacaggcccccgcgccctgcggctttcggatgctgcgga 300
nnnnnnnnnnagccacttgcaggagtcagtattgtttctttggtttttataccatgtatt 360
ttttgttgggactcaaaggacagtgatccgtatttagtcaaattaggaaattaagttgaa 420
acatcttgattcctaaaaagtgtattttataaaacatttactgattaatgaattttatgg 480
-4-
CA 02409705 2002-11-15
WO 01/87921 PCT/USO1/15464
tattttgttctctctatagataagcgtgtggaaaattggcctctgatgcagtctccttgg 540
cctacactaagtataagcactctttatctcctgtttgtgtggctgggtccaaaatggatg 600
aaggaccgagaaccttttcagatgcgtctagtgctcattatctataattttgggatggtt 660
ttgcttaacctctttatcttcagagaggtatgtttttaagatcactttaataattttcca 720
aggttattggaaatttaaaaatgagaatgtgtaaaaccatnnnnnnnnnnaatcggaatg 780
catgaaatttttaatgcatttgaaatttttaaagaaaatattgtgtttaaaataatttga 840
aaggctacattttgtatataattgtgtttttaatgctgtgtttactaaaactttactaca 900
aatattattactctttttccagttattcatgggatcatataatgcgggatatagctatat 960
ttgccagagtgtggattattctaataatgttcatgaagtcagggtaagtacattaaaaat 1020
actcttaatcagtaaaagtggtttgatttttataggccccagtctgtgaaaannnnnnnn 1080
nntccatgcCttgtacattttgtgcaatatacaaatgtttattttggasttacttacaat 1140
gagtataaacccatacaatagtgtcattttggtgtttataacacgctttccctttttaca 1200
gatagctgctgctctgtggtggtactttgtatctaaaggagttgagtatttggacacagt 1260
gttttttattctgagaaagaaaaacaaccaagtttctttccttcatgtgtatcatcactg 1320
tacgatgtttaccttgtggtggattggaattaagtgggttgcaggaggacaaggtgagca 1380
ttttcaggaatatactgcttgcgtttaattgcatatatgtgttcagtggaaagcaatgag 1440
aacctaggactttgacttgatctaccatttaacttgctttcatggttaatcatttccatg 1500
ttcatttcttttttttttttttttttttttttttgagatggagtctcgctctgtcaccag 1560
gctggagtgcagtggcgcgatctcggctcactgcaacctccacctcccgggttccagcga 1620
ttctcctgcctcagcctcctgagtagctgggactacaggcacacaccaccacgcctagct 1680
aattttttgtatttttagtagagacagggtttcaccatgttggccaggatggtaaaagat 1740
ctcttgaccttgtgatccgcnnnnnnnnnncatctcagtggcttactgcctaataaaatt 1800
ttctgtatcttgtaattacctgttgtttttctaaagcattttttggagcccagttgaatt 1860
cctttatccatgtgattatgtactcatactatgggttaactgcatttggcccatggattc 1920
agaaatatctttggtggaaacgatacctgactatgttgcaactggtgagttaaatgcttc 1980
caaagtttcttctggtaaaatactgaaattgtttaaatttgattaattttaaagtgcaat 2040
gtcattttagacaattttcnnnnnnnnnnagatgccgatgttgttaaaagttgtttacta 2100
ttcagattaaatgttttgtgctgtcatttctgtttttcagattcaattccatgtgaccat 2160
tgggcacacggcactgtctctttacactgactgccccttccccaaatggatgcactgggc 2220
tctaattgcctatgcaatcagcttcatatttctctttcttaacttctacattcggacata 2280
caaagagcctaagaaaccaaaagctggaaaaacagccatgaatggtatttcagcaaatgg 2340
tgtgagcaaatcagaaaaacaactcatgatagaaaatggaaaaaagcagaaaaatggaaa 2400
agcaaaaggagattaaattgaactgggccttaactgttgttgaca 2445
<210> 8
<211> 347
<212> PRT
<213> Saccharomyces
<400> 8
Met Asn Ser Leu Val Thr Gln Tyr Ala Ala Pro Leu Phe Glu Arg Tyr
1 5 10 15
Pro Gln Leu His Asp Tyr Leu Pro Thr Leu Glu Arg Pro Phe Phe Asn
20 25 30
Ile Ser Leu Trp Glu His Phe Asp Asp Val Val Thr Arg Val Thr Asn
35 40 45
Gly Arg Phe Val Pro Ser Glu Phe Gln Phe Ile Ala Gly Glu Leu Pro
50 55 60
Leu Ser Thr Leu Pro Pro Val Leu Tyr Ala Ile Thr Ala Tyr Tyr Val
65 70 75 80
Ile Ile Phe Gly Gly Arg Phe Leu Leu Ser Lys Ser Lys Pro Phe Lys
85 90 95
Leu Asn Gly Leu Phe Gln Leu His Asn Leu Val Leu Thr Ser Leu Ser
100 105 110
Leu Thr Leu Leu Leu Leu Met Val Glu Gln Leu Val Pro Ile Ile Val
115 120 125
Gln His Gly Leu Tyr Phe Ala Ile Cys Asn Ile Gly Ala Trp Thr Gln
130 135 140
Pro Leu Val Thr Leu Tyr Tyr Met Asn Tyr Ile Val Lys Phe Ile Glu
145 150 155 160
Phe Ile Asp Thr Phe Phe Leu Val Leu Lys His Lys Lys Leu Thr Phe
165 170 175
-5-
CA 02409705 2002-11-15
WO 01/87921 PCT/USO1/15464
Leu His Thr Tyr His His Gly Ala Thr Ala Leu Leu Cys Tyr Thr Gln
180 185 190
Leu Met Gly Thr Thr Ser Ile Ser Trp Val Pro Ile Ser Leu Asn Leu
195 200 205
Gly Val His Val Val Met Tyr Trp Tyr Tyr Phe Leu Ala Ala Arg Gly
210 215 220
Ile Arg Val Trp Trp Lys Glu Trp Val Thr Arg Phe Gln Ile Ile Gln
225 230 235 240
Phe Val Leu Asp Ile Gly Phe Ile Tyr Phe Ala Val Tyr Gln Lys Ala
245 250 255
Val His Leu Tyr Phe Pro Ile Leu Pro His Cys Gly Asp Cys Val Gly
260 265 270
Ser Thr Thr Ala Thr Phe Ala Gly Cys Ala Ile Ile Ser Ser Tyr Leu
275 280 285
Val Leu Phe Ile Ser Phe Tyr Ile Asn Val Tyr Lys Arg Lys Gly Thr
290 295 300
Lys Thr Ser Arg Val Val Lys Arg Ala His Gly Gly Val Ala Ala Lys
305 310 315 320
Val Asn Glu Tyr Val Asn Val Asp Leu Lys Asn Val Pro Thr Pro Ser
325 330 335
Pro Ser Pro Lys Pro Gln His Arg Arg Lys Arg
340 345
<210> 9
<211> 345
<212> PRT
<213> Saccharomyces
<400> 9
Met Asn Thr Thr Thr Ser Thr Val Ile Ala Ala Val Ala Asp Gln Phe
1 5 10 15
Gln Ser Leu Asn Ser Ser Ser Ser Cys Phe Leu Lys Val His Val Pro
20 25 30
Ser Ile Glu Asn Pro Phe Gly Ile Glu Leu Trp Pro Ile Phe Ser Lys
35 40 45
Val Phe Glu Tyr Phe Ser Gly Tyr Pro Ala Glu Gln Phe Glu Phe Ile
50 55 60
His Asn Lys Thr Phe Leu Ala Asn Gly Tyr His Ala Val Ser Ile Ile
65 70 75 80
Ile Val Tyr Tyr Ile Ile Ile Phe Gly~Gly Gln Ala Ile Leu Arg Ala
85 90 95
Leu Asn Ala Ser Pro Leu Lys Phe Lys Leu Leu Phe Glu Ile His Asn
100 105 110
Leu Phe Leu Thr Ser Ile Ser Leu Val Leu Trp Leu Leu Met Leu Glu
115 120 125
Gln Leu Val Pro Met Val Tyr His Asn Gly Leu Phe Trp Ser Ile Cys
130 135 140
Ser Lys Glu Ala Phe Ala Pro Lys Leu Val Thr Leu Tyr Tyr Leu Asn
145 150 155 160
Tyr Leu Thr Lys Phe Val Glu Leu Ile Asp Thr Val Phe Leu Val Leu
165 170 175
Arg Arg Lys Lys Leu Leu Phe Leu His Thr Tyr His His Gly Ala Thr
180 185 190
Ala Leu Leu Cys Tyr Thr G1n Leu Ile Gly Arg Thr Ser Val Glu Trp
195 200 205
Val Val Ile Leu Leu Asn Leu Gly Val His Val Ile Met Tyr Trp Tyr
210 215 220
Tyr Phe Leu Ser Ser Cys Gly Ile Arg Val Trp Trp Lys Gln Trp Val
225 230 235 240
Thr Arg Phe Gln Ile Ile Gln Phe Leu Ile Asp Leu Val Phe Val Tyr
245 250 255
-6-
CA 02409705 2002-11-15
WO 01/87921 PCT/USO1/15464
Phe Ala Thr Tyr Thr Phe Tyr Ala His Lys Tyr Leu Asp Gly Tle Leu
260 265 270
Pro Asn Lys Gly Thr Cys Tyr Gly Thr Gln Ala Ala Ala Ala Tyr Gly
275 280 285
Tyr Leu Ile Leu Thr Ser Tyr Leu Leu Leu Phe Ile Ser Phe Tyr Ile
290 295 300
Gln Ser Tyr Lys Lys Gly Gly Lys Lys Thr Val Lys Lys Glu Ser Glu
305 310 315 320
Val Ser Gly Ser Val Ala Ser Gly Ser Ser Thr Gly Val Lys Thr Ser
325 330 335
Asn Thr Lys Val Ser Ser Arg Lys Ala
340 345
<210> 10
<211> 16
<212> DNA
<213> Human
<400> ~.0
tttcttaact tctaga 16
<210> 11
<211> 16
<212> DNA
<213> Human
<220>
<223> n = unknown
<400> 11
tttcttannc attncn 16
<210> l2
<211> 16
<212> DNA
<213> Human
<400> 12
tttcttaact tctaca 16
<210> l3
<211> 16
<212> DNA
<213> Human
<220>
<223> n = unknown
<400> 13
tttcttanac attcgg 16
<210> 14
<211> l5
<212> DNA
<213> Artificial Sequence
<220>
<223> Probe
<400> 14
ctttcttcta cattc 15
_7_
CA 02409705 2002-11-15
WO 01/87921 PCT/USO1/15464
<210> 15
<211> 20
<212> DNA ,
<213> Artificial Sequence
<220>
<223> PCR Probe
<400> 15
gtgtggaaaa ttggcctctg 20
<210> 16
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> PCR Probe
<400> 16
gtcctcctgc aacccagtta 20
<210> 17
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> PCR Probe
<400> 17
catggctgtt tttccagctt 20
<210> 18
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> PCR Probe
<400> 18
cccagttgaa ttcctttatc ca 22
<210> 19
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> PCR Probe
<400> 19
gtcaacaaca gttaaggccc a 21
<210> 20
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> PCR Probe
_g_
CA 02409705 2002-11-15
WO 01/87921 PCT/USO1/15464
<400> 20
aggttaagca aaaccatccc a 21
<210> 21
<211> 27
<212> DNA
<213> Artificial Sequence
<220>
<223> PCR Probe
<400> 21
ccatcctaat acgactcact atagggc 27
<210> 22
<211> 23
<212> DNA
<213> Artificial Sequence ,
<220>
<223> PCR Probe
<400> 22
actcactata gggctcgagc ggc 23
<210> 23
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> PCR Probe
<400> 23
aggttctcgg tccttcatcc 20
<210> 24
<211> 23
<212> DNA
<213> Artificial Sequence
<220>
<223> PCR Probe
<400> 24
gaagatgccg atgttgttaa aag 23
-9-
