Note: Descriptions are shown in the official language in which they were submitted.
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
BIFUNCTIONAL MOLECULES AND VECTORS COMPLEXED THEREWITH FOR
TARGETED GENE DELtIVERY
Work described herein was supported by NIH grants EY1 1439 and
HL54352. The government has certain rights in such subject matter.
FIELD OF INVENT10N
The present invention relates to gene therapy, especially to adenovirus
vector-based gene therapy. In particular, adenovirus vectors complexed with
bifunctional molecules for targeted delivery of therapeutic and other products
are
provided. The bifunctional molecules complexed with adenovirus delivery
particles circumvent Coxsackie Adenovirus Receptor (CAR) and integrin
interactions and improve gene delivery by such particles. The bifunctional
molecules, compositions, kits, and methods of preparation and use of the
vector/bifunctional molecules for,gene therapy are provided.
BACKGROUND OF THE INVENTION
Adenovirus delivery vectors
Adenovirus, which is a DNA virus with a 36 kilobase (kb) genome, is very
well-characterized and its genetics and genetic organization are understood.
The genetic organization of adenoviruses permits substitution of large
fragments
of viral DNA with foreign DNA. In addition, recombinant adenoviruses are
structurally stable and no rearranged viruses are observed after extensive
amplification.
Adenoviruses have been employed as delivery vehicles for introducing
desired genes into eukaryotic cells. The adenovirus delivers such genes to
eukaryotic cells by binding to cellular receptors followed by internalization.
The
adenovirus fiber protein is responsible for binding to cells. The fiber
protein has
two domains, a rod-like shaft portion and a globular head portion that
contains
the receptor binding region. The fiber spike is a homotrimer, and there are 12
spikes per virion. Human adenoviruses bind to and infect a broad range of
cultured cell lines and primary tissues from different~species.
The 35,000+ base pair (bpj genome of adenovirus type 2 has been
sequenced and the predicted amino acid sequences of the major coat proteins
(hexon, fiber and .penton base) have been described (see, e.g., Neumann et
al.~
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
_2_
Gene 69: 153-157 (1988); Herisse et al., Nuc. Acids Res. 9: 4023-4041 11981 );
Roberts et-al.; .!. BioL~Chem. 259: 13968=13975 (1984); Kinloch et al., J.
Biol.
Chem. 259: 6431-6436 (1984); and Chroboczek et al., Virol. 161: 549-554,
1987).
The 35,935 by sequence of Ad5 DNA is also known and portions of
many other adenovirus genomes have been sequenced. The upper packaging
limit for adenovirus virions is about 105% of the wild-type genome length
(see,
e.g., Bett, et al., J. Virol. 67(70): 591 1-21, 1993). Thus, for Ad2 and AdS,
this
would be an upper packaging limit of about.38 kb of DNA.
Adenovirus DNA also includes inverted terminal repeat sequences (ITRs)
ranging in size from about 100 to 150 bp, depending on the serotype. The
inverted repeats permit single strands of viral DNA to circularize by base-
pairing
of their terminal sequences to form base-paired "panhandle" structures that
are
required for replication of the viral DNA.
For efficient packaging, the iTRs and the packaging signal (a few hundred by
in
length) comprise the "minimum requirement" for replication and packaging of a
genomic nucleic acid into an adenovirus particle. Helper-dependent vectors
lacking all viral ORFs but including these essential cis elements (the ITRs
and
contiguous packaging sequence) have been constructed,
Ad vectors have several distinct advantages as gene delivery vehicles.
For example, recombination of such vectors is rare; there are no known
associations of human malignancies with adenoviral infections despite common
human infection with adenoviruses; the genome may be manipulated to
accommodate foreign genes of a fairly substantial size; and host proliferation
is
not required for expression of adenoviral proteins. Adenovirus (Ad)-based gene
delivery vectors efficiently infect may different cells and tissues. This
broad
tropism, however, means that gene delivery cannot be directed to a specific
target cell. A large fraction of intravenously administered adenovirus is
retained
by the liver, which could lead to undesirable side-effects. Adenovirus may
. potentiate immune responses. For example, Adenovirus type 5 (Ad5) also
transduces dendritic cells, which present antigens very efficiently, thereby
possibly exacerbating the immune response against the vector. It has been
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
-3-
proposed that vectors with different targeting efficiencies might eliminate
these
problems perra~itting. a lower total particle nose and more specific targeting
(see,
e.g., U.S. application Serial No. 09/482,682).
The wealth of information on adenovirus structure and mechanism of
infection, its efficient infection of nondividing cells, and its large genetic
capacity
make adenovirus a popular gene therapy vector. The wide expression of
receptors to which adenovirus binds makes targeting adenovirus vectors
difficult. In particular, because of the widespread distribution of the Ad
receptor
(CAR), current adenoviral (Ad) vectors cannot be targeted to specific cell
types
(see, e.g., Bergelson et al. (1997) Science 275:1320-1323; Tomko et al. (1997)
Proc.NatLAcad.Sci. USA 94:3352-3356). Moreover, CAR and/or internalization
receptors (av integrins) (see, Wickham et al. (1993) Cell 73:309-319) are
absent .or present at low levels on some cell types, rendering them resistant
to
Ad-mediated gene delivery. .
Approximately 20% of all gene therapy clinical trials, registered with the
NIH Recombinant DNA Advisory Committee, use replication-deficient adenovirus
vectors (Office of Recombinant DNA Database). While successes have been
reported, especially in the area of tumor management (see, e.g., Bilbao et al.
(1998) Adv.Exp.Med.Biol. 451:365-374; Gomez-Navarro et al. (1999)
Eur.J.Cancer 35:867-885), the use of adenovirus gene delivery vectors has been
hampered by host inflammatory responses to the virus or encoded transgene
products (ICay et al. (1997) Proc.NatLAcad.Sci.USA 94:12744-12746). In
addition, some cell types lack either the Ad attachment receptor, Coxsackie
Adenovirus Receptor (CAR; Bergelson ef al. (1997)~Science 275:1320-1323;
Tomko et al. (1997) Proc.NatLAcadSci. USA 94:3352-3356) or integrins ov~3
and av~5, which serve as virus internalization receptors (Wickham et aL (1993)
Cell 73:309-319). For example, because airway epithelia do not express CAR
and integrins on their apical surface (Goldman et al. (1995) J.Virol. 69:5951-
5958; Grubb et al. (1994) Nature 371:802-806), clinical trials for the
treatment
of cystic fibrosis reported variable, generally low, efficacy (Zabner et al.
(1993)
Cell 75:207-216; Crystal et al. (1994) Nature genet. 4:42-51 ) using
adenoviral
vectors.
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
-4-
Thus, while adenoviral vectors and others, hold much promise for
therapeutic~applications, their usefiulness is limited by the widespread
tissue
distribution of CAR, which restricts delivery to specific cell types, and also
by
the absence of CAR and/or av integrin receptors on certain cells in vivo.
There
have been attempts to overcome these limitations by modifying one or more of
the Ad outer capsid proteins in order to retarget vectors to different cell
receptor. While improvements in gene delivery have been realized, each method
has its limitation. Also, the underlying factors that promote gene delivery
have
not been clearly defined, which has impeded further progress in Ad vector
development; and the specificity of targeting requires further improvement.
Hence, there is a need to improve delivery and targeting of gene delivery
vectors, including adenoviral gene delivery vectors, and to understand the
underlying. basis therefor. Therefore, it is an object herein to provide
methods
and vectors that cari specifically target specific cells and tissues and that
provide
improved delivery and internalization of such vectors. It is also an object
herein
to identify the underlying mechanism for internalization and to provide
delivery
methods and delivery vectors based thereon.
SUMMARY OF THE INVENTION
A vector targeting method that takes advantage of the common cell
signaling pathways initiated by ligation of av integrins and cell surface
proteins
and receptors that upon ligand interaction activate phosphatidylinositol 3
kinases
(PI3K) or the phosphatidylinositol 3- (P13) signalling pathway is provided.
Bifunctional molecules (or multifunctional molecules) for effecting the
targeting
and complexes that contain the bifunctional molecules conjugated to a viral
particle or bacterial surface protein are provided. Methods of gene delivery
and
gene therapy are also provided. In a preferred embodiment the virus for
delivery
and to which the bifunctional molecule specifically binds is adenovirus or
adeno-
associated virus. More preferably the virus is adenovirus, including fiberless
viral
particles,
In particular, bifunctional molecules that contain an antibody or antigen-
binding portiorr thereof and a targeting agent are provided. The
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
_5_
antibody specifically binds to an antigen in a protein that binds to o~
integrin; and
the targeting agent~specifically binds to a cell surface protein that
activates the
phosphatidylinositof 3 (P13) signaling pathway. In particular, the targeting
agent
binds to a cell surface protein that.triggers phosphatidylinositol-3-OH kinase
(PI3K) activation.
Thus, the bifunctional molecules include a targeting agent, which is a
moiety that specifically binds to a cell surface protein that triggers
activation of
PI3K, and a binding portion (designated "P" herein) that specifically binds to
a
protein on a viral particle or bacterial cell surface. Generally such viral or
bacteria! surface protein specifically binds to an an integrin or other
protein on
the surface of a targeted ceN that facilitates or effects internalization of
the virus
or bacterial into the cell.
The .bifunctional molecules optionally include a linker or plurality of
linkers
that links the antibody or antigen-binding portion thereof to the targeting
agent.
The linker can be a peptide, preferably of from 2 to 100, more preferably 3 to
50, more preferably 5 to 20 amino acids, a single amino acid, or a chemical
linker, such as those produced by reaction with crosslinking agents or
heterobifunctional crosslinking reagents. The bifunctional molecules can be
fusion proteins, chemical conjugates or mixtures thereof, a single amino acid
or a
peptide.
Thus the bifunctional agents can be represented by the formula:
(P)" -(L)q (TA)m, where m and n are integers of 1 or higher, and are
generally 1, and q is O or an integer of one or more, and is generally 1 or 2.
In
instances where either or both of n and m are greater than 7 , the resulting
molecule is technically a multifunctional molecule. Each P and each TA do can
be the same or different.
The protein that binds to a" integrin is a viral. protein or a bacterial
protein
that interacts with a~ integrins for internalization of the respective virus
or
bacteria. It is with such protein that the "P" moiety of the bifunctional~
molecule
interacts. The P moiety is generally an antibody or portion thereof or
recombinant molecule having the binding specificity of an antibody. The
antibody or antigen-binding portion of the bifunctional molecule specifically
binds
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
-6-
to such protein, which for example is a viral protein, such as the penton
protein
of ~denovirus:
The antibody or antigen-binding portion of the bifunctionat molecule can
include a heavy chain or a portion thereof sufficient for antigen-binding
fused to
the targeting agent; or is an Fab or Fab'2 fragment, or is a synthetic or
recombinant molecule that contains antibody fragments, such as portions of the
heavy chain and light chain variable regions sufficient for specific
interaction
with the antigen.
The targeted cell surface protein is any cell surface protein in which
binding thereto facilitates internalization, particularly via the signaling
pathway
that involves PI3K. Such surface proteins, include, but are not limited to
cytokine receptors, growth hormone receptors and other non-steroidal hormone
receptors, such as a~PDGF receptor, an IGF-1 receptor, an EGF receptor, a
member of the FGF receptor family, a TNF receptor, a CSF-1 receptor, an
insulin
receptor, an IGF-1 receptor, an NGF receptor, an II-2 receptor, an II-3
receptor,
an II-4 receptor, an IgM receptor, a CD4 receptor, a CD2 receptor, a CD3/T
cell
receptor, a G protein linked thrombin receptor, an ATP receptor, an fMLP
receptor, and tyrosine kinase receptors that, when activated, result in
increased
accumulation of Ptdlns(3,4,5)P3, receptors associated with the src family
20, non-receptor tyrosine kinases that stimulate PI3Ks to lead to phosphatidyl-
inositol(3,4,5)P3 (Ptdlns(3,4,5)P3) accumulation.
tn exemplified embodiments, growth factor/cytokines, such as TNF-a,
IGF-1, SCF, PDGF and EGF, hormones, such as insulin, and other molecules or
portions thereof that trigger phosphatidylinositol-3-OH kinase (Pt3K)
activation, a
signaling molecule involved in adenovirus internalization, are fused to a
monoclonal antibody specific for the viral particle protein that interacts
with av
integrins, which in the case of adenovirus the viral penton base. Ad vectors
complexed with these bifunctionat mAbs exhibit increased gene delivery of
about
10-50 fold to human melanoma cells lacking av integrins. The bifunctional Mabs
. also enhance gene delivery by fiberless adenovirus particles, which cannot
bind
to CAR. Improved gene delivery correlates with increased virus internalization
and attachment as well as P13K activity. The use of bifunctional mAbs to
trigger
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
-7-
specific cell signaling pathways offers a widely applicable method for
bypassing
the normal..Ad receptors in gene delivery and potentially increasing the
selectivity
of gene transfer.
Isolated nucleic acid molecule{sj that encode the bifunctional molecules
are also provided. In some instances, in which the "P" moiety is an antibody
or
portion thereof, the bifunctional molecule includes two chains, which can be
separately expressed and the reconstituted, such as by the selected expression
system. . Preferred expression systems are baculovirus systems.
Also provided are combinations that include a bifunctional molecule and a
viral or bacterial vector. The components of the combinations may be separate
or combined in a single composition in which the bifunctional molecules have
been complexed with the viral particles or bacterial cells. Kits, containing
the combinations optionally include instructions for administration and/or
complexing, are also provided. Upon complexing of a bifunctional molecule and
a viral or.bacterial vector, the resulting complex can be used far delivery of
gene
products, such as for therapeutics, gene therapy and or for production of
transgenic animals.
Preferred delivery vectors herein are adenovirus vectors, including fiberless
adenovirus vectors.
Methods of gene therapy by administration of the targeted gene delivery
vectors that include the bifunctional molecules complexed with a viral
particle or
bacterial cells are also provided.
In exemplified embodiments, bifunctional molecules and complexes
thereof with adenovirus delivery vectors are provided. In an exemplary
embodiment, a bifunctional molecule that recognizes the RGD motif in the
penton base protein of adenovirus is fused to the mature form of a receptor
targeting molecule, such as TNF-a. The bifunctional molecules were expressed
in insect cells using a non-lytic baculovirus expression system. In
particular, the
bifunctional molecule was produced from a monoclonal antibody, designated
DAV-1, that specifically interacts with penton base on the surface of
adenovirus
strains, including Ad2, Ad3, Ad4 and AdS. In particular, this antibody
includes
sequence of amino acids set forth in SEQ ID No. 2 or SEQ iD No. 6 or a
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
_g_
sufficient portion thereof for antigen recognition or is encoded by nucleic
acid
that hybridizes along its full length under conditions of low stringency, more
preferably moderate stringency, most preferably high stringency to a
sufficient
portion of SEQ ID Nos. 1 or 5 to encode an antigen-binding portion of the
antibody. The antibody or portion thereof also include light chain that
includes
all or a portion of the sequence of amino acids set forth in SEQ ID No. 4 or
nucleic acid that hybridizes along its full length under conditions of low
stringency, more preferably moderate stringency, most preferably high
stringency to a sufficient portion of~ the SEQ ID~ No. 3 so that the resulting
70 molecule encodes an antigen-binding portion of the antibody.
The targeting agent or portion thereof can be selected from among, for
example, is a tumor necrosis factor (TNF), a fibroblast growth factor (FGF),
an
insulin-tike. growth factor (IGF), a colony stimulating factor (CSF), insulin
and a
stem cell factor (SCF). .
In exemplfied embodiments, bifunctional molecules were capable of
enhancing infection of M21-L12 melanoma cells, which lack av integrins and are
also resistant to TNFa killing. M21 cells are relatively resistant to
transduction
with adenovirus vectors. Incubation of Ad encoding fact with the.origina!
monoclonal antibody alone had little effect enhancing gene delivery. In
contrast, preincubation of Ad.lacZ particles with the bifunctiona! antibody
produced a 20-fold increase in virus-mediated gene delivery. Enhanced virus
infection by the bifunctionat antibodies was due to a combination of increased
virus binding and internalization. Enhanced internalization resulted from
increased activation of PI3K through TNFa receptor ligation. Other
bifunctiona!
molecules containing receptor ligands were capable of activating Pl3K and
enhancing gene delivery,
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
-9-
These results demonstrate that activation of receptors that activate P13lC
bypasses-the requirement for w integrins or, for adenovirus, CAR to promote
virus entry. Receptor bypass was highly effective when cytokine or growth
factors were activated in close proximity to bound virus particles.
DETAILED DESCRIPTION OF THE INVENTION
A. DEFINITIONS
Unless defined otherwise, all technical and scientific terms used herein
have the same meaning as is commonly understood by one of skill in the art to
which this invention belongs. All patents, applications, published
applications
and other publications and sequences from GenBank and other data bases
referred to anywhere in the disclosure herein are incorporated by reference in
their entirety.
As. used hereiri, the amino acids, which occur in the various amino acid
sequences appearing herein; are identified according to their weil-
known, three-letter or one-letter abbreviations. The nucleotides, which occur
in
the various DNA fragments, are designated with the standard single-letter
designations used routinely in the art (see, Table 1 ).
As used herein, amino acid residue refers to an amino acid formed upon
chemical digestion (hydrolysis) of a polypeptide at its peptide linkages. The
amino acid residues described herein are preferably in the "L" isomeric form.
However, residues in the "D" isomeric form can. be substituted for any L-amino
acid residue, as long as the desired functional property is retained by the
polypeptide. NHZ refers to the free amino group present at the amino terminus
of a polypeptide. COON refers to the free carboxy group present at the
carboxyl
terminus of a polypeptide. In keeping with standard polypeptide nomenclature
described in J. Biol. Chem., 243:3552-59 (1969) and adopted at 37 C.F.R. ~ ~
1.821 - 1.822, abbreviations for amino acid residues are shown in the
following
Table:
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
-10-
Table 1
Table of Correspondence
SYM BOL
1-letter 3-fetter AMINO ACID
Y Tyr tyrosine
G Gly glycine
F Phe phenylalanine
M . Met methionine
A Ala aianine
S Ser serine
Ile isoleucine
L . Leu leucine
T Thr threonine
V Val valine
P Pro proline
K Lys lysine
H His histidine
Q Gln glutamine
E Glu glutamic acid
Z Glx Glu and/or Gln
W Trp tryptophan
R Arg arginine
D Asp aspartic acid
N Asn asparagine
B Asx Asn and/or Asp
C Cys cysteine
X Xaa Unknown .or other
It should be noted that all amino acid residue sequences represented
30. herein by formulae have a left to right orientation in the conventional
direction of
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
-11-
amino-terminus to carboxyl-terminus. in addition, the phrase "amino acid
residue" ~is vbroadly defined to include the amino acids listed in the Table
of
Correspondence and modified and unusual amino acids, such as those referred
to in 37 C.F.R. ~ ~ 1.821-1.822, and incorporated herein by reference.
Furthermore, it should be noted that a dash at the beginning or end of an
amino
acid residue sequence indicates a peptide bond to a further sequence of one or
more amino acid residues or to an amino-terminal group such as NHZ or to a
carboxyl-terminal group such as COOH.
In a peptide or protein, suitable conservative substitutions of amino acids
are known to those of skill in this art and may be made generally without
altering
the biological activity of the resulting molecule. Those of skill in this art
recognize that, in general, single amino acid substitutions in non-essential
regions of.a.polypeptide do not substantially alter biological activity (see,
e~g.,
Watson et al. Molecular Biology of the Oene, 4th Edition, 1987, The
Bejacmin/Cummings Pub. co., p.224).
Such substitutions are preferably made in accordance with those set forth
in TABLE 2 as follows:
TABLE 2
Original residue Conservative substitution
Ala (A) Gly; Ser
Arg (R) Lys
Asn (N) Gln; His
Cys (C) Ser
Gln (Q) Asn
Glu (E) Asp
Gly (G) Ala; Pro
His (H) Asn; Gln
ile (t) Leu; Val
Leu (L) !1e; Val
Lys (K) Arg; Gln; Glu
Met (M) Leu; Tyr; lle
Phe (F) Met; Leu; Tyr
Ser (S) Thr
Thr (T) Ser
Trp (W) Tyr
Tyr (Y) Trp; Phe
Val (V) Ile; Leu
Other substitutions are also permissible
and may be determined empirically
or in
accord with known conservative substitutions.
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
-12-
As used herein, a complementing plasmid describes plasmid vectors that
deliver.~nucleic acids into a packaging cell line for stable integration into
a
chromosome in the cellular genome.
As used herein, a delivery .plasmid is a plasmid vector that carries or
delivers nucleic acids encoding a therapeutic gene or gene that encodes a
therapeutic product or a precursor thereof or a regulatory gene or other
factor
that results in a therapeutic effect when delivered in vivo in or into a cell
line,
such as, but not limited to a packaging cell line, to propagate therapeutic
viral
vectors.
As used herein, a variety of vectors are described. For example, one
vector is used to deliver particular nucleic acid molecules into a packaging
cell
line for stable integration into a chromosome. These types of vectors are
generally identified herein as complementing piasmids. A further type of
vector
described herein carries or delivers nucleic acid molecules in or into a cell
line
(e.g., a packaging cell line) for the purpose of propagating therapeutic viral
vectors; hence, these vectors are generally referred to herein as delivery
plasmids. A third "type" of vector described herein is used to carry nucleic
acid
molecules encoding therapeutic proteins or polypeptides or regulatory proteins
or
are regulatory sequences to specific cells or cell types in a subject in need
of
treatment; these vectors are generally identified herein as therapeutic viral
vectors or recombinant adenoviral vectors or viva! Ad-derived vectors and are
in
the form of a virus particle encapsulating a viral nucleic acid containing an
expression cassette for expressing the therapeutic gene.
As used herein, a DNA or nucleic acid homolog refers to a nucleic acid
that includes a preselected conserved nucleotide sequence, such as a sequence
encoding a therapeutic polypeptide. By the term "substantially homologous" is
meant having at least 80%, preferably at least 90%, most preferably at least
95 % homology therewith or a less percentage of homology or identity and
conserved biological activity or function.
. The terms "homology" and "identity" are often used interchangeably. In
this regard, percent homology or identity may be determined, for example, by
comparing sequence information using a GAP computer program. The GAP
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
-13-
program utilizes the alignment method of Needleman and Wunsch (J. Mol. Biol.
48:443(-1970), as revised by Smith. and Waterman (Adv. App/. Math. 2:482
(1981 ). Briefly, the GAP program defines similarity as the number of aligned
symbols (i.e., nucleotides or amino acids) which are similar, divided by the
total
number of symbols in the shorter of the two sequences. The preferred default
parameters for the GAP program may include: ( 1 ) a unary comparison matrix
(containing a value of 1 for identities and 0 for non-identities) and the
weighted
comparison matrix of Gribskov and Burgess, Nucl. Acids Res. 14:6745 (1986),
as described by Schwartz and Dayhoff, eds:, ATLAS OF PROTEIN SEQUENCE
AND STRUCTURE, National Biomedical Research Foundation, pp. 353-358
(1979); (2) a penalty of 3.0 for each gap and an additional 0.10 penalty for
each
symbol in each gap; and (3) no penalty for
end gaps. -
Whether any two nucleic acid molecules have nucleotide sequences that
are at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% "identical" can be
determined using known computer algorithms such as the "FAST A" program,
using for example, the default parameters as in Pearson and Lipman, Proc.
Natl.
Acad. Sci. USA 85:2444 (1988). Alternatively the BLAST function of the
National Center for Biotechnology Information database may be used to
determine identity
In genera(, sequences are aligned so that the highest order match is
obtained. "Identity" per se has an art-recognized meaning and can be
calculated
using published techniques. (See, e.g.: Computational Molecular Biology, Lesk,
A.M., ed., Oxford University Press, New York, 1988; Biocomputing: Informatics
and Genome Projects, Smith, D.W., ed., Academic Press, New York, 1993;
Computer Analysis of Sequence Data, Part I, Griffin, A.M., and Griffin, H.G.,
eds., Humana Press, New Jersey, 1994; Seguence Analysis in Molecular
Biology, von Heinje, G., Academic Press, 1987; and Seguence Analysis Primer,
Gribskov, M. and Devereux, J., eds., M Stockton Press, New York, 1991 ).
While there exist a number of methods to measure identity between two
polynucleotide or polypeptide sequences, the term "identity" is well known to
skilled artisans (Carillo, H. & Lipton, D., SIAM J Applied Math 48:1073
(1988)).
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
-14-
Methods commonly employed to determine identity or similarity between two
sequences.include, but are not limited to, those disclosed in Guide to Huge
Computers, Martin J. Bishop, ed., Academic Press, San Diego, 1994, and
Carillo, H. & Lipton, D., SIAM J Applied Math 48:1073 (1988). Methods to
determine identity and similarity are codified in computer programs. Preferred
computer program methods to determine identity and similarity between two
sequences include, but are not limited to, GCG program package (Devereux, J.,
et al., Nucleic Acids Research 12(1):387 (1984)), BLASTP, BLASTN, FASTA
(Atschul, S.F., et al., J Molec Biol 275:403 (1990)).
Therefore, as used herein, the term "identity" represents a comparison
between a test and a reference polypeptide or polynucleotide. For example, a
test polypeptide may be defined, as any polypeptide that is 90% or more
identical to.a reference' polypeptide.
As used herein, the term at least "90% identical to" refers to percent
identities from 90 to 99.99 relative to the reference polypeptides. Identity
at a
level of 90% or more is indicative of the fact that, assuming for
exemplification
purposes a test and reference polynucleotide length of 100 amino acids are
compared. No more than 10% (i.e., 10 out of 100) amino acids in the test
polypeptide differs from that of the reference polypeptides. Similar
comparisons
may be made between a test and reference polynucleotides. Such differences
may be represented as point mutations randomly distributed over the entire
length of an amino acid sequence or they may be clustered in one or more
locations of varying length up to the maximum allowable, e.g. 10/100 amino
acid difference (approximately 90% identity). Differences are defined as
nucleic
acid or amino acid substitutions, or deletions.
As used herein, stringency conditions refer to the washing conditions for
removing the non-specific probes and conditions that are equivalent to either
high, medium, or low stringency as described below:
1) high stringency: 0.1 x SSPE, 0.1 % SDS, 65°C
2) medium stringency: 0.2 x SSPE, 0.1 °/ SDS, 50°C
3) low stringency: 1.0 x SSPE, 0.1 % SDS, 50°C.
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
-15-
It is understood that equivalent stringencies rnay be achieved using
alternative
buffers, salts and temperatures.
As used herein, genetic therapy involves the transfer of heterologous
DNA to the certain cells, target cells, of a mammal, particularly a human,
with a
disorder or conditions for which such therapy is sought. The DNA is introduced
into the selected target cells in a manner such that the heterologous DNA is
expressed and a therapeutic product encoded thereby is produced.
Alternatively, the heterologous DNA may in some manner mediate expression of
DNA that encodes the therapeutic product, it rinay encode a product, such as a
peptide or RNA that in some manner mediates, directly or indirectly,
expression
of a therapeutic product. Genetic therapy may also be used to nucleic acid
encoding a gene product replace a defective gene or supplement a gene product
produced by the mammal or the cell in which it is introduced. . The introduced
nucleic acid may encode a therapeutic compound, such as a growth factor
inhibitor thereof, or a tumor necrosis factor or inhibitor thereof, such as a
receptor therefor, that is not normally produced ~in the mammalian host or
that is
not produced in therapeutically effective amounts or at a therapeutically
useful
time. The heterologous DNA encoding the therapeutic .product may be modified
prior to introduction into the cells of the afflicted host in order to enhance
or
otherwise alter the product or expression thereof.
As used herein, heterologous DNA is DNA that encodes RNA arid proteins
that are not normally produced iri vivo by the cell in which it is expressed
or that
mediates or encodes mediators that alter expression of endogenous DNA by
affecting transcription, translation, or other regulatable biochemical
processes.
Heterologous DNA may also be referred to as foreign DNA. Any DNA that one
of skill in the art would recognize or consider as heterologous or foreign to
the
cell in which is expressed is herein encompassed by heterologous DNA.
Examples of heterologous DNA include, but are not limited to, DNA that encodes
traceable marker proteins, such as a protein that confers drug resistance, DNA
that encodes therapeutically effective substances, such as anti-cancer agents,
enzymes and hormones, and DNA that encodes other types of proteins, asuch as
antibodies. Antibodies that are encoded by heterologous DNA may be secreted
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
-16-
or expressed on the surface of the cell in which the heterologous DNA has been
introduced.
Hence, herein heterologous DNA or foreign DNA, refers to a DNA
molecule not present in the exact orientation and position as the counterpart
DNA molecule found in the corresponding wild-type adenovirus. It may also
refer to a DNA molecule from another organism or species (i.e., exogenous) or
from another Ad serotype.
As used herein, a therapeutically effective product is a product that is
encoded by heterologous DNA that,.upon introduction of the DNA into a host, a
product is expressed that effectively ameliorates or eliminates the symptoms,
manifestations of an inherited or acquired disease or that cures said disease.
Typically, DNA encoding the desired heterologous DNA is cloned into a
plasmid vector and introduced by routine methods, such as calcium-phosphate
mediated DNA uptake (see, (1981 ) Somat. Cell. Mot. Genet. 7:603-616) or
microinjection, into producer cells, such as packaging cells. After
amplification
in producer cells, the vectors that contain the heterologous DNA are
introduced
into selected target cells.
As used herein, an expression or delivery vector refers to any plasmid or
virus into which a toreign or heterologous DNA may be inserted for expression
in
a suitable host cell - i.e., the protein or polypeptide encoded by the DNA is
synthesized in the host cell's system. Vectors capable of directing the
expression of DNA segments (genes) encoding one or more proteins are referred
to herein as "expression vectors." Also included are vectors that allow
cloning
of cDNA (complementary DNA) from mRNA produced using reverse
transcriptase.
As used herein, a gene is a nucleic acid molecule whose nucleotide
sequence encodes RNA or polypeptide. A gene can be either RNA or DNA.
Genes may include regions preceding and following the cading region (leader
and
trailer) as well as intervening sequences (introns) between individual coding
segments (exons?.
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
-17-
As used' herein, tropism with reference to a adenovirus refers to the
selective ~infectivity or binding that is conferred on the particle by the
fiber
protein, particularly the C-terminus portion that comprises the knob.
As used herein, isolated with reference to a nucleic acid molecule or
polypeptide or other biomolecule means that the nucleic acid or. polypeptide
has
separated from the genetic environment from which the polypeptide or nucleic
acid were obtained. It may also mean altered from the natural state. For
example, a polynucleotide or a polypeptide naturally present in a living
animal is
not "isolated,° but the same polynucleotide or polypeptide separated
from the
coexisting materials of its natural state is "isolated", as the term is
employed
herein. Thus, a polypeptide or polynucleotide produced and/or contained within
a recombinant host cell is considered isolated. Also intended as an "isolated
polypeptide" or an "isolated polynucleotide" are polypeptides or
polynucleotides
that have been puPified, partially or substantially, from a recombinant host
cell or
from a native source. For example, a recombinantly produced version of a
compounds can be substantially purified by the one-step method described in
Smith and Johnson, Gene 67:31-40 (1988). The terms isolated and purified are
sometimes used interchangeably.
Thus, by "isolated" is meant that the nucleic is free of the coding
sequences of those. genes that, in the naturally-occurring genome of the
organism Iif any) immediately flank the gene encoding the nucleic acid of
interest. _ Isolated DNA may be single-stranded or double-stranded, and may be
genomic DNA, cDNA, recombinant hybrid DNA, or synthetic DNA. It may be
identical to a native DNA sequence, or may differ from such sequence by the
deletion, addition, or substitution of one or more nucleotides.
Isolated or purified as it refers to preparations made from biological cells
or hosts means any cell extract containing the indicated DNA or protein
including
a crude extract of the DNA or protein of interest. For example, in the case of
a
protein, a purified preparation can be obtained following an individual
technique
or.a series of preparative or biochemical techniques and the DNA or protein of
interest can be present at various degrees of purity in these preparations.
The
procedures may include for example, but are not limited to, ammonium sulfate
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
_7 8_
fractionation, gel filtration, ion exchange change chromatography, affinity
chromatography, ~dertsity gradient centrifugation and electrophoresis.
A preparation of DNA or protein that is "substantially pure" or "isolated"
should be understood to mean a preparation free from naturally occurring
materials with which such DNA or protein is normally associated in nature.
"Esseritially pure" should be understood to mean a "highly" purified
preparation
that contains at least 95% of the DNA or protein of interest.
A cell extract that contains the DNA or protein of interest should be
understood to mean a homogenate preparation ~or cell-free preparation obtained
from cells that express the protein or contain the DNA of interest. The term
"cell extract" is intended to include culture media, especially spent culture
media
from which the cells have been removed.
As used herein, a packaging cell line is a cell line that provides a missing
gene product or its equivalent.
'(5 As used herein, an adenovirus viva( particle is the minimal structural or
functional unit of a virus. A virus can refer to a single particle, a stock of
particles or a viral genome. The adenovirus (Ad) particle is relatively
complex
and may be resolved into.various substructures.
As used herein, "penton" or "penton complex" are preferentially used
Zd herein to designate a, complex of penton base and fiber. The term "penton"
may
also be used to indicate penton base, as well as penton complex. The meaning
of the term "penton" alone should ~be clear from the context within which it
is
used.
As used herein, a plasmid refers to an autonomous self-replicating
25 extrachromosomal circular nucleic acid molecule, typically DNA.
As used herein, a post-transcription regulatory element (PRE) is a
regulatory element found in viral or cellular messenger RNA that is not
spliced,
i.e. intronless messages. Examples include, but are not limited to, human
hepatitis virus, woodchuck hepatitis virus, the TK gene and mouse histone
gene.
30 The PRE may be placed before a polyA sequence and after a heterologous DNA
sequence.
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
_7 9-
As used herein, pseudotyping describes the production of adenoviral
vectors havir7gvmodified capsid protein or capsid proteins from a different
serotype than the serotype of the vector itself. One example, is the
production
of an adenovirus 5. vector particle containing an Ad37 fiber protein. This may
be
accomplished by producing the adenoviral vector in packaging cell lines
expressing different fiber proteins.
As used herein, promoters of interest herein may be inducible or
constitutive. Inducible promoters will initiate transcription only in the
presence
of an additional molecule; constitutive promoters do not require the presence
of
any additional molecule to regulate gene expression. a regulatable or
inducible
promoter may also be described as a promoter where the rate or extent of RNA
polymerase binding and initiation is modulated by external stimuli. Such
stimuli
inc(ude,~but are not limited to various compounds or compositions, light,
heat,
stress and chemical energy sources. Inducible, suppressible and repressible
promoters are considered regulatable promoters. Preferred promoters herein,
are
promoters that are selectively expressed in ocular cells, particularly
photoreceptor cells.
As used herein, receptor refers to a biologically active molecule that
specifically binds to (or with) other molecules. The term "receptor protein"
may
be used to more specifically indicate the proteinaceous nature of a specific
receptor.
As used herein, recombinant refers to any progeny formed as the result of
genetic engineering. This may also be used to describe a virus formed by
recombination of plasmids in a packaging cell.
As used herein, a transgene or therapeutic nucleic acid molecule includes
DNA and RNA molecules encoding an RNA or polypeptide. Such molecules may
be "native" or naturally-derived sequences; they may also be "non-native" or
"foreign" that are naturally- or recombinantly-derived. The term "transgene,"
which rnay be used interchangeably herein with the term °therapeutic
nucleic
acid molecule," is often used to describe a heterologous or foreign
(exogenous)
gene that is carried by a viral vector and transduced into a host ceH.
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
-20-
Therefore, therapeutic nucleotide nucleic acid molecules include antisense
sequences or~ nucleotide sequences which may be transcribed into antisense
sequences. Therapeutic nucleotide sequences (or transgenes) all include
nucleic
acid molecules that function to produce a desired effect in the cell or cell
nucleus
into which said therapeutic sequences are delivered. For example, a
therapeutic
nucleic acid molecule can include a sequence of nucleotides that encodes a
functional protein intended for delivery into a cell which is unable to
produce
that functional protein.
As used herein, a promoter region refers to the portion of DNA of a gene
that controls transcription of the DNA to which it is operatively linked. The
promoter region includes specific sequences of DNA that are sufficient for RNA
polymerise recognition, binding and transcription initiation. This portion of
the
promoter region is referred to as the promoter. In addition, the promoter
region
includes sequences that modulate this recognition, binding and transcription
initiation activity of the RNA polymerise. These sequences may be cis acting
or
may be responsive to tans acting factors. Promoters, depending upon the
nature of the regulation, may be constitutive or regulated.
As used herein, the phrase "operatively linked" generally means the
sequences or segments have been covalently joined into one piece of DNA,
whether in single-or double stranded form, whereby control sequences on one
segment control expression or replication or other such control of other
segments. The two segments -are not necessarily contiguous.
As used herein, exogenous encompasses any therapeutic' composition
that is~ administered by the therapeutic methods provided herein. Thus,
exogenous may also be referred to herein as foreign, or non-native or other
equivalent expression.
As used herein, antibody refers to an immunoglobulin, whether natural or
partially or wholly synthetically produced, including any derivative thereof
that
retains the specific binding ability the antibody. Hence antibody includes any
protein having a binding domain that is homologous or substantially homologous
to an immunoglobulin binding domain. Antibodies include members of any
immunoglobulin claims, including IgG, IgM, IgA, IgD and IgE.
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
-21-
As used herein, antibody fragment refers to any derivative of an antibody
that is less~then fiull~ length, retaining -at least~a portion of the full-
length
antibody's specific binding ability. Examples of antibody fragments
include,but
are not limited to, Fab, Fab', F(ab)Z, single-chain Fvs (scFV), FV, dsFV
diabody
and Fd fragments and~other recombinant form of antibodies that retain or
exhibit
binding specificity.
The fragment can include multiple chains linked together, such as by
disulfide bridges. An antibody fragment generally contains at least about 50
amino acids and typically at least 200 amino acids. For purposes herein, any
fragment that retains specific binding for a crv integrin binding protein is
contemplated. Such fragments may be produced by chemical or recombinant
means.
As~ used herein, an Fv antibody fragment is composed of one variable
heavy domain (VH) and one variable light domain linked by noncovalent
interactions.
As used herein, a dsFV refers to an Fv with an engineered intermolecular
disulfide bond, which stabilizes the VH V~ .pair.
As used herein, an F(ab)2 fragment is an antibody fragment that results
from digestion of an immunoglobulin with pepsin at pH 4.0-4.5; it may be
recombinantly produced.
Thus, with reference to the DAV-1 antibody exemplified herein, the Fab
portion is the entire light chain and amino acids 1-229 of the DAV-1 heavy
chain
(SEQ ID Nos. 1 and -2). The Fab fragment is involved in antigen binding, with
the exception of the first 19 amino acids which constitute the signal peptide
sequence for secretion of the antibody. Fab fragments can be generated by
digestion with papain.
The Fab'2 portion is the Fab fragment and the hinge region, which
connects the Fab antigen-binding portion with the Fc portion which is involved
in
complement activation and macrophage binding. Amino acids 230-242 of the
. DAV-1 heavy fragment constitute the hinge region of DAV-i . The Fab'2
fragments used in this manuscript that were generated by cloning comprise
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
-22-
amino acids 1-247 of the DAV-1 heavy chain sequence. Fab'2 fragments can
be generated by .digestion with pepsin.
As used herein, Fab fragments is an antibody fragment that results from
digestion of an immunoglobulin with papain; it may be recombinantly produced.
As used herein, scFVs refer to antibody fragments that .contain a variable
light chain (V~) and variable heavy chain (V") covalently connected by a
polypeptide linker in any order. The linker is of a length such that the two
variable domains are bridged without substantial interference. Preferred
linkers
are (Gly-Ser)~ residues with some Glu or Lys residues dispersed throughout to
increase solubility.
As used herein, diabodies are dimeric scFV; diabodies typically have
shorter peptide linkers than scFvs, and they preferentially dimerize.
As.used herein, humanized. antibodies refer to antibodies that are
modified to include "human" sequences of amino acids so that administration to
a human will not provoke an immune response. Methods for preparation of
such antibodies are known. For example, the hybridoma that expresses the
monoclonal antibody is altered by recombinant DNA techniques to express an
antibody in which the amino acid composition of the non-variable regions is
based on human antibodies. Computer programs have been designed to identify
such regions. For human therapy, humanized antibodies are preferred.
As used herein, production by recombinant means by using recombinant
DNA methods means the use of the well known methods of molecular biology
for expressing proteins encoded by cloned DNA, including cloning expression of
genes and methods, such as gene sfiuffling and phage display with screening
for
desired specificities.
As used herein, the term "conjugated" refers stable attachment, such
ionic or covalent attachment.
As used herein, a composition refers to any mixture of two or more
products or compounds. It may be a solution, a suspension, liquid, powder, a
paste, aqueous, non-aqueous or any combination thereof.
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
-23-
As used herein, a combination refers to any association between two or
more ~ items.
As used herein, fluid refers to any composition that can flow. Fluids thus
encompass compositions that are in the form of semi-solids, pastes, solutions,
aqueous mixtures, gels, lotions, creams and other such compositions.
As used herein, substantially identical to a product means sufficiently
similar so that the property of interest is sufficiently unchanged so that the
substantially identical product can be used in place of the product.
B. Adenovirus delivery and internalization .
Attachment and internalization
Adenovirus attachment to cells is mediated by the elongated fiber, which
mediates initial attachment of the virus to cell receptors. The fiber is a
homotrimeric proteiri with an elongated central shaft domain that varies in
length
among different virus serotypes. The C terminus of the protein contains a
globular domain known as the knob, which is responsible for receptor
interaction. The N terminus anchors the protein to the virus surface via
interaction with the penton base protein.
The cellular receptor recognized by fiber is known as Coxsackie
Adenovirus Receptor (CAR), which is a member of the Ig superfamily and
contains two extracellular domains. The N-terminal domain is sufficient to
mediate fiber interaction. Secondary interactions of the virus penton base
protein with av integrins promote virus internalization into clathrin-coated
pits
and endosomes.
Virions are capable 'of disrupting the early endosome allowing the majority
of the virion particle to escape into the cytoplasm. Viral particles are then
transported along microtubules to the nuclear pore complex and virion DNA is
translocated into the nucleus.
Ad enter cells by a clathrin-coated pit pathway. Ad internalization is
complex process that is found herein to be similar in some respects to that
.described for cell invasion by certain pathogenic bacteria. Clustering of av
integrins (not CAR) results in the formation of a cytoplasmic signaling
complex
involving at least three major components (cSRC, CAS, PI3K). This signaling
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
-24-
complex is capable of further activation of the Rho family of small GTPases
(RAC, CDE42) ~ivhose~ activation- ultimately results in the reorganization of
actin
cytoskeleton and enhanced virus internalization.
Adenovirus internalization via the clathrin-coated pit pathway (Patterson
et al. (1983) J.Gen.Virol. 64:1091-1099; Wang et al. (1998) J.Virol. 72:3455-
3458 ) requires activation of several signaling molecules including
phospatidylinositol 3-OH kinase (PI3K; Li et al. (1998) J. Virol. 72:2055-2061
)
and the Rho family of small GTPases (Li et al. (1998) J.Virol. 72:8806-88121.
The major downstream target of this signaling pathway is the actin
cytoskeleton,
which promotes virus uptake.
PI3Ks
The phosphatidylinositol 3-kinases (P13 kinases or PI3Ks) represent a
ubiquitous.family of heterodimeric lipid kinases that are found in association
with
the cytoplasmic domain of hormone and growth factor receptors and oncogene
products. Phosphoinositide 3-OH-kinases (PI3Ks) constitute a large family of
enzymes capable of 3-phosphorylating at least one of the cellular
phosphoinositides (Whitman et al. (1988) Nature 332:644-646).
3-phosphorylated phosphoinositides are found in all higher eukaryotic cells.
PI3Ks act as downstream effectors of the above-noted receptors, are
recruited upon receptor stimulation and mediate the activation of second
messenger signaling pathways through the production of phosphorylated deriva-
tives of inositol. PI3Ks have been implicated in many cellular activities
including
growth factor mediated cell transformation, mitogenesis, protein trafficking,
cell
survival and proliferation, DNA synthesis, apoptosis, neurite outgrowth,
nitric
oxide signaling and insulin-stimulated glucose transport.
PI3Ks phosphorylate phosphatidylinositol (Ptdlns) at the 3'-hydroxyl of
the inositol ring and substrates include Ptdlns, Ptlns(4)phosphate
Ptdlns(4,5)bi-
sphosphate and Ptdlns(3,4,5) triphosphate; the major product is
Ptdlns(3,4,5)tri-
phosphate (see, e.g., Fry (1994) Biochim. Biophys. Acta. 1226: 237-268). A
PI3K and a lipid product of this enzyme, phosphatidylinositol (3,4,5)-
triphosphate
(hereinafter "Ptdlns(3,4,5)P3"), are part of an important second messenger
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
-25-
system in cellular signal transduction. Ptdlns(3,4,5) P3 appears to be a
second
messei-~ger'iri extremely diverse signalling pathways.
As.described herein, PI3K is a member of a family of lipid kinases that
include a p85 regulatory subunit and a p1 10 catalytic subunit (Toker et al.,
Nature, 387:673 (1997)). The p85 subunit of PI3K binds directly to
phosphorylated FAK (Chen et al., J. Biol. Chem., 271:26329 (i 996)). The
products of PI3K activation, phosphatidylinositol-3,4-biphosphate and
phosphatidytinositol-3,4,5-triphosphate are increased in the plasma membrane
of
activated but not quiescent cells and have been proposed to act as second
messengers for a number of cell functions including cell motility, the Ras
pathway, vesicle trafficking and secretion, apoptosis, the movement of
organelle
membranes, shape alteration through rearrangement of cytoskeletal actin,
transformation, chemotaxis, cell cycle progression and intracellular protein
trafficking (Carpenter et al., Curr. Opin. Cell Biol,, 8:153 (1996); Chou et
al.,
Cell 85:573 (1996); Wennstrom et al., Curr. Biol., 4:385 (1994); Toker et al.,
Nature, 387:673 (1997)). The phospholipid second messengers
phosphatidylinositol-3,4-biphosphate and phosphatidylinositol-3,4,5-
triphosphate
mediate the cell functions and processes by activation of protein kinase B and
the small GTP-binding proteins Ras, Rho, Rac and CDC42 (Hall, Science,
279:509 (1998); Karlund et al., Science 275:1927 (1997); Tapon et al., Curr.
Opin. Cell Biol., 9:86 (1995)). Activation of Rac and CDC42 induces
polymerization of monomeric actin, resulting in the formation of a dense
network
of actin filaments underlying the plasma membrane, and the actin-rich regions
form a variety of membrane extensions known as lamettipodia ("membrane
ruffling") and filopodia ("hairlike structures") (Luo et al., Nature 379:837
(1996)). Activation of Rho is associated with the formation of actin-
associated
stress fibers (Nobes et al., Cell, 81:53 (1995); Ridley et al., Cell, 70:389
(1992)). The polymerized actin filaments maintain the architecture of the
surface protrusions. This actin assembly initiated by activation of PI3K plays
an
important role in a number of biological and/or pathogenic processes including
directed cell migration (Zigmond, Curr. Biol., 8:66 (1996)), axonal guidance
in
neuronal cells (Luo et al., Genes Dev., 8:1787 (1994)), and cell invasion by a
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
-26-
number of different bacteria (Chen et al., Science, 274:2115 (1996); Hordijk
et
al., Science, 278:1464 (1998)). Recent studies have indicated that actin
polymerization also facilitates ctathrin-mediated endocytosis (Benmerah et
al., J.
Cell Biol., 140:1055 (1998); Lamaze et a/, J. Biol. Chem., 272:20332 (1997);
Witke et al., EMBO J., 17:967 (1998)).
A number of stimulatory agonists activate the PI3K-mediated signalling
pathway. Many of the effects of insulin on glucose and lipid metabolism are
elicited through activation of PI3K (Shepherd et al., Biochem. J., 333(3):471
(19981). IGF-1, PDGF and EGF stimulate cell~proliferation in astroglial cells
through increased P13K activity (Pomerance et al., J. Neurosci. Res., 40:737
(1995)). Insulin or IGF-1 induced membrane ruffling is mediated via activation
of
P13K (Kotani et al., EMBO J., 13(10):2313 (1994)1. PI3K-associated p85
associates with EGFR~ and PDGFR upon stimulation with EGF or PDGF,
respectively (Hu et al., Mol. Cell. Biol., 12:981 (1992)). Fibronectin,
insulin and
PDGF stimulation of ILK (integrin-linked kinase) are dependent on the activity
of
PI3K (Delcommenne et al., Proc. Nat/. Acad. Sci. USA 95:1 1211 (1998)).
Stimulation of certain cell types with TNF-a has been shown to activate PI3K
(Guo et al., J. Biol. Chem., 271:615 (1996)). PI3K is also activated by
internalins, which are bacterial surface proteins involved in bacterial
invasion
(Ireton et al., Science, 274:780 (1996)).
Adenovirus endocytosis also requires activation of PI3K (Li et al., J. Virol.
72:2055 (1998)). Adenovirus endocytosis is a multistep process beginning with
its attachment to cells via the elongated fiber protein which the cell surface
protein receptor known as CAR (Bergelson et al., Science, 275:1320 (1997)).
Secondary interactions of the virus penton base protein via their RGD motifs
with av integrins on the cell surface. promotes virus internalization, via a
receptor-mediated endocytosis pathway, into clathrin-coated pits and
endosomes. While fiber binding is not required for PI3K activation; the
interaction of adenovirus penton base protein to with av integrins stimulates
PI3K (Li et al., J. Virol. 72:2055 (1998)). Stimulation of PI3K has been shown
to be essential to viral entry; when cells were treated with the PI3K-specific
inhibitors wortmannin and LY294002, adenovirus internalization was inhibited
(Li
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
-27-
et al., J. Virol. 72:2055 (1998)). The clustering of the av integrins results
in the
formation.. of .a. cytoplasmic signaling complex involving at least three
major
components: cSRC, CAS and PI3K. This signaling complex is capable of further
activation of the Rho family of small GTPases (Rac, CDC42) whose activation
ultimately results in the reorganization of the actin cytoskeleton and
enhanced
virus internalization.
Thus, the signaling pathways activated by growth factors/cytokine
receptors, including tumor necrosis factor a (TNF-a), insulin-like growth
factor 1
(IGF-1 ) and epidermal growth factor (EGF) receptors (Hotamisligi! et al.
(1994)
Proc.NatLAcad.Sci.USA 24:4854-4858; Guo et al. (1996) J.Biol.Chem.
271:615-618; Pomerance et al. (1995 J.Neurosci. 40:73.7-746; Kotani, et al.
(1994) EMBO J. 73:2313-2321; and Hu et al. (1992) Moi.Celi Biol. 12:981-990)
initiate signaling events that converge at P13K activation.
It is shown herein that advantage can be taken of the similarity in
signaling processes elicited by cell surface receptors that activate PI3
kinases
and the av integrin mediated viral internalization, providing the basis for
the
methods and vectors provided herein, which bypass Ad integrin interaction to
facilitate gene delivery. It is shown herein that molecules that bind to and
activate receptors that participate in the PI3 signalling pathway can be used
to
target linked moieties, such as adenoviral particles, to such receptors, which
.include hormone and growth factor receptors, other G-protein coupled
receptors
and receptors for various oncogenes, and effect internalization.
1. Bifunctional molecules
Provided herein are bifunctional molecules that are conjugates of an
agent, such as an antibody or fragment thereof, that specifically binds to av
integrin-binding protein (referred to as component "P" herein) and an agent
(referred to as TA) that targets moieties linked to the protein that
specifically
binds to the av integrin-binding protein to cells that express surface
receptors to
which the targeting agent specifically binds. TA and P are joined directly,
typically by covalent linkage, or are linked via a linker L.
For purposes herein these conjugates are referred to as bifunctional
molecules and include the following components: (TA)", Pm and Lq, wherein n
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
-28-
and m are integers of 1 or more, typically '1 or 2, and q is 0 or an integer
of 1 or
more. These ~conaponents are selected such that the resulting molecules will
bind
to or interact with a protein on a viral particle or bacteria to form a
complex and
target the resulting complex to a cell surface protein that activates PI3K and
that
is recognized by the targeting agent such that the resulting complex is
internalized. Where n and m are other than one, the resulting molecules are
multifunctional, in such instances more than one TA andlor P moiety can be
used, each may be the same or different. The components TA, P and L .may be
conjugated by covalent linkages, ionic linkages or any other bond resulting in
attachment.
It is understood that the P and the targeting agent (or linker and targeted
agent) may be linked in any order and through any appropriate linkage, as long
as the resulting conjugate binds ~to a receptor to which targeted binds and
inter-
nalizes the complexed viral particles or bacterial cells in cells bearing the
receptor.
Generally, P is an antibody or fragment thereof that specifically binds to
av integrin binding proteins, such as the penton protein of adenovirus. P is
preferably a monoclonal antibody or fragment thereof or synthetic antibody or
recombinant protein that includes a sufficient portion of the antibody chains
to
specifically bind to a selected antigen. In this instance, the antigen is one
present in a protein on a viral particle or bacterial surface that mediates
attachment of the viral particle of bacterium to av integrins.
a. Antigen-binding portion
in preferred embodiments, the moiety (P) that binds to proteins that
interact with av integrins, is a monoclonal antibody or antigen-binding
fragment
thereof. Proteins, such as the penton protein of adenovirus, that interact
with
av integrins to facilitate internalization of viral particles and bacteria
occur on
viral particles and bacterial cells surfaces. Antibodies specific therefor can
be
made by standard methods, such as using hybridoma technology or by making
recombinant antibodies or fragments thereof and screening, such as through
phage display technology, for binding to the viral or bacterial surface
protein.
The antibody or fragment thereof or recombinant version thereof, is then
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
-29-
modified to include a targeting agent, such as a growth factor or hormone or
otherprotein that binds to receptors that activate the PI3K signaling pathway.
The resulting bifunctional molecule specifically binds to a viral or bacterial
surface protein, such as penton, and also will specifically bind to a selected
targeted cell that expresses the targeted receptors.
b. Targeting agents
The targeting agents are those that are (igands, including hormones,
growth factors and cytokines, that specifically bind to and activate receptors
that activate the PI3K signaling pathway. Hence the targeting agent is chosen
to bind to receptors. Selecting targeted receptors can be those that are
overexpressed in a particular disorder, such as an angiogenic disorder,
including
cancers, and inflammatory disorders. PI3K activity in cells of hematopoietic
lineage, particularly neutrophils; monocytes, and other, types of leukocytes,
is
involved in many. of the non-memory immune responses associated with acute
and chronic inflammation.
Receptors include, but are not limited to, tyrosine kinase receptors which,
when activated, result in increased accumulation of Ptdlns(3,4,5)P3, such as
the
PDGF receptor, the EGF receptor, members of the FGF receptor family, the
CSF-1 receptor, the insulin receptor, the IGF-1 receptor, the SCF (stem cell
factor) receptor, a ~TNF receptor, such as a TNF-a receptor, and the NGF
receptor; receptors associated with the src family non-receptor tyrosine
kinases
that stimulate Ptdlns(3,4,5)P3 accumulation, such as the 1l-2 receptor, II-3
receptor, mlgM receptor, the CD4 receptor, the CD2 receptor, and the CD3/T
cell receptor. Other receptors, such as the cytokine 11-4 receptor and the G
protein linked thrombin receptor, ATP receptor, and the fMLP receptor, that
stimulate the activity of a PI3K, resulting in subsequent Ptdlns (3,4,5)P3
accumulation are contemplated herein.
The targeting agents are selected to bind to such cell surface proteins,
which must then facilitate internalization of the targeting agent and anything
Linked thereto.
The resulting conjugates provided can be used to delivery genes and
products to cells that express such receptors, Hence, this provides a means to
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
-30-
specifically target genes and products to a wide array of cells and in a wide
variety . of 'organisms; including plants as well as animals, for effecting
genetic
therapy and/or delivering products to cells involved in a wide array of
disorders
and conditions.
2. Preparation of bifunctional molecules
Methods for preparation of antigen-binding proteins, such as antibodies
and antigen-binding fragments thereof that bind to proteins that bind to av
integrins are known to those of skill in the art. The bifunctional molecules
can
be prepared by recombinant and/or chemical methods. Bifunctional molecules
can be fusion proteins that can be prepared using standard recombinant
methods. Bifunctional molecules can be prepared using heterobifunctional
reagents and linkers or other suitable chemical conjugation agents.
Preparation
of bifunctional molecules is exemplified herein, and the exemplified methods
can
be adapted for preparation of any desired bifunctional molecules.
Plasmids and host cells for expression of constructs encoding bifunctional
molecules
Nucleic acid encoding the selected "P" moiety, such as antibody,
generally a heavy chain or portion thereof, is inserted into a suitable vector
and
expressed in a suitable prokaryotic or eukaryotic host. For antibody
expression,
the light chain can be inserted into another plasmid for expression. Numerous
suitable hosts and vectors are known and available to those of skill in this
art
and may be purchased commercially or constructed according to published
protocols using well known and available starting materials. Suitable
eukaryotic
host cells include insect cells, yeast cells, and animal cells. Insect cells
and
bacterial host cells are presently preferred. Suitable prokaryotic host cells
include E. coli, strains of Bacillus and Streptomyces. For purposes herein,
baculovirus expression systems are preferred.
The DNA construct is introduced into a plasmid suitable for expression in
the selected host. The sequences of nucleotides in the plasmids that are
regulatory regions, such as promoters and operators, are operationally
associated
with one another for transcription. The sequence of nucleotides encoding the
av
integrin binding protein (designated P) can also include DNA encoding a
secretion
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
-31-
signal, whereby the resulting peptide is a precursor protein. Secretion
signals
suitabie.far-.use are~widely available~and are well known in the art.
Prokaryotic
and eukaryotic secretion signals functional in E. coli, may be employed. The
presently preferred secretion signals include, but are not limited to, those
encoded by the following E. coli genes: ompA, ompT, ompF, ompC, beta-
lactamase, pelB and bacterial alkaline phosphatase, and the like (von Heijne
(1985) J. Mol. Biol. 184:99-105). In addition, the bacterial pelB gene
secretion
signal (I_ei et al. (1987) J. Bacteriol. 169:4379), the phoA secretion signal,
and
the cek2 secretion signal, functional in insect cells, may be employed. The
most
preferred secretion signal for bacterial expression is the E. coli ompA
secretion
signal. For eukaryotic expression systems, particularly insect cell systems,
the
signals from secreted proteins, such as insulin, growth hormone, mellitin, and
mammalian. alkaline phosphatase are of interest herein. Other prokaryotic and
eukaryotic secretion signals known to those of skill in the art may also be
employed (see, e-g., von Heijne (1985) J. MoI. Biol. 184:99-105). Using the
methods described herein, one of skill in the art can substitute secretion
signals
that are functional in either yeast, insect or mammalian cells to secrete the
heterologous protein from those cells. The resulting processed protein may be
recovered from the periplasmic space or the fermentation medium or growth
medium.
The plasmids can include a_ selectable marker gene or genes that are
functional in the host. A selectable marker gene includes any gene that
confers
a phenotype on bacteria that allows transformed bacterial cells to.be
identified
and selectively grown from among a vast majority of untransformed cells.
Suitable selectable marker genes for bacterial hosts, for example, include the
ampicillin resistance gene (Amp'), tetracycline resistance gene (Tc') and the
kanamycin resistance gene (Kan'). The kanamycin resistance gene is presently
preferred.
The plasmids used herein preferably include a promoter in operable
association with the DNA encoding the protein or polypeptide of interest and
are
designed for expression of proteins in a bacterial host. It has been found
that
tightly regulatable promoters are preferred for expression of saporin.
Suitable
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
-32-
promoters for expression of proteins and polypeptides herein are widely
available
and are ~welT ~krio'wn~ in the art. For expression of the proteins such
promoters
are inserted in a plasmid in operative linkage with a control region such as
the
lac operon. Preferred promoter regions are those that are inducible and
functional in E. coli or early genes in vectors of viral origin. Examples of
suitable
inducible promoters and promoter regions include, but are not limited to: the
E.
coli lac operator responsive to isopropyl ,B-D-thiogalactopyranoside (IPTG;
see, et
al. Nakamura et al. (1979) Cell 1 ~:1 109-11 17); the metallothionein promoter
metal-regulatory-elements responsive to heavy-metal (e-q., zinc) induction
(see,
e-q., U.S. Patent No. 4,870,009 to Evans et al.); the phage T7lac promoter
responsive to 1PTG (see, e~cr., U.S. Patent No. 4,952,496; and Studier et at.
(1990) Meth. Enzymol. 185:60-89) and the TAC promoter. Other promoters
include, but are not limited to, the T7 phage promoter and other T7-like phage
promoters, such as the T3, T5~ and SP6 promoters, the trp, Ipp, and lac .
promoters, such as the IacUVS, from E. coli; the P10 or polyhedrin gene
promoter of baculovirus/insect cell expression systems (see, e~g., U.S. Patent
Nos. 5,243,041, 5,242,687, 5,266,317, 4,745,051, and 5,169,784) and
inducible promoters from other eukaryotic ~ expression systems.
Particularly preferred plasmids for transformation of E. coli cells include
the pET expression vectors (see, U.S patent 4,952,496; available from
NOVAGEN, Madison, WI; see, also literature published by Novagen describing
the system). Such plasmids include pET 11 a, which contains the T7lac
promoter, T7 terminator, the inducible E. coli lac operator, and the lac
repressor
gene; pET 12a-c, which contains the T7 promoter, T7 terminator, and the E,
coli
ompT secretion signal; and pET 15b (NOVAGEN, Madison, WI), which contains
a His-TagT"' leader sequence (Seq. ID N0. 23) for use in purification with a
His
column and a thrombin cleavage site that permits cleavage following
purification
over the column; the T7-lac promoter region and the T7 terminator.
Other preferred plasmids include the pKK plasmids, particularly pKK 223-
3 (available from Pharmacia; see also, Brosius et al. (1984) Proc.. Natl.
Acad.
Sci. 81:6929; Ausubel et al., Current Protocols in Molecular Biology; U.S.
Patent Nos. 5,122,463, 5,173,403, 5,187,153, 5,204,254, 5,212,058,
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
-33-
5,212,286, 5,215,907, 5,220,013, 5,223,483, and 5,229,279), which contain
the TACwpromoter. Plasmid pKK has been .modified by insertion of a kanamycin
resistance cassette with EcoRl sticky ends (purchased from Pharmacia; obtained
from pUC4K, see, e.4., Vieira et al. (1982) Gene 19:259-268; and U.S. Patent
No. 4,719,179) into the ampicillin resistance marker gene.
Other preferred vectors include the pP~ lambda inducible expression
vector and the tac promoter vector pDR450 (see, e-g., U.S. Patent Nos.
5,281,525, 5,262,309, 5,240,831, 5,231,008, 5,227,469, 5,227,293, ;
available from Pharmacia P.L. Biochemicals, see; also Mott, et al. (1985)
Proc.
Natl. Acad. Sci. U.S.A. 82:88; and De Boer et al. (1983) Proc. Natl. Acad.
Sci.
U.S.A. 80:21 ); and baculovirus vectors, such as a pBIueBac vector (also
called
pJVETL and derivatives thereof; see, e-g., U.S. Patent Nos. 5,278,050,
5,244,805, 5,243,041, 5,242,687, 5,266,317, 4,745,051, and 5,169,784),
including pBIueBa~c III.
Other plasmids include the pIN-IIIompA plasmids (see, U.S. Patent No.
4,575,013 to Inouye; see, also, Duffaud et al. (1987) Meth. Enz. 153:492-507),
such as pIN-IIIompA2 . The pIN-IIIompA plasmids include an insertion site for
heterologous DNA linked in transcriptional reading frame with functional
fragments derived from the lipoprotein gene of E. coli. The plasmids also
include
a DNA fragment coding for the signal peptide of the ompA protein of E. coli,
positioned such that the desired polypeptide is expressed with the ompA signal
peptide at its amino terminus, thereby-allowing efficient secretion across the
.
cytoplasmic membrane. The plasmids further include DNA encoding a specific
segment of the E. coli lac promoter-operator, which is positioned in the
proper
orientation for transcriptional expression of the desired polypeptide, as well
as a
separate functional E. coli lacl gene encoding the associated repressor
molecule
that, in the absence of lac operon inducer, interacts with the lac
promoter-operator to prevent transcription therefrom. Expression of the
desired
polypeptide is under the control of the lipoprotein (Ipp) promoter and the lac
promoter-operator, although transcription from either promoter is normally
blocked by the repressor molecule. The repressor is selectively inactivated by
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
-34-
means of an inducer molecule thereby inducing transcriptional expression of
the
desired p~olypeptide from' both promoters.
The repressor protein may be encoded by the plasmid containing the
construct or a second plasmid that contains a gene encoding for a repressor-
protein. The repressor-protein is capable of repressing the transcription of a
promoter that contains sequences of nucleotides to which the repressor-protein
binds. The promoter can be derepressed by altering the physiological
conditions
of the cell. The alteration can be accomplished by the addition to the growth
medium of a molecule that inhibits, for example, the ability to interact with
the
operator or with regulatory proteins or other regions of the DNA or by
altering
the temperature of the growth media. Preferred repressor-proteins include, but
are not limited to the E. coli lacl repressor responsive to 1PTG induction,
the
temperature sensitive c1857 repressor. The E. coli lacl repressor is
preferred.
In certain preferred embodiments, the constructs also include a
transcription terminator sequence. The promoter regions and transcription
terminators are each independently selected from the same or different genes.
In some embodiments, the DNA fragment is replicated in bacterial cells,
preferably in E. coli. The DNA fragment also typically includes a bacterial
origin
of replication, to ensure the maintenance of the DNA fragment from generation
to generation of the bacteria. In this way, large quantities of the DNA
fragment
can be produced by replication in bacteria. Preferred bacterial origins of
replication include, but are not limited to, the f1-on and col E1 origins of
replication.
Preferred bacterial hosts contain chromosomal copies of DNA encoding
T7 RNA polymerase operably linked to an inducible promoter, such as the IacUV
promoter (see, U.S. Patent No. 4,952,496). Such hosts include, but are not
limited to, lysogenic E. coli strains HMS174(DE3)pLysS, BL21 (DE3)pLysS,
HMS174(DE3) and BL21 (DE3). Strain BL21 (DE3) is preferred. The pLys
strains provide low levels of T7 lysozyme, a natural inhibitor of T7 RNA
30~ polymerase. Preferred eukaryotic host are the insect cells Saodoptera
fructiperda
(sf9 cells; see, e-g., Luckow et al. (1988) Bio/technology 6:47-55 and U.S.
Patent No. 4,745,051 ).
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
-3 5-
For insect hosts, which are presently preferred, baculovirus vectors, such
as a pIZ (see; e-a~., U.S: Patent Nos. 5,278,050, 5,244,805, 5,243,041,
5,242,687, 5,266,317, 4,745,051, and 5,169,784; available from
INVITROGEN, San' Diego) may also be used for expression of the polypeptides.
The pBIueBaclll vector is a dual promoter vector and provides for the
selection of
recombinants by blue/white screening as this plasmid contains the ,8-
galactosidase genie (IacZ) under the control of the insect recognizable ETL
promoter and is inducible with IPTG. A DNA construct is introduced into a
baculovirus vector pBluebac III (INVlTROGEN, San Diego, CA) and then co-
transfected with ~wildtype virus into insect cells Spodoptera frugiperda (sf9
cells;
see, e.q., Luckow et al. (1988) Bio/technology 6:47-55 and U.S. Patent No.
4,745,051 ).
Other baculovirus vectors, such as pPbac and pMbac (available from
Stratagene, San Diego, CA, see, also Lernhardt et al. (1993) Strate_qies 6:20-
21,
and the Stratagene Catalog page 218), which contain the human alkaline
phosphatase (see, e'q., Bailey et al. (1989) Proc. Natl. Acad. Sci. U. S. A.
86:22-26) and melittin (see, e.q., Tessier et al. ( 1991 ) Gene 98:177-183)
secretory signals inserted into the BamHl and Ndel sites, respectively of
pJVP10Z (see, e-q., Kawamoto et al. (1991 ) Biochem. Biophys. Res. Commun.
181:756-63, Ueda et a1.(1994) Gene 140:267-272, are also suitable for use
herein, particularly if secretion is desired. Insertion of genes into the
Smal/BamH! sites of these vectors results in fusion proteins that are directed
into
the insect cell secretory pathway, which processes the pro-polypeptide so that
mature peptide or fusion protein is secreted into the growth medium. Other
heterologous signal sequences, such as the insulin signal sequence (see, e-g.,
U.S. Patent No. 4,431,746 for DNA encoding the signal sequence), the growth
hormone signal sequence, mammalian alkaline phosphatase, the mellitin signs!
sequence and others that are processed by insect cells are used.
The constructs provided herein have can be inserted into the baculovirus
vector sold commercially under the name pBLUEBACIII (If~VITROGEN, San
Diego CA; see the INVITROGEN CATALOG; see, Vialard et al. (1990) J. Virol.
64:37; see also,.U.S. Patent No. 5,270,458; U.S. Patent No. 5,243,041; and
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
-36-
published International PCT Application WO 93/10139, which is based on U.S.
patent application Serial'No. 07/792;600. .The pBIueBaclll vector is a dual
promoter vector and provides for the selection of recombinants by blue/white
screening as this plasmid contains the ~-galactosidase gene (IacZ).under the
control of the insect recognizable ETL promoter and is inducible with IPTG.
The
construct of interest is inserted into this vector under control of the
polyhedrin
promoter. The DNA is then cotransfected, such as by Ca(P04)a or calcium phos-
phate transfection or liposomes, into Spodoptera frugiperda cells (sf9 cells)
with
wildtype baculovirus and grown in tissue culture flasks or in suspension
cultures.
Blue occlusion minus viral plaques are selected and plaque purified and
screened
for expression. Details are set forth in the Examples.
Combinatorial methods
Molecules of desired specificity can be prepared using a variety of
protocols in which portions of antibody molecules are combined to produce
antigen binding molecules and are screened for desired specificity. Generally
for
phage display libraries, at least the Fab fragment is required, since
secretion of
the heterodimeric antibody fragment is involved.
Complementarily determining regions (CDRs) that are present in the Fab
fragment can be varied by random mutagenesis (creation of "synthetic antibody
libraries") or by other methods. A phagemid vector such as pComblll, designed
to express the heavy chain antibody fragment as an N-terminal fusion with the
plll phage coat protein domain (Barbas et al. (1991 ).Proc. Nat/. Acad Sci.
USA,
88:7978) can be used for heterodimeric expression of the library of Fab
antibody
fragments (or Fab'2 antibody fragments) on the surface of phage, using
bacteria.
Thus, for example, the DAV-1 heavy chain fused to the growth factor or
a.portion of the growth factor involved in binding to its receptor may be used
to
form the phage display .library, and the library may then be "panned" for
bifunctional antibodies that bind with high specificity to both the adenoviral
surface protein and to the growth factor/cytokine~ receptor.
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
-37-
Linkers and chemical conjugation
For~fusion-protein the linkers are peptides; for chemically conjugated
molecules the tinkers may be other moieties. In addition, a combinations of
chemically conjugated molecules, and recombinantly produced portions, such as
recombinantly produced antibodies or fragments or other antigen binding
molecules may be combined and chemically fused to targeting agents, .such as a
growth factor or hormone. If a linker is used it is selected such that it does
not
interfere with the activity of the targeted agent upon interaction of the
conjugate
with a cell surface protein. Any appropriate linker known to those of skill in
this
art may be used. The linker may be selected to improve activity by permitting
the targeted agent to complex with the viral or bacterial vector In some
instances the linker is selected to increase the specificity, toxicity,
solubility,
serum stability, and/or intracellular availability targeted moiety. In some
embodiments, several linkers may be included in order to take advantage of
desired properties of each linker. Flexible linkers and linkers that increase
solubility of the conjugates are contemplated for use, either alone or with
other
linkers are contemplated herein.
For chemical conjugation the components of the bifunctional molecules
may be directly linked or attached via a linker. Linkers that are suitable for
chemically linking. conjugates include, but are not limited to, disulfide
bonds,
thioether bonds, hindered disulfide bonds, esters, and covalent bonds between
free reactive groups, such as amine and thiol groups. These bonds are produced
using heterobifunctional reagents to produce reactive thiol groups on one or
both
of the potypeptides and then reacting the thiol groups on one polypeptide with
reactive thiol groups or amine groups on the other. Other linkers include, but
are
not limited to: acid cleavable linkers, such as bismaleimidoethoxy propane;
acid
labile-transferrin conjugates and adipic acid dihydrazide that are cleaved in
more
acidic environments; photocleavable cross linkers that are cleaved by visible
or
UV light.
. Linkers that are suitable for chemically linked conjugates include, but are
not limited to: disulfide bonds; thioether bonds; hindered disulfide bonds;
and
covalent bonds between free reactive groups, such as amine and thiol groups.
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
-38-
These bonds are produced using heterobifunctional reagents to produce reactive
thiol groups...on.oi~e or both of the polypeptides and then reacting the thiol
groups on one polypeptide with reactive thiol groups or amine groups to which
reactive maleimido groups or thiol groups can be attached on the other. Other
linkers include, acid cleavable linkers, such as bismaleimidoethoxy propane,
acid
labile-transferrin conjugates and adipic acid dihydrazide, that would be
cleaved in
more acidic intracellular compartments; cross linkers that are cleaved upon
exposure to UV or visible light; and tinkers, such as the various domains,
such as
C"1, C"2, and CH3; from the constant region .of human IgG, (see, Batra et al.
(1993) Molecular Immunol. 30:379-386). In some embodiments, several linkers
may be included in order to take advantage of desired properties of each
linker.
Chemical linkers~and peptide linkers may be inserted by covalently
coupling the linker to the TA and the P portion (the erv integrin protein
binding
portion, such as an antibody). The heterobifunctional agents, described below,
may be used to effect such covalent coupling. Peptide linkers may also be
linked by expressing DNA encoding the linker and TA, linker and P, or linker,
targeted agent and TA as a fusion protein. .
Numerous heterobifunctional cross-linking reagents that are used to form
covalent bonds between amino groups and thiol groups and to introduce thiol
groups into proteins, .are known to those of skill in this art (see, e~g., the
PIERCE
CATALOG, ImmunoTechnology .Catalog & Handbook, 1992-1993, which
describes the preparation of and use of such reagents and provides a
commercial
source for such reagents; see, also, e~Q., Cumber et al. (1992) Bioconiugate
Chem. 3:397-401; Thorpe et al. (1987) Cancer Res. 47:5924-5931; Gordon et
al. (1987) Proc. Natl. Acad Sci. 84:308-312; Walden et al. (1986) J. Mol. Cell
Immunol. 2:191-197; Carlsson et al. (1978) Biochem. J. 173: 723-737;~Mahan
et al. (1987) Anal. Biochem. 162:163-170; Wawryznaczak et al. (1992) Br. J.
Cancer 66:361-366; Fattorn et al. (19.92) Infection & Immun. 60:584-589).
30' These reagents may be used to form covalent bonds between the TA and
targeted agent. These reagents include, but are not limited to: N-succinimidyl-
3-
(2-pyridyldithio)propionate (SPDP; disulfide linker); sulfosuccinimidyl 6-[3-
(2-
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
-39-
pyridyldithio)propionamido]hexanoate (sulfo-LC-SPDP); succinimidyloxycarbonyl-
a-methyl herizyl ~thiosulfate (SMBT, hindered~disulfate linker); succinimidyl
6-[3-
(2-pyridyldithio) propionamido]hexanoate (LC-SPDP); sulfosuccinimidyl 4-(N-
maleiri~idomethyl)cyclohexane-1-carboxylate (sulfo-SMCC); succinimidyl 3-(2-
pyridyldithio)butyrate (SPDB; hindered disulfide bond linker);
sulfosuccinimidyl 2-
(7-azido-4-methylcoumarin-3-acetamide) ethyl-1,3'-dithiopropionate (SAED);
sulfo-succinimidyl 7-azido-4-methylcoumarin-3-acetate (SAMOA); sulfosuccinimi-
dyl6-(alpha-methyl-alpha-(2-pyridyldithio)toluamido]hexanoate (sulfo-LC-SMPT);
1,4-di-(3'-(2'-pyridyldithio)propionamido]butane (DPDPB); 4-succinimidyloxycar-
bonyl-a-methyl-a-(2-pyridylthio)toluene (SMPT, hindered Bisulfate linker);
sulfo-
succinimidyl6(a-methyl-a-(2-pyridyldithio)toluamido]hexanoate (sulfo-LC-SMPT);
m-maleimidobenzoyl-N-hydroxysuccinimide ester (MBS); m-maleimidobenzoyl-N-
hydroxysulfosuccinimide ester (sulfo-MBS); N-succinimidyl(4-
iodoacetyl)aminobenzoate (SIAB; thioether linker); sulfosuccinimidyl(4-
iodoacetyl)amino benzoate (sulfo-SIAB); succinimidy) 4(p-maleimidophenyl)but-
grate (SMPB); sulfosuccinimidyl 4-(p-maleimidophenyl)butyrate (sulfo-SMPB);
azidobenzoyl hydrazide (ABH).
Acid cleavable linkers, photocleavable and heat sensitive linkers may also
be used, particularly where it may be necessary to cleave the targeted agent
to
permit it to be more readily accessible to reaction.
Acid cleavable linkers include, but are not limited to, bismaleimidoethoxy
propane; and adipic acid dihydrazide linkers (see, e-g., Fattom et al. (1992)
Infection & Immun. 60:584-589) and acid labile transferrin conjugates that
contain a sufficient portion of transferrin to permit entry into the
intracellular
transferrin cycling pathway (see, e-g., Welhoner et al. (1991 ) J. Biol. Chem.
266:4309-4314).
Photocleavable linkers are linkers that are cleaved upon exposure to
light (see, e-q., Goldmacher et al. (1992) Bioconi. Chem. 3:104-107, which.
linkers are herein incorporated by reference), thereby releasing the targeting
agent from the bifunctional molecule and the complex upon exposure to light.
Photocleavable linkers that are cleaved upon exposure to tight are known isee,
e-g., Hazum et al. ( 198 i j in Peat.. Proc. Eur. Peat. Symp.. 16th,
Brunfeldt, K
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
-40-
(Ed), pp. 105-1 10, which describes the use of a nitrobenzyl group as a
photocleavable protective group for cysteine; Yen et al. (1989) Makromol. Chem
190:69-82, which describes water soluble photocleavable copolymers, including
hydroxypropylmethacrylamide copolymer, glycine copolymer, fluorescein
copolymer and methylrhodamine copolymer; Goldmacher et al. 11992) Bioconi.
Chem. 3:104-107, which describes a cross-linker and reagent that undergoes
photolytic degradation upon exposure to near UV light (350 nm); and Senter et
al. (1985) Photochem. Photobiol 42:231-237, which describes
nitrobenzyloxycarbonyl chloride cross linking reagents that produce
photocleavable linkages), thereby releasing the targeted agent upon exposure
to
light. Such linkers would have particular use in treating dermatological or
ophthalmic conditions that can be exposed to light using fiber optics. After
administration of the conjugate, the eye or skin or other body part can be
exposed to light, -resulting in release of the targeted moiety from the
conjugate.
Such photocleavable linkers are useful in connection with diagnostic protocols
in
which it is desirable to remove the targeting agent to permit rapid clearance
from
the body of the animal.
3. Preparation of complexes of the bifunctional molecules with viral
vector particles or bacterial particles
The complexes between the bifunctional molecules and vectors can be
prepared by incubating the vectors and bifunctional molecules under suitable
conditions to effect formation of the complexes.
Assays for activity
Any assay to assess the ability of the resulting complexes to
deliver genes. Such assays are known to those of skill in the art, and several
are
exemplified herein (see EXAMPLES).
4. Exemplary embodiment DAV-1 constructs and use thereof for
targeting
Exemplary of the embodiments contemplated herein are
bifunctional molecules formed by linkage of a targeting agent, such as a
growth
factor known to bind to receptors that activate PI3K, to an antibody or
antigen-
binding portion thereof, that specifically binds to the penton protein of a
variety
of adenovirus serotypes. It is understood that these embodiments are exemplary
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
-41-
and that any antibody that binds to a protein on a viral particle or bacterial
cell or
other-moiety intended.for delivery into a cell. can be used to specifically
target
such moieties to cells by virtue of interaction of the targeting agent with
cell
surface receptors. Presently preferred are adenovirus particles and the penton
protein thereof that is responsible for interaction with av integrins, which
promote viral internalization.
A penton base monoclonal antibody, DAV-1, which recognizes the
integrin binding site on adenovirus particle types 2/5 (Stewart et al. (1997)
EMBO J. 76:1 189-1 198; EXAMPLE 1 ), binds to the penton base with high
atfinity but does not inhibit virus infection is re-engineered herein (see,
EXAMPLE
1 ). Nucleic acid encoding the DAV-1 heavy chain (see, e.g., SEQ ID Nos. 5)
has
been fused with one of several different cytokineslgrowth factors known to
activate PI3K and the encoded fusion proteins are co-expressed in insect cells
with the DAV-1 light chain. The resulting bifunctional molecules retain
immunoreactivity and cytokine function.
The bifunctional molecules have been complexed with adenovirus and
shown to provide increased gene delivery to cells lacking av integrins, as
well as
cells expressing av integrins, evidencing PI3K activation. Complexing with the
bifunctional molecule also allows gene delivery by a fiberless Ad vector that
lacks the ability to bind CAR (see, EXAMPLES 5 and 6).
a. Analysis of bifunctional signaling antibodies
DAV-1 bifunctional signaling antibodies, designated DT (DAV-1 fused to
TNF-a), DI (DAV-1 fused to IGF-1 ), and DE (DAV-1 fused to EGF), were
expressed in insect cells as secreted proteins and purified on Protein L
affinity
columns. The DT heavy chain (DHT) had an apparent molecular weight of
approximately 70 kDa, consistent with the combined sizes of the DAV-1 r heavy
chain (53 kDa) and monomeric TNF-a ligand (17 kDA). The apparent molecular
weight of the K light chains of DAV-1 (D~) was identical to that of the
recombinant DT molecule (approx. 25 kDa). Western blot analyses showed that
the. DAV-1 mAb (D) and the DT molecules) were recognized by an anti-mouse
IgG antibody, while only the DT molecule was recognized by an anti-TNF-or
polyclonal antibody.
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
-42-
DT molecules were capable of binding to immobilized penton base or Ad
particles i~rr~ an~ ELISA and elicited cytotoxicity against a TNF-a sensitive
cell line,
MCF-7, indicating that the DT bifunctional molecule retains virus and cytokine
receptor binding functions.
b. Bifunctional molecules promote Ad-mediated gene delivery
to cells lacking av integrins
A first generation adenovirus vector containing a RSV-driven LacZ
reporter gene with DT was preincubated at a ratio of 2 antibody molecules per
RGD motif. This complex was then added to M21-L12 human melanoma cells,
which do not express av integrins (Felding-Habermann et al. (1992)
J. Clin.lnvest. 89:2018-2022), but can support efficient virus binding
(Wickham
et al. (1993) Cell 73:309-319). Ad complexed with DT but not D alone,
significantly increases.Ad-mediated gene delivery to M21-L12 cells as measured
by transgene expression at 48 hrs post-infection. Approximately 60% of cells
incubated with Ad plus DT stained positive for ~-galactosidase, compared to
less
than 3% of calls that had been incubated with virus alone or virus plus D. The
increase in gene delivery by DT was not due to increased activation of the RSV
LTR transgene promoter as a consequence of ligation of the TNF receptor, since
M21-L12 cells that had been infected with adenovirus alone for three hours
followed by addition of DT showed very little increase in gene delivery at 48
hours postinfection. This result indicates that bifunctional molecules
increase
adenovirus-mediated gene delivery by enhancing one or more steps associated
with cell entry.
c. DT molecules enhance Ad binding and internalization
The following experiments showed that DT enhancement of gene delivery
was associated with increased virus attachment to M21-L12 cells. Pre-
incubation of '251-labeled Ad particles with DT but not D molecules increased
virus binding approximately 5 fold. To investigate the molecules responsible
for
increased binding, competition experiments were performed. Ad-DT binding to
cells was measured in the presence of a 50-fold excess of recombinant fiber
protein or anti-TNF-a or a combination of these molecules. Either recombinant
fiber or anti-TNF-a antibody alone was capable of blocking only 20-25 % of Ad-
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
-43-
DT binding to cells. !n contrast, approximately 70% of binding could be
inhibited~by a combination of fiber~and anti-TNF-a. These findings indicate
that
Ad-DT binding to cells is mediated by CAR-fiber interaction as well as TNF-a
receptor association.
d. DT molecules potentiate internalization of '251-labeled virus
particles as measured by resistance to trypsin digestion.
As demonstrated in earlier studies(Wickham et al. (1993) Cell 73:309-
319), M21-L12 cells support relatively low levels of adenovirus
internalization.
This is due to the absence of av integrins. DT molecules significantly
increased
the rate and extent of adenovirus internalization into these cells. Together,
these findings indicate that DT molecules enhance gene delivery by promoting
virus binding as well as virus internalization.
e. DT enhancement of gene delivery is associated with P13K
activation
Efficient Ad internalization via av integrins requires activation of PI3K, a
key cellular signaling molecule. M21-L12 cells were treated with PI3K
inhibitors, wortmannin or LY292004 prior to virus infection to show that DT
enhancement of gene delivery also involves P13K,. Wortmannin and LY294002
inhibited Ad-mediated gene delivery by approximately 70% and 50%,
respectively, indicating that PI3K activity plays a major role in DT
enhancement
of gene delivery.
For further demonstration of the role of PI3K-dependent signaling in
enhanced gene delivery, Ad-mediated gene delivery by other bifunctional
molecules whose cytokine/growth factor domains are known to activate PI3K
was measured. DT, DE and DI molecules enhanced gene delivery by
approximately 30, 10 and 5 fold respectively. Enhanced gene delivery by these
molecules was also inhibited by pretreatment of cells with wortmannin. These
findings further demonstrate that PI3K activation promotes Ad gene delivery.
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
-44-
f. Bifunctional molecules allow gene delivery by fiberless
adenovirus particles .
Fiberless adenovirus vectors that cannot bind to CAR have been
constructed (see, e.g., copending U.S. application Serial No. 09/482,682 and
U.S. application Serial No. 09/562,934; see, also Von Seggern et al. (1999)
J.Virol. 73:1601-1608). The structure of these particles is nearly
identical~to
that of wildtype virions. Fiberless particles alone showed almost no transgene
delivery to SW480 epithelial cells, even though these cells express both CAR
and integrin av~5 (Von Seggern et al. (1999) J.Virol. 73:1601-1608).
DT molecules enhanced gene delivery of fiberless viruses. Fiberless
particles complexed with DT or DI molecules exhibited increased gene delivery
approximately 10-15, 3 and 5 fold, respectively, compared to the uncomplexed
fiberless particles. These findings indicate that fiberless particles can be
retargeted to cells via signal transducing antibodies.
The use of fiberless adenoviral vectors for gene therapy is desirable because
it is
then possible to restrict viral tropism to selected cell types by adopting a
specific
targeting strategy and abrogating the interaction between the viral fiber
protein
and the CAR receptors.
g. Summary of results
It is demonstrated herein that Ad vectors complexed with bifunctional
molecules significantly increased gene delivery to human melanoma cells
lacking
w integrins and was associated with both increased virus binding and
internalization compared to Ad vectors without such bifuctional ri~olecules.
Importantly, P13K activation plays a' key role in this process as a
significant
reduction in delivery following treatment of cells with pharmacologic
inhibitors of
PI3K was observed. Moreover, bifunctional molecules displaying distinct growth
factor ligands, each of which is known to activate PI3K, also enhanced gene
delivery. The variability in gene delivery by different bifunctional molecules
is
most likely to be due to differences in the expression of growth
factor/cytokine
receptors on different cell types or to the extent of P13K activation induced
by
each ligand.
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
-45-
Achieving gene delivery to specific cell types has been hampered by the
fiber receptor (CAR),-which is expressed on multiple cell types. To circumvent
this problem, a fiberless adenovirus vector was retargeted with bifunctional
molecules. Significant enhancement of gene delivery by a fiberless adenovirus
complexed with several different bifunctional molecules was detected. These
studies confirm the structural and functional integrity of fiberless
adenovirus
particles and indicate their usefulness for retargeting in gene delivery.
The PI3K-dependent signaling pathway should be useful for increasing the
uptake of other viral vectors. For example, adeno-associated virus (AAV) has
also been reported to use av integrins for infection. Because a variety of
bacterial and viral pathogens use integrins and/or PI3K activation for host
cell
invasion indicates that targeting of PI3K-dependent signaling pathways can
also
be used as a general scheme for potentiating cell entry of nonviral vectors.
The
exemplified methods and bifunctional molecules can be adapted for use for
potentiating entry of other viral vectors and bacterial vectors that use the
PI3K-
dependent signaling pathways for internalization.
C. Construction of the viral particles
1. Selection of viral genome and fiber protein
Methods for preparing recombinant adenoviral vectors for gene
product delivery are well known. Preferred among those are the methods
exemplified herein (see EXAMPLES) and also described in copending U..S.
application Serial No. 09/482,682 (also filed as International PCT application
No. PCT/US00/00265, filed January 14, 2000, which claims priority to U.S.
provisional application Serial No. 60/115,920, as does U.S. application Serial
No.09/482,682)).
As noted, any desired recombinant adenovirus is contemplated for use in
the methods herein as long as the viral genome is packaged in a capsid that
includes at least the portion of a fiber protein that provides selective
binding to
photoreceptor cells. This fiber protein is preferably from an adenovirus type
D
serotype and is preferably an Ad37 fiber. The fiber protein should retain the
knob region at the C-terminus ("head domain") from the Ad type D virus that
contains the type-specific antigen and is responsible for binding to the cell
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
-46-
surface receptor. Hence the fiber protein can be a chimeric fiber protein as
long
as it~retain~s a sufficient portion 'of the type ~D serotype to specifically
bind to
photoreceptor cells. Generally the portion retained will be all or a portion
of the
knob region. The precise amount of knob region required can be determined
empirically by including portions thereof and identifying the minimum residues
from and Ad type D serotype, preferably Ad37, to effect selective targeting of
a
virion packaged with such fiber to photoreceptors in the eye upon introduction
of
the packaged virion into the aqueous humor.
Recombinant adenovirus containing .heterologous nucleic acids that
encode a desired product, such a gene to correct a genetic defect, may be made
by any methods' known to those of skill in the art. The viruses are packaged
in a
suitable cell line.
The family of Adenoviridae includes many members with at least 51
known serotypes of human adenovirus (Ad1-Ad47) (Shenk, Virology, Chapter
67, in Fields et al., eds. Lippincott-Raven, Philadelphia, 1996,) as well as
members of the genus Mastadenovirus including human, simian, bovine, equine,
porcine, ovine, canine and opossum viruses, and members of the Aviadenovirus
genus, including bird viruses, e.g. CELO. Thus it is contemplated that the .
methods herein can be applied to any recombinant viral vectors derived from
any
adenovirus species. One of skill in the art would have knowledge of the
different adenoviruses (see, e.g.,Shenk, Virology, Chapter 67, in Fields et
al.,
eds. Lippincott-Raven, Philadelphia, 1996,) and can construct recombinant
viruses containing portions of the genome of any such virus. The methods
herein may also be adapted for use with any delivery vehicle that internalizes
via
receptors that use the P13K signalling pathway, particularly that employ an
integrins in the process.
2. Packaging'
Recombinant adenoviral vectors generally have at least a deletion in the
first viral early gene region, referred to as E1, which includes the E1a and
E1b
~ regions. Deletion of the viral E1 region renders the recombinant adenovirus
defective for replication and incapable of producing infectious viral
particles in
subsequently-infected target cells. Thus, to generate E1-deleted adenovirus
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
-47-
genome replication and to produce virus particles requires a system of
complerrievtation 'which 'provides the missing E1 gene product. E1
complementation is typically provided by a cell line expressing E1, such as
the
human embryonic kidney packaging cell line, i.e. an epithelial cell line;
called
293. Cell line 293 contains the E1 region of adenovirus, which provides E1
gene region products to "support" the growth of E1-deleted virus in the cell
line
(see, e.g., Graham et al., J. Gen. Virol. 36: 59-71, 1977). Additionally, cell
lines
that may be usable for production of defective adenovirus having a portion of
the adenovirus E4 region have been reported (W0 96/22378). Multiply deficient
adenoviral vectors and complementing cell lines have~also been described (WO
9.5/34671, U.S. Patent No. 5,994,106).
Copending U.S. application Serial No. 09/482,682 [also filed as
International PCT application No. PCT/US00/00265, filed January 14, 2000))
provides packaging cell lines that support viral vectors with deletions of
major
portions of the viral genome, without the need for helper viruses and also
provides cell lines and helper viruses for use with helper-dependent vectors.
The copending application provides a packaging cell line that has
heterologous DNA stably integrated into the chromosomes of the cellular
genome. The heterologous DNA sequence encodes one or more adenovirus
regulatory and/or structural polypeptides that complement the genes deleted or
mutated in the adenovirus vector genome to be replicated. and packaged. The
packaging cell line expresses, for example, one or more adenovirus structural
proteins, polypeptides, or fragments thereof, such as penton base, hexon,
fiber,
polypeptide Illa, polypeptide V, polypeptide VI, polypeptide VII, polypeptide
VIII,
and biologically active fragments thereof. The expression. can be constitutive
or
under the control of a regulatable promoter. These cell lines are particularly
designed for expression of recombinant adenoviruses intended for delivery of
therapeutic products.
Particular packaging cell lines complement viral vectors having a deletion
or mutation of a DNA sequence encoding an adenovirus structural protein,
regulatory polypeptides E1A and E1 B, and/or one or more of the following
regulatory proteins or polypeptides: E2A, E2B, E3, E4, L4, or fragments
thereof.
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
-48-
The packaging cell lines are produced by introducing each DNA molecule
into the cells and then~into the genome via a. separate complementing plasmid
or
plurality of DNA molecules encoding the complementing proteins can be
introduced via a single complementing plasmid.
' For therapeutic applications, the delivery plasmid further includes a
nucleotide sequence encoding a foreign polypeptide. Exemplary delivery
plasmids is pDV44, pE1 B gal and pE1 sp1 B. In a similar or analogous manner,
therapeutic genes may be introduced.
The cell further includes a complementing plasmid encoding a fiber as
contemplated herein; the plasmid or portion thereof is integrated into a
chrorriosome/s) of the cellular genome of the cell.
In one embodiment, a composition comprises a cell containing first and
second delivery p(asmids wherein. a first delivery p(asmid comprises an
adenovirus genome~ lacking a nucleotide sequence encoding fiber and incapable
of directing the packaging of new viral particles in the absence of a second
delivery plasmid, and a second delivery plasmid comprises an adenoviral genome
capable of directing the packaging of new viral particles in the presence of
the
first delivery plasmid.
The packaging cell line can be derived from. a procaryotic cell line or from
a eukaryotic cell line. While various embodiments suggest the use of mammalian
cells, and more particularly, epithelial cell fines, a variety of other, non-
epithelial
cell lines are used in various embodiments.
3. Components of the nucleic acid molecule included in the particle
A .recombinant viral vector or therapeutic viral vector for use in the
methods herein, typically includes a nucleic acid fragment that encodes a
protein or polypeptide molecule, or a biologically active fragment thereof, or
other regulatory sequence, that is intended fog use for therapeutic
applications.
The nucleic acid molecule to be packaged in the viral particle also may
include an enhancer element and/or a promoter located 3' or 5' to and
controlling the expression of the therapeutic product-encoding nucleic acid
moleucle if the product is a protein. Further, for purposes herein, the
promoter
andlor other transcriptional and translational regulatory sequences
controlling
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
-49-
expression of the product is preferably one that 'is expressed specifically in
the
targiaed-cells,'such as the a photoreceptor-specific~promoter, such as a
rhodopsin gene promoter.
The nucleic acid molecule to be packaged in viral capsid includes at least
2 different operatively linked DNA segments. The DNA can be manipulated and
amplified by PCR as described herein and by using standard techniques, such as
those described in Molecular Cloning: A Laboratory Manual, 2nd Ed, Sambrook
et al., eds., Cold Spring Harbor, New York (1989). Typically, to produce such
molecule, the sequence encoding the selected polypeptide and the promoter or
enhancer are operatively linked to a DNA molecule capable of autonomous
replication in a cell either in vivo or in vitro. By operatively linking the
enhancer
element or promoter and nucleic acid molecule to the vector, the attached
segments. are replicated along with the vector sequences.
Thus, the recombinant DNA molecule (rDNA) is a hybrid DNA molecule
. comprising at least 2 nucleotide sequences not normally found together in
nature. In various preferred embodiments, one of the sequences is a sequence
encoding an Ad-derived polypeptide, protein, or fragment thereof. The nucleic
acid molecule intended to be packaged is from about 20 base pairs to about
40,000 base pairs in length, preferably about 50 by to about 38,000 by in
length. In various embodiments, the nucleic acid molecule is of sufficient
length
to encode one or more adenovirus proteins or functional polypeptide portions
thereof. Since individual Ad polypeptides vary in length from about 19 amino
acid residues to about 967 amino acid residues, encoding nucleic acid
molecules
from about 50 by up to about 3000 bp, depending on the number and size of
individual polypeptide-encoding sequences that are "replaced" in the viral
vectors by therapeutic product-encoding nucleic acid molecules.
Preferably the molecule includes an adenovirus tripartite leader (TPL)
nucleic acid sequence operatively linked to an intron containing RNA
processing
signals (such as for example, splice donor or splice acceptor sites) suitable
for
' expression in the packaging cell line. Most preferably the intron contains a
splice
. donor site and a splice acceptor site. Alternatively, the TPL nucleotide
sequence
may not comprise an intron. The intron includes any sequence of
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
-50-
nucleotides that function in the packaging cell line to provide RNA processing
signals,-including- splicing signals, ~ Introns.have been well characterized
from a
large number of structural genes, and include but are not limited to a native
intros 1 from adenovirus, such as Ad5's TPL intros 1; others include the SV40
VP intros; the rabbit beta-globin intros, and synthetic intros constructs
(see,
e.g., Petitclere et al. (1995)J. Biothechnol., 4:169; and Choi et al. (1991
/(lo/.
Cell. Biol_, 11:3070).
The nucleic acid molecule encoding the TPL includes either (a) first and
second TPL axons or (b) first, second and .third TPL axons, where each TPL
axon
in the sequence is selected from among the complete TPL axon 1, partial TPL
axon 1, complete TPL axon 2 and complete TPL axon 3. A complete axon is
one which contains the complete nucleic acid sequence based on the sequence
found in the wildtype viral genome. Preferably the TPL axons are from Ad2,
Ad3, AdS, Ad7 and the like, however, they may come from any Ad serotype, as
, described herein. A preferred partial TPL axon 1 is described in the
Examples.
The use of a TPL with a partial axon 1 has been reported (International PCT
application No. WO 98/13499).
The intros and the TPL axons can be operatively linked in a variety of
configurations to provide a functional TPL nucleotide sequence, An intros may
not be a part of the construct. For example, the intros can be positioned
between any of TPL axons 1, 2 or 3, and the axons can be in any order of first
and second, or first/second/third. The intros can also be placed preceding the
first TPL axon or following the last TPL axon. In a preferred embodiment,
complete TPL axon 1 is operatively linked to complete TPL axon 2 operatively
linked to complete TPL axon 3. In a preferred 'variation, adenovirus TPL
intros 1
is positioned between complete TPL axon 1 and complete TPL axon 2. It may
also be possible to use analogous translational regulators from other viral
systems such as rabiesvirus.
4. Complementing Plasmids
~ Also contemplated are the use of nucleic acid molecules, typically in the
form of DNA plasmid vectors, which are capable of expression of an adenovirus
structural protein or regulatory protein. Because these expression plasmids
are
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
-51-
used to,compiement the defective genes of a recombinant adenovirus vector
genome;.tYre~plasmids are referred tows complementing or complementation
plasmids:
The complementing plasmid contains an expression cassette, a nucleotide
sequence capable of expressing a protein product encoded by the nucleic acid
molecule. Expression cassettes typically contain a promoter and a structural
gene operatively linked to the promoter. The complementing plasmid can further
include a sequence of nucleotides encoding TPL nucleotide to enhance
expression of the structural gene product whey used in the context of
adenovirus genome replication and packaging.
A complementing plasmid can include a promoter operatively linked to a
sequence of nucleotides encoding an adenovirus structural polypeptide, such
as,
but are not limited to, penton base; hexon; fiber; polypeptide Illa;
polypeptide V;
polypeptide VI; polypeptide VII; polypeptide VIII; and biologically active
fragments thereof. In another variation, a complementing plasmid may also
include a sequence of nucleotides encoding a first adenovirus regulatory
polypeptide, a second regulatory polypeptide, and/or a third regulatory
polypeptide; or any combination of the foregoing.
5. Nucleic Acid Molecule Synthesis
A nucleic acid molecule comprising synthetic oligonucleotides can be
prepared using any suitable method, such as, the phosphotriester or
phosphodiester methods (see, e.g., Narang (1979) et al., Meth. Enzymol.,
68:90; U.S. Patent No. 4,356,270; and Brown et al., (1979) Meth. Enzymol.,
68:109). . For oligonucleotides, the synthesis of the family members can be
conducted simultaneously in a single reaction vessel, or can be synthesized
independently and later admixed in preselected molar ratios. For simultaneous
synthesis, the nucleotide residues that are conserved at preselected positions
of
the sequence of the family member can be introduced in a chemical synthesis
protocol simultaneously to the variants by the addition of a single
preselected
nucleotide precursor to the solid phase oligonucleotide reaction admixture
when
that position number of the oligonucleotide is being chemically added to the
growing otigonucteotide polymer. The addition of nucleotide residues to those
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
-52-
positions in the sequence that vary can be introduced simultaneously by the
addition ~ of ~amouhts; preferably equimolar amounts, of multiple preselected
nucleotide precursors to the solid phase oligonucleotide reaction admixture
during chemical synthesis. For example, where all four possible natural
nucleotides (A,T,G and C) are to be added at a preselected position, their
precursors are added to the oligonucleotide synthesis reaction at that step to
simultaneously form four variants (see, e.g., Ausubel et al. (Current
Protocols in
Molecular Biology, Suppl. 8. p.2.11.7, John Wiley & Sons, Inc., New York
,1991 ).
70 Nucleotide bases other than the common four nucleotides (A,T,G or C), or
the RNA equivalent nucleotide uracil (U), can also be used. For example, it is
well known that inosine (I) is capable of hybridizing with A, T and G, but not
C.
Examples of_ other useful nucleotide analogs are known in the art and may be
found referred to in 37 C.F.R. ~ 1.822.
. Thus, where all four common nucleotides are to occupy a single position
of a family of oligonucleotides, that is, where the preselected nucleotide
sequence is designed to contain oligonucleotides that can hybridize to four
sequences that vary at one position, several different oligonucleotide
structures
are contemplated. The composition can contain four members, where a
preselected position contains A,T,G or C. Alternatively, a composition can
contain two nucleotide sequence members, where' a preselected position
contains I or C, and has the capacity the hybridize at that position to all
four
possible common nucleotides. Finally, other nucleotides may be included at the
preselected position that have the capacity to hybridize. in a non-
destabilizing
25_ manner with more than one of the common nucleotides in a manner similar to
inosine.
Similarly, larger nucleic acid molecules can be constructed in synthetic
oligonucleotide pieces, and assembled by complementary hybridization and
ligation, as is well known.
D. . Adenovirus Expression Vector Systems
The adenovirus vector genome that is encapsulated in the virus particle
and that expresses exogenous genes in a gene therapy setting is a key
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
-53-
component of the system, which systems are well known and readily available.
Thus,~.the..comPonents of a recombinant adenovirus vector genome include the
ability to express selected adenovirus structural genes, to express a desired
exogenous protein, and to contain sufficient replication and packaging signals
that the genome is packaged into a gene delivery vector particle. The
preferred
replication signal is an adenovirus inverted terminal repeat containing an
adenovirus origin of replication, as is well known.
Although adenovirus include many proteins, not all adenovirus proteins
are required for assembly of a recombinant. adenovirus particle (vector).
Thus,
deletion of the appropriate genes from a recombinant Ad vector permits
accommodation of even larger "foreign" DNA segments.
Particularly contemplated are helper dependent systems as described
above, i.n which the ~adenovirus. vector genome does not encode a functional
adenovirus fiber protein. A non-functional fiber gene refers to a deletion,
mutation or other modification to the adenovirus fiber gene such that the gene
does not express any or insufficient adenovirus fiber protein to package a
fiber-
containing adenovirus particle without complementation of the fiber gene by a
complementing plasmid or packaging cell line. Such a genome is referred to as
a
"fiberless" genome, not to be confused with a fiberless particle.
Alternatively, a
fiber protein may be encoded but is insufficiently expressed to result in a
fiber
containing particle. .
Thus, among the delivery vectors contemplated for use are helper-
independent fiberless recombinant adenovirus vector genomes that include genes
that (a).express all adenovirus structural gene products but express
insufficient
adenovirus fiber protein to package a fiber-containing adenovirus particle
without
complementation of said fiber gene; (b) express an exogenous protein, and (c)
contains an adenovirus packaging signal and inverted terminal repeats
containing
adenovirus origin of replication.
The adenovirus vector genome is propagated in the laboratory in the form
of rDNA plasmids containing the genome, and upon introduction,into an
appropriate host, the viral genetic elements provide for viral genome
replication
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
-54-
and packaging rather than plasmid-based propagation. Exemplary methods for
preparing an Ad-vector genome are described in the Examples.
A vector herein includes a nucleic acid (preferably DNA) molecule capable
of autonomous replication in a cell and to which a DNA segment, e.g., a gene
or
polynucleotide, can be operatively linked to bring about replication of the
attached segment. For purposes herein, one of the nucleotide segments to be
operatively linked to vector sequences encodes at least a portion of a
therapeutic
nucleic acid molecule. As noted above, therapeutic nucleic acid molecules
include those encoding proteins and also those that encode regulatory factors
. that can lead to expression or inhibition or alteration of expression of a
gene
product in a targeted cell.
1. Nucleic Acid Gene Expression Cassettes
In various embodiments; a peptide-coding sequence of the therapeutic
gene is inserted into an expression vector and expressed; however, it is also
feasible to construct an expression .vector which also includes some non-
coding
sequences as well. Preferably, however, non-coding sequences are excluded.
Alternatively, a nucleotide sequence for a soluble form of a polypeptide may
be
utilized. Another preferred therapeutic viral vector includes a nucleotide
sequence encoding at least a portion of a therapeutic nucleotide sequence
operatively linked to the expression vector for expression of the coding
sequence
in the therapeutic nucleotide sequence.
The choice of viral vector into which a therapeutic nucleic acid molecule
is operatively linked depends directly, as is well known in the art, on the
functional properties desired, e.g., vector replication and protein
expression, and
the host cell to be transformed. Although certain adenovirus serotypes are
recited herein in the form of specific examples, it should be understood that
the
use of any adenovirus serotype, including hybrids and derivatives thereof are
contemplated.
A translatable nucleotide sequence is a linear series of nucleotides that
provide an uninterrupted series of at least 8 codons that encode a potypeptide
in
one reading frame. Preferably, the nucleotide sequence is a DNA sequence. The
vector itself may be of any suitable type, such as a viral vector (RNA or DNA,
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
-55-
naked straight-chain or circular DNA, or a vesicle or envelope containing the
nucleic acid ~mat.erial. and any polypeptides .that are to be inserted into
the cell.
2. Promoters
As noted elsewhere herein, an expression nucleic acid in an Ad-derived
vector may also include a promoter, particularly a tissue or cell specific
promoter, preferably one expressed in the targeted cells.
Promoters nucleic acid fragments that contain a DNA sequence that
controls the expression of a gene located 3' or downstream of the promoter.
The promoter is the DNA sequence to which.RNA polymerase specifically binds
and initiates RNA synthesis (transcription) of that gene, typically located 3'
of
the promoter. A promoter also includes DNA sequences which direct the
initiation of transcription, including those to which RNA polymerase
specifically
binds. If more than one nucleic acid sequence encoding a particular
polypeptide
or protein is included in a therapeutic viral vector or nucleotide sequence,
more
than one promoter or enhancer element may be included, particularly if that
would enhance efficiency of expression. Regulatable (inducible) as well as
constitutive promoters may be used, either on separate vectors or on the same
vector.
For example, some useful regulatable promoters are those of the CREB-
regulated gene family and include inhibin, gonadotropin, cytochrome c,
glucagon, and the like. (See, e.g., International PCT application No. No. W0
96/14061 ). Preferably the promoter selected is from a photoreceptor-specific
gene, such as a rhodopsin gene or gene that encodes a protein that regulates
rhodopsin expression.
A regulatable or inducible promoter may be described as a promoter
wherein the rate of RNA polymerase binding and initiation is modulated by
external stimuli. (see, e.g., U.S. Patent Nos. 5,750,396 and 5,998,205). Such
stimuli include various compounds or compositions, light, heat, stress,
chemical
energy sources, and the like. Inducible, suppressible and repressible
promoters
are. considered regulatable promoters.
Regulatable promoters may also include tissue-specific promoters.
Tissue-specific promoters direct the expression of the gene to which they are
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
-56-
operably linked to a specific cell type. Tissue-specific promoters cause the
gene
located 3.'.of it to be expressed. predominantly, if not exclusively, in the
specific
cells where the promoter expressed its endogenous gene. Typically, it appears
that if a tissue-specific promoter .expresses the gene located 3' of it at
all, then
it is expressed appropriately in the correct cell types (see, e.g., Palmiter
et al.
(1986) Ann. Rev. Genet. 20: 465-499).
E. Formulation and administration
Compositions containing therapeutically effective concentrations of
recombinant adenovirus delivery vectors for delivery of therapeutic gene
products to cells that express the targeted receptor, such as IGF-1 receptors
and
TNF-a receptors.
Preferable modes of administration include, local and topical modes~of
administration, such as, but are, not limited to, intramuscular, intravenous,
intraperitoneal and subretina.l injection, particularly intravitreal
injection,
The recombinant viral compositions may also be formulated for
implantation into tissues, including as the anterior or posterior chamber of
the
eye, particularly the vitreous cavity, in sustained released formulations,
such as
adsorbed to biodegradable supports, including collagen sponges, or in
liposomes.
Sustained release formulations may be formulated for multiple dosage
administration, so.that during a selected period of time, such as a month or
up
to about a year, several dosages are administered. Thus, for example,
liposomes
may be prepared such that a total of about two to up to about five or more
times
the single dosage is administered in one injection. The vectors are
formulated in an pharmaceutically acceptable carriers for the selected route
of
administration in a volume suitable for such route.
To prepare compositions the viral particles are dialyzed into a suitable
pharmaceutically acceptable carrier or viral particles may be concentrated
and/or
mixed therewith. The resulting mixture may be a solution, suspension or
emulsion. In addition, the viral particles may be formulated as the sole
pharmaceutically active ingredient in the composition or may be combined with
other active agents for the particular disorder treated.
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
-57-
Suitable carriers include, but are not limited to, physiological saline,
phosphat.e~ buffered saline (PBS), balanced salt solution (BSS), lactate
Ringers
solution, and solutions containing thickening and solubilizing agents, such as
glucose, polyethylene glycol, and polypropylene glycol and mixtures thereof.
Liposomal suspensions may also be suitable as pharmaceutically acceptable
carriers. These may be prepared according to methods known to those skilled in
the art.
The compositions can be prepared with carriers that protect them against
rapid elimination from the body, such as time release formulations or
coatings.
Such carriers include controlled release formulations, such as, but not
limited to,
microencapsulated delivery systems, and biodegradable, biocompatible polymers,
such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid,
polyorthoesters, polylactic acid and other types of implants that may be
placed
directly into the body or tissue of interest.
Liposomal suspensions rnay also be suitable as pharmaceutically
acceptable carriers. Preferably such liposomes. For example, liposome
formulations may be prepared by methods known to those of skill in the art
[see,
e-q., Kimm et al. (1983) Bioch. Bioph. Acta 728:339-398; Assil et al. (1987)
Arch Ophthalmol. 105:400; and U.S. Patent No. 4,522,81 1 ). The viral
particles
may be encapsulated into the aqueous phase of liposome systems. The active
materials can also be mixed with other active materials, that do not impair
the
desired action, or with materials that supplement the desired action or have
other action, such as anti-tumor agents.
. For purposes herein; the viral or other particles may be complexed with
the bifunctional molecules (the conjugates) prior to packaging or immediately
prior to use. Hence combinations and kits containing the combinations of the
selected delivery vector and the bifunctional molecules are also provided. The
bifunctional molecules and delivery vectors may be packaged as separate
compositions or as a single composition. The kits optionally include
instructions
for use and administration of the combinations.
The compositions can be enclosed in ampules, disposable syringes or
multiple or single dose vials made of glass, plastic or other suitable
material.
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
-58-
Such enclosed compositions can be provided in kits. In particular, kits
containing vials, ampules or other.container, preferably disposable vials or
containers or other packages with sufficient amount of the composition to
deliver a desired amount, which depends upon the treated condition.
Finally, the combinations and components compositions thereof may be
packaged as articles of manufacture containing packaging material, typically a
vial or container, an pharmaceutically acceptable composition containing the
viral
particles and a label that indicates the therapeutic use of the composition.
Also provided are kits for practice of the methods herein: The kits
contain one or more containers, such as sealed vials, with sufficient
composition
for single dosage administration.
Administration
The compositions containing the compounds are administered
systemically by any suitable route, or. may be administered topically, such as
by
injection into synovial fluids for treatment of rheumatoid arthritis, in the
form of
perietrating eyedrops for treatment of occular disorders or disorders in which
the
vectors can be suitably targeted from the eye.
. It is further understood that, for any particular subject and disorder,
specific dosage regimens should be adjusted over time according to the
individual need and the professional judgment of the person administering or
supervising the administration of the recombinant viruses, and that the
concentration ranges set forth herein are exemplary only. and are not intended
to
limit the scope or practice of the methods provided herein.
F. Diseases, Disorders and therapeutic products
The bifunctional molecules provided herein permit targeting of viral and
bacterial vectors to cells that express targeted receptors. The targeted
receptors
are those that activate the PI3K signalling pathway and internalized linked
ligands by virtue thereof. Because such receptors are diverse and widespread,
the use of bifunctional molecules provides a flexible means for gene delivery
and
therapeutic product delivery to cells and tissues. Receptors for the targeting
agents, such as growth factors and hormones, are overexpressed on cells
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
-59-
associated with various disorders and conditions and/or on only selected cell
types..
The use of the PI3K signaling strategy to tailor delivery of the adenovirus
vectors to cell types over-expressing the desired growth factor receptor or
cytokine receptor or other cell surface receptor that activates the PI3K
pathway
permits internalization via such receptors, Adenovirus binding and
internalization
can be further enhanced by taking advantage of additional interactions with
CAR
and also with integrins, if they are present on the cell surface. The
bifunctional
molecules provided herein do not bind.the viral fiber protein, thus allowing
for
interactions with CAR. In addition, preferred bifunctional molecules bind the
penton base protein. which has five "RGD°' integrin binding sites.
Since not all
five "RGD" sites are bound by the whole molecule, the presence of the bifunc-
tional molecule precludes neither CAR nor integrin interactions, and in
addition
offers a specific growth factor/cytokine - receptor binding interaction. In
that
sense, it is Pike a "triple-edged sword" for enhanced levels of binding and
internalization; once targeting has been achieved. It is also advantageous to
adopt a targeting strategy, which does not preclude interaction of the
adenovirus
with the av integrins because the integrins are known to not only signal on
their
own, but to promote optimal activation of growth factor receptors (Vuori et
al.,
Science, 266:1576 (1994); Cybulsky et al., J. Clin. Invest., 94:68 (1994);
Jones et al., J. Cell Biol., 139:279 (1997); Miyamoto et al., J. Cell Biol.,
135:1633 (i 996j; Schneller et al., EMBO J,, 16:5600 (1997); Woodard et al.,
J.
Cell Sci., 111:469 (1998); Moro et al., EMBO J., 17:6622 (1998); Soldi et al.,
FMBO J., 18:882 ( 1999)).
1. Diseases and disorders
Methods for specifically targeting recombinant adenovirus vectors for
delivery of gene products, particularly therapeutic products are provided
herein.
These methods are particularly suitable for targeting cells that express
receptors
to which the bifunctional molecules provided herein selectively bind resulting
in
internalization of the linked delivery vector. Adenoviruses are presently
preferred. Diseases that can be targeted include, but are not limited to,
cancers,
vascular disorders, diabetic retinopathies, restenosis, ophthalmic disorders,
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
-60-
hyperproliferative disorders and hormonal disorders. The methods and
bifunctional molecules provided. herein permit targeting to restricted sets of
cells
associated with particular disorders.
Angiogenesis
In the normal adult, angiogenesis is tightly regulated and limited to wound
healing, pregnancy and uterine cycling. Angiogenesis is turned on by specific
angiogenic molecules such as basic and acidic fibroblast growth factor (FGF),
vascular endothelial growth factor (VEGF), angiogenin, transforming growth
factor (TGF), tumor. necrosis factor-a (TNF-a)~ and platelet derived growth,
factor
(PDGF). Angiogenesis can be suppressed by inhibitory molecules such as
interferon-a, thrombospondin-1, angiostatin and endostatin. It is the balance
of
these naturally occurring stimulators and inhibitors that is controls the
normally
quiescent capillary vasculature. When this balance is upset, as in certain
disease
states, capillary endothelial cells are induced to proliferate, migrate and
ultimately differentiate.
Angiogenesis plays a central role in a variety of disease including cancer
and neovascularization. Sustained growth and metastasis of a variety of tumors
has also been shown to be dependerit on the growth of new host blood vessels
into the tumor. in response to tumor derived angiogenic factors. Proliferation
of
new blood vessels in response to a variety of stimuli occurs as the dominant
finding in the majority of eye disease and that blind including proliferative
diabetic retinopathy (PDR), age-related macular degeneration (ARMD), rubeotic
glaucoma, interstitial keratrtis and retinopathy of prematurity. In these
diseases,
tissue damage can stimulate release of angiogenic factors resulting in
capillary
proliferation. VEGF plays a dominant role in iris neovascularization and
neovascular retinopathies. While reports clearly show a correlation between
intraocular VEGF levels and ischemic retinopathic ocular neovascularization,
FGF
likely plays a role. Basic and acidic FGF are known to be present in the
normal
adult retina, even though detectable levels are not consistently correlated
with
neovascularization. This may be largely due to the fact that FGF binds very
tightly to charged components of the extracellular matrix and may not be
readily
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
-61-
available in a freely diffusible form that would be detected by standard
assays of
intraocula~...fluids. . . - . ,
A .final common pathway in the angiogenic response involves integrin-
mediated information exchange between a proliferating vascular endothelial
cell
and the extracellular matrix. This class of adhesion receptors, called
integrins,
are expressed as heterodimers having an a and ~ subunit on all cells. One such
integrin, a~/33, is the most promiscuous member of this family and allows
endothelial cells to interact with a wide variety of extracellular matrix
components. Peptide and antibody antagonists of this integrin inhibit
angiogenesis by selectively inducing apoptosis of the proliferating vascular
endothelial cells Two cytokine-dependent pathways of angiogenesis exist and
may be defined by their dependency on distinct vascular cell integrins, a",B3
and
a~5. Specifically, basic FGF- and. VEGF-induced angiogenesis depend on
integrin
a"Q3 and a~~5, respectively,. since antibody antagonists of each integrin
selectively block one of these angiogenic pathways in the rabbit corneal and
chick chorioallantoic membrane (CAMS models. Peptide antagonists that block
all a" integrins inhibit FGF- and VEGF-stimulated angiogenesis. While normal
human ocular blood vessels do not display either integrin, a",83 and a~,85
integrins
are selectively displayed on blood vessels in tissues from patients with
active
neovascular eye disease. While only a"~3 was consistently observed in tissue
from patients with ARMD,a~3 and a",85 were present in tissues from patients
with PDR. Systemically administered peptide antagonists of integrins blocked
new blood vessel formation in a mouse model of retinal vasculogenesis.
In. addition to adhesion events described above, cell migration through the
extracellular matrix also depends on proteolysis. Matrix metalloproteinases
are a
family of zinc-requiring matrix-degrading enzymes that include the
collagenases,
gelatinases and stromelysins, all of which have been implicated in invasive
cell
behavior. Invasive cell processes such as tumor metastasis and angiogenesis
have been found to be associated with the expression of integrins and MMP-2,
MMP-2 are all found throughout the eye where they may interact to maintain a
quiescent vasculature until the balance is upset, resulting in pathological
angiogenesis. A non-catalytic C-terminal hemopexin-like domain of MMP-2
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
-62-
(PEX) can block cell surface collagenolytic activity and inhibit angiogenesis
in the
CAM model by: preventing localization of MMP-2 to the surface of invasive
cells
through interaction with the integrin a~~3.
Anti-angiogenic agents have a role in treating retinal degeneration to
prevent the damaging effects of trophic and growth factors. Angiogenic agents,
also have role in promoting desirable vascularization to retard retinal
degeneration by enhancing blood flow to cells.
Growth FactorslCytokines and Pathological Conditions
EGF Receptors
EGF receptors are overexpressed in glioblastomas, bladder tumors,
advanced gastric tumors and cervical cancers (Gullick (1991 ) Br. Med. Bull.,
47:87). They are overexpressed in 63% of tumor specimens from patients with
lung cancer (Pastorino et al. (1993) J. Cell. Biochem. Suppl., 17F:237), and
are
overexpressed in astrocytic gliomas (Goussia et al. (2000) Oncvl. Rep. 7:401.
Overexpression is also correlated with tumor invasion and progression of human
esophageal and gastric carcinomas (Yoshida et al., Exp. Pathol., 40:291
(1990)).
FGF Receptors
These receptors are overexpressed in human pancreatic adenocarcinomas
(Kobrin etal., CancerRes., 53:4741 (1993)),
in human breast and gynecological cancers (Jaakkola et al., Int. J. Cancer,
54:378 (1993)), human astrocytomas (Morrison et al., J. Neuro-oncol., 18:207
(1994)); and in human melanoma tissues (Xerri et al., Melanoma Res., 6:223
(1996)). FGF receptor expressing cells are also implicated in restenosis,
Kaposi
sarcoma, diabetic retinopathies and numerous disorders of the eye.
EGFR, FGFR and IGF-1 R
EGFR, FGFR and IGF-1 R are overexpressed in pancreatic cancers (Korc,
Surg. Oncol. Clin. N. Am., 7:25 (1998))
tGF-1 R
IFG-1 R is overexpressed and hyperphosphorylated in primary breast
tumors (Surmacz; J. Mamm. Gland Biol. Neoplasia, 5:95 (2000)).
TNFR
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
-63-
Overexpression of both TNFa~receptors, p55 and p75, is observed in neoplastic
cells from patients with chronic lyrr~phocytic leukemia (Waage et al., Blood,
80:2577 (1992)) TNFa p55 receptor is overexpressed in breast carcinomas
(Pusztai et al., Br. J. Cancer, 70.:289(1994)). TNFR is overexpressed in
normal
and malignant myeloid cells, e.g., HL-60 promyelocytes (Munker et al., Blood,
70:1730 (1987)).
SCF receptors
Development of mastocytosis (abnormal infiltration of mast cells into
various organs) in patients with myelodysplastic syndrome (MDS) is due to a
mutation in c-kit (the SCF receptor), which renders it ultra-sensitive to SCF
(Dror
et al., Br. J. Haematol., 108:729 (2000)). Therefore, SCF-derived bifunctional
molecules can be used to deliver therapeutic products to such cells. Benign
and
malignant ovarian turi~ors express c-kit (SCF receptor) while normal tissue
does
not (Tonary et al.; /nt. J. Cancer, 89:242 (2000)).
2. Therapeutic products
Among the DNA that encodes therapeutic products contemplated for use
is DNA encoding correct copies of defective genes, such as the defective gene
(CFTR) associated with cystic fibrosis (see, e-g., International Application
WO
93/03709, which is based on U.S. Application Serial No. 07/745,900; and
Riordan et al. (1989) Science 245:1066-1073), and anticancer agents, such as
tumor necrosis factors, and cytotoxic agents. Therapeutic products include but
are not limited to, wild-type genes that are defective in targeted ocular
disorders,
such as defective gene products or fragments thereof sufficient to correct the
genetic defect, trophic factors, including growth factors, inhibitors and
agonists
of trophic factors, anti-apoptosis factors and other products herein or known
to
those of skill in the art to be useful for treatment of selected disorders.
The following examples are included for illustrative purposes only and are
not intended to limit the scope of the invention.
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
-64-
EXAMPLE 1
Preparation.and characterization of DAV-1
A monoclonal antibody, designated DAV-1, had been previously obtained
and characterized (see, Stewart et al. (1997) EMBO J. 76:1 189-1198) as
described in this Example. The nucleic acid and protein sequences of the heavy
and light chain of DAV-1 are set forth in SEQ ID Nos. 1-4; and the nucleic
acid
and protein sequences of the portion used in exemplified fusion proteins
containing substantially full-length heavy chain is set forth in SEQ ID Nos. 5
and
6:
Materials and Methods
Cell lines, viruses and recombinant proteins
A549, HeLa, H2981 and SW480 cell lines, adenovirus serotypes Ad2,
Ad3 and Ad4 were purchased from the American Type Tissue Culture Collection
(Rockville, MD). For virus isolation, HeLa cells were infected with either
Ad2,
Ad3 or Ad4 at a multiplicity of 10 p.f.u./cell and then harvested 48-72 h
later.
Cells were frozen and thawed five times to release intracellular virus
particles.
After removing the cell debris by high-speed centrifugation, virions were
isolated
by banding on a 15-40% cesium chloride gradient in 10 mM Tris-HCI, 150 mM
NaCI pH 8.1 (TBS) as reported previously (Everitt et al., 1977). Banded
virions
were removed and.then dialyzed into TBS buffer containing 10% glycerol,
except for cryo-EM studies in which case the CsCI was removed by multiple
centrifugation steps in a Microcon 100 (Amicon) filtration device using pH 8.1
phosphate buffer. Recombinant Ad2 penton base containing 571 amino acids
(Neumann et al., 1988) was produced in Sf9 insect cells using baculovirus as
previously described (Nemerow et al., 1993); Wickham et al., 1993).
Generation and characterization of the DAV-1 anti-penton base mAb
A hybridoma (designated DAV-1 ) secreting a mAb of the subtype y1 K
was generated by standard techniques. The DAV-1 mAb was purified from
ascites fluids using protein G-Sepharose (HiTrap GII, Pharmacia), Fab
fragments
of the DAV-1 mAb were generated by papain digestion. Briefly, 1-5 mg/ml of
purified DAV-1 IgG in 50 mM Tris-HCI pH 8.0, 10 mM I-cysteine, 3 mM EDTA
was incubated for 7 h at 37°C in the presence of 8% w/w soluble papain
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
-65-
(Sigma Chemical Co., St. Louis, MO). The reaction was stopped by the addition
of 30 mM iodoacetamide, and the Fab .antibody fragments were then isolated on
a Resource S FPLC column (Pharmacia) equilibrated with 50 mM MES pH 5Ø
The purified Fab fragments were analyzed by SDS-PAGE and then concentrated
to 2.2 mg/ml using a Centricon 10 membrane ultrafiltration device (Amicon).
Reactivity of the DAV-1 mAb with different adenovirus serotypes was
quantified in an ELISA. Ninety-six well polystyrene plates (Immobilon,
Dynatech)
were coated with 1 Ng of penton base or with 5 Ng of purified Ad2, Ad3 or Ad4
in PBS for 18 h at 4°C. After blocking non-specific binding sites with
2% non-
fat dried milk, l0,ug/ml of purified DAV-1 mAb or an irrelevant control
antibody
were added to the wells for 60 min at 22°C. Antibody binding was
detected by
the addition of alkaline phosphatase linked to goat anti-mouse IgG followed by
substrate (Sigma Chemical Co., St. Louis, MO). Substrate development was
quantified at 405 nm in an ELISA plate reader (Titertek, Flow laboratories).
75 To examine whether the DAV-1 mAb also recognized RGD-containing cell
matrix proteins, 1-2,ug of recombinant penton base protein, or fibronectin,
vitronectin, collagen (type 1 ) and fibrogen were reacted with the DAV-1 mAb
in
a Western blot. Recombinant penton base or cell matrix proteins were
electrophoresed on a 8-15% gradient SDS gel (Novex, San Diego, CA) and then
transferred to'a nitrocellulose fitter (tmmobilon P, Milliporel. Following
blocking
of non-specific binding sites with 1 % non-fat dried milk (Blotto), the
filters were
reacted with 10 ~g/ml of the DAV-1 mAb followed by incubation with alkaline
phosphatase linked to goat anti-mouse IgG (Tropix, Bedford, MA) and then with
a chemiluminescent substrate (CDP).
Functional analysis of the DAV-1 mAb
The effect of the DAV-1 mAb on penton base binding to cell surface a"
integrins was examined as follows. To 1 x 1 Os A549 epithelial cells 10 ~rglml
of
purified DAV-1 IgG or Fab fragments of the DAV-'1 mAb was added. Varying
amounts of '251-labeled penton base (10 uCi/,ug) were then added to the cells
in
the presence or absence of a 50-fold excess of unlabeled penton base and
incubated for 60 min at 4°C. Unbound penton base was removed by
centrifuging the cell samples through a cushion of 1:1 glycerol/mineral oil
and
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
-66-
the amount of cell-associated penton base was determined by counting the cell
pellet.in ~a. y-counter..
The effect of the DAV-1 mAb on adenovirus infection was quantified by
plaque assay. A549 cells were seeded into six-well plates and cultured to 90%
confluency. Three Ng/ml of DAV-1 Fab or 18 ,ug of whole IgG DAV-1 antibody
were added to the cell cultures, followed by addition of purified 100 p.f.u.
Ad2
and incubation at 37°C for 2 h. The Ad2 and antibody mixtures were then
removed, and 8 ml of overlay medium containing 0.5% agarose in DMEM
medium and 10% FCS was added into each' well. The cells were fed with 4 m!
of overlay medium on day 5 post-infection. The plaques were scored on day 10
post-infection.
Epitope mapping and kinetic analysis of DAV-1 binding to penton base
As noted above, the DAV-1 binding site on the Ad2 penton base was
identified by affinity-directed mass spectrometry. For these studies, a region
of
the penton base that approximately spanned the RGD-containing epitope
sequence was selected. A series of overlapping synthetic peptides varying by
one amino acid on the N-terminal or C-terminal region of the Ad2 penton base
RGD sequence, 4$°MNDHAIRGDTFATRA4sa (SEQ ID NO. 19), was generated
by
solid-phase protocols, and the precise boundaries of the DAV-1 epitope were
then determined by affinity-directed mass spectrometry (see, Zhao et al.
(1994)
Anal. Chem. 66:3723-3726; Zhao et al.. (1996) Proc. Natl. Acad Sci. U.S.A.
93:4020-4024).
Precise measurements of DAV-1 interactions with the penton base protein
were determined by SPR (Karlsson et al. (1991 ) J. lmmunol. .Methods 145:229-
240) using an automated biosensor system (BIAcore 2000 Pharmacia). Briefly,
recombinant penton base at 60 Ng/ml was immobilized onto carboxymethyl
dextran-coated biosensor chips in 10 mM MES pH 6.5 containing 10 mM NaCI.
Following amine coupling of the penton base, varying amounts of purified Fab
fragments (3.6-57.O,uglml) or IgG molecules (36-576,ug/ml) were flowed over
the penton base at a rate of 40 NI/min, respectively. Kinetic binding data
(Ko",
Koff and Ko) were obtained using BIAevaluation software (version 2.1 ).
Stoichiometric data was obtained by observing the change in SPR at saturation
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
-67-
binding and assuming a molecular mass of 350 kDa for the penton base, 43 kDa
for Fab fragments and 150 kDa ~fo~ IgG molecules. The sequence recognized by
DAV-1 was IRGDTFATR (see SEQ ID NO. 20).
EXAMPLE 2
Preparation and Analysis of Bifunctional Signaling Antibodies
A. Cloning of DAV-1-encoding cDNA
The hybridoma secreting a monoclonal antibody of the type y1 K
(designated DAV-1 ) was generated as described in EXAMPLE 1 (see, Stewart et.
al. (1997) EMBO J. 76:1 189-1 198). Total .RNA was isolated. from the DAV-1
hybridoma cell line (Trizol reagent, Gibco BRL) and cDNA was generated using
the Superscript Plasmid System kit (Gibco BRL) essentially as described
(Uematsu, Immunogenetics, 34: 174-178 (1991 )). The DAV-1 heavy chain was
PCR amplified with: primers 5'-CCT GCT CTG TGT TTA CAT GAG GG (CH3
region) (.SEQ ID. NO. 15); 5'-CCC AGG GTC ATG GAG TTA G (CH1 region]
(SEQ ID. NO. 16); for kappa (light) chain amplification: 5'-AAG ATG GAT ACA
GTT GGT GC (CL-A) (SEQ ID. NO. 17) and 5'-TGT CAA GAG CTT CAA CAG GA
(CL-B) (SEQ ID. NO. 18) were the primers used. PCR amplification was carried
out using the parameters 94°C for 1 minute, 63°C for 1 minute
and 72°C for 1
minute, for a total of 30 cycles. The PCR products were ligated into pCR2.1
(Invitrogen, Carlsbad, CA) using a TA cloning kit (Invitrogen, Carlsbad, CA),
and
then sequenced by automated sequencing. Further amplification to obtain the
complete DAV-1 heavy and light chains was performed using standard PCR
reactions as described above.
The cDNA coding the y heavy and K-light chains of (DAV-1 ) were
subcloned into an expression vector, designated pIZ, which contains a Zeocin
selection marker for expression in insect cells (Invitrogen, CA). The portion
of
the DAV-1 heavy chain used to generate fusion proteins with various cytokines
or growth factors was the full-length heavy chain minus the last 18 amino
acids
(coding portion in SEQ ID NO. 1 encoding amino acid 1 through 438, and SEQ
ID NO. 5) was cloned into the pIZ expression vector between its Kpnl and EcoRl
restriction sites by introducing Kpnl and EcoRl sites into the 5' and 3' ends,
respectively. (see, SEQ ID. NO. 5). This was accomplished by using the "sense"
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
-68-
PCR primer 5'-GGT ACC GCC ACC ATG GGA TGG AGC TGG ATC T (SEQ ID.
NO. 21 )~ having a Kpnl .restriction-site, and the "antisense" primer 5'-GAA
TTC
ATG TAA CAC AGA GCA GGA (SEQ ID. NO. 22) having an EcoRl restriction
site, for PCR amplification of the portion of the DAV-1 heavy chain sequence
set
forth in SEQ ID. N0. 5, prior to cloning. The DAV-1 light chain (SEQ ID NO. 3)
was cloned into the Hindlll and Xbal sites of the pIZ expression vector by
introducing Hindlll and Xbal sites into the 5' and 3' ends of the light chain
encoding DNA (see SEQ ID. NO. 3). This was accomplished by using the
"sense" PCR primer 5'-AAG CTT GCC ACC ATG GAG ACA GAC ACA ATC CTG
CT (SEQ ID. NO: 23) having a Hindlll restriction site, and the "antisense"
primer
5'-TCT AGA TGT CTC TAA CAC TCA TTC CTG T (SEQ ID. NO. 24) having an
Xbal restriction site, for PCR amplification of the DAV-1 light chain sequence
set
forth SEQ ID. NO. 3, prior to cloning. The resulting vectors were designated
as
pIZ-y, pIZ-K for heavy chain and light chain constructs, respectively.
Fab'2 forms of the DAV-1 antibody were also PCR amplified by creating a
C-terminal deletion in the DAV-1 y-heavy chain at amino acid position 247
(see,
SEQ tD No. 1 ), and were cloned between the Kpni and EcoRt sites of the pIZ
vector using the "sense" primer sequence set forth in SEQ ID. NO. 21 (having a
Kpnl restriction site), and the "antisense" primer 5'-GAA TTC TGA TAC TTC
TGG GAC TGT (SEQ ID. NO. 25 with an an EcoRl restriction site).
B. Cloning of the Bifunctional Signaling Antibodies
DNA encoding full length mature human TNF-a, IGF-1, EGF and SCF
peptides were obtained by PCR amplification of: cDNA obtained from ATCC
(Rockville, Md) encoding human TNF-a; RT-PCR of total RNA isolated from U937
cells for human 1GF-1; cDNA obtained from Invitrogen, Carlsbad, CA for SCF;
and a synthetic template prepared by annealing two oligonucleotides having an
18 by overlap (SEQ ID NOS. 30 and 31 ) for EGF. For construction of the fusion
proteins, DNA sequences encoding the full length mature human TNF-a, IGF-1
and EGF peptides (peptide sequences set forth in SEQ 1D. NOS. 7, 8 and 9
respectively) were ligated in frame into the EcoRl site in p1Z-Y downstream
(3'-
end) of the DAV-1 heavy chain portion (SEQ 1D. NO. 5) used to prepare the .
fusion proteins.
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
-69-
To facilitate cloning of the full Length mature peptides into the pIZ-y
vector at..the EcoRl site 3' to the DAV-1 .heavy chain sequence, EcoRl sites
were
introduced at the 5' and 3'-ends of the nucleic acid encoding each of the full
length mature peptides TNF-a, IGF-1 and EGF by PCR amplification using the
following primers: For amplification of TNF-a, "sense" primer 5'-GAA TTC GTC
AGA TCA TCT TCT CGA AC fSEQ ID. NO. 26) and "antisense" primer 5'-GAA
TTC TAC AGG GCA ATG ATC CCA AA (SEQ ID. NO. 27); for amplification of
IGF-1, "sense" primer 5'-GAA TTC GGA CCG GAG ACG CTC TGC GG (SEQ ID.
N0. 28) and "antisense" primer 5'-GAA TTC TAA GCT GAC TTG GCA GGC TT .
(SEQ ID. NO. 29); for amplification of EGF, "sense" primer 5'-GAA TTC AAT
AGT GAC TCT GAA TGT CCC CTG TCC CAC GAT GGG TAC TGC CTC CAT
GAT GGT GTG TGC
ATG TAT ATT GAA GCA TTG GAC AAG TAT GCA (SEQ ID. NO. 30) and
"antisense" primer 5'-GAA TTC TAG CGC AGT TCC CAC CAC TTC AGG TCT
'! 5 CGG TAC TGA CAT CGC TCC CCG ATG TAG CCA ACA ACA CAG TTG CAT
GCA TAC TTG TCC AAT GCT TC (SEQ ID. NO. 31 ). The orientation of the
fusion proteins was determined by PCR analysis. All sequences were confirmed
using automated DNA sequencing.
The fusion proteins contain the portion of the DAV-1 heavy chain
sequence set forth in SEQ ID. N0. 6, followed by a two amino acid "linker"
sequence generated by the EcoRl site between the DAV-1 and growth factor
sequences (see amino acids 439 (Glu) and 440 (Phe) in SEQ ID NOS. 11, 12 and
13), followed in-frame by the full length, mature growth factor peptide.
Sequences of fusion proteins of DAV-1 heavy chain with TNF-or, IGF-1 and EGF
are set forth in SEQ ID. NOS. 11, 12 and 13, respectively.
For construction of the fusion protein of DAV-1 heavy chain with SCF,
the DNA sequence encoding the full length mature SCF peptide (peptide
. sequence set forth in SEQ ID. NO. 10) was ligated in frame between the Notl
and Xbal sites of the pIZ-y vector, downstream (3'-end) of the DAV-1 heavy
chain portion (SEQ ID. NO. 5) used to prepare the fusion protein. To
facilitate
cloning of the full length mature SCF peptide into the pIZ-y vector at the
Notl
and Xbal sites 3' to the DAV-1 heavy chain sequence, Notl and Xbal sites were
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
-70-
introduced at the 5' and 3'-ends of the SCF sequence encoding the full length
mature peptide: by PCR amplification using the following primers: "sense"
primer
5'-GCG GCC GCA AGG GAT CTG CAG GAA TCG (SEQ ID. NO. 321 and
"antisense" primer 5'-TCT AGA GTG CAA CAG GGG GTA ACA TA (SEQ ID.
NO. 33). Generation of the Notl site at the 5'-end~of the full length SCF-
encoding nucleic acid resulted in change of the first amino acid from glutamic
acid (Glu) in the wildtype sequence (see first amino acid of SEQ ID. N0> 10)
to
glutamine (Gln) in the fusion protein (see amino acid 450 in SEQ 1D. NO. 14).
The resulting fusion construct includes the portion of the DAV-1 heavy chain
peptide sequerice set forth in SEQ ID. NO. 6, followed by 1 1 amino acids of
"linker" sequence (amino acids 439 to 449 in SEQ ID. NO. 14), followed by the
SCF mature peptide. The sequence of the resulting fusion protein is set forth
in
SEQ ID. NO. 14: '
Similar cloning strategies were employed. to generate growth factors such
as TNF-a, IGF-1, EGF and SCF fused to the 3'-end of the Fab'2 forms of the
DAV-1 antibody.
C. Generation of secreted bifunctional antibody fusion proteins
The DAV-1 heavy chain-TNF, heavy chain-IGF-1 or heavy chain-EGF
expression vector and the DAV-1 light chain expression vector were co-
transfected into SF9 insect cells. The SF9 insect cells (Invitrogen) were
transfected with a total of 3 Ng plasmid DNA comprising the heavy chain-growth
factor / cytokine fusion and light chain vectors using 15 NI Superfect
(Qiagen) in
200,u1 DMEM (serum-free) at room temperature for 15 minutes and then added
to fresh cultures of SF9 cell monolayers (about 90% confluency). Transfected
cells were then subjected to Zeocin selection (600 Ng/ml) for the production
of
bifunctional molecules using a penton base ELISA assay. A pool of positive
Zeocin-resistant cells was then selected for the production of fusion
proteins.
. D. Purification and functional analysis of bifunctional molecules
.Supernatants from transfected SF9 cells were assayed for bifunetional
, antibody production by an ELISA assay using immobilized penton base as
previously described (Mathias et al., J. Virol., 72(11 ): 8669 (19981) and as
described in this Example. Recombinant Ad2 penton base was produced in
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
-71-
Trichoplusia Tn 5B1-4 insect cells (Wickham~eta/., Biotech. Prog., 8:391-396
(1992)~) 'using the baculovirus vector~pBIueBac (Invitrogen, Carlsbad, CA).
The
recombinant Ad2 penton base was used to coat a 96-well plastic tissue culture
plate (Immulon-4, Dynatech) at a concentration of 1 Ng protein/well. Non-
specific binding sites were quenched by incubation with a blocking agent
(Superblock; Pierce), and then the SF9 cell culture supernatants were added to
the plates and incubated at 22 °C for 1 h. Bound antibody was detected
with
HRP conjugated rabbit anti-mouse antibody (whole molecule). Culture
supernatants that tested positive for the bifunctional antibody were passed
through a Protein L (Actigen, Cambridge, UK) affinity column. Bound antibody
was eluted with either 50 mM diethylamine (pH9.7) or 0.1 M citrate-0.15 M
NaCI (pH 3.0), and pooled fractions were dialyzed against PBS ( 10 mM sodium
phospate, .150 nM NaCI, pH 7.2). .The purified fusion proteins were further
characterized by SDS-PAGE and western blot.
The cytotoxic activity of the DT bifunctional monoclonal antibodies (DAV-
1-TNFa bifunctional antibody) resulting from its interaction with TNF-a
receptors
was assayed using the TNF-sensitive MCF-7 cell line as previously described
(Xiang et al., J. Biotech., 53: 3 (1997).
SF9 cell supernatants or the purified bifunctional proteins were separated
on 12% SDS-PAGE. gels and either stained with Coomassie blue or transferred to
PVDF membrane filters (Amersham) and probed with rabbit anti-mouse (Sigma,
St. Louis, MO) or goat anti- human TNF-a (Chemicon, Temecula, CA) antibodies
followed by secondary antibodies conjugated to horseradish peroxidase (Sigma,
St. Louis,.MO) and detection with a chemiluminescence reagent (Supersignal,
Pierce, Rockford, IL). Western blot analyses showed that the DAV-1 monoclonal
antibody (D molecule) and the DAV-1-TNFa bifunctional antibody (DT molecule)
were both recognized by an anti-mouse IgG antibody, while only the DT
molecule was recognized by an anti-TNFa polyclonal antibody.
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
-7 2-
E7(AMPLE 3
Gene-delivery vectors and complexi~g with bifunctional molecules
A. Adenovirus propagation
Cell lines that are commonly used for growing adenovirus are useful as
host cells for the preparation of adenovirus packaging cell lines. Preferred
cells
include 293 cells, an adenovirus-transformed human embryonic kidney cell line
obtained from the ATCC, having Accession Number CRL 1573; HeLa, a human
epithelial carcinoma cell line (ATCC Accession Number CCL-2); A549, a human
lung carcinoma cell line (ATCC Accession Number CCL 1889); and other
epithelial-derived cell lines. As a result of the adenovirus transformation,
the
293 cells contain the E1 early region regulatory gene. All cells were
maintained
in complete DMEM + 10% fetal calf serum unless otherwise noted.
These cell lines allow the production and propagation of adenovirus-based
gene delivery vectors that have deletions in preselected gene regions and that
7 5 are obtained by cellular complementation of adenoviral genes. Such units
include but are not limited to E1 early region, E4 and the viral fiber gene.
Adenovirus type 2 (Ad2, ATCC) was propagated in A549 (ATCC # CCL
185) epithelial cells and purified as previously described (Wickham et al.,
Cell,
73: 309 (1993)) and as described in this Example. Cells were infected with Ad2
at a multiplicity of infection (M01) of 10 and then harvested 2-3 days later.
Cells
were frozen and thawed five times to release intracellular particles, and then
the
cell debris was removed by centrifugation. The cell lysate was subjected to
density gradient-ultracentrifugation on 25%-40% cesium chloride gradients, and
the virus. band was removed and dialyzed against 40 mM Tris-HCI-buffered
saline, pH 8.1, containing 10% glycerol.
B. Adenovirus gene delivery vectors
Adenoviral vectors for delivery of genes, such as therapeutic genes, and
methods for their construction and propagation are well known and readily
available (see, e.g., co-pending U.S. application Serial No. 09/482,f82;
International PCT application No. PCT/US00/00265, and U.S. application Serial
No. 09/562,934). Other delivery vectors may be used. A variety of Ad delivery
vectors are known and available.
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
-73-
In general, exemplary fiber-expressing and fiberless recombinant
adenovirus~ vectors. have been described .(Von Seggern et al., J. Virol., 73:
1601
(1999); copending U.S. application Serial No. 09/482,682 filed January 14,
2000, and also International PCT application No. PCTlUS00100265, filed
January 14, 2000)). Construction of Ad5.~3gal.wt and Ad5.~3gaL~F (deposited
on January 15, 1999, the ATCC under accession number VR2636) is described
therein. Ad2 or Ad5 vectors using the RSV LTR in place of the SV40 promoter
can be constructed in a manner analogous to the similar Ad5-based vectors
described in the above-noted applications. Such vectors were used in the
experiments in the Examples herein. As described therein, gutted Ad
vectors are those from which most or all viral genes have been deleted. They
are grown by co-infection of the producing cells with a "helper" virus (using
an
E1-deleted Ad vector). The helper virus traps-complements the missing Ad
functions, including production of the viral structural proteins needed for
particle
assembly. The helper virus can be a fiber-deleted Ad (such as that described
in
Von Seggern et al., J. Virol. 73:1601-1608 (1999)). The vector is prepared in
a
fiber expressing cell line (see, e.g., Von Seggern et al. (1998) J. Gen.
Virol.
79:1461-1468; Von Seggern et al. (2000) , J. Virol. 74:354-362). All the
necessary Ad proteins except fiber are provided by the fiber-deleted helper
virus,
and the particles are equipped with the particular fiber expressed by the host
cells. '
A helper adenovirus vector genome and a gutless adenoviral vector
genome are delivered to a packaging cell line (see, e.g., International PCT
application No. PCTlUS00100265, filed January 14, 2000). The cells are
maintained under standard cell maintenance or growth conditions, whereby the
helper vector genome and the packaging cell together provide the
complementing proteins for the packaging of the adenoviral vector particle.
Such gutless adenoviral vector particles are recovered by standard techniques.
The helper vector genome may be delivered in the -form of a plasmid or similar
construct by standard transfection techniques, or it may ~be delivered through
infection by a viral particle containing the genome. Such viral particle is
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
-74-
commonly called a helper virus. Similarly, the gutless adenoviral vector
genome
may be~delivered to .the cell by transfection or viral infection.
The helper virus genome is preferably a fiberless adenovirus vector
genome. Preferably, such genome also lacks the genes encoding the adenovirus
E1A and EiB proteins. More preferably, the genome further lacks the
adenovirus genes encoding the adenovirus E3 proteins. Alternatively, the genes
encoding such proteins may be present but mutated so that they do not encode
functional E 1 A, E 1 B and E3 proteins. Furthermore, such vector genome may
not
encode other functional early proteins, such as E2A, E2B, and E4 proteins.
Alternatively, the genes encoding such other early proteins may be present but
mutated so that they do not encode functional proteins.
The packaging cell also provides proteins necessary for the
complementation of the gutless vector so that an adenovirus particle
containing
the gutless vector genome may be produced. Thus, the packaging cell line can
provide wild-type or modified fiber protein. Alternatively, the cell tine
could
package a fiberless particle, which could be used by itself or to which .
exogenously provided fiber could be added.
In producing gutless vectors, the helper virus genome is also packaged,
thereby producing helper virus. Iri order the minimize the amount of helper
virus
produced and maximize the amount of gutless vector particles produced, it is
preferable to delete or otherwise modify the packaging sequence in the helper
virus genome, so that packaging of the genome is prevented or limited. Since
the gutless vector genome will have a packaging sequence, it will be
preferentially packaged.
One way to do this is to mutate the packaging sequence by deleting one or more
of the nucleotides comprising the sequence or otherwise mutating the sequence
to inactivate or hamper the packaging function. An alternative approach is to
engineer the helper genome so that recombinase target sites flank the
packaging
sequence and to provide a recombinase in the packaging cell. The action of
recombinase on such sites results in the removal of the packaging sequence
from the helper virus genome. Preferably, the recombinase is provided by a
nucleotide sequence in the packaging cell that encodes the recombinase. Most
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
-75-
preferably, such sequence is stably integrated into the genome of the
packaging
cell. Various kinds of recombinase 'are knovvn by those skilled in the art.
The
preferred recombinase is Cre recombinase, which operates on so-called lox
sites,
which are engineered on either side of the packaging sequence as discussed
above. Further information about the use of Cre-IoxP recombination is found in
U.S. Pat. No. 5,919,676 and Morsy and Caskey, Molecular Medicine Today,
Jan. 1999, pgs. 18-24.
As the gutless vectors lack many or all Ad genes, they must be grown as
mixed cultures in the presence of a helper virus which can provide the missing
functions. To date, such helper viruses have provided all Ad functions except
E1, and E1 is complemented by growth in 293 cells or the equivalent. The
resulting virus particles are harvested, and the helper virus is typically
removed
by CsCI gradient centrifugation. (the vector chromosome is generally shorter
than
the helper chromosome, resulting in a difference in buoyant density between
the
two particles).
An example of a gutless gene delivery vector is pAd~RSVDys (Haecker et
al. (1996) Human Gene Therapy 7:1907-1914). This plasmid contains a full-
length human dystrophin cDNA driven by the RSV promoter and flanked by Ad
inverted terminal repeats and packaging signals. Desired therapeutic proteins
and other products intended for delivery to cells can be readily substituted
for
the dystrophin gene in this vector.
293 cells are infected with a first-generation Ad which serves as a helper
virus, and then transfected with purified vector DNA. The helper Ad genome
and the delivery vector DNA are replicated as Ad chromosomes, and packaged
into particles using the viral proteins produced by the helper virus.
Particles are
isolated and the delivery vector-containing particles separated from the
helper by
virtue of their smaller genome size and therefore different density on CsCI
gradients.
The vector is grown in either 633 or 705 cells and AdS.~gaLAF is used
as a helper virus; both helper and the delivery vector genomes replicate and
are
packaged into particles. The provides all the essential Ad proteins except
fiber,
and the fiber protein is that produced by the cells (Ad5 fiber in 633 cells
and
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
-76-
Ad37 fiber in the case of 705 cells). The packaged viral particles are then
isolated ~~by centrifugation.
For experiments exemplified herein, the following first generation
recombinant virus and its fiberless derivative were used. The first-generation
Ad2 virus Ad.RSV.~3-gal is an E-1 and E-3 deleted, replication-defective,
recombinant vector containing a Rous Sarcoma virus regulatory sequence -
driven LacZ reporter gene (Stratford-Perricaudet et al., J. Clin. Invest.,
90:626
(1992)).
First, a recombinant plasmid pAd.RSV,B-gal was constructed, in which the
LacZ gene with the SV40 early region polyadenylation signal driven by the Rous
Sarcoma virus long terminal repeat (RSV-LTR) is inserted downstream of the 1.3
map units (mu) from the left end of the adenovirus type 5 (Ad5) genome in
place
of E1 a and E1 b (mu 1.3-9.4). The reporter gene is followed by mu 9.4-17 of
Ad5 to allow homologous recombination with the adenoviral genome for the
generation of the recombinant adenovirus. The recombinant adenovirus was
constructed by in vivo homologous recombination between plasmid pAd.RSV~-
gal and Ad5 d1327, an E-3 deletion mutant of Ad5 (Trousdale, M.D. et al.,
Cornea, 14:280 (1995)).
Briefly, cells were cotransfected with 5 Ng of linearized pAd.RSV~-gal and
5 dug of the 2.6 - 100 mu fragment of Ad5 DNA. After overlaying with agar and
incubation for 10 days at 37 °C, plaques containing recombinant
adenovirus
were picked and screened for nuclear ~B-galactosidase activity. The Ad.RSV~-
gaI/dF vector is identical to the first-generation virus with the exception of
a
fiber deletion to generate fiberless virions.
' As noted, these and other exemplary fiber-expressing and fiberless
recombinant adenovirus vectors have been described (Von Seggern et al., J.
Virol., 73: 1601 (1999); copending U.S. application Serial No. 09/482,682
filed
January 14, 2000, and also International PCT application No. PCT/US00/00265,
filed January 14, 2000)).
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
_77_
C. Complexing of adenovirus delivery vector particles with bifunctional
molecules
Complexation of the recombinant adenovirus vectors with the bifunctional
molecules was accomplished as follows: The E1 deleted adenovirus vector
encoding LaeZ, under control of the RSV LTR, in place of E1 (Ad.RSV.~3-gal
vector described above), was incubated with DAV-TNF (DT molecules) or control
DAV (D molecules) antibodies at a ratio of 2 antibody molecules per RGD motif
of adenovirus at room temperature for 30 minutes in either EXEL-400 medium
(JRH Bioscience, Lenexa, iCS) or Dulbecco modified Eagle's medium (DMEM)
(Gibco-BRL).
EXAMPLE 4
Adenovirus, gene express, cell binding and internalization assays
A. Gene delivery and expression assay
The complex of Example 3C was then mixed with M21-L12 human
melanoma cells, which are deficient in a"/33.and a"/35 integrin (Wickham et
al.,
Cell, 73: 309 (1993)), on ice for 60 min. Unbound virus was removed by
washing with ice-cold PBS, and the cells were warmed to 37°C for
varying
times and then plated in tissue culture plates. Ad-mediated gene transfer was
examined 24 or 48 hours post infection by staining for ~3-galactosidase
activity
as previously described, by incubating the cells for 60 min at 37 °C
with 3.5
mM o-nitrophenyl,B-D-galactopyranoside (ONPG) as a chromagenic substrate and
in buffer containing 0.5% Nonidet P-40 (Li et al., J. Virol., 72: 2055 (1998);
Huang et al., J. Virol., 70: 4502 (1996)).
B. Binding assay
To measure adenovirus binding to cells, 500 Ng aliquots of adenovirus
vector was labeled with '251 by incubation with lodogen (Pierce) in an lodogen-
coated tube containing 1 mCi of Na'251. Iodinated proteins were separated from
free '251 by gel filtration as described (Huang et al. (1999) J. Virol.
73:2798-
2802). Binding of radiolabeled adenovirus on M21-L12 cells was then
quantitated as described earlier (Huang et al. (1999) J. Virol. 73:2798-2802),
and as described in this Example. 106 cells in suspension were incubated with
106 cpm (viral particles were generally labeled to a specific activity of 5 x
10g to
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
_78-
8 x 106 cpm/Ng) of the labeled virus proteins at 4 °C for 2 h. Non-
specific
binding ~was-deterrriined by incubating cells and labeled proteins in the
presence
of a 100-fold excess of unlabeled virus or fiber protein. After the cells were
washed four times in ice-cold phosphate buffered saline, specific binding was
calculated by subtracting the non-specific binding from the total bound cpm.
C. Internalization assay
To measure virus endocytosis; cells were incubated with complexed ~251-
labeled adenovirus and DAV-TNF or control antibodies, in DMEM supplemented
with 0.5% purified bovine serum albumin (BSA) at 4°C for 60 minutes.
After
removal of non-bound virus by washing with ice-cold PBS, the cells were
warmed to 37°C for varying times. Uninternalized virions were removed
by
incubation with trypsin-EDTA at room temperature for 5 min. prior to counting
the cell pellets.
EXAMPLE 5
Adenovirus complexed with bifunctional molecules targeted to receptors
that promote internalization of ligands by PI3K activation are internalized
via
binding to the targeted receptors.
Analysis of bifunctional signaling antibodies.
DAV-1 bifunctional signaling antibodies, designated DT (DAV-1 fused to
TNF-a), DI iDAV-1 fused to IGF-1 ), and DE (DAV-1 fused to EGF), were
expressed in insect cells as secreted proteins and purified on Protein L
affinity
columns. The DT heavy chain (D~"T) had an apparent molecular weight of
approximately 70kDa, consistent with the combined sizes of the DAV-1 y heavy
chain (53 kDa) and monomeric TNF-a ligand (17 kDA). The apparent molecular
weight of the K light chains of DAV-1 (D~) was identical to that of the
recombinant DT molecule (approx. 25 kDa). Western blot analyses showed that
the DAV-1 mAb (D) and the DT molecules were recognized by an anti-mouse IgG
antibody, while only the DT molecule was recognized by an anti-TNF-a
polyclonal antibody.
, DT molecules were capable of binding to immobilized penton base or Ad
particles in an ELISA and elicited cytotoxicity against a TNF-a sensitive cell
line,
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
_79_
MCF-7, indicating that the DT bifunctional molecule retains virus and cytokine
receptor binding functions.
Bifunctional molecules promote Ad-mediated gene delivery to av integrins
A first generation adenovirus vector containing a RSV-driven LacZ
reporter gene with DT was preincubated at a ratio of 2 antibody molecules per
RGD motif. This complex was then added to M21-L12 human melanoma cells,
which do not express av integrins (Felding-Habermann et al. (1992)
J.Clin.invest. 89:2018-2022), but can support efficient virus binding (Wickham
et al. (1993) Cell 73:309-319). Ad complexed with DT but not D alone,
significantly increases Ad-mediated gene delivery to M21-L12 cells as measured
by transgene expression at 48 hrs post-infection. Approximately 60% of cells
incubated with Ad plus DT stained positive for /3-galactosidase, compared to
less
than 3°l0 of cells that 'had been incubated with virus alone or virus
plus D. The
increase in gene delivery by DT was not due to increased activation of the RSV
LTR transgene promoter as a consequence of ligation of the TNF receptor, since
M21-L12' cells that had been infected with adenovirus alone for three hours
followed by addition of DT showed very little increase in gene delivery at 48
hours post-infection. This result indicates that bifunctional molecules
increase
adenovirus-mediated gene delivery by enhancing one or more steps associated
with cell entry. .
DT molecules enhance Ad binding and internalization.
The following experiments~showed that DT enhancement of gene delivery
was associated with increased virus attachment to M21-L12 cells. '251-labeled
Ad particles alone or complexed with D or DT molecules were analyzed for
binding to M21-L12 cells. Binding of '251-Ad complexed with DT molecules was
also examined in the absence or presence of an excess of recombinant Ad5 fiber
protein, a polyclonal anti-human TNF-a antibody or a combination of the TNF-a
antibody and fiber protein prior to addition to M21-L12 cells. '251-labeled Ad
was
incubated with DT or D molecules prior to addition to M21-L12 cells and
incubation on ice for 60 min. Unbound Ad was removed by washing and the
cells were warmed to 37 °C for varying times to allow virus
internalization as
measured by resistance to trypsinization. The results of these experiments
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
-80-
showed that pre-incubation of 'zsl-labeled Ad particles with DT but not with D
molecules iricreased~ virus binding approximately 5-fold.
To investigate the molecules responsible for increased binding,
competition experiments were performed. Ad-DT binding to cells was measured
in the presence of a 50-fold excess of recombinant fiber protein or anti-TNF-a
or
a combination of these molecules. Either recombinant fiber or anti-TNF-a
antibody alone was capable of blocking only 20-25% of Ad-DT binding to cells.
In contrast, approximately 70% of binding could be inhibited by a combination
of
fiber and anti-TNF-a. These findings indicate that Ad-DT binding to cells is
mediated by CAR-fiber internalization as well as TNF-a-receptor association.
DT molecules potentiate internalization of 'zsl-labeled virus particles as
measured
by resistance to trypsin digestion.
As demonstrated. in earlier studies (Wickham et al. (1993) Cell 73:309-
319), because M21-L12 cells do not express av integrins, relatively low levels
of
adenovirus internalization by these cells occurs. DT molecules significantly
increased the rate and extent of adenovirus internalization into these cells.
These
findings indicate that DT molecules enhance gene delivery by promoting virus
binding as well as virus internalization.
DT enhancement of gene delivery is associated with PI3K activation.
Efficient Ad internalization via av integrins requires activation of PI3K, a
key cellular signaling molecule. Experiments demonstrating that DT
enhancement of gene delivery is mediated by PI3-kinase were performed. In
these experiments, to show that DT enhancement of gene delivery also involves
P13K, M21-L12 melanoma cells were pretreated with the PI3K inhibitors
wortmannin (30 nM) or LY292004 (20 ~M) for 30 min prior to the addition of
Ad.RSV:~3gal complexed with D or DT molecules. Ad mediated gene delivery
was analyzed 48 hours post infection. The results show that wortmannin and
LY294002 inhibited Ad-mediated gene delivery by approximately 70% and 50%,
respectively, indicating that PI3K activity plays a major role in DT
enhancement
or gene delivery. .
For further demonstration of the role of PI3K-dependent signaling in
enhanced gene delivery, Ad-mediated gene delivery by other bifunctional
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
-81-
molecules whose cytokinelgrowth factor domains are known to activate PI3K
was-measured.~ Bifunctional molecules that target PI3K signaling pathways (DT
= DAV-1-TNF; DE = DAV1-EGF; DI = DAV-1-IGF-1) also enhance Ad-mediated
gene delivery to M21-L12 cells. DT, DE and DI molecules enhanced gene
delivery by approximately 30, 10 and 5 fold .respectively. Enhanced gene
delivery by these molecules was also inhibited by pretreatment of cells with
wortmannin. These findings further demonstrate that PI3K activation promotes
Ad gene delivery.
EXAMPLE 6
DEMONSTRATION OF TARGETED DELIVERY VIA GROWTH FACTOR
RECEPTORS
Bifunctional molecules allow gene delivery by fiberless adenovirus
particles
Fiberless adenovirus vector that cannot bind to CAR have been
constructed (see Example 3 and also; e.g., copending U.S. application
Serial.No.
09/482,682 and U,S. application Serial No. 09/562,934; see, also Von Seggern
et al. ( 1999) J. Virol. 73:1601-1608). The structure of these particles is
nearly
identical to that of wildtype virions. Fiberless particles alone showed almost
no
transgene delivery to SW480 epithelial cells, even though these cells express
CAR and integrin av~5 (Von Seggern et al. (1999) J.Virol. 73:1601-1608). To
show that bifurictional molecules promote gene delivery by a fiberless Ad
vector,
CAR and av integrin-expressing SW480 cells were infected with a fiberless
adenovirus or fiberless virus complexed with DT molecules at. a ratio of 1
antibody molecule per viral particle. The reporter gene expression was
examined
by ~-gal staining 48 hours post infection. The fiberless virus was incubated
with
bifunctional molecules before incubation with SW480 cells.at 37 ° for
15 min.
Ad-mediated gene delivery was examined 48 post infection.
The results demonstrated that DT molecules enhanced gene delivery of
fiberless viruses. Fiberless particles complexed with DT or DI molecules
exhibited increased gene delivery approximately 10-15, 3 and 5 fold,
respectively, compared to the uncomplexed fiberless particles. These findings
indicate that fiberless particles can be retargeted to cells via signal
transducing
antibodies.
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
-82-
Since modifications will be apparent to those of skill in this art, it is
intendedwthat this invention be limited only by the scope of the appended
claims.
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
SEQUENCE LISTING
<110> Nemerow, R.
Glen et
al.
<120> BIFUNCTIONAL MOLECULES ECTORS OMPLEXED THEREWITH
FOR TARGETED
AND C
V
GENEDELIVERY
<130> 22908-1228
<140> Unassigned
<141> 2000-07-10
<160> 33
<170> FastSEQ r 0
fo Windows
Version
4.
<210> 1
<211> 1516
<212> DNA
<213> Mouse
<220>
<221> CDS
<222> (28)...(1395)
<223> DAV-1heavy penton base antibody
chain, monoclonal
<400> 1
cagacactga g t 54
acacactgac gga ctc
tctaacc tgg ttc
at agc
tgg
atc
tt
Met
Gly
Trp
Ser
Trp
Ile
Phe
Leu
Phe
1 5
ctc ctg gga actgcaggc gtc~c~ctct gaggtccag cttcagcag 102
tca
Leu Leu Gly ThrAlaGly ValHisSer GluValGln LeuGlnGln
Ser
15 ~ 20 25
tca gga gag ctggtgaaa cctggggcc tcagtgaag atatcctgc 150
cct
Ser Gly Glu LeuValLys ProGlyAla SerValLys IleSerCys
Pro
30 35 40
aag get gga tacacattc actgactac aacatgcac tgggtgaag 198
tct
Lys Ala Gly TyrThrPhe.ThrAspTyr AsnMetHis TrpValLys
Ser
45 50 55
cag agc gga aagagcctt gagtggatt ggatatatt tatccttac 246
cat
Gln Ser Gly LysSerLeu GluTrpIle GlyTyrIle TyrProTyr
His ~ ~
60 6S 70
aaa ggt act ggctacaac cagaagttc aagagcaag gccacattg 294
ggt
Lys Gly Thr GlyTyrAsn GlnLysPhe LysSerLys AlaThrLeu
Gly
75 80 85
aca aca agt tcctccaac acagcctac atggagctc cgcagcctg 342
gac
Thr Thr Ser SerSerAsn TlirAlaTyr MetGluLeu ArgSerLeu
Asp
90 95 100 105
aca tct gcc tctgcagtc tattactgt gcaagaggg attgettac ~ 390
gat
Thr Ser Ala SerAlaVal TyrTyr~Cys AlaArgGly IleAlaTyr
Asp
110 115 120
tgg ggc ggg actctggtc actgtctct gcagccaaa acgacaccc 438
caa
Trp Gly Gly ThrLeuVal ThrValSer AlaAlaLys ThrThrPro
Gln
125 130 135
cca tct tat ccactggcc cctggatct getgcccaa actaactcc 486
gtc
Pro Ser Tyr ProLeuAla ProGlySer AlaAlaGln ThrAsnSer
Val
140 145 ~ 150
1
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
atg gtgacc ctgggatgc ctggtcaag ggctatttc cctgagcca gtg 534
Met ValThr LeuGlyCys LeuValLys GlyTyrPhe ProGluPro Val
155 . 160 165
aca gtgacc tggaactct ggatccctg tccagcggt gtgcacacc ttc 582
Thr ValThr TrpAsnSer GlySerLeu SerSerGly ValHisThr Phe
170 . 175 180 185
cca getgtc .ctgeagtct gacctctac actctgage agctcagtg act 630
Pro AlaVal Len-Gln.SerAspLeuTyr 'ThrLeuSer SerSerVal Thr
190 195 200
gtc ccctcc agcacctgg cccagcgag accgtcacc tgcaacgtt gcc 678
Val ProSer SerThrTrp ProSerGlu ThrValThr CysAsnVal Ala
205 210 215
cac ccggcc agcagcacc aaggtggac aagaaaatt gtgcccagg gat 726
His ProAla SerSerThr LysValAsp LysLysIle ValProArg Asp
220 225 230
tgt ggttgt aagccttgc atatgtaca gtcccagaa gtatcatct gtc 765
Cys GlyCys LysProCys IleCysThr ValProGlu ValSerSer Val
235 240 245
ttc atcttc cccccaaag cccaaggat gtgctcacc attactctg act 822
Phe IlePhe ProProLys ProLysAsp ValLeuThr IleThrLeu Thr
250 25S 260 265
cct aaggtc acgtgtgtt gtggtagac atcagcaag gatgatccc gag 870
Pro LysVal ThrCysVaI ValValAsp IIeSerLys AspAspPro Glu
270 ~ 275 280
~
gtc cagttc agctggttt gtagat.gatgtggaggtg cacacaget cag 918
Val GlnPhe SerTrpPhe ValAspAsp ValGluVal HisThrAla Gln
285 290 295
acg caaccc cgggaggag cagttcaac agcactttc cgctcagtc agt 966
Thr GlnPro ArgGluGlu GlnPheAsn SerThrPhe ArgSerVal Ser
300 305 310
gaa cttccc atcatgcac caggactgg ctcaatggc aaggagttc aaa 1014
Glu LeuPro IleMetHis GlnAspTrp LeuAsnGly LysGluPhe Lys
315 320 325
- agggtc aacagtgca getttccct gcccceatc gagaaaacc atc 1062
tgc
Cys ArgVal AsnSerAla AlaPhe-ProAlaProIle GluLysThr Ile
330 335 340 345
tceaaaaceaaa ggeagaccg aaggetcea caggtgtae aecattcea 1110
SerLysThrLys GlyArgPro LysAlaPro GlnValTyr ThrIlePro
350 355 360
cctcccaaggag cagatggcc aaggataaa gtcagtctg acctgcatg 1158
ProProLysGlu GlnMetAla LysAspLys ValSerLeu ThrCysMet
365 370 375
ataacagacttc ttccctgaa gacattact gtggagtgg cagtggaat 1206
IleThrRspPhe PheProGlu AspIleThr ValGluTrp GlnTrpAsn
380 ~ 385 390
gggcagccagcg gagaactac aagaacact cagcccatc atggacaca 1254
GlyGlnProAla GluAsnTyr LysAsnThr GlnProIle MetAspThr
395 400 405
gatggc~tcttac ttcgtctac agcaagctc aatgtgcag aagagcaac 1302
AspGlySerTyr PheValTyr SerLysLeu AsnValGln LysSerAsn
410 415 420 425
2
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
tgg gag gga aat act ttc tgc tct tta cat ggc ctg 1350
gca atc gtg gag
Trp Glu Gly Asn Thr:Phe Cys Ser Leu His Gly Leu
Ala Ile Val Glu
430 ~ 435 440
cac aac cat act gag aag ctc tcc tct cct aaa 1395
cac agc cac ggt
His Asn His Thr.Glu Lys.SerLeu Ser Ser Pro Lys
His His Gly
445 450 455
tgatcccagt ctacaggact~c.tgtcaccta 1455
gt.cct.tggag cctccacccc
ccctctggtc
tccctgtataaataaagcac ctagcactgccttgggaccctgcaataaaaaaaaaaaaaa1515
a 1516
<210>
2
<211>
456
<212>
PRT
<213>
Mouse
<220>
<221> PEPTIDE
<222> (0)...(0)
<223> DAV-1 heavy chain, penton base monoclonal antibody
<400> 2
Met Gly Trp Ser Trp Ile Phe Leu Phe Leu Leu Ser Gly Thr Ala Gly
1 5 10 15
Val His Ser Glu Val Gln Leu Gln Gln Ser Gly Pro Glu Leu Val Lys
20 25 30
Pro Gly Ala Ser Val Lys Ile Ser Cys Lys Ala Ser Gly Tyr Thr.Phe
35 40 45
Thr Asp Tyr Asn Met His Trp Val Lys Gln Ser His Gly Lys Ser Leu
50 ' S5 60
Glu Trp Ile Gly Tyr Ile.Tyr Pro Tyr Lys Gly Gly Thr Gly Tyr Asn
65 70 ~ 75 80
Gln Lys Phe Lys Ser Lys Ala Thr Leu Thr Thr Asp Ser Ser Ser Asn
85 90 95
Thr Ala Tyr Met Glu Leu Arg Ser Leu Thr Ser Asp Ala Ser Ala Val
100 105 110
Tyr Tyr Cys Ala Arg Gly Ile Ala Tyr Trp Gly Gln Gly Thr Leu Val
115 120 125
Thr Val Ser Ala Ala Lys Thr Thr Pro Pro Ser Val Tyr Pro Leu Ala
130 135 140
Pro Gly Ser Ala Ala Gln Thr Asn Ser Met Val Thr Leu Gly Cys Leu
145 150 155 160
Val Lys Gly Tyr Phe Pro Glu Pro Val Thr Val Thr Trp Asn Ser Gly
165 170 175
Ser Leu Ser Ser Gly Val His Thr Phe Pro Ala Val Leu Gln Ser Asp
280 185 190
Leu Tyr Thr Leu Ser Ser Ser Val Thr Val Pro Ser Ser Thr Trp Pro
195 200 205
Ser Glu Thr Val Thr Cys Asn Val Ala His Pro Ala Ser Ser Thr Lys
210 215 220
Val Asp Lys Lys Ile Val Pro Arg Asp Cys Gly Cys Lys Pro Cys Ile
225 230 235 240
Cys Thr Val Pro Glu Val Ser Ser Val Phe Ile Phe Pro Pro Lys Pro
245 250 255
Lys Asp Val Leu Thr Ile Thr Leu Thr Pro Lys Val Thr Cys Val Val
260 265 270
Val Asp Ile Ser Lys Asp Asp Pro Glu Val Gln Phe Ser Trp Phe Val
275 280 285
Asp Asp Val Glu Val His Thr Ala Gln Thr Gln Pro Arg Glu Glu Gln
290 295 300
Phe Asn Ser Thr Phe Arg Ser Val Ser Glu Leu Pro Ile Met His Gln
305 310 315 320
Asp Trp Leu Asn Gly Lys Glu Phe Lys Cys Arg Val Asn Ser Ala Ala
325 330 335
Phe Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Thr Lys Gly Arg Pro
3
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
340 345 350
Lys Ala Pro Gln Val Tyr Thr Ile Pro Pro Pro Lys Glu Gln Met Ala
355 : _ 360 365
Lys Asp Lys Val Ser Leu Thr Cys Met Ile Thr Asp Phe Phe Pro Glu
370 375 380
Asp Ile Thr Val Glu Trp Gln Trp Asn Gly Gln Pro Ala Glu Asn Tyr
385 390 395 400
Lys Asn Thr Gln Pro Ile Met Asp Thr Asp Gly Ser Tyr Phe Val Tyr
405 410 ~ 415
Ser Lys Len Asn.-Val.Gln Lys'Sex Asn Trp Glu Ala Gly Asn Thr Phe
420 425 430
Ile Cys Ser Val Leu His Glu Gly Leu His Asn His His Thr Glu Lys
435 ' 440 445
Ser Leu Ser His Ser Pro Gly Lys
450 455
<210> 3
<211> 831
<212> DNA
<213> Mouse
<220>
<221>
CDS
<222> 6)
(13)...(72
<223> light penton base antibody
DAV-1 chain, monoclonal
<400>
3
aagcttaccg 51
cc
atg
gag
aca
gac
aca
atc
ctg
cta
tgg
gtg
ctg
ctg
ctc
Met
Glu
Thr
Asp
Thr
Ile
Leu
Leu
Trp
Val
Leu
Leu
Leu
1 5 10
tgggtt ccaggc~tcc actggtgac attgtg ctgacccaatct ccaget 99
TrpVal ProGlySer ThrGlyAsp.IleVal LeuThrGlnSer ProAla
15 . 20 25
tctttg getgtgtct ctagggcag agggcc accatctcctgc aaggcc 147
SerLeu AlaValSer LeuGlyGln ArgAla ThrI1eSerCys LysAla
30 35 40 45
agccaa agtgttgat tatgatggt gatagt tatatgaactgg taccaa 195
SerGln SerValAsp TyrAspGly AspSer TyrMetAsnTrp TyrGln
50 55 60
cagaaa ccaggacag ccacccaaa ctcctc atctatgetgca tccaat 243
G1nLys ProGlyGln ProProLys LeuLeu IleTyrAlaAla SerAsn
65 70 75
ttagaa tctgggatc ccagccagg tt.tagt ggcagtgggtct gggaca 291
LeuGlu SerGlyIle ProAlaArg PheSer GlySerGlySer GlyThr
80 85 90
gacttc accctcaac atccatcct gtggag gaggaggatget gcaacc 339
AspPhe ThrLeuAsn IleHisPro ValGlu GluGluAspAla AlaThr
95 100 105
tattac tgtcagcaa actaatgag gatccg tggacgttcggt ggaggc 387
TyrTyr CysGlnGln ThrAsnGlu AspPro TrpThrPheGly GlyGly
110 115 120 125
accaag ctggaaatc aaacggget gatget gcaccaactgta tccatc 435
ThrLys LeuGluIle LysArgAla AspAla AlaProThrVal SerIle
130 135 140
ttccca ccatccagt gagcagtta acatct ggaggtgcctca gtcgtg 483
PhePro ProSerSer GluGlnLeu ThrSer GlyGlyAlaSer ValVal
145 150 155
4
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
tgcttcttgaac aacttc tacccc aaagacatc aat,gtcaag tggaag 531
CysPheLeuAsn AsnPhe TyrPro LysAspIle AsnValLys TrpLys
160 ' 165 170
attgatggcagt gaacga caaaat ggcgtcctg aacagttgg actgat 579
IleAspGlySer GluArg GlnAsn GlyValLeu AsnSerTrp ThrAsp
175 180 185
caggacagc.aaagacagc acctac agcatgagc agcaccctc acgttg 627
GlnAspSe-r.LysAsp:Ser ThrTyr SerMetSer .SerThrLeu ThrLeu
190 195 200 205
accaaggacgag tatgaa cgacat aacagctat acctgtgag gccact 675
ThrLysAspGlu TyrGlu ArgHis AsnSerTyr ThrCysGlu AlaThr
210 215 220
cacaagacatca acttca cccatt gtcaagagc ttcaacagg aatgag 723
HisLysThrSer ThrSer ProIle ValLysSer PheAsnArg AsnGlu
225 230 235
tgttagagacaaa ctccatccta 776
ggtcctgaga
cgccaccacc
agctccccag
Cys
tcttcccttc taaggtct.tg gaggcttcct cgagcggtaa agggcgaatt ccagc 831
<210> 4
<211> 238
<212> PRT
<213> Mouse
<220>
<221> PEPTIDE
<222> (0) . .. (0)
<223> DAV-1 light chain, penton base monoclonal antibody
<400> 4
Met Glu Thr Asp Thr Ile Leu Leu Trp Val Leu Leu Leu Trp Val Pro
1 5 10 15
Gly Ser Thr Gly 'Asp Ile Val Leu Thr Gln Ser Pro Ala Ser Leu Ala
20 25 30
Val Ser Leu Gly Gln Arg Ala Thr Ile Ser Cys Lys Ala Ser Gln Ser
35 40 45
Val Asp Tyr Asp Gly Asp Ser Tyr Met Asn Trp Tyr Gln Gln Lys Pro
. 50 55 60
Gly Gln Pro Pro Lys Leu Leu Ile Tyr Ala Ala Ser Asn Leu Glu Ser
65 70 75 80
Gly Ile Pro Ala Arg Phe Ser Gly Ser_Gly Ser Gly Thr Asp Phe Thr
85 90 95
Leu Asn Ile His Pro Val Glu Glu Glu Asp Ala Ala Thr Tyr Tyr Cys
100 105 110
Gln Gln Thr Asn Glu Asp Pro Trp Thr Phe Gly Gly Gly Thr Lys Leu
115 120 125
Glu Ile Lys Arg Ala Asp Ala Ala Pro Thr Val Ser Ile Phe Pro Pro
130 135 140
Ser Ser Glu Gln Leu Thr Ser Gly Gly Ala Ser Val Val Cys Phe Leu
145 150 155 160
Asn Asn Phe Tyr Pro Lys Asp Ile Asn Val Lys Trp Lys Ile Asp Gly
165 170 175
Ser Glu Arg Gln Asn Gly Val Leu Asn Ser Trp Thr Asp Gln Asp Ser
180 185 190
Lys Asp Ser Thr Tyr Ser Met Ser Ser Thr Leu Thr Leu Thr Lys Asp
195 200 205
Glu Tyr Glu Arg His Asn Ser Tyr Thr Cys Glu Ala Thr His Lys Thr
210 ~ 215 . 220
Ser Thr Ser Pro Ile Val Lys Ser Phe Asn Arg Asn Glu Cys
225 230 235
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
<210>
<211> 14
13
<212>
DNA
<213>
Mouse
<220>
<221>
CDS
<222> (1314)
(0)
.
..,
<223> .DAV-l~heavy forfusion
Portion chain protein
caf used
bifunc tional
antibody
<400>
5
atgggatgg agctgg.atcttt ctcttcctc ctgtca ggaactgca ggc 48
MetGlyTrp Ser.Trp IlePhe LeuPheLeu LeuSer GlyThrAla Gly
1 5 10 15
gtccactct gaggtc cagctt cagcagtca ggacct gagctggtg aaa 96
ValHisSer GluVal GlnLeu GlnGlnSer GlyPro GluLeuVal Lys
20 25 30
cctggggcc tcagtg aagata tcctgcaag gettct ggatacaca ttc 144
ProGlyAla SerVal LysIle SerCysLys AlaSer GlyTyrThr Phe
35 ~ 40 . 45
actgactac aacatg cactgg gtgaagcag agccat ggaaagagc ctt 192
ThrAspTyr AsnMet HisTrp ValLysGln SerHis GlyLysSer Leu
50 55 60
gagtggatt ggatat atttat ccttacaaa ggtggt actggctac ~aac 240
GluTrpIle GlyTyr I1eTyr ProTyrLys GlyGly ThrGlyTyr Asn
65 70 75 80
cagaagttc aagagc aaggcc aca'ttgaca acagac agttcctcc aac 288
GlnLysPhe LysSer LysAla ThrLeuThr ThrAsp SerSerSer Asn
85 90 95
acagcctac atggag ctccgc agcctgaca tctgat gcctctgca gtc 336
ThrAlaTyr MetGlu LeuArg SerLeuThr SerAsp AlaSerAla Val
100 105 110
tattactgt gcaaga gggatt gettactgg ggccaa gggactctg gtc 384
TyrTyrCys AlaArg GlyIle AlaTyrTrp GlyGln GlyThrLeu Val
115 120 125
actgtctct gcagcc aaaacg acaccccca tctgtc tatccactg gcc 432
ThrValSer AlaAla LysThr ThrProPro SerVal TyrProLeu Ala
130 135 140
cctggatct getgcc caaact aactccatg gtgacc ctgggatgc ctg 480
ProGlySer AlaAla GlnThr AsnSerMet ValThr LeuGlyCys Leu
145 150 155 160
gtcaagggc tatttc cctgag ccagtgaca gtgacc tggaactct gga 528
ValLysGly TyrPhe ProGlu ProValThr ValThr TrpAsnSer Gly
165 170 175
tccctgtcc agcggt gtgcac accttccca getgtc ctgcagtct gac 576
SerLeuSer SerGly ValHis ThrPhePro AlaVal LeuGlnSer Asp
180 I85 190
ctctacact ctgagc agctca gtgactgtc ccctcc agcacctgg ccc 624
LeuTyrThr LeuSer SerSer ValThrVal ProSer SerThrTrp Pro
195 200 205
agcgagacc gtcace tgcaac gttgcccac ccggcc agcagcacc aag 672
SerGluThr ValThr CysAsn ValAlaHis ProAla SerSerThr Lys
6
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
2.10 215 220
gtggacaag aaaatt gtgcccagg gattgt ggttgtaag ccttgc ata 20
?
ValAspLys LysIle ValProArg AspCys GlyCysISysProCys Ile
225 230 235 240
tgtacagtc ccagaa gtatcatct gtcttc atcttcccc ccaaag ccc 768
CysThrVal ProGlu ValSerSer ValPhe IlePhePro ProLys Pro
245 250 . 255
aaggatgtg -ctc~-acc~attactctg actcct aag-gtcacg tgtgtt gtg 816
LysAspVal LeuThr IleThrLeu ThrPro LysValThr CysVal Val
260 265 - 270
gtagacatc agcaag gatgatccc gaggtc cagttcagc tggttt gta 864
ValAspIle SerLys AspAspPro GluVal GlnPheSer TrpPhe Val
275 280 285
gatgatgtg gaggtg cacacaget cagacg caaccccgg gaggag cag 912
AspAspVal Glu.Va1 HisThrAla GlnThr GlnProArg GluGlu Gln
290 295 300
ttcaacagc actttc cgctcagtc agtgaa cttcccatc atgcac cag 960
PheAsn'SerThrPhe Arg'SerVal SerGlu LeuProIle MetHis Gln
305 _ 310 315 320
gactggctc aatggc aaggagttc aaatgc agggtcaac agtgca get 1008
AspTrpLeu AsnGly LysGluPhe LysCys ArgValAsn SerAla Ala
325 330 335
ttccctgcc cccatc gagaaaacc atctcc aaaaccaaa ggcaga ccg 1056
PheProAla Pro-Ile GluLysThr IleSer LysThrLys GlyArg Pro
340 . 345 350
aaggetcca caggtg tacaccatt ccacct cccaaggag cagatg gcc 1104
LysAlaPro GlnVal TyrThrIle ProPro ProLysGlu GlnMet Ala
355 360 365
aaggataaa gtcagt ctgacctgc atgata acagacttc ttccct gaa . 1152
LysAspLys ValSer LeuThrCys MetIle ThrAspPhe PhePro Glu
370 375 380
gacattact gtggag tggcagtgg aatggg cagccagcg gagaac tac 1200
AspIleThr ValGlu TrpGlnTrp AsnGly GlnProAla GluAsn Tyr
385 390 395 400
aagaacact cagccc atcatggac acagat ggctcttac ttcgtc tac 1248
LysAsnThr GlnPro IleMetAsp ThrAsp GlySerTyr PheVal Tyr
40 5 410 415
agcaagctc aatgtg cagaagagc aactgg gaggcagga aatact ttc 1296
SerLysLeu AsnVal GlnLysSer AsnTrp GluAlaGly AsnThr Phe
420 425 430
atctgctct gtgtta cat 1314
IleCysSer ValLeu His
435
<210> 6
<211> 438
<212> PRT
<213> Mouse
<220> .
<221> PEPTIDFs
<222> (0) . ..-(0)
7
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
<223> Portion of DAV-1 heavy chain used fox fusion protein
bifunctional antibody
<400> 6
Met Gly Trp Ser Trp Ile Phe Leu Phe Leu Leu Ser Gly Thr Ala Gly
1 . 5 10 15
Val His Ser Glu Val Gln Leu Gln Gln Ser Gly Pro Glu Leu Val Lys
20 25 30
Pro Gly Ala Ser Val Lys Ile Ser Cys.Lys Ala Ser Gly Tyr Thr Phe
35 .. .... . : ~ . . 4p - . . ~ . 45
Thr Asp Tyr Asn Met His Trp Val Lys Gln Ser His Gly Lys Ser Leu
50 55 60
Glu Trp Ile Gly Tyr Ile Tyr Pro Tyr Lys Gly Gly Thr Gly Tyr Asn
65 70 75 80
Gln Lys Phe Lys Ser Lys Ala Thr Leu Thr Thr Asp Ser Ser Ser Asn
85 90 95
Thr Ala Tyr Met Glu Leu Arg Ser Leu Thr Ser Asp Ala Ser Ala Val
100 105 110
Tyr Tyr Cys Ala Arg Gly Ile Ala Tyr Trp Gly Gln Gly Thr Leu Val
115 120 125
Thr Val Ser Ala Ala Lys Thr Thr Pro Pro Ser Val Tyr Pro Leu Ala
130 135 140
Pro Gly Ser Ala Ala Gln Thr Asn Ser Met Val Thr Leu Gly Cys Leu
145 150 155 160
Val Lys Gly Tyr Phe Pro Glu Pro Val Thr Val Thr Trp Asn Ser Gly
165 170 175
Ser Leu Ser Ser Gly Val His Thr Phe Pro Ala Val Leu Gln Ser Asp
180 185 190
Leu Tyr Thr Leu Ser Ser Ser Val Thr Val Pro Ser Ser Thr Trp Pro
195 200 205
Ser Glu Thr Val Thr Cys Asn Val Ala His Pro Ala Ser Ser Thr Lys
210 ' 215 ' 220
Val Asp Lys Lys Ile Val Pro Arg Asp Cys Gly Cys Lys Pro Cys Ile
225 . 230 235 240
Cys Thr Val Pro Glu Val Ser Ser Val Phe Ile Phe Pro Pro Lys Pro
245 250 255
Lys Asp Val Leu Thr Ile Thr Leu Thr Pro Lys Val Thr Cys Val Val
260 265 270
Val Asp Ile Ser Lys Asp Asp Pro Glu Val Gln Phe Ser Trp Phe Val
275 280 285
Asp Asp Val Glu Val His Thr Ala Gln Thr Gln Pro Arg Glu Glu Gln
290 295 300
Phe Asn Ser Thr Phe Arg Ser Val Ser Glu Leu Pro Ile Met His Gln
305 310 315 320
Asp Trp Leu Asn Gly Lys Glu Phe Lys Cys Arg Val Asn Ser Ala Ala
325 ~ 330 335
Phe Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Thr Lys Gly Arg Pro
340 345 350
Lys Ala Pro Gln Val Tyr Thr Ile Pro Pro Pro Lys Glu Gln Met Ala
355 360 365
Lys Asp Lys Val Ser Leu Thr Cys Met Ile Thr.Asp Phe Phe Pro Glu
370 375 380
Asp Ile Thr Val Glu Trp Gln Trp Asn Gly Gln Pro Ala Glu Asn Tyr
385 390 395 400
Lys Asn Thr Gln Pro Ile Met Asp Thr Asp Gly Ser Tyr Phe Val Tyr
405 410 415
Ser Lys Leu Asn Val Gln Lys Ser Asn Trp Glu Ala Gly Asn Thr Phe
420 425 430
Ile Cys Ser Val Leu His
435
<210> 7
<211> 157
<212> PRT
<213> Human
8
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
<220>
<221> PEPTIDE
<222> (0)...(0)
<223> Tumor necrosis factor-alpha (TNF alpha, mature
peptide)
<400> 7
Val Arg Ser Ser Ser Arg Thr Pro Ser Asp Lys Pro Val Ala His Val
1 _ 5 10 ~ I5
Val Ala Asn PrQ.-.Gln;Ala-Glu Gly Gln Leu Gln Trp Leu Asn Arg Arg
20 25 ~ 30
Ala Asn Ala Leu Leu Ala Asn Gly Val Glu Leu Arg Asp Asn Gln Leu
35 -~ 40 45
Val Val Pro Ser Glu Gly Leu Tyr Leu Ile Tyr Ser Gln Val Leu Phe
S0 55 ~ 60
Lys GIy Gln Gly Cys Pro Ser Thr His Val Leu Leu Thr His Thr Ile
65 70 75 80
Ser Arg Ile Ala Val Ser Tyr Gln Thr Lys Val Asn Leu Leu Ser Ala
85 90 95
Ile Lys Ser Pro Cys Gln Arg Glu Thr Pro Glu Gly Ala Glu Ala Lys
100 105 ~ 110
Pro Trp Tyr'Glu Pro Ile Tyr Leu Gly Gly Val Phe Gln Leu Glu Lys
115 120 125
Gly Asp Arg Leu Ser Ala Glu Ile Asn Arg Pro Asp Tyr Leu Asp Phe
130 135 140
Ala Glu Ser Gly Gln Val Tyr Phe Gly Ile Ile Ala Leu
145 150 155
<210> 8
<211> 70
<212> PRT
<213> Human
<220>
<221> PEPTIDE
<222> (0)...(0)
<223> Human Insulin-like Growth Factor 1 sequence
(IGF-1, mature peptide)
<400> 8
GIy Pro Glu Thr Leu Cys Gly Ala Glu Leu Val Asp Ala Leu Gln Phe
1 5 10 15
Val Cys Gly Asp Arg Gly Phe Tyr Phe Asn Lys Pro Thr Gly Tyr Gly
20 25 30
Ser Ser Ser Arg Arg Ala Pro Gln Thr Gly Ile Val Asp Glu Cys Cys
35 40 ~ 45
Phe Arg Ser Cys Asp Leu Arg Arg Leu Glu Met Tyr Cys Ala,Pro Leu
50 55 60
Lys Pro Ala Lys Ser Ala
65 70
<210> 9
<211> 53
<212> PRT
<213> Human
<220>
<221> PEPTIDE
<222> (0)...(0)
<223> Epidermal Growth Factor (EGF, mature peptide)
<400> 9
Asn Ser Asp Ser Glu Cys Pro Leu Ser His Asp Gly Tyr Cys Leu His
1 5 10 15
Asp Gly .Val Cys Met Tyr Ile Glu Ala Leu Asp Lys Tyr Ala Cys Asn
20 25 30
Cys Val Val Gly Tyr Ile Gly Glu Arg Cys Gln Tyr Arg Asp Leu Lys
9
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
35 40 45
Trp Trp Glu Leu Arg
<210> 10
<211> 164
<212> PRT
<213> Human
<220>
<221> PEPTIDE'
<222> (0) . . . ,(0)
<223> Stem Cell Factor (SCF, mature peptide)
<~400> 10
GIu GIy Ile Cys Arg Asn Arg VaI Thr Asn Asn Val Lys Asp Val Thr
1 5 10 15
Lys Leu Val Ala Asn Leu Pro Lys Asp Tyr Met Ile Thr Leu Lys Tyr
20 25 30
Val Pro Gly Met Asp Val Leu Pro Ser His Cys Trp Ile Ser Glu Met
35 40 . 45
Val Val Gln Leu Ser Asp Ser Leu Thr Asp Leu Leu Asp Lys Phe Ser
50 55 60.
Asn Ile Sex Glu Gly Leu Ser Asn Tyr Ser Ile hle Asp Lys Leu Val
65 70 75 ~ 80
Asn Ile Val Asp Asp Leu Val Glu Cys Val Lys Glu Asn Ser Ser Lys
85 90 95
Asp Leu Lys Lys Ser Phe Lys Ser Pro Glu Pro Arg Leu Phe Thr Pro
100 105 110
Glu Glu Phe Phe Arg Ile Phe Asn Arg Ser Ile Asp Ala Phe Lys Asp
115 - 120 125
Phe Val Val Ala Ser Glu Thr Ser Asp~Cys Val Val Ser Ser Thr Leu
130 ~ 135 140
Ser Pro Glu Lys Asp Ser Arg Val Ser Val Thr Lys Pro Phe Met Leu
145 150 - 155 160
Pro Pro Val Ala
<210> 11
<211> 597
<2I2> PRT
<213> Artificial Sequence
<220>
<223> Fusion protein with N-terminal portion of DAV-1 heavy chain
and TNF alpha mature peptide
<400> 11
Met Gly Trp Sex Trp Ile Phe Leu Phe Leu Leu Ser Gly Thr Ala Gly
1 5 10 15
Val His Ser Glu.Va1 Gln Leu Gln Gln Ser Gly Pro Glu Leu Val Lys
20 25 30
Pro Gly Ala Ser Val Lys Ile Ser Cys Lys Ala Ser Gly Tyr Thr Phe
35 40 45
Thr Asp Tyr Asn Met His Trp Val Lys Gln Ser His Gly Lys Ser Leu
50 55 60
Glu Trp Ile Gly Tyr Ile Tyr Pro Tyr Lys Gly Gly Thr Gly Tyr Asn
65 70 75 80
Gln Lys Phe Lys Ser Lys Ala Thr Leu Thr Thr Asp Ser Ser Ser Asn
85 90 95
Thr Ala Tyr Met Glu Leu Arg Ser Leu Thr Ser Asp Ala Ser Ala Val
100 105 110
Tyr Tyr.Cys Ala Arg Gly Ile Ala Tyr Trp Gly Gln Gly Thr Leu Val
115 120 125
Thr Val Ser Ala Ala Lys Thr Thr Pro Pro Ser Val Tyr Pro Leu Ala
130 135 140
Pro Gly Ser Ala Ala Gln Thr Asn Ser Met Val Thr Leu Gly Cys Leu
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
145 150 155 160
Val Lys Gly Tyr Phe Pro Glu Pro Val Thr Val Thr Trp Asn Ser Gly
165 170 175
Ser, Leu Ser Ser Gly Val His Thr Phe Pro Ala Val Leu Gln Ser Asp
180 185 190
Leu Tyr Thr Leu Ser Ser Ser Val Thr Val Pro Ser Ser Thr Trp Pro
195 ~. 200 205
Ser Glu Thr Val Thr Cys Asn Val Ala His Pro Ala Ser Ser Thr Lys
210 215 220
Val Asp Lys~Lys..Ile~Val Pro Arg Asp Cys Gly Cys Lys Pro Cys Ile
225 ~ 230 . 235 ~ 240
Cys Thr Val Pro Glu Val Ser Ser Val Phe Ile Phe Pro Pro Lys Pro
245 250 ~ 255
Lys Asp Val Leu Thr Ile Thr Leu Thr Pro Lys Val Thr Cys Val Val
260 265 ' 270
Val Asp Ile Ser Lys Asp Asp Pro Glu Val Gln Phe Ser Trp Phe Val
275 280 285
Asp Asp Val Glu Val His Thr Ala Gln Thr Gln Pro Arg Glu Glu Gln
290 295 ' 300
Phe Asn Ser Thr Phe Arg Ser Val Ser Glu Leu Pro Ile Met His Gln
305 310 315 320
Asp Trp Leu Asn Gly Lys Glu Phe Lys Cys Arg Val Asn Ser Ala Ala
325 330 335
Phe Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Thr Lys Gly Arg Pro
340 345 350.
Lys Ala Pro Gln Val Tyr Thr Ile Pro Pro Pro Lys Glu Gln Met Ala
355 360 365
Lys Asp Lys Val Ser Leu Thr Cys Met Ile Thr Asp Phe Phe Pro Glu
370 375 380
Asp Ile Thr Val Glu Trp Gln Trp Asn Gly Gln Pro Ala Glu Asn Tyr
385 390 395 400
Lys Asn Thr Gln-Pro Ile Met Asp Thr Asp Gly Ser Tyr Phe Val Tyr
405 410 415
Ser Lys Leu Asn Val Gln Lys Ser~Asn Trp Glu Ala Gly Asn Thr Phe
420 425 430
Ile Cys Ser Val Leu His Glu Phe Val Arg Ser Ser Ser Arg Thr Pro
435 440 445
Ser Asp Lys Pro Val Ala His Val Val Ala Asn Pro Gln Ala Glu Gly
450 455 460
Gln Leu Gln Trp Leu Asn Arg Arg Ala Asn Ala Leu Leu Ala Asn Gly
465 470 475 480
Val Glu Leu Arg Asp Asn Gln Leu Val Val Pro Ser Glu Gly Leu Tyr
485 490 495
Leu Ile Tyr Ser Gln Val Leu Phe Lys Gly Gln Gly Cys Pro Ser Thr
500 505 510
His Val Leu Leu Thr His Thr Ile Ser Arg Ile Ala Val Ser Tyr Gln
515 520 525
Thr Lys Val Asn Leu Leu.Ser Ala Ile Lys Ser Pro Cys Gln Arg Glu
530 535 ~ 540
Thr Pro Glu Gly Ala Glu Ala Lys Pro Trp Tyr Glu Pro Ile Tyr Leu
545 550 555 560
Gly Gly Val Phe Gln Leu Glu Lys Gly Asp Arg Leu Ser Ala Glu Ile
565 570 575
Asn Arg Pro Asp Tyr Leu Asp Phe Ala Glu Ser Gly Gln Val Tyr Phe
580 585 590
Gly Ile Ile Ala Leu
595
<210> 12
<211> 510
<212> PRT
<213> Artificial Sequence
<220>
<223> Fusion protein with N-terminal portion of DAV-1 heavy chain
and IGF-1 mature peptide
11
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
<400> 12
Met Gly Trp Ser Trp Ile Phe Leu Phe Leu Leu Ser Gly Thr Ala Gly
1 , 5 10 15
Val His Ser Glu Val Glii Leu Gln Gln Ser Gly Pro Glu Leu Val Lys
20 25 30
Pro Gly Ala Ser Val Lys Ile Ser Cys Lys Ala Ser Gly Tyr Thr Phe
35 40 45
Thr Asp Tyr Asn Met His Trp Val Lys Gln Ser His Gly Lys Ser Leu
50 . 55 60 .
Glu Trp Ile .Gly..Tyr. Ile Tyr Pro Tyr Lys Gly.Gly.Thr Gly Tyr Asn,
65 ~ 70 75 80
Gln Lys Phe Lys Ser Lys Ala Thr Leu Thr Thr Asp Ser Ser Ser Asn
85 90 95
Thr Ala Tyr Met Glu Leu Arg Ser Leu Thr Ser Asp Ala Ser Ala Val
100 105 ~ 110
Tyr Tyr Cys Ala Arg Gly Ile Ala Tyr Trp Gly Gln Gly Thr Leu Val
115 120 125
Thr Val Ser Ala Ala Lys Thr Thr Pro Pro Ser Val Tyr Pro Leu Ala
130 135 140
Pro Gly Ser Ala Ala Gln Thr Asn Ser Met Val Thr Leu Gly Cys Leu
145 150 155 160
Val Lys Gly Tyr Phe Pro Glu Pro Val Thr Val Thr Trp Asn Ser Gly
165 170 175
Ser Leu Ser Ser Gly Val His Thr Phe Pro Ala Val Leu Gln Ser Asp
180 185 190
Leu Tyr Thr Leu Ser Ser Ser Val Thr Val Pro Ser Ser Thr Trp Pro
195 200 205
Ser Glu Thr Val Thr Cys Asn Val Ala His Pro Ala Ser Ser Thr Lys
210 215 220
Val Asp Lys Lys Ile Val Pro Arg Asp Cys Gly Cys Lys Pro Cys I1e
225 230 .. 235 240
Cys Thr Val Pro Glu Val Ser Ser Val Phe Ile Phe Pro Pro Lys Pro
245 250 255
Lys Asp Val Leu Thr Ile Thr Leu Thr Pro Lys Val Thr Cys Val Val
260 265 270
Val Asp Ile Ser Lys Asp Asp Pro Glu Val Gln Phe Ser Trp Phe Val
275 280 285
Asp Asp Val Glu Val His Thr Ala Gln Thr Gln Pro Arg Glu Glu Gln
290 295 300
Phe Asn Ser Thr Phe Arg Ser Val Ser Glu Leu Pro Ile Met His Gln
305 310 315 320
Asp Trp Leu Asn Gly Lys Glu Phe Lys Cys Arg Val Asn Ser Ala Ala
325 330 335
Phe Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Thr Lys Gly Arg Pro
340 345 ~ 350
Lys~Ala Pro Gln Val Tyr Thr Ile Pro Pro~Pro Lys Glu Gln Met Ala
355 360 365
Lys Asp Lys Val Ser Leu Thr Cys Met_Ile Thr Asp Phe Phe Pro Glu
370 375 380
Asp Ile Thr Val Glu Trp Gln Trp Asn Gly Gln Pro Ala Glu Asn Tyr.
385 390 395 400
Lys Asn Thr Gln Pro Ile Met Asp Thr Asp Gly Ser Tyr Phe Val Tyr
405 410 415
Ser Lys Leu Asn Val Gln Lys Ser Asn Trp Glu Ala Gly Asn Thr Phe
420 425 430
Ile Cys Ser Val Leu His Glu Phe Gly Pro Glu Thr Leu Cys Gly Ala
435 440 . 445
Glu Leu Val Asp Ala Leu Gln Phe Val Cys Gly Asp Arg Gly Phe Tyr
450 455 460
Phe Asn Lys Pro Thr Gly Tyr Gly Ser Ser Ser Arg Arg Ala Pro Gln
465 470 475 480
Thr Gly Ile Val Asp Glu Cys Cys Phe Arg Ser Cys Asp Leu Arg Arg
485 490 495
Leu Glu Met Tyr Cys Ala Pro Leu Lys Pro Ala Lys Ser Ala
500 505
<210> 23
12
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
<211> 493
<212> PRT
<213> Artificial Sequence
<220>
<223> Fusion protein with N-terminal portion of DAV-1 heavy chain
and EGF mature peptide
<400> 13
Met Gly Trp~Se~"2rp;Ile,Phe Leu Phe Leu Leu Ser Gly Thr Ala Gly
1 5 10 ~ 15
Val His Ser Glu Val Gln Leu Gln Gln Ser Gly Pro Glu Leu Val Lys
20 25 30
Pro Gly Ala Ser Val Lys Ile Ser Cys Lys Ala Ser Gly Tyr Thr Phe
35 40 45
Thr Asp Tyr Asn Met His Trp Val Lys Gln Ser His Gly Lys Ser Leu
50 55 60
Glu Trp Ile Gly Tyr Ile Tyr Pro~Tyr Lys Gly Gly Thr Gly Tyr Asn
65 70 75 80
Gln Lys Phe Lys Ser Lys Ala Thr Leu Thr Thr Asp Ser Ser Ser Asn
85 90 95
Thr Ala Tyr Met Glu Leu Arg Ser Leu Thr Ser Asp Ala Ser Ala Val
100 105 110.
Tyr Tyr Cys Ala Arg Gly Ile Ala Tyr'Trp Gly Gln Gly Thr Leu Val
115 120 125
Thr Val Ser Ala Ala Lys Thr Thr Pro Pro Ser Val Tyr Pro Leu Ala
130 135 140
Pxo Gly Ser Ala Ala Gln Thr Asn Ser Met Val Thr Leu Gly Cys Leu
145 150 155 160
Val Lys Gly Tyr Phe Pro Glu Pro Val Thr Val Thr Trp Asn Ser~Gly
165 170 175
Ser Leu Ser Ser.Gly Val His Thr Phe Pro Ala Val Leu Gln Ser Asp
180 , 185 190
Leu Tyr Thr Leu Ser Ser Ser Val Thr Val Pro Ser Ser Thr Trp Pro
195 200 205
Ser Glu Thr Val Thr Cys Asn Val Ala His Pro Ala Ser Ser Thr Lys
210 215 220
Val Asp Lys Lys Ile Val Pro Arg Asp Cys Gly Cys Lys Pro Cys Ile
225 230 235 240
Cys Thr Val Pro Glu Val Ser Ser Val Phe Ile Phe Pro Pro Lys Pro
245 250 255
Lys Asp Val Leu Thr Ile Thr Leu Thr Pro Lys Val Thr Cys Val Val
260 265 270
Val Asp Ile Ser Lys Asp Asp Pro Glu VaI Gln Phe Ser Trp Phe Val
275 ~ 280 285
Asp Asp Val Glu Val His Thr Ala Gln Thr Gln Pro Arg Glu Glu Gln
290 295 300
Phe Asn Ser Thr Phe Arg Ser Val Ser Glu Leu Pro Ile Met His Gln
305 310 ~ 315 320
Asp Trp Leu Asn Gly Lys Glu Phe Lys Cys Arg Val Asn Ser Ala Ala
325 330 33S
Phe Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Thr Lys Gly Arg Pro
340 345 350
Lys Ala Pro Gln Val Tyr Thr Ile Pro Pro Pro Lys Glu Gln Met Ala
355 360 365
Lys Asp Lys Val Ser Leu Thr Cys Met Ile Thr Asp Phe Phe Pro Glu
370 375 380
Asp Ile Thr Val Glu Trp Gln Trp Asn Gly Gln Pro Ala Glu Asn Tyr
385 390 395 400
Lys Asn Thr Gln Pro Ile Met Asp Thr Asp Gly Ser Tyr Phe Val Tyr
405 410 415
Ser Lys Leu Asn Val Gln Lys Ser Asn Trp Glu Ala Gly Asn Thr Phe
420 ~ 425 430
Ile Cys Ser Val Leu His Glu Phe Asn Ser Asp Ser Glu Cys Pro Leu
435 440 445
Ser His Asp Gly Tyr Cys Leu His Asp Gly Val Cys Met Tyr Ile Glu
450 455 460
13
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
Ala Leu Asp Lys Tyr Ala Cys Asn Cys Val Val Gly Tyr Ile Gly Glu
465 470 475 480
Arg Cys Gln_Tyr Arg Asp Leu Lys Trp Trp Glu Leu Arg
. . 485 ' ' ' 490
<210> 14
<211> 613
<212> P12T
<213> Artificial Sequence
<220> .
<223> Fusion protein with N-terminal portion of DAV-1 heavy chain
and SCF~mature peptide
<400> 14
Met Gly Trp Ser Trp Ile Phe Leu Phe Leu Leu Ser Gly Thr Ala Gly
1 ' 5 10 15
Val His Ser Glu Val Gln Leu Gln Gln Ser Gly Pro Glu Leu Val Lys
20 25 30
Pro Gly Ala Ser Val Lys Ile Ser Cys Lys Ala Ser Gly Tyr Thr Phe
35 40 45
Thr Asp Tyr Asn Met His Trp Val Lys Gln Ser His Gly Lys Ser Leu
50 55 60
Glu Trp Ile Gly Tyr Ile Tyr Pro Tyr Lys Gly.Gly Thr Gly Tyr Asn
65 70 75 80
Gln Lys Phe Lys Ser Lys Ala Thr Leu Thr Thr Asp Ser Ser Ser Asn
85 90 95
Thr Ala Tyr Met Glu Leu Arg Ser Leu Thr Ser Asp Ala Ser Ala Val
100 105 110
Tyr Tyr Cys Ala Arg Gly Ile Ala Tyr Trp Gly Gln Gly Thr Leu Val
115 . . 120 125
Thr Val Ser Ala Ala Lys Thr Thr Pro Pro Ser Val Tyr Pro Leu Ala
130 135 140
Pro Gly Ser Ala Ala Gln Thr Asri Ser Met Val Thr Leu Gly Cys Leu
145 150 155 160
Val Lys Gly Tyr Phe Pro Glu Pro Val Thr Val Thr Trp Asn Ser Gly
165 170 175
Ser Leu Ser Ser Gly Val His Thr Phe Pro Ala Val Leu Gln Ser Asp
180 185 190
Leu Tyr Thr Leu Ser Ser Ser Val Thr Val Pro Ser S2r Thr Trp Pro
195 200 205
Ser Glu Thr Val Thr Cys Asn Val Ala His Pro Ala Ser Ser Thr Lys
210 215 220
Val Asp Lys Lys Ile Val Pro Arg Asp Cys Gly Cys Lys Pro Cys Ile
225 230 235 240
Cys Thr Val Pro Glu Val Ser Ser Val Phe Ile Phe Pro Pro Lys Pro
245 250 255
Lys Asp Val Leu Thr Ile Thr Leu Thr Pro Lys Val Thr Cys Val Val
' 260 ~ 265 . 270
Val Asp Ile Ser Lys Asp Asp Pro Glu Val Gln Phe Ser Trp Phe Val
275 280 285
Asp Asp Val Glu Val His Thr Ala Gln Thr Gln Pro Arg Glu Glu Gln
290 ~ 295 ~ 300
Phe Asn Ser Thr Phe Arg Ser Val Ser Glu Leu Pro Ile Met His Gln
305 310 315 320
Asp Trp Leu Asn Gly Lys Glu Phe Lys Cys Arg Val Asn Ser Ala Ala
325 330 ' 335
Phe Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Thr Lys Gly Arg Pro
340 345 350
Lys Ala Pro Gln Val Tyr Thr Ile Pro Pro Pro Lys Glu Gln Met Ala
355 360 365
Lys Asp Lys Val Ser Leu Thr Cys Met Ile Thr Asp Phe Phe Pro Glu
370 375 380
Asp Ile Thr Val Glu Trp Gln Trp Asn Gly Gln Pro Ala Glu Asn Tyr
385 . 390 395 400
Lys Asn Thr Gln Pro Ile Met Asp Thr Asp Gly Ser Tyr Phe Val Tyr
405 410 415
14
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
Ser Lys Leu Asn Val Gln_Lys Sex Asn Trp Glu Ala Gly Asn Thr Phe .
420 425 430
Ile Cys Ser _Val Leu His Glu Phe Cys Arg Tyr Pro Ala Gln Trp Arg
435 ~ ~ 440 445
Pro Gln Gly Ile Cys Arg Asn Arg Val Thr Asn Asn Val Lys Asp Val
450 455 ' 460
Thr Lys Leu Val Ala Asn Leu Pro Lys.Asp Tyr Met Ile Thr Leu Lys
465 470 475 480
Tyr Val Pro,Gly Met Asp Val Leu Pro Ser His Cy$ Trp Ile Ser Glu
_ _..485 . . 490 , 495
Met Val Val~Gln Leu $er. Asp Ser Leu Thr Asp~Leu Leu Asp Lys Phe
500 505 510
Ser Asn Ile Ser Glu Gly Leu Ser Asn Tyr Ser Ile Ile Asp Lys Leu
515 520 525
Val Asn Ile Val Asp Asp Leu Val Glu Cys Val Lys Glu Asn Ser Ser
530 535 540
Lys Asp Leu Lys Lys Ser Phe Lys Ser Pro Glu Pro Arg Leu Phe Thr
545 550 555 560
Pro Glu Glu Phe Phe Arg Ile Phe Asn Arg Ser Ile Asp Ala Phe Lys
565 570 575
Asp Phe Val Val Ala Ser Glu Thr Ser Asp Cys Val Val Ser Ser Thr
580 585 590
Leu Ser Pro Glu Lys Asp Ser Arg Val Ser Val Thr Lys Pro Phe Met
595 ' 600 , ~ 605
Leu Pro Pro Val Ala
610
<210> 15
<211> 23
<212> DNA
<213> Artificial Sequence
<220>
<223> PCR primer for amplification of CH3 region of
DAV-l heavy chain.
<400> 15
cctgctctgt gtttacatga ggg 23
<210> 16
<211> 19
<212> DNA
<213> Artificial Sequence
<220>
<223> PCR primer for amplification of CFil region of
DAV-1 heavy chain.
<400> 16
cccagggtca tggagttag
19
<210> 17
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> PCR primer for amplification of DAV-1 kappa chain
CL-A.
<400> I7
aagatggata cagttggtgc 20
<210> 18
<211> 20.
<212> DNA
<213> Artificial Sequence
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
<220>
<223> PCR primer for amplification of DAV-1 kappa chain
CL-B.
<400> 18
tgtcaagagc ttcaacagga 20
<210> 19
<211> 15
<212> PRT
<2I3> Adenovirus
<220>
<221> PEPTIDE
<222> (0) . . . (0) '
<223> Peptide spanning integrin binding site on penton base.
<400> 19
Met Asn Asp His Ala Ile Arg Gly Asp Thr Phe Ala Thr Arg Ala
1 5 10 15
<210> 20
<211> 9
<212> PRT
<213> Adenovirus
<220>
<221> PEPTIDE
<222> (0)...(0)
<223> Epitope on penton base integrin binding site recognized by DAV-1.
<400> 20
Ile Arg Gly Asp Thr Phe Ala Thr Arg
1 5
<210> 21
<211> 31
<212> DNA
<213> Artificial Sequence
<220>
<223> PCR sense primer for subcloning DAV-1 heavy chain for whole antibody
or Fab'2 constructs.
<400> 21
ggtaccgcca ccatgggatg gagctggatc t 31
<210> 22
<211> 24
<212> DNA
<213> Artificial Sequence
<220> .
<223> PCR antisense primer for subcloning DAV-1 heavy chain for
whole antibody construct.
<400> 22
gaattcatgt aacacagagc agga 24
<210> 23
<211> 35
<212> DNA
<213> Artificial Sequence
<220> . '
<223> PCR sense primer for subcloning DAV-1 light chain for
whole antibody dr Fab~2 constructs.
16
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
<400> 23
aagcttgcca ccatggagac agacacaatc ctgct 35
<210> 24
<211> 28
<212> DNA
<213> Artificial Sequence
<220>
<223> PCR antisense,primer for subcloniTiglight chain for
DAV_-1
whole antibody or Fab'2 constructs.
<400> 24 -
tctagatgtc tctaacactc attcctgt 28
<210> 25
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> PCR antisense primer for subcloningheavy chain for
DAV-1
Fab'2 constructs.
<400> 25
gaattctgat acttctggga ctgt 24
<210> 26
<211> 26
<212> DNA
<213> Artificial Sequence.
<220>
<223> PCR sense primer for subchoning DAV-1/TNFa
TNFa into
fusion construct.
<400> 26
gaattcgtca gatcatcttc tcgaac 26
<210> 27
<211> 26
<212> DNA
<213> Artificial Sequence
<220>
<223> PCR antisense primer for subcloninginto DAV-1/TNFa
TNFa
fusion construct.
<400> 27
gaattctaca gggcaatgat cccaaa 26
<210> 28
<211> 26
<212> DNA
<213> Artificial Sequence
<220>
<223> PCR sense primer for subcloning o DAV-1/IGF-1
IGF-1 int
fusion construct .
<400> 28
gaattcggac cggagacgct ctgcgg 26
<210> 29
<211> .26
<212> DNA
<213> Artificial Sequence
17
CA 02414272 2003-O1-09
WO 02/04522 PCT/EPO1/07878
<220>
<223> PCR antiserise primer for subcloning IGF-1 into DAV-1/IGF-1
fusion, construct.
<400> 29
gaattctaag ctgacttggc aggctt 26
<210> 30
<211> 96
<212> DNA -
<213> Artificial Sequence
<220>
<223> PCR sense primer for subcloning EGF into DAV-1/EGF
fusion construct.
<400> 30
gaattcaata gtgactctga atgtcccctg tcccacgatg ggtactgcct ccatgatggt 60
gtgtgcatgt atattgaagc attggacaag tatgca 96
<210> 31
<211> 98
<212> DNA
<213> Artificial Sequence
<220>
<223> PCR antisense primer for subcloning EGF into DAV-1/EGF
fusion construct.
<400> 31
gaattctagc gcagttccca ccacttcagg tctcggtact gacatcgctc cccgatgtag 60
ccaacaacac agttgcatgc atacttgtcc aatgcttc 98
<210> 32
<211> 27
<212> DNA
<213> Artificial Sequence
<220>
<223> PCR sense primer for subcloning SCF into DAV-1/SCF
fusion construct.
<400> 32
gcggccgcaa gggatctgca ggaatcg 27
<210> 33
<211> 26
<212> DNA
<213> Artificial Sequence
<220>
<223> PCR antisense primer for subcloning SCF into DAV-1/SCF
fusion construct.
<400> 33
tctagagtgc aacagggggt aacata 26
18
