Note: Descriptions are shown in the official language in which they were submitted.
CA 02415253 2003-O1-06
r
WO 02/04656 PCT/EPO1/07259
- 1
Description
Bioprobes and use thereof
The invention relates to bioprobes which alter by
specific binding to biological material the electric
and/or dielectric properties thereof and thereby make
possible detection and/or purification of the material
modified in this way by means of electrophoresis and/or
dielectrophoresis.
Removing one or more biological species selectively
from a pool of biological material or from a background
comprising very similar biological species is a
frequent task in biotechnology, bioanalysis and
diagnostics. The biological material here may be, for
example, tissue, cells, viruses, cell organelles,
proteins, protein complexes, carbohydrates, lipids or
other organic compounds or a mixture of the groups
listed. Accordingly, the different species originate
from at least one of said groups. The differences in
the properties of the various biological species, on
which the separation or detection principle is based,
may be very small so that separation and/or detection
is often achieved only with great difficulties, if at
all.
There are a multiplicity of solution strategies for
detecting and separating biological material
(Lottspeich and Zorbas (1998) Bioanalytik. Spektrum
Akademischer Verlag, Heidelberg). In principle, it is
possible to distinguish methods which utilize for
separation and detection the differences in the
properties of the species to be fractionated from those
in which detection and separation of said species can
be achieved only by selective modification of the
biological material provided.
CA 02415253 2003-O1-06
- 2 -
- The properties characteristic for the biological
material, which are used for detecting and/or
separating various species, are, inter alia, polarity,
hydrophobicity, charge, size, weight and density.
Examples of methods utilizing said properties are
electrophoresis, gel filtration, affinity chromato-
graphy and centrifugation.
Methods in which the biological material is selectively
labeled in a specific manner and in which separation or
detection of the various species is made possible only
due to the label or due to the properties altered by
said label are all methods which are based on an
antibody-antigen interaction. Examples of these are
EZISA (enzyme-linked immunosorbent assay) methods and
particular variants of FACS (fluorescence-activated
cell sorting) and MACS (magnetic activated .cell
sorting). In these cases, an enzyme, a fluorescent dye
or a magnetic bead is selectively bound to particular
species of the biological material by using
specifically binding antibodies, in order to make
possible detection or purification of the species
labeled in this way.
An example which may be mentioned of a method in which
it is very difficult to fractionate biological material
is free-flow electrophoresis (FFE) (Bauer J. (1999) J.
Chrom. B 722: 55). In this method, a laminar liquid
stream is passed between two glass plates close to one
another. Applying an electric field perpendicular to
the direction of flow makes it possible to fractionate
the various species of the biological material
provided, due to their different charge. If, for
example, FFE is used for fractionating cells, said
cells are electrically attracted by the cathode due to
their negative charge. The lateral migration velocity
of the cells in this case depends on the surface charge
density of the cells. Cells with different surface
charge densities have different lateral migration
CA 02415253 2003-O1-06
- 3 -
velocities and thus can be separated from one another.
The decisive disadvantage of FFE is the fact that
biological material very often has very similar charge
properties. All cells, for example, have a negative
and, in addition, very often nearly identical surface
charge density and thus can be separated from one
another by means of FFE only with great difficulty. In
FFE an adequate resolution can often be achieved only
if the surface charge density of the cells has been
modified sufficiently by a pathogenic change. For this
reason, the use of FFE has decreased sharply today and
the method has been displaced by other often more
expensive and technically more complicated methods.
In the relatively new method of dielectrophoresis
(Fiedler et al. (1998) Anal. Chem. 70: 1909; Betts et
al. (1999) J. Appl. Microbiol. Symp. Suppl. 85: 201),
too, problems have to be dealt with, which are similar
to those arising in electrophoretic methods such as the
above-described FFE. Dielectrophoresis (DEP) is a
method in which the dielectric properties of biological
material are utilized in order to separate said
material from one another. Dielectrophoresis takes
place when biological material is subjected to
inhomogeneous alternating electric fields. The
biological material moves in the inhomogeneous electric
field due to its dielectric properties (permanent or
inducible electric dipole), making a fractionation
possible as a result.
For example, cells contain various regions which can be
polarized and thus be utilized for dielectrophoresis.
These regions include the electric charge bilayer
surrounding a cell, the cell membranes marking the
boundaries of the cell or cell organelles, and also the
polar cytoplasm in the cell interior.
Dielectrophoresis may be used, for example, for
fractionating cells, bacteria and other microorganisms.
However, it is conceivable to use dielectrophoresis
also for fractionating other biological material such
CA 02415253 2003-O1-06
as, for example, nucleic acids, proteins, lipids or
other organic compounds.
Examples of possible applications of dielectrophoresis
are the testing of drinking water, food and biological
fluids with regard to pathogenic microorganisms and the
concentration of stem cells from bone marrow or
peripheral blood.
Dielectrophoresis has the disadvantage that the
dielectric properties of biological material, too, are
often very similar, thus making a fractionation of
different species more difficult.
It is therefore the object of the present invention to
increase the resolution of electrophoretic and/or
dielectrophoretic methods and thus to make available an
improved detection and/or purification method.
The object is achieved by specific binding of bioprobes
to a particular species or to a group of particular
- species from a pool of biological material containing
at least one species, as a result of which the electric
and/or dielectric properties of the species labeled in
this way are altered selectively and specifically, thus
making it possible to purify and/or detect the species
labeled in this way or the complex of bioprobe and
biological species, which has formed due to binding of
said bioprobe.
According to the invention, the biological material
here comprises in particular at least one species of at
least one group selected from the group consisting of
tissue, cells, cell organelles, viruses, proteins,
peptides, nucleic acids, carbohydrates, lipids or other
organic compounds, and the species may also be
modified.
The essential advantage of the invention described here
compared with the usual methods is the possibility of
simple and rapid separation and/or detection of the
CA 02415253 2003-O1-06
_ 5 _
complex of biological species and bioprobe, which has
formed due to binding of said bioprobe to said
biological species, and this advantage can be used on
the one hand to enable detection or purification of the
species selectively labeled in this way but,
conversely, may also be used for selectively removing
one or more bioprobes from a pool of bioprobes with
different binding specificities. In the latter case it
is possible, prior to carrying out the separation
method, to contact the biological material in
particular with a library of inventive bioprobes of
different binding specificity so that selectively
binding bioprobes can be identified and isolated from
said library.
The decisive advantage of the method of the invention
compared with methods such as FRCS and MACS is that the
bioprobe need not be modified in a complicated manner
by a fluorescent dye or a magnetic bead in order to
enable detection and/or purification of the labeled
biological material, and that likewise the complex
apparatus unavoidable in methods such as FACS or MACS
is not needed.
The inventive method for detecting or purifying
biological material may in particular comprise the
following steps:
a) Providing biological material which contains
different species.
b) Adding a bioprobe containing a part A which
binds specifically to at least one of said
species and a part B which alters the
electric and/or dielectric properties of the
one or more species labeled by specific
binding of said bioprobe so that detection
and/or purification of said labeled species
by electrophoresis and/or dielectrophoresis
is made possible or improved.
CA 02415253 2003-O1-06
- 6 -
c) Constructing an electric field for detecting
or purifying said complex or complexes of one
or more iological species and specifically
bound bioprobe by electrophoresis or
dielectrophoresis.
For the purpose of identifying and isolating bioprobes
specifically binding to biological material provided,
the method of the invention may in particular comprise
the following steps:
a) Providing biological material which contains
at least one species.
b) Adding a bioprobe or various bioprobes
comprising in each case a part A which can
specifically bind to at least one of said
species and a part B which alters the
electric and/or dielectric properties of the
one or more species labeled by binding of a
bioprobe so that detection and/or
purification of a complex forming in this way
of one or more biological species and
biological material become possible, with the
various bioprobes having different binding
specificities and at least one of the
bioprobes added binding to said biological
material.
c) Constructing an electric field for detecting
or purifying said complex or complexes of one
or more biological species and specifically
bound bioprobe by electrophoresis or
dielectrophoresis.
The various bioprobes according to (b) in this case may
be in particular a library of bioprobes of different
substrate specificity, which comprises more than 109,
in particular more than 1012, different bioprobes.
The bioprobes of the invention comprise a part A which
mediates the specific interaction between the probe and
the biological material and a part B which alters the
CA 02415253 2003-O1-06
properties of said biological material in the desired
way, i.e. alters the charge with regard to
electrophoresis and the dielectricity constant or
specific conductivity or polarizability with regard to
dielectrophoresis. There is no need here for the parts
A and B to be structurally separated from one another.
Part A of the bioprobe is or comprises, for example, a
peptide binding specifically to biological material. In
this case, a specific interaction between the peptide
and a peptide receptor present on [sic] the biological
material is formed. An example of such an interaction
is that of the Saccharomyces cerevisiae a-factor
receptor Ste2p with the corresponding a-factor peptide
ligand. Further examples are the TSH receptor
(Schuppert et al. (1996) Thyroid 6: 575), the FSH
receptor (Tilly et al. (1992) Endocrinology 131: 799),
the EGF receptor (Christensen et al. (1998) Dan. Med.
Bull. 45: 121), the TNF receptor (Murphy et al. (1994)
Thymus 23: 177), the transferrin receptor (Ponka and
Lok (1999) Int. J. Biochem. Cell Biol. 31: 1111), the
insulin receptor (Milazzo et al. (1992) Cancer Res. 52:
3924), the FGF receptor (Kiefer et al. (1991) Growth
Factors 5: 115), the TGF(3 receptor (Derynck et al.
(1994) Princess Takamatsu Symp. 24: 264), the IGF
receptor (Peyrat and Bonneterre (1992) Breast Cancer
Res. Treat. 22: 59), the angiotensin II receptor (Smith
and Timmermans (1994) Curr. Opin. Nephrol. Hypertens.
3: 112) and the somatostatin receptor (Schonbrunn
(1999) Ann. Oncol. 10 Suppl. 2: 17) and the
interactions with their particular ligands. Similarly,
all peptides capable of binding specifically to the
desired biological material can be used.
The specifically binding part A may also be an
antibody, in particular for example an antibody
recognizing marker structures on cell surfaces. An
example of such a marker structure is the transferrin
receptor. Furthermore, part A may also comprise a low
molecular weight structure which binds specifically to
CA 02415253 2003-O1-06
biological material. An example of such a low molecular
weight structure is acetylcholine which is specifically
bound by the acetylcholine receptor. However, part A of
the bioprobe may also be, for example, a carbohydrate,
a lipid, an inorganic compound, a nucleic acid or any
other ligand binding specifically to biological
material or may comprise one of these groups.
Part B of the bioprobe, which is linked to part A is or
comprises a structure which, when binding to the
biological material, alters the electric and/or
dielectric properties thereof such that the behavior of
the biological material modified in this way changes in
an electric and/or dielectric field. This may take
place, for example, by introducing an electric charge,
by altering the dielectricity constants and/or by
altering the specific conductivity of said biological
material. Examples of carriers of electric charge are
in this context acidic and basic amino acids (asparate,
glutamate, lysine, arginine), nucleic acids (single-
stranded and double-stranded DNA and RNA, DNA/RNA
heteroduplex), organic acids and bases (tartrate,
citrate, amines), polyquaternary amines and inorganic
charge carriers. Structures which alter the dielectric
behavior of the biological material are, in addition to
the structures mentioned above, also hydrophobic,
electrically neutral structures such as lipids, fatty
acids, waxes, oils and sterols, for example.
In a preferred embodiment, part B of the bioprobe is or
comprises a nucleic acid which is covalently linked to
part A of the bioprobe directly or via an intermediate
link. The nucleic acid in this case comprises
preferably at least 5 or 10, particularly preferably at
least 15 or 20, nucleotides.
In a particularly embodiment of the bioprobe, part B of
said bioprobe comprises a nucleic acid which comprises
the genetic information for part A of the bioprobe,
with part A of the bioprobe comprising a protein or
CA 02415253 2003-O1-06
_ g _
- polypeptide and part B of the bioprobe comprising a
single- or double-stranded RNA or DNA or an RNA/DNA
heteroduplex which is covalently linked to part A of
the bioprobe. Here, too, part A of the bioprobe
particularly preferably comprises a ligand for the
Ste2p receptor, the TSH receptor, the FSH receptor, the
EGF receptor, the TNF receptor, the transferrin
receptor, the insulin receptor, the FGF receptor, the
TGF~i receptor, the IGF receptor, the angiotensin II
receptor or the somatostatin receptor and part B of the
bioprobe in each case a nucleic acid which comprises
the sequences coding for said ligands. In this
preferred embodiment, part A and part B of the bioprobe
are preferably linked covalently to one another via a
unit which is capable of taking over the growing
peptide chain in a ribosomally catalyzed translation
reaction with formation of a covalent bond. Said unit
in this context comprises, for example, a puromycin
molecule or puromycin analog and/or an amino acid or an
amino acid analog. In this connection, see also for
example Roberts et al. (1997) Proc. Natl. Acad. Sci.
USA 94: 12297, WO 98/16636 and Krayevsky et al. (1979)
Progress in Nucleic Acids Research and Molecular
Biology 23:1.
In addition to selective labeling of particular species
from the biological material provided with a
specifically binding bioprobe, it is also possible to
label said species with a fluorescent dye, a dye (such
as, for example, propidium iodide, Calcofluor), an
appropriately labeled specifically binding antibody
(e.g., FITC), a radiolabeled (e.g. 35S-methionine) or
another compound which enables simple detection of the
biological material.
The biological materials labeled by means of the
bioprobe may be detected and/or fractionated either
electrophoretically using a constant electric field,
for example by free-flow electrophoresis, or by
CA 02415253 2003-O1-06
- 10 -
dielectrophoresis using an inhomogeneous alternating
field. Using the bioprobes, in particular in DEP, can
significantly improve the resolution.
The inventive method of labeling biological species
with bioprobes and subsequent fractionation of the
biological material by electrophoresis or
dielectrophoresis may be applied particularly
preferably in the use of biochips. Preference should be
given here to applying biochips as described by Cheng
et al. (Cheng et al. (1998) Anal. Chem. 70:2321).
Biochips allow carrying out the separation and/or
detection in a miniaturized form. Miniaturization can
additionally reduce the experimental complexity, for
example in comparison with FACS.
The dielectric fractionation of cells on a chip has
already been described (Cheng et al. (1998) Anal. Chem.
70:2321) in this specific case, the differences in the
dielectric properties of the species to be fractionated
were large enough to make a fractionation possible. The
use of the bioprobes of the invention allows a
fractionation of biological species even if the
differences in the dielectric properties of said
biological species themselves are not large enough to
make fractionation via dielectrophoresis possible.
Examples
Example l:
Preparation of a bioprobe
The bioprobe is prepared starting from a DNA sequence
via an in vitro transcription and translation.
According to Roberts and Szostak (1997; Proc. Natl.
Acad. Sci. USA 94: 12297), the peptide forming during
translation is covalently linked to its mRNA via a
puromycin molecule. Thus the peptide portion is the
specific binder whereas the mRNA portion, due to its
strong negative charge in the neutral pH region, alters
the physical properties of the biological material such
CA 02415253 2003-O1-06
- 11 -
that selection or detection is made possible. In the
exemplary embodiment, the bioligical material is a
population of yeast cells of the species Saccharomyces
cerevisiae of mating type MATa, which express the
a-factor receptor (STE2) (Davis and Davey (1997)
Biochem. Soc. Trans. 25: 1015). The detailed procedure
is described in the following: starting from a DNA
sequence (Seq 1) which can be prepared via standard
methods (oligonucleotide synthesis) or which is
commercially available (e. g. INTERACTIVA The Virtual
Laboratory, Ulm), a double-stranded DNA molecule
(Seq 2) is generated via a polymerase chain reaction
(PCR). The DNA molecule contains the following sequence
regions: a T7 promoter sequence, a TMV translation
initiation sequence, a coding region containing a 5'-
encoded E tag, an a-factor sequence and a 3'-encoded
Strep tag. The PCR is carried out according to the art
as follows:
The following ingredients are added to a PCR reaction
vessel:
1 u1 of DNA (from oligonucleotide synthesis,
corresponds to 1 nmol, Seq 1)
10 u1 of Taq polymerase buffer, lOx (Promega, Mannheim)
10 p1 of 25 mM MgCl2 (Promega, Mannheim)
10 u1 of 2.5 mM dNTP mix (Promega, Mannheim)
10 u1 of 10 pM primer 1 (Seq 3)
10 ~1 of 10 uM primer 2 (Seq 4)
2 u1 of 5 U/ul Taq polymerase (Promega, Mannheim)
The PCR program is characterized as follows:
10 cycles of 1 min at 95°C, 2 min at 55°C, 2 min at
?2°C
The DNA is quantified and approximately 1 nmol of the
double-stranded DNA is used as template for in vitro
transcription. The transcription is carried out using a
commercially available system from Ambion (Austin,
USA). The standard mixture is as follows:
50 u1 of DNA template (1 nmol)
20 p1 of reaction buffer (Ambion, Austin)
20 u1 of 75 mM ATP (Ambion, Austin)
CA 02415253 2003-O1-06
- 12 -
_ 20 u1 of 75 mM CTP (Ambion, Austin)
20 p1 of 75 mM GTP (Ambion, Austin)
20 ~zl of 75 mM UTP (Ambion, Austin)
20 u1 of enzyme mix (Ambion, Austin)
30 u1 of H20
The mixture is incubated at 37°C for one hour. The RNA
is worked up via phenol-chloroform extraction (Davis et
al. 1994) and then quantified.
In order to prepare the bioprode, the mRNA must be
modified at its 3' end such that a short DNA sequence
is present on the mRNA and a puromycin molecule is
present on the 3' end of said short DNA sequence. This
technique is described by Roberts and Szostak (1997;
see above). In the exemplary embodiment, the
modification is carried out as follows:
2 nmol of mRNA
2 nmol of linker (Seq 5; INTERACTIVA, Ulm)
2 nmol of splint (Seq 6; INTERACTIVA, Ulm)
H20 to 125 u1
The mixture is heated at 70°C for 3 min and cooled at
room temperature for 15 min. Then 15 u1 of lOx ligase
buffer (Promega, Mannheim) and 10 u1 of 20 U/ul T4 DNA
ligase (Promega, Mannheim) are added. The puromycin
carrying linker is ligated to the mRNA by incubating at
room temperature for 4 h.
The total mixture is admixed with 10 nmol of antisplint
(Seq 7) and heated at 80°C for 5 min. The ligation
mixture is then cooled on ice and the ligated mRNA is
quantified.
The bioprobe is prepared by adding 10 u1 of
s5S-methionine (APbiotech, Freiburg), 15 u1 of amino
acid mastermix without methionine (Ambion, Austin) and
200 u1 of Retic Lysate IVT (Ambion, Austin) to 200 pmol
of ligated mRNA and translating said mRNA. H20 is added
to 300 u1. The mixture is incubated at 30°C for 30 min.
Then 100 p1 of 2.5 M KCl and 70 u1 of 1 M MgCl2 are
added and the mixture is stored at -20°C overnight.
The bioprobes are worked up by adding 10 ml of binding
buffer (100 mM Tris/HC1 pH 8.0; 10 mM EDTA pH 8.0; 1 M
CA 02415253 2003-O1-06
i
- 13 -
NaCl; 0.250 Triton X-100) to the translation mixture
and adding to that 10 mg of oligo-dT cellulose
(Apbiotech, Freiburg). The mixture is incubated at 4°C
for one hour. The cellulose with the bound bioprobes is
removed by filtration and washed with 8 ml of binding
buffer. The bioprobes are eluted with 4 times 100 u1 of
H20. The bioprobes are quantified by determining the 35S
decays in a scintillation counter and can then be used
for binding to the biological material.
Sequences
Seq 1
GGTGCGCCGGTGCCGTATCCGGATCCGCTGGAACCGCGTTGGCATTGGTTGC
AACTAAAACCTGGCCAACCAATGTACTGGAGCCACCCGCAGTTTGAGAAA
Seq 2 .
TAATACGACTCACTATAGGGACAATTACTATTTACAATTACAATGGGTGCGCCG
GTGCCGTATCCGGATCCGCTGGAACCGCGTTGGCATTGGTTGCAACTAAAACC
TGGCCAACCAATGTACTGGAGCCACCCGCAGTTTGAGAAAGCAGGTGCATCCG
CT
Seq 3
TAA TAC GAC TCA CTA TAG GGA CAA TTA CTA TTT ACA ATT ACA ATG GGT
GCG CCG GTG CCG TAT
Seq 4
AGC GGA TGC TTT CTC AAA CTG
Seq 5
CC-Puromycin
Seq 6
GCGCGCTTTTTTn?NAGCGGATGC
CA 02415253 2003-O1-06
i
WO 02/04656 PCT/EP01/07259
1
' SEQUENCE LISTING
<110> Xzillion GmbH & Co. KG
<120> Bioprobes and use thereof
<130> 200at15
<140>
<141>
<150> 10033194.7
<151> 2000-07-07
<160> 6
<170> PatentIn Ver. 2.1
<210> 1
<211> 102
<212> DNA
<213> Artificial sequence
<220>
<223> Description of artificial sequence: alpha factor
<900> 1
ggtgcgccgg tgccgtatcc ggatccgctg gaaccgcqtt ggcattggtt gcaactaaaa 60
cctggccaac caatgtactg gagccacccg cagtttgaga as 102
<210> 2
<211> 162
<212> DNA
<213> Artificial sequence
<220>
<223> Description of artificial sequence: PRE fusagene
<400> 2
taatacgact cactataggg acaattacta tttacaatta caatgggtgc gccggtgccg 60
tatccggatc cgctggaacc gcgttggcat tggttgcaac taaaacctgg ccaaccaatg 120
tactggagcc acccgcagtt tgagaaagca ggtgcatccg ct 162
<210> 3
<211> 63
<212> DNA
<213> Artificial sequence
<220>
<223> Description of artificial sequence: PCR primer
..
CA 02415253 2003-O1-06
_ WO 02/04656 PCT/EPOl/07259
2
<400> 3
taataegact cactataggg acaattacta tttacaatta caatgggtgc gccggtgccg 60
tat 63
<210> 9
<211> 21
<212> DNA
<213> Artificial sequence
<220>
<223> Description of artificial sequence: PCR primer
<900> 4
agcggatgct ttctcaaact g 21
<210> 5
<211> 29
<212> DNA
<213> Artificial sequence
<220>
<223> Description of artificial sequence: linker with puromycin on
3' end
<400> 5
aaaaaaaaaa aaaaaaaaaa aaaaaaacc 29
<210> 6
<211> 25
<212> DNA
<213> Artificial sequence
<220>
<223> Description of artificial sequence: splint
<400> 6
gcgcgctttt tttttnagcg gatgc 25
