Note: Descriptions are shown in the official language in which they were submitted.
CA 02416877 2003-01-22
Annielder: apoGene GmbH & Co. KG
Unser Zeichen: 80264 WO
Somatic Cloning Gene Transfer for Producing Recombinant Proteins, Cells and
Organs
The present invention relates to a process for recombinant manufacturing of
substances in which
cells are transformed using a nucleotide sequence coding for the substance,
the transformed cells
are subjected to a cloning process, and the cells so obtained are incorporated
into a host
organism. The present invention relates in particular to the use of the method
in the production of
recombinant proteins, cells and tissues. According to a further aspect, the
invention relates to a
method, wherein cells of an individual are isolated, these cells are
introduced into an
immunoincompetent animal for further growth, and the cells, tissue and / or
organs cultivated in
the animal are again isolated and introduced into an individual.
With the ascendance of recombinant gene technology biological systems were
increasingly
involved for manufacturing useful substances. With definition of the
nucleotide sequence of the
human genome it can be expected that discovery of new proteins and their role
in the human
body will be promoted and accelerated so that in the near future a number new
substances for
medical or other purposes will be available, whose manufacture is desirable.
Nevertheless, use of
existing in vitro cell culture systems for this purpose includes the drawback
that until optimal
production of the particular substances at least 1 to 2 years lapse. Moreover,
handling such
systems is complicated, subject to disturbances and cost-intensive. Thus, for
instance, one of the
major difficulties in large-scale operation of cell culture systems is the
risk of contamination of
the culture solution.
In recent years animals have been increasingly used for producing substances
of industrial and
pharmaceutical interest. To do this, along with the creation of so-called germ-
line transgenic
animals somatic gene transfer is used, wherein DNA coding for a particular
substance is
introduced into the somatic cells of a target individual. This can be done
either in vivo; that is, in
the entire organism or in vitro or in the laboratory into cells that have been
harvested from the
organism and after insertion of the construct into said cells, they are
reintroduced into the
organism. Expression of the construct is then induced in the animal so that
the substance of
interest can develop its effect in the animal.
CA 02416877 2012-10-09
77811-5
2
The fact that the incorporated gene is expressed or has an effect only in the
individual treated and is limited to the lifetime of the transformed cells is
an inherent drawback in
the transfer of gene constructs in somatic cells. There is no transfer to
subsequent generations.
In the case of somatic gene transfer, other frequently encountered problems,
which
can negatively affect the characteristics and/or the behaviour of the target
cells, include
particularly the fact that sufficiently large number of specific target cells
with stabile transfection
are obtained frequently only after great effort and the randomness of the
integration of the inserted
construct. Furthermore, problems often occur with respect to inadequate
expression of the
polypeptide coded by the inserted construct, which along with the difficulties
at the level of the
DNA can also be associated with intra- and extracellular obstacles and must
each be investigated.
The problems described above, therefore, restrict the use of the applications
of somatic gene
transfer in biotechnology in the broadest sense and are especially significant
in the production of
livestock.
According to one aspect of the present invention, there is provided a method
for
recombinant manufacturing of substances, wherein a) cells are transformed
using a nucleotide
sequence coding for the substance; b) the transformed cells are subjected to a
cloning process, and
c) the cells obtained in Step b) are adapted for administration into a host
organism.
According to another aspect of the present invention, there is provided a
method for
manufacturing a recombinant protein, comprising the steps of: a) isolating
fibroblast cells from a
bovine; b) transfecting the isolated fibroblast cells with a plasmid
comprising a nucleotide
sequence coding for the recombinant protein; c) isolating a nucleus from the
transfected fibroblast
cells; d) injecting the isolated nucleus into an enucleated bovine oocyte that
is genetically identical
to the isolated fibroblast cells; e) stimulating the oocyte to divide and form
an embryo;
f) introducing the embryo into a host bovine; g) allowing the embryo to
develop into a fetus in the
host bovine; h) harvesting the fetus from the host bovine; i) isolating cells
from the fetus;
j) introducing the isolated cells in a bovine
CA 02416877 2011-07-29
77811-5
2a
animal; k) expressing the recombinant protein in the bovine animal; and I)
obtaining the
expressed recombinant protein from the bovine animal.
According to another aspect of the present invention, there is provided the
use of transgenic animals, created according to the method described above for
the
manufacturing of recombinant substances.
According to still another aspect of the present invention, there is provided
a
method for manufacturing cells, tissues or organs in an animal organism,
wherein a) cells
are isolated from an individual; b) the cells are introduced into an
immunoincompetent
organism; c) the organism is cultured; and d) the cells of the individual
grown in the
organism are isolated.
According to yet another aspect of the present invention, there is provided
the use of the method described above for manufacturing of a transplant.
A feature of the present invention therefore is the elimination of the
drawbacks,of the prior art and to provide a novel method for manufacturing
particular
substances of interest.
This is achieved by a method for recombinant manufacturing of substances
in which in a first step cells are transformed using a nucleotide sequence
coding for said
substance, the transformed cells are subjected to a cloning process, and the
cells
obtained in the cloning step are introduced into a host organism.
The cells used in the first step of the method can be any cells isolated from
the individual and which can be subjected to a cloning process. Examples of
these are
particularly fetal or adult fibroblasts, primitive germ cells, granulosa
cells, thymocytes,
spleen cells, liver cells, macrophages, testicular or ovarian cells, etc. The
cells can be
used as such, isolated, or in culture, whereby they can also be subjected to a
cloning
process prior to transformation.
According to a preferred embodiment, the cells used for the transformation are
isolated
from an already available cellular clone, a cell culture of from an organism.
In the sense
CA 02416877 2011-07-29
77811-5
2b
of the invention, a cell clone is defined as cultivated cells cloned in vitro,
fetuses obtained
by cloning, or cloned animals.
In one aspect, the present invention relates to a method for recombinant
manufacturing of a recombinant protein, comprising the steps of: a) isolating
cells having
the same genotype as a bovine animal, wherein said cells are selected from the
group of
cells consisting of fetal fibroblasts, adult fibroblasts, primitive germ
cells, granulosa cells,
thymocytes, spleen cells, liver cells, macrophages, testicular cells and
ovarian cells; b)
transfecting the isolated cells using a polynucleotide coding for the
recombinant protein;
c) subjecting the transfected cells to a nuclear transfer cell cloning process
thereby
generating cloned transfected cells; d) introducing the cloned transfected
cells prepared
in step c) into the bovine animal; e) expressing the recombinant protein in
the bovine
animal; and f) obtaining the expressed recombinant protein from the bovine
animal.
In another aspect, the present invention relates to a method for
manufacturing a recombinant protein using a transgenic bovine animal produced
by the
steps of: a) isolating a cell selected from the group of cells consisting of
fetal fibroblasts,
adult fibroblasts, primitive germ cells, granulosa cells, thymocytes, spleen
cells, liver
cells, macrophages, testicular cells and ovarian cells; b) transfecting the
isolated cell
using a polynucleotide coding for the recombinant protein; c) subjecting the
transfected
cell to a nuclear transfer cell cloning process, thereby generating a cloned
transfected
cell; and d) introducing the cloned transfected cell prepared in step c) into
a bovine
animal and preparing the transgenic bovine animal, said method comprising
expressing
the recombinant protein in the transgenic bovine animal and obtaining the
expressed
recombinant protein from the transgenic bovine animal
CA 02416877 2010-06-29
77811-5
3
The cells are then transformed using a nucleotide sequence coding for the
substance
of interest. In this context, substances are defined as all substances
synthesized in
the body such a proteins, polysaccharides, lipids, etc. as well as cells,
tissues and
organs that exhibit the inserted nucleotide sequence. The nucleotide sequence
coding for the substance is, therefore, not only a sequence directly coding
the
sequence but also a sequence that codes for different polypeptides / enzymes,
which
form the substance of interest within or outside of the cells. In the context
of the
present invention recombinant is defined as those genes, which for the animal
were
altered either exogenously or endogenously but were altered in their
expression
1o patterns by means of recombinant gene technology such that, for example, in
their
differentiation-specific expression pattern or quantity expressed.
All currently known techniques can be used for transformation such as
physical,
chemical or viral techniques. In view of a targeted integration of the
construct at
particular sites in the genome the use of homologous recombination is
preferred. If
large gene clusters are inserted into the host cell, then the use of
artificial
chromosomes is also possible. Cell hybrids, too, as are used in mapping, can
be
created and selected so that they include also specific chromosomal fragments
from
the target genome in addition to the production animal genome. This is
particularly
advantageous, when an entire system of the target genome is to be transferred
such
as, for example, the immunoglobulin gene system.
The cells are then subjected to a cloning process. Cloning processes are known
and
described, for example, in WO 99/36510 and WO 99/35906. The cloned cells are
then allowed to proliferate to a particular developmental stage in vivo and /
or in vitro,
to the fetus for example, and then incorporated into the host organism (Step
c) of
Claim 1). Likewise, the cloned cells are allowed to proliferate to the point
that there is
a certain differentiation, whereby already certain, differentiated cells are
incorporated
into the host organism.
The cloned cells are then inserted into a host organism, which can be an
animal, an
animal fetus, an animal embryo or an animal cell aggregate as well as cloned
animals,
cloned animal fetuses, cloned animal embryos and cell aggregates. According to
a
preferred embodiment, the original donor cells which are transformed and then
subjected to a cloning process, are of the same genotype as the host organism.
CA 02416877 2003-01-22
4
An advantage of such a procedure is that an already available - that is, a
stock host organism can
be provided with cells in a very short time, preferably of the same genotype
containing genes for
novel expression and can produce recombinant substances. The time savings so
realized in
comparison to conventional germ line gene transfer up to obtaining animals
ready for production
can be up to 5 years. Furthermore, the present method, notwithstanding the
time savings and the
more rapidly produced production system and the consequent costs savings, is
also more
efficient, since the producing organisms can be generated more cost-
effectively. Thus it is
possible to use cells of a clone available in vitro, in addition to which
already vital animals are
available, as the original donor cells for the transformation and to introduce
them after
transformation and cloning into the host organism, which, because it is a
clone, inherently has the
same genotype.
A further advantage of the herein described somatic cloning gene transfer
method is also the
possibility of a quick response to new requirements or necessities in the case
of expression of
recombinant proteins. Normally, even when using a production animal species
having a short
generation interval, such as the rabbit, for example, 7 months can lapse after
creation of the
construct until sufficient material is available for the first studies of the
expressing gene. A
further year is required to production of the target polypeptide. In the case
of cattle the process
can take at least 3 to 4 years before the polypeptide of interests can be
obtained by means of
transgenic animals. In contrast, the method according to the invention makes
it possible to
considerably shorten the time for transforming cells using a novel construct
in an already
available host organism and obtaining the expression clone (the times is
merely a couple of
months).
The method according to the invention therefore makes it possible to obtain,
in a timeframe
comparable to that of in vitro cell culture, the first protein quantities for
analysis, whereby
according to the invention a production system is already additionally
available that can be used
for producing the target substance. The host organisms or animals can
therefore be used quickly
for manufacturing of the target substances.
In certain cases it is advantageous to prepare the host organism, which
preferably is or is to be
produced for stock, specifically for subsequent somatic cell gene transfer.
This is particularly
necessary if the applied transgenic or otherwise processed cells are to be
provided with an
CA 02416877 2003-01-22
advantage relative to the cells or structures present in the host organism, in
order to obtain
improved expression or manifestation.
For this purpose, certain cells, tissues or organs can be removed, for
example, in the host
organism, which can be done using a physical, chemical, immunological,
molecular genetic or
5 surgical procedure. Furthermore, animals or fetuses that are bred negative
at specific gene loci
are homoyzygote negative (screen out concept) or kept in stock and used as
required.
One possibility for depleting certain cells, tissues, or organs in the host
organism is to use already
transgenic organisms containing the construct, which is under the control of a
developmental
stage-specific or inducible promoter. In the first instance, on activation of
the promoter during
the particular developmental stage a tissue specific protein is automatically
generated which
results in apoptosis or extinction of the particular cells; for example,
diphtheria toxin. In the
second instance, a suicide gene construct is activated, which has pre-
programmed a suitable
tissue-specific promoter by the application of a specific effector, such as
tetracycline or ecdyson,
which results in specific depletion of the cells, tissues or organs.
A simple possibility for preparing and propagating such organisms is their
cloning, using which
the construct, once introduced into the organism, can be securely passed on to
progeny. It is clear
that by doing this any cells, tissue or organs in the organism can be
influenced as needed in their
proliferation or development.
The removal of cells / tissues can be used as an example of depletion of
certain cells, from which
the milk gland normally develops. At the birth of an animal relatively few of
these cells are
present. They develop only in the course of the first gravidity and shortly
before birthing there is
a burst in proliferation and formation of the functional milk gland.
Therefore, if these animal
mammary gland stem cells, which are present only in low numbers, are removed
in the early
developmental stage of the host organism and the removed cells replaced by
recombinant
(transformed) cells of this type, which carry expression programming for
synthesis of a particular
recombinant substance, the result will be attained that in the animal organism
obtained in this
fashion the forming milk glands will develop from the applied transformed
cells. Consequently,
in the production animal the recombinant substance will also be expressed in
the introduced
mammary system. The time savings in such a procedure is about 3 years.
CA 02416877 2003-01-22
6
A further example is the total or partial removal of blood stem cells or the
stem cells of the
immune system from the host organism by irradiation, for example, or another
process and their
replacement by transformed stem cells that have been transformed according to
the invention and
subjected to a cloning process and make possible, for example, the expression
of humanized
antibodies (ABs) or AB fragments (bispecific AB, for example) or other animal
or human blood
factors. If, in the cloned stem cells the immunoglobulin genes of the animal
have been replaced
in vitro by those of the human being and if these cells are introduced into
the host organism using
the method according to the invention, then said host organisms form human-
identical polyclonal
antibodies that can be of great value in the treatment of human disease.
Furthermore, with the help of the method according to the invention an
efficient and
unproblematic production system can be provided for factors present in the
animals but whose
concentrations in said animals are too low for their collection to be economic
interest. One
example of this is the expression of several genes for heparin synthesis under
very powerful
promoters. Since heparin occurs naturally in the organism, no immunological
reaction would be
produced against the cells, which would preferably be of the identical
genotype, nor against the
product.
Recloning of the cells can be repeated at least three times. It has been found
that cells can
complete up to 150 divisions; in other words, the cells from the cloning
process survive
substantially longer than normal cells and can therefore also survive in the
animal even after
several cloning processes and express genes at least as long as the animal
lives.
In similar fashion and further development of the above areas of application,
cells can be
harvested from an available animal and embryos, fetuses and in vitro cultured
cell lines
established. These cell lines are then genetically altered using known
methods. The cells are then
differentiated directly in the in vitro culture or after re-cloning isolated
from fetal organs and
introduced as "transgenes" or otherwise genotypical, homogenetic cells into
the adult original
donor organism. Since these cells, with the exception of the transgene, do not
differ from the
original animal, the cells are capable of establishing themselves in the
animal and will produce,
for example, recombinant substances according to the genetic transformation.
According to a further aspect, the invention also relates to a method for
manufacturing cells,
CA 02416877 2003-01-22
7
tissues or organs in animal organisms, in which in a first step cells from an
individual are
isolated, the cells are introduced into an immunoincompetent animal organism,
the animal
organism is bred, the cells growing in the organism are isolated and the
isolated cells are
introduced into an individual.
This method is particularly suited for culturing cells, tissues and organs,
preferably of human
origin, in animal organisms, because the cells in the animal host organism are
increased or grow
even to form tissues and organs.
According to a preferred embodiment, the cells of the original donor
individual or the tissue or
organs cultured therefrom are reinstated into the same individual from which.
they were
harvested, whereby tissue or organs can be made available that are not
rejected when
reintroduced (transplantation) into the individual.
An immunoincompetent animal organism is defined as any animal or fetus or
animal
embryo / cell aggregate, that does not reject the cells derived from the
original donor individual.
Suitable for this purpose are organisms that have been rendered
immunodeficient as well as
organisms, which are in such an early stage of development, during which the
developing
immune system has not yet 'learnt' to differentiate between self and non-self.
Therefore, if cells
from the original donor individual are introduced into such a host organism,
these cells will not
be rejected but will be essentially recognized as self and appropriately
further develop.
Therefore, preferably animal organisms that were maintained by cloning are
suitable as animal
host organisms. Thus it is possible to keep a plurality of fetuses or embryos
or cell aggregates in
stock and to process them as needed using the cells of the original donor
individual. The
fetuses / embryos / cell aggregates are then allowed to grow to a stage, in
which they have
produced the desired effect; up to developing a mature organ or tissue or even
to the point of
developing a sufficient quantity of cells of the original donor individual,
for example. This
tissue / organ or these cells are then harvested, for example, by taking the
organ from the animal
and transplanted into the original donor individual. Naturally, this may
involve sacrificing the
animal depending on the removal of the particular organ.
The cells of the original donor individual can be introduced into a
conventional host organism. In
this case it must be expected that the animal will form chimeras from the
cells / tissue / organ
CA 02416877 2010-06-29
77811-5
8
with its own cells / tissue / organ. In order to assure that the only its
`self' cells are
reintroduced into the original donor individual, the particular overall tissue
/ organ /
cells can be isolated and the animal cells separated, which can be
accomplished, for
example, by marking using antibodies against the animal cells and separation
using
FACS (fluorescence activated cell sorting).
According to a preferred embodiment, however, the affected cells / tissue /
organs
from the host organism are removed, which can be done as hereinbefore
described.
Thus, for example, in a fetal host organism, in which the organ system is
removed, the
corresponding organ-specific stem cells of the original donor individual such
as, for
1o example, adult human stem cells that are harvested directly from the
concerned
organ, are introduced into the fetus and then replace the depleted cells and
form the
particular organ. When this is done, a chimerical organism is created, which
receives
a xenoorgan appropriate for transplantation. The affected organ represents a
xenoorgan in the animal organism, which is not rejected in virtue of the
absent
immunocompetence of the fetus. After successful transplantation to the
original donor
individual - a human patient, for example - if human stem cells were used, it
would
not be a xenogenic but an allogenic transplant or, if appropriate, even an
autologous
transplant, if the organ were created from adult stem cells of that particular
individual /
patient, which is possible in the case of certain organs and diseases
notwithstanding
the time requirement of approximately one year (kidney or liver, for example).
The use of the present method thus enables generating cells, tissues or organs
within
a short span of time so that even certain patients can be quickly provided
with organs
with a substantial or even absolute MHC type match. The method according to
the
invention, therefore, solves the currently existing problem of scarcity of
available
organs / tissues for transplantation.
The following examples explain the invention without limiting it. In the
examples the
harvesting of bispecific antibodies from the serum of non-transgenic cloned
calves is
described. The following steps were performed for creating calves with
transgenic
marrow cells, whereby reference is made to WO 99/36510 and WO 99/35906.
1. Harvesting and genetic transformation of primary bovine fetal fibroblasts.
CA 02416877 2003-01-22
9
2. Cloning by nucleus transfer of transgenic embryos to host animals.
3. Harvesting the fetuses and isolation of transgenic bone marrow stem cells
from the fetal
liver.
4. Transfusion of these transgenic cells into available clone calves of the
same chromosomal
genotype.
5. Harvesting of serum by blood drawing.
6. Lysis of tumor cells by means of bispecific antibodies.
Example 1
1. Harvesting / genetic transformation of primary bovine fetal fibroblasts
(BOFFs).
a) Investigation of the sensitivity of bovine fetal fibroblasts (BOFFs) versus
various
antibiotics (selection marker).
BOFFs were semi-confluently plated and sensitivity tested in confrontation
with neomycin
(G418), hygromycin an puromycin relative to concentration and effect / time.
Various
preparations of BOFFs showed clear differences with respect to the required
antibiotic
concentrations (up to 2100x) in order to reach the LD100. The time / effect
window between and
within preparations were in part strongly shifted. The best results were
obtained using puromycin
in a concentration of 1.5 g / ml (3 5-fold concentration versus selection of
stabile human or
murine fibroblast cell lines).
Various transfection methods, which are conventionally used for transfecting
established cell
lines, were tested for their efficacy (antibiotic-resistant clones /
transfection ratio) in BOFFs. The
following were tested:
DOSPER (Roche, lipofection, polycationic lipids);
LIPOFECTINAMINETM (GIBCOBRL Life Technologies, Lipofection, polycationic
lipids);
CLONfectinTM (Clontech, lipofection, cationic and amphilic [sic] lipids);
CA 02416877 2003-01-22
TransFastTM (Promega, lipofection, cationic and amphophilic lipids);
Ca3(PO4)2 DNA precipitates in the presence of 12% DMSO.
In contrast with establish fibroblast lines, which can be selected without
difficulty in heavy
dilution so that antibiotic resistant clones are generated, BOFFs cannot be
plated below a certain
5 critical density. In the selection for single-cell clones or in the case of
growth from extreme
dilution, in order to isolate individual clones, BOFFs either die out or go
through one or more
crises resulting in changes in morphology and / or proliferation behavior. The
plating density was
therefore chosen to allow optimal growth. However, this results in the
antibiotic resistant cells
representing a population and are not of clonal origin. -By subsequent
isolation and sub-cloning
10 transgenic clonal cell lines are generated.
b) Transfection with ScFv and pJW6puro in BOFFs
Plasmids used:
MAR::ScFv: The MAR sequences (chicken lysozyme gene matrix attachment regions;
Castilla et
al., Nat. Biotechnol. 16 (1998), 349) was cloned using ScFv in BlueScript
(Stratagene). p77
(Brem et al., Theriogenology 43 (1995), 175) in pUC18 (Norander et al., Gene
26 (1983), 101).
pJW6puro (Morgenstern & Land, Nucleic Acids Res. 18, 1068) p77 and MAR::ScFv
were
linearized in order to assure a functional integration of the constructs.
Based on the availability of
restriction enzyme cleavage points the vector sequences could not be separated
from the gene
construct sequences. pJW6puro was transfixed circularly / supercoiled. The DNA
quantities used
or the ScFv: selection marker mixing ratio was 8:1 (2.5 g p77 + 2.5 g
MAR::ScFv + 0.6 g
pJW6puro = 5.6 g total DNA) or 3:1 (0.7 g p77 + 0.9 g MAR::ScFv + 0.6 gg
pJW6puro = 2.2 g total DNA).
When this was done, BOFF #32330201 pl cells were used from which more than 1
year before
transfection embryos and after transfer, clone calves (10 calves born) were
generated. After
treatment with trypsin the cell suspension was transferred into 10 mm culture
plates and cultured
using Dulbecco's modified Eagle's medium (Gibco, Grand Island, NY),
supplemented with 10%
fetal calve serum (Biochrom, Berlin), 2 mM L-glutamine, 104 mM 2-mercapto
ethanol, 2 mM
non-essential amino acids (Sigma, St. Louis, MO), 100 1U/ml penicillin and 100
g/ml
CA 02416877 2003-01-22
11
streptomycin. The cells are cultured at 37 C under 5% CO2 in air until the
cell sheet was sub-
confluent (2 to 3 days) whereupon a part of this "0 passage" was frozen (10%
dimethyl sufoxide,
Sigma) and stored in liquid nitrogen.
Transfection preparations: BOFFs were plated prior to transfection sub-
semiconfluently
(approximately 5x104 105 cells) in 6-well culture dishes (0 35 mm) (MEM, 15%
FCS, lx
glutamine / penicillin / streptomycin). Transfection was done after setting
and manifestation of
fibroblast morphology by the cells. A transfection experiment was done for
each 0 35 mm plate.
Transfast Lipofection: DNA:liposome ratio = 1:2, incubation time 1.5 hour.
Ca3(PO4)2 DNA precipitate transfection:
After an incubation time of 4 hours, transfection efficiency was augmented by
the addition of
12% DMSO for 2 min (Muller et al., EMBO J. 12 (1993), 4221).
Selection, establishment and analysis of transfectant pools:
The selection medium was added 24 hours after transfection. After 2 days of
section in 6-well
culture plates the cells of one 0 35 mm well were divided 1:150 on a 24-well
plate
(concentration 28x 102 cells/plate) Selection was continued until there was
sub-confluent
growth with puro BOFFs on the plate (49 days). The pools were expanded,
cryopreserved and
tested for successful transfection with p77 MAR::ScFv using PCR.
Screening for ScFv transfectants:
Primer 377L2 / f 5'CAGGTGTCCTCTCTGACATCG3' and
377R2 5'CGCAGAGTCCACAGAGG3'
(Annealing temperature, 66 C; 1 kb amplificate)
Screening for p77 transfectants:
Primer: 246 5'GAAGA000CATTTTGTCCCAAG3' and
251 5'GTCCCGAGGTAGATCTTCCC3'
CA 02416877 2003-01-22
12
(Annealing temperature, 62 C; 2.5 kb amplificate)
Primer: 248 5'GATGCTTCTCTATTCCTCTG3' and
251 5'GTCCCGAGGTAGATCTTCCC3'
(Annealing temperature, 60 C; 1.2 kb amplificate)
PCR Results:
Transfast lipofection: with both tested DNA ratios no p77 / MAR::ScFv
positive pools.
Ca3(PO4)2 DNA precipitate transfection: -DNA of interest: selection
marker=3:1: no
p77 / MAR::ScFv positive pools.
Ca3(PO4)2 DNA precipitate transfection: DNA of interest: selection marker =
8:1 (Pool 3): 6 of
24 pools positive for p77 and MAR::ScFv characterization of the positive clone
/ pool: A3, B2,
B3, C2, C3, C6 (strong signal).
Example 2
The animals were cloned according to the method descried in PCT/EP98/00229 and
the
transgenic embryos were transferred to the host animals.
Example 3
Harvesting of the fetuses and isolation of transgenic bone marrow stem cells
from the fetal liver.
Transgenic bovine fetuses were harvested in the second trimester of gravidity.
In this period, the
hepatolineal period of fetal development, the liver is the principal site of
blood formation and the
locus of stem cells of all blood cells, the hemocystoblasts. The B lymphocytes
develop from
these hemocystoblasts after migration into the marrow cavity of the bones in
the course of
lymphocytopoiesis. The fetal liver is harvested aseptically and placed in RPMI
medium with 4
g gentamycin sulfate and 200 IU/ml heparin as an anticoagulant. Separation of
the individual
cells is done under strictly sterile conditions.
Example 4
CA 02416877 2003-01-22
13
Transfusion of the transgenic cells into clone calves of the same chromosomal
genotype.
Transplantation of the fetal hematopoietic cells is done in a suspension of
physiological saline
solution or medium by intravenous catheter infusion (14 gauge, 1.7 mm x 64 mm,
Teruno Co.,
Ltd).
Example 5
Harvesting and purification of serum by blood drawing.
Blood is collected in regular intervals after transfusion of the transgenic
blood cells- by puncture
of the Venajugularis. Serum is separated from the blood cells by centrifuging
the blood (1000
xg, 30 min). Sodium azide (final concentration: 0.02%) is added to the serum
and it is then
filtered through a cellulose acetate filter (0.22 m). The residue is adjusted
to pH 7.2 using 1 M
NaOH. For biscFV molecule cleanup, the culture residue is passed through a
protein L-agarose
column (#20520 Pierce, Rockford II, USA) that has been equilibrated using 0.1
M sodium
phosphate buffer (protein L binds human IgG, in particular single chain
variable elements (ScFv)
but not bovine IgG1 and IgG2). After application of the culture residue, the
column bed is
washed with 0.1 M phosphate buffer. The bound proteins are eluted using a 0.1
M glycine buffer
stepwise at pH 3.0 and 2Ø The collected eluate is dialyzed over night
against PBS, 0.22 m
sterile filtered and stored at 4 C.
Example 6
Lysis of tumor cells using bispecific antibodies.
The biological activity of the bispecific antibodies is tested in the
cytotoxicity test using 5,000
SKMel63 or M21 tumor cells. These two melanoma cell lines are strongly
positive for the
HMWG (high molecular weight glycoprotein) target antigen, which is recognized
by the 9.2.27
monoclonal antibody (only the scFv portion). Peripheral blood lymphocytes
(PBLs harvested
fresh from healthy human donors and isolated by Ficoll gradient). are added to
the target cells in
a ratio of 10:1. Then 150 p.g/ml chemically conjugated bsF(ab')2 with 9.2.27 x
CD3 specificity
(melanoma x T lymphocyte in all cell culture plates for panclonal stimulation
of all T
lymphocytes, at this concentration alone it exhibits no mitogenic properties)
is added. then the
recombinant biscFv molecules purified from the serum are added directly. The
total volume of
CA 02416877 2003-01-22
14
the experimental preparation per cell culture plate in the microtitre plate is
150 l. The plate is
incubated for 5 days in the incubator at 37dc/5% CO2. The non-adhering blood
lymphocytes are
removed after multiple washings with PBS so that only the residual adherent
tumor cells remain
in the cell culture dishes (visual inspection). 100 l of fresh medium and 10
l of the cell
proliferation stain WST (Boehringer Mannheim, <Category>Abbreviation. N 1644
807) is
added to the cell culture dishes. Incubation then follows (47dc/5% C02) in the
incubator for 1 to
4 hours and which is then followed by evaluation by ELISA reader (480 nm).
Visual assessment
and the low optical density show 100% tumor cell killing. This demonstrates
that recombinant
bispecific antibodies produced in transgenic blood cells are highly efficient.
CA 02416877 2003-05-30
1
SEQUENCE LISTING
<110> ApoGene
<120> Somatic Cloning Gene Transfer for Producing Recombinant
Proteins, Cells and Organs
<130> 77811-5
<140>
<141>
<150> PCT/EPOO/07239
<151> 2000-07-27
<160> 6
<170> Patentln Ver. 2.1
<210> 1
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: ScFv
<400> 1
caggtgtcct ctctgacatc g 21
<210> 2
<211> 17
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: ScFv
<400> 2
cgcagagtcc acagagg 17
<210> 3
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artific:i.al Sequence: ScFv
<400> 3
gaagacccca ttttgtccca ag 22
<210> 4
<211> 20
<212> DNA
<213> Artificial Sequence
CA 02416877 2003-05-30
2
<220>
<223> Description of Artificial Sequence: ScFv
<400> 4
gtcccgaggt agatcttccc 20
<210> 5
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: ScFv
<400> 5
gatgcttctc tattcctctg 20
<210> 6
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: ScFv
<400> 6
gtcccgaggt agatcttccc 20
