Note: Descriptions are shown in the official language in which they were submitted.
CA 02422362 2003-03-13
WO 02/22811 PCT/CA01/01306
MODULATION OF MEIOTIC RECOMBINATION
FIELD OF THE INVENTION
The invention is in the field of genetic manipulation of eulcaryotic cells and
organisms, particularly the modulation of homologous recombination between non-
sister
chromatids in meiosis.
BACKGROUND OF THE INVENTION
Mitosis and meiosis are in many ways opposite processes. A principal role of
DNA
recombination in mitotic cells is to preserve the fidelity of genetic
information and ensure
that it is faithfully reproduced and passed on to daughter cells. In contrast,
DNA
recombination during meiosis acts to create new permutations of genetic
information by
facilitating reshuffling or intermixing of the maternal and paternal genomes
during gamete
formation to enable production of offspring with novel genomes as compared to
either parent.
The different purposes of DNA recombination in meiotic versus mitotic cells
are reflected in
the very different rolls and mechanisms of homologous recombination in each
cell type [1-5;
7; 8].
There is a fundamental mechanistic distinction between the primary processes
of
homologous recombination in meiotic (germ-line) cells compared to mitotic
(vegetative/somatic) cells. In meiotic cells, homologous recombination occurs
primarily
between non-sister chromatids (to shuffle the genome), whereas in mitotic
cells homologous
recombination occurs primarily between sister chromatids (to correct genomic
errors). Sister
chromatids are replicated copies of a particular maternal or paternal
chromosome.
Recombination between non-sister chromatids (i.e. between a paternal chromatid
and a
maternal chromatid) occurs 500-1000 fold more frequently in meiotic cells
versus mitotic
cells [48;50]. The meiotic process of non-sister chromatid exchange (NSCE)
facilitates novel
recombination of the genetic information from two parents of the organism. In
contrast, the
mitotic process of sister-chromatid exchange (SCE) resulting from
recombination-mediated
repair is a primary mechanism for maintaining genome fidelity throughout a
multi-cellular
organism.
There are a significant number of mechanical distinctions between mitotic SCE
and
meiotic NSCE, as these processes are currently understood. Physical
interactions and
recombination between meiotic chromosomes is associated with formation and
function of
- 1 -
CA 02422362 2012-09-11
the synaptonemal complex which is a unique proteinaceous structure that
assembles during
meiosis and participates in enabling pairing and exchange between non-sister
chromatids
[156; 157; 158; 159; 160]. Double-strand breaks in meiotic recombination are
understood to
be catalysed by a conserved, specific enzyme, SPO1 1 [4;9-11], whereas in
mitotic cells
double-strand breaks generally result from spontaneous lesions [3;7]. SPO1 1
is a Type II
topoisomerase [121] that is responsible for double-strand break formation in
meiotic
homologous recombination [9;121].
SP011 proteins are identifiable based on their homology with respect to five
conserved protein motifs of the archaebacterial subunit A of Topoisomerase VI
[121].
Motif I, as depicted in Figure 1, contains the active site tyrosine, and
motifs III to V include
what has been called the "Toprim" (topoisomerase and primase) domain [166].
Motif III
includes an invariant glutamate residue (E), and motif V includes a "DXD"
motif. This trio
of acidic residues fall within an "acidic pocket" anf appear to coordinate
Mg+2 binding to
assist catalysis of cleavage of DNA by the active site tyrosine [167].
Mutations in this acidic
pocket impair or abolish the ability of SPO1 1 to create double strand breaks
in vivo [167].
Table 1. Key Amino Acid Residues in the Five Conserved Motifs Present in SPO1
1 Proteins
is Amino acid in TOPVLA Corresponding amino acid
from S. Shibataa AtSP011-1b
Thr 100 Ser 97
Arg 102 Arg 99
Tyr 106 Tyr 103
Arg 150 Arg 130
Gly 161 Gly 141
Glu 209 Glu 189
Phe 214 Phe 194
Leu 217 Leu 197
Gly 235 Gly 215
Pro 237 Pro 217
Thr 241 Thr 221
Arg 242 Arg 222
Asp 261 Asp 241
Asp 263 Asp 243
Pro 264 Pro 244
Gly 266 Gly 246
Ile 269 Ile 249
a The amino acid numbering for TOP VIA from S. Shibata is taken from Figure 1
of Bergerat
et al. [121]
b The amino acid numbering for SPO1 1 from A. thaliana (SEQ ID NO: 40) is
taken from
Hartung, F. and Puchta, H. [14]
- 2 -
CA 02422362 2012-09-11
Arabidopsis thaliana has two SPO1 1 proteins, Arabidopsis thaliana SP011-1
(AtSPO1 1-1) and Arabidopsis thaliana SPO1 1-2 (AtSPO1 1-2) [14]. The amino
acid
sequences of AtSPO1 1-1 and AtSP011-2 are provided in Figures 1B and 1C,
respectively.
Table 1 identifies the AtSPO1 1 residues that correspond to the key conserved
SPO1 1
residues [121].
Upon formation of double strand breaks in either SCE or NSCE, the exposed
double-
stranded ends are understood to be resected by an exonuclease activity that
degrades the
DNA to generate single-stranded DNA (ssDNA) ends which have a 3'-hydroxyl
group. This
resection process is understood to be catalysed by a protein complex composed
of at least
three known proteins, MRE11, RAD50 and XRS2/NBS1 which are conserved from
yeast to
plants and humans [12-19]. The ssDNA ends may then be acted upon by another
set of
proteins so that the ends invade the sister chromatid in mitotic cells or,
uniquely, the
chromatid of the paired homologous chromosome from the other parent in meiotic
cells.
Strand invasion may be catalysed by a group of proteins which are known as
RecA
homologues as a consequence of their sequence and functional similarity to the
Escherichia
coli RecA protein. RecA has been extensively studied and has been demonstrated
in vitro to
catalyse pairing between homologous DNA molecules and strand invasion [6].
Yeast are
reported to have at least four proteins with homology to RecA: RAD51; RAD55;
RAD57;
and DMC1 [5]. These proteins are also highly conserved in plants and humans
[21;22;24;25;39]. Eukaryotic RecA homologues also catalyse pairing between
homologous
DNA molecules and strand invasion [51;52]. Genetic studies illustrate the
primacy of this
group of proteins in mitotic and meiotic homologous recombination [13;20;23;53-
57]. These
biochemical and genetic studies demonstrate the high conservation of function
of RecA
homologues from lower to higher eukaryotes. Whereas RAD51, RAD55 and RAD57
play a
role in both mitotic and meiotic homologous recombination [23;56], DMC1
functions in a
meiosis-specific manner [20;54;55]. Biochemical and genetic evidence points to
RAD51,
RAD55 and RAD57 interacting in a common pathway whereas DMC1 acts in a unique
but
overlapping pathway [53;56]. The existence of two unique pathways of RecA
homologues
acting during meiosis is also supported by cytological studies whereby DMC1
and RAD51
are found at different nodes along the chromosome undergoing recombination
[53]. RAD51,
RAD55 and RAD57 may only facilitate homologous recombination on DNA molecules
with
a specific structure and topology unique to this group of proteins [59]. It
has been proposed
that DMC1 may act on specific DNA structures, potentially not recognized by
RAD51,
-2a-
CA 02422362 2003-03-13
WO 02/22811 PCT/CA01/01306
RAD55 or RAD57, to promote pairing and recombination between homologous
maternal and
paternal chromosomes and catalyse NSCE [53;60]. These DNA structures may be
meiosis-
specific, again illustrating the unique attributes of homologous recombination
involving
NSCE during meiosis versus SCE in mitotic cells.
While RAD51 and DMC1 can apparently catalyse pairing and strand invasion
alone,
they also act in concert with other proteins that enhance homologous
recombination. For
example, RAD51 physically interacts with RAD54 [61;62] and RAD52 [42] and both
of
these proteins are conserved from yeast to humans [64;65]. Inclusion of RAD54
or RAD52
in in vitro assays demonstrate these proteins can stimulate the pairing and
strand invasion
activity of RAD51 [23;66]. DMC1 does not physically interact with RAD54 [53]
but does
interact with a RAD54 homologue, known as TID1 [53], which acts in NSCE during
meiosis
[49]. This again illustrates the uniqueness of the homologous recombination
pathways
catalysed by DMC1 versus RAD51. In addition to the promoting effects of RAD54
and
RAD52, homologous recombination is enhanced by a complex of proteins which
bind
ssDNA. In eukaryotes, this protein complex is a heterotrimer known as RPA
[26]. ssDNA-
binding proteins function in DNA recombination and repair by reducing
secondary structure
in ssDNA thereby increasing the ability of RecA-like proteins to bind and act
upon the
ssDNA [67]. RPA is conserved from yeast to humans [26]. RPA has been
demonstrated to
physically interact with RAD51 and DMC1 [68], as well as associating with
RAD52 [69],
and may thereby act in recruiting RecA-homologues and/or other recombination
proteins to
recombinogenic ends, or assist in forming recombinogenic DNA-protein
complexes.
Other participants in the pairing and strand exchange processes leading to
homologous recombination in meiotic cells include MSH4, MSH5 and
MLH1[27;29;31].
These proteins are also conserved from yeast to plants and humans
[28;30;32;33] . MLH1
functions principally in mismatch repair to ensure fidelity of DNA replication
in vegetative
cells but also plays a role in homologous recombination in meiotic cells [31].
MSH4 and
MSH5 are meiosis-specific homologues of a set of proteins, unique from MLH1,
which
function in mismatch repair in vegetative cells [27; 29] . The biochemical
role of MSH4 and
MSH5 during meiosis is unclear as yet but evidence points to these proteins
participating in
DNA exchange between homologous chromosomes [27; 29]. The specificity of MSH4
and
MSH5 to homologous recombination in meiotic cells again points to the
uniqueness of this
homologous recombination process versus that which occurs in vegetative cells.
- 3 -
CA 02422362 2003-03-13
WO 02/22811 PCT/CA01/01306
Strand invasion and formation of the initial crossover or chiasma between the
sister
chromatids in vegetative cells and non-sister chromatids in meiotic cells is
followed by
branch migration, DNA replication and strand displacement. This increases the
length of
genetic information exchanged between the two chromatids. A second chiasma
then occurs.
The chiasma are acted upon by an enzyme known as a resolvase. This family of
enzymes
recognize and bind the cruciform structure created by the chiasma between the
paired
chromatids. Resolvases have been well characterized in microorganisms,
including lower
eukaryotes[43; 44], and the activity has been detected in humans [161] .
It has been suggested that recombinases may be used to stimulate mitotic
homologous
recombination between sister chromatids in eukaryotes, which has been proposed
as a
mechanism to promote gene targeting in vegetative/somatic cells [63;82;85;86].
Gene
targeting generally involves the directed alteration of a specific DNA
sequence in its
genomic locus in vivo. Problems have however been reported with mitotic gene
targeting. It
has for example been found that overexpression of RecA-homologues in mitotic
cells may
cause cell cycle arrest [92]. International Patent Publication WO 97/08331
dated 6 March
1997 summarizes a range of difficulties with earlier suggestions that the E.
colt RecA
recombinase would be useful for stimulating homologous mitotic recombination
(as for
example had been suggested in International Patent Publications WO 93/22443,
WO
94/04032 and WO 93/06221). Utilization of E. colt RecA in eukaryotic cells is
potentially
problematic because the direction of strand transfer catalysed by RecA is the
opposite to the
direction of strand transfer catalysed by eukaryotic RecA homologues [52].
Nevertheless,
overexpression of E. colt RecA has been reported to promote gene targeting
approximately
10-fold in mouse cells [63] and less than two-fold in plants [82]. However,
this latter result
in plants also demonstrated a very low overall frequency of gene targeting,
which would tend
to cast doubt on the statistical significance of the result.
In the face of difficulties associated with the use of E. coli RecA in mitotic
gene
targeting, alternative enzymes have been used to catalyse homologous sister
chromatid
exchange in mitotic cells. For example, U.S. Patent Nos. 5,780,296 and
5,945,339 disclose
methods to promote homologous recombination using Rec2 as an alternative
recombinase to
overcome problems with the use of RecA [86]. It has been reported that
overexpression of
human RAD51 (hRAD51) can increase gene targeting frequency by 2-3 fold [85].
In applications other than gene targeting in mitotic cells, other studies have
suggested
that increased expression of E. colt RecA or RAD51 may increase the resistance
of cells to
- 4 -
CA 02422362 2003-03-13
WO 02/22811 PCT/CA01/01306
radiation or other DNA damaging agents [82; 85; 87-89; 91], and enhance the
frequency of
intrachromosomal recombination [88;90;91] and sister-chromatid exchange [82].
It has also
been suggested that increased RAD51 activity during meiosis has no effect on
the viability of
gametes, although no evaluation of homologous recombination in these cells was
conducted
[87]. Identification of mechanistic steps in meiotic homologous recombination
has utilized
genetic analysis of mutants to identify genes involved in homologous
recombination and
DNA repair, and mutants with reduced meiotic homologous recombination have
been
identified [9;20;23;93]. Null-mutations typically have a severe effect on the
whole meiotic
process, and can affect viability of gametes [9;20;54;55;93-95] and have
pleiotropic effects
on the organism at different developmental stages or in different tissues or
in response to
environmental conditions. For example, rad51 null mutants may have decreased
meiotic
homologous recombination frequency but they also reportedly have poor DNA
repair and
resistance to environmental stresses and DNA damaging agents [96;97], as well
as a lethal
phenotype in embryos [95].
SUMMARY OF THE INVENTION
The present invention recognizes the need in the art for methods of modifying
the
frequency of non-sister chromatid exchange in meiosis to facilitate heritable
genomic
changes during gamete formation, for example to facilitate breeding of plants
and animals
and for gene targeting in meiotic cells. The invention provides methods of
modifying the
level of expression or functional activity of factors such as enzymes or other
catalytic
proteins or structural proteins alone or in concert, to modify the frequency
of meiotic
homologous recombination involving the exchange of genetic information between
non-sister
chromatids from homologous maternal and paternal chromosomes. The steps at
which
modulation may occur include: homologous chromosome pairing, doublestrand
break
formation; resection; strand invasion; branch migration; and resolution.
In one aspect, the invention provides methods of increasing meiotic homologous
recombination in a eukaryote, comprising transforming a eukaryotic cell with a
nucleic acid
encoding an activator of meiotic homologous recombination. The nucleic acid
encoding the
activator of meiotic homologous recombination may be operably linked to a
promoter, so that
the transformed eukaryotic cell is capable of expressing the activator of
meiotic homologous
recombination. The transformed eukaryotic cell, or its progeny, may then be
allowed to
undergo meiosis to produce viable gametes under conditions wherein the
activator of meiotic
- 5 -
CA 02422362 2003-03-13
WO 02/22811 PCT/CA01/01306
homologous recombination is active during meiosis to increase the frequency of
homologous
non-sister chromatid exchange (NSCE). In alternative embodiments, the
activator of meiotic
homologous recombination may be an enzyme or other catalytic protein or
structural protein,
or transcription factor controlling the expression thereof, involved in
meiotic homologous
recombination, such as a eukaryotic homologue of SPO 1 1 [9-11], MREll [12-
15], RAD50
[16;17], XRS2/NBS1 [18;19], DMC1 [20-22], RAD51 [21;23-25], RPA [26], MSH4
[27;28],
MSH5 [29;30], MLH1 [31-33], RAD52 [34;35], RAD54 [36;37], TID1 [53], RAD55
[38;39], RAD57 [39;40], Rad59 [41;42] or Resolvase [43;44;161] or chromatin
remodeling
proteins [152-155] or synaptomemal complex proteins (proteins associated with
assembly
and function of the synaptonemal complex) [156; 157; 158; 163] . In some
embodiments, the
frequency of mitotic homologous sister chromatid exchange in the eukaryote may
not be
altered to a level detrimental to cell viability, growth or reproduction,
while the frequency of
meiotic homologous recombination is increased or decreased. The promoter may
be
regulatable by induction or repression or may be a meiosis-specific promoter
or a promoter
with enhanced expression during meiosis, i.e. a preferentially-meiotic
promoter, or a
promoter capable of expressing the activator at a level sub-inhibitory to
vegetative cells. The
invention includes non-human eukaryotes produced by such processes.
In alternative aspects, the invention provides methods of selectively
inhibiting meiotic
homologous recombination in a eukaryote. Such methods may involve transforming
a
eukaryotic cell with a nucleic acid encoding an inhibitor of meiotic
recombination. The
nucleic acid encoding the inhibitor of meiotic recombination may be operably
linked to a
promoter, such as a promoter regulated by induction or repression, meiosis-
specific or
preferentially-meiotic promoter, or a promoter capable of expressing the
activator at a level
sub-inhibitory to vegetative cells, so that the transformed eukaryotic cell
may be capable of
expressing the inhibitor of meiotic recombination. The transformed eukaryotic
cell, or a
descendant of the transformed eukaryotic cell, may then be allowed to undergo
meiosis to
produce viable gametes under conditions wherein the inhibitor of meiotic
recombination is
active during meiosis to decrease the level of homologous non-sister chromatid
exchange.
The inhibitor of meiotic recombination may be a dominant-negative form (such
as a mutant
endogenous protein or a mutant or wild-type heterologous protein) of an enzyme
or other
catalytic protein or a structural protein, or transcription factor controlling
the expression
thereof, involved in meiotic homologous recombination. In some embodiments,
the
frequency of mitotic homologous sister chromatid exchange in the eukaryote may
not be
- 6 -
CA 02422362 2013-10-18
altered to a level detrimental to cell viability, growth or reproduction,
while meiotic
homologous recombination is increased or decreased. The invention includes non-
human
eukaryotes produced by such processes.
In alternative aspects, the invention provides methods of plant and animal
breeding, in
which the frequency of non-sister chromatid exchange in meiotic homologous
recombination is
modulated, prior to crossing a gamete from the parent organism with a second
gamete to obtain
progeny. The invention includes non-human eukaryotes produced by such
processes.
The invention also provides methods of genomic mapping and map-based gene
cloning
comprising modulating the frequency of non-sister chromatid exchange in
meiotic homologous
recombination in a first cell, crossing the first cell with a second cell, and
measuring the genetic
linkage between markers in a progeny cell.
Various embodiments of the invention provide a method of modulating meiotic
homologous recombination in plant cells, comprising: transforming a plant cell
of a plant
species with a nucleic acid encoding a protein, wherein the protein comprises
five conserved
motifs present in SPO 1 1 proteins, wherein the five conserved motifs
correspond to residues 90
to 103, 130 to 149, 182 to 197, 209 to 228, and 241 to 249 of Arabidopsis
thaliana SP011-1
(AtSP011-1) when the amino acid sequences of the protein and AtSP011-1 are
aligned using
the BLAST algorithm, and wherein, when the amino acid sequences of the protein
and
AtSP011-1 are aligned using the BLAST algorithm, the protein further
comprises: arginine at a
position corresponding to arginine 99 of Arabidopsis thaliana SP011-1 (AtSPO 1
1 -1); tyrosine
at a position corresponding to tyrosine 103 of AtSP011-1; arginine at a
position corresponding
to arginine 130 of AtSP011-1;glycine at a position corresponding to glycine
141 of AtSP011-
1; glutamate at a position corresponding to glutamate 189 of AtSP011-1;
phenylalanine at a
position corresponding to phenylalanine 194 of AtSP011-1; leucine at a
position corresponding
to leucine 197 of AtSP011-1; glycine at a position corresponding to glycine
215 of AtSP011-
1; proline at a position corresponding to proline 217 of AtSP011-1; threonine
at a position
corresponding to threonine 221 of AtSP011-1; arginine at a position
corresponding to arginine
222 of AtSP011-1; aspartate at a position corresponding to aspartate 241 of
AtSP011-1;
proline at a position corresponding to proline 244 of AtSP011-1; glycine at a
position
corresponding to glycine 246 of AtSP011-1; and isoleucine at a position
corresponding to
7
CA 02422362 2013-10-18
isoleucine 249 of AtSP011-1,wherein the protein is operable to initiate
meiotic recombination,
wherein said nucleic acid is operably linked to a promoter; and allowing the
transformed plant
cell, or a descendant of the transformed plant cell, to undergo a meiotic
event to produce a
viable gamete, wherein expression of the protein in the transformed plant cell
or the descendant
increases the frequency of homologous non-sister chromatid exchange during the
meiotic
event.
Various embodiments of the invention provide a plant cell of a plant species,
comprising a recombinant nucleic acid encoding: a protein, wherein the protein
comprises five
conserved motifs present in SPO1 1 proteins, wherein the five conserved motifs
correspond to
residues 90 to 103, 130 to 149, 182 to 197, 209 to 228, and 241 to 249 of
Arabidopsis thaliana
SP011-1 (AtSP011-1) when the amino acid sequences of the protein and AtSP011-1
are
aligned using the BLAST algorithm, and wherein, when the amino acid sequences
of the
protein and AtSP011-1 are aligned using the BLAST algorithm, the protein
further comprises:
arginine at a position corresponding to arginine 99 of Arabidopsis thaliana
(AtSP011-1);
tyrosine at a position corresponding to tyrosine 103 of AtSP011-1; arginine at
a position
corresponding to arginine 130 of AtSP011-1; glycine at a position
corresponding to glycine
141 of AtSP011-1; glutamate at a position corresponding to glutamate 189 of
AtSP011-1;
phenylalanine at a position corresponding to phenylalanine 194 of AtSP011-1;
leucine at a
position corresponding to leucine 197 of AtSP011-1; glycine at a position
corresponding to
glycine 215 of AtSPO1 1-1; proline at a position corresponding to proline 217
of AtSP011-1;
threonine at a position corresponding to threonine 221 of AtSP011-1; arginine
at a position
corresponding to arginine 222 of AtSP011-1; aspartate at a position
corresponding to aspartate
241 of AtSP011-1; proline at a position corresponding to proline 244 of
AtSP011-1; glycine at
a position corresponding to glycine 246 of AtSP011-1; and isoleucine at a
position
corresponding to isoleucine 249 of AtSP011-1, wherein said nucleic acid is
operably linked to
a promoter, and wherein the plant cell is operable to undergo a meiotic event
to produce a
viable gamete, wherein expression of the protein in the plant cell increases
the frequency of
homologous non-sister chromatid exchange during the meiotic event.
Various embodiments of the invention provide a plant cell of a plant species,
7a
CA 02422362 2013-10-18
comprising a recombinant nucleic acid encoding: a protein, wherein the protein
comprises five
conserved motifs present in SPO 1 1 proteins, wherein the five conserved
motifs correspond to
residues 90 to 103, 130 to 149, 182 to 197, 209 to 228, and 241 to 249 of
Arabidopsis thaliana
SPO 1 1-1 (AtSPO 1 1-1) when the amino acid sequences of the protein and AtSPO
1 1-1 are
aligned using the BLAST algorithm, and wherein, when the amino acid sequences
of the
protein and AtSP011-1 are aligned using the BLAST algorithm, the protein
further comprises:
arginine at a position corresponding to arginine 99 of Arabidopsis thaliana
(AtSP011-1);
arginine at a position corresponding to arginine 130 of AtSP011-1; glycine at
a position
corresponding to glycine 141 of AtSP011-1; glutamate at a position
corresponding to
glutamate 189 of AtSP011-1; phenylalanine at a position corresponding to
phenylalanine 194
of AtSP011-1; leucine at a position corresponding to leucine 197 of AtSP011-1;
glycine at a
position corresponding to glycine 215 of AtSP011-1; proline at a position
corresponding to
proline 217 of AtSP011-1; threonine at a position corresponding to threonine
221 of AtSP011-
1; arginine at a position corresponding to arginine 222 of AtSP011-1;
aspartate at a position
corresponding to aspartate 241 of AtSP011-1; proline at a position
corresponding to proline
244 of AtSP011-1; glycine at a position corresponding to glycine 246 of
AtSP011-1; and
isoleucine at a position corresponding to isoleucine 249 of AtSP011-1, wherein
the protein
lacks a tyrosine at a position corresponding to tyrosine 103 of AtSP011-1,
wherein the protein
is operable to inhibit double strand break catalysis by an endogenous SPO 1 1
protein, and
wherein said nucleic acid is operably linked to a promoter, wherein the plant
cell is operable to
undergo a meiotic event to produce a viable gamete, and wherein expression of
the protein in
the plant cell decreases the frequency of homologous non-sister chromatid
exchange during the
meiotic event.
DETAILED DESCRIPTION OF THE INVENTION
In one aspect of the invention, the frequency of homologous recombination
between
non-sister chromatids during meiosis is increased or decreased by specifically
changing the
activity level of one or more activators or inhibitors of meiotic homologous
recombination,
such as proteins involved in homologous recombination, to affect one or more
steps of the
homologous recombination process.
7b
CA 02422362 2013-10-18
Taking advantage of the fact that meiotic homologous recombination between
homologous non-sister chromatids first requires a double-strand break in one
of the paired
homologues, one aspect of the present invention facilitates an increase in the
potential for
homologous recombination events by increasing the number of double-strand
breaks. Local
chromatin structure plays an important role in the positioning and frequency
of meiotic double-
strand breaks leading to meiotic homologous recombination [151]. Chromatin
structure
remodeling may be a result of the action of two groups of enzymes highly
conserved among
eukaryotes: 1) ATP-dependent remodeling complexes, and 2) histone
acetyltransferases and
histone deacetylases [152-155]. Thus one may increase the frequency of double-
strand breaks
by modifying the activity level of chromatin remodeling enzymes to create
chromatin structure
that facilitates a greater incidence of double-strand break formation. This
may be achieved, for
example, by enhancing histone acetyl transferase activity. Conversely one may
decrease the
frequency of double-strand breaks by modifying the activity level of chromatin
remodeling
enzymes to create chromatin structure that is less amenable to double-strand
break formation.
This may be achieved, for example, by
7c
CA 02422362 2003-03-13
WO 02/22811 PCT/CA01/01306
enhancing histone deacetylase activity. In addition to the manipulation of
chromatin
structure, the frequency of double-strand break formation may be achieved, for
example, by
increasing the level of SPO 1 1 activity during appropriate stages in meiosis
or other
appropriate stages in the cell cycle. Conversely, one may reduce the frequency
of
homologous recombination during meiosis by suppressing the function or
expression of
SPO 1 1 at appropriate stages in meiosis, to decrease the number of double-
strand breaks
available and, therefore, decrease the frequency of initiating DNA exchange
between
homologous chromosomes during meiosis.
In alternative embodiments, meiotic homologous recombination frequency may be
modified by modifying the activity level of enzymes involved in resection of
double-stranded
DNA (dsDNA) to create ssDNA ends required for strand invasion of the paired
homologous
chromosome. Thus, activity of MRE11, RAD50 and/or XRS2/NBS1 could be increased
to
promote creation of recombinogenic ssDNA by increasing the number of double-
strand
breaks created by SPO 1 1 being converted into recombinogenic ssDNA, to
increase the
frequency of meiotic homologous recombination. Conversely, frequency of
meiotic
homologous recombination may be decreased by reducing the activity of MRE11,
RAD50
and/or XRS2/NBS1 so as to decrease the conversion of double-strand breaks
created by
SPO 1 1 into recombinogenic ends. In addition, modifying the resection process
may be used
to increase gene targeting frequency by promoting conversion of gene targeting
substrates to
DNAs having recombinogenic ends, for example by increased activity of SP011,
MRE11,
RAD50 and/or XRS2/NBS1.
In alternative embodiments, meiotic homologous recombination frequency may be
modulated by modifying the activity of enzymes and structural proteins
involved in pairing of
homologous DNA and strand invasion. Thus, activity of RecA homologues such as
RAD51
and DMC1 may be increased in meiosis to promote homologous DNA pairing of non-
sister
chromatids and initiation of crossovers by strand invasion. Increased activity
levels of these
proteins may increase conversion of recombinogenic ends created by MRE11,
RAD50 and
XRS2/NBS1 into functional crossover events thereby increasing homologous
recombination
frequency. Because RAD51 and DMC1 act in unique but overlapping pathways [53],
one
may modulate the homologous recombination frequency and frequency of NSCE by
increasing the activity of DMC1 and RAD51 individually or in concert.
Conversely, the
activity level of DMC1 and RAD51 alone or in concert may be decreased to
decrease the
frequency of NSCE. Other RecA homologues such as RAD55 and RAD57 may also be
used
- 8 -
CA 02422362 2003-03-13
WO 02/22811 PCT/CA01/01306
in this way in meiosis. In addition, other proteins participating in
homologous DNA pairing
and strand-invasion, such as MSH4, MSH5 and MLH1, may be used to increase or
decrease
meiotic homologous recombination frequency through modulating their activity
levels at
appropriate stages of meiosis. ssDNA-binding proteins such as EcSSB or RPA
which may
function coordinately with RecA homologues may also be used to modulate
homologous
recombination frequency. For example, during meiosis, reducing the level of
RPA in the
nucleus or the activity of RPA within the nucleus may affect the activity of
RecA
homologues during meiosis and change the homologous recombination frequency.
In alternative embodiments, meiotic homologous recombination frequency may be
modulated by modifying the activity of proteins that act in conjunction with
RecA
homologues to promote DNA pairing and crossing-over. For example, meiotic
homologous
recombination may be increased by increasing activity level of RAD54 and TID1,
alone or in
concert, independently or coordinately with RAD51 and/or DMC1 (RAD51 activity
is
stimulated in vitro by inclusion of RAD54 [66] and TID1 is a homologue of
RAD54 that
physically interacts with DMC1 [53]). Conversely, meiotic homologous
recombination
frequency may be decreased by reduction of expression or activity level of
RAD54 and/or
TID1. In some embodiments, homologous recombination frequency may be modulated
by
regulating the expression and functional activity of these four proteins
independently or in
different permutations. This approach of modulating recombination frequency
may also be
used with other proteins that physically interact directly or indirectly and
modify the activity
of RecA homologues functioning during meiosis.
In alternative embodiments, meiotic homologous recombination frequency may be
modulated by modifying the activity level of resolvase. Thus, activity of
resolvase may be
increased to promote resolution of crossovers thereby increasing the frequency
of exchange
of genetic information between non-sister chromatids. It has been reported
that, of the total
number of crossovers initiated between homologous chromosomes during meiosis,
only a
fraction are resolved to result in actual exchange of genetic information
between the
homologous chromosomes, with the rest dissolving without causing exchange of
genetic
information [72]. In another aspect of the invention, meiotic homologous
recombination
frequency may be decreased by reducing the level or functional activity of
resolvase during
meiosis.
In alternative embodiments, meiotic homologous recombination frequency may be
modulated by modifying the assembly or function of the synaptonemal complex.
Thus the
- 9 -
CA 02422362 2009-10-07
action of proteins important in assembly and function of the synaptonemal
complex such as
potential regulatory proteins, like ATM [163] or MEK1 [157], or structural
proteins, like
HOPI [156], RED1 [164], or ZIP1 [165], or functional homologues thereof, may
be inhibited
so as to impair formation of the synaptonemal complex and reduce homologous
chromosome
pairing by decreasing the frequency of non-sister chromatid exchange. In
another aspect of
the invention, assembly and function of the synaptonemal complex may be
promoted to
increase recombination frequency during meiosis.
In alternative embodiments, the activator or inhibitor of meiotic homologous
recombination may be an anti-sense molecule or a co-suppreseive nucleic acid.
A co-
suppreseive nucleic acid is a nucleic acid that supresses the expression of
another nucleic
acid by means of co-suppression. Anti-sense oligonucleotides, including anti-
sense RNA
molecules and anti-sense DNA molecules, generally act to block the translation
of mRNA by
binding to targeted mRNA and inhibiting protein translation from the bound
mRNA. For
example, anti-sense oligonucleotides complementary to regions of a DNA
sequence encoding
an enzyme involved in meiotic homologous recombination, such as DMC1, may be
expressed
in transformed plant cells during the appropriate developmental stage to down-
regulate the
enzyme. Alternative methods of down-regulating protein expression may include
the use of
ribozymes or other enzymatic RNA molecules (such as hammerhead RNA structures)
that are
capable of catalysing the cleavage of RNA (as disclosed in U.S. Patent Nos.
4,987,071 and
5,591,610. The mechanism of ribozyme action generally
involves sequence specific hybridization of the ribozyme molecule to
complementary target
RNA, followed by endonucleolytic cleavage. Additionally, antibodies or
peptides which
inhibit the activity of the target protein may be introduced or expressed in
meiotic cells to
suppress activity of the target protein.
It is well known in the art that some modifications and changes can be made in
the
structure of a polypeptide without substantially altering the biological
function of that
peptide, to obtain a biologically equivalent polypeptide. In one aspect of the
invention,
proteins that modulate meiotic recombination may differ from a portion of the
corresponding
native sequence by conservative amino acid substitutions. As used herein, the
term
"conserved amino acid substitutions" refers to the substitution of one amino
acid for another
at a given location in the peptide, where the substitution can be made without
loss of
function. In making such changes, substitutions of like amino acid residues
can be made, for
example, on the basis of relative similarity of side-chain substituents, for
example, their size,
-10-
- _____________ .
CA 02422362 2009-10-07
4
charge, hydrophobicity, hydrophilicity, and the like, and such substitutions
may be assayed
for their effect on the function of the peptide by routine testing. In some
embodiments,
conserved amino acid substitutions may be made where an amino acid residue is
substituted
for another having a similar hydrophilicity value (e.g., within a value of
plus or minus 2.0),
where the following hydrophilicity values are assigned to amino acid residues
(as detailed in
United States Patent No. 4,554,101): Arg (+3.0);
Lys
(+3.0); Asp (+3.0); Glu (+3.0); Ser (+0.3); Asn (+0.2); Gin (+0.2); Gly (0);
Pro (-0.5); Thr (-
0.4); Ala (-0.5); His (-0.5); Cys (-1.0); Met (-1.3); Val (-1.5); Leu (-1.8);
Ile (-1.8); Tyr (-2.3);
Phe (-2.5); and Trp (-3.4). In alternative embodiments, conserved amino acid
substitutions
may be made where an amino acid residue is substituted for another having a
similar
hydropathic index (e.g., within a value of plus or minus 2.0). In such
embodiments, each
amino acid residue may be assigned a hydropathic index on the basis of its
hydrophobicity
and charge characteristics, as follows: Ile (+4.5); Val (+4.2); Leu (+3.8);
Phe (+2.8); Cys
(+2.5); Met (+1.9); Ala (+1.8); Gly (-0.4); Thr (-0.7); Ser (-0.8); Trp (-
0.9); Tyr (-1.3); Pro (-
1.6); His (-3.2); Glu (-3.5); Gin (-3.5); Asp (-3.5); Asn (-3.5); Lys (-3.9);
and Arg (-4.5). In
alternative embodiments, conserved amino acid substitutions may be made where
an amino
acid residue is substituted for another in the same class, where the amino
acids are divided
into non-polar, acidic, basic and neutral classes, as follows: non-polar: Ala,
Val, Leu, Ile,
Phe, Trp, Pro, Met; acidic: Asp, Glu; basic: Lys, Arg, His; neutral: Gly, Ser,
Thr, Cys, Asn,
Gin; Tyr.
Various aspects of the present invention encompass nucleic acid or amino acid
sequences that are homologous to other sequences. As the term is used herein,
an amino acid
or nucleic acid sequence is "homologous" to another sequence if the two
sequences are
substantially identical and the functional activity of the sequences is
conserved (for example,
both sequences function as or encode a selected enzyme or promoter function;
as used herein,
the term 'homologous' does not infer evolutionary relatedness). Nucleic acid
sequences may
also be homologous if they encode substantially identical amino acid
sequences, even if the
nucleic acid sequences are not themselves substantially identical , a
circumstance that may
for example arise as a result of the degeneracy of the genetic code.
Two nucleic acid or protein sequences are considered substantially identical
if, when
optimally aligned, they share at least about 25% sequence identity in protein
domains
essential for conserved function. In alternative embodiments, sequence
identity may for
example be at least 50%, 70%, 75%, 90% or 95%. Optimal alignment of sequences
for
-11 -
CA 02422362 2009-10-07
comparisons of identity may be conducted using a variety of algorithms, such
as the local
homology algorithm of Smith and Waterman,1981, Adv. App!. Math 2: 482, the
homology
alignment algorithm of Needleman and Wunsch, 1970, J Mol. Biol. 48:443, the
search for
similarity method of Pearson and Lipman, 1988, Proc. Natl. Acad. ScL USA 85:
2444, and the
computerised implementations of these algorithms (such as GAP, BESTFIT, FASTA
and
TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group,
Madison,
WI, U.S.A.). Sequence alignment may also be carried out using the BLAST
algorithm,
described in Altschul etal., 1990,1 MoL Biol. 215:403-10 (using the published
default
settings). Software for performing BLAST analysis may be available through the
National
Center for Biotechnology Information.
The BLAST algorithm involves first identifying high scoring sequence pairs
(HSPs) by
identifying short words of length W in the query sequence that either match or
satisfy some
positive-valued threshold score T when aligned with a word of the same length
in a database
sequence. T is referred to as the neighbourhood word score threshold. Initial
neighbourhood
word hits act as seeds for initiating searches to find longer HSPs. The word
hits are extended
in both directions along each sequence for as far as the cumulative alignment
score can be
increased. Extension of the word hits in each direction is halted when the
following
parameters are met: the cumulative alignment score falls off by the quantity X
from its
maximum achieved value; the cumulative score goes to zero or below, due to the
accumulation of one or more negative-scoring residue alignments; or the end of
either
sequence is reached. The BLAST algorithm parameters W, T and X determine the
sensitivity
and speed of the alignment. The BLAST programs may use as defaults a word
length (W) of
11, the BLOSUM62 scoring matrix (Henikoff and Henikoff, 1992, Proc. Natl. Acad
ScL
USA 89: 10915-10919) alignments (B) of 50, expectation (E) of 10 (which may be
changed in
alternative embodiments to 1 or 0.1 or 0.01 or 0.001 or 0.0001; although E
values much
higher than 0.1 may not identify functionally similar sequences, it is useful
to examine hits
with lower significance, E values between 0.1 and 10, for short regions of
similarity), M=5,
N=4, for nucleic acids a comparison of both strands. For protein comparisons,
BLASTP may
be used with defaults as follows: G=11 (cost to open a gap); E.-4 (cost to
extend a gap); E=10
(expectation value, at this setting, 10 hits with scores equal to or better
than the defined
alignment score, S, are expected to occur by chance in a database of the same
size as the one
being searched; the E value can be increased or decreased to alter the
stringency of the
search.); and W=3 (word size, default is 11 for BLASTN, 3 for other blast
programs). The
- 12 -
CA 02422362 2003-03-13
WO 02/22811 PCT/CA01/01306
BLOSUM matrix assigns a probability score for each position in an alignment
that is based
on the frequency with which that substitution is known to occur among
consensus blocks
within related proteins. The BLOSUM62 (gap existence cost = 11; per residue
gap cost =-- 1;
lambda ratio = 0.85) substitution matrix is used by default in BLAST 2Ø A
variety of other
matrices may be used as alternatives to BLOSUM62, including: PAM30 (9,1,0.87);
PAM70
(10,1,0.87) BLOSUM80 (10,1,0.87); BLOSUM62 (11,1,0.82) and BLOSUM45
(14,2,0.87).
One measure of the statistical similarity between two sequences using the
BLAST algorithm
is the smallest sum probability (P(N)), which provides an indication of the
probability by
which a match between two nucleotide or amino acid sequences would occur by
chance. In
alternative embodiments of the invention, nucleotide or amino acid sequences
are considered
substantially identical if the smallest sum probability in a comparison of the
test sequences is
less than about 1, preferably less than about 0.1, more preferably less than
about 0.01, and
most preferably less than about 0.001.
An alternative indication that two nucleic acid sequences are substantially
identical is
that the two sequences hybridize to each other under moderately stringent, or
preferably
stringent, conditions. Hybridization to filter-bound sequences under
moderately stringent
conditions may, for example, be performed in 0.5 M NaHPO4, 7% sodium dodecyl
sulfate
(SDS), 1 mM EDTA at 65 C, and washing in 0.2 x SSC/0.1% SDS at 42 C (see
Ausubel, et
al. (eds), 1989, Current Protocols in Molecular Biology, Vol. 1, Green
Publishing
Associates, Inc., and John Wiley & Sons, Inc., New York, at p. 2.10.3).
Alternatively,
hybridization to filter-bound sequences under stringent conditions may, for
example, be
performed in 0.5 M NaHPO4, 7% SDS, 1 mM EDTA at 65 C, and washing in 0.1 x
SSC/0.1% SDS at 68 C (see Ausubel, et al. (eds), 1989, supra). Hybridization
conditions
may be modified in accordance with known methods depending on the sequence of
interest
(see Tijssen, 1993, Laboratory Techniques in Biochemistry and Molecular
Biology --
Hybridization with Nucleic Acid Probes, Part I, Chapter 2 "Overview of
principles of
hybridization and the strategy of nucleic acid probe assays", Elsevier, New
York). Generally,
stringent conditions are selected to be about 5 C lower than the thermal
melting point for the
specific sequence at a defined ionic strength and pH.
In some embodiments, the invention provides methods of increasing meiotic
homologous recombination in the context of methods for breeding agricultural
species, and
plants and animals produced by such processes. Increased recombination
frequency may be
desirable to facilitate breeding of agricultural species, for example by
facilitating the
- 13 -
CA 02422362 2003-03-13
WO 02/22811 PCT/CA01/01306
exchange of alleles at tightly linked genetic loci. Where breeding stock are
modified to
increase the level of meiotic homologous recombination, for example, the
effort required to
identify progeny which have lost an undesirable allele at a genetic locus of
interest may be
reduced.
One aspect of the invention involves the modulation of meiotic homologous
recombination frequency in plant breeding, for example of Bras sica sp. In a
prophetic
example of such an embodiment, the following conditions may apply:
a) Locus 1:
-controls a quality trait such as saturated fatty acid content in seed oil.
¨allele "A" confers high saturate content, which is undesirable in the context
of this
example.
¨allele "a" confers low saturate content, which is desirable in the context of
this
example.
b) Locus 2:
-controls the agronomic trait of lodging which is related to stem rigidity.
¨allele "B" confers a weak stem which results in lodging of the crop causing
it to be
difficult to harvest.
¨allele "b" confers a rigid stem resulting in an upright plant at maturity
that increases
harvestability with reduced seed loss which is desirable because it may
increase yield.
c) Variety X under development has the genotype "aB/aB" conferring desirable
oil
properties but poor harvestiblity because of susceptibility to lodging.
d) Accession line Z has the genotype "Ab/Ab" giving it the properties of poor
oil quality but
lodging resistance.
e) Locus 1 and 2 have tight genetic linkage to each other.
f) Goal: To remove the deleterious "B" allele at Locus 2 from Variety X and
transfer into
Variety X the lodging resistance trait conferred by the "b" allele at Locus 2
in Accession
Line Z using sexual crosses between Variety X and Accession Z.
In such an example, with natural levels of meiotic recombination frequency, a
large
population may be required to represent a gamete with the desired "ab"
genotype in the
progeny resulting from the Fl plant. This is because Locus 1 and 2 are tightly
linked
resulting in few crossover events between the two loci carried by homologous
chromosomes
from Variety X and Accession Z in the Fl hybrid. Using the present invention
to provide an
increased meiotic homologous recombination frequency, the representation of
the "oh"
- 14 -
CA 02422362 2003-03-13
WO 02/22811 PCT/CA01/01306
gamete in the progeny from the Fl may be increased. This is because increased
homologous
recombination potential results in more crossover events in the genome of the
Fl hybrid. As
a result, there is an increased chance for crossovers to occur between Locus 1
and 2 leading
to a greater frequency of breaking the linkage between the desirable "a"
allele for low
saturate content and the undesirable "B" allele for increase lodging at the
closely linked loci 1
and 2 to produce the highly desirable hybrid chromosome carrying the "a"
allele for reduced
saturate content and the "b" allele for reduced lodging.. Thus the frequency
of the "ab"
gamete in the progeny will be increased versus that found under conditions of
natural
recombination frequency.
In one aspect of the invention, the 'enhanced recombination factor' is
introduced into
Variety X so that Variety X has increased meiotic homologous recombination
potential. The
'enhanced recombination factor' conferring the increased homologous
recombination
potential may be detectable by a molecular marker. Variety X may then be
sexually crossed
with Accession Z and the resulting hybrid will have increased recombination
potential.
During gamete formation by this Fl, frequency of crossovers and exchange of
genetic
information between homologous chromosomes from Variety X and Accession Z will
be
increased versus the wild-type situation. As a result, there will be increased
chance of
exchange between Locus 1 and 2 resulting in increased frequency of gametes
with the desired
"ab" genotype. Representation of the "ab" genotype in the F1 progeny will thus
be increased
versus the wild-type situation. When plants of interest carrying the "ab"
genotype are found
in the progeny, the factor conferring increased recombination frequency can be
removed by
backcrossing to Variety X. During gamete formation in this new plant meiotic
homologous
recombination and/or independent assortment of chromosomes during meiosis will
cause the
'enhanced recombination factor' to segregate from Loci 1 and 2. By using
molecular
markers, the resultant progeny can be screened to identify plants which retain
the "ab"
genotype but no longer carry the 'enhanced recombination factor' and, thus,
these plants will
be restored to wild-type levels of meiotic homologous recombination. In
alternative aspects
of the invention, the 'enhanced recombination factor' may be removed from the
genome of a
particular plant line by flanking the 'enhanced recombination factor' with
recognition sites
for a site-specific recombinase. Exposing the plant line to the action of the
site-specific
recombinase will thus excise the 'enhanced recombination factor' from the
genome of the
plant line.
- 15 -
CA 02422362 2003-03-13
WO 02/22811 PCT/CA01/01306
If meiotic homologous recombination frequency is increased during this
breeding
procedure, in accordance with the present invention, recombinants between the
two loci
would be at a higher frequency in the progeny, and the breeder may develop a
new variety in
a less expensive and more efficient manner.
An alternative aspect of the invention involves increasing meiotic homologous
recombination to enhance efficiency of genetic mapping and map-based cloning,
for example
in agricultural species. Genetic distance between chromosomal loci is governed
by meiotic
recombination frequency between homologous chromosomes on which the loci under
consideration are located. By monitoring the frequency of co-inheritance of
phenotypic or
molecular markers corresponding to the loci under consideration, the genetic
distance and
order of the loci can be established. If two loci, 1 and 2, are on the same
chromosome but are
physically separated by a large region of the chromosome, numerous
opportunities exist for
recombination events to occur along this long stretch of DNA to combine
alleles carried by
the maternal and paternal chromosomes at these loci. The loci are considered
linked if the
frequency of new combinations of maternal and paternal alleles at Loci 1 and 2
observed in
the progeny is less than 50%. The genetic distance between the two loci
corresponds to this
frequency. If Loci 1 and 3 are physically closer to one another along the
chromosome than
Loci 1 and 2, then there is generally less chance of recombination to occur
between these loci
to make new combinations of maternal and paternal alleles at Loci 1 and 3.
Again, this is
determined by observing the frequency of coinheritance of allelic combinations
in the
progeny. By determining the frequency of combinations of alleles at Loci 1, 2
and 3 in the
progeny, genetic distance and order of the loci can be determined. For
example, if
combinations of maternal and paternal alleles at locus 1 and 2 are found in
the progeny at a
frequency of 40%, and combinations between locus 2 and 3 are found to be 25%,
but
combinations between 1 and 3 are found to be 15%, then the order of the loci
is 1-3-2 with
map distances between the ordered loci being 15 and 25 units. This type of
information can
be compiled for loci conferring phenotypic effects as well as loci
corresponding to molecular
markers such as RFLP's, RAPD's, AFLP's, SNP's, and microsatellites [98-100].
Detailed
genetic maps can be determined for agricultural organisms. In this manner, for
example,
molecular markers can be linked to desirable traits. The markers can then be
used to assist
breeders in transferring desirable traits to varieties that are released to
producers.
Reliance on natural levels of meiotic homologous recombination frequency to
determine the distance between markers may present difficulties with existing
mapping
- 16 -
CA 02422362 2003-03-13
WO 02/22811 PCT/CA01/01306
techniques. For example, two markers may be deemed to be very tightly linked
genetically
but could still be physically separated by very long stretches of DNA. Thus
the invention
enabling enhanced meiotic recombination frequency will enable markers with
tighter linkage
to the target loci to be defined while reducing the population size required
to do so versus
what is possible when relying on natural levels of recombination frequency.
Such markers
with tighter linkage to the target locus will enable more reliable monitoring
of the segregation
of the desired locus in a breeding program.
Genetic maps defined with molecular markers may also be used to clone genes
responsible for traits of interest. This process of map-based gene cloning
involves linking
molecular markers to the desired trait by determining the frequency of co-
inheritance of
molecular markers with the trait [98-100]. Once a marker has been found which
is inherited
at high frequency with the target trait, it can be used as a molecular probe
to screen a DNA
library of the organism to identify a fragment of DNA which encodes the
cognate gene. One
major difficulty with map-based gene cloning is that the relationship between
genetic
distance and physical distance can vary between species and even between
different regions
of the genome in a given species. Therefore a molecular marker may show
absolute linkage
to the target trait locus but it may be physically hundreds of kilobases away
from the actual
gene of interest. This makes identifying and cloning the actual gene
responsible for the trait
difficult because there may be vast stretches of DNA to evaluate in order to
identify the gene.
In addition, one might map more than one molecular marker showing absolute
linkage to the
target trait locus. However, using a reasonable population size, it may not be
possible to
identify which marker is physically closer to the target gene. Thus, while one
marker may be
10 kilobases from the target gene and the other is 400 kilobases from the
target gene, with
conventional methods relying on natural levels of recombination frequency
there may be no
way of differentiating which of the two markers should be used to most
efficiently clone the
target gene. It would therefore be beneficial to map-based cloning projects to
utilize the
present invention to provide elevated meiotic homologous recombination levels
so as to
increase precision in determining genetic distance between molecular markers
and target trait
loci.
In an alternative aspect, the invention provides methods of decreasing meiotic
homologous recombination, for example to enhance efficiency of breeding
agricultural
species. Decreased recombination frequency may be desirable in directed
breeding of
agricultural species to promote linkage drag, thereby maintaining genotypic
integrity during
-17-
CA 02422362 2003-03-13
WO 02/22811 PCT/CA01/01306
sexual crosses conducted to introgress desirable traits. This may, for
example, reduce the
number of plants per backcross generation required to restore the genotype of
the recurrent
parent. For example, in plant breeding of Brassica sp., the following
conditions may apply:
a) Variety X: -has favourable quality and agronomic characteristics and is an
established variety in the industry but is susceptible to a disease due to
allele "A" at
Locus 1.
b) Accession Z: -has poor quality and agronomic characteristics but is
resistant to
the same disease due to allele "a" at Locus 1.
c) Goal: To transfer disease resistance trait from Accession Z to Variety X
and
maintain all of the favourable quality and agronomic characteristics of
Variety X.
A conventional approach might involve a sexual cross between Variety X and
Accession Z in an attempt to transfer the disease resistance trait to Variety
X. During meiosis
in the Fl plant, natural levels of recombination between Variety X and
Accession Z
homologous chromosomes may result in extensive mixing of the two genomes. This
may
indeed combine the favourable disease resistance allele "a" from Accession Z
with a Variety
X chromosome. However, many detrimental alleles responsible for poor quality
and
agronomic characteristics in Accession Z become intermixed with the favourable
alleles from
the Variety X genome. This may necessitate several rounds of backcrossing the
hybrid plant
to Variety X, the recurrent parent, to restore the favourable characteristics
of Variety X while
selecting for the disease resistance allele introduced from Accession Z. To
restore the
original genotype of Variety X might require in excess of seven backcross
generations.
Using the present invention, it may be desirable to expedite the process of
variety
development through the use of plants with modified meiotic homologous
recombination
frequency. An engineered decrease in meiotic homologous recombination
frequency may be
used to reduce the mixing of genomes and genetic information between Variety X
and
Accession Z, to provide a higher frequency of progeny from the initial hybrid
which have the
"a" allele conferring disease resistance transferred to the Variety X
chromosome with the rest
of the Variety X genome largely intact.
In alternative embodiments, variety X may be modified to have decreased
meiotic
homologous recombination potential by introduction of a 'suppressed-
recombination factor'.
The 'suppressed-recombination factor' conferring the decreased homologous
recombination
potential may be detectable by a molecular marker. Variety X may then be
sexually crossed
with Accession Z, so that the resulting hybrid will have decreased
recombination potential.
- 18 -
CA 02422362 2003-03-13
WO 02/22811 PCT/CA01/01306
During gamete formation by this Fl plant, the frequency of meiotic crossovers
and exchange
of genetic information between homologous chromosomes from Variety X and
Accession Z
will be decreased compared to the wild-type frequency. Thus the frequency of
Fl progeny
plants containing high proportions of the Variety X genome and its favourable
characteristics
plus disease resistance may be increased versus that possible with wild-type
levels of meiotic
homologous recombination. When such plants are identified, they may be
backcrossed to
Variety X to remove vestiges of the Accession Z genome. During gamete
formation in such
a plant, meiotic homologous recombination and/or independent assortment of
chromosomes
during meiosis may cause the inhibitor of meiotic recombination, such as a
suppressed-
recombination factor', to segregate from the disease resistance gene. By using
molecular
markers, the resultant progeny may be screened to identify plants which retain
the disease
resistance gene in the favourable Variety X genome but no longer carry the
'suppressed-
recombination factor' so that these plants may be restored to wild-type levels
of meiotic
homologous recombination. In alternative aspects of the invention, the
'suppressed-
recombination factor' may be removed from the genome of a particular plant
line by flanking
the 'suppressed-recombination factor' with recognition sites for a site-
specific recombinase.
Exposing the plant line to the action of the site-specific recombinase will
thus excise the the
'suppressed-recombination factor' from the genome of the plant line.
In an alternative aspect, the invention provides methods to increase meiotic
homologous recombination leading to enhanced efficiency of gene targeting.
Homologous
recombination activities are at an elevated state in meiotic cells compared to
mitotic cells in
which recombination activities must generally be induced by DNA damage. Thus
supplying
gene targeting substrates to meiotic cells, in accordance with one aspect of
the present
invention, takes advantage of endogenous meiotic enzymes and DNA states to
promote
recombination with the target locus. The present invention may also be used to
increase
recombination potential in meiotic cells to further enhance meiotic gene
targeting frequency.
In one aspect of the present invention, increasing one or more meiotic
homologous
recombination functions by providing an activator of meiotic homologous
recombination can
increase meiotic homologous recombination frequency. Thus, in accordance with
this aspect
of the invention, by supplying gene targeting substrate to meiotic cells one
may increase gene
targeting frequency. Gene targeting has been successfully applied in a variety
of eukaryotic
species including fungi [101], plants [82;102-104] and lower [105;106] and
higher animals
- 19 -
CA 02422362 2003-03-13
WO 02/22811 PCT/CA01/01306
[63;85;107]. However, these gene targeting strategies involve only
vegetative/somatic cells
undergoing mitosis.
In one aspect of the present invention, increasing gene targeting frequency by
performing the process in meiotic cells may facilitate the rapid generation of
homozygous
lines with targeted changes. In this aspect, the gene targeting event may
occur at meiosis I,
resulting in four gametes, each of which may have the targeted change. In
plants and other
monoecious organisms where both male and female gametes are produced by the
same
individual, simply self-crossing the individual may result in a high frequency
of diploid
progeny which are homozygous for the targeted genetic change. In addition, in
the case of
plants, one may obtain individuals homozygous for the targeted genetic change
by
performing microspore culture after delivering gene targeting substrate to the
meiotic cells or
the microspores themselves. Microspores are haploid cells resulting from
meiosis in the plant
anther. These cells may be cultured to regenerate entire plants. The plants
may be
chemically treated to create a diploid chromosome content so that they are
homozygous for
all genetic information. Therefore, microspores carrying the targeted genetic
change as a
result of treating meiotic cells or microspores with gene targeting substrate
may be cultured
and converted into plants that are homozygous for the targeted change.
Alternatively, where
male and female gametes are produced by different individuals, the gene
targeting process
may be done simultaneously in both a male and female plant, so that the male
and female
plants may be crossed. The gene targeting methods of the invention may be
contrasted with
conventional gene targeting strategies in which transformed organisms are
hemizygous for
the targeted change resulting in a need for further crosses to generate
homozygous progeny.
Conventional gene targeting strategies also generally rely on methods for
regenerating
organisms from transformed totipotent cells [82;102-104].
In one aspect of the invention, targeted changes in either maternal or
paternal
chromosomes may be obtained by delivering gene targeting substrate
specifically to either
female or male reproductive organs. This is not possible with conventional
strategies that
target somatic cells. Specific targeting of maternal or paternal derived
chromosomes may for
example be used to investigate and exploit such epigenetic processes as
parental genomic
imprinting.
In some aspects of the invention, transformed plant cells may be cultured to
regenerate whole plants having a transformed genotype and displaying a desired
phenotype
as, for example, modified by the expression of a protein encoded by a
recombinant nucleic
- 20 -
CA 02422362 2003-03-13
WO 02/22811 PCT/CA01/01306
acid construct mediated by a transcriptional regulatory region of the
invention. A variety of
plant culture techniques may be used to regenerate whole plants, such as are
described in
Gamborg and Phillips, "Plant Cell, Tissue and Organ Culture, Fundamental
Methods",
Springer Berlin, 1995); Evans et al. "Protoplasts Isolation and Culture",
Handbook of Plant
Cell Culture, Macmillian Publishing Company, New York, 1983; or Binding,
"Regeneration
of Plants, Plant Protoplasts", CRC Press, Boca Raton, 1985; or in Klee et al.,
Ann. Rev. of
Plant Phys. 38:467 (1987). A cell, tissue, organ, or organism into which has
been introduced
a foreign nucleic acid, is considered "transformed", "transfected", or
"transgenic". A
transgenic or transformed cell or organism also includes progeny of the cell
or organism and
progeny produced from a breeding program employing a transgenic plant as a
parent in a
cross and exhibiting an altered phenotype resulting from the presence of a
recombinant
nucleic acid construct. A transgenic plant is therefore a plant that has been
transformed with a
recombinant nucleic acid construct, or the progeny of such a plant that
includes the transgene.
The invention provides vectors, such as vectors for transforming plants or
plant cells. The
term "vector" in reference to nucleic acid molecule generally refers to a
molecule that may be
used to transfer a nucleic acid segment(s) from one cell to another. One of
skill will recognize
that after the nucleic acid is stably incorporated in transgenic plants and
confirmed to be
operable, it can be introduced into other plants by sexual crossing. Any of a
number of
standard breeding techniques may be used, depending upon the species to be
crossed.
In various embodiments, the invention comprises plants or animals transformed
with
the nucleic acids of the invention. Accordingly, an aspect of the invention
relates to
transformed embodiments of all higher plants, including monocots and dicots,
such as, non-
exclusively, species from the genera Brassica, Sinapis, Triticum, Zea,
Hordeum, Avena,
Oriza, Glycine, Linum, Medicago, Lens,Pisum, Cicer, Solanum, Lycopersicon,
Secale,
Populus, Gossypium, Raphanus, Triflorium, Phaseolus, Bromus,Phleum, Agropyron,
Helianthus, Beta, Malus,Prunus,Cucurbita, Phoenix, Abies, Acer, Quercus, Olea,
Allium,
Washingtonia, Papaver, Rosa, Carthamus, Vicia, Fragaria, Lotus, Onobrychis,
Trigonelia,
Vigna, Citrus,Geranium, Manihot, Daucus, Arabidopsis, Atropa, Capsicum, Picea,
Prunus,
Pyrus, Pinus, Hyoscyamus, Nicotianaõ Arachus, Asparagus, Heterocatlis,
Nemesia,
Pelargonium, Panicum, Penniserum, Ranunculus, Senecio, Salpiglossis, Cucarnis,
Browallia,
Cedrus, Lolium, Sorghum, Datura,Petunia, Digitalis, Majorana, Cichorium,
Lactuca,
Antirrhinum, and Manihot.
-21-
CA 02422362 2003-03-13
WO 02/22811 PCT/CA01/01306
In one aspect, the invention includes mechanisms for achieving meiosis-
specific or
preferentially-meiotic expression, or activity, of factors that modulate
meiotic homologous
recombination. In one aspect, this may involve the use of meiosis-specific or
preferentially
meiotic promoters (i.e. promoters that are expressed exclusively or primarily
during meiosis,
respectively) operably linked to a gene of interest for expression during
meiosis. Examples of
such promoters may be found in the meiotic recombination factor genes
described herein,
including homologues obtainable from species from yeast to plants and animals.
Specific
examples of published promoters tested to be meiosis-specific are DMC1 [138]
and MSH4
[27]. Additional promoters may be obtainable from genes that are expressed in
meiosis-
specific manner (for example, see [21]) or genes that are induced during
meiosis [137].
Preferentially-meiotic promoters may include promoters active in vegetative
cells or germ-
line cells which lead to meiotic cells, wherein expression is mediated
sufficiently close to the
onset of meiosis. New promoters may be engineered to be meiosis-specific or
preferentially
meiotic, such as promoters that are initially active in both mitotic and
meiotic cells. Such
promoters may be modified by deletion or inactivation of mitotic expression
elements so that
their expression becomes preferential or specific during meiosis.
Certain transcription factors (e.g. NDT80) and promoter consensus sequences
(e.g.
URS1) are understood to be responsible for meiosis-specific expression [137].
Constitutive or
vegetatively active promoters may be converted to meiosis-specific or
preferentially-meiotic
promoters by modifying the promoter to contain the recognition sequences for
meiosis-
specific transcription factors and to be active only when the promoter binds
these
transcription factors.
Bipartite promoters may be used to provide meiosis-specific expression.
Bipartite
systems consists of 1) a minimal promoter containing a recognition sequence
for 2) a specific
transcription factor. The bipartite promoter is inactive unless it is bound by
the transcription
factor. The gene of interest may be placed behind the minimal promoter so that
it is not
expressed, and the transcription factor may be linked to a meiosis-specific
promoter. The
transcription factor may be a naturally occurring protein or a hybrid protein
composed of a
DNA-binding domain and a transcription-activating domain. Because the activity
of the
minimal promoter is dependent upon binding of the transcription factor, the
operably-linked
coding sequence will not be expressed in vegetative cells. In meiotic cells,
the meiosis-
specific promoter will be turned on facilitating expression of the
transcription factor. The
transcription factor will act in trans and bind to the DNA recognition
sequence in the minimal
- 22 -
CA 02422362 2003-03-13
WO 02/22811 PCT/CA01/01306
promoter via the cognate DNA-binding domain. The activation domain of the
transcription
factor will then be in the appropriate context to aid recruitment of RNA
polymerase and other
components of the transcription machinery. This will cause transcription of
the target gene.
With this bipartite system, the gene of interest will only be expressed in
cells entering or
undergoing meiosis since the necessary transcription factor is linked to a
meiosis-specific
promoter and will only be expressed at the desired developmental stage (i.e.
the target gene
will be expressed in a spatial and temporal pattern mirroring the meiosis-
specific promoter
expressing the transcription factor). In addition, a bipartite system could be
used to
coordinate expression of more than one gene during meiosis. Different genes
could be placed
behind individual minimal promoters all of which have the same recognition
sequence for a
specific transcription factor and whose expression, therefore, is reliant upon
the presence of
the transcription factor. The transcription factor is linked to a meiosis-
specific promoter.
Therefore, when cells enter meiosis, the promoter expressed the transcription
factor which
then can coordinately activate expression of the suite of target genes. Use of
a bipartite
system may have the advantage that if expression of the target genes is no
longer required in
a particular plant or animal line, then the transcription factor may be bred
out, so that without
the transcription factor present, the target gene(s) will no longer be
expressed in this line. If
the target genes are desired to be expressed at a later stage, the promoter:
:transcription factor
locus may be bred back into the line. In addition, the bipartite system may be
used to
modulate the level of expression of a target gene. Bipartite promoters may be
operably linked
to a variety of sequences, such as:
1) positive factors to increase homologous recombination frequency: wild-type
endogenous genes to facilitate overexpression of particular homologous
recombination
enzymes or other catalytic proteins or structural proteins or regulatory
proteins; heterologous
genes which promote homologous recombination; or,
2) negative factors to decrease homologous recombination frequency: altered
endogenous proteins or wild-type or altered heterologous proteins capable of
causing
dominant-negative effect; anti-sense RNA to target genes; antibodies which
bind and inhibit
action of target proteins.
Minimal promoter elements in bipartite promoters may include, for example:
1) truncated CaMV 35S (nucleotides ¨59 to +48 relative to the transcription
start site)
[139];
-23 -
CA 02422362 2003-03-13
WO 02/22811 PCT/CA01/01306
2) DNA recognition sequences: E. coil lac operator [140, 141], yeast GAL4
upstream
activator sequence [139]; TATA BOX, transcription start site, and may also
include a
ribosome recruitment sequence.
Bipartite promoters may for example include transcription factors such as: the
yeast
GAL4 DNA-binding domain fused to maize Cl transcription activator domain
[139]; E. coil
lac repressor fused to yeast GAL4 transcription activator domain [140]; or the
E. coil lac
repressor fused to herpes virus VP16 transcription activator domain [141].
Meiosis-specific promoters may be used directly to express factors for
promoting or
suppressing meiotic homologous recombination frequency by fusing the factor
coding
sequence to the promoter. However, some meiosis-specific promoters may promote
transcription at too low of a level (i.e. weakly expressed) or at too high of
a level (i.e.
strongly expressed) to achieve the desired effect on homologous recombination
frequency.
Therefore, for example, a weak meiosis-specific promoter may be used to
express a
transcription factor which can promote a high level of expression when it
binds to the
minimal promoter adjacent to the target gene. Thus while the target gene might
only be
expressed at a low level if it was directly fused to the meiosis-specific
promoter, this
promoter can indirectly facilitate high level expression of the target gene by
expressing a very
active transcription factor. The transcription factor may be present at low
levels but because it
is so effective at activating transcription at the minimal promoter fused to
the target gene, a
higher level of expression of the target gene will be achieved than if the
gene was directly
fused to the weak meiosis-specific promoter. In addition, the transcription
factor may also be
engineered so that its mRNA transcript is more stable or is more readily
translated, or that the
protein itself is more stable. Conversely, if the meiosis-specific promoter is
too strong for a
desired application, it may be used to express a transcription factor with low
ability to
promote transcription at the minimal promoter adjacent to the target gene.
In alternative aspects of the invention, inducible promoters may be provided.
A
sequence encoding an inhibitor or activator of meiotic homologous
recombination may be
cloned behind an inducible or repressible promoter. The promoter may then be
induced (or
de-repressed) by appropriate external treatment of the organism when
organismal
development proceeds to a point when meiosis is initiated. Regulation of such
promoters may
be mediated by environmental conditions such as heat shock [142], or chemical
stimulus.
Examples of chemically regulatable promoters active in plants and animals
include the
ecdysone, dexamethasone, tetracycline and copper .systems [143; 144; 145; 146;
147; 148].
- 24 -
CA 02422362 2012-09-11
=
In alternative embodiments, a meiosis-specific promoter may be used to
express a heterologous RNA-polymerase which recognizes specific sequences not
naturally present in the cell. For example, T7 RNA Polymerase may be used in
eukaryotes to specifically promote transcription of a target gene linked to
the T7 RNA
Pol recruitment DNA sequence [149]. Genes affecting homologous recombination
may then be regulated by the expression of T7 RNA Polymerase.
In some aspects, the present invention provides meiosis-specific expression of
inhibitors or activators of meiotic homologous recombination (meiosis
recombination
factors), which may avoid deleterious effects that may otherwise be caused by
expression of such factors during vegetative/mitotic growth. Constitutive
expression
of recombination factors, as exemplified here by RAD51, was found to severely
inhibit cell proliferation: the growth rate of cells expressing the
recombinase was
reduced by approximately 5-fold versus the control, a result that is in
accordance with
observations made in animal cells where overexpression of recombinases has
been
found to inhibit cell proliferation by arresting cell division [92].
In alternative embodiments, the invention provides isolated nucleic acids and
proteins. By isolated, it is meant that the isolated substance has been
substantially
separated or purified away from other biological components with which it
would
otherwise be associated, for example in vivo. The term 'isolated' therefore
includes
substances purified by standard purification methods, as well as substances
prepared
by recombinant expression in a host, as well as chemically synthesized
substances.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 is an annotated alignment of SPO1 1 protein sequences taken
from sequence accessions provided in the prior art. Identical or highly
conserve
amino acids are shaded. The position of the essential tyrosine residue of the
active
site is highlighted with a double asterisk. Location of the five conserved
motifs
present in SPO1 1 proteins are indicated by lines above the alignment.
Location of the
Toprim domain is indicated by a line beneath the sequences. Locations of the
invariant glutamate residue (E) and "DXD" motif are indicated by asterisks.
Figure 2 is the amino acid sequence of Arabidopsis thaliana SP011-1
(AtSP011-1).
Figure 3 is the amino acid sequence of Arabidopsis thaliana SP011-2
(AtSP011-2).
-25-
CA 02422362 2012-09-11
In the context of the present invention, "promoter" means a nucleotide
sequence
capable of mediating or modulating transcription of a nucleotide sequence of
interest, when
the transcriptional regulatory region is operably linked to the sequence of
interest. A
transcriptional regulatory region and a sequence of interest are "operably
linked" when the
sequences are functionally connected so as to permit transcription of the
sequence of interest
to be mediated or modulated by the transcriptional regulatory region. In some
embodiments,
to be operably linked, a transcriptional regulatory region may be located on
the same strand
as the sequence of interest. The transcriptional regulatory region may in some
embodiments
be located 5' of the sequence of interest. In such embodiments, the
transcriptional regulatory
region may be directly 5' of the sequence of interest or there may be
intervening sequences
between these regions. The operable linkage of the transcriptional regulatory
region and the
sequence of interest may require appropriate molecules (such as
transcriptional activator
-25a-
CA 02422362 2003-03-13
WO 02/22811 PCT/CA01/01306
proteins) to be bound to the transcriptional regulatory region, the invention
therefore
encompasses embodiments in which such molecules are provided, either in vitro
or in vivo.
The term "recombinant" means that something has been recombined, so that when
made in reference to a nucleic acid construct the term refers to a molecule
that is comprised
of nucleic acid sequences that are joined together or produced by means of
molecular
biological techniques. The term "recombinant" when made in reference to a
protein or a
polypeptide refers to a protein or polypeptide molecule which is expressed
using a
recombinant nucleic acid construct created by means of molecular biological
techniques. The
term "recombinant" when made in reference to genetic composition refers to a
gamete or
progeny with new combinations of alleles that did not occur in the parental
genomes.
Recombinant nucleic acid constructs may include a nucleotide sequence which is
ligated to,
or is manipulated to become ligated to, a nucleic acid sequence to which it is
not ligated in
nature, or to which it is ligated at a different location in nature.
Recombinant nucleic acid
constructs therefore indicates that the nucleic acid molecule has been
manipulated using
genetic engineering, i.e. by human intervention. Recombinant nucleic acid
constructs may
for example be introduced into a host cell by transformation. Such recombinant
nucleic acid
constructs may include sequences derived from the same host cell species or
from different
host cell species, which have been isolated and reintroduced into cells of the
host species.
Recombinant nucleic acid construct sequences may become integrated into a host
cell
genome, either as a result of the original transformation of the host cells,
or as the result of
subsequent recombination events. Transformation techniques that may be
employed include
plant cell membrane disruption by electroporation, microinjection and
polyethylene glycol
based transformation (such as are disclosed in Paszkowski etal. EMBO J. 3:2717
(1984);
Fromm etal., Proc. Natl. Acad. Sci. USA 82:5824 (1985); Rogers etal., Methods
Enzymol.
118:627 (1986); and in U.S. Patent Nos. 4,684,611; 4,801,540; 4,743,548 and
5,231,019),
biolistic transformation such as DNA particle bombardment (for example as
disclosed in
Klein, et al.,Nature 327: 70 (1987); Gordon-Kamm, etal. "The Plant Cell" 2:603
(1990);
and in U.S. Patent Nos. 4,945,050; 5,015,580; 5,149,655 and 5,466,587);
Agrobacterium-
mediated transformation methods (such as those disclosed in Horsch etal.
Science 233: 496
(1984); Fraley etal., Proc. Nat'l Acad Sci. USA 80:4803 (1983); and U.S.
Patent Nos.
4,940,838 and 5,464,763).
Although various embodiments of the invention are disclosed herein, many
adaptations and modifications may be made within the scope of the invention in
accordance
-26 -
CA 02422362 2009-10-07
, .
with the common general knowledge of those skilled in this art. Such
modifications include
the substitution of known equivalents for any aspect of the invention in order
to achieve the
same result in substantially the same way. Numeric ranges are inclusive of the
numbers
defining the range. In the specification, the word "comprising" is used as an
open-ended term,
substantially equivalent to the phrase "including, but not limited to", and
the word
"comprises" has a corresponding meaning. Citation of references herein shall
not be
construed as an admission that such references are prior art to the present
invention.
EXAMPLES
To demonstrate methods for increasing and decreasing homologous recombination
frequency during meiosis in accordance with various aspects of the present
invention,
Saccharomyces cerevisiae was used as a eukaryote model system. To demonstrate
mechanisms for engineering modified meiotic homologous recombination
frequency,
proteins involved in different steps of the homologous recombination pathway
have been
utilized, including:
a) SPO1 1, which catalyses formation of the initial double-strand break in one
member
of a pair of aligned homologous maternal and paternal chromosomes. The double-
strand
break is then processed to become recombinogenic and participate in a cross-
over event.
SPO1 1 is hi *My conserved amongst eukaryotic species from yeast to plants and
humans [9-
11].
b) DMC1, which is a meiosis-specific RecA homologue that acts on ssDNA
resulting
from the processing of double-strand breaks created by SPO1 1. DMC1
facilitates the paring
of homologous sequences on paired homologous chromosomes and catalyses
invasion of the
ssDNA strand into the paired duplex DNA of a non-sister chromatid. DMC1
accumulates
only in meiotic cells [20; 21; 22; 138;] and appears to have no function in
homologous
recombination occurring in mitotic cells [20;49;53-55]. DMC1 is highly
conserved amongst
eukaryotic species from yeast to plants and humans [20-22]. DMC1 acts in a
unique but
overlapping pathway regarding other RecA homologues functioning during meiosis
[53].
DMC1 is unique from RAD51 in that it forms octameric complexes when it binds
ssDNA
-27 -
CA 02422362 2003-03-13
WO 02/22811 PCT/CA01/01306
[108]. DMC1 also has proteins that interact with it during homologous
recombination which
are unique from those interacting with other RecA homologues [49;53].
c) RAD51, which is a RecA homologue that also acts on ssDNA resulting from the
processing of double-strand breaks created by SPO1 1. RAD51 functions in both
meiotic and
mitotic cells [23;53;58]. RAD51 is highly conserved amongst eukaryotic species
from yeast
to plants and humans [21;23-25]. It is unique from DMC1 in that it forms a
hexameric
complex like E. coli RecA when it binds ssDNA [109;110]. It acts in a unique
pathway from
DMC1 and has proteins that specifically interact with it and not DMC1
[49;53;56].
d) MRE11, which is a nuclease that acts in resection of double-strand breaks
created
by SPO 1 1 to provide ssDNA ends which are acted upon by RAD51 and DMC1 [4].
MREll
is highly conserved amongst eukaryotic species from yeast to plants and humans
[12-15].
MREll functions in both meiotic and mitotic cells [13;93;111;112].
e) ssDNA-binding proteins, which act to maintain ssDNA ends created by MREll
and associated proteins free of secondary structure [67]. By doing so, the
ssDNA ends are in
an optimum topology for the action of RecA homologues like RAD51 and DMC1.
ssDNA-
binding proteins are highly conserved from yeast to humans [26]. Eukaryotic
ssDNA-
binding protein function is facilitated by a heterotrimeic complex known as
RPA [26].The
ssDNA-binding protein in E. coli., known as SSB, is an ancestor of the
eukaryotic proteins
[74;113]. SSB binds ssDNA principally as a homotetramer, but may also bind as
a monomer
[76]. As a result, SSB provides an efficient system to test the effect of
modifying the cellular
level of ssDNA-binding proteins on homologous recombination, versus studying
the effects
of each individual subunit of the eukaryotic heterotrimeric RPA. A cloned E.
coli SSB gene
was evaluated for its effect on meiotic homologous recombination frequency. To
assist
movement of this prokaryotic protein into the eukaryotic nucleus, it was
engineered to encode
a nuclear localization sequence derived from Simian virus 40 T-antigen [114].
In alternative aspects of the invention, homologous recombination frequency is
increased by increasing the amount of a limiting factor through increased
expression of the
cognate gene, enhanced translational capacity of the cognate mRNA, decreased
turnover of
the protein or cognate mRNA; or by expressing an altered form of the protein
with enhanced
activity potential.
To reduce meiotic homologous recombination frequency, expression of the
cognate
gene for a target protein may be reduced, for example by antisense or
cosuppression of the
gene, by reducing translation of the cognate mRNA or increasing degradation of
the mRNA
-28-
CA 02422362 2003-03-13
WO 02/22811 PCT/CA01/01306
or protein. Alternatively, activity of the target wild-type protein may be
inhibited through
coexpression of an alternative form of the protein that acts in a 'dominant'
fashion to inhibit
(i.e. 'negatively' affect) the activity of the endogenous wild-type protein.
This 'dominant-
negative' effect may result by one or more modes of action. A non-exclusive
list of possible
modes of action includes:
1) Titration of substrate, in which an alternate form of the protein of
interest binds to
the target substrate of the wild-type endogenous protein, wherein the
alternate-form protein
cannot complete the catalytic or other normal functions performed by the wild-
type protein.
By binding the substrate, the alternate-form protein titrates the substrate
thereby inhibiting
access to the substrate by the endogenous wild-type protein. The functional
activity of the
endogenous wild-type protein is therefore inhibited.
2) Titration of cofactors or co-members of protein complexes, in which the
alternate-
form protein binds to cofactors required for full activity of the endogenous
wild-type protein;
the cofactors may be organic or inorganic compounds or other proteins which
are co-
members of heteromeric protein complexes (i.e. the complex is composed of more
than one
type of protein). For example, many proteins, including those involved in many
DNA
recombination processes, act in multi-protein heteromeric complexes. If one
member of the
complex is absent or in limiting amounts, the function and activity level of
the entire complex
is reduced. Therefore if an alternate-form of a target protein, which may be
non-functional or
having reduced function itself but still capable of interacting with members
of its normal
protein complex, is expressed in a cell it can reduce activity of the
endogenous wild-type
protein by binding with and titrating members of the protein complex. These
members of the
complex are then no longer available to form functional complexes with the
wild-type protein
and, therefore, the function of the endogenous wild-type protein is reduced.
3) Direct inhibition of endogenous wild-type protein, in which the alternate-
form
protein may bind with the wild-type protein directly to inhibit its activity.
Many proteins,
including those participating in different steps of DNA recombination, form
homomeric
protein complexes (i.e. the complex is composed of a single type of protein).
If one member
of the homomeric complex is inactive in the correct biochemical context, it
may poison (i.e.
inhibit) the activity of the entire complex. Therefore, if an alternate-form
protein, which has
reduced or absent activity itself but which can still interact with endogenous
wild-type
protein to form complexes, is expressed in a cell it can reduce activity of
the entire complex.
The cell therefore has a combination of complexes composed of the following:
- 29 -
CA 02422362 2003-03-13
WO 02/22811 PCT/CA01/01306
a) the alternate-form protein (which may directly titrate substrate (see
"1"));
b) hybrid complexes of the alternate-form protein and the endogenous wild-
type protein. These complexes may have reduced or absent activity.
c) homogenous endogenous wild-type protein complexes wherein the activity
level and function of the wild-type complexes is reduced because i) there is
decreased number of functional form homogenous wild-type complexes
because of titration of wild-type protein into the hybrid complexes composed
of alternate-form and wild-type protein monomers, and ii) there is decreased
function of homogenous wild-type complexes because they may interact with
hybrid complexes or homogenous alternate-form complexes and/or lose the
competition for substrate which is titrated by the hybrid complexes or
homogenous alternate-form complexes.
To assess the effect of alternative forms of recombination proteins on meiotic
homologous recombination frequency, heterologous proteins were expressed and
mutant
proteins engineered to have reduced or no function. To demonstrate the effect
of heterologous
protein expression, the DMC1 gene from Arabidopsis thaliana (AtDMC1) was
expressed
during meiosis in S. cerevisiae. AtDMC1 has approximately 40% similarity to
ScDMC1. In
alternative embodiments, heterologous expression of AtDMC1 may, therefore,
function to
promote homologous recombination frequency by compensating for a potentially
limiting
amount of endogenous ScDMC1, or it may decrease homologous recombination
frequency
by a dominant-negative effect, as outlined above, due to direct or indirect
inhibition of
endogenous ScDMC1 activity. To demonstrate the effect of altered forms of
recombination
proteins on meiotic homologous recombination frequency, novel forms of DMC1,
RAD51
and SPO1 1, and MREll were created and assessed.
a) RAD51, a RecA homologue that catalyses strand exchange between homologous
DNA [52]. ATP-binding is necessary for full activity in DNA pairing and strand
exchange in
vitro [115-117]. ATP-binding is facilitated by protein motifs known as Walker
A and Walker
B boxes [118]. Mutations inhibiting ATP binding and/or hydrolysis decrease
biological
activity of RAD51 regarding its role in recombination-mediated repair of DNA
damage
caused by radiation [96]. ScRAD51 and AtRAD51 were cloned and it was found
that their
protein sequences have 62% similarity and the conserved Walker A and B Box
motifs. We
engineered the genes to encode proteins with decreased ability for ATP-binding
and
hydrolysis by changing a glycine residue within the Walker A box to aspartic
acid (i.e.
- 30 -
CA 02422362 2003-03-13
WO 02/22811 PCT/CA01/01306
ScRAD51: G190D; AtRAD51: G135D). The effect of these mutant protein forms on
meiotic
homologous recombination was then demonstrated. This glycine and other amino
acid
residues essential for homologous recombination activity are highly conserved
amongst the
RAD51-like family of proteins in eukaryotes. Other amino acids in the Walker A
and B Box
motifs may be changed to affect ATP-binding.
b) DMC1, a RecA homologue that catalyses strand exchange between homologous
DNA [51]. ATP-binding motifs, Walker A and B boxes, are conserved in this
family of
proteins [20]. Genetic analysis demonstrates that wild-type sequence in the
Walker A Box is
essential for wild-type activity in vivo [53]. A mutant form of DMC1, DMC1-
G126D which
has a similar amino acid change at a corresponding residue in the Walker A box
as outlined
above for RAD51, was created. ScDMC1 and AtDMC1 were cloned and it was found
that
their protein sequences have 40% similarity and the conserved Walker A and B
Box motifs.
The genes were engineered to encode proteins with decreased ATP-binding and
hydrolysis
ability by changing a glycine residue within the Walker A box to aspartic acid
(i.e. ScDMC1:
G1 90D; AtDMC1: G135D). The effect of these mutant protein forms on meiotic
homologous recombination was then demonstrated. Other amino acids in the
Walker A and
B Box motifs may be changed to affect ATP-binding. In some embodiments,
identification
of candidate mutations for interfering with DMC1 function may be predicted by
alignment of
DMC1 with RAD51 and EcRecA protein sequences. The crystal structure for EcRecA
has
been determined [119;120] so protein domains responsible for intra-complex and
inter-
complex interactions may be determined. Therefore, through sequence alignments
between
DMC1 with RAD51 and EcRecA, one may predict which domains of DMC1 are involved
in
intra- and inter-complex interactions. These regions are highly conserved
amongst DMC1
genes from many diverse species from yeast to plants and animals, including
humans.
ScDMC1 was cloned and engineered to encode mutations potentially responsible
for:
i) ATP-binding and hydrolysis with mutation G126D;
ii) ATP-induced conformational change with mutation N263Y; and,
iii) monomer-monomer interactions with mutation A288T.
Combinations of these mutations were also created to evaluate any synergistic
or additive
effects resulting from two or more mutations in the same protein.
c) SPO1 1, a Type II topoisomerase [121] that is responsible for double-strand
break
formation in meiotic homologous recombination [9;121]. Type II topoisomerases
have five
conserved motifs which are also present in SPO1 1 proteins from low and high
eukaryotic
-31 -
CA 02422362 2003-03-13
WO 02/22811 PCT/CA01/01306
species [121]. Mutation of key amino acids in these motifs can inactivate SPO1
1. When
such a mutant is present in a homozygous state, double-strand break formation
is prevented
[121] thereby inhibiting meiotic homologous recombination. ScSP011 and AtSP011
were
cloned to demonstrate the use and application of SPO 1 1 in a dominant-
negative approach to
reduce meiotic homologous recombination. The two protein sequences have
approximately
20% sequence similarity and possess the five characteristic Type II
topoisomerase motifs
including a key tyrosine residue essential for catalytic activity [121]. Genes
were engineered
to encode proteins with decreased ability to generate double-strand breaks by
changing the
tyrosine residue in "Motif 1" (i.e. ScSP011: Y135F; AtSP011: Y103F). The
effect of these
mutant protein forms on meiotic homologous recombination was then
demonstrated.
d) MRE11, a nuclease responsible for resection of double-strand breaks created
by
SPO 1 1 to provide ssDNA ends which are acted upon by RAD51 and DMC1 [4].
Phophoesterase motifs are conserved in this family of proteins. Biochemical
analysis
demonstrates mutation of key amino acids within these motifs can inactivate
the nuclease
activity of this protein and impair its biological activity [111;112;122].
Conserved amino
acids outside of the phosphoesterase domains can also affect function of MREll
[111].
AtMREll and ScMREll were cloned to demonstrate the use of MREll in a dominant-
negative approach to reduce homologous recombination. AtMREll was engineered
to
encode a protein defective for phosphoesterase activity by changing a key
amino acid residue
in Motif I from aspartate to alanine (i.e. AtMRE11: Motif I:D-A).
A. Cloning and evaluation of target genes
Target genes were cloned using specific oligonucleotides designed to prime DNA
synthesis in a PCR reaction with either cDNA or genomic DNA (gDNA) from the
appropriate species as template. The primers were designed to incorporate
convenient
restriction sites into the amplicon to facilitate initial cloning of the gene
and its subcloning
into various expression vectors. Genes cloned and the oligo primers used to
achieve this are
described in TABLE 1. PCR conditions were as described [123] or as recommended
by the
supplier of the thermostable DNA polymerase Pfu (Stratagene) or Taq
(Pharmacia). PCR
reactions were conducted using a thermocycler (Perkin-Elmer Model 9700).
1) AtDMC1
Template DNA was derived from a commercially available cDNA library of
Arabidopsis thaliana ecotype Columbia in the vector lambda ZAP II
(Stratagene). The
library was mass-excised following the protocol supplied by the manufacture.
The resultant
-32-
CA 02422362 2003-03-13
WO 02/22811 PCT/CA01/01306
phagemid suspension was concentrated by a combination of precipitation with
polyethylene
glycol as described by Ausubel et al. (1998) and desiccation using a Speed Vac
(Savant). In
this manner, the phagemid suspension was concentrated at least 5-fold. One
hundred
microlitres of the concentrated phagemid suspension was extracted with phenol
and
chloroform following standard procedures to remove protein and other
contaminants from
DNA with subsequent precipitation using ethanol [123]. In this manner, DNA
from
approximately 2 ml of phagemid suspension was concentrated and resuspended in
20 1 of
LTE ((lmM Tris-HC1 , 0.1 mM EDTA (pH 8.0)) with RNase A (20 pg/m1)).
A primary PCR reaction was performed with 1 j.il Arabidopsis cDNA library
phagemid, 0.5 pmole 0L11434, 0.5 pmole OL11433, 0.2 mM dNTP's (i.e. dATP,
dCTP,
dGTP, dTTP; Pharmacia), 1.25 U Pfu (Stratagene) and Pfu buffer constituents
recommended
by the manufacturer in a volume of 25 1. The PCR conditions were 5 min @ 94
C, followed
by 25 cycles of 30s @94 C, 45 s @60 C and 2 mm @72 C, followed by 10 min @72 C
and storage at 4 C or ¨20 C. A secondary PCR was then performed with 2 ul of
the above
reaction used as template with 1.0 pmol OL11434 and 1.0 pmol OL11435 and other
constituents as above except using 2.5 U Pfu and a final volume of 50 1. Two
independent
secondary reactions were done with identical PCR conditions as above. The two
reactions
were pooled and DNA fragments were resolved by agarose electrophoresis using a
1% gel
and following standard procedures [123]. A DNA fragment of 1 kilobase pair
(kb)
expected to correspond to AtDMC1 was excised and the DNA recovered from the
agarose
using the Qiaquick Gel Extraction Kit (Qiagen) and protocol supplied by the
manufacturer.
DNA was digested with XhoI and phosphorylated with T4-polynucleotide kinase
following
standard procedures [123]. The plasmid cloning vector pBluescript II KS-
(Stratagene) was
digested with EcoRV and XhoI. The amplicon and vector DNA were purified by
agarose
electrophoresis and recovered as above. Amplicon and vector DNA were then
mixed in the
presence of T4 DNA ligase (Gibco-BRL) to covalently link the two molecules
following
standard procedures [123] in a final volume of 25 1. After 2 h at room
temperature, 1 p.1 of
glycogen (20 mg/ml) was added to the ligation mixture made up to 100 IA with
distilled
water. After precipitation with ethanol [123], the DNA was resuspended in 4 pl
of distilled
water. E. coli strain DH5alpha (Gibco-BRL) was transformed with 2.5 p.1 of the
concentrated
ligation following standard procedures [123] and plated on sterile TYS medium
(per litre
distilled water: 10 g Tryptone (Difco); 5 g yeast extract (Difco); 5 g NaC1
(Sigma); 15 g agar
-33-
CA 02422362 2003-03-13
WO 02/22811 PCT/CA01/01306
(Sigma)) containing ampicillin (100 pg/m1). Putative clones were propagated in
liquid TYS
(i.e. without agar) and ampicillin (100 jig/ml). Plasmid DNA was isolated by
standard
alkaline-lysis "mini-prep" procedure [123]. The DNA sequence of the resultant
clone,
pKR225, was determined at a commercial sequencing facility (Plant
Biotechnology Institute,
Saskatoon, Canada). Cloning of all other genes in this invention followed the
same principles
as for pKR225 with noted exceptions.
2) AtSPOli
A primary PCR reaction was performed with 2 1 Arabidopsis cDNA library
phagemid (isolated as described for cloning of AtDMC1), 0.5 pmole AtSP011-
5'Sma oligo,
0.5 pmole AtSP011-3'X oligo, 0.2 mM dNTP's, 1.25 U Pfu (Stratagene) and Pfu
buffer
constituents recommended by the manufacturer in a volume of 25 pl. The PCR
conditions
were 5 min @ 94 C, followed by 30 cycles of 30 s @ 94 C, 30 s @ 60 C and 2.5
min @ 72 C,
followed by 10 min @ 72 C and storage at 4 C or ¨20 C. A secondary PCR was
then
performed with 2 pi of the above reaction used as template with 1.0 pmol
AtSP011-5'Sma
oligo and 1.0 pmol AtSP011-3'PstNot oligo and other constituents as per the
primary PCR
reaction except using 2.5 U Pfu and a final volume of 50 4 Two independent
secondary
reactions were done with identical PCR conditions as above except replacing
the step at 60 C
with 63 C. The two reactions were pooled and DNA was digested with PstI. The
plasmid
cloning vector pBluescript II SK- (Stratagene) was digested with EcoRV and
PstI. DNA
fragments of interest corresponding to AtSP011 (-1.1 kb) and the vector (-3
kb) were
purified by agarose gel electrophoresis and recovered from the agarose as
described above.
The fragments were ligated together, transformed into E. coil and putative
clones of the gene
identified as described above. The DNA sequence of the resultant clone, pTK82,
was
determined to confirm it encoded AtSP011.
3. AtRAD51
Template for use in amplifying AtRAD51 was obtained from cDNA generated from
RNA isolated from A. thaliana ecotype Columbia total plant tissues treated
with gamma
radiation. Plants were grown in sterile culture as follows. Seeds of A.
thaliana ec. Columbia
were surface sterilized by first rinsing in 70% (v/v) ethanol for one minute
followed by
washing for 5-7 min with a solution of 50% (v/v) bleach, 0.05% (w/v) Tween 20
(Sigma).
After rinsing three times with sterile distilled water, the seeds were
resuspended in 0.1%
(w/v) agarose. Seeds were then dispensed in a grid pattern (-30 seeds/plate)
with 1-2 cm
spacing on sterile growth medium (0.5X Mirashige and Skoog basal salt media
(Sigma)
- 34 -
CA 02422362 2003-03-13
WO 02/22811 PCT/CA01/01306
containing 1% (w/v) sucrose, nicotinic acid (1 pg/m1), thiamine-HC1 (10
g/ml), pyridoxine-
HC1 (1 p.g/m1), myo-inositiol (100 g/m1) and solidified with 1.0% (w/v) agar
in 100 mm x
15 mm or 150 mm x 15 mm petri plates (Fisher). The plates were then placed at
4 C for 48 h
and transferred to a controlled environment chamber with temperature of 18-22
C and a light
regime of 16 h light and 8 h dark. After approximately 3 weeks plants were
treated with
gamma radiation using a Gamma-Cell 40 irradiator with a Co6 radiation source.
Plates
containing plants were placed in the irradiator and left for time periods
corresponding to
desired dosages estimated from the calibrated emission from the radiation
source and
accounting for decay over time. Plant tissues were collected after 5-10 min
recovery time
and rapidly frozen using liquid N2. For RNA extraction, plant tissues were
first ground to a
fine powder in the presence of liquid N2 using a mortar and pestle, and then
RNA was
isolated using the Rneasy Plant Kit (Qiagen) following the instructions
provided by the
manufacturer. cDNA was prepared from total RNA extracted from the plants
exposed to 20
or 40 krad of gamma radiation using a SuperScript Preamplification System for
First Strand
cDNA Synthesis following directions of the manufacturer (GIBCO-BRL). First
strand cDNA
from 5-10 lig total RNA from plants treated with 20 or 40 krad of gamma
radiation was
primed using oligo-dT supplied with the kit.
A primary PCR reaction was performed with 4 1 first-strand cDNA from either
the
had or 40 had treated plants, 0.5 pmole AtRAD51-5'Bam oligo, 0.5 pmole AtRAD51-
20 3'X oligo, 0.2 mM dNTP's, 2.5 U Taq (Pharmacia) and Taq buffer
constituents
recommended by the manufacturer in a volume of 251.11. The PCR conditions were
5 min @
94 C, followed by 25 cycles of 30 s @ 94 C, 30 s @ 55 C and 75 s @ 72 C,
followed by 10
min @ 72 C and storage at 4 C or ¨20 C. Two secondary PCR reactions were then
performed
for each of the above reactions using either 5 or 10 p.1 of the primary
reactions in separate
reactions as template with 1.0 pmole AtRAD51-5'Bam oligo and 1.0 pmole AtRAD51-
3'Pst
oligo and other constituents as above except using 5 U Taq and a final volume
of 50 pl. Two
independent secondary reactions were done for each template sample with
identical PCR
conditions as above. The two respective reaction series were pooled and DNA
fragments
were digested with BamHI and PstI. The plasmid cloning vector pBluescript II
KS-
(Stratagene) was digested with BamHI and PstI. DNA fragments of interest
corresponding to
AtRAD51 (-1.2kb) and the vector (-3 kb) were purified by agarose gel
electrophoresis and
recovered from the agarose as described above. The fragments were ligated
together,
-35-
CA 02422362 2003-03-13
WO 02/22811 PCT/CA01/01306
transformed into E. coli and putative clones of the gene identified as
described above. Two
clones were selected: pRH2 and pRH7 derived from cDNA from plants treated with
20 or 40
krad of gamma radiation, respectively. Determination of the DNA sequence of
these clones
revealed both had mutations at different positions of the open reading frame.
To resynthesize
a gene encoding a wild-type AtRAD51, restriction fragments from pRH2 and pRH7
were
combined as follows: pRH2 was digested with XbaI and BamHI and a ¨400 bp
fragment was
purified; pRH7 was digested with PstI and XbaI and a ¨770bp fragment was
purified; both
fragments were combined and ligated into pBluescript II KS- (Stratagene)
digested with
BamHI and PstI. The resulting clone, pRH15, was sequenced and found to encode
a wild-
type AtRAD51.
3. AtMREll
Using the first 1000 bp of hMREll cDNA sequence [124] to query public DNA
sequence databanks with the BLAST search algorithm [125], an Arabidopsis
genomic
sequence (ACCESSION #AB010695) was identified with some sequence homology.
Based
on this genomic DNA sequence, oligonucleotide primers were designed to amplify
a ¨450 bp
fragment that would encode the ¨250 bp of the 5' region of the putative
AtMREll coding
sequence and ¨200 bp of a potential intron sequence. The ¨450 bp fragment was
amplified
by PCR using genomic DNA from A. thaliana ec. Columbia which was isolated
following the
method of Junghans and Mezlaff (1990) [126]. Plants from which DNA was
isolated were
first grown at 18-22 C with 16 h light and 8 h dark for 3-4 wk. Aerial tissues
were collected
and rapidly frozen with liquid N2 before storage at ¨80 C until processing.
For PCR a
primary reaction included 1.2 g of genomic DNA, 0.5 pmole 0L12414 oligo, 0.5
pmole
0L12413 oligo, 0.2 mM dNTP's, 1.25 U Tag (Pharmacia) and Taq buffer
constituents
recommended by the manufacturer in a volume of 25 1. The PCR conditions were
5 min @
94 C, followed by 30 cycles of 30 s @ 94 C, 30 s @ 58 C and 1.0 min @ 72 C,
followed by
10 min @ 72 C and storage at 4 C or ¨20 C. A secondary PCR was then performed
with 2 .1
of the above reaction used as template with 1.0 pmol 0L12414 oligo and 1.0
pmol 0L12415
oligo and other constituents as per the primary PCR reaction except using 2.5
U Taq and a
final volume of 50 1. Two independent secondary reactions were done with
identical PCR
conditions as above. The 450 bp fragment was purified by agarose gel
electrophoresis and
recovered from the gel as described above. Approximately 100 ng of this DNA
fragment was
labeled with alpha-32P-dCTP by random priming as per standard procedure [123].
A cDNA
library of A. thaliana ec. Columbia obtained from a commercial supplier
(Stratagene) was
-36-
CA 02422362 2003-03-13
WO 02/22811 PCT/CA01/01306
plated on 150 mm x 15 mm petri plates (Fisher) at a plaque density approaching
confluence,
following directions of the manufacturer. Plaque lifts from six such plates
were performed
using Hybond-N membranes (Amersham) following directions of the supplier.
Membranes
were probed with the radiolabelled 450 bp fragment following the method of
Church and
Gilbert (1984), with ¨1x106 cpm of probe per millilitre of hybridization
solution.
Hybridization was performed overnight at 60 C using a rotisserie incubator
(Robbins
Scientific). Non-specific binding of the probe was reduced by washing
membranes following
standard procedures [123] with two 10 min washes at 22 C with 60-80 ml of
4.73xS SC, 0.1%
(w/v) SDS, followed by two 30 mm washes at 50 C with 60-80 ml of the same
solution
prewarmed to 50 C. Filters were then transferred to a solid support, wrapped
in plastic film
and placed in an X-ray cassette. After overnight exposure at ¨80 C, the film
was developed
and twelve putative clones (C1-C12) were identified which hybridized to the
450 bp
fragment. These clones were purified from contaminating phage following
standard
procedures [123] and using the 450 bp fragment as probe with identical
conditions as above.
One clone, phi-C7A, was characterized further. The insert was isolated by
conversion to
plasmid vector following directions of the manufacturer (Stratagene) resulting
in pKR242.
pKR242 was sequenced using primers flanking the multiple cloning site of the
vector, as
suggested by the manufacturer (Stratagene), and 0L12779 and 0L12780 (Table 1).
The
entire sequence of pKR242 was determined and shown to encode an homologue
MREll
genes from other species. The cDNA, encoding the coding region of the gene was
compared
to the genomic sequence in the public database (ACCESSION #AB010695) which
disclosed
that the gene contains twenty introns. Comparison of predicted amino acid
sequence encoded
by pKR242 with other MREll protein sequences illustrated it was not full-
length.
Comparison of genomic DNA sequence to genes from other species enabled
prediction of a
putative start codon for AtMRE11. To clone the 5' portion of AtMREll not
present in
pKR242 PCR was employed. First-strand cDNA was synthesized from total RNA
isolated
from A. thaliana ec. Columbia treated with 30 bad of gamma radiation as
described above. A
primary PCR reaction was performed with 2 1 first-strand cDNA, 0.5 pmole
OL12414
oligo, 0.5 pmole OL12413 oligo, 0.2 mM dNTP's, 1.25 U Pfu (Stratagene) and Pfu
buffer
constituents recommended by the manufacturer in a volume of 25 1. The PCR
conditions
were 5 min @94 C, followed by 25 cycles of 30 s @94 C, 30s @5 C and 60s @72 C,
followed by 10 min @ 72 C and storage at 4 C or ¨20 C. Two secondary PCR
reactions were
then performed using 2 pi of the primary reaction as template with 1.0 pmole
0L12414 oligo
- 37 -
=
CA 02422362 2003-03-13
WO 02/22811 PCT/CA01/01306
and 1.0 pmole 01 12415 oligo and other constituents as above except using 2.5
U Pfu and a
final volume of 50 pl. The two reactions were pooled and DNA was digested with
EcoRI
and XbaI. The plasmid cloning vector pBluescript II KS- (Stratagene) was
digested with
EcoRI and XbaI. DNA fragments of interest corresponding to the 5' end of
AtMREll (-225
bp) and the vector (-3 kb) were purified by agarose gel electrophoresis and
recovered from
the agarose as described above. The fragments were ligated together,
transformed into E. coli
and putative clones of the DNA fragment identified as described above. One
clone, pRH1
was sequenced to confirm it encodes the 5' end of AtMRE11. To resynthesize a
gene
encoding a full-length AtMRE11, restriction fragments from pRH1 and pKR242
were
combined as follows: pRH1 was digested with HindIII and XbaI and a ¨225 bp
fragment was
purified; pKR242 was digested with XbaI and XhoI and a ¨2. kb fragment was
purified; both
fragments were combined and ligated into pSPORT2 (Gibco-BRL) digested with
HindIII and
Sall. The resulting clone, pNH2 was sequenced and found to encode a wild-type
AtMRE11.
Comparison of the conceptual protein encoded by the cloned AtMREll gene to
other
MREll proteins from other organisms confirms it is a homologue of this family
of proteins.
The conservation extends to phophoesterase motifs which have been determined
to be
essential for the function of this family of proteins [111;112;122]. Alternate
forms of
AtMRE11 may be engineered to confer a dominant-negative effect as described
above for
other proteins. For example, the phosphesterase motifs responsible for
nuclease activity are
highly conserved within the MREll family. Mutations of different amino acids
within these
motifs may inactivate MREll function [111;112;122]. Mutations outside of these
motifs
may also suppress function of the protein [111].
6. ScDMC1
a) genomic clone
ScDMC1 gene in yeast contains a single intron which may be excised in a
meiosis-
specific manner [20]. Template for amplifying ScDMC1 was genomic DNA from
Saccharomyces cerevisiae strain RK1308 [128] isolated by standard procedure
[123]. Two
PCR reactions were performed with approximately 1 p,g of genomic DNA, 1.0 pmol
yDMC-
5'Bam oligo and 1.0 pmol yDMC-3'Pst oligo, 0.2 mM dNTP's, 2.5 U Pfu
(Stratagene) and
Pfu buffer constituents recommended by the manufacturer in a volume of 50 pl.
The PCR
conditions were 5 min @ 94 C, followed by 25 cycles of 30 s @ 94 C, 30 s @ 55
C and 2 min
@ 72 C, followed by 10 min @ 72 C and storage at 4 C or ¨20 C. The two
reactions were
pooled and DNA was digested with PstI. The plasmid cloning vector pBluescript
II KS-
- 38 -
CA 02422362 2003-03-13
WO 02/22811 PCT/CA01/01306
(Stratagene) was digested with SmaI and PstI. DNA fragments of interest
corresponding to
ScDMC1 (-1.1 kb) and the vector (-3 kb) were purified by agarose gel
electrophoresis and
recovered from the agarose as described above. The fragments were ligated
together,
transformed into E. coli and putative clones of the gene identified as
described above. The
DNA sequence of the resultant clone, pMW13, was determined to confirm it
encoded
ScDMC1-genomic.
b) cDNA clone
Template for use in amplifying ScDMC1-cDNA was obtained from cDNA generated
from RNA isolated from S. cerevisiae cells undergoing meiosis. Strain RK1308
[128]was
grown in YPD liquid medium (1% (w/v) yeast extract, 2% (w/v) peptone, 2% (w/v)
glucose)
to cell density of ¨2x107 cells/ml at 30 C with shaking at 225 RPM. Cells were
collected by
centrifugation, washed and resuspended in SPM medium ( 0.3% (w/v) potassium
acetate,
0.02% (w/v) raffinose, 5 m/mluracil, 5 1-1,g/m1 histidine, 25 g/ml leucine)
then cultured as
above for 2.5 h. Cells from 10 ml of culture were collected by centrifugation,
washed with
sterile distilled water (SDW) and resuspended in 1 ml SDW before rapid
freezing in a dry-
ice/ methanol bath and stored at ¨80 C. Total RNA was extracted from these
cells following
a standard protocol [123]. Approximately 41.ig of RNA was used to create cDNA
primed
with oligo-dT using the Superscript Preampification System for First Strand
cDNA Synthesis
(Gibco/BRL) following directions of the manufacturer. Two PCR reactions were
performed
with 3 !al of first strand cDNA, 1.0 pmol yDMC-5'Bam oligo and 1.0 pmol yDMC-
3'Pst
oligo, 0.2 mM dNTP's, 2.5 Ti Pfu (Stratagene) and Pfu buffer constituents
provided by the
manufacturer in a volume of 50 pl. The PCR conditions were 5 min @ 94 C,
followed by 25
cycles of 30s @94 C, 30s @55 C and 2 min @72 C, followed by 10 min @72 C and
storage at 4 C or ¨20 C. The two reactions were pooled and DNA was digested
with PstI.
The plasmid cloning vector pBluescript II KS- (Stratagene) was digested with
SmaI and PstI.
DNA fragments of interest corresponding to ScDMC1-cDNA (-1.1 kb) and the
vector (-3
kb) were purified by agarose gel electrophoresis and recovered from the
agarose as described
above. The fragments were ligated together, transformed into E. coli and
putative clones of
the gene identified as described above. The DNA sequence of the resultant
clone, pMW19,
was determined to confirm it encoded ScDMC1-cDNA.
7. ScRAD51
Template for amplifying ScRAD51 was genomic DNA from Saccharomyces
cerevisiae strain AB972 [129] isolated by standard procedure [123]. Two PCR
reactions were
-39-
CA 02422362 2003-03-13
WO 02/22811 PCT/CA01/01306
performed with approximately 1 lAg of genomic DNA, 1.0 pmol yR51-5'Bam oligo
and 1.0
pmol yR51-3'Pst oligo, 0.2 mM dNTP's, 2.5 U Pfu (Stratagene) and Pfu buffer
constituents
provided by the manufacturer in a volume of 50 p1. The PCR conditions were 5
min @ 94 C,
followed by 25 cycles of 30 s @ 94 C, 30 s @ 58 C and 2.5 min @ 72 C, followed
by 10 min
@ 72 C and storage at 4 C or ¨20 C. The two reactions were pooled and DNA was
digested
with BamHI and PstI. The plasmid cloning vector pBluescript II KS-
(Stratagene) was
digested with BamHI and PstI. DNA fragments of interest corresponding to
ScRAD51 (-1.2
kb) and the vector (-3 kb) were purified by agarose gel electrophoresis and
recovered from
the agarose as described above. The fragments were ligated together,
transformed into E. coli
and putative clones of the gene identified as described above. The DNA
sequence of the
resultant clone, pMW35, was determined to confirm it encoded ScRAD51.
8. ScRAD52
Template for amplifying ScRAD52 was genomic DNA from Saccharomyces
cerevisiae strain AB972 [129] isolated by standard procedure [123]. Two PCR
reactions were
performed with approximately 1 jig of genomic DNA, 1.0 pmol yR52-5'Pme oligo
and 1.0
pmol yR52-3'Not oligo, 0.2 mM dNTP's, 2.5 U Pfu (Stratagene) and Pfu buffer
constituents
recommended by the manufacturer in a volume of 50 1. The PCR conditions were
5 min @
94 C, followed by 25 cycles of 30 s @ 94 C, 30 s @ 60 C and 2 mM @ 72 C,
followed by 10
min @ 72 C and storage at 4 C or ¨20 C. The two reactions were pooled and DNA
was
digested with EcoRI and NotI. The plasmid cloning vector pBluescript II SK-
(Stratagene)
was digested with EcoRI and NotI. DNA fragments of interest corresponding to
ScRAD52
(-1.5 kb) and the vector (-3 kb) were purified by agarose gel electrophoresis
and recovered
from the agarose as described above. The fragments were ligated together,
transformed into
E. coli and putative clones of the gene identified as described above. The DNA
sequence of
the resultant clone, pTK50, was determined to confirm it encoded ScRAD52.
9. ScRAD54
Template for amplifying ScRAD54 was genomic DNA from Saccharomyces
cerevisiae strain AB972 [129] isolated by standard procedure [123]. Two PCR
reactions were
performed with approximately 1 1.ig of genomic DNA, 1.0 pmol yR54-5'RI oligo
and 1.0
pmol yR54-3'Pst oligo, 0.2 mM dNTP's, 2.5 U Pfu (Stratagene) and Pfu buffer
constituents
recommended by the manufacturer in a volume of 50 1. The PCR conditions were
5 mM @
94 C, followed by 25 cycles of 30 s @ 94 C, 30 s @ 60 C and 5 min @ 72 C,
followed by 10
min @ 72 C and storage at 4 C or ¨20 C. The two reactions were pooled and DNA
was
- 40 -
CA 02422362 2003-03-13
WO 02/22811 PCT/CA01/01306
digested with PstI. The plasmid cloning vector pBluescript II KS- (Stratagene)
was digested
with SmaI and PstI. DNA fragments of interest corresponding to ScRAD54 (-2.7
kb) and the
vector (-3 kb) were purified by agarose gel electrophoresis and recovered from
the agarose as
described above. The fragments were ligated together, transformed into E. coil
and putative
clones of the gene identified as described above. The DNA sequence of the
resultant clone,
pMW34, was determined to confirm it encoded ScRAD54.
10. ScSPO1 1
Template for amplifying ScSPO1 lwas genomic DNA from Saccharomyces cerevisiae
strain AB972 [129] isolated by standard procedure [123]. Two PCR reactions
were
performed with approximately 1 g of genomic DNA, 1.0 pmol ySPO-5'Bam oligo
and 1.0
pmol ySPO -3'Pst oligo, 0.2 mM dNTP's, 2.5 U Pfu (Stratagene) and Pfu buffer
constituents
recommended by the manufacturer in a volume of 50 1. The PCR conditions were
5 min @
94 C, followed by 25 cycles of 30 s @ 94 C, 30 s @ 63 C and 2.5 min @ 72 C,
followed by
10 mM @ 72 C and storage at 4 C or ¨20 C. The two reactions were pooled and
DNA was
digested with BamHI and PstI. The plasmid cloning vector pBluescript II KS-
(Stratagene)
was digested with BamHI and PstI. DNA fragments of interest corresponding to
ScSP011
(-1.2 kb) and the vector (-3 kb) were purified by agarose gel electrophoresis
and recovered
from the agarose as described above. The fragments were ligated together,
transformed into
E. coli and putative clones of the gene identified as described above. The DNA
sequence of
the resultant clone, pTK81, was determined to confirm it encoded ScSP011.
11. EcSSB
Template for amplifying SSB was genomic DNA from E. coil strain CC106 [130].
Genomic DNA from the strain was isolated as follows: 1) cells were cultured to
mid-log
phase in TYS liquid medium at 37 C; 2) cells were pelleted by centrifugation
and washed
with sterile distilled water; 3) 20 ml of cell culture was centrifuged and the
cell pellet
resuspended in 0.5 ml TE/Tween buffer (10 mM Tris-HC1 (pH 8.0), 1 mM EDTA,
0.01%
(w/v) Tween 20); 4) cells were incubated at 85 C for 20-30 mM and then
pelleted by
microcentrifugation for 5-10 min; 5) the supernatant was collected and 50 p1
of TE-RNase
(RNase A 20 g/ml) was added before incubation at room temperature for 30 min;
6) the
supernatant was extracted with phenol and chloroform and precipitated with
ethanol as per
standard procedure [123]. 7) the DNA was resuspended in 20 1 of LTE (TE
diluted 1:10
with distilled water).
-41-
CA 02422362 2003-03-13
WO 02/22811 PCT/CA01/01306
The SSB gene was amplified with two primer sets to create two clones of the
gene
with different restriction sites at the 5' end. PCR reactions were performed
with 4 1 of
genomic DNA, 1.0 pmol SSB-5 'Barn oligo and 1.0 pmol SSB-3'Pst oligo, or 1.0
pmol SSB-
Sma oligo and 1.0 pmol SSB-3'Pst oligo, plus 0.2 mM dNTP's, 2.5 U Pfu
(Stratagene) and
Pfu buffer constituents recommended by the manufacturer in a volume of 50 pl.
The PCR
conditions were 5 mm @ 94 C, followed by 25 cycles of 30 s @ 94 C, 30 s @ 55 C
and 1.0
min @ 72 C, followed by 10 mm @ 72 C and storage at 4 C or ¨20 C. The
amplified DNA
from the PCR reactions using SSB-5'Bam oligo and SSB-3'Pst oligo or SSB-5'Sma
oligo
and SSB-3'Pst oligo was digested with BamHI and PstI or SmaI and PstI,
respectively. The
corresponding plasmid cloning vector pBluescript II KS- (Stratagene) was also
digested with
BamHI and PstI or SmaI and PstI, respectively. DNA fragments of interest
corresponding to
SSB (-0.55 kb) and the vector (-3 kb) were purified by agarose gel
electrophoresis and
recovered from the agarose as described above. The fragments were ligated
together,
transformed into E.coli and putative clones of the SSB gene identified as
described above.
The DNA sequence of the resultant clones, pTK27 and pTK28, were determined to
confirm
they encoded SSB with flanking restriction sites of BamHI and PstI or SmaI and
PstI,
respectively.
A SSB derivative was also created so that the resultant protein would encode a
nuclear localization sequence (i.e. NLS-SSB). A synthetic oligonucleotide was
created which
encoded the nuclear localization sequence (NLS) corresponding to that found in
simian virus
40 T-antigen [114]. The nucleotide sequence
(GGATCCAAAAAAATGGCTCCTAAGAAGAAG-
AGAAAGGTTGGAGGAGGACCCGGG) encodes a BamHI site, in-frame start codon, and
SmaI site (underlined). A plasmid containing this cloned NLS sequence and
derived from
pBluescript II KS- (Stratagene) was digested with SmaI and PstI and the DNA
fragment
corresponding to the vector (-3 kb) was gel purified. pTK28 was also digested
with SmaI
and PstI and the DNA fragment corresponding to the SSB gene (-0.55 kb) was
also gel
purified. The DNA fragments were recovered from agarose, ligated together,
transformed
into E. coli and putative clones of the NLS-SSB gene identified as described
above. The
DNA sequence of the resultant clone, pTK29, was determined to confirm it
encoded NLS-
SSB.
B. Engineering and cloning of altered forms of target genes
-42 -
CA 02422362 2003-03-13
WO 02/22811 PCT/CA01/01306
Altered forms of genes were engineered to encode proteins with altered amino
acid
sequences and modified function. Site-directed mutagenesis was performed using
the
QuickChange Site-Directed Mutagenesis Kit (Stratagene), unless otherwise
stated, following
directions of the manufacturer using a thermocycler (Perkin-Elmer Model 9700)
and the
thermostable DNA polymerase Pfu (Stratagene). Base-pair changes of interest
were
incorporated into oligonucleotides which were then used to prime replication
of an altered
form of the target gene. Oligonucleotides used to incorporate the desired base
changes in
target genes are listed in TABLE 1.
1. DMC1
ScDMC1 was engineered to encode mutations potentially responsible for:
i) ATP-binding and hydrolysis with mutation ScDMC1:G126D;
ii) ATP-induced conformational change with mutation ScDMC1:N263Y;
iii) monomer-monomer interactions with mutation ScDMC1:A288T.
To create these mutations the protocol of the QuickChange Site-Directed
Mutagenesis Kit
(Stratagene) was followed. The mutagenesis reactions contained ¨50 ng of pMW13
as
template, the appropriate oligonucleotides and reaction constituents and Pfu
polymerase
(Stratagene) as recommended by the manufacturer. The reactions were incubated
in a
thermocycler for 30 s @ 95 C followed by 12 cycles of 30 s @ 95 C, 1 min @ 55
C and 8
min 20 s @ 68 C before storage at 4 C or ¨20 C. ScDMC1:G126D was created using
oligos
yDMC-G126D-sense and yDMC-G126D-antisense resulting in the plasmid pTK68-3.
ScDMC1:N263Y was created using oligos yDMC-N263Y-sense and yDMC-N263Y -
antisense resulting in the plasmid pTK70-5. ScDMC1:A288T was created using
oligos
yDMC-A288T-sense and yDMC-A288T-antisense resulting in the plasmid pTK64-1.
All
clones were sequenced to confirm the presence of the mutation.
Combinations of these mutations were also created using two methods. Firstly,
the
QuickChange Site-Directed Mutagenesis Kit (Stratagene) and supplied protocol
were used
with the template being one of the mutant gene forms from above and a
oligonucleotide pair
which confers a mutation at a different site. ScDMC1:G126D+A288T was created
in a
reaction containing ¨50 ng of pTK64-1 (i.e. ScDMC1:A288T) as template with
oligonucleotides yDMC-G126D-sense and yDMC-G126D-antisense resulting in the
plasmid
pTK67-3. Likewise ScDMC1:N263Y +A288T was created in a reaction containing ¨50
ng
of pTK64-1 (i.e. ScDMC1:A288T) as template with oligonucleotides yDMC-N263Y-
sense
and yDMC-N263Y -antisense resulting in the plasmid pTK69-6. Secondly, a
combination of
-43 -
CA 02422362 2003-03-13
WO 02/22811 PCT/CA01/01306
restriction fragments from various constructs was used to create genes with
multiple
mutations. ScDMC1:G126D+ N263Y was created by digesting pTK68-3 (i.e.
ScDMC1:G126D) with NdeI and PstI, purifying ¨3.5 kb fragment and ligating to
this a ¨550
bp fragment purified from pTK70-5 (i.e. ScDMC1:N263Y) digested with NdeI and
PstI
resulting in the plasmid pTK71-1. Likewise ScDMC1:G126D+ N263Y+A288T was
created
by digesting pTK68-3 (i.e. ScDMC1:G126D) with NdEI and PstI, purifying ¨3.5 kb
fragment
and ligating this to a ¨550 bp fragment purified from pTK69-6 (i.e.
ScDMC1:N263Y
+A288T) digested with NdeI and PstI resulting in the plasmid pTK72-1. All
clones were
sequenced to confirm the presence of the mutation.
2. RAD51
ScRAD51 was engineered to encode mutations potentially responsible for ATP-
binding and hydrolysis with mutation ScRAD51:G190D. Site-directed mutatgenesis
was
performed as above with the exception that pMW35 was used as template and the
oligonucleotides were yRAD51-G190D-sense and yRAD51-G190D-antisense resulting
in the
plasmid pTK84. The clone was sequenced to confirm the presence of the
mutation.
3. SPO1 1
ScSPO1 1 was engineered to encode mutations potentially responsible for
topoisomerase-like DNA cleavage activity with mutation ScSP011:Y135F. Site-
directed
mutatgenesis was performed as above with the exception that pTK81 was used as
template
and the oligonucleotides were ySPO-Y135F-sense and ySPO-Y135F -antisense
resulting in
the plasmid pTK83-3. The clone was sequenced to confirm the presence of the
mutation.
4. MREll
AtMREll was engineered to encode mutations responsible for nuclease activity
with
mutation AtMRE11: Motif I:D-A. This was done using PCR and an oligonucleotide
that
incorporates a base change into the gene resulting in the desired changed
amino acid
sequence. The insert of pNH2 corresponding to AtMREll was first isolated by
digesting the
plasmid with EcoRI and purifying the ¨2.2 kb fragment corresponding to AtMREll
by
agarose gel electrophoresis. This was ligated to pBluescript KS+ previously
digested with
EcoRI. The resultant clone of AtMREll was denoted pF01. A primary PCR reaction
was
performed with ¨30 ng of pF01 as template DNA, 50 pmol MRE-F1 oligo and 50
pmol OL
12413 oligo, 0.2 mM dNTP's, 2.5 U PfuTurbo (Stratagene) and PfuTurbo buffer
constituents
recommended by the manufacturer in a volume of 50 pd. The PCR conditions were
3 min @
94 C, followed by 25 cycles of 30 s @ 94 C, 1 min @ 52 C and 1 min @ 72 C,
followed by 3
-44 -
CA 02422362 2003-03-13
WO 02/22811 PCT/CA01/01306
min @ 72 C and storage at 4 C or ¨20 C. A secondary PCR reaction was then
performed
using a 10 1 aliquot of the primary reaction as template and other conditions
identical to
above except that 25 pmol each of MRE-F2 oligo and OL 12415 oligo were used,
and that the
extension step was 45 s @ 72 C. A tertiary PCR reaction was then performed
with a 5 1
aliquot of the secondary reaction as template and all other conditions
identical to the
secondary reaction except that the annealing step was 30 s @ 58 C. A
quaternary PCR
reaction was then performed using a 5 pl aliquot of the tertiary reaction as
template and all
other conditions identical to the tertiary reaction. The amplified DNA was
digested with PstI
and XbaI and a ¨250 bp fragment corresponding to the 5' portion of AtMREll was
gel-
purified. The middle region of AtMREll was isolated by digestion of pF01 with
XbaI and
Avail, and a 1.3 kb fragment was gel-purified. The 3' end of AtMREll was
amplified by
PCR using 25 ng of pF01 as template DNA, 50 pmol MRE-AVA oligo and 50 pmol MRE-
R1 oligo, 0.2 mM dNTP's, 2.5 U cloned Pfu (Stratagene) and cloned Pfu buffer
constituents
recommended by the manufacturer in a volume of 50 p1. The PCR conditions were
3 min @
94 C, followed by 10 cyCles of 30 s @94 C, 30s @52 C and 2 min @72 C, followed
by 20
cycles of 30 s @ 94 C, 30 s @ 58 C and 2 min @ 72 C, followed by 2 min @72 C
and
storage at 4 C or ¨20 C. The amplified DNA was digested with Avail and Sail,
and a 650 bp
DNA fragment was gel-purified. The plasmid cloning vector pBluescript KS+
(Stratagene)
was digested with PstI and Sall, and also gel-purified. To resynthesize a gene
representing an
open reading frame encoding AtMRE11: Motif I:D-A, the fragments prepared above
were
combined and ligated together, transformed into E. coli, and putative clones
of the gene were
identified as described above. The DNA sequence of the resulting clone, pF012,
was
determined to confirm it encodes AtMRE11: Motif I:D-A, with the desired
altered basepair
mutation in the 5' region of AtMRE11, and that 5' and 3' ends amplified by PCR
had the
correct sequence of AtMRE11.
C. Genetic Assay
To demonstrate alternative mechanisms for increasing and decreasing meiotic
homologous recombination, a genetic assay was employed to examine the effects
of different
proteins on meiotic homologous recombination and non-sister chromatid
exchange. A
diploid strain of S. cerevisiae, BR2495 [27] was used which possesses
heteroalleles at genes
essential for biosynthesis of different metabolites required for cell growth
and/or division or
viability. The allele for a particular gene carried on the maternal chromosome
has a mutation
and encodes a non-functional protein. The allele for the same gene. on the
paternal
- 45 -
CA 02422362 2003-03-13
WO 02/22811 PCT/CA01/01306
chromosome also has a mutation making its gene product non-functional.
However, the
mutation of the paternal allele is at a different position in the gene than
the mutation in the
maternal allele. Because both maternal and paternal alleles are both mutated,
the diploid cell
cannot make a functional gene product. After meiosis, gametes and progeny that
inherit only
the maternal or paternal allele also cannot make a functional gene product.
However, if a
recombination event occurs whereby genetic information is exchanged between
maternal and
paternal chromosomes within the DNA region between the mutations carried by
the two
alleles, then a functional allele can result. Progeny carrying this recombined
allele resulting
from exchange between non-sister chromatids may therefore encode a functional
gene
product. Thus we have a genetic assay to monitor exchange of genetic
information between
non-sister chromatids from homologous maternal and paternal chromosomes. The
system
used here employed S. cerevisiae BR2495 strain [27] with genotype as follows:
Mata leu2-
27 his4-280 / Mata (Mat alpha) leu2-3,112 his4-260; ura3-1 / ura3-1; p1-289 /
trp1-1;
CYH10 / cyh10; ag4-8 thrl-1 / ARG4 thr1-4; ade2-1 / ade2-1. BR2495 has
heteroalleles to
conveniently assay for non-sister chromatid exchange at four loci:
i.) his4 which when functional encodes histidinol dehydrogenase which
participates in
biosynthesis of histidine enabling cells to grow in absence of external
histidine;
ii.) leu2 which when functional encodes 3-isopropylmalate dehydrogenase which
participates in biosynthesis of leucine enabling cells to grow in absence of
external leucine;
iii.) trpl which when functional encodes phosphoribosylanthranilate isomerase
which
participates in biosynthesis of tryptophan enabling cells to grow in absence
of external
tryptophan;
iv.) thrl which when functional encodes homoserine kinase which participates
in
biosynthesis of threonine enabling cells to grow in absence of external
threonine.
The strain or progeny carrying defective alleles are termed auxotrophic for
histidine,
leucine, tryptophan and threonine because they are unable to grow in the
absence of these
compounds being provided externally for them. Recombinants resulting in
genetic exchange
between non-sister chromatids of homologous maternal and paternal chromosomes
leading to
functional alleles are termed prototrophs because they can make their own
histidine, leucine,
tryptophan and threonine and do not require an external source of these
compounds for
growth and cell division.
The exemplified assay system involves growth of a BR2495 strain expressing the
test
gene of interest. The strain is induced to undergo meiosis. Progeny are
assayed for viability
- 46 -
CA 02422362 2003-03-13
WO 02/22811 PCT/CA01/01306
and the ability to grow in the absence of histidine, leucine, tryptophan or
threonine. By
determining the number of prototrophic and viable progeny in a given
treatment,
recombination frequency can be determined (i.e. # prototrophic progeny per #
viable
progeny). By comparing recombination frequency between different test genes,
the effect of
the test gene being expressed on either increasing or decreasing meiotic
homologous
recombination can be determined.
D. Gene Expression
To test the effect of different genes in strategies to modulate meiotic
homologous
recombination frequency a gene expression system and plasmid vectors
functional in S.
cerevisiae were employed. The exemplified expression system used was based on
the
plasmids described by Gari et al. (1997). Briefly, a series of S. cerevisiae
expression vectors
were created with variation in vector copy-number per cell and variations in
strength of
transcription promoter. Therefore, by using different vectors combining
different cell copy-
number with different promoter strengths, the effect of expressing genes at
different levels
can be evaluated. The plasmids are based on pCM188 and pCM189 with copy-number
of 1-2
plasmids per cell and pCM190 with copy-number of upto 40 plasmids per cell
[131]. The
transcription promoters on these plasmids is a hybrid system developed by Gari
et al. (1997)
which permits suppression or induction of gene expression by varying growth
medium
constituents. The promoter system employs a DNA-binding protein, tetR, fused
to a
transcription activator derived from the VP16 protein [132]. tetR us a natural
component of
the regulatory system controlling expression of tetracycline resistance in
prokaryotes [132].
In the absence of tetracycline, tetR is bound to a defined DNA sequence, tet0,
and prevents
expression of tetracycline resistance genes. In the presence of tetracycline,
tetR binds
tetracycline resulting in a conformational change that causes it to release
tet0 and thereby
permitting expression of tetracycline resistance. By fusing tetR with VP16 and
incorporating
tet0 sites with basal transcription promoter sequences, Gari et al. (1997)
created a regulatable
transcription promoter system. In the presence of tetracycline or doxycycline,
an analogue of
tetracycline, transcription of the target gene is suppressed because the tetR-
VP16 fusion
cannot bind to the promoter to initiate transcription. Conversely, when
tetracycline or
doxycycline is absent the tetR-VP16 fusion protein can bind to tet0, recruit
RNA polymerase
and facilitate transcription of the target gene. By varying the number of tet0
sites from two
(pCM188) to seven (pCM189 and pCM190) the promoter strength can be increased
¨2-fold
- 47 -
CA 02422362 2003-03-13
WO 02/22811 PCT/CA01/01306
[132]. The combination of vector copy number and promoter strength allows
target gene
expression to be varied ¨5-fold (pCM188 versus pCM190).
The exemplified regulatable expression system discloses strategies to affect
meiotic
homologous recombination frequency by enabling the promotion of gene
expression in cells
preparing for and undergoing meiosis. By promoting transcription in cells
specifically at this
stage one suppresses the effects or any artifactual results due to
constitutive expression of test
genes during all stages of vegetative growth leading to meiosis.
Alternatively, a promoter
could be used which is expressed during meiosis or is meiosis-specific.
In summary, the exemplified system involves cloning genes of interest into
pCM188
or pCM190. The cells are cultured in the presence of doxycycline to suppress
expression of
test genes during vegetative growth. The cells are prepared to undergo meiosis
and the
doxycyline is removed to enable expression of the test gene. The cells are
induced to
undergo meiosis and resulting progeny cells are tested for viability and
frequency of
prototrophy resulting from recombination between heteroalleles on non-sister
chromatids.
The frequency of meiotic homologous recombination can thus be determined for
each test
gene enabling evaluation and comparison of strategies to modify meiotic
homologous
recombination.
2. Single gene expression constructs
a) AtDMC1
To show the effect of heterologous expression of DMC1 genes on meiotic
homologous recombination frequency, AtDMC1 was cloned and expressed in S.
cerevisiae
cells undergoing meiosis. AtDMC1 was cloned into the expression vectors
pCM188,
pCM189 and pCM190. All three vectors were digested with PmeI and the free ends
were
dephosphorylated using calf-intestinal phosphatase (New England BioLabs)
following the
protocol supplied by the manufacturer. pKR225 was digested with SmaI and ThoI
and
treated with the Klenow fragment of DNA polymera' se (Gibco/BRL) following
standard
procedures [123]. The DNA fragment released from pKR225 corresponding to
AtDMC1
(-1.1 kb) was purified by agarose gel electrophoresis and recovered from the
agarose as
described above. The AtDMC1 fragment was then ligated to the prepared vector
fragments,
transformed into E. coli and putative clones identified as described above.
The resultant
clones of AtDMC1 in pCM188, pCM189 and pCM190 were denoted pTK45, pTK5 and
pTK6, respectively.
b) ScDMC1
-48 -
CA 02422362 2003-03-13
WO 02/22811 PCT/CA01/01306
To show the effect of increased expression of native DMC1 on meiotic
homologous
recombination frequency, ScDMC1 was cloned and expressed in S. cerevisiae
cells
undergoing meiosis. ScDMC1 was cloned into pCM190 by first digesting this
vector with
PmeI and PstI. pMW13 was digested with XbaI and treated with T4 DNA polymerase
following standard procedures [123] before subsequent digestion with PstI. DNA
fragments
of interest corresponding to ScDMC1 (-1.1 kb) and pCM190 (-8 kb) were purified
by
agarose gel electrophoresis and recovered from the agarose as described above.
The
fragments were ligated together, transformed into E. coli and putative clones
of the gene in
the expression vector were identified. The resultant clone of ScDMC1 in pCM190
was
denoted pTK58.
To show the effect of expression of mutant DMC1 on meiotic homologous
recombination
frequency, yDMC1:G126D was cloned and expressed in S. cerevisiae cells
undergoing
meiosis. yDMC1:G126D was cloned into pTK77, a derivative of pCM190 containing
the
additional restriction sites SmaI, EcoRV, FseI and SwaI, in 5'-3' order,
located adjacent to
but 5' of the unique HindIII site of pCM190 and 3' of the CYC1 terminator of
the vector.
The pTK77 vector was digested with PmeI and PstI. pTK68-3 was digested with
XbaI and
treated with Klenow polymerase following standard procedures [123] before
subsequent
digestion with PstI. DNA fragments of interest corresponding to yDMC1:G126D (-
1.1 kb)
and pTK77 (-8 kb) were purified by agarose gel electrophoresis and recovered
from the
agarose as described above. The fragments were ligated together, transformed
into E. coli
and putative clones of the gene in the expression vector were identified. The
resultant clone
of yDMC1:G126D in the pCM190 derived pTK77 was denoted pTK85.
c) ScRAD51
To show the effect of increased expression of native RAD51 on meiotic
homologous
recombination frequency, ScRAD51 was cloned and expressed in S. cerevisiae
cells
undergoing meiosis. ScRAD51 was cloned into pCM190 by first digesting this
vector with
BamHI and PstI. pMW35 was also digested with BamHI and PstI. DNA fragments of
interest corresponding to ScRAD51 (-1.2 kb) and pCM190 (-8 kb) were purified
by agarose
gel electrophoresis and recovered from the agarose as described above. The
fragments were
ligated together, transformed into E. coli and putative clones of the gene in
the expression
vector were identified. The resultant clone of ScRAD51 in pCM190 was denoted
pTK53.
To show the effect of expression of mutant RAD51 on meiotic homologous
recombination
-49 -
CA 02422362 2003-03-13
WO 02/22811 PCT/CA01/01306
frequency, yRAD51:G190D was cloned and expressed in S. cerevisiae cells
undergoing
meiosis. yRAD51:G190D was cloned into pCM190 by first digesting this vector
with BamHI
and PstI. pTK84 was also digested with BamHI and PstI. DNA fragments of
interest
corresponding to yRAD51:G190D (-1.2 kb) and pCM190 (-8 kb) were purified by
agarose
gel electrophoresis and recovered from the agarose as described above. The
fragments were
ligated together, transformed into E. coli and putative clones of the gene in
the expression
vector were identified. The resultant clone of yRAD51:G190D in pCM190 was
denoted
pTK95.
d) EcSSB
To show the effect of increased ssDNA-binding protein on meiotic homologous
recombination frequency, SSB and NLS-SSB were cloned and expressed in S.
cerevisiae
cells undergoing meiosis. SSB and NLS-SSB were cloned individually into pCM190
[132]
by first digesting this vector with BamHI and PstI. pTK27 (SSB) and pTK29 (NLS-
SSB)
were also digested with BamHI and PstI. DNA fragments of interest
corresponding to SSB
or NLS-SSB (-0.6 kb) and pCM190 (-8 kb) were purified by agarose gel
electrophoresis and
recovered from the agarose as described above. The SSB and NLS-SSB DNA
fragments
were ligated independently to the DNA fragment corresponding to pCM190,
transformed into
E. coli and putative clones of the genes in the expression vector were
identified. The
resultant clones of SSB and NLS-SSB in pCM190 were denoted pTK35 and pTK36,
respectively.
e) SeSPO1 1
To show the effect of increased expression of native SPO1 1 on meiotic
homologous
recombination frequency, ScSP011 was cloned and expressed in S. cerevisiae
cells
undergoing meiosis. ScSPO1 1 was cloned into pCM190 by first digesting this
vector with
BamHI and PstI. pTK81 was also digested with BamHI and PstI. DNA fragments of
interest
corresponding to ScSP011 (-1.2 kb) and pCM190 (-8 kb) were purified by agarose
gel
electrophoresis and recovered from the agarose as described above. The
fragments were
ligated together, transformed into E. coli and putative clones of the gene in
the expression
vector were identified. The resultant clone of ScSPO1 1 in pCM190 was denoted
pTK89.
To show the effect of expression of mutant SPO1 1 on meiotic homologous
recombination frequency ySPO1 1:Y135F was cloned and expressed in S.
cerevisiae cells
undergoing meiosis. ySPO1 1:Y135F was cloned into pCM190 by first digesting
this vector
with BamHI and PstI. pTK83-3 was also digested with BamHI and PstI. DNA
fragments of
-50-
CA 02422362 2003-03-13
WO 02/22811 PCT/CA01/01306
interest corresponding to ySPO 1 1:Y135F (-1.2 kb) and pCM190 (-8'kb) were
purified by
agarose gel electrophoresis and recovered from the agarose as described above.
The
fragments were ligated together, transformed into E. coli and putative clones
of the gene in
the expression vector were identified. The resultant clone of ySPO 1 1:Y135F
in pCM190 was
denoted pTK94.
E. Biological Assay
To demonstrate the effect of different genes on meiotic homologous
recombination
frequency, plasmids containing the candidate genes were first created, as
described above,
__ and then introduced into S. cerevisiae BR2495 to create different strains.
These strains were
then grown, induced to undergo meiosis and the resultant progeny scored for
phenotypic
markers to determine meiotic homologous recombination frequency. Comparison of
the
homologous recombination frequency in the various strains to control strains
containing only
the corresponding parental vector containing no test gene enabled assessment
of the genetic
__ and biological effects of the test genes.
Expression vectors containing the test genes were introduced into S.
cerevisiae
BR2495 cells following the method of Geitz et al. [133]. Exemplified genes and
the
corresponding expression plasmids are outlined in TABLE 2. Cell lines carrying
these
plasmid constructs were selected for by culturing cells in minimal medium
lacking uracil (i.e.
__ SC-URA; [134]): BR2495 is homozygous for the defective ura3-1 allele [27]
and therefore
cannot synthesize this essential metabolite; expression plasmids based on
pCM188, pCM189
and pCM190 have a functional URA3 gene and therefore BR2495 cells possessing
such
plasmids will be able to synthesize uracil and be able to grow on medium
lacking uracil.
Cells were cultured in the presence of doxycycline (10 Kg/m1 for solid media;
5 pg/ml for
__ liquid media) to suppress expression of test genes until desired growth
stages.
To assay meiotic homologous recombination frequency, single colonies from each
test strain were used to first inoculate 3 ml of SC-URA+DOX (i.e. SC-URA
containing
doxycycline at 5 ig/m1) in a 15 ml tube (Falcon) which was then incubated at
30 C with =
shaking (200 RPM) for ¨1.5 d. Ten cultures were prepared for each test strain,
including
__ BR2495 possessing the parental expression vector without a test gene and
BR2495
possessing the various expression plasmids containing the test genes. Cells
from 1 ml of
culture were pelleted by centrifugation at 9000 RPM for 2 mm in a standard
microcentrifuge
(Brinkman) and resuspended in 1 ml of sterile-distilled water (SDW). The cells
were used to
-51 -
CA 02422362 2003-03-13
WO 02/22811 PCT/CA01/01306
inoculate 5 ml of SC-A pre-meiosis medium (per litre: 1.7 g yeast nitrogen
free base (Difco),
g ammonium acetate (Sigma), 20 g potassium acetate (Sigma), 2 g amino acid
drop out mix
[134]; and in some experiments doxycycline at 5 g/ml) in a 50 ml tube
(Falcon) at a 1:50
dilution. The cultures were then incubated at 30 C with shaking (225 RPM) for
2 d. Aliquots
5 of cells from each culture were then collected to assay for mitotic
homologous recombination
frequency occurring during vegetative growth. Dilutions of these cells were
plated on YPD
medium (per litre: 10 g Bacto-yeast extract, 20 g Bacto-peptone, 20 g glucose,
20 g Bacto-
agar; [134]) to determine viable cell number, and plated on minimal media
lacking particular
amino acids so as to examine homologous recombination at different test
genomic loci in
BR2495 (i.e. SC minus histidine (SC-his), leucine (SC-leu), threonine (SC-
thr), or tryptophan
(SC-trp) [134]). These plates were incubated at 30 C for 2-4 d and then
colonies were
counted. The remaining cells in each culture in pre-meiosis medium were
pelleted by
centrifugation at 4000 RPM for 10 min at 4 C. For cultures containing
doxycyline in the pre-
meiosis medium, the pellet was resuspended in 5 ml of SC-A pre-meiosis medium
and
incubated at room temperature for 3 h. These cells, and those cells incubated
in pre-meiosis
medium without doxycycline, were then pelleted by centrifugation at 4000 RPM
for 10 min
at 4 C and resuspended in 4 ml SPM meiosis-induction medium (0.3% (w/v)
potassium
acetate, 0.02% (w/v) raffinose, 5 i_tg/m1 histidine, 25 jig/m1 leucine, 5
jig/m1 tryptophan, 50
iAg/m1threonine, 5 1...tg/m1 adenine). The cells were again pelleted by
centrifugation at 4000
RPM for 10 mm at 4 C and resuspended in 3.5 ml SPM meiosis-induction medium.
Cultures
were then incubated at 30 C with shaking (225 RPM) for 2 d to enable cells to
undergo
meiosis. Dilutions of the cells were made using SDW and cells were then plated
on YPD to
determine viable cell number, and on minimal media lacking particular amino
acids so as to
examine meiotic homologous recombination at different test genomic loci in
BR2495, as
described above. Duplicate dilutions and plating of each culture were
performed. Plates
were incubated at 30 C for 2-4 d and then colonies were counted. Frequency of
recombinants
for each culture was determined by dividing the number of prototrophs
conferred by
restoration of function for a particular test locus hetero allele by the
viable cell number, taking
into consideration the dilution factors. Meiotic homologous recombination
frequency for
each culture was corrected when necessary for background recombinants
resulting during
vegetative growth by subtraction of the mitotic homologous recombination
frequency
determined prior to placing the cells in SPM meiosis-induction medium. Mean
values for the
10 replicates of each test strain were determined using the corrected values.
Inclusion of the
- 52 -
CA 02422362 2003-03-13
WO 02/22811 PCT/CA01/01306
values from all 10 replicates in determining the mean was evaluated by the Q-
test [135] and
values from individual replicates were excluded from the final mean if the
statistic indicated a
significant deviation from the values of other replicates. Comparison of means
of meiotic
homologous recombination frequency from test genes to that from control
strains was done to
determine the effect of the test gene. Statistical significance of the
differences between these
values was confirmed by evaluation using the t-test [136].
Results
As shown in TABLE 2, results from the exemplified embodiments demonstrate
modification of meiotic homologous recombination frequency and non-sister
chromatid
exchange (increases and decreases) through modifying the expression and
activity of
components of the DNA recombination process. The genetic evidence shows that
non-sister
chromatid exchange during meiosis is modified by the exemplified embodiments.
1. Reduced meiotic homologous recombination frequency
Meiotic homologous recombination may for example be reduced by a dominant-
negative effect conferred by heterologous expression of a protein or
expression of a mutant
form of a native protein. This reduction occurs at different genomic loci both
on the same
and different chromosomes. In the exemplified embodiments, heterologous
expression of
AtDMC1 in S. cerevisiae results in up to a 34% reduction in meiotic homologous
recombination. The suppression is found at three different genetic loci , his4
and leu2, located
on chromosome III, and trpl, located on chromosome IV. The level of
suppression of
meiotic homologous recombination may also be regulatable by controlling the
level of
expression of the inhibitory factor, as demonstrated by the estimated 3-fold
difference in
expression between pTK5 and pTK6 resulting in ¨20% difference in inhibiting
meiotic
homologous recombination frequency. ScDMC1 expressed in plants or animals may
also be
used to decrease meiotic homologous recombination or an animal protein may be
used to
decrease meiotic homologous recombination in plants, or an animal protein may
be used to
decrease meiotic homologous recombination in an evolutionarily distant animal
species.
These results also demonstrate the efficacy of a dominant-negative effect to
reduce meiotic
homologous recombination frequency. In alternative embodiments, this may also
be achieved
by expressing an altered form of a native protein. In the exemplified
embodiments,
expression of a mutant form of ScDMC1 results in up to a 24% reduction in
meiotic
homologous recombination frequency; expression of a mutant form of ScRAD51
results in up
to a 44% reduction in meiotic homologous recombination frequency; and
expression of a
- 53 -
CA 02422362 2003-03-13
WO 02/22811 PCT/CA01/01306
mutant form of ScSPO 1 1 results in up to a 48% reduction in meiotic
homologous
recombination frequency. The suppression is found at different genetic loci
and on different
chromosomes demonstrating the effect is general to the whole genome. The
results
demonstrate how affecting the activity level of proteins involved in meiotic
homologous
recombination can be used to reduce homologous recombination frequency. These
results
also demonstrate the efficacy of using a dominant-negative effect to reduce
meiotic
homologous recombination frequency. Mutant forms of proteins involved in
meiotic
recombination and non-sister chromatid exchange may also be used in plant and
animal
species to modulate meiotic homologous recombination frequency.
2. Increased meiotic homologous recombination frequency
In the exemplified embodiments, meiotic homologous recombination frequency
occurs at different genomic loci both on the same and different chromosomes.
Increased
expression of either ScDMC1 or ScRAD51 or ScSPO 1 1 is shown to increase
meiotic
homologous recombination frequency by up to ¨5-fold, ¨3-fold, or ¨2-fold,
respectively.
The increase is shown at three different genetic loci, his4 and leu2 , located
on chromosome
III, and trpl , located on chromosome IV demonstrating the effect is general
to the whole
genome. Increased expression or activity level of proteins involved in meiotic
recombination and non-sister chromatid exchange may also be used in plant and
animal
species to modulate meiotic homologous recombination frequency.
In alternative exemplified embodiments, expression of prokaryotic proteins is
shown
to increase or decrease homologous meiotic recombination. Heterologous
expression of a
ssDNA-binding protein, SSB, is shown to decrease or increase homologous
recombination
frequency depending upon the genomic locus. A dominant-negative effect results
at some
loci to suppress homologous recombination, as shown at the leu2 locus where a
reduction of
homologous recombination frequency by ¨40% was shown. In contrast, a
stimulation of
homologous recombination occurs at some loci, as shown by the his4 locus where
homologous recombination frequency was enhanced by 13%. In both cases, the
action of
SSB in eukaryotes was promoted ¨10% by addition of a nuclear localization
sequence to the
protein (i.e. NLS-SSB). In alternative embodiments, modifying the function or
expression of
endogenous native ssDNA-binding proteins may also be used to modify meiotic
homologous
recombination frequency.
- 54 -
CA 02422362 2003-03-13
WO 02/22811 PCT/CA01/01306
TABLE 1: Oligonucleotides for amplifying and modifying target genes
Oligo name Target Sequence (5 '-3')
Gene
OL11434 AtDMC1 CATATGATGGCTTCTCTTAAGGCTG
OL11433 AtDMC1 GACATATAAAAGAGTTCGCTCC
OL11435 AtDMC1 AAACTCGAGCTAATCCTTCGCGTCAGCAATG
AtSPO-5' Sma AtSP011 GGGTATGGAGGGAAAATTCGCTAG
AtSPO-3 'X AtSPO 1 1 CCTTGAGTTGGAGACTAGTTATC
AtSPO-3'PstNot AtSPO 1 1 ATCCTGCAGGCGGCCGCTCATCAAGGAGAGCTTACTTCAC
AtRAD51-5'Bam AtRAD51 GGGGGATCCAAAAAAATGACGACGATGGAGCAGCG
AtRAD51-3'X AtRAD51 GAAGCAAGGCATTGTTGTGG
AtRAD51-3'Pst AtRAD51 AACTGCAGTTATCAATCCTTGCAATCTGTTACAC
0L12414 AtMREll CGGAATTCATGATTGTAAAACTTGACAGGG
0L12413 AtMREll GGTCGCTGACTACTTGAAAC
0112415 AtMREll TCATTCAGACAGTGGCGACG
0L12779 AtMRE 1 1 GGCCTGAAGTTCAAGAAG
0L12780 AtMREll GCTCGACTTCTTCGCTTG
MRE-F1 AtMREll GCGCTGCAGCATATGCCCGGGGAATTCATGTCTAGGGAGG
ATTTTAGTGATACACTT
MRE-F2 AtMREll GCGCTGCAGCATATGCCCGGGGAATTCATGTCTAGGGAGG
ATTTTAGTGATACACTTCGAGTACTTGTTGCAACTGCTTG
CCACTTGGGCTAC
MRE-R1 AtMREll CGCGTCGACCCCGGGTTAAGGCGCGCCTCTTCTTAGAGCT
CCATAG
MRE-AVA AtMREll GATAGGTCCACTCGACCCACTGG
YDMC-5 'Barn ScDMC1 GGGGGATCCAAAAAAATGTCTGTTACAGGAACTGAG
YDMC-3 'Pst ScDMC1 AACTGCAGCTACTAGTCACTTGAATCGGTAATACC
YDMC-G126D- ScDMC1 GGTGAATTTAGGTGTGATAAGACACAGATGTCTC
sense
YDMC-G126D- ScDMC1 GAGACATCTGTGTCTTATCACACCTAAATTCACC
antisense
YDMC-N263Y- ScDMC1 GCAGTATTTCTGACATACCAAGTTCAATCAGAC
sense
YDMC-N263Y- ScDMC1 GTCTGATTGAACTTGGTATGTCAGAAATACTGC
antisense
YDMC-A288T- ScDMC1 GAGGGCACGTTCTGACACATGCGTCAGC
sense
YDMC-A288T- ScDMC1 GCTGACGCATGTGTCAGAACGTGCCCTC
antisense
YR51-5'Bam ScRAD51 GGGGGATCCAAAAAAATGTCTCAAGTTCAAGAACAAC
YR51-3'Pst ScRAD51 AACTGCAGTTACTACTCGTCTTCTTCTCTGGGG
YRAD51-G190D- ScRAD51 CGGTGAATTCAGGACAGATAAGTCCCAGCTATGTC
sense
-55-
CA 02422362 2003-03-13
WO 02/22811 PCT/CA01/01306
Table 1 continued
Oligo name Target Sequence (5'-3')
Gene
YR52-5'Pme ScRAD52 AAAGAATTCGTTTAAACATGGCGTTTTTAAGCTATTTTG
YR52-3'Not ScRAD52 ATCGCGGCCGCTCATCAAGTAGGCTTGCGTGCA
YR54-5'RI 5cRAD54 GGGGAATTCAAAAAAATGGCAAGACGCAGATTAC
YR54-3'Pst ScRAD54 AAACTGCAGTCATCAATGTGAAATATATTGAAATGC
YSPO-5'Bam ScSPO1 1 ATCGGATCCAAAAAAATGGCTTTGGAGGGATTG
Yspo-3'Pst ScSPO1 1 GGGCTGCAGTCATCATTTGTATTCAAAAATTCTGG
YSPO-Y135F-sense ScSPO1 1 GTGAGAGATATCTTCTTCTCCAACGTGGAATTG
YSPO-Y135F- ScSP011 CAATTCCACGTTGGAGAAGAAGATATCTCTCAC
antisense
- 56 -
0
Table 2
=
t..)
Expression Plasmid His4
Lela Tip]
Gene Experiment Plasmid Vector Promoterb Copy Prototroph
Ratio Mean Prototroph Ratio Mean Prototroph Ratio Mean Ratio
r..)
oe
Construct Number' Frequencyd of HiRe
Ratio of Frequency of HR Ratio of Frequency of HR
of HR 1--,
1--,
, HR ,
HR
1 contror pCM188 Weak Low 6.26x1(Y'
0.68
pTK45 pCM188 Weak Low 4.23x10'
0.70 0.02
control pCM188 Weak Low 5.57x10"
5.33x10-5
2 0.72
0.84 0.84
pTK45 pCM188 Weak Low 4.01x10-3
4.49x10-5
control pCM189 Strong Low 5.86x10'
1.44x104
1 0.62
0.76
pTK5 pCM189 Strong Low 3.61x10'
1.09x10-4
AtDMC I 0.73 0.11
0.84 0.08
control pCM189 Strong Low 3.95x I 0'
1.20x10-4
2, 0.83
0.91 n
pTK5 pCM189 Strong Low 3.29x10-
1.09x104
_
0
control pCM190 Strong High 1.3 Ox I 0-2
3.60x104 1.)
1 0.82 ,
0.61 .i.
pTK6 pCM190 Strong High 1.06x10-2 2.20x10
0.73 0.13
0.66 0.05
control pCM190 Strong High 1.47x10-2
2.30x104 u.)"
c7,
2 0.63 ,
0.70 1.)
' pTK6 pCM190 Strong High 9.28x10'
1.60x10 '
LA
1.)
.---1
0
0
.
u.)
control pCM190 Strong High 1.81x10-3
5.25x10-5 3.64x105 ,
1 2.59 2.59
2.26 1.42 0
pTK58 pCM190 Strong High 4.70x10-3
1.19x104 5.15x10-5 co
ScDMC1
5.24+2.98 1.71+0.30 I
control pCM190 Strong High
2.69x10-5 4.14x10-5
2 _a
8.22 2.02 col-
pTK58 pCM190 Strong High
2.21x10 ' 8.36x10-5
control pCM190 Strong High 1.81X10'
2.69X10-5 3.39x10-5
ScRAD51 1 1.87 1.87
2.07 2.07 1.83 1.83
pTK53 pCM190 Strong High 3.39X10'
5.58X10-5 6.22x10-5
,
control pCM190 Strong High 6.96x10'
1.58x10-4
SSB 1 1.131.13
0.61 0.61
pTK3 5 pCM190 Strong High 7.89x10' -
9.58x10,-- IV
n
1-3
control pCM190 Strong High 6.96x10-3
1.58x104 n
NLS-SSB 1 1.29 1.29
0.54 0.54
pTK36 pCM190 Strong High 9.00x10-3
8.61x10-5 C;
.--...
o
1--,
o
cA
0
o
t..)
t..)
00
Table 2 (continued)
Expression Plasmid His4
Leu2 Trpl
Gene Experiment Plasmid Vector Promoterb Copy
Prototroph Ratio Mean Prototroph Ratio Mean
Prototroph Ratio Mean Ratio
Construct Number c Frequencyd of HR e
Ratio of Frequency of HR Ratio of Frequency of HR of HR
HR
BR
yDMC1: control pCM190 Strong High 8.81x10-3 1.69x104
0
10.76 0.76 0.91 0.91
G126D pTK85 pCM190 Strong High 6.72x10-3 1.53x10-4
0
1.)
,
.i.
1.)
oo control pCM190 Strong High 8.81x10-3 1.69x10-
4 7.64x10-5 1.)
, 1., 0.5610.17 0.39
0.39 0.38 u.)
yRAD51: pTK95 pCM190 Strong High 3.43x10- 6.58x10-5
2.88x10-5 m
1.)
0.5910.20
_______________________________________________________________________________
________________________ 0.6610.28
G190D control pCM190 Strong High 5.21x10-3 1.23x104
5.12x10-5 1.)
20.73 0.78 0.94 0
pTK95 pCM190 Strong High 3.82x10-3 9.58x10-
5 4.83x10-5 0
u.)
1
0
u.)
control pCM190 Strong High 4.37x10-3 6.14x10-
5 4.90x10-5 I
ScSP011 11.80 1.80
1.87 1.87 1.64 1.64 H
pTK89 pCM190 Strong High 7.87x10-3 1.15x10-
4 8.04x1 0 - 5 CA
ySP011: control pCM190 Strong High 6.93x10-3 1.23x10-4
5.72x10-5
Y135F pTK94 pCM190 Strong High 4.53x10-3 0.65 0.65
6.41x10-5 0.52 0.52
4.49x10-5
0.79 0.79
aControl plasmid contained no gene for expression.
bPromoter strength was indicated as "weak" for plasmids containing 2 copies of
tet0 and "strong' for plasmids containing 7 copies of tet0.
'Plasmid copy number was "low" with 1-2 copies per cell and "high" for
plasmids with upto 40 copies per cell.
dPrototroph frequency determined as the number of prototrophs per viable cell
number. Value represents the mean from 10 independent cultures. 00
'Meiotic homologous recombination frequency determined by dividing the
prototroph frequency of the strain with the test gene with that of the
control. n
,-i
n
=
=
cA
CA 02422362 2009-10-07
REFERENCES
The following documents, to which reference may be made elsewhere herein by
number.
1. Hall,RM, Collis,CM: Mobile gene cassettes and integrons: capture and spread
of
genes by site-specific recombination. Mol.Microbiol. 15: 593-600 (1995).
2. Critchlow,SE, Jackson,SP: DNA end-joining: from yeast to man. Trends
Biochem.Sci. 23: 394-398 (1998).
3. Lindahl,T, Wood,RD: Quality control by DNA repair. Science 286: 1897-1905
(1999).
4. Roeder,GS: Meiotic chromosomes: it takes two to tango. Genes Dev. 11: 2600-
2621
(1997).
5. Paques,F, Haber,JE: Multiple pathways of recombination induced by double-
strand
breaks in Saccharomyces cerevisiae. Microbiol.Mol.Biol.Rev. 63: 349-404
(1999).
6. Kowalczykowski,SC, Dixon,DA, Eggleston,AK, Lauder,SD, Rehrauer,WM:
Biochemistry of homologous recombination in Escherichia coli. Microbiol.Rev.
58:
401-465 (1994).
7. Haber,JE: DNA recombination: the replication connection. Trends
Biochem.Sci. 24:
271-275(1999).
_
8. Strickberger,MW: Genetics. Macmillan Publishing Company, New York (1985).
9. Keeney,S, Giroux,CN, Kleckner,N: Meiosis-specific DNA double-strand breaks
are
catalysed by Spoil, a member of a widely conserved protein family. Cell 88:
375-384
(1997).
10. Cha,RS, Weiner,BM, Keeney,S, Dekker,J, Kleckner,N: Progression of
meiotic DNA
replication is modulated by interchromosomal interaction proteins, negatively
by
Spollp and positively by Rec8p. Genes Dev. 14: 493-503 (2000).
- 59 -
CA 02422362 2003-03-13
WO 02/22811 PCT/CA01/01306
11. Hartung,F, Puchta,H: Molecular characterisation of two paralogous SPO1
1
homologues in Arabidopsis thaliana. Nucleic Acids Res. 28: 1548-1554 (2000).
12. Johzuka,K, Ogawa,H: Interaction of Mrell and Rad50: two proteins
required for
DNA repair and meiosis-specific double-strand break formation in Saccharomyces
cerevisiae. Genetics 139: 1521-1532 (1995).
13. Rozwadowski,K, Kreiser,T, Hasnadka,R, Lydiate,D. AtMRE11: a component of
meiotic recombination and DNA repair in plants. 10th International Conference
on
Arabidopsis Research, Melbourne, Australia, July 4-8, 1999. 1999.
Ref Type: Abstract
14. Hartung,F, Puchta,H: Isolation of the complete cDNA of the Mrel1 homologue
of
Arabidopsis indicates conservation of DNA recombination mechanisms between
plants and other eukaryotes. Plant Physiol. 121: 312 (1999).
15. Petrini,JH, Walsh,ME, DiMare,C, Chen,XN, Korenberg,JR, Weaver,DT:
Isolation
and characterization of the human MREll homologue. Genomics 29: 80-86 (1995).
16. Alani,E, Subbiah,S, Kleckner,N: The yeast RAD50 gene encodes a predicted
153-kD
protein containing a purine nucleotide-binding domain and two large heptad-
repeat
regions. Genetics 122: 47-57 (1989).
17. Dolganov,GM, Maser,RS, Novikov,A, Tosto,L, Chong,S, Bressan,DA,
Petrini,JH:
Human Rad50 is physically associated with human Mrell: identification of a
conserved multiprotein complex implicated in recombinational DNA repair.
Mol.Cell
Biol. 16: 4832-4841 (1996).
18. Ivanov,EL, Sugawara,N, White,CI, Fabre,F, Haber,JE: Mutations in XRS2 and
RAD50 delay but do not prevent mating-type switching in Saccharomyces
cerevisiae.
Mol.Cell Biol. 14: 3414-3425 (1994).
19. Carney,JP, Maser,RS, Olivares,H, Davis,EM, Le Beau,M, Yates,JR, III,
Hays,L,
Morgan,WF, Petrini,JH: The hMrell/hRad50 protein complex and Nijmegen
breakage syndrome: linkage of double-strand break repair to the cellular DNA
damage response. Cell 93: 477-486 (1998).
- 60 -
CA 02422362 2003-03-13
WO 02/22811 PCT/CA01/01306
20. Bishop,DK, Park,D, Xu,L, Kleckner,N: DMC1: a meiosis-specific yeast
homolog of
E. coli recA required for recombination, synaptonemal complex formation, and
cell
cycle progression. Cell 69: 439-456 (1992).
21. Kobayashi,T, Kobayashi,E, Sato,S, Hotta,Y, Miyajima,N, Tanaka,A, Tabata,S:
Characterization of cDNAs induced in meiotic prophase in lily microsporocytes.
DNA Res. 1: 15-26 (1994).
22. Habu,T, Taki,T, West,A, Nishimune,Y, Morita,T: The mouse and human
homologs of
DMC1, the yeast meiosis-specific homologous recombination gene, have a common
unique form of exon-skipped transcript in meiosis. Nucleic Acids Res. 24: 470-
477
(1996).
23. Shinohara,A, Ogawa,H, Ogawa,T: Rad51 protein involved in repair and
recombination in S. cerevisiae is a RecA-like protein. Cell 69: 457-470
(1992).
24. Doutriaux,MP, Couteau,F, Bergounioux,C, White,C: Isolation and
characterisation of
the RAD51 and DMC1 homologs from Arabidopsis thaliana. Mol.Gen.Genet. 257:
283-291 (1998).
25. Shinohara,A, Ogawa,H, Matsuda,Y, Ushio,N, Ikeo,K, Ogawa,T: Cloning of
human,
mouse and fission yeast recombination genes homologous to RAD51 and recA.
Nat.Genet. 4: 239-243 (1993).
26. Wold,MS: Replication protein A: a heterotrimeric, single-stranded DNA-
binding
protein required for eukaryotic DNA metabolism. Annu.Rev.Biochem. 66: 61-92
(1997).
27. Ross-Macdonald,P, Roeder,GS: Mutation of a meiosis-specific MutS homolog
decreases crossing over but not mismatch correction. Cell 79: 1069-1080
(1994).
28. Paquis-Flucklinger,V, Santucci-Darmanin,S, Paul,R, Saunieres,A, Turc-
Carel,C,
Desnuelle,C: Cloning and expression analysis of a meiosis-specific MutS
homolog:
the human MSH4 gene. Genomics 44: 188-194 (1997).
- 61 -
CA 02422362 2003-03-13
WO 02/22811 PCT/CA01/01306
29. Hollingsworth,NM, Ponte,L, Halsey,C: MSH5, a novel MutS homolog,
facilitates
meiotic reciprocal recombination between homologs in Saccharomyces cerevisiae
but
not mismatch repair. Genes Dev. 9: 1728-1739 (1995).
30. Winand,NJ, Panzer,JA, Kolodner,RD: Cloning and characterization of the
human and
Caenorhabditis elegans homologs of the Saccharomyces cerevisiae MSH5 gene.
Genomics 53: 69-80 (1998).
31. Hunter,N, Borts,RH: Mlhl is unique among mismatch repair proteins in its
ability to
promote crossing-over during meiosis. Genes Dev. 11: 1573-1582 (1997).
32. Kolodner,RD, Hall,NR, Lipford,J, Kane,MF, Morrison,PT, Finan,PJ, Burn,J,
Chapman,P, Earabino,C, Merchant,E: Structure of the human MLH1 locus and
analysis of a large hereditary nonpolyposis colorectal carcinoma kindred for
mlhl
mutations. Cancer Res. 55: 242-248 (1995).
33. Jean,M, Pelletier,J, Hilpert,M, Belzile,F, Kunze,R: Isolation and
characterization of
AtMLH1, a MutL homologue from Arabidopsis thaliana. Mol.Gen.Genet. 262: 633-
642 (1999).
34. Milne,GT, Weaver,DT: Dominant negative alleles of RAD52 reveal a DNA
repair/recombination complex including Rad51 and Rad52. Genes Dev. 7: 1755-
1765
(1993).
35. Muris,DF, Bezzubova,O, Buerstedde,JM, Vreeken,K, Balajee,AS, Osgood,CJ,
Troelstra,C, Hoeijmakers,JH, Ostermann,K, Schmidt,H: Cloning of human and
mouse
genes homologous to RAD52, a yeast gene involved in DNA repair and
recombination. Mutat.Res. 315: 295-305 (1994).
36. Emery,HS, Schild,D, Kellogg,DE, Mortimer,RK: Sequence of RAD54, a
Saccharomyces cerevisiae gene involved in recombination and repair. Gene 104:
103-
106 (1991).
37. Kanaar,R, Troelstra,C, Swagemakers,SM, Essers,J, Smit,B, Franssen,JH,
Pastink,A,
Bezzubova,0Y, Buerstedde,JM, Clever,B, Heyer,WD, Hoeijmakers,JH: Human and
- 62 -
CA 02422362 2003-03-13
WO 02/22811 PCT/CA01/01306
mouse homologs of the Saccharomyces cerevisiae RAD54 DNA repair gene:
evidence for functional conservation. Curr.Biol. 6: 828-838 (1996).
38. Lovett,ST: Sequence of the RAD55 gene of Saccharomyces cerevisiae:
similarity of
RAD55 to prokaryotic RecA and other RecA-like proteins. Gene 142: 103-106
(1994).
39. Dosanjh,MK, Collins,DW, Fan,W, Lennon,GG, Albala,JS, Shen,Z, Schild,D:
Isolation and characterization of RAD51C, a new human member of the RAD51
family of related genes. Nucleic Acids Res. 26: 1179-1184 (1998).
40. Kans,JA, Mortimer,RK: Nucleotide sequence of the RAD57 gene of
Saccharomyces
cerevisiae. Gene 105: 139-140 (1991).
41. Bai,Y, Symington,LS: A Rad52 homolog is required for RAD51-independent
mitotic
recombination in Saccharomyces cerevisiae. Genes Dev. 10: 2025-2037 (1996).
42. Benson,FE, Baumann,P, West,SC: Synergistic actions of Rad51 and Rad52 in
recombination and DNA repair . Nature 391: 401-404 (1998).
43. Kleff,S, Kemper,B, Sternglanz,R: Identification and characterization of
yeast mutants
and the gene for a cruciform cutting endonuclease. EMBO J. 11: 699-704 (1992).
44. Kupfer,C, Kemper,B: Reactions of mitochondrial cruciform cutting
endonuclease 1
(CCE1) of yeast Saccharomyces cerevisiae with branched DNAs in vitro.
Eur.J.Biochem. 238: 77-87 (1996).
45. Trelles-Sticken,E, Loidl,J, Scherthan,H: Bouquet formation in budding
yeast:
initiation of recombination is not required for meiotic telomere clustering.
J.Cell Sci.
112 ( Pt 5): 651-658 (1999).
46. Scherthan,H, Weich,S, Schwegler,H, Heyting,C, Harle,M, Cremer,T:
Centromere and
telomere movements during early meiotic prophase of mouse and man are
associated
with the onset of chromosome pairing. J.Cell Biol. 134: 1109-1125 (1996).
- 63 -
CA 02422362 2003-03-13
WO 02/22811 PCT/CA01/01306
47. Bass,HW, Marshall,WF, Sedat,JW, Agard,DA, Cande,WZ: Telomeres cluster de
novo
before the initiation of synapsis: a three-dimensional spatial analysis of
telomere
positions before and during meiotic prophase. J.Cell Biol. 137: 5-18 (1997).
48. Bishop,DK: RecA homologs Dmcl and Rad51 interact to form multiple nuclear
complexes prior to meiotic chromosome synapsis. Cell 79: 1081-1092 (1994).
49. Arbel,A, Zenvirth,D, Simchen,G: Sister chromatid-based DNA repair is
mediated by
RAD54, not by DMC1 or TID1. EMBO J. 18: 2648-2658 (1999).
50. Roeder,GS: Chromosome synapsis and genetic recombination: their roles in
meiotic
chromosome segregation. Trends Genet. 6: 385-389 (1990).
51. Li,Z, Golub,EI, Gupta,R, Radding,CM: Recombination activities of HsDmel
protein,
the meiotic human homolog of RecA protein. Proc.Natl.Acad.Sci.U.S.A 94: 11221-
11226 (1997).
52. Sung,P, Robberson,DL: DNA strand exchange mediated by a RAD51-ssDNA
nucleoprotein filament with polarity opposite to that of RecA. Cell 82: 453-
461
(1995).
53. Dresser,ME, Ewing,DJ, Conrad,MN, Dominguez,AM, Barstead,R, Jiang,H,
Kodadek,T: DMC1 functions in a Saccharomyces cerevisiae meiotic pathway that
is
largely independent of the RAD51 pathway. Genetics 147: 533-544 (1997).
54. Couteau,F, Belzile,F, Horlow,C, Grandjean,O, Vezon,D, Doutriaux,MP: Random
chromosome segregation without meiotic arrest in both male and female
meiocytes of
a drncl mutant of Arabidopsis. Plant Cell 11: 1623-1634 (1999).
55. Pittman,DL, Cobb,J, Schimenti,KJ, Wilson,LA, Cooper,DM, Brignull,E,
Handel,MA,
Schimenti,JC: Meiotic prophase arrest with failure of chromosome synapsis in
mice
deficient for Dmcl, a germline-specific RecA homolog. Mol.Cell 1: 697-705
(1998).
56. Johnson,RD, Symington,LS: Functional differences and interactions among
the
putative RecA homologs Rad51, Rad55, and Rad57. Mol.Cell Biol. 15: 4843-4850
(1995).
- 64 -
CA 02422362 2003-03-13
WO 02/22811 PCT/CA01/01306
57. Basile,G, Aker,M, Mortimer,RK: Nucleotide sequence and transcriptional
regulation
of the yeast recombinational repair gene RAD51. Mol.Cell Biol. 12: 3235-3246
(1992).
58. Ogawa,T, Yu,X, Shinohara,A, Egelman,EH: Similarity of the yeast RAD51
filament
to the bacterial RecA filament. Science 259: 1896-1899 (1993).
59. Sugawara,N, Ivanov,EL, Fishman-Lobell,J, Ray,BL, Wu,X, Haber,JE: DNA
structure-dependent requirements for yeast RAD genes in gene conversion.
Nature
373: 84-86 (1995).
60. Rockmill,B, Sym,M, Scherthan,H, Roeder,GS: Roles for two RecA homologs in
promoting meiotic chromosome synapsis. Genes Dev. 9: 2684-2695 (1995).
61. Clever,B, Interthal,H, Schmuckli-Maurer,J, King,J, Sigrist,M, Heyer,WD:
Recombinational repair in yeast: functional interactions between Rad51 and
Rad54
proteins. EMBO J. 16: 2535-2544 (1997).
62. Jiang,H, Xie,Y, Houston,P, Stemke-Hale,K, Mortensen,UH, Rothstein,R,
Kodadek,T:
Direct association between the yeast Rad51 and Rad54 recombination proteins.
J.Biol.Chem. 271: 33181-33186 (1996).
63. Shcherbakova,OG, Lanzov,VA, Ogawa,H, Filatov,MV: Overexpression of
bacterial
RecA protein stimulates homologous recombination in somatic mammalian cells.
Mutat.Res. 459: 65-71 (2000).
64. Milne,gene targeting, Weaver,DT: Dominant negative alleles of RAD52 reveal
a
DNA repair/recombination complex including Rad51 and Rad52. Genes Dev. 7:
=
1755-1765 (1993).
65. Muris,DF, Bezzubova,O, Buerstedde,JM, Vreeken,K, Balajee,AS, Osgood,CJ,
Troelstra,C, Hoeijmakers,JH, Ostermann,K, Schmidt,H: Cloning of human and
mouse
genes homologous to RAD52, a yeast gene involved in DNA repair and
recombination. Mutat.Res. 315: 295-305 (1994).
66. Petukhova,G, Stratton,S, Sung,P: Catalysis of homologous DNA pairing by
yeast
Rad51 and Rad54 proteins. Nature 393: 91-94 (1998).
- 65 -
CA 02422362 2003-03-13
WO 02/22811 PCT/CA01/01306
67. Sugiyama,T, Zaitseva,EM, Kowalczykowski,SC: A single-stranded DNA-binding
protein is needed for efficient presynaptic complex formation by the
Saccharomyces
cerevisiae Rad51 protein. J.Biol.Chem. 272: 7940-7945 (1997).
68. Golub,EI, Gupta,RC, Haaf,T, Wold,MS, Radding,CM: Interaction of human
rad51
recombination protein with single-stranded DNA binding protein, RPA. Nucleic
Acids Res. 26: 5388-5393 (1998).
69. Gasior,SL, Wong,AK, Kora,Y, Shinohara,A, Bishop,DK: Rad52 associates with
RPA
and functions with rad55 and rad57 to assemble meiotic recombination
complexes.
Genes Dev. 12: 2208-2221 (1998).
70. Baumann,P, West,SC: Heteroduplex formation by human Rad51 protein: effects
of
DNA end-structure, hRP-A and hRad52. J.Mol.Biol. 291: 363-374 (1999).
71. Mazin,AV, Zaitseva,E, Sung,P, Kowalczykowski,SC: Tailed duplex DNA is the
preferred substrate for Rad51 protein-mediated homologous pairing. EMBO J. 19:
1148-1156 (2000).
72. Kleckner,N: Meiosis: how could it work? Proc.Natl.Acad.Sci.U.S.A 93: 8167-
8174
(1996).
73. Shalev,G, Sitrit,Y, Avivi-Ragolski,N, Lichtenstein,C, Levy,AA: Stimulation
of
homologous recombination in plants by expression of the bacterial resolvase
ruvC.
Proc.Natl.Acad.Sci.U.S.A 96: 7398-7402 (1999).
74. Philipova,D, Mullen,JR, Maniar,HS, Lu,J, Gu,C, Brill,SJ: A hierarchy of
SSB
protomers in replication protein A. Genes Dev. 10: 2222-2233 (1996).
75. Alani,E, Thresher,R, Griffith,JD, Kolodner,RD: Characterization of DNA-
binding and
strand-exchange stimulation properties of y-RPA, a yeast single-strand-DNA-
binding
protein. J.Mol.Biol. 227: 54-71 (1992).
76. Meyer,RR, Laine,PS: The single-stranded DNA-binding protein of Escherichia
coli.
Microbiol.Rev. 54: 342-380 (1990).
- 66 -
CA 02422362 2003-03-13
WO 02/22811 PCT/CA01/01306
77. Citovsky,V, Wong,ML, Zambryski,P: Cooperative interaction of Agrobacterium
VirE2 protein with single-stranded DNA: implications for the T-DNA transfer
process. Proc.Natl.Acad.Sci.U.S.A 86: 1193-1197 (1989).
78. Gutierrez,C, Martin.,G, Sogo,JM, Salas,M: Mechanism of stimulation of
DNA
replication by bacteriophage phi 29 single-stranded DNA-binding protein p5.
J.Biol.Chem. 266: 2104-2111(1991).
79. Williams,KR, LoPresti,MB, Setoguchi,M: Primary structure of the
bacteriophage T4
DNA helix-destabilizing protein. J.Biol.Chem. 256: 1754-1762 (1981).
80. Monaghan,A, Webster,A, Hay,RT: Adenovirus DNA binding protein: helix
destabilising properties. Nucleic Acids Res. 22: 742-748 (1994).
81. Citovsky,V, Knorr,D, Schuster,G, Zambryski,P: The P30 movement protein of
tobacco mosaic virus is a single-strand nucleic acid binding protein. Cell 60:
637-647
(1990).
82. Reiss,B, Schubert,I, Kopchen,K, Wendeler,E, Schell,J, Puchta,H: RecA
stimulates
sister chromatid exchange and the fidelity of double-strand break repair, but
not gene
targeting, in plants transformed by Agrobacterium. Proc.Natl.Acad.Sci.U.S.A
97:
3358-3363 (2000).
83. Shao,RG, Cao,CX, Zhang,H, Kohn,KW, Wold,MS, Pornmier,Y: Replication-
mediated DNA damage by camptothecin induces phosphorylation of RPA by DNA-
dependent protein kinase and dissociates RPA:DNA-PK complexes. EMBO J. 18:
1397-1406 (1999).
84. Biswas,EE, Zhu,FX, Biswas,SB: Stimulation of RTH1 nuclease of the yeast
Saccharomyces cerevisiae by replication protein A. Biochemistry 36: 5955-5962
(1997).
85. Yanez,RJ, Porter,AC: Gene targeting is enhanced in human cells
overexpressing
hRAD51. Gene Ther. 6: 1282-1290 (1999).
- 67 -
CA 02422362 2003-03-13
WO 02/22811 PCT/CA01/01306
86. Rubin,BP, Ferguson,DO, Holloman,WK: Structure of REC2, a
recombinational repair
gene of Ustilago maydis, and its function in homologous recombination between
plasmid and chromosomal sequences. Mol.Cell Biol. 14: 6287-6296 (1994).
87. Asleson,EN, Okagaki,RJ, Livingston,DM: A core activity associated with the
N
terminus of the yeast RAD52 protein is revealed by RAD51 overexpression
suppression of C-terminal rad52 truncation alleles. Genetics 153: 681-692
(1999).
88. Reiss,B, Klemm,M, Kosak,H, Schell,J: RecA protein stimulates homologous
recombination in plants. Proc.Natl.Acad.Sci.U.S.A 93: 3094-3098 (1996).
89. Schild,D: Suppression of a new allele of the yeast RAD52 gene by
overexpression of
RAD51, mutations in srs2 and ccr4, or mating-type heterozygosity. Genetics
140:
115-127 (1995).
90. Amaudeau,C, Helleday,T, Jenssen,D: The RAD51 protein supports homologous
recombination by an exchange mechanism in mammalian cells. J.Mol.Biol. 289:
1231-1238 (1999).
91. Vispe,S, Cazaux,C, Lesca,C, Defais,M: Overexpression of Rad51 protein
stimulates
homologous recombination and increases resistance of mammalian cells to
ionizing
radiation. Nucleic Acids Res. 26: 2859-2864 (1998).
92. Havre,PA, Rice,MC, Noe,M, Kmiec,EB: The human REC2/RAD51B gene acts as a
DNA damage sensor by inducing G1 delay and hypersensitivity to ultraviolet
irradiation. Cancer Res. 58: 4733-4739 (1998).
93. Ajimura,M, Leem,SH, Ogawa,H: Identification of new genes required for
meiotic
recombination in Saccharomyces cerevisiae. Genetics 133: 51-66 (1993).
94. Takanami,T, Sato,S, Ishihara,T, Katsura,I, Takahashi,H, Higashitani,A:
Characterization of a Caenorhabditis elegans recA-like gene Ce-rdh-1 involved
in
meiotic recombination. DNA.Res. 5: 373-377 (1998).
95. Tsuzuki,T, Fujii,Y, Sakumi,K, Tominaga,Y, Nakao,K, Sekiguchi,M,
Matsushiro,A,
Yoshimura,Y, MoritaT: Targeted disruption of the Rad51 gene leads to lethality
in
embryonic mice. Proc.Natl.Acad.Sci.U.S.A 93: 6236-6240 (1996).
-68-
CA 02422362 2003-03-13
WO 02/22811 PCT/CA01/01306
96. Chanet,R, Heude,M, Adjiri,A, Maloisel,L, Fabre,F: Semidominant mutations
in the
yeast Rad51 protein and their relationships with the Srs2 helicase. Mol.Cell
Biol. 16:
4782-4789 (1996).
97. Sonoda,E, Sasaki,MS, Buerstedde,JM, BezzubOva,O, Shinohara,A, Ogawa,H,
Takata,M, Yamaguchi-Iwai,Y, Takeda,S: Rad51-deficient vertebrate cells
accumulate
chromosomal breaks prior to cell death. EMBO J. 17: 598-608 (1998).
98. Primrose,SB: Principles of Genome Analysis. Blackwell Science Ltd., Oxford
(1995).
99. Kumar,LS: DNA markers in plant improvement: An overview. Biotechnol.Adv.
17:
143-182 (1999).
100. Paterson,AH, Tanksley,SD, Sorrells,ME: DNA markers in plant improvement.
Advances in Agronomy 46: 39-90 (1997).
101. Rothstein,R: Targeting, disruption, replacement, and allele rescue:
integrative DNA
transformation in yeast. Methods Enzymol. 194: 281-301 (1991).
102. Offringa,R, De Groot,MJ, Haagsman,HJ, Does,MP, van den Elzen,PJ,
Hooykaas,PJ:
Extrachromosomal homologous recombination and gene targeting in plant cells
after
Agrobacterium mediated transformation. EMBO J. 9: 3077-3084 (1990).
103. Miao,ZH, Lam,E: Targeted disruption of the TGA3 locus in Arabidopsis
thaliana.
Plant J. 7: 359-365 (1995).
104. Zhu,T, Mettenburg,K, Peterson,DJ, Tagliani,L, Baszczynski,CL: Engineering
herbicide-resistant maize using chimeric RNA/DNA oligonucleotides.
Nat.Biotechnol. 18: 555-558 (2000).
105. Broverman,S, MacMorris,M, Blumenthal,T: Alteration of Caenorhabditis
elegans
gene expression by targeted transformation. Proc.Natl.Acad.Sci.U.S.A 90: 4359-
4363
(1993).
106. Rong,YS, Golic,KG: Gene targeting by homologous recombination in
drosophila.
Science 288: 2013-2018 (2000).
- 69 -
CA 02422362 2003-03-13
WO 02/22811 PCT/CA01/01306
107. Thompson,S, Clarke,AR, Pow,AM, Hooper,ML, Melton,DW: Germ line
transmission
and expression of a corrected HPRT gene produced by gene targeting in
embryonic
stem cells. Cell 56: 313-321 (1989).
108. Passy,SI, Yu,X, Li,Z, Radding,CM, Masson,JY, West,SC, Egelman,EH: Human
Dmcl protein binds DNA as an octameric ring. Proc.Natl.Acad.Sci.U.S.A 96:
10684-
10688 (1999).
109. Baumann,P, Benson,FE, Hajibagheri,N, West,SC: Purification of human Rad51
protein by selective spermidine precipitation. Mutat.Res. 384: 65-72 (1997).
110. Yu,X, Egelman,EH: The RecA hexamer is a structural homologue of ring
helicases .
Nat.Struct.Biol. 4: 101-104 (1997).
111. Tsubouchi,H, Ogawa,H: A novel mrell mutation impairs processing of double-
strand
breaks of DNA during both mitosis and meiosis. Mol.Cell Biol. 18: 260-268
(1998).
112. Furuse,M, Nagase,Y, Tsubouchi,H, Murakami-Murofushi,K, Shibata,T, Ohta,K:
Distinct roles of two separable in vitro activities of yeast Mrell in mitotic
and meiotic
recombination. EMBO J. 17: 6412-6425 (1998).
113. Chedin,F, Seitz,EM, Kowalczykowski,SC: Novel homologs of replication
protein A
in archaea: implications for the evolution of ssDNA-binding proteins. Trends
Biochem.Sci. 23: 273-277 (1998).
114. Kalderon,D, Roberts,BL, Richardson,WD, Smith,AE: A short amino acid
sequence
able to specify nuclear location. Cell 39: 499-509 (1984).
115. Gupta,RC, Bazemore,LR, Golub,EI, Radding,CM: Activities of human
recombination
protein Rad51. Proc.Natl.Acad.Sci.U.S.A 94: 463-468 (1997).
116. Zaitseva,EM, Zaitsev,EN, Kowalczykowski,SC: The DNA binding properties of
Saccharomyces cerevisiae Rad51 protein. J.Biol.Chem. 274: 2907-2915 (1999).
117. Sung,P, Stratton,SA: Yeast Rad51 recombinase mediates polar DNA strand
exchange
in the absence of ATP hydrolysis. J.Biol.Chem. 271: 27983-27986 (1996).
- 70 -
CA 02422362 2003-03-13
WO 02/22811 PCT/CA01/01306
118. Walker,JE, Saraste,M, Runswick,MJ, Gay,NJ: Distantly related sequences in
the
alpha- and beta-subunits of ATP synthase, myosin, kinases and other ATP-
requiring
enzymes and a common nucleotide binding fold. EMBO J. 1: 945-951 (1982).
119. Story,RM, Weber,IT, Steitz,TA: The structure of the E. coli recA protein
monomer
and polymer . Nature 355: 318-325 (1992).
120. Story,RM, Steitz,TA: Structure of the recA protein-ADP complex . Nature
355: 374-
376 (1992).
121. Bergerat,A, de Massy,B, Gadelle,D, Varoutas,PC, Nicolas,A, Forterre,P: An
atypical
topoisomerase II from Archaea with implications for meiotic recombination .
Nature
386: 414-417 (1997).
122. Bressan,DA, Olivares,HA, Nelms,BE, Petrini,JH: Alteration of N-terminal
phosphoesterase signature motifs inactivates Saccharomyces cerevisiae Mrel 1.
Genetics 150: 591-600 (1998).
123. Current Protocols in Molecular Biology. Ausubel,FM, Brent,R, Kingston,RE,
Moore,DD, Seidman,JG, Smith,JA, Struhl,K eds. 1987. John Wiley and Sons, Inc.
Ref Type: Serial (Book,Monograph)
124. Chamankhah,M, Wei,YF, Xiao,W: Isolation of hMRE11B: failure to complement
yeast mrell defects due to species-specific protein interactions. Gene 225:
107-116
(1998).
125. Altschul,SF, Gish,W, Miller,W, Myers,EW, Lipman,DJ: Basic local alignment
search
tool. J.Mol.Biol. 215: 403-410 (1990).
126. Junghans,H, Metzlaff,M: A simple and rapid method for the preparation of
total plant
DNA. Biotechniques 8: 176 (1990).
127. Hebsgaard,SM, Korning,PG, Tolstrup,N, Engelbrecht,J, Rouze,P, Brunak,S:
Splice
site prediction in Arabidopsis thaliana pre-mRNA by combining local and global
sequence information. Nucleic Acids Res. 24: 3439-3452 (1996).
- 71 -
CA 02422362 2003-03-13
WO 02/22811 PCT/CA01/01306
128. Tishkoff,DX, Johnson,AW, Kolodner,RD: Molecular and genetic analysis of
the gene
encoding the Saccharomyces cerevisiae strand exchange protein Sep 1. Mol.Cell
Biol.
11: 2593-2608 (1991).
129. Link,AJ, Olson,MV: Physical map of the Saccharomyces cerevisiae genome at
110-
kilobase resolution. Genetics 127: 681-698 (1991).
130. Cupples,CG, Miller,JH: A set of lacZ mutations in Escherichia coli that
allow rapid
detection of each of the six base substitutions. Proc.Natl.Acad.Sci.U.S.A 86:
5345-
5349 (1989).
131. Schneider,JC, Guarente,L: Vectors for expression of cloned genes in
yeast: regulation,
overproduction, and underproduction. Methods Enzymol. 194: 373-388 (1991).
132. Gari,E, Piedrafita,L, Aldea,M, Herrero,E: A set of vectors with a
tetracycline-
regulatable promoter system for modulated gene expression in Saccharomyces
cerevisiae. Yeast 13: 837-848 (1997).
133. Gietz,RD, Schiestl,RH, Willems,AR, Woods,RA: Studies on the
transformation of
intact yeast cells by the LiAc/SS-DNA/PEG procedure. Yeast 11: 355-360 (1995).
134. Adams,A, Gottschling,DE, Kaiser,CA, Stearns,T: Mehods in Yeast Genetics.
Cold
Spring Harbor Laboratory Press, (1997).
135. Dean,RB, Dixon,W: Simplified statistics for small numbers of
observations.
Anal.Chem. 23: 636-638 (1951).
136. Devore,JL: Probability and Statistics. Duxbury Press, (1995).
137. Chu,S, DeRisi,J, Eisen,M, Mulholland,J, Botstein,D, Brown,P0,
Herskowitz,I: The
transcriptional program of sporulation in budding yeast. Science 282: 699-705
(1998).
138. Klimyuk,VI, Jones,JD: AtDMC1, the Arabidopsis homologue of the yeast DMC1
gene:
characterization, transposon-induced allelic variation and meiosis-associated
expression. Plant J. 11: 1-14 (1997).
- 72 -
' 27-05-2002 002 .10:48 FR W.GEORGIA VA
c AN co 02 4u2v2 E3 6R26 02 040 36- 0032- 1 04 2 7 4 T
CA0101306
01149892399446
s
139. Guyer,D, Tuttle,A, RouSe,S, Volrath,S, Johnson,M, Potter,S, Gorlach,J,
Goff,S,
Crossland,L, Ward,E: Activation of latent transgenes in Arabidopsis using a
hybrid
transcription factor. Genetics 149: 633-639 (1998).
140. Moore,I, Galweiler,L, Grosskopf,D, Schell,J, Pahne,K: A transcription
activation
= system for regulated gene expression in transgenic plants.
Proc.Natl.Acad.Sci.U.S.A 95:
376-381 (1998).
141. Labow,MA, Bairn,SB, Shenk,T) Levine,AJ: Conversion of the lac repressor
into an
allosterically regulated transcriptional activator for mammalian cells.
Mol.Cell Biol. 10:
3343-3356 (1990).
142. Ain1ey,WM, Key,JL: Development Of a heat shock inducible expression
cassette for
plants: characterization of parameters for its use in transient expression
assays. Plant
Mol.Biol. 14: 949-967 (1990).
143. Martinez,A, Sparks,C, Hart,CA, Thompson,J, Jepson,i: Ecdysone agonist
inducible
transcription in transgenic tobacco plants. Plant I. 19: 97-106 (1999).
144. Bohner,S, Lenk,I, Rieping,M, klerold,M, Gatz,C: Technical advance:
transcriptional
activator TGV mediates dexamethasone-inducible and tetracycline-inactivatable
gene
expression. Plant J. 19: 87-95 (1999).
145. Gatz,C, Kaiser,A, Wendenburg,R: Regulation of a modified CaMV 35S
promoter by
the Tri10-encoded Tet repressor in transgenic tobacco. Mol.Gen.Genet. 227:229-
237
(1991).
146. Weinmarm,P, Gossen,IVI, Hillen,W, Bujard,H, Gatz,C: A chimeric
transactivator allows
tetracycline-responsive gene expression in whole plants. Plant 3. 5: 559-569
(1994).
147. Mett,VL, Podivinsky,E, Termant,AM, Lochhead,LP, Jones,WT, Reynolds,PH:A
system for tissue-specific copper-controllable gene expression in transgenic
plants:
nodule-specific antisense of aspaxtate atninotransferase-P2. Transgenic Res.
5:105-113
(1996).
148. Mett,VL, Lochhead,LP, Reynolds,PH: Copper-controllable gene expression
system for
whole plants. Proc.Natl.Acad.Sci.U.S.A 90: 4567-4571 (1993).
149. Benton,BM, Eng,WK, Dunn,JI, Studier,FW, Sterriglanz,R, Fisher,PA: Signal-
mediated =
import of bacteriophage T7 RNA polymerase into the Saccharomyoes cerevisiae
nucleus and specific transcription of target genes. Mol.Cell Biol. 10: 353-360
(1990).
150. Church,G.M., Gilbert,W. : Genomic sequencing. Proc.Natl.Acad.Sci.U.S.A
81: 1991-
1995 (1984).
151. Ohta K, Shibata T, Nicolas A.: Changes in chromatin structure at
recombination
initiation sites during yeast meiosis. EMBO I. 13;5754-63 (1994).
152. Peterson CL.: ATP-dependent chromatin =modeling: going mobile. FEBS Lett.
476:68-72 (2000).
- 73 -
EmPfangsl AMENDED SHEET
-
_
CA 02422362 2012-09-11
=
153. Peterson CL, Logie C.: Recruitment of chromatin remodeling machines. J
Cell
Biochem.78:179-85 (2000) .
154. Sterner DE, Berger SL.:Acetylation of histones and transcription-related
factors.
Microbiol Mol Biol Rev. 64:435-59 (2000).
155. Cress WD, Seto E.:Histone deacetylases, transcriptional control, and
cancer.
J Cell Physiol. 184:1-16 (2000).
156. Hollingsworth,NM, Goetsch,L, Byers,B: The HOPI gene encodes a meiosis-
specific component of yeast chromosomes. Cell 61: 73-84 (1990).
157. Rockmill,B, Roeder,GS: A meiosis-specific protein kinase homolog required
for
chromosome synapsis and recombination. Genes Dev. 5: 2392-2404 (1991).
158. Roeder,GS: Sex and the single cell: meiosis in yeast. Proc Natl Acad Sci
U S A 92:
10450-10456 (1995).
159. Chen,Q, Pearlman,RE, Moens,PB: Isolation and characterization of a cDNA
encoding a synaptonemal complex protein. Biochem Cell Biol 70: 1030-1038
(1992).
160. Schmekel,K, Meuwissen,RL, Dietrich,AJ, Vink,AC, van Marle,J, van Veen,H,
Heyting,C: Organization of SCP1 protein molecules within synaptonemal
complexes of the rat. Exp Cell Res 226: 20-30 (1996).
161. Hyde,H, Davies,AA, Benson,FE, West,SC: Resolution of recombination
intermediates by a mammalian activity functionally analogous to Escherichia
coli
RuvC resolvase. J.Biol.Chem. 269: 5202-5209 (1994).
162. Vispe,S, Cazaux,C, Lesca,C, Defais,M: Overexpression of Rad51 protein
stimulates
homologous recombination and increases resistance of mammalian cells to
ionizing
radiation. Nucleic Acids Res. 26: 2859-2864 (1998).
163. Xu,Y, Ashley,T, Brainerd,EE, Bronson,RT, Meyn,MS, Baltimore,D: Targeted
disruption of ATM leads to growth retardation, chromosomal fragmentation
during
meiosis, immune defects, and thymic lymphoma. Genes Dev. 10: 2411-2422
(1996).
164. Rockmill,B, Roeder,GS: RED1: a yeast gene required for the segregation of
chromosomes during the reductional division of meiosis. Proc Natl Acad Sci U S
A
85: 6057-6061 (1988).
165. Sym,M, Roeder,GS: Zipl-induced changes in synaptonemal complex structure
and
polycomplex assembly. J Cell Biol 128: 455-466 (1995).
166. Romanienko, Peter J. and R. Daniel Camerini-Otero: Cloning,
Characterization, and
Localization of Mouse and Human SP011. Genomics. 61, 156-169 (1999).
167. Nichols, Matthew D., DeAngelis, Kristen, Keck, James L., and Berger,
James M.
Structure and function of an archaeal topoisomerase VI subunit with homology
to
the meiotic recombination factor SpollEMBO J. 18: 6177-6188 (1999).
-74-
CA 02422362 2003-06-17
SEQUENCE LISTING
<110> HER MAJESTY IN RIGHT OF CANADA AS REPRESENTED BY
THE MINISTER OF AGRICULTURE AND AGRI-FOOD CANADA
<120> MODULATION OF MEIOTIC RECOMBINATION
<130> 81601-36
<140> CA 2,422,362
<141> 2001-09-12
<150> CA 2,319,247
<151> 2000-09-15
<150> US 60/249,296
<151> 2000-11-17
<150> US 60/256,490
<151> 2000-12-20
<160> 38
<170> PatentIn Ver. 2.0
<210> 1
<211> 54
<212> DNA
<213> Artificial Sequence
<220>
<221> misc_binding
<222> (1)..(6)
<223> BamHI restriction site
<220>
<221> misc_feature
<222> (13)..(15)
<223> in-frame start codon
<220>
<221> misc_binding
<222> (49)..(54)
<223> SmaI restriction site
<220>
<223> Description of Artificial Sequence: Nuclear
localization sequence (NLS) corresponding to that
found in simian virus 40 T-antigen
<400> 1
ggatccaaaa aaatggctcc taagaagaag agaaaggttg gaggaggacc cggg 54
<210> 2
<211> 25
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:
Oligonucleotide (0L11434) for amplifying and
- 74a -
CA 02422362 2003-06-17
modifying target gene AtDMC1)
<400> 2
catatgatgg cttctcttaa ggctg 25
<210> 3
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:
Oligonucleotide (0L11433) for amplifying and
modifying target gene (AtDMC1)
<400> 3
gacatataaa agagttcgct cc 22
<210> 4
<211> 31
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:
Oligonucleotide (0L11435) for amplifying and
modifying target gene (AtDMC1)
<400> 4
aaactcgagc taatccttcg cgtcagcaat q 31
<210> 5
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:
Oligonucleotide (AtSPO-5'Sma) for amplifying and
modifying target gene (AtSP011)
<400> 5
gggtatggag ggaaaattcg ctag 24
<210> 6
<211> 23
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:
Oligonucleotide (AtSPO-3'X) for amplifying and
modifying target gene (AtSP011)
<400> 6
ccttgagttg gagactagtt atc 23
<210> 7
<211> 41
<212> DNA
<213> Artificial Sequence
- 74h -
CA 02422362 2003-06-17
<220>
<223> Description of Artificial Sequence:
Oligonucleotide (AtSPO-3'PstNot) for amplifying
and modifying target gene (AtSP011)
<400> 7
atcctgcagg cggccgctca tcaaqgagag cttacttcac g 41
<210> 8
<211> 35
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:
Oligonucleotide (AtRAD51-5"Bam) for amplifying and
modifying target gene (AtRAD51)
<400> 8
gggggatcca aaaaaatgac gacgatggag cagcg 35
<210> 9
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:
Oligonucleotide (AtRAD51-3"X) for amplifying and
modifying target gene (AtRAD51)
<400> 9
gaagcaaggc attgttgtgg 20
<210> 10
<211> 34
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:
Oligonucleotide (AtRAD51-3'Pst) for amplifying and
modifying target gene (AtRAD51)
<400> 10
aactgcagtt atcaatcctt gcaatctgtt acac 34
<210> 11
<211> 30
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:
Oligonucleotide (0L12414) for amplifying and
modifying target gene (AtMRE11)
<400> 11
cggaattcat gattgtaaaa cttgacaggg 30
- 74c -
CA 02422362 2003-06-17
<210> 12
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:
Oligonucleotide (0L12413) for amplifying and
modifying target gene (AtMRE11)
<400> 12
ggtcgctgac tacttgaaac 20
<210> 13
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:
Oligonucleotide (0L12415) for amplifying and
modifying target gene (AtMRE11)
<400> 13
tcattcagac agtggcgacg 20
<210> 14
<211> 18
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:
Oligonucleotide (0L12779) for amplifying and
modifying target gene (AtMRE11)
<400> 14
ggcctgaagt tcaagaag 18
<210> 15
<211> 18
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:
Oligonucleotide (0L12780) for amplifying and
modifying target gene (AtMRE11)
<400> 15
gctcgacttc ttcgcttg 18
<210> 16
<211> 57
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:
Oligonuclectide (MRE-F1) for amplifying and
modifying target gene (AtMRE11)
- 74d -
CA 02422362 2003-06-17
<400> 16
gcgctgcagc atatgcccgg ggaattcatg tctagggagg attttagtga tacactt 57
<210> 17
<211> 93
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:
Oligonucleotide (MRE-F2) for amplifying and
modifying target gene rAtMRE11)
<400> 17
gcgctgcagc atatgcccgg ggaattcatg tctagggagg attttagtga tacacttcga 60
gtacttgttg caactgcttg ccacttgggc tac 93
<210> 18
<211> 46
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:
Oligonucleotide (MRE-R1 for amplifying and
modifying target gene (AtMRE11)
<400> 18
cgcgtcgacc ccgggttaag gcgcgcctct tcttagagct ccatag 46
<210> 19
<211> 23
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:
Oligonucleotide (MRE-AVA) for amplifying and
modifying target gene (AtMRE11)
<400> 19
gataggtcca ctcgacccac tgg 23
<210> 20
<211> 36
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:
Oligonucleotide (YDMC-5'Eam) for amplifying and
modifying target gene (ScDMC1)
<400> 20
gggggatcca aaaaaatgtc tgttacagga actgag 36
<210> 21
<211> 35
<212> DNA
<213> Artificial Sequence
- 74e -
CA 02422362 2003-06-17
<220>
<223> Description of Artificial Sequence:
Oligonucleotide (YDMC-3'Pst) for amplifying and
modifying target gene (ScDMC1)
<400> 21
aactgcagct actagtcact tgaatcggta atacc 35
<210> 22
<211> 34
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:
Oligonucleotide (YDMC-G126D-sense) for amplifying
and modifying target gene (ScDMC1)
<400> 22
ggtgaattta ggtgteataa gacacagatg tctc 34
<210> 23
<211> 34
<212> DNA
<213> Artificial Sequence
<220>
<223> Description. of Artificial Sequence:
Oligonuclectide (YDMC-G126D-antisense) for
amplifying and modifying target gene (ScDMC1)
<400> 23
gagacatctg tgtcttatca cacctaaatt cacc 34
<210> 24
<211> 33
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:
Oligonucleotide (YDMC-N263Y-sense) for amplifying
and modifying target gene (ScDMC1)
<400> 24
gcagtatttc tgacatacca agttcaatca gac 33
<210> 25
<211> 33
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:
Oligonucleotide (YDMC-N263Y-antisense) for
amplifying and modifying target gene (ScDMC1)
<400> 25
gtctgattga acttggtatg tcagaaatac tgc 33
- 741 -
CA 02422362 2003-06-17
<210> 26
<211> 28
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:
Oligonucleotide (YDMC-A288T-sense) for amplifying
and modifying target gene (ScDMC1)
<400> 26
gagggcacgt tctgacacat gcgtcagc 28
<210> 27
<211> 28
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:
Oligonucleotide (YDMC-A288T-antisense) fox
amplifying and modifying target gene (ScDMC1)
<400> 27
gctgacgcat gtgtcagaac gtgccctc 28
<210> 28
<211> 37
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:
Oligonucleotide (YR51-5'Bam) for amplifying and
modifying target gene .ScRAD51)
<400> 28
gggggatcca aaaaaatgtc tcaagttcaa gaacaac 37
<210> 29
<211> 33
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:
Oligonucleotide (YR51-3'Pst) for amplifying and
modifying target gene (ScRAD51)
<400> 29
aactgcagtt actactegtc ttcttotctg ggg 33
<210> 30
<211> 35
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:
Oligonucleotide (YRADS1-G190D-sense) for
amplifying and modifying target gene (ScRAD51)
- 74g -
CA 02422362 2003-06-17
<400> 30
cggtgaattc aggacagata agtcccagct atgtc 35
<210> 31
<211> 39
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:
Oligonucleotide (YR52-5'Pme) for amplifying and
modifying target gene (ScRAD52)
<400> 31
aaagaattcg tttaaacatg gcgtttttaa gctattttq 39
<210> 32
<211> 33
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:
Oligonuclectide (YR52-'PNot) for amplifying and
modifying target gene (ScRAD52)
<400> 32
atcgcggccg ctcatcaagt aggcttqcgt gca 33
<210> 33
<211> 34
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:
Oligonucleotide (YR54-5'RI) for amplifying and
modifying target gene (ScRAD54)
<400> 33
ggggaattca aaaaaatggc aagacgcaga ttac 34
<210> 34
<211> 36
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:
Oligonucleotide (YR54-3'Pst) for amplifying and
modifying target gene (ScRAD54)
<400> 34
aaactgcagt catcaatgtg aaatatattg aaatgc 36
<210> 35
<211> 33
<212> DNA
<213> Artificial Sequence
- 74h -
CA 02422362 2003-06-17
<220>
<223> Description of Artificial Sequence:
Oligonucleotide (YSPC-5'13am) for amplifying and
modifying target gene (ScSP011)
<400> 35
atcggatcca aaaaaatggc tttggaggga ttg 33
<210> 36
<211> 35
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:
Oligonucleotide (YSPC-3'Pst) for amplifying and
modifying target gene ScSP011)
<400> 36
gggctgcagt catcatttgt attcaaaaat tctgg 35
<210> 37
<211> 33
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:
Oligonucleotide (YSPO-Y135F-sense) for amplifying
and modifying target gene (ScSP011)
<400> 37
gtgagagata tcttcttctc caacgtggaa ttg 33
<210> 38
<211> 33
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:
Oligonucleotide (YSPO-Y135F-antisense) for
amplifying and modifying target gene (ScSP011)
<400> 38
caattccacg ttggagaaga agatatctct cac 33
- 74i -
