Note: Descriptions are shown in the official language in which they were submitted.
CA 02426371 2003-04-17
WO 02/33049 PCT/USO1/31954
TITLE OF THE INVENTION
HUMAN TUBEROINFUNDIBULAR PEPTIDE OF 39 RESIDUES
BACKGROUND OF THE INVENTION
This invention relates to newly identified polynucleotides, polypeptides
encoded by such polynucleotides, the use of such polynucleotides and
polypeptides, as
well as the production of such polynucleotides and polypeptides. More
particularly,
the polypeptide of the present invention is a human protein, which has been
putatively
identified as a ligand of a parathyroid hormone receptor homolog, hereinafter
referred
to as "PTHZ Receptor". In particular, the invention relates to isolated
nucleic acid
molecules, such as DNA and RNA encoding a novel human tuberoinfundibular
peptide of 39 residues.
It is well established that many medically significant biological
processes are mediated by proteins participating in signal transduction
pathways that
involve G-proteins and/or second messengers, e.g., cAMP (Lefkowitz, Nature
351:353-354 (1991)). Some examples of these proteins include the G-protein
coupled
receptor (GPCR), such as those for adrenergic agents and dopamine (Kobilka, B.
K.,
et al., PNAS 84:46-50 (1987); Kobilka, B. K., et al., Sciefzce 238:650-656
(1987);
Bunzow, J. R., et al., Nature 336:783-787 (1988)), G-proteins themselves,
effector
proteins, e.g., phospholipase C, adenyl cyclase, and phosphodiesterase, and
actuator
proteins, e.g., protein kinase A and protein kinase C (Simon, M. L, et al.,
Science
252:802-8 (199.1)).
The G protein transmembrane signaling pathways consist of three
proteins: receptors, G proteins and effectors. G-protein coupled receptors are
a
diverse class of receptors that mediate signal transduction by binding to G
proteins.
These receptors are glycoproteins and comprise a superfamily of structurally
related
molecules. Possible relationships among seven transmembrane receptors are
reviewed in Probst, et al., DNA afid Cell Biology 11(1):1-20 (1992).
G-protein coupled receptors are known to share certain structural
similarities and homologies (see, e-g., Gilman, A. G., Ann. Rev. Bioclaern.
56: 615-649
(1987), Strader, C. D., et al., The FASEB Joatrnal 3:1825-1832 (1989),
Kobilka, B. K.,
et al., Nature 329:75-79 (1985) and Young, et al., Gell 45:711-719 (1986)).
-1-
CA 02426371 2003-04-17
WO 02/33049 PCT/USO1/31954
The G-protein coupled receptors exhibit detectable amino acid
sequence similarity and all appear to share a number of structural
characteristics
including: an extracellular amino terminus; seven predominantly hydrophobic a-
helical domains (of about 20-30 amino acids) connecting at least eight
divergent
hydrophilic loops and which are believed to span the cell membrane and are
referred
to as transmembrane domains 1-7; approximately twenty well-conserved amino
acids;
and a cytoplasmic carboxy terminus. The amino acid similarity among different
G-
protein receptors ranges from about 10% to more than 80% and receptors which
recognize similar or identical ligands generally exhibit high levels of
homology. The
third cytosolic loop between transmembrane domains five and six is the
intracellular
domain responsible for the interaction with G-proteins. G-protein coupled
receptors
are found in numerous sites within a mammalian host.
The G-protein coupled receptors can be grouped based on their
homology levels and/or the ligands they recognize. The G-protein coupled
receptors
includes dopamine receptors which bind to neuroleptic drugs used for treating
psychotic and neurological disorders. Other examples of members of this family
include calcitonin, adrenergic, endothelin, cAMP, adenosine, muscarinic,
acetylcholine, serotonin, histamine, thrombin, kinin, follicle stimulating
hormone,
opsins, endothelial differentiation gene-1 receptor and rhodopsins, odorant,
cytomegalovirus receptors, etc.
G-protein coupled receptors recognize a great diversity of ligands, e.g.,
neurotransmitters, peptide hormones and small molecules and transduce their
signals
via heterotrimeric guanine nucleotide-binding proteins (G-proteins), thereby
effecting
a broad array of biological activities through various intracellular enzymes,
ion
channels and transporters.
The function of GPCR activation is to stimulate GTP/GDP exchange at
G proteins. In a cell, the guanine nucleotide exchange cycle is initiated by
binding of
an agonist - occupied (or activated) GPCR to a heterotrimeric G-protein in the
cell
membrane. This stimulates the dissociation of the GDP from the a-subunit of
the G-
protein, thereby allowing endogenous GTP to bind in its place. This, in turn,
causes
dissociation of the receptor and the Ga-GTP and G(3r-subunits of the G-
protein. The
Ga-GTP and G(3r-subunits can each activate effectors, such as adenyl cyclase,
phospholipase C, and ion channels. The Ga-GTP is inactivated by intrinsic
GTPase,
which hydrolyzes the GTP to GDP; Ga-GDP in turn inactivates the G~3r by
binding to
-2-
CA 02426371 2003-04-17
WO 02/33049 PCT/USO1/31954
it, thereby resulting in an inactive GDP-containing heterotrimeric G-protein
ready for
the next activation cycle.
Thus, the function of each G-protein coupled receptor is to
discriminate its specific ligand from the complex extracellular milieu and
then to
activate G-proteins to produce a specific intracellular signal. In summary,
cell surface
proteins, by intracellularly transmitting information regarding the
extracellular
environment via specific intracellular pathways induce an appropriate response
to a
particular stimulus. Indeed, by virtue of an array of varied membrane surface
proteins, eukaryotic cells are exquisitely sensitive to their environment.
The parathyroid hormone/parathyroid hormone-related protein
(PTH/PTHrP) receptor is a member of a subgroup of the G protein-coupled
receptor
superfamily that includes the receptors for glucagon, glucagon-like peptide-1,
vasoactive intestinal protein, CRF, secretin, calcitonin (CT), and a number of
others.
The two ligands for the PTH/PTHrP receptor, PTH and PTHrP, are the products of
distinct, yet evolutionarily related, genes (Behar, V., et al., Endocrinology
137:2748-
2757 (1996)).
PTH is secreted by four small glands located behind the thyroid gland.
The most important physiological function of PTH is to maintain extracellular
fluid
calcium concentration by increasing the rate of bone destruction with
mobilization of
calcium and phosphate from bone, increasing renal tubular resorption of
calcium,
increasing intestinal absorption of calcium and decreasing renal tubular
resorption of
phosphate. These actions account for all-important clinical manifestations of
PTH
excess or deficiency (Behar, supra).
Regulation of calcium concentration is necessary for the normal
function of the gastrointestinal, skeletal, neurologic, neuromuscular, and
cardiovascular systems. PTH regulates calcium and phosphate metabolism via the
activation of G-protein coupled receptor that also binds PTHrP. This dual
hormone
recognition is presumed to be via a unique seven-transmembrane domain receptor
(PTH/PTHrP receptor) that specifically recognizes the N-terminal regions 1-34
of
both hormones (Behar, supra).
PTH synthesis and release are controlled principally by the serum
calcium level: a low level stimulates and a high level suppresses both the
hormone
synthesis and release. PTH exerts its effects primarily through receptor-
mediated
activation of adenylate cyclase, although receptor-mediated activation of
-3-
CA 02426371 2003-04-17
WO 02/33049 PCT/USO1/31954
phospholipase C by PTH has also been reported (Hruska, et al., J. ClirZ.
Invest. 79:230
(1987)).
Recently, a new G-protein coupled receptor (PTHZ receptor) was
identified during a molecular screen for members of the secretin receptor
family. A
number of previous studies have suggested that PTH receptors with properties
different from those of the PTII/PTHrP receptor exist. The human PTHZ receptor
shares 51°~o identity (over 70°70 sequence similarity) with the
human PTHI receptor
(also referred to as the PTH/PTHrP receptor) as well as significant homology
with the
other receptors of this class (Usdin, T. B., Endocrinology 138: 831-834
(1997)).
The PTH2 receptor is a G protein-coupled receptor selectively activated
by PTH ( 1 ). It is a member of the secretin receptor family, which includes
receptors
for secretin, vasoactive intestinal polypeptide, pituitary adenylate cyclase
activating
polypeptide, calcitonin, glucagon, glucagon-like peptide I, gastric inhibitory
polypeptide, and CRF as well as PTH and PTHrP (originally called hypercalcemia
of
malignancy factor) (Usdin, T. B., et al., Endocrinology 137:4285-4297 (1996)).
Both PTH receptors, PTHI and PTH2 receptors belong to the type II
family of G-protein-coupled receptors that respond to peptide modulators,
including
calcitonin, glucagon, secretin, and vasoactive intestinal polypeptide. The
similarity
identified For PTH receptors extends to their ligands. (Usdin, T. B., et al.,
Endocrinology 140:3363-3371 (1999)).
The PTHZ and PTH, receptors, together with their ligands, have
presumably evolved to selectively mediate different physiological functions.
In this
regard, the PTHI receptor mediates the principal actions of PTH (elevation of
blood
calcium levels) and PTHrP (a locally acting autocrine/paracrine factor and
developmental regulator) whereas the PTHZ receptor responds to TIP39 and
perhaps
PTH but not to PTHrP. (Hoare, S.R., J. Bio. Chern. 275: 27274-27283 (2000)).
Many of the cells that express the PTHZ receptor are hormone
secreting, and the colocalization with somatostatin is striking. It is
suggested that the
PTHz receptor may be involved in the specified regulatory functions of each of
the
cells that express it. (Usdin, T. B., et al., Endocrinology 140:3363-3371
(1999)).
The newly discovered PTHz receptor is most abundant in the nervous
system, particularly, in the brain. Its expression is relatively high in the
hypothalamus, where nerve terminals in the median eminence and cell bodies in
the
periventricular nucleus have particularly high receptor levels, suggesting a
role in the
modulation of pituitary function. It is present at low levels in the placenta
and testis.
_4_
CA 02426371 2003-04-17
WO 02/33049 PCT/USO1/31954
In many of the areas where PTHZ receptor mRNA is present, it is clear from the
size
and morphology of the labeled cells that it is present within neurons. This
and the fact
that it is present in distinct brain nuclei suggest that it may function as a
neurotransmitter receptor (Ted. B. Usdin, E~zdocrinology 138: 831-834 (1997)).
PTHZ receptor concentration in the superficial lamina of the spinal cord
dorsal horn suggests a role in the modulation of pain perception. In the
periphery, the
receptor is expressed by discrete cells in a number of tissues including
pancreatic islet
somatostatin cells, heart and vascular muscle cells, and cells within
bronchioles and
vasculature in the lung (Usdin, T. B., et al., Nature Neurosciefice 2:941-943
(1999);
Hoare, supra).
There are some reports that suggest that the PTH2 receptor is present in
some of the phylogenetically older parts of the forebrain as well as in
several
hypothalamic and brainstem nuclei, suggesting that it is involved in the
modulation of
primitive functions. Several of the areas where PTHZ receptor mRNA is most
abundant contain a major or primarily cholinergic population of neurons,
raising the
possibility that activation of this receptor modulates eholinergic
neurotransmission.
Likewise, it is striking that many of the areas that express PTHZ receptor
mRNA are
part of hippocampal input or output pathways (Usdin, T. B., et al.,
EfTdocrinology
137:4285-4297 (1996)).
PTHZ encoding messenger RNA is also abundantly expressed in
arterial and cardiac endothelium and at lower levels in vascular smooth
muscle. It is
also abundant in the lung, both within bronchi and in the parenchyma, and is
present
within the exocrine pancreas. It is expressed by sperm in the head of the
epididymis.
A small number of cells associated with the vascular pole of renal glomeruli
also
express the receptor. These data suggest that this receptor may be responsible
for
PTH effects in a number of physiological systems.
The location of PTH2 receptor mRNA in the cardiovascular system and
kidney suggests that it may play a role in blood pressure regulation. Indeed,
elevated
PTH, especially in chronic renal failure, has been reported to cause
deleterious effects
in the heart and lung. Stage-specific expression in sperm raises the question
of
whether it is involved in male infertility. The data suggest that increased
PTH may
play a role in several chronic diseases and because of the possibility that
the PTH~
receptor is involved. (Usdin, T. B., et al., Endocrinology 137:4285-4297
(1996)).
To date, PTH was thought to be the only endogenous substance known
to activate the PTH~ receptor, so it was assumed to be the natural ligand.
Recently a
-5-
CA 02426371 2003-04-17
WO 02/33049 PCT/USO1/31954
putative endogenous ligand for PTH~ was isolated and characterized. The 39-
amino
acid peptide, named tuberoinfundibular peptide or TIP39, has been isolated
from
bovine hypothalamus, and based on the PTH~ receptor distribution it is thought
to be
involved in modulation of pain and pituitary function. The PTH receptor and
bovine
TIP39 are considered to form a part of an extended family of related receptors
and
ligands (1). Usdin, T. B., et al., Nature Neczroscience, 2:941-943 (1999).
TIP39 appears to be distantly related to PTH and PTHrP. Clues about
the biological function of the PTH2 receptor and TIP39 are provided by the
cellular
distribution of the receptor. Strong staining using an antibody that
recognizes the
PTHZ receptor has been observed in the external none of the median eminence,
where
hypothalamic neurons release factors into the portal circulation that regulate
pituitary
hormone secretion (T.B. Usdin, TIPS 21: 128-130 (2000)).
Bovine TIP39 has been implicated as a good candidate as the PTHZ
receptor's endogenous ligand. Indeed, it has been shown to be a strong
activator of
the human, rat, and zebrafish PTHZ receptors. According to investigators,
because
TIP39, used in various studies, was purified from bovine brain and PTHZ
receptor
expression is highest in the brain, it appears likely that, at least in the
CNS, a homolog
of bovine TIP39 acts on the human PTHZ receptor (Usdin, T.B., Endocrinology
140:3363-3371 (1999); Hoare, supra).
Studies by T.B. Usdin have shown that bovine tuberoinfundibular
peptide of 39 residues (bTIP39) activates the human and rat PTHZ receptors
(ECso =
0.5 and 0.8 nM, respectively) but has little or no effect at PTHI receptors.
Activation
of the rat PTHZ receptor by bTII'39 results in a twofold greater accumulation
in cAMP
than that elicited by PTH, and bTIP39 is 100-fold more potent than PTH. By
contrast,
bTIP39 and PTH have a similar potency and efficacy at the human PTHZ receptor.
(T.B. Usdin, TIPS 2:128-130 (2000)).
As noted, the PTH~ receptor has been observed to be present in several
populations of hypothalamic neurons, and its expression in the somatostatin-
containing cells of the periventricular nucleus, which are major regulators of
growth
hormone secretion, is particularly striking. The PTHz receptor has also been
shown to
be expressed in primary sensory neurons (Usdin, T.B., Erzdocrizzology 140:3363-
3371
(1999)).
According to conventional data, bovine TIP39 increases cAMP in
dorsal root ganglion (DRG)-like F-11 cells, and because other agents that
increase
-6-
CA 02426371 2003-04-17
WO 02/33049 PCT/USO1/31954
cAMP in DRG neurons potentiate nociception, it is suggested that a PTHz
receptor
antagonist might be useful for ameliorating some types of pain.
As well, it is hypothesized that the PTHZ receptor might stimulate
somatostatin release in both pancreatic islets and the hypothalamus, and thus
therapeutic agentslcompounds that are selective for the PTHz receptor might
indirectly
modulate secretion of insulin, glucagon or growth hormone (T.B. Usdin, TIPS
21:
128-130 (2000)).
Discrete cellular populations in several peripheral organs have
relatively high PTHZ receptor expression. These include somatostatin-
synthesizing D
cells of the pancreatic islets, calcitonin-synthesizing parafollicular C cells
of the
thyroid, several populations of gastrointestinal peptide-synthesizing cells,
and
cartilage and heart muscle cells. As such, the data suggest that the PTHZ
receptor and
bovine TIP39 could be involved in the modulation of pituitary hormone release,
sensory and particularly nociceptive sensitivity, pancreatic islet function,
Ca'+
homeostasis and cardiovascular function (Usdin, T. B., et al., Nature
Neuroscience
2:941-943 (1999)).
As such, there are many potential pharmacological uses for compounds
that interact with and modulate the activity of cell surface proteins such as
the PTH~
receptor. For example, calcium channels, play a central role in regulating
intracellular
Ca Z+ levels, which influence cell viability and function. Intracellular
levels of Ca 2+
concentrations are implicated in a number of vital processes in animals, such
as
neurotransmitter release, pain, muscle contraction, pacemaker activity, and
secretion
of hormones and other substances.
In order to study the function of human TIP39 and to obtain disease-
specific pharmacologically active agents, there is a need to obtain isolated
(preferably
purified) human TIP39, and isolated (preferably purified) human TIP39. In
addition,
there is also a need to develop assays to identify such pharmacologically
active agents.
As such, the availability of the disclosed isolated nucleic acid
molecules that encode human TIP39 will fulfill the above referenced voids in
the prior
art and will provide detailed information of the human TIP39 structure and
function
based on predictions drawn from non-human T1P39 data. This, in turn, will
allow for
the development of therapeutic candidates that modulate pain perception, treat
metabolic disorders, hypertension, cardiovascular disease and neurological
disorders
attending a defective human TIP39 or its respective receptor, etc.
CA 02426371 2003-04-17
WO 02/33049 PCT/USO1/31954
As well, the identity of a human TIP39 would enable the rapid
screening of a large number of compounds to identify those candidates suitable
for
further, in-depth studies of therapeutic applications.
SUMMARY OF THE INVENTION
The invention provides isolated nucleic acid molecules encoding a
novel human protein, including mRNAs, DNAs, cDNAs, genomic DNA as well as
antisense analogs thereof and biologically active and diagnostically or
therapeutically
useful fragments thereof.
Another aspect of the invention provides an isolated, purified human
tuberoinfundibular peptide of 39 residues (invention polypeptide/peptide),
which is a
ligand for the human parathyroid hormone-2 receptor.
Plasmids containing DNA encoding the invention peptide are also
provided. Recombinant cells containing the above-described DNA, mRNA or
plasmids are also provided herein.
In accordance with a further aspect of the present invention, there are
provided processes for producing the invention peptides) by recombinant
techniques
comprising culturing transformed prokaryotic andlor eukaryotic host cells,
containing
nucleic acid sequences encoding the invention peptide under conditions
promoting
expression of the invention peptide, followed by subsequent recovery of the
polypeptide(s).
In accordance with yet another further aspect of the present invention,
there are provided antibodies against the invention peptide.
Tn accordance with still another embodiment of the invention, there are
provided processes of administering compounds comprising the invention peptide
to a
host that bind to and activate the human parathyroid hormone-2 receptor.
In accordance with yet another aspect of the present invention, there
are provided nucleic acid probes comprising nucleic acid molecules of
sufficient
length to specifically hybridize to the polynucleotide sequences of the
present
invention.
In another aspect, the invention features assays for detecting the
invention peptide.
In accordance with still another aspect of the present invention, there
are provided diagnostic assays for detecting diseases related to mutations in
the
_g_
CA 02426371 2003-04-17
WO 02/33049 PCT/USO1/31954
nucleic acid sequences encoding the invention peptide and for detecting an
altered
level of the encoded polypeptide.
In accordance with yet a further aspect of the present invention, there
are provided processes for utilizing the invention peptide or nucleic acid
molecules
encoding such polypeptides for in vitro purposes such as synthesis of DNA and
manufacture of DNA vectors.
A further aspect of the invention provides assays) for screening and
identifying potential pharmaceutically effective compounds that specifically
interact
with and modulate the activity of cell surface proteins, particularly PTH2
receptor.
In a related aspect, the invention features fragments of the invention
peptide. Preferably, the fragment is capable of binding human PTHZ receptor.
In
preferred embodiments, this fragment is at least six amino acids long or its
analog,
which is capable of binding PTHZ receptor, wherein "analog" denotes a peptide
having a sequence at least 50°l0 (and preferably at least 70%)
identical to the peptide
of which it is an analog.
Also within the invention is a therapeutic composition including, in a
pharmaceutically-acceptable earner, (a) the invention peptide, (b) an
immunologically
active or biologically active fragment thereof, or (c) an antibody having
affinity for (a)
or (b) above. These therapeutic compositions provide a means for treating
various
disorders characterized by abnormal (low or ubiquitous) level of the invention
peptide
or a dysfunctional PTHZ receptor.
These invention nucleic acids, invention peptides and antibodies,
including fragments thereof are useful as diagnostics, for distinguishing
disease states
caused by a dysfunctional endogenous human TIP39 or PTHz receptor from those
which are not.
The nucleic acid probes of the invention enable one of ordinary skill in
the art of genetic engineering to identify and clone similar polypeptides from
any
species thereby expanding the usefulness of the sequences of the invention. As
well,
the sequences of the invention will enable one skilled in the art to screen
for and
identify other ligands of the PTHZ receptor in human sand other mammalian
species.
Also provided in accordance with the present invention are methods
for identifying cells that express the invention peptide. Methods for
identifying
compounds which modulate the activity of the invention peptide are also
provided.
The DNA, mRNA, vectors, and cells provided herein permit
production of human tuberoinfundibular peptide of 39 residues, as well as
antibodies
-9-
CA 02426371 2003-04-17
WO 02/33049 PCT/USO1/31954
to the peptide. This provides a means to prepare synthetic or recombinant
invention
peptides that are substantially free of contamination from many other proteins
whose
presence can interfere with analysis of a single human tuberoinfundibular
peptide of
39 residues. The availability of desired receptors, i.e., PTHZR makes it
possible to
observe the effect of a drug substance on the receptor and to thereby perform
initial in
vitro screening of the drug substance in a test system that is specific for
the invention
peptide and its corresponding receptor.
The availability of human TIP39-specific antibodies makes possible
the application of the technique of immunohistochemistry to monitor the
distribution
and expression density of the invention peptide as well as its corresponding
receptor
(e.g., in normal vs. diseased brain tissue). Such antibodies could also be
employed for
diagnostic and therapeutic applications. This antibody is preferably capable
of
neutralizing a biological activity of the PTHZ receptor (i.e. adenylate
cyclase
activation).
Thus, antibodies, (monoclonal or polyclonal), including purified
preparations of an antibody, which is capable of forming an immune complex
with the
invention peptide, such antibody being generated by using as antigen either
(1) a
polypeptide that includes a fragment of invention peptide, or (2) the
invention peptide.
The ability to screen drug substances in vitro to determine the effect of
the drug on native human tuberoinfundibular peptide of 39 residues or its
binding to
its native receptor should permit the development and screening of TIP39-
specific or
disease-specific drugs. Also, testing of the invention peptide with a variety
of
potential agonists or antagonists provides additional information with respect
to the
function and activity of the invention peptide and should lead to the
identification and
design of compounds that are capable of very specific interaction with native
human
tuberoinfundibular peptide of 39 residues or its interaction with its specific
receptor.
The resulting drugs should exhibit fewer unwanted side effects than drugs
identified
by screening with cells that express a non-human TIP39.
Further in relation to drug development and therapeutic treatment of
various disease states, the availability of DNAs encoding the invention
peptide
enables identification of any alterations in such genes (e.g., mutations)
which may
correlate with the occurrence of certain disease states. In addition, the
creation of
animal models of such disease states becomes possible, by specifically
introducing
such mutations into synthetic DNA sequences which can then be introduced into
laboratory animals or in vitro assay systems to determine the effects thereof.
- 10-
CA 02426371 2003-04-17
WO 02/33049 PCT/USO1/31954
Therefore, it is an object herein to isolate and characterize nucleic acid
molecules encoding human TIP39. It is also an object herein to provide methods
for
the recombinant production of the invention peptide as well as to provide
methods for
screening compounds to identify compounds that modulate the activity of human
TIP39.
Other features and advantages of the invention will be apparent to
those of skill in the art upon further study of the specification and claims.
BRIEF DESCRIPTION OF THE DRAWINGS
IO FIG. 1 presents the nucleotide and deduced amino acid sequence of
human tuberoinfundibular peptide of 39 residues. The deduced amino acid
sequence
is that of the prepolypeptide, i.e., immaturelprecursor or prior to post-
translational
modification. The bold sequence around the ATG (GCACGGT atgG) partially
conformed to Kozak's rule (GCACACCatgG). Polyadenylation signal AATAA is
underlined. The deduced amino acid sequence refers to the polypeptide sequence
prior to post-translational modification and hence it is labeled "precursors'.
FIG. 2 presents depicts the alignment of the polypeptide sequences of
human tuberoinfundibular peptide of 39 residues precursors (prior to post
translational
modification) and its corresponding mouse equivalent. Importantly, the
predicted
signal peptide sequence in the human sequence (SEQ ID N0:2) is single-
underlined,
while the predicted mature sequence, is double underlined.
FIG. 3 depicts the alignment of the mature polypeptide amino acid
sequences corresponding to human tuberoinfundibular peptide of 39 residues and
its
corresponding rat, mouse and bovine equivalent. Importantly, the amino acid
sequence of human TIP39 shown in this figure corresponds to the mature
protein, i.e.,
after post translational modification etc.
FIG. 4A and FIG. 4B depict dose-response curve analysis of the effect
of human and mouse tuberoinfundibular peptide of 39 residues, human PTH and
rat
PTH on rat PTHZR (A) and human PTHZR (B) expressing HEK293 cells. The dose-
response effect is measured by an increase in cAMP levels after stimulation
with a
prospective ligand.
FIG. 5A and FIG. 5B illustrate a dose-response curve of agonists on
stably-transfected HEK293 cells expressing a rat PTHZR (A) and human PTH~R (B)
respectively. A representative example of the dose-response effect of
potential
agonists is to increase intracellular calcium concentration.
-lI-
CA 02426371 2003-04-17
WO 02/33049 PCT/USO1/31954
DETAILED DESCRIPTION OF THE INVENTION
It must be noted that as used herein and in the appended claims, the
singular forms "a", "an", and "the" include plural reference unless the
context clearly
dictates otherwise. Thus, for example, reference to "a host cell" includes a
plurality of
such host cells, reference to the ''antibody" is a reference to one or more
antibodies
and equivalents thereof known to those skilled in the art, and so forth.
Unless defined otherwise, all technical and scientific terms used herein
have the same meanings as commonly understood by one of ordinary skill in the
art to
which this invention belongs. Although any methods and materials similar or
equivalent to those described herein can be used in the practice or testing of
the
present invention, the preferred methods, devices, and materials are now
described.
All publications mentioned herein are incorporated herein by reference
for the purpose of describing and disclosing the methodologies, vectors etc
which are
reported in the publications that might be used in connection with the
invention.
Nothing herein is to be construed as an admission that the invention is not
entitled to
antedate such disclosure by virtue of prior invention.
In the description that follows, a number of terms used in the field of
recombinant DNA technology are extensively utilized. In order to provide a
clearer
and consistent understanding of the specification and claims, including the
scope to be
given such terms, the following definitions are provided.
The present invention provides isolated nucleic acid molecules that
encode a novel human peptide, human tuberoinfundibular peptide of 39 residues
(hTIP39). Specifically, isolated DNA encoding the invention peptide are
described as
are recombinant messenger RNA (mRNA). Splice variants of the isolated DNA are
also described. Typically, unless hTIP39 arises as a splice variant, hTIP39-
encoding
DNA will share substantial sequence homology (i.e., greater than about
90°Io), with
the hTIP39-encoding DNA described herein. DNA or RNA encoding a splice variant
may share less than 90°70 overall sequence homology with the DNA or RNA
provided
herein, but such a splice variant would include regions of nearly 100%
homology to
the disclosed DNAs.
"Invention nucleic acid(s)" and "nucleic acid molecules" are used
interchangeably and refer to the nucleic acid molecules of the invention that
encode
the invention peptide.
-I2-
CA 02426371 2003-04-17
WO 02/33049 PCT/USO1/31954
As used herein, "humanTIP39" or "hTIP39" refers to a human TIP39
that is encoded by a nucleic acid molecule that hybridizes under high
stringency
conditions to the nucleotide sequences disclosed herein. Such nucleic acid
molecule
can be characterized in a number of ways, for example - the DNA may encode the
amino acid sequence set forth in SEQ ID N0:2 or 14, or the DNA may include the
nucleotide sequence as set forth in SEQ TD NO:1.
The nucleic acid molecules described herein are useful for producing
invention peptides, when such nucleic acids are incorporated into a variety of
protein
expression systems known to those of skill in the art. In addition, such
nucleic acid
molecules or fragments thereof can be labeled with a readily detectable
substituent
and used as hybridization probes for assaying for the presence and/or amount
of a
hTIP39 encoding gene or mRNA transcript in a given sample. The nucleic acid
molecules described herein, and fragments thereof, are also useful as primers
andlor
templates in a PCR reaction for amplifying genes encoding the invention
protein
described herein.
A "gene" refers to a nucleic acid molecule whose nucleotide sequence
codes for a polypeptide molecule. Genes may be uninterrupted sequences of
nucleotides or they may include such intervening segments as introns, promoter
regions, splicing sites and repetitive sequences. A gene can be either RNA or
DNA.
A preferred gene is one that encodes the invention peptide.
The term "nucleic acid" or "nucleic acid molecule" is intended for
ribonucleic acid (RNA) or deoxyribonucleic acid (DNA), probes,
oligonueleotides,
fragment or portions thereof, and primers. DNA can be either complementary DNA
(cDNA) or genomic DNA, e.g. a gene encoding the invention peptide.
Unless otherwise indicated, a nucleotide defines a monomeric unit of
DNA or RNA consisting of a sugar moiety (pentose), a phosphate group, and a
nitrogenous heterocyclic base. The base is linked to the sugar moiety via the
glycosidic carbon (1' carbon of the pentose) and that combination of base and
sugar is
a nucleoside. When the nucleoside contains a phosphate group bonded to the 3'
or 5'
position of the pentose, it is refewed to as a nucleotide. A sequence of
operatively
linked nucleotides is typically referred to herein as a "base sequence" or
"nucleotide
sequence", and their grammatical equivalents, and is represented herein by a
formula
whose left to right orientation is in the conventional direction of 5'-
terminus to 3'-
terminus.
-13-
CA 02426371 2003-04-17
WO 02/33049 PCT/USO1/31954
Each "nucleotide sequence" set forth herein is presented as a sequence
of deoxyribonucleotides (abbreviated A, G, C and T). However, by "nucleotide
sequence" of a nucleic acid molecule is intended, for a DNA molecule or
polynucleotide, a sequence of deoxyribonucleotides, and for an RNA molecule or
polynucleotide, the corresponding sequence of ribonucleotides (A, G, C and U),
where each thymidine deoxyribonucleotide (T) in the specified
deoxyribonucleotide
sequence is replaced by the ribonucleotide uridine (U). For instance,
reference to an
RNA molecule having the sequence of SEQ m NO:1 set forth using
deoxyribonucleotide abbreviations is intended to indicate an RNA molecule
having a
sequence in which each deoxyribonucleotide A, G or C of SEQ ID NO:1 has been
replaced by the corresponding ribonucleotide A, G or C, and each
deoxyribonucleotide T has been replaced by a ribonucleotide U.
A "fragment" of a nucleic acid molecule or nucleotide sequence is a
portion of the nucleic acid that is less than full-length and comprises at
least a
minimum length capable of hybridizing specifically with the nucleotide
sequence of
SEQ ~ NO:1 under stringent hybridization conditions. The length of such a
fragment is preferably 15-17 nucleotides or more.
A "variant" nucleic acid molecule or DNA molecule refers to DNA
molecules containing minor changes in the native nucleotide sequence encoding
the
invention polypeptide(s), i.e., changes in which one or more nucleotides of a
native
sequence is deleted, added, and/or substituted, preferably while substantially
maintaining the biological activity of the native nucleic acid molecule.
Variant DNA
molecules can be produced, for example, by standard DNA mutagenesis techniques
or
by chemically synthesizing the variant DNA molecule or a portion thereof.
Generally,
differences are limited so that the nucleotide sequences of the reference and
the
variant are closely similar overall and, in many regions, identical.
Changes in the nucleotide sequence of a variant polynucleotide may be
silent. That is, they may not alter the amino acids encoded by the
polynucleotide.
Where alterations are limited to silent changes of this type, a variant will
encode a
polypeptide with the same amino acid sequence as the reference.
Alternatively, the changes may be "conservative." Conservative
variants are changes in the nucleotide sequence that may alter the amino acid
sequence of a polypeptide encoded by the reference polynucleotide. Such
nucleotide
changes may result in amino acid substitutions, additions, deletions, fusions
and
truncations in the polypeptide encoded by the reference sequence. Thus,
conservative
_ 1q _
CA 02426371 2003-04-17
WO 02/33049 PCT/USO1/31954
variants are those changes in the protein-coding region of the gene that
result in
conservative change in one or more amino acid residues of the polypeptide
encoded
by the nucleic acid sequence, i.e. amino acid substitutian.
An "insertion" or "addition", as used herein, refers to a change in an
amino acid or nucleotide sequence resulting in the addition of one or more
amino acid
or nucleotide residues, respectively, as compared to the naturally occurnng
molecule.
A "substitution", as used herein, refers to the replacement of one or
more amino acids or nucleotides by different amino acids or nucleotides,
respectively.
Preferably, a variant form of the preferred nucleic acid molecule has at
least 70%, more preferably at least 80%, and most preferably at least
90°Io nucleotide
sequence similarity with the native gene encoding the invention peptide.
"Mature" protein as it relates to the human TIP39 disclosed herein and
shown in Figure 3, refers to the mature proteins) after post-translational
modification.
In the same vein, "precursors" or "precursor" or "prepolypeptide" refers to
the
deduced amino acid sequence of the gene product of the nucleic acid molecule
encoding a human TIP39 prior to any post-translational modification.
"Primer" or "nucleic acid polymerase primer(s)" refers to an
oligonucleotide, whether natural or synthetic, capable of acting as a point of
initiation
of DNA synthesis under conditions in which synthesis of a primer extension
product
complementary to a nucleic acid strand is initiated, i.e., in the presence of
four
different nucleotide triphosphates and an agent for polymerization (i.e., DNA
polymerase or reverse transcriptase) in an appropriate buffer and at a
suitable
temperature. The exact length of a primer will depend on many factors, but
typically
ranges from 15 to 25 nucleotides. Short primer molecules generally require
cooler
temperatures to form sufficiently stable hybrid complexes with the template. A
primer need not reflect the exact sequence of the template, but must be
sufficiently
complementary to hybridize with a template. A primer can be labeled, if
desired.
"Polypeptide" or "peptide" or "protein" refers to a polymer of amino
acid residues and to variants and synthetic analogs of the same and are used
interchangeably herein. Thus, these terms apply to amino acid polymers in
which one
or more amino acid residues is a synthetic non-naturally occurring amino acid,
such as
a chemical analog of a corresponding naturally occurring amino acid, as well
as to
naturally occurnng amino acid polymers. The invention peptide is the preferred
polypeptide.
-15-
CA 02426371 2003-04-17
WO 02/33049 PCT/USO1/31954
The term "amino acid sequence" as used herein refers to an
oligopeptide, peptide, polypeptide, or protein sequence, and fragments or
portions
thereof, and to naturally occurring or synthetic molecules.
"Identity" or "homology" with respect to the invention peptide is
defined herein as the percentage of amino acid residues in the candidate
sequence that
are identical with the residues in SEQ >D NO: 2 or 14, preferably SEQ ID
N0:14,
corresponding to a homosapien, after aligning the sequences and introducing
gaps, if
necessary, to achieve the maximum percent homology, and not considering any
conservative substitutions as part of the sequence identity. No N- nor C-
terminal
extensions, deletions nor insertions shall be construed as reducing identity
or
homology.
As used herein, a "variant" of the invention peptide refers to a
polypeptide having an amino acid sequence with one or more amino acid
substitutions, insertions, andlor deletions compared to the sequence of the
invention
peptide. Generally, differences are limited so that the sequences of the
reference
(invention peptide) and the variant are closely similar overall, and in many
regions,
identical. Such variants are generally biologically active and necessarily
have less
than 100% sequence identity with the polypeptide of interest.
In a preferred embodiment, the biologically active variant has an amino
acid sequence sharing at least about 70% amino acid sequence identity with the
invention peptide - SEQ ID NO: 14., preferably at least about 75%, more
preferably
at least about 80%, still more preferably at least about 85%, even more
preferably at
least about 90%, and most preferably at least about 95%. Amino-acid
substitutions
are preferably substitutions of single amino-acid residues.
A "fragment" of the invention peptide (reference protein) is meant to
refer to a protein molecule which contains a portion of the complete amino
acid
sequence of the wild type or reference protein.
Complementary DNA clones encoding the invention peptide may be
prepared from the DNA provided. The nucleic acid clones provided herein may be
used to isolate genomic clones encoding the invention peptide and to isolate
any
splice variants by screening libraries prepared from different neural tissues.
Alternatively, the library may be screened with a suitable probe. Thus,
one means of isolating a nucleic acid encoding the invention peptide is to
probe a
mammalian genomic library with a natural or artificially designed nucleic acid
probe
using methods well known in the art. Nucleic acid probes derived from the
invention
16-
CA 02426371 2003-04-17
WO 02/33049 PCT/USO1/31954
peptide encoding genes) are particularly useful for this purpose. Examples of
nucleic
acids are RNA, cDNA, or isolated genomie DNA encoding the invention peptide.
Such nucleic acids may include, but are not limited to, nucleic acids having
substantially the same nucleotide sequence as set forth in SEQ >D NO:1 or one
encoding the amino acid sequence as set forth in SEQ )D NO: 2 or 14,
preferably SEQ
>D NO: 14.
Nucleic acid amplification techniques, which are well known in the art,
can be used to locate splice variants of the invention peptide. This is
accomplished by
employing oligonueleotides based on DNA sequences surrounding divergent
sequences) as primers for amplifying human RNA or genomic DNA. Size and
sequence determinations of the amplification products can reveal the existence
of
splice variants. Furthermore, isolation of human genomic DNA sequences by
hybridization can yield DNA containing multiple exons, separated by introns
that
correspond to different splice variants of transcripts encoding the invention
peptide.
Techniques for nucleic-acid manipulation are described generally in, for
example,
Sambrook, et al. (1989) and Ausubel, et al. (1987, with periodic updates).
Methods
for chemical synthesis of nucleic acids are discussed, for example, in
Beaucage and
Carruthers, Tetra. Letts. 22:1859-1862, 1981, and Matteucci, et al., J. Am.
Chem. Soc.
103:3185 (1981). Chemical synthesis of nucleic acids can be performed, for
example,
on commercial automated oligonucleotide synthesizers.
It has been found that not all hTIP39 encoding nucleic acid molecules
are expressed in all neural tissues or in all portions of the brain. Thus, in
order to
isolate cDNA encoding the invention peptide or its splice variant, it is
preferable to
screen libraries prepared from different neuronal or neural tissues.
As used herein, a "splice variant" refers to variant invention peptide(s)-
encoding nucleic acids) produced by differential processing of primary
transcripts)
of genomic DNA, resulting in the production of more than one type of mRNA.
cDNA
derived from differentially processed primary transcript will encode the
invention
peptides) that have regions of complete amino acid identity and regions having
different amino acid sequences. Thus, the same genomic sequence can lead to
the
production of multiple, related mRNAs and proteins. Both the resulting mRNAs
and
proteins are referred to herein as "splice variants".
As used herein, a nucleic acid "probe" is single-stranded DNA or
RNA, or analog thereof, that has a sequence of nucleotides that includes at
least 14,
preferably at least 20, more preferably at least 50, contiguous bases that are
the same
-17-
CA 02426371 2003-04-17
WO 02/33049 PCT/USO1/31954
as or the complement of any 14 or more contiguous bases set forth in any of
SEQ ID
NO:1. In addition, the entire eDNA encoding region of the invention
polypeptide, or
the entire sequence con-esponding to SEQ B7 NO:1 may be used as a probe.
Presently preferred probe-based screening conditions comprise a
temperature of about 37°C, a formamide concentration of about 20%, and
a salt
concentration of about SX standard saline citrate (SSC; 20X SSC contains 3M
sodium
chloride, 0.3M sodium citrate, pH 7.0). Such conditions will allow the
identification
of sequences which have a substantial degree of similarity with the probe
sequence,
without requiring perfect homology.
Preferably, hybridization conditions will be selected which allow the
identification of sequences having at least 70% homology with the probe, while
discriminating against sequences which have a lower degree of homology with
the
probe. As a result, nucleic acids having substantially the same nucleotide
sequence as
the sequence of nucleotides set forth in SEQ ID NO:1 are obtained.
After screening the library, positive clones are identified by detecting a
hybridization signal; the identified clones are characterized by restriction
enzyme
mapping and/or DNA sequence analysis, and then examined, by comparison with
the
sequences set forth herein, to ascertain whether they include DNA encoding the
entire
invention peptide. If the selected clones are incomplete, they may be used to
rescreen
the same or a different library to obtain overlapping clones. If desired, the
library can
be rescreened with positive clones until overlapping clones that encode an
entire
invention peptide are obtained. If the library is a cDNA library, then the
overlapping
clones will include an open reading frame. If the library is genomic, then the
overlapping clones may include exons and introns. In both instances, complete
clones
may be identified by comparison with the DNA and encoded proteins provided
herein.
Thus, the nucleic acid probes are useful for various applications. On
the one hand, they may be used as PCR primers for amplification of nucleic
acid
molecules according to the invention. On the other hand, they can be useful
tools for
the detection of the expression of molecules according to the invention in
target
tissues, for example, by in-situ hybridization or Northern-Blot hybridization.
The invention probes may be labeled by methods well-known in the
art, as described hereinafter, and used in various diagnostic kits.
A "label" refers to a compound or composition that facilitates detection
of a compound or composition with which it is specifically associated, which
can
include confernng a property that makes the labeled compound or composition
able to
- 18-
CA 02426371 2003-04-17
WO 02/33049 PCT/USO1/31954
bind specifically to another molecule. "Labeled" refers to a compound or
composition
that is specifically associated, typically by covalent bonding but non-
covalent
interactions can also be employed to label a compound or composition, with a
label.
Thus, a label may be detectable directly, i.e., the label can be a
radioisotope (e.g., 3H,
~~C, ~''p, ASS, '251, 13'I) or a fluorescent or phosphorescent molecule (e.g.,
FITC,
rhodamine, lanthanide phosphors), or indirectly, i.e., by enzymatic activity
(e.g.,
horseradish peroxidase, beta-galactosidase, luciferase, alkaline phosphatase)
or by its
ability to bind to another molecule (e.g., streptavidin, biotin, an antigen,
epitope, or
antibody). Incorporation of a label can be achieved by a variety of means,
ie., by use
of radiolabeled or biotinylated nucleotides in polymerase-mediated primer
extension
reactions, epitope-tagging via recombinant expression or synthetic means, or
binding
to an antibody.
Labels can be attached directly or via spacer arms of various lengths,
i.e., to reduce steric hindrance. Any of a wide variety of labeled reagents
can be used
fox purposes of the present invention. For instance, one can use one or more
labeled
nucleoside triphosphates, primers, linkers, or probes. A description of
immunofluorescent analytic techniques is found in DeLuca, "Immunofluorescence
Analysis", in Antibody As a Tool, Marchalonis, et al., eds., John Wiley &
Sons, Ltd.,
pp. 189-231 (1982), which is incorporated herein by reference.
The term label can also refer to a "tag", which can bind specifically to a
labeled molecule. For instance, one can use biotin as a tag and then use
avidinylated
or streptavidinylated horseradish peroxidase (HRP) to bind to the tag, and
then use a
chromogenic substrate (e.g., tetrarnethylbenzamine) to detect the presence of
HRP. In
a similar fashion, the tag can be an epitope or antigen (e.g., digoxigenin),
and an
enzymatically, fluorescently, or radioactively labeled antibody can be used to
bind to
the tag.
Use of the terms "isolated" and/or "purified" in the present
specification and claims as a modifier of DNA, RNA, polypeptides or proteins
means
that the DNA, RNA, polypeptides or proteins so designated have been produced
in
such form by the hand of man, and thus are separated from their native in vivo
cellular
environment. As a result of this human intervention, the recombinant DNAs,
RNAs,
polypeptides and proteins of the invention are useful in ways described herein
that the
DNAs, RNAs, polypeptides or proteins as they naturally occur are not.
Similarly, as used herein, "recombinant" as a modifier of DNA, RNA,
polypeptides or proteins means that the DNA, RNA, polypeptides or proteins so
-19-
CA 02426371 2003-04-17
WO 02/33049 PCT/USO1/31954
designated have been prepared by the efforts of human beings, e.g., by
cloning,
recombinant expression, and the like. Thus as used herein, recombinant
proteins, for
example, refers to proteins produced by a recombinant host, expressing DNAs
which
have been added to that host through the efforts of human beings.
As used herein, "mammalian" refers to the variety of species from
which the invention TIP39 protein is derived, e.g., human, rat, mouse, rabbit,
monkey,
baboon, chicken, bovine, porcine, ovine, canine, feline, and the like. A
preferred
TIP39 protein herein, is human TIP39.
In one embodiment of the present invention, cDNAs encoding the
invention peptide disclosed herein include substantially the same nucleotide
sequence
as set forth in SEQ DJ NO:1. Preferred cDNA molecules encoding the invention
proteins include the same nucleotide sequence as that set forth in SEQ ID
NO:I.
Another embodiment of the invention contemplates nucleic acids)
having substantially the same nucleotide sequence as the reference nucleotide
sequence that encodes substantially the same amino acid sequence as that set
forth in
SEQ ID N0:2 or 14, preferably SEQ TD NO: 14 as it relates to the polypeptide
corresponding to that of a homosapien.
In defining nucleic acid sequences, all subject nucleic acid sequences
capable of encoding substantially similar amino acid sequences are considered
substantially similar or are considered as comprising substantially identical
sequences
of nucleotides to the reference nucleic acid sequence, i.e., human TIP39
encoding
sequence.
In practice, the term "substantially the same sequence" means that
DNA or RNA encoding two proteins hybridize under moderately stringent
conditions
and encode proteins that have the same sequence of amino acids or have changes
in
sequence that do not alter their structure or function.
Nucleotide sequence "similarity" is a measure of the degree to which
two polynucleotide sequences have identical nucleotide bases at corresponding
positions in their sequence when optimally aligned (with appropriate
nucleotide
insertions or deletions). Sequence similarity or percent similarity can be
determined,
for example, by comparing sequence information using sequence analysis
software
such as the the GAP computer program, version 6.0, available from the
University of
Wisconsin Genetics Computer Group (UWGCG). The GAP program utilizes the
alignment method of Needleman and Wunsch (J. Mol. Biol. 48:443, 1970), as
revised
by Smith and Waterman (Adv. Appl. Math. 2:482, 1981).
-20-
CA 02426371 2003-04-17
WO 02/33049 PCT/USO1/31954
As used herein, "substantially identical sequences of nucleotides" share
at least about 90% identity, and substantially identical amino acid sequences
share
more than 95% amino acid identity. It is recognized, however, that proteins
(and
DNA or mRNA encoding such proteins) containing less than the above-described
level of homology arising as splice variants or that are modified by
conservative
amino acid substitutions (or substitution of degenerate codons) are
contemplated to be
within the scope of the present invention.
The present invention also encompasses nucleic acids which differ
from the nucleic acids shown in SEQ ll7 NO:1, but which have the same
phenotype.
Phenotypically similar nucleic acids are also referred to as "functionally
equivalent
nucleic acids".
As used herein, the phrase "functionally equivalent nucleic acids"
encompasses nucleic acids characterized by slight and non-consequential
sequence
variations that will function in substantially the same manner to produce the
same
protein products) as the nucleic acids disclosed herein.
Functionally equivalent sequences will function in substantially the
same manner to produce substantially the same compositions as the nucleic acid
and
amino acid compositions disclosed and claimed herein. In particular,
functionally
equivalent DNAs encode proteins that are the same as those disclosed herein or
that
have conservative amino acid variations, such as substitution of a non-polar
residue
for another non-polar residue or a charged residue for a similarly charged
residue.
These changes include those recognized by those of skill in the art as those
that do not
substantially alter the tertiary structure of the protein.
In particular, functionally equivalent nucleic acids encode polypeptides
that are the same as those disclosed herein or that have conservative amino
acid
variations, or that are substantially similar to one having the amino acid
sequence as
set forth in SEQ ID N0:2 or 14, preferably SEQ ID N0:14.
For example, conservative variations include substitution of a non-
polar residue with another non-polar residue, or substitution of a charged
residue with
a similarly charged residue. These variations include those recognized by
skilled
artisans as those that do not substantially alter the tertiary structure of
the protein.
Further provided are nucleic acids encoding the invention polypeptides
that, by virtue of the degeneracy of the genetic code, do not necessarily
hybridize to
the invention nucleic acids under specified hybridization conditions.
Preferred
nucleic acids encoding the invention polypeptide are comprised of nucleotides
that
-21 -
CA 02426371 2003-04-17
WO 02/33049 PCT/USO1/31954
encode substantially the same amino acid sequence set forth in SEQ ID NO: 2 or
14,
preferably SEQ m N0:14.
Thus, an exemplary nucleic acid encoding an invention polypeptide
may be selected from:
(a) DNA encoding the amino acid sequence set forth in SEQ m NO: 2
or 14, preferably the latter.
(b) DNA that hybridizes to the DNA of (a) under moderately stringent
conditions, wherein said DNA encodes biologically active human TIP39; or
(c) DNA degenerate with respect to either (a) or (b) above, wherein
said DNA encodes biologically active human TIP39.
As used herein, the term "degenerate" refers to codons that differ in at
least one nucleotide from SEQ m NO:1, but encode the same amino acids as that
set
forth in SEQ m NO: 2 or 14, preferably SEQ m N0:14. For example, codons
specified by the triplets "UCU", "UCC", "UCA", and "UCG" are degenerate with
respect to each other since all four of these codons encode the amino acid
serine.
As used herein, the "amino acid sequence" of SEQ m NO: 1 or 2
refers to the deduced amino acid sequence set forth in SEQ m NO: 1 or the
amino
acid sequence set forth in SEQ ID NO: 2 corresponding to humans. Each of the
amino acid sequences are those of the immature protein, i.e., prior to post-
translational modification. Likewise, SEQ m NO: 14 refers to the mature
polypeptide.
Hybridization refers to the binding of complementary strands of
nucleic acid (i.e., sense:antisense strands or probeaarget-DNA) to each other
through
hydrogen bonds, similar to the bonds that naturally occur in chromosomal DNA.
Stringency levels used to hybridize a given probe with target-DNA can be
readily
varied by those of skill in the art.
The phrase "stringent hybridization" is used herein to refer to
conditions under which polynucleic acid hybrids are stable. As known to those
of
skill in the art, the stability of hybrids is reflected in the melting
temperature (T",) of
the hybrids. T,n can be approximated by the formula:
81.5° C.-16.6(loglo [Na+])+0.41(%G+C)-600/1,
where 1 is the length of the hybrids in nucleotides. T", decreases
approximately 1°-1.5° C with every 1°Io decrease in
sequence homology. In general,
the stability of a hybrid is a function of sodium ion concentration and
temperature.
Typically, the hybridization reaction is performed under conditions of lower
-22-
CA 02426371 2003-04-17
WO 02/33049 PCT/USO1/31954
stringency, followed by washes of varying, but higher, stringency. Reference
to
hybridization stringency relates to such washing conditions.
As used herein, the phrase "moderately stringent hybridization" refers
to conditions that permit target-DNA to bind a complementary nucleic acid that
has
about 60% identity, preferably about 75% identity, more preferably about 85%
identity to the target DNA; with greater than about 90% identity to target-DNA
being
especially preferred. Preferably, moderately stringent conditions are
conditions
equivalent to hybridization in 50% formamide, 5X Denhart's solution, 5X SSPE,
0.2%
SDS at 42°C, followed by washing in 0.2X SSPE, 0.2% SDS, at
65°C.
The phrase "high stringency hybridization" refers to conditions that
permit hybridization of only those nucleic acid sequences that form stable
hybrids in
0.018M NaCI at 65°C (i.e., if a hybrid is not stable in 0.018M NaCI at
65°C, it will
not be stable under high stringency conditions, as contemplated herein). High
stringency conditions can be provided, for example, by hybridization in 50%
formamide, 5X Denhart's solution, 5X SSPE, 0.2% SDS at 42°C., followed
by
washing in 0.1X SSPE, and 0.1% SDS at 65°C.
The phrase "low stringency hybridization" refers to conditions
equivalent to hybridization in 10% formamide, 5X Denhart's solution, 6X SSPE,
0.2%
SDS at 42°C., followed by washing in 1X SSPE, 0.2% SDS, at
50°C.
Denhardt's solution and SSPE (see, e.g., Sambrook, Fritsch, and
Maniatis, in: Molecular Cloning, A Laboratory MafZUal, Cold Spring Harbor
Laboratory Press, 1989) are well known to those of skill in the art as are
other suitable
hybridization buffers. For example, SSPE is pH 7.4 phosphate-buffered 0.18M
NaCI.
SSPE can be prepared, for example, as a ZOX stock solution by dissolving 175.3
g of
NaCI, 27.6 g of NaH2P0~ and 7.4 g EDTA in 800 ml of water, adjusting the pH to
7.4, and then adding water to 1 liter. Denhardt's solution (see, Denhardt
(1966)
Biochem. Biophys. Res. Commun. 23:641) can be prepared, for example, as a 50X
stock solution by mixing 5 g Ficoll (Type 400, Pharmacia LKB Biotechnology,
INC.,
Piscataway N.J.), 5 g of polyvinylpyrrolidone, and 5 g bovine serum albumin
(Fraction V; Sigma, St. Louis Mo.), and then adding water to 500 ml and
filtering to
remove particulate matter.
Preferred nucleic acids encoding the invention polypeptide(s) hybridize
under moderately stringent, preferably high stringency, conditions to
substantially the
entire sequence, or substantial portions (i.e., typically at least 15-30
nucleotides) of
the nucleic acid sequence set forth in SEQ m NO:1.
-23-
CA 02426371 2003-04-17
WO 02/33049 PCT/USO1/31954
The invention nucleic acids can be produced by a variety of methods
well-known in the art, e.g., the methods described herein, employing PCR
amplification using oligonucleotide primers from various regions of SEQ ID
NO:1
and the like.
As used herein, "expression" refers to the process by which
polynucleic acids are transcribed into mRNA and translated into peptides,
polypeptides, or proteins. If the polynucleic acid is derived from genomic
DNA,
expression may, if an appropriate eukaryotic host cell or organism is
selected, include
splicing of the mRNA.
An example of the means for preparing the invention polypeptide(s) is
to express nucleic acids encoding the invention polypeptide in a suitable host
cell,
such as a bacterial cell, a yeast cell, an amphibian cell (i.e., oocyte), or a
mammalian
cell, using methods well known in the art, and recovering the expressed
polypeptide,
again using well-known methods. Invention polypeptides can be isolated
directly
from cells that have been transformed with expression vectors comprising
nucleic
acid encoding the invention peptides or fragments/portions thereof.
Incorporation of cloned DNA into a suitable expression vector,
transfection of eukaryotic cells with a plasmid vector or a combination of
plasmid
vectors, each encoding one or more distinct genes or with linear DNA, and
selection
of transfected cells are well known in the art (see, e.g., Sambrook, et al.
(1989)
Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor
Laboratory Press). Suitable means for introducing (transducing) expression
vectors
containing invention nucleic acid constructs into host cells to produce
transduced
recombinant cells (i.e., cells containing recombinant heterologous nucleic
acid) are
well-known in the art (see, for review, Friedmann, 1989, Science, 244:1275-
1281;
Mulligan, 1993, Science, 260:926-932, each of which axe incorporated herein by
reference in their entirety).
Exemplary methods of transduction include, e.g., infection employing
viral vectors (see, e.g., U.S. Pat. No. 4,405,712 and 4,650,764), calcium
phosphate
transfection (U.S. Pat. Nos. 4,399,216 and 4,634,665), dextran sulfate
transfection,
electroporation, lipofection (see, e.g., U.S. Pat. Nos. 4,394,448 and
4,619,794),
cytofection, particle bead bombardment, and the like. The heterologous nucleic
acid
can optionally include sequences which allow for its extrachromosomal (i.e.,
episomal) maintenance, or the heterologous nucleic acid can be donor nucleic
acid
that integrates into the genome of the host. Recombinant cells can then be
cultured
-24-
CA 02426371 2003-04-17
WO 02/33049 PCT/USO1/31954
under conditions whereby the invention peptides) encoded by the DNA is (are)
expressed. Preferred cells include mammalian cells (e.g., HEK 293, CHO and Ltk
cells), yeast cells (e.g., methylotrophic yeast cells, such as Pichia
pastoris), bacterial
cells (e.g., Esclaericlzia coli), and the like.
Suitable expression vectors are well-known in the art, and include
vectors capable of expressing DNA operatively linked to a regulatory sequence,
such
as a promoter region that is capable of regulating expression of such DNA.
Thus, an
expression vector refers to a recombinant DNA or RNA construct, such as a
plasmid,
a phage, recombinant virus or other vector that, upon introduction into an
appropriate
host cell, results in expression of the inserted DNA. Appropriate expression
vectors
are well known to those of skill in the art and include those that are
replicable in
eukaryotic cells and/or prokaryotic cells and those that remain episomal or
those
which integrate into the host cell genome.
Exemplary expression vectors for transformation of E. coli prokaryotic
cells include the pET expression vectors (Novagen, Madison, Wis., see U.S.
Pat. No.
4,952,496), e.g., pETlla, which contains the T7 promoter, T7 terminator, the
inducible
E. coli lac operator, and the lac repressor gene; and pET 12a-c, which
contains the T7
promoter, T7 terminator, and the E. coli ompT secretion signal. Another such
vector
is the pIN-IITompA2 (see Duffaud, et al., Meth. in Enzymology, 153:492-507,
1987),
which contains the lpp promoter, the lacUVS promoter operator, the ompA
secretion
signal, and the lac repressor gene.
Exemplary eukaryotic expression vectors include eukaryotic cassettes,
such as the pSV-2 gpt system (Mulligan, et al., 1979, Nature, 277:108-114);
the
Okayama-Berg system (Mol. Cell Biol., 2:161-170), and the expression cloning
vector
described by Genetics Institute (1985, Science, 228:810-815). Each of these
plasmid
vectors are capable of promoting expression of the invention chimeric protein
of
interest.
As used herein, "heterologous or foreign DNA andlor RNA" are used
interchangeably and refer to DNA or RNA that does not occur naturally as part
of the
genome of the cell in which it is present or to DNA or RNA which is found in a
location or locations in the genome that differ from that in which it occurs
in nature.
Typically, heterologous or foreign DNA and RNA refers to DNA or RNA that is
not
endogenous to the host cell and has been artificially introduced into the
cell.
Examples of heterologous DNA include DNA that encodes the invention peptides.
-25-
CA 02426371 2003-04-17
WO 02/33049 PCT/USO1/31954
In preferred embodiments, DNA is ligated into a vector, and
introduced into suitable host cells to produce transformed cell lines that
express the
invention peptide, or a fragment thereof. The resulting cell lines can then be
produced
in quantity for reproducible quantitative analysis of the effects of drugs on
receptor
function.
In other embodiments, mRNA may be produced by in vitro
transcription of DNA encoding the invention peptide. This mRNA can then be
injected into Xenopus oocytes where the RNA directs the synthesis of the
invention
peptide. Alternatively, the invention-encoding DNA can be directly injected
into
oocytes for expression of a functional invention peptide. The transfected
mammalian
cells or injected oocytes may then be used in the methods of drug screening
provided
herein.
Eukaryotic cells in which DNA or RNA may be introduced include any
cells that are transfectable by such DNA or RNA or into which such DNA or RNA
may be injected. Preferred cells are those that can be transiently or stably
transfected
and also express the DNA and RNA. Presently most preferred cells are those
that can
express recombinant or heterologous human TIP39 encoded by the heterologous
DNA. Such cells may be identified empirically or selected from among those
known
to be readily transfected or injected.
Exemplary cells for introducing DNA include cells of mammalian
origin (e.g., COS cells, mouse L cells, Chinese hamster ovary (CHO) cells,
human
embryonic kidney cells, African green monkey cells and other such cells known
to
those of skill in the art), amphibian cells (e.g., Xenopvs laevis oocytes),
yeast cells
(e.g., Saccharomyces cerevisiae, Picl2ia pastoris), and the like. Exemplary
cells for
expressing injected RNA transcripts include Xenopus laevis oocytes. Cells that
are
preferred for transfection of DNA are known to those of skill in the art or
may be
empirically identified, and include HEK 293; Ltk- cells; COS-7 cells ; and
DG44 cells
(dhrf- CHO cells; see, e.g., Urlaub, et al. (1986) Cell. Molec. Genet.
12:555). Other
mammalian expression systems, including commercially available systems and
other
such systems known to those of skill in the art, for expression of DNA
encoding the
invention peptide provided herein are presently preferred.
Nucleic acid molecules may be stably incorporated into cells or may be
transiently introduced using methods known in the art. Stably transfected
mammalian
cells may be prepared by transfecting cells with an expression vector having a
selectable marker gene (such as, for example, the gene for thymidine kinase,
-26-
CA 02426371 2003-04-17
WO 02/33049 PCT/USO1/31954
dihydrofolate reductase, neomycin resistance, and the like), and growing the
transfected cells under conditions selective for cells expressing the marker
gene. To
produce such cells, the cells should be transfected with a sufficient
concentration of
invention peptide-encoding nucleic acids to form the invention peptides) that
are
encoded by heterologous DNA. The precise amounts and ratios of DNA encoding
the
invention peptides may be empirically determined and optimized for a
particular cells
and assay conditions.
Heterologous DNA may be maintained in the cell as an episomal
element or may be integrated into chromosomal DNA of the cell. The resulting
recombinant cells may then be cultured or subcultured (or passaged, in the
case of
mammalian cells) from such a culture or a subculture thereof. Methods for
transfection, injection and culturing recombinant cells are known to the
skilled
artisan. Similarly, the invention peptides) may be purified using protein
purification
methods known to those of skill in the art. For example, antibodies or other
ligands
that specifically bind to human TIP39 may be used for affinity purification of
the
invention peptide.
In accordance with the above, host cells are transfected with DNA
encoding the invention peptide. Using methods such as northern blot or slot
blot
analysis, transfected cells that contain invention peptide encoding DNA or RNA
can
be selected. Transfected cells can also be analyzed to identify those that
express the
invention peptide. Analysis can be earned out, for example, by measuring the
ability
of cells to bind the PTHZ receptor, or a PTHZ receptor agonist, compared to
the PTHZ
receptor binding ability of untransfected host cells or other suitable control
cells, by
electrophysiologically monitoring the currents through the cell membrane in
response
to invention peptide, and the like.
In particularly preferred aspects, eukaryotic cells which contain
heterologous DNAs express such DNA and form recombinant invention peptide. In
more preferred aspects, recombinant invention peptide activity is readily
detectable
because it is a type that is absent from the untransfected host cell.
As used herein, activity of the invention peptide refers to any activity
characteristic of human TIP39. Such activity can typically be measured by one
or
more in vitro methods, and frequently corresponds to an ijz vivo activity of
human
TIl'39. Such activity may be measured by any method known to those of skill in
the
art, such as, for example, assays that measure parathyroid hormone-2 receptor
binding
and cAMP levels.
-27-
CA 02426371 2003-04-17
WO 02/33049 PCT/USO1/31954
The invention peptide, biologically active fragments, and functional
equivalents thereof can also be produced by chemical synthesis. For example,
synthetic polypeptides can be produced using Applied Biosystems, Inc. Model
430A
or 431A automatic peptide synthesizer (Foster City, Calif.) employing the
chemistry
provided by the manufacturer.
The present invention also provides compositions containing an
acceptable carrier and any of an isolated, purified invention polypeptide, an
active
fragment thereof, or a purified, mature protein and active fragments thereof,
alone or
in combination with each other. These polypeptides or proteins can be
recombinantly
derived, chemically synthesized or purified from native sources.
As used herein, the term "acceptable carrier" encompasses any of the
standard pharmaceutical carriers, such as phosphate buffered saline solution,
water
and emulsions such as an oil/water or water/oil emulsion, and various types of
wetting
agents.
Also provided are antisense oligonucleotides having a nucleotide
sequence capable of binding specifically with any portion of an mRNA that
encodes
the invention peptide so as to prevent translation of the mRNA. The antisense
oligonucleotide may have a sequence capable of binding specifically with any
portion
of the sequence of the cDNA encoding the invention polypeptides.
In accordance with yet another embodiment of the present invention,
there are provided anti-human TIP39 antibodies having specific affinity for
the
invention peptides. Active fragments of antibodies are encompassed within the
definition of "antibody"'.
Invention antibodies can be produced by methods known in the art
using invention polypeptides, proteins or portions thereof as antigens. For
example,
polyclonal and monoclonal antibodies can be produced by methods well known in
the
art, as described, for example, in Harlow and Lane, Antibodies: A Laboratory
Manual
(Cold Spring Harbor Laboratory (1988)), which is incorporated herein by
reference.
Invention polypeptides can be used as immunogens in generating such
antibodies.
Alternatively, synthetic peptides can be prepared (using commercially
available
synthesizers) and used as immunogens. Amino acid sequences can be analyzed by
methods well known in the art to determine whether they encode hydrophobic or
hydrophilic domains of the corresponding polypeptide. Altered antibodies such
as
chimeric, humanized, CDR-grafted or bifunctional antibodies can also be
produced by
methods well known in the art. Such antibodies can also be produced by
hybridoma,
-28-
CA 02426371 2003-04-17
WO 02/33049 PCT/USO1/31954
chemical synthesis or recombinant methods described, for example, in Sambrook,
et
al., supra., and Harlow and Lane, supra. Both anti-peptide and anti-fusian
protein
antibodies can be used. (see, for example, Bahouth, et al., Trends
Plaarrnacol. Sci.
12:338 ( 1991); Ausubel, et al., Cccrrent Protocols ira Moleccclar Biology
(John Wiley
and Sons, N.Y. (1989) which are incorporated herein by reference).
Antibody so produced can be used, inter alia, in diagnostic methods
and systems to detect the level of the invention peptides) present in a
mammalian,
preferably human, body sample, such as tissue.
Such antibodies can also be used for the immunoaffinity or affinity
chromatography purification of the invention polypeptide. In addition, methods
are
contemplated herein for detecting the presence of invention polypeptides on
the
surface of a cell comprising contacting the cell with an antibody that
specifically binds
to invention polypeptides, under conditions permitting binding of the antibody
to the
polypeptides, detecting the presence of the antibody bound to the cell, and
thereby
detecting the presence of invention polypeptides on the surface of the cell.
With
respect to the detection of such polypeptides, the antibodies can be used for
in vitro
diagnostic or in vivo imaging methods.
Immunological procedures useful for in vitro detection of invention
polypeptides in a sample include immunoassays that employ a detectable
antibody.
Such immunoassays include, for example, ELISA, Pandex microfluorimetric assay,
agglutination assays, flow cytometry, serum diagnostic assays and
immunohistochemical staining procedures, which are well known in the art. An
antibody can be made detectable by various means well known in the art. For
example, a detectable marker can be directly or indirectly attached to the
antibody.
Useful markers include, for example, radionucleotides, enzymes, fluorogens,
chromogens and chemilumineseent labels.
The above referenced anti-human TIP39 antibodies can also be used to
modulate the activity of the invention peptide in living animals, in humans,
or in
biological tissues isolated therefrom. Accordingly, compositions comprising a
carrier
and an amount of an antibody having specificity for the invention peptide
effective to
block naturally occurring T1P39 or other ligands from binding to PTHZ receptor
are
contemplated herein. For example, a monoclonal antibody directed to an epitope
of
the invention peptide molecule and having an amino acid sequence substantially
the
same as an amino acid sequence as shown in SEQ ID NO: may be useful for
blocking
binding of the invention polypeptide to human PTHz receptor.
-29-
CA 02426371 2003-04-17
WO 02/33049 PCT/USO1/31954
"Immunologically active fragment(s)" of the invention peptides are
also embraced by the invention. Such fragments are those proteins that are
capable of
raising human TIP39-specific antibodies in a target immune system (e.g.,
murine or
rabbit) or of competing with human TIP39 for binding to hTIP39-specific
antibodies,
and is thus useful in immunoassays for the presence of human TIP39 peptides in
a
biological sample. Such immunologically active fragments typically have a
minimum
size of 8 to 11 consecutive amino acids of a native human TIP39 peptide.
The present invention further provides transgenic non-human
mammals that are capable of expressing exogenous nucleic acids encoding the
invention peptides. As employed herein, the phrase "exogenous nucleic acid"
refers
to nucleic acid sequence which is not native to the host, or which is present
in the host
in other than its native environment (e.g., as part of a genetically
engineered DNA
construct). A transgenic mouse expressing exogenous invention nucleic acid
encoding the invention peptide is particularly preferred.
Animal model systems which elucidate the physiological and
behavioral roles of the invention peptides are also contemplated, and may be
produced
by creating transgenic animals in which the expression of the invention
peptide is
altered using a variety of techniques. Examples of such techniques include the
insertion of normal or mutant versions of nucleic acids encoding the invention
polypeptide by microinjection, retroviral infection or other means well known
to those
skilled in the art, into appropriate fertilized embryos to produce a
transgenic animal
(Hogan, et al., Manipulating the Mouse Embryo: A Laboratory Manual (Cold
Spring
Harbor Laboratory, (1986)).
Invention nucleic acids, oligonucleotides (including antisense), vectors
containing same, transformed host cells, polypeptides and combinations
thereof, as
well as antibodies of the present invention, can be used to screen compounds
in vitro
to determine whether a compound functions as a potential agonist or antagonist
to
invention peptides.
These in vitro screening assays provide information regarding the
function and activity of invention peptides, which can lead to the
identification and
design of compounds that are capable of specific interaction with native human
TIP39
or the human PTHz receptor.
Accordingly, a method for identifying compounds, which bind to the
invention peptides) are also contemplated by the present invention. The
invention
peptide may be employed in a competitive binding assay. Such an assay can
-30-
CA 02426371 2003-04-17
WO 02/33049 PCT/USO1/31954
accommodate the rapid screening of a large number of compounds to determine
which compounds, if any, are capable of binding to invention peptide.
Subsequently,
more detailed assays can be carried out with those compounds found to bind, to
further determine whether such compounds act as modulators, agonists or
antagonists
of invention peptide.
In accordance with another embodiment of the present invention,
transformed host cells that recombinantly express the PTHZ receptor can be
contacted
with a test compound, and the modulating effects) thereof can then be
evaluated by
comparing the invention peptide-mediated response (e.g., via measurement of
second
messenger activity/cAMP activity) in the presence and absence of the test
compound,
or by comparing the response of test cells or control cells, i.e., cells that
do not
express the invention peptides to the presence of the compound.
As used herein, a compound or a signal that "modulates the activity" of
invention peptide refers to a compound or a signal that alters the activity of
invention
peptide so that the activity of the invention peptide is different in the
presence of the
compound or signal than in the absence of the compound or signal. In
particular, such
compounds or signals include agonists and antagonists. Such activity is
generally
detected by measuring cAMP levels.
The term "agonist" refers to a substance or signal, such as the
invention peptide, that activates receptor function; and the term
°'antagonist" refers to
a substance that interferes with receptor function. Typically, the effect of
an
antagonist is observed as a blocking of activation by an agonist. Antagonists
include
competitive and non-competitive antagonists. A competitive antagonist (or
competitive blocker) interacts with or near the site specific for the agonist
(e.g., ligand
or neurotransmitter) for the same or closely situated site. A non-competitive
antagonist or Mocker inactivates the functioning of the receptor by
interacting with a
site other than the site that interacts with the agonist.
As understood by those of skill in the art, assay methods for identifying
compounds that modulate invention peptide activity generally require
comparison to a
control. One type of a "control" is a cell or culture that is treated
substantially the
same as the test cell or test culture exposed to the compound, with the
distinction that
the "control" cell or culture is not exposed to the compound. For example, in
methods
that use voltage clamp electrophysiological procedures, the same cell can be
tested in
the presence or absence of compound, by merely changing the external solution
bathing the cell. Another type of "control" cell or culture may be a cell or
culture that
-31 -
CA 02426371 2003-04-17
WO 02/33049 PCT/USO1/31954
is identical to the transfected cells, with the exception that the "control"
cell or culture
do not express the invention peptide, but like the transfected cell expresses
a
functional human PTHZ receptor. Accordingly, the response of the transfected
cell to
compound is compared to the response (or lack thereof) of the "control" cell
or culture
to the same compound under the same reaction conditions.
In yet another embodiment of the present invention, the activation of
invention peptides can be modulated by contacting the polypeptides with an
effective
amount of at least one compound identified by the above-described bioassays.
An alternative method contemplates contacting a cell expressing a
PTH~ receptor with a test compound in the presence of the invention peptide,
and
determining the effect of the test compound by measuring level of cAMP as a
measure
of the modulating effect of the test compound on PTHz receptor activity,
wherein an
increase in CAMP levels is indicative of the modulating effects of the test
compound
on the PTHZ receptor (agonist), i.e., opening of the PTHZ receptor, while a
decrease
reflects the opposite (antagonist).
In accordance with another embodiment of the present invention, there
are provided methods for diagnosing disease states characterized by abnormal
signal
transduction. For example, a sample can be obtained from a patient believed to
be
suffering from a pathological disorder characterized by dysfunctional signal
transduction, and contacted with a nucleic acid probe having a sequence of
nucleotides that are substantially homologous to the nucleotide sequence set
forth in
one of SEQ ID NO:1. Binding of the probe to any complimentary mRNA present in
the sample can be determined and is indicative of the regression, progression
or onset
of such a pathological disorder in the patient.
Alternatively, the patient sample can be contacted with a detectable
probe that is specific for the gene product of the invention nucleic acid
molecule ,
under conditions favoring the formation of a probe/gene product complex. The
presence of the complex is indicative of the regression, progression or onset
of said
pathological disorder in the patient.
In accordance with another embodiment of the present invention, there
are provided diagnostic systems, preferably in kit form, comprising at least
one
invention nucleic acid in a suitable packaging material. The diagnostic
nucleic acids
are derived from the invention peptide-encoding nucleic acids described
herein. In
one embodiment, for example, the diagnostic nucleic acids are derived from SEQ
ID
NO:1. Invention diagnostic systems are useful for assaying for the presence or
-32-
CA 02426371 2003-04-17
WO 02/33049 PCT/USO1/31954
absence of nucleic acid encoding the invention peptide in either genomic DNA
or in
transcribed nucleic acid (such as mRNA or cDNA) encoding the invention
peptide.
A suitable diagnostic system includes at least one invention nucleic
acid, preferably two or more invention nucleic acids, as a separately packaged
chemical reagents) in an amount sufficient for at least one assay.
Instructions for use
of the packaged reagent are also typically included. Those of skill in the art
can
readily incorporate invention nucleic probes and/or primers into kit form in
combination with appropriate buffers and solutions for the practice of the
invention
methods as described herein.
"Treatment" refers to both therapeutic treatment and prophylactic or
preventative measures. Those in need of treatment include those already with
the
disorder as well as those prone to have the disorder or those in which the
disorder is to
be prevented.
A "disorder" is any condition that would benefit from treatment with
the invention peptide of the invention. This includes chronic and acute
disorders or
diseases including those pathological conditions which predispose the mammal
to the
disorder in question. Disorders include, but are not limited to, those of the
cardiovascular system, the nervous system and those involving pain perception.
As used herein, "functional" with respect to a recombinant or
heterologous human TIP39 means that the peptide exhibits an activity attending
native
human TIP39 as assessed by any in vitro or ifz vivo assay disclosed herein or
known to
those of skill in the art. Possession of any such activity that may be
assessed by any
method known to those of skill in the art and provided herein is sufficient to
designate
a peptide as functional. Such activity may be detected as noted ,rupra.
Having described preferred embodiments of the invention with
reference to the accompanying drawings, it is to be understood that the
invention is
not limited to those precise embodiments, and that various changes and
modifications
may be effected therein by one skilled in the art without departing from the
scope or
spirit of the invention as defined in the appended claims.
EXAMPLE 1
Isolation of DNA Encoding Human tuberoinfundibular peptide of 39 residues
DNA Encoding a human tuberoinfundibular peptide of 39
residues
-33-
CA 02426371 2003-04-17
WO 02/33049 PCT/USO1/31954
A. Cloning of human TIP39 cDNA
A cDNA fragment specific to human TIP39 was generated by
PCR amplification of human hypothalamus cDNA. The following degenerate
oligonucleotide primers were utilized to generate a fragment for plasmid
subcloning:
Hw37 [TIGCIGA(T/C)GA(T/C)GCIGCITTCCG] (SEQ ID N0:4) and
Hw39 [TCIA(AlG)IACIA(A/G)IA(A/G)IA(A/G)(C/T)TTGTGCAT]
(SEQ ID N0:5).
The resulting 98 by fragment was subcloned into the PCRII vector as
described by the manufacturer and sequenced. Sequence analysis indicated that
the
fragment encodes a peptide that aligns with bovine T1P39 peptide between
positions
5-36. The sequence information obtained from this clone was utilized to design
the
following oligonucleotide primer pair, which should yield a PCR fragment of
approximately 70 bp:
Hw60 (TGCATGTACGAGTTCAGCCAGTGG) (SEQ ID N0:6) and
KBO1 (CTTCCGGGAGCGCGCGCGGTTG) (SEQ ID N0:7).
The Hw60 and KBO1 primers were used to screen a human fetal brain
stem cDNA library (Incyte/Genomic Systems). Two identical clones were
identified
and sequenced. The DNA sequence and deduced amino acid sequence of the
precursor of TIP39 is shown in Fig. 1.
B. Cloning of mouse TIP39 cDNA
To clone mouse TIP39, a genomic clone homologous to human
TIP39 was obtained and the region that contains TIP39 was sequenced. Primers
derived from mouse genomic sequence were used to screen a mouse brain stem
cDNA
library (Incyte/Genomic Systems).
HS05: CTAGCTGACGACGCGGCCTTC (SEQ ID N0:8)
HS07: GGGCGCGTCCAGTAGCAACAGC (SEQ ID N0:9)
Two identical clones were obtained and sequenced. Amino acid
sequence of the precursor of mouse TIP39 is homologous to Human TIP39. The
predicted sequences of the prepolypeptide and mature peptide (double-
underlined) are
shown in Fig. 2.
C. PCR amplification of rat TIP39.
Rat TIP39 gene was PCR amplified from rat brain cDNA using
primers derived from mouse cDNA.
HS 16: CTTGGGTAGCCCCCTGTCTCGG (SEQ ID NO:10)
HS07: GGGCGCGTCCAGTAGCAACAGC (DEQ ID N0:9)
-34-
CA 02426371 2003-04-17
WO 02/33049 PCT/USO1/31954
The alignment of mature human, bovine, rat and mouse TIP39 peptide
sequence is shown in Fig. 3.
Recombinant cell lines generated by transfection with DNA encoding
human TIP39 can be further characterized using one or more of the following
methods.
(a) Northern or slot blot analysis for expression of human
tuberoinfundibular peptide of 39 residues encoding messages
(b) Immunostaining with a TIP39 specific antibody or
measuring cAMP production.
EXAMPLE 2
Functional assays involving TIP39 in activation of its receptor
1. Establishment of cell lines that stably express rat and human
PTHZR.
HEK293 cells were transfected with rat and human PTH2R and cell
lines that stably express the receptors were established and evaluated. One
cell line
was selected for each rat and human PTHZR and used for all the functional
assays.
Specifically, HEK293 cells were transfected with pCDNA3.1/V5-His-RatPTH2R
plasmid DNA and pCDNA3.1 E/Uni-lacZ-HumanPTH2R plasmid DNA using
FuGENE 6 transfection reagent (Roche Molecular Biochemicals). Three days after
transfection, cells were put under selection with 800pg/ml geneticin (G418,
Gibco
BRL). After three weeks of selection, single colonies were cloned using
cloning
cylinders. Cloned colonies were scaled up to T25 flasks. More than 10 cell
lines for
each plasmid were tested for function in the cAMP SPA assay. One cell line per
plasmid was chosen for further characterization based on the cyclase assay
results.
2. cAMP SPA Assay for PTHZR activation
HEK293PTHZR cells were seeded in a 96-well poly-D-lysine coated
plate at 100,000 cells per well and cultured overnight. After washing with 200
p1 of
PBS and treating with 100 ttl of 300 nM IBMX in assay medium (MEM without
phenol red and FBS) at 37°C for 10 min. The assay medium was then
aspirated and
the cells were washed with PBS. The cellular of cAMP was measured using cAMP
SPA Direct Screening (Amersham/Pharmacia RPA559). Each concentration of ligand
-35-
CA 02426371 2003-04-17
WO 02/33049 PCT/USO1/31954
was repeated as triplicate. The dose-response curves of the ligands on HEK293
cells
stably transfected with rat and human PTHZR are shown in Figure 4A and Figure
4B,
respectively.
Results: In order to test cAMP response in HEK293 cells stably
transfected with rat and human PTHZR, the level of CAMP upon stimulation with
an
agonist peptide in HEK 293 cells expressing rat PTHZR was measured. Positive
responses were observed when cells expressing the rat PTH cells were
stimulated with
Human TIP39, mouse TILP39, human PTH (1-34) and rat PTH(1-34) i.e., an
increase
in the level of cAMP to about the same maximal level ( up to 29 pmol/100,000
cells).
The increase in cAMP was dose-dependent and is depicted in Fig.4A. The logEC50
for HumanTIP39, Mouse TIP39, human PTH(1-34) and rat PTH(1-34) are -9.7~0.2, -
9.9~0.1. -9.3~0.2 and -10.3~0.5, respectively (mean~S.D., n= 3-7). The
response
with human PTH(1-34) appears to be slightly less potent as shown in Fig. 4A.
A similar increase in CAMP level upon stimulation with these peptides
in HEK293 cells that expresses human PTH2R was also observed. The maximal
response reached 25 pmol/100,000 cells. The potency of these peptides appeared
to
be similar to that detected in cells expressing rat PTH2R. logEC50 for Human
TIP39,
mouse T1P39, Human PTH(1-34) and rat PTH(1-34) in HEK293 cells that expressed
human PTHZR was recorded as follows: -9.7~0.2,-9.7~0.3, -9.1~0.2 and -9.8~0.4,
respectively(mean~S.D, n= 4-7) . Again, human PTH(1-34) appeared to be
slightly
less potent than the other peptides (Fig. 4B).
3. Measurement of [Ca2+]i using the FLIPR
HEK293 cells were seeded into black walnut clear-base 96 well plates
(BD Biocoat) coated with poly-D-lysine at a density of 100,000 cells per well
in
MEM, and cultured overnight. The cells were then washed two times with 1XHBSS
buffer (1X Hank's balanced Salt Solution (Life Technologies), 20mM HEPES, 2mM
Calcium Chloride, 0.12mM probenecid (Sigma, (710mg/5m1 1N NaOH)), then loaded
with loading buffer (HBSS+10°7oFBS+4uM Fluo-3AM cell permeant Molecular
Probes) at 37°C for 60 min. The cells were washed two times with 1XHBSS
buffer.
The plates were then placed into a FLIPR (Molecular Devices) to monitor cell
fluorescence (ex=488 nM, EM=540 nM) before and after the addition of various
agonists for 3 minutes. Responses were measured as peak fluorescence intensity
(FI)
minus basal FI, and where appropriate were expressed as a percentage of a
maximum
human TIP39-induced response.
-36-
CA 02426371 2003-04-17
WO 02/33049 PCT/USO1/31954
Curve-fitting and parameter estimation were carried out using Graph
Pad Prism, 3.00 (GraphPad Software Inc., California, U.S.A.). The dose-
response
curves for variaus ligand on the rat and human PTHZR cell lines are shown in
Fig. 5A
and Fig. 5B, respectively.
Results: Overall, human TIP39 caused an increase in intracellular
calcium concentration. Importantly, human TIP39 caused an increase in [Caz+]i
in
HEK293 that expresses rat PTHZR, which was typified by initially rapid onset
(peak
~20S), followed by a rapidly declining secondary phase, returning to baseline
level
within 80S (data not shown). Mouse TIP39 also increased [Ca2+]i with similar
kinetics.
When measuring the peak fluorescence change upon stimulation with
human TiP39, mouse TIP39, Human PTH(1-34) and rat PTH(1-34), - Human and
Mouse TTP39 were observed to be agonist compared to rat PTH and human PTH.
Maximum response from rat PTH was ca 30% compared to that of human TIP39 on
rat PTHZR expressing cells. Human PTH(1-34) was found to elicit little
response if
any.
All agonist-induced responses were concentration-dependent (Figure
5A). The logEC50 for human TIl'39, mouse TIP39, and rat PTH(1-34) on HEK293
cells that express rat PTHZR were observed to be -7.2~0.1, -7.3~0.1 and -
7.4~0.1,
respectively (mean~S.D, n= 4-5). A similar rapid rise in intracellular calcium
in
HEK293 cells that expresses human PTHZR was also observed. The data suggest
that
Human TIP39 and mouse TIP39 are full agonists in comparison to the rat and
human
PTH. Human PTH(1-34) appeared to elicit little response. Maximum response
elicited
by rat PTH(1-34) was 42~2% compared to that elicited by human TIP39. The
logEC50 for human TIP39, mouse TIP39, and rat PTH(1-34) are -7.6~0.1, -
7.8~0.2,
and -7.3~0.1 respectively (mean~S.D., n= 4-5) (Fig. 5B).
While the invention has been described in detail with reference to
certain preferred embodiments thereof, it will be understood that
modifications and
variations are within the spirit and scope of that which is described and
claimed.
Summary of Sequences
Sequence ID No. 1 is a nucleotide sequence encoding a human
tuberoinfundibular peptide of 39 residues and the deduced amino acid sequence
of the
human tuberoinfundibular peptide of 39 residues (TIP39) (prepolypeptide).
-37-
CA 02426371 2003-04-17
WO 02/33049 PCT/USO1/31954
Sequence ID No. 2 is the amino acid sequence of the prepolypeptide
human tuberoinfundibular peptide of 39 residues prepolypeptide(TIP39) The
mature
polypeptide is doubleunderlined.
Sequence >D No. 3 is the amino acid sequence of mouse
tuberoinfundibular peptide of 39 residues (TIP39).
Sequence ID No. 11 is the amino acid sequence of a mature rat
tuberoinfundibular peptide of 39 residues (TIP39).
Sequence >D No. 12 is the amino acid sequence of a mature bovine
tuberoinfundibular peptide of 39 residues (TIP39).
Sequence ID No. 13 is the amino acid sequence of a mature mouse
tuberoinfundibular peptide of 39 residues.
Sequence ID No. 14 is the amino acid sequence of a mature human
tuberoinfundibular peptide of 39 residues (hTIP39).
-38-
CA 02426371 2003-04-17
WO 02/33049 PCT/USO1/31954
SEQUENCE LISTTNG
<110> Merck & Co., Inc.
<120> ISOLATED NUCLEIC ACID MOLECULES ENCODING
HUMAN TUBEROINFUNDIBULAR PEPTIDE OF 39 RESIDUES, ENCODED
PROTEIN, CELLS TRANSFORMED THEREWITH AND USES THEREOF
<130> 20733Y PCT
<150> 60/241,012
<151> 2000-10-17
<160> 14
<170> FastSEQ for Windows Version 4.0
<210> 1
<211> 572
<212> DNA
<213> Human
<220>
<221> CDS
<222> (209)...(509)
<400> 1
ttggtcccaa ttagttggtg cagcggcagg ttccccccac
ccccggctcc60
gcggccaagc
tcattaccgc tggcggctcc ggggag ggggtgaccccggc
gtccccggcc120
taatgagcct
ccccggcctg cgtcactgcc tgcggaggcgatataagg
gggctgccac180
cggtgcgggg
gc
catcgctgcc ccagcccact tg gagacccgc tcc agg 232
gcacggtg cag
a gtg
Met GluThrArg Ser Arg
Gln
Val
1 5
agccct cgggttcgg ctgctgctg ctgctgctgctg ctg gtg gtg 280
ctg
SerPro ArgValArg LeuLeuLeu LeuLeuLeuLeu Leu Val Val
Leu
15 20
ccctgg ggcgtccgc actgcctcg ggagtcgccctg ccc gtc ggg 328
ccg
ProTrp GlyValArg ThrAlaSer GlyValAlaLeu Pro Val Gly
Pro
25 30 35 40
gtcctc agcctccgc cccccagga cgggcctgggcg gat gcc acc 376
ccc
ValLeu SerLeuArg ProProGly ArgAlaTrpAla Asp Ala Thr
Pro
45 50 55
cccagg ccgcggagg agcctggcg ctggcggacgac gcg ttc cgg 424
gcc
ProArg ProArgArg SerLeuAla LeuAlaAspAsp Ala Phe Arg
Ala
60 65 70
gagcgc gcgcggttg ctggccgcc ctcgagcgccgc cac ctg aac 472
tgg
GluArg AlaArgLeu LeuAlaAla LeuG1uArgArg His Leu Asn
Trp
75 80 85
tcgtac atgcacaag ctgctggtg ttggatgcgccc t gagcgcgctg 519
SerTyr MetHisLys LeuLeuVal LeuAspAlaPro
90 95 100
cccgtcccca tcttaataaa gaccatgccc tgcgcaaaaa aaaaaaaaaa aaa 572
<210> 2
CA 02426371 2003-04-17
WO 02/33049 PCT/USO1/31954
<211> 100
<212> PRT
<213> Human
<400> 2
Met Glu Thr Arg Gln Val Ser Arg Ser Pro Arg Va1 Arg Leu Leu Leu
1 5 10 15
Leu Leu Leu Leu Leu Leu Val Val Pro Trp Gly Val Arg Thr Ala Ser
20 25 30
Gly Val Ala Leu Pro Pro Val Gly Val Leu Ser Leu Arg Pro Pro Gly
35 40 45
Arg A1a Trp Ala Asp Pro Ala Thr Pro Arg Pro Arg Arg Ser Leu A1a
50 55 60
Leu Ala Asp Asp Ala Ala Phe Arg G1u Arg Ala Arg Leu Leu Ala Ala
65 70 75 80
Leu G1u Arg Arg His Trp Leu Asn Ser Tyr Met His Lys Leu Leu Val
85 90 95
Leu Asp Ala Pro
100
<210> 3
<211> 100
<212> PRT
<213> Mouse
<400> 3
Met Glu Thr Cys Gln Met Ser Arg Ser Pro Arg Glu Arg Leu Leu Leu
2 5 10 15
Leu Leu Leu Leu Leu Leu Leu Val Pro Trp Gly Thr Gly Pro A1a Ser
20 25 30
Gly Val Ala Leu Pro Leu Ala Gly Val Phe Ser Leu Arg Ala Pro Gly
35 40 45
Arg A1a Trp Ala G1y Leu Gly Ser Pro Leu Ser Arg Arg Ser Leu Ala
50 55 60
Leu A1a Asp Asp Ala Ala Phe Arg Glu Arg Ala Arg Leu Leu Ala Ala
65 70 75 80
Leu Glu Arg Arg Arg Trp Leu Asp Ser Tyr Met Gln Lys Leu Leu Leu
85 90 95
Leu Asp Ala Pro
100
<210> 4
<211> 20
<212> DNA
<213> Primer
<400> 4
tgcgatcgat cgcgcttccg 20
<210> 5
<211> 26
<212> DNA
<213> Primer
<400> 5
tcaagacaag aagaagcttt gtgcat 2~
<210> 6
<211> 24
<212> DNA
<213> Primer
CA 02426371 2003-04-17
WO 02/33049 PCT/USO1/31954
<400> 6
tgcatgtacg agttcagccagtgg 24
<210> 7
<211> 22
<212> DNA
<213> Primer
<400> 7
cttccgggag cgcgcgcggttg 22
<210> 8
<211> 21
<212> DNA
<213> Primer
<400> 8
ctagctgacg acgcggccttc 21
<210> 9
<211> 22
<212> DNA
<213> Primer
<400> 9
gggcgcgtcc agtagcaacagc 22
<210> 10
<211> 22
<212> DNA
<213> Primer
<400> 10
cttgggtagc cccctgtctc gg 22
<210> 11
<211> 39
<212> PRT
<213> Rat
<400> 11
Ser Leu Ala Leu Ala Asp Asp Ala Ala Phe Arg Glu Arg Ala Arg Leu
1 5 10 15
Leu A1a A1a Leu Glu Arg Arg Arg Trp Leu Asp Ser Tyr Met Gln Lrys
20 25 30
Leu Leu Leu Leu Asp A1a Pro
<210> 12
<211> 39
<212> PRT
<213> Bovine
<400> 12
Ser Leu Ala Leu Ala Asp Asp A1a A1a Phe Arg Glu Arg Ala Arg T~eu
1 5 10 15
T~eu A1a Ala Leu Glu Arg Arg ~Iis Trp Beu Asn Ser Tyr Met His Lys
20 25 30
Leu Leu Val Leu Asp Ala Pro
<210> 13
.-3_
CA 02426371 2003-04-17
WO 02/33049 PCT/USO1/31954
<211> 39
<212> PRT
<213> Mouse
<400>
13
Ser Leu Leu AlaAsp AspAla PheArgGluArg AlaArg Leu
A1a Ala
1 5 10 25
Leu Ala Leu GluArg ArgArg LeuAspSerTyr MetGln Lys
Ala Trp
20 25 30
Leu Leu Leu AspAla Pro
Leu
35
<210>
14
<211>
39
<212>
PRT
<213>
Human
<400>
14
Ser Leu Leu AlaAsp AspAla PheArgfluArg AlaArg Leu
A1a Ala
1 5 10 15
Leu Ala Leu GluArg ArgHis LeuAsnSerTyr MetHis Lys
Ala Trp
20 25 30
Leu Leu Leu AspAla Pro
Val
35
_4
