Note: Descriptions are shown in the official language in which they were submitted.
CA 02426812 2003-04-24
WO 02/34947 PCT/USO1/32630
DETECTING SPECIFIC NUCLEOTIDE SEQUENCES
This application claims the priority benefit of U.S. provisional patent
application
serial No. 60/242,672, filed October 24, 2000.
FIELD OF THE INVENTION
The present invention broadly concerns methods for detecting specific
nucleotide
sequences. More particularly, the present invention relates to methodology in
which the
detection of a signal from an oligonucleotide that is labeled with a molecular
energy transfer
(MET) pair, including an energy donor and an energy acceptor, indicates the
presence of a
specific nucleotide sequence in a sample. The methodology has enough
sensitivity to
distinguish a single nucleotide in the context of other nucleotides. Thus, the
invention also
concerns detection of nucleic acid polymorphisms, such as single nucleotide
polymorphisms
{SNPs).
BACKGROUND OF THE INVENTION
Certain identifying nucleotide sequences in genes suggest the presence of
disease, a
susceptibility to disease, or a phenotype. These identifying sequences may
represent
spontaneous changes in a particular gene (e.g., mutations) of an individual or
may represent a
difference between forms of a gene (e.g., alleles) that persist in a
population. The changes or
differences may occur at several nucleotides in a gene or may occur at a
single nucleotide.
Single-nucleotide changes or differences represent greater challenges for
detection systems.
An identifying sequence that distinguishes between alleles of a gene is said
to
characterize a "single-nucleotide polymorphism" or SNP, when the difference in
question
resides at one nucleotide position. Single nucleotide changes have been shown
to give rise to
a variety of genetic diseases. For example, sickle cell anemia is caused by
the transversion of
an adenine residue to a thymine residue in the sixth codon of the human (3-
globin gene. This
transversion results in the substitution of a valine residue fox a glutamate
residue in the (3-
globin subunit of hemoglobin, causing a reduced solubility of the
deoxyhemoglobin molecule
and, in turn, a "sickling" of affected red blood cells. The sickled red blood
cells become
trapped in the microcirculation and cause damage to multiple organs.
Kan et czt., Lcancet 2: 910-12 {1978), were the first to describe the
diagnosis of sickle
cell anemia by examining DNA from affected individuals, based on the linkage
of the sickle
_1_
CA 02426812 2003-04-24
WO 02/34947 PCT/USO1/32630
cell allele to a HpaI restriction fragment length polymorphism. Later, Geever
et al., Proc.
Nat'l Acad. Sci. USA 78: 5081-85 (1982), and Chang et al., New England J. Med.
307: 30-32
( 1982), demonstrated that the mutation in question affected the cleavage site
of both DdeI
and MstII and, therefore, could be detected directly by restriction enzyme
cleavage. Conner
et al., Proc. Nat'l Acczcl. Sci. USA 80: 278-82 ( 1983), described a more
general approach to
the direct detection of single-nucleotide variation, by the use of sequence-
specific
oligonucleotide hybridization. In this method, a short synthetic
oligonucleotide probe
hybridizes, under appropriate conditions, to only one allele.
All of these approaches are slow, technically challenging and require
reasonably large
amounts of DNA.
The polymerise chain reaction (PGR), developed by Saiki et al., Science 230:
1350-
54 (1985), allowed for rapid amplification of a small amount of a target DNA.
PCR utilizes
two oligonucleotide primers that anneal to opposing strands of DNA at
positions spanning a
sequence of interest. A DNA polymerise, such as the Klenow fragment of E. coli
DNA
polymerise I (Saiki et al. ( 1985), ,ruprcz) or Thermus aquaticus DNA
polymerise (Saiki et al.,
Science 239: 487-91 (1988)), is used for sequential rounds of template-
dependent synthesis of
the DNA sequence. Prior to the initiation of each new round, the DNA is
denatured and fresh
enzyme is added, in the case of the E. coli enzyme. In this manner,
exponential amplification
of the target sequences is achieved.
The resultant amplified DNA then can be analyzed readily for the presence of
DNA
sequence variation, such as the sickle cell mutation, by sequence-specific
oligonucleotide
hybridization (Sailci et al., Nature 324: 163-66 (1986)), restriction enzyme
cleavage (Saiki et
crl. (1985), szzpra; Chehab et al., Nature 329: 293-94(1987)), ligation of
oligonucleotide pairs
(Landegrenet al., Science 241: 1077-80 (1988)), or ligation amplification.
While PGR
increased the speed of analysis and reduced the amount of DNA required, it did
not change
the method of analysis of DNA sequence variation.
More recently, U.S. patent No. 5,639>611 to Wallace et al. disclosed an allele-
specific
polymerise chain reaction, said to be suitable for detecting the allele
responsible for sickle
cell anemia. Wallace et al. found that amplification proceeds with reduced
efficiency when
the 3' nucleotide of one of the PCR primers forms a mismatched base-pair with
the template.
Thus, under Wallace's method, the specific primers direct amplification of a
specific allele
only. The formation of an amplified fragment, after multiple rounds of
amplification,
indicates the presence of the allele in the test sample.
-2-
CA 02426812 2003-04-24
WO 02/34947 PCT/USO1/32630
While Wallace's method represents an improvement over restriction digests and
radiolabeled hybridizations, the approach remains laborious and time-
consuming. Besides
requiring gel electrophoresis, the method necessitates performing multiple
implication and
detection reactions to identify the genotype of a sample. Thus, a need exists
for a quicker,
less labor-intensive procedure for detecting identifying sequences, including
single-
nucleotide polymorphisms.
SUMMARY OF THE INVENTION
It is therefore one object of the present invention to provide an enhanced
method of
detecting the presence of identifying sequences in a genomic sample.
It is another object of the invention to provide kits for detecting the
presence of
identifying sequences in a genomic sample.
In accomplishing these and other objects of the invention, there is provided,
in
accordance with one aspect of the present invention, a method for determining
the presence
in a DNA sample of a first identifying sequence or a second identifying
sequence, or both,
which method comprises:
(A) providing a first oligonucleotide comprising:
(i) a first nucleotide sequence capable of specifically hybridizing to the
first
identifying sequence, but unable to hybridize specifically with the second
identifying
sequence; and
(ii) a second nucleotide sequence at the 5' end of the first nucleotide
sequence,
(B) providing a second oligonucleotide comprising:
(i) a third nucleotide sequence capable of specifically hybridizing to the
second identifying sequence, but unable to hybridize specifically to the first
identifying sequence; and
(ii) a fourth nucleotide sequence at the 5' end of the first nucleotide
sequence,
(C) providing a third oligonucleotide,
(D) providing a fourth oligonucleotide comprising:
(i) a fifth nucleotide sequence,
(ii) a sixth nucleotide sequence at the 5' end of the fifth nucleotide
sequence,
-3-
CA 02426812 2003-04-24
WO 02/34947 PCT/USO1/32630
(iii) a seventh nucleotide sequence at the 5' end of the sixth nucleotide
sequence, and
(iv) an eighth nucleotide sequence at the S' end of the seventh nucleotide
sequence,
wherein the fifth nucleotide sequence is identical to the second nucleotide
sequence, the fourth oligonucleotide is capable of forming a first hairpin
containing
nucleotides of the sixth and eighth nucleotide sequences, and the fourth
oligonucleotide emits a first detectable signal if the first hairpin is not
formed,
(E) providing a fifth oligonucleotide comprising:
(f) a ninth nucleotide sequence,
(ii) a tenth nucleotide sequence at the 5' end of the ninth nucleotide
sequence,
(iii) an eleventh nucleotide sequence at the 5' end of the tenth nucleotide
sequence, and
(iv) a twelfth nucleotide sequence at the 5' end of the eleventh nucleotide
sequence,
wherein the ninth nucleotide sequence is identical to fourth nucleotide
sequence, the fifth oligonucleotide is capable of forming a second hairpin
containing
nucleotides of the tenth and twelfth nucleotide sequences, and the fourth
oligonucleotide emits a second detectable signal if the second hairpin is not
formed,
(F) if the first identifying sequence is present in the DNA sample, then:
(f) annealing the first oligonucleotide to the first identifying sequence,
(ii) extending the 3' end of the first oligonucleotide using the first
identifying
sequence as a template to form an extended first strand, wherein the first
identifying sequence is annealed to the extended first strand,
(iii) separating the first identifying sequence from the extended first
strand,
(iv) annealing the third oligonucleotide to the extended first strand,
(v) extending the 3' end of the third oligonucleotide using the extended first
strand as a template to form an extended second strand, wherein the extended
first
strand is annealed to the extended second strand,
(vi) separating the extended first strand from the extended second strand,
(vii) annealing the fourth oligonucleotide to the extended second strand,
CA 02426812 2003-04-24
WO 02/34947 PCT/USO1/32630
(viii) extending the 3' end of the fourth oligonucleotide using the extended
second strand as a template to form a doubly extended first strand, wherein
the
doubly extended first strand is annealed to the extended second strand,
(ix) separating the doubly extended first strand from the extended second
strand,
(x) annealing the third oligonucleotide to the doubly extended first strand,
(xi) extending the 3' end of the third oligonucleotide using the doubly
extended first strand as a template to form a doubly extended second strand,
(xii) optionally amplifying the doubly extended first and second strands,
(xiii) detecting the first detectable signal, and
(xiv) determining that the first identifying sequence is present in the DNA
sample, and
(G) if the second identifying sequence is present in the DNA sample, then:
(i) annealing the second oligonucleotide to the second identifying sequence,
(ii) extending the 3' end of the second oligonucleotide using the second
identifying sequence as a template to form an extended third strand, wherein
the
second identifying sequence is annealed to the extended third strand,
(iii) separating the second identifying sequence from the extended third
strand,
(iv) annealing the third oligonucleotide to the extended third strand,
(v) extending the 3' end of the third oligonucleotide using the extended third
strand as a template to form an extended fourth strand, wherein the extended
third
strand is annealed to the extended fourth strand,
(vi) separating the extended third strand from the extended fourth strand,
(vii) annealing the fifth oligonucleotide to the extended fourth strand,
(viii) extending the 3' end of the fifth oligonucleotide using the extended
fourth strand as a template to form a doubly extended third strand, wherein
the
doubly extended third strand is annealed to the extended fourth strand,
(ix) separating the doubly extended third strand from the extended fourth
strand,
(x) annealing the third oligonucleotide to the doubly extended third strand,
-5-
CA 02426812 2003-04-24
WO 02/34947 PCT/USO1/32630
(xi) extending the 3' end of the third oligonucleotide using the doubly
extended third strand as a template to form a doubly extended fourth strand,
(xii) optionally amplifying the doubly extended third and fourth strands, and
(xiii) detecting the second detectable signal, and
(xiv) determining that the second identifying sequence is present in the DNA
sample.
In a preferred embodiments, the amplification reaction is PCR, and each of the
first and
second donor moieties is a fluorophore, while each of the first and second
acceptor moieties
is a quencher of light emitted by the fluorophore.
In another embodiment, there is provided a method for determining the presence
in
a DNA sample of a first identifying sequence or a second identifying sequence,
or both,
which method comprises:
(A) contacting the sample with first and second oligonucleotides,
wherein the first oligonucleotide contains:
(i) a first nucleotide sequence,
(ii) a second nucleotide sequence at the 5' end of the first nucleotide
sequence,
(iii) a third nucleotide sequence at the 5' end of the second nucleotide
sequence, and
(iv) a fourth nucleotide sequence at the 5' end of the third nucleotide
sequence,
wherein the first oligonucleotide is capable of forming a first hairpin
containing nucleotides of the second and fourth nucleotide sequences, and the
first oligonucleotide emits a first detectable signal if the first hairpin is
not formed,
wherein the second oligonucleotide contains:
(i) a fifth nucleotide sequence,
(ii) a sixth nucleotide sequence at the 5' end of the fifth nucleotide
sequence,
(iii) a seventh nucleotide sequence at the 5' end of the sixth nucleotide
sequence, and
(iv) an eighth nucleotide sequence at the 5' end of the seventh nucleotide
sequence,
CA 02426812 2003-04-24
WO 02/34947 PCT/USO1/32630
wherein the second oligonucleotide is capable of forming a second hairpin
containing nucleotides of the sixth and eighth nucleotide sequences, and the
second oligonucleotide emits a second detectable signal if the second hairpin
is not
formed,
(B) incorporating:
(i) the first oligonucleotide into a double-stranded nucleic acid using a
polymerase if the first identifying sequence is present in the sample, thereby
preventing the first hairpin from forming,
(ii) the second oligonucleotide into a double-stranded nucleic acid using a
polymerase if the second identifying sequence is present in the sample,
thereby
preventing the second hairpin from forming, or
(iii) each of the first and second oligonucleotides into a double-stranded
nucleic acid using a polymerase if both of the first and second identifying
sequences
are present in the sample, thereby preventing each of the first and second
hairpins
from forming,
(C) optionally conducting an amplification reaction, thereby incorporating:
(i) the first oligonucleotide into a first amplification product if the first
identifying sequence is present in the sample,
(ii) the second oligonucleotide into a second amplification product if the
second identifying sequence is present in the sample, or
(iii) the first oligonucleotide into a first amplification product if the
first
identifying sequence is present in the sample, and the second oligonucleotide
into a
second amplification product if the second identifying sequence is present in
the
sample,
(D) determining:
(i) that the first identifying sequence is present in the sample if the first
signal is detected,
(ii) that the second identifying sequence is present in the sample if the
second
signal is detected, or
(iii) that the first and second identifying sequences are present in the
sample
if the first and second signals are detected.
_7_
CA 02426812 2003-04-24
WO 02/34947 PCT/USO1/32630
The present invention also provides a method of directly identifying one or
more
nucleic acid polymorphisms in a single nucleic acid sample. This improved
technique
meets two major requirements. First, it permits detection of the nucleic acid
polymorphisms without prior separation of unincorporated oligonucleotides.
Second, it
allows detection of the one or more nucleic acid polymorphisms in a sample
directly, by
incorporating the labeled oligonucleotide into the amplified nucleic acid
sample.
The present invention also relates to kits for the identification of one or
more nucleic acid
polymorphism in a single sample. Such kits may be diagnostic kits where the
presence of
the nucleic acid polymorphism is correlated with the presence or absence of a
disease or
disorder.
Other objects, features and advantages of the present invention will become
apparent
from the following detailed description. The detailed description and specific
examples,
while indicating preferred embodiments, are given for illustration only since
various
changes and modifications within the spirit and scope of the invention will
become apparent
to those skilled in the art from this detailed description. Further, the
examples demonstrate
the principle of the invention and cannot be expected to specifically
illustrate the application
of this invention to all the examples where it will be obviously useful to
those skilled in the
prior art.
DESCRIPTION OF THE FIGURES
FIGURE 1 represents a general schematic of the oligonucleotide primers of the
present invention.
The first oligonucleotide (0l) comprises a first nucleotide sequence (1) and a
second
nucleotide sequence (2) at the 5' end of the first nucleotide sequence
(hatched).
The second oligonucleotide (02) comprises a third nucleotide sequence (3) and
a
fourth nucleotide sequence (4) at the 5' end of the third nucleotide sequence
(solid).
The third oligonucleotide (03) comprises the reverse primer.
The fourth oligonucleotide (04) comprises a fifth nucleotide sequence (5)
(hatched), a
sixth nucleotide (6) sequence at the 5' end of the fifth nucleotide sequence,
a seventh
nucleotide (7) sequence at the 5' end of the sixth nucleotide sequence, and an
eighth
nucleotide sequence (8) at the 5' end of the seventh nucleotide sequence. The
fifth nucleotide
sequence is identical to the second nucleotide sequence. 04 is capable of
forming a first
hairpin which contains nucleotide sequences six and eight. 04 emits a signal
if the hairpin is
not formed.
_g_
CA 02426812 2003-04-24
WO 02/34947 PCT/USO1/32630
The fifth oligonucleotide (OS) comprises a ninth nucleotide sequence (9)
(solid), a
tenth nucleotide sequence (10) at the 5' end of the ninth nucleotide sequence,
a eleventh
nucleotide sequence (11) at the 5' end of the tenth nucleotide sequence, and a
twelfth
nucleotide sequence (12) at the 5' end of the eleventh nucleotide sequence.
The ninth
nucleotide sequence is identical to the fourth nucleotide sequence. OS is
capable of forming
a hairpin containing nucleotides of the 10 and 12 nucleotide sequences. OS
emits a signal if
the hairpin is not formed.
FIGURE 2 provides a schematic representation of one of the preferred
embodiments
of the inventive methodology. It employs sequence-specific primers separate
from the
hairpin-forming oligonucleotides. If a DNA sample contains a target sequence,
the
sequence-specific forward primer (O1) will anneal and extend during the first
cycle of a
polymerase chain reaction, forming an extended first strand. In subsequent
cycles, a
hairpin-forming oligonucleotide (04) anneals to a 5' tail of the incorporated
sequence-
specific primer (as in cycle 3) and acts as a primer in formation of a doubly
extended first
strand. During still later cycles, as polymerase copies the doubly extended
first strand, it
forces the incorporated oligonucleotide out of its hairpin formation and into
an extended,
light-emitting conformation (as in cycle 4). Again, repetitive cycles will
increase the
magnitude of signal emitted.
FIGURE 3 is a schematic illustration of the structure of an oligonucleotide
(A) in a
hairpin conformation and (B) an extended conformation. Element (a) represents
a
nucleotide sequence that specifically hybridizes to a target sequence; (b) and
(d) represent
nucleotide sequences that hybridize to one another to form a hairpin; and (c)
represents the
sequence that links (b) with (d) and forms the loop of the hairpin. Open and
closed circles
on (b) and (d) represent a pair of molecular energy transfer molecules.
FIGURE 4 depicts another embodiment of the inventive methodology that utilizes
a
polymerase chain reaction. Hairpin-forming oligonucleotides (a) contain a
primer sequence
specific for each identifying sequence. If a DNA sample contains a target
sequence, the
specific primer will anneal and extend during the first cycle of a polymerase
chain reaction
(forming an extended first strand). In a second cycle, as polymerise copies
the extended
first strand, it forces the incorporated oligonucleotide out of its hairpin
formation and into
an extended, light-emitting conformation. Repetitive (n) cycles will increase
the magnitude
of the signal emitted.
-9-
CA 02426812 2003-04-24
WO 02/34947 PCT/USO1/32630
FIGURE SA shows the genotyping results of the CYP17 gene for the A-type allele
and G-type allele. Both primers differed at their 3' terminal nucleotide.
Column 2
represents the fluorescence measurements for FAM, and column 3 represents the
fluorescence measurements for SR. Column 1 show the genotype of the CYP17 DNA
tested.
FIGURE SB illustrates the benefit of using multiplex PCR reaction over a
single-
Alex PCR reaction. This figure shows the gentoyping results of the CYP17 gene
for the A-
type and G-type allele. The A-specific primer is labeled with FAM and the G-
specific
primer is labeled with SR. Column 1: a CYP17 DNA sample containing the A-type
allele
was screened via a singleplex PCR reaction using the A-specific primer. Column
2: a
CYP17 DNA sample containing the G-type allele was screened via a singleplex
PCR
reaction using the A-specific primer. Column 3: a CYP17 DNA sample containing
the A-
type allele was screened via a singleplex PCR reaction using the G-specific
primer.
Column 4: a CYP17 DNA sample containing the G-type allele was screened via a
singleplex PCR reaction using the G-specific primer. Column 5: a CYP17 DNA
sample
containing both A-type and G-type alleles were screened via a multiplex PCR
reaction using
both A-specific and G-specific primers. Column 6: a CYP17 DNA sample
containing both
the A-type and G-type allele was screened via a multiplex PCR reaction using
both the A-
specific and G-specific primers. Comparing columns 1 and 2: FAM signal is
detected in
both A-type and G-type DNA samples using the A-specific primer. This result
demonstrates the low allelic discrimination achieved using the A-specific
primer in a
singleplex PCR reaction. Comparing columns 3 and 4: SR signal is detected in
both A-type
and G-type DNA samples using the G-specific primer. This result demonstrates
the low
allelic discrimination using only the G-specific primer in a singleplex PCR
reaction.
Comparing columns 5 and 6 demonstrates the high allelic discrimination when
using both
the A-specific and G-specific primers in a multiplex PCR reaction because the
allelic there
was no signal of the opposite allele generated.
FIGURE 6A shows the genotyping results of the HER2 gene for the A-type allele
and G-type allele. Both primers differed at their 3' terminal nucleotide. The
no DNA
controls are designated by NDC. Column 1 represents the fluorescence
measurements for
FAM and column 2 represents the fluorescence measurements for SR. Column 3
show the
genotype of the HER2 DNA tested.
-10-
CA 02426812 2003-04-24
WO 02/34947 PCT/USO1/32630
FIGURE 6B shows a graphic representation of the fluorescence results of figure
SA.
The results demonstrate the allelic discrimination of the multiplex PCR
reaction using both
the A-specific and G-specific primers.
FIGURE 7A shows the genotyping results of the CYP2C8 gene for the C-type
allele
and T-type allele. The 3' terminal nucleotide of the C-specific primer
contained the
mismatch for detecting the polymorphism. The second nucleotide removed from
the
terminus of the T-specific primer contained the mismatch nucleotide for
detecting the
polymorphism. The no DNA controls are designated by NDC. Column 1 represents
the
fluorescence measurements for FAM and column 2 represents the fluorescence
measurements for SR. Column 3 show the genotype of the CYP2C8 DNA tested.
FIGURE 7B shows a graphic representation of the fluorescence results of figure
6A.
The results demonstrate the good allelic discrimination of the multiplex PCR
reaction using
both the C-specific and T-specific primers.
FIGURE 8A shows the genotyping results of the HTR2C gene for the C-type allele
and G-type allele. The third nucleotide removed from the terminus of the C-
specific and
G-specific primer contained the mismatch nucleotide for detecting the
polymorphism. The
no DNA controls are designated by NDC. Column 1 represents the fluorescence
measurements for FAM and column 2 represents the fluorescence measurements for
SR.
Column 3 show the genotype of the HTR2C DNA tested.
FIGURE 8B shows a graphic representation of the fluorescence results of figure
7A.
The results demonstrate the allelic discrimination of the multiplex PCR
reaction using both
the C-specific and G-specific primers.
FIGURE 9A shows the genotyping results of the CCRS gene for the wild-type gene
and the
deletion mutant. The no DNA controls are designated by NDC. Column 1
represents the
fluorescence measurements for FAM and column 2 represents the fluorescence
measurements for SR. Column 3 show the genotype of the CCRS DNA tested.
FIGURE 9B shows a graphic representation of the fluorescence results of figure
8A.
The results demonstrate the good allelic discrimination of the multiplex PCR
reaction using
both the wild-type and deletion mutant primers.
-11-
CA 02426812 2003-04-24
WO 02/34947 PCT/USO1/32630
DETAILED DESCRIPTION
A PCR-based methodology has been discovered for detecting specific nucleotide
sequences (identifying sequences), absent the drawbacks of conventional
technology. The
instant invention enables the rapid detection of genetic polymorphisms, such
as a SNPs,
insertions and deletions, within a target sequence. Elucidation of a
polymorphism is
accomplished by discerning the presence of one or more identifying sequences
via their
hybridization to sequence-specific oligonucleotide primers. The invention's
creative use of
fluorescence resonance energy transfer (FRET)-labeled oligonucleotides enables
the rapid
characterization of these hybridizations.
As described herein, an "identifying sequence" refers to a particular
nucleotide acid
that may represent a variation of a gene that persists in a population, such
as an allele, or a
spontaneous change in a particular nucleic acid sequence of an individual,
such as a
mutation. The difference or change from the wild type form can encompass a
single
nucleotide or several nucleotides and typically indicates a particular
phenotype, disease or
disease-susceptibility.
A genomic sample from an individual may encompasses two alleles of a
particular
gene, depending on whether the individual is homozygous or heterozygous for a
given
gene. Accordingly, a genomic sample can contain a first identifying sequence,
a second
identifying sequence, both a first and second identifying sequences or no
identifying
sequences. In one embodiment, the invention identifies genetic polymorphisms
in a DNA
sample by simultaneously detecting the presence of a first identifying
sequence, a second
identifying sequence, or both. To this end, the sample is contacted, in step
(A), with first
and second oligonucleotides. The first and second oligonucleotides may differ
from each
other in their terminal 3' nucleotide only. In another preferred embodiment,
the
oligonucleotides may differ at a nucleotide or at nucleotides other than the
3' terminal
nucleotide. For example, the second, third, fourth, or fifth nucleotides
removed from the
3' terminus of each primer may differ individually or in combination.
In another embodiment, the present invention can be used to determine the
presence
of a variety of identifying sequences simultaneously. For example, where a
particular gene
has five possible alleles, five oligonucleotides, specific for the
corresponding identifying
sequences, can be used simultaneously. In this manner, the genotype of the
sample can be
determined immediately.
-12-
CA 02426812 2003-04-24
WO 02/34947 PCT/USO1/32630
In a preferred embodiment of the present invention, two sequence-specific
oligonucleotide primers, one specific for a first identifying sequence and one
for a second
identifying sequence, together with another primer (such as a reverse primer),
are used in a
PCR mixture containing a genomic DNA template. Primarily, nucleotides toward
the 3' end
of a primer determine specificity. Thus, the sequence-specific primers may
differ from each
other in their terminal 3' nucleotide only. Additionally, the primers may
differ at a
nucleotide or at nucleotides other than the 3' terminal nucleotide. For
example, the second,
third, fourth, or fifth nucleotides removed from the 3' terminus of each
primer may differ
individually or in combination. When nucleotides other than the 3' terminal
nucleotide
differ, the primer sequences will bridge the polymorphism. Regardless of
mismatch location,
under appropriate annealing temperature and PCR conditions, each sequence-
specific primer
only directs amplification using its complementary sequence as a template.
Resultant PCR
products, representing the target sequences, then are detected by conducting
PCR
amplification using two FRET-labeled primers, each specific for the PCR
product, together
with another primer complementary to the PCR products.
According to this aspect of the invention the method comprises the following
steps:
In step (A), a first oligonucleotide is provided comprising (i) a first
nucleotide
sequence capable of specifically hybridizing to the first identifying
sequence, but unable to
specifically hybridize with the second identifying sequence due to one or more
nucleotide
mismatches, and (ii) a second nucleotide sequence at the 5' end of the first
nucleotide
sequence.
In step (B), a second oligonucleotide is provided comprising (i) a third
nucleotide
sequence capable of specifically hybridizing to the second identifying
sequence, but unable
to specifically hybridize with the first identifying sequence due to one or
more nucleotide
mismatches, and (ii) a fourth nucleotide sequence at the 5' end of the first
nucleotide
sequence.
In step (C), a third oligonucleotide is provided.
In step (D), a fourth oligonucleotide is provided, comprising (i) a fifth
nucleotide
sequence, (ii) a sixth nucleotide sequence at the 5' end of the fifth
nucleotide sequence,
tiii) a seventh nucleotide sequence at the 5' end of the sixth nucleotide
sequence, and
(iv) an eighth nucleotide sequence at the 5' end of the seventh nucleotide
sequence. The
fifth nucleotide sequence is identical to the second nucleotide sequence, the
fourth
oligunucleotide is capable of forming a first hairpin which contains
nucleotides of the sixth
-13-
CA 02426812 2003-04-24
WO 02/34947 PCT/USO1/32630
and eighth nucleotide sequences, and the fourth oligonucleotide emits a first
detectable
signal if the first hairpin is not formed.
In step (E), a fifth oligonucleotide is provided that comprises (i) a ninth
nucleotide
sequence, (ii) a tenth nucleotide sequence at the 5' end of the ninth
nucleotide sequence,
(iii) an eleventh nucleotide sequence at the 5' end of the tenth nucleotide
sequence, and (iv)
a twelfth nucleotide sequence at the 5' end of the eleventh nucleotide
sequence. The ninth
nucleotide sequence is identical to the fourth nucleotide sequence, the fifth
oligonucleotide
is capable of forming a second hairpin containing nucleotides of the tenth and
twelfth
nucleotide sequences, and the fourth oligonucleotide emits a second detectable
signal if the
second hairpin is not formed.
In step (F), if the first identifying sequence is present in the DNA sample,
then (i)
the first oligonucleotide anneals with the first identifying sequence, (ii)
the 3' end of the
first oligonucleotide is extended using the first identifying sequence as a
template to form
an extended first strand, wherein the first identifying sequence is annealed
to the extended
first strand, (iii) first identifying sequence is separated from the extended
first strand, (iv)
the third oligonucleotide is annealed to the extended first strand, (v) the 3'
end of the third
oligonucleotide is extended using the extended first strand as a template to
form an
extended second strand, wherein the extended first strand is annealed to the
extended
second strand, (vi) the extended first strand is separated from the extended
second strand,
(vii) the fourth oligonucleotide is annealed to the extended second strand,
(viii) the 3' end
of the fourth oligonucleotide is extended using the extended second strand as
a template to
form a doubly extended first strand, wherein the doubly extended first strand
is annealed to
the extended second strand, (ix) the doubly extended first strand is separated
from the
extended second strand, (x) the third oligonucleotide is annealed to the
doubly extended
first strand, (xi) the 3' end of the third oligonucleotide is extended using
the doubly
extended first strand as a template to form a doubly extended second strand,
(xii) the
doubly extended first and second strands are optionally amplified, (xiii) the
first detectable
signal is detected, and (xiv) it is determined that the first identifying
sequence is present in
the DNA sample. Figure 2 schematically represents the essence of step (F).
In step (G), if the second identifying sequence is present in the DNA sample,
then
(i) the second oligonucleotide anneals with the second identifying sequence,
(ii) the 3' end
of the second oligonucleotide is extended using the second identifying
sequence as a
-14-
CA 02426812 2003-04-24
WO 02/34947 PCT/USO1/32630
template to form an extended third strand, wherein the second identifying
sequence is
annealed to the extended third strand, (iii) the second identifying sequence
is separated from
the extended third strand, (iv) the third oligonucleotide is annealed to the
extended third
strand, (v) the 3' end of the third oligonucleotide is extended using the
extended third
strand as a template to form an extended fourth strand, wherein the extended
third strand is
annealed to the extended fourth strand, (vi) the extended third strand is
separated from the
extended fourth strand, (vii) the fifth oligonucleotide is annealed to the
extended fourth
strand, (viii) the 3' end of the fifth oligonucleotide is extended using the
extended fourth
strand as a template to form a doubly extended third strand, wherein the
doubly extended
third strand is annealed to the extended fourth strand, (ix) the doubly
extended third strand
is separated from the extended fourth strand, (x) the third oligonucleotide is
annealed to the
doubly extended third strand, and (xi) the 3' end of the third oligonucleotide
is extended,
using the doubly extended third strand as a template to form a doubly extended
fourth
strand. Then, (xii) the doubly extended third and fourth strands are
optionally amplified,
(xiii) the second detectable signal is detected, and (xiv) it is determined
that the second
identifying sequence is present in the DNA sample.
Advantageously, the fourth oligonucleotide emits the first detectable signal
only if
the first hairpin is not formed, and the fifth oligonucleotide emits the
second detectable
signal only if the second hairpin is not formed. The first detectable signal
emitted by the
fourth oligonucleotide if the first hairpin is not formed preferably is more
intense than a
signal emitted by the fourth oligonucleotide if the first hairpin is formed,
and the second
detectable signal emitted by the fifth oligonucleotide if the second hairpin
is not formed is
more intense than a signal emitted by the fifth oligonucleotide if the second
hairpin is
formed. The fourth oligonucleotide ideally emits the first detectable signal
only if the first
hairpin is not formed, and the fifth oligonucleotide emits the second
detectable signal only
if the second hairpin is not formed.
In preferred embodiments, the fourth oligonucleotide contains a first
molecular
energy transfer pair including a first energy donor moiety that is capable of
emitting a first
energy, and a first energy acceptor moiety that is capable of absorbing an
amount of the
emitted first energy. The first donor moiety is attached to a nucleotide of
the sixth
nucleotide sequence and the first acceptor moiety is attached to a nucleotide
of the eighth
nucleotide sequence, or the first acceptor moiety is attached to a nucleotide
of the sixth
-15-
CA 02426812 2003-04-24
WO 02/34947 PCT/USO1/32630
nucleotide sequence and the first donor moiety is attached to a nucleotide of
the eighth
nucleotide sequence, and the first acceptor moiety absorbs the amount of the
emitted first
energy only if the first hairpin is formed. Additionally, the fifth
oligonucleotide further
contains a second molecular energy transfer pair including a second energy
donor moiety
that is capable of emitting a second energy, and a second energy acceptor
moiety that is
capable of absorbing an amount of the emitted second energy. The second donor
moiety is
attached to a nucleotide of the tenth nucleotide sequence and the second
acceptor moiety is
attached to a nucleotide of the twelfth nucleotide sequence, or the second
acceptor moiety is
attached to a nucleotide of the tenth nucleotide sequence and the second donor
moiety is
attached to a nucleotide of the twelfth nucleotide sequence, and the second
acceptor moiety
absorbs the amount of the emitted second energy only if the second hairpin is
formed.
Each of the first and second donor moieties can be a fluorophore, and each of
the
first and second acceptor moieties is a quencher of light emitted by the
fluorophore. The
preferred first and second acceptor moieties are DABSYL, while the preferred
first donor
moiety is fluorescein and the preferred second acceptor moiety is
sulfarhodamine, or vice
versa.
Ideally, the amplification reaction is a polymerase chain reaction, e.g., a
triamplification, a nucleic acid sequence-based amplification, a strand
displacement
amplification, a cascade rolling circle amplification, or an amplification
refractory mutation
system. The amplification reaction may be conducted in situ.
Step (F)(xii) ideally comprises (a) separating the doubly extended first
strand from
the doubly extended second strand, (b) annealing the third oligonucleotide to
the doubly
extended first strand, and annealing the fourth oligonucleotide to the doubly
extended
second strand, (c) extending the 3' end of the third oligonucleotide using the
doubly
extended first strand as a template to form another doubly extended second
strand, wherein
the doubly extended first strand is annealed to the other doubly extended
second strand, and
extending the 3' end of the fourth oligonucleotide using the doubly extended
second strand
as a template to form another doubly extended first strand, wherein the doubly
extended
second strand is annealed to the other doubly extended first strand, and (d)
repeating (a),
(b), and (c) for a finite number of times, wherein, in (a), the doubly
extended first and
second strands respectively are the doubly extended first strand and the other
doubly
-16-
CA 02426812 2003-04-24
WO 02/34947 PCT/USO1/32630
extended second strand of (c), or respectively are the other doubly extended
first strand and
the doubly extended second strand of (c).
Step (G)(xii) ideally comprises separating the doubly extended third strand
from the
doubly extended fourth strand, (b) annealing the third oligonucleotide to the
doubly
extended third strand, and annealing the fifth oligonucleotide to the doubly
extended fourth
strand, (c) extending the 3' end of the third oligonucleotide using the doubly
extended third
strand as a template to form another doubly extended fourth strand, wherein
the doubly
extended third strand is annealed to the other doubly extended fourth strand,
and extending
the 3' end of the fifth oligonucleotide using the doubly extended fourth
strand as a template
to form another doubly extended third strand, wherein the doubly extended
fourth strand is
annealed to the other doubly extended third strand, and (d) repeating (a),
(b), and (c) for a
finite number of times, wherein, in (a), the doubly extended third and fourth
strands
respectively are the doubly extended third strand and the other doubly
extended fourth
strand of (c), or respectively are the other doubly extended third strand and
the doubly
extended fourth strand of (c).
The molecular energy transfer (MET) phenomenon is a process by which energy is
passed between a donor molecule and an acceptor molecule. Fluorescence
resonance energy
transfer (F.RET), which involves at least one fluorophore, is a form of MET. A
fluorophore is
a compound that absorbs light at one wavelength, and emits light at different
wavelength. A
spectrofluorimeter is used to simultaneously emit light which excites the
fluorophore, and
detect light emitted by the fluorophore. In FRET, the fluorophore is a donor
molecule which
absorbs photons, and subsequently transfers this energy to an acceptor
molecule. Donor and
acceptor molecules that engage in MET or FRET are termed "MET pairs" and "FRET
pairs,"
respectively. Forster, Z. Nczturforseh A4: 321-27 (1994); Clegg, Methods In
Enzymology
211: 353-88 ( 1992).
When two fluorophores are in close proximity, and the emission spectrum of the
first
fluorophore overlaps the excitation spectrum of the second fluorophore,
excitation of the first
fluorophore causes it to emit light that is absorbed by the second
fluorophore, which in turn
causes the second fluorophore to emit light. As a result, the fluorescence of
the first
fluorophore is quenched, while the fluorescence of the second fluorophore is
enhanced. If the
energy of the first fluorophore is transferred to a compound that is not a
fluorophore,
however, the fluorescence of the first fluorophore is quenched without
subsequent emission
of light by the non-fluorophore.
-17-
CA 02426812 2003-04-24
WO 02/34947 PCT/USO1/32630
The FRET phenomenon has been exploited to detect nucleic acids. One of these
methods is disclosed in U.S. patent No. 5,866,366, the entire contents of
which are herein
incorporated by reference. The '366 patent relates a FRET-labeled hairpin
oligonucleotide
which is used as a probe in polymerase chain reaction (PCR) methods to detect
target nucleic
acid sequences. This oligonucleotide contains an energy donor and an energy
acceptor
constituting a FRET pair. The donor and acceptor are respectively situated on
first and
second nucleotide sequences of the oligonucleotide. These two nucleotide
sequences are
complementary to each other, and are therefore able to form a hairpin in the
oligonucleotide.
If the first and second nucleotide sequences are annealed to each other, then
the donor
and acceptor are in close proximity. In this spatial arrangement, the acceptor
absorbs the
emission from the donor, and thereby quenches the signal from the donor.
However, if the
nucleotide sequences are not annealed to each other, then the donor and
acceptor are
separated, the acceptor can no longer absorb the emission from the donor, and
the signal from
the donor is not quenched.
Thus, if the oligonucleotide is incorporated into an amplification product
during PCR,
then the hairpin unfolds, resulting in the separation of the donor from the
acceptor, and the
consequent emission of an observable signal. However, if the oligonucleotide
is not
incorporated into a PGR amplification product, then the hairpin remains, and
the emission
from the donor is quenched by the acceptor. Detection of a signal after PCR
therefore
indicates the presence of the target.
In preferred embodiments, the concentration of the first oligonucleotide in
the
reaction mixture in which (F)(i) is conducted is less than 50 nM, 25 nM, or 5
nM, is
between 5 and 50 nM or between 20 and 30 nM, or is about 25 nM. The
concentration of
the fourth oligonucleotide in the reaction mixture in which (F)(vii) is
conducted is
preferably less than 500 nM, 250 nM, or 50 nM, is between 50 and 500 nM or
between
200 and 300 nM, or is about 250 nM. Preferably, the concentration of the
fourth
oligonucleotide in the reaction mixture in which (F)(vii) is conducted is at
least five times,
ten times, twenty times, thirty times, from five to thirty times, from ten to
twenty times, or
about ten times the concentration of the first oligonucleotide in the reaction
mixture in
which (F)(i) is conducted. Preferably, the concentration of the second
oligonucleotide in
the reaction mixture in which (F)(i) is conducted is less than 50 nM, 25 nM, 5
nM, is
between 5 and 50 nM or between 20 and 30 nIVf, or is about 25 nM. Preferably,
the
concentration of the fifth oligonucleotide in the reaction mixture in which
(F)(vii) is
-18-
CA 02426812 2003-04-24
WO 02/34947 PCT/USO1/32630
conducted is less than 500 nM, 250 nM, 50 nM, is between 50 and 500 nM or
between 200
and 300 nM, or is about 250 nM. Preferably, the concentration of the fifth
oligonucleotide
in the reaction mixture in which (F)(vii) is conducted is at least five times,
ten times,
twenty times, thirty times, from five to thirty times, from ten to twenty
times, or about ten
times the concentration of the second oligonucleotide in the reaction mixture
in which (F)(i)
is conducted.
In a further embodiment, the present invention provides a method for the
direct
identification of a nucleic acid polymorphism, where the detection may be
performed
without opening the reaction tube. This embodiment, the "closed-tube" format,
reduces
greatly the possibility of carryover contamination with amplification products
that has
slowed the acceptance of PCR in many applications. The closed-tube method also
provides
for high throughput of samples and may be totally automated.
The nucleic acids in the sample may be purified or unpurified. In a specific
embodiment, the oligonucleotides of the invention are used in situ
amplification reactions,
performed on samples of fresh or preserved tissues or cells. In ira sitar
reactions, it is
advantageous to use methods that allow for the accurate and sensitive
detection of the target
directly after the amplification step. In contrast, conventional ifa situ PCR
requires, in
paraffin embedded tissue, detection by a hybridization step, as the DNA repair
mechanism
invariably present in tissue samples from, e.g., CNS, lymph nodes, and spleen,
precludes
detection by direct incorporation of a reporter nucleotide during the PCR
step. Typically,
when conventional linear primers labeled with biotin or digoxigenin moieties
are employed in
in situ PCR, little or no detectable label is incorporated during
amplification, which
comprises annealing and extension steps. Moreover, when amplification reaction
conditions
are modified to enhance incorporation of nucleotides labeled with such
moieties,
unacceptably high background and false positive results are obtained. This can
be attributed
to the activity of endogenous DNA repair enzymes, which incorporate the
labeled nucleotides
into nicked DNA in the sample. Others have attempted to use other types of
singly labeled
PCR primers (Nuovo, 1997, PCR In Situ Hybridization: Protocols and
Applications, Third
Edition, Lippincott-Raven Press, New York), but have not been able to achieve
adequate
sensitivity, often leading resulting in false negative results. The
requirements for a
hybridization step, followed by a washing step, add additional time and
expense to
conventional iri situ PCR protocols. It is therefore advantageous to use
methods that allow
-19-
CA 02426812 2003-04-24
WO 02/34947 PCT/USO1/32630
for the accurate and sensitive detection of the target directly after the
amplification step. Such
methods are afforded by the present invention.
In a specific embodiment, the energy emitted by the donor moiety (e.g., when a
quencher is the acceptor moiety) or by the acceptor moiety (e.g., when a i-
luorophore or
chromophore is the acceptor moiety), that is detected and measured after
conducting an
amplification reaction of the invention correlates with the amount of the
preselected target
sequence originally present in the sample, thereby allowing determination of
the amount of
the preselected target sequence present in the original sample. Thus, the
methods of the
invention can be used quantitatively to determine the existence of a nucleic
acid
polymorphism, number of chromosomes, or amount of DNA or RNA, containing the
preselected target sequence.
In another embodiment of the present invention, the first oligonucleotide
contains (i)
a first nucleotide sequence, (ii) a second nucleotide sequence at the 5' end
of the first
nucleotide sequence, (iii) a third nucleotide sequence at the 5' end of the
second nucleotide
sequence, and (iv) a fourth nucleotide sequence at the 5' end of the third
nucleotide
sequence. Under hybridizing conditions, the first oligonucleotide would form a
first
hairpin, containing nucleotides of the second and fourth nucleotide sequences
(Figure 3A).
Conversely, the first oligonucleotide emits a first detectable signal if the
first hairpin is not
formed (Figure 3B).
The second oligonucleotide contains (i) a fifth nucleotide sequence, (ii) a
sixth
nucleotide sequence at the 5' end of the fifth nucleotide sequence, (iii) a
seventh nucleotide
sequence at the 5' end of the sixth nucleotide sequence, and (iv) an eighth
nucleotide
sequence at the 5' end of the seventh nucleotide sequence. Again, the second
oligonucleotide is capable of forming a second hairpin containing nucleotides
of the sixth
and eighth nucleotide sequences, and the second oligonucleotide emits a second
detectable
signal if the second hairpin is not formed.
In step (B), the first oligonucleotide is incorporated into a double-stranded
nucleic
acid, by means of a polymerase, if the first identifying sequence is present
in the sample,
thereby preventing the first hairpin from forming (Figure 4, through 2
cycles).
Alternatively, a polymerase effects the incorporation of the second
oligonucleotide into a
double-stranded nucleic acid, if the second identifying sequence is present in
the sample,
thereby preventing the second hairpin from forming. If both the first and
second
-20-
CA 02426812 2003-04-24
WO 02/34947 PCT/USO1/32630
identifying sequences are present in the sample, each of the first and second
oligonucleotides is incorporated into a double-stranded nucleic acid,
precluding formation
of the first and second hairpins, respectively.
In step (C), which is optional, an amplification reaction is conducted (Figure
4,
through n cycles). The result is (i) incorporation of the first
oligonucleotide into a first
amplification product, if the first identifying sequence is present in the
sample, (ii)
incorporation of the second oligonucleotide into a second amplification
product, if the
second identifying sequence is present in the sample, or (iii) incorporation
of the first
oligonucleotide into the first amplification product and the second
oligonucleotide into the
second amplification product, if both identifying sequences are present in the
sample. In
step (D), a determination is made as to whether the first identifying sequence
is present in
the sample (i. e. , if the first signal is detected), whether the second
identifying sequence is
present (if the second signal is detected), or whether both identifying
sequences are present
in the sample (both signals are detected).
Advantageously, the first oligonucleotide emits the first detectable signal
only if the
first hairpin is not formed, and the second oligonucleotide emits the second
detectable
signal only if the second hairpin is not formed. The first detectable signal,
emitted by the
first oligonucleotide if the first hairpin is not formed, preferably is more
intense than a
signal emitted by the first oligonucleotide if the first hairpin is formed,
and the second
detectable signal, emitted by the second oligonucleotide if the second hairpin
is not formed,
is more intense than a signal emitted by the second oligonucleotide if the
second hairpin is
formed.
In another embodiment, the first oligonucleotide further contains a first
molecular
energy transfer pair which includes a first energy donor moiety that is
capable of emitting a
first energy, and a first energy acceptor moiety that is capable of absorbing
an amount of
the emitted first energy. The first donor moiety is attached to a nucleotide
of the second
nucleotide sequence and the first acceptor moiety is attached to a nucleotide
of the fourth
nucleotide sequence, or the first acceptor moiety is attached to a nucleotide
of the second
nucleotide sequence and the first donor moiety is attached to a nucleotide of
the fourth
nucleotide sequence, and the first acceptor moiety absorbs the amount of the
emitted first
energy only if the first hairpin is formed. Additionally, the second
oligonucleotide further
contains a second molecular energy transfer pair including a second energy
donor moiety
-21-
CA 02426812 2003-04-24
WO 02/34947 PCT/USO1/32630
that is capable of emitting a second energy, and a second energy acceptor
moiety that is
capable of absorbing an amount of the emitted second energy. The second donor
moiety is
attached to a nucleotide of the sixth nucleotide sequence and the second
acceptor moiety is
attached to a nucleotide of the eighth nucleotide sequence, or the second
acceptor moiety is
attached to a nucleotide of the sixth nucleotide sequence and the second donor
moiety is
attached to a nucleotide of the eighth nucleotide sequence, and the second
acceptor moiety
absorbs the amount of the emitted second energy only if the second hairpin is
formed.
It is preferred that each of the first and second donor moieties is a
fluorophore, and
that each of the first and second acceptor moieties is a quencher of light
emitted by the
fluorophore. Illustrative of the first and second acceptor moieties is DABSYL,
while the
first donor moiety can be fluorescein and the second acceptor moiety can be
sulfarhodamine; alternatively, the first donor moiety is sulfarhodamine arid
the second
acceptor moiety is fluorescein.
The amplification reaction ideally is a polymerase chain reaction, such as a
triamplification, a nucleic acid sequence-based amplification, a strand
displacement
amplification, a cascade rolling circle amplification, or an amplification
refractory mutation
system. The amplification reaction may be conducted in situ.
As referred to herein, nucleic acids that are "complementary" can be perfectly
or
imperfectly complementary, as long as the desired property resulting from the
complementarity is not lost, e.g., ability to hybridize.
An additional aspect of the present invention relates to kits for determining
the
presence of a first identifying sequence or a second identifying sequence or
both. In
specific embodiments, the kits comprise first to fifth oligonucleotides, in
one or more
containers. The kit can further comprise additional components for carrying
out the
amplification reactions of the invention. Where the target nucleic acid
sequence being
amplified is one implicated in disease or disorder, the kits can be used for
diagnosis or
prognosis. In a specific embodiment, a kit is provided that comprises, in one
or more
containers, forward and reverse primers of the invention for carrying out
detection and
amplification of the nucleic acid polymorphism, and optionally, a DNA
polymerase or two
DNA polymerases respectively with and without exonuclease activity. A kit for
triamplification can further comprise, in one or more containers, a blocking
oligonucleotide, and optionally DNA ligase.
-22-
CA 02426812 2003-04-24
WO 02/34947 PCT/USO1/32630
Oligonucleotides in containers can be in any form, e.g., lyophilized, or in
solution
(e.g., a distilled water or buffered solution), etc. oligonucleotides ready
for use in the same
amplification reaction can be combined in a single container or can be in
separate
containers. Multiplex kits are also provided, containing more than one pair of
amplification
(forward and reverse) primers, wherein the signal being detected from each
amplified
product is of a different wavelength, e.g., wherein the donor moiety of each
primer pair
fluoresces at a different wavelength. Such multiplex kits contain at least two
such pairs of
primers.
In a specific embodiment, a kit comprises, in one or more containers, a pair
of
primers preferably in the range of 10-100 or 10-80 nucleotides, and more
preferably, in the
range of 20-40 nucleotides, that are capable of priming amplification. Such
primers can
initiate amplification in a variety of amplification reactions, including, but
not limited to,
PCR (see e.g., Innis et al., 1990, PCR Protocols, Academic Press, Inc., San
Diego,
Calif.), competitive PCR, competitive reverse-transcriptase PCR (Clementi et
al., 1994,
Genet. Anal. Tech. Appl. 11(1).1-6; Siebert et al., 1992, Nature 359:557-558),
triamplification, NASBA and strand displacement.
A pair of primers, consisting of a forward primer and a reverse primer, for
use in
PCR or strand displacement amplification, consists of primers that are each
complementary
with a different strand of two complementary nucleic acid strands, such that
when an
extension product of one primer in the direction of the other primer is
generated by a
nucleic acid polymerase, that extension product can serve as a template for
the synthesis of
the extension product of the other primer. A pair of primers, consisting of a
forward
primer and a reverse primer, for use in triamplification, consists of primers
that are each
complementary with a different strand of two complementary nucleic acid
strands, such that
when an extension-ligation product of one primer in the direction of the other
primer is
generated by a nucleic acid polymerase and a nucleic acid ligase, that
extension-ligation
product can serve as a template for the synthesis of the extension-ligation
product of the
other primer. The amplified product in these instances is that content of a
nucleic acid in
the sample between and including the primer sequences.
In another embodiment, a kit for determining the presence of a first
identifying
sequence or a second identifying sequence or both, comprising in one or more
containers
(a) oligonucleotide primers, one or both of which are hairpin primers labeled
with
-23-
CA 02426812 2003-04-24
WO 02/34947 PCT/USO1/32630
fluorescent and quenching moieties that can perform MET; and optionally: (b) a
control
DNA target sequence; (c) an optimized buffer for amplification; (d)
appropriate enzymes
for the method of amplification contemplated, e.g., a DNA polymerase for PCR
or
triamplification or SDA, or a reverse transcriptase for NASBA; and (e) a set
of directions
for carrying out the amplification. Such directions can describe, for example,
the optimal
conditions, e.g., temperature, number of cycles of amplification, pH, salt,
etc, for
conducting the reaction. Optionally, the kit provides (f) means for
stimulating and
detecting fluorescent light emissions, e.g., a fluorescence plate reader or a
combination
thermocycler-plate-reader to perform the analysis.
In yet another embodiment, a kit for triamplification is provided. The kit
comprises
forward and reverse extending primers and a blocking oligonucleotide. Either
the forward
or reverse primer is labeled with one moiety of a pair of MET moieties, and
the blocking
oligonucleotide is labeled with the other MET moiety of the pair. One
embodiment of such
a kit comprises, in one or more containers: (a) a first oligonucleotide; (b) a
second
oligonucleotide, wherein said first and second oligonucleotides are linear
primers for use in
a triamplification reaction; (c) a third oligonucleotide that is a blocking
oligonucleotide that
comprises a sequence complementary and hybridizable to a sequence of said
first
oligonucleotide, said first and third oligonucleotides being labeled with a
first and second
moiety, respectively, that are members of a molecular energy transfer pair
consisting of a
donor moiety and an acceptor moiety, such that when said first and third
oligonucleotides
are hybridized to each other and the donor moiety is excited and emits energy,
the acceptor
moiety absorbs energy emitted by the donor moiety; and (d) in a separate
container, a
nucleic acid ligase.
Another embodiment of a kit comprises in a container a universal hairpin
optionally
also comprising a second container containing cyanogen bromide or a nucleic
acid ligase
(e.g., DNA ligase, for example, T4 DNA ligase).
A kit for carrying out a reaction such as that shown in FIG. 2 comprises in
one or
more containers: (a) a first and second oligonucleotide; (b) a third
oligonucleotide, wherein
the first and second oligonucleotides are forward primers and the third
oligonucleotide is a
reverse primer for DNA synthesis in an amplification reaction to identify a
nucleic acid
polymorphism, and wherein said first and second oligonucleotides comprise (i)
a 5'
sequence that is not complementary to a preselected target sequence in said
nucleic acid
-24-
CA 02426812 2003-04-24
WO 02/34947 PCT/USO1/32630
sequence, and (ii) a 3' sequence that is complementary to said preselected
target sequence
and may comprise one or more mismatch nucleotides; and (c) a fourth
oligonucleotide that
comprises in 5' to 3' order (i) a first nucleotide sequence of 6-30
nucleotides, wherein a
nucleotide within said first nucleotide sequence is labeled with a first
moiety selected from
the group consisting of a donor moiety and an acceptor moiety of a molecular
energy
transfer pair, wherein the donor moiety emits energy of one or more particular
wavelengths
when excited, and the acceptor moiety absorbs energy at one or more particular
wavelengths emitted by the donor moiety; (ii) a second, single-stranded
nucleotide sequence
of 3-20 nucleotides; (iii) a third nucleotide sequence of 6-30 nucleotides,
wherein a
nucleotide within said third nucleotide sequence is labeled with a second
moiety selected
from the group consisting of said donor moiety and said acceptor moiety, and
said second
moiety is the member of said group not labeling said first nucleotide
sequence, wherein said
third nucleotide sequence is sufficiently complementary in reverse order to
said first
nucleotide sequence for a duplex to form between said first nucleotide
sequence and said
third nucleotide sequence such that said first moiety and second moiety are in
sufficient
proximity such that, when the donor moiety is excited and emits energy, the
acceptor
moiety absorbs energy emitted by the donor moiety; (iv) at the 3' end of said
third
oligonucleotide primer, a fourth nucleotide sequence of 10-25 nucleotides that
comprises at
its 3' end a sequence identical to said 5' sequence of said first
oligonucleotide primer.
Where such kit is used for triamplification, a blocking oligonucleotide can
also provided.
Another kit of the invention comprises in one or more containers: (a) a first
oligonucleotide; (b) a second oligonucleotide, said first and second
oligonucleotide being
hybridizable to each other; said first oligonucleotide being labeled with a
donor moiety said
second oligonucleotide being labeled with an acceptor moiety, said donor and
acceptor
moieties being a molecular energy transfer pair, wherein the donor moiety
emits energy of
one or more particular wavelengths when excited, and the acceptor moiety
absorbs energy
at one or more particular wavelengths emitted by the donor moiety; and (c) in
a separate
container, a nucleic acid ligase.
The approach of the present invention presents a powerful tool for genetic
disease
diagnosis, carrier screening, HLA typing, human gene mapping, forensics, and
paternity
testing, inter e~lia. The invention is further described by reference to the
following
-25-
CA 02426812 2003-04-24
WO 02/34947 PCT/USO1/32630
example, which is set forth by way of illustration only. Nothing in the
following examples
should be taken as a limitation upon the overall spirit and scope of the
present invention.
EXAI<~IPLES
Example 1: General Amplification Reaction with Universal FRET Primers
1. Primer Design:
A schematic representation of the oligonucleotide primers of the present
invention are
shown in Figure 1.
For the purpose of the examples following, the oligonucleotide primers of the
present
invention will be referred as the primers listed below:
O1 will herein be referred to as "forward primer". This is a sequence specific
primer
that contains one or more mismatched nucleotides for the detection of one or
more
polymorphisms and is capable of binding to the FAM universal primer;
02 will herein be referred to as "forward primer". This is the second sequence
specific primer that contains one or more mismatched nucleotides for detection
one or more
polymorphisms. This primer is capable of binding to the SR universal primer;
03 will herein be referred to as the "reverse primer";
04 will herein be referred to as the "FAM universal primer"; and
OS will herein be referred to as the "SR universal primer".
Examples of the forward and reverse primer sequences can be found in Table 1
and
Table 2. Table 1 illustrates representative examples of both forward and
reverse primers.
The sequence specific forward primer pairs in Table 1 differ at their terminal
3' nucleotide.
Table 2 illustrates representative examples of both forward and reverse
primers, as well as the
gene target sequence containing the polymorphism.
The universal FRET primers used in the following examples, comprise the
following
sequences:
Green (FAM) primer:
5'-FAM-AGCGATGCGTTCGAGCATCGCTGAAGGTGACCAAGTTCATGCT-~' (SEQ ID NO:1); and
red (Sulforhodmaine (SR)):
5'- (SR)-GGACGCTGAGATGCGTCCTGAAGGTCGGAGTCAACGGATT-3' (SEQ ID N0:2).
The sequences capable of forming the hairpin are underlined in both universal
primers and the italicized T shows where the DABSYL quencher is tethered to a
base.
-26-
CA 02426812 2003-04-24
WO 02/34947 PCT/USO1/32630
~_
_ ,.
.-. O N
o ~ ~ N ~
z
,
0 o z z M
o c~ ~
z a z ~ ~ z z z
a ~ ~1 w ~ "' ~
' 1
y ~ ~ a ' " ' a a _ o
a o'
,
a d ~ ~ ~ ~ H ~ w
U
d ~"
~ U d H
~ d H d ~ U d H
C. ~ U
7
U d U U ~ U ~ ~ U
~ ~ U U
v C ~ U ~ U U
'7 U U U
E~
d U ~
v3 U C U ~ U C7 ~ ~ d
7
d U U
~ ~ U
d C V ~ d ~ U ~ E'"
U 7
t7 U C
7
U U U ~ ~ U
C C ~ ~ U C7 d
7 7 C7
~ U U U
d U H U U
d C (. C C
7 7 7 .7
N
N
O O N ~ M
O p N ~ M
zz ,..~_,~,.~~ Zz O NN O
O O
z ~~ ~o ~~ 0 0 rya zz o zz
0 o o
~r~o ~~ zz zz ~ A~ zz ~M r~r~
' A z ' r ' ~
a ~ z ' c ' ~
~. o w ~ A a o a
~ "'" ~ vv a r~ ~y as o a
a w
w
w aa aa
as
d o,0,~U ~~ ~~ ~~ ~ ~~' a
d c
~ d ~ U C7 d d
~ d E"' U U
U
7 ~ C7 C7 U W
C ~ U E-~
7
t
m _ d E-.,U d C7 .~ H C~ ~ U
. U U ~ d C7 d H 7 ~ U
~ C~7
~
3 ~ U ~, U d d U _ U U
~ U E..,U d d U H H U
E-'
U U U U ~' '~ d (~
U U U U F" d d
t'- d C7
C7 d ~ U d
t7 H U
~ ~ E. ~ ~ ~
U ~ ~ , ~
U ~ d
~ d
U U U C7 E-~
U d U d ~ d C7 E-' U ~
d d ~ d U
U U d ~ d d t7 d C7 d
U U d ~ d d C7 d C7
U E-~
U H
v C7 U d
C7 HH HH UU ~~ ~ UU U d
~
dd .7 ~H
7C U
C ~
d U U U U d E-~ E U
d U U U U d H E-~ ~
t-~ U C7 d H E C7 U
E-~ U C7 d H E- C7 U
U U d U U C7 d E~ U ~
U U d U U C7 d E-~ U U
U U U E-'C7
U U U E-~C7 UU d d ~
d d ~
UU dd dd UU dd .7C C ~~ C
7 .7C 7C
C 7 7
U U U C7 U
C7 U U U C7 U H U U ~ U
C7 d U U U U
C7 ~ d U C7 d E
C7 d d U C7 d -~
_; =
, i~i t7 C7 C~7 , c~i U U C7
~ C3 C7 O C7 C7 : H U U C7
,~ C7 C7 U E-
~ U
~-~~ ~ N ,~
N ~, ~ ~~ N ~
N N N
C N 'cd 'c~'cV ~ ~ ' ' i C
'cd 'c~ 'c~ 'cC'c~ ' ' C ' ' /1
' 'cV d b ' '
' '
d
'u~c d a a a c t c ~ c w
,~ d a a ,~ a c ~ ~ ~ !
a ~ ~ ~ 'W a ~
_' a a ' a a
.~ a a
O p
~ O
O
~ ~ Q~ ~ ~O o~ ~ CL
O
C d ~ d' d d N p '~T_ ' ~
.O
O
~O (~ r1 M
v~ z' 'z z' o
~ ~ ~ ~ ~ X ~ ..c
tn
U C
y O
d
b C
d m ~ N N d ~
0'
z ~ ~ z ~ .~ z ;~ ~ z u
.
o 0
I-' t-'v.. 4. t-' U
U (C
00 by
dD
cd
O
N ~
'~ O J O p
t~
O X y 'O a ~ p ~~ U CD
a' Q
= 'O v ~p y v 0. , pip WOO
l J U y ~ ~ _
V
~
N
C l C UN ~ ., N ~ -0
. ~ ~ '
'i
vLl
~ . O d 0.1 ~CaC '
y ~ r.
.. n
z v~ ~ ~~ yd GH
~
,- ~ x ~ x x o
-
o Q ~ o y .~ U a n
o v
C
Q .'~ O O O O "d O
N
O ~ 1J ~ 1 L p C
~ T
'-' v
'D v n m ,,n .O .-..' ...
N C3
,a
27
CA 02426812 2003-04-24
WO 02/34947 PCT/USO1/32630
H H
v ~ d ~ ~ H d
E-i H E'U -1H
t~ U d -~ E
d d H
. C7 (~ U U E, H U
d
- dd H UU C d~ C7~ U H
7
~ H
U U ~ ~ d ~ d ~ ~ ~ U
H H d
C~ H H
U d
'~ U U U H H d d U U H H
H
~ d
U H H C7
U
UU U 7t H dd V H ~ d a''
.7 U H H
C
o d d ~ U U U H
~ U U d U U
UU U HH d UCU7 H H U U
C7 C7 ~ C7 C7 ~ C7 C7 U U U
'
. .-. ~ .-. ~. .-. U d
n~ ~ . d ,-~ N E-~~ N d .~.
,-~ d U U ,--. d U
N N
a M ~ ~ U .~ ~ C7:-~ ~ C7~.~ U U
~s ~ ~ ~s i~ ~ ~ ~
v~ ~~ H : ~ H ~: H ~'. C7d
a~
..,
U N d o
~ H .o
U
U ~ ~ ~ ~
d U H ~ ~ H
U 3
C UH HU ~ U" ~ N
.7
UCH.7
C7 H H d
o
UU dCU7 HH HdU
o UUU UUH UHU H~H d
U U ~' d U E-a H
H U
'r' U H d C7 C7 C'7 C7
U H d d
H H H
_ U ~Y d ,'~'r H ~ ~ U ~7 d
H U ~
C7 U C7 U d H d C7 H
H d d '~ d d
d H d C7 U H U
d d ~
C7 d d H U H d U U d C7
U
dUC7 C'7UC7 UUU UHU' d
v~ C7 U H C7 U C7 d d d ,..._,
C7 H C7 t5
V ~ N ~ ~ .-. ~ O
" ~
d
'
L, p ~ M ~ . ~r
c
~..-. N
N ~...'cti p ~' M cd
b p
0
0
y,~ ~~ '~ " ~ ~ O
~ U ~~ C~ ~ v~
~ n ~
, zz ~~ ~~ ~ c~
v ~
~
... ~
~
n
~
0 0 ~
0 ~
v ~ ~ o~..~ ~ U j o _
' ( -~
C7
~'~.~ o ~U~ c~.N , Q"~
.b ,-. >, ~ ~, o 0
> ~ v
c~f ~ ~ >, ~ s..
U ~ cCf N ... >, U ;~ >,
N .~ ~ 00 N' d
. ~ ~ ~ ~ ~,, .-. II
O U
w. .fl a~ ,~ ~ ~ O. ~ O
~ p N N ~ ' ~
~ "' ~ ''
c C~
C A
U
Q ~ >, ~ .~ .
~ ~ ~ 'b ~ ~1.
~ H a C
c
o
C7 n a~ >, .~ ~ . ~, v ~
~ o v ~ a ~ U
> v U ~
~ x
~ N . .
a~
o, '
0
~ z
W a~ d c~ U ~ U
28
CA 02426812 2003-04-24
WO 02/34947 PCT/USO1/32630
1. Amplification: Amplification reactions were assembled in standard 96-well
polypropylene PCR plates reactions, which can be read directly on an a Victor
II
fluorescence plate reader (Wallac). Alternatively, reactions can take place in
tubes, and
then be transferred to plates for fluorescence measurements. The PCR
amplification
reaction mixture is listed below.
2 Reaction Mix: Final volume was 20 p.1:
Reagent Final Concentration
Genomic DNA ~40 ng
Oligonculeotide ?. Primer 250 nM each
Oligonucleotide 3 Primer 250 nM
Oligonucleotide 4-FAM {Seq ID 250 nM
No:l)
0liganucleotide 5-SR {Seq TD 250 nM
No:2)
MgCl~ 1.8 mM
KCi 50 mM
Tris HC1 {pH 8.3) 100 mM
dNTPs 200 ~tM each
rTaq Polymerase {Shuzo Co, Japan)0.5 units
Water to volume
*As an alternative enzyme, Platinum
Taq (BRL) was successfully used
with the same buffer.
3. PCR Reaction: The UltraPlates were sealed with cyclesealer (Robbins
Scientific), placed
onto the thermocycler block (Perkin-Elmer 9700) and preheated to 94°C.
After heating at
94°C for 5 minutes, 35 cycles of amplification (10 seconds at
94°C, 20 seconds at 55°C, 40
seconds at 72°C) followed.
4. Fluorescence measurement: Following the reaction, the plate was placed in a
black
support to prevent cross-talk, and fluorescence intensity was measured with
green and red
Filters. Several instruments were found to be adequate for the fluorescence
measurement of
the samples, two fluorescent plate readers and two digital cameras.
Measurements were performed using a Victor II fluorescence plate reader
(Wallac).
Additional emission and excitation filters for SR channel were installed by
the
manufacturer.
-29-
CA 02426812 2003-04-24
WO 02/34947 PCT/USO1/32630
Erample 2: Multiplex allele-specific PCR for detecting a SNP in the CYP 17
gene
1. Amplification Reaction: Samples of human genomic DNA were analyzed for the
presence of *2 allele in the CYP 17 gene. In particular, the DNA samples were
analyzed for
the presence of either the A-type or G-type allele.
PCR Amplification Reaction Primers
The unlabeled forward primer specific for the A-type allele comprised the
sequence
5'-gaaggtgaccaagttcatgctGCCACAGCTCTTCTACTCCACT (SEQ ID No: 12), where the
sequence identical to the 3'-portion of the FAM labeled primer is shown in
lower case.
The unlabeled forward primer specific for the G-type allele comprised the
sequence
5'-gaaggtcggagtcaacggattGCCACAGCTCTTCTACTCCACC, where the sequence identical
to the 3'-portion of the SR labeled primer is shown in lower case. The
nucleotides directed
to identifying the polymorphism are shown in bold. The reverse primer used in
the
reaction comprised the sequence GGCACCAGGCCACCTTCTCTT (SEQ ID No: 14).
The universal FRET primers used were identical to those described in Example
1.
2. Amplification Reaction
Three sets of amplification reactions were prepared to determine whether a
multiplex
PCR reaction would be capable of achieving a high level of allelic
discrimination.
Reaction 1 (Sin~leplex): The amplification reaction mixture using human
genomic DNA
was the same as that described in Example 1, with the following differences.
This reaction
only utilized the primer specific for the A-type allele, the FAM labeled
hairpin primer, and
the reverse primer.
Reaction 2 (Singleplex): The amplification reaction mixture using human
genomic DNA
was the same as that described in Example 1, with the following differences.
This reaction
only utilized the primer specific for the G-type allele, the SR-labeled
hairpin primer, and the
reverse primer.
Reaction 3 (lVlultiplex): The amplification reaction mixture using human
genomic DNA was
the same as that described in Example 1. This reaction used both of the
fot~~ard primers, i.e.,
the primer specific for the G-type allele and the primer specific for the A-
type allele, the SR-
labeled hairpin primer, the FAM-labeled hairpin primer, and the reverse
primer. This
reaction is exemplary of multiplex PCR amplification because both allele
specific primers are
present in the same reaction.
-30-
CA 02426812 2003-04-24
WO 02/34947 PCT/USO1/32630
3. PCR Reaction
The three sets of reactions each included three 'no DNA controls' (NDC). The
mixtures were preheated at 94°C for 3 min and subjected to
thermocycling (PCR) for 35
cycles of 10 sec at 94°C, 20 sec at 55°C, and 40 sec at
72°C.
4. Fluorescence measurement
Following PCR, the relative fluorescence was measured in a plate reader, using
emission filters 585 nm for FAM and 620 nm for SR. The average fluorescent
signal in no
DNA controls was subtracted from the corresponding signal of each sample
reaction, and
the corrected fluorescent signal is shown on the plot. (Figure 5B).
5. Results
The results are shown in Figures 5A and 5B. Figures 5A and 5B show that the A-
specific primer had produced FAM signal on both A-type and G-type DNA (1 and
2), and
the G-specific primer produced SR signal with both A-type and G-type DNA (3
and 4).
Hence, when these primers were taken separately, the allelic discrimination
was low and
not sufficient to distinguish between the types of DNA. When both the A-
specific and G-
specific primers, however, were present simultaneously (reaction 3, multiplex
PCR), (5 and
6) .
Example 3: lVlultinlex allele-specific PCR for detecting a SNP in the HER2
Eene
1. Amplification Reaction: Samples of genomic DNA were analyzed for the
presence of a
SNP in the HER2 gene. In particular, the DNA samples were analyzed for the
presence of
either the A-type or G-type allele.
PCR Amplification Reaction Primers
The primers and target sequence are summarized in Table 2(A). The unlabeled
forward primer specific for the A-type allele comprised the sequence
5'-gaaggtgaccaagttcatgctGCCAACCACCGCAGAGAT (SEQ ID No: XX), where the
sequence identical to the 3'-portion of the FAM labeled primer is shown in
lower case and
the nucleotide directed to identifying the polymorphism is shown in bold. The
unlabeled
forward primer specific for the G-type allele comprised the sequence
-31-
CA 02426812 2003-04-24
WO 02/34947 PCT/USO1/32630
5'-gaaggtcggagtcaacggattGCCAACCACCGCAGAGAC (Seq ID No: XX), where the
sequence identical to the 3'-portion of the SR labeled primer is shown in
lower case, and
the nucleotide directed to identifying the polymorphism is shown in bold. The
reverse
primer used in the reaction comprised the sequence TCAATCCCTGACCCTGGCTT (SEQ
ID No: XX). The universal FRET primers used were identical to those described
in
Example 1.
2. ll~Iultiplex Amplification Reaction
The amplification reaction mixture using genomic DNA was the same as that
described in Example 1. This reaction used both of the forward primers, i.e.,
the primer
specific for the G-type allele and the primer specific for the A-type allele,
the SR-labeled
hairpin primer, the FAM-labeled hairpin primer, and the reverse primer.
3. PCR Reaction
The PCR reactions each included four 'no DNA controls' (NDC). The mixtures
were preheated at 94°G for 3 min and subjected to thermocycling (PCR)
for 35 cycles of 10
sec at 94°C, 20 sec at 55°C, and 40 sec at 72°C.
4. Fluorescence measurement
Following PCR, the relative fluorescence was measured in a plate reader, using
emission filters 585 nm for FAM and 620 nm for SR. The average fluorescent
signal in no
DNA controls was subtracted from the corresponding signal of each sample
reaction, and
the corrected fluorescent signal is shown on the plot. (Figures 6A and 6B).
5. Results
The results are shown in Figures 6A and 6B. The figure illustrates good
allelic
discrimination when both the A-specific and G-specific primers were present
simultaneously.
Example 4: lVlultiplex allele-specific PCR for detecting a SNP in CYP2C8 gene
by
brid i~ng the polymorphism
~. Amplification Reaction: Samples of genornic DNA were analyzed for the
presence of a
SNP in the CYP2C8 gene. In particular, the DNA samples were analyzed for the
presence of
-32-
CA 02426812 2003-04-24
WO 02/34947 PCT/USO1/32630
either the C-type or T-type allele. The primers used in this reaction differ
from each other.
The primer specific for the T-type allele will bridge the polymorphism because
a nucleotide
other than its 3' terminal nucleotide differs.
PCR Amplification Reaction Primers
The primers and target sequence are summarized in Table 2(B). The unlabeled
forward primer specific for the C-type allele comprised the sequence
5'-gaaggtgaccaagttcatgctGTTGCAGGTGATAGCAGATCG (SEQ ID No: XX), where the
sequence identical to the 3'-portion of the FAM labeled primer is shown in
lower case, and
the nucleotide directed to identifying the polymorphism is shown in bold. The
unlabeled
forward primer specific for the T-type allele comprised the sequence
5'-gaaggtcggagtcaacggattGTTGGAGGTGATAGCAGATAG (Seq ID No: XX), where the
sequence identical to the 3'-portion of the SR labeled primer is shown in
lower case, and
the nucleotide directed to identifying the polymorphism is shown in bold. With
this primer,
the second nucleotide removed from the 3' terminus of the primer differs
rather than the 3'
terminal nucleotide. The reverse primer used in the reaction comprised the
sequence
TGCTTCATCCCTGTCTGAAGAAT (SEQ ID No: XX). The universal FRET primers
used were identical to those described in Example 1.
2. l~~IultipleY Amplification Reaction
The amplification reaction mixture using genomic DNA was the same as that
described in Example 1. This reaction used both of the forward primers, i.e.,
the primer
specific for the c-type allele and the primer specific for the t-type allele,
the SR-labeled
hairpin primer, the FAM-labeled hairpin primer, and the reverse primer.
3. PCR Reaction
The PCR reactions each included four 'no DNA controls' (NDC). The mixtures
were preheated at 94°C for 3 min and subjected to thermocycling (PCR)
for 35 cycles of 10
sec at 94°C, 20 sec at 55°C, and 40 sec at 72°C.
-33-
CA 02426812 2003-04-24
WO 02/34947 PCT/USO1/32630
4. Fluorescence measurement
Following PCR, the relative fluorescence was measured in a plate reader, using
emission filters 585 nm for FAM and 620 nm for SR. The average fluorescent
signal in no
DNA controls was subtracted from the corresponding signal of each sample
reaction, and
the corrected fluorescent signal is shown on the plot. (Figures 7A and 7B).
5. Results
The results are shown in Figures 7A and 7B. The figure illustrates good
allelic
discrimination when both the C-specific and T-specific primers were present
simultaneously.
Example 5: Multiple~c allele-specific PCR for detectin g a SNP in HTR2C gene
by
brid ing the polymorphism
1. Amplification Reaction: Samples of genomic DNA were analyzed for the
presence of a
SNP in the HTR2C gene. In particular, the DNA samples were analyzed for the
presence of
either the C-type or G-type allele. The primers used in this reaction will
bridge the
polymorphism because the 3 nucleotide removed from the 3' terminal nucleotide
differs.
PCR Amplification Reaction Primers
The primers and target sequence are summarized in Table 2(C). The unlabeled
forward primer specific for the C-type allele comprised the sequence
5'-gaaggtgaccaagttcatgctGGGCTCACAGAAATATCAGAT (SEQ ID No: XX), where the
sequence identical to the 3'-portion of the FAM labeled primer is shown in
lower case and
the nucleotide directed to identifying the polymorphism is shown in bold. The
unlabeled
forward primer specific for the T-type allele comprised the sequence
5'-gaaggtcggagtcaacggattGGGCTCACAGAAATATCACAT (Seq ID No: XX), where the
sequence identical to the 3'-portion of the SR labeled primer is shown in
lower case and the
nucleotide directed to identifying the polymorphism is shown in bold. With
this primer, the
second nucleotide removed from the 3' terminus of the primer differs rather
than the 3'
terminal nucleotide. The reverse primer used in the reaction comprised the
sequence
TGCACCTAATTGGCCTATTGGTTT (SEQ ID No: XX). The universal FRET primers
used were identical to those described in Example 1.
-34-
CA 02426812 2003-04-24
WO 02/34947 PCT/USO1/32630
2 Multinler Amplification Reaction
The amplification reaction mixture using genomic DNA was the same as that
described in Example 1. This reaction used both of the forward primers, i.e.,
the primer
specific for the G-type allele and the primer specific for the G-type allele,
the SR-labeled
hairpin primer, the FAM-labeled hairpin primer, and the reverse primer.
3. PCR Reaction
The PCR reactions each included four 'no DNA controls' (NDC). The mixtures
were preheated at 94°C for 3 min and subjected to thermocycling (PCR)
for 35 cycles of 10
sec at 94°C, 20 sec at 55°C, and 40 sec at 72°C.
4. Fluorescence measurement
Following PCR, the relative fluorescence was measured in a plate reader, using
emission filters 585 nm for FAM and 620 nm for SR. The average fluorescent
signal in no
DNA controls was subtracted from the corresponding signal of each sample
reaction, and
the corrected fluorescent signal is shown on the plot. (Figures 8A and 8B).
5. Results
The results are shown in Figures 8A and 8B. The figure illustrates good
allelic
discrimination when both the C-specific and G-specific primers were present
simultaneously.
Example 6: Multiplex allele-specific PCR for detecting a deletion in the CCRS
gene
1. Amplification Reaction: Samples of genomic DNA were analyzed for the
presence of a
deletion in the CCRS gene. Tn particular, the DNA samples were analyzed for
the presence of
absence of the gene deletion.
PCR Amplification Reaction Primers
The primers and target sequence are summarized in Table 2(D). The unlabeled
forward primer specific for the wild-type allele comprised the sequence
5'-gaaggtgaccaagttcatgctCTCATTTTCCATACAGTCA (SEQ ID No: XX), where the
sequence identical to the 3'-portion of the FAM labeled primer is shown in
lower case and
-3 5-
CA 02426812 2003-04-24
WO 02/34947 PCT/USO1/32630
the nucleotide directed to identifying the wild-type allele is shown in bold.
The unlabeled
forward primer specific for the mutant allele comprised the sequence
5'-gaaggteggagtcaacggattgcagctctcattttccatacatta (Seq ID No: XX), where the
sequence
identical to the 3'-portion of the SR labeled primer is shown in lower case.
The reverse
primer used in the reaction comprised the sequence ACCAGCCCCAAGATGACTATCTT
(SEQ ID No: XX). The universal FRET primers used were identical to those
described in
Example 1.
2. lYlultipleY Amplification Reaction
The amplification reaction mixture using genomic DNA was the same as that
described in Example 1. This reaction used both of the forward primers, i.e.,
the primer
specific for the wild type-allele and the primer specific for the mutant-
allele, the SR-labeled
hairpin primer, the FAM-labeled hairpin primer, and the reverse primer.
3. PCR Reaction
The PCR reactions each included four 'no DNA controls' (NDC). The mixtures
were preheated at 94°C for 3 min and subjected to thermocycling (PCR)
for 35 cycles of 10
sec at 94°C, 20 sec at 55°C, and 40 sec at 72°C.
4. Fluorescence measurement
Following PCR, the relative fluorescence was measured in a plate reader, using
emission filters 585 nm for FAM and 620 nm for SR. The average fluorescent
signal in no
DNA controls was subtracted from the corresponding signal of each sample
reaction, and
the corrected fluorescent signal is shown on the plot. (Figures 9A and 9B).
5. Results
The results are shown in Figures 9A and 9B. The figure illustrates good
allelic
discrimination when both the wild type-specific and mutant-specific primers
were present
simultaneously.
-36-
