Note: Descriptions are shown in the official language in which they were submitted.
CA 02429679 2003-05-23
1
DESCRIPTION
HD3A GENE INDUCING FLOWERING OF PLANT AND UTILIZATION THEREOF
Technical Field
The present invention relates to genes that induce flowering
in plants, and methods for modifying the flowering time of plants
using the genes . The methods for modifying the flowering time of plants
are useful for plant breeding and such.
Background Art
Ger.erally, heading (flowering) of rice is promoted bv short-day
conditions and delaved bylong-dayconditions. A.mong known cultivars,
typically those from Kyushu and the south of Mainland Japan have strong
photoperiod sensitivity whereas cultivars from the Tohoku district
or Hokkaido show complete loss of such ser.s~.tivity or have extremely
weak photoperiod sensitivity. Rice plants that lack the photoperiod
sensitivity have a characteristic to flower after a certain length
of growth period, and the heading date of the plant does not change
with changes in photoperiod. Adaptation of rice plants in particular
locations and seasons drastically changes in accordance with the
ex_stenceofphotoperiodsensitivityin the plant. Thus,modification
of photoperiod sensitivity in rice is an important aspec-_ of rice
breed'yng.
In conventional breeding programs, the alteration of the heading
da7-e of rice is ach;_eved through methods invo-vir.g: (1) seiection
of early maturing varieties or late varieties by crossing; and (2)
mutagenesis by rad;~ation and chemicals; and so on. However, such
breeding programs require long periods of time -:o be successful, and
bear other problems, such as unpredictabilityof the degree or direction
of the variation in the progeny.
The term "photoperiod sensitivity gene" is a generic term for
genes that enhance the rice photoperiod sensitivity in the field of
rice genetics. The existence of several photoperiod sensitivity genes
has been observed to be inherent in mutants and cultivars, and
photoperiod sensitivity genes are suggested to exist on loci, for
CA 02429679 2003-05-23
2
example, such as Sel locus (chromosome 6; Yokoo and Fujimaki (1971)
Japan. J. Breed. 21:35-39) , El locus (chromosome 7; Tsai, K.H. (1976)
Jpn. J. Genet. 51: 115-128; Okumoto, Y. et al. (1992) Jpn. J. Breed.
42: 415-429), E2 locus (unknown), E3 locus (chromosome 3; Okumoto
et al. Japanese Society of Breeding, 91st lecture, Japanese Journal
of Breeding 47(Suppl.1): 31), and so on (Yamagata et al. (1986) In
Rice Genetics, International Rice Research Ir.s-.itute, Manilla,
pp351-359).
When a photoperiod sensitivity gene of rice or a gene regulating
the heading of rice under the control of the photoperiod sensitivity
gene is isolated, introduction of the gene into any desired rice cultivar
by a transformati on method makes it possible to control the heading
time of the rice cultivar. Furthermore, theflowering timeof various
plants can be controlled by utilizing genes of other plants
corresponding to such rice photoperiod sensitivity gene. This kind
of breeding method can be sa'-d to be extremely advantageous compared
to conventional methods in the aspect of convenience and reliability.
Oisclosure of the Invention
The present invention was made in view of these circumstances.
An obj ect of the present invention is to provide novel genes controlling
-z:he flowering of a plant. Furthermore, another object of the present
invention is to modify the flowering time of a plant using such genes.
The present inventors particularly Tocused or.rice among plants,
for which the development of a conven-Jent method for modzfying the
heading time (flowing time) is strongly desired, and actively pursued
the isolation of genes associated with the heading of rice.
In rice, Hd3a, a quantitative trait loci (QTL) , detected by using
progenies derived from a cross between Nipponbare and Kasalath, had
been revealed to be located on the short arm of chromosome 6.
Furthermore, the analysis using a nearly isogenic line of Hd3a region
(allele of Kasalath) having the genetic background of Nipponbare
revealed that the Hd3a locus is identical to a photoperiod sensitivity
gene locus promoting heading under short-day condition.
To isolate the photoperiod sensitivity gene Hd3a, which had been
known to exist but had not yet been identified, the present inventors
CA 02429679 2003-05-23
3
first mapped the Hd3a gene regior. by linkage analysis with P1-derived
artificial chromosome (PAC) clones. Specifically, detailed ~inkage
analysis of the Hd3a region was performed with a large segregating
population essential for map base cloning. First, using the
segregating population ofthe Hd3aregion,alinkage map wasconstructed
using restriction fragment leng=h polymorphism (RFLP) markers and
i t was proved that Hd3a was located in the interval between RELP markers
C764 and B174 (Monna, et al., the 1999 Annual Meeting of Japanese
Society of Molecular Biology) Furthermore, utilizing cleaved
amplified polymorphic sequence (CAPS) markers CP13 and CP15 flanking
both sides of Hd3a, plants having chromosomes with a recombination
occurred in the vicinity of Hd3a were selected from a populatior, having
the Hd3a region segregated to determine their genotype by the progeny
assay. Eight (8) individuals having recombination between the Hd3a
and CP13 were identified, two (2) between Hd3a and CP15.
Next, the present inventors conducted alignment of the Hd3a gene
region using P1-derived artificial chromosome (PAC) clones.
Specifically, 3 types of PAC clones having sequences of DNA markers
exist-ing in the vicinity of the Hd3a locus were screened from the
Nipponbare PAC genomic library. P0046E09 and P0698G05 clones had the
nucleotide sequences of markers, CP13 and CP15, which are flanking
both sides of Hd3a, and thus these PAC clones were revealed to comprise
the Hd3a gene region (Fig. 1) . As a result of nucleotide sequence
analvsis of the PAC clone P0046E09, the candidate genomic region was
limited within a region of about 20 kb. Gene prediction and homology
search against the nucleotide sequence of this candidate region
detected regions showing high homoiogy to the lipid transfer protein,
acyl-CoA synthase genes, and FT gene of Arabidopsis.
Then, the expression of these candidate genes was analyzed by
RT-PCR using Nipponbare and a nearlyisogenicline (NIL (Hd3a)) wherein
the Hd3a gene region had been substituted with Kasalath chromosome
segment. As a result, expression of all the three genes was confirmed,
and increase in the transcription level of the FT-like gene was observed
undershort-daycondition(Fig.2). Thus, the FT-likegene wasselected
as the potential Hd3a candidate gene.
A cosmid library was constructed from the genomic DNA of Kasalath.
CA 02429679 2003-05-23
4
A clone corresponding to the FT-like gene region was screened from
the cosmid library (Fig. 1) , and the nucleotide sequence of the FT-like
gene regionwas analvzed. As a result, mutations at 41 sites (insertion,
deletion, and substitution of nucleotides) were found in that of
Kasalath as compared to the nucleotide sequence of Nipponbare (Fig.
3) . A nucleotide substitution within the exon caused an amino acid
substitution of asparagine (Kasalath) to proline (Nipponbare) (Fig.
3).
Next, the present inventors introduced a fragment cor_=aining
only the candidate gene region of Kasalath or Nipponbare into a
transformable vector to transform rice plants, and analyzed the
phenotype of the resulting transformant. As a result, among the plants
having these genes introduced appeared plants that showed early heading
under both short-day and long-day conditions. However, significant
changes in the head'_ng time were not observed among plants introduced
with the vector alone (Tab'-e 1) . Furthermore, self-pollina-_ed
progenies from the transformed plants that showed early-heading under
short-day condition were cultivated to examine the difference in the
number of days from sowing to heading (days to heading) . As a result,
plants showing early heading time compared to the control were
segregated, and al'~~ the plants showing eariv heading contained the
introduced gene (Fig. 4) Similarly, under long-day condit4ons, in
contrast to the cor.tro? that di d not reach the heading stage, heading
plants was observed among the above-described self-pol7_ina=ed
progenies, and all of such plants retained the introduced fragment
(Fig. 4).
The above-described results confirmed that the candidate r7-1 ike
gene has the funct_on to promote the heading (flowering) of rice,
and it was concluded that the candidate F-7-like gene is Hd3=- gene.
The Hd3a gene is widely distributed in plants and is suggested to
be associated with the induction of flowering of these plants.
Finally, the present inventors succeeded in isolating t',:e Hd3a
gene that induces flowering of plant. The present inventors also found
that the flowering time of plants can be modified using the gene,
and completed the present invention.
More specifically, this invention provides the following:
CA 02429679 2003-05-23
(1) a DNA encoding a protein derived from plants which induces
the flowering of plants, wherein said DNA is selected fro:n the group
consisting of:
(a) a DNA encoding the protein comprising the amino acid sequence
5 of SEQ ID NO: 2 or 4;
(b) a DNA encodir.g the protein co:nprising the amino ac-~d sequence
of SEQ ID NO : 2 or 4, wherein one or more of the amino acids are substituted,
deleted, added, and/or inserted; and
(c) a DNA hybridizing under s--ringent conditions w'_th the DNA
consisting of the nucleotide sequence of any one of SEQ ID NO: 1,
3, 23 or 24;
(2) the DNA of (1) , wherein the DNA is derived from rice;
(3) a DNA encoding an antisense RNA complementary to the
transcription product of the DNA of (1) or (2);
(4) a DNA encoding an RNA having the activity of a ribozyme
that specifically digests the transcription product of the DNA of
(1) or (2) ;
(5) a DNA encoding an RNA that represses the expression of the
DNA of (1) or (2) upon expression in a planz cell due to a co-repressing
effect;
(6 ) a DNA of ( 1 ) or ( 2), wherein the DNA is used to induce the
fiowering of plant;
(7) a DNA of any one of (3) to (5) , wherein the DNA is used
to suppress the flowering of plar.t;
(8) a vector comprising the DNA of any one of (1) to (5);
(9) a plant cell introduced with the vector of (8);
(10)a plant transformant comprising the plant cei~_ of (9)
(11)"the :plant transformant of (10) , wherei;,, said =plant
transformant is rice;
(12) a piant transformant which is a progeny or a c-one of the
plant transformant of (10) or (11) ;
(13)a breeding material of the plant transformant of any one
of (10) to (12);
(14) a method for producing a plant transformant of (10)
or (11), which comprises the following steps of:
(a) introducing the DNA of (1) or (2) into a plant cell, and
CA 02429679 2003-05-23
6
(b) regenerating a plant from the plant cell;
(15) a method for inducing the flowering of plant, wherein
said method comprises the step of expressing the DNA of (1) or (2)
in cells of the plant body;
(16) a method for suppressing the flowering of plant, which is
characterized by the repression of the expression of endogenous DNA
of (1) or (2) in cells of the plant body;
(17) the method of (16) , which comprises the step of expressing
the DNA of any one of (3) to (5) in cells of the plant body; and
(18) the method of any one of (14) to (17) , wherein the plant
is rice.
The present invention provides DNA encoding the Hd3a protein.
The nucleotide sequences of Hd3a genomic DNA and cDNA of Kasalath
are set forth in SEQ ID NO: 1 and SEQ ID NO: 23, respective~~_y, and
the amino acid sequence of protein encoded by these DNAs in SEQ ID
NO: 2. Furthermore, the nucleotide sequences of Hd3a genomic DNA and
cDNA of Nipponbare are set forth in SEQ ID NO: 3 and SEQ ID NO: 24,
respectively, and the amino acid sequence of protein encoded bv these
DNAs in SEQ ID NO: 4.
Hd3a is one of quantitative trait loci (QTL) -zhat was de =ected
using the progeny derived from a cross between Nipponbare and Kasalath,
and was proved to be located on the short arm of chromosome 6.
Furthermore, analysis of the nearly isogenic llne of the Kasalath
allele of Hd3a with the genetic background of Nipponbare revealed
that the Hd3a locus promotes heading under short-day condition.
Although Hd3a is known to be a gene having the action to promote
heading under short-day condition existing anywhere within a broad
region of the short arm of=rice chromosome 6, the gene itself has
notyetbeen identifiedor isolatec'i. Thepresent inventors have f_nal ly
elucidated the existing region cf Hd3a through complicated steps,
succeeding for the first time in isolating the Hd3a gene as a single
gene.
Currently, the control of heading time is an important -zarget
in the breeding of rice cultivars in Japan. In cold districts, due
to the early arrival of autumn and low temperatures, the control of
heading time is critical to avoid cold-weather damage. On the other
CA 02429679 2003-05-23
7
hand, in southwest warm regions, to avoid concentrated harvesting
labor in large scale rice growing zones, fine modification of heading
date of rice is required.
Hd3a has the function to induce flowering. Therefore, the use
of the sense strand of Hd3a gene for trans formation enables the promotion
of the heading in rice (flowering) . On the other hand, theintroduction
of the gene in the antisense direction enables the suppression of
flowering. The time needed f or such transformation techniquesin plant
breeding is remarkably short as compared to gene transfer by cross
breeding. Furthermore, the fact that the transformation does not
accompany other changes of the trait is also beneficial. Accordingly,
the flowering time of a plant can be readilv altered using the isolated
Hd3a gene. Therefore, the gene contributes to the breeding of rice
cultivars particularly adapted to different districts. Furthermore,
the heading time of plants can be diversified and novel plant cultivars
may be bred for cultivars that are deficient in the Hd3a gene by
introducing the geneby genetic recombination, and f or cultivars having
the gerie, by controlling the expression of the gene using antisense
DNA or ribozymes.
DNAs encoding an Hd3a protein of the present invention include
genomic DNAs, cDNAs, and chemically synthes ized DNAs. A genomic DNA
and cDNA can be prepared according to conventional methods known to
those skilled in the art. More specifically, a genomic DNA can be
prepared, for example, as follows: (1) extract genomic DNA from rice
cultivars having an Hd3a gene (e.g. Kasalath or Nipponbare); (2)
construct a genomic library (utilizing a vector, such as plasmid,
phage, cosmid, BAC, PAC, and so on) ; (3) spread the library; and (4)
conduct colony hybridization or plaque jiybridi.zation using a probe;
prepared based on the DNA encoding a proteir of the present invention
(e.g. SEQ ID NO: 1, 3, 23, or 24) . Alternatively, a genomic DNA can
be prepared by PCR, using primers specific to a DNA encoding a protezn
of the present invention (e.g. SEQ ID NO: 1, 3, 23, or 24) . On the
otherhand, cDNAcanbeprepared, forexample, asfol-lows: (1) synthesize
cDNAs based on mRNAs extracted from rice cultivars having an Hd3a
gene (e.g. Kasalath or Nipponbare); (2) prepare a cDNA library by
inserting the synthesized cDNA into vectors, such as XZAP; (3) spread
CA 02429679 2003-05-23
8
the cDNA library; and (4) conduct colony hybridization or plaque
hybridization as described above. Alternatively, cDNA can be also
prepared by PCR.
The present invention includes DNAs encoding proteins
functionally equivalent to the Hd3a protein of SEQ ID NO : 2 or 4 (Kasalath
orNipponbare). Herein,theterm"functionally equivalentto the Hd3a
protein" indicates that the object protein has the function of
introducing the flowering of plant. Such DNAs are derived preferably
from monocotyledonous plants, more preferably from Gramineae, and
most preferably from rice.
ExamplesofsuchDNAsinclude those encoding mutants, derivatives,
alleles, variants, and homologues comprising the amino acid sequence
of SEQ ID NO: 2 or 4 wherein one or more amino acids are substituted,
deleted, added and/or inserted.
Examples of methods for preparing a DNA encoding a protein
comprising altered amino acids well known to those skilled in the
art include the site-directed mutagenesis (Kramer, W. and Fritz, H.
-J., (1987) "Oligonucleotide-directed construction of mutagenesis
via gapped duplex DNA." Me--hods in Enzymology, 154: 350-367). The
amino acid sequence of a protein may also be mutated in nature due
to the mutation of a nucleotide sequence. A DNA encoding proteins
having the am~no acid sequence of a natural Hd3a protein wherein one
or more amino acids are substituted, deleted, and/or added are alSo
included in the DNA of the present inventi on, so long as they encode
a protein functionally equivalent to a natural Hd3a protein (SEQ ID
NO: 2 or 4) . Additionaliy, nucleotide sequence mutants tha= do not
give rise to amino acid sequence changes in the protein (deaeneracy
mutants) are also included in the DNA of the present invention.
Whether a DNA encodes a protein that induces flowering of a plant
or not can be assessed by, for example, as follows: cultivate the
plant introduced with a test DNA in a growth chamber wherein the
photoperiod can be modified; and examine the number of days required
from sowing to flowering (from sowing to heading in rice) . Under any
photoperiod conditions, a protein is considered to have the flowering
promoting-function when it promotes the flowering of a plant compared
to a control plant. The flowering promoting-function can be
CA 02429679 2003-05-23
9
particularly readily proven under a photoperiod condition wherein
the flowering of the control plant is suppressed, for example, under
long-day conditions (14 to 16 h) for rice, due to the expected widened
difference in the flowering time with the comparative control.
A DNA encoding a protein functional ly equivalent to an Hd3a protein
described in SEQ ID NO: 2 or 4 can be produced, for example, by methods
well known to those skilled in the art including: hybridization
techniques (Southern, E.M. (1975) Journal of Molecular Biology 98:
503.); and polymerase chain reaction (PCR) techniques (Saiki, R. K.
et al . (1985) Science 230: 1350-1354; Saiki, R. K. et al. (1988) Science
239: 487-491) That is, it is routine for a person skilled in the
art to isolate a DNA with high homology to the Hd3a gene from rice
and other plants using the nucleotide sequence of an Hd3a gene (SEQ
ID NO : 1, 3, 23, or 24) or parts thereof as a probe, and oligonucleotides
hybridizing specifically to the nucleotide sequence of the Hd3a gene
(SEQ ID NO: 1, 3, 23, or 24) as a primer. Such DNA encoding proteins
functionally equivalent to an Hd3a protein, obtainable by
hybridization techniques or PCR techniques, are included in the DNA
of this invention.
Hybridization reactions to isolate such DNAs are preferably
conducted under stringent conditions. S-!_-ringent hybridization
conditions of the present invention include conditions such as: 6
M urea , 0.4% SDS, and 0. 5x SSC ; and those which yieid a s imilar stringency
to the conditions. DNAs with higher homology are expected when
hybridization is performed under conditions with higher stringency,
for example, 6 M urea, 0.4% SDS, and 0.1x SSC. Those DNAs isolated
under such conditions are expected to encode a protein having a high
amino acid level homology with an N.d3a protein (SEQ ID NO; 2 or 4)
Herein, high homo'_ogy means an identity of at least 50% or more, more
preferably 70% or more, and much more preferably 90% or more (e.g.
95% or more), through the entire amino acid sequence.
The degree of homology of one amino acid sequence or nucleotide
sequence to another can be determined by following the algorithm BLAST
by Karlin and Altschul (Proc. Natl. Acad. Sci. USA 90: 5873-5877,
1993) . Programs such as BLASTN and BLASTX developed based on this
algorithm (Altschul et al. (1990) J. Mol. Biol. 215: 403-410) may
CA 02429679 2006-03-31
be used. To analyze a nucleotide sequence according to BLASTN
based on BLAST, the parameters are set, for example, as score=
100 and word length= 12. On the other hand, parameters used for
the analysis of amino acid sequences by the BLASTX based on
5 BLAST include, for example, score= 50 and word length= 3.
Default parameters of each program are used when using BLAST and
Gapped BLAST program. Specific techniques for such analysis are
known in the art.
For example, plant transformants with modified the
10 flowering time can be created using a DNA of the present
invention. More specifically, a DNA encoding a protein of the
present invention is inserted into an appropriate vector; the
vector is introduced into a plant cell; and then, the resulting
transformed plant cell is regenerated. The Hd3a gene isolated
by the present inventors functions to induce the flowering.
Therefore, the flowering time of arbitrary cultivars can be
controlled by transforming the cultivars with the gene and
expressing the same. The time needed for transformation is
remarkably short as compared to ordinary gene transfer by
crossing. Furthermore, the fact that the transformation does
not accompany other changes of the trait is also beneficial.
On the other hand, a plant transformant with repressed
flowering can be created using DNA that represses the expression
of a DNA encoding a protein of the present invention: wherein
the DNA is inserted into an appropriate vector, the vector is
introduced into a plant cell, and then, the resulting
transformed plant cell is regenerated. The phrase "repression
of expression of DNA encoding a protein of the present
invention" includes repression of gene transcription as well as
repression of translation to protein. It also includes not only
the complete suppression of DNA expression but also a reduction
in expression.
The expression of a specific endogenous gene in plants can
be repressed using antisense technology methods, which are
commonly used in the art. Ecker et al. were the first to
demonstrate the antisense effect of an antisense RNA introduced
by electroporation in plant cells using the transient gene
expression method (J. R. Ecker and R. W. Davis (1986) Proc.
Natl. Acad. Sci. USA 83: 5372). Thereafter,
CA 02429679 2003-05-23
11
the target gene expression was reportedly reduced in tobacco and
petunias by expressing antisense RNAs (A. R. van der Krol et al. (1988)
Nature 333: 866) . The antisense technique has now been established
as a means to repress target gene expression in plants.
Multiple factors cause repression of the target gene expression
by antisense nucleic acid. These include: inhibi tion oftranscription
initiation resulting from triple strand formation; repression of
transcription resulting from hybrids formed at the site where the
RNA polymerase has formed a local open loop structure; transcription
inhibition resulting from hybrid formation with the RNA being
synthesized; repression of splicing resulting from hybrid formation
at the junction between ar_ intron and an exon; repression of splicing
resulting f rom hybridformation at the site of spliceosome formation;
repression of mRNA translocation from the nucleus to the cytoplasm
resulting from hybrid formation with mRNA; repression of splicing
resulting from hybrid formation at the capping site or at the poly
A addition site; repression of translation initiatior.resulting from
hybri d formation a-:: the biinding site for the translation i ni tiat'ion
factors; repression of translation resulting from hybrid formation
at the site for ribosome binding near the initiation codon; inhibition
of peptide chain elongation resulting from hybrid formation in the
translated region or at :.he polysome b_nding sites of mRNA; and
repression of gene expression resulting from hybrid formation at the
sites of ;~n teraction be tween nucleic acids and proteins . Thesefactors
repress the target gene expression by inhibiting the process of
transcription, splicing, or translation (Hirashima and Inoue, "Shin
Seikagaku Jikken Koza (New Biochemistry Experimentation Lectures)
2, Kakusan (Nucleic Acids) IV, Idenshi No Fukusei To Hatsqgen
(Replication and Expression of Genes)," Nihon Seikagakukai Hen (The
Japanese Biochemical Society), Tokyo Kagaku Dozin, pp. 319-347,
(1993)).
Accordingly, an antisense sequence of the present invention can
repress the target gene expression by any of the above mechanisms.
In one embodiment, if an antisense sequence is designed to be
complementary to the untranslated region near the 5' end of the gene's
mRNA, it will effectively inhibit translation of a gene. It is also
CA 02429679 2003-05-23
12
possible to use sequences complementary to the coding regions or to
the untranslated region on the 3' side. Thus, the anti sense DNA used
in the present invention includes DNA having antisense sequences
against both the untranslated regions and the translated regions of
the gene. The antisense DNA to be used is connec:.ed downstream of
an appropriate promoter, and, preferably, a sequence containing the
transcription --ermination signal is connected on the 3' side. The
DNA thus prepared can be transfected into the desired plant by known
methods. The sequence of the antisense DNA is preferably a sequence
complementary to the endogenous gene of the plant to be transformed
or a part thereof, but it need not be perfectly complementary, so
long asitcan effectivelyinhibit the gene expression. Thetranscribed
RNA is preferably at least 90%, and more preferab'-y at least 95%
complementary to the transcribed products of the targetgene. In order
to effectively inhibit the expression of the target gene by means
of an antisense sequence, the antisense DNA should be at least 15
nucleotides long, more preferably at least 100 nucleotides long, and
still more preferably at least 500 nucleotides lor:g. However, the
antisense DNA to be used is generally shorter than 5 kb, and preferably
shorter than 2.5 kb.
DNAs encoding ribozymes can also be used to repress the expression
of endogenous genes. A ribozyme is ar. RNA molecule -.hat has catalytic
activities. There are many ribozymes having various activ4lties.
Research on ribozymes as RNA cleaving enzymes has enabled the design
ofa ribozyme thatsite-specificallycleavesRNA. Whi'_esomeribozymes
of the group I intron type or the M1RNA contained i~. RNaseP consist
of 400 nucleotides or more, others belonging to the ::ammerhead type
or the hairpin type have an activity domain of about 40 nucleotides
(Makoto Koizumi and Eiko Ohtsuka (1990) Tanpakushi_su Kakusan Kohso
(Nucleic acid, Protein, and Enzyme) 35: 2191).
The self-cleavage domain of a hammerhead type ribozyme cleaves
at the 3' side of C15 of the sequence G13U14C15. Formation of a
nucleotide pair between U14 and A at the ninth position is considered
to be important for the ribozyme activity. Furthermore, it has been
shown that the cleavage also occurs when the nucleo=ide at the 15th
position is A or U instead of C(M. Koizumi et al. (1988) FEBS Lett.
CA 02429679 2003-05-23
13
228: 225) . If the substrate binding site of the ribozyme is designed
to be complementary to the RNA sequences adjacent to the target site,
one can create a restriction-enzyme-like RNA cleavir{g ribozyme which
recognizes the sequence UC, UU, or UA within the target RNA (M. Koizumi
et al. (1988) FEBS Lett. 239: 285; Makoto Koizumi and Eiko Ohtsuka
(1990) TanpakushitsuKakusan Kohso (Protein, Nucleic acid, and Enzyme)
35: 2191; M. Koizumi et al. (1989) Nucleic Acids Res. 17: 7059) . For
example, in the coding region of the Hd3a gene (SEQ ID NO: 1, 3, 23,
or 24) , there are a plurality of sites that can be used as ribozyme
targets.
The hairpin type ribozyme is also useful in the present invention.
A hairpin type ribozyme can be found, for example, in the minus strand
of the satellite RNA of tobacco ringspot virus (J. M. Buzayan (1986)
Nature 323: 349) . This ribozyme has also been shown to
target-specificallycleaveRNA (Y. KikuchiandN. Sasaki (1992) Nucleic
Acids Res. 19: 6751; Yo Kikuchi (1992) Kagaku To Seibutsu (Chemistry
and Biology) 30: 112).
The ribozyme designed to cleave the target is fusedwith a promoter,
such as the cauliflower mosaic virus 35S promoter, and with a
transcription termination sequence, so that it will be transcribed
in plant ce-, ls. However, if extra sequences have been added to the
5' end or the 3' end of the transcribed RNA, the r;bozyme activity
can be lost. In this case, one can place an additional trimm;~~ng ribozyme,
which functions in cis to perform the tr:.mming on the 5' or the 3'
side of the ribozyme portion, in order to precisely cut the r4 bozyme
portion from the transcribed RNA containing the r'-bozyme (K. Taira
et al. (1990) Protein Eng. 3: 733; A. M. Dzaianott and J. J. Bujarski
(1989) Proc: Natl. Acad. Sci. USA 86: 4823; C. A. Grosshands and R.
T. Cech (1991) Nucleic Acids Res. 19: 3875; K. Taira et al. (1991)
Nucleic Acid Res. 19: 5125) . Multiple sites within the -.arget gene
can be cleaved by arranging these structural units in tandem to achieve
greater effects (N. Yuyama et al., Biochem. Biophys. Res. Commun.
186: 1271 (1992) ) . Usingsuchribozymes, itispossibletospecifically
cleave the transcription products of the target gene in -zhe present
invention, thereby repressing the expression of the gene.
Endogenous gene expression can also be repressed by co-repression,
CA 02429679 2003-05-23
14
through transformation with a DNA having a sequence identical or similar
to the target gene sequence. "Co-repression" refers to the phenomenon
wherein, when a gene having a sequence identical or similar to the
target endogenous gene sequence is introduced into plants by
transformation, expression of both the introduced exogenous gene and
the target endogenous gene becomes repressed. Although the detailed
mechanism of co-repression is unknown, it is frequently observed in
plants (Curr. Biol. 7: R793, 1997; Curr. Biol. 6: 810, 1996) . For
example, if one wishes to obtain a plant body in which the Hd3a gene
is co-repressed, the plant in question can be transformed with a vector
DNA designed to express the Hd3a gene or DNA having a similar sequence
to select a plant wi th suppressed the flowering compared to wild-type
plant, among the resultant plants. The gene to be used for
co-repressi on does not need to be completely identical to the target
gene, but it should have at least 70% or more sequence identity,
preferably 80% or more sequence identity, and more preferably 90%
or more (e.g. 95% or more) sequence identity. Sequence identity may
be determined by the 'above-described method.
Ir.addition,endogenous gene expression in the present invention
can also be repressed by transforming the plant with a gene having
the dominant negative phenotype of the target gene. A gene having
the dominant nega tive phenotype ref ers to a gene which, when expressed,
can eliminate or reduce the activity of the wild type endogenous gene
inherent to the plant.
Vectors used for the transformation of plant cells are not limited
so long as the vector can express inserted genes in plant cells. For
example,vectorscomprising promotersforconstitutive gene expression
in plant cells (e.g., cauliflower mosaic virus 35S promoter); and
promoters inducible by exogenous stimuli can be used. The term"plant
cell" used herein includes various forms of piant cells, such as cultured
cell suspensions, protoplasts, leaf sections, and callus.
A vector can be introduced into plant cells by known methods,
such asthe polyethylene glycol method, electroporation, Agrobacterium
mediated transfer, and particle bombardment. Plants can be
regenerated from transformed plant cells by known methods depending
on the type of the plant cell (see Toki et al. , (1995) Plant Physiol.
CA 02429679 2003-05-23
100:1503-1507).
For example, transformation and regeneration methods for rice
plants include: (1) introducing genes into protoplasts using
polyethylene glycol, and regenerating the plant body (suitable for
5 indicarice cultivars) (Datta,S.K. (1995) in "Gene Transfer To Plants",
Potrykus I and Spangenberg Eds., pp66-7 4); (2) introducing genes into
protoplasts using electric pulse, and regenerating the plant body
(suitableforjaponicaricecultivars)(Tokietal.(1992)Plant Phvsiol.
100: 1503-1507); (3) introducing genes directly into cells by the
10 particle bombardment, and regenerating the plant body (Christou et
al. (1991) Bio/Technology, 9: 957-962) ; (4) introducing genes using
Agrobacterium, and regenerating the plant body (Hiei et al. (1994)
Plant J. 6: 271-282) ; and so on. These methods are already establ=shed
in the art and are widely used in the technical field of the present
15 invention. Such methodscan besuitably usedforthe presentinvention.
Once a transformed plant, wherein a DNA of the present invention
is introduced into the genome, is obtained, it is possible to gain
descendantsfrom that plant body by sexual or vegetative propagation.
Alternatively, plants can be mass-produced from breeding materials
(for example, seeds, fruits, ears, tubers, tubercles, tubs, callus,
protoplast, etc.) obtained from the plant, as well as descendants
or clones thereof. Plant cells transformed with a DNA of the present
invention,plantbodies including these cells, descendants and clones
of the plant, as well as breeding materials obtained from the plant,
its descendant and clones, are all included in the present invention.
The resulting plant prepared as above =_s different from that
of wild-type plants in terms of the flowering time. For example, plants
into which a DNA encoding an Hd3a protein is in.troduced have decreased
time to flowering under paddy field conditions. On the other hand,
plants wherein the expression of a DNA encoding an Hd3a protein is
repressed due to the introduction of antisense DNAs, have delayed
flowering time. Thus, the time needed for flowering of plants can
be regulated bycontrolling the expressionoftheHd3agene. According
to the present invention, the heading date of rice, a valuable crop,
can be readily controlled, which is extremely beneficialin the breeding
of rice cultivars adapted to a particular environment.
CA 02429679 2003-05-23
16
Brief Description of the Drawings
Fig. 1 depicts a diagram showing the high-resolution linkage
map of the Hd3a region and candidate genomic region thereof:
A: a linkage map prepared using segregating populations of 2207
plar._s;
B: Nipponbare-derived PAC clones located in the Hd3a region;
C: an enlarged map of the vicinity of the Hd3a region.
Blackclosedcircleson onthe lirepresent CAPS markers; arrows indicate
the predicted gene regions; and Rec. shows the approximate
reco:nbination positions of recombinant individuals. The candidate
region is represented by a square. DNA fragments used in the
transformation are also shown in the lower part of the map.
Fig. 2 depicts photographs showing changes in the amount of
transcripts of the FT-like gene in rice cultivated under different
photoperiod conditions. "S" represents transcripts in plants that
have been cultivated under long-day condition (16 h daylight) for
30 davs after sowing, then shifted'to short-day treatment (10 h daylight)
and cultivated for 0, 2, 6, and 10 days. "L" represents transcripts
from plants that have been further cultivated for 10 days under the
long-daycondition. "G" represents the genomic DNA; and "N" the control
transcript obtained without the template.
Fig. 3 depicts a diagram showing the Hd3a gene structure. Boxes
represent the translation region. Positions of Nipponbare with
different sequence to Kasalath are shown in the figure. The
transcription initiation site is indicated by the arrow pointing left
in t-e figure.
Fig. 4 depicts bar graphs'showing the frequency distributi.on
of number of days to heading in the self-pollinated progenies (T1)
of transformed rice plants under the short-day (A) and long-day (B)
conditions,respectively. In both f igures, dark bars represent plants
having the transgene, and bars with slanted lines those without the
transgene. Under the long-day conditions, no heading was observed
in either Nipponbare or NIL (Hd3a), even after 100 days.
Best Mode for Carrying out the Invention
CA 02429679 2003-05-23
17
Herein below, the present invention is specifically described
with reference to Examples; however, it is not to be construed as
being limited thereto.
[Example 1] High-resolution linkage analysis
A detailed linkage analysis of the Hd3a region with a large
segregating population essential for map base cloning was performed.
As the segregating population for the linkage analysis, a backcross
progeny BC3F3 generation derived from a cross between Nipponbare and
Kasalath was used. The linkage analysis was carried out in two steps.
First, using 595 plants of the segregating population for the Hd3a
region, a linkage map was prepared with RFLP markers. As a result,
Hd3a was proven to be localized within the region between the RFLP
markers C764 and B174 (Monna, et al., The 1999 Annual Meeting, Japanese
Society of Molecular Biology) . Then, to further improve the map
resolution, linkage analysis was performed with a large population.
Specifically, plants having chromosomes in which recombination was
occurred in the vicinity of Hd3a were screened from a population of
2207 plants segregated for the Hd3a region us,:ng following CAPS (Cleaved
Amplified Poiymorphic Sequence) markers f7-ank'-ng Hd3a: CP13 (primer
[SEQ ID NO: 5/5'-GAGTAATTTGCGGTCAGAGTC-3'] and [SEQ ID NO:
6/5'-CCAAACAACACATCCTCAG-3' restriction enzyme Tai I) ); and CP15
(primer [SEQ ID NO: 7/5'-ACCGCAGGTCTCCTTGTCA~_'T-3'] and [SEQ ID NO:
8/5'-GCTATTGCCATCGCCTTGTGT-3'], restriction enzyme Msp I) . The
genotype of the Hd3a locus was determined bv the progeny testing.
Specificaily,10self-pollinated progeny plants of the selectedplants
were cultivated in a growth chamber under short-day conditions
(irradiation for 10 h) to determine the ger_~otype of Hd3a base on the
variation in number of days to heading in each rice line. As a result
of the linkage analysis, 8 recombinant plants between Hd3a and CP13,
and 2 between Hd3a and CP15 were identifiled (Fig. 1).
[Example 2] Alignment of Hd3a gene region by P1-derived
artificial chromosome (PAC) clones
Three PAC clones (P0037G03, P0046E09, and P0698G05) having the
nucleotide sequences of DNA markers 1-5A, R778, and CP39 that are
CA 02429679 2006-03-31
18
located near the Hd3a locus were screened from the PAC genomic
library of Nipponbare. Among the screened 3 PAC clones,
P0046E09 and P0698G05 were revealed to have the nucleotide
sequences of Hd3a-flanking markers CP13 and CP15, and thus
contain the Hd3a gene region (Fig. 1).
[Example 3] Identification of candidate gene region by
nucleotide sequence analysis
To further delimit the candidate genome region of Hd3a and
identify the candidate gene, the nucleotide sequence of the PAC
clone P0046E09 was analyzed. For the nucleotide sequence
analysis, the insert DNA of P0046E09 (including the vector) was
ultrasonically fragmented to prepare two sublibraries comprising
insert DNAs, one of an average length of 2 kb and the other of 5
kb. Nucleotide sequences of 2000 clones arbitrarily selected
from these two types of sublibraries were analyzed and assembled
using computer software Phred/Phrap. Using the information on
the nucleotide sequences within the candidate gene region
specified by the linkage analyses, new CAPS (Cleaved Amplified
Polymorphic Sequence) markers were prepared to limit the
candidate region.
The Hd3a gene co-segregated with CAPS markers 25-3UL
(primers [SEQ ID NO: 9/5' -TCAGAACTTCAACACCAAGG -3'] and [SEQ ID
NO: 10/5'- ACCTTAGCCTTGCTCAGCTA -3'], restriction enzyme Hae
III) and CP39 (primers [SEQ ID NO: 11/5'- GGGAGAATATGTTGCAGTAG-
3'] and [SEQ ID NO: 12/5'- CAAATGGTAATGGGTCAA -3'], restriction
enzyme Alu I). Furthermore, two plants with recombination were
detected, one with a recombination between the Hd3a gene and 25-
5UL (primers [SEQ ID NO: 13/5'- CTGTCTCGAAATCGCCTCTG -3'] and
[SEQ ID NO: 14/5'- TCCAGCACATCACCCACAA -3'], restriction enzyme
Hae III), and the other between the Hd3a and CP59 (primers [SEQ
ID NO: 15/5'- AGCCTCTGCGTCACTGTCATC -3'] and [SEQ ID NO: 16/5'-
GCAGCAGCAAACTCCCAAAG -3'], restriction enzyme TthH81),
respectively (Fig. 1). Thus, the candidate genomic region was
delimited to a region of approximately 20 kb. Gene prediction
and similarity search were performed for the nucleotide sequence
of this candidate region using GENSCAN, and revealed that detect
CA 02429679 2003-05-23
19
regions having a very hlgh similarity to genes encoding the lipid
transfer protein, acyl-CoA synthase, and FT gene of Arabidopsis in
the candidate genomic region.
[Example 4] Expression analysis of Hd3a candidate gene
RT-PCR for the candidate gene was performed for Nipponbare and
the nearly isogenic line (NIL (Hd3a)) in which the Hd3a gene region
is substituted with a chromosome fragment of Kasalath. Specifically,
total RNA was extracted from collected leaves, cDNA was synthesized
usIng reverse transcrip--ase, and then PCR was performed using primer
sets capable of specifically amplifying the 3 genes found within the
Hd3a candidate genomic region: (for the FT-like gene: sense strand
[SEQ ID NO: 9/5'- TCAGAACTTCAACACCAAGG -3'] and antisense strand [SEQ
ID NO:10/5'-ACCTTAGCCTTGCTCAGCTA -3'];for the lipid transferprotein
gene: sense strand [SEQ ID NO: 17/5'- GGGGACGTCGGACCTGT-3'] and
antisense strand [SEQ ID NO: 18/5'- AGTTGAAGTTTGGGCTGGTCG-3']; and
for the acyl-CoA synthase gene: sense strand [SEQ-ID NO: 11/5'-
GGGAGA.ATATGTTGCAGTAG -3'] and antisense strand [SEQ ID NO: 12/5'-
CAAATGGTA.ATGGGTCAA -3'] ). Assessment of the amount of RNA used as
a template was carried out bv PCR using a set of primers (sense strand
[SEQ ID NO: 19/5'- TCCATCTTGGCATCTCTCAG -3'] and antisense strand
[SEQ ID NO: 20/5'- GTACCCGCATCAGGCATCTG -3';) that can amplify a
fragment within =he actin gene. After cultivating Nipponbare and NIL
(Hd3a) for 30 days under long-day conditions (irradia-:ion for 16.0
h), they were further cultivated either under short-day condition
(irradiation for 10. 0 h) for 0, 2, 6, and 10 days or under the long-day
condition for 10 days. Then, leaves were collected from these plants
for analysis.
As a resu'i -, all of the three predicted genes within the candidate
gene region were confirmed to be expressed. The transcript of the
FT-like gene was detected in plants cultivated under the short-day
condition, but not under the long-day conditions (Fig. 2) . No
significant difference in the transcript amount was observed between
Nipponbare and NIL (Hd3a) under the short-day condition (Fig. 2).
As to other candidate genes, the transcript of lipid transfer protein
gene was detected only in Nipponbare, and the transcript of the acyl-CoA
CA 02429679 2003-05-23
synthase gene was detected in both Nipponbare and NIL (Hd3a) but with
no difference-:n the expression level between plants cultivated under
the short-day and long-day conditions. According to the
aforementioned results, the FT-like gene whose transcription level
5 increases under the short-day condition was used as a potential
candidate gene in functional analysis by transformation.
[Example5] Nucleotide sequence analysis of Hd3a candidate gene
A cosmid library was prepared from the genomic DNA of Kasalath
10 to screen clone H3PZ1-1 corresponding to the Hd3a candidate region.
More specifically, using the genomic DNA of Kasalath, a genomic DNA
library was constructed with the pPZP2CH-lac vector. The library was
screened using the nucleotide sequences 25-5UL and CP39 that are in
the vicinity of Hd3a to select the clone H3PZ1-1 containing the Hd3a
15 candidate gene (Fig. 1) . Nucleotide sequence analysis of the clone
and comparison thereof with Hd3a of Nipponbare proved the presence
of nucleotide substitution at 32 sites, insertion (2 bp and 3 bp)
at 2 sites, dnd deletion (1 bp to 50 bp) at 7 sites in Nipponbare
compared to the Kasalath nucieotide sequence (Fyg. 3).
20 cDNA was synthesized from RNA extrac--ed from a plant of nearly
isogenicline (NIL (Hd3a) ) f or cDNA nucleotidesequence analysis which
plant had been treated under the short-dav cond~~_tion, and RT-PCR was
performed using a pa;ir of primers comprising 'he region from the
initiation codon to the termination codor. (sense strand [SEQ ID NO:
21/5' -GCTGCCTCTATCACAGTATATT- 3'] and antiser.se strand [SEQ ID NO:
10/5'- ACCTTAGCCTTGCTCAGCTA -3']1. The PCR product was cloned and
sequenced. The transcription initiation site was determined by
5'-RACE to confi rm that the site was 152 bp ups =ream of the sequence
predicted as the transcription initiation codon.
As a result of the analysis, among the mutations, only a
one-nucleotide substitution and a two-nucleotide substitution on the
N-terminal side were found to be mutations w_thir_ the exon. The iatter
substitution was revealed to cause an amino acid substitution of
asparagine (Kasalath) to proline (Nipponbare) (Fig. 3).
[Example 6) Functional identification of candidate gene by
CA 02429679 2003-05-23
21
transformation
8.7 kb SpeI fragment containing cnly the candidate gene region
from the cosmid clone H3PZ1-1 was cloned into vector pPZP2H-lac that
can be transformed via Agrobacterium (pPZHd3aK) . Similarly, 8.7 kb
Spel fragment of Nipponbare was also ir:corporated into a pPZP2H-lac
(pPZHd3aN) Using the vectors contai::ing these fragments and the
vector alone, transformation was performed according to the Toki's
method (Plar.t Mol . Bi ol . Rep. 15 : 16-21 , 1997 ). Nipponbare was used
as a rice line to be transformed. As a result, 21 (17 with the vec-,-or
alone) and 20 (20 with the vector alone) hygromycin-resistant plants
were obtained in the transformation experiment with pPZHd3aK and
pPZHd3aN, respectively.
Whether the intended region had been incorporated was
investigated by CAPS analysis with the CAPS marker 25-5UL for pPZHd3aK,
and for pPZHd3aN by PCR using primer M13 Primer RVand TAKARA within
the vector and the primer within the gene [SEQ ID NO: 22/5'-
CGCTCAGCAACGAGTTTC -3' ] . As a result, all of the transformants which
had been introduced with pPZHd3aK and pPZHd3aN were revealed to have
the candidate genes incororated.
These regenera ted pla:.ts were immed'_ately trans ferred ir. --o growth
chambers set up either for short-dav conditions (irradiation for 10
h) or long-day conditions (irradi_=tior. for 13.5 h) to investigate
the number of days required for heading. Among the plants introduced
with pPZHd3aK and pPZHd3aN,plantsshowir.gsignificantlyeariv heading
were observed under both the short-day and long-day conditior.s (Table
1) . No plant with any significant changes in the heading time appeared
among those introduced with the vecto-r alone (Table 1).
CA 02429679 2003-05-23
22
Table 1
aF
>
}+
U
~ m
N
cn 41 T
c0 O m
GU
y~
Q -
co C w
O C.
U VJ
OO W
co r
ti eo ai
=- a.
N T ~
,a O
co . _
Q~ m
ca c
v m
O .~ W T
Rm ~ ~ 4~
_ trD
U'l O tA
W
Ln - 9C ap i en C W O
bA N
+ - pU
O N N m Il} O =- .
L S
W C pa . ~==+
> N ~ N N W O-
lC
Go N ?4D
N
O W T7 L
N C d
O O U
~ ~ C 7 >
N
.- 0 RC :m
+~ y > "MO
qr v d W 0
CL
O O O O
]G C'1 a
Ia 'd ic R1 W iC
C-! M C"~ f'~"f C
aD = N
~ ~c J
N J N U N V N (~ ~ W
CL G7 d d G. tU Q. N .= W S
~ > G > C. > d > ,
im a
v~ rJ cq J sa <n C.
CA 02429679 2003-05-23
23
Furthermore, when the self-pollinated progeny from the
early-heading transformed piant (pPZHd3aK) was cultivated under the
short-day condition to examine the segregation in the number of days
to heading, the variation was in a continuous distribution, but plants
showing early heading compared to the control Nipponbare were
segregated and the segregated plants contained the transgene (Fig.
4).
On the other hand, when self-pollinated progenies were similarly
cultivated under the long-day conditions, heading plants appeared
among these progenies in contrast to Nipponbare and NIL (Hd3a) for
which no heading is observed even after 100 days. All of the heading
plants contained the introduced DNA fragments (Fig. 4).
These results confirmed that the FT-like gene, i. e. , the candidate
gene, has the function to promote the heading under the short-day
conditions, and the gene was determined to be the Hd3a. The heading
action of the allele of Kasalath was predicted to be stronger than
that of Nipponbare. However, the allele of Nipponbare was also
suggested to maintain the function to a degree. Early heading observed
under the long-day conditions is likely to occur due to the elevated
Hd3a expression level via the newly introduced Hd3a gene by
transformation.
Industrial Applicability
The present invention provides genes that induce the flowering
of plant. The present invention makes it possible to control the
heading date of rice, and thus may be very useful in breeding. Control
of the heading date of rice plants is particularly useful for breeding
rice cultivars adapted to particular locations and seasons.
Furthermore, the method for breeding rice cultivars using a gene of
the present invention is beneficial as compared to conventional methods,
in that an object plant can be obtained in a short period with high
reliability.
CA 02429679 2003-10-22
24
SEQUENCE LISTING
<110> National Institute of Agrobiological Sciences and Bio-Oriented
Technology Research Advancement Institution
<120> GENE HD3A INDUCING FLOWERING OF PLANT AND UTILIZATION THEREOF
<130> 12871-62
<140> CA 2,429,679
<141> 2001-11-22
<150> JP 2000-356839
<151> 2000-11-24
<160> 24
<170> PatentIn Ver. 2.1
<210> 1
<211> 4229
<212> DNA
<213> Oryza sativa
<220>
<223> genomic DNA
<220>
<221> exon
<222> (825)..(1184)
<220>
<221> intron
<222> (1185)..(1346)
<220>
<221> exon
<222> (1347)..(1408)
<220>
<221> intron
<222> (1409)..(1541)
<220>
<221> exon
<222> (1542)..(1582)
<220>
<221> intron
<222> (1583)..(2889)
<220>
<221> exon
<222> (2890)..(3274)
<220>
<221> CDS
<222> (978)..(1184)
<220>
<221> CDS
CA 02429679 2003-10-22
<222> (1347)..(1408)
<220>
<221> CDS
<222> (1542)..(1582)
<220>
<221> CDS
<222> (2890)..(3119)
<400> 1
gataagttgc ggaaaaacca acaaattagc aacaaatatg agtaaaactt gtatacatgt 60
gtcttcttag cgatttaaaa atcaatgctg aaaataaatt ataataaaat taaaaatctc 120
aagataatct ctaaaatgta gttttaaaat ttaaattttg attgcgactg ataagaaaaa 180
aaaacaaatg atgggaggct atatcaactg tcaaactggc taatttagaa agacgacatc 240
gaattcctac agattggagg cagcaaaaga gagcctgtct ctgccgggtg cgtgcatgat 300
gctcgatcat atcccatctc tcctcacttc atcatcaaca agaacaagag gaactatata 360
gctgcaagat ctagactgaa actactatag caactaactg tactgtagct agattacgct 420
tagctatagc tgctgctgca gctgctgctg catctatctg taaattccaa ctacgacgtc 480
gactgctgca agctagcttg accggctagc tagatagcta gctagctcaa aagagaaagc 540
tttgcgaaat aggagtagct agctagctct agctagggcg ccatcgatgc gtgaccaccg 600
agctcgcctc gtccacacgt acaggaagac gatgcagaaa gcggccggca tgcagtaaac 660
tgaccgagct aagagagaga gagagagatg atattattct tctgcagcta aattaaagtg 720
aaagttggac atggacatgg acatagtaat tttgcatggc catcatcttg ccctcctata 780
taaagcggcc atctcactct caaccacagc tcgatccagc agccctgcac cacacacagt 840
tcagctagca gatcacctag ctagatagct gcctctatca cagtatattt gctccctgca 900
acttgctgct gctgcaatag ctagcagctg cagctagtaa gcaaaactat ataccttcag 960
ggttttttgc aagatcg atg gcc gga agt ggc agg gac agg gac cct ctt 1010
Met Ala Gly Ser Gly Arg Asp Arg Asp Pro Leu
1 5 10
gtg gtt ggt agg gtt gtg ggt gat gtg ctg gac gcg ttc gtc cgg agc 1058
Val Val Gly Arg Val Val Gly Asp Val Leu Asp Ala Phe Val Arg Ser
15 20 25
acc aac ctc aag gtc acc tat ggc tcc aag acc gtg tcc aat ggc tgc 1106
Thr Asn Leu Lys Val Thr Tyr Gly Ser Lys Thr Val Ser Asn Gly Cys
35 40
gag ctc aag ccg tcc atg gtc acc cac cag cct agg gtc gag gtc ggc 1154
Glu Leu Lys Pro Ser Met Val Thr His Gln Pro Arg Val Glu Val Gly
45 50 55
ggc aat gac atg agg aca ttc tac acc ctt gtatgtgagc tctaccatgt 1204
Gly Asn Asp Met Arg Thr Phe Tyr Thr Leu
CA 02429679 2003-10-22
26
60 65
gtcgtagttg gttcagagac cagaagttat actttctttc attattatat tgtagaaaat 1264
tttgtttggt acttaaccca agatgacttt aaaatgcatt aatttgatgt ttgtcatggt 1324
tgtttgtggt gtgtacctga ag gtg atg gta gac cca gat gca cca agc cca 1376
Val Met Val Asp Pro Asp Ala Pro Ser Pro
70 75
agt gac cct aac ctt agg gag tat cta cat tg gtaagcacac taatgttaag 1428
Ser Asp Pro Asn Leu Arg Glu Tyr Leu His Trp
80 85 90
ctagcgcact tgttttcatg caatgatcaa aataatcact gctagctgat ttacatacat 1488
aaccacatct tgactgcatg atgggttgat catcttaatt tgtttgtcca cag g ttg 1545
Leu
gtc act gat att cct ggt act act gca gcg tca ttt g gtcagtatta 1592
Val Thr Asp Ile Pro Gly Thr Thr Ala Ala Ser Phe
95 100
aacgatcaaa tggtttagat tgatttgatt tcccacttaa atacattgca gtataaaact 1652
aacagaggta aattgtcttt ccatactatt gtttgggggg gggggggggg ggcagtgagt 1712
tgttgagcat tttccctcac tcgcgagccc ccagtttgcc gcattaattc cccatcatcc 1772
ttcaccacca ccaaaaataa aaagtgattt ggagaaggat acgctcctcc aaataatttt 1832
taacaagttc accaccacaa cgaggcaccg ataaccgcca tgagtccacg caccctgcag 1892
ctagtcgtgc caccagcacc acagtttgcc acaccgcgag caatccacgc catcacttgc 1952
cgctgtgagt ccacgatcac acgcctcgat cagccagctg ccatgatatg tcggcttggg 2012
cttggattcc gcaacatacc atgtccccat cgatggcacc acactctaat tcgccaacac 2072
aacactgaag ggatcggacc gggagggcta gctcactcaa gatagtgacg ggatgattcg 2132
atgggaattc catggggaac aaagcacaaa atcatgaaaa tgtccttttc aattccatgg 2192
caaattccta aagcaatact ctctctccat tctataatgt aggttgcaca ctcatttcaa 2252
gattcaactt tcaaaacatt tgactaacga tttgtataat ataaattgaa ttttatttga 2312
tagaaataat attattggat tgatatttca atatactttc atatggttat aattttgtta 2372
ctacaaactt tatagtatat tagaaattat aaataaaaaa ttagttttat agaccgtaca 2432
tgccaagttt gaccatacca taatatgaaa aagagggagt agtaaccttg tttatattgg 2492
caatatatac ttcctccgtt tctaaatatt tgacgctgtt gactttttaa acatgtttga 2552
ccgttcgtct tattaaaaaa taagtaatta ttaattcttt tcctatcatt tgatttattg 2612
ttaaatatat ttttatgcag acatatagtt ttacatattt cataaaagtt tttgaataag 2672
aagaatgatc gtcaaatatt tagaaacgag gggagtatat tgctagtaaa ttttactgta 2732
CA 02429679 2003-10-22
27
aagtcatgtt tcttcatgtg tcttttttag aacatttctt cttcatgtgt tccattcaat 2792
tttttcgatc tccaccacca ctaccacagt tgtatgtgta gtagctagct gttgcacatg 2852
ctcatgttaa tctgaatctg ttcatggttt tttgcag gg caa gag gtg atg tgc 2906
Gly Gln Glu Val Met Cys
105
tac gag agc cca agg cca acc atg ggg atc cac cgg ctg gtg ttc gtg 2954
Tyr Glu Ser Pro Arg Pro Thr Met Gly Ile His Arg Leu Val Phe Val
110 115 120 125
ctg ttc cag cag ctg ggg cgt cag aca gtg tac gcg ccc ggg tgg cgt 3002
Leu Phe Gln Gln Leu Gly Arg Gln Thr Val Tyr Ala Pro Gly Trp Arg
130 135 140
cag aac ttc aac acc aag gac ttc gcc gag ctc tac aac ctc ggc tcg 3050
Gln Asn Phe Asn Thr Lys Asp Phe Ala Glu Leu Tyr Asn Leu Gly Ser
145 150 155
ccg gtc gcc gcc gtc tac ttc aac tgc cag cgc gag gcc ggc tcc ggc 3098
Pro Val Ala Ala Val Tyr Phe Asn Cys Gln Arg Glu Ala Gly Ser Gly
160 165 170
ggc agg agg gtc tac aac tag ctaacgatga tcccgatcga tctgctgcat 3149
Gly Arg Arg Val Tyr Asn
175 180
gctcactatc atcatccagc atgctataca ttgcaggttc agacaattga aatgattctc 3209
gacacacaac atatatatga tggtgtaatt aattatgcaa ttaattagct gagcaaggct 3269
aaggtctctc atgaagctag ctttgctcta tatatatata tatatatata tatatatata 3329
tatatatata tatatatata tatatatata tagtgaagtg tgcaataagc tgcaggtata 3389
taagactgga tttaaggagc taattaacta aaccatgcat cacgtatatg tgagatgcag 3449
tcgtgctctt gcatccaagg atacatacag catatgcatg caatattggt atcatatgca 3509
tgcaatattg gtatcatatg cagcggctgc tagctactcc tagaagctat acagcagaat 3569
gtaaacatat atgtgtagca gtacttatac gtagcacatc gatctgcaca tgttggatgt 3629
agcaagaaat tgctatgaaa tataagtaga gatgtgctta atatcaaatg tgtgtcacat 3689
gtgaatctat cagctgggca tatatagtgt ctctttcagg cttccatctc actgtctatc 3749
tcgcccccca ctgaatatat atttcgacag ctgtcgcgtt ccgattcgtc gaaatctctc 3809
gctagcacag tttaaggaca ggtactacgt gctaatgata tgatatgatg gtgaaaggga 3869
ctacagctag ggagtatcaa tcagaaccca tgttttggaa aagctgatac ggatcgatat 3929
tgatcatatg catgcgtaga agaattcatc gtcagaaaac gcgtacgatt ggtcgtatgt 3989
gaaagaagca tatatatcta gatctgtaac tttaaaatcc actctcctat gatcgatcga 4049
gcatccattg gtgagttata tgttcaaaag catagatcga gatcgtcacg attggtagtg 4109
ggtgatcgat gcagctatac tagctccttt tctctcccaa tcgtcgaaga ttcaggcatt 4169
CA 02429679 2003-10-22
28
cacccaatgc tgttgcaggg atataattgt ctctgttatt ttttattctg acattgtata 4229
<210> 2
<211> 179
<212> PRT
<213> Oryza sativa
<400> 2
Met Ala Gly Ser Gly Arg Asp Arg Asp Pro Leu Val Val Gly Arg Val
1 5 10 15
Val Gly Asp Val Leu Asp Ala Phe Val Arg Ser Thr Asn Leu Lys Val
20 25 30
Thr Tyr Gly Ser Lys Thr Val Ser Asn Gly Cys Glu Leu Lys Pro Ser
35 40 45
Met Val Thr His Gln Pro Arg Val Glu Val Gly Gly Asn Asp Met Arg
50 55 60
Thr Phe Tyr Thr Leu Val Met Val Asp Pro Asp Ala Pro Ser Pro Ser
65 70 75 80
Asp Pro Asn Leu Arg Glu Tyr Leu His Trp Leu Val Thr Asp Ile Pro
85 90 95
Gly Thr Thr Ala Ala Ser Phe Gly Gln Glu Val Met Cys Tyr Glu Ser
100 105 110
Pro Arg Pro Thr Met Gly Ile His Arg Leu Val Phe Val Leu Phe Gln
115 120 125
Gln Leu Gly Arg Gln Thr Val Tyr Ala Pro Gly Trp Arg Gln Asn Phe
130 135 140
Asn Thr Lys Asp Phe Ala Glu Leu Tyr Asn Leu Gly Ser Pro Val Ala
145 150 155 160
Ala Val Tyr Phe Asn Cys Gln Arg Glu Ala Gly Ser Gly Gly Arg Arg
165 170 175
Val Tyr Asn
<210> 3
<211> 4110
<212> DNA
<213> Oryza sativa
<220>
<223> genomic DNA
<220>
<221> exon
<222> (812)..(1170)
<220>
<221> intron
<222> (1171)..(1332)
<220>
<221> exon
<222> (1333)..(1394)
<220>
<221> intron
<222> (1395)..(1527)
<220>
CA 02429679 2003-10-22
29
<221> exon
<222> (1528)..(1568)
<220>
<221> intron
<222> (1569)..(2875)
<220>
<221> exon
<222> (2876)..(3260)
<220>
<221> CDS
<222> (964)..(1170)
<220>
<221> CDS
<222> (1333)..(1394)
<220>
<221> CDS
<222> (1528)..(1568)
<220>
<221> CDS
<222> (2876)..(3105)
<400> 3
gataagttgc ggaaaaacca acaaattagc aacaaatatg agtaaaactt gtatacatgt 60
gtcttcttag cgatttaaaa atcaatgctg aaaataaatt acaataaaat taaaaatctc 120
aagataatct ctaaaatgta gttttaaaat ttaaattttg attgcgactg ataagaaaaa 180
aaaacaaatg atgggaggct atatcaactg tcaaactggc taatttagaa agacgacatc 240
gaattcctac agattggagg cagcaaaaga gagcccgtct ctgccgggtg cgtgcatgat 300
gctcgatcat atcccatctc tcctcacttc atcatcaaca agaacaagag gaactatata 360
gctgcaagat ctagactgaa actactatag caactaactg tactgtagct agattacgct 420
tagctatagc tgctgctgca tctatctgta aattccaact acgacgtcga ctgctgcaag 480
ctagcttggc cggctagcta gatagctagc tagctcaaaa gagaaagctt tgcgaaatag 540
gagtaactag ctagctctag ctagggcgcc atcgatgcgt gaccaccgag ctcgcctcgt 600
ccacacgtac aggaagacga tgcagaaagc ggccggcatg cagtacactg accgagctaa 660
gagagagaga gagatgatat tattcttctg cagctaaatt aaagtgaaag ttggacatgg 720
acatggacat agtaattttg catggccatc atcttgccct cctatataaa gcggccatct 780
cactctcaac cacagctcga tccagcagcc ctgcaccaca cacagttcag ctagcagatc 840
acctagctag atagctgcct ctatcacagt atatttgctc cctgcaactt gctgctgctg 900
caatagctag cagctgcagc tagtaagcaa aactataaac cttcagggtt ttttgcaaga 960
tcg atg gcc gga agt ggc agg gac agg gac cct ctt gtg gtt ggt agg 1008
CA 02429679 2003-10-22
Met Ala Gly Ser Gly Arg Asp Arg Asp Pro Leu Val Val Gly Arg
1 5 10 15
gtt gtg ggt gat gtg ctg gac gcg ttc gtc cgg agc acc aac ctc aag 1056
Val Val Gly Asp Val Leu Asp Ala Phe Val Arg Ser Thr Asn Leu Lys
20 25 30
gtc acc tat ggc tcc aag acc gtg tcc aat ggc tgc gag ctc aag ccg 1104
Val Thr Tyr Gly Ser Lys Thr Val Ser Asn Gly Cys Glu Leu Lys Pro
40 45
tcc atg gtc acc cac cag cct agg gtc gag gtc ggc ggc aat gac atg 1152
Ser Met Val Thr His Gln Pro Arg Val Glu Val Gly Gly Asn Asp Met
50 55 60
agg aca ttc tac acc ctt gtatgtgagc tctaccatgt gtcgtagttg 1200
Arg Thr Phe Tyr Thr Leu
gtgcagagac cagaagttat actttctttc attattatat tatagaaaaa tttgtttggt 1260
acttaaccca agatgacttt aaaatgcatt aatttgatgt ttgtcatggt tttttgtggt 1320
gtgtacctga ag gtg atg gta gac cca gat gca cca agc cca agt gac cct 1371
Val Met Val Asp Pro Asp Ala Pro Ser Pro Ser Asp Pro
75 80
aac ctt agg gag tat cta cat tg gtaagcacac taatgttaag ctagcgcact 1424
Asn Leu Arg Glu Tyr Leu His Trp
85 90
tgttttcatg caatgatcaa aataatcact gctagctgat ttacatacat aaccacatct 1484
tgactgcatg atgggttgat catcttaatt tgtttgtcca cag g ttg gtc act gat 1540
Leu Val Thr Asp
att cct ggt act act gca gcg tca ttt g gtcagtatta aacgatcaaa 1588
Ile Pro Gly Thr Thr Ala Ala Ser Phe
95 100
tggtttagat tgatttgatt tcccacttaa atacattgca gtataaaact aacagaggta 1648
aattgtcttt ccatactatt gtttgggggg ggggggccag ggggcagtga gttgttgagc 1708
attttccctc actcgcgagc ccccagtttg ccgcattaat tccccatcat ccttcaccac 1768
cacaaaaaaa aaagtgattt ggagaaggat acgctcctcc aaataatttt taacaagttc 1828
accaccacaa cgaggcaccg acaaccgcca tgagtccacg caccctgcag ctagtcgtgc 1888
caccagcacc acagttagcc acaccgcgag caatccacgc catcacttgc cgctgtgagt 1948
ccacgatcac acgcctcgat cagccagctg ccatgatatg tcggcttggg cttggattct 2008
gcaacatacc atgtccccat cgatggcacc acactctaat tcgccaacac aacactgaag 2068
ggatcggatc gggagggcta gctcactcaa gatagtgacg ggatgattcg atgggaattc 2128
catggggaac aaagcacaaa atcattaaaa tgtccttttc aattccatgg caaattccta 2188
aagcaatact ctctctccat tctataatgt aggttgcaca ctcatttcaa gattcaactt 2248
CA 02429679 2003-10-22
31
tcaaaacatt tgactaacga tttgtataat ataaattgaa ttttatttga tagaaataat 2308
attattggat tgatatttca atatactttc atatggttat aattttgtta ctacaaactt 2368
tatagtatat tagaaattat aaataaaaaa ttagttttgt agaccgtaca tgccaagttt 2428
gaccatacca tattatgaaa aagagggagt agtaaccttg tttatatttg caatatatac 2488
tccctccgtt tctaaatatc tgacgctgtt gactttttaa acatgtttga ccgttcgtct 2548
tattaaaaaa taagtaatta ttaattcttt tcctatcatt tgatttattg ttaaatatat 2608
ttttatgcag acatatagtt ttacatattt cataaaagtt tttgaataag aagaatgatc 2668
gtcaaatatt tagaaacgag gggagtatat tgctagtaaa ttttactgta aagtcatgtt 2728
tcttcatgtg tcttttttag aacatttctt cttcatgtgt tccaatcaat tttttcgatc 2788
tccaccacca ctaccacagt tgtatgtgta gtagctagct gttgcacatg ctcatgttaa 2848
tctgaatctg tccatggttt tttgcag gg caa gag gtg atg tgc tac gag agc 2901
Gly Gln Glu Val Met Cys Tyr Glu Ser
105 110
cca agg cca acc atg ggg atc cac cgg ctg gtg ttc gtg ctg ttc cag 2949
Pro Arg Pro Thr Met Gly Ile His Arg Leu Val Phe Val Leu Phe Gln
115 120 125
cag ctg ggg cgt cag aca gtg tac gcg ccc ggg tgg cgt cag aac ttc 2997
Gln Leu Gly Arg Gln Thr Val Tyr Ala Pro Gly Trp Arg Gln Asn Phe
130 135 140
aac acc aag gac ttc gcc gag ctc tac aac ctc ggc tcg ccg gtc gcc 3045
Asn Thr Lys Asp Phe Ala Glu Leu Tyr Asn Leu Gly Ser Pro Val Ala
145 150 155 160
gcc gtc tac ttc aac tgc cag cgc gag gca ggc tcc ggc ggc agg agg 3093
Ala Val Tyr Phe Asn Cys Gln Arg Glu Ala Gly Ser Gly Gly Arg Arg
165 170 175
gtc tac ccc tag ctaacgatga tcccgatcga tctgctgcat gctcactatc 3145
Val Tyr Pro
180
atcatccagc atgctataca ttgcaggttc agacaattga aatgattctc gacacacaac 3205
atatatatga tggtgtaatt aattatgcaa ttaaatagct gagcaaggct aaggtctctc 3265
atgaagctag ctttgctcta tatatatata tatatatata tagtgaagtg tgcaataagc 3325
tgcaagtata taagactgga tttaaggagc taattaacta aaccatgcat catgtatatg 3385
tgagatgcag tcgtgctctt gcatccaagg atacatacag catatgcatg caatattggt 3445
atcatatgca gcggctgcta gctactccta gatcaagcta tacagcagaa tgtaaacata 3505
tatgtgtagc agtacttata cgtagcacat cgatctgcac atgttggatg tagcaagaaa 3565
ttgctatgaa atataagtag agatgtgctt aatatcaaat gtgtatcaca tgtgaatcta 3625
CA 02429679 2003-10-22
32
tcagctgggc atatatagtg tctctttcag gcttccatct cactgtctat ctcgcccccc 3685
actgaatatg cccagtttaa ggacaggtac tacgtgctga tgatatgata tgatggtgaa 3745
agggactaca gctagggagt atcaatcaga acccatgttt tggaaaagct gatacggatc 3805
gatattgatc atatgcatgc gtagaagaat tcatcgtcag aaaacgcgta cgattggtcg 3865
tatgtgaaag aagcatatat atctagatct gtaactttaa aatccactct cctatgatcg 3925
atcgagcatc cattggtgag ttatatgttc aaaagcatcg atcgagatcg tcacgattgg 3985
tagtgggtga tcgatgcagc tatactagct ccttttctct cccaatcgtc gaagattcag 4045
gcattcagcc aatgctgttg cagggatata attgtctctg ttatttttta ttctgacatt 4105
gtata 4110
<210> 4
<211> 179
<212> PRT
<213> Oryza sativa
<400> 4
Met Ala Gly Ser Gly Arg Asp Arg Asp Pro Leu Val Val Gly Arg Val
1 5 10 15
Val Gly Asp Val Leu Asp Ala Phe Val Arg Ser Thr Asn Leu Lys Val
20 25 30
Thr Tyr Gly Ser Lys Thr Val Ser Asn Gly Cys Glu Leu Lys Pro Ser
35 40 45
Met Val Thr His Gln Pro Arg Val Glu Val Gly Gly Asn Asp Met Arg
50 55 60
Thr Phe Tyr Thr Leu Val Met Val Asp Pro Asp Ala Pro Ser Pro Ser
65 70 75 80
Asp Pro Asn Leu Arg Glu Tyr Leu His Trp Leu Val Thr Asp Ile Pro
85 90 95
Gly Thr Thr Ala Ala Ser Phe Gly Gln Glu Val Met Cys Tyr Glu Ser
100 105 110
Pro Arg Pro Thr Met Gly Ile His Arg Leu Val Phe Val Leu Phe Gln
115 120 125
Gln Leu Gly Arg Gln Thr Val Tyr Ala Pro Gly Trp Arg Gln Asn Phe
130 135 140
Asn Thr Lys Asp Phe Ala Glu Leu Tyr Asn Leu Gly Ser Pro Val Ala
145 150 155 160
Ala Val Tyr Phe Asn Cys Gln Arg Glu Ala Gly Ser Gly Gly Arg Arg
165 170 175
Val Tyr Pro
<210> 5
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:an artificially
synthesized primer sequence
<400> 5
CA 02429679 2003-10-22
33
gagtaatttg cggtcagagt c 21
<210> 6
<211> 19
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:an artificially
synthesized primer sequence
<400> 6
ccaaacaaca catcctcag 19
<210> 7
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:an artificially
synthesized primer sequence
<400> 7
accgcaggtc tccttgtcat t 21
<210> 8
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:an artificially
synthesized primer sequence
<400> 8
gctattgcca tcgccttgtg t 21
<210> 9
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:an artificially
synthesized primer sequence
<400> 9
tcagaacttc aacaccaagg 20
<210> 10
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
CA 02429679 2003-10-22
34
<223> Description of Artificial Sequence:an artificially
synthesized primer sequence
<400> 10
accttagcct tgctcagcta 20
<210> 11
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:an artificially
synthesized primer sequence
<400> 11
gggagaatat gttgcagtag 20
<210> 12
<211> 18
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:an artificially
synthesized primer sequence
<400> 12
caaatggtaa tgggtcaa 18
<210> 13
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:an artificially
synthesized primer sequence
<400> 13
ctgtctcgaa atcgcctctg 20
<210> 14
<211> 19
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:an artificially
synthesized primer sequence
<400> 14
tccagcacat cacccacaa 19
<210> 15
<211> 21
CA 02429679 2003-10-22
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:an artificially
synthesized primer sequence
<400> 15
agcctctgcg tcactgtcat c 21
<210> 16
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:an artificially
synthesized primer sequence
<400> 16
gcagcagcaa actcccaaag 20
<210> 17
<211> 17
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:an artificially
synthesized primer sequence
<400> 17
ggggacgtcg gacctgt 17
<210> 18
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:an artificially
synthesized primer sequence
<400> 18
agttgaagtt tgggctggtc g 21
<210> 19
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:an artificially
synthesized primer sequence
<400> 19
tccatcttgg catctctcag 20
CA 02429679 2003-10-22
36
<210> 20
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:an artificially
synthesized primer sequence
<400> 20
gtacccgcat caggcatctg 20
<210> 21
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:an artificially
synthesized primer sequence
<400> 21
gctgcctcta tcacagtata tt 22
<210> 22
<211> 18
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:an artificially
synthesized primer sequence
<400> 22
cgctcagcaa cgagtttc 18
<210> 23
<211> 847
<212> DNA
<213> Oryza sativa
<400> 23
tgcaccacac acagttcagc tagcagatca cctagctaga tagctgcctc tatcacagta 60
tatttgctcc ctgcaacttg ctgctgctgc aatagctagc agctgcagct agtaagcaaa 120
actatatacc ttcagggttt tttgcaagat cgatggccgg aagtggcagg gacagggacc 180
ctcttgtggt tggtagggtt gtgggtgatg tgctggacgc gttcgtccgg agcaccaacc 240
tcaaggtcac ctatggctcc aagaccgtgt ccaatggctg cgagctcaag ccgtccatgg 300
tcacccacca gcctagggtc gaggtcggcg gcaatgacat gaggacattc tacacccttg 360
tgatggtaga cccagatgca ccaagcccaa gtgaccctaa ccttagggag tatctacatt 420
ggttggtcac tgatattcct ggtactactg cagcgtcatt tgggcaagag gtgatgtgct 480
acgagagccc aaggccaacc atggggatcc accggctggt gttcgtgctg ttccagcagc 540
tggggcgtca gacagtgtac gcgcccgggt ggcgtcagaa cttcaacacc aaggacttcg 600
ccgagctcta caacctcggc tcgccggtcg ccgccgtcta cttcaactgc cagcgcgagg 660
ccggctccgg cggcaggagg gtctacaact agctaacgat gatcccgatc gatctgctgc 720
atgctcacta tcatcatcca gcatgctata cattgcaggt tcagacaatt gaaatgattc 780
tcgacacaca acatatatat gatggtgtaa ttaattatgc aattaattag ctgagcaagg 840
ctaaggt 847
CA 02429679 2003-10-22
37
<210> 24
<211> 847
<212> DNA
<213> Oryza sativa
<400> 24
tgcaccacac acagttcagc tagcagatca cctagctaga tagctgcctc tatcacagta 60
tatttgctcc ctgcaacttg ctgctgctgc aatagctagc agctgcagct agtaagcaaa 120
actataaacc ttcagggttt tttgcaagat cgatggccgg aagtggcagg gacagggacc 180
ctcttgtggt tggtagggtt gtgggtgatg tgctggacgc gttcgtccgg agcaccaacc 240
tcaaggtcac ctatggctcc aagaccgtgt ccaatggctg cgagctcaag ccgtccatgg 300
tcacccacca gcctagggtc gaggtcggcg gcaatgacat gaggacattc tacacccttg 360
tgatggtaga cccagatgca ccaagcccaa gtgaccctaa ccttagggag tatctacatt 420
ggttggtcac tgatattcct ggtactactg cagcgtcatt tgggcaagag gtgatgtgct 480
acgagagccc aaggccaacc atggggatcc accggctggt gttcgtgctg ttccagcagc 540
tggggcgtca gacagtgtac gcgcccgggt ggcgtcagaa cttcaacacc aaggacttcg 600
ccgagctcta caacctcggc tcgccggtcg ccgccgtcta cttcaactgc cagcgcgagg 660
caggctccgg cggcaggagg gtctacccct agctaacgat gatcccgatc gatctgctgc 720
atgctcacta tcatcatcca gcatgctata cattgcaggt tcagacaatt gaaatgattc 780
tcgacacaca acatatatat gatggtgtaa ttaattatgc aattaaatag ctgagcaagg 840
ctaaggt 847
