Note: Descriptions are shown in the official language in which they were submitted.
CA 02430475 2003-05-28
WO 02/050104 PCT/USO1/45105
METHODS AND CELLS FOR DETECTING MODULATORS OF RGS PROTEINS
FIELD OF THE INVENTION
Tlus invention relates to novel cells that respond to a pheromone and express
a
reporter gene operably linked to a pheromone-responsive promoter. In certain
embodiments,
the reporter is Reuilla luciferase, Photi~us luciferase, green fluorescent
protein, or derivates
of green fluorescent protein. In other embodiments, the cells also express a
heterologous
regulator of G proteins ("RGS protein").
In another embodiment, the invention relates to methods of screening for
compounds
that modulate RGS proteins, wherein the methods employ the novel cells of the
invention.
BACKGROUND OF THE INVENTION
The G protein signaling pathway is one of the most important signaling
cascades for
relaying extracellular signals, such as neurotransmitters, hormones, odorants,
and Light. Such
pathways have been identified in diverse organisms, including yeast and
mammals.
Classically, the system is composed of three major components: G protein-
coupled receptors
(GPCRs), heterotrimeric G proteins having a, (3, and y subunits, and
intracellular effectors
(Gilman, 1987). Recently, the RGS family of proteins has been discovered. RGS
proteins
provide a mechanism by which cells can fme tune both the duration and the
magnitude of a
signal generated through the G protein pathways (Kehrl et al., 1999). The
present invention
is directed to modified host systems that can be used to isolate and
characterize novel factors
that regulate RGS proteins. Such factors show great potential for controlling
and treating
diseases resulting from inappropriate activity of G protein signaling
pathways.
The G protein signaling pathway commences upon activation of a GPCR, which is
characterized by its seven transmembrane domains. When the GPCR is stimulated,
its
-1-
CA 02430475 2003-05-28
WO 02/050104 PCT/USO1/45105
intracellular loops and C-terminal tail interact with an associated G protein
(Wieland et al.
1999). The Ga subunit of the G protein then releases guanosine diphosphate
(GDP) and
binds guanosine triphosphate (GTP) in its place. The binding of the GTP alters
the shape, or
three-dimensional conformation, of the Ga subunit, resulting in the
dissociation of the
heterotrimer into a GTP-liganded Ga subunit and a G(3y dimer. The released
subunits are
then free to induce downstream signaling events, ultimately mediating
biochemical
responses, changes in cellular physiology, or other specific cellular
responses. The signaling
is terminated when the Ga subunits hydrolyze GTP, returning to the GDP-bound
state,
followed by reassembly with the G(3y subunits to form the inactive
heterotrimers (Kehrl,
IO 1998).
To elicit an appropriate cellular response, the strength of the intracellular
signals must
be tightly regulated. While there are a number of types of regulation of the
system, such as
phosphorylation of GPCRs, receptor binding proteins, and G[3y-trapping
proteins, many
investigators have focused on GTPase activating proteins (GAPS) (see Wieland
et al., 1999).
GAPS accelerate the rate of the Ga-GTPase hydrolysis, thereby reducing the
signal generated
in the pathway and "desensitizing" the system. (DeVries et al., 1999).
RGS proteins represent a relatively new class of GAPs. The first member of the
family was obtained from the yeast Saceha~omyces ce~evisiae (Dohlman et al.,
1996;
Weiland et al., 1999). Hapliod mutants were identified that were
hypersensitive to
pheromone-induced cell cycle arrest, a response mediated by a GPCR pathway.
Studies
revealed that a mutated gene product, Sst2; interacted with the G protein Ga-
subunit as a
GAP. Thus, Sst2 served as a negative regulator of the system, controlling the
maturation of
the yeast. Subsequently, many more members of the RGS family have been
characterized in
a number of species, including over 20 different members in mammals (Zheng et
al. 1999). It
_2_
CA 02430475 2003-05-28
WO 02/050104 PCT/USO1/45105
is hypothesized that the repertoire of RGS proteins is greatly increased by
alternative splicing
(Panetta et al., 1999).
In addition to their role as GAPS for activated Ga subunits, RGS proteins have
also
been reported to stimulate G(3y-mediated pathways. Although RGS proteins have
a
siguficantly higher affinity for Goc-GTP, RGS proteins have a low affinity for
Ga-GDP.
When RGS proteins bind to Ga,-GDP, G(3y proteins remain free to mediate
downstream
events (see Panetta et al., 1999). Thus, RGS proteins may be critical in
regulating G protein
signaling pathways in more than one way.
Because of the size of the RGS family and the crucial role of RGS proteins in
regulating G protein signaling pathways, scientists have begun to study how
individual RGS
proteins achieve their specificity. One level of specificity results from the
expression pattern
of different RGS proteins; some RGS proteins are expressed in particular
tissues while some
are expressed ubiquitously (Zheng et al., 1999; Panetta et al., 1999). It is
also suspected that
different RGS proteins may have differing specificity for individual Gcx-
subunits (I~ehrl et
al., 1998). This would enable certain RGS proteins to preferentially modulate
certain G
protein signal pathways over others (Zheng et al., 1999), or bias a dual G
alpha response from
a single GPCR.
Control of G protein signaling pathways may also be achieved through
modulation of
RGS protein concentration or activity. For example, transcription of RGS
protein-encoding
~0 genes may be altered through biochemical feedback mechanisms (see Panetta
et al., 1999).
Platelet-activated factor has been shown to trigger RGS 1 expression in B
cells, while RGS 16
expression is induced by carbachol. Conversely, RGS4 expression is down-
regulated in
response to intracellular cAMP levels.
-3-
CA 02430475 2003-05-28
WO 02/050104 PCT/USO1/45105
Many cell-based research platforms linl~ the desired effect of a gene or drug
of interest
to a change in cell phenotype through the use of reporter genes. In yeast
systems, for
example, reporter genes have commonly focused on auxotrophy genes for cell
growth on
selective media, or the LacZ gene for colorometric endpoint using assays that
detect
(3-galactosidase activity. The gene encoding luciferase, for example, from
Renilla z~enifof~zzzis
or Plzotizzus pyz"alis, is also useful as a reporter gene in yeast. Luciferase
reporters provide
increases in assay sensitivity, speed, ease, signal:noise ratios, and provide
high quality
quantitative data to yeast-based assays for a myriad of target identification
and drug
discovery applications. Use of the luciferase reporter gene in yeast provides
substantial
improvements to yeast-based assays such as assays for modulators of RGS
proteins.
In one embodiment, the instant invention is directed to methods for the
identification
of compounds capable of regulating RGS proteins, for example, compounds that
directly or
indirectly interact with the RGS proteins themselves. Clues to such factors
can be found in
the literature. For example, both RGS3 and RGS 12 have regions predicted to
assume a
coiled coil structure; such domains often mediate interactions with proteins
of the cellular
cytoslceleton (Kehrl et al., 1999). This may allow RGS proteins to fluctuate
between
membrane-associated and cytosolic pools, thus altering the availability of the
RGS proteins at
a given time and/or influencing the type of Ga-subunit the RGS protein
modulates (DeVries
et al., 1999).
The novel modified cells of the invention, and the novel methods incorporating
these
cells provide a significant advance for detecting substances that affect RGS
proteins. At this
time, no one has developed an efficient and specific screening system to
systematically detect
compounds that are capable of regulating RGS activity. Such compounds axe of
great
therapeutic value, as they could potentially modulate one or more of hundreds
of G protein
pathways that mediate a vast array of biological processes and underlie
several diseases. In
-4-
CA 02430475 2003-05-28
WO 02/050104 PCT/USO1/45105
addition, pharmacologists estimate that up to 60% of all medicines used today
exert their
effects through G protein signaling pathways (Roush, 1996). By uncovering new
factors that
regulate these systems, the phenomenon of drug tolerance associated with many
of these
medicines may be countered.
SUMMARY OF THE INVENTION
In one aspect, the invention is directed to a cell that responds to a
pheromone
comprising a heterologous nucleic acid encoding a suitable reporter operably
linlced to a
pheromone-responsive promoter, wherein the reporter is, for example, Revcilla
luciferase,
Photiuus luciferase, green fluorescent protein, or a derivate of green
fluorescent protein. The
cell may be a mammalian cell or a yeast cell. In particular embodiments, the
yeast cell is
Saccharomyces ce~evisiae, Schizosaccha~ofzzyces pombe, or Pichia
pastof°is, preferably
Saccha~~onzyces ce~evisiae.
The heterologous nucleic acid encoding the promoter may be contained on a
vector,
for example, a plasmid. In alternative embodiments, the heterologous nucleic
acid is
integrated into the cell's genome.
For certain embodiments, the pheromone-responsive promoter i's LUC1, FUS1,
FUS2,
KAR3, FUS3, STE3, STE13, STE12, CHS1, FART, AGAl, AGA2, AGal, GPA1, STE2,
STE3, STE6, MFA1, MFA2, MFal, MFa2, CIKl, or BART.
In another aspect, the cells of the invention may fi~ther comprise a
heterologous
nucleic acid encoding an RGS protein. The RGS protein may lack a G gamma-like
("GGL")
or disheveled EGL-10 pleckstrin ("DEP") domain. In alternative embodiments,
the cell will
further comprise an endogenous nucleic acid encoding a native RGS protein
corresponding to
a heterologous RGS protein, wherein the endogenous nucleic acid is mutated
such that it does
-5-
CA 02430475 2003-05-28
WO 02/050104 PCT/USO1/45105
not produce a functional native RGS protein. The mutation is either or each of
a deletion,
insertion, or substitution.
Any RGS protein is suitable for use in the invention, including RGSZ1, RGSZ2,
Ret-
RGS1, RGS1, RGS2, RGS3, RGS4, RGSS, RGS6, RGS7, RGSB, RGS9-1, RGS9-2, RGS10,
RGS 11, RGS 12, RGS 13, RGS 14, RGS 16, RGS-PX1, GAIP, Axin, Conductin, egl-
10, eat-16,
p1 lSRhoGEF, and isoforms thereof or proteins containing an RGS-like (RGL)
domain.
Where the protein contains an RGS-like (RGL) domain, that domain may be PLCB
or
gamma subunit of cGMP PDE. Preferably, the RGS protein is RGS2, RGS4, RGS6,
RGS11,
or RGSZ. In some embodiments, the RGS protein lacks a GGL or DEP domain.
In some embodiments the cell will further comprise a heterologous nucleic acid
encoding GbetaS. In a particular, embodiment, the GbetaS is human.
In certain embodiments, the RGS protein is a chimera. The chimera may comprise
an
N-terminus of RGS4 and a C-terminus of RGS7, an N-terminus of RGS7 and a C-
terminus of
RGS4, an N-terminus of RGS4 and a complete RGS 10, an N-terminus RGS4 and a
complete
RGS7, an N-terminus of RGS4 and a C-terminus of RGS9 lacking a GGL domain, an
N-
terminus of RGS4 and a C-terminus of RGS9 having a GGL domain, and an N-
terminus of
RGS4 and the RGS domain of axin, or portions thereof.
In particular embodiments, the N-terminus of RGS4 comprises amino acids
1-57 of RGS4, the C-terminus of RGS7 comprises amino acids 255-470 of RGS7 the
N-
terminus of RGS7 comprises amino acids 1-332 of RGS7, the C-terminus of RGS4
comprises
amino acids 58-206 of RGS4, and the axin RGS domain comprises amino acids 199-
345 of
axm.
The invention includes cells comprising a heterologous nucleic acid encoding a
chimeric RGS protein, such as those described above. The cell may be a
mammalian cell or a
-6-
CA 02430475 2003-05-28
WO 02/050104 PCT/USO1/45105
yeast cell. In particular embodiments, the yeast cell is Saccha~~o~ayces
cep°evisiae,
Schizosacchar~omyces pombe, or Pichia pastof°is, preferably
Saccharomyces cef°evisiae.
The heterologous nucleic acid encoding the chimeric RGS protein may be
contained
on a vector, for example, a plasmid. In alternative embodiments, the
heterologous nucleic
acid is integrated into the cell's genome.
Another aspect of the invention relates to an isolated nucleic acid encoding a
chimeric
RGS protein. The chimeric RGS protein may be any of those discussed above. The
isolated
nucleic acid may be inserted into a vector, such as a plasmid or a virus. The
plasmid may be
a low copy number plasmid.
In yet another aspect, the invention is a method of detecting the ability of a
test
sample to alter RGS protein-mediated reporter gene expression, comprising:
(a) providing at least one first cell that responds to a pheromone, wherein
the first
cell comprises a heterologous nucleic acid encoding a reporter operably linked
to a
pheromone-responsive promoter, wherein expression of the heterologous nucleic
acid
produces a measurable signal;
(b) ,providing at least one second cell that responds to a pheromone, wherein
the
second cell comprises a heterologous nucleic acid encoding a reporter operably
linked to a
pheromone-responsive promoter, wherein expression of the heterologous nucleic
acid
produces a measurable signal, and a second heterologous nucleic acid encoding
an RGS
protein;
(b) incubating a test sample with the first and second cells in the presence
of a
pheromone under conditions suitable to detect the measurable signal;
(c) detecting the level of expression of the heterologous nucleic acid
encoding the
reporter; and
_7
CA 02430475 2003-05-28
WO 02/050104 PCT/USO1/45105
(d) comparing the level of expression in the first and second cells, wherein a
difference in the level of expression indicates that the test sample alters
RGS protein-
mediated reporter gene expression.
To carry out the method of the invention, any suitable cell of the invention,
such as
those described above, may be used.
In one embodiment, the method may be performed using the test sample at a
single
concentration, or, alternatively, the test sample is used in a range of
concentrations.
In performing the methods of the invention, detection of the level of
expression of the
reporter gene maybe accomplished using any suitable method known in the art.
In certain
embodiments, detection of the reporter gene is accomplished using a halo
assay. In
alternative embodiments, the level of expression of the reporter is detected
spectrophotometrically. Detection may be automated, thereby increasing the
utility of the
invention for screening test compounds on a large scale.
In a different aspect, the invention is a method of detecting the ability of a
test sample
to alter RGS protein-mediated reporter gene expression, comprising:
(a) providing at least two aliquots of a cell that responds to a pheromone,
wherein
the cell comprises a heterologous nucleic acid encoding a reporter operably
linked to a
pheromone-responsive promoter, wherein expression of the heterologous nucleic
acid
produces a measurable signal, and a second heterologous nucleic acid encoding
an RGS
protein;
(b) incubating the aliquots of cells in the presence of a pheromone under
conditions
suitable to detect the measurable signal, wherein one of the aliquots contains
a test sample;
(c) detecting the level of expression of the heterologous nucleic acid
encoding the
reporter in the aliquots; and
_g_
CA 02430475 2003-05-28
WO 02/050104 PCT/USO1/45105
(d) comparing the level of expression of the reporter in the aliquots, wherein
a
difference in the level of expression between the aliquots indicates that the
test sample alters
RGS protein-mediated reporter gene expression.
To carry out the method of the invention, any suitable cell of the invention,
such as
those described above, may be used.
In one embodiment, the method may be performed using the test sample at a
single
concentration, or, alternatively, the test sample is used in a range of
concentrations.
In performing the methods of the invention, detection of the level of
expression of the
reporter gene maybe accomplished using any suitable method lcnown in the art.
In certain
embodiments, detection of the reporter gene is accomplished using a halo
assay. In
alternative embodiments, the level of expression of the reporter is detected
spectrophotometrically. Detection may be automated, thereby increasing the
utility of the
invention for screening test compounds on a large scale.
BRIEF DESCRIPTION OF THE DRAWINGS
FIGURE 1 depicts halo assays for yeast with plasmids comprising RGS4
constructs.
Yeast derived from strains KY103 and KY113 are shown.
FIGURE 2A shows that yeast with the RGS4 and FUS 1-lacZ constructs exhibit a
marked attenuation of pheromone-induced growth when compared to control
strains lacking
the RGS4 construct in a strain derived from KY103.
FIGURE 2B shows that yeast with the RGS4 and FUSl-lacZ constructs show a
marked attenuation of pheromone-induced growth when compared to control
strains lacking
the RGS4 construct in a strain derived from KYl 13.
-9-
CA 02430475 2003-05-28
WO 02/050104 PCT/USO1/45105
FIGURE 3 shows that a yeast strain (KY117) with the RGS4 and FUS 1-luciferase
constructs exhibits an attenuated level of luminescence in the presence of
alpha factor when
compared to a control strain Iaclcing the RGS4 construct (KYl 18).
FTGURE 4A depicts dose response curves of luminescence in response to alpha
factor in cells containing RGS4 and FUSl-luciferase constructs and a control
strain Iaclcing
an RGS4 construct. Both strains are derived from KY103.
FIGURE 4B depicts dose response curves of luminescence in response to alpha
factor in cells containing RGS4 and FUS1-luciferase constructs and control
strain lacking an
RGS4 construct. Both strains are derived from KYl 13.
FIGURE 5 depicts a schematic of the yeast pheromone-based assay for screening
compounds as RGS bloclcers.
FIGURES 6A-C shows single dose assays for 96 compounds as a screen for
compounds that interfere with RGS4-mediated attenuation of luminescence.
Figure 6A
shows the effect of the compounds in a yeast strain expressing RGS4. Figure 6B
shows the
effect of the compounds in a yeast strain having a control vector lacking the
RGS4 sequence.
Figure 6C shows the fold difference between the RGS4-expressing and control
yeast strains.
FIGURES 7A-D shows dose response curves for test compounds SBQ7B1,
SBQ8B1, CL485, and CL744, respectively. For each compound, figures showing the
original counts per second, fold difference between strains, and fold
difference within a strain
are provided.
FIGURE 8 shows that yeast strains expressing RGSZ1 demonstrated smaller halos
and decreased Luminescence than control yeast strains expressing an empty
vector, indicating
complementation of sst2 in yeast. Also shown axe the results of halo assays
for yeast strains
expressing RGS2, RGS7, and RGS9.
-10-
CA 02430475 2003-05-28
WO 02/050104 PCT/USO1/45105
FIGURES 9A-D show dose response curves for test yeast strains expressing
RGSZ1,
RGS~, RGS7, and RGS9, respectively, compared to control yeast strains
expressing an empty
vector in response to varying concentrations of alpha factor.
FIGURE 10 shows the results of halo assays for yeast strains co-expressing
RGS9
and hGbetaS.
FIGURE 11 shows the results of halo assays for yeast strains co-expressing
RGS7
and hGbetaS.
FIGURE 12 shows the results of luciferase assays for chimeric RGS4/RGS10,
RGS4,
RGS 10, RGS7, RGS9, RGS6, and RGS 11.
FIGURE 13 shows the results of luciferase assays for RGS7, chimeric
RGS7(ggl)/RGS4, chimeric RGS4/RGS7(ggl) 4/RGS10, RGS4, RGS10, RGS7, RGS9,
RGS6, and RGS11.
DETAILED DESCRIPTION OF THE INVENTION
The modified cells of this invention employ a host cell. An effective host
cell for use
in the present invention simply requires that it is defined genetically in
order to engineer the
appropriate expression of a pheromone-responsive promoter linked to a
reporter(s),
optionally an exogenous RGS protein, and any other desired genetic
manipulations. The host
cell can be any cell, such as a eulcaryotic or prokaryotic cell, for example,
a mammalian cell,
capable of responding to a pheromone or other compound that serves as a ligand
for a GPCR.
The cell may naturally respond to the pheromones or other compounds or may be
genetically
engineered to respond to them. Preferably, the host cell is a fungal cell, for
example, a
member of the genera Aspe~gillus or Neuropo~a. In more preferred embodiments,
the host
cell is a yeast cell. In alternative preferred embodiments the yeast cell is
Sacclzaf omyces
cep°evisiae, Schizosaccha~omyces pombe or Pichia pasto~is.
-11-
CA 02430475 2003-05-28
WO 02/050104 PCT/USO1/45105
The cell of the invention employs at least one construct comprising a
heterologous
nucleic acid encoding a reporter operably linlced to a pheromone-responsive
promoter,
wherein expression of the heterologous nucleic acid produces a measurable
signal.
Preferably, the heterologous nucleic acid is contained on a vector, such as a
plasmid,
although, alternatively, the nucleic acid may be integrated into the cell's
chromosome.
In certain embodiments the host cell further comprises an exogenous RGS
protein. In
preferred embodiments, the endogenous RGS protein in the host cell is mutated.
Upon
treatment with a pheromone, such as alpha factor, the pheromone sensitive-
promoter is
activated, resulting in expression of the reporter gene. Expression of a
functional RGS
protein inhibits activation of the pheromone-responsive promoter, resulting in
a decrease in
the expression of the reporter gene. The presence of a compound that inhibits
RGS protein
activity results in an increase in expression of the reporter gene.
Heterologous nucleic acid sequences are expressed in a cell by means of, for
example,
an expression vector or plasmid. An expression vector or plasmid is a
replicable DNA
construct in which a heterologous nucleic acid is operably linked to one or
more suitable
control sequences capable of affecting the expression of the reproter protein
or protein
subunit coded for by the heterologous nucleic acid sequence in the intended
host cell.
Generally, control sequences include a transcriptional promoter, an optional
operator
sequence to control transcription, a sequence encoding suitable mRNA ribosomal
binding
sites, and sequences that control the termination of transcription and
translation.
In addition to plasmids, vectors useful for practicing the invention include
viruses,
and integrable DNA fragments such as insertion sequences and transposons that
integrate into
the host genome by genetic recombination. Viral vectors suitable for use in
the invention
include adenovirus, adeno-associated virus, herpes simplex virus, rous sarcoma
virus,
lentivirus, and sindbis virus. The vector may replicate and function
independently of the host
-12-
CA 02430475 2003-05-28
WO 02/050104 PCT/USO1/45105
genome, as in the case of a plasmid, or may integrate into the genome itself,
as in the case of
an integrable DNA fragment, such as, for example, an insertion sequence or
transposon.
Suitable vectors will contain replication and control sequences that are
derived from species
compatible with the intended host cell. For example, a promoter operable m a
host cell is one
that binds the RNA polymerase of that cell. Suitable replication and control
sequences are
well known to those of skill in the art.
Nucleic acids axe operably associated with a control sequence when they are
functionally related to each other. For example, a promoter is operably linked
to a nucleic
acid if it controls the transcription of the nucleic acid. A ribosome binding
site is operably
linked to a nucleic acid if it is positioned so as to permit translation.
The pheromone-responsive promoter and the ligand used can vary widely as Iong
as
their specific interaction are lcrzown or can be deduced by available scientif
c methods. Any
of a variety of naturally occurring pheromone-responsive promoters, or
synthetic pheromone-
response element, or other pheromone-response-element-containing-gene could be
used.
Preferably, the pheromone-responsive promoter is from FUS1, FUS2, KAR3, FUS3,
STE3,
STE13, STEI2, CHS1, FART, AGAl, AGA2, AGal, GPA1, STE2, STE3, STE6, MFAI,
MFA2, MFal, MFa2, CIK1, LUCI, BAR1, or an omega element.
Preferably, the pheromone used in the invention is alpha factor, a factor, or
an M
pheromone, although any pheromone or functional component that initiates
changes in a
yeast cell associated with the mating process (such as morphological changes,
agglutiniation,
morphogenesis, cell fusion, nuclear fusion, and so forth) is suitable fox use
in this invention.
As used herein, "heterologous" refers to nucleic acids, proteins, and other
material
originating from organisms other than the cell of the invention, or
combinations thereof not
naturally found in the cells of the invention. This term also refers to
nucleic acid that
originates from the same orgazusm as the cell of the invention, but which has
been modified
-13-
CA 02430475 2003-05-28
WO 02/050104 PCT/USO1/45105
in any way relative to the corresponding endogenous sequence.
Any G protein-coupled receptor system may be employed in practicing this
invention.
Examples of such receptor systems include, but are not limited to, those
related to adenosine
receptors, somatostatin receptors, dopamine receptors, cholecystolcinin
receptors, muscarinic
cholinergic receptors, a-adrenergic receptors, (3-adrenergic receptors, opiate
receptors,
cannabinoid receptors, histamine receptors, growth hormone releasing factor
receptors,
glucagon receptors, serotonin receptors, vasopressin receptors, melanocortin
receptors, and
neurotensin receptors.
The reporter gene is generally selected in order that the interaction between
binding of
the ligand to its GPCR and the pheromone-responsive promoter can be monitored
by well-
known and straightforward techniques. Preferably, the reporter gene is
selected based on its
cost, ease of measuring its activity and low bacl~ground. That is, the
activity can be
determined at relatively low levels of expression of the reporter gene because
of a high signal
to bacl~ground ratio and/or a relatively low or no uninduced activity. The
reporter can be any
reporter for which its activity can be detected by any means available.
Illustrative of
reporters that can be used in the present invention are luciferase genes,
green fluorescent
protein genes, derivatives of green fluorescent protein genes, or CAT.
Preferably, the activity
of the reporter is indicated by colorimetric or fluorescent methods.
In a preferred embodiment, the reporter gene is a luciferase gene, for
example, a
luciferase gene from Reuilla f ehiformis or Photihus py~alis. Luciferase genes
from other
organisms are also well known to those of slcill in the art. A significant
advantage conferred
by the use of the luciferase reporter gene is that it enables a liquid assay
that is rapid, thereby
permitting high through-put screening of test samples. Additionally, use of
the luciferase
reporter in yeast provides enhanced assay sensitivity, enables gathering of
quantitative data,
and allows assay automation, especially for higher through-put (384 well)
assay formats. The
- 14-
CA 02430475 2003-05-28
WO 02/050104 PCT/USO1/45105
short assay time adds utility in drug screening applications in avoiding
compound toxicity
effects due to long (48+ hours) incubation times presently needed for standard
auxotrophic
(HIS3, LYS2, URA3) reporters or counter selection (CANT, URA3, CYH2)
reporters, both
of which require cell growth for endpoint determinations.
Illustrative of RGS proteins which can be used in this invention are proteins
containing an RGS domain such as RGSZ1, RGSZ2, Ret-RGS1, RGS1, RGS2, RGS3,
RGS4,
RGSS, RGS6, RGS7, RGSB, RGS9-1, RGS9-2, RGS10, RGS11, RGS12, RGS13, RGS14,
RGS16, RGS-PX1, GAIP, Axin, Conductin, egl-10, eat-16, p115RhoGEF, and
isoforms
thereof or proteins containing an RGS-like (RGL) domain, for example, PLCB,
gamma
subunit of cGMP PDE.
Both 2 micron and low copy number (CEN) versions of pheromone-responsive
promoter-reporter gene constructs can be made to enable further control over
reporter gene
function or assay sensitivity by manipulation of the reporter gene copy number
within a cell.
Molecular cloning techniques are carried out using standard methods, for
example,
those described by Ausubel et al., 1998. Restriction digests are performed as
to
manufacturers' specifications. Where appropriate to the cloning scheme, cDNA
fragments
were end-filled to generate blunt ends using I~lenow according to standard
techniques.
Dephosphorylation of cDNA fragments and/or vectors was conducted using Shrimp
Alkaline
Phosphatase (SAP) according to manufacturers' instructions (Boehringer Manheim
or
Amersham Life Science). Ligation reactions were conducted using standard
techniques, and
recombinant vectors were transformed into Esche~ichia coli DHSalpha cells and
plated on
LB-agar plates containing appropriate antibiotic(s). Colonies were recovered
and plasmid
DNA prepared using either DNA midi prep lcits, or automated DNA preparation
(Qiagen).
Integrity of plasmids and cloning strategies were confirmed using reagents
from Perlcin-
Elmer, and automated sequencing equipment from ABI. Yeast strains were
transformed
-15-
CA 02430475 2003-05-28
WO 02/050104 PCT/USO1/45105
using a Lithium Acetate procedure and plated on appropriate media (Rose et
al., 1990). All
yeast media and reagents were prepared using standard methods.
The novel modified cells of this invention are readily applied in various
screening
methods for determining the expression of the reporter gene in the presence of
test
compounds. The screening methods of this invention are designed to detect
compounds that
interact with the ability of the RGS protein to modify the G protein response
pathway as
determined by an alteration in the activity of the reporter gene. The test
compound may be a
peptide, which is preferably about two amino acids in length, or a non-peptide
chemical
compound. The non-peptide test compounds includes compounds, complexes and
salts as
well as natural product samples, such as plant extracts, tissue extracts, and
materials obtained
from fermentation broths.
In a prefeiTed embodiment of the invention, cells were developed in which RGS
activity can be monitored. In one example, the luciferase gene was linlced to
a pheromone-
responsive promoter, FUS 1. This FUS 1-luciferase reporter gene was expxessed
in a yeast
cell in which the endogenous RGS protein, Sst2, was deleted or expressed in a
yeast strain
wherein the endogenous sst2 gene contains a mutation rendering it functionally
equivalent to
a sst2 deleted strain. In the "test" cells, a plasmid was added expressing the
mammalian
RGS4 protein, while "control" cells were transfected with plasmids lacking the
RGS4 gene.
The test and control cells were treated with the alpha factor ligand, which
binds to the
receptor and stimulates the cellular cascade to drive the FUS 1 promoter and
expression of the
luciferase reporter gene. In the control strain, a high level of luciferase
was expressed,
resulting in strong luminescence in the presence of the substrate. Conversely,
the yeast strain
containing the RGS4, which negatively regulates the signal cascade,
demonstrated a greatly
diminished activity of the FUS 1-luciferase reporter gene. These findings
correlated with
previous findings using other reporters such as ~i-gal activity or auxotrophic
markers.
-16-
CA 02430475 2003-05-28
WO 02/050104 PCT/USO1/45105
These yeast cells can be used in a number of ways to investigate or discover
factors
that interact with RGS proteins. For example, a test compound can be added to
the test strain
containing the vector expressing the RGS4 protein. If the factor interacts
with the RGS4
protein, it will blocl~ or enhance the RGS4 protein function, thus affecting
the RGS protein
ability to negatively regulate the signal induced from alpha factor/receptor
interaction. The
alpha factor signal stimulation will then be available (prolonged in its
ability) to reduce
expression of the reporter gene, resulting in a high level of luminescence.
Alternatively, a
compound that enhances RGS function will reduce reporter gene expression.
Compounds
that demonstrate an increase in Iuciferase activity within the test (RGS4-
expressing) strain in
comparison to the control strain are considered to be potential drug
candidates. Compounds
that result in an increase in luciferase activity in the test strain of
approximately 50% (or
some other suitably determined percentage) over that seen for a vector control
cell can be
tested in a dose response assay.
These types of RGS assays show great potential in drug discovery. They are
very
sensitive, have a short testing period, and are ideal for high through-put
systems used in large
scale drug discovery. In addition, the luciferase-RGS assay may be used to
identify ligands
for orphan G-protein receptors, and could be used to study or screen other
members in
G-protein pathways, such as kinases.
The following Examples are provided to further illustrate various aspects of
the
present invention. They are not to be construed as limiting the invention.
Example 1. FUSl-LacZ reporter RGS assay:
Stimulation of the GPCR receptor by alpha factor in yeast is well
characterized (see
Dohlman et al., 1996). Stimulation of this pathway usually results in yeast
cell cycle arrest.
This signaling pathway is controlled by an endogenous RGS protein, Sst2, which
functions as
-17-
CA 02430475 2003-05-28
WO 02/050104 PCT/USO1/45105
a negative regulator of GPCR signaling. The RGS protein acts to accelerate the
endogenous
GTPase activity of the Ga,-subunit. Deletion of the gene encoding Sst2 in
yeast results in
yeast cells that are supersensitive to the ligand, since the ability to turn
off the GPCR signal is
impaired. A mammalian RGS protein, RGS4, can functionally complement for Sst2
in yeast.
In the present experiment, reporter gene activity was measured in yeast
strains deleted
for sst2 in the presence or absence of the mammalian RGS4 protein. In this
assay, we tested
whether the RGS4 protein could modulate the alpha-factor-induced pheromone-
response
pathway leading to activation of pheromone-responsive genes. A lacZ gene was
operably
linked downstream to the pheromone-responsive promoter (FUS1-lacZ reporter
gene) and
expressed in a cell, such as a MATa cell, capable of responding to the
pheromone alpha
factor.
A plasmid (Kp27) comprising the FUS-1 promoter and the LacZ reporter gene was
prepared. This plasmid was generated by digestion of pRS424 plasmid
[Stratagene] with
.~YhoI and EagI. The FUS1-promoter region (GenBank M16717) was generated as a
1.095kb
EcoRI-SaII fragment while the 13-galactosidase gene (GenBank CVU89671) was
generated as
a 3.Olcb SaII-EagI fragment. A three-way, directional ligation was conducted
between the
prepared pRS424 vector, the FUS 1 fragment and the 13-galactosidase fragment
using standard
methods to generate plasmid Kp27. Recombinant DNA was transformed into E. coli
and
DNA from selected transformants was prepared by standard methods. The Kp27
construct
was confirmed by restriction digests and sequence analysis.
We also prepared plasmid constructs encoding the RGS4 protein. The cDNA
encoding full-length rat RGS4 (Genbank AF117211) was obtained by PCR using
plasmid
pWE2RGS4 as a template (Shuey et al., 1997) with the following primers:
Kx 13 (forward)
5'-GACGTCTCCCATGTGCAAAGGACTCG (SEQ ID NO: 1)
-18-
CA 02430475 2003-05-28
WO 02/050104 PCT/USO1/45105
which contains an embedded BsmBI site and part of a NcoI sequence; and
Kx41 (reverse):
5'-CGGGATCCTTATTAGGCACACTGAGGGACTAGGGAAG (SEQ ID NO: 2)
which contains an extra stop codon and the embedded BamHI site.
To construct a hemagglutinin-tagged ("HA") RGS4, a different 3'primer was used
which lacks the stop codon, but contains an embedded BamHI site:
Kx42(reverse): 5'-GAGGATCCGGCACACTGAGGGACTAGGGAAG (SEQ ID NO: 3)
The PCR products (approximately 650 bp) were digested with BsmBI and Baf~zHI
and
ligated to vectors Kp46 or Kp57 for untagged and HA-tagged RGS4 protein
expression,
respectively. The resultant plasmids Kp118 (RGS4-Kp46) and Kpl 19 (RGS4-Kp57)
were
transformed into bacterial cells. Recombinant DNA was prepared and confirmed
by
sequence analysis using the following primers:
Kx43: 5'-TTTTTACAGATCATCAAGGA (SEQ ID NO: 4)
Kx44: 5'-TGCGTCTTGAGAGCGCTTTT (SEQ ID NO: 5)
Kx39: 5'-GAGCCAAGAAGAAGTCAAGAAAT (SEQ ID N0: 6)
Kx40: 5'-TGGGCTTCATCAAAACAGG (SEQ ID N0: 7)
To generate a yeast strain in which the endogenous RGS protein, SST2, was
deleted, a
SST2::NE0 construct was obtained from LEU marked plasmid pEKI39/I38 by
digestion
with NhoI and SacI. The resulting 4.0 kb fragment containing the sst2-NEO-sst2
cassette was
gel isolated and purified. ,Tlus cDNA fragment was co-transformed into yeast
strain CY770
(MATa leu2-3,112 ura3-52 trill-901 his-200 ade2-101 gal4 ga180 lys2::GALuas-
HIS3 cyhR;
Young, et al., 1995) with URA marked pRS416 (Stratagene) to enhance
integration.
Following transformation, yeast cells were grown in YPD medium and plated on
SC-ura
media., Resultant URA+ yeast colonies were sequentially replica plated onto
YPD media
containing SOug/ml, and then with 100 ug/ml 6418 (Geneticin from BRL). The
6418
resistant CY770 yeast colonies were confirmed by PCR analysis to verify the
sst2 NEO-sst2
-19-
CA 02430475 2003-05-28
WO 02/050104 PCT/USO1/45105
construct integration. The primers used for PCR verification were the
following:
Kx24: 5'-TATCGAGTCAATGGGGCAGGC (SEQ ID NO: 8)
Kx25: 5'-CGAAACGTGGATTGGTGAAAG (SEQ ID NO: 9)
Kx26: 5'-ATTCGGCTATGACTGGGCACAAC (SEQ ID NO: I O)
Kx27: 5' GTAAAGCACGAGGAAGCGGTCAG (SEQ ID NO: 11
A 4.2 lcb PCR fragment was expected from Kx24 and Kx25 primers for a confirmed
Icnoclcout strain, while a 4.9 lcb PCR product was expected for the wildtype
(non-lcnockout)
yeast strain. A 2.6 kb PCR product was expected from Kx24 and Kx27 primers for
a
confirmed knockout stain, while no PCR product was expected from the wildtype
(non
lcnoclc-out) strain. A 2.4 lcb PCR product was expected from Kx25 and Kx26
primers for a
confirmed lcnoclcout strain while no PCR product was expected from the
wildtype (non
knock-out) strain.
Following PCR verification, candidate yeast colonies were plated on SC-ura
plates to
confirm the loss of the pRS416 plasmid used to facilitate integration. To test
the ability of
the RGS4 protein to complement the loss of the Sst2 protein, 6418 resistant,
ura-minus
colonies were tested for response to alpha factor stimulation using pheromone-
response halo
assays (Dohlman et al., 1996). Results are depicted in Figures 1, 2A and 2B,
which show
halo assays and dose curves, respectively, in two yeast backgrounds. One of
the tested and
confirmed CY7700sst (knockout) yeast colonies was designated KY103 (MATa leu2-
3,112
ura3-52 trill-901 his-200 ade2-101 gal4 ga180 Lys2::GALuas-HIS3 cyhR , sst2,
G418R).
Similarly, yeast strain YPH499 (American Type Culture Collection, Manassas,
VA) was
deleted for the sst2 gene and designated KY113 (MATa ura3-52 lys2-801a ade2-
lOlo trpl-
D63 his3-D200 Ieu2-Dl, sst2).
Pheromone-responsive yeast test strains were generated using a Li-acetate
method
(Rose et al., 1990) and plated on plasmid retention media. Plasmids Kp118 (RGS
expression
plasmid) and Kp27 (FUS I-lacZ reporter plasmid) were transformed into KY103.
-20-
CA 02430475 2003-05-28
WO 02/050104 PCT/USO1/45105
Control yeast strains were prepared by co-transforming empty expression
plasmid
Kp46, which lacks an RGS-encoding sequence, and reporter plasmid Kp131 into
strain
KY103 to generate yeast strain Ky116, and into strain KY113 to generate strain
KY118.
To see if the RGS4 protein interfered with pheromone-induced transcription of
the 13-
galactosidase gene, yeast having the RGS4 construct and control yeast having
an empty
vector were treated with alpha factor (25 nM). Expression of RGS4 in strain
KYl 17
desensitized the pheromone-induced LacZ signal (data not shown). Expression of
RGS4 also
rescued pheromone-induced growth arrest.
Example 2. FUS1-luciferase reporter RGS assay:
Example 1 confirmed that a plasmid generated with the desired baclcbone and
pheromone-responsive FUS 1 promoter operably liuced upstream of the LacZ gene
could be
used to study the activity of an RGS protein. In this experiment, a luciferase
gene was linked
downstream to the FUS 1 promoter instead of the lacZ gene. This luciferase
system provides
certain advantages over the system with the lacZ reporter gene, most notably
increased speed
and ease of monitoring gene expression.
A FUS-1 reporter plasmid (Kp120) comprising a luciferase gene was constructed.
The FUS 1-luciferase reporter cassette was constructed by an NcoI Xba I
digestion of
plasmid pGL (Promega) to isolate a 1.7 kb fragment containing the firefly
luciferase gene.
This fragment was blunt ended and purified. The Kp27 vector served as the base
vector and
was prepared by digestion with BamHI-NotI (to remove the LacZ gene),
dephosphorylated,
blunt-ended, and purified. The prepared vector and luciferase fragment were
ligated to
generate plasmid Kp 120. This cloning scheme resulted in an expected four
extra amino acid
residues (methionine, alanine, glycine, serine) fiom the original Kp27 vector
that were fused
-21 -
CA 02430475 2003-05-28
WO 02/050104 PCT/USO1/45105
in frame to the N-terminus of the luciferase ORF. The BaynHI and NcoI
restriction sites were
retained. The plasmid Kp120 construct was confirmed by DNA sequencing using
primers:
Kx45: 5'-ATATAAGCCATCAAGTTTCTG; and (SEQ ID NO: 12)
Kx46: 5'-CTCACTAAAGGGAACAAAAG (SEQ ID NO: 13)
Plasmid constructs encoding the RGS4 protein and yeast strains in which the
endogenous RGS protein (SST2) was deleted were prepared as described in
Example 1.
Pheromone-responsive yeast test strains were generated using the Li-acetate
method
(Rose et al., 1990) and plated on plasmid retention media. Transformation of
plasmids
Kpl 18 (RGS expression plasmid) and Kp131 (FUS1-luc reporter plasmid) into
yeast strain
KY103 generated yeast strain KYl 15. Kp131 was derived from Kp120. Briefly,
the FUSl-
luciferase reporter cassette was excised from Kp120 using KpnI and SacI
restriction enzymes.
The 2.8 kb fragment was gel purified, blunt ended and ligated into pRS416 to
generate
Kp 131. Kp 118 and Kp 131 were also co-transformed into KY 113 to generate
yeast strain
KY117.
Control yeast strains were prepared by co-transforming empty expression
plasmid
Kp46 and reporter plasmid Kp131 into KY103 to generate yeast strain Ky116, and
into strain
KY113 to generate strain KY118.
To determine if the RGS4 protein interferes with pheromone-induced
transcription of
the luciferase protein, yeast having the RGS4 construct and control yeast
having an empty
vector were treated with alpha factor (25 nM). Results using the KYl 13-based
strains
KY117 (RGS4) and KY118 (control) are shown in Figure 3. This figure shows that
the
RGS4 protein likely interacts with the yeast Ga subunit (Gpalp), causing the
alpha factor-
induced luciferase signal to decrease. Strong luminescence was seen with the
control strains
lacl~ing the RGS4 protein. In contrast, weak luminescence was seen in the
yeast strain
expressing the RGS4 protein. Pheromone-responsive luciferase activity was
observed in
-22-
CA 02430475 2003-05-28
WO 02/050104 PCT/USO1/45105
yeast strains generated from both base yeast strains KY103 and KYl 13.
However, the
response of KY113-based yeast strains was slightly stronger (data not shown)
and therefore
these strains are more sensitive.
These findings correlated with the findings set forth in Example 1, in which
we
monitored 13-gal activity. Dose response curves for the luciferase system,
shown in Figures
4A and 4B, reveal that luciferase works as well as lacZ as a reporter gene.
Additionally, the
luciferase reporter is more sensitive than beta-galactosidase since the fold-
increase is higher
(data not shown).
Example 3. Low copy version of the FUS1-luciferase reporter.:
As an alternative to the 2um version of the FUS 1-luciferase reporter
constructs
discussed previously, a low copy number (CEN) version of the luciferase
construct of
Example 2 was made. The CEN version of the pheromone pathway responsive FUS 1-
luciferase reporter was generated by digestion of plasmid Kp120 with KphI and
SacI to
isolate a 2.8 kb fragment containing the FUS 1 promoter and the luciferase
gene reporter
cassette. Plasmids pRS414 and pRS416 (Stratagene) were each digested with KpnI
and SacI
and gel purified. Standard ligations were performed to generate two additional
FUS1-
luciferase recombinant plasmids; Kp133 (TRPl marked) and Kp135/Kp131 * (URA3
marked). Bacterial transformation and generation of plasmid DNAs were
performed by
standard methods. Plasmids were confirmed by DNA sequencing. Plasmid Kp131
represents a similar construct to Kp135, but was generated independently using
a different
cloning scheme.
The CEN versions of the reporter gene were tested in a pheromone response
assay.
These versions were found to function in the pheromone response assay and to
provide a
suitable signal-to-noise ratio (data not shown),
- 23 -
CA 02430475 2003-05-28
WO 02/050104 PCT/USO1/45105
Example 4. Incorporating alternative reporter genes:
A variety of reporter genes can be used in the system. Illustrative of
reporters that can
be used in the present invention are reporter genes such as luciferase genes
from species other
than firefly, green fluorescent protein gene, or CAT. For example, a Renilla
Iuciferase gene
reporter can be used as an alternative to a firefly luciferase reporter. To
construct these, the
open reading frame encoding for Renilla luciferase was cloned into the
pheromone-
responsive reporter plasmids described in Examples 1 or 2 to generate FUS 1-
RenLuc. High
(2 micron) and low (CEN) copy number plasmids were generated in an analogous
manner to
that described for firefly luciferase reporter genes.
Example 5. RGS-assay-single point drug screen:
The validated strains described above were used for the identification of
small
molecules that modulate the activity of the co-expressed mammalian RGS
protein. A
schematic of the screen is shown in Figure 5. Yeast strains with the RGS
expression plasmid
and a control strain were used to test for small molecules that modulate the
function of RGS4,
resulting in an increase in luciferase activity. On the basis of molecular
modeling, a subset of
molecules in a library of test chemicals was tested in single point assays.
Compounds that
demonstrated an increase in Iuciferase activity in the test (RGS4) strain in
comparison to the
control strain were "positive" and were considered interesting candidates for
further study.
Specifically, yeast strains containing either the RGS expression plasmid (KYl
17), or
the control baclcbone vector (stain KY118) were inoculated into appropriate
media (SC-leu-
trp) and incubated overnight at 30°C. The cell density of these fresh
yeast cultures was
determined by OD6oo and cells were diluted to OD6oo of 0.05 in appropriate
growth media
(SC-leu-trp). 150 ~,1 of cell suspension was seeded into the wells of a 96
well microtitre
-24-
CA 02430475 2003-05-28
WO 02/050104 PCT/USO1/45105
plate, and approximately 1 ~.1 of stock test compound (1 Omg/ml) was
transferred to individual
wells using a replicator.
Test compounds were incubated with the cells for 3 hours at 30°C. The
cells were
then stimulated with ligand (10 ~,1 alpha factor (200 nM stock in l OX
solution) to a final
concentration of 20 nM). The plate was shaken briefly and incubated for 2
hours at 30°C.
100 ~d LucLite substrate (Paclcard) was added to each well, and the plate was
sealed and
shaken at room temperature in the dark for 1 hour. Luminescence was determined
using a
Top Count (Paclcard) for 2 seconds.
Results of single dose assays of 96 compounds is shown in Figure 6. Each
compound
was added to two yeast strains: an RGS4 strain (Fig. 6A) and a control vector
strain (Fig. 6B).
The difference in luminescence (fold) is calculated as counts per
second(RGS)/counts per
second(vector) (Fig. 6C). A compound with a fold increase in luminescence
higher than the
average is considered a candidate as a RGS bloclcer.
Example 6. RGS-assay-Dose response assay of potential drugs:
Compounds causing an increase in luciferase activity in the test strain of
approximately 50% over that seen in the control strain in the single point
assay (Example 5)
were then tested in a dose response assay.
A yeast strain containing the RGS expression plasmid (I~Y117), and a control
yeast
stain containing the baclcbone vector (I~Y11 ~) were inoculated in appropriate
media (SC-leu-
trp) and incubated overnight at 30°C. The cell density of fresh yeast
cultures was determined
by OD6oo and cells were diluted to an OD6oo of 0.05 in appropriate growth
media (SC-LT).
Aliquots of 150 p1 of suspended cells were dispensed into Row A of a 96 well
micxotiter
plate. DMSO was added to the remaining yeast cells to a final concentration of
3% and 100
~.1 of cells was seeded into the remaining wells of the 96 well plate. Test
compound (4.5 ~1)
- 25 -
CA 02430475 2003-05-28
WO 02/050104 PCT/USO1/45105
was added to the cells in Row A, resulting in a final concentration of 900
~,M, mixed, and 50
~,1 was transferred from Row A into Row B, and mixed well. Subsequently 50 ~,1
was
transferred from Row B into Row C, and so forth through Row G to create a
serial dilution
within a column of the 96 well plate. This established an 8 point dose
response curve with all
wells containing 3% DMSO.
Cells and test compound were incubated at 30°C for 4 hours, then 10 ~.1
of ligand
(alpha factor in 200 nM stock l Ox solution) was added to a final
concentration of 20 nM.
The plate was shaken briefly and incubated for 2 hours at 30°C. 100 ~,l
of LucLite substrate
was added to each well, and the plate was sealed and shaken at room
temperature in the dark
for 1 hour. Luminescence was determined using a Top Count (Paclcard) for 2
seconds.
Results for four test compounds are shown in Figures 7A-D. Compound SBQBB 1
demonstrated the ability to greatly affect RGS4 function.
Example 7. Functional complementation by additional mammalian RGS proteins.
Previously, it had been demonstrated that mammalian RGS4 is able to complement
SST2p to enable S. ce~evisiae to recover from alpha factor stimulation that
did not result in
productive mating. The RGS protein accelerates the endogenous GTPase activity
of the yeast
G-alpha protein, Gpal . Previous data support only RGS4 as capable of
functionally
replacing SST2. To investigate the overall utility in using the pheromone-
response pathway
to investigate the function of mammalian RGS proteins, RGSZI and RGS2 were
also
expressed in the sst2 lmockout strain containing the pheromone-responsive
luciferase reporter
gene (FUS1-luc) previously described.
General cloning: cDNA encoding the various mammalian RGSZl and RGSZ2 proteins
were subcloned into vector p426-TEF (ATCC #87669). This vector [6359 bp, URA3,
2mu-
-26-
CA 02430475 2003-05-28
WO 02/050104 PCT/USO1/45105
ori, TEFp-CYClt, REP3, AmpR] contains an elongation factor 1-alpha promoter
from S
cerevisiae (see Genbank YSCEF1AB for sequence) and is suggested to be 5-fold
stronger
than the ADH promoter (Mumberg et al., Gene, 156:119). Designated cDNA inserts
were
generated using standard methods for polymerase chain reaction, restriction
digests, ligations,
and transformation into DHS-alpha E.coli cells. DNA was prepare using Qiagen
preps,
confirmed by restriction digest, and DNA sequence analysis. The resulting
constructs were
sequenced at 5'-end junction site. The sequencing primer is Kx65:
5'-TCAGTTTCATTTTTCTTGTTCTAT (SEQ. ID. NO: 14)
This primer hybridizes to the TEF promoter region.
Human RGSZl:
RGSZ1 cDNA was prepared using a 26 by 5' forward oligonucleotide primer
containing an embedded SAM HI restriction site:
5'-GC ggatccATGGGATCAGAGCGGATG (SEQ. ID. NO: 15)
and 27 by 3' reverse oligonucleotide primer containing an embedded CIaI
restriction site and
a stop codon:
5'-CG atcgattaCTATGCTTCAATAGATT (SEQ. ID. NO: 16).
These primers were used in a standard PCR reaction, using a previously
described RGSZ1-
pACT recombinant vector as template. A 650 by fragment is obtained that
encodes the full-
length RGSZ1 (Genbank AF079479) and contains the endogenous start and stop
codons.
The PCR product was gel purified, digested with BamHI and ClaI restriction
enzymes, and
ligated into the prepared BamHI and CZaI sites of p426TEF. Restriction digest
analysis using
HincII alone, SphI alone, or SalI+SphI, confirms the direction of the cDNA
insert. The
resulting plasmid, pTEF426-RGSZ1, is designated Kp140 (also known as pKHY55)
and
Kp 141 (also known as pKHY56).
_27_
CA 02430475 2003-05-28
WO 02/050104 PCT/USO1/45105
Human RGS2:
Human RGS2 cDNA (Genbank NM 002923) was obtained by PCR amplification
from a human whole brain library using a 21 by forward 5' oligonucleotide
primer with an
embedded NotI site:
5'-CCAGCGGGAGAACGATAATGC (SEQ. ID. NO: 17)
and a 19 by 3' reverse oligonucleotide primer with an embedded BamHI site:
5'-CCCCTCAGGAAAAGAATG (SEQ. ID. NO: 1 &)
The 705 by PCR product was ligated in the pCRII vector (Invitrogen), to
generate pKHY146
(hRGS2-pCRII). pKHY146 was transformed into bacterial cells following vendor
instructions, plasmid DNA prepared and sequence confirmed. The hRGS2 cDNA was
excised from pKHY146 using NotI and BamHI and subcloned into the prepared NotI
and
BamHI sites of pcDNA3.I (Invitrogen). The resulting recombinant plasmid (hRGS2-
pcDNA3. I) is designated pKHY150. The pKHYI50 was digested with PmeI and a 650
by
fragment was isolated, gel purified, and used in a blunt end ligation into the
prepared SmaI
site of p426TEF, to generate the recombinant plasmid hRGS2-pTEF426 and two
resulting
(sibling) recombinant plasmids designated Kpl3~ (also known as pKHY53) and
Kp139 (also
lazown as pKHY54). Orientation of the hRGS2 cDNA insert was determined by
restriction
digest analysis using PstI or HindIII.
Generation of strains: These RGS constructs were transformed into yeast KY113;
the
FUS1-Iuciferase reporter (Kp120) was also co-transformed into KY113. The
resulting yeast
strains are designated as follows:
_2g_
CA 02430475 2003-05-28
WO 02/050104 PCT/USO1/45105
Table 1
Strain plamid nso ltnownRGS
as
KY199 Kp138 .pKHY53 RGS2
KY200 Kp139 .pKHY54 RGS2
KY201 Kp140 .pKHY55 RGSZ1
KY202 Kp141 .pKHY56 RGSZ1
KY21I p426TEF
~KY212 ~p426TEF
Three colonies from each yeast transformation were picked and streaked onto SC-
Ura-Trp plates. Two of the three colonies were tested in the pheromone-
response assay (as
previously described) to measure luciferase reporter gene activity. Briefly,
100 ~.I of 0.1
OD6oo overnight culture was stimulated by alpha factor in concentrations of 25
or 225 ng for
2 hours at 30C. The same culture was also subjected to pheromone-response halo
assay (as
previously described) . CeII lawn (made from 0.3 OD6oo culture) on SC-Ura-Trp
agax plates
was stimulated with alpha factor in concentrations of 50 or 250 ng per each
spot. The plates
were incubated at 30°C for about 40 hours, and then observed for halo
formation.
Results:
Results of the halo assay are depicted in Figure 8 and results for the
luciferase
reporter assay are depicted in Figures 9A and 9B. Yeast strains expressing
RGSZ1
demonstrated smaller halos and decreased luminescence compared to yeast
strains expressing
the empty vector, thus indicating complementation of sst2 in yeast. Additional
dose response
curves and more detailed halo assays (alpha factor at 431, 48, 5.3, or 0.6 ng
per spot, or 431,
144, 48, or 16 ng per spot) were done for these strains. Responses from RGSZ1-
expressing
strains were not as robust as that observed previously from strains expressing
RGS4. This
suggests that RGSZ1 displays 33% of the response observed with RGS4 (1/8 vs.
1/27 fold
when compared to its control vector).
The yeast strain expressing RGS2 demonstrates halos that are slightly smaller
than the
-29-
CA 02430475 2003-05-28
WO 02/050104 PCT/USO1/45105
halos observed for stains expressing the vector only. Strains expressing RGS2,
however,
demonstrate decreased luminescence in comparison to control strains
(especially at 62 nlVn,
which is suggestive of functional complementation of sst2.
Human RGS7:
Full length human RGS7 (Genbanlc AF090116) was obtained from a human brain
cDNA library (Clontech) by PCR amplification using a 20 base forward
oligonucleotide
primer with an embedded NotI site:
5'-CTTGGCGGAGGAGGGCACAC
(SEQ ID NO: 19)
and a reverse 22 base oligonucleotide primer having an embedded BamHI site:
5'-TGGAGGCATTGAGACGGAAGA (SEQ ID NO: 20)
The resulting 1698 by PCR product was restriction digested with appropriate
enzymes
and ligated into the NotI and BamHI sites of pcDNA3.1. The resulting
recombinant vector
(hRGS7-pcDNA3.1) is designated pI~HY126, and was confirmed by restriction
digests and
sequence analysis. pI~HY126 was digested with PmeI, a 1.5 kb fragment was
isolated, gel
purified, and blunt ligated into the SmaI site of p426TEF. The orientation of
the hRGS7
cDNA insert was determined by restriction digest analysis using XbaI,
Fli~cdIII, or ClaI and
SacI. Two sibling isolates of the confirmed hRGS7-pTEF426 plasmid were
designated
I~p144 (also known as pI~HY59) and I~p145 (also known as pKHY60).
A second hRGS7 clone was generated that encodes from the G-gamma like ("GGL")
domain to the end of the protein. This GGL-hRGS7 cDNA was generated by PCR
using a 27
base forward oligonucleotide primer containing an embedded BamHI site and a
start codon:
5'-GCGGATCCATGAAACCTCCAACAGAAG (SEQ ID NO: 21)
and a 26 base reverse oligonucleotide primer containing an embedded CIaI site
and
exogenous stop codon:
5'-CGATCGATTATTAGTAAGACTGAGCA
(SEQ ID NO: 22)
-30-
CA 02430475 2003-05-28
WO 02/050104 PCT/USO1/45105
with pKHYl26 as template. The resultant PCR product is 660 by and encodes from
amino
acid sequence KPPT to the terminal amino acid. The 650 by PCR product was
digested with
the appropriate enzymes, isolated, gel purified, and directionally ligated
into the BamHI and
CZaI site of prepared p426TEF vector (ATCC). Recombinant plasmids were
confirmed by
restriction digests using NcoI and 6Yhh~I, XbaI alone, or CIaI and Ncol. Two
sibling isolates
of the recombinant plasmid (GGL-hRGS7-p426TEF) were designated I~p142 (also
known as
pKHY57) or I~p143 (also known as pI~HHY58).
Human RGS9:
Full length human RGS9 (Genbank AF071476) was obtained from a human brain
cDNA library (Clontech) by PCR amplification using a 40 base forward
oligonucleotide
primer with an embedded HindIII site:
5'-GCAAGCTTCCACCATGACAATCCGACACCAAGGCCAGCAG (SEQ ID NO: 23)
and a 39 base reverse oligonucleotide primer with an embedded ~'baI site:
5'-GCTCTAGATTACAGGCTCTCCCAGGGGCAGATGACC (SEQ ID NO: 24)
The resulting 2.0 kb PCR product was restriction digested with appropriate
enzymes,
and ligated into the Hi~dIII and XbaI sites of pWE3 to generate recombinant
vector hRGS9-
pWE3. The construct was confirmed by restriction digests and sequence
analysis. hRGS9-
pWE3 was used as template with a forward oligonucleotide primer containing an
embedded
BanZHI site:
5'-CCGGATCCAGATGACAATCCGACACCAAGGCCAGC (SEQ ID NO: 25)
and a reverse oligonucleotide primer containing an embedded ~'hoI site:
5'-CGCTCGAGTTACAGGCTCTCCCAGGGGCAGATGACC (SEQ ID NO: 26)
were used to generate a 2.0 kb fragment using standard PCR methods. The hRGS9
PCR
product was digested with the BarnHI and.XhoI, purified and directionally
ligated into the
prepared BamHI and XhoI sites of pACT2 to generate the plasmid PACT-hRGS9,
which was
-31 -
CA 02430475 2003-05-28
WO 02/050104 PCT/USO1/45105
confirmed by sequence analysis. The cDNA encoding full length hRGS9,
containing
endogenous start and stop codons, was excised from pACT-hRGS9 using BamHI and
lihoI
restriction enzymes to obtain a 2.0 lcb fragment. The 2.0 lcb fragment was
isolated, gel
purified, and directionally ligated into the prepared BamHI and ~'hoI sites of
vector p426TEF.
The resulting recombinant plasmids (hRGS9-TEF426) were confirmed by
restriction digest
with BamHI and SpYcI and designated Kp148 (also known as pKHY63) and Kp149
(also
known as pKHY62).
A second hRGS9 clone was generated that encodes from the G-gamma lilce (GGL)
domain to the end of the protein. This GGL-hRGS9 cDNA was generated by PCR
using a 28
base forward oligonucleotide primer containing an embedded BamHI site and a
start codon:
5'-GCGGATCCATGAAGAAACAAACAGTCGT (SEQ ID NO: 27)
a~zd a 26 base reverse oligonucleotide primer containing an embedded CIaI site
and
exogenous stop codon:
5'-CGATCGAATTATTACAGGCTCTCCCAG (SEQ ID NO: 28)
with Kp148 as template.
The resulting PCR product is a 1.4 lcb fragment. The cloning strategy is
similar to
that described for GGL-RGS7, such that the 1400 by PCR product was digested
with
appropriate enzymes, isolated, gel purified, and directionally ligated into
the BamHI and ClaI
sites of prepared p426TEF vector (ATCC). Recombinant plasmids were confirmed
by
restriction digests with SacI alone, EcoRI alone, SaII alone, or BamHI and
SphI to confirm
direction. Two sibling isolates of the recombinant plasmid (GGL-RGS9-p426TEF)
were
designated Kp146 (also known as pKHY61) and Kp147 (also known as pKHY62).
-32-
CA 02430475 2003-05-28
WO 02/050104 PCT/USO1/45105
Generatation of strains: The above RGS constructs were transformed into yeast
KYl 13.
The FUS1-luciferase reporter (Kp120) was also co-transformed into this yeast
strain. The
resulting yeast strains axe designated as follows:
Table 2
Strain plamid also knownRGS
as
KY199 Kp138 .pKHY53 RGS2
KY200 Kp139 .pKHY54 RGS2
KY201 Kp140 .pKHY55 RGSZ1
KY202 Kp141 .pKHY56 RGSZl
KY203 Kp142 .pKHY57 RGS7(GGL)
KY204 Kp143 .pKHY58 RGS7(GGL)
KY205 Kp144 .pKHY59 RGS7(full))
KY206 Kp145 .pKHY60 RGS7(full)
KY207 Kp146 .pKHY61 RGS9(GGL)
KY208 Kp147 .pKHY62 RGS9(GGL)
KY209 Kp148 .pKHY63 RGS9(full)
KY210 Kp149 .pKHY64 RGS9(full)
KY211 p426TEF
KY212 p426TEF
Three colonies from each yeast transformation were picked and streaked onto SC-
Ura-Trp plates. Two of the three colonies were subjected to pheromone response
assay (as
- 33
CA 02430475 2003-05-28
WO 02/050104 PCT/USO1/45105
previously described) to measure luciferase xeporter gene activity. Briefly,
100 ~.1 of 0.1
OD6oo overnight culture was stimulated by alpha factor in concentrations of 25
or 225 ng for
2 hours at 30C. The same culture was also subjected to pheromone response halo
assay (as
previously described). Cell lawn (made from 0.3 ODdoO culture) on SC-Ura-Trp
agar plates
was stimulated with alpha factor in concentrations of SO or 250 ng per spot.
The plates were
incubated at 30C fox about 40 hours, and observed for halo formation.
Results:
Results for the luciferase reporter assay are depicted in Figures 9A-D and
results of
the halo assays are depicted in Figure 8. Yeast strains expressing RGSZl
demonstrated
smaller halos and decreased luminescence than yeast strains expressing the
empty vector,
indicating complementation of sst2 in yeast. Additional dose response curves
and more
detailed halo assays (alpha factor at 431, 48, 5.3, and 0.6 ng per spot, or
431, 144, 48 orl6 ng
per spot) were done for these strains. Responses from RGSZ1 expressing strains
were not as
robust as that observed previously from strains expressing RGS4, suggesting
that RGSZ1
displays 33% of the response observed with RGS4 (1/8 vs.l/27 fold when
compared to its
control vector).
The yeast strain expressing RGS2 demonstrates halos that are slightly smaller
that the
halos observed for stains expressing the vector only. Strains expressing RGS2,
however,
demonstrate decreased luminescence in comparison to control strains
(especially at 62 nM),
and is suggestive of functional complementation of sst2. The yeast strain
expressing either
the full length or the GGL+RGS C-terminal of RGS7 demonstrated halos and
luminescence
that were similar to negative control strains, suggesting that this form of
RGS does not easily
provide functional complementation of sst2. The yeast strains expressing
either the full
length or the GGL+RGS C-terminal of RGS9 demonstrate halos that are similar to
negative
control strains. There is some indication, however, of decreased luminescence
in strains
-34-
CA 02430475 2003-05-28
WO 02/050104 PCT/USO1/45105
expressing full length RGS9 in comparison to negative control strain.
Example 8: co-expression of human GbetaS
RGS7 and RGS9 are longer RGS proteins being 469 and 673 amino acids,
respectively, and are within a subclass of the RGS protein family, together
with RGS6 and
RGS 1 l, that contain a DEP domain, and the highly conserved GGL domain that
binds GbetaS
(Snow et al., 1999). RGS7 and RGS9 demonstrate a high level of homology within
the GGL
domains. RGS6 and RGS7 have 80% homology in the DEP domain, but RGS7 and RGS9
have only 50%. Present worlc in the RGS field suggests that this subclass of
GGL-domain-
containing RGS proteins would function similarly. Our findings, however,
suggest that
these, and potentially members of other subclasses of RGS proteins may not
display identical
functionality. The GGL domain has been demonstrated to bind the heterotrimeric
G-protein
GbetaS, with suggestions that the GGL-RGS/GbetaS interaction may be impot-tant
for proper
folding of both proteins, and functionally relevant. GbetaS is the most
distinct isoform of the
Gbeta proteins, and is highly expressed in the brain. The homology between
GbetaS and the
yeast Gbeta (STE4) is <40%. Therefore, we co-expressed human GbetaS with RGS7
or
RGS9 (or RGS4 as a control) in yeast to determine whether human GbetaS would
enable the
GGL-domain-containing RGS proteins to functionally complement sst2.
The cDNA encoding human GbetaS was obtained by PCR using a 39 base forwaxd
oligonucleotide primer containing an embedded Hi~dIII site:
5'-GCCCAAGCTTCCGCCAGCCATGGCAACCGAGGGGCTGCA (SEQ ID NO: 29)
and a 24 base reverse oligonucleotide primer containing an embedded XhoI site:
5'-CCGCTCGAGTTAGGCCCAGACTCT (SEQ ID NO: 30)
and hGBetaS recombinant vector as template (Liang et al., 2000). The hGbetaS
PCR product
was digested with Hi~cdIII and XhoI, gel purified, and ligated into Hi~dIII
and ~'hoI digested
p425TEF. The resulting recombinant vector was confirmed by sequence analysis
and
-35-
CA 02430475 2003-05-28
WO 02/050104 PCT/USO1/45105
designated hGbetaS-p425TEF. This vector was co-transformed with the FUS1-
luciferase
reporter plasmid (Kp 120), and previously described recombinant plasmids
encoding RGS2,
RGS4, RGS7, RGS9, and RGSZ1, or empty plasmid control vectors) into yeast
strain
KY113. The resulting yeast strains containing the combination of plasmid are
surmnarized in
the following table.
Table 3
Strain RGS plasmid GbetaS plasmidReporter plasmid
#
ySAl P426TEF RGS P425TEF hGBetaSKp120 Firefly luciferase
2
ySA2 P426TEF RGS P425TEF hGBetaSKp 120 Firefly
4 luciferase
ySA3 P426TEF RGS P425TEF hGBetaSKp120 Firefly Iuciferase
Z
ySA4 P426TEF RGS P425TEF hGBetaSKp120 Firefly luciferase
7
ySAS P426TEF RGS P425TEF hGBetaSKp120 Firefly luciferase
9
ySA6 P426TEF RGS P425TEF Kp120 Firefly luciferase
2
ySA7 P426TEF RGS P425TEF Kp120 Firefly luciferase
4
ySA8 P426TEF RGS P425TEF Kp120 Firefly luciferase
Z
ySA9 P426TEF RGS P425TEF Kp120 Firefly luciferase
7
ySAlO P426TEF RGS P425TEF Kp120 Firefly luciferase
9
ySA21 P426TEF P425TEF Kp120 Firefly luciferase
ySA38 P426TEF P425TEF hGBetaSKp120 Firefly luciferase
The strains were tested for activity in pheromone-responsive halo assays and
luciferase reporter assays, as previously described. The results from the halo
assays are
depicted in Figure 10 for RGS7 and Figure 11 for RGS9. As a control, we tested
the effect of
hGbetaS on the ability of RGS4 to complement sst2. RGS4 is a short RGS protein
of 206
-36-
CA 02430475 2003-05-28
WO 02/050104 PCT/USO1/45105
amino acids and does not contain a GGL domain. Halo assays and luminescence of
strains
co-expressing hGbetaS and RGS4 were similar to strains expressing RGS4 and an
empty
control vector (data not shown). Since RGS7 and RGS9 both contain a GGL
domain, one
would anticipate that these RGS proteins would be similarly affected by co-
expression of
GbetaS. Co-expression of hGbetaS with RGS9, however, had no effect on RGS7 as
halos
were similar to the vector control strain. Co-expression of hGbetaS, however,
resulted in an
increase in halo size (rather than a decrease as occurs by RGS4 expression) in
comparison to
vector control strains. Expression of hGbetaS alone had no effect, similar to
the vector-only
control. This is an unanticipated result and suggests that despite the
similarity in domain
stmcture of RGS7 and RGS9, these two RGS proteins may in fact be functionally
dissimilar.
Example 9: Chimeric RGS Proteins
To fiu-ther investigate the utility of the assay, several chimeric RGS
proteins were
tested. Specific RGS chimeric proteins are described below, but in general we
investigated
the effect of N-terminal and C-terminal RGS protein combinations, or the
addition of a the N-
terminal region of an RGS protein that has been demonstrated to complement
(for example
RGS4) for an sst2 lcnoclcout, to a different, but full length, RGS protein.
Cloning strategies used in chimeric gene construction
1. RGS4N/RGS7C:
The RGS4 N-terminal region of 171 bp, which encodes amino acids 1-57 of RGS4,
was obtained by PCR using rat RGS4 cDNA as template. The forward primer
contained an
embedded BamHl site:
chiRgs4 Nterm 5'-CGCGGATCCATGTGCAAAGGGCTTGCA (SEQ ID NO: 31)
while the reverse primer contained an embedded SmaI site:
-37-
CA 02430475 2003-05-28
WO 02/050104 PCT/USO1/45105
chiRgs4r Nterm 5'-TCCCCCGGGCTTGACTTCCTCTTGGCT (SEQ ID NO: 32)
The RGS7 C-terminal region, which begins with the GGL domain of full length
human RGS7 through the last amino acid, was amplified to produce a 645 by
product
encoding amino acids 255-470 of RGS7. The forward primer contained an embedded
S~aal
site:
chiRgs7 Cterm 5'-TCCCCCGGGGATGAGTTACAACAACAG (SEQ ID NO: 33)
The reverse primer contains an embedded Clal site:
chiRgs7r Cterm 5'-CCCATCGATTTAGTAAGACTGAGC (SEQ ID NO: 34)
The two PCR products were gel purified, cut with SmaI and ligated. The
ligation
mixture was then used as template to produce the full length chimeric PCR
product of 816
bp. The forward primer used in this PCR reaction was chiRgs4 Nterm (SEQ ID NO:
31 ) and
the reverse primer was chiRgs7r Cterm (SEQ ID NO: 34). The resulting chimeric
gene was
gel purified, re-amplified, cut with the appropriate restriction enzymes, and
cloned into the
BarraHl and Clal site of vector p426TEF, which encodes an N-terminal HA tag.
2. RGS7N/RGS4C:
The RGS7 N-terminal region includes the GGL domain of RGS7 and was amplified
using human RGS7 cDNA as template to produce a 996 by PCR product encoding
amino
acids 1-332. The forward primer contains an embedded BamHI site:
chiRgs7 Nterm 5'-CGCGGATCCATGGCCCAGGGGAAT (SEQ ID NO: 35)
The reverse primer contains an embedded Smal site:
chiRgs7r Nterm 5'-TCCCCCGGGAAAACCCCATCGTTT (SEQ ID NO: 36)
The RGS4C region contains only the RGS4 core domain and was amplified using
RGS4 cDNA as a template to produce a 447 by PCR product encoding amino acids
58-206.
The forward primer contains an embedded Smal site:
-38-
CA 02430475 2003-05-28
WO 02/050104 PCT/USO1/45105
chiRgs4 Cterm 5'-TCCCCCGGGAAATGGGCTGAATCACTG (SEQ ID No: 37)
The reverse primer contains an embedded Clal site:
chiRgs4r Cterm 5'-CCCATCGATTTAGGCACACTGAGGGAC (SEQ ID NO: 38)
The two PCR products were gel purified, cut with Smal and ligated. The
ligation
mixture. was used as template for PCR amplification of the chimeric gene
product of 1443 bp.
The primers used were as described above. The forward primer was chiRgs7 Nterm
(SEQ ID
NO: 35), while the reverse primer was chiRgs4r Cterm (SEQ ID NO: 38). The
resulting
chimeric gene was gel purified, re-amplified, cut with appropriate restriction
enzymes and
cloned into the BamHl and Clal site of vector p426TEF, which encodes an N-
terminal HA
tag.
3. RGS4N/RGS10 (full length):
The RGS4N region is identical to that described for the RGS4N/RGS7C chimera
described above.
The RGS 10 (full length) for this chimera was obtained from p426-RGS 10 by
restriction digest using Smal and Xhol. The plasmid p426-RGS10 was constructed
by PCR
amplification using human RGS 10 cDNA (Genbanlc no. XM 049797) as template.
The
forward primer contains an embedded HindIII site:
RGS10 fwd 5'-CCCAAGCTTATGGAACACATCCACGACAGC (SEQ ID NO: 39)
The reverse primer contains an embedded XhoI site:
RGS10 rev 5'- CCGCTCGAGTCATGTGTTATAAATTCTGGA (SEQ ID NO: 40)
The PCR product of 504 bp, which encodes the full length RGS10, was gel
purified and
cloned into the IlihilIII and XhoI sites of vector p426TEF.
The RGS4 N-terminal region PCR product described above was cut with Smal and
ligated with the gel purif ed S~aal and XhoI restriction fragment of RGS 10.
The ligation
-39-
CA 02430475 2003-05-28
WO 02/050104 PCT/USO1/45105
mixture was used as template for PCR to obtain the chimeric RGS4/RGS 10. The
forwaxd
primer used was chiRgs4 Nterm (SEQ ID NO: 32), while the reverse primer was
RGS 10 rev
(SEQ ID NO: 40), both described above. The resulting chimeric gene was gel
purified, re-
amplified and cloned into the BamHl and Xho 1 site of vector p426TEF, which
encodes an N-
terminal HA tag.
4. RGS4N/RGS7 full length:
The RGS4 N-terminal region was obtained as described above. The full length
RGS7
cDNA was amplified using cloned human RGS7 as a template to produce a 1410 by
PCR
product encoding amino acids 1-470. The forward primer contains an embedded
SnZaI site:
RGS7N fwd 5'-TCCCCCGGGATGGCCCAGGGGAAT (SEQ ID NO: 41)
The reverse primer contained an embedded CIaI site:
Rgs7r Cterm 5'-CCCATCGATTTAGTAAGACTGAGC (SEQ ID NO: 42)
The two PCR products were gel purified, cut with Sn2aI and ligated. The
ligation
mixture was then used as template for PCR to obtain the RGS4N/RGS7 full length
chimeric
gene. The forward primer was chiRgs4 Nterm (SEQ ID NO: 31) and the reverse
primer was
Rgs7r Cterm (SEQ ID NO: 42). The resulting chimeric gene was gel purified, re-
amplified
and cloned into the BamHl and Clal site of vector p426TEF, which encodes an N-
terminal
HA tag.
5. RGS4N/RGS9C:
Two different chimeras for RGS4N/RGS9C where constructed, wherein one contains
the GGL domain in the RGS9 C-terminal region, while the other does not contain
the GGL
domain within the RGS9 C-terminal region.
5a. RGS4N/RGS9C (minus GGL domain):
The RGS4 N-terminal region was amplified by PCR as described previously,
digested
with BamHI and HindIII and gel purified.
-40-
CA 02430475 2003-05-28
WO 02/050104 PCT/USO1/45105
The RGS9 C-terminal region (minus the GGL domain) was amplified using the
human RGS9 cDNA as template to obtain a 1125 by product encoding amino acids
302-675.
The forward primer contains an embedded HindIII site: RGS9RGS fwd (minus GGL
domain)
5'-CCCAAGCTTATGAACTTCAGCGAA (SEQ ID NO: 43)
The reverse primer contains an embedded XhoI site:
RGS9RGS rev 5'- CCGCTCGAGTTACAGGCTCTCCCA (SEQ ID NO: 44)
The RGS9C (minus GGL domain) PCR product was purified, cut with HindIII and
XhoI, and cloned into HihdIII and.XhoI sites of vector p426TEF. The resulting
plasmid was
then digested with BamHI and HihdIII, and Iigated with the BamHI and Hi~dIII
RGS4 N-
terminal fragment to generate the RGS4N/RGS9c minus GGL domain chimeric
plasmid.
5b. RGS4N/RGS9C (plus GGL domain):
The RGS9 C-terminal region including the GGL domain fragment was amplified
using RGS9 cDNA as template to produce an 1356 by PCR produce encoding amino
acids
223-675 of human RGS9. The forward primer, RGS9chi Cterm HihdIII fwd (plus GGL
domain), contains an embedded HindIII site:
5'-CCCAAGCTTGCTGTCAAAAAAGAGATC (SEQ ID NO: 45)
The reverse primer contains an embedded ~YhoI site:
RGS9RGS rev 5'-CCGCTCGAGTTACAGGCTCTCCCA (SEQ ID NO: 46)
The RGS4NlRGS9C (minus GGL domain) chimeric plasmid (described above) was
cut with Hi~dIII and XhoI and the cDNA band containing the vector with RGS4N
was gel
purified. The vector-RGS4N cDNA was then Iigated to the HihdIII andXh.ol RGS9C
(plus
GGL) prepared PCR product to generate the RGS4N/RGS9 plus GGL domain chimeric
plasmid.
6. RGS4N/axin:
The RGS domain present in human axin was PCR amplified to produce a 441 by
-41 -
CA 02430475 2003-05-28
WO 02/050104 PCT/USO1/45105
fragment encoding amino acids 199-345. The forward primer, AxinSmal fwd,
contains an
embedded SzzzaI site:
5'-TCCCCCGGGGGCAGTGCCTCCCCCACCCCACCAT (SEQ ID NO: 47)
The reverse primer, AxinXho 1 rev, contains an embedded XhoI site
5'-CCGCTCGAGTTAGACTTTGGGGCTCTCCGA (SEQ ID NO: 48)
The p426TEF plasmid containing the RGS4N/RGS7C chimera was cut with SmaI and
XhoI to remove the RGS7C fragment, and then gel purified. The vector-RGS4 DNA
was
then ligated with the SmaI and Xhol fragment encoding the RGS domain of the
axin gene to
produce the RGS4N/Axin chimeric plasmid.
7. RGSll:
Human RGS11 was amplified using cDNA (GenBank no. NM 003834) as template
to produce a 1341 by PCR product encoding amino acids 1-447. The forward
primer
contains an embedded EcoRI site:
RGS 11 fwd 5'-CCGGAATTCATGGCCGCCGGCCCCGCGCCG (SEQ ID NO: 49)
The reverse primer contains an embedded HindIII site:
RGS11 rev 5'-CCCAAGCTTCTAGGCCACCCCATCTCCACC (SEQ ID NO: 50)
The resulting PCR product was digested with EcoRl and HihdIII, and subcloned
into
similar sites of the p426TEF vector.
8. RGS6:
Human RGS6 was amplified from cDNA (GenBanl~ no. AF156932) to obtain a 1419
by PCR product encoding the full length protein of amino acids 1-473. The
forward primer
contains an embedded HindIII site:
RGS6 fwd 5'-CCCAAGCTTATGGCTCAAGGATCCGGGGAT (SEQ ID NO: S 1)
The reverse primer contains an embedded XhoI site:
RGS6 rev 5'-CCGCTCGAGTCAGGAGGACTGCATCAG (SEQ ID NO: 52)
-42-
CA 02430475 2003-05-28
WO 02/050104 PCT/USO1/45105
The PCR product was digested with Hi~dIII and XhoI and cloned into similar
sites of the
p426TEF vector.
Strain generation:
Yeast strains were produced to evaluate the ability of the various RGS
chimeric
proteins to complement an sst2 knoclc-out. The RGS chimeric plasmids were
transformed
into the base strain KY113, in the presence or absence of human GbetaS. All
strains
contained either control or expression plasmid and firefly luciferase reporter
gene to enable
investigation under similar media conditions. Strains are summarized in the
following table:
Table 4
Strain nameP426 TEF plsamid P425 TEF plasmid
Ysa21 vector vector
Ysa38 vector Hgbeta5
Ysa4 RGS7 Hgbeta5
Ysa7 RGS7 Vector
Ysa42 RGS7(minus N terminus, plus Hgbeta5
GGL)
Ysa46 RGS7(minus N terminus, plus Vector
GGL)
Ysa44 RGS7N/RGS4C clumera Hgbeta5
Ysa48 RGS7N/RGS4C chimera Vector
Ysa93 RGS4N/RGS7C chimera Hgbeta5
Ysa94 RGS4N/RGS7C chimera Vector
Ysa152 RGS4N/RGS7 full length chimeraHgbeta5
Ysal53 RGS4N/RGS7 full length chimeraVector
YsaS RGS9 Hgbeta5
YsalO RGS9 Vector
- 43 -
CA 02430475 2003-05-28
WO 02/050104 PCT/USO1/45105
Ysa43 RGS9(minus N terminus, plus Hgbeta5
GGL)
Ysa47 RGS9(minus N terminus, plus vector
GGL)
Ysa125 RGS4N/RGS9C (minus GGL) Hgbeta5
Ysa126 RGS4N/RGS9C (minus GGL) vector
Ysa127 RGS4N/RGS9C (plus GGL) Hgbeta5
Ysa128 RGS4N/RGS9C (plus GGL) vector
Ysa89 RGS 10 Hgbeta5
Ysa90 RGS 10 vector
Ysa155 RGS4N/RGS10 full length chimeraHgbeta5
Ysa156 RGS4N/RGS 10 full length chimeravector
Ysa91 RGS 11 Hgbeta5
Ysa92 RGS 11 vector
Ysa45 RGS6 Hgbeta5
Ysa49 RGS6 vector
Ysa105 RGS4N/RGSdomain of axin chimeravector
Ysa106 RGS4N/RGSdomain of axin chimeraHgbeta5
RESULTS:
These strains were tested for functional complementation in the pheromone
response
assay, using a pheromone-responsive reporter gene. For example, the luciferase
reporter
gene was employed in the quantitative assay. Strains were also tested in a
'halo assay' in
response to 2 day exposure to alpha factor in a qualitative assay for
pheromone response.
All strains were tested in dose response assays. For luciferase based assays,
the alpha
factor doses tested were 0, 100 pmol, 1 nmol, 10 nmol, 100 nmol, 1 ~,mol, 10
~mol, and 100
-44-
CA 02430475 2003-05-28
WO 02/050104 PCT/USO1/45105
~,mol.
The halo assays were conducted as previously mentioned. For comparison of the
numerous dose response curves, response was determined for a single dose of
alpha factor
within the curve. Response was then determined as a percent response to the
negative control
strain containing no RGS and no GbetaS. For example, a construct having no
effect would be
ranlced at 100, similar to the sst2 knoclcout strain containing empty vectors,
while a highly
functional complementing RGS protein, such as RGS4, would be ranked at 0.
We tested several short, that is, relatively low molecular weight, RGS
proteins. RGS2
and RGSz were previously tested and demonstrated some ability to complement
the sst2
knockout phenotype, although not as effectively as RGS4. RGS 10 is also a
short RGS
protein, however when expressed as a wild-type protein, it did not demonstrate
complemenation in either the luciferase or the halo assay. The RGS4/RGS 10
chimera,
however, restored the RGS function to values very close to those observed for
expression of
RGS4 alone. These results are shown in Figure 12.
From these data, RGS4 is the most effective RGS protein in the complementation
of
the sst2 knockout phenotype. RGS7 is non-functional, and is not much improved
by deleting
the N-terminal xegion. These data are shown in Figure 14. Addition of the RGS4
N-terminal
region to either the RGS7 C-terminal region or addition of the RGS4 N-terminal
region to the
full length RGS7 protein, however, enables some level of functional
complementation.
Moreover, improvements are also noted in the halo assay.
RGS9 in its native state demonstrated an intermediate ability to complement
the sst2
knockout phenotype. This complementation is negated in the absence of the RGS9
N-
terminal region. Addition of the RGS4 N-terminal to the non-functional C-
terminal RGS9-
ggl, however, improves complementation, which is further improved by removal
of the ggl
domain of RGS9.
- 45 -
CA 02430475 2003-05-28
WO 02/050104 PCT/USO1/45105
In addition, we observed some intermediate complementation by RGS6 (value of
25)
and RGS 11 (value of 50), which was not affected by co-expression of G-betas.
We observed a difference in the response of strain expressing RGS9, where the
wild-
type protein had some effect; however co-expressed with GbetaS often an
enhanced
pheromone response was observed. A similar effect was not observed by co-
expression of
GbetaS with other GGL-containing RGS proteins, that is, RGS6, RGS7, and RGA11.
This
finding suggests an alternate function of RGS9.
-46-
CA 02430475 2003-05-28
WO 02/050104 PCT/USO1/45105
References
Ausubel, F. et al., (Ed), Current Protocols in Molecular Biology, John Wiley &
Sons,
Inc., USA, (1998).
De Vries, L., et al., RGS p~°oteius: mop°e than just GAPS for
heterotrimet°ic G
p~oteius, Trends in Cell Biology, Elsevier Science, Vol. 9, pp. 138-143 (April
1999).
Dohlman et al., Sst2, a negative f°egulator ofphe~omone signaling in
the yeast
Saceha~omyces ce~evisiae: expression, localization and genetic interaction and
physical
association with Gpal (the G alpha subunit), Mol. Cell. Biol., Vol. 16, No. 9,
pp. 5194-5209
(1996).
Kehrl, J.H., Fleterot~imeric G pf otein Signaling: Roles in Immune Function
and
Fine-Tuning by RGS P~oteihs, Immunity, Vol. 8, pp. 1-10 (1998).
Panetta, R., et al., Regulators of G Protein Signaling (RGS) 2 and l6A~e
Induced in
Response to Bacterial Lipopolysaccharide and Stimulate c fos P~omote~
Expression,
Biochemical and Biophysical Reseaxch Communications, Vol. 259, No. 3, pp. 550-
556 (June
1999).
Rousch, Wade, Regulating G Protein Signaling, Science (Cell Biology), Vol.
271,
pp. 1056-1058 (Feb. 1996)
Shuey D.J., et al., RGS7 attenuates signal transduction thi°ough the
Galpha q family
of hete~otf~ime~ic G proteins in manamalian cells, J. Neurochem., Vol. 70, pp.
1964-1972
(1997).
Wieland, T., et al., Regulators of G protein signalling.' a novel protein
family
involved in timely deactivation and desensitization of signalling via
heterot~ime~ic G
p~°oteins, Naunyn-Schmiedeberg's Arch Pharmacol, Vol. 360, pp. 14-26
(1999).
-47-
CA 02430475 2003-05-28
WO 02/050104 PCT/USO1/45105
Young, K., et al., Identification of compounds affecting specific interaction
ofpeptide
bindingpai~s, US 5,989,808 (1995).
Zhen, B., et al., Dives°gence of RCS proteins: evidence foy~ the
existence of six
mammalian RCS subfamilies, Dept. of Cellular and Molecular Medicine, and
Phatology,
University of California, San Diego, La Jolla, California, Elsevier Science
Ltd., Vol. 4, pp.
411-414 (1999).
All cited publications, patents, and patent applications are hereby
incorporated by
reference in their entirety.
While the foregoing specification teaches the principles of the present
invention, with
examples provided for the purpose of illustration, it will be appreciated by
one skilled in the
art from reading this disclosure that various changes in form and detail can
be made without
departing from the true scope of the invention.
-48-
CA 02430475 2003-05-28
WO 02/050104 PCT/USO1/45105
SEQUENCE ZISTING
<110> American Home Products Corp.
Young, Kathleen
Cao, Jian
Shuey, David
<120> Methods and Cells for Detecting Modulators of RGS
Proteins
<130> 1142.219-304
<150> US 60/250,147
<151> 2000-12-01
<160> 52
<170> PatentIn version 3.0
<210> 1
<211> 26
<212> DNA
<213> Rattus rattus
<400> 1
gacgtctccc atgtgcaaag gactcg
26
<210> 2
<211> 37
<212> DNA
<213> Rattus rattus
<400> 2
cgggatcctt attaggcaca ctgagggact agggaag
37
<210> 3
<211> 31
<212> DNA
<213> Rattus rattus
<400> 3
gaggatccgg cacactgagg gactagggaa g
31
<210> 4
<211> 20
<212> DNA
-1-
CA 02430475 2003-05-28
WO 02/050104 PCT/USO1/45105
<213> Rattus rattus
<400> 4
tttttacaga tcatcaagga
<210> 5
<211> 20
<212> DNA
<213> Rattus rattus
<400> 5
tgcgtcttca gagcgctttt
<210> 6
<211> 23
<212> DNA
<213> Rattus rattus
<400> 6
gagccaagaa gaagtcaaga aat
23
<210> 7
<211> 19
<212> DNA
<213> Rattus rattus
<400> 7
tgggcttcat caaaacagg
19
<210> 8
<211> 21
<212> DNA
<213> Saccharomyces cerevisiae
<400> 8
tatcgagtca atggggcagg c
21
<210> 9
<211> 21
<212> DNA
<213> Saccharomyces cerevisiae
CA 02430475 2003-05-28
WO 02/050104 PCT/USO1/45105
<400> 9
cgaaacgtgg attggtgaaa g
21
<210> 10
<211> 23
<212> DNA
<213> Saccharomyces cerevisiae
<400> 10
attcggctat gactgggcac aac
23
<210> 11
<211> 23
<212> DNA
<213> Saccharomyces cerevisiae
<400> 11
gtaaagcacg aggaagcggt cag
23
<210> 12
<211> 21
<212> DNA
<213> Photinus pyralis
<400> 12
atataagcca tcaagtttct g
21
<210> 13
<211> 20
<212> DNA
<213> Photinus pyralis
<400> 13
ctcactaaag ggaacaaaag
<210> 14
<211> 24
<212> DNA
<213> Saccharomyces cerevisiae
<400> 14
tcagtttcat ttttcttgtt ctat
-3-
CA 02430475 2003-05-28
WO 02/050104 PCT/USO1/45105
24
<210>15
<211>24
<212>DNA
<213>.Homo Sapiens
<400> 15
ggatccatgg gatcagagcg gatg
24
<210> 16
<211> 27
<212> DNA
<213> Homo Sapiens
<400> 16
cgatcgatta ctatgcttca atagatt
27
<210> 17
<211> 21
<212> DNA
<213> Homo Sapiens
<400> 17
ccagcgggag aacgataatg c
21
<210> 18
<211> 18
<212> DNA
<213> Homo sapiens
<400> 18
cccctcagga aaagaatg
18
<210> 19
<211> 20
<212> DNA
<213> Homo Sapiens
<400> 19
cttggcggag gagggcacac
-4-
CA 02430475 2003-05-28
WO 02/050104 PCT/USO1/45105
<210> 20
<211> 21
<212> DNA
<213> Homo Sapiens
<400> 20
tggaggcatt gagacggaag a
21
<210> 21
<211> 27
<212> DNA
<213> Homo sapiens
<400> 21
gcggatccat gaaacctcca acagaag
27
<210> 22
<211> 26
<212> DNA
<213> Homo Sapiens
<400> 22
cgatcgatta ttagtaagac tgagca
26
<210> 23
<211> 40
<212> DNA
<213> Homo Sapiens
<400> 23
gcaagcttcc accatgacaa tccgacacca aggccagcag
<210> 24
<211> 36
<212> DNA
<213> Homo Sapiens
<400> 24
gctctagatt acaggctctc ccaggggcag atgacc
36
<210> 25
-5-
CA 02430475 2003-05-28
WO 02/050104 PCT/USO1/45105
<211> 35
<212> DNA
<213> Homo Sapiens
<400> 25
ccggatccag atgacaatcc gacaccaagg ccagc
<210> 26
<211> 36
<212> DNA
<213> Homo Sapiens
<400> 26
cgctcgagtt acaggctctc ccaggggcag atgacc
36
<210> 27
<211> 28
<212> DNA
<213> Homo Sapiens
<400> 27
gcggatccat gaagaaacaa acagtcgt
28
<210> 28
<211> 27
<212> DNA
<213> Homo Sapiens
<400> 28
cgatcgaatt attacaggct ctcccag
27
<210> 29
<211> 39
<212> DNA
<213> Homo Sapiens
<400> 29
gcccaagctt ccgccagcca tggcaaccga ggggctgca
39
<210> 30
<211> 24
<212> DNA
-6-
CA 02430475 2003-05-28
WO 02/050104 PCT/USO1/45105
<213> Homo Sapiens
<400> 30
ccgctcgagt taggcccaga ctct
24
<210> 31
<211> 27
<212> DNA
<213> Homo Sapiens
<400> 31
cgcggatcca tgtgcaaagg gcttgca
27
<210> 32
<211> 27
<212> DNA
<213> Homo Sapiens
<400> 32
tcccccgggc ttgacttcct cttggct
27
<210> 33
<211> 27
<212> DNA
<213> Homo Sapiens
<400> 33
tcccccgggg atgagttaca acaacag
27
<210> 34
<211> 24
<212> DNA
<213> Homo Sapiens
<400> 34
cccatcgatt tagtaagact gagc
24
<210> 35
<211> 24
<212> DNA
<213> Homo Sapiens
CA 02430475 2003-05-28
WO 02/050104 PCT/USO1/45105
<400> 35
cgcggatcca tggcccaggg gaat
24
<210> 36
<211> 24
<212> DNA
<213> Homo Sapiens
<400> 36
tcccccggga aaaccccatc gttt
24
<210> 37
<211> 27
<212> DNA
<213> Homo Sapiens
<400> 37
tcccccggga aatgggctga atcactg
27
<210> 38
<211> 27
<212> DNA
<213> Homo Sapiens
<400> 38
cccatcgatt taggcacact gagggac
27
<210> 39
<211> 30
<212> DNA
<213> Homo Sapiens
<400> 39
cccaagctta tggaacacat ccacgacagc
<210> 40
<211> 30
<212> DNA
<213> Homo Sapiens
<400> 40
ccgctcgagt catgtgttat aaattctgga
_g_
CA 02430475 2003-05-28
WO 02/050104 PCT/USO1/45105
<210> 41
<211> 24
<212> DNA
<213> Homo Sapiens
<400> 41
tcccccggga tggcccaggg gaat
24
<210> 42
<211> 24
<212> DNA
<213> Homo Sapiens
<400> 42
cccatcgatt tagtaagact gage
24
<210> 43
<211> 24
<212> DNA
<213> Homo Sapiens
<400> 43
cccaagctta tgaacttcag cgaa
24
<210> 44
<211> 24
<212> DNA
<213> Homo sapiens
<400> 44
ccgctcgagt tacaggctct ccca
24
<210> 45
<211> 27
<212> DNA
<213> Homo Sapiens
<400> 45
cccaagcttg ctgtcaaaaa agagatc
27
-9-
CA 02430475 2003-05-28
WO 02/050104 PCT/USO1/45105
<210> 46
<211> 24
<212> DNA
<213> Homo Sapiens
<400> 46
ccgctcgagt tacaggctct ccca
24
<210> 47
<211> 34
<212> DNA
<213> Homo Sapiens
<400> 47
tcccccgggg gcagtgcctc ccccacccca ccat
34
<210> 48
<211> 30
<212> DNA
<213> Homo sapiens
<400> 48
ccgctcgagt tagactttgg ggctctccga
<210> 49
<211> 30
<212> DNA
<213> Homo Sapiens
<400> 49
ccggaattca tggccgccgg ccccgcgccg
<210> 50
<211> 30
<212> DNA
<213> Homo Sapiens
<400> 50
cccaagcttc taggccaccc catctccacc
<210> 51
-10-
CA 02430475 2003-05-28
WO 02/050104 PCT/USO1/45105
<211> 30
<212> DNA
<213> Homo Sapiens
<400> 51
cccaagctta tggctcaagg atccggggat
<210> 52
<211> 27
<212> DNA
<213> Homo Sapiens
<400> 52
ccgctcgagt caggaggact gcatcag
27
-11-
