Note: Descriptions are shown in the official language in which they were submitted.
CA 02430648 2003-06-06
WO 02/46468 PCT/JPO1/10689
1
DESCRIPTION
Method for MALDI-TOF-MS analysis and/or sequencing of oligonucleotides
Field of the invention
The present invention relates to an improved method for the analysis and/or
sequencing of oligonucleotides by using Matrix-assisted laser
desorption/ionization
time-of-flight mass spectrometry (MALDI-TOF-MS) methodology. In particular,
the
invention relates to modified ribonucleotides, which reduce or eliminate the
signal
intensity drop-off during the MALDI analysis and/or sequencing.
Background art
The Human Genome Project is in the final stages of sequencing the human
genome. One of the post-human genome projects would be to re-sequence a
specific site
for comparing each different person or species as well as for the
determination of Single
Nucleotide Polymorphisms (SNPs). Such a re-sequencing system must be very
speedy
and cost effective.
MALDI-TOF-MS (Smith, L. M., Science, 1993, 262, 530; and Hillenkamp et
al., Biological Mass Spectrometry, Burlingame and McCloskey Editors, Elsevier
Science Publishers, Amsterdam,1990, pp.49-60), has evolved into a rapid,
accurate, and
sensitive method for the mass analysis of high molecular weight synthetic and
biologically important polymers. MALDI-TOF-MS represents an advantageous
methodology for analyzing and sequencing oligonucleotides as well as for the
determination of SNPs.
MALDI-TOF-MS has the advantage of enabling very fast DNA sequencing
and not requiring gels or fluorescent-dyes.
Short DNA re-sequencing systems based on the Sanger method have been
performed with MALDI-TOF-MS (Monforte, J.A., and Becker, C.H., Natut-e Med.,
1997, 3, 360-362; Kirpekar, F. et al., Nucleic Acids Res., 1998, 26, 2554-
2559). The
longer the length of DNA that can be sequenced using MALDI-TOF-MS analysis,
the
greater the advantages MALDI-TOF-MS will gain as an alternative technique in
the area
of DNA sequencing.
CA 02430648 2003-06-06
WO 02/46468 PCT/JPO1/10689
2
However, substantial limitations in the approach of analyzing DNA by
MALDI-TOF-MS have been revealed. One of these limitations is that the DNA
molecules fragment substantially during the course of the MALDI process. The
DNA
exhibits not only the intact parent ion signal but also some other ion signals
caused from
the DNA fragmentation, as base loss and backbone cleavage. A model was
developed
for the fragmentation mechanism (Zhu, L.; et al., J. Am. Chew. Soc. 1995, 117,
6048-6056) in which the initiating step of DNA fragmentation during MALDI is
protonation of the nucleobase moiety, which weakens the N-glycosidic linkage
causing
base loss with concomitant formation of a carbocation at the 1' position of
the
deoxyribose moiety. A subsequent rearrangement leads to backbone cleavage at
the 3'
carbon-oxygen bond.
The stabilization of DNA during the MALDI analysis has been thought to have
utility for DNA sequencing or other nucleic acid analyses.
U.S. Patent No. 5,691,141 describes a method for sequencing DNA, based on
the Sanger methodology. This method involves introducing mass modifications
into the
oligonucleotide primer, the chain-terminating nucleoside triphosphates and/or
the
chain-elongating nucleoside triphosphates, or by using mass-differentiated tag
probes
hybridizable to specific tag sequences. As nucleotide modifications, U.S.
5,691,141
describes primers modified by glycine residues at the 5'-position of the sugar
moiety of
the terminal nucleoside; primers at C-5 of the heterocyclic base of a
pyrimidine
nucleoside with glycine residues, with f3-alanine residues, with ethylene
glycol
monomethyl ether, with diethylene glycol monomethyl ether; primers mass-
modified at
C-8 of the heterocyclic base of deoxyadenosine with glycine or glycylglycine;
primers
mass-modified at the C-2' of the sugar moiety of 2'-amino-2'-deoxythymidine
with
ethylene glycol monomethyl ether residues; DNA primers mass-modified in the
internucleotidic linkage via alkylation of phosphorothioate groups (according
to the
procedure described in Slim G. and Gait M.J., Nucleic Acids Reseaf-ch, 1991,
vo1.19,
No.6, 1183-1188); 2'-amino-2'-deoxyuridine-5'-triphosphate and
3'-amino-2',3'-dideoxythymidine-5'-triphosphate mass-modified at the 2'-amino
or
3'-amino function with glycine or l3-alanine residues; deoxyuridine-5'-
triphosphate
mass-modified at C-5 of the heterocyclic base with glycine, glycyl-glycine and
13-alanine residues; 8-glycyl-2'-deoxyadenosine-5'-triphosphate and
CA 02430648 2003-06-06
WO 02/46468 PCT/JPO1/10689
3
8-glycyl-glycyl-2'-deoxyadenosine-5'-triphosphate; and chain-elongating
2'-deoxy-thymidine-5'-(alpha-S-)triphosphate and chain-terminating
2',3'-dideoxythymidine-5'-(alpha-S-)triphosphate and subsequent alkylation
with
2-iodoethanol and 3-iodopropanol.
However, DNA sequencing by mass spectrometry using the modified
oligonucleotides described U.S. 5,691,141 has the problems of signal intensity
drop-off
and base loss. This disadvantage does not allow sequencing in an efficient
way,
especially for the sequencing of longer DNA sequences (Taranenko, et al.,
NucleicAeids
Res., 1998, 26, 2488-2490).
Schuette J.M. et al., (J. Pharm. Biomed. Ahal.1995,13,1195-1203) suggest the
use of MALDI-TOF-MS, previously used to sequencing natural phosphodiester DNA
sequences, for sequencing DNA comprising alpha-phosphorothioate
deoxyribonucleotides (S-dNTPs). However, the data presented in this document
(for
example Fig.2 of Schuette at al.) show that the use of S-dNTPs is not
efficient for
sequencing analysis by using MALDI.
The unsuitability of the incorporation of phosphorothioate nucleotides into
DNA for MALDI sequencing analysis have also been confirmed by the present
inventors. In the present application, Figures 1A and 1B (referring to oligo
DNA
comprising S-dNTPs and referred to hereafter as S-DNAs) compared to Fig.lC and
1D
(referring to phosphodiester DNAs) show that the substitution of
phosphodiester to
phosphorothioate in DNA sequences increases fragmentation when spectra of the
20mer
and 30mer were focused. Then, the signal intensity drop-off with increasing
mass range
as shown by oligo S-DNA was much more dramatic than that shown by DNA.
The above data confirm the necessity, in this field of investigation, of
developing a new approach to MALDI-TOF-MS analysis methodology which will be
able to remedy the signal intensity drop-off and allow the sequencing of much
longer
oligonucleotides sequences.
Summary of the invention
The present inventors have surprisingly found that alpha-phosphorothioate
ribonucleotides having a 2'-electronegative substituents referred to hereafter
as
S-2'-e-NTPs (preferably S-2'-fluoro-ribonucleotides (S-2'-F-NTPs), or
CA 02430648 2003-06-06
WO 02/46468 PCT/JPO1/10689
4
S-2'-OH-ribonucleotides (S-NTPs)), and arabino-ribonucleotides (ara-NTPs) can
be
advantageously used in MALDI-TOF-MS analysis showing a resistance to signal
intensity drop-off.
Accordingly, the present invention refers to a method for MALDI-TOF-MS
analysis of RNA sequences, fragments or transcripts (in general
oligoribonucleotides)
which method utilizes at least one ribonucleotide selected from the group
consisting of
S-2'-e-ATP, -CTP, -GTP, -UTP and derivatives thereof (preferably S-2'-F-NTPs
or
S-NTPs).
The present invention also refer to a method for MALDI-TOF-MS analysis of
RNA sequences, fragments or transcripts (in general oligoribonucleotides)
which method
utilizes at least one ribonucleotide selected from the group consisting of ara-
ATP, -CTP,
-GTP, -UTP and derivatives thereof.
Further, the present invention relates to a method for determining DNA
nucleotide sequences using the MALDI-TOF-MS comprising:
a) providing ribonucleosides triphosphates or alpha-thin-substituted
(chain-elongating ribonucleotides) selected from ara-NTPs or S-2'-e-NTPs
(preferably S-2'-F-NTPs or S-NTPs) as above defined;
b) reacting said chain-elongating ribonucleotides with one or more kinds of
3'-dNTP derivatives (chain terminating ribonucleotides) in the presence of
an RNA polymerase and a DNA template comprising a promoter sequence
for the RNA polymerase to obtain an oligoribonucleotide transcription
product; and
c) analyzing said oligoribonucleotide transcription product by
MALDI-TOF-MS and determining the sequence of the transcription product
and of the DNA template.
The invention also relates to a method for the determination of SNPs using
MALDI-TOF-MS and S-2'-e-NTPs (preferably S-2'-F-NTPs or S-NTPs) or ara-NTPs.
The invention further refers to a kit for sequencing DNA templates or RNA
transcription products by MALDI-TOF-MS, comprising:
i) a set of chain-elongating ribonucleotides modified according to the present
invention (as above indicated at step a)) for synthesizing a RNA transcription
product;
CA 02430648 2003-06-06
WO 02/46468 PCT/JPO1/10689
ii) one or more chain-terminating ribonucleotides for terminating the
synthesis
of the RNA transcription product and generating sets of base-specific
terminated complementary ribonucleotide transcription fragments; and
iii) a RNA polymerase.
5 The kit above disclosed can also optionally further comprises (iv) one or
more
matrices for MALDI-TOF-MS analysis.
The invention also refers to a kit for the determination of SNPs using
MALDI-TOF-MS comprising the elements (i)-(iii) and the optional (iv) as above
disclosed.
Brief description of the drawings
Figure 1A and 1B: UV-MALDI mass spectra of equimolar mixtures of S-DNA
obtained
using 3-HPA (panel A) and TRAP (panel B) as the matrix, respectively. The
volume (~,l)
of sample/matrix on the probe tip (A) and (B) was: 0.5/1Ø
Figure 1C and 1D: UV-MALDI mass spectra of equimolar mixtures of DNA obtained
using 3-HPA (panel C) and THAP (panel D) as the matrix, respectively. The
volume (p,1)
of sample/matrix on the probe tip (C) and (D) was: 0.5/1Ø
Figure 2A and 2B: UV-MALDI mass spectra of equimolar mixtures of 2'-F-RNA
obtained using 3-HPA (panel A) and THAP (panel B) as the matrix, respectively.
The
volume (~,l) of sample/matrix on the probe tip (A) and (B) was: 0.8/0.8.
Figure 2C and 2D: UV-MALDI mass spectra of equimolar mixtures of RNA obtained
using 3-HPA (panel C) and THAP (panel D) as the matrix, respectively The
volume (~,1)
of sample/matrix on the probe tip (C) and (D) was: 0.8/0.8.
Figure 3: Configuration of (A) deoxy-; (B) ribo-; (C) 2'-fluoro-; (D) arabino-
: (E)
phosphorothioated deoxy-; (F) phosphorothioated ribo-; (G) phosphorothioated
2'-fluoro-; and (H) phosphorothioated 2'-electronegative (2'-e) substituent
oligonucleotide.
Figure 4. UV-MALDI mass spectra of equimolar mixtures of S-RNA obtained using
3-HPA (panel A) and THAP (panel B) as the matrix, respectively. The volume
(~1) of
sample/matrix on the probe tip was (A): 0.5/1.0, (B): 0.8/0.8.
The peaks indicated as [20mer+2H~2+ and [30mer+2H~2~ refer to a double
positive charge
effect.
CA 02430648 2003-06-06
WO 02/46468 PCT/JPO1/10689
6
Figure 5. UV-MALDI mass spectra of equimolar mixtures of 5-2'-F-RNA obtained
using 3-HPA (panel A) and TRAP (panel B) as the matrix, respectively. The
volume (p,1)
of sample/matrix on the probe tip was (A): 0.5/1.0, (B): 0.8/0.8.
Figure 6. UV-MALDI mass spectra of crude (not purified) S-2'F-RNA 10 mer
(panel A),
20 mer (panel B), and 30 mer (panel C) obtained using 3-HPA as the matrix. The
concentration (A): 250~,M, (B): 250p~M, (C): 250~,M was calculated as the
concentration
of the pure end product (A): l0mer S-2'F-RNA, (B): 20mer 5-2'F-RNA, (C): 30mer
5-2'F-RNA, respectively. The volume (~,1) of sample/matrix on the probe tip
(A), (B),
and (C) was: 0.5/1Ø
Figure 7. UV-MALDI mass spectra of equimolar mixtures of (A) and (B):
CH3S-RNA-N+ obtained using 3-HPA without ammonium citrate dibasic (panel A)
and
2,5-DHBA (panel B) as the matrix. The volume (~,l) of sample/matrix on the
probe tip
was (A): 1.0/1.0, (B): 0.5/1Ø
Figure 8. UV-MALDI mass spectra of equimolar mixtures of ara-RNA obtained
using
3-HPA (panel A) and TRAP (panel B) as the matrix, respectively. The volume
(~,l) of
sample/matrix on the probe tip were (A): 0.5/2.0, (B): 0.5/1.5.
Detailed description of the invention
The present invention discloses a method for MALDI-TOF-MS analysis and/or
sequencing of RNA sequences, fragments or transcripts (in general
oligoribonucleotides)
which method utilizes at least one ribonucleotide selected from S-2'-e-NTPs
(preferably
S-2'-F-NTPs or S-NTPs) and ara-NTPs. Examples of analysis of
oligoribonucleotide
ladders according to the present invention are reported in Figures 4, 5, 6 and
8.
The modified ribonucleotides useful in the MALDI-TOF-MS method according
to the present invention, are indicated as S-2'-e-NTPs and ara-NTPs, while the
oligo
comprising the NTPs are indicated as oligo S-2'-e-RNA and oligo ara-RNA,
respectively.
An oligo chemical formula comprising S-2'-e-NTPs is described in Fig.3 (H).
The term "S" refers to the alpha-phosphothioate backbone, and the substituent
"e" refers
to a strong electronegative substituent at position 2' of the ribose moiety.
The
electronegative substituent is preferably selected from the group consisting
of F, Cl, NH2,
N3 and OH (see Table III of Guschlbauer W. and Jankowski K., Nucleic
AcidResear-ch,
1980, volume 8, number 6,1421-1433) but it is not limited to these preferred
substituents.
CA 02430648 2003-06-06
WO 02/46468 PCT/JPO1/10689
7
Other strong electronegative substituents can also be used. When "e" is -OH,
the
ribonucleotide is indicated as S-NTP (in this case the oligo will be indicated
as oligo
S-RNA).
The ribonucleotide S-2'-e-NTPs comprise different nitrogenous bases, that is
adenine, guanine, cytosine, uracil and/or their derivatives. Accordingly, the
compound
S-2'-e-NTP can be also generally indicated as S-2'-e-ATP, S-2'-e-GTP, S-2'-e-
CTP,
S-2'-e-UTP.
Kawasaki A.M., et al., (J.Med.Chem., 1993, 36, 831-841) have disclosed
S-2'-F-NTP and prepared oligo able to retain binding affinity to RNA targets.
However,
there has been no disclosure or suggestion of using this ribonucleotide or
oligo for
MALDI-TOF-MS analysis or sequencing. With reference to the S-2'-F-NTPs and
S-2'-F-RNA according to the present invention, they have been prepared by
TriLink
BioTechnologies (San Diego, CA).
Oligo S-RNAs have been disclosed and synthesized by Slim G. and Gait M.J.,
(NucleieAcidsResearch, 1991, vo1.19, No.6, 1183-1188) in the study of the
mechanism
of cleavage of hammerhead ribozymes. However, there has been no disclosure or
suggestion of use of this oligo in MALDI systems.
S-NTPs according to the present invention comprise different nitrogenous bases
adenine, guanine, cytosine, uracil and/or their derivatives and are
represented as S ATP,
S-CTP, S-GTP, S-UTP and derivatives thereof.
The present inventors have found that an oligo comprising at least one kind of
S-NTP (formula F of Figure 3) shows a resistance to signal intensity drop-off
MALDI-TOF-MS analysis and/or sequencing (Fig.4).
The advantageous use of S-RNA in analysis and sequencing with
MALDI-TOF-MS was not predictable since the introduction of the alpha-
phosphorothio
group in DNA (see Figure 3E and Figures 1A, 1B) as well as the introduction of
an
alkyl-thio- in the alpha phosphoric group of RNA (see Figure 7) did not
exhibit resistance
to signal intensity drop-off in MALDI-TOF-MS analysis and/or sequencing.
With reference to the oligo S-2'-e-RNA, a preferred example is the oligo
S-2'-F-RNA comprising at least one S-2'-F-NTP selected from the group
consisting of
S-2'-F-ATP, S-2'-F-CTP, S-2'-F-GTP, S-2'-F-UTP and derivatives thereof.
With reference to the fluoro substituent at position 2' of the ribose, Tang
Wei et
CA 02430648 2003-06-06
WO 02/46468 PCT/JPO1/10689
8
al. (Anal. Chem., 1997, 69, 302-312) proposed that a deoxyribonucleotide
(dNTP)
having a fluorine moiety substituted at the 2' carbon stabilizes the DNA
sequence to
fragmentation and thus extending the accessible mass range. However, a recent
study
(Scalf, M. Ph.D. thesis, University of Wisconsin, Madison, WI, 2000)
demonstrated that
2'-fluoro-electronegative substituents do not alleviate signal intensity drop-
off. This
may make the sequencing of DNA sequences disadvantageous in MALDI analysis.
The present inventors have further investigated the effect of the introduction
of
2'-fluoro ribonucleotides (2'-F-NTPs) into an oligo RNA (2-F'-RNA) and found
that the
result of MALDI sequencing method using oligo 2'-F-RNA (Figures 2A and 2B of
the
present application) does not differ from that of RNA sequences (Figures 2C
and 2D) and
does not alleviate signal intensity drop-off for long RNA sequences.
The 2'-F-RNAs used in the experimental part of the present application were
prepared by TriLink BioTechnologies (San Diego, CA), synthesized in form of
2'-fluoro-(C)"T. The dTTP (which is not 2'-fluoro modified) was employed as
starting
nucleotide, binding the CPG support. On it the 2'-fluoro-CTPs were added
according to
the usual and well known technique in the art, described for example in
"Current
Protocols in Molecular Biology", VoI.I, Section V, Unit 2.11, John Wiley &
Sons, Inc.
Oligomers of 2'-fluoro-(C)loT, -(C )2oT and -(C )3oT were synthesized. These
oligomers
were referred to as 2'-F-RNA 10 mer, 20 mer and 30 mer, respectively, even if
the real
size of these oligomers is 11, 21 and 31 for the presence of T at the 3' end.
In fact, dTTP is
not modified and the present invention relates to the 2'-electronegative- and
ara-substituents.
S-2'-F-(C )"Ts and ara(C )nTs were also synthesized in the same way as
illustrated for 2'-F-(C )"Ts. Also in these cases the oligomers will be
referred to as 10 mer,
20 mer and 30 mer, even if the real size of them is 11, 21 and 31 because of
the presence
of T at the 3' end.
Similarly, the oligomer of Figures 6, will be referred to 1-10 mer, 1-20 mer
and
1-30 mer, even if their real size is 1-11, 1-21 and 1-31, because of the
presence of T at the
3' end.
With reference to the method according to the present invention for analysis
of
oligos comprising S-2'-F-NTPs, Figures 5 and 6 clearly show that the
introduction of the
alpha-phosphorothio group in combination with the fluoro substituent at
position 2' of the
CA 02430648 2003-06-06
WO 02/46468 PCT/JPO1/10689
9
ribose is particularly useful and efficient in the MALDI-TOF-MS analysis
and/or
sequencing showing a resistance to the signal intensity drop-off. This is a
surprising effect
since the introduction of an alkyl-S group into a ribonucleotide (see Figure
7C and D) as
well as the introduction of a fluoro at 2'-position of a ribonucleotide (see
Figure 2A and
2B) demonstrated a persistence of signal intensity drop-off.
The present inventors also found that oligos comprising
2'-epimer-ribonucleotides (also known both as arabino-NTPs and ara-
NTPs)(formula D
of Figure 3) show a resistance to signal intensity drop-off in MALDI-TOF-MS
analysis
and/or sequencing. These ribonucleotides comprise the different nitrogenous
bases
adenine, guanine, cytosine, uracil and/or their derivatives as described for
compound
S-2'-e-RNA. The resistance to signal intensity drop-off is shown in Figure 8
for ORNs
(oligoribonucleotides) ara-RNA.
Ara-RNA can be prepared, for example, according to Beardsley, G. P., et al.,
Nucleie Acids Res., 1988, 16, 9165-9176; Tang, W., et al., Ahal. Chem., 1997,
69,
302-312. The ara-RNA was disclosed in Tang et al., but it was observed that
the
arabino-nucleosides showed base loss peaks as in Figures 3B, 4, 6B, and 8 (of
the Tang et
al. document). This indicated that the stabilization by this modification was
less than
complete (see page 311, left column, lines 16-20 of the Tang et al. document).
Therefore,
the. ara-RNA was considered not useful for MALDI-TOF-MS analysis or
sequencing. On
the contrary, the present inventors have demonstrated that an ara-RNA ladder
comprising
ara-ribonucleotides, preferably in the presence of 3-HPA as MALDI matrix, show
resistance to signal intensity drop-off using MALDI-TOF-MS analysis or
sequencing.
The ribonucleotides described above are used to prepare oligoribonucleotide
sequence products, which can be defined as S-2'-e-RNA (preferably S-2'-F-RNA
or
S-RNA) and ara-RNA. An oligoribonucleotide sequence product (ORN), according
to
the present invention, can be any ORN comprising the alpha-thin and/or arabino
modified
ribonucleotides according to the invention, such as, for example, an
oligoribonucleotide
ladder, an oligoribonucleotide fragment or complete sequence of a gene, a RNA
transcript
product of an Expressed Sequence Tag (EST) or a full-length RNA sequence, a
fragment
of a RNA transcript of t-RNA, r-RNA, m-RNA or a primer.
A RNA fragment such as a ladder can be prepared, for example, by providing at
least one kind of the alpha-thio and/or arabino modified ribonucleotide
according to the
CA 02430648 2003-06-06
WO 02/46468 PCT/JPO1/10689
invention in order to form an ORN according to the standard technologies known
in the
art (for instance by chemical incorporation of modified ribonucleotides or by
the
Transcriptional Sequencing (TS) method below described). Accordingly, the
present
invention also refers to RNA sequences or fragments or transcript products
5 (oligoribonucleotides) comprising ribonucleotides alpha-thin andlor arabino
modified
according to the invention, as above described.
Examples of analysis of oligoribonucleotide ladders are reported in Figures 4,
5,
6 and 8 showing a high resolution of the peaks indicating purity of the
ladders analyzed.
The analysis can also be used for determining the mass of the ladders.
10 The data of Figures 4, 5, 6 and 8 compared to the data of "control" Figures
1, 2
and 7 demonstrate that the introduction of alpha-thin phosphoric
ribonucleotides into
RNA ladders significantly reduced signal intensity drop-off (Figure 4). It was
an
unexpected result in view of the fact that both the introduction of
alpha-phosphorothioated dNTP into DNA (S-DNA) and the introduction of an alkyl-
thio
phosphoric NTP into RNA (CH3S-RNA) ladders showed a high signal intensity drop-
off
(see Figures 1A, 1B and 7A, 7B, respectively).
The combination of both an alpha-thio phosphoric group and a strong
electronegative substituent (preferably fluoro) at the 2' position, introduced
into a
ribonucleotide renders a oligoribonucleotide (RNA) sequence comprising said
ribonucleotides particularly useful for MALDI-TOF-MS analysis and/or
sequencing.
Accordingly, Figure 5 shows that all the oligomers (10 mer, 20 mer and 30 mer)
have a
clear resistance to the signal drop-off compared to Figure 4, wherein oligo 30
mer show in
3-HPA a signal drop-off effect. 5-2'-F-RNA is particularly stable and
resistant to base
loss and exhibits lower background noise than S-RNA.
Comparison between Figure 5 and Figure 2A,B clearly show an improved
resistance to signal drop-off for 20 mer and 30 mer ladders of 2'-F-RNAs.
Figure 6 is an UV-MALDI-TOF-MS mass spectra for fragments of 1-10 mer
(panel A), fragments of 1-20 mer (panel B) and fragments 1-30 mer (panel C).
The panels
of Figure 6 show that the resolution of the peaks was good and the method has
proved to
efficiently sequence the provided fragments.
Figure 8 shows that ara-RNA 10 mer, 20 mer and 30 mer ladders, preferably in
presence of matrix 3-HPA, have a resistance to signal drop-off and therefore
ara-NTPs
CA 02430648 2003-06-06
WO 02/46468 PCT/JPO1/10689
11
can be efficiently used in MALDI-TOF-MS analysis and/or sequencing.
The matrices employed in the MALDI-TOF-MS method according to the
present invention can be selected from the matrices usually employed in MALDI
methodology, for example 3-HPA, THAP, 2,5-DHBA (Zhu, Y. F., et al., Rapid
Commun.
Mass Spectt~ometfy,1996,10, 383-388; Tang, W., et al., Ahal. Chem.,1997, 69,
302-312).
The selection of a specific matrix in particular experimental conditions could
be
important in MALDI methodology for obtaining a good resolution of the signal
and a
resistance to signal drop-off. For example, in MALDI analysis arabino-10 mer,
20 mer
and 30 mer (Figure 8A), the selection of the matrix 3-HPA is considered
preferably
advantageous.
With reference to the sequencing of RNA sequences or fragments, sequencing
methodologies have been described in the art, for example by Faulstich, K., et
al., Anal.
Chem., 1997, 69, 4349-4353; and Wouner, K., et al., Nucleosides & Nucleotides,
1997,
16, 573-577. However, these methods refer to RNA genomic fragment sequencing
and
cannot be used for purpose of the present method, which requires the
introduction of the
modified ribonucleotides into oligoribonucleotides.
Accordingly, another aspect of the present invention relates to a method for
determining DNA nucleotide sequence using the method called "transcriptional
sequencing" (TS) and MALDI-TOF-MS.
The TS method is described in Sasaki, N. et al. (Proc. Natl. Acad. Sei.
USA,1998,
95, 3455-3460), and also in US 6,074,824, and PCT application WO 99/02729. TS
involves a method for determining the DNA nucleotide sequence of a DNA
template,
comprising I) providing ribonucleoside-5'-triphosphates (also known as chain-
elongating
ribonucleotides) selected from the group consisting of ATP, GTP, CTP, UTP and
derivatives thereof; II) reacting said ribonucleotides with one or more 3'-
dNTP
derivatives (chain-terminating ribonucleotides) in presence of RNA polymerase
and the
DNA template fragment or sequence comprising a promoter sequence for the RNA
polymerase; and III) separating the resulting RNA transcription products and
determining
the ribonucleotide sequence of the RNA transcript (and of the DNA template).
According to a further aspect, the present invention relates to a method
comprising the steps of:
a) providing ribonucleotides, such as S-2'-e-NTPs (preferably S-2'-F-NTPs,
CA 02430648 2003-06-06
WO 02/46468 PCT/JPO1/10689
12
S-2'-C1-NTPs, S-2'-NH2-NTPs, S-2'-N3-NTPs or S-NTPs) or ara-NTPs;
b) reacting the ribonucleotides of step a) with one or more kinds of 3'-dNTP
derivatives in the presence of RNA polymerase and a DNA template
comprising a promoter sequence for the RNA polymerase to obtain an
oligoribonucleotide transcription product;
c) analyzing said oligoribonucleotide transcription product by
MALDI-TOF-MS and determining the transcription product sequence and
DNA template sequence.
The oligoribonucleotide transcription product can be preferably purified
before
applying the MALDI step (Wu, Q. et al., Rapid Commun. Mass Spectrum., 1996,
10,
835-838).
Optionally, the DNA template can be subjected to an amplification step before
performing TS, as disclosed in US 6,074,824.
In the step a) of the above method, the S-2'-e-NTPs are selected from the
group
consisting of S-2'-e-ATP, S-2'-e-GTP, S-2'-e-CTP, S-2'-e-UTP, and derivatives
thereof
(wherein "e" is preferably F, Cl, NH2, N3 or OH); and the ara-NTPs are
selected from the
group consisting of ara-ATP, ara-GTP, ara-CTP, ara-UTP and derivatives
thereof.
The phrase "derivative thereof' is intended to encompass NTPs or dNTPs
comprising any modification known in the art, for example, those having the
modified
bases listed in Table 13-3 of Patentin Version 2.1, User Manual, U.S. Patent
and
Trademark Office, or WIPO Standard ST.25 (1998), Appendix 2, Table 2.
The 3'-dNTP derivatives (also known as chain-terminating ribonucleotides) are
selected from the group consisting of 3'-dATP, 3'-dGTP, 3'-dCTP, 3'-UTP and
derivatives thereof, having the modification as above disclosed S-2'-e-, S-,
and arabino.
In simple words, they correspond to the modified ribonucleotides according to
the present
invention having a deoxy at 3'-position, so that they terminate the
ribonucleotide
transcript synthesis. They can also be indicated as S-2'-e-3'-dNTPs, S-3'-
dNTPs,
ara-3'-dNTPs or derivatives thereof.
The RNA polymerase can be any RNA polymerase able to incorporate
S-2'-e-NTPs (preferably S-2'-F-NTPs or S-NTPs), or ara-NTPs or derivatives
thereof
and S-2'-e-3'-dNTPs (preferably S-3'-F-dNTPs or S-3'-dNTPs), ara-3'-dNTPs or
derivatives thereof (Padilla, R.; Sousa R. Nucleic Acids Res. 1999, 27, 1561-
1563; and
CA 02430648 2003-06-06
WO 02/46468 PCT/JPO1/10689
13
Griffiths, A. D., et al., Nucleic Acids Res. 1987, 15, 4145-4162). Examples of
suitable
RNA polymerises are T7, T3, K11, SP6 and BA14 RNA polymerises (Hyone-Myong
Eun, "Enzymology Primer for Recombinant DNA Technology" Academic Press, Inc.,
1996, Chapter "RNA Polymerises"). Particularly advantageous for the TS method
are the
RNA polymerises having mutations as described in WO 99/02729, showing an
enhanced
ability for incorporating NTPs and/or 3'-NTPs. These mutant RNA polymerises
are, for
example, T7 RNA polymerise having at least one of the mutations F644Y, L665P,
F667Y, F644Y/L665P, F644Y/F667Y, L665P/F667Y and F644Y/L665P/F667Y; a T3
RNA polymerise having at least one of the mutations F645Y, L666P, F668Y,
F645Y/L666P, F645Y/F668Y, L6656/F668Y and F645Y/L666P/F668Y; a K11 RNA
polymerise having at least one of the mutations L668P, F690Y, L688P/F690Y.
Preferably, the RNA polymerise is a T7 RNA polymerise having the mutations
F644Y
and/or F667Y. A more complete description of suitable mutant RNA polymerises
as well
as the explanation of the terminology used can be found in WO 99/02729. A
further
useful RNA polymerise is the T7 RNA polymerise Y639F described in Padilla, R.
and
Sousa, R., Nucleic Acids Res., 1999, 27,1561-1563.
Once the RNA transcript fragments are prepared according to the TS
methodology known in the art (see reference above cited) and comprising the
modified
ribonucleotides according to the present invention, said RNA transcript
fragments can be
sequenced using MALDI-TOF-MS methodology.'
The transcripts S-2'-e-RNA (preferably S-2'-F-RNA or S-RNA) which are
produced by T7 RNA polymerise have only Rp-thiophosphodiester linkage. In
order to
maintain the Rp-S-linkage, they show the ability to resist to RNA cleavage,
nucleaseSl,
nucleasePl, RNaseT1 and RNaseA (Padilla, R.; Sousa R. Nucleic Acids Res. 1999,
27,
1561-1563; Dahm, S. C., et al., Biochemistry 1993, 32,13040-13045; Loverix,
S., et al., J.
Cherr~istry & Biol~gy 2000, 7, 651-658).
The present invention also relates to a method for the determination of SNPs
using MALDI-TOF-MS and S-2'-e-NTPs (preferably S-2'-F-NTPs or S-NTPs) or
ara-NTPs. The method for determining SNPs can be realized using the TS method
and
applying MALDI-TOF-MS as above described.
In particular, for determining polymorphism, at least two alleles (or one
allele
and a wild type) of the same gene or gene fragment have to be sequenced.
Alternatively,
CA 02430648 2003-06-06
WO 02/46468 PCT/JPO1/10689
14
one or more alleles are sequenced and compared to an already known sequenced
allele (or
to the wild type).
A general method and different approaches for determining SNPs using
MALDI-TOF-MS is described in US 5,965,363.
Preferably, the sequences or fragment transcripts (oligoribonucleotides)
analyzed for polymorphism are subjected to accurate purification, in order to
remove
unwanted nucleic acid products from the spectrum. Further, the size of the
oligoribonucleotides to be analyzed have to be within the range of the mass-
spectrometry
able to assure the necessary mass resolution and accuracy (see US 5,965,363).
In a particular embodiment, the template DNA can be amplified, using specific
primers, according to techniques known in the art. Then, a target sequence
(that is a
sequence that one intends to analyze and sequence comprising the presumed
polymorphism) is distinguished. Accordingly, the target sequence (for example
corresponding to an exon or shorter) will is extracted from the template
preferably during
the amplification step using the appropriate primers, or by cleaving off a
portion of one or
more flanking regions at the level of DNA template. Then, the transcription
product is
prepared and the masses of each of the reduced-length (amplified or not)
target
oligoribonucleotide(s) is determined using MALDI-TOF-MS. This method can be
used
to detect polymorphism in a single target nucleic acid by detecting
variability in mass as
compared to a wild type target nucleic acid or other alleles of said target
nucleic acid.
The method can also be used to detect polymorphisms in a set of different
target
nucleic acids comprising (optionally also comprising amplifying each of said
target
nucleic acids) reducing the length and/or isolating a target oligonucleotide,
using the TS
method and determining the masses of the transcription products, comprising
the
incorporated ribonucleotides of the present invention, by MALDI-TOF-MS.
The invention further refers to a kit for sequencing a DNA template or a RNA
transcription product by MALDI-TOF-MS, comprising:
i) a set of chain-elongating ribonucleosides triphosphates or
alpha-phosphothioated for synthesizing a RNA transcription product, said
chain-elongating ribonucleosides selected from the group consisting of
S-2'-e-NTPs (preferably S-2'-F-NTPs or S-NTPs) and ara-NTPs;
ii) one or more chain-terminating ribonucleotide for terminating the synthesis
CA 02430648 2003-06-06
WO 02/46468 PCT/JPO1/10689
of the RNA transcription product and generating sets of base-specific
terminated complementary ribonucleotide transcription fragments; and
iii) a RNA polymerase.
The kit above disclosed can also optionally further comprise:
5 iv) a set of primers suitable for amplification of the template or target
DNA;
and
v) one or more matrix for MALDI-TOF-MS analysis. A matrix can be
selected, for example, among those described in Zhu, Y. R, et al., Rapid
Commute. Mass Spectrometry, 1996,10, 383-388; Tang, W., et al., Anal.
10 Chem., 1997, 69, 302-312.
The present invention also refers to a kit for the determination of SNPs using
MALDI-TOF-MS comprising the same elements (i)-(iii) and the optional elements
(iv)-(v) as disclosed for the kit for sequencing a DNA template or a RNA
transcription
product, and further optionally at least one restriction endonuclease capable
of reducing
15 the length of amplified target oligonucleotides (US 5,96,363).
The products and methods according to the present invention using the
MALDI-TOF-MS methodology will be particularly advantageous, for example, in
the
area of DNA re-sequencing and/or SNPs investigation, because the invention
remedies
the substantial phenomenon of signal intensity drop-off with increasing mass
range.
The present invention will be further explained more in detail with reference
to
the following examples.
Examples
Matrices and setting of mass spectrometer
The matrices employed were purchased from Aldrich Chemical Co.
(Milwaukee, WI). The preparation of matrix 3-hydroxypicolinic acid (3-HPA)
followed
the protocol, which mixed 180 ~,1 of 0.5M 3-HPA in 50% acetonitrile and 20 ~,1
of 0.5 M
ammonium citrate dibasic in MilliQ water, was employed in experiments. The
matrix
2,5-dihydroxybenzoic acid (2,5-DHBA) was prepared as a 0.5M solution in 10%
acetonitrile. The preparation of 2,4,6-trihydroxyacetophenone
(2,4,6-TRAP)/2,3,4-trihydroxyacetophenone (2,3,4-THAP) matrix followed the
protocol previously described (Zhu, Y. F., et al., Rapid Commu~c. Mass
Spech~ometf y.
CA 02430648 2003-06-06
WO 02/46468 PCT/JPO1/10689
16
1996, 10, 383-388) and a molar ratio of 2:1:1 for 2,4,6-THAP:2,3,4-
THAP:ammonium
citrate dibasic was employed for all TRAP preparations. Matrix 2,5-DHBA or
THAP
was employed to certify and investigate oligonucleotide fragmentation in MALDI
process. Each 10, 20 and 30mer oligonucleotide of 50 pmol per ~,l was mixed as
the
preparation of equimolar mixture. To an oligonucleotide sample was added a
matrix
solution, on a 2-mm diameter stainless steel probe tip. This solution was
mixed well
with pipetting on the probe tip and allowed to crystallize at room temperature
before
analysis by MALDI-TOF-MS.
Mass spectra were obtained on a Bruker Reflex III time-of flight mass
spectrometer, equipped with a 337 nm N2 laser giving a 2 ns pulse width and
operated in
linear, positive-ion detection mode at 28.5 kV (IS/1) with a delayed
extraction voltage of
20.8 kV (IS/2). The laser power setting employed for the samples was 25-30 %
of the
full laser power. Sweet spots on the surfaces of the matrix and sample mixture
crystallized were searched and shot to gain the best spectrum in all
experiments. Clear
crystals were favored over white muddy color crystals. Each spectrum consisted
of the
sum of 50 shots. MALDI-TOF-MS was performed as described according to the
state of
the art literature.
Preparation of ribonucleotides and DNA, S-DNA, RNA , 2'-F-RNA, S-RNA ladders
DNA, S-DNA, RNA and S-RNA (Figures 3A, 3E, 3B and 3F, respectively)
ladders were synthesized and HPLC purified by GENSET OLIGOS (Kyoto, Japan and
Paris, France). Sequence of the DNA were 10 mer: d(GATCTCAGCT) (SEQ ID N0:1);
20 mer: d(GATCTCAGCTCTAATGCGGT)(SEQ ID N0:2);
mer: d(GATCTCAGCTCTAATGCGGTTCGATAAATC)(SEQ ID N0:3).
Sequences of the RNA were the same to the DNA with the difference that T
25 was U in the RNA and are defined as 10 mer: (GAUCUCAGCU) (SEQ ID N0:4), 20
mer: (GAUCUCAGCUCUAAUGCGGU) (SEQ ID N0:5), and 30 mer:
(GAUCUCAGCUCUAAUGCGGUUCGAUAAAUC) (SEQ ID N0:6).
S-DNA and S-RNA were synthesized as phosphorothioate substituted the DNA
and the RNA with amine at 3' end for adding positively charged tag,
respectively.
30 2'-fluoro-(C)nT (2'-F-RNA) (n = 10, 20 or 30) were synthesized and purified
from polyacrylamide gel by TriLink BioTechnologies (San Diego, CA) (SEQ ID NO:
7-9). In the following sequences SEQ ID NO: 7-9, the T in position 3' was
added with
CA 02430648 2003-06-06
WO 02/46468 PCT/JPO1/10689
17
the only purpose of starting material on CPG beads (CPG, Inc., Lincoln Park,
NJ 07035)
during the synthesis:
The dTTP is not 2'-modified and was not considered for the purpose of the
present invention. Only the 2'-F-CTPs were counted for the numbering of the
oligomers.
Therefore, even is the oligomers synthesized are 11, 21 and 31 mer, they were
referred to
as 10 mer, 20 mer and 30 mer.
The l0mer: 5'- 2'-fluoro CCCCCCCCCCT -3' (SEQ ID N0:7);
The 20mer: 5'- 2'-fluoro CCCCCCCCCCCCCCCCCCCCT -3' (SEQ ID N0:8);
The 30mer: 5'- 2'-fluoro CCGCCCCCCCCCCCCCCCCCCCCCCCCCCCT -3' (SEQ
ID N0:9).
All oligonucleotides as stock solution were dissolved with TE buffer (lOmM
Tris-Cl pH 8.0, 1mM EDTA pH8.0). MilliQ water was employed at any other
dilution
step.
Analysis of DNA, RNA and 2'-F-RNA ladders
Figures 1C,D and Figures 2C,D and 2A,B show that equimolar mixtures of the
10, 20 and 30mer for each of the three different 2' groups were prepared and
analyzed
using two different matrices in MALDI. In each Figure, signal intensity drop-
off with
increasing mass range was a positive trend. The behavior of the
oligonucleotide ladders
were repeated as the same trend with 3-HPA and TRAP. In Figures 1D , 2D and 2B
the
spectra of 30mer in DNA, RNA and 2'-F-RNA ladder using THAP show that the
trend
of stability to bass loss was followed as the order 2'-F-RNA > RNA > DNA.
Previous
studies mentioned the same trend that much more electronegative 2' group
provided
greater stabilization of the oligonucleotide in MALDI analysis (Scalf, M.
Ph.D. thesis,
University of Wisconsin, Madison, WI, 2000). However, in the present example,
the
intensity of electronegativity at 2' position exhibited no effect toward
resistance to
signal intensity drop-off.
Analysis of S DNA ladder
Figures 1A and 1B compared to Figures 1C and 1D show that the substitution
of phosphorothioate in DNA facilitated excessive fragmentation when spectra of
the
20mer and the 30mer was focussed. Signal intensity drop-off with increasing
mass range
CA 02430648 2003-06-06
WO 02/46468 PCT/JPO1/10689
18
as shown in the S-DNA ladder was much more dramatic than that in the DNA.
Previous
study also suggested that oligo S-DNA was not suitable for sequencing product
in
MALDI analysis (Schuette, J. M., et al., J. Pharm. Biomed. Anal. 1995,13,1195-
1203).
Analysis of S-RNA ladder
S-RNA ladder was analyzed in matrices 3-HPA and THAP. Figures 4A and 4B
compared to Figures 2C and 2D show that the substitution of phosphorothioate
in RNA
gained a resistance toward decreasing signal intensity drop-off with
increasing mass
range using both matrices. The signal intensity of each peak in THAP was
almost even.
Synthesis and analysis of S-2'-F RNA ladder
S-2'-fluoro-(C)"T (S-2'F-RNA) (Figure 3G) as phosphorothioate substituted
2'-fluoro-(C),1T (SEQ ID NO: 7-9) was also prepared by TriLink
BioTechnologies. The
numbering of oligomers length was 10 mer, 20 mer and 30 mer, and the presence
of T at
the 3' end was not considered for reason of numbering. Similarly, the crude
oligomers
represented in Figure 6, are indicated as 1-10 mer,1-20 mer and 1-30 mer,
because the T
at position 3' end was not considered for reason of numbering.
The crude S-2'-F-(C)"Ts (S-2'-F-RNAs) were synthesized and processed by
ethanol precipitation to remove excess salt and exchanged to the sodium salt
form (as
purchased from TriLink Biotechnologies, San Diego, CA). Crude l0mer, 20mer,
30mer
S-2'-F-RNA were not subjected to purification. Therefore, the crude l0mer,
20mer,
30mer S-2'-F-RNA contained 1-l0mer, 1-20mer, 1-30mer S-2'-F-RNA, respectively.
These crude oligoribonucleotides were used for the experiment reported in
Figure 6.
Then, the same kind of crude oligoribonucleotides were purified by
polyacrylamide gel and purified oligoribonucleotides of 10 mer, 20 mer and 30
mer
(S-2'-F-RNA) were obtained. These purified oligoribonucleotides were used for
the
experiment reported in Figure 5
In Figure 5A and 5B, the 10, 20, 30mer ladders of S-2'-F-RNA show extremely
sharp signal peaks, no base loss, and even signal intensity peaks using 3-HPA
and THAP
matrices. The signal to noise ratio was high enough to detect these signals.
Figures 6A and 6B show that the l0mer and the 20mer of the crude
S-2'-F-RNA were analyzed in 3-HPA. In order to judge how the ladder spectra is
CA 02430648 2003-06-06
WO 02/46468 PCT/JPO1/10689
19
resistant to signal intensity drop-off with increasing mass range, a
comparison with the
spectra of 2'-F-RNA ladder as a control was performed. In the spectra of 2'-F-
RNA
ladder as shown in Figure 2A, the signal intensity of the 20mer was assigned
as 20 when
the intensity of the l0mer was 100. The intensity decreased five times with
increasing
the mass about two times. However, in the spectra of 20mer S-2'-F-RNA as shown
in
Figure 6B, the intensity of the l8mer was assigned as 62 when the intensity of
the 9mer
was 100. The intensity decreased by less than a factor of two with increasing
the mass by
a factor of about two. The number of the signal peaks from S-2'-F-RNA ladder
was less
effect for decreasing the signal intensity. This result demonstrates that S-2'-
F-RNA has
the robust trend of resistance to signal intensity drop-off with increasing
mass range.
Figure 6C shows that the crude S-2'-F-RNA was analyzed in 3-HPA. Decreasing
the
signal intensity with mass range was also demonstrated. However, the
resistance to
decreasing the signal intensity was revealed in the condition of which the
length of the
product is longer, the number of the mole is smaller. It is expected that
equimolar of
S-2'-F-RNA ladder would be able to exhibit spectra of almost even signal
intensity in
MALDI analysis.
This data demonstrated that the S-2'-F-RNA as well as the S-RNA have an
ability to resist to signal intensity drop-off.
Synthesis and analysis of CH3S RNA
In order to verify the effect of the introduction of an alkyl-thio at the
alpha
position of a phosphoric group in RNA, the analysis of CH3S-RNA was performed.
Gut
et al. presented a procedure for selective DNA alkylation and detection by
mass
spectrometry using l0mer phosphorothioated DNA (Gut, I. G., et al., Rapid
Commun.
Mass Spectrometry 1997, 11, 43-50). The same procedure was employed for
producing
10, 20, 30 mer of CH3S-RNA with a positive charged tag. Accordingly,
positively
charged 3' tagged RNA (CH3S-oligoribonucleotide-N+(CH3)3) were synthesized.
All
methylated phosphorothioates,
5'- (SCH3)-GAUCUCAGCU-(CH3)3N+CSHioCONH-C6H1~OP02 3' (SEQ ID NO:10);
5'- (SCH3)- GAUCUCAGCUCUAAUGCGGU -(CH3)3N+CSHIOCONH-C6HiZOP02 3'
(SEQ ID NO: 11); 5'- (SCHs)
GAUCUCAGCUCUAAUGCGGUUCGAUAAAUC)-(CH3)3N+CSHIOCONH-C6H120
CA 02430648 2003-06-06
WO 02/46468 PCT/JPO1/10689
P02 3' (SEQ ID NO: 12); were synthesized according to Gut et al., using the
CH3I
reaction. The reproducibility of the analysis was certified in the present
MALDI
technique using alpha-cyano-4-hydroxycinnamic acid methyl ester (CNME) as
matrix.
In analysis of CH3S-oligoribonucleotide-N+(CH3)3, equivolumes from each
5 l0mer, 20mer, 30mer of the CH3S-RNA after the addition of the positive
charged tag
were mixed as the preparation of equimolar mixture.
Figures 7A,B show spectra of these oligo CH3S-RNA. In the analysis of
CH3S-RNA as shown in Figures 7A,B, a number of shorter spectra instead of the
expected intact parent ion peak were observed.
10 The control spectra of those were shown in Figures 4A,B as spectra of S-
RNA.
This data shows that the introduction of an alkyl-thio group in the alpha-
phosphoric group of ribonucleotides (Fig.7) does not avoid signal intensity
drop-off,
while the introduction of only a thio- group (Fig.4) shows a resistance to
signal intensity
drop-off. This is a further confirmation that the effect of signal drop-off
resistance of
15 S-NTPs was not predictable.
Analysis of ara RNA ladder
Arabino-(C)nT ladders (n = l0mer, 20mer and 30mer) having the sequences of
SEQ ID NO: 7-9, respectively, were synthesized and purified from
polyacrylamide gel
20 by TriLink BioTechnologies (San Diego, CA). Also in this case as for the
synthesis of
2'-F-RNAs and S-2'-F-RNAs, the oligomer lengths were indicated as 10 mer, 20
mer
and 30 mer, since the T at position 3' end was not considered for reason of
numbering.
The dTTP, in fact, does not have the -OH at 2'-epimer position that the ara-
NTPs have.
Arabinonucleic acids were mentioned more stable toward snake venom
phosphodiesterase (SVDPE) hydrolysis than the ribonucleic acid derivatives;
i.e.,
ara-RNA > RNA > 2'-F-RNA (Noronha, A. M., et al., J. Biochemistry 2000, 39,
7050-7062). Since the present inventors focused on a trend of sugar-phosphate
in
oligonucleotide, the order in stability to SVDPE hydrolysis was investigated
to suit
stability to fragmentation in MALDI analysis. The behavior of the ara-RNA
ladder in
MALDI analysis was further certified in the matrices 3-HPA and TRAP. Figure 8A
shows that extremely sharp signal peaks and the resistance to signal intensity
drop-off
with increasing mass range were observed using 3-HPA. The signal intensity of
each
CA 02430648 2003-06-06
WO 02/46468 PCT/JPO1/10689
21
peak was almost even. Ara-RNA ladder in matrix THAP was also resistant among
the 20
mer and the 30 mer as shown in Figure 8B. The ara-RNA ladder exhibited
resistance to
signal intensity drop-off with increasing mass range as shown in Figure 8A and
8B. It
has been understood that phosphorothioate-substitution of RNA made backbone
cleavage difficult. The effect was investigated to prove that the backbone
cleavage at the
sugar-phosphate would become one of the key roles toward decreasing signal
intensity
with increasing mass range in MALDI analysis.
Fig.B, preferably Fig.BA, shows that, contrary to the disclosure in the state
of
the art, ara-NTPs are able to resist signal intensity drop-off using MALDI-TOP-
MS.
Sequencing method
RNA transcript fragments of a specific template DNA fragment or sequence can
be produced with TS methodology disclosed in the references as above
indicated. The
RNA transcript fragments can be treated with an amount of desalting acid
solution and
can be recovered substantially free from contaminants. The transcripts are
then mixed
with a matrix and crystallized. The RNA sequence is determined by MALDI-TOF-
MS,
according to the methodology known in the art. The sequence of the template
DNA bases
are then determined according to the transcript RNA bases.
All cited patents, publications and other materials referred to in this
application
are herein incorporated by reference.
The invention being thus described, it will be obvious that the same may be
varied in many ways. Such variations are not to be regarded as a departure
from the spirit
and scope of the present invention, and all such modifications as would be
obvious to one
skilled in the art are intended to be included within the scope of the
following claims.
CA 02430648 2003-06-06
WO 02/46468 PCT/JPO1/10689
1/3
SEQUENCE LISTING
<110> HAYASHIZAICI, Yoshihide
ONO, Tetsuyoshi
<120> Method for MALDI-TOF-MS analysis and/or sequencing of oligonucleotides
<130> 1244
<160> 12
<170> PatentIn version 3.0
<210> 1
<211> 10
<212> DNA
<213> Synthetic
<400> 1
gatctcagct 10
<210> 2
<211> 20
<212> DNA
<213> Synthetic
<400> 2
gatctcagct ctaatgcggt 20
<210> 3
<211> 30
<212> DNA
<213> Synthetic
<400> 3
gatctcagct ctaatgcggt tcgataaatc 30
<210> 4
<211> 10
<212> RNA
<213> Synthetic
<400> 4
gaucucagcu 10
<210> 5
<211> 20
<212> RNA
<213> Synthetic
<400> 5
gaucucagcu cuaaugcggu 20
<210> 6
<211> 30
<212> RNA
<213> Synthetic
<400> 6
gaucucagcu cuaaugcggu ucgauaaauc 30
<210> 7
<211> 10
<212> RNA
CA 02430648 2003-06-06
WO 02/46468 PCT/JPO1/10689
2/3
<213> Synthetic
<220>
<221> modified_base
<222> (10)..(10)
<223> a T base is added onto the 3' end
<220>
<221> modified_base
<222> (1)..(10)
<223> each CTP has an Fluoro substituent at the 2' position of the saga
<400> 7
cccccccccc 10
<210> 8
<211> 20
<212> RNA
<213> Synthetic
<220>
<221> modified_base
<222> (20)..(20)
<223> a T base is added onto the 3' end
<220>
<221> modified base
<222> (1)..(20)
<223> each CTP has an Fluoro substituent at the 2' position of the saga
<400> 8
CCCCCCCCCC CCCCCCCCCC 2O
<210> 9
<211> 30
<212> RNA
<213> Synthetic
<220>
<221> modified_base
<222> (30)..(30)
<223> a T base is added onto the 3' end
<220>
<221> modified_base
<222> (1)..(30)
<223> each CTP has an Fluoro substituent at the 2' position of the saga
<400> 9
CCCCCCCCCC CCCCCCCCCC CCCCCCCCCC 30
<210> 10
<211> 10
<212> RNA
<213> Synthetic
<220>
<221> modified base
CA 02430648 2003-06-06
WO 02/46468 PCT/JPO1/10689
3/3
<222> (1)..(10)
<223> A -SCH3 group is present at the alpha position of the phosphoric
group in each RN
<220>
<221> modified_base
<222> (10)..(10)
<223> 3' end modified with a (CH3)3N+C5H10CONH-C6H120P02- positively ch
arged to
<400> 10
gaucucagcu 10
<210> 11
<211> 20
<212> RNA
<213> Synthetic
<220>
<221> modified_base
<222> (1)..(20)
<223> A -SCH3 group is present at the alpha position of the phosphoric
group in each RN
<z2o>
<221> modified_base
<222> (20)..(20)
<223> 3' end modified with a (CH3)3N+C5H10CONH-C6H120P02- positively ch
arged to
<400> 11
gaucucagcu cuaaugcggu 20
<210> 12
<211> 30
<212> RNA
<213> Synthetic
<220>
<221> modified_base
<222> (1)..(30)
<223> A -SCH3 group is present at the alpha position of the phosphoric
group in each RN
<220>
<221> modified_base
<222> (30)..(30)
<223> 3' end modified with a (CH3)3N+C5H10CONH-C6H120P02- positively ch
arged to
<400> 12
gaucucagcu cuaaugcggu ucgauaaauc 30
