CA 02431859 2004-03-29
50409-13D(S)
TRANSGENIC AND CLOhIED-MAMMALS -
- . Background of the Invention
'The ability to modify animal genomes through transgenic technology has
opened new avenues for medical applications. By targeting the expression of
biomedical .proteins to the mammary gland of large farm animals, low-cost
production of high quantities of valuable therapeutic proteins is now
possible.
Houdebine (i995) Reprod. Nutr. Dev. 35:609-617; Maga et al. (1995) -
Bio/Technology, 13:1452-1457;.Echelard (1996) Curr.Op.Biotechnol. 7:536-540;
Young et_ al. ( 1997) BioPharm. 10:34-38. f~lthough the total sales for the
top
fifteen biopharmaceuticals in 1996 were $7.S~biIlion, expectations are that
this
number will continue to rise in the future. Med. Ad News 16:30.- Transgenic
technology. is appl.icabie and attractive-for.proteins that, whether
duewto.high unit,-
dosage requirements, frequency of administration, or large patient
populations,
-are needed in high volume, and also to complex proteins that are difficult to
produce in commercially viable quantities using traditional cell culture
methods.
In addition, the production of human pharmaceuticals in the milk~of transgenic
20 farm animals solves many of the problems 'associated with microbial
bioreactors,
e.g., lack ofpost-translational modifications,.improper~folding, high
purification
costs, or animal cell bioreactors, e.g., high capital costs; expensive culture
media,
low yields. . . ~ - - -
Dairy goats are ideal for transgenic production of therapeutic recombinant
25 proteins. Their average milk output is 600-800 liters per lactation. . With
herds of
CA 02431859 2003-06-20
WC 00126357 ~C°T.ItfS9912571~
a manageable size and at concentrations of approximately 1-5 gramslliter.
reproducibly achieved with various animal models, yields of transgenic protein
to
obtain 1-300 kg of purifaed product per year are achievable. Cordon et al.
(1987)
BiolTechnology 5:1183-1187; l~eade et al. (1990) BiolTeclmology 8:443-446;
Ebert et aI. (I991) BiolTeclanology 9:835-838; Simons et aI. (1987) Nature
328:530-532; Vhright et al. {199.1 ) Bi~lTechnology 9:801-834; Velander et al:
. _.
(19-92) Proc Natl.4cact S'ci USA 89:12003-120007; Hansson et al. (1994) J73ioi
Chem. 269:5358-5363; liurwitz et al. (1994) Transgenic lies. 3;365-375. 'This
represents the low to middle range.of the high volume protein category and
quantities that would be required for the majority of biopharrrr~aceuticals
currently
under development: Ivloreover, the goat generation interval, i.e., gestation,
growth to sexual maturity and gestation, is 18 months as compared to almost
three years for cows. This period permits expansion of the produetiora herds
within the time frame needed for the regulatory approval of the transgenically-
produced therapeutic proteins. rinaliy, the:rr~uch lower i:~cide:~ce of
sc:apie i::
goats (only 7 cases ever reported in the tT.S.) relative to sheep, which have
identical reproductive performance, and lower lactation output, makes goats
better candidates for the production of therapeutic proteins. .
currently, there are very few reliable methods of producing transgenic
goats. one sl~:ch :~etlrnd is prons~clea_r microinjection. Using pronuclear
microinjection methods, transgene integration into the genetic snake up ~ccurs
iri
1-3% of all the anicr~injected embryos. Ebert et al. (I993) Theriogenology,
39:121-135.
In 1981, it was reported that mouse embryonic stem cells can be isolated,
propagated in viv~, genetically modified and, ultimately, can contribute to
the
germline of a host embry~. leans et al. (198i) Nature 292:154-156; ~lartirB
(1981) Proc Natl Acad ;Sci USA 78:?634-7638; Bradley et al. (1984) Nature
309:255-256. Since then, marine erruayonic stem cells have been extensively
exploited in developmental and genetic steadies to modify, e.g., delete,
replace,
mutate, single targeted genes. I~Iansour et al. (1988) Nature 336:348-352;
-2-
CA 02431859 2004-11-25
50409-13D(S)
McMahon et al. (1990) Cell 62:1073-1085; recently reviewed
in: Bronson et al. (1994) J. Biol. Chem. 269:27155-27158;
Rossant, et al. (1995) Nat. Med. 6:592-594. Although
extensive studies in the mouse have clearly indicated the
utility of these elegant and powerful techniques, successful
application of embryonic cell technology has been
conclusively reported only in the mouse.
A need exists, however, for methods for obtaining
cloned and transgenic animals such as goats.
Summary of the Invention
The present invention is based, at least in part,
on the discovery that cloned and transgenic mammals, e.g.,
cloned and transgenic goats, can be produced by introduction
of a somatic cell chromosomal genome into a functionally
enucleated oocyte with simultaneous activation. The
functionally enucleated oocyte can be activated or
nonactivated. In one embodiment, a nonactivated
functionally enucleated oocyte (e.g., a caprine oocyte at
metaphase II stage) is fused (e.g., by electrofusion) with a
donor somatic cell (e.g., a caprine somatic cell) and
simultaneously activated with fusion. In another
embodiment, an activated functionally enucleated oocyte
(e. g., a naturally matured caprine oocyte at telophase
stage) is fused (e. g., by electrofusion) with a donor
somatic cell (e.g., a caprine somatic cell) and
simultaneously activated with fusion.
The use somatic cell lines, e.g., recombinant
primary somatic cell lines, for nuclear transfer of
transgenic nuclei dramatically increases the efficiency of
production of transgenic animals, e.g., up to 1000, if the
animals are made by the methods described herein. It also
- 3 -
CA 02431859 2005-06-27
50409-13D(S)
solves the initial mosaicism problem as each cell in the
developing embryo contains the transgene. In addition,
using nuclear transfer from transgenic cell lines to
generate transgenic animals, e.g., transgenic goats, permits
an accelerated scale up of a specific transgenic line. For
example, a herd can be scaled up in one breeding season.
Thus, in one aspect the present invention provides
a method of producing a transgenic non-human mammal
comprising: (a) introducing a nucleus from a non-human
mammalian somatic cell into a functionally enucleated oocyte
that has been pretreated with ethanol, said functionally
enucleated oocyte being from the same species as said
somatic cell and being in the metaphase II stage of meiotic
cell division, and said nucleus from said somatic cell
comprising at least one recombinant nucleic acid sequence
under the control of at least one promoter sequence, to form
a reconstructed embryo; and (b) allowing the reconstructed
embryo from step (a) to develop into a mammal, thereby
providing the transgenic non-human mammal.
In another aspect the present invention provides a
method of making a transgenic non-human mammal comprising:
(a) fusing a non-human mammalian somatic cell capable of
expressing a transgenic protein with a functionally
enucleated oocyte that has been pretreated with ethanol,
said functionally enucleated oocyte being from the same
species as said somatic cell and being in the metaphase II
stage of meiotic division, and the nucleus from said somatic
cell containing at least one recombinant nucleic acid
sequence to obtain a reconstructed embryo; (b) activating
the reconstructed embryo from step (a); (c) transferring the
activated reconstructed embryo from step (b) into a female
non-human mammalian recipient; and (d) allowing the
- 3a -
CA 02431859 2005-06-27
50409-13D(S)
transferred reconstructed embryo from step (c) to develop
into a mammal, thereby providing the transgenic non-human
mammal .
In another aspect the present invention provides a
method of making a transgenic non-human mammal comprising:
(a) fusing a non-human mammalian somatic cell capable of
expressing a transgenic protein with a functionally
enucleated oocyte, said functionally enucleated oocyte being
from the same species as the somatic cell and being in the
metaphase II stage of meiotic division, and the nucleus from
said somatic cell containing at least one recombinant
nucleic acid sequence to obtain a reconstructed embryo; (b)
activating the reconstructed embryo from step (a); (c)
maintaining the activated reconstructed embryo from step (b)
in culture until the embryo is in the 2- to 8-cell stage of
embryogenesis; (d) transferring the 2- to 8-cell stage
reconstructed embryo from step (c) into a female non-human
mammalian recipient; (e) allowing the transferred
reconstructed embryo from step (d) to develop into a mammal
thereby providing the transgenic non-human mammal.
In another aspect the present invention provides a
method of producing a transgenic non-human mammal
comprising: (a) introducing a nucleus from a non-human
mammalian somatic cell into a functionally enucleated
oocyte, said functionally enucleated oocyte being from the
same species as said somatic cell and being in the metaphase
II stage of meiotic cell division, and said nucleus from
said somatic cell comprising at least one recombinant
nucleic acid sequence under the control of at least one
promoter sequence, to form a reconstructed embryo; (b)
transferring said reconstructed embryo to a non-human
mammalian recipient when said reconstructed embryo is in the
- 3b -
CA 02431859 2005-06-27
50409-13D(S)
2- to 8-cell stage of embryogenesis; and (c) allowing said
reconstructed embryo to develop into a mammal, thereby
providing the transgenic non-human mammal.
The generation of transgenic animals, e.g.,
transgenic goats, by nuclear transfer with somatic cells has
the additional benefit of allowing genetic
- 3c -
CA 02431859 2003-06-20
WO 00/26357 1'~'T/TJS99125'710
manipulations that are not feasible with traditional rnicroinjcction
approaches.
Foz example, nuclear transfer with somatic cells allows the introduction of
specific mutations, or even the targeting of foreign genes directed to
specific sites
in the genome solving the problem of integration position effect. Homologous
recombination in the dotaor s~r~aatic cells can °'knock-out" or replace
the
endogenous protein, e.g., a endogenous goat proteira, to lower purification
costs _.
of heterologous proteins expressed in milk and help to precisely adjust the
animal
bioreactors.
In general, the invention features a method of providing a cloned non-
human tiiammal, e.g:, a cloned goat. The methods below are described for
goats,
but can be applied for ~nli ror~-laurrnn mammal. The method includes:
introducing a ca~rine ger~orrac from a caprine.somatic cell into a caprine
oocyte,
preferably a naturally matured telopha~e oocyte, to form ~ reconstructed
embryo;
t 5 an'd allowing the reconstructed embryo to develop into a goat, e.g:, by
introducing
the reconstructed embryo into a recipient doe, thereby providing a goat.
In one embodimeait, the nucleus of the caprine somatic cell is introduced
into the caprine oocyte, e.g., by direct nuclear injectior$ or by fusion,
e.g.,
electrofusion, of the soriiatic cell with the oocyte:
In preferred eynbodiment, the goat develops from the reconstructed
embryo. In another embodiment, the goat is a descendant of a goat which
developed from the reconstructed embryo.
In a preferred eubodiment: the somatic cell is non-quiescent {e.g., the cell
is activated), e.g., the somatic cell is in G, stage. In another preferred
embodiment, the somatic cell is quiescent (e.g., the cell is arrested),.e.g.,
the
somatic cell is in G~ stage. In a preferred embodiment, the somatic cell is an
embryonic somatic cell, e.g., the somatic cell is an embryonic fibroblast. The
somatic cell can be any of: a fibroblast (e.g., a primary fibroblast), a
muscle cell
(e.g., a myocyte), a cumaxlus cell,.a neural cell or a mammary cell.
-4.
CA 02431859 2003-06-20
V1'O 00126357 PCTlUS99/25710
In a preferred embodiment; the oocyte is a frmction~lly enucleated oocyte,
e.g., an enucleated oocyte. In a preferred embodiment, the oocyte is in
metaphase
II; the oocyte is in telophase; the oocyte is obtained using an in vivo
protocol; the
oocyte is obtained using an. in vivo.protocol to obtain an oocyte which is in
a
desired stage of the cell cycle' e.g., metaphase II or telophase; the oocyte
is
activated prior to or simultaneously with the introduction ~f the genome. In
another preferred emb~diment, the o~cyte and somatic cell are synchronized,
e.g.,
both the oocyte and somatic cell are activated or both the oocyte and somatic
cell
are arrested:
In a preferred embodiment, the method further includes mating the goat
which develops from the reconstructed embryo with a second goat. A second
goat can be a normal goat, a second goat which devel~ps from a reconstructed
embryo or is descended.from a goat which developed from a reconstructed
embryo or a second goat developed from a reconstructed embryo, or descended
from a goat which developed from a reconstructed embryo, which was formed .
from genetic material from the same animal, ~n animal of the same genotype, or
same cell line, which supplied the genetic material for the first goat. In a
preferred embodiment, a first transgenic goat which develops from the
reconstructed embryo can be mated with a second transgenic goat which
2U tleveiOpeC1 fiom a. re~onStrllCteC1 emDryO anQ whlC:h LOI'liatri5 a
different iaagtsg2ne
that the first transgenic goat.
In a preferred embodiment, the goat is a male goat. In other preferred
embodiments, the goat is a female goat. A female goat can be induced to
lactate
and milk can be obtained from the goat.
In a preferred embodimento a product, e.g., a protein, e.g:, a recombinant
protein, e.g:; a human protein, is recovered from the goat; a product, e.g., a
protein, e.g., a human protein, is recovered from the milk, urine, hair,
bI~od, skin
or meat of the goat.
_5_
CA 02431859 2003-06-20
WO 00126357 PC'i'/TJS99125710
In another aspect, the invention features a method of providing a
transgeriic non-human tnamrnal, e.g., a transgenic.goat. The methods below are
described for goats, but can be applied for any non-human anamxnal. The method
includes: introducing a genetically engineered caprine genome of a caprine
somatic cell into,a caprine oocyte, preferably a naturally matured telophase
oocyte, to form a reconstructed drnbryo; and allowing the reconstnacted embryo
_e
to develop into a goat, e.g., by introducing the xeconstructed embryo into a
recipient doe; thereby providing ~ transgenic goat.
In one embodiment, the nucleus of the genetically engineered caprine
somatic cell is introduced into the caprine oocyte, e.g., by direct,nuclear
injection
or by fusion, e.g., electrofusion, of the somatic cell with the oocyte.
In preferred embodiment, the goat develops from the se~onstn~cted
embryo. In. another embodiment, the goat is a descendant of a g~at which
developed from the reconstructed embryo.
In a preferred embodiment: the somatic cell is non-quiescent (e.g., the cell
is activated), e..g., the somatic cell is in (~, stage. In another preferred
embodiment, the somatic cell is quiescent (e.g.,-ihe cell is arrestEd), e.g.,
the
somatic cell is in Go stage. In a preferred embodiment; the somatic cell is an
embryonlC SOmatlC Cell, e.g., the somatic cell is an, embryonic fibroblast. A
2o somatic cell can be any of: a fbroblast (e.g., a primary fibroblast), a
muscle cell
(e.g., a myocyte), a cumulus cell, a neural cell or a mammary cell.
In a preferred embodiment, a transgenic sequence has been introduced
into the somatic cell; the somatic cell is from a cell liras, e.g:, a primary
cell line;
the somatic cell gs from a cell line and a transgenic sequence has been
insexted
into the cell.
In a preferred emlaodiment, the oocyte is a functionally enucleated oocyte,
e.g., an enucleated ~ocyte.
In a preferred embodiment, the oocyte is in metaphase II; the oocyte is in
telophase; the oocyte is obtained using an in vivo protocol; the oocyte is
obtained
using an in vivo pr~tocol to obtain an oocyte which is in a desired stage of
the cell
-6-
CA 02431859 2003-06-20
WO 00!26357 1~~:'1'~599125710
cycle, e.g., metaphase II or telophase; the oocyte is activated prior to or
simultaneously with the.introduction of the genetically engineered genome. In
another preferred embodiment, the oocyte and somatic cell are synchronized,
e.g.,
both the oocyte and the somatic cell are activated or both the oocyte and
somatic
cell are arrested.
In a preferred embodiment, the method furtlher includes mating the _.
transgenic goat which develops from the reconstructed embryo with a second
goat. The second goat can be a normal goat, a seccmd goat which develops from
a reconstructed embryo or is descended from a goat which developed frorrfr a
reconstructed embryo or a seeond goat developed from a reconstructed embryo,
or descended from a goat which developed from a reconstructed embryo, which
was formed from genetic material frorzr the same animal, an animal of the same
genotype, or same cell line, which supplied the genetic material for the first
goat.
Ima preferred embodiment, a first trarisgenic goat which develops from the
reconstructed embryo can be mated with a second transgenic goat which
developed from a reconstructed embryo and which contains a different transgene
than the first transgenic goat.
In a preferred embodiment, the goat is a m;~Ie goat. In other preferred
embodiments the goat is a female goat. A female goat can be induced to lactate
z0 and milk can be oniained from the goat.
In a preferred embodiment: a product, e.g.,. a protein, e.g., a recombinant
protein, e.g., a human protein, is recovered from the goat; a product, e.g., a
protein, e.g., a human protein, is recovered from tl~e milk, urine, hair,
blood, skin
or meat of the goat.
In a preferred embodiment, the caprine genome of the somatic sell
includes a transgenic sequence. The transgenic sequence can be any of
integrated into the genome; a heterologous transgene, e.g., a human transgene;
a
knockout, knockin or other event which disrupts the expression of a caprine
gene;
m a sequence which encodes a protean, e.g., a human protein; a heterologous
30. promoter; a heterologous sequence under the coni~ol of a promoter, e.g., a
caprine
_7_
CA 02431859 2003-06-20
WO 00126357 P°C't'IlQJS99/25710
promoter. The transgenic sequence care encode any product of interest such as
a. .
protein, polypeptide or peptide. A protein can be any of: a hormone, an
iminunoglobulin, a plas~iaa protein, and era enzyme. The transgenic sequence
car!
encode any protein whose expression in the transgenic goat is desired
including,
but not limited to, any of a-1 proteinase inhibitor, alkaline phosphotase,
angiogenin, extracellular superoxade clisrnutase, fibrogen,
glucocerebrosidase, ..
glutamate decarboxylase, humaru seaym albumin, myelin basic protein,
proinsulin,
soluble CD4, lactoferrin, lactoglobulin, lysozyme, lactoalbumin,
erythapoietin,
tissue plasminogen activator, human growth factor; antithrombiri III, insulin,
prolactin, and al-antitrypsiri.
In a preferred embodiment, the transgenic sequence encodes a human
protein.
In a-preferred embodiment, the caprine genome includes a heterologous
transgenic seguence.under the control of a promoter, e.g., a caprine
promoter..
The promoter can be a tissue-specific promoter. The tissue specific promoter
can
be any of milk-specific promoters; blood-specific promoters; muscle-specific
promoters; neural-specific promoters; skin-specific promoters; hair-specific
promoters; and urine-speci~°ic prorrioters. The rrlilk-specific
promoter can be any
of. a casein promsiter9 a beta lactogl~bulin promoter, a whey acid protein
promoter and a lactaUumin promote.
In another aspect, the invention features a method of making or producing
a non-human mammal, e.g., a goat, e.g., a cloned ~r transgenic goat. The
methods
below are described for goats; but can ~e applied for any non-human matrimal.
The method includes fusing, e.g., by electrofusi~n, a caprine sorriatic cell,
e.g., a
caprine somatic cell capable of expressing a transgenic protein, with an
erlucleated c~prine oocyte, preferably a naturally matured telophase oocyte,
to
obtain a reconstructed embryo; activating the reconstructed embryo;
transferring
the embryo int~ a recipient doe; and allowing the embryo to develop into a
goat.
_g_
CA 02431859 2003-06-20
w0 00/26357 1'~T~JS9gI25710
In a preferred embodiment, the goat develops from the reconstructed
embryo. In another embodiment, the goat is a descendant of a goat which
developed from the reconstructed embryo. .
In a preferred embodiment, the somatic cell is an embryonic somatic cell.
A somatic cell can be any of: a ~broblast (e.g., a primaary fibroblast), a
muscle
cell (e.g., a myocyte), a cumulus cell, a neural cell ox a mammary cell. In a
..
preferred embodiment, the somatic cell is a non-quiescent cell (e.g., the cell
is
activated), e:g., the somatic cell is ira G, stage, e.g., in G, prior to
START. In
another preferred embodiment, the somatic cell is a quiescent cell (e.g., the
cell is
arrested), e.g., the somatic cell is in Go stage.
In a preferred embodiment, the oocyte is in metaphase II: Alternatively,
the oocyte is in telophase. In either embodiment, the oocyte is activated
prior to
or simultaneously with the introduction of the genome. In a preferred
embodiment; the oocyte is obtained using an in vivo protocol; the oocyte is
obtained using an in vivo protocol to obtain an oocyte which is in a desired
stage
of the cell cycle, e.g., metaphase II or telophase.. In a preferred
embodiynent, the
oocyte and somatic cell are synchronized, e.g., both the oocyte. and somatic
cell
are activated or both the oocyte and somatic cell are arrested.
In a preferred embodiment: a transgenic sequence has been introduced
~0 into the somatic ceii; the somatic ceii is from. a ceii line, e.g., a
primary c;eil iir~d;
the somatic cell is from a cell line and a transgenic sequence has been
inserted
into the cell.
In a preferred embodiment, the method further includes mating the goat
which develops from the reconstructed embryo witlh a second goat. A second
goat can be a normal goat, a second goat which develops from a xeconstructed
embryo or is descended from a goat which developed from a reconstructed
embryo or a second goat developed from a reconstructed embryo,. or is
descended
from a goat which developed from a reconstructed embryo, which was formed
from genetic material from the same animal, an animal of the same genotype, or
3Q . same cell Line, which supplied the genetic material for the first goat.
In a
CA 02431859 2003-06-20
WO 00/263x7 1''C'f/U599/25710
preferred embodiment, a first transgenic goat which develops from the
reconstructed embryo can be mated with a second transgenic goat which
developed from a reconstructed embryo and which contains a different transgene
than the first transgenic goat.
In a preferred embodirhent, the goat is a male goat. In other preferred
embodiments, the goat is a female g~at. I~ female goat can be induced to
lactate
and milk can be obtained frorri the goad.
In a preferred embodimerbt: a product, e.g., a protein, e.g., a recombinant
protein, e.g., a human protein, is recovered from.the goat; a product, e.g., a
protein, e.g., a human protein, is recovered from the milk, urine, hair,
blood, skin
or meat of the goat.
In a preferred embodiment,: the caprine genome of the soraiatic cell
includes a transgenic sequenee. The transgenic sequence can be any of
integrated into the genome; a heterologous transgene, e.g., a human transgene;
a
knockout; knockin or other event which disrupts the expression of a caprine
gene;
a seyaence which Pncoc_les a protein, e.g., a human protein; a heterologous
promoter; a heterologous sequenee under the control of a promoter, e.g.; a
caprine
promoter. The transgenic sequence can encode any product of interest such as a
protein; a polypeptide, or a peptide. A protein can be any of: a hormone, an
iinmunoglobulin, a plasma protein, and an enzyme.. i~he transgenic sequence
can
encode any protein whose expression in the transgenic goat is desired
including,
but not limited to any of a.-1 proteinase inhibitor, alkaline phosphotase,
angiogenin, extracellular superoxide dismutase, fibrogen; glucocerebrosidase;
glutamate rlecarboxylase, human serum albumin, myelin basic protein,
proinsulin,
soluble CD4, lactoferrin, lactoglobulin, lysozyme, lactoalbumin,
erythrpoietin,
tissue plasminogen activator,,human growth factor, antithrombin III, insulin,
prolactin, and al-antitrypsin.
In a preferred embodiment, the transgenic sequence encodes a human
protein.
_t~_
CA 02431859 2003-06-20
s
WO 00/2b357 PCTltJS99J25710
In a preferred embodiment, the caprine genome comprises a heterologous
transgenic sequence under the control of a promoter, e.g., a caprine promoter.
The
promoter can be a tissue-specific promoter. The tissue specific promoter can
be
any o~ milk-specific promoters; blood-specific promoters; muscle-specific
b . prorrioters; neural-specific promoters; stein-specific promoters; hair-
specific
promoters9 and urine-specific promoters. . The milk-specific promoter can be
any ..
of: a casein promoter, a beta lactoglobulin promoter, a whey acid protein
promoter and a lacfalbumin promoter.
The invention also includes a non-human ani.nial made by any of the
methods described herein. The methods described for goats can be applied for
any non-human mammal. Accordingly, in another aspect, the invention features
a cloned goat, or descendant thereof, obtained by introducing a caprine genome
of
a caprine'somatic cell into a caprine oocyte, preferably a naturally matured
75 telophase oocyte, to,a obtain reconstructed embryo and allowing the
reconstructed embryo to develop into a goat.
In a preferred embodiment, the caprine genc~me can be frown an embry~nic
somatic Belt. A somatic cell can be any of: fibroblast (e.g., a primary
fibroblast),
a muscle cell (e.g., a myocyte), a cumulus cell or a riiamrnary cell. In a
preferred
embodiment, the somatic cell is a non-quiescent cell (e.g. the cell is
activated),
e.g., the somatic cell is in G, stage, e.g., in G, prior to START. In another
preferred embodiment, the somatic cell is a quiescent cell (e.g., the cell is
arrested), e.g:, the somatic cell is in Ga stage.
In a preferred embodiment, the caprine oocyte can be a functionally
enucleated oocyte, e.g., an enucleated oocyte.
In a preferred embodiment, the oocyte is in metaphase II; the oocyte is in
telophase; the oocyte is obtained using an in vivo protocol; the oocyte is
obtained
using an in vtvo protocol to obtain an oocyte which is in a desired stage of
the cell .
cycle, e.g., metaphase II or telophase; the oocyte i s activated prior to or
simultaneously with the introduction of the genome. In a preferred embodiment,
-1 i-
CA 02431859 2003-06-20
WO Q0/2b357 PC'flUS99i257i~
the oocyte and somatic cell,are synchronized, e.g., both the oocyte and
somatic
cell are activated or both the oocyte and somatic cell are arrested. _ .
In a preferred embodiment, the caprine genorne can be introduced by
fusing; e.g., by electrofusion, of a somatic cell with the functionally
enucleated
oocyte.
In another aspect, the invention features one, or more, .e.g.; a population
having at least one male and one female, cloned goat, each cell of which has
its
chromosomal genome derived from a caprine somatic cell, wherein said caprine
somatic cell is from ~ goat other than cloned goat.
In a preferred embodiment, the chromosomal genome can be from an
embryonic somatic cell. A somatic cell can be any of: a fibroblast (e.g., a
primary- fibroblast), a muscle cell (e.g., a myocyte), a neural cell, a
cumulus cell
or a mammary celi. In a preferred embodiment, the somatic cell is a non-
quiescent cell (e.g., the cell is activated), e.g., the Somatic .,211 is in ~,
stage, ;,.g.,
in G, prior to ST1~IZT. In another preferred embodiment, the somatic cell is a
quiescent cell (e.g., the cell is arrested), e.g., the somatic cell is iii Cso
stage.
In another aspect, the invention features a transgenic goat, or descendant
r_hP,,~of5 obtained by iz~txoducing a caprine genome of a genetically
engineered
caprine somatic cell into a caprine oocyte, preferably a naturally. matured
telophase oocyte, to obtain a reconstructed embryo and. allowing the
reconstructed embryo to develop int~ a goat.
In a preferred embodiment, the caprine genome can be from an embryonic
soanatic cell. In another preferred emb~diment, the caprine genome can be
froara a
caprine fibroblast, e.g:, an embryonic fibroblast.
In a preferred embodiment, the caprine oocyte can be a functionally
enucleated oocyte; e.g., an enucleated oocyte.
In a preferred embodiment, the oocyte is in metaphase II; the oocyte is in
telophase; the oocyte is obtained using an in viyo protocol; the oocyte is
obtained
~~2-
CA 02431859 2003-06-20
WO 00/26357 PCTltIS9~/25710
using an ifi vivo protocol to obtain an oocyte which, is in a desired stage of
the cell
cycle, e.g., metaphase TI or telophase; the oocyte is activated prior to or
simultaneously with the introduction of the genome. lai a preferred
embodiment,
the oocyte and the somatic cell are synchronized, e.g., both the oocyte and
the
somatic cell are activated or both the oocyte and the somatic cell are
arrested.
In a preferred embodiment, the caprine genome can be introduced by
fusing, e.g., by electrofusion, of a somatic cell with the functionally
enucleated
oocyte.
In a preferred embodiment, the caprine genome of the somatic cell
includes a transgenic sequence. The transgenic sequence can be any of:
integrated into the genome; a heterologous transgenc~, e.g., a human
transgene; a
knockout, knockin or other event which,disrupts the expression of a caprine
gene;
a sequence which encodes a protein, e.g., a human. protein; a heterologous
promoter; a heterologous sequence under the control of a promoter, e.g., a
caprine
promoter. The transgenic sequence can encode a protein which can be arty ~f a
hormone, an immunoglobulin, a plasma protein, an enzyme, and a peptide. The
transgenic sequence can encode any product of interest such as a protein, a
polypeptide or a peptide. A protein which can be any protein whose expression
in the transgenic goat is desired including, but not limited to any of a-I
, .proteinase inhibitor, aikaiine phosphotase, angiogenin, extraceiiulare
s~iperoxide
dismutase, fibrogen, glucocerebrasidase, glutamate decarboxylase, human serum
albumin, myelin basic, protein; proinsulin, soluble (~~4, lactoferrin,
lactoglobulin;
lysozyme, Iactoalbumin, erythrpoietin, tissue plasminogen activator, hmnan
grovth.factor, antithrombin III, insulin, prolactin, and ocl-antitrypsin.
In a preferred embodiment, the transgenic sequence encodes a human
protein.
In a preferred embodiment; the caprine genome comprises a heterologous
transgenic sequence under the control of a promoter, e.g., a caprine prombter.
The
promoter can be a tissue-specific .promoter. The tissue specific promoter can
be
any of milk-specific promoters; blood-specific promoters; muscle-specific
-13-
CA 02431859 2003-06-20
WO 00126357 PC"I'/U~991257t0
promoters; neural-specific promoters;, skin-specific promoters; hair-specific
promoters; and urine-specific promoters. The milk-specific promoter can be any
of: a casein promoter, a beta lactoglobulin promoter, a whey acid protein
promoter and a Iactalbumin promoter. .
In another aspect, the invention features a transgenic goat, each cell of ..
which has its chromosomal genome derived from a genetically engineered
caprine somatic ccll, wherein paid caprine somatic cell is from a goat other
than
said transgenic goat.
In a preferred embodiment, the chromosomal genome can be from an
embryonic somatic cell. In another preferred embodiment, the chromosomal
genome can be from a caprine .flbroblast, e.g., an embryonic fibroblast.
In a preferred embodiment, the chromosomal genome of the soriiatic cell
includes a transgenic sequence. The transgenic sequence can be any of-.
integrated into the genorne; a heterologous transgene, e.g., a human
transgene; a
knockout; knockin or other event which disrupts the expression of a caprine
gene;
a sequence vcihich encodes a protein,.e.g., a hur~nan protein; a heterologous
promoter; a heterologous sequence under the control of a promoter, e.g., a
caprine
promoter. The transgenic sequence can encode amy product of interest such as a
20 , protein, a polypeptide and a peptide. ~ ~roteiti can be aroy of: a
hormone, an
immunoglobulin, a plasma protein, an enzyme, and a peptide. The tiarisgenic
sequence can encode any protein whose expression in the transgenic goat is
desired including, but not limited to any of: a.-1 proteinase inhibitor,
alkaline
phosphotase, angiogenin, extracellular superoxide dismutase, fibrogen,
25 glucocerebrosidase, glutamate decarbokylase, human serum albumin, myelin
basic protein, proinsulin, soluble CD4, lactoferrin, lactoglobulin, lysozyme,
.
lactoalbumin, erytlirpoietin, tissue plasminogen activator, human growth
factor,
antithrombin III, insulin, prolactin, and ocl-antitrypsin.
In a preferred embodiment; the transgenic sequence encodes a human ,
30 protein.
-t 4-
CA 02431859 2003-06-20
!v0 00126357 ~e'~~599/25710
In a preferred embodiment, the chromosomal genorne comprises a
heterologous transgenic sequence under the control of a promoter, e.g., a
caprine
promoter. The promoter can be a tissue-specific promoter. The tissue specific
promoter can be any of milk-specific promoters; blood-specific promoters;
muscle-specific promoters; neural-specific promoters; skin-specific promoters;
hair-specific promoters; and urine-specific promoters. The milk-specific --
promoter can be any of a casein promoter, a beta laci:oglobulin promoter, a
whey
acid protein promoter and a lactalbumin promoter.
In another aspect; the invention features a goat made by mating a goat
which developed from a reconstructed embryo ~rnade; as described herein) with
a
second goat.
In a preferred embodiment: the second goat developed from a
reconstructed embryo or is descended-fi-om a goat which developed from a
reconstructed embryo; the second goat developed from a t°econstxucted
embryo,
or is descended from a goat which developed from a reconstructed embryo, which
was formed from genetic material from the same animal, an animal of the same
genotype, or same cell Line, which supplied the genetic material fox the first
goat.
In a preferred embodiment, a first transgenic goat which develops from the
Gu i~econ~t~c=ui~te~ eYfiW yCa ca~5'C~e ~~aicd ivitii a SeGvi'ad irnna"genii,
goat which
developed from a reconstructed embryo and which contains a different transgene
than the first transgenic goat.
In another aspect, the invention features a plurality of fransgenic goats
obtained by mating a goat which developed from a reconstructed embrym with a
second goat.
In a preferred embodiment: the second goat developed from a
reconstructed embryo or is descended from a goat v~rhich developed from a
reconstructed embryo; the second goat developed from a reconstructed embryo,
or is descended from a goat which developed from ~~ reconstructed embryo,
which
-15-
CA 02431859 2003-06-20
WO 00!26357 ~C'TAIJS99/257t~
was formed from genetic material fr~m the same animal, an animal of the same
genotype, or same cell line, which supplied the genetic material for the first
goat. ,
In a preferred embodiment, a first g~at which developed from a reconstructed
embryo can be mated avith a second goat which developed from a reconstructed
embryo and which contains a different transgene than the first goat:
In yet another aspect, the invention features a method of providing a
transgenic goat which is hom~zygous for a transgenic sequence. The method
includes providing a somatic veil which is heterozygous for a transgenic
10. sequence; alloying somatic.~ecombination to occur so as to produce a
somatic
cell which is homozygous for the transgenic sequence; introducing the genome
from the somatic cell which is homozygous for the transgenic sequence into a
caprine oocyte, preferably a naturally matured telophase oocyte, to fore a
reconstructed embryo; and allowing the reconstructed embrya~.to develop into a
95 . goat, e.g:, by introduci~ag the reconstrzcted e~nhr~r:~ into a recipient
doe, thereby
providing a transgenic goat dvlcich is homozygous for a transgeriic sequence.
In another aspect, the invention features a transgenic goat which is
homozygous for a transgenic sequence.
2o In a preferred embodiyraent, the transgenic goat was made by introducing
the genome frown the sorttatic cell which is homozygous for the transgenic
sequence into a caprine. oocyte, preferably a naturally matured telophase
o~cyte,
to form a reconstructed embryo; and allowing the reconstructed embryo fo
develop into a goat.
In another aspect, the invention features a method of making a cloned
non-human mammal, e.g., a goat, cow, pig, horse, sheep, Llama, camel. The
method includes providing an activated oocyte, e.g., an oocyte in telophase
stage,
preferably a naturally matured telophase oocyte; fianctionaliy enucleating the
. oocyte; introducia~g the chromosomal genome of a somatic cell into the
CA 02431859 2003-06-20
CVO 00126357 t'C'6'1U599/25710
functionally enucleated oacyte to obtain a reconstructed embryo; and allowing
the reconstructed embryo to develop ,e.g., by introducing the reconstructed
embry~ into a recipient doe, thereby making a: cloned mammal.
In a preferred embodiment, the mammal, e.g., a goat, develops from the
. recorsstructed embryo. In another embodiment, the mammal, e.g., a goat, is a
descendant of a mammal, e.g., a goat which developed from the reconstrezcted
..
embryo:
In a preferred embodiment, the somatic cell is an embryonic somatic cell.
In a preferred embodiment the somatic cell is a fibrobiast, e.g., an embryonic
fibroblast. In a preferred embodiment, the somatic cell is a non-quiescent
cell
(e.g., the cell is activated), e:g., the.somatic cell is in G, stage, e.g:, in
G, prior to
START. In another preferred embodiment, the somatic cell is a quiescent cell
(e.g:, the cell is arrested), e.g., the somatic cell is in Go stage.
In a preferred embodiment, the oocyte is. activated prior to or
simultaneously with the introduction of the genorne. In a preferred
emb~diment,
the oocyte is obtained using an in vivo protocol, e.g., the oocyte is obtained
using
an in vivo protocol to obtain an oocyte which is in a desired stage of the
cell
cycle, e.g., metaphase Il or telophase. In a preferred embodiment, the oocyte
and
somatic cell are synchronized, e.g., both the oocyte ,and somatic cell are
activated
or both the oocyte and somatic cell are arrested.
In a preferred embodiment, the chromosomal genome of the somatic cell
is introduced into the oocyte by fusion, e.g., electrofusion, or by direct
injection
of the nucleus into the oocyte, e.g., microinjection.
In another aspect, the invention features a cloned non-human mammal,
e.g., a goat, cow, pig, horse, sheep, llama,' camel, obtained by functionally
enucleating an activated oocyte, e.g., an oocyte in telophase, and introducing
the
chromosomal genome of a somatic cell into the enu.cleated oocyte, preferably a
nat<irally matured telophase ~ocyte, to form a reconstructed embryo; and
allowing
17_
CA 02431859 2003-06-20
WO 00/26357 P'C't'1US99l257t0
the reconstructed embryo to develop, e.g., by introducing the reconstructed
embryo into a recipient mammal.
In a preferred embodiment, the oocyte is obtained using an in vivo
protocol, e.g., the oocyte is obtained using an in viv~ protocol t~ obtain an
oocyte:
which is in a desired stage of the cell cycle, e.g:,. telophase.
In another aspect, the invention features a reconstructed non-human
mammalian embryo, e.g., a goat, cow, pig, horse, sheep, llama, camel embryo,
obtained by functionally enucleating an activated oocyte, e.g., an oocyte in
telophase, preferably a naturally ax~atured telophase oocyte, and introducing
the
chromosomal genome of a sorr~atic cell into the enucleated oocyte.
In a preferred embodiment, the oocyte is obtained using an in vivo
protocol; the oocyte is obtained using an irp vivo protocol to obtain an
oocyte
which is in a desired stage of the cell cycle, e.g., telophase
In yet another aspect, the invention features a method of making a
transgeriic non-human mammal, e.g., a goat, cow, pig, horse, sheep, llama,
camel.
The method includes providing an activated oocyte, e.g., an oocyte in
telophase
stage, preferably a naturally matured telophase oocyte; functionally
enucleating
1 .-7_..,. s L,..-.~..,ni~, 7 ~ n~ o nsa ca4tn 11 7 Pt1 afi'~PPYPf~
Lo tile f5o(:ylG; ~it'Lr~uuc.ti3g cftc i,atavaaavsvaiaaa byenv~me va a
gvnv...vt~... 3 ....g~.
somatic cell into the functionally enucleated oocyte to obtain a reconstructed
eri~bryo; and allowing the reconstructed embryo to develop, e.g.; by
introducing
the reconstructed embryo into a recipient female, such that a transgenic
mammal
is obtained.
25 In a preferred embodira~ent, the maynmal develops from the reconstructed
embryo. In another embodiment, the mammal is a descendant of a mammal
which developed from the reconstructed embryo.
In a preferred embodiment, the somatic cell is an embryonic somatic cell.
In another preferred embodiment, the somatic cell is a fibroblast, e.g., an
3o embryonic fabrolalast. In a preferred embodiment, the somatic cell is a non-
_~ g_
CA 02431859 2003-06-20
W~ OU126357 P~T/tJS991257I0
quiescent cell (e.g., the cell is activated), e.g., the somatic cell is in G,
stage, e.g.,
in G, prior to START. In another preferred embodiment, the somatic cell is a
quiescent cell (e.g., the cell is arrested), e.g., the somatic cell is in. Go
stage.
In a preferred embodiment, the oocyte is activated prior to or
simultaneously with the introduction of the genuine. In a preferred
embodiment,
the oocyte is obtained using an io vivo protocol, e.g.; the oocyte is obtained-
using
an in vivo protocol to obtain an oocyte which is in a desired stage of the
cell
cycle, e.g., telophase. In a preferred embodiment, the; oocyte and somatic
cell are
synchronized, e.g., both the oocyte and somatic cell acre activated or both
the
oocyte and somatic cell are arrested. In a preferred embodiment, the
chromosomal genome of the somatic cell is introducc;d into the oacyte by
fusion,
e.g., electrofusion, or by direct injection of the nucle~xs into .the oocyte,
e.g.,
microinjection.
In a preferred embodiment, the nucleus ofthe somatic cell comprises a
transgenic sequence. The. transgenic sequence can be any of: integrated intcs
the
genome; a heterologous transgene, e.g., a human transgene; a knockout, knockin
or other event which disrupts the expression of a caprme gene; a sequence
e~Jhich
encodes a protein, e.g.; a human protein; a heteroIogous promoter; a
heterologous
sequence under the control of a promoter, e.g., a caprine promoter. The
2o transgenic sequence can encode any product of inierest such as a protein, a
polypeptide and a peptide. A protein can be any of a hormone, an
immunoglobulin, a plasma protein, and an enzyme. The transgenic seqi.~ence can
encode any protein whose expression in the transgenic mammal is desired
including, but not limited to any of: a.-1 proteinase inhibitor, alkaline
25 phosphotase, angiogenin, extracellular superoxide dismutase; fabrogen;
giucocerebrosidase, giutarirnate decarboxylase, human serum albumin, myelin
basic protein, proinsulin; soluble CDR, Iactoferrin, lactoglo~ulin, lysozyme,
lactoalbumin, erythrpoietin, tissue plasminogen activator, human growth
factor,
antithrombin III, insulin, prolactin, and a.l-antitrypsin.
_1g_
CA 02431859 2003-06-20
WO OOI2b3S7 . YCT/U~a991257t0
In a preferred embodiment, the transgenic sequence encodes a human
protein. _
In a preferred embodiment, the chromosomal genome comprises a
heterologaus transgenic sequence under the control of a promoter, e.g., a
mammalian-specific promoter, e.g.; a caprine promoter. The promoter can be a
tissue-specific promoter. The tissue specific promoter can be any of: mills-
specific promoters; blood-specific promoters; muscle-specific promoters;
neural-
specific promoters; skin-specific promoters; hair-specific promoters; and
urine-
specific promoters. The milk-specific promoter can be any of: a casein
promoter,
a beta lactoglobulin promoter, a whey acid protein promoter and a lactalbumin
promoter.
In another aspect, the invention features a transgenic non-human mammal,
e.g:, a goat, cow, pig, horse, sheep; llama, cannel, made by functionally
t5 erlucleating an activated oocyte, e.g., an oocyte.in telophase, preferably
a
naturally matured telophase ~ocyte, and introducing the chromosomal genome of
a genetically engineered sorna~ic cell into the enucleated oocyte td form a
reconstructed embryo and alloying the reconstructed embryo to develop, e.g.,
by
introducing the reconstructed embryo int~ a recipient axyam~nal.
In a preferred embodiment, ft~e oocyte is obtained using an iiuvivo
protocol, e.g., the oocyte is obtained using an iri vivo protocol to obtain an
oocyte
which is in a desired stage of the cell cycle, e.g., telophase.
In another aspect; the invention features a reconstructed non-human
mammalian embryo, a:g., a goat, cow; pig, horse,,sheep, llama, camel embryo,
obtained by functionally enucleating an activated oocyte, e.g., an oocyte in
telophase, preferably a naturally matured telophase oocyte, and introducing
the
chromosomal genome of a genetically engineered somatic cell into the
enucleated
oocyte.
-20-
CA 02431859 2003-06-20
WO 00/2657 T'OT/tJS99/2571d
In a preferred embodiment, the oocyte is obtained using an in vivo
protocol, e.g., the oocyte is obtained using an ifr vivo protocol to obtain an
odcyte
which is in a desired stage of the cell cycle, e.g.; telophase.
In yet another aspect, the invention features a vrrrethod of making a cloned
non-human mammal, e.g., a goat, cow, pig, horse, sheep, llama, camel. The _.
method includes providing an oocyte, preferably a na~t~~rally matured
telopliase
oocyte; functionally enucleating the oocyte; introducing the chromosomal
genome of a omatic cell into tlZe functionally enucleated oocyte to ~btain a
reconstructed embryo, wherein the oocyte is activated prior to or
simultaneously
with the introductiorq ofthe chromosomal genome; introducing the reconstructed
embryo into a recipient mammal; and allowing the reconstnacted embry~ to
develop, thereby making a cloned mammal.
In a preferred embodiment, the mammal develops from fhe reconstructed
75 embryo. In another embodiment, the mammal is a descendant of a mamrilal
~~~hich developed from floe reconstructed embryo.
In a preferred embodiment, the somatic cell i;> an embryonic cell. In
another preferred embodiment, the somatic cell is a fibroblast; e.g., an
embryonic
fibroblast. In a preferred embodiment, the somatic cell is a non-quiescent
cell
(e.g., the cell is activated), e.g., the somatic cell is in C.~, stage, e.g.,
iri G, prior to
START. iri another preferred embodiment, the somatic cell is a quiescent cell
(e.g., the cell is arrested), e.g., the somatic cell is iri (3o stage. In
another preferred
embodiment, the oocyte. is ain enucleated oocyte.
In a preferred embodiment, the oocyte is in metaphase II; the oocyte is in
telophase; the oocyte is obtained using an in vivo prot~col, e.g., the.oocyte
is
obtained using an in vivo protocol to obtain an oocyte which is in a desired
stage
of the cell cycle, e.g., telophase. In a preferred embodiment, the oocyte and
somatic cell are synchronized, e.g.; both the oocyte and somatic cell are
activated
or both the oocyte and SOmatlG Cell are arrested.
-21-
CA 02431859 2003-06-20
WC? 00/2635'7 ~C'TIUS99I257t0
In a preferred embodiment, the chromosomal genome of the somatic cell
is introduced into the oocyte by fusion, e.g., electrofusion, or by direct
injection
ofthe nucleus into the Qocyte, e.g., microinjection.
In another aspect, the invention features a cloned non-human mammal,
e.gs~ a goat, cow, pig, horse, sheep, llama, carnal, made try functionally _.
enucleating a mammalian oocyte, preferably a naturally matured telophase
oocyte, and activating the oocyte prior to or simultaneously ~.vith the
introduction
of the chromosomal genome of a somatic cell into the enucleated oocyte.
In yet another aspect, the invention features a. reconstructed non-human
mammalian embryo, e.g., a goat, core, pig, horse, sheep, llama, camel embryo,
obtained by functionally enucleating a mammalian oocyte; preferably a
naturally
matured telophase oocyte, and activating the oocyte prior to and/or
simultaneously vrith tfe intrnduetis~l~ of the chromosol~la~ genolne of a
somatic
cell into the enueleated oocyte:
In another aspect, the invention features a method of making a transgenic
non-human mammal, e.g., a goat, cow, pig, horse, sheep; llama, camel. The
2o method'includes providing an oocyte, preferably a naturally matured
telophase
oocyte; functionally enueleating the oocyte°, introducing the
chromosomal
genonie of a genetically engineered. somatic cell into the fiznctionally
enucleated
oocyte to obtain a reconstructed embryo, wherein the oocyte is activated prior
to
or simultaneously with the introduction of the chromosomal genome; and
25, allowing the reconstructed embryo to develop, e.g., by introducing the
reconstructed embryo into a recipient mammal, such that a transgenic mammal is
obtained.
In a preferred embodiment, the mammal develops from the reconstructed
embryo. In another embodiment, the mammal is a descendant of a mammal
30 ~ which developed from the reconstructed embryo.
-22-
CA 02431859 2003-06-20
w~ oons~s~ rcTr~s~gias~lo
In a preferred embodiment, the somatic cell is an embryonic samatic cell.
In another preferred embodiment, the somatic cell is a fibroblast, e.g., an
embryonic fibroblast. In a preferred embodiment, the somatic cell is a rion-
quiescent cell (e.g., the cell is activated), e.g., the somatic cell is in G,
stage, e.g.,
in G, prior to START. In another preferred embodiment, the somatic cell is a
quiescent cell (e.g., the cell is arrested, e.g., the somatic cell is in Go
stage. In ..
another preferred embodiment, the oocyte is an enucleated oocyte
In a preferred embodiment, the oocyte is in metaphase II; the oocyte is in
telophase; the oocyte is obtained using an in vivo protocol; the oocyte is
obtained
using an i~z viva protocol to obtain an oocyte which is in a desired stage of
the cell
cycle, e.g., metaphase Il or telophase; the oocyte is activated prior to or
simultaneously with the introduction of the genome. In a preferred embodiment,
the oocyte and somatic cell are synchronized, e.g., both the oocyte and the
somatic cell are activated or both the oocyte and somatic cell are arrested.
In a preferred embodiment, the chromosomal genome of the somatic cell
is introduced into the oocyte by fusion, e.g., electrofu.sion, ar by direct
injection
ofthe nucleus into the oocyte, e.g., rrlicroinjection.
In a preferred embodiment, the nucleus of the somatic cell comprises a
trarisgenic sequence. The transgenic sequence can beg any of: integrated into
the
genome; a heteroiogous transgene, e.g., a human transgene; a knockaui,
knuc;kin
or other event which disrupts the_expression of a caprine gene; a sequence
which .
encodes a protein, e.g., a human protein.; a heterologous promoter; a
heterologous
sequence under the control of a promoter, e.g., a tissue-specific promoter.
The
transgenic sequence can encode any product of interest such as a protein, a
polypeptide and a pepride. A lirotein can be any of a hormone, an
immunoglobulin, a plasma protein, and an enzyme. The transgenic sequence can
encode a protein whose expression in the transgenic mammal is desired
including, but not limited to any of: oe-1 proteinase inhibitor, alkaline -.
phosphotase, angiogenin, extraceliular superoxide dismutase, fibrogen,
30: glucocerebrosidase, glutamate decarboxylase, human senzm albumin, myelin
-23-
CA 02431859 2003-06-20
WO 00!26357 ~'~T/1I~99/25710
basic pratein, proinsulin, solaable ~D4, lactoferrin, lactoglobulin, lysozyme,
lactoalbumin, erythrpoietin, tissue plasminogen activator, Human growth
factor,
antithrombin III, insulin, prolactin, and a 1-antitrypsin.
In a preferred embodiment, the transgenic sequence enc~des a human -
protein.
In a preferred embodiment; the chromosomal genome comprises a
heterologous transgenic sequence under the control of a promoter, e.g:, a
mammalian-specific promoter; e.g., ~. caprine promoter: °The promoter
can be a
tissue-specific promoter. q'he tissue specific promoter can be any-of: triilk-
specific.promoters; blood-specific promoters; muscle-specific .promoters;
neural-
specific promoters; skin-specifie pr~moters; hair-specific pramoters;.and
urine-
specific promoters. The milk-specific promoter can be any of. a casein
promoter,
a beta lactoglob~alin promoter, ~ whey acid protein promoter and a lactalbumin
promoter.
In another aspect, the inventiort features a transgenic non-human mammal,
e.g., a goat, cow, pig, horse, sheep, llama, camel; made by functi~nally
enucleating a mammalian oocyte, preferably a naturally matured tc;lophase
oocyte, and activating the oocyte prior to or simultaneously with the
introduction
of the chromosomal genc~me of a genetically engineered somatic cell into the
enucleated oocyte.
In yet another aspect, the invention features a reconstructed non-human
mammalian embr<,~a, e.g:, a goat, cow, pig, horse, sheep, llama, camel
err~bryo,
obtained by functionally enucleating a mammalian oocyte,.preferably a
naturally
matured telcrphase oocyte, and activating the oocyte.prior to or
simultaneously
with the introductioxi of the chromosomal genome of a genetically engineered
somatic cell into the enucleated oocyte.
-
CA 02431859 2003-06-20
vv~ oa~263s~ ~~~-r~~~~ns7~o
The invention also includes a product, e.g., a protein, e.g:, a heterologous
protein, described herein obtained from a nan-human mammal, e:g., a cloned or
trarisgenic rriarnrnal, e.g., a cloned or transgenic goat, described herein.
In a preferred embodiment, product is milk or a pratein secreted into milk.
In another aspect, the invention features a method of providing a protein,
e.g., a human protein. The method includes: providing anon-human mammal,
e.g., a transgenia mammal, e.g., a transgenic goat; described herein; and
recovering the product from the mammal, or from a product, e.g., milk; of the
mammal.
In another aspect, the in~~en~ion features a me~tr~od of providing a
heterologous polypeptide. The methods-includes introducing a caprine genome,
e.g., by introducing a nucleus; of a genetically engineered caprine somatic
cell
into a caprine oocyte, preferably a naturally matured telophase oocyte, to
form a
reconstructed embryo; allowing the reconstructed eit~ibryo to develop into a
goat,
e.g., by introducing the reconstructed erhbryo into a recipient doe; and
recovering .
the polypeptide Pram the goat or a descendant thereof.
In a preferred embodiment, the nucleus of the: caprine somatic cell is
introduced into the caprine oocyte, e.g., by direct nuclear injection ~r by
fusion,
2t? . e.g., electrofusion, of the somatic cell with the oocyte.
In a preferred embodiment: the somatic cell is anon-quiescent cell (e.g.,
the cell is activated), e.g., the somatic cell is in G, stage, e.g., in G,
prior to
START. In another preferred embodiment, the somatic cell is a quiescent cell
(e.g., the cell is arrested), e.g:, the somatic cell is in d:~o stage. In a
prefera-ed
embodiment, the samatic cell is an embryonic somatic cell, e.g., an embryonic
fibroblast. The somatic cell can be a fibroblast (e.g.., a primary
fibroblast), a
muscle cell (e.g., a myocyte), a neural cell, a cumulus cell or a mammary
cell.
In a preferred embodiment, a transgenic sequence has been introduced
into the somatic cell; the somatic cell is from a cell line, e.g., a primary
cell line;
-25-
CA 02431859 2003-06-20
WO 00!26357 t'CTltJS9~lz~7i6D
the somatic cell is from a cell line and a transgenic sequence has been
inserted
into the cell.
In a preferred embadinmn~, the oocyte is a functionally enucleated oacyte,
e.g;, an enucleated oocyte.
In a preferred embodiment, the oocyte is in metaphase II; the oocyte is in
telophase; the oocyte is abtained using an iaa vivo protocol; the oocyte is
obtained .~
using an in vevo protocol to obtain an oocyte which is in a desired stage of
the cell
cycle, a:g., metaphase II or talophase; the oocyte is activated prior to or.
simultaneously with the introductioa~ of the genome. In a preferred
embodiment,
the oocyte and the somatic cell are synchronized, e.g., both the oocyte and
the
somatic cell are activated or both the ooeyte and the somatic cell are
arrested.
In a preferred embodiment, the caprine genome of the somatic cell
includes a transgenic sequence. The transgenic sequence can be any of:
integrated into the genome; a heterologous transgene, e.g., a human transgene;
a .
knockout, knoclcin or o'iner event which disrupts the expression of a caprine
gene;
a sequence which encodes a protein, e.g., a human protein; a heterologous
promoter; a heterologous sequence under the control of a promoter, e.g., a
caprine
promoter. The transgenic sequence can encode any product of interest including
a protein, a polypeptide and a peptide, A protein can be any of: a hormone, an
im???ay_n_oglol?olin, a plassrxa pxotein, aid axc_ enayrue, Tb~e tsansgex~ic
sequence cart
encode any protein whose expression in the txansgenic goat is desired
including,
but not limited to any of a.-I proteinase inhibitor, alkaline phosphotase,
angiogenin, extracellular supcroxide dismutase, frbrogen, glucocerebrosidase,
glutamate decarboxylase, human senzm albumin, myelin basic protein,
proinsulin,
soluble CD4, lactoferrin, lactoglobulin, lysozyme, lactoalbumin,
erythxpoietin,
tissue plasminogen activator, human growth factor, antithrombin III, insulin,
pralactin,,arid cxl-antitrypsin.
In a preferred embodiment, the transgenic sequence encodes a human
protein.
-2~-
CA 02431859 2003-06-20
'WfJ 00/2635? PC'1"/1J~99/25710
lri a preferred embodinxent, the caprine genoinc; comprises a heterologous
transgenic sequence under the control of a promoter, e.g., a caprine promoter.
The
promoter can be a tissue-specific promoter. The tissue specific promoter can
be
. any of: milk-specific promoters; blood-specific promoters; muscle-specific
promoters; neural-specific promoters; skin-specific promoters; hair-specific
promoters; and urine-specific promoters. The milk-specific promoter can be any
..
of: a casein promoter, a beta Iactoglobulin promoter, a whey acid protein
promoter and a lactaibumin prompter.
In another aspect, the invention features a method of making a
heterologous polypeptide. The method includes fusi;rag a genetically
engineered
caprine somatic cell which comprises a transgene encoding a heterologous
polypeptide and a milk-specific promoter, with an enucleated caprine oocyte,
preferably a naturally matured telophase oocyteg to obtain a reconstructed
15 embryo; and allowing the reconstructed erribryo to develop into .a
~rar~sgcnic goat,
P.g., by introducing the reconstructed embryo into a :recipient doe:
In a preferred embodiment, the transgene is operatively linked to the milk-
specific promoter. The milk-specific promoter can ~~e any of: a casein
promoter,
a beta lactoglobulin promoter, a whey acid protein promoter and a, lactalbumin
20 promoter. .
~n a preferred embodiment, the nucleus of the caprine somatic cell is
introduced into the caprine oocyte, e.g., by direct nuclear injection or by
fusion,
e.g., electrofusion, of the somatic cell with the oocyt e.
In a preferred embodiment, the somatic cell ::is an embryonic somatic cell.
25 In another preferred embodiment, the somatic cell is a fibroblast; e.g., an
embryonic fibroblast.-
Tn a preferred embodiment, the oocyte is a functionally enucleated oocyte,
e.g., an enucleated oocyte.
In a preferred embodiment, the oocyte is in metaphase II; the oocyte is in
~~ telophase; the oocyte is obtained using an in vivo protocol; the oocyte is
obtained
-2T-
CA 02431859 2003-06-20
WO ~0126357 P~~'/U5991257i8
using an in vivo protocol to obtain an, oocyte which is in a desired stage of
the cell
cycle, e.g., metaphase II or telophase; the oocyte is activated prior to or
simultaneously with the introduction of the genorr~.e. In a preferred
embodiment,
the oocyte and the sornatie cell are synchronized, e.g., both the oocyte and
the
somatic cell are activated or both the oocyte and the somatic cell are
arrested. .
In a preferred errabodiment, the caprine genome of the somatic cell --
includes a transgenic sequence. The transgenic sequence can be any of:
integrated into the ger~ome; a heterologous transgene, e.g,, a human
transgene; a
knockout, knockin or other even'c wvhich disrupts the expression of a caprine
gene;
a sequence which encodes a protein, e.g., a human protein; a heterologous
promoter; a heterologous sequence under the control of a promoter, e.g., a
caprine
promoter. The transgenic sequence can encode any product of interest such as a
protein, a polypeptide or a peptide. l~ protein can be any of a hormone, an
immunoglobulin, a plasma protein, an erizyme. The trar~sgenic sequence can
encode a protein whose expression in the-transgenic goat is desired including,
'out
not limited'to any of: a-1 p~oteinase inhibitor, alkaline phosphcitase,
angiogenia~,
extraceliular superoxide dismutase, fabrogen, glucocerebrosidase, glutamate
decarboxylase, human serum ,albumin, myelin basic protein, proinsulin, soluble
CD4, lactoferrin, lactogiobulin, lysozyme, lactoalbumin, erythrpoietin, tissue
7~1 pia_cmi_n_ngg~i a~tzva_tngi ~~~~~,n growth fa~tn_r~ antitl~gr~_rn__hi_n
IIh i~cpl_ir_~3 ~_rnl_~r_.fia_t, .
and oc1-arttitrypsin.
In a preferred embodiment, the txansgenic sequence encodes a human
protein.
In a preferred embodiment, the heterologous polypeptide is purified from
~ the milk of the transgenic goat.
In a preferred embodiment, the method can also include rrr~ilking the
trans.genic goat.
In another aspect, the irwention features a method of providing a
. heterologous polypeptide. Tl~e method includes obtaining a goat made by
-28-
CA 02431859 2003-06-20
wo aorz~~s°r ~~Tr~s~~~2s~~o
introducing a caprine genome of a genetically engineered caprine somatic cell
. into a caprine oocyte, preferably a naturally matured telophase oocyte, to
form a
reconstructed embryo; and alloying the: reconstructed embryo to develop into a
goat, e.g., by introducing the reconstructed embryo into a recipient d~e; and
recovering the polypeptide from the goat, e.g., from the milk of the goat, or
a
descendant thereof. _.
In a preferred embodiment, the caprine geno:rrze of the somatic cell
includes a transgenic sequence. Thc; transgenic. sequence can be any of:
integrated into the genome; a heterologous transgene, e.g., a human transgene;
a
knockout, knockin or other event which disrupts the expression of a caprine
gene;
a sequence which encodes a protein, e.g., a human protein; a l~eterologous
promoter; a. heterologous sequence under the control of a promoter, e.g., a
caprine
promoter. The transgenic sequence can encode any product of interest such as a
protein, a polypeptide and a peptide. A protein can be any of a horanone, an
immunoglobulin, a plasma protein, and an enzyme: The transgenic sequence can
encode any protein whose expression in the transgenic goat is desired
including,
but not limited to any of a.-1 proteinase inhibitor, alkaline phosphotase,
angiogenin, extracellular superoxide dismutase, fibrogen; glucocerebrosidase,
glutamate decarboxylase, human serum albumin, myelin basic protein,
proinsulin,
2o soluble t;u4, iactoferzrin, lactogiobuiin, iysozyrne, lactoaibumin,
etytrirpoieiiir,
tissue plasminogen activator, human growth factor, antithrombin III, insulin,
prolactin, and cxl-antitrypsin.
In a preferred embodiment, the transgenic sequence encodes a 'human
protein.
In a preferred ernbodirnent, the heterologous polypeptide is purred from
the milk of the transgenic goat.
In another aspect, the invention features method ofmaking a
reconstructed caprine embryo. The method includes introducing a caprine
-29-
CA 02431859 2003-06-20
1
dvc~ oorz6~s~ ~e~r~s~~rzs~~o
genorne from a caprine somatic cell into a caprine oocyte, preferably a
naturally
matured telophase oocyte, thereby forming a reconstructed embryo.
In a preferred embodiment: the somatic cell is a non-quiescent cell (e:g.,
the cell is activated), e.g.; the somatic Bell is in G, stage. .In, anothex
preferred
embodiment; the somatic cell is a. quiescent cell (e.g., the cell is
arrested), e.g.,
the somatic cell is in Ga stage. In a preferred embodiment, the somatic cell
is an -
embryonic somatic cell, e.g., are embryonic fibrol~last. The somatic cell can
be a
fibroblast (e.g:, a primary fibroblast~, a muscle call (e.g., a myocyte), a
neural
cell, a cumulus cell .ar a mammary dell.
In a preferred embodiment: the ~ocyte is in_ metaphase II; the oocyte is in
telophase; the oc~cy~e is obtained easing an in viv~ pros~col; the occyte is
obtained
using an in viva protocol to obtai~a an oocyte which is in a desired stage of
the cell
cycle, e.g., metaphase II of telophase; the oocyte is enucleated. In a
preferred
erribodiment; the oocyte and the soanatic cell are synchronized, e.g., both
the
oocyte and the somatic cell aro activated or both the oocyte and the somatic
cell
are arrested.
In yet another aspect; the invention features a reconstructed capriiae
embryo obtained by inCroducing a capririe genome from a caprine somatic cell
2o into a caprine oocyte, preferably a naturally matured telophase oocyte.
In another aapect,, the invention features a method ofnnaking a
reconstructed trans~enic caprine embryo. 'fhe anethod includes introducing a
caprine genome, e.g_, by introducing a nucleus, of a genetically engineered
2~ caprine somatic cell into a eaprine ~~cyte, preferably a naturally matured
telophase oocyte, thereby forming a transgenic reconstructed embrya.
In a preferred ernbodirnent the somatic cell is a non-quiescent cell ~i.e.,
the cell is activated), e.g., the somatic cell. is in G; stage. in another
preferred
embodiment, the sorna.tic cell is a quiescent cell ~a.e., the cell is
arrested), e.g., the
30 somatic cell is in GQ stage. In a preferred embodiment, the.samatic cell is
an
~30-
CA 02431859 2003-06-20
WO 04/26357 t'CTigJS99I2571U
embryonic somatic cell, e.g.,. an embryonic fibroblast: The somatic cell can
be a
fibroblast {e:g., a prirriary fibroblast), a muscle cell (e.g., a rnyocyte>, a
neural
cell, a cumulus cell or a mammary cell.
In a preferred embodiment: the oocyte is in metaphase II; the oocyte is in
. telophase; the oocyte is obtained using an in vivo protocol;-the oocyte is
obtained
using an are vivo protocol to obtain an omcyte which is in a desired stage of
the cell --
cycle, e:g., metaphase II or telophase; the oocyte is enuclea~ed. In a
preferred
embodiment, the ooeyte and the somatic cell are syrmhronized, e.g:, both the
oocyte and fhe somatic cell are activated or both the oocyte and somatic cell
are
arrested.
In another aspect; the invention features a reconstructed transgenic caprine
embryo obtained by introducing a caprine genome, e.g., by introducing a
nucleus,
of a genetically engineered caprine somatic cell into a caprine oocyte,
preferably
a naturally matured telophase oocyte.
Iri another aspect, the invention features a method of providing a herd of
goats. The method includes making a first goat by :introducing a caprine
genome;
e.g., by introducing the nucleus, from a caprine omatic cell into a caprine
oocyte,
~,r, o~ r"i.,t. +" tt f, a +..t.. t.: t ,.. r ~,-...<aod ,~~."t,..«o
Gv prv.tama4.a~l a'nasuramy Waa~tlr~"u a~:avptaaS2 vvvy e, w mi~"ii a
reCOiass.aw.m o.asavay
and allowing the reconstructed embryo to develop into the first goat; making a
second goat by introduciing a caprine genorne, ~e.g., by introducing the
nucleus,
from a caprine somatic cell into a caprine oocyte, preferably a naturally
matured,
telophase oocyte, to form a reconstructed embryo and allowing the
reconsiructed
embryo to develop into the second gout; whereby the genome of the first and
second goats aie from the genetic material of the same anneal, same genotype
or
same cell line, thereby providing a herd of goats.
In a preferred embodiment, the first goat, or' descendant thereof, is mated
with the second goat or a descendant thereof.
_31_
CA 02431859 2003-06-20
WO OOI26357 PCT//tJS99125?nc~
In another aspect, the invention features a herd of gaats,obtained by
making a first goat by introducing a capririe genome, e.g., by introducing the
nucleus, from a caprine somatic cell into a caprine oocyte, preferably a
naturally
matured teloplzase oocyte, to form a reconstructed ernt~ryo and.allowing the
reconstructed embryo to develop into the first goat; making a second goat by
introducing a caprirde genome, ~.g.; by introd~acirig the nucleus; from
a.capririe
somatic cell into a caprine oocyte to form a reconstructed embryo and
allovsring
the reconstructed e~nb~yo to develop into the second goat; whereby the genorue
of
the first and second goats are from the genetic material of the same animal,
same
90 genotype or same cell line.
In a preferred embodiment, the herd of goats is obtained by any of the
methods described herein.
In another aspect, the invention features, an embryonic or fetal caprine
somatic cell.
Ire a preferred em~bodin~aea~t, the cell is a purified embryonic or fetal
cagrine somatic cell.
In a preferred embodiment, the cell is in a preparation of embryonic, or
fetal caprine somatic cells.
In a-preferred embodiment, -the cell can be used to derive an embryonic or
fetal caprine somatic cei't line.
Xn a preferred eynbodiment, the cell includes a transgene, e.g., a transgene
encoding a polypeptide. 'hhe transgene can be: integrated into the genome of
the
satnatic cell; a heterologous transgene,.e.g., a heterologous transgene which
includes a human sequence; a knockout, knoekin or other event which disnapts
the expression of a caprine gene; a sequence which encodes .a protein, e.g., a
human protein; a heterologous promoter; a heterologous sequence under the
control of a promoter, e.g., a caprine promoter: The transgenic sequence can
encode a product of intexest such as a protein, polypeptide ar peptide.
CA 02431859 2003-06-20
CVO flfl/26~57 PC'fItJS99/2571fl
W a preferred embodiment; the transgene encodes any of. a hormone, an
imrnunoglobulin, a plasma protein, and an enzyme: 'the transgene can encode,
- e.g:, any of a-1 proteinase inhibitor, alkaline phospl~~ofase; angiogenin,
extracelluiar superoxide dismutase, fibrogen, glucocc:rebrosidase, glutamate
decarboxylase, human serum albumin; myelin basic :protein, prainsulin, soluble
CT34; lactoferrin, lactoglobulin, lysozyrrie, lactoalliutnin,.erythrpoietih,
tissue
plasminogen activator, human growth factor, antithromlain III, insulin;
prolactin,
and al-antitrypsin.
In a preferred embodiment, the transgene is under the control of a
9 0 promoter, e.g., a heterologous or a caprine promoter.. The pramoter' can
be a:
tissuerspecific promoter. The tissue specific promoter can be ariy of a milk-
specific promoter; a blood-specific promoter; a muscle-specific promoter; a
neural-specific promoter; a skin-sp~cifc promoter; a hair specific promoter;
and,
a urine-specific promoter. The a ilk-specific promoter cai~ be, e.g., any of:
a Vii-
casein promoter; a ~-Iactoglobin promoter; a whey acid protein ~iornoter; aid
a
lactalbumin promoter.
In' a preferred embodiment, the somatic cell :°~s a fibroblast. 'I'he
fibroblast
can be a primary fibroblasf or a primary derived fibrobiasf.
In a preferred embodiment, the cell is obtained from a goat; e.g., an
embryonic goat, derived from a germ cell.obtained 4i'om a transgenic mammal.
The germ cell can be sperm from a transgenic goat.
In a preferred embodirr~ent, the cell is a genetically engineered embryonic
or fetal caprine somatic cell, e.g., a purified genetically engineered
embryonic or
fetal caprine somatic cell.
In a preferred embodiment, the cell is.part of a preparation of genetically
engineered embryonic or fetal caprine somatic cells. In another preferred
embodiment, the cell is used to derive a genetically engineered embryonic or
fetal
caprine somatic cell Line.
In a preferred embodiment, the genetically f;ngineered cell includes a
nucleic acid, e.g., a nucleic acid encoding a polype~atide, which has been
-33-
CA 02431859 2003-06-20
wo oorz63s~ pC~ius~~lzs~g~
introduced, into the cell. T'he nucleic acid can be: integrated into the
genome of
the somatic cell; a heterologous rfucleic acid, e.g., a heterologous nucleic
acid ,
which includes a human sequence; a knockout, knockin or other event which
disrupts the expression of a caprine gene; a sequence which encodes a protein,
~ e.g., a human protein; a hetezologous promoter; a heferologous sequence
under
the control of a promoter, e.g., a caprine promoter.- The .nucleic acid
sequence. can _.
encode any product of interest such as a protein, polypeptide or peptide.
Tn a preferred embodiment, the nucleic acid encodes atiy of a hormone,
an immunoglobuliri, a plasma protein, and an enzyme. -The nucleic acid can
10~ : encode, e.g., any of cx-1 proteinase inhibitor, alkaline phosphotase,
angiogenin,
extracellular superoxide dismutase, fibrogen, glucoceiebrosidase, glutamate
decarboxylase, human serum albumin, myelin basic protein, proinsulin, soluble
CD4, lactoferrin, lactoglobulin, lysazyme, lactoalbumin, erythrpoietin, tissue
plasminogen activator; human growth. factor, antithrombin iIl, insulin,
prolactin,
arid oil=antitrypsin.
In a preferred embodiment, the nucleic acid is under the control of a.
promoter, e.g., a caprine or heterologous promoter. The promoter can be a
tissue-
specific promoter. The tissue specific promoter can be any of a milk-specific
promoter; a blood-specific promoter; a rriuscle-specific promoter; a neural-
2t~ specific promoter; a skin-specific promoter; a hair specific promoter;
and, a urine-
specific promoter. The milk-specific promoter can be,,e.g_, any of a (3-
.casein
promoter; a ~i-lactoglobin promoter; a whey acid protein promoter; and a
lactalbumin promoter.
In a preferred embodiment, the somatic cell is a, fi~roblast. The fibroblast
can be a primary fibroblast or a primary derived fibroblast.
In a preferred embodiment, the cell is obtained from a goat, e.g., an
embryonic goat, derived from a germ cell obtained from a txansgenic goat. The
germ cell can be sperm or an ooeyte from.a transgenic goat.
Tri a preferred embodiment, the cell is used as a source of genetic material
far nuclear transfer
-
CA 02431859 2003-06-20
vvo oon6~s~ ~cTlus~~ns~lo
In another aspect, the invention features an embryonic or fetal caprine
' sar~atic cell, a preparation of cells, or an embryonic or fetal caprine
somatic cell
line, e.g.; as described herein,, in a container, e.g., an airtight or liquid
tight
container.
In another aspect, the invention features an e~,mbryonic or fetal caprine
somatic. cell, a preparation of cells, or an embryonic ar fetal caprine
somatic cell
line, e.g,, as described herein, which is. frozen, e.g., is cryopreserv~ed.
In another.aspect, the invention features a kit. The kit includes a container
of the cell or, cells described.herein. In a preferred embodiment, the kit
further
includes,instructions for use in preparing a transgenic animal
In a preferred embodiment; the kit furtherincludes a recipient oocyte, e.g.,
an enucleated oocyte.
In another aspect, the invention features a method for providing a
component for the production of a cloned or transgenic goat. The method
includes obtaining a frozen sample of the cell or cells, e.g., those described
herein, and thawing the sample.
In another aspect, the invention features, a method of .preparing an
embryonic or fetal caprine somatic cell line.. The method includes obtaining a
somatic cell.from.an embryonic or fetal goat; and; culturing the cell, e,g.,
in a
suitable medium, such that a somatic cell line is obtained.
In a preferred embodiment, the cell line is a. genetically engineered cell
line,. e.g., the cell comprises a transgene. The transgene can be; integrated
into
the somatic cell genome; a heteroiogous transgene, e.g., a heferologous
transgene
which includes a human sequence; a knockout, knockin or other event which
disrupts the expression of a caprine gene; a sequence which encodes a protein,
30. e.g., a human protein; a heterologotis promoter; a heterologous sequence
under
-35-
CA 02431859 2003-06-20
W~ 00126357 ~ t'~'t'~~99/257~0
the control of a promoter, e.g.,, a caprine promoter. The transgenic sequence
can -
encode ariy product of interest such as a protein, poiypeptide or peptide. .
In a preferred em'oodiment, the transgerie encodes any of: a hormone, an
imtnunoglobulin, a plasma protein, and an enzyrrie. The transgene can encode
any protein; e:g:, any of: 0:-1 proteinase inhibitor, alkaline phosphotase,
angiogenin, extracellular superoxide dismutase, ~brogen, glucocerebrosidase,
..
glutamate decarboxylase; human serum albumin, 'myelin basic p~oteii~,
proinsulin,
soluble CD4, lactoferrin, lacfbglobulin; lysozyme, lactoalbumin,
erythrpoietin,
tissue plaszninogen acti~~tor, human growth factor, antithrornbin III,
insulin,
prolactin, and oc 1-antitrypsin.
In a pref~~red ernbodiriient, the transgene is under the control off. a
promoter, e.g., a caprine or.hetei~ologous promoter: The promoter can be a
tissue
specific promoter. °fhe tissue specific promoter can be any of a milk-
specific
promoter; a blood-specifac pi~~moter, a muscle-specific promoter; a neural-
~5 specific p rorraoter; a skir~~speci~e pr~m,oter; a lair specify prompter;
and, a urine«
specific prornot~r. The milk-specific 'promoter can be, e.g., any of a ~3-
casein
promoter; a ~3-lactoglobin prorrfoter; a rwhey acid pratein promoter; and a
lactalbuinin promoter.
In a preferred eanbodiment, the genetically engineered cell includes a
nucleic acid, e.g., a nucleic acid encoding a polypeptide, which his been
introduced into the cell. Tlie nucleic acid care be: integrated into the
genome of
the somatic cell; a heterologous nucleic acid, e.g:, a heterologous nucleic
acid
which includes a human sequence; a knockout, knockin or other event which
disrupts the e~cpression of a caprine gene; a sequence which encodes a
protein,
e.g:, a human protein;.a heterologous promoter; a heterologous sequence under
the control of a promoter, e.g., a caprine promoter. The nucleic acid sequence
can
encode any product of interest such as a protein, polypeptide or peptide.
In a preferred embodiment, the nucleic acid can encode any of a
hormone, an immunoglobulin, a plasma protein, and an enzyme. The nucleic
acid can encode, e.g.; any of: c~-1 proteinase inhibitor; alkaline
phosphotase,
-36-
CA 02431859 2003-06-20
Wfl OOIZb357 PCTltJS99I25710
angiogeniti, extracellular superoxide dismutase, flbrogen; glucocerebrosida~e,
glutamate decaxboxylase, human serum albumin, myeiiri basic protein,
pxoinsulin,
soluble CD4, Iactoferrin, lactoglobulin, Iysozyme, lactoalbumln,
erythrpoietin,
tissue plasminogen activatoz, human growth factor, antithrornbin III, insulin;
prolactin, and ixl-antitrypsin.
in a preferred embodiment, the rfucleic.acid is under the control of a
promoter, e.g., a caprine or heterologous promoter. The promoter can be .a
tissue-
specific promoter; The tissue specific promoter can be any of a milk-specie
promoter; a blood-specific promoter; a muscle-specific promoter; a neural-
specific promoter; a skin-specific promoter; a hair specific promoter; and, a
urine-
specifie promoter. The rriilk-specific promoter can be, e.g., any of a [I-
casein
promoter; a ~3-lactoglobin promoter; a whey acid protein promoter; and a
lactalbumin promoter.
In a preferred embodiment, the sarnatic,cell is a Iibroblast. The.fibrobiast
can
~i 5 be a primary fibroblast or a primary derived fibroblast.
In a preferred emhodiment, the cell is obtained from a gaat, e.g., an
embryonic or fetal goat, derived from a germ cell obtained from a transgenic
goat. The germ cell can be sperm or an oocyte fronn a transgenic goat.
In a preferred embodiment, the cell is used as a source of genetic material
. for nuclear transfer.
In another aspect, the invention features, a method of preparing an
embryonic or fetal caprine somatic cell line. The method includes inseminating
a
female recipient with the semen fromv a goat; obtaining a transgenic, embryo
from
the recipient; obtaining a somatic cell from the embryo; and, culturing the
cell in
a suitable medium, such that a somatic cell line is obtained.
In a preferred embodiment, the semen is from a transgenic goat.
In a preferred embodiment, the cell line is a genetically engineered cell
line, e.g., the cell comprises 'a trans,gene. The transgene can be: integrated
into
the somatic cell genome; a heterologaus transgene, e.g., a heterologous
transgene
-37-
CA 02431859 2003-06-20
WO OOt26357 PC'T/~.7~9~/~~7t0
which includes a human sequence; a knockout, knoekin or other event which
disrupts the expression of a caprine gene; a sequence which encodes a protein,
e.g., a human protein; a heterotogous -promoter; a heteroiogous sequence under
the control of a promoter, e.g., a caprine promoter. The transgenic sequence
can
encode any product of interest such as a pxotein, polypepfide or peptide. .
In a preferred embodiment, tlae transgezie encodes any of: a horrraone9 an ..
immunoglobulin, a plasrria protein,. and an enzyme. The transgene can encode
any protein, e:g., any of oc-l; pxoteinase inhibitor, alkaline phosph4tase, -
angiogenin, extraceilular superoxide dismutase, flbrogen, glucocerebrosidase,
9.0 glutamate decarboxylase, human serum albumin, myeliwbasic protein,
proinsuliri,
soluble CD4, lactoferrin,.lactoglobulin, lysozyme, lactoalbumin,
erythrpoietin,
tissue plasminogeti activator, hurnari growth factor, antithroznbin III;
insulin,
prolactin, and a.l-antitzypsin.
In a preferred embodiment, the transgene is under the control of a
Z~ promoter, e:g., a capr~ne os heterologous promoter. The_ promoter can be a
tissue-
specific promoter.. The tissue specific pxornoter can be any of: a milk-
specific
promoter; a blood-specific promoter; a muscle-specific promoter; a neural-
specific promoter; a skin-specific promoter; a hair specific promoter; arid, a
urine-
specific pxomoter: The milk-specific promoter can be, e.g:, any of: a ~-casein
~0 promoter; a 6..lactoglobin promoter; a whey acid protein pr~moter; and a
lactalbumin promoter.
In a preferred embodiment, the genetically engineered cell includes a
nucleic acid, e.g., a nucleic acid encoding a palypeptide, which has been
introduced into the cell. °The nucleic acid can be: integrated into the
genome of
25 the-somatic cell; a heterologous nucleic acid, e:g., a heterologous nucleic
acid
which includes a human sequence; a knockout, knoclcin or other event which
disrupts the expression of a eaprine gene; a sequence, which encodes a
protein,
e.g., a human protein; a heterologous promoter; a heterologous sequence under
the control of a promoter, e. g., a caprine promoter. . The nucleic acid
sequence can a
3o encode any product of interest such as -a protein, polypeptide or peptide..
-38~
CA 02431859 2003-06-20
WO 00126357 l'CTffJS99/25710
In a preferred embodiment, the nucleic acid can encodes any of: a
hormone; an immunoglobulin, a plasma protein, and an enzyme: Tlie nucleic
. acid can encode, e.g., any of a.-1 proteinase inhibitor, alkaline
phosphotase,
_ angiogeniri,.extracellular superoxide dismutase, fibrogen,
glucocerebrosidase;
glutamate decarbaxylase, human serum albumin, myelin basic protein,
proinsulin;
soluble ~CD4, Iactoferrin, lactoglobulin, Iysozyme, lactc~lburi~in,
erythrpaietin, ..
tissue. plasminogen activator, human growth factor, antithrombin III, insulin,
prolactin, and al-antitrypsin.
In a preferred embodiment, the nucleic acid is under the control at' a
~o promoter, e.g., a caprine or heterologous promoter. The promoter can be a
tissue-
specific promoter. The tissue specific promoter can be any af: a milk-specific
promoter; a blood-specific promoter; a muscle-specific promoter; a neural-
specific promoter; a skin-specific promoter; a hair specific piomoter; and, a
urine-
specific promoter. The milk-specific promotef can be, e.g., any o~ a ~3-casein
promoter; a (3-lactoglobin promoter; a.whey acid protein promoter; and a
lactalburilin promater_ . . ,
In a preferred embodiment, the somatic cell is a fibroblast. , The fibroblast
can be a primary fibroblast or a primarjr derived fibroblast. .
In a preferred embodiment, the cell is used as a source of genetic material
z0 for nuclear transfer.
The present invention is also based, in part, on the discovery that a
reconstructed embryo which is transferred into a recipient mamrxial at th.e
two to
four cell stage of embryageriesis can develop into a cloned rnaminal. The
mammal can be an'embryo, a fetus, or a post natal mammal, e.g., an adult
marnimal.
Accordingly, in one aspect, the invention features a method of producing
a non-human mammal, e.g., a cloned mammal, e.g., a goat, cow, pig, horse,
sheep, llama, camel. The method includes maintaining a mammalian
reconstructed embryo, e:g.; a reconstructed embryo wherein the genarne is
_g9_
CA 02431859 2003-06-20
WO OOI26357 ~CT/US~9125710
derived from a somatic cell, in culture until the embryo is in the 2 to- 8
cell stage,
transferring the embryo, at the 2 to r cell stage into a recipient mammal, and
allowing the reconstructed embryo to develop into a mammal, to thereby produce
a mammal.
In a preferred embodiment, the mammal develops from the reconstructed
embryo. In another embodiment, the mammal is a descendarrt of a mammal
which developed from the roc~nstructed embryo.
In a preferred ernbodiar~ent, the reconstructed embryo is maintained in
culture until the embryo is in the 2 to 8, the 2 to 6, the 2 to 4 cell stage
of
embrycigenesis.
In a preferred emsbodiment, the genome of the reconstructed embryo is
derived from: a somatic cell, e.g., a fibroblast or epithelial cell; a
genetically
engineered somatic cell, e.g., a somatic cell comprising a tra.nsgenic
sequence.
in a preferred ert~bodirr~ent, the method further includes mating the
~ 5 mammal which develops from the reconstructed embryo with: a second
marnmal;
a second mammal which develops from a reconstructed embryo or is descended
from a mammal which developed from a reconstructed embryo; or a second
mamrn:al developed from a reconstructed embryo, or ~ieseended from a mammal
which developed from a reconstructed embryo, which was formed from genetic
r, ,-n,-;a1 F.-~~ ~3,~ gurn~ a::iTn~~, an anivn_ai of t_h_g catnP gPrinty pPi
nr c~,~nE ~e~l ine,
a'itawaa a as r=x.,.
which supplied the genetic material for the first mammal. In a preferred
embodiment, a first transgenic mammal which develops from the reconstructed
embryo can be mated with a second transgenic mammal which developed from a
reconstructed embryo and which contains a different transgene that the first
25 transgenic mammal.
In a preferred embodiment, the mammal is a male mammal. In other
preferred embodiments, the mammal is a female mammal. A female gnammal
can be induced to lactate and milk can be obtained from the mammal.
In a preferred embodiment: a product, e.g., a protein, e.g., a recombinant
35 protein, e.g., a human protein, is recovered from the mammal; a product,
e.g., a
-40-
CA 02431859 2003-06-20
wo oor~6~s~' ~~r~usg9r~swo
protein, e.g., a human protein, is recovered from the milk; urine, hair,
blood,. skin
or meat of the mammal..
In a preferred embodiment, the mammal is: embryonic; fetal; or,
postnatal, e.g.; adult.
. In a preferred embodiment, the genome of theneconstructed embryo is
derived from a genetically engineered somatic cell, e.g.,.a transgenic cell or
a cell ..
which a nucleic acid has been introduced.
In another aspect; the invention features a rilethod of producing a non-
1 o human mammal, e.g., a transgenic mammal, e.g., a l;oat, cow, pig, horse,
sheep,
llama, camel. The method.includes maintaining a mammalian reconstructed
embryo (e.g., a reconstructed embryo wherein its genome is derived from a ,
genetically engineered somatic cell) in' culture until the embzyo is in the 2
to 8
cell stage, transferring the embryo at the 2 to 8 cell stage into a recipient
riiammal; and allowing the reconstructed embryo to develop intb a mammal, to
thereby produce a transgenic mamrr~al.
In a preferred embodiment, the mammal develops from the reconstructed
embryo. In another embodiment, the mammal is a descendant of a mammal
which developed from the reconstructed embryo.
In a preferred erribodiment, the reconstructed embryo is maintained in
culture until the embryo is in the 2 to $, the 2 to 6, the 2 to 4 cell stage
of
embryogenesis.
In a preferred embodiment, the method further includes mating the
mammal which develops from the reconstructed embryo with; a second mammal;
a second mammal which develops from a reconstructed embryo or is descended
from a mammal which developed from a reconstrut;ted embryo; or a second
mammal developed from a reconstructed embryo, or descended from a mammal
which developed from a reconstructed embryo, which was formed from genetic
material from the same animal, an animal of the same genotype, ~r same cell
line,
which supplied the genetic material for the first mammal. In a preferred
-41-
CA 02431859 2003-06-20
wo oa~2~~s~ ~~~~~~~~ZS°r~a
embodiment, a first transgenic nrarrimal which develops from the reconstructed
embryo can be mated with a second ttansgenic mammal which developed from a
reconstructed embryo and which contains a different transgene that the first
transgenic mammal.
In a preferred embodiment, the mammal i5 a male mammal. In other
preferred embodiments, the mammal is a female mammal: f~ female mammal ..
can be induced to lactate and milk can be obtained from the mammal.
In a preferred embodirgient: a product, e.g., a protein, e.g., a recombinant
protein, e.g., a huriian protein, is recovered from the mammal; a product,
e.g., a
~0 protein, e.g., a human protein, is recovered from the milk, urine, hair,
blood, skin
or meat of the mammal.
In a preferred embodiment, the genome of the genetically engineered
somatic cell includes a transgenic sequence.. T'ne transgenic sequence can be
amy
of a-heterologous transgene9 e.g.9 a human tzan$gene; a,knockout, knockin or.
other event i~rhicl~ disrupts the expression of a mammalian gene; a sequence
which encodes a protein; e.g., a human protein; a heterologous promoter; a
heterolagous sequence under the control of a promoter, e.g., a caprine
promoter.
The transgenic sequence can encode any product of iiiterest.sucli as a
protein,
polypeptide or peptide.
In a preferred ernbodinaent, the transgenic sequence encodes any of a
hormone, an irnmunoglobulin, a plasma protein, and an enzyme. The transgenic
sequence can encode any protein whose expression in the transgenic rziamrrial
is
desired, e.g., any of: 0.-1 proteinase inhibitor, alkaline phosphotase,
angiogenin,
extracellular supeioxide dismutase, fibrogen, glucocerebrosidase; glutamate
decarboxylase, human serum albumin; myelin basic protein, proinsulin, soluble
CD4, lactoferrin, lactoglobuliri, lysozye, lactoalbumin, erythrpoietin, tissue
plasminogen activator; human growth factor, antithrombin III, insulin,
prolactin,
arid al-antitrypsin.
In a preferred embodiment, the transgenic sequence encades a human
protein.
~2~.
CA 02431859 2003-06-20
W~.00/26357 ~~TlL1S99125710
In a preferred embodiment,, the transgenic sequence is urgder the control of
a promoter, e.g., a caprine or heterologous prombter. The promoter-can be a
tissue-specific promoter. The tissue specific promoter can be any of: milk-
specific promoters; blood-specific promoters; muscle-specific prom~ters;
neural-
specific promoters; skin-specific promoters; hair-specific promoters; and
urine-
specific promoters. The milk-specific promoter can: be, e.g., any of: a casein
..
prom~ter, a beta lactoglobulin promoter, a whey acid protein promoter and a
lactalbumin promoter.
In a preferred embodiment, a.nucleie acid can be introduced into the
gename of the genetically engineered somatic cell. The nucleic acid can be any
of a heterologous transgene, e.g., a human transger~e; a knockout, knockin or
other event. which disrupts the expression of a mammalian gene; a sequence
which encodes a protein, e.g., a human protein; a heterologous promoter; a
heterologous sequence under the control of a promoter, e.g., a caprine or
heterologous promoter. The nucleic acid sequence can encode any product of
interest such as a protein, polypeptide or peptide. .
in a preferred embodiment, the nucleic acid encodes any of a hormone,
an immunoglobulin, a plasma protein, and an enzyme. The nucleic acid sequence
can encode any protein whose expression in the tra:nsgenic mammal is desired,
2o e.g., any of: a-i proteinase inhilsitor, W tcaiine phosophotase,
a:ngiugeyu,
extracellular superoxide dismutase, fibrogen, gluco~cer~brosidase, glutarraate
decarboxylase, human serum albumin, myelin basic pr~tein, proirisulin,
si~luble
CI?4, lactoferrin, lactoglobulin, lysozyme, 3actoalbumin, erythrpoietin,
tissue
plasrninogen activator, human growth factor, antithrombin III, ansulin,
prolactin,
25 and ocI-antitrypsin.
In a preferred embodiment, the nucleic acid sequence encodes a human
protein.
In a preferred embodiment, the nucleic acid sequence is under the control
of a promoter, e.g., a.caprine or heteroiogous pron:~oter. T'he.promoter carp
be a
30- tissue-specific promoter: The tissue specific promoter care be any of:
milk-
-43-
CA 02431859 2003-06-20
WO 00/26357 P~'rlUS99l25Tt0
specific promoters; blood~specific promoters; muscle-specific promoters;
neural-
.specific promoters; skin-specific promoters; hair-specific promoters; and
urine-
specific promoters. The milk-specific promoter can be, e.g., any of: a casein
promoter, a beta lactoglobulin promoter, a whey acid protein promoter and a
lactalbumin promoter.
In another aspect, the invention features a method of producing a cloned .
goat. The method includes maintaining a capriile reconstructed embryo (e.g., a
reconstructed embryo wherein its genome is derived from a capririe somatic
call)
in culture until the embryo is. in the 2 to 8 cell stage, transferring the
embryo at
the 2 to 8 cell stage unto a recipient goat, and allowing the reconstructed
embryo
to develop into a goat, to thereby produce a goat.
In a preferred embodiment, the goat is: embryonic; fetal; or, postnatal,
e.g:, adult.
In a preferred embodiment, the goat develops from the reconstructed
embryo. In another embodiynent, the goat is a descendant of a goat which
developed frown the reconstructed embryo.
In a preferred embodiment, the reconstructed embryo is maintained in
culture until the embryo is in the 2 to 8, the 2 to f, the 2 to 4 cell stage
of .
er!~brj ogenPC7C, ,
In a preferred embodiment, the genome of the reconstructed embryo is
derived from: a caprine somatic cell, e.g., a fibroblast or epithelial cell; a
genetically engineered caprine somatic cell, e,g., the genome 'of the caprine
.
somatic cell comprises a.transgenic sequence or a nucleic acid has been
introduced into tlae genome of the somatic cell.
In a preferred embodiment, the method further includes mating the goat
which develops from the reconstructed embryo with: a second goat;-a second
goat
which develops from a reconstructed embryo or is descended from a goat which
developed from a reconstructed embryo; or a second goat developed from a
30. reconstr acted embryo, or descended from a goat which developed from a
-44-
CA 02431859 2003-06-20
WD OOi263S7 ~c~rms~~~xs~ro
reconstructed embryo, which was formed from. genetic material from the same
animal, an animal of the same genotype, or same cell. Iine, vahich supplied
the
genetic material for the f rst goat. In a preferred embodiment, a- first
transgenic
goat which develops from the reconstructed embryo can be mated with a,sec~ind
transgenic goat which developed from a reconstructed embryo and which
contains a different transgene that the first transgenic; goat.
In a preferred embodiment, the goat is a male. goat. In other preferred
embodiments; the goat is a female goat. A female goat can be induced to
lactate
and milk can be obtained from the goat.
In a preferred embodiment: a product, e.g., a protein, e.g., a recombinant
protein, e.g., a human protein, is recovered from the goat; a pioduct, e.g., a
protein; e.g,, a human protein, is recovered from the milk, urine, hair,
blood, skin
or meat of the goat. .
In another aspect, the invention features a method of producing a
transgeriic goat. T'he method includes maintaining a. caprine reconstructed
embryo (e.g., a reconstructed embryo wherein its genome is derived from a
genetically engineered somatic cell) in culture until 'the embryo is in the ~
to 8
cell stage; transferring the embryo at the 2 to 8 cell stage into a recipient
goat, and
. allowing the reconstructed embryo to develop into a. goat, to thereby.
produce a
~n~genic goat.
In a preferred embodiment, the goat is: embryonic; fetal; or, postnatal,
e.g:, adult.
In a preferred embodiment, the goat develops from the reconstructed
embryo. Iri another embodiment, the goat is a descendant of a goat which
developed from the reconstructed embryo.
In a preferred embodiment, the reconstructed embryo is maintained im
culture until the embryo is in the 2 to 8, the 2 to b, the 2,to 4 cell stage
of
embryogenesis. - .
_45-
CA 02431859 2003-06-20
WO flfl~26357 ~C't'/CTS99125?t0
In a preferred embodiment, the genome of the reconstructed embryo is
derived from a somatic cell, e.g., a fibroblast or epithelial cell.
In a preferred embodiment, the method further includes mating the goat
which develops from the reconstructed embryo with: a second goat; a second
goat
which develops from a reconstructed embryo or is descended from a goat which
developed from a reconstructed embryo;.or a second goat developed from a
reconstructed embryo, ar descended from a gaat which developed from a
reconstructed embryri, which was formed from genetic material from the same
animal, an animal of the same genotype, or same cell Line, which supplied the
1 o : genetic material for the fzrst goat. In a preferred embodiment, a first
transgenic
goat which develops from the reconstructed embryo can be mated with a second
transgenic goat which developed from a reconstructed embryo and which
contains a different transgene that the first transgenic goat.
In a preferred embc~dirnent, the goat is a anale goat. In other preferred
embodiments, the goat is a female goat. A female goat can be induced to
lactate
and milk can be obtained from the goat.
In a preferred embodiment: a product, e.g., a protein, e.g., a recombinant
protein, e.g., a human proteixi, is recovered from the goat; a product, e.g.,
a
protein, e.g., a human lirotein, is recovered from the milk, urine, hair,
blood, skin
w or iiieat.of iii2 goat.
In .a preferred embodiment, the genome of the genetically engineered
somatic cell includes a transgenic sequence. The transgenic sequence cari be
any
of a heterologous traxisgene, e.g., a human transgene; a knockout, knockin or
other event which disrupts the expression of a mammalian gene; a sequence
which encodes a protean, e.g., a human protein; a heterologous promoter; a
heterologous sequence under the control of a promoter, e.g., a caprine or
heterologous promoter: the transgenic sequence can encode any product ~f
interest such as a protein, polypeptide or peptide. .
In a preferred embodiment, the transgenic sequence encodes any of a
hormone, an immunoglobulin, a plasma protein, and an enzyme. _ 'The transgenic
a~6_
CA 02431859 2003-06-20
WO 00!26357 PC'fItJS99125710
sequence can encode any protein whose expression in the transgenic mammal is
. desired, e.g., any of: a-I proteinase inhibitor, alkaline phosphotase,
angiogenin,
extracellular superoxide dismutase, ~brogen, glucoce;rebrosidase; glutamate
_ decarboxylase, human serum albumin, myelin basic protein, proinsulin,
soluble
CD4, lactoferrin, lactoglobulin, lysozyme, lactoalbumin, erythzpoietin, tissue
plasminogen activator, human growth .factor, antithrombin II I, insulin,
prolactin,
and a.l-antitrypsin.
In a preferred embodiment, the transgenic sequence encodes a human
protein.
In a preferred embodiment, the transgenic sequence is under the control of
a promoter, e.g., a caprine or heterologous promoter. The promoter can be a
tissue-specific promoter. The tissue specific promoter can be any of milk-
specific promoters; blood-specific promoters; muscle;-specific promoters;
neural-
specific promoters; skin=specife promoters; lair-specific promoters; and urine-
specific pFOmoters. The milk-specific promoter can be,. e.g., any of: a casein
promoter, a beta Iactoglobulin promoter, a ~vvhey acid protein promoter.and a
lactalbumin promoter.
In a preferred embodiment, a nucleic acid has been introduced into the
genome of the genetically engineered somatic cell. °I"he nucleic acid
sequence
can be any:of a heterologous transgene, e.g., a human transgene; a knockout,
knockin or other event which disrupts the expression of a mammalian gene; a
sequence which encodes a protein, e.g:, a human protein; a heterologous
promoter; a heterologous. sequence under the control of a promoter, e.g., a
caprine
or heterologous promoter. The txansge~ic sequence .can encode and product of
interest such as a protein, poIypeptide or peptide.
In a preferred embodiment, the nucleic acid encodes any of a hormone,
an immurioglobulin, a plasma protein, and an enzyme. The nucleic acid sequence
can encode any protein whose expression in the transgenic mammal is desired,
e.g., any of: a-1 proteinase inhibitor, alkaline phospliotase, angiogenin,
extracellular superoxide dismutase, fibrogen, glucocerebrosidase, glutamate
-47-
CA 02431859 2003-06-20
WO 00/26357 ~'~T/tJ~99/z57t~
decarboxylase, human serum albumin, myelin basic protein; proinsulin, soluble
CD4, lactoferrin, lactoglobulin, Iysozyrne, lactoalbumin, erythrpoietin,
tissue
plasminogen activator, human growth factor, antithrombin III, insulin,
prolactin,
and al-antitrypsin.
In a preferred embodiment, the nucleic .acid sequence encodes a lawman
protein. ..
In a preferred embodiment, the nucleic acid sequence is under the control
of a promoter, e.g., a caprine or heterologous promoter. The promoter can be a
tissue-specific promoter. The tissue specific promoter can be any ofo milk-
specific promoters; blood-specific promoters; muscle-specific promoters;
neural-
specific promoters; skin-specific promoters; hair-specific promoters; and
urine-
specific promoters. The milk-specific promoter can be, e.g., any of a casein
promoter, a beta lactoglobuiin promoter, a whey acid protein promoter and a
lactalbumin promoter.
In another aspect; the invention features a kit. The kit includes a
reconstructed embryo which is in the 2 to 8 cell stage. In a preferred
embodiment, the kit further includes instructions for producing a mammal,
e.g.,
an embryonic, fetal or postnatal mammal.
In another aspect, the invention features a kit which includes, a later stage
embryo, e.g., an embryo after the 8 cell stage, or a fetus, obtained, e.g., by
the
methods described herein.
As used herein, the term "functional enucleation'rrefers to a process of
rendering the endogenous genome of a cell; e.g., an oocyte, incapable of
functioning, e.g., replicating and/or synthesizing DNA. Such an oocyte is
referred to herein as a "functionally enucleated oocyte".
CA 02431859 2003-06-20
!V~ 00/26357 ~CTJUS99I25710
The terms protein, polypeptide and peptide a:re used interchangeably
herein.
As used, herein, the term "transgenio sequence" refers to a nucleic acid
sequence (e.g., encoding one of rnore human proteins), which is inserted by
artifice into a cell. The transgenic sequence, also referred to herein as a
transgene, becomes part of the genome of an animal which develops in whole or
in part from that cell. In embodiments of the invention, the transgenic
sequence
is integrated into the chromosomal genome. If the firansgenic sequence is
integrated into the genome it results, merely by virhde of its insertion, in a
change
in the nucleic acid sequence of the genome into which it is inserted. A
transgenic
sequence can be partly or entirely species-heterologous, i.e., the transgenic
sequence, or a portion thereof, can be from a species which is different from
the
cell into which it is introduced. A transgenic sequence can be partly or
entirely
species-homologous, i.e., the transgenic sequence, or a portion thereof, 'can
be
from the same species as is the cell into. which it is introduced. If a
trarisgenic.
sequence is homologous (in tlae sequence sense or in the species-homologous
sense) to an endogenous gene of the cell into which it is introduced, then the
transgenic sequence, preferably, has one or more of the following
characteristics:
. it is designed for insertion, or is inserted, into the ce;Il's genorrne iii
such a way as
to alter the sequence of the genome of the cell into which it is inserted
(e~g., it is
inserted at a location which differs from that of the endogenous gene or its
unsertion results in a change in the sequence of the endogenous endogenous
gene); it includes a mutation, e.g., a mutation which results in misexpression
of
the transgenic sequence; by virtue of its insertion, i~t can result in
misexpression
of the gene into which it is inserted, e.g.~ the insertion can result in a
knockout of
the gene into which it is inserted. A transgenic sequence can include one or
more
transcriptional regulatory sequences and any other :nucleic acid sequences,
such
as introns, that may be necessary for a desired level or pattern of expression
of a
3~ selected nucleic acid, all operably linked .to the selected nucleic acid. -
'file
CA 02431859 2003-06-20
WO OQ1263S7 PC'~'/US391257~~
transgenic sequence can include an enhancer sequence and or sequences urhich
allow for secretion.
The terms ''reconstructed embryo", "reconstituted embryo", "nuclear
transfer unit" and "nuclear transfer embryo" are used interchangeably herein.
As used herein, 'the term "normal goat" refers to a goat which did not
develop 'from a reconstructed. embry~.
1Q . A "naturally derived oocyte" is one which is allowed to reach a selected
stage, e.g., metaphase II or more preferably telophase, by culturing under
natural
conditions, e.g., in vivo. The term "natural, conditions" means the absence of
treatment of the oocyte with exogenously added chemicals, e.g:, ethanol, to
affect
. the stage of meiosis. In preferred embodiments, a naturally matured
preparation
can include metaphase sI, telopl-Aase or both.stages. The inventors have
discovered that naturally matured oocytes are preferable to those which have
been
chemically induced.
Other features and advantages of the invention will be apparent from the
~n following description and from the claims.
Det~dled Desc~°ipti~pa ~f'fhe dsaveeati~ra
Sources of Somatio Cyenomes:
Somatic Cells . .
Somatic cells can supply the genome for producing a reconstructed
embryo in the methods described herein. 'fhe term "somatic cell", as used
herein,
refers to a differentiated cell. The cell can be a somatic cell or a cell that
is
committed to a somatic cell lineage. Alternatively, any of the methods and
-50-
CA 02431859 2003-06-20
WO 00/26357' ~CTlUS99/25'710
animals described herein can utilize a diploid stem cell that gives rise to a
germ
cell in order to supply the genome for producing a reconstructed embryo.
The somatic cell can be from an animal or from a cell culture. If taken
from an animal, the anirilal can be at any stage of development, e.g.; an
embryo, a
. fetus or an adult. Embryonic cells .are preferred. Embryonic cells can
include
embryonic stem cells as well as embryonic cells committed to a somatic cell -
lineage: ySuch cells can be obtained from the endoderm, mesoderm or ectoderm
of the embryo. Preferably; the erzabryonic cells are committed to somatic cell
lineage. Embryonic cells committed to a somatic cell lineage refer to cells
isolated on or after day 10 of embryogenesis. I-Iowe;ver, cells can be
obtained
prior to day ten of embryogenesis. If a cell line is used as, a source of a
chromosomal genome, primary cells are preferred. The term "primary cell line"
as used herein includes primary cell lines as well as primary-derived cell
lines.
Suitable somatic cells include fibroblasts (e.g., primary fibroblasts, e.g.,
embryonic primary fibroblasts), muscle cells (e.g., myocytes), cumulus cells,
.
neural cells; and mammary calls. ~ther suitable cells include hepatocytes and
pancreatic islets. Preferably, the somatic cell is an embryonic somatic cell,
e.g., a
cell isolated on or after day 1 U of embryogenesis: 'The genome 'of the
somatic
cells can be the naturally occurring genome, e.g:, fmr the production of
cloned
. mammals, or the,genome can be genetically altered to comprise a transgenic
sequence, e:g.; for the production of transgenic cloned mammals.
Somatic cells can be obtained by, for example, dissociation of tissue, e.g.,
by mechanical (e.g., chopping, mincing) or enzymatic means (e.g.,
trypsinization)
to obtain a cell suspension and then by culturing the cells until a confluent
monolayer is obtained. The somatic cells can then be harvested and prepared
for
cryopreservation, or maintained as a stock culture. The isolation of caprine
somatic cells, e.g., fibrobIasts; is described herein.
The somatic cell can be a quiescent or non-quiescent somatic cell. "Non-
quiescent", as used herein, refers to a cell in mitotic cell cycle. The
mitotic cell
30. cycle has four distinct phases, G" 8, GZ and M. The beginning event in the
cell
-51-
CA 02431859 2003-06-20
W~ UO/26357 ~C't'JIJS991257t0
cycle, called START, takes place. during the G, phase. "START" as used herein
,
refers to early G, stage of the cell cycle prior to the commitment of a cell
to
proceeding through the cell cycle. For example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 1~
up to
11 hours after a cell enters the G, stage, the cell is considered prior to
START.
The decision as to whether tlye cell will undergo, another cell cycle is made
at
START. Once the cell has passed thr~ugh START, it passes through the
remainder of the G, phase (i.e., the pre-I7NA synthesis stage). The S phase is
the
DNA synthesis stage, which is followed by the GZ phase, the stage between
synthesis and mitosis. Mitosis. takes place during the IvI phase. If at,
START, the
cell does not undergo another cell cycle, the cell becomes quiescent. In
addition,
a cell can be induced to exit the. cell cycle_and become quiescent. A
"quiescent"
cell, also referred to as a cell ire Go phase, refers to a cell which is not
in any of the
four .phases of the cell cycle. Preferably; the somatic cell is a cell in the
Gophase
or the G, phase of the mitotic cell cycle.
Using donor somatic cells at certain phases-of the. cell cycle, e.g., Ga ~r G,
phase, can ~ltow for synchronization between the ~ocyte and the genome of the
somatic cell. For example, reconstruction of an oocyte in metaphase II by
introduction of a nucleus of a somatic cell in Go or G,, e.g., by simultaneous
activation and fusi~n, can animic the events occurring dui"ing fertilization.
13y
way of another example, an oocyie in teloplaase II fused, e.g., by
simultaneous
activation and fusion, .with the gen~me of a somatic cell in G, prior t~
START,
provides a synchronizatioai of cell cycle between the oocyte and donor nuclei.
Methods of deteritiining which phase of the cell cycle a cell is in are
known. For example, as described below im the Examples, various markers are
present at different stages of the cell .cycle. Such markers can include
cyclins I~
1, 2, 3 and proliferating cell nuclear antigen (PCNA) for G" and BrDu to
detect
DNA synthetic activity. In addition, cells can be induced to enter the Go
stage by
culturing the cells on serum-deprived medium. Alternatively, cells in Go stage
can be induced t~ enter the cell cycle, i.e., at G, stage, by serum
activation.
-52-
CA 02431859 2004-03-29
50409-13D(S)
The-donor cells can be obtained from a mammal, e.g., an embryonic,, fetal
or adult mammal, or from a culture system, e.g., a synchronous culture system.
For example, the donor cell can be selected from a culture system which
contains
at least a majority of donor cells (e.g., 50%, 55%, 60%; 65%, 70%, 75%, 80%,
. '85%, 90% or more) in a specif c stage of the mitotic.cell .cycle.
Sources of Genetically Engineered Somatic Cells:
Trans~enic Mammals
Methods for generating non-human transgenic mammals which can be
used as a source of somatic cells in the invention are known in the art. Such
methods cari involve introducing DNA constructs into the germ line of a mammal
to make a transgenic mammal. For example, one or several copies of the
construct may. be incorporated intoahe genome of a mammalian embryo by
standard transgenic techniques. '
Although goats are a preferred source of genetically engineered somatic
cells, other non-human mammals can be used. Preferred non-human mammals
are ruminants, e,g., cows, sheep, camels or goats. .Goats of Swiss origin,
e.g., the
Alpine, Saanen and Toggenburg breed goats, are useful in the methods described
herein. Additional examples of preferred non-human animals include oxen,
horses, llamas, and pigs.' The mammal used as the source of genetically
engineered cells wilt depend on the transgenic mammal to be obtained by the
methods of the invention as, by way of example, a goat genome should be
introduced, into a goat functionally enucleated ooeyte.
Preferably, the somatic cells for use in the invention are obtained from a
25, transgenic goat. Methods of producing transgenic goats are known in the
art. For
example, a transgene~can be introduced into the germline of a goat by
microinjection.as described, for example; in Ebert et al. (1994)
BiolTechnology
12:699 .
Other transgenic non-human animals to be used as a source of genetically
. engineered somatic cells can be produced by introducing a transgene into the
-53-
CA 02431859 2003-06-20
W~ 00/26357 ~CT/f.JS~9/25730
germline of the non-human animal. Embryonal_ target cells at various
developmental stages can be uscd to introduce transgenes. Different methods
are , ,
used depending on the stage of development of the embryonal target cell. The
specific Iine(s) of any animal used to practice this-invention are selected
for
general good health, good embryo yields, good pronuclear visibility in the.
embryo, and good rcproductive fitness. In addition, the haplotype is a
significant
factor.
Transfected Cell Lines
Genetically engineered somatic cells for use in the invention can be
obtained from a cell line into which a nucleic acid of.interest, e.g.,
a,nucleic acid
which encodes a protein, leas been introduced.
A construct can be introduced into a cell via conventional transformation
or transfection techniques. As used herein, the terms "transfection" and
"transformation" include a variety of techniques for introducing a trarisgenic
sequence into a host cell, including calciuhZ_phosplaate or calcium chloride
co-
precipitation, DEAF-dextrane-mediated transfec~ion, lipofection, or
electroporation. In addition, biological vectors; e.g., viral vectors can be
used as
described below: Suitable methods for transf~rming or trarisfecting host cells
can
Ltd be foiiud in ~aWbrvva ei ai., i vlci,ului viGi'Ii'g:.ri
~.T,uwYCasi~Y°y wi iiiP.s'2i 2nd L'~..,
Cold Spring Herb~r Labos-catory, (Cold Spxing Harbor Laboratory Press, Cold
Spring Harbox, NY, I989), and other suitable laboratory manuals.
Two useful approaches are eIectroporation and lipofection. Brief
examples of each are described below.
The DNA construct can be stably introduced into a donor somatic cell Line
by electroporation using the following protocol; somatic cells, e.g.,
fibroblasts,
e.g., embryonic fibroblasts, ate resuspended in PES at about 4 x 106
cells/rral.
Fifty rnicorgrams of linearized DNA is added to the 0.5 ml cell suspension,
and
the suspension is placed in a 0.~ can electrode.gap cuvette (Biorad).
Electroporation is performed using a Biorad Gene Pulser electroporator with a
CA 02431859 2003-06-20
WO 00126357 PCT/CJS99125710
330 volt pulse at 2S mA,1000 rnicroFarad and.infinite resistance. If the Dl~IA
construct contains a Neomyocin resistance gene for selection, neomyocin
resistant clones are selected following incubation with 3S0 micio_gramlml of
6418 (GibcoBRL) for 1 S days.
The DNA construct can be stably introduced into a donor somatic cell line
by lipofection using a protocol such as the following: about 2 x 105 cells are
-.
plated. into a 3.S cmiameter well and transfected with 2 rnicrograrns of
linearized
DNA using LapfectAMINET"" (GibcoBR.L). Forty-eight, hours after transfection,
the cells are split 1:1000 and 1:5000 and, if the DNA construct contains a
neornyosin resistance gene for selection,, G4i8 is added to a
final.concentration of
0.35 mg/ml. Neomyocin resistant clones are isolated and.expanded for
cyropreservation as well as nuclear transfer.
Tissue-Specific Expression of Proteins
It is often desirable to express a protein, e.g:, a heterologous protein, in a
specific tissue or fluid, e.g., the milk, of a transgenic animal: The
heterologous
protein can be recovered from the tissue or fluid in which it is.expressed.
For
example; it is often desirable to express, the heterolol;ous protein in milk.
Methods for producing a heterologous protein under the control of a milk
specific
promoter are described below. In addition, other tissue-specific promoters, as
well as, other regulatory elements, e.g., signal sequences and sequence which
enhance secretion of non-secreted proteins, are descy~ibed below.
lViilk Specific Promoters
I3seful transcriptional promoters are those promoters that are
preferentially activated in mammary epithelial cells,. including promoters
that
control the genes encoding milk proteins such as caseins, beta lactoglobulin
(Clark et al., (1989) Bio/Technology 7: 487-492), whey acid protein (Gordon et
al. (1987) BiolTechnology 5: 1183-1187); and lactalbumin (Soulier et al.,
(1992)
-55-
CA 02431859 2003-06-20
WO ~0/26357 1'CTliJS99l257t0
FEBS Letfs. 297: ~. Casein promoters may be derived from the alpha, beta,
gamma or kappa casein genes of any mammalian species; a preferred promoter is
derived from the goat beta casein gene (DiTuilio, (1992) Bio/Technology 10:74-
77). Milk-specific protein promoter or the promoters that are specifically
activated in mammary tissue can be derived from cDNA or genomic sequences.
Preferably, they are genoaxaic in origin. ..
DNA sequence information is available for the mammary gland specific
genes listed above; in at least one, and often in several organisms. See,
e.g.,
Richards et al., J. I3iol. Claem. 256, 526-532 (1981) (oc-lactalbumin rat);
Campbell
et al:, Nucleic Acids Res. i2; 8685-8697 (1984) (rat WAP); Jones et al., J.
Biol.
Chem. 260, 7042-7050 (1985) {rat ~i-casein); Yu-Lea ~ Rosen, J. Biol. Chem.
258, 10794-10804 (1983) (racy-casein); l'-iall, Biochem. J. 242, 735-74.2
(1987) (
a-Iactalbumin human); Stewart, Nucleic Acids Res. 12, 389 (1984) (bovine ~,sl
and K casein cDNAs); (rorodetsky et al., ~iene 66, 87-96 (1988) (bovine (3
casein); Alexander et aL, Irur. J. Biochem. I789 395-401 (2988) (Bovine x
casein);
Brignon et al., FEBS Left. 188, 48-55 {1977) (bovine a.S2 casein); Jamieson et
al:, Gene 6l, 85-90 (1987), Ivanov et al., Biol. Chem. Hloppe-Seyler 369, 425-
429
{1988), Alexander et al., Nucleic Acids hes. 17, 6739 (1989) (bovine (3
lactoglobulin)p'Vilotte et al., Biochimie 69, 609-620 (1987) (bovine a-
zo iactaibumin). The structure and ~nciior~ of the vari~ii~s mili~ proieira
genes are
reviewed by Merrier ~ '~Iilotte, J. Dairy Sci. 76, 3079-3098 (1993)
(incorporated
by reference in its entirety for all purposes). If additional flanking
sequence are
useful in optimizing expression of the heterologous protein, such sequences
can
be cloned using the existing sequences as probes: IViammary-gland specific
regulatory sequences from different organisms can be obtained by screening
libraries from such organisms using known cognate nucleotide sequences, or
antibodies to cognate proteins as probes.
Signal Sequences
_gg_
CA 02431859 2003-06-20
W~ 00/26357 P~T/US99/25714
Useful signal sequences are milk~specific signal sequences or other signal
sequences which result iri the secretion of eukaryotic or prokaryotic
proteins.
Preferably, the signal sequence is selected from milk-specific signal
sequences,
i.e., it is from a gene which encodes a product secreted into milk. Most
preferably, the milk-specific signal sequence is related to the milk-specific
promoter used in the construct, which are described below. The size of the
signal ..
sequence is not critical. All that is required is that the sequence be of a
suff cient
size to effect secretion of the desired recombinant protein, e.g., in the
mammary
tissue. For example, signal sequences from genes coding for caseins, e.g.,
alpha,
1 o beta, gamma or kappa caseins, beta lactoglobulin, whey acid protein, and
lactalbumin can be used: A preferred signal sequence is the goat ~i-casein
signal
sequence.
Signal sequences from othei secreted proteins, e.g.; proteins secreted by
kidney cells, pancreatic cells or liver Bells, can also be used. Preferably,
the
signal sequence results in the secretion of proteins into, for example, urine
or
blood.
Amino-Terminal Regions of Secreted Proteins
A non-secreted protein can also be modified in such a manner that it is
2u secreted such as by inclusion in the protein to be secreted of iii or pait
of the
coding sequence of a protein which is normally secreted. Preferably the entire
sequence of the protein vrhich is normally secreted is not included in the
sequence
of the protein but rather only a sufficient portion of the amino terminal end
of the
protein which is normally secreted to result in secretion of the protein. For
example, a protein which is not normally secreted is fused (usually at its
amino
terminal end) to an amino terminal portion of a protein which is normally
secreted.
In one aspect, the protein which is normally secreted is a protein which is
. normally secreted in milk. Such proteins include proteins secreted by
mammary
3o epithelial cells, milk proteins such as caseins, beta lactoglobulin, whey
acid
_57_
CA 02431859 2003-06-20
W~ 00/26357 PC'r/IJ~991~S7d0
protein , and lactalburrain. Casein proteins inctude alpha, beta, gamma or
kappa .
casein genes of any rndmmalian species. A preferred protein is beta casein;
e.g.,
goat beta casein. 'fhe sequences which encode the secreted protein can be
derived from either cl_7I~A or genomic sequences:. Preferably, they are
genomic
in origin, and include one or more iritrons.
Other °Tissue-Specific Promoters
Other tissue-specific promoters which provide expression in a particular
tissue can be used. Tissue specific promoters are promoters which are
expressed
1o more strongly in a particular tas5ue than in others. 'Tissue specific
promoters are
often expressed essentially exclusively in the. specific tissue.
Tissue-specific promoters which can be used include: a tleural-specific
promoter, e.g., nestin, ~7nt-1, fax-1, Engrailed-l, Engrailed-~, Sonic
hedgehog; a
liver=specific proyraoter, e.g., albumin, alpha-1 antirypsin; a muscle-
specific
promoter, e.g., Irlyogenin, actin, ~yd0; myosin; an oocyte specific promoter,
e.g., ZP1, ZP2, ZP3; a testes-specifac promoter, ~.g., protamiri, fertiliri,
synaptonernal c~mplex protein-1; a blood-specific promoter, e.g., globulin,
GATA-l, porphobilinogen deaminase; a lung-specific promoter, e.g., surfactant
protein C; a skim- or wool-specific promoter, e.g.,.lceratin, elastin;
endotheliurri-
specific promoters, e.g.,'fie-i, q°ie-2; and a bone-specify promoter,
e.g., BI~P.
In additioai, general promoters can be used for expression in several
tissues. Examples of general promoters include (3-actin, ROSA-21, PCr~, F~S, c-
.
myc, Jun-A, and Jun-l~.
OhIA Constructs
A chssette which encodes a heterologous protein can be assembled as a
construct which includes a promoter for a specific tissue, e.g., for
marrlrnary
epithelial cells, e.g., a casein promoter, e.g., a goat beta casein promoter,
a milk-
specific signal sequence, e.g., a casein signal sequence,.e.g., a (3-casein
signal
3o sequence, arid a I)leTA encoding the heterologous protein.
_5g_
CA 02431859 2003-06-20
VVO.00/26357 PCTfLJS99125710
The construct can also include a 3' untcanslated region downstream of the
DNA sequence coding for the non-secreted protein. Such regions can stabilize
the RNA transcript of the expression system and thus increases the yield of
desired protein from the expression system. Among the 3' uritranslated regions
useful in the constructs for use in the invention are sequences that provide a
poly
A signal. Such sequences may be derived, e.g.,. from the SV40 small t antigen,
the casein 3'-untranslated region or other 3' untranslated sequences vsrell
known in
the art. In one aspect, the 3' unixanslated region is dc;rived from a milk
specific
protein. The length of the 3' untranslated region is not critacal but the
stabilizing
effect of its poly A transcript appears important in stabilizing the RNA of
the
expression sequence.
Optionally, the construct can include a 5' untranslated regiom between the
promoter and the DNA sequence encoding the signal sequence. Such
untranslated regions can be from the same control region from Which promoter
is
is taken or can be from a different gene, e_g., they may be derived from other
synthetic; semi-synthetic or natural sources. Again their specific-length is
not
critical, however, they appear to be useful in improving the level of
expression.
The construct can also include about 10%, 20%; 30%, ~r more of the N
terminal coding region of a gene preferentially expressed in mammary
epithelial
2~7 cells. nor example, the hi-terminal coding region can correspond to
the,prornoter
used; e.g., a goat ~3-casein N-terminal coding region.
The construct can be prepared using methods known .in the art. 'I""he
constiucf can be prepared as part of a larger plasmicf. Such preparation
allows the
clotting and selection of the correct constructions in an efficient manner.
The
25 construct can be located between convenient restriction sites on the
plasmid so
that they can be easily isolated from the remaining plasmid sequences for
incorporation into the desired mammal.
Heterologous Proteins
_59.
CA 02431859 2003-06-20
WO OOI2635? PCTltJS99/2~7H0
Transgenic sequences encoding heterologous proteins can be introduced
into the germline of anon-human mammal or can be transfected into a cell line
to
provide a source of genetically engineered soraiatic cells as described above.
The protein can be a complex or muitiirieric protein, e.g., a homo- or
heteromultimer, e.g., proteins ~rhich naturally occur as homo- or
heteromultimers, e.g., homo- or hetero- dimers, trimers or tetramers. The
protein -.
can be a protein which is processed by removal, e.g., cleavage, of N-terminus,
C-
terminus or internal fragments. Even conipIex proteins can be expressed in
active
form. Protein encoding sequences which cah be introduced into the genome of
mammal, e.g., goals, include glycoproteins; neuropeptides, immunoglobulins,
enzymes, peptides and hormones. The protein may be a naturally occurring
protein or a recombinant protein, e.g., a fragmaent, fusion protein, e.g., an
immunoglogulin fusion protein, or mutien. It may be human or non-human in
origin. The heterologous protein naay be a potential therapeutic ~r
Z5 pharmaceutical agent such as, but nod limited to; alpha-1 proteinase
inhsbitor,
alpha-1 atltitrypsine, alkaline phosphatase, angiogenin, antithrombin III, any
of
the blood clotting factors including Factor VIII, Factor IX, and Factor ~C
chitinase, erythropoietin, extracellutar superoxide dismutase, fibrinogen,
glucocerebrosidase, glutamate decarboxylase, human growth factor, human serum
20 albumin, immunoglobulin, insulin, myelin basic protein, proinsulin,
prolactin,
soluble CD4 ox a component ~r complex thereof, lactofernn, laetoglobulin,
lysozyme, lactalbumin, tissue plasminogen activator or a variant thereof
Immunoglobulins are particulafly prefered heterologous protiex<s.
Examples of immunoglobulins include IgA, IgCi, IgE, Igl~, chimeric antibodies,
25 humanized antibodies, recombinant antibodies, single chain antibodies and
antibody-protein fusions.
Nucleotide sequence information is available for several of the genes
encoding the heterologous proteins listed above, in at least one, and often in
several organisms. See e.g., I_,ong et aI. (I984) Ba~chen~. 23(2I):4828-4837
30 (aplha-1 antitry~sin); Il~itchell et al. (1986) 1'r~Z, rlatl. .Acted. Sci
RIS~4 83:7182-
-60-
CA 02431859 2004-03-29
50409-13D(S)
7186 (alkaline phosphatase); Schneider et al. (1.988)~EMBOJ. 7(13):4151-4156
(angiogenin); Bock et ~al..(1988) Biochem. 27(16):6171-6178 (antithrombin
III);
Olds et al. (1991) Br. J. Haematol. 78(3):408-413 (antithrombiri.III); Lin et
al:
(1985) Proc.~Natl. Acad. Sci. USA~82(22):7580-7584 (erythropoeitin); U.S.
Patent No. 5,614,184 (erythropoietin);~Horowitz et al. (1989) Genomics 4(1):87
96 (glucocerebrosidase); Kelly et al: (1992) Ann. Hum. Genet. 56(3):255-265
(glutamte decarboxylase); U.S: Patent No. 5,707,828 (human serum albumin); .
U.S. Patent No. 5,652,352 (human serum albumin); Lawn et al. (1981) Nucleic
Acid Res. 9(22):6103-6114 (human serum albumin); Kamholz et al. (1,986) Prot.
Natl. Acad. Sci. USA 83(13):4962-4966 (myelin basic.piotein); Hiraoka et al.
(1991) Mol. Cell Endocrinol. 75(1):71-80 (prolactin); U.S: Patent No:
$,571,896
(lactoferrin); Pennica et al. (1983) Natura 301 (5897):214-221 (tissue
plasminogen activator); Sarafanov,et al. (1995)Mol. Biol. 29:161-165.
15-
Ooc es
. Oocytes for use in the invention include oocytes in metaphase II stage of
meiotic cell division, e.g., oocytes arrested in metaphase II, and telophase
stage of
meiotic division, e.g., telophase I or telophase IL -Oocytes in metaphase II
. contain one polar body, whereas oocytes in telophase can be identified based
on
the presence of a protrusion of the plasma membrane. from the second.polar
body
up to the formation of a second polar body. In addition, oocytes in metaphase
II
can be distinguished from oocytes in telophase 1I based on biochemical and/or
developmental distinctions. For example, oocytes in metaphase Ih can be in an
arrested state, whereas oocytes in telophase are in an activated state.
Preferably,
the oocyte is a~caprine oocyte.
Occytes can be obtained at various times during a goat's reproductive
cycle. For example, at given times during the reproductive cycle, a
significant
percentage of the oocytes, e.g., about 55%, 60%, 65%, 70%, 75%, 80% or more,
. ~ . are oocytes in telophase. 'These oocytes are naturally matured oocytes.-
1n
-61- . ~ .
CA 02431859 2003-06-20
W~ 00/26357 P~'d'IIJS99/25710
addition, oocytes at various stages of the cell cycle can be obtained and then
induced in vitro to enter a particular stage of meiosis. For example, oocytes
.
cultured on serum-starved medium become arrested in metaphase. In addition,
arrested oocytes can be induced to enter telopliase by seryn activation. Thus,
.
oocytes in telophase can be easily obtained for use in the invention:
Oocytes can be matured in vitro before they~are rised to form a
reconstructed embryo. 'I his process usually requires collecting imrnatiare
oocytes
from mammalian ovaries, c.g., a caprine ovary, and maturing the oocyte in a
medium prior to enucleation until the oocyte reaches the desired meiotic
stage,
e.g., metaphase or telophase. In addition, ~ocytes that have been matured in
vavo
can be used to f~rm a t-econsta-ucted embryo.
Oocytes can be collected, from a female mammal during superovulation.
Briefly, oocytes, e.g., caprine oocytes, can be recovered surgically by
hushing the
oocytes from the oviduct of the female donor. Methods of inducing
15- superovitiation in goats and the collection of caprine oocytes is
described herein.
Preferably, the meiotic stage of the oocyte, e.g., gnetaphase,Il or telophase
Il, correlates to the stage of the cell cycle of the donor somatic cell. The
correlation betvi~een the meiotic stage of tlae oocyte and the mitotic stage
mf the
cell cycle of the donor somatic cell is referred to herein as
"synchronization". For
2v °v~'llinple re~v::ut:~.~.:a::'~: of an aorac°.wt_P in
IvvPta»rh~y IT by iI'ti_-a_'Qdl~Ctio%1 ~f a Xlii~l~idS
of a somatic cell in Ga or (.~" e.g:, by simultaneous activation and fusion9
can
mimic the events occurring during fertilization. By way of another example, an
oocyte in telophase fused, e.g., by simultaneous activation and fusion, with
the
genome ~f a somatic cell in G~ prior to START, provides a synchronization
25 between the.oocyte and the donor nuclei.
Functional Enucleation
'The donor oocyte, e.g., capaine oocyte, should be functionally enucleated
such that the endogenous genome of the oocyte is incapable of functioning,
e.g.,
30 replicating or
_g2_
CA 02431859 2003-06-20
WO 00/26357 PC."T~tJS99/25710
synthesizing DNA. Methods of functionally enuclearing an oocyte include:
removing the genome from the oocyte (i.e., enucleation), e.g., such that the
' oocyte is devoid of nuclear genome; inactivating DhIA within the oocyte,
e.g., by .
irradiation (e.g., by X-ray irradiation, or laser irradiation); chemical
.inactivation,
or the like.
Enucleation
One method of rendering the genome of an oocyte incapable of
functioning is to remove the genome from the oocyte (i.e., enucleation). A
micropipette or needle can be inserted into the zona pellicuda in order to
remove
nuclear material from an oocyte. For example, metaphase II stage oocytes which
have one polar body can be enucleate~ with a micropipette by aspirating the
first
polar body and adjacent cytoplasm surrounding the polar body, e.g.,
approximately 20%, 30%, 40%, 50%, 60% of the cytoplasm, which presumably
contains the metaphase plate. 'Telphase stage oocytes which have two polar
bodies can be enucleated with a micropipette orneedle by removing the second
polar body and surrounding cytoplasm, e.g., approximately 5%, 10%,
20°f°, 30%,
40%, 50%, 60% of cytoplasm: Specifically, oocytes in telophase stage can be
enucleated..at any point from the presence of a protrusion in the plasma
membrane
~~ from tlZe se~'n,~d p~nla,: 1,'!v'~y'vip to thra fnrmot;nn of fhe se~::rod
pf~'l3r.bc~dy 'T'hy.C.
a. a vvu aasv vmaswav ,
as used herein, oocytes which demonstrate a protn~sion in the plasma membrane,
usually with a spindle abutted to it, up to extrusion of the second polar body
are
considered to be oocytes in telophase. Alternatively, oocytes.which have one
clear and distinct polar body with no evidence of protrusion are considered to
be
oocytes in metaphase. Methods of enucleating an oocyte, e.g., a caprine
oocyte,
are described in further detail in the Examples.
Irradiation
The oocyte can be functionally enucleated by inactivating the endogenous
DNA of the oocyte,using irradiation. Methods of using irradiation are known in
-63-
CA 02431859 2004-03-29
50409-13D(S)
the art and described, for example, in Bradshaw et al. (1995) Molecul. Reprod.
. .
Dev. 41:503-512 .
Chemical lnactivation
The oocyte can be functionally enucleated by chemically inactivating the
endogenous DNA of the oocyte. . Methods of chemically inactivating the DNA
are known in the art. For example, chemical inactivation can be performed
using
the etopsoide-cycloheximide method as described in Fulkaj and Moore (1993)
Molectel. Reprod Dev. 34:427-430 .
Introduction of a Functional Chromosomal Genome into an 0ocyte
Methods described herein can include the introduction of a functional
chromosomal genome into an oocyte, e.g., a functionally enucleated oocyte,
e.g.,
an enucleafed oocyte, to form a reconstructed embryo. The functional
chromosomal genome directs the development of a cloned or twansgenic animal
which arises from the reconstructed embryo. Methods which result in the
transfer
of an essentially intact chromosomal genome'to the oocyte can be used.
Examples include fusion of a cell which contains the functional chromosomal
genome with the oocyte and nuclear injection, i.e., direct transfer of the
nucleus
into the oocyte. .
Fusion
Fusion of the somatic cell with an oocyte can be performed by; for
example, electrofusion, viral fusion, biochemical reagent fusion (e.g., HA
protein), or chemical fusion (e.g., with polyethylene glycol (PEG) or
ethanol).
Fusion of the somatic cell with the oocyte and activation can be
performed simultaneously. For example, the nucleus of the somatic cell can be
deposited within the zona pelliduca which contains the oocyte. The steps of
fusing the nucleus with the oocyte and activation can then be performed
CA 02431859 2004-03-29
50409-13D(S)
simultaneously by, for example, applying an, electric field. Methods of
simultaneous fusion and activation of a somatic cell and an oocyte are
described
herein.
Activation of a Recombinant Embryo
Activation refers to the beginning of embryonic development, e.g.,
replication and DNA synthesis. Activation can be induced by, for example,
electric shock (e.g., in electrofusion), the use of ionophores, ethanol
activation, or
the oocyte can be obtained during a stage .in which it is naturally activated,
e:g.,
an oocyte in telophase.
Electrofusion
A reconstructed embryo can be activated using electric shock, i:e.,
electrofusion. The use of electrofusion allows for the fusion of the somatic
cell
- with the oocyte and activation to be performed simultaneously.
Chambers, such as the BTX 200 Embryomanipulation System, for
carrying out electrofusion are commercially available from, for example, BTX,
San Diego. Methods for performing electrofusion to fuse a somatic cell, e.g.,
a
caprine somatic cell, and an oocyte, e.g., an enucleated oocyte, e.g., an
enucleated
caprine oocyte, are described herein:
Ionophores
In addition, the reconstructed embryo can be activated by ionophore
activation. Using an ionophore, e.g., a calcium.ionophore, the calcium
. concentration across the membrane of the reconstructed embryo is changed. As
the free calcium concentration in the cell increases, there is a decrease in
phosphorylation of intracellular proteins and the oocyte is activated. Such
methods of activation are described, for example, in U.S. Patent Number
5,496,720.
-65-
CA 02431859 2004-03-29
50409-13D(S)
Ethanol Activation
Prior to enucleation, an oocyte, e.g., an oocyte in metaphase II, can be
activated with ethanol according to the ethanol activation treatment as
described
in Presicce and Yang (1994) Mol. Reprod. Dev. 37:61-68, and Bordignon and
Smith (1998) Mol. Reprod. flev: 49:29-36 .
Ooctyes in Telophase
Oocytes in telophase are generally already activated. Thus, these cells
often naturally exhibit a decrease in calcium concentration which prevents
fertilization and allows the embryo to develop.
Transfer of Reconstructed Embryos
A reconstructed embryo of the invention can be transferred, e.g.,
implanted, to a recipient doe and allowed to develop into a cloned or
transgenic
mammal, e.g., a cloned or transgenic goat. For example, the reconstructed
embryo can be transferred via the fimbria into the oviductal lumen of each
recipient doe as described below in the Examples. hl addition, methods of
transferring an embryo to a recipient mammal are known in the art and
described,
for example, in Ebert et al. (1994) BiolTechnology 12:699.
The reconstructed embryo can be maintained in a culture until at least first
- cleavage (2-cell stage) up to blastocyst stage, preferably the embryos are
transferred at 2-cell or 4 cell=stage. Various culture media for embryo
development are known in the art. For example, the reconstructed embryo can be
co-cultured with oviductal epithelial cell monolayer derived from the type of
mammal to be provided by the.invention. Methods of obtaining goat oviductal
epithelial cells (GOEC), maintaining the cells in a co-culture are described
in the
Examples below.
Purification of Proteins from Milk
-66-
CA 02431859 2003-06-20
i~VO 00126357 PCTlLJS99/25710
The transgenic protein can be produced in milk at relatively high
concentrations and in large volumes, providing continuous high level output of
normally processed peptide that is easily harvested from a renewable resource.
There are several different methods known in the art for isolation of proteins
form
milk.
Milk proteins usually are isolated by a comuination of processes. ltaw ..
milk first is fractionated to remove fats, for example; by skimming,
centrifugation, sedimentation (H.E. Swaisgood, Developments, irz Dairy
Chemistry, I: Chemistry of Milk Protein, Applied Science Publishers, NY,
1982),
t0 acid precipitation (LT.S. Patent No. 4,644,056) or enzymatic coagulation
with
rennin or chymotrypsin (Swaisgood, ibid.}. Next, the mayor milk proteins may
be
fractionated into either a clear solution or a bulk precipitate from which the
specific protein of interest rgaay be readily purified:
French Patent No. 2487642 describes the isolaticin of milk proteins from
skim milk or whey by membrane ultrafiltration in combination with exclusion
chromatography or ion excharAge chromatography. ~Ilaey is first produced by
removing the casein by coagulation with rennet or. lactic acid. U.S. Patent
N~.
4,485,040 describes the isolation of an alpha-Iactogiobulin-enriched product
in
the retentate from whey by two sequential ultrafiltration steps. U.S. Patent
No.
4,644,056 provides a rriefri~d for purifying irnmunogiobulin frorri riiiik ~r
colostrum by acid precipitation at pI-I 4.0-5.5, and sequential cross-flow
filtration
first on a merribrane with 0.1 - 1.2 micrometer pare size to clarify the
product
pool and.then on a membrane with a separation limit-of 5 - 80 kd to
concentrate
lt.
Similarly, U.S. Patent No. 4,897,465 teaches the concentration and
enrichment of a protein such as imrnunoglobulin from blood serum, egg yolks or
whey by sequential ultrafiltration on metallic oxide membranes with a pI~
shift.
Filtration is carried out first at a pH below the isoelectric point (pI) of
the selected
protein to remove bulk contaminants from the protein retentate, and next at a
pH
3o above the pI of the selected protein to retain impurities and pass the
selected
-67-
CA 02431859 2004-03-29
50409-13D(S)
protein to the permeate. A different filtration concentration method is taught
by
European Patent ~No. EP 467 482 B 1 in which defatted skim milk is reduced to
pH 3-4, below the pI of the milk proteins, to solubilize bothcasein and whey
proteins. -Three successive rounds of ultrafiltration or diafiltration then
concentrate the proteins to form a retentate containing 15-20% solids of which
90% is protein. Altematively,.British Patent Application No. 2179947 discloses
the isolation. of lactoferrin from whey by ultrafiltration to concentrate the
sample,
followed by weak cation exchange ,chromatography at approximately a neutral
pH. No measure of purity is reported. In PCT Publication TTo. Wp 95!22258, a
protein such as -lactoferrin is recovered from milk-that has been adjusted to
high
ionic strength by the addition of concentrated salt, followed by cation
exchange
chromatography.
In all of these methods, milk or a fraction thereof is first treated to remove
fats, lipids, and other particulate matter that would foul filtration
membranes or
~5 _ chromatography media. The initial fractions thus produced may consist of
casein,
whey, or total milk protein, from which the protein of interest is then
isolated.
PCT Patent Publication No. W0. 94/19935 discloses a method of isolating
a biologically active protein frorn'whole milk'by ,stabilizing the solubility
of total
milk proteins with a positively charged,agent such as aTginine, imidazole or
2o Bis-Tris. This treatment forms a.clarified solution from which the protein
may be
isolated, e.g., by filtration through membranes that otherwise would become
clogged by precipitated proteins.
U.S. Patent No. 6,268,487 discloses a method for isolating a soluble milk
component, such as a peptide, in its biologically active form from whole milk
or a
25 milk fraction by tangential flow filtration. Unlike previous isolation
methods,
this eliminates the need for a first fractionation of whole milk to remove fat
and
casein micelles, thereby simplifying the process and- avoiding losses of
recovery
and bioacdvity. This method may be used in combination with additional
purification steps to further remove contaminants and purify the product,
e.g.,
30 protein, of interest.
-68-
CA 02431859 2004-03-29
50409-13D(S)
This invention is fu~rther.illustrated by the following examples~which in no
way should be construed as being further limiting.
5. Examples
Donors and recipients used in the following examples weredairy goats of .
the following breeds (mixed or not): Alpine, Saanen, and Toggenburg. All
'goats
were maintained at the Genzyme Transgenics faun in Charlton, Massachusetts.
Collections and 'transfers were completed during the spring and early summer
(off season). . . .
Isolation of Caprine Somatic Cells.
Caprine fetal fibroblast cell lines used as karyoplast donors were 'derived
from six day 35-40 fetuses produced by artificially inseminating non-
transgenic
does with fresh collected semen from a tiansgenic antithrombin III (ATIII)
founder buck. An ATIII cell line was chosen since it provides a well .
characterized genetic marker to the somatic cela lines, and it targets high,
level
expression of a complex glycosylated protein (ATIII) in the milk of lactating
does. Three fetuses which were derived from the semen of the transgenic ATIII
. buck were surgically removed at day 40 post coitus and placed in
equilibrated
Ca'''/Mg"-free phosphate buffered saline (PBS): Cell suspensions were prepared
by mincing and digesting fetal tissue in 0.025% trypsinl0.5 mM EDTA at
37°C
for ten minutes. Cells were washed with equilbrated Medium.199T""
(M199)(Gibco) + 10% Fetal Bovine Serurri (FBS) supplemented with
nucleosides, 0.1 mM 2-mercaptoethanol, 2 mM L-glutamine, 1%
penicillin/streptomycin (10,000 LU. each/ml) (fetal cell medium), and cultured
in
25 cm~, flasks. The cultures were re-fed 24 hours later with equilibrated
fetal cell
-69-
CA 02431859 2003-06-20
WO OOI26357 PC'd7E3~991257~t9
medium. A confluent monolayer of primary fetal cells was harvested by.
trypsinization on day four by washing the monolayer twice, with ~a++~Mg~'+-
free
PBS, followed by incubation with 0.025% trypsin10.5 rnM EDfiA at
38°C for 7
m inutes.
Cells potentially expressing A°fIII were then prepared for
cryopreservation, or maintained as stock cultures.
Sexing az~d Genoty,~aing oJ'I~ozz~r C'~11 Lanes
Genomic DNA was isolated from fetal head tissue for ATIII donor
1,0 karyoplasts by digestion with proteinase h followed by precipitation with
isopropanol as described in Laird et al. (1991) Nucleac acid Res. 19:4293, and
analyzed by poIyrzierase chain reaction (PCI~) for the presence of human
W ntithrombin Ill, (A T IiI) sequences as wail as for sexing. i ne A T iia
sequence is
part of the BC6 construct (Goat Beta-Casein - human ATIII cDNA) used to
generate the ATIII transgenic line as described in Edmunds et al. (1998) Mood
91:4561-4571. The human ATIII sequencewas detected by amplification of a 367
by sequence with oligonucleotides GTC11.and GTC12 (see below). For sexing,
the zfX/zfY primer pair was used (see below) giving rise to a _445.bp
(zfX)/447
by (zfy) doublet. l3pon digestion with the restriction ei~zzyme Sacl (hIew
England
l3iolabs), the zfX band was cut into ~vo small fragments (272 and i 73 'np).
Males
were identified.by the presence of the uncut.447 by zf~' band. .
For the PCR reactions9 approximately 250 ng of genomic DNA was
diluted in 50 ml of.PClz buffer (20 mM Tris pII 8.3, 50 rnM KCl and 1.5 mM
MgClz, 0.25 mM deoxynucleotide triphosphates, and each primer at a
concentration of 600 mM) with 2.5 units of Taq polymerise and processed using
the following temperature program:
l cycle at 94°C 60 seconds
5 cycles at 94°G 30 seconds
58°C 45 seconds
_.
CA 02431859 2003-06-20
'WO 00/2637 ~CTdUS93125710
74°C 45 seconds
30 cycles at 94°C 30 seconds
SS°C 30 seconds
74°C 30 seconds
The following primer set was used to detect the human A'I'III sequence:
GTC 11: CTCCATCAGTTGCTGGAGGGTGTC.ATTA (SEQ ID N~:1
GTC 12: GAAGGTTTATCTTTTGTCCTTGCTCaCTCA (SEQ ID N~:2)
The following primer set was used for sexing:
~ zfX: ATAATCACATGGAGAGCCACAAGC (S:EQ ID NO:3)
zfY: GCACTTCTTTGGTATCTGAGAAAG (SEQ.ID N0:4)
Two of the fetuses were identified to be a~r~ale and were both negative for
U $ne A T III sequence. An~ther fetliiS ~V'aS ~d~Ylt1 led 'atS fcat3aic and
C:vu iaaaWd
positive for the presence of the ATIII sequence.
Preparatioaa ofATIIl ~xpressir~g Do~aor Celds for Er~zbryo Reconstitution
A transgenic female line (CFFI55-92-6) originating from a day 40 fetus
25 was identified by PCR analyses, as described above, and used for alI
nuclear
transfer manipulations: Transgenic fetal fibroblast cells were maintained in
25
cmz flasks with fetal cell medium, re-fed on day :four following each passage,
and
harvested by trypsinization on day seven. From each passage, a new 25 cm'-
flasks was seeded to maintain the stock culture.- Briefly, fetal cells were
seeded in
30 4-well plates with fetal cell medium and rnaintai:ned in culture (5% C~JZ
at 39°C).
_77_
CA 02431859 2003-06-20
WO 00/26357 PC'T/iJ~99/257t~
Forty-eight hours later, the ynedium was replaced with fresh fetal cell medium
containing 0.5% FBS. The culture was re-fed every 48-72 hours over the next
seven days with fresh fetal cell medium containing 0.5% FI3S. On the seventh
day following first addition of fetal cell medium (0.5% F)3S), somatic cells
used
as karyoplast donors were harvested by trypsinization as previously described.
'The cells were resuspended in equilibrated M199+10% FI3S supplemented with
2mM L-glutamine, 1% penicillinlstreptomycin (10,000 LIJ. each/ml) one to three
hours prior to fusion to the enucleated oocytes.
10' Krxryotypiaag of Cell Lifaes
'The clonal lines were fu~her evaluated by karyotyping to determine gross
chromosomal abnormalities in the cell Iines. Cells were induced to an-est at
metaphase by incubation daith 0.02 p.g/anl of I~emecolcine (Sigma) for 12
hours.
After trypsinization, the resulting pellet was suspended in a hypotonic
solution of
~5 mM I~.Cl in water and incubated at 37°C for 20 minutes. Cells were
fixed for
5 minutes each time in 3 changes of ice-cold acetic acid-methanol (I :3)
solution
before drops of the cell suspension were placed in pre-washed microscopic
slides.
Following air-drying, chromosome preparations were stained with 3% Caiernsa
stain (Sigma) in P13S for 10 minutes. The chromosome spreads were counted for
a as a'annn_. r.......~:~w s:.. .1 '~'
2~ eatifl felt lifle at ivvv~i aiaa~aatiea;~savi3 ui'rW"ca via iaiaaufirjivia.
Immmaohist~chenaiccal ~4nafysis
Antibodies specific for vimentin (Sigma) and pan-cytokeratin (Sigma)
were used to characterize and confirm the morphology of the cell lines. Cells
were plated in sterile gelatin coated cover slips to 75% confluency and fixed
in
2% paraformaldehyde with O.OS% saponin for 1 hour. Cells were incubated in
0.5% PVP in P13S (PBS/PVP) with primary antibodies for 2 hours at 37
°C,
rinsed with 3 changes of PBSII'~IP at 10 minute intervals, and incubated for 1
hour in secondary antibodies conjugated with Cy3 and FITC respectively.
Alkaline phosphatase (Sigma) activity of the cells was also performed to
_72_
CA 02431859 2003-06-20
wo oons~s~ pcTms99nsm o
determine the presence or absence'of undifferentiated cells, The cover slips
were
rinsed and subsequently mounted 'on glass slides with 50% glycerol inPBSlPVP
with 10 p,g/ml bisbenzimide (H-33342, Sigma) and observed under fluorescent
rntcroscopy..
Epithelial anil fibroblast lines positive for vimentin and pan-cytokeratin,
respectively, and negative for alkaline phosphatase activity were generated
from .-
the ATIII primary cultures. In the cell cultures, tvvo morphologically
distinct cell
types were observed. Larger."fibroblast-like" cells stained positive for
virnentin .
and smaller "epithelial-like" cells stained positive for pan-cytokeratin which
0 coexisted in the prirxaary cell cultures. The isolated fibroblast lines from
ATIII
shoved a tendency to differentiate into epithelial-like cells when cultured
for 3
days after reaching confluency. Subsequent passages induced selection against
fibroblast cells giving rise to pure epithelial cells ;as confirmed by the
lack of
positive staining for vimentin. Senesces or possible cell cycle arrest was
first
obseived at passage 28. These cells appear bigger in size, (>30 pm) compared
to
the normally growing cells (15-25.um) and can be maintained in culture in the
absence of apparent mitotic activity for several months without loss of
viability.
Embryo reconstruction using nuclei from the arrested cells produced morula
stage
embyos suggesting reacquistion of mitotic activity.
2U
Donor Karyoplast Cedl Cycle Synchronization and Clzaracterization
Selected diploid transgenie female cell lines were propagated, passaged
sequencialiy and cyrobanked as future karyoplast stock. Donor karyopla~sts for
nuclear transfer were seeded 'in 4 well plates arid cultured for up to 48
hours in
DMEM + 10% FBS or when cells reached 70-80% confluency. Subsequently,
the cells were induced to exit growth phase and enter the quiescent. stage
(G°) by
serum deprivation for seven days using DMEM supplemented with 0.5% FBS to
synchronize the cells.. Following synchronization at G°, a group of
cells were
induced to re-enter the cell cycle by resuspending; the cells in M199 + 10%
FBS
up to thxee hours prior to karyoplast-cytoplast fusi~n to synchronize the
cells at
-73-
CA 02431859 2003-06-20
WO OOI263S7 PC°rltJ~991257t0
the early G, phase prior to STAI~'I°. , A second group of cells were
also released
from the quiescent state and cultured in Ie~Il99 + 10% FBS for l2 or 36 hours
to
synchronize cells at the S-phase. Cells v~ere harvested by standard
trypsinisation
and resuspended in 1VI199 -+- 10% FBS and electofused as lcaryoplasts donors
within I hour
'The metaphase spreads from the transgeriic cell lines carrying the ATIII
construct at passage 5 was 81 % diploid and this did not alter significantly
at
passage 15 where 78% of the spreads were diploid.
Ceti cycle synchrony eves determined by immunohistoehemical analysis
using antibodies against cyclin ~l, 2, 3 and PCNA (~ncogene Research
Products) fox the absence of the protein complex to indicate quiescence
(G°) or
presence of the complex to indicate G, entry. Cells in the presumed S-phase of
the cell cycle were identified by the presence of DNA synthetic activity using
the
thymidine analog 5-bromo 2'-deoxyuridine-5'triphospate (BrDu, Sigzria) and
streptavidiil-Biotin l3rDu stai~~ing 1<it (Gncogene Igesearch Products):
Immunofluorescence analysis of cells subjected to the synchronization
regimen demonstarted that following seven days of serurr~ deprivation,
90°!~ of
the cells were negative for Ci, stage cyclins D 1, 2"3 and PNCA, and were
therefore in G° arrest. Restoration of the serum content to 10% for
this line
induced reentry i~ato the cell cycle with approximately 74% of the calls
reaching
early G; within 3 hours following serum, addition based on positive staining
for
cyclins D l, 2, 3 and PCNA. Saturn restoration for 12 to 36 hours showed that
89% of the cells were positive far BrLW indicating DNA synthetic activity. lr~
this study, clonal lines generally responded differently to the serum
synchronization regimen. , An indirect relationship was observed where the
rate of
cell synchronization decreases with the increase in passage numbers. Further,
as
passage number increased the population doubling times decreased, each clonal
cell line revealed a decreased sensitivity to serum synchronization of the
cell
cycle.
_74.
CA 02431859 2003-06-20
~V~ 00/26357 PCTltIS99125710
Superovulation of Doraor Goats arid Gocyte Collection
Estrus was synchronized on day ~ by a 6 mg subcutaneous Norgestomet
ear implant (Synchro-mate B). A single injection of prostaglandin
- (PGF2a.)(Upjohn US) was administered on day 7: Starting on day 12, FSI-I
(Folltropin-V, Vetrepharm, St Lauremt, Quebec, Canada) was administered twice
daily over four consecutive days. The ear implant was removed~n day 14. -
Twenty-four hours following implant removal, the doinor animals were mated
several times to vasectornized rizales over a 48 hour interval. A single
injection of
GnRH (Rhone-Merieux US) was administered intramuscularly following the last
FSH injection. Oocytes were recovered surgically from donor animals by mid-
ventral laparotomy approximately 18 to 24 hours following the last mating" by
flushing the oviduct with Ca~"IMg*~ -free PBS prewarmed at 37°C.
Oocytes were
then recovered and cultured in equilibrated M 199+10%FBS supplemented with
2mM L-glutarnine, 1% penicilliii/streptomycin (10,000 LU. each/ml):
~ocyte Enucleatiorr
do vivo matured oocytes were collected from donor goats. Oocytes with
attached cumulus cells or devoid of polar bodies were discarded. Cumulus-free
oocytes were divided into two groupsa oocytes with only oiie polar body
evident
(metaphase II stake) and the activated telophase II protoc~1 (oocytes with one
polar body and evidence of an extruding second polar body). Oocytes in
telophase II were cultured iii M199 +.IO% FBS for 2 to 4 hours. Oocytes that
had activated during this period, as evidenced by a first polar body and a
partially
extruded second polar body9 were grouped as culti.ire induced, calcium
activated
telophase II oocytes (Telophase II-Ca2+) and enucleated. Oocytes that lead not
activated were incubated for 5 minutes in PBS containing 7% ethanol prior to
enucleation. Metaphase II stage oocytes (one polar body) were enucleated with
a
25-30 micron glass pipette by aspirating the first polar body and adjacent
_ cytoplasm surrounding the polar body (approximately 30% of the cytoplasm)
. presumably containing metaphase plate.
-75-
CA 02431859 2003-06-20
W ~. 00!26357 ~CTIdJS991257 t t6
As discussed above, telophase stage o~cytes were prepared by two
procedures. Oocytes were intiaIIy incubated in phosphate buffered saline (PBS,
Caz+lMg2+ free) supplemented with 5% ~I3S for'15 minutes and cultured in M199
+ 10% FBS at 3S°C for approximately three hours until the telophase
spindle
configuration or the extrusion of the second polar body was reached. All the
oocytes that responded to the sequential culture under differential
extracellular -
calcium concentration treatment were seperated and grouped as Telophase lI-
Ca2~.
The other oocytes that did riot respond were further incubated in 7% ethanol
in
M199 + 10% FBS for 5-7 minutes (Telophase Il-ETOH) and cultured in M199 +
10% CBS at 38°C for another 3 hours,until.the telophase ll spindle
configuration
was reached. Thereafter, the oocytes were incubated in 30-50 ~tl drops of M199
+
10% FBS conatining 5 ~.gli l of cytochalasin-B for 10-15 minutes at
38°C.
Oocytes were enucleated 'uitle a 30 micron, {OD) glass pipette by aspirating
the
first polar body and approximately 30% of the adjacent cytoplasm containg the
metaphase ii or anout 10% of the cytoplasm containing the telophase di
spir~die.
After enucleation the oocytes were immediately reconstructed.
EntbYyo Recorc~truction
CFF155-92-6 somatic cells used as karyoplast donors were harvested on
2n clay 7 iJy tr~pci;ri~i_n-g ~f~,~2~°/n fryr~ci-_n-/Q:~ m_,M_
F~T_A_)f~igvn~;) f9_r ? 7tl~inut~S-
Single cells were resuspended in equilibrated M199+10% FBS supplemented
with 2mM L-glutamine, penicillin/streptomycin. The donor cell injection was
carried out in the same medium as for enucleation. Donor cells were graded
into
small, medium and large before selection for injection to enucleated
cytoplasts.
Small single cells {10-15 ynicron) were selected with a 20-30 micron
diarrieter
glass pipette. The pipette was introduced through the same slit of the zone
made
during enucleation and donor cells were injected between the zone pellucida
and
the ooplasmic membrane. The reconstructed embryos were incubated in M199
30-60 minutes before fusion and activation.
Jl7
-7f-
CA 02431859 2003-06-20
W~ 00/26357 t'C'f/tJS99/25710
Fusion and Activation
All reconstz-ucted embryos (ethanol pretreatment or not) were washed in
fusion buffer {0.3 M mannitol, 0.05 mM CaCl2, 0.1 a~rzM MgS04, 1 mM K~I-IPOa,
Q.l mM glutathione, 0.1 mglznl BSA in distilled water) for 2 minutes before
electrofusion. Fusion and activation were carried out at room temperatuz~e, in
a
chamber with two stainless steel electrodes 200 microns apart (BTX 200 ..
Embryomanipulation System, BTX-Genetrorzics, San Diego, CA) filled with
fusion buffer. Reconstructed embryos were placed with a pipette in groups of 3-
4
and manually aligned so the cytoplasrr~ic membrane of the recipient oocytes
and
donor CFFI55-92-6 cells were parallel. to the electrodes. Cell fusion and
activation were simultaneously induced 32-42 hours post GnRH injection with an
initial alignmentllzolding pulse of S-l0 V AC for 7 seconds, followed by a
fusion
pulse of .1.4 to 1.8 KV/cm DC for 70 microseconds using an Electrocell
Manipulator and Enhancer 400 {BT'X-Genetronics). Embryos were washed in
fusion medium for 3 minutes, then they were transferred to M199 containizig 5
;~g/rnl cytochalasin-B (Sigma) and 10% FBS and, incubated for 1 hour. Embryos
.
were removed from M199/cytochalasin-B medium and cocultured in 50
microliter drops of M199 plus 10% FBS with goat oviductal epithelial cells
overlaid with paraffin oil. Embryo cultures were maintained in a humidified
39°C incubator with 5% CO, for 48 hours before transfer ~f the. embryos
to
recipient does.
Reconstructed embryos at 1 hour following; simultaneous activation and
fusion with G°,G, and S-phase karyoplasts all showed nuclear envelope
breakdown (NEBD) and premature chromosome c;ondensation.(PCC) when the
cytoplasts were at the arrested metaphase II stage. Subsequent nuclear
envelope
formation was observed to be at about 35% at 4 he~ur post activation. Oocytes
reconstructed at telophase.Il stage showed that an average of 22% of oocytes
observed at 1 hour post fusion of G°,G, and S-phase karyoplast
underwent NEBD
and PCC, whereas the remaining oocytes have intact nuclear lamina surrounding
the decondensing nucleus. No consistent nuclear morphology.other than lack of,
-77-
CA 02431859 2003-06-20
WO 00126357 PC'r/US99/257t0
of the occurrence of NEBD and PCC was observed between the metaphase and
two telophase reconstruction prot~cols employed. Differences became evident
when cloned embryos were observed to have a higher incidence of advanced
cleavage stages (8 to 32 .blastomeres~ when embryos were reconstructed with S-
phase donor nuclei cozripared to when Gaox G, stage karyoplasts were used (2
to 8
blastomeres) following culture t~8 vitYO for 36 -to 48 hours. Fluorescent _.
microscopy analysis showed that the.nuclei of some of the rapidly dividing
embryos were fragmented. Other embryos developed to the 32 to 64 cell stage
within 3 days of culture before cleavage development was,blocked. Analysis of
blastomere and nuclei numbers of these embryos showed the failure of
synchronous occurrence of cytokines and karyokinesis wherein blastomeres were
either .devoid or their corresponding nuclei or contained multiple nuclei. In
contrast, morphologically normal looking embryos showed synchronous
cytokinesis and karyokinesis.
Goat Oviductctl ~patheliczl Cells (Ci~EC)lReconstructed Enabr~o Coculture
G~EC were derived from oviducfal tissue collected during surgical
~viductal flushing performed on synchronized and superovulated does. ~viductal
. tissue from a single doe was transferred to a sterile 1 S ml polypropylene
culture
~.. -roa,.-.,ø ,~ ~q~ ~ c~n a of as~, ~ ~~ t "a~ 'n o
illbe li~~lta~rlllilg J 1111 Vd Ciai~,i111ilipl'S.°u l~t~~, a0/u Ft7J,
~. 'ana,'a i..°glusumi v,
penicillin/strepomycin. A single cell suspension was prepared by irottexing
for l
minute, followed by culture in a humidified S% C02 incubator at 38°C
for up to
one hour. . The tube was vortexed a second time for one minute, then cultured
an
additional five minutes to allow debris to settle. The top four millimeters
containing presumed single cells was Transferred to a new I S ml culture tube
and
centrifuged at 600x g for 7 minutes, at room temperature. The supernatant was
removed, and the cell pellet resuspended in 8 ml of equilibrated GOEC medium.
The GOEC were cultured in a 2S cmz flask, re-fed on day 3, and harvested by
trypsinization oxa day six, as previously described. Monolayers were prepared
weekly, from primary (p~1JC cultures, for each experiment. Cells were
_70_
CA 02431859 2003-06-20
CVO 00/26357 PC'~I17S99125710
resuspended in GOEC medium at Sx1051m1, and 50 microliter/well was seeded in
4-well plates (lSmm). .The medium was overlaid with 0.5 ml light paraffin oil,
and the plates were cultured in a humidified 5% C~~'' incubator at
38°C. The
cultures were re-fed on day two with 80% fresh equilibrated culture medium.
All
reconstructed embryos were cocultured with the GUEC rrionolayers in vitro in
incubator at 39°C, 5% C02 before transfer to recipients of GTC farm. ..
All experimental replicates for ATIII yielded cleavage stage embryos that
were transferable on day 2 into synchronized recipients. Embryos using
fibroblasts arid epithelial cell phenotype as donor karyoplasts showed
cleavage
and development in culture. The percentage of cleavage development was higher
in reconstructed couplets that used preactivated telophase II stage cytoplasts
(45%) and telophase II-ethanol activated (56.%) wren compared to cytoplasts
used at metaphase II arrested (35%) using ATIII karyoplasts. There were no
differences observed in the cleavage rates of embryos that were reconstructed
using donor karyoplasts in G°, G, or S-phase of the cell cycle
although, the
morphological quality of embryos vVas better wherd doaaor karyoplasts were in
as
G° ~r.G, compared to S-phase. -Embryos were generally between the 2 to
8 cell
stage with the majority of the embryos having 3=4 blastorueres at the time of
transfer. Normal cleavage development corresponded chronologically to
approximately 36 to 48 hours post fusion and activation. IvIorphoiogicaiiy
normal appearing embryos were selected at the 2 to 8 cell stage following
development in vitro for 36 to 48 hors.
Estrus Synchrortizatzon of Recipient does
Hormonal treatments were delayed by 1 day for recipients (as compared
to donors) to insure donor/recipient synchrony. Estrus was synchronized on day
1 by a 6 mg subcutaneous norgestomet ear implant. A single injection of
prostaglandin was administered on day 8. Starting on day 14, a single
intramuscular treatment of PMSG (CalBiochem IJS) was administered. The ear
3o implant was removed on day 15. Twenty-four hours following implant removal,
-79-
CA 02431859 2003-06-20
WO 00126357 t'C'&'ltJ~99/257t0
recipient does were mated several times to vasectomized males over three
consecutive days.
Enzbryo Transfer to Recipienat does
Reconstructed embryos were co-cultured with G~EC monolayers for
approximately 4~ hours prior to transfer to synchronized recipients.
Immediately -
prior to transfer, reconstructed embryos were placed in equilibrated Ham's F-
12
medium + 10% F13S. 'Two to four reconstructed embryos were transferred via the
fimbria into the oviductal lumen of each recipient. Transfers were perfotTned
in a
minimal volume of IIIams's F-12 medium -~- 10% FBS using a sterile fire-
polished
glass micropipet.
The development of embryos reconstructed by nuclear transfer using
transgenic caprine fetal fibroblasts and i~a vivo derived oocytes is
summarized in
Table 1. There was a, total of 14 .rounds of collection and transfers, with 4
donors
set up for cGllection and ~--5 recipient does set up for transfer 4~ hours
later. The
three different enucleati~n/activation protocols were employed: Metaphase II,
Telophase, and l~Ietaphas~ II pretreated with Ethanol: Following fission-
activation, reconstructed embryos were co-cultured with primary goat
epithelial
cells; at least until cleavage (2-cell stage) up to early 1 fs-cell stage;
with most
embryos being transferred at chronologically correct,2- and 4-cell stages. X11
transfers were surgical and oviductal, in hormonally synchronized recipients
(due
to the season). Rates of development were slightly superior when using the
Telophase protocol and Ethanol protocol as compared to the Metaphase II
protocol. This is partly due to the fact that enucleation of the second polar
body
seems less traumatic for the oocytes, and partly due to what seems to be
higher.
activation rate for oocytes pretreated with ethanol.
Table 1: Development of caprine embryos reconstructed by nuclear transfer of
transgenic fetal fibroblasts. Three enucleation/procedure were used: Metaphase
II
{first polar body enucleation), Telophase (second polar body enucleation),
-80-
CA 02431859 2003-06-20
VVO 00/2b357 P~T/US99I25710
Ethanol (preactivation of Metaphase II stage oocytes by ?% ethanol treatment
prior to enucleation). In all cases, concomitant fusion and activation was
used.
Enucleation oocytes Oocytes Embryos Embryos
And Reconstructedlysed Cleaved ~'ransferred
-
activation ( o ) ( o )
,
protocol
Metaphase
II 138 67(48.5) 48(35) 47 .
Telophase 92 38(41) 41(44).. 38
Ethanol 55 23(42) 31(56) 27
FoIiowing embryo transfer, recipient does were examined by ultrasound,
as early as day 25. ~-Iigh pregnancy rates ranging from 55-78% for ATIII
recipient does were diagnosed. For all three enucleation/activation protocols,
it
was observed that high proportion of does (65%) appeared. positive at day ~0.
However, it must be noted that, in most cases, fetal ;heartbeats could not be
detected at such an early stage. Moreever, the positive ultrasound signal
detected
at day 30 was not characteristic of normal embryo development and appeared
closer to vesicular development not associated with the formation of an embryo
proper. This kind of embryonic development is not typically observed in other
caprine embryo transfer programs (for example with microinjected embryos).
Biweekly, examination of these vesicular developments between day 25 and day
,,n w.r_.,v...a 6z.,.:. +z .~ 1. i .,.~ ~t da~r 4C) mr~o"ct ref the
~tV cW auai5ucu mame:jc prcg ",aaaavi28 w2rc. ava.~.~:~.il. aaau J , ...
fetuses were reabsorbed and normal ultrasound images were not apparent.
However, far 2 pregaiancies, heartbeats were detected by day 40. In these
2 cases, ultrasound examination between day 25 and day 40, not only detected a
heartbeat, but also showed the development of recognizable embryonic
strictures.
One of these pregnancies was established using the; Metaphase II
enucIeation/activation protocol, fusing the enucleated cytoplast to a
quiescent
karyoplast originating from a passage 6 culture of the CFF I55-92-6 fibroblast
cell
line. In this instance, 4 four-cell stage reconstructed embryos were
transferred to
the oviduct of the recipient doe. The other pregnalzcy {twins) was obtained
from
embryos reconstnacted according to the Tel~phase enucleation/activation
-81-
CA 02431859 2003-06-20
WO 00/26357 ~'C'1'/US99/25790
protocol, fusing an ertucleated cytoplast derived from preactivated telophase
Caz+
oocytes and G, karyoplasts originating from a passage 5 culture of the CFF I
55- r
92-6 epithelial cell line. In this case, 3 reconstructed embryos (1 two-cell
stage
and 2 four-cell stage) were transferred to the oviduct of the,recipient doe.
No pregnancies were observed with embryos generated by the Ethanol
enucleation/activation protocol. I-lowever, numbers are i~ot large enough to
conclude on the relative efficacy of the 3 enucleation/activatiom protocols
used in
this study.
Table 2: Induction of pregna~a~y and further development following transfer ~f
eaprine embryos reconstructed with transgenic fetal fibroblasts and activated
according to three protocols
Enucleation RecipientsUltrasound Results . Term --~
~
Activation (average (positive/total recip) prec~nancie
#
protocol of
embryos/
recip) 30 days 40days 50 days
Metaphase J
II 15(3.1) 9/i5 1/15 2/15 1
Telophase 14(2.7) 11/14 1/14 1/14 1 (twins)
Ethanol 9(3) 5/9 0/9 0/9 0
Peri~aratcal Care of Recipieyat E~aabryos
Does were monitored daily throughout pregnancy for outward signs of
health (e.g.; appetite; alertness, appearance). Pregnancy was determined by
ultrasonograph 25-28 days after the first day of standing estrus. Does were
ultrasounded biweekly till approximately day 75 and there after once a month
to
monitor and assess fetal viability. Additionally, recipient does had serum
samples drawn at approximately day 21 post standing estrus for serugn
progesterone analysis. This was to determine if a functioning corpus luteum
was
present. and h~w this compared to the animal's reproductive status (i.e.,
pregnancy)., At approximately day 130, the pregnant does were vaccinated with
tetanus toxoid and Closta-idium C8il~. Selenium ~ vitamin E (Bo-Se) and
vitamins A, D, and 13 complex were given intramuscularly or subcutaneously and
_82_
CA 02431859 2003-06-20
iv0 00/26357 P~TI~.JS99/25710
a dewormer was administered. T'he does were moved to a clean kidding stall on
approximately Day 143 and allowed to acclimate to this new environment prior
to
kidding. Observations of the pregnant does were increased to monitor for signs
of pending parturition. After the beginning of regular contractions, the does
remained under periodic observation until birth occurred. If labor was not
progressive after approximately 1 S minutes of strong contractions the. fetal
..
position was assessed by vaginal palpation. If the position appeared normal
then
the labor seas allowed to proceed for an additional 'i-30 minutes (depending
on
the doe) before initiating an assisted vaginal birth. If indicated a cesarean
section
1 o was performed. When indicated, parturition was induced with approximately
S-
mg of PGF2oc (e.g. Lutalyse). This induction can occur approximately
between I4S-155 days of gestation. Parturition generally occurs between 30 and
40 hours after the first injection. The monitoring process is the same as
described
above.
Once a kid was born, tlae animal was quickly towel dried and checked for
gross abnormalities and normal breathing. Kids were immediately reraaoved from
the dam. Once the animal was determined to be in good health, the umbilicus
was dipped in 7% tincture of iodine. Within the first hour of birth, the kids
received their first feeding of heat-treated colostrurn. At the time of birth,
kids
2o received injections of selenium t~ vitamin F (uso-Se) and vitamins h, i.r,
and is
complex to boost performance and health.
The first transgenic female goat offspring vvas produced by nuclear
transfer was bom after 154 days of gestation following the induction of
parturition and cesarean delivery. The birth weight of the offspring was x.35
kg
which is within the medium weight range of the alpine breed. The female twins
were born naturally with minimal assistance a month later with a gestation
length
of 1 S 1 days. The birth weights of the twins were both 3.5 kg which are also
within the medium weight range for twins of this breed. All three kids
appeared
normal and healthy and were phenotypically similar for coat color and
expressing
markings typical of the alpine breed. In addition, ;all three offspring were
similar
_83_
CA 02431859 2003-06-20
w~ 00126357 t'C'I'IL)S99/~57t0
in appearance to the transgenic founder buck. No distinguishable phenotypic
influence from the breed of the donor oocyte (Saanen, Toggenburg lbreed) or
the .
heterogeneous expression of the fetal genotype was observed.
Transgenfc CI~ned Goats
In order to confirm that the three kids were transgenic for the BC6
construct comprising the goat beta casein promoter and the human A.TIII gene
sequence, PCR amplification and southern analysis bf the segment of the
transgene were perfosrned.
Shortly after birth, blood samples and ear skin biopsies were obtained
form the cloned female goats and the surrogate darns. The samples were
subjected to genomic I7I~TA isolation. Laird et al. (1991 ) Nucleic Acids Res.
19:4293. Each sample was first analyzed by PGR using AT HI specific primers,
and then subjected to Southern bI~t analyses usrng the AT IH cI~RTA (Edmunds
et
95 al. (i998) Blood 9i:45b1-4571). F'or each sample, 5 pg of genomie I~hIA was
digested with EcoRI (IoTew England Riolabs, I3everly, NIA), electrophoresed i~
0.7% agar~se gels (SeaI~ern~, ft~E) and irnfnobilized on nylon membranes
(MagnaGraph, MSI, ~Iestboro, MA) by capillary transfer following standard
procedures. Laird et al. (1991) Nucleic Acids Res. 19:4293. Membranes were
2p prQl~ed with the 1.5 kb ~'h'h~ I ~o Sc~l I AT III cDIvIA fragment labeled
with a, -3zP
dCTP using the Prime-It~ kgt (Stratagene, La Jolla, CA). I-Iybridization was
executed at 65°C overnight. Church et al. (1984) Prot. Nail Acad: Sci.
~1S'.~.
81:199.1-1995. The blot was washed with 0.2 X SSC, 0.1 % ST)S and exposed to
X-OMATT'" AR film for 48 hours.
PCR analysis confirmed that all of the kids were transgenic for the l3Cb
construct comprising the g~at beta casein promoter and the human ATHI gene a
sequence. Southern blot analysis demonstrated the integrity of the ~C6
transgene. Hybridization to a diagnostic 4.1 kb EcolZf fragment was detected
for .
all three cloned animals, the cell lines and a transgenic posit':ve control,
blrt not
0
CA 02431859 2003-06-20
w~ 00126357 1'CT3'g1S99125710
for the two recipient does. As expected, due to cross hybridization of the
ATIII
cDNA probe to the endogenous goat AT locus; a 14 kb band was detected in all
samples.
In addition, fluorescence in situ hybridization (FISH) was performed to
determine the integration site of the BC6 construct. . For typing of the
cloned
goats, whole blood was cultured for lymphocytes harvest. Ponce de Leon et al.
{1992} J. Hared. 83:36-42. Fibroblast cells and.lymphocytes were pretreated
and
hybridized as previously described in van de Corput et al. (1998) Histochem
Ccll
Biol. 110:432-437, and Klinger et al. {1992).,Qm. J. Ha~rracara. Genet. 51:55-
65. A
digoxygen labeled probe containing the entare 14.7 kb BC6 transgene was used
in
this procedure. The TSA T~'-Direct system (NEN T"" L ife Science Products,
Boston, MA} was used to amplify the signal. R-bands were visualized using
DAPI counterstain and identified as in Di Berardino et al. (1987) J. ~lered.
78:225-230. A Zeiss Axioskop microscope mounted with a FIamamatsu Digital
Camera was used with Image-Pro C~ Plus software {Media Cybernetics, Silver
Spring, MD) to capture and process images.FISI-i analysis of blood cultures
from
each transgenic kid with probes for the BC6 transgene showed that all three
carry
a chromosome 5 transgene integration identical to thai: found in the metaphase
2o plates derived from the CFF6 cell line. Moreover; analysis of at least 75
metaphase plates for each cloned offspring confirmed that they are not mosaic
far
the chromosome 5 transgenec integrateon.
As final confirmation that all three kids are derived from the transgenic
CFF6 cell line, PCR-RFLP analysis for the very polyrnorphic MI-iC class II
DRI3
gene was undertaken. Typing for the second axon of tt~e caprine MHC class II
DRB gene was perfom~ed using PCR-RFLP Typing as described Amills et al.
(1996) Irramunopathol: 55:255-260. Fifteen microlitens of nested PCR product
was digested with 20 units of Rsal (New England Biolabs, Beverly, MA}.
Following digestion, restriction fragments were separated at room
teri9perature in
-85-
CA 02431859 2003-06-20
gyp ~0/z635°7 ~~~'~~~9izs r~~
a 4 to 20 % nondenaturing polycrylalnide gel (1~VPT~" precast gel, Stratagene,
La
Jolla, CA) in the presence of ethidiuln bromide.
As illustrated by the Rsral digests of the I?RB gene second axon, the three
cloned offspring are identical to each other and identical to the CFF6 donor
cell
line; whereas the recipient does carry different alleles.
,Induction o, f Lactation and T~cansgene Expression of Proteins zn Milk
In order to determine whether the targeted mammary gland specific
expression of human ATIII proteins were present in milk, the cloned transgenic
prepubertal clones were transiently induced to lactate. . .At two rilonths of
age,
the cloned offspring was subjected to~a tyro week hormonal lactati~il-
induction
protocol. Horanonal induction of.lactation for the CFF6-1 female was performed
as described in Ryot et al. ( 1989) Indian ~ Anima Res. 10:49-51. 1 he.~Fl~6-1
kid
was hand-milked oncd daily to collect milk samples for AT III expression
95 analyses. All protein analysis methods 4.,rre described in lrdanunds et al.
(1998)
Blood 91:4561-4571. Concentration of recombinant A'TIII in the milk was
determined by a rapid reversephase HiPLC method using a Hewlett Packard 100
f3PLC (Wilmington, TAE) with detection at 214 nm. The ATIII activity was
evaluated by measuring thrombin inhibition with a tw~-stage colorimetric
20 endpoint assay. ~Iestern blot analysis was performed ~itl~ an affinity
purified
sheep anti-ATIiI 1~RP c~njugated polyclonal antibody (Sero'Tec, ~xford, LJI~).
Samples were boiled for 30 seconds, in redueing sample buffer prior to loading
onto a 10-20 % gradient gel (~wl Scientific). Electrophoresis was operated at
164 volts (constant) until the dye front ran off the gel.
25 At the end of the treatment, small milk samples of 0.5 to 10 ml were
collected daily for 20 days. 'fhhe small initial volumes of milk, 0.5 to 1
lnl, were
typical of the amounts seed in prepubertal female goats hormonally induced to
lactate. The volumes increased to 1.0 ml per day by the time the female was
dried
off, 25 days after the onset. The concentration and activity of ATI3I in
several of
30 the samples was evaluated. As pgeviously noted with does frown tills
specific EC6
~gg-
CA 02431859 2003-06-20
WO 00!26357 P~T/1JS99125710
transgenic cell line, high levels of the recombinant ATIII was detected by
, Western blot analysis. Edmunds et al. (1998) Blood 91:4561-4571. The
concentration of recombinant ATIII in the milk of the cloned offspring was 5.8
grarris per liter (20.SU/ml) at day 5, and 3.7 grams per liter (14.6 U/ml) by
day 9.
These were in Line with levels recorded during the early part of a first
natural
lactation of does from this 13C6 line (3.7 to 4.0 grams per liter).
1 o . Discussion:
Healthy transgenic goats were obtained by nuchar transfer of somatic
cells to oocytes that were enucieated either in the arrested Metaphase II or
the
activated Telophase II-stage. These studies show that serum-starved cells used
to
generate term pregnancies are likely at the G~/G, transitaon following
restoration
with 10% serum.
Imrrunoflcresence screening revealed that after 7 days of serum
starvation, fetal somatic cells were negative for G, stage cyclins D.1, D2, D3
and
PCNA; whereas within 3 hours of 10% FBS serum-activation a majority (e.g.
approximately 70%) expressed these markers.
Deconstruction of an enucleated metaphase II arrested oocyte with the
transfer of a nucleus from a don~r karyoplast synchronized at G° or G,
of the,cell
cycle following simultaneous fusion and activation mimic the chronological
events 'occurring during fertilization. The successful dLevelopment to term
and
birth of a normal and healthy .tiansgenic offspring following the
simultaneoais
fusion and activation protocol is in contrast with procedures.employed in
other
studies that report the requirement for prolonged exposure of donor nuclei to
elevated cytoplasmic MPF activity to support cha~omavdn remodeling and
reprogramming. See Campbell et a1. (1996) Nature 380:64-66; V~ilmut et aI.
(1997) Nature 385:810-813; Schnieke et al. (1997) Science 278:2130-2133;
Cibelli et al, (1998) Science 280:I2S6-1258. This result challenges the
-07-
CA 02431859 2003-06-20
WO 00/26357 PC'tYtJS99125710
contention that prolonged rera~odeling of the somatic nuclei in conditions of
elevated MPF activity prior to activation is important for embryonic and fetal
development to term. The results also demonstrate that a reconstructed embryo
may not have a requirement for prolonged exposure of the donor nucleus to MPF
nor are NEBD and PCC entirely requisite events. Rather chromatin remodeling
events involving NE13D and PCC are Iikely permissive effects of MPF activity w
and, as such, may not be required for the acquisition of developmental
competence or totipotency. Instead, these events are likely to serve to
facilitate
the acquisition of synchronicity between the cytoplast and the karyoplast.
These
10, events may even be detrimental if normal diploidy is not maintained when
the
donor nuclei are induced to undergo PCC with resultant chromosome dispersion
due to an aberrant spindle apparatus due in part to MPF activity. Therefore,
karyoplast and cytoplast synchronization with respect to cell cycle is
important,
first for maintenance of normal ploidy and, second far the proper induction of
genome reactivation and subseguent acquisition of,developr~zental competence
of
reconstructed embryos.
Further support is pr~vided in the second method where chromatin-intact
metaphase II arrested oocytes were activated to reduce MPF activity and induce
the oocyte to exit the M-phase and enter the first mitotic cleavage.
~(~ flppr07C~~n$tCly J JlOUr~ pUSya~tIV'c~LF(Drll, illG oo(:y6eS S~VGIe
ell~.ILlG4le(1 dt l~I(3~J lilac
stage prior to the onset of Ci, and fused and simultaneously activated with a
don~r
karyoplast in G, prior to S'f'I' of the cycle. In addition, the simultaneous
activation and fusion insured that tendencies of non-aged oocytes to revert
back
to an arrested state were circumvented. ilsing this paradigm, a noranal and
healthy set of twin cloned transgenic kids were produced. This procedure
inherently provides a homogenous synchronization regimen: for the cytoplast to
coincide closer with the donor nuclei in G, prior to S'I°T. Further
preactivatior~
of the oocyte induces a decline in cytoplasmic MPF activity, thus inhibiting
the
occurrence of NEBD and PCC. These results suggest that NEBD and PCC is
only facultative for the induction of cytoplast and karyoplast synchr~ny but
not
m30_
CA 02431859 2003-06-20
WO 00/26357 PCTIUS99/25710
necessary for acquisition of proper genome reactivation and subsequent
. development to term of the nuclear transfer embryo using somatic cell
nuclei.
These, findings further suggest that differentiated cells at the Go or G,
stage
function similar to embryonic blastomeres with respect to their ability to
acquire
totipotency when used in combination with an arrested or an activated
recipient
cytoplast. The use of both metaphase II arrested and telophase II cytoplasts
provides dual options for cytoplast preparation in addition to providing an .
opportunity for a longer time frame to prepare the cytoplast. T'he use of
Telophase II cytoplasts may have several practical and biological advantages.
The telophase appr~ach facilitates efficient enucleation avoiding the
necessity for
chromatin staining and ultraviolet localization. Moreover, enucleati~n at
telophase enables removal of minimal cytoplasmic material and selection of a
synchronous group of activated donor cytoplasts. This procedure, also allows
for
the preparation of highly homogenous group of donor nuclei to be synchronized
~ 5 with the cell cycle of the cytoplast. When used for embryo reconstruction,
these
populations showed a higher rate, of embryonic development in witr~o. 'f hus,
reconstructed embryos comprised ~f a synchronously activated cytoplast and
karyoplast are developmentally competent.
20 In addition to a successful transgenic founder production, nuclear transfer
of somatic cells allows for the selection of the appropriate transgenic cell
line
before the generation of cloned transgenic embryos.- 'I°his is
particularly
important in the cases where several proteins are to be co-expressed by the
transgenic mammary.gland. For example, in the transgenic production of
25 recombinant monoclonal antibodies in milk, heavy chain and light chain
transgenes ideally should be expressed in the same secretory cells of the
mammary epithelium at equivalent levels for the efficient production of intact
. antibodies. In addition, transgenes expressing each protein should be co=
integrated in the same locus to favor equivalent expression and avoid
segregation
30 of heavy chain and light chain transgenes during herd propagation..
-89-
CA 02431859 2004-03-29
50409-13D (S)
The generation of transgenic'animals that have corripletely identical
genetic backgrounds also enhances the possibility of studying the expression
and
secretion characteristics of recombinant proteins by the mammary gland.. For
example, the availability~of several ~completely.identical trarisgenic females
producing recombinant human ATIII will help determine the extent of variation
i-n the carbohydrate structure of this.profein, as it is produced by the
mammary ,
gland.. Thus, it may be feasible to improve the, characteristics of the
recombinant
proteins produces iri the transgenic animal system by varying environmental .
factors, (e.g., nutrition) or to increase the milk volume yield of lactation-
induction
protocols.to diminish further the time necessary to obtain adequate amounts of
recombinant protein for pre-clinical or clinical programs.
The high-level expression of recombinant human ATIII detected in the.
~ 5 milk of the CFF6-1 cloned goat illustrates one of the most important
aspects of
this technology. By combining nuclear transfer with lactation-induction in~
prepubertal goats; it may be possible to characterize transgenic animals and
the
proteins they secrete in 8 to 9 months from the time of cell line transfection
of
milk expression.. The amount of milk collected in an induced lactation. is not
only
20 sufficient to evaluate the recombinant protein yield, but, when. mg per ml
expression levels are obtained, is adequate for more qualitative analyses
w , (glycosylation, preliminary pharmaco-kinetics, biological and
pharmacological
activities). The continued availability o.f the transfected donor cell line
also
insures that genetically identical animals can be quickly generated, to
rapidly
25 supply therapeutic proteins (with predictable characteristics) for clinical
trials.
Other embodiments are within the following claims: .
-90-
