Note: Descriptions are shown in the official language in which they were submitted.
CA 02432736 2003-06-16
WO 02/47721 PCT/USO1/47955
TITLE OF THE INVENTION
SILENCED ANTI-CD28 ANTIBODIES AND USE THEREOF
Field of the Invention
This invention relates to anti-CD28 antibodies defective of mitogenic activity
and to uses thereof.
Ba~ound of the Invention
Immune reactions, particularly organ transplant rejections, are chiefly
attributed to the activation of T
lymphocytes. This activation of T cells is induced by a signal from antigen-
presenting cells (APC). The signal
from the APC involves a first signal via the T-cell receptor (TCR) and a
second signal (costimulat0ry signal) via
costimulatory molecules. The first signal is from the major histocompatibility
antigen (MHC) complex of
peptides antigen where the APC is presents the T-cell antigen through the TCR.
The second signal is mediated
by several co-stimulatory molecules, examples of which include B7 (B7-1 (CD80)
and B7-2 (CD86)) are known
as ligands on the APC side and CD28, CTLA-4, etc. as receptors on the T-cell
side. The ligand B7 is a
glycoprotein belonging to the immunoglobulin super family and is expressed in
B cells etc. which belong to the
antigen-presenting cell group. Both CD28 and CTLA-4, which recognize B7 as the
common ligand, are
transmembrane glycoproteins belonging to the inununoglobulin super family.
Thus, the activation of T cells is
regulated by the concurrent transduction of the first signal via TCR and the
second signal from, e.g., the B7 and
CD28/CTLA-4. The signal from B7-to CD28 is known to promote whereas the signal
from B7 to CTLA-4
inhibits the activation of T cells [Waterhouse et al., Science, 270:985-988
(1995)].
Heretofore, for the purpose of inducing immunosuppression or tolerance,
attempts have been made to
block the B7-CD28 signal by administering CTLA-4Ig, anti-B7-1 antibody/anti-B7-
2 antibody, anti-CD28
antibody or the like. For example, CTIA-4Ig binds to B7 thereby interfering
with the reaction between B7 and
CD28 and, as a consequence, block the signal from CD28 to
exhibit~immunosuppressive activity. However,
since the reaction between B7 and CTLA-4 is also inhibited simultaneously, the
signal of CTLA-4 acting
negatively on the activation of T cells is also suppressed so that the desired
tolerance is not induced (Kirk et al.,
Proc. Natl. Acad. Sci. USA, 94:8789-8794 (1997). An anti-B7 antibody was also
prepared and reported to have
suppressed activation of T cells but just as in the case of CTLA-4Ig, it
suppressed the CTLA-4 signal as well.
CA 02432736 2003-06-16
WO 02/47721 PCT/USO1/47955
An anti-CD28 antibody, in an in vit~~o experiment, was found to produce a
mitogenic effect on T cells, and the
combination of the stimulation with this antibody and an anti-CD3 antibody
promoted the growth and activation
of T cells and enhanced the production of cytolcines [WO 90105541, Eur. J.
Immunology, 16, 1289-1296 (1986),
etc.]. Furthermore, mitogenic stimulation of the CD28 receptor of the T cell
by an anti-CD28 antibody has been
stimulated in vivo resulted in the generation of a T-cell activation signal
similar to the second signal from B7 to
CD28 [Yin et al., J. Immunology, 163:4328-4334 (1999)]. These T-cell
activating functions suggested that an
anti-CD28 antibody might be used as an immunopotentiator in the therapy of
cancer and AIDS (WO 90105541).
.SUMMARY OF THE INVENTION
The anti-CD28 antibodies prepared by conventional technologies exert a
mitogenic action on T cells.
Although the reasons for this mitogenic activity is not fully understood, the
binding of the anti-CD28 Fc region
to the Fc receptor of the antigen-presenting cell is believed to be the
probable reason (Cole et al., J.
Immunology, 36:159 (1997). Therefore, by utilizing genetic engineering
technology, we introduced mutations
into the Fc receptor binding site of the anti-CD28 antibody to modify the
antibody so that it would no longer
have mitogenic activity. One such antibody the present inventors have
generated, TN228 IgG2M3, in which
IgG2M3 has two amino acid substitution in IgG gene. Furthermore, we
demonstrated that the resulting silenced
anti-CD28 antibody has no mitogenic activity which is very useful for inducing
T cell tolerance.
Therefore, the present invention provides anti-CD28 antibodies having no
mitogenic activity
hereinafter referred to as silenced anti-CD28 antibodies), and a methods of
suppressing immune reactions,
particularly transplant rejections, and inducing immunotolerance by using said
antibodies.
An object of the present invention is a silenced anti-CD28 antibody, where the
anti-CD28 antibody
may be a chimeric antibody and/or a humanized antibody. The variable regions
of the anti-CD28 antibodies
may include the amino acid sequences shown in SEQ ID NOS: 2, 4, 6 and 8 and
polynucleotides encoding such
amino acid sequences. For example, such polnucleotides include SEQ ID NOS: 1,
3, 5, and 7.
Another object of the present invention is vectors and cell hosts comprising
the polynucleotides which
encode the anti-CD28 antibodies.
Another object of the present invention is methods for producing the silenced
anti-CD28 antibody by
culturing a cell host comprising the polynucleotides which encode the anti-
CD28 antibodies under conditions
which allow expression of the polynucleotide and collecting the gene products
produced.
CA 02432736 2003-06-16
WO 02/47721 PCT/USO1/47955
Another object of the present invention is a pharmaceutical composition
comprising one or more of the
silenced anti-CD28 antibodies, preferably admixed with one or more
pharmaceutically acceptable ingredients.
The silenced anti-CD28 antibodies are useful for inducing T-cell tolerance,
immunosuppression and as
a prophylactic/therapeutic drug for organ or tissue transplant rejection.
Accordingly, the present invention
provides methods for inducing T-cell tolerance, immunosuppression, and
providing a prophylaxis or treatment
therapy during an organ or tissue transplant rejection by administering one or
more of the silenced anti-CD28
antibodies to a mammal. Preferably, such silenced anti-CD28 antibodies are
administered in as a
pharmaceutical composition as described herein and may include additional
drug/pharmaceuticals where
appropriate.
BRIEF DESCRIPTION OF DRAWINGS
Figure 1. Plasmid constructs for ChTN228 antibody expression. VL and VH of
marine TN228 were
constructed as mini-exons flanked by Xbal sites. The VL sequence was
incorporated into the expression vector
pVk and the VH sequence was incorporated into the expression vector pVg2M3.
Figure 2. Nucleotide sequences and deduced amino acid sequences of the light
chain of GhTN228 in
the mini-exons. The signal peptide sequences are in italics. The CDRs are
underlined. The mature light chain
begins with an aspartic acid residue (bold letter). Untranslated and intron
sequences are in lower case . (SEQ ID
NOS: 1 and 2).
Figure 3. Nucleotide sequences and deduced amino acid sequences of the heavy
chain variable regions
of ChTN228 in the mini-exons. The signal peptide sequences are in italics. The
CDRs are underlined. The
mature heavy chain begins with a glutamine residue (bold letter). Untranslated
and intron sequences are in
lower case. (SEQ ID NOS: 3 and 4).
Figure 4. Competition experiment. P815/CD28+ cells were incubated with 25 ng
of
MuTN228-FITC and two-fold serial dilutions of either ChTN228 or MuTN228 as
described. P815/CD28' cells
were also incubated with MuTN228-FITC alone, without any competitor. The mean
channel fluorescence for
each sample was plotted against the concentration of competitor.
Figure 5. Inhibition effect of TN228-IgG2m3 on human primary MLR(1).
Percentage inhibition of
primary MLR from four individuals were shown separately.
Figure 6. Inhibition effect of TN228-IgG2m3 on human primary MLR(2).
Percentage inhibition of
primary MLR from four individuals were shown separately.
3
CA 02432736 2003-06-16
WO 02/47721 PCT/USO1/47955
Figure 7. The effect of TN228-IgG2m3 on secondary MLR.
The data from two volunteers were shown separately.
[3H]-thymidine uptake in 2nd MLR were presented as percentage of dpm of Raji
stimulation alone in
Ist MLR as 100. TN228-IgG2m3:0.lug/mL
Figure 8. Plasmid constructs for HuTN228 antibody expression. VL and VH of
humanized TN228
were constructed as mini-exons flanked by XbaI sites. The VL sequence was
incorporated into the expression
vector pVk and the VH sequence was incorporated into the expression vector
pVg2M3
Figure 9. Nucleotide sequences and deduced amino acid sequences of the heavy
chain variable regions
of HuTN228 in the mini exons. The signal peptide sequences are in italics. The
CDRs are underlined. The
mature heavy chain begins with a glutamine residue (bold letter). (SEQ ID NOS:
5 and 6)
Figure 10. Nucleotide sequences and deduced amino acid sequences of the light
chain variable regions
of HuTN228 in the mini exons. The signal peptide sequences are in italics. The
CDRs are underlined. The
mature light chain begins with an aspartic acid residue (bold letter). (SEQ ID
NOS:7 and 8)
Figure 11. FAGS competition assay. The binding of FITC-labeled MuTN228 to
P815/CD28' cells in
the presence of various amounts of competitor MuTN228 or HuTN228 antibody was
analyzed in a flow
cytometry competition experiment as described in the examples.
Figure 12. ELISA competition assay. The binding of biotinylated MuTN228 to
sCD28-Fc in the
presence of various amounts of competitor MuTN228 or HuTN228 antibody was
analyzed in an ELISA
competition experiment as described in the examples.
Figure 13. I-125 competition assay. The binding of'z5I labeled MuTN228 to
P815/CD28+ cells in the
presence of various amounts of competitor MuTN228 or HuTN228 antibody was
analyzed in an lzsl labeled
antibody competition experiment as described in the examples.
Figure 14. Plasmid constructs for PVl-IgG3 antibody expression. VL and VH of
PVl were
constructed as mini-exons flanked by XbaI sites. The VL sequence was
incorporated into the expression vector
pMVk.rg.dE, and the Vg sequence into the expression vector pMVg3.D.Tt. The two
plasmids were then
recombined to generate a single plasmid co-expressing the heavy and light
chains of PV 1-IgG3.
Figure 15A . Sequences of cDNA and deduced amino acid sequences of the light
chain and heavy
chain in the mini-exons. The CDRs are underlined. The mature light chain
begins with an aspartic acid residue
(double underlined) at position 20. (SEQ ID NOS:9 and 10).
4
CA 02432736 2003-06-16
WO 02/47721 PCT/USO1/47955
Figure 15B. Sequences of cDNA and deduced amino acid sequences of variable
regions of PV 1 in the
mini-exons. The CDRs are underlined. The mature heavy chain with glutamine
(double underlined) at position
20. (SEQ ID NOS:11 and 12).
Figure 16. Analysis of PV-1-IgG3 by size exclusion chromatography using HPLC
as described in
Methods. The protein was monitored by its absorbance at 280 nM.
Figure 17. SDS-PAGE analysis ofmouse IgG3 isotype control (lane 1), PVl (lane
2), and PVl-IgG3
(lane 3). Proteins in Panel A were nm under nonreducing conditions, and in
Panel B reducing conditions. MW
represents molecular weight markers. The numbers are MW standards in kD.
Figure 18. EL4 cells stained with PV 1 (A), 37.51 (B), or PV 1-IgG3 (C), and
analyzed by flow cytometry.
Secondary antibodies used were: FITC-conjugated donkey anti-Armenian hamster
IgG (H+L) for PV 1, FITC-
conjugated donkey anti-Syrian hamster IgG for 37.51, and FITC-conjugated goat
anti-mouse kappa for PV 1-IgG3.
The solid line profiles represent cells stained with secondary antibodies
only. The broken line profiles represent '
cells stained with both primary and secondary antibodies as described in
Methods . Mouse IgG3 isotype control did
not stain EL4 cells (data not shown).
Figure 19. (A). Excess PVl, or PVI-IgG3 competes with R-PE-conjugated PV1 for
binding to
EL4 cells. Thin solid line (black) in flow cytomeiry histogram represents
cells without any staining, thick solid
line (dark blue) cells stained with R-PE-PV 1 alone, thin broken line
(magenta) cells stained with R-PE-PV 1 and
excess unconjugated PVl, and thin double broken line (light blue) cells
stained with R-PE-PVl and excess
unconjugated PVl-IgG3. Excess mouse IgG3 isotype control had no effect on R-PE-
PVl's binding to EL4 cells
(data not shown). (B). Excess 145.2C11, or 145.2C11-IgG3 compete with R-PE-
conjugated 145.2C11 for
binding to EL4. Thin solid line (black) represents cells without any staining,
thick solid line (dark blue) cells
stained with R-PE-145.2C11 alone, thin broken line (magenta) cells stained
with R-PE-145.2C11 and excess
unconjugated 145.2C11, and thin double broken line (light blue) cells stained
with R-PE-145.X11 and excess
unconjugated 145.2C11-IgG3. (C). Excess PVl competes with PV 1-IgG3 for
binding to EL4 cells. EL4 cells
were stained with PVl-IgG3 with or without excess PVl. Cells were washed and
stained with mouse IgG3-
specific, FITC-conjugated donkey anti-mouse IgG (H+L). Thin solid line (black)
represents cells stained with
secondary antibodies only, thick solid line (dark blue) cells stained with PV
1-IgG3 and secondary antibodies,
and thin broken line (magenta) cells stained with PV 1-IgG3 and excess PV l,
and secondary antibodies.
Figure 20. Mouse splenic cells stained with PVl-IgG3 and 145.2C11. Cells were
stained with mouse
IgG3 isotype control (A) or PVl-IgG3 (B), counter-stained with R-PE-conjugated
goat anti-mouse IgG3 and
CA 02432736 2003-06-16
WO 02/47721 PCT/USO1/47955
with FITC-conjugated 145.X11, and analyzed by two-color flow cytometry as
described in Materials and
Methods . Only cells in the lymphocyte gate were analyzed. PVl-IgG3-positive
cells are in the upper quadrants
and CD3-positive cells are in the right side quadrants. The number in each
quadrant represents percentage of
the cells in that particular quadrant.
DETAILED DESCRIPTION OF THE INVENTTON
In the context of this invention, the term "silenced anti-CD28 antibody" means
any anti-CD28 antibody
defective of mitogenic activity. More specifically, it is an antibody which
binds specifically to the antigen
CD28 receptor on the surface of the T cell and does not promote the growth or
activation of T cells by combined
stimulation with an anti-CD3 antibody.
A silenced anti-CD28 antibody can be constructed on the basis of an anti-CD28
antibody or an anti-
CD28 antibody-producing hybridoma by mutating or modifying an agonistic anti-
CD28 antibody by a genetic
engineering technique or by chemical modification. Taking the use of genetic
engineering technology as an
example, the binding affinity of the anti-CD28 antibody for the Fc receptors
can be reduced or eliminated by
introducing a mutation into the amino acid sequence of the Fc domain of the
antibody. For example, a silenced
anti-CD28 antibody can be obtained by isolating cDNA from hybridoma cells
capable of producing an anti-
CD28 monoclonal antibody and introducing a mutations) into the region of the
sequence corresponding to the
Fc domain which plays an important role in the binding to the Fc receptor (WO
88!07089). The site of mutation
is not particularly restricted inasmuch as the binding to the Fc receptors may
be inhibited. Thus, in the case of a
Class IgG antibody, for instance, the H-chain amino acid residues 234, 235,
236, 237, 318, 320 and 322 are
preferred and a silenced anti-CD28 antibody can be constructed by replacing at
least one of these amino acids
with a different amino acid.
The source of such a silenced anti-CD28 antibody can be judiciously selected
according to the target
animal in which the antibody is used. For example, nonhuman monoclonal
antibodies contain amino acid
sequences showing antigenicity in humans over a fairly broad range. Many
studies have shown that the immune
response of a patient to a foreign antibody following injection of the
antibody is remarkably intense and the very
administration of the antibody may bring the patient into a perilous condition
or deprive the antibody of the
therapeutic utility. Therefore, it is recommendable to replace the Fc region
so as to make the antibody relatively
more homologous to the therapeutic target animal, replace the framework
potions of the variable regions, or use
the antibody obtained from a transgenic animal into which the antibody gene of
the target animal has been
CA 02432736 2003-06-16
WO 02/47721 PCT/USO1/47955
introduced. For example, when the antibody is to be administered to a human, a
chimeric antibody (EP 125023)
available on replacement of the Fc region, a humanized antibody with the
framework portion replaced
(EP0239400, EP045126) or a human antibody (EP546073, WO 97/07671) obtained
from a transgenic animal
into which the human antibody gene has been introduced. By introducing
mutations in these antibodies by
genetic engineering techniques such as those described above or by chemical
modification, the mitogenic
activity of the antibodies can be reduced or eliminated.
As specific examples of the anti-CD28 antibody having a silenced Fc region,
there can be mentioned
not only the antibodies described hereinafter in the Examples section but also
the antibodies synthetically
prepared using the constant region gene of the therapeutic target animal and
the variable region polynucleotides
based on the amino acid sequences of variable regions shown in SEQ ID N0:2 and
N0:4 or SEQ ID N0:6 and
N0:8. Examples of such polynucleotides are SEQ 1D NOS:1, 3, 5, and 7.
More specific examples of this invention are HuTN228 and MuTN228 and Fab
fragments thereof
F(ab)'2 fragments thereof, derivatives thereof and etc..
As appreciated by those skilled in the art, because of third base degeneracy,
almost every amino acid
can be represented by more than one triplet codon in a coding nucleotide
sequence. Further, minor base pair
changes may result in variation (conservative substitution) in the amino acid
sequence encoded, are not expected
to substantially alter the biological activity of the gene product. Thus, a
nucleic acid sequencing encoding a
protein or peptide as disclosed herein, may be modified slightly in sequence
(e.g., substitution of a nucleotide in
a triplet codon), and yet still encode its respective gene product of the same
amino acid sequence.
The term "expression vector" refers to an polynucleotide which encodes the
peptide of the invention
and provides the sequences necessary for its expression in the selected host
cell. Expression vectors will
generally include a transcriptional promoter and terminator, or will provide
for incorporation adjacent to an
endogenous promoter. Expression vectors will usually be plasmids, further
comprising an origin of replication
and one or more selectable markers. However, expression vectors may
alternatively be viral recombinants
designed to infect the host, or integrating vectors designed to integrate at a
preferred site within the host's
genome. Examples of expression vectors are disclosed in Molecular Cloning: A
Laboratory Manual Second
Edition, Sambrook, Fritsch, and Maniatis, Cold Spring Harbor Laboratory Press,
1989.
Suitable host cells for expression of the silenced anti-CD28 antibody include
prokaryotes, yeast,
archae, and other eukaryotic cells. Appropriate cloning and expression vectors
for use with bacterial, fungal,
yeast, and mammalian cellular hosts are well known in the art, e.g., Pouwels
et al. Cloning Vectors: A
CA 02432736 2003-06-16
WO 02/47721 PCT/USO1/47955
Laboratory Manual, Elsevier, New York (1985). Preferably, the cells are
mammalian cells. The vector may be
a plasmid vector, a single or double-stranded phage vector, or a single or
double-stranded RNA or DNA viral
vector. Such vectors may be introduced into cells as polynucleotides,
preferably DNA, by well known
techniques for introducing DNA and RNA into cells. The vectors, in the case of
phage and viral vectors also
may be and preferably are introduced into cells as packaged or encapsulated
virus by well known techniques for
infection and transduction. Viral vectors may be replication competent or
replication defective. In the latter
case viral propagation generally will occur only in complementing host cells.
Cell-free translation systems
could also be employed to produce the proteins using RNAs derived from the
present DNA constructs.
The silenced anti-CD28 antibodys/proteins can be purified by
isolationlpurification methods for
proteins generally known in the field of protein chemistry. More particularly,
there can be mentioned, for
example, extraction, recrystallization, salting out with ammonium sulfate,
sodium sulfate, etc., centrifugation,
dialysis, ultrafiltration, adsorption chromatography, ion exchange
chromatography, hydrophobic
chromatography, normal phase chromatography, reversed-phase chromatography,
gel filtration method, gel
permeation chromatography, affinity chromatography, electrophoresis,
countercurrent distribution, etc. and
combinations of these.
According to the present invention, purified antibodies may be produced by the
recombinant expression
systems described above. The method comprises culturing a host cell
transformed with an expression vector
comprising a DNA sequence that encodes the protein under conditions sufficient
to promote expression of the
protein. The protein is then recovered from culture medium or cell extracts,
depending upon the expression
system employed. As is known to the~skilled artisan, procedures for purifying
a recombinant protein will vary
according to such factors as the type of host cells employed and whether or
not the recombinant protein is
secreted into the culture medium.
The silenced anti-CD28 antibody when formulated into a pharmaceutical
composition can be used in
(a) transplant rejections following the transplantation of organs or tissues,
such as heart, kidney, liver, bone
marrow, skin, cornea, lung, pancreas, small intestine, muscle, nerve, etc.;
(b) graft-versus-host reactions in the
transplantation of bone marrow; (c) autoimmune diseases such as rheumatoid
arthritis, systemic lupus
erythematosus, multiple sclerosis, myasthenia gravis, type I diabetes, etc.;
and (d) immune diseases such as
asthma, atopic dermatitis, etc.
While the silenced anti-CD28 antibody by itself can be expected to suppress
immune reactions and
transplant rejections and induce immunotolerance, it can also be used in
combination with other drugs. Among
CA 02432736 2003-06-16
WO 02/47721 PCT/USO1/47955
such other drugs which are useful for combining with the silence anti-CD28
antibody are various
immunosuppressants such as rapamycin, deoxyspergaulin, anti-CD40 antibody,
anti-CD40L antibody, prograf,
cyclosporin A, anti-IL-2 antibody, anti-IL-2 receptor antibody, anti-IL-12
antibody, anti-ILl2 receptor antibody
and MMF. Rapamycin, in particular, inhibits transduction of the signal related
to growth of T cells among
S signals from the IL2 receptor but does not inhibit transduction of the
apoptosis-related signal, so that its use in
combination with a specific inhibitor of the CD28 signal is expected to be
usefizl.
The silenced anti-CD28 antibody of this invention can be administered orally
or parenterally,
preferably by the intravenous, intramuscular or subcutaneous route.
The silenced anti-CD28 antibody of this invention can be prepared in the form
of a solution or a
lyophilized powder and, where necessary, may be formulated with various
pharmaceutically acceptable
additives such as an excipient, diluent, stabilizer, isotonizing agent and
buffer. The preferred additives include a
sugar such as maltose, a surfactant such as polysorbate, an amino acid such as
glycine, a protein such as human
serum albumin, and a salt such as sodium chloride.
Also, the dosage form such as injectable preparations (solutions, suspensions,
emulsions, solids to be
dissolved when used, etc.), tablets, capsules, granules, powders, liquids,
liposome inclusions, ointments, gels,
external powders, sprays, inhalating powders, eye drops, eye ointments,
suppositories, pessaries, and the like
can be selected appropriately depending on the administration method, and the
peptide of the present invention
can be accordingly formulated. Formulation in general is described in Chapter
25.2 of Comprehensive
Medicinal Chemistry, Volume 5, Editor Hansch et al, Pergamon Press 1990.
The dosage of the pharmaceutical composition of this invention is dependent on
the specific
composition, the type of disease as the target of therapy or prophylaxis, the
method of administration, the
patient's age and condition and the duration of treatment, among other
variables. However, in the case of
intravenous, intramuscular or subcutaneous administration, 0.01-100 mg/kg,
preferably 0.1-10 mg/kg, per day
per adult can be administered.
When the silenced anti-CD28 antibody of this invention is used for suppression
of transplant rejection
or induction of immunotolerance in an organ or tissue transplantation, the
composition can be administered in a
dose of about 1 mg/kg/day immediately before transplantation, immediately
after transplantation, and 3, 7, 12,
18, 25, 35, 4S and 60 days after transplantation, by intravenous,
intramuscular or subcutaneous injection. The
administration frequency and dosage may be judiciously increased or decreased
while the course of rejection
reaction after transplantation is monitored.
CA 02432736 2003-06-16
WO 02/47721 PCT/USO1/47955
While the administration interval depends on the method of administration used
and the patient's
condition, among other factors, not only continuous administration but also
intermittent administration is
feasible. Thus, since the silenced anti-CD28 antibody of this invention is an
antibody, it provides a sustained
effect so that intermittent dosing may be rewarded with the expected efficacy.
As to the period of treatment,
once a tolerant state is established, this tolerance can be maintained even if
the use of the silenced anti-CD28
antibody is discontinued. In this respect, this silenced anti-CD28 antibody is
undoubtedly superior to other
immunosuppressants the immunosuppressive effect of which declines after
discontinuation.
EXAMPLES
Having generally described this invention, a further mderstanding can be
obtained by reference to
certain specific examples which are provided herein for purposes of
illustration only, and are not intended to be
limiting unless otherwise specified. The examples below are carried out using
standard techniques, that are well
known and routine to those of skill in the art, except where otherwise
described in detail.
Example 1. Amino acid sequencing of the mouse anti-human CD28 antibody
The hybridoma producing anti-human CD28 antibody (clone:TN228, mouse IgGl
kappa) was
generously provided by Dr. Yagita (Juntendo University School of Medicine,
Japan). Approximately 0.2 mg of
purified anti-human CD28 antibody (TN228) was reduced in 0.64 M guanidine-HCI,
0.28 M Tris-HCI, pH 8.5,
0.055 M DT7 for 90' at 60 C (under argon), carboxymethylated by addition of
iodoacetic acid to 0.13 M for 45'
at room temperature (in the dark), followed by addition of DTr to 0.32 M (to
terminate the carboxymethylation
reaction), and immediately buffer-exchanged in 0.1 M sodium phosphate, 0.002 M
EDTA, pH 8.0 using a PD-
10 column (catalog #17-0851-O1, Amersham Pharmacia Biotech, Uppsala, Sweden).
The eluate was adjusted to
0.005 M DTT, 0.02 % glycerol, and one third of the solution (about 0.35 ml)
was transferred to a separate tube
for N-terminal deblocking of the heavy chain. The sample was digested with
18001tU of pyroglutamate
aminopeptidase (catalog # 7334, Takara Shuzo Co., Ltd., Tokyo, Japan) for 24
hours at 45 C. The N-terniinal
sequences of the light and heavy chains from the deblocked sample were
determined by 20 cycles of automated
Edman degradation and PTH analysis.on a Model 241 Protein Sequencer (Hewlett
Packard, Palo Alto, CA).
The PTH derivatives were analyzed on a Hypersil ODS C18 column. The sequencer
and HPLC were operated
according to the manufacturer's instructions using reagents, solvents, and
columns obtained from Hewlett
Packard.
CA 02432736 2003-06-16
WO 02/47721 PCT/USO1/47955
N-terminal sequencing results for TN228 deblocked with pyroglutamate
aminopeptidase were as
follows:
residue aminoresiduenoamino residuenoamino residueamino
no. acid acid acid no. acid
1 D,Q 6 Q,E 11 L 16 G,Q
2 1,v 7 s 12 A,V 17 Q,S
3 V, 8 P, G 13 V, A 18 R, L
Q
4 L 9 A,P 14 S,P 19 A,S
T, 10 S, G 15 L, S 20 T, I
K
5 Example 2. Cloning of variable region cDNAs
The V region cDNAs for the light and heavy chains of TN228 were cloned from
the hybridoma cells by
an anchored polymerase chain reaction (PCR) method described by Co et al. (Co,
M.S., N.M. Avadalovic, P.C.
Carom M.V. Avadalovic, D.A. Scheinberg, and C. Queen. 1992. Chimeric and
humanized antibodies with
specificity for the CD33 antigen. J. Irmnunol. 148: 1149-1154.). Amplification
was performed on cDNA using
3' primers that anneal respectively to the mouse kappa and gamma chain C
regions, and a 5' primer that anneals
to the added G-tail of the cDNA. For VL PCR, the 3' primer has the sequence
(SEQ ID N0:13):
5'TATAGAGCTCAAGCTTGGATGGTGGGAAGATGGATACAGTTGGTGC3'
with residues 17- 46 hybridizing to the mouse Ck region. For VH PCR, the 3'
primers have the degenerate
sequences (SEQ ID NOS:14, 15 and 16):
A G T
5'TATAGAGCTCAAGCTTCCAGTGGATAGACCGATGGGGCTGTCGTTTTGGC3'
T
with residues 17 - 50 hybridizing to mouse IgG CH1. Tlie non-hybridizing
sequences in the two primer sets
contain restriction sites used for cloning. The VL and VH cDNAs were subcloned
into a TOPOII Blunt vector
(Invitrogen, Inc., Carlsbad, CA) for sequence determination.
Several light and heavy chain clones were sequenced from two independent PCR
reactions. For the
light chain, two unique sequences homologous to mouse light chain variable
regions were identified. One VL
11
CA 02432736 2003-06-16
WO 02/47721 PCT/USO1/47955
sequence was non-functional due to a frame shift mutation and was identified
as the non-productive allele. The
other VL sequence was typical of a functional mouse kappa chain variable
region. For the heavy chain, a
unique sequence homologous to a typical mouse heavy chain variable region was
identified. Their nucleotide
sequences and their deduced amino acid sequences of variable region are
described in Fig. 2 and Fig. 3.
Example 3. Construction and expression of chimeric TN228-IgG2M3
(Methods)
TN228 VL and VH were converted by PCR into mini-exon segments flanked by Xbal
sites as described
by He et al. (He, X.Y., Z. Xu, J. Melrose, A. Mullowney, M. Vasquez, C. Queen,
V. Vexler, C. Klingbeil, M.S.
Co, and E.L. Berg. 1998. Humanization and pharmacokinetics of a monoclonal
antibody with specificity for
both E- and P-selectin. J. Inanunol. 160: 1029-1035) and were subcloned into
the light chain and heavy chain
expression plasnuds (Fig. 1). Each mini-exon contains a signal peptide
sequence, a mature variable region
sequence and a splicing donor sequence derived from the most homologous mouse
J chain gene. Such splicing
donor sequences are used to splice the V region exon to the human antibody
constant region. Each mini-exon
was sequenced after it had been cloned into the expression vector to ensure
the correct sequence was obtained
and that no PCR errors were generated. The constant region exons of the light
and heavy chain expression
plasmids were also confirmed by sequencing.
In this specification, ChTN228 refers to a chimeric antibody containing the
mouse TN228 VL and VH
variable regions, a liuman IgG2M3 constant region for the heavy chain, and a
human kappa constant region for
the light chain. The heavy chain constant region was modified (Cole, M.S., C.
Anasetti, and J,Y. Tso. 1997.
Human IgG2 variants of chimeric anti-CD3 are nonmitogenic to T cells. J.
Immunol. 159: 3613-3621) from the
germline human 2 genomic fragment, arid the light chain was derived from the
germline human K genomic
fragment. Both the heavy and light chain genes are driven by the human
cytomegalovirus major immediate
early promoter and enhancer. The heavy chain gene is Followed by the
transcription terminator derived from the
human complement gene C2 (Ashfield, R., P. Enriquez-Harris, and N,J.
Proudfoot. 1991. Transcriptional
termination between the closely linked human complement genes CZ and factor B:
common termination factor
for C2 and c-myc? EMBO J. 10: 4197-4207). The light chain selection marker gpt
gene (Mulligan, R.C., and P.
Berg. 1981. Selection for animal cells that express the Escherichia colt gene
coding for xanthine-guanine
phosphoribosyltransferase. Proc. Natl. Acad. Sci. USA 78: 2072-2076) and the
heavy chain selection marker
dlafi~ gene (Simonsen, C,C., and A,D. Levinson. 1983. Isolation and expression
of an altered mouse
12
CA 02432736 2003-06-16
WO 02/47721 PCT/USO1/47955
dihydrofolate reductase cDNA. Proc. Natl. Acad. Sci. USA 80: 2495-2499) are
both driven by the SV40 early
promoter. For expression of chimeric TN228, transient transfection into COS-7
cells (monkey kidney cell line)
was done using lipofectamine (catalog # 10964-013, GIBCO BRL). Spent media
from transient transfectants
were analyzed for human IgG2M3 antibody production by ELISA, using goat anti-
human IgG gamma chain
specific antibody as- capturing reagent and HRP-conjugated goat anti-human
kappa chain antibody as
developing reagent. The spent media was also tested for the ability of ChTN228
to bind to P815/CD28+ cells
(stably transfected cell with CD28 into P815 (mouse mastcytoma)) by indirect
immunofluorescent staining and
analyzed by flow cytometry. For stable cell line -production, the chimeric
expression plasmids were transfected
into marine myeloma cell line Sp2/0 by electroporation and the transfectants
were selected for gpt expression.
The spent media from stable transfectants were analyzed by ELISA as for the
transient transfection.
Results
The cloned VL and VH genes were converted into mini-exons by PCR (Fig. 2 and
3) and subcloned into
the light and heavy chain expression vectors as described above and shown in
Fig. 1.
Transient transfection of COS-7 cells: The chimeric expression vectors were
transiently ixansfected into
monkey kidney cell line COS-7 to produce the chimeric TN228+ antibody. Spent
medium from the transfected
cells was tested by ELISA for the production of chimeric IgG2M3 antibodies and
by flow cytometry for binding
to P815/CD28+ cells. Spent medium was positive in both assays. The yield of
chimeric antibody from transient
transfection was -~0.9 p,g/ml. The ChTN228 antibody from transient supernatant
bound to P815/CD28+ cells in
a concentration dependent manner (data not shovm).
Stable transfection of Sp2/0 cells: The chimeric expression vectors were
transfected into Sp210 cells for
the production of a stable cell line. Spent media from several transfectants
were tested for the production of
chimeric TN228 antibody and for binding to P815/CD28+ cells as with the
transient transfectants. Most
fransfectants were positive for both assays. One transfectant was chosen for
its lugher antibody productivity and
expanded to grow in 5 L of serum free medium. ChTN228 was purified from 5 L of
spent medium by affinity
chromatography. The yield of purified antibody was ~25 mg.
Example 4 Protein purification of chimeric antibodyChTN228
One of the high ChTN228. expressing transfectants from the stable iransfection
(Clone 7H) was grown
in 5 L of GIBCO hybridoma serum-free medium (catalog # 12045-076, GIBCO BRL).
Spent culture
13
CA 02432736 2003-06-16
WO 02/47721 PCT/USO1/47955
supernatant was harvested when cell viability reached 10 % or below,
concentrated to 500 ml, and loaded onto a
ml protein-A Sepharose column using a Phamiacia Pl pump (2-3 ml/min). The
column was washed with PBS
before the antibody was eluted with 0,1 M Glycine, 0.1 M NaCl, pH 2.7. The
eluted protein was dialyzed.
against 3 changes of 2 L PBS and then desalted onto a PD-10 column
equilibrated with PBS containing an
additional 0.1 M NaCI. The desalted protein solution was filtered through a
0.2 ~.m filter prior to storage at 4 C.
Example 5 Purity determination by size exclusion HPLC and SDS-PAGE
Size exclusion HPLC was performed using a Perkin Eliner HPLC system consisting
of a PE ISS 200
Advanced LC Sample Processor, a PE Series 410 Bio LC Pump, a PE 235C Diode
Array Detector, and a PE
Nelson 600 Series LINK. Perkin Ehner Turbochrom Navigator Version 4.1 software
was used to control the
autosampler, pump, and detector, and to acquire, store, and process the data.
Separation was achieved using two
TosoHaas TSK-GEL G3000SWXL size exclusion HPLC columns, 7.8 mm x 300 mm, 5 pm
particle size, 250 h
pore size (catalog # 08541, TosoHaas, Montgomeryville, MD) connected in
series. The mobile phase was 200
mM potassium phosphate/150 xnM potassium chloride at pH 6.9, and the flow rate
was 1.00 mL/minute. The
colunm eluate was monitored spectrophotometrically at both 220 mn and 280 nm.
The injection volume was 50
pL (50 pg) of the ChTN228 sample.
SDS-PAGE was performed according to standard procedures on a 4-20% gradient
gel (catalog #
EC6025, Novex, San Diego, CA).
The purity of the isolated ChTN228 was analyzed by size exclusion HPLC and SDS-
PAGE. Based on
this analysis, the protein is 96.5 % monomer and has the mobility
corresponding to a protein of molecular
weight 160 kD. SDS-PAGE analysis of MuTN228, isotype control MuFd79 (mouse
IgGl), ChTN228, and
isotype control HuEP5C7 (human IgG2M3) under nonreducing conditions also
indicated that all four antibodies
have a molecular Weight of about 150-160 kD. Analysis of the same four
proteins under reducing conditions
indicated all four antibodies were comprised of a heavy chain with a molecular
weight of about 50 kD and a
light chain with a molecular weight of about 25 kD.
Example 6. Competition experiment:
Methods
A titration experiment was done using serial two-fold dilutions of MuTN228-
FITC antibody beginning
at 250 ng/est. PS 15/CD28+ cells (SxI05 cells/test) were incubated with FITC-
labeled antibody for 1 hour on ice,
14
CA 02432736 2003-06-16
WO 02/47721 PCT/USO1/47955
washed with PBS and analyzed by flow cytometry. For the competition
experiments, 25 ng of MuTN228-FITC
and serial two-fold dilutions of competing ChTN228 or MuTN228 antibodies
beginning at 800 ng/test were
added to P815/CD28+ cells (5x 105 cells/test). As a control, P815/CD28+ cells
(5x105 cells/test) were incubated
with 25 ng of MuTN228-FITC alone (i.e. without any competitor). HuEP5C7 and
MuFd79 isotype control
antibodies (800ng/test) were also tested as competitors. Cells were incubated
with the antibody mixture in a
final volume of 150 p1 for one hour on ice (in the dark), then washed and
analyzed by flow cytometry.
Results
The binding specificity of the MuTN228 and ChTN228 antibodies was compared in
a flow cytometry
competition experiment as described in the Methods. Various amounts of
unlabeled MuTN228 or ChTN228
were mixed with 25 ng of FITC-labeled MuTN228 antibody and incubated with
P815/CD28' cells. Both
MuTN228 and ChTN228 competed with MuTN228-FITC in a concentration dependent
manner, indicating that
binding of both antibodies is specific for the CD28 antigen (Fig. 4). The
isotype control antibodies MuFd79 and
HuEP5C7 did not compete with MuTN228-FITC, indicating that the MuTN228 and
ChTN228 antibodies
recognize the CD28 antigen through V-region specific interactions.
Example 7 Chimeric anti-human CD28 antibody which has reduced affinity to
human F R inhibits~rimary
mixed lymphocyte reaction.
Cell preparation
Human peripheral blood mononuclear cells (PBMC) were prepared from normal
healthy volunteers by
density gradient centrifugation using Ficoll-Paque plus (Amersham Pharmacia
Biotech, Tokyo, Japan). Human
blood were diluted with equal volume of RPMI1640 and overlaid on Ficoll-Paque
plus. After centrifugation for
ruin. at room temperature, PBMCs were collected and washed with RPMI 1640.
Thereafter, PBMCs were
suspended with the medium(RPMI1640 containing 2.5% human type AB serum, 2-
mercaptoethanol, and
25 antibiotics) and applied to a nylon fiber column(Wako junyaku, Osaka,
Japan). After 1 hr incubation at 37 C in
5 % COZ, T cells were eluted with warm medium.
CA 02432736 2003-06-16
WO 02/47721 PCT/USO1/47955
human B cell lines (Raji and JY) were used as stimulator cells in the mixed
lymphocyte reaction.
These cells were X-ray irradiated (2000R) before use.
Primary mixed l~rnphocyte reaction (1St MLRI
Purified human T cells (1 x 105 cells/well) and irradiated Raji (1 x 105
cells/well) were plated in 96well
flat bottom micro plate. Antibodies were added to the culture medium and cells
were incubated for 7 days. All
cultures were labeled for final 6 hours with IO kBq/well [3H]thymidine
(Amersham Pharmacia biotech). Cells
were harvested and incorporated radioactivity was measured by liquid
scintillation counter.
The effect of TN228-IgG2m3 (ChTN228) on primary MLR was shown on Fig.S and 6.
The original
anti-human CD28 antibody TN228 (MuTN228) did not inhibit primary MLR, however,
chimeric antibody
TN228-IgG2m3 inhibited in a dose dependent manner. Therefore, conversion of Fc
region of anti-human CD28
antibody to one with reduced affinity to human Fc R makes the antibody
antagonistic to T cell proliferation.
Chimeric anti-human CD28 antibody which has reduced affinity to human Fc R
reduced T cell low
responsiveness in secondary mixed lymphocyte reaction.
Secondary mixed lymphocyte reaction (2°d MLR~
Purified human T cells (1 x 105 cells/well) and irradiated Raji cells (1 x 105
cells/well) were plated in
96-well flat bottom micro plates. Antibodies were added to the culture medium
and cells were incubated. After
5 days, cells were collected, washed with fresh medium. Cells were, suspended
with fresh medium and cultured
for 8 days. Cells were restimulated with irradiated Raji or JY cells. After
additional 7 days culture, cells were
incubated with 10 kBq/well [3H]thynudine for 6 houxs. Cells were harvested and
radioactivity was measured by
liquid scintillation counter.
TN228-IgG2m3 inhibited primary MLR (Fig. 5 and 6). Next, we analyzed the
effect of this antibody
on secondary MLR. The antibody was applied to primary MLR culture, then
antibody was removed from
culture supernatant. After culturing in the medium without antibodies, cells
were re-stimulated with the same
stimulatox cells(Raji) or third party stimulator(JY). The proliferation of
cells treated with TN228-IgG2m3
through primary MLR was reduced compared to that of none-treated cells.
However, both cells proliferated to
almost the same extent with third party stimulator (JY) (Fig. 7). This result
indicates that anti-human CD28
antibody with xeduced affinity to human Fc R may induce T-cell energy through
alo-antigen stimulation.
Example 8. Design of humanized TN228 variable re ions
16
CA 02432736 2003-06-16
WO 02/47721 PCT/USO1/47955
The V-region sequences of MuTN228 were analyzed by computer modeling. Based on
a sequence
homology search against the Kabat antibody sequence database (8. Johnson, G.,
and T.T. Wu. 2000. Kabat
database and its applications: 30 years after the first variability plot.
Nucleic Acids Res. 28: 214-218), IC4
(Manheimmer-Lory, A., J.B. Katz, M. Pillinger, C. Ghossein, A. Smith, B.
Diamond. 1991. Molecular
characteristics of antibodies bearing an anti-DNA-associated idiotype. J. Exp.
Med. 174: 1639-1652) was
selected to provide the framework for both the humanized TN228 heavy chain and
light chain variable regions.
The humanized TN228 heavy chain variable domain has 65 residues out of 85
framework residues that are
identical to those of the mouse TN228 heavy chain framework, or 76% sequence
identity. The humanized
TN228 light chain variable domain has 56 residues out of 80 framework residues
that are identical to those of
the mouse TN228 light chain framework, or 70% sequence identity.
The computer programs ABMOD and ENCAD (Levitt, M. 1983. Molecular dynamics of
native
protein. h Computer simulations of trajectories. J. Mol. Biol. 168: 595-620)
were used to construct a
molecular model of the TN228 variable domain, which was used to locate the
amino acids in the mouse TN228
framework that are close enough to the CDRs to potentially interact with them.
To design the humanized
TN228 heavy and light chain variable regions, the CDRs from the mouse TN228
heavy chain were grafted into
the framework regions of the human IC4 heavy chain and the CDRs from the mouse
TN228 light chain were
grafted into the framework regions of the human IC4 light chain. At framework
positions where the computer
model suggested significant contact with the CDRS, the amino acids from the
mouse antibody were substituted
for the original human framework amino acids. For humanized TN228, this was
done at residues 27, 29, 30, 48,
67, 71 and 78 of the heavy chain. For the light chain, no substitutions were
made (i.e., a straight grafting of the
MuTN228 CDRs into the IC4 framework region was done). Furthermore, framework
residues that occurred
only rarely at their positions in the database of human antibodies were
replaced by human consensus amino
acids at those positions. For humanized TN228 this was done at residues 23,
40, 73, 83 and 85 of the heavy
chain and at residues 69 and 77 of the light chain. The amino acid sequences
of the humanized
TN228 antibody heavy and light chain variable regions are shown Figure 9 and
10.
Example 9. Construction and expression of humanized TN22$-IgG2M3
Methods
Once the humanized variable region amino acid sequences had been designed as
described above,
genes were constructed to encode them, including signal peptides, splice donor
signals and appropriate
17
CA 02432736 2003-06-16
WO 02/47721 PCT/USO1/47955
restriction enzyme sites (Figure 8). The heavy and light chain variable region
genes were constructed and
amplified using eight overlapping synthetic oligonucleotides ranging in length
from approximately 65 to 80
bases (He, X.Y, Z. Xu, J. Melrose, A. Mullowney, M. Vasquez, C. Queen, V.
Vexler, C. Klingbeil, M.S. Co,
and E.L. Berg. 1998. Humanization and pharxnacokinetics of a monoclonal
antibody with specificity for both E-
and P-selectin. J. Immunol. 160: 1029-1035). The oligonucleotides were
annealed pairwise and extended with
the Klenow fragment of DNA polymerase I, yielding four double-stranded
fragments. The resulting fragments
were denatured, annealed pairwise, and extended with Klenow, yielding two
fragments. These fragments were
denatured, annealed pairwise, and extended once again, yielding a full-length
gene. The resulting product was
amplified by polymerase chain reaction (PCR) using Taq polymerase, gel-
purified, digested with Xbal, gel-
purified again, and subcloned into the XbaI site of pVg2M3 for the expression
of heavy chain, and pVk for the
expression of light chain. The pVg2M3 vector for human gamma 2 heavy chain
expression (Cole, M.S., C.
Anasetti, and J.Y. Tso. 1997. Human'IgG2 variants of chimeric anti-CD3 are
nonmitogenic to T cells. J.
Immunol. 159: 3613-3621), and the pVk vector for human kappa light chain
expression (CO, M.S., N.M.
Avadalovic, P.C. Carom M.V. Avadalovic, D.A. Scheinberg, and C. Queen. 1992.
Chimeric and humanized
antibodies with specificity for the CD33 antigen. J. Immunol. 148:1149-1154)
have been previously described.
The sequences of the V-regions and constant region exons of the heavy and
light chain final plasmids
were verified by nucleotide sequencing. The gross structures of the final
plasmids were verified by restriction
mapping. All DNA manipulations were performed by standard methods.
In this specification, HuTN228 refers to a humanized antibody containing the
humanized TN228 VH
and V~ variable regions, a human IgG2M3 constant region for the heavy chain,
and a human kappa constant
region for the light chain. The heavy chain constant region was modified
(Cole, M.S., C. Anasetti, and J.Y. Tso
1997. Human IgG2 variants of chimeric anti-CD3 are nonxnitogenic to T cells.
J. Inununol. 159: 3613-3621)
from the germline human 2 genomic fragment, and the light chain was derived
from the germline human K
genomic fragment The human cytomegalovirus major immediate early promoter and
enhancer drive both the
heavy and light chain genes. The heavy chain gene is followed by the
transcription terminator derived from the
human complement gene C2 (Ashfield, R., P. Enriquez-Harris, and N.J.
Proudfoot. 1991. Transcriptional
termination between the closely linked human complement genes C2 and factor B:
common termination factor
for C2 and c-myc? EMBO J. 10: 4197-4207). The light chain selection marker gpt
gene (Mulligan, R.C., and P.
Berg. 1981. Selection for animal cells that express the Escherichia coli gene
coding for xanthine-guanine
phosphoribosyltransferase. Proc. Natl. Acad. Sci. USA 78: 2072-2076) and the
heavy chain selection marker
18
CA 02432736 2003-06-16
WO 02/47721 PCT/USO1/47955
dhfr gene (Simonsen, C.C., and A.D. Levinson. 1983. Isolation and expression
of an altered mouse
dihydrofolate reductase cDNA. Proc. Natl. Aced. Sci. USA 80: 2495-2499) are
both driven by the SV40 early
promoter.
For expression of HuTN228, transient transfection into COS-7 cells (monkey
kidney cell line) was
done using Lipofectamine 2000 (catalog # 11668-027, Life Technologies). Spent
media from transient
transfectants were analyzed for human IgG2M3 antibody production by ELISA,
using goat anti-human IgG
gamma chain specific antibody as capturing reagent and HRP-conjugated goat
anti-human kappa chain antibody
as developing reagent. The spent media were also tested for the ability of
HuTN228 to bind to P815/CD28~
cells by indirect immunofluorescent staining and analyzed by flow cytometry
(data not shown). For stable cell
line production, the humanized expression plasmids were transfected into
marine myeloma cell line Sp2/0 by
electroporation and the transfectants were selected for gpt expression. The
spent media from stable transfectants
were analyzed by ELISA as for the transient transfection.
Results
Based on the humanized V-region amino acid sequence design, heavy and light
chain V-genes (Figure
9 and 10) were constructed as described in the Methods. Tlie heavy and light
chain V-genes were cloned into
the pVg2M3 and pVk vectors, respectively, as shown in Figure 8. Several clones
were analyzed by nucleotide
sequencing and correct clones of both~the heavy chain and light chain
expression vectors were used for the
transfection. The constant regions of both the heavy and light chain
expression vectors were also confirmed by
sequencing.
Example 10. Expression of HuTN228.
Transient transfection of COS-7 cells: The expression vectors were transiently
transfected into
monkey kidney cell line COS-7 to produce the HuTN228 antibody. Spent medium
from the transfected cells
was tested by ELISA for the production of humanized gG2M3 antibodies and by
flow cytometry for binding to
P$'SlCD28~ cells (data not shown). Spent medium was positive in both assays.
The yield of humanized antibody
from transient transfection was -3.7 g/ml. The HuTN228 antibody from transient
supernatant bound to
P8151CD28+ cells in a concentration dependent manner (data not shown).
19
CA 02432736 2003-06-16
WO 02/47721 PCT/USO1/47955
Stable transfection of Sp2/0 cells: The humanized expression vectors were
transfected into Sp2/0 cells
for the production of a stable cell line. Spent media from several
transfectants were tested for the production of
HuTN228 antibody as with the transient transfectants. One transfectant (clone
4) was chosen for its higher
antibody productivity and expanded in GIBCO hybridoma serum free medium.
HuTN228 antibody was
purified from 570 ml of spent medium by affinity chromatography. The yield of
purified antibody was ~7 mg.
Example 11. Protein purification.
One of the high HuTN228 expressing transfectants from the stable transfecdon
(Clone 4) was grown in
570 ml of GIBCO hybridoma serum-free medium (catalog # 12045076, Life
Technologies). Spent culture
supernatant was harvested when cell viability reached 10% or below and loaded
onto a 2 nil protein-A
Sepharose column. The column was washed with PBS before the antibody was
eluted with 0.1 M Glycine, 0.1
M NaCl, pH 2.5. The eluted protein was dialyzed against 3 changes of 2 L PBS
and then desalted onto a PD-10
column equilibrated with PBS containing an additional 0.1 M NaCI. The desalted
protein solution was fcltered
through a 0.2 m filter prior to storage at 40C.
Example 11. Purity determination by size exclusion HPLC and SDS-PAGE
Methods
Size exclusion HPLC was performed using a Perlcin Eliner HPLC system
consisting of a PE ISS 200
Advanced LC Sample Processor, a PE Series 410 Bio LC Pump, a PE 235C Diode
Array Detector, and a PE
Nelson 600 Series LINK. Perkin Eliner Turbochrolin Navigator Version 4.1
software was used to control the
autosampler, pump, and detector, and to acquire, store, and process the data.
Separation was achieved using two
TosoHaas TSK-GEL G3000SWXI, size exclusion HPLC columns (7.8 mm x 300 mm, 5 m
particle size, 250
pore size; catalog # 08541, TosoHaas, Montgomeryville, MD) connected in
series. The mobile phase was 200
mM potassium phosphate/150 mM potassium chloride at pH 6.9, and the flow rate
was 1.00 mL/minute. The
column eluate was monitored spectrophotometrically at both 220 nm and 280 inn.
The injection volume was 60
1 (60 g) of the HuTN228 sample.
SDS-PAGE was performed according to standard procedures on a 4-20% gradient
gel (catalog #
EC6025, Novex, San Diego, CA).
The isotype of the purified antibody was confirmed using the Human IgG
Subclass Profile ELISA Kit
(catalog # 99-1000, Zymed Laboratories, South San Francisco, CA) following the
manufacturer's
recommendations. (Results)
CA 02432736 2003-06-16
WO 02/47721 PCT/USO1/47955
The purity of the isolated HuTN228 antibody was analyzed by size exclusion
HPLC and SDS-PAGE.
The HPLC elution prof 1e of HuTN228 is not shown. Based on this analysis, the
protein is -98% monomer and
has the mobility corresponding to a protein of molecular weight -160 kD.
SDS-PAGE analysis of MuTN228, isotype control MuFd79 (mouse IgGl), HuTN228,
and isotype
control HuEP5C7 (human IgG2M3) under nonreducing conditions also indicated
that all four antibodies have a
molecular weight of about 150-160 kD. Analysis of the same four proteins under
reducing conditions indicated
that all four antibodies were comprised of a heavy chain with a molecular
weight of about 50 kD and a light
chain with a molecular weight of about 25 kD.
The isotype test indicated that the isotype of the HuTN228 antibody was
consistent with the expected
IgG2 isotype (data not shown).
Example 12. FAGS competition experiment.
Methods
A titration experiment was done using serial two-fold dilutions of MuTN228-
FITC antibody beginning
at 250 ng/test. P815/CD28+ cells (3x105 cells/test) were incubated with FITC-
labeled antibody for 1 hour on ice
in 100 1 of FAGS Staining Buffer (FSB = PBS, 2% FBS, 3% normal mouse serum,
0.1 % NaN3) washed with 2
ml of FSB, and analyzed by flow cytometry (data not shown).
For the competition experiments, MuTN228-FITC (50 ng/test) in 25 1 of FSB was
combined with
three-fold serial dilutions of competing HuTN228 or MuTN228 antibodies
(beginning at 200 g/ml) in 25 1 of
FSB, and added to P815/CD28+ cells (3x105 cells/test) in 50 1 of FSB. As a
control, P815/CD28+ cells were
incubated with MuTN228-FITC alone (50 ngltest in 50 1 of FSB). HuEP5C7 (human
IgG2M3) and MuFd79
(mouse IgGl) isotype control antibodies (200 g/ml) in 25 1 of FSB were also
tested as nonspecific competitors.
Cells were incubated with the antibody mixture in a final volume of 100 1 for
one hour on ice (in the dark), then
washed with 2 ml of FSB, and analyzed by flow cytometry. This experiment was
repeated three times.
Results
The binding specificity of the MuTN228 and HuTN228 antibodies to CD28
molecules on P8151CD28+
cells was compared in a flow cytometry competition experiment as described in
the Methods. A representative
result is shown in Figure 5. Both MuTN228 and HuTN228 competed with MuTN228-
FITC in a concentration
dependent manner, indicating that binding of both antibodies is specific for
the CD28 antigen. The relative
binding of HuTN228 was a few fold less than that of MuTN228. The isotype
control antibodies MuFd79 and
21
CA 02432736 2003-06-16
WO 02/47721 PCT/USO1/47955
HuEP5C7 did not compete with MuTN228-FITC, indicating that the MuTN228 and
HuTN228 antibodies
recognize the CD28 antigen through ~-region specific interactions.
Example 13. ELISA competition experiment.
Methods
A 96 well ELISA plate (None-Immuno plate, catalog # 439454, NalgeNunc,
Naperville, IL) was coated
with 100 I/well of sCD28-Fc (0.5 g/ml in PBS) (sCD28-Fc means the fused
protein, in which the extracellular
domains of CD28 were combined with the CH2 and CH3 domains of IgGL) overnight
at 4 C. The plate was
blocked for 30 minutes with 300 1/well of Superblock Blocking Buffer in TBS
(catalog # 37535, Pierce,
Rockford, IL), and washed with 300 1/well of ELISA Wash Buffer (EWB = PBS,
0.1% Tween-20). A mixture
of MuTN228-biotin (0.5 g/ml) in 100 1 of ELISA Buffer (EB = PBS, 1% BSA, 0.1%
Tween-20) and three-fold
serially diluted HuTN228 or MuTN228 competitor antibodies (starting at 100
g/ml) in 100 1 of EB was added
in triplicate in a final volume of 200 1/well. Isotype control antibodies
HuEP5C7 and MuFd79 (100 glml) in
100 1 of EB were also tested as non-specific competitors. As a'no competitor'
control, 100 1 of EB was added
to 100 1 of MuTN228-biotin (0.5 g/ml). As a blank, 200 1 of EB was added to
the remaining wells (containing
no MuTN228-biotin). The plate was incubated at room temperature for 1.5 hours
with shaking. After washing
the wells 4 times with 300 1/well of EWB, 100 1/well of Streptavidin-HRP (1
g/ml, catalog # 21124, Pierce)
was added to all the wells. The plate was incubated at room temperature for 1
hour with shaking. After
washing the wells as above, 100 1/well of ABTS substrate (catalog #507602 &
506502, KPL, Gaithersburg,
MD) was added to all the wells. The plate was incubated at room temperature
for S-7 minutes and the optical
density was read at 415 nm. This experiment was repeated three times.
Results
The binding specificity of the HuTN228 and MuTN228 antibodies to sCD28-Fc was
compared in an
2S ELISA competition experiment as described in the Methods. A representative
result is shown in Figure 12.
Both MuTN228 and HuTN228 competed with MuTN228-biotin in a concentration
dependent manner. The
isotype control antibodies MuFd79 and HuEP5C7 did not compete with MuTN228-
biotin, indicating that the
MuTN228 and HuTN228 antibodies recognize the CD28 antigen through V-region
specific interactions. The
ICSO values of MuTN228 and HuTN228 for all three experiments are shown in
Table 2. The relative binding of
HuTN228 was on average 2.6 fold less than that of MuTN228.
22
CA 02432736 2003-06-16
WO 02/47721 PCT/USO1/47955
Table 2. ELISA competition summary
ICso ( ~~)
Competitor Expt Expt Expt Average Std. Dev.
1 2 3
MuTN228 0.21 0.20 0.15 0.19 0.03
HuTN228 0.37 0.64 0.48 0.50 0.14
Example 14. lzsl-labeled antibod~competition experiment
Methods
The relative binding affinities of the MuTN228 and HuTN228 antibodies were
determined following
the method of Queen et al. (Queen, C., W.P. Schneider, H.E. Selick, P.W.
Payne, N.F. Landolfi, J.F. Duncan,
N.M. Avdalovic, M. Levitt, R.P. Junghans, T.A. Waldmann. 1989. A humanized
antibody that binds to the
interleukin 2 receptor. Proc. Natl. Acad. Sci. 86:10029-10033). Briefly, ~10
ng of I~sI-labeled MuTN228 in 50
1 of Binding Buffer (BB = PBS, 2% FBS, 1 g/ml mouse IgG, 0.1% NaN3) was
combined in triplicate with three-
fold serial dilutions of MuTN228 or HuTN228 competitor antibodies (beginning
at 400 g /ml) in 50 1 of BB,
added to 100 1 of P8151CD28~ cells (2.5 x 105 cells/test) in incubation tubes
(Skatron Macrowell Tube Strips,
catalog # 15773, Molecular Devices, Sunnyvale, CA), and incubated fox 90
minutes at 4 C with gentle shaking.
Isotype control antibodies HuEP5C7 and MuFd79 (400 g /ml) in 50 1 of BB were
also tested as nonspecific
competitors. Following the incubation, the cell-antibody mixture was
transferred to centrifuge tubes (Sarstedt
Micro Tubes, catalog # 72.702, Sarstedt, Newton, NC) containing 0.1 ml 80%
dibutyl phthalate-20% olive oil,
the incubation tubes were washed once with 50 1 of BB, and bound and free
counts were separated by
centrifugation as described (Kuziel, W.A., S.J. Morgan, T.C. Dawson, S.
Griffin, 0. Smithies, K. Ley, N.
Maeda. 1997. Severe reduction in leukocyte adhesion and monocyte extravasation
in mice deficient in CC
chemokine receptor 2. Proc. Natl. Acad. Sci. 94:12053-12058). This experiment
was repeated three times.
Results
The relative binding affinities of the MuTN228 and HuTN228 antibodies were
compared in an l2sl-
labeled antibody competition experiment as described in the Method. A
representative result is shown in
Figure 13. Both MuTN228 and HuTN228 competed with ~zSI-labeled MuTN228 in a
concentration dependent
manner. The isotype control antibody MuFd79 showed weak but repeatable
competition at high concentrations,
but the isotype control antibody HuEP5C7 did not compete with ~ZSI-labeled
MuTN228, indicating that the
HuTN228 antibody recognizes the CD28 antigen through V-region specific
interactions. The ICso values of
23
CA 02432736 2003-06-16
WO 02/47721 PCT/USO1/47955
MuTN228 and HuTN228 for all three experiments are shown in Table 3. The
apparent binding affinity of
HuTN228 was approximately 2.4 fold less than that of the MuTN228 antibody.
Table 3. I-125 competition summary
ICso (nM)
Competitor Expt Expt Expt Average St. Dev.
1 2 3
MuTN228 0.93 1.05 1.02 1.00 0.06
HuTN228 2.65 2.43 2.13 2.40 0.26
Example 15 Amino acid se9uencing of the hamster anti-marine CD28 antibody
Method
Hybridoma and antibodies. The Armenian hamster anti-marine CD28 hybridoma PV 1
was obtained from
ATCC (ATCC HB-12352). Purified PVI, R-phycoerythrin (R-PE)-conjugated PVl were
purchased from
Southern Biotechnology (Birmingham, AL). The Syrian hamster anti-CD28 antibody
37.51 was from
PharMingen (San Diego, CA). Secondary antibodies fluorescein (FITC)-conjugated
donkey anti-Armenian
hamster IgG (H+L), FITC-conjugated donkey anti-Syrian hamster IgG (H+L), FITC-
conjugated donkey anti-
mouse IgG (H+L), R-PE-F(ab')2 donkey anti-mouse IgG (H+L) were from Jackson
ImmunoResearcli (West
Grove, PA); and FITC-conjugated goat anti-mouse kappa, R-PE-conjugated goat
anti-mouse IgG3, and horse
radish peroxidase (HRP)-conjugated goat anti-mouse kappa were from Southern
Biotechnology. Goat anti-
mouse IgG3, and mouse IgG3 isotype control FLOPC 22 were from Sigma Chemicals
(St. Louis, MO). The
Armenian hamster anti-marine CD3 antibody 145.2C11 and its hamster/mouse
chimeric version 145.2C11-IgG3
were generated in our laboratory. FITC-conjugated 145.X11 was from Boehringer
Mannheim (Indianapolis,
IN).
Cloning of variable region cDNAs. The V region cDNAs for the light and heavy
chains of PV 1 were cloned
from the hybridoma cells by an anchored polymerase chain reaction (PCR) method
described by Co et al. (Co,
M.S., N.M. Avadalovic, P.C. Carom M.V. Avadalovic, D.A. Scheinberg, and C.
Queen. 1992. J. Immurzol.
148:1149-1154.). Amplification was performed on cDNA using 3' primers that
anneal respectively to the
hamster kappa and gamma chain C regions, and a 5' primer that anneals to the
added G-tail of the cDNA. For
24
CA 02432736 2003-06-16
WO 02/47721 PCT/USO1/47955
VLPCR, the 3' primer has the sequence of 5' TATAGAGCTCCACTTCCAGTGCCC (SEQ ID
N0:20) , with
residues 11- 24 hybridizing to the hamster Ck region. For VH PCR, the 3'
primers has the degenerated
sequences of (SEQ ID NOS:17, 18 and 19):
A G T
5'TATAGAGCTCAAGCTTCCAGTGGATAGACCGATGGGGCTGTCGTTTTGGC,
T
with residues 19 - 50 hybridizing to most rodent IgG CHI. The non-hybridizing
sequences in the two primer
sets contain restriction sites used for cloning. The VL and VH cDNAs were
subcloned into a pUCl9 vector for
sequence determination. To avoid PCR-generated errors, five independent clones
for each cDNA were
sequenced, and only the clones whose sequence agreed with the consensus
sequence were chosen to express the
chimeric PV1.
Results
Cloning of P V 1 V region cDNAs. The PV I light and heavy chain V region cDNAs
were cloned from the
hybridoma cells as described in Methods. For the V~, PCR, only 3' primer
corresponding to the hamster Cy
region could yield VL cDNA product from PV 1. A 3' primer from the hamster CY
region, on the other hand,
did not yield any PCR product. These results indicated that the hybridoma PV 1
uses kappa for its light chain.
Several light and heavy chain clones were sequenced and were found to contain
the same VL and VH,
respectively. Limited CHl and Cy sequence data indicated that the cloned heavy
and light chains are not marine
in origin.
Example 16 Construction and expression of chimeric PV1-I_~G3.
Method
PVl VL and VH were made by PCR into mini-exon segments flanked by Xbal sites
as described (He, X.Y., Z.
Xu, J. Melrose, A. Mullowney, M. Vasquez, C. Queen, V. Vexler, C. Klingbeil,
M.S. Co, and E.L. Berg. 1998.
J. Itnrnunol. 160:1029-1035.) and they were separately introduced to the light
chain and heavy chain expression
plasmids (Fig. 14). Each mini-exon contains a signal peptide sequence, a
mature variable region sequence and a
5' splicing donor sequence derived from the most homologous mouse J chain
gene. Such splicing donor is used
to splice the V region exon to the mouse antibody constant region. Each mini-
exon was sequenced again after it
CA 02432736 2003-06-16
WO 02/47721 PCT/USO1/47955
had been cloned into the expression vector to ensure the correct splicing
signal was introduced, and no PCR
errors were generated.
A vector was constructed to express both the heavy and light chain genes of
the chimeric PVl-IgG3
S from a single plasmid. In this report, PVl-IgG3 refers to a chimeric
antibody containing the hamster PVl VL
and VH variable regions, a mouse IgG3 constant region for the heavy chain, and
a mouse kappa constant region
for the light chain. The expression vector pV 1.g3.rg.dE (Fig. 14) was
obtained by a two-step cloning process
similar to that described by Cole et. al. (Cole, M.S., C. Anasetti, and J.Y.
Tso. 1997. J. Inamunol. 159:3613-
3621.). The heavy chain constant region was derived from the mouse 'y3 genomic
fragment, and the light chain
from the K fragment. Both the heavy and light chain genes are driven by the
human cytomegalovirus major
immediate early promoter and enhancer, and they are separated by the
transcription terminator derived from the
human complement gene C2 (Ashfield, R., P. Enriquez-Harris, and N.J.
Proudfoot. 1991. EMBO J. 10:4197-
4207.). The selection marker gpt gene (Mulligan, R.C., and P. Berg. 1981.
Proc, Natl. Aced. Sci. USA 78:2072-
2076) is driven by a modified SV40 early promoter. For expression of the
chimeric PVl-IgG3, the single
plasmid vector was transfected into the marine myeloma cell line NSO, and the
transfectants were selected for
gpt expression. Spent media from transfectants were analyzed for mouse IgG3
antibody production by ELISA,
using goat anti-mouse IgG3 as capturing reagent and HRP-conjugated goat anti-
mouse kappa chain as
developing reagent. The assay is specific for mouse IgG3; other mouse IgG
isotypes are negative in this
analysis.
Results
Expression of the chimeric PV 1-I~,aG3. The cloned VL and VH were made into
mini-exons (Fig. 15) and
incorporated into an expression vector as described in Materials and Methods
and Fig. 15. The expression
vector was then transfected into a marine myeloma cell line NSO to produce the
chimeric PVl-IgG3. Spent
media from several transfectants were assayed by ELISA for the production of
mouse IgG3 antibodies and by
FACScan for binding to EL4 cells. Most transfectants were positive in both
assays. One transfectant was
chosen for its high antibody productivity and expanded to grow in 1 L of serum-
free medium. PV 1-IgG3 was
purified from the 1 L spent medium by affinity chronnatography. The yield was
> 10 mg/L.
26
CA 02432736 2003-06-16
WO 02/47721 PCT/USO1/47955
Example 17 Characterization of the purified chimeric PVI-I~G3 by HPLC and SDS-
PAGE
Methods
Protein Purification. One of the high IgG3-expressing transfectants (Clone #1)
was grown in 1 L of Gibco
Serum-free Hybridoma medium. Spent culture supernatant was harvested when cell
viability reached 30 % or
below, concentrated to 200 ml, and loaded onto a 5 ml protein-A Sepharose
colunm using a Pharmacia P1 pump
(2-3 ml/min). The column was then washed with PBS containing an additional 0.1
M NaCl (final concentration
of NaCl was 0.25 M) before the antibody was eluted with 3.5 M MgCl2. The
eluted protein was then desalted
onto a PD10 column equilibrated with PBS containing an additional 0.1 M NaCI.
The desalted protein solution
was filtered through a 0.2 ~m filter prior to storage at 4 °C. Like all
mouse IgG3, PV 1-IgG3 at high
concentrations (>1 mg/mL) precipitates in the cold but returns to solution by
warming at 37° C. The antibody
stays in solution at room temperature. ~ Repeated cycles of cold precipitation
do not seem to affect the antigen
binding activity of the antibody.
Purit~Detemvnation by size exclusion HPLC and SDS-PAGE. Size exclusion HPLC
was performed using a
Perkin Eliner HPLC system consisting of a PE ISS 200 Advanced LC Sample
Processor, a PE Series 410 Bio
LC Pump, a PE 235C Diode Array Detector, and a PE Nelson 600 Series LINK.
Perkin Elmer Turbochrom
Navigator Version 4.1 software was used to control the autosampler, pump, and
detector, and to acquire, store,
and process the data. Separation was achieved using tyvo TosoHaas TSK-GEL
G3000SWXL size exclusion
HPLC columns (TosoHaas, catalog # 08541, 7.8 mm x 300 mm, 5 ~m particle size,
250 A pore size) connected
in series. The mobile phase was 200 mM potassium phosphate/150 n~Ivl potassium
chloride at pH 6.9, and the
flow rate was 1.00 mL/minute. The column eluate was monitored
spectrophotometrically at both 220 nm and
280 nm. The injection volume was 50 pL (63.5 ug) of the undiluted PVl-IgG3
sample. SDS-PAGE was
performed according to standard procedures.
Results
. The purity of the isolated PV 1-IgG3 was analyzed by size exclusion HPLC and
SDS-PAGE. The HPLC
elution profile of PV 1-IgG3 is shown in Fig. 16. Based on this analysis, the
protein is 99% monomer and has
the mobility corresponding to the molecular weight of 150 kD. SDS-PAGE
analysis of PVl, PVl-IgG3 and
isotype control under nonreducing conditions also indicated all three
antibodies have the molecular weight of
27
CA 02432736 2003-06-16
WO 02/47721 PCT/USO1/47955
about 150 kD (Fig. 17A). The minor bands seen in Fig. 17A were artifacts due
to boiling of the samples in SDS
without reduction. They reflected the number of incomplete inter-chain
disulfide bonds in the antibodies.
Analysis of the same three proteins under reducing conditions (Fig. 17B),
however, indicated that PV 1, but not
PV 1-IgG3 or the isotype control, has a heavy chain with molecular weight
slightly higher than the 50 kD
molecular weight usually seen with IgG. The hamster antibody PV 1 thus either
has heavy glycosylation at
Asn29~ in CH3, or it has an exiza glycosylation site elsewhere in the heavy
chain. As discussed later, this
unusual glycosylation pattern may contribute to PV 1's nonspecific binding to
EL4 cells, perhaps by
lectin/carbohydrate interaction.
to Example 18
Methods
Flow cytometry. Murine T cell line EL4 cells (2.5 x 105 cells/0.2 ml) were
stained with 1 pg/ml of PVl, 37.51
or PVI-IgG3 at 4° C for 30 min, washed with 2 ml of cold PBS, and
stained with 20 p1 of specific fluorochrome-
conjugated secondary antibodies (10 ~,g/ml). After 20 min of incubation at
4° C in the dark, the cells were
15 washed with PBS and analyzed by FACScan (Becton Dickenson, Milpitas, CA).
In the competition experiment, EL4 cells (2.5 x 105 cells/0.2 ml) were stained
with 1 ~g/ml of R-PE-PV 1 and
25 ~glml of PVl, PVl-IgG3, or IgG3 isotype control at 4° C for 30 min
in the dark, washed with PBS and
analyzed by FACScan. Similar competition experiment was also conducted using
various versions of 145.X11.
20 In the reverse competition experiment, Elfl cells (2.5 x 105 cells/0.2 ml)
were stained with 1 ~g/ml of PV 1-
IgG3 and 25 pg/ml of PV l at 4° C for 30 min, washed 2 times with PBS,
stained with FITC-conjugated donkey
anti-mouse IgG (H+L), washed, and analyzed by FACScan. To control for
nonspecific binding of the secondary
antibodies to PV l, EL4 cells were stained with excess PV 1 without PV 1-IgG3
and analyzed.
25 For mouse T cell staining, BALB/c mouse splenic cells (2.5 x 105 cells/0.2
ml) were stained with 1 ~.g/ml of
mouse IgG3 isotype control (FLOPC 21) or PVI-IgG3 at 4° C for 30 min,
washed with 2 ml of cold PBS, and
stained with 20 p1 of FITC-conjugated 145.2C11 (10 ltg/ml) and 20 p1 of R-PE-
conjugated goat anti-mouse
28
CA 02432736 2003-06-16
WO 02/47721 PCT/USO1/47955
IgG3 (10 pg/ml). After 20 min of incubation at 4° C in the dark, the
cells were washed with PBS and analyzed
by FACScan.
Results
Characterization of PV 1 and PVl-IgG3 by flow cKtometry. PV 1 was used to
stain CD28-positive T cell line
EL4 and analyzed by FACScan. The pattern of staining ilidicated that PV I
binds EL4 cells at two different sites
(Fig. 17A). In addition, PV 1 as well as several Armenian hamster anti-marine
T cell antibodies (145.2C11,
anti-CD3; H57-597, anti-TCR; and UC10-4F10-11, anti-CTLA4) also bind
nonspecifically to CD28-negative
myeloma cell line NSO (data not shown). The Syrian hamster anti-CD28 antibody
37.51, on the other hand,
binds specifically to only one site on EL4 cells (Fig. 17B). It appears that,
in addition to CD28 binding, PVl
also binds nonspecifically to other sites, possibly through the
carbohydrate/lectin type of interaction. As shown
in Fig. I7C, the chimeric PV 1-IgG3 does not contain this nonspecific binding
activity. The antibody binds EL4
cells in a pattern similar to that of 37.51, and it does not bind to CD28-
negative NSO cells (data not shown).
Thus, the nonspecific binding property of PVl lies in the heavy chain constant
region of this particular antibody
and it is eliminated upon chimerization.
To demonstrate that PVl-IgG3 contains the CD28-specific binding activity, we
used the FACScan competition
assay. In these experiments, R-PE-conjugated PVl was mixed with excess (25-
fold) unlabeled PV 1, PVl-IgG3
or mouse IgG3 control, and the mixture was used to stain EL4 cells. As shown
in Fig. 18A, both PVl and PVl-
IgG3, but not isotype control, prevented R-PE-conjugated PVI from binding to
EL4 cells. The inhibition by
PV 1-IgG3 was less than that by PV 1, and we interpreted these data as PV 1-
IgG3 competed with R-PE-
conjugated PVl for the CD28 sites but not for the nonspecific sites.
Similarly, both 145.2C11(Armenian
hamster anti-marine CD3) and the chimeric 145.2C11-IgG3 prevented R-PE-
conjugated 145.2C11 from binding
to EL4 cells (Fig. 18B), but the clvmeric antibody is less efficient due to
its inability to eliminate R-PE-
145.2C11's nonspecific binding to cells.
We also did the reverse competition experiment using excess (25-fold) PV I to
compete with PV I-IgG3 for
binding to EL4 cells. Although PV-1-IgG3 was not labeled in this case, it was
specifically recognized by the
FITC-conjugated donkey anti-mouse antibodies. The results in Fig. I8C showed
that the inhibition of PVI-
29
CA 02432736 2003-06-16
WO 02/47721 PCT/USO1/47955
IgG3's binding to EL4 cells by excess, PVl was almost complete, demonstrating
that PVl and PVl-IgG3 bind to
the same epitope.
Finally, PV1-IgG3 was used to stain mouse splenic cells. PVl-IgG3-coated
splenic cells were specifically
recognized by the secondary antibodies R-PE-conjugated goat anti-mouse IgG3.
Simultaneously, FITC-
conjugated 145.2C 11 was also added to splenic cells to label CD3-positive
cells. In the two-color flow
cytometry analysis. PVl-IgG3 specifically stained CD3-positive cells, but not
CD3-negative cells (Fig. 19B).
Mouse IgG3 isotype control, on the other hand, did not stain the CD3-positive
cells (Fig. 19A). Thus, the
chimeric PV I-IgG3 recognizes an antigen that is expressed on marine T cells,
an antigen binding activity that is
consistent with an anti-CD28 antibody.
Example 19 Induction of Collagen Induced Arthritis
Methods
Mice were immunized iniradermally at the base of the tail with 125 pg of
bovine CII (Collagen Gijutsu
Kenkyukai, Japan) emulsified with an equal volume of CFA (Wako, Japan). Mice
were boosted by intradermal
injection with 125pg of bovine CII in CFA on day 21. Mice were treated anti-
CD28 antibody (PV 1-IgG3) at the
dose of lmg/kg/day continuous infusion via osmotic pump for 7days after the
initial immunization. Arthritis
development was checked by inspection of four paws on day 11 after the second
immunization, and the
inflammation of four paws was graded from 0 to 3 as described previously
(Tada, Y., A. Ho, D.-R. Koh, T. W.
Mak. 1996. J. Immunol. 156:4520, . Tada, Y., A. Ho, T. Matsuyama, T. W. Mak.
1997. J. Exp. Med. 185:231).
Each paw was graded and the four scores were added such that the maximal score
per mouse was 12. The
arthritis index was calculated by dividing the total score of the experimental
mice by the number of the total
number of mice.
Results
CA 02432736 2003-06-16
WO 02/47721 PCT/USO1/47955
Mice were immunized with bovine CII, and observed for development of
arthritis. At day 11 after the second
immunization, arthritis index was sigxrificantly reduced in mice treated with
anti-CD28 antibody (0.63 ~0.50)
(P<0.01) versus control (7.50~0.66).
Exam 1p a 20
Methods
Mice;Animals
Female BALB/c and C3H mice were obtained from Charles River Japan, Inc.
(Yokohama, Japan). Animals
were all housed in a specific pathogen-free facility in microisolator cages
with filtered air and free access to
food and water. All mice were 6-8 wk of age when experiments were initiated.
Antibodies;
Anti-mouse silent CD28 (PV 1-IgG3) has identical specificity to that of PV-1
clone but it does not have strong
agonistic activity in viixo (Fc-->IgG3): Anti-mouse CD154 (TRAP1, IgGl) was
purchased from BD PharMingen
(San Diego, CA). CTLA4-Ig (CTLA-4/Fc Chimera) was purchased from Genzyme
(Cambridge, MA).
Tail-Skin transplantation;
Full thickness skin grafts (0.5 cm2) from tail of donor mice(BALB/c:H-2d) were
transplanted on the dorsal
thorax of recipient mice(C3H:H-2b) and secured with a band-aid for 7 days.
Graft survival was then followed by
daily visual inspection. Rejection was defined as the >80% loss of viable
epidermal graft tissue. Statistical
analyses were performed using a Dunnett's Multiple Comparison test. Values of
p < 0.05 were considered
significant.
Treatment protocols;
Skin graft recipients were treated with 10, 50, 250 pg of anti-mouse silent
CD28,
250 pg of anti-mouse CD 154 and 100 p,g of CTLA4-Ig administered i.p. on the
day of transplantation (day 0)
and on postoperative days 3, and 6.
31
CA 02432736 2003-06-16
WO 02/47721 PCT/USO1/47955
Results;
Simultaneous blockade of the CD40 and CD28 T cell costimulatory pathways by
administration of anti-mouse
silent CD28 and anti-mouse CD 154 effectively promotes skin allograft survival
in C3H mice. Control animals
rejected their grafts at 9 days. Anti-CD40L mAb alone modestly prolonged
allograft survival (MST 10 days),
but was seen to dramatically improve survival when combined with CD28
extending median survival time-
(MST-) beyond 33 days. This strategy is markedly less effective in
administration of CTLA4-Ig and anti-mouse
CD40L mAb, with MST of 12 days.
Example 21 Pre~arationof Fab and F(ab'12 fragment and of anti-CD28 antibod
Preparation of Fab fr~ment of anti-CD28 antibody
Anti-human CD28 antibody (HuTN228) was digested with immobilized-Ficin
(Pierce, USA). Immobilized
ficin was activated with SOmM Tris-HCL pH 6.8 buffer containing SmM EDTA and
ll.SmM cysteine ~HCl and
packed to a column. Antibody solution was added to the column, and incubated
at 37°C for 2 or 3 days. The
column was washed with PBS and the digest was concentrated by ultrafiltration.
The concentrated digest was
applied to the gel-filtration column (TSKgel-3000SWx1, Tosoh, Japan) and
appropriate fractions were collected
and concentrated by ultrafiltration. Protein concentration was determined by
absorbance at 280nm (Abs280 =
1.4 for lmg/mL) and the fragment size was confirmed by SDS-PAGE.
Preparation of F(ab')2 fragnnent of anti-CD28 antibody
Anti-human CD28 antibody was prepared with the same method as that of Fab
fragment except for the
concentration of cysteine (1. lSmM) and the period of incubation (one over
night).
Obviously, numerous modifications and variations of the present invention are
possible in light of the
above teachings. It is therefore to be understood that within the scope of the
appended claims, the invention may
be practiced otherwise than as specifically described herein.
All publications, patent applications, patents, and other references mentioned
herein are incorporated
by reference in their entirety.
32
CA 02432736 2003-06-16
WO 02/47721 PCT/USO1/47955
SEQUENCE LISTING
<110> VASQUEZ, Maximiliano
HINTON, Paul
TAMURA, Kouichi
HIGASHI, Yauyuki
SEKI, Nobuo
UEDA, Hirotsugu
TSO, J. Yun
<120> SILENCED ANTI-CD28 ANTIBODIES AND USE THEREOF
<130> 200071USOPROV
<150> US 60/255,155
<151> 2000-12-14
<160> 21
<170> PatentIn version 3.1
<210> 1
<211> 427
<212> DNA
<213> hybrid
<220>
<221> CDS
<222> (12)..(404)
<223>
<400> 1
tctagaccac c 50
atg
gag
tca
gac
aca
ctc
ctg
cta
tgg
gtg
ctg
ctg
ctc
Met Leu
Glu Leu
Ser Leu
Asp
Thr
Leu
Leu
Leu
Trp
Val
1 ~ 5 10
tgggttccaggctcc actggtgac attgtgctcacc caatctccaget 98
TrpValProGlySer ThrGlyAsp IleValLeuThr GlnSerProAla
15 20 25
tctttggetgtgtct ctggggcag agagccaccatc tcctgcagagcc 146
SerLeuAlaValSer LeuGlyGln ArgAlaThrIle SerCysArgAla
30 35 40 45
agtgaaagtgttgaa tattat'gtc acaagtttaatg cagtggtaccaa 194
SerGluSerValGlu TyrTyrVal ThrSerLeuMet GlnTrpTyrGln
50 55 60
cagaaaccaggacag ccacccaaa ctcctcatctat getgcatccaac 242
GlnLysProGlyGln ProProLys LeuLeuIleTyr AlaAlaSerAsn
65 70 75
gtagattctggggtc cctgccagg tttagtggcagt gggtctgggaca 290
ValAspSerGlyVal ProAlaArg PheSerGlySer GlySerGlyThr
80 ~ 85 90
1
CA 02432736 2003-06-16
WO 02/47721 PCT/USO1/47955
gac ttc agc ctc aac atc cat cct gtg gag gag gat gat att gca atg 338
Asp Phe Ser Leu Asn Ile His Pro Val Glu Glu Asp Asp Ile Ala Met
95 100 105
tat ttc tgt cag caa agt agg aag gtt cca ttc acg ttc ggc tcg ggg 386
Tyr Phe Cys Gln Gln Ser Arg Lys Val Pro Phe Thr Phe Gly Ser Gly
110 115 120 125
aca aag ttg gaa ata aaa cgtaagtaga cttttgctct aga 427
Thr Lys Leu Glu Ile Lys
230
<210> 2
<211> 131
<212> PRT
<213> hybrid
<400> 2
Met GIu Ser Asp Thr Leu Leu Leu Trp Val Leu Leu Leu Trp Val Pro
1 5 10 15
Gly Ser Thr Gly Asp Ile Val Leu Thr Gln Ser Pro Ala Ser Leu Ala
20 25 30
Val Ser Leu Gly Gln Arg Ala,Thr Ile Ser Cys Arg Ala Ser Glu Ser
35 40 45
Val Glu Tyr Tyr Val Thr Ser Leu Met Gln Trp Tyr Gln Gln Lys Pro
50 55 60
Gly Gln Pro Pro Lys Leu Leu Ile Tyr Ala Ala Ser Asn Val Asp Ser
65 70 75 80
Gly Val Pro Ala Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Ser
85 90 95
Leu Asn Tle His Pro Val Glu Glu Asp Asp Ile Ala Met Tyr Phe Cys
100 105 110
Gln Gln Ser Arg Lys Val Pro,Phe Thr Phe Gly Ser Gly Thr Lys Leu
115 120 125
Glu Ile Lys
130
<210> 3
2
CA 02432736 2003-06-16
WO 02/47721 PCT/USO1/47955
<211>877
<212>DNA
<213>hybrid
<220>
<221>CDS
<222>(12)..(431)
<223>
<400>
3
tctagacc ac gagtca 50
c gac
atg aca
ctc
ctg
cta
tgg
gtg
ctg
ctg
ctc
Met Glu
Ser
Asp
Thr
Leu
Leu
Leu
Trp
Val
Leu
Leu
Leu
1 5 10
tgggttccaggc tccactggt gacattgtgctcacc caatctccaget 98
TrpValProGly SerThrGly AspIleValLeuThr GlnSerProAla
15 20 25
tctttggetgtg tctctgggg cagagagccaccatc tcctgcagagcc 146
SerLeuAlaVal SerLeuGly.GlnArgAlaThrIle SerCysArgAla
30 35 40 45
agtgaaagtgtt gaatattat gtcacaagtttaatg cagtggtaccaa 194
SerGluSerVal GluTyrTyr ValThrSerLeuMet GlnTrpTyrGln
50 55 60
cagaaaccagga cagccaccc aaactcctcatctat getgcatccaac 242
GlnLysProGly GlnProPro LysLeuLeuIleTyr AlaAlaSerAsn
65 70 75
gtagattctggg gtccctgcc aggtttagtggcagt gggtctgggaca 290
ValAspSerGly ValProAla ArgPheSerGlySer GlySerGlyThr
80 85 90
gacttcagcctc aacatccat cctgtggaggaggat gatattgcaatg 338
AspPheSerLeu AsnIleHis ProValGluGluAsp AspIleAlaMet
95 100 105
tatttctgtcag caaagtagg aaggttccattcacg ttcggctcgggg 386
TyrPheCysGln GlnSerArg~LysValProPheThr PheGlySerGly
110 115 120 125
acaaagttggaa ataaaacgt aagtagacttttget ctagatcta 431
ThrLysLeuGlu IleLysArg Lys ThrPheAla LeuAspLeu
130 135
gaccaccatg gctgtcctgg tgctgttcct ctgcctggtt gcatttccaa gctgtgtcct 491
gtcccaggtg cagctgaagg agtcaggacc tggcctggtg gcgccctcac agagcctgtc 551
catcacttgc actgtctctg gattttcatt aaccagctat ggtgtacact gggttcgcca 611
gcctccagga aagggtctgg aatggctggg agtcatatgg cctggtggag gcacaaattt 671
taattcggct ctcatgtcca gactgagcat cagcgaagac aactccaaga gccaagtttt 731
3
CA 02432736 2003-06-16
WO 02/47721 PCT/USO1/47955
cttaaaaatg aacactctgc aaactgatga cacagccata tattattgtg ccagagatcg 791
ggcgtatggt aactacctct atgccatgga ctactggggt caaggaacct cagtcaccgt 851
ctcctcaggt aagaatggcc tctaga 877
<210> 4
<211> 133
<212> PRT
<213> hybrid.
<400> 4
Met Glu Ser Asp Thr Leu Leu Leu Trp Val Leu Leu Leu Trp Val Pro
1 5 10 15
Gly Ser Thr Gly Asp Ile Val Leu Thr Gln Sex Pro Ala Ser Leu Ala
20 25 30
Val Ser Leu Gly Gln Arg Ala Thr Ile Ser Cys Arg Ala Ser Glu Ser
35 ~40 45
Val Glu Tyr Tyr Val Thr Ser Leu Met Gln Trp Tyr Gln Gln Lys Pro
50 55 60
G1y Gln Pro Pro Lys Leu Leu Ile Tyr Ala Ala Ser Asn Val Asp Ser
65 70 75 80
Gly Val Pro Ala Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Ser
85 90 95
Leu Asn Ile His Pro Val Glu Glu Asp Asp Ile Ala Met Tyr Phe Cys
100 105 110
Gln Gln Ser Arg Lys Val Pro Phe Thr Phe Gly Ser Gly Thr Lys Leu
115 ' 120 125
Glu Ile Lys Arg Lys
130
<210> 5
<211> 6
<212> PRT
<213> hybrid
<400> 5
4
CA 02432736 2003-06-16
WO 02/47721 PCT/USO1/47955
Thr Phe Ala Leu Asp Leu
1 5
<210> 6
<211> 450
<212> DNA
<213> hybrid
<220>
<221> CDS
<222> (12) . . (431)
<223>
<400>
6
tctagaccac 50
c
atg
get
gtc
ctg
gtg
ctg
ttc
ctc
tgc
ctg
gtt
gca
ttt
Met u
Ala Val
Val Ala
Leu Phe
Val
Leu
Phe
Leu
Cys
Le
1 5 10
ccaagctgtgtc ctgtcccaggtg cagctgcaggag tcaggacct ggc 98
ProSerCysVal LeuSerGlnVal GlnLeuGlnGlu SerGlyPro Gly
15 20 25
ctggtgaagccc tcagagaccctg tccctcacttgc getgtctct gga 146
LeuValLysPro SexGluThr~Leu SerLeuThrCys AlaValSer Gly
30 35 40 45
ttttcattaacc agctatggtgta cactggattcgc cagcctcca gga 194
PheSerLeuThr SerTyrGlyVal HisTrpIleArg GlnProPro Gly
50 55 60
aagggtctggaa tggctgggagtc atatggcctggt ggaggcaca aat 242
LysG1yLeuGlu TrpLeuGlyVal IleTrpProGly GlyGlyThr Asn
65 70 75
tttaattcgget ctcatgtccaga ctgaccatcagc gaagacacc tcc 290
PheAsnSerAla LeuMetSerArg LeuThrIleSer GluAspThr Ser
80 85 90
aagaaccaagtt tccttaaaattg agctctgtgaca gotgetgac aca 338
LysAsnGlnVal SerLeuLysLeu SerSerValThr AlaAlaAsp Thr
95 100 105
gccgtatattat tgtgccagagat cgggcgtatggt aactacctc tat 386
AlaValTyrTyr CysAlaArg~Asp ArgAlaTyrGly AsnTyrLeu Tyr
110 l15 120 125
gcgatggactac tggggtcaagga accttagtcacc gtctcctca 431
AlaMetAspTyr TrpGlyGlnGly ThrLeuValThr ValSerSer
130 135 140
ggtaagaatg 450
gcctctaga
<210>
7
<211> 40
1
S
CA 02432736 2003-06-16
WO 02/47721 PCT/USO1/47955
<212> PRT
<213> hybrid
<400> 7
Met Ala Val Leu VaI Leu Phe Leu Cys Leu Val Ala Phe Pro Ser Cys
1 5 10 15
Val Leu Ser Gln Val Gln Leu Gln GIu Ser Gly Pro Gly Leu Val Lys
20 25 30
Pro Ser Glu Thr Leu Ser Leu Thr Cys Ala Va1 Ser Gly Phe Ser Leu
35 40 45
Thr Ser Tyr Gly Val His Trp'Ile Arg Gln Pro Pro Gly Lys Gly Leu
50 55 60
Glu Trp Leu Gly Val Ile Trp Pro Gly Gly Gly Thr Asn Phe Asn Ser
65 70 75 80
Ala Leu Met Ser Arg Leu Thr Ile Ser Glu Asp Thr Ser Lys Asn Gln
85 90 95
Val Ser Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr
100 105 110
Tyr Cys Ala Arg Asp Arg Ala Tyr Gly Asn Tyr Leu Tyr Ala Met Asp
115 120 125
Tyr Trp Gly Gln Gly Thr Leu~Val Thr Val Ser Ser
130 135 140
<210> 8
<211> 427
<212> DNA
<213> hybrid
<220>
<221> CDS
<222> (12)..(404)
<223>
<400> 8
tctagaccac c atg gag tca gac aca ctc ctg cta tgg gtg ctg ctg ctc 50
Met Glu Ser Asp Thr Leu Leu Leu Trp Val Leu Leu Leu
1 5 10
6
CA 02432736 2003-06-16
WO 02/47721 PCT/USO1/47955
tgggttccaggctcc actggt'gac att cagatgacccaa tctccatct 98
TrpValProGlySer ThrGlyAspIle GlnMetThrGln SerProSer
15 20 25
tctttgtctgcgtct gtgggggacagg gtcaccatcaca tgcagagcc 146
SerLeuSerAlaSer ValGlyAspArg ValThrIleThr CysArgAla
30 35 40 45
agtgaaagtgttgaa tattatgtcaca agtttaatgcag tggtaccaa 194
SerGluSerValGlu TyrTyrValThr SerLeuMetGln TrpTyrGln
50 ' 55 60
cagaaaccaggaaag gcacccaaactc ctcatctatget gcatccaac 242
GlnLysProGlyLys AlaProLysLeu LeuIleTyrAla AlaSerAsn
65 70 75
gtagattetggggtc ccttccaggttt agtggcagtggg tctgggaca 290
ValAspSerGlyVal ProSerArgPhe SerGlySerGly SerGlyThr
80 85 90
gacttcaccetcacc atctct~tctctg cagccggaggat attgcaacg 338
AspPheThrLeuThr IleSerSerLeu GlnProGluAsp IleAlaThr
95 100 105
tattactgtcagcaa agtaggaaggtt ccattcacgttc ggcgggggg 386
TyrTyrCysGlnGln SerArgLysVal ProPheThrPhe GlyGlyGly
110 115 120 125
acaaaggtggaaata aaacgtaagtaga 427
cttttgctct
aga
ThrLysValGluIle Lys
130
<210> 9
<211> 131
<212> PRT
<213> hybrid
<400> 9
Met Glu Ser Asp Thr Leu Leu Leu Trp Val Leu Leu Leu Trp Val Pro
1 5 10 15
Gly Sex Thr Gly Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser
20 25 30
Ala Ser Val Gly Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Glu Ser
35 ,40 45
Val Glu Tyr Tyr Val Thr Ser Leu Met Gln Trp Tyr Gln Gln Lys Pro
50 55 60
Gly Lys Ala Pro Lys Leu Leu Ile Tyr Ala Ala Ser Asn Val Asp Ser
7
CA 02432736 2003-06-16
WO 02/47721 PCT/USO1/47955
65 70 75 80
Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr
85 90 95
Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp Ile Ala Thr Tyr Tyr Cys
100 105 110
Gln Gln Ser Arg Lys Val Pro Phe Thr Phe Gly Gly Gly Thr Lys Val
115 ~ 120 125
Glu Ile Lys
130
<210> 10
<211> 445
<212> DNA
<213> hybrid
<220>
<221> CDS
<222> (21)..(419)
<223>
<400> 10
tctagac agtggggaacaat at 53
atg tca
g cag
atc
cag
gtc
ctc
atg
tcc
ctg
Met sp
A Ser
Gln
Ile
Gln
Val
Leu
Met
Ser
Leu
1 5 10
ctcctctggatg tctggtgcctgt ggagatattgtg atgacccagtct 101
LeuLeuTrpMet SerGlyAlaCys GlyAspIleVal MetThrGlnSer
15 20 25
ccatattccetg getgtgtcagca ggagagaaggtc accatgagttgc 149
ProTyrSerLeu AlaValSerAla GlyGluLysVal ThrMetSerCys
30 .35 40
aggtccagtcag agcctctattac agtggaatcaaa aagaacctcttg 197
ArgSerSerGln SerLeuTyrTyr SerGlyIleLys LysAsnLeuLeu
45 50 55
gcctggtaccag cagaaaccaggc cagtctccgaaa ctgctgatctac 245
AlaTrpTyrGln GlnLysProGly GlnSerProLys LeuLeuIleTyr
60 65 70 75
tttacatctact cggttacct~ggggtaccggatcgc ttcacaggcagt 293
PheThrSerThr ArgLeuProGly ValProAspArg PheThrGlySer
80 85 90
ggatctgggaca gattacactctc accatcaccagt gtccaggetgaa 341
GlySerGlyThr AspTyrThrLeu ThrIleThrSer ValGlnAlaGlu
8
CA 02432736 2003-06-16
WO 02/47721 PCT/USO1/47955
95 100 105
gac atg ggg cat tat ttc tgt cag cag ggt ata agc act ccg ctc acg 389
Asp Met Gly His Tyr Phe Cys,Gln Gln Gly Ile Ser Thr Pro Leu Thr
110 115 120
ttc ggt gat ggc acc aag ctg gag ata aga cgtaagtaga atccaaagtc 439
Phe Gly Asp Gly Thr Lys Leu Glu Ile Arg
125 130
tctaga 445
<210> 11
<211> 133
<212> PRT
<213> hybrid
<400> 11
Met Asp Ser Gln Ile Gln Val Leu Met Ser Leu Leu Leu Trp Met Ser
1 5 10 15
Gly Ala Cys Gly Asp Ile Val Met Thr Gln Ser Pro Tyr Ser Leu Ala
20 25 30
Val Ser Ala Gly Glu Lys Val Thr Met Ser Cys Arg Ser Ser Gln Ser
35 40 45
Leu Tyr Tyr Ser Gly Ile Lys Lys Asn Leu Leu Ala Trp Tyr Gln Gln
50 55 . 60
Lys Pro Gly Gln Ser Pro Lys Leu Leu Ile Tyr Phe Thr Ser Thr Arg
65 70 75 80
Leu Pro Gly Val Pro Asp Arg Phe Thr Gly Ser Gly Ser Gly Thr Asp
85 90 95
Tyr Thr Leu Thr Ile Thr Ser Val Gln Ala Glu Asp Met Gly His Tyr
100 105 110
Phe Cys Gln Gln Gly Ile Ser Thr Pro Leu Thr Phe Gly Asp Gly Thr
115 120 125
Lys Leu Glu Ile Arg
130
<210> 12
9
CA 02432736 2003-06-16
WO 02/47721 PCT/USO1/47955
<211> 467
<212> DNA
<213> hybrid
<220>
<221> CDS
<222> (16j..(444j
<223>
<400> 12
tctagag tcttcacc 51
atg
gta
tgg
ggc
ttg
atc
atc
atc
ttc
ctg
gtc
aca
Met
Val
Trp
Gly
Leu
Ile
Ile
Ile
Phe
Leu
Val
Thr
1 5 10
gcagetacaggt gtccactcccaggtc cagttgaag cagtctgggget 99
AlaAlaThrGly ValHisSer.GlnVal GlnLeuLys GlnSerGlyAla
15 20 25
gagcttgtgaag cctggagcctcagtg aagatatcc tgcaaaacttca 147
GluLeuValLys ProGlyAlaSerVal LysIleSer CysLysThrSer
30 35 40
ggctataccttc actgatggctacatg aactgggtt gagcagaagcct 195
GlyTyrThrPhe ThrAspGlyTyrMet AsnTrpVal GluGlnLysPro
45 50 55 60
gggcagggcctt gagtggattggaaga attgatcct gatagtggtaat 243
GlyGlnGlyLeu GluTrpTleGlyArg IleAspPro AspSerGlyAsn
65 70 75
actcggtacaat cagaaattccagggc aaggccaca ctgactagagac 291
ThrArgTyrAsn GlnLysPheGlnGly LysAlaThr LeuThrArgAsp
80 85 90
aaatcctccagc acagtctacatggac ctcaggagc ctgacatctgag 339
LysSerSerSer ThrValTyr~MetAsp LeuArgSer LeuThrSerGlu
95 100 105
gactctgetgtc tattactgtgcgaga gatgggacc ttctacggtacc 387
AspSerAlaVal TyrTyrCysAlaArg AspGlyThr PheTyrGlyThr
110 115 120
tacggctactgg tacttcgatttctgg ggccagggg acccaggtcacc 435
TyrGlyTyrTrp TyrPheAspPheTrp GlyGlnGly ThrGlnValThr
125 130 135 140
gtctcctcaggtgagtcct 467
taaaacctct
aga
ValSerSer
<210>
13
<211>
143
<212>
PRT
<213>
hybrid
CA 02432736 2003-06-16
WO 02/47721 PCT/USO1/47955
<400> 13
Met Val Trp Gly Leu Ile Ile Ile Phe Leu Val Thr Ala Ala Thr Gly
1 5 10 15
Val His Ser Gln Val Gln Leu Lys Gln Ser Gly Ala Glu Leu Val Lys
20 25 30
Pro Gly Ala Ser Val Lys Ile Ser Cys Lys Thr Ser Gly Tyr Thr Phe
35 40 45
Thr Asp Gly Tyr Met Asn Trp Val Glu Gln Lys Pro Gly Gln Gly Leu
50 55 60
Glu Trp Ile Gly Arg Ile Asp Pro Asp Sex Gly Asn Thr Arg Tyr Asn
65 70 . 75 80
Gln Lys Phe Gln Gly Lys Ala Thr Leu Thr Arg Asp Lys Ser Ser Ser
85 90 95
Thr Val Tyr Met Asp Leu Arg Ser Leu Thr Ser Glu Asp Ser Ala Val
100 105 110
Tyr Tyr Cys Ala Arg Asp Gly Thr Phe Tyr Gly Thr Tyr Gly Tyr Trp
115 120 125
Tyr Phe Asp Phe Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser
130 135 140
<210> 14
<211> 46
<212> DNA
<213> Artificial Sequence
<220>
<223> synthetic DNA
<400> 14
tatagagctc aagcttggat ggtgggaaga tggatacagt tggtgc 46
<210> 15
<211> 50
<212> DNA
<213> Artificial Sequence
<220>
<223> synthetic DNA
11
CA 02432736 2003-06-16
WO 02/47721 PCT/USO1/47955
<400> l5
tatagagctc aagcttccag tggatagacc gatggggctg tcgttttggc 50
<210> 16
<211> 50
<212> DNA
<213> Artificial Sequence
<220>
<223> synthetic DNA
<400> 16
tatagagctc aagcttccag tggatagaca gatgggggtg ttgttttggc 50
<210> 17
<211> 50
<212> DNA
<213> Artificial Sequence
<220>
<223> synthetic DNA
<400> 17
tatagagctc aagcttccag tggatagacc gttggggctg tcgttttggc 50
<210> 18
<211> 50
<212> DNA
<213> Artificial Sequence
<220>
<223> synthetic DNA
<400> 18
tatagagctc aagcttccag tggatagacc gatggggctg tcgttttggc 50
<210> 19
<211> 50
<212> DNA
<213> Artificial Sequence
<220>
<223> synthetic DNA
<400> 19
tatagagcte aagcttccag tggatagacc gatgggggtg ttgttttggc 50
<210> 20
<211> 50
<212> DNA
<213> Artificial Sequence
12
CA 02432736 2003-06-16
WO 02/47721 PCT/USO1/47955
<220>
<223> synthetic DNA
<400> 20
tatagagctc aagcttccag tggatagtcc gatggggctg tcgttttggc 50
<210> 21
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> synthetic DNA
<400> 21
tatagagctc cacttccagt gccc 24
I3
<210> 18
<211>
