Note: Descriptions are shown in the official language in which they were submitted.
CA 02433041 2003-06-25
WO 02/053171 PCT/EPOl/15317
Use of intermediate-conductance potassium channels and
modulators for diagnosing and treating diseases
involving disturbed keratinocyte activity
The invention relates to the use of human or mouse
intermediate-conductance calcium-activated potassium
channels and/or their encoding nucleic acids for
diagnosing, preventing and/or treating diseases which
are connected with disturbed keratinocyte activity, and
to their use for identifying pharmacologically active
substances. In addition, the invention relates to the
use of modulators of intermediate-conductance calcium
activated potassium channels for diagnosing, preventing
and/or treating diseases which are connected with
disturbed keratinocyte activity.
Many diseases of the skin are connected with disturbed
keratinocyte activity. The importance of the
keratinocytes for maintaining normal physiological
processes in the skin during wound healing can be
retraced by way of example: the wound healing process
is an extremely complex process which is characterized
by the phases of blood coagulation in the region of the
wound, recruitment of inflammatory cells,
reepithelialization and tissue reorganization. Blood
coagulation results in the formation of a fibrin matrix
which serves to fill the cavity arising from the wound
and provides a matrix through which the cells can
immigrate. Chemoattractants which have become deposited
in the matrix then recruit neutrophils and monocytes
which initiate an inflammatory reaction. There then
comes the central step of reepithelialization for the
purpose of once again forming a protective epithelial
barrier over the wound. This is accomplished by
keratinocytes, which constitute the majority of the
epidermal cells and are only found in the skin. In
order to achieve reepithelialization, the keratinocytes
change [lacuna] integrin composition at the cell
CA 02433041 2003-06-25
WO 02/053171 PCT/EPO1/15317
- 2
surface, as a result of which they detach themselves
from their initial location and are able to migrate
over the wound. There they reattach themselves,
proliferate and finally differentiate. Keratinocytes
secrete matrix metalloproteinases and collagenases
which break down proteins in the surrounding tissue and
thereby facilitate migration in the wound tissue. In
addition, keratinocytes secrete growth factors such as
VEGF, KAF, TGF-beta and TGF-alpha. These growth factors
in turn stimulate cell proliferation and the formation
of components of the extracellular matrix and mediate
the growth of new blood vessels into the wound bed.
During the subsequent tissue reorganization, which can
last for up to 2 years after injury, there is a
continuous process of collagen synthesis, of renewed
breakdown of collagen, of squamous differentiation of
the keratinocytes and the formation of a scar.
This overview of the wound healing process makes clear
that wound healing which proceeds normally requires
complex spatial and chronological changes in
keratinocyte activity, such as migration, proliferation
and differentiation. Disturbances in keratinocyte
activies can therefore lead to disturbances in wound
healing and to other skin diseases. Examples of
diseases with which dysfunctional keratinocytes have
been connected are psoriasis, contact dermatitis,
atopic eczema, ulcera, vitiligo, hyperkeratoses,
actinic keratoses and acne.
Disturbances in the wound healing or in the scar, such
as the formation of hypertrophic scars or keloids, can
also occur after the wound has closed. A connection
with keratinocyte activity has also been suggested in
the case of these diseases. Thus, keratinocytes derived
from hypertrophic scars which were formed following
burn wounds were demonstrated to exhibit a higher
CA 02433041 2003-06-25
WO 02/053171 PCT/EPO1/15317
- 3
degree of proliferation, differentiation and activation
than did keratinocytes derived from intact skin.
Skin diseases, disturbed wound healing and cosmetic
impairment are problems which arise during aging. Thus,
what is termed geriatric skin is characterized by
thinning of the epidermis and consequently of the
protective barrier. In addition, the number of
enzymically active melanocytes declines by 10-20o every
10 years in humans from the age of 25-30 onwards,
resulting in exposure to radiation increasing. In
connection with this, the pigmentation of old skin is
frequently heterogeneous; both local loss of
pigmentation and hyperpigmentation are observed. This
has been attributed, inter alia, to modification of the
melanocyte/keratinocyte interaction. Examples of
frequently occurring pigment lesions are lentigo and
ephelides.
Only very little is known about the molecular
principles which underlie skin diseases and wound
healing and consequently also disturbances in wound
healing. This is due to the enormous complexity of the
skin and of the diseases which are associated with it.
Thus, therapies which have to date been developed for
intervening in wound healing disturbances are not
particularly satisfactory. Established forms of therapy
are limited to physically supporting the wound healing
(e. g. bandages, compresses or gels) or transplanting
skin tissues, cultured skin cells and/or matrix
proteins. In recent years, growth factors have been
tested for their ability to ameliorate wound healing
without, however, significantly improving on
conventional therapy. The diagnosis of wound healing
disturbances is also based on optical analyses of the
skin which are not particularly informative since a
CA 02433041 2003-06-25
WO 02/053171 PCT/EPO1/15317
- 4
deeper understanding of gene regulation during wound
healing is thus far lacking.
Potassium channels constitute a heterogeneous group of
proteins which play an important role in regulating the
membrane potential and consequently also the
secondarily energetized transmembrane transport of
molecules. In addition, they frequently play a role in
cell proliferation (Nilius and Droogmans; 1994, News in
Physiol. Sci., 9: 105-110). In some cases, potassium
channels have been connected with genetically
transmissible diseases (Curran, 1998, Curr. Opin. in
Biotech., 9: 565-572). This fact, and also the
advantages of the potassium channels that they can be
used for developing robust assay systems for in-vitro
characterization and for high throughput screening,
explain the attractiveness of potassium channels as a
target for developing drugs (Curran, see above).
The potassium channel family is a very heterogeneous
group which can be divided into five subfamilies: the
voltage-activated potassium channels (Kv), the long QT
related potassium channels, the inward rectifying
potassium channels and the calcium-activated potassium
channels. While a large number of publications mention
the voltage-dependent potassium channels as being
suitable targets for treating skin diseases
(WO 99/07411; WO 97/18332; WO 99/25703), n drugs for
treating diseases which are connected with disturbed
keratinocyte activity have so far been developed.
The calcium-activated potassium channels are divided
into three well characterized subgroups: the small-
conductance (SK); the intermediate-conductance (IK) and
the big-conductance (BK) potassium channels. These
subgroups differ in their voltage sensitivity and
calcium sensitivity, their expression profile, their
CA 02433041 2003-06-25
WO 02/053171 PCT/EPO1/15317
- 5
biological function and their pharmacological
properties.
Homologs of the IK channel have been identified both in
humans (hIKl or hsk4; Ishii et al. 1997 Proc. Natl.
Acad. Sci. USA 94: 11651-11656; Joiner et al., 1997,
Proc. Natl. Acad. Sci. USA, 94: 11013-11018;
WO 99/03882; WO 98/11139) and in mice (mIKl; Vandorpe
et al., 1998, J. Biol. Chem. 273: 21542-21553). Because
they have the same properties, it is assumed that the
Gardos channel, which has been characterized only
electrophysiologically and pharmacologically in
erythrocytes, is identical with hIKl (Ishii et al. 1997
Proc. Natl. Acad. Sci. USA 94: 11651-11656). The Gardos
channel plays an important function in the strength
with which the sickle cell anemia phenotype is
expressed by exerting an influence on the dehydration
and volume of diseased erythrocytes (Curran, see
above ) . In the mouse, the cDNA encoding the IK channel
has been isolated from erythroleukemia cells (Vandorpe
et al., see above). This study showed that the
expression of mIKl is increased during the
differentiation of ES cells into erythroid cells. In
addition, it was possible to inhibit the proliferation
and differentiation with inhibitors of the ion channel.
It is striking that, in humans, the IK channel, in
contrast to SK channels, is only expressed in a few
cell types and organs (WO 99/03882; Ishii et al. 1997
Proc. Natl. Acad. Sci. USA 94: 11651-11656; Joiner et
al., 1997, Proc. Natl. Acad. Sci. USA, 94: 11013-
11018): all the publications show that expression is
restricted to organs which cannot be excited
electrically, such as placenta and prostate, whereas no
expression is detected in the brain or in the heart.
This is reflected in the school of thought that
expression of hIK in humans is restricted to cells of
the blood (e.g. B lymphocytes, T lymphocytes and
CA 02433041 2003-06-25
WO 02/053171 PCT/EPO1/15317
- 6
erythrocytes) and of the vascular system (e. g.
endothelial cells of the kidney and the mesentery and
capillary endothelial cells in the brain (Kohler et
al., 2000, Circ. Res. 87: 496-503) (WO 00/34248). The
IK1 channel has also been shown to be expressed in
cells of the urinary bladder and the colon (Ohya et
al., 2000, Jpn. J. Pharmacol. 84: 97-100; Warth et al.,
1999, Pfliigers Arch. 438: 437-444). No expression of
hIKl or mIKl has thus far been detected in skin or
keratinocytes.
In addition to employing it for modulating sickle cell
anemia, it has been proposed that hIKl be used for
diagnosing, preventing or treating diseases which are
connected with dysfunctional leukocytes (WO 99/25347).
In addition, inhibitors of the IK channel are used in
connection with developing drugs for treating diarrhea
and cystic fibrosis. In recent years, a large number of
specific modulators of IK activity, which can be used
pharmaceutically, have been developed (Syme et al.,
2000, Am. J. Physiol. 278: C570-581; WO 99/25347;
WO 00/33834; WO 00/34228; WO 00/34248; WO 00/37422).
The object of the invention was to make available
polypeptides, and/or their encoding nucleic acids,
which are involved in diseases which are connected with
disturbed keratinocyte activity and whose use
decisively improves diagnosis, prevention or treatment
and the identification and development of
pharmaceuticals which are effective in diseases which
are connected with disturbed keratinocyte activity.
An additional object of the invention was to provide
modulators of the activity of the polypeptides
according to the invention, the use of which modulators
decisively improves diagnosis, prevention or treatment
and the identification and development of
CA 02433041 2003-06-25
WO 02/053171 PCT/EPO1/15317
pharmaceuticals which are effective in diseases which
are connected with disturbed keratinocyte activity.
When keratinocytes were stimulated with ATP, bradykinin
and histamine, which are released in the skin in
association with diseases which are connected with
disturbed keratinocyte activity, the keratinocytes were
found to be hyperpolarized for a long period.
Surprisingly, it was possible to identify, as the
mediator of this electrophysiological response, an
intermediate-conductance calcium-activated potassium
channel which had previously not been detected in the
skin or in keratinocytes and which was for the first
time brought into connection with disturbed
keratinocyte activity. In addition, it was possible,
for the first time, to establish a connection between
the level of expression and/or activity of an
intermediate-conductance calcium-activated potassium
channel and potassium channel and the diagnosis,
prevention and/or treatment of diseases which are
connected with disturbed keratinocyte activity, in
particular wound healing disturbances and/or psoriasis.
The polypeptides, and their encoding nucleic acids, do
not belong to the previously known targets for
diagnosing, for example the indication and/or
treatment, such as the modulation, and/or preventing
diseases which are connected with disturbed
keratinocyte activity, or for identifying
pharmacologically active substances, which means that
completely novel therapeutic approaches result from
this invention. In addition, modulators of the
polypeptides according to the invention, such as
inhibitors or activators, have not been used in
diagnosing, preventing and/or treating diseases which
are connected with disturbed keratinocyte activity,
which means that completely novel therapeutic
approaches result.
CA 02433041 2003-06-25
WO 02/053171 PCT/EPO1/15317
g -
The object is therefore achieved by using the human
(hIKl or hSK4; SEQ ID No. 3; Ishii et al. 1997 Proc.
Natl. Acad. Sci. USA 94: 11651-11656; Joiner et al.,
1997, Proc. Natl. Acad. Sci. USA, 94: 11013-11018;
WO 99/03882; WO 98/11139) or mouse (mIKl; SEQ ID No. 4;
Vandorpe et al. 1998, J. Biol. Chem. 273: 21542-21553)
intermediate-conductance calcium-activated potassium
channel IKl polypeptide, or functional variants
thereof, and/or nucleic acids encoding them, or
variants thereof, for diagnosing, preventing and/or
treating diseases which are connected with disturbed
keratinocyte activity or for identifying
pharmacologically active substances.
In addition, the object is achieved by using modulators
of IK1 activity for diagnosing, preventing and/or
treating diseases which are connected with disturbed
keratinocyte activity.
None of the ion channels or their encoding nucleic
acids has previously been reported to be connected with
diseases which are connected with disturbed
keratinocyte activity, for example in association with
disturbed wound healing, nor has such a connection been
suggested. It was therefore unexpected that these
compounds can be used in accordance with the invention.
The accession numbers of the polypeptides employed in
accordance with the invention, and of their cDNAs, are
listed in Table 1.
Furthermore, none of the modulators of the polypeptides
according to the invention has previously been reported
to be connected with skin diseases, for example in
association with disturbed wound healing and/or
psoriasis, nor has such a connection been suggested. It
was therefore unexpected that these compounds can be
used in accordance with the invention.
CA 02433041 2003-06-25
WO 02/053171 PCT/EPO1/15317
- 9
In addition to this, it has not been disclosed that the
modulators of the activity of the polypeptides which
can be used in accordance with the invention can be
employed for diagnosing, preventing and/or treating
diseases which are connected with disturbed
keratinocyte activity, in particular wound healing
disturbances and/or psoriasis, which means that this
invention results in completely novel therapeutic
approaches.
The polypeptides which are used in accordance with the
invention can furthermore be characterized by the fact
that they are prepared synthetically. Thus, the entire
polypeptide, or parts thereof, can be synthesized, for
example using classical synthesis (Merrifield
technique). Parts of the above-described polypeptides
are suitable, in particular, for obtaining antisera
which can be used to screen suitable gene expression
libraries in order, in this way, to obtain further
functional variants of a polypeptide which can be used
in accordance with the invention.
'Keratinocyte activity' is understood as meaning the
state of a keratinocyte which is defined by the
parameters proliferation rate and the degree of
differentiation of the keratinocyte under
investigation. The skilled person is familiar with
methods for determining the parameters (de Fries and
Mitsuhashi, 1995, J. Clin. Lab. Anal. 9:89-95; Perros
and Weightman, 1991, Cell Prolif. 24:517-23; Savino and
Dardenne, 1985, J. Immunol. Methods 85:221-6; Schulz et
al., 1994, J. Immunol. Methods 167:1-13; Frahm et al.,
1998, J. Immunol. Methods 211: 43-50; Rosenthal et al.,
1992, J, Invest, Dermatol, 98:343-50). The degree of
differentiation can, for example, be determined using
suitable stains with which the skilled person is
familiar.
CA 02433041 2003-06-25
WO 02/053171 PCT/EPO1/15317
- 10
'Disturbed' keratinocyte activity is understood as
meaning a keratinocyte activity of a keratinocyte in
the skin which differs from the keratinocyte activity
of keratinocytes in normal, intact skin. For example,
the activity of the 'disturbed' keratinocytes can
differ from that of normal keratinocytes as a result of
an increased or reduced proliferation rate or as the
result of premature, accelerated, decelerated or
delayed differentiation or differentiation which is not
present. Examples of diseases which are connected with
disturbed keratinocyte activity are contact dermatitis,
atopic eczema, vitiligo, hyperkeratoses, actinic
keratoses, hypertrophic scars, keloids, lentigo,
ephelides and geriatric skin. In addition, wounds, for
example normally healing wounds and poorly healing
wounds, in particular ulcera, are, in particular,
preferred diseases within the meaning of the present
invention which are characterized by disturbed
keratinocyte activity. A particularly preferred disease
is psoriasis.
The term 'regulation' is understood, for example, as
meaning an increase or decrease in the quantity and/or
activity of the polypeptides or nucleic acids which
encode them, with it being possible for this change to
take place, for example, at the transcriptional,
translational and posttranscriptional or
posttranslational level.
The term 'functional variants' is to be understood as
meaning polypeptides which, for example like the
polypeptides which can be used in accordance with the
invention, are connected with disturbed keratinocyte
activity and/or exhibit structural features of the
polypeptides which can be used in accordance with the
invention.
CA 02433041 2003-06-25
WO 02/053171 PCT/EPO1/15317
- 11
Functional variants also include fusion proteins of the
IK channels having a moiety of approx. 1-300,
preferably approx. 1-200, particularly preferably
approx. 1-150, in particular approx. 1-100, especially
approx. 1-50, foreign amino acids, which can be linked
to the polypeptide chain of the IK channels N
terminally, C-terminally or as an insertion.
Furthermore, an IK channel which can be used in
accordance with the invention can be linked to a green
fluorescent protein or variants thereof.
Functional variants of the polypeptides can also be
parts of the polypeptide which is used in accordance
with the invention, having a length of at least 6 amino
acids, preferably having a length of at least 8 amino
acids, in particular having a length of at least
12 amino acids, very particularly having a length of at
least 20 amino acids, especially having a length of
40 amino acids, most preferably having a length of at
least 80 amino acids. Also included are deletions of
the polypeptide in the range of approx. 1-60,
preferably of approx. 1-30, in particular of approx. 1-
15, especially of approx. 1-5, amino acids. For
example, the first amino acid methionine can be missing
without the function of the polypeptide being
significantly altered.
Within the meaning of the present invention,
'functional variants' are polypeptides which exhibit a
sequence homology, in particular a sequence identity,
of approx. 500, preferably approx. 600, in particular
approx. 700, particularly preferably approx. 900, most
preferably 95o, with one of the IK channels having the
amino acid sequence as depicted in either SEQ ID No. 3
or SEQ ID No. 4. Accordingly, the corresponding
polypeptides which are derived from other organisms
than humans or the mouse, preferably from nonhuman
mammals, such as monkeys, pigs and rats, are also
CA 02433041 2003-06-25
WO 02/053171 PCT/EPO1/15317
- 12
examples of these functional variants. Other examples
are polypeptides which are encoded by different alleles
of the gene, in different individuals or in different
organs of an organism.
'Sequence identity' is understood as meaning the
congruence (= o positive) which exists between two
sequences and which is determined using BlastP 2Ø1,
for example, in the case of polypeptide sequences and
using BlastN 2Ø14, for example, in the case of
polynucleotide sequences, with the filter being set at
'off' (Altschul et al., 1997, Nucleic Acid Res.
25: 3389-3402). For example, BlastP 2Ø1 is used for
determining the similarity between two polypeptides,
with the filter being set at 'off' and BLOSUM being 62.
Functional variants also include, for example,
polypeptides which are encoded by nucleic acids which
are isolated from non-skin-specific tissue, e.g.
embryonic tissue, but which, following expression in a
keratinocyte, possess the described functions.
In order to establish whether a polypeptide is a
functional variant of a polypeptide which can be used
in accordance with the invention, it is possible to
employ functional tests to compare the activity of the
polypeptide to be examined with the activity of a
polypeptide, as depicted in SEQ ID No. 3 or SEQ ID
No. 4, which can be used in accordance with the
invention. On the assumption that the polypeptide to be
examined meets the requirements a a functional variant
at the level of sequence identity, the polypeptide to
be examined is then a functional variant when its
activity in the functional test turns out to be similar
or identical to that of the polypeptide which can be
used in accordance with the invention.
CA 02433041 2003-06-25
WO 02/053171 PCT/EPO1/15317
- 13
These functional tests include, for example, the
application of an expression vector which contains a
nucleic acid encoding the polypeptide to be examined,
or the application of the actual polypeptide to be
examined, or of an antibody which is directed against
the polypeptide to be examined, or of an antisense
polynucleotide, in wounds. Following incubation, for
example of an expression vector, the progress of the
wound healing is compared when administering the
different expression vectors, containing either a
nucleic acid encoding the polypeptide to be examined or
a nucleic acid encoding a polypeptide which can be used
in accordance with the invention, or an expression
vector without insert. These functional tests can also
be applied, for example, to the activity of the
polypeptide to be examined in connection with
disturbances in wound healing, for example in
connection with poorly healing, dexamethasone-treated
or diabetic wounds in animals. Thus, the application of
PDGF-A and PDGF-B polypeptides to poorly healing wounds
in rabbits led, for example, to a comparable
improvement in the healing of the wounds (J. Surg.
Res., 2000, 93: 230-236). Comparable tests can be
carried out in the case of skin diseases, for example
psoriasis. In this case, an expression vector which
contains a nucleic acid encoding the polypeptide to be
examined, or the actual polypeptide to be examined, or
an antibody directed against the polypeptide to be
examined, or an antisense oligonucleotide, is applied,
for example, to an affected portion of human skin,
which has been transplanted to SCID mice, and the
course of the skin disease, for example the healing, is
determined and compared with the course of the skin
disease in a control experiment. In the case of
psoriasis, this can also include, for example,
antiproliferation studies in what are termed mouse tail
tests. In this case, use is made of the fact that the
normal histological structure of the skin of a mouse
CA 02433041 2003-06-25
WO 02/053171 PCT/EPO1/15317
- 14
tail strongly resembles that of human skin which is
affected with psoriasis: thus, tail skin possesses what
are termed hinge regions, where hair strands come out
from under the scales; at these sites, the skin is
orthokeratotic and possesses a granular layer like
normal skin. After a polypeptide to be examined has
been added, histological sections of the tail skin are
measured for the formation of a granulation layer, the
induction of orthokeratotic tissue in parakeratotic
regions and the thickness of the epidermis (Jarret et
al., 1970, Br J Dermatol 82: 187-199). This method can
also be quantified by measuring sagital sections after
staining with hematoxylin/eosin (Bosman et al., 1992,
Skin Pharmacol 5: 41-48; Bosman et al., 1994, Skin
Pharmakol 7: 324-334). In addition, the
antiinflammatory effect of the polypeptide to be
examined can be employed by means of topical
administration to mice in which edemas have been
induced with oxazolone or to pigs in which allergic
skin reactions have been induced with DNFB (Meingassner
et al., 1997, Br J Dermatol 137: 568-576). Functional
tests also involve measuring the effect of the
polypeptide to be examined on the extent of the skin
scaling. Thus, measurements of transepidermal water
loss (TEWL) in psoriatric patients verify that the
pathologically altered epithelial layers have lost
their barrier function for water (Frodin et al., 1988,
Acta Derm Venerol 68: 461-467, see example).
The term 'encoding nucleic acid' refers to a DNA
sequence which encodes an isolatable, bioactive
polypeptide which can be used in accordance with the
invention or a precursor. The polypeptide can be
encoded by a full-length sequence or by any part of the
encoding sequence as long as the specific, for example
ion-channel, activity is retained.
CA 02433041 2003-06-25
WO 02/053171 PCT/EPO1/15317
- 15
It is known that small changes in the sequence of the
nucleic acids which can be used in accordance with the
invention can be present, for example as a result of
the degeneracy of the genetic code, or that
untranslated sequences can be appended at the 5' end
and/or 3' end of the nucleic acid, without the activity
of the latter being significantly altered. This
invention therefore also includes what are termed
'variants' of the above-described nucleic acids.
'Stringent hybridization conditions' are to be
understood as meaning the conditions under which a
hybridization takes place at 60°C in 2.5 x SSC buffer,
followed by several washing steps at 37°C in a lower
buffer concentration, such as 0.5 x SSC buffer, and is
stable.
The term 'variants' designates any DNA sequences which
are complementary to a DNA sequence, which hybridize
with the reference sequence under stringent conditions
and encode a polypeptide which exhibits an activity
which is similar to that of the polypeptide encoded by
the reference sequence.
Variants of the nucleic acids can also be part of the
nucleic acids used in accordance with the invention
having a length of at least 8 nucleotides, preferably
having a length of at least 18 nucleotides, in
particular having a length of at least 24 nucleotides.
The nucleic acids which are used in accordance with the
invention are preferably DNA or RNA, preferably a DNA,
in particular a double-stranded DNA. Furthermore, the
sequence of the nucleic acids can be characterized in
that it contains at least one intron and/or one polyA
sequence. The nucleic acids which are used in
accordance with the invention can also be employed in
the form of their antisense sequence.
CA 02433041 2003-06-25
WO 02/053171 PCT/EPO1/15317
- 16
It is furthermore possible to use a nucleic acid which
has been prepared synthetically for implementing the
invention. Thus, the nucleic acid which can be used in
accordance with the invention can, for example, be
synthesized chemically, for example by the
phosphotriester method, using the cDNA sequences
depicted in SEQ ID No. 1 or SEQ ID No. 2 and/or using
the protein sequences depicted in SEQ ID No. 3 or SEQ
ID No. 4 (see also Table 1) while referring to the
genetic code (see, e.g., Uhlmann, E. & Peyman, A.
(1990) Chemical Reviews, 90, 543-584, No. 4).
Another use of the nucleic acid sequences which are
employed in accordance with the invention is that of
constructing antisense oligonucleotides (Zheng and
Kemeny, 1995, Clin. Exp. Immunol. 100: 380-2; Nellen
and Lichtenstein, 1993, Trends Biochem. Sci. 18: 419-
23; Stein, 1992, Leukemia 6: 967-74) and/or ribozymes
(Amarzguioui, et al. 1998, Cell. Mol. Life Sci.
54: 1175-202; Vaish, et al., 1998, Nucleic Acids Res.
26: 5237-42; Persidis, 1997, Nat. Biotechnol. 15: 921-
2; Couture and Stinchcomb, 1996, Trends Genet. 12: 510-
5) and/or what are termed small interfering RNA
molecules (siRNAs) (Elbashir et al., Nature 2001;
411: 494-8). Antisense oligonucleotides can be used to
decrease the stability of the above-described nucleic
acid and/or inhibit the translation of the above-
described nucleic acid. A similar approach is that of
using siRNA oligonucleotides, which likewise lead to a
decrease in the quantity of polypeptide. Thus, the
expression of the corresponding genes in skin cells
can, for example, be decreased both in vivo and in
vitro by using antisense molecules and/or siRNA
molecules and/or ribozymes. These oligonucleotides can
therefore be suitable for use as a therapeutic agent.
This strategy is particularly suitable for skin cells,
preferably for keratinocytes, when the antisense
oligonucleotides are complexed with liposomes (Smyth et
CA 02433041 2003-06-25
WO 02/053171 PCT/EPO1/15317
- 17
al., 1997, J. Invest. Dermatol. 108: 523-6; White et
al., 1999, J. Invest. Dermatol. 112: 699-705; White et
al., 1999, J. Invest. Dermatol. 112: 887-92). A single
stranded DNA or RNA is preferred for use as a probe or
as an antisense oligonucleotide.
The probe according to the invention can be used for
diagnosing diseases which are connected with disturbed
keratinocyte activity, where appropriate in combination
or together with suitable additives and/or auxiliary
substances.
As a rule, oligonucleotides are rapidly broken down by
endonucleases or exonucleases, in particular by DNases
and RNases which are present in the cell. For this
reason, is it advantageous to modify the nucleic acid
in order to stabilize it against breakdown such that a
high concentration of the nucleic acid is maintained in
the cell over a long period (Beigelman et al., 1995,
Nucleic Acids Res. 23: 3989-94; Dudycz, 1995,
WO 95/11910; Macadam et al., 1998, WO 98/37240; Reese
et al., 1997, WO 97J29116). Typically, such a
stabilization can be obtained by introducing one or
more internucleotide phosphorus groups or by
introducing one or more non-phosphorus
internucleotides.
Uhlmann and Peymann (1990 Chem. Rev. 90, 544) provide a
summary of suitable modified internucleotides (see also
Beigelman et al., 1995 Nucleic Acids Res. 23: 3989-94;
Dudycz, 1995, WO 95/11910; Macadam et al., 1998,
WO 98/37240; Reese et al., 1997, WO 97/29116). Modified
internucleotide phosphate radicals and/or non-
phosphorus bridges in a nucleic acid which can be
employed in one of the uses according to the invention
contain, for example, methylphosphonate, phosphoro-
thioate, phosphoramidate, phosphorodithioate or
phosphate ester, whereas non-phosphorus internucleotide
CA 02433041 2003-06-25
WO 02/053171 PCT/EPO1/15317
- 18
analogs contain, for example, siloxane bridges,
carbonate bridges, carboxymethyl esters, acetamidate
bridges and/or thioether bridges. The intention also is
that this modification should improve the durability of
a pharmaceutical composition which can be employed in
one of the uses according to the invention.
In another embodiment of the invention, the nucleic
acids which can be used in accordance with the
invention are employed for preparing a vector,
preferably in the form of a shuttle vector, phagemid,
cosmid, expression vector or vector which is effective
in gene therapy. In addition, the above-described
nucleic acids can be used to prepare knock-out gene
constructs or expression cassettes.
Thus, the nucleic acid which can be used in accordance
with the invention can be present in a vector,
preferably in an expression vector or a vector which is
effective in gene therapy. The vector which is
effective in gene therapy preferably contains skin-
specific or keratinocyte-specific regulatory sequences
which are functionally linked to the above-described
nucleic acid.
In general, preference is given to using a double-
stranded DNA for expressing the relevant gene, with
particular preference being given to the DNA region
which encodes the polypeptide. This region begins, for
example, with the first start codon (ATG) which is
located in a Kozak sequence (Kozak, 1987, Nucleic Acids
Res. 15: 8125-48) up to the next stop codon (TAG, TGA
or TAA) which is located in the same reading frame as
the ATG. In prokaryotes, this region begins with a
conserved sequence of 6 nucleotides, i.e. what is
termed the Shine-Dalgarno sequence (Shine & Dalgarno,
1975, Eur J Biochem. 57: 221-30), which is located a
few nucleotides upstream of the start codon.
CA 02433041 2003-06-25
WO 02/053171 PCT/EPO1/15317
- 19
The expression vectors can be prokaryotic or eukaryotic
expression vectors. Examples of prokaryotic expression
vectors are, e.g., the vectors pGEM or pUC derivatives,
for expression in E. coli, while examples of eukaryotic
expression vectors are, e.g., the vectors p426Met25 and
p426GAL1, for expression in Saccharomyces cerevisiae
(Mumberg et al. (1994) Nucl. Acids Res., 22, 5767-
5768) " e.g., baculovirus vectors, for expression in
insect cells, as disclosed in EP-B1-0 127 839 or
EP-B1-0 549 721, and, e.g., the vectors Rc/CMV and
Rc/RSV or SV40 vectors, for expression in mammalian
cells, all of which can be obtained generally.
In general, the expression vectors also contain
promoters which are suitable for the given host cell,
such as the trp promoter for expression in E. coli
(see, e.g., EP-Bl-0 154 133), the Met 25, GAL 1 or ADH2
promoter for expression in yeasts (Russel et al.
(1983), J. Biol. Chem. 258, 2674-2682; Mumberg, see
above) or the baculovirus polyhedrin promoter for
expression in insect cells (see z.13 EP-B1-0 127 839).
Regulatory elements which permit constitutive,
regulable, tissue-specific, cell cycle-specific or
metabolism-specific expression in eukaryotic cells are
suitable, for example, for expression in mammalian
cells. Regulatory elements according to the present
invention contain promoter, activator, enhancer,
silencer and/or repressor sequences.
Examples of suitable regulatory elements which permit
constitutive expression in eukaryotes are promoters
which are recognized by RNA polymerase III or viral
promoters, CMV enhancer, CMV promoter, SV40 promoter or
LTR promoters, e.g. derived from MMTV (mouse mammary
tumor virus; Lee et al. (1981) Nature 214, 228-232) and
other viral promoter and activator sequences which are
derived, for example, from HBV, HCV, HSV, HPV, EBV,
HTLV or HIV.
CA 02433041 2003-06-25
WO 02/053171 PCT/EPO1/15317
- 20
Examples of regulatory elements which permit inducible
expression in eukaryotes are the tetracycline operator
in combination with an appropriate repressor (Gossen M.
et al. (1994) Curr. Opin. Biotechnol. 5, 516-20).
Expression of the genes which are used in accordance
with the invention preferably takes place under the
control of tissue-specific promoters, with skin-
specific promoters, such as the human K10 promoter
(Bailleul et al., 1990. Cell 62: 697-708), the human
K14 promoter (Vassar et al., 1989, Proc. Natl. Acad.
Sci. USA 86: 1563-67) or the bovine cytokeratin IV
promoter (Fucks et al., 1988; The biology of wool and
hair (eds.: G.E. Rogers, et al.), pp. 287-309. Chapman
and Hall, London/New York) being particularly to be
preferred.
Other examples of regulatory elements which permit
tissue-specific expression in eukaryotes are promoters
or activator sequences derived from promoters or
enhancers belonging to those genes which encode
proteins which are only expressed in particular cell
types, preferably keratinocytes.
Examples of regulatory elements which permit cell
cycle-specific expression in eukaryotes are promoters
of the following genes: cdc25, cyclin A, cyclin E,
cdc2, E2F, B-myb and DHFR (Zwicker J. and Muller R.
(1997) Trends Genet. 13, 3-6).
Examples of regulatory elements which permit
metabolism-specific expression in eukaryotes are
promoters which are regulated by hypoxia, by glucose
lack, by phosphate concentration or by heat shock.
Examples of regulatory elements which simultaneously
permit expression which is spatially and temporally
restricted are nucleic acids which encode a fusion
CA 02433041 2003-06-25
WO 02/053171 PCT/EPO1/15317
- 21
protein, with the nucleic acid being present between
the sequence for the site-specific recombinase Cre and
a modified estrogen receptor which is under the control
of a tissue-specific promoter. The resulting, tissue-
s specific cytoplasmic fusion protein can translocate
into the cell nucleus, as a result of administering the
estrogen analog tamoxifen, and generate recombinations
which lead to a change in gene expression (Feil et al.,
1996, Proc Natl Acad Sci 93: 10887-90). In order to
enable the nucleic acids which can be used in
accordance with the invention to be introduced by means
of transfection, transformation or infection, and
thereby permit expression of the polypeptide in a
eukaryotic or prokaryotic cell, the nucleic acid can be
present as a plasmid, as part of a viral or nonviral
vector. Viral vectors which are particularly suitable
in this context are: baculoviruses, vaccinia viruses,
adenoviruses, adeno-associated viruses and
herpesviruses. Particularly suitable nonviral vectors
in this context are: virosomes, liposomes, cationic
lipids and polylysine-conjugated DNA.
Examples of vectors which are effective in gene therapy
are viral vectors, for example adenoviral vectors or
retroviral vectors (Lindemann et al., 1997, Mol. Med.
3: 466-76; Springer et al., 1998, Mol. Cell. 2: 549-
58). Eukaryotic expression vectors are suitable for use
in gene therapy in isolated form since, when applied
topically, naked DNA is able to penetrate into skin
cells (Hengge et al., 1996, J. Clin. Invest. 97: 2911-
6; Yu et al., 1999, J. Invest. Dermatol. 112: 370-5).
Vectors which are effective in gene therapy can also be
obtained by complexing the nucleic acid which is used
in accordance with the invention with liposomes since
it is possible, in this way, to achieve a very high
efficiency of transfection, particularly of skin cells
(Alexander and Akhurst, 1995, Hum. Mol. Genet. 4: 2279-
CA 02433041 2003-06-25
WO 02/053171 PCT/EPO1/15317
- 22
85). In lipofection, small unilamellar vesicles
composed of cationic lipids are prepared by
ultrasonicating the liposome suspension. The DNA is
bonded sonically on the surface of the liposomes in a
ratio which is such that a positive net charge remains
and the plasmid DNA is completely complexed by the
liposomes. In addition to the DOTMA (1,2-
dioleyloxypropyl-3-trimethylammonium bromide) and DPOE
(dioleoylphosphatidylethanolamine) lipid mixtures
employed by Felgner et al. (1987, see above), a large
number of new lipid formulations have by now been
synthesized and tested for their efficiency in
transfecting various cell lines (Behr, J.P. et al.
(1989), Proc. Natl. Acad. Sci. USA 86, 6982-6986;
Felgner, J.H. et al. (1994) J. Biol. Chem. 269, 2550
2561; Gao, X. & Huang, L. (1991), Biochim. Biophys.
Acta 1189, 195-203). Examples of the new lipid
formulations are DOTAP N-[1-(2,3-dioleoyloxy)propyl]
N,N,N-trimethylammonium ethyl sulfate and DOGS
(TRANSFECTAM; dioctadecylamidoglycylspermine).
Auxiliary substances which increase the transfer of
nucleic acids into the cell can, for example, be
proteins or peptides which are bonded to DNA or
synthetic peptide-DNA molecules which enable the
nucleic acid to be transported into the nucleus of the
cell (Schwartz et al. (1999) Gene Therapy 6, 282;
Branden et al. (1999) Nature Biotech. 17, 784).
Auxiliary substances also include molecules which
enable nucleic acids to be released into the cytoplasm
of the cell (Planck et al. (1994) J. Biol. Chem. 269,
12918; Kichler et al. (1997) Bioconj. Chem. 8, 213) or,
for example, liposomes (Uhlmann and Peymann (1990) see
above). Another, particularly suitable form of gene-
therapy vector can be obtained by applying the nucleic
acids which are used in accordance with the invention
to gold particles and shooting these particles into
tissues, preferably into the skin, or cells using what
CA 02433041 2003-06-25
WO 02/053171 PCT/EPO1/15317
- 23
is termed the gene gun (Wang et al., 1999, J. Invest.
Dermatol., 112: 775-81, Tuting et al., 1998, J. Invest.
Dermatol. 111: 183-8). When the skin is bombarded,
epidermal cells and keratinocytes, which constitute the
main constituent of the epidermis, are transfected
preferentially (Udvardi et al., 1999, J. Mol. Med.
77: 744-750; Lu and Goldsmith, 1996, Proc. Assoc. Am.
Physicians, 108: 165-172).
Another form of a vector which is effective in gene
therapy can be prepared by introducing 'naked'
expression vectors into a biocompatible matrix, for
example a collagen matrix. This matrix can be
introduced into skin in which keratinocyte activity is
disturbed, for example into a wound, in order to
transfect the immigrating cells with the expression
vector and to express the polypeptides which are used
in accordance with the invention in the cells
(Goldstein and Banadio, US 5,962,427).
It is also advantageous, for using the above-described
nucleic acid in gene therapy, if the part of the
nucleic acid which encodes the polypeptide contains one
or more noncoding sequences, including intron
sequences, preferably between the promoter and the
start codon of the polypeptide, and/or a polyA
sequence, in particular the naturally occurring polyA
sequence or an SV40 virus polyA sequence, especially at
the 3' end of the gene, since this makes it possible to
stabilize the mRNA (Jackson, R.J. (1993) Cell 74, 9-14
and Palmiter, R.D. et al. (1991) Proc. Natl. Acad. Sci.
USA 88, 478-482).
The present invention also relates to a host cell,
preferably a skin cell, in particular a keratinocyte,
which [lacuna] at least one vector andlor at least one
knock-out gene construct which includes a nucleic acid,
or variants thereof, which encodes a polypeptide, or
CA 02433041 2003-06-25
WO 02/053171 PCT/EPO1/15317
- 24
functional variants thereof, as depicted in SEQ ID No.
ID No. 3 or SEQ ID No. ID No. 4. The skilled person is
familiar with knock-out gene constructs, for example
from US patents US 5,625,122; US 5,698,765;
US 5,583,278 and US 5,750,825.
Host cells can be either prokaryotic or eukaryotic
cells; examples of prokaryotic host cells are E. coli,
and examples of eukaryotic cells are S. cerevis.iae and
insect cells.
The host cells according to the invention can be used
for diagnosing, preventing and/or treating diseases
which are connected with disturbed keratinocyte
activity, in particular wound healing disturbances
and/or psoriasis, or for identifying pharmacologically
active substances.
A further preferred transformed host cell is a
transgenic, embryonic nonhuman stem cell which contains
at least one nucleic acid, or variant thereof, which
encodes a polypeptide, or functional variant thereof,
as depicted in SEQ ID No. ID No. 3 or SEQ ID No. ID No.
4. In a preferred embodiment, the above nucleic acid is
contained in a knock-out gene construct or an
expression cassette or an above-described stem cell.
Methods for transforming. Transfecting or infecting
host cells and/or stem cells are well known to the
skilled person and include, for example,
electroporation and microinjection.
The invention also relates to a transgenic, nonhuman
mammal which contains at least one above-described
knock-out gene construct or an above-described
expression cassette, preferably integrated into the
genome. In general, transgenic animals exhibit an
expression of the nucleic acids and/or polypeptides
which is elevated in a tissue-specific manner and can
CA 02433041 2003-06-25
WO 02/053171 PCT/EPO1/15317
- 25
be used for analyzing and/or diagnosing diseases which
are connected with disturbed keratinocyte activity, in
particular wound healing disturbances and/or psoriasis.
Thus, for example, an activin A-transgenic mouse
exhibits improved wound healing (Munz et al., 1999,
EMBO J. 18: 5205-15) whereas a transgenic mouse
containing a dominantly negative KGF receptor exhibits
delayed wound healing (Werner et al., 1994, Science
266: 819-22).
Methods for preparing transgenic animals, in particular
the mouse, are likewise known to the skilled person
from DE 196 25 049 and the patents US 4,736,866;
US 5,625,122; US 5,698,765; US 5,583,278 and
US 5,750,825 and involve transgenic animals which can
be generated, for example, by directly injecting
expression vectors (see above) into embryos or
spermatocytes, by transfecting expression vectors into
embryonic stem cells (Politer and Pinkert: DNA
Microinjection and Transgenic Animal Production, pages
15 to 68 in Pinkert, 1994: Transgenic animal
technology: a laboratory handbook, Academic Press,
London, UK; Houdebine, 1997, Harwood Academic
Publishers, Amsterdam, The Netherlands;
Doetschman: Gene Transfer in Embryonic Stem Cells,
pages 115 to 146 in Pinkert, 1994, see above;
Wood: Rebrovirus-Mediated Gene Transfer, pages 147 to
176 in Pinkert, 1994, see above; Monastersky: Gene
Transfer Technology: Alternative Techniques and
Applications, pages 177 to 220 in Pinkert, 1994, see
above) or by isolating cell nuclei from differentiated
somatic cells, for example fibroblasts, and then
transferring them into denucleated oocytes (McCreath et
al., 2000, Nature 405: 1004-5). Thus, known knock-out
mouse models, such as the eNOS (Lee et al., 1999, Am.
J. Physiol. 277: H1600-H1608), Nf-1 (Atit et al., 1999,
J. Invest. Dermatol. 112: 835-42) and osteopontin (Liaw
CA 02433041 2003-06-25
WO 02/053171 PCT/EPO1/15317
- 26
et al., 1998, J. Clin. Invest. 101: 967-71) knock-out
mice, exhibit impaired wound healing.
In the same way, nucleic acids which can be used in
accordance with the invention can [lacuna] integrated
into what are termed targeting vectors (Pinkert, 1994,
see above) [lacuna] it is possible, after transfecting
embryonic stem cells and homologous recombination, to
generate, for example, knock-out mice which in general,
as heterozygous mice, exhibit a decreased expression of
nucleic acid whereas homozygous mice no longer exhibit
any expression of the nucleic acid. Tissue-specific
reduction in the expression of genes which are used in
accordance with the invention, for example in skin-
specific cells, in particular in keratinocytes using
the Cre-loxP system (stat3 knock-out, Sano et al.,
EMBO J 1999 18: 4657-68), is particularly to be
preferred in this connection. The transgenic and knock-
out cells or animals which are generated in this way
can be used, for example, for analyzing diseases which
are connected with disturbed keratinocyte activity, for
example a wound. However, they can also be used for
screening and identifying pharmacologically active
substances or vectors which are active in gene therapy.
The invention also relates to a process for preparing a
polypeptide for diagnosing and/or preventing and/or
treating diseases which are connected with disturbed
keratinocyte activity, in particular wound healing
disturbances and/or psoriasis, or for identifying
pharmacologically active substances in a suitable host
cell, which process is characterized in that an above-
described nucleic acid is used.
The polypeptide is prepared, for example, by using
methods which are well known to the skilled person to
express the above-described nucleic acid in a suitable
expression system, as already explained above. Examples
CA 02433041 2003-06-25
WO 02/053171 PCT/EPO1/15317
- 27
of suitable host cells are the E. coli strains DHS,
HB101 or BL21, the yeast strain S. cerevisiae, the
insect cell line lepidopteran, e.g. from Spodoptera
frugiperda, or the animal cells COS, Vero, 293, HaCaT
and HeLa, all of which are available generally.
The invention also relates to a process for preparing a
fusion protein for diagnosing and/or preventing and/or
treating diseases which are connected with disturbed
keratinocyte activity or for identifying
pharmacologically active substances in a suitable host
cell, which process uses an above-described nucleic
acid.
In another embodiment of the invention, a functional
variant of the polypeptides which can be used in
accordance with the invention is a fusion protein, i.e.
fusion proteins containing at least one polypeptide as
depicted in SEQ ID No. 3 or SEQ ID No. 4 or a
functional variant thereof. These fusion proteins can
be used for diagnosing, preventing and/or treating
diseases which are connected with disturbed
keratinocyte activity, in particular wound healing
disturbances and/or psoriasis, or for identifying
pharmacologically active substances.
Fusion proteins are prepared in this connection which
contain the above-described polypeptides, with the
fusion proteins either themselves already exhibiting
the function of an above-described polypeptide or only
being functionally active the specific function after
the fusion moiety has been eliminated. In particular,
these fusion proteins include fusion proteins which
contain a moiety of approx. 1-300, preferably approx.
1-200, particularly preferably approx. 1-150, in
particular approx. 1-100, especially approx. 1-50,
foreign amino acids. Examples of such peptide sequences
are prokaryotic peptide sequences which can be derived,
CA 02433041 2003-06-25
WO 02/053171 PCT/EPO1/15317
- 28
for example, from E. coli galactosidase. In addition,
it is also possible to use viral peptide sequences, for
example from the bacteriophage M13, in order, in this
way, to generate fusion proteins for the phage-display
method, with which the skilled person is familiar.
Other preferred examples of peptide sequences for
fusion proteins are peptides which facilitate detection
of the fusion protein; these include, for example,
green fluorescent protein or variants thereof.
In order to purify the above-described proteins, it is
possible to attach an additional polypeptide (tag).
Suitable protein tags make it possible, for example, to
achieve high-affinity absorption to a matrix, stringent
washing with suitable buffers, without the complex
being eluted to any significant degree, and subsequent
selective elution of the absorbed complex. Examples of
protein tags which are known to the skilled person are
the (His)6 tag, the Myc tag, the FLAG tag, the
hemagluteinin tag, the glutathione transferase (GST)
tag, intein containing an affinity chintin-binding tag
or the maltose-binding protein (MBP) tag. These protein
tags can be located N-terminally, C-terminally and/or
within the protein.
The invention also relates to a process for preparing
an antibody, preferably a polyclonal or monoclonal
antibody, for diagnosing, preventing and/or treating
diseases which are connected with disturbed
keratinocyte activity, in particular wound healing
disturbances and/or psoriasis, or for identifying
pharmacologically active substances, in which process a
polypeptide, or functional equivalents thereof, or
parts thereof containing at least 6 amino acids,
preferably containing at least 8 amino acids, in
particular containing at least 12 amino acids, is/are
used in accordance with the present invention.
CA 02433041 2003-06-25
WO 02/053171 PCT/EPO1/15317
- 29
The process is effected, using methods which are well
known to the skilled person, by immunizing a mammal,
for example a rabbit, with the above-described
polypeptide, or the said parts thereof, where
appropriate in the presence of, e.g., Freund's adjuvant
and/or aluminum hydroxide gels (see, e.g., Diamond,
B.A. et al (1981) The New England Journal of Medicine,
1344-1349). The polyclonal antibodies which are formed
in the animal as a result of an immunological reaction
can then be readily isolated from the blood, and
purified, for example by means of column
chromatography, using well known methods. Monoclonal
antibodies can be prepared, for example, using the
known method of Winter & Milstein (Winter, G. &
Milstein, C. (1991) Nature, 349, 293-299).
The present invention also relates to an antibody for
analyzing, diagnosing, preventing and/or treating
diseases which are connected with disturbed
keratinocyte activity, in particular wound healing
disturbances and/or psoriasis, or for identifying
pharmacologically active substances which are directed
against an above-described polypeptide, or functional
variants thereof, and react specifically with the
above-described polypeptides, with the abovementioned
parts of the polypeptide either themselves being
immunogenic or being able to be made immunogenic, or to
have their immunogenicity increased, by being coupled
to suitable carriers, such as bovine serum albumin.
This antibody is either polyclonal or monoclonal; it is
preferably a monoclonal antibody. According to the
present invention, the term antibody is also understood
as meaning recombinantly prepared and optionally
modified antibodies or antigen-binding parts thereof,
such as chimeric antibodies, humanized antibodies,
multifunctional antibodies, bispecific antibodies,
oligospecific antibodies, single-stranded antibodies,
Flab) fragments or F(ab)2 fragments (see, e.g.,
CA 02433041 2003-06-25
WO 02/053171 PCT/EPO1/15317
- 30
EP-Bl-0 368 684, US 4,816,567, US 4,816 397,
WO 88/01649, WO 93/06213, WO 98/24884).
The invention also relates to the use of an antibody
which is directed against a polypeptide, or functional
variants thereof, as depicted in SEQ ID No. ID No. 3 or
SEQ ID No. ID No. 4 for diagnosing and/or preventing
and/or treating diseases which are connected with
disturbed keratinocyte activity, in particular wound
healing disturbances and/or psoriasis, particularly
preferably psoriasis.
Thus, the local injection of monoclonal antibodies
directed against TGF-(31 can improve wound healing in an
animal model (Ernst et al., 1996, Gut 39: 172-5).
The invention also relates to the use of modulators of
the activity of a polypeptide, or functional variants
thereof, as depicted in SEQ ID No. 3 or SEQ ID No. 4,
preferably of a polypeptide as depicted in SEQ ID No. 3
or SEQ ID No. 4, for diagnosing and/or preventing
and/or treating diseases which are connected with
disturbed keratinocyte activity.
Within the meaning of the invention, the term
'modulator' encompasses chemical substances, compounds,
compositions and mixtures which exert an influence on
the the activity of the ion channel IK according to the
invention in that the modulator either opens it
(=activates) or closes it (=inhibits). Furthermore, the
modulator can modulate the kinetics of the channel
activity. A modulator can be an inhibitor which
inhibits the activity of the ion channel or an
activator which activates the activity of the ion
channel.
In addition, the term "modulatoR " also encompasses
compounds, compositions and mixtures which modulate the
CA 02433041 2003-06-25
WO 02/053171 PCT/EPO1/15317
- 31
expression of the polypeptides as depicted in SEQ I~
No. 3 or SEQ ID No. 4 or functional variants thereof.
The modulation can take place, for example, at the
transcriptional or translational level. Substances
which increase the quantity of the polypeptides which
can be used in accordance with the invention are
activators whereas substances which reduce the quantity
of the polypeptides which can be used in accordance
with the invention are inhibitors.
Methods for determining channel activity are known to
the skilled person from the literature. For example, IK
channels have been expressed in oocytes by means of in-
vitro transcription and injection, and the ion channel
activity has been measured using the patch-clamp method
(WO 98/11139; Gerlach et al., 2000, J. Biol. Chem.,
275: 585-598; Khanna et al., 1999, J. Biol. Chem.,
274: 14838-14849). Furthermore, IK channels can be
expressed in human cell lines and analyzed using the
patch-clamp method (WO 00/37422; WO 99/25347). It is
also possible to investigate cells possessing
endogenously expressed IK channels in this way (Gerlach
et al., 2000, J. Biol. Chem., 275: 585-598). IK
channels which are expressed endogenously, or by means
of transfection, in skin cells, for example
keratinocytes, can be used in an analogous manner.
Examples of other methods which are suitable for
identifying modulators of channels are radioactive Ru+
flux test systems and fluorescence test systems using
voltage-dependent dyes (Vestergaard-Bogind et al.,
1988, J. Membr. Biol. 88: 67-75; Daniel et al., 1991,
J. Pharmacol. Meth. 25: 185-193; Holevinsky et al.
1994, J. Membr. Biol. 137: 59-70). For example, it is
possible to use an FLIPR (fluorescence image plate
reader) test system (WO 99/25347). Test systems for
testing the inhibitory or activating effect of a
substance on the potassium flow through an IK channel
can be implemented by adding the substances to a
CA 02433041 2003-06-25
WO 02/053171 PCT/EPO1/15317
- 32
solution which is in contact with IK channel-expressing
cells (e. g. Blatz et al., 1986, Nature, 323: 718-720;
Park, 1994, J. Physiol., 481: 555-570).
In general, the activity of a channel can be determined
by measuring the electric current or the ion flow or
the secondary effects of the electric current or of the
ion flow. Modulators of the activity of the ion channel
alter the electric current or the ion flow. In this
way, it is possible to study the modulatory properties
of substances which are to be tested.
Changes in the cation flow through the channel can be
detected, for example, either directly by determining
the changes in the concentrations of the ions or
indirectly by measuring the membrane potential by means
of radioactively labeling the ions. If the influence of
the modulators on intact cells or organisms is being
detected, it is possible to measure a very wide variety
of secondary physiological effects. Possible effects
are transcriptional changes, changes in cell volume,
changes in the metabolism of the cell, the release of
hormones, etc. (WO 98/11139). WO 99/25347 discloses
methods for screening a chemical substance for a
modulatory effect on an IK channel.
None of the known modulators of the polypeptides as
depicted in SEQ ID No. 3 or SEQ ID No. 4 has previously
been reported to have a connection with diseases which
are connected with disturbed keratinocyte activity, in
particular wound healing disturbances and/or psoriasis,
for example in association with disturbed wound
healing, nor has such a connection been suggested. It
was therefore unexpected that these compounds can be
used in accordance with the invention.
In another embodiment of the invention, the modulator
is an inhibitor.
CA 02433041 2003-06-25
WO 02/053171 PCT/EPO1/15317
- 33
According to the invention, it is possible, for the
purpose of modulating the IK channels, to use at least
one antibody which is directed against a polypeptide,
or functional variant thereof, as depicted in SEQ ID
No. ID No. 3 or SEQ ID No. ID No. 4. In this
connection, the antibodies can have an inhibitory
effect or an activating effect on the activity of the
polypeptide which can be used in accordance with the
invention.
Inhibitors of IK channel activity have been disclosed,
for example, in WO 99/25347. For example, it is
possible to use a symmetric or asymmetric derivative of
1,4-dihydropyridine-3,5-dicarboxylic acid in accordance
with the general formula (I):
H
RZ ~ Ra
R400C HXR 'COORS
or a pharmaceutically tolerated salt, an oxide or a
hydrate thereof;
where
R is an alkyl group or cycloalkyl group which is
optionally substituted by halogen, preferably by F or
Cl;
or R is a monocyclic or polycyclic aryl group, where
the aryl group can be substituted, once or more than
once, by a substituent selected from halogen, in
particular F or Cl, trifluoromethyl (-CF3), vitro
(-NOz) , cyano (-CN) , azido (-N3) , a group of the formula
-S(O)n-alkyl, -S(O)n-NH-alkyl or -S(O)n-N-(alkyl)z,
where n can preferably be 0, 1 or 2, an alkyl group, a
cycloalkyl group, an alkoxy group, a trifluoromethyloxy
CA 02433041 2003-06-25
WO 02/053171 PCT/EPO1/15317
- 34
group (-OCF3) , a carboxyl group (-COOH) , a group of the
formula -C00-alkyl, a carbamoyl group (-CONH2), and a
group of the formula -CONH-alkyl or CON(alkyl)2;
or R is a monoheterocyclic or polyheterocyclic group,
where the heterocyclic group can be substituted, once
or more than once, by an alkyl group, an alkoxy group,
a carboxyl group (-COOH), a group of the formula -C00
alkyl, and/or a group of the formula -C00-phenyl, with
preferred heteroatoms being N, S and 0;
and R1, R2, R3 and R4 are, independently of each other,
hydrogen, an alkyl group, a cycloalkyl group, an
alkenyl group, an alkynyl group, an alkoxy group, a
phenyl group, a phenylalkyl group, a furanyl group, a
furanylalkyl group, a pyridyl group or a pyridylalkyl
group which is optionally substituted by halogen,
preferably by F or CL.
A preferred embodiment is that of using an inhibitor of
the general formula ( I ) in which R is a C3_~ cycloalkyl
group, in particular a cyclohexyl group; or a phenyl
group, preferably a monosubstituted phenyl group, where
the phenyl group [lacuna] once or more than once by a
substituent selected from the group consisting of
halogen, trifluoromethyl (-CF3), vitro (-NOz) and cyano
(-CN);
or R is a pyridyl group or a dihydropyridyl group,
where this group can be monosubstituted by a group of
the formula -COO-alkyl or a group of the formula -C00-
phenyl.
In another preferred embodiment, it is possible to use
an inhibitor according to the general formula (I) where
R is a 2-nitrophenyl group, a 3-nitrophenyl group, a
4-nitrophenyl group, a 2-trifluoromethylphenyl group, a
3-trifluoromethylphenyl group, a 4-trifluoroethylphenyl
CA 02433041 2003-06-25
WO 02/053171 PCT/EPO1/15317
- 35
group, a 2-cyanophenyl group, a 3-cyanophenyl group or
a 4-cyanophenyl group;
or R is a 2-pyridyl, 4-pyridyl, 3-pyridyl, a 1,2- or
1, 4- or 1, 6-dihydro-2-pyridyl group, a l, 2- or 1, 4- or
1,6-dihydro-3-pyridyl group or a 1,2- or 1,4- or 1,6
dihydro-4-pyridyl group, where the pyridyl or
dihydropyridyl groups can be monosubstituted by C1-6
alkyl, a group of the formula -COO-C1_6-alkyl or a group
of the formula -C00-phenyl.
In another preferred embodiment, use is made of a
modulator of the general formula ( I ) where R1, R2, R3,
and R4 are, independently of each other, C1_6-alkyl,
preferably methyl, ethyl, propyl, isopropyl, butyl or
isobutyl.
A preferred embodiment is that of using an inhibitor of
the general formula (I) where the inhibitor is an
asymmetric derivative of 1,4-dihydropyridine-3,5
dicarboxylic acid in accordance with general formula
(I). Preference is given to asymmetric derivatives
which are asymmetric C1_6-alkyl derivatives of 1,4
dihydropyridine-3,5-dicarboxylic acid (I). For example,
it is possible to use the following substances:
ethylmethyl 1,4-dihydro-2,6-dimethyl-4-(2-nitrophenyl)-
pyridine-3,5-dicarboxylate;
propylmethyl 1,4-dihydro-2,6-dimethyl-4-(2-nitro-
phenyl)-pyridine-3,5-dicarboxylate;
ethylmethyl 1,4-dihydro-2,6-dimethyl-4-(3-nitrophenyl)-
pyridine-3,5-dicarboxylate.
Another preferred embodiment is that of using a
symmetric derivative of 1,4-dihydropyridine-3,5-
dicarboxylic acid depicted by the general formula (I).
CA 02433041 2003-06-25
WO 02/053171 PCT/EPO1/15317
- 36
Preferred compounds contain symmetric C1_6-alkyl
derivatives of 1,4-dihydropyridine-3,5-dicarboxylic
acid. For example, it is possible to use the following
substances in accordance with the invention:
dimethyl 1,4-dihydro-2,6-dimethyl-4-(2-nitrophenyl)-
pyridine-3,5-dicarboxylate (nifedipine);
diethyl 1,4-dihydro-2,6-dimethyl-4-(2-nitrophenyl)-
pyridine-3,5-dicarboxylate.
In another embodiment, it is possible to use, in
accordance with the invention, inhibitors which are
derivatives or metabolites of clotrimazole in
accordance with the general formula (II) (see also
WO 99/25347)
5
cm
R$ R6
R'
or a pharmaceutically tolerated salt, an oxide or a
hydrate thereof;
where
X is halogen, in particular F or C1, a trifluoromethyl
group, a nitro group or a cyano group;
RS is hydrogen, halogen, in particular F or C1,
hydroxyl, an alkyl group, a cycloalkyl group, an alkoxy
group or an alkyloxy group, where appropriate
substituted by halogen, preferably F or Cl;
CA 02433041 2003-06-25
WO 02/053171 PCT/EPO1/15317
- 37
R6 is hydrogen or a phenyl group, where the phenyl
group can be substituted, once or more than once, by
substituents selected from halogen, preferably F or C1,
and hydroxyl;
R' is hydrogen, halogen, preferably F or C1, hydroxyl,
alkyl or alkoxy, where appropriate substituted by
halogen, preferably F or Cl;
R$ is a group of the formula -Y-CH2-R9, where Y is
oxygen (-0-) or sulfur (-S-); a group of the formula
=NO-CHZ-R9; a group of the formula -0-phenyl-CH=CH2; a
group of the formula -CH2-CH(CH3)-S-phenyl, where the
phenyl group can be substituted, once or more than
once, by substituents selected from halogen, preferably
F or C1, and hydroxyl; or a phenyl group, where the
phenyl group can be substituted, once or more than
once, by substituents selected from halogen, preferably
F or C1, and hydroxyl; and where R9 is an ethenyl group
(CHZ=CH-); a phenyl group, where the phenyl group can
be substituted, once or more than once, by substituents
selected from halogen, preferably F or Cl, and hydroxyl
group; a phenyl-S-phenyl group; a group of the formula
CHZ-0-phenyl, where the phenyl group can be
substituted, once or more than once, by substituents
selected from halogen, preferably F or C1, and hydroxyl
group; or a group of the general formula (VII),
~~ Ft~o (VIn
z
where Z is S, O or N;
and R1° is hydrogen or halogen, preferably F or C1, or
hydroxyl group.
Preference is given to using the following derivatives
and metabolites:
CA 02433041 2003-06-25
WO 02/053171 PCT/EPO1/15317
- 38
2-chlorophenyl-4-hydroxyphenylphenylmethane; 2-chloro-
phenylbisphenylmethane; 2-chlorophenylbisphenylmeth-
anol; 3-(1-[2,4-dichlorophenyl]ethoxymethyl)-2-chloro-
thiophene; 0-(2,4-dichlorobenzyl)-2,4-dichloroaceto-
phenoneoxime; 1-(2,4-dichloro)-1-(4-(phenylthio)benzyl-
oxy)ethane; 1-(2,4-dichlorophenyl)-1-1-(allyloxy)-
ethane; 1-(2,4-dichlorophenyl)-1-(4-chlorobenzylthio)-
ethane; 1-(2,4-dichlorophenyl)-1-(2,4-dichlorobenzyl-
oxy)ethane; 1-(2,4-dichlorophenyl)ethyl-2,6-dichloro-
benzyl ether; 1-(2-[4-chlorophenoxy]ethyloxy)-1-(2,4-
dichlorophenyl)propene; 1-(2,4-dichlorophenyl)ethyl-(4-
chlorophenyl)methyl ether; 3-chlorobenzyl-2-vinylphenyl
ether and 1-(4-chlorophenyl)-3-(2,6-
dichlorophenylthio)butane.
The document WO 99/25347 discloses other substances
which act as inhibitors of hIKl and can be used in
accordance with the invention. Examples are the
imidazole derivatives miconazole, econazole,
butoconazole, oxiconazole, sulconazole and
thioconazole, the triazole derivatives fluconazole,
terconazole and itraconazole, the nitroimidazole
derivatives metronidazole, tinidazole, nimorazole,
ornidazole and benznidazole.
Other suitable modulators which can be used in
accordance with the invention are oxime derivatives in
accordance with the general formula (III) (see
WO 00/34228):
Y R13 11
R1
ENO Riz
R1
or a pharmaceutically tolerated salt, an oxide or a
hydrate thereof;
CA 02433041 2003-06-25
WO 02/053171 PCT/EPO1/15317
- 39
where
Y is oxygen, sulfur or an amino group, preferably an
amino group of the formula NHRls;
R11 is hydrogen; an alkyl group; a cycloalkyl group; a
hydroxyl group; an alkoxy group; an acyl group; a
phenyl group or a benzyl group, where the group, in
particular the phenyl group or benzyl group, can be
substituted, once or more than once, by substituents
selected from halogen, in particular F or C1, -CF3,
-N02, -CN, alkyl group, cycloalkyl group, hydroxyl
group and alkoxy group; a group of the formula CHZCN; a
group of the formula CH2C02R', where R' is hydrogen or
an alkyl group; a group of the formula CH2CONRI°R",
where RI" and R" are, independently of each other,
hydrogen or an alkyl group, where appropriate
substituted by halogen; or a group of the formula
-CH2C (=NOH) NH2;
R12 is hydrogen; an alkyl group; a cycloalkyl group; a
phenyl group or a benzyl group, where the group, in
particular the phenyl group or benzyl group, can be
substituted, once or more than once, by substituents
selected from halogen, in particular F or C1, -CF3,
-NO2, -CN, alkyl group, cycloalkyl group, hydroxyl
group and alkoxy group;
R13 is hydrogen; an alkyl group; a cycloalkyl group; a
phenyl group or a benzyl group, where the group, in
particular the phenyl group or benzyl group, can be
substituted, once or more than once, by substituents
selected from halogen, in particular F or Cl, -CF3,
-N02, -CN, alkyl group, cycloalkyl group, hydroxyl
group and alkoxy group; and
R14 and R15 are, independently of each other, hydrogen;
halogen, in particular F or C1; -CF3; -NO2; -CN; an
CA 02433041 2003-06-25
WO 02/053171 PCT/EPO1/15317
- 40
alkyl group, an alkoxy group; a phenyl group or a
benzyl group, where the group, in particular the phenyl
group or benzyl group, can be substituted, once or more
than once, by substituents selected from halogen, in
particular F or C1, -CF3, -NO2, -CN, alkyl, cycloalkyl,
hydroxyl and alkoxy; or are a group of the formula -
S02NR" R" ' , where R" and R" ' are, independently of
each other, hydrogen or an alkyl group;
or R14 and R15 together form an additional 4-membered to
7-membered fused ring, where the fused ring can be
aromatic or partially saturated and can be substituted,
once or more than once, by substituents selected from
halogen, in particular F or C1, -CF3, -NO2, -CN and a
group of the formula -SOZNR" R" ' , where R" and R" '
are, independently of each other, hydrogen or an alkyl
group.
-In a preferred embodiment of the modulator which can
be used in accordance with the invention, R11 is
hydrogen or an alkyl group. In another preferred
embodiment, R12 is hydrogen, an alkyl group or a benzyl
group or phenyl group, where the where the phenyl group
or benzyl group can be substituted, once or more than
once, by substituents selected from halogen, -CF3, -N02,
-CN, alkyl, cycloalkyl, hydroxyl and alkoxy.
In another preferred embodiment, Y is oxygen or an
amino group of the formula NHR13, where R13 here is
hydrogen, alkyl, benzyl or acetyl.
In another preferred embodiment, R14 and R15 are,
independently of each other, hydrogen, halogen, alkyl
or alkoxy.
In another preferred embodiment, R19 and R15 together
form an additional 6-membered fused ring, where the
fused ring can be aromatic or partially saturated,
CA 02433041 2003-06-25
WO 02/053171 PCT/EPO1/15317
- 41
where the fused ring can be substituted, once or more
than once, by substituents selected from halogen, in
particular F or Cl, -CF3, -NOz, -CN and a group of the
formula -S02NR" R" ' , where R" and R" ' are,
independently of each other, hydrogen or an alkyl
group.
In a particularly preferred embodiment, it is possible
to use the following oxime derivatives as modulators in
accordance with the invention:
2-aldoximo-1-naphthol; 2-aldoximo-5,6-dimethylphenol;
2-aldoximo-5,6-dichlorophenol; O-benzyl-2-formyl-5,6-
dichlorophenoloxime; O-methyl-2-formyl-5,6-dichloro-
phenoloxime; 2-aldoximo-5,6,7-8-tetrahydro-1-naphthol;
1-hydroxy-2-acetonaphthoneoxime; 1-methoxy-2-aceto-
naphthoneoxime; O-ethyl-1-methoxy-2-acetonaphthone-
oxime; 1-ethoxy-2-acetonaphthoneoxime; 1-benzyloxy-2-
acetonaphthoneoxime; 2-hydroxy-3,4-dimethylaceto-
phenoneoxime; 2-methoxy-3,4-dimethylacetophenoneoxime;
2-hydroxy-3,4-dimethoxyacetophenoneoxime; 2,3,4-tri
methoxyacetophenoneoxime; 1-hydroxy-5,6,7,8-tetrahydro
2-acetonaphthoneoxime; 1-methoxy-5,6,7,8-tetrahydro-2
acetonaphthoneoxime; 1-(2-propyloxy)-2-acetonaphthone
oxime; N-(2-acetylphenyl)acetamideoxime.
In another embodiment, it is possible to use chemical
compounds in accordance with the general formula (IV)
(see WO 00134248)
t~
R~s
CA 02433041 2003-06-25
WO 02/053171 PCT/EPO1/15317
- 42
or a pharmaceutically tolerated salt, an oxide or a
hydrate thereof, as modulators in accordance with the
invention;
where
A is oxygen, sulfur or nitrogen;
R16 is hydrogen; an alkyl group; a cycloalkyl group; a
hydroxyl group; an alkoxy group; an acyl group; a
phenyl group or a benzyl group, where the group, in
particular the phenyl group or benzyl group, can be
substituted, once or more than once, by substituents
selected from halogen, in particular F or C1, -CF3,
-N02, -CN, alkyl, cycloalkyl, hydroxyl and alkoxy; a
group of the formula CH2CN; a group of the formula
CHzC02R', where R' is hydrogen or an alkyl group; a
group of the formula CH2CONRI"R°, where RI" and R° are,
independently of each other, hydrogen or an alkyl
group; or a group of the formula -CHzC(=NOH)NH2;
R1' is hydrogen; an alkyl group; a cycloalkyl group; a
phenyl group or a benzyl group, where the group, in
particular the phenyl group or benzyl group, can be
substituted, once or more than once, by substituents
selected from halogen, in particular F or Cl, -CF3,
-NO2, -CN, alkyl, cycloalkyl, hydroxyl and alkoxy;
Rla, R19 and R2° are, independently of each other,
hydrogen; halogen, in particular F or Cl; -CF3; -NO2;
-CN; an alkyl group; an alkoxy group; a phenyl group or
a benzyl group, where the group, in particular the
phenyl group or benzyl group, can be substituted, once
or more than once, by substituents selected from
halogen, in particular F or C1, -CF3, -N02, -CN, alkyl,
cycloalkyl, hydroxyl and alkoxy; or a group of the
formula -SOZNR" R" ' , where R" and R" ' are,
independently of each other, hydrogen or an alkyl
CA 02433041 2003-06-25
WO 02/053171 PCT/EPO1/15317
- 43
group, where appropriate substituted, preferably by F
or Cl;
or R2° is defined as above and R1$ and R19 together form
an additional 4-membered to 7-membered fused ring,
where the fused ring can be heterocyclic, where the
hetero atoms are preferably N, S or 0, can be aromatic,
saturated or partially saturated, and optionally
[lacuna] by substituents selected from halogen, in
particular F or Cl, -CF3, -N02, -CN and a group of the
formula -S02NR" R" ' , where R" and R" ' are,
independently of each other, hydrogen or an alkyl
group.
In a preferred embodiment, R16 is hydrogen or an alkyl
group. In another preferred embodiment, R1' is hydrogen
or an alkyl group. In another preferred embodiment, R19,
RZ° and R1$ are, independently of each other, hydrogen
or an alkyl group.
Particular preference is given to the use, according to
the invention, of 1-ethyl-4,5-dichlorobenzimidazolone,
1,3-diethyl-4,5-dichlorobenzimidazolone, 3-ethyl-5-
chlorobenzoxazolone and the activators 1-ethyl-2-
benzimidazolinone (1-EBIO), 1-ethyl-4,5-dichloro-2
benzimidazolinone (Boehringer et al., 2000 J. Med.
Chem., 43: 2664), 5,6-dichloro-1-ethyl-1,3-dihydro-2H
benzimidazol-2-one (DCEBIO; Singh et al., 2001, J
Pharmacol Exp Ther; 296: 600-11) and chlorzoxazone
(Syme et al., 2000, Am. J. Physiol. 278: C570-C581).
In another preferred embodiment, use is made of a
modulator in accordance with formula (IV) in which R18
and R19 together form a 5-membered or 6-membered fused
ring, where the ring can be heterocyclic; in addition,
the ring can be aromatic, saturated or partially
saturated and the ring can be optionally substituted,
once or more than once, by substituents selected from
CA 02433041 2003-06-25
WO 02/053171 PCT/EPO1/15317
- 44
the group consisting of halogen, in particular F or C1,
-CF3, -N02, -CN and a group of the formula -SO2NR' ' R' ' ' ,
where R " and R " ' are, independently of each other,
hydrogen or an alkyl group, where appropriate
substituted, in particular by F or C1.
Particular preference is given to the use of 1,3-
diethyl-5,6,7,8-tetrahydronaphtho[1,2-d]imidazolinone,
1-ethyl-5,6,7,8-tetrahydronaphtho[1,2-d]imidazolinone;
3-ethylnaphtho[1,2-d]oxazolinone; 3-ethylnaphtho[1,2-
d]imidazolinone; 3-ethylquinolino[5,6-d]imidazolinone
and 3-benzyl-(2,1,3-thiadiazolo)-[4,5-g]benzimid-
azolone.
Furthermore, a chemical compound in accordance with the
general formula (V) (see WO 00/37422):
23
R2~- C-Rzz
R24
or a pharmaceutically tolerated salt, an oxide or a
hydrate thereof, can be used as a modulator in
accordance with the invention;
where
B and C, independently of each other, are a group of
the formula - (CHZ) n-, of the formula - (CHZ) n-Y' - (in one
of the two directions) or of the formula -(CHZ)n-Y'-
(CHZ)m-, where, in this formula, n and m are,
independently of each other, 0, l, 2, 3 or 4, Y' is 0,
S or NR " ', where R " ' is hydrogen or an alkyl group;
R21 and Rz2 are, independently of each other, alkyl,
alkenyl, alkynyl, cycloalkyl, amino, trihalomethyl, in
particular trifluoromethyl or trichloromethyl, nitro,
CA 02433041 2003-06-25
WO 02/053171 PCT/EPO1/15317
- 45
cyano, phenyl or a group of the formula OR', -SR',
-R'OR", -R'SR", -C(0)R', -C(S)R', -C(0)OR', -C(S)OR',
-C(O)SR', -C(S)SR', -C(O)NR' (OR"), -C(S)NR' (OR"),
-C ( O ) NR' ( SR" ) , -C ( S ) NR' ( SR" ) , -CH ( CN ) 2, -C ( S ) NR' R" ,
-C(0)NR'R", -CH [C(0)R']2, -CH [C(S)R'J2, -CH [C(O)OR']2,
-CH [C (S) OR' ] 2, -CH [C (O) SR' ] 2, -CH [C (S) SR' ] z, CHzOR' ,
CH2SR', -NR'C(0)R", or OC(O)R';
or is an unsaturated, partially saturated or saturated
monocyclic or polycyclic group, an aralkyl group or
heteroalkyl group, where the monocyclic or polycyclic
groups, aralkyl groups or heteroalkyl groups can be
substituted, once or more than once, by a group
consisting of halogen, in particular F or C1,
trihalomethyl, in particular trifluoromethyl or
trichloromethyl, alkyl, alkenyl, alkynyl, amino, vitro,
cyano or amido, or a group of the formula -R', -OR',
SR', -R'OR", -R'SR", -C(0)R', -C(S)R', -C(0)OR',
-C ( S ) OR' , -C ( 0 ) SR' or -C ( S ) SR' , or a phenyl group or
phenoxy group, where the group, in particular the
phenyl group or phenoxy group, can be substituted, once
or more than once, by a group consisting of halogen, in
particular F or C1, trihalomethyl, in particular
trifluoromethyl or trichloromethyl, alkyl, alkenyl,
alkynyl, amino, vitro, cyano or amido, or a group of
the formula -R' , -OR' , SR' , -R' OR' ' , -R' SR' ' , -C (0) R' ,
-C(S)R', -C(O)OR', -C(S)OR', -C(0)SR', -C(S)SR',
-NR'C(0)R" or OC(0)R';
where
R' and R" are, independently of each other, hydrogen,
alkyl, alkenyl, alkynyl, cycloalkyl, alkoxy or phenyl,
where appropriate substituted, in particular by F or
C1, or a group of the formula NR" ' R" " , where R" '
and R" " , independently of each other, are hydrogen or
alkyl;
CA 02433041 2003-06-25
WO 02/053171 PCT/EPO1/15317
- 46
R23 and R24 are, independently of each other, alkyl,
alkenyl, alkynyl, cycloalkyl, amino, trihalomethyl, in
particular trifluoromethyl or trichloromethyl, vitro,
cyano, phenyl or a group of the formula OR', -SR',
-R'OR", -R'SR", -C(O)R', -C(S)R', -C(0)OR', -C(S)OR',
-C ( O ) SR' , -C ( S ) SR' , -C ( 0 ) NR' ( OR" ) , -C ( S ) NR' ( OR" ) ,
-C (0) NR' (SR" ) , -C (S) NR' (SR" ) , -CH (CN) 2, -C (S) NR' R" ,
-C(0)NR'R", -CH [C(0)R']z, -CH[C(S)R']2, -CH [C(0)OR']2,
-CH [C (S) OR' ] 2, -CH [C (0) SR' ] Z, -CH [C (S) SR' ] Z, CHZOR' ,
CH2SR', -NR'C(0)R", or OC(O)R';
where
R' and R " are, independently of each other, hydrogen,
alkyl, alkenyl, alkynyl, cycloalkyl, alkoxy, phenyl or
a group of the formula NR" ' R" " , where R" ' and R" "
are, independently of each other, hydrogen or alkyl,
where appropriate substituted, in particular by F or
C1;
or R23 and R24 together form an unsaturated, partially
saturated or completely saturated monocyclic or
polycyclic group or a monoheterocyclic or polyhetero-
cyclic group, where the heteroatom is preferably N, S
or O, where the monocyclic or polycyclic groups can be
substituted, once or more than once, by a group
consisting of halogen, in particular F or C1,
trihalomethyl, in particular trifluoromethyl or
trichloromethyl, alkyl, alkenyl, alkynyl, amino, vitro,
cyano or amido, or a group of the formula -R', -OR',
SR', -R'OR", -R'SR", -C(O)R', -C(S)R', -C(0)OR',
-C ( S ) OR' , -C ( 0 ) SR' , -C ( S ) SR' , or a phenyl group or
phenoxy group, where the group, in particular the
phenyl group or phenoxy group, can be substituted, once
or more than once, by a group consisting of halogen, in
particular F or C1, trihalomethyl, in particular
trifluoromethyl or trichloromethyl, alkyl, alkenyl,
alkynyl, amino, vitro, cyano or amido, or a group of
CA 02433041 2003-06-25
WO 02/053171 PCT/EPO1/15317
- 47
the formula -R' , -OR' , SR' , -R' OR' ' , -R' SR' ' , -C (O) R' ,
-C(S)R', -C(0)OR', -C(S)OR', -C(O)SR', -C(S)SR',
-NR'C(O)R" or OC(O)R';
where
R' and R" are, independently of each other, hydrogen,
alkyl, alkenyl, alkynyl, cycloalkyl, alkoxy, phenyl or
a group of the formula NR" ' R" " , where R" ' and R" "
are, independently of each other, hydrogen or alkyl,
where appropriate substituted, in particular by F or
C1.
A preferred embodiment of a modulator which can be used
in accordance with the invention is a malic ester
derivative in accordance with general formula (VIII)
C02Rzs
R2t-B C-R~
C~aRzs
or a pharmaceutically tolerated salt, an oxide or a
hydrate thereof,
where
A, B, R21 and R22 are defined as above and R25 and R26
are, independently of each other, hydrogen, alkyl,
cycloalkyl, where appropriate substituted, in
particular by F or C1, or a group of the formula
NR" ' R" " , where R" ' and R" " are, independently of
each other, hydrogen or alkyl, where appropriate
substituted, in particular by F or C1.
In another preferred embodiment, it is possible to use
a malic ester derivative as described above where R2s
CA 02433041 2003-06-25
WO 02/053171 PCT/EPO1/15317
- 48
and R26 together form a heterocyclic 6-9-membered ring
and produce a diester derivative.
Particular preference is given to the use, according to
the invention, of the following malic acid derivatives
as modulators of IK activity:
diethyl-2-(4-fluorophenyl)-2-(3-picolyl)malonate;
diethyl-2-(4-nitrophenyl)-2-(2-picolyl)malonate;
diethyl-2-(4-nitrophenyl)-2-(4-picolyl)malonate;
diethyl-2-phenyl-2-(3-picolyl)malonate; diethyl-2-(5-
chloro-2-nitro-4-(trifluoromethyl)phenyl)-2-(3-
picolyl)malonate; diethyl-2-benzyl-2-(3-picolyl)-
malonate; diethyl-2-(4-nitrophenyl)-2-[(benzotriazol-1-
yl)methyl]malonate; diethyl-2-(2-thienyl)-2-(2-
picolyl)malonate; diethyl-2-(4-(acetylamino)phenyl)-2-
(2-picolyl)malonate; diethyl-2-(4-benzoylamino)phenyl)-
2-(2-picolyl)malonate and 2-(4-nitrophenyl)-2-(2-
picolyl)malononitrile.
Other substances in accordance with the general formula
V whose use according to the invention is particularly
preferred are 2-(3-phenoxyphenyl)butyronitrile; 2-(2-
chlorophenyl)butyronitrile; dicyclopropane(4-chloro-
phenyl)carbinol; ethyl-1-(4-chlorophenyl)cyclopentane-
1-carboxylate and 1-(4-chlorophenyl)-1-(3-methyl-5-
oxadiazolyl)cyclopentane.
In another embodiment, the modulators which are used in
accordance with the invention act as activators of IK
activity.
Isatin derivatives in accordance with the following
general formula (VI) (see also WO 00/33834)
CA 02433041 2003-06-25
WO 02/053171 PCT/EPO1/15317
- 49
R
R
3a
32 NO R27
or a pharmaceutically tolerated salt, an oxide or a
hydrate thereof, can be used as activators in
accordance with the invention;
where
R2' is hydrogen; an alkyl group; a cycloalkyl group; an
acyl group; a phenyl group or benzyl group, where the
group, in particular the phenyl group or benzyl group,
can be substituted, once or more than once, by a group
selected from halogen, in particular F or Cl, -N02, -
CN, -CF3, alkyl, cycloalkyl, hydroxyl and alkoxy; a
group of the formula -CH2CN; a group of the formula
-CH2COZR', where R' is hydrogen or an alkyl group, where
appropriate substituted, in particular by F or C1; a
group of the formula -CH2CONRI°R~, where RI° and R" are,
independently of each other, hydrogen, alkyl, where
appropriate substituted, in particular by F or Cl,
phenyl group or benzyl group, where the phenyl group or
benzyl group can be substituted, once or more than
once, by halogen and/or alkyl, or RI" and R", together
with the N atom to which they are bonded, form a 4-
membered to 7-membered monocyclic ring, where the
heterocyclic group can be substituted, once or more
than once, by a group selected from halogen, in
particular F or C1, alkyl, cycloalkyl, alkyloxy,
cycloalkyloxy, phenyl or benzyl; or a group of the
formula -CH2C (=NOH) NH2.
R28 is hydrogen; an alkyl group; a cycloalkyl group; a
group of the formula -CH2C02R' , where R' is hydrogen or
CA 02433041 2003-06-25
WO 02/053171 PCT/EPO1/15317
- 50
an alkyl group; or is a phenyl group or benzyl group,
where the phenyl group or benzyl group can be
optionally substituted, once or more than once, by
substituents selected from halogen, in particular by F
or C1, -NOz, -CN, CF3, alkyl, cycloalkyl, hydroxyl and
alkoxy; and
R29, R3°, R31 and R32 are, independently of each other,
hydrogen; halogen, in particular by F or Cl; -NO2; -CN;
CF3; alkyl; an alkoxy group; a phenyl group or benzyl
group, where the phenyl or benzyl groups can be
substituted, once or more than once, by substituents
selected from halogen, in particular by F or Cl, -NO2,
-CN, CF3, alkyl, cycloalkyl, hydroxyl and alkoxy; or a
group of the formula -SOzNR" R" ' , where R" and R" '
are, independently of each other, hydrogen or an alkyl
group, where appropriate substituted, in particular by
F or C1;
or R31 and R32 are defined as above, and R29 and R3o
together form an additional 4-membered to 7-membered
fused ring, where the fused ring can be aromatic,
partially saturated or saturated and the fused ring can
be substituted, once or more than once, by substituents
selected from halogen, in particular by F or Cl, -NO2,
-CN, CF3 and a group of the formula -SOZNR' ' R' ' ' , where
R " and R" ' are, independently of each other, hydrogen
or an alkyl group, where appropriate substituted, in
particular by F or Cl.
In a preferred embodiment, R2' in formula (VI) is
hydrogen; a C1_6 alkyl group; a phenyl group; a benzyl
group; a group of the formula -CH2C02R', where R' is
hydrogen or a C1_6 alkyl group, where appropriate
substituted, in particular by F or C1; a group of the
formula -CH2NH-Z, where 2 is a phenyl or benzyl group,
where these phenyl or benzyl groups can be substituted,
once or more than once, by halogen, in particular by F
CA 02433041 2003-06-25
WO 02/053171 PCT/EPO1/15317
- 51
or C1; or a group of the formula CH2C0-Y", where Y" is
a heterocyclic 6-membered monocyclic group containing
at least one nitrogen atom as heteroatom, and which can
be substituted, once or more than once, by a C1_6 alkyl
group or a phenyl group. Y" is preferably a piperidinyl
group or a piperazinyl group.
In another preferred embodiment, R28 in the formula (VI)
is hydrogen, C1_6 alkyl group, phenyl, benzyl or a group
of the formula -CHZCOOH.
In another preferred embodiment, R29, R3°, R31 and R32
are, independently of each other, hydrogen, F, Br, Cl,
NO2, CN, CF3 or C1_6 alkyl, where appropriate
substituted, in particular by F or Cl.
Particularly preferred modulators which can be used in
accordance with the invention are: 5,7-dinitro-1-
methyl-1H-indole-2,3-dione-3-(0-methyloxime); 5-bromo-
7-nitro-1H-indole-2,3-dione-3-oxime; 5-bromoisatin-3-
oxime; 5,6-dichloro-1-methylisatin-3-oxime; 4,5-
dichloroisatin-3-oxime; 4,5-dichloro-1-methylisatin-3-
oxime; O-methyl-4,5-dichloro-1-methylisatin-3-oxime;
benzoisatin-3-oxime; 6,7-dichloroisatin-3-oxime;
0-methyl-6,7-dichloroisatin-3-oxime; 0-methyl-6,7-
dichloro-1-methylisatin-3-oxime; 6,7-dichloro-1-methyl-
isatin-3-oxime; O-t-butyl-6,7-dichloroisatin-3-oxime;
0-((4-phenylpiperazin-1-yl)carbonylmethyl)-6,7-
dichloroisatin-3-oxime; 6-fluoro-7-methoxyisatin-3
oxime; 0-(4-chlorobenzylamino)methyl-6,7-dichloro
isatin-3-oxime; 6,7-difluoroisatin-3-oxime; 6,7
dimethylisatin-3-oxime; 5,6-dichloroisatin-3-oxime;
0-carboxymethyl-5-bromoisatin-3-oxime; 0-(ethoxycar
bonylmethyl)-5-bromoisatin-3-oxime; 0-(carboxymethyl)
6,7-dichloroisatin-3-oxime; O-(carboxymethyl)-6,7-
dichloroisatin-3-oxime; 6-chloro-7-methylisatin-3-
oxime; 6-fluoro-7-methylisatin-3-oxime.
CA 02433041 2003-06-25
WO 02/0531?1 PCT/EPO1/15317
- 52
Another modulator which can be used in accordance with
the invention is zoxazolamine, which acts as activators
of hIK1 (Syme et al., 2000, Am. J. Physiol. 278: C570-
C581).
Within the meaning of the invention, halogen is a
fluorine, chlorine, bromine or iodine atom.
Particularly preferred halogens are F or Cl.
Within the meaning of the invention, an alkyl group is
a monovalent, saturated, unbranched or branched
hydrocarbon chain. The hydrocarbon chain preferably
contains from 1 to 12 carbon atoms (C1_12-alkyl) , in
particular from 1 to 6 carbon atoms (C1_6-alkyl; lower
alkyl), containing pentyl, isopentyl, neopentyl,
tertiary pentyl, hexyl and isohexyl. In an even more
preferred embodiment, alkyl is a C1_9 alkyl group,
containing butyl, isobutyl, secondary butyl and
tertiary butyl. In a particularly preferred embodiment,
alkyl is a C1_3-alkyl group which can, in particular, be
methyl, ethyl, propyl or isopropyl.
Within the meaning of the present invention, a
cycloalkyl group is a cyclic alkyl group which
preferably contains from three to seven carbon atoms
(C3-~-cycloalkyl), including cyclopropyl, cyclobutyl,
cyclopentyl and cyclohexyl.
Within the meaning of the invention, an alkoxy group is
an 'alkyl-O-' group, with alkyl being defined as above.
Within the meaning of the present invention, an amino
group can be a primary (-NHZ), secondary (-NH-R) or
tertiary amino group (-N-R' R" ) , where R' and R" are,
independently of each other, alkyl as defined above.
Within the meaning of the present invention, an acyl
group is a carboxyl group or an alkylcarbonyl group,
CA 02433041 2003-06-25
WO 02/053171 PCT/EPO1/15317
- 53
with alkyl being defined as above. Examples of
preferred acyl groups are carboxyl, acetyl and
propionyl.
Within the meaning of the present invention, an alkenyl
group is a carbon chain containing one or more double
bonds, including dimes, trienes and polyenes. In a
preferred embodiment, the alkenyl group of the present
invention contains between two and six carbon atoms (C2-
6-alkenyl). Particularly preferred alkenyl groups are
ethenyl, 1,2 or 2,3-propenyl; or 1,2-, 2,3- or 3,4-
butenyl.
Within the meaning of the present invention, an alkynyl
I5 group denotes a carbon chain containing one or more
triple bonds, including diynes, triynes and polyynes.
In a preferred embodiment, the alkynyl group of the
present invention contains between two and six carbon
atoms (C2_6-alkynyl). Particularly preferred alkynyl
groups are ethynyl, 1,2 or 2,3-propynyl; or 1,2-, 2,3-
or 3,4-butynyl.
Within the meaning of the present invention, an amido
group is a substituent of the formula R' -CO-NH- or R' -
CO-N(alkyl)-, where R' is hydrogen or an alkyl group
defined as above. Examples of preferred amido groups
are formamido, acetamido and propionamido.
Within the meaning of this invention, a monocyclic or
polycyclic aryl group is a monocyclic or polycyclic
aromatic hydrocarbon group. Examples of preferred aryl
groups are phenyl, naphthyl and anthracenyl.
Within the meaning of this invention, an unsaturated
monocyclic or polycyclic group is a monocyclic or
polycyclic alkyl group, i.e. a monocyclic or polycyclic
aromatic hydrocarbon chain. An example of a preferred,
CA 02433041 2003-06-25
WO 02/053171 PCT/EPO1/15317
- 54
partially saturated monocyclic group is cyclopenta-2,4-
dien-1-ylidene.
Within the meaning of the invention, an aralkyl group
is an aryl group defined as above, with the aryl group
being linked to an alkyl group defined as above. An
example of a preferred aralkyl group is benzyl.
Within the meaning of the invention, a monocyclic or
heterocyclic group is a monocyclic or polycyclic
compound which contains one or more heteroatoms in the
ring structure. Preferred heteroatoms contain nitrogen
(N), oxygen (O) and sulfur (S). One or more ring
structures can be aromatic (i.e. heteroaryl), saturated
or partially saturated. Preferred monocyclic groups
contain 5-membered and 6-membered heterocyclic groups.
Examples of preferred monocyclic heterocyclic groups
contain furan-2-yl; furan-3-yl; 2-, 4- or 5-imidazolyl,
3-, 4-, or 5-isoxazolyl, 1-, 2-, 3-pyridinyl and 1- or
2-thienyl. Examples of preferred saturated or partially
saturated monocyclic heterocyclic groups contain
1,3,5,6,2-dioxadiazinyl, piperazinyl, piperidinyl,
1,2-, 1,3- or 1,4-pyranyl and pyrrolidinyl. Examples of
preferred aromatic heterocyclic groups contain
acridinyl, carbazolyl, indazolyl, quinolinyl or
benzofuranyl.
Within the meaning of the invention, a heteroalkyl
group denotes a monoheterocyclic or polyheterocyclic
group as defined above, with the heterocyclic group
being linked to an alkyl group defined as above.
Particularly preferred modulators which can be used in
accordance with the invention are hIK4 activators
1-EBIO (1-ethyl-2-benzimidazolinone), DCEBIO (5,6-
dichloro-1-ethyl-1,3-dihydro-2H-benzimidazol-2-one) and
also the benzoxazolones chlorzoxazone and zoxazolamine,
which act as activators of hIKl (Syme et al., 2000, Am.
CA 02433041 2003-06-25
WO 02/053171 PCT/EPO1/15317
- 55
J. Physiol. 278: C570-C581). In addition, WO 00/33834
discloses isatin derivatives as activators of hIKl.
Examples are 5-bromoisatin-3-oxime and 5,6-dichloro-1-
methylisatin-3-oxime.
Particularly preferred inhibitors of hIK4 are
charybdotoxin and clotrimazole (Khanna et al., 1999, J.
Biol. Chem. 274: 14838-14849). WO 99/25347 discloses
additional substances which act as inhibitors of hIKl.
Examples are the imidazole derivatives miconazole,
econazole, butoconazole, oxiconazole, sulconazole and
thioconazole, the triazole derivatives fluconazole,
terconazole and itraconazole, and the nitroimidazole
derivatives metronidazole, tinidazole, nimorazole,
ornidazole and benznidazole. In addition, the document
discloses derivatives of 1,4-dihydropyridine-3,5-
dicarboxylic acid, for example ethylmethyl 1,4-dihydro-
2,6-dimethyl-4-(2-nitrophenyl)pyridine-3,5-dicarbox-
ylate, and also clotrimazole derivatives, for example
2-chlorophenyl-4-hydroxyphenylphenylmethane.
The modulators which are used in accordance with the
invention can be employed for diagnosing and/or
preventing and/or treating diseases which are connected
with disturbed keratinocyte activity, in particular
wound healing disturbances, particularly preferably
psoriasis. Preferred diseases which are connected with
disturbed keratinocyte activity are contact dermatitis,
atopic eczema, vitiligo, hyperkeratoses, actinic
keratoses, hypertrophic scars, keloids, lentigo,
ephelides and geriatric skin. Particularly preferred
diseases are wounds, for example normally healing
wounds and poorly healing wounds, in particular ulcera,
and also psoriasis.
The present invention also relates to a process for
producing a pharmaceutical for treating diseases which
are connected with disturbed keratinocyte activity, in
CA 02433041 2003-06-25
WO 02/053171 PCT/EPO1/15317
- 56
particular wound healing disturbances, particularly
preferably psoriasis, in which process at least one
nucleic acid which can be used in accordance with the
invention, at least one polypeptide which can be used
in accordance with the invention, at least one antibody
which can be used in accordance with the invention
and/or at least one modulator which can be used in
accordance with the invention is combined with suitable
additives and auxiliary substances.
In the case of psoriasis, or preference is to be given
to using a modulator of the activity of the ion
channel, for example an activator of the activity of
the ion channel or an inhibitor of the activity of the
ion channel in accordance with the present invention.
Examples of modulators are DCEBIO, zoxazolamine,
chlorzoxazone, 1-EBIO and a specific antibody. In
addition, preference is to be given, in the case of
psoriasis, to a nucleic acid which leads to a
downregulation of the quantity of IK channel, for
example an antisense oligonucleotide, an siRNA or a
ribozyme in accordance with the present invention.
In the case of wound healing, in particular of ulcera,
preference is to be given to increasing the quantity of
IK channel, for example by means of carrying out a
gene-therapy treatment using a nucleic acid which
encodes a polypeptide which can be used in accordance
with the invention.
The present invention furthermore relates to a
pharmaceutical, which has been produced by this
process, for treating diseases which are connected with
disturbed keratinocyte activity, in particular wound
healing disturbances and/or psoriasis, particularly
preferably psoriasis, which pharmaceutical comprises at
least one polypeptide, as depicted in SEQ ID No. 3 or
SEQ ID No. 4, or a one nucleic acid encoding this
CA 02433041 2003-06-25
WO 02/053171 PCT/EPO1/15317
- 57
sequence, or or at least one antibody which can be used
in accordance with the invention, or at least one
modulator which can be used in accordance with the
invention, where appropriate together with suitable
additives and auxiliary substances.
The invention furthermore relates to the use of this
pharmaceutical for treating diseases which are
connected with disturbed keratinocyte activity.
Diseases which are connected with disturbed
keratinocyte activity can be treated in a conventional
manner, for example using bandages, plasters,
compresses or gels which contain the pharmaceuticals
according to the invention. Thus, it is possible to
administer the pharmaceuticals, which comprise suitable
additives or auxiliary substances, such as
physiological sodium chloride solution, demineralized
water, stabilizers, proteinase inhibitors, gel
formulations, such as white vaseline, low-viscosity
paraffin and/or yellow wax, etc., topically and locally
in order to immediately and directly exert an influence
on the disease. Furthermore, the pharmaceuticals
according to the invention can, where appropriate, be
administered in the form of liposome complexes or gold
particle complexes, likewise topically and locally in
the region of the diseased skin surface. In addition,
the treatment can be effected using a transdermal
therapeutic system (TTS) which enables the
pharmaceuticals according to the invention to be
released in a time-controlled manner. TTSs are
disclosed, for example, in EP 0 944 398 A1,
EP 0 916 336 Al, EP 0 889 923 A1 and EP 0 892 493 A1.
However, the treatment with the pharmaceuticals
according to the invention can also be effected using
oral dosage forms, such as tablets or capsules, by way
of the mucous membranes, for example of the nose or of
CA 02433041 2003-06-25
WO 02/053171 PCT/EPO1/15317
- 58
the oral cavity, or in the form of dispositories which
are implanted under the skin.
A preferred embodiment of a pharmaceutical is used for
preventing and/or treating psoriasis, with the
intention being to decrease the activity of the
keratinocytes. An embodiment which is particularly
preferred in this connection consists in using suitable
modulators and/or antibodies to inhibit the
(electrophysiological) activity of the hIKl channel
according to the invention.
A particularly preferred embodiment consists in
administering a medicament which comprises a modulator
which can be used in accordance with the invention
[lacuna] can be effected in the form of the active form
of the modulator. Preference is given to administering
a composition which comprises the active form of the
modulator, optionally in the form of a pharmaceutically
acceptable salt, together with one or more suitable
additives and auxiliary substances, such as adjuvants,
carrier materials and buffer solutions and diluents,
such as physiological sodium chloride solution,
demineralized water, stabilizers, proteinase
inhibitors, gel formulations, such as white vaseline,
low-viscosity paraffin and/or yellow wax, etc., which
are particularly suitable for topical application in
order to immediately and directly exert an influence on
the wound healing.
A preferred embodiment consists in using an antibody,
or an antibody fragment, which is directed against the
hIKl channel polypeptide, or a functional variant
thereof, as a pharmaceutical in accordance with the
present invention.
CA 02433041 2003-06-25
WO 02/053171 PCT/EPO1/15317
- 59
Another particularly preferred embodiment consists in
decreasing the expression of the nucleic acids which
encode the hIK1 polypeptide according to the invention.
A preferred embodiment of a nucleic acid as a
pharmaceutical in accordance with the present invention
is represented by antisense nucleotides (see above) and
ribozymes (WO 99/15703) and also what are termed small
interfering RNAs (siRNAs). The latter are double-
stranded RNA molecules which downregulate gene
expression in a sequence-specific and post-
transcriptional manner (Elbashir et al., 2001, Nature
411: 494-498).
Another preferred embodiment of a pharmaceutical is
used for preventing and/or treating wound healing
disturbances by, for example, administering a
polypeptide according to the invention or (a) nucleic
acids) which encodes) the polypeptide.
A pharmaceutical which comprises the described nucleic
acid in naked form or in the form of one of the above-
described vectors which are effective in gene therapy,
or in a form in which it is complexed with liposomes or
gold particles, is especially suitable for use in
performing gene therapy in humans. The pharmaceutical
excipient is, for example, a physiological buffer
solution, preferably having a pH of approx. 6.0-8.0,
preferably of approx. 6.8-7.8. In particular of approx.
7.4 and/or an osmolarity of approx. 200-
400 milliosmol/liter, preferably of approx. 290-
310 milliosmol/liter. In addition, the pharmaceutical
excipient can comprise suitable stabilizers such as
nuclease inhibitors, preferably sequestrants such as
EDTA, and/or other auxiliary substances with which the
skilled person is familiar.
CA 02433041 2003-06-25
WO 02/053171 PCT/EP01/15317
- 60
The described nucleic acid, where appropriate in the
form of the viral vectors which are described in more
detail above, or as liposome complexes or a gold
particle complex, is customarily administered topically
and locally in the region of the wound.
A preferred embodiment of a pharmaceutical in
accordance with the present invention consists in
administering the polypeptide itself, together with
suitable additives or auxiliary substances, such as
physiological sodium chloride solution, demineralized
water, stabilizers, proteinase inhibitors, gel
formulations, such as white vaseline, low-viscosity
paraffin and/or yellow wax, etc., in order to
immediately and directly exert an influence on the
wound healing.
Another preferred embodiment of a pharmaceutical in
accordance with the present invention consists in using
a suitable carrier material, for example what are
termed microcarriers, which are composed of
biocompatible materials, such as dextran matrix (see
US598888), to transplant autologous and allogenic cells
which expresses the polypeptide according to the
invention.
The present invention furthermore relates to a process
for producing a diagnostic agent for diagnosing
diseases which are connected with disturbed
keratinocyte activity, in particular wound healing
disturbances and/or psoriasis, which process is
characterized in that use is made of at least one
nucleic acid, as depicted in SEQ ID Nos. 1 and 2, of at
least one polypeptide, as depicted in SEQ ID Nos. 3 and
4, or of at least one modulator in accordance with the
present invention, where appropriate together with
suitable additives and auxiliary substances.
CA 02433041 2003-06-25
WO 02/053171 PCT/EPO1/15317
- 61
The present invention also relates to a diagnostic
agent for diagnosing diseases which are connected with
disturbed keratinocyte activity, in particular wound
healing disturbances and/or psoriasis, which agent
comprises at least one nucleic acid, as depicted in SEQ
ID Nos . 1 and 2, at least one polypeptide, as depicted
in SEQ ID Nos. 3 and 4, or at least one modulator in
accordance with the invention, where appropriate
together with suitable additives and auxiliary
substances.
For example, it is possible, in accordance with the
present invention, to use one of the above-described
nucleic acids to prepare a diagnostic agent on the
basis of the polymerase chain reaction (Examples 3, 4,
5; PCR diagnostics, e.g. in accordance with
EP 0 200 362) or of an RNase protection assay, as
described in more detail in Example 2. These tests are
based on the specific hybridization of the above-
described nucleic acids with the complementary
counterstrand, usually the corresponding mRNA. In this
connection, the above-described nucleic acid can also
be modified as described, for example, in EP 0 063 879.
Preferably, well known methods employing suitable
reagents are used to label, for example radioactively
using a-P32-dCTP or nonradioactively using biotin or
digoxigenin, an above-described DNA fragment, which is
then incubated with isolated RNA which has preferably
previously been bound to suitable membranes composed,
for example, of cellulose or nylon. When the quantity
of RNA being analyzed is the same for each tissue
sample, it is consequently possible to determine the
quantity of mRNA which has been specifically bound by
the probe and to compare this with the quantity of mRNA
derived from healthy tissue. Alternatively, in situ
hybridization can also be used to determine the
quantity of mRNA in tissue sections (see, for example,
CA 02433041 2003-06-25
WO 02/053171 PCTjEPOlj15317
- 62
Werner et al., 1992, Proc. Natl. Acad. Sci. USA
89: 6896-900).
The diagnostic agent according to the invention can
consequently also be used to specifically measure a
tissue sample in vitro for the strength of the
expression of the corresponding gene in order to be
able to diagnose a possible disease which is connected
with disturbed keratinocyte activity with certainty
(Examples 2, 3, 4 and 5). Such a method is particularly
suitable for the early prognosis of disturbances. This
makes it possible to use therapy preventatively and to
analyze predispositions. Thus, expression of the gene
mIK1 is already increased in the unwounded state in the
intact skin of old mice, which exhibited wound healing
disturbances after wounding, as compared with the
intact skin of control mice and, in particular, with
the intact skin of young mice. The strength with which
the mIK1 gene is expressed therefore makes it possible
to still predict wound healing disturbance in tissue
which is intact (Example 3, Table 2).
Another diagnostic agent according to the invention
comprises the polypeptide which can be used in
accordance with the invention or the immunogenic parts
thereof which are described in more detail above. For
example, the polypeptide, or the parts thereof, which
are preferably bound to a solid phase, for example
composed of nitrocellulose or nylon, can, for example,
be brought into contact, in vitro, with the body fluid,
for example wound secretion, to be investigated in
order, in this way, to be able to react, for example,
with autoimmune antibody. The antibody/peptide complex
can then be detected, for example using labeled anti-
human IgG antibodies or anti-human IgM antibodies. The
label is, for example, an enzyme, such as peroxidase,
which catalyzes a color reaction. The color reaction
CA 02433041 2003-06-25
WO 02/053171 PCT/EPO1/15317
- 63
can then be used to readily and rapidly detect the
presence and quantity of autoimmune antibodies present.
Another diagnostic agent comprises the antibodies
according to the invention themselves. These antibodies
can be used, for example, to readily and rapidly
investigate a tissue sample to determine whether the
polypeptide in question is present in elevated quantity
in order, thereby, to obtain an indication of the
possible presence of a disease which is connected with
disturbed keratinocyte activity. In this case, the
antibodies according to the invention are, for example,
labeled with an enzyme, as already described above. The
specific antibody/peptide complex can thereby be
detected readily, and just as rapidly, by way of an
enzymic color reaction.
Another diagnostic agent according to the invention
comprises a probe, preferably a DNA probe, and/or
primers. This opens up a further possibility of using
a suitable probe to obtain the nucleic acids which can
be used in accordance with the invention, for example
by isolating them from a suitable gene library, for
example from a wound-specific gene library (see, for
example, J. Sambrook et al., 1989, Molecular Cloning, A
Laboratory Manual, 2nd edition, Cold Spring Harbor
Laboratory, Cold Spring Harbor, NY, chapter 8, pages
8.1 to 8.81, chapter 9, pages 9.47 to 9.58 and chapter
10, pages 10.1 to 10.67).
Examples of suitable probes are DNA or RNA fragments
having a length of approx. 100-1000 nucleotides,
preferably having a length of approx. 200-500
nucleotides, in particular having a length of approx.
100-400 nucleotides, and whose sequences can be deduced
from the polypeptide sequences, or functional variants
thereof, as depicted in SEQ ID No. 3 or SEQ ID No. 4 of
the sequence listing and/or with the aid of the cDNA
CA 02433041 2003-06-25
WO 02/053171 FCT/EPO1/15317
- 64
sequences, or variants thereof, as depicted in SEQ ID
No. 1 or SEQ ID No. 2 [lacuna] specified database
entries (see also Example 2).
Alternatively, it is possible to use the deduced
nucleic acid sequences to synthesize oligonucleotides
which are suitable for being used as primers for a
polymerase chain reaction. These primers can be used to
amplify and isolate the nucleic acid which can be used
in accordance with the invention, or parts thereof,
from cDNA, for example skin-specific cDNA (Examples 2,
3, 4 and 5). Examples of suitable primers are DNA
fragments having a length of approx. 10-100
nucleotides, preferably having a length of from approx.
10 to 50 nucleotides, in particular having a length of
10-30 nucleotides, whose sequence can be deduced from
the polypeptides as depicted in SEQ ID No. 3 to SEQ ID
No. 4 and/or with the aid of the cDNA sequences as
depicted in SEQ ID No. 1 or SEQ ID No. 2 (Examples 3, 4
2 0 and 5 ) .
The invention also relates to a process for producing a
test for finding pharmacologically active substances
which are connected with diseases involving disturbed
keratinocyte activity, in particular wound healing
disturbances and/or psoriasis, which process is
characterized in that at least one nucleic acid, as
depicted in SEQ ID Nos. 1 and 2, at least one
polypeptide, as depicted in SEQ ID Nos. 3 and 4, at
least one antibody or at least one modulator in
accordance with the present invention is/are used,
where appropriate together with suitable additives and
auxiliary substances, for producing the test.
Within the meaning of the present invention, the term
'pharmacologically active substances' is to be
understood as meaning all those molecules, compounds
and/or compositions and substance mixtures which are
CA 02433041 2003-06-25
WO 02/053171 PCT/EPO1/15317
- 65
able to interact, under suitable conditions, where
appropriate together with suitable additives and
auxiliary substances, with the above-described nucleic
acids, polypeptides or antibodies. While possible
pharmacologically active substances are simple chemical
organic or inorganic molecules or compounds, they can
also contain peptides, proteins or complexes thereof.
Because of their interaction, the pharmacologically
active substances can exert an influence, in vivo or in
vitro, on the functions) of the nucleic acids,
polypeptides or antibodies or else only bind to the
above-described nucleic acids, polypeptides or
antibodies or enter into other interactions, in a
covalent or noncovalent manner, with them. In
particular, pharmacologically active substances are
substances which are able to modulate the channel
activity as described above.
In addition, the invention contains a test for
identifying substances which are pharmacologically
active in connection with diseases which are connected
with disturbed keratinocyte activity, which test
includes at least one nucleic acid, at least one
polypeptide or at least one modulator according to the
present invention, where appropriate together with
suitable additives and auxiliary substances.
A suitable system can be produced, for example, by
stably transforming epidermal or dermal cells, in
particular keratinocytes, with expression vectors which
contain selectable marker genes and the above-described
nucleic acids. In this method, the expression of the
above-described nucleic acids in the cells is altered
such that it corresponds to the pathologically
disturbed expression in vivo. It is also possible to
employ antisense oligonucleotides, which contain the
nucleic acids which can be used in accordance with the
invention, for this purpose. In the case of these
CA 02433041 2003-06-25
WO 02/053171 PCT/EPO1/15317
- 66
systems, therefore, it is particularly advantageous to
be acquainted with the expression behavior of the genes
in disturbed physiological processes as described in
this application. The pathological behavior of the
cells in vitro can frequently be imitated in this way
and it is possible to search for substances which
restore the normal behavior of the cells and which
possess therapeutic potentential.
HaCaT cells, which are generally available, and the
expression vector pCMV4 (Anderson et al., 1989, J.
Biol. Chem. 264: 8222-9) are, for example, suitable for
these test systems. In this connection, the nucleic
acid which can be used in accordance with the invention
can be integrated into the expression vectors either in
the sense orientation or in the antisense orientation
such that the functional concentration in the cells of
the mRNA of the corresponding genes is either increased
or decreased as a result of hybridizing with the
antisense RNA. After the transformation and selection
of stable transformands the cells in culture generally
exhibit a proliferation behavior, migration behavior
and/or differentiation behavior which is/are altered as
compared with control cells. This behavior in vitro
frequently correlates with the function of the
corresponding genes in regenerative processes in the
organism (Yu et al., 1997, Arch. Dermatol. Res.
289: 352-9; Mils et al., 1997, Oncogene 14: 15555-61;
Charvat et al., 1998, Exp. Dermatol 7: 184-90; Mythily
et al., 1999, J. Gen. Virol. 80: 1707-13; Werner, 1998,
Cytokine Growth Factor Rev. 9: 153-65) and can be
detected using simple tests which are easy to implement
such that, based on this, it is possible to construct
test systems for identifying pharmacologically active
substances. Thus, the proliferative behavior of cells
can be established very rapidly by, for example,
incorporating labeled nucleotides into the DNA of the
cells (see, for example, de Fries and Mitsuhashi, 1995,
CA 02433041 2003-06-25
WO 02/053171 PCT/EPO1/15317
- 67
J. Clin. Lab. Anal. 9: 89-95; Perros and Weightman,
1991, Cell Prolif. 24: 517-23; Savino and Dardenne,
1975, J. Immunol. Methods 85: 221-6), by staining the
cells with specific dyes (Schulz et al., 1994, J.
Immunol. Methods 167: 1-13) or by using immunological
methods (Frahm et al., 1998, J. Immunol. Methods
211: 43-50). Migration can be readily detected using
the migration index test (Charvat et al., see above)
and comparable test systems (Benestad et al., 1987,
Cell Tissue Kinet. 20: 109-19, Junger et al., 1993, J.
Immunol. Methods 160: 73-9). Examples of suitable
differentiation markers are keratin 6, 10 and 14 and
also loricrin and involucrin (Rosenthal et al., 1992,
J, Invest, Dermatol, 98: 343-50), whose expression can
readily be detected, for example, using antibodies
which are available generally.
Another suitable test system is based on identifying
interactions using what is termed the two hybrid system
(Fields and Sternglanz, 1994, Trends in Genetics, 10,
286-292; Colas and Brent, 1998 TIBTECH, 16, 355-363).
In this test, cells are transformed with expression
vectors which express fusion proteins composed of the
polypeptide which can be used in accordance with the
invention and a DNA-binding domain from a transcription
factor such as Gal4 or LexA. In addition, the
transformed cells contain a reporter gene whose
promoter contains sites for binding the corresponding
DNA-binding domain. By means of transforming another
expression vector which expresses a second fusion
protein composed of a known or unknown polypeptide and
an activation domain, for example from Gal4 or
herpesvirus VP16, the expression of the reporter gene
can be greatly increased if the second fusion protein
interacts with the polypeptide which can be used in
accordance with the invention. This increase in
expression can be used for identifying novel
pharmacologically active substances by, for example,
CA 02433041 2003-06-25
WO 02/053171 PCT/EPO1/15317
_ 68
preparing a cDNA library from regenerating tissue for
the purpose of constructing the second fusion protein.
In addition, this test system can be used for screening
substances which inhibit an interaction between the
polypeptide which can be used in accordance with the
invention and a pharmacologically active substance
which is already known. These substances decrease the
expression of the reporter gene in cells which are
expressing the fusion proteins composed of the
polypeptide which can be used in accordance with the
invention and the pharmacologically active substances
(Vidal and Endoh, 1999, Trends in Biotechnology,
17: 374-81). In this way, it is possible to rapidly
identify novel active compounds which can be used for
treating diseases which are connected with disturbed
keratinocyte activity.
Pharmacologically active substances of the polypeptides
which can be used in accordance with the invention can
also be nucleic acids which are isolated using
selection methods such as SELEX (see Jayasena, 1999,
Clin. Chem. 45: 1628-50; Klug and Famulok, 1994, M.
Mol. Biol. Rep. 20: 97-107; Toole et al., 1996,
US 5589281). In the SELEX method, those molecules
(aptamers) which bind to a polypeptide with high
affinity are typically isolated, by means of repeated
amplification and selection, from a large pool of
different, single-stranded RNA molecules. Aptamers can
also be synthesized and selected in their mirror-image
form, for example as a L-ribonucleotide (Nolte et al . ,
1996, Nat. Biotechnol. 14: 1116-9; Klussmann et al.,
1996, Nat. Biotechnol. 14: 1112-5). Forms which have
been isolated in this way enjoy the advantage that they
are not broken down by naturally occurring
ribonucleases and therefore possess greater stability.
The invention also relates to a process for preparing
an array, which is fixed on a support material, for
CA 02433041 2003-06-25
WO 02/053171 PCT/EPO1/15317
- 69
performing analysis in connection with diseases which
are connected with disturbed keratinocyte activity, in
which process at least one nucleic acid, at least one
polypeptide or at least one antibody in accordance with
the invention is used for the preparation.
Methods for preparing such arrays by means of spotting,
printing or solid phase chemistry in combination with
photolabile protecting groups are disclosed, for
example, in WO 89/109077, WO 90/15070, WO 95/35505 and
US 5,744,305.
The invention furthermore relates to an array, which is
fixed on a support material, for performing analysis in
connection with diseases which are connected with
disturbed keratinocyte activity, in particular wound
healing disturbances and/or psoriasis, which array is
characterized in that it contains at least one nucleic
acid and/or at least one polypeptide and/or at least
one antibody in accordance with the present invention.
Arrays according to the invention can be used for
performing analysis in connection with diseases which
are connected with disturbed keratinocyte activity, in
particular wound healing disturbances and/or psoriasis.
The invention furthermore relates to a process for
preparing a DNA chip and/or protein chip for performing
analysis in connection with diseases which are
connected with disturbed keratinocyte activity, in
particular wound healing disturbances and/or psoriasis,
which process is characterized in that at least one
nucleic acid, as depicted in SEQ ID Nos. 1 and 2, at
least one polypeptide, as depicted in SEQ ID Nos. 3 and
4, or at least one antibody, as described above, is
used for the preparation.
Methods for preparing such DNA chips and/or protein
chips by means of spotting, printing or solid phase
CA 02433041 2003-06-25
WO 02J053171 PCT/EPO1/15317
- 70
chemistry in combination with photolabile protecting
groups are disclosed, for example, in WO 89/109077,
WO 90/15070, WO 95/35505 and US 5,744,305.
The invention furthermore relates to a DNA chip and/or
protein chip for performing analysis in connection with
diseases which are connected with disturbed
keratinocyte activity, in particular wound healing
disturbances and/or psoriasis, which DNA chip and/or
protein chip contains) at least one nucleic acid, as
depicted in SEQ ID Nos. 1 and 2, and/or at least one
polypeptide, as depicted in SEQ ID Nos. 3 and 4, and/or
or at least one antibody in accordance with the present
invention. DNA chips are disclosed, for example, in
US 5,837,832.
The present invention also relates to a pharmaceutical
for indication and therapy, which pharmaceutical
comprises a nucleic acid which can be used in
accordance with the invention, a polypeptide which can
be used in accordance with the invention or a modulator
which can be used in accordance with the invention and,
where appropriate, suitable additives or auxiliary
substances, and to a process for producing such a
pharmaceutical for treating diseases which are
connected with disturbed keratinocyte activity, in
particular wound healing disturbances and/or psoriasis,
in which process a nucleic acid which can be used in
accordance with the invention, as depicted in SEQ ID
Nos. 1 and 2, a polypeptide which can be used in
accordance with the invention, as depicted in SEQ ID
Nos. 3 and 4, or a modulator which can be used in
accordance with the invention, is formulated with a
pharmaceutically acceptable excipient.
The wording of all the claims is hereby incorporated
into the description by reference.
CA 02433041 2003-06-25
WO 02/053171 PCT/EPO1/15317
- 71
The following tables and figures, and the following
examples, are solely intended to describe the invention
in more detail without restricting it.
Tables and figures
Table 1 lists the hIKl polypeptides and nucleic acids
which can be used in accordance with the
invention and their database accession
numbers.
Table 2 shows differential regulation of mIK1
expression, as determined by means of TaqMan
analysis, in association with different wound
healing states in the mouse as an example of
diseases which are connected with disturbed
keratinocyte activity.
Table 3 shows the kinetics of the differential
regulation of mIKl expression, as determined
by means of TaqMan analysis, in association
with wound healing as an example of a disease
which is connected with disturbed
keratinocyte activity.
Table 4 shows differential regulation of mIKl
expression, as determined by means of TaqMan
analysis, in two different wound healing
states in humans (normal wound healing and
ulcer) as examples of diseases which are
connected with disturbed keratinocyte
activity.
Table 5 shows the expression profile of hIKl, as
determined by means of TaqMan analysis, in
different human organs.
CA 02433041 2003-06-25
WO 02/053171 PCT/EPO1/15317
- 72
Figure 1 shows the change in membrane potential (Vm)
in mV, as determined by means of patch-clamp
analysis, as the electrophysiological
response of HaCaT keratinocytes to (A)
different concentrations of ATP, (B) 10 uM
bradykinin or 100 uM histamine (C) 'caged
IP3' before and after UV-induced flash
photolysis.
Figure 2 shows the influence, as determined by means
of patch-clamp analysis, of different
modulators of hIKl on the ATP-induced
electrophysiological response as a change in
the membrane potential (Vm) in mV. (A)
addition of charybdotoxin at various
concentrations prior to the addition of ATP
(B) addition of clotrimazole (1 uM) prior to
the addition of ATP (C) addition of
charybdotoxin (100 nM) after the addition of
ATP (D) addition of 1-EBIO (1 mM) prior to
the addition of ATP.
Figure 3 shows the immunostaining of just confluent
(confluent), 2 days postconfluent
(2d postconfluent), 4 days postconfluent
(4d postconfluent) and 6 days postconfluent
(6d postconfluent) HaCaT cells with an anti-
K10 antibody.
Figure 4 shows the quantity of hIKl, as determined by
means of an RNase protection assay, in
proliferating (lane '1'), just confluent
(lane '2') and 4 days postconfluent (lane
'3') HaCaT keratinocytes as an
autoradiograph. 1000 cpm of the hybridization
probe are loaded in the 'probe' lane. The
'tRNA' lane contains the negative control.
CA 02433041 2003-06-25
WO 02/053171 PCT/EPO1/15317
- 73
Figure 5 shows the influence of various modulators of
hIKl on the proliferation of HaCaT
keratinocytes (n=3). As a control, use was
made of cells where only the respective
solvent was added to the medium. Clotrimazole
(10 uM) and 1-EBIO (1 mM) inhibited
proliferation completely while the addition
of charybdotoxin (200 nM) retarded
proliferation.
Figure 6 shows the quantities, as detected by means of
immunoblotting, of the protein markers of
keratinocyte differentiation, i.e.
involucrin, keratin 1 (K1) and keratin 10
(K10) under the influence of 1000 ~M 1-EBIO
(lanes 1 and 2), 100 uM 1-EBIO (lanes 3 and
4), 1 uM 1-EBIO (lanes 5 and 6), 1000 uM
zoxazolamine (lanes 7 and 8), 100 ~M
zoxazolamine (lanes 9 and 10), 1 ~M
zoxazolamine (lanes 11 and 12), and in the
control (lane 'C'; to DMSO/DMEM), in HaCaT
keratinocytes.
Figure 7 shows the influence of different
concentrations of the hIKl activator 1-EBIO
on the proliferation of HaCaT keratinocytes
without addition of serum. The incorporation
of BrDU was determined, as a measure of the
proliferation, by measuring the absorption at
450 nm (A[450 nmJ). Greater proliferation is
reflected in higher absorption. Cells which
had grown under the influence of serum ('KGM-
l0o FCS' lane) were used as the proliferation
control. Another hIK1 activator, i.e.
zoxazolamine ('1000 uM Zox' lane) was used
for comparing with the effect of 1-EBIO. The
negative controls, without activator or only
CA 02433041 2003-06-25
WO 02/053171 PCT/EPO1/15317
- 74
with the solvent DMSO, are labeled '~KGM" and
'KGM DMSO', respectively.
Figure $ shows the influence of different
concentrations of the hIKl activator 1-EBIO
on the serum-induced proliferation of HaCaT
keratinocytes ('DMEM-loo FCS' lane). The
incorporation of BrDU was determined, as a
measure of the proliferation, by measuring
the absorption at 450 nm (A[450 nm]). Greater
proliferation is reflected in higher
absorption. DMSO in DMEM/10o FCS without
activator was used as the negative control
for the solvent ('DMSO' lane). The hIKl
activator zoxazolamine, in DMEM/l0o FCS, was
used as the positive control ('1000 uM Zox'
lane).
The polypeptide sequences of mIKl and hIKl, and their
encoding nucleic acids, are as depicted in SEQ ID No. 1
to SEQ ID No. 4.
The oligonucleotides and polynucleotides which were
used for the examples are as depicted in SEQ ID No. 5
to SEQ ID No. 13.
Examples
Example l: The intermediate-conductance calcium-
dependent potassium channel hIKl mediates a long-
lasting, 1-EBIO-modulated hyperpolarization of
keratinocytes following stimulation with ATP,
bradvkinin or histamine
In order to identify an ion channel which is
substantially involved in the transduction of wound
healing-specific signals, HaCaT cells were investigated
electrophysiologically. The HaCaT keratinocytes were
CA 02433041 2003-06-25
WO 02/053171 PCT/EPO1/15317
- 75
propagated in DEM containing loo FCS (Gibco BRL) to
which antibiotics (penicillin/streptomycin, 100 U/ml)
had been added. The final concentration of Ca2+ was
1.8 mM. The cells were incubated until a confluent cell
culture had developed; the culture medium was then
replaced with standard bath solution (SBS; 130 mM NaCl,
3 mM KCl; 2 mM CaCl2; 2 mM MgCl2; 25 mM HEPES/NaHEPES;
mM D-glucose; pH 7.4), and the dishes were examined
in an inverse microscope (Axiovert, Zeiss). The patch
10 pipettes were prepared from small borosilicate tubes on
a horizontal pulling device (DMZ, Zeitz) using the two-
step pulling method. The pipettes were then filled with
a solution containing 135 mM potassium gluconate, 10 mM
KCl, 1.6 mM Na2HP0~, 0.73 mM CaClz, 1.03 mM MgCl2, 1 mM
EGTA, 14 mM HEPES/NaHEPES and 100 mg of nystatin/ml;
pH 7.2 (Ca2+ activity in the solution - 10-~ M) . The
resistance of these patch pipettes was 5-8 GSZ in the
bath. After a seal in the GS2 range had been produced
(typically 1.5-2 GSZ) the amplifier was switched to
current clamp mode. The membrane potentials reached
stable values within 3-5 min. The electrophysiological
signals were recorded, amplified and digitalized using
an Axopatch 200 amplifier in combination with a TL-1
Labmaster Interface and AXOTAPE software (Axon
Instruments). The statistical analysis (one-way ANOVA
with Bonferri post-test comparison) was carried out
using Graphpad prism 2Ø
In experiments in which the intracellular Caz+
concentration was increased by flash photolysis of
'caged IP3' (Calbiochem), the patch-clamp recording was
carried out in the whole-cell configuration, with a
pipette solution containing 120 mM potassium gluconate,
20 mM KC1, 1 mM MgCl2, 10 mM HEPES/NaHEPES, 2 mM Na2ATP,
0.3 mM NaGTP (pH 7.2) and 10-100 mM 'caged IP3' being
used. AFter 5-7 min of whole-cell recording, IP3 was
released by means of a UV light flash which was
generated using a xenon arc lamp (75 W; excitation
CA 02433041 2003-06-25
WO 02/053171 PCTjEP01J15317
- 76
filter: 330 ~ 40 nm) which was connected to the
epifluorescence port of the microscope. The UV light
beam was focused on the keratinocytes by the 40-times
phase contrast objective. The duration of the flash
(1 s) was set using a Uniblitz shutter (Vincent
Assoc.).
In experiments in which the entire solution in which
the cells were incubated was exchanged, a conical
plexiglas holder possessing several influx lines and
one efflux line was placed in the culture dish in order
to reduce the volume of the recording chamber down to
1 ml. The inflow of liquid was gravity-dependent and
was controlled by means of magnetic valves. Outflow was
effected by applying a negative pressure using a vacuum
pump. Substances were added, while observing visually,
directly into the keratinocytes under investigation
using a remotely controlled, magnet-controlled Y tube
system (diameter of the efflux tube: 100 Vim).
The electrophysiological recordings were carried out,
using perforated patches, on HaCaT cells which had
grown into a confluent monolayer. In the current-clamp
mode, the average membrane potential of the
keratinocytes was -42 ~ 1 mV (n=76) under controlled
conditions. Perfusing the HaCaT cells with ATP (1-
1000 uM) induced a biphasic change in the membrane
potential, with this change consisting of a short,
transient depolarization followed by a marked and long-
lasting hyperpolarization (Figure 1 A). At ATP
concentrations of >_ 10 uM, the strong hyperpolarization
lasted for at least 5 min after addition of the ATP
(5 min), with some keratinocytes even remaining
hyperpolarized during the whole of the observation
period (up to 20 min). This observation demonstrates
that changes in the concentration of ATP bring about
long-lasting changes in the membrane potential and
consequently in the activity of the keratinocytes.
CA 02433041 2003-06-25
WO 02/053171 PCT/EPO1/15317
_ 77
The hyperpolarization after the addition of 1 uM ATP
represented a process which could be reversed rapidly
by washing out the solution (n=9) . When 10 uM ATP were
added, a hyperpolarization of 30 ~ 2 mV (n=28) was
observed. A response which was practically identical
quantitatively and kinetically was measured when
bradykinin (10 uM, n=3) or histamine (100 uM, n=4) was
added to the keratinocytes, indicating that the
substances ATP, histamine and bradykinin regulate the
same effector system (Figure 1 B).
Since it is known that all three extracellular
mediators are able to stimulate phosphoinositide
metabolism in keratinocytes (Talwar et al., 1989, J.
Invest. Dermatol. 93: 241-245; Pillai et al., 1992, J.
Clin. Invest. 90: 42-51; Rosenbach et al., 1993, Arch.
Dermatol. Res. 285: 393-396), an investigation was
carried out to determine whether the formation of IP3
and the subsequent increase in the cytosolic
concentration of Caz+ are part of the signal
transduction pathway. To do this, whole-cell recordings
were carried out using keratinocytes which had been
loaded with 'caged-IP3' (10-100 ~M). In all the cells
which were investigated (n=7), it was observed that the
sudden conversion of 'caged-IP3' into IP3 by means of
flash photolysis led to a rapid, transient
depolarization followed by a hyperpolarization
(Figure 1 C). The IP3-induced biphasic voltage change
tallied very precisely with that which was observed
after adding 1 ~ZM ATP. The striking similarity between
the electrophysiological responses which were brought
about by the three agonists, i.e. ATP, histamine and
bradykinin, and IP3 suggest that the biphasic change in
membrane voltage was mediated by the mobilization of
Ca2+ from IP3-sensitive stores.
CA 02433041 2003-06-25
WO 02/053171 PCT/EPO1/15317
- 78 _
Since the three extracellular mediators, as well as the
IP3-mediated signal pathway, might also be able to
activate other signal cascades, an investigation was
carried out to determine whether stimulation of
adenylyl cyclase (AC) or protein kinase C (PKC) imitate
or influence the ATP-mediated electrophysiological
response.
Pretreating the HaCaT cells with the AC activator
forskolin (10 uM) for 3-10 min did not have any effect
either on the resting potential or the changes in
voltage which are observed after adding ATP (n=5).
While stimulating PKC with the phorbol ester PMA
(60 ng/ul) caused a slow depolarization to -32 ~ 2 mV,
it had no influence on the effect of ATP (n=4). While
inhibiting PKC with calphostin C (50 nM) in turn led to
a weak hyperpolarization to -58 ~ 3 mV, it had likewise
no effect on the ATP-mediated change in voltage.
Calcium-dependent potassium channels are possible
candidates which may be responsible for this marked and
long-lasting change, which has been demonstrated for
the first time, in the membrane potential following
stimulation with the signal molecules ATP, histamine
and bradykinin. In order to identify the ion channel
which was responsible for the hyperpolarization, an
investigation was carried out into the influence of
various K+ channel blockers on the ATP-mediated
electrophysiological effect. Charybdotoxin (ChTx;
Alomone Labs) caused a dose-dependent inhibition of the
ATP-mediated hyperpolarization. As Figure 2 A shows,
the addition of ChTx (10-100 nM, n=15) retarded
repolarization of the rapid depolarization and
prevented hyperpolarization. When ChTx was used at a
concentration of 100 nM (n=4), it completely prevented
repolarization and the membrane potential remained on a
depolarized plateau as long as ATP was added. The same
effect was observed with 1 uM clotrimazole (n=3; Figure
CA 02433041 2003-06-25
WO 02/053171 PCT/EPO1/15317
_ 7g _
2 B). If ChTx (100 nM) was added after the ATP-mediated
hyperpolarization had been measured, a complete
reversal of the hyperpolarization was observed even
though ATP was still present (n=2; Figure 2 C). None of
the other K+ channel blockers which were tested (TEA,
Ba2+ and verapamil) led to a comparable depolarization
on a plateau during treatment with ATP. Verapamil (10-
100 uM), which inhibits K+ flaws in terminally
differentiating keratinocytes (Mauro et al., 1997, J.
Invest. Derm., 108: 864-870), did not have any
influence on the hyperpolarizing effect of ATP
(hyperpolarization to -73 ~ 1 mV, n=3). K+ channels
which are inhibited by clotrimazole and charybdotoxin
are voltage-independent calcium-activated potassium
channels. In order to clarify the identity still
further, an investigation was carried out to determine
whether 1-EBIO, which is a specific activator of the
intermediate-conductance calcium-activated potassium
channel hIK1 (Syme et al., 2000, Am. J. Physiol.,
278: C570-581), is able to imitate ATP-mediated
hyperpolarization. As Figure 2 D shows, 1-EBIO (1 mM;
tocris) induced a rapid and powerful hyperpolarization
to -83 ~ 3 mV (n=3). If ATP (10 uM) was added in the
presence of 1-EBIO, the typical transient
depolarization was observed, with this depolarization
being much stronger, however, than under controlled
conditions (cf. Figure 1 A), something which can be
explained by the increased flow of chloride ions and
cations due to the increase in voltage across the
membrane. It was furthermore observed that a derivative
of 1-EBIO, i.e. DCEBIO (5,6-dichloro-1-ethyl-1,3-
dihydro-2H-benzimidazol-2-one) can elicit a depolar-
ization of the HaCaT cells which is 300-1000 times
stronger than that elicited by 1-EBIO. This result
shows that DCEBIO can be used at much lower
concentrations in order to achieve the same
electrophysiological effect as that achieved with
1-EBIO (approx. 300-1000 times less concentrated) and
CA 02433041 2003-06-25
WO 02/053171 PCT/EPO1/15317
- 80
is consequently a particularly preferred modulator of
the hIKl channel.
It was consequently possible, for the first time, to
detect hIK1 in keratinocytes and to demonstrate its
role in keratinocyte activity. This demonstrates that
the polypeptide hIKl and its encoding nucleic acids,
and also modulators of the channel, are suitable for
being used in diseases which are connected with
disturbed keratinocyte activity, in particular in wound
healing disturbances and/or psoriasis.
Example 2: Detecting the expression of hIKl in HaCaT
cells and differential regulation of hsk4 (=IK1) in
differentiating keratinocytes
In order to investigate whether the expression, as well
as the activity, of hIKl is regulated in keratinocytes,
a check was carried out to determine whether the
activity of the keratinocytes correlates to the
expression of hIKl.
For this, an analysis was carried out of proliferating
subconfluent cells, of cells which had just reached
confluence and of resting cells (4 days after
confluence). The activity of these keratinocytes was
determined using the differentiation-specific
expression of keratin 10. To do this, the cells were
washed in ice-cold PBS and fixed with acetone/methanol
(l: l) at -20°C for 20 min. Endogenous peroxidases were
blocked with to H202 at room temperature. After the
nonspecific binding sites had been saturated with 30
BSA in PBS, the cells were incubated overnight at 4°C
in a 1:500 dilution of mouse anti-K10 antibody (DAKO)
in 3% BSA in PBS and then washed three times with PBS
and once with 3o BSA in PBS. After a 2 h incubation at
room temperature with a peroxidase-coupled anti-mouse
antibody, the cells were washed three times with PBS
CA 02433041 2003-06-25
WO 02/053171 PCT/EPO1/15317
- 81
and once with ddH20. The cells were then stained using
the peroxidase substrate kit and 3-amino-9-
ethylcarbazole as the chromogenic substrate (Vector
Laboratories). Whereas the proliferating cells, and the
cells which had just reached confluence, did not
exhibit any staining, it was found that the majority of
the postconfluent cells were stained (Figure 3). The
expression of the differentiation-specific keratin 10
gene showed that the majority of the resting cells
consisted of partially differentiated cells (Fuchs,
1988, Trends Genet. 4: 277-281; Ryle et al., 1989,
Differentiation, 40: 42-54).
Standard methods were used to isolate RNA from
proliferating, confluent and postconfluent cells which
had been grown in parallel (Chomczynski and Sacchi,
1987, Anal. Biochem. 62: 156-159), and an RNAse
protection assay was carried out for detecting hIKl
(Werner et al., 1992, Proc. Natl. Acad. Sci. USA
89: 6896-6900).
In brief: a PCR-amplified gene fragment was cloned into
the transcription vector pBluescript KSII (+)
(Stratagene) and the plasmid was linearized. An
antisense transcript was then prepared in vitro using
T3 or T7 polymerase and 32P-UTP (800 Ci/mol). In each
case, 20 ug of RNA were hybridized overnight at 42°C
with 100 000 cpm of labeled antisense transcript. 20 ~g
of tRNA were used as the negative control. The hybrids
were then digested at 30°C for 1 h with RNAse and RNAse
T1. The protected fragments were fractionated on 50
acrylamide/8 M urea gels and analyzed by
autoradiography. A riboprobe (SEQ ID No. 5) which was
complementary to nucleotides 740-1004 of the human hIKl
gene was used for detecting hIKl. The result of the
experiment is shown in Figure 4. It was observed that
hIKl is strongly expressed in proliferating (lane '1')
and just confluent cells (lane '2') whereas the
CA 02433041 2003-06-25
WO 02/053171 PCT/EPOl/15317
- 82
quantity was significantly reduced in postconfluent,
partially differentiated cells (lane '3'). No signal
was observed in the case of the negative control
('tRNA' lane). 1000 cpm of the hybridization probe were
loaded, as a control for the radioactive label and as a
size standard, in the 'probe' lane. The results, which
were repeated three times using RNAs from independent
experiments, therefore show that the onset of
differentiation in HaCaT keratinocytes is accompanied
by a reduction in hIKl mRNA and there is consequently a
connection between keratinocyte activity and hIKl
expression.
Example 3: Differential expression of mIKl in mouse
wounds
The skin is a highly complex system whose cell
composition is subjected, for example during a disease,
to spatial and chronological changes. Moreover, the
activities of the cells change, for example as a result
of interaction with other cells. Processes in the skin
can therefore only be inadequately imitated by simple
cell systems. In order to confirm that IK1 plays an
important role in regulating cell activities in
physiological processes in the skin as well as in cell
culture, the expression of murine mIKl (SEQ ID No. 2)
was monitored in biopsies of punch wounds taking wound
healing, and various wound healing states, as the
example. The investigation was effected by means of
TaqMan analysis in an Applied Biosystems GeneAmp 5700.
Normally healing day 1 wounds and intact skin were
obtained from isotonic sodium chloride solution-treated
10-week-old BALB/c mice by cutting with scissors. In
order to obtain tissue from mice possessing poorly
healing wounds, BALB/c mice were treated with
dexamethasone (0.5 mg of dexamethasone in isotonic salt
solution per kg of body weight i.p. twice daily for 5
days) prior to the wounding. The control employed was
CA 02433041 2003-06-25
WO 02j053171 PCT/EPO1/15317
- 83
intact skin from mice which had been treated with
isotonic sodium chloride solution as described above.
In order to obtain tissue from young mice and old mice,
use was made of untreated day 1 wounds and intact skin
samples from 4-week-old and 12-month-old BALB/c mice.
Ti~lound tissue and intact skin from mice with diabetes
(db/db mouse) were obtained by isolating untreated day
1 wounds and intact skin from 10-week-old C57B/Ks
db/db/Ola mice by cutting with scissors. C57B/Ks wild-
type mice were used as control animals in this
experiment. Intact skin and untreated day 1 wounds were
also obtained from these latter animals.
The RNA was isolated by using a disperser to homogenize
the biopsies in RNAclean buffer (AGS, Heidelberg) to
which 1/100th part by volume of 2-mercaptoethanol had
been added. The RNA was then extracted by being
phenolized twice with water-saturated acidic phenol in
the presence of 1-bromo-3-chloropropane. An isopropanol
precipitation and an ethanol precipitation were then
carried out and the RNA was washed with 75o ethanol.
After that, the RNA was subjected to digestion with
DNase I. For this, 20 ug of RNA (to 50 u1 with DEPC-
treated water) were incubated, at 37°C for 20 min, with
5.7 u1 of transcription buffer (Roche), 1 u1 of RNase
inhibitor (Roche; 40 U/ul) and 1 u1 of DNase I (Roche;
10 U/~1). 1 u1 of DNase I was then added once again and
the mixture was incubated at 37°C for a further 20 min.
After that, the RNA was phenolized, precipitated with
ethanol and washed. All the steps enumerated above were
carried out with DEPC (diethylpyrocarbonate)-treated
solutions or liquids provided the latter did not
contain any reactive amino groups. cDNA was then
prepared from the extracted RNA. This took place in the
presence of 1x TaqMan RT buffer (PE Applied
Biosystems), 5.5 mM MgCl2 (PE Applied Biosystems), in
each case 500 uM dNTPs (PE Applied Biosystems), 2.5 ~M
random hexamers (PE Applied Biosystems), 1.25 U of
CA 02433041 2003-06-25
WO 02/053171 PCT/EPO1/15317
- 84
MultiScribe reverse transcriptase/ul (50 U/ul, PE
Applied Biosystems), 0.4 U of RNase inhibitor/ul
(20 U/ul, PE Applied Biosystems), 20 u1 of RNA
(50 ng/ul) and DEPC-treated water (to make up to a
volume of 100 u1). After the RNA had been added, and
after thorough mixing, the mixture was aliquoted into
2x 0.2 ml tubes (in each case 50 ~l) and the reverse
transcription was carried out in a temperature cycler
(10 min at 25°C; 30 min at 48°C and 5 min at 95°C).
The cDNA was subsequently quantified by means of
quantitative PCR using the 'SYBR-Green PCR Master Mix'
(PE Applied Biosystems) with a triple determination (in
each case using mIKl primers and GAPDH primers) being
carried out for determining the quantity of the mIKl
cDNA. The stock solution for each triplet contained, in
a total volume of 57 ~l, 37.5 u1 of 2x 'SYBR Master
Mix', 0.75 u1 of AmpErase UNG (1 U/~1) and 18.75 ~l of
DEPC-treated water. For each triplicate determination,
1.5 ~Z1 each of forward primer and backward primer (mIKl
primer 1 (SEQ ID No. 6) and mIK1 primer 2 (SEQ ID No.
7)) were added, in a previously optimized concentration
ratio, to 57 N1 of stock solution. In each case 60 u1
of the stock solution/primer mixture were mixed with
15 u1 of cDNA solution (2 ng/ul) and the whole was
aliquoted into 3 wells. In parallel with this, a stock
solution containing primers for determining GAPDH (SEQ
ID No. 12 and SEQ ID No. 13) was prepared as a
reference, mixed with a further 15 ~1 of the same cDNA
solution and aliquoted into 3 wells. In addition,
different cDNA solutions were prepared as a dilution
series in order to construct a standard curve for the
GAPDH PCR (4 ng/~1; 2 ng/ul; 1 ng/ul; 0.5 ng/ul and
0.25 ng/ul). In each case, 15 u1 volumes of these cDNA
solutions were mixed with 60 u1 of stock
solution/primer mixture for determining GAPDH and
aliquoted into 3 wells. A standard curve for the mIK1
PCR was constructed in the same way; the same dilutions
CA 02433041 2003-06-25
WO 02/053171 PCT/EPO1/15317
- 85
were used as those for the GAPDH standard curve. A PCR
mixture without cDNA served as the control. In each
case, 15 u1 of DEPC water were added to in each case
60 ~1 of mIKl and GAPDH stock solution/primer mixture
and the total mixture was in each case aliquoted into 3
wells. The assay mixtures were amplified in a GeneAmp
5700 (2 min at 50°C; 10 min at 95°C, followed by 3
cycles of 15 s at 96°C and 2 min at 60°C; after that 37
cycles of 15 s at 95°C and 1 min at 60°C).
The analysis was effected by determining the relative
abundance of mIKl in relation to the GAPDH reference.
To do this, a standard curve was first of all
constructed, with the CT values for the dilution series
being plotted against the logarithm of the quantity of
cDNA in the PCR assay mixture (in ng of transcribed
RNA) and the slope (s) of the straight lines being
determined. The efficiency (E) of the PCR is then given
as follows: E - 10-l~s - 1. The relative abundance (X)
of the mIKl cDNA species under investigation (Y) in
relatlOn t0 GAPDH 1S glen: X= ( 1+EGAPDH) CT~GAPDH) / ( 1+Ey) CT (Y) -
The numerical values were then standardized by making
the quantity of cDNA from the intact skin of 10-week-
old BALB/c control animals, or the intact skin of the
C57B/Ks control animals, equal to 1. The relative
changes in the expression of mIKl in various wound
healing states are compiled in Table 2. It turns out
that it was possible to observe an increase in mIKl
expression, as compared with the intact skin, in all
the wound healing states in the mouse. A striking
feature was that, while a marked upregulation, by a
factor of 3 and a factor of 4, respectively, was
measured in the control animal wound and the wound
which healed well in young mice, only a weak, and
nonsignificant, increase in expression was observed in
the wounds in old mice. A less marked increase in
expression as compared with control animals (factor,
2.2) was also observed in poorly healing,
CA 02433041 2003-06-25
WO 02/053171 PCT/EPO1/15317
- 86
dexamethasone-treated wounds. This underlines the fact
that, in murine wounds, wound healing is accompanied by
a marked increase in mIKl expression and that disturbed
keratinocyte activity, as can occur to an increased
extent in the wounds of older or dexamethasone-treated
animals, can be characterized by a decrease in mIKl
expression. In general, therefore, modulating,
preferably increasing, the expression and/or activity
of IK1 can be advantageous for treating or preventing
diseases which are connected with disturbed
keratinocyte activity.
In order to determine suitable time points for
diagnosing, preventing and/or treating a disease
connected with disturbed keratinocyte activity, the
expression of mIKl was determined in murine biopsies
taken at different time points in wound healing. In
this experiment, wound biopsies, and a biopsy of the
intact skin of 10-week-old control mice, were obtained
by cutting with scissors, as described above, at the
times of 1 h, 7 h, 15 h, 24 h, 3 days, 5 days, 7 days
and 14 days after wounding. The RNA was isolated from
the tissue and the relative quantity of mIKl in the
biopsies was determined. In this case, it turned out
that it was already possible to observe a marked
upregulation of mIKl expression at 7 h after wounding
(Table 3). The expression of mIK1 remained increased,
as compared with intact skin, up to the end of the
period of observation (day 14 after wounding),
indicating that regulation of mIKl expression over the
entire course of the wound healing is essential for the
wound healing to proceed optimally. This underlines the
particular suitability of IK1 channels for diagnosing,
preventing and/or treating diseases which are connected
with disturbed keratinocyte activity since a diagnosis
can be carried out, or the prevention and/or treatment
can be begun, at any time point.
CA 02433041 2003-06-25
WO 02/053171 PCT/EPO1/15317
_ 87 _
Example 4: Differential expression of hIKl in human
wounds
Mice have proved to be a suitable model system for
investigating wound healing in humans. Despite this,
the intention was to check whether it was also possible
to detect in humans a differential expression of the
nucleic acids which can be used in accordance with the
invention, which was observed in mice when wound
healing was taken as the example. To do this, 4 mm or
6 mm punches were used to take skin samples from the
untreated intact skin, from day 1 wounds or from day 5
wounds of healthy volunteers. The biopsies taken from
in each case 14 volunteers were pooled in the case of
each group (intact skin, day 1 wound and day 5 wound).
In addition, punch biopsies of the intact skin, and of
the bottom of the wound and the edge of the wound, were
taken simultaneously in patients suffering from chronic
venous ulcers (ulcera cruris venosum). The biopsies
from in each case 6 volunteers were pooled in the case
of each group (intact skin, wound edge and wound
bottom). The biopsies were comminuted using a ball mill
and, as described in Example 3, RNA was then isolated
from the comminuted biopsies, as described in Example
3, after which the RNA was digested with DNase I and
then transcribed into cDNA. Wound healing-relevant
cDNAs were also quantified as described in Example 3.
The results of the experiments are compiled in Table 4.
The amplification primers (hGAPDH primer
1: CATGGGTGTGAACCATGAGAAG (SEQ ID No. 10); hGAPDH
primer 2: CTAAGCAGTTGGTGGTGCAGG (SEQ ID No. 11), hIK1
primer l: GCGCTCTCAATCAAGTCCG (SEQ ID No. 8), hIK1
primer 2: GTGTTCATGTAA.AGCTTGGCCA (SEQ ID No. 9)) for
the analysis of hIKl were selected on the basis of the
known sequences of human GAPDH (GenBank: M17851) and
human hIKl (SEQ ID No. 1). For the quantification, cDNA
from 10 ng of reverse-transcribed total RNA were
amplified, per assay, in a total volume of 25 u1. The
CA 02433041 2003-06-25
WO 02/053171 PCT/EPO1/15317
_ 88 _
PCR was carried out in accordance with the
manufacturer's instructions (PE Applied Biosystems,
SYBR Green PCR and RT-PCR Reagents Protocol, 1998). The
CT values were analyzed and the frequency of hIK1 mRNA
relative to GAPDFI mRNA was calculated from them. The
results of the experiment are shown in Table 4. It was
found that the quantity of hIKl mRNA in human day 1
wounds was only slightly increased as compared with
intact skin while a decrease in expression of hIKl was
measured on day 5 after wounding, something which can
be the result, for example, of the increased
differentiation of the keratinocytes (see Example 2).
On the other hand, it is not possible to observe any
decrease in expression, as compared with intact skin,
in the bottom of the ulcer patient wound in which
keratinocyte activity is markedly disturbed. This
demonstrates that regulation of keratinocyte activity
is essential for avoiding diseases which are connected
with disturbed keratinocyte activity and that hIKl is
therefore a suitable therapeutic target. In general,
therefore, modulating, preferably increasing, the
expression and/or activity of IK1 can be advantageously
used for treating or preventing diseases which are
connected to disturbed keratinocyte activity.
Preferably, the expression of IKl should be increased
in wounds, in particular ulcers, of the skin.
Example 5: Localizina hIKl in different oraans
hIKl has already been shown to be expressed in
different human tissues (Ishii et al. 1997; Proc. Natl.
Acad. Sci. USA 94: 11651-11656; Joiner et al. 1997;
Proc. Natl. Acad. Sci. USA 94: 11013-11018;
WO 99/03882). It is noticeable that expression is
restricted to organs that are not electrically
excitable, such as placenta and prostate, while no
expression has been detected in the brain or in the
heart. This is reflected in the school of thought that
CA 02433041 2003-06-25
WO 02/053171 PCT/EPO1/15317
_ 89 _
expression of hIKl in humans is restricted to cells of
the blood and of the vascular system (WO 00/34248).
Because of the selective expression in non-excitable
organs, modulators of this channel are regarded as
being suitable medicaments for a large number of
diseases in a variety of administration forms since the
danger of cardiovascular complications is assumed to be
low. Despite the large number of publications which
deal with the localization of hIK1 in tissues or cells,
expression in the skin has not previously been
demonstrated either in humans or in another mammal.
In order to investigate whether, and in what quantity,
hIKl is expressed in the skin relative to other organs,
use was made of organ-specific total RNA pools which
were obtained from adult human donors (BioChain
Institute, Inc.): total kidney RNA was isolated from
5 donors, while total lung RNA was isolated from
5 donors, total fat tissue RNA from 4 donors, total
liver RNA from 5 donors, total brain RNA from 5 donors,
total heart RNA from 5 donors, total spleen RNA from 2
donors, total skeletal muscle RNA from 5 donors, and
total small intestine RNA from 5 donors, with these
total RNAs then being digested with DNAse I and pooled
separately according to organ. A TaqMan analysis was
then carried out, as described in Example 3, using the
total RNAs from these organs and total RNA from skin,
which was obtained as in Example 4, and the frequency
of hIKl mRNA relative to GAPDH mRNA was determined. The
relative quantities of hIKl mRNA in the organs are
shown in Table 5. It was surprisingly possible to
demonstrate, for the first time, that hIKl is expressed
in the skin. In addition, it was observed that hIKl is
expressed in the skin to a degree which is comparable
with that in the lung and spleen, for example. A
comparatively strong expression of hIKl had been
detected in the latter two organs (WO 99/03882). In
addition, it was surprisingly possible to demonstrate
CA 02433041 2003-06-25
WO 02/053171 PCT/EPO1/15317
- 90
that hIKl is expressed in brain, heart and skeletal
muscle. This result, which is contradictory to the
prior art, is probably due to the fact that the
sensitivity of the TaqMan analysis is higher than that
of the Northern blot analysis which was used in the
prior art. This experiment therefore highlights two
aspects of the present invention. On the one hand, the
expression hIKl is a prerequisite for being able to use
the hIKl gene, the protein, and modulators of its
activity, for diagnosing, preventing and/or treating
diseases which are connected with disturbed
keratinocyte activity. On the other hand, the
surprising demonstration of the expression of hIKl in
excitable organs shows that, contrary to the prevailing
opinion, it is probable that cardiovascular
complications will occur in association with oral
administration, for example. By contrast, the
prevention and/or treatment of diseases which are
connected with disturbed keratinocyte activity, in
particular wound healing disturbances and/or psoriasis,
are preferably to be treated topically, since this form
of administration ensures direct and specific contact
with the keratinocytes. The use of hIKl, its encoding
nucleic acids and/or modulators of its activity, is
therefore particularly advantageous when preventing
and/or treating these diseases.
Example 6: Both activation and inhibition of hIK1
activitv exert an influence on keratinocvte activitv
The intention now is to demonstrate that modulators of
the IK channel are able to regulate keratinocyte
activity.
The influence of modulators on differentiation was
investigated taking the hIKl activator 1-EBIO (Syme et
al., 2000, Am. J. Physiol., 278: C570-C581) as an
example. For this, HaCaT cells were grown for 2 days in
CA 02433041 2003-06-25
WO 02/053171 PCT/EPOlj15317
- 91
medium. 1 mM 1-EBIO (tocris) was then added to the
medium containing the proliferating, subconfluent cells
and the whole was incubated for 3 days. The
differentiation of the keratinocytes was then
investigated by immunostaining with a K10 antibody, as
shown in Example 2. It was found that the majority of
the control cells, to which no 1-EBIO had been added,
were partially differentiated, with this being
demonstrated by immunostaining using the anti-K10
antibody as in Example 2. The proportion of stained
cells was signficantly reduced in the case of cells
which were incubated in the presence of 1-EBIO.
These observations were confirmed by means of Western
blot analyses. For this, 5x105 HaCaT cells per well were
grown in medium in a 6-well plate. On the following
day, the medium was replaced with medium which
contained different concentrations of 1-EBIO or
2-amino-5-chlorobenzoxazole (zoxazolamine (Aldrich)).
to DMSO in medium was used as the solvent control (lane
'C'). The cells were incubated for 4 days, with the
medium being replaced daily. After 4 days, the protein
concentration in the cell lysates was determined (BCA
Assay, Pierce). Immunoblotting was then used to compare
equal quantities of protein from the different lysates
with the keratinocyte differentiation markers
involucrin (1:500, Sigma) and keratin 1 and 10 (1:250,
Progeny (Figure 6). It can be clearly seen that the two
hIKl activators, i.e. 1-EBIO and zoxazolamine, inhibit
differentiation, and consequently the keratinocyte
activity, of HaCaT cells in a dose-dependent manner.
The influence of activators of IKl on proliferation was
investigated using 1-EBIO and zolxazolamine (see
above). Firstly, the influence of different
concentrations of 1-EBIO on the growth rate of HaCaT
cells was measured in the presence and in the absence
of serum. For this purpose, 1x104 HaCaT cells per well
CA 02433041 2003-06-25
WO 02/053171 PCT/EPO1/15317
- 92
were cultured in keratinocyte growth medium (KGM) for
days in a 96-well plate, in order to synchronize the
cell cycle, with this being followed by a two-day
incubation in the presence of different concentrations
5 of 1-EBIO in KGM (see Figures 7 and 8) in the absence
(Figure 7) and in the presence (Figure 8) of serum.
KGM/l0o FCS was used as a positive control for
proliferation while the IK1 activator zoxazolamine was
used at a concentration of 1 mM as a comparison for the
1-EBIO effect. to DMSO in KGM served as the solvent
control. Cell proliferation was measured by the
incorporation of bromodideoxyuridine (BrDU) while cell
division was measured in accordance with the
manufacturer's instructions ('The Cell Proliferation
ELISA, BrDU, Roche). The incorporation of BrDU was
quantified by determining the absorption at 450 nm. In
Figures 7 and 8, the absorption (A[450 nm] ) is in each
case plotted on the Y axis as a measure of the
proliferation rate. Greater absorption reflects greater
proliferation. Comparison of the two IK1 activators 1-
EBIO and zoxazolamine between the serum-treated cells
and the untreated cells clearly shows that, in the
first place, the two activators are not on their own
able to stimulate cell proliferation (Figure 7). In
addition to this, both activators are able to inhibit
serum-induced proliferation and are consequently able
to modulate keratinocyte activity (Figure 8). In this
connection, it should be mentioned that the morphology
of the cells remains unaltered, i.e. the cells
'persist' in a resting state and there is no sign of
apoptosis. Figure 8 also shows that the inhibition
brought about by the hlKl activator 1-EBIO is dose-
dependent and shows its strongest effect at a
concentration of 1 mM.
In order to investigate the effect of the hIKl channel
inhibitors clotrimazole and charybdotoxin, either 10 uM
clotrimazole, 200 nM charybdotoxin (ChTx) or 1 mM
CA 02433041 2003-06-25
WO 02/053171 PCT/EPO1/15317
- 93
1-EBIO were/was added to cells which were growing
subconfluently and the number of cells per well was
determined daily.
As can be seen from Figure 5 (n=3), both the addition
of one of the two inhibitors and the addition of the
hIKl activator inhibited proliferation while the growth
of control cells, to which no modulators had been
added, remained unimpaired. The addition of
clotrimazole and 1-EBIO at the given concentration led
to complete inhibition; by contrast, growth which was
only retarded was observed when 200 nM charybdotoxin
were added.
The results of the experiment show that modulators of
the hIK1 channel affect both parameters of keratinocyte
activity, i.e. proliferation and differentiation,
simultaneously. Interestingly, this applies in the same
way both to activators and to inhibitors: addition
leads to inhibition of proliferation and
differentiation. This can be explained by the known
role of the ion channel in the cell cycle: presumably,
phases of both greater opening and of closing are
required for passing through a cell cycle.
Consequently, both prolonged activation and prolonged
inhibition of the activity of the ion channel would
lead to inhibition of proliferation, thereby
corresponding to the experimental observations. A
comparable effect on differentiation can be deduced in
an equivalent manner. The discovery of modulators which
inhibit both differentiation and proliferation of the
keratinocytes provides the possibility, for the first
time, of developing completely novel active compounds.
Modulating different activities of hIK1 can
consequently give rise to special, and completely new,
therapeutic possibilities for treating and/or
preventing diseases which are connected with disturbed
keratinocyte activity. Thus, modulating the activity of
CA 02433041 2003-06-25
WO 02/053171 PCT/EPOl/15317
- 94
hIKl, for example, is particularly advantageous
precisely for treating psoriasis, where the cause of
the disease is the result of a combination of cell
hyperproliferation and the reduced apoptosis of
differentiated cells. Particular preference is given to
derivatives of the modulators which can be employed at
lower concentration, for example DCEBIO (5,6-dichloro-
1-ethyl-1,3-dihydro-2H-benzimidazol-2-one), as dichloro
derivative of 1-EBIO. An increase in the quantity of
the IK channel is correspondingly preferred for
treating wound healing disturbances, where the aim is
to stimulate keratinocyte proliferation. This can be
effected, for example, by gene therapy using a gene-
therapy vector which contains a nucleic acid which
encodes an IK channel which can be used in accordance
with the invention.
It will be evident to the skilled person, that the
compositions and processes according to the invention
can be modified in many different ways. The intention
therefore is that the present invention should also
cover those changes and variations which come within
the protected scope of the claims and their
equivalents.
The priority application DE 100 65 475.4 was filed on
December 28, 2000 and the priority application
US 60!277,453 was filed on March 20, 2000. All the
publications which are cited here are hereby
incorporated in their entirety by reference.
CA 02433041 2003-06-25
WO 02/053171 PCT/EPO1/15317
- 95
Table 1
No. NAME Organism PROTEIN SEQ ID No. cDNA SEQ ID No.
l, hIK1 Homo trEMBL: 3 EMBL: 1
Sapiens 015554 AF000972
2. mIKl Mus trEMBL: 4 EMBL: 2
musculus 089109 AF042487
Table 2
Wound healing state Rel. quantity
of mIKl cDNA
Intact skin 1.00
Control animals
Wound 3.00
Control animals
Intact skin 1.20
Dexamethasone-treated animals
Wound 2.68
Dexamathasone-treated animals
Intact skin 0.52
Young animals
Wound 2.06
Young animals
Intact skin 1.45
Old animals
Wound 1.55
Old animals
Intact skin 1.00
Diabetes control animals (C57B/Ks)
Wound 2.45
Diabetes control animals (C57B/Ks)
Intact skin 0.41
Diabetes animals (C57B/Ks-db/db/Ola)
Wound 2.04
Diabetes animals (C57B/Ks-db/db/Ola)
CA 02433041 2003-06-25
WO 02/053171 PCT/EPOl/15317
- 96
Table 3
Time after wounding Rel. quantity of mIKl cDNA
Intact skin 1.00
1 h 1.03
7 h 1.71
15 h 2.24
24 h 1.86
3 d 2.71
d 2.59
7 d 2.43
14 d 2.24
Table 4
Biopsy Rel. quantity of hIKl cDNA
Patient pool 1: 1.00
Intact skin
Healthy patients
Patient pool 2: 1.32
Day 1 wound
Healthy patients
Patient pool 3: 0.64
Day 5 wound
Healthy patients
Patient pool 4: 0.83
Intact skin
Ulcer patients
Patient pool 4: 0.42
Wound edge
Ulcer patients
Patient pool 4: 0.81
Wound bottom
Ulcer patients
CA 02433041 2003-06-25
WO 02/053171 PCT/EPO1/15317
- 97
Table 5
Organ Rel. quantity of hIR cDNA
Skin 0.54
Kidney 0.41
Liver 0.23
Brain 0.39
Heart 0.36
Spleen 0.66
Skeletal muscle 0.28
Small intestine 0.56
Lung 0 . 5 8
Fat tissue 0.58
CA 02433041 2003-06-25
WO 02/053171 PCT/EP01/15317
- 1
SEQUENCE LISTING
<110> Switch Biotech AG
<120> Use of intermediate-conductance potassium channels and
modulators for diagnosing and treating diseases involving disturbed
keratinocyte activity
<130> 535154PC
<150> DE 10065475.4
<151> 2000-12-28
<150> DS 601277,453
<I51> 2000-03-20
<160> 13
<170> Word 97, PC-DOS/MS-DOS
<210> 1
<211> 1284
<212> Dt3A
<213> Homo Sapiens
<220>
<223> hlKl
<300>
<308> EMBL database: ~pp0972
<400> 1
atgggcgggg atctggtgct tggcctgggg gccttgagac gccgaaagcg cttgctggag 60
caggagaagt ctctggccgg ctgggcactg gtgctggcag gaactggcat tggactcatg 120
gtgctgcatg cagagatgct gtggttcggg gggtgctcgt gggcgctcta cctgttcctg 180
gttaaatgca cgatcagcat ttccaccttc ttactcctct gcctcatcgt gqcctttcat 240
gccaaagagg tccagctgtt catgaccgac aacgggctgc gggactggcg cgtggcgctg 300
accgggcggc aggcggcgca gatcgtgctg gagctggtgg tgtgtgggct gcacccggcg 360
ccagtgcggg gcccgccgtg cgtgcaggat ttaggggcgc cgctgacctc cccgcagccc 420
tggccgggat tcctgggcca aggggaagcg ctgctgtccc tggccatgct gctgcgtctc 480
tacctggtgc cccgcgccgt gctcctgcgc agcggcgtcc tgctcaacgc ttcctaccgc 540
agcatcggcg ctctcaatca agtccgcttc cgccactggt tcgtggccaa gctttacatg 600
aacacgcacc ctggccgcct gctgctcggc ctcacgcttg gcctctggct gaccaccgcc 660
tgggtgctgt ccgtggccga gaggcaggct gttaatgcca ctgggcacct ttcagacaca 720
ctttggctga tccccatcac attcctgacc atcggctatg gtgacgtggt gccgggcacc 780
atgtggggca agatcgtctg cctgtgcact ggagtcatgg qtgtctqctg cacagccctg 840
ctggtggccg tggtggeccg gaagctggag tttaacaagg cagagaagca cgtgcacaac 900
CA 02433041 2003-06-25
WO 02/053171 PCT/EPO1/15317
- 2
ttcatgatgg atatccagta taccaaagag atgaaggagt ccgctgcccg agtgctacaa 960
gaagcctgga tgttctacaa acatactcgc aggaaggagt ctcatgctgc ccgcaggcat 1020
cagcgcaagc tgctggccgc catcaacgeg ttccgccagg tgcggctgaa acaccggaag 1080
ctccgggaac aagtgaactc catggtggac atctccaaga tgcacatgat cctgtatgac 1140
ctgcagcaga atctgagcag ctcacaccgg gecctggaga aacagattga cacgctggcg 1200
gggaagctgg atgccctgac tgagctgctt agcactgccc tggggccgag gcagcttcca 1260
gaacccagcc agcagtccaa gtag 1284
<210> 2
<211> 1469
<212> DtJA
<213> Mus musculus
<220>
<223> mIKl
<300>
<308> EMBL database: AF042487
<400> 2
ctgggcagga agctggctga gccccaagac ctcaggggcc atgggcgggg agctggtgac 60
tggcctgggg gccctgagac ggagaaagcg cctgctggag caggagaaga gggtggccgg 120
ctgggcgttg gtgctggcgg gaactggcat cggactcatg gttctgcacg ctgagatgtt 180
gtggttcctg ggctgcaagt gggtgctgta cctgctcctg gttaagtgtt tgatcaccct 240
gtccactgcc ttcctccttt gtcttattgt ggtcttccat gccaaggagg tccagctgtt 300
catgactgac aacgggctcc gggactggcg cgtggcgetg acccggcggc aggtggcgca 360
gatcctgctg gagctgttgg tgtgcggggt gcacccggtg cccctacgga gcccgcactg 420
cgccctggcg ggggaggcca ccgacgcgca gccctggccg ggtttcctgg gcgaaggcga 480
ggcgttgctg tccctggcca tgctcctgcg tctctacctg gtgccccgcg cggtgctgct 540
gcgcagcggg gtcctgctca acgcgtccta ccgcagcatc gggqcgctca accaagtccg 600
cttccgccac tggttcgtgg ccaagctgta catgaacacg cacccgggtc gcctgctgct 660
gggcctcacg ctgggtctct ggctcaccac agcttggqtg ctgtctgtgg ctgagaggca 720
ggctgtcaat gccacggggc acctcacaga cacactgtgg ctgattccga tcacattcct 780
gaccattggc tatggggacg tggtacctgq caccatgtgg ggcaagattg tctgcctgtg 840
caccggagtc atgggggtct gctgcacagc tctcctggtg gctgtggtgg ctcggaagct 900
ggagttcaac aaggcggaga aacacgtgca caacttcatg atggacatcc attatgccaa 960
agagatgaag gagtcagcgg cgcggctgct gcaggaagcc tggatgtact acaagcacac 1020
tcgaaggaag gactcccggg ctgcccgcag acatcagcgc aagatgctgg ccgccatcca 1080
cacgttccgc caggtacggc tgaaacaccg gaagctccgg gaacaagtga attccatggt 1140
ggacatctcc aagatgcaca tgatcetgtg cgacctgcag ctgggtctca gctcctcgca 1200
ccgtgccctg gagaagagaa tcgacggtct ggcaggaaag ctggatgccc tgacagagct 1260
gctcggcact gctctgcagc aacagcagct accagaaccc agtcaggagg ccacatagct 1320
ccacatgaac tcacagaaga accaggctaa gtacccaagg accgagctca aggacatgct 1380
ccctgccaat tccgaccaag ccccacgata aatcacctca agatgccagg acccaagtgg 1940
atccacgttg aggtgcatgg actctggtg 1469
CA 02433041 2003-06-25
WO 02/053171 PCT/EPO1/15317
- 3
<210> 3
<2I1> 427
<212> PRT
<213> Homo Sapiens
<220>
<223> hTKl
<300>
<308> ~trEMBL database: p15554
<400> 3
Met Giy Gly Asp Leu Val Leu Gly Leu Gly 10
Ala Leu Arg Arg Arg Lys Arg Leu Leu Glu 20
Gln Glu Lys Ser Leu Ala Gly Trp Ala Leu 3p
Val Leu Ala Giy Thr Gly Ile Gly Leu Met 40
Val Leu His Ala Glu Met Leu Trp Phe Gly 50
Gly Cys Ser Trp Ala Leu Tyr Leu Phe Leu 60
Vai Lys Cys Thr Ile Ser Ile Ser Thr phe 70
Leu Leu Leu Cys Leu Ile Val Ala Phe His 80
Ala Lys Glu Val Gln Leu Phe Met Thr Asp g0
Asn Gly Leu Arg Asp Trp Arg Val Ala Leu 100
Thr GIy Arg Gln Ala Ala GIn Ile Val Leu IIO
Glu Leu Val Val Cys Gly Leu His Pro Ala 120
Pro Val Arg Gly pro pro Cys val Gln Asp I30
Leu Gly AIa Pro Leu Thr Ser Pro Gln Pro 140
Trp Pro Gly Phe Leu Gly Gln Gly GIu Ala 150
Leu Leu Ser Leu Ala Met Leu Leu Arg Leu 160
Tyr Leu Val Pro Arg Ala Val Leu Leu Arg 170
Sex Gly Val Leu Leu Asn Ala Ser Tyr Arg I80
Ser Ile Gly Ala Leu Asn Gln Val Arg Phe I90
Arg His Trp Phe Val Ala Lys Leu Tyr Met 200
Asn Thr His Pro Gly Arg Leu Leu Leu Gly 210
Leu Thr Leu Gly Leu Trp Leu Thr Thr Ala 220
Trp VaI Leu Ser Val Ala Glu Arg Gln Ala 230
Val Asn Ala Thr Gly His Leu Ser Asp Thr 240
Leu Trp Leu Ile Pro Ile Thr Phe Leu Thr 250
Ile Gly Tyr Gly Asp Val Vai Pro Gly Thr 260
Met Trp Gly Lys Ile Val Cys Leu Gys Thr 270
Gly Val Met GIy Val Cys Cys Thr Ala Leu 280
Leu Val Ala Val Val Ala Arg Lys Leu Glu 290
Phe Asn Lys Ala Glu Lys His Val His Asn 300
Phe Met Met Asp Ile Gln Tyr Thr Lys Glu 310
Met Lys Glu Ser Ala Ala Arg Val Leu Gln 320
Giu Ala Trp Met Phe Tyr Lys His Thr Arg 330
~'g Lys Glu Ser His Ala Ala Arg Arg His 340
Gln ~g LYs Leu Leu Ala Ala Ile Asn Ala 350
Phe Arg Gln Val Arg Leu Lys His Arg Lys 360
CA 02433041 2003-06-25
WO 02/053171 PCT/EPO1/15317
- 4
Leu Arg Glu Gln Val Asn Ser Met Val Asp 370
Ile Ser Lys Met His Met Ile Leu Tyr Asp 380
Leu Gln Gln Asn Leu Ser Ser Ser His Arg 390
Ala Leu Glu Lys Gln Ile Asp Thr Leu Ala 400
Gly Lys Leu Asp Ala Leu Thr Glu Leu Leu 910
Ser Thr Ala Leu Gly Pro Arg Gln Leu Pro 420
Glu Fro Ser Gln Gln Ser Lys 427
<210> 4
<211> 925
<212> PRT
<213> Mus musculus
<220>
<223> mIKI
<304>
<308> trEMBL database: pgglpg
<400> 9
Met Gly Gly Glu Leu Val Thr Gly Leu Gly 10
Ala Leu Arg Arg Arg Lys Arg Leu Leu Glu 20
Gln Glu Lys Arg Val Ala Gly Trp Ala Leu 30
Val Leu Ala Gly Thr Gly Ile Gly Leu Met 40
Val Leu His Ala Glu Met Leu Trp Phe Leu 50
Gly Cys Lys Trp Val Leu Tyr Leu Leu Leu 60
Val Lys Cys Leu Ile Thr Leu Ser Thr Aia 70
Phe Leu Leu Cys Leu Ile Val Val Phe His 80
Ala Lys Glu Val Gln Leu Phe Met Thr Asp 90
Asn Gly Leu Arg Asp Trp Arg Val Ala Leu 100
Thr Arg Arg Gln Val Ala Gln Ile Leu Leu 110
Glu Leu Leu Val Cys Gly Val His Pra Val 120
Pro Leu Arg Ser Pro His Cys Ala Leu Ala 130
Gly Glu Ala Thr Asp Ala Gln Pro Trp Pro 190
Gly Phe Leu Gly Glu Gly Glu Ala Leu Leu 150
Ser Leu Ala Met Leu Leu Arg Leu Tyr Leu 160
Val Pro Arg Ala Val Leu Leu Arg Ser Gly 1'70
Val Leu Leu Asn Ala Ser Tyr Arg Ser Ile 180
Gly Ala Leu Asn Gln Val Arg Phe Arg His 190
Trp Phe Val Ala Lys Leu Tyr Met Asn Thr 200
His Pro Gly Arg Leu Leu Leu Gly Leu Thr 2I0
Leu Gly Leu Trp Leu Thr Thr Ala Trp Val 220
Leu Ser Val Ala Glu Arg Gln Ala Val Asn 230
Ala Thr Gly His Leu Thr Asp Thr Leu Trp 290
Leu Ile Pro Ile Thr Phe Leu Thr Ile Gly 250
Tyr Gly Asp Val Val Pro Gly Thr Met Trp 260
Gly Lys Ile Val Cys Leu Cys Thr Gly Val 270
CA 02433041 2003-06-25
WO 02/053171 PCT/EPO1/15317
- 5 -
Met Gly Val Cys Cys Thr Ala Leu Leu Val 280
Ala Val Val Ala Arg Lys Leu Glu Phe Asn 290
Lys Ala GIu Lys His Val His Asn Phe Met 300
Met Asg Ile His Tyr Ala Lys Glu Met L~rs 310
Glu Ser Ala Ala Arg Leu Leu GIn Glu Ala 320
Trp Met Tyr Tyr Lys His Thr Arg Arg Lys 330
Asp Ser Arg Ala Al.a Arg Arg His Gln Arg 340
Lys Met Leu Ala Ala Ile His Thr Phe Arg 350
Gln Val Arg Leu Lys His Arg Lys Leu Arg 360
Glu Gln Val Asn Ser Met Val Asp Iie Sex 370
Lys Met His Met IIe Leu Cys Asp Leu G1n 380
Leu G1y Leu Ser Ser Ser His Arg Ala Leu 390
Glu Lys Arg Ile Asp Gly Leu Ala Gly Lys 400
Leu Asp Ata Leu Thr Glu Leu Leu Gly fihr 410
A3.aLeu Gln Gln Gln Gln Leu Pro Glu Pro 420
Sex Gln Glu Ala fihr 425
<210> 5
<211> 265
<212> PRT
<213> Homo Sapiens
<220>
<223> hlKl riboprobe
<400> 5
cattcctgac catcggctat ggtgacgtgg tgccgggcac catgtggggc aagatcgtct 60
gcctgtgcac tggagtcatg ggtgtctgct gcacagccct gctggtggcc gtggtggccc 120
ggaagctgga gtttaacaag gcagagaagc acgtgcacaa cttcatgatg gatatccagt 180
ataecaaaga gatgaaggag tccgctgccc gagtgctaca agaagcctgg atgttctaca 240
aacatactcg caggaaggag tctca 265
<210> 6
<211> 16
<212> bNA
<213> Mus musculus
<220>
<223> mlKl primer 1
<400> 6
CTGGCGGGAA CTGGCA 16
<210> 7
CA 02433041 2003-06-25
WO 02/053171 PCT/EPO1/15317
- 6
<211> 17
<212> DNA
<213> Mus musculus
<220>
<223> ~IKl primer 2
<400> 7
CACCCACTTG CAGCCCA 17
<210> 8
<211> 19
<212> DNA
<213> Homo Sapiens
<220>
<223> hlKl primer 1
<400> 8
GCGCTCTCAA TCAAGTCCG 19
<210> 9
<211> 22
<212> DNA
<2i3> Homo Sapiens
<220>
<223> hlKl primer 2
<400> 9
GTGTTCATGT AAAGCTTGGC CA 22
<210> 10
<211> 22
<212> DNA
<213> Homo Sapiens
<220>
<223> hGAPDH primer 1
<400> 10
CATGGGTGTG AACCATGAGA AG 22
CA 02433041 2003-06-25
WO 02/053171
PCT/EPO1/15317
<210>11
t<211>21
<212>DNA
<213>Homo sapi.ens
<220>
<223> hGAPDH primer 2
<400> I1
CTAAGCAGTT GGTGGTGCAG G 21
<210>12
<211>1g
<212>DNA
<213>Mus musculus
<220>
<223> murine GAPDH primer 1
<40(~> 12
atcaacggga agcccatca 1g
<210>13
<211>20
<212>I3NA
<213>Mus musculus
<220>
<223> murine GAPDH primer 2
<400> 13
GACATACTCA GCACCGGCCT 20
<212> PRT
<213> Homo Sapiens
<220>
<223> hlKl ribo
