Note: Descriptions are shown in the official language in which they were submitted.
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
1
BUTYRYI~CHOI~INESTERASE POI~YPEPTIDE VARIANTS WITH
INCREASED CATALYTIC EFFICIENCY AND METHODS OF USE
This invention was made with government support
under grant number 1801 DA011707 awarded by the National
Institutes of Health. The United States Government has
certain rights in this invention.
BACKGROUND OF THE INVENTION
The present invention relates generally to the
fields of computational chemistry and molecular modeling
and, more specifically, to butyrylcholinesterase
polypeptide variants with increased catalytic efficiency.
Cocaine abuse is a significant social and
medical problem in the United States as evidenced by the
estimated 3.6 million chronic users. Cocaine abuse often
leads to long-term dependency as well as life-threatening
overdoses. However, no effective antagonist is currently
available that combats the reinforcing and toxic effects
of cocaine.
One difficulty in identifying an antagonist to
treat cocaine abuse arises largely from the narcotic's
mechanism of action. Specifically, cocaine inhibits the
re-uptake of neurotransmitters resulting in over-
stimulation of the reward pathway. It is this over-
stimulation that is proposed to be the basis of cocaine's
reinforcing effect. In addition, at higher
concentrations, cocaine interacts with multiple receptors
in both the central nervous and cardiovascular systems,
leading to toxicities associated with overdose. Because
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
2
of this multifarious mechanism of action of cocaine, it
is difficult to identify selective antagonists to treat
both the reinforcing and toxic effects of cocaine.
Additionally, antagonists that block cocaine's binding to
its receptors tend to display many of the same
deleterious effects as cocaine.
Recently, alternative treatment strategies
based on intercepting and neutralizing cocaine in the
bloodstream have been proposed. For example, dopamine
D1, D2, and D3 antagonists affect the reinforcing potency
of cocaine in the rat model, these antagonists display a
narrow range of effective doses and the extent of
decrease in cocaine potency is quite small. In addition,
these dopamine antagonists produce profound decreases in
other behaviors when the doses are increased only
slightly above the levels that display an effect on
cocaine self-administration behavior.
A separate treatment strategy involves partial
protection against the effects of cocaine using antibody-
based approaches. Limitations of immunisation approaches
include the stoichiometric depletion of the antibody
following the binding of cocaine. The use of a catalytic
antibody, which metabolizes cocaine in the bloodstream,
partially mitigates this problem by degrading and
releasing cocaine, permitting binding of additional
cocaine. However, the best catalytic antibody identified
to date metabolizes cocaine significantly slower than
endogenous human serum esterases.
In vivo, cocaine is metabolized by three
principal routes: 1) N-demethylation in the liver to form
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
3
norcocaine, 2) hydrolysis by serum and liver esterases to
form ecgonine methyl ester, and 3) nonenzymatic
hydrolysis to form benzoylecgonine. In humans,
norcocaine is a minor metabolite, while benzoylecgonine
and ecgonine methyl ester account for about 90% of a
given dose. The metabolites of cocaine are rapidly
cleared and appear not to display the toxic or
reinforcing effects of cocaine. Low serum levels of
butyrylcholinesterase have been correlated with adverse
physiological events following cocaine overdose,
providing further evidence that butyrylcholinesterase
accounts for the cocaine hydrolysis activity observed in
plasma. Human plasma obtained from individuals with a
defective version of the butyrylcholinesterase gene has
been shown to have little or no ability to hydrolyze
cocaine in vitro, and the hydrolysis of cocaine in plasma
of individuals carrying one defective and one wild type
copy of the butyrylcholinesterase gene has been shown to
proceed at one-half the normal rate. Therefore, it has
been suggested that individuals with defective versions
of the butyrylcholinesterase gene are at higher risk for
life-threatening reactions to cocaine. Recently,
administration of butyrylcholinesterase has been
demonstrated to confer limited protection against cocaine
overdose in mice and rats.
Although administration of
butyrylcholinesterase provides some effect against
cocaine toxicity in vivo, it is not an efficient catalyst
of cocaine hydrolysis. The low cocaine hydrolysis
activity of wild-type butyrylcholinesterase requires the
use of prohibitively large quantities of purified enzyme
for therapy.
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
4
A number of naturally occurring human
butyrylcholinesterases as well as species variations are
known, none of which exhibits increased cocaine
hydrolysis activity. Similarly, although a variety of
recombinantly prepared butyrylcholinesterase mutations
have been tested for increased cocaine hydrolysis
activity, only one such mutant, termed A328Y, has been
identified that exhibits increased cocaine hydrolysis
activity. Further butyrylcholinesterase mutations that
lead to increased cocaine hydrolysis activity need to be
identified to permit clinical evaluation of
butyrylcholinesterase.
Thus, there exists a need for recombinant
butyrylcholinesterase polypeptides capable of hydrolyzing
cocaine significantly more efficiently than wild-type
butyrylcholinesterase. The present invention satisfies
this need and provides related advantages as well.
SUD~IARY OF THE INVENTION
This invention is directed to twenty-five
butyrylcholinesyterase variant polypeptides having
increased cocaine hydrolysis activity compared to
naturally occurring human butyrylcholinesterase, as well
as to their encoding nucleic acids. The invention also
provides libraries comprising butyrylcholinesterase
variants having at least one amino acid alteration in one
or more regions of butyrylcholinesterase and further
having at least one butyrylcholinesterase variant
exhibiting enhanced cocaine hydrolysis activity compared
to butyrylcholinesterase. The invention further is
directed to methods of hydrolyzing a cocaine-based
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
butyrylcholinesterase substrate and to methods of
treating a cocaine-induced condition.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 shows the (A) nucleic acid sequence
5 designated SEQ ID N0: 53 and (B) the deduced amino acid
sequence of the butyrylcholinesterase variant designated
SEQ ID N0: 52.
Figure 2 shows the amino acid sequence of human
butyrylcholinesterase (SEQ ID NO: 44).
Figure 3 shows the nucleic acid sequence of
human butyrylcholinesterase (SEQ ID NO: 43).
Figure 4 shows an amino acid sequence alignment
of human wild-type (SEQ ID N0: 44), human A variant (SEQ
ID N0: 45), human J variant (SEQ ID NO: 46), human K
variant (SEQ ID NO: 47), horse (SEQ ID N0: 48), cat (SEQ
ID N0: 49) and rat butyrylcholinesterase variants (SEQ ID
N0: 50) .
Figure 5 shows (A) the correlation between the
HPZC assay and the isotope tracer assay as demonstrated
by plotting the quantitiation of benzoic acid formation
by both methods, and (B) the Km for cocaine hydrolysis
activity of horse butyrylcholinesterase using the
Zineweaver-Burk double-reciprocal plot.
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
6
Figure 6 shows solid phase immobilization of
wild-type (filled circles) and truncated (open circles)
butyrylcholinesterase for measuring cocaine hydrolysis
activity.
Figure 7 shows the use of multiple synthesis
columns and colon-based mutagenesis for the synthesis of
focused libraries.
Figure 8 shows alignment of amino acid and
nucleic acid sequences for all butyrylcholinesterase
variant alterations in their respective regions of human
butyrylcholinesterase.
DETAINED DESCRIPTION OF THE INVENTION
This invention is directed to twenty-five
butyrylcholinesyterase variant polypeptides having
increased cocaine hydrolysis activity compared to
naturally occurring human butyrylcholinesterase, as well
as to their encoding nucleic acids.
The invention also is directed to methods of
hydrolyzing a cocaine-based butyrylcholinesterase
substrate and to methods of treating a cocaine-induced
condition. In this embodiment, the invention provides a
method of treating an individual suffering from symptoms
due to cocaine toxicity including grand-mal seizures,
cardiac arrest, stroke, and drug-induced psychosis
accompanied by elevated blood pressure. The
butyrylcholinesterase variants of the invention hold
significant clinical value because of their capability to
hydrolyze cocaine at a higher rate than any of the known
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
7
naturally occurring variants. It is this increase in
cocaine hydrolysis activity that enables,a much more
rapid response to the life-threatening symptoms of
cocaine toxicity that sets the butyrylcholinesterase
variants of the invention apart from other treatment
options.
The invention also provides libraries of
butyrylcholinesterase variants as well as of nucleic
acids encoding butyrylcholinesterase variants. The
butyrylcholinesterase variant libraries of the invention
have one or more amino acid alterations in regions
determined to be important for cocaine hydrolysis
activity. Therefore, the invention provides libraries
that can be screened for butyrylcholinesterase variants
exhibiting increased cocaine hydrolysis activity.
Cholinesterases are ubiquitous, polymorphic
carboxylase Type B enzymes capable of hydrolyzing the
neurotransmitter acetylcholine and numerous ester-
containing compounds. Two major cholinesterases are
acetylcholinesterase and butyrylcholinesterase.
Butyrylcholinesterase catalyzes the hydrolysis of a
number of choline esters as shown:
BChE
Acetylcholine + H20 -----> Choline + Corresponding Acid
Butyrylcholinesterase preferentially uses butyrylcholine
and benzoylcholine as substrates. Butyrylcholinesterase
is found in mammalian blood plasma, liver, pancreas,
intestinal mucosa and the white matter of the central
nervous system. The human gene encoding
butyrylcholinesterase is located on chromosome 3 and over
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
8
thirty naturally occuring genetic variations of
butyrylcholinesterase are known. The
butyrylcholinesterase polypeptide is 574 amino acids in
length and encoded by 1,722 base pairs of coding
sequence. Three naturally occuring butyrylcholinesterase
variations are the atypical alleles referred to as A
variant (SEQ ID N0: 45), the J variant (SEQ ID N0: 46)
and the K variant (SEQ ID N0: 47), which are aligned in
Figure 4. The A variant has an D70G mutation and is rare
(0.5o allelic frequency), while the J variant has a E497V
mutation and has only been found in one family. The K
variant has a point mutation at nucleotide 1615, which
results in an A539T mutation and has an allelic frequency
of around 12o in Caucasians.
In addition to the naturally-occurring human
variations of butyrylcholinesterase, a number of species
variations are known. The amino acid sequence of cat
butyrylcholinesterase is 88o identical with human
butyrylcholinesterase (see Figure 4). Of the seventy
amino acids that differ, three are located in the active
site gorge and are termed A277L, P285L and F398I.
Similarly, horse butyrylcholinesterase has three amino
acid differences in the active site compared with human
butyrylcholinesterase, which are A277V, P285L and F398I
(see Figure 4). The amino acid sequence of rat
butyrylcholinesterase contains 6 amino acid differences
in the active site gorge, which are A277K, V280L, T284S,
P285I, L286R and V288I (see Figure 4).
Naturally occurring human butyrylcholinesterase
variations, species variations as well as recombinantly
prepared mutations have previously been described by Xie
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
9
et al., Molecular Pharmacoloay 55:83-91 (1999).
Recombinant human butyrylcholinesterase mutants that have
been tested for increased cocaine hydrolysis activity
include mutants with the following single or multiple
changes: N68Y/Q119/A277W, Q119/V288F/A328Y, Q119Y, E19'7Q,
V288F, A328F, A328Y, F329A arid F329S. Out of these
mutants, the only butyrylcholinesterase mutant identified
that exhibits increased cocaine hydrolysis activity is
the A328Y mutant, which has a Tyrosine (Y) rather than an
Alanine (A) at amino acid position 328 and exhibits a
four-fold increase in cocaine hydrolysis activity
compared to human butyrylcholinesterase (Xie et al.,
supra, 1999) .
The invention provides butyrylcholinesterase
variant polypeptides encompassing the same or
substantially the same amino acid sequence as shown as
SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24,
26, 28, 30, 32, 34, 36, 38, 40, 42, 52, 54, 56 and 58,
and functional fragments of butyrylcholinesterase variant
polypeptides encompassing the same or substantially the
same amino acid sequence as shown as SEQ ID NOS: 2, 4, 6,
8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34,
36, 38, 40, 42, 52, 54, 56 and 58.
The butyrylcholinesterase variant polypeptide
encompassing the same or substantially the same amino
acid sequence as shown as SEQ ID NO: 2, or functional
fragment thereof, has a twenty-four-fold increase in
cocaine hydrolysis activity relative to
butyrylcholinesterase. The butyrylcholinesterase variant
polypeptide encompassing the same or substantially the
same amino acid sequence shown as SEQ ID N0: 4, or
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
functional fragment thereof, has a ten-fold increase in
cocaine hydrolysis activity relative to
butyrylcholinesterase. The butyrylcholinesterase variant
polypeptide encompassing the same or substantially the
5 same amino acid sequence shown as SEQ ID N0: 6, or
functional fragment thereof, has a sixteen-fold increase
in cocaine hydrolysis activity relative to
butyrylcholinesterase. The butyrylcholinesterase variant
polypeptide encompassing the same or substantially the
10 same amino acid sequence shown as SEQ ID N0: 8, or
functional fragment thereof, has a eight-fold inorease in
cocaine hydrolysis activity relative to
butyrylcholinesterase. The butyrylcholinesterase variant
polypeptide encompassing the same or substantially the
same amino acid sequence shown as SEQ ID N0: 10, or
functional fragment thereof, has a one-hundred-fold
increase in cocaine hydrolysis activity relative to
butyrylcholinesterase. The butyrylcholinesterase variant
polypeptide encompassing the same or substantially the
same amino acid sequence shown as SEQ ID NO: 12, or
functional fragment thereof, has a one-hundred-fold in
cocaine hydrolysis activity relative to
butyrylcholinesterase. The butyrylcholinesterase variant
polypeptide encompassing the same or substantially the
same amino acid sequence shown as SEQ ID N0: 14, or
functional fragment thereof, has a ninety-seven-fold in
cocaine hydrolysis activity relative to
butyrylcholinesterase. The butyrylcholinesterase variant
polypeptide encompassing the same or substantially the
same amino acid sequence shown as SEQ ID N0: 16, or
functional fragment thereof, has a ninety-one-fold in
cocaine hydrolysis activity relative to
butyrylcholinesterase. The butyrylcholinesterase variant
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
11
polypeptide encompassing the same or substantially the
same amino acid sequence shown as SEQ ID N0: 18, or
functional fragment thereof, has a sixty-eight-fold in
cocaine hydrolysis activity relative to
butyrylcholinesterase. The butyrylcholinesterase variant
polypeptide encompassing the same or substantially the
same amino acid sequence shown as SEQ ID N0: 20, or
functional fragment thereof, has an increased cocaine
hydrolysis activity relative to butyrylcholinesterase.
The butyrylcholinesterase variant polypeptide
encompassing the same or substantially the same amino
acid sequence shown as SEQ ID NO: 22, or functional
fragment thereof, has an increased cocaine hydrolysis
activity relative to butyrylcholinesterase. The
butyrylcholinesterase variant polypeptide encompassing
the same or substantially the same amino acid sequence
shown as SEQ ID N0: 24, or functional fragment thereof,
has an increased cocaine hydrolysis activity relative to
butyrylcholinesterase. The butyrylcholinesterase variant
polypeptide encompassing the same or substantially the
same amino acid sequence shown as SEQ ID N0: 26, or
functional fragment thereof, has an increased cocaine
hydrolysis activity relative to butyrylcholinesterase.
The butyrylcholinesterase variant polypeptide
encompassing the same or substantially the same amino
acid sequence shown as SEQ ID N0: 28, or functional
fragment thereof, has a four-fold in cocaine hydrolysis
activity relative to butyrylcholinesterase. The
butyrylcholinesterase variant polypeptide encompassing
the same or substantially the same amino acid sequence
shown as SEQ ID N0: 30, or functional fragment thereof,
has a four-fold increase in cocaine hydrolysis activity
relative to butyrylcholinesterase. The
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
1~
butyrylcholinesterase variant polypeptide encompassing
the same or substantially the same amino acid sequence
shown as SEQ ID NO: 32, or functional fragment thereof,
has a two-fold increase in cocaine hydrolysis activity
relative to butyrylcholinesterase. The
butyrylcholinesterase variant polypeptide encompassing
the same or substantially the same amino acid sequence
shown as SEQ ID NO: 34, or functional fragment thereof,
has a three-fold increase in cocaine hydrolysis activity
relative to butyrylcholinesterase. The
butyrylcholinesterase variant polypeptide encompassing
the same or substantially the same amino acid sequence
shown as SEQ ID N0: 36, or functional fragment thereof,
has a two-fold increase in cocaine hydrolysis activity
relative to butyrylcholinesterase. The
butyrylchol.inesterase variant polypeptide encompassing
the same or substantially the same amino acid sequence
shown as SEQ ID NO: 38, or functional fragment thereof,
has a two-fold increase in cocaine hydrolysis activity
relative to butyrylcholinesterase. The
butyrylcholinesterase variant polypeptide encompassing
the same or substantially the same amino acid sequence
shown as SEQ ID NO: 40, or functional fragment thereof,
has a one-and-a-half-fold increase in cocaine hydrolysis
activity relative to butyrylcholinesterase. The
butyrylcholinesterase variant polypeptide encompassing
the same or substantially the same amino acid sequence
shown as SEQ ID N0: 42, or functional fragment thereof,
has a two-and-a-half-fold increase in cocaine hydrolysis
activity relative to butyrylcholinesterase. The
butyrylcholinesterase variant polypeptide encompassing
the same or substantially the same amino acid sequence
shown as SEQ ID NO: 52, or functional fragment thereof,
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
13
has a seven-fold to fifteen-fold increase in cocaine
hydrolysis activity relative to butyrylcholinesterase.
The butyrylcholinesterase variant polypeptide
encompassing the same or substantially the same amino
acid sequence shown as SEQ ID N0: 54, or functional
fragment thereof, has a four-fold increase in cocaine
hydrolysis activity relative to butyrylcholinesterase.
The butyrylcholinesterase variant polypeptide
encompassing the same or substantially the same amino
acid sequence shown as SEQ ID N0: 56, or functional
fragment thereof, has a two-and-a-half-fold increase in
cocaine hydrolysis activity relative to
butyrylcholinesterase. The butyrylcholinesterase variant
polypeptide encompassing the same or substantially the
same amino acid sequence shown as SEQ ID N0: 58, or
functional fragment thereof, has a two-fold increase in
cocaine hydrolysis activity relative to
butyrylcholinesterase.
The butyrylcholinesterase variant polypeptides
of the invention hold significant clinical value because
of their capability to hydrolyse cocaine at a higher rate
than any of the known naturally occurring variants. It
is this increase in cocaine hydrolysis activity that
enables a much more rapid response to the life-
threatening symptoms of cocaine toxicity that confers
upon the butyrylcholinesterase variant polypeptides of
the invention their therapeutic value. The
butyrylcholinesterase variant polypeptides of the
invention have two or more amino acid alterations in
regions determined to be important for cocaine hydrolysis
activity.
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
14
As used herein, the term
"butyrylcholinesterase" is intended to refer to a
polypeptide having the sequence of naturally occurring
human butyrylcholinesterase shown as SEQ ID N0: 44.
As used herein, the term "butyrylcholinesterase
variant" is intended to refer to a molecule that is
structurally similar to a butyrylcholinesterase, but
differs by at least one amino acid from the
butyrylcholinesterase shown as SEQ ID N0: 44. A
butyrylcholinesterase variant is structurally similar to
the butyrylcholinesterase shown as SEQ ID NO: 44, but
exhibits increased cocaine hydrolysis activity. For
example, the cocaine hydrolysis activity of a
butyrylcholinesterase variant polypeptide of the
invention can be increased by a factor of 5, 6, 7, 8, 9,
10, 12, 14, 16, 18, 20, 24, 28, 32, 36, 40, 80, 100 or
more.
A butyrylcholinesterase variant polypeptide can
have a one, two, three, four, five, six or more amino
acid alterations compared to buyrylcholinesterase. A
specific example of a butyrylcholinesterase variant
polypeptide has the amino acids Tryptophane and
Methionine at positions 328 and 332, respectively, of
which the amino acid sequence and encoding nucleic acid
sequence is designated as SEQ ID NOS: 2 and 1,
respectively. Additional examples of
butyrylcholinesterase variant polypeptides are the
butyrylcholinesterase variant polypeptide having the
amino acids Tryptophane and Proline at positions 328 and
332, respectively of which the amino acid sequence and
nucleic acid sequence are described herein and designated
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
SEQ ID NOS: 4 and 3, respectively; the
butyrylcholinesterase variant polypeptide having the
amino acids Tryptophane and Zeucine at positions 328 and
331, respectively, of which the amino acid sequence and
5 nucleic acid sequence are described herein and designated
SEQ ID NOS: 6 and 5, respectively; the
butyrylcholinesterase variant polypeptide having the
amino acids Tryptophane and Serine at positions 328 and
332, respectively, of which the amino acid sequence and
10 nucleic acid sequence are described herein and designated
SEQ ID NOS: 8 and 7, respectively; the
butyrylcholinesterase variant polypeptide having the
amino acids Serine, Alanine, Glycine, Tryptophane and
Methionine at positions 199, 227, 287, 328 and 332,
15 respectively, of which the amino acid sequence and
nucleic acid sequence are described herein and designated
SEQ ID NOS: 10 and 9, respectively; the
butyrylcholinesterase variant polypeptide having the
amino acids Serine, Alanine, Glycine and Tryptophane at
positions 199, 227, 287 and 328, respectively, of which
the amino acid sequence and nucleic acid sequence are
described herein and designated SEQ ID NOS: 12 and 11,
respectively; the butyrylcholinesterase variant
polypeptide having the amino acids Serine, Glycine and
Tryptophane at positions 199, 287 and 328, respectively,
of which the amino acid sequence and nucleic acid
sequence are described herein and designated SEQ ID NOS:
14 and 13, respectively; the butyrylcholinesterase
variant polypeptide having the amino acids Alanine,
Glycine and Tryptophane at positions 227, 287 and 328,
respectively, of which the amino acid sequence and
nucleic acid sequence are described herein and designated
SEQ ID NOS: 16 and 15, respectively; the
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
16
butyrylcholinesterase variant polypeptide having the
amino acids Alanine and Tryptophane at positions 227 and
328, respectively, of which the amino acid sequence and
nucleic acid sequence are described herein and designated
SEQ ID NOS: 17 and 18, respectively; the
butyrylcholinesterase variant polypeptide having the
amino acid Serine at position 332, of which the amino
acid sequence and nucleic acid sequence are described
herein and designated SEQ ID NOS: 20 and 19,
20 respectively; the butyrylcholinesterase variant
polypeptide having the amino acid Methionine at position
332, of which the amino acid sequence and nucleic acid
sequence are described herein and designated SEQ ID NOS:
22 and 21, respectively; the butyrylcholinesterase
variant polypeptide having the amino acid Proline at
position 332, of which the amino acid sequence and
nucleic acid sequence are described herein and designated
SEQ ID NOS: 24 and 23, respectively; the
butyrylcholinesterase variant polypeptide having the
amino acid Leucine at position 331, of which the amino
acid sequence and nucleic acid sequence are described
herein and designated SEQ ID NOS: 26 and 25,
respectively; the butyrylcholinesterase variant
polypeptide having the amino acid Alanine at position
227, of which the amino acid sequence and nucleic acid
sequence are described herein and designated SEQ ID NOS:
28 and 27, respectively; the butyrylcholinesterase
variant polypeptide having the amino acid Glycine at
position 227, of which the amino acid sequence and
nucleic acid sequence are described herein and designated
SEQ ID NOS: 30 and 29, respectively; the
butyrylcholinesterase variant polypeptide having the
amino acid Serine at position 227, of which the amino
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
17
acid sequence and nucleic acid sequence are described
herein and designated SEQ ID NOS: 32 and 31,
respectively; the butyrylcholinesterase variant
polypeptide having the amino acid Proline at position
227, of which the amino acid sequence and nucleic acid
sequence are described herein and designated SEQ ID NOS:
34 and 33, respectively; the butyrylcholinesterase
variant polypeptide having the amino acid Threonine at
position 227, of which the amino acid sequence and
nucleic acid sequence are described herein and designated
SEQ ID NOS: 36 and 35, respectively; the
butyrylcholinesterase variant polypeptide having the
amino acid Cysteine at position 227, of which the amino
acid sequence and nucleic acid sequence are described
herein and designated SEQ ID NOS: 38 and 37,
respectively; the butyrylcholinesterase variant
polypeptide having the amino acid Methionine at position
227, of which the amino acid sequence and nucleic acid
sequence are described herein and designated
SEQ ID NOS: 40 and 39, respectively; the
butyrylcholinesterase variant polypeptide having the
amino acid Serine at position 199, of which the amino
acid sequence and nucleic acid sequence are described
herein and designated SEQ ID NOS: 42 and 41,
respectively; the butyrylcholinesterase variant
polypeptide having the amino acid Tryptophane at position
328, of which the amino acid sequence and nucleic acid
sequence are described herein and designated SEQ ID NOS:
52 and 51, respectively; the butyrylcholinesterase
variant polypeptide having the amino acid Glycine at
position 287, of which the amino acid sequence and
nucleic acid sequence are described herein and designated
SEQ ID NOS: 54 and 53, respectively; the
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
18
butyrylcholinesterase variant polypeptide having the
amino acid Glutamine at position 285, of which the amino
acid sequence and nucleic acid sequence are described
herein and designated SEQ ID NOS: 56 and 55,
respectively; the butyrylcholinesterase variant
polypeptide having the amino acid Serine at position 285,
of which the amino acid sequence and nucleic acid
sequence are described herein and designated SEQ ID NOS:
58 and 57, respectively.
As used herein, the term "polypeptide" is
intended to mean two or more amino acids covalently
bonded together. A polypeptide of the invention includes
small polypeptides having a few or several amino acids as
well as large polypeptides having several hundred or more
amino acids. Usually, the covalent bond between the two
or more amino acid residues is an amide bond. However,
the amino acids can be joined together by various other
means known to those skilled in the peptide and chemical
arts. Therefore, a polypeptide, in whole or in part, can
include molecules which contain non-amide linkages
between amino acids, amino acid analogs, and mimetics.
Similarly, the term also includes cyclic peptides and
other conformationally constrained structures. A
polypeptide also can be modified by naturally occurring
modifications such as post-translational modifications,
including phosphorylation, lipidation, prenylation,
sulfation, hydroxylation, acetylation, addition of
carbohydrate, addition of prosthetic groups or cofactors,
formation of disulfide bonds, proteolysis, assembly into
macromolecular complexes, and the like.
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
19
As described below, polypeptides of the
invention also encompass, for example, modified forms of
naturally occurring amino acids such as D-stereoisomers,
non-naturally occurring amino acids, amino acid analogues
and mimetics so long as such variants have substantially
the same amino acid sequence as the reference
butyrylcholinesterase variant polypeptide and exhibit
about the same cocaine hydrolysis activity. A
butyrylcholinesterase variant polypeptide of the
invention can have two or more amino acid alterations.
Furthermore, a butyrylcholinesterase variant polypeptide
of the invention can have one or more additional
modifications that do not significantly change its
cocaine hydrolysis activity, but confer a desirable
property such as increased biostability.
It is understood that the amino acid sequences
of the invention can have a similar, non-identical
sequence, and retaining comparable functional and
biological activity of the polypeptide defined by the
reference amino acid sequence. A polypeptide having such
a similar, non-identical, but nevertheless substantially
the same amino acid sequence can have at least about 750,
80 0, 82 0, 84 0, 8 6 0 or 88 0, or at least 90 0, 91 0, 92 0, 93 0
or 94% amino acid identity with respect to the reference
amino acid sequence; as well as greater than 95o, 960,
970, 980 or 99o amino acid identity as long as such
polypeptides retain a biological activity of the
reference butyrylcholinesterase variant polypeptide. It
is recognised, however, that polypeptides, or encoding
nucleic acids, containing less than the described levels
of sequence identity arising as splice variants or that
are modified by conservative amino acid substitutions, or
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
by substitution of degenerate codons also are encompassed
within the scope of the present invention.
A biological activity of a
butyrylcholinesterase variant of the invention is cocaine
5 hydrolysis activity as described herein. For example,
the butyrylcholinesterase variant A328W/Y332M designated
SEQ ID N0: 2 exhibits about a twenty-four-fold increased
cocaine hydrolysis activity compared to
butyrylcholinesterase; the butyrylcholinesterase variant
10 A328W/Y332P designated SEQ ID N0: 4 exhibits about a
ten-fold increased cocaine hydrolysis activity compared
to butyrylcholinesterase; the butyrylcholinesterase
variant A328W/V331L designated SEQ ID N0: 6 exhibits
about a sixteen-fold increased cocaine hydrolysis
15 activity compared to butyrylcholinesterase; the
butyrylcholinesterase variant A328W/Y332S designated SEQ
ID NO: 8 exhibits about an eight-fold increased cocaine
hydrolysis activity compared to butyrylcholinesterase;
the butyrylcholinesterase variant
20 A328W/Y332M/S287G/F227A/A199S designated SEQ ID N0: 10
exhibits about a one-hundred-fold increased cocaine
hydrolysis activity compared to butyrylcholinesterase;
the butyrylcholinesterase variant A328W/S287G/F227A/A199S
designated SEQ ID N0: 12 exhibits about a
one-hundred-fold increased cocaine hydrolysis activity
compared to butyrylcholinesterase; the
butyrylcholinesterase variant A328W/S287G/A199S
designated SEQ ID N0: 14 exhibits about a ninety-seven-
fold increased cocaine hydrolysis activity compared to
butyrylcholinesterase; the butyrylcholinesterase variant
A328W/S287G/F227A designated SEQ ID NO: 16 exhibits about
a ninety-one-fold increased cocaine hydrolysis activity
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
21
compared to butyrylcholinesterase; the
butyrylcholinesterase variant A328W/F227A designated SEQ
ID N0: 18 exhibits about a sixty-eight-fold increased
cocaine hydrolysis activity compared to
butyrylcholinesterase; the butyrylcholinesterase variant
Y332S designated SEQ ID N0: 20 exhibits an increased
cocaine hydrolysis activity compared to
butyrylcholinesterase; the butyrylcholinesterase variant
Y332M designated SEQ ID N0: 22 exhibits an increased
cocaine hydrolysis activity compared to
butyrylcholinesterase; the butyrylcholinesterase variant
Y332P designated SEQ ID N0: 24 exhibits an increased
cocaine hydrolysis activity compared to
butyrylcholinesterase; the butyrylcholinesterase variant
V331Z designated SEQ ID N0: 26 exhibits an increased
cocaine hydrolysis activity compared to
butyrylcholinesterase; the butyrylcholinesterase variant
F227A designated SEQ ID NO: 28 exhibits about a four-fold
increased cocaine hydrolysis activity compared to
butyrylcholinesterase; the butyrylcholinesterase variant
F227G designated SEQ ID N0: 30 exhibits about a four-fold
increased cocaine hydrolysis activity compared to
butyrylcholinesterase; the butyrylcholinesterase variant
F227S designated SEQ ID N0: 32 exhibits about a two-fold
increased cocaine hydrolysis activity compared to
butyrylcholinesterase; the butyrylcholinesterase variant
F227P designated SEQ ID N0: 34 exhibits about a three-
fold increased cocaine hydrolysis activity compared to
butyrylcholinesterase; the butyrylcholinesterase variant
F227T designated SEQ ID N0: 36 exhibits about a two-fold
increased cocaine hydrolysis activity compared to
butyrylcholinesterase; the butyryleholinesterase variant
F227C designated SEQ ID N0: 38 exhibits about a two-fold
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
22
increased cocaine hydrolysis activity compared to
butyrylcholinesterase; the butyrylcholinesterase variant
F227M designated SEQ ID N0: 40 exhibits about a one-and-
a-half-fold increased cocaine hydrolysis activity
compared to butyrylcholinesterase; the
butyrylcholinesterase variant A199S designated SEQ ID
NO: 42 exhibits about a two-and-a-half-fold increased
cocaine hydrolysis activity compared to
butyrylcholinesterase; the butyrylcholinesterase variant
A328W designated SEQ ID NO: 52 exhibits at least about a
seven-fold to fifteen-fold increased cocaine hydrolysis
activity compared to butyrylcholinesterase; the
butyrylcholinesterase variant S287G designated SEQ ID N0:
54 exhibits about a four-fold increased cocaine
hydrolysis activity compared to butyrylcholinesterase;
the butyrylcholinesterase variant P285Q designated SEQ ID
NO: 56 exhibits about a two-and-a-half-fold increased
cocaine hydrolysis activity compared to
butyrylcholinesterase; the butyrylcholinesterase variant
P285S designated SEQ ID NO: 58 exhibits about a two-fold
increased cocaine hydrolysis activity compared to
butyrylcholinesterase.
One skilled in the art will appreciate that the
exact increase in cocaine hydrolysis activity compared to
~5 butyrylcholinesterase that is detected can depend on the
particular assay chosen. Therefore, while all of the
butyrylcholinesterase variants of the invention have
increased cocaine hydrolysis activity, the values set
forth herein are approximate values that can vary
dependiong on the assay performed to measure the
activity. However, one skilled in the art will be able
to perform the appropriate controls to determine the
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
23
relative values of cocaine hydrolase activity of the
various variants, all of which have increased activity.
It is understood that minor modifications in
the primary amino acid sequence can result in a
polypeptide that has a similar, non-identical sequence,
but retains comparable functional or biological activity
to a butyrylcholinesterase variant polypeptide of the
invention. These modifications can be deliberate, as
through site-directed mutagenesis, or may be accidental
such as through spontaneous mutation. For example, it is
understood that only a portion of the entire primary
structure of a butyrylcholinesterase variant polypeptide
can retain the cocaine hydrolysis activity of the
reference butyrylcholinesterase variant polypeptide.
Such functional fragments of the sequence of a
butyrylcholinesterase variant polypeptide of the
invention are included within the definition as long as
at least one biological function of the
butyrylcholinesterase variant is retained. It is
understood that various molecules can be attached to a
polypeptide of the invention, for example, other
polypeptides, carbohydrates, lipids, or chemical
moieties.
The term "functional fragment," when used in
reference to a butyrylcholinesterase variant polypeptide
of the invention, refers to a polypeptide fragment that
is a portion of the butyrylcholinesterase variant
polypeptide, provided that the portion has a biological
activity, as described herein, that is characteristic of
the reference butyrylcholinesterase variant polypeptide.
The amino acid length of a functional fragment of a
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
24
butyrylcholinesterase variant polypeptide of the present
invention can range from about 5 amino acids up to the
full-length protein sequence of the reference
butyrylcholinesterase variant polypeptide. In certain
embodiments, the amino acid lengths include, for example,
at least about 10 amino acids, at least about 15, at
least about 20, at least about 25, at least about 30, at
least about 35, at least about 40, at least about 45, at
least about 50, at least about 75, at least about 100, at
least about 150, at least about 200, at least about 250
or more amino acids in length up to the full-length
butyrylcholinesterase variant polypeptide sequence. The
functional fragments can be contiguous amino acid
sequences of a butyrylcholinesterase variant polypeptide,
including contiguous amino acid sequence corresponding to
the substrate binding domain of the butyrylcholinesterase
variant polypeptide. A functional fragment of a
butyrylcholinesterase variant polypeptide of the
invention exhibiting a functional activity can have, for
example, at least 8, 10, 15, 20, 30 or 40 amino acids,
and often has at least 50, 75, 100, 200, 300, 400 or more
amino acids of a polypeptide of the invention, up to the
full length polypeptide minus one amino acid. The
appropriate length and amino acid sequence of a
functional fragment of a polypeptide of the invention can
be determined by those skilled in the art, depending on
the intended use of the functional fragment. For
example, a functional fragment of a butyrylcholinesterase
variant is intended to refer to a portion of the
butyrylcholinesterase variant that still retains some or
all of the cocaine hydrolysis activity of the parent
polypeptide.
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
A functional fragment of a
butyrylcholinesterase variant polypeptide can contain
active site residues important for the catalytic activity
of the enzyme. Regions important for the hydrolysis
5 activity of a butyrylcholinesterase variant polypeptide
can be determined or predicted through a variety of
methods known in the art. Related enzymes such as, for
example, acetylcholinesterase and carboxylesterase, that
share a high degree of sequence similarity and have
10 biochemically similar catalytic properties can provide
information regarding the regions important for catalytic
activity of a butyrylcholinesterase variant polypeptide.
For example, structural modeling can reveal the active
site of an enzyme, which is a three-dimensional structure
15 such as a cleft, gorge or crevice formed by amino acid
residues generally located apart from each other in
primary structure. Therefore, a functional fragment of a
butyrylcholinesterase variant polypeptide of the
invention can encompass amino acid residues that make up
regions of a butyrylcholinesterase enzyme important for
cocaine hydrolysis activity such as those residues
located along the active site gorge.
In addition to structural modeling of a
butyrylcholinesterase enzyme, biochemical data can be
25 used to determine or predict regions of a
butyrylcholinesterase variant polypeptide important for
cocaine hydrolysis activity when preparing a functional
fragment of a butyrylcholinesterase variant polypeptide
of the invention. In this regard, the characterization
30 of naturally occurring butyrylcholinesterase enzymes with
altered cocaine hydrolysis activity can be useful for
identifying regions important for the catalytic activity
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
26
of a butyrylcholinesterase variant polypeptide.
Similarly, site-directed mutagenesis studies can provide
data regarding catalytically important amino acid
residues as reviewed, for example, in Schwartz et al.,
Pharmac. Ther. 67: 283-322 (1992), which is incorporated
by reference. In particular, a functional fragment of a
butyrylcholinesterase variant polypeptide can include the
active site residues corresponding to amino acid
positions 82, 112, 128, 231, 329, 332, 430 and 440 of the
butyrylcholinesterase shown as SEQ ID NO: 14. Thus, a
functional fragment can, for example, be 360 amino acid
residues in length and can include residues 80 to 440 of
the reference butyrylcholinesterase variant polypeptide.
Therefore, a functional fragment of a
butyrylcholinesterase variant polypeptide can encompass
an area or region of the amino acid sequence of
butyryleholinesterase that is determined or predicted to
be important for cocaine hydrolysis activity. As
described above, a region can be determined or predicted
to be important for cocaine hydrolysis activity by using
one or more of structural, biochemical or modeling
methods and, as a consequence, is defined by general
rather than absolute boundaries. A region can encompass
two or more consecutive amino acid positions of the amino
acid sequence of butyrylcholinesterase that are predicted
to be important for cocaine hydrolysis activity. A
region of butyrylcholinesterase useful as a functional
fragment of a butyrylcholinesterase variant polypeptide
for practicing the claimed invention is no more than
about 30 amino acids in length and preferably is between
2 and 20, between 5 and 15 amino acids in length.
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
27
A butyrylcholinesterase variant polypeptide of
the invention, or a functional fragment thereof, can have
conservative amino acid substitutions as compared with
the reference butyrylcholinesterase variant amino acid
sequence. Conservative substitutions of encoded amino
acids include, for example, amino acids that belong
within the following groups: (1) non-polar amino acids
(Gly, Ala, Val, Leu, and Ile); (2) polar neutral amino
acids (Cys, Met, Ser, Thr, Asn, and Gln); (3) polar
acidic amino acids (Asp and Glu); (4) polar basic amino
acids (Lys, Arg and His); and (5) aromatic amino acids
(Phe, Trp, Tyr, and His).
A butyrylcholinesterase variant polypeptide
having the same or substantially the same amino acid
sequence of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18,
20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 52, 54,
56 and 58, or a functional fragment thereof, also can be
chemically modified, provided that the polypeptide
retains a biological activity of the reference
butyrylcholinesterase variant polypeptide. For example,
chemical modification of a butyrylcholinesterase variant
polypeptide of the invention can include alkylation,
acylation, carbamylation and iodination. Moreover,
modified polypeptides also can include those polypeptides
in which free amino groups have been derivatized to form,
for example, amine hydrochlorides, p-toluene sulfonyl
groups, carbobenzoxy groups, t-butyloxycarbonyl groups,
chloroacetyl groups or formyl groups. Free carboxyl
groups can be modified to form salts, methyl and ethyl
esters or other types of esters or hydrazides. Free
hydroxyl groups can be modified to form 0-aryl or O-alkyl
derivatives. The imidazole nitrogen of histidine can be
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
28
derivatized to form N-im-benzylhistidine. A
butyrylcholinesterase variant polypeptide of the
invention also can include a variety of other
modifications well known to those skilled in the art,
provided the biological activity of the reference
butyrylcholinesterase variant polypeptide remains
substantially unaffected.
An isolated polypeptide having the same or
substantially the same amino acid sequence of SEQ ID NOS:
2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30,
32, 34, 36, 38, 40, 42, 52, 54, 56 or 58, or a functional
fragment thereof, also can be substituted with one or
more amino acid analogs of the twenty standard amino
acids, for example, 4-hydroxyproline, 5-hydroxylysine,
3-methylhistidine, homoserine, ornithine or
carboxyglutamate, and can include amino acids that are
not linked by peptide bonds.
A butyrylcholinesterase variant polypeptide
having the same or substantially the same amino acid
sequence of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18,
20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 52, 54,
56 or 58, or a functional fragment thereof, also can
contain mimetic portions that orient functional groups,
which provide a function of a butyrylcholinesterase
enzyme. Therefore, mimetics encompass chemicals
containing chemical moieties that mimic the function of
the polypeptide. For example, if a polypeptide contains
similarly charged chemical moieties having similar
functional activity, a mimetic places similar charged
chemical moieties in a similar spatial orientation and
constrained structure so that the chemical function of
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
29
the charged moieties is maintained. Exemplary mimetics
are peptidomimetics, peptoids, or other peptide-like
polymers such as poly-(3-amino acids, and also non-
polymeric compounds upon which functional groups that
mimic a peptide are positioned.
A butyrylcholinesterase variant of the
invention can be prepared by a variety of methods well
known in the art. If desired, random mutagenesis can be
performed to prepare a butyrylcholinesterase variant of
the invention. Alternatively, as disclosed herein, site-
directed mutagenesis based on the information obtained
from structural, biochemical and modeling methods
described herein can be performed to target those amino
acids predicted to be important for cocaine hydrolysis
activity. For example, molecular modeling of cocaine in
the active site of butyrylcholinesterase can be utilized
to predict amino acid alterations that allow for higher
catalytic efficiency based on a better fit between the
enzyme and its substrate. As described herein, residues
predicted to be important for cocaine hydrolysis activity
include 3 hydrophobic gorge residues and the catalytic
triad residues. Furthermore, it is understood that amino
acid alterations of residues important for the functional
structure of a butyrylcholinesterase variant, which
include the cysteine residues 65Cys-92Cys, ~SZCys-ZSSCys, and
4ooCys-sisCys involved in intrachain disulfide bonds are
generally not altered in the preparation of a
butyrylcholinesterase variant that has cocaine hydrolysis
activity.
Following mutagenesis of butryrylcholinesterase
or a butryrylcholinesterase variant expression,
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
purification and functional characterization of the
butyrylcholinesterase variant can be performed by methods
well known in the art. As disclosed below, a
butyrylcholinesterase variant can be expressed in an
5 appropriate host cell line and subsequently purified and
characterized for cocaine hydrolysis activity.
Butyrylcholinesterase variants characterized as having
significantly increased cocaine hydrolysis activity can
subsequently be used in the methods of hydrolyzing a
10 cocaine-based substrate as well as the methods of
treating a cocaine-induced condition described below.
A butyrylcholinesterase variant of the
invention exhibits cocaine hydrolysis activity. As
disclosed herein, a butyrylcholinesterase variant of the
15 invention can have increased cocaine hydrolysis activity
compared to butyrylcholinesterase and can be used to
treat a cocaine-induced condition. A polypeptide having
minor modifications compared to a butyrylcholinesterase
variant of the invention is encompassed by the invention
20 so long as equivalent cocaine hydrolysis activity is
retained. In addition, functional fragments of a
butyrylcholinesterase variant that still retain some or
all of the cocaine hydrolysis activity of the parent
butyrylcholinesterase variant are similarly included in
25 the invention. Similarly, functional fragments of
nucleic acids, which encode functional fragments of a
butyrylcholinesterase variant of the invention are
similarly encompassed by the invention.
A functional fragment of a
30 butyrylcholinesterase variant of the invention can be
prepared by recombinant methods involving expression of a
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
31
nucleic acid molecule encoding the butyrylcholinesterase
variant or functional fragment thereof, followed by
isolation of the variant or functional fragment thereof
by routine biochemical methods described herein. It is
understood that functional fragments also can be prepared
by enzymatic or chemical cleavage of the full length
butyrylcholinesterase variant. Methods for enzymatic and
chemical cleavage and for purification of the resultant
peptide fragments are well known in the art (see, for
example, Deutscher, Methods in Enzymoloqy, Vol. 182,
"Guide to Protein Purification," San Diego: Academic
Press, Inc. (1990), which is incorporated herein by
reference).
Furthermore, functional fragments of a
butyrylcholinesterase variant can be produced by chemical
synthesis. If desired, such molecules can be modified to
include D-stereoisomers, non-naturally occurring amino
acids, and amino acid analogs and mimetics in order to
optimize their functional activity, stability or
bioavailability. Examples of modified amino acids and
their uses are presented in Sawyer, Peptide Based Drug
Design, ACS, Washington (1995) and Gross and Meienhofer,
The Peptides: Analysis, Synthesis, Bioloay, Academic
Press, Inc., New York (1983), both of which are
incorporated herein by reference.
If desired, random segments of a
butyrylcholinesterase variant can be prepared and tested
in the assays described herein. A fragment having any
desired boundaries and modifications compared to the
amino acid sequence of the reference
butyrylcholinesterase variant of the invention can be
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
32
prepared. Alternatively, available information obtained
by the structural, biochemical and modeling methods
described herein can be used to prepare only those
fragments of a butyrylcholinesterase variant that are
likely to retain the cocaine hydrolysis activity of the
parent variant. As described herein, residues predicted
to be important for cocaine hydrolysis activity include 8
hydrophobic gorge residues and the catalytic triad
residues. Furthermore, residues important for the
functional structure of a butyrylcholinesterase variant
include the cysteine residues 6sCys-9zCys, 2s2Cys-zssCys, and
4ooCys-si9Cys involved in intrachain disulfide bonds .
Therefore, a functional fragment can be a truncated form,
region or segment of the reference butyrylcholinesterase
variant designed to possess most or all of the residues
critical for cocaine hydrolysis activity or functional
structure so as to retain equivalent cocaine hydrolysis
activity. Similarly, a functional fragment can include
non-peptidic structural elements that serve to mimic
structurally or functionally important residues of the
reference variant. Also included as
butyrylcholinesterase variants of the invention are
fusion proteins that result from linking a
butyrylcholinesterase variant or functional fragment
thereof to a heterologous protein, such as a therapeutic
protein, as well as fusion constructs of nucleic acids
encoding such fusion proteins. Fragments of nucleic
acids that can hybridize to a butyrylcholinesterase
variant or functional fragment thereof are useful, for
example, as hybridization probes and are also encompassed
by the claimed invention.
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
33
Thus, th'e invention provides twenty-five
butyrylcholinesterase variants encompassing the same or
substantially the same amino acid sequences shown as SEQ
ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26,
28, 30, 32, 34, 36, 38, 40, 42, 52, 54, 56 and 58, and
functional fragments thereof. As described herein, each
of the invention butyrylcholinesterase variants exhibits
about an increased cocaine hydrolysis activity compared
to butyrylcholinesterase.
The invention also provides twenty-five nucleic
acids shown as SEQ ID NOS: 1, 3, 5, 7, 9, 11, 13, 15, 17,
19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 51, 53, 55
and 57, respectively, and fragments thereof, which
encode the butyrylcholinesterase variants encompassing
the same or substantially the same amino acid sequences
shown as SEQ TD NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20,
22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 52, 54, 56
and 58, respectively. Thus, the present invention
provides nucleic acids that encode a
butyrylcholinesterase variant encompassing the same or
substantially the same amino acid sequences shown as SEQ
ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26,
28, 30, 32, 34, 36, 38, 40, 42, 52, 54, 56 and 58.
It is understood that a nucleic acid molecule
of the invention or a fragment thereof includes sequences
that are substantially the same as the reference
sequence, but have one or more additions, deletions or
substitutions with respect to the reference sequence, so
long as the nucleic acid molecule retains its ability to
selectively hybridize with the subject nucleic acid
molecule under moderately stringent conditions, or highly
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
34
stringent conditions. Moderately stringent conditions
are hybridization conditions equivalent to hybridization
of filter-bound nucleic acid in 50o formamide, 5 X
Denhart's solution, 5 X SSPE, 0.2o SDS at 42°C, followed
by washing in 0.2 X SSPE, 0.2% SDS, at 50°. Highly
stringent conditions refers to conditions equivalent to
hybridization of filter-bound nucleic acid in 500
formamide, 5 X Denhart's solution, 5 X SSPE, 0.2o SDS at
42°C, followed by washing in 0. 2 X SSPE, 0. 2 o SDS, at 65°.
Other suitable moderately stringent and highly stringent
hybridization buffers and conditions are well known to
those of skill in the art and are described, for example,
in Sambrook et al., Molecular Cloninct: A haboratory
Manual, 2nd ed., Cold Spring Harbor Press, Plainview, New
York (1989); and Ausubel et al., Current Protocols in
Molecular Bioloay, John Wiley & Sons, New York (2000).
Thus, it is not necessary that two nucleic acids exhibit
sequence identity to be substantially complementary, only
that they can specifically hybridize or be made to
specifically hybridize without detectable cross
reactivity with other similar sequences.
In general, a nucleic acid molecule that has
substantially the same nucleotide sequence as a reference
sequence will have greater than about 60o identity, such
as greater than about 65o, 700, 75o identity with the
reference sequence, such as greater than about 800, 850,
900, 950, 970 or 99o identity to the reference sequence
over the length of the two sequences being compared.
Identity of any two nucleic acid sequences can be
determined by those skilled in the art based, for
example, on a BZAST 2.0 computer alignment, using default
parameters. BLAST 2.0 searching is available at
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
ncbi.nlm.nih.gov/gorf/bl2.html., as described by Tatiana
et al., FEMS Microbiol Zett. 174:247-250 (1999).
As used herein, the term "fragment" when used
in reference to a nucleic acid encoding the claimed
5 polypeptides is intended to mean a nucleic acid having
the same or substantially the same sequence as a portion
of a nucleic acid encoding a polypeptide of the invention
or segments thereof. The nucleic acid fragment is
sufficient in length and sequence to selectively
10 hybridize to a butyrylcholinesterase variant encoding
nucleic acid or a nucleotide sequence that is
complementary to a butyrylcholinesterase variant encoding
nucleic acid. Therefore, fragment is intended to include
primers for sequencing and polymerise chain reaction
15 (PCR) as well as probes for nucleic acid blot or solution
hybridization.
Similarly, the term "functional fragment" when
used in reference to a nucleic acid encoding a
butyrylcholinesterase or butyrylcholinesterase variant is
20 intended to refer to a portion of the nucleic acid that
encodes a portion of the butyrylcholinesterase variant
that still retains some or all of the cocaine hydrolysis
activity of the reference variant polypeptide. A
functional fragment of a polypeptide of the invention
25 exhibiting a functional activity can have, for example,
at least 6 contiguous amino acid residues from the
polypeptide, at least 8, 10, 15, 20, 30 or 40 amino
acids, and often has at least 50, 75, 100, 200, 300, 400
or more amino acids of a polypeptide of the invention, up
30 to the full length polypeptide minus one amino acid.
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
36
As used herein, the term "cocaine hydrolysis
activity," is intended to refer to the catalytic action
of a butyrylcholinesterase or butyrylcholinesterase
variant as measured by the rate of cocaine hydrolysis
into the metabolites.
As used herein, the term "effective amount" is
intended to mean an amount of a butyrylcholinesterase
variant of the invention that can reduce the cocaine-
toxicity or the severity of a cocaine-induced condition.
Reduction in severity includes, for example, an arrest or
a decrease in symptoms, physiological indicators,
biochemical markers or metabolic indicators. Symptoms of
cocaine overdose include, for example, cardiac
arrythmias, seizures and hypertensive crises. As used
herein, the term "treating" is intended to mean causing a
reduction in the severity of a cocaine-induced condition.
As used herein, the term "cocaine-based
substrate" refers to (-)-cocaine or any molecule
sufficiently similar to (-)-cocaine in structure to be
hydrolyzed by butyrylcholinesterase or a
butyrylcholinesterase variant including, for example,
(+)-cocaine, acetylcholine, butyrylthiocholine,
benzoylcocaine and norcocaine.
The nucleic acid shown as SEQ ID NO: 1, or
fragment thereof, encodes a butyrylcholinesterase variant
encompassing the same or substantially the same amino
acid sequence shown as SEQ ID N0: 2. As shown in Table 1,
the nucleic acid shown as SEQ ID: 1 differs from the
nucleic acid encoding human butyrylcholinesterase shown
in Figure 3 at the codon positions encoding amino acid
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
37
residues 328 and 332, respectively. In the human
butyrylcholinesterase (SEQ ID N0: 13) the codons get and
tat encode Alanine at amino acid position 328 and
Tyrosine at amino acid position 332, respectively. In
contrast, in the nucleic acid encoding the A328W/Y332M
butyrylcholinesterase variant designated SEQ ID N0: 2,
the codons tgg and atg encode Tryptophane at amino acid
position 328 and Methionine at amino acid position 332,
respectively.
The invention provides a further nucleic acid
shown as SEQ ID N0: 3, or fragment thereof, encodes a
butyrylcholinesterase variant encompassing the same or
substantially the same amino acid sequence shown as SEQ
ID NO: 4. As shown in Table 1, the nucleic acid shown as
SEQ ID: 3 differs from the nucleic acid encoding human
butyrylcholinesterase shown in Figure 3 and designated
SEQ TD N0: 13, at the codons encoding amino acid residues
328 and 332. In the human butyrylcholinesterase (SEQ ID
NO: 13) the codons get and tat encode Alanine at amino
acid position 328 and Tyrosine at amino acid position
332. In contrast, in the nucleic acid encoding the
A328W/Y332P butyrylcholinesterase variant designated SEQ
ID N0: 4, the codons tgg and cca encode Tryptophane at
amino acid position 328 and Proline at amino acid
position 332.
The invention provides a further nucleic acid
shown as SEQ ID N0: 5, or fragment thereof, encodes a
butyrylcholinesterase variant encompassing the same or
substantially the same amino acid sequence shown as SEQ
TD NO: 6. As shown in Table 1, the nucleic acid shown as
SEQ ID: 5 differs from the nucleic acid encoding human
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
38
butyrylcholinesterase shown in Figure 3 and designated
SEQ ID N0: 43, at the codon positions encoding amino acid
residues 328 and 331. In the human butyrylcholinesterase
(SEQ ID N0: 43) the codons get and gtc encode Alanine at
amino acid position 328 and Valine at amino acid position
331. In contrast, in the nucleic acid encoding the
A328W/V331L butyrylcholinesterase variant.designated SEQ
ID N0: 6, the corresponding codons encode Tryptophane at
amino acid position 328 and Leucine at amino acid
position 331.
The invention provides a further nucleic acid
shown as SEQ ID N0: 7, or fragment thereof, encodes a
butyrylcholinesterase variant encompassing the same or
substantially the same amino acid sequence shown as SEQ
ID N0: 8. As shown in Table 1, the nucleic acid shown as
SEQ ID: 7 differs from the nucleic acid encoding human
butyrylcholinesterase shown in Figure 3 and designated
SEQ ID N0: 43 at the codon positions encoding amino acid
residues 328 and 332. In the human butyrylcholinesterase
(SEQ ID N0: 43) the codons get and tat encode Alanine at
amino acid position 328 and Tyrosine at amino acid
position 332. In contrast, in the nucleic acid encoding
the A328W/Y332S butyrylcholinesterase variant designated
SEQ ID N0: 8, the codons tgg and tcg encode Tryptophane
at amino acid position 328 and Serine at amino acid
position 332.
The invention provides a further nucleic acid
shown as SEQ ID NO: 9, or fragment thereof, which encodes
a butyrylcholinesterase variant encompassing the same or
substantially the same amino acid sequence shown as SEQ
ID N0: 10. As shown in Table 1, the nucleic acid shown
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
39
as SEQ ID: 9 differs from the nucleic acid encoding human
butyrylcholinesterase shown in Figure 3 and designated
SEQ ID NO: 43, at the codon positions encoding amino acid
residues 199, 227, 287, 332 and 328. In the human
butyrylcholinesterase (SEQ ID NO: 43) the codons gca,
ttt, tca, get and tat encode Alanine at amino acid
position 199, Phenylalanine at amino acid position 227,
Serine at amino acid position 287, Alanine at amino acid
position 328 and Tyrosine at amino acid position 332. In
contrast, in the nucleic acid encoding the
A328W/Y332M/S287G/F227A/A199S butyrylcholinesterase
variant designated SEQ ID N0: 10, the codons tca, gcg,
ggt, tgg and atg encode Serine at amino acid position
199, Alanine at amino acid position 227, Glycine at amino
acid position 287, Tryptophane at amino acid position 328
and Methionine at amino acid position 332, respectively.
The invention provides a further nucleic acid
shown as SEQ ID N0: 11, or fragment thereof, encodes a
butyrylcholinesterase variant encompassing the same or
substantially the same amino acid sequence shown as SEQ
ID N0: 12. As shown in Table l, the nucleic acid shown
as SEQ ID: 11 differs from the nucleic acid encoding
human butyrylcholinesterase shown in Figure 3 and
designated SEQ ID N0: 43, at the codon positions encoding
amino acid residues 199, 227, 287 and 328, respectively.
In the human butyrylcholinesterase (SEQ ID N0: 43) the
codons gca, ttt, tca and get encode Alanine at amino acid
position 199, Phenylalanine at amino acid position 227,
Serine at amino acid position 287, and Alanine at amino
acid position 328, respectively. In contrast, in the
nucleic acid encoding the A328W/S287G/F227A/A199S
butyrylcholinesterase variant designated SEQ ID N0: 12,
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
the codons tca, gcg, ggt and tgg encode Serine at amino
acid position 199, Alanine at amino acid position 227,
Glycine at amino acid position 287 and Tryptophane at
amino acid position 328, respectively.
5 The invention provides a further nucleic acid
shown as SEQ ID N0: 13, or fragment thereof, which
encodes a butyrylcholinesterase variant encompassing the
same or substantially the same amino acid sequence shown
as SEQ ID NO: 14. As shown in Table 1, the nucleic acid
10 shown as SEQ ID: 13 differs from the nucleic acid
encoding human butyrylcholinesterase shown in Figure 3
and designated SEQ ID N0: 43, at the codon positions
encoding amino acid residues 199, 287 and 328,
respectively. In the human butyrylcholinesterase (SEQ ID
15 N0: 43) the codons gca, tca and get encode Alanine at
amino acid position 199, Serine at amino acid position
287 and Alanine at amino acid position 328, respectively.
In contrast, in the nucleic acid encoding the
A328W/S287G/A199S butyrylcholinesterase variant
20 designated SEQ ID NO: 14, the codons tca, ggt and tgg,
encode Serine at amino acid position 199, Glycine at
amino acid position 287 and Tryptophane at amino acid
position 328, respectively.
The invention provides a further nucleic acid
25 shown as SEQ ID NO: 15, or fragment thereof, which
encodes a butyrylcholinesterase variant encompassing the
same or substantially the same amino acid sequence shown
as SEQ ID N0: 16. As shown in Table 1, the nucleic acid
shown as SEQ ID: 15 differs from the nucleic acid
30 encoding human butyrylcholinesterase shown in Figure 3
and designated SEQ ID N0: 43, at the codon positions
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
41
encoding amino acid residues 227, 287 and 328,
respectively. In the human butyrylcholinesterase (SEQ ID
N0: 43) the colons ttt, tca, get encode Phenylalanine at
amino acid position 227, Serine at amino acid position
287 and Alanine at amino acid position 328, respectively.
In contrast, in the nucleic acid encoding the
A328W/S287G/F227A butyrylcholinesterase variant
designated SEQ ID N0: 16, the colons gcg, ggt and tgg
encode Alanine at amino acid position 227, Glycine at
amino acid position 287 and Tryptophane at amino acid
position 328, respectively.
The invention provides a further nucleic acid
shown as SEQ ID N0: 17, or fragment thereof, which
encodes a butyrylcholinesterase variant encompassing the
same or substantially the same amino acid sequence shown
as SEQ ID NO: 18. As shown in Table l, the nucleic acid
shown as SEQ ID: 17 differs from the nucleic acid
encoding human butyrylcholinesterase shown in Figure 3
and designated SEQ ID NO: 43, at the colon positions
encoding amino acid residues 227 and 328, respectively.
In the human butyrylcholinesterase (SEQ ID N0: 43) the
colons ttt and get at nucleotide encode Phenylalanine at
amino acid position 227 and Alanine at amino acid
position 328, respectively. In contrast, in the nucleic
acid encoding the A328W/F227A butyrylcholinesterase
variant designated SEQ ID NO: 18, the colons gcg and tgg
encode Alanine at amino acid position 227 and Tryptophane
at amino acid position 328, respectively.
The invention provides a further nucleic acid
shown as SEQ ID N0: 19, or fragment thereof, which
encodes a butyrylcholinesterase variant comprising
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
42
substantially the same amino acid sequence shown as SEQ
ID N0: 20. As shown in Table 1, the nucleic acid shown
as SEQ ID: 19 differs from the nucleic acid encoding
human butyrylcholinesterase shown in Figure 3 and
designated SEQ ID NO: 43, at the colon position encoding
amino acid residue 332. In the human
butyrylcholinesterase (SEQ ID N0: 43) the colon tat
encodes Tyrosine at amino acid position 332. In
contrast, in the nucleic acid encoding the Y332S
butyrylcholinesterase variant designated SEQ ID N0: 20,
the colon tcg encodes Serine at amino acid position 332.
The invention provides a further nucleic acid
shown as SEQ ID NO: 21, or fragment thereof, which
encodes a butyrylcholinesterase variant encompassing the
same or substantially the same amino acid sequence shown
as SEQ ID NO: 22. As shown in Table l, the nucleic acid
shown as SEQ ID: 21 differs from the nucleic acid
encoding human butyrylcholinesterase shown in Figure 3
and designated SEQ ID N0: 43, at the colon position
encoding amino acid residue 332. In the human
butyrylcholinesterase (SEQ ID N0: 43) the colon tat
encodes Tyrosine at amino acid position 332. In
contrast, in the nucleic acid encoding the Y332M
butyrylcholinesterase variant designated SEQ ID N0: 22,
the colon atg encodes Methionine at amino acid position
332.
The invention provides a further nucleic acid
shown as SEQ ID N0: 23, or fragment thereof, which
encodes a butyrylcholinesterase variant encompassing the
same or substantially the same amino acid sequence shown
as SEQ ID NO: 24. As shown in Table 1, the nucleic acid
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
43
shown as SEQ ID: 23 differs from the nucleic acid
encoding human butyrylcholinesterase shown in Figure 3
and designated SEQ ID N0: 43, at the colon position
encoding amino acid residue 332. In the human
butyrylcholinesterase (SEQ ID N0: 43) the colon tat
encodes Tyrosine at amino acid position 332. In
contrast, in the nucleic acid encoding the Y332P
butyrylcholinesterase variant designated SEQ ID NO: 24,
the colon cca encodes Proline at amino acid position 332.
The invention provides a further nucleic acid
shown as SEQ ID N0: 25, or fragment thereof, which
encodes a butyrylcholinesterase variant encompassing the
same or substantially the same amino acid sequence shown
as SEQ ID NO: 26. As shown in Table l, the nucleic acid
shown as SEQ ID: 25 differs from the nucleic acid
encoding human butyrylcholinesterase shown in Figure 3
and designated SEQ ID N0: 43, at the colon position
encoding amino acid residue 331. In the human
butyrylcholinesterase (SEQ ID N0: 43) the colon gtc
encodes Valine at amino acid position 331. In contrast,
in the nucleic acid encoding the V331L
butyrylcholinesterase variant designated SEQ ID N0: 26,
the colon ttg encodes Leucine at amino acid position 331.
The invention provides a further nucleic acid
shown as SEQ ID NO: 27, or fragment thereof, which
encodes a butyrylcholinesterase variant encompassing the
same or substantially the same amino acid sequence shown
as SEQ ID N0: 28. As shown in Table 1, the nucleic acid
shown as SEQ ID: 27 differs from the nucleic acid
encoding human butyrylcholinesterase shown in Figure 3
and designated SEQ ID NO: 43, at the colon position
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
44
encoding amino acid residue 227. In the human
butyrylcholinesterase (SEQ ID NO: 43) the codon ttt
encodes Phenylalanine at amino acid position 227. In
contrast, in the nucleic acid encoding the F227A
butyrylcholinesterase variant designated SEQ ID N0: 28,
the codon gcg encodes Alanine at amino acid position 227.
The invention provides a further nucleic acid
shown as SEQ ID N0: 29, or fragment thereof, which
encodes a butyrylcholinesterase variant encompassing the
same or substantially the same amino acid sequence shown
as SEQ ID N0: 30. As shown in Table 1, the nucleic acid
shown as SEQ ID: 29 differs from the nucleic acid
encoding human butyrylcholinesterase shown in Figure 3
and designated SEQ ID N0: 43, at the codon position
encoding amino acid residue 227. In the human
butyrylcholinesterase (SEQ ID N0: 43) the codon ttt
encodes Phenylalanine at amino acid position 227. In
contrast, in the nucleic acid encoding the F227G
butyrylcholinesterase variant designated SEQ ID N0: 30,
the codon ggg encodes Glycine at amino acid position 227.
The invention provides a further nucleic acid
shown as SEQ ID N0: 31, or fragment thereof, which
encodes a butyrylcholinesterase variant encompassing the
same or substantially the same amino acid sequence shown
as SEQ ID N0: 32. As shown in Table 1, the nucleic acid
shown as SEQ ID: 31 differs from the nucleic acid
encoding human butyrylcholinesterase shown in Figure 3
and designated SEQ ID N0: 43, at the codon position
encoding amino acid residues 227. In the human
butyrylcholinesterase (SEQ ID NO: 43) the codon ttt
encodes Phenylalanine at amino acid position 227. In
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
contrast, in the nucleic acid encoding the F227S
butyrylcholinesterase variant designated SEQ ID N0: 32,
the colon agt encodes Serine at amino acid position 227.
The invention provides a further nucleic acid
5 shown as SEQ ID NO: 33, or fragment thereof, which
encodes a butyrylcholinesterase variant encompassing the
same or substantially the same amino acid sequence shown
as SEQ ID N0: 34. As shown in Table 1, the nucleic acid
shown as SEQ ID: 33 differs from the nucleic acid
10 encoding human butyrylcholinesterase shown in Figure 3
and designated SEQ ID NO: 43, at the colon position
encoding amino acid residues 227. In the human
butyrylcholinesterase (SEQ ID N0: 43) the colon ttt
encodes Phenylalanine at amino acid position 227. In
15 contrast, in the nucleic acid encoding the F227P
butyrylcholinesterase variant designated SEQ ID NO: 34,
the colon ccg encodes Proline at amino acid position 227.
The invention provides a further nucleic acid
shown as SEQ ID NO: 35, or fragment thereof, which
20 encodes a butyrylcholinesterase variant encompassing the
same or substantially the same amino acid sequence shown
as SEQ ID N0: 3~. As shown in Table 1, the nucleic acid
shown as SEQ ID: 35 differs from the nucleic acid
encoding human butyrylcholinesterase shown in Figure 3
25 and designated SEQ ID NO: 43, at the colon position
encoding amino acid residue 227. In the human
butyrylcholinesterase (SEQ ID N0: 43) the colon ttt
encodes Phenylalanine at amino acid position 227. Tn
contrast, in the nucleic acid encoding the F227T
30 butyrylcholinesterase variant designated SEQ ID N0: 36,
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
46
the codon act encodes Threonine at amino acid position
227.
The invention provides a further nucleic acid
shown as SEQ ID N0: 37, or fragment thereof, which
encodes a butyrylcholinesterase variant encompassing the
same or substantially the same amino acid sequence shown
as SEQ ID N0: 38. As shown in Table 1, the nucleic acid
shown as SEQ ID: 37 differs from the nucleic acid
encoding human butyrylcholinesterase shown in Figure 3
and designated SEQ ID N0: 43, at the codon position
encoding amino acid residue 227. In the human
butyrylcholinesterase (SEQ ID N0: 43) the codon ttt
encodes Phenylalanine at amino acid position 227. In
contrast, in the nucleic acid encoding the F227C
butyrylcholinesterase variant designated SEQ ID N0: 38,
the codon tgt encodes Cysteine at amino acid position
227.
The invention provides a further nucleic acid
shown as SEQ ID N0: 39, or fragment thereof, which
encodes a butyrylcholinesterase variant encompassing the
same or substantially the same amino acid sequence shown
as SEQ ID N0: 40. As shown in Table 1, the nucleic acid
shown as SEQ ID: 39 differs from the nucleic acid
encoding human butyrylcholinesterase shown in Figure 3
and designated SEQ ID N0: 43, at the codon position
encoding amino acid residue 227. In the human
butyrylcholinesterase (SEQ ID N0: 43) the codon ttt
encodes Phenylalanine at amino acid position 227. In
contrast, in the nucleic acid encoding the F227M
butyrylcholinesterase variant designated SEQ ID N0: 40,
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
47
the codon atg encodes Methionine at amino acid position
227.
The invention provides a further nucleic acid
shown as SEQ ID N0: 41, or fragment thereof, which
encodes a butyrylcholinesterase variant encompassing the
same or substantially the same amino acid sequence shown
as SEQ ID N0: 42. As shown in Table l, the nucleic acid
shown as SEQ ID: 41 differs from the nucleic acid
encoding human butyrylcholinesterase shown in Figure 3
and designated SEQ ID N0: 43, at the codon position
encoding amino acid residue 199. In the human
butyrylcholinesterase (SEQ ID N0: 43) the codon gca
encodes Alanine at amino acid position 199. In contrast,
in the nucleic acid encoding the A199S
butyrylcholinesterase variant designated SEQ ID N0: 42,
the codon tca encodes Serine at amino acid position 199.
The invention provides a further nucleic acid
shown as SEQ ID N0: 51, or fragment thereof, which
encodes a butyrylcholinesterase variant encompassing the
same or substantially the same amino acid sequence shown
as SEQ ID N0: 52. As shown in Table 1, the nucleic acid
shown as SEQ ID: 51 differs from the nucleic acid
encoding human butyrylcholinesterase shown in Figure 3
and designated SEQ ID N0: 43, at the codon position
encoding amino acid residue 328. In the human
butyrylcholinesterase (SEQ ID N0: 43) the codon get
encodes Alanine at amino acid position 328. In contrast,
in the nucleic acid encoding the A328W
butyrylcholinesterase variant designated SEQ ID N0: 52,
the codon tgg encodes Tryptophane at amino acid position
328.
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
48
The invention provides a further nucleic acid
shown as SEQ ID N0: 53, or fragment thereof, which
encodes a butyrylcholinesterase variant encompassing the
same or substantially the same amino acid sequence shown
as SEQ ID N0: 54. As shown in Table 1, the nucleic acid
shown as SEQ ID: 53 differs from the nucleic acid
encoding human butyrylcholinesterase shown in Figure 3
and designated SEQ ID NO: 43, at the codon position
encoding amino acid residue 287. In the human
butyrylcholinesterase (SEQ ID N0: 43) the codon tca
encodes Serine at amino acid position 287. In contrast,
in the nucleic acid encoding the S287G
butyrylcholinesterase variant designated SEQ ID NO: 54,
the codon ggt encodes Glycine at amino acid position 287.
The invention provides a further nucleic acid
shown as SEQ ID N0: 55, or fragment thereof, which
encodes a butyrylcholinesterase variant encompassing the
same or substantially the same amino acid sequence shown
as SEQ ID N0: 56. As shown in Table l, the nucleic acid
shown as SEQ ID: 55 differs from the nucleic acid
encoding human butyrylcholinesterase shown in Figure 3
and designated SEQ ID N0: 43, at the codon position
encoding amino acid residue 285. In the human
butyrylcholinesterase (SEQ ID NO: 43) the codon cct
encodes Proline at amino acid position.285. In contrast,
in the nucleic acid encoding the P285Q
butyrylcholinesterase variant designated SEQ ID N0: 56,
the codon cag encodes Glutamine at amino acid~position
285.
The invention provides a further nucleic acid
shown as SEQ ID NO: 57, or fragment thereof, which
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
49
. encodes a butyrylcholinesterase variant encompassing the
same or substantially the same amino acid sequence shown
as SEQ ID N0: 58. As shown in Table 1, the nucleic acid
shown as SEQ ID: 57 differs from the nucleic acid
encoding human butyrylcholinesterase shown in Figure 3
and designated SEQ ID NO: 43, at the colon position
encoding amino acid residue 285. In the human
butyrylcholinesterase (SEQ ID NO: 43) the colon cct
encodes Proline at amino acid position 285. In contrast,
in the nucleic acid encoding the P285S
butyrylcholinesterase variant designated SEQ ID N0: 58,
the colon tcg encodes Serine at amino acid position 285.
The A328W butyrylcholinesterase variant (SEQ ID
N0: 52) was obtained by PCR site-directed mutagenesis of
human butyrylcholinesterase as described in Example I
below and exhibits at least a seven-fold to fifteen-fold
increase in cocaine hydrolysis activity compared to human
butyrylcholinesterase. The butyrylcholinesterase
variants designated SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14,
16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42,
54, 56 and 58, were obtained as described in Examples II
through VI below and exhibit increased cocaine hydrolysis
activity compared to human butyrylcholinesterase as
described herein for each variant.
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
Table 1. Nucleotide Sequences Corresponding to Amino
Acid Positions 1.99, 227, 285, 287, 328, 331 and 332.
Codon sequences that differ from human
butyrylcholinesterase (SEQ ID N0: 43) are set forth
5 below.
SEQ 199 227 285 287 328 331 332
ID NO
na (aa)
Human BchE 43 (44) gca ttt cct tca get gtc tat
A328W/Y332M 1 (2) tgg atg
A328W/Y332P 3 (4) tgg cca
A328W/V331L 5 (6) tgg ttg
10 A328W/Y332S 7 (8) tgg tcg
A328W/Y332M/52879 (10) tca gcg ggt tgg atg
G
/F227A/A199S
A328W/S287G 11(12) tca gcg ggt tgg
15 /F227A/A199S
A328W/S287G/A19913 (14) tca ggt tgg
S
A328W/S287G/F22715 (16) gcg ggt tgg
A
20 A328W/F227A 17 (18) gcg tgg
Y332S 19 (20) tcg
Y332M 21 (22) atg
Y332P 23 (24) cca
V331L 25 (26) ttg
25 F227A 27 (28) gcg
F227G 29 (30) ggg
F227S 31 (32) agt
F227P 33(34) ccg
F227T 35 (36) act
3 F227C 37 (38) tgt
0
F227M 39 (40) atg
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
51
SEQ 199 227 285 287 328 331 332
ID NO
na (aa)
A199S 41 (42)tca
A328W 51(52) tgg
S287G 53(54) ggt
P285Q 55(56) cag
P285S 57(58) tcg
Thus, the invention provides twenty-five
nucleic acids shown as SEQ ID N0: SEQ ID NOS: 1, 3, 5, 7,
9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35,
37, 39, 41, 51, 53, 55 and 57, respectively, or fragments
thereof, which encode the butyrylcholinesterase variants
encompassing the same or substantially the same amino
acid sequences shown as SEQ ID NOS: 2, 4, 6, 8, 10, 12,
14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40,
42, 52, 54, 56 and 58, respectively.
A butyrylcholinesterase variant can be obtained
by screening a library or collection of molecules. A
library can contain a few or a large number of different
molecules, varying from as small as 2 molecules to as
large as 103 or more molecules. Therefore, a library can
range in size from 2 to 10, 10 to 10z, 102 to 103, 103 to
105, 105 to 108, 10B to 101° or 101° to 1013 molecules .
The molecules making up a library can be nucleic acid
molecules such as an RNA, a cDNA or an oligonucleotide; a
peptide or polypeptide including a variant or modified
peptide or a peptide containing one or more amino acid
analogs. In addition, the molecules making up a library
can be peptide-like molecules, referred to herein as
peptidomimetics, which mimic the activity of a peptide;
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
52
peptidomimetics, which mimic the activity of a peptide
or a polypeptide such as an enzyme or a fragment thereof.
Moreover, a library can be diverse or redundant depending
on the intent and needs of the user. Those skilled in
the art will know the size and diversity of a library
suitable for obtaining a butyrylcholinesterase variant
polypeptide.
The invention also provides a library of
butyrylcholinesterase variants having at least one amino
acid alteration in one or more regions of
butyrylcholinesterase corresponding to amino acid
positions 68-82 (SEQ ID NO: 59), 110-121 (SEQ ID N0: 60),
194-201 (SEQ ID N0: 61), 224-234 (SEQ ID N0: 62), 277-289
(SEQ ID N0: 63), 327-332 (SEQ ID N0: 64) or 429-442 (SEQ
ID N0: 65) of butyrylcholinesterase or functional
fragment therof, wherein the library of
butyrylcholinesterase variants of the invention has at
least one butyrylcholinesterase variant exhibiting
enhanced cocaine hydrolysis activity compared to
butyrylcholinesterase, with the proviso that a
butyrylcholinesterase variant having a single amino acid
alteration is not the human butyrylcholinesterase having
Y at position 328. The invention further provides a
library of butyrylcholinesterase variants wherein said
butyrylcholinesterase variants have at least two amino
acid alterations.
In addition, the invention provides seven
distinct libraries of butyrylcholinesterase variants,
each variant having at least one amino acid alteration in
a region of butyrylcholinesterase corresponding to amino
acid positions 68-82 (SEQ ID N0: 59), 110-121 (SEQ ID N0:
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
53
60), 194-201 (SEQ ID N0: 61), 224-234 (SEQ ID N0: 62),
277-289 (SEQ ID N0: 63), 327-332 (SEQ ID NO: 64) or 429-
442 (SEQ ID NO: 65) of butyrylcholinesterase or
functional fragment thereof, respectively. A library of
butyrylcholinesterase variants of the invention can be
used to screen for butyrylcholinesterase variants with
increased cocaine hydrolysis activity.
As used herein, the term "library" means a
collection of molecules. A library can contain a few or
a large number of different molecules, varying from as
small as 2 molecules to as large as 1013 or more
molecules. Therefore, a library can range in size from 2
to 10, 10 to 102, 102 to 103, 103 to 105, 105 to 108, 10$ to
101° or 101° to 1013 molecules . The molecules making up a
library can be nucleic acid molecules such as an RNA, a
cDNA or an oligonucleotide; a peptide or polypeptide
including a variant or modified peptide or a peptide
containing one or more amino acid analogs. In addition,
the molecules making up a library can be peptide-like
molecules, referred to herein as peptidomimetics, which
mimic the activity of a peptide; or a polypeptide such as
an enzyme or a fragment thereof. Moreover, a library can
be diverse or redundant depending on the intent and needs
of the user. Those skilled in the art will know the size
and diversity of a library suitable for a particular
application.
As used herein, the term "corresponding to"
refers to an amino acid sequence that is substantially
the same as a reference amino acid sequence. The amino
acid sequence can occupy the same or different amino acid
positions relative to the reference polypeptide, fragment
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
54
or segment. It is understood that, while
butyrylcholinesterases of different species origin as
well as allelic variations will have substantially
identical amino acid sequences, the physical locations as
well as the size of a particular amino acid sequence may
vary. Therefore, the amino acids making up a given
segment in a butrylcholinesterase or
butyrylcholinesterase variant may not be in the same
physical location or occupy the identical amino acid
positions as in the reference butyrylcholinesterase or
butyrylcholinesterase variant. For example,
butyrylcholinesterases of different species origin as
well as allelic variations have substantially similar
amino acid sequences, but the amino acid positions making
up a region may not correspond to those recited for SEQ
ID NOS: 59 through 65. For example, a region that is
substantially similar in amino acid sequence to the
region designated as SEQ ID N0: 59 may not occupy amino
acid positions 68-82 in a non-human butyrylcholinesterase
or an allelic variation of any species origin, but is
nevertheless encompassed by the present invention.
As used herein, the term "region" is intended
to refer to an area of the amino acid sequence of
butyrylcholinesterase that is determined or predicted to
be important for cocaine hydrolysis activity. As
described below, a region has been determined or
predicted to be important for cocaine hydrolysis activity
by using one or more of structural, biochemical or
modeling methods and, as a consequence, is defined by
general rather than absolute boundaries. A region can
encompass two or more consecutive amino acid positions of
the amino acid sequence of butyrylcholinesterase that are
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
predicted to be important for cocaine hydrolysis
activity. A region of butyrylcholinesterase useful for
practicing the claimed invention is no more than about 30
amino acids in length and preferably is between 2 and 20,
5 between 5 and 15 amino acids in length.
As used herein, the term "alteration" is
intended to refer to a modification at an amino acid
position of butyrylcholinesterase. An amino acid
alteration therefore can be a substitution, deletion or
10 any other structural modification at an amino acid
position. An amino acid alteration can occur directly at
the amino acid level or result from translation of a
nucleic acid encoding an amino acid alteration. An amino
acid alteration can lead to the replacement of an amino
15 acid with an another amino acid or with an amino acid
analog. Examples of an amino acid alteration include the
amino acid substitution of Alanine (A) with Tryptophane
(W) resulting in the butyrylcholinesterase variant
designated SEQ ID NO: 52; the amino acid substitution of
20 Serine (S) with Glycine (G) resulting in the
butyrylcholinesterase variant designated SEQ ID N0: 54;
the amino acid substitution of Proline (P) with Glutamine
(Q) resulting in the butyrylcholinesterase variant
designated SEQ ID NO: 56; and the amino acid substitution
25 of Proline (P) with Serine (S) resulting in the
butyrylcholinesterase variant designated SEQ TD N0: 58.
A library that is sufficiently diverse to
contain a butyrylcholinesterase variant with enhanced
30 cocaine hydrolysis activity can be prepared by a variety
of methods well known in the art. For example, a library
of butyrylcholinesterase variants can be prepared that
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
56
contains each of the 19 amino acids not found in the
reference butyrylcholinesterase at each of the
approximately 573 amino acid positions and screening the
resultant variant library for butyrylcholinesterase
variants with enhanced cocaine hydrolysis activity.
Alternatively, a butyrylcholinesterase variant
polypeptide can be obtained from focused library prepared
utilizing the structural, biochemical and modeling
information relating to butyrylcholinesterase as
described herein. It is understood that any information
relevant to the determination or prediction of residues
or regions important for the cocaine hydrolysis activity
or structural function of butyrylcholinesterase can be
useful in the design of a focused library of
l5 butyrylcholinesterase variants. Thus, the
butyrylcholinesterase variants can be focused to contain
amino acid alterations at amino acid positions located in
regions determined or predicted to be important for
cocaine hydrolysis activity. A focused library of
butyrylcholinesterase variants can be screened in order
to identify a butyrylcholinesterase variant with enhanced
cocaine hydrolysis activity by targeting amino acid
alterations to regions determined or predicted to be
important for cocaine hydrolysis activity.
Regions important for the cocaine hydrolysis
activity of butyrylcholinesterase can be determined or
predicted. Related enzymes such as, for example,
acetylcholinesterase and carboxylesterase, that share a
high degree of sequence similarity and have biochemically
similar catalytic properties can provide information
regarding the regions important for catalytic activity of
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
57
butyrylcholinesterase. For example, structural modeling
can reveal the active site of an enzyme, which is a
three-dimensional structure such as a cleft, gorge or
crevice formed by amino acid residues generally located
apart from each other in primary structure. Therefore,
amino acid residues that make up regions of
butyrylcholinesterase important for cocaine hydrolysis
activity can include residues located along the active
site gorge. For a description of structural modeling of
butyrylcholinesterase, see for example, Harel et al.,
Proc. Nat. Acad. Sci. USA 89: 10827-10831 (1992) and
Soreq et al., Trends Biochem. Sci. 17(9): 353-358 (1992),
which are incorporated herein by reference.
In addition to structural modeling of
butyrylcholinesterase, biochemical data can be used to
determine or predict regions of butyrylcholinesterase
important for cocaine hydrolysis activity. In this
regard, the characterization of naturally occurring
butyrylcholinesterase variants with altered cocaine
hydrolysis activity is useful for identifying regions
important for the catalytic activity of
butyrylcholinesterase. Similarly, site-directed
mutagenesis studies can provide data regarding
catalytically important amino acid residues as reviewed,
for example, in Schwartz et al., Pharmac. Ther. 67:
283-322 (1992), which is incorporated by reference.
To generate a library of butyrylcholinesterase
variants having enhanced cocaine hydrolysis activity,
distinct types of information can be used alone or
combined to determine or predict a region of an amino
acid sequence or a specific amino acid residue of
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
58
butyrylcholinesterase important for cocaine hydrolysis
activity. For example, information based on structural
modeling and biochemical data is combined to determine a
region of an amino acid sequence a region of an amino
acid sequence or a specific amino acid residue of
butyrylcholinesterase important for cocaine hydrolysis
activity. Because information obtained by a variety of
methods can be combined to predict the catalytically
active regions, one skilled in the art will appreciate
that the regions themselves represent approximations
rather than strict confines. As a result, a
butyrylcholinesterase variant can have amino acid
alterations outside of the regions determined or
predicted to be important for cocaine hydrolysis
activity. Similarly, a butyrylcholinesterase variant of
the invention can have amino acid alterations outside of
the regions determined or predicted to be important for
cocaine hydrolysis activity. Furthermore, a
butyrylcholinesterase variant of the invention can have
any other modification that does not significantly change
its cocaine hydrolysis activity. It is further
understood that the number of regions determined or
predicted to be important for cocaine hydrolysis activity
can vary based on the predictive methods used.
Once a number of regions or specific residues
have been identified by any method appropriate for
determination of regions or specific amino acid residues
important for cocaine hydrolysis, each region or specific
positions can be randomized across some or all amino acid
positions to create a library of variants containing the
wild-type amino acid plus one or more of the other
nineteen naturally occurring amino acids at one or more
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
59
positions within each of the regions. As summarised in
Table 2, regions of an amino acid sequence of
butyrylcholinesterase important for cocaine hydrolysis
can include, for example, amino acid residues 68 through
82, 110 through 121, 194 through 201, 224 through 234,
277 through 289, 327 through 332, and 429 through 442
corresponding to the human butyrylcholinesterase
designated SEQ ID N0: 44. Seven regions of an amino acid
sequence of butyrylcholinesterase selected for the
focused library of butyrylcholinesterase variants
provided by the invention are shown in Table 2.
Table 2. Summary of Butyrylcholinesterase Libraries
Region Location Length # Variants Species Diversity
1 68-82 15 285 3
2 110-121 12 228 3
3 194-201 8 152 1
4 224-234 11 209 2
5 277-289 13 247 8
6 327-332 6 114 0
7 429-442 14 266 0
Total 79 1,501
13.8%
The location of the regions of the amino acid
sequence of butyrylcholinesterase shown in Table 2 are
shown in reference to the amino acid sequence of human
butyrylcholinesterase (Figure 2). The number of
butyrylcholinesterase variants for each region reflects
one variant for each of 19 amino acid substitutions at
each position compared to human butyrylcholinesterase and
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
a total library sire of 1,501 variants. Species
diversity indicates the number of positions within each
region that have a naturally occurring amino acid
difference compared to human butyrylcholinesterase. With
5 regard to libraries of the invention, a naturally
occurring butyrylcholinesterase can be of any species
origin, for example, human, primate, horse, or murine.
Therefore, a butyrylcholinesterase can be, for example a
mammalian butyrylcholinesterase. In addition, a
10 butyrylcholinesterase of the invention can be an isotype
variation, polymorphism or any other allelic variation of
a naturally occurring butyrylcholinesterase. A nucleic
acid encoding a butyrylcholinesterase of the invention
encodes a polypeptide having the sequence of any
15 naturally occurring butyrylcholinesterase. Therefore, a
nucleic acid encoding a butyrylcholinesterase can encode
a butyrylcholinesterase of any species origin, for
example, human, primate, horse, or murine. In addition,
a nucleic acid encoding a butyrylcholinesterase
20 encompasses any naturally occurring allele, isotype or
polymorphism.
Methods for preparing libraries containing
diverse populations of various types of molecules such as
peptides, peptoids and peptidomimetics are well known in
25 the art (see, for example, Ecker and Crooke,
Biotechnoloay 13:351-360 (1995), and Blondelle et al.,
Trends Anal. Chem. 14:83-92 (1995), and the references
cited therein, each of which is incorporated herein by
reference; see, also, Goodman and Ro, Peptidomimetics for
30 Drua Design, in "Burger's Medicinal Chemistry and Drug
Discovery" Vol. 1 (ed. M.E. Wolff; John Wiley & Sons
1995), pages 803-861, and Gordon et al., J. Med. Chem.
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
61
37:1385-1401 (1994), each of which is incorporated herein
by reference). Where a molecule is a peptide, protein or
fragment thereof, the molecule can be produced in sritro
directly or can be expressed from a nucleic acid, which
can be produced in vitr~. Methods of synthetic peptide
chemistry are well known in the art.
A library of butyrylcholinesterase variants of
the invention also can be produced, for example, by
constructing and subsequently screening a nucleic acid
expression library encoding butyrylcholinesterase
variants. Methods fox producing such libraries are well
known in the art (see, for example, Sambrook et al.,
supra, 1989). A library of nucleic acids can be composed
of DNA, RNA or analogs thereof. A library containing RNA
molecules can be constructed, for example, by
synthesizing the RNA molecules chemically.
The invention also provides a library of
nucleic acids encoding butyrylcholinesterase variants,
each nucleic acid having at least one codon encoding at
least one amino acid alteration in one or more regions of
butyrylcholinesterase corresponding to amino acid
positions 68-82 (SEQ ID NO: 59), 110-121 (SEQ ID NO: 60),
194-201 (SEQ ID N0: 61), 224-234 (SEQ ID NO: 62), 277-289
(SEQ ID N0: 63), 327-332 (SEQ ID N0: 64) or 429-442 (SEQ
ID N0: 65) of butyrylcholinesterase, wherein at least one
of the nucleic acids encodes a butyrylcholinesterase
variant having enhanced cocaine hydrolysis activity
compared to butyrylcholinesterase, with the proviso that
a butyrylcholinesterase variant having a single amino
acid alteration is not the human butyrylcholinesterase
having Y at position 328.
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
62
The invention further provides seven distinct
libraries of nucleic acids encoding butyrylcholinesterase
variants, each nucleic acid having at least one codon
encoding at least one amino acid alteration in a region
of butyrylcholinesterase corresponding to amino acid
positions 68-82 (SEQ ID N0: 59), 110-121 (SEQ ID N0: 60),
194-201 (SEQ ID NO: 61), 224-234 (SEQ ID N0: 62), 277-289
(SEQ ID N0: 63), 327-332 (SEQ ID NO: 64) or 429-442 (SEQ
ID N0: 65) of butyrylcholinesterase, respectively.
A library of nucleic acids encoding a
butyrylcholinesterase variant can be obtained by any
means desired by the user. Those skilled in the art will
know what methods can be used to obtain a nucleic acid
encoding butyrylcholinesterase variant of the invention.
For example, a butyrylcholinesterase variant can be
generated by mutagenesis of nucleic acids encoding
butyrylcholinesterase using methods well known to those
skilled in the art (Molecular Cloning: A Laboratory
Manual, Sambrook et al., supra, 1989). A
butyrylcholinesterase variant of the invention can be
obtained from a library of nucleic acids that is
randomized to be sufficiently diverse to contain nucleic
acids encoding every possible naturally occurring amino
acid at each amino acid position of
butyrylcholinesterase. Alternatively, a
butyrylcholinesterase variant of the invention can be
obtained from a library of nucleic acids such that it
contains a desired amino acid at a predetermined position
predicted or determined to be important for cocaine
hydrolysis activity.
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
63
One or more mutations can be introduced into a
nucleic acid molecule encoding a butyrylcholinesterase
variant to yield a modified nucleic acid molecule using,
for example, site-directed mutagenesis (see Wu (Ed.),
Meth. In Enzymol. Vol. 217, San Diego: Academic Press
(1993); Higuchi, "Recombinant PCR" in Innis et al. (Ed.),
PCR Protocols, San Diego: Academic Press, Inc. (1990),
each of which is incorporated herein by reference). Such
mutagenesis can be used to introduce a specific, desired
amino acid alteration.
The efficient synthesis and expression of
libraries of butyrylcholinesterase variants using
oligonucleotide-directed mutagenesis can be accomplished
as previously described by Wu et al., Proc. Natl. Acad.
Sci. USA, 95:6037-6042 (1998); Wu et al., J. Mol. Biol.,
294:151-162 (1999); and Kunkel, Proc. Natl. Acad. Sci.
USA, 82:488-492 (1985), which are incorporated herein by
reference. Oligonucleotide-directed mutagenesis is a
well-known and efficient procedure for systematically
introducing mutations, independent of their phenotype and
is, therefore, ideally suited for directed evolution
approaches to protein engineering. To perform
oligonucleotide-directed mutagenesis a library of nucleic
acids encoding the desired mutations is hybridized to
single-stranded uracil-containing template of the
wild-type sequence. The methodology is flexible,
permitting precise mutations to be introduced without the
use of restriction enzymes, and is relatively inexpensive
if oligonucleotides are synthesized using codon-based
mutagenesis.
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
64
Codon-based synthesis or mutagenesis represents
one method well known in the art for avoiding genetic
redundancy while rapidly and efficiently producing a
large number of alterations in a known amino acid
sequence or for generating a diverse population of random
sequences. This method is the subject matter of U.S.
Patent Nos. 5,264,563 and 5,523,388 and is also described
in Glaser et al. J. Immunoloay 149:3903-3913 (1992).
Briefly, coupling reactions for the randomization of, for
example, all twenty codons which specify the amino acids
of the genetic code are performed in separate reaction
vessels and randomization for a particular codon position
occurs by mixing the products of each of the reaction
vessels. Following mixing, the randomized reaction
products corresponding to codons encoding an equal
mixture of all twenty amino acids are then divided into
separate reaction vessels for the synthesis of each
randomized codon at the next position. If desired, equal
frequencies of all twenty amino acids can be achieved
with twenty vessels that contain equal portions of the
twenty codons. Thus, it is possible to utilize this
method to generate random libraries of the entire
sequence of butyrylcholinesterase or focused libraries of
the regions or specific positions determined or predicted
to be important for cocaine hydrolysis activity.
Variations to the above synthesis method also
exist and include, for example, the synthesis of
predetermined codons at desired positions and the biased
synthesis of a predetermined sequence at one or more
codon positions as described by Wu et al, supra, 1998.
Biased synthesis involves the use of two reaction vessels
where the predetermined or parent codon is synthesized in
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
one vessel and the random codon sequence is synthesized
in the second vessel. The second vessel can be divided
into multiple reaction vessels such as that described
above for the synthesis of codons specifying totally
5 random amino acids at a particular position.
Alternatively, a population of degenerate codons can be
synthesized in the second reaction vessel such as through
the coupling of NNG/T nucleotides or NNX/X where N is a
mixture of all four nucleotides. Following synthesis of
10 the predetermined and random codons, the reaction
products in each of the two reaction vessels are mixed
and then redivided into an additional two vessels for
synthesis at the next codon position.
A modification to the above-described
15 codon-based synthesis for producing a diverse number of
variant sequences can similarly be employed for the
production of the libraries of butyrylcholinesterase
variants desoribed herein. This modification is based on
the two vessel method described above which biases
20 synthesis toward the parent sequence and allows the user
to separate the variants into populations containing a
specified number of codon positions that have random
codon changes.
Briefly, this synthesis is performed by
25 continuing to divide the reaction vessels after the
synthesis of each codon position into two new vessels.
After the division, the reaction products from each
consecutive pair of reaction vessels, starting with the
second vessel, is mixed. This mixing brings together the
30 reaction products having the same number of codon
positions with random changes. Synthesis proceeds by
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
66
then dividing the products of the first and last vessel
and the newly mixed products from each consecutive pair
of reaction vessels and redividing into two new vessels.
In one of the new vessels, the parent colon is
synthesized and in the second vessel, the random colon is
synthesized. For example, synthesis at the first colon
position entails synthesis of the parent colon in one
reaction vessel and synthesis of a random colon in the
second reaction vessel. For synthesis at the second
colon position, each of the first two reaction vessels is
divided into two vessels yielding two pairs of vessels.
For each pair, a parent colon is synthesized in one of
the vessels and a random colon is synthesized in the
second vessel. When arranged linearly, the reaction
products in the second and third vessels are mixed to
bring together those products having random colon
sequences at single colon positions. This mixing also
reduces the product populations to three, which are the
starting populations for the next round of synthesis.
Similarly, for the third, fourth and each remaining
position, each reaction product population for the
preceding position are divided and a parent and random
colon synthesized.
Following the above modification of colon-based
esynthesis, populations containing random colon changes at
one, two, three and four positions as well as others can
be conveniently separated out and used based on the need
of the individual. Moreover, this synthesis scheme also
allows enrichment of the populations for the randomized
sequences over the parent sequence since the vessel
containing only the parent sequence synthesis is
similarly separated out from the random colon synthesis.
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
67
This method can be used to synthesize a library of
nucleic acids encoding butyrylcholinesterase variants
having amino acid alterations in one or more regions of
butyrylcholinesterase predicted to be important for
cocaine hydrolysis activity.
Alternatively, a library of nucleic acids
encoding butyrylcholinesterase variants can also be
generated using gene shuffling. Gene shuffling or DNA
shuffling is a method for directed evolution that
generates diversity by recombination (see, for example,
Stammer, Proc. Natl. Acad. Sci. USA 91:10747-10751
(1994) Stammer, Nature 370:389-391 (1994); Crameri et
al., Nature 391:288-291 (1998); Stammer et al., U.S.
Patent No. 5,830,721, issued November 3, 1998). Gene
shuffling or DNA shuffling is a method using in vitro
homologous recombination of pools of selected mutant
genes. For example, a pool of point mutants of a
particular gene can be used. The genes are randomly
fragmented, for example, using DNase, and reassembled by
PCR. If desired, DNA shuffling can be carried out using
homologous genes from different organisms to generate
diversity (Crameri et al., supra, 1998). The
fragmentation and reassembly can be carried out in
multiple rounds, if desired. The resulting reassembled
genes constitute a library of butyrylcholinesterase
variants that can be used in the invention compositions
and methods.
Thus, the invention also provides a library of
nucleic acids encoding butyrylcholinesterase variants,
each nucleic acid having at least one codon encoding at
least one amino acid alteration in one or more regions of
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
68
butyrylcholinesterase corresponding to amino acid
positions 68-82 (SEQ ID N0: 59), 110-121 (SEQ ID N0: 60),
194-201 (SEQ ID N0: 61), 224-234 (SEQ ID N0: 62), 277-289
(SEQ ID NO: 63), 327-332 (SEQ ID N0: 64) or 429-442 (SEQ
ID NO: 65) of butyrylcholinesterase, wherein at least one
of the nucleic acids encodes a butyrylcholinesterase
variant having enhanced cocaine hydrolysis activity
compared to butyrylcholinesterase, with the proviso that
a butyrylcholinesterase variant having a single amino
acid alteration is not the human butyrylcholinesterase
having Y at position 328.
The invention nucleic acids encoding
butyrylcholinesterase variants and libraries thereof can
be expressed in a variety of eukaryotic cells. For
example, the nucleic acids can be expressed in mammalian
cells, insect cells, plant cells, and non-yeast fungal
cells. Mammalian cell lines useful for expressing the
invention library of nucleic acids encoding
butyrylcholinesterase variants include, for example,
Chinese Hamster Ovary (CHO), human T293 and Human NIH 3T3
cell lines. Expression of the invention library of
nucleic acids encoding butyrylcholinesterase variants can
be achieved by both stable or transient cell transfection
(see Example III, Table 6).
The incorporation of variant nucleic acids or
heterologous nucleic acid fragments at an identical site
in the genome functions to create isogenic cell lines
that differ only in the expression of a particular
variant or heterologous nucleic acid. Incorporation at a
single site minimizes positional effects from integration
at multiple sites in a genome that affect transcription
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
69
of the mRNA encoded by the nucleic acid and complications
from the incorporation of multiple copies or expression
of more than one nucleic acid species per cell.
Techniques known in the art that can be used to target a
variant or a heterologous nucleic acid to a specific
location in the genome include, for example, homologous
recombination, retroviral targeting and
recombinase-mediated targeting.
One approach for targeting variant or
heterologous nucleic acids to a single site in the genome
uses Cre recombinase to target insertion of exogenous DNA
into the eukaryotic genome at a site containing a site
specific recombination sequence (Sauer and Henderson,
Proc. Natl. Acad. Sci. USA, 85:5166-5170 (1988);
Fukushige and Sauer, Proc. Natl. Acad. Sci. U.S.A.
89:7905-7909 (1992); Bethke and Sauer, Nuc. Acids Res.,
25:2828-2834 (1997)). In addition to Cre recombinase,
Flp recombinase can also be used to target insertion of
exogenous DNA into a particular site in the genome
(Dymecki, Proc. Natl. Acad. Sci. U.S.A. 93:6191-6196
(1996)). The target site for Flp recombinase consists of
13 base-pair repeats separated by an 8 base-pair spacer:
5'-GAAGTTCCTATTC[TCTAGAAA]GTATAGGAACTTC-3'. As described
herein, the butyrylcholinesterases designated SEQ ID NOS:
2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28; 30,
32, 34, 36, 38, 40, 42, 52, 54, 56 and 58, were obtained
by transfection of variant libraries corresponding to the
regions set forth in Table 2 of human
butyrylcholinesterase into mammalian cells using Flp
recombinase and the human 293T cell line. It is
understood that any combination of site-specific
recombinase and corresponding recombination site can be
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
used in methods of the invention to target a nucleic acid
to a particular site in the genome.
A suitable recombinase can be encoded on a
vector that is co-transfected with a vector containing a
5 nucleic acid encoding a butyrylcholinesterase variant.
Alternatively, the expression element of a recombinase
can be incorporated into the same vector expressing a
nucleic acid encoding a butyrylcholinesterase variant.
In addition to simultaneously transfecting the nucleic
10 acid encoding a recombinase with the nucleic acids
encoding a butyrylcholinesterase variant, a vector
encoding the recombinase can be transfected into a cell,
and the cells can be selected for expression of
recombinase. A cell stably expressing the recombinase
15 can subsequently be transfected with nucleic acids
encoding variant nucleic acids.
As disclosed herein, the precise site-specific
DNA recombination mediated by Cre recombinase can be used
to create stable mammalian transformants containing a
20 single copy of exogenous DNA encoding a
butyrylcholinesterase variant. As exemplified below, the
frequency of Cre-mediated targeting events can be
enhanced substantially using a modified doublelox
strategy. The doublelox strategy is based on the
25 observation that certain nucleotide changes within the
core region of the lox site alter the site selection
specificity of Cre-mediated recombination with little
effect on the efficiency of recombination (Hoess et al.,
Nucleic Acids Res. 14:2287-2300 (1986)). Incorporation
30 of loxP and an altered loxP site, termed 1ox511, in both
the targeting vector and the host cell genome results in
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
71
site-specific recombination by a double crossover event.
The doublelox approach increases the recovery of
site-specific integrants by 20-fold over the single
crossover insertional recombination, increasing the
absolute frequency of site-specific recombination such
that it exceeds the frequency of illegitimate
recombination (Bethke and Sauer, Nuc. Acids Res.,
25:2828-2834 (1997)).
Following the expression of a library of
butyrylcholinesterase variants in a mammalian cell line,
randomly selected clones can be sequenced and screened
for increased cocaine hydrolysis activity. Methods for
sequencing selected clones are well known to those of
skill in the art and are described, for example, in
Sambrook et al., su ra, 1989, and in Ausubel et al.,
supra, 2000. Selecting a suitable method for measuring
the cocaine hydrolysis activity of a
butyrylcholinesterase variant depends on a variety of
factors such as, for example, the amount of the
butyrylcholinesterase variant that is available. The
cocaine hydrolysis activity of a butyrylcholinesterase
variant can be measured, for example, by
spectrophotometry, by a microtiter-based assay utilizing
a polyclonal anti-butyrylcholinesterase antibody to
uniformly capture the butyrylcholinesterase variants and
by high-performance liquid chromatography (HPLC).
Enhanced cocaine hydrolysis activity of a
butyrylcholinesterase variant compared to
butyrylcholinesterase can be determined by a comparison
of catalytic efficiencies. Clones expressing
butyrylcholinesterase variants exhibiting increased
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
72
cocaine hydrolysis activity can sequenced to confirm the
precise location and nature of the mutation. To ensure
that a library of butyrylcholinesterase variants has been
screened exhaustively, screening of each library can be
continued until clones encoding identical
butyrylcholinesterase amino acid alterations have been
identified on multiple occasions.
Clones expressing a butyrylcholinesterase
variant with increased cocaine hydrolysis activity can be
used to established larger-scale cultures suitable for
purifying larger quantities of the butyrylcholinesterase.
A butyrylcholinesterase variant of interest can be cloned
into an expression vector and used to transfect a cell
line, which can subsequently be expanded. Those skilled
in the art will know what type of expression vector is
suitable for a particular application. A
butyrylcholinesterase variant exhibiting increased
cocaine hydrolysis activity can be cloned, for example,
into an expression vector carrying a gene that confers
resistance to a particular chemical agent to allow
positive selection of the transfected cells. An
expression vector suitable for transfection of, for
example, mammalian cell lines can contain a promoter such
as the cytomegalovirus (CMV) promoter for selection in
mammalian cells. As desribed herein, a
butyrylcholinesterase variant can be cloned into a
mammalian expression vector and transfected into Chinese
Hamster Ovary cells (CHO). Expression vectors suitable
for expressing a butyrylcholinesterase variant are well
known in the art and commercially available.
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
73
Clones expressing butyrylcholinesterase
variants can be selected and tested for cocaine
hydrolysis activity. Cells carrying clones exhibiting
enhanced cocaine hydrolysis activity can be expanded by
routine cell culture systems to produce larger quantities
of a butyrylcholinesterase variant of interest. The
concentrated recombinant butyrylcholinesterase variant
can be harvested and purified by methods well known in
the art and described, for example, by Masson et al.,
Biochemistry 36: 2266-2277 (1997), which is incorporated
herein by reference.
A butyrylcholinesterase variant exhibiting
increased cocaine hydrolysis activity in vitro can be
utilized for the treatment of cocaine toxicity and
addiction in v.zvo. The potency for treating cocaine
toxicity of a butyrylcholinesterase variant exhibiting
increased cocaine hydrolysis activity in vitro can be
tested using an acute overdose animal model as disclosed
herein (see Example VII). In addition, animal models of
reinforcement and discrimination are used to predict the
efficacy of a butyrylcholinesterase variant for treatment
of cocaine addiction as disclosed below (see Example
VII). Suitable animal subjects for overdose as well as
reinforcement and discrimination models are known in the
art and include, for example, rodent and primate models.
A butyrylcholinesterase variant effective in reducing
either cocaine toxicity or cocaine addiction in one or
more animal models can be used to treat a cocaine-induced
condition by administering an effective amount of the
butyrylcholinesterase variant to an individual.
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
74
A butyrylcholinesterase variant having an
increased serum half-life can be useful for testing a
butyrylcholinesterase variant in a subject or treating a
cocaine-induced condition in an individual. Useful
methods for increasing the serum half-life of a
butyrylcholinesterase variant include, for example,
conversion of the butyrylcholinesterase variant into a
tetramer, covalently attaching synthetic and natural
polymers such as polyethylene glycol (PEG) and dextrans
to the truncated butyrylcholinesterase variant, liposome
formulations, or expression of the enzyme as an Ig-fusion
protein. Furthermore, conversion of a
butyrylcholineserase variant into a tetramer can be
achieved by co-transfecting the host cell line with the
COLA gene as well as by addition of poly-L-proline to the
media of transfected cells. These and other methods
known in the art for increasing the serum half-life of a
butyrylcholinesterase variant are useful for testing a
butyrylcholinesterase variant in an animal subject or
treating a cocaine-induced condition in an individual.
The invention also provides a method of
hydrolyzing a cocaine-based butyrylcholinesterase
substrate including contacting a butyrylcholinesterase
substrate with a butyrylcholinesterase variant selected
from the group shown as SEQ ID NOS: 2, 4, 6, 8, 10, 12,
14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40,
42, 52, 54, 56 and 58, under conditions that allow
hydrolysis of cocaine into metabolites, wherein the
butyrylcholinesterase variant exhibits increased cocaine
hydrolysis activity compared to butyrylcholinesterase as
described herein for each of these variants.
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
The invention further provides a method of
treating a cocaine-induced condition including
administering to an individual an effective amount of the
butyrylcholinesterase variant selected from the group
5 shown as SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20,
22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 52, 54, 56
and 58, wherein the butyrylcholinesterase variant
exhibits increased cocaine hydrolysis activity compared
to butyrylcholinesterase as described herein for each of
10 these variants.
As described herein, a butyrylcholinesterase
variant exhibiting increased cocaine hydrolysis activity
can hydrolyze a cocaine-based butyrylcholinesterase
substrate in vitro as well as in vivo. A cocaine-based
15 butyrylcholinesterase substrate can be contacted with a
butyrylcholinesterase variant of the invention in vitro,
for example, by adding the substrate to supernatant
isolated from cultures of butyrylcholinesterase variant
library clones. Alternatively, the butyrylcholinesterase
20 variant can be purified prior to being contacted by the
substrate. Appropriate medium conditions in which to
contact a cocaine-based substrate with a
butyrylcholinesterase variant of the invention are
readily determined by those skilled in the art. For
25 example, 100 ~tM cocaine in lOmM Tris at pH 7.4 can be
contacted with a butyrylcholinesterase variant at 37° C.
As described below, butyrylcholinesterase variants from
culture supernatants can further be immobilized using a
capture agent, such as an antibody prior to being
30 contacted with a substrate, which allows for removal of
culture supernatant components and enables contacting of
the immobilized variants with substrate in the absence of
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
76
contaminants. Following contacting of a
butyrylcholinesterase variant of the invention with a
cocaine-based substrate, cocaine hydrolysis activity can
be measured by a variety of methods known in the art and
described herein, for example, by high-performance liquid
chromatography or the isotope tracer cocaine hydrolsis
assay.
The invention also provides a method of
treating cocaine overdose as well as cocaine addiction in
an individual by administering a therapeutically
effective amount of the butyrylcholinesterase variant.
The dosage of a butyrylcholinesterase variant required to
be effective depends, for example, on whether an acute
overdose or chronic addiction is being treated, the route
and form of administration, the potency and bio-active
half-life of the molecule being administered, the weight
and condition of the individual, and previous or
concurrent therapies. The appropriate amount considered
to be an effective dose for a particular application of
the method can be determined by those skilled in the art,
using the teachings and guidance provided herein. For
example, the amount can be extrapolated from in vitro or
in vivo butyrylcholinesterase assays described herein.
One skilled in the art will recognize that the condition
of the individual needs to be monitored throughout the
course of treatment and that the amount of the
composition that is administered can be adjusted
accordingly.
For treating cocaine-overdose, a
therapeutically effective amount of a
butyrylcholinesterase variant of the invention can be,
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
77
for example, between about 0.1 mg/kg to 0.15 mg/kg body
weight, for example, between about 0.15 mg/kg to 0.3
mg/kg, between about 0.3 mg/kg to 0.5 mg/kg or preferably
between about 1 mg/kg to 5 mg/kg, depending on the
treatment regimen. For example, if a
butyrylcholinesterase variant is administered to an
individual symptomatic of cocaine overdose a higher one-
time dose is appropriate, while an individual symptomatic
of chronic cocaine addiction may be administered lower
doses from one to several times a day, weekly, monthly or
less frequently. Similarly, formulations that allow for
timed-release of a butyrylcholinesterase variant would
provide for the continuous release of a smaller amount of
a butyrylcholinesterase variant to an individual treated
for chronic cocaine addiction. It is understood, that
the dosage of a butyrylcholinesterase variant has to be
adjusted based on the catalytic activity of the variant,
such that a lower dose of a variant exhibiting
significantly enhanced cocaine hydrolysis activity can be
administered compared to the dosage necessary for a
variant with lower cocaine hydrolysis activity.
A butyrylcholinesterase variant can be
delivered systemically, such as intravenously or
intraarterially. A butyrylcholinesterase variant can be
provided in the form of isolated and substantially
purified polypetides and polypeptide fragments in
pharmaceutically acceptable formulations using
formulation methods known to those of ordinary skill in
the art. These formulations can be administered by
standard routes, including for example, topical,
transdermal, intraperitoneal, intracranial,
intracerebroventricular, intracerebral, intravaginal,
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
78
intrauterine, oral, rectal or parenteral (e. g.,
intravenous, intraspinal, subcutaneous or intramuscular)
routes. In addition, a butyrylcholinesterase variant can
be incorporated into biodegradable polymers allowing for
sustained release of the compound useful for treating
individual symptomatic of cocaine addiction.
Biodegradable polymers and their use are described, for
example, in detail in Brem et al., J. Neurosura.
74:441-446 (1991), which is incorporated herein by
reference.
A butyrylcholinesterase variant can be
administered as a solution or suspension together with a
pharmaceutically acceptable medium. Such a
pharmaceutically acceptable medium can be, for example,
water, sodium phosphate buffer, phosphate buffered
saline, normal saline or Ringer's solution or other
physiologically buffered saline, or other solvent or
vehicle such as a glycol, glycerol, an oil such as olive
oil or an injectable organic ester. A pharmaceutically
acceptable medium can additionally contain
physiologically acceptable compounds that act, for
example, to stabilize or increase the absorption of the
butyrylcholinesterase variant. Such physiologically
acceptable compounds include, for example, carbohydrates
such as glucose, sucrose or dextrans; antioxidants such
as ascorbic acid or glutathione; chelating agents such as
EDTA, which disrupts microbial membranes; divalent metal
ions such as calcium or magnesium; low molecular weight
proteins; lipids or liposomes; or other stabilizers or
excipients.
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
79
Formulations suitable for parenteral
administration include aqueous and non-aqueous sterile
injection solutions such as the pharmaceutically
acceptable mediums described above. The solutions can
additionally contain, for example, buffers, bacteriostats
and solutes which render the formulation isotonic with
the blood of the intended recipient. Other formulations
include, for example, aqueous and non-aqueous sterile
suspensions which can include suspending agents and
thickening agents. The formulations can be presented in
unit-dose or multi-dose containers, for example, sealed
ampules and vials, and can be stored in a lyophilized
condition requiring, for example, the addition of the
sterile liquid carrier, immediately prior to use.
Extemporaneous injection solutions and suspensions can be
prepared from sterile powders, granules and tablets of
the kind previously described.
The butyrylcholinesterase variant of the
invention can further be utilized in combination
therapies with other therapeutic agents. Combination
therapies that include a butyrylcholinesterase variant
can consist of formulations containing the variant and
the additional therapeutic agent individually in a
suitable formulation. Alternatively, combination
therapies can consist of fusion proteins, where the
butyrylcholinesterase variant is linked to a heterologous
protein, such as a therapeutic protein.
The butyrylcholinesterase variant of the
invention also can be delivered to an individual by
administering an encoding nucleic acid for the peptide or
variant. The encoding nucleic acids for the
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
butyrylcholinesterase variant of the invention are useful
in conjunction with a wide variety of gene therapy
methods known in the art for delivering a therapeutically
effective amount of the polypeptide or variant. Using
5 the teachings and guidance provided herein, encoding
nucleic acids for a butyrylcholinesterase variant can be
incorporated into a vector or delivery system known in
the art and used for delivery and expression of the
encoding sequence to achieve a therapeutically effective
10 amount. Applicable vector and delivery systems known in
the art include, for example, retroviral vectors,
adenovirus vectors, adenoassociated virus, ligand
conjugated particles and nucleic acids for targeting,
isolated DNA and RNA, liposomes, polylysine, and cell
15 therapy, including hepatic cell therapy, employing the
transplantation of cells modified to express a
butyrylcholinesterase variant, as well as various other
gene delivery methods and modifications known to those
skilled in the art, such as those described in Shea et
20 al., Nature Biotechnoloay 17:551-554 (1999), which is
incorporated herein by reference.
Specific examples of methods for the delivery
of a butyrylcholinesterase variant by expressing the
encoding nucleic acid sequence are well known in art and
25 described in, for example, United States Patent No.
5,399,346; United States Patent Nos. 5,580,859;
5, 589, 466; 5, 460, 959; 5, 656, 465; 5, 643, 578; 5, 620, 896;
5,460,959; 5,506,125 European Patent Application No.
EP 0 779 365 A2; PCT NO. WO 97/10343; PCT NO. WO
30 97/09441; PCT No. WO 97/10343, all of which are
incorporated herein by reference. Other methods known to
those skilled in the art also exist and are similarly
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
81
applicable for the delivery of a butyrylcholinesterase
variant by expressing the encoding nucleic acid sequence.
In addition to the treatment of cocaine-induced
conditions such as cocaine overdose or cocaine addiction,
a butyrylcholinesterase can also be administered
prophylactically to avoid the onset of a cocaine overdose
upon subsequent entry of cocaine into the bloodstream.
It is further contemplated that a butyrylcholinesterase
variant exhibiting increased cocaine hydrolysis activity
of the invention can have diagnostic value by providing a
tool for efficiently determining the presence and amount
of a cocaine-induced substance in a medium.
It is understood that modifications that do not
substantially affect the activity of the various
embodiments of this invention are also included within
the definition of the invention provided herein.
Accordingly, the following examples are intended to
illustrate but not limit the present invention.
EXAMPLE I
A Butyrylcholinesterase Variant with Increased Cocaine
Hydrolysis Activity
This example describes the discovery and
characterization of the butyrylcholinesterase variant
designated SEQ ID NO: 52, in which Alanine (A) at amino
acid position 328 of human butyrylcholinesterase is
replaced with Tryptophane (W). The A328W
butyrylcholinesterase variant designated SEQ ID NO: 52
exhibits a fifteen-fold increase in cocaine hydrolysis
activity compared to human butyrylcholinesterase.
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
82
Structural modeling of cocaine in the active site of
human butyrylcholinesterase
In order to determine amino acid residues
important for cocaine hydrolysis activity, cocaine was
docked into the active site of butyrylcholinesterase with
the FlexiDock program (Tripos Inc., St. Louis, MO) in
Sybyl 6.4 software on a Silicone Graphics Octane
computer. Flexidock allows docking of ligands into
protein active sites, allowing the user to define bonds
which are flexible during the docking process. The user
must identify the starting conformation and position the
interacting faces of the protein-ligand.
The structures of (-)-cocaine and (+)-cocaine
were retrieved from the Cambridge Structural Database
where its code-names are COCAIN10 and COCHCL. The HC1
molecule was deleted from COCHCZ so that all computations
were done with the base form of cocaine. Before the
FlexiDock program was run, cocaine was manually aligned
with butyrylcholine in the model of human
butyrylcholinesterase as described by Harel et al., Proc.
Natl. Acad. Sci. USA, 89: 10827-10831 (1992). Manual
alignment was performed so that the tropane ring of
cocaine faced the Tryptophane residue (W) at amino acid
position 82 of butyrylcholinesterase, the carboxyl group
of the benzoic ester of cocaine was within 1.5A of the
Serine (S) residue at amino acid position 198 of
butyrylcholinesterase, and the benzene ring of cocaine
was in the aryl binding pocket of butyrylcholinesterase.
In the FlexiDock the binding pocket was defined as all
amino acids within 4A of butyrylcholine. After defining
the binding pocket, the butyrylcholine molecule was
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
83
extracted. All atoms in the binding pocket, except atoms
in rings and double bonded atoms were defined as
rotatable, thus yielding 124 rotatable bonds in
butyrylcholinesterase and 7 rotatable bonds in cocaine.
Mutacrenesis of human butyrylcholinesterase and Expression
of a butyrylcholinesterase variant.
Based on the FlexiDock modeling of cocaine into
the active site of the human butyrylcholinesterase
molecule, amino acids that interfere with binding were
selected for mutagenesis.
Thirty-four variants were prepared using PCR-
site directed mutagenesis of human butyrylcholinesterase
DNA performed utilizing Pfu polymerase (Stratagene, La
Jolla, CA). Three oligonucleotide primers were used to
perform the mutagenesis. The mutagenesis primers were
used at the same time as a general primer such as the SP6
promoter sequencing primer (MBI Fermentas, Amherst, NY)
to amplify one end of the butyrylcholinesterase cDNA.
The following primers were used to prepare the A328W
mutant: A328W antisense
5' ATAGACTAAAAACCATGTCCCTTCATC 3'; T7 old sense
5' TAATACGACTCACTATAGGG 3'; and SP6 antisense
5' ATTTAGGTGACACTATAG 3'. The A328W primer spans 27
nucleotides and contains the A328W mutation in the middle
of the primer. The PCR reaction products (megaprimers)
were cleaned on QuiaQuick PCR (Qiagen, Santa Clarita, CA)
according to the manufacturer's protocol to remove excess
primers. The cleaned megaprimers were extended in a
second PCR reaction to generate the complete 1.8 kb
coding sequence of each of the 34 variants.
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
84
The 1.8-kb fragments constituting the
butyrylcholinesterase variants were cloned into the
plasmid pGS and resequenced to make sure the desired
mutation was present. The plasmid pGS is identical with
pRc/CMV (Invitrogen, Carlsbad, CA) except that the Neo
gene has been replaced by rat glutamine synthesase.
To express the thirty-four
butyrylcholinesterase variants in mammalian cell lines,
thirty-four stable Chinese Hamster Ovary (CHO) cell lines
expressing a butyrylcholinesterase variant were made.
Transfection of CHO-KI (No. CCL 61; American Type; Fisher
Scientific Co., Pittsburgh, PA) cells by calcium
phosphate precipitation was followed by selection of
colonies in glutamine-free, serum-free medium
Ultraculture containing 50~aM methionine sulfoximine
(BioWhittaker, Inc., Walkersville, MD). Colonies
expressing the highest levels of butyrylcholinesterase
activity were expanded. A second plasmid that carries
the COLA gene, which encodes the proline rich attachment
domain, was transfected into each of the CHO-KI cell
lines to allow butyrylcholinesterase to form tetramers,
which are more stable.
The secreted butyrylcholinesterase variants
were collected from the expanded cell lines. For
collection of large volumes of each secreted
butyrylcholinesterase variant, cells in 1-liter roller
bottles were fed every 2 to 3 days with 100m1 of
Ultraculture containing 25~a.M methionine sulfoximine
followed by 100m1 of Dulbecco's modified Eagle's medium
and Ham's F12 50:50 mix without L-glutamine
(Mediatech,Herndon, VA; Fisher Scientific Co.,
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
Pittsburgh, PA). The amount of secreted
butyrylcholinesterase variant is about 1 mg per liter.
Twenty liters of culture medium were collected for each
of the thirty-four variants over a period of months and
5 stored sterile at 4°C during the collection period.
Purification and Characterization of the
Butyrylcholinesterase Variants
To purify the butyrylcholinesterase variants,
the culture medium corresponding to each variant was
10 filtered through lnlhatman #1 filter paper (Whatman Inc.,
Clifton, NJ) on a Buchner funnel. The filtrate was
poured through a chromatography column (XK50/30,
Pharmacia Biotech, Piscatawy, NJ) packed with 100m1 of
affinity gel procainamide-Sepharose 4B. The
15 butyrylcholinesterase variants stick to the affinity gel
during loading so that 20mg of enzyme that was previously
in 20 liters was concentrated in 100m1 of affinity gel.
The affinity gel was subsequently washed with .3M sodium
chloride in 20mM potassium phosphate pH 7.0 and 1mM EDTA
20 to elute contaminating proteins. Next, the affinity gel
was washed with buffer containing 20mM potassium
phosphate and 1 mM EDTA pH 7.0 to reduce the ionic
strength. Finally, the butyrylcholinesterasae variants
was eluted with 250m1 of 0.2M procainamide in buffer.
25 To further purify the butyrylcholinesterase
variants and remove the procainamide a second
purification step was performed. The
butyrylcholinesterase variants recovered in the first
purification step were diluted 10-fold with buffer (20 mM
30 TrisCl, 1 mM EDTA pH 7.4) to reduce the ionic strength to
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
86
about 0.02M. The diluted enzyme was loaded onto a column
containing 400m1 of the weak anion exchanger DE52
(Whatman, Clifton, NJ). At this low ionic strength the
butyrylcholinesterase variant sticks to the ion exchange
gel. After loading was complete the column was washed
with 2 liters of buffer containing 20mM TrisCl and 1mM
EDTA pH7.4 until the absorbency of the eluant at 280nm
was nearly zero, indicating that the procainamide had
washed off. Subsequently, the butyrylcholinesterase
variants were eluted from the column with a salt gradient
from 0 to 0.2M NaCl in 20mM TrisCl pH 7.4. Following the
elution of the butyrylcholinesterase variants 10m1
fractions were collected for each variant using a
fraction collector. Activity assays were performed to
identify the peak containing butyrylcholinesterase
variant. SDS gel electrophoresis was performed to
determine the purity of each butyrylcholinesterase
variants, which was determined to be approximately 900.
The thirty-four purified
butyrylcholinestesterase variants were assayed for their
ability to hydrolyze cocaine. The assay measured the
affinity of (-)-cocaine for the butyrylcholinesterase
variants and the maximal rate of hydrolysis of (-)-
cocaine for each variant. Enzyme-catalyzed hydrolysis of
cocaine was recorded on a temperature-equilibrated
Gilford Spectrophotometer at 240nm where the difference
in molar absorptivity between substrate and product was
DE=6, 700M-1 cm~'1 as described by Gatley, Biochem.
Pharmacol. 41:1249-1254 (1991). Km values were determined
in 0.1M potassium phosphate pH 7.0 at 30°C for (-)-
cocaine. Vmax values and Km values were calculated using
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
87
Sigma Plot for Macintosh (Jandel Scientific, San Rafael,
CA ) .
Once V"~ax values and Km values were calculated,
the number of active sites in each butyrylcholinesterase
preparation was determined. The titration of active
sites was performed with chlorpyrifos oxon (MET-674B,
Chem Service, West Chester, PA), an inhibitor of
butyrylcholinesterase. One molecule of chlorpyrifos oxon
binds and inhibits one molecule of butyrylcholinesterase,
which allows for calculation of the number of active
sites. Based on the number of active sites, the k~at
value for each variant was calculated (Table 3).
Thirty-four variants were tested for cocaine binding or
cocaine hydrolysis (Table 4). One variant, A328W, was
determined to have 15 times faster cocaine hydrolysis
activity compared to wild-type butyrylcholinesterase.
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
88
Table 3. Binding constant (Ki and Km) and hydrolysis rate
(k~at) for human butyrylcholinesterase and mutants
Ki ~~~ Km ~~M~ kcat ~mlri
1~
wild-type 11 14 3.9
D70G 201
D70N 490
G117H 440
G117K 300
Q119H 34
Q119Y
56 2.0
T120F 97
E197D 40
E197G 37
E197Q 17 0.1
Z286A 8.5
L286H 24
V288F 17 1.0
V288H 55
A328F 21 24 5.8
A328G 18
A328H 27
A328I 11 0.5
A328W 10 37.2
A328Y 9 10.2
F329A 128 2.7
2 F329S 41 1.9
5
Y332A 240
Y332F 22
G439A 7
N68Y/Q119Y/A277W 60 1.7
3 Q119Y/V288F/A328Y 33 2.3
0
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
89
Table 4. Mutants tested for cocaine binding or hydrolysis
(34 plus wild-type)
Mutant Cocaine Binding or Cocaine Hydrolysis
wild-type Ki = 11 ~tM
D70G Ki= 201 uM
D70N Ki= 490 uM
G115A no activity
G116F no activity
G116W no activity
1.o G117H Ki = 440 ~M
Q119H Ki = 34 ~xM
Q119Y not a cocaine hydrolase
T120F not a cocaine hydrolase
E197D Ki = 40 uM
1 E197G Ki = 37 uM
5
E197Q Not a cocaine hydrolase
S224Y No activity
L286A K.i = 24 pM
L286H Not a cocaine hydrolase
2 L286W Not a cocaine hydrolase
~
V288F Not a cocaine hydrolase
V288H Ki= 55 uM
V288W Not a cocaine hydrolase
A328F Not a cocaine hydrolase
5 A328G Not a cocaine hydrolase
A328H Not a cocaine hydrolase
A328I Not a cocaine hydrolase
A328W Hydrolyzes cocaine 15 times faster than
wild-type
A328Y Hydrolyzes cocaine 4 times faster than
wild-type
~ F329A Not a cocaine hydrolase
F329S kcat is faster than wild type
Y332F Ki= 22 ~tM
G439A Ki= 7 E.tM
G439L No cocaine hydrolysis activity
3 N68Y/Q119Y/A277WNot a cocaine hydrolase
5
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
Mutant Cocaine Binding or Cocaine Hydrolysis
Qll9Y/V288F/A328YNot a cocaine hydrolase
EXAMPhE II
Development of a Cocaine Hydrolysis Assay
This example describes the development of a
5 cocaine hydrolysis assay that permits the efficient
analysis of hundreds of butyrylcholinesterase variants
simultaneously.
Development of an isotope tracer cocaine hydrolysis
assa
10 For the purpose of validating new cocaine
hydrolysis assays, butyrylcholinesterase hydrolysis of
cocaine was first measured as described previously (Xie
et al., Mol. Pharmacol. 55:83-91 (1999)), using
high-performance liquid chromatography (HPZC). Briefly,
15 reactions containing 100 ~M cocaine in 10 mM Tris, pH 7.4
were initiated by the addition of horse
butyrylcholinesterase (ICN Pharmaceuticals, Inc., Costa
Mesa, CA) and incubated 2-4 hours at 37°C. Following the
incubation, the pH was adjusted to 3, and the sample was
20 filtered. Subsequently, the sample was applied to a
Hypersil ODS-C 18 reversed phase column (Hewlett Packard,
Wilmington, DE) previously equilibrated with an 80:20
mixture of 0.05 M potassium phosphate, pH 3.0 and
acetonitrile. The isocratic elution of cocaine,
25 benzoylecognine, and benzoic acid was quantitated at 220
nm. Measurement of the formation of ecognine methyl
ester and benzoic acid was dependent both on the amount
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
91
of butyrylcholinesterase in the reaction and on the time
of reaction.
At the conclusion of the isotope tracer assay,
an aliquot of the reaction mix is acidified in order to
take advantage of the solubility difference between the
product and the substrate at pH 3Ø At pH 3.0, [3H]-
benzoic acid (pKa=4.2) is soluble in a scintillation
cocktail consisting of 2.5-diphenyloxazole (PPO) and
[1,4-bis-2-(4-methyl-5-phenyloxazolyl0-benzene] (POPOP)
(PPO-dimethyl-POPOP scintillation fluor, Research
Products Tnternational Corp., Mt. Prospect, IL) while
[3H]-cocaine is not. The signal generated by acidified
reaction mixture from enzyme blanks was less than 20 of
the total dpm palced in the fluor, consistent with
cocaine being insoluble in PPO-dimethyl-POPOP.
The isotope tracer cocaine hydrolysis assay was
validated by direct comparison with the established HPLC
assay and the accuracy of the isotope assay was
demonstrated by determining the Km value for horse
butyrylcholinesterase. The rate of cocaine hydrolysis,
determined by measuring the rate of formation of benzoic
acid was quantitated both by HPLC and the isotope tracer
assay in reactions containing variable amounts of
butyrylcholinesterase. Formation of [3H]-benzoic acid was
dependent on the length of assay incubation and on the
amount of butyrylcholinesterase added. Good correlation
between the established HPLC assay and the isotope tracer
assay was observed, as demonstrated by plotting the
quantitation of benzoic acid formation measured by HPLC
versus the benzoic acid formation measured in the isotope
assay (see Figure 5A; r2 = 0.979). To demonstrate the
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
92
precision and sensitivity of the isotope assay the amount
of cocaine was varied and the Km was determined using the
Zineweaver-Burk double-reciprocal plot of cocaine
hydrolysis by horse butyrylcholinesterase depicted in
figure 5B. Velocity was calculated as cpm benzoic acid
formed x 10-5 following a 2 hour incubation at 37°C. Based
on these data the K", for cocaine hydrolysis is
approximately 37.6 ~M (x intercept = -1/K,t,), which is in
close agreement with previously published values of 38 ~M
(Gatley, supra, 1991) and 45 ~ 5 ~M (Xie et al., supra,
1999) for horse butyrylcholinesterase.
Immobilization of active Butyrylcholinesterase
The supernatants isolated from each of the
butyrylcholinesterase variant library clones contains
variable butyrylcholinesterase enzyme concentrations.
Consequently, the cocaine hydrolysis activity measured
from equal volumes of culture supernatants from distinct
butyrylcholinesterase variant clones reflects the
expression level as well as the enzyme activity. In
order to be able to compare equal enzyme concentrations
and more rapidly identify variants with the desired
activity, butyrylcholinesterase from culture supernatants
are immobilized using a capture reagent, such as an
antibody, that is saturated at low butyrylcholinesterase
concentrations as described previously by Watkins et al.,
Anal. Biochem. 253: 37-45 (1997). As a result,
butyrylcholinesterase from dilute samples is concentrated
and uniform quantities of different butyrylcholinesterase
variant clones are immobilized, regardless of the initial
concentration of butyrylcholinesterase in the culture
supernatant. Subsequently, unbound butyrylcholinesterase
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
93
and other culture supernatant components that potentially
interfere with the assay (such as unrelated serum or
cell-derived proteins with significant esterase activity)
are washed away and the activity of the immobilized
butyrylcholinesterase is determined by measuring the
formation of benzoic acid as described above.
To assess the efficiency of the above assay,
efficient capture of human butyrylcholinesterase, as well
as a truncated soluble monomeric form of human
butyrylcholinesterase (Blong et al., Biochem. J. 327:
747-757 (1997)), was demonstrated in a microtiter format
using a commercially available rabbit anti-human
cholinesterase polyclonal antibody (DAKO, Carpinteria,
CA)(Figure 6). In order to determine the optimal
conditions for capturing butyrylcholinesterase a
microtiter plate was coated with increasing quantities of
rabbit anti-butyrylcholinesterase, was blocked, and
incubated with varying amounts of culture supernatant.
The amount of active butyrylcholinesterase captured was
determined calorimetrically using an assay that measures
butyrylthiocholine hydrolysis at 405 nm in the presence
of dithiobisnitrobenzoic acid (Xie et al., supra, 1999).
Subsequently, the butyrylcholinesterase activity captured
from dilutions of culture supernatants from cells
expressing either the wild-type human
butyrylcholinesterase or the monomeric truncated version
was measured. The rabbit anti-butyrylcholinesterase
capture antibody was saturated by the
butyrylcholinesterase present in 25 u1 of culture
supernatant with greater butyrylcholinesterase activity
being captured from supernatant containing the full
length wild-type form of the enzyme (Figure 6, compare
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
94
filled circles with open circles). Unbound material was
removed by washing with 100 mM Tris, pH 7.4 and the
amount of active butyrylcholinesterase captured was
quantitated by measuring butyrylthiocholine hydrolysis.
Butyrylcholinesterase is expressed in culture
supernatants at quantities sufficient to saturate a
polyclonal anti-butyrylcholinesterase antibody on a
microtiter plate. In addition, the captured enzyme is
active, as demonstrated by the hydrolysis of
butyrylthiocholine.
Measurement of cocaine hydrolysis with isotope tracer
assay and immobilized Butyrylcholinesterase
The optimal conditions for immobilization of
active butyrylcholinesterase are used in conjunction with
the cocaine isotope tracer assay to measure the cocaine
hydrolysis activity in a microtiter format. The assay is
characterized by determining the K,t, for cocaine hydrolysis
activity, as described above. At least three approaches
are used to either increase the assay sensitivity or the
assay signal.
First, longer assay incubation times that
proportionately increase the signal can be used. Second,
the sensitivity of the assay can be enhanced by
increasing the specific activity of the radiolabeled
cocaine substrate. Third, a previously identified
butyrylcholinesterase mutant which is 4-fold more
efficient for cocaine hydrolysis can used (Xie et al.,
supra, 1999), which in conjunction with doubling the
assay incubation time and increasing the specific
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
activity of the cocaine 10-fold, can increase the assay
signal about 80-fold.
EXAMPhE III
Synthesis and Characterization of Butyrylcholinesterase
5 Variant Libraries
This example describes the synthesis and
characterization of butyrylcholinesterase variant
libraries expressed in mammalian cells.
In order to facilitate the synthesis of
10 libraries of butyrylcholinesterase variants, DNA encoding
wild-type human butyrylcholinesterase, a truncated,
enzymatically active, monomeric version of human
butyrylcholinesterase, and the A328Y mutant that displays
a four-fold increased cocaine hydrolysis activity are
15 cloned into a modified doublelox targeting vector, using
unique restriction sites. In preliminary assays the
wild-type human butyrylcholinesterase was captured more
efficiently and, therefore, serves as the initial DNA
template for the synthesis of libraries of
20 butyrylcholinesterase variants.
Synthesis of focused libraries of butyrylcholinesterase
variants by codon-based mutacrenesis
A variety of information can be used to focus
the synthesis of the initial libraries of
25 butyrylcholinesterase variants to discreet regions. For
example, butyrylcholinesterase and Torpedo
acetylcholinesterase (AChE) share a high degree of
homology (53% identity). Furthermore, residues 4 to 534
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
96
of Torpedo AChE can be aligned with residues 2 to 532 of
butyrylcholinesterase without deletions or insertions.
The catalytic triad residues (butyrylcholinesterase
residues Ser198, G1u325, and His438) and the intrachain
disulfides are all in the same positions. Due to the
high degree of similarity between these proteins, a
refined 2.8- A x-ray structure of Torpedo AChE (Sussman
et al., Science 253: 872-879 (1991)) has been used to
model butyrylcholinesterase structure (Harel et al.,
20 supra, 1992)).
Studies with cholinesterases have revealed that
the catalytic triad and other residues involved in ligand
binding are positioned within a deep, narrow, active-site
gorge rich in hydrophobic residues (reviewed in Soreq et
al., Trends Biochem. Sci. 17:353-358 (1992)). The sites
of seven focused libraries of butyrylcholinesterase
variants (Figure 2, underlined residues) were selected to
include amino acids determined to be lining the active
site gorge (Figure 2, hydrophobic active site gorge
residues are shaded).
In addition to the structural modeling of
butyrylcholinesterase, butyrylcholinesterase biochemical
data was integrated into the library design process. For
example, characterization of naturally occurring
butyrylcholinesterases with altered cocaine hydrolysis
activity and site-directed mutagenesis studies provide
information regarding amino acid positions and segments
important for cocaine hydrolysis activity (reviewed in
Schwartz et al., Pharmac. Ther. 67: 283-322(1995)).
Moreover, comparison of sequence and cocaine hydrolysis
data of butyrylcholinesterases from different species can
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
97
also provide information regarding regions important for
cocaine hydrolysis activity of the molecule based on
comparison of the cocaine hydrolysis activities of these
butyrylcholinesterases. The previously identified A328Y
mutant is present in the library corresponding to region
6 and serves as a control to demonstrate the quality of
the library synthesis and expression in mammalian cells
as well as the sensitivity of the microtiter-based
cocaine hydrolysis assay.
Table 5. Butyrylcholinesterase Regions Predicted to be
Important for Catalytic Efficiency.
Region Location SEQ ID NO Length
1 68-82 59 15
2 110-121 60 12
3 194-201 61 8
4 224-234 62 11
5 277-289 63 13
6 327-332 64 6
7 429-442 65 14
The seven regions of butyrylcholinesterase
selected for focused library synthesis span residues that
include the 8 aromatic active site gorge residues (W82,
W112, Y128, W231, F329, Y332, W430 and Y440) as well as
two of the catalytic triad residues. The integrity of
intrachain disulfide bonds, located between 6sCys-92Cys,
252Cys-263CyS, and 4ooCys-sl9Cys is maintained to ensure
functional butyrylcholinesterase structure. In addition,
putative glycosylation sites (N-X-S/T) located at
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
98
residues 17, 57, 106, 241, 256, 341, 455, 481, 485, and
486 also are avoided in the library synthesis. In total,
the seven focused libraries span 79 residues,
representing approximately 140 of the
butyrylcholinesterase linear sequence, and result in the
expression of about 1500 distinct butyrylcholinesterase
variants.
Libraries of nucleic acids corresponding to the
seven regions of human butyrylcholinesterase to be
mutated are synthesized by codon-based mutagenesis, as
described above and as depicted schematically in
Figure 7. Briefly, multiple DNA synthesis columns are
used for synthesizing the oligonucleotides by ~3-
cyanoethyl phosphoramidite chemistry, as described
previously by Glaser et al., supra, 1992. In the first
step, trinucleotides encoding for the amino acids of
butyrylcholinesterase are synthesized on one column while
a second column is used to synthesize the trinucleotide
NN(G/T); where N is a mixture of dA, dG, dC, and dT
cyanoethyl phosphoramadites. Using the trinucleotide
NN(G/T) results in thorough mutagenesis with minimal
degeneracy, accomplished through the systematic
expression of all twenty amino acids at every position.
Following the synthesis of the first codon,
resins from the two columns are be mixed together,
divided, and replaced in four columns. By adding
additional synthesis columns for each codon and mixing
the column resins in the manner illustrated in Figure 7,
pools of degenerate oligonucleotides will be segregated
based on the extent of mutagenesis. The resin mixing
aspect of codon-based mutagenesis makes the process rapid
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
99
and cost-effective because it eliminates the need to
synthesize multiple oligonucleotides. In the present
study, the pool of oligonucleotides encoding single amino
acid mutations are used to synthesize focused
butyrylcholinesterase libraries.
The oligonucleotides encoding the
butyrylcholinesterase variants containing a single amino
acid mutation is cloned into the doublelox targeting
vector using oligonucleotide-directed mutagenesis
(Kunkel, supra, 1985). To improve the mutagenesis
efficiency and diminish the number of clones expressing
wild-type butyrylcholinesterase, the libraries are
synthesized in a two-step process. In the first step,
the butyrylcholinesterase DNA sequence corresponding to
each library site is deleted by hybridization
mutagenesis. In the second step, uracil-containing
single-stranded DNA for each deletion mutant, one
deletion mutant corresponding to each library, is
isolated and used as template for synthesis of the
libraries by oligonucleotide-directed mutagenesis. This
approach has been used routinely for the synthesis of
antibody libraries and results in more uniform
mutagenesis by removing annealing biases that potentially
arise from the differing DNA sequence of the mutagenic
oligonucleotides. In addition, the two-step process
decreases the frequency of wild-type sequences relative
to the variants in the libraries, and consequently makes
library screening more efficient by eliminating
repetitious screening of clones encoding wild-type
butyrylcholinesterase.
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
100
The quality of the libraries and the efficiency
of mutagenesis is characterized by obtaining DNA sequence
from approximately 20 randomly selected clones from each
library. The DNA sequences demonstrate that mutagenesis
occurrs at multiple positions within each library and
that multiple amino acids were expressed at each
position. Furthermore, DNA sequence of randomly selected
clones demonstrates that the libraries contain diverse
clones and are not dominated by a few clones.
Optimization of Transfection Parameters for Site-Specific
Tnteclration
Optimization of transfection parameters for
Cre-mediated site-specific integration was achieved
utilizing Bleomycin Resistance Protein (BRP) DNA as a
model system.
Cre recombinase is a well-characterized 38-kDa
DNA recombinase (Abremski et al., Cell 32:1301-1311
(1983)) that is both necessary and sufficient for
sequence-specific recombination in bacteriophage P1.
Recombination occurs between two 34-base pair loxP
sequences each consisting of two inverted 13-base pair
recombinase recognition sequences that surround a core
region (Sternberg and Hamilton, J. Mol. Biol. 150:467-486
(1981a); Sternberg and Hamilton, J. Mol. Biol.,
150:487-507 (1981b)). DNA cleavage and strand exchange
occurs on the top or bottom strand at the edges of the
core region. Cre recombinase also catalyzes
site-specific recombination in eukaryotes, including both
yeast (Sauer, Mol. Cell. Biol. 7:2087-2096 (1987)) and
mammalian cells (Sauer and Henderson, Proc. Natl. Acad.
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
101
Sci. USA, 85:5166-5170 (1988); Fukushige and Sauer, Proc.
Natl. Acad. Sci. U.S.A. 89:7905-7909 (1992); Bethke and
Sauer, Nuc. Acids Res., 25:2828-2834 (1997)).
Calcium phosphate transfection of 13-1 cells
was previously demonstrated to result in targeted
integration in 1% of the viable cells plated (Bethke and
Sauer, Nuc. Acids Res., 25:2828-2834 (1997)). Therefore,
initial studies were conducted using calcium phosphate to
transfect 13-1 cells with 4 ~,tg pBS185 and 10, 20, 30, or
40 p.g of pBS397-fl(+)/BRP. The total level of DNA per
transfection was held constant using unrelated
pBluescript II KS DNA (Stratagene; Za Jolla, CA), and
transformants were selected 48 hours later by replating
in media containing 400 ~.g/ml geneticin. Colonies were
counted 10 days later to determine the efficiency of
targeted integration. Optimal targeted integration was
typically observed using 30 ~a.g of targeting vector and 4
~a.g of Cre recombinase vector pBS185, consistent with the
~tg targeting vector and 5 p.g of pBS185 previously
20 reported (Bethke and Sauer, Nuc. Acids Res., 25:2828-2834
(1997)). The frequency of targeted integration observed
was generally less than lo. Despite the sensitivity of
the calcium phosphate methodology to the amount of DNA
used and the buffer pH, targeted integration efficiencies
observed were sufficient to express the protein
libraries.
As shown in Table 6, several cell lines as well
as other transfection methods were also characterized.
As disclosed herein, Flp recombinase also can used to
target insertion of exogenous DNA into a particular site
in the genome as described by Dymecki, supra,1996. The
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
102
target site for Flp recombinase consists of 13 base-pair
repeats separated by an 8 base-pair spacer:
5'-GAAGTTCCTATTC[TCTAGAAA]GTATAGGAACTTC-3'. Briefly,
variant libraries corresponding to the region of
butyrylcholinesterase corresponding to amino acids 327 to
332 of butyrylcholinesterase (shown as region 6 in Table
2) were transfected into mammalian cells using flp
recombinase and the 293T cell line. The
butyrylcholinesterase variants designated SEQ ID NOS: 2,
l0 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32,
34, 36, 38, 40, 54, 56 and 58 were identified and
characterized using the methods described herein
utilizing Flp recombinase and the 293T human cell line.
In general, lipid-mediated transfection methods
are more efficient than methods that alter the chemical
environment, such as calcium phosphate and DEAE-dextran
transfection. Tn addition, lipid-mediated transfections
are less affected by contaminants in the DNA
preparations, salt concentration, and pH and thus
generally provide more reproducible results (Felgner et
al., Proc. Natl. Acad. Sci. USA, 84:7413-7417 (1987)).
Consequently, a formulation of the neutral lipid dioleoyl
phosphatidylethanolamine and a cationic lipid, termed
GenePORTER transfection reagent (Gene Therapy Systems;
San Diego, CA), was evaluated as an alternative
transfection approach. Briefly, endotoxin-free DNA was
prepared for both the targeting vector pBS397-fl(+)/BRP
and the Cre recombinase vector pBS185 using the EndoFree
Plasmid Maxi kit (QIAGEN; Valencia, CA). Next, 5 ~tg
pBS185 and varying amounts of pBS397-fl(+)/BRP were
diluted in serum-free medium and mixed with the
GenePORTER transfection reagent. The DNA/lipid mixture
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
103
was then added to a 60-70o confluent monolayer of 13-1
cells consisting of approximately 5 x 105 cells/100-mm
dish and incubated at 37°C. Five hours later, fetal calf
serum was added to 100, and the next day the transfection
media was removed and replaced with fresh media.
Transfection of the cells with variable
quantities of the targeting vector yielded targeted
integration efficiencies ranging from 0.1o to 1.0%, with
the optimal targeted integration efficiency observed
using 5 ~.g each of the targeting vector and the Cre
recombinase vector. Lipid-based transfection of the 13-1
host cells under the optimized conditions resulted in
0.5o targeted integration efficiency being consistently
observed. A 0.5o targeted integration is slightly less
than the previously reported 1.0o efficiency (Bethke and
Sauer, Nuc. Acids Res., 25:2828-2834 (1997)), and is
sufficient to express large protein libraries and allows
expressing libraries of protein variants in mammalian
cells.
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
104
TABZE 6. Expression of a single butyrylcholinesterase
variant per cell using either stable or transient cell
transfection.
Cell Expression Integration Integration? Integration?
Line Method (PCR) (Activity)
NIH3T3 Transient N/A N/A Transient,
(13-1) (lipid- very low
based) activity
NIH3T3 Stable Cre Yes No measurable
(13-l) recombinase activity
CHO Transient N/A N/A Transient,
(lipid- measurable
based) activity
(colorimetric
and cocaine
hydrolysis)
293 Transient N/A N/A Transient,
(lipid- measurable
based) activity
(colorimetric
and cocaine
hydrolysis)
293 Stable Flp Yes Measurable
recombinase activity
(colorimetric
and cocaine
hydrolysis)
These results demonstrate optimization of
transfection conditions for targeted insertion in N1H3T3
13-1 cells. Conditions for a simple, lipid-based
transfection method that required a small amount of DNA
and generated reproducible 0.5% targeting efficiency were
established.
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
105
Expression of butyrylcholinesterase variant libraries in
mammalian cells
Each of the seven libraries of
butyrylcholinesterase variants are transformed into a
host mammalian cell line using the doublelox targeting
vector and the optimized transfection conditions
described above. Following Cre-mediated transformation
the host cells are plated at limiting dilutions to
isolate distinct clones in a 96-well format. Cells with
the butyrylcholinesterase variants integrated in the
Cre/1ox targeting site are selected with geneticin.
Subsequently, the DNA encoding butyrylcholinesterase
variants from 20-30 randomly selected clones from each
library are sequenced and analyzed as described above.
Briefly, total cellular DNA is isolated from about 104
cells of each clone of interest using DNeasy Tissue Kits
(Qiagen, Valencia, CA). Next, the butyrylcholinesterase
gene is amplified using PfuTurbo DNA polymerase
(Stratagene; La Jolla, CA) and an aliquot of the PCR
product is then used for sequencing the DNA encoding
butyrylcholinesterase variants from randomly selected
clones by the fluorescent dideoxynucleotide termination
method (Perkin-Elmer, Norwalk, CT) using a nested
oligonucleotide primer.
As described previously, the sequencing
demonstrates uniform introduction of the library and the
diversity of mammalian transformants resembles the
diversity of the library in the doublelox targeting
vector following transformation of bacteria.
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
106
Table 7. Relative Activity of butyrylcholinesterase
variants (WT=1) with enhanced cocaine hydrolase activity
and corresponding colon changes.
Wild-type 1
A199S GCA to TCA 2.5
F227A TTT to GCG 4.1
F227G TTT to GGG 4.0
F227S TTT to AGT 2.3
F227P TTT to CCG 2.9
10F227T TTT to ACT 1.9
F227C TTT to TGT 1.9
F227M TTT to ATG 1.4
P285Q CCT to CAG 2.4
P285S CCT to AGC 1.9
15S287G TCA to GGT 4.1
A328W GCT to TGG 7*
V331L GTC to TTG n.d
Y332S TAT to TCG n.d
Y332M TAT to ATG n.d
20Y332P TAT to CCA n.d
A328W/Y332M/S287G/F 227A/A199S 100
A328W/S287G/F227A/A 199S 100
A328W/S287G/A199S 97
A328W/S287G/F227A 91
25A328W/F227A 68
A328W/Y332M 24
A328W/Y332P 10
A328W/V331L 16
A328W/Y332S 8
30 * In this assay the A28W mutant was determined to have a seven-fold
increase relative to the wild-type rather than the fifteen-fold
increase detected as described in Example I.
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
107
As described herein, a library corresponding to
region five of butyrylcholinesterase was expressed and
individual variants were screened by measuring the
hydrolysis of [3H]-cocaine using the microtiter assay.
The catalytic efficiency (VmaX /Km) of variants with
enhanced activity were characterized using the microtiter
assay to determine their relative Km and VmaX~ Twenty-four
butyrylcholinesterase variants were identified that have
enhanced cocaine hydrolase activity: A328W/Y332M(SEQ TD
NO: 2), A328W/Y332P (SEQ ID NO: 4), A328W/V331L (SEQ ID
NO: 6) and A328W/Y332S(SEQ ID N0: 8),
A328W/Y332M/S287G/F227A/A199S (SEQ TD N0: 10),
A328W/S287G/F227A/A199S (SEQ ID N0: 12),
A328W/S287G/A199S (SEQ ID N0: 14), A328W/S287G/F227A (SEQ
ID NO: 16), A328W/F227A (SEQ ID N0: 18), Y322S (SEQ ID
N0: 20), Y332M (SEQ ID NO: 22),Y332P (SEQ ID N0: 24),
V331Z (SEQ ID N0: 26), F227A (SEQ ID N0: 28), F227G (SEQ
ID NO: 30), F227S (SEQ ID N0: 32), F227P (SEQ ID N0: 34),
F227T (SEQ ID NO: 36), F227C (SEQ ID NO: 38), F227M (SEQ
ID NO: 40), A199S (SEQ ID N0: 42); S287G (SEQ ID N0: 54);
P285Q (SEQ ID N0:56); P285S (SEQ ID N0: 58).
EXAMPLE IV
Characterization of Butyrylcholinesterase Variants that
Display Enhanced Cocaine Hydrolysis Activity
This example describes the molecular
characterization of butyrylcholinesterase variants that
display enhanced cocaine hydrolysis activity in the
microtiter assay desribed below. The cocaine hydrolysis
activity measured in the microtiter assay format is
further confirmed using greater amounts of the
butyrylcholinesterase variants of interest. In addition
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
108
to the microtiter-based assay, the activity of the clones
is demonstrated in solution phase with product formation
measured by the HPLC assay to verify the increased
cocaine hydrolysis activity of the butyrylcholinesterase
variants and confirm that the enhanced hydrolysis is at
the benzoyl ester group.
The kinetic constants for wild-type
butyrylcholinesterase and the best variants are
determined and used to compare the catalytic efficiency
of the variants relative to wild-type
butyrylcholinesterase. Kmvalues for (-)-cocaine are
determined at 37°C. Vn,ax and Km values are calculated
using Sigma Plot (Jandel Scientific, San Rafael, CA).
The number of active sites of butyrylcholinesterase is
determined by the method of residual activity using
echothiopate iodide or diisopropyl fluorophosphates as
titrants, as described previously by Masson et al.,
Biochemistry 36: 2266-2277 (1997). Alternatively, the
number of butyrylcholinesterase active sites is estimated
using an ELISA to quantitate the mass of
butyrylcholinesterase or butyrylcholinesterase variants
present in culture supernatants. Purified human
butyrylcholinesterase is used as the standard for the
ELISA quantitation assay. The catalytic rate constant,
k~at, is calculated by dividing V",aX by the concentration of
active sites. Finally, the catalytic efficiencies of the
best variants are compared to wild-type
butyrylcholinesterase by determining k~at~K", for each
butyrylcholinesterase variant.
In order to better characterize all the clones
expressing butyrylcholinesterase variants with increased
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
109
cocaine hydrolysis activity, the DNA encoding the
variants is sequenced. DNA sequencing reveals the
precise location and nature of the mutations and thus,
quantifies the total number of distinct
butyrylcholinesterase variants identified. Screening of
each library is complete when clones encoding identical
butyrylcholinesterase mutations are identified on
multiple occasions, indicating that the libraries have
been screened exhaustively.
EXAMPLE V
Synthesis and Characterization of Combinatorial
Butyrylcholinesterase Variant Libraries
This example demonstrates synthesis and
characterization of combinatorial libraries of
butyrylcholinesterase variants expressed in mammalian
cells.
The beneficial mutations identified from
screening libraries of butyrylcholinesterase variants
containing a single amino acid mutation are combined in
vitro to further improve the butyrylcholinesterase
cocaine hydrolysis activity. The positive combination of
beneficial mutations designated biochemical additivity
has been observed on multiple occasions. For example,
the iterative process of increasing antibody affinity in
a stepwise fashion through the accumulation and
subsequent combination of beneficial mutations has led to
the identification of antibodies displaying 500-fold
enhanced affinity using variant libraries containing less
than 2,500 distinct variants. Importantly, the principle
of biochemical additivity is not restricted to improving
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
110
the affinity of antibodies, and has been exploited to
achieve improvements in other physical properties, such
as thermostability, catalytic efficiency, or enhanced
resistance to pesticides.
The best mutations identified from screening
the seven focused butyrylcholinesterase libraries are
used to synthesize a combinatorial library. The number
of distinct variants in the combinatorial library is
expected to be small, typically a fraction of the number
of distinct variants from the initial libraries. For
example, combinatorial analysis of single mutations at
eight distinct sites would require a library that
contains 28, or 256, unique variants. The combinatorial
library is synthesized by oligonucleotide-directed
mutagenesis, characterized, and expressed in the
mammalian host cell line. Variants are screened and
characterized as described above. DNA sequencing reveals
additive mutations.
EXAMPLE VI
Expression and Purification of Butyrylcholinesterase
Variants
This example demonstrates the expression in a
mammalian cell line and subsequent purification of
butyrylcholinesterase variants.
Clones expressing the most catalytically active
butyrylcholinesterase variants, as well as wild-type
butyrylcholinesterase, are used to establish larger-scale
cultures in order to purify quantities of the enzyme
necessary for in vivo studies. It is estimated that
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
111
approximately 100 mg each of wild-type
butyrylcholinesterase and the optimal variant is required
to complete the in vivo toxicity and addiction studies in
rats as described below.
The butyrylcholinesterase variants of interest
are cloned into the pCMV/Zeo vector (Invitrogen,
Carlsbad, CA) using unique restriction sites, The
cloning of the variants is verified using restriction
mapping and DNA sequencing. Subsequently, the variants
are expressed in transfected Chinese Hamster ovary cells
CHO Kl (ATCC CCh 61). CHO cells were selected for
expression because butyrylcholinesterase is a
glycoprotein and these cells have been previously used
for the expression of recombinant human therapeutic
glycoproteins (Goochee et al., Biotechnoloay 9:1347-1355
(1991); Jenkins and Curling, Enzyme Microb. Technol.
16:354-364 (1994)) as well as fully active recombinant
butyrylcholinesterase (Masson et al., supra, 1997).
Initially, the CHO cells are transiently transfected with
all the butyrylcholinesterase variants to confirm
expression of functional butyrylcholinesterase.
Subsequently, the cells are stably transfected and clones
expressing butyrylcholinesterase variants are selected
using the antibiotic Zeocin (Invitrogen. Carlsbad, CA).
Colonies are picked with a sterile cotton-tipped stick
and transferred to 24-well plates. The
butyrylcholinesterase expression is measured and the
colonies with the highest activity are further expanded.
The kinetic constants of the butyrylcholinesterase
variants are determined to ensure that expression in CH0
cells does not diminish the enzymatic activity compared
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
112
to butyrylcholinesterase variants expressed in NIH3T3
cells.
The cells are expanded in T175 flasks and
expanded further into multiple 3L spinner flasks until
approximately 5 x 108 cells are obtained. Subsequently,
the cell lines are transferred to CELL-PHARM System 2000
hollow fiber cell culture systems (Unisyn Technologies,
Hopkinton, MA) for the production and continuous recovery
of butyrylcholinesterase. The hollow fiber system
permits high cell densities to be obtained (108/m1) from
which 60-120 ml of concentrated butyrylcholinesterase is
harvested each day. It is anticipated that it requires
one month to produce sufficient quantities of
butyrylcholinesterase for further evaluation.
The concentrated recombinant
butyrylcholinesterase harvested from the hollow fiber
systems are purified, essentially as described previously
(Masson et al., supra, 1997). The serum-free medium is
centrifuged to remove particulates, its ionic strength is
reduced by dilution with two volumes of water, and
subsequently, the sample is loaded on a procainamide
Sepharose affinity column. Butyrylcholinesterase is
eluted with procainamide, purified further by ion
exchange chromatography and concentrated. A recombinant
butyrylcholinesterase mutant expressed in CHO cells has
previously been enriched to 99o purity with over 50%
yields using this purification approach (Lockridge et
al., Biochemistry 36:786-795 (1997)). The enzyme is
filter-sterilized through a 0.22-~a.m membrane and stored
at 4°C. Under these conditions, butyrylcholinesterase
retains over 90o of its original activity after 18 months
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
113
(Lynch et al., Toxicology and Applied Pharmacol. 55:83-91
(1999) ) .
EXAMPhE VII
Evaluation of Wild-Tvt~e Butyrylcholinesterase and
Butyrylcholinesterase Variants
This example describes the evaluation of wild-
type butyrylcholinesterase and butyrylcholinesterase
variants in rat cocaine toxicity and reinforcement
models.
Butyrylcholinesterase variants that display
increased cocaine hydrolysis activity in vitro display
greater potency for the treatment of cocaine toxicity and
addiction in vivo. To characterize the
butyrylcholinesterase variants in vivo, an acute overdose
model is used to measure the potency of
butyrylcholinesterase variants for toxicity, while models
of reinforcement and discrimination are used to predict
the potency of butyrylcholinesterase variants for the
treatment of addiction. Although the pharmacokinetics of
human butyrylcholinesterase variants are not expected to
be optimal in models, the rat cocaine models are well
characterized and require significantly smaller
quantities of purified butyrylcholinesterase than do
primate models. It is anticipated that both wild-type
butyrylcholinesterase and the butyrylcholinesterase
variants with increased cocaine hydrolysis activity
display dose-dependent responses. Furthermore, the
butyrylcholinesterase variant optimized for cocaine
hydrolysis activity are efficacious at substantially
smaller doses than the wild-type butyrylcholinesterase.
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
114
Modification of the Toxicity of Cocaine
The effect of butyrylcholinesterase variants on
cocaine toxicity is evaluated as previously described in
rat model of overdose by Mets et al., Proc. Nat. Acad.
Sci. USA 95:10176-10181 (1998). This model uses
co-infusion of catecholamines because variable endogenous
catecholamine levels have been shown to affect cocaine
toxicity (Mets et al., Zife Sci. 59:2021-2031 (1996)).
Infusion of cocaine at 1 mg/kg/min produces ZDSo = 10
mg/kg and ZD9o= 16 mg/kg when the levels of
catecholamines are standardized.
Six groups of six rats each are used in this
study. The rats are Sprague-Dawley males, weighing
250-2758 upon receipt in the vivarium, which is
maintained on a 12 hour light-dark cycle. The rats have
food and water available ad libitum at all times. Prior
to treatment the rats are fitted with femoral arterial
and venous catheters and permitted to recover.
Subsequently, the rats are treated with varying amounts
of the butyrylcholinesterase variants (0.35, 1.76, or
11.8 mg/kg) or equivalent volumes of saline 15 minutes
prior to the co-infusion of catecholamines and cocaine (1
mg/kg/min). The infusion is for 16 minutes to deliver
the LD9o of cocaine, unless the animals expire sooner.
Based on the relative catalytic efficiencies of wild-type
butyrylcholinesterase and the previously described
catalytic antibody (Mets et al., supra, 1998), it is
anticipated that increasing doses of
butyrylcholinesterase confer increased survival rate to
the rats relative to the saline controls and that the
highest butyrylcholinesterase dose (11.8 mg/kg) protects
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
115
all the animals. A butyrylcholinesterase variant that
hydrolyzes cocaine 10-fold more efficiently in vitro is
be expected to confer protection to all of the animals at
a lower dose (1 mg/kg, for example).
Modification of the Abuse of Cocaine
The discriminative and reinforcing
pharmacological effects of cocaine are believed to most
closely reflect the actions of cocaine that embody abuse
of the drug. Therefore, the butyrylcholinesterase
variants are evaluated in both cocaine reinforcement and
cocaine discrimination models in rats.
The rat model of the reinforcing effects of
cocaine has been used extensively to evaluate other
potential therapies for cocaine (Koob et al., Neurosci.
Lett. 79: 315-320(1987); Hubner and Moreton,
Psychopharmacoloay 105: 151-156 (1991); Caine and Koob,
J. Pharmacol. Exp. Ther. 270:209-218 (1994); Richardson
et al., Brain Res. 619: 15-21 (1993)).
Male Sprague-Dawley rats are maintained as
described above. Six operant chambers (Med Associates,
St. Albans, VT), equipped with a house light, retractable
lever, dipper mechanism, red, yellow, and green stimulus
lights, and a pneumatic syringe-drive pump apparatus
(IITC Life Sciences, Inc., Woodland Hills, CA) for drug
delivery are interfaced with an IBM-compatible computer
through input and output cards (Med Associates, Inc., St.
Albans, VT). The chambers are housed within an air
conditioned, sound attenuating cubicle (Med Associates).
Custom self-administration programs, controlling
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
116
scheduled contingencies and stimulus arrays within the
operant chambers, are written using the Med-PC
programming language for DOS.
The reinforcing effects of cocaine are assessed
in a model that quantitates the number of injections
taken by rats under conditions in which intravenous
administration is contingent upon a response made by the
animal (Mats et al., supra, 1998). The rats are trained
in the operant conditioning chambers to press a lever in
order to gain access to 0.5 ml of a sweetened milk
solution. After the rats have acquired the lever-press
response on a fixed-ratio 1 (FR1) schedule of
reinforcement, the response requirements are successively
increased to an FR5 schedule. When the rats display
stable rates of milk-maintained responding over three
consecutive days on this schedule (less than 100
variability in reinforcer deliveries over the one-hour
session) a catheter is surgically introduced in the left
internal jugular vein and the rats are given a minimum of
two days to recover from surgery.
On the first operant training session following
surgery, rats are allowed to respond on the lever, in a
one-hour session, for the simultaneous 5-second delivery
of both milk and an intravenous bolus of cocaine (0.125
mg/kg/injection). The milk is then removed from the
chamber and for the next three days, the rats are given
access to one of three doses of cocaine (0.125, 0.25, or
0.5 mg/kg/injection) for one hour each, in
self-administration sessions six hours in duration.
Thus, the rats are allowed access to each dose twice per
session and the doses are presented in repeated ascending
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
117
order (i.e., 0.125, 0.25, 0.5, 0.125, 0.25, 0.5
mg/kg/injection). Within each one-hour long
dose-component, the original FR5 schedule with a
10-second timeout is retained. In addition, 10-minute
timeout periods are instituted after each dose component
in an attempt to minimize carryover effects across the
individual one-hour sessions.
When the rats display consistent cocaine
self-administration (over 160 injections per six-hour
session with less than 15o variability) over three
consecutive days, they are placed on a schedule in which
smaller doses, as well as saline, are available during
single daily sessions. Each session is divided into two
components, with saline and three doses of cocaine
available in each component. The first component of each
session provides access to a series of low doses
(0-0.0625 mg/kg/injection) while the second component
provides access to a wider range of doses (0-0.5
mg/kg/injection).
After the rates of cocaine self-administration
are stabilized the rats are divided between six groups
and each group (n = 6 rats) is given 0.35, 1.76, or 11.8
mg/kg of either wild-type butyrylcholinesterase, the
optimized butyrylcholinesterase variant or an equivalent
volume of saline 30 minutes prior to the beginning of the
daily self- administration sessions. The effects of the
pretreatment are monitored for several days until the
cocaine self-administration behavior of the rat returns
to baseline.
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
118
Using a fixed ratio (FR) schedule, the number
of injections is limited only by the duration of the
session and consequently, the number of injections is
used as the dependent variable to compare the potency of
optimized butyrylcholinesterase with wild-type
butyrylcholinesterase. Following administration of
varying concentrations of wild-type butyrylcholinesterase
or the optimized butyrylcholinesterase variant, the dose
response curves are analyzed using a mixed factor MANOVA.
The butyrylcholinesterase concentration (0.35, 1.76, or
11.8 mg/kg,) is loaded as the between-subjects factor and
the cocaine dose (0, 0.015, 0.03, 0.06, 0.125, 0.25, 0.5
mg/kg/injection) is loaded as the within-subjects factor.
All individual comparisons across butyrylcholinesterase
treatment groups at individual cocaine doses use the
Tukey HSD post-hoc procedure (see Gravetter, F. J. and
Wallnau, Z. B., Statistics for the Behavioural Sciences
(5th ed., 2000, Wadsworth Publ., Belmont, CA)) and the
criterion for statistical significance is set at p <
0.05. At higher butyrylcholinesterase doses (11.8
mg/kg), the number of injections taken by the rats is
expected to be lower than the untreated (saline) control
group. Furthermore, rats treated with the
butyrylcholinesterase variant displaying enhanced cocaine
hydrolysis are expected to reduce their number of
injections at a smaller dose (0.35 mg/kg) than the
animals treated with the wild-type butyrylcholinesterase.
Drug discrimination is relevant to the
subjective effect of cocaine in clinical situations and
antagonism of cocaine discrimination following
pretreatment is considered clear evidence of therapeutic
potential (Holtzman, Moderm Methods in Pharmacoloay,
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
119
Testing and Evaluation of Drua Abuse, Wiley-Ziss Inc.,
New York, (1990); Spealman, NIDA Res. Mon. 119: 175-179
(1992)). The most frequently used procedure to establish
and evaluate the discriminative stimulus effect of drugs
is to train animals in a controlled operant procedure to
use the injected drug as a stimulus to control
distribution of responding on two levers. Dose- effect
curves consisting of distribution of the responses on the
"drug-associated" lever as a function of drug dose are
easily generated. These cocaine dose-effect curves can
be altered by the administration of a competitive
antagonist. The amount of the shift of the curve and
time required for the original sensitivity of the animal
to cocaine to return are useful data for evaluating the
potential therapeutic use of wild-type
butyrylcholinesterase and the optimized variant. The
discriminative stimulus effects of cocaine in rat models
have been used to evaluate the therapeutic potential of
dopamine reuptake inhibitors, as well as agonists and
antagonists to the dopamine receptors (Witkin et al., J.
Pharmacol. Exp. Ther. 257: 706-713 (1989) Kantak et al.,
J. Pharmacol. Exp. Ther. 274: 657-665 (1995); Barret and
Appel, Psychopharmacoloay 99: 13-16 (1989) Callahan et
al., Psychopharmacoloay 103: 50-55 (1991)).
A multiple trial procedure for training and
testing cocaine as a discriminative stimulus is used to
evaluate the potency of butyrylcholinesterase in rats as
previously described in Bertalmio et al. J. Pharmacol.
Methods 7: 289-299 (1982) and Schecter, Eur. J.
Pharmacol. 326: 113-118 (1997). A dose-response curve
for cocaine is obtained in a single session in the
presence of butyrylcholinesterase or the optimized
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
120
butyrylcholinesterase variant. Subsequently, the
recovery of the rat's original sensitivity to cocaine is
tracked on a twice-weekly basis to assess the duration of
action of the butyrylcholinesterase.
The rats are deprived to 800 of their
free-feeding weight at the beginning of the experiment in
order to train them in the food-reinforced operant
procedure. Each rat is placed in an operant conditioning
chamber equipped with two light stimuli and two
retractable levers, one on either side of a milk delivery
system and trained to press on one of the levers to
receive access to 0.5 ml of sweetened condensed milk.
Once the rats have learned to respond on this lever, a
multiple-trials procedure is initiated. Each session
consists of 6 trials with each trial lasting 15 minutes.
The first 10 minutes of each trial are a blackout period,
during which no lights are on and responding has no
consequence. This 10-minute period allows for drug
absorption in the subsequent testing phases of the study.
The last 5 minutes of each trial are a milk-reinforced
period (FR5). Once the rats respond consistently and
rapidly during the 5-minute response period (signaling
period), cocaine is introduced into the procedure.
Initially, 10 mg/kg cocaine is given 10 minutes
prior to the beginning of three of six weekly sessions.
During these sessions, the "non-cocaine" lever (saline)
previously extended is retracted and the other,
"cocaine-associated," lever is extended on the other side
of the milk delivery cup. Responses (initially only a
single response; eventually five responses) on this
second lever result in milk presentation if cocaine was
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
121
administered prior to the session. The rats are being
trained to respond on the second lever if they detect the
interoceptive effects of the administered cocaine.
Because cocaine's interoceptive effects are not believed
to extend beyond 30 minutes, the sessions following
cocaine administration lasts for only two trials (15
minutes each). At this juncture the rats do not receive
a cocaine injection on three days of the week and on
those days they are reinforced with milk (FR5) for
responding on the available non-cocaine lever during the
signaling periods of six trials. On the remaining three
days of the week, the rats are given 10 mg/kg cocaine
before the beginning of the session and are reinforced
for responding on the available cocaine lever during the
signaling periods on each of two trials.
Subsequently, each daily session is initiated
with one to four trials without cocaine administration,
followed by the administration of 10 mg/kg cocaine.
Thus, each session ends with two trials in which
responding on the cocaine-appropriate lever is required
for food delivery. Although only the "correct" levers
are extended during this phase, the critical step of
making both levers available during the entire session is
taken as soon as the animals learn to switch from the
non-cocaine to the cocaine lever within daily sessions.
Subsequently, each session begins with a 10-minute
blackout period followed by presentation of both levers
for five minutes. During the first 1 to 4 trials of a
daily session, no cocaine is given, and 5 consecutive
responses on the non-cocaine lever result in food during
this 5-minute period. If the rat switches from one lever
to the other or responds on the incorrect lever, he does
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
122
not get reinforced and both levers are retracted for 10
seconds, at which time the levers are presented again and
the trial restarted. At the start of the second, third,
or fourth trial, 10 mg/kg cocaine are given and the rat
is returned to the test box. When the light is
illuminated and the levers presented on the next two
trials, five consecutive responses on the cocaine lever
are required for milk presentation to demonstrate that
the rats are learning to switch their responding from the
non-cocaine lever to the cocaine lever using the
interoceptive effects of cocaine as a cue to tell them
which lever is correct on a given trial.
A cocaine dose-effect curve is obtained as soon
as the rats meet criterion of 80o correct lever selection
on three consecutive sessions. On the first trial of a
test session, saline is given. On subsequent trials, 0.1,
0.3, 1 .0, 3.2, and 10 mg/kg cocaine is administered,
each at the start of the 10 minute blackout that begins
each trial. During these test trials, five consecutive
responses on either lever result in milk presentation,
but switching from one lever to the other prior to
completion of an FR results in lever retraction for 10
seconds. It is anticipated that animals begin this
session with responses on the non-cocaine lever and
gradually increase the percent of responses made on the
cocaine lever until all responses are made on that lever.
Thus, a dose-response curve of lever selection versus
dose of cocaine administered is established during each
test session.
Once cocaine has been established as a
discriminative stimulus, the rats are placed in separate
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
123
groups (n = 6 per group) that receive 0.35, 1.76, or 11.8
mg/kg of either wild-type butyrylcholinesterase or the
optimized variant. The discriminative stimulus effects
of cocaine is determined 30 minutes following enzyme
administration and daily afterwards until sensitivity to
cocaine is re-established. On the initial test session
following administration of butyrylcholinesterase, larger
doses of cocaine are given if there is no selection of
the cocaine lever following any of the smaller test
doses. Doses as large as 100 mg/kg cocaine are given if
the animals fail to select the cocaine-appropriate lever
following administration of 10 or 32 mg/kg cocaine.
Because dose-response curves to cocaine can be obtained
in a single session, this protocol provides information
on the relative ability of the two types of
butyrylcholinesterase to decrease the potency of cocaine
as a discriminative stimulus, which is a relevant aspect
of its abuse liability. The butyrylcholinesterase
variant displaying enhanced cocaine hydrolysis activity
in vitro is more potent.
Throughout this application various
publications have been referenced within parentheses.
The disclosures of these publications in their entireties
are hereby incorporated by reference in this application
in order to more fully describe the state of the art to
which this invention pertains.
Although the invention has been described with
reference to the disclosed embodiments, those skilled in
the art will readily appreciate that the specific
experiments detailed are only illustrative of the
invention. It should be understood that various
CA 02433057 2003-06-25
WO 02/064796 PCT/USO1/50450
124
modifications can be made without departing from the
spirit of the invention. Accordingly, the invention is
limited only by the following claims.
