Note: Descriptions are shown in the official language in which they were submitted.
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
SPECIFIC HUMAN ANTIBODIES FOR SELECTIVE CANCER THERAPY
FIELD OF THE INVENTION
[1.] The present invention relates to the field of tissue targeting and
identification, with the aid of phage display technology, of peptides and
polypeptides
that specifically bind to target cells. Such peptides and polypeptides are Fv
molecules, constructs thereof, fragments of either or constructs of a
fragment. More
particularly, the peptides and polypeptides may have anti-cancer activity,
and/or are
associated with, or conjugated to, anti-cancer agents, especially against
blood-related
cancers.
BACKGROUND OF THE INVENTION
[2.] Tissue-selective targeting of therapeutic agents is an emerging
discipline in the pharmaceutical industry. New cancer treatments based on
targeting
have been designed to increase the specificity and potency of the treatment,
while
reducing toxicity, thereby enhancing overall efficacy. Mouse monoclonal
antibodies
(MAb's) to tumor-associated antigens have been employed in an attempt to
target
toxin, radionucleotide, and chemotherapeutic conjugates to tumors. In
addition,
differentiation antigens, such as CD19, CD20, CD22 and CD25, have been
exploited
as cancer specific targets in treating hematopoietic malignancies. Although
extensively studied, this approach has several limitations. One limitation is
the
difficulty of isolating appropriate monoclonal antibodies that display
selective
binding. A second limitation is the need for high antibody immunogenicity as a
prerequisite for successful antibody isolation. A third limitation is the
elicitation in
the patient of an immune response against murine antibodies (human anti-mouse
antibody-HAMA response) that often results in a shorter serum half life, and
prevents
repetitive treatments, thus diminishing the therapeutic value of the antibody.
This
latter limitation has stimulated interest both in engineering chimeric or
humanized
monoclonal antibodies of murine origin, and in discovering human antibodies.
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
[3.] There are many factors that influence the therapeutic efficacy of
monoclonal antibodies (blabs) for treating cancer. These factors include
specificity of
antigen expression on tumor cells, level of expression, antigenic
heterogeneity, and
accessibility of the tumor mass. Leukemia and lymphoma have been generally
more
responsive to treatment with antibodies than solid tumors, such as carcinomas.
MAbs
rapidly bind to leukemia and lymphoma cells in the bloodstream and easily
penetrate
to malignant cells in lymphatic tissue, thus making lymphoid tumors excellent
candidates for MAb-based therapy. An ideal system would entail identifying a
MAb
that recognizes a marker on the cell surface of stem cells that produce
malignant
progeny cells.
[4.] To aid in the discovery/production of blabs, phage libraries have been
used to select random single chain Fvs (scFvs) that bind to isolated, pre-
determined
target proteins such as antibodies, hormones and receptors. In addition, the
use of
antibody display libraries in general, and phage scFv libraries in particular,
facilitates
an alternative means of discovering unique molecules for targeting specific,
yet
unrecognized and undetermined, cell surface moieties.
[5.] Leukemia, lymphoma, and myeloma are cancers that originate in the
bone marrow and lymphatic tissues and are involved in uncontrolled growth of
cells.
Acute lymphoblastic leukemia ("ALL") is a heterogeneous disease that is
defined by
specific clinical and immunological characteristics. Like other forms of ALL,
the
definitive cause of most cases of B-cell ALL ("B-ALL") is not known, although
in
many cases, the disease results from acquired genetic alterations in the DNA
of a
single cell, causing it to become abnormal and multiply continuously
[6.] AML is a heterogeneous group of neoplasms with a progenitor cell
that, under normal conditions, gives rise to terminally differentiated cells
of the
myeloid series (erythrocytes, granulocytes, monocytes, and platelets). As in
other
forms of neoplasia, AML is associated with acquired genetic alterations that
result in
replacement of normally differentiated myeloid cells with relatively
undifferentiated
blasts, exhibiting one or more type of early myeloid differentiation. AML
generally
evolves in the bone marrow and, to a lesser degree, in the secondary
hematopoietic
2
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
organs. AML primarily affects adults, peaking in incidence between the ages of
15-
40 years, but it is also known to affect both children and older adults.
Nearly all
patients with AML require treatment immediately after diagnosis to achieve
clinical
remission, in which there is no evidence of abnormal levels of circulating
undifferentiated blast cells.
[7.] To date, a variety of monoclonal antibodies have been developed that
induce cytolytic activity against tumor cells. A humanized version of the
monoclonal
antibody MuMAb4D5, directed to the extracellular domain of P 185 - growth
factor
receptor (HER2) - was approved by the FDA and is being used to treat human
breast
cancer (US Patent No.'s 5,821,337 and 5,720,954). Following binding, the
antibody is
capable of inhibiting tumor cell growth that is dependent on the HER2 growth
factor
receptor. In addition, a chimeric antibody against CD20, which causes rapid
depletion of peripheral B cells, including those associated with lymphoma, was
recently approved by the FDA (US Patent No. 5,843,439). The binding of this
antibody to target cells results in complement-dependent lysis. This product
has
recently been approved and is currently being used in the clinic to treat low-
grade B-
cell non-Hodgkin's lymphoma.
[8.] Several other humanized and chimeric antibodies are under
development or are in clinical trials. In addition, a humanized Ig that
specifically
reacts with CD33 antigen, expressed both on normal myeloid cells, as well as
on most
types of myeloid leukemic cells, was conjugated to the anti-cancer drug
calicheamicin, CMA-676 (Sievers et al., Blood, 90 (10 Suppl. 1 Part 1), 504A
(1997)). This conjugate, known as the drug Mylotarg, has recently been
approved
(Canon et al., Cancer Supplement, 73, 1049-1056 (1994)). In light of its
cytolytic
activity, an additional anti-CD33 antibody (HuM195), currently in clinical
trials, was
conjugated to several cytotoxic agents, including the gelonin toxin (McGraw et
al.,
Cancer Immunol. Immunother, 39, 367-374 (1994)) and radioisotopes ~31I (Canon
et
al., Blood 83, 1760-1768 (1994)), 9°Y (Jurcic et al., Blood, 92, (10
Suppl. Part 1-2),
613A (1998)) and 2~3B1 (Sgouros et al., J. Nucl. Med., 38 (5 Suppl.), 231P
(1997)).
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
[9.] A chimeric antibody against the leukocyte antigen CD-45 (cHuLym3)
is in preclinical phase for treatment of human leukemia and lymphoma (Sun et
al.,
Cancer Immunol. Immunother., 48, 595-602 (2000)) as a conditioning for bone
marrow transplantation. In in vitro assays, specific cell lysis was observed
in ADCC
(antibody dependent cell-mediated cytotoxicity) assays (Henkart, Immunity, 1,
343-
346 (1994); Squier and Cohen, Current Opin. Immunol., 6, 447-452 (1994)).
[10.] Although these preliminary results seem promising, they have the
following limitations. The final product comprises non-human sequences,
resulting in
a problematic immune response to non-human material, such as HAMA. This
HAMA response prevents repetitive treatments and results in a shorter serum
half life
for the product. In addition, the above methods allow for the isolation of a
single
antibody species only, and only allow for the isolation of antibodies against
known
and purified antigens. Further, these methods are not selective insofar as
they allow
for the isolation of antibodies against cell surface markers that are present
on normal
cells as well as on malignant cells.
[11.] Thus, a method, which overcomes these above discussed limitations,
would be desirable. Further, such method would ideally enable the
identification of
target ligands or markers on cancer cells or cells involved in mediating
metastis of
cancer cells, for example. Additionally, such method would also enable the
production of antibodies to such targets. Phage display technology appears to
offer
such abilities.
[12.] The use of phage display technology has enabled the isolation of scFvs
comprising fully human sequences. For example, fully human antibody against
the
human TGFb2.receptor based on a scFv clone derived from phage display
technology
was recently developed. This scFv, converted into a fully human IgG4 that is
capable
of competing with the binding of TGFb2 (Thompson et al., J. Immunol Methods,
227,
17-29 (1999)), has strong anti-proliferative activity. This technology, known
to one
skilled in the art, is more specifically described in the following
publications: Smith,
Science, 228, 1315 (1985); Scott et al, Science, 249, 386-390 (1990); Cwirla
et al.,
PNAS, 87, 6378-6382 (1990); Devlin et al., Science, 249, 404-406 (1990);
Griffiths et
4
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
al., EMBO J., 13(14), 3245-3260 (1994); Bass et al., Proteins, 8, 309-314
(1990);
McCafferty et al., Nature, 348, 552-554(1990); Nissim et al., EMBO J., 13, 692
-698
(1994); U.S. Patent Nos 5,427,908, 5,432,018, 5,223,409 and 5,403,484, lib.
[13.] Using this phage display technology, the inventors of the present
invention have identified cell markers present on or cells in diseased or
malignant
state. Therefore, it is an objective of the present invention to identify
peptides and
polypeptides that recognize cell markers that are substantially exposed or
over-
expressed, particularly on or in cells in a diseased or malignant state.
[14.] It is a further objective of the present invention to use and expand
phage display technology as an aid to identify such peptides and polypeptides.
[15.] It is a further objective of the present invention to identify such
peptides and polypeptides by immuno-cross-reactivity.
[16.] It is a still further objective of the present invention that such
peptides
and polypeptides be of fully human origin.
[17.] It is a still further objective of the present invention that such
peptides
and polypeptides be isolated against antigens that may not necessarily be
immunogenic.
[18.] It is a still further objective of the present invention to provide
peptides
or polypeptides that prevent, retard or cure cancer, particularly blood-
related cancers
including leukemia or lymphoma.
[19.] It is a still further objective of the present invention to provide for
local
targeting of cancerous cells with such peptides and polypeptides alone, or
associated
with, or coupled to, an anti-cancer agent and/or a diagnostic label or marker.
[20.] It is a still further objective of the present invention to provide a
method for producing a targeting agent against desired ligands.
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
[21.] It is a still further objective of the present invention to identify
specific
motifs that provide for the recognition of cell markers that are over-
expressed in the
malignant state and that can be used in the construction of a targeting or
diagnostic
label or marker for an anti-cancer agent.
[22.] It is a still further objective of the present invention to provide a
composition comprising an effective amount of such peptides, polypeptides or
motifs
associated with, or coupled to, an anti-cancer agent or to a diagnostic label
or marker.
[23.] It has been established that scFv penetrate tissues and are cleared from
the blood more rapidly than a full size antibody because they are smaller in
size.
Adams, G.P., et al., Br. J. Cancer 77, 1405-1412 (1988); Hudson, P.J., Curr.
Opin.
Immunol. 11(5), 548-557 (1999); Wu, A.M., et al., Tumor Targeting 4, 47
(1999).
Thus, scFv are often employed in diagnostics involving radioactive labels such
as
tumor imaging to allow for a more rapid clearance of the radioactive label
from the
body. A number of cancer targeting scFv multimers have recently undergone pre-
clinical evaluation for in vivo stability and efficacy. Adams, G.P., et al.,
Br. J. Cancer
77, 1405-1412 (1988); Wu, A.M., et al., Tumor Targeting 4, 47 (1999).
[24.] Single chain Fv (scFv) fragments are comprised of the variable
domains of the heavy (VH) and light (VL) chains of an antibody tethered
together by a
polypeptide linker. The linker is long enough to allow the (VH) and the (VL)
domains
to fold into a functional Fv domain enabling the scFv to recognize and bind
its target
with the similar or increased affinity of the parent antibody. A, commonly
used linker
comprises glycine and serine residues to provide flexibility and protease
resistance.
[25.] Typically, scFv monomers are designed with the C-terminal end of the
VH domain tethered by a polypeptide linker to the N-terminal residue of the
VL.
Optionally an inverse orientation is employed: the C-terminal end of the VL
domain
is tethered to the N-terminal residue of VH through a polypeptide linker.
Power, B., et
al., J. Immun. Meth. 242, 193-204 (2000). The polypeptide linker is typically
around
twelve amino acids in length. When the linker is reduced to about three to
twelve
amino acids, the scFvs can not fold into a functional Fv domain and instead
associate
6
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
with a second scFv to form a diabody. Further reducing the length of the
linker to less
than three amino acids forces the scFv association into trimers or tetramers,
depending on the linker length, composition and Fv domain orientations. B.E.
Powers, P.J. Hudson, J. Immun. Meth. 242 (2000) 193-194.
[26.] Recently, it has been discovered that mulitvalent antibody fragments
such as scFv dimers, trimers, and tetramers often provide higher apparent
affinity over
the binding of the parent antibody to the target. This higher affinity offers
many
advantages including ideal pharmaco-kinetics for tumor targeting applications.
[27.] The greater binding affinity of these multivalent forms is therefore
desirable in diagnostics and therapeutic regimens. For example, a scFv may be
employed as a blocking agent to bind a target receptor and thus block the
binding of
the "natural" ligand. In such instances, it is desirable to have a high
affinity
association between the scFv and the receptor to decrease chances for
disassociation,
which may allow an undesirable binding of the natural ligand to the target. In
addition, this high affinity is especially critical when the target receptors
are involved
in adhesion and rolling or when the target receptors are on cells present in
areas of
high sheer flow, such as platelets.
[28.] Therefore, an object of the invention is multivalent forms of Yl and
Y17 scFv. These multivalent forms include, but are not limited to dimers,
trimers and
tetramers, sometimes referred to herein as diabodies, triabodies, and
tetrabodies,
respectively.
SUMMARY OF THE INVENTION
[29.] The present invention provides for the identification of peptides and
polypeptides that bind selectively and/or specifically to target cells
especially against
blood related cancer cells, their construction, their use on their own, or in
association
with, or combined, conjugated or fused to one or more pharmaceutical agents.
7
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
[30.] One embodiment of the present invention provides for a peptide or
polypeptide comprising an Fv molecule, a construct thereof, a fragment of
either, or a
construct of a fragment having enhanced binding characteristics so as to bind
selectively and/or specifically to a target cell in favor of other cells,
wherein the
binding selectivity or specificity is primarily determined by a first
hypervariable
region, and wherein the Fv is a single chain Fv ("scFv") or a disulfide Fv
("dsFv"), .
and optionally having one or more tags.
[31.] In another embodiment of the present invention there is provided a
peptide or polypeptide comprising an Fv molecule, a construct thereof, a
fragment of
either, or a construct of a fragment having enhanced binding characteristics
so as to
bind selectively and/or specifically to a substantially exposed and/or
overexpressed
binding site on, or in, a target comprising a cell in favor of other cells on,
or in which,
the binding site is not substantially available and/or expressed, wherein the
binding
selectivity or specificity is primarily determined by a first hypervariable
region, and
wherein the Fv is a scFv or a dsFv, and optionally having one or more tags.
[32.] In a further embodiment of the present invention there is provided a
peptide or polypeptide comprising an Fv molecule, a construct thereof, a
fragment of
either, or a construct of a fragment having enhanced binding characteristics
so as to
bind selectively and/or specifically to a target cell in favor of other cells,
wherein the
Fv molecule comprises a first chain having a first, a second and a third
hypervariable
region and a second chain having a first, a second and a third hypervariable
region,
wherein one of the hypervariable regions of the first chain has a sequence
selected
from the group comprising SEQ ID NOs:B-24, and wherein one of the
hypervariable
regions of the second chain has a sequence selected from the group comprising
SEQ
ID NOs:I-6 and 125-202, and wherein the first, second, and third hypervariable
regions are a CDR3, CDR2 and CDRl region, respectively, and wherein the Fv is
a
scFv or a dsFv, and optionally having one or more tags.
[33.] In a further embodiment of the invention,
8
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
(a) the first and second chain each comprises a first hypervariable region
selected
from the group comprising SEQ ID NOs:B-24,
(b) the first hypervariable regions of the first and second chains are
identical and
are selected from the group comprising SEQ ID NOs:B-24,
(c) the first hypervariable region of the first chain is selected from the
group
comprising SEQ ID NOs:B-24, and the first hypervariable region of the second
chain
is selected from the group comprising SEQ ID NOs:l-6 and 125-202, or
(d) the first hypervariable region of the first chain is selected from the
group
comprising SEQ ID NOs:l-6 and 125-202, and the first hypervariable region of
the
second chain is selected from the group comprising SEQ ID NOs:B-24.
[34.] In a still further embodiment of the present invention there is provided
a peptide or polypeptide comprising an Fv molecule, a construct thereof, a
fragment
of either or a construct of a fragment that binds to an unknown ligand on a
first cell
having a first and a second state, wherein the binding is effective in the
second state
but not substantially in the first state and, by virtue of immuno-cross-
reactivity, binds
specifically or selectively to a ligand on a second cell, and wherein the Fv
is a scFv or
a dsFv, and optionally having one or more tags.
[35.] In a still further embodiment of the present invention there is provided
a method for identifying a targeting molecule which binds to unknown immuno-
cross-
reactive binding site on first and second cells comprising
(a) one or more biopanning steps that are performed on a first target cell
that, in a
second state but not in a first state, substantially exposing or displaying a
binding site
comprising an unknown ligand, so as to produce a first population of
recognition
molecules;
(b) subsequent biopanning and/or selection steps commencing with the resultant
stock of recognition molecules of step (a) that are performed on a second cell
that
displays a binding site comprising an unknown ligand having immuno-cross-
9
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
reactivity to the the unknown ligand of the first cell so as to produce a
second
population of recognition molecules;
(c) amplification and purification of the second population of recognition
molecules of step (b); and
(d) construction from the recognition sites of the purified recognition
molecules of
step (c) peptides or polypeptides that comprise targeting molecules that are
selective
and/or specific for unknown ligands on the second cell
[36.] In a still further embodiment of the present invention there is provided
a binding motif comprising the amino acid sequence of Rl-X Phe Pro-Rz whexein
R~
and Rz each comprises 0-15 amino acid residues, and wherein X is either Arg,
Gly or
Lys.
[37.] In yet another embodiment of the present invention there is provided a
method of production of a targeting agent comprising the following steps:
a) isolating and selecting one or more targeting molecules comprising a
primary
recognition site by a biopanning procedure directly on a target cell or by a
biopanning
procedure indirectly on a first target cell in a second but not in a first
state, and
subsequently by a biopanning procedure directly on a second target cell to
produce
one or more said targeting molecules;
b) amplification, purification and identification of the one or more targeting
molecules;
c) construction of a targeting agent from the one or more targeting molecules
or
recognition sites thereof;
wherein the targeting agent can be a peptide, polypeptide, antibody or
antibody fragment or a multimer thereof.
[38.] In another embodiment of the present invention there is provided a
peptide or polypeptide having the formula or structure:
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
A-X-B
wherein X is a hypervariable CDR3 region of 3 to 30 amino acids; A and B can
each
be amino acid chains from 1 to 1000 amino acids in length, wherein A is the
amino
end and B is the carboxy end. ,
BRIEF DESCRIPTION OF THE DRAWINGS
[39.] The invention is herein described in more detail, by way of example
only, and not by way of limitation, with reference to the accompanying
drawings
described below, wherein:
[40.] Figure 1 presents phage clone binding to fixed platelets, as determined
by the EIA assay. Data are presented as a function of absorbance at 405 nm.
[41.] Figures 2a, 2b and 2c present the binding of mononuclear cell
samples obtained from three individual AML patients to scFvs, as determined by
FACS analysis. Fluorescence intensity of cells bound by the two FITC-labeled
tested
samples (control scFv and scFv clone Y1) is presented.
[42.] Figure 3 presents the binding of Y-I to platelets (3a) and monocytes
(3b) that have been Ficoll-purified, as determined by FACS analysis.
Fluorescence
intensity of cells bound by the two FITC-labeled tested samples (control scFv
and
scFv clone Y1) is presented.
[43.] Figure 4 presents the binding of FITC-labeled scFv clone Y1 to cord-
blood CD34+ stem cells. CD34+ gated cells, in the FL3-H channel, were analyzed
in
the FLI-H channel for their binding to FITC-labeled negative control scFv
(figure 4a)
or FITC-labeled scFv clone Yl (figure 4b). Figure 4c presents a FSC and SSC
dot
plot analysis of the same FITC-labeled scFv clone Y1 sample as in 4b. The
circled
areas in figures 4b and 4c delineate the sub-population of CD34+ cells that
bind scFv
clone Y1.
[44.] Figure 5: FACS analyses of samples obtained from two patients with
pre-B-ALL cells are presented: one from a child (5a, 5c, Se) and the other
from an
11
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
adult (5b, Sd, Sf). A double staining procedure, using either a commercially
available
PE-labeled CD19 (a marker for normal peripheral B-cells; Figure Sa, Sc) or a
PE-
labeled CD34 (a marker for stem cells; Figure Sd) was employed, together with
a
FITC-labeled negative control scFv (5a, Sb) or FITC-labeled Y-I scFv (5c, Sd).
Figure Sb is a double negative control. Fluorescence intensity (x-axis) of
cells bound
by the FITC-labeled sample (scFv clone Y1), relative to the negative control
staining
pattern, is presented (Se and Sf).
[45.] Figure 6: This figure provides results of a binding comparison study
performed using Jurkat cells. FACS analysis of binding to Jurkat cells of FITC-
labeled Y-I scFv monomers, diabodies and triabodies, together with a negative
control, is presented.
[46.] Figure 7: This figure proivdes results of a study comparing the
binding of IgG- Y-I and scFv-Y1. A double staining procedure was employed to
compare the binding of full sized IgG-Y1 to that of the scFv-YI form. Five
nanograms of IgG-YI were used for FACS analysis on RAJI cell (YI negative
cells;
Figure 7a) and on Jurkat cells (Y1 positive cells; Figure 7b). For detection,
PE
labeled goat anti-human IgG was used. For the binding of the scFv-YI -I ~lpg
(200-
fold) was used, followed by staining with PE-labeled rabbit anti-scFv
antibodies and
FACS analysis (Figure 7c).
[47.] Figure 8: This figure shows a binding comparison between a YI
dimer, the Y1 scFv (CONY1), and Y1 IgG.
[48.] Figure 9: This figure shows a binding comparison between a Y1
sulfide bridge dimer with the Y1 scFv (CONY1).
[49.] Figure 10: This figure is a graph of the Superdex 75 profile of Y1-
cys-kak.
[50.] Figure 11: This figure reveals the size of the dimers compared to the
monomer in reducing and non-reducing conditions.
12
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
[51.] Figure 12: This figure provides results of an ELISA assay.
[52.] Figure 13: This figure is a chart of the epitopes of anti-GPIba
antibodies.
[53.] Figure 14: This figure is the amino acid SEQ ID NO:.
DETAILED DESCRIPTION OF THE INVENTION
[54.] Specificity is herein defined as the recognition, by one or more
domains in the peptide or polypeptide of the invention, of a target ligand and
subsequent binding thereto.
[55.] Selectivity is herein defined as the ability of a targeting molecule to
choose and bind one cell type or cell state from a mixture of cell types or
cell states,
all cell types or cell states of which may be specific for the targeting
molecule.
[56.] Conservative amino acid substitution is defined as a change in the
amino acid composition by way of changing one or two amino acids of a peptide,
polypeptide or protein, or fragment thereof. The substitution is of amino
acids with
generally similar properties (e.g., acidic, basic, aromatic, size, positively
or negatively
charged, polar, non-polar) such that the substitutions do not substantially in
a major
way alter peptide, polypeptide or protein characteristics (e.g., charge, IEF,
affinity,
avidity, conformation, solubility) or activity. Typical substitutions that may
be
performed for such conservative amino acid substitution may be among the
groups of
amino acids as follows:
(i) glycine (G), alanine (A), valine (V), leucine (L) and isoleucine (I)
(ii) aspartic acid (D) and glutamic acid (E)
(iii) alanine (A), serine (S) and threonine (T)
(iv) histidine (H), lysine (K) and arginine (R)
(v) asparagine (I~ and glutamine (Q)
13
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
(vi) phenylalanine (F), tyrosine (Y) and tryptophan (W)
[57.] Conservative amino acid substitutions can be made in, as well as,
flanking the hypervariable regions primarily responsible for the selective
and/or
specific binding characteristics of the molecule, as well as other parts of
the molecule,
e.g., variable heavy chain cassette. Additionally or alternatively,
modification can be
accomplished by reconstructing the molecules to form full-size antibodies,
diabodies
(dimers), triabodies (timers) and/or tetrabodies (tetramers) or to form
minibodies or
microbodies.
[58.] As used herein in the specification and in the claims, an Fv is defined
as a molecule that is made up of a variable region of a heavy chain of a human
antibody and a variable region of a light chain of a human antibody, which may
be the
same or different, and in which the variable region of the heavy chain is
connected,
linked, fused or covalently attached to, or associated with, the variable
region of the
light chain.
[59.] A fragment of an Fv molecule is defined as any molecule smaller than
the original Fv that still retains the selective and/or specific binding
characteristics of
the original Fv. Examples of such fragments include but are limited to (1) a
minibody, which comprises a fragment of the heavy chain only of the Fv, (2) a
microbody, which comprises a small fractional unit of antibody heavy chain
variable
region (PCT Application No. PCT/IL99/00581), (3) similar bodies comprising a
fragment of the light chain, and (4) similar bodies comprising a functional
unit of a
light chain variable region.
[60.] An anti-cancer agent is an agent with anti-cancer activity, i.e., any
activity that inhibits the growth or differentiation of cancerous or immature
pre-
cancerous cells, or any activity that inhibits metastasis of cancerous cells.
In the
present invention, an anti-cancer agent is also an agent with anti-angiogenic
activity
that prevents, inhibits, retards or halts angiogenesis of tumor tissue or is
also an agent
with anti-adhesion acitivities that inhibits, retards or halts adhesion and
metastatic
invastion of cancerous and pre-cancerous cells.
14
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
[61.] Inhibition of growth of a cancer cell is herein defined as the (i)
prevention of cancerous or metastatic growth, (ii) slowing down of the
cancerous or
metastatic growth, (iii) the total prevention of the growth process of the
cancer cell or
the metastatic process, while leaving the cell intact and alive, or (iv)
killing the cancer
cell. More specifically, inhibition of cancerous growth can be applied
especially
against blood-related cancers, e.g., AML, multiple myeloma, or chronic
lymphatic
leukemia.
[62.] A phagemid is defined as a phage particle that carnes plasmid DNA.
Because it carries plasmid DNA, the phagemid particle does not have sufficient
space
to contain the full complement of the phage genome. The component that is
missing
from the phage genome is information essential for packaging the phage
particle. In
order to propagate the phage, therefore, it is necessary to culture the
desired phage
particles together with a helper phage strain that complements the missing
packaging
information.
[63.] A cassette, as applied to polypeptides and as defined in the present
invention, refers to a given sequence of consecutive amino acids that serves
as a
framework and is considered a single unit and is manipulated as such. Amino
acids
can be replaced, inserted into, removed, or attached at one or both ends.
Likewise,
stretches of amino acids can be replaced, inserted into, removed or attached
at one or
both ends.
[64.] As used herein, an immunoglobulin (Ig) molecule is defined as any one
of five classes, i.e., IgG, IgA, IgD, IgE, or IgM. The IgG class encompasses
several
sub-classes including, but not restricted to, IgGI, IgG2, IgG3, and IgG4.
[65.] A pharmaceutical composition refers to a formulation which comprises
a peptide or polypeptide of the invention and a pharmaceutically acceptable
carrier,
excipient or diluent thereof.
[66.] A pharmaceutical agent refers to an agent that is useful in the
prophylactic treatment or diagnosis of a mammal including, but not restricted
to, a
human, bovine, equine, porcine, murine, canine, feline, or any other warm-
blooded
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
animal. The pharmaceutical agent is selected from the group comprising
radioisotope, toxin, oligonucleotide, recombinant protein, antibody fragment,
and
anti-cancer agent. Examples of such pharmaceutical agents include, but are not
limited to anti-viral agents including acyclovir, ganciclovir and zidovudine;
anti-
thrombosis/restenosis agents including cilostazol, dalteparin sodium,
reviparin
sodium, and aspirin; anti-inflammatory agents including zaltoprofen,
pranoprofen,
droxicam, acetyl salicylic 17, diclofenac, ibuprofen, dexibuprofen, sulindac,
naproxen, amtolmetin, celecoxib, indomethacin, rofecoxib, and nimesulid; anti-
autoimmune agents including leflunomide, denileukin diftitox, subreum, WinRho
SDF, defibrotide, and cyclophosphamide; and anti-adhesion/anti-aggregation
agents
including limaprost, clorcromene, and hyaluronic acid.
[67.] An anti-leukemia agent is an agent with anti-leukemia activity. For
example,
anti-leukemia agents include agents that inhibit or halt the growth of
leukemic or
immature pre-leukemic cells, agents that kill leukemic or pre-leukemic, agents
that
increase the susceptibility of leukemic or pre-leukemic cells to other anti-
leukemia
agents, and agents that inhibit metastasis of leukemic cells. In the present
invention,
an anti-leukemia agent may also be agent with anti-angiogenic activity that
prevents,
inhibits, retards or halts vascularization of tumors.
[68.] The term "affinity" as used herein is a measure of the binding strength
(association constant) between a receptor (e.g., one binding site on an
antibody) and a
ligand (e.g., antigenic determinant). The strength of the sum total of
noncovalent
interactions between a single antigen-binding site on an antibody and a single
epitope
is the affinity of the antibody for that epitope. Low affinity antibodies bind
antigen
weakly and tend to dissociate readily, whereas high-affinity antibodies bind
antigen
more tightly and remain bound longer. The term "avidity" differs from affinity
because the former reflects the valence of the antigen-antibody interaction.
[69.] Specificity of antibody-antigen interaction: Although the antigen-
antibody reaction is specific, in some cases antibody elicited by one antigen
can cross-
react with another unrelated antigen. Such cross-reactions occur if two
different
antigens share an homologous or similar epitope or an anchor region thereof or
if
16
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
antibodies specific for one epitope bind to an unrelated epitope possessing
similar
chemical properties.
[70.] Blast cells are cells in an immature stage of cellular development
distiguished by a higher cytoplasm-to-nucleus ratio than a resting cell.
[71.] A platelet is a disc like cytoplasmic fragment of a megakaryocyte that
is shed in the marrow sinus and subsequently are circulating in the peripheral
blood
stream. Platelets have several physiological functions including a major role
in
clotting. A platelet contains granules in the central part and peripherally,
clear
protoplasm, but no definite nucleus.
[72.] The term "epitope" is used herein to mean the antigenic determinant or
antigen site that interacts with an antibody, antibody fragment, antibody
complex or a
complex comprising a binding fragment thereof or T-cell receptor. The term
epitope
is used interchangeably herein with the tersm ligand, domain, and binding
region.
[73.] A given cell may express on its surface a protein having a binding site
(or epitope) for a given antibody, but that binding site may be exist in a
cryptic form
(e.g., be sterically hindered or be blocked, or lack features needed for
binding by the
antibody) in the cell in a state, which may be called a first stage (stage I
). Stage I
may be, for example, a normal, healthy, non-diseased status. When the epitope
exists
in cryptic form, it is not recognized by the given antibody, i.e., there is no
binding of
the antibody to this epitope or to the given cell at stage I. However, the
epitope may
be exposed by, e.g., undergoing modifications itself, or being unblocked
because
nearby or associated molecules are modified or because a region undergoes a
conformational change. Examples of modifications include changes in folding,
changes in post-translational modifications, changes in phospholipidation,
changes in
sulfation, changes in glycosylation, and the like. Such modifications may
occur when
the cell enters a different state, which may be called a second stage (stage
II).
Examples of second states, or stages, include activation, proliferation,
transformation,
or in a malignant status. Upon being modified, the epitope may then be
exposed, and
the antibody may bind.
17
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
[74.] As used herein the term "Fib fragment" is a monovalent antigen-
binding fragment of an immunoglobulin. A Fab fragment is composed of the light
chain and part of the heavy chain.
[75.] Polyclonal antibodies are the product of an immune response and are
formed by a number of different B-lymphocytes. Monoclonal antibodies are
derived
from a single cell.
[76.] Agglutination as used herein means the process by which suspended
bacteria, cells, discs, or other particles of similar size are caused to
adhere and form
into clumps. The process is similar to precipitation but the particles are
larger and are
in suspension rather than being in solution.
[77.] The term aggregation means the clumping of platelets induced in vitro,
and thrombin and collagen, as part of a sequential mechanims leading to the
formation
of a thrombus or hemostatic plug.
[78.] The~expression pattern of a gene can be studied by analyzing the
amount of gene product produced under various conditions, at specific times,
in
various tissues, etc. A gene is considered to be "over expressed" when the
amount of
gene product is higher than that found in a normal control, e.g., non-diseased
control.
[79.] A promoter is a region on DNA at which RNA polymerise binds and
initiates transcription.
[80.] Antibodies, or immunoglobulins, are protein molecules that bind to
antigen. They are composed of units of four polypeptide chains (2 heavy and 2
light)
linked together by disulfide bonds. Each of the chains has a constant and
variable
region. They can be divided into five classes, IgG, IgM. IgA, IgD, and IgE,
based on
their heavy chain component. They are produced by B lymphocytes and recognize
a
particular foreign antigenic determinant and facilitate clearing of that
antigen.
[81.] Antibodies may be produced and used in many forms, including
antibody complexes. As used herein, the term "antibody complex" or "antibody
complexes" is used to mean a complex of one or more antibodies with another
18
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
antibody or with an antibody fragment or fragments, or a complex of two or
more
antibody fragments.
[82.] F(ab')2 fragment is a bivalent antigen binding fragment of an
immunoglobulin obtained by pepsin digestion. It contains both light chains and
part
of both heavy chains.
[83.] Fc fragment is a non-antigen-binding portion of an immunoglobulin. It
contains the carboxy-terminal portion of heavy chains and the binding sites
for the Fc
receptor.
[84.] Fd fragment is the variable region and first constant region of the
heavy chain of an immunoglobulin.
[85.] Contaminating proteins are those proteins that are not specifically
being selected for and which may be present in a sample.
[86.] Peptido-mimetics are small molecules, peptides, polypeptides, lipids,
polysaccharides or conjugates thereof that have the same functional effect or
activity
of another entity such as an antibody.
[87.] Phagemids are plasmid vectors designed to contain an origin of
replication from a filamentous phage, such as m13 of fd.
[88.] A wide spectrum of diseases exists that involves diseased, altered, or
otherwise modified cells that express cell-specific and/or disease-specific
ligands on
their surfaces. These ligands can be utilized to effect recognition,
selection, diagnosis
and treatment of specific diseases through recognition, selection, diagnosis
and
treatment of each individual cell. The subject invention provides for peptides
or
polypeptides that comprise an Fv molecule, a construct thereof, a fragment
thereof, a
construct of a fragment thereof, or a fragment of a construct, all of which
have
enhanced binding characteristics. These binding characteristics allow the
peptide or
polypeptide molecule to bind selectively and/or specifically to a target cell
in favor of
other cells, the binding specificity and/or selectivity being primarily
determined by a
first hypervariable region. The Fv can be a scFv or a dsFv.
19
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
[89.] The Fv molecule described above can be used to target the diseased
cell. The diseased cell can be, for example, a cancer cell. Examples of types
of
cancer that are amenable to diagnosis and/or treatment by specific targeting
include,
but are not limited to, carcinoma, sarcoma, leukemia, adenoma, lymphoma,
myeloma,
blastoma, seminoma, and melanoma. Leukemia, lymphoma, and myeloma are
cancers that originate in the bone marrow and lymphatic tissues and are
involved in
uncontrolled growth of cells.
[90.] New approaches for diagnosing and treating diseases, particularly
cancer, have been developed in recent years. Among them is the tumor targeting
approach, using targeting molecules that can be selected and produced in a
variety of
ways. One approach for identifying possible targeting molecules is phage
display.
Phage display is a technique in which peptides, polypeptides, antibodies or
proteins
are generated and selected by their expression and display on the surface of a
filamentous bacteriophage by fusion to a phage coat protein, with the DNA
encoding
the displayed protein residing within the phage virion. The scFv that is
produced by
the phage display technique is comprised of the variable domains of each of
the
antibody heavy and light chains, linked by a flexible amino-acid polypeptide
spacer
(Nissim et al., EMBO J, 13, 692-698 (1994)).
[91.] A phage display library (also termed phage peptide/antibody library,
phage library, or peptide/antibody library) comprises a large population of
phage
(generally 10g - 10~), each phage particle displaying a different peptide or
polypeptide
sequence. These peptide or polypeptide fragments may constructed to be of
variable
length. The displayed peptide or polypeptide can be derived from, but need not
be
limited to, human antibody heavy or light chains.
[92.] In the present invention, an scFv antibody library produced by the
phage display technique was utilized to obtain and produce targeting
molecules. Flow
cytometry, particularly fluorescence-activated cell sorting ("FACS"), was used
for
identifying and isolating specific phage clones, the peptide or polypeptide of
which
recognizes target cells. Phage-expressed scFv antibody fragments are amenable
to in
vitro screening, enrichment and selection of high affinity clones (U.S. patent
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
5,821,337; U.S. patent 5,720,954). Thus, a library of this type offers a
powerful
means for generating new tools for research and clinical applications, and has
numerous advantages over the conventional approach (Caron et al., Cancer
Supplement, 73, 1049-1056 (1994)). The library contains the potential for a
high
diversity of antibody molecules (Nissim et al., EMBO J., 692-69 8 (1994)). In
the
present instance, stable human cDNA can be used as a continuous source of
material
for antibody production (I1.S. patent 5,843,439). Molecule recognition and
selection
are not influenced by the in vivo immunogenicity of candidate target proteins.
[93.] While affinity selection of phage displayed antibodies provides a
useful method for enriching antigen-reactive scFvs from large libraries, it
requires
multiple steps to isolate a single clone and to characterize soluble scFv. The
scFvs
themselves can be modified to improve their affinities and/or avidity by
performing
conservative amino acid substitutions, or by producing fragments of the scFv,
or
constructs of said fragments.
[94.] The scFvs of the subject invention, specific for different human cells
and tissues, can be associated with, combined, fused or linked to various
pharmaceutical agents and/or radioactive isotopes in a pharmaceutically
effective
amount with, optionally, a pharmaceutically effective Garner, to form drug-
peptide
compositions, fusions or conjugates having anti-disease and/or anti-cancer
activity,
and/or for diagnostic purposes thereof.
[95.] Phage clones are selected by and identified through a multi-step
procedure known as biopanning. Biopanning is carried out by incubating phage
displaying protein ligand variants (a phage display library) with a target,
removing
unbound phage by a washing technique, and specifically eluting the bound
phage.
The eluted phage are optionally amplified before being taken through
additional
cycles of binding and optional amplification that enriches the pool of
specific
sequences in favor of those phage clones bearing antibody fragments that
display the
best binding to the target. After several rounds, individual phage clones are
characterized, and the sequences of the peptides displayed by the clones are
determined by sequencing the corresponding DNA of the phage virion.
21
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
[96.] The scFv obtained in this manner is also referred to a lead compound.
A lead compound is defined as a compound, the final format of which comprises
a
core peptide or polypeptide. The lead compound can be modified and/or
expanded,
but it must retain the core peptide or polypeptide or some conservatively
modified
form thereof. Modifications by way of amino acid substitution can be made at
the N-
terminus, at the carboxy terminus, or in any of the CDR regions of an Fv or in
the
regions upstream or downstream thereof, for example. Modifications also
include but
are not limited to, fused proteins, coupling to drugs or toxins, construction
of
multimers, and expansion to full antibody molecules. One preferred category of
lead
compound, as provided for in the present patent, is an scFv obtained as the
final
product of the biopanning procedure.
[97.] An embodiment of the invention provides for at least one non-natural
modification of the peptide or polypeptide of the invention. The non-natural
modification can render the peptide or polypeptide more immunogenic or more
stable.
Non-natural modifications include, but are not limited to peptoid
modification,
sernipeptoid modification, cyclic peptide modification, N-terminus
modification, C-
terminus modification, peptide bond modification, backbone modification, and
residue modification.
[98.] The selection of antigen-specific phage antibodies has largely relied on
biopanning against an immobilized single antigen. There has been limited
selection
using whole cells as a .target. In the present invention, whole cells were
used to select
specific antibodies that recognize leukemia cell surface determinants, wherein
the
specific receptor was not previously known or characterized. This method does
not
permit facile adjustment of antigen concentration or the removal of undesired
dominant antibody reactivities. Additionally, the phage may enrich for those
that
display multiple copies of scFv, as opposed to those with higher affinity
clones.
Nevertheless, the advantages of this approach make it an invaluable tool for
isolating
novel human antibody molecules.
[99.] An embodiment of the invention provides for a peptide or polypeptide
comprising an Fv molecule, a construct thereof, a fragment of either or a
construct of
22
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
a fragment that binds to an unknown ligand on a first cell having a first and
a second
state, wherein the binding is effective in the second state but not
substantially in the
first state and, by virtue of immuno-cross-reactivity, binds specifically or
selectively
to a ligand on a second cell, and wherein the Fv is a scFv or a dsFv, and
optionally
having one or more tags.
[100.] A further embodiment provides for the peptide or polypeptide of the
invention, wherein the selective and/or specific binding of the peptide or
polypeptide
to the ligand of the second cell is determined primarily by a first
hypervariable region.
[101.] A yet further embodiment provides for the peptide or polypeptide of
the invention, wherein the first hypervariable region is a CDR3 region having
an
amino acid sequence selected from the group consisting of SEQ >D NOs:B-24.
[102.] A yet further embodiment provides for the peptide or polypeptide of
the invention, wherein the first hypervariable region is a CDR3 region having
an
amino acid sequence selected from the group consisting of SEQ >D NOs:B-24, and
wherein the binding selectivity or specificity is secondarily influenced by a
second
hypervariable region and/or by a third hypervariable region and/or by one or
more of
the upstream and/or by one or more of the downstream regions flanking the
first, the
second and the third hypervariable regions, respectively.
[103.] A further embodiment provides for the ligand of the second cell bound
by the peptide or polypeptide of the invention. One such two-cell selection
protocol
was based on the following: Megakaryocytes are large multinucleated cells
derived
from hematopoietic stem cells in the bone marrow. Platelets break off the
megakaryocyte cytoplasm and enter the peripheral blood. In vitro, a wide range
of
cytokines directly affects stem cells. For example, thrombopoietin increases
platelet
count by directly increasing the differentiation of stem cells into
megakaryocytes.
Thus, these cells express several cell surface markers that are also found in
premature
cells.
[104.] Malignant blood cells (leukemia and lymphoma) are characterized as
immature cells that express cell surface proteins normally found in partially
23
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
differentiated hematopoietic progenitors. Thus, platelets are an attractive
source for
the identification of premature cell surface markers expressed on diseased or
malignant blood cells. In one protocol discussed below, specific cells such
as, but not
limited to platelets, carrying unknown ligands, were used for initial
biopanning steps.
Subsequent clone selection was performed with a desired target cell, of which
the
targeted cell surface markers are unknown, such as but not limited to AML
cells. In
this method, phage clones obtained by biopanning on platelets can provide
tools for
recognizing and binding to ligands on diseased or malignant blood cells of
interest.
[105.] The target as described above includes cells derived from an isolated
tissue. The isolated tissue can be a diseased tissue and, more specifically, a
cancer
tissue. Cancer tissue can be derived from any form of malignancy including,
but not
limited to, carcinoma, sarcoma, leukemia, adenoma, lymphoma, myeloma,
blastoma,
seminoma, and melanoma.
[106.] In addition to the biopanning method described above, another
approach is based on isolation of a peptide or polypeptide that binds a ligand
on a cell
as determined by direct panning on that ligand.
[107.] The present invention provides for a peptide or polypeptide comprising
an Fv molecule, a construct thereof, a fragment of either, or a construct of a
fragment.
A construct may be a multimer (e.g., diabody, triabody, tetrabody) or a full-
size Ig
molecule; a fragment might be a minibody or a microbody. All derived
constructs
and fragments retain enhanced binding characteristics so as to bind
selectively and/or
specifically to a target cell in favor of other cells. The binding selectivity
and/or
specificity is primarily determined by a first hypervariable region, and
wherein the Fv
is a scFv or a dsFv, and optionally having one or more tags.
[108.] In one embodiment of the invention, a tag is inserted or attached to
the
Fv peptide or polypeptide to aid in the preparation and identification
thereof, and in
diagnostics. The tag can later be removed from the molecule. The tag may be,
but is
not limited to, the following tags: AUI, AUS, BTag, c-myc, FLAG, Glu-Glu, HA,
His6, HSV, HTTPHH, IRS, KT3, Protein C, S~Tag , T7, V5, VSV-G (Jarvik and
24
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
Telmer, Ann. Rev. Gen., 32, 601-618 (1998)), and KAK (lysine-alanine-lysine).
The
tag is preferably c-myc or KAK.
[109.] The two variable chains of the Fv molecule of the present invention
may be connected or linked together by a spacer of 0-20 amino acid residues in
length. The spacer may be branched or unbranched. Preferably, the linker is 0-
15
amino acid residues, and most preferably the linker is (Gly4Ser)3 to yield a
single
chain Fv ("scFv"). The scFv is obtainable from a phage display library.
[110.] The Fv molecule itself is comprised of a first chain and a second
chain,
each chain comprising a first, second and third hypervariable region. The
hypervariable loops within the variable domains of the light and heavy chains
are
termed Complementary Determining Regions (CDR). There are CDR1, CDR2 and
CDR3 regions in each of the heavy and light chains. These regions are believed
to
form the antigen binding site and can be specifically modified to yield
enhanced
binding activity. The most variable of these regions in nature being the CDR3
region
of the heavy chain. The CDR3 region is understood to be the most exposed
region of
the Ig molecule and as shown and provided herein is the site primarily
responsible for
the selective and/or specific binding characteristics observed.
[111.] An embodiment of the invention provides for a peptide or polypeptide
comprising an Fv molecule, a construct thereof, a fragment of either, or a
construct of
a fragment having enhanced binding characteristics so as to bind selectively
and/or
specifically to a substantially exposed and/or over-expressed binding site on
or in a
target comprising a cell in favor of other cells on or in which the binding
site is not
substantially available and/or expressed, wherein the binding selectivity or
specificity
is primarily determined by a first hypervariable region, and wherein the Fv is
a scFv
or a dsFv, and optionally having one or more tags.
[112.] A further embodiment of the invention provides for a peptide or
polypeptide wherein the first hypervariable region is a CDR3 region having an
amino
acid sequence selected from the group consisting of SEQ ID NOs:B-24.
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
[113.] A yet further embodiment provides for the peptide or polypeptide of
the invention, wherein the first hypervariable region is a CDR3 region having
an
amino acid sequence selected from the group consisting of SEQ ID NOs:B-24, and
wherein the binding selectivity or specificity is secondarily influenced by a
second
hypervariable region and/or by a third hypervariable region and/or by one or
more of
the upstream regions and/or by one or more of the downstream regions flanking
the
first, the second and the third hypervariable regions, respectively, wherein
the second
and third hypervariable regions are a CDR2 and a CDR1 region, respectively.
[114.] An embodiment of the invention provides for peptide or polypeptide
that binds to a target cell that is an activated, excited, modified, changed,
disturbed or
diseased cell. A further embodiment of the invention provides for the target
cell
being a cancer cell. The target cell can be selected from the group comprised
of, but
is not limited to, carcinoma, sarcoma, leukemia, adenoma, lymphoma, myeloma,
blastoma, seminoma, and melanoma. In a preferred embodiment, the cancer cell
is a
leukemia cell. In a most preferred embodiment, the leukemia cell is an AML
cell.
[115.] The peptide or polypeptide of the present invention is also any
construct or modified construct of the Fv that retains one or more of the
hypervariable
regions of the heavy andlor light chains and has selective and/or specific
binding
characteristics. Construct or modified construct includes, but is not limited
to, scFv,
dsFv, multimers of scFv such as dimers, trimers, tetramers and the like (also
referred
to as diabody, triabody, tetrabody), and full antibody, and any other multimer
that can
be constructed thereof, and that incorporates one or more of the hypervariable
domains of the antibody. The peptide or polypeptide of the present invention
is also a
fragment of any construct or modified construct having some or all of the
binding
characteristics of the original construct.
[116.] The peptide or polypeptide of the present invention is also a construct
of a fragment having some or all of the selective and/or specific binding
characteristics of the original construct. Fvs herein described selectively
and/or
specifically bind to target cells and can be associated with, or conjugated
to, anti-
cancer agents or anti-disease agents.
26
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
[117.] Peptides, polypeptides, fragments thereof, constructs thereof and
fragments of constructs thereof of Fv molecules of the invention can be
prepared in
either prokaryotic or eukaryotic expression systems. In one embodiment of the
invention, the eukaryotic expression system is a mammalian system, and the
peptide
or polypeptide produced in the mammalian expression system, after
purification, is
substantially free of mammalian contaminants. A eukaryotic cell system, as
defined
in the present invention refers to an expression system for producing peptides
or
polypeptides by genetic engineering methods, wherein the host cell is a
eukaryote. In
another embodiment of the invention, a prokaryotic system for production of
the
peptide or polypeptide of the invention uses E. coli as the host for the
expression
vector. The peptide or polypeptide produced in the E. coli system, after
purification,
is substantially free of E. coli contaminating proteins. Use of a prokaryotic
expression system may result in the addition of a methionine residue to the N-
terminus of some or all of the sequences provided for in the present
invention.
Removal of the N-terminal methionine residue after peptide or polypeptide
production
to allow for full expression of the peptide or polypeptide can be performed by
methods commonly known in the art, such as, but not limited to, the use of
Aeromonas aminopeptidase under suitable conditions (U.S. Patent No.;
5,763,215).
[118.] The subject invention provides for production of a scFv based on the
Fv peptide of the invention. Promoters incorporated into the vectors used for
the
cloning and amplification of the scFv in prokaryotic cells can be chosen from
a wide
selection. A promoter is a DNA sequence that is situated upstream of
structural genes
and is capable of controlling the expression of genes. Promoters are found in
the
natural state in the chromosomes) of the organism and can also be engineered
into
prokaryotic or eukaryotic expression vectors. Promoters engineered into
specific loci
on the desired DNA fragment provide for finely tuned and precisely controlled
expression of the gene of interest. In the present invention, several
promoters were
used in constructs that include the gene coding for the Fv of choice.
Promoters
include, but are not limited to the following: deo, Pl-P2, osmB, 7~ PL, [i-lac-
U5, SRa
5, and CMV early promoter. Deo is a double stranded DNA plasmid which, upon
introduction into a. suitable E. coli host, renders the host capable of
effecting
27
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
expression of DNA encoding a desired naturally-occurring polypeptide or
polypeptide
analog thereof under the control of the constitutive E. coli-derived
deoxyribonucleotide promoter, deo Pl-P2. A fuller description is provided in
U.S.
Patent No. 5,795,776 (Fischer, August 18, 1998) and U.S. Patent No. 5,945,304
(Fischer, August 31, 1999).
[119.] Expression of the E. coli osmB promoter is regulated by osmotic
pressure. Vectors carrying this promoter can be used to produce high levels of
a wide
variety of recombinant eukaryotic and prokaryotic polypeptides under control
of the
osmB promoter in an E. coli host. A fuller description is provided in U.S.
Patent No.
5,795,776 (Fischer, August 18, 1998) and U.S. Patent No. 5,945,304 (Fischer,
August
31, 1999).
[120.] ~,P,_, is a thermoinducible ~, bacteriophage promoter regulated by the
thermolabile repressor cI85~. For A fuller discussion, see Hendrix et al.
Lambda II,
Cold Spring Harbor Laboratory (1983).
[121.] ~3-lac-US is a lacZ promoter (Gilbert and Muller-Hill, PNAS (US), 58,
2415 (1967).
[122.] SRaS is a mammalian cDNA expression system composed of the
simian virus 40 (5V40) early promoter and the R-US segment of the human T-cell
leukemia virus type 1 long terminal repeat. This expression system is 1 or 2
orders of
magnitude more active than the SV40 early promoter in a wide variety of cell
types
(Takebe et al., Molecular and Cellular Biology, 8, 466-472 (1988).
[123.] The human cytomegalovirus promoter, known as the CMV
intermediate/early enhancer/promoter is most preferably used in the present
invention
to promote constitutive expression of clone DNA inserts in mammalian cells.
The
CMV promoter is described in Schmidt, E.V. et al., (1990) Mol. Cell. Biol.,
10, 4406,
and is U.S. Patent Nos. 5,168,062 and 5,385,839.
[124.] In a preferred embodiment of the invention, the promoter for induction
of the phagemid system in prokaryotes is selected from a group comprising deo,
28
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
osmB, ~.PL, ~i-lac-U5, and CMV promoters. In a more preferred embodiment of
the
invention, the (3-lac-US promoter was used for induction of the phagemid
system in E.
coli. In a most preferred embodiment, the CMV promoter is used.
[125.] In an embodiment of the invention, a peptide or polypeptide of the
subject invention comprises: (a) a leader sequence that is present only in the
encoded
sequence but is lacking in the mature protein; (b) a variable regions of a
heavy chain
of the order of 135-145 amino acids, including a first hypervariable region of
4-12
amino acids that is subject to modifications; (c) a spacer region of _< 20
amino acids
that may be shortened or eliminated; (d) variable region of a light chain that
is also
subject to specific modifications described herein followed by; (e) a tag
sequence for
follow-up, that is optionally not present in the final injectable product. The
spacer,
being generally about ~15 amino acid residues long in the scFv, allows the two
variable
chains (heavy and light) to fold into functional Fv domain. The functional Fv
domain
retains selective and/or specific enhanced binding activity.
[126.] In another embodiment, (d) above is followed by a tag sequence or
label that can be used for conjugation, diagnostic and/or identification
purposes. In
this embodiment, the tag is designed to connect between the peptide or
polypeptide of
the invention and an agent for treatment or diagnosis of the target cell.
[127.] The spacer region of the scFv may be linear or branched, and is
generally comprised of glycine and serine residues, in multiples of the
formula
(Gly4Ser)", and is generally between a total of 0-20 amino acids in length,
preferably
0-15 amino acids long and linear. By changing the spacer length as
appropriate, a
variety of multimers can be obtained. In an embodiment of the invention, the
spacer
is 0-S amino acids in length. In another embodiment, the spacer is < 3 amino
acids
long (as detailed below).
[128.] An example of an amino acid sequence of a scFv molecule of the
subject invention follows:
29
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
ATGAAATACCTATTGCCTACGGCAGCCGCTGGATTGTTATTACTCGCGGCCCAGCCGGCC
M K Y L L P T A A A G L L L L A A Q P A
1 ____________________________________________________________.
61 ATGGCCGAGGTGCAGCTGGTGGAGTCTGGGGGAGGTGTGGTACGGCCTGGGGGGTCCCTG
2 1 M A E V Q L V E S G G G V V R P G G S L
121 AGACTCTCCTGTGCAGCCTCTGGATTCACCTTTGATGATTATGGCATGAGCTGGGTCCGC
4 1 R L S C A A S G F T F D D Y G M S W V R
181 CAAGCTCCAGGGAAGGGGCTGGAGTGGGTCTCTGGTATTAATTGGAATGGTGGTAGCACA
6 1 Q A P G K G L E W V S G I N W N G G S T
241 GGTTATGCAGACTCTGTGAGGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCC
8 1 G Y A D S V K G R F T I S R D N A K N S
301 CTGTATCTGCAAATGAACAGTCTGAGAGCCGAGGACCGGCCGGTGTATTACGTGGCAAGA
1 0 1 L Y L Q M N S L R A E D T A V Y Y C A R
361 ATGAGGGCTCCTGTGATTTGGGCCCAAGTAACCCTGGTCACCGTGTCGAGAGTGGGAGGC
12 1 M R A P V I W G Q G T L V T V S R G G G
421 GGTTCAGGCGGAGGTGGCTCTGGCGGTGGCGGATCGTCTGAGCTGACACAGGACCCTGCT
1 4 1 G S G G G G S G G G G S S E L T Q D P A
481 GTGTCTGTGGCCTTGGGACAGACAGTCAGGATCACATGCCAAGGAGACAGCCTCAGAAGC
1 6 1 V S V A L G Q T V R I T C Q G D S L R S
541 TATTATGCAAGCTGGTACCAGCAGAAGCAGGACCAGGCCCCTTGTCTTGTCATCATGGGT
1 8 1 Y Y A S W Y Q Q K P G Q A P V L V I Y G
601 AAAA.ACAACCGGCCCTCAGGGATCCCAGACCGATTCTCTGGCTCCAGCTCAGGAAACACA
2 0 1 K N N R P S G I P D R F S G S S S G N T
661 GCTTCCTTGACCATCACTGGGGCTCAGGCGGAAGATGAGGCTGACTATTACTGTAACTCC
2 2 1 A S L T I T G A Q A E D E A D Y Y C N S
721 CGGGACAGCAGTGGTAACCATGTGGTATTCGGCGGAGGGACCAAGCTGACCGTCCTAGGT
2 4 1 R D S S G N H V V F G G G T K L T V L G
781 GCGGCCGCAGAACAAAAACTCATCTCAGAAGAGGATCTGAATGGGGCCGCATAG
261 A A A E K L I S E E D L N G A A
[129.] The leader sequence is underlined with a dashed line. The VH region is
encoded by the bolded amino acid sequence. This specific clone is derived from
the
germline VH3-DP32; however, the germline of each clone is dependent on its
particular origin (see below). The amino acid sequence enclosed in a box
encodes for
the V,.,-CDR3 sequence, the hypervariable region among all clones derived from
this
library. The spacer region joining the VH and the VL regions is a flexible
polypeptide,
encoded by amino acids shown by italics. Finally the V,_, region is presented.
The
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
fused VL fragment in all the clones is derived from a single unmutated V gene
of
germline IGLV3SI, and is here followed by the c-myc tag, underlined with a
wavy
line. The full amino acid sequence is identical to SEQ 117 N0:25.
[130.] Repertoires of VH fragments (from 49 germlines) were first generated
by PCR from rearranged V-genes of peripheral blood lymphocytes of non-
immunized
human (referred to as a "naive repertoire") by the supplier of the library.
The origin
(germline) of the VH-sequence can be identified by a homology test (Blast
search),
using one of the following web sites:
[131.] The binding characteristics of an antibody can be optimized in one of
several ways. One way of optimizing an antibody to obtain a higher binding
affinity
relative to the original lead-compound is based on replacing the amino acid
residues
in the lead-compound, to introduce higher variability, or to extend the
sequence. For
example, the entire original V~ region can be replaced with a V~ region from a
different antibody subtype.
[132.] An additional way to optimize binding affinity is to construct a
phagemid display mutagenesis library. In a phagemid display mutagenesis
library,
oligonucleotides are synthesized so that each amino acid of the core sequence
within
the VH and the VL CDR3 is independently substituted by any other amino acid,
preferably in a conservative manner known in the art. The subject invention
provides
for a set of specific antibody scFv displayed on phage, wherein the displayed
antibody
fragments and the soluble antibody fragments that can be extracted from the
phage
virions have the same biological activity.
[133.] The phage display library used herein was constructed from peripheral
blood lymphocytes of non-immunized human, and the Fv peptide was selected
against
previously uncharacterized and unpurified antigens on the surface of a target
cell. As
used herein, previously uncharacterized and unpurified antigens refer to
ligands
presented on the surface of cells that have not been identified,
characterized, isolated
or purified by biochemical or molecular means previous to the current work,
and that
31
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
are observed or predicted in the present work by virtue of the selective
and/or specific
binding to isolated antibody fragments observed.
[134.] The scFv of the present invention displays enhanced binding to a target
cell. The enhanced binding is directed to specific surface markers. Specific
surface
markers are molecules that are sequestered in the cellular membrane and are
accessible to circulating recognition molecules. The presence of surface
markers
allowed for the development of the phage display technology via the biopanning
technology described herein. In the present invention specific surface markers
are
employed to characterize and differentiate among various cell types, as well
as to
serve as the binding site for Fvs in their various forms. A variety of
hematopoietic
cell types can be differentiated according to their characteristic surface
markers and,
similarly, diseased or cancerous cells display surface markers that are unique
to their
type and stage.
[135.] Selection of the scFv clone can be accomplished by two different
biopanning strategies:
1. selection directly, by using the diseased or cancer cell as the target
cell, and
2. step-wise selection, by using a first e.g., normal cell in a second, e.g.,
activated, excited, modified, changed, or disturbed state, whereby a binding
site of the
first cell in the second state comprises an unknown ligand that is
substantially
exposed or displayed. By virtue of immuno-cross-reactivity, the resulting
clone may
bind, after subsequent biopanning or selection steps, selectively and/or
specifically to
a novel and unknown ligand on a second cell. Following further optional
amplification and subsequent purification, targeting molecules may be
constructed
from the recognition sites of the purified recognition molecules selective
and/or
specific for an unknown ligand on a second cell.
[136.] In one embodiment of the invention, the first cell may be a normal
cell,
the first state a non-activated state and the second state an activated,
excited,
modified, changed or disturbed state. The second cell in the step-wise
selection may
be a human cell. In another embodiment of the invention, the second cell in
the step-
32
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
wise selection is a diseased cell. In a more preferred embodiment, the second
cell in
the step-wise selection is a cancer cell such as, but not limited to,
carcinoma, sarcoma,
leukemia, adenoma, lymphoma, myeloma, blastoma, seminoma, and melanoma. In a
more preferred embodiment, the second cell is a leukemia cell. In a most
preferred
embodiment, the second cell is an AML cell.
[137.] A more preferred embodiment of the invention provides for a peptide
or polypeptide wherein the selective and/or specific binding of the peptide or
polypeptide to the ligand of the second cell is determined primarily by a
first
hypervariable region. In a yet more preferred embodiment, the first
hypervariable
region is a CDR3 region having an amino acid sequence selected from the group
consisting of SEQ m NOs:B-24.
[138.] In another embodiment of the present invention herein provides for the
ligand of the second cell bound by the peptide or polypeptide of the
invention. A
further embodiment provides for any molecule that recognizes and binds the
ligand
bound by the peptide or polypeptide of the invention.
[139.] The enhanced binding to a cancer cell is most likely due to
overexpression of the ligand and/or exposure of binding site in the cancer
cell relative
to expression in the normal cell. As used herein, the term overexpression of
the
ligand is defined as the expression of a gene or its product normally silent
in the
particular cell type and/or in a particular stage of the cell cycle, or of
increased
expression of a gene that is expressed at basal levels under normal, non-
malignant
conditions for that particular cell type.
[140.] In a more preferred embodiment of the invention, the target cell of the
biopanning procedure is contained in a cell suspension. Hematopoietic cells
are
obtained in suspension, and biopanning may be carried out by mixing a phage
library
with a blood cell suspension, followed by washing with several buffers. Phage
are
extracted from the human cells, amplified, and the displayed antibody fragment
sequence is determined.
33
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
(141.] In a yet more preferred embodiment of the invention, the blood cell
suspension comprises leukemic cells. In a most preferred embodiment, the blood
cell
suspension comprises AML cells. In another embodiment of the subject
invention,
the target cell is derived from an isolated organ or part thereof.
[142.] In another embodiment of the subject invention, the target cell or the
second cell is derived from a cell line. Cell lines can be cultured and
manipulated
such that they can aid in determination of the binding characteristics of the
Fv clones.
In addition, cell lines can be useful in the development of diagnostic kits.
[143.] In a preferred embodiment, the cell line is a hematopoietic cell line,
such as but not limited to the following lines: Jurkat, Molt-4, HS-602, U937,
TF-I,
THP-1, KG-1, ML-2, and HUT-78 cell lines.
[144.] In a preferred embodiment of the invention the CDR3 region is built,
inserted, coupled or fused into or onto any one of 84 cassettes (SEQ ID NOs:30-
113).
In a more preferred embodiment, the CDR3 region is built, inserted, coupled or
fused
into or onto any one of 49 cassettes (SEQ ID NOs:30-32, 35, 37-39, 41, 43, 45,
46,
48, 51, 54, 57, 59-68, 70, 71, 76-85, 87, 89-92, 94, 97, 99, 103, 106, 112,
and 113). In
a most preferred embodiment, the CDR3 region is built, inserted, coupled or
fused to
the C-terminus of cassette of SEQ ID N0:61, or any of the above sequences
having at
least 90% sequence similarity therewith.
[145.] In one embodiment, the amino acid sequence of the cassette is
ostensibly fixed, whereas the replaced, inserted or attached sequence can be
highly
variable. The cassette can be comprised of several domains, each of which
encompasses a function crucial to the final construct. The cassette of a
particular
embodiment of the present invention comprises, from the N-termmius, framework
region 1 (FRI), CDRI, framework region 2 (FR2), CDR2, and framework region 3
(FR3).
[146.] In an embodiment of the invention, it is possible to replace distinct
regions within the cassette. For example, the CDR2 and CDR1 hypervariable
regions
of the cassette may be replaced or modified by non-conservative or,
preferably,
34
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
conservative amino acid substitutions. More specifically, the CDR2 and CDR1
regions of a cassette of consecutive amino acids selected from the group
comprising
of SEQ >D NOs:30-113 or a fragment thereof can be replaced by SEQ >D NOs:115
and 114, respectively. Even more specifically, the CDR2 and CDRl regions of a
cassette of consecutive amino acids selected from the group comprising of SEQ
ID
NOs:30-32, 35, 37-39, 41, 43, 45, 46, 48, 51, 54, 57, 59-68, 70, 71, 76-85,
87, 89-92,
94, 97, 99, 103, 106, 112, and 113 or fragment thereof can be replaced by SEQ
DD
NOs:115 and 114, respectively.
[ 147.] In a preferred embodiment of the invention, the peptide or polypeptide
comprises a heavy and a light chain, and each chain comprises a first, second
and
third hypervariable region which are the CDR3, CDR2 and CDR1 regions,
respectively. The binding selectivity and specificity are determined
particularly by ,
the CDR3 region of a chain, possibly by the CDR3 region of the light chain
and,
preferably, by the CDR3 region of the heavy chain, and secondarily by the CDR2
and
~CDRI regions of the light chain and, preferably, of the heavy chain. The
binding
selectivity and specificity may also be secondarily influenced by the upstream
or
downstream regions flanking the first, second, and/or third hypervariable
regions.
[148.] In a preferred embodiment, the CDR3 region of the peptide or
polypeptide has an amino acid sequence selected from the group comprising SEQ
>D
NOs:B-24.
[ 149.] In a more preferred embodiment, the CDR3 region of the heavy chain
has an amino acid sequence selected from the group comprising SEQ >I7 NOs:B-
24,
the CDR2 has an amino acid sequence identical to SEQ ID NO:115, and the CDRI
region has an amino acid sequence identical to SEQ ID NO: 114.
[150.] In a most preferred embodiment of the invention, the CDR3 region has
an amino acid sequence identical to SEQ m N0:8.
[151.] In addition to the heavy and light chain, the Fv comprises a flexible
spacer of 0-20 amino acid residues. The spacer can be a branched chain or a
straight
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
chain. Two possible sequences of the spacer are identical to SEQ ID NOs:123
and
124.
[152.] A preferred embodiment of the invention is a scFv with a CDR3
sequence identical to SEQ )D NO: 8 and a full scFv sequence identical to SEQ
>D
NO: 25.
[153.] Another preferred embodiment of the invention is a scFv with a CDR3
sequence identical to SEQ m NO: 20and a full scFv sequence identical to SEQ >D
NO: 203.
[154.] In a most preferred embodiment of the invention the CDR3, CDR2 and
CDR1 regions have the amino acid SEQ >D NOs:B, 115 and 114, respectively.
[155.] In an embodiment of the invention, the Fv peptide comprises a CDR1
and CDR2 region of the variable heavy chain, which itself comprises a cassette
with
an amino acid sequence selected from the group comprising SEQ ~ NOs:30-113; a
CDR3 region, preferably of the variable heavy chain, which has an amino acid
sequence selected from the group comprising SEQ 1D NO: 8-24; an upstream
region
flanking the CDR3 region which has the amino acid sequence of SEQ >D NO: 117;
a
downstream region flanking the CDR3 region which has the amino acid sequence
of
SEQ >D N0:116; a spacer of 0-20 amino acid residues of SEQ >D N0:123 or 124; a
variable light chain region the sequence of which is SEQ >D N0:7.
[156.] Similarly, in another embodiment the upstream region flanking the
CDR2 region has the amino acid sequence of SEQ >Z7 N0:119, the downstream
region flanking the CDR2 region has the amino acid sequence of SEQ ID N0:118,
the
upstream region flanking the CDR1 region has the amino acid sequence of SEQ >D
N0:121 and the downstream region flanking the CDR1 region has the amino acid
sequence of SEQ R7 N0:120.
[157.] A preferred embodiment of the invention provides for a peptide or
polypeptide wherein the second and third hypervariable regions are a CDR2 and
a
CDR1 hypervariable region, respectively and wherein the CDR3 amino acid
sequence
36
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
is SEQ ID N0:8, wherein the CDR2 amino acid sequence is SEQ ll~ NO:11 S,
wherein the CDR1 amino acid sequence is SEQ 117 NO:l 14, wherein the upstream
region flanking the CDR3 region has the amino acid sequence of SEQ ID N0:117,
wherein the downstream region flanking the CDR3 region has the amino acid
sequence of SEQ ID N0:116, wherein the upstream region flanking the CDR2
region
has the amino acid sequence of SEQ ID NO: 119, wherein the downstream region
flanking the CDR2 region has the amino acid sequence of SEQ ID NO: 118,
wherein
the upstream region flanking the CDR1 region has the amino acid sequence of
SEQ
ID NO: 121 and wherein the downstream region flanking the CDRl region has the
amino acid sequence of SEQ ID N0:120.
[158.] Another preferred embodiment of the invention provides for an Fv
molecule that comprises a first chain having a first, a second and a third
hypervariable
region and a second chain having a first, a second and a third hypervariable
region,
wherein one of the hypervariable regions of the first chain has a sequence
selected
from the group consisting of SEQ ID NOs:B-24, and wherein one of the
hypervariable
regions of the second chain has a sequence selected from the group consisting
of SEQ
ID NOs:l -6 and 125-202, and wherein the first, second and third hypervariable
regions are a CDR3, CDR2 and CDR1 region, respectively and wherein the Fv is a
scFv or a dsFv, and optionally having one or more tags.
[159.] Another embodiment of the invention provides for a peptide or
polypeptide (i) wherein the first chain and the second chain each comprises a
first
hypervariable region selected from the group consisting of SEQ ID NOs:B-24; or
(ii)
wherein the first hypervariable region of the first and second chains are
identical and
selected from the group consisting of SEQ ID NOs:B-24; or (iii) wherein the
first
hypervariable region of the first chain is selected from the group consisting
of SEQ ID
NOs:B-24, and the first hypervariable region of the second chain is selected
from the
group consisting of SEQ ID NOs:l-6 and 125-202; or (iv) wherein the first
hypervariable region of the first chain is selected from the group consisting
of SEQ ID
NOs:l-6 and 125-202, and the first hypervariable region of the second chain is
.
selected from the group consisting of SEQ ID NOs:B-24.
37
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
[ 160.] A further embodiment provides for the peptide or polypeptide of the
invention wherein the second and third hypervariable regions of the first
chain are
SEQ ID NOs:114 and 115, respectively.
[161.] For all the amino acid sequences of < 25 amino acid residues described
and detailed herein (e.g., CDR regions, CDR flanking regions), it is to be
understood
and considered as a further embodiment of the invention that these amino acid
sequences include within their scope one or two amino acid substitutions) and
that
preferably the substitutions are conservative amino acid substitutions. For
all the
amino acid sequences of > 25 amino acid residues described and detailed
herein, it is
to be understood and considered as an embodiment of the invention that these
amino
acid sequences include within their scope an amino acid sequence with >_ 90%
sequence similarity to the original sequence (Altschul et al., Nucleic Acids
Res., 25,
3389-3402 (1997)). Similar or homologous amino acids are defined as non-
identical
amino acids which display similar properties, e.g., acidic, basic, aromatic,
size,
positively or negatively charged, polar, non-polar.
[162.] Percentage amino acid similarity or homology or sequence similarity is
determined by comparing the amino acid sequences of two different peptides or
polypeptides. The two sequences are aligned, usually by use of one of a
variety of
computer programs designed for the purpose, and amino acid residues at each
position
are compared. Amino acid identity or homology is then determined. An algorithm
is
then applied to determine the percentage amino acid similarity. It is
generally
preferable to compare amino acid sequences, due to the greatly increased
sensitivity
to detection of subtle relationships between the peptide, polypeptide or
protein
molecules. Protein comparison can take into account the presence of
conservative
amino acid substitutions, whereby a mismatch may yet yield a positive score if
the
non-identical amino acid has similar physical and/or chemical properties
(Altschul et
al., Nucleic Acids Res., 25, 3389-3402 (1997).
[163.] In an embodiment of the invention the three hypervariable regions of
each of the light and heavy chains can be interchanged between the two chains
and
among the three-hypervariable sites within and/or between chains.
38
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
[164.] One skilled in the art will realize that demonstration of specific
and/or
selective binding of the peptide or polypeptide of the invention necessitates
the use of
a suitable negative control. A suitable negative control may be a peptide or
polypeptide, the amino acid sequence of which is almost identical to the
peptide or
polypeptide of the invention, with the only difference being in the
hypervariable
CDR3 region. Another suitable negative control may be a peptide or polypeptide
that
is the same size and/or general three-dimensional structure as the peptide or
polypeptide of the invention but has a totally unrelated amino acid sequence.
Another
suitable negative control may be a peptide or polypeptide with completely
different
physical and chemical characteristics, when compared to the peptide or
polypeptide of
the invention. The negative controls used in the development of the present
invention
are designated N14, having a CDR3 sequence identical to SEQ >D N0:28, and
C181,
having a CDR3 sequence identical to SEQ m N0:29. Other negative controls,
however, may likewise be suitable.
[165.] Another embodiment provides for a nucleic acid molecule, preferably a
DNA molecule, encoding the Fv peptide or polypeptide of the invention.
[166.] In a preferred embodiment of the invention, and in order to optimize
the selective binding of the Fv, the CDR3 sequences that confers primary
binding
selectivity and/or specificity to the Fv may be moved to any other heavy chain
germline. More particularly they may be moved to one of 84 possible heavy
chain
germlines. These 84 germlines (SEQ >D NOs:30-113) comprise (a) the germline in
which the claimed phage clone was originally isolated, (b) 48 additional
germlines
available in the phage display library and (c) 35 alternative germlines
claimed herein
(Tomlinson et al, J. Mol. Biol., 227(3):776-798 (1992)). The local linear, or
3-
dimensional environment of the CDR3 region, in concert with the CDR3 region
itself,
may potentially play a role in guiding or encouraging the proper CDR3 binding.
For
example, peptides having any of the CDR3 sequences recited herein as SEQ >D
NOs:B-24, 125 and derived from any of the 49 germline sequences (SEQ ID NOs:30-
32, 35, 37-39, 41, 43, 45, 46, 48, 51, 54, 57, 59-68, 70, 71, 76-85, 87, 89-
92, 94, 97,
99, 103, 106, 112, and 113) are also encompassed by the subject invention.
39
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
[167.] Germline DP-32 is the cassette for several clones of the present
invention. The C-terminus of this germline has been replaced with a consensus
sequence to aid in phage display library preparation. The seven carboxy-
terminal
amino acids of SEQ ED NO: 61 have been replaced by the seven amino acid
sequence of SEQ ID NO: 122.
[168.] CDR3 regions of Fvs of the present invention may contain the core
sequence Arsiciyi,ySPhe Pro which binds specifically to AML cells. Eight
examples of
such CDR3 regions are presented in Table 2. Although the motif coincides with
the
three N-terminal amino acid residues of the CDR3 region in each case, it may
also be
located elsewhere in the CDR3 region. Alternatively, the motif is a binding
motif that
is used to build or construct an anchor or a binding region of part of a
larger binding
or targeting or recognition molecule or is used alone as a target vehicle.
[169.] In a further embodiment of the present invention there is provided a
binding motif comprising the amino acid sequence of Rl-X Phe Pro-RZ wherein Rl
and R2 each comprises 0- 15, preferably 1-9, amino acid residues and wherein X
is
either Arg, Gly or Lys. Most preferably, the CDR3 comprises the amino acid
sequence of RI-X Phe Pro-R2, wherein Rl and RZ each comprises 0-15 amino acid
residues, and wherein X is either Arg, Gly, or Lys.
[170.] In another preferred embodiment of the peptide or polypeptide of the
subject invention, 1-1000 amino acids may be added either to the C-terminus or
to the
N-terminus of the peptide, while the peptide maintains its biological
activity. In a
preferred embodiment of the invention, 150-500 amino acids may be added either
to
the C-terminus or to the N-terminus of the peptide or polypeptide, while the
peptide
maintains its biological activity. In another preferred embodiment of the
invention,
800-1000 amino acids may be added either to the C-terminus or the N-terminus
of the
peptide or polypeptide, while the peptide or polypeptide maintains its
biological
activity.
[171.] An example for extending the core amino-acid sequence is by building
a full-sized immunoglobulin Ig, using a lead compound as the core of the Ig.
The
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
full-sized Ig may, for example, belong to the immunoglobulin class that can
induce
the endogenous cytolytic activity via complement or activation of cellular
cytolytic
activity (e.g., IgGI, IgG2, or IgG3). The full-sized Ig may belong to the
immunoglobulin class of strongly binding antibodies (e.g., IgG4). On binding,
the
full-sized Ig may act in one or more of many ways, e.g., by acting as a flag
for the
body's defense mechanism to initiate an immune response, by tranducing
intracellular
cell signaling, or by causing damage to a target cell.
[172.] One preferred embodiment of the present invention provides for an Ig
molecule expressed as a recombinant polypeptide and produced in a eukaryotic
cell
system. In a preferred embodiment of the invention, the Ig polypeptide is an
IgG
polypeptide and it is produced in a mammalian cell system. In a more preferred
embodiment the mammalian cell system comprises the CMV promoter.
[173.] In a preferred embodiment of the invention, the IgG molecule
comprises a CDR3, CDRZ and CDRI hypervariable region, both in the light and in
the heavy chains. In a more preferred embodiment of the invention, the Fv
molecule
comprises a CDR3, CDR2 and a CDR1 region having SEQ >D NOs:B, 115 and 114,
respectively. The CDR3, CDR2 and CDR1 regions can be of the heavy chain or of
the light chain.
[174.] A further preferred embodiment of the invention provides for an IgG
molecule having a light chain with a sequence identical to SEQ ID NO: 27 and a
heavy chain with a sequence identical to SEQ ID NO: 26, or a heavy chain and a
light chain having at least 90% sequence similarity therewith. In a most
preferred
embodiment of the invention the two heavy chains of the IgG are identical and
the
two light chains of the IgG are identical.
[175.] In another embodiment, the peptide of the subject invention is
constructed to fold into multivalent Fv forms.
[176.] The present invention provides for a Y1 or Y17 peptide or polypeptide
comprising an scFv molecule. As used herein a scFv is defined as a molecule
which
is made up of a variable region of a heavy chain of a human antibody and a
variable
41
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
region of a light chain of a human antibody, which may be the same or
different, and
in which the variable region of the heavy chain is connected, linked, fused or
covalently attached to, or associated with, the variable region of the light
chain.
[177.] A Y1 and Y17 scFV construct may be a multimer (e.g., dimer, trimer,
tetramer, and the like) of scFv molecules that incorporate one or more of the
hypervariable domains of the Y1 or Y17 antibody. All scFv derived constructs
and
fragments retain enhanced binding characteristics so as to bind selectively
and/or
specifically to a target cell in favor of other cells. The binding selectivity
and/or
specificity is primarily determined by hypervariable regions.
[178.] The hypervariable loops within the variable domains of the light and
heavy chains are termed Complementary Determining Regions (CDR). There are
CDR1, CDR2 and CDR3 regions in each of the heavy and light chains. The most
variable of these regions is the CDR3 region of the heavy chain. The CDR3
region is
understood to be the most exposed region of the Ig molecule, and as provided
herein,
is the site primarily responsible for the selective and/or specific binding
characteristics observed.
[179.] The Y1 and Y17 peptide of the subject invention can be constructed to
fold into multivalent Fv forms. Y1 and Y17 multimeric forms were constructed
to
improve binding affinity and specificity and increased half life in blood.
[180.] Mulitvalent forms of scFv have been produced by others. One
approach has been to link two scFvs with linkers. Another approach involves
using
disulfide bonds between two scFvs for the linkage. The simplest approach to
production of dimeric or trimeric Fv was reported by Holliger et al., PNAS,
90,
6444-6448 (1993) and A. Kortt, et al., Protein Eng., 10, 423-433 (1997). One
such
method was designed to make dimers of scFvs by adding a sequence of the FOS
and
JUN protein region to form a leucine zipper between them at the c-terminus of
the
scFv. Kostelny SA et al., Jlmmunol. 1992 Mar 1;148(5):1547-53; De Kruif J et
al., J
Biol Chem. 1996 Mar 29;271(13):7630-4. Another method was designed to make
tetramers by adding a streptavidin coding sequence at the c-terminus of the
scFv.
42
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
Streptavidin is composed of 4 subunits so when the scFv-streptavidin is
folded, 4
subunits accommodate themselves to form a tetramer. Kipriyanov SM et al., Hum
Antibodies Hybridomas, 1995;6(3):93-101. In yet another method, to make
dimers,
trimers and tetramers, a free cysteine is introduced in the protein of
interest. A
peptide-based cross linker with variable numbers (2 to 4) of maleimide groups
was
used to cross link the protein of interest to the free cysteines. Cochran JR
et al.,
Immunity, 2000 Mar;l2(3):241-50.
[181.] In this system, the phage library (as described herein above) was
designed to display scFvs, which can fold into the monovalent form of the Fv
region
of an antibody. Further, and also discussed herein above, the construct is
suitable for
bacterial expression. The genetically engineered scFvs comprise heavy chain
and
light chain variable regions joined by a contiguously encoded 15 amino acid
flexible
peptide spacer. The preferred spacer is (Gly4Ser)3. The length of this spacer,
along
with its amino acid constituents provides for a nonbulky spacer, which allows
the VH
and the VL regions to fold into a functional Fv domain that provides effective
binding
to its target.
[182.] The present invention is directed to Yl and Y17 multimers prepared by
any known method in the art. A preferred method of forming multimers, and
especially dimers, employs the use of cysteine residues to form disulfide
bonds
between two monomers. In this embodiment, dimers are formed by adding a
cysteine
on the carboxyl terminus of the scFvs (referred to as Y1-cys scFv or Y1 dimer)
in
order to facilitate dimer formation. After the DNA construct was made (See
Example
2D and 6D) and used for transfection, Y1 dimers were expressed in a production
vector and refolded in vitro. The protein was analyzed by SDS-PAGE, HPLC, and
FACS. Two-liter fermentation batches of the antibodies were run. After
expressing
Yl-cys in E. coli strain BL21, refolding was done in arginine. Following
refolding,
the protein was dialyzed and purified by Q-sepharose and gel filtration
(sephadex 75).
Two peaks were detected by SDS-PAGE (non-reduced) and by gel filtration. The
peaks were collected separately and analyzed by FACS. Monomer and dimer
binding
to Jurkat cells was checked by FACS. The binding by dimers required only 1/100
the
43
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
amount of the monomeric antibody for the same level of staining, indicating
that the
dimer has greater avidity. Conditions for dimer refolding were determined, and
material comprising >90% dimers (mg quantities) was produced after subsequent
dialysis, chromatographic, and gel filtration steps. The purified dimer was
characterized by gel filtration and by SDS-PAGE analysis under oxidizing
conditions.
The dimer's binding capacity was confirmed by radioreceptor assay, ELISA, and
FACS analyses.
[183.] CONY1 scF antibody fragment is derived from Yl scFV. The DNA
sequence encoding the myc tag of Y1 scFv were removed and replaced by
synthetic
oligonucleotide DNA sequence encoding the amino acids lysine, alanine lysine
(KAK).
[184.] To compare the binding of the scFv monomer (also referred to as
CONY1) with the YI dimer, binding competition experiments were done in vitro
on
KG-1 cells. In addition, these experiments also compared the binding of the
full YI
IgG to the scFv Y1 monomers. To perform this study, Y1 IgG was labeled with
biotin. This study revealed that Y1 IgG competed with IgG Y1-Biotin. Non-
relevant
human IgG did not compete with the labeled Y1 IGg. Y1 scFvs (5 p,g and 10 pg)
partially competed with Yl IgG-Biotin (SOng). The studies also showed that lng
of
IgGYI-FITC bound to KG-1 cells (without serum) to the same extent as lpg of
scFv-
FITC, but in the presence of serum, most of Y1 IgG binding was "blocked."
These
studies also showed that the binding of the Y1 dimer is at least 20-fold
higher than
that of the scFV monomer as analyzed by radioreceptor assay, ELISA or FACS.
[185.] In yet another emobodiment, a lysine-alanine-lysine was added in
addition to the cysteine at the carboxyl end (referred to as YI-cys-kak scFv).
The
amino acid sequence of this scFv construct is reproduced below.
1 MEVQLVESGG GVVRPGGSLR LSCAASGFTF DDYGMSWVRQ
APGKGLEWVS GINWNGGSTG 60
61 YADSVKGRFT ISRDNAKNSL YLQMNSLRAE DTAVYYCARM
RAPVIWGQGT LVTVSRGGGG 120
121 SGGGGSGGGG SSELTQDPAV SVALGQTVRI TCQGDSLRSY
YASWYQQKPG QAPVLVIYGK 180
44
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
181 NNRPSGIPDR FSGSSSGNTA SLTITGAQAE DEADYYCNSR
DSSGNHVVFG GGTKLTVLGG 240
241 GGCKAK
[186.] The Y1-cys-kak was produced in a ~,-pL vector in bacteria. Expression
in the ~,-pL vector was induced by increasing the temperature to 42°C.
Inclusion
bodies were obtained from induced cultures and semi-purified by aqueous
solutions,
to remove unwanted soluble proteins. The inclusion bodies were solubilized in
guanidine, reduced by DTT, and refolded in vitro in a solution based on
arginine/ox-glutathione. After refolding, the protein was dialyzed and
concentrated
by tangential flow filtration to a buffer containing Urea/phosphate buffer.
The protein
was repurified and concentrated by ionic-chromatography in an SP-column.
[187.] In order to obtain higher levels of expression in E. coli of the CONY1
scFv, as well as in the Y1-cys-KaK scFv, we introduced at position 2 of the N-
terminal sequence of the scFv construct the amino acid encoding for the
alanine
residue. A four-fold level of expression was obtained with this newly modified
construct.
[188.] An ELISA assay was performed to ascertain the differences in binding
between the monomer (CONYl scFv-also known as Yl-kak) and the dimer YI-cys
kak (the cysteine dimer) for antigen GPIb (glycocalicin) derived from
platelets. A
polyclonal anti single chain antibody and/or a novel polyclonal anti-VL
(derived from
rabbits) and anti-rabbit HRP, were used to detect the binding to GPIb. The
dimer was
approximately 20-100 fold more active than the monomer. For instance, to.reach
0.8
OD units 12.8mg/ml of monomer was used compared to only O.lmg/ml of dimer. See
Figure 12.
[189.] The dimer was characterized by SDS-page electrophoresis, gel
filtration chromatography, ELISA, radioreceptor binding, and FACS. The
apparent
affinity of the dimer was higher than the monomer due to the avidity effect.
This
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
effect was confirmed by ELISA to glycocalicin, FACS to KG-1 cells, and
competition
in a radioreceptor assay.
[190.] HPLC was performed to profile the dimer after refolding and
purification from a Superdex 75 gel filtration column. In Figure 10, the Y1-
cys-kak
(dimer) is the first peak on the left 010.8 minutes) and the subsequent peak
is the
monomer (~12 minutes). The dimer is approximately 52kDa and the monomer
26kDa, according to protein size markers run on the same column. The balance
between the dimer and monomer can be changed by varying the conditions of the
refolding (concentration of the oxidized agent and the concentration of the
protein in
the refolding buffer). The dimer and monomer were separated by chromatography
in
a superdex 75 column.
[191.] In Figure 1 l, a gel is shown with a mixed population of dimers and
monomers. In the reduced form, the monomers are seen due to the reduction
between
the two monomers and in the non-reduced form, two population are seen (as in
the gel
filtration experiment) a monomer fraction of about 30kDa and a dimer of about
60kDa.
[192.] In addition, FAGS binding analysis to KG-1 cells showed that the
dimer is more sensitive than the monomer when a two or three-step binding
assay was
performed. Dimers directly labeled by FITC showed a slight advantage (use of l
Ox
fold less material) than the monomer. The radio receptor assay on KG-1 cells,
where
the dimer was used as competitor, showed that the dimer is 30x fold more
efficient
than the monomer.
[193.] Varying the length of the spacers is yet another preferred method of
forming dimers, trimers, and tetramers (often referred to in the art as
diabodies,
triabodies and tetrabodies, respectively). Dimers are formed under conditions
where
the spacer joining the two variable chains of a scFv is shortened to
generally. This
shortened spacer prevents the two variable chains from the same molecule from
folding into a functional Fv domain. Instead, the domains are forced to pair
with
complimentary domains of another molecule to create two binding domains. In a
46
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
preferred method, a spacer of only 5 amino acids (Gly4Ser) was used for
diabody
construction. This dimer can be formed from two identical scFvs, or from two
different populations of scFvs and retain the selective and/or specific
enhanced
binding activity of the parent scFv(s), and/ or show increased binding
strength or
affinity.
[194.] In a similar fashion, triabodies are formed under conditions where the
spacer joining the two variable chains of a scFv is shortened to generally
less than 5
amino acid residues, preventing the two variable chains from the same molecule
from
folding into a functional Fv domain. Instead, three separate scFv molecules
associate
to form a trimer. In a preferred method, triabodies were obtained by removing
this
flexible spacer completely. The triabody can be formed from three identical
scFvs, or
from two or three different populations of scFvs and retain the selective
and/or
specific enhanced binding activity of the parent scFv(s), and/or show
increased
binding strength or affinity.
[195.] Tetrabodies are similarly formed under conditions where the spacer
joining the two variable chains of a scFv is shortened to generally less than
S amino
acid residues, preventing the two variable chains from the same molecule from
folding into a functional Fv domain. Instead, four separate scFv molecules
associate
to form a tetramer. The tetrabody can be formed from four identical scFvs, or
from
1-4 individual units from different populations of scFvs and should retain the
selective
and/or specific enhanced binding activity of the parent scFv(s), and/or show
increased
binding strength or affinity.
[196.] Whether triabodies or tetrabodies form under conditions where the
spacer is generally less than 5 amino acid residues long depends on the amino
acid
sequence of the particular scFv(s) in the mixture and the reaction conditions.
[197.] In a preferred method, tetramers are formed via a biotin/streptavidin
association. A novel fermentation construct that is capable of being
enzymatically
labeled with biotin (referred to herein as Y1-biotag or Y1-B) was created. A
sequence that is a substrate for the BirA enzyme was added at the Yl C-
terminus.
47
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
The BirA enzyme adds a biotin to the lysine residue within the sequence. Y1-
biotag
was cloned and expressed in E. coli. The inclusion body material was isolated
and
refolded. The purity of the folded protein was >95%, and >100 mg were obtained
from a 1-L culture (small-scale, non-optimized conditions). The molecular
weight of
this form was found to be similar to that of the scFv according to HPLC, SDS-
PAGE,
and mass spectroscopy. Yl-biotag was found to be the most consistent reagent
for
FACS analysis. However, when Y1-biotag binding to KG-1 cells was examined in
the presence of serum, high concentrations (10-fold more) are required for
comparable binding in the absence of serum. Nevertheless, this construct
offered the
advantage of specific biotinylation in which the binding site of the molecule
remains
intact. Further, each molecule is labeled by only one biotin -- each molecule
receives
one biotin on the carboxyl end.
[198.] Limiting labeling to one biotin/molecule in a desired location enabled
production of tetramers with streptavidin. The tetramers were formed by
incubating
Y1-B with steptavidin-PE.
[199.] FACS analysis indicated that the tetramers made by Y1-biotag and
streptavidin-PE were 100 to 1000 fold more sensitive that Y1 scFv monomers in
the
absence of serum. Y1-biotag tetramers with strepavidin-PE appear to
specifically
bind to one of the Y1-reactive cell lines (KG-1). The differential of this
reaction,
from background binding, was very high, and offered high sensitivity to detect
low
amounts of receptor. FACS evaluation of normal whole blood with Y1-SAV
tetramers indicated that no highly reactive population is present. Monocytes
and
granulocytes were positive to a small extent. In cell lines where a positive
result was
present, such as with KG-1 cells, the tetramers were at least 100-fold more
reactive.
[200.] Then, the tetramers were incubated with the cell samples. A low dose
of the Y1 tetramers (5 ng) binds well to the cell line (KG-1) providing a 10
to 20-fold
higher response than previously observed with other Y1 antibody forms. A minor
reaction was observed when a negative cell line was examined with varying
doses of
the tetramers.
48
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
[201.] An embodiment of the invention provides for a method for identifying
a targeting molecule which binds to unknown immuno-cross-reactive binding
sites on
first and second cells comprising (a) one or more biopanning steps that are
performed
on a first target cell that, in a second state but not in a first state,
substantially exposes
or displays a binding site comprising an unknown ligand so as to produce a
first
population of recognition molecules; (b) subsequent biopanning and/or
selection
steps, commencing with the resultant stock of recognition molecules of step
(a), that
are performed on a second cell that displays a binding site comprising an
unknown
ligand having immuno-cross-reactivity to the unknown ligand of the first cell
so as to
produce a second population of recognition molecules; (c) amplification and
purification of the second population of recognition molecules of step (b);
and (d)
construction from the recognition sites of the purified recognition molecules
of step
(c) peptides or polypeptides that comprise targeting molecules that are
selective
and/or specific for unknown ligands on the second cell.
[202.] A preferred embodiment provides for the first cell to be a normal cell,
the first state to be a non-activated state and the second state to be an
activated,
excited, modified, changed or disturbed state. In a more preferred embodiment
the
second cell is a diseased cell. In a yet more preferred embodiment the
diseased cell is
a cancer cell. The cancer cell may be, but is not limited to carcinoma,
sarcoma,
leukemia, adenoma, lymphoma, myeloma, blastoma, seminoma, and melanoma. In a
yet more preferred embodiment, the cancer cell is a leukemia cell. In a most
preferred
embodiment the leukemia cell is an AML cell.
[203.] An embodiment of the present invention provides for use of the
peptide or polypeptide optionally in association with or attached, coupled,
combined,
linked or fused to a pharmaceutical agent, in the manufacture of a medicament.
In a
preferred embodiment the medicament has activity against a diseased cell. In
yet a
more preferred embodiment, the activity is against a cancer cell. The cancer
cell be
but is not limited to carcinoma, sarcoma, leukemia, adenoma, lymphoma,
myeloma,
blastoma, seminoma, and melanoma. In yet amore preferred embodiment the cancer
49
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
cell is a leukemia cell. In a most preferred embodiment the leukemia cell is
an AML
cell.
[204.] An embodiment of the invention provides for a pharmaceutical
composition comprising mixtures of different monomeric scFvs, and/or mixtures
of
diabodies or triabodies or tetrabodies constructed from different scFvs.
[205.] A further embodiment provides for use of the peptide or polypeptide of
the invention, in association with, or attached, coupled, combined, linked or
fused to a
pharmaceutical agent, in the manufacture of a medicament. The medicament can
have activity against diseased cells, and more specifically against cancer
cells. The
cancer cells may be, but are not limited to, carcinoma, sarcoma, leukemia,
adenoma,
lymphoma, myeloma, blastoma, seminoma, and melanoma. In a more preferred
embodiment, the medicament is active against leukemia cells. In a most
preferred
embodiment, the medicament is active against AML cells. Activity of the
medicament against the said cells may cause retardation of cancerous growth,
complete prevention of any growth, or killing of the cancerous cells.
[206.] In an embodiment of the invention, the activity of the medicament or
of the pharmaceutical composition is by inhibiting cell growth.
[207.] The peptide or polypeptide of the invention can be used for preparing a
composition, preferably a pharmaceutical composition, for use in inhibiting
the
growth of a cancer cell, preferably a leukemia cell, and most preferably an
AML cell.
In an embodiment of the invention, the peptide or polypeptide can be used for
preparing a composition for use in inhibition of growth of a cancer cell, said
composition comprising at least one compound having a pharmaceutical ligand
selective and/or specific for the cancer cell.
[208.] A peptide or polypeptide of the subject invention may be administered
alone to a patient, or as comprising a medicament or a pharmaceutical
composition, in
association with, conjugated, linked, or fused to a pharmaceutically effective
amount
of a pharmaceutical agent, a pharmaceutically effective carrier and,
optionally, an
adjuvant. Such pharmaceutical compositions may include proteins, diluents,
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
preservatives and anti-oxidants (see Osol et al. (eds.), Remington's
Pharmaceutical
Sciences (16th ed), Mack Publishing Company, (1980)).
[209.] In another embodiment, the pharmaceutical agent is an antibody or
fragment thereof that is linked to a peptide or polypeptide of the invention
by a
peptide bond.
[210.] In a preferred embodiment, the toxin is, for example, gelonin,
Pseudomonas exotoxin (PE), PE40, PE38,diptheria toxin, ricin, or modifications
or
derivatives thereof.
[211.] In a preferred embodiment, the radioisotopes used include gamma-
emitters, positron-emitters, and x-ray emitters that may be used for
localization and/or
therapy, and beta-emitters and alpha-emitters that may be used for therapy.
[212.] In a specific embodiment of the subject invention, the therapeutic
radioisotope is selected from a group comprising 111 indium, ' l3indium,
9~"'rhenium,
losrhenium, lolrhenium, 991"technetium, lz~"'tellurium, lzzmtellurium,
lzsmtelluriunm
l6sthulium, 167thulium 168thulium lz3iodine, lz6iodine, 131iodine, 133iodine,
$1"'krypton,
33xenon, 9oyttrium, zl3bismuth, "bromine, l8fluorine, 9sruthenium,
97ruthenium,
lo3ruthenium, losmthenium, 1°7mercury, zo3mercury, 67gallium and
6ggallium and the
like.
[213.] In another specific embodiment of the subject invention, the anti-
cancer agent is selected from the group comprising doxorubicin, adriamycin,
cis-
platinum, taxol, calicheamicin, vincristine, cytarabine (Ara-C),
cyclophosphamide,
prednisone, daunorubicin, idarubicin, fludarabine, chlorambucil, interferon
alpha,
hydroxyurea, temozolomide, thalidomide and bleomycin, and derivatives thereof.
[214.] An embodiment of the invention provides for a method of inhibiting
the growth of a cancer cell that comprises contacting the cancer cell with an
amount
of the peptide or polypeptide of the invention. In a preferred embodiment, the
cancer
cells may be but are not limited to carcinoma, sarcoma, leukemia, adenoma,
lymphoma, myeloma, blastoma, seminoma, and melanoma. In a more preferred
51
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
embodiment the cancer cell is a leukemia cell. In a most preferred embodiment
the
leukemia cell is an AML cell. An embodiment of the invention allows for in
vivo and
ex vivo treatment of the patient. A more specific embodiment of the invention
allows
for ex vivo purging of autologous bone marrow to remove abnormal stem cells.
[215.] In a more specific embodiment of the invention, the blood of a
leukemia patient can be circulated ex vivo through a system comprising a
peptide or
polypeptide of the invention conjugated to an anti-cancer agent. After removal
of
bound cells and unbound anti-cancer agent, the blood cells can be reintroduced
into
the body of a patient. Alternatively, the blood of a leukemia patient can be
circulated
ex vivo through a system comprising a peptide or polypeptide of the invention
attached to a solid phase. The cells that pass through the system and that do
not bind
to the peptide or polypeptide of the invention attached to a solid phase can
be
reintroduced into the body of a patient.
[216.] In another preferred embodiment of the invention, the peptide or
polypeptide is utilized for ex vivo autologous bone marrow in suspension in
order to
remove abnormal stem cells prior to implantation. Purging of abnormal stem
cells
can be performed by running the suspension over a solid support (such as, but
not
limited to, magnetic beads and affinity columns) to which the peptide or
polypeptide
of the invention (i.e., the targeting molecule), constructs, fragments,
fragments of
constructs, or constructs of fragments thereof are bound. Bone marrow thus
purged
ex vivo can then be used for autologous bone marrow transplantation. This
preferred
embodiment is based on the identification in the present invention of a
phagemid
clone (Y1) that binds to stem cells released from bone marrow of leukemia
patients,
but does not bind to stem cells released from the bone marrow of healthy
donors.
Similarly, the Y1 phagemid clone binds to blast cells that are determined by
FACS
analysis to be abnormal, as well as to leukemic cells.
[217.] Blast cells are herein defined as primary cells that are precursors for
all
the circulating cells in the mammalian organism. Due to their progenitor
characteristics, blast cells are not found circulating in significant
quantities in the
adult organism. The presence of circulating blast cells without exogenous
stimulation
52
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
can be an indication of malignancy, e.g., of the hematopoietic system, and
their
subsequent disappearance may indicate remission of the malignant disease.
[218.] In another embodiment of the invention, the pharmaceutical
composition is used for prophylaxis.
[219.] In a preferred embodiment, two or more peptides or polypeptides of
the invention are combined to form a mixture.
[220.] As used herein, a mixture is defined as two or more molecules or
particles of different species that are contained in a single preparation. The
different
species of molecules form neither covalent nor non-covalent chemical bonds.
[221.] In one embodiment of the subject invention, the peptide or polypeptide
of the subject invention is linked, fused or conjugated to a pharmaceutical
agent.
[222.] In another embodiment of the subject invention, the link between the
peptide and the pharmaceutical agent is a direct link. As used herein, a
direct link
between two or more neighboring molecules is obtained via a chemical bond
between
elements or groups of elements in the molecules. The chemical bond can be for
example, an ionic bond, a covalent bond, a hydrophobic bond, a hydrophilic
bond, an
electrostatic bond or a hydrogen bond. The bonds can be selected from, but not
limited to, a group comprising amine, carboxy, amide, hydroxyl, peptide and
disulfide. The direct link could preferably be a protease resistant bond.
[223.] In yet another embodiment, the link between the peptide and the
pharmaceutical agent is affected by a linker compound. As used herein in the
specification and in the claims, a linker compound is defined as a compound
that joins
two or more moieties together. The linker can be straight-chained or branched.
The
branched linker compound can be composed of a double-branch, triple branch, or
quadruple or more branched compound. The linker compound may be, but is not
limited to, a dicarboxylic acid, a malemido hydrazide, PDPH, a carboxylic acid
hydrazide, and a small peptide. Examples of other linker compounds include:
Dicarboxylic acids such as succinic acid, glutaric acid, and adipic acid;
Maleimido
53
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
hydrazides such as N-[e-maleimidocaproic acid] hydrazide, 4-[N-
maleimidomethyl]cyclohexan-1-carboxylhydrazide, and N-[x-maleimidoundcanoic
acid] hydrazide]; PDPH linker such as (3-[2-pyridyldithio]propionyl hydrazide)
conjugated to sulfurhydryl reactive protein; Carboxylic acid hydrazides
selected from
2-5 carbon atoms; and direct coupling using small peptide linkers between the
free
sugar of, for example, the anti-cancer drug doxorubicin and a scFv. Small
peptides
include, but are not limited to AU1, AUS, BTag, c-myc, FLAG, Glu-Glu, HA,
His6,
HSV, HTTPHH, IRS, KT3, Protein C, S~Tag~, T7, V5, VSV-G, and KAK Tag.
[224.] Any known method of administration of a peptide or polypeptide of
the subject invention may be sued such as: intravenous, intramuscular,
subcutaneous,
topical, intratracheal, intrathecal, intraperitoneal, intralymphatic, nasal,
sublingual,
oral, rectal, vaginal, respiratory, buccal, intradermal, transdermal or
intrapleural.
[225.] For intravenous administration, the formulation preferably will be
prepared so that the amount administered to the patient will be an effective
amount
from about 0.1 mg to about 1000mg of the desired composition. More preferably,
the
amount administered will be in the range of about lmg to about SOOmg of the
desired
composition. The compositions of the invention are effective over a wide
dosage
range, and depend on factors such as the particulars of the disease to be
treated, the
half life of the peptide or polypeptide-based pharmaceutical composition in
the body
of the patient, physical and chemical characteristics of the pharmaceutical
agent and
of the pharmaceutical composition, mode of administration of the
pharmaceutical
composition, particulars of the patient to be treated or diagnosed, as well as
other
parameters deemed important by the treating physician.
[226.] The pharmaceutical composition for oral administration can be in the
form of tablet, liquid, emulsion, suspension, syrup, pill, caplet, or capsule.
The
pharmaceutical composition may also be administered in a device.
[227.] The pharmaceutical composition for topical administration can be in
the form of cream, ointment, lotion, patch, solution, suspension, or gel.
54
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
[228.] In addition, the pharmaceutical composition can be prepared for solid,
liquid, or sustained release formulation.
[229.] The compositions comprising the antibody fragments produced in
accordance with the invention may comprise conventional pharmaceutically
acceptable diluents or carriers. Tablets, pills, caplets and capsules may
include
conventional excipients such as lactose, starch and magnesium stearate.
Suppositories
may include excipients such as waxes and glycerol. Injectable solutions
comprise
sterile pyrogen-free media such as saline, and may include buffering agents,
stabilizing agents or preservatives. Conventional enteric coatings may also be
used.
[230.] The subject invention also encompasses a method of producing the
antibody fragment by synthetic means known in the art.
[231.] An embodiment of the invention comprises a pharmaceutical
composition comprising at least one peptide or polypeptide of the invention,
attached,
coupled, combined, linked or fused to an imaging agent for use in the
diagnostic
localization and/or imaging of a tumor.
[232.] A further embodiment of the invention provides for a diagnostic kit for
in vitro analysis of treatment efficacy before, during, or after treatment,
comprising an
imaging agent comprising a peptide of the invention linked to an indicative
marker
molecule. The invention further provides for a method of using the imaging
agent for
diagnostic localization and/or imaging of a cancer, more specifically a tumor,
comprising the following steps:
a) contacting the cells with the composition,
b) measuring the radioactivity bound to the cells, and
c) visualizing the tumor.
[233.] In a preferred embodiment of the invention, the imaging agent of the
kit is a fluorescent dye and the kit provides for analysis of treatment
efficacy of
cancers, more specifically blood-related cancers, e.g., leukemia, lymphoma and
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
myeloma. FACS analysis is used to determine the percentage of cells stained by
the
imaging agent and the intensity of staining at each stage of the disease,
e.g., upon
diagnosis, during treatment, during remission and during relapse.
[234.] The invention further provides a composition comprising an effective
amount of an imaging agent, the peptide of the invention and a physiologically
acceptable Garner.
[235.] In a preferred embodiment, the indicative marker molecule is any
known marker known in the art, which includes, but is not limited to, a
radioactive
isotope, an element that is opaque to X-rays, a paramagnetic ion, or a
fluorescent
molecule, and the like.
[236.] In a specific embodiment of the subject invention, the indicative
radioactive isotope may be, but is not limited to, "'indium, "3indium,
99"'rhenium,
iosrhenium '°'rhenium 99"'technetium,'z'"'tellurium 'zz"'tellurium
'zs"'telluriunm
> > > >
~6sthulium,'67thulium'6gthulium'z3iodine,'z6iodine,'3'iodine,'33iodine,
$'"'krypton,
33Xenon, 9°yttrium, z'3bismuth, 77bromine,'gfluorine, 9sruthenium,
9~ruthenium,
'o3ruthenium,'°sruthenium,'°7mercury, z°3mercury,
b~gallium and 6ggallium.
[237.] According to another preferred embodiment the indicative marker
molecule is a fluorescent marker molecule. According to a more preferred
embodiment the fluorescent marker molecule is fluorescein, phycoerythrin, or
rhodamine, or modifications or conjugates thereof.
[238.] The subject invention also envisages a composition comprising an
effective amount of an imaging agent of the invention, a pharmaceutical agent
linked
thereto and a physiolgically acceptable Garner.
[239.] The invention also provides a method for imaging an organ or cells
that involves contacting the organ or cells to be imaged with an imaging agent
of the
invention under conditions such that the imaging agent binds to the organ and
cells,
imaging the bound imaging agent and, thereby, imaging the organ or cells.
56
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
[240.] The subject invention further provides a method of treating an organ in
vivo that involves contacting the organ to be treated with a composition of
the
invention under conditions such that the composition binds to the organ,
thereby
treating the organ.
[241.] In a preferred embodiment of the invention, the peptide or polypeptide
may be utilized to target malignant cells, more particularly, leukemia cells
in whole
blood, by monitoring and imaging the cells, e.g., by FACS analysis. Specimens
receiving higher scores (e.g., four-fold higher) for tumor cells relative to
normal cells
are subj ect for treatment.
[242.] The invention provides for treating a patient suffering from a cancer,
comprising administering to the patient an amount of the peptide or
polypeptide of the
invention effective to treat the cancer. In a preferred embodiment the cancer
is
selected from the group comprising carcinoma, sarcoma, leukemia, adenoma,
lymphoma, myeloma, blastoma, seminoma, and melanoma. In a more preferred
embodiment the cancer is a leukemia and in a most specific embodiment the
leukemia
is AML.
[243.] In a most preferred embodiment the peptide or polypeptide of the
invention specifically or selectively binds to AML cells. The invention
provides for a
ligand presented on AML cells bound the peptide or polypeptide of the
invention, and
further provides for a peptide or polypeptide that binds said ligand.
[244.] The novel antibody fragments of the subject invention or their
corresponding peptidomimetics are used in the manufacture of compositions or
medicaments to treat various diseases and conditions.
[245.] The subject invention provides a method for production of a targeting
agent comprising the following steps:
a) isolating and selecting one or more targeting molecules comprising a
primary
recognition site by a biopanning procedure directly on a target cell or by a
biopanning
procedure indirectly on a first target cell in a second but not in a first
state and
57
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
subsequently by a biopanning procedure directly on a second target cell to
produce
one or more said targeting molecules;
b) amplification, purification and identification of the one or more targeting
molecules; and
c) construction of a targeting agent from the one or more targeting molecules
or
recognition sites thereof wherein the targeting agent can be a peptide,
polypeptide,
antibody or antibody fragment or a multimer thereof.
[246.] The targeting agent can additionally be constructed so as to be
coupled,
attached, combined, linked or fused to or in association with a pharmaceutical
agent.
[247.] In a preferred embodiment of the invention the targeting agent is an
anti-disease or anti-cancer agent.
[248.] In another preferred embodiment of the invention the pharmaceutical
agent is selected from the group comprising radioisotope, toxin,
oligonucleotide,
recombinant protein, antibody fragment, and anti-cancer agent. The
radioisotope may
be selected from a group comprising lllindium,'~3indium, 99"'rhenium,
losrhenium,
'°~rhenium, 99"'technetium, lzyellurium, Izzmtellurium, ~zs'ntelluriunm
~6sthulium,
i67thulium ~6gthulium lzsiodine, ~z6iodine, l3~iodine, 133iodine, 8'mkrypton,
33xenon,
9oyttrium, z'3bismuth, "bromine, l8fluorine, 9sruthenium, 97ruthenium,
lo3ruthenium,
~os~thenium, 1°7mercury, zo3mercury, 67gallium and oggallium.
[249.] In yet another embodiment the toxin may be selected from the group
comprising gelonin, Pseudomonas exotoxin (PE), PE40, PE38, diptheria toxin,
ricin,
or modifications or derivatives thereof.
[250.] In yet another embodiment of the invention the anti-cancer agent is
selected from the group comprising doxorubicin, morpholino-doxorubicin (MDOX),
adriamycin, cis-platinum, taxol, calicheamicin, vincristine, cytarabine (Ara-
C),
cyclophosphamide, prednisone, daunorubicin, idarubicin, fludarabine,
chlorambucil,
interferon alpha, hydroxyurea, temozolomide, thalidomide and bleomycin, and
derivatives thereof.
58
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
[251.] The subject invention provides a method for the identification of
antibody fragments by: (a) biopanning that involves incubating a phage display
library with cells derived from blood; (b) washing to remove unbound phage;
(c)
eluting the bound phage from the blood cells; (d) amplifying the resulting
bound
phage; and (e) determining the displayed peptide sequence of the bound phage
so as
to identify the peptide.
[252.] The subject invention provides for a peptide or polypeptide having, the
formula or structure:
A-X-B
wherein X is a hypervariable CDR3 region of 3 to 30 amino acids; and A and B
can
each be amino acid chains from 1 to 1000 amino acids in length, wherein A is
the
amino end and B is the carboxy end.
[253.] In a preferred embodiment of the invention A is 150-250 amino acid
residues and B is 350-500 amino acid residues.
[254.] In another preferred embodiment the CDR3 region of the peptide is 5-
13 amino acid residues.
[255.] In another preferred embodiment X in the formula above is an amino
acid sequence selected from the group consisting of SEQ >D NOs:B-24.
[256.] In another embodiment of the invention the peptide or polypeptide is
part of a larger or full antibody or a multimer.
[257.] In yet another embodiment a dimeric molecule comprises two peptides
or polypeptides, one of which is the peptide or polypeptide of the invention.
The
dimeric molecule may comprise two identical peptides or polypeptides of the
invention.
59
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
[258.] In a preferred embodiment of the invention X is an amino acid
sequence selected from the group consisting of SEQ )D NOs:8-24 in said dimeric
molecule.
[259.] Another embodiment provides for a nucleic acid molecule encoding
the peptide or polypeptide or dimeric molecule of the invention.
[260.) The invention provides for the use of the peptide or polypeptide,
optionally in association with or attached, coupled, combined, linked or fused
to a
pharmaceutical agent, in the manufacture of a medicament.
[261.] The invention further provides for use of the peptide or polypeptide in
the manufacture of a medicament that has activity against a diseased cell,
more
specifically a cancer cell. The cancer cell may be selected from a group
comprising
carcinoma, sarcoma, leukemia, adenoma, lymphoma, myeloma, blastoma, seminoma,
and melanoma. More specifically, the cancer cell may be a leukemia cell and
most
specifically, the leukemia cell maybe an AML cell.
[262.] An exchangeable system, as defined in the present invention and as
discussed below in the examples, is a nucleic acid construct that has been
designed to
allow for exchange or replacement of a redefined variable region within said
construct, without need for further manipulation or rebuilding of the
molecule. Such
a system allows for rapid and convenient preparation of the desired nucleic
acid
molecule.
FXAMPT.F~
[263.] The following examples are set forth to aid in understanding the
invention but are not intended and should not be construed, to limit its scope
in any
way. Although specific reagents and reaction conditions are described,
modifications
can be made that are meant to be encompassed by the scope of the invention.
The
following examples, therefore, are provided to further illustrate the
invention.
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
EXAMPLE 1:
[264.] 1. Preparation of cells, bacterial strains, scFv phage display
library, cellular membranes and protein purification for the biopanning
procedure:
[265.] 1.1 Preparation of leukemia cells. Blood samples were obtained
from leukemia patients. Mononuclear cells (primary cells) were separated from
other
blood cells on a Ficoll cushion (Iso-prep, Robbins Scientific Corp.,
Sunnyvale, CA,
USA). Centrifugation was performed at 110 x g for 25 minutes. Cells at the
interface
were collected and washed twice in PBS. Cells were then suspended in RPMI +
10%
fetal calf serum (FCS) and enumerated. For long term storage, 10% FCS and 10%
DMSO were added to the lymphocytes which were then frozen at -70
°C.
[266.] 1.2 Preparation of fixed platelets. Platelet concentrate obtained
from a blood bank was incubated for 1 hour, at 37°C. An equal volume of
2.0%
paraformaldehyde was added, and platelets were fixed for 18 hr, at
40°C. The
platelets were washed twice with cold saline (centrifugation for 10 min, at
2500 x g),
resuspended in 0.01 % HEPES in saline, and counted using a microscope.
[267.] Platelet sensitivity to plasma von Willebrand factor and ristocetin was
verified. Plasma von Willebrand factor (vWF; 18 ,ug/ml) and ristocetin (0.6
mg/Ml)
were added to fixed platelets, and platelet aggregation was induced and
monitored by
a chronolog lumi-aggregometer.
[268.] 1.3 Bacterial strains - TG-1 and HB2151: Fresh bacterial
cultures were prepared for infection by growing the cells to A6oo of 0.5-0.9
(exponentially growing cells). E. coli TG-1 cells were used for phage
propagation and
E. coli HB2151 cells were used for scFv protein production.
[269.] 1.4 sc~ display phage library source. The scFv library (Nissim
et al., EMBO J., 13, 692-698 (1994)) was provided by Dr. A. Nissim with the
agreement of the MRC. The library was originally constructed as a phagemid
library
displaying scFv fragments in which the VH and the VL domains were linked by a
flexible polypeptide. The scFvs displayed in the phagemid library were fused
to the
61
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
N-terminus of the minor coat protein pIII of the phage, which was then
subcloned into
the pHENI vector (Nissim et al., EMBO J., 13, 692-698 (1994)). Repertoires of
antibody fragments were first generated by PCR from rearranged V-genes of
peripheral blood lymphocytes of unimmunized human (referred to as "naive
repertoires"). To diversify the repertoire, random nucleotide sequences
encoding
heavy chain CDR3 lengths of 4-12 residues were introduced into a bank of 49
cloned
human VH gene segments. The fused VL fragment in all the clones it derived
from a
single unmutated V gene of germline IGLV3S1, creating a single pot library of
approximately 108 clones.
[270.] 1.5 Membrane preparation from AML cells. To the pellet
containing 10$ washed cells, l ml cold lysis solution (0.3M sucrose, SmM EDTA,
1mM PMSF) was added, then spun for 20 minutes at 11,000 x g at 4°C. The
supernatant fluid was discarded, and the pellet was resuspended in TE (lOmM
Tris,
1mM EDTA, 1mM PMSF) and spun as above. The final pellet was resuspended in 6
ml PBS at an AZBO of 0.4 and was used to coat 3 Maxisorb immuno-tubes (NUNC),
at
37°C, for 2 hr. Following coating, tubes were rinsed 3 times with PBS,
then blocked
with MPBS (2% skim milk in PBS), at RT, for 2 hours. Before biopanning, the
tubes
were rinsed an additional three times with PBS.
EXAMPLE 2:
[271.] 2. Manipulation of phagemid particles re: biopanning procedure
[272.] 2.1 Phagemid selection and amplification: Phagemids that
expressed epitopes of specific interest were selected from the library by a
four-step
biopanning procedure:
a) Binding of the phagemid particles to a target, more particularly binding of
the
phagemid particles to washed target cells or cell membranes
b) Removal of the non-bound phagemid particles, more particularly removal by
extensive washing
c) Elution of bound phagemid particles
62
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
d) Propagation and amplification of the eluted phagemid particles, more
particularly propagating and amplifying in E. coli
[273.] 2.2 Clone identification: The four-step biopanning procedure was
generally repeated 3-5 times. Selected phagemid clones were individually
propagated, and further characterized by:
a) DNA sequencing
b) Comparison ex-vivo of phage binding to several cell types
c) Infection of E. coli HB2151 to produce soluble scFv
[274.] 2.3 Sequence analysis: The encoded scFv DNA of ~800bp within
the phagemid particles was amplified by PCR using an upstream primer #203743
(5'-
GAAATACCTATTGCCTACGG) and a downstream primer #181390 (5'-
TGAATTTTCTGTATGAGG). DNA fragments were fully sequenced from both ends
by the automatic ABI PRISM DNA sequencer (310 Genetic Analyzer, Perkin Elmer)
using ABI PRISM Big Dye termination cycle sequencing kit and the above
primers.
Two additional primers, primer #191181 (5%-CGATCCGCCACCGCCAGAG) and
its complementary primer # 191344 (5'-CTCTGGCGGTGGCGGATCG), which are
located at the flexible polypeptide junction region between the heavy and
light chains,
were used for sequencing.
EXAMPLE 3:
[275.] 3. Biopanning protocols
[276.] 3.1 Basic biopanning protocols: The biopanning procedure is an
integral part of the phage display technology described above. Three
biopanning
protocols were developed and used in the present work:
a) Protocol AM (AML cell membrane panning/bacterial elution, followed by
whole AML cell panning/trypsin elution)
b) Protocol YPR (fixed human platelet panning/acid elution)
63
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
c) Protocol YPNR (fixed human platelet panning/acid elution)
[277.] These protocols are described in detail below:
[278.] 3.1.1 Protocol AM
[279.] 3.1.1.1 Prewashing: One ml aliquots containing 2x10' frozen AML
cells from patients, stored at -70°C, were quick-thawed at 37°C
and immediately
diluted into 10 ml cold 2% PBS-Milk (MPBS). Cells were spun 5' at 120 x g at
room
temperature (RT), washed twice, resuspended in MPBS and counted with a
hemocytometer. Cell membranes were prepared as described in Section 1.5.
[280.] 3.1.1.2 Selection was carried out on immobilized AML cell
membranes by the addition of 2m1 MPBS containing 10'2 phagemids from the
original Nissim library. The tube was slowly agitated for 30 minutes, then
incubated
for an extra 90 minutes without agitation, both steps at RT. Following three
rounds of
panning on AML cell membranes, one round of panning was carned out on whole
AML cells.
[281.] 3.1.1.3 Wash: To remove excess unbound phagemids, the tube
contents were decanted and the tube was washed 10 times with PBS, 0.1 % Tween,
followed by 10 washes with PBS only.
[282.] 3.1.1.4 Elution: Exponentially growing E. coli TG-1 cells (2 ml) were
added directly to the tube and incubated with slow agitation at 37°C
for 30 minutes.
As above, an aliquot was plated for titration and the remaining volume was
plated for
amplification.
[283.] 3.1.1.5 Amplification: Colonies from the large plates were scraped
and pooled. An aliquot (~10~) of ampicillin resistant E. coli TG-1 cells was
grown in
liquid culture to A6oo of ~0.5, then infected with helper phage (VSC-M13,
Stratagene)
to produce a large amplified phagemid stock. Phagemids were rescued by a PEG
precipitation procedure (18a). The amplified Tl 6MI stock above (~10"
phagemids/ml) was used for subsequent rounds of panning. The selection
procedure
was repeated for two additional rounds, using 10" phagemids of the previously
64
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
amplified stock. The amplified stock of the third panning procedure on
immobilized
membranes was designated T 16M3.
[284.] 3.1.1.6 Re-panning on whole cells: The amplified stock of the third
membrane panning, T16M3, was used to pan intact AML cells. Selection was
carned
out in a final volume of 0.5 ml MPBS containing 2x 107 cells and 101°
Colony
Forming Units (CFU) of phagemids (Nissim library), and 1013 wild-type
bacteriophage M13, with slow agitation for 2 hours at 4°C. Bound
phagemids were
eluted from the washed cell pellet with 50 ~cl of Trypsin:EDTA (0.25%:0.05%),
then
neutralized by the addition of 50 ,u1 of FCS. For titration and amplification,
1 ml of
an E. coli TG-I culture (A6oo = 0.5) was used. The amplified, and final, stock
was
designated T16M3.1.
[285.] 3.1.2 Protocol YPR
[286.] 3.1.2.1 Selection: Clone selection was accomplished by panning 108
fixed human platelets with 1011 phagemids (Nissim library) in 1 ml
PBS/HEPES/1%BSA buffer. Binding was allowed to proceed for one hour at RT
while mixing the sample by rotation.
[287.] 3.1.2.2 Cell wash: Platelets were washed five times by low speed
centrifugation (3500 x g) and resuspended as above.
[288.] 3.1.2.3 Elution: First round bound phagemids were eluted from fixed
platelets by the acid elution technique:
[289.] The platelets were incubated for 10 minutes at RT with 200 ~sl 0.1 M
glycine (pH 2.2). After neutralization with 0.5 M Tris-HCI, pH 8.0 and
centrifugation, the remaining platelet-bound phage were eluted by addition of
200,u1
trypsin-EDTA (0.25%/0.05) and neutralization by the addition of 50 ~l FCS. The
cells were removed by centrifugation, and the supernatant fluids containing
eluted
phage, from both acid and trypsin elution protocols, were collected and
designated
YPR(a)-1 and YPR(t)-1 stocks, respectively. These stocks were then amplified
by
adding 1 ml of exponentially growing TG-1 cells for 30 min., at 37°C.
An aliquot
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
was plated for titration, and the remaining infected E. coli cells were plated
on 2 x
TV/AMP 15 cm plates. Plates were incubated overnight at 30°C. The
output after
each round of panning was determined by counting the colonies on a titration
plate.
[290.] 3.1.2.4 Amplification: The clones were amplified as described in
section 3.1.1.5. The amplified stocks of 1012 phagemid/ml from the acid and
trypsin
elution protocols, designated Rl(a) and R1(t) stocks, respectively, were
combined and
used for subsequent rounds of panning.
[291.] 3.1.2.5 Second and third rounds of panning were carned out as
described for the first panning round of the YPR procedure with the following
modifications: (i) For the second panning 1012 of R1 (a), combined with 1012
of Rl(t),
were used and (ii) elution was carried out with glycine (pH 2.2) only. The
amplified
eluate of the second round was designated R2. (iii) For the third round of
biopanning,
1012 of R2 was used, and elution was carried out as in the second round. The
amplified stock of round three was designated R3.
[292.] 3.1.3 YPNR protocol
[293.] 3.1.3.1 Biopanning and washing were carried out essentially as
described in the YPR protocol. However, in this protocol, (i) elution was
carried out
after each of three rounds of panning with glycine (pH 2.2), and (ii) the
first panning
and amplification were followed by two subsequent rounds of panning without
amplification. The first, second, and third rounds were designated YPNRI,
YPNR2,
and YPNR3, respectively.
[294.] 3.2 Selection of negative control scFv clones
[295.] 3.2.1 N14 CDR3 sequence: For all binding experiments, a single
clone was picked from the naive library (before selection). A phage stock and
a
soluble scFv, designated N14, were prepared from this clone. Sequence analysis
indicates that it belongs to the VH4-DP65 gene family. The sequence of the 11-
mer
VH-CDR3 encoded by this clone, designated N14 CDR3, is as follows (SEQ m
N0:28):
66
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
Phe Leu Thr Tyr Asn Ser Tyr Glu Val Pro Thr
[296.] 3.2.2 C181 CDR3 sequence: An additional negative clone, C181,
was used in the binding analysis experiments. Clone C181 (reactive to
recombinant
hepatitis B virus [HBV] particles) belongs to the VH3-DP35 family, and the
sequence
of the 9-mer VH-CDR3 encoded by this clone, designated C181 CDR3, is as
follows
(SEQ ID N0:29):
Thr Asn Trp Tyr Leu Arg Pro Leu Asn
EXAMPLE 4:
[297.] 4. Production, purification, labeling and characterization of
scFv clones
[298.] 4.1 Production of soluble scFv: pHENl, a vector used to
construct the original phagemid library, was designed with an amber stop codon
encoded at the junction of the scFv gene and the pIIl gene. Therefore, when
the
vectors of selected clones are introduced by phagemid infection into E. coli
HB215 l,
which is a non-suppressor strain, this system enables production and secretion
of
soluble scFv into the bacterial periplasm (Harrison et al., Methods in
Enzymology,
267, 83-109 (1996)). The scFv is then readily retrievable from the culture
broth.
Soluble scFvs are produced under the control of the lacZ promoter (Gilbert and
Muller-Hill, PNAS (US), 58, 2415 (1967)), which is induced with IPTG.
[299.] A sequence encoding c-myc tag (10 amino acids - Glu Gln Lys Leu
Ile Ser Glu Glu Asp Leu; SEQ ID NO: 123.) is contained in the vector upstream
to
the amber mutation. The C-terminus of the expressed scFv should carry the c-
myc
tag, which can be detected using mouse anti-myc tag antibodies (derived from
the
European Collection of Cell Culture (ECACC) 9E10-hybridoma).
[300.] 4.2 Purification of scFv on Protein-A beads affinity column:
The scFvs of selected clones and of the control clone C181 all belong to the
VH3
family, allowing purification on a Protein -A affinity column. Periplasmic
fractions
(100-250 ml) from induced cultures of each clone were prepared and incubated
with
67
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
Protein-A Sepharose beads. The bound scFvs were recovered from the column by
acid elution (0.1 M glycine, pH 3.0), followed by eluate neutralization with
Tris,
pH.8Ø The concentration of the recovered protein was determined by AZ$o
measurement, followed by PBS buffer exchange by dialysis or on a G-25
Sepharose
column.
[301.] 4.3 Purification of N14-scFv on a Sephacryl S-200 column: The
scFv of the negative clone N14 belongs to the VH4 gene family and cannot,
therefore,
be purified on a Protein-A affinity column. For scFv-N14 purification, total
protein in
the periplasmic fraction of a 200m1 induced culture was precipitated by 60%
ammonium sulfate. The pellet was resuspended in 2m1 O.IxPBS, SmM EDTA, SmM
PMSF and loaded on a Sephaeryl S-200 column (1.5 x 90cm) pre-equilibrated with
the running buffer (0.1 xPBS, SmM EDTA). Proteins were fractionated, and
fractions
containing the N14-scFv (as detected by SDS-PAGE and Western analysis) were
pooled, lyophilized, and suspended in 1/10 volume H20. The N14-scFv (unlabeled
and FITC-labeled) was then used as a negative control in FACS analysis
experiments.
[302.] 4.4. Labeling of purified scFvs with FITC: Approximately one
milligram of purified scFv from each preparation was resuspended in PBS and
coupled to FITC using a Fluoro-Tag FITC conjugation commercial kit (Sigma cat.
#FITC-1), according to the manufacturer's instructions.
[303.] 4.5 Quality Analysis of the purified and labeled scFv
[304.] 4.5.1 Following purification and FITC labeling, the profile of each
preparation (labeled and unlabeled) was analyzed by SDS-PAGE, Western
blotting,
HPLC using a Superdex-75 column (A280 and A495) and fluorometry. The analysis
indicated 80% purity of the N 14 scFv, and 90% purity for the V,.,3 clones,
with
approximately 2 molecules of FITC conjugated to each scFv molecule (F/P ratio
of
2:1).
[305.] 4.5.2 Binding activity following FITC labeling was assessed to
verify retention of scFv specificity (see Example S).
68
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
[306.] 4.6 Biochemical characterization of phagemid clones: Several
types of analysis were used to evaluate the structure and assess the purity of
the
various scFv preparations (see Example 8) including SDS-PAGE, mass
spectroscopy
(for Y1 and Y17 scFvs only), and HPLC. Western analysis and EIA were used for
identifying the scFv; and FACS was used to characterize scFv binding.
EXAMPLE 5:
[307.] 5. Binding assays
[308.] The binding of the selected clones to cells was evaluated at two
levels,
the phagemid level and the soluble scFv level.
[309.] 5.1 Binding at the phagemid level
[310.] To this end, a phagemid stock was prepared individually from each of
the selected clones.
[311.] 5.1.1 Colony test: In one set of experiments, a mixture of 10~
specific phagemids, derived from the biopanning protocol, which render
infected E.
coli ampicillin resistant, and 10" wild-type M13 phage, which do not carry
ampicillin
resistance and serve as a "Mocker", was incubated with 105 cells, chosen from
a panel
of cell types. Following incubation and washing, the bound phage were eluted
with
trypsin, and an aliquot was used to infect E. coli TG-I. The E. coli were then
plated
on 2xTY/AMP plates and incubated overnight at 30°C. The number of
colonies
obtained for each clone was calculated and compared. The results give a
measure of
the binding affinity and specificity of the phagemids.
[312.] 5.1.2 White/Blue colony test: In this test, in which each experiment
includes an internal control, the specific phagemid was mixed at the same
ratio as in
Section 5.1.1 above, i.e., 1/100, with another control phagemid designated
pGEM7
(Promega Corp., Madison, Wisconsin, USA). This pGEM7 phagemid carnes
resistance to ampicillin; however, it does not express any recombinant
polypeptide at
the N-terminus of its pIII gene. Following TG-1 infection and incubation on
ampicillin plates containing 1mM X-gal, colonies were enumerated. The colonies
69
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
obtained containing pGEM7 are blue, whereas the colonies obtained from the
specific
phagemids are white. The enrichment factor, derived from the ratio of
input/output of
the white/blue colonies (grown on the same plate) for each test tube, was then
calculated.
[313.] 5.1.3 EIA of phagemids
[314.] 5.1.3.1 Phagemid binding to selected cells: Approximately 5X105 of
the selected cells were fixed with acetone:methanol (1:1) on the surface of 24
well
plates. The binding test required 109 phagemids. Binding was carried out at
37°C for
lhr, followed by an extensive wash with PBS/Tween (0.05%). After extensive
washing with PBS, the plates were incubated with rabbit anti-M13, anti-rabbit
IgG-
HRP and substrate. The intensity of the color produced was read by an ELISA
plate
reader, at A4°5, and was proportional to the level of bound phagemids.
[315.] 5.1.3.2 Phagemid binding to fixed platelets: Polystyrene microtiter
plates were coated with 10g fixed platelets and were incubated overnight, at
4°C.
Approximately 101° phagemids were used for evaluating binding.
Washing and
incubation of plates and determination of binding level were carned out as
described
in 5.1.3.1 above.
[316.] 5.1.4 Binding assays to specific proteins, selected from the group
consisting of human growth hormone (hGH), fibrinogen, fibronectin, BSA, SM
(skim
milk) and glycocalicin (proteolytic fragment of GPIb), were performed. Binding
was
assayed in the following manner. Polystyrene microtiter plate wells were
coated with
one of the proteins to be tested, at 2 ~g/well. Coating was allowed to proceed
during
overnight incubation, at 4°C. Approximately 101° phagemids were
added to test
binding. After extensive washing with PBS, the plates were incubated with
rabbit
anti-M13, anti-rabbit BIRD, and substrate. The level of binding was measured
by the
intensity of color produced. The optical density was measured at A4°5.
Each sample
was assayed in duplicate, and the average was calculated.
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
[317.] 5.2 Binding Tests at the scFv level: Binding of the scFvs
produced in the periplasm of HB2151 was compared in several cell types by two
different assays, by EIA and by FACS analysis.
[318.] 5.2.1 EIA of soluble scFv: Approximately 5x105 AML cells were
incubated with 5-10 ,ug total protein. Binding was carried out at 4°C
for lhr, followed
by EIA, using mouse anti-myc antibodies, anti-mouse HRP, and a substrate.
Excess
unbound antibodies were removed after each step by washing cells three times
with
PBS. The intensity of the color produced is read by an ELISA plate reader
(O.D.aos).
As above, the color intensity is proportional to the level of binding.
[319.] 5.2.2 FRCS analysis of cells
[320.] 5.2.2.1 Analysis of cells stained by the "three-step staining"
procedure: FACS analysis was performed to test and confirm the specificity of
the
selected clones. Initially, a "three step staining" procedure was established,
using
crude extracts or purified unlabeled scFv, followed by mouse anti-myc
antibodies
and, finally, FITC- or PE-conjugated anti-mouse antibodies.
[321.] FACS analysis requires 5-8x105 cells, which have been Ficoll-purified
and resuspended in PBS+1% BSA. Binding was carned out for lhr at 4°C.
After each
step, cells were washed and resuspended in PBS+1% BSA. After the final
staining
step, cells were fixed by resuspending in PBS, 1% BSA, 2% formaldehyde, then
read
by FACS (Becton-Dickinson).
[322.] 5.2.2.2 Staining of cells with FITC-labeled scFv, in a single staining
step: FITC-labeled scFv was incubated with 5-8x105 Ficoll-purified cells in
PBS+1%
BSA. Binding was carned out for lhr at 4°C. Cells were then washed and
fixed as in
section 5.2.2.1 above, and read by FACS.
71
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
EXAMPLE 6: Panning and Sequencing Results
[323.] 6.1 Results of AM Protocol
[324.] 6.1.1 Panning Results for AM Protocol: The estimated number of
phagemids used for panning (input), and the estimated number of bound
phagemids
eluted in the AM protocol (output) are summarized in the following table
(Table 1):
Table 1. Panning results derived from protocol AM
M,..~
I ~~ n 4 ~ut 1f
o 1l ti t- ~ e~
k G ~F~l stock '
p
m ,source u , rm
n ut~st e o n i
e ~ ~:1~ ~
~ f
ix ~
.-
~
Nissim library-Membranes Bacterial 3x10 T16M1
of TG-1
2x10~~ AML
T16MI - Membranes Bacterial 6.4x10' T16M2
10" of TG- I
AML
T16M2- 10" Membranes Bacterial 10" T16M3
of TG-1
AML
T16M3 - AML cells T sin 2x10" T16M3.1
[325.] Note the enrichment in the yield (output) obtained with each
successive panning. In addition, there is no drop in the output when T16M3 was
used
to pan AML whole cells, suggesting that the bound phagemids are possibly
specific
for components on the external cell surface or that this specific system may
contain a
relatively high number of non-specific bound phagemids.
[326.] 6.1.2 Clone Sequence Results for AM Protocol: Although clones
were picked and sequenced from T16M1, T16M2 and T16M3 output stocks, the
results presented below are mainly of those clones that were derived from the
T16M3.1 output stock (AML intact cell panning). Clones AM10, AM11 and AM12
were identified in the T16M3 stock, but not in the subsequent output.
[327.] The amino acid sequences displayed in the V,.i-CDR3 and their
frequency in the tested clone output are summarized in Table 2.
Table 2. Selected clones following AM biopanning protocol, from the T16M3 and
T 16M3.1 outputs.
72
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
CloneVH- VH-CDR3 GermlinFrequencyFrequency
# sequence in
CDR a T16M3 in
3 output T16M3.1
size ou ut
AM1 8 Pro Trp Asp Asp Val Thr VH3- 5/31 8/51
Pro Pro DP47
1 2 3 4
5 6 7 8
AM2 12 Gly Phe Pro Arg Ile VH3- 11/31 20/51
Thr Pro Pro Ser Ala DP46
Glu Ile
1 2 3 4 5
6 7 8 9 10
11 12
AM3 5 Gly Phe Pro Met Pro VH3- 1/31 2/51
1 2 3 4 5 DP46
AM6 10 Gly Phe Pro His Ser VH3- 4/31 6/51
Ser Ser Val Ser DP46
Arg
1 2 3 4 5
6 7 8 9 10
AM7 11 Arg Phe Pro Met VH3- 3/31 4/51
Arg His Glu Lys Thr DP46
Asn Tyr
1 2 3 4 5
6 7 8 9 10
11
AMS 8 Arg Phe Pro Pro Thr VH3- 6/31 8/51
Ala Thr Iie DP46
1 2 3 4 5
6 7 8
AM9 7 Thr Gin Arg Arg VH3- 0/31 2/51
Asp Leu Gly DP87
I 2 3 4 5
6 7
AM10 11 Lys Phe Pro Gly VH3- 0/31 1/31
Gly Thr Val Arg DP46
Gly Leu Lys
1 2 3 4 5
6 7 8 9 10
11
AM11 12 Gly Phe Pro Val lie VH3- 0/31 1/31
Val Glu Gln Arg DP49
Gin Ser Thr
1 2 3 4 5
6 7 8 9 10
11 12
AM12 10 Arg Phe Pro Gin VH3- 0/31 1/31
Arg Val Asp Asn DP46
Arg Val
1 2 3 4 5
6 7 8 9 10
[328.] The amino acid sequence of Ar~/~,yPhePro is present in seven of the
ten isolated clones presented in Table 2, and represents a motif therein. In
addition,
note that the identified motif represents the N-terminal three amino acids of
the CDR3
region in each case. Accordingly, this motif may be an effective anchor or
binding
73
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
site on its own or in combination with other amino acid residues extending
beyond
either one or both ends of the CDR3 region or as part of a larger peptide or
polypeptide or Fv molecule.
[329.] Other CDR3 regions with high affinity for binding to AML cells may
be constructed based on the core sequence Arg/G,yPhePro. They may be
constructed
by varying any of the above 5-12-mers by additions, deletions or mutations,
while
maintaining the A~~/G,yPhePro core sequence.
[330.] CDR3 regions of the invention have the amino acid sequence Rl-
''rg/~,yPhePro-R2, where Rl comprises 0-15 amino acids, preferably 0-9, most
preferably 0-1 amino acid and R2 comprises an amino acid sequence from 1-15
amino acids, most preferably 1-9 amino acids. R1 and R2 are amino acid
equences
that do not adversely affect the specific binding of the A'g/G,yPhePro
sequence to
AML cells.
[331.] The CDR3 region of the light chain of the above clones is identical and
is recited in SEQ ID NO: 125.
[332.] 6.2 Results of YPR and YPNR Protocols
[333.] 6.2.1 Panning Results for YPR and YPNR Protocols: The
estimated number of phagmids used for panning (input) and the estimated number
of
bound phagemids eluted (output) are summarized in the following tables (Tables
3,
4).
Table 3. Panning results derived from the YPR protocol.
w ~.u ~ ... .
In~pua sfiock _. O.u.tput~lmpli~fied
-b~' Elution s~t~ock
Nissim librarYlO"Acid 10' Rl(a)
T sin 4x 10' Rl(t)
Pooled [R1(a) Acid SxlO' R2
-10",
+ Rl t -1012
R2 -10 Acid 3x10 R3
74
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
[334.] Table 3 demonstrates that trypsin elution yields a 4-fold greater
output
as compared to acid elution in the first round.
[335.] Re-panning according to the YPNR protocol without the amplification
step minimized the possibility of preferentially amplifying phagemid infection
or
bacterial infection. The resulting output is depicted in Table 4.
Table 4. Panning results derived from the YPNR protocol.
... . " ~~ f( -
nput stock T ~~E~lu3tionOutput E~lutton
~~~ s stock
.~n a~
Nissim librarYlOAcid 3x10 YPNRl
YPNR1-3x10' Acid 4x10 YPNR2
YPNR2-4x10 Acid 10~ YPNR3
~
[336.] As expected, the results presented in Table 4 show a decrease in.phage
yield after each round of panning. This protocol was used in order to prevent
bias due
to amplification of nonspecific phage.
[337.] 6.2.2 Clone Sequence Results for YPR and YPNR Protocols:
Several clones from the third panning from both protocols were selected for
sequencing. The amino acid sequences presented in Table S are those of the
CDR3
regions of the heavy chain (VH-CDR3). The germline and the frequency with
which
the sequences appeared in the R3 output are also indicated in this table.
Table 5: Selected Y-series clones following the YPR biopanning protocol with
the
R3 output.
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
@lone ,~-CDRr3 Vn-,,CDR3 Germline requeney
# - ize sequence
a
Y1 6 Met Arg Ala Pro VM-DP32 14/30
Val Ile
1 2 3 4
5 6
Y16 6 Thr Gly Gln Ser VH3-DP26 1/30
Ile Lys Arg Ser
1 2 3 4
5 6 7 8
Y17 6 Leu Thr His Pro VH3-DP32 7/30
Tyr Phe
1 2 3 4
5 6
Y-27 6 Leu Arg Pro Pro VH3-DPS2 3/30
Glu Ser
1 2 3 4
5 6
Y-44 11 Thr Ser Lys Asn Thr VH3-DP32 2/30
Ser Ser Ser Lys
Arg His
1 2 3 4
5 6 7 8
9 10 11
Y-45 12 Arg Tyr Tyr Cys Arg VH3-DP49 1/30
Ser Ser Asp Cys
Thr Val Ser
1 2 3 4
5 6 7 8
9 10 11 12
Y-52 10 Phe Arg Arg Met VH3-DP49 1/30
Gln Thr Val Pro
Ala Pro
1 2 3 4
5 6 7 8
9 10
[338.] The majority of isolated clones from the YPNR protocol were Y1 as
well.
[339.] The CDR3 region of the light chain of the above clones is identical and
is recited in SEQ ID NO: 125.
EXAMPLE 7:
[340.] 7. Results of Binding Evaluation
[341.] 7.1 Binding of selected phagemid clones to AML cells (AM
clone series): The binding assay for assessing phagemid binding to cells, the
White/Blue colony test as described in Example S, was performed with the AM
clones. With the exception of clone AM7, no preferential binding to the tested
cells
76
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
was detected. Significant, but non-selective, binding of clone AM7 to all
target cells,
either as a phagemid or purified scFv, was observed. Results demonstrate no
enrichment for the AM clone series.
[342.] 7.2 Binding of Y Clone Series
[343.] 7.2.1 Phagemid binding - EIA using fixed platelets: After three
rounds of panning using two different protocols, phage clones were tested by
EIA for
binding to fixed platelets. Phagemid stock was prepared from each of the
selected
clones, and these clones were tested in two sets of EIA. Each sample was
assayed in
duplicate, and the average, was calculated. The results are summarized in
Figure I
and indicate that six of the nine Y-series clones show a positive EIA
reaction. The
highest degree of binding was associated with clones Y1, Y16, Y17, and Y-27.
Phage
stocks M13 (wild-type bacteriophage) and E6 (selected on CLL leukemia cells)
were
used as negative controls. The dominant clone, phage Yl, showed the highest
binding
to fixed platelets and, together with Y17, showed significantly higher binding
than M
13 or E6 phage clones.
EXAMPLE 8:
[344.] 8. Detailed characterization of scFvs and clone binding
[345.] 8.1 Structure and identification of scFv: The native structure of
Y-I was assessed by HPLC analysis with a Superdex 75 column and by mass
spectroscopy. Results of the former method indicate the presence of monomers,
dimers, and tetramers in the preparation. Mass spectroscopy was sufficiently
sensitive to identify the expected molecular weight of 26.5 kD and, in cases
in which
the c-myc tag was cleaved, a molecular weight of 24 kD was obtained.
[346.] Results of SDS-PAGE, however, indicate that the intact, non-cleaved
molecule has an apparent molecular weight of 30 kD, despite the expected
molecular
weight is 26.5 kD, according to the nucleic acid sequence and to the mass
spectroscopy results above. Western analysis using c-myc-specific antibodies
confirmed the SDS-PAGE 30 kD results and supported the implication that the c-
myc
77
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
tag is present on the end of the intact molecule. The discrepancy between the
results
of the two procedures is due to the level of precision of the methods as well
as the
running conditions of SDS-PAGE that can alter the apparent molecular weight of
the
tested protein.
[347.] 8.2 Binding of platelet-selected clones to leukemic cells: As
noted in the introduction, platelet cell surface markers may be expressed on
premature
hernatopoietic cells. The binding of platelet-selected clones was tested by
FACS
analysis. FACS analysis was performed after staining whole blood, followed by
RBC
lysis, or on Iso-prep- (Ficoll cushion) purified mononuclear cells. ScFvs were
prepared from each clone, purified on protein-A, and FITC labeled (as
described in
Sections 4.1-4.4). In order to enable production of intact scFv in the non-
suppressor
E. coli strain HB2151, the amber codon (TAG) found in the VH-CDR3 of the Y-27
clone was mutated by DNA site-directed mutagenesis to code for glutarnic~ acid
(GAG). The target cells for such studies were cells isolated from fresh blood
samples
of various patients with leukemia. The samples were obtained from three
Medical
Centers in Israel.
[348.] Clones Y1 and Y17 showed preferential binding to the leukemia cells
tested whereas all the other Y-series clones gave binding at background levels
only.
Table 6 presents the binding of FITC-labeled Y- I and Y- 17 to a variety of
leukemic
cells.
Table 6. Y- I binding specificity for leukemia cells.
B cell lineage
N14/C18 ~ 0/68 0/6 ~ 0/6 ~ 0/6 ~ 0/5 ~ 0/3 ~ 0/18
1
Y1 54/68 2/6 1/6 3/6 4/S 2/3 0115
Y17 3/3 N.D.* 1/1 2/2 N.D.* N.D.* 11/11
*Not determined
78
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
[349.] The results, presented as fractions in Table 6, represent the fraction
of
patients, the cells of who were identified by FACS analysis as positively
reacting with
each tested antibody. The numerator represents the number of positive
patients, with
the denominator density the total number of patients tested for a given
scFv/cell type
combination. Y- 17 bound strongly to all tested cells; this binding was thus
considered to be non-cell selective. However, Y1 binding was found to be
highly
selective for several specimens of leukemic cells, especially those in the
acute phase.
Y1-scFv binding was further analyzed as described below.
[350.] Representative results of YI binding to three AML samples are
presented in Figure 3. In each case, a large proportion of the cell population
fluoresces at a significantly higher intensity than that of the background
fluorescence
obtained by staining with the negative control scFv. These results indicate
that, for
each patient, Y1 binds to a different fraction of the total cell population.
The right-
hand Y-I peak in each graph is believed to represent the minimum number of Yl-
binding cells in the population, with the proportion of the total cells under
this peak
most likely representing the minimum proportion of YI -binding cells in each
sample.
[351.] 8.3 Binding of Y-I to normal blood cells: Y1 binding to Ficoll
purified normal blood cells was analyzed according to the different blood cell
types.
Although no binding to normal lymphocytes was detected, Y1 bound to Ficoll
purified monocytes from 9/28 subjects, platelets from 5/8 subjects, and red
blood cells
(RBC) from 1/4 subjects. However, CD14-specific antibodies bound to cells in
all of
the monocyte preparations and in many of the neutrophil preparations. A
summary of
this analysis is presented in Table 7.
Table 7. FACS analysis of scFv binding to Ficoll-purified normal blood dells.
AntibodyI,yniph.oc-.ytesM~onoey~tes~hFeu~ttrophils3 latefe'~ts'~4~,~~ aCs
N 14 0/ 18 0/4 0/4 0/3 0/4
Y1 0/28 9/28 0/4 S/8 1/4
CD14 0/15 14/14 8/14 0/5 0/4
79
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
[352.] These binding results represent the fraction of normal blood samples
that were identified by FACS analysis as positively reacting with each tested
antibody. Note that, although selected on fixed platelets, FITC-Y1 scFv shows
relatively low binding aff- nits to platelets.
[353.] Figure 4 demonstrates the binding of Yl to Ficoll-purified platelets
(4a)
and to monocyte-gated cells (4b). The shift on the monocyte cell population is
greater
than that observed on platelets, with a calculated mean fluorescence 30-fold
and 5-
fold greater, respectively, than the negative control. This observation is
most
probably due to the characteristic of platelets to adhere in multiples to
Ficoll-purified
monocytes. Subsequent experiments showed that, when assayed in whole blood
samples, no Y1 binding was observed in any of the normal monocytes,
granulocytes,
platelets or RBC tested. Similarly, no Y1 binding to platelets was observed
when
derived from platelet-rich plasma (PRP). Under the same binding conditions (in
whole blood, followed by RBC lysis with FACS lysing solution [Becton
Dickenson]),
Y1 bound to leukemia cells in a manner similar to that obtained after Ficoll
purification. We may therefore conclude that, under natural conditions, the Y-
I
epitope on platelets or monocytes is hidden. During the Ficoll purification
procedure
the epitope is exposed, making it accessible for recognition by Y1, whereas
for
leukemic cells the epitope is exposed under both purified and non-purified
conditions
[354.] In addition to normal hematopoietic cell progenitors of the lymphatic
and myeloid lineages, Y1 binding to hematopoietic stem cells (CD34+ cells) in
cord
blood was tested. Figure 5 presents the binding results of FITC-labeled scFv
clones
to cord-blood CD34+ stem cells; Figure 5a presents the results of binding of
CD34+
gated cells to the FITC-labeled negative control scFv, and Figure 5b presents
the same
analysis for binding of CD34+ gated cells to FITC-labeled scFv clone Y1.
Figure 5c
presents a FSC and SSC dot plot analysis of the same FITC-labeled scFv clone Y-
I
sample as in 5b. Results of this analysis indicated the presence of two CD34+
stem
cell sub-populations derived from cord blood, with differences in forward
scatter
(FSC) an indication of cell size. Y1 binds to the smaller sized cells of the
two
populations. The circled areas in Figures 5b and 5c delineate the sub-
population of
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
CD34+ cells that bind the clone Y1 scFv. Further analysis indicated that the
smaller
sized cells are dead cells that are present in the cell population, and Y1
binding may
possibly indicate the presence of an intracellular ligand recognized by Y1.
[355.] The experiment was performed on peripheral blood cells of GM-CSF
pre-treated healthy donors (GM-CSF treatment mobilizes stem cell release into
the
bloodstream) as well. Results similar to those presented in Figure 5 were
obtained.
[356.] 8.4 Binding specificity of Yl scFv compared to various cell
markers on AML cells: Y1 staining of Ficoll-purified peripheral cells and bone
marrow cells from AML patients was compared to staining of those cells by a
panel
of other antibodies. Results of such FACS analyses, for samples obtained from
14
patients, are summarized in Table 8. Note that there is significant
variability in the
frequency of stained cells in preparations from various individuals for all of
the
markers tested, including Yl. Lack of correlation between the binding of
various
markers and that of Yl suggests that Yl does not bind to any of the ligands
that are
bound by the other tested markers, and that the Y- I ligand does not
constitute any of
the tested sell surface markers.
81
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
Table 8. Comparison of Y1 scFv binding with binding of antibodies to various
cell
markers
~'1 C CD CD;
aaient s 4 ~ CD34 BN/ B
3 33 a **
1 0 ND 2.5 47 4 PB
2 34 88 0 80 83 PB
3 66 100 20 87 9 BM
4 86 83 2 73 3 BM
100 100 0 100 0 BM
6 0 72 0 49 1 BM
7 59 20 93 100 0 BM
8 40 86 40 48 6.5 BM
9 70 75 67 75 1 PB
25 24 55 82 5 PB
11 26 76 17 83 52 PB
12 60 40 60 94 ND PB
13 17 ND 13 75 15 PB
14 0 24 27 70 0 BM
**BM/PB- bone marrow/penpheral blood
[357.] The results are expressed as the percentage of cells in Ficoll-purified
samples of a given patient, which was identified by FACS analysis as
positively
reacting with each individual antibody.
[358.] In light of the concentration of Yl (~l~g/Sx105) required for binding
detection, the results indicate that Yl scFv has a relatively high binding
affinity to the
specific ligand on AML cells.
[359.] In addition to the results presented in Table 8, which show binding of
Y1 to AML cells, we have shown above (Table 6) that Y1 can also bind to most
other
types of leukemia cells tested, including B-ALL cells, although the sample
size for
these other leukemia specimens was limited. Figure 6 presents a FACS analysis
of Yl
scFv binding to pre-B-ALL cells obtained from two patients. A double staining
procedure, using either a commercially available PE-labeled CD 19 (a marker
for
normal peripheral B-cells; Figure 6a, 6c) or a PE-labeled CD34 (a marker for
stem
cells; Figure 6d) was employed, together with a FITC-labeled negative control
scFv
or FITC-labeled Yl scFv. Figure 6b is a double negative control. Fluorescence
intensity (x-axis) of cells bound by the FITC-labeled sample (scFv clone Y1),
relative
to the negative control-staining pattern, is presented (6e and 6f). The
results of Figure
82
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
6 demonstrate that most of the leukemic, pre-B-ALL cells within each of the
two
samples tested are positive for Y1 cell staining due to Y- I binding.
[360.] 8.5 Binding of Yl-scFv to cell Lines: Several cell lines.derived
from malignant hematopoietic lineages were screened for their ability to be
recognized by Yl. FACS analysis indicates that Y1 binds to many of the tested
cells
(Table 9). Note that only one human B-cell line and one mouse myeloid cell
line was
tested. Importantly, this binding was restricted to exponentially growing
cells. Cells
in stationary phase generally did not bind to Y1, indicating that Y1 ligand
expression
is regulated during the life cycle of the cells. Additionally, binding
strength differs
among the reacting cells. This observation implies that there are differences
in
expression levels or in affinity of the ligand in different cells.
Table 9. Binding Of Yl To Hematopoietic Cell Lines
_.,. .~ ~~~~ ,
~. , ~, ~ ~4 9. '~ ' ~ _~: ~' w~Reaefive~
~~ Reactive Medmm Reacttye Lo
" a : Hi h
~ ;
T '
, . .
: . ~ -
., y_~ .z ~ ,~ .: . f:.
v~ .. b ~ . a ~
,~ ~
YP ,g,:.n.
~ ~
~ k~~> ~~~ ~ ~.~, ~~~ ~~...~.
,~ ~i . x~~~ ~ . . r, ;~. .~.~
, : M~~
Human MyeloidKG-1; THP-l; HL-60; HEL; K-562;NB-4
U937;
Tf 1; MEG MC1010
Human B-cell Namalwa; Daudi;
UMUC3,ItAJI
Human T-cellJurkat; Hs-602 CCRF-CEM; Molt-4;
Hut-78;
Mouse Myeloid M1; P388D1;
PUS-
1.8;
WEHI-274.1
[361.] 8.6 Binding of Y1 purified in the presence of DTT: Once the Y1
clone was selected, the process for producing the scFv was further developed.
Results
of FTLC analysis of the Y1 batches indicated that the protein may multimerize
with
mainly monomers and tetramers forming, the ratio between the two forms
differing
from one preparation to the next. In order to obtain homogeneous material, SmM
DTT was added during the affinity purification on Protein-A sepharose column,
followed by removal by PBS buffer exchange. Indeed, after DTT treatment, most
(>90%) of the material was found in the monomeric fraction. No significant
difference was found between the binding of the monomeric form of Y1 (purified
in
the presence of DTT and analyzed on HPLC) and the binding of the mixture of Y1
forms.
83
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
[362.] 8.7 Yl is a specific clone to leukemia cells: The Y1 cassette
belongs to the VH-DP32 germline. Several other clones, originating from the
same
germline, were isolated and are detailed in Example 6. These clones include
Y17, Y-
27, and Y-44. The primary sequences (i.e., germline cassette) of all these
clones
differ in their CDR3 regions only. However, only Y1 shows selectivity to
leukemic
cells. The CD3 ,sequences of these clones are summarized in Table 10, and the
binding profiles of the clones are summarized in Table 11.
Table 10: The CDR3 sequence of VH3-DP32 isolated clones
fi ~ x a2 ~,~.Y.1
Clone ~''~"i's~ ~ Germime
# ~'"~e,~"'~" ,~~N~-"~
;a '~~,.,
CDR3T~sequence
~ .
_~ ~ ~
V
: H ~
v ,~~_ / ~~p
;. ~
~
.
,
~.
~
Yl Met Arg Ali Pro Val Ile VH3-DP32
1 2 3 4 5
6
Y17 Leu Thr His Pro Tyr Phe VH3-DP32
1 2 3 4 5
6
Y-27 Leu Arg Pro Pro Glu Ser VH3-DP32
1 2 3 4 5
6
Y-44 Thr Ser Lys Asn Thr Ser VH3-DP32
Ser Ser Lys Arg His
1 2 3 4 5
6 7 8 9 10
11
Table 11: Binding profile of VH3-DP32 isolated clones
'~,~ .. '"'T~ ~ ~,y q~ '~p'~ ~tL'~t ~~
~ ~ ~~ 1~ ',,
Clone,#
, y,
BincLngspecWc~t~y. ~ a
Yl Binds to man lukemia cells.
Y17 Binds to all tested hematopoeitic
cells, including
normal l m hoc tes.
Y-27 Does not bind to any of the hematopoietic
cells
tested.
Y-44 Does not bind to any of the hematopoietic
cells
tested.
[363.] Tables 10 and 11 indicate that, although the primary sequences are
identical among the four clones with the exception of the VH-CDR3 region, the
binding profiles differ significantly from one clone to another. This
observation
reinforces the concept that the sequence of the VH-CDR3 region plays an
important
84
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
role in the specificity of the binding site to the antigen. Note that neither
the length of
the CDR3 sequence nor the specific gerrnfirie cassette in which it is placed
appears to
be a primary determinant of binding specificity. Y17 and Y-27 each comprises a
ti-
mer CDR3, as does Y1, and heavy chains of all three clones are derived from
the
identical germline. In the case of Y17 and Y-27, selective binding to
hematopoietic
cells has not been demonstruted.
F.x a wrpl .F. 4
[364.] 9.1 Construction of triabodies: The vector pHEN-Y1, encoding
the original Yl, was amplified using PCR for both the VL and the VH regions,
individually. The sense oligonucleotide 5'-
AACTCGAGTGAGCTGACACAGGACCCT, and the anti-sense oligonucleotide
S'-TTTGTCGACTCATTTCTTTTTTGCGGCCGCACC were used for the VL PCR
reaction. The cDNA product of the expected size of 350 by was purified,
sequenced,
and digested with XhoI and NotI restriction enzymes.
[365.] The same procedure was employed to amplify the VH region (using the
sense oligonucleotide 5'-ATGAAATACCTATTGCCTACGG and anti-sense
oligonucleotide S'-AACTCGAGACGGTGACCAGGGTACC). The VH PCR product
was digested with NcoI and XhoI restriction enzymes. A triple ligation
procedure
into the pHEN vector, pre-digested with NcoI-NotI, was employed. The final
vector
was designated pTria-Y 1. .
[366.] Following E. coli transformation, several clones were picked for
further analysis, which included DNA sequencing, protein expression, and
extraction
from the periplasmic space of the bacteria. SDS-PAGE under reducing conditions
and Western blot analysis were performed to confirm the size of the Y1
triabodies.
[367.] 9.2 Construction of diabodies
[368.] The pTria-Y1 vector from above was linearized with XhoI restriction
enzyme, and synthetic complimentary double stranded oligonucleotides
(5'-TCGAGAGGTGGAGGCGGT and 5' TCGAACCGCCTCCACCTC) were
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
pre-annealed and ligated into the XhoI site, between the Y1-heavy and Y1-light
chains. This new vector was designated pDia-Yl. As described for the
triabodies, the
DNA sequence and protein expression was confirmed.
[369.] 9.3 Expression and purification of diabodies and triabodies
[370.] Expression in E-coli was essentially as described above for the
scFv-Yl. However, the purification of Y1 diabodies and triabodies from the
periplasm of the transformed E.coli cells was different. The scFv Y1 monomer
form
can be purified on an affinity column of Protein-A Sepharose beads. Multimeric
forms of Y1 are, however, ineffectually purified by this procedure. Therefore,
periplasmic proteins extracted from the bacteria were precipitated over-night
with
60% ammonium sulfate, resuspended in H20, and loaded onto a Sephacryl-200
(Pharmacia) size exclusion column pre-equilibrated with O.1.xPBS. Fractions
were
collected and analyzed by HPLC, and separate fractions containing either the
dimer or
timer forms were collected for FITC labeling and FACS analysis.
[371.] 9.4 Binding of Y1 diabodies and triabodies to cells
[372.] FACS analysis was performed on Jurkat cells using a "three step
staining procedure." First, crude extracts or purified unlabeled scFv are
stained, then
mouse anti-myc antibodies, and finally, FITC- or PE-conjugated anti-mouse
antibodies. FACS analysis requires 5-8x105 cells, which have been Ficoll-
purified and
resuspended in PBS+1 % BSA. Binding was carried out for 1 hour at 4°C.
After
each step, cells were washed and resuspended in PBS+1% BSA. After the final
staining step, cells were fixed by re-suspending in PBS, 1 % BSA, 2 %
formaldehyde,
and then read by FACS (Becton-Dickinson).
[373.] The binding of Y1-scFv was compared to that of diabodies and
triabodies. In this analysis (Figure 7, the binding profile of all three forms
was very
similar, indicating that the above modifications in the molecule did not
alter, conceal
or destroy the apparent binding affinity of Y1 to its ligand.
86
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
[374.] 9.5 Production of Yl-cys-kak (cysteine dimer)
[375.] One liter of ~,pL-yl-cys-kak bacterial culture was induced at
42°C for
2-3 hrs. This culture was centrifuged at 5000 RPM for 30 minutes. The pellet
was
resuspended in 180 mls of TE (SOmM Tris-HCl pH 7.4, 20mM EDTA). 8 mls of
lysozyme (from a 5 mg/ml stock) was added and incubated for 1 hr. 20 mls of SM
NaCI and 25 mls of 25% Triton was added and incubated for another hour. This
mixture was centrifuged at 13000 RPM for 60 minutes at 4° C. The
supernatant was
discarded. The pellet was resuspended in TE with the aid of a tissuemiser (or
homogenizer). This process was repeated 3-4 times until the inclusion bodies
(pellet)
were gray/light brown in color. The inclusion bodies were solublized in 6M
Guanidine-HCI, O.1M Tris pH 7.4, 2 mM EDTA (1.5 grams of inclusion bodies in
10
mls solubilization buffer provided ~10 mg/ml soluble protein). This was
incubated
for at least 4 hrs. The protein concentration was measured and brought to a
concentration of 10 mg/ml. DTE was added to a final concentration of 65 mM and
incubated overnight at room temperature. Re-folding was initiated by dilution
of 10
mls of protein (drop by drop) to a solution containing 0.5 M Arginine, 0.1 M
Tris pH
8, 2 mM EDTA, 0.9 mM GSSG. The re-folding solution was incubated at
~10° C for
48 hrs. The re-folding solution containing the protein was dialyzed in a
buffer
containing 25 mM Phosphate buffer pH 6, 100 mM Urea, and concentrated to 500
mls. The concentrated/dialyzed solution was bound to an SP-sepharose column,
and
the protein was eluted by a gradient of NaCI (up to 1M).
[376.] 9.6 A Study of the Affinity of the S-S Yl-Dimer in
Comparison to CONYl and Yl-IgG, using a Radioreceptor Binding Assay
(RRA) with KG-1 Cells
[377.] The assay system involved the use of radioactive ligands that were
prepared by iodination with l2sl using chloramine T on the Yl-IgG construct or
the
Bolton-Hunter reagent on the CONY1 (the Yl scFv) construct. The assay tubes
contained Sx106 KG-1 cells per 0.2 ml and a labeled tracer with varying
amounts of
unlabeled competitor, in PBS + 0.1 % BSA, pH 7.4. After 1-hour incubation with
87
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
agitation at 4°C, the cells were thoroughly washed with cold buffer and
taken for
radioactivity counting.
[378.] In the 1ZRA study using labeled Y1-IgG, a 2 ng/tube of lzsl-Y1-IgG
was used, and competition was performed with each of the three molecules. The
results are provided in Figure 8. This results presented in this figure
demonstrate that
the affinity of the S-S Y1 dimer was 30 times higher than that of CONY1. A
rough
estimate of the affinity of the Y1-IgG in this experiment is 2x 10-8 M. The
corresponding affinity of the dimer is, therefore, 4 x 10-g M.
[379.] In a second 1RRA using labeled CONY1, a 100 ng/tube of lasl-Y1-IgG
was used, and competition was performed with each of the three molecules. The
results are provided in Figure 9. This figure shows that the affinity of the S-
S dimer
was 20 times higher than that of CONY1. A rough estimate of the affinity of
CONY1
in this experiment is 10-6M. The corresponding affinity of the dimer is,
therefore, Sx
10-8 M.
[380.] 9.7 ELISA to GC (glycocalicin)
[381.] 100 ~1 of purified glycocalicin was incubated in a 96 flat well
maxisorp plates, overnight at 4°C. The plate was washed with PBST
(PBS+0.05%
tween) 3 times, then 200 ml of PBST-milk (PBST + 2% Non fat milk), for 1 hr at
room temperature. The plate was washed with PBST, and the monomer or dimer
(100
~1) was added in PBST-milk at different concentrations for lhr at room temp.
Then
the plate was washed and anti-VL polyclonal (derived from immunized rabbits
with
VL derived from Y1) (1:100 diluted in PBST-milk) was added for an hour. The
plate
was washed and anti-rabbit HRP was added for an additional hour. The plate was
washed 5 times and 100 ~1 TMB substrate was added for approximately 15 minutes
then 100 ~1 of 0.5 HZS04 was added to stop the reaction. The optical density
of the
plate was measured at 450nm in an ELISA reader.
88
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
[382.] 9.8 Y1 reactivity with recombinant glycocalicin (GC) expressed
in Prokaryotic (E. coh~ system
[383.] The DNA fragment encoding the N-terminal soluble part of human
platelet GPIb - glycocalicin (GC, amino acid 1 to amino acid 493) was cloned
into an
IPTG inducible prokaryotic vector cassette. E. coli (BL21 DE3) cells harboring
the
newly constructed plasmid were grown at 37°C to O.D. 0.7-0.8, than at
37°C for 3
hours for in the presence of IPTG for induction. SDS-polyacrylamide gel loaded
either with natural semi-purified human platelet derived GC or with E. coli
cell
lysates (total protein content) derived from induced and non-induced cells
were
analyzed. Western blot analysis was performed with scFv Y1-biotinylated,
polyclonal
rabbit anti-human GC antibody, commercially available mouse anti human CD42
monoclonal antibody (SZ2 Immunotech, PM640 Serotec, HIP1 Pharmigen, AN51
DAKO) and polyclonal antibody against the N-terminus of gplba (Sc-7071, Santa
Cruz). The two polyclonal antibodies recognized both the recombinant bacterial
derived GC as well as the natural human platelet derived GC. The scFv Y1 and
the
commercially available antibodies recognized only the natural human derived
GC, but
not the bacterial derived recombinant platelet GC.
[384.] Post-translational modification, such as glycosilation and sulfation is
essential for scFv and commercially available antibodies binding to GC. The
prokaryotic (E.coli) system lacks post-translation modification mechanisms,
such as
glycosilation and sulfation.
[385.] 9.9 Making tetramers of Yl
[386.] A construct was designed where the following sequence,
LNDIFEAQKIEWHE, was added at the C-terminus of the Y1 by PCR and cloning
into a IfTG inducible expression system. The clone was named Y1-biotag. This
sequence is a substrate for the enzyme BirA, that in the presence of free
biotin, the
enzyme is capable of covalently connecting biotin to the lysine (K) residue
(Phenotypic analysis of antigen-specific T lymphocytes. Science. 1996 Oct
4;274(5284):94-6, Altman JD et al). This construct was produced as inclusion
bodies
in BL21 bacterial cells. Refolding was performed as described previously.
Inclusion
89
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
bodies were solubilized in guanidine-DTE. Refolding was done by dilution in a
buffer containing arginine-tris-EDTA. Dialysis and concentration was performed
followed by HiTrapQ ionic exchange purification.
[387.] The purified Y1-biotag scFv was incubated with BirA enzyme
(purchased from Avidity) and biotin as recommended by the provider. The
biotinylated Y1-biotag was analyzed by HABA test (that estimates the amount of
biotin per molecule) and demonstrated that there was around >0.8 biotin
residues/molecule.
[388.] The Y1-biotag biotinylated was incubated with Streptavidin-PE
(Phycoerytrin) to form complexes and used in FACS experiments using KG-1 cells
(positive for Y1). Streptavidin can bind up to 4 biotinilated Y-1-biotag
molecules.
The sensitivity of the binding was increased at least 100 fold due to the
increase in
avidity.
[389.] The sequence of Y1-biotag is as follows:
1 MEVQLVESGG GVVRPGGSLR LSCAASGFTF DDYGMSWVRQ
41 APGKGLEWVS GINWNGGSTG YADSVKGRFT ISRDNAKNSL
81 YLQMNSLRAE DTAVYYCARM RAPVIWGQGT LVTVSRGGGG
121 SGGGGSGGGG SSELTQDPAV SVALGQTVRI TCQGDSLRSY
161 YASWYQQKPG QAPVLVIYGK NNRPSGIPDR FSGSSSGNTA
201 SLTITGAQAE DEADYYCNSR DSSGNNVVFG GGTKLTVLGG
241 GGLNDIFEAQ KIEWHE
[390.] EXAMPLE 10: Construction of full sized Yl-IgGI
[391.] Whole IgG molecules have several advantages over the Fv forms,
including a longer half life in vivo and the potential for inducing an in vivo
cellular
response, such as those mediated by ADCC or CDC (complement dependent
cytotoxicity; Tomlinson, Current Opinions oflmmunology, 5, 83-89(1993)). By a
molecular cloning approach that is described below, we have converted the Y1
Fv
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
regions into full sized IgGI molecules. Yl-IgGl construction was accomplished
by
joining fragments of cDNA to each other in the following order:
[392.] 10.1 A leader sequence compatible for a mammalian expression
system: An exchangeable system was designed to allow convenient insertion of
elerAents required for a full IgG molecule. The following complimentary double
stranded oligonucleotides encoding a putative leader sequence were
synthesized,
annealed, and ligated into the XhoI site of mammalian expression vector (under
the
SRaS promoter).
S'-
TCGACCTCATCACCATGGCCTGGGCTCTGCTGCTCCTCACCCTCCTCACTC
AGGACACAGGGTCCTGGGCCGAT
and
5'-
GATCGATTGCACCAGCTGGATATCGGCCCAGGACCCTGTGTCCTGAGTGA
G GAGGGTGAGGAGCAGCAGCCCAGGCCATGGTGATGAGG. Upstream of
the initiation ATG codon, two Kozak elements were included. In addition, an
internal
EcoRV site was introduced between the putative cleavage site of the leader
sequence
and the XhoI site to allow subcloning of the variable regions. This modified
vector
was designated pBJ-3.
[393.] 10.2 The VL encoding sequence derived from the Y1 scFv cDNA
sequence was inserted between the leader and the constant light region-
encoding
sequence. Similarly, the VH encoding sequence derived from the Y1 scFv cDNA
sequence was inserted between the leader and the constant heavy region-
encoding
sequence. This was accomplished by PCR amplification of the vector pHEN-Y1,
encoding for the original Y1, to obtain the VL and the VH regions,
individually.
[394.] 10.3 The oligonucleotides
5'-TTTGATATCCAGCTGGTGGAGTCTGGGGGA (sense) and
S'-GCTGACCTAGGACGGTCAGCTTGGT (anti-sense) were used for the VL PCR
reaction. The cDNA product of the expected size of 350 by was purified,
sequenced
and digested with EcoRV and AvrII restriction enzymes. The same procedure was
91
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
employed to amplify and purify the VH cDNA region, using the sense and the
anti-
sense oligonucleoitides
5'-GGGATATCCAGCTG(C/G)(A/T)GGAGTCGGGC
and
5'-GGACTCGAGACGGTGACCAGGGTACCTTG, respectively.
[395.] 10.4 Constant regions: The constant ~,3 (CL- 7~3) region and the
constant heavy regions CH1-CH3 derived for IgGI cDNA were individually
synthesized as follows:
[396.] 10.4.1 For the constant CL-~,3 region, RT-PCR was
performed on mRNA extracted from a pool of normal peripheral B-cells (CD 19+
cells) in combination with the sense 5'-CCGTCCTAGGTCAGCCCAAGGCTGC and
the anti-sense 5'-TTTGCGGCCGCTCATGAACATTCTGTAGGGGCCACTGT
oligonucleotides. The PCR product of the expected size 0400 bp) was purified,
sequenced, and digested with AvrII and NotI restriction enzymes.
[397.] 10.4.2 For the constant IgGI regions (y chain), a human B
cell clone (CMV - clone #40), immortalized at BTG, was selected for PCR
amplification. This clone was shown to secrete IgGl against human CMV and was
also shown to induce ADCC response in in-vitro assays. For the CHl-CH3 cDNA,
oligonucleotides 5'-
CCGCTCGAGTGC(T/C)TCCACCAAGGGCCCATC(G/C)GTCTTC (sense) and 5'-
TTTGCGGCCGCTCATTTACCC(A/G)GAGACAGGGAGAGGCT (anti-sense)
were synthesized and used for PCR amplification. As described for the CL cDNA
encoding sequence, the PCR product of expected size (1500 bp) was purified,
sequenced, and digested with AvrII and NotI restriction enzymes.
[398.] 10.5 For the final expression vectors, a triple ligation
procedure was carned out using the EcoRV-NotI pre-digested vector, EcoRV-AvrII
variable cDNAs and AvrII-NotI constant regions. The final vectors for heavy
chain
and light chain expression were designated Y-I-HC and Y1-LC, respectively.
92
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
[399.] 10.6 An additional vector, pBJ-Yl-LP, was constructed based on
the Y1-LC to allow double selection based on the puromycin resistant gene
(PAC). In
this vector the neomycin-resistant gene of the Yl-LC plasmid was replaced with
a
fragment of ~1600bp encoding for the PAC gene (from the pMCC-ZP vector).
[400.] 10.7 The open reading frame (ORF) of both the Y-1-IgG-HC and
Y1-IgG-LC and their encoded amino acid sequences are presented below:
[401.] 10.7.1 The ORF of Yl-IgG-HC (VH CHl CH2 CH3)
1 ATGGCCTGGGCTCTGCTGCTCCTOACCCTCCTCACTCAGGACACAGGGTCCTGGGCCGAT
1 M A W A L L L L T L L T Q D T G S W A D
61 ATCCAGCTGGTGGAGTCTGGGGGAGGTGTGGTACGGCCTGGGGGGTCCCTGAGACTCTCC
2 1 I Q L Y E S G G G V V R P G G S L R L S
121 TGTGCAGCCTCTGGATTCACCTTTGATGATTATGGCATGAGCTGGGTCCGCCAAGCTCCA
4 1 C A A S G F T F D D Y G M S W V R Q A P
181 GGGAAGGGGCTGGAGTGGGTCTCTGGTATTAATTGGAATGGTGGTAGCACAGGTTATGCA
6 1 G K G L E W V S G I N W N G G S T G Y A
241 GACTCTGTGAAGGGCCGATTCACCATCTCTAGAGACAACGCCAAGAACTCCCTGTATCTG
8 1 D S V K G R F T I S R D N A K N S L Y L
301 CAAATGAACAGTCTGAGAGCCGAGGACACGGCCGTGTATTACTGTGCAAGAATGAGGGCT
1 0 1 Q M N S L R A E D T A V Y Y C A R M R A
361 CCTGTGATTTGGGGCCAAGGTACCCTGGTCACCGTCTCGAGTGCTTCCACCAAGGGCCCA
12 1 P V I W G Q G T L V T V S S A S T K G P
421 TCGGTCTTCCCCCTGGCACCCTCCTCCAAGAGCACCTCTGGGGGCACAGCGGCCCTGGGC
1 4 1 S V F P L A P S S K S T S G G T A A L G
481 TGCCTGGTCAAGGACTACTTCCCCGAACCGGTGACGGTGTCGTGGAACTCAGGCGCCCTG
1 6 1 C L V K D Y F P E P V T V S W N S G A L
541 ACCAGCGGCGTGCACACCTTCCCGGCTGTCCTACAGTCCTCAGGACTCTACTCCCTCAGC
1 8 1 T S G V H T F P A V L Q S S G L Y S L S
601 AGCGTGGTGACCGTGCCCTCCAGCAGCTTGGGCACCCAGACCTACATCTGCAACGTGAAT
2 0 1 S V V T V P S S S L G T Q T Y I C N V N
661 CACAAGCCCAGCAACACCAAGGTGGACAAGAGAGTTGAGCCCAAATCTTGTGACAAAACT
2 2 1 H K P S N T K V D K R V E P K S C D K T
721 CACACATGCCCACCGTGCCCAGCACCTGAACTCCTGGGGGGACTGTCAGTCTTCOTCTTC
2 4 1 . H T C P P C P A P E L L G G P S V F L F
781 CCCCCAAAACCCAAGGACACCCTCATGATCTCCCGGACCCCTGAGGTCACATGCGTGGTG
2 6 1 P P K P K D T L M I S R T P E V T C V V
841 GTGGACGTGAGCCACGAAGACCCTGAGGTCAAGTTCAACTGGTACGTGGACGGCGTGGAG
2 8 1 V D V S H E D P E V K F N W Y V D G V E
901 GTGCATAATGCCAAGACAAAGCCGCGGGAGGAGCAGTACAACAGCACGTACCGTGTGGTC
3 0 1 V H N A K T K P R E E Q Y N S T Y R V V
961 AGCGTCCTCACCGTCCTGCACCAGGACTGGCTGAATGGCAAGGAGTACAAGTGCAAGGTC
93
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
3 2 1 S V L T V L H Q D W L N G K E Y K' C K V
1021 TCCAACAAAGCCCTCCCAGCCCCCATCGAGAAAACCATCTCCAAAGCCAAAGGGCAGCCC
3 4 1 S N K A L P A P I E K T I S K A K G Q P
1081 OGAGAACCACAGGTGTACACCCTGCCCCCATCCCGGGAGGAGATGACCAAGAACCAGGTC
3 6 1 R E P Q V Y T L P P S R E E M T K N Q V
1141 AGCCTGACCTGCCTGGTCAAAGGCTTCTATCCCAGCGACATCGCCGTGGAGTGGGAGAGC
3 8 1 S L T C L V K G F Y P S D I A V E W E S
1201 AATGGGCAGCCGGAGAACAACTACAAGACCACGTCTCCCGTGCTGGACTCCGACGGCTCC
4 0 1 N G Q P E N N Y K T T S P V L D S D G S
1261 TTCTTCCTCTATAGCAAGCTCACCGTGCACAAGAGCAGGTGGCAGCAGGGGAACGTCTTC
4 2 1 F F L Y S K L T V D K S R W Q Q G N V F
1321 TCATGCTCCGTGATGCATGAGGCTCTGCACAACCACTACACGCAGAAGAGCCTCTCCCTG
4 4 1 S C S V M H E A L H N H Y T Q K S L S L
1381 TCTCTGGGTAAATGA
461 S L G K
[402.] 10.7.2 The ORF of Yl-IgG-LC (VL C,,)
1 ATGGCCTGGGCTCTGCTGCTCCTCACCCTCCTCACTCAGGACACAGGGTCCTGGGCCGAT
1 M A W A L L L L T L L T Q D T G S W A D
61 GCAGAGCTGACTCAGGACCCTGCTGTGTCTGTGGCCTTGGGACAGACAGTCAGGATCACA
2 1 A E L T Q D P A V S V A L G Q T V R I T
1212 TGCCAAGGAGACAGCCTCAGAAGCTATTATGCAAGCTGGTACCAGCAGAAGCCAGGACAG
4 1 C Q G D S L R S Y Y A S W Y Q Q K P G Q
181 GCCCCTGTACTTGTCATCTATGGTAAAAACAACCGGCCCTCAGGGATCCCAGACCGATTC
1 6 1 A P V L V I Y G K N N R P S G I P D R F
241 TCTGGCTCCAGCTCAGGAAACACAGCTTCCTTGACCATCACTGGGGCTCAGGCGGAAGAT
8 1 S G S S S G N T A S ~ T I T G A Q A E D
301 GAGGCTGACTATTACTGTAACTCCCGGGACAGCAGTGGTAACCATGTGGTATTCGGCGGA
1 0 1 E A D Y Y C N S R D S S G N H V V F G G
361 GGGACCAAGCTGACCGTCCTAGGTCAGCCCAAGGCTGCCCCCTCGGTCACTCTGTTCCCG
1 2 1 G T K L T V L G Q P K A A P S V T L F P
421 CCCTCCTCTGAGGAGCTTCAAGCCAACAAGGCCACACTGGTGTGTCTCATAAGTGACTTC
1 4 1 P S S E E L Q A N K A T L V C L I S D F
481 TACCCGGGAGCCGTGACAGTGGCCTGGAAGGCAGATAGCAGCCCCGTCAAGGCGGGAGTG
1 6 1 Y P G A V T V A W K A D S S P V K A G V
541 GAGACCACCACACCCTCCAAACAAAGCAACAACAAGTACGCGGCCAGCAGCTACCTGAGC
1 8 1 E T T T P S K Q S N N K Y A A S S Y L S
601 CTGACGCCTGAGCAGTGGAAGTCCCACAAAAGCTACAGCTGCCAGGTCACGCATGAAGGG
2 0 1 L T P E Q W K S H K S Y S C Q V T H E G
661 AGCACCGTGGAGAAGACAGTGGCCCCTACAGAATGTTCATGA
2 2 1 S T V E K T V A P T E C S
94
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
[403.] The leader sequence is underlined. The VH and VL regions are each
encoded by amino acid sequences that are bolded, followed by either the IgGI
(for the
heavy chain) or the ~,3 (for the light chain) constant region sequences.
[404.] 10.8 Expression of Yl heavy and light chain in CHO cells.
Vectors Y1-HC and Y1-LC were used individually for the transfection and
selection
of stable cells expressing the heavy or light chains. Following selection on
6418 and
cell growth, the secreted protein in the supernatant was analyzed for IgGI
expression
by the capture EIA assay and by Western blot analysis, as described below.
[405.] 10.8.1 Capture EIA assay: The wells of 96 well plates were pre-
coated with mouse anti-human IgGI Fc (Sigma). The supernatant from above was
added to the wells, and the presence of heavy chain IgGI was detected with
biotinylated goat anti-y chain specific antibody (Sigma), streptavidin-HRP and
substrate. An ELISA plate reader monitored development of the color at A4os.
[406.] 10.8.2 Western blot analysis: The supernatant for the above cells
was run on 12.5% SDS-PAGE. Expression of each chain was detected with (a) goat
anti-human IgG-HRP (H+L; Sigma Cat #A8667) for heavy chain detection and (b)
biotinylated goat anti-human ~,3 chain (Southern Biotechnology Association,
Cat
#2070-08) for light chain detection.
Expression of both chains was confirmed by the above assays, and co-
transfection
was carned out to obtain full size Y1-IgGI.
[407.] 10.9 Expression and Purification of Y1-IgG
[408.] 10.9.1 Cell Culture and Transfection: CHO cells were cultivated in
F-12 medium with 10% fetal calf serum and 40 ~,g/mi gentaMicin at 37°C
in 5% COZ
atmosphere. One day before transfection 0.8 x106 cells were seeded on 90mm
dishes.
The cultures were co-transfected with 10 ~g of light and heavy chains DNA by
the
FuGene (Roche) transfection reagent technique. After 2 days of growth in
nonselective medium, the cells were cultured for 10-12 days in F-12 medium
containing 550 ~g/ml neomycin and 3 ~g/ml puromycin. The cells were
trypsinized
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
and cloned by limiting dilution of 0.5 cell/well in Costar 96-well plates.
Individual
colonies were picked, grown in six-well dishes and transferred to flasks.
[409.] 10.9.2 Determination of heavy and light chain secretion: A
sandwich ELISA assay was used to determine the concentration of the antibody
secreted into the supernatant of transfected CHO cells. In order to determine
the
concentration of the antibody, the following reagents were used: monoclonal
anti
human IgGI(Fc) (Sigma) as the coated antibody, goat anti-human IgG (y-chain
specific) biotin conjugate as the detector (Sigma), and pure human IgGI,
lambda
(Sigma) as standard. Based on this ELISA assay the production rate varied
between
3-4 pg/ml.
[410.] 10.9.3 Production and Purification of MAb from the cells: Cells
were grown in roller bottles to a final concentration of 1-2x108 cells per
bottle in F-12
medium with 10% fetal calf serum, supplemented with neomycin and puromycin.
For
the production, cells were cultured in the same medium, but with 2% of fetal
calf
serum for an additional two days. The secreted antibody was purified on a
protein G-
Sepharose column (Pharmacia). Binding was in 20mM sodium phosphate buffer, pH
7.0; elution was performed in O.1M glycine buffer, pH 2.5-3-0. The quantity of
the
purified antibody was determined by UV absorbance; purity was analyzed by SDS-
PAGE. Under non-denaturing conditions the fulll IgG antibody has its expected
molecular weight of 160kD. In denaturing gels both heavy and light chains have
the
expected molecular size of 55 and 28 kD, respectively.
[411.] 10.9.4 Binding of full size Yl-IgG molecule: Binding experiments
were performed to determine the level of binding of the Y1-IgG molecule
compared
to the binding level of the scFv-Y1 molecule. A two-step staining procedure
was
employed, wherein 5 n8 of Y1-IgG were reacted with both RAJI cells (negative
control, Figure 7a) and Jurkat cells (Y1 positive cells, Figure 7b). For
detection, PE-
labeled goat anti-human IgG was used. Similarly, 1 ~g of scFv-Y1 was reacted
with
Jurkat cells (Figure 7c), and PE-labeled rabbit anti-scFv was used for
detection.
Results indicate that both Y1-IgG and scFv-Y1 bind to the Jurkat cells, with
96
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
approximately 103 -fold more scFv-Y1 molecules needed to obtain a level of
detection
similar to that of the Y1-IgG.
Brief Describtion of the Tables
[412.] Table 1: Panning results derived from protocol AM. The estimated
number of phagemids used for panning (input), and the estimated number of
bound
phagemids eluted (output) are summarized for the four consecutive steps of the
AM
biopanning protocol. The cell source and elution medium for each output result
is
listed, as well as the term used to distinguish each separate stock.
[413.] Table 2: Selected clones following the AM biopanning protocol.
The number of amino acid residues in the CDR3 region (VH-CDR3 size) and the
CDR3 amino acid sequences for the different clone types isolated are
summarized. In
addition, the frequency of each of the clone types in the two AM biopanning
outputs,
the T 16M3 and T 16M3.1 outputs, are presented.
[414.] Table 3: Panning results derived from the YPR protocol. The
estimated number of phagemids used for panning (input), and the estimated
number
of bound phagemids eluted (output) are summarized. The elution medium for each
output result is listed, as well as the term used to distinguish each separate
stock.
[415.] Table 4: Panning results derived from the YPNR protocol. The
estimated number of phagemids used for panning (input), and the estimated
number
of bound phagemids eluted (output) are summarized for the three consecutive
steps of
the YPNR biopanning protocol. The elution medium for each output result is
listed,
as well as the term used to distinguish each separate stock.
[416.] Table 5: Selected Y-series clones following the YPR biopanning
protocol with the R3 output. Several different clones were identified in the
R3
output stock. The number of amino acid residues comprising, and the amino acid
sequences of, the VH-CDR3 regions of the identified clones, as well as
germline
designations, are detailed.
97
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
[417.] Table 6: Yl binding specificity for leukemia cells. The results of
binding experiments of three different scFv clones, each reacted with mixtures
of cells
containing primarily each of seven different leukemic cell types, as
determined by
FACS analysis, are presented. The results represent the fraction of patients,
the cells
of whom were identified by FACS analysis as positively reacting with each
tested
antibody. The numerator represents the number of positive patients, with the
denominator denoting the total number of patients tested for a given
scFv/leukemic
cell type combination
[418.] Table 7: FACS analysis of scFv binding to Ficoll-purified normal
blood cells. Three scFv clones are each analyzed for binding to five different
Ficoll-
purified normal blood cell types. These binding results represent the fraction
of
normal blood samples that were identified by FACS analysis as positively
reacting
with each tested antibody.
[419.] Table 8: Comparison of Yl scFv binding with binding of
antibodies to various cell markers. Results of FACS analysis of staining by Y1
and
by a panel of other antibodies are presented. Ficoll-purified peripheral and
bone
marrow cells from ANE patients were prepared and the binding specificity of Y1
scFv
compared to various cell markers on AML cells was studied. The results are
expressed as the percentage of cells in the Ficoll-purified samples of a given
patient,
which was identified by FACS analysis as positively reacting with each Fv.
Four
other antibodies were run for comparison: (1) CD13 - a marker for granulocytes
and
monocytes; (2) CD14 - a marker for monocytes and neutrophils; (3) CD33 - a
marker
for normal myeloid cells and leukemic myeloid cells; and (4) CD34 - a marker
for
stem cells.
[420.] Table 9: Binding of Yl to hematopoietic cell lines. FAGS analysis
was performed to determine the binding of Y1 scFv to three different
categories of
human leukemia cell lines, and to one murine cell line. Cell lines to which Y1
was
positively bound (reactive) or not (non-reactive) are listed.
[421.] Table 10: The CDR3 sequence of VH3-DP32 isolated clones.
Following different biopanning and selection procedures several clones based
on the
98
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
DP32 germline were isolated. Clones Y1, Y17, Y-27 and Y-44 were identified
during
the biopanning selection on platelets (YPR and YPNR protocols). The sequence
of
the VH-CDR3 region of each of these clones is presented.
[422.] Table 11: Binding profile of VH3-DP32 isolated clones. The
binding specificity of DP32-derived clones to several hematopoietic cells was
tested
by FACS analysis.
[423.] The invention has been described with reference to specific examples,
materials and data. As one skilled in the art will appreciate, alternate means
for using
or preparing the various aspects of the invention may be available. Such
alternate
means are to be construed as included within the intent and spirit of the
present
invention as defined by the following claims:
99
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
SEQUENCE LISTING
<110> Bio-Technology General Corp
<210> 1
<211> 10
<212> PRT
<213> Homo Sapiens
<400> 1
Ser Ser Tyr Thr Ser Ser Ser Thr Leu Val
1 5 10
<210>2
<211>10
<212>PRT
<213>Homo-sapiens
<400> 2
Ser Ser Tyr Thr Ser Ser Ser Thr Leu Gly
1 5 10
<210> 3
<211> 9
<212> PRT
<213> Homo Sapiens
<400> 3
Gln Ser Tyr Asp Ser Asn Leu Arg Val
1 5
1
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
<210> 4
<211> 8
<212> PRT
<213> ' Homo sapiens
<400> 4
Gln Gln Leu Asn Ser Tyr Pro Thr
1 5
<210> 5
<211> 11
<212> PRT
<213> Homo Sapiens
<400> 5
Asn Ser Arg Asp Ser Ser Gly Phe Gln Leu Val
1 5 10
<210> 6
<211> 9
<212> PRT
<213> Homo Sapiens
<400> 6
Gln Gln Ala Asn Ser Phe Pro Ile Thr
1 5
<210> 7
<211> 111
<212> PRT
<213> Homo Sapiens
<400> 7
2
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
Ser Glu Leu Thr Gln Asp Pro Ala Val Ser Val Ala Leu Gly Gln Thr
1 5 10 15
Val Arg Ile Thr Cys Gln Gly Asp Ser Leu Arg Ser Tyr Tyr Ala Ser
20 25 30
Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Val Leu Val Ile Tyr Gly
35 40 45
Lys Asn Asn Arg Pro Ser Gly Ile Pro Asp Arg Phe Ser Gly Ser Ser
50 55 60
Ser Gly Asn Thr Ala Ser Leu Thr Ile Thr Gly Ala Gln Ala Glu Asp
65 70 75 80
Glu Ala Asp Tyr Tyr Cys Asn Ser Arg Asp Ser Ser Gly Asn His Val
85 , 90 95
Val Phe Gly Gly Gly Thr Lys Leu Thr Val Leu Gly Ala Ala Ala
100 105 110
<210> 8
<211> 6
<212> PRT
<213> Homo Sapiens
<400> 8
Met Arg Ala Pro Val Ile
1 5
<210> 9
<211> 8
<212> PRT
<213> Homo Sapiens
<400> 9
Pro Trp Asp Asp Val Thr Pro Pro
1 5
<210> 10
3
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
<211> 12
<212> PRT
<213> Homo sapiens
<400> 10
Gly Phe Pro Arg Ile Thr Pro Pro Ser Ala Glu Ile
1 5 10
<210> 11
<211> 5
<212> PRT
<213> Homo Sapiens
<400> 11
Gly Phe Pro Met Pro
1 5
<210> 12
<211> 10
<212> PRT
<213> Homo sapiens
<400> 12
Gly Phe Pro His Ser Ser Ser Val Ser Arg
1 5 10
<210> 13
<211> 11
<212> PRT
<213> Homo Sapiens
<400> 13
4
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
Arg Phe Pro Met Arg His Glu Lys Thr Asn Tyr
1 5 10
<210> 14
<211> 8
<212> PRT
<213> Homo Sapiens
<400> 14
Arg Phe Pro Pro Thr Ala Thr Ile
1 5
<210> 15
<211> 7
<212> PRT
<213> Homo Sapiens
<400> 15
Thr Gln Arg Arg Asp Leu Gly
1 5
<210> 16
<211> 11
<212> PRT
<213> Homo Sapiens
<400> 16
Lys Phe Pro Gly Gly Thr Val Arg Gly Leu Lys
1 5 10
<210> 17
S
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
<211> 12
<212> PRT
<213> Homo Sapiens
<400> 17
Gly Phe Pro Val Ile Val Glu Glu Arg Gln Ser Thr
1 5 10
<210> 18
<211> 10
<212> PRT
<213> Homo Sapiens
<400> 18
Arg Phe Pro Gln Arg Val Asp Asn Arg Val
1 5 10
<210> 19
<211> 8
<212> PRT
<213> Homo Sapiens
<400> 19
Thr Gly Gln Ser Ile Lys Arg Ser
1 5
<210> 20
<211> 6
<212> PRT
<213> Homo Sapiens
<400> 20
6
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
Leu Pro Tyr
Thr Phe
His
1 5
<210>21
<211>6
<212>PRT
<213>HomoSapiens
<400>21
Leu g Pro Gln
Ar Pro Ser
1 5
<210>22
<211>11
<212>PRT
<213>HomoSapiens
<400> 22
Thr Ser Lys Asn Thr Ser Ser Ser Lys Arg His
1 5 10
<210> 23
<211> 12
<212> PRT
<213> Homo Sapiens
<400> 23
Arg Tyr Tyr Cys Arg Ser Ser Asp Cys Thr Val Ser
1 5 10
<210> 24
7
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
<211> 10
<212> PRT
<213> Homo Sapiens
<400> 24
Phe Arg Arg Met Glu Thr Val Pro Ala Pro
1 5 10
<210> 25
<211> 277
<212> PRT
<213> Homo Sapiens
<400> 25
Met Lys Tyr Leu Leu Pro Thr Ala Ala Ala Gly Leu Leu Leu Leu Ala
1 5 10 15
Ala Gln Pro Ala Met Ala Glu Val Gln Leu Val Glu Ser Gly Gly Gly
20 25 30
Val Val Arg Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly
35 40 45
Phe Thr Phe Asp Asp Tyr Gly Met Ser Trp Val Arg Gln Ala Pro Gly
50 55 60
Lys Gly Leu Glu Trp Val Ser Gly Ile Asn Trp Asn Gly Gly Ser Thr
65 70 75 80
Gly Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn
85 90 95
Ala Lys Asn Ser Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp
100 105 110
Thr Ala Val Tyr Tyr Cys Ala Arg Met Arg Ala Pro Val Ile Trp Gly
115 120 125
Gln Gly Thr Leu Val Thr Val Ser Arg Gly Gly Gly Gly Ser Gly Gly
130 135 140
Gly Gly Ser Gly Gly Gly Gly Ser Ser Glu Leu Thr Gln Asp Pro Ala
145 150 155 160
Val Ser Val Ala Leu Gly Gln Thr Val Arg Ile Thr Cys Gln Gly Asp
165 170 175
8
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
Ser Leu Arg Ser Tyr Tyr Ala Ser Trp Tyr Gln Gln Lys Pro Gly Gln
180 185 190
Ala Pro Val Leu Val Ile Tyr Gly Lys Asn Asn Arg Pro Ser Gly Ile
195 200 205
Pro Asp Arg Phe Ser Gly Ser Ser Ser Gly Asn Thr Ala Ser Leu Thr
210 215 220
Ile Thr Gly Ala Gln Ala Glu Asp Glu Ala Asp Tyr Tyr Cys Asn Ser
225 230 235 240
Arg Asp Ser Ser Gly Asn His Val Val Phe Gly Gly Gly Thr Lys Leu
245 250 255
Thr Val Leu Gly Ala Ala Ala Glu Gln Lys Leu Ile Ser Glu Glu Asp
260 265 270
Leu Asn Gly Ala Ala
275
<210> 26
<211> 464
<212> PRT
<213> Homo sapiens
<400> 26
Met Ala Trp Ala Leu Leu Leu Leu Thr Leu Leu Thr Gln Asp Thr Gly
1 5 10 15
Ser Trp Ala Asp Ile Gln Leu Val Glu Ser Gly Gly Gly Val Val Arg
20 25 30
Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe
35 40 45
Asp Asp Tyr Gly Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu
50 55 60
Glu Trp Val Ser Gly Ile Asn Trp Asn Gly Gly Ser Thr Gly Tyr Ala
65 70 75 80
Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn
85 90 95
Ser Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val
100 105 110
Tyr Tyr Cys Ala Arg Met Arg Ala Pro Val Ile Trp Gly Gln Gly Thr
115 120 125
9
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
Leu Val Thr Val Ser Ser Ala Ser Thr Lys Gly Pro Ser Val Phe Pro
130 135 140
Leu Ala Pro Ser Ser Lys Ser Thr Ser Gly Gly Thr Ala Ala Leu Gly
145 150 155 160
Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr Val Ser Trp Asn
165 170 175
Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala Val Leu Gln
180 185 190
Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro Ser Ser
195 200 205
Ser Leu Gly Thr Gln Thr Tyr Ile Cys Asn Val Asn His Lys Pro Ser
210 215 220
Asn Thr Lys Val Asp Lys Arg Val Glu Pro Lys Ser Cys Asp Lys Thr
225 230 235 240
His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly Gly Pro Ser
245 250 255
Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg
260 265 270
Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro
275 280 285
Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala
290 295 300
Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val
305 310 315 320
Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr
325 330 335
Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr
340 345 350
Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu
355 360 365
Pro Pro Ser Arg Glu Glu Met Thr Lys Asn Gln Val Ser Leu Thr Cys
370 375 380
Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser
385 390 395 400
Asn Gly Gln Pro Glu Asn Asn Tyr Lys~Thr Thr Ser Pro Val Leu Asp
405 410 415
Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser
420 425 430
Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
435 440 445
Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Leu Gly Lys
450 455 460
<210> 27
<211> 233
<212> PRT
<213> Homo sapiens
<400> 27
Met Ala Trp Ala Leu Leu Leu Leu Thr Leu Leu Thr Gln Asp Thr Gly
1 5 10 15
Ser Trp Ala Asp Ala Glu Leu Thr Gln Asp Pro Ala Val Ser Val Ala
20 25 30
Leu Gly Gln Thr Val Arg Ile Thr Cys Gln Gly Asp Ser Leu Arg Ser
35 40 45
Tyr Tyr Ala Ser Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Val Leu
50 55 60
Val Ile Tyr Gly Lys Asn Asn Arg Pro Ser Gly Ile Pro Asp Arg Phe
65 70 75 80
Ser Gly Ser Ser Ser Gly Asn Thr Ala Ser Leu Thr Ile Thr Gly Ala
85 90 95
Gln Ala Glu Asp Glu Ala Asp Tyr Tyr Cys Asn Ser Arg Asp Ser Ser
100 105 110
Gly Asn His Val Val Phe Gly Gly Gly Thr Lys Leu Thr Val Leu Gly
115 120 125
Gln Pro Lys Ala Ala Pro Ser Val Thr Leu Phe Pro Pro Ser Ser Glu
130 135 140
Glu Leu Gln Ala Asn Lys Ala Thr Leu Val Cys Leu Ile Ser Asp Phe
145 150 155 160
Tyr Pro Gly Ala Val Thr Val Ala Trp Lys Ala Asp Ser Ser Pro Val
165 170 175
Lys Ala Gly Val Glu Thr Thr Thr Pro Ser Lys Gln Ser Asn Asn Lys
180 185 190
Tyr Ala Ala Ser Ser Tyr Leu Ser Leu Thr Pro Glu Gln Trp Lys Ser
195 200 205
His Lys Ser Tyr Ser Cys Gln Val Thr His Glu Gly Ser Thr Val Glu
11
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
210 215 220
Lys Thr Val Ala Pro Thr Glu Cys Ser
225 230
<210> 28
<211> 11
<212> PRT
<213> Homo sapiens
<400> 28
Phe Leu Thr Tyr Asn Ser Tyr Glu Val Pro Thr
1 5 10
<210> 29
<211> 9
<212> PRT
<213> Homo Sapiens
<400> 29
Thr Asn Trp Tyr Leu Arg Pro Leu Asn
1 5
<210> 30
<211> 98
<212> PRT
<213> Homo sapiens
<400> 30
Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala
1 5 10 15
Thr Val Lys Ile Ser Cys Lys Val Ser Gly Tyr Thr Phe Thr Asp Tyr
20 25 30
12
CA 02433227 2003-06-27
WO PCT/USO1/49440
02/059264
Tyr Met HisTrpVal Gln AlaPro GlyLysGly LeuGlu Met
Gln Trp
35 40 45
Gly Leu ValAspPro Glu GlyGlu ThrIleTyr AlaGlu Phe
Asp Lys
50 55 60
Gln Gly ArgValThr Ile AlaAsp ThrSerThr AspThr Tyr
Thr Ala
65 70 75 80
Met Glu LeuSerSer Leu SerGlu AspThrAla ValTyr Cys
Arg Tyr
85 90 95
Ala Thr
<210> 31
<211> 98
<212> PRT
<213> Homo Sapiens
<400> 31
Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Ile Phe Thr Asp Tyr
20 25 30
Tyr Met His Trp Val Arg Gln Ala Pro Gly Gln Glu Leu Gly Trp Met
35 40 45
Gly Arg Ile Asn Pro Asn Ser Gly Gly Thr Asn Tyr Ala Gln Lys Phe
50 55 60
Gln Gly Arg Val Thr Met Thr Arg Asp Thr Ser Ile Ser Thr Ala Tyr
65 70 75 80
Thr Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Thr Tyr Tyr Cys
85 90 95
Ala Arg
<210> 32
<211> 98
<212> PRT
13
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
<213> Homo Sapiens
<400> 32
Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala
1 5 10 15
Ser Val Lys Val Ser Cys Lys Val Ser Gly Tyr Thr Leu Thr Glu Leu
20 25 30
Ser Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Met
35 40 45
Gly Gly Phe Asp Pro Glu Asp Gly Glu Thr Ile Tyr Ala Gln Lys Phe
50 55 60
Gln Gly Arg Val Thr Met Thr Glu Asp Thr Ser Thr Asp Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Ser Leu Arg Ser Gl.u Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Thr
<210> 33
<211> 98
<212> PRT
<213> Homo Sapiens
<400> 33
Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Gly Tyr
20 25 30
Tyr Met His Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met
35 40 45
Gly Arg Ile Asn Pro Asn Ser Gly Gly Thr Asn Tyr Ala Gln Lys Phe
50 55 60
Gln Gly Arg Val Thr Ser Thr Arg Asp Thr Ser Ile Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Arg Leu Arg Ser Asp Asp Thr Val Val Tyr Tyr Cys
85 90 95
14
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
Ala Arg
<210> 34
<211> 98
<212> PRT
<213> Homo Sapiens
<400> 34
Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Gly Tyr
20 25 30
Tyr Met His Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met
35 40 45
Gly Trp Ile Asn Pro Asn Ser Gly Gly Thr Asn Tyr Ala Gln Lys Phe
50 55 60
Gln Gly Arg Val Thr Met Thr Arg Asp Thr Ser Ile Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Arg Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg
<210> 35
<211> 98
<212> PRT
<213> Homo Sapiens
<400> 35
Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Gly Tyr
20 25 30
Tyr Met His Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
35 40 45
Gly Trp Ile Asn Pro Asn Ser Gly Gly Thr Asn Tyr Ala Gln Lys Phe
50 55 60
Gln Gly Trp Val Thr Met Thr Arg Asp Thr Ser Ile Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Arg Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg
<210> 36
<211> 98
<212> PRT
<213> Homo sapiens
<220>
<221> X
<222> (1)..(98)
<223> Xaa
<400> 36
Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Leu Gly Ala
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Gly Tyr
20 25 30
Tyr Met His Trp Val Xaa Gln Ala Pro Gly Gln Gly Leu Glu Trp Met
35 40 45
Gly Trp Ile Asn Pro Asn Ser Gly Gly Thr Asn Tyr Ala Gln Lys Phe
50 55 60
Gln Gly Arg Val Thr Met Thr Arg Asp Thr Ser Ile Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Arg Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg
16
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
<210> 37
<211> 98
<212> PRT
<213> Homo sapiens
<400> 37
Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asn Tyr
20 25 30
Cys Met His Trp Val Arg Gln Val His Ala Gln Gly Leu Glu Trp Met
35 40 45
Gly Leu Val Cys Pro Ser Asp Gly Ser Thr Ser Tyr Ala Gln Lys Phe
50 55 60
Gln Ala Arg Val Thr Ile Thr Arg Asp Thr Ser Met Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Met Tyr Tyr Cys
85 90 95
Val Arg
<210> 38
<211> 98
<212> PRT
<213> Homo Sapiens
<400> 38
Gln Met Gln Leu Val Gln Ser Gly Pro Glu Val Lys Lys Pro Gly Thr
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Phe Thr Phe Thr Ser Ser
20 25 30
Ala Val Gln Trp Val Arg Gln Ala Arg Gly Gln Arg Leu Glu Trp Ile
35 40 45
Gly Trp Ile Val Val Gly Ser Gly Asn Thr Asn Tyr Ala Gln Lys Phe
50 55 60
17
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
Gln Glu Arg Val Thr Ile Thr Arg Asp Met Ser Thr Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Ala
<210> 39
<211> 98
<212> PRT
<213> Homo Sapiens
<400> 39
Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser
1 ' S 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Gly Thr Phe Ser Ser Tyr
20 25 30
Ala Ile Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met
35 40 45
Gly Gly Ile Ile Pro Ile Phe Gly Thr Ala Asn Tyr Ala Gln Lys Phe
50 55 60
Gln Gly Arg Val Thr Ile Thr Ala Asp Glu Ser Thr Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg
<210> 40
<211> 98
<212> PRT
<213> Homo Sapiens
<400> 40
Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser
1 5 10 15
18
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Gly Thr Phe Ser Ser Tyr
20 25 30
Ala Ile Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met
35 40 45
Gly Arg Ile Ile Pro Ile Leu Gly Ile Ala Asn Tyr Ala Gln Lys Phe
50 55 60
Gln Gly Arg Val Thr Ile Thr Ala Asp Lys Ser Thr Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg
<210> 41
<211> 98
<212> PRT
<213> Homo sapiens
<400> 41
Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr
20 25 30
Ala Met His Trp Val Arg Gln Ala Pro Gly Gln Arg Leu Glu Trp Met
35 40 45
Gly Trp Ile Asn Ala Gly Asn Gly Asn Thr Lys Tyr Ser Gln Lys Phe
50 55 60
Gln Gly Arg Val Thr Ile Thr Arg Asp Thr Ser Ala Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg
<210> 42
19
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
<211> 98
<212> PRT
<213> Homo Sapiens
<400> 42
Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr
20 25 30
Ala Met His Trp Val Arg Gln Ala Pro Gly Gln Arg Leu Glu Trp Met
35 40 45
Gly Trp Ser Asn Ala Gly Asn Gly Asn Thr Lys Tyr Ser Gln Glu Phe
50 55 60
Gln Gly Arg Val Thr Ile Thr Arg Asp Thr Ser Ala Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Met Ala Val Tyr Tyr Cys
85 90 95
Ala Arg
<210> 43
<211> 98
<212> PRT
<213> Homo Sapiens
<400> 43
Gln Val Gln Leu Val Gln Ser Gly Ser Glu Leu Lys Lys Pro Gly Ala
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr
20 25 30
Ala Met Asn Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met
35 40 45
Gly Trp Ile Asn Thr Asn Thr Gly Asn Pro Thr Tyr Ala Gln Gly Phe
50 55 60
Thr Gly Arg Phe Val Phe Ser Leu Asp Thr Ser Val Ser Thr Ala Tyr
65 70 75 80
Leu Gln Ile Cys Ser Leu Lys Ala Glu Asp Thr Ala Val Tyr Tyr Cys
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
85 90 95
Ala Arg
<210> 44
<211> 98
<212> PRT
<213> Homo Sapiens
<400> 44
Gln Val Gln Leu Val Gln Ser Gly Ser Glu Leu Lys Lys Pro Gly Ala
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr
20 25 30
Ala Met Asn Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met
35 40 45
Gly Trp Ile Asn Thr Asn Thr Gly Asn Pro Thr Tyr Ala Gln Gly Phe
50 55 60
Thr Gly Arg Phe Val Phe Ser Leu Asp Thr Ser Val Ser Thr Ala Tyr
65 70 75 80
Leu Gln Ile Ser Ser Leu Lys Ala Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg
<210> 45
<211> 98
<212> PRT
<213> Homo Sapiens
<400> 45
Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr
20 25 30
Asp Ile Asn Trp Val Arg Gln Ala Thr Gly Gln Gly Leu Glu Trp Met
21
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
35 40 45
Gly Trp Met Asn Pro Asn Ser Gly Asn Thr Gly Tyr Ala Gln Lys Phe
50 55 60
Gln Gly Arg Val Thr Met Thr Arg Asn Thr Ser Ile Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg
<210> 46
<211> 98
<212> PRT
<213> Homo sapiens
<400> 46
Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr
20 25 30
Gly Ile Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met.
35 40 45
Gly Trp Ile Ser Ala Tyr Asn Gly Asn Thr Asn Tyr Ala Gln Lys Leu
50 55 60
Gln Gly Arg Val Thr Met Thr Thr Asp Thr Ser Thr Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Arg Ser Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg
<210> 47
<211> 92
<212> PRT
<213> Homo sapiens
22
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
<400> 47
Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr
20 25 30
Gly Ile Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met
35 40 45
Gly Trp Ile Ser Ala Tyr Asn Gly Asn Thr Asn Tyr Ala Gln Lys Leu
50 55 60
Gln Gly Arg Val Thr Met Thr Thr Asp Thr Ser Thr Ser Thr Ala Tyr
65 ' 70 75 80
Met Glu Leu Arg Ser Leu Arg Ser Asp Asp Thr Ala
g5 90
<210> 48
<211> 98
<212> PRT
<213> Homo sapiens
<400> 48
GlnValGln LeuVal GlnSerGly AlaGluVal LysLysPro GlyAla
1 5 10 15
SerValLys ValSer CysLysAla SerGlyTyr ThrPheThr SerTyr
20 25 30
TyrMetHis TrpVal ArgGlnAla ProGlyGln GlyLeuGlu TrpMet
35 40 45
GlyIleIle AsnPro SerGlyGly SerThrSer TyrAlaGln LysPhe
50 55 60
GlnGlyArg ValThr MetThrArg AspThrSer ThrSerThr ValTyr
65 70 75 80
MetGluLeu SerSer LeuArgSer GluAspThr AlaValTyr TyrCys
85 90 95
Ala Arg
<210> 49
23
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
<211> 98
<212> PRT
<213> Homo sapiens
<400> 49
Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Asn Ser Tyr
20 25 30
Tyr Met His Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met
35 40 45
Gly Ile Ile Asn Pro Ser Gly Gly Ser Thr Ser Tyr Ala Gln Lys Phe
50 55 60
Gln Gly Arg Val Thr Met Thr Arg Asp Thr Ser Thr Ser Thr Val Tyr
65 70 75 80
Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg
<210> 50
<211> 98
<212> PRT
<213> Homo sapiens
<400> 50
Gln Met Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Thr Gly Ser
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Tyr Arg
20 25 30
Tyr Leu His~Trp Val Arg Gln Ala Pro Gly Gln Ala Leu Glu Trp Met
35 40 45
Gly Trp Ile Thr Pro Phe Asn Gly Asn Thr Asn Tyr Ala Gln Lys Phe
50 55 60
Gln Asp Arg Val Thr Ile Thr Arg Asp Arg Ser Met Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Met Tyr Tyr Cys
24
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
85 90 95
Ala Arg
<210> 51
<211> 98
<212> PRT
<213> Homo Sapiens
<400> 51
Gln Met Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Thr Gly Ser
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Tyr Arg
20 25 30
Tyr Leu His Trp Val Arg Gln Ala Pro Gly Gln Ala Leu Glu Trp Met
35 40 45
Gly Trp Ile Thr Pro Phe Asn Gly Asn Thr Asn Tyr Ala Gln Lys Phe
50 55 60
Gln Asp Arg Val Thr Ile Thr Arg Asp Arg Ser Met Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Met Tyr Tyr Cys
85 90 95
Ala Arg
<210> 52
<211> 96
<212> PRT
<213> Homo Sapiens
<400> 52
Gln Val Thr Leu Lys Glu Ser Gly Pro Val Leu Val Lys Pro Thr Glu
1 5 10 15
Thr Leu Thr Leu Thr Cys Thr Val Ser Gly Phe Ser Leu Ser Asn Ala
20 25 30
Arg Met Gly Val Ser Trp Ile Arg Gln Pro Pro Gly Lys Ala Leu Glu
35 40 45
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
Trp Leu Ala His Ile Phe Ser Asn Asp Glu Lys Ser Tyr Ser Thr Ser
50 55 60
Leu Lys Ser Arg Leu Thr Ile Ser Lys Asp Thr Ser Lys Ser Gln Val
65 70 75 80
Val Leu Thr Met Thr Asn Met Asp Pro Val Asp Thr Ala Thr Tyr Tyr
85 90 95
<210> 53
<211> 99
<212> PRT
<213> Homo Sapiens
<400> 53
Gln Ile Thr Leu Lys Glu Ser Gly Pro Thr Leu Val Lys Pro Thr Gln
1 5 10 15
Thr Leu Thr Leu Thr Cys Thr Phe Ser Gly Phe Ser Leu Ser Thr Ser
20 25 30
Glu Trp Cys Gly Trp Ile Arg Gln Pro Pro Gly Lys Ala Leu Glu Trp
35 40 45
Leu Ala Leu Ile Tyr Trp Asn Asp Asp Lys Arg Tyr Ser Pro Ser Leu
50 55 60
Lys Ser Arg Leu Thr Ile Thr Lys Asp Thr Ser Lys Asn Gln Val Val
65 70 75 80
Leu Thr Met Thr Asn Met Asp Pro Val Asp Thr Ala Thr Tyr Tyr Cys
85 90 95
Ala His Arg
<210> 54
<211> 96
<212> PRT
<213> Homo Sapiens
<400> 54
Gln Val Thr Leu Arg Glu Ser Gly Pro Ala Leu Val Lys Pro Thr Gln
1 5 10 15
26
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
Thr Leu Thr Leu Thr Cys Thr Phe Ser Gly Phe Ser Leu Ser Thr Ser
20 25 30
Gly Met Cys Val Ser Trp Ile Arg Gln Pro Pro'Gly Lys Ala Leu Glu
35 40 45
Trp Leu Ala Leu Ile Asp Trp Asp Asp Asp Lys Tyr Tyr Ser Thr Ser
50 55 60
Leu Lys Thr Arg Leu Thr Ile Ser Lys Asp Thr Ser Lys Asn Gln Val
65 ' 70 75 80
Val Leu Thr Met Thr Asn Met Asp Pro Val Asp Thr Ala Thr Tyr Tyr
85 90 95
<210>55
<211>96
<212>PRT
<213>Homo sapiens
<400> 55
Gln Val Thr Leu Lys Glu Ser Gly Pro Ala Leu Val Lys Pro Thr Gln
1 5 10 15
Thr Leu Thr Leu Thr Cys Thr Phe Ser Gly Phe Ser Leu Ser Thr Ser
20 25 30
Gly Met Arg Val Ser Trp Ile Arg Gln Pro Pro Gly Lys Ala Leu Glu
35 40 45
Trp Leu Ala Arg Ile Asp Trp Asp Asp Asp Lys Phe Tyr Ser Thr Ser
50 55 60
Leu Lys Thr Arg Leu Thr Ile Ser Lys Asp Thr Ser Lys Asn Gln Val
65 70 75 80
Val Leu Thr Met Thr Asn Met Asp Pro Val Asp Thr Ala Thr Tyr Tyr
85 90 95
<210> 56
<211> 100
<212> PRT
<213> Homo sapiens
<400> 56
27
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
Gln Ile Thr Leu Lys Glu Ser Gly Pro Thr Leu Val Lys Pro Thr Gln
1 5 10 15
Thr Leu Thr Leu Thr Cys Thr Phe Ser Gly Phe Ser Leu Ser Thr Ser
20 25 30
Gly Val Gly Val Gly Trp Ile Arg Gln Pro Pro Gly Lys Ala Leu Glu
35 40 45
Trp Leu Ala Leu Ile Tyr Trp Asn Asp Asp Lys Arg Tyr Ser Pro Ser
50 55 60
Leu Lys Ser Arg Leu Thr Ile Thr Lys Asp Thr Ser Lys Asn Gln Val
65 70 75 80
Val Leu Thr Met Thr Asn Met Asp Pro Val Asp Thr Ala Thr Tyr Tyr
85 90 95
Cys Ala His Arg
100
<210> 57
<211> 100
<212> PRT
<213> Homo sapiens
<400> 57
Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asp His
20 25 30
Tyr Met Asp Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
Gly Arg Thr Arg Asn Lys Ala Asn Ser Tyr Thr Thr Glu Tyr Ala Ala
50 55. 60
Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asp Ser Lys Asn Ser
65 70 75 80
Leu Tyr Leu Gln Met Asn Ser Leu Lys Thr Glu Asp Thr Ala Val Tyr
85 90 95
Tyr Cys Ala Arg
100
<210> 58
28
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
<211> 100
<212> PRT
<213> Homo sapiens
<400> 58
Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asp His
20 25 30
Tyr Met Ser Trp Val Arg Gln Ala Gln Gly Lys Gly Leu Glu Leu Val
35 40 45
Gly Leu Ile Arg Asn Lys Ala Asn Ser Tyr Thr Thr Glu Tyr Ala Ala
50 55 60
Ser Val Lys Gly Arg Leu Thr Ile Ser Arg Glu Asp Ser Lys Asn Thr
65 70 75 80
Leu Tyr Leu Gln Met Ser Ser Leu Lys Thr Glu Asp Leu Ala Val Tyr
85 90 95
Tyr Cys Ala Arg
100
<210> 59
<211> 100
<212> PRT
<213> Homo Sapiens
<400> 59
Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asp His
20 25 30
Tyr Met Ser Trp Val Arg Gln Ala Gln Gly Lys Gly Leu Glu Leu Val
35 40 45
Gly Leu Ile Arg Asn Lys Ala Asn Ser Tyr Thr Thr Glu Tyr Ala Ala
50 55 60
Ser Val Lys Gly Arg Leu Thr Ile Ser Arg Glu Asp Ser Lys Asn Thr
65 70 75 80
Leu Tyr Leu Gln Met Ser Ser Leu Lys Thr Glu Asp Leu Ala Val Tyr
29
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
85 90 95
Tyr Cys Ala Arg
100
<210> 60
<211> 98
<212> PRT
<213> Homo Sapiens
<400> 60
Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Arg
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Asp Asp Tyr
20 25 30
Ala Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
Ser Gly Ile Ser Trp Asn Ser Gly Ser Ile Gly Tyr Ala Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr
65 70 75 80
Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Leu Tyr Tyr Cys
85 90 95
Ala Lys
<210> 61
<211> 98
<212> PRT
<213> Homo Sapiens
<400> 61
Glu Val Gln Leu Val Glu Ser Gly Gly Gly Val Val Arg Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Asp Asp Tyr
20 25 30
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
Gly Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
Ser Gly Ile Asn Trp Asn Gly Gly Ser Thr Gly Tyr Ala Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr
65 70 75 80
Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Leu Tyr His Cys
85 90 95
Ala Arg
<210> 62
<211> 98
<212> PRT
<213> Homo Sapiens
<400> 62
Glu Val Gln Leu Val Glu Ser Gly Gly Val Val Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Asp Asp Tyr
20 25 30
Thr Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
Ser Leu Ile Ser Trp Asp Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Ser Leu Tyr
65 70 75 80
Leu Gln Met Asn Ser Leu Arg Thr Glu Asp Thr Ala Leu Tyr Tyr Cys
85 90 95
Ala Lys
<210> 63
<211> 98
<212> PRT
31
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
<213> Homo sapiens
<400> 63
Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asp Tyr
20 25 30
Tyr Met Ser Trp Tle Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
Ser Tyr Ile Ser Ser Ser Gly Ser Thr Ile Tyr Tyr Ala Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asri Ser Leu Tyr
65 70 75 80
Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg
<210> 64
<211> 100
<212> PRT
<213> Homo Sapiens
<400> 64
Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asn Ala
20 25 30
Trp Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
Gly Arg Ile Lys Ser Lys Thr Asp Gly Gly Thr Thr Asp Tyr Ala Ala
50 55 ' 60
Pro Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asp Ser Lys Asn Thr
65 70 75 80
Leu Tyr Leu Gln Met Asn Ser Leu Lys Thr Glu Asp Thr Ala Val Tyr
85 90 95
32
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
Tyr Cys Thr Thr
100
<210> 65
<211> 98
<212> PRT
<213> Homo Sapiens
<400> 65
Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Pro Ala Ser Gly Phe Thr Phe Ser Asn His
20 25 30
Tyr Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
Ser Tyr Ile Ser Gly Asp Ser Gly Tyr Thr Asn Tyr Ala Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Asn Asn Ser Pro Tyr
65 70 75 80
Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Val Lys
<210> 66
<211> 98
<212> PRT
<213> Homo sapiens
<400> 66
Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asn His
20 25 30
Tyr Thr Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
33
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
35 40 45
Ser Tyr Ser Ser Gly Asn Ser Gly Tyr Thr Asn Tyr Ala Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr
65 70 75 80
Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Val Lys
<210> 67
<211> 98
<212> PRT
<213> Homo sapiens
<400> 67
Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asn Ser
20 25 30
Asp Met Asn Trp Val His Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
Ser Gly Val Ser Trp Asn Gly Ser Arg Thr His Tyr Ala Asp Ser Val
50 55 60
Lys Gly Arg Phe Ile Ile Ser Arg Asp Asn Ser Arg Asn Thr Leu Tyr
65 70 75 80
Leu Gln Thr Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Val Arg
<210> 68
<211> 97
<212> PRT
<213> Homo Sapiens
34
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
<400> 68
Glu Val Gln Leu Val Glu Thr Gly Gly Gly Leu Ile Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Val Ser Ser Asn
20 25 30
Tyr Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
Ser Val Ile Tyr Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys
50 55 60
Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu
65 70 75 80
Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala
85 90 95
Arg
<210> 69
<211> 97
<212> PRT
<213> Homo Sapiens
<400> 69
Glu .Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Val Ser Ser Asn
20 25 30
Tyr Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
Ser Val Ile Tyr Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys
50 55 60
Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu
65 70 75 80
Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala
85 90 95
Arg
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
<210> 70
<211> 97
<212> PRT
<213> Homo sapiens
<400> 70
Glu Val Gln Leu Val His Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Gly Ser Gly Phe Thr Phe Ser Ser Tyr
20 25 30
Ala Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
Ser Ala Ile Gly Thr Gly Gly Gly Thr Tyr Tyr Ala Asp Ser Val Lys
50 55 60
Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr Leu
65 70 75 80
Gln Met Asn Ser Leu Arg. Ala Glu Asp Met Ala Val Tyr Tyr Cys Ala
85 90 95
Arg
<210> 71
<211> 97
<212> PRT
<213> Homo Sapiens
<400> 71
Glu Val Gln Leu Val Gln Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Gly Ser Gly Phe Thr Phe Ser Ser Tyr
20 25 30
Ala Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
36
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
Ser Ala Ile Gly Thr Gly Gly Gly Thr Tyr Tyr Ala Asp Ser Val Lys
50 55 60
Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr Leu
65 70 75 80
Gln Met Asn Ser Leu Arg Ala Glu Asp Met Ala Val Tyr Tyr Cys Ala
85 90 95
Arg
<210> 72
<211> 98
<212> PRT
<213> Homo Sapiens
<400> 72
Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ser Ala Ser Gly Phe Thr Phe Ser Ser Tyr
20 25 30
Ala Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Tyr Val
35 40 45
Ser Ala Ile Ser Ser Asn Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr
65 70 75 80
Val Gln Met Ser Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Val Arg
<210> 73
<211> 35
<212> PRT
<213> Homo Sapiens
37
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
<400> 73
Thr Phe Ser Ser Tyr Ala Met His Trp Val Arg Gln Ala Pro Gly Lys
1 5 10 15
Gly Leu Glu Tyr Val Ser Ala Ile Ser Ser Asn Gly Gly Ser Thr Tyr
20 25 30
Tyr Ala Asp
<210> 74
<211> 98
<212> PRT
<213> Homo Sapiens
<400> 74
Gln Val Gln Leu Val Glu Ser Gly Gly Gly Val Val Gln Pro Gly Arg
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr
20 25 30
Ala Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
Ala Val Ile Ser Tyr Asp Gly Ser Asn Lys Tyr Tyr Ala Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr
65 70 75 80
Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg
<210> 75
<211> 98
<212> PRT
<213> Homo sapiens
<400> 75
38
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
Gln Val Gln Leu Val Glu Ser Gly Gly Gly Val Val Gln Pro Gly Arg
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr
20 25 30
Ala Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
Ala Val Ile Ser Tyr Asp Gly Ser Asn Lys Tyr Tyr Ala Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr
65 70 75 80
Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg
<210> 76
<211> 98
<212> PRT
<213> Homo sapiens
<400> 76
Gln Val Gln Leu Val Glu Ser Gly Gly Gly Val Val Gln Pro Gly Arg
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr
20 25 30
Ala Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
Ala Val Ile Ser Tyr Asp Gly Ser Asn Lys Tyr Tyr Ala Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr
65 70 75 80
Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg
39
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
<210> 77
<211> 98
<212> PRT
<213> Homo Sapiens
<400> 77
Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr
20 25 30
Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
Ser Ala Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr
65 70 75 80
Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Lys
<210> 78
<211> 97
<212> PRT
<213> Homo Sapiens
<400> 78
Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr
20 25 30
Asp Met His Trp Val Arg Gln Ala Thr Gly Lys Gly Leu Glu Trp Val
35 40 45
Ser Ala Ile Gly Thr Ala Gly Asp Thr Tyr Tyr Pro Gly Ser Val Lys
50 55 60
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
Gly Arg Phe Thr Ile Ser Arg Glu Asn Ala Lys Asn Ser Leu Tyr Leu
65 70 75 80
Gln Met Asn Ser Leu Arg Ala Gly Asp Thr Ala Val Tyr Tyr Cys Ala
85 90 95
Arg
<210> 79
<211> 98
<212> PRT
<213> Homo Sapiens
<400> 79
Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cxs Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr
20 25 30
Glu Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
Ser Tyr Ile Ser Ser Ser Gly Ser Thr Ile Tyr Tyr Ala Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr
65 70 75 80
Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg
<210> 80
<211> 98
<212> PRT
<213> Homo Sapiens
<400> 80
Gln Val Gln Leu Val Glu Ser Gly Gly Gly Val Val Gln Pro Gly Arg
41
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr
20 25 30
Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
Ala Val Ile Ser Tyr Asp Gly Ser Asn Lys Tyr Tyr Ala Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr
65 70 75 80
Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Lys
<210> 81
<211> 98
<212> PRT
<213> Homo Sapiens
<400> 81
Gln Val Gln Leu Val Glu Ser Gly Gly Gly Val Val Gln Pro Gly Arg
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr
20 25 30
Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
Ala Val Ile Trp Tyr Asp Gly Ser Asn Lys Tyr Tyr Ala Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr
65 70 75 80
Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg
<210> 82
42
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
<211> 98
<212> PRT
<213> Homo sapiens
<400> 82
Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr
20 25 30
Ser Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
Ser Tyr Ile Ser Ser Ser Ser Ser Thr Ile Tyr Tyr Ala Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr
65 70 75 80
Leu Gln Met Asn Ser Leu Arg Asp Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg
<210> 83
<211> 97
<212> PRT
<213> Homo Sapiens
<400> 83
Glu Asp Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Pro Ser Cys Ala Ala Ser Gly Phe Ala Phe Ser Ser Tyr
20 25 30
Val Leu His Trp Val Arg Arg Ala Pro Gly Lys Gly Pro Glu Trp Val
35 40 45
Ser Ala Ile Gly Thr Gly Gly Asp Thr Tyr Tyr Ala Asp Ser Val Met
50 55 60
Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Lys Ser Leu Tyr Leu
65 70 75 80
43
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
Gln Met Asn Ser Leu Ile Ala Glu Asp Met Ala Val Tyr Tyr Cys Ala
85 90 95
Arg
<210> 84
<211> 98
<212> PRT
<213> Homo sapiens
<400> 84
Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr
20 25 30
Trp Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Val Trp Val
35 40 45
Ser Arg Ile Asn Ser Asp Gly Ser Ser Thr Thr Tyr Ala Asp Ser Val
50 55 60
Lys.Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Leu Tyr
65 70 75 80
Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg
<210> 85
<211> 98
<212> PRT
<213> Homo sapiens
<400> 85
Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
44
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr
20 25 30
Trp Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
Ala Asn Ile Lys Gln Asp Gly Ser Glu Lys Tyr Tyr Val Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr
65 70 75 80
Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg
<210>86
<211>97
<212>PRT
<213>Homo sapiens
<400> 86
Gln Val Gln Leu Gln Gln Trp Gly Ala Gly Leu Leu Lys Pro Ser Glu
1 5 10 15
Thr Leu Ser Leu Thr Cys Ala Val Tyr Gly Gly Ser Phe Ser Gly Tyr
20 25 30
Tyr Trp Ser Trp Ile Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp Ile
35 40 45
Gly Glu Ile Ile His Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu Lys
50 55 60
Ser Arg Val Thr Ile Ser Val Asp Thr Ser Lys Asn Gln Phe Ser Leu
65 70 75 80
Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys Ala
85 90 95
Arg
<210> 87
<211> 97
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
<212> PRT
<213> Homo sapiens
<400> 87
Gln Val Gln Leu Gln Gln Trp Gly Ala Gly Leu Leu Lys Pro Ser Glu
1 5 10 15
Thr Leu Ser Leu Thr Cys Ala Val Tyr Gly Gly Ser Phe Ser Gly Tyr
20 25 30
Tyr Trp Ser Trp Ile Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp Ile
35 40 45
Gly Glu Ile Asn His Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu Lys
50 55 60
Ser Arg Val Thr Ile Ser Val Asp Thr Ser Lys Asn Gln Phe Ser Leu
65 70 75 80
Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys Ala
85 90 95
Arg
<210> 88
<211> 97
<212> PRT
<213> Homo sapiens
<400> 88
Gln Val Gln Leu Gln Gln Trp Gly Ala Gly Leu Leu Lys Pro Ser Glu
1 5 10 15
Thr Leu Ser Leu Thr Cys Ala Val Tyr Gly Gly Ser Val Ser Gly Tyr
20 25 30
Tyr Trp Ser Trp Ile Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp Ile
35 40 45
Gly Tyr Ile Tyr Tyr Ser Gly Ser Thr Asn Asn Asn Pro Ser Leu Lys
50 55 60
Ser Arg Ala Thr Ile Ser Val Asp Thr Ser Lys Asn Gln Phe Ser Leu
65 70 75 80
Asn Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Cys Cys Ala
46
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
85 90 95
Arg
<210> 89
<211> 99
<212> PRT
<213> Homo sapiens
<400> 89
Gln Leu Gln Leu Gln Glu Ser Gly Ser Gly Leu Val Lys Pro Ser Gln
1 5 10 15
Thr Leu Ser Leu Thr Cys Ala Val Ser Gly Gly Ser Ile Ser Ser Gly
20 25 30
Gly Tyr Ser Trp Ser Trp Ile Arg Gln Pro Pro Gly Lys Gly Leu Glu
35 40 45
Trp Ile Gly Tyr Ile Tyr His Ser Gly Ser Thr Tyr Tyr Asn Pro Ser
50 55 60
Leu Lys Ser Arg Val Thr Ile Ser Val Asp Arg Ser Lys Asn Gln Phe
65 70 75 80
Ser Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr
85 90 95
Cys Ala Arg
<210> 90
<211> 99
<212> PRT
<213> Homo Sapiens
<400> 90
Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Gln
1 5 10 15
Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Gly Ser Ile Ser Ser Gly
20 25 30
47
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
Gly Tyr Tyr Trp Ser Trp Ile Arg Gln His Pro Gly Lys Gly Leu Glu
35 40 45
Trp Ile Gly Tyr Ile Tyr Tyr Ser Gly Ser Thr Tyr Tyr Asn Pro Ser
50 55 60
Leu Lys Ser Arg Val Thr Ile Ser Val Asp Thr Ser Lys Asn Gln Phe
65 70 75 80
Ser Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr
85 90 95
Cys Ala Arg
<210> 91
<211> 99
<212> PRT
<213> Homo Sapiens
<400> 91
Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Glu
1 5 10 15
Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Gly Ser Val Ser Ser Gly
20 25 30
Ser Tyr Tyr Trp Ser Trp Ile Arg Gln Pro Pro Gly Lys Gly Leu Glu
35 40 45
Trp Ile Gly Tyr Ile Tyr Tyr Ser Gly Ser Thr Asn Tyr Asn Pro Ser
50 55 60
Leu Lys Ser Arg Val Thr Ile Ser Val Asp Thr Ser Lys Asn Gln Phe
65 70 75 80
Ser Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr
85 90 95
Cys Ala Arg
<210> 92
<211> 98
<212> PRT
48
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
<213> Homo Sapiens
<400> 92
Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Glu
1 5 10 15
Thr Leu Ser Leu Thr Cys Ala Val Ser Gly Tyr Ser Ile Ser Ser Gly
20 25 30
Tyr Tyr Trp Gly Trp Ile Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp
35 40 45
Ile Gly Ser Ile Tyr His Ser Gly Ser Thr Tyr Tyr Asn Pro Ser Leu
50 55 60
Lys Ser Arg Val Thr Ile Ser Val Asp Thr Ser Lys Asn Gln Phe Ser
65 70 75 80
Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg
<210> 93
<211> 98
<212> PRT
<213> Homo Sapiens
<400> 93
Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Glu
1 5 10 15
Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Tyr Ser Ile Ser Ser Gly
20 25 30
Tyr Tyr Trp Gly Trp Ile Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp
35 40 45
Ile Gly Ser Ile Tyr His Ser Gly Ser Thr Tyr Tyr Asn Pro Ser Leu
50 55 60
Lys Ser Arg Val Thr Ile Ser Val Asp Thr Ser Lys Asn Gln Phe Ser
65 70 75 80
Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys
85 90 95
49
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
Ala Arg
<210>94
<211>98
<212>PRT
<213>Homo Sapiens
<400> 94
Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Asp
1 5 10 15
Thr Leu Ser Leu Thr Cys Ala Val Ser Gly Tyr Ser Ile Ser Ser Ser
20 25 30
Asn Trp Trp Gly Trp Ile Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp
35 40 45
Ile Gly Tyr Ile Tyr Tyr Ser Gly Ser Thr Tyr Tyr Asn Pro Ser Leu
50 55 60
Lys Ser Arg Val Thr Met Ser Val Asp Thr Ser Lys Asn Gln Phe Ser
65 70 75 80
Leu Lys Leu Ser Ser Val Thr Ala Val Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg
<210> 95
<211> 98
<212> PRT
<213> Homo Sapiens
<400> 95
Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Gln
1 5 10 15
Thr Leu Ser Leu Thr Cys Ala Val Ser Gly Tyr Ser Ile Ser Ser Ser
20 25 30
Asn Trp Trp Gly Trp Ile Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
35 40 45
Ile Gly Tyr Ile Tyr Tyr Ser Gly Ser Ile Tyr Tyr Asn Pro Ser Leu
50 55 60
Lys Ser Arg Val Thr Met Ser Val Asp Thr Ser Lys Asn Gln Phe Ser
65 70 75 80
Leu Lys Leu Ser Ser Val Thr Ala Val Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg
<210> 96
<211> 98
<212> PRT
<213> Homo sapiens
<400> 96
Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Glu
1 5. 10 15
Thr Leu Ser Leu Thr Cys Val Val Ser Gly Gly Ser Ile Ser Ser Ser
20 25 30
Asn Trp Trp Ser Trp Val Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp
35 40 45
Ile Gly Glu Ile Tyr His Ser Gly Asn Pro Asn Tyr Asn Pro Ser Leu
50 55 60
Lys Ser Arg Val Thr Ile Ser Ile Asp Lys Ser Lys Asn Gln Phe Ser
65 70 75 80
Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg
<210> 97
<211> 98
<212> PRT
<213> Homo Sapiens
51
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
<400> 97
Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Glu
1 5 10 15
Thr Leu Ser Leu Thr Cys Val Val Ser Gly Gly Ser Ile Ser Ser Ser
20 25 30
Asn Trp Trp Ser Trp Val~Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp
35 40 45
Ile Gly Glu Ile Tyr His Ser Gly Ser Pro Asn Tyr Asn Pro Ser Leu
50 55 60
Lys Ser Arg Val Thr Ile Ser Val Asp Lys Ser Lys Asn Gln Phe Ser
65 70 75 80
Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg
<210> 98
<211> 98
<212> PRT
<213> Homo Sapiens
<400> 98
Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Pro Gly
1 5 10 15
Thr Leu Ser Leu Thr Cys Ala Val Ser Gly Gly Ser Ile Ser Ser Ser
20 25 30
Asn Trp Trp Ser Trp Val Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp
35 40 45
Ile Gly Glu Ile Tyr His Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu
50 55 60
Lys Ser Arg Val Thr Ile Ser Val Asp Lys Ser Lys Asn Gln Phe Ser
65 70 75 80
Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Cys Cys
85 90 95
Ala Arg
52
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
<210>99
<211>98
<212>PRT
<213>Homo Sapiens
<400> 99
Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Gly
1 5 10 15
Thr Leu Ser Leu Thr Cys Ala Val Ser Gly Gly Ser Ile Ser Ser Ser
20 25 30
Asn Trp Trp Ser Trp Val Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp
35 40 45
Ile Gly Glu Ile Tyr His Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu
50 55 60
Lys $er Arg Val Thr Ile Ser Val Asp Lys Ser Lys Asn Gln Phe Ser
65 70 75 80
Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg
<210> 100
<211> 99
<212> PRT
<213> Homo sapiens
<400> 100
Gln Leu Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Glu
1 5 10 15
Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Gly Ser Ile Ser Ser Ser
20 25 30
Ser Tyr Tyr Trp Gly Trp Ile Arg Gln Pro Pro Gly Lys Gly Leu Glu
35 40 45
53
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
Trp Ile Gly Ser Ile Tyr Tyr Ser Gly Ser Thr Tyr Tyr Asn Pro Ser
50 55 60
Leu Lys Ser Arg Val Thr Ile Ser Val Asp Thr Ser Lys Asn Gln Phe
65 70 75 80
Ser Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr
85 90 95
Cys Ala Arg
<210> 101
<211> 99
<212> PRT
<213> Homo sapiens
<400> 101
Gln Leu Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Glu
1 5 10 15
Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Gly Ser Ile Ser Ser Ser
20 25 30
Ser Tyr Tyr Trp Gly Trp Ile Arg Gln Pro Pro Gly Lys Gly Leu Glu
35 40 45
Trp Ile Gly Ser Ile Tyr Tyr Ser Gly Ser Thr Tyr Tyr Asn Pro Ser
50 55 60
Leu Lys Ser Arg Val Thr Ile Ser Val Asp Thr Ser Lys Asn His Phe
65 70 75 80
Ser Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr
85 90 95
Cys Ala Arg
<210>102
<211>97
<212>PRT
<213>Homo sapiens
<400> 102
54
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Glu
1 5 10 15
Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Gly Ser Ile Ser Ser Tyr
20 25 30
Tyr Trp Ser Trp Ile Arg Gln Pro Ala Gly Lys Gly Leu Glu Trp Ile
35 40 45
Gly Arg Ile Tyr Thr Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu Lys
50 55 60
Ser Arg Val Thr Asn Ser Val Asp Thr Ser Lys Asn Gln Phe Ser Leu
65 70 75 80
Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys Ala
85 90 95
Arg
<210> 103
<211> 97
<212> PRT
<213> Homo Sapiens
<400> 103
Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Glu
1 5 10 15
Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Gly Ser Ile Ser Ser Tyr
20 25 30
Tyr Trp Ser Trp Ile Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp Ile
35 40 45
Gly Tyr Ile Tyr Tyr Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu Lys
50 55 60
Ser Arg Val Thr Ile Ser Val Asp Thr Ser Lys Asn Gln Phe Ser Leu
65 70 75 80
Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys Ala
85 90 95
Arg
<210> 104
<211> 97
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
<212> PRT
<213> Homo Sapiens
<400> 104
Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Glu
1 5 10 15
Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Gly Ser Val Ser Ser Tyr
20 25 30
Tyr Trp Ser Trp Ile Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp Ile
35 40 45
Gly Tyr Ile Tyr Tyr Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu Lys
50 55 60
Ser Arg Val Thr Ile Ser Val Asp Thr Ser Lys Met Gln Phe Ser Leu
65 70 75 80
Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys Ala
85 90 95
Arg
<210> 105
<211> 97
<212> PRT
<213> Homo Sapiens
<400> 105
Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Asp
1 5 10 15
Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Gly Ser Ile Ser Ser Tyr
20 25 30
Tyr Trp Ser Trp Ile Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp Ile
35 40 45
Gly Tyr Ile Tyr Tyr Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu Lys
50 55 60
Ser Arg Val Thr Ile Ser Val Asp Thr Ser Lys Asn Gln Phe Ser Leu
65 70 75 80
Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys Ala
85 90 95
56
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
Arg
<210> 106
<211> 98
<212> PRT
<213> Homo sapiens
<400> 106
Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Glu
1 5 10 15
Ser Leu Lys Ile Ser Cys Lys Gly Ser Gly Tyr Ser Phe Thr Ser Tyr
20 25 30
Trp Ile Gly Trp Val Arg Gln Met Pro Gly Lys Gly Leu Glu Trp Met
35 40 45
Gly Ile Ile Tyr Pro Gly Asp Ser Asp Thr Arg Tyr Ser Pro Ser Phe
50 55 60
Gln Gly Gln Val Thr Ile Ser Ala Asp Lys Ser Ile Ser Thr Ala Tyr
65 70 75 80
Leu Gln Trp Ser Ser Leu Lys Ala Ser Asp Thr Ala Met Tyr Tyr Cys
85 90 95
Ala Arg
<210> 107
<211> 98
<212> PRT
<213> Homo sapiens
<400> 107
Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Glu
1 5 10 15
Ser Leu Lys Ile Ser Cys Lys Gly Ser Gly Tyr Ser Phe Thr Ser Tyr
20 25 30
Trp Ile Gly Trp Val Arg Gln Met Pro Gly Lys Gly Leu Glu Trp Met
35 40 45
Gly Ile Ile Tyr Pro Gly Asp Ser Asp Thr Arg Tyr Ser Pro Ser Phe
50 55 60
57
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
Gln Gly Gln Val Thr Ile Ser Ala Asp Lys Pro Ile Ser Thr Ala Tyr
65 70 75 80
Leu Gln Trp Ser Ser Leu Lys Ala Ser Asp Thr Ala Met Tyr Tyr Cys
85 90 95
Ala Arg
<210> 108
<211> 98
<212> PRT
<213> Homo sapiens
<400> 108
Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Glu
1 5 10 15
Ser Leu Lys Ile Ser Cys Lys Gly Ser Gly Tyr Ser Phe Thr Ser Tyr
20 25 30
Trp Ile Gly Trp Val Arg Gln Met Pro Gly Lys Gly Leu Glu Trp Met
35 40 45
Gly Ile Ile Tyr Pro Gly Asp Ser Asp Thr Arg Tyr Ser Pro Ser Phe
50 55 60
Gln Gly Gln Val Thr Ile Ser Ala Asp Lys Ser Ile Ser Thr Ala Tyr
65 70 75 80
Leu Gln Trp Ser Ser Leu Lys Ala Ser Asp Thr Ala Met Tyr Tyr Cys
85 ~ 90 95
Ala Arg
<210> 109
<211> 98
<212> PRT
<213> Homo sapiens
<400> 109
Glu Val Gln Leu Leu Gln Ser Ala Ala Glu Val Lys Arg Pro Gly Glu
1 . 5 10 15
Ser Leu Arg Ile Ser Cys Lys Thr Ser Gly Tyr Ser Phe Thr Ser Tyr
58
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
20 25 30
Trp Ile His Trp Val Arg Gln Met Pro Gly Lys Glu Leu Glu Trp Met
35 40 45
Gly Ser Ile Tyr Pro Gly Asn Ser Asp Thr Arg Tyr Ser Pro Ser Phe
50 55 60
Gln Gly His Val Thr Ile Ser Ala Asp Ser Ser Ser Ser Thr Ala Tyr
65 70 75 80
Leu Gln Trp Ser Ser Leu Lys Ala Ser Asp Ala Ala Met Tyr Tyr Cys
85 90 95
Val Arg
<210> 110
<211> 98
<212> PRT
<213> Homo Sapiens
<400> 110
Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Glu
1 5 10 15
Ser Leu Arg Ile Ser Cys Lys Gly Ser Gly Tyr Ser Phe Thr Ser Tyr
20 25 30
Trp Ile Ser Trp Val Arg Gln Met Pro Gly Lys Gly Leu Glu Trp Met
35 40 45
Gly Arg Ile Asp Pro Ser Asp Ser Tyr Thr Asn Tyr Ser Pro Ser Phe
50 55 60
Gln Gly His Val Thr Ile Ser Ala Asp Lys Ser Ile Ser Thr Ala Tyr
65 70 75 80
Leu Gln Trp Ser Ser Leu Lys Ala Ser Asp Thr Ala Met Tyr Tyr Cys
85 90 95
Ala Arg
<210> 111
<211> 98
<212> PRT
<213> Homo sapiens
59
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
<400> 111
Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Glu
1 5 10 15
Ser Leu Arg Ile Ser Cys Lys Gly Ser Gly Tyr Ser Phe Thr Ser Tyr
20 25 30
Trp Ile Ser Trp Val Arg Gln Met Pro Gly Lys Gly Leu Glu Trp Met
35 40 45
Gly Arg Ile Asp Pro Ser Asp Ser Tyr Thr Asn Tyr Ser Pro Ser Phe
50 55 60
Gln Gly His Val Thr Ile Ser Ala Asp Lys Ser Ile Ser Thr Ala Tyr
65 70 75 80
Leu Gln Trp Ser Ser Leu Lys Ala Ser Asp Thr Ala Met Tyr Tyr Cys
85 90 95
Ala Arg
<210> 112
<211> 101
<212> PRT
<213> Homo sapiens
<400> 112
Gln Val Gln Leu Gln Gln Ser Gly Pro Gly Leu Val Lys Pro Ser Gln
1 5 10 15
Thr Leu Ser Leu Thr Cys Ala Ile Ser Gly Asp Ser Val Ser Ser Asn
20 25 30
Ser Ala Ala Trp Asn Trp Ile Arg Gln Ser Pro Ser Arg Gly Leu Glu
35 40 45
Trp Leu Gly Arg Thr Tyr Tyr Arg Ser Lys Trp Tyr Asn Asp Tyr Ala
50 55 60
Val Ser Val Lys Ser Arg Ile Thr Ile Asn Pro Asp Thr Ser Lys Asn
65 70 75 80
Gln Phe Ser Leu Gln Leu Asn Ser Val Thr Pro Glu Asp Thr Ala Val
85 90 95
Tyr Tyr Cys Ala Arg
100
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
<210> 113
<211> 87
<212> PRT
<213> Homo Sapiens
<400> 113
Arg Lys Leu Gly Ala Ser Val Lys Val Ser Arg Lys Ala Ser Ser Tyr
1 5 10 15
Thr Phe Thr Ser Tyr Asp Ile His Cys Val Arg Gln Ala Pro Gly Lys
20 ~ 25 30
Gly Leu Lys Gly Trp Met Gly Gly Ile Tyr Ser Gly Asn Gly Lys Thr
35 40 45
Gly Tyr Ala Gln Lys Phe Gln Arg Val Thr Met Thr Arg Asp Met Ser
50 55 60
Thr Ser Thr Ala Tyr Met Glu Leu Ser Ser Gln Arg Ser Glu Asp Ile
65 70 75 80
Asp Val Tyr Tyr Cys Ala Arg
<210> 114
<211> 5
<212> PRT
<213> Homo Sapiens
<400> 114
Asp Tyr Gly Met Ser
1 5
<210> 115
<211> 17
<212> PRT
<213> Homo Sapiens
<400> 115
Gly Ile Asn Trp Asn Gly Gly Ser Thr Gly Tyr Ala Asp Ser Val Lys
1 5 10 15
61
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
Gly
<210> 116
<211> 11
<212> PRT
<213> Homo sapiens
<400> 116
Trp Gly Gln Gly Thr Leu Val Thr Val Ser Arg
1 5 10
<210> 117
<211> 11
<212> PRT
<213> Homo sapiens
<400> 117
Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala Arg
1 5 10
<210> 118
<211> 11
<212> PRT
<213> Homo Sapiens
<400> 118
Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn
1 5 10
<210> 119
<211> 8
<212> PRT
<213> Homo Sapiens
62
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
<400> 119
Gly Lys Gly Leu Glu Trp Val Ser
1 5
<210> 120
<211> 6
<212> PRT
<213> Homo Sapiens
<400> 120
Trp Val Arg Gln Ala Pro
1 5
<210> 121
<211> 11
<212> PRT
<213> Homo Sapiens
<400> 121
Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Asp
1 5 l0
<210> 122
<211> 7
<212> PRT
<213> Homo Sapiens
<400> 122
Ala Val Tyr Tyr Cys Ala Arg
1 5
<210> 123
<211> 20
<212> PRT
<213> Homo Sapiens
63
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
<400> 123
Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly
1 5 10 15
Gly Gly Gly Ser
<210> 124
<211> 15
<212> PRT
<213> Homo sapiens
<400> 124
Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser
1 5 10 15
<210> 125
<211> 9
<212> PRT
<213> Homo Sapiens
<400> 125
Asn Ser Arg Asp Ser Ser Gly Asn His
1 5
<210> 126
<211> 8
<212> PRT
<213> Homo sapiens
<400> 126
Ala Ala Trp Asp Asp Ser Leu Val
1 5
<210> 127
<211> 8
64
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
<212> PRT
<213> Homo Sapiens
<400> 127
Met Gln Ser Ile Gln Leu Pro Thr
1 5
<210> 128
<211> 9
<212> PRT
<213> Homo Sapiens
<400> 128
Met Gln Ser Ile Gln Leu Pro Ala Thr
1 5
<210> 129
<211> 10
<212> PRT
<213> Homo Sapiens
<400> 129
Ala Ala Trp Asp Asp Gly Leu Ser Leu Val
1 5 10
<210> 130
<211> 10
<212> PRT
<213> Homo Sapiens
<400> 130
Ala Ala Trp Asp Asp Ser Leu Ser Gly Val
1 5 10
<210> 131
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
<211> 11
<212> PRT
<213> Homo Sapiens
<400> 131
Asn Ser Arg Asp Ser Ser Gly Ser Val Arg Val
1 5 10
<210> 132
<211> 9
<212> PRT
<213> Homo Sapiens
<400> 132
Leu Leu Tyr Tyr Gly Gly Ala Tyr Val
1 5
<210> 133
<211> 11
<212> PRT
<213> Homo Sapiens
<400> 133
Asn Ser Arg Asp Ser Ser Gly Val Ser Arg Val
1 5 10
<210> 134
<211> 10
<212> PRT
<213> Homo Sapiens
<400> 134
Ala Ala Trp Asp Asp Ser Leu Pro Tyr Val
1 5 10
66
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
<210> 135 ..
<211> 12
<212> PRT
<213> Homo Sapiens
<400> 135
Ala Ala Trp Asp Asp Ser Leu Cys Pro Glu Phe Val
1 5 10
<210> 136
<211> 11
<212> PRT
<213> Homo Sapiens
<400> 136
Ala Ala Trp Asp Asp Ser Leu Ala Trp Phe Val
1 5 10
<210> 137
<211> 10
<212> PRT
<213> Homo Sapiens
<400> 137
Leu Ala Trp Asp Thr Ser Pro Arg Trp Val
1 5 10
<210> 138
<211> 10
<212> PRT
<213> Homo sapiens
<400> 138
Thr Ala Trp Asp Asp Ser Leu Ala Val Val
1 5 10
67
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
<210> 139
<211> 11
<212> PRT
<213> Homo Sapiens
<400> 139
Asn Ser Arg Asp Ser Ser Gly Asn His Arg.Val
1 5 10
<210> 140
<211> 9
<212> PRT
<213> Homo Sapiens
<400> 140
Gln Gln Tyr Gly Ser Ser Gln Arg Thr
1 5
<210> 141
<211> 10
<212> PRT
<213> Homo Sapiens
<400> 141
Ala Ala Trp Asp Asp Ser Leu Arg Leu Val
1 5 10
<210> 142
<211> 9
<212> PRT
<213> Homo Sapiens
<400> 142
Met Gln Gly Thr His Trp Arg Pro Thr
68
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
1 5
<210> 143
<211> 9
<212>~ PRT
<213> Homo Sapiens
<400> 143
Met Gln Gly Lys His Trp Pro Leu Thr
1 5
<210> 144
<211> 9
<212> PRT
<213> Homo sapiens
<400> 144
Ala Ala Trp Asp Asp.Ser Leu Gly Phe
1 5
<210> 145
<211> 9
<212> PRT
<213> Homo Sapiens
<400> 145
Met Gln Gly Thr His Arg Arg Ala Thr
1 5
<210> 146
<211> 9
<212> PRT
<213> Homo Sapiens
<400> 146
69
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
Met Gln Ala Leu Gln Thr Pro Leu Thr
1 5
<210> 147
<211> 9
<212> PRT
<213> Homo sapiens
<400> 147
Met Arg Gly Thr His Arg Arg Ala Thr
1 5
<210> 148
<211> 9
<212> PRT
<213> Homo Sapiens
<400> 148
Met Gln Gly Thr His Trp His Pro Thr
1 5
<210> 149
<211> 8
<212> PRT
<213> Homo Sapiens
<400> 149
Met Gln Ala Leu Gln Ser Pro Thr
1 5
<210> 150
<211> 10
<212> PRT
<213> Homo Sapiens
<400> 150
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
Ala Ala Trp Asp Asp Ser Leu Ala Phe Val
1 5 10
<210> 151
<211> 8
<212> PRT
<213> Homo Sapiens
<400> 151
Met Gln Ala Leu Gln Thr Pro Thr
1 5
<210> 152
<211> 8
<212> PRT
<213> Homo Sapiens
<400> 152
Gln Gln Ser Tyr Ser Thr Arg Thr
1 5
<210> 153
<211> 9
<212> PRT
<213> Homo sapiens
<400> 153
Met Gln Gly Thr His Trp Pro Phe Thr
1 ' 5
<210> 154
<211> 9
<212> PRT
<213> Homo Sapiens
71
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
<400> 154
Met Gln Gly Thr His Trp Pro Ala Thr
1 5
<210> 155
<211> 10
<212> PRT
<213> Homo Sapiens
<400> 155
Ala Ala Trp Asp Asp Ser Leu Arg Ser Val
1 5 10
<210> 156
<211> 9
<212> PRT
<213> Homo Sapiens
<400> 156
Ala Ala Trp Asp Asp Ser Leu Leu Val
1 5
<210> 157
<211> 11
<212> PRT
<213> Homo sapiens
<400> 157
Asp Ser Trp Asp Asn Ser Leu Val Ser Pro Val
1 5 10
<210> 158
<211> 9
<212> PRT
<213> Homo Sapiens
72
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
<400> 158
Met Gln Ala Leu Gln Ser Pro Ala Thr
1 5
<210> 159
<211> 9
<212> PRT
<213> Homo Sapiens
<400> 159
Met Gln Ala Leu Gln Thr Pro Val Thr
1 5
<210> 160
<211> 11
<212> PRT
<213> Homo Sapiens
<400> 160
Ala Ala Trp Asp Asp Ser Leu Ser Ala Tyr Val
1 5 10
<210> 161
<211> 11
<212> PRT
<213> Homo Sapiens
<400> 161
Asn Ser Arg Asp Ser Ser Gly Arg Val Asn Val
1 5 10
<210> 162
<211> 8
<212> PRT
73
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
<213> Homo sapiens
<400> 162
Met Gln Ala Leu Arg Thr Arg Thr
1 5
<210> 163
<211> 11
<212> PRT
<213> Homo Sapiens
<400> 163
Ala Ala Trp Asp Asp Ser Leu Phe Tyr Pro Val
1 5 10
<210> 164
<211> 9
<212> PRT
<213> Homo Sapiens
<400> 164
Met Gln Gly Thr His Trp Pro Val Thr
1 5
<210> 165
<211> 8
<212> PRT
<213> Homo Sapiens
<400> 165
Met Gln Gly Thr His Trp Arg Thr
1 5
<210> 166
<211> 10
74
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
<212> PRT
<213> Homo Sapiens
<400> 166
Ala Ala Trp Asp Asp Ser Leu Phe Tyr Val
1 5 10
<210> 167
<211> 9
<212> PRT
<213> Homo Sapiens
<400> 167
Met Gln Ser Ile Gln Leu Pro Leu Thr
1 5
<210> 168
<211> 11
<212> PRT
<213> Homo Sapiens
<400> 168
Ala Ala Trp Asp Asp Ser Leu Leu Gly Ser Val
1 5 10
<210> 169
<211> 9
<212> PRT
<213> Homo Sapiens
<400> 169
Cys Ser Tyr Ala Gly Ser Ser Tyr Val
1 5
<210> 170
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
<211> 8
<212> PRT
<213> Homo Sapiens
<400> 170
Gln Gln Asp Tyr Asn Leu Leu Thr
1 5
<210> 171
<211> 10
<212> PRT
<213> Homo Sapiens
<400> 171
Val Leu Tyr Met Gly Ser Gly Ser Ala Val
1 5 10
<210> 172
<211> 9
<212> PRT
<213> Homo Sapiens
<400> 172
Met Gln Arg Ile Glu Phe Pro Asn Thr
1 5
<210> 173
<211> 11
<212> PRT
<213> Homo Sapiens
<400> 173
Ala Ala Trp Asp Asp Ser Leu Ala Cys Ala Val
1 5 10
76
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
<210> 174
<211> 8
<212> PRT
<213> Homo Sapiens
<400> 174
Gln G1n Ala Asn Ser Phe Arg Thr
1 5
<210> 175
<211> 11
<212> PRT
<213> Homo Sapiens
<400> 175
Ala Ala Trp Asp Asp Ser Leu Ser Arg Pro Val
1 5 10
<210>176
<211>10
<212>PRT
<213>Homo Sapiens
<400> 176
Ala Ala Trp Asp Asp Ser Leu Tyr Asn Val
1 5 10
<210>177
<211>11
<212>PRT
<213>Homo Sapiens
<400> 177
Ala Ala Trp Asp Asp Ser Leu Asn Arg Asn Val
1 5 10
77
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
<210> 178
<211> 8
<212> PRT
<213> Homo Sapiens
<400> 178
Met Gln Val Leu Gln Thr Arg Thr
1 5
<210> 179
<211> 8
<212> PRT
<213> Homo Sapiens
<400> 179
Met Gln Ala Leu Gln Thr Arg Thr
1 5
<210> 180
<211> 8
<212> PRT
<213> Homo sapiens
<400> 180
Gln Gln Ser Tyr Ser Thr Arg Met
1 5
<210> 181
<211> 8
<212> PRT
<213> Homo Sapiens
<400> 181
Met Gln Ala Leu Gln Thr Leu Thr
78
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
1 5
<210> 182
<211> 8
<212> PRT
<213> Homo Sapiens
<400> 182
Met Arg Ala Leu Gln Thr Pro Thr
1 5
<210> 183
<211> 11
<212> PRT
<213> Homo Sapiens
<400> 183
Ala Ala Trp Asp Asp Ser Leu Pro Gly Tyr Val
1 5 10
<210> 184
<211> 10
<212> PRT
<213> Homo Sapiens
<400> 184
Ala Ala Trp Asp Asp Ser Leu Gly Phe Val
1 5 10
<210> 185
<211> 10
<212> PRT
<213> Homo Sapiens
<400> 185
79
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
Ala Ala Trp Asp Asp Ser Leu Phe Leu Val
1 5 10
<210> 186
<211> 8
<212> PRT
<213> Homo Sapiens
<400> 186
Met Gln Ser Ile Gln Leu Arg Thr
1 5
<210> 187
<211> 10
<212> PRT
<213> Homo Sapiens
<400> 187
Ala Ala Trp Asp Asp Ser Leu Ser Ile Val
1 5 10
<210> 188
<211> 8
<212> PRT
<213> Homo Sapiens
<400> 188
Met Gln Gly Thr His Trp Pro Thr
1 5
<210> 189
<211> 8
<212> PRT
<213> Homo Sapiens
<400> 189
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
Met Gln Ala Leu His Thr Arg Thr
1 5
<210> 190
<211> 9
<212> PRT
<213> Homo Sapiens
<400> 190
Asn Ser Arg Asp Ser Ser Gly Ser Val
1 5
<210> 191
<211> 9
<212> PRT
<213> Homo sapiens
<400> 191
Gln Gln Tyr Gly Ser Ser Pro Tyr Thr
1 5
<210> 192
<211> 8
<212> PRT
<213> Homo Sapiens
<400> 192
Gln Gln Ser Tyr Ser Thr Arg Thr
1 5
<210> 193
<211> 9
<212> PRT
<213> Homo Sapiens
81
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
<400> 193
Gln Gln Ala Asn Ser Phe Ala Ala Thr
1 5
<210> 194
<211> 9
<212> PRT
<213> Homo sapiens
<400> 194
Gln Gln Ala Asn Ser Phe Pro Ala Thr
1 5
<210> 195
<211> 10
<212> PRT
<213> Homo Sapiens
<400> 195
Val Leu Tyr Met Gly Ser Gly Val Tyr Val
1 5 10
<210> 196
<211> 11
<212> PRT
<213> Homo Sapiens
<400> 196
Ala Ala Trp Asp Asp Ser Leu Trp Ser Ala Val
1 5 10
<210> 197
<211> 12
<212> PRT
<213> Homo Sapiens
82
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
<400> 197
Ala Ala Trp Asp Asp Ser Leu Pro Arg Arg Leu Val
1 5 10
<210> 198
<211> 11
<212> PRT
<213> Homo Sapiens
<400> 198
Ala Ala Trp Asp Asp Ser Leu Pro Ser Gly Val
1 5 10
<210> 199
<211> 8
<212> PRT
<213> Homo Sapiens
<400> 199
Met Gln Ala Leu Gln Thr Leu Thr
1 5
<210>200
<211>10
<212>PRT
<213>Homo Sapiens
<400> 200
Ala Ala Trp Asp Asp Gly Leu Leu Arg Val
1 5 10
<210> 201
<211> 10
<212> PRT
83
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
<213> Homo Sapiens
<400> 201
Ala Ala Trp Asp Asp Ser Leu Ala Leu Val
1 5 10
<210> 202
<211> 11
<212> PRT
<213> Homo Sapiens
<400> 202
Asn Ser Arg Asp Ser Ser Gly Phe Gln Leu Val
1 5 10
<210> 203
<211> 277
<212> PRT
<213> Homo Sapiens
<400> 203
Met Lys Tyr Leu Leu Pro Thr Ala Ala Ala Gly Leu Leu Leu Leu Ala
1 5 10 15
Ala Gln Pro Ala Met Ala Glu Val Gln Leu Val Glu Ser Gly Gly Gly
20 25 30
Val Val Arg Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly
35 40 45
Phe Thr Phe Asp Asp Tyr Gly Met Ser Trp Val Arg Gln Ala Pro Gly
50 55 60
Lys Gly Leu Glu Trp Val Ser Gly Ile Asn Trp Asn Gly Gly Ser Thr
65 70 75 80
Gly Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn
85 90 95
84
CA 02433227 2003-06-27
WO 02/059264 PCT/USO1/49440
Ala Lys Asn Ser Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp
100 105 110
Thr Ala Val Tyr Tyr Cys Ala Arg Leu Thr His Pro Tyr Phe~.Trp Gly
115 120 125
Gln Gly Thr Leu Val Thr Val Ser Arg Gly Gly Gly Gly Ser Gly Gly
130 135 140
Gly Gly Ser Gly Gly Gly Gly Ser Ser Glu Leu Thr Gln Asp Pro Ala
145 150 155 160
Val Ser Val Ala Leu Gly Gln Thr Val Arg Ile Thr Cys Gln Gly Asp
165 170 175
Ser Leu Arg Ser Tyr Tyr Ala Ser Trp Tyr Gln Gln Lys Pro Gly Gln
180 185 190
Ala Pro Val Leu Val Ile Tyr Gly Lys Asn Asn Arg Pro Ser Gly Ile
195 200 205
Pro Asp Arg Phe Ser Gly Ser Ser Ser Gly Asn Thr Ala Ser Leu Thr
210 215 220
Ile Thr Gly Ala Gln Ala Glu Asp Glu Ala Asp Tyr Tyr Cys Asn Ser
225 230 235 240
Arg Asp Ser Ser Gly Asn His Val Val Phe Gly Gly Gly Thr Lys Leu
245 250 255
Thr Val Leu Gly Ala Ala Ala Glu Gln Lys Leu Ile Ser Glu Glu Asp
260 265 270
Leu Asn Gly Ala Ala
275
