CA 02433436 2003-06-16
WO 02/50301 PCT/USO1/48276
Gene Expression Profiles Associated With Osteoblast Differentiation
Inventors
Darren Ji, Douglas W. Axelrod, Jonathon S. Cools, Neelam Jaiswal, Richard
Einstein,
Adam Houghton and Lawrence Mertz
Related Applicators
This application claims the benefit of U.S. Provisional Applications
60/255,882
(filed December 18, 2000) and 60/285,691 (filed April 24, 2001), all of which
are herein
incorporated by reference in their entirety.
Background Of The Invention
Bone is a dynamic tissue in which old tissue is broken down and new tissue is
synthesized. Control of the rate of breakdown and synthesis of new bone tissue
is critical
to the integrity of the skeletal structure. When the rates become unbalanced,
serious
conditions may result.
The process of synthesizing new bone tissue is mediated by osteoblasts. During
the process of synthesizing new bone tissue, osteoblasts differentiate from
precursor stem
cells to mature bone-forming cells. During this differentiation, numerous
genes undergo
changes in expression levels. The expression levels of various enzymes and
structural
proteins, for example alkaline phosphatase and Type-1 collagen, are up-
regulated while
other genes are down-regulated.
In order to treat a condition characterized by an imbalance in tha rates of
breakdown and synthesis of bone tissue, it may be desirable to increase or
decrease the
rate of break down and/or synthesis. Thus, in a number of clinical
applications, it may
desirable to enhance the rate of bone formation by promoting the
differentiation of
precursor stem cells into osteoblasts. One application wluch is particularly
important is
the treatment of osteoporosis which is characterized by a decrease in bone
mass making
the bones more fragile and subj ect to fracture. Other potential uses for
reagents capable
of affecting the synthesis of bone tissue include the healing of broken bones,
recovery
after surgical procedures involving bones and the like.
While the changes in the expression levels of a number of individual genes
have
CA 02433436 2003-06-16
WO 02/50301 PCT/USO1/48276
been identified, the investigation of the global changes in gene expression
which occur in
precursor stern cells as they differentiate into osteoblasts has not been
reported. Such
information would be useful, for example, in assessing the effects of a course
of
treatment designed to change the rate of formation of bone tissue.
Accordingly, there
exists a need for the investigation of the changes in global gene expression
levels as well
as the need for the identification of new molecular markers associated with
the
differentiation of precursor stem cells into osteoblasts. Furthermore,
identification of
additional genes involved in differentiation may allow development of reagents
designed
to alter their expression levels and thereby allow control of the
differentiation process. In
addition, identification of the genes involved in the process allows their use
as diagnostic
or prognostic markers which are uniquely associated with differentiation.
Summary Of The Invention
The present invention relates to the elucidation of the global changes in gene
expression in precursor stem cells undergoing the process of differentiation
into
osteoblasts.. In one aspect, the present invention relates to detecting a
change in an
expression level of one or more genes or gene families associated with the
differentiation
of one or more precursor stem cells into one or more osteoblasts. In a related
aspect, the
activity of a protein encoded by a gene or member of a gene family may be
assayed.
Such assays may be conducted by themselves or in conjunction with determining
an
expression level. In some aspects, it may be desirable to determine an
expression level
of one or more genes or members of a gene family in Table 1 while at the same
time
determining an activity level of one or more proteins encoded by a gene or
member of a
gene family of Table 1. The genes or member of gene families for which
expression
levels are determined may be the same or different as the genes encoding the
proteins
assayed. Thus, in some embodiments, it may be desirable to determine the
expression
level of a gene and the activity level of the protein encoded by the gene. In
other
embodiments, it may be desirable to determine the expression level of one gene
while
determining the activity level of a protein encoded by another gene. Those
skilled in the
art will appreciate that the expression and/or activity level of any number of
genes and
proteins may be determined according to the present invention.
2
CA 02433436 2003-06-16
WO 02/50301 PCT/USO1/48276
In a related aspect, the present invention includes methods of screening for
an
agent that modulates the differentiation of a precursor stem cell into an
osteoblast,
comprising: preparing a first gene or gene family expression profile and/or
assaying for
an activity of a protein encoded by a gene or member of a gene family of Table
1 in a
cell population comprising one or more precursor stem cells; contacting the
cell
population with an agent; preparing a second gene or gene family expression
profile
and/or assaying for an activity of a protein encoded by a gene or member of a
gene
family of Tables 1 or 2 of the cell population after being contacted with the
agent; and
comparing the first and second expression profiles and/or activities.
Tn one aspect, the present invention provides a method of diagnosing a
condition
characterized by abnormal deposition of bone tissue, comprising detecting the
level of
expression in a tissue sample of one or more genes or gene families from Table
1 and/or
assaying for an activity of a protein encoded by a gene or member of a gene
family of
Table 1, wherein differential expression and/or activity is indicative of
inadequate bone
tissue deposition.
In another aspect, the present invention also includes methods of monitoring
the
treatment of a patient with a condition characterized by abnormal bone tissue
deposition,
comprising administering a pharmaceutical composition to the patient,
preparing a gene
or gene family expression profile and/or assaying for an activity of a protein
encoded by
a gene or member of a gene family of Table 1 from a cell or tissue sample from
the
patient and comparing the patient expression profile andlor activity to an
expression
profile andfor activity from a precursor stem cell population or an osteoblast
cell
population.
In another aspect, the present invention also includes methods of treating a
patient
2S with a condition characterized by abnormal bone tissue deposition,
comprising
administering a pharmaceutical composition to the patient; preparing a gene or
gene
family expression profile and/or assaying for an activity of a protein encoded
by a gene
or member of a gene family of Table 1 from a cell or tissue sample from the
patient
comprising precursor stem cells; and comparing the patient expression profile
andlor
activity to an expression profile andlor activity from an untreated cell
population
comprising precursor stem cells.
3
CA 02433436 2003-06-16
WO 02/50301 PCT/USO1/48276
The invention includes methods of diagnosing a condition characterized by an
abnormal rate of formation of osteoblasts in a patient comprising detecting
the level of
expression in a tissue sample of one or more genes or gene families from Table
1 and/or
assaying for an activity of a protein encoded by a gene or member of a gene
family of
Table 1; wherein differential expression andlor activity is indicative of an
abnormal rate
of formation of osteoblasts.
The invention includes a method of monitoring the treatment of a patient with
a
condition characterized by abnormal rate of formation of osteoblasts,
comprising
administering a pharmaceutical composition to the patient, preparing a gene or
gene
family expression profile and/or assaying for an activity of a protein encoded
by a gene
or member of a gene family of Table 1 from a cell or tissue sample from the
patient and
comparing the patient expression profile andlor activity to an expression
profile and/or
activity from a precursor stem cell population or an osteoblast cell
population.
In a related aspect, the present invention provides a method of treating a
patient
with a condition characterized by an abnormal rate of formation of
osteoblasts,
comprising administering to the patient a pharmaceutical composition, wherein
the
composition alters the expression of at least one gene or gene family in Table
1 and/or
alters an activity of a protein encoded by a gene or member of a gene family
of Table 1,
preparing an expression profile and/or assaying for an activity from a cell or
tissue
20, sample from the patient comprising precursor stem cells and comparing the
patient
.. ~h, expression profile and/or activity to an expression profile and/or
activity from an
untreated cell population comprising precursor stem cells.
The invention further includes a method of diagnosing osteoporosis in a
patient
comprising detecting the level of expression in a tissue sample of one or more
genes or
gene families from Table 1 and/or assaying for an activity of a protein
encoded by a gene
or member of a gene family of Table 1; wherein differential expression and/or
activity is
indicative of osteoporosis.
In a related aspect, the present invention provides a method of monitoring the
treatment of a patient with osteoporosis, comprising administering a
pharmaceutical
composition to the patient, preparing a gene or gene family expression profile
and/or
assaying for an activity of a protein encoded by a gene or member of a gene
family of
4
CA 02433436 2003-06-16
WO 02/50301 PCT/USO1/48276
Table 1 from a cell or tissue sample from the patient and comparing the
patient
expression profile and/or activity to an expression profile andlor activity
from a
precursor stem cell population or an osteoblast cell population.
In one aspect, the present invention provides a method of treating a patient
with
osteoporosis, comprising administering to the patient a pharmaceutical
composition,
wherein the composition alters the expression of at least one gene or gene
family in
Table 1 and/or alters an activity of a protein encoded by a gene or member of
a gene
family of Table 1, preparing an expression profile and/or assaying for an
activity of a
protein encoded by a gene or member of a gene family of Table 1 from a cell or
tissue
sample from the patient comprising precursor stem cells and comparing the
patient
expression profile and/or activity to an expression profile and/or activity
from an
untreated cell population comprising precursor stem cells.
Also included in the inventions are methods of screening for an agent capable
of
ameliorating the effects of osteoporosis, comprising exposing a cell to the
agent; and
detecting the expression level of one or more genes or gene families from
Table 1 and/or
assaying for an activity of a protein encoded by a gene or member of a gene
family of
Table 1.
In one aspect, the present invention is a method of monitoring the progression
of
bone tissue deposition in a patient, comprising detecting the level of
expression in a
tissue sample of one or more genes or gene families from Table 1 and/or
assaying for an
activity of a protein encoded by a gene or member of a gene family of Table 1;
wherein
differential expression and/or activity is indicative of bone tissue
deposition.
In a related aspect, the present invention is a method of screening for an
agent
capable of modulating the deposition of bone tissue, comprising exposing a
cell to the
agent and detecting the expression level of one or more genes or gene families
from
Table 1 and/or assaying for an activity of a protein encoded by a gene or
member of a
gene family of Table 1 .
All of these methods may include the step of detecting the expression levels
of at
least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more genes or members of the gene
families in Table 1
. Preferably, expression of all of the genes or members of the gene families
or nearly all
of the genes or members of the gene families in Table 1 may be detected. In a
related
5
CA 02433436 2003-06-16
WO 02/50301 PCT/USO1/48276
aspect, the methods of the present invention may comprise the step of assaying
for an
activity of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more proteins encoded by
a gene or
member of a gene family of Table 1. In some preferred embodiments, the methods
of the
present invention may comprise both determining an expression level of one or
more
genes of members of a gene family of Table 1 and assaying an activity of one
or more
proteins encoded by a gene or member of a gene family of Table 1. In some
embodiments, the expression level of a gene and the activity level of the
protein encoded
by the same gene may be determined. In other embodiments, the expression level
of at
least one gene may be determined while the activity level of at least one
protein encoded
by a different gene may be determined.
In one aspect, the present invention provides a method for identifying an
agent
that modulates the differentiation of precursor stem cells into osteoblasts
comprising
contacting a cell population with the agent and assaying for at least one
activity of at
least one gene or the activity of at least one member of a gene family
identified in Table
1. In a related aspect, the present invention provides a method of monitoring
the
treatment of a patient with a condition characterized by abnormal bone
deposition
comprising administering a pharmaceutical composition to the patient and
assaying for
at least one activity of at least one gene or one member of a gene family
identified in
Table 1. The present invention also includes a method of diagnosing a
condition
characterized by the abnormal rate of formation of osteoblast comprising
detecting the
level of activity of at least one gene or one member of a gene family
identified in Table
1.
In some preferred aspects, the present invention encompasses a composition
comprising at least two oligonucleotides, wherein each of the oligonucleotides
comprises
a sequence that specifically hybridizes to one or more genes or members of a
gene family
in Table 1. In some aspects, the composition may comprise at least 1, 2, 3, 4,
5, 6, 7, 8,
9, 10 oligonucleotides, wherein each of the oligonucleotides comprises a
sequence that
specifically hybridizes to one or more genes or members of a gene family in
Table 1. In
some embodiments, one or more of the oligonucleotides may be attached to a
solid
support. The solid support may be any known to those skilled in the axt
including, but
not limited to, a membrane, a glass support, a filter, a tissue culture dish,
a polymeric
6
CA 02433436 2003-06-16
WO 02/50301 PCT/USO1/48276
material and a silicon support.
In a preferred aspect, the present invention provides a solid support to which
is
attached at least two oligonucleotides, wherein each of the oligonucleotides
comprises a
sequence that specifically hybridizes to at least one gene or to at least one
member of a
~ gene family in Table 1. In some embodiments, at least one oligonucleotide is
attached
covalently to the solid support. In some embodiments, at least one
oligonucleotide is
attached non-covalently to the solid support. Oligonucleotides may be attached
to the
solid supports of the invention at any density known to those skilled in the
art, for
example, at about at least 10 different oligonucleotides in discrete locations
per square
centimeter, at about at least 100 different oligonucleotides in discrete
locations per
square centimeter, at about at least 1000 different oligonucleotides in
discrete locations
per square centimeter and/or at about at least 10,000 different
oligonucleotides in discrete
locations per square centimeter. The selection of an appropriate density for a
given
application is a routine procedure for those skilled in the art.
The invention also includes computer systems comprising a database containng
information identifying the expression level of one or more members of one or
more of
the gene families in Table 1 and/or the activity level of one or more proteins
encoded by
a gene or by a member of a gene family of Table 1 in a resting precursor stem
cell and/or
a precursor stem cell differentiating into an osteoblast and/or an osteoblast;
and a user
interface to view the information. The database may further comprise sequence
information for one or more of the genes of one or one or more members of one
or more
of the gene families of Table 1. The database may comprise information
identifying the
expression level for one or more genes or one or more members of one or more
of the
gene families in the set of gene families expressed in a precursor stem cell
that is not
differentiating. The database may comprise information identifying the
expression level
for one or more genes or one or more members of one or more of the gene
families in
the set of genes or gene families expressed in a precursor stem cell that is
differentiating
into a cell type other than an osteoblast. The database may comprise
information
identifying the expression level for one or more genes or one or more members
of one or
more of the gene families in the set of genes or gene families expressed in a
precursor
stem cell that is differentiating into an osteoblast. The database may further
contain or
7
CA 02433436 2003-06-16
WO 02/50301 PCT/USO1/48276
be linked to descriptive information from an external database, which
information
correlates said genes and/or gene families to records in the external
database.
Lastly the invention includes methods of using the disclosed computer systems
to
present information identifying the expression level in a tissue or cell of a
set of genes
and/or gene families comprising at least one of the genes or gene families in
Table 1,
comprising comparing the expression level of at least one gene or gene family
in Table 1
in the tissue or cell to the level of expression of the gene in the database.
The invention
also includes methods of using the disclosed computer systems to present
information
identifying the activity level in a tissue or cell of one or more proteins
encoded by one or
more genes and/or members of a gene family comprising at least one of the
genes or gene
families in Table 1, comprising comparing the activity level of at least one
protein
encoded by one gene or member of a gene family in Table 1 in the tissue or
cell to the
level of activity of the protein in the database.
Brief Description Of The Drawings
Figure 1A shows the expression level of an RNA related to aquaporin mRNA as a
function of time in the absence (control-open circles solid line) and in the
presence
(BMP-2-open squares dashed line) of 300 ng/ml BMP-2. Figure 1B shows the
expression level of the RNA as a function of time in the absence (control-open
circles
solid line) and in the presence (open triangles dashed line) of 1 ng/ml TGFb-
1.
Figure 2A shows the expression level of an RNA related to the mRNA encoding
Mpv 17 protein as a function of time in the absence (control-open circles
solid line) and
in the presence (open squares dashed line) of 300 ng/ml BMP-2. Figure 2B shows
the
expression level as a function of time in the absence (control-open circles
solid line) and
in the presence (open triangles dashed line) of 1 ng/ml TGFb-1.
Figure 3A shows the expression level of an RNA related to claudin protein
mRNA as a function of time in the absence (control-open circles) and in the
presence
(open squares dashed line) of 300 ng/ml BMP-2. Figure 3B shows the expression
level
as a function of time in the absence (control-open circles) and in the
presence (open
triangles dashed line) of 1 ng/ml TGFb-1.
Figure 4A shows the expression level of an RNA related to SM22a mRNA as a
8
CA 02433436 2003-06-16
WO 02/50301 PCT/USO1/48276
function of time in the absence (control-open circles) and in the presence
(open squares
dashed line) of 300 ng/ml BMP-2. Figure 4B shows the expression level as a
function of
time in the absence (control-open circles) and in the presence (open triangles
dashed line)
of 1 ng/ml TGFb-1.
Figure 5 shows the expression level of the RNA of EST: AA722810 as a function
of time in the absence (control-open circles solid line) and in the presence
(open triangles
dashed line) of 1 nghnl TGFb-1.
Figure 6A shows the expression level of the RNA related to the mRNA encoding
PEDF as a function of time in the absence (control-open circles solid line)
and in the
presence (open squares dashed line) of 300 ng/ml BMP-2. Figure 6B shows the
expression level as a fwction of time in the absence (control-open circles
solid line) and
in the presence (open triangles dashed line) of 1 ng/ml TGFb-1.
Figure 7A shows the expression level of TGFb II receptor mRNA as a fiuiction
of
time in the absence (control-open circles, solid line) and the presence (BMP-2-
open
squares, dashed line) of 300 ng/ml BMP-2. Figure 7B shows the expression level
of the
RNA as a function of time in the absence (control-open circles, solid line)
and in the
presence (open triangles, dashed line) of 1 ng/ml TGFb-1.
Figure 8 shows the expression level of Bradykinin B2 Receptor mRNA as a
function of time in the absence (control-open circles, solid line) and the
presence (BMP-
2-open squares, dashed line) of 300 ng/ml BMP-2.
Figure 9 shows the expression level of an mRNA related to Frizzled-related
protein frpHE as a function of time in the absence (control-open circles,
solid line) and in
the presence (open triangles, dashed line) of 1 ng/ml TGFb-1.
Figure 10A shows the expression level of AH Receptor mRNA as a function of
time in the absence (control-open circles, solid line) and the presence (BMP-2-
open
squares, dashed line) of 300 ng/ml BMP-2. Figure l OB shows the expression
level of the
RNA as a function of time in the absence (control-open circles, solid line)
and in the
presence (open triangles, dashed line) of 1 ng/ml TGFb-1.
Figure 11A shows the expression level of GPx-4 mRNA as a function of time in
the absence (control-open circles, solid line) and the presence (BMP-2-open
squares,
dashed line) of 300 ng/ml BMP-2. Figure 11B shows the expression level of the
RNA as
9
CA 02433436 2003-06-16
WO 02/50301 PCT/USO1/48276
a function of time in the absence (control-open circles, solid line) and in
the presence
(open triangles, dashed line) of 1 ng/ml TGFb-1.
Figure 12A shows the expression level of Preproenkephalin mRNA as a function
of time in the absence (control-open circles, solid line) and the presence
(BMP-2-open
squares, dashed line) of 300 ng/ml BMP-2. Figure 12B shows the,expression
level of the
RNA as a function of time in the absence (control-open circles, solid line)
and in the
presence (open triangles, dashed line) of 1 ng/ml TGFb-1.
Figure 13 shows the expression level of Cartilage Derived Morphogenic Protein
mRNA as a function of time in the absence (control-open circles, solid line)
and the
presence (open triangles, dashed line) of 1 ng/ml TGFb-1.
Figure 14 shows the expression level of the RNA related to aquaporin mRNA as
a function of time in the absence (control-open circles) and in the presence
(BMP-2-
closed squares) of 300 ng/ml BMP-2 or in the presence, (TGFb-1-closed circles)
of 1
ng/ml TGFb-1.
Figure 15 shows the expression level of the RNA related to C1 inhibitor mRNA
as a function of time in the absence (control-open circles) and in the
presence (BMP-2-
closed squares) of 300 ng/ml BMP-2 or in the presence (TGFb-1-closed circles)
of 1
ng/ml TGFb-1.
Figure 16 shows the expression level of RNA related to claudin 11 mRNA as a
function of time in the absence (control-open circles) and in the presence
(BMP-2-closed
squares) of 300 ng/ml BMP-2 or in the presence (TGFb-1-closed circles) of 1
ng/ml
TGF-(31.
Figure 17 shows the expression level of DKI~-1 mRNA as a function of time in
the absence (control-open circles) and in the presence (BMP-2-closed squares)
of 300
ng/ml BMP-2 or in the presence (TGFb-1-closed circles) of 1 ng/ml TGFb-1.
Figure 18 shows the expression level of ESTAI869864 RNA as a function of time
in the absence (control-open circles) and in the presence (BMP-2-closed
squares) of 300
ng/ml BMP-2 or in the presence (TGFb-1-closed circles) of 1 ng/ml TGFb-1.
Figure 19 shows the expression level of the RNA related to stromal cell
derived
receptor-la, mRNA as a function of time in the absence (control-open circles)
and in the
presence (BMP-2-closed squares) of 300 ng/ml BMP-2 or in the presence (TGFb-1-
CA 02433436 2003-06-16
WO 02/50301 PCT/USO1/48276
closed circles) of 1 ng/ml TGFb-1.
Figure 20 shows the expression level of TGFb II Receptor mRNA as a function
of time in the absence (control-solid circles) and in the presence of 300
ng/ml of BMP-2
(closed triangle, dotted line) or in the presence of 1 ng/m1 TGFbl (open
square, solid
line) in the case for HFSCs. For HMSCs, the mRNA was measured as a function of
time
in the absence (control-solid circle, solid line) and in the presence of 300
ng/ml of BMP-
2 (solid triangle, dotted line) or in the presence of either 1 ng/ml TGFb
(open square,
solid line) or 100 nM dexamethasone (crosses, solid line).
Figure 21 shows the expression level of Bradykinin B2 Receptor mRNA as a
function of time in the absence (control-solid circles) and in the presence of
300 ng/ml of
BMP-2 (closed triangle, dotted line) or in the presence of 1 ng/ml TGFb1 (open
square,
solid line) in the case for HFSCs. For HMSCs, the mRNA was measured as a
function
of time in the absence (control-solid circle, solid line) and in the presence
of 300 ng/ml
of BMP-2 (solid triangle, dotted line) or in. the presence of either 1 nghnl
TGFb (open
square, solid line) or 100 WVI dexamethasone (crosses, solid line).
Figure 22 shows the expression level of the mRNA related to Frizzled related
protein frpHE as a function of time in the absence (control-solid circles) and
in the
presence of 300 ng/ml of BMP-2 (closed triangle, dotted line) or in the
presence of 1
ng/ml TGFbl (open square, solid line) in the case for HFSCs. For HMSCs, the
mRNA
was measured as a function of time in the absence (control-solid circle, solid
line) and in
the presence of 300 ng/ml of BMP-2 (solid triangle, dotted line) or in the
presence of
either 1 ng/ml TGFb (open square, solid line) or 100 nM dexamethasone
(crosses, solid
line).
Figure 23 shows the expression level of AH Receptor mRNA as a function of
time in the absence (control-solid circles) and in the presence of 300 ng/ml
of BMP-2
(closed triangle, dotted line) or in the presence of 1 ng/ml TGFbI {open
square, solid
line) in the case for HFSCs. For HMSCs, the mRNA was measured as a function of
time
in the absence (control-solid circle, solid line) and in the presence of 300
ng/ml of BMP-
2 (solid triangle, dotted Line) or in the presence of either 1 ng/ml TGFb
(open square,
solid Line) or 100 nM dexamethasone (crosses, solid line).
Figure 24 shows the expression level of GPx-4 mRNA as a function of time in
11
CA 02433436 2003-06-16
WO 02/50301 PCT/USO1/48276
j
the absence (control-solid circles) and in the presence of 300 ng/ml of BMP-2
(closed
triangle, dotted line) or in the presence of 1 ng/ml TGFb1 (open square, solid
line) in the
case for HFSCs. For HMSCs, the mRNA was measured as a function of time in the
absence (control-solid circle, solid line) and in the presence of 300 ng/ml of
BMP-2
(solid triangle, dotted line) or in the presence of either 1 ng/ml TGFb (open
square, solid
line) or 100 nM dexamethasone (crosses, solid line).
Figure 25 shows the expression level of preproenkephalin mRNA as a function of
time in the absence (control-solid circles) and in the presence of 300 ng/ml
of BMP-2
(closed triangle, dotted line) or in the presence of 1 ng/ml TGFbl (open
square, solid
line) in the case for HFSCs. For HMSCs, the mRNA was measured as a function of
time
in the absence (control-solid circle, solid line) and in the presence of 300
ng/ml of BMP-
2 (solid triangle, dotted line) or in the presence of either 1 ng/ml TGFb
(open square,
solid line) or 100 nM dexamethasone (crosses, solid line).
Figure 26 shows the expression level of Cartilage-derived morphogenic protein
mRNA as a function of time in the absence (control-solid circles) and in the
presence of
300 ng/ml of BMP-2 (closed triangle, dotted line) or in the presence of 1
ng/ml TGFbl
(open square, solid line) in the case for HFSCs. For HMSCs, the mRNA was
measured
as a function of time in the absence (control-solid circle, solid line) and in
the presence of
300 ng/ml of BMP-2 (solid triangle, dotted line) or in the presence of either
1 ng/ml
TGFb (open square, solid line) or 100 nM dexamethasone (crosses, solid line).
Detailed Description
Mazry biological functions are accomplished by altering the expression of
various
genes through transcriptional (e.g. through control of initiation, provision
of RNA
precursors, RNA processing, etc.) and/or translational control. For example,
fundamental biological processes such as cell cycle, cell differentiation and
cell death,
are often characterized by the variations in the expression levels of groups
of genes.
Changes in gene expression also are associated with pathogenesis. For example,
the lack of sufficient expression of functional tumor suppressor genes and/or
the over
expression of oncogene/protooncogenes could lead to tumorgenesis or
hyperplastic
growth of cells (Marshall, (1991) Cell 64:313-326; Weinberg, (1991) Science
254:1138-
12
CA 02433436 2003-06-16
WO 02/50301 PCT/USO1/48276
1146). Thus, changes in the expression levels of particular genes (e.g.,
oncogenes or
tumor suppressors) serve as signposts for the presence and progression of
various
diseases.
Monitoring changes in gene expression may also provide certain advantages
during drug screening development. Often drugs are screened for the ability to
interact
with a major target without regard to other effects the drugs have on cells.
Often such
other effects cause toxicity in the whole animal, which prevent the
development and use
of the potential drug.
The present inventors have examined cell populations comprising precursor stem
cells and cell populations comprising precursor stem cells that have been
induced to
differentiate into osteoblasts to identify the global changes in gene
expression during this
differentiation process. These global changes in gene expression, also
referred to as
expression profiles, provide useful markers for diagnostic uses as well as
markers that
can be used to monitor disease states, disease progression, toxicity, drug
efficacy and
drug metabolism.
The expression profiles have been used to identify individual genes that are
differentially expressed under one or more conditions. In addition, the
present invention
identifies families of genes that are differentially expressed. As used
herein, "gene
families" includes, but is not limited to, the specific genes identified by
accession
number herein, as well as related sequences. Related sequences may be, for
example,
sequences having a high degree of sequence identify with a specifically
identified
sequence either at the nucleotide level or at the level of amino acids of the
encoded
polypeptide. A high degree of sequence identity is seen to be at least about
65%
sequence identity at the nucleotide level to said genes, preferably about 80
or 85%
sequence identity or more preferably about 90 or 95% or more sequence identity
to said
genes. With regard to amino acid identity of encoded polypeptides, a high
degree of
identity is seen to be at least about 50% identity, more preferably about 75%
identity and
most preferably about 85% or more sequence identity. ' In particular, related
sequences
include homologous genes from different organisms. For example, if the
specifically
identified gene is from a non-human mammal, the gene family would encompass
homologous genes from other mammals including humans. If the specifically
identified
13
CA 02433436 2003-06-16
WO 02/50301 PCT/USO1/48276
gene is a human gene, gene family would encompass the homologous gene from
different organisms. Those skilled in the art will appreciate that a
homologous gene may
be of different length and may comprise regions with differing amounts of
sequence
identity to a specifically identified sequence.
Assa.~ ats
The genes and sequences identified as being differentially expressed in the
cell
population induced to differentiate as well as related sequences may be used
in a variety
of nucleic acid detection assays to detect or quantititate the expression
level of a gene or
multiple genes in a given sample. For example, traditional Northern blotting,
nuclease
protection, RT-PCR, QPCR (quantitative RT-PCR), Taqman° and
differential display
methods may be used for detecting gene expression levels. Those methods are
useful for
some embodiments of the invention. However, methods and assays of the
invention are
most efficiently designed with hybridization-based methods for detecting the
expression
of a large number of genes.
Any hybridization assay format may be used, including solution-based and solid
support-based assay formats. Solid supports containing oligonucleotide probes
for
differentially expressed genes of the invention can be filters, polyvinyl
chloride dishes,
silicon or glass based chips, etc. Such supports and hybridization methods are
widely
available, for example, those disclosed by WO 95/11755. Any solid surface to
which
oligonucleotides can be bound, either directly or indirectly, either
covalently or non-
covalently, can be used. A preferred solid support is a high density array or
I~NA chip.
These contain a particular oligonucleotide probe in a predetermined location
on the array.
Each predetermined location may contain more than one molecule of the probe,
but each
molecule within the predetermined location has an identical sequence. Such
predetermined locations are termed features. There may be, for example, from
2, 10,
100, 1000 to 10,000, 100,000 or 400,000 of such features on a single solid
support. The
solid support, or the area within which the probes are attached may be any
convenient
size and may preferably be on the order of a square centimeter.
Oligonucleotide probe arrays for expression monitoring can be made and used
according to any techniques known in the art (see for example, Lockhart et
al., (1996)
14
CA 02433436 2003-06-16
WO 02/50301 PCT/USO1/48276
Nat. Biotech. 14, 1675-1680; McGall et al., (1996) Proc. Nat. Acad. Sci. USA
93,
13555-13460). Such probe arrays may contain at least two or more
oligonucleotides that
are complementary to or hybridize to two or more of the genes described in
Table 1. For
instance, such arrays may also contain oligonucleotides that are complementary
or
hybridize to at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 50, 70 or
more the genes
described herein.
The genes which are assayed according to the present invention are typically
in
the form of mRNA or reverse transcribed mRNA. The genes may be cloned or not.
The
genes may be amplified or not. The cloning itself does not appear to bias the
representation of genes within a population. However, it may be preferable to
use
polyadenylated RNA as a source, as it can be used with less processing steps.
Table 1 provides the Accession numbers and name for the sequences of the
differentially expressed maxkers (SEQ m NO: 1-60). The sequences of the genes
in
GenBanlc are expressly incorporated herein.
Probes based on the sequences of the genes described above may be prepared by
any commonly available method. Oligonucleotide probes for interrogating the
tissue or
cell sample are preferably of sufficient length to specifically hybridize only
to
appropriate, complementary genes or transcripts. Typically the oligonucleotide
probes
will be at least 10, 12, 14, 16, 18, 20 or 25 nucleotides in length. In some
cases longer
probes of at least 30, 40 or 50 nucleotides will be desirable.
As used herein, oligonucleotide sequences that are complementary to one or
more
of the genes and/or gene families described in Table 1, refer to
oligonucleotides that are
capable of hybridizing under stringent conditions to at least part of the
nucleotide
sequences of said genes. Such hybridizable oligonucleotides will typically
exhibit at
least about 75% sequence identity at the nucleotide level to said genes,
preferably about
80 or 85% sequence identity or more preferably about 90 or 95% or more
sequence
identity to said genes.
"Bind(s) substantially" refers to complementary hybridization between a probe
nucleic acid and a target nucleic acid and embraces minor mismatches that can
be
accommodated by reducing the stringency of the hybridization media to achieve
the
desired detection of the target polynucleotide sequence.
CA 02433436 2003-06-16
WO 02/50301 PCT/USO1/48276
The terms "background" or "background signal intensity" refer to hybridization
signals resulting from non-specific binding, or other interactions, between
the labeled
target nucleic acids and components of the oligonucleotide array (e.g., the
oligonucleotide probes, control probes, the array substrate, etc.). Background
signals
may also be produced by intrinsic fluorescence of the array components
themselves. A
single background signal can be calculated for the entire array, or a
different background
signal may be calculated for each target nucleic acid. In a preferred
embodiment,
background is calculated as the average hybridization signal intensity for the
lowest 5 to
10% of the probes in the array, or, where a different background signal is
calculated for
each target gene, for the lowest 5 to 10% of the probes for each gene. Of
course, one of
skill in the art will appreciate that where the probes to a particular gene
hybridize well
and thus appear to be specifically binding to a target sequence, they should
not be used in
a background signal calculation. Alternatively, background may be calculated
as the
average hybridization signal intensity produced by hybridization to probes
that axe not
complementary to any sequence found in the sample (e.g., probes directed to
nucleic
acids of the opposite sense or to genes not found in the sample such as
bacterial genes
where the sample is mammalian nucleic acids). Background can also be
calculated as the
average signal intensity produced by regions of the array that lack any probes
at all.
The phrase "hybridizing specifically to" refers to the binding, duplexing, or
hybridizing of a molecule substantially to or only to a particular nucleotide
sequence or
sequences under stringent conditions when that sequence is present in a
complex mixture
(e.g., total cellular) DNA or RNA.
Assays and methods of the invention may utilize available formats to
simultaneously screen at least about 100, preferably about 1000, more
preferably about
10,000 and most preferably about 1,000,000 different nucleic acid
hybridizations.
The terms "mismatch control" or "mismatch probe" refer to a probe whose
sequence is deliberately selected not to be perfectly complementary to a
particular target
sequence. For each mismatch (lVhVI) control in a high-density array there
typically exists
a corresponding perfect match (PM) probe that is perfectly complementary to
the same
particular target sequence. The mismatch may comprise one or more bases.
While the mismatch(s) may be located anywhere in the mismatch probe, terminal
16
CA 02433436 2003-06-16
WO 02/50301 PCT/USO1/48276
mismatches are less desirable as a terminal mismatch is less likely to prevent
hybridization of the target sequence. In a particularly preferred embodiment,
the
mismatch is located at or near the center of the probe such that the mismatch
is most
likely to destabilize the duplex with the target sequence under the test
hybridization
conditions.
The term "perfect match probe" refers to a probe that has a sequence that is
perfectly complementary to a particular target sequence. The test probe is
typically
perfectly complementary to a portion (subsequence) of the target sequence. The
perfect
match (PM) probe can be a "test probe" or a "normalization control" probe, an
expression Ievel control probe and the like. A perfect match control or
perfect match
probe is, however, distinguished from a "mismatch control" or "mismatch probe"
as
defined herein.
As used herein a "probe" is defined as a nucleic acid, capable of binding to a
target nucleic acid of complementary sequence through one or more types of
chemical
bonds, usually through complementary base pairing, usually through hydrogen
bond
formation. As used herein, a probe may include natural (i.e., A, G, U, C or T)
or
modified bases (7-deazaguanosine, inosine, etc.). 111 addition, the bases in
probes may be
joined by a linkage other than a phosphodiester bond, so long as it does not
interfere with
hybridization. Thus, probes may be.peptide nucleic acids in which the
constituent bases
are joined by peptide bonds rather than phosphodiester linkages.
The term "stringent conditions" refers to conditions under which a probe will
hybridize to its target subsequence, but with only insubstantial hybridization
to other
sequences or to other sequences such that the difference may be identified.
Stringent
conditions are sequence-dependent and will be different in different
circumstances.
Longer sequences hybridize specifically at higher temperatures. Generally,
stringent
conditions are selected to be about 5°C lower than the thermal melting
point (Tm) for the
specific sequence at a defined ionic strength and pH.
Typically, stringent conditions will be those in which the salt concentration
is at
least about 0.01 to 1.0 M sodium ion concentration (or other salts) at pH 7.0
to 8.3 and
the temperature is at least about 30°C for short probes (e.g., 10 to SO
nucleotides).
Stringent conditions may also be achieved with the addition of destabilizing
agents such
17
CA 02433436 2003-06-16
WO 02/50301 PCT/USO1/48276
as formamide.
The "percentage of sequence identity" or "sequence identity" is determined by
comparing two optimally aligned sequences or subsequences over a comparison
window
or span, wherein the portion of the polynucleotide sequence in the comparison
window
may optionally comprise additions or deletions (i.e., gaps) as compared to the
reference
sequence (which does not comprise additions or deletions) for optimal
alignment of the
two sequences. The percentage is calculated by determining the number of
positions at
which the identical residue (e.g., nucleic acid base or amino acid residue)
occurs in both
sequences to yield the number of matched positions, dividing the number of
matched
positions by the total number of positions in the window of comparison and
multiplying
the result by 100 to yield the percentage of sequence identity.
Percentage sequence identity can be calculated by the local homology algorithm
of Smith ~ Watennan, (1981) Adv. Appl. Math. 2:482-485; by the homology
alignment
algorithm of Needleman & Wunsch, (1970) J. Mol. Biol. 48:443-445; or by
computerized implementations of these algorithms (GAP & BESTFIT in the GCG
Wisconsin Software Package, Genetics Computer Group) or by manual alignment
and
visual inspection.
Percentage sequence identity when calculated using the programs GAP or
BESTFIT is calculated using default gap weights. The BESTFIT program has two
alignment variables, the gap creation penalty and the gap extension penalty,
which can be
modified to alter the stringency of a nucleotide and/or amino acid alignment
produced by
the program. Parameter values used in the percent identity determination were
default
values previously established for version 8.0 of BESTFIT (see Dayhoff, (1979)
Atlas of
Protein Sequence and Structure, National Biomedical Research Foundation, pp.
353-
358).
Probe design
One of skill in the art will appreciate that an enormous number of array
designs
are suitable for the practice of this invention. In some preferred
embodiments, a high
density array may be used. The high density array will typically include a
number of
probes that specifically hybridize to the sequences of interest (see WO
99/32660 for
18
CA 02433436 2003-06-16
WO 02/50301 PCT/USO1/48276
methods of producing probes for a given gene or genes). In addition, in a
preferred
embodiment, the array will include one or more control probes.
High density array chips of the invention include "test probes" as defined
herein.
Test probes could be oligonucleotides that range from about 5 to about 45 or 5
to about
500 nucleotides, more preferably from about 10 to about 40 nucleotides and
most
preferably from about 15 to about 40 nucleotides in length. In other
particularly
preferred embodiments, the probes are 20 or 25 nucleotides in length. In
another
preferred embodiment, test probes are double or single strand nucleic acid
sequences,
preferably DNA sequences. Nucleic acid sequences may be isolated or cloned
from
natural sources or amplified from natural sources using native nucleic acid as
templates.
These probes have sequences complementary to particular subsequences of the
genes
whose expression they are designed to detect. Thus, the test probes are
capable of
specifically hybridizing to the target nucleic acid they are to detect.
In addition to test probes that bind the target nucleic acids) of interest,
the high
density array can contain a number of control probes. The control probes fall
into three
categories referred to herein as (1) normalization controls; (2) expression
level controls;
and (3) mismatch controls.
Normalization controls are oligonucleotide or other nucleic acid probes that
are
complementary to labeled reference oligonucleotides or other nucleic acid
sequences that
are added to the nucleic acid sample to be screened. The signals obtained from
the
normalization controls after hybridization provide a control for variations in
hybridization conditions, label intensity, "reading" eff ciency and other
factors that may
cause the signal of a perfect hybridization to vary between arrays. In a
preferred
embodiment, signals (e.g., fluorescence intensity) read from all other probes
in the array
are divided by the signal (e.g., fluorescence intensity) from the control
probes thereby
normalizing the measurements.
Virtually any probe may serve as a normalization control. However, it is
recognized that hybridization efficiency varies with base composition and
probe length.
Preferred normalization probes are selected to reflect the average length of
the other
probes present in the array, however, they can be selected to cover a range of
lengths.
The normalization controls) can also be selected to reflect the (average) base
19
CA 02433436 2003-06-16
WO 02/50301 PCT/USO1/48276
composition of the other probes in the array, however in a preferred
embodiment, only
one or a few probes\are used and they are selected such that they hybridize
well (i. e., no
secondary structure) and do not match any target-specific probes.
Expression level controls are probes that hybridize specifically with
constitutively expressed genes in the biological sample. Virtually any
constitutively
expressed gene provides a suitable target for expression level controls.
Typically
expression level control probes have sequences complementary to subsequences
of
constitutively expressed "housekeeping genes" including, but not limited to
the actin
gene, the transferrin receptor gene, the GAPDH gene, and the like.
Mismatch controls may also be provided for the probes to the target genes, for
expression level controls or for normalization controls. Mismatch controls are
oligonucleotide probes or other nucleic acid probes identical to their
corresponding test
or control probes except for the presence of one or more mismatched bases. A
mismatched base is a base selected so that it is not complementary to the
corresponding
1S base in the target sequence to which the probe would otherwise specifically
hybridize.
One or more mismatches are selected such that under appropriate hybridization
conditions (e.g., stringent conditions) the test or control probe would be
expected to
hybridize with its target sequence, but the mismatch probe would not hybridize
(or would
hybridize to a significantly lesser extent). Preferred mismatch probes contain
a central
mismatch. Thus, for example, where a probe is a twenty-mer, a corresponding
mismatch
probe will have the identical sequence except for a single base mismatch
(e.g.,
substituting a G, C or T for an A) at any of positions six through fourteen
(the central
mismatch).
Mismatch probes thus provide a control for non-specific binding or cross
hybridization to a nucleic acid in the sample other than the target to which
the probe is
directed. Mismatch probes also indicate whether a hybridization is specific or
not.
For example, if the target is present the perfect match probes should be
consistently brighter than the mismatch probes. In addition, if all central
mismatches are
present, the mismatch probes can be used to detect a mutation. The difference
in
intensity between the perfect match and the mismatch probe provides a good
measure of
the concentration of the hybridized material.
CA 02433436 2003-06-16
WO 02/50301 PCT/USO1/48276
Nucleic Acid Samples
As is apparent to one of ordinary shill in the art, nucleic acid samples,
which may
be DNA and/or RNA, used in the methods and assays of the invention may be
prepared
by any available method or process. Methods of isolating total mRNA are well
lmown to
those of slcill in the art. For example, methods of isolation and purification
of nucleic
acids are described in detail in Chapter 3 of Tijssen, (1993) Laboratory
Techniques in
Biochemistry and Molecular Biology: Hybridization With Nucleic Acid Probes,
Elsevier
Press. Such samples include RNA samples, but also include cDNA synthesized
from a
mRNA sample isolated from a cell or tissue of interest. Such samples.also
include DNA
amplified from the cDNA, and RNA transcribed from the amplified DNA. One of
skill
in the art would appreciate that it is desirable to inhibit or destroy RNase
present in
homogenates before homogenates can be used.
Biological samples may be of any biological tissue or fluid or cells from any
organism as well as cells raised isz vitro, such as cell lines and tissue
culture cells.
Frequently, the sample will be a "clinical sample" which is a sample derived
from a
patient. Typical clinical samples include, but are not limited to, sputum,
blood, blood-
cells (e.g., white cells), tissue or fine needle biopsy samples, urine,
peritoneal fluid, and
pleural fluid, or cells therefrom.
Biological samples may also include sections of tissues, such as frozen
sections
or fonnalin fixed sections taken for histological purposes.
Forming; Hi h~; Density Array
Methods of forming high density arrays of oligonucleotides with a minimal
number of synthetic steps are lmown. The oligonucleotide analogue array can be
synthesized on a solid substrate by a variety of methods, including, but not
limited to,
light-directed chemical coupling, and mechanically directed coupling (see U.S.
Patent
5,143,854).
In brief, the light-directed combinatorial synthesis of oligonucleotide arrays
on a
glass surface proceeds using automated phosphoramidite chemistry and chip
masking
techniques. In one specific implementation, a glass surface is derivatized
with a silane
21
CA 02433436 2003-06-16
WO 02/50301 PCT/USO1/48276
reagent containing a functional group, e.g., a hydroxyl or amine group blocked
by a
photolabile protecting group. Photolysis through a photolithogaphic mask is
used
selectively to expose functional groups which are then ready to react with
incoming 5'
photoprotected nucleoside phosphoramidites. The phosphoramidites react only
with
those sites which are illuminated (and thus exposed by removal of the
photolabile
blocking group). Thus, the phosphoramidites only add to those areas
selectively exposed
from the preceding step. These steps are repeated until the desired array of
sequences
have been synthesized on the solid surface. Combinatorial synthesis of
different
oligonucleotide analogues at different locations on the array is determined by
the pattern
of illumination during synthesis and the order of addition of coupling
reagents.
In addition to the foregoing, additional methods which can be used to generate
an
array of oligonucleotides on a single substrate are described in WO 93/0966.
High
density nucleic acid arrays can also be fabricated by depositing premade or
natural
nucleic acids in predetermined positions. Synthesized or natural nucleic acids
are
deposited on specific locations of a substrate by light directed targeting and
oligonucleotide directed targeting. Another embodiment uses a dispenser that
moves
from region to region to deposit nucleic acids in specific spots.
Hvbridization
Nucleic acid hybridization simply involves contacting a probe and target
nucleic
acid under conditions where the probe and its complementary target can form
stable
hybrid duplexes through complementary base pairing (see WO 99/32660). The
nucleic
acids that do not form hybrid duplexes are then washed away leaving the
hybridized
nucleic acids to be detected, typically through detection of an attached
detectable label.
It is generally recognized that nucleic acids are denatured by increasing the
temperature
or decreasing the salt concentration of the buffer containing the nucleic
acids. Under low
stringency conditions (e.g., low temperature and/or high salt) hybrid duplexes
(e.g.,
DNA:DNA, RNA:RNA or RNA:DNA) will form even where the aimealed sequences are
not perfectly complementary. Thus specificity of hybridization is reduced at
lower
stringency. Conversely, at higher stringency (e.g., higher temperature and/or
lower salt
and/or in the presence of destabilizing reagents) successful hybridization
tolerates fewer
22
CA 02433436 2003-06-16
WO 02/50301 PCT/USO1/48276
mismatches. One of skill in the art will appreciate that hybridization
conditions may be
selected to provide any degree of stringency. In a preferred embodiment,
hybridization is
performed at low stringency in this case in 6~ SSPE-T at 37°C (0.005%
Triton x-100) to
ensure hybridization and then subsequent washes are performed at higher
stringency
(e.g., 1 ~ SSPE-T at 37°C) to eliminate mismatched hybrid duplexes.
Successive washes
may be performed at increasingly higher stringency (e.g., down to as low as
0.25
SSPET at 37°C to 50°C) until a desired level of hybridization
specificity is obtained.
Stringency can also be increased by addition of destabilizing agents such as
formasnide.
Hybridization specificity may be evaluated by comparison of hybridization to
the test
probes with hybridization to the various controls that can be present (e.g.,
expression
level control, normalization control, mismatch controls, etc.).
In general, there is a trade-off between hybridization specificity
(stringency) and
signal intensity. Thus, in a preferred embodiment, the wash is performed at
the highest
stringency that produces consistent results and that provides a signal
intensity greater
than approximately 10% of the background intensity. Thus, in a preferred
embodiment,
the hybridized array may be washed at successively higher stringency solutions
and read
between each wash. Analysis of the data sets thus produced will reveal a wash
stringency above which the hybridization pattern is not appreciably altered
and which
provides adequate signal for the particular oligonucleotide probes of
interest.
Simal Detection
The hybridized nucleic acids are typically detected by detecting one or more
labels attached to the sample nucleic acids. The labels may be incorporated by
any of a
number of means well known to those of skill in the art (see WO 99/32660).
Databases
The present invention includes relational databases containing sequence
information, for instance, for the genes and members of the gene families of
Table 1 as
well as gene expression information in various tissue samples saved on
computer
readable meditun and/or a user interface. Databases may also contain
information
associated with a given sequence or tissue sample such as descriptive
information about
23
CA 02433436 2003-06-16
WO 02/50301 PCT/USO1/48276
the gene associated with the sequence information, or descriptive information
concerning
the clinical status of the tissue sample, or the patient from which the sample
was derived.
The database may be designed to include different parts, for instance a
sequence
database and a gene expression database. Methods for the configuration and
construction
of such databases are widely available, for instance, see U.S. Patent
5,953,727, which is
herein incorporated by reference in its entirety.
The databases of the invention may be linked to an outside or external
database.
In a preferred embodiment, the external database is GenBank and the associated
databases maintained by the National Center for Biotechnology Information
(NCBI).
Any appropriate computer platform may be used to perform the necessary
comparisons between sequence information, gene expression information and any
other
information in the database or provided as an input. For example, a large
number of
computer workstations are available from a variety of manufacturers, such has
those
available from Silicon Graphics. Client/server environments, database servers
and
networks are also widely available and appropriate platforms for the databases
of the
invention.
The databases of the invention may be used to produce, among other things,
electronic Northerns that allow the user to determine the cell type or tissue
in which a
given gene is expressed and to allow determination of the abundance or
expression level
of a given gene in a particular tissue or cell.
The databases of the invention may also be used to present information
identifying the expression level in a sample of a set of genes comprising one
or more of
the sequences of genes or members of the gene families of Table 1, comprising
comparing the expression level of at least one gene or member of a gene family
of Table
1 in the sample to the level of expression of the gene in the database. Such
methods may
be used to predict the differentiation state of the precursor stem cells
present in a given
sample by comparing the level of expression of a gene or member of a gene
family in
Table 1 from a sample to the expression levels found in normal, un-
differentiated
precursor stem cells and/or precursor stem cells induced to differentiate into
osteoblasts
and/or precursor stem cells induced to differentiate into a cell type other
than an
osteoblast and/or osteoblasts. Such methods may also be used in the drug or
agent
24
CA 02433436 2003-06-16
WO 02/50301 PCT/USO1/48276
screening assays as described below.
Diagnostic Uses for the Differentiation Markers
As described above, the genes and gene expression information provided in
Table
1 may be used as diagnostic markers for the prediction or identification of
the
differentiation state of a sample comprising precursor stem cells. For
instance, a tissue
sample may be assayed by any of the methods described above, and the
expression levels
from a gene or member of a gene family from Table 1 may be compared to the
expression levels found in un-differentiated precursor stem cells and/or
precursor stem
~ 0 cells induced to differentiate into osteoblasts andlor precursor stem
cells induced to
differentiate into a cell type other than an osteoblast and/or osteoblasts.
The comparison
of expression data, as well as available sequence or other information may be
done by
researcher or diagnostician or may be done with the aid of a computer and
databases as
described above. Such methods may be used to diagnose or identify conditions
characterized by abnormal bone deposition, reabsorption and/or abnormal rates
of
osteoblast differentiation.
Those skilled in the art will appreciate that a wide variety of conditions axe
associated with abnormal bone deposition or loss. Such conditions include, but
axe not
limited to, osteoporosis, osteopenia, osteodystrophy, and various other
osteopathic
conditions. The methods of the present invention will be particularly useful
in
diagnosing or moutoring the treatment of conditions such as postmenopausal
osteoporosis (PMO), glucocorticoid-induced osteoporosis (GIO) and male
osteoporosis.
Agents which modulate the expression of one or more the genes or gene families
identified in Table 1 and/or modulate the activity of one or more of the
proteins encoded
by one or more of the genes or members of a gene family identified in Table 1
will be
useful in treatment of the conditions.
In some preferred embodiments, the present invention may be used to diagnose
and/or monitor the treatment of drug-induced abnormalities in bone formation
or loss.
For example, at present a combination of cyclosporine with prednisone is given
to
patients who have received an organ transplant in order to suppress tissue
rejection. The
combination causes rapid bone loss in a manner different than that observed
with
CA 02433436 2003-06-16
WO 02/50301 PCT/USO1/48276
prednisone alone (such as elevated level of serum osteocalcin and 1,25(OH)z
Vitamin D
in patients treated with cyclosporine but not in patients treated with
prednisone). Other
drugs are also known to effect bone formation or loss. The anticonvulsant
drugs
diphenylhydantoin, phenobarbital and carbamazepine, and combination of these
drugs,
cause alterations in calcium metabolism. A decrease in bone density is
observed in
patients taking anticonvulsant drugs. Although heparin is an effective therapy
for
thromboembolic disorders, increased incidences of osteoporotic fractures have
been
reported in patients with heparin therapy hence the present invention will be
useful to
monitor patients undergoing heparin treatment.
Other embodiments of the present invention allow the diagnosis and/or
monitoring of the treatment of other conditions that involve altered bone
metabolism.
For example, idiopathic juvenile osteoporosis (IJO) is a generalized decrease
in
mineralized bone in the absence of rickets or excessive bone resorption and
typically
occurs in children before the onset of puberty. In addition, thyroid diseases
have been
linked bone loss. A decrease in bone mass has been shown in patients with
thyrotoxicosis causing these individuals to be at increased rislc of having
fractures.
These individuals also sustain fractures at an earlier age than individuals
who have never
been thyrotoxic.
Other conditions in which the present invention will be useful include
multiple
myeloma and leukemia. Nearly 60% of patients with multiple myelomas have bone
fractures with focal and lytic bone lesions and osteosclereotic bone lesions.
Leukemia
may also be associated with diffuse osteopenia and vertebral fracture in
patients with
acute lymphoblastic leukemia.
Another situation in which the present invention will be useful is the
diagnosis
and/or monitoring of the treatment of skeletal disease linked to breast
cancer. Breast
cancer frequently metastasizes to the skeleton and about 70% of patients with
advanced
cancer develop symptomatic skeletal disease. Moreover, the anticancer
treatments
presently in use have been shown to lead to early menopause and bone loss when
given
to premenopausal women.
The present invention will be useful in diagnosing and/or monitoring the
treatment of chronic anemia associated with abnormal bone formation or loss.
26
CA 02433436 2003-06-16
WO 02/50301 PCT/USO1/48276
Homozygous beta-thalassemia is usually described as an example of chronic
anemia
predisposing to osteoporosis. Patients with thalassemia have expansion of bone
marrow
space with thinning of the adjacent trabeculae.
The present invention will be useful in diagnosing and/or monitoring the
treatment of mastocytosis. Sleeletal symptoms (osteopenia and vertebral
fracture) are
present in 60 to 75% of the patients with systemic mast cell disease.
Other conditions in which the present invention will fmd application are:
Fanconi
syndrome where osteomalacia is a common feature; fibrous dysplasia, McCune-
Albright
syndrome refers to patients with fibrous dysplasia with a sporadic,
developmental
disorder characterized by a unifocal or multifocal expanding fibrous lesion of
bone-
forming mesenchyme that often results in pain, fracture or deformity;
osteogenesis
imperfecta (0I, also called brittle bone disease) is associated with recurrent
fractures and
skeletal deformity, various skeletal dysplasias, i. e., osteochondroplasia
which is
characterized by abnormal development of cartilage and/or bone and other
diseases such
as achodroplasia, mucopolysacchaidoses, dysostosis and ischemic bone diseases.
The present invention will be particularly useful by providing one or markers
which may be used as markers of bone turnover to determine osteoporosis.
The present invention may also be used in in vitro assays or treatments as a
marker of osteoblast differentiation and/or proliferation.
The agents of the present invention may be used for a variety of purposes. In
a
preferred embodiment, they may be used in fracture repair of all types, i.e.,
non-union
fractures, spinal fusion, accelerated healing of all types fractures from
minor greensticlc
or compression fractures to comminuted, complicated fractures. Both local
administrations to these fractures as well as parenteral administration which
increases
cartilage and bone formation, increases bone mass, and increases bone strength
rapidly
may be used. Another preferred embodiment of the present invention is the use
of bone
formation modulating agents in periodontal disease and/or for increasing bone
around
teeth.
Use of the Differentiation Markers for Monitoring Disease Pro e~~;r ssion
As described above, the genes and gene expression information provided in
Table
27
CA 02433436 2003-06-16
WO 02/50301 PCT/USO1/48276
1 may also be used as markers for the monitoring of disease progression, such
as
osteoporosis. For instance, a tissue sample may be assayed by any of the
methods
described above, and the expression levels for a gene or member of a gene
family from
Table 1 may be compared to the expression levels fomzd in un-differentiated
precursor
stem cells and/or precursor stem cells induced to differentiate into
osteoblasts and/or
precursor stem cells induced to differentiate into a cell type other than an
osteoblast
and/or osteoblasts. The comparison of the expression data, as well as
available sequence
or other information may be done by researcher or diagnostician or may be done
with the
aid of a computer and databases as described above.
The markers of the invention may also be used to track or predict the progress
or
efficacy of a treatment regime in a patient. For instance, a patient's
progress or response
to a give drug may be monitored by creating a gene expression profile from a
tissue or
cell sample after treatment or aehninistration of the drug. The gene
expression profile
may then be compared to a gene expression profile prepared from un-
differentiated
precursor stem cells and/or precursor stem cells induced to differentiate into
osteoblasts
and/or precursor stem cells induced to differentiate into a cell type other
than an
osteoblast and/or osteoblasts and/or from tissue or cells from the same
patient before
treatment. The gene expression profile may be made from at least one gene,
preferably
more than one gene, and most preferably all or nearly all of the genes in
Table 1.
Use of the Differentiation Markers for Drug Screening
According to the present invention, the genes identified in Table 1 may be
used as
markers to evaluate the effects of a candidate drug or agent on a cell. A
candidate drug
or agent can be screened for the ability to stimulate the transcription or
expression of a
given marker or markers or to down-regulate or counteract the transcription or
expression
of a marker or markers. For instance, agents that modulate, induce or inhibit
gene
expression in a sample to that which resembles a gene expression profile in an
osteoblast
differentiated cell population may be screened for the ability to modulate the
differentiation process, bone depositions, etc. According to the present
invention one can
also compare the specificity of a drug effect by looking at the number of
markers which
the drug has and comparing them. More specific drugs will have less
transcriptional
28
CA 02433436 2003-06-16
WO 02/50301 PCT/USO1/48276
targets. Similar sets of markers identified for two drugs indicates a
similarity of effects.
Assays to monitor the expression of a marlcer or markers as defined in Table 1
may utilize any available means of monitoring for changes in the expression
level of the
nucleic acids of the invention. As used herein, an agent is said to modulate
the
expression of a nucleic acid of the invention if it is capable of up- or down-
regulating
expression of the nucleic acid in a cell.
In one assay format, gene clops containing probes to one or more genes or
members of a gene family from Table 1 may be used to directly monitor or
detect
changes in gene expression in the treated or exposed cell as described in more
detail
above. In another format, cell lines that contain reporter gene fusions
between the open
reading frame and/or 5'-~3' regulatory regions of a gene or member of a gene
family in
Table 1 and any assayable fusion partner may be prepared. Numerous assayable
fusion
partners are known and readily available including the firefly luciferase gene
and the
gene encoding chloramphenicol acetyltransferase (Alam et al., (1990) Anal.
Biochem.
188:245-254). Cell lines containing the reporter gene fusions are then exposed
to the
agent to be tested under appropriate conditions and time. Differential
expression of the
reporter gene between samples exposed to the agent and control samples
identifies agents
which modulate the expression of the nucleic acid.
Additional assay formats may be used to monitor the ability of the agent to
modulate the expression of a gene or member of a gene family identified in
Table 1. For
instance, as described above, mRNA expression may be monitored directly by
hybridization of probes to the nucleic acids of the invention. Cell lines are
exposed to
the agent to be tested under appropriate conditions and time and total RNA or
mRNA is
isolated by standard procedures such those disclosed in Sambrook et al.,
(1989)
Molecular Cloiung: A Laboratory Manual, Cold Spring Harbor Laboratory Press.
In another assay format, cells or cell lines are first identified which
express the
gene products of the invention physiologically. Cells and/or cell lines so
identified
would be expected to comprise the necessary cellular machinery such that the
fidelity of
modulation of the transcriptional apparatus is maintained with regard to
exogenous
contact of agent with appropriate surface transduction mechanisms and/or the
cytosolic
cascades. Such cell lines may be, but are not required to be, bone marrow
derived.
29
CA 02433436 2003-06-16
WO 02/50301 PCT/USO1/48276
Further, such cells or cell lines may be transduced or transfected with an
expression
vehicle (e.g., a plasmid or viral vector) construct comprising an operable non-
translated
5'-promoter containing end of the structural gene encoding the instant gene
products
fused to one or more antigenic fragments, which are peculiar to the instant
gene products,
wherein said fragments are under the transcriptional control of said promoter
and are
expressed as polypeptides whose molecular weight can be distinguished from the
naturally occurring polypeptides or may further comprise an immunologically
distinct
tag or some other detectable marker or tag. Such a process is well known in
the art (see
Sambrook et al., (1989) Molecular Cloning: A Laboratory Manual, Cold Spring
Harbor
Laboratory Press).
Cells or cell lines transduced or transfected as outlined above are then
contacted
with agents under appropriate conditions; for example, the agent comprises a
pharmaceutically acceptable excipient and is contacted with cells comprised in
an
aqueous physiological buffer such as phosphate buffered saline (PBS) at
physiological
pH, Eagles balanced salt solution (BSS) at physiological pH, PBS or BSS
comprising
serum or conditioned media comprising PBS or BSS and/or serum incubated at
37°C.
Said conditions may be modulated as deemed necessary by one of skill in the
art.
Subsequent to contacting the cells with the agent, said cells are disrupted
and the
polypeptides of the lysate are fractionated such that a polypeptide fraction
is pooled and
contacted with an antibody to be further processed by immunological assay
(e.g., ELISA,
immunoprecipitation or Western blot). The pool of proteins isolated from the
"agent-
contacted" sample is then compared with a control sample where only the
excipient is
contacted with the cells and an increase or decrease in the immunologically
generated
signal from the "agent-contacted" sample compared to the control is used to
distinguish
the effectiveness of the agent.
Another embodiment of the present invention provides methods for identifying
agents that modulate the levels or at least one activity of a proteins)
encoded by the
genes in Table 1. Such methods or assays may utilize any means of monitoring
or
detecting the desired activity.
In one format, the relative amounts of a protein of the invention between a
cell
population that has been exposed to the agent to be tested compared to an un-
exposed
CA 02433436 2003-06-16
WO 02/50301 PCT/USO1/48276
control cell population may be assayed. In this format, probes such as
specific antibodies
are used to monitor the differential expression of the protein in the
different cell
populations. Cell lines or populations are exposed to the agent to be tested
under
appropriate conditions and time. Cellular lysates may be prepared from the
exposed cell
line or population and a control, unexposed cell line or population. The
cellular lysates
are then analyzed with the probe, such as a specific antibody.
Agents that are assayed in the above methods can be randomly selected or
rationally selected or designed. As used herein, an agent is said to be
randomly selected
when the agent is chosen randomly without considering the specific sequences
involved
in the association of the a protein of the invention alone or with its
associated substrates,
binding partners, etc. An example of randomly selected agents is the use a
chemical
library or a peptide combinatorial library, or a growth broth of an organism.
As used herein, an agent is said to be rationally selected or designed when
the
agent is chosen on a nonrandom basis which takes into account the sequence of
the target
site and/or its conformation in connection with the agent's action. Agents can
be
rationally selected or rationally designed by utilizing the peptide sequences
that make up
these sites. For example, a rationally selected peptide agent can be a peptide
whose
amino acid sequence is identical to or a derivative of any functional
consensus site.
The agents of the present invention can be, as examples, peptides, small
molecules, vitamin derivatives, as well as carbohydrates. Dominant negative
proteins,
DNA encoding these proteins, antibodies to these proteins, peptide fragments
of these
proteins or mimics of these proteins may be introduced into cells to affect
function.
"Mimic" used herein refers to the modification of a region or several regions
of a peptide
molecule to provide a structure chemically different from the parent peptide
but
topographically and functionally similar to the parent peptide (see Meyers,
(1995)
Molecular Biology and Biotechnology, VCH Publishers, 659-664). A skilled
artisan can
readily recognize that there is no limit as to the structural nature of the
agents of the
present invention.
Without further description, it is believed that one of ordinary skill in the
art can,
using the preceding description and the following illustrative examples, make
and utilize
the compounds of the present invention and practice the claimed methods. The
31
CA 02433436 2003-06-16
WO 02/50301 PCT/USO1/48276
following working examples therefore, specifically point out the preferred
embodiments
of the present invention, and are not to be construed as limiting in any way
the remainder
ofthe disclosure.
Examples
Example 1
Identification of Genes Differentially Expressed in Differentiating: Precursor
Stem Cells
Human Fetal Stromal Cells (HFSCs) were obtained from Dr. Xu Cao,
Department of Pathology at the University of Alabama. These cells were
isolated from
the bone marrow of a twenty-week human embryo. HFSCs are derived from a
primary
culture and represent a heterogeneous population of osteoprogenitor cells.
HFSCs
exhibit a high replicative capacity, with a doubling time of approximately
twenty hours.
HFSCs retain a spindle-shaped morphology and have a uniform attachment
throughout
subcultivation. HFSCs can be sub-cultured up to twelve passages while
retaining both
proliferative and osteogenic capability.
HFSCs used for READS analysis or QPCR (quantitative RT-PCR) were cultured
in Dulbecco's Modified Eagle Medium (DMEM)-high glucose or DMEM-low glucose
supplemented with 10% Fetal Bovine Serum, respectively, at 37°C in a
humidified
atmosphere containing 95% air and 5% COZ in the absence and presence of the
indicated
treatment. RNA was extracted from the cells at zero minutes, three hour, six
hours,
twelve hours, twenty-four hours, forty-eight hours, three days, six days,
twelve days and
twenty-four days. When indicated, cells were contacted with either bone
morphogenic
protein-2 (BMP-2) at 300 ng/ml or transforming growth factor beta (TGF-beta)
at 1
ng/rnl or cycloheximide at 1 ~.M. Cells were incubated for the period of time
indicated
and harvested.
Total cellular RNA was prepared from the human fetal stromal cells described
above. Synthesis of cDNA was performed as previously described in WO 97/05286
and
in Prashar et al., (1996) Proc. Natl. Acad. Sci. USA 93:659-663 (READs).
Briefly;
cDNA was synthesized according to the protocol described in the GibcoBRL kit
for
cDNA synthesis. The reaction mixture for first-strand synthesis included 6 ~,g
of total
RNA, and 200 ng of a mixture of one-base anchored oligo(dT) primers with all
three
32
CA 02433436 2003-06-16
WO 02/50301 PCT/USO1/48276
possible anchored bases
(ACGTAATACGACTCACTATAGGGCGAATTGGGTCGACTTTTTTTTTTTTTTTT
T n1 (SEQ ID NO: 61) wherein n1 = A/C or G) along with other components for
first-
strand synthesis reaction except reverse transcriptase. This mixture was
incubated at
65°C for five minutes, chilled on ice and the process repeated.
Alternatively, the reaction
mixture may include 10 ~,g of total RNA and 2 pmol of one of the two-base
anchored.
Oligo(dT) primers annealed such as RP5.0 (CTCTCAAGGATCTTACCGCTT,BAT)
(SEQ TD NO: 62) or RP6.0 (TAATACCGCGCCACATAGCATI$CG) (SEQ ID NO: 63)
or RP9.2 (CAGGGTAGACGACGCTACGCT18GA) (SEQ ID NO: 64) along with other
components for first-strand synthesis reaction except reverse transcriptase.
This mixture
was then layered with mineral oil and incubated at 65°C for seven
minutes followed by
50°C for another seven minutes. At this stage, 2 ~.1 of Superscript'
reverse transcriptase
(200 uuuts/ ~,1; GibcoBRL) was added quickly and mixed, and the reaction
continued for
one hour at 45-50°C. Second-strand synthesis was performed at
16°C for two hours. At
the end of the reaction, the cDNA was precipitated with ethanol and the yield
of cDNA
was calculated. In our experiments, 200 ng of cDNA was obtained from 10 ~.g of
total
RNA.
The adapter oligonucleotide sequences were
A1 (TAGCGTCCGGCGCAGCGACGGCCAG (SEQ ID NO: 65) and
A2 (GATCCTGGCCGTCGGCTGTCTGTCGGCGC) (SEQ ID NO: 66). One
microgram of oligonucleotide A2 was first phosphorylated at the 5' end using
T4
polynucleotide kinase (PNK). After phosphorylation, PNK was heated denatured,
and 1
~,g of the oligonucleotide A1 was added along with lOX annealing buffer (1 M
NaCl/100 mM Tris-HCl (pH 8.0), 10 mM EDTA (pH 8.0)) in a final volume of 20
~,1.
This mixture was then heated at 65°C for ten minutes followed by slow
cooling to room
temperature for thirty minutes, resulting in formation of the Y adapter at a
final
concentration of 100 ng/~l. About 20 rig of the cDNA was digested with 4 units
of Bgl II
in a final volume of 10:1 for thirty minutes at 37°C. Two microliters
(4 ng of digested
cDNA) of this reaction mixture was then used for ligation to 100 ng (fifty-
fold) of the Y-
shaped adapter in a final volume of 5 ~1 for sixteen hours at 15°C.
After ligation, the
reaction mixture was diluted with water to a final volume of 80 ~.1 (adapter
ligated cDNA
33
CA 02433436 2003-06-16
WO 02/50301 PCT/USO1/48276
concentration, 50 pg/~1) and heated at 65°C for ten minutes to denature
T4 DNA ligase
and 2 ~,1 aliquots (with 100 pg of cDNA) were used for PCR.
The following sets of primers were used for PCR amplification of the adapter
ligated 3'-end cDNA: GAAGCCGAGACGTCGGTCG(T),8 n1, n2 (SEQ ID NO: 67)
(wherein n1, n2 = AA, AC, AG, AT, CA, CC, CG, CT, GA, GC, GG or GT) as the 3'
primer with A1 as the 5' primer or alternatively P5.0, RP6.0 or RP9.2 used as
3' primers
with primer Al . l serving as the 5' primer. To detect the PCR products on the
display
gel, 24 pmol of oligonucleotide A1 or Al.l was 5'-end-labeled using 15 :1 of
[garnma-
32P]ATP (Amersham; 3000 Ci/mmol) and PNK in a final volume of 20 ~,1 for
thirty
minutes at 37°C. After heat denaturing PNK at 65°C for twenty
minutes, the labeled
oligonucleotide was diluted to a final concentration of 2 ~.M in 80 q,1 with
unlabeled
oligonucleotide Al.l. The PCR mixture (20 ~,1) consisted of 2 q.1 (100 pg) of
the
template, 2 ~.l of 10~ PCR buffer (100 mM Tris~HCl (pH 8.3), 500 mM I~Cl), 2
~,1 of 15
mM MgCl2 to yield 1.5 mM final Mgz+ concentration optimum in the reaction
mixture,
200 ~,M dNTPs, 200 nM each 5' and 3' PCR primers, and 1 unit of Amplitaq~
Gold.
Primers and dNTPs were added after preheating the reaction mixture containing
the rest
of the components at 85°C. This "hot start" PCR was done to avoid
amplification
artifacts arising out of arbitrary annealing of PCR primers at lower
temperature during
transition from room temperature to 94°C in the first PCR cycle. PCR
consisted of five
cycles of 94°C for thirty seconds, SS°C for two minutes, and
72°C for sixty seconds
followed by twenty-five cycles of 94°C for thirty seconds, 60°C
for two minutes, and
72°C fox sixty seconds. A higher number of cycles resulted in smeary
gel patterns. PCR
products (2.5 ~,1) were analyzed on b% polyacrylamide sequencing gel. For
double or
multiple digestion following adapter ligation, 13.2 ~,l of the ligated cDNA
sample was
digested with a secondary restriction enzymes) in a final volume of 20 ~,1.
From this
solution, 3 ~.l was used as template for PCR. This template volume of 3 ~,l
carried 100
pg of the cDNA and 10 mM MgClz (from the 10~ enzyme buffer), which diluted to
the
optimum of 1.5 mM in the final PCR volume of 20 ~,1. Since Mg2+ comes from the
restriction enzyme buffer, it was not included in the reaction mixture when
amplifying
secondarily cut cDNA. Individual cDNA fragments corresponding to mRNA species
were separated by denaturing polyacrylamide gel electrophoresis and visualized
by
34
CA 02433436 2003-06-16
WO 02/50301 PCT/USO1/48276
autoradiography.
Bands identified as having different expression levels in treated versus
untreated
human fetal stromal cells were extracted from the display gels as described by
Liang et
al., (1995) Curr. Opin. Immunol. 7:274-280), reamplified using the 5'- and 3'-
primers,
and subcloned into pCR-Script with high efficiency using the PCR-Script
cloning lcit
from Stratagene. Plasmids were sequenced by cycle sequencing on an ABI
automated
sequencer. Alternatively, bands were extracted (cored) from the display gels,
PCR
amplified and sequenced directly without subcloning.
The sequences thus identified are listed in Table 1 along with any related
sequences as indicated by the designation "Related To" under the Class colmnn
in Table
1. This table also provides the GenBank accession number and name of the genes
related
to the sequences identified by the READS analysis. The identity column of
Table 1
contains information on the closeness of the sequence determined by READS
analysis to
the sequence in the public database. For example, the first entry of Table 1
indicates that
the sequence of the fragment identified by READS is identical to the published
sequence
in 343 of the 348 positions of the READS fragment and has 98% sequence
identity to the
published sequence. The last column of Table 1 also indicates whether the
expression of
the sequence identified by READS analysis was up- or down-regulated in the
differentiation process.
Figures 1-25 present a graphic depiction of the expression level of some genes
whose expression pattern was found to be dependent upon the activation state
of the
precursor stem cells. These figures represent the data obtained from READS gel
analysis
of the mRNA expression data from Human Fetal Stromal Cells. READS analysis (as
described above) was performed on the total RNA samples isolated from HFSCs
that
were treated with either TGFb (1 ng/ml of culture media) or BMP-2 (300 ng/ml
of
culture media) for up to twenty-four days. Time points were selected at one,
three, six,
twelve and twenty-four days post initial treatment. In a few cases, time
points were
selected at thirty minutes, three, six, twelve, twenty-four and forty-eight
hours post initial
treatment. Control cells received media only with no added osteogenic agent.
Subsequent to READS gel analysis, the images of each gel were converted into
electronic format and the intensities of each band of interest were calculated
relative to
CA 02433436 2003-06-16
WO 02/50301 PCT/USO1/48276
the background autoradiographic intensity of each gel image. The corrected
values are
termed adjusted intensity values, which were plotted on the y-axis versus the
time course
of the experiment.
Example 2
Gene chip expression anal,
Precursor stem cells (for example, HFSCs or human mesenchymal stem cells)
which may be treated with a differentiation inducing agent and/or osteoblasts
may be
obtained using any means known to those skilled in the art. For example, human
mesenchymal stem cells (HMSCs) are isolated from human bone marrow and are
capable
of differentiating into bone, cartilage, fat and other connective tissues.
HMSCs exposed
to osteogenic stimulus undergo osteogenic differentiation by showing an
increase in
alkaline phosphatase (APase) enzyme activity and deposition of mineralized
hydroxtapatite extracellular matrix (Jaiswal et al., (1997) J. Cell. Biochem
64:295-312).
HMSCs obtained from Clonetics were expanded to passage four and cultured in a
basal
medium (DMEM-LG containing 10% FBS and 1% antibiotic/antimycotic) at
37°C in a
humidified atmosphere containng 95% air and 5% CO2. Cultures were treated with
BMP-2 (100 ng/ml) and TGFbl (1 ng/ml) to extract RNA at twenty minutes, three,
six,
twelve, twenty-four, and forty-eight hours and, three, six, twelve and sixteen
days.
Microarray sample preparation may be conducted following the protocols set
forth in the Affymetrix GeneChip Expression Analysis Manual. For example,
samples
comprising cells of interest or tissue comprising such cells may be frozen.
Frozen
samples may be ground to a powder, for example, using a Spex Certiprep 6800
Freezer
Mill. Total RNA may be extracted using conventional techniques such as with
Trizol
(GibcoBRL) utilizing the manufacturer's protocol. The total RNA yield for each
sample
will likely be in the range of 200-500 ~.g per 300 mg sample weight. mRNA may
be
isolated using the Oligotex mRNA Midi kit (Qiagen) followed by ethanol
precipitation.
Double stranded cDNA can be generated using conventional techniques such as
those
described above of by using the Superscript Choice system (GibcoBRL). First
strand
cDNA synthesis may be primed with a T7-(dT24) oligonucleotide. The cDNA may be
purified, i.e., may be phenol-chloroform extracted and ethanol precipitated.
The cDNA
36
CA 02433436 2003-06-16
WO 02/50301 PCT/USO1/48276
may be re-suspended at final concentration of ahoutl ~.g/ml. From 2 ~.g of
cDNA,
cRNA may be synthesized using Ambion's T7 MegaScript~ ifa vitro Transcription
Kit.
In preferred embodiments, the cRNA may be detectably labeled. The cRNA may
be directly labeled by incorporating one or more detectable moieties into the
cRNA
molecule. In other embodiments, the cRNA may incorporate a moiety to which a
detectably labeled reagent may bind. For example, the cRNA may incorporated a
biotin
or digoxigenin moiety and may be detected using a detectably labeled
avid/streptavidin
or anti-digoxigenin antibody. To incorporate a moiety to which a detectably
labeled
reagent may bind, nucleoside triphosphates containing the binding moiety may
be added
to the transcription reaction. For example, nucleotides Bio-I 1-CTP and Bio-16-
UTP
(Enzo Diagnostics) may be added to the reaction. The transcription reaction
may be
allowed to proceed an appropriate length of time in order to generate the
desired amount
of cRNA. Suitable conditions might be a 37°C incubation for six hotus.
Typically,
impurities can be removed from the cRNA using conventional techniques such as,
for
example, using the RNeasy~ Mini kit protocol (Qiagen). cRNA can be fragmented
by
heating in a suitable buffer. One example of a suitable buffer would be of 200
mM Tris-
acetate (pH 8.1), 500 mM KOAc and 150 mM MgOAc. The cRNA may be heated at
94°C for about thirty minutes.
The fragmented cRNA can be assayed using a gene chip. In some embodiments,
the assay may be conducted using the Affymetrix protocol. For example, 55 ~.g
of
fragmented cRNA may be hybridized on the Affymetrix Human 42K array set for
twenty-four hours at 60 rpm in a 45°C hybridization oven. The chips may
be washed
and stained with a suitable reagent. When biotin is incorporated into the
cRNA, one
suitable reagent might be Streptavidin Phycoerythrin (SAPE) (Molecular
Probes). To
amplify staining, SAPE solution may be added twice with an anti-streptavidin
biotinylated antibody (Vector Laboratories) staining step in between.
Hybridization to
the probe azTays may be detected using any technique known to those skilled in
the art,
for example, by fluorometric scanning using a Hewlett Packard Gene Array
Scanner.
Data may be analyzed using Affymetrix GeneChip~ version 3.0 and Expression
Data
Mining Tool (EDMT) software (version 1.0). When the Affymetrix GeneChip 42K
human gene chip is used to assay expression levels, the EDMT may be set to the
37
CA 02433436 2003-06-16
WO 02/50301 PCT/USO1/48276
following criteria: (1) For each gene, Affymetrix GeneChip average difference
values
may be determined by standard Affymetrix EDMT software algorithms, wluch also
made
"Absent" (= not detected), "Present" (= detected) or "Marginal" (= not clearly
Absent or
Present) calls for each GeneChip element; (2) all negative values (= Absent)
can be
raised to a floor of +20 (positive 20) so that fold change calculations may be
made where
values were not already greater than or equal to +20; (3) median levels of
expression may
be compared between the differentiating and non-differentiating cells to
obtain greater
than or equal three-fold up/down values; (4) The median value for the higher
expressing
group may be greater or equal to 200 average difference units in order to be
considered
for statistical significance; (5) Genes passing the first four criteria will
be analyzed for
statistical significance using a two-tailed T test and deemed statistically
significant if p <
0.05.
The expression levels of one or more of the genes identified as involved in
the
differentiation of precursor stem cells may be assayed as described above. To
serve as a
positive control, the expression level of a gene that does not change during
differentiation may be assayed.
Example 3
Quantitative RT-PCR Verification of Expression Levels
Figures 15-26 show quantitative RT-PCR profiles from some of the selected
targets described in Table 1. Human fatal stromal cells (HFSCs) and Human
Mesenchymal stem cells (HMSCs) were used for this study. Briefly, PCR primers
were
designed using the DNA sequences provided by sequence analysis of the READS
fragments. TaqMan probes were also designed using the READS fragment sequence
information. Experimental conditions were as follows: HFSCs were cultures in
vitro
and were left untreated for up to twenty days, or were treated with the
osteogenic agents
TGFb (1 ng/ml culture media) or BMP-2 (300 ng/ml of culture media) for the
same
period. HMSCs were also cultured in vitro and were left untreated for sixteen
days, or
were treated with TGFb (1 ng/ml culture media), BMP-2 (300 ng/ml culture
media) or
dexamethasone (100 nM) for the same time period. Cells in each treatment group
were
harvested at zero, three, six and twelve hours, one, three, six, twelve and
twenty days in
38
CA 02433436 2003-06-16
WO 02/50301 PCT/USO1/48276
the case of HFSCs. For the HMSC experiments, cells were harvested at zero,
three, six
and twelve hours, one, three, six, twelve and sixteen days post treatment.
Total RNA
was isolated from the cells using Trizol and the RNA was quantitated using a
spectrophotometer set at A26o. Total RNA (10 ng) was assayed in duplicate
suing the
TaqMan~ assay (Perlcin-Elmer) in biplex format where each target gene in each
RNA
sample was assayed versus a reference mRNA which was shown previously to be
constitutively expressed and not regulated by any of the osteogenic
treatments. The
threshold cycle (CT) values of the target and reference gene were analyzed and
the delta
CT values were calculated for each RNA sample. Fold change (expressed as
relative
expression) was plotted versus the time course of the experiment. Expression
was
relative to the delta CT value (Target CT minus Reference CT) for t = 0 which
was set to a
value of 1Ø
Example 4
Activity Assays_
The present invention has identified numerous genes and gene families
differentially regulated during the differentiation of precursor stem cells
into osteoblasts.
The activity levels of proteins encoded by these genes or members of gene
families may
be assayed using any technique known to those skilled in the art. When the
encoded
protein is an enzyme, it may be desirable to assay the enzymatic activity of
the protein.
This may accomplished, for example, by contacting a sample with a substrate
for the
enzyme and assaying for the conversion of substrate to product. For example, a
labeled
substrate may be provided which is converted into a labeled product which may
be
subsequently quantified. Labels may be of any type conventionally used by
those slcilled
in the art for this purpose. In some preferred embodiments, the label may be a
chromophoric group, a fluorescent group, a radioactive group or other
detectable group.
In some instances it may be preferable to detect the activity using an
immunological technique such as V~estern blotting, ELISA, radio-
immunoprecipitation
(RIP) and the lilce. Thus, the term activity is seen to include the physical
presence of the
protein of interest. This may be useful in cases where the protein lacks a
readily
assayable enzymatic activity or where, for other reasons, assaying an
enzymatic activity
39
CA 02433436 2003-06-16
WO 02/50301 PCT/USO1/48276
is not desirable.
An agent which may be an activator or inhibitor of a particular biological
target
may be assayed. The assays may be cell-free assays to measure the biological
activity of
protein target after disruption of the cell in which the target is expressed.
The assays
may be cell based assays to determine the activity of the target protein by
measuring a
biological response of a cell in which the target protein is located.
Cell-free assays may optionally include one or more purification steps. Such
purification steps include, but are not limited to, centrifugation steps,
precipitation steps
and chromatographic steps. After disruption of the cell expressing the protein
target of
interest, the target may be purified to a desired purity before the assay is
conducted.
When the assay is specific for the activity in question, it may be desirable
to use the
disrupted cells with no purification step. In other instances, it may be
desirable to purify
the desired activity from one or more contaminants prior to assaying. In a
preferred cell-
free system, enzyme activity or receptor binding may be measured using
europhimn-
chelated antibody specific for target enzyme or europhium-derivitized ligand
that binds
to receptor (see, for example, Matlus, (1993) Clin. Chem. 39:1953-1959; Gaarde
et al.,
(I997) J. Biomol. Screen. 2:213-223). In some embodiments, fluorescence
polarization/correlation spectroscopy can also be used to measure enzymatic or
binding
reaction by using fluorescenylated peptide substrate or target (Seethala et
al., (1997)
Anal. Biochem, 253:210-218, 1997, Lynch et al., (1997) Anal Biochem 247:77-
82).
Cell-based assays using reporter genes may be used for the screening of
compounds. Activation of a cell surface receptor or a ligand-gated ion channel
can
induce a change in the transcription pattern of a number of genes. The ligand-
induced
alteration in transcription can be measured using gene fusion, in which a
promoter
element responsive to activation is fused to the coding region for an enzyme
or protein
whose level can easily be measured (Martin et al., (1996) Biotechniques 21:520-
524).
Other assays, which detect immediate early response to gene activation are -
elevation of
second messengers (CAMP, Ca'+), phosphorylation of an intermediate signaling
protein
or subcellular translocation of a signaling molecule (Stable et al., (1997)
Anal. Biochem.
252:115-126; Miyawaki et al., (1997) Nature 388:882-887; Lenormand et al.,
(1993) J.
Cell. Biol. 122:1079-1088). Design and execution of such assays are routine in
the art.
CA 02433436 2003-06-16
WO 02/50301 PCT/USO1/48276
Example 5
Drug; Screening Assa,
Candidate agents and compounds will be screened for their ability to modulate
the expression levels and/or activities of one or more of the genes identified
as being
involved in the differentiation of precursor stem cells into osteoblasts by
any technique
knomz to those skilled in the art including those assays described above. In
some
preferred embodiments, the assay of gene expression level may be conducted
using real
time PCR. Real time PCR detection may be accomplished by the use of the ABI
PRISM.
7700 Sequence Detection System. This system measures the fluorescence
intensity of
the sample each cycle and is able to detect the presence of specific amplicons
within the
PCR reaction. Each sample is assayed for the level of one or more of the genes
identified as being involved in the differentiation of precursor cells into
osteoblasts
including, but not limited to, those genes and members of gene families
identified in
Table 1.
The expression level of a control gene, for example GAPDH, may be used to
normalize the expression levels. Suitable primers for the candidate genes may
be
selected using techniques well lrnown to those skilled in the art. These
primers may be
used in conjunction with SYBR green (Molecular Probes), a nonspecific double
stranded
DNA dye, to measure the expression level mRNA corresponding to the genes,
which will
typically be normalized to the GAPDH level in each sample.
Normalized expression levels from cells exposed to the agent are then compared
to the normalized expression levels in control cells. Agents that modulate the
expression
of one or more the genes may be further tested as drug candidates in
appropriate iya vitro
and/or i~ vivo models.
Although the present invention has been described in detail with reference to
examples above, it is understood that various modifications can be made
without
departing from the spirit of the invention. Accordingly, the invention is
limited only by
the following claims. All cited patents, applications and publications
referred to in this
application are herein incorporated by reference in their entirety.
41
CA 02433436 2003-06-16
WO 02/50301 PCT/USO1/48276
m
WW WW ~ WN NN NN NN N ~N -i s -~ a
Ut.PWN OtD07V O)Cn.pW N O i0N VW G7.pW N-~OtD07J 07U7.pWN -i
N N N N N N N N N N N N
W i i
c ci ci ci o ~ ~ ci ~ nn
T T ~ T ~ T J O' T T ~ Td
G) G~ G) G) G~ G) G~ G) N
(D N N N (D tD N N N (D (D G~N
7 7 7 N
~ 7 >
N N (D O N N N (D (D N N N
Nj ~~ x ~T ,~"~~cn~x x x~ x~ xx x -Dn~ ~x xoDO~-~~m - ~x xW
, n ~n
~ t0O ~~ (,pW OV O O)_ U7~ OO J OW WV -~ ~ ~
OW OO Wj jW t1O)W .pW VV m WfnOU7JO OVm U1W U7O1 WZ
L~
WU7(jCDO7 P c007PQ7AU1!J100O OUtf37 Nt0WV 1a. WC
C011O O ya
~W V ~O O _ ~fDOyl1WV W O) iCON ~
WV O)O O ~ ~ ~~ OV W~ O
V WV p ' 'O O07WV ODW~ COW O C U W c
11 1 0
f
CTDN OUt01O7
1
7~
OO C(pO CO OO C(~OO O OC CC OC O OO OO CO CO OO O OC CW
33 3 ~ ~3 ~3 3 3
g 3 3 3~ 33 ~3 ~ 33 33 ~3 ~3 ~~ 3 33 3
0o mo o
mo 0o v o0 0 od dm om o 00 0o mo mo 00 0 om rUZ
W~ O O > >> O
Nfp , f/1 N N(A '-IN41!A!A N N p1f/1WN ON ON U!fpN N>
wm Oc~rycd dfyzp mm a>rya fna n~ m mrymm m
~ Ow dm w fn
a'O? '~N~ 'O'O-~O a'D'O'O~ j~ ~_,~ a aa aa_.~'p.O'p'p_a 'Oa.fanNO
CD- ~OD (D (D-fD ~ (D(D(D(D
(D (D
. N (p(D (D(D(D(D(D (D7(D<D(D(D(D,~
u'~~ ga o> >> ~m >> > >g o3 z > >> >> z m> >> > >
C 41.-.fpN!~O~~ fpfpN N ND flyt/7(nNN
n (/lO N fAN DN (/l(pf/7N NN (D
~ o ... m~ Dw ~ ~a na oo ~ D3 c~ 00 ~~ ~~ o ~3 3
...
z ~m ~~ _ n _ ~ ~~ n i iZ mW ZD rm p'D ~
~ ~
~ ~ ~ f '>
'N _ O O J D r O
?. O O Cfpa nN ' '3t T( >> t0 ~= Np n ~W ~ a n
~O D n n
,'pWC .-7? ~~ (Dt~~p ~ zO ~O SS j ~fnW ij (D~ ~ OIa(D
v uiN aa o cn ~ Dj oC~~~ mm N~ roz ~fn,~a ~?~~ ai
G)
fn mc~ 'o~._ ~ ~, oo v~ o0 o .ao~o a o
~ '
0 0' y~ m,~= z ~ ~ m aa ~' ~z ~o,~m coJo 0
'
.1~W . W mm o ~ ~? ' o c~ ~ h ~~~~~ m
o na ~ d c
a N o ~ w o ~ o~,Z ~~ a ~ o
~
O ~ O O7 AA p~~Ø.S 'O O W ~a.D N '?'(D~ (DN
~
O 4i~ a'0 ~ Wv ~,O ~O O ~ jN O D.7.
f
O O' f7T 0 ,. 7 x 'O O O '~ O
O N .. tz ~ 91WN ~ N
~
~~ Q7~ p ~ GD coWa
d
N jV. O ~ j m _ N
~ N O
d(y 9 ~ X ID C O,fp (7V
'DnO ~ (D fpt11
W _ ~ a j , ~ ~O I
O ~
n d61 O 7 X' (D n fp .0m
~ ~
n~ ~ m ~ ~ o.y w,
v ~o o ~ c ~ m ~ m
C1N
o m ~ O m < s~
C7~ ' J N '~-I
:UN D ~ 3 dN
w m W o ?..r
m c s
n
a
o o a
m o o a
o ' '~ ~ m
fnp f
n
m
W
fn m
m
0
~c
n
0
d
N
(D
NN N NN NN .p.P.p.?N NN NN NU7U1W Cn ~P Wp..P.NN N
O)J NO W OGtCJ1U1VJ O)U7O)07p CJ1U7 fDOO OO J WW fbV V WW
. jj O W
OW ~ V ~W NN WO Ot0? ~m WO ~ N W(OOW U~~ p7(pt0AODWd
NN CO-'W ''N NN NN 01CJ1j ON NN NN N N~ ~W CnJ A ~P.pp NN N
OV ~ OO O0 JO NN OW ?N NN N W~ W OW ~V O O ~~ W'
. OO ~ OC tf (j )lf .P t O .O Q7P . ~
P O D0 O f7~ JI P . P
COc0t0N V Wc0t0CO(pQ OD07COtD(Dc0c0COt0(7DOGf0COf0(DO f0t0CD(DfDtD(DtD'
fDCD A WW V VV O OV <DCOc0tD.p,<n07f0c0CD tDCDWfpODCDW 90
m
vv v v ov o 0o vo 0 0
cc o0 0 oc cc oo cc c co 00 00 0 oc cc cc cc cc c cc c
- ~
aa ~~ ~ ~w oo fy oa o of E~ ~~ ~ ~a ao aa ao aa a aa a
- '
<p(D== 7 7fp((D>> (D(D(D(D> >7 77 7 Ofpfp(D(DID(D(9(D(D(DfD(D(DN
p NN fnfnInON (D(DNN N Na (DO f0n (~t0O(nfnOO (D
f t
CC (pp (pfnC C_C p(pCC C_C(Opp (O0 0 0C CC CC CC CC C CC CO
(yp~(C C Cp ( CC ( ( fC ff f C NN NN d NN O
C C C CC C
_N C1N~ p7(y67N p7y O dC1G7N Nd N 91p~p~p~p~d N
O ND DN N D N N N N
NID N ( I ( N N(D(D N (D ON (D
nn mm m mn aa mm nn a nm mm mm m ma nn nn nn o.a n na ap
nn n a an a nn na n n =,
m
42
CA 02433436 2003-06-16
WO 02/50301 PCT/USO1/48276
V07D)O O07O)Q)Q)~07CItU7CIIUtU1U7U7GJ~j LT.p.A.p~..pA ?? ~? WW W W
O(OWV mCJ7? WN O (OW V O1(J1.p.W N Of0W V01Cr.pWN O t0N V Q)
N N N N N N N N N N N
O O O n n O n C7 n (7 n
T T S ~ S T J ~' ~' S T
Ct C) Ct ~ Ct
N N N N (D N N N N N N
7 ~ 7 ~ 7
~ 7 7 7 7 ~7 7
(D N N N N N N (D N W' N
D D DD DD D DD DD D DD DD DD D DD D D DD
r ~~ -n 07N~ -- - - '
j ~j ~ ~ W~ C7nn nC7n~-rC r n~ vC Cj ~C nztC ~
O ON O ~ ~ O O O~ OO ON -Q).pO Wr a W OO 07
D O m ~ W W O UtV VO ODp WA W ~~ ~p pV Vj Ui O O
O
N WO Aw w~ A r~ WO ~O r Nm ~O ~~ ~r N I
V w
. ( N W _ ~OOD ? VO WJ ~ ~N N( V~ tV VI~ (n?
p D O 0
67Q) OODmV ODCJIO) VN N WA (11r aN f0 VU1 W A VUt
S 22 SS 2Z 2 SZ SZ S2 S 2Z SZ 22 SZ Z S2 22 22 22 I2 S S
C OC OO OO O OO CC OO C OO OO OO cc O OO OO cO OC OO O O
3 9~ ~3 33 3
3 ~ 33 33 ~ ~3 3~ ~3 33 3 ~~ ~3 ~~ 3~ 33 3 3
m om o0 00 0 0o wm oo m o0 00 0o m 0 00 0o mo om o0 0 0
NN d 7_ f/1N O td41NN NN >> M !pU!t/1N OtdfOO 41N t/1N
N da aa NSUN Na,Za v~,z va aa va,o~ ~ -'~ a~ fnm''D~ a~ a ~
v,o v-ca a ' '
'-
c m cocococo~ccom D~ com D cococococom ?~'m co~oco, z .n co'~ucoco
~rn>> >> > >> m m
>> >> >> >> m
m N NN N N N NO m > >> >> m~n> >> >
n~ n /1 NN 7 MM f/)f/1f/1N (nN f/!41fn(n (nZJNN N /!
7
_ _
~ ~~ ' ~
( ~ C(DTvO_ ~N S.N C~ ?n_,~.~~ 7O
D 7 c ~~1 S-.
~
O O ~7 C7C _ Wz O~ ~O~ ~N T~,p _p7VO N c (DN T'~ ,a7~ Z
C (D
3~ OO NT ~ .CD ~( O ~ O-'-N (C ~a A O7 O'0 ~ 'O d D
to N O a
~~ o~ ~ co 3 3~ ~'So~ ~~ nam ~ om o . ~ ~o ~ o
.
o o ~ O . a a _.
N fDN N d ~'~7N N (DT.~W 7Z ~p~~ ~~'~V O O(DZ c
o O a
o - ~~ mN m v ~ ~D ~D ~.-, enp ~p ~ D co
C O OO ~ .7..O TG ~ ~n A'~ _ 7
7
O n ~ ~ N O n _ ~ n a
W i ~~ ~ ~ ~~ ~ ~ ~ ~~ ~
v Dn w w ~ n c73 D>> , ~ ~ o
i~Z m m -~ ~m m m D c' m
w D na N ~n s v ~ ~ -~ zv om T C7o 9< mo,
'~'~ Dc N c
v o ao O._. ~ cD. ~ ~x in N
N D ~
r,o ~ ~ N ~ O 3 c~ ~~ ~ 3- o ~c
n N m rva 0 m
m ~ ~ v~~n ~ a c o ~ a = c
' m~ o~
~~ m ' a ~ ~ N~,n~ a m ~N N~
o a i
N o ~ y ~,~ c,A~ s~ j ocom~ o~D
~ '
o ~' ~ ' ~~ m' v ~ ~ ~' -i
o ~7 . ~
G 9
~ Wo 3 N o ~~ 00 0
N ~7
~
r
3 p Zo Q IT1
~, 3 Z r
o m 'o ' N
. cn~ a
m tQ
N "O O
w o m N
sj lr ~ jj .P.p.pW W WW W~ N NW WN N N
pp pp IVNN NO OO VV V OW O .p'P"PV V0707)
W C'7-~(\ OV V VC11WW 7O ~ ~~ ~A AO N' N 01.'.Nj OW Wm WtD(Dc0
~
V _p .faA.pc0t0(DCON __ 'P'p'W W WW W' ? ?W WN NNN
.P ~
jj ?W NN N N pi>00W NN NO O.O f0V c0NV V? .P N VV V V
U1VN JN OO O OO pO pp ~ ~O O01U1 O(DCDNW WN W~''~WO 07O O O
tDt0c0.pc0t0tDCOctDODN OV O OO OO Oc0c0c0t0CDc0c0c0t0~ 0tD(D(OtDf
(DCDc0 t0(Dt0c0c0f0 O OO OO pO WW W 01V VN VO OODf0c0(Oc0
v vo ov v vo vo 00 0 00 ov o
0 0o Cc o0 0 00 00 0o C cC Co 0o cc c o0 oc cc Cc CC c c
a F
f ~f a ~ f f~ ~~ ~~ a aa af ~f aa a ~f fa aa aa aa a a
c mm >> > >> >> >> m mm m> >> mm m > >m mm m'mmm m m
o 'mm m mm mm mc'o~ ~no ccm'mm ~o ~ mm mo ~~ ~<noc ~ cn
cc rco~ncc caca~ncoc cc c<ncnc cc c cns cc cc cc cc c c
c cc vv cc c cc cc cc d v~ vc cc y~ ~ cc c~ ~v vv d~ v v
m mm ~~ mm m dm mm mm ~ mm m~ wm mm m ~m mm mm mm mm m m
~m aa mm m mm mm mm ~ a a a
a aa a~ mm aa a
a aa aa a a. ao.aa a aa o.a aa aa aa a
43
CA 02433436 2003-06-16
WO 02/50301 PCT/USO1/48276
J .i
O O OO OO OO (OCOt0t0t0tD(p(p(O(pp7(pppCpCpC7p(pp CbppV JJ ~1~IJ JV
V W U1.PWN O c000J Q7U1.pW N O t0ODV07Ut?.WN OCO07V Q)U1A WN
N d dN N N N N N fl1 N N N N
f7 n (~n (~C! C~ n n 7 O ~ ) n
T T ~'T T T ~ S T t ~ I C J
Ct Ct~ ~ ~ G) Ct Ct T ~ ? .T
Cr G) Ct
N N NN O O N O N N N N N N
>
> >> 7 7 7 7 7 O a O 7 7
O N N(D N (D N N (D N N N N (D
D D DD D D D D D DD D D DD D
r r C)r C~ ~~ ~ ~~ xx Cn x C w xr r) - v - -
~ j ( rr _~ 3 vn (~aoC r~
-~O O-aN(DVO N NN ~~ OO J Co O
O W O
O A OW COO p.pW WW .P.p~IO 67_(DO)VI W ,.i~ N,~O)V( .ijOW W O)C
COtD W JiP J7
01 (D? c0W ~ 0707COf0O~U1CT~If0NO U1UIO .
~ J WW Jr J V~ NO W pN 0~ ~ ~O O0 O)A~ ~~ ~ W
A (ON O ? ~
-'c0cO c f 07 Ut o O . . 0 ~ W ~0 N OV N~ .pW V N01
OJ D01 0 0 O D p.p, 0
c0
N (O O) U C (, WO ~I
7 71n
z z zz xz zx z zz zz zz z sx =x zz zz zz z zz zz zz z zz
O O OO CC OC C CC CC CO O OC OC CG CO CO O OC OO OO C CO
3 33 3~ 3 33 33 33 ~ ~3 3~ 3~ 33 ~~ ~ ~~ 33 3~ 3 3~
0 0 0o mm on~m mm mm mo 0 oe~om mw wo mo 0 om o0 0o m n~o
>> > > >> >> > > > >> > > > > >
UI4J(OM N tpfpM U! N N fnN NU7fnt/7 (d
m m mw v,3 n~~ z 2z ~~;=I~ ~ ~,~mc~3p 3-o,pd a~mN vm mo~m ad
-ca aa,cco --.~ ~ ~~ ~~ a ' 'am a~S - a a aN aa aa ~
,p
~ _.. .. Z Z x ~
(D(D(D(D~~ (D~ S? _(D(D(D'G(pO '~ ~7 (U(D(D~ 7(D(D(D O7
> > >> ~ 7 77 > > ZD Z D d ~n
N (pNt/!On Vl ~~ nN N >O >< ~n ~ 5 ~v m> >> O
TC !G~ -~.~ (nx N- DN DO NN N NN (Af/!NN n a(p
-
o ~ ~o mv o.o a aa a;c ~o Z Nd ~~ o~ ~J a3 ~ 3~'o~ ~.3 ~ o
Z oO 'o ~.0 00 -_ >> ~ ~N ZN c .oo c~ ~3 ,a ~ .00
_ m m m o m
m D ~D ~m m='m mm '~'~o0 W ~ D< Nc c~ cZ o Zo (n 3Z ~ am
m o m ~ ' ~cc 0 o oo ~D o D ~~ oD a N
v is v > >> ~ 3 x~ v ~m ~N ..- a ~
NO r ~p o N
C TvO C~ (DO OO G~~1D. ~N OO n O NN NO O N.fa
f o
O N 3it3 '~.~ 0 00 -co~ v Z Nm ~ o m oO m c ofvia~ _ No
' D ~.
_ ~ a ~ ~~ 0 0o aa ~n ~ 3 ~ ~y ~ ~~ ~,9 v
~ c Vw m7 .f7~ 3~ OO ~ 7c'a ~ O bc0 Z N(DNO
n
OD
D .C (D(D W ~~ P
a(DI 'ONO ~~ Nro O...~ OZ
-n >> m m o
m n .o ~ om
O O = D
0 V pr 'a N a
O ~ ON c7 ~ (D~ N 7~ "ll ~ c ~N
7 O O C D
W O'N p(D 7 :-I~W a
~ j
j NC 7 t0~ N~ O O
p
0j N CT
V ~
O~ ~ O~ 7N O NN
0 _ 7
N o r 3 ~~C7? ~o
o _)
N
O JV A D
O O . ~. mO O
p w 0
0 3 ... _~ r
o S~ 1't1
w ~ Z
N r
N
W
W GJ
O
7
N
7
N
n
v
W
.P
W W NN WCnOp W WW ~ ~j j WW ~ ~ Q7Ol.P,p.p.pW
W W OlO i~? 'PP Q7p AA N p (D N Ja
COCp(Df0 j ~ ~ O O WW (nO
O W AO ~~ \ ~. 01 AN J W~ ODc0 O NCOCDA C11N p ON
N
W W NN Wp 07.Np_ _~ ~O O __ _W U1~ c0c0CDm07.pA ?.PW ~O
W W V OO p W WW 'AA WW ~ ? N pO)p N WOJCOCoJa W
'VO U1
N Ot~N 01W WCOCOCOCOWW tDj s OUtU1V Ja~ Op ,t0CD-'j COCONCO. CpCO
p Cp N
f0c0f0f0t0(Df0p p OO OO O~ ~ (Oc0tD f0CO~U7.p.PW f0(OCOc0tDCOf007CO
c0tD~lV WV VO p OO Op NO O 07(D~l tDA O 07W ~!07tDOD07
o v ot5ov v v o0 00 ov v v ov v o vo
0 0 00 00 oC o 00 00 00 o CC CC CC Co 00 o CC CC CC o 00
f f yo ~ ~F ff ~~ F f FF
g aa aa aa a f aa aa aa
7 7 77 77 7Cp7 O3 77 C7 7 CpCpC~Cp~CpCD7 O7 7 CpCpCpCpCpCp7 77
N N ND (DN DO N ~(DN(DtDN N OO Op OO ON NN N Op (DO OO N ND
(O(Df0t f0p tC (Cf~(O(C(~(Of0CpCC CC CC Cf0f0f~(pCC CC CC t0(~(
t0( (O f0
C C CC CC CpjC CC CC CC C pjCypjpjpj~ pjC CC C pjy ypjpjpjC CC
C1N NN N~ N N NN NN Nd N N NN N N NN
N N(D(D(D(DN (D (D(DNN Nl9
m m mm mm ma m mm mm mm m aa na na nm mm m an na an m mm
n n na aa a n nn an an n a na a a o.n
44
CA 02433436 2003-06-16
WO 02/50301 PCT/USO1/48276
'P W W W W W W W W ' W N N N N N N N N j N
W N O c0 W V Q7 U1 ,p W N . O (D OD V O Ut A W N O t0 OD J W Ut p W N r O (00
000
J~(J~~~S~~~~~~5~~~_ (~D f~D (~D (~_D N d N
N N O O N N p~ N N N N N N N N
7. ~' f17 N =, 7. N N N N N ~ j.
J ? ~ T T T T (D (D (D (D (D
~ m m m m m m m m m n a n a n c~ c~ c~
m m ~ o m m 1 -~r ~ 1 1 ~ ~ ~ 1 0 0 0 0 o m' m' m
X ~ m ~ x v ~ g g g D D D D D D D D D D D D D D D D
Z ~t r v v fn j v r X v ~ r ~ T n ~ ~ r m r T
N O OD UI ~ J (n W W V OD O j p V V W ~ O O O O O O O W O
W W N m O N O O p 01 d) Oo ..a W Q7 .A N O J ~ O O
f0 00 07 p~ p~ V N .p N W O t0 p N OD .? j O ,p O1 W V j O f0 N ~ ? O O W c0 p
V V c0 Q) O OD N ~ O m O ~ ~ ~ O (O U~ W V j O O ~
W N N N W W O O O N O ~ .P W '~' W p A W t0 Vt 07 V N N _ O O ~P j Nj O O J~.
O V OD ~1 .P A N O 'P~ CNJ1 ~ C°~11
S Z ~ S 2 S N N ' O .O ~ ~S O 'G
m a x ~ ~ ~ ~ ~ ~ Z I z S S z z 2 Z z
in c 3 ~ ~ ~ ~ ~ o ~ ~p ~ p c (p ? S A C p'7 N a' m m o 0 0 0 0 0 0 0 0 0
o a o a s o °°~' y m ~ ~ Ja ~ ~ ~ ~ ~ 3 ~ N 3 3 ~ o 0 0 0 0 0 0
0 0 0
N N O ~ N -~ O ~ 0 tp C ~'' O 7 x. c ~ O ~ ~ ~. fn fn N N N m N N (n N
d 'O O ~ N (A c7 f/! (/1 Z Z Z 7 N CI N N N N N N N N
N = o a N g ~ j j y N j j ° m cn ~ + c~ D o D D ~p a a a a a a a a
a a
O ' T ~ ~ ~ Z ~ ~ c c ~ ~7 °' c ~ -~ a co w cc cu c'o' cu co cu cu
co
~ m N ~ N fn fn n Z Z ~ l~ ~ N m Z N c o ~ o o > > > > c >
X O ~ ~ Z O O - (7 ~ W Z O O N (y D . N 'i O N N (d fO N N N N N N
.b. ~° ~ m m o ° wo c o ~ m ~ ~ In ° m a o °
° o
a W ' D (7 ° n c o 3 z 3
-" ~ ~ m C~ C~ m U' m .. o ~ .n m N ~ m o a n~ v o v
3 o p~ ~ o Z cn N O G7 O ° (~ N N W m c ~ ~. ~ ~ a ~ 'o ~ Z Z z
° Z
m -., D a . c m n .. m ~ Z m
n D Z m_ ~ D D G) 3 ° N 7 ° x a ° v N .o ~ D 3 w D D D ~
D
Z ~ W °' ~ ~ Z ~, ~ ° W n o ~ . N ' =I
D z -~ m N o 2 °-' ~ r ~ T .D ~ ~ ~ ~ ~ ~ o ~ ° ~ ~. 5~ ~
° ~ ~ W m ~ ° o C
m ~ -~ ~ ~ ~ ~ o: -,i C < o ~ 3 ~. T ~° ca ~ s W= o Z '" c°w D N
N Z ~ ~ r'-v
o a x ~ ~ ~ o o = ~ 2 in ~ N~ ~ ° ~ v ° D ~ ~ W o D g ~ ca'n
m ~ 3 3 ° ~ m '°_ N ~ ''' °-' ~. z ~ ~ m p ~ ~ o ~ ~ W ~
D eo
? m ~p ~ d = S o 0 o O ° ~° Z =~ O ° w D m '° m ~
T ~ C~ ~ ~ -n ~ G~
o O ~ ~ ° S m v N -I z ~ °~ co D a r°n o o' m d Z ~ co cn
o ,~ co m ~'
° ~ o '°. a ° -o D = m N ~ c. ~ H D U, ~ ~ ~ c? ~ a j
°
d 'a a ~ m ~ ~ cu ~. D ° T ~ a ~ o .o W ~ ~ ~. ~ 0 3 ~ m
t=t7 ~ a 'n, _ ~' ~' N ~ ~ r o o ~' p D ~ ~ O ~ ca ~° N m v~ ~°
n 3~°~°00°~~_°~~mcc.m_ ° pfJoo n ~~.rNV
N o Z Z z 2 ~ ~ m ° .° °' n ~ w o w y W o
o D Ov~nD~~oa~~~ ~ <° ~ ~ c°'o
x Z a o o ° o m ~ ~o co ~ _ ~ m cn ,°p
O. D (D ~ ~ ~ N O ~ _-i (D ~ (D (D
(C O N a A ~ n ~ ~ j fD~ a
j ° ~p W v ~
N (D Z O O
s o D n ~a' N~ ~ D ~ x ~ ~' 'C
v o
m DWOm Dc° N ro f~D
Z _.
o ~ " 3 <"' O
x m ~ Z -a
o: m m D Uf
3 r''
m v
0
o'
c%~
m
cn
V
W
W
v
m
z
i
c
3
m
N p N W N 0 ~ ~ ,W ~ ~ N ? N N ~ ~ > ~ ~ W W ~ N N N N W W W
V W .p O ? A. N ~ ? ~ ~ V N CO O (O 00 CO W W ? Ut Cn O G7 N N W
O7 O OD ~_ p. W V J W N ~_ O V O W \ ' O W (D ~_ (D W ~ O t0 N N CD f0 CO O
~ N Uf N W N ~''~ ~ W '~ N Cl1 W j N N ~ N N W V N N N N N W W W
O W N O O p A 0 W CJt j W ~ W O N N yi CJ7 m A W .? .p W W j1 W O Q) j Wj W
O W p ~''~ CO 07 OD J O N O 07 h. O U7 O A N G1 O V J O Vt J ~ 07 N
V c0 N p c0 c0 t0 ~ tD (O c0 p Q CO (D Q7 OD c0 CD V O V ~l t0 f0 c0 W ~ c0 f0
to t0 (D t0 c0
W V W c0 O OD f0 N O O V W c0 OD -~ -~ N OD O O ?. ~ CIi c0 p c0 W W c0 c0 c0
(D
v
o° ~ o° o° o° o° o° c o°
o° c c o° c o° o° o° o° o° c
o° o° o° c c c c c c o° o o° o°
o° o° o°
> > > > > ~ > > ~ ~ ~ ~ > > > > > ~ > > > ~ m m m m m = > > > > >
m c m m m m m ~n m m ~ ~ m co m m m 'm m ~ m m m ~o ~ ~ ~n ~ ~ m m m m m m m
~c ~ cn se co ~ c° c ~ ~ c c cn c ~ <n ~ cc ~n c ~ ~n cc c c c c c c ~o
~ c° ~c re cn ~
c c c c c c c c c c c c c c c c
v mm m-ccccc~cccvm-mdmm
a~ Q v m. m m m- o m m ~ ~ d ~ m w m w v ~ m d w ~ m m m m m v v ~ w d v v
m - m m m m m n m m n a m a m m m m m n m m m n n n n n a m m m m m m m
°. C n n n n a n n a a n n n a a a a n n a n n n n
a
<IMG>
