Note: Descriptions are shown in the official language in which they were submitted.
CA 02434518 2003-07-10
WO 02/057476 PCT/US02/01887
METHODS AND MICROORGANISMS FOR THE PRODUCTION OF 3-(2-
HYDROXY-3-METHYL-BUTYRYLAMINO)-PROPIONIC ACID (HMBPA)
Related Applications
The present invention claims the benefit of prior-filed provisional Patent
Application Serial No. 60/263,053, filed January 19, 2001 (pending). The
present
invention is also related to U.S. Patent Application Serial No. 09!667,569,
filed
September 21, 2000 (pending), which is a continuation-in-part of U.S. Patent
Application Serial No. 09J400,494, filed September 21, 1999 (abandoned). U.S.
Patent
Application Serial No. 09/667,569 also claims the benefit of prior-filed
provisional
Patent Application Serial No. 60/210,072, filed June 7, 2000, provisional
Patent
Application Serial No. 60/221,836, filed July 28, 2000, and provisional Patent
Application Serial No. 60/227,860, filed August 24, 2000. The entire content
of each of
the above-referenced applications is incorporated herein by this reference.
Background of the Invention
Conventional means of synthesizing chemical compounds is via synthesis
from bulk chemicals, a process which is limited by factors such as substrate
availability
and/or cost, difficulty in resolving complex mixtures ofproducts, complexities
in
synthesizing large quantities of compounds in purified form, and difficulty in
producing
chiral compounds. Accordingly, researchers have recently looked to bacterial
or
microbial systems that express enzymes useful for various biosynthetic
processes, for
example, in the synthesis of pharmaceutical compounds, research reagents,
nutriceuticals, vitamins, nutritional supplements, antibiotic compounds and
the like. In
particular, bioconversion processes have been evaluated as a means of favoring
production of preferred compounds and recently methods of direct microbial
synthesis
have been the focus of much research in the areas of pharmaceuticals and
agriculture.
Summary of the Invention
The present invention relates to a processes for the direct microbial
synthesis of [R]-3-(2-hydroxy-3-methyl-butyrylamino)-propionic acid or 3-(2-
hydroxy-
3-methyl-butyrylamino)-propionic acid ("HMBPA"), referred to interchangeably
herein
as "(3-alanine 2-(R)-hydroxyisolvalerate", "(3-alanine 2-hydroxyisolvalerate",
"(3-alanyl-
a-hydroxyisovalarate", N-(2-hydroxy-3-methyl-1-oxobutyl)-(3-alanine ("HMOBA")
-1-
CA 02434518 2003-07-10
WO 02/057476 PCT/US02/01887
and/or "fantothenate". In particular, it has been discovered that in
microorganisms
engineered to overexpress certain enzymes conventionally associated with
pantothenate
and/or isaleucine-valine (ilv) biosynthesis, an alternative biosynthetic
pathway is present
that competes for lcey precursors of pantothenate biosynthesis, namely a-
ketoisovalerate
(a-KIV) and (3-alanine. a,-KIV is converted to a-hydroxyisovalerate (a,-HIV)
catalyzed
by various reductase enzymes and oc-HIV is subsequently condensed with (3-
alanine to
produce HMBPA.
In one embodiment, the invention features a process for the production of
3-(2-hydroxy-3-methyl-butyrylamino)-propionic acid (HMBPA) that includes
culturing
a microorganism having increased keto reductase activity or increased
pantothenate
synthetase activity in the presence of excess cc-ketoisovalerate and excess (3-
alanine,
such that HMBPA is produced. In another embodiment, the invemtion features a
process for the production of 3-(2-hydroxy-3-methyl-butyrylamino)-propionic
acid
(HMBPA) that includes culturing a microorganism having increased keto
reductase
activity and increased pantothenate synthetase activity in the presence of
excess a-
ketoisovalerate and excess (3-alanine, such that HMBPA is produced. In one
embodiment, the microorganism has a modified panE gene, for example, a
modified
panEl gene and/or a modified panE2 gene (e.g., the panE gene is overexpressed,
deregulated or present in multiple copies). In another embodiment, the
microorganism
has a modified panC gene (e.g., the panC gene is overexpressed, deregulated or
present
in multiple copies). In another embodiment, the microorganism fiu-ther has
increased
acetohydroxyacid isomeroreductase activity. In another embodiment, the
microorganism is cultured under conditions of increased acetohydroxyacid
isomeroreductase activity in the presence of excess a-ketoisovalerate and
excess (3-
alanine, such that HMBPA is produced. In yet another embodiment, the
microorganism
comprises a modified ilvC gene (e.g., the ilvC gene is overexpressed,
deregulated or
present in multiple copies). In yet another embodiment, the microorganism
further has
reduced ketopantoate hydroxymethyltransferase activity (e.g., has a modified
paf2B gene,
for example a pang gene that has been deleted.
In another aspect, the invention features a process for the production of 3-
(2-hydroxy-3-methyl-butyrylamino)-propionic acid (HMBPA) that includes
culturing a
microorganism having reduced ketopantoate hydroxymethyltransferase activity in
the
presence of excess a-ketoisovalerate and excess /3-alanine, such that HMBPA is
produced. In another aspect, the invention features a method for enhancing
production
_2-
CA 02434518 2003-07-10
WO 02/057476 PCT/US02/01887
of 3-(2-hydroxy-3-methyl-butyrylamino)-propionic acid (HMBPA) relative to
pantothenate that includes culturing a recombinant microorganism under
conditions such
that the HMBPA production is enhanced relative to pantothenate production. In
another
aspect, the invention features a process for the production of 2-
hydroxyisovaleric acid
(a-HIV) that includes culturing a microorganism which overexpresses PanEl or
PanE2
and which further has reduced PanC or PanD activity under conditions such that
a-HIV
is produced. In another aspect, the invention features a process for the
production of 3-
(2-hydroxy-3-methyl-butyrylamino)-propionic acid (HMBPA) that includes
culturing a
recombinant microorganism having decreased expression or activity of sera or
glyA
1:0 under conditions such that HMBPA is produced. In another aspect, the
invention
features a process for the production of 3-(2-hydroxy-3-methyl-butyrylarnino)-
propionic
acid (HMBPA) that includes culturing a recombinant microorganism having
decreased
expression or activity of serA and glyA under conditions such that HMBPA is
produced.
Conditions for culturing the above described microorganisms include, for
example,
conditions of increased steady state glucose, conditions of decreased steady
state
dissolved oxygen, and/or cultured under conditions of decreased serine.
Products
produced according to the above described processes and/or methods are also
featured.
Also featured are recombinant microorganisms utilized in the above-described
methods.
Compounds produced according to the methodologies ofthe present
invention have a variety of uses. For example, HMBPA can be used to synthesize
. inhibitors of HMG CoA Reductase (II) (Gordon et czl. Bio. Med. Clzem. Lett.
1 (3):161
(1991). Inhibitors of HMG CoA Reductase (II) have been studied for use as in
the
treatment of hypercholesterolaemia and coronary atherosclerosis progression.
Inhibitors
of HMG CoA Reductase also have been used to reduce risk of cardiovascular
events in
patients at rislc. Moreover, the HMBPA precursor 2-hydroxyisovalerate (a-HIV)
has
been demonstrated to have nutriceutical properties, for example, in the
prevention of
aging of the skin. In particular, a-hydraxy acids, such as a-HIV (or 2-
hydroxyvaline),
can be used to synthesize a-hydroxy esters which have been found to induce
increased
skin thickness by increasing biosyntheses of glycosaminoglycans,
proteoglycans,
collagen, elastin, and other dermal components. The compounds can be used to
treat
skin disorders such as age spots, skin lines, wrinkles, photoaging and aging.
Other features and advantages of the invention will be apparent from the
following detailed description and claims.
-3-
CA 02434518 2003-07-10
WO 02/057476 PCT/US02/01887
Brief Description of the Drawings
Figure 1 is a schematic representation of the pantothenate and isoleucine-
valine (ilv) biosynthetic pathways. Pantothenate biosynthetic enzymes are
depicted in
bold and their corresponding genes indicated in italics. Isoleucine-valine
(ilv)
biosynthetic enzymes are depicted in bold italics and their corresponding
genes indicated
in italics.
Figure 2 is a schematic representation of the biosynthetic pathway
leading to [R]-3-(2-hydroxy-3-methyl-butyrylamino)-propionic acid ("HMBPA") in
B.
subtilis.
Figm°e 3 is a schematic depiction of the structure of [R]-3-(2-
hydroxy-3-
methyl-butyrylamino)-propionic acid ("HMBPA").
Figuf~e 4 is a HPLC chromatogram of a sample of medium from a 14 L
fermentation of PA824.
Figuy~e S is a mass spectrum depicting the relative monoisotopic mass of
[R]-3-(2-hydroxy-3-methyl-butyrylamino)-propionic acid.
Figure 6 depicts an alignment of the C-terminal amino acids from known
or suspected Pang proteins.
Figure 7 is a schematic representation of the construction of the plasmid
pAN624.
Figure 8 is a schematic representation of the construction of the plasmid
pAN620.
Figuoe 9 is a schematic representation of the construction of the plasmid
pAN63 6.
Figure 10 is a schematic representation of the construction of the plasmid
pAN637 which allows selection for single or multiple copies using
chloramphenicol.
Figure 11 is a schematic representation of the construction of the plasmid
pAN238, a plasmid for overexpressing B. subtilis paned from the P~6 promoter.
Detailed Description of the Invention
The present invention is based, at least in part, on the discovery of a novel
biosynthetic pathway in bacteria, namely the [R]-3-(2-hydroxy-3-methyl-
butyrylamino)-
propionic acid ("HMBPA") biosynthetic pathway. In particular, it has been
discovered
that bacteria are capable of generating HMBPA from a-ketoisovalerate (a-I~IV),
a key
product of the isoleucine-valine (ilv) biosynthetic pathway and precursor of
the
-4-
CA 02434518 2003-07-10
WO 02/057476 PCT/US02/01887
pantothenate biosynthetic pathway. Production of HMBPA in bacteria involves at
least
the pantothenate biosynthetic enzymes ketopantoate reductase (the pahEl gene
product)
and/or acetohydroxyacid isomeroreductase (the ilvC gene product) and results
from the
condensation of 2-hydroxyisovaleric acid (a-HIV), formed by reduction of a-
KIV, and
(3-alanine, the latter reaction being catalyzed by the pantothenate
biosynthetic enzyme
pantothenate synthetase (the pa~C gene product). Production of HMBPA is
achieved by
increasing ketopantoate reductase (e.g., PanEl) and/or PanE2 and/or
acetohydroxyacid
isomeroreductase activities (e.g., IIvC) in microorganisms, for example, by
overexpressing or deregulating the genes encoding said enzymes. Optimal
production of
HMBPA is achieved by decreasing or deleting ketopantoate
hydroxymethyltransferase
activity (the pang gene product) in microorganisms, for example, by modifying
or
deleting the pasiB gene which encodes ketopantoate hydroxymethyltransferase
(e.g.,
PanB), optionally in addition to increasing ketopantoate reductase and/or
PanE2 and/or
acetohydroxyacid isomeroreductase activities in said microorganisms. The
substrates a-
KIV and (3-alanine are required for HMBPA production, the latter provided, for
example, by (3-alanine feeding and/or increased aspartate-a-decarboxylate
activity (the
parZD gene product). Increasing substrate concentration (i.e., a-KIV and/or (3-
alanine)
further enhances production of HMBPA. a-KIV production can be increased by
overexpressing ilvBNCD genes and/or alsS. HMBPA production can further be
increased by limiting serine availability or synthesis in appropriately
engineered
microorganisms.
In order that the present invention may be more readily understood,
certain terms are first defined herein.
The term "pantothenate biosynthetic pathway" includes the biosynthetic
pathway involving pantothenate biosynthetic enzymes (e.g., polypeptides
encoded by
biosynthetic enzyme-encoding genes), compounds (e.g., precursors, substrates,
intermediates or products), cofactors and the like utilized in the formation
or synthesis of
pantothenate. The term "pantothenate biosynthetic pathway" includes the
biosynthetic
pathway leading to the synthesis of pantothenate in microorganisms (e.g., in
vivo) as
well as the biosynthetic pathway leading to the synthesis of pantothenate irc
vitro.
-5-
CA 02434518 2003-07-10
WO 02/057476 PCT/US02/01887
The term "pantothenate biosynthetic enzyme" includes any enzyme
utilized in the formation of a compound (e.g., intermediate or product) of the
pantothenate biosynthetic pathway. For example, synthesis of pantoate from a-
ketoisovalerate (a-I~IV) proceeds via the intermediate, ketopantoate.
Formation of
S ketopantoate is catalyzed by the pantothenate biosynthetic enzyme
ketopantoate
hydroxymethyltransferase (the pa~B gene product). Formation of pantoate is
catalyzed
by the pantothenate biosynthetic enzyme ketopantoate reductase (the panE gene
product). Synthesis of (3-alanine from aspartate is catalyzed by the
pantothenate
biosynthetic enzyme aspartate-a-decarboxylase (the panD gene product).
Formation of
pantothenate from pantoate and (3-alanine (e.g., condensation) is catalyzed by
the
pantothenate biosynthetic enzyme pantothenate synthetase (the pa~C gene
product).
Based on the newly discovered HMBPA biosynthesis pathway, pantothenate
biosynthetic enzymes may also perform an alternative function as enzymes in
the
HMBPA biosynthetic pathway described herein.
The term "pantothenate" includes the free acid forth of pantothenate, also
referred to as "pantothenic acid" as well as any salt thereof (e.g., derived
by replacing
the acidic hydrogen of pantothenate or pantothenic acid with a canon, for
example,
calcium, sodium, potassium, ammonium), also referred to as a ''pantothenate
salt". The
term "pantothenate" also includes alcohol derivatives of pantothenate.
Preferred
pantothenate salts are calcium pantothenate or sodium pantothenate. A
preferred alcohol
derivative is pantothenol. Pantothenate salts and/or alcohols of the present
invention
include salts and/or alcohols prepared via conventional methods from the free
acids
described herein. In another embodiment, calcium pantothenate is synthesized
directly
by a microorganism of the present invention. A pantothenate salt of the
present
invention can likewise be converted to a free acid form of pantothenate or
pantothenic
acid by conventional methodology.
The term "isoleucine-valine biosynthetic pathway" includes the
biosynthetic pathway involving isoleucine-valine biosynthetic enzymes (e.g.,
polypeptides encoded by biosynthetic enzyme-encoding genes), compounds (e.g.,
precursors, substrates, intermediates or products), cofactors and the like
utilized in the
formation or synthesis of conversion of pyruvate to valine or isoleucine. The
term
"isoleucine-valine biosynthetic pathway" includes the biosynthetic pathway
'leading to
the synthesis of valine or isoleucine in microorganisms (e.g., in vivo) as
well as the
biosynthetic pathway leading to the synthesis of valine or isoleucine in
vitro. Figure 1
-6-
CA 02434518 2003-07-10
WO 02/057476 PCT/US02/01887
includes a schematic representation of the isoleucine-valine biosynthetic
pathway.
Isoleucine-valine biosynthetic enzymes are depicted in bold italics and their
corresponding genes indicated in italics
The term "isoleucine-valine biosynthetic enzyme" includes any enzyme
utilized in the formation of a compound (e.g., intermediate or product) of the
isoleucine-
valine biosynthetic pathway. According to Figure 1, synthesis of valine from
pyruvate
proceeds via the intermediates, acetolactate, a,(i-dihydroxyisovalerate (a,~3-
DHIV) and
a-ketoisovalerate (a-KIV). Formation of acetolactate from pyruvate is
catalyzed by the
isoleucine-valine biosynthetic enzyme acetohydroxyacid synthetase (the ilvBN
gene
product, or alternatively, the alsS gene product). Formation of a,(3-DHIV from
acetolactate is catalyzed by the isoleucine-valine biosynthetic enzyme
acetohydroxyacidisomero reductase (the ilvC gene product). Synthesis of a-KIV
from
a,(3-DHIV is catalyzed by the isoleucine-valine biosynthetic enzyme
dihydroxyacid
dehydratase (the ilvD gene product). Moreover, valine and isoleucine can be
interconverted with their respective a-keto compounds by branched chain amino
acid
transaminases. Based on the newly discovered HMBPA biosynthesis pathway,
isoleucine-valine biosynthetic enzymes may also perform an alternative
function as
enzymes in the HMBPA biosynthetic pathway described herein.
The term "3-(2-hydroxy-3-methyl-butyrylamino)-propionic acid
("HMBPA") biosynthetic pathway" includes the alternative biosynthetic pathway
involving biosynthetic enzymes and compounds (e.g., substrates and the like) .
traditionally associated with the pantothenate biosynthetic pathway utilized
in the
formation or synthesis of HMBPA. The term "HMBPA biosynthetic pathway"
includes
the biosynthetic pathway leading to the synthesis of HMBPA in microorganisms
(e.g., in
vivo) as well as the biosynthetic pathway leading to the synthesis of HMBPA in
vitro.
The term "HMBPA biosynthetic enzyme" includes any enzyme utilized
in the formation of a compound (e.g., intermediate or product) of the HMBPA
biosynthetic pathway. For example, synthesis of 2-hydroxyisovaleric acid (a-
HIV) from
a-ketoisovalerate (a-KIV) is catalyzed by the panEl or panE2 gene product
(PanE l,
alternatively referred to herein ketopantoate reductase or PanE2, a a-ketoacid
reductase
that does not significantly contribute to pantothenate biosynthesis) and/or is
catalyzed by
the ilvC gene product (alternatively referred to herein as acetohydroxyacid
isomeroreductase). Formation of HMBPA from (3-alanine and a-HIV is catalyzed
by the
panC gene product (alternatively referred to herein as pantothenate
synthetase).
_7_
CA 02434518 2003-07-10
WO 02/057476 PCT/US02/01887
The term "3-(2-hydroxy-3-methyl-butyrylamino)-propionic acid
("HMBPA")" includes the free acid form of HMBPA, also referred to as "3-(2-
hydroxy-
3-methyl-butyrylamino)-propionate" as well as any salt thereof (e.g., derived
by
replacing the acidic hydrogen of [R]-3-(2-hydroxy-3-methyl-butyrylamino)-
propionic
acid or [R]-3-(2-hydroxy-3-methyl-butyrylamino)-propionate with a cation, for
example,
calcium, sodium, potassium, ammonium), also referred to as a "3-(2-hydroxy-3-
methyl-
butyrylamino)-propionic acid salt" or "HMBPA salt". Preferred HMBPA salts are
calcium HMBPA or sodium HMBPA. HMBPA salts of the present invention include
salts prepared via conventional methods from the free acids described herein.
An
HMBPA salt of the present invention can likewise be converted to a free acid
form of
[R]-3-(2-hydroxy-3-methyl-butyrylamino)-propionic acid or [R]-3-(2-hydroxy-3-
methyl-
butyrylamino)-propionate by conventional methodology.
Various aspects of the invention are described in further detail in the
following subsections.
I. Targeting Genes Encoding T~af°ious Pantothe~zate and/or
Isoleucine-halirze(ilv) afzdlo~ HMBPA Biosynthetic Enzymes
In one embodiment, the present invention features targeting or modifying
various biosynthetic enzymes of the pantothenate and/or isoleucine-valine(ilv)
and/or
HMBPA biosynthetic pathways. In particular, the invention features modifying
various
enzymatic activities associated with said pathways by modifying or altering
the genes
encoding said biosynthetic enzymes.
The term "gene", as used herein, includes a nucleic acid molecule (e.g., a
DNA molecule or segment thereof) that, in an organism, can be separated from
another '
gene or other genes, by intergenic DNA (i.e., intervening or spacer DNA which
naturally
flanks the gene and/or separates genes in the chromosomal DNA of the
organism).
Alternatively, a gene may slightly overlap another gene (e.g., the 3' end of a
first gene
overlapping the 5' end of a second gene), said overlapping genes separated
from other
genes by intergenic DNA. A gene may direct synthesis of an enzyme or other
protein
molecule (e.g., may comprise coding seqeunces, for example, a contiguous open
reading
frame (ORF) which encodes a protein) or may itself be functional in the
organism. A
gene in an organism, may be clustered in an operon, as defined herein, said
operon being
separated from other genes and/or operons by the intergenic DNA. An "isolated
gene",
_g_
CA 02434518 2003-07-10
WO 02/057476 PCT/US02/01887
as used herein, includes a gene which is essentially free of sequences which
naturally
flank the gene in the chromosomal DNA of the organism from which the gene is
derived
(i. e., is free of adjacent coding sequences which encode a second or distinct
protein,
adjacent structural sequences or the like) and optionally includes 5' and 3'
regulatory
sequences, for example promoter sequences and/or terminator sequences. In one
embodiment, an isolated gene includes predominantly coding sequences for a
protein
(e.g., sequences which encode Bacillus proteins). In another embodiment, an
isolated
gene includes coding sequences for a protein (e.g., for a Bacillus protein)
and adjacent 5'
and/or 3' regulatory sequences from the chromosomal DNA of the organism from
which
the gene is derived (e.g., adjacent 5' and/or 3' Baeillus regulatory
sequences).
Preferably, an isolated gene contains less than about 10 kb, 5 kb, 2 kb, 1 kb,
0.5 kb, 0.2
kb, 0.1 kb, 50 bp, 25 by or 10 by of nucleotide sequences that naturally flank
the gene in
the chromosomal DNA of the organism from which the gene is derived.
The term "operon" includes at least two adjacent genes or ORFs,
optionally overlapping in sequence at either the 5' or 3' end of at least one
gene or ORF.
The term "operon" includes a coordinated unit of gene expression that contains
a
promoter and possibly a regulatory element associated with one or more
adjacent genes
or ORFs (e.g., structural genes encoding enzymes, for example, biosynthetic
enzymes).
Expression of the genes (e.g., structural genes) can be coordinately
regulated, for
example, by regulatory proteins binding to the regulatory element or by anti-
termination
of transcription. The genes of an operon (e.g., structural genes) can be
transcribed to
give a single rnRNA that encodes all of the proteins.
A "gene having a mutation" or "mutant gene" as used herein, includes a
gene having a nucleotide sequence which includes at least one alteration
(e.g.,
substitution, insertion, deletion) such that the polypeptide or protein
encoded by said
mutant exhibits an activity that differs from the polypeptide or protein
encoded by the
wild-type nucleic acid molecule or gene. In one embodiment, a gene having a
mutation
or mutant gene encodes a polypeptide or protein having an increased activity
as
compared to the polypeptide or protein encoded by the wild-type gene, for
example,
when assayed under similar conditions (e.g., assayed in microorganisms
cultured at the
same temperature). As used herein, an "increased activity" or "increased
enzymatic
activity" is one that is at least 5% greater than that of the polypeptide or
protein encoded
by the wild-type nucleic acid molecule or gene, preferably at least 5-10%
greater, more
preferably at least 10-25% greater and even more preferably at least 25-50%,
50-75% or
_g_
CA 02434518 2003-07-10
WO 02/057476 PCT/US02/01887
75-100% greater than that of the polypeptide or protein encoded by the wild-
type nucleic
acid molecule or gene. Ranges intermediate to the above-recited values, e.g.,
75-85%,
85-90%, 90-95%, are also intended to be encompassed by the present invention.
As
used herein, an "increased activity" or "increased enzymatic activity" can
also include
an activity that is at least 1.25-fold greater than the activity of the
polypeptide or protein
encoded by the wild-type gene, preferably at least 1.5-fold greater, more
preferably at
least 2-fold greater and even more preferably at least 3-fold, 4-fold, 5-fold,
10-fold, 20-
fold, 50-fold, 100-fold or greater than the activity of the polypeptide or
protein encoded
by the wild-type gene.
In another embodiment, a gene having a mutation or mutant gene encodes
a polypeptide or protein having a reduced activity as compared to the
polypeptide or
protein encoded by the wild-type gene, for example, when assayed under similar
conditions (e.g., assayed in microorganisms cultured at the same temperature).
A mutant
gene also can encode no polypeptide or have a reduced level of production of
the wild-
type polypeptide. As used herein, a "reduced activity" or "reduced enzymatic
activity"
is one that is at least 5% less than that of the polypeptide or protein
encoded by the wild-
type nucleic acid molecule or gene, preferably at least 5-10% Iess, more
preferably at
least 10-25% less and even more preferably at least 25-50%, 50-75% or 75-100%
less
than that of the polypeptide or protein encoded by the wild-type nucleic acid
molecule or
gene. Ranges intermediate to the above-recited values, e.g., 75-85%, 85-90%,
90-95%,
are also intended to be encompassed by the present invention. As used herein,
a
"reduced activity" or "reduced enzymatic activity" can also include an
activity that has
been deleted or "knocked out" (e.g., approximately 100% less activity than
that of the
polypeptide or protein encoded by the wild-type nucleic acid molecule or
gene).
Activity can be determined according to any well accepted assay for
measuring activity of a particular protein of interest. Activity can be
measured or
assayed directly, for example, measuring an activity of a protein isolated or
purified
from a cell or mocroorganism. Alternatively, an activity can be measured or
assayed
within a cell or mocroorganism or in an extracellular medimn. For example,
assaying
for a mutant gene (i.e., said mutant encoding a reduced enzymatic activity)
can be
accomplished by expressing the mutated gene in a microorganism, for example, a
mutant
microorganism in which the enzyme is temperature-sensitive, and assaying the
mutant
gene for the ability to complement a temperature sensitive (Ts) mutant for
enzymatic
activity. A mutant gene that encodes an "increased enzymatic activity" can be
one that
-10-
CA 02434518 2003-07-10
WO 02/057476 PCT/US02/01887
complements the Ts mutant more effectively than, for example, a corresponding
wild-
type gene. A mutant gene that encodes a "reduced enzymatic activity" is one
that
complements the Ts mutant less effectively than, for example, a corresponding
wild-type
gene.
It will be appreciated by the skilled artisan that even a single substitution
in a nucleic acid or gene sequence (e.g., a base substitution that encodes an
amino acid
change in the corresponding amino acid sequence) can dramatically affect the
activity of
an encoded polypeptide or protein as compared to the corresponding wild-type
polypeptide or protein. A mutant gene (e.g., encoding a mutant polypeptide or
protein),
as defined herein, is readily distinguishable from a nucleic acid or gene
encoding a
protein homologue in that a mutant gene encodes a protein or polypeptide
having an
altered activity, optionally observable as a different or distinct phenotype
in a
microorganism expressing said mutant gene or producing said mutant protein or
polypeptide (i.e., a mutant microorganism) as compared to a corresponding
microorganism expressing the wild-type gene. By contrast, a protein homologue
has an
identical or substantially similar activity, optionally phenotypically
indiscernable when
produced in a microorganism, as compared to a corresponding microorganism
expressing the wild-type gene. Accordingly it is not, for example, the degree
of
sequence identity between nucleic acid molecules, genes, protein or
polypeptides that
serves to distinguish between homologues and mutants, rather it is the
activity of the
encoded protein or polypeptide that distinguishes between homologues and
mutants:
homologues having, for example, low (e.g., 30-50% sequence identity) sequence
identity
yet having substantially equivalent functional activities, and mutants, for
example
sharing 99% sequence identity yet having dramatically different or altered
functional
activities.
It will also be appreciated by the skilled artisan that nucleic acid
molecules, genes, protein or polypeptides fox use in the instant invention can
be derived
from any microorganisms having a HMBPA biosynthetic pathway, an ilv
biosynthetic
pathway or a pantothenate biosynthetic pathway. Such nucleic acid molecules,
genes,
protein or polypeptides can be identified by the skilled artisan using known
techniques
such as homology screening, sequence comparison and the like, and can be
modified by
the skilled artisan in such a way that expression or production of these
nucleic acid
molecules, genes, protein or polypeptides occurs in a recombinant
microorganism (e.g.,
by using appropriate promotors, ribosomal binding sites, expression or
integration
-11-
CA 02434518 2003-07-10
WO 02/057476 PCT/US02/01887
vectors, modifying the sequence of the genes such that the transcription is
increased
(taking into account the preferable codon usage), etc., according to
techniques described
herein and those known in the art).
In one embodiment, the genes of the present invention are derived from a
Gram positive microorganism organism (e.g., a microorganism which retains
basic dye,
for example, crystal violet, due to the presence of a Gram-positive wall
surrounding the
microorganism). The term "derived from" (e.g., "derived from" a Gram positive
microorganism) refers to a gene which is naturally found in the microorganism
(e.g., is
naturally found in a Gram positive microorganism). In a preferred embodiment,
the
genes of the present invention are derived from a microorganism belonging to a
genus
selected from the group consisting of Bacillus, CoJ°nyebacter~ium
(e.g., Cornyebacter~ium
glutarrzicurrz), Lactobacillus, Lactococci and Streptomyces. In a more
preferred
embodiment, the genes of the present invention are derived from a
microorganism is of
the genus Bacillus. In another preferred embodiment, the genes of the present
invention
are derived from a microorganism selected from the group consisting of
Bacillus
subtilis, Bacillus lentirr2or~bus, Bacillus hr2tus, Bacillus firmus, Bacillus
parztothenticus,
Bacillus arrzyloliquefaciens, Bacillus cer~eus, Bacillus cir°culans,
Bacillus coagularzs,
Bacillzrs licherzifot~mis, Bacillus megateriurn, Bacillus punzilus, Bacillus
thur~ingiensis,
Bacillus lzalodurans, and other Group 1 Bacillus species, for example, as
characterized
by 16S rRNA type. In another preferred embodiment, the gene is derived from
Bacillus
br~evis or Bacillus stearothermoplzilus. In another preferred embodiment, the
genes of
the present invention are derived from a microorganism selected from the group
consisting of Bacillzzs lichenifor~mis, Bacillzrs arzzyloliquefacierzs,
Bacillus subtilis, and
Bacillus puzzzilus. In a particularly preferred embodiment, the gene is
derived from
Bacillus subtilis (e.g., is Bacillus subtilis-derived). The term "derived from
Bacillus
subtilis" or "Bacillus szrbtilis-derived" includes a gene which is naturally
found in the
microorganism Bacillus subtilis. Included within the scope of the present
invention are
Bacillus-derived genes (e.g., B. subtilis-derived genes), for example,
Bacillus or B.
subtilis coaX genes, serA genes, glyA genes, coaA genes, pan genes and/or ilv
genes.
In another embodiment, the genes of the present invention are derived
from a Gram negative (excludes basic dye) microorganism. In a preferred
embodiment,
the genes of the present invention are derived from a microorganism belonging
to a
genus selected from the group consisting of Salmohella (e.g., Salmonella
typhirrzuriurn),
Escher~icl~ia, Klebsiella, Serratia, and Proteus. In a more preferred
embodiment, the
-12-
CA 02434518 2003-07-10
WO 02/057476 PCT/US02/01887
genes of the present invention are derived from a microorganism of the genus
Escherichia. In an even more preferred embodiment, the genes of the present
invention
are derived from Escherichza coli. In another embodiment, the genes of the
present
invention are derived from Sacchat~ornyces (e.g., Sacchar~omyces cerevisiae).
II. Recombinant Nucleic Acid Molecules and hectors
The present invention further features recombinant nucleic acid
molecules (e.g., recombinant DNA molecules) that include genes described
herein (e.g.,
isolated genes), preferably Bacillus genes, more preferably Bacillus subtilis
genes, even
more preferably Bacillus subtilis pantothenate biosynthetic genes and/or
isoleucine-
valine (ilv) biosynthetic genes and/or FIMBPA biosynthetic genes. The term
''recombinant nucleic acid molecule" includes a nucleic acid molecule (e.g., a
DNA
molecule) that has been altered, modified or engineered such that it differs
in nucleotide
sequence from the native or natural nucleic acid molecule from which the
recombinant
nucleic acid molecule was derived (e.g., by addition, deletion or substitution
of one or
more nucleotides). Preferably, a recombinant nucleic acid molecule (e.g., a
recombinant
DNA molecule) includes an isolated gene of the present invention operably
linked to
regulatory sequences. The phrase "operably linked to regulatory sequence(s)"
means
that the nucleotide sequence of the gene of interest is linked to the
regulatory
sequences) in a manner which allows for expression (e.g., enhanced, increased,
constitutive, basal, attenuated, decreased or repressed expression) of the
gene, preferably
expression of a gene product encoded by the gene (e.g., when the recombinant
nucleic
acid molecule is included in a recombinant vector, as defined herein, and is
introduced
into a microorganism).
The term "regulatory sequence" includes nucleic acid sequences which
affect (e.g., modulate or regulate) expression of other nucleic acid sequences
(i.e.,
genes). In one embodiment, a regulatory sequence is included in a recombinant
nucleic
acid molecule in a similar or identical position and/or orientation relative
to a particular
gene of interest as is observed for the regulatory sequence and gene of
interest as it
appears in nature, e.g., in a native position and/or orientation. For example,
a gene of
interest can be included in a recombinant nucleic acid molecule operably
linked to a
regulatory sequence which accompanies or is adjacent to the gene of interest
in the
natural organism (e.g., operably linked to "native" regulatory sequences
(e.g., to the
"native" promoter). Alternatively, a gene of interest can be included in a
recombinant
-13-
CA 02434518 2003-07-10
WO 02/057476 PCT/US02/01887
nucleic acid molecule operably linked to a regulatory sequence which
accompanies or is
adjacent to another (e.g., a different) gene in the natural organism.
Alternatively, a gene
of interest can be included in a recombinant nucleic acid molecule operably
linked to a
regulatory sequence from another organism. For example, regulatory sequences
from
other microbes (e.g., other bacterial regulatory sequences, bacteriophage
regulatory
sequences and the like) can be operably linked to a particular gene of
interest.
In one embodiment, a regulatory sequence is a non-native or non-
naturally-occurring sequence (e.g., a sequence which has been modified,
mutated,
substituted, derivatized, deleted including sequences which are chemically
synthesized).
Preferred regulatory sequences include promoters, enhancers, termination
signals, anti-
termination signals and other expression control elements (e.g., sequences to
which
repressors or inducers bind and/or binding sites for transcriptional and/or
translational
regulatory proteins, for example, in the transcribed mRNA). Such regulatory
sequences
are described, for example, in Sambrook, J., Fritsh, E. F., and Maniatis, T.
Molecular
~ Cloning: A Labor°atoyy Manual. 2nd, ed., Cold Spring Har°bon
Laboratory, Cold Spring
Harbor Laboratory Press, Cold Spring Harbor, NY, 1989. Regulatory sequences
include
those which direct constitutive expression of a nucleotide sequence in a
microorganism
(e.g., constitutive promoters and strong constitutive promoters), those which
direct
inducible expression of a nucleotide sequence in a microorganism (e. g.,
inducible
promoters, for example, xylose inducible promoters) and those which attenuate
or
repress expression of a nucleotide sequence in a microorganism (e.g.,
attenuation signals '.
or repressor sequences). It is also within the scope of the present invention
to regulate
expression of a gene of interest by removing or deleting regulatory sequences.
For
example, sequences involved in the negative regulation of transcription can be
removed
such that expression of a gene of interest is enhanced.
In one embodiment, a recombinant nucleic acid molecule of the present
invention includes a nucleic acid sequence or gene that encode at least one
bacterial gene
product (e.g., a pantothenate biosynthetic enzyme, an isoleucine-valine
biosynthetic
enzyme and/or a HMBPA biosynthetic enzyme) operably linked to a promoter or
promoter sequence. Preferred promoters of the present invention include
Bacillus
promoters and/or bacteriophage promoters (e.g., bacteriophage which infect
Bacillus).
In one embodiment, a promoter is a Bacillus promoter, preferably a strong
Bacillus
promoter (e.g., a promoter associated with a biochemical housekeeping gene in
Bacillus
or a promoter associated with a glycolytic pathway gene in Bacillus). In
another
-14-
CA 02434518 2003-07-10
WO 02/057476 PCT/US02/01887
embodiment, a promoter is a bacteriophage promoter. In a preferred embodiment,
the
promoter is from the bacteriophage SPO1. In a particularly preferred
embodiment, a
promoter is selected from the group consisting of PAS, P26 or Pveg, having for
example,
the following respective seqeunces:
GCTATTGACGACAGCTATGGTTCACTGTCCACCAACCAAAACTGTGCTCAGT
ACCGCCAATATTTCTCCCTTGAGGGGTACAAAGAGGTGTCCCTAGAAGAGAT
CCACGCTGTGTAAAAATTTTACAAAAAGGTATTGACTTTCCCTACAGGGTGT
GTAATAATTTAATTACAGGCGGGGGCAACCCCGCCTGT(SEQ ID NO:1),
GCCTACCTAGCTTCCAAGAAAGATATCCTAACAGCACAAGAGCGGAAAGAT
GTTTTGTTCTACATCCAGAACAACCTCTGCTAAAATTCCTGAAAAATTTTGCA
AAAAGTTGTTGACTTTATCTACAAGGTGTGGTATAATAATCTTAACAACAGC
AGGACGC (SEQ ID N0:2), and
GAGGAATCATAGAATTTTGTCAAAA'TAATTTTATTGACAACGTCTTATTAAC
GTTGATATAATTTAAATTTTATTTGACAAAAATGGGCTCGTGTTGTACAATA'
AATGTAGTGAGGTGGATGCAATG (SEQ ID N0:3). Additional preferred promoters
include tef (the translational elongation factor (TEF) promoter) and pyc (the
pyruvate
carboxylase (PAC) promoter), which promote high level expression in Bucillus
(e.g.,
Bucillus subtilis). Additional preferred promoters, for example, for use in
Gram positive
microorganisms include, but are not limited to, amy and SP02 promoters.
Additional
preferred promoters, for example, for use in Gram negative microorganisms
include, but
are not limited to, cos, tac, t~ p, tet, trp-tet, lpp, luc, lpp-lac, laclQ,
T7, T5, T3, gul, tic,
aru, SP6, ~,-PR or ~,-PL.
In another embodiment, a recombinant nucleic acid molecule of the
present invention includes a terminator sequence or terminator sequences
(e.g.,
transcription terminator sequences). The term "terminator sequences" includes
regulatory sequences that serve to terminate transcription of mRNA. Terminator
sequences (or tandem transcription terminators) can further serve to stabilize
mRNA
(e.g., by adding structure to mRNA), for example, against nucleases.
In yet another embodiment, a recombinant nucleic acid molecule of the
present invention includes sequences which allow for detection of the vector
containing
said sequences (i.e., detectable and/or selectable markers), for example,
genes that
encode antibiotic resistance or sequences that overcome auxotrophic mutations,
for
example, tfpC, fluorescent markers, drug markers, and/or colorimetric markers
(e.g.,
lacZ/(3-galactosidase). In yet another embodiment, a recombinant nucleic acid
molecule
-15-
CA 02434518 2003-07-10
WO 02/057476 PCT/US02/01887
of the present invention includes an artificial ribosome binding site (RBS) or
a sequence
that becomes transcribed into an artificial RBS. The term "artificial ribosome
binding
site (RBS)" includes a site within an mRNA molecule (e.g., coded within DNA)
to
which a ribosome binds (e.g., to initiate translation) which differs from a
native RBS
(e.g., a RBS found in a naturally-occurring gene) by at least one nucleotide.
Preferred
artificial RBSs include about 5-6, 7-8, 9-10, 11-12, 13-14, 15-16, 17-18, 19-
20, 21-22,
23-24, 25-26, 27-28, 29-30 or more nucleotides of which about 1-2, 3-4, 5-6, 7-
8, 9-10,
11-12, 13-15 or more differ from the native RBS (e.g., the native RBS of a
gene of
interest, for example, the native pafaB RBS TAAACATGAGGAGGAGAAAACATG
(SEQ ID N0:4) or the native pa~D IZBS
ATTCGAGAAATGGAGAGAATATAATATG (SEQ ID NO:S)).
Preferably, nucleotides that differ are substituted such that they are
identical to one or more nucleotides of an ideal RBS when optimally aligned
for
comparisons. Ideal RBSs include, but are not limited to, AGAAAGGAGGTGA (SEQ
ID NO:6), TTAAGAAAGGAGGTGANNNNATG (SEQ ID N0:7),
TTAGAAAGGAGGTGATINNNNATG (SEQ ID N0:8),
AGAAAGGAGGTGAT~7~1NNNNNATG (SEQ ID N0:9), and
AGAAAGGAGGTGATI1~NNNNATG (SEQ ID NO:10). Artificial RBSs can be used to
replace the naturally-occurring or native RBSs associated with a particular
gene.
Artificial RBSs preferably increase translation of a particular gene.
Preferred artificial
tress (e.g., RBSs for increasing the translation ofpayaB, for example, ofB.
subtiiis
pang) include CCCTCTAGAAGGAGGAGAAAACATG (SEQ ID NO:11) and
CCC'rCTAGAGGAGGAGAAAACATG (SEQ ID N0:12). Preferred artificial RBSs
(e.g., RBSs for increasing the translation of pafiD, for example, of B.
subtilis panD)
include TTAGAAAGGAGGATTTAAATATG (SEQ ID NO:13),
TTAGAAAGGAGGTTTAATTAATG (SEQ ID N0:14),
TTAGAAAGGAGGTGATTTAAATG (SEQ ID NO:15),
TTAGAAAGGAGGTGTTTAAAATG (SEQ ID N0:16), ATTCGAGAAAGGAGG
TGAATATAATATG (SEQ ID N0:17), ATTCGAGAAAGGAGGTGAATAATAATG
(SEQ ID NO:18), and ATTCGTAGAAAGGAGGTGAATTAATATG (SEQ ID N0:19).
The present invention further features vectors (e.g., recombinant vectors)
that include nucleic acid molecules (e.g., genes or recombinant nucleic acid
molecules
comprising said genes) as described herein. The term "recombinant vector"
includes a
vector (e.g., plasmid, phage, phasmid, virus, cosmid or other purified nucleic
acid
-16-
CA 02434518 2003-07-10
WO 02/057476 PCT/US02/01887
vector) that has been altered, modified or engineered such that it contains
greater, fewer
or different nucleic acid sequences than those included in the native or
natural nucleic
acid molecule from which the recombinant vector was derived. Preferably, the
recombinant vector includes a biosynythetic enzyme-encoding gene or
recombinant
nucleic acid molecule including said gene, operably linked to regulatory
sequences, for
example, promoter sequences, terminator sequences and/or artificial ribosome
binding
sites (RBSs), as defined herein. In another embodiment, a recombinant vector
of the
present invention includes sequences that enhance replication in bacteria
(e.g.,
replication-enhancing sequences). In one embodiment, replication-enhancing
sequences
are derived from E coli. In another embodiment, replication-enhancing
sequences are
derived from pBR322.
In yet another embodiment, a recombinant vector of the present invention
includes antibiotic resistance sequences. The term "antibiotic resistance
sequences"
' includes sequences which promote or confer resistance to antibiotics on the
host
organism (e.g., Bacillus). In one embodiment, the antibiotic resistance
sequences are
selected from the group consisting of cat (chloramphenicol resistance)
sequences, tet
(tetracycline resistance) sequences, erm (erythromycin resistance) sequences,
neo
(neomycin resistance) sequences, kan (kanamycin resistance) and spec
(spectinomycin
resistance) sequences. Recombinant vectors of the present invention can
further include
homologous recombination sequences (e.g., sequences designed to allow
recombination
of the gene of interest into the chromosome of the host organism). For
example, bpi,
vpr, and/or amyE sequences can be used as homology targets for recombination
into the
host chromosome. It will further be appreciated by one of skill in the art
that the design
of a vector can be tailored depending on such factors as the choice of
microorganism to
be genetically engineered, the level of expression of gene product desired and
the like.
IT~ Recombinant Mici°oo~°ganisnas
The present invention further features microorganisms, i.e., recombinant
microorganisms, that include vectors or genes (e.g., wild-type and/or mutated
genes) as
described herein. As used herein, the term "recombinant microorganism"
includes a
microorganism (e.g., bacteria, yeast cell, fungal cell, etc.) that has been
genetically
altered, modified or engineered (e.g., genetically engineered) such that it
exhibits an
altered, modified or different genotype and/or phenotype (e.g., when the
genetic
-17-
CA 02434518 2003-07-10
WO 02/057476 PCT/US02/01887
modification affects coding nucleic acid sequences of the microorganism) as
compared
to the naturally-occurring microorganism from which it was derived.
In one embodiment, a recombinant microorganism of the present
invention is a Gram positive organism (e.g., a microorganism which retains
basic dye,
for example, crystal violet, due to the presence of a Gram-positive wall
surrounding the
microorganism). In a preferred embodiment, the recombinant microorganism is a
microorganism belonging to a genus selected from the group consisting of
Bacillus,
Co~nyebacter~iunz, LactobacillZts, Lactococci and Streptomyces. In a more
preferred
embodiment, the recombinant microorganism is of the genus Bacillus. In another
.
preferred embodiment, the recombinant microorganism is selected from the group
consisting of Bacillus subtilis, Bacillus lentimorbus, Bacillus lentos,
Bacillus fir~fraus,
Bacillus pantothenticus, Bacillus anzyloliqz~efaciens, Bacillus cef~eus,
Bacillus ci~culans,
Bacillus coagulans, Bacillus lichenifor~mis, Bacillus rnegateriunZ, Bacillus
pun2ilus,
Bacillus thuringiensis, Bacillus halodu~ans, and other Group 1 Bacillus
species, for
example, as characterized by 16S rRNA type. In another preferred embodiment,
the
recombinant microorganism is Bacillus bt~evis or Bacillus
steaf~otlzef~moplailus. In '
another preferred embodiment, the recombinant microorganism is selected from
the
group consisting of Bacillus lichenifornZis, Bacillus arnyloliqu~faciens,
Bacillus subtilis,
and Bacillus pumilzts.
In another embodiment, the recombinant microorganism is a Gram
negative (excludes basic dye) organism. In a preferred embodiment, the
recombinant
microorganism is a microorganism belonging to a genus selected from the group
consisting of Salmonella, Escher~ichia, Klebsiella, Ser~ratia, and Pf~oteus.
In a more
preferred embodiment, the recombinant microorganism is of the genus
Escher~ichia. In
an even more preferred embodiment, the recombinant microorganism is
Esche~ichia
coli. In another embodiment, the recombinant microorganism is Saccharomyces
(e.g., S
cerevisiae).
A preferred "recombinant" microorganism of the present invention is a
microorganism having a deregulated pantothenate biosynthesis pathway or
enzyme, a
deregulated isoleucine-valine (ilv) biosynthetic pathway or enzyme and/or a
deregulated
HMBPA biosynthetic pathway or enzyme. The term "deregulated" or "deregulation"
includes the alteration or modification of at least one gene in a
microorganism that
encodes an enzyme in a biosynthetic pathway, such that the level or activity
of the
biosynthetic enzyme in the microorganism is altered or modified. Preferably,
at least
-l~-
CA 02434518 2003-07-10
WO 02/057476 PCT/US02/01887
one gene that encodes an enzyme in a biosynthetic pathway is altered or
modified such
that the gene product is enhanced or increased. The phrase "deregulated
pathway" can
also include a biosynthetic pathway in which more than one gene that encodes
an
enzyme in a biosynthetic pathway is altered or modified such that the level or
activity of
more than one biosynthetic enzyme is altered or modified. The ability to
"deregulate" a
pathway (e.g., to simultaneously deregulate more than one gene in a given
biosynthetic
pathway) in a microorganism in some cases arises from the particular
phenomenon of
microorganisms in which more than one enzyme (e.g., two or three biosynthetic
enzymes) are encoded by genes occurring adjacent to one another on a
contiguous piece
of genetic material termed an "operon" (defined herein). Due to the
coordinated
regulation of genes included in an operon, alteration or modification of the
single
promoter and/or regulatory element can result in alteration or modificatiomof
the
expression of each gene product encoded by the operon. Alteration or
modification of
' the regulatory element can include, but is not limited to removing the
endogenous
promoter and/or regulatory element(s), adding strong promoters, inducible
promoters or
multiple promoters or removing regulatory sequences such that expression of
the gene
products is modified, modifying the chromosomal location of the aperon,
altering
nucleic acid sequences adjacent to the operon or within the operon such as a
ribosome
binding site, increasing the copy number of the operon, modifying proteins
(e.g..,
regulatory proteins, suppressors, enhancers, transcriptional activators and
the like)
involved in transcription of the operon and/or translation of the gene
products of the
operon, ox any other conventional means of deregulating expression of genes
routine in
the art (including but not limited to use of antisense nucleic acid molecules,
for example,
to block expression of repressor proteins). Deregulation can also involve
altering the
coding region of one or more genes to yield, for example, an enzyme that is
feedback
resistant or has a higher or lower specific activity.
In another preferred embodiment, a recombinant microorganism is
designed or engineered such that at least one pantothenate biosynthetic
enzyme, at least
one isoleucine-valine biosynthetic enzyme, and/or at least one HMBPA
biosynthetic
enzyme is overexpressed. The term "overexpressed" or "overexpression" includes
expression of a gene product (e.g., a biosynthetic enzyme) at a level greater
than that
expressed prior to manipulation of the microorganism or in a comparable
microorganism
which has not been manipulated. In one embodiment, the microorganism can be
-19-
CA 02434518 2003-07-10
WO 02/057476 PCT/US02/01887
genetically designed or engineered to overexpress a level of gene product
greater than
that expressed in a comparable microorganism which has not been engineered.
Genetic engineering can include, but is not limited to, altering or
modifying regulatory sequences or sites associated with expression of a
particular gene
(e.g., by adding strong promoters, inducible promoters or multiple promoters
or by
removing regulatory sequences such that expression is constitutive), modifying
the
chromosomal location of a particular gene, altering nucleic acid sequences
adjacent to a
particular gene such as a ribosome binding site, increasing the copy number of
a
particular gene, modifying proteins (e.g., regulatory proteins, suppressors,
enhancers,
transcriptional activators and the like) involved in transcription of a
particular gene
and/or translation of a particular gene product, or any other conventional
means of
deregulating expression of a particular gene routine in the art (including but
not limited
to use of antisense nucleic acid molecules, for example, to block expression
of repressor
proteins). Genetic engineering can also include deletion of a gene, for
example, to block
a pathway or to remove a repressor. In embodiments featuring microorganisms
having
deleted genes, the skilled artisan will appreciate that at least low levels of
certain
compounds may be required to be present in or added to the culture medium in
order that
the viability of the microorganism is not compromised. ~ften, such low levels
are
present in complex culture media as routinely formulated. Moreover, in
processes
featuring culturing microorganisms having deleted genes cultured under
conditions such
that commercially or industrially attractive quantities of product are
produced, it may be
necessary to supplement culture media with slightly increased levels of
certain
compounds. For example, in processes featuring culturing a microorganism
having a
deleted pa~zB gene, at least low levels of pantothenate must be present in the
media, e.g.,
levels such as those found in routinely formulated complex media, whereas
slightly
increased levels of pantothenate may be added to the media in order to produce
cormnercially or industrially attractive amounts of, for example, HMBPA. For
example,
10-30 mg/L pantothenate can be added to the media in order to produce
commercially or
industrially attractive amounts of HMBPA.
In another embodiment, the microorganism can be physically or
environmentally manipulated to overexpress a level of gene product greater
than that
expressed prior to manipulation of the microorganism or in a comparable
microorganism
which has not been manipulated. For example, a microorganism can be treated
with or
cultured in the presence of an agent known or suspected to increase
transcription of a
-20-
CA 02434518 2003-07-10
WO 02/057476 PCT/US02/01887
particular gene and/or translation of a particular gene product such that
transcription
and/or translation are enhanced or increased. Alternatively, a microorganism
can be
cultured at a temperature selected to increase transcription of a particular
gene and/or
translation of a particular gene product such that transcription and/or
translation are
enhanced or increased.
V. Culturing and Ferrraenting Recotnbit~ant Microorganisms
The term "culturing" includes maintaining and/or growing a living
microorganism of the present invention (e.g., maintaining and/or growing a
culture or
strain). In one embodiment, a microorganism of the invention is cultured in
liquid
media. In another embodiment, a microorganism of the invention is cultured in
solid
media or semi-solid media. In a preferred embodiment, a microorganism of the
invention is cultured in media (e.g., a sterile, liquid media) comprising
nutrients essential
or beneficial to the maintenance and/or growth of the microorganism (e.g.,
carbon
sources or carbon substrate, for example carbohydrate, hydrocarbons, oils,
fats, fatty
acids, organic acids, and alcohols; nitrogen sources, for example, peptone,
yeast extracts,
meat extracts, malt extracts, urea, ammonium sulfate, ammonium chloride,
ammonium
nitrate and ammonium phosphate; phosphorus sources, For example, phosphoric
acid, .
sodium and potassium salts thereof; trace elements, :for example, magnesium,
iron,
manganese, calcium, copper, zinc, boron, molybdenum, and/or cobalt salts; as
well as
growth factors such as amino acids, vitamins, growth promoters and the like)
Preferably, microorganisms of the present invention are cultured under
controlled pH. The term ''controlled pH" includes any pH which results in
production of
the desired product (e.g., HMBPA). In one embodiment microorganisms are
cultured at
a pH of about 7. In another embodiment, microorganisms are cultured at a pH of
between 6.0 and ~.5. The desired pH may be maintained by any number of methods
known to those skilled in the art.
Also preferably, microorganisms of the present invention are cultured
under controlled aeration. The term "controlled aeration" includes sufficient
aeration
(e.g., oxygen) to result in production of the desired product (e.g., HMBPA).
In one
embodiment, aeration is controlled by regulating oxygen levels in the culture,
for
example, by regulating the amount of oxygen dissolved in culture media.
Preferably,
aeration of the culture is controlled by agitating the culture. Agitation may
be provided
by a propeller or similar mechanical agitation equipment, by revolving or
shaking the
-21 -
CA 02434518 2003-07-10
WO 02/057476 PCT/US02/01887
cuture vessel (e.g., tube or flask) or by various pumping equipment. Aeration
may be
further controlled by the passage of sterile air or oxygen through the medium
(e.g.,
through the fermentation mixture). Also preferably, microorganisms of the
present
invention are cultured without excess foaming (e.g., via addition of
antifoaming agents).
Moreover, microorganisms of the present invention can be cultured under
controlled temperatures. The term "controlled temperature" includes any
temperature
which results in production of the desired product (e.g., HMBPA). In one
embodiment,
controlled temperatures include temperatures between 15°C and
95°C. In another
embodiment, controlled temperatures include temperatures between 15°C
and 70°C.
Preferred temperatures are between 20°C and 55°C, more
preferably between 30°C and
50°C.
Microorganisms can be cultured (e.g., maintained and/or grown) in liquid
media and preferably are cultured, either continuously or intermittently, by
conventional
culturing methods such as standing culture, test tube culture, shaking culture
(e.g., rotary
shaking culture, shake flask culture, etc.), aeration spinner culture, or
fermentation. In a
preferred embodiment, the microorganisms are cultured in shake flasks. In a
more
preferred embodiment, the microorganisms are cultured in a fermentor (e.g., a
fermentation process). Fermentation processes of the present invention
include, but are
not limited to, batch, fed-batch and continuous processes or methods of
fermentation.
The phrase "batch process" or "batch fermentation" refers to a closed system
in which
the composition of media, nutrients, supplemental additives and the like is
set at the
beginning of the fermentation and not subject to alteration during the
fermentation,
however, attempts may be made to control such factors as pH and oxygen
concentration
to prevent excess media acidification and/or microorganism death. The phrase
"fed-
batch process" or "fed-batch" fermentation refers to a batch fermentation with
the
exception that one or more substrates or supplements are added (e.g., added in
increments or continuously) as the fermentation progresses. The phrase
"continuous
process" or "continuous fermentation" refers to a system in which a defined
fermentation
media is added continuously to a fermentor and an equal amount of used or
"conditioned" media is simultaneously removed, preferably .for recovery of the
desired
product (e.g:, HMBPA). A variety of such processes have been developed and are
well-
known in the art.
-22-
CA 02434518 2003-07-10
WO 02/057476 PCT/US02/01887
The phrase "culturing under conditions such that a desired compound is
produced" includes maintaining and/or growing microorganisms under conditions
(e.g.,
temperature, pressure, pH, duration, etc.) appropriate or sufficient to obtain
production
of the desired compound or to obtain desired yields of the particular compound
being
produced. For example, culturing is continued for a time sufficient to produce
the
desired amount of a compound~(e.g., HMBPA). Preferably, culturing is continued
for a
time sufficient to substantially reach suitable production of the compound
(e.g., a time
sufficient to reach a suitable concentration of HMBPA or suitable ratio of
HMBPA:pantothenate). In one embodiment, culturing is continued for about 12 to
24
hours. In another embodiment, culturing is continued for about 24 to 36 hours,
36 to 48
hours, 48 to 72 hours, 72 to 96 hours, 96 to 120 hours, 120 to 144 hours, or
greater than
144 hours. In yet another embodiment, microorganisms are cultured under
conditions
such that at least about 5 to 10 g/L of compound are produced in about 36
hours, at least
about 10 to 20 g/L compound are produced in about 48 hours, or at least about
20 to 30
g/L compound in about 72 hours. In yet another embodiment, microorganisms are
cultured under conditions such that at least a ratio of
HMBPA:HMBPA+pantothenate of
1:10 is achieved (i. e. , 10% HMBPA versus 90% pantothenate, for example, as
determined by comparing the peaks when a sample of product is analyzed be
HPLC), '
preferably such that at least a ratio of 2:10 is acr~ieved (20% HMBPA versus
90%
pantotheante), more preferably such that a ratio of at least 2.5:10 is
achieved (25%
HMBPA versus 75% pantotheante), more preferably at least 3:10 (30% HMBPA
versus
70% pantotheante), 4:10 (40% HMBPA versus 60% pantotheante), 5:10 (50% HMBPA
versus 50% pantotheante), 6:10 (60% HMBPA versus 40% pantotheante), 7:10 (70%
HMBPA versus 30% pantotheante), 8:10 (80% HMBPA versus 20% paniotheante), 9:10
(90% HMBPA versus 10% pantotheante) or greater.
The methodology of the present invention can further include a step of
recovering a desired compound (e.g., HMBPA). The term "recovering" a desired
compound includes extracting, harvesting, isolating or purifying the compound
from
culture media. Recovering the compound can be performed according to any
conventional isolation or purification methodology known in the art including,
but not
limited to, treatment with a conventional resin (e.g., anion or cation
exchange resin, non-
ionic adsorption resin, etc.), treatment with a conventional adsorbent (e.g.,
activated
charcoal, silicic acid, silica gel, cellulose, alumina, etc.), alteration of
pH, solvent
extraction (e.g., with a conventional solvent such as an alcohol, ethyl
acetate, hexane and
- 23 -
CA 02434518 2003-07-10
WO 02/057476 PCT/US02/01887
the like), dialysis, filtration, concentration, crystallization,
recrystallization, pH
adjustment, lyophilization and the like. For example, a compound can be
recovered
from culture media by first removing the microorganisms from the culture.
Media are
then passed through or over a cation exchange resin to remove cations and then
through
or over an anion exchange resin to remove inorganic anions and organic acids
having
stronger acidities than the compound of interest. The resulting compound can
subsequently be converted to a salt (e.g., a calcium salt) as described
herein.
Preferably, a desired compound of the present invention is "extracted",
"isolated" or "purified" such that the resulting preparation is substantially
free of other
media components (e.g., free of media components and/or fermentation
byproducts).
The language "substantially free of other media components" includes
preparations of
the desired compound in which the compound is separated from media components
or
fermentation byproducts of the culture from which it is produced. In one
embodiment,
the preparation has greater than about 80% (by dry weight) of the desired
compound
(e.g., less than about 20% of other media components or fermentation
byproducts), more
preferably greater than about 90% of the desired compound (e.g., less than
about 10% of
other media components or fermentation byproducts), still more preferably
greater than
about 95% of the desired compound (e.g., less than about 5% of. other media
components
or fermentation byproducts), and most preferably greater than about 98-99%
desired
compound (e.g., less than about 1-2% other media components or fermentation
byproducts). When the desired compound has been derivatized to a salt, the
compound
is preferably further free of chemical contaminants associated with the
formation of the
salt. When the desired compound has been derivatized to an alcohol, the
compound is
preferably further free of chemical contaminants associated with the formation
of the
alcohol.
In an alternative embodiment, the desired compound is not purified from
the microorganism, for example, when the microorganism is biologically non-
hazardous
(e.g., safe). For example, the entire culture (or culture supernatant) can be
used as a
source of product (e.g., crude product). In one embodiment, the culture (or
culture
supernatant) is used without modification. In another embodiment, the culture
(or
culture supernatant) is concentrated. In yet another embodiment, the culture
(or culture
supernatant) is dried or lyophilized.
-24-
CA 02434518 2003-07-10
WO 02/057476 PCT/US02/01887
Preferably, a production method of the present invention results in
production of the desired compound at a significantly high yield. The phrase
"significantly high yield" includes a level of production or yield which is
sufficiently
elevated or above what is usual for comparable production methods, for
example, which
is elevated to a level sufficient for commercial production of the desired
product (e.g.,
production of the product at a commercially feasible cost). In one embodiment,
the
invention features a production method that includes culturing a recombinant
microorganism under conditions such that the desired product (e.g., HMBPA) is
produced at a level greater than 2 g/L. In another embodiment, the invention
features a
production method that includes culturing a recombinant microorganism under
conditions such that the desired product (e.g., HMBPA) is produced at a level
greater
than 10 g/L. In another embodiment, the invention features a production method
that
includes culturing a recombinant microorganism under conditions such that the
desired
product (e.g., HMBPA) is produced at a level greater than 20 glL. In yet
another
embodiment, the invention features a production method that includes culturing
a
recombinant microorganism under conditions such that the desired product
(e.g.,
HMBPA) is produced at a level greater than 30 g/L. In yet another embodiment,
the
invention features a production method that includes culturing a recombinant
microorganism under conditions such that the desired product (~.g., HMBPA) is
produced at a level greater than 40 g/L. The invention further features a
production
method .for producing the desired compound that involves culturing a
recombinant .
microorganism under conditions such that a sufficiently elevated level of
compound is
produced within a commercially desirable period of time.
Depending on the biosynthetic enzyme or-combination of biosynthetic
enzymes manipulated, it may be desirable' or necessary to provide (e.g., feed)
microorganisms of the present invention at least one biosynthetic precursor
such that the
desired compound or compounds are produced. The term "biosynthetic precursor"
or
"precursor" includes an agent or compound which, when provided to, brought
into
contact with, or included in the culture medium of a microorganism, serves to
enhance
or increase biosynthesis of the desired product. In one embodiment, the
biosynthetic
precursor or precursor is aspartate. In another embodiment, the biosynthetic
precursor or
precursor is ~3-alanine. The amount of aspartate or [3-alanine added is
preferably an
amount that results in a concentration in the culture medium sufficient to
enhance
productivity of the microorganism (e.g., a concentration sufficient to enhance
production
- 25 -
CA 02434518 2003-07-10
WO 02/057476 PCT/US02/01887
of HMBPA. The term "excess (3-alanine" includes (3-alanine levels increased or
higher
that those routinely utilized for culturing the microorganism in question. For
example,
culturing the Bacillus microorganisms described in the instant Examples is
routinely
done in the presence of about 0-5 g/L (3-alanine. Accordingly, excess (3-
alanine levels
can include levels of about 5-10 g/L or more preferably about 5-20 g/L (3-
alanine.
Biosynthetic precursors of the present invention can be added in the form of a
concentrated solution or suspension (e.g., in a suitable solvent such as water
or buffer) or
in the form of a solid (e.g., in the form of a powder). Moreover, biosynthetic
precursors
of the present invention can be added as a single aliquot, continuously or
intermittently
over a given period of time.
In yet another embodiment, the biosynthetic precursor is valine. In yet
another embodiment, the biosynthetic precursor is a-ketoisovalerate.
Preferably, valine
or a-ketoisovalerate is added in an amount that results in a concentration in
the medium
sufficient for production of the desired product (e.g., HMBPA) to occur. The
term
"excess a-KIV" includes a-KIV levels increased or higher that those routinely
utilized
for culturing the microorganism in question. For example, culturing the
Bacillus
microorganisms described in the instant Examples can be done in the presence
of about
0-5 g/L a-KIV. Accordingly, excess a-KIV levels can include levels of about 5-
10 g/L,
and more preferably about S-20 g/L. The term "excess valine" includes valine
levels
increased or higher that those routinely utilized for culturing the
microorganism in .
question. For example, culturing the Bacillus microorganisms described in the
instant
Examples is routinely done in the presence of about 0-0.5 g/L valine.
Accordingly,
excess valine levels can include levels of about 0.5-5 g/L, preferably about 5-
20 g/L
valine. Biosynthetic precursors are also referred to herein as "supplemental
biosynthetic
substrates".
Moreover, certain aspects of the present invention include culturing
microorganisms (e.g., recombinant microorganisms) under conditions of
increased
steady state glucose, decreased steady state dissolved oxygen and/or decreased
serine.
The term "increased steady state glucose" includes steady state glucose levels
increased
or higher that those routinely utilized for culturing the microorganism in
question. For
example, culturing the Bacillus microorganisms described in the instant
Examples is
routinely done in the presence of about 0.2-1.0 g/L steady state glucose.
Accordingly,
increased steady state glucose levels can include levels of about 1-2 g/1,
about 2-5 g/1,
and preferably about 5-20 g/L steady state glucose. The term "decreased steady
state
-26-
CA 02434518 2003-07-10
WO 02/057476 PCT/US02/01887
dissolved oxygen" includes steady state dissolved oxygen levels less or lower
that those
routinely utilized for culturing the microorganism in question and, for
example,
inversely correlates with increased steady state glucose levels. For example,
culturing
the Bacillus microorganisms described in the instant Examples is routinely
done in the
presence of about 10-30% dissolved oxygen. Accordingly, decreased steady state
dissolved oxygen can include levels of about 0-10%, and preferably about 0-5%
steady
state dissolved oxygen. The term "reduced serine" includes serine levels
within the
lower range of those routinely utilized for culturing the microorganism in
question. For
example, culturing the Bacillus microorganisms described in the instant
Examples is
routinely done in the presence of about 0-0.5 g/L serine. Accordingly, reduced
serine
levels can include, for example, levels of 0-0.1 g/L serine.
Another aspect of the present invention includes biotransformation
processes which feature the recombinant microorganisms described herein. The
term
"biotransformation process", also referred to herein as "bioconversion
processes",
includes biological processes which results in the production (e.g.,
transformation or
conversion) of appropriate substrates and/or intermediate compounds into a
desired
product (~.g., HMBPA).
In one embodiment, the invention features a biotransformation process
for the production of HMBPA comprising cantacting a microorganism which
overexpresses a reductase (e.g-., overexpresses PanEl, PanE2 and/or IIvC) with
appropriate substrates or precursors under conditions such that HMBPA is
produced and
recovering said HMBPA. In another embodiment, the invention features a
biotransformation process for the production of HMBPA comprising contacting a
microorganism which has a reduced or deleted Pang activity with appropriate
substrates
or precursors under conditions such that HMBPA is produced and recovering said
HMBPA. In yet another embodiment, the invention features a biotransformation
process
for the production of HMBPA comprising contacting a microorganism which
overexpresses at least one reductase and has a reduced or deleted Pang
activity with
appropriate substrates or precursors under conditions such that HMBPA is
produced and
recovering said HMBPA. Preferred recombinant microorganisms for carrying out
the
above-described biotransformations include the recombinant microorganisms
described
herein. In yet another embodiment, the invention features a biotransformation
reaction
that includes contacting aHIV and (3-alanine with isolated or purified PanC
under
conditions such that HMBPA is produced. a,-HIV can optionally be obtained by
-27-
CA 02434518 2003-07-10
WO 02/057476 PCT/US02/01887
contacting oc-KIV with purified or isolated reductase (e.g., PanEl, PanE2
and/or IIvC)
and a source of reducing equivalent, for example, NADH. Conditions under which
a-
HIV or HMBPA are produced can include any conditions which result in the
desired
production of a-HIV or HMBPA, respectively. In yet another embodiment, the
present
invention includes a method of producing a-HIV that includes culturing a
microorganism that overexpresses PanEl and/or PanE2, and/or IIvC and has a
reduced
or deleted PanC or PanD (to reduce HMBPA or [3-alanine sunthesis,
respectively) under
conditions such that a.-HIV is produced.
The microorganisms) and/or enzymes used in the biotransformation
reactions are in a form allowing them to perform their intended function
(e.g., producing
a desired compound). The microorganisms can be whole cells, or can be only
those
portions of the cells necessary to obtain the desired end result. The
microorganisms can
be suspended (e.g., in an appropriate solution such as buffered solutions or
media),
rinsed (e.g., rinsed free of media from culturing the microorganism), acetone-
dried,
immobilized (e.g., with polyacrylamide gel or k-carrageenan or on synthetic
supports,
for example, beads, matrices and the like), fixed, cross-linked or
permeablized (e.g.,
have permeablized membranes and/or walls such that compounds, for example,
substrates, intermediates ~or products can more easily pass through said
membrane or
wall).
This invention is further illustrated by the following examples which
should not be construed as limiting. The contents of all references, patents
and
published patent applications cited throughout this application are
incorporated herein by
reference.
-2~-
CA 02434518 2003-07-10
WO 02/057476 PCT/US02/01887
FXAMPT.F~
Example I: Discovery and Characterization of the [R]-3-(2-hydroxy-3-methyl-
butyrylamino)-propionic acid (HMBPA) Biosynthetic Pathway
In developing Bacillus strains for the production of pantothenate, various
genetic manipulations were made to enzymes involved in the pantothenate
biosynthetic
pathway and the isoleucine-valine (ilv) pathway (Figure 1) as described in
U.S. Patent
Application Serial No. 09/400,494 and U.S. Patent Application Serial No.
09/667,569.
For example, strains having a deregulated panBCD operon and/or having
deregulated
panEl exhibited enhanced pantothenate production (when cultured in the
presence of (3~-
alanine and a-KIV). Strains further deregulated for iIvBNC and ilvD exhibited
enhanced
pantothenate production in the presence of only (3-alanine. Moreover, it was
possible to
achieve [i-alanine independence by further deregulating panD.
An exemplary strain is PA824, a tryptophan prototroph, Spec and Tet
resistant, deregulated for panBCD at the panBCD locus, deregulated for panEl
at the
panEl locus (two genes in the B. subtilis genome are homologous to E. coli
panE,
panEl and panE2, the former encoding the major ketopantoate reductase involved
in
pantothenate production, while panE2 does not contribute to pantothenate
synthesis
(U.S. Patent Application Serial No. 09/400,494), deregulated fer ilvD at the
ilvD locus,
overexpressing an iIvBNC cassette at the amyE locus, and overexpressing pcrnD
at the
bpr locus.
The production of pantothenic acid by PA824 was investigated in 14 L
fermentor vessels. The composition of the batch and feed media are as follows.
BATCH
MATERIAL g/L (final)
1 Yeast extract 10
2 Na Glutamate 5
3 (NH4)ZSOd 8
4 KH~PO 5
5 KzHPOd 7.6
Addded After Sterilization and Cool Down
-29-
CA 02434518 2003-07-10
WO 02/057476 PCT/US02/01887
1 Glucose 2.5
2 CaCh 0.1
3 MgCl2 1
4 Sodium Citrate 1
FeS04~7 Hz0 0.01
5 SM-1000X 1 ml
The final volume of the batch medium is 6 L. The trace element solution
SM-1000X has following composition: 0.15 g Na2Mo042 H20, 2.5 g H3B03, 0.7 g
CoC12~6 HBO, 0.25 g CuS04~5 HZO, 1.6 g MnCly4 HZO, 0.3 g ZnSOd~7 HZO are
dissolved
5 in water (final volume 1 L).
The batch medium was inoculated with 60 ml of shake flask PAS24
culture (OD=10 in SVY medium: Difco Veal Infusion broth 25 g, Difco Yeast
extract 5
g, Sodium Glutamate 5 g, (NH4)ZSO~ 2.7 g in 740 ml H,O, autoclave; add 200 ml
sterile
1 M KzHPO4 (pH 7) and 60 ml sterile 50% Glucose solution (final volume 1 L)).
The
fermentation was run at 43 °G at an air flow rate of 12 L/min as a
glucose limited fed
batch. The initial batched glucose (2.5 g/L) was consumed during exponential
growth.
Afterwards glucose concentrations were maintained between 0.2-1 g/L by
continuous
feeding of FEED solution as follows.
FEED
MATERIAL g/L (final)
1 Glucose 550
2 CaCIZ 0.1
3 SM-1000X 3 ml
The variable feed rate pump was computer controlled and linked to the
glucose concentration in the tank by an algorithm. In this example the total
feeding was
6 L.
During fermentation the pH was set at 7.2. Control was achieved by pH
measurements linked to computer control. The pH value was maintained by
feeding
either a 25% NH3-solution or a 20% H3P04-solution. NH3 acts simultaneousely as
a N-
-30-
CA 02434518 2003-07-10
WO 02/057476 PCT/US02/01887
source for the fermentation. The dissolved oxygen concentration [p0,] was set
at 30%
by regulation of the agitation and aeration rate. Foaming was controlled by
addition of
silicone oil. After the stop of the addition of the feed solution, in this
example after 48
h, the fermentation was continued until the [p02] value reached 95%. Then the
fermentation was stopped by killing the microorganism through sterilization
for 30 min.
The successful sterilization was proven by plating a sample of the
fermentation broth on
agar plates. The pantothenate titer in the fermentation broth was 21.7 g/L
after
sterilization and removal of the cells by centrifugation (determined by HPLC
analysis).
For HPLC analysis the fermentation broth sample was diluted with sterile
water (1:40). 5 ~1 of this dilution was injected into a HPLC column (Aqua C18,
S~m,
150*2.0 mm, PhenomenexTM). Temperature of the column was held at 40°C.
Mobile
phase A was 14.8 mM H3P03, mobile phase B 100% Acetonitrile. Flow rate was
constant at 0.5 mL/min. A gradient was applied
start: 2% mobile phase B
0-3 min linear increase to 3% mobile phase B
3-3.5 min linear increase to 20% mobile phase B
The detection was carried out by an U~% -detector (210 nm). Run time
was 7 min with an additional 3 min posttime. The retention time for
pantothenic acid is
3.9 minutes. The HPLC chromatogram for the abo ~e mentioned sample is given in
Figure 4.
Identificatiozz ofcozzznouzzd related to zaeak with retention time 4.7 minutes
Under the described fermentation conditions, PA824 routinely yields
approximately 20-30 g/L pantothenate. In addition to producing significant
quantities of
pantothenate, it was discovered a second compound eluted with an approximate
retention time of 4.7 minutes in this system. The second prominent product
formed in
the fermentation was shown to be [R]-3-(2-hydroxy-3-methyl-butyrylamino)-
propionic
acid (HMBPA) (also referred to herein as "(3-alanine 2-(R)-
hydroxyisolvalerate", "(3-
alanine 2-hydroxyisolvalerate", and/or "(3-alanyl-a-hydroxyisovalarate). It
was
identified by its mass spectrum (Figure 5; relative monoisotopic mass 189), 'H-
and
13C-NMR (data not shown) after chromatographic purification by reverse phase
flash
chromatography (mobile phase 10 mM KHZPOd, with increasing contents of
acetonitrile
( 1-50%)).
-31 -
CA 02434518 2003-07-10
WO 02/057476 PCT/US02/01887
In order to verify the identity of the compound, deliberate synthesis of
racemic (3-alanine 2-hydroxyisolvalerate was performed as follows. [3-alanine
(2.73 g /
30 mmol) and sodium methoxide (5.67 g of a 30% solution in methanol / 31.5
mmol)
were dissolved in methanol (40 mL). Methyl 2-hydroxyisovalerate (2-hydroxy-3-
methylbutyric acid methyl ester) (3.96g / 30 mmol) was added and refluxed for
18 hours.
Methanol was then removed by rotavap and replaced by tert-butanol (50 mL).
Potassium tert-butoxide was added (50 mg) and refluxed for 26 hours. The
solvent was
removed in vaeuo, the residue dissolved in water (50 mL) and passed through a
strongly
acidic ion-exchange resin (H+-form LewatiteTM S 100 Gl; 100 mL). More water is
used
to rinse the ion exchanger. The aqueous eluates are combined and the water
removed irz
vacuo. The residue is subjected to flash chromatography (silica gel; 2% acetic
acid in
ethyl acetate as eluent) and the product fractions evaporated to give a solid
residue. The
residue was recrystallized from ethyl acetate / toluene (10 mL / 20 mL,
respectively) and
analytically pure HMBPA ((3-alanine 2-hydroxyisolvalerate) was obtained, which
showed a relative monoisotopic mass of 190 (189 + H+) in the mass spec and the
same
'H-NMR resonances as the product obtained from fermentation.
The biosynthetic pathway resulting in HMBPA production is set forth in
Figure 2. The chemical structure of [R]-3-(2-hydroxy-3-methyl-butyrylamino)-
propionic acid (HMBPA) is depicted in Figure 3. As depicted in Figure 2, HMBPA
is
the condensation product of a-hydroxyisovaleric acid (a-HIV) and (3-alanine,
catalyzed
by the PanC enzyme. a-HIV is generated by reduction of a-KIV , a reaction
which is
catalyzed by the reductases PanE (e.g., PanEl and/or PanE2) andlor IIvC.
Based on the chemical structure and biosynthetic pathway leading to
HMBPA production, the present inventors formulated the following model to
describe
the interaction between the.previously known pantothenate and isoleucine-
valine (ilv)
pathways and the newly characterized HMBPA biosynthetic pathway. In at least
one
aspect, the model states that there exist at least two pathways in
microorganisms that
compete for a-KIV, the substrate for the biosynthetic enzyme Pang, namely the
pantothenate biosynthetic pathway and the HMBPA biosynthetic pathway. (A third
and
fourth pathway competing for a-KIV are those resulting in the production of
valine or
leucine from a-KIV, see e.g., Figure 1). At least the pantothenate
biosynthetic pathway
and the HMBPA biosynthetic pathway further produce competitive substrates for
the
enzyme PanC, namely a-HIV and pantoate. The model predicts that reducing Pang
activity will increase a-KIV availability for a-HIV synthesis (and ultimately,
HMBPA
-32-
CA 02434518 2003-07-10
WO 02/057476 PCT/US02/01887
synthesis) and decrease the amount of pantoate and/or pantothenate synthesized
by a
microorganism. Conversely, increasing Pang activity will increase pantoate and
ketopantoate availability for pantoate/pantothenate synthesis. The following
examples
provide expermental support for the model and further exemplify processes for
increasing the production of HMBPA based on the model.
EXAMPLES II-VI:
For Examples II-VI, quanitation of pantothenate and/or HMBPA was
performed as follows. Aliquots of fermentation media were diluted 1:100 and
aliquots
of test tube cultures were diluted 1:10 in water or 5% acetonitrile prior to
injection on a
Phenomenex AquaTM 5~ C18 HPLC column (250 x 4.60mm, 125A). Mobile phases
were A = 5% acetonitrile, 50 mM monosodium phosphate buffer adjusted to pH 2.5
with
phosphoric acid; and B = 95% acetonitrile, 5% HZO.
Linear gradients were as follows.
Minutes Solvent A Solvent B
0 100/ 0%
16 100% 0%
17 0% 100%
0% 100~0
21 l00% 0%
Additional parameters and apparatus were as follows: Flow rate = 1.0
ml/min; Injection volume = 20 ~,1; Detector = Hewlett Packard 1090 series DAD
UV
20 detector-3014, Signal A = 197 nm, ref. = 450 mn, Firmware revision E;
Column heater =
Oven tempature 40°C; Hardware = Hewlett Packard KayakTM XA; and
Software =
Hewlett Packard Chemstation PIusTM family revision A.06.03[509].
Under these fermentation conditions, PA824 routinely yields
approximately 30-40 g/L pantothenate. HMBPA elutes at approximately 13 minutes
in
this system.
- 33 -
CA 02434518 2003-07-10
WO 02/057476 PCT/US02/01887
Example II: Ketopantoate Reductase Contributes to the Production of HMBPA
and Increasing Ketopantoate Reductase Activity in Bacillus Results
in Enhanced HMBPA Production
As described in Example I, a novel HPLC peak corresponding to
HMBPA was observed in microorganisms overexpressing pazzEl indicating that
increased ketopantoate reductase contributes to the production of HMBPA (in
addition
to production of pantothenate). As mentioned previously, two genes in the B.
subtilis
genome are homologous to the E. coli pa~cE gene encoding ketopantoate
reductase and
have been named panEl and pazzE2. In Bacillus, the pazzEl gene encodes the
major
ketopantoate reductase involved in pantothenate production, while pazzE2 does
not
contribute to pantothenate synthesis. In fact, overexpression of panE2 from a
P?6
promoter leads to a reduction in pantothenate titer (see e.g., U.S. Patent
Application
Serial No. 09/400,494).
Accordingly, it was tested whether, beside being produced by the pazzEl
gene product, it was possible that a significant portion of the oc-HIV
necessary to make
HMBPA was being produced by the pazzE2 gene product. It was hypothesized that
the
panE2 gene product is an enzyme that can reduce oc-KIV to a-HIV, but that can
not
significantly reduce ketopantoate to pantoate.
To test the hypothesis, pazzE2 was deleted from pantothenate production
strain PA824 (described in Example I) by transforming with a dpazzE2: : cat
cassette
from chromosomal DNA of strain PA248 (dpahE2: : cat) (set forth as SEQ ID
N0:24,
for construction see e.g., U.S. Patent Application Serial No. 09/400,494) to
give strain
PA919. Three isolates of PA919 were compared to PA824 for pantothenate and
HMBPA production in test tube cultures grown in SVY plus (3-alanine.
-34-
CA 02434518 2003-07-10
WO 02/057476 PCT/US02/01887
V
N
w
V
H
~1
N
H
cn N CO ~
di d1 cri i-c7
N
h
O '
a 1 N ~
N
C
w
V
w 3
i a~' '
A ~ N m
N
N
1 a1 a1
-f-
a
A
CA 02434518 2003-07-10
WO 02/057476 PCT/US02/01887
As indicated by the data in Table 1, all three isolates of PA919 produced
about four-fold lower HMBPA than PA824 demonstrating that the panE2 gene
product
is a potent contributor to HMBPA synthesis. Moreover, significant increases in
HMBPA production can be achieved simply by overexpression of panE2. An
exemplary
plasmid for the overexpression of panE2, named pAN238, is set forth as SEQ ID
N0:25
(Figure 10).
Example III. Increasing Production of HMBPA by Reducing Pang Activity in
Microorganisms.
Strains derived from PA365 (the RL-1 lineage equivalent of PA377,
described in U.S. Patent Application Serial No. 09/667,569) which are deleted
for the
Pz6 panBCD cassette and which contain a P26 pa~C*D cassette amplified at the
vpr
locus and either the wild type P~6 panB cassette (PA666) or a P26 dpanB
cassette
(PA664) amplified at the bpi° locus were constructed as follows. Are
alignment of the C-
terminal amino acids of known or suspected Pang proteins is shown in Figure 6.
Three
regions called l, 2 and 3, that were identified having conserved or semi-
conserved amino
acid residues, are indicated by arrows at the top of the figure. The B.
subtilis PanFi
protein (.RBS02239) is underlined. Two of the Pang proteins (RCY14036 and
CAB56202.1) axe missing region 3 while the latter Pang protein is also missing
region 2
and has non-conserved amino acid residues occupying region 1.
B. subtilis Pang variants were created that were missing regions 1, 2 and
3. The desired variants were created by designing 3' PCR primers to amplify
the B.
subtilis pah B gene such that region 3, regions 2 and 3, or all three regions
would be
missing from the final product. The PCR products were generated and cloned
into E.
coli expression vector pASI~-1BA3, creating plasmids pAN446, pAN447, and
pAN448,
respectively. The plasmids were then transformed into E. coli strain SJ2 that
contains
the panB6 mutation to test for complementation. Only pAN446, which is missing
region
3, was able to complement. This indicates that region 3 is not essential for
B. subtilis
Pang activity but that region 2 is required for activity or stability.
-36-
CA 02434518 2003-07-10
WO 02/057476 PCT/US02/01887
The next step in this analysis was to transfer the pang gene from pAN446
to a B. subtilis expression vector and then introduce it into a strain
appropriate for
testing activity of the encoded Pang protein in B. subtilis. To do this, a
strain that is
deleted for the P~6 panBCD operon was first created. This was accomplished by
first
inserting a cat gene between the BseRI site located just upstream of the pang
RBS and
the Bg/II site located in parzD, creating plasmid pAN624 (Figure ~. The
sequence of
pAN624 is set forth as SEQ ID N0:20. The resulting deletion-substitution
mutation
(OparzBCD::cat624), which removes all of pang and panC, was crossed into PA354
by
transformation, with selection for resistance to chloramphenicol on plates
supplemented
with 1 mM pantothenate. One of the transformants was saved and named PA644.
Chromosomal DNA isolated from PA644 was analyzed by PCR and was shown to
contain the deletion-substitution mutation. As expected, PA644 requires
pantothenate
for growth but retains the engineered ilv genes (PZ6ilvBNC PZ~iIvD) as well as
the PZbpan
EI gene originally present in PA354. Thus, it has all the enzymes involved in
pantoate
synthesis overproduced except Pang. The gene containing the shortest pang
deletion
was inserted into B. subtilis expression vector pOTP61 (described in US patent
application Serial No. 09/667,569), creating plasmid pAN627. At the same time,
a wild-
type pa~cB control gene was inserted into pOTP6l, creating plasm.id pAN630.
The I\lntl
fragments of each plasmid, lacking E. coli vector sequences, were ligated and
transformed into PA644, with selection for resistance to tetracycline.
One transformant from each transformation was saved and further
transformed with chromosomal DNA from PA628 with selection for Pan+. PA628
contains a multicopy PZ~panC*D expression plasmid (pAN620) integrated at the
vpr~
locus. In order to determine the effects of the pang gene mutation directly on
pantothenate production, plasmid pAN620, set forth as SEQ ID N0:21 and
illustrated
schematically in Figm°e ~, provides the remaining two enzymes required
for
pantothenate synthesis (PanC and PanD). Four transformants from each
transformation
were isolated, grown in SVY medium containing 10 g/L aspartate for 48 hours,
then
assayed for pantothenate production. Transformants with the 3'deleted pang
gene were
named PA664 and those containing the wild-type gene were called PA666. The
data
showed that the 3' deleted pang gene in PA664 encodes a Pang protein with
greatly
reduced activity. To test for HMBPA production, test tube cultures of PA365,
PA666,
and PA664 were grown in SVY + aspartate medium with and without added oc-I~IV
or
-37-
CA 02434518 2003-07-10
WO 02/057476 PCT/US02/01887
pantoate for 48 hours and then assayed for HMBPA and pantothenate as described
previously.
-38-
CA 02434518 2003-07-10
WO 02/057476 PCT/US02/01887
M N
O O O
~ x
,O ,~ ~ oo N ~n
~
~
c~.i -~ e ~ ~i f~~
C
~
r
O
co O ~O
OI
~ x
~ ~,
w + C~l M ~O
~
~ M M O
r
'"v
V7 01
~ V'7 M
vW ., O O
~,
pa
~
CL
O I~ M
p ~ M M O
~
Y
O
'N
O
h
~
_
~"
~'
~r O
?
H
"~'
II
~
d
W o et P~
M
39
CA 02434518 2003-07-10
WO 02/057476 PCT/US02/01887
The data presented in Table 2 demonstrate that in the absence of
supplements, PA664 produced the most HMBPA while PA666 produced the least,
indicating an inverse correlation between Pang activity and HMBPA production.
This
is consistent with the model which predicts that the two pathways compete for
a-KIV,
the substrate for Pang, and produce competitive substrates for PanC; lowering
Pang
activity would be expected to increase a-KIV availability for a-HIV synthesis
and
increase HMBPA production, correspondingly decreasing the amount of pantoate
synthesized. When a-KIV is added to the medium, all three strains produced
significantly more HMBPA. This result evidences that a-KIV is a precursor to
HMBPA, as described in Figure 2, and that excess a-KIV favors HMBPA
production.
This result also suggests that synthesis of HMBPA is at least partially due to
an overflow
effect of excess a-KIV production. When pantoate was added to the medium,
HMBPA
was reduced by roughly 50 percent in all three strains. Conversely, the
strains each
produced significantly more pantothenate. This result is also consistent with
the model
that the two pathways produce competing substrates for PanC (a-HIV and
pantoate).
Taken together, the above results further indicate that decreasing pantoate
synthesis
should be beneficial in promoting HMBPA production as well as reducing
pantothenate
levels.
Example IV. Methods for Regulating HMBPA:Pantothenate Levels
As demonstrated in Examples I and II, PanEl and/or PanE2
contribrate to enhanced HMBPA production as does reduced Pang activity. This
Example demonstrates that overexpressing PanEl increases HMBPA production
relative
to pantothenate production whereas overexpressing Pang decreases HMBPA
production
relative to pantothenate production. Furthermore, in strains overexpressing
IIvC,
HMBPA production is enhanced.
PA668 is a derivative of PA824 that contains extra copies of P~6 panB
amplified at the vp~ or pang locus. PA668 was constructed using the pang
expression
vector (pAN636) which allows for selection of multiple copies using
chloramphenicol.
The sequence of pAN636 is set forth as SEQ ID NC:22 and the vector is depicted
schematically in Figure 9. The pAN636 Notl restriction fragment, missing the E
coli
vector sequences, was ligated and then used to transform PA824 with selection
on plates
contailing 5 ~,g/ml chloramphenicol. Transformants resistant to 30 ~,g/ml
-40-
CA 02434518 2003-07-10
WO 02/057476 PCT/US02/01887
chloramphenicol were isolated and screened for pantothenate production in 48
hour test
tube cultures. The isolates shown produce less HMBPA that PA824 (conversely
producing about 10 percent more pantothenate than PA824). A second strain,
called
PA669, was constructed which is PA824 with extra copies of P~6 panEl amplified
at
the vpr or pavcEl locus. Strain PA669 was constructed by transforming PA824
with the
self ligated NotI fragment of plasmid pAN637 with selection for resistance to
chloramphenicol. The sequence of pAN637 is set forth as SEQ ID N0:23 and the
vector
is depicted schematically in Figure 10. Two isolates of PA669 were chosen for
further
study; PA669-5 produces less PanEl than PA669-7 as judged by SDS-PAGE analysis
of
total cell extracts made from the two strains.
Test tube cultures of strains PA824, PA668-2, PA668-24, and the two
isolates of PA669 (PA669-5 and PA669-7) were grown in three different media
(SVY,
SVY + aspartate, and SVY + aspartate + pantoate) for 48 hours and then assayed
for
pantothenate, HMBPA, and (3-alanine (Table 3).
-41 -
CA 02434518 2003-07-10
WO 02/057476 PCT/US02/01887
w
0 0 0 0
~n
.-i ,-w M
,~ l~
'
.o ,~ ~ o o
V 0
V ~ ~ V
w
x
''"~ 'Jr-~ v~ N ~O ~O
~n
N ~ N N
N
ett ,
~
b~A
~O a1 oo
,~ N
W f-
~O
~,f.,
b~D
'
M O ~ d
V7 ~ M l
O O O O
V
0
' ~
'
- v> ~ oo ~
N
N ~ N M
M
,
~1
~
l~ ~ ~ N
t~
d'
M
,
b
A
~
w
x V V V V
V
H
x
.s
c~ o 0 0 0
o ~ 0
~ ~ o 0 00
~
, ~
w
H o
W W W
M
M
d
z z z
~,
W ~ ~ W
W
o zz o0
z ~ z
~ z
,
,
N N V)
~ l~
Mi e~ , , ,
d' 00 ,
00 C1
Cv
-N N ~O ~O
\O \O
W P-~ P-~ at-
P.i W
42
CA 02434518 2003-07-10
WO 02/057476 PCT/US02/01887
None of the strains produced detectable quantities of HMBPA in SVY
medium. All strains produced roughly equivalent amounts of pantothenate and
low
amounts of (3-alanine indicating that (3-alanine is limiting for both
pantothenate and
HMBPA synthesis in these cultures and that (3-alanine is a precursor for both
compounds. When grown in SVY + aspartate medium, the two PA669 isolates
produced more HMBPA than PA824 whereas both PA668 isolates produced less
HMBPA than PA824. It is noteworthy that the strain that produces the most
PanEl
(PA669-7) produced the most HMBPA (and the least pantothenate). This suggests
that
high levels of PanE 1 favor the production of HMBPA at the expense of lower
pantothenate synthesis. It is also interesting that PA668-24 produced more
HMBPA
than PA668-2, even though SDS-PAGE analysis of extracts from the two strains
showed
that they produce roughly equivalent levels of Pang. The SDS-PAGE analysis
also
showed that PA668-24 makes much more IIvC than PA668-2. Based on these data,
it is
proposed that IIvC influences HMBPA synthesis by increasing steady state
levels of
a-KIV and/or by catalyzing a-HIV formation from. a-I~IV, thereby accounting
for the
observed shift towards production of HMBPA.
The final set of data in. Table 3 shows that adding pantoate to the growth
medium decreased HMBPA production by all strains that had previously produced
detectable levels, e.g., by shifting synthesis towards pantothenate. This
fizrther supports
the model that a-HIV and pantoate are competitive substrates for PanC.
Example V: Increasing I3MSPA Production by Limiting Serine Availability
It was hypothesized that the ratio of pantothenate to HMBPA production
could also be controlled by regulating the availability of serine or methylene
tetrahydrofolate in the microorganism cultures. In particular, it is proposed
that
decreasing the availability of serine could increase HMBPA production relative
to
pantothenate production, whereas increasing the availability of serine would
decrease the
production of HMBPA relative to pantothenate production. This method is based
on the
understanding that the Pang substrate, methylenetetrahydrofolate is derived
from serine.
Thus, regulating serine levels should effectively regulate Pang substrate
levels. To test
this hypothesis, PA824 was grown in test tube cultures of SVY glucose plus 5
g!L (3-
alanine and~ 5 g!L serine for 48 hours at 43°C.
-43-
CA 02434518 2003-07-10
WO 02/057476 PCT/US02/01887
Table 4: Production of HMBPA and pazztotlzezzate by PA824 with and without
the addition of seriue
serine added
at 5 g/L ODGOO [pan] g/L [HMBPA] g/L
- 16.3 4.9 0.84
- 14.0 4.5 0.80
+ 13.1 6.4 0.56
+ 12.9 6.0 0.62
As demonstrated in Table 4, addition of serine decreases the level of
production while conversely increasing pantothenate production. At least one
method of
decreasing methylene tetrahydrofolate levels in order to regulate HMBPA
production
levels is to decrease the activity of serine hydroxymethyl transferase (the
glyA gene
product), thereby decreasing methylene tetrahydrofolate biosynthesis in
appropriately
engineered microorganisms. At least one method of decreasing serine levels in
order to
regulate HMBPA production is to decrease the activity of 3-phosphoglycerate
dehydrogenase (the serA gene product).
Example VI: Increasing HMBPA Production by Modifying Culture Conditions for
Recombinant Microorganisms
In at least one fermentation (Fermentation P 162), levels of HMBPA
production reached 35 g/L. Briefly, fermentation of strain PA824 was carried
out as
described in Example I but utilizing PFM-155 medium formulated as follows.
BATCH
MATERIAL g/L (final)
1 Amberex 1003 5
2 Cargill 200/20 (soy40
flour)
3 Na Glutamate 5
4 (NHd)~SO~ 8
MgSOy7H20 1
-44-
CA 02434518 2003-07-10
WO 02/057476 PCT/US02/01887
6 MAZU DF204C 1
7 H20 qs to 4
L
Added After Sterilization and Cool Down
1 KHZPOd 10
2 KzHPOy3H20 20
. 3 HZO qs to 400
ml
1 80% Glucose 20
2 CaC12~2H,0 0.1
1 Sodium Citrate 1
2 FeS04~7HZ0 0.01
3 SM-1000X 1 X
FEED
MATERIAL g/L (final)
1 80% Glucose 800
2 CaClz~2H20 0.8
3 H20 qs to 3500
ml
Added After Sterilization and Cool Down
1 Sodium Citrate 2.0
2 FeS04~7HZ0 0.02
3 SM-1000X 2 X
4 Glutamate Na 5.0
H20 qs to 500
ml
However, as a result of loss of process control during the fermentation,
the dissolved oxygen became limiting between 16 and 17 hours and glucose began
to
accumulate after 16 hours.
-45-
CA 02434518 2003-07-10
WO 02/057476 PCT/US02/01887
These changes in fermentation conditions produced the following
significant results at or after 16 hours. Namely, synthesis of HMBPA began to
increase
with a corresponding decrease in pantothenate synthesis. In the four hour
interval before
16 hours the culture produced 7 g/1 HMBPA, four hours afterwards, 9.0 g/1.
Pantothenate was the reverse with 10 g/1 and 6.0 g/1 produced between 12-16
hours and
16-20 hours, respectively. Between 20 and 36 hours the average rate of HMBPA
synthesis was 1.0 g/1 hr. Overall, fermentation P162 produced 35 g/1 of HMBPA
in 36
hours.
Thus, it appears that overfeeding of glucose, and/or limitation of
dissolved oxygen (e.g., beginning at about 16 hours) leads to an increase in
HMBPA
production. Accordingly, two methods for increasing HMBPA production (relative
to
pantothenate production) are to increase steady state glucose levels and/or
decrease
steady state dissolved oxygen levels.
Equivalents Those skilled in the art will recognize, or be able to ascertain
using no
more than routine experimentation, many equivalents to the specific
embodiments of the
invention described herein. Such equivalents are intended to be encompassed by
the
following claims.
-46-
CA 02434518 2003-07-10
WO 02/057476 PCT/US02/01887
SEQUENCE LISTING
<110> OmniGene BioProducts Inc.,etal.
<120> METHODS AND MICROORGANTSMS FOR THE PRODUCTION OF 3-(2-
HYDROXY-3-METHYL-B(JTYRLAMINO)-PROPIONTC ACTD (HMBPA)
<130> BGI-146PC
<140>
<141>
<160> 25
<170> Patentln Ver. 2.0
<210> 1
<211> 194
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: promoter
sequence .
<220>
<221> -35 signal
<222> (136)..(141)
<220>
<221> -lO signal
<222> (159)..(164)
<400> 1
gctattgacg acagctatgg ttcactgtcc accaaccaaa actgtgctca gtaccgccaa 60
tatttctccc ttgaggggta caaagaggtg tccctagaag agatccacgc tgtgtaaaaa 120
ttttacaaaa aggtattgac tttccctaca gggtgtgtaa taatttaatt acaggcgggg 180
gcaaccccgc ctgt 194
<210> 2
<211> 163
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: promoter
sequence
<220>
<221> -35 signal
<222> (113)..(118)
<220>
<221> -10 signal
<222> (136)..(141)
-1-
CA 02434518 2003-07-10
WO 02/057476 PCT/US02/01887
<400> 2
gcctacctag cttccaagaa agatatccta acagcacaag agcggaaaga tgttttgttc 60
tacatccaga acaacctctg ctaaaattcc tgaaaaattt tgcaaaaagt tgttgacttt 120
atctacaagg tgtggtataa taatcttaac aacagcagga cgc 163
<210> 3
<211> 127
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: promoter
sequence
<220>
<221> -35 signal
<222> (34)..(39)
<220>
<221> -lO signal
<222> (58)..(63)
<220>
<221> -35 signal
<222> (75)..(80)
<220>
<221> -10 signal
<222> (98)..(103)
<400> 3
gaggaatcat agaattttgt caaaataatt ttattgacaa cgtcttatta acgttgatat 60
aatttaaatt ttatttgaca aaaatgggct cgtgttgtac aataaatgta gtgaggtgga 120
tgcaatg 127
<210> 4
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: ribosome
binding site
<400> 4
taaacatgag gaggagaaaa catg 24
<210> 5
<211> 28
<212> DNA
<213> Artificial Sequence
CA 02434518 2003-07-10
WO 02/057476 PCT/US02/01887
<220>
<223> Description of Artificial Sequence: ribosome
binding site
<400> 5
attcgagaaa tggagagaat ataatatg 28
<210> 6
<211> 13
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: ribosome
binding site
<400> 6
agaaaggagg tga 13
<210> 7
<211> 23
<212> DNA
<2l3> Artificial Sequence
<220>
<223> Description of Artificial Sequence: ribosome
binding site
<220>
<223> All occurrences of n = any nucleotide
<400> 7
ttaagaaagg aggtgannnn atg 23
<210> 8
<2l1> 23
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: ribosome
binding site
<220>
<223> A11 occurrences of n = any nucleotide
<400> 8
ttagaaagga ggtgannnnn atg 23
<210> 9
<211> 23
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: ribosome
binding site
-3-
CA 02434518 2003-07-10
WO 02/057476 PCT/US02/01887
<220>
<223> All occurrences of nucleotide
n = any
<400> 9
agaaaggagg tgannnnnnn atg 23
<210> 10
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of ArtificialSequence: ribosome
binding site
<220>
<223> All occurrences of nucleotide
n = any
<400> 10
agaaaggagg tgannnnnna tg 22
<210> 11
<211> 25
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of ArtificialSequence: ribosome
binding site
<400> 11
ccctctagaa ggaggagaaa acatg 25
<210> 12
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of ArtificialSequence: ribosome
binding site
<400> 12
ccctctagag gaggagaaaa catg 24
<210> 13
<211> 23
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of ArtificialSequence: ribosome
binding site
<400> l3
ttagaaagga ggatttaaat atg 23
<210> 14
<211> 23
<212> DNA
-4-
CA 02434518 2003-07-10
WO 02/057476 PCT/US02/01887
<213> Artificial Sequence
<220>
<223> Description of ArtificialSequence: ribosome
binding site
<400> 14
ttagaaagga ggtttaatta atg 23
<210> 15
<211> 23
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of ArtificialSequence: ribosome
binding site
<400> 15
ttagaaagga ggtgatttaa atg 23
<210> 16
<211> 23
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of ArtificialSequence: ribosome
binding site
<400> 16
ttagaaagga ggtgtttaaa atg 23
<210> 17
<211> 28
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of ArtificialSequence: ribosome
binding site
<400> 17
attcgagaaa ggaggtgaat ataatatg 28
<210> 18
<211> 27
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of ArtificialSequence: ribosome
binding site
<400> 18
attcgagaaa ggaggtgaat aataatg 27
<210> 19
<211> 28
<212> DNA
-5-
CA 02434518 2003-07-10
WO 02/057476 PCT/US02/01887
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: ribosome
binding site
<400> 19
attcgtagaa aggaggtgaa ttaatatg 28
<210> 20
<211> 6886
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: vector
<220>
<223> pAN624
<400> 20
aagaaaccaa ttgtccatat tgcatcagac attgccgtca ctgcgtcttt tactggctct 60
tctcgctaac caaaccggta accccgctta ttaaaagcat tctgtaacaa agcgggacca 120
aagccatgac aaaaacgcgt aacaaaagtg tctataatca cggcagaaaa gtccacattg 180
attatttgca cggcgtcaca ctttgctatg ccatagcatt tttatccata agattagcgg 240
atcctacctg acgcttttta tcgcaactct ctactgtttc tccatacccg tttttttggg 300
ctaacaggag gaattaacca tggatccgag ctcgacagta tcaagcactt cacaatctgg 360
gagctgaaag cccgccttat gtagctcata cttgacaaat ccaaggtcaa aatggatatt 420
gtgggcgaca aaataagcgc cgtcaagcaa ttggaatact tcttcagcaa ctgcttcaaa 480
tggctgttca ttctcgacca tttgattaga gattccagta agctgctcaa taaaagcagg 540
gattgattta tttggattaa tgtattttga aaaccgctca gtaatttgtc cattttcgat 600
tacaaccgct gcgatttgta tgattttatc gcctttcttc ggcgaattcc ctgttgtctc 660
tacatctata acaacgaacc gttgcttatt cattaaaatg gacacctcaa ttcttgcata 720
cgacaaaagt gtaacacgtt ttgtacggaa atggagcggc aaaaccgttt tactctcaaa 780
atcttaaaag aaaacccccg ataaaggggg cttttcttct acaaaattgt acgggctggt 840
tcgttcccca gcatttgttc aattttgttt tgatcattca gaacagccac tttcggctca 900
tggcttgccg cttcttgatc agacatcatt ttgtaggaaa taataatgac cttatctcct 960
tcctgcacaa ggcgtgcggc tgcaccgttt aagcatatga cgccgcttcc~ccgtttacca 1020
ggaataatat acgtttcaag acgtgctcca ttattattat tcacaatttg tactttttca 1080
ttaggaagca ttcccacagc atcaatgaga tcctctagag tcgacctgca ggcatgcaag 1140
cttccgtcga cgctctccct tatgcgactc ctgcattagg aagcagccca gtagtaggtt 1200
gaggccgttg agcaccgccg ccgcaaggaa tggtgcatgc aaggagatgg cgcccaacag 1260
tcccccggcc acggggcctg ccaccatacc cacgccgaaa caagcgctca tgagcccgaa 1320
gtggcgagcc cgatcttccc catcggtgat gtcggcgata taggcgccag caaccgcacc 1380
tgtggcgccg gtgatgccgg ccacgatgcg tccggcgtag aggatcaatc ttcatccatt 1440
ccaaggtaaa tcccccttcg ccgtttctgt taccattata caccttttga accttaacgt 1500
aaacgttaag ttttaaaaaa caataaaaaa gacgagcagc atacagcacc cgtctttcac 1560
tttcctgttt aagctaaact tcccgccact gacagagact ctttttgaag gctttcagaa 1620
agcactcgat acgcgatctg gagctgtaat ataaaaacct tcttcaacta acggggcagg 1680
ttagtgacat tagaaaaccg actgtaaaaa gtacagtcgg cattatctca tattataaaa 1740
gccagtcatt aggcctatct gacaattcct gaatagagtt cataaacaat cctgcatgat 1800
aaccatcaca aacagaatga tgtacctgta aagatagcgg taaatatatt gaattacctt 1860
tattaatgaa ttttcctgct gtaataatgg gtagaaggta attactatta ttattgatat 1920
ttaagttaaa cccagtaaat gaagtccatg gaataataga aagagaaaaa gcattttcag 1980
gtataggtgt tttgggaaac aatttccccg aaccattata tttctctaca tcagaaaggt 2040
ataaatcata aaactctttg aagtcattct ttacaggagt ccaaatacca gagaatgttt 2100
tagatacacc atcaaaaatt gtataaagtg gctctaactt atcccaataa cctaactctc 2160
cgtcgctatt gtaaccagtt ctaaaagctg tatttgagtt tatcaccctt gtcactaaga 2220
aaataaatgc agggtaaaat ttatatcctt cttgttttat gtttcggtat aaaacactaa 2280
-6-
CA 02434518 2003-07-10
WO 02/057476 PCT/US02/01887
tatcaatttc tgtggttata ctaaaagtcg tttgttggtt caaataatga ttaaatatct 2340
cttttctctt ccaattgtct aaatcaattt tattaaagtt catttgatat gcctcctaaa 2400
tttttatcta aagtgaattt aggaggctta cttgtctgct ttcttcatta gaatcaatcc 2460
ttttttaaaa gtcaatatta ctgtaacata aatatatatt ttaaaaatat cccactttat 2520
ccaattttcg tttgttgaac taatgggtgc tttagttgaa gaataaagac cacattaaaa 2580
aatgtggtct tttgtgtttt tttaaaggat ttgagcgtag cgaaaaatcc ttttctttct 2640
tatcttgata ataagggtaa ctattgcatg ataagctgtc aaacatgaga attcccgttt 2700
tcttctgcaa gccaaaaaac cttccgttac aacgagaagg attcttcact ttctaaagtt 2760
cggcgagttt catccctctg tcccagtcct tttttggatc aaggcagact gctgcaatgt 2820
ctatctattt taataatagg tgcagttcgc aggcgatact gcccaatgga agtataccaa 2880
aatcaacggg cttgtaccaa cacattagcc caattcgata tcggcagaat agattttttt 2940
aatgccttcg ttcgtttcta aaagcagaac gccttcatca tctataccta acgccttacc 3000
gtaaaaggtt ccgtttaacg ttctggctct catattagtg ccaataccga gcgcatagct 3060
ttcccataaa agcttaatcg gcgtaaatcc gtgcgtcata taatcccggt accgtttctc 3120
aaagcatagt aaaatatgct ggatgacgcc ggcccgatca attttttccc cagcagcttg 3180
gctgaggctt gtcgcgatgt ccttcaattc atctggaaaa tcattaggct gctggttaaa 3240
cggtctccag cttggctgtt ttggcggatg agagaagatt ttcagcctga tacagattaa 3300
atcagaacgc agaagcggtc tgataaaaca gaatttgcct ggcggcagta gcgcggtggt 3360
cccacctgac cccatgccga actcagaagt gaaacgccgt agcgccgatg gtagtgtggg 3420
gtctccccat gcgagagtag ggaactgcca ggcatcaaat aaaacgaaag gctcagtcga 3480
aagactgggc ctttcgtttt atctgttgtt tgtcggtgaa cgctctcctg agtaggacaa 3540
atccgccggg agcggatttg aacgttgcga agcaacggcc cggagggtgg cgggcaggac 3600
gcccgccata aactgccagg catcaaatta agcagaaggc catcctgacg gatggccttt 3660
ttgcgtttct acaaactctt tttgtttatt tttctaaata cattcaaata tgtatccgct 3720
catgagacaa taaccctgat aaatgcttca ataatattga aaaaggaaga gtatgagtat 3780
tcaacatttc cgtgtcgccc ttattccctt ttttgcggca ttttgccttc ctgtttttgc 3840
tcacccagaa acgctggtga aagtaaaaga tgctgaagat cagttgggtg cacgagtggg 3900
ttacatcgaa ctggatctca acagcggtaa gatccttgag agttttcgcc ccgaagaacg 3960
ttttccaatg atgagcactt ttaaagttct gctatgtggc gcggtattat cccgtgttga 4020
cgccgggcaa gagcaactcg gtcgccgcat acactattct cagaatgact tggttgagta 4080
ctcaccagtc acagaaaagc atcttacgga tggcatgaca gtaagagaat tatgcagtgc 4140
tgccataacc atgagtgata acactgcggc caacttactt ctgacaacga tcggaggacc 4200
gaaggagcta accgcttttt tgcacaacat gggggatcat gtaactcgcc ttgatcgttg 4260
ggaaccggag ctgaatgaag ccataccaaa cgacgagcgt gacaccacga tgcctgtagc 4320
aatggcaaca acgttgcgca aactattaac tggcgaacta cttactctag cttcccggca 4380
acaattaata gactggatgg aggcggataa agttgcagga ccacttctgc gctcggccct 4440
tccggctggc tggtttattg ctgataaatc tggagccggt gagcgtgggt ctcgcggtat 4500
cattgcagca ctggggccag atggtaagcc ctcccgtatc gtagttatct acacgacggg 4560
gagtcaggca actatggatg aacgaaatag acagatcgct gagataggtg cctcactgat 4620
taagcattgg taactgtcag accaagttta ctcatatata ctttagattg atttaaaact 4680
tcatttttaa tttaaaagga tctaggtgaa gatccttttt gataatctca tgaccaaaat 4740
cccttaacgt gagttttcgt tccactgagc gtcagacccc gtagaaaaga tcaaaggatc 4800
ttcttgagat cctttttttc tgcgcgtaat ctgctgcttg caaacaaaaa aaccaccgct 4860
accagcggtg gtttgtttgc cggatcaaga gctaccaact ctttttccga aggtaactgg 4920
cttcagcaga gcgcagatac caaatactgt ccttctagtg tagccgtagt taggccacca 4980
cttcaagaac tctgtagcac cgcctacata cctcgctctg ctaatcctgt taccagtggc 5040
tgctgccagt ggcgataagt cgtgtcttac cgggttggac tcaagacgat agttaccgga 5100
taaggcgcag cggtcgggct gaacgggggg ttcgtgcaca cagcccagct tggagcgaac 5160
gacctacacc gaactgagat acctacagcg tgagctatga gaaagcgcca cgcttcccga 5220
agggagaaag gcggacaggt atccggtaag cggcagggtc ggaacaggag agcgcacgag 5280
ggagcttcca gggggaaacg cctggtatct ttatagtcct gtcgggtttc gccacctctg 5340
acttgagcgt cgatttttgt gatgctcgtc aggggggcgg agcctatgga aaaacgccag 5400
caacgcggcc tttttacggt tcctggcctt ttgctggcct tttgctcaca tgttctttcc 5460
tgcgttatcc cctgattctg tggataaccg tattaccgcc tttgagtgag ctgataccgc 5520
tcgccgcagc cgaacgaccg agcgcagcga gtcagtgagc gaggaagcgg aagagcgcct 5580
gatgcggtat tttctcctta cgcatctgtg cggtatttca caccgcatat ggtgcactct 5640
cagtacaatc tgctctgatg ccgcatagtt aagccagtat acactccgct atcgctacgt 5700
gactgggtca tggctgcgcc ccgacacccg ccaacacccg ctgacgcgcc ctgacgggct 5760
tgtctgctcc cggcatccgc ttacagacaa gctgtgaccg tctccgggag ctgcatgtgt 5820
cagaggtttt caccgtcatc accgaaacgc gcgaggcagc agatcaattc gcgcgcgaag 5880
_7_
CA 02434518 2003-07-10
WO 02/057476 PCT/US02/01887
gcgaagcggc atgcataatg tgcctgtcaa atggacgaag cagggattct gcaaacccta 5940
tgctactccg tcaagccgtc aattgtctga ttcgttacca attatgacaa cttgacggct 6000
acatcattca ctttttcttc acaaccggca cggaactcgc tcgggctggc cccggtgcat 6060
tttttaaata cccgcgagaa atagagttga tcgtcaaaac caacattgcg accgacggtg 6120
gcgataggca tccgggtggt gctcaaaagc agcttcgcct ggctgatacg ttggtcctcg 6180
cgccagctta agacgctaat ccctaactgc tggcggaaaa gatgtgacag acgcgacggc 6240
gacaagcaaa catgctgtgc gacgctggcg atatcaaaat tgctgtctgc caggtgatcg 6300
ctgatgtact gacaagcctc gcgtacccga ttatccatcg gtggatggag cgactcgtta 6360
atcgcttcca tgcgccgcag taacaattgc tcaagcagat ttatcgccag cagctccgaa 6420
tagcgccctt ccccttgccc ggcgttaatg atttgcccaa acaggtcgct gaaatgcggc 6480
tggtgcgctt catccgggcg aaagaacccc gtattggcaa atattgacgg ccagttaagc 6540
cattcatgcc agtaggcgcg cggacgaaag taaacccact ggtgatacca ttcgcgagcc 6600
tccggatgac gaccgtagtg atgaatctct cctggcggga acagcaaaat atcacccggt 6660
cggcaaacaa attctcgtcc ctgatttttc accaccccct gaccgcgaat ggtgagattg 6720
agaatataac ctttcattcc cagcggtcgg tcgataaaaa aatcgagata accgttggcc 6780
tcaatcggcg ttaaacccgc caccagatgg gcattaaacg agtatcccgg cagcagggga 6840
tcattttgcg cttcagccat acttttcata ctcccgccat tcagag 6886
<210> 21
<211> 7140
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: vector
<220>
<223> pAN620
<400> 21
tcggcggccg cttcgtcgac cgaaacagca gttataaggc atgaagctgt ccggtttttg 60
caaaagtggc tgtgactgta aaaagaaatc gaaaaagacc gttttgtgtg aaaacggtct 120
ttttgtttcc ttttaaccaa ctgccataac tcgaggccta cctagcttcc aagaaagata 180
tcctaacagc acaagagcgg aaagatgttt tgttctacat ccagaacaac ctctgctaaa 240
attcctgaaa aattttgcaa aaagttgttg actttatcta caaggtgtgg tataataatc 300
ttaacaacag caggacgctc tagattagaa aggaggattt aaatatgaga cagattactg 360
atatttcaca gctgaaagaa gccataaaac aataccattc agagggcaag tcaatcggat 420
ttgttccgac gatggggttt ctgcatgagg ggcatttaac cttagcagac aaagcaagac 480
aagaaaacga cgccgttatt atgagtattt ttgtgaatcc tgcacaattc ggccctaatg 540
aagattttga agcatatccg cgcgatattg agcgggatgc agctcttgca gaaaacgccg 600
gagtcgatat tctttttacg ccagatgctc atgatatgta tcccggtgaa aagaatgtca 660
cgattcatgt agaaagacgc acagacgtgt tatgcgggcg ctcaagagaa ggacattttg 720
acggggtcgc gatcgtactg acgaagcttt tcaatctagt caagccgact cgtgcctatt 780
tcggtttaaa agatgcgcag caggtagctg ttgttgatgg gttaatcagc gacttcttca 840
tggatattga attggttcct gtcgatacgg tcagagagga agacggctta gccaaaagct 900
ctcgcaatgt atacttaaca gctgaggaaa gaaaagaagc gcctaagctg tatcgggccc 960
ttcaaacaag tgcggaactt gtccaagccg gtgaaagaga tcctgaagcg gtgataaaag 1020
ctgcaaaaga tatcattgaa acgactagcg gaaccataga ctatgtagag ctttattcct 1080
atccggaact cgagcctgtg aatgaaattg ctggaaagat gattctcgct gttgcagttg 1140
ctttttcaaa agcgcgttta atagataata tcattattga tattcgtaga aaggaggtga 1200
attaatatgt atcgtacgat gatgagcggc aaacttcaca gggcaactgt tacggaagca 1260
aacctgaact atgtgggaag cattacaatt gatgaagatc tcattgatgc tgtgggaatg 1320
cttcctaatg aaaaagtaca aattgtgaat aataataatg gagcacgtct tgaaacgtat 1380
attattcctg gtaaacgggg aagcggcgtc atatgcttaa acggtgcagc cgcacgcctt 1440
gtgcaggaag gagataaggt cattattatt tcctacaaaa tgatgtctga tcaagaagcg 1500
gcaagccatg agccgaaagt ggctgttctg aatgatcaaa acaaaattga acaaatgctg 1560
gggaacgaac cagcccgtac aattttgtaa aggatcctgt tttggcggat gagagaagat 1620
tttcagcctg atacagatta aatcagaacg cagaagcggt ctgataaaac agaatttgcc 1680
tggcggcagt agcgcggtgg tcccacctga ccccatgccg aactcagaag tgaaacgccg 1740
tagcgccgat ggtagtgtgg ggtctcccca tgcgagagta gggaactgcc aggcatcaaa 1800
_g_
CA 02434518 2003-07-10
WO 02/057476 PCT/US02/01887
taaaacgaaa ggctcagtcg aaagactggg cctttcgttt tatctgttgt ttgtcggtga 1860
acgctctcct gagtaggaca aatccgccgg gagcggattt gaacgttgcg aagcaacggc 1920
ccggagggtg gcgggcagga cgcccgccat aaactgccag gcatcaaatt aagcagaagg 1980
ccatcctgac ggatggcctt tttgcgtttc tacaaactct tggtaccgag acgatcgtcc 2040
tctttgttgt agcccatcac ttttgctgaa gagtaggagc cgaaagtgac ggcgtattca 2100
ttgagcggca gctgagtcgc accgacagaa atcgcttctc ttgatgtgcc cggcgatccg 2160
actgtccagc cgttcggtcc gctgttgccg tttgaggtaa cagcgacaac gccttctgac 2220
atggcccagt caagcgctgt gcttgtcgcc cagtccgggt tgtttaaaga gtttccgaga 2280
gacaggttca tcacatctgc cccgtcctgc actgcacgtt ccacgcccgc gatgacgttt 2340
tccgttgtgc cgcttccgcc aggccctaac acacgataag caagaagtgt ggcatcaggc 2400
gctacgcctt taatcgttcc gtttgcagcc acagttccgg ctacgtgtgt gccatggtca 2460
gttgcctcgc ccctcggatc gccggttggt gtttcttttg gatcgtaatc attgtccaca 2520
aaatcgtatc ctttatattg tccaaagttt ttcttcagat ctgggtgatt gtattcaacc 2580
ccagtgtcaa taatcgccac cttgatgcct tttcctgtgt agcctaaatc ccatgcatcg 2640
tttgctccga tataaggcgc actgtcatcc atttgcggag atacggcgtc ttcggagatt 2700
gtggggaatt ctcatgtttg acagcttatc atgcaatagt tacccttatt atcaagataa 2760
gaaagaaaag gatttttcgc tacgctcaaa tcctttaaaa aaacacaaaa gaccacattt 2820
tttaatgtgg tctttattct tcaactaaag cacccattag ttcaacaaac gaaaattgga 2880
taaagtggga tatttttaaa atatatattt atgttacagt aatattgact tttaaaaaag 2940
gattgattct aatgaagaaa gcagacaagt aagcctccta aattcacttt agataaaaat 3000
ttaggaggca tatcaaatga actttaataa aattgattta gacaattgga agagaaaaga 3060
gatatttaat cattatttga accaacaaac gacttttagt ataaccacag aaattgatat 3120
tagtgtttta taccgaaaca taaaacaaga aggatataaa ttttaccctg catttatttt 3180
cttagtgaca agggtgataa actcaaatac agcttttaga actggttaca atagcgacgg 3240
agagttaggt tattgggata agttagagcc actttataca atttttgatg gtgtatctaa 3300
aacattctct ggtatttgga ctcctgtaaa gaatgacttc aaagagtttt atgatttata 3360
cctttctgat gtagagaaat ataatggttc ggggaaattg tttcccaaaa cacctatacc 3420
tgaaaatgct ttttctcttt ctattattcc atggacttca tttactgggt ttaacttaaa 3480
tatcaataat aatagtaatt accttctacc cattattaca gcaggaaaat tcattaataa 3540
aggtaattca atatatttac cgctatcttt acaggtacat cattctgttt gtgatggtta 3600
tcatgcagga ttgtttatga actctattca ggaattgtca gataggccta atgactggct 3660
tttataatat gagataatgc cgactgtact ttt tacagtc ggttttctaa tgtcactaac 3720
ctgccccgtt agttgaagaa cgaagcggcc gcaattcttg aagacgaaag ggcctcgtga 3780
tacgcctatt tttataggtt aatgtcatga taataatggt ttcttagacg tcaggtggca 3840
cttttcgggg aaatgtgcgc ggaaccccta tttgtttatt tttctaaata cattcaaata 3900
tgtatccgct catgagacaa taaccctgat aaatgcttca ataatattga aaaaggaaga 3960
gtatgagtat tcaacatttc cgtgtcgccc ttattccctt ttttgcggca ttttgccttc 4020
ctgtttttgc tcacccagaa acgctggtga aagtaaaaga tgctgaagat cagttgggtg 4080
cacgagtggg ttacatcgaa ctggatctca acagcggtaa gatccttgag agttttcgcc 4140
ccgaagaacg ttttccaatg atgagcactt ttaaagttct gctatgtggc gcggtattat 4200
cccgtattga cgccgggcaa gagcaactcg gtcgccgcat acactattct cagaatgact 4260
tggttgagta ctcaccagtc acagaaaagc atcttacgga tggcatgaca gtaagagaat 4320
tatgcagtgc tgccataacc atgagtgata acactgcggc caacttactt ctgacaacga 4380
tcggaggacc gaaggagcta accgcttttt tgcacaacat gggggatcat gtaactcgcc 4440
ttgatcgttg ggaaccggag ctgaatgaag ccataccaaa cgacgagcgt gacaccacga 4500
tgcctgcagc aatggcaaca acgttgcgca aactattaac tggcgaacta cttactctag 4560
cttcccggca acaattaata gactggatgg aggcggataa agttgcagga ccacttctgc 4620
gctcggccct tccggctggc tggtttattg ctgataaatc tggagccggt gagcgtgggt 4680
ctcgcggtat cattgcagca ctggggccag atggtaagcc ctcccgtatc gtagttatct 4740
acacgacggg gagtcaggca actatggatg aacgaaatag acagatcgct gagataggtg 4800
cctcactgat taagcattgg taactgtcag accaagttta ctcatatata ctttagattg 4860
atttaaaact tcatttttaa tttaaaagga tctaggtgaa gatccttttt gataatctca 4920
tgaccaaaat cccttaacgt gagttttcgt tccactgagc gtcagacccc gtagaaaaga 4980
tcaaaggatc ttcttgagat cctttttttc tgcgcgtaat ctgctgcttg caaacaaaaa 5040
aaccaccgct accagcggtg gtttgtttgc cggatcaaga gctaccaact ctttttccga 5100
aggtaactgg cttcagcaga gcgcagatac caaatactgt ccttctagtg tagccgtagt 5160
taggccacca cttcaagaac tctgtagcac cgcctacata cctcgctctg ctaatcctgt 5220
taccagtggc tgctgccagt ggcgataagt cgtgtcttac cgggttggac tcaagacgat 5280
agttaccgga taaggcgcag cggtcgggct gaacgggggg ttcgtgcaca cagcccagct 5340
tggagcgaac gacctacacc gaactgagat acctacagcg tgagctatga gaaagcgcca 5400
_9_
CA 02434518 2003-07-10
WO 02/057476 PCT/US02/01887
cgcttcccga agggagaaag gcggacaggt atccggtaag cggcagggtc ggaacaggag 5460
agcgcacgag ggagcttcca gggggaaacg cctggtatct ttatagtcct gtcgggtttc 5520
gccacctctg acttgagcgt cgatttttgt gatgctcgtc aggggggcgg agcctatgga 5580
aaaacgccag caacgcggcc tttttacggt tcctggcctt ttgctggcct tttgctcaca 5640
tgttctttcc tgcgttatcc cctgattctg tggataaccg tattaccgcc tttgagtgag 5700
ctgataccgc tcgccgcagc cgaacgaccg agcgcagcga gtcagtgagc gaggaagcgg 5760
aagagcgcct gatgcggtat tttctcctta cgcatctgtg cggtatttca caccgcatat 5820
ggtgcactct cagtacaatc tgctctgatg ccgcatagtt aagccagtat acactccgct 5880
atcgctacgt gactgggtca tggctgcgcc ccgacacccg ccaacacccg ctgacgcgcc 5940
ctgacgggct tgtctgctcc cggcatccgc ttacagacaa gctgtgaccg tctccgggag 6000
ctgcatgtgt cagaggtttt caccgtcatc accgaaacgc gcgaggcagc tgcggtaaag 6060
ctcatcagcg tggtcgtgaa gcgattcaca gatgtctgcc tgttcatccg cgtccagctc 6120
gttgagtttc tccagaagcg ttaatgtctg gcttctgata aagcgggcca tgttaagggc 6180
ggttttttcc tgtttggtca cttgatgcct ccgtgtaagg gggaatttct gttcatgggg 6240
gtaatgatac cgatgaaacg agagaggatg ctcacgatac gggttactga tgatgaacat 6300
gcccggttac tggaacgttg tgagggtaaa caactggcgg tatggatgcg gcgggaccag 6360
agaaaaatca ctcagggtca atgccagcgc ttcgttaata cagatgtagg tgttccacag 6420
ggtagccagc agcatcctgc gatgcagatc cggaacataa tggtgcaggg cgctgacttc 6480
cgcgtttcca gactttacga aacacggaaa ccgaagacca ttcatgttgt tgctcaggtc 6540
gcagacgttt tgcagcagca gtcgcttcac gttcgctcgc gtatcggtga ttcattctgc 6600
taaccagtaa ggcaaccccg ccagcctagc cgggtcctca acgacaggag cacgatcatg 6660
cgcacccgtg gccaggaccc aacgctgccc gagatgcgcc gcgtgcggct gctggagatg 6720
gcggacgcga tggatatgtt ctgccaaggg ttggtttgcg cattcacagt tctccgcaag 6780
aattgattgg ctccaattct tggagtggtg aatccgttag cgaggtgccg ccggcttcca 6840
ttcaggtcga ggtggcccgg ctccatgcac cgcgacgcaa cgcggggagg cagacaaggt 6900
atagggcggc gcctacaatc catgccaacc cgttccatgt gctcgccgag gcggcataaa 6960
tcgccgtgac gatcagcggt ccagtgatcg aagttaggct ggtaagagcc gcgagcgatc 7020
cttgaagctg tccctgatgg tcgtcatcta cctgcctgga cagcatggcc tgcaacgcgg 7080
gcatcccgat gccgccggaa gcgagaagaa tcataatggg gaaggccatc cagcctcgcg 7140
<210> 22
<211> 6725
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: vector
<220>
<223> pAN636
<400> 22
tcggcggccg cttcgtcgac cgaaacagca gttataaggc atgaagctgt ccggtttttg 60
caaaagtggc tgtgactgta aaaagaaatc gaaaaagacc gttttgtgtg aaaacggtct 120
ttttgtttcc ttttaaccaa ctgccataac tcgaggccta cctagcttcc aagaaagata 180
tcctaacagc acaagagcgg aaagatgttt tgttctacat ccagaacaac ctctgctaaa 240
attcctgaaa aattttgcaa aaagttgttg actttatcta caaggtgtgg tataataatc 300
ttaacaacag caggacgctc tagaaggagg agaaaacatg aaaacaaaac tggattttct 360
aaaaatgaag gagtctgaag aaccgattgt catgctgacc gcttatgatt atccggcagc 420
taaacttgct gaacaagcgg gagttgacat gattttagtc ggtgattcac ttggaatggt 480
cgtcctcggc cttgattcaa ctgtcggtgt gacagttgcg gacatgatcc atcatacaaa 540
agccgttaaa aggggtgcgc cgaatacctt tattgtgaca gatatgccgt ttatgtctta 600
tcacctgtct aaggaagata cgctgaaaaa tgcagcggct atcgttcagg aaagcggagc 660
tgacgcactg aagcttgagg gcggagaagg cgtgtttgaa tccattcgcg cattgacgct 720
tggaggcatt ccagtagtca gtcacttagg tttgacaccg cagtcagtcg gcgtactggg 780
cggctataaa gtacagggca aagacgaaca aagcgccaaa aaattaatag aagacagtat 840
aaaatgcgaa gaagcaggag ctatgatgct tgtgctggaa tgtgtgccgg cagaactcac 900
agccaaaatt gccgagacgc taagcatacc ggtcattgga atcggggctg gtgtgaaagc 960
ggacggacaa gttctcgttt atcatgatat tatcggccac ggtgttgaga gaacacctaa 1020
atttgtaaag caatatacgc gcattgatga aaccatcgaa acagcaatca gcggatatgt 1080
-10-
CA 02434518 2003-07-10
WO 02/057476 PCT/US02/01887
tcaggatgta agacatcgtg ctttccctga acaaaagcat tcctttcaaa tgaaccagac 1140
agtgcttgac ggcttgtacg ggggaaaata agggggggat cctgttttgg Cggatgagag 1200
aagattttca gcctgataca gattaaatca gaacgcagaa gcggtctgat aaaacagaat 1260
ttgcctggcg gcagtagcgc ggtggtccca cctgacccca tgccgaactc agaagtgaaa 1320
cgccgtagcg ccgatggtag tgtggggtct ccccatgcga gagtagggaa ctgccaggca 1380
tcaaataaaa cgaaaggctc agtcgaaaga ctgggccttt cgttttatct gttgtttgtc 1440
ggtgaacgct ctcctgagta ggacaaatcc gccgggagcg gatttgaacg ttgcgaagca 1500
acggcccgga gggtggcggg caggacgccc gccataaact gccaggcatc aaattaagca 1560
gaaggccatc ctgacggatg gcctttttgc gtttctacaa actcttggta ccgagacgat 1620
cgtcctcttt gttgtagccc atcacttttg ctgaagagta ggagccgaaa gtgacggcgt 1680
attcattgag cggcagctga gtcgcaccga cagaaatcgc ttctcttgat gtgcccggcg 1740
atccgactgt ccagccgttc ggtccgctgt tgccgtttga ggtaacagcg acaacgcctt 1800
ctgacatggc ccagtcaagc gctgtgcttg tcgcccagtc cgggttgttt aaagagtttc 1860
cgagagacag gttcatcaca tctgccccgt cctgcactgc acgttccacg cccgcgatga 1920
cgttttccgt tgtgccgctt ccgccaggcc ctaacacacg ataagcaaga agtgtggcat 19$0
caggcgctac gcctttaatc gttccgtttg cagccacagt tccggctacg tgtgtgccat 2040
ggtcagttgc ctcgcccctc ggatcgccgg ttggtgtttc ttttggatcg taatcattgt 2100
ccacaaaatc gtatccttta tattgtccaa agtttttctt cagatctggg tgattgtatt 2160
caaccccagt gtcaataatc gccaccttga tgccttttcc tgtgtagcct aaatcccatg 2220
catcgtttgc tccgatataa ggcgcactgt catccatttg cggagatacg gcgtcttcgg 2280
agattgtggg gaattctcat gtttgacagc ttatcatgca atagttaccc ttattatcaa 2340
gataagaaag aaaaggattt ttcgctacgc tcaaatcctt taaaaaaaca caaaagacca 2400
cattttttaa tgtggtcttt attcttcaac taaagcaccc attagttcaa caaacgaaaa 2460
ttggataaag tgggatattt ttaaaatata tatttatgtt acagtaatat tgacttttaa 2520
aaaaggattg attctaatga agaaagcaga caagtaagcc tcctaaattc actttagata 2580
aaaatttagg aggcatatca aatgaacttt aataaaattg atttagacaa ttggaagaga 2640
aaagagatat ttaatcatta tttgaaccaa caaacgactt ttagtataac cacagaaatt 2700
gatattagtg ttttataccg aaacataaaa caagaaggat ataaatttta ccctgcattt 2760
attttcttag tgacaagggt gataaactca aatacagctt ttagaactgg ttacaatagc 2820
gacggagagt taggttattg ggataagtta gagccacttt atacaatttt tgatggtgta 2880
tctaaaacat tctctggtat ttggactcct gtaaagaatg acttcaaaga gttttatgat 2940
ttataccttt ctgatgtaga gaaatataat ggttcgggga aattgtttcc caaaacacct 3000
atacctgaaa atgctttttc tctttctatt attccatgga cttcatttac tgggtttaac 3060
ttaaatatca ataataatag taattacctt ctacccatta ttacagcagg aaaattcatt 3120
aataaaggta attcaatata tttaccgcta tctttacagg tacatcattc tgtttgtgat 3180
ggttatcatg caggattgtt tatgaactct attcaggaat tgtcagatag gcctaatgac 3240
tggcttttat aatatgagat aatgccgact gtacttttta cagtcggttt tctaatgtca 3300
ctaacctgcc ccgttagttg aagaacgaag cggccgcaat tcttgaagac gaaagggcct 3360
cgtgatacgc ctatttttat aggttaatgt catgataata atggtttctt agacgtcagg 3420
tggcactttt cggggaaatg tgcgcggaac ccctatttgt ttatttttct aaatacattc 3480
aaatatgtat ccgctcatga gacaataacc ctgataaatg cttcaataat attgaaaaag 3540
gaagagtatg agtattcaac atttccgtgt cgcccttatt cccttttttg cggcattttg 3600
ccttcctgtt tttgctcacc cagaaacgct ggtgaaagta aaagatgctg aagatcagtt 3660
gggtgcacga gtgggttaca tcgaactgga tctcaacagc ggtaagatcc ttgagagttt 3720
tcgccccgaa gaacgttttc caatgatgag cacttttaaa gttctgctat gtggcgcggt 3780
attatcccgt attgacgccg ggcaagagca actcggtcgc cgcatacact attctcagaa 3840
tgacttggtt gagtactcac cagtcacaga aaagcatctt acggatggca tgacagtaag 3900
agaattatgc agtgctgcca taaccatgag tgataacact gcggccaact tacttctgac 3960
aacgatcgga ggaccgaagg agctaaccgc ttttttgcac aacatggggg atcatgtaac 4020
tcgccttgat cgttgggaac cggagctgaa tgaagccata ccaaacgacg agcgtgacac 4080
cacgatgcct gcagcaatgg caacaacgtt gcgcaaacta ttaactggcg aactacttac 4140
tctagcttcc cggcaacaat taatagactg gatggaggcg gataaagttg caggaccact 4200
tctgcgctcg gcccttccgg ctggctggtt tattgctgat aaatctggag ccggtgagcg 4260
tgggtctcgc ggtatcattg cagcactggg gccagatggt aagccctccc gtatcgtagt 4320
tatctacacg acggggagtc aggcaactat ggatgaacga aatagacaga tcgctgagat 4380
aggtgcctca ctgattaagc attggtaact gtcagaccaa gtttactcat atatacttta 4440
gattgattta aaacttcatt tttaatttaa aaggatctag gtgaagatcc tttttgataa 4500
tctcatgacc aaaatccctt aacgtgagtt ttcgttccac tgagcgtcag accccgtaga 4560
aaagatcaaa ggatcttctt gagatccttt ttttctgcgc gtaatctgct gcttgcaaac 4620
aaaaaaacca ccgctaccag cggtggtttg tttgccggat caagagctac caactctttt 4680
-11-
CA 02434518 2003-07-10
WO 02/057476 PCT/US02/01887
tccgaaggta actggcttca gcagagcgca gataccaaat actgtccttc tagtgtagcc 4740
gtagttaggc caccacttca agaactctgt agcaccgcct acatacctcg ctctgctaat 4800
cctgttacca gtggctgctg ccagtggcga taagtcgtgt cttaccgggt tggactcaag 4860
acgatagtta ccggataagg cgcagcggtc gggctgaacg gggggttcgt gcacacagcc 4920
cagcttggag cgaacgacct acaccgaact gagataccta cagcgtgagc tatgagaaag 4980
cgccacgctt cccgaaggga gaaaggcgga caggtatccg gtaagcggca gggtcggaac 5040
aggagagcgc acgagggagc ttccaggggg aaacgcctgg tatctttata gtcctgtcgg 5100
gtttcgccac ctctgacttg agcgtcgatt tttgtgatgc tcgtcagggg ggcggagcct 5160
atggaaaaac gccagcaacg cggccttttt acggttcctg gccttttgct ggccttttgc 5220
tcacatgttc tttcctgcgt tatcccctga ttctgtggat aaccgtatta ccgcctttga 5280
gtgagctgat accgctcgcc gcagccgaac gaccgagcgc agcgagtcag tgagcgagga 5340
agcggaagag cgcctgatgc ggtattttct ccttacgcat ctgtgcggta tttcacaccg 5400
catatggtgc actctcagta caatctgctc tgatgccgca tagttaagcc agtatacact 5460
ccgctatcgc tacgtgactg ggtcatggct gcgccccgac acccgccaac acccgctgac 5520
gcgccctgac gggcttgtct gctcccggca tccgcttaca gacaagctgt gaccgtctcc 5580
gggagctgca tgtgtcagag gttttcaccg tcatcaccga aacgcgcgag gcagctgcgg 5640
taaagctcat cagcgtggtc gtgaagcgat tcacagatgt ctgcctgttc atccgcgtcc 5700
agctcgttga gtttctccag aagcgttaat gtctggcttc tgataaagcg ggccatgtta 5760
agggcggttt tttcctgttt ggtcacttga tgcctccgtg taagggggaa tttctgttca 5820
tgggggtaat gataccgatg aaacgagaga ggatgctcac gatacgggtt actgatgatg 5880
aacatgcccg gttactggaa cgttgtgagg gtaaacaact ggcggtatgg atgcggcggg 5940
accagagaaa aatcactcag ggtcaatgcc agcgcttcgt taatacagat gtaggtgttc 6000
cacagggtag ccagcagcat cctgcgatgc agatccggaa cataatggtg cagggcgctg 6060
acttccgcgt ttccagactt tacgaaacac ggaaaccgaa gaccattcat gttgttgctc 6120
aggtcgcaga cgttttgcag cagcagtcgc ttcacgttcg ctcgcgtatc ggtgattcat 6180
tctgctaacc agtaaggcaa ccccgccagc ctagccgggt cctcaacgac aggagcacga 6240
tcatgcgcac ccgtggccag gacccaacgc tgcccgagat gcgccgcgtg cggctgctgg 6300
agatggcgga cgcgatggat atgttctgcc aagggttggt ttgcgcattc acagttctcc 6360
gcaagaattg attggctcca att cttggag tggtgaatcc gttagcgagg tgccgccggc 6420
ttccattcag gtcgaggtgg cccggctcca tgcaccgcga cgcaacgcgg ggaggcagac 6480
aaggtatagg gcggcgccta caatccatgc caacccgttc catgtgctcg ccgaggcggc 6540
ataaatcgcc gtgacgatca gcggtccagt gatcgaagtt aggctggtaa gagccgcgag 6600
cgatccttga agctgtccct gatggtcgtc atctacctgc ctggacagca tggcctgcaa 6660
cgcgggcatc ccgatgccgc cggaagcgag aagaatcata atggggaagg ccatccagcc 6720
tcgcg 6725
<210> 23
<211> 6806
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: vector
<220>
<223> pAN637
<400> 23
tcggcggccg cttcgtcgac cgaaacagca gttataaggc atgaagctgt ccggtttttg 60
caaaagtggc tgtgactgta aaaagaaatc gaaaaagacc gttttgtgtg aaaacggtct 120
ttttgtttcc ttttaaccaa ctgccataac tcgaggccta cctagcttcc aagaaagata 180
tcctaacagc acaagagcgg aaagatgttt tgttctacat ccagaacaac ctctgctaaa 240
attcctgaaa aattttgcaa aaagttgttg actttatcta caaggtgtgg tataataatc 300
ttaacaacag caggacgctc tagacaattg agatcttaag aaaggaggtg ttaattaatg 360
aagattggaa tcattggcgg aggctccgtt ggtcttttat gcgcctatta tttgtcactt 420
tatcacgacg tgactgttgt gacgaggcgg caagaacagg ctgcggccat tcagtctgaa 480
ggaatccggc tttataaagg cggggaggaa ttcagggctg attgcagtgc ggacacgagt 540
atcaattcgg actttgacct gcttgtcgtg acagtgaagc agcatcagct tcaatctgtt 600
ttttcgtcgc ttgaacgaat cgggaagacg aatatattat ttttgcaaaa cggcatgggg 660
catatccacg acctaaaaga ctggcacgtt ggccattcca tttatgttgg aatcgttgag 720
-12-
CA 02434518 2003-07-10
WO 02/057476 PCT/US02/01887
cacggagctg taagaaaatc ggatacagct gttgatcata caggcctagg tgcgataaaa 780
tggagcgcgt tcgacgatgc tgaaccagac cggctgaaca tcttgtttca gcataaccat 840
tcggattttc cgatttatta tgagacggat tggtaccgtc tgctgacggg caagctgatt 900
gtaaatgcgt gtattaatcc tttaactgcg ttattgcaag tgaaaaatgg agaactgctg 960
acaacgccag cttatctggc ttttatgaag ctggtatttc aggaggcatg ccgcatttta 1020
aaacttgaaa atgaagaaaa ggcttgggag cgggttcagg ccgtttgtgg gcaaacgaaa 1080
gagaatcgtt catcaatgct ggttgacgtc attggaggcc ggcagacgga agctgacgcc 1140
attatcggat acttattgaa ggaagcaagt cttcaaggtc ttgatgccgt ccacctagag 1200
tttttatatg gcagcatcaa agcattggag cgaaatacca acaaagtggt ttactaagga 1260
tcctgttttg gcggatgaga gaagattttc agcctgatac agattaaatc agaacgcaga 1320
agcggtctga taaaacagaa tttgcctggc ggcagtagcg cggtggtccc acctgacccc 1380
atgccgaact cagaagtgaa acgccgtagc gccgatggta gtgtggggtc tccccatgcg 1440
agagtaggga actgccaggc atcaaataaa acgaaaggct cagtcgaaag actgggcctt 1500
tcgttttatc tgttgtttgt cggtgaacgc tctcctgagt aggacaaatc cgccgggagc 1560
ggatttgaac gttgcgaagc aacggcccgg agggtggcgg gcaggacgcc cgccataaac 1620
tgccaggcat caaattaagc agaaggccat cctgacggat ggcctttttg cgtttctaca 1680
aactcttggt accgagacga tcgtcctctt tgttgtagcc catcactttt gctgaagagt 1740
aggagccgaa agtgacggcg tattcattga gcggcagctg agtcgcaccg acagaaatcg 1800
cttctcttga tgtgcccggc gatccgactg tccagccgtt cggtccgctg ttgccgtttg 1860
aggtaacagc gacaacgcct tctgacatgg cccagtcaag cgctgtgctt gtcgcccagt 1920
ccgggttgtt taaagagttt ccgagagaca ggttcatcac atctgccccg tcctgcactg 1980
cacgttccac gcccgcgatg acgttttccg ttgtgccgct tccgccaggc cctaacacac 2040
gataagcaag aagtgtggca tcaggcgcta cgcctttaat cgttccgttt gcagccacag 2100
ttccggctac gtgtgtgcca tggtcagttg cctcgcccct cggatcgccg gttggtgttt 2160
cttttggatc gtaatcattg tccacaaaat cgtatccttt atattgtcca aagtttttct 2220
tcagatctgg gtgattgtat tcaaccccag tgtcaataat cgccaccttg atgccttttc 2280
ctgtgtagcc taaatcccat gcatcgtttg ctccgatata aggcgcactg tcatccattt 2340
gcggagatac ggcgtcttcg gagattgtgg ggaattctca tgtttgacag cttatcatgc 2400
aatagttacc cttattatca agataagaaa gaaaaggatt tttcgctacg ctcaaatcct 2460
ttaaaaaaac acaaaagacc acatttttta atgtggtctt tattcttcaa ctaaagcacc 2520
cattagttca acaaacgaaa attggataaa gtgggatatt tttaaaatat atatttatgt 2580
tacagtaata ttgactttta aaaaaggatt gattctaatg aagaaagcag acaagtaagc 2640
ctcctaaatt cactttagat aaaaatttag gaggcatatc aaatgaactt taataaaatt 2700
gatttagaca attggaagag aaaagagata tttaatcatt atttgaacca acaaacgact 2760
tttagtataa ccacagaaat tgatattagt gttttatacc gaaacataaa acaagaagga 2820
tataaatttt accctgcatt tattttctta gtgacaaggg tgataaactc aaatacagct 2880
tttagaactg gttacaatag cgacggagag ttaggttatt gggataagtt agagccactt 2940
tatacaattt ttgatggtgt atctaaaaca ttctctggta tttggactcc tgtaaagaat 3000
gacttcaaag agttttatga tttatacctt tctgatgtag agaaatataa tggttcgggg 3060
aaattgtttc ccaaaacacc tatacctgaa aatgcttttt ctctttctat tattccatgg 3120
acttcattta ctgggtttaa cttaaatatc aataataata gtaattacct tctacccatt 3180
attacagcag gaaaattcat taataaaggt aattcaatat atttaccgct atctttacag 3240
gtacatcatt ctgtttgtga tggttatcat gcaggattgt ttatgaactc tattcaggaa 3300
ttgtcagata ggcctaatga ctggctttta taatatgaga taatgccgac tgtacttttt 3360
acagtcggtt ttctaatgtc actaacctgc cccgttagtt gaagaacgaa gcggccgcaa 3420
ttcttgaaga cgaaagggcc tcgtgatacg cctattttta taggttaatg tcatgataat 3480
aatggtttct tagacgtcag gtggcacttt tcggggaaat gtgcgcggaa cccctatttg 3540
tttatttttc taaatacatt caaatatgta tccgctcatg agacaataac cctgataaat 3600
gcttcaataa tattgaaaaa ggaagagtat gagtattcaa catttccgtg tcgcccttat 3660
tccctttttt gcggcatttt gccttcctgt ttttgctcac ccagaaacgc tggtgaaagt 3720
aaaagatgct gaagatcagt tgggtgcacg agtgggttac atcgaactgg atctcaacag 3780
cggtaagatc cttgagagtt ttcgccccga agaacgtttt ccaatgatga gcacttttaa 3840
agttctgcta tgtggcgcgg tattatcccg tattgacgcc gggcaagagc aactcggtcg 3900
ccgcatacac tattctcaga atgacttggt tgagtactca ccagtcacag aaaagcatct 3960
tacggatggc atgacagtaa gagaattatg cagtgctgcc ataaccatga gtgataacac 4020
tgcggccaac ttacttctga caacgatcgg aggaccgaag gagctaaccg cttttttgca 4080
caacatgggg gatcatgtaa ctcgccttga tcgttgggaa ccggagctga atgaagccat 4140
accaaacgac gagcgtgaca ccacgatgcc tgcagcaatg gcaacaacgt tgcgcaaact 4200
attaactggc gaactactta ctctagcttc ccggcaacaa ttaatagact ggatggaggc 4260
ggataaagtt gcaggaccac ttctgcgctc-ggcccttccg gctggctggt ttattgctga 4320
-13-
CA 02434518 2003-07-10
WO 02/057476 PCT/US02/01887
taaatctgga gccggtgagc gtgggtctcg cggtatcatt gcagcactgg ggccagatgg 4380
taagccctcc cgtatcgtag ttatctacac gacggggagt caggcaacta tggatgaacg 4440
aaatagacag atcgctgaga taggtgcctc actgattaag cattggtaac tgtcagacca 4500
agtttactca tatatacttt agattgattt aaaacttcat ttttaattta aaaggatcta 4560
ggtgaagatc ctttttgata atctcatgac caaaatccct taacgtgagt tttcgttcca 4620
ctgagcgtca gaccccgtag aaaagatcaa aggatcttct tgagatcctt tttttctgcg 4680
cgtaatctgc tgcttgcaaa caaaaaaacc accgctacca gcggtggttt gtttgccgga 4740
tcaagagcta ccaactcttt ttccgaaggt aactggcttc agcagagcgc agataccaaa 4800
tactgtcctt ctagtgtagc cgtagttagg ccaccacttc aagaactctg tagcaccgcc 4860
tacatacctc gctctgctaa tcctgttacc agtggctgct gccagtggcg ataagtcgtg 4920
tcttaccggg ttggactcaa gacgatagtt accggataag gcgcagcggt cgggctgaac 4980
ggggggttcg tgcacacagc ccagcttgga gcgaacgacc tacaccgaac tgagatacct 5040
acagcgtgag ctatgagaaa gcgccacgct tcccgaaggg agaaaggcgg acaggtatcc 5100
ggtaagcggc agggtcggaa caggagagcg cacgagggag cttccagggg gaaacgcctg 5160
gtatctttat agtcctgtcg ggtttcgcca cctctgactt gagcgtcgat ttttgtgatg 5220
ctcgtcaggg gggcggagcc tatggaaaaa cgccagcaac gcggcctttt tacggttcct 5280
ggccttttgc tggccttttg ctcacatgtt ctttcctgcg ttatcccctg attctgtgga 5340
taaccgtatt accgcctttg agtgagctga taccgctcgc cgcagccgaa cgaccgagcg 5400
cagcgagtca gtgagcgagg aagcggaaga gcgcctgatg cggtattttc tccttacgca 5460
tctgtgcggt atttcacacc gcatatggtg cactctcagt acaatctgct ctgatgccgc 5520
atagttaagc cagtatacac tccgctatcg ctacgtgact gggtcatggc tgcgccccga 5580
cacccgccaa cacccgctga cgcgccctga cgggcttgtc tgctcccggc atccgcttac 5640
agacaagctg tgaccgtctc cgggagctgc atgtgtcaga ggttttcacc gtcatcaccg 5700
aaacgcgcga ggcagctgcg gtaaagctca tcagcgtggt cgtgaagcga ttcacagatg 5760
tctgcctgtt catccgcgtc cagctcgttg agtttctcca gaagcgttaa tgtctggctt 5820
ctgataaagc gggccatgtt aagggcggtt ttttcctgtt tggtcacttg atgcctccgt 5880
gtaaggggga atttctgttc atgggggtaa tgataccgat gaaacgagag aggatgctca 5940
cgatacgggt tactgatgat gaacatgccc ggttactgga acgttgtgag ggtaaacaac 6000
tggcggtatg gatgcggcgg gaccagagaa aaatcact ca gggtcaatgc cagcgcttcg 6060
ttaatacaga tgtaggtgtt ccacagggta gccagcagca tcctgcgatg cagatccgga 6120
acataatggt gcagggcgct gacttccgcg tttccagact ttacgaaaca cggaaaccga 6180
agaccattca tgttgttgct caggtcgcag acgttttgca gcagcagtcg cttcacgttc 6240
gctcgcgtat cggtgattca ttctgctaac cagtaaggca accccgccag cctagccggg 6300
tcctcaacga caggagcacg atcatgcgca cccgtggcca ggacccaacg ctgcccgaga 6360
tgcgccgcgt gcggctgctg gagatggcgg acgcgatgga tatgttctgc caagggttgg 6420
tttgcgcatt cacagttctc cgcaagaatt gattggctcc aattcttgga gtggtgaatc 6480
cgttagcgag gtgccgccgg cttccattca ggtcgaggtg gcccggctcc atgcaccgcg 6540
acgcaacgcg gggaggcaga caaggtatag ggcggcgcct acaatccatg ccaacccgtt 6600
ccatgtgctc gccgaggcgg cataaatcgc cgtgacgatc agcggtccag tgatcgaagt 6660
taggctggta agagccgcga gcgatccttg aagctgtccc tgatggtcgt catctacctg 6720
cctggacagc atggcctgca acgcgggcat cccgatgccg ccggaagcga gaagaatcat 6780
aatggggaag gccatccagc ctcgcg 6806
<210> 24
<211> 3867
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: vector
<400> 24
aagctttctc aagaagcgaa caagaaaaaa gaagagcaga ttaaacagct tcaagagttt 60
gtcgctagat tcagcgccaa tgcgtctaaa tctaagcagg ctacatcaag aaagaaactt 120
ctcgaaaaaa tcacgctgga tgatattaaa ccgtcttccc gccgctatcc ttatgttaac 180
ttcacgccgg aacgggaaat cggaaatgat gttcttcgcg tggaaggctt aacaaaaaca 240
atcgatggcg taaaggtgct tgacaatgtc agctttatta tgaatcgaga agataaaatt 300
gctttcactg gccgaaatga acttgctgtt actacgctgt ttaaaatcat ttccggggaa 360
atggaagctg acagcggaac gtttaaatgg ggtgttacca catctcaagc gtattttcca 420
aaagacaaca gcgaatattt cgaaggcagt gatctgaacc ttgtagactg gcttcgccaa 480
-14-
CA 02434518 2003-07-10
WO 02/057476 PCT/US02/01887
tattctccgc acgaccaaag tgagagcttt ttacgcggtt tcttaggacg catgctgttc 540
tctggagaag aagtccacaa aaaagcaaat gtactttccg ggggagaaaa ggtccgctgt 600
atgctgtcga aagcgatgct ttctggcgcc aatattttaa ttttggatga gccgaccaac 660
catttagacc tagagtccat tacagcgctc aataacggct taatcagctt taaaggcgct 720
atgctgttta cttcccatga ccatcagttt gtgcagacca ttgccaacag aattatagaa 780
attacaccta acggcatcgt cgataagcaa atgagctatg acgagttcct tgaaaatgct 840
gatgtgcaga aaaaattgac tgaactatac gccgaataaa aaagcagaga tttctctgct 900
ttttttgata cctaaatgtg aaaggagatc acaacatgaa atttttggtt gtcggagcag 960
gtggagtagg cgggtatatt ggcggacggc tttcggagaa aggaaatgat gtgacatttc 1020
tcgtgcgcca aaaacgagct gagcagctta aaaaaaccgg gcttgtcatc catagtgaaa 1080
aagggaatgt atcatttcag cccgaactaa tcagtgccgg agaaacaggg caatttgatg 1140
tcgttatcat tgcttctaaa gcatactcgc ttggtcaagt gatagaggat gtcaaaccat 1200
ttatccatca agaatctgtc attatccctt ttttaaatgg gtaccgccac tatgagcagc 1260
tatttgcggc attttcaaaa gaacaggtgc tgggcggcct gtgttttata gaaagtgctt 1320
tagacaacaa aggagaaatt catcatacga gcgcatcgca tcgttttgta tttggagaat 1380
ggaacggcga gcgtacggag cggataagag cgcttgaaga ggcattttca ggtgtgaagg 1440
ctgaagtcat cattagcggg catatcgaga agatcccctg cagcaatagt tacccttatt 1500
atcaagataa gaaagaaaag gatttttcgc tacgctcaaa tcctttaaaa aaacacaaaa 1560
gaccacattt tttaatgtgg tctttattct tcaactaaag cacccattag ttcaacaaac 1620
gaaaattgga taaagtggga tatttttaaa atatatattt atgttacagt aatattgact 1680
tttaaaaaag gattgattct aatgaagaaa gcagacaagt aagcctccta aattcacttt 1740
agataaaaat ttaggaggca tatcaaatga actttaataa aattgattta gacaattgga 1800
agagaaaaga gatatttaat cattatttga accaacaaac gacttttagt ataaccacag 1860
aaattgatat tagtgtttta taccgaaaca taaaacaaga aggatataaa ttttaccctg 1920
catttatttt cttagtgaca agggtgataa actcaaatac agcttttaga actggttaca 1980
atagcgacgg agagttaggt tattgggata agttagagcc actttataca atttttgatg 2040
gtgtatctaa aacattctct ggtatttgga ctcctgtaaa gaatgacttc aaagagtttt 2100
atgatttata cctttctgat gtagagaaat ataatggttc ggggaaattg tttcccaaaa 2160
cacctatacc tgaaaatgct ttttctcttt ctattattcc atggacttca tttactgggt 2220
ttaacttaaa tatcaataat aatagtaatt accttctacc cattattaca gcaggaaaat 2280
tcattaataa aggtaattca atatatttac cgctatcttt acaggtacat cattctgttt 2340
gtgatggtta tcatgcagga ttgtttatga actctattca ggaattgtca gataggccta 2400
atgactggct tttataatat gagataatgc cgactgtact ttttacagtc ggttttctaa 2460
tgtcactaac ctgccccgtt agttgaagaa ggtttttata tt acagctcc cgggagatct 2520
gggatcacta gtccaaacga cagaaggcga ccacctgcat ggatttttga ttgaaaaagc 2580
aaaacgttta tctctcgctg caccagtatt agaaaccgtt tatgcgaatc tgcaaatgta 2640
tgaagcagaa aaataaaaaa aggaggcgga aaagcctcct tttatttact taaaaagccc 2700
aatttccgtt tctgaagata ggctctcttt tcccgtctgc cgtaattccg tcaatattca 2760
tatccttaga accgatcata aagtccacgt gtgtaatgct ttcatttagg ccttctttga 2820
caagctcttc acgagacatc tgctttccgc cttcaatatt aaaggcatag gcgcttccga 2880
tcgccaaatg atttgacgcg ttttcatcaa acagcgtgtt atagaaaaga atgtttgatt 2940
gtgatatagg cgaatcgtaa ggaacaagtg ccacttcacc taaatagtga gaaccttcat 3000
ctgtttccac cagttctttt aaaatatcct cacctttttc agctttaatg tcgactatac 3060
ggccattttc aaacgtcagg gtgaaatttt caataatatt tccgccgtag cttaatggtt 3120
ttgtgcttga taccactccg tcaaccccgt ctttttgcgg cagcgtgaac acttcttctg 3180
tcggcatatt ggccataaac tcatggccac tttcattcac gcttcccgca cctgcccaaa 3240
catgcttcct aggcagctta attgttagat cagttccttc tgcttgataa tgtaaggcag 3300
cgtaatgtct ctcgttcaaa tggtcaactt tttcatgaag attttggtca tgattgatcc 3360
acgcctgaac cgggttgtct tcatttacgc gcgtcgcttt aaaaatttct tcccacagaa 3420
ggtggatcgc ttcctcctct gatttgccag gaaacacctt gtgagcccag cctgctgatg 3480
ccgcacctac gacagtccag ctgactttgt ctgattgaat atattgtctg tatgtatgta 3540
atgctttgcc tgctgctttt tggaatgccg caatccgttt ggaatctata ccttttagca 3600
agtctgggtt cgacgacaca acagaaatga aagcagctcc atttttggca agctcttctc 3660
tgccttttgc ttcccattca ggatattctt caaatgcttc aaacggcgca agttcgtatt 3720
ttaatttggc gacttcgtca tcctgccaat tcacggtgac gttttttgcg cccttttcat 3780
atgcgtgttt tacaattaaa cggacaaaat cccgaacgtc tgttgaagca tttacgacta 3840
catactggcc tttttggaca ttaacgc 3g67
-15-
CA 02434518 2003-07-10
WO 02/057476 PCT/US02/01887
<210> 25
<211> 8704
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: vector
<220>
<223> pAN238
<400> 25
gcggccgctt cgtcgaccga aacagcagtt ataaggcatg aagctgtccg gtttttgcaa 60
aagtggctgt gactgtaaaa agaaatcgaa aaagaccgtt ttgtgtgaaa acggtctttt 120
tgtttccttt taaccaactg ccataactcg aggcctacct agcttccaag aaagatatcc 180
taacagcaca agagcggaaa gatgttttgt tctacatcca gaacaacctc tgctaaaatt 240
cctgaaaaat tttgcaaaaa gttgttgact ttatctacaa ggtgtggtat aataatctta 300
acaacagcag gacgctctag aggaggagac taacatgaaa tttttggttg tcggagcagg 360
tggagtaggc gggtatattg gcggacggct ttcggagaaa ggaaatgatg tgacatttct 420
cgtgcgccaa aaacgagctg agcagcttaa aaaaaccggg cttgtcatcc atagtgaaaa 480
agggaatgta tcatttcagc ccgaactaat cagtgccgga gaaacagggc aatttgatgt 540
cgttatcatt gcttctaaag catactcgct tggtcaagtg atagaggatg tcaaaccatt 600
tatccatcaa gaatctgtca ttatcccttt tttaaatggg taccgccact atgagcagct 660
atttgcggca ttttcaaaag aacaggtgct gggcggcctg tgttttatag aaagtgcttt 720
agacaacaaa ggagaaattc atcatacgag cgcatcgcat cgttttgtat ttggagaatg 780
gaacggcgag cgtacggagc ggataagagc gcttgaagag gcattttcag gtgtgaaggc 840
tgaagtcatc attagcgggc atatcgagaa ggacatttgg aaaaagtatc tctttattgc 900
agcgcaagcg gggatcacaa cgttatttca acgaccgctt ggcccaatcc tcgccacaga 960
agccggacgt cacacggccc aaactcttat tggggaaatt tgcactgttt tacgaaaaga 1020
aggtgttccg gctgatccgg ctcttgagga agagagcttt cgtacgatga ccagcatgtc 1080
ttaccatatg aagtcctcca tgcttcggga tatggaaaac ggccaaacga cagaaggcga 1140
ccacctgcat ggatttttga ttgaaaaagc aaaacgttta tctctcgctg caccagtatt 1200
agaaaccgtt tatgcgaatc tgcaaatgta tgaagcagaa aaataaaaaa aggaggcgga 1260
aaagcctcct tttatttact taaaaagccc aatttccgtt tctgaagata ggctctcttt 1320
tcccgtctgc cgggatcctg ttttggcgga tgagagaaga ttttcagcct gatacagatt 1380
aaatcagaac gcagaagcgg tctgataaaa cagaatttgc ctggcggcag tagcgcggtg 1440
gtcccacctg accccatgcc gaactcagaa'gtgaaacgcc gtagcgccga tggtagtgtg 1500
gggtctcccc atgcgagagt agggaactgc caggcatcaa ataaaacgaa aggctcagtc 1560
gaaagactgg gcctttcgtt ttatctgttg tttgtcggtg aacgctctcc tgagtaggac 1620
aaatccgccg ggagcggatt tgaacgttgc gaagcaacgg cccggagggt ggcgggcagg 1680
acgcccgcca taaactgcca ggcatcaaat taagcagaag gccatcctga cggatggcct 1740
ttttgcgttt ctacaaactc ttggtaccca gaaaaagcgg caaaagcggc tgttaaaaaa 1800
gcgaaatcga.agaagctgtc tgccgctaag acggaatatc aaaagcgttc tgctgttgtg 1860
tcatctttaa aagtcacagc cgatgaatcc cagcaagatg tcctaaaata cttgaacacc 1920
cagaaagata aaggaaatgc agaccaaatt cattcttatt atgtggtgaa cgggattgct 1980
gttcatgcct caaaagaggt tatggaaaaa gtggtgcagt ttcccgaagt ggaaaaggtg 2040
cttcctaatg agaaacggca gctttttaag tcatcctccc catttaatat gaaaaaagca 2100
cagaaagcta ttaaagcaac tgacggtgtg gaatggaatg tagaccaaat cgatgcccca 2160
aaagcttggg cacttggata tgatggaact ggcacggttg ttgcgtccat tgataccggg 2220
gtggaatgga atcatccggc attaaaagag aaatatcgcg gatataatcc ggaaaatcct 2280
aatgagcctg aaaatgaaat gaactggtat gatgccgtag caggcgaggc aagcccttat 2340
gatgatttgg ctcatggaac ccacgtgaca ggcacgatgg tgggctctga acctgatgga 2400
acaaatcaaa tcggtgtagc acctggcgca aaatggattg ctgttaaagc gttctctgaa 2460
gatggcggca ctgatgctga cattttggaa gctggtgaat gggttttagc accaaaggac 2520
gcggaaggaa atccccaccc ggaaatggct cctgatgttg tcaataactc atggggaggg 2580
ggctctggac ttgatgaatg gtacagagac atggtcaatg cctggcgttc ggccgatatt 2640
ttccctgagt tttcagcggg gaatacggat ctctttattc ccggcgggcc tggttctatc 2700
gcaaatccgg caaactatcc agaatcgttt gcaactggag cgactgagaa ttccaattcc 2760
ccatggagag aaaagaaaat cgctaatgtt gattactttg aacttctgca tattcttgaa 2820
tttaaaaagg ctgaaagagt aaaagattgt gctgaaatat tagagtataa acaaaatcgt 2880
-16-
CA 02434518 2003-07-10
WO 02/057476 PCT/US02/01887
gaaacaggcg aaagaaagtt gtatcgagtg tggttttgta aatccaggct ttgtccaatg 2940
tgcaactgga ggagagcaat gaaacatggc attcagtcac aaaaggttgt tgctgaagtt 3000
attaaacaaa agccaacagt tcgttggttg tttctcacat taacagttaa aaatgtttat 3060
gatggcgaag aattaaataa gagtttgtca gatatggctc aaggatttcg ccgaatgatg 3120
caatataaaa aaattaataa aaatcttgtt ggttttatgc gtgcaacgga agtgacaata 3180
aataataaag ataattctta taatcagcac atgcatgtat tggtatgtgt ggaaccaact 3240
tattttaaga atacagaaaa ctacgtgaat caaaaacaat ggattcaatt ttggaaaaag 3300
gcaatgaaat tagactatga tccaaatgta aaagttcaaa tgattcgacc gaaaaataaa 3360
tataaatcgg atatacaatc ggcaattgac gaaactgcaa aatatcctgt aaaggatacg 3420
gattttatga ccgatgatga agaaaagaat ttgaaacgtt tgtctgattt ggaggaaggt 3480
ttacaccgta aaaggttaat ctcctatggt ggtttgttaa aagaaataca taaaaaatta 3540
aaccttgatg acacagaaga aggcgatttg attcatacag atgatgacga aaaagccgat 3600
gaagatggat tttctattat tgcaatgtgg aattgggaac ggaaaaatta ttttattaaa 3660
gagtagttca acaaacgggc catattgttg tataagtgat gaaatactga atttaaaact 3720
tagtttatat gtggtaaaat gttttaatca agtttaggag gaattaatta tgaagtgtaa 3780
tgaatgtaac agggttcaat taaaagaggg aagcgtatca ttaaccctat aaactacgtc 3840
tgccctcatt attggagggt gaaatgtgaa tacatcctat tcacaatcga atttacgaca 3900
caaccaaatt ttaatttggc tttgcatttt atcttttttt agcgtattaa atgaaatggt 3960
tttgaacgtc tcattacctg atattgcaaa tgattttaat aaaccacctg cgagtacaaa 4020
ctgggtgaac acagccttta tgttaacctt ttccattgga acagctgtat atggaaagct 4080
atctgatcaa ttaggcatca aaaggttact cctatttgga attataataa attgtttcgg 4140
gtcggtaatt gggtttgttg gccattcttt cttttcctta cttattatgg ctcgttttat 4200
tcaaggggct ggtgcagctg catttccagc actcgtaatg gttgtagttg cgcgctatat 4260
tccaaaggaa aataggggta aagcatttgg tcttattgga tcgatagtag ccatgggaga 4320
aggagtcggt ccagcgattg gtggaatgat agcccattat attcattggt cctatcttct 4380
actcattcct atgataacaa ttatcactgt tccgtttctt atgaaattat taaagaaaga 4440
agtaaggata aaaggtcatt ttgatatcaa aggaattata ctaatgtctg taggcattgt 4500
attttttatg ttgtttacaa catcatatag catttctttt cttatcgtta gcgtgctgtc 4560
attcctgata tttgtaaaac atatcaggaa agtaacagat ccttttgttg atcccggatt 4620
agggaaaaat atacctttta tgattggagt tctttgtggg ggaattatat ttggaacagt 4680
agcagggttt gtctctatgg ttccttatat gatgaaagat gttcaccagc taagtactgc 4740
cgaaatcgga agtgtaatta ttttccctgg aacaatgagt gtcattattt tcggctacat 4800
tggtgggata cttgttgata gaagaggtcc tttatacgtg ttaaacatcg gagttacatt 4860
tctttctgtt agctttttaa ctgcttcctt tcttttagaa acaacatcat ggttcat gac 4920
aattataatc gtatttgttt taggtgggct ttcgttcacc aaaacagtta tatcaacaat 4980
tgtttcaagt agcttgaaac agcaggaagc tggtgctgga atgagtttgc ttaactttac 5040
cagcttttta tcagagggaa caggtattgc aattgtaggt ggtttattat ccataccctt 5100
acttgatcaa aggttgttac ctatggaagt tgatcagtca acttatctgt atagtaattt 5160
gttattactt ttttcaggaa tcattgtcat tagttggctg gttaccttga atgtatataa 5220
acattctcaa agggatttct aaatcgttaa gggatcaact ttgggagaga gttcaaaatt 5280
gatccttttt ttataacagt tcgaagcggc cgcaattctt gaagacgaaa gggcctcgtg 5340
atacgcctat ttttataggt taatgtcatg ataataatgg tttcttagac gtcaggtggc 5400
acttttcggg gaaatgtgcg cggaacccct atttgtttat ttttctaaat acattcaaat 5460
atgtatccgc tcatgagaca ataaccctga taaatgcttc aataatattg aaaaaggaag 5520
agtatgagta ttcaacattt ccgtgtcgcc cttattccct tttttgcggc attttgcctt 5580
cctgtttttg ctcacccaga aacgctggtg aaagtaaaag atgctgaaga tcagttgggt 5640
gcacgagtgg gttacatcga actggatctc aacagcggta agatccttga gagttttcgc 5700
cccgaagaac gttttccaat gatgagcact tttaaagttc tgctatgtgg cgcggtatta 5760
tcccgtattg acgccgggca agagcaactc ggtcgccgca tacactattc tcagaatgac 5820
ttggttgagt actcaccagt cacagaaaag catcttacgg atggcatgac agtaagagaa 5880
ttatgcagtg ctgccataac catgagtgat aacactgcgg ccaacttact tctgacaacg 5940
atcggaggac cgaaggagct aaccgctttt ttgcacaaca tgggggatca tgtaactcgc 6000
cttgatcgtt gggaaccgga gctgaatgaa gccataccaa acgacgagcg tgacaccacg 6060
atgcctgcag caatggcaac aacgttgcgc aaactattaa ctggcgaact acttactcta 6120
gcttcccggc aacaattaat agactggatg gaggcggata aagttgcagg accacttctg 6180
cgctcggccc ttccggctgg ctggtttatt gctgataaat ctggagccgg tgagcgtggg 6240
tctcgcggta tcattgcagc actggggcca gatggtaagc cctcccgtat cgtagttatc 6300
tacacgacgg ggagtcaggc aactatggat gaacgaaata gacagatcgc tgagataggt 6360
gcctcactga ttaagcattg gtaactgtca gaccaagttt actcatatat actttagatt 6420
gatttaaaac ttcattttta atttaaaagg atctaggtga agatcctttt tgataatctc 6480
-17-
CA 02434518 2003-07-10
WO 02/057476 PCT/US02/01887
atgaccaaaa tcccttaacg tgagttttcg ttccactgag cgtcagaccc cgtagaaaag 6540
atcaaaggat cttcttgaga tccttttttt ctgcgcgtaa tctgctgctt gcaaacaaaa 6600
aaaccaccgc taccagcggt ggtttgtttg ccggatcaag agctaccaac tctttttccg 6660
aaggtaactg gcttcagcag agcgcagata ccaaatactg tccttctagt gtagccgtag 6720
ttaggccacc acttcaagaa ctctgtagca ccgcctacat acctcgctct gctaatcctg 6780
ttaccagtgg ctgctgccag tggcgataag tcgtgtctta ccgggttgga ctcaagacga 6840
tagttaccgg ataaggcgca gcggtcgggc tgaacggggg gttcgtgcac acagcccagc 6900
ttggagcgaa cgacctacac cgaactgaga tacctacagc gtgagctatg agaaagcgcc 6960
acgcttcccg aagggagaaa ggcggacagg tatccggtaa gcggcagggt cggaacagga 7020
gagcgcacga gggagcttcc agggggaaac gcctggtatc tttatagtcc tgtcgggttt 7080
cgccacctct gacttgagcg tcgatttttg tgatgctcgt caggggggcg gagcctatgg 7140
aaaaacgcca gcaacgcggc ctttttacgg ttcctggcct tttgctggcc ttttgctcac 7200
atgttctttc ctgcgttatc ccctgattct gtggataacc gtattaccgc ctttgagtga 7260
gctgataccg ctcgccgcag ccgaacgacc gagcgcagcg agtcagtgag cgaggaagcg 7320
gaagagcgcc tgatgcggta ttttctcctt acgcatctgt gcggtatttc acaccgcata 7380
tggtgcactc tcagtacaat ctgctctgat gccgcatagt taagccagta tacactccgc 7440
tatcgctacg tgactgggtc atggctgcgc cccgacaccc gccaacaccc gctgacgcgc 7500
cctgacgggc ttgtctgctc ccggcatccg cttacagaca agctgtgacc gtctccggga 7560
gctgcatgtg tcagaggttt tcaccgtcat caccgaaacg cgcgaggcag ctgcggtaaa 7620
gctcatcagc gtggtcgtga agcgattcac agatgtctgc ctgttcatcc gcgtccagct 7680
cgttgagttt ctccagaagc gttaatgtct ggcttctgat aaagcgggcc atgttaaggg 7740
cggttttttc ctgtttggtc acttgatgcc tccgtgtaag ggggaatttc tgttcatggg 7800
ggtaatgata ccgatgaaac gagagaggat gctcacgata cgggttactg atgatgaaca 7860
tgcccggtta ctggaacgtt gtgagggtaa acaactggcg gtatggatgc ggcgggacca 7920
gagaaaaatc actcagggtc aatgccagcg cttcgttaat acagatgtag gtgttccaca 7980
gggtagccag cagcatcctg cgatgcagat ccggaacata atggtgcagg gcgctgactt 8040
ccgcgtttcc agactttacg aaacacggaa accgaagacc attcatgttg ttgctcaggt 8100
cgcagacgtt ttgcagcagc agtcgcttca cgttcgctcg cgtatcggtg attcattctg 8160
ctaaccagta aggcaacccc gccagcctag ccgggtcctc aacgacagga gcacgatcat 8220
gcgcacccgt ggccaggacc caacgctgcc cgagatgcgc cgcgtgcggc tgctggagat 8280
ggcggacgcg atggatatgt tctgccaagg gttggtttgc gcattcacag ttctccgcaa 8340
gaattgattg gctccaattc ttggagtggt gaatccgtta gcgaggtgcc gccggcttcc 8400
attcaggtcg aggtggcccg gctccatgca ccgcgacgca acgcggggag gcagacaagg 8460
tatagggcgg cgcctacaat ccatgccaac ccgttccatg tgctcgccga ggcggcataa 8520
atcgccgtga cgatcagcgg tccagtgatc gaagttaggc tggtaagagc cgcgagcgat 8580
ccttgaagct gtccctgatg gtcgtcatct acctgcctgg acagcat ggc ct gcaacgcg 8640
ggcatcccga tgccgccgga agcgagaaga atcataatgg ggaaggccat ccagcctcgc 8700
gtcg 8704
-18-
