Note: Descriptions are shown in the official language in which they were submitted.
CA 02442346 2003-09-26
WO 02/079231
PCT/US02/09681
- 1 -
NUCLEIC ACIDS ENCODING ISAV POLYPEPTIDES
FIELD
This invention relates to Infectious Salmon Anemia Virus (ISAV), more
specifically to ISAV nucleic acid sequences and the peptides these nucleic
acids
encode. This invention also relates to the use of ISAV peptides in producing
an
immune response in fish.
BACKGROUND
Global aquaculture production is estimated at 39.4 million tons annually, is
worth $52.5 billion (US), and contributes over 20% of the total fish harvest.
Although the United States contributes only 2% of global production, the
aquaculture industry in this country is gaining momentum and importance. For
example, farm-raised salmon are a prominent industry in the Pacific Northwest
and
Maine.
As the natural fisheries provided by the open seas decline globally, and the
world's population is projected to grow to 8 billion people by 2025, cultured
finfish
products will be in increasing demand as an important protein source. Some of
the
factors that must be successfully accommodated to sustain the economic
viability
and increase the productivity of finfish culture include maintaining adequate
culture
facilities, complying with regulatory and environmental requirements and
countering
the many infectious pathogens and diseases that can threaten farmed
populations of
aquatic animals. Of these variables, the economic impact of disease on
cultured
finfish operations has become increasingly important. One of the primary means
for
raising finfish culture efficiency is through the development of reliable
treatments
against infectious pathogens and thus improve the overall health of farmed
species.
Infectious salmon anemia (ISA), formerly called Hemorrhagic Kidney
Syndrome (HKS), has caused massive economic losses in the Atlantic salmon
farming industry in Norway, Atlantic Canada, and Scotland. Mortality from ISA
disease is variable, ranging from 10% to more than 50%. Clinical signs of the
disease are apparent in Atlantic salmon, but other salmonids can act as non-
symptomatic reservoirs for the virus. The pathological changes associated with
ISA
CA 02442346 2003-09-26
WO 02/079231 PCT/US02/09681
- 2 -
are characterized by severe anemia, leukopenia, ascites and hemorrhaging of
internal
organs with subsequent necrosis of hepatocytes and renal interstitial cells.
The
infectious agent is an enveloped virus (ISAV) which replicates in endothelial
cells in
vivo and buds from the cell surface. The virus has a single-stranded RNA
genome
consisting of 8 segments with negative polarity, and the structural,
morphological,
and physiochemical properties of the virus suggest that ISAV is related to
members
of the Orthomyxoviridae family (see, e.g., Falk, et al., J. Virol. 71:9016-23
(1997)).
ISA originally appeared in Norway in 1984 (Thorud and Djubvik, 1988). In
1996 and 1998, the disease was diagnosed on fish farms in Atlantic Canada and
Scotland, respectively. Subsequent to the appearance of clinical disease in
Canada,
ISAV surveillance programs were instituted in New Brunswick. A central aspect
of
the Canadian ISAV management approach involves the depopulation of ISAV-
infected cages that are found through participation in the surveillance
protocols. The
Canadian government and Canadian salmon producers themselves have developed
several compensation programs to offset losses from eradication measures,
which
has helped lower the incidence of new cases of both virus and disease at
previously
negative marine sites. Recent Canadian outbreaks are currently confined to the
Bay
of Fundy area of Maritime Canada. However, the Norwegian disease pattern has
shown that the virus spreads from population to population principally by
exposure
to body fluids from infected fish, through untreated water coming from fish
processing plants or through shared equipment that hasn't been properly
disinfected
at marine sites. Thus, Atlantic salmon netpens at neighboring Maine marine
sites
are at considerable risk of encountering ISA virus.
Historically, the elimination of ISA disease in other countries through the
attempted eradication of ISA virus has proven to be futile. Given the many
unknown factors involved in disease transmission, including ties between the
ISA
pathogen and wild reservoirs of virus, outright elimination of ISA and the
virus
(ISAV) does not appear to be an achievable goal. However, as shown over time
in
several other international epizootics of ISA, mortality from ISA can be
decreased
through the development of biosecurity protocols and good management
techniques.
Nonetheless, the development of effective treatments against ISAV remains a
high
priority for salmon producers in the U.S. and elsewhere.
CA 02442346 2003-09-26
WO 02/079231 PCT/US02/09681
- 3 -
Fish that survive ISA demonstrative a protective immune response indicating
that prophylactic treatment against ISA is possible. Whole killed viral
formulations
have been shown to be effective against other viral diseases of fish, but the
disadvantage of such an approach is that virulent virus may remain in the
formulation if extreme care is not taken during the manufacturing process.
Additionally, the immune response conferred is often brief and may need to be
boosted. Finally, killed virus formulations are prepared by growing virus in
large
amounts in cell culture or in the actual animal species, and either method is
expensive. Furthermore, if the titer of the amplified virus is low, then
achieving the
appropriate antigenic dose within the final formulation requires the addition
of more
virus and raises the cost of production. Thus, a need remains for an effective
ISAV
vaccine.
SUMMARY
ISAV nucleic acid molecules are disclosed. In some embodiments, the
nucleic acid molecule has a sequence at least 70% identical to SEQ ID NO: 1, a
nucleic acid sequence at least 85% identical to SEQ ID NO: 3, or a nucleic
acid
sequence at least 85% identical to SEQ ID NO: 1 1 , or a sequence consisting
essentially of SEQ ID NO: 1, SEQ ID NO: 3, or SEQ ID NO: 11. In particular
embodiments, the nucleic acid molecule is operably linked to a heterologous
nucleic
acid, such as an expression control sequence. In one specific non-limiting
example,
the nucleic acid sequence is included in a vector.
Host cells and transgenic fish transformed by such nucleic acids also are
disclosed. In some embodiments, the nucleic acid molecule encodes an antigenic
epitope capable of eliciting an immune response in the cell or fish, such as
an
immune response against ISAV. Particular fish and fish cells include (but are
not
limited to) rainbow trout, coho salmon, chinook salmon, amago salmon, chum
salmon, sockeye salmon, Atlantic salmon, arctic char, brown trout, cutthroat
trout,
brook trout, catfish, tilapia, sea bream, seabass, flounder, or sturgeon.
CA 02442346 2011-06-06
-3A-
In one aspect the present invention provides a nucleic acid molecule,
including: a
nucleic acid sequence at least 70% identical to SEQ ID NO: 1; a nucleic acid
sequence at
least 85% identical to SEQ ID NO: 3; or a nucleic acid sequence at least 85%
identical to
SEQ ID NO: 11.
The nucleic acid sequence may be at least 80% identical to SEQ ID NO: 1. The
nucleic acid sequence may be at least 90% identical to SEQ ID NO: 1, SEQ ID
NO: 3, or
SEQ ID NO: 11. The nucleic acid sequence may be at least 95% identical to SEQ
ID
NO: 1, SEQ ID NO: 3, or SEQ ID NO: 11.
The nucleic acid sequence may consist essentially of SEQ ID NO: 1, SEQ ID NO:
3, or SEQ ID NO: 11.
The nucleic acid molecule may be operably linked to a heterologous nucleic
acid
including an expression control sequence. The nucleic acid molecule may encode
an
antigenic epitope.
In another aspect the present invention provides a vector including a nucleic
acid
molecule including: a nucleic acid sequence at least 70% identical to SEQ ID
NO: 1; a
nucleic acid sequence at least 85% identical to SEQ ID NO: 3; or a nucleic
acid sequence
at least 85% identical to SEQ ID NO: 11, operably linked to a heterologous
nucleic acid
including an expression control sequence.
In another aspect the present invention provides a host cell, including a
nucleic
acid molecule including: a nucleic acid sequence at least 70% identical to SEQ
ID NO: 1;
a nucleic acid sequence at least 85% identical to SEQ ID NO: 3; or a nucleic
acid
sequence at least 85% identical to SEQ ID NO: 11, operably linked to a
heterologous
nucleic acid including an expression control sequence.
The host cell may be a fish cell. The fish cell may be from rainbow trout,
coho
salmon, chinook salmon, amago salmon, chum salmon, sockeye salmon, Atlantic
salmon,
CA 02442346 2011-06-06
-3B-
arctic char, brown trout, cutthroat trout, brook trout, catfish, tilapia, sea
bream, seabass,
flounder, or sturgeon.
In another aspect the present invention provides a nucleic acid including at
least
100 consecutive nucleotides of SEQ ID NO: 1.
In another aspect the present invention provides a transgenic animal, a
nucleated
cell of which includes: an expression control sequence operably linked to a
nucleic acid
sequence at least 70% identical to SEQ ID NO: 1, a nucleic acid sequence at
least 85%
identical to SEQ ID NO: 3, or a nucleic acid sequence at least 85% identical
to SEQ ID
NO: 11; wherein the nucleic acid sequence at least 70% identical to SEQ ID NO:
1, the
nucleic acid sequence at least 85% identical to SEQ ID NO: 3, or the nucleic
acid
sequence at least 85% identical to SEQ ID NO: 11 encodes an antigenic epitope.
The transgenic animal may exhibit an increased resistance to infection by
infectious salmon anemia virus as compared to a non-transformed animal of the
same
species. The transgenic animal may be an aquaculture animal. The transgenic
animal may
be a fish. The transgenic animal may be a rainbow trout, coho salmon, chinook
salmon,
amago salmon, chum salmon, sockeye salmon, Atlantic salmon, arctic char, brown
trout,
cutthroat trout, brook trout, catfish, tilapia, sea bream, seabass, flounder,
or sturgeon.
In another aspect the present invention provides a method of eliciting an
immune
response against infections salmon anemia virus in a fish, including:
introducing into the
fish a therapeutically effective amount of a nucleic acid molecule including:
a nucleic acid
sequence at least 70% identical to SEQ ID NO: 1; a nucleic acid sequence at
least 85%
identical to SEQ ID NO: 3; or a nucleic acid sequence at least 85% identical
to SEQ ID
NO: 11, operably linked to a heterologous nucleic acid including an expression
control
sequence, wherein the nucleic acid molecule encodes an antigenic epitope of
infectious
salmon anemia virus, thereby eliciting an immune response against infectious
salmon
anemia virus in the fish.
CA 02442346 2011-06-06
-3C-
The nucleic acid molecule may have a nucleic acid sequence at least 80%
identical
to SEQ ID NO: 1. The nucleic acid molecule may have a nucleic acid sequence at
least
85% identical to SEQ ID NO: 1. The nucleic acid molecule may have a nucleic
acid
sequence at least 90% identical to SEQ ID NO: 1. The nucleic acid molecule may
have a
nucleic acid sequence at least 95% identical to SEQ ID NO: 1. The nucleic acid
molecule
may have a nucleic acid sequence consisting essentially of SEQ ID NO: 1.
The nucleic acid sequence may be at least 90% identical to SEQ ID NO: 3 or SEQ
ID NO: 11. The nucleic acid sequence may be at least 95% identical to SEQ ID
NO: 3 or
SEQ ID NO: 11. The nucleic acid sequence may be at least 95% identical to SEQ
ID NO:
3 or SEQ ID NO: 11. The nucleic acid sequence may consist essentially of SEQ
ID NO: 3
or SEQ ID NO: 11.
In another aspect the present invention provides a method of producing a
transgenic fish, including contacting a nucleated cell of the fish with an
amount of a
nucleic acid molecule including: a nucleic acid sequence at least 70%
identical to SEQ ID
NO: 1; a nucleic acid sequence at least 85% identical to SEQ ID NO: 3; or a
nucleic acid
sequence at least 85% identical to SEQ ID NO: 11, operably linked to a
heterologous
nucleic acid including an expression control sequence, wherein the amount of
the nucleic
acid molecule is sufficient to introduce the nucleic acid molecule into the
cell, thereby
producing a transgenic fish.
The fish may be rainbow trout, coho salmon, chinook salmon, amago salmon,
chum salmon, sockeye salmon, Atlantic salmon, arctic char, brown trout,
cutthroat trout,
brook trout, catfish, tilapia, sea bream, seabass, flounder, or sturgeon.
In another aspect the present invention provides a polypeptide encoded by a
nucleic acid molecule, including: a nucleic acid sequence at least 70%
identical to SEQ
ID NO: 1; a nucleic acid sequence at least 85% identical to SEQ ID NO: 3; or a
nucleic
acid sequence at least 85% identical to SEQ ID NO: 11, or a conservative
variant thereof.
CA 02442346 2011-06-06
-3D-
In another aspect the present invention provides a method of inducing an
immune
response in a fish, including: delivering to the fish a therapeutically
effective amount of a
composition comprising a polypeptide having an amino acid sequence as set
forth as SEQ
ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO:
12, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 17, or SEQ ID NO: 18, an
antigenic
fragment thereof, or a conservative variant thereof; and wherein the
polypeptide is an
antigenic epitope of infectious salmon anemia virus, thereby eliciting an
immune response
against infectious salmon anemia virus in the fish.
The polypeptide may have an amino acid sequence consisting essentially of SEQ
ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO:
12, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 17, or SEQ ID NO: 18. The
polypeptide may include a fusion protein.
CA 02442346 2003-09-26
WO 02/079231
PCT/US02/09681
- 4 -
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 is a graph showing the results of an efficacy trial of Atlantic salmon
treated with whole killed ISAV and challenged with live ISAV.
FIG. 2 is a digital image of the results of SDS-PAGE analysis of purified
ISAV proteins.
FIG. 3 is a graph illustrating the results of a humoral immune response to
whole killed ISAV in Atlantic salmon.
FIG. 4 is the amino acid sequence alignment of the RNA binding domain of
NP from influenza virus A and B with the putative NP RNA binding domain from
ISA virus. This alignment was predicted using the Clustal W system.
FIG. 5 is a graph illustrating the titration of ISAV-specific antibodies from
Atlantic salmon infected with ISAV.
FIG. 6 is a graph illustrating the ISAV-specific antibodies in sera obtained
from Atlantic salmon infected with ISAV or rainbow trout injected with a
nucleic
acid encoding an ISAV-specific protein.
BRIEF DESCRIPTION OF THE SEQUENCE LISTING
The nucleic acid sequences listed herein are shown using standard letter
abbreviations for nucleotide bases. Only one strand of each nucleic acid
sequence is
shown, but the complementary strand is understood as included by any reference
to
the displayed strand.
SEQ ID NO: 1 shows a 2.4 kbp nucleic acid fragment of ISAV (segment 1)
with a partial open reading frame (orf) encoding the P1 protein.
SEQ ID NO: 2 shows the partial amino acid sequence of the P1 protein
encoded by SEQ ID NO: 1.
SEQ ID NO: 3 shows a 2.4 kbp nucleic acid fragment of ISAV (segment 2)
with a 2127 bp orf encoding the PB1 protein.
SEQ ID NO: 4 shows the amino acid sequence of the PB1 protein, measuring
709 aa, encoded by SEQ ID NO: 3.
SEQ ID NO: 5 shows a 2.2 kbp nucleic acid fragment of ISAV (segment 3)
with a 1851 bp orf encoding the NP protein.
CA 02442346 2003-09-26
WO 02/079231 PCT/US02/09681
- 5 -
SEQ ID NO: 6 shows the amino acid sequence of the NP protein, measuring
617 aa, encoded by SEQ ID NO: 5.
SEQ ID NO: 7 shows a 1.9 kbp nucleic acid fragment of ISAV (segment 4)
with a 1737 bp orf encoding the P2 protein.
SEQ ID NO: 8 shows the amino acid sequence of the P2 protein, measuring
579 aa, encoded by SEQ ID NO: 8.
SEQ ID NO: 9 shows a 1.6 kbp nucleic acid fragment of ISAV (segment 5)
with a 1335 bp orf encoding the P3 protein.
SEQ ID NO: 10 shows the amino acid sequence of the P3 protein, measuring
445 aa, encoded by SEQ ID NO: 9.
SEQ ID NO: 11 shows a 1.5 kbp nucleic acid fragment of ISAV (segment 6)
with an 1185 bp orf encoding the HA protein.
SEQ ID NO: 12 shows the amino acid sequence of the HA protein,
measuring 395 aa, encoded by SEQ ID NO: 10.
SEQ ID NO: 13 shows a 1.3 kbp nucleic acid fragment of ISAV (segment 7)
with a 771 bp orf encoding the P4 protein and a 441 bp orf encoding the P5
protein.
SEQ ID NO: 14 shows the amino acid sequence of the P4 protein, measuring
257 aa, encoded by SEQ ID NO: 13.
SEQ ID NO: 15 shows the amino acid sequence of the P5 protein, measuring
147 aa, also encoded by SEQ ID NO: 13.
SEQ ID NO: 16 shows a 1.0 kbp nucleic acid fragment of ISAV (segment 8)
with a 705 bp orf encoding the P6 protein and a 552 bp orf encoding the P7
protein.
SEQ ID NO: 17 shows the amino acid sequence of the P6 protein, measuring
235 aa, encoded by SEQ ID NO: 16.
SEQ ID NO: 18 shows the amino acid sequence of the P7 protein, measuring
184 aa, also encoded by SEQ ID NO: 16.
CA 02442346 2003-09-26
WO 02/079231 PCT/US02/09681
- 6 -
DETIALED DESCRIPTION
Abbreviations
aa = amino acid
bp = base pair
ISA = infectious salmon anemia
ISAV = infectious salmon anemia virus
kbp = kilo-base pair
orf = open reading frame
PCR = polymerase chain reaction
RT = reverse transcription
Terms
The following explanations of terms are provided in order to facilitate review
of the embodiments described herein. Explanations of common terms also can be
.. found in Rieger et al., Glossary of Genetics: Classical and Molecular, 5th
edition,
Springer-Verlag: New York, 1991; Lewin, Nucleic acids VII, Oxford University
Press: New York, 1999; and Dictionary of Bioscience, Mcgraw-Hill: New York,
1997.
The singular forms "a," "an," and "the" refer to one or more than one, unless
.. the context clearly dictates otherwise. For example, the term "comprising a
nucleic
acid" includes single or plural nucleic acids and is considered equivalent to
the
phrase "comprising at least one nucleic acid."
The term "or" refers to a single element of stated alternative elements or a
combination of two or more elements. For example, the phrase "a first nucleic
acid
.. or a second nucleic acid" refers to the first nucleic acid, the second
nucleic acid, or
both the first and second nucleic acids.
As used herein, "comprises" means "includes." Thus, "comprising A and
B" means "including A and B," without excluding additional elements.
The standard one- and three-letter nomenclature for amino acid residues is
used.
Amplification of a nucleic acid. Any of several techniques that increases
the number of copies of a nucleic acid molecule. An example of amplification
is the
CA 02442346 2003-09-26
WO 02/079231 PCT/US02/09681
- 7 -
polymerase chain reaction (PCR), in which a sample containing the nucleic acid
is
contacted with a pair of oligonucleotide primers under conditions that allow
for the
hybridization of the primers to nucleic acid in the sample. The primers are
extended
under suitable conditions, dissociated from the template, and then re-
annealed,
extended, and dissociated to amplify the number of copies of the nucleic acid.
The
amplification products (called "amplicons") can be further processed,
manipulated,
or characterized by (without limitation) electrophoresis, restriction
endonuclease
digestion, hybridization, nucleic acid sequencing, ligation, or other
techniques of
molecular biology. Other examples of amplification include strand displacement
amplification, as disclosed in U.S. Patent No. 5,744,311; transcription-free
isothermal amplification, as disclosed in U.S. Patent No. 6,033,881; repair
chain
reaction amplification, as disclosed in WO 90/01069; ligase chain reaction
amplification, as disclosed in European Patent Appl. 320 308; gap filling
ligase
chain reaction amplification, as disclosed in U.S. Patent No. 5,427,930; and
NASBATM RNA transcription-free amplification, as disclosed in U.S. Patent No.
6,025,134.
Conservative amino-acid substitution. Conservative amino acid
substitutions in a polypeptide, such as an ISAV polypeptide, include those
listed in
Table 1 below.
CA 02442346 2003-09-26
WO 02/079231
PCT/US02/09681
- 8 -
Table 1
Original Residue Conservative Substitutions
Ala Ser
Arg Lys
Asn Gin, His
Asp Glu
Cys Ser
Gin Asn
Glu Asp
His Asn; Gin
Ile Leu, Val
Leu Ile; Val
Lys Arg; Gin; Glu
Met Leu; Ile
Phe Met; Leu; Tyr
Ser Thr
Thr Ser
Trp Tyr
Tyr Trp; Phe
Val Ile; Leu
Non-conservative substitutions are those that disrupt the secondary, tertiary,
or quaternary conformation of a polypeptide. Such non-conservative
substitutions
can result from changes in: (a) the structure of the polypeptide backbone in
the area
of the substitution; (b) the charge or hydrophobicity of the polypeptide; or
(c) the
bulk of an amino acid side chain. Substitutions generally expected to produce
the
greatest changes in polypeptide properties are those in which: (a) a
hydrophilic
residue is substituted for (or by) a hydrophobic residue; (b) a proline is
substituted
for (or by) any other residue; or (c) a residue having a bulky side chain, for
example,
CA 02442346 2003-09-26
WO 02/079231 PCT/US02/09681
- 9 -
phenylalanine, is substituted for (or by) one not having a side chain, for
example,
glycine. In particular embodiments, a residue having an electropositive side
chain,
for example, lysyl, arginyl, or histadyl, is not substituted for (or by) an
electronegative residue, for example, glutamyl or aspartyl.
Analog or homolog. An analog is a molecule that differs in chemical
structure from a parent compound. A homolog differs by an increment in the
chemical structure (such as a difference in the length of a nucleic acid or
amino acid
chain), a molecular fragment, a structure that differs by one or more
functional
groups, or a change in ionization.
Antigen. A compound, composition, or substance that can stimulate the
production of antibodies or a T-cell response in an animal, including
compositions
that are injected or absorbed into an animal. An antigen reacts with the
products of
specific humoral or cellular immunity, including those induced by heterologous
immunogens. The term "antigen" includes all related antigenic epitopes.
Animal. A living, multi-cellular, vertebrate organism, including, for
example, mammals, birds, reptiles, and fish. The term "aquaculture animal"
includes all species suitable for aquaculture farming, such as fish,
cephalopods, and
crustaceans, including the specific species described herein. Similarly, the
term
"subject" includes both human and veterinary subjects, such as aquaculture
animals.
cDNA (complementary DNA). A piece of DNA lacking internal, non-
coding segments (introns) and regulatory sequences that determine
transcription.
cDNA can be synthesized in a laboratory by reverse transcription from
messenger
RNA extracted from cells.
Complementarity. A nucleic acid that performs a similar function to the
sequence to which it is complementary. The complementary sequence does not
have
to confer replication competence in the same cell type to be complementary,
but
merely confer replication competence in some cell type.
Delivery of compositions. For administration to animals, purified active
compositions can be administered alone or combined with an acceptable carrier.
Preparations can contain one type of therapeutic molecule, or can be composed
of a
combination of several types of therapeutic molecules. The nature of the
carrier will
depend on the particular mode of administration being utilized. For instance,
CA 02442346 2003-09-26
WO 02/079231 PCT/US02/09681
- 10 -
parenteral formulations usually comprise injectable fluids that include
physiologically acceptable fluids such as water, physiological saline,
balanced salt
solutions, aqueous dextrose, glycerol or the like as a vehicle. For solid
compositions
(e.g., powder, pill, tablet, or capsule forms), which can be added to an
aquaculture
environment, conventional non-toxic solid carriers can include, for example,
mannitol, lactose, starch, or magnesium stearate. In addition to biologically-
neutral
carriers, compositions to be administered to fish can contain minor amounts of
non-
toxic auxiliary substances, such as wetting or emulsifying agents,
preservatives, and
pH buffering agents and the like, for example sodium acetate or sorbitan
monolaurate.
It is also contemplated that the nucleic acids could be delivered to cells
subsequently expressed by the host cell, for example through the use viral
vectors,
plasmid vectors, or liposomes administered to fish.
Compositions of the present invention can be administered by any means
that achieve their intended purpose. Amounts and regimens for the
administration of
the nucleic acids, or an active fragment thereof, can be readily determined.
For use in treating viral infections, compositions are administered in an
amount effective to inhibit viral infection or progression of an existing
infection, or
administered in an amount effective to inhibit or alleviate a corresponding
disease.
In one embodiment, infection is completely prevented.
Typical amounts initially administered would be those amounts adequate to
achieve tissue concentrations at the site of action which have been found to
achieve
the desired effect in vitro. The compositions can be administered to a host in
vivo,
for example through systemic administration, such as intravenous,
intramuscular, or
intraperitoneal administration. The compositions also can be administered
intralesionally, through scarification of the skin, intrabuccal
administration,
cutaneous particle bombardment, or by immersion in water containing a nucleic
acid
composition described herein (for uptake by the fish). Additionally, the
nucleic acid
compositions can be administered by encapsulation with a nanoparticle matrix
composed of a nucleic acid in methacrylic acid polymer, and an attenuated
bacteria
(such as Yersinia ruckeri, Edwardsiella ictaluri, Aeromonas salmonicida, or
Vibrio
CA 02442346 2011-06-06
-11 -
anguillarum) carrying the nucleic acid for delivery by immersion
administration (see, e.g.,
U.S. Patent No. 5,877,159).
Effective doses for using compositions can vary depending on the severity of
the
condition to be treated, the age and physiological condition of the fish, mode
of
administration, and other relevant factors. Thus, the final determination of
the
appropriate treatment regimen can be made by someone at the site of the fish,
such as an
operator or employee of an aquaculture facility. Typically, the dose range
will be from
about 1 g/kg body weight to about 100ing/kg body weight, such as about 10
g/kg body
weight to about 900 g/kg body weight, or from about 50 g/kg body weight to
about 500
g/kg body weight, or from about 50 g/kg body weight to about 150 p,g/kg body
weight,
such as about 100 rig/kg body weight. Nanogram quantities of transforming DNA
have
been shown to be capable of inducing an immune response in fish (see, e.g.,
Corbeil, S.,
et al., Vaccine 18(25):2817-24 (2000)).
The dosing schedule can vary from a single dosage to multiple dosages given
several times a day, once a day, once every few days, once a week, once a
month,
annually, biannually, biennially, or any other appropriate periodicity. The
dosage
schedule can depend on a number of factors, such as the species' or subject's
sensitivity
to the composition, the type and severity of infection, route of
administration, and the
volume of the container that contains the fish. In the case of a more
aggressive disease,
compositions can be administered by alternate routes, including
intramuscularly and by
environmental uptake. Continuous administration also can be appropriate in
some
circumstances, for example, immersing fish or other aquaculture animals in
water
containing the composition.
Hybridization conditions. "Stringent conditions" encompass conditions under
which hybridization will only occur if there is less than 25% mismatch between
the
hybridization probe and the target sequence. "Stringent conditions" can be
broken down
into particular levels of stringency for more precise measurement. Thus, as
used herein,
"moderate stringency" conditions are those under which DNA molecules with more
than
25% sequence variation (also termed "mismatch") will not hybridize; conditions
of
"medium stringency" are those under which DNA molecules with more than 15%
mismatch will not hybridize, and conditions of "high
CA 02442346 2003-09-26
WO 02/079231 PCT/US02/09681
- 12 -
stringency" are those under which DNA sequences with more than 10% mismatch
will not hybridize. Conditions of "very high stringency" are those under which
DNA sequences with more than 6% mismatch will not hybridize.
Hybridization. Oligonucleotides hybridize by hydrogen bonding, which
includes Watson-Crick, Hoogsteen, or reversed Hoogsteen hydrogen bonding
between complementary nucleotide units. For example, adenine and thymine are
complementary nucleotides that pair through formation of hydrogen bonds.
"Complementary" refers to sequence complementarity between two nucleotide
units.
For example, if a nucleotide unit at a certain position of an oligonucleotide
is
capable of hydrogen bonding with a nucleotide unit at the same position of a
nucleic
acid molecule, then the oligonucleotides are complementary to each other at
that
position. The oligonucleotide and the nucleic acid molecule are complemtary to
each other when a sufficient number of corresponding positions in each
molecule are
occupied by nucleotide units that can hydrogen bond with each other.
Nucleic acid molecules and nucleotide sequences derived from the disclosed
molecules also can be defined as nucleotide sequences that hybridize under
stringent
conditions to the sequences disclosed, or fragments thereof.
"Specifically hybridizable" and "complementary" are terms which indicate a
sufficient degree of complementarity, such that stable and specific binding
occurs
between an oligonucleotide and the target nucleic acid. An oligonucleotide
need not
be 100% complementary to the target to be specifically hybridizable. An
oligonucleotide is specifically hybridizable when binding of the
oligonucleotide to
the target molecule interferes with the normal function of the target and
there is a
sufficient degree of complementarity to avoid non-specific binding of the
oligonucleotide to non-target sequences under conditions in which specific
binding
is desired (for example, under physiological conditions in the case of in vivo
assays)
or under conditions in which the assays are performed.
Hybridization conditions resulting in particular degrees of stringency will
vary depending upon the nature of the hybridization, method of choice, and the
composition and length of the hybridizing nucleic acid used. Generally, the
temperature of hybridization and the ionic strength (especially the Na+
concentration) of the hybridization buffer will determine the stringency of
CA 02442346 2003-09-26
WO 02/079231 PCT/US02/09681
- 13 -
hybridization. Calculations regarding hybridization conditions required for
attaining
particular degrees of stringency are discussed in Sambrook et al., Molecular
Cloning: A Laboratory Manual (Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, NY, 2001).
Epitope. A site on an antigen at which an antibody can bind, the molecular
arrangement of the site determining the combining antibody. A portion of an
antigen molecule that deteimines its capacity to combine with the specific
combining site of its corresponding antibody in an antigen-antibody
interaction.
Nucleotide molecules that hybridize. Nucleotide molecules and sequences
which are derived from the disclosed nucleotide molecules as described above
also
can be defined as nucleotide sequences that hybridize under stringent
conditions to
the nucleotide sequences disclosed, or fragments thereof.
Genetic fragment. Any nucleic acid derived from a larger nucleic acid.
Heterologous. Originating from a different organism or distinct tissue
culture, such as from a different species or cell line.
Homologs. Two nucleotide sequences that share a common ancestral
sequence and diverged when a species carrying that ancestral sequence split
into two
species.
Isolated. An "isolated" biological component (such as a nucleic acid,
polypeptide, protein, or organelle) has been substantially separated, produced
apart
from, or purified away from other biological components (for example, other
chromosomal and extrachromosomal DNA and RNA, and polypeptides) found in the
cell of the organism in which the component naturally occurs. Nucleic acids,
polypeptides, and proteins that have been "isolated" thus include nucleic
acids and
polypeptides purified by standard purification methods. The term also embraces
nucleic acids, polypeptides, and proteins that are chemically synthesized or
prepared
by recombinant expression in a host cell.
Nucleic acid. A deoxyribonucleotide or ribonucleotide polymer in either
single or double stranded form. Unless otherwise limited, this term
encompasses
known analogues of natural nucleotides that hybridize to nucleic acids in a
manner
similar to naturally occurring nucleotides. An "oligonucleotide" (or "oligo")
is a
linear nucleic acid of up to about 250 nucleotide bases in length. For
example, a
CA 02442346 2003-09-26
WO 02/079231 PCT/US02/09681
- 14 -
polynucleotide (such as DNA or RNA) which is at least 5 nucleotides long, such
as
at least 15, 50, 100, or even more than 200 nucleotides long.
Operably linked. A first nucleic acid sequence is operably linked with a
second nucleic acid sequence when the first nucleic acid sequence is placed in
a
functional relationship with the second nucleic acid sequence. For instance, a
promoter is operably linked to a coding sequence if the promoter affects the
transcription or expression of the coding sequence. Generally, operably linked
nucleic acid sequences are contiguous. Where necessary to join two protein
coding
regions, the operably linked sequences are in the same reading frame.
Expression control sequence. A nucleic acid sequence that affects,
modifies, or influences expression of a second nucleic acid sequence.
Promoters,
operators, repressors, and enhancers are examples of expression control
sequences.
ORF (open reading frame). A series of nucleotide triplets (codons) coding
for amino acids without any termination codons. These sequences are usually
translatable into a peptide.
Ortholog. Two nucleotide sequences are orthologs of each other if they
share a common ancestral sequence and diverged when a species carrying that
ancestral sequence split into two species. Orthologous sequences are also
homologous sequences.
Parenteral. Administered outside of the intestine and not via the alimentary
tract. Generally, parenteral formulations are those that will be administered
through
any possible mode except ingestion. This term especially refers to injections,
whether administered intravenously, intrathecally, intramuscularly,
intraperitoneally,
or subcutaneously, and various surface applications including intranasal,
intradermal, and topical application, for instance.
Polypeptide. Any chain of amino acids, regardless of length or post-
translational modification (for example, glycosylation or phosphorylation).
Polypeptide sequence homology. In certain embodiments, a polypeptide is
at least about 70% homologous to a corresponding sequence (such as SEQ ID
NO:1)
or a native polypeptide (such as HA), such as at least about 80% homologous,
and
even at least about 95% homologous. Such homology is considered to be
"substantial homology."
CA 02442346 2003-09-26
WO 02/079231 PCT/US02/09681
- 15 -
Polypeptide homology is typically analyzed using sequence analysis
software, such as the programs available from the Genetics Computer Group
(Madison, WI, see the Genetics Computer Group website)
Portion of a nucleic acid sequence. At least 10, 20, 30, 40, 50, 60, 70, 80,
or more contiguous nucleotides of the relevant sequence.
Promoter. A promoter is one type of expression control sequence composed
from an array of nucleic acid sequences that directs transcription of a
nucleic acid.
A promoter includes necessary nucleic acid sequences near the start site of
transcription, such as a TATA element. A promoter also can include distal
enhancer
or repressor elements that can be located as much as several thousand base
pairs
from the start site of transcription. A promoter can be constitutive or
inducible. An
inducible promoter directs transcription of a nucleic acid operably coupled to
it only
under certain environmental conditions, such as in the presence of metal ions
or
above a certain temperature.
Protein Purification. Polypeptides can be purified by any 'method known to
one of skill in the art. Exemplary, non-limiting methods are described in:
Guide to
Protein Purification: Methods EnzymologyI, ed. Deutscher, Academic Press, San
Diego, 1997; and Scopes, Protein Purification: Principles and Practice, 3rd
ed.,Springer Verlag, New York, 1994.
Purified. The term purified does not require absolute purity; rather, it is
intended as a relative term. Thus, for example, a purified nucleic acid is one
in
which the nucleic acid is more enriched than the nucleic acid is in its
natural
environment within a cell. In one embodiment, a preparation is purified if a
component, such as a nucleic acid, represents at least 50% of the total amount
of that
component (e.g. the nucleic acid content) of the preparation.
Recombinant. A recombinant nucleic acid is one that has a sequence that is
not naturally occurring, or has a sequence that is made by an artificial
combination
of two otherwise separated segments of sequence. This artificial combination
can be
accomplished by chemical synthesis or artificial manipulation of isolated
segments
of nucleic acids, for example by genetic engineering techniques. Similarly, a
recombinant protein is one encoded for by a recombinant nucleic acid molecule.
CA 02442346 2003-09-26
WO 02/079231 PCT/US02/09681
- 16 -
The term recombinant includes nucleic acids that have been altered solely by
deletion of a portion of the nucleic acid.
Resistance to infection. Animals resistant to infection will demonstrate
decreased symptoms of infection compared to non-resistant animals. Evidence of
resistance to infection can appear as, for example, lower rates of mortality;
increased
life-spans measured after exposure to the infective agent; fewer or less
intense
physiological symptoms, such as fewer lesions; or decreased cellular or tissue
concentrations of the infective agent. In one embodiment, resistance to
infection is
demonstrated by a heightened immune response.
Sequence identity. The similarity between two nucleic acid sequences, or
two amino acid sequences, is expressed in terms of the similarity between the
sequences, otherwise referred to as sequence identity. Sequence identity is
frequently measured in terms of percentage identity (or similarity or
homlogy); the
higher the percentage, the more similar are the two sequences.
Methods of alignment of sequences for comparison are well-known in the
art. Various programs and alignment algorithms are described in: Smith and
Waterman, Adv. AppL Math. 2:482, 1981; Needleman and Wunsch, J MoL Bio.
48:443, 1970; Pearson and Lipman, Methods in Molec. Biology 24: 307-331, 1988;
Higgins and Sharp, Gene 73:237-244, 1988; Higgins and Sharp, CABIOS 5:151-153,
1989; Corpet et al., Nucleic Acids Research 16:10881-90, 1988; Huang et al.,
Computer Applications in BioSciences 8:155-65,1992; and Pearson et al.,
Methods
in Molecular Biology 24:307-31,1994. Altschul et al. (1994) presents a
detailed
consideration of sequence alignment methods and homology calculations.
The NCBI Basic Local Alignment Search Tool (BLAST) (Altschul et al., J.
MoL Biol. 215:403-410, 1990) is available from several sources, including the
National Center for Biological Information (NBCI, Bethesda, MD) and on the
Internet, for use in connection with the sequence analysis programs blastp,
blastn,
blastx, tblastn and tblastx. It can be accessed at the NCBI website.
Homologs of the nucleic acids and polypeptides described herein are
typically characterized by possession of at least 70% sequence identity
counted over
the full length alignment with a disclosed sequence using the NCBI Blast 2.0,
gapped blastp set to default parameters. Such homologous nucleic acids or
peptides
CA 02442346 2003-09-26
WO 02/079231
PCT/US02/09681
- 17 -
will possess at least 70%, at least 80%, or even at least 90% or 95% sequence
identity determined by this method. When less than the entire sequence is
being
compared for sequence identity, homologs will possess at least 70%, such as at
least
85%, or even at least 90% or 95% sequence identity over short windows of 10-20
amino acids. Methods for determining sequence identity over such short windows
are described at the NCBI website. These sequence identity ranges are provided
for
guidance only; it is entirely possible that strongly significant homologs or
other
variants could be obtained that fall outside of the ranges provided.
In addition to the peptide homologs described above, nucleic acid molecules
that encode such homologs are encompassed by alternative embodiments. One
indication that two nucleic acid sequences are substantially identical is that
the
polypeptide which the first nucleic acid encodes is immunologically cross
reactive
with the polypeptide encoded by the second nucleic acid. Another indication
that
two nucleic acid sequences are substantially identical is that the two
molecules
hybridize to each other under stringent conditions. Stringent conditions, as
described above, are sequence dependent and are different under different
environmental parameters.
Nucleic acid sequences that do not show a high degree of identity can
nevertheless encode similar amino acid sequences, due to the degeneracy of the
genetic code. It is understood that changes in nucleic acid sequence can be
made
using this degeneracy to produce multiple nucleic acid sequence that all
encode
substantially the same polypeptide.
Nucleic acid molecules demonstrating substantial similarity may be of
different types. A DNA molecule can demonstrate some degree of identity to an
RNA molecule by comparing the sequences, where a T residue on the DNA
molecule is considered identical to a U residue on the RNA molecule.
Substantially similar. When optimally aligned (with appropriate nucleotide
insertions or deletions) with the other nucleic acid (or its complementary
strand),
there is nucleotide sequence identity in at least about 50%, 60%, 70%, 80% or
90 to
95% of the nucleotide bases.
CA 02442346 2003-09-26
WO 02/079231 PCT/US02/09681
- 18 -
Therapeutic agent. Includes treating agents, prophylactic agents, and
replacement agents made from nucleic acid and/or amino acid compositions
described
herein.
Therapeutically effective amount or effective amount. A quantity
sufficient to achieve a desired effect in situ, in vitro, in vivo, or within a
subject
being treated. For instance, the effective amount can be the amount necessary
to
inhibit viral proliferation or to measurably alter progression of disease. In
general,
this amount will be sufficient to measurably inhibit virus (ISAV) replication
or
infectivity.
An effective amount can be administered in a single dose, or in several
doses, for example daily, during a course of treatment. However, the effective
amount can depend on the composition applied or administered, the subject
being
treated, the severity and type of the affliction, and the manner of
administration.
The compositions disclosed have application in various settings, such as
aquaculture, environmental containment, or veterinary settings. Therefore, the
general term "subject being treated" is understood to include all fish that
are or may
be infected with a virus or other disease-causing microorganism that is
susceptible to
neutralization by the compositions described herein.
Transduced, transformed, and transfected. A virus or vector "transduces"
a cell when it transfers nucleic acid into the cell. A cell is "transformed"
by a
nucleic acid transduced into the cell when the DNA becomes stably replicated
by the
cell, either by incorporation of the nucleic acid into the cellular genome, or
by
episomal replication. Transfection is the uptake by eukaryotic cells of a
nucleic acid
from the local environment and can be considered the eukaryotic counterpart to
bacterial transformation.
As used herein, the term transformation encompasses all techniques by
which a nucleic acid molecule might be introduced into a cell.
Transgene. An exogenous gene supplied by a vector.
Transgenic. Of, pertaining to, or containing a gene, ORF, or other nucleic
acid native to another species, microorganism, or virus. The term "transgenic"
includes transient and permanent transformation, where the nucleic acid
integrates
,
CA 02442346 2003-09-26
WO 02/079231 PCT/US02/09681
- 19 -
into chromosomal DNA, including the germ line, or is maintained
extrachmmosomally.
Variants of Amino Acid and Nucleic Acid Sequences. The production of
proteins disclosed herein (for example, HA) can be accomplished in a variety
of
ways. DNA sequences which encode for the protein, or a fragment of the
protein,
can be engineered such that they allow the protein to be expressed in
eukaryotic
cells, bacteria, insects, and/or plants. In order to accomplish this
expression, the
DNA sequence can be altered and operably linked to other regulatory sequences.
The final product, which contains the regulatory sequences and the nucleic
acid, is
referred to as a vector. This vector can then be introduced into the
eukaryotic cells,
bacteria, insect, and/or plant. Once inside the cell, the vector allows the
protein to
be produced.
The DNA can be altered in numerous ways without affecting the biological
activity of the encoded protein. For example, PCR can be used to produce
variations
in the DNA sequence which encodes an ISAV peptide. Such variants can be
variants that are optimized for codon preference in a host cell that is to be
used to
express the protein, or other sequence changes that facilitate expression.
At least two types of cDNA sequence variant can be produced. In the first
type, the variation in the cDNA sequence is not manifested as a change in the
amino
acid sequence of the encoded polypeptide. These silent variations are simply a
reflection of the degeneracy of the genetic code. In the second type, the cDNA
sequence variation does result in a change in the amino acid sequence of the
encoded protein. In such cases, the variant cDNA sequence produces a variant
polypeptide sequence. In order to preserve the functional and immunologic
identity
of the encoded polypeptide, certain embodiments utilize amino acid
substitutions
that are conservative.
Variations in the cDNA sequence that result in amino acid changes, whether
conservative or not, can be minimized in order to preserve the functional and
immunologic identity of the encoded protein. Variant amino acid sequences can,
for
example, be 70, 80%, 90%, or even 95% identical to the native amino acid
sequence.
Vector. A nucleic acid molecule as introduced into a host cell, thereby
producing a transformed host cell. A vector can include nucleic acid sequences
that
CA 02442346 2003-09-26
WO 02/079231 PCT/US02/09681
-20 -
permit it to replicate in the host cell, such as an origin of replication. A
vector can
also include one or more therapeutic genes and/or selectable marker genes and
other
genetic elements. A vector can transduce, transform or transfect a cell,
thereby
causing the cell to express nucleic acids and/or proteins other than those
native to
the cell. A vector optionally includes materials to aid in achieving entry of
the
nucleic acid into the cell, such as a viral particle, liposome, protein
coating, or the
like. Plasmids are often used as vectors to transform fish cells.
ISAV Specific Nucleic Acids and Polypeptides
Polypeptides and nucleic acid molecules are disclosed herein, as are and
treatments for protecting fish, shellfish, and other aquacultured organisms
against
ISAV. The nucleic acids include segments of the ISAV genome, such as the
segments described herein and summarized in Table 5 below, or fragments
thereof.
Also included are fragments of the ISAV genome that overlap the individual
segments summarized in Table 5.
ISAV polypeptides are described herein, as are nucleic acids that encode the
ISAV polypeptides. ISAV polypeptides include, but are not limited to, Pl, PB1,
(nucleotprotein) NP, P2, P3, hemaglutinin (HA), P4, P5, P6, and P7. Thus,
polypeptides having a sequence as set forth as SEQ ID NO: 2, SEQ ID NO: 4, SEQ
ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ
ID NO: 15, SEQ ID NO: 17, or SEQ ID NO: 18, an antigenic fragment thereof, or
a
conservative variant thereof, are provided herein.
Polypeptides can be divided into sections, such as an N-terminal and a C-
terminal portion. Thus, in one embodiment, polypeptide fragments are provided
that
include the N-terminal or the C-terminal portion of an ISAV polypeptide.
Antigenic fragments of an ISAV polypeptide are provided herein. An
antigenic fragment is any ISAV polypeptide that can produce an immune response
in
fish. The immune response can be a B cell or a T cell response, or induction
of a
cytokine.
Also provided herein are nucleic acids that encode and ISAV polypeptide. In
one embodiment, a nucleic acid is provided that encodes a P1 polypeptide. One
CA 02442346 2003-09-26
WO 02/079231 PCT/US02/09681
- 21 -
specific non-limiting example of a P1 polypeptide is the sequence set forth as
SEQ
ID NO:2, a fragment, or a conservative variant thereof.
In another embodiment, a nucleic acid is provided that encodes a
hemaglutinin (HA) polypeptide. One specific, non-limiting example of an HA
polypeptide is the sequence as set forth as SEQ ID NO:12, a fragment, or a
conservative variant thereof.
In a further embodiment, a nucleic acid is provided that encodes a PB1
polypeptide. One specific, non-limiting example of an PB1 polypeptide is the
sequence as set forth as SEQ ID NO:4, a fragment, or a conservative variant
thereof.
Nucleic acids are also disclosed herein that are substantially similar to
particular segments, such as nucleic acids that are at least 70% identical to
SEQ ID
NO: 1, at least 85% identical to SEQ ID NO: 3, or at least 85% identical to
SEQ ID
NO: 11. Thus, in one embodiment, a nucleic acids is provided that is are at
least 75%
identical to SEQ ID NO: 1, at least at least 80% identical to SEQ ID NO: 1, at
least
85% identical to SEQ ID NO: 1, at least 90% identical to SEQ ID NO: 1, or at
least
95% identical to SEQ ID NO: 1. In another embodiment, a nucleic acid is
provided
that is at least 90% identical to SEQ ID NO: 3, at least 95% identical to SEQ
ID NO:
3, or at least 99% identical to SEQ ID NO:3. In a further embodiment, a
nucleic acid
is provided that is at least 90% identical to SEQ ID NO: 11, at least 95%
identical to
SEQ ID NO: 11, or at least 99% identical to SEQ ID NO:11.
In yet another embodiment, nucleic acids are provided that consist essentially
of an ISAV nucleic acid sequences, such as a nucleic acid having a sequence as
set
forth as SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO:
9, SEQ ID NO: 11, or SEQ ID NO: 16.
The nucleic acids disclosed herein can be operably linked to a heterologous
nucleic acid, such as an expression control sequence. In one embodiment, the
expression control sequence is a promoter, such as an interferon response
element,
beta-actin, a cytokine promoter, a cytomegalovirus promoter, or a fish viral
promoter. In particular embodiments, the promoter is an inducible promoter,
such as
a heat shock promoter, or a promoter induced by a hormone or a metal ion.
Nucleic
acid compositions can contain other elements, such as additional expression
control
elements, structural sequences, origins of replication, or multiple coding
sequences.
CA 02442346 2003-09-26
WO 02/079231
PCT/US02/09681
-22 -
In particular embodiments, an expression control sequence operably linked to a
nucleic acid encoding an ISAV polypeptide is included in a vector, including,
but
not limited to, a plasmid, a viral vector, a phagemid, or a cosmid. Cloning
vectors
include, but are not limited to, those described in U.S. Patent No. 5,998,697.
Viral
vectors include, but are not limited to, retroviral or adenoviral vectors.
The nucleic acid compositions described herein can be utilized in vitro, in
vivo, or in situ. For example, a nucleic acid at least 70% identical to SEQ ID
NO: 1
could be used to study an antigenic epitope of interest for in vitro
production and
manipulation, or to study its effect on cell physiology or activity in vivo,
or for
tissue-specific expression analysis in situ. Particular uses of these nucleic
acid
compositions also are illustrated in the Examples below.
In some embodiments, the nucleic acid molecule encodes an antigenic
sequence, such as an antigenic sequence for pathogens of aquacultural animals.
Aquacultural animals include fish (both bony and cartilaginous fish),
shellfish and
other arthropods, and molluscs. Particular exemplary aquicultural animals
include,
but are not limited, to the following: salmonids, such as rainbow trout
(Oncorhynchus mykiss), coho salmon (O. kisutch), chinook salmon (0.
tshawytcha),
amago salmon (0. rhodurus), chum salmon (0. k-eta Walbaum), sockeye salmon (0.
nerka), Atlantic salmon (Salmo salar), arctic char (Salvelinus alpinus), brown
trout
(Salmo trutta), cutthroat trout (Salmo clarkii), and brook trout (Salvelinus
fontinalis); catfish (ktalurus punctatus); tilapia (Oreochromis niloticusand
and
Oreochromis mozambicus); sea bream (Archosargus rhomboidal is), seabass
(Dicentrarchus labrax); flounder (Paralichthys dentatus); sturgeon
(Scaphirhynchus
albus); eels (including members of the order Anguilliformes, class
Actinopterygii,
such as Conger spp., Ariosoma spp., Gnathophis spp., Coloconger spp., Anguilla
spp., Nessorhamphus spp., Cynoponticus spp., Anarchias spp., Echidna spp.,
Enchelycore spp., Gymnothorax spp., and Uropterygius spp.); cephalopods
(octopi
and squids); crustaceans (including lobsters, prawns, shrimp, crabs, and
crayfish in
the order Decapoda); and bivalves (clams and oysters, such as Ostrea edulis
and
Pisidium spp.). In some embodiments, the aquaculture animal is a fish, such as
a
salmonid. In particular embodiments, In some embodiments, the nucleic acid
CA 02442346 2003-09-26
WO 02/079231 PCT/US02/09681
- 23 -
molecule encodes a polypeptide that is an antigenic sequence, such that upon
introduction in fish, an immune response is induced against ISAV.
Eliciting an Immune Response in Fish
Some embodiments employ nucleic acid compositions containing nucleic
acid sequences encoding antigenic epitopes. In such embodiments, the nucleic
acid
composition includes an expression control sequence operably linked to a
nucleic
acid sequence encoding an antigenic epitope, thus driving expression of the
nucleic
acid sequence and eliciting an immune response to the antigenic epitope in the
fish.
In particular embodiments, the antigen expressed is a polypeptide encoded by
ISAV,
which elicits an immune response in the fish against ISAV.
In any such embodiment, the fish utilized can belong to a particular species,
such as rainbow trout, coho salmon, chinook salmon, amago salmon, chum salmon,
sockeye salmon, Atlantic salmon, arctic char, brown trout, cutthroat trout,
brook
trout, catfish, tilapia, sea bream, seabass, flounder, and sturgeon.
Exemplary, non-limiting uses of these nucleic acid compositions are
described in the Examples below.
In certain embodiments, any of the nucleic acid compositions described
herein is used to transform fish tissue to produce a transgenic fish. In such
embodiments, a nucleated cell of the transgenic fish is transformed with a
nucleic
acid sequence substantially similar to the nucleic acid sequences described
herein
(for example, SEQ ID NOS.: 1, 3, 5, 7, 9, 11, 13, and 16). In particular
embodiments, the nucleic acid is at least 70% identical to SEQ ID NO: 1, at
least
85% identical to SEQ ID NO: 3, or at least 85% identical to SEQ ID NO: 11,
operably linked to a heterologous nucleic acid sequence.
If it encodes an antigenic epitope, expression of the nucleic acid sequence
can induce an immune response to the antigenic epitope within the fish or
other
aquaculture animal. In such embodiments, the animal exhibits an increased
resistence to infection by ISAV as compared to a non-transformed animal of the
same species.
In alternative embodiments, the animal subject is treated with a polypeptide
composition that functions as an antigenic epitope and induces an immune
response
CA 02442346 2003-09-26
WO 02/079231 PCT/US02/09681
-24 -
within that subject, such as the polypeptides a sequence as set forth as SEQ
ID NO:
2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12,
SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 17, or SEQ ID NO: 18, an antigenic
fragment thereof, or a conservative variant thereof. In some embodiments, the
antigenic polypeptide is a fusion protein, such as a polypeptide as set forth
in SEQ
ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID
NO: 12, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 17, or SEQ ID NO: 18, an
antigenic fragment thereof, or a conservative variant thereof, coupled to a
fusion
partner. Such fusion partners include, but are not limited to, antigens from
other fish
viruses (for example, glycoprotein from rhabdovirus, birnavirus, reovirus,
nodavirus,
herpes virus, or infectious pancreatic necrosis virus), ISS DNA elements, or T-
cell
epitopes.
The antigenic polypeptides can be obtained by recombinant methods, such as
expression in eukaryotic or bacterial cell culture, or can be chemically
synthesized.
In particular embodiments, the antigenic polypeptides are recombinantly
expressed
in a non-mammalian eukaryotic cell culture, such as a fish cell culture, for
example
a CHSE-214, TO, SHK, RTG-2, or EPC cell culture. Thus, an antigenic
polypeptide
can be prepared by transforming fish cells with a nucleic acid vector encoding
an
antigenic polypeptide (including one that is'a fusion protein), as described
above,
culturing the host cells under conditions suitable for expressing the
antigenic
polypeptide, and then recovering the antigenic polypeptide from the cell
culture.
Additionally, such cell cultures can be transformed with multiple nucleic acid
vectors, thus expressing multiple antigenic polypeptides.
Recovered antigenic polypeptides can then be purified and readied for
delivery to the subject (as described above), and the antigenic polypeptide
can be
combined with a pharmaceutically acceptable salt, carrier, adjuvant, or
diluent,
and/or other active or inactive ingredients, to form a pharmaceutical
composition.
The amount or concentration of the antigenic polypeptide within the
pharmaceutical
composition can vary according to factors such as the effectiveness of the
antigenic
polypeptide in inducing an immune response within the species of the subject,
the
severity of the disease or condition to be treated, the route or frequency of
administration, or other relevant factors. These compositions also can be
tested for
CA 02442346 2003-09-26
WO 02/079231 PCT/US02/09681
-25 -
immunogenicity prior to delivery to a subject using an in vitro assay, such as
one of
the assays described in the Examples below.
Once prepared, an effective amount of the antigenic polypeptide or
pharmaceutical composition is delivered to the subject via a suitable route of
administration, for example, intramuscular, intraperitoneal, oral, immersion,
or
ultrasound administration. An effective amount is any amount that enhances the
immunocompetence of the subject treated and elicits some immunity against
ISAV,
for example, by delaying, inhibiting, or even preventing the onset or
progression of
ISA. In some embodiments, the subject's immune system is stimulated by at
least
about 15%, such as by at least about 50%, or even at least about 90%.
EXAMPLES
The following examples are intended to illustrate the invention, but not to
limit it in any manner, either explicitly or implicitly. While these examples
are
typical of those that might be used, other procedures, methodologies, or
techniques
known to those skilled in the art alternatively can be used.
Example 1
Vaccine Trial to Test the Efficacy of the Whole Killed ISAV Vaccine
Atlantic salmon, each weighing about 90 g, were anaesthetized and
intraperitoneal injected with 0.2 ml of a solution of whole killed ISAV. Four
groups
of twenty fish in each group were studied; two groups were injected with whole
killed ISAV and two groups were injected with an equivalent amount of saline.
Following vaccination, the salmon were acclimated to saltwater at 12 C and
held for 798 degree days prior to challenge with ISAV. Twenty-four native
Atlantic
salmon were anaesthetized, fin clipped for identification, and intraperitoneal
injected
with 1 ml ISAV infected CHSE-214 cell culture supernatant (1x107 TCID50/m1).
Six of these fish were added to each of the four tanks containing the groups
of either
the vaccinated or control fish. Saline-injected control salmon experienced a
cumulative mortality of 57.5% when challenged with ISAV by cohabitation.
CA 02442346 2011-06-06
-26-
Vaccinated salmon had a cumulative mortality of 17.5 %. The RPS value of the
ISAV
whole killed vaccine was 70.0%.
EXAMPLE 2
Humoral Immune Response to Whole Killed ISAV
Atlantic salmon were vaccinated with the two different serials of whole killed
ISAV in MV4 at two different antigen doses, and sera was collected at 350
degree-days,
696 degree-days, and 972 degree-days after vaccination.
ISAV-specific antibodies in the sera were detected by enzyme-linked
immunosorbent assay (ELISA). ISAV antigen was dried onto wells of an ELISA
plate
overnight at 37 C. Wells were rinsed three times with PBS/Tween TM and, serial
dilutions of anti-ISAV Atlantic salmon sera were added in triplicate. After
one hour,
wells were rinsed three times with PBS/Tween. A second antibody, mouse anti-
salmon
immunoglobulin, was added to each well, the plates were incubated for one
hour, and
then rinsed with PBS/Tween in triplicate. After incubation with a third
antibody, goat
anti-mouse IgG conjugated to alkaline phosphatase, the wells were washed with
PBS/Tween and developer containing p-nitrophenyl phosphate was added. The
absorbance was measured at 405 nm.
FIG. 3 illustrates the results of this humoral response trial. Antibody levels
were
reported as a percent of the value obtained with mAb 10A3 to normalize the
variation
between ELISA plates. A lx dose of the whole killed ISAV vaccine serial 327
elicits a
humoral immune response at 972 degree-days post-vaccination.
EXAMPLE 3
Virus and RNA Purification
Virus was prepared by inoculating CHSE-214 cell monolayers in a 6300 cm2 Cell
Factory (Nalge Nunc International, Rochester, NY, USA) with ISA virus.
Following
complete cell lysis, the cell culture supernatant was harvested from the Cell
Factory 8 as
disclosed by the manufacturer and filtered through a sterile 0.45 micron
filter to remove
extraneous cell debris. After dialysis against solid polyethylene glycol to
reduce the
volume, the cell culture supernatant was centrifuged for two hours at 24,000
rpm using a
SW28 rotor and a Beckman L8-
CA 02442346 2003-09-26
WO 02/079231 PCT/US02/09681
-27 -
70M ultracentrifuge (Beckman Coulter, Inc., Fullerton, CA, USA). The pelleted
virus was resuspended in TNE, layered on a 25, 35 and 45% sucrose gradient and
centrifuged for 3 hours at 27,000 rpm using a SW28 rotor and a Beckman L8-70M
ultracentrifuge. Virus at the interface of the 35 and 45% sucrose layers was
collected, resuspended in TNE and centrifuged for two hours at 24,000 rpm
using a
SW28 rotor and a Beckman L8-70M ultracentrifuge. The fraction collected from
the
35-45% interface was enriched with material that reacted with an ISAV-specific
monoclonal antibody. Viral RNA was isolated from the pelleted virus using
Trizol
(Gibco) as described by the manufacturer and then used to construct cDNA
libraries.
Purified ISAV was resuspended in SDS-sample buffer. The solubilized
proteins were separated by SDS-PAGE on a 5% stacking gel and a 12% resolving
gel and visualized by Coomassie blue staining. As shown in FIG. 2, after SDS-
PAGE, four distinct protein bands were evident: 72 kDa, 47 kDa, 42 kDa, 25
kDa.
Seven proteins from purified ISAV were subjected to N-terminal amino acid
sequence analysis. The proteins of purified ISAV were separated by SDS-PAGE,
blotted onto PVDF membrane (BioRad Laboratories, Hercules, CA) and stained
with 0.1% Coomassie blue R-250 in 40% methano1/1% acetic acid. The stained
protein bands were cut out of the membrane and subjected to N-terminal amino
acid
sequence analysis using an Applied Biosystems model 470A gas-phase sequencer
(Applied Biosystems, Inc., Foster City, CA) or an Applied Biosystems model 473
liquid-phase sequencer with on-line phenylthiohydantoin analysis. The results
of
this sequencing analysis are shown in Table 2.
Table 2: N-terminal amino acid sequence analysis of ISAV proteins
Protein MW Sequence analysis Similarity analysis
(kDa)
KVSFDMA; SLQGPVA (internal No similarity found
sequence)
N-terminally blocked N/A
38 N-terminally blocked N/A
RLXLRNHPDTTWIGDSRSDQSRXNQ Putative segment 7 ISAV;
(N-terminal sequence) segment 4 Influenza C
42 RLXLRNHPDTTWIGDSRSDQSRXNQ HA (segment 6)
(N-terminal sequence)
47 EPXIXENPTXLAI (N-terminal sequence) 5:E-7 (segment 5)
72 N-terminally blocked N/A
CA 02442346 2011-06-06
-28-
EXAMPLE 4
Construction of cDNA libraries
Strategies for Cloning the ISAV Genome.
Approach 1: First strand cDNA was synthesized from ISA vRNA by reverse
transcription with the ISAV-specific primer (SEQ ID NO: 19):
5'-AAGCAGTGGTAACAACGCAGAGTAGCAAAGA-3'
RNA (100 ng) isolated from purified ISAV or CHSE-214 cells (control) was
mixed with ISAV primer (20 pmol/ 1), incubated at 80 C for 5 min and then
combined
with the following in a total of 20 1: 4 I 5x first strand buffer (Gibco
Invitrogen Corp.,
Carlsbad, CA), 2 1 10 mM dNTP mix (Boehringer Mannheim), 1 1 0.1 M DTT
(Gibco)
and 1 I Superscript II TM reverse transcriptase (15 U/ 1; Gibco). The mixture
was
incubated at 25 C for 10 min and then at 42 C for 1 hr.
The first strand ISAV cDNA products synthesized by reverse transcription were
PCR amplified using the ISAV primer and random hexamers. To the first strand
reaction,
the following components were added in a total of 100 1: 1.51.d 10 mM dNTP
mix
(Boehringer Mannheim, 1.25 1 ISAV primer (20 pmol/ 1), 1 1 random hexamers
(25
pmol/ 1; Gibco), 10 p,1 10x PCR buffer with M& (Boehringer Mannheim), 1 .1
Taq (5
U/ 1, Boehringer Mannheim). After 35 cycles of 94 C for 30 sec, 59 C for 45
sec and
72 C for 1 min, the PCR products were extended for 10 min at 72 C. The
amplified
cDNA products were separated by agarose gel electrophoresis, gel purified and
then
cloned into the pGEM-T vector as described by the manufacturer (Promega).
Approach 2: First strand cDNA was synthesized from ISA vRNA by reverse
transcription with random hexamer primers. RNA (100 ng) isolated from purified
ISAV
or CHSE-214 cells (control) was mixed with random hexamers (50 ng/ 1; Gibco),
incubated at 65 C for 5 mM, placed on ice for 2 min and then combined with
the
following in a total of 20 pl: 4 pl 5x first strand buffer (Gibco), 2 I 10 mM
dNTP mix
(Boehringer Mannheim), 1 p.10.1 M DTT (Gibco) and 1 1 Superscript II reverse
transcriptase (15 U/ 1; Gibco). The mixture was incubated at 25 C for 10 min
and then
at 50 C for 50 min.
CA 02442346 2011-06-06
-29-
The TimeSaver TM cDNA synthesis kit (Pharmacia) was used for second strand
cDNA synthesis. The first strand reaction was added to the second strand
reaction mix,
incubated at 12 C for 30 min and then at 22 C for 1 hr. After spin column
purification,
the blunt ended, double stranded cDNAs were cloned into dephosphorylated, Smal
digested pUC18 (Pharmacia) as outlined by the manufacturer.
For both libraries, E. coli DH5a (Gibco) was transformed with the ligation
reactions and the ampicillin-resistant colonies containing either pGEM-T or
pUC18 with
cloned ISAV cDNA were selected by blue/white screening. The white colonies
were
transferred to 96 well plates containing 200111 LB/ampicillin (250 g/m1)/15%
glycerol
per well, grown overnight at 37 C and stored at ¨20 C.
RT-PCR amplification of segments 2, 6 and 8 from ISAV CCBB.
First strand cDNAs for segments 2, 6 and 8 were synthesized from ISA virus RNA
by reverse transcription using primers outlined in Table 3 and conditions
described above.
PCR amplification was used for second strand cDNA synthesis; after 30 cycles
of 95 C
for 1 min, 50 C for 1 min and 72 X for for for 2 min, the PCR products were
extended
for 10 min at 72 C (see Table 3 for primers). RT-PCR products were gel
purified as
described by the manufacturer (Qiagen).
Table 3. RT and PCR oligonucleotide DNA primers for RNA segments 2, 6 and 8 of
ISA
virus isolate CCBB.
Segment Primer name Primer sequence (5'-3')
2 seg 2-5'F-mRNA GAACGCTCTTTAATAACCATG
seg 2-3'R-mRNA TCAAACATGCTTTTTCTTC
6 HA forward AGCAAAGATGGCACGATTC
HA reverse TGCACTTTTCTGTAAACGTACAAC
8 seg 8-5'F-mRNA AAGCAGTGGTAACAACGCAGAGTCTATCTACCATG
seg 8-3'R-mRNA TTATTGTACAGAGTCTTCC
Selection and Identification of ISAV Clones from the cDNA Libraries.
CA 02442346 2003-09-26
WO 02/079231 PCT/US02/09681
- 30 -
The contents of one 96-well plate were transferred to one Hybond N+
membrane (Amersham) then placed on top of an LB agar plate containing
ampicillin
(250 g/ml). Clones were grown on the filters at 37 C overnight and the
filters
were processed on soaking pads saturated with the following solutions: 0.5 N
NaOH (7 min); 1 M Tris-HC1 pH 7.4 (2 min); 1 M Tris-HC1 pH 7.4 (2 min); 0.5 M
Tris-HC1 pH 7.4, 1.5 M NaC1 (4 min). The filters were transferred to a bath of
2x
SSC (lx SSC is 0.15 M NaC1, 0.015 M Na3 citrate), 1% sodium dodecyl sulfate
(SDS) and then soaked in 2x SSC. After a brief wash in chloroform, the filters
were
air dried and then baked at 80 C for 2 hrs. Prehybridization of the filters
for 2 hr in
6x SSC, 0.5% SDS, 5x Denhardt's and 0.1mg/m1 E. coli tRNA (Sigma) was
followed by hybridization with a probe labelled with [a3213] dCTP by nick
translation. Nick translation was done as outlined by the manufacturer
(Amersham).
The libraries were initially screened using gel purified, RT-PCR amplified
cDNA
for segments 2, 6 or 8 of ISAV isolate CCBB. The remaining segments were
identified using probes consisting of gel purified, restriction enzyme
fragments
digested from the plasmids of randomly selected library clones. Library clones
were
grouped based on the probe to which they hybridized (see Table 4). Eight
distinct
cDNA hybridization groups were identified. Of these, two groups were found in
cDNA library 1 and all but one segment of the ISAV genome in cDNA library 2
(see
Table 4).
Plasmid DNA isolated from representative clones of each group using
Qiaprep columns (Qiagen) was sequenced at the University of Maine Core
Sequencing Facility. Only those sequences that matched other orthomyxovirus
sequences or that did not match non-viral sequences were analyzed further.
CA 02442346 2011-06-06
-31-
Table 4. Summary of groups formed from screening ISA virus cDNA libraries.
Number of positive clones
Origin of
Probe cDNA library cDNA library
probe
approach 11 approach 22
5:E-6 approach 2 0 33
Segment 2 RT-PCR 0 41
1-1#2;5-1#1 approach 1 212; 1144 6;43
2:C-5;4:D-8 approach 2 0 5;38
5:E-7 approach 2 0 14
Segment 6 RT-PCR 0 0
2:B-10 approach 2 0 50
Segment 8 RT-PCR 6 10
Library from approach 1 had a total of 1364 clones
2 Library from approach 2 had a total of 768 clones
Northern Blot Hybridization.
Northern blot analysis was used to correlate each representative sequence with
a
specific ISAV genomic segment. Total RNA was isolated from CHSE-214 cell
monolayers or CHSE-214 cell monolayers infected with ISAV using Trizol (Gibco)
as
outlined by the manufacturer. The RNA was separated on a 2% agarose gel
containing
formaldehyde and transferred onto Hybond 1\1+ membrane (Amersham) in 10x SSC
by
capillary action as described in Fourney et al., Focus, 10:5-7 (1992).
The probes used for Northern blot analysis were gel purified, restriction
enzyme
fragments digested from the plasmids of appropriate cDNA library clones. The
probes
were labelled with [00213]dCTP (NEN) by nick translation (Amersham) and
hybridized to
the blots at 42 C for 18 hr in ULTRAhybTm (Ambion). The membranes were washed
2 x
5 min in 2X SSC-0.1% SDS at 42 C and then 2 x 15 min in 0.1X SSC- 0.1% SDS at
42
C. The results were recorded on Kodak X-OMAT AR film.
The probes used in the Northern blot hybridization experiments were derived
from
four clones constructed using approach 2, one clone constructed using approach
1 and
RT-PCR products of the three known segments (see Table 3). A single RNA blot
was
consecutively probed with each of the eight individual probes. One probe was
hybridized
to the Northern blot and the results were visualized by
Y:\1'1005\2744 CA \ Apt= Desc Pgs 110606 wpd
CA 02442346 2003-09-26
WO 02/079231 PCT/US02/09681
- 32 -
autoradiography. The next probe was hybridized to the same Northern blot, the
results were visualized and compared with the results from the previous
hybridization. By repeating this process with each of the eight probes, each
individual probe and its corresponding nucleotide sequence was correlated with
a
specific RNA segment.
Eight RNA segments were identified; segments 1 and 2 were both
approximately 2400 nucleotides in length. The ISAV RNA segment corresponding
to each cDNA clone is summarized in Table 5. The genome segments are numbered
with respect to their mobility in agarose gels, from the slowest to the
fastest and
comprise a genome of 14,500 nucleotides.
Table 5. RNA segments of ISAV isolate CCBB, their genes and encoded proteins
Molecular
Length of Nascent
l
Length of Encoded weight
Segment Clone segment polypeptide
ORF (bp) protein
predicted
(kb) length (aa)
(liD a)
1 5:E-6 2.4 1749 P1
2 PB1 2.4 2127 PB1 709 80.5
3 1-1#2/5-5#1 2.2 1851 NP 617 68.0
4 2:C-5/4:D-8 1.9 1737 P2 579 65.3
5 5:E-7 1.6 1335 P3 445 48.8
6 HA 1.5 1185 HA 395 43.1
2:B-10 1.3 771 P4 257 28.6
7
441 P5 147 16.3
705 P6 235 26.5
8 NS 1.0
552 P7 184 20.3
Based on the average length determined from Northern blot hybridization
analyses with 2-
5 replicates per probe.
Purified cellular MA was separated on a 2% agarose gel and transferred to a
Hybond N+ membrane. Lanes 1-7 & 10 contain cellular RNA from CHSE cells
infected with ISA virus isolate CCBB; lane 8 contains cellular RNA from ISA
virus
isolate ME-01; lane 9 contains cellular RNA from CHSE cells infected with ISA
virus isolate NB-99; and lane 11 contains cellular RNA from neve CHSE cells.
The RNA blot was consecutively hybridized with radioactively labeled DNA
probes specific for one of the ISA virus RNA segments. The results recorded by
autoradiography after the addition of each single probe to the same RNA blot
are
shown in lanes 1-11. The probes are identified by segment (according to Table
5
CA 02442346 2003-09-26
WO 02/079231 PCT/US02/09681
- 33 -
above): lane 1, segment 3; lane 2, segment 4; lane 3, segment 6; lane 4,
segment 1;
lane 5, segment 5; lane 6, segment 7; lane 7, segment 8; lanes 8-11, segment
2.
Molecular weight standards on the left are in kbp. The RNA segments are
labeled
on the right.
Construction of Full-Length Clones of Each ISAV Genome Segment.
Full-length cDNA sequence for each of the ISAV RNA segments, with the
exception of segment 1, was generated by rapid amplification of cDNA ends
(RACE) PCR using the RLM-RACE kit (Ambion). The PCR products were cloned
into either pCle2.1-TOPO or pGEM-T as directed by the manufacturers
(Invitrogen or Promega, respectively) and then sequenced. AssemblyLIGN 1Ø9b
(Oxford Molecular Group) was used to order the overlapping sequenced DNA
fragments for construction of the full-length sequence.
PCR primers were designed from the consensus sequence obtained for each
ISAV RNA segment and used to amplify full-length cDNA sequence for each
segment with the exception of segment 1. The PCR product for each segment was
cloned into pGEM-T as directed by the manufacturer (Promega) and DNA from
three representative clones was sequenced. The computer programs contained in
MacVectorTM 6.5.3 (Oxford Molecular Group) were used to identify open reading
frames and regions of local similarity. The nucleotide and predicted amino
acid
sequence for each open reading frame were analyzed by BLAST searches through
the National Center for Biotechnology Information server (Altschul et al.,
1990;
Pearson & Lipman, 1988) or the Influenza database (Los Alamos National
Laboratory). The most likely cleavage sites for signal peptidase in HA and 5:E-
7
were determined using SignalP V1.1 (Nielsen et al., 1997).
The length of each gene, the corresponding encoded polypeptide(s) and the
predicted molecular weights of the translated proteins are summarized in Table
1.
Only partial sequence from segment 1 was obtained. The cDNA sequence of
segments 1-6 was predicted to encode one open reading frame. Segments 7 and 8
each were predicted to encode two proteins.
Comparison of the cDNA nucleotide and predicted amino acid sequences for
the ISA virus genome to those listed in the GenBank and Influenza databases
CA 02442346 2003-09-26
WO 02/079231 PCT/US02/09681
-34..
showed that RNA segments 1 and 5 of ISA virus isolate CCBB were unique. RNA
segments 2, 3, 4 and 6 were found to encode the putative proteins PB1, NP, PA
and
HA, respectively. The predicted sequences of the P6 and P7 proteins encoded on
RNA segment 8 were similar to the sequences of the two open reading frames
(orf)
on segment 8 from other ISA virus isolates.
The protein sequence of the partial open reading frame encoded on segment
1 was unique. The predicted amino acid sequence of PB1, encoded by RNA
segment 2, was 82.2 to 84.5% similar to the amino acid sequences of PB1
proteins
from Norwegian (AJ002475) and Scottish (AF262392) ISA virus isolates. The
assignment of NP to the open reading frame encoded on RNA segment 3 was based
on nucleotide sequence similarity to the influenza A NP RNA binding region
(see
FIG. 4) and to the putative NP sequence described by Snow & Cunningham (2001).
The sequence for the CCBB ISA virus NP was highly conserved, sharing 96.6%
identity to that reported for the Scottish NP (AJ276858). The predicted
protein
sequence of P2 from RNA segment 4 had 99% identity to the putative PA sequence
(AF306548) described by Ritchie et al. (2001). The nucleotide sequences for
segment 5 of the Scottish (AF429988), Norwegian (AF429987) and Maine
(AF429986) isolates of ISAV were 76.4, 76.0 and 99.7% similar to the
corresponding sequence of ISAV isolate CCBB.
The predicted translation of the open reading frame encoded by RNA
segment 6 shared 84.8 to 84.3 % identity to the predicted HA protein sequences
for
ISA virus isolates from Norway (AF302799) and Scotland (AJ276859), and 99.2%
identity to the Maine ISA virus isolate (AY059402). The nucleotide sequence
for
ISAV CCBB segment 7 had 99.6% identity with a reported ISAV sequence
(AX083264). The P4 and P5 proteins encoded on segment 7 had 99.2 to 99.3%
identity to the translations predicted for orfl and orf2 from the reported
sequence
(AX083264). The nucleotide sequence for segment 8 of the Norwegian (AF429990)
and ME/01 (AF429989) isolates of ISAV was 88.7-99.9% identical to the
corresponding sequence from ISAV isolate CCBB. Our results confirmed that
segment 8 encoded two proteins as previously reported by Mjaaland et al.
(1997).
The amino acid sequence translated from the largest open reading frame was
75.6-
CA 02442346 2003-09-26
WO 02/079231 PCT/US02/09681
- 35 -
97.9% identical to the sequence previously reported for Norwegian (AF262382),
Scottish (AJ242016) and Canadian (AJ242016) isolates of ISA virus.
FIG. 4 shows the amino acid sequence alignment of the RNA binding
domain of NP from influenza virus A and B with the putative NP RNA binding
domain from ISA virus as predicted using the Clustal W system. ISAV NP, aa 189-
307 from accession number AF404345; Inf A NP, aa 90-188 from accession number
P15675; Inf B NP, aa 149-249 from accession number P04666. Identical amino
acids and amino acid residues with similarity in physical and chemical
properties are
indicated as * and ^, respectively. The NP RNA binding domain from influenza
viruses A and B was taken from Kobayashi et al. (1994).
EXAMPLE 5
Humoral Immune Response
Anti-ISA virus antibodies were generated in Atlantic salmon injected with
tissue culture supernatant from ISA virus-infected CHSE cell monolayers. Anti-
ISA
virus antibodies were also generated in rainbow trout vaccinated with DNA
vaccines
expressing a ISAV-specific antigens. Mouse polyclonal and monoclonal
antibodies
(mAbs) to ISA virus were generated by Rob Beecroft (Immuno-Precise Antibodies
Ltd.). ISAV-specific immunoreactive antigens were detected by IFAT, ELISA,
Western blot and serum neutralization assays.
Indirect Fluorescent Antibody Technique (IFAT)
IFATs were used to screen the ISAV-specific monoclonal antibodies (mAb).
CHSE-214 cells infected with ISAV were fixed to a glass slide with 100%
acetone,
blocked with 3% skim milk buffer, incubated with ISAV-specific mAb 10A3,
washed and reacted with TRITC-labelled goat anti-mouse antibody (Sigma). The
slide was washed, air dried, and fixed to a glass slide with Cytoseal 60
(Stephens
Scientific).
Viral-infected cells were stained a deep red whereas control slides of naïve
CHSE cells were negative by IFAT with mAb 10A3.
CA 02442346 2003-09-26
WO 02/079231 PCT/US02/09681
- 36 -
ELISA
The levels of ISAV-specific antibodies in serum from Atlantic salmon
infected with ISAV or rainbow trout vaccinated with a DNA vaccine were
determined by enzyme-linked immunosorbent assay (ELISA). DNA vaccines tested
were pISA-HA (NA), pISA-HA (Nor), pISA-seg7, and pISA-seg8.
ISAV antigen was dried onto wells of an ELISA plate overnight at 37 C.
Wells were rinsed three times with PBS/Tween and then serial dilutions of anti-
ISAV sera were added in triplicate. After 1 hr, wells were rinsed three times
with
PBS/Tween. The second antibody, mouse anti-salmon/rainbow trout
immunoglobulin (Rob Beecroft), was added to each well. The plates were
incubated
for 1 hr and then rinsed with PBS/Tween in triplicate. After incubation with
the
third antibody, goat anti-mouse IgG conjugated to alkaline phosphatase, the
wells
were washed with PBS/Tween and developer containing p-nitrophenyl phosphate
was added. The absorbance was measured at 405 nm.
ISAV-specific antibodies were detected in sera from fish injected with either
live ISAV (Fig. 4 and 5) or with DNA vaccines expressing ISAV-specific
antigens
(Fig. 5).
Antibody studies are conducted in Atlantic salmon vaccinated with an ISAV
DNA vaccine, an ISAV recombinant vaccine or a whole killed ISAV vaccine {DNA
vaccines: pISA-NP, pISA-Ac, pISA-HA (NA), pISA-HA (Nor), pISA-seg7;
recombinant vaccines: rHA-1; whole killed vaccines: lx, 2x and 4x doses of
formalin killed ISAV}. Sera samples are collected from 5 fish/timepoint at 4,
6, 8,
10 and 12 weeks post-vaccination.
FIG. 5 shows the titration of ISAV-specific antibodies from Atlantic salmon
infected with ISAV. Fish 1 had not been exposed to ISAV and, thus, the serum
was
used as a negative control. Fish 45 was injected with ISAV, and the ELISA
results
indicated that the corresponding serum contained ISAV-specific antibodies.
Sera
from fish 1 and fish 45 were negative when tested by ELISA using plates coated
with CHSE-214 cells.
FIG. 6 shows ISAV-specific antibodies in sera obtained from Atlantic
salmon infected with ISAV or rainbow trout injected with a nucleic acid
encoding an
ISAV-specific DNA vaccine. Sera were collected at 4, 6, 8, 10 and 12 weeks
post-
CA 02442346 2003-09-26
WO 02/079231 PCT/US02/09681
- 37 -
injection with 1 jag DNA vaccine or post-infection with at least lx103 TCID50
live
ISAV/fish. Levels of ISAV-specific antibodies were expressed as a percentage
of
the mAb values to normalize variations between ELISA plates. ISAV-specific
antibodies were detected at various times post-treatment. However, the levels
of
ISAV-specific antibodies were much higher in fish that had been exposed to
live
virus relative to those injected with the nucleic acid.
SDS-PAGE and Western Blot Analysis:
Whole cell lysates of naive and ISAV-infected CHSE cells as well as
purified ISAV were screened for the presence of immunoreactive antigens with
mAb
10A3 and sera from Atlantic salmon infected with ISAV. SDS-polyacrylamide gel
electrophoresis (PAGE) was carried out by the method of Laemmli (1970).
Proteins
were solubilized with SDS-polyacrylamide gel electrophoresis (PAGE) sample
buffer and separated by SDS-PAGE on 5% stacking gel and 12% resolving gel.
Immunoreactive protein bands were visualized by Western blot analysis.
Briefly,
proteins separated by SDS-PAGE were electrophoretically transferred to
nitrocellulose (Bio-Rad Laboratories). The membranes were blocked with 3% skim
milk buffer and then incubated with either mAb 10A3 or sera from Atlantic
salmon
infected with ISAV followed by an incubation with goat anti-mouse
immunoglobulin G conjugated to alkaline phosphatase or mouse anti-salmon
immunoglobulin (Rob Beecroft), respectively. In the latter case, a final
incubation
with goat anti-mouse immunoglobulin G conjugated to alkaline phosphatase was
required. The immunoreactive proteins were visualized following development
with
5-bromo-4-chloro-3-indoly1 phosphate and nitroblue tetrazolium.
Immunoreactive polypeptides encoded by the RNA segments were identified
by Western blot analysis performed on naïve and ISAV-infected CHSE-214 cells
(see Table 6 below). Sera, collected from Atlantic salmon injected with live
ISA
virus, reacted with the 72 and 42 lcDa proteins of ISA virus (Table 6).
Similar
analyses were performed with ISA virus-specific mouse polyclonal and
monoclonal
antibodies.
CA 02442346 2003-09-26
WO 02/079231 PCT/US02/09681
- 38 -
Table 6. ISAV immunoreactive proteins detected by Western blot analysis
Sera Immunoreactive proteins (kDa)
CHSE CHSE/ISAV Purified ISAV
mAb 10A3 42 42
Mouse polyclonal - 42, 36, 25, 15, 42, 25, 15
11,9
Atlantic salmon - 72, 42 Not done
convalescent
*Serum from Atlantic salmon infected with ISAV reacted with a 72 kDa and a 42
kDa
protein and was neutralizing. These two proteins are potential vaccine
candidates.
Of the six immunoreactive proteins present in the cellular preparation of ISA
virus and recognized by the mouse polyclonal sera, three were present in the
purified
ISA virus sample (42, 25 and 15 kDa; Table 5). Only the 42 kDa protein was
recognized by the monoclonal antibody (Table 5). For each serum tested, no
reaction was observed with the naïve CHSE sample indicating that the
immunoreactive proteins were derived from ISA virus.
Serum Neutralization Assay
Ten-fold dilutions of ISAV in PBS were incubated with PBS or serum from
naive or ISAV-infected Atlantic salmon for 1 hr at 15 C. Aliquots of 100 IA of
the
serum/virus mixture were transferred in quadruplicate to 96-well cell culture
plates
seeded with CHSE-214 cells, incubated at 15 C and monitored for CPE. Table 7
summarizes the results.
Table 7: Summary of serum neutralization studies
Sample Neutralization
ISAV/PBS
ISAV/sera from naïve Atlantic salmon
ISAV/sera from ISAV-infected Atlantic salmon +
*Serum from ISAV-infected Atlantic salmon is neutralizing. Studies to
determine if serum
from Atlantic salmon infected with ISAV isolate CCBB is neutralizing with the
Scottish,
Norwegian and Maine isolates of ISAV are underway.
Having illustrated and described the principals of the invention by several
embodiments, it should be apparent that those embodiments can be modified in
arrangement and detail without departing from the principles of the invention.
Thus,
the invention includes all such embodiments and variations thereof, and their
equivalents.
