Note: Descriptions are shown in the official language in which they were submitted.
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
REAGENTS AND METHODS FOR MODULATING
DKK-MEDIATED INTERACTIONS
FIELD OF THE INVENTION
The present invention relates to signal transduction, bone development, bone
loss disorders, modulation of lipid-related conditions, research reagents,
methods of
screening drug leads, drug development, treatments for bone and/or lipid
disorders,
screening and development of therapies, molecular, cellular, and animal models
of
bone and/or lipid development and maintenance, which are mediated by Dkk,
including Dkk-1, and/or LRPS, LRP6, HBM or other members of the Wnt pathway.
BACKGROUND OF THE INVENTION
Two of the most common types of osteoporosis are postmenopausal and
senile osteoporosis. Osteoporosis affects both men and women, and, taken with
other abnormalities of bone, presents an ever-increasing health risk for an
aging
population. The most common type of osteoporosis is that associated with
menopause. Most women lose between 20-60% of the bone mass in the trabecular
compartment of the bone within 3-6 years after the cessation of menses. This
rapid
bone loss is generally associated with an increase of bone resorption and
formation.
However, the resorptive cycle is more dominant and the result is a net loss of
bone
mass. Osteoporosis is a common and serious disease among postmenopausal
women. There are an estimated 25 million women in the United States alone who
are afflicted with this disease. The results of osteoporosis are personally
harmful,
and also account for a large economic loss due to its chronicity and the need
for
extensive and long-term support (e.g., hospitalization and nursing home care)
from
disease sequelae. This is especially true in elderly patients. Additionally,
while
osteoporosis is generally not thought of as a life-threatening condition, a 20-
30%
mortality rate is related to hip fractures in elderly women. A large
percentage of this
mortality rate can be directly associated with postmenopausal osteoporosis.
1
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
The most vulnerable tissue in the bone to the effects of postmenopausal
osteoporosis is the trabecular bone. This tissue is often referred to as
spongy bone
and is particularly concentrated near the ends of the bone, near the joints,
and in the
vertebrae of the spine. The trabecular tissue is characterized by small
structures
which inter-connect with each other as well as the more solid and dense
cortical
tissue which makes up the outer surface and central shaft of the bone. This
cris-
cross network of trabeculae gives lateral support to the outer cortical
structure and is
critical to the biomechanical strength of the overall structure. In
postmenopausal
osteoporosis, it is primarily the net resorption and loss of the trabeculae
which lead
to the failure and fracture of the bone. In light of the loss of the
trabeculae in
postmenopausal women, it is not surprising that the most common fractures are
those associated with bones which are highly dependent on trabecular support,
e.g.,
the vertebrae, the neck of the femur, and the forearm. Indeed, hip fracture,
Colle's
fractures, and vertebral crush fractures are indicative of postmenopausal
osteoporosis. Osteoporosis affects cortical as well as trabecular bone.
Alterations in
endosteal bone resorption and Haversian remodeling with age affect cortical
thickness and structural integrity contributing the increased risk for
fracture.
One of the earliest generally accepted methods for treatment of
postmenopausal osteoporosis was estrogen replacement therapy. Although this
therapy frequently is successful, patient compliance is low, primarily due to
the
undesirable side-effects of chronic estrogen treatment. Frequently cited side-
effects
of estrogen replacement therapy include reinitiation of menses, bloating,
depression,
and, potentially, increased risk of breast or uterine cancer. In order to
limit the
known threat of uterine cancer in women who have not had a hysterectomy, a
protocol of estrogen and progestin cyclic therapy is often employed. This
protocol is
similar to that used in birth control regimens, and often is not tolerated by
women
because of the side-effects characteristic of progestin. More recently,
certain
antiestrogens, originally developed for the treatment of breast cancer, have
been
shown in experimental models of postmenopausal osteoporosis to be efficacious.
Among these agents is raloxifene (See, U.S. Patent No. 5,393,763; Black et
al., J.
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
Clin. Invest., 93:63-69 (1994); and Ettinger et al., JAMA 282:637-45 (1999)).
In
addition, tamoxifen, a widely used clinical agent for treating breast cancer,
has been
shown to increase bone mineral density in post menopausal women suffering from
breast cancer (Love et al., N. Engl. J. Med., 326:852-856 (1992)).
Another therapy for the treatment of postmenopausal osteoporosis is the use
of calcitonin. Calcitonin is a naturally occurring peptide which inhibits bone
resorption and has been approved for this use in many countries (Overgaard et
al.,
Br. Med. J., 305:556-561 (1992)). The use of calcitonin has been somewhat
limited,
however. Its effects are very modest in increasing bone mineral density, and
the
treatment is very expensive. Another therapy for the treatment of
postmenopausal
osteoporosis is the use of bisphosphonates. These compounds were originally
developed for treating Paget's disease and malignant hypercalcemia. They have
been shown to inhibit bone resorption. Alendronate, a bisphosphonate, has been
' approved for the treatment of postmenopausal osteoporosis. These agents may
be
helpful in the treatment of osteoporosis, but these agents also have potential
liabilities which include osteomalacia, extremely long half-life in bone
(greater than 2
years), and possible "frozen bone syndrome," e.g., the cessation of normal
bone
remodeling.
Senile osteoporosis is similar to postmenopausal osteoporosis in that it is
marked by the loss of bone mineral density and resulting increase in fracture
rate,
morbidity, and associated mortality. Generally, it occurs in later life, i.e.,
after 70
years of age. Historically, senile osteoporosis has been more common in
females,
but with the advent of a more elderly male population, this disease is
becoming a
major factor in the health of both sexes. It is not clear what, if any, role
hormones
such as testosterone or estrogen have in this disease, and its etiology
remains
obscure. Treatment of this disease has not been very satisfactory. Hormone
therapy, estrogen in women and testosterone in men, has shown equivocal
results;
calcitonin and bisphosphonates may be of some utility.
The peak mass of the skeleton at maturity is largely under genetic control.
Twin studies have shown that the variance in bone mass between adult
monozygotic
3
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
twins is smaller than between dizygotic twins (Slemenda et al., J. Bone Miner.
Res.,
6: 561-567 (1991 ); Young et al., J. Bone Miner. Res., 6:561-567 (1995);
Pocock et
al., J. Clin. Invest., 80:706-710 (1987); Kelly et al., J. Bone Miner. Res.,
8:11-17
(1993)). It has been estimated that up to 60% or more of the variance in
skeletal
mass is inherited (Krall et al., J. Bone Miner. Res., 10:S367 (1993)). Peak
skeletal
mass is the most powerful determinant of bone mass in elderly years (Hui et
al.,
Ann. Int. Med., 111:355-361 (1989)), even though the rate of age-related bone
loss
in adult and later life is also a strong determinant (Hui et al., Osteoporosis
Int., 1:30-
34 (1995)). Since bone mass is the principal measurable determinant of
fracture
risk, the inherited peak skeletal mass achieved at maturity is an important
determinant of an individual's risk of fracture later in life. Thus, study of
the genetic
basis of bone mass is of considerable interest in the etiology of fractures
due to
osteoporosis.
Recently, a strong interest in the genetic control of peak bone mass has
developed in the field of osteoporosis. The interest has focused mainly on
candidate
genes with suitable polymorphisms to test for association with variation in
bone mass
within the normal range, or has focused on examination of genes and gene loci
associated with low bone mass in the range found in patients with
osteoporosis. The
vitamin D receptor locus (VDR) (Morrison et al., Nature, 367:284-287 (1994)),
PTH
gene (Howard et al., J. Clin. Endocrinol. Metab., 80:2800-2805 (1995); Johnson
et
al., J. Bone Miner. Res., 8:11-17 (1995); Gong et al., J. Bone Miner. Res.,
10:S462
(1995)) and the estrogen receptor gene (Hosoi et al., J. Bone Miner. Res.,
10:S170
(1995); Morrison et al., Nature, 367:284-287 (1994)) have figured most
prominently
in this work. These studies are difficult because bone mass (i.e, the
phenotype) is a
continuous, quantitative, polygenic trait, and is confounded by environmental
factors
such as nutrition, co-morbid disease, age, physical activity, and other
factors. Also,
this type of study design requires large numbers of subjects. In particular,
the
results of VDR studies to date have been confusing and contradictory (Garnero
et
al., J. Bone Miner. Res., 10:1283-1288 (1995); Eisman et al., J. Bone. Miner.
Res.,
10:1289-1293 (1995); Peacock, J. Bone Miner. Res., 10:1294-1297 (1995)).
4
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
Furthermore, thus far, the art has not determined the mechanisms) whereby the
genetic influences exert their effect on bone mass.
While it is well known that peak bone mass is largely determined by genetic
rather than environmental factors, studies to determine the gene loci (and
ultimately
the genes) linked to variation in bone mass are difficult and expensive. Study
designs which utilize the power of linkage analysis, e.g., sib-pair or
extended family,
are generally more informative than simple association studies, although the
latter do
have value. However, genetic linkage studies involving bone mass are hampered
by
two major problems. The first problem is the phenotype, as discussed briefly
above.
Bone mass is a continuous, quantitative trait, and establishing a discrete
phenotype
is difficult. Each anatomical site for measurement may be influenced by
several
genes, many of which may be different from site to site. The second problem is
the
age component of the phenotype. By the time an individual can be identified as
having low bone mass, there is a high probability that their parents or other
members
of prior generations will be deceased and therefore unavailable for study, and
younger generations may not have even reached peak bone mass, making their
phenotyping uncertain for genetic analysis.
Thus, there is a need in the art for additional research tools for the
elucidation
of the molecular mechanism of bone modulation, for the screening and
development
of candidate drugs, and for treatments of bone development and bone loss
disorders. The present invention is directed to these, as well as other,
important
ends.
In addition to bone modulation, the present invention relates to modulation of
lipid levels. Cardiovascular disease is the most common cause of mortality in
the
United States, and atherosclerosis is the major cause of heart disease and
stroke. It
is widely appreciated that cholesterol plays an important role in
atherogenesis.
Normally, most cholesterol serves as a structural element in the walls of
cells,
whereas much of the rest is in transit through the blood or functions as the
starting
material for the synthesis of bile acids in the liver, steroid hormones in
endocrine
cells and vitamin D in skin. The transport of cholesterol and other lipids
through the
s
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
circulatory system is facilitated by their packaging into lipoprotein
carriers. These
spherical particles comprise protein and phospholipid shells surrounding a
core of
neutral lipid, including unesterified ("free") or esterified cholesterol and
triglycerides.
Risk for atherosclerosis increases with increasing concentrations of low
density
lipoprotein (LDL) cholesterol, whereas risk is inversely proportional to
levels of high-
density lipoprotein (HDL) cholesterol. The receptor-mediated control of plasma
LDL
levels has been well-defined, and recent studies have now provided new
insights
into HDL metabolism.
The elucidation of LDL metabolism began in 1974 by Michael Brown and
Joseph Goldstein. In brief, the liver synthesizes a precursor lipoprotein
(very low
density lipoprotein, VLDL) that is converted during circulation to
intermediate density
lipoprotein (IDL) and then to LDL. The majority of the LDL receptors expressed
in
the body are on the surfaces of liver cells, although virtually all other
tissues
("peripheral tissues") express some LDL receptors. After binding, the receptor-
lipoprotein complex is internalized by the cells via coated pits and vesicles,
and the
entire LDL particle is delivered to lysosomes, wherein it is dissembled by
enzymatic
hydrolysis, releasing cholesterol for subsequent cellular metabolism. This
whole-
particle uptake pathway is called "receptor-mediated endocytosis." Cholesterol-
mediated feedback regulation of both the levels of LDL receptors and cellular
cholesterol biosynthesis help ensure cellular cholesterol homeostasis. Genetic
defects in the LDL receptor in humans results in familial
hypercholesterolemia, a
disease characterized by elevated plasma LDL cholesterol and premature
atherosclerosis and heart attacks. One hypothesis for the deleterious effects
of
excess plasma LDL cholesterol is that LDL enters the artery wall, is
chemically
modified, and then is recognized by a special class of receptors called
macrophage
scavenger receptors, that mediate the cellular accumulation of the LDL
cholesterol in
the artery, eventually leading to the formation of an atherosclerotic lesion.
The major lipoprotein classes include intestinally derived chylomicrons that
transport dietary fats and cholesterol, hepatic-derived VLDL, IDL, and LDL
that can
be atherogenic, and hepatic- and intestinally-derived HDL that are
antiatherogenic.
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
Apoprotein B (ApoB) is necessary for the secretion of chylomicrons (ApoB48)
and
VLDL, IDL, and LDL (ApoB100). Plasma levels of VLDL triglycerides are
determined
mainly by the rates of secretion in LDL lipolytic activity. Plasma levels of
LDL
cholesterol are determined mainly by the secretion of ApoB100 into plasma, the
efficacy with which VLDL are converted to LDL and by LDL receptor-mediated
clearance. Regulation of HDL cholesterol levels is complex and is affected by
rates
of synthesis of its Apo proteins, rates of esterification of free cholesterol
to
cholesterol ester by LCAT, levels of triglyceride-rich lipoproteins and CETP-
mediated
transfer of cholesterol esters from HDL, and clearance from plasma of HDL
lipids
and Apo proteins.
Normal lipoprotein transport is associated with low levels of triglycerides
and
LDL cholesterol and high levels of HDL cholesterol. When lipoprotein transport
is
abnormal, lipoprotein levels can change in ways that predispose individuals to
atherosclerosis and arteriosclerosis (see Ginsburg, Endocrinol. Metab. Clin.
North
Am., 27:503-19 (1998)).
Several lipoprotein receptors may be involved in cellular lipid uptake. These
receptors include: scavenger receptors; LDL receptor-related protein/a2-
macroglobulin receptor (LRP); LDL receptor; and VLDL receptor. With the
exception
of the LDL receptor, all of these receptors are expressed in atherosclerotic
lesions
while scavenger receptors are mostly expressed in macrophages, the LRP and
VLDL receptors may play an important role in mediating lipid uptake in smooth
muscle cells (Hiltunen et al., Atherosclerosis, 137 suppl.:S81-8 (1998)).
A major breakthrough in the pharmacologic treatment of hypercholesterolemia
has been the development of the "statin" class of 3-hydroxy-3-methylglutaryl-
CoA
reductase (HMG CoA reductase) inhibitory drugs. 3-hydroxy-3-methylglutaryl-CoA
reductase is the rate controlling enzyme in cholesterol biosynthesis, and its
inhibition
in the liver stimulates LDL receptor expression. As a consequence, both plasma
LDL cholesterol levels and the risk for atherosclerosis decrease. The
discovery and
analysis of the LDL receptor system has had a profound impact on cell biology,
physiology, and medicine.
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
HDL is thought to remove unesterified, or "free" cholesterol (FC) from
peripheral tissues, after which most of the cholesterol is converted to
cholesterol
ester (CE) by enzymes in the plasma. Subsequently, HDL cholesterol is
efficiently
delivered directly to the liver and steroidogenic tissues via a selective
uptake
pathway and the HDL receptor, SR-BI (class B type I scavenger receptor) or, in
some species, transferred to other lipoproteins for additional transport in
metabolism
(see Krieger, Proc. Natl. Acad. Sci. USA, 95:4077-4080 (1998)).
These issues illustrate a need in the art for additional research tools for
the
elucidation of the molecular mechanism of lipid modulation, for the screening
and
development of candidate drugs, and for treatments of lipid levels and lipid
level
modulation disorders. The present invention is directed to these, as well as
other,
important ends.
SUMMARY OF THE INVENTION
The present invention provides reagents, compounds, compositions and
methods relating to novel interactions of the extracellular domain of LRPS,
HBM (a
variant of LRPS), and/or LRP6 with Dkk proteins. LRPS is also referred to as
Zmax1
or Zmax. Thus, when discussing methods, reagents, compounds, and compositions
of the invention which relate to the interaction between Dkk and LRP5 (or
Zmax1 ),
the invention is also to be understood to encompass embodiments relating to
interactions between Dkk and LRP6 and Dkk and HBM. Moreover, where Dkk is
discussed herein, it is to be understood that the methods, reagents,
compounds, and
compositions of the present invention include the Dkk family members,
including but
not limited to Dkk-1, Dkk-2, Dkk-3, Dkk-4 and Soggy. Furthermore, the
invention
encompasses novel fragments of Dkk-1 which demonstrate a binding interaction
between the ligand binding domain (LBD) of LRP5 and additional proteins and/or
which can modulate an interaction between LRPS, or a variant or fragment
thereof,
and a Dkk protein. The invention provides assays, methods, compositions, and
compounds relating to Dkk-Wnt signaling. Numerous Wnt proteins are compatible
with the present invention, including Wnt1-Wnt19, and particularly, Wnt1,
Wnt3,
s
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
Wnt3a, and Wnt10b. The present invention further provides reagents, compounds,
compositions and methods modulating interactions between one or more other
proteins and Dkk-1. The present invention also provides a series of peptide
aptamers which bind to Dkk-1 or to LRP5 (or HBM and/or LRP6).
The polypeptides of the invention, for example in the form of peptide
oligomers, aptamers, proteins, and protein fragments as well as the nucleic
acids of
the invention, for example in the form of nucleic acids which encode the
polypeptides
of the invention as well as antisense, or complimentary nucleic acids, are
useful as
reagents for the study of bone mass and lipid level modulation. The
polypeptides
and nucleic acids of the invention are also useful as therapeutic and
diagnostic
agents.
The present invention provides useful reagents for the modulation of Dkk
proteins with LRPS, LRP6, and/or HBM, the modulation Dkk-1 and/or Dkk-1
interacting protein activity, and modulation of LRPS/Dkk-1, LRP6/Dkk1 and
HBM/Dkk-1 interactions and Dkk-1/Dkk-1 interacting protein interactions. The
present invention provides a series of peptide aptamers which bind Dkk-1 or
LRPS,
LRP6, and/or HBM.
An object of the invention is to provide for a method of regulating
LRPS/LRP6/HBM/HBM-like activity in a subject comprising administering a
therapeutically effective amount of a composition which modulates Dkk
activity. The
subject can be a vertebrate or an invertebrate organism, but more preferably
the
organism is a canine, a feline, an ovine, a primate, an equine, a porcine, a
caprine,
a camelid, an avian, a bovine, or a rodent organism. A more preferred organism
is a
human. In a preferred embodiment, the Dkk protein is Dkk-1. In a particularly
preferred embodiment, Dkk-1 activity is decreased. In another embodiment, Dkk
activity modulates bone mass and/or lipid levels. In a preferred embodiment,
bone
mass is increased and/or lipid levels are decreased. In another preferred
embodiment, the modulation in bone mass is an increase in bone strength
determined via one or more of a decrease in fracture rate, an increase in
areal bone
density, an increase in volumetric mineral bone density, an increase in
trabecular
9
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
connectivity, an increase in trabecular density, an increase in cortical
density or
thickness, an increase in bone diameter, and an increase in inorganic bone
content.
The invention further provides such a method wherein the composition comprises
a
Dkk, Dkk-1 or a LRPS/LRP6/HBM binding fragment thereof, such as those depicted
in Figure 6 or a mimetic of those fragments depicted in Figure 6. The
invention
further provides such a method wherein the composition comprises one or more
of
the proteins which interact with Dkk, including Dkk-1, such as those depicted
in
Figure 5, or a Dkk-binding fragment thereof, or an antisense, siRNA, or shRNA
molecule which recognizes and binds to a nucleic acid encoding one or more Dkk
interacting or Dkk-1 interacting proteins. The invention further provides such
a
method wherein the composition comprises an LRPS/LRP6/Zmax1 antibody, Dkk
antibody, a Dkk-1 antibody or an antibody to a Dkk-1 interacting protein. The
invention further provides such a method wherein the compositions comprise an
aptamer of Dkk or Dkk-1, such as those depicted in Figure 3 (SEQ ID NOs:171-
188),
or a mimetic of such an aptamer. The method further provides that invention
further
provides such a method wherein the compositions comprise an aptamer of a Dkk
interacting or Dkk-1 interacting protein, or a mimetic of such an aptamer.
A composition of the present invention may modulate activity either by
enhancing or inhibiting the binding of Dkk to LRPS/LRP6/Zmax1, particularly
Dkk-1,
or the binding of Dkk-1 to a Dkk-1 interacting protein, such as those shown in
Figure
5. A composition of the present invention may comprise an LRP5 peptide
aptamer,
such as OST262 (SEQ ID N0:208), Figures 4 (SEQ ID NOs:189-192) (particularly,
peptide (SEQ ID N0:191 ) and 13 (including SEQ IDNOs:204-214), or a mimetic of
such an aptamer. Preferred compositions of the present invention also comprise
LRP5 antibodies.
Another aspect of the invention is to provide for a method of regulating Dkk-
Wnt pathway activity in a subject comprising administering a therapeutically
effective
amount of a composition which modulates Dkk-Wnt pathway activity. In a
preferred
embodiment, the Dkk protein is Dkk-1. In a particularly preferred embodiment,
Dkk-
1 activity is decreased. In another embodiment, Dkk activity modulates bone
mass
to
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
and/or lipid levels. In a preferred embodiment, bone mass is increased and/or
lipid
levels are decreased. In another preferred embodiment, the modulation in bone
mass is an increase in bone strength determined via one or more of a decrease
in
fracture rate, an increase in areal bone density, an increase in volumetric
mineral
bone density, an increase in trabecular connectivity, an increase in
trabecular
density, an increase in cortical density or thickness, an increase in bone
diameter,
and an increase in inorganic bone content. In another preferred embodiment,
the
Wnt is Wnt1-Wnt19. In a particularly preferred embodiment, the Wnt is Wnt1,
Wn3,
Wnt3a, or Wnt10b. Preferred compositions comprise Dkk-modulating or Dkk-1-
modulating compounds or one or more Dkk interacting or Dkk-1 interacting
proteins,
or a Dkk-binding fragment thereof. Other preferred Dkk modulating compositions
comprise a Dkk or Dkk-1 antibody or an antibody to a Dkk interacting or Dkk-1
interacting protein. Also contemplated are antisense, siRNA, and shRNA
molecules
which recognize and bind to a nucleic acid encoding one or more Dkk-1
interacting
proteins. The invention further provides such a method wherein the composition
comprises a biologically active or LRPS/LRP6/HBM binding fragment of Dkk,
including Dkk-1, such as those depicted in Figure 6 or a mimetic of those
fragments
depicted in Figure 6. The Dkk modulating composition may also comprise a
peptide
aptamer of a Dkk interacting or Dkk-1 interacting protein, or a mimetic of
such an
aptamer. A composition of the present invention may modulate activity either
by
enhancing or inhibiting the binding of Dkk, including Dkk-1, to LRPS, LRP6, or
HBM
or the binding of Dkk, including Dkk-1, to a Dkk interacting protein, such as
those
shown in Figure 5. The invention further provides such a method wherein the
composition comprises an aptamer of Dkk or Dkk-1, such as those depicted. A
composition of the present invention may comprise an LRP5 peptide aptamer,
such
as OST262 (SEQ ID N0:208). Preferred compositions of the present invention
also
comprise LRP5 antibodies.
A further aspect of the invention is to provide for a method of modulating Wnt
signaling in a subject comprising administering a therapeutically effective
amount of
a composition which modulates Dkk activity or modulates Dkk interaction with
LRP5
11
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
(or LRP6 or HBM). In a preferred embodiment, the Dkk protein is Dkk-1. In a
particularly preferred embodiment, Dkk-1 activity is decreased. In another
embodiment, Dkk activity modulates bone mass and/or lipid levels. In a
preferred
embodiment, bone mass is increased and/or lipid levels are decreased. In
another
preferred embodiment, the modulation in bone mass is an increase in bone
strength
determined via one or more of a decrease in fracture rate, an increase in
areal bone
density, an increase in volumetric mineral bone density, an increase in
trabecular
connectivity, an increase in trabecular density, an increase in cortical
density or
thickness, an increase in bone diameter, and an increase in inorganic bone
content.
In another preferred embodiment, the Wnt is Wnt1-Wnt19. In a particularly
preferred
embodiment, the Wnt is Wnt1, Wnt3, Wnt3a, or Wnt1 Ob. Preferred Wnt modulating
compositions comprise one or more Dkk interacting or Dkk-1 interacting
proteins, or
a biologically active or LRPS/LRP6/HBM binding fragment thereof. Also
contemplated are antisense, siRNA, and shRNA molecules which recognize and
bind to a nucleic acid encoding one or more Dkk interacting or Dkk-1
interacting
proteins. The invention further provides such a method wherein the composition
comprises a biologically active or LRPS/LRP6/HBM binding fragment of Dkk or
Dkk-
1, such as those depicted in Figure 6 or a mimetic of those fragments depicted
in
Figure 6. The Dkk modulating composition may also comprise a peptide aptamer
of
a Dkk interacting or Dkk-1 interacting protein, or a mimetic of such an
aptamer. A
composition of the present invention may modulate activity either by enhancing
or
blocking the binding of Dkk, including Dkk-1, to LRPS, LRP6, or HBM or the
binding
of Dkk or Dkk-1 to a Dkk interacting or Dkk-1 interacting protein, such as
those
shown in Figure 5. The invention further provides such a method wherein
compositions comprising an aptamer of Dkk or Dkk-1, such as those depicted in
Figure 3 (SEQ ID NOs:171-188), or a mimetic of such an aptamer. The invention
further provides such a method wherein the composition comprises a Dkk or Dkk-
1
antibody or an antibody to a Dkk interacting or Dkk-1 interacting protein. The
invention further provides such a method wherein compositions of an LRP5
peptide
aptamer, such as OST262 (SEQ ID N0:208), Figures 4 (SEQ ID N0:189-192
12
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
(particularly peptide (SEQ ID N0:191 ) and Figure 13 (including SEQ ID NOs:204-
214), or a mimetic of such an aptamer. Additional preferred compositions of
the
present invention also comprise LRP5 antibodies.
Additionally, the invention provides for a method of modulating bone mass
and/or lipid levels in a subject comprising administering to the subject a
composition
which modulates Dkk activity or Dkk interaction with LRP5 in an amount
effective to
modulate bone mass and/or lipid levels, wherein bone mass and/or lipid levels
are in
need of modulation. In a preferred embodiment, the Dkk protein is Dkk-1. In a
particularly preferred embodiment, Dkk-1 activity is decreased. In another
embodiment, Dkk activity modulates bone mass and/or lipid levels. In a
preferred
embodiment, bone mass is increased and/or lipid levels are decreased. In
another
preferred embodiment, the modulation in bone mass is an increase in bone
strength
determined via one or more of a decrease in fracture rate, an increase in
areal bone
density, an increase in volumetric mineral bone density, an increase in
trabecular
connectivity, an increase in trabecular density, an increase in cortical
density or
thickness, an increase in bone diameter, and an increase in inorganic bone
content.
Preferred bone mass and/or lipid modulating compositions comprise one or more
Dkk interacting or Dkk-1 interacting proteins, or a biologically active or
LRPS/LRP6/HBM binding fragment thereof. Also contemplated are antisense,
siRNA, and shRNA molecules which recognize and bind to a nucleic acid encoding
one or more Dkk interacting or Dkk-1 interacting proteins. The invention
further
provides such a method wherein the composition comprises a biologically active
or
LRPS/LRP6/HBM binding fragment of Dkk, including Dkk-1, such as those depicted
in Figure 6 or a mimetic of those fragments depicted in Figure 6. The Dkk
modulating composition may also comprise a peptide aptamer of a Dkk
interacting or
Dkk-1 interacting protein, or a mimetic of such an aptamer. The invention
further
provides such a method wherein the composition comprises an aptamer of Dkk or
Dkk-1, such as those depicted in Figure 3 (SEQ ID NOs:171-188), or a mimetic
of
such an aptamer. A composition of the present invention may modulate activity
either by enhancing or inhibiting the binding of Dkk, including Dkk-1, to
LRPS, LRP6,
13
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
or HBM or the binding of Dkk, including Dkk-1, to a Dkk interacting protein,
such as
those shown in Figure 5. The invention further provides such a method wherein
the
composition comprises a Dkk or Dkk-1 antibody or an antibody to a Dkk
interacting
or Dkk-1 interacting protein. A composition of the present invention may
comprise
5, an LRP5 peptide aptamer, such as OST262 (SEQ ID N0:208), Figures 4 (SEQ ID
NOs:189-192 (particularly peptide 13 (SEQ ID N0:191 )) and 13 (including SEQ
ID
NOs:204-214), or a mimetic of such an aptamer. Preferred compositions of the
present invention also comprise LRPS antibodies. It is a further aspect of the
invention that such lipid-modulated diseases include a cardiac condition,
atherosclerosis, familial lipoprotein lipase deficiency, familial apoprotein
CII
deficiency, familial type 3 hyperlipoproteinemia, familial
hypercholesterolemia,
familial hypertriglyceridemia, multiple lipoprotein-type hyperlipidemia,
elevated lipid
levels due to dialysis and/or diabetes, and an elevated lipid level of unknown
etiology.
Bone disorders contemplated for treatment and/or diagnosis by the methods
and compositions disclosed herein include a bone development disorder, a bone
fracture, age related loss of bone, a chondrodystrophy, a drug-induced bone
disorder, high bone turnover, hypercalcemia, hyperostosis, osteogenesis
imperfecta,
osteomalacia, osteomyelitis, osteoporosis, Paget's disease, osteoarthritis,
and
rickets.
It is a further object of the invention to provide a method of screening for
compounds or compositions which modulates the interaction of Dkk with LRPS,
LRP6, HBM, or a Dkk-binding fragment of LRPS, LRP6, or HBM comprising:
(a) exposing Dkk or a LRPS/LRP6/HBM binding
fragment thereof to a compound; and
(b) determining whether said compound binds to Dkk or the
LRPS/LRP6/HBM binding fragment thereof.
In a preferred embodiment, the Dkk is Dkk-1. In a particularly preferred
embodiment, the binding of Dkk-1 to LRPS/LRP6/HBM is decreased.
14
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
It is a further object of the invention to provide a method of screening
compounds or compositions which modulate the interaction of DKK with LRPS,
LRP6, HBM, or a DKK-finding fragment thereof comprising:
(a) exposing DKK or a LRPS/LRP6/HBM binding
fragment thereof to a compound; and,
(b) determining whether said compound modulates
the interaction of Dkk with LRPS, LRP6, or HBM,
or the Dkk-binding fragment of LRPS/LRP6/HBM.
In a preferred embodiment, the Dkk is Dkk-1. In a particularly preferred
embodiment, the interaction of Dkk-1 with LRPS/LRP6/HBM is decreased.
It is a further object of the invention to provide a method of screening for
compounds or compositions which modulates the interaction of Dkk with LRPS,
LRP6, HBM, or a Dkk-binding fragment of LRPS, LRP6, or HBM comprising:
(a) exposing Dkk or a LRPS/LRP6/HBM binding fragment
thereof to a compound;
(b) determining whether said compound binds to Dkk or the
LRPS/LRP6/HBM binding fragment thereof; and,
(c) further determining whether said compound modulates
the interaction of Dkk with LRPS, LRP6, or HBM, or the
Dkk-binding fragment of LRPS/LRP6/HBM.
In preferred embodiments of such methods, Dkk or a biologically active
fragment thereof is attached to a solid substrate. In an alternative
embodiment of
the invention, LRPS/LRP6/HBM, or a biologically active fragment thereof (such
as
the ligand binding domain), is exposed to the compound. Another aspect of the
invention provides for compounds and compositions identified by the disclosed
methods. A preferred embodiment of the invention provides that the compound
screened in an afore-mentioned method is one or more proteins which interact
with
Dkk, particularly Dkk-1, as depicted in Figure 5, or a LRPS/LRP6/HBM-binding
fragment thereof. Another preferred embodiment provides that the compound
comprises a Dkk or Dkk-1 peptide aptamer, such as those depicted in Figure 3
(SEQ
is
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
ID NOs:171-188), or a mimetic of such aptamers. The compound may also
comprise a peptide aptamer of a Dkk interacting or Dkk-1 interacting protein,
or a
mimetic of such an aptamer. The method further provides that the compound
comprises a Dkk or Dkk-1 antibody or an antibody to a Dkk-1 interacting
protein.
The invention further provides that the compound may comprise an t_RP5 peptide
aptamer, such as OST262 (SEQ ID N0:208), Figure 4 (SEQ ID NOs:189-192)
(particularly peptide 13 (SEQ ID N0:191 )) and Figure 13 (including SEQ ID
NOs:204-214), or a mimetic of such an aptamer. Preferred compounds of the
present invention also comprise LRP5 antibodies.
It is a further object of the invention to provide a method of screening for
compounds or compositions which modulate the interaction of Dkk and a Dkk
interacting protein comprising:
(a) exposing a Dkk interacting proteins or a Dkk-
binding fragment thereof to a compound; and,
(b) determining whether said compound binds to a
Dkk interacting proteins or the Dkk-binding
fragment thereof.
In a preferred embodiment, the Dkk is Dkk-1.
It is a further object of the invention to provide a method of screening for
compounds or compositions which modulate the interaction of Dkk and a Dkk
interacting protein comprising:
(a) exposing Dkk interacting proteins) or a Dkk-
binding fragment thereof to a compounds; and,
(b) determining whether said compound modulates
the interaction of Dkk and Dkk interacting proteins.
It is a further object of the invention to provide a method of screening for
compounds or compositions which modulate the interaction of Dkk and a Dkk
interacting protein comprising:
(a) exposing a Dkk interacting proteins or a Dkk-
binding fragment thereof to a compound;
16
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
(b) determining whether said compound binds to a
Dkk interacting proteins or the Dkk-binding
fragment thereof; and,
(c) further determining whether said compound
modulates the interaction of Dkk and Dkk
interacting proteins.
In a preferred embodiment, Dkk is Dkk-1.
In preferred embodiments of such methods, the Dkk interacting proteins,
particularly Dkk-1 interacting proteins, or a Dkk-binding fragment thereof are
attached to a solid substrate. Another aspect of the invention provides for
compounds and compositions identified by the disclosed methods. A preferred
embodiment provides that the compound comprises a Dkk or Dkk-1 peptide
aptamer, such as those depicted in Figure 3 (SEQ ID NOs:171-188), or a mimetic
of
such aptamers. The compound may also comprise a peptide aptamer of a Dkk
interacting or Dkk-1 interacting protein, or a mimetic of such an aptamer. The
compound may also comprise an antibody to a Dkk interacting or Dkk-1
interacting
protein.
It is another object of the invention to provide for a composition for
treating
bone mass disorders comprising a LRPS/LRP6/HBM modulating compound and a
pharmaceutically acceptable excipient and/or carrier therefor. Preferred LRP5
(or
LRP6 or HBM) modulating compounds include Dkk or Dkk-1 or a LRPS/LRP6/HBM
binding fragment thereof. Also contemplated are compounds which comprise
monoclonal or polyclonal antibodies or immunologically active fragments
thereof
which bind to Dkk, including Dkk-1, and a pharmaceutically acceptable
excipient
and/or carrier. Another preferred embodiment provides that the modulating
compound comprises one or more Dkk interacting or Dkk-1 interacting proteins,
or a
biologically active fragment thereof. Also contemplated are compounds which
comprise monoclonal or polyclonal antibodies or immunologically active
fragments
thereof which bind to Dkk interacting or Dkk-1 interacting proteins, or a
biologically
active fragment thereof, and a pharmaceutically acceptable excipient and/or
carrier.
1~
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
Another preferred embodiment provides that the modulating compound comprises
an antisense, siRNA, and shRNA molecule which recognizes and binds to a
nucleic
acid encoding a Dkk interacting or Dkk-1 interacting protein. Another
preferred
embodiment provides that the modulating compound comprises a Dkk or Dkk-1
peptide aptamer, a mimetic of a Dkk or Dkk-1 peptide aptamer, a peptide
aptamer of
a Dkk interacting or Dkk-1 interacting protein, or a mimetic of such an
aptamer.
Another embodiment provides that the compound comprises an LRP5 peptide
aptamer, such as OST262 (SEQ ID N0:208), Figure 4 (SEQ ID NOs:189-192)
(particularly peptide) and Figure 13 (including SEQ ID NOs:204-214), or a
mimetic of
such an aptamer. Preferred compounds of the present invention also comprise
LRPS antibodies.
It is a further object of the invention to provide a pharmaceutical
composition
for treating a Dkk-mediated disease or condition comprising a compound which
modulates Dkk activity and a carrier therefor, including pharmaceutically
acceptable
excipients. Such compositions include those wherein the compound comprises an
antisense, siRNA, and shRNA molecule or an antibody which binds to Dkk,
including
Dkk-1, and thereby prevents it from interacting with LRPS, LRP6, or HBM. Other
such compositions include one or more of Dkk interacting or Dkk-1 interacting
proteins, such as those depicted in Figure 5, or a Dkk-binding fragment
thereof, or a
monoclonal or polyclonal antibody, or immunologically active fragment thereof,
which
binds to a Dkk interacting or Dkk-1 interacting protein or Dkk-binding
fragment
thereof. Other contemplated compositions include antisense, siRNA, and shRNA
molecules which recognize and bind to a nucleic acid encoding a Dkk
interacting or
Dkk-1 interacting protein. Further contemplated compositions include Dkk and
Dkk-1
peptide aptamers, such as those depicted in Figure 3 (SEQ ID NOs;171-188),
mimetics of such aptamers, a peptide aptamer of a Dkk interacting or Dkk-1
interacting protein, or a mimetic of such an aptamer. Other contemplated
compositions comprise an LRP5 peptide aptamer, such as OST262 (SEQ ID
N0:208), Figure 4 (SEQ ID NOs:189-192) (particularly peptide 13 (SEQ ID N0:191
))
is
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
and Figure 13 (including SEQ ID N0:204-214), or a mimetic of such an aptamer.
Other preferred compositions of the present invention comprise LRP5
antibodies.
A further object of the invention to provide for a method of modulating the
expression of a nucleic acid encoding a Dkk interacting or Dkk-1 interacting
protein
in an organism, such as those shown in Figure 5, comprising the step of
administering to the organism an effective amount of composition which
modulates
the expression of a nucleic acid encoding a Dkk-1 interacting protein. In a
preferred
embodiment, said composition comprises an antisense, siRNA, or shRNA molecule
which recognizes and binds to a nucleic acid encoding a Dkk interacting or Dkk-
1
interacting protein.
One aspect of the invention provides for a method of modulating at least one
activity of Dkk or a Dkk-1 interacting protein comprising administering an
effective
amount of a composition which modulates at least one activity of Dkk or a Dkk-
1
interacting protein. The invention provides for a composition comprising a Dkk
interacting or Dkk-1 interacting protein, such as those shown in Figure 5, or
a
biologically active fragment thereof. Other agents contemplated for this
method are
antisense, siRNA, or shRNA molecules which recognize and bind to a nucleic
acid
encoding a Dkk interacting or Dkk-1 interacting protein. The method further
provides
that the composition comprises a Dkk or Dkk-1 antibody or an antibody to a Dkk
interacing or Dkk-1 interacting protein. In another preferred embodiment, the
composition comprises a Dkk or Dkk-1 peptide aptamer, a mimetic of a Dkk or
Dkk-1
peptide aptamer, a peptide aptamer of a Dkk interacting or Dkk-1 interacting
protein,
or a mimetic of such an aptamer. The method provides that a composition of the
present invention may comprise an LRP5 peptide aptamer, such as OST262 (SEQ
ID N0:208), Figure 4 (SEQ ID N0:189-192) (particularly peptide including (SEQ
ID
N0:191 )) and Figure including (SEQ ID NOs:204-214), or a mimetic of such an
aptamer. Preferred compositions of the present invention also comprise LRPS
antibodies. In a further preferred embodiment, the modulated Dkk activity is
lipid
modulation or bone mass modulation.
19
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
In all of the testing/screening embodiments of the present invention discussed
below to obtain compounds or compositions which ultimately impact
LRPS/LRP6/HBM signaling, one skilled in the art will recognize that HBM can be
used as a control in the absence of a test sample or compound. Further, the
effect
of a test sample of compound on Wnt signaling through the interaction of Dkk
with
LRPS/LRP6/HBM does not necessarily require a direct measurement of an
association or interaction of Dkk and LRPS/LRP6/HBM. Other positive
phenotypes/activities established by the High Bone Mass phenotype or by using
HBM as a control.
One aspect of the invention provides for a method of identifying binding
partners for a Dkk protein comprising the steps of:
(a) exposing the Dkk proteins) or a LRPS/LRP6 binding fragment
thereof to a potential binding partner; and
(b) determining if the potential binding partner binds to a Dkk protein or
the LRP5/LRP6 binding fragment thereof.
In a preferred embodiment, the Dkk is Dkk-1.
Another aspect of the invention is to provide for a method of identifying a
compound that effects Dkk-mediated activity comprising
(a) providing a group of transgenic animals having (1 )
a regulatable one or more Dkk interacting protein
genes, (2) a knock-out of one or more Dkk
interacting protein genes, or (3) a knock-in of one
or more Dkk interacting protein genes;
(b) providing a second group of control animals
respectively for the group of transgenic animals in
step (a); and
(c) exposing the transgenic animal group and the
control animal group to a potential Dkk-modulating
compound which modulates bone mass or lipid
levels; and
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
(d) comparing the transgenic animal group and the
control animal group and determining the effect of
the compound on bone mass or lipid levels in the
transgenic animals as compared to the control
animals.
In a preferred embodiment, the Dkk is Dkk-1.
It is another aspect of the invention to provide for a method for determining
whether a compound modulates a Dkk interacting protein, said method comprising
the steps of:
(a) mixing the Dkk interacting protein or a Dkk-binding
fragment thereof with the ligand binding domain of
Dkk in the presence of said at least one
compound;
(b) measuring the amount of said binding domain of
Dkk bound to said Dkk interacting protein or the
Dkk-binding fragment thereof as compared to a
control without said at least one compound; and
(c) determining whether the compound reduces the
amount of said binding domain of Dkk binding to
said Dkk interacting protein or Dkk-binding
fragment thereof.
In a preferred embodiment, the Dkk is Dkk-1.
In a preferred embodiment, the binding domain is attached to a solid
substrate. The invention further provides for compounds identified by this
method.
In a preferred embodiment, the invention provides that the Dkk interacting or
Dkk-1
interacting protein is detected by antibodies. In another preferred
embodiment, the
solid substrate is a microarray. Another preferred embodiment provides that
the
ligand binding domain of Dkk and/or Dkk interacting protein is fused or
conjugated to
a peptide or protein. The invention also provides that the compounds include
Dkk
21
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
and Dkk-1 peptide aptamers, mimetics of Dkk and Dkk-1 peptide aptamers, Dkk
and
Dkk-1 interacting proteins peptide aptamers, or mimetics of such aptamers.
An aspect of the invention provides a composition comprising one or more
polypeptide sequences of one or more Dkk-1 interacting proteins, or a
biologically
active fragment thereof, one or more Dkk proteins, or a biologically active
fragment
thereof, or LRPS/LRP6/HBM polypeptide sequences or a biologically active
fragment
thereof (for example, the ligand binding domain) and a pharmaceutically
acceptable
excipient and/or carrier. Another aspect of the invention provides that the
composition comprises a Dkk or Dkk-1 antibody or an antibody to a Dkk
interacting
or Dkk-1 interacting protein and a pharmaceutically acceptable excipient. A
composition of the present invention may comprise an LRPS peptide aptamer,
such
as OST262 (SEQ ID N0:208), Figure 4 (SEQ ID NOs:189-192) (particularly peptide
13 (SEQ ID N0:191 )) and Figure 13 (including SEQ ID NOs:204-214), or a
mimetic
of such an aptamer. A composition of the present invention may comprise a Dkk
peptide aptamer, for example as shown in Figure 3 (SEQ ID NOs:171-188).
Preferred compositions of the present invention also comprise LRP5 antibodies.
Another aspect of the invention is to provide an antibody or immunologically
active antibody fragment which recognizes and binds to a Dkk-1 amino acid
sequence selected from the group consisting of: Asn34-His266 (SEQ ID N0:110),
Asn34-Cys245 (SEQ ID N0:111 ), Asn34-Lys182 (SEQ ID N0:112), Cys97-His266
(SEQ ID N0:113), Va1139-His266 (SEQ ID N0:114), GIy183-His266 (SEQ ID
N0:115), Cys97-Cys245 (SEQ ID N0:116), or Va1139-Cys245 (SEQ ID N0:117) of
human Dkk-1. Additional antibodies may bind to any of the sequences depicted
in
Figures 3 (SEQ ID NOs:171-188) and Figure 4 (SEQ ID NOs:189-192). Another
aspect of the invention is to provide for polyclonal antibodies to one or more
amino
acid sequences: Peptide 1 -GNKYQTIDNYQPYPC (SEQ ID N0:118), Peptide 2
LDGYSRRTTLSSKMYHTKGQEG (SEQ ID N0:119), Peptide 3
RIQKDHHQASNSSRLHTCQRH (SEQ ID N0:120), Peptide 4 - RGEIEETITESFGND
(SEQ ID N0:121 ), and Peptide 5 - EIFQRCYCGEGLSCRIQKD (SEQ ID NO: 122).
22
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
It is a further object of the invention to provide a nucleic acid encoding a
Dkk
protein, e.g. Dkk-1, a Dkk interacting or Dkk-1 interacting protein aptamer,
or an
LRPS aptamer comprising a nucleic acid encoding a scaffold protein in-frame
with
the activation domain of Gal4 or LexA that is in-frame with a nucleic acid
which
encodes for a Dkk or Dkk-1 or Dkk interacting or Dkk-1 interacting protein
amino acid
sequence. Preferably the scaffold protein is thioredoxin (trxA), S1 nuclease
from
Staphylococcus or M13. Other preferable embodiments include Dkk-1 amino acid
sequences selected from Figure 6.
It is yet a further object of the invention to provide a composition
comprising a
polypeptide sequence of Figure 3 (SEQ ID NOs:171-188), Figure 4 (SEQ ID
N0:189-192), or of Dkk-1 interacting proteins identified in Figure 5 and a
pharmaceutically acceptable excipient and/or carrier.
Another aspect of the invention includes a method of detecting the modulatory
activity of a compound on the binding interaction of a first peptide and a
second
peptide of a peptide binding pair that bind through extracellular interaction
in their
natural environment, comprising:
(i) culturing at least one eukaryotic cell, wherein the eukaryotic cell
comprises;
a) a nucleotide sequence encoding a first heterologous
fusion protein comprising the first peptide or a segment
thereof joined to a DNA binding domain of a
transcriptional activation protein;
b) a nucleotide sequence encoding a second heterologous
fusion protein comprising the second peptide or a
segment thereof joined to a transcriptional activation
domain of a transcriptional activation protein;
wherein binding of the first peptide or segment thereof and the second
peptide or segment thereof reconstitutes a transcriptional activation
protein; and
23
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
c) a reporter element activated under positive transcriptional
control of the reconstituted transcriptional activation
protein, wherein expression of the reporter element
produces a selected phenotype;
(ii) incubating a compound with the eukaryotic cell under conditions
suitable to detect the selected phenotype; and
(iii) detecting the ability of the compound to affect the binding interaction
of the peptide binding pair by determining whether the compound
affects the expression of the reporter element which produces the
selected phenotype;
wherein (1 ) said first peptide is a Dkk peptide and said second peptide is a
peptide selected from LRPS, HBM, LRP6, and the Dkk-binding portion of
LRPS/LRP6/HBM or (2) said first peptide is a Dkk-interacting protein or the
Dkk-binding fragment thereof, and said second peptide is a Dkk peptide.
In one embodiment, the eukaryotic cell is a yeast cell. In a preferred
embodiment, the yeast cell is Saccharomyces. In a particularly preferred
embodiment, the Saccharomyces cell is Saccharomyces cerevisiae. The invention
further provides that the compound may comprise a Dkk interacting or Dkk-1
interacting protein, or a biologically active fragment thereof. In one
embodiment, the
Dkk interacting or Dkk-1 interacting protein, or a Dkk-binding fragment
thereof, is
added directly to the assay. In another embodiment, the Dkk interacting or Dkk-
1
interacting protein, or a Dkk-binding fragment thereof, is recombinantly
expressed by
the eukaryotic cell in addition to the first and second peptides. In a
preferred
embodiment the compound comprises a Dkk or Dkk-1 aptamer, a mimetic of a Dkk
or Dkk-1 peptide aptamer, a Dkk interacting or Dkk-1 interacting protein
aptamer, or
a mimetic of a Dkk-1 interacting protein aptamer. Other preferred embodiments
provide that the compound comprises an LRP5 peptide aptamer, such as OST262
(SEQ ID N0:208), Figure 4 (SEQ ID NOs:189-192) (particularly peptide 13 (SEQ
ID
N0:191 ) and Figure 13 (including SEQ ID NOs:204-214), or a mimetic of such an
aptamer. Alternatively, the present invention also provides that the compound
may
24
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
comprise LRP5 antibodies or Dkk antibodies. In another embodiment, the yeast
cell
further comprises at least one endogenous nucleotide sequence selected from
the
group consisting of a nucleotide sequence encoding the DNA binding domain of a
transcriptional activation protein, a nucleotide sequence encoding the
transcriptional
activation domain of a transcriptional activation protein, and a nucleotide
sequence
encoding the reporter element, wherein at least one of the endogenous
nucleotide
sequences is inactivated by mutation or deletion. In another embodiment, the
peptide binding pair comprises a ligand and a receptor to which the ligand
binds. In
one embodiment, the transcriptional activation protein is Gal4, Gcn4, Hap1,
Adr1,
SwiS, Ste12, Mcm1, Yap1, Ace1, Ppr1, Arg81, Lac9, Qa1 F, VP16, or a mammalian
nuclear receptor. In another embodiment, at least one of the heterologous
fusion
proteins is expressed from an autonomously-replicating plasmid. In one
embodiment, the DNA binding domain comprises a heterologous DNA-binding
domain of a transcriptional activation protein. In a preferred embodiment, the
DNA
binding protein is selected from the group consisting of a mammalian steroid
receptor and bacterial LexA protein. In another embodiment, the reporter
element is
selected from the group consisting of IacZ, a polynucleotide encoding
luciferase, a
polynucleotide encoding green fluorescent protein (GFP), and a polynucleotide
encoding chloramphenicol acetyltransferase. In a particularly preferred
embodiment,
the reporter element is IacZ
The invention further provides for a rescue screen for detecting the activity
of
a compound for modulating the binding interaction of a first peptide and a
second
peptide of a peptide binding pair, comprising:
(i) culturing at least one yeast cell, wherein the yeast cell comprises;
a) a nucleotide sequence encoding a first heterologous fusion
protein comprising the first peptide or a segment thereof joined
to a DNA binding domain of a transcriptional activation protein;
b) a nucleotide sequence encoding a second heterologous
2s
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
fusion protein comprising the second peptide or a segment
thereof joined to a transcriptional activation domain of a
transcriptional activation protein;
wherein binding of the first peptide or segment thereof and the second
peptide or segment thereof reconstitutes a transcriptional activation
protein; and
c) a reporter element activated under positive transcriptional
control of the reconstituted transcriptional activation protein,
wherein expression of the reporter gene prevents exhibition of a
selected phenotype;
(ii) incubating a compound with the yeast cell under conditions suitable to
detect the selected phenotype; and
(iii) detecting the ability of the compound to affect the binding interaction
of
the peptide binding pair by determining whether the compound affects
the expression of the reporter element which prevents exhibition of the
selected phenotype,
wherein said first peptide is a Dkk peptide and said second peptide is a
peptide selected from LRPS, HBM, LRP6 and a Dkk-binding fragment of
LRPS/LRP6/H BM.
In a preferred embodiment, the invention provides that the yeast cell is
Saccharomyces. In a particularly preferred embodiment, the Saccharomyces cell
is
Saccharomyces cerevisiae. In one embodiment, the compound comprises one or
more Dkk interacting or Dkk-1 interacting proteins, or a Dkk-binding fragment
thereof. Compounds used in the present invention may comprise an LRP5 peptide
aptamer, such as OST262 (SEQ ID N0:208), Figure 4 (SEQ ID NOs:189-192)
(particularly peptide 13 (SEQ ID N0:191 )) and Figure 13 (including SEQ ID
NOs:204-214), or a mimetic of such an aptamer. Alternatively, the compound may
comprise LRP5 antibodies or Dkk antibodies. In another embodiment, the yeast
cell
further comprises at least one endogenous nucleotide sequence selected from
the
group consisting of a nucleotide sequence encoding the DNA binding domain of a
26
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
transcriptional activation protein, a nucleotide sequence encoding the
transcriptional
activation domain of a transcriptional activation protein, and a nucleotide
sequence
encoding the reporter gene, wherein at least one of the endogenous nucleotide
sequences is inactivated by mutation or deletion. In another embodiment, the
transcriptional activation protein is Gal4, Gcn4, Hap1, Adr1, SwiS, Ste12,
Mcm1,
Yap1, Ace1, Ppr1, Arg81, Lac9, Qa1 F, VP16, or a mammalian nuclear receptor.
In
one embodiment, at least one of the heterologous fusion proteins is expressed
from
an autonomously-replicating plasmid. In another embodiment, the DNA binding
domain is a heterologous DNA-binding domain of a transcriptional activation
protein.
The invention also provides for a rescue screen for detecting the modulatory
activity of a compound on the binding interaction of a first peptide and a
second
peptide of a peptide binding pair, comprising:
(i) culturing at least one yeast cell, wherein the yeast cell comprises;
a) a nucleotide sequence encoding a first heterologous fusion
protein comprising the first peptide or a segment thereof joined
to a DNA binding domain of a transcriptional activation protein;
b) a nucleotide sequence encoding a second heterologous
fusion protein comprising the second peptide or a segment
thereof joined to a transcriptional activation domain of a
transcriptional activation protein;
wherein binding of the first peptide or segment thereof and the second
peptide or segment thereof reconstitutes a transcriptional activation
protein; and
c) a reporter element activated under positive transcriptional
control of the reconstituted transcriptional activation protein,
wherein expression of the reporter element prevents exhibition
of a selected phenotype;
(ii) incubating a compound with the yeast cell under conditions suitable to
detect the selected phenotype; and
2~
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
detecting the ability of the compound to affect the binding interaction of
the peptide binding pair by determining whether the compound affects
the expression of the reporter element which prevents exhibition of the
selected phenotype,
wherein said first peptide is a Dkk interacting or Dkk-1 interacting protein
peptide and said second peptide is a Dkk or Dkk-1 peptide.
In a preferred embodiment of the rescue screen, the yeast cell is
Saccharomyces. In a particularly preferred embodiment, the Saccharomyces cell
is
Saccharomyces cerevisiae. In another embodiment, the yeast cell further
comprises
at least one endogenous nucleotide sequence selected from the group consisting
of
a nucleotide sequence encoding the DNA binding domain of a transcriptional
activation protein, a nucleotide sequence encoding the transcriptional
activation
domain of a transcriptional activation protein, and a nucleotide sequence
encoding
the reporter gene, wherein at least one of the endogenous nucleotide sequences
is
inactivated by mutation or deletion. In one embodiment, the transcriptional
activation
protein is Gal4, Gcn4, Hap1, Adr1, SwiS, Ste12, Mcm1, Yap1, Ace1, Ppr1, Arg81,
Lac9, Qa1 F, VP16, or a mammalian nuclear receptor. In another embodiment of
the
rescue screen, at least one of the heterologous fusion proteins is expressed
from an
autonomously-replicating plasmid. In another embodiment, the DNA binding
domain
is a heterologous DNA-binding domain of a transcriptional activation protein.
The invention also provides for a method for identifying potential compounds
which modulate Dkk activity comprising:
a) measuring the effect on binding of one or more Dkk interacting
protein, or a Dkk-binding fragment thereof, with Dkk or a
LRPS/LRP6/HBM binding fragment thereof in the presence and
absence of a compound; and
b) identifying as a potential Dkk modulatory compound a
compound which modulates the binding between one or more
Dkk interacting proteins or Dkk-binding fragment thereof and
Dkk or LRPS/LRP6/HBM fragment thereof.
28
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
In a preferred embodiment, the Dkk is Dkk-1.
The invention further provides for any of the Dkk peptide aptamers of Figure 3
(SEQ ID NOs:171-188). The invention also provides for any of the LRP peptide
aptamers of Figure 4 (SEQ ID NOs:189-192).
Another aspect of the invention provides for a method of identifying agents
which modulate the interaction of Dkk with the Wnt signaling pathway
comprising:
(a) injecting mRNA encoding Dkk and an agent into a Xenopus
blastomere;
(b) assessing axis duplication or analyzing marker gene expression; and
(c) identifying agents which elicit changes in axis duplication or marker
gene expression as agents which modulate the interaction of Dkk with the Wnt
signaling pathway. Wherein the agent may be chosen from among mRNA encoding
Dkk interacting proteins, fragments thereof, siRNA, shRNA, antisense
nucleotides,
and antibodies. In a preferred embodiment, Dkk is Dkk-1. In a further
embodiment,
mRNA of HBM, LRPS/6, any Wnt (including Wnt1-Wnt19, particularly Wnt1, Wnt3,
Wnt3a, and Wnt10b), Wnt antagonist, or combination of these is co-injected
into the
Xenopus blastomere. In another embodiment, the marker gene analyzed could
include Siamois, Xnr3, slug, Xbra, HNK-1, endodermin, Xlhbox8, BMP2, BMP4,
XLRP6, EF-1, or ODC.
The present invention provides for a method for identifying agents which
modulate the interaction of Dkk with the Wnt signaling pathway comprising:
(a) transfecting cells with constructs encoding Dkk and potential Dkk
interacting proteins, mRNA fragments thereof, siRNA, shRNA, or
antisense, antibodies to LRP5/HBM/LRP6/Dkk/Dkk-interacting protein;
(b) assessing changes in expression of a reporter gene linked to a Wnt-
responsive promoter; and,
(c) identifying as a Dkk interacting protein any protein which alters reporter
gene expression compared with cells transfected with a Dkk construct
alone. In a further preferred embodiment, the cells may be HOB-03-
CE6, HEK293, or U20S cells.
29
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
In alternative embodiments, the Wnt-responsive promoter is TCF or LEF. In
other preferred embodiments, the cells are co-transfected with CMV beta-
galactosidase or tk-Renilla.
The present invention further provides for a LRPS/HBM monoclonal or
polyclonal antibody to one or more peptides of amino acid sequences
MYWTDWVETPRIE (SEQ ID N0:123), MYWTDWGETPRIE (SEQ ID N0:124),
KRTGGKRKEILSA (SEQ ID N0:125), ERVEKTTGDKRTRIQGR (SEQ ID N0:126),
or KQQCDSFPDCIDGSDE (SEQ ID N0:127).
Additionally, the present invention provides a method for identifying
compounds which modulate Dkk and LRPS/LRP6/HBM interactions comprising:
(a) immobilizing LRPS/LRP6/HBM to a solid surface; and
(b) treating the solid surface with a secreted Dkk protein or a secreted
epitope-tagged Dkk and a test compound; and
(c) determining whether the compound regulates binding between Dkk and
LRPS/LRP6/HMB using antibodies to Dkk or the epitope tag or by
directly measuring activity of an epitope tag.
In one embodiment, the Dkk is Dkk-1. In a preferred embodiment, the epitope
tag is alkaline phosphatase, histidine, myc, or a V5 tag.
Another embodiment of the present invention provides for a method for
identifying compounds which modulate Dkk and LRPS/LRP6/HBM interactions
comprising:
(a) creating an LRPS, LRP6, or HBM fluorescent fusion protein using a first
fluorescent tag;
(b) creating a Dkk fusion protein comprising a second fluorescent tag;
(c) adding a test compound; and,
(d) assessing changes in the ratio of fluorescent tag emissions using
Fluorescence Resonance Energy Transfer (FRET) or Bioluminescent
Resonance Energy Transfer (BRET) to determine whether the
compound modulates Dkk and LRPS/LRP6/HBM interactions.
In a preferred embodiment, the Dkk is Dkk-1.
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
The present invention also provides for a method of diagnosing low or high
bone mass and/or low or high lipid levels in a subject comprising examining
expression of Dkk, LRPS, LRP6, HBM or HBM-like variant in the subject and
determining whether Dkk, LRPS, LRP6, or HBM or a HBM-like variant is over- or
under-expressed to determine whether subject has (a) high or low bone mass
and/or
(b) high or low lipid levels.
The invention further provides for a transgenic animal wherein Dkk is knocked
out in a tissue-specific fashion. In a preferred embodiment, the Dkk is Dkk-1.
In one
preferred embodiment, the tissue specificity is bone tissue. In another
preferred
embodiment, the tissue specificity is liver or other tissues or cells involved
in
regulating lipid metabolism or cancer tissue.
The present invention further provides a method of screening for compounds
which modulate the interaction of Dkk with LRPS, LRP6, or HBM comprising:
(a) exposing LRPS, LRP6, or HBM, or a Dkk-binding fragment of LRPS,
LRP6, or HBM to a compound; and
(b) determining whether said compound bound to LRPS, LRP6, or HBM or
the Dkk-binding fragment of LRPS, LRP6, or HBM and further
determining whether said compound modulates the interaction of Dkk
and LRPS, LRP6, or HBM.
In one embodiment, the Dkk is Dkk-1. In a preferred embodiment, the
compound comprises an LRPS peptide aptamer. Other preferred compositions
include the peptide aptamer, OST262 (SEQ ID N0:208), Figure 4 (SEQ ID NOs:189-
192) (particularly peptide 13 (SEQ ID N0:191 ) and Figure 13 (including SEQ ID
NOs:204-214), or a mimetic of such an aptamer, and an LRP5 antibody.
The present invention also provides a method for identifying compounds
which modulate Dkk and LRPS/LRP6/HBM interactions comprising:
(a) immobilizing LRPS/LRP6/HBM to a solid surface; and
(b) treating the solid surface with a secreted Dkk protein or a secreted
epitope-tagged Dkk and a test compound; and
31
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
(c) determining whether the compound regulates binding between Dkk and
LRPS/LRP6/HBM using antibodies to Dkk or the epitope tag or by
directly measuring activity of an epitope tag. In a preferred
embodiment, the epitope tag is alkaline phosphatase, histidine, myc or
a V5 tag.
In a preferred embodiment, the Dkk is Dkk-1.
The invention also provides for a method for identifying compounds which
modulate the interaction of Dkk with the Wnt signaling pathway comprising:
(a) transfecting cells with constructs containing Dkk and Wnt proteins;
(b) assessing changes in expression of a reporter element linked to a Wnt-
responsive promoter; and
(c) identifying as a Dkk/Wnt interaction modulating compound any
compound which alters reporter gene expression compared with cells
transfected with a Dkk construct alone.
In one embodiment, the Dkk is Dkk-1. In another embodiment, the Wnt is any
of Wnt1-Wnt19. In a preferred embodiment, the Wnt is Wnt1, Wnt3, Wnt3a, or
Wnt10b. In a particularly preferred embodiment, the Wnt construct contains
Wnt3a.
In another particularly preferred embodiment, the Wnt construct contains Wnt1.
In
another preferred embodiment, the Wnt construct encodes for a Wnt that signals
through the canonical Wnt pathway. In a particularly preferred embodiment,
both
Wnt3a and Wnt1 constructs are co-transfected into the cells. In another
embodiment, the cells may be U2-OS, HOB-03-CE6, or HEK293 cells. In another
embodiment, the reporter element used is TCF-luciferase, tk-Renilla, or a
combination thereof.
The Envention also provides for a method of testing compounds that modulate
Dkk-mediated activity in a mammal comprising:
(a) providing a group of transgenic animals having (1 ) a regulatable one or
more Dkk genes, (2) a knock-out of Dkk genes, or (3) a knock-in of one
or more Dkk genes;
32
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
(b) providing a second group of control animals respectively for the group
of transgenic animals in step (a); and
(c) exposing the transgenic animal group and control animal group to a
potential Dkk-modulating compound which modulates bone mass or
lipid levels; and
(d) comparing the transgenic animals and the control group of animals and
determining the effect of the compound on bone mass or lipid levels in
the transgenic animals as compared to the control animals.
In a preferred embodiment, the Dkk is Dkk-1.
The invention further provides variants of LRP5 which demonstrate HBM
biological activity, i.e., that are "HBM-like." In preferred embodiments,
variants
G171F, M282V, G171K, G171Q, A65V, G171V, 61711, and A214V of LRPS are
provided. The invention further provides for the use any of these variants in
the
forgoing methods.
BRIEF DESCRIPTION OF THE FIGURES
Figure 1 shows a schematic of the components of the Wnt signal transduction
pathway. Schematic obtained from:
http://www.stanford.edu/~rnusse/pathways/cell2.html
Figure 2 (A-C) show bait sequences (SEQ ID NOs:168-170) utilized in yeast
two hybrid (Y2H) screens for protein-protein interactions.
Figure 3 shows a table of peptide aptamer insert sequences (SEQ ID NOs:
171-192) identified in Y2H screen with a Dkk-1 bait sequence.
Figure 4 shows a table of peptide aptamer insert sequences identified in a
Y2H screen using a LRP5 ligand binding domain bait sequence.
Figure 5 shows a table of proteins identified in a Y2H screen using a Dkk-1
bait sequence. These proteins are identified by both their nucleic acid and
amino
acid accession numbers.
Figure 6 shows the results of a minimum interaction domain mapping screen
of Dkk-1 with LRPS. At the top, a map of Dkk-1 showing the location of the
signal
33
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
sequence, and cysteine rich domains 1 and 2. Below, the extent of domains
examined using LRP5 LBD baits, LBD1 and LBD4, of Figure 2. To the right,
scoring
of the binding results observed in the experiment.
Figure 7 shows a diagram of the Xenopus Embryo Assay for Wnt activity.
Figure 8 shows the effects of Zmax/LRP5 and HBM on Wnt signaling in the
Xenopus embryo assay.
Figure 9 shows the effects of Zmax/LRP5 and HBM on induction of secondary
axis formation in the Xenopus embryo assay.
Figure 10 shows the effects of human Dkk-1 on the repression of the
canonical Wnt pathway.
Figure 11 shows the effects of human Dkk-1 on Zmax/LRPS and HBM-
mediated Wnt signaling.
Figure 12 shows pcDNA3.1 construct names with nucleotide sequences
(including SEQ ID NOs:193-203) for LRPS-binding peptide aptamers, Dkk-1
peptides
and control constructs.
Figure 13 shows the amino acid sequences (including SEQ ID NOs:204-214)
for the corresponding LRPS-binding peptides, Dkk-1 peptide aptamers and
control
constructs in Figure 12.
Figure 14 shows the effects of Dkk-1 and Dkk-2 on Wnt1 signaling with
coreceptors LRPS, HBM, and LRP6 in HOB03CE6 cells.
Figure 15 shows the effects of Dkk-1 and Dkk-2 on Wnt3a signaling with
coreceptors LRPS, HBM, and LRP6 in HOB03CE6 cells.
Figure 16 demonstrates that the LRPS-LBD peptide aptamer 262 activates
Wnt signaling in the presence of Wnt3a in U20S cells.
Figure 17 shows the differential binding of an antibody generated to a
sequence (a.a. 165-177) containing the HBM mutation in LRP5 in LRP5 and HBM
virus-infected cells.
Figure 18 shows data generated from a Y2H interaction trap where a mutant
Dkk-1 (C220A) is unable to bind to LRP5 and demonstrating the window of
capability
of detecting small molecule effects on LRP and Dkk interactions.
34
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
Figure 19 shows that Dkk-1 represses Wnt3a-mediated Wnt signaling in
U20S bone cells using the cell-based reporter gene assay for high throughput
screening.
Figure 20 demonstrates that Wnt1-HBM generated signaling is not efficiently
inhibited by Dkk-1 in U20S bone cells while LRPS and LRP6-mediated signaling
are
using the cell-based reporter gene assay for high throughput screening.
Figure 21 shows that the TCF signal in the cell-based reporter gene assay for
high throughput screening can be modulated by Dkk-1 and Dkk-1-AP without Wnt
DNA transfection.
Figure 22 shows the morphological results in the Xenopus assay using
aptamers 261 and 262 from the LRPS-LBD to activate Wnt signaling.
Figure 23 demonstrates that LRPS-LBD aptamers 261 and 262 induce Wnt
signaling over other LRP5 aptamers.
Figure 24 shows that the mutation 6171 F in LRP5 produces a greater
activation of the Wnt pathway than LRP5 which is consistent with HBM activity.
Figure 25 shows that the mutation M282V in LRP5 produces an activation of
the Wnt pathway which is consistent with HBM activity in U20S cells.
Figure 26 shows the amino acid sequence of the various peptides of dkk-1
selected to generate polyclonal antibodies, their relationship to the Dkk-1
amino acid
sequence and identities of polyclonal antibodies generated.
Figure 27 shows a Western blot demonstrating that polyclonal antibody #5521
to amino acids 165-186 of Dkk-1 was able to detect Dkk1-V5 and Dkk1-AP from
conditioned medium.
Figure 28 shows a Western blot demonstrating that polyclonal antibody
#74397 to amino acids 147-161 was able to detect Dkk1-V5 in both conditioned
medium and immunoprecipitated conditioned medium.
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
DETAILED DESCRIPTION OF THE INVENTION
1. Definitions
In general, terms in the present application are used consistent with the
manner in which those terms are understood in the art. To aid in the
understanding
of the specification and claims, the following definitions are provided.
"Gene" refers to a DNA sequence that encodes through its template or
messenger RNA a sequence of amino acids characteristic of a specific peptide.
The
term "gene" includes intervening, non-coding regions, as well as regulatory
regions,
and can include 5' and 3' ends.
By "nucleic acid" is meant to include single stranded and double stranded
nucleic acids including, but not limited to DNAs, RNAs (e.g., mRNA, tRNAs,
siRNAs), cDNAs, recombinant DNA (rDNA), rRNAs, antisense nucleic acids,
oligonucleotides, and oligomers, and polynucleotides. The term may also
include
hybrids such as triple stranded regions of RNA and/or DNA or double stranded
RNA:DNA hybrids. The term also is contemplated to include modified nucleic
acids
such as, but not limited to biotinylated nucleic acids, tritylated nucleic
acids,
fluorophor labeled nucleic acids, inosine, and the like.
"Gene sequence" refers to a nucleic acid molecule, including DNA which
contains a non-transcribed or non-translated sequence, which comprises a gene.
The term is also intended to include any combination of gene(s), gene
fragment(s),
non-transcribed sequences) or non-translated sequences) which are present on
the
same DNA molecule.
The nucleic acid sequences of the present invention may be derived from a
variety of sources including DNA, cDNA, synthetic DNA, synthetic RNA or
combinations thereof. Such sequences may comprise genomic DNA which may or
may not include naturally occurring introns. Moreover, such genomic DNA may be
obtained in association with promoter regions and/or poly (A) sequences. The
sequences, genomic DNA or cDNA may be obtained in any of several ways.
Genomic DNA can be extracted and purified from suitable cells by means well
36
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
known in the art. Alternatively, mRNA can be isolated from a cell and used to
produce cDNA by reverse transcription or other means.
"cDNA" refers to complementary or copy DNA produced from an RNA
template by the action of RNA-dependent DNA polymerase (reverse
transcriptase).
Thus, a "cDNA clone" means a duplex DNA sequence for which one strand is
complementary to an RNA molecule of interest, carried in a cloning vector or
PCR
amplified. cDNA can also be single stranded after first strand synthesis by
reverse
transcriptase. In this form, it is a useful PCR template and does not need to
be
carried in a cloning vector. This term includes genes from which the
intervening
sequences have been removed. Thus, the term "gene", as sometimes used
generically, can also include nucleic acid molecules comprising cDNA and cDNA
clones.
"Recombinant DNA" means a molecule that has been engineered by splicing
in vitro a cDNA or genomic DNA sequence or altering a sequence by methods such
as PCR mutagenesis.
"Cloning" refers to the use of in vitro recombination techniques to insert a
particular gene or other DNA sequence into a vector molecule. In order to
successfully clone a desired gene, it is necessary to use methods for
generating
DNA fragments, for joining the fragments to vector molecules, for introducing
the
composite DNA molecule into a host cell in which it can replicate, and for
selecting
the clone having the target gene from amongst the recipient host cells.
"cDNA library" refers to a collection of recombinant DNA molecules containing
cDNA inserts which together comprise the entire or a partial repertoire of
genes
expressed in a particular tissue or cell source. Such a cDNA library can be
prepared
by methods known to one skilled in the art and described by, for example,
Cowell
and Austin, "cDNA Library Protocols," Methods in Molecular Biology (1997).
"Cloning vehicle" refers to a plasmid or phage DNA or other DNA sequence
which is able to replicate in a host cell. This term can also include
artificial
chromosomes such as BACs and YACs. The cloning vehicle is characterized by one
or more endonuclease recognition sites at which such DNA sequences may be cut
in
37
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
a determinable fashion without loss of an essential biological function of the
DNA,
which may contain a marker suitable for use in the identification of
transformed cells.
"Expression" refers to the process comprising transcription of a gene
sequence and subsequent processing steps, such as translation of a resultant
mRNA to produce the final end product of a gene. The end product may be a
protein (such as an enzyme or receptor) or a nucleic acid (such as a tRNA,
antisense RNA, or other regulatory factor). The term "expression control
sequence"
refers to a sequence of nucleotides that control or regulate expression of
structural
genes when operably linked to those genes. These include, for example, the lac
systems, the trp system, major operator and promoter regions of the phage
lambda,
the control region of fd coat protein and other sequences known to control the
expression of genes in prokaryotic or eukaryotic cells. Expression control
sequences will vary depending on whether the vector is designed to express the
operably linked gene in a prokaryotic or eukaryotic host, and may contain
transcriptional elements such as enhancer elements, termination sequences,
tissue-
specificity elements and/or translational initiation and termination sites.
"Expression vehicle" refers to a vehicle or vector similar to a cloning
vehicle
but which is capable of expressing a gene which has been cloned into it, after
transformation into a host. The cloned gene is usually placed under the
control of
(i.e., operably linked to) an expression control sequence.
"Operator" refers to a DNA sequence capable of interacting with the specific
repressor, thereby controlling the transcription of adjacent gene(s).
"Promoter" refers to a DNA sequence that can be recognized by an RNA
polymerise. The presence of such a sequence permits the RNA polymerise to bind
and initiate transcription of operably linked gene sequences.
"Promoter region" is intended to include the promoter as well as other gene
sequences which may be necessary for the initiation of transcription. The
presence
of a promoter region is sufficient to cause the expression of an operably
linked gene
sequence. The term "promoter" is sometimes used in the art to generically
indicate
a promoter region. Many different promoters are known in the art which direct
38
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
expression of a gene in a certain cell types. Tissue-specific promoters can
comprise
nucleic acid sequences which cause a greater (or decreased) level of
expression in
cells of a certain tissue type.
"Operably linked" means that the promoter controls the initiation of
expression
of the gene. A promoter is operably linked to a sequence of proximal DNA if
upon
introduction into a host cell the promoter determines the transcription of the
proximal
DNA sequences) into one or more species of RNA. A promoter is operably linked
to
a DNA sequence if the promoter is capable of initiating transcription of that
DNA
sequence.
"Prokaryote" refers to all organisms without a true nucleus, including
bacteria.
"Eukaryote" refers to organisms and cells that have a true nucleus, including
mammalian cells.
"Host" includes prokaryotes and eukaryotes, such as yeast and filamentous
fungi, as well as plant and animal cells. The term includes an organism or
cell that is
the recipient of a replicable expression vehicle.
The term "animal" is used herein to include all vertebrate animals, except
humans. It also includes an individual animal in all stages of development,
including
embryonic and fetal stages. Preferred animals include higher eukaryotes such
as
avians, rodents (e.g., mice, rabbits, rats, chinchillas, guinea pigs, hamsters
and the
like), and mammals. Preferred mammals include bovine, equine, feline, canine,
ovine, caprine, porcine, buffalo, humans, and primates.
A "transgenic animal" is an animal containing one or more cells bearing
genetic information received, directly or indirectly, by deliberate genetic
manipulation
or by inheritance from a manipulated progenitor at a subcellular level, such
as by
microinjection or infection with a recombinant viral vector (e.g., adenovirus,
retrovirus, herpes virus, adeno-associated virus, lentivirus). This introduced
DNA
molecule may be integrated within a chromosome, or it may be extra-
chromosomally
replicating DNA.
"Embryonic stem cells" or "ES cells" as used herein are cells or cell lines
usually derived from embryos which are pluripotent meaning that they are un-
39
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
differentiated cells. These cells are also capable of incorporating exogenous
DNA
by homologous recombination and subsequently developing into any tissue in the
body when incorporated into a host embryo. It is possible to isolate
pluripotent cells
from sources other than embryonic tissue by methods which are well understood
in
the art.
Embryonic stem cells in mice have enabled researchers to select for
transgenic cells and perform gene targeting. This allows more genetic
engineering
than is possible with other transgenic techniques. For example, mouse ES cells
are
relatively easy to grow as colonies in vitro. The cells can be transfected by
standard
procedures and transgenic cells clonally selected by antibiotic resistance.
See, for
example, Doetschman et al.., 1994, Gene transfer in embryonic stem cells. In
Pinkert (Ed.) Transgenic Animal Technology: A Laborator~r Handbook. Academic
Press Inc., New York, pp.115-146. Furthermore, the efficiency of this process
is
such that sufficient transgenic colonies (hundreds to thousands) can be
produced to
allow a second selection for homologous recombinants. Mouse ES cells can then
be
combined with a normal host embryo and, because they retain their potency, can
develop into all the tissues in the resulting chimeric animal, including the
germ cells.
The transgenic modification can then be transmitted to subsequent generations.
Methods for deriving embryonic stem (ES) cell lines in vitro from early
preimplantation mouse embryos are well known. See for example, Evans et al.,
1981 Nature 29: 154-6 and Martin, 1981, Proc. Nat. Acad. Sci. USA, 78: 7634-8.
ES
cells can be passaged in an undifferentiated state, provided that a feeder
layer of
fibroblast cells or a differentiation inhibiting source is present.
The term "somatic cell" indicates any animal or human cell which is not a
sperm or egg cell or is capable of becoming a sperm or egg cell. The term
"germ
cell" or "germ-line cell" refers to any cell which is either a sperm or egg
cell or is
capable of developing into a sperm or egg cell and can therefore pass its
genetic
information to offspring. The term "germ cell-line transgenic animal" refers
to a
transgenic animal in which the genetic information was incorporated in a germ
line
cell, thereby conferring the ability to transfer the information to offspring.
If such
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
offspring in fact possess some or all of that information, then they, too, are
transgenic animals.
The genetic alteration of genetic information may be foreign to the species of
animal to which the recipient belongs, or foreign only to the particular
individual
recipient. In the last case, the altered or introduced gene may be expressed
differently than the native gene.
"Fragment" of a gene refers to any portion of a gene sequence. A
"biologically active fragment" refers to any portion of the gene that retains
at least
one biological activity of that gene. For example, the fragment can perhaps
hybridize to its cognate sequence or is capable of being translated into a
polypeptide
fragment encoded by the gene from which it is derived.
"Variant" refers to a gene that is substantially similar in structure and
biological activity or immunological characteristics to either the entire gene
or to a
fragment of the gene. Provided that the two genes possess a similar activity,
they
are considered variant as that term is used herein even if the sequence of
encoded
amino acid residues is not identical. Preferentially, as used herein (unless
otherwise
defined) the variant is one of LRPS, HBM or LRP6. The variant preferably is
one that
yields an HBM-like phenotype (i.e., enhances bones mass and/or modulates lipid
levels). These variants include missense mutations, single nucleotide
polymorphisms (SNPs), mutations which result in changes in the amino acid
sequence of the protein encoded by the gene or nucleic acid, and combinations
thereof, as well as com in the exon domains of the H8M gene and mutations in
LRPS or LRP6 which result in an HBM like phenotype.
"Amplification of nucleic acids" refers to methods such as polymerase chain
reaction (PCR), ligation amplification (or ligase chain reaction, LCR) and
amplification methods based on the use of Q-beta replicase. These methods are
well known in the art and described, for example, in U.S. Patent Nos.
4,683,195 and
4,683,202. Reagents and hardware for conducting PCR are commercially
available.
Primers useful for amplifying sequences from the HBM region are preferably
complementary to, and hybridize specifically to sequences in the HBM region or
in
41
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
regions that flank a target region therein. HBM sequences generated by
amplification may be sequenced directly. Alternatively, the amplified
sequences)
may be cloned prior to sequence analysis.
"Antibodies" may refer to polyclonal and/or monoclonal antibodies and
fragments thereof, and immunologic binding equivalents thereof, that can bind
to the
HBM proteins and fragments thereof or to nucleic acid sequences from the HBM
region, particularly from the HBM locus or a portion thereof. Preferred
antibodies
also include those capable of binding to LRPS, LRP6 and HBM variants. The term
antibody is used both to refer to a homogeneous molecular entity, or a mixture
such
as a serum product made up of a plurality of different molecular entities.
Proteins
may be prepared synthetically in a protein synthesizer and coupled to a
carrier
molecule and injected over several months into rabbits. Rabbit sera is tested
for
immunoreactivity to the HBM protein or fragment. Monoclonal antibodies may be
made by injecting mice with the proteins, or fragments thereof. Monoclonal
antibodies will be screened by ELISA and tested for specific immunoreactivity
with
HBM protein or fragments thereof. Harlow et al., Antibodies: A Laboratory
Manual,
Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1988) and Using
Antibodies: A Laboratory Manual, Harlow, Ed and Lane, David (Cold Spring
Harbor
Press, 1999). These antibodies will be useful in assays as well as
pharmaceuticals.
By "antibody" is meant to include but not limited to polyclonal, monoclonal,
chimeric,
human, humanized, bispecific, multispecific, primatizedT"" antibodies.
"HBM protein" refers to a protein that is identical to a Zmax1 (LRPS) protein
except that it contains an alteration of glycine 171 to a valine. An HBM
protein is
defined for any organism that encodes a Zmax1 (LRPS) true homolog. For
example,
a mouse HBM protein refers to the mouse Zmax1 (LRPS) protein having the
glycine
170 to valine substitution.
By "HBM-like" is meant a variant of LRPS, LRP6 or HBM which when
expressed in a cell is capable of modulating bone mass, lipid levels, Dkk
activity,
and/or Wnt activity.
42
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
In one embodiment of the present invention, "H8M gene" refers to the
genomic DNA sequence found in individuals showing the HBM characteristic or
phenotype, where the sequence encodes the protein indicated by SEQ ID NO: 4.
The HBM gene and the Zmax1 (LRPS) gene are allelic. The protein encoded by the
H8M gene has the property of causing elevated bone mass, while the protein
encoded by the Zmax1 (LRPS) gene does not. The H8M gene and the Zmax1
(LRPS) gene differ in that the H8M gene has a thymine at position 582, while
the
Zmax1 gene has a guanine at position 582. The H8M gene comprises the nucleic
acid sequence shown as SEQ ID NO: 2. The H8M gene may also be referred to as
an "HBM polymorphism." Other HBM genes may further have silent mutations, such
as those discussed in Section 3 below.
In alternative embodiments of the present invention, "HBM gene" may also
refer to any allelic variant of Zmax1 (LRPS) or LRP6 which results in the HBM
phenotype. Such variants may include alteration from the wild-type protein
coding
sequence as described herein and/or alteration in expression control sequences
of
Zmax1 (LRPS) or contains an amino acid mutation in LRP5 or LRP6, such that the
resulting protein produces a phenotype which enhances bone mass and/or
modulates lipid levels. A preferred example of such a variant is an alteration
of the
endogenous Zmax1 (LRPS) promoter region resulting in increased expression of
the
Zmax1 (LRPS) protein.
"Normal," "wild-type," "unaffected", "Zmax1 ", "Zmax", "LR3" and "LRPS" all
refer to the genomic DNA sequence that encodes the protein indicated by SEQ ID
NO: 3. LRPS has also been referred to LRP7 in mouse. Zmax1, LRP5 and Zmax
may be used interchangeably throughout the specification and are meant to be
the
same gene, perhaps only relating to the gene in a different organism. The
Zmax1
gene has a guanine at position 582 in the human sequence. The Zmax1 gene of
human comprises the nucleic acid sequence shown as SEQ ID NO: 1. "Normal,"
"wild-type," "unaffected", "Zmax1" and "LRPS" also refer to allelic variants
of the
genomic sequence that encodes proteins that do not contribute to elevated bone
43
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
mass. The Zmax1 (LRPS) gene is common in the human population, while the HBM
gene is rare.
"Bone development" generally refers to any process involved in the change of
bone over time, including, for example, normal development, changes that occur
during disease states, and changes that occur during aging. This may refer to
structural changes and dynamic rate changes such as growth rates, resorption
rates,
bone repair rates, and etc. "Bone development disorder" particularly refers to
any
disorders in bone development including, for example, changes that occur
during
disease states and changes that occur during aging. Bone development may be
progressive or cyclical in nature. Aspects of bone that may change during
development include, for example, mineralization, formation of specific
anatomical
features, and relative or absolute numbers of various cell types.
"Bone modulation" or "modulation of bone formation" refers to the ability to
affect any of the physiological processes involved in bone remodeling, as will
be
appreciated by one skilled in the art, including, for example, bone resorption
and
appositional bone growth, by, inter alia, osteoclastic and osteoblastic
activity, and
may comprise some or all of bone formation and development as used herein.
Bone is a dynamic tissue that is continually adapting and renewing itself
through the renewal of old or unnecessary bone by osteoclasts and the
rebuilding of
new bone by osteoblasts. The nature of the coupling between these processes is
responsible for both the modeling of bone during growth as well as the
maintenance
of adult skeletal integrity through remodeling and repair to meet the everyday
needs
of mechanical usage. There are a number of diseases that result from an
uncoupling of the balance between bone resorption and formation. With aging
there
is a gradual "physiologic" imbalance in bone turnover, which is particularly
exacerbated in women due to menopausal loss of estrogen support, that leads to
a
progressive loss of bone. As bone mineral density falls below population norms
there is a consequent increase in bone fragility and susceptibility to
spontaneous
fractures. For every 10 percent of bone that is lost, the risk of fracture
doubles.
Individuals with bone mineral density (BMD) in the spine or proximal femur 2.5
or
44
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
more standard deviations below normal peak bone mass are classified as
osteoporotic. However, osteopenic individuals with BMD between 1 and 2.5
standard deviations below the norm are clearly at risk.
Bone is measured by several different forms of X-ray absorptiometry. All of
the instruments measure the inorganic or bone mineral content of the bone.
Standard DXA measurements give a value that is an areal density, not a true
density
measurement by the classical definition of density (mass/unit volume).
Nevertheless, this is the type of measurement used clinically to diagnose
osteoporosis. However, while BMD is a major contributing factor to bone
strength,
as much as 40% of bone strength stems from other factors including: 1 ) bone
size
(i.e., larger diameters increase organ-level stiffness, even in the face of
lower
density); 2) the connectivity of trabecular structures; 3) the level of
remodeling
(remodeling loci are local concentrators of strain); and 4) the intrinsic
strength of the
bony material itself, which in turn is a function of loading history (i.e.,
through
accumulated fatigue damage) and the extent of collagen cross-linking and level
of
mineralization. There is good evidence that all of these strength/fragility
factors play
some role in osteoporotic fractures, as do a host of extraskeletal influences
as well
(such as fall patterns, soft tissue padding, and central nervous system reflex
responsiveness).
Additional analytical instruments can be used to address these features of
bone. For example, the pQCT allows measurement of separate trabecular and
cortical compartments for size and density and the ,uCT provides quantitative
information on architectural features such as trabecular connectivity. The
,uCT also
gives a true bone density measurement. With these tools, the important non-BMD
parameters can be measured for diagnosing the extent of disease and the
efficacy of
treatments. Current treatments for osteoporosis are based on the ability of
drugs to
prevent or retard bone resorption. Although newer anti-resorptive agents are
proving
to be useful in the therapy of osteoporosis, they are viewed as short-term
solutions
to the more definitive challenge to develop treatments that will increase bone
mass
and/or the bone quality parameters mentioned above.
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
Thus, bone modulation may be assessed by measuring parameters such as
bone mineral density (BMD) and bone mineral content (BMC) by pDXA X-ray
methods, bone size, thickness or volume as measured by X-ray, bone formation
rates as measured for example by calcien labeling, total, trabecular, and mid-
shaft
density as measured by pQCT and/or,uCT methods, connectivity and other
histological parameters as measured by ,uCT methods, mechanical bending and
compressive strengths as preferably measured in femur and vertebrae
respectively.
Due to the nature of these measurements, each may be more or less appropriate
for
a given situation as the skilled practitioner will appreciate. Furthermore,
parameters
and methodologies such as a clinical history of freedom from fracture, bone
shape,
bone morphology, connectivity, normal histology, fracture repair rates, and
other
bone quality parameters are known and used in the art. Most preferably, bone
quality may be assessed by the compressive strength of vertebra when such a
measurement is appropriate. Bone modulation may also be assessed by rates of
change in the various parameters. Most preferably, bone modulation is assessed
at
more than one age.
"Normal bone density" refers to a bone density within two standard deviations
of a Z score of 0 in the context of the HBM linkage study. In a general
context, the
range of normal bone density parameters is determined by routine statistical
methods. A normal parameter is within about 1 or 2 standard deviations of the
age
and sex normalized parameter, preferably about 2 standard deviations. A
statistical
measure of meaningfulness is the P value which can represent the likelihood
that the
associated measurement is significantly different from the mean. Significant P
values are P < 0.05, 0.01, 0.005, and 0.001, preferably at least P < 0.01.
"HBM" refers to "high bone mass" although this term may also be expressed
in terms of bone density, mineral content, and size.
The "HBM phenotype" and "HBM-like phenotype" may be characterized by an
increase of about 2 or more standard deviations, preferably 2, 2.5, 3, or more
standard deviations in 1, 2, 3, 4, 5, or more quantitative parameters of bone
modulation, preferably bone density and mineral content and bone strength
46
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
parameters, above the age and sex norm for that parameter. The HBM phenotype
and HBM-like phenotype are characterized by statistically significant
increases in at
least one parameter, preferably at least 2 parameters, and more preferably at
least 3
or more parameters. The HBM phenotype and the HBM-like phenotype may also be
characterized by an increase in one or more bone quality parameters and most
preferably increasing parameters are not accompanied by a decrease in any bone
quality parameters. Most preferably, an increase in bone modulation parameters
and/or bone quality measurements is observed at more than one age. The HBM
phenotype and HBM-like phenotype also includes changes of lipid levels, Wnt
activity and/or Dkk activity.
The terms "isolated" and "purified" refer to a substance altered by hand of
man from the natural environment. An isolated peptide may be for example in a
substantially pure form or otherwise displaced from its native environment
such as
by expression in an isolated cell line or transgenic animal. An isolated
sequence
may for example be a molecule in substantially pure form or displaced from its
native
environment such that at least one end of said isolated sequence is not
contiguous
with the sequence it would be contiguous with in nature.
"Biologically active" refers to those forms of proteins and polypeptides,
including conservatively substituted variants, alleles of genes encoding a
protein or
polypeptide fragments of proteins which retain a biological and/or
immunological
activity of the wild-type protein or polypeptide. Preferably the activity is
one which
induces a change in Dkk activity, such as inhibiting the interaction of Dkk
with a
ligand binding partner (e.g., LRP5 or LRP6 or Dkk-1 with a Dkk-1 interacting
protein
such as those shown in Figure 5). By biologically active is also meant to
include any
form which modulates Wnt signaling.
By "modulate" and "regulate" is meant methods, conditions, or agents which
increase or decrease the wild-type activity of an enzyme, inhibitor, signal
transducer,
receptor, transcription activator, co-factor, and the like. This change in
activity can
be an increase or decrease of mRNA translation, mRNA or DNA transcription,
and/or
47
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
mRNA or protein degradation, which may in turn correspond to an increase or
decrease in biological activity.
By " modulated activity" is meant any activity, condition, disease or
phenotype
which is modulated by a biologically active form of a protein. Modulation may
be
effected by affecting the concentration or subcellular localization of
biologically active
protein, i.e., by regulating expression or degradation, or by direct agonistic
or
antagonistic effect as, for example, through inhibition, activation, binding,
or release
of substrate, modification either chemically or structurally, or by direct or
indirect
interaction which may involve additional factors.
By "effective amount" or "dose effective amount" or "therapeutically effective
amount" is meant an amount of an agent which modulates a biological activity
of the
polypeptide of the invention.
By "immunologically active" is meant any immunoglobulin protein or fragment
thereof which recognizes and binds to an antigen.
By "Dkk" is meant to refer to the nucleic acids and proteins of members of the
Dkk (Dickkopf) family. This includes, but is not limited to, Dkk-1, Dkk-2, Dkk-
3, Dkk-
4, Soggy, and related Dkk proteins. Dkk-1 is a preferred embodiment of the
present
invention. However, the Dkk proteins have substantial homology and one skilled
in
the art will appreciate that all of the embodiments of the present invention
utilizing
Dkk-1 may also be utilized with the other Dkk proteins.
By "Dkk-1" is meant to refer to the Dkk-1 protein and nucleic acids which
encode the Dkk-1 protein. Dkk-1 refers to Dickkopf-1, and in Xenopus it is
related to
at least Dkk-2, Dkk-3, and Dkk-4 (see Krupnik et al., Gene 238:301-313
(1999)).
Dkk-1 was first identified in Xenopus (Glinka et al., Nature 391:357-62
(1998)). It
was recognized as a factor capable of inducing ectopic head formation in the
presence of inhibition of the BMP pathway. It was then also found to inhibit
the axis-
inducing activity of several Xenopus Wnt molecules by acting as an
extracellular
antagonist of Wnt signaling. Mammalian homologs have been found including Dkk-
1, Dkk-2, Dkk-3, Dkk-4 and soggy (Fedi et al., 1999 and Krupnick et al. 1999).
Human Dkk-1 was also referred to as sk (Fedi et al. 1999). As used herein, Dkk-
1 is
48
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
meant to include proteins from any species having a Wnt pathway in which Dkk-1
interacts. Particularly preferred are mammalian species (e.g., murine,
caprine,
canine, bovine, feline, equine, primate, ovine, porcine and the like), with
particularly
preferred mammals being humans. Nucleic acid sequences encoding Dkk-1 include,
but are not limited to human Dkk-1 (GenBank Accession Nos. AH009834,
XM 005730, AF261158, AF261157, AF177394, AF127563 and NM 012242), Mus
musculus dickkopf homolog 1 (GenBank Accession No. NM 010051 ), and Danio
rerio dickkopf-1 (GenBank Accession Nos. AF116852 and AB023488). The genomic
sequences with exon annotation are GenBank Accession Nos. AF261157 and
AF261158. Also contemplated are homologs of these sequences which have Dkk-1
activity in the Wnt pathway. Dkk-1 amino acid sequences include, but are not
limited
to human dickkopf homolog 1 (GenBank Accession Nos. AAG15544, BAA34651,
NP 036374, AAF02674, AAD21087, and XP 005730), Danio rerio (zebrafish)
dickkopf1 (GenBank Accession Nos. BAA82135 and AAD22461 ) and murine
dickkopf-1 (GenBank Accession Nos. 054908 and NP 034181 ). Variants and
homologs of these sequences which possess Dkk-1 activity are also included
when
referring to Dkk-1.
By "Dkk mediated" disorder, condition or disease is any abnormal state that
involves Dkk activity. The abnormal state can be induced by environmental
exposure or drug administration. Alternatively, the disease or disorder can be
due to
a genetic defect. Dkk mediated diseases, disorders and conditions include but
are
not limited to bone mass disorders or conditions and lipid disorders and
conditions.
For example, bone mass disorders/conditions/diseases, which may be mediated by
Dkk, include but are not limited to age related loss of bone, bone fractures
(e.g., hip
fracture, Colle's fracture, vertebral crush fractures), chondrodystrophies,
drug-
induced disorders (e.g., osteoporosis due to administration of glucocorticoids
or
heparin and osteomalacia due to administration of aluminum hydroxide,
anticonvulsants, or glutethimide), high bone turnover, hypercalcemia,
hyperostosis,
osteogenesis imperfecta, osteomalacia, osteomyelitis, osteoporosis, Paget's
disease, osteoarthritis, and rickets.
49
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
Lipid disorders/diseases/conditions, which may be mediated by Dkk, include
but are not limited to familial lipoprotein lipase deficiency, familial
apoprotein CII
deficiency, familial type 3 hyperlipoproteinemia, familial
hypercholesterolemia,
familial hypertriglyceridemia, multiple lipoprotein-type hyperlipidemia,
elevated lipid
levels due to dialysis and/or diabetes, and elevated lipid levels of unknown
etiologies
The term "recognizes and binds," when used to define interactions of
antisense nucleotides, siRNAs (small inhibitory RNA),.or shRNA (short hairpin
RNA)
with a target sequence, means that a particular antisense, siRNA, or shRNA
sequence is substantially complementary to the target sequence, and thus will
specifically bind to a portion of an mRNA encoding polypeptide. As such,
typically
the sequences will be highly complementary to the mRNA target sequence, and
will
have no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 base mismatches throughout
the
sequence. In many instances, it may be desirable for the sequences to be exact
matches, i.e. be completely complementary to the sequence to which the
oligonucleotide specifically binds, and therefore have zero mismatches along
the
complementary stretch. As such, highly complementary sequences will typically
bind
quite specifically to the target sequence region of the mRNA and will
therefore be
highly efficient in reducing, and/or even inhibiting the translation of the
target mRNA
sequence into polypeptide product.
Substantially complementary oligonucleotide sequences will be greater than
about 80 percent complementary (or '% exact-match') to the corresponding mRNA
target sequence to which the oligonucleotide specifically binds, and will,
more
preferably be greater than about 85 percent complementary to the corresponding
mRNA target sequence to which the oligonucleotide specifically binds. In
certain
aspects, as described above, it will be desirable to have even more
substantially
complementary oligonucleotide sequences for use in the practice of the
invention,
and in such instances, the oligonucleotide sequences will be greater than
about 90
percent complementary to the corresponding mRNA target sequence to which the
oligonucleotide specifically binds, and may in certain embodiments be greater
than
about 95 percent complementary to the corresponding mRNA target sequence to
so
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
which the oligonucleotide specifically binds, and even up to and including
96%, 97%,
98%, 99%, and even 100% exact match complementary to the target mRNA to
which the designed oligonucleotide specifically binds.
Percent similarity or percent complementary of any of the disclosed
sequences may be determined, for example, by comparing sequence information
using the GAP computer program, version 6.0, available from the University of
Wisconsin Genetics Computer Group (UWGCG). The GAP program utilizes the
alignment method of Needleman and Wunsch (1970). Briefly, the GAP program
defines similarity as the number of aligned symbols (i.e., nucleotides or
amino acids)
which are similar, divided by the total number of symbols in the shorter of
the two
sequences. The preferred default parameters for the GAP program include: (1 )
a
unary comparison matrix (containing a value of 1 for identities and 0 for non-
identities) for nucleotides, and the weighted comparison matrix of Gribskov
and
Burgess (1986), (2) a penalty of 3.0 for each gap and an additional 0.10
penalty for
each symbol in each gap; and (3) no penalty for end gaps.
By "mimetic" is meant a compound or molecule that performs the same
function or behaves similarly to the compound mimicked.
By "reporter element" is meant a polynucleotide that encodes a poplypeptide
capable of being detected in a screening assays. Examples of polypeptides
encoded by reporter elements include, but are not limited to, IacZ, GFP,
luciferase,
and chloramphenicol acetyltransferase.
2. Introduction
A polymorphism in LRP5 (Zmax), G171V, designated as HBM, has been
identified as conferring a high bone mass phenotype in a population of related
subjects as described in co-pending applications International Patent
Application
PCT/US 00/16951, and U.S. Patent Application Nos. 09/543,771 and 09/544,398,
which are hereby incorporated by reference in their entirety (Little et al.,
Am J Hum
Genet. 70:11-19 (2002)). LRP5 is also described in International Patent
Application
WO 98/46743, which is incorporated by reference in its entirety. Loss of LRP5
s1
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
function has been shown to have a deleterious effect on bone (Gong et al.,
Cell
107:513-523 (2001 )). Additionally, the HBM polymorphism and LRP5 may also be
important in cardiac health and lipid-mediated disorders. Thus, methods of
regulating their activity can serve as methods of treating and/or preventing
cardiac
and lipid-mediated disorders.
Recent studies have indicated that LRP5 participates in the Wnt signal
transduction pathway. The Wnt pathway is critical in limb early embryological
development. A recently published sketch of the components of Wnt signaling is
shown in Figure 1
(Nusse, 2001 http://www.stanford.edu/~rnusse/pathways/cell2.html) (see also,
Nusse, Nature 411:255-6 (2001 ); and Mao ef al., Nature 411:321-5 (2001 )).
Briefly
summarized, Wnt proteins are secreted proteins which interact with the
transmembrane protein Frizzled (Fz). LRP proteins, such as LRP5 and LRP6, are
believed to modulate the Wnt signal in a complex with Fz (Tamai et al., Nature
407:530-5 (2000)). The Wnt pathway acts intracellularly through the Disheveled
protein (Dsh) which in turn inhibits glycogen synthetase kinase-3 (GSK3) from
phosphorylating ~i-catenin. Phosphorylated (3-catenin is rapidly degraded
following
ubiquitination. However, the stabilized ~i-catenin accumulates and
translocates to
the nucleus where it acts as a cofactor of the T-cell factor (TCF)
transcription
activator complex.
The protein dickkopf-1 (Dkk-1 ) is reported to be an antagonist of Wnt
pathway. Dkk-1 is required for head formation in early development. Dkk-1 and
its
function in the Wnt pathway are described in e.g., Krupnik, et al., Gene
238:301-13
(1999); Fedi et al., J. Biol. Chem. 274:19465-72 (1999); see also for Dkk-1
and the
Wnt pathway, Wu et al., Curr. Biol. 10:1611-4 (2000), Shinya et al., Mech.
Dev. 98:3-
17 (2000), Mukhopadhyay et al., Dev Cell 1:423-434 (2001 ) and in PCT Patent
Application No. WO 00/52047, and in references cited in each. It has been
known
that Dkk-1 acts upstream of Dsh, however the nature of the mechanism of
inhibition
by Dkk-1 is just beginning to be elucidated. Dkk-1 is expressed in the mouse
embryonic limb bud and its disruption results in abnormal limb morphogensis,
among
s2
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
other developmental defects (Gotewold et al., Mech. Dev. 89:151-3 (1999); and,
Mukhopadhyay et al., Dev Cell 1:423-434 (2001 )).
Related U.S. provisional application 60/291,311 disclosed a novel interaction
between Dkk-1 (GenBank Accession No. XM 005730) and LRPS. The interaction
between Dkk-1 and LRPS was discovered by a yeast two hybrid (Y2H) screen for
proteins which interact with the ligand binding domain of LRPS, as described
in
Example 1. The two-hybrid screen is a common procedure in the art, which is
described, for example, by Gietz et al., Mol. Cell. Biochem. 172:67-79 (1997);
Young, Biol. Reprod. 58:302-11 (1998); Brent and Finley, Ann. Rev. Genef.
31:663-
704 (1997); and Lu and Hannon, eds., Yeast Hybrid Technologies, Eaton
Publishing,
Natick MA, (2000). More recently, other studies confirm that Dkk-1 is a
binding
partner for LRP and modulates the Wnt pathway via direct binding with LRP (R.
Nusse, Nature 411:255-256 (2001 ); A. Bafico et al., Nat. Cell Biol. 3:683-686
(2001 );
M. Semenov, Curr. Biol. 11:951-961 (2001 ); B. Mao, Nature 411:321-325 (2001
),
Zorn, Curr. Biol. 11:8592-5 (2001 )); and, L. Li et al., J. Biol Chem.
277:5977-81
(2002)).
Mao and colleagues (2001 ) identified Dkk-1 as a ligand for LRP6. Mao et al.
suggest that Dkk-1 and LRP6 interact antagonistically where Dkk proteins
inhibit the
Wnt coreceptor functions of LRP6. Using co-immunoprecipitation, the group
verified
that the Dkk-1/LRP6 interaction was direct. Dkk-2 was also found to directly
bind
LRP6. Contrary to data contained in provisional application 60/291,311, Mao et
al.
report that no interaction was detected between any Dkk protein and LRPS, as
well
as no interaction with LDLR, VLDLR, ApoER, or LRP). Additionally, Mao et al.
demonstrated that LRP6 can titrate Dkk-1's effects of inhibiting Wnt signaling
using
the commercial TCF-luciferase reporter gene assay (TOPFLASH). A similar
conclusion was drawn from analogous studies in Xenopus embryos. Deletion
analyses of LRP6 functional domains revealed that EGF repeats (beta-
propellers) 3
and 4 were necessary for Dkk-1 binding and that the ligand binding domains of
LRP6
had no effect on Dkk-1 binding. The findings of Mao et al. contrast with data
obtained by the present inventors indication that the ligand binding domains
of LRP5
53
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
were necessary and sufficient for Dkk-1 binding in yeast. Using classical
biochemical ligand-receptor studies, Mao et al. determined a Kd=0.34 nM for
Dkk-
1/LRP6 and a Kd=0.73 nM for Dkk-2/LRP6.
Semenov et al. (2001 ) verified the Mao group's results and confirmed by
coimmunoprecipitation that Dkk-1 does not directly bind to Wnt or Frizzled but
rather
interacts with LRP6. Their Scatchard analyses found a Kd=0.5 nM for Dkk-
1/LRP6.
Semenov et al, also demonstrated that Dkk-1 could abolish an LRPS/Frizzled8
complex implying that Dkk-1 can also repress Wnt signaling via interactions
with
LRPS. A Dkk-1 mutant where cysteine 220 was changed to alanine abolished LRP6
binding and was unable to repress Wnt signaling. Studies in Xenopus embryos
confirmed the results and revealed a functional consequence of Dkk-1/LRP6:
repression of Wnt signaling. Their Xenopus work also suggested that LRP6/Dkk-1
may be specific for the canonical, ~i-catenin-mediated, Wnt pathways as
opposed to
the Wnt Planar Cell Polarity pathway.
Bafico et al. (2001 ) employed a'251-labeled Dkk-1 molecule to identify LRP6
as its sole membrane receptor with a Kd=0.39 nM. Again, the functional
consequences of the Dkk-1 /LRP6 interaction was a repression of the canonical
Wnt
signaling even when Dkk-1 was added at extremely low concentrations (30 pM).
Not wishing to be bound by theory, it is believed that the present invention
provides an explanation for the mechanism of Dkk-1 inhibition of the Wnt
pathway
and provides a mechanism whereby the Wnt pathway may be modulated. The
present application and related provisional application 60/291,311 describe
Dkk-
1/LRP5 interactions and demonstrate that the interaction between LRPS/LRP6/HBM
and Dkk can be used in a method as an intervention point in the Wnt pathway
for an
anabolic bone therapeutic or a modulator of lipid metabolism.
As detailed below, in the section "Methods to Identify Binding Partners" and
Examples 6 and 7, Dkk-1 is able to repress LRPS-mediated Wnt signaling but not
HBM-mediated Wnt signaling. This observation is of particular interest because
the
HBM mutation in LRP5 is a gain of function or activation mutation. That is,
Wnt
signaling, via the canonical pathway, is enhanced with HBM versus LRPS. The
54
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
present data suggest the mechanism of this functional activation: the
inability of Dkk-
1 to repress HBM-mediated Wnt signaling. Further investigations of other Wnt
or
Dkk family members show differential activities in the canonical Wnt pathway
that
demonstrate the complexity and variability in Wnt signaling that can be
achieved
depending on the LRP/Dkk/Wnt/Frizzled repertoire that is expressed in a
particular
cell or tissue. This may attest to the apparent bone specificity of the HBM
phenotype
in humans and in the HBM transgenic animals.
Furthermore, the present data reveal the importance and functional
consequence for the potential structural perturbation of the first beta-
propeller
domain of LRPS. Our data identified the ligand binding domain of LRP5 as the
interacting region with Dkk-1 while the Mao et al. publication demonstrated
the
functional role of propellers 3 and 4 in their LRP6/Dkk-1 studies. In the
present
invention, we implicate the first beta propeller domain, via the HBM mutation
at
residue 171, as having a functional consequence in the Dkk-1-mediated Wnt
pathway. The involvement of position 171 of propeller 1 may be direct or
indirect
with Dkk-1. Direct involvement could arise from perturbations of the 3-
dimensional
structure of the HBM extracellular domain that render Dkk-1 unable to bind.
Alternatively, residue 171 of propeller 1 may directly interact with Dkk-1;
however, by
itself, it is insufficient to bind and requires other LRP5 domains. Potential
indirect
candidate molecules may be among the proteins identified the Dkk-1 yeast-two-
hybrid experiments.
It may be that the disruption of Dkk activity is not necessarily mediated by
enhancing or preventing the binding of Dkk to LRPS/LRP6/HBM. More than one
mechanism may be involved. Indeed, the inventors have observed that Dkk-1
binds
LRPS, LRP6, and HBM. It is able to effectively inhibit LRP6, and to a slightly
lesser
extent, LRP5 activity. Further, has been observed that different members of
the Dkk
family differentially affect LRPS/LRP6/HBM activity. For example, Dkk-1
inhibits
LRPS/LRP6/HBM activity while another Dkk may enhance LRPS/LRP6/HBM activity.
An endpoint to consider is the modulation of the LRPS/LRP6/HBM activity, not
simply
binding.
ss
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
The present disclosure shows that targeting the disruption of the Dkk-1/LRP5
interaction is a therapeutic intervention point for an HBM mimetic agent. A
therapeutic agent of the invention may be a small molecule, peptide or nucleic
acid
aptamer, antibody, or other peptide/protein, etc. Methods of reducing Dkk-1
expression may also be therapeutic using methodologies such as: RNA
interference,
antisense oligonucleotides, morpholino oligonucleotides, PNAs, antibodies to
Dkk-1
or Dkk-1 interacting proteins, decoy or scavenger LRP5 or LRP6 receptors, and
knockdown of Dkk-1 or Dkk-1 interactor transcription.
In an embodiment of the present invention, the activity of Dkk-1 or the
activity
of a Dkk-1 interacting protein may be modulated for example by binding with a
peptide aptamer of the present invention. In another embodiment, LRP5 activity
may be modulated by a reagent provided by the present invention (e.g., a
peptide
aptamer). In another embodiment, the Dkk-1/LRP5 interaction may be modulated
by
a reagent of the present invention (e.g., a Dkk-1 interacting protein such as
those
identified in Figure 5). In another embodiment, the Wnt signal transduction
pathway
may be modulated by use of one or more of the above methods. In a preferred
embodiment of the present invention, the Dkk-1 mediated activity of the Wnt
pathway may be specifically modulated by one or more of the above methods. In
another preferred embodiment of the present invention, the Wnt signal
transduction
pathway may be stimulated by down-regulating Dkk-1 interacting protein
activity;
such down-regulation could, for example, yield greater LRP5 activity. In a
more
preferred embodiment, by stimulating LRP5 activity, bone mass regulation may
be
stimulated to restore or maintain a more optimal level. In another preferred
embodiment, by stimulating LRP5 activity, lipid metabolism may be stimulated
to
restore or maintain a more optimal level. Alternative embodiments provide
methods
for screening candidate drugs and therapies directed to correction of bone
mass
disorders or lipid metabolism disorders. And, preferred embodiments of the
present
invention provide drugs and therapies developed by the use of the reagents
and/or
methods of the present invention. One skilled in the art will understand that
the
present invention provides important research tools to develop an effective
model of
56
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
osteoporosis, to increase understanding of bone mass and lipid modulation, and
to
modulate bone mass and lipid metabolism.
Previous investigation of a large family in which high bone mass is inherited
as a single gene (autosomal dominant) trait (HBM-1 ) has provided important
insight
into the mechanism by which bone density might be modulated. Members of this
family have significantly increased spinal and hip BMD (>3 standard deviations
above the norm) which affects young adults as well as elderly family members
into
the ninth decade. The bones of affected members, while appearing very dense
radiographically, have normal external shape and outer dimensions. Cortical
bone is
thickened on endosteal surfaces and "affected" individuals are asymptomatic
without
any other phenotypic abnormalities. Assays of biochemical markers that reflect
skeletal turnover suggest that the disorder is associated with a normal rate
of bone
remodeling. Affected individuals have achieved a balance in bone turnover at a
density that is significantly greater than necessary for normal skeletal
stresses.
Importantly, the bones most affected are load-bearing bones which are
subjected to
the greatest mechanical and gravitational stresses (spine and hip). These are
the
most important bones to target fir therapeutic interventions in osteoporosis.
The
gene identified as being responsible for this phenotype, Zmax or LRPS, was not
previously associated with bone physiology. The fact that modification of this
gene,
such as that produced by the polymorphism leading to the autosomal dominant
inheritance of the HBM family phenotype, identifies Zmax/LRP5 and the pathway
by
which it is regulated, including Dkk/Wnt pathways discussed above, as an
important
target for developing modulators of bone density. Modulation of Zmax/LRP5 to
mimic the gain in function provided by the HBM polymorphism would be expected
to
provide an important therapy for bone wasting conditions. Additionally, such
modulation in young adults could enhance peak bone mass and prevent or delay
fracture risk later in life. Alternatively, modulation to reduce function
could be
employed to treat conditions where bone is being inappropriately produced.
s~
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
3. PolXpeptides
Polypeptides contemplated for use in this invention include those which
modulate Dkk and Dkk interacting protein activities. Preferred polypeptides
and
peptides include those which modulate the Wnt pathway. Examples of preferred
sequences include the Y2H baits exemplified in Figure 2, peptide aptamers of
Figure
3 (SEQ ID NOs:171-188) and Figure 4 (SEQ ID NOs:189-192), the polypeptides of
the Dkk-1 interacting proteins identified in Figure 5, those polypeptides
shown in
Figure 6, the LRP binding domain of Dkk (amino acids 138-266 of hDkk1 ), the
cysteine-rich domain 2 (a.a. 183-245 of hDkk-1 ), the cysteine-rich domain 1
(a.a. 97-
138 of hDkk), and LRP5 binding aptamers of Figure 13 (including SEQ ID NOs:204-
213). Although Dkk-1 is exemplified, the other Dkk proteins contain
substantially
similar regions and may also be used according to the present invention.
For example, the baits depicted in Figure 2 were used in a yeast two hybrid
(Y2H) screen. The Y2H screen was performed as described in Example 2 to
determine the minimum required binding domain for Dkk-1 to bind LRPS. The
minimum binding domain constructs (i.e., residues 139-266 in bold below and
residues 97-245 which are underlined, of Dkk-1 ) include the second cysteine
rich
domain which has sequence homology to a colipase fold.
mmalgaagat rvfvamvaaa lgghpllgvs atlnsvlnsn aiknlppplg gaaghpgsav 60
saapgilypg gnkyqtidny c~ypcaedee cgtdeyca~ trgcxdagv-gi clacrkrrkr 120
cmrhamccpg nyckngicvs sdgnhfraei eetitesfgn dhstldqJrsr rttlsskmyh 180
tkggeasvcl rssdcasglc carhfwskic kpvlkegqvc tkhrrkashg~ leifarcyca 240
ealscriqkd hhqasnssrl htcqrh (GenBank Accession No. XP 005730) (SEQ ID
N0:128).
This homology suggests a lipid-binding function and may facilitate Dkk-1
interactions
at the plasma membrane (van Tilbeurgh, H., Biochim. Biophys. Acta. 1441:173-84
(1999)). An interaction domain of Dkk-1 that is able to interact with the
ligand
binding domain (LBD) of LRPS is a useful reagent in the modulation of LRPS
activity
s8
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
and modulation of Dkk-1/LRP5 complex formation. Similar screens can be
prepared
for Dkk-1 and Dkk-1 interacting proteins or polypeptides.
A set of peptide aptamers was identified from a library of random peptides
constrained and presented in a thioredoxin A (trxA) scaffold as described in
Example
3. Peptide aptamers are powerful new tools for molecular medicine as reviewed
by
Hoppe-Seyler & Butz, J. Mol. Med., 78:426-430 (2000); Brody and Gold, Rev.
Mol.
Biotech., 74:5-13 (2000); and Colas, Curr. Opin. in Chem. Biol. 4:54-9 (2000)
and
the references cited therein. Briefly, peptide aptamers have been shown to be
highly,
specific reagents capable of binding in vivo. As such, peptide aptamers
provide a
method of modulating the function of a protein and may serve as a substitute
for
conventional knock-out methods, knock-down or complete loss of function.
Peptide
aptamers are also useful reagents for the validation of targets for drug
development
and may be used as therapeutic compounds directly or provide the necessary
foundation for drug design. Once identified, the peptide insert may be
synthesized
and used directly or incorporated into another carrier molecule. References
reviewed and cited by Brody and Gold (2000, supra) describe demonstrated
therapeutic and diagnostic applications of peptide aptamers and would be known
to
the skilled artisan.
The peptide aptamers of the present invention are useful reagents in the
binding of Dkk-1 to its ligands and thereby modulation of the Wnt pathway and
may
be used to prevent Dkk-1 from inhibiting LRP5 modulation or Dkk-1 interacting
protein modulation of the Wnt pathway. The sequence of these peptide aptamers
is
shown in Figure 3 (SEQ ID NOs:171-188). The peptide aptamers refers to the
peptide constrained by the thioredoxin scaffold. The aptamers are also
contemplated as therapeutic agents to treat Dkk-1 mediated diseases and
conditions. Such aptamers are useful structural guides to chemists, for the
design of
mimetic compounds of the aptamers.
Peptide aptamers were likewise developed to the LRP5 ligand binding domain
(LBD) bait sequences. The sequences of these peptide aptamers is shown in
Figure
4 (SEQ ID NOs:189-192). These are useful reagents which may be used to disrupt
59
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
the Dkk-1/LRP5 binding interface while leaving Dkk-1 undisturbed. These can be
used as comparative controls for Wnt signaling, thus, a control is provided
for the
specificity of any drug or therapy screened. The aptamers are also useful
therapeutic agents to treat LRP mediated diseases and conditions. Such
aptamers
may also be used as structural guides to chemists, for the design of mimetic
compounds of the aptamers.
Thirty proteins were identified which interact with Dkk-1, Dkk-1 interacting
proteins, were identified in a yeast-two-hybrid screen using the Dkk-1 bait
and are
shown in Figure 5. It was noted that these results suggest an interaction of
Dkk-1
with Notch-2. It has been suggested that cross-talk exists between the Wnt and
Notch signaling pathways. For instance, Presenilin1 (Ps1 ) is required for
Notch
processing and inhibits the downstream Wnt pathway. The extracellular domain
of
Notch is thought to interact with Wnt. Furthermore, the Notch intracellular
domain is
thought to interact with disheveled and in signal induced processing, the
intracellular
domain is thought to interact with presenilin. (Soriano et al., J. Cell Biol.
152:785-94
(2001 )). For additional information regarding the relationships between Notch
and
Wnt signaling, see Wesley, Mol. Cell. Biol. 19:5743-58 (1999) and Axelrod et
al.,
Science 271:1826-32 (1996).
An interaction between Dkk-1 and chordin has also been noted; suggesting
that cross-talk exists between the Wnt and TGF-beta/BMP signaling pathways
(Letamendia et al., J. Bone Joint Surg. Am. 83A:S31 (2001 ); Labbe et al.,
Proc. Natl.
Acad. Sci. USA 97:8358-63 (2000); Nishita et al., Nature 403:781-5 (2000);
DeRobertis et al., Int. J. Dev. Biol. 45:1389-97 (2001 ); and Saint-Jeannet et
al., Proc.
Natl. Acad. Sci. USA 94:13713-8 (1997)). The BMP signaling pathway has an
established role in bone and connective tissue development, repair and
homeostasis
(review in Rosen and Wozney "Bone Morphogenetic Proteins" In: Principles of
Bone
Biology, 2"d Edition, Eds. J. Bilezikian, L. Raisz and G. Rodan, Academic
Press, pp.
919-28 (2002)). Chordin is an important molecule during development which also
modulates BMP signaling in adults by sequestering BMPs in latent complexes
(Piccolo et al., Cell 86:589-98 (1996) reviewed in Reddi, Arthritis Res. 3:1-5
(2001 );
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
DeRobertis et al., Int. J. Dev. Biol. 45:189-97 (2001 )). It may be that Dkk
effects
bone mass modulation through both the Wnt signaling pathway via LRP and the
BMP pathway via chordin.
Moreover, a number of putative growth factors, growth factor related proteins,
and extracellular matrix proteins have been identified as Dkk-1 interacting
proteins.
Additional information regarding Dkk-1 interacting proteins identified in the
Y2H
assay may be obtained from publicly available databases such as PubMed via the
use of the accession numbers provided in the present application. In a
preferred
embodiment of the invention, the amino acid sequences of these Dkk-1
interacting
proteins or biologically active fragments thereof be used to modulate Dkk, Dkk-
1,
LRPS, LRP6, HBM, or Wnt activity. Although these proteins were identified as
interacting with Dkk-1, due to the substantial homology between the various
Dkk
proteins, such interacting proteins are contemplated to interact with the
other Dkk
family members.
4. Ahtamer Mimetics
The present invention further provides for mimetics of Dkk, particularly Dkk-
1,
and LRP5 peptide aptamers. Such aptamers may serve as structural guides to
chemists for the design of mimetic compounds of the aptamers. The aptamers and
their mimetics are useful as therapeutic agents to treat LRP- or Dkk-mediated
diseases and conditions.
5. Nucleic Acid Molecules
The present invention further provides nucleic acid molecules that encode
polypeptides and proteins which interact with Dkk and Dkk interacting
proteins,
and/or LRPS (also LRP6 and HBM) to modulate biological activities of these
proteins. Preferred embodiments provide nucleic acids encoding for fragments
of
Dkk-1 protein, including the nucleic acids of Figure 7, the Dkk-1 interacting
proteins
listed in Figure 5, polypeptide aptamers of Dkk-1 (Figure 3 - SEQ ID NOs:171-
188),
LRP5 (Figure 4 - SEQ ID NOs:189-192), Figure 13 peptide aptamers (including
SEQ
61
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
ID N0:204-214) encoded by Figure 12 polynucleotides (including SEQ ID N0:193-
203), LRP6 and HBM and the related fusion proteins herein described,
preferably in
isolated or purified form. As used herein, "nucleic acid" is defined as RNA,
DNA, or
cDNA that encodes a peptide as defined above, or is complementary to a nucleic
acid sequence encoding such peptides, or hybridizes to either the sense or
antisense strands of the nucleic acid and remains stably bound to it under
appropriate stringency conditions. The nucleic acid may encode a polypeptide
sharing at least about 75% sequence identity, preferably at least about 80%,
and
more preferably at least about 85%, with the peptide sequences; at least about
90%,
95%, 96%, 97%, 98%, and 99% or greater are also contemplated. Specifically
contemplated are genomic DNA, cDNA, mRNA, antisense molecules, enzymatically
active nucleic acids (e.g., ribozymes), as well as nucleic acids based on an
alternative backbone or including alternative bases, whether derived from
natural
sources or synthesized. Such hybridizing or complementary nucleic acids,
however,
are defined further as being novel and nonobvious over any prior art nucleic
acid
including that which encodes, hybridizes under appropriate stringency
conditions, or
is complementary to a nucleic acid encoding a protein according to the present
invention.
As used herein, the terms "hybridization" (hybridizing) and "specificity"
(specific for) in the context of nucleotide sequences are used
interchangeably. The
ability of two nucleotide sequences to hybridize to each other is based upon
the
degree of complementarity of the two nucleotide sequences, which in turn is
based
on the fraction of matched complementary nucleotide pairs. The more
nucleotides in
a given sequence that are complementary to another sequence, the greater the
degree of hybridization of one to the other. The degree of hybridization also
depends on the conditions of stringency which include temperature, solvent
ratios,
salt concentrations, and the like. In particular, "selective hybridization"
pertains to
conditions in which the degree of hybridization of a polynucleotide of the
invention to
its target would require complete or nearly complete complementarity. The
complementarity must be sufficiently high so as to assure that the
polynucleotide of
62
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
the invention will bind specifically to the target nucleotide sequence
relative to the
binding of other nucleic acids present in the hybridization medium. With
selective
hybridization, complementarity will be about 90-100%, preferably about 95-
100%,
more preferably about 100%.
"Stringent conditions" are those that (1 ) employ low ionic strength and high
temperature for washing, for example: 0.015 M NaCI, 0.0015 M sodium titrate,
0.1
SDS at 50°C; or (2) employ during hybridization a denaturing agent
such as
formamide, for example, 50% (vol/vol) formamide with 0.1 % bovine serum
albumin,
0.1 % Ficoll, 0.1 % polyvinylpyrrolidone, 50 mM sodium phosphate buffer at pH
6.5
with 750 mM NaCI, 75 mM sodium citrate at 42°C. Another example is use
of 50%
formamide, 5X SSC (0.75 M NaCI, 0.075 M sodium citrate), 50 mM sodium
phosphate (pH 6.8), 0.1 % sodium pyrophosphate, 5X Denhardt's solution,
sonicated
salmon sperm DNA (50 ug/ml), 0.1 % SDS, and 10% dextran sulfate at
42°C, with
washes at 42°C in 0.2X SSC and 0.1 % SDS. A skilled artisan can readily
determine
and vary the stringency conditions appropriately to obtain a clear and
detectable
hybridization signal.
As used herein, a nucleic acid molecule is said to be "isolated" or "purified"
when the nucleic acid molecule is substantially separated from contaminant
nucleic
acid encoding other polypeptides from the source of nucleic acid. Isolated or
purified
is also meant to include nucleic acids which encode Dkk or fragments thereof
which
lack surrounding genomic sequences that flank the Dkk gene. Isolated or
purified is
further intended to include nucleic acids which encode Dkk interacting
proteins or
biologically active fragments thereof which lack surrounding genomic sequences
that
flank the Dkk interacting protein genes.
The present invention further provides fragments of the encoding nucleic acid
molecule. As used herein, a fragment of an encoding nucleic acid molecule
refers to
a small portion of the entire protein encoding sequence. The size of the
fragment
will be determined by the intended use. For example, if the fragment is chosen
so as
to encode an active portion of the protein, the fragment will need to be large
enough
to encode the functional regions) of the protein. If the fragment is to be
used as a
63
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
nucleic acid probe or PCR primer, then the fragment length is chosen so as to
obtain
a relatively small number of false positives during probing/priming.
Fragments of the encoding nucleic acid molecules of the present invention
(i.e., synthetic oligonucleotides) that are used as probes or specific primers
for the
polymerise chain reaction (PCR), or to synthesize gene sequences encoding
proteins of the invention can easily be synthesized by chemical techniques,
for
example, the phosphotriester method of Matteucci et al. (J. Am. Chem. Soc.
103:3185-3191 (1981 )) or using automated synthesis methods. In addition,
larger
DNA segments can readily be prepared by well known methods, such as synthesis
of a group of oligonucleotides that define various modular segments of the
gene,
followed by ligation of oligonucleotides to build the complete modified gene.
The polypeptide encoding nucleic acid molecules of the present invention may
further be modified to contain a detectable label for diagnostic and probe
purposes.
A variety of such labels are known in the art and can readily be employed with
the
encoding molecules herein described. Suitable labels include, but are not
limited to,
biotin, radiolabeled nucleotides and the like. A skilled artisan can employ
any of the
art known labels to obtain a labeled encoding nucleic acid molecule.
Modifications to the primary structure itself by deletion, addition, or
alteration
of the amino acids incorporated into the protein sequence during translation
can be
made without destroying the activity of the protein. Such substitutions or
other
alterations result in proteins having an amino acid sequence encoded by a
nucleic
acid falling within the contemplated scope of the present invention.
Antisense molecules corresponding to the polypeptide coding or
complementary sequence may be prepared. Methods of making antisense
molecules which bind to mRNA, form triple helices or are enzymatically active
and
cleave TSG RNA and single stranded DNA (ssDNA) are known in the art. See,
e.g.,
Antisense and Riboz~rme Methodolo~c v:Laborator,~r Companion (Ian Gibson, ed.,
Chapman & Hall, 1997) and Riboz~rme Protocols: Methods in Molecular Biology
(Phillip C. Turner, ed., Humana Press, Clifton, NJ, 1997).
64
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
Also contemplated is the use of compounds which mediate postranscriptional
gene silencing (PTGS), quelling and RNA interference (RNAi). These compounds
typically are about 21 to about 25 nucleotides and are also known as short
interfering
RNAs or short inhibitory RNAs (siRNAs). The siRNAs are produced from an
initiating double stranded RNA (dsRNA). Although the full mechanism by which
the
siRNAs function is not fully elucidated, it is known that these siRNAs
transform the
target mRNA into dsRNA, which is then degraded. Preferred forms are 5'
phosphorylated siRNAs, however, hydroxylated forms may also be utilized. For
additional background regarding the preparation and mechanism of siRNAs
generally, see, e.g., Lipardi et al., Cell 107(3): 297-307 (2001 ); Boutla et
al., Curr.
Biol. 11 (22): 1776-80 (2001 ); Djikeng et al., RNA 7(11 ): 1522-30 (2001 );
Elbashir et
al., EMBO J. 20(23): 6877-88 (2001 ); Harborth et al., J. Cell. Sci. 114(Pt.
24): 4557-
65 (2001 ); Hutvagner et al., Science 293(5531 ): 811-3 (2001 ); and Elbashir
et al.,
Nature 411:494-98 (2001 ).
Also contemplated are short hairpin RNAs (shRNAs). shRNAs are a
modification of the siRNA method described above. Instead of transfecting
exogenously synthesized dsRNA into a cell, sequence-specific silencing can be
achieved by stabling expressing siRNA from a DNA template as a fold-back stem-
loop, or hairpin. This approach is known as shRNA. This method permits the
analysis of loss of function phenotypes due to sequence-specific gene
silencing in
mammalian cells by avoiding many of the problems associated with siRNAs, such
as
RNase degradation of the reagents, expensive chemical synthesis, etc. For
additional background regarding the preparation and mechanism of shRNAs
generally, see, e.g., Yu et al., PNAS 99:6047-6052 (2002); Paddison et al.,
Genes
and Devel. 16:948-58 (2002); and Brummelkamp et al., Science 296:550-553
(2002).
For additional background on the use of this method in mammalian gene
knockdown
methodologies, see Tuschl, Nature Biotech. 20:446-448 (2002) (and references
therein).
In one preferred embodiment, the siRNA or shRNA is directed to a Dkk
encoding mRNA, wherein a preferred Dkk is Dkk-1. In another embodiment, the
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
siRNA or shRNA is directed towards a protein which binds to and modulates the
activity of or is modulated by a Dkk; these proteins include LRPS, LRP6 and
HBM as
well as other members of the Wnt pathway.
6. Isolation of Other Related Nucleic Acid Molecules
The identification of the nucleic acid molecule of Dkk allows a skilled
artisan to
isolate nucleic acid molecules that encode other members of the Dkk family
(see,
Krupnik et al., 1999). Further, the presently disclosed nucleic acid molecules
allow
a skilled artisan to isolate nucleic acid molecules that encode Dkk-1-like
proteins, in
addition to Dkk-1. The presently disclosed Dkk-1 interacting proteins and
their
corresponding nucleic acid molecules allows a skilled artisan to further
isolate other
related protein family members which interact with Dkk-1.
A skilled artisan can readily use the amino acid sequence of Dkk and Dkk
interacting proteins to generate antibody probes to screen expression
libraries
prepared from appropriate cells. Typically, polyclonal antiserum from mammals
such
as rabbits immunized with the purified protein (as described below) or
monoclonal
antibodies can be used to probe a mammalian cDNA or genomic expression
library,
such as a human macrophage library, to obtain the appropriate coding sequence
for
other members of the protein family. The cloned cDNA sequence can be expressed
as
a fusion protein, expressed directly using its own control sequences, or
expressed by
constructions using control sequences appropriate to the particular host used
for
expression of the desired protein.
Alternatively, a portion of the coding sequence herein described can be
synthesized and used as a probe to retrieve DNA encoding a member of the
protein
family from any mammalian organism. Oligomers containing approximately 18-20
nucleotides (encoding about a 6-7 amino acid stretch) are prepared and used to
screen
genomic DNA or cDNA libraries to obtain hybridization under stringent
conditions or
conditions of sufficient stringency to eliminate an undue level of false
positives.
Additionally, pairs of oligonucleotide primers can be prepared for use in a
polymerase chain reaction (PCR) to selectively clone an encoding nucleic acid
66
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
molecule. A PCR denature/anneal/extend cycle for using such PCR primers is
well
known in the art and can readily be adapted for use in isolating other
encoding nucleic
acid molecules. For example, degenerate primers can be utilized to obtain
sequences
related to Dkk-1 or Dkk-1 interacting proteins. Primers can be designed that
are not
perfectly complementary and can still hybridize to a portion of a target
sequence or
flanking sequence and thereby provide for amplification of all or a portion of
a target
sequence. Primers of about 20 nucleotides or less, preferably have about one
to three
mismatches located at the 5' and/or 3' ends. Primers of about 20 to 30
nucleotides
have up to about 30% mismatches and can still hybridize to a target sequence.
Hybridization conditions for primers with mismatch can be determined by the
method
described in Maniatis et al., Molecular Cloning: A Laborator)r Manual (Cold
Spring
Harbor Laboratory, Cold Spring Harbor, NY, 1982) or by reference to known
methods.
The ability of the primer to hybridize to a sequence of either Dkk-1, a Dkk-1
interacting
protein, or a related sequence under varying conditions can be determined
using this
method. Because a target sequence is known, the effect of mismatches can be
determined by methods known to those of skill in the art. Degenerate primers
would be
based on putative conserved amino acid sequences of the Dkk-1 and Dkk-1
interacting
protein genes.
7. rDNA Molecules for Polyipeptide Expression
The present invention further provides recombinant DNA molecules (rDNAs) that
contain a polypeptide coding sequence. As used herein, a rDNA molecule is a
DNA
molecule that has been subjected to molecular manipulation in situ. Methods
for
generating rDNA molecules are well known in the art, for example, see Sambrook
et
al., Molecular Clonina: A Laborator)r Manual (Cold Spring Harbor Laboratory,
Cold
Spring Harbor, NY, 1989). In the preferred rDNA molecules, a coding DNA
sequence
is operably linked to expression control sequences and/or vector sequences.
The choice of vector and/or expression control sequences to which one of the
protein family encoding sequences of the present invention is operably linked
depends
directly, as is well known in the art, on the functional properties desired,
e.g., protein
67
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
expression, and the host cell to be transformed. A vector contemplated by the
present
invention is at least capable of directing the replication and/or insertion
into the host
chromosome, and preferably also expression, of the structural gene included in
the
rDNA molecule.
Expression control elements that are used for regulating the expression of an
operably linked protein encoding sequence are known in the art and include,
but are not
limited to, inducible promoters, constitutive promoters, secretion signals,
and other
regulatory elements. Preferably, the inducible promoter is readily controlled,
such as
being responsive to a nutrient in the host cell's medium. Preferred promoters
include
yeast promoters, which include promoter regions for metallothionein, 3-
phosphoglycerate kinase or other glycolytic enzymes such as enolase or
glyceraldehyde-3-phosphate dehydrogenase, enzymes responsible for maltose and
galactose utilization, and others. Vectors and promoters suitable for use in
yeast
expression are further described in EP 73,675A. Appropriate non-native
mammalian
promoters might include the early and late promoters from SV40 (Fiers et al,
Nature,
273:113 (1978)) or promoters derived from Moloney murine leukemia virus, mouse
tumor virus, avian sarcoma viruses, adenovirus II, bovine papilloma virus or
polyoma.
In addition, the construct may be joined to an amplifiable gene (e.g., DHFR)
so that
multiple copies of the gene may be made. For appropriate enhancer and other
expression control sequences, see also Enhancers and Eukar)iotic Gene
Expression
(Cold Spring Harbor Press, Cold Spring Harbor, NY, 1983). Preferred bone
related
promoters include CMVbActin or type I collagen promoters to drive expression
of the
human HBM, Zmax1/LRP5 or LRP6 cDNA. Other preferred promoters for mammalian
expression are from cytomegalovirus (CMV), Rous sarcoma virus (RSV), Simian
virus
40 (SV40), and EF-1 a (human elongation factor 1 a-subunit).
In one embodiment, the vector containing a coding nucleic acid molecule will
include a prokaryotic replicon, i.e., a DNA sequence having the ability to
direct
autonomous replication and maintenance of the recombinant DNA molecule
extrachromosomally in a prokaryotic host cell, such as a bacterial host cell,
transformed
therewith. Such replicons are well known in the art. In addition, vectors with
a
68
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
prokaryotic replicon may also include a gene whose expression confers a
detectable
marker such as a drug resistance. Typical bacterial drug resistance genes are
those
that confer resistance to ampicillin or tetracycline.
Vectors that include a prokaryotic replicon can further include a prokaryotic
or
bacteriophage promoter capable of directing the expression (transcription and
translation) of the coding gene sequences in a bacterial host cell, such as E.
coli. A
promoter is an expression control element formed by a DNA sequence that
permits
binding of RNA polymerise and transcription to occur. Promoter sequences
compatible with bacterial hosts are typically provided in plasmid vectors
containing
convenient restriction sites for insertion of a DNA segment of the present
invention.
Typical of such vector plasmids are pUCB, pUC9, pBR322 and pBR329 available
from
Biorad Laboratories, (Richmond, CA), and pPL and pKK223 available from
Pharmacia
(Piscataway, NJ).
Expression vectors compatible with eukaryotic cells, preferably those
compatible
with vertebrate cells, can also be used to form a rDNA molecule that contains
a coding
sequence. Eukaryotic cell expression vectors are well known in the art and are
available from several commercial sources. Typically, such vectors are
provided
containing convenient restriction sites for insertion of a desired DNA
segment. Typical
of such vectors are pSVL and pKSV-10 (Pharmacia), pBPV-1/pML2d (International
Biotechnologies, Inc.), vector systems that include Histidine Tags and
periplasmic
secretion, or other vectors described in the art.
Eukaryotic cell expression vectors used to construct the rDNA molecules of the
present invention may further include a selectable marker that is effective in
an
eukaryotic cell, preferably a drug resistance selection marker. A preferred
drug
resistance marker is the gene whose expression results in neomycin resistance,
i.e.,
the neomycin phosphotransferase (neo) gene (Southern et al., J. Mol. Anal.
Genet.
1:327-341 (1982)). Alternatively, the selectable marker can be present on a
separate
plasmid, and the two vectors introduced by co-transfection of the host cell,
and selected
by culturing in the appropriate drug for the selectable marker.
69
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
8. Host Cells Containing an Exogenouslyr Supplied rDNA Nucleic Acid
Molecule
The present invention further provides host cells transformed with a nucleic
acid
molecule that encodes a polypeptide or protein of the present invention. The
host cell
can be either prokaryotic or eukaryotic. Eukaryotic cells useful for
expression of a
protein of the invention are not limited, so long as the cell line is
compatible with cell
culture methods and compatible with the propagation of the expression vector
and
expression of the gene product. Preferred eukaryotic host cells include, but
are not
limited to, yeast, insect and mammalian cells, preferably vertebrate cells
such as those
from a mouse, rat, monkey or human cell line but also can include
invertebrates with,
for example, cartilage. Preferred eukaryotic host cells include but are not
limited to
Chinese hamster ovary (CHO) cells (ATCC No. CCL61 ), NIH Swiss mouse embryo
cells NIH/3T3 (ATCC No. CRL 1658), baby hamster kidney cells (BHK), HOB-03-CE6
osteoblast cells, and other like eukaryotic tissue culture cell lines.
Any prokaryotic host can be used to express a rDNA molecule encoding a
protein of the invention. A preferred prokaryotic host is E. coli.
Transformation of appropriate cell hosts with a recombinant DNA (rDNA)
molecule of the present invention is accomplished by well known methods that
typically
depend on the type of vector used and host system employed. With regard to
transformation of prokaryotic host cells, electroporation and salt treatment
methods are
typically employed; see, for example, Cohen et al., Proc. Natl. Acad. Sci. USA
69: 2110
(1972); Maniatis et al. (1982); and Sambrook et al. (1989). With regard to
transformation of vertebrate cells with vectors containing rDNAs,
electroporation,
cationic lipid or salt treatment methods are typically employed; see, for
example,
Graham et al., Virol. 52: 456 (1973); Wigler et al., Proc. Natl. Acad. Sci.
USA 76: 1373-
76 (1979).
Successfully transformed cells, i.e., cells that contain a rDNA molecule of
the
present invention, can be identified by well known techniques including the
selection for
a selectable marker. For example, cells resulting from the introduction of an
rDNA of
the present invention can be cloned to produce single colonies. Cells from
those
~o
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
colonies can be harvested, lysed and their DNA content examined for the
presence of
the rDNA using a method such as that described by Southern, J. Mol. Biol. 98:
503
(1975), or Berent et al., Biotech. 3: 208 (1985). Alternatively, the cells can
be cultured
to produce the proteins encoded by the rDNA and the proteins harvested and
assayed,
using for example, any suitable immunological method. See, e.g., Harlow et
al., (1988).
Recombinant DNA can also be utilized to analyze the function of coding and
non-coding sequences. Sequences that modulate the translation of the mRNA can
be
utilized in an affinity matrix system to purify proteins obtained from cell
lysates that
associate with the Dkk-1 or Dkk-1 interacting protein or expression control
sequence.
Synthetic oligonucleotides would be coupled to the beads and probed with the
lysates,
as is commonly known in the art. Associated proteins could then be separated
using,
for example, a two dimensional SDS-PAGE system. Proteins thus isolated could
be
further identified using mass spectroscopy or protein sequencing. Additional
methods
would be apparent to the skilled artisan.
9. Production of Recombinant Peptides and Proteins usina a cDNA or Other
Recombinant Nucleic Acids
The invention also relates to nucleic acid molecules which encode a Dkk
protein
and polypeptide fragments thereof, and proteins and polypeptides which bind to
Dkk
(e.g., LRPS, LRP6 and HBM, Dkk interacting proteins such as the proteins of
Figure 5)
and molecular analogues. The polypeptides of the present invention include the
full
length Dkk and polypeptide fragments thereof, Dkk binding proteins and
polypeptides
thereof. Preferably these proteins are mammalian proteins, and most preferably
human proteins and biologically active fragments thereof. Alternative
embodiments
include nucleic acid molecules encoding polypeptide fragments having a
consecutive
amino acid sequence of at least about 3, 5, 7, 8, 9, 10, 15, 20, 25, 30, 40,
50, 60, 70,
80, 90, 100, 125, 150, 175, or 200 amino acid residues from a common
polypeptide
sequence; amino acid sequence variants of a common polypeptide sequence
wherein
an amino acid residue has been inserted N- or C-terminal to, or within, the
polypeptide
sequence or its fragments; and amino acid sequence variants of the common
~1
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
polypeptide sequence or its fragments, which have been substituted by another
conserved residue. Recombinant nucleic acid molecules which encode
polypeptides
include those containing predetermined mutations by, e.g., homologous
recombination,
site-directed or PCR mutagenesis, and recombinant Dkk proteins or polypeptide
fragments of other animal species, including but not limited to vertebrates
(e.g., rabbit,
rat, murine, porcine, camelid, reptilian, caprine, avian, fish, bovine, ovine,
equine and
non-human primate species) as well as invertebrates, and alleles or other
naturally
occurring variants and homologs of Dkk binding proteins of the foregoing
species and
of human sequences. Also contemplated herein are derivatives of the commonly
known Dkk, Dkk interacting proteins, or fragments thereof, wherein Dkk, Dkk
interacting proteins, or their fragments have been covalently modified by
substitution,
chemical, enzymatic, or other appropriate means with a moiety other than a
naturally
occurring amino acid (for example a detectable moiety such as an enzyme or
radioisotope) and soluble forms of Dkk. It is further contemplated that the
present
invention also includes nucleic acids with silent mutations which will
hybridize to the
endogenous sequence and which will still encode the same polypeptide.
The nucleic acid molecules encoding Dkk binding proteins, the LRP5 binding
domain fragment of Dkk, or other polypeptides of the present invention are
preferably
those which share a common biological activity (e.g., mediate Dkk activity
such as its
interaction with LRPS, HBM or LRP6). The polypeptides of the present invention
include those encoded by a nucleic acid molecule with silent mutations, as
well as
those nucleic acids encoding a biologically active protein with conservative
amino acid
substitutions, allelic variants, and other variants of the disclosed
polypeptides which
maintain at least one Dkk activity.
The amino acid compounds of the invention are polypeptides which are partially
defined in terms of amino acid residues of designated classes. Polypeptide
homologs
would include conservative amino acid substitutions within the amino acid
classes
described below. Amino acid residues can be generally sub-classified into four
major
subclasses as follows:
~2
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
Acidic: The residue has a negative charge due to loss of H+ ion at
physiological
pH, and the residue is attracted by aqueous solution so as to seek the surface
positions
in the conformation of a peptide in which it is contained when the peptide is
in aqueous
medium, at physiological pH.
Basi : The residue has a positive charge due to association with H+ ion at
physiological pH, and the residue is attracted by aqueous solution so as to
seek the
surface positions in the conformation of a peptide in which it is contained
when the
peptide is in aqueous medium at physiological pH.
Neutral/non-polar: The residues are not charged at physiological pH, but the
residue is repelled by aqueous solution so as to seek the inner positions in
the
conformation of a peptide in which it is contained when the peptide is in
aqueous
medium. These residues are also designated "hydrophobic."
Neutral/polar: The residues are not charged at physiological pH, but the
residue
is attracted by aqueous solution so as to seek the outer positions in the
conformation of
a peptide in which it is contained when the peptide is in aqueous medium.
It is understood, of course, that in a statistical collection of individual
residue
molecules some molecules will be charged, and some not, and there will be an
attraction for or repulsion from an aqueous medium to a greater or lesser
extent. To fit
the definition of "charged", a significant percentage (at least approximately
25%) of the
individual molecules are charged at physiological pH. The degree of attraction
or
repulsion required for classification as polar or nonpolar is arbitrary and,
therefore,
amino acids specifically contemplated by the invention have been classified as
one or
the other. Most amino acids not specifically named can be classified on the
basis of
known behavior.
Amino acid residues can be further subclassified as cyclic or noncyclic, and
aromatic or non-aromatic, self-explanatory classifications with respect to the
side chain
substituent groups of the residues, and as small or large. The residue is
considered
small if it contains a total of 4 carbon atoms or less, inclusive of the
carboxyl carbon.
Small residues are, of course, always nonaromatic.
73
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
The gene-encoded secondary amino acid proline, although technically within the
group neutral/nonpolar/large/cyclic and nonaromatic, is a special case due to
its known
effects on the secondary conformation of peptide chains, and is not,
therefore, included
in this defined group.
Other amino acid substitutions of those encoded in the gene can also be
included in peptide compounds within the scope of the invention and can be
classified
within this general scheme according to their structure.
All of the compounds of the invention may be in the form of the
pharmaceutically
acceptable salts or esters. Salts may be, for example, Na+, K+, Ca+2, Mg+2 and
the like;
the esters are generally those of alcohols of 1-6 carbons.
The present invention further provides methods for producing a protein of the
invention using nucleic acid molecules herein described. In general terms, the
production of a recombinant form of a protein typically involves the following
steps.
First, a nucleic acid molecule is obtained that encodes Dkk, such as a nucleic
acid molecule encoding human Dkk or any other Dkk sequence, or that encodes a
Dkk
binding protein, a Dkk aptamer or a biologically active fragment thereof.
Particularly for
Dkk binding peptides, the nucleotides encoding the peptide are incorporated
into a
nucleic acid in the form of an in-frame fusion, insertion into or appended to
a thioredoxin
coding sequence. The coding sequence (ORF) is directly suitable for expression
in any
host, as it is not interrupted by introns.
These DNAs can be transfected into host cells such as eukaryotic cells or
prokaryotic cells. Eukaryotic hosts include mammalian cells and vertebrate
(e.g.,
osteoblasts, osteosarcoma cell lines, Drosophila S2 cells, hepatocytes, tumor
cell lines
and other bone cells of any mammal, as well as insect cells, such as Sf9 cells
using
recombinant baculovirus). For example, a DNA expressing an open reading frame
(ORF) under control of a type I collagen promoter, or such osteoblast
promoters as
osteocalcin histone, type I collagen, TGF~31, MSX2, cfos/cJun and Cbfa1, can
be used
to regulate the Dkk in animal cells. Alternatively, the nucleic acid can be
placed
downstream from an inducible promoter, which can then be placed into
vertebrate or
invertebrate cells or be used in creating a transgenic animal model.
74
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
Alternatively, proteins and polypeptides of the present invention can be
expressed in an heterologous system. The human cell line GM637, SV-40
transformed
human fibroblasts, can be transfected, with a plasmid containing a Dkk ligand
binding
domain coding sequence under the control of the chicken actin promoter (Reis
et al.,
EMBO J. 11: 185-193 (1992)). Such transfected cells could be used as a source
of
Dkk binding domain in functional assays. Alternatively, polypeptides encoding
only a
portion of Dkk or any of the disclosed Dkk binding peptides Dkk aptamers or a
polypeptide encoding a Dkk interacting protein can be expressed alone or in
the form of
a fusion protein. For example, Dkk derived peptides can be expressed in
bacteria (e.g.,
E. col~~ as GST- or His-Tag fusion proteins. These fusion proteins are then
purified and
can be used to generate polyclonal antibodies or can be used to identify other
Dkk
ligands.
The nucleic acid coding sequence is preferably placed in operable linkage with
suitable control sequences, as described above, to form an expression unit
containing
the protein encoding open reading frame. The expression unit is used to
transform a
suitable host and the transformed host is cultured under conditions that allow
the
production of the recombinant protein. Optionally the recombinant protein is
isolated
from the medium or from the cells; recovery and purification of the protein
may not be
necessary in some instances where some impurities may be tolerated.
Each of the foregoing steps can be done in a variety of ways. For example, the
desired coding sequences may be obtained from genomic fragments and used
directly
in appropriate hosts. The construction of expression vectors that are operable
in a
variety of hosts is accomplished using appropriate replicons and control
sequences, as
set forth above. The control sequences, expression vectors, and transformation
methods are dependent on the type of host cell used to express the gene and
were
discussed in detail earlier. Suitable restriction sites can, if not normally
available, be
added to the ends of the coding sequence so as to provide an excisable gene to
insert
into these vectors. A skilled artisan can readily adapt any host/expression
system
known in the art for use with the nucleic acid molecules of the invention to
produce
recombinant protein.
~s
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
10. Methods to Identifyr Binding Partners
Another embodiment of the present invention provides methods for use in
isolating and identifying binding partners of Dkk or Dkk interacting proteins.
Dkk or a
Dkk interacting protein or a polypeptide fragment thereof can be mixed with a
potential
binding partner or an extract or fraction of a cell under conditions that
allow the
association of potential binding partners with Dkk or with Dkk interacting
proteins. After
mixing, the peptides, polypeptides, proteins or other molecules that have
become
associated with Dkk or a Dkk interacting protein are separated from the
mixture. The
binding partner that bound to the polypeptide then can be purified and further
analyzed.
Determination of binding partners of Dkk and Dkk interacting proteins as well
as agents
which prevent the interaction of Dkk with one of its interacting proteins
(e.g., LRPS,
LRP6, HBM, or those proteins listed in Figure 5) can be performed using a
variety of
different competition assays as are known in the art. For example, the minimal
sequence of Dkk, as described herein, can be used to identify antibodies which
compete with LRP5 (or LRP6, HBM or other ligand binding partners) for binding
to Dkk-
1 and vice versa. The minimal Dkk sequence can be bound to the bottom of a 96-
well
plate (or other solid substrate), and antibodies or other potential binding
agents (e.g.,
polypeptides, mimetics, homologs, antibody fragments and the like) can be
screened in
a competition assay to identify agents with binding affinities, for example,
greater than
the natural ligand binding partner of Dkk.
In the present invention, suitable cells are used for preparing assays, for
the
expression of a LRP and/or Dkk or proteins that interact therewith. The cells
may be
made or derived from mammals, yeast, fungi, or viruses. A suitable cell for
the
purposes of this invention is one that includes but is not limited to a cell
that can exhibit
a detectable Dkk-LRP (or HBM) interaction, and preferably, the differential
interaction
between Dkk-1-LRPS and Dkk-1-HBM. For the desired assay, the cell type may
vary.
In several embodiments, bone cells are preferred, for example, a human
osteoblast cell
(e.g. hOB-03-CE6) or osteosarcoma cell ( e.g. U20S). Additional hOB cells are
hOB-
03-C5, hOB-02-02 and, an immortalized pre-osteocytic cell line referred to as
hOB-01-
C1-PS-09 cells (which are deposited with American Type Culture Collection in
76
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
Manassas, Va. with the designation PTA-785), Examples of osteosarcoma cells
would
include SaoS2, MG63 and HOS TE85 Immortalized refers to a substantially
continuous and permanently established cell culture with substantially
unlimited cell
division potential. That is, the cells can be cultured substantially
indefinitely, i.e., for at
least about 6 months under rapid conditions of growth, preferably much longer
under
slower growth conditions, and can be propagated rapidly and continually using
routine
cell culture techniques. Alternatively stated, preferred cells can be cultured
for at least
about 100, 150 or 200 population doublings. These cells produce a complement
of
proteins characteristic of normal human osteoblastic cells and are capable of
osteoblastic differentiation. They can be used in cell culture studies of
osteoblastic cell
sensitivity to various agents, such as hormones, cytokines, and growth
factors, or in
tissue therapy. Certain non bone cells such as HEK 293 cells that exhibit
detectable
Dkk-LRP (or HBM) interaction are also be useful for the assays of this
invention.
To identify and isolate a binding partner, the entire Dkk protein (e.g., human
Dkk-1, GenBank Accession No. BAA34651 ) or a Dkk interacting protein (Genbank
Accession Nos. for some Dkk-1 interacting proteins are given in Figure 5) can
be used.
Alternatively, a polypeptide fragment of the protein can be used. Suitable
fragments of
the protein include at least about 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40,
45, 50, 55, 60,
65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150 or more contiguous
amino acid
residues of any Dkk or Dkk interactor sequence. Preferable sequences of Dkk
include
portions or all of one or both of the cysteine rich domains (e.g., Cys-1 and
Cys-2 of
Dkk-1 ) or the conserved sequences at the amino terminus of Dkk-1 (See Krupnik
et al.,
Gene 238: 301-313 (1999)). Alternatively, portions of LRPS, LRP6, HBM and
other Dkk
interacting proteins such as those in Figure 5 that interact with Dkk-1 can be
used to
identify and isolate agents which modulate Dkk activity. Alternatively,
peptide aptamers
of LRPS, LRP6, HBM, Dkk and other Dkk interacting proteins such as those in
Figure 5
that interact with Dkk-1 can be used to identify and isolate agents which
modulate Dkk
activity.
As used herein, a cellular extract refers to a preparation or fraction which
is
made from a lysed or disrupted cell. A variety of methods can be used to
obtain cell
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
extracts. Cells can be disrupted using either physical or chemical disruption
methods.
Examples of physical disruption methods include, but are not limited to,
sonication and
mechanical shearing. Examples of chemical lysis methods include, but are not
limited
to, detergent lysis and enzyme lysis. A skilled artisan can readily adapt
methods for
preparing cellular extracts in order to obtain extracts for use in the present
methods.
Once an extract of a cell is prepared, the extract is mixed with the protein
of the
invention under conditions in which association of the protein with the
binding partner
can occur. A variety of conditions can be used, the most preferred being
conditions
that closely resemble conditions found in the cytoplasm of a human cell.
Features such
as osmolarity, pH, temperature, and the concentration of cellular extract
used, can be
varied to optimize the association of the protein with the binding partner.
After mixing under appropriate conditions, the bound complex is separated from
the mixture. A variety of techniques can be utilized to separate the mixture.
For
example; :antibodies specific to a protein of the invention can be used to
immunoprecipitate the binding partner complex. Alternatively, standard
chemical
separation techniques such as chromatography and density/sediment
centrifugation
can be used. For example, a protein of the invention is expressed with an
affinity tag
such as a His tag. The His labeled protein and any bound molecule may be
retained
and selectively eluted from a Ni-NTA column.
After removal of non-associated cellular constituents found in the extract,
the
binding partner can be dissociated from the complex using conventional
methods. For
example, dissociation can be accomplished by altering the salt concentration
or pH of
the mixture.
To aid in separating associated binding partner pairs from the mixed extract,
the
protein of the invention can be immobilized on a solid support. For example,
the protein
can be attached to a nitrocellulose matrix or acrylic beads. Attachment of the
protein to
a solid support aids in separating peptide/binding partner pairs from other
constituents
found in the extract. The identified binding partners can be either a single
protein or a
complex made up of two or more proteins.
~s
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
Alternatively, the nucleic acid molecules of the invention can be used in a
Y2H
system. The Y2H system has been used to identify other protein partner pairs
and can
readily be adapted to employ the nucleic acid molecules herein described.
Methods of
performing and using Y2H systems are known. See, e.g., Finley et al., "Two-
Hybrid
Analysis of Genetic Regulatory Networks," in The Yeast Two-Hybrid System (Paul
L.
Bartel et al., eds., Oxford, 1997); Meijia Yang, "Use of a Combinatorial
Peptide Library
in the Two-Hybrid Assay," in The Yeast Two-H~ bri id Sy sr tem (Paul L. Bartel
et al., eds.,
Oxford, 1997); Gietz et al., "Identification of proteins that interact with a
protein of
interest: Applications of the yeast two-hybrid system," Mol. & Cell. Biochem.
172: 67-9
(1997); K. H. Young, "Yeast Two-Hybrid: So Many Interactions,(in) so Little
Time," Biol.
Reprod. 58: 302-311 (1998); R. Brent et al., "Understanding Gene and Allele
Function
with Two-Hybrid Methods," Annu. Rev. Genet. 31:663-704 (1997) and U.S. Patent
No.
5,989,808. The Dkk-1 interacting proteins identified in Figure 5 were
identified using the
Y2H inter~.;cting system using Dkk-1 as bait.
One preferred in vitro binding assay for Dkk modulators would comprise a
mixture of a LRP binding domain of Dkk and one or more candidate binding
targets or
substrates. After incubating the mixture under appropriate conditions, one
would
determine whether Dkk or a fragment thereof bound with the candidate modulator
present. For cell-free binding assays, one or more of the components usually
comprises or is coupled to a label. The label may provide for direct
detection, such as
radioactivity, luminescence, optical or electron density, etc., or indirect
detection such
as an epitope tag, an enzyme, etc. A variety of methods may be employed to
detect
the label depending on the nature of the label and other assay components. For
example, the label may be detected bound to the solid substrate or a portion
of the
bound complex containing the label may be separated from the solid substrate,
and the
label thereafter detected. Fluorescence resonance energy transfer may be
utilized to
monitor the interaction of two labeled molecules. For example, a fluorescence
label on
Dkk and another label on LRP5 or a soluble fragment thereof such as the
extracellular
domain will exchange fluorescence resonance energy when in close proximity
indicating that the two molecules are bound. A preferred binding partner for
Dkk will
79
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
increase or decrease the affinity between Dkk and LRPS which will be readily
observable in a fluorescence spectrometer. Alternatively, an instrument, such
as a
surface plasmon resonance detector manufactured by BIAcore (Uppsala, Sweden),
may be used to observe interactions with a fixed target. One skilled in the
art knows of
many other methods which may be employed for this purpose.
Thereby, the present invention provides methods for screening candidates
including polypeptides of the present invention for activity which identifies
these
candidates as valuable drug leads. Other suitable methods are also known in
the art
and are suitable for use herein, including Xenopus oocyte injection studies
and TCF
luciferase assays.
Additional assays can be used to identify the activity of Dkk and Dkk
interacting
proteins in the Wnt pathway, as well as the impact of modulators of Dkk and
Dkk
interacting proteins on the Wnt pathway. These include, for example, a Xenopus
embryo ~:~say and a TCF-luciferase reporter gene assay to monitor Wnt
signaling
modulation.
Xenopus embryos are an informative in vivo assay system to evaluate the
modulation of Wnt signaling. Ectopic expression of certain Wnts or other
activators of
the Wnt signaling pathway results in a bifurcation of the anterior neural
plate. This
bifurcation results in a duplicated body axis, which suggests a role for Wnt
signaling
during embryonic development (McMahon et al., Cell 58: 1075-84 (1989); Sokol
et al.,
Cell 67: 741-52 (1991 )). Since these original observations, the Xenopus
embryo assay
has been extensively used as an assay system for evaluating modulation of the
Wnt
signaling pathway. One preferred embodiment of the present invention is
demonstrated in Example 6.
Constructs for Xenopus expression can be prepared as would be known in the
art. For example, a variety of cDNAs have been engineered into the vector
pCS2+
(Turner et al., Genes Devel. 8: 1434-1447 (1994)) to facilitate the in vitro
generation of
mRNA for use in Xenopus embryo injection experiments. DNA inserts are
subcloned in
the sense orientation with respect to the vector SP6 promoter. Downstream of
the
insert, the vector provides an SV40 virus polyadenlylation signal and a T3
promoter
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
sequence (i.e., for the generation of antisense mRNA). Constructs can be
generated
for various Dkk family members, LRPS, LRP6, HBM, Dkk-1 interactors, etc.
Constructs
could be generated in pCS2+ that contain the nucleic acid sequence encoding
for the
peptide aptamers that were identified in yeast screens. These sequences would
be
fused to a 5' synthetic translation initiation sequence followed by a
canonical signal
sequence to ensure that the peptide aptamer would be translated and secreted
from
the cell.
Once these constructs are made then mRNA can be synthesized and injected
into Xenopus oocytes. mRNA for microinjection into Xenopus embryos is
generated by
in vitro transcription using the cDNA constructs in the pCS2+ vector described
above as
template. Various amounts of RNA can be injected into the ventral blastomere
of the 4-
or 8-cell Xenopus embryo substantially as described in Moon et al., Technique-
J. of
Methods in Cell and Mol. Biol. 1: 76-89 (1989), and Peng, Meth. Cell. Biol.
36: 657-62
( 1991 ).
Previous data has shown that expression of LRPS, in the presence of WntSa,
results in a Wnt-induced duplicated axis formation in Xenopus embryos (Tamai
et al.,
Nature 407: 530-535 (2000)). The roles of Dkk-1 and Dkk-2, and Dkk-1
interacting
proteins, in modulating the LRPS-mediated Wnt response in vivo can be analyzed
using, for example, the Xenopus embryo. In addition, the peptide aptamers, Dkk
interacting proteins, or combinations of the above can be evaluated in a
similar manner.
Experiments can also be conducted wherein RNA is injected into the dorsal
blastomere to ensure the specificity of the observed phenotypes. Lineage
tracing
experiments can be performed where a marker gene such as green fluorescent
protein
.(GFP) or LacZ is co-injected with the experimental RNAs. Detecting marker
gene
expression would identify the targeted cells of the microinjection and aid in
elucidating
the mechanism of action. In addition to the Wnt signaling components listed
above, the
point at which HBM acts upon the Wnt pathway can also be analyzed. This can be
done by co-injections of various dominant-negative constructs. For example, a
dominant negative TCF-3 construct would be useful to demonstrate that the
observed
axis duplication (and Wnt activation) is mediated via the ~i-catenin-TCF
response. If so,
81
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
such a construct would be expected to abolish the observed duplicated axis
phenotype.
Another example would include a dominant negative Dsh construct. Since Dsh is
far
upstream in the Wnt signaling pathway, a dominant negative construct should
abolish
the activation of the Wnt response and the observed axis duplication. If it
does not, this
would suggest that axis duplication is being induced via a different signaling
pathway.
The marker genes of the injected Xenopus embryos can be analyzed as follows.
Representative embryos are collected at stage 10.5 (11 hours post
fertilization) for
marker gene analysis. RNA is extracted and purified from the embryos following
standard protocols (Sambrook et al., 1989 at 7.16). Marker genes could include
the
following: Siamois (i.e., Wnt responsive gene), Xnr3 (i.e., Wnt responsive
gene), slug
(i.e., neural crest marker), Xbra (i.e., early mesoderm marker), HNK-1 (i.e.,
ectodermal/neural marker), endodermis (i.e., endoderm), Xlhbox8 (i.e.,
pancreatic),
BMP2 and BMP4 (i.e., early mesoderm), XLRP6 (i.e., maternal and zygotic
expression,
it is also the LRP6 homolog in the frog), EF-1 (i.e., control) and ODC (i.e.,
control).
Induction of marker genes is analyzed and quantitated by RT-PCR/TaqMan~.
This type of marker analysis is excellent to monitor changes in gene
expression
that result very early in the embryo as a direct result of signaling
perturbation. Other
experiments could be designed that would monitor changes in gene expression in
a
more tissue or spatially-restricted fashion. Examples would include the
generation of a
transgenic Xenopus model. For example, Zmax/LRP5 and HBM expression could be
under the control of the brachyury or cardiac-actin promoters directing gene
expression
transiently in the mesoderm or in the somites, respectively. Phenotype
analyses of
these transgenic Xenopus animals would include marker gene
analysis/transcriptional
profiling (from a restricted tissue source) and histologic examination of the
tissue.
A TCF-luciferase assay system such as that described in Example 7 can also be
used to monitor Wnt signaling activity, Dkk activity and Dkk interacting
protein activity.
Constructs for the TCF-luciferase assays can be prepared as would be known in
the
art. For example, Dkk and Dkk interacting protein peptides, LRPS/LRP6, among
others, can be expressed in pcDNA3.1, using Kozak and signal sequences to
target
peptides for secretion.
s2
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
Once constructs have been prepared, cells such as osteoblasts and HEK293
cells are seeded in well plates and transfected with construct DNA, CMV beta-
galactosidase plasmid DNA, and TCF-luciferase reporter DNA. The cells are then
lysed and assayed for beta-galactosidase and luciferase activity to determine
whether
Dkk, Dkk interacting proteins, or other molecules such as antibodies affect
Wnt
signaling.
Additional assays for monitoring Wnt signaling activity, Dkk activity, and Dkk
interacting protein activity include:
Modulation of another Wnt-responsive transcription factor, LEF, as
visualized by a reporter gene activity. One example includes the activation of
the LEF1 promoter region fused to the luciferase reporter gene (Hsu et al.,
Mol.
Cell. Biol. 18: 4807-18 (1999)).
Alterations in cell proliferation, cell cycle or apoptosis. There are
numerous examples describing Wnt-mediated cellular transformations including
Shimizu et al., Cell. Growth Differ. 8: 1349-58 (1997).
Stabilization and cellular localization of de-phosphorylated ~3-catenin as
an indicator of Wnt activation (Shimizu et al., 1997).
Additional methods of assaying Wnt signaling, through either the canonical or
non-canonical pathways, would be apparent to the artisan of ordinary skill.
11. Methods to Identifyr Agents that Modulate the Expression of a Nucleic Acid
Encoding the Dkk and/or LRP5 Proteins and/or Dkk interacting_proteins
Another embodiment of the present invention provides methods for identifying
agents that modulate the expression of a nucleic acid encoding Dkk. Such
assays may
utilize any available means of monitoring for changes in the expression level
of the
nucleic acids of the invention. As used herein, an agent is said to modulate
the
expression of Dkk, if it is capable of up- or down-regulating expression of
the nucleic
acid in a cell (e.g., mRNA).
In one assay format, cell lines that contain reporter gene fusions between the
nucleic acid encoding Dkk (or proteins which modulate the activity of Dkk) and
any
83
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
assayable fusion partner may be prepared. Numerous assayable fusion partners
are
known and readily available, including but not limited to the firefly
luciferase gene and
the gene encoding chloramphenicol acetyltransferase (Alam et al., Anal.
Biochem. 188:
245-254 (1990)). Cell lines containing the reporter gene fusions are then
exposed to
the agent to be tested under appropriate conditions and time. Differential
expression of
the reporter gene between samples exposed to the agent and control samples
identifies
agents which modulate the expression of a nucleic acid encoding Dkk or other
protein
which modulates Dkk activity. Such assays can similarly be used to determine
whether
LRP5 and even LRP6 activity is modulated by regulating Dkk activity.
Additional assay formats may be used to monitor the ability of the agents) to
modulate the expression of a nucleic acid encoding Dkk, alone or Dkk and LRPS,
and/or Dkk interacting proteins such as those identified in Figure 5. For
instance,
mRNA expression may be monitored directly by hybridization to the nucleic
acids of the
invention. Cell lines are exposed to the agent to be tested under appropriate
conditions
and time and total RNA or mRNA is isolated by standard procedures such those
disclosed in Sambrook et al. (1989); Ausubel et al., Current Protocols in
Molecular
Bioloav (Greene Publishing Co., NY, 1995); Maniatis et al., Molecular Cloning:
A
Laborator~r Manual (Cold Spring Harbor Laboratory, Cold Spring Harbor, NY,
1982);
and Short Protocols in Molecular Bioloqv: A Compendium of Methods from Current
Protocols in Molecular Bioloav (Frederick M. Ausubel et al., April 1999).
Probes to detect differences in RNA expression levels between cells exposed to
the agent and control cells may be prepared from the nucleic acids of the
invention. It
is preferable, but not necessary, to design probes which hybridize only with
target
nucleic acids under conditions of high stringency. Only highly complementary
nucleic
acid hybrids form under conditions of high stringency. Accordingly, the
stringency of
the assay conditions determines the amount of complementarity which should
exist
between two nucleic acid strands in order to form a hybrid. Stringency should
be
chosen to maximize the difference in stability between the probeaarget hybrid
and
potential probe:non-target hybrids.
84
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
Probes may be designed from the nucleic acids of the invention through
methods known in the art. For instance, the G+C content of the probe and the
probe
length can affect probe binding to its target sequence. Methods to optimize
probe
specificity are commonly available. See for example, Sambrook et al. (1989) or
Ausubel et al. (Current Protocols in Molecular Bioloav, Greene Publishing Co.,
NY,
1995).
Hybridization conditions are modified using known methods, such as those
described by Sambrook et al. (1989) and Ausubel et al. (1995), as suitable for
each
probe. Hybridization of total cellular RNA or RNA enriched for polyA RNA can
be
accomplished in any available format. For instance, total cellular RNA or RNA
enriched
for polyA RNA can be affixed to a solid support and the solid support exposed
to at
least one probe comprising at least one, or part of one of the nucleic acid
sequences of
the invention under conditions in which the probe will specifically hybridize.
Alternatively, nucleic acid fragments comprising at least one, or part of one
of the
sequences of the invention can be affixed to a solid support, such as a porous
glass
wafer. The glass or silica wafer can then be exposed to total cellular RNA or
polyA
RNA from a sample under conditions in which the affixed sequences will
specifically
hybridize. Such glass wafers and hybridization methods are widely available,
for
example, those disclosed by Beattie (WO 95/11755). By examining for the
ability of a
given probe to specifically hybridize to an RNA sample from an untreated cell
population and from a cell population exposed to the agent, agents which up-
or down-
regulate the expression of a nucleic acid encoding Dkk, a Dkk interacting
protein,
and/or LRPS can be identified.
Microarray technology and transcriptional profiling are examples of methods
which can be used to analyze the impact of putative Dkk or Dkk interacting
protein
modulating compounds. For transcriptional profiling, mRNA from cells exposed
in vivo
to a potential Dkk modulating agent, such as the Dkk interacting proteins
identified in
the present invention (e.g., those identified in Figure 5), agents which
modulate Dkk
interacting proteins, and mRNA from the same type of cells that were not
exposed to
the agent could be reverse transcribed and hybridized to a chip containing DNA
from
ss
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
numerous genes, to thereby compare the expression of genes in cells treated
and not
treated with the agent. If, for example a putative Dkk modulating agent down-
regulates
the expression of Dkk in the cells, then use of the agent may be undesirable
in certain
patient populations. For additional methods of transcriptional profiling and
the use of
microarrays, refer to, for example, U.S. Patent No. 6,124,120 issued to
Lizardi (2000).
Additional methods for screening the impact of Dkk and Dkk interacting protein
modulating compounds or the impact of Dkk or Dkk interacting proteins on
modulation
of LRPS, LRP6, HBM or the Wnt pathway include the use of TaqMan PCR,
conventional reverse transcriptase PCR (RT-PCR), changes in downstream
surrogate
markers (i.e., Wnt responsive genes), and anti-Dkk Western blots for protein
detection.
Other methods would be readily apparent to the artisan of ordinary skill.
12. Methods to Identifj~gents that Modulate at Least One Activityr of Dkk, a
Dkk Interacting Protein, or LRPS/LRP61HBM
Another embodiment of the present invention provides methods for identifying
agents that modulate at least one activity of Dkk, Dkk interacting proteins,
and/or
LRPS/LRP6/HBM proteins or preferably which specifically modulate an activity
of a
Dkk/Dkk interacting protein complex or an LRPS(or LRP6/HBM)/Dkk complex, or a
biologically active fragment of Dkk (e.g., comprising the domain which binds
LRPS/LRP6/HBM) or a Dkk interacting protein complex. Such methods or assays
may
utilize any means of monitoring or detecting the desired activity as would be
known in
the art (See, e.g., Wu et al., Curr. Biol. 10:1611-4 (2000); Fedi et al., J.
Biol. Chem.
274:19465-72 (1991 ); Grotewold et al., Mech. Dev. 89:151-3 (1999); Shibata et
al.,
Mech. Dev. 96:243-6 (2000); Wang et al., Oncogene 19:1843-8 (2000); and Glinka
et
al., Nature 391:357-62 (1998)). Potential agents which modulate Dkk include,
for
example, p53, the tumor suppressor protein, which can induce Dkk-1. Damage to
DNA
has also been observed to up-regulate Dkk-1 expression via a stabilization and
activation of p53 (Wang et al., Oncogene 19:1843-48 (2000)); and, Shou et al.,
Oncogene 21:878-89 (2002)). Additionally, Fedi et al. (1999) purportedly
showed that
Dkk-1 can block the Wnt2-induced oncogenic transformation of NIH-3T3 cells.
86
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
Furthermore, it has been suggested that Dkk expression can be modulated by BMP
signaling in the developing skeleton (Mukhopadhyay et al., Dev. Cell. 1:423-34
(2001 );
and Grotewold et al., EM80 J. 21:966-75 (2002)). Grotewold et al. additionally
describe altered Dkk expression levels in response to stress signals including
UV
irradiation and other genotoxic stimuli. They propose that Dkk expression is
pro-
apoptotic. In animals expressing HBM constructs conferring high bone mass, a
reduced osteoblast apoptosis effect was observed. Thus, HBM and HBM-like
variants
may control/alter Dkk's role in programmed cell death. Other agents which
potentially
modulate Dkk activity include the Dkk interacting proteins identified in
Figure 5.
In one embodiment, the relative amounts of Dkk or a Dkk interacting protein of
a
cell population that has been exposed to the agent to be tested is compared to
an un-
exposed control cell population. Antibodies can be used to monitor the
differential
expression of the protein in the different cell populations. Cell lines or
populations are
exposed to the agent to be tested under appropriate conditions and time.
Cellular
lysates may be prepared from the exposed cell line or population and a
control,
unexposed cell line or population. The cellular lysates are then analyzed with
the
probe, as would be known in the art. See, e.g., Ed Harlow and David Lane,
Antibodies: A Laborator)r Manual (Cold Spring Harbor, NY, 1988) and Ed Harlow
and
David Lane, Using Antibodies: A Laborator~Manual (Cold Spring Harbor, NY
1998).
For example, N- and C- terminal fragments of Dkk can be expressed in bacteria
and used to search for proteins which bind to these fragments. Fusion
proteins, such
as His-tag or GST fusion to the N- or C-terminal regions of Dkk (or to
biologically active
domains of Dkk-1 ) or a whole Dkk protein can be prepared. These fusion
proteins can
be coupled to, for example, Talon or Glutathione-Sepharose beads and then
probed
with cell lysates to identify molecules which bind to Dkk. Prior to lysis, the
cells may be
treated with purified Wnt proteins, RNA, or drugs which may modulate Wnt
signaling or
proteins that interact with downstream elements of the Wnt pathway. Lysate
proteins
binding to the fusion proteins can be resolved by SDS-PAGE, isolated and
identified by,
for example protein sequencing or mass spectroscopy, as is known in the art.
See,
e.g., Protein Purification Applications: A Practical Approach (Simon Roe, ed.,
2"d ed.
8~
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
Oxford Univ. Press, 2001 ) and "Guide to Protein Purification" in Meth.
Enzymology vol.
182 (Academic Press, 1997).
The activity of Dkk, a Dkk interacting protein, or a complex of Dkk with
LRPS/LRP6/HBM may be affected by compounds which modulate the interaction
between Dkk and a Dkk interacting protein (such as those shown in Figure 5)
and/or
Dkk and LRPS/LRP6/HBM. The present invention provides methods and research
tools for the discovery and characterization of these compounds. The
interaction
between Dkk and a Dkk interacting protein and/or Dkk and LRPS/6/HBM may be
monitored in vivo and in vitro. Compounds which modulate the stability of a
Dkk -
LRPS/LRP6/HBM complex are potential therapeutic compounds. Example in vitro
methods include: Binding LRPS/6/HBM, Dkk, or a Dkk interacting protein to a
sensor
chip designed for an instrument such are made by Biacore (Uppsala, Sweden) for
the
performance of an plasmon resonance spectroscopy observation. In this method,
the
chip witf~~ one of Dkk, a Dkk interacting protein, or LRPS/6 is first exposed
to the other
under conditions which permit them to form the complex. A test compound is
then
introduced and the output signal of the instrument provides an indication of
any effect
exerted by the test compound. By this method, compounds may be rapidly
screened.
Another, in vitro, method is exemplified by the SAR-by-NMR methods (Shuker ef
al.,
Science. 274:1531-4 (1996)). Briefly, a Dkk-1 binding domain and/or LRP 5 or 6
LBD
are expressed and purified as'SN labeled protein by expression in labeled
media. The
labeled proteins) are allowed to form the complex in solution in an NMR sample
tube.
The heteronuclear correlation spectrum in the presence and absence of a test
compound provides data at the level of individual residues with regard to
interactions
with the test compound and changes at the protein-protein interface of the
complex.
One of skill in the art knows of many other protocols, e.g. affinity capillary
electrophoresis (Okun et al. J Biol Chem 276:1057-62 (2001 ); Vergun and Chu,
Methods, 19:270-7 (1999)), fluorescence spectroscopy, electron paramagnetic
resonance, etc. which can monitor the modulation of a complex and/or measure
binding
affinities for complex formation.
ss
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
In vitro protocols for monitoring the modulation of a Dkk/LRPS/LRP6/HBM
complex include the yeast two hybrid protocol. The yeast two hybrid method may
be
used to monitor the modulation of a complex in vivo by monitoring the
expression of
genes activated by the formation of a complex of fusion proteins of Dkk and
LRP ligand
binding domains. Nucleic acids according to the invention which encode the
interacting
Dkk and LRP LBD domains are incorporated into bait and prey plasmids. The Y2H
protocol is performed in the presence of one or more test compounds. The
modulation
of the complex is observed by a change in expression of the complex activated
gene. It
will be appreciated by one skilled in the art that test compounds can be added
to the
assay directly or, in the case of proteins, can be coexpressed in the yeast
with the bait
and prey compounds. Similarly, fusion proteins of Dkk and Dkk interacting
proteins can
also be used in a Y2H screen to identify other proteins which modulate the
Dkk/Dkk
interacting protein complex.
Assay protocols such as these may be used in methods to screen for
compounds, drugs, treatments which modulate the Dkk/Dkk interacting protein
and/or
Dkk/LRPS/6 complex, whether such modulation occurs by competitive binding, or
by
altering the structure of either LRP 5/6 or Dkk at the binding site, or by
stabilizing or
destablizing the protein-protein interface. It may be anticipated that peptide
aptamers
may competitively bind, although induction of an altered binding site
structure by steric
effects is also possible.
12.1 Antibodies and Antibod~Fragments
Polyclonal and monoclonal antibodies and fragments of these antibodies which
bind to Dkk or LRPS/LRP6/HBM can be prepared as would be known in the art. For
example, suitable host animals can be immunized using appropriate immunization
protocols and the peptides, polypeptides or proteins of the invention.
Peptides for use
in immunization are typically about 8-40 residues long. If necessary or
desired, the
polypeptide immunogens can be conjugated to suitable carriers. Methods for
preparing
immunogenic conjugates with carriers such as bovine serum albumin (BSA),
keyhole
limpet hemocyanin (KLH), or other carrier proteins are well known in the art
(See,
89
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
Harlow et al., 1988). In some circumstances, direct conjugation using, for
example,
carbodiimide reagents, may be effective; in other instances linking reagents
such as
those supplied by Pierce Chemical Co., Rockford, IL, may be desirable to
provide
accessibility to the polypeptide or hapten. The hapten peptides can be
extended at
either the amino or carboxy terminus with a cysteine residue or interspersed
with
cysteine residues, for example, to facilitate linking to a carrier.
Administration of the
immunogens is conducted generally by injection over a suitable time period and
with
use of suitable adjuvants, as is generally understood in the art. During the
immunization schedule, titers of antibodies are taken to determine adequacy of
antibody formation.
Anti-peptide antibodies can be generated using synthetic peptides, for
example,
the peptides derived from the sequence of any Dkk, including Dkk-1, or
LRPS/LRP6/HBM. Synthetic peptides can be as small as 2-3 amino acids in
length, but
are preferably at least 3, 5, 10, or 15 or more amino acid residues long. Such
peptides
can be determined using programs such as DNAStar. The peptides are coupled to
KLH using standard methods and can be immunized into animals such as rabbits.
Polyclonal anti-Dkk or anti-LRPS/LRP6/HBM peptide antibodies can then be
purified,
for example using Actigel beads containing the covalently bound peptide.
While the polyclonal antisera produced in this way may be satisfactory for
some
applications, for pharmaceutical compositions, use of monoclonal preparations
is
preferred. Immortalized cell lines which secrete the desired monoclonal
antibodies may
be prepared using the standard method of Kohler and Milstein or modifications
which
effect immortalization of lymphocytes or spleen cells, as is generally known
(See, e.g.,
Harlow et al., 1988 and 1998). The immortalized cell lines secreting the
desired
antibodies can be screened by immunoassay in which the antigen is the peptide
hapten, polypeptide or protein. When the appropriate immortalized cell culture
secreting the desired antibody is identified, the cells can be cultured either
in vitro or by
production in ascites fluid.
The desired monoclonal antibodies are then recovered from the culture
supernatant or from the ascites supernatant. Fragments of the monoclonal
antibodies
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
which contain the immunologically significant portion can be used as agonists
or
antagonists of Dkk activity. Use of immunologically reactive fragments, such
as the
Fab, scFV, Fab', of F(ab')2 fragments are often preferable, especially in a
therapeutic
context, as these fragments are generally less immunogenic than the whole
immunoglobulin.
The antibodies or fragments may also be produced, using current technology, by
recombinant means. Regions that bind specifically to the desired regions of
Dkk or
LRPS/LRP6/HBM can also be produced in the context of chimeras with multiple
species
origin. Antibody reagents so created are contemplated for use diagnostically
or as
stimulants or inhibitors of Dkk activity.
In one embodiment, antibodies against Dkk, bind Dkk with high affinity, i.e.,
ranging from 10-5 to 10-9 M. Preferably, the anti-Dkk antibody will comprise a
chimeric,
primate, Primatized~, human or humanized antibody. Also, the invention
embraces the
use of antibody fragments, e.g., Fab's, Fv's, Fab's, F(ab)Z, and aggregates
thereof.
Another embodiment contemplates chimeric antibodies which recognize Dkk or
LRPS/LRP6/HBM. A chimeric antibody is intended to refer to an antibody with
non-
human variable regions and human constant regions, most typically rodent
variable
regions and human constant regions.
A "primatized~ antibody" refers to an antibody with primate variable regions,
e.g., CDR's, and human constant regions. Preferably, such primate variable
regions
are derived from an Old World monkey.
A "humanized antibody" refers to an antibody with substantially human
framework and constant regions, and non-human complementarity-determining
regions
(CDRs). "Substantially" refers to the fact that humanized antibodies typically
retain at
least several donor framework residues (i.e., of non-human parent antibody
from which
CDRs are derived).
Methods for producing chimeric, primate, primatized~, humanized and human
antibodies are well known in the art. See, e.g., U.S. Patent 5,530,101, issued
to Queen
et al.; U.S. Patent 5,225,539, issued to Winter et al.; U.S. Patents 4,816,397
and
91
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
4,816,567, issued to Boss et al. and Cabilly et al. respectively, all of which
are
incorporated by reference in their entirety.
The selection of human constant regions may be significant to the therapeutic
efficacy of the subject anti-Dkk or LRPS/LRP6/HBM antibody. In a preferred
embodiment, the subject anti-Dkk or LRPS/LRP6/HBM antibody will comprise
human,
gamma 1, or gamma 3 constant regions and, more preferably, human gamma 1
constant regions.
Methods for making human antibodies are also known and include, by way of
example, production in SCID mice, and in vitro immunization.
The subject anti-Dkk or LRPS/LRP6/HBM antibodies can be administered by
various routes of administration, typically parenteral. This is intended to
include
intravenous, intramuscular, subcutaneous, rectal, vaginal, and administration
with
intravenous infusion being preferred.
The anti-Dkk or LRPS/LRP6/HBM antibody will be formulated for therapeutic
usage by standard methods, e.g., by addition of pharmaceutically acceptable
buffers,
e.g., sterile saline, sterile buffered water, propylene glycol, and
combinations thereof.
Effective dosages will depend on the specific antibody, condition of the
patient,
age, weight, or any other treatments, among other factors. Typically effective
dosages
will range from about 0.001 to about 30 mg/kg body weight, more preferably
from about
0.01 to 25 mg/kg body weight, and most preferably from about 0.1 to about 20
mg/kg
body weight.
Such administration may be effected by various protocols, e.g., weekly, bi-
weekly, or monthly, depending on the dosage administered and patient response.
Also,
it may be desirable to combine such administration with other treatments.
Antibodies to Dkk-1 interacting proteins, such as those identified in Figure
5, are
also contemplated according to the present invention, and can be used
similarly to the
Dkk-1 antibodies mentioned in the above methodology.
The antibodies of the present invention can be utilized in experimental
screening, as diagnostic reagents, and in therapeutic compositions.
92
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
12.2 Chemical Libraries
Agents that are assayed by these methods can be randomly selected or
rationally selected or designed. As used herein, an agent is said to be
randomly
selected when the agent is chosen randomly without considering the specific
sequences involved in the association of Dkk-1 alone, Dkk-1 interacting
proteins alone,
or with their associated substrates, binding partners, etc. An example of
randomly
selected agents is the use of a chemical library or a peptide combinatorial
library, or a
growth broth of an organism.
The agents of the present invention can be, as examples, peptides, small
molecules, vitamin derivatives, as well as carbohydrates. A skilled artisan
can readily
recognize that there is no limit as to the structural nature of the agents of
the present
invention.
12.3 Peptide Synthesis
The peptide agents of the invention can be prepared using standard solid phase
(or solution phase) peptide synthesis methods, as is known in the art. In
addition, the
DNA encoding these peptides may be synthesized using commercially available
oligonucleotide synthesis instrumentation and produced recombinantly using
standard
recombinant production systems. The production of polypeptides using solid
phase
peptide synthesis is necessitated if non-nucleic acid-encoded amino acids are
to be
included.
13. Uses for Agents that Modulate at Least One Activity or f Dkk~ a Dkk
Interacting Protein, a Dkk/Dkk Interactingi Protein Complex, or a DkkILRP5 or
Dkk/LRP6 Complex
The proteins and nucleic acids of the invention, such as the proteins or
polypeptides containing an amino acid sequence of LRPS, Dkk, and Dkk
interacting
proteins are involved in bone mass modulation and lipid modulation of other
Wnt
pathway mediated activity. Agents that modulate (i.e., up and down-regulate)
the
expression of Dkk or Dkk interacting proteins, or agents, such as agonists and
93
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
antagonists respectively, of at least one activity of Dkk or a Dkk interacting
protein may
be used to modulate biological and pathologic processes associated with the
function
and activity of Dkk or a Dkk interacting protein.
As used herein, a subject can be preferably any mammal, so long as the
mammal is in need of modulation of a pathological or biological process
modulated by a
protein of the invention. The term "mammal" means an individual belonging to
the class
Mammalia. The invention is particularly useful in the treatment of human
subjects.
As used herein, a biological or pathological process modulated by Dkk or a Dkk
interacting protein may include binding of Dkk to a Dkk interacting protein,
Dkk to
LRP5 or LRP6 or release therefrom, inhibiting or activating Dkk or a Dkk
interacting
protein mRNA synthesis or inhibiting Dkk or Dkk interacting protein modulated
inhibition
of LRP5 or LRP6 mediated Wnt signaling. Further bone-related markers may be
observed such as alkaline phosphatase activity, osteocalcin production, or
mineraiization.
Pathological processes refer to a category of biological processes which
produce a deleterious effect. For example, expression or up-regulation of
expression of
LRPS or LRP6 and/or Dkk and/or a Dkk interacting protein may be associated
with
certain diseases or pathological conditions. As used herein, an agent is said
to
modulate a pathological process when the agent statistically significantly (p
< 0.05)
alters the process from its base level in the subject. For example, the agent
may
reduce the degree or severity of the process mediated by that protein in the
subject to
which the agent was administered. For instance, a disease or pathological
condition
may be prevented, or disease progression modulated by the administration of
agents
which reduce or modulate in some way the expression or at least one activity
of a
protein of the invention.
As LRPS/6 and Dkk are involved both directly and indirectly in bone mass
modulation, one embodiment of this invention is to use Dkk or Dkk interacting
protein
expression as a method of diagnosing a bone condition or disease. Certain
markers
are associated with specific Wnt signaling conditions (e.g., TCFlLEF
activation).
Diagnostic tests for bone conditions may include the steps of testing a sample
or an
94
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
extract thereof for the presence of Dkk or Dkk interacting protein nucleic
acids (i.e.,
DNA or RNA), oligomers or fragments thereof or protein products of TCF/LEF
regulated
expression. For example, standard in situ hybridization or other imaging
techniques
can be utilized to observe products of Wnt signaling.
This invention also relates to methods of modulating bone development or bone
loss conditions. Inhibition of bone loss may be achieved by inhibiting or
modulating
changes in the LRPS/6 mediated Wnt signaling pathway. For example, absence of
LRPS activity may be associated with low bone mass. Increased activity LRPS
may be
associated with high bone mass. Therefore, modulation of LRPS activity will in
turn
modulate bone development. Modulation of the Dkk/LRPS/6 or Dkk/Dkk interacting
protein complex via agonists and antagonists is one embodiment of a method to
regulate bone development. Such modulation of bone development can result from
inhibition of the activity of, for example, a Dkk/LRP(5/6) protein complex, a
Dkk/Dkk
interacting protein complex, upregulated transcription of the LRP5 gene or
inhibited
translation of Dkk or Dkk interacting protein mRNA.
The agents of the present invention can be provided alone, or in combination
with other agents that modulate a particular pathological process. As used
herein, two
agents are said to be administered in combination when the two agents are
administered simultaneously or are administered independently in a fashion
such that
the agents will act at the same time.
The agents of the present invention can be administered via parenteral,
subcutaneous (sc), intravenous (iv), intramuscular (im), intraperitoneal (ip),
transdermal
or buccal routes. Alternatively, or concurrently, administration may be by the
oral route.
The dosage administered will be dependent upon the age, health, and weight of
the
recipient, kind of concurrent treatment, if any, frequency of treatment, and
the nature of
the effect desired.
The present invention further provides compositions containing one or more
agents which modulate expression or at least one activity of a protein of the
invention.
While individual needs vary, determination of optimal ranges of effective
amounts of
each component is within the skill of the art. Typical dosages of the active
agent which
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
mediate Dkk or Dkk interacting protein activity comprise from about 0.0001 to
about 50
mg/kg body weight. The preferred dosages comprise from about 0.001 to about 50
mg/kg body weight. The most preferred dosages comprise from about 0.1 to about
1
mg/kg body weight. In an average human of 70 kg, the range would be from about
7
Ng to about 3.5 g, with a preferred range of about 0.5 mg to about 5 mg.
In addition to the pharmacologically active agent, the compositions of the
present invention may contain suitable pharmaceutically acceptable carriers
comprising
excipients and auxiliaries which facilitate processing of the active compounds
into
preparations which can be used pharmaceutically for delivery to the site of
action.
Suitable formulations for parenteral administration include aqueous solutions
of the
active compounds in water-soluble form, for example, water-soluble salts. In
addition,
suspensions of the active compounds as appropriate oily injection suspensions
may be
administered. Suitable lipophilic solvents or vehicles include fatty oils, for
example,
sesame oil, or synthetic fatty acid esters, (e.g., ethyl oleate or
triglycerides). Aqueous
injection suspensions may contain substances which increase the viscosity of
the
suspension include, for example, sodium carboxymethyl cellulose, sorbitol
and/or
dextran. Optionally, the suspension may also contain stabilizers. Liposomes
and other
non-viral vectors can also be used to encapsulate the agent for delivery into
the cell.
The pharmaceutical formulation for systemic administration according to the
invention may be formulated for enteral, parenteral, or topical (top)
administration.
Indeed, all three types of formulations may be used simultaneously to achieve
systemic
administration of the active ingredient.
Suitable formulations for oral administration include hard or soft gelatin
capsules,
pills, tablets, including coated tablets, elixirs, suspensions, syrups or
inhalations and
controlled release forms thereof.
Potentially, any compound which binds Dkk or a Dkk interacting protein or
modulates the Dkk/LRP5 or Dkk/LRP6 or Dkk/Dkk interacting protein complex may
be
a therapeutic compound. In one embodiment of the invention, a peptide or
nucleic acid
aptamer according to the invention is used in a therapeutic composition. Such
compositions may comprise an aptamer, or a LRPS or LRP6 fragment unmodified or
96
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
modified. In another embodiment, the therapeutic compound comprises a Dkk-1
interacting protein, or biologically active fragment thereof.
Nucleic acid aptamers have been used in compositions for example by chemical
bonding to a carrier molecule such as polyethylene glycol (PEG) which may
facilitate
uptake or stabilize the aptamer. A di-alkylgylcerol moiety attached to an RNA
will
embed the aptamer in liposomes, thus stabilizing the compound. Incorporating
chemical substitutions (i.e. changing the 2'0H group of ribose to a 2'NH in
RNA confers
ribonuclease resistance) and capping, etc. can prevent breakdown. Several such
techniques are discussed for RNA aptamers in Brody and Gold (Rev. Mol. Biol.
74:3-13
(2000)).
Peptide aptamers may by used in therapeutic applications by the introduction
of
an expression vector directing aptamer expression into the affected tissue
such as for
example by retroviral delivery, by encapsulating the DNA in a delivery complex
or
simple by naked DNA injection. Or, the aptamer itself or a synthetic analog
may be
used directly as a drug. Encapsulation in polymers and lipids may assist in
delivery.
The use of peptide aptamers as therapeutic and diagnostic agents is reviewed
by
Hoppe-Syler and Butz (J. Mol. Med. 78:426-430 (2000)).
In another aspect of the invention. The structure of a constrained peptide
aptamer of the invention may be determined such as by NMR or X-ray
crystallography.
(Cavanagh et al., Protein NMR Spectroscopy: Principles and Practice, Academic
Press,
1996; Drenth, Principles of Protein X-R~r Cr)rstallography, Springer Verlag,
1999)
Preferably the structure is determined in complex with the target protein. A
small
molecule analog is then designed according to the positions of functional
elements of
the 3D structure of the aptamer. (Guidebook on Molecular Modeling in Drug
Design,
Cohen, Ed., Academic Press, 1996; Molecular Modeling and Drug Design (Topics
in
Molecular and Structural Bioloavl, Vinter and Gardner Eds., CRC Press, 1994)
Thus
the present invention provides a method for the design of effective and
specific drugs
which modulate the activity of Dkk, Dkk interacting proteins, Dkk/Dkk
interacting protein
complex and the Dkk/LRP complex. Small molecule mimetics of the peptide
aptamers
of the present invention are encompassed within the scope of the invention.
97
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
In practicing the methods of this invention, the compounds of this invention
may
be used alone or in combination, or in combination with other therapeutic or
diagnostic
agents. In certain preferred embodiments, the compounds of this invention may
be co-
administered along with other compounds typically prescribed for these
conditions
according to generally accepted medical practice. For example, the compounds
of this
invention can be administered in combination with other therapeutic agents for
the
treatment of bone loss. Bone loss mediating agents include bone resorption
inhibitors
such as bisphosphonates (e.g., alendronic acid, clodronic acid, etidronic
acid,
pamidronic acid, risedronic acid and tiludronic acid), vitamin D and vitamin D
analogs,
cathepsin K inhibitors, hormonal agents (e.g., calcitonin and estrogen), and
selective
estrogen receptor modulators or SERMs (e.g., raloxifene). And bone forming
agents
such as parathyroid hormone (PTH) and bone morphogenetic proteins (BMP)
Additionally contemplated are combinations of agents which regulate Dkk-1 and
agents which regulate lipid levels such as HMG-CoA reductase inhibitors (i.e.,
statins
such as Mevacor~, Lipitor~ and other inhibitors such as Baycol~, Lescol~,
Pravachol~
and Zocor~), bile acid sequestrants (e.g., Colestid~ and Welchol~), fabric
acid
derivatives (Atromid-S~, Lopid~, Tricor~), and nicotinic acid.
[0001] The compounds of this invention can be utilized in vivo, ordinarily in
vertebrates
and preferably in mammals, such as humans, sheep, horses, cattle, pigs, dogs,
cats,
rats and mice, or in vitro.
14. Transgenic Animals
Transgenic animal models can be created which conditionally express Dkk
and/or LRPS or LRP6 and/or Dkk interacting proteins, such as those shown in
Figure 5.
These animals can be used as research tools for the study of the physiological
effects
of the Dkk-1/Dkk-1 interacting protein interaction and/or the LRP5 / Dkk
interaction.
Alternatively, transgenic animals can be created which express a transgenic
form of
Dkk alone or in addition to a transgenic form of HBM or express Dkk
interacting
proteins alone or in addition to a transgenic form of Dkk. Transgenic animals
expressing HBM or LRP5 can be crossed with transgenic animals expressing Dkk
or
98
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
Dkk interacting proteins to obtain heterozygote as well as homozygote animals
which
express both desired genes.
Animal models may be created to directly modulate the Dkk/Dkk interacting
protein or Dkk/ LRP5 interaction activity in vivo to serve as a research tool
for
determining the efficacy of candidate compounds which modulate the Dkk/Dkk
interacting protein or LRP5 / Dkk interaction activity in vitro. Animals, such
as
transgenic mice, can be created using the techniques employed to make
transgenic
mice that express for example, human Dkk or a Dkk interacting protein, or
knockouts
(KO), which may be conditional, of the gene encoding mouse Dkk or Dkk
interacting
protein. Knock-in animals include animals wherein genes have been introduced
and
animals wherein a gene that was previously knocked-out is reintroduced into
the
animal. Other transgenic animals can be created with inducible forms of Dkk or
a Dkk
interacting protein to study the effects of the gene on bone mass development
and loss
as well as lipid level regulation. These animals can also be used to study
long term
effects of Dkk or Dkk interacting protein modulation. Transgenic animals may
be
created to express peptide aptamers, or produce RNA aptamers. The transgenic
vectors may direct expression in a tissue specific manner by the use of tissue
specific
promoters. In a preferred embodiment, a peptide aptamer fusion protein is
expressed
using a bone specific promoter. Such systems can provide a tissue specific
knock-out
of Dkk or Dkk interacting protein activity.
General methods for creating transgenic animals are known in the art, and are
described in, for example, Strategies in Transgenic Animal Science (Glenn M.
Monastersky and James M. Robl eds., ASM Press; Washington, DC, 1995);
Transgenic Animal Technology: A Laborator)r Handbook (Carl A. Pinkert ed.,
Academic
Press 1994); Transcienic Animals (Louis Marie Houdebine, ed., Harwood Academic
Press, 1997); Overexpression and Knockout of Cytokines in Transgenic Mice
(Chaim
O. Jacob, ed., Academic Press 1994); Microinjection and Transgenesis:
Strategies and
Protocols (Springer Lab Manual) (Angel Cid-Arregui and Alejandro Garcia-
Carranca,
eds., Springer Verlag 1998); and Manipulating the Mouse Embryo: A Laborator~r
Manual (Brigid Hogan et al., eds., Cold Spring Harbor Laboratory Press 1994).
99
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
15. Peptide and Nucleotide Aptamers and Peptide Autamer Mimetics
Another embodiment contemplates the use of peptide and nucleotide aptamer
technology to screen for agents which interact with Dkk, which block Dkk from
interacting with LRPS or LRP6, or which block any other Dkk ligand
interaction, or
which interact with Dkk interacting proteins, such as those shown in Figure 5.
Peptide
aptamers are molecules in which a variable peptide domain is displayed from a
scaffold
protein. Thioredoxin A (trxA) is commonly used for a scaffold. The peptide
insert
destroys the catalytic site of trxA. It is recognized that numerous proteins
may also be
used as scaffolding proteins to constrain and/or present a peptide aptamer.
Other
scaffold proteins that could display a constrained peptide aptamer could
include
staphylococcal nuclease, the protease inhibitor eglin C, the Streptomyces
tendea alpha-
amylase inhibitor Tendamistat, Sp1, and green fluorescent protein (GFP)
(reviewed in
Hoppe-Seyler et al., J. Steroid Biochem Mol. Biol. 78:105-11 (2001 )), and the
S1
nuclease from Staphylococcus or M13 for phage display. Any molecule to which
the
aptamer could be anchored and presented in its bioactive conformation would be
suitable.
Aptamers can then specifically bind to a given target protein in vitro and in
vivo
and have the potential to selectively block the function of their target
protein. Peptide
aptamers are selected from randomized expression libraries on the basis of
their in vivo
binding capacity to the desired target protein. Briefly, a target protein
(e.g., Dkk, a Dkk
interacting protein, or LRPS/6) is linked to a heterologous DNA binding domain
(BD)
and expressed as bait in a yeast test strain. Concomitantly, a library coding
for different
peptides (e.g., 16-mers) of randomized sequence inserted in a scaffold protein
sequence, which are linked to a heterologous transcriptional activation domain
(AD) is
expressed as prey. If a peptide binds to a target protein, a functional
transcription
factor is reconstituted, in which the BD and AD are bridged together by
interacting
proteins. This transcription factor is then able to activate the promoter of a
marker gene
which can be monitored by colorimetric enzymatic assays or by growth
selection.
Additional variation, methods of preparing and screening methodologies are
described
in, for example, Hoppe-Seyler et al., J. Mol. IVled. 78: 426-430 (2000).
loo
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
Nucleotide aptamers are described for example in Brody et al., Trends Mol.
Biotechnol. 74: 5-13 (2000). Additional methods of making and using nucleotide
aptamers include SELEX, i.e., Systematic Evolution of Ligands by Exponential
Enrichment. SELEX is a process of isolating oligonucleotide ligands of a
chosen target
molecule (see Tuerk and Gold, Science 249:505-510 (1990); U.S. Pat. Nos.
5,475,096,
5,595,877, and 5,660,985). SELEX, as described in Tuerk and Gold, involves
admixing
the target molecule with a pool of oligonucleotides (e.g., RNA) of diverse
sequences;
retaining complexes formed between the target and oligonucleotides; recovering
the
oligonucleotides bound to the target; reverse-transcribing the RNA into DNA;
amplifying
the DNA with polymerise chain reactions (PCR); transcribing the amplified DNA
into
RNA; and repeating the cycle with ever increasing binding stringency. Three
enzymatic
reactions are required for each cycle. It usually takes 12-15 cycles to
isolate aptamers
of high affinity and specificity to the target. An aptamer is an
oligonucleotide that is
capable of binding to an intended target substance but not other molecules
under the
same conditions.
In another reference, Bock et al., Nature 355:564-566 (1990), describe a
different process from the SELEX method of Tuerk and Gold in that only one
enzymatic
reaction is required for each cycle (i.e., PCR) because the nucleic acid
library in Bock's
method is comprised of DNA instead of RNA. The identification and isolation of
aptamers of high specificity and affinity with the method of Bock et al. still
requires
repeated cycles in a chromatographic column.
Other nucleotide aptamer methods include those described by Conrad et al.,
Meth. Enzymol. 267:336-367 (1996). Conrad et al. describe a variety of methods
for
isolating aptamers, all of which employ repeated cycles to enrich target-bound
ligands
and require a large amount of purified target molecules. More recently
described
methods of making and using nucleotide aptamers include, but are not limited
to those
described in U.S. Patent Nos. 6,180,348; 6,051,388; 5,840,867; 5,780,610,
5,756,291
and 5,582,981.
Potentially, any compound which binds Dkk or a Dkk interacting protein or
modulates the Dkk/Dkk interacting protein or Dkk/LRP5 or Dkk/LRP6 complex may
be
101
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
a therapeutic compound. In one embodiment of the invention, a peptide or
nucleic acid
aptamer according to the invention is used in a therapeutic composition. Such
compositions may comprise an aptamer, or a LRP5 or LRP6 fragment unmodified or
modified.
Nucleic acid aptamers have been used in compositions for example by chemical
bonding to a carrier molecule such as polyethylene glycol (PEG) which may
facilitate
uptake or stabilize the aptamer. A di-alkylglycerol moiety attached to an RNA
will
embed the aptamer in liposomes, thus stabilizing the compound. Incorporating
chemical substitutions (i.e., changing the 2'-OH group of ribose to a 2'-NH in
RNA
confers ribonuclease resistance) and capping, etc. can prevent breakdown.
Several
such techniques are discussed for RNA aptamers in Brody and Gold Rev. Mol.
Biol.
74:3-13 (2000).
Peptide aptamers may by used in therapeutic applications by the introduction
of
an expression vector directing aptamer expression into the affected tissue
such as for
example by retroviral delivery, by encapsulating the DNA in a delivery complex
or
simple by naked DNA injection. Or, the aptamer itself or a synthetic analog
may be
used directly as a drug. Encapsulation in polymers and lipids may assist in
delivery.
The use of peptide aptamers as therapeutic and diagnostic agents is reviewed
by
Hoppe-Syler and Butz J. Mol. Med. 78:426-430 (2000).
In another aspect of the invention, the structure of a constrained peptide
aptamer of the invention may be determined such as by NMR or X-ray
crystallography.
(Cavanagh et al., Protein NMR Spectroscop~r : Principles and Practice,
Academic
Press, 1996; Drenth, Principles of Protein X-Ra~,~r)rstallographx, Springer
Verlag,
1999) Preferably the structure is determined in complex with the target
protein. A
small molecule analog is then designed according to the positions of
functional
elements of the 3D structure of the aptamer. (Guidebook on Molecular Modelina
in
Drug Desian, Cohen, Ed., Academic Press, 1996; Molecular Modeling and Drug
Desian
I,Topics in Molecular and Structural Biolog~r), Vinter and Gardner Eds., CRC
Press,
1994) Thus, a method is provided for the design of effective and specific
drugs which
modulate the activity of Dkk, Dkk interacting proteins, Dkk/Dkk interacting
protein
102
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
complex, and the Dkk/LRP complex. Small molecule mimics of the peptide
aptamers of
the present invention are also encompassed within the scope of the invention.
16. Alternative Variants of LRP51LRP6 Having HBM Activity
A structural model of the LRPS/Zmax1 first beta-propeller module was generated
based on a model prediction in Springer et al., (1998) J. Molecular Biology,
283:837-
862. Based on the model, certain amino acid residues were identified as
important
variants of LRPS/HBM/Zmax1. The following three categories provide examples of
such variants:
The shape of the beta-propeller resembles a disk with inward-sloping sides and
a hole down the middle. Residue 171 is in a loop on the outer or top surface
of the
domain in blade 4 of propeller module 1. Thus, variants comprising changed
residues
in structurally equivalent positions in other blades; as well as residues that
are slightly
more interior to the binding pocket, but still accessible to the surface, are
important
embodiments of the present invention for the study of bone mass modulation by
LRPS/HBM, for the development of pharmaceuticals and treatments of bone mass
disorders, and for other objectives of the present invention. The following
are examples
of such variants:
A214V ( a position equivalent to 171 in blade 5; alanine is not
conserved in other propellers),
E128V (a position equivalent to 171 in blade 3; glutamate is not
conserved in other propellers),
A65V (a position equivalent to 171 in blade 2; alanine is conserved in
propellers 1-3 but not 4),
G199V (an accessible interior position in blade 5; glycine is
conserved in propellers 1-3 but not 4), and
M282V (accessible interior position in blade 1; methionine is
conserved in propellers 1-3 but not 4).
LRPS/Zmax1 has four beta-propeller structures; the first three beta-propeller
modules conserve a glycine in the position corresponding to residue 171 in
human
103
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
LRPS/Zmax1. Therefore, variants bearing a valine in the equivalent positions
in the
other propellers are important embodiments of the present invention. The
following
variants are useful for the study of bone mass modulation by LRPS/HBM, for the
development of pharmaceuticals and treatments of bone mass disorders, and for
other
objectives of the present invention: G479V, 6781 V, and Q1087V.
The G171V HBM polymorphism results in "occupied space" of the beta-propeller
1, with the side-chain from the valine residue sticking out into an open
binding pocket
and potentially altering a ligand/protein interaction. The glycine residue is
conserved in
LRPS/Zmax1 propellers 1, 2 and 3 but is a glutamine in propeller 4. Therefore,
the
following variants of LRPS/HBM are important embodiments of the present
invention for
the study of bone mass modulation by LRPS/HBM, for the development of
pharmaceuticals and treatments of bone mass disorders, and for other
objectives of the
present invention:
6171 K (which introduces a charged side-chain),
6171 F (which introduces a ringed side-chain),
61711 (which introduces a branched side-chain), and
6171 Q (which introduces the propeller 4 residue).
Furthermore, LRP6 is the closest homolog of LRPS/Zmax1. LRP6 has a beta-
propeller structure predicted to be similar, if not identical to Zmax1. The
position
corresponding to glycine 171 in human LRPS/Zmax1 is glycine 158 of human LRP6.
Thus, corresponding variants of LRP6 are an important embodiment of the
present
invention for the study of the specificity of LRPS/Zmax1 versus its related
family
member, for the development of pharmaceuticals and treatments of bone mass
disorders, and for other objectives of the present invention. Specifically,
for example, a
glycine to valine substitution at the structurally equivalent position,
residue 158, of
human LRP6 and similar variants of other species' LRP6 homologs represent
important
research tools.
Site-directed mutants of LRP5 were generated in the full-length human LRP5
cDNA using the QuikChange XL-Site-Directed Mutagenesis Kit (catalog #200516,
104
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
Stratagene, La Jolla, CA) following the manufacturer's protocol. The mutant
sequences
were introduced using complementary synthetic oligonucleotides:
A65V: TGGTCAGCGGCCTGGAGGATGTGGCCGCAGTGGACTTCC (SEQ ID
N0:129) and
GGAAGTCCACTGCGGCCACATCCTCCAGGCCGCTGACCA(SEQID
N0:130)
E128V: AAGCTGTACTGGACGGACTCAGTGACCAACCGCATCGAGG (SEQ
ID N0:131 ) and
CCTCGATGCGGTTGGTCACTGAGTCCGTCCAGTACAGCTT (SEQ ID
N0:132)
6171 K: ATGTACTGGACAGACTGGAAGGAGACGCCCCGGATTGAGCG
(SEQ ID NO: 133) and
CGCTCAATCCGGGGCGTCTCCTTCCAGTCTGTCCAGTACAT (SEQ ID
N0:134)
6171 F: ATGTACTGGACAGACTGGTTTGAGACGCCCCGGATTGAGCG (SEQ
ID N0:135) and
CGCTCAATCCGGGGCGTCTCAAACCAGTCTGTCCAGTACAT (SEQ ID
N0:136)
61711: ATGTACTGGACAGACTGGATTGAGACGCCCCGGATTGAGCG (SEQ
ID N0:137) and
CGCTCAATCCGGGGCGTCTCAATCCAGTCTGTCCAGTACAT (SEQ ID
N0:138)
G171Q: ATGTACTGGACAGACTGGCAGGAGACGCCCCGGATTGAGCG
(SEQ ID N0:139) and
CGCTCAATCCGGGGCGTCTCCTGCCAGTCTGTCCAGTACAT (SEQ ID
N0:140)
G199V: CGGACATTTACTGGCCCAATGTACTGACCATCGACCTGGAGG
(SEQ ID N0:141 ) and
CCTCCAGGTCGATGGTCAGTACATTGGGCCAGTAAATGTCCG (SEQ ID
N0:142)
los
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
A214V: AGCTCTACTGGGCTGACGTCAAGCTCAGCTTCATCCACCG (SEQ
ID NO: 143) and
CGGTGGATGAAGCTGAGCTTGACGTCAGCCCAGTAGAGCT(SEQID
N0:144)
M282V: GAGTGCCCTCTACTCACCCGTGGACATCCAGGTGCTGAGCC (SEQ
ID N0:145) and
GGCTCAGCACCTGGATGTCCACGGGTGAGTAGAGGGCACTC (SEQ ID
N0:146)
G479V:CATGTACTGGACAGACTGGGTAGAGAACCCTAAAATCGAGTGTGC
(SEQ ID N0:147) and
GCACACTCGATTTTAGGGTTCTCTACCCAGTCTGTCCAGTACATG (SEQ ID
N0:148)
6781 V: CATCTACTGGACCGAGTGGGTCGGCAAGCCGAGGATCGTGCG
(SEQ ID N0:149) and
CGCACGATCCTCGGCTTGCCGACCCACTCGGTCCAGTAGATG (SEQ ID
N0:150)
Q1087V: GTACTTCACCAACATGGTGGACCGGGCAGCCAAGATCGAACG
(SEQ ID N0:151 ) and
CGTTCGATCTTGGCTGCCCGGTCCACCATGTTGGTGAAGTAC (SEQ ID
N0:152)
LRP6 G158V:
GTACTGGACAGACTGGGTAGAAGTGCCAAAGATAGAACGTGC (SEQ ID
N0:153) and
GCACGTTCTATCTTTGGCACTTCTACCCAGTCTGTCCAGTAC(SEQID
N0:154).
All constructs were sequence verified to ensure that only the engineered
modification was present in the gene. Once verified, each variant was
functionally
evaluated in the TCF-luciferase assay in U20S cells (essentially as described
in
Example 7. Other functional evaluations could also be performed, such as the
Xenopus
embryo assay (essentially as described in Example 6), or other assays to
evaluate Wnt
106
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
signaling, Dkk modulation, or anabolic bone effect. Binding of these mutants
to Dkk,
LRP-interacting proteins, Dkk-interacting proteins, or peptide aptamers to any
of the
preceding could also be investigated in a variety of ways such as in a two-
hybrid
system (such as in yeast as described in this application), or other methods.
Figure 24 shows the effects of the 6171 F mutation in propeller 1 of LRPS.
This
mutation is at the same position as HBM's 6171 V substitution. Expression of
6171 F
results in an HBM effect. That is, in the presence of Wnt, 6171 F is able to
activate the
TCF-luciferase reporter construct. In fact, it may activate the reporter to a
greater
extent than either LRP5 or HBM. Furthermore, in the presence of Dkk1 and Wnt1,
6171 F is less susceptible than LRP5 to modulation by Dkk. These data
exemplify that
the 6171 F variant modulates Wnt signaling in a manner similar to HBM. In
addition,
this data confirms that HBM's valine residue at 171 is not the only
modification at 171
that can result in an HBM effect. Together these data support an important
role for
LRP5 propeller 1 in modulating Wnt pathway activity; in responding to Dkk
modulation;
and, in the ability to generate an HBM effect.
Figure 25 shows the effects of the M282V mutation in propeller 1 of LRPS.
M282 expression results in an HBM-effect. That is, in the presence of Wnt,
M282 is
able to activate the TCF-luciferase reporter construct. Furthermore, in the
presence of
Dkk1 and Wnt1, M282V is less susceptible than LRP5 to modulation by Dkk. These
data show that the M282V variant modulates Wnt signaling in a manner similar
to HBM.
In addition, this data confirms that modifications of other residues in
propeller 1 of LRP5
can result in an HBM effect.
These data support an "occupied space" model of the HBM mutation in propeller
1 and show that multiple mutations of propeller 1 are capable of generating an
HBM
effect; the original G171V HBM mutation is not unique in this ability.
Moreover, various
perturbations in propeller 1 can modulate Dkk activity.
These data illustrate the molecular mechanism of Dkk modulation of LRP
signaling. Using the methods disclosed herein and in U.S. Application
60/290,071,
generation of a comprehensive mutant panel will reveal residues in LRP that
function in
Dkk modulation of Wnt signaling. Such variants of LRP5 and LRP6 that modulate
Dkk
log
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
activity and the residues which distinguish them from LRP5 and LRP6 are points
for
therapeutic intervention by small molecule compound, antibody, peptide
aptamer, or
other agents. Furthermore, models of each HBM-effect mutation/polymorphism may
be
used in rational drug design of an HBM mimetic agent.
These are only a few illustrative examples presented to better describe the
present invention. Variants of LRP5 which have demonstrated HBM activity in
assays
include 6171 F, M282V, 6171 K, 6171 Q and A214V. Clearly, other variants may
be
contemplated within the scope of the present invention. Furthermore, wherever
HBM is
recited in the methods of the invention, it should be understood that any such
alternative variant of LRP which demonstrates HBM biological activity is also
encompassed by those claims.
17. Screening Assays
The two-hybrid system is extremely useful for studying protein:protein
interactions. See, e.g., Chien et al., Proc. Natl Acad. Sci. USA 88:9578-82
(1991 );
Fields et al., Trends Genetics 10:286-92 (1994); Harper et al., Cel175:805-16
(1993);
Vojtek et al., Cel174:205-14 (1993); Luban et al., Cel173:1067-78 (1993); Li
et al.,
FASEB J. 7:957-63 (1993); Zang et al., Nature 364:308-13 (1993); Golemis et
al., Mol.
Cell. Biol. 12:3006-14 (1992); Sato et al., Proc. Natl Acad. Sci. USA 91:9238-
42 (1994);
Coghlan et al., Science 267:108-111 (1995); Kalpana et al., Science 266:2002-6
(1994); Helps et al., FEBS Lett. 340:93-8 (1994); Yeung et al., Genes & Devel.
8:2087-
9 (1994); Durfee et al., Genes & Devel. 7:555-569 (1993); Paetkau et al.,
Genes &
Devel. 8:2035-45; Spaargaren et al., 1994 Proc. Natl. Acad. Sci. USA 91:12609-
13
(1994); Ye et al., Proc. Natl Acad. Sci. USA 91:12629-33 (1994); and U.S.
Patent Nos.
5,989,808; 6,251,602; and 6,284,519.
Variations of the system are available for screening yeast phagemid (see,
e.g.,
Harper, Cellular Interactions and Development: A Practical Approach, 153-179
(1993);
Elledge et al., Proc. Natl Acad. Sci. USA 88:1731-5 (1991 )) or plasmid
(Bartel, 1993
and Bartel, Cell 14:920-4 (1993)); Finley et al., Proc. Natl Acad. Sci. USA
91:12980-4
los
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
(1994)) cDNA libraries to clone interacting proteins, as well as for studying
known
protein pairs.
The success of the two-hybrid system relies upon the fact that the DNA binding
and polymerise activation domains of many transcription factors, such as GAL4,
can
be separated and then rejoined to restore functionality (Morin et al., Nuc.
Acids Res.
21:2157-63 (1993)). While these examples describe two-hybrid screens in the
yeast
system, it is understood that a two-hybrid screen may be conducted in other
systems
such as mammalian cell lines. The invention is therefore not limited to the
use of a
yeast two-hybrid system, but encompasses such alternative systems.
Yeast strains with integrated copies of various reporter gene cassettes, such
as
for example GAL.fwdarw.LacZ, GAL.fwdarw.HIS3 or GAL.fwdarw.URA3 (Bartel, in
Cellular Interactions and Development: A Practical Approach, 153-179 (1993);
Harper
et al., Cel175:805-16 (1993); Fields et al., Trends Genetics 10:286-92 (1994))
are co-
transformed with two plasmids, each expressing a different fusion protein. One
plasmid
encodes a fusion between protein "X" and the DNA binding domain of, for
example, the
GAL4 yeast transcription activator (Brent et al., Ce1143:729-36 (1985); Ma et
al., Cell
48:847-53 (1987); Keegan et al., Science 231:699-704 (1986)), while the other
plasmid
encodes a fusion between protein "Y" and the RNA polymerise activation domain
of
GAL4 (Keegan et al., 1986). The plasmids are transformed into a strain of the
yeast
that contains a reporter gene, such as IacZ, whose regulatory region contains
GAL4
binding sites. If proteins X and Y interact, they reconstitute a functional
GAL4
transcription activator protein by bringing the two GAL4 components into
sufficient
proximity to activate transcription. It is well understood that the role of
bait and prey
proteins may be alternatively switched and thus the embodiments of this
invention
contemplate and encompass both alternative arrangements.
Either hybrid protein alone must be unable to activate transcription of the
reporter gene, the DNA-binding domain hybrid, because it does not provide an
activation function, and the activation domain hybrid, because it cannot
localize to the
GAL4 binding sites. Interaction of the two test proteins reconstitutes the
function of
GAL4 and results in expression of the reporter gene. The reporter gene
cassettes
109
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
consist of minimal promoters that contain the GAL4 DNA recognition site
(Johnson et
al., Mol. Cell. Biol. 4:1440-8 (1984); Lorch et al., J. Mol. Biol. 186:821-824
(1984))
cloned 5' to their TATA box. Transcription activation is scored by measuring
either the
expression of ~3-galactosidase or the growth of the transformants on minimal
medium
lacking the specific nutrient that permits auxotrophic selection for the
transcription
product, e.g., URA3 (uracil selection) or HIS3 (histidine selection). See,
e.g., Bartel,
1993; Durfee et al., Genes & Devel. 7:555-569 (1993); Fields et al., Trends
Genet.
10:286-292 (1994); and U.S. Pat. No. 5,283,173.
Generally, these methods include two proteins to be tested for interaction
which
are expressed as hybrids in the nucleus of a yeast cell. One of the proteins
is fused to
the DNA-binding domain (DBD) of a transcription factor and the other is fused
to a
transcription activation domain (AD). If the proteins interact, they
reconstitute a
functional transcription factor that activates one or more reporter genes that
contain
binding sites for the DBD. Exemplary two-hybrid assays which have been used
for
Dkk-1 or Dkk-1/LRP5 are presented in the Examples below.
Additional methods of preparing two hybrid assay systems for Dkk-1 interactors
would be evident to one of ordinary skill in the art. See for example, Finley
et al., "Two-
Hybrid Analysis of Genetic Regulatory Networks," in The Yeast Two-Hybrid
System
(Paul L. Bartel et al., eds., Oxford, 1997); Meijia Yang, "Use of a
Combinatorial Peptide
Library in the Two-Hybrid Assay," in The Yeast Two-Hybrid System (Paul L.
Bartel et
al., eds., Oxford, 1997); Gietz et al., "Identification of proteins that
interact with a protein
of interest: Applications of the yeast two-hybrid system," Mol. & Cell.
Biochem. 172:67-9
(1997); K. H. Young, "Yeast Two-Hybrid: So Many Interactions,(in) so Little
Time," Biol.
Reprod. 58:302-311 (1998); R. Brent et al., "Understanding Gene and Allele
Function
with Two-Hybrid Methods," Annu. Rev. Genet. 31:663-704 (1997). It will be
appreciated that protein networks can be elucidated by performing sequential
screens
of activation domain-fusion libraries.
Without further description, it is believed that one of ordinary skill in the
art can,
using the preceding description and the following illustrative examples, make
and utilize
the compounds of the present invention and practice the claimed methods. The
llo
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
following working examples therefore, specifically point out preferred
embodiments of
the present invention, and are not to be construed as limiting in any way the
remainder
of the disclosure.
EXAMPLES
The present invention is described by reference to the following Examples,
which are offered by way of illustration and are not intended to limit the
invention in any
manner. Standard techniques well-known in the art or the techniques
specifically
described below were utilized.
For routine practice of the protocols referenced below, one of skill in the
art is
directed to the references cited in this application as well as the several
Current
Protocol guides, which are continuously updated, widely available and
published by
John Wiley and Sons, (New York). In the life sciences, Current Protocols
publishes
comprehensive manuals in Molecular Biology, Immunology, Human Genetics,
Protein
Science, Cytometry, Neuroscience, Pharmacology, Cell Biology, Toxicology, and
Nucleic Acid Chemistry. Additional sources are known to one of skill in the
art.
Example 1
Yeast Two Hybrid Screen Usina LRP5 Liaand Bindina Domain (LBDI Bait Seauences
In a screen against human osteoblast library (i.e., HOB03C5, a custom Gibco
generated Y2H compatible cDNA library from a human osteoblast cell line as
described
by Bodine and Komm, Bone 25:535-43 (1999)), an interaction with Dkk-1 was
identified. The LRPS ligand binding domain (LBD) baits used for this screen
are
depicted in Figures 2B and C. The basic protocol is as follows:
An overnight culture of the yeast strain containing the bait of interest is
grown in
20 ml of appropriate selective medium containing 2% glucose at 30°C.
The overnight
culture is diluted by a 10 fold factor into YPDmedia supplemented with 40 mg/I
of
adenine, and grown for 4 hours at 30°C.
For each mating event, an aliquot of the frozen prey library is grown in 150
ml
YAPD medium for 5 hours at 30°C.
111
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
Appropriate volumes calculated by measuring the OD600 of each culture are
combined into a tube. The number of diploids to be screened is typically ten
times the
number of clones originally present in the prey library of interest. Assuming
a mating
efficiency of 20% minimum, fifty times (i.e., ten times coverage multiplied by
20%
mating efficiency) as many haploid cells containing the bait and as many cells
containing the prey are used in any given mating event. The mixture is
filtered over a 47
mm, 0.45 mm sterile Metricel filter membrane (Gelman).
Using sterile forceps, the filter is transferred onto a 100 mm2 YAPD agar
plate
with the cell side up, removing all air bubbles underneath the filter. The
plate is
incubated overnight at room temperature.
The filter is transferred into a 50 ml Falcon tube using sterile forceps and
10 ml
SD medium containing 2% glucose are added to resuspend the cells. The filter,
once
free of cells, is removed and the cell suspension is spun for 5 min. at 2,000
xg.
The cells are resuspended in 10 ml SD medium containing 2% glucose. An
aliquot of 100 ,u1 is set aside for titration.
The cells are plated onto large square plates containing appropriate selective
media and incubated at 30°C for three to five days.
To calculate the mating efficiency and to determine the total number of
diploid
cells screened, the 100 ,u1 aliquot set aside for titration is diluted and
plated onto
different selective media. The mating efficiency is calculated by dividing the
number of
diploids/ml by the lowest number of haploids/ml, either bait or prey, and
multiplied by
100. For example, if 2 million diploids were obtained by mating 10 million of
haploids
containing a bait and 12 million of haploids containing a prey, then the
mating efficiency
is calculated by dividing 2 million by 10 million, which equals 0.2 and
multiplied by 100
which equals 20%. Typical mating efficiencies under the above conditions are
within
about 20 to about 40%. The total number of diploids screened in a mating event
is
obtained by multiplying the number of diploids/ml by the total number of ml
plated,
typically about 10.
112
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
Isolation of colonies containing pairs of interacting proteins.
Yeast colonies from the interaction selection (large square) plates are picked
with a sterile toothpick and patched onto plates containing the appropriate
selective
media and incubated at 30°C for two days.
To further ensure purity of the yeast, the. plates are replicated onto another
plate
containing the same media and incubated at 30°C for another two days.
Yeast patches are scraped using a sterile toothpick and placed into a 96-well
format plate containing 100 ~cl SD -L -W -H with 2% glucose liquid medium.
Half the volume of the plate is transferred to a 96-well plate containing 50
,u1 of
40% glycerol for storage. The other half is set aside for replication and
galactosidase
activity assay (see below).
Cells are replicated onto a SD -L -W -H plate with 2% glucose plate to create
a
master plate, and incubated two days at 30°C. The master plate is
replicated onto
different selective media to score the strength of each interaction.
Cells are also replicated onto media selecting for the prey vector only for
colony
PCR and incubated two days at 30°C.
Galactosidase activity assay
Ten microliters from the 96-well plate (set aside from above) are transferred
into
another 96-well plate containing 100 ,u1 SD and 2% glucose media. The cell
density is
measured at ODsoo using a spectrophotometer, the ODsoo is usually between 0.03
and
0.1. Fifty microliters of Galactosidase reaction mixture (Tropix) are added to
microplates (Marsh) specifically designed for the luminometer (Hewlett Packard
Lumicount). Fifty microliters of the diluted cells are then added and mixed by
pipetting.
The reaction is incubated sixty to one hundred twenty minutes at room
temperature.
Relative Light Units (RLUs) are read by the luminometer. Each plate contains a
negative control, constituted by diploid yeast containing the bait of interest
and an
empty prey vector. To be scored as positive, the diploids tested have to have
an RLU
number at least twice as high as the negative control.
113
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
Example 2
Minimum interaction domain map,~ina_
Further analysis of yeast two hybrid (Y2H) interacting proteins includes the
dissection of protein motifs responsible for the interaction. Sequence
alignment of
multiple clones identified in the Y2H screens can help identify the smallest
common
region responsible for the interaction. In the absence of appropriate clones,
deletion
mapping of interacting domains is necessary.
PCR primers containing restriction sites suitable for cloning are designed to
cover multiple sub-domains of the protein of interest (bait or prey). The
methods
involved in cloning, sequencing, yeast transformation, mating, and scoring of
interactions are readily performed by one of ordinary skill in the art of
molecular biology
and genetic engineering.
Materials and Methods
Minimum interaction domain: primers were designed for PCR of the Dkk-1 clone
isolated by screening a primary osteoblast cell strain (HOB03C5) library with
pooled
Zmax1/LRPS ligand binding domain (LBD) baits: LBD1 (Leu969-Pro1376) and LBD4
(Arg1070-Pro1376). The primers, which are presented in 5' to 3' orientation,
were as
follows:
SEQ ID NO Primer Sequence
155 Forward 1 TTTTTTGTCGACCAATTCCAACGCTATCAAG
156 Forward 2 TTTTTTGTCGACCTGCGCTAGTCCCACCCGC
157 Forward 3 TTTTTTGTCGACCGTGTCTTCTGATCAAAATC
158 Forward 4 TTTTTTGTCGACCGGACAAGAAGGTTCTGTTTG
159 Reverse 1 TTTTTTGCGGCCGCTTATTTGGTGTGATACATTTTTG
160 Reverse 2 TTTTTTGCGGCCGCTTAGCAAGACAGACCTTCTCC
161 Reverse 3 TTTTTTGCGGCCGCTTAGTGTCTCTGACAAGTGTG
114
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
PCR was performed using PfuTurbo~ polymerase (Stratagene). The PCR
products were gel purified, digested with Sall/ Notl and ligated to pPC86
(Gibco/BRL)
which had been linearized with Sall/Notl. Clones were recovered and sequenced
to
ascertain that the structure was as expected and that the Gal4 activation
domain and
Dkk-1 were in-frame. The ORF of Dkk-1 was Met1-His266, as in human Dkk-1
(GenBank Accession No. XM 005730).
The clones used were as follows: D5 (F1/R3: Asn34-His266), D4 (F1/R2:
Asn34-Cys245), D3 (F1/R1: Asn34-Lys182), D9 (F2/R3: Cys97-His266), D12 (F3/R3,
va1139-His266), D14 (F4/R3: GIy183-His266), D8 (F2/R2: Cys97-Cys245), and D11
(F3/R2: Val139-Cys245). F1, F2, F3 and F4 refer respectively to Forward
primers 1, 2,
3 and 4. R1, R2 and R3 refer respectively to reverse primers 1, 2 and 3.
These clones were transformed into yeast and mated with each of three yeast
strains containing pDBleu (Gibco/BRL), pDBIeuLBD1, and pDBIeuLBD4. Positive
interactions were detected by growth of the hybrids on appropriate selective
media.
Results
Minimum interaction domain: Figure 6 shows that while growth was observed in
diploids of D4, D5, D8, D9, and D12, no growth was observed in hybrids of D3,
D11,
and D12. Carboxy terminal (C-terminal) deletions indicated that while the C-
terminal
amino acids of Dkk-1 containing the potential N-glycosylation site (Arg246-
His266) are
not required for interaction with Zmax1/LRP5 LBD baits, the Cys2 domain,
GIy183-
Cys245, is required. N-terminal deletions also demonstrated that the region
between
the two cysteine domains, i.e. Va1139 to Lys182, is also required. Two minimum
interaction domain constructs were isolated: D12 (Va1139-His266) and D8 (Cys97-
Cys245). Similar constructs could be prepared for Dkk-1 interactors.
Example 3
Yeast-2 Hybrid screen for peptide aptamer sequences to Dkk-1
Peptide aptamer library construction
lls
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
A peptide aptamer library, Tpep, was constructed, which provides a means to
identify chimeric proteins that bind to a protein target (or bait) of interest
using classic
yeast two hybrid (Y2H) assays. The Tpep library is a combinatorial aptamer
library
composed of constrained random peptides, expressed within the context of the
disulfide
loop of E. coli thioredoxin (trxA), and as C-termini fusion to the S.
cerevisiae Gal4
activation domain. The Tpep library was generated using a restriction enzyme
modified
recombinant Y2H prey vector, pPC86 (Gibco), which contains the trxA scaffold
protein.
Generation of aptamer-encoding sequences
Aptamer-encoding sequences were produced as follows. DNA encoding
random stretches of approximately sixteen amino acids surrounded by
appropriate
restriction sites were generated by semi-random oligonucleotide synthesis. The
synthetic oligonucleotides were PCR-amplified, restriction digested, and
cloned into the
permissive sites within the trxA scaffold protein. The cloning strategy was to
insert the
random oligonucleotide sequence is in-frame with the scaffold protein coding
sequence,
resulting in expression of a scaffold protein-aptamer chimera. The scaffold
protein is
itself in-frame with the activation domain of Gal4, within the pPC86 vector
that is
appropriate for the aptamer to be expressed and functional in a regular Y2H
assay.
Additional methods of preparing aptamers would be apparent to the skilled
artisan.
Generation of a permissive recombinant pPC86 vector containing the trxA coding
sequence
First the Rsrl1 restriction site located within the Gal4 activation domain of
pPC86
(Gibco) was eliminated by site-directed mutagenesis (QuickchangeT"" kit,
Stratagene).
The amino acid sequence of the Gal4 activation domain was unchanged by this
modification. The strength of different control interactions was verified to
be
unchanged by the modification.
Second, the E. coli trxA coding sequence was cloned into the Sall and Notl
sites
of the Rsril-modified pPC86. EcoRl and Spel sites were then introduced within
the trxA
116
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
Rsrll site. The oligonucleotides encoding the peptide aptamers were cloned
into the
EcoRl and Spel sites of the resulting vector.
Example 4
Yeast-2 Hybrid screen for Dkk-1 interacting proteins
A Dkk-1 bait sequence was utilized in a yeast two hybrid screen to identify
Dkk-1
interacting proteins. The procedure for the Y2H was carried out similarly to
that
employed in Example 1, except that the Dkk-1 bait from Figure 2C was used
instead of
LRP baits. The screen was performed using Hela and fetal brain libraries
(Invitrogen
Corporation, Carlsbad, CA). Multiple libraries were used to identify
additional Dkk-1
interacting proteins and to confirm interactions found in other libraries.
The list of Dkk-1 interacting proteins uncovered in these Y2H screens are
listed
in Figure 5.
The interacting proteins identified in the Dkk-1 bait screen can be used in
other
Y2H screens with LRP baits and other Dkk-1 interacting proteins to determine
more
complex interactions which may modulate Dkk-1/LRP interactions and/or Wnt
signaling.
Example 5
Generation of antibodies
In each of the following antibody-generating examples, the synthesis of these
linear peptides is followed by injection into two New Zealand Rabbits.
Subsequent
boosts and bleeds are taken according to a standard ten-week protocol. The end-
user
receives back 5 mgs of peptide, aliquots of pre-bleeds, roughly 80 ml of crude
sera
from each of the two rabbits and, and ELISA titration data is obtained.
Generation of LRPS Polymorphism-specific antibodies
Antibodies were generated to the following peptides to obtain antibodies which
distinguish the HBM polymorphism versus wild-type LRPS/Zmax: MYWTDWVETPRIE
11~
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
(SEQ ID N0:123) (mutant peptide) and MYWTDWGETPRIE (SEQ ID N0:124) (wild-
type peptide for negative selection). Immunofluorescence data confirmed that
the
antibody, after affinity purification, is specific for HBM and does not
recognize LRP5
(Figure 17).
Generation of LRPS Monospecific antibodies
LRP5 monospecific polyclonal antibodies were generated to the following amino
acid sequences of LRPS: Peptide 1 (a.a. 265-277) - KRTGGKRKEILSA (SEQ ID
N0:125), Peptide 2 (a.a. 1178-1194) - ERVEKTTGDKRTRIQGR (SEQ ID N0:126),
and Peptide 3 (a.a. 1352-1375) - KQQCDSFPDCIDGSDE (SEQ ID N0:127).
Immunofluorescence confirmed that the antibody generated detects LRPS.
Generation of Dkk-1 monospecific polyclonal antibodies
Dkk-1 monospecific polyclonal antibodies were generated to the following amino
acid sequences of Dkk-1: Peptide 1 (a.a. 71-85) - GNKYQTIDNYQPYPC (SEQ ID
N0:118), Peptide 2 (a.a. 165-186) - LDGYSRRTTLSSKMYHTKGQEG (SEQ ID
N0:119 ),, Peptide 3 (a.a. 246-266) - RIQKDHHQASNSSRLHTCQRH (SEQ ID
N0:120), Peptide 4 (a.a. 147-161 ) - RGEIEETITESFGND (SEQ ID N0:121 ), and
Peptide 5 (232-250) - EIFQRCYCGEGLSCRIQKD (SEQ ID N0:122) of human Dkk-1.
Figure 26 shows the location of the various peptides selected, their
relationship to the
Dkk-1 amino acid sequence and polyclonal antibodies generated.
Western blots demonstrated that the antibodies generated against peptides 2
(Antibody #5521 ) (Figure 27) and 4 (Antibody #74397) (Figure 28) are specific
toward
Dkk-1. Figure 27 shows Western blots using 500 ,u1 of conditioned medium (CM)
from
non-transfected 293 cells or from 293 cells transfected with Dkk1-V5 that were
immunoprecipitated by anti-V5 antibody. Bead elutes were separated by non-
reducing
SDS-PAGE (lanes #4, 5 of Figure 27). 20 ,u1 of conditioned medium from both
samples
(lanes #2, 3 of Figure 27) and from Dkk1-AP transfected 293 cells (lane #6 of
Figure
27) were additionally separated on the gel. The Western was performed using
lls
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
antibodies Anti-V5/AP (1:10,000) and Ab#5521 (10 ,ug/ml). Ab#5521 detected
Dkk1-V5
and Dkk1-AP from conditioned medium.
Figure 28 shows Western blot results using Ab#74397. Anti-V5/AP was tested
at a 1:4000 dilution and Ab#74397 was tested at a 1:500 dilution. Ab#74397 was
able
to detect Dkk1-V5 in both conditioned medium and immunoprecipitated
conditioned
medium.
The results obtained with antibodies #5521 and #74397 are summarized in the
following table:
Rabbit Peptide Peptide Purified Western Immuno- Location
No. PositionSequence (YIN) precipitation
5521 165-186 LDGYSR Y (ProteinY N/A Between
RTTLSSK G Cy1 and
MYHTKG purified) Cys2
QEG domain
74397 147-161 RGEIEETI N Y N/A Between
TESFGN Cy1 and
D Cys2
domain
Example 6
Effects of exogenous Dkk-1 on Wnt-mediated signaling in the Xenopus embr)ro
assay
Xenopus embryos are an informative and well-established in vivo assay system
to evaluate the modulation of Wnt signaling (McMahon et al., Cell 58: 1075-84
(1989);
Smith and Harland, 1991; reviewed in Wodarz and Nusse 1998) .
Modification of the Wnt signaling pathway can be visualized by examining the
embryos for a dorsalization phenotype (duplicated body axis) after RNA
injection into
the ventral blastomere at the 4- or 8-cell stage. On the molecular level,
phenotypes can
be analyzed by looking for expression of various marker genes in stage 10.5
embryos.
Such markers would include general endoderm, mesoderm, and ectoderm markers as
well as a variety of tissue-specific transcripts.
119
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
Analysis can be done by RT-PCR/TaqMan~ and can be done on whole embryo
tissue or in a more restricted fashion (microdissection). Because this system
is very
flexible and rapid, by injecting combinations of transcripts, such as HBM and
different
Wnts or Wnt antagonists, the mechanism of HBM in the Wnt pathwaycan thereby be
dissected. Furthermore, investigations are conducted to determine whether
Zmax/LRP5 and HBM differentially modulate Wnt signaling either alone, or in
combination with other components. Previous studies have demonstrated that
LRP6
alone or LRP5 + WntSa were able to induce axis duplication (dorsalization) in
this
system (Tamai et al., Nature 407: 530-35 (2000)).
Constructs for Xenopus Expression (Vector pCS2+)
Constructs were prepared using the vector pCS2+. DNA inserts were subcloned
in the sense orientation with respect to the vector SP6 promoter. The pCS2+
vector
contains an SV40 virus polyadenylation signal and T3 promoter sequence (for
generation of antisense mRNA) downstream of the insert.
Full length Zmax/LRP5 and HBM ORF cDNA: Insert cDNA was isolated from
the full length cDNA retrovirus constructs (with optimized Kozak sequences) by
Bglll-
EcoRl digestion and subcloned into the BamHl-EcoRl sites of the pCS2+ vector.
Full length XWntB: This cDNA was PCR amplified from a Xenopus embryo
cDNA library using oligos 114484 (SEQ ID N0:162) (5'-
CAGTGAATTCACCATGCAAAACACCACTTTGTTC-3') and 114487 (SEQ ID N0:163)
(5'-CAGTTGCGGCCGCTCATCTCCGGTGGCCTCTG-3'). The oligos were designed
to amplify the ORF with a consensus Kozak sequence at the 5' end as determined
from
GenBank #X57234. PCR was carried out using the following conditions:
96°C, 45 sec.;
63°C, 45 sec.; 72°C, 2 min. for 30 cycles. The resulting PCR
product was purified,
subcloned into pCRll-TOPO (Invitrogen Corp.), sequence verified, and digested
with
BamHl/Xhol. This insert was subcloned into the vector at the BamHl Xhol sites.
Full length WntSa: A murine WntSa cDNA clone was purchased from Upstate
Biotechnology (Lake Placid, NY) and subcloned into the EcoRl site of the
vector.
Sequencing confirmed insert orientation.
120
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
Full length human Dkk-1: A human cDNA with GenBank accession number
AF127563 was available in the public database. Using this sequence, PCR
primers
were designed to amplify the open reading frame with a consensus Kozak
sequence
immediately upstream of the initiating ATG. Oligos 117162 (SEQ ID N0:164) (5'-
CAATAGTCGACGAATTCACCATGGCTCTGGGCGCAGCGG-3') and 117163 (SEQ
ID N0:165) (5'-GTATTGCGGCCGCTCTAGATTAGTGTCTCTGACAAGTGTGAA-3')
were used to screen a human uterus cDNA library by PCR. The resulting PCR
product
was purified, subcloned into pCRll-TOPO (Invitrogen Corp.), sequence verified,
and
digested with EcoRl/Xhol. This insert was subcloned into the pCS2+ vector at
the
EcoRl-Xhol sites.
Full length human Dkk-2: A full length cDNA encoding human Dkk-2 was
isolated to investigate the specificity of the Zmax/LRPS/HBM interaction with
the Dkk
family of molecules. Dkk-1 was identified in yeast as a potential binding
partner of
Zmax/LRI'S/HBM. Dkk-1 has also been shown in the literature to be an
antagonist of
the Wnt signaling pathway, while Dkk-2 is not (Krupnik et al., 1999). The Dkk-
2 full
length cDNA serves as a tool to discriminate the specificity and biological
significance
of Zmax/LRPS/HBM interactions with the Dkk family (e.g., Dkk-1, Dkk-2, Dkk-3,
Dkk-4,
Soggy, their homologs and variant, etc.). A human cDNA sequence for Dkk-2
(GenBank Accession No. NM 014421 ) was available in the public database. Using
this
sequence, PCR primers were designed to amplify the open reading frame with a
consensus Kozak sequence immediately upstream of the initiating ATG. Oligos
51409
(SEQ ID N0:166) (5'- CTAACGGATCCACCATGGCCGCGTTGATGCGG-3') and
51411 (SEQ ID N0:167) (5'-GATTCGAATTCTCAAATTTTCTGACACACATGG-3')
were used to screen human embryo and brain cDNA libraries by PCR. The
resulting
PCR product was purified, subcloned into pCRll-TOPO, sequence verified, and
digested with BamHl/EcoRl. This insert was subcloned into the pCS2+vector at
the
BamHl-EcoRl sites.
Full length LRP6 was isolated from the pED6dpc4 vector by Xhol-Xbal digestion.
The full length cDNA was reassembled into the Xhol-Xbal sites of pCS2+. Insert
orientation was confirmed by DNA sequencing.
121
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
mRNA Synthesis and Microinjection Protocol
mRNA for microinjection into Xenopus embryos is generated by in vitro
transcription using the cDNA constructs in the pCS2+ vector described above as
template. RNA is synthesized using the Ambion mMessage mMachine high yield
capped RNA transcription kit (Cat. #1340) following the manufacturer's
specifications
for the Sp6 polymerase reactions. RNA products were brought up to a final
volume of
50 NI in sterile, glass-distilled water and purified over Quick Spin Columns
for
Radiolabelled RNA Purification G50-Sephadex (Roche, Cat. #1274015) following
the
manufacturer's specifications. The resulting eluate was finally extracted with
phenol:chloroform:isoamyl alcohol and isopropanol precipitated using standard
protocols (Sambrook et al., 1989). Final RNA volumes were approximately 50 p1.
RNA
concentration was determined by absorbance values at 260 nm and 280 nm. RNA
integrity was visualized by ethidium bromide staining of denaturing
(formaldehyde)
agarose gel electrophoresis (Sambrook et al., 1989). Various amounts of RNA (2
pg to
1 ng) are injected into the ventral blastomere of the 4- or 8-cell Xenopus
embryo.
These protocols are described in Moon et al., Technique-J. of Methods in Cell
and Mol.
Biol. 1: 76-89 (1989), and Peng, Meth. Cell. Biol. 36: 657-62 (1991 ).
Screening for Duplicated Body Axis
In vitro transcribed RNA is purified and injected into a ventral blasomere of
the 4-
or 8-cell Xenopus embryo (approx. 2 hours post-fertilization). At stage 10.5
(approx. 11
hours post-fertilization), the injected embryos are cultured for a total of 72
hours and
then screened for the presence of a duplicated body axis (dorsalization)
(Figure 7).
Using XWntB-injected (2-10 pg) as a positive control (Christian et al. (1991
)) and water-
injected or non-injected embryos as negative controls, we replicated the
published
observation that Zmax(LRPS) + WntSa (500 and 20 pg, respectively) could induce
axis
duplication. WntSa (20 pg) alone could not induce axis duplication (as
previously
reported by Moon et al. (1993)). We have also injected GFP RNA (100-770 pg) as
a
negative control to show that the amount of RNA injected is not perturbing
embryo
development (not shown). Strikingly, HBM + WntSa (500 and 20 pg, respectively)
122
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
yielded an approximately 3.5 fold more robust response of the phenotype
(p=0.043 by
Fisher's exact test) compared to Zmax(LRPS) + WntSa, suggesting that the HBM
mutation is activating the Wnt pathway (Figures 8 and 9). The HBM/WntSa
embryos
also appear to be more "anteriorized" than the Zmax(LRPS)/WntSa embryos, again
suggestive of a gain-of-function mutation.
The role of Dkk-1 as a modulator of Zmax/LRP5- and HBM-mediated Wnt
signaling was investigated. Literature reports have previously characterized
Xenopus
and murine Dkk-1 as antagonists of the canonical Wnt pathway in the Xenopus
system
(Glinka et al., Nature 391:357-362 (1998)). Using the human Dkk-1 construct, a
dose-
response assay was performed to confirm that our construct was functional and
to
identify the optimal amount of RNA for microinjection. Using 250 pg/embryo of
hDkk-1
RNA, over 90% (p<0.001 ) of the embryos were observed to display enlarged
anterior
structures (big heads) as anticipated from the published reports (Figure 10).
The mechanism of hDkk-1 modulation of Wnt signaling in the presence of
Zmax/LRP5 or HBM was also investigated. Without any hDkk-1 present, it was
confirmed that HBM + WntSa was a more potent activator of Wnt signaling than
Zmax/LRP5 + WntSa (p<0.05). Interestingly, in the presence of hDkk-1 (250 pg),
Zmax/LRPS-mediated Wnt signaling was repressed (p<0.05) but hDkk-1 was unable
to
repress HBM-mediated Wnt signaling (p<0.01 ) (Figure 11 ). The specificity of
this
observation can be further addressed by investigating other members of the Dkk
family,
other Wnt genes, LRP6, additional Zmax/LRPS mutants, and the peptide aptamers.
Example 7
Effects of exogenous Dkk and LRP5 on Wnt signaling in the TCF-luciferase Assay
Wnt activity can be antagonized by many proteins including secreted Frizzled
related proteins (SFRPs), Cerberus, Wnt Inhibitory Factor-1 and Dkk-1 (Krupnik
et al.,
1999). The Dkk family of proteins consists of Dkk-1-4 and Soggy, a Dkk-3-like
protein.
Dkk-1 and Dkk-4 have been shown to antagonize Wnt mediated Xenopus embryo
development, whereas Dkk-2, Dkk-3, and Soggy do not. Unlike many of these
proteins
123
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
that antagonize Wnt activity by directly interacting with Wnt proteins, Dkk-1
acts by
binding to two recently identified Wnt coreceptors, LRPS and LRP6. (Mao et
al., 2001;
Bafico et al., 2001 ). The details of this interaction have been examined by
the present
inventors and Mao et al. using deletion constructs of LRP6, which demonstrated
that
EGF repeats 3 and 4 are important for Dkk-1 interaction. Accordingly, the
activity of
two Dkk proteins, Dkk-1 and Dkk-2, were investigated with various Wnt members,
LRPS, LRP6, and the mutant form of LRPS, designated HBM. The present invention
explores whether there is any functional difference between LRP5 and HBM with
regard
to Dkk action on Wnt mediated signaling. Various reagents were developed,
including
Dkk-1 peptides, constrained LRP5 peptide aptamers, constrained Dkk-1 peptide
aptamers and polyclonal antibodies to Dkk-1 (in Example 5 above) to identify
factors
that mimic HBM mediated Wnt signaling.
Methods
Various LRPS constrained peptides were developed. Specifically, four peptides
that interact with the LBD of LRPS (Figure 4,constructs OST259-262 in Figure
12) and
three peptides that interact with the cytoplasmic domain of LRP5 (constructs
OST266-
OST268 in Figure 12). In addition two Dkk-1 peptides were developed:
constructs
OST264 and OST265 in Figure 12, corresponding to Dkk-1 amino acids 139-266 and
96-245, containing the smallest region of Dkk-1 that interacts with LRP5
(Figure 6).
The cDNA clones encoding the LRPS LBD interacting peptides and the Dkk-1
peptides
were subcloned into pcDNA3.1 with the addition of a Kozak and signal sequence
to
target the peptide for secretion. The constructs encoding the three peptides
interacting
with the cytoplasmic domain of LRP5 were also subcloned into pcDNA3.1.
However,
these latter constructs do not contain a signal sequence.
HOB-03-CE6 osteoblastic cells developed by Wyeth Ayerst (Philadelphia, PA)
were seeded into 24-well plates at 150,000 cells per well in 1 ml of the
growth media
(D-MEM/F12 phenol red-free) containing 10% (v/v) heat-inactivated FBS, 1X
penicillin
streptomycin, and 1X Glutamax-1, and incubated overnight at 34°C. The
following day,
the cells were transfected using Lipofectamine 2000~ (as described by the
124
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
manufacturer, Invitrogen) in OptiMEM (Invitrogen) with 0.35 ,ug /well of LRPS,
HBM, or
control plasmid DNA (empty vector pcDNA3.1 ) and either Wnt1 or Wnt3a plasmid
DNA. Similar experiments were performed with LRP6 plasmid DNA (0.35,ug/well)
or a
control pEDdpc4 empty vector. Furthermore, each of these groups were then
divided
into three groups, those receiving 0.35 ,ug/well Dkk-1, Dkk-2, or pcDNA3.1
control DNA.
All wells were transfected with 0.025 ,ug/well of CMV beta-galactosidase
plasmid DNA
and 0.35 ,ug/well 16X TCF(AS)-luciferase reporter DNA (developed by Ramesh
Bhat,
Wyeth-Ayerst (Philadelphia, PA)). After 4 hours of incubation, the cells were
rinsed and
1 ml of fresh growth media was added to each well. The cells were cultured
overnight
at 34°C, followed by a wash and a change of media. Cells were cultured
for an
additional 18-24 hours at 37°C. Cells were then lysed with 50 ~cl/well
of 1X lysis buffer.
The extracts were assayed for beta-galactosidase activity (Galacto Reaction
Buffer
Diluent & Light Emission Accelerator, Tropix) using 5 ,u1 extract + 50 ~cl
beta-
galactosidase diluent and luciferase activity (Luciferase Assay Reagent,
Promega)
using 20 ~I extract.
U20S human osteosarcoma cells were also utilized. U20S cells (ATCC) were
seeded into 96-well plates at 30,000 cells per well in 200u1 of the growth
media
(McCoy's 5A) containing 10% (v/v) heat-inactivated FBS, 1X penicillin
streptomycin,
and 1X Glutamax-1, and incubated overnight at 37°C. The following day,
the nmedia
was replaced with OptiMEM (Invitroge) and cells were transfected using
Lipofectamine
2000~ (as described by the manufacturer, Invitrogen) with 0.005pg/well of
LRPS, HBM,
LRP6 or contol plasmid DNA (empty vector pcDNA3.1 ) and either Wnt1
(.0025ug/well)
or Wnt3a (.0025ug/well) plasmid DNA. In addition, the 16x-(AS) TCF-TK-firefly-
luciferase (Ramesh Bhat, WHRI, Wyeth) and control TK-renilla luciferase
(Promega
Corp.) were co-transfected at 0.3ug/well and 0.06ug/well respectively in all
experiments. Futhermore, each of these groups was then divided into different
groups,
those receiving 0.05ug/well Dkk-1, Dkk-2, Dkk3, Dkk1-Alkaline Phosphatase
(AP),
mutant Dkk-1 (C220A), Soggy or pcDNA3.1 control DNA. In other experiments,
cells
were co-transfected with 0.005 Ng/well of LRPS, 0.0025ug/well of Wnt1 or Wnt3a
(using
0.0025 Ng/well of a control pcDNA3.1 ) with LRPS-interacting aptamers
(0.05ug/well).
12s
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
Cells were cultured for an additional 18-20 hours at 37°C. Culture
medium was
removed. Cells were cultured for an additional 18-20 hours at 37°C.
Culture medium
was removed. Cells were then lysed with 100 ~I/well of 1X Passive Lysis Buffer
(PLB)
of Dual Luciferase Reagent kit (DLR-kit-Promega Corp.) 20 ~cl of the lysates
were
combined with LARII reagent of DLR-kit and assayed for TCF-firefly luciferase
signal in
Top Count (Packard) instrument. After measuring the Firefly readings, 100 ~I
of the
"Stop and Glo" reagent of DLR kit that contains a quencher and a substrate for
renilla
luciferase was added into each well. Immediately the renilla luciferase
reading was
measured using the Top Count (Packard) Instrument. The ratios of the TCF-
firefly
luciferase to control renilla readings were calculated for each well and the
mean ratio of
triplicate or more wells was expressed in all data.
Results
The results of these experiments demonstrate that Dkk-1, in the presence of
Wnt1 and LRPS, significantly antagonized TCF-luciferase activity (Figure 14).
In
marked contrast, Dkk-1 had no effect on HBM/Wnt1 mediated TCF-luciferase
activity
(Figure 14). In similar experiments, Dkk-1 was also able to antagonize
LRPS/Wnt3a
but not HBM/Wnt3a mediated TCF-luciferase activity (Figure 15). These results
indicate that the HBM mutation renders Dkk-1 inactive as an antagonist of Wnt1
and
Wnt3a signaling in HOB03CE6 osteoblastic cells. In other experiments with
Wnt1, Dkk-
1 had no effect on LRP5 or HBM mediated TCF-luciferase activity (Figure 14).
In
contrast, with either LRP5 or HBM in the presence of Wnt3a, Dkk-2 was able to
antagonize the TCF-luciferase activity (Figure 15). These latter results
indicate that the
HBM mutation has no effect on Dkk-2 action in the presence of Wnt3a.
Experiments
were also performed using the closely related LRP6 cDNA in HOB-03-CE6 cells.
In
these experiments, LRP6/Wnt1 and LRP6/Wnt3a mediated TCF-luciferase were
regulated in the same manner as LRPS. Specifically, Dkk-1 antagonized
LRP6/Wnt1
mediated TCF-luciferase activity, whereas Dkk-2 had no effect (Figure 14).
However,
similar to the action of Dkk-2 with LRP5/Wnt3a, Dkk-2 was able to antagonize
LRP6/Wnt3a mediated TCF-luciferase activity (Figure 15).
126
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
The results in the U20S cells show a robust effect of the OST262 LRP5 peptide
aptamer activation of Wnt signaling in the presence of Wnt3a (Figure 16).
These
functional results are confirmed by the results shown below in Example 11
using LRP5
peptide aptamers in the Xenopus assay. Such results affirmatively demonstrate
that
the effects of small molecules on LRPS/LRP6/HBM signaling can be detected
using the
TCF-luciferase assay.
These data demonstrate that there is a functional difference between LRP5 and
HBM regarding the ability of Dkk-1 to antagonize Wnt1 and Wnt3a signaling.
These
data and previous data showing that Dkk-1 directly interacts with LRP5
suggests that
the inability of Dkk-1 to antagonize HBM/Wnt signaling may in part contribute
to the
HBM phenotype. These experiments further demonstrate the ability to test
various
molecules (e.g., small molecules, aptamers, peptides, antibodies, LRP5
interacting
proteins or Dkk-1 interacting proteins, and the like) for a LRPS ligand that
mimics HBM
mediated Wnt signaling or factors that block Dkk-1 interaction with LRPS.
Example 8
Yeast-2 Hybrid Interaction Trap
Small molecule inhibitors (or partial inhibitors) of the Dkk-LRP interaction
may be
an excellent osteogenic therapeutic. One way to investigate this important
protein-
protein interaction is using Y2H techniques substantially as described above
and as is
well known in the art. Regions of LRPS, such as LRP5 LBD, have been found to
functionally interact with Dkk. This interaction is quantitated using a
reporter element
known in the art, e.g., LacZ or luciferase, which is only activated when bait
and prey
interact. The Y2H assay is used to screen for compounds which modulate the LRP-
Dkk interaction. Such a modulation would be visualized by a reduction in
reporter
element activation signifying a weaker or disrupted interaction, or by an
enhancement
of the reporter element activation signifying a stronger interaction. Thus,
the Y2H assay
can be used as a high-throughput screening technique to identify compounds
which
disrupt or enhance Dkk interaction with LRPS/LRP6/HBM, which may serve as
potential
therapeutics.
12~
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
For example, the Interaction Trap methodology can be used as follows. The
LRP5 LBD, for example, was fused with LexA and Dkk-1 was fused with either
Gal4-AD
or B42. With the LRPSLBD-LexA bait and the Gal4AD-Dkk prey, over a 20-fold
activation of a IacZ reporter (under the control of a single LexA operator)
was detected
over the background. Using a Dkk-1 mutant (C220A) that is unable to bind to
LRP, the
interaction was reduced in yeast, showing the specificity of this interaction
and system
(Figure 18). As a result, small molecules may be identified that modulate this
interaction between LRP and Dkk.
Example 9
Cell-Based Functional Huh-Throughput Assav
To develop a high throughput assay, the TCF-luciferase assay described in
Example 7 was modified utilizing low level expression of endogenous LRPS/6 in
U20S
and HEK293 cells. However, HOB-03-CE6 cells and any other cells which show a
differential response to Dkk depending on whether LRPS, LRP6 or HBM are
expressed. Using U20S (human osteosarcoma) and HEK293 (ATCC) cells, the TCF-
luciferase and tk-Renilla reporter element constructs were co-transfected
along with
Wnt3a/1 and Dkk. Wnt3a alone, by using endogenous LRPS/6, was able to
stimulate
TCF reporter gene activation. When Dkk, is co-transfected with Wnt3a/Wnt 1 and
reporters (TCF-luci and tk-Renilla), Dkk represses reporter element activity.
In addition,
the TCF-luci signal is activated by Wnt3a/Vl/nt1 can be repressed by the
addition of
Dkk-enriched conditioned media to the cells containing Wnt3a/Wnt1 and
reporters. The
assay is further validated by the lack of TCF-reporter inhibition by a point
mutant
construct (C220A) of Dkk1.
The Dkk-mediated repression of the reporter is dependent upon the
concentration of transfected Dkk cDNA or on the amount of Dkk-conditioned
media
added. In addition, the Dkk-mediated reporter suppression can be altered by
the co-
transfection of LRPS, LRP6, and HBM cDNAs in the U20S or HEK293 cells. In
general, U20S cells show greater sensitivity to Dkk-mediated reporter
suppression than
that in HEK-293 cells. In U20S cells, the transfection of LRPS/LRP6/HBM cDNA
leads
128
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
to moderate activation of TCF-luci in the absence of Wnt3a/Wnt1 transfection.
This
activation presumably utilizes the endogenous Wnts present in U20S cells.
Under this
condition, Dkk1 can repress TCF-luci and shows a differential signal between
LRP5
and HBM. By co-transfecting Wnt3a/Wnt1, there is a generalized increase in the
TCF-
luci signal in the assay. Further, one can detect Dkk-mediated differential
repression of
the reporter due to LRP5 and HBM cDNA expression as well as between LRPS and
LRP6 cDNA. The repression is maximal with LRP6, moderate with LRPS, and least
with HBM cDNA expression. In addition, the assay can detect the functional
impact of
the LRP5 interacting peptide aptamers (Figure 4), Dkk1 interacting aptamers
and
binding domains of Dkk-1 (Figure 6; OST264 and OST265 of Figures 12 and 13).
Using this system with a suppressed Wnt-TCF signal due to the presence of
both Dkk and Wnt3a, one can screen for compounds that could alter Dkk
modulation of
Wnt signaling, by looking for compounds that activate or the TCF-luciferase
reporter,
and thereby relieve the Dkk-mediated repression of the Wnt pathway. Such
compounds identified may potentially serve as HBM-mimetics and be useful, for
example, as osteogenic therapeutics. Data generated from this high throughput
screen
are demonstrated in Figures 19-21. Figure 19 shows that Dkk1 represses Wnt3a-
mediated signaling in U20S bone cells. Figure 20 demonstrates the functional
differences between LRPS, LRP6, and HBM. Dkk-1 represses LRP6 and LRPS but has
little or no effect on HBM-generated Wnt1 signaling in U20S cells. Figure 21
demonstrates the differential effects of various Dkk family members and
modified Dkks,
including Dkk-1, a mutated Dkk-1 (C220A), Dkk-1-AP (modified with alkaline
phosphatase), Dkk-3, and Soggy.
Example 10
DKK/LRPS/6/HBM ELISA Assav
A further method to investigate Dkk binding to LRP is via ELISA assay. Two
possible permutations of this assay are exemplified. LRP5 is immobilized to a
solid
surface, such as a tissue culture plate well. One skilled in the art will
recognize that
other supports such as a nylon or nitrocellulose membrane, a silicon chip, a
glass slide,
129
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
beads, etc. can be utilized. In this example, the form of LRP5 used is
actually a fusion
protein where the extracellular domain of LRP5 is fused to the Fc portion of
human IgG.
The LRPS-Fc fusion protein is produced in CHO cell extracts from stable cell
lines. The
LRPS-Fc fusion protein is immobilized on the solid surface via anti-human Fc
antibody
or by Protein-A or Protein G-coated plates, for example. The plate is then
washed to
remove any non-bound protein. Conditioned media containing secreted Dkk
protein or
secreted Dkk-epitope tagged protein (or purified Dkk or purified Dkk-epitope
tagged
protein) is incubated in the wells and binding of Dkk to LRP is investigated
using
antibodies to either Dkk or to an epitope tag. Dkk-V5 epitope tagged protein
would be
detected using an alkaline phosphatase tagged anti-V5 antibody.
Alternatively, the Dkk protein could be directly fused to a detection marker,
such
as alkaline phosphatase. Here the detection of the Dkk-LRP interaction can be
directly
investigated without subsequent antibody-based experiments. The bound Dkk is
detected in an alkaline phosphatase assay. If the Dkk-alkaline phosphatase
fusion
protein is bound to the immobilized LRPS, alkaline phosphatase activity would
be
detected in a colorimetric readout. As a result, one can assay the ability of
small
molecule compounds to alter the binding of Dkk to LRP using this system.
Compounds, when added with Dkk (or epitope-tagged Dkk) to each well of the
plate,
can be scored for their ability to modulate the interaction between Dkk and
LRP based
on the signal intensity of bound Dkk present in the well after a suitable
incubation time
and washing. The assay can be calibrated by doing cold competition experiments
with
unlabeled Dkk or with a second type of epitope-tagged Dkk. Any small molecule
that is
able to modulate the Dkk-LRP interaction may be a suitable therapeutic
candidate,
more preferably an osteogenic therapeutic candidate.
Example 11
Functional Evaluation of Peptide A~tamers in Xenopus
The constrained peptide aptamers constructs OST258-263 (where 258 contains
the signal sequence by itself and 263 contains an irrelevant constrained
peptide)
(Figures 12 and 13) were used to generate RNA substantially as described in
Example
130
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
7, except the vector was linearized by restriction endonuclease digestion and
RNA was
generated using T7 RNA polymerase.
Aptamer RNA was injected at 250 pg per blastomere using the protocol of
Example 7. Wnt signaling was activated, as visualized by embryo dorsalization
(duplicated body axis) with aptamers 261 and, more strongly, 262. The results
of this
assay are shown in Figures 22 and 23. These results suggest that aptamers 261
and
262 are able to activate Wnt signaling possibly by binding to the LBD of LRP,
thereby
preventing the modulation of LRP-mediated signaling by Dkk.
The aptamers of the present invention can serve as HBM-mimetics. In the
Xenopus system they are able to induce Wnt signaling all by themselves. They
may
also serve as tools for rational drug design by enhancing the understanding of
how
peptides are able to interact with LRP and modulate Wnt signaling at the
specific amino
acid level. Thus, one would be able to design small molecules to mimic their
effects as
therapeutics. In addition, the aptamers identified as positives in this assay
may be used
as therapeutic molecules themselves.
Example 12
Homogenous Assav
An excellent method to investigate perturbations in protein-protein
interactions is
via Fluorescence Resonance Energy Transfer (FRET). FRET is a quantum
mechanical
process where a fluorescent molecule, the donor, transfers energy to an
acceptor
chromophore molecule which is in close proximity. This system has been
successfully
used in the literature to characterize the intermolecular interactions between
LRP5 and
Axin (Mao et al., Molec. Cell Biol. 7:801-809). There are many different
fluorescent
tags available for such studies and there are several ways to fluorescently
tag the
proteins of interest. For example, CFP (cyan fluorescent protein) and YFP
(yellow
fluorescent protein) can be used as donor and acceptor, respecively. Fusion
proteins,
with a donor and an acceptor, can be engineered, expressed, and purified.
For instance, purified LRP protein, or portions or domains thereof, fused to
CFP
and purified Dkk protein, or portions or domains thereof that interact with
Dkk or LRP
131
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
respectively, fused to YFP can be generated and purified using standard
approaches.
If LRP-CFP and Dkk-YFP are in close proximity, the transfer of energy from CFP
to
YFP will result in a reduction of CFP emission and an increase in YFP
emission.
Energy is supplied with an excitation wavelength of 450 nm and the energy
transfer is
recorded at emission wavelengths of 480 nm and 570 nm. The ratio of YFP
emission
to CFP emission provides a guage for changes in the interaction between LRP
and
Dkk. This system is amenable for screening small molecule compounds that may
alter
the Dkk-LRP protein-protein interaction. Compounds that disrupt the
interaction would
be identified by a decrease in the ratio of YFP emission to CFP emission. Such
compounds that modulate the LRP-Dkk interaction would then be considered
candidate
HBM mimetic molecules. Further characterization of the compounds can be done
using the TCF-luciferase or Xenopus embryo assays to elucidate the effects of
the
compounds on Wnt signaling.
While the above example describes a cell-fee, solution-phase assay using
purified components, a similar cell-based assay could also be performed. For
example,
LRP-CFP fusion protein can be expressed in cells. The Dkk-YFP fusion protein
then
could be added to the cells either as purified protein or as conditioned
media. The
interaction of LRP and Dkk is then monitored as described above.
All references cited herein are hereby incorporated by reference in their
entirety
for all purposes. The following applications are also incorporated by
reference in their
entirety herein for all purposes: U.S. Application No. 60/290,071, filed May
11, 2001;
U.S. Application No. 09/544,398, filed on April 5, 2000; U.S. Application No.
09/543,771, filed April 5, 2000; 09/578,900; U.S. Application No. 09/229,319,
filed
January 13, 1999; U.S. Provisional Application 60/071,449, filed January 13,
1998; and
International Application PCT/US00/16951, filed June 21, 2000; International
PCT
Application entitled "HBM Variants That Modulate Bone Mass and Lipid Levels,"
filed
May 13, 2002; and International PCT Application entitled "Transgenic Animal
Model of
Bone Mass Modulation," filed May 13, 2002. Additionally, this application
claims priority
to U.S. provisional applications 60/291,311, filed May 17, 2001; 60/353,058,
filed
132
CA 02446582 2003-11-07
WO 02/092015 PCT/US02/15982
February 1, 2002; and 60/361,293, filed March 4, 2002; the texts of which are
herein
incorporated by reference in their entirety for all purposes.
133
