Note: Descriptions are shown in the official language in which they were submitted.
DEMANDES OU BREVETS VOLUMINEUX
LA PRESENTE PARTIE I)E CETTE DEMANDE OU CE BREVETS
COMPRI~:ND PLUS D'UN TOME.
CECI EST ~.E TOME 1 DE 2
NOTE: Pour les tomes additionels, veillez contacter le Bureau Canadien des
Brevets.
JUMBO APPLICATIONS / PATENTS
THIS SECTION OF THE APPLICATION / PATENT CONTAINS MORE
THAN ONE VOLUME.
THIS IS VOLUME 1 OF 2
NOTE: For additional vohxmes please contact the Canadian Patent Oi~ice.
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-1-
CONJUGATES ACTIVATED BY CELL SURFACE PROTEASES AND
THERAPEUTIC USES THEREOF
RELATED APPLICATIONS
Benefit of priority to U.S. provisional application Serial No. 60/293,267,
filed May 23, 2001, to Edwin L. Madison, Joseph Edward Semple and George
P. Vlasuk, entitled "CONJUGATES ACTIVATED BY CELL SURFACE PROTEASES
AND THERAPEUTIC USES THEREOF" is claimed. Where permitted, the subject
matter of the application is incorporated by reference in its entirety.
FIELD OF THE INVENTION
Conjugates, compositions and methods for localized delivery of
therapeutic agents for treating a variety of disorders, such as ,
proliferative
diseases, autoimmune diseases, infectious diseases and inflammatory diseases,
are provided. The conjugates, which act as prodrugs, contain therapeutic
agents and peptidic substrates that are cleaved by cell surface proteases to
release therapeutic agents in the vicinity of the targeted cells.
BACKGROUND
Effective treatment of cancer and other proliferative diseases involves
administration of chemotherapeutic agents, typically systemic administration.
Typically chemotherapeutic agents are cytotoxic agents that act by inhibiting
proliferation or other metabolic processes, so that actively proliferating and
growing cells will be targeted by the agent. Such targeting, however, is not
highly specific, and the side-effects are often devastating.
Thus, a goal in pharmacology is the design of specific agents that act
with high specific activity on targeted cells or tissues. This aim is of
particular
importance, for example, in the design of agents for treatments of diseases,
such as proliferative diseases, including neoplastic disease, and diseases of
viral
,25 origin, in which the ratio of toxic dose to therapeutic dose is generally
close to
' one and the dosage must be restricted. Numerous approaches to achieving this
goal have been developed. Among these are the use of conjugates thafi contain
a targeting agent, such as an antibody and/or growth factor, and a therapeutic
agent, that act on specific cells; the use of antisense technology that is
targeted
to specific genes and/or proteins; the use of genetic therapy to provide, for
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-2-
example, correct copies of defective genes or pharmaceutically active
compounds, and the use of toxins that are relatively non-toxic unless
delivered
intracellularly. Thus far success has been limited. There are only a limited
number and type of potential targeting agents, and the specificity of such
agents
is optimal.
Hence there is a need to develop means for delivery of therapeutic agents
to targeted cells and tissues. Therefore, it is an object herein, among
others, to
provide methods and compounds for targeted delivery of therapeutic agents.
SUMMARY OF THE INVENTION
Provided herein are compounds and methods for targeted delivery of
therapeutic agents. The compounds are conjugates that contain a peptidic
substrate for a cell surface protease, or a soluble, shed or released form
thereof,
and an agent that upon cleavage by the protease is a therapeutic agent or in a
form that can be activated by the targeted cell or tissue or in the localter
thereof. The agents include therapeutic agents, such as a cytotoxic agents,
drugs, therapeutic nucleic acid moleulces, and diagnostic agents, such as
labelled moieties and imaging agents. The cell surface proteases are
profieases
located at a cell surface and, include, but are not limited to, membrane-bound
proteases such as membrane-bound serine proteases (SPs), including, for
example, proteases designated MTSPs and endotheliases. Also contemplated
are proteases that are located at the cell surface by virtue of a specific
binding
interaction with a receptor therefor. Included among such proteases is
urokinase plasminogen activator (u-PA; see, e.g., Hung (1984) Adv. Exp. Med.
Bio1.172:281-293; Cheng et al. (1989) Gene 69:357-363) bound to urokinase
plasminogen activator receptor (u-PAR). The conjugates contain one or more
substrates for one or a plurality of cell surface proteases linked either
directly or
via a linker to a targeted agent, including a therapeutic agent, such as a
cytotoxic agent. The conjugates provided herein contain the following
components: (peptidic substrate)S, (linker)q, and (targeted agent)t in which:
at
least one peptidic substrate moiety is linked with or without a linker (L) to
at
least one therapeutic agent, s is 1 or more and each substrate is the same or
different, and is typically is between 1 and 6, generally 1, 2 or 3; q is 0 or
more
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-3-
as long as cell surface protease(s) cleaves the peptidic substrates) and
releases
active therapeutic agent or, releases the agent in a form that is converted by
the
cell, tissue or surrounding environment to an active form, q is 0 to t,
generally 1
to 4; t is 1 or more, generally 1 or 2 and each targeted agent are the same or
different; linker refers to any linker; and the targeted agent is any agent,
typically a therapeutic agent, such as a cytotoxic agent, a nucleic acid, a
diagnostic agent, such as an imaging agent or labeled moiety, or a drug,
including, but not limited to, anti-tumor, anti-cancer, anti-angiogenic, pro-
apoptotic and anti-mitotic agents or treatments.
The therapeutic agents include any biologically active molecule. These
agents include toxins, cytokines and lymphokines, growth factors, nucleic acid
molecules, such as antisense nucleic acid, dsRNA, and DNA molecules. The
therapeutic agents include those that are active intracellularly, such as
cytotoxins, or extracellularly, such as modulators of the activity of
extracellular
receptors. When in the conjugates the therapeutic agents are substantially
inactive, and when cleaved are released in active form or in a form that can
be
activated by the targeted cell or tissue or environment thereof.
In an exemplary embodiment, the conjugates for use in the methods and
compositions provided herein can be represented by the formula:
(peptide')S (linker)q (therapeutic agent)t
or a derivative thereof, where peptide' is a peptidic substrate for a cell
surface
protease; s is greater than or equal to 1, or is 1 to 6, or is 1 or 2, or is
1; linker
is any linker; q is greater than or equal to 0, or is 0 to 4, or is 0 or 1;
the
therapeutic agent is, for example, a cytotoxic agent, including, but not
limited
to, an anti-tumor, anti-angiogenic, anti-cancer, pro-apoptotic and anti-
mitotic
agents; and t is 1 or more, or is 1 or 2. In these conjugates, the therapeutic
agent is covalently attached, optionally via a linker L, to either the C-
terminus or
the N-terminus of the peptidic substrate.
In certain embodiments, peptide' is a substrate for a cell surface protease
whereby, upon action of the protease, the conjugate, which is substantially
inactive, is cleaved at a point on the peptidic substrate chain to release a
compound of the formula:
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-4-
(peptidea)S (linker)q (therapeutic agent)t
or a derivative thereof, that exhibits therapeutic activity in vitro and/or in
vivo.
In these conjugates, the therapeutic agent is, for example, a cytotoxic agent,
and peptides is a truncated version of peptide' resulting from cleavage at the
P1-
, P1' bond.
The conjugates can be used to target and deliver the targeted agents to
specific cells, and hence can be used for the treatment any diseases that are
associated with cells or tissues that express a cell surface protease,
including
cell-associated and cell-localized proteases. The cells on which or near which
such proteases are expressed are not necessarily involved in the disease or
disease process, but are present and can serve to present the protease, which
cleaves the targeted conjugate.
Methods of treatment of diseases associated with cells or tissues that
express a cell surface protease, including cell-associated and cell-localized
proteases. The diseases include, but not limited to, proliferative diseases,
autoimmune diseases, infectious diseases and inflammatory diseases. For
example, diseases include e, but are not limited to, rheumatoid arthritis,
lupus,
multiple sclerosis, psoriasis, diabetic retinopathies, other ocular disorders,
including recurrence of pterygii, scarring excimer laser surgery and glaucoma
filtering surgery, various disorders of the anterior eye, cardiovascular
disorders,
restenosis, chronic inflammatory diseases, wounds, circulatory disorders,
crest
syndromes, bacterial infections, viral diseases, includuing AIDS,
dermatological
disorders, and cancer, including solid neoplasms and vascular tumors,
including,
but are not limited to, lung, colon, esophageal, breast, ovarian and prostate
cancers.
Also provided are methods for identifying proteases to target conjugates
for treatment of diseases. The methods involve identifying cell-surface
protease-associated disease by identifying a cell involved in the disease
process
or a cell in the vicinity of the cell involved in the disease process; and
identifying a cell surface protease on the cell. Conjugates that target such
proteases as provided herein can then be prepared.
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-5-
DESCRIPTION OF THE FIGURES
Figures 1-5 provide in vitro CTSO (time for 50% cleavage) (min) for
exemplary conjugates provided herein: A = 0.1-25 min; B = 25-100 min; C =
100-250 min; D = > 250 min.
Figure 1 shows exemplary doxorubicin conjugates provided herein and in
vitro CT5° (min) data for cleavage of the conjugates by MTSP1.
Figure 2 shows exemplary doxorubicin conjugates provided herein and in
vitro CT5° (min) data for cleavage of the conjugates by u-PA.
Figure 3 shows exemplary taxol conjugates provided herein and in vitro
CTSo (min) data for cleavage of the conjugates by MTSP1.
Figure 4 shows exemplary taxol conjugates provided herein and in vitro
CTSO (min) data for cleavage of the conjugates by u-PA.
Figure 5 shows exemplary doxorubicin and taxol conjugates provided
herein and in vitro CTSO (min) data for cleavage of the conjugates by ET1
(endotheiiase 1 ).
DETAILED DESCRIPTION OF EMBODIMENTS
A. Definitions
Unless defined otherwise, all technical and scientific terms used herein
have the same meaning as is commonly understood by one of skill in the art to
which the inventions) belong. All patents, patent applications, published
applications and publications, Genbank sequences, websites and other published
materials referred to throughout the entire disclosure herein, unless noted
otherwise, are incorporated by reference in their entirety. In the event that
there
are a plurality of definitions for terms herein, those in this section
prevail.
Where reference is made to a URL or other such indentifier or address, it
understood that such identifiers can change and particular information on the
Internet can come and go, but equivalent information can be found by searching
the Internet. Reference thereto evidences the availability and public
dissemination of such information.
As used herein, a targeted agent is any agent intended for targeted
delivery and includes therapeutic agents and diagnostic agents and any other
agent intended for targeted delivery.
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-6-
As used herein, targeted delivery means delivery to a selected cell or
tissue that expresses a protease that releases the targeted agent. Such
delivery
does not have to be exclusively to such selected cell or tissue, but must
include
it, and generally deliveries higher amounts to such selected cells or tissues.
Delivery includes introduction into a cell or tissue or binding to the cell or
tissue
or release in the vicinity of the cell or tissue. For example, in some
instances, a
tumor induces production of proteases, receptors, co-factors or substrates
asssociated with the stroma; delivery, thus, includes targeting such induced
stromal activities, such as proteases, receptors and/or enzyme co-factors, in
invading cells or cells in the tumor that is targeted.
As used herein, therapeutic index is the ratio of LDSO/EDSO.
As used herein, a therapeutic agent is any drug or other agent that is
intended for delivery to a targeted cell or tissue, such as proliferating
cells,
including tumor cells and cells involved in a proliferative, typically an
undesirable, response. Therapeutic agents, include, but are not limited to,
anti-
cancer agents, anti-angiogenic agents, pro-apoptotic agents, anti-mitotic
growth
factors, cytokines, such as tumor necrosis factors and interleukins, and
cytotoxic agents and other such agents as described herein and known to those
of skill in the art. Therapeutic agents include those that are active upon
internalization and also those that act extracellularly, such modulators of
the
activities of certain cell surface receptors, such as G proteins that
transduce
extracellular signals.
As used herein, an inactive therapeutic agent is a therapeutic agent that
is conjugated to a peptide and thereby, either by virtue of conformational
changes or size or other factors such as steric hinderance does not exhibit
any
or exhibits substantially reduced activity compared to the released active
therapeutic agent. For example, conjugated doxorubicin is not toxic to cells
until
it is released from the conjugate in a form that can enter the cell. Upon
cleavage of the agent from the conjugate it is in active form or in a form
that is
further processed by one or a plurality of steps, including enzymatically or
chemically, in or on the cell, into an active form.
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
_7_
As used herein, an active therapeutic agent is a therapeutic agent that
has been released from the conjugate by cleavage of the peptidic substrate
portion of the conjugate. The active therapeutic agent is by virtue of
cleavage
able to exhibit its intended activity, typically by entering the cell. When
conjugated the therapeutic agents have reduced or no activity as therapeutic
agents, and upon cleavage are released in the vicinity of a cell.
As used herein, an anti-cancer agent (used interchangeably with "anti-
tumor or anti-neoplasm agent") refers to any agents used in the treatment of
cancer. These include any agents, when used alone or in combination with
other compounds, that can alleviate, reduce, ameliorate, prevent, or place or
maintain in a state of remission of clinical symptoms or diagnostic markers
associated with neoplasm, tumor or cancer, and can be used in methods,
combinations and compositions provided herein. Non-limiting examples of anti-
neoplasm agents include anti-angiogenic agents, alkylating agents,
'15 antimetabolite, certain natural products, platinum coordination complexes,
anthracenediones, substituted ureas, methylhydrazine derivatives,
adrenocortical
suppressants, certain hormones, antagonists and anti-cancer polysaccharides.
As used herein, substantially inactive with reference to the conjugated
thereapeutic agent means at least 1 %, generally 10, 20, 30, 50, 60, 70, 80 or
90 or 100% inactive compared to the unconjugated therapeutic agent in a
standard or art-recognized assays, such as in vitro or in vivo assays, that
assess
the therapeutic activity of fihe agent.
As used herein, a targeted cell or tissue refers to the cells or tissues that
include cell surface proteases that cleave the conjugates. The cells or
tissues
can be involved in the disease or can be present at the disease loci or locus
by
virtue of participation in the disease process or merely serendipitously.
As used herein, angiogenesis is intended to broadly encompass the
totality of processes directly or indirectly involved in the establishment and
maintenance of new vasculature (neovascularization), including, but not
limited
to, neovascularization associated with tumors.
As used herein, anti-angiogenic treatment or agent refers to any
therapeutic regimen and compound, that, when used alone or in combination
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
_g_
with other treatment or compounds, can alleviate, reduce, ameliorate, prevent,
or place or maintain in a state of remission, one or more clinical symptoms or
diagnostic markers associated with undesired and/or uncontrolled angiogenesis.
Thus, for purposes herein an anti-angiogenic agent refers to an agent that
inhibits the establishment or maintenance of vasculature. Such agents include,
but are not limited to, anti-tumor agents, and agents for treatments of other
disorders associated with undesirable angiogenesis, such as diabetic
retinopathies, hyperproliferative disorders and others.
As used herein, non-anti-angiogenic anti-tumor agents refer to anti-tumor
agents that do not act primarily by inhibiting angiogenesis. Whether anti-
tumor
agents act primarily by inhibiting angiogenesis can be determined using the
assays provided herein, or using other assays well known to those of skill in
the
art.
As used herein, undesired and/or uncontrolled angiogenesis refers to
pathological angiogenesis wherein the influence of angiogenesis stimulators
outweighs the influence of angiogenesis inhibitors. As used herein, deficient
angiogenesis refers to pathological angiogenesis associated with disorders
where
there is a defect in normal angiogenesis resulting in aberrant angiogenesis or
an
absence or substantial reduction in angiogenesis.
As used herein, a cell surface protease is any protease that is located on
or at a cell surface and/or proteases that are located at the cell surface by
virtue
of a specific binding interaction with a receptor therefor, or that is
localized at or
near or associated with the cell surface. An exemplary protease located at the
cell surface by virtue of a specific binding interaction with a receptor
therefor is
urokinase plasminogen activator (u-PA) bound to urokinase plasminogen
activator receptor (u-PAR). Hence cell surface proteases contemplated herein
include cell surface-associated proteases. It also includes all forms thereof
that
can be circulating or inside a cell. To be categorized as a cell surface
protease,
there must be at least one form thereof that is located (i.e. on the surfaces
such
as transmembrane protease or bound to receptor fiherefor) on the surface of a
cell at some point in its cycle. Cell surface protease include serine
proteases,
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
_g_
such as, but are not limited to, the transmembrane serine protease (MTSPs) and
endotheliases and urokinases.
As used herein, a serine protease (SP) refers to a diverse family of
proteases in which a serine residue is involved in the hydrolysis of proteins
or
peptides. The serine residue can be part of the catalytic triad mechanism,
which
includes a serine, a histidine and an aspartic acid in the catalysis, or be
part of
the hydroxyl/E-amine or hydroxyl/a-amine catalytic dyad mechanism, which
involves a serine and a lysine in the catalysis. Of particular interest are
SPs of
mammalian, including human, origin. Those of skill in this art recognize that,
in
general, single amino acid substitutions in non-essential regions of a
polypeptide
do not substantially alter biological activity (see, e.g., Watson et al.
(1987)
Molecular Biology of the Gene, 4th Edition, The Bejacmin/Cummings Pub. co.,
p.224).
As used herein shed, soluble and released forms of cell surface proteases
are contemplated. Such forms include, for example, forms found in serum upon
proteolytic degradation or other removal of the extracellular portion of
membrane
bound protease, and splice variants that do not include a transmembrane
domain.
As shown herein, the protease activity of cell surface proteases and
proteases associated with cells can be exploited to provide a means to
concentrate therapeutic agents, such as cytotoxic agents, near such cells by
providing conjugates that are activated upon cleavage by such enzymes. Such
conjugates, upon the action of a cell surface protease or cell-associate
protease,
release the therapeutic agent, such as a cytotoxic agent, or a derivative
thereof
that can be converted to a therapeutic agent, locally at the site of action.
As
noted above, the substrates are designed to be substrates of targeted
proteases
that are expressed or are active on the surfaces of cells, such as tumor cells
or
endothelial cells, involved in or present at the sites) or locus or loci of
the
disease. By virtue of specific expression, localization or activation of such
proteases or the presence of receptors, substrates or enzyme co-factors
therefor, administration of the conjugates provided herein permits targeting
of
therapeutic agents to such cells. Upon contacting with the proteases, active
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-10-
therapeutic agents are released in the immediate vicinity of the targeted
cells.
For example, specific profiles of some of the MTSPs are as follows.
As used herein, "transmembrane serine protease (MTSP)" refers to a
family of transmembrane serine proteases that share common structural features
as described herein (see, also Hooper et al. (2001 ) J. Biol. Chem.276:857-
860).
Thus, reference, for example, to "MTSP" encompasses all proteins encoded by
the MTSP genes, including but are not limited to: MTSP1, MTSP3, MTSP4,
MTSP6, MTSP7, MTSP9, MTSP10, MTSP12, MTSP20, MTSP22 and MTSP25
or an equivalent molecule obtained from any other source or that has been
prepared synthetically or that exhibits the same activity. Other MTSPs
include,
but are not limited to, corin, enteropeptidase, human airway trypsin-like
protease
(HAT), TMPRSS2 and TMPRSS4. The MTSPs described herein can be used to
identify other MTSPs. Methods for isolating nucleic acid encoding other MTSPs,
including nucleic acid molecules encoding full-length molecules and splice
variants and MTSPs from species, such as cows, sheep, goats, pigs, horses,
primates, including chimpanzees and gorillas, rodents, dogs, cats and other
species of interest, such as domesticated animals, farm and zoo animals are
known to those of skill in the art and are outlined herein. The nucleic acid
molecules described herein including those set forth in SEQ IDs can be used to
obtain nucleic acid molecules encoding full-length MTSP polypeptides from
human sources or from other species, such as by screening appropriate
libraries
using the nucleic acid molecules or selected primers or probes based thereon.
Sequences of encoding nucleic acid molecules and the encoded amino
acid sequences of exemplary MTSPs and/or domains thereof are set~forth in SEQ
ID Nos. 1-4-5, 269-270 and 272-276. The term also encompasses MTSPs with
amino acid substitutions that do not substantially alter activity of each
member
and also encompasses polyeptides encoded by splice variants thereof. Hence,
encompassed are MTSPs with amino acid substitutions such that the resulting
polypeptide retains at least 1 %, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%,
80%, 90% of the proteolytic activity of the unaltered polypeptide, and also
encompasses MTSPs encoded by splice variants thereof and MTSPs encoded by
allelic variants, such as single nucleotide polymorphisms (SNPs). Suitable
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-11-
substitutions, including, although not necessarily, conservative substitutions
of
amino acids, are known to those of skill in this art and can be made without
eliminating the biological activity, such as the catalytic activity, of the
resulting
molecule. MTSPs include those of animal, such as mammalian, including
human, origin.
As used herein, a "protease domain of an MTSP" refers to an
extracellular protease domain of an MTSP that exhibits proteofytic activity
and
shares homology and structural features with the chymotrypsin/trypsin family
protease domains. Hence it is at least the minimal portion of the domain that
exhibits proteolytic activity as assessed by standard in vitro assays.
Contemplated herein are such protease domains and catalytically active
portions
thereof.
Exemplary MTSP polypeptides, with the protease domains indicated, are
set forth in SEQ ID Nos. 1-45, 269-270 and 272-276, and including smaller
portions thereof that retain or exhibit protease activity. The protease
domains
vary in size and constitution, including insertions and deletions in surface
loops.
They retain conserved structure, including at least one of the active site
triad,
primary specificity pocket, oxyanion hole and/or other features of serine
protease domains of proteases. Thus, for purposes herein, the protease domain
is a portion of a MTSP, as defined herein, and is homologous to a domain of
other MTSPs. MTSPs include, MTSP1, MTSP3, MTSP4, MTSP6, MTSP7,
MTSP9, MTSP10, MTSP12, MTSP20, MTSP22 and MTSP25 (see SEQ ID Nos.
1-19, 42-45, 269-270 and 272-276; see, also International PCT application No.
WO 02/00860 (see SEQ ID Nos. 38 and 97 therein, which provide an MTSP12
variant); corin (SEQ ID Nos. 28 and 29), enteropeptidase (SEQ ID Nos. 30 and
31 ) human airway trypsin-like protease (HAT) (SEQ ID Nos. 32 and 33), hepsin
(SEQ ID Nos. 34 and 35), TMPRSS2 (SEQ ID Nos. 36 and 37) and TMPRSS4
(SEQ ID Nos. 38 and 39). As with the larger class of enzymes of the
chymotrypsin (S1 ) fold (see, e.g., Internet accessible MEROPS data base), the
MTSPs protease domains share a high degree of amino acid sequence identity.
The His, Asp and Ser residues necessary for activity are present in conserved
motifs. In those that are activated by cleavage, the activation site, which
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-12-
results in the N-terminus of second chain in the two chain forms has a
conserved motif and readily can be identified (see, e.g., amino acids 801-806,
SEQ ID No. 29, amino acids 406-410, SEQ ID No. 31; amino acids 186-190,
SEQ ID No. 33; amino acids 161-166, SEQ ID No. 35; amino acids 255-259,
SEQ ID No. 37; amino acids 190-194, SEQ ID No. 39 and other as known to
those of skill and the art and/or as described herein).
For example, with reference to MTSP10 (see SEQ ID Nos. 44 and 45),
there dISUlflde bonds aS fOIIOWS: C4$$ C5p4, C587 C653~ 0619 C632~ 0643 0673
(see
SEQ 1D Nos. 44 and 45) (chymotrypsin numbering 42 to 58; 136-201; 168-182
and 191-220). Disulfide bonds form between the Cys residues 0573 Cz96 to link
the protease domain to another domain so that upon activation cleavage
(between residues R4sz and 1463 of SEQ ID No. 45) the resulting polypeptide is
a
two chain molecule. The C573 (SEQ ID NO. 45 is a free Cys in a single chain
form of the protease domain. As noted the protease also can be provided as a
two chain molecule. Single chain and two chain forms are proteolytically
active.
A two chain form is produced by bonding, typically between the C573 and a Cys
outside the protease domain, such as Cys2ss. Upon activation cleavage the
disulfide bond remains resulting in a two chain polypeptide. The size of chain
"A" is a function the starting length of the polypeptide prior to activation
cleavage between the R4s2 and 1463. Any length polypeptide that includes the
protease domain (residues 463-692 of SEQ ID No. 45) or catalytically active
fragments thereof, is contemplated herein. Two chain forms include at least
the
protease domain a polypeptide from C29s up to and including C573.
As used herein, a two-chain form of the protease domain refers to a two-
chain form that is formed from a single chain form of the protease in which
the
Cys pairing between, e.g., a Cys outside the protease domain such as, for
example Cys573 (SEQ ID No. 45 for MTSP), which links the protease domain to
the remainder of the polypeptide, the "A" chain. A two chain protease domain
form refers to any form in which the "remainder of the polypeptide", i.e., "A"
chain, is shortened and includes a Cys from outside the protease domain.
As used herein, the catalytically active domain of an MTSP refers to the
protease domain. Reference to the protease domain of an MTSP generally refers
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-13-
to a single chain form of the protein. If the two-chain form or both forms is
intended, it is so-specified. The zymogen form of each protein is a single
chain,
which is converted to the active two or multi chain form by activation
cleavage.
By active form is meant a form active in vivo or in vitro.
As used herein, activation cleavage refers to the cleavage of the protease
at the N-terminus of the protease domain (generally between an R and I or V in
the full-length protein. By virtue of the Cys-Cys pairing between a Cys
outside
the protease domain and a Cys in the protease domain (see, e.g., Cys5.,3 SEQ
ID
No. 45, upon cleavage the resulting polypeptide has two chains ("A" chain and
the "B" chain, which is the protease domain of an MTSP?. Cleavage can be
effected by another protease or autocatalytically. The conjugates provided
herein advantageously contain sites that are recognized by the active cell
surface protease (or cell-associated protease) and are cleaved thereby to
release
active or an inactive prodrug form of a therapeutic agent.
As used herein an MTSP1, whenever referenced herein, includes at least
one or all of or any combination of:
a polypeptide encoded by the sequence of nucleotides set forth in
SEQ ID No. 1 or 40;
a polypeptide encoded by a sequence of nucleotides that
hybridizes under conditions of low, moderate or high stringency to the
sequence
of nucleotides set forth in SEQ ID No. 1 or 40;
a polypeptide that comprises the sequence of amino acids set
forth in SEQ ID No. 2 or 41;
a polypeptide that comprises a sequence of amino acids having at
least about 40%, 60%, 70%, 75%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%,
87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98% or
99% sequence identity with the sequence of amino acids set forth in SEQ ID
No. 2 or 41; and/or
a polypeptide encoded by a splice variant of the MTSP1 set forth
in SEQ ID No. 1 or 40.
The MTSP1 can be from any animal, particularly a mammal, and includes
but is not limited to, humans, rodents, fowl, ruminants and other animals. The
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-14-
full length zymogen or two chain activated form is contemplated or any domain
thereof, including the protease domain, which can be a two chain activated
form, or a single chain form. MTSP1 also is referred to TADG-15 and
matriptase. As described below, the protein originally designated matriptase
appears to be an MTSP1 splice variant or processed product.
As used herein an MTSP3, whenever referenced herein, includes at least
one or all of or any combination of:
a polypeptide encoded by the sequence of nucleotides set forth in
SEQ ID No. 3;
a polypeptide encoded by a sequence of nucleotides that
hybridizes under conditions of low, moderate or high stringency to the
sequence
of nucleotides set forth in SEQ ID No. 3;
a polypeptide that comprises the sequence of amino acids set
forth as amino acids 205-437 of SEQ ID No. 4;
a polypeptide that comprises a sequence of amino acids having at-
feast about 40%, 60%, 70%, 75%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%,
87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98% or
99% sequence identity with the sequence of amino acids set forth in SEQ ID
No. 4; and/or
a polypeptide encoded by a splice variant of the MTSP3 set forth
in SEQ ID Nos. 3 and 4.
The MTSP3 can be from any animal, particularly a mammal, and includes
but are not limited to, humans, rodents, fowl, ruminants and other animals.
The
full length zymogen or two chain activated form is contemplated or any domain
thereof, including the protease domain, which can be a two chain activated
form, or a single chain form.
As used herein an MTSP4, whenever referenced herein, includes at least
one or all of or any combination of:
a poiypeptide encoded by the sequence of nucleotides set forth in
any of SEQ ID No. 5, 7 or 9;
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-15-
a polypeptide encoded by a sequence of nucleotides that
hybridizes under conditions of low, moderate or high stringency to the
sequence
of nucleotides set forth in any of SEQ ID Nos. 5, 7 or 9;
a polypeptide that comprises the sequence of amino acids set
forth in any of SEQ ID Nos. 6, 8 or 10;
a polypeptide that comprises a sequence of amino acids having at
least about 40%, 60%, 70%, 75%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%,
87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98% Or
99% sequence identity with the sequence of amino acids set forth in SEQ ID
No. 6, 8 or 10; and/or
a polypeptide encoded by a splice variant of the MTSP4s set forth
in SEQ ID Nos. 7-10.
The MTSP4 can be from any animal, particularly a mammal, and includes
but are not limited to, humans, rodents, fowl, ruminants and other animals.
The
full length zymogen or two chain activated form is contemplated or any domain
thereof, including the protease domain, which can be a two chain activated
form, or a single chain form.
As used herein an MTSPC, whenever referenced herein, includes at least
one or all of or any combination of:
a polypeptide encoded by the sequence of nucleotides set forth in
any of SEQ ID No. 11;
a polypeptide encoded by a sequence of nucleotides that
hybridizes under conditions of low, moderate or high stringency to the
sequence
of nucleotides set forth in any of SEQ ID Nos. 1 1;
a polypeptide that comprises the sequence of amino acids set
forth in any of SEQ ID No. 12;
a polypeptide that comprises a sequence of amino acids having at
least about 40%, 60%, 70%, 75%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%,
87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98% or
99% sequence identity with the sequence of amino acids set forth in SEQ ID
No. 12; and/or
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-16-
a polypeptide encoded by a splice variant of the MTSP6 set forth
in SEQ ID No. 12.
The MTSP6 can be from any animal, particularly a mammal, and includes but are
not limited to, humans, rodents, fowl, ruminants and other animals. The full
length zymogen or two chain activated form is contemplated or any domain
thereof, including the protease domain, which can be a two chain activated
form, or a single chain form. Of particular interest herein is the MTSP6 of
SEQ
ID No. 12.
As used herein an MTSP7, whenever referenced herein, includes at least
one or all of or any combination of:
a polypeptide encoded by the sequence of nucleotides set forth in
SEQ ID No. 13;
a polypeptide encoded by a sequence of nucleotides that
hybridizes under conditions of low, moderate or high stringency to the
sequence
of nucleotides set forth in SEQ ID No. 13;
a polypeptide that comprises the sequence of amino acids set
forth in SEQ ID No. 13;
a polypeptide that comprises a sequence of amino acids having at
least about 40%, 60%, 70%, 75%, 80%, 81 %, 82%, 83%, 84%, 85%, $6%,
87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98% or
99% sequence identity with the sequence of amino acids set forth in SEQ ID
No. 14; and/or
a polypeptide encoded by a splice variant of the MTSP7 set forth
in SEO ID No. 13.
The MTSP7 can be from any animal, particularly a mammal, and includes
but are not limited to, humans, rodents, fowl, ruminants and other animals.
The
full length zymogen or two chain activated form is contemplated or any domain
thereof, including the protease domain, which can be a two chain activated
form, or a single chain form.
As used herein an MTSP9, whenever referenced herein, includes at least
one or all of or any combination of:
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-17-
a polypeptide encoded by the sequence of nucleotides set forth in
SEQ iD No. 17 or SEQ ID No. 42;
a polypeptide encoded by a sequence of nucleotides that
hybridizes under conditions of low, moderate or high stringency to the
sequence
of nucleotides set forth in SEQ JD No. 17 or 42;
a polypeptide that comprises the sequence of amino acids set
forth in SEQ ID No. 18 or 43;
a polypeptide that comprises a sequence of amino acids having at
least about 40%, 60%, 70%, 75%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%,
87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98% or
99% sequence identity with the sequence of amino acids set forth in SEQ ID
No. 18 or 270; and/or
a polypeptide encoded by a splice variant of the MTSP9 set forth
in SEQ ID No. 17.
The MTSP9 can be from any animal, particularly a mammal, and includes
but are not limited to, humans, rodents, fowl, ruminants and other animals.
The
full length zymogen or two chain activated form is contemplated or any domain
thereof, including the protease domain, which can be a two chain activated
form, or a single chain form.
As used herein an MTSP10, whenever referenced herein, includes at least
one or all of or any combination of:
a polypeptide encoded by the sequence of nucleotides set forth in
SEQ ID No. 44;
a polypeptide encoded by a sequence of nucleotides that
hybridizes under conditions of low, moderate or high stringency to the
sequence
of nucleotides set forth in SEQ ID No. 44;
a polypeptide that comprises the sequence of amino acids set
forth in SEQ ID No. 45;
a polypeptide that comprises a sequence of amino acids having at
least about 40%, 60%, 70%, 75%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%,
87%, 88%, 89%, 90%, 91 %, 92%, 93%. 94%, 95%, 96%, 97%, 98% or
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-18-
99% sequence identity with the sequence of amino acids set forth in SEQ ID
No. 45; and/or
a polypeptide encoded by a splice variant of the MTSP10 set forth
in SEQ ID No. 44.
The MTSP10 can be from any animal, particularly a mammal, and
includes but are not limited to, humans, rodents, fowl, ruminants and other
animals. The full length zymogen or two chain activated form is contemplated
or any domain thereof, including the protease domain, which can be a two chain
activated form, or a single chain form.
MTSP10 polypeptides, including, but not limited to splice variants
thereof, and nucleic acids encoding MTSPs, and domains, derivatives and
analogs thereof are provided herein. Single chain protease domains that have
an
N-terminus functionally equivalent to that generated by activation of the
zymogen form of MTSP10 are also provided. The cleavage site for the protease
domain of MTSP10 is between amino acid R and amino acids I (R ~ IIGGT~
(residues 462-467 SEQ ID No. 45).
As used herein an MTSP12, whenever referenced herein, includes at least
one or all of or any combination of: SEQ ID No. 19 and 20
a polypeptide encoded by the sequence of nucleotides set forth in
SEQ ID No. 19 or by a sequence of nucleotides that includes nucleotides that
encode the sequence of amino acids set forth in SEQ ID No. 20;
a polypeptide encoded by a sequence of nucleotides that
hybridizes under conditions of low, moderate or high stringency to the
sequence
of nucleotides set forth in is set forth as SEQ ID No. 19;
a polypeptide that includes the sequence of amino acids set forth
in SEQ ID No. 20 or a catalytically active portion thereof;
a polypeptide that includes a sequence of amino acids having at
least about 40%, 60%, 70%, 75%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%,
87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98% or
99% sequence identity with the sequence of amino acids set forth in SEQ ID
No. 20; and/or
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-19-
a polypeptide encoded by a splice variant of the MTSP12 that
includes the sequence of amino acids set forth in SEQ ID No. 20.
In particular, the MTSP12 polypeptide, with the protease domains as
indicated in SEQ ID Nos. 19 and 20, is provided. The polypeptide is a single
or
multi-chain polypeptide. A protease domain of an MTSP12, whenever
referenced herein, includes at least one or all of or any combination of or a
catalytically active portion of:
a polypeptide that includes the sequence of amino acids set forth
in SEQ ID No. 20 or a catalytically active portion thereof but that does not
include the sequence of amino acids set forth in SEQ ID No. 271;
a polypeptide that includes the sequence of amino acids set forth
in SEQ ID No. 272 or a catalytically active fragment thereof;
a polyeptide containing amino acids 237 to 456 of SEQ ID No. 6,
a polypeptide containing amino aicds 538 to 765 of SEQ ID No. 20, and a
polypeptide containing amino acids 861 to 1087 of SEQ ID No. 20, but that
does not include the sequence of amino acids set forth in SEQ ID No. 271;
a polypeptide encoded by a sequence of nucleotides that
hybridizes under conditions of low, moderate or high stringency to a sequence
of nucleotides that encodes any of the polypeptides of a)-c);
a polypeptide encoded by a sequence of nucleotides that
hybridizes under conditions of low, moderate or high stringency to the
sequence
of nucleotides set forth in SEQ ID No. 20 but that does not encode the
sequence
of amino acids set forth in SEQ ID No. 271;
a polypeptide that includes a sequence of amino acids having at
least about 60%, 70%, 75%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%,
88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%
sequence identity with the sequence of amino acids set forth in SEQ ID No. 20;
a polypeptide that includes a sequence of amino acids having at
(east about 60%, 70%, 75%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%,
88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%
sequence identity with the sequence of amino acids of the polypeptides of a)-
e);
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-20-
a polypeptide encoded by a splice variant of a sequence of
nucleotides that encodes an MTSP12 of any of the above.
Smaller portions thereof that retain protease activity are also provided.
The MTSP12 can be from any animal, particularly a mammal, and includes but
are not limited to, humans, rodents, fowl, ruminants and other animals. The
full-length zymogen or two-chain activated form is contemplated or any domain
thereof, including the protease domain, which can be a two-chain activated
form, or a single chain form. MTSP12 also includes the variant described
International PCT application No. WO 02/00860 (see SEQ ID Nos. 38 and 97
therein.
As used herein an MTSP20, whenever referenced herein, includes at
least one or all of or any combination of:
a polypeptide encoded by the sequence of nucleotides set forth in
SEQ ID No. 273;
a polypeptide encoded by a sequence of nucleotides that
hybridizes under conditions of low, moderate or high stringency to the
sequence
of nucleotides set forth in SEQ ID No. 273;
a polypeptide that comprises the sequence of amino acids set
forth in SEQ ID No. 273;
a polypetide that comprises a sequence of amino acids having at
least about 40%, 60%, 70%, 75%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%,
87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98% or
99% sequence identity with the sequence of amino acids set forth in SEQ ID
No. 274; and/or
a polypeptide encoded by a splice variant of the MTSP20 encoded
by the sequence of nucleotides that includes the sequence set forth in SEQ ID
No. 273.
The MTSP20 may be from any animal, particularly a mammal, and
includes but are not limited to, humans, rodents, fowl, ruminants and other
animals. The full length zymogen or two-chain activated form is contemplated
or any domain thereof, including the protease domain, which can be a two-chain
activated form, or a single chain form.
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-21-
As used herein an MTSP22, whenever referenced herein, includes at
least one or all of or any combination of:
a polypeptide encoded by the sequence of nucleotides set forth in
SEQ ID No. 275;
a polypeptide encoded by a sequence of nucleotides that
hybridizes under conditions of low, moderate or high stringency to the
sequence
of nucleotides set forth in SEQ ID No. 275;
a polypeptide that comprises the sequence of amino acids set
forth in SEQ ID No. 276;
a polypetide that comprises a sequence of amino acids having at
least about 40%, 60%, 70%, 75%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%,
87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98% or
99% sequence identity with the sequence of amino acids set forth in SEQ ID
No. 276; and/or
a polypeptide encoded by a splice variant of the MTSP22 set forth
in SEQ ID No. 275.
The MTSP22 may be from any animal, particularly a mammal, and
includes but are not limited to, humans, rodents, fowl, ruminants and other
animals. The full length zymogen or two-chain activated form is contemplated
or any domain thereof, including the protease domain, which can be a two-chain
activated form, or a single chain form.
As used herein an MTSP25, whenever referenced herein, includes at
least one or all of or any combination of:
a polypeptide encoded by the sequence of nucleotides set forth in
SEQ ID No. 269;
a polypeptide encoded by a sequence of nucleotides that
hybridizes under conditions of low, moderate or high stringency to the
sequence
of nucleotides set forth in SEQ ID No. 269;
a polypeptide that comprises the sequence of amino acids set
forth in SEQ ID No. 270;
a polypetide that comprises a sequence of amino acids having at
least about 40%, 60%, 70%, 75%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%,
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-22-
87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98% Or
99% sequence identity with the sequence of amino acids set forth in SEQ ID
No. 270; and/or
a polypeptide encoded by a splice variant of the MTSP25 set forth
in SEQ ID No. 269.
The MTSP25 may be from any animal, particularly a mammal, and
includes but are not limited to, humans, rodents, fowl, ruminants and other
animals. The full length zymogen or two-chain activated form is contemplated
or any domain thereof, including the protease domain, which can be a two-chain
activated form, or a single chain form.
As used herein, a human protein is one encoded by nucleic acid present
in the genome of a human, including all allelic variants and conservative
variations as long as they are not variants found in other mammals.
As used herein, not substantially cleaved by plasmin or prostate specific
antigen (PSA) (or other non-cell surface-associated protease), means in
comparable in vitro assays (under optimal conditions for each enzyme) in which
the activity of a targeted cell surface membrane protease or catalytically
active
portion of the activity of the protease domain (or a catalytically active form
thereof) of prostate specific antigen (PSA) or plasmin for cleavage of the
conjugate is compared, the relative activity is greater than at least 2:1,
3:1, 4:1,
5:1, 10:1, 50:1 or 100:1.
As used herein, activity refers to the ratio k~at/~m. where k~at is the rate
of
catalytic turnover for a particular enzyme, and ICm is the Michaelis constant
for
the binding of the substrate.
As used herein, a "nucleic acid encoding a protease domain or
catalytically active portion of a MTSP" shall be construed as referring to a
nucleic acid encoding only the recited single chain protease domain or active
portion thereof, and not the other contiguous portions of the MTSP as a
continuous sequence.
As used herein, a CUB domain is a motif that mediates protein-protein
interactions in complement components
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-23-
C1r/C1s and has also been identified in various proteins involved in
developmental processes.
As used herein, a zymogen is an enzymatically inactive protein (i.e,
typically, but not necessarily, less than 1 % of active form) that is
converted to a
proteolytic enzyme by the action of an activator, including by autoactivation.
Inactive means less active than the form those of skill in the art consider to
be
the active form of the enzyme. The ratio of activity of a zymogen to the
activated form varies from enzyme-to-enzyme.
As used herein, "disease or disorder" refers to a pathological condition in
an organism resulting from, e.g., infection or genetic defect, and
characterized
by identifiable symptoms. The diseases contemplated for treatment herein are
any for which a cell surface protease, including a cell-localized or cell-
associated
protease is asssociated with a targeted cell or tissue involved in the disease
or
disease process. Such association can be because the protease is involved in
the disease or is serendipitously associated with cells involved with the
disease.
These diseases herein are called cell surface protease-associated diseases.
Hence, to treat th disease a cellsurface protease is identified that is
expressed
on cells associated with the disorder, such as, for example, immune cells for
treating inflammatory diseases, and virally infected cells for treating viral
diseases. The conjugate is designed as described herein for cleavage by the
selected protease.
As used herein, neoplasm (neoplasia) refers to abnormal new growth, and
thus means the same as tumor, which can be benign or malignant. Unlike
hyperplasia, neoplastic proliferation persists even in the absence of the
original
stimulus.
As used herein, neoplastic disease refers to any disorder involving cancer,
including tumor development, growth, metastasis and progression.
As used herein, cancer refers to a general term for diseases caused by
any type of malignant tumor.
As used herein, malignant, as applied to tumors, refers to primary tumors
that have the capacity of metastasis with loss of growth contr~l and
positional
control.
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-24-
As used herein, endotheliase refers to a mammalian protein, including
human protein, that has a transmembrane domain and is expressed or active on
the surface of endothelial cells and includes a protease domain, particularly
an
extracellular protease domain, and is generally a serine protease (see, also
U.S.
application Serial No. 09/717,473 and International PCT application No. WO
01 /36604). Thus, reference, for example, to endotheliase encompasses all
proteins encoded by the endotheliase gene family, or an equivalent molecule
obtained from any other source or that has been prepared synthetically or that
exhibits the same activity. The endotheliase gene family are transmembrane
proteases expressed or active in endothelial cells. These proteases include
serine proteases. These include proteins that have these features and also
include a protease domain that exhibits sequence homology to the endotheliases
1 and 2. Endotheliase 1 and 2, for example exhibit about 40% or 45% identity.
Sequence homology means sequence identity along its length when aligned to
maximize identity of at least about 25%, 40%, 60%, 70%, 75%, 80%, 81 %,
82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%,
95%, 96%, 97%, 98% or 99% or greater number of residues. Sequence
homology also is assessed by determining whether the encoding sequences of
nucleic acids hybridize under conditions of at least moderate, or for more
closely
related proteins, high stringency to the nucleic acid molecules provided
herein or
to those that encode the same proteins but differ in sequence by virtue of the
degeneracy of the genetic code. In addition, "endotheliases" encompasses
endotheliases with amino acid substitutions, including those set forth in
Table 1,
such that the resulting polypeptide retains at least 1 %, 5%, 10%, 20%, 30%,
40%, 50%, 60%, 70%, 80%, 90% of the proteolytic activity of the unaltered
polypeptide. Suitable substitutions of amino acids are known to those of skill
in
this art and can be made generally without altering the biological activity of
the
resulting molecule. As noted, those of skill in this art recognize that, in
general,
single amino acid substitutions in non-essential regions of a polypeptide do
not
substantially alter biological activity (see, e.g., Watson et al. Moleeular
Biology
of the Gene, 4th Edition, 1987, The Bejacmin/Cummings Pub. Co., p.224). Also
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-25-
included within the definition of "endotheliases", is the catalytically active
fragment or shed forms of an endotheliase.
As used herein an endotheliase 1, whenever referenced herein, includes
at least one or all of or any combination of:
a polypeptide encoded by the sequence of nucleotides set forth in
SEQ ID No. 21;
a polypeptide encoded by a sequence of nucleotides that
hybridizes under conditions of low, moderate or high stringency to the
sequence
of nucleotides set forth in SEQ ID No. 21;
a polypeptide that comprises the sequence of amino acids set
forth in SEQ ID No. 22;
a polypeptide that comprises a sequence of amino acids having at
least about 40%, 60%, 70%, 75%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%,
87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98% or
99% sequence identity with the sequence of amino acids set forth in SEQ ID
No. 22; and/or
a polypeptide encoded by a splice variant of a nucleic acid
molecule that encodes a protein containing the polypeptide set forth in SEQ ID
No. 22.
The endotheliase 1 can be from any animal, particularly a mammal, and
includes but are not limited to, humans, rodents, fowl, ruminants and other
animals. The full length zymogen or two chain activated form is contemplated
or any domain thereof, including the protease domain, which can be a two chain
activated form, or a single chain form.
As used herein an endotheliase 2, whenever referenced herein, includes
at least one or all of or any combination of:
a polypeptide encoded by the sequence of nucleotides set forth in
SEQ ID No. 23 or 25;
a polypeptide encoded by a sequence of nucleotides that
hybridizes under conditions of low, moderate or high stringency ao the
sequence
of nucleotides set forth in SEQ ID No. 23 or 25;
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-26-
a polypeptide that comprises the sequence of amino acids set
forth in SEQ ID No. 24 or 26;
a polypeptide that comprises a sequence of amino acids having at
least about 40%, 60%, 70%, 75%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%,
87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98% or
99% sequence identity with the sequence of amino acids set forth in SEQ ID
No. 24 or 26; and/or
a polypeptide encoded by a splice variant of a nucleic acid set
forth in SEQ ID No. 23 or 25.
The endotheliase 2 can be from any animal, particularly a mammal, and
includes but are not limited to, humans, rodents, fowl, ruminants and other
animals. The full length zymogen or two chain activated form is contemplated
or any domain thereof, including the protease domain, which can be a two chain
activated form, or a single chain form.
As used herein, the protease domain of an endotheliase refers to the
polypeptide portion of the endotheliase that is the extracellular portion that
exhibits protease activity. The protease domain is a polypeptide that includes
at
least the minimum number of amino acids, generally more than 50 or 100,
required for protease activity. Protease activity can be assessed empirically,
such as by testing the polypeptide for its ability to act as a protease.
Assays,
such as those described in the EXAMPLES, with the exception that a known
endotheliase substrate is employed in place of the test compounds, can be used
to assess protease activity. Furthermore, since proteases, particularly serine
proteases, have characteristic structures and sequences or motifs, the
protease
domain can be readily identified by such structure and sequence or motif.
As used herein, a portion of protease domain of endotheliase refers to a
portion of protease domain of endotheliase that is located within or is the
extracellular domain of an endotheliase and exhibits serine proteolytic
activity.
Hence, it is at least the minimal portion of the extracellular domain that
exhibits
proteolytic activity as assessed by standard assays. An exemplary protease
domain of an endotheliase is set forth in SEQ ID No. 22 and as amino acids 321-
688 and 321-562 of SEQ ID Nos. 24 and 26, respectively. Smaller portions
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-27-
thereof that retain protease activity are contemplated. The protease domains
vary in size and constitution, including insertions and deletions in surface
loops.
Such domains exhibit conserved structure, including at least one structural
feature, such as the active site triad, primary specificity pocket, oxyanion
hole
and/or other features of serine protease domains of proteases. Thus, for
purposes herein, the protease domain is a portion of an endotheliase, as
defined
herein, but is homologous in terms of structural features and retention of
sequence of similarity or homology the protease domain of chymotrypsin or
trypsin.
As used herein, homologous means about greater than about 25%, 40%,
60%, 80%, 90%, 95%, 98% or greater sequence identity. By sequence
identity, the number of conserved amino acids as determined by standard
alignment algorithms programs, and used with default gap penalties established
by each supplier. Also homology can be assessed by conserved nucleic acid
sequence, which includes anything that hybridizes under at least low
stringency
conditions and encodes the domain. Similarly, nucleic acid sequence alignment
programs are commercially available (DNAStar "MegAlign" program (Madison,
WI) and the University of Wisconsin Genetics Computer Group (UWG) "Gap"
program (Madison, WI)). Substantially homologous nucleic acid molecules
would hybridize typically at moderate stringency or at high stringency all
along
the length of the nucleic acid of interest. Also contemplated are nucleic acid
molecules that contain degenerate codons in place of codons in the hybridizing
nucleic acid molecule.
As used herein, recitation that a polypeptide consists essentially of the
protease domain means that the only endotheliase portion of the polypeptide is
a
protease domain or a catalytically active portion thereof. The polypeptide can
optionally include additional non-endotheliase-derived sequences of amino
acids.
As used herein, domain refers to a portion of a molecule, e.g., proteins
or nucleic acids, that is structurally and/or functionally distinct from other
portions of the molecule.
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-28-
As used herein, an active form of a protease refers to an enzyme that
catalyzes hydrolysis of proteins or peptides. Reference to a protease includes
the active and zymogen or other less active form.
As used herein, nucleic acids include DNA, RNA and analogs thereof,
including peptide nucleic acids (PNA) and mixtures thereof. Nucleic acids can
be
single or two stranded. When referring to probes or primers, optionally
labeled,
with a detectable label, such as a fluorescent or radiolabel, single-stranded
molecules are contemplated. Such molecules are typically of a length such that
their targets are statistically unique or of low copy number (typically less
than 5,
generally less than 3) for probing or priming a library. Generally a probe or
primer contains at least 14, 16 or 30 contiguous of sequence complementary to
or identical to a gene of interest. Probes and primers can be 10, 20, 30, 50,
100 or more nucleic acids long.
As used herein, nucleic acid encoding a fragment or portion of an
endotheliase refers to a nucleic acid encoding only the recited fragment or
portion of endotheliase protein, and not the other contiguous portions of the
endotheliase as a continuous sequence.
As used herein, heterologous nucleic acid is nucleic acid that, if it is DNA
encodes RNA, or, if RNA, encodes proteins that generally are not normally
produced in vivo by the cell in which it is expressed or that mediates or
encodes
mediators that alter expression of endogenous nucleic acid, such as DNA, by
affecting transcription, translation, or other regulatable biochemical
processes or
that is located in a different locus from its normal locus. Heterologous
nucleic
acid is generally not endogenous to the cell into which it is introduced, but
has
been obtained from another cell or prepared synthetically. Generally, although
not necessarily, such nucleic acid encodes RNA and proteins that are not
normally produced by the cell in which it is now expressed.
Heterologous nucleic acid, such as DNA, also be referred to as foreign
nucleic acid, such as DNA. Any nucleic acid, such as DNA, that one of skill in
the art would recognize or consider as heterologous or foreign to the cell in
which is expressed is herein encompassed by heterologous nucleic acid;
heterologous nucleic acid includes exogenously added nucleic acid that is also
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-29-
expressed endogenously. Examples of heterologous nucleic acid include, but are
not limited to, nucleic acid that encodes traceable marker proteins, such as a
protein that confers drug resistance, nucleic acid that encodes
therapeutically
effective substances, such as anti-cancer agents, enzymes and hormones, and
nucleic acid, such as DNA, that encodes other types of proteins, such as
antibodies, and RNA, such as RNA interference (RNAi) or other double-stranded
RNA, and antisense RNA. Antibodies that are encoded by heterologous nucleic
acid can be secreted or expressed on the surface of the cell in which the
heterologous nucleic acid has been introduced.
14 For example, nucleic acid can be the the targeted agent, such as the
therapeutic or diagnostic agent, in the conjugate. Nucleic acids, include ds
RNA
use for RNA interference (RNAi) (see, e.g. Chuang et al. (2000) Proc. Nat/.
Acad. Sci. U.S.A. 97:4985) which is employed to inhibit the expression of a
targeted gene by generating loss-of-function. Methods relating to the use of
RNAi to silence genes in organisms including, mammals, C. elegans, Drosophila
and plants, and humans are known (see, e.g., Fire et al. (1998) Nature 39~:806-
81 1 Fire (1999) Trends Genet. 75:358-363; Sharp (2001 ) Genes Dev. X5:485-
490; Hammond, et al. (2001 ) Nature Rev. Genet.2:1 10-1 1 19; Tuschl (2001 )
Chem. Biochem. 2:239-245; Hamilton et al. ( 1999) Science 286:950-952;
Hammond et al. (2000) Nature 4Q4:293-296; 7amore et al. (2000) Cell 909:25-
33; Bernstein et al. (2001 ) Nature 409: 363-366; Elbashir et al. (2001 )
Genes
Dev. 75:188-200; Elbashir et al. (2001 ) Nature 47 7:494-498; International
PCT
application No. WO 01 /29058; International PCT application No. WO
99/32619). By selecting appropriate sequences, expression of dsRNA can
interfere with accumulation of endogenous mRNA encoding a targeted gene
product. Regions that include at least about 21 nucleotides and that are
selective (i.e. whose target is unique) for the nucleic acid encoding a
targeted
gene product are used to prepare the RNAi.
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-30-
As used herein, genetic therapy involves the transfer of heterologous
nucleic acid, such as DNA, into certain cells, target cells, of a mammal,
particularly a human, with a disorder or conditions for which such therapy is
sought. The nucleic acid molecules are included in a conjugate linked via a
cell
surface protein cleavage site. The nucleic acid, such as DNA, is introduced
into
the selected target cells in a manner such that the heterologous nucleic acid,
such as DNA, is expressed and a therapeutic product encoded thereby is
produced. Alternatively the heterologous nucleic acid, such as DNA, can in
some manner mediate expression of DNA that encodes the therapeutic product,
or it can encode a product, such as a peptide or RNA that in some manner
mediates, directly or indirectly, expression of a therapeutic product. Genetic
therapy can also be used to deliver nucleic acid encoding a gene product that
replaces a defective gene or supplements a gene product produced by the
mammal or the cell in which it is introduced. The introduced nucleic acid can
encode a therapeutic compound, such as a growth factor inhibitor thereof, or a
tumor necrosis factor or inhibitor thereof, such as a receptor therefor, that
is not
normally produced in the mammalian host or that is not produced in
therapeutically effective amounts or at a therapeutically useful time. The
heterologous nucleic acid, such as DNA, encoding the therapeutic product can
be modified prior to introduction into the cells of the afflicted host in
order to
enhance or otherwise alter the product or expression thereof. Genetic therapy
can also involve delivery of an inhibitor or repressor or other modulator of
gene
expression, such dsRNA or antisense or other nucleic acid molecule. The
conjugates herein can be used to deliver a product, such as a nucleic acid for
gene therapy.
As used herein, a therapeutically effective product for gene therapy is a
product that is encoded by heterologous nucleic acid, typically DNA, that,
upon
introduction of the nucleic acid into a host, a product is expressed that
ameliorates or eliminates the symptoms, manifestations of an inherited or
acquired disease or that cures the disease. Also included are biologically
active
nucleic acid molecules, such as RNAi and antisense.
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-31-
As used herein, a sequence complementary to at least a portion of an
RNA, with reference to antisense oligonucleotides, means a sequence having
sufficient complementarily to be able to hybridize with the RNA, generally
under
moderate or high stringency conditions, forming a stable duplex; in the case
of
double-stranded SP antisense nucleic acids, a single strand of the duplex DNA
(or dsRNA) can thus be tested, or triplex formation can be assayed. The
ability
to hybridize depends on the degree of complementarily and the length of the
antisense nucleic acid. Generally, the longer the hybridizing nucleic acid,
the
more base mismatches with a SP encoding RNA it can contain and still form a
stable duplex (or triplex, as the case can be). One skilled in the art can
ascertain
a tolerable degree of mismatch by use of standard procedures to determine the
melting point of the hybridized complex.
Amino acid substitutions can be made or occur in any SPs and protease
domains thereof. Amino acid substitutions include conservative substitutions,
such as those set forth in Table 1, which do not eliminate proteolytic
activity.
As described herein, substitutions that alter properties of the proteins, such
as
removal of cleavage sites and other such sites are also contemplated; such
substitutions are generally non-conservative, but can be readily effected by
those of skill in the art.
Suitable conservative substitutions of amino acids are known to those of
skill in this art and can be made generally without altering the biological
activity,
for example enzymatic activity, of the resulting molecule. Also included
within
the definition, is the catalytically active fragment of an SP, particularly a
single
chain protease portion.
Conservative amino acid substitutions are made, for example, in accordance
with those set forth in TABLE 1 as follows:
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-32-
TABLE 1
Ala (A) Gly; Ser
Arg (R) Lys, Orn
Asn (N) Gln; His
Asp (D) Glu
Cys (C) Ser
Gln (Q) Asn
Glu (E) Asp
Gly (G) Ala; Pro
His (H) Asn; Gln
Ile (I) Leu; Val; Nle; Met
Leu (L) lle; Val; Nle; Met
Lys (K) Arg; Gln; Glu
Met (M) Leu; Tyr; Ile; Nle
Phe (F) Met; Leu; Tyr, Trp
Ser (S) Thr
Thr (T) Ser
Trp (W) Tyr; Phe
Tyr (Y) Trp; Phe
Val (V) Ile; Leu; Nle; Met
Other substitutions are also
permissible and can be determined
empirically or in
accord with known conservative substitutions. For example, one or more amino
acid residues within the sequence can be substituted by another amino acid of
a
similar polarity which acts as a functional equivalent, resulting in a silent
alteration. Substitutes for an amino acid within the sequence can be selected
from other members of the class to which the amino acid belongs. For example,
the nonpolar (hydrophobic) amino acids include alanine, leucine, isoleucine,
valine, proline, phenylalanine, tryptophan and methionine. The polar neutral
amino acids include glycine, serine, threonine, cysteine, tyrosine,
asparagine,
and glutamine. The positively charged (basic) amino acids include arginine,
lysine and histidine. The negatively charged (acidic) amino acids include
aspartic
acid and glutamic acid.
As used herein, the amino acids, which occur in the various amino acid
sequences appearing herein, are identified according to their well-known,
three-
letter or one-letter abbreviations. The nucleotides, which occur in the
various
DNA fragments, are designated with the standard single-letter designations
used
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-33-
routinely in the art. Other abbreviations, include: hR or hArg for
homoarginine;
hY or hTyr for homotyrosine; Cha for cyclohexylalanine; Amf for
4-aminomethylphenylalanine; DPL for 2-(4,6-dimethylpyrimidinyl)lysine;
(imidazolyllK for N'-(2-imidazolyl)lysine; Me2P03-Y for
0-dimethylphosphotyrosine; O-Me-Y for O-methyltyrosine; TIC for
tetrahydro-3-isoquinoline carboxylic acid; MeL for 2-keto-3-amino-5-methyl-
hexane; DAP for 1,3-diaminopropane; TFA for trifiuoroacetic acid; AA for
acetic
acid.
As used herein, a splice variant refers to a variant produced by
differential processing of a primary transcript of genomic DNA that results in
more than one type of mRNA.
As used herein, a probe or primer based on a nucleotide sequence
disclosed herein, includes at least 10, 14, generally at least 16 or 30 or 100
contiguous sequence of nucleotides.
As used herein, antisense polynucleotides refer to synthetic sequences of
nucleotide bases complementary to mRNA or the sense strand of double-
stranded DNA. Admixture of sense and antisense polynucleotides under
appropriate conditions leads to the binding of the two molecules, or
hybridization. When these polynucleotides bind to (hybridize with) mRNA,
inhibition of protein synthesis (translation) occurs. When these
polynucleotides
bind to double-stranded DNA, inhibition of RNA synthesis (transcription)
occurs.
The resulting inhibition of translation andlor transcription leads to an
inhibition of
the synthesis of the protein encoded by the sense strand. Antisense nucleic
acid molecules typically contain a sufficient number of nucleotides to
specifically
bind to a target nucleic acid, generally afi least 5 contiguous nucleotides,
often
at least 14 or 16 or 30 contiguous nucleotides or modified nucleotides
complementary to the coding portion of a nucleic acid molecule that encodes a
gene of interest, for example, nucleic acid encoding a single chain protease
domain of an SP.
As used herein, an array refers to a collection of elements, such as
antibodies, containing three or more members. An addressable array is one in
which the members of the array are identifiable, typically by position on a
solid
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-34-
phase support. Hence, in general the members of the array are immobilized on
discrete identifiable loci on the surface of a solid phase.
As used herein, antibody refers to an immunoglobulin, whether natural or
partially or wholly synthetically produced, including any derivative thereof
that
retains the specific binding ability of the antibody. Hence antibody includes
any
protein having a binding domain that is homologous or substantially homologous
to an immunoglobulin binding domain. Antibodies include members of any
immunoglobulin claims, including IgG, IgM, IgA, IgD and IgE.
As used herein, antibody fragment refers to any derivative of an antibody
that is less than full-length, retaining at least a portion of the full-length
antibody's specific binding ability. Examples of antibody fragments
include,but
are not limited to, Fab, Fab', F(ab)2, single-chain Fvs (scFV), FV, dsFV
diabody
and Fd fragments. The fragment can include multiple chains linked together,
such as by disulfide bridges. An antibody fragment generally contains at least
about 50 amino acids and typically at least 200 amino acids.
As used herein, an Fv antibody fragment is composed of one variable
heavy domain (VH) and one variable light domain linked by noncovalent
interactions.
As used herein, a dsFV refers to an Fv with an engineered intermolecular
disulfide bond, which stabilizes the VH V~ pair.
As used herein, an F(ab)~ fragment is an antibody fragment that results
from digestion of an immunoglobulin with pepsin at pH 4.0-4.5; it can be
recombinantly expressed to produce the equivalent fragment.
As used herein, Fab fragments are antibody fragments that result from
digestion of an immunoglobulin with papain; they can be recombinantly
expressed to produce the equivalent fragment.
As used herein, scFVs refer to antibody fragments that contain a variable
light chain (V~) and variable heavy chain (VH) covalently connected by a
polypeptide linker in any order. The linker is of a length such that the two
variable domains are bridged without substantial interference. Exemplarly
linkers
include, but are not limited to, (Gly-Ser)~ residues, which can include ome
Glu or
Lys residues dispersed throughout, for example, to increase solubility.
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-35-
As used herein, humanized antibodies refer to antibodies that are
modified to include human sequences of amino acids so that administration to a
human does not provoke an immune response. Methods for preparation of
such antibodies are known. For example, to produce such antibodies, the
encoding nucleic acid in the hybridoma or other prokaryotic or eukaryotic
cell,
such as an E. coli or a CHO cell, that expresses the monoclonal antibody is
altered by recombinant nucleic acid techniques to express an antibody in which
the amino acid composition of the non-variable region is based on human
antibodies. Computer programs have been designed to identify such non-
variable regions.
As used herein, diabodies are dimeric scFV; diabodies typically have
shorter peptide linkers than scFvs, and they generally dimerize.
As used herein, production by recombinant means by using recombinant
DNA methods means the use of the well known methods of molecular biology
for expressing proteins encoded by cloned DNA.
As used herein, the term assessing is intended to include quantitative and
qualitative determination in the sense of obtaining an absolute value for the
activity of an SP, or a domain thereof, present in the sample, and also of
obtaining an index, ratio, percentage, visual or other value indicative of the
level
of the activity. Assessment can be direct or indirect and the chemical species
actually detected need not of course be the proteolysis product itself but can
for
example be a derivative thereof or some further substance.
As used herein, biological activity refers to the in vivo activities of a
compound or physiological responses that result upon in uivo administration of
a
compound, composition or other mixture. Biological activity, thus, encompasses
therapeutic effects and pharmaceutical activity of such compounds,
compositions and mixtures. Biological activities can be observed in in vitro
systems designed to test or use such activities.
As used herein, a combination refers to any association between two or
among more items.
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-36-
As used herein, fluid refers to any composition that can flow. Fluids thus
encompass compositions that are in the form of semi-solids, pastes, solutions,
aqueous mixtures, gels, lotions, creams and other such compositions.
As used herein, an effective amount of a compound for treating a
particular disease is an amount that is sufficient to ameliorate, or in some
manner reduce the symptoms associated with the disease. Such amount can be
administered as a single dosage or can be administered according to a regimen,
whereby it is effective. The amount can cure the disease but, typically, is
administered in order to ameliorate the symptoms of the disease. Repeated
administration can be required to achieve the desired amelioration of
symptoms.
As used herein, equivalent, when referring to two sequences of nucleic
acids, means that the two sequences in question encode the same sequence of
amino acids or equivalent proteins. When equivalent is used in referring to
two
proteins or peptides, it means that the two proteins or peptides have
substantially the same amino acid sequence with amino acid substitutions lsee,
e.g., Table 1, above) that do not substantially alter the activity or function
of the
protein or peptide (i.e, retain at least about 1 % of the activity). When
equivalent refers to a property, the property does not need to be present to
the
same extent (e.g., two peptides can exhibit different rates of the same type
of
enzymatic activity), but the activities are generally substantially the same.
Complementary, when referring to two nucleotide sequences, means that the
two sequences of nucleotides are capable of hybridizing, typically with less
than
25%, often with less than 15%, or even less than 5% or with no mismatches
between opposed nucleotides. Generally the two molecules hybridize under
conditions of high stringency.
As used herein, a method for treating or preventing disease or disorder
associated with undesired and/or uncontrolled angiogenesis means that the
diseases or the symptoms associated with the undesired and/or uncontrolled
angiogenesis are alleviated, reduced, ameliorated, prevented, placed in a
state of
remission, or maintained in a state of remission. It also means that the
hallmarks of pathological angiogenesis are eliminated, reduced or prevented by
the treatment. Non-limiting examples of the hallmarks of the pathological
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-37-
angiogenesis include uncontrolled degradation of the basement membrane and
proximal extracellular matrix of the endothelial cells, migration, division,
and
organization of the endothelial cells into new functioning capillaries, and
the
persistence of such functioning capillaries.
As used herein, operatively linked or operationally associated refers to the
functional relationship of DNA with regulatory and effector sequences of
nucleotides, such as promoters, enhancers, transcriptional and translational
stop
sites, and other signal sequences. For example, operative linkage of DNA to a
promoter refers to the physical and functional relationship between the DNA
and
the promoter such that the transcription of such DNA is initiated from the
promoter by an RNA polymerise that specifically recognizes, binds to and
transcribes the DNA. In order to optimize expression and/or in vitro
transcription, it can be necessary to remove, add or alter 5' untranslated
portions of the clones to eliminate extra, potential inappropriate alternative
16 translation initiation (i.e., start) codons or other sequences that can
interfere
with or reduce expression, either at the level of transcription or
translation.
Alternatively, consensus ribosome binding sites (see, e.g., Kozak (1991 ) J.
Biol.
Chem. 266:19867-19870) can be inserted immediately 5' of the start codon
and can enhance expression. The desirability of (or need for) such
modification
can be empirically determined.
As used herein, a promoter region or promoter element refers to a
segment of DNA or RNA that controls transcription of fibs DNA or RNA to which
it is operatively linked. The promoter region includes specific sequences that
are
sufficient for RNA polymerise recognition, binding and transcription
initiation.
This portion of the promoter region is referred to as the promoter. In
addition,
the promoter region includes sequences that modulate this recognition, binding
and transcription initiation activity of RNA polymerise. These sequences can
be
cis acting or can be responsive to traps acting factors. Promoters, depending
upon the nature of the regulation, can be constitutive or regulated. Exemplary
promoters contemplated for use in prokaryotes include the bacteriophage T7 and
T3 promoters.
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-38-
As used herein, sample refers to anything which can contain an analyte
for which an analyte assay is desired. The sample can be a biological sample,
such as a biological fluid or a biological tissue. Examples of biological
fluids
include urine, blood, plasma, serum, saliva, semen, stool, sputum, cerebral
spinal fluid, tears, mucus, amniotic fluid or the like. Biological tissues are
aggregates of cells, usually of a particular .kind together with their
intercellular
substance that form one of the structural materials of a human, animal, plant,
bacterial, fungal or viral structure, including connective, epithelium, muscle
and
nerve tissues. Examples of biological tissues also include organs, tumors,
lymph
nodes, arteries and individual cell(s).
As used herein, to hybridize under conditions of a specified stringency is
used to describe the stability of hybrids formed between two single-stranded
DNA fragments and refers to the conditions of ionic strength and temperature
at
which such hybrids are washed, following annealing under conditions of
stringency less than or equal to that of the washing step. Typically high,
medium and low stringency encompass the following conditions or equivalent
conditions thereto:
1 ) high stringency: 0.1 x SSPE or SSC, 0.1 % SDS, 65 °C
2) medium stringency: 0.2 x SSPE or SSC, 0.1 % SDS, 50°C
3) low stringency: 1.0 x SSPE or SSC, 0.1 % SDS, 50°C.
Equivalent conditions refer to conditions that select for substantially the
same
percentage of mismatch in the resulting hybrids. Additions of ingredients,
such
as formamide, Ficoll, and Denhardt's solution affect parameters such as the
temperature under which the hybridization should be conducted and the rate of
the reaction. Thus, hybridization in 5 )C SSC, in 20% formamide at 42°
C is
substantially the same as the conditions recited above hybridization under
condifiions of low stringency. The recipes for SSPE, SSC and Denhardt's and
the preparation of deionized formamide are described, for example, in Sambrook
et al. (1989) Molecular Cloning, A Laboratory Manual, Cold Spring Harbor
Laboratory Press, Chapter 8; see, Sambrook et al., vol. 3, p. B.13, see, also,
numerous catalogs that describe commonly used laboratory solutions). It is
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-39-
understood fihat equivalent stringencies can be achieved using alternative
buffers, salts and temperatures.
The terms substantially identical or similar varies with the context as
understood by those skilled in the relevant art and generally means at least
40,
60, 80, 90, 95 or 98%.
As used herein, substantially identical to a product means sufficiently
similar so that the property of interest is sufficiently unchanged so that the
substantially identical product can be used in place of the product.
As used herein, fiarget cell refers to a cell that expresses a cell surface
protease.
As used herein, test substance, including compounds provided herein,
refers to a chemically defined compound (e.g., organic molecules, inorganic
molecules, organic/inorganic molecules, proteins, peptides, nucleic acids,
oligonucleotides, lipids, polysaccharides, saccharides, or hybrids among these
molecules such as glycoproteins, etc.) or mixtures of compounds (e.g., a
library
of test compounds, natural extracts or culture supernatants, etc.) whose
effect
on or interaction with a cell surface protein or cell surface-associated
protein, or
a domain thereof, is determined by the methods herein.
As used herein, the terms a therapeutic agent, therapeutic regimen,
radioprotectant, chemotherapeutic mean conventional drugs and drug therapies,
including vaccines, which are known to those skilled in the art.
Radiotherapeutic agents are well known in the art.
As used herein, vector (or plasmid) refers to discrete elements that are
used to introduce heterologous DNA into cells for expression and/or
replication
thereof. The vecfiors typically remain episomal, but can be designed to effect
integration of a gene or portion thereof into a chromosome of the genome. Also
contemplated are vectors that are artificial chromosomes, such as yeast
artificial
chromosomes and mammalian artificial chromosomes. Selection and use of such
vehicles are well known to those of skill in the art. An expression vector
includes vectors capable of expressing DNA that is operatively linked with
regulatory sequences, such as promoter regions, that are capable of effecting
expression of such DNA fragments. Thus, an expression vector refers to a
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-40-
recombinant DNA or RNA construct, such as a plasmid, a phage, recombinant
virus or other vector that, upon introduction into an appropriate host cell,
results
in expression of the cloned DNA. Appropriate expression vectors are well
known to those of skill in the art and include those that are replicable in
eukaryotic cells and/or prokaryotic cells and those that remain episomal or
those
which integrate into the host cell genome.
As used herein, chemically stable means that the compound is stable
enough to be formulated for pharmaceutical use. Such chemical stability is
well
known to those of skill in the art and can be determined by well known routine
methods. Whether a given compound is chemically stable enough to be
formulated for pharmaceutical use depends on a number of factors including,
but
not limited to, the type of formulation and route of administration desired,
the
disease to be treated, and the method of preparing the pharmaceutical
formulation.
As used herein, a "functional equivalent" of a side chain of an amino acid
is a group or moiety that functions in substantially the same way as the
naturally occurring side chain to achieve substantially the same result (e.g.,
a
substrate for a cell surface protease). For example, functional equivalents of
the
side chain of arginine include, but are not limited to, homoarginine,
guanidinoaminopropyl, guanidinoaminoethyl, (Me)~arginine side chain,
(Et)~arginine side chain, (4-aminomethyl)phenylmethyl, 4-amidinophenylmethyl,
4-guanidinophenylmethyl, or a conformationally constrained arginine side chain
analog such as:
N H
N H' \
NH2
.x
N
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-41-
where x is 0 or 1 (see, e.g., Webb et al. ( 1991 ) J. Org. Chem. 56:3009), or
a
conformationally constrained arginine side chain analog such as:
HzN~NH NHz
H2N NH W ~/~NH
HN
d
NH HzN NH
~NHz
~ / or
where d is an integer from 0 to 5, or 1 to 3; and W is N or CH; or a mono- or
di-
substituted N-alkyl derivative of the above groups, where alkyl is, in certain
embodiments, lower alkyl, such as methyl.
As used herein, pharmaceutically acceptable derivatives of a compound
include salts, esters, enol ethers, enol esters, acids, bases, solvates,
hydrates or
prodrugs thereof. Such derivatives can be readily prepared by those of skill
in
this art using known methods for such derivatization. The compounds produced
can be administered to animals or humans without substantial toxic effects and
either are pharmaceutically active or are prodrugs. Pharmaceutically
acceptable
salts include, but are not limited to, amine salts, such as but not limited to
N,N'-
dibenzylethylenediamine, chloroprocaine, choline, ammonia, diethanolamine and
other hydroxyalkylamines, ethylenediamine, N-methylglucamine, procaine, N-
benzylphenethylamine, 1-para-chlorobenzyl-2-pyrrolidin-1'-ylmethyl-
benzimidazole, diethylamine and other alkylamines, piperazine and tris(hydroxy-
methyl)aminomethane; alkali metal salts, such as but not limited to lithium,
potassium and sodium; alkali earth metal salts, such as but not limited to
barium, calcium and magnesium; transition metal salts, such as but not limited
to zinc; and other metal salts, such as but not limited to sodium hydrogen
phosphate and disodium phosphate; and also including, but not limited to,
salts
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-42-
of mineral acids, such as but not limited to hydrochlorides and sulfates; and
salts of organic acids, such as but not limited to acetates, lactates,
malates,
tartrates, citrates, ascorbates, succinates, butyrates, valerates and
fumarates.
Pharmaceutically acceptable esters include, but are not limited to, alkyl,
alkenyl,
alkynyl, aryl, heteroaryl, aralkyl, heteroaralkyl, cycloalkyl and heterocyclyl
esters
of acidic groups, including, but not limited to, carboxylic acids, phosphoric
acids, phosphinic acids, sulfonic acids, sulfinic acids and boronic acids.
Pharmaceutically acceptable enol ethers include, but are not limited to,
derivatives of formula C = C(OR) where R is hydrogen, alkyl, alkenyl, alkynyl,
aryl, heteroaryl, aralkyl, heteroaralkyl, cycloalkyl or heterocyclyl.
Pharmaceutically acceptable enol esters include, but are not limited to,
derivatives of formula C=C(OC(O)R) where R is hydrogen, alkyl, alkenyl,
alkynyl, aryl, heteroaryl, aralkyl, heteroaralkyl, cycloalkyl ar heterocyclyl.
Pharmaceutically acceptable solvates and hydrates are complexes of a
compound with one or more solvent or water molecule, generally 1 to about
100, typically 1 to about 10, such as 1 to about 2, 3 or 4, solvent or water
molecules.
As used herein, treatment means any manner in which one or more of
the symptoms of a condition, disorder or disease are ameliorated or otherwise
beneficially altered. Treatment also encompasses any pharmaceutical use of the
compositions herein, such as use for treating cancer.
As used herein, amelioration of the symptoms of a particular disorder by
administration of a particular pharmaceutical composition refers to any
lessening, whether permanent or temporary, lasting or transient that can be
attributed to or associated with administration of the composition.
As used herein, a prodrug is a compound that, upon in vivo
administration, is metabolized or otherwise converted to the biologically,
pharmaceutically or therapeutically active form of the compound. To produce a
prodrug, the pharmaceutically active compound is modified such that the active
compound is regenerated by metabolic processes. The prodrug can be designed
to alter the metabolic stability or the transport characteristics of a drug,
to mask
side effects or toxicity, to improve the flavor of a drug or to alter other
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-43-
characteristics or properties of a drug. By virtue of knowledge of
pharmacodynamic processes and drug metabolism in vivo, those of skill in this
art, once a pharmaceutically active compound is known, can design prodrugs of
the compound (see, e.g., Nogrady (1985) Medicinal Chemistry A Biochemical
Approach, Oxford University Press, New York, pages 388-392).
It is to be understood that the conjugates provided herein can contain
chiral centers. Such chiral centers can be of either the (R) or (S)
configuration,
or can be a mixture thereof. Thus, the compounds provided herein can be
enantiomerically pure, or be stereoisomeric or diastereomeric mixtures. In the
case of amino acid residues, such residues can be of either the L- or D-form.
The configuration for naturally occurring amino acid residues is generally L.
When not specified the residue is the L form. It is to be understood that the
chiral centers of the compounds provided herein can undergo epimerization in
vivo. As such, one of skill in the art will recognize that administration of a
compound in its (R) form is equivalent, for compounds that undergo
epimerization in vivo, to administration of the compound in its (S) form.
The conjugates provided herein are prodrugs because they include a
therapeutic agent in an inactive form that is ultimately converted to an
active
form at the targeted cell or tissue or in the environment thereof. Upon
exposure
to targeted protease either a biologically, pharmaceutically or
therapeutically
active form of a compound is released, or, a derivative that can be further
metabolized into a biologically, pharmaceutically or therapeutically active
form of
a compound.
As used herein, substantially pure means sufficiently homogeneous to
appear free of readily detectable impurities as determined by standard methods
of analysis, such as thin layer chromatography (TLC), gel electrophoresis,
high
performance liquid chromatography (HPLC) and mass spectrometry (MS1, used
by those of skill in the art to assess such purity, or sufficiently pure such
that
further purification would not alter the physical and chemical properties,
such as
enzymatic and biological activities, of the substance for its intended
purpose.
Methods for purification of the compounds to produce substantially chemically
pure compounds are known to those of skill in the art. A substantially
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-44-
chemically pure compound may, however, be a mixture of stereoisomers. In
such instances, further purification might increase the specific activity of
the
compound.
As used herein, a peptidic substrate includes peptides and molecules,
such as peptide mimetics and peptides that include peptide bond surrogates.
As used herein, conventional terminology (Schecter et al. (1967)
Biochem. Bioahys. Res. Common. 27:157-162) is used to refer to specific
subsites of a protease substrate:
Pn...P3-P2-P1 y P1'-P2'-P3'...Pn'. The scissile bond (i.e., the cleavage site)
of a
substrate is indicated by the arrow. Positions N-terminal of that bond are
referred to as unprimed positions. Subsites are then assigned a number based
on their distance from the scissile bond. Amino acids (or amino acid
surrogates)
that form the scissile bond are assigned the number 1, adjacent residues the
number 2, and so on, counting away from the scissile bond. Each specific
subsite of the substrate, therefore, is uniquely identified by a number and
the
designation as primed or unprimed.
As used herein, a surrogate of a peptide bond is a divalent group that
possesses similar steric and/or electronic characteristics to -C(O)NH-.
Peptide
bond surrogates include, but are not limited to, alkene isosteres (-CR=CR-),
particularly (E)-alkene isosteres of formula -CH = CH-, hydroxyethylene
isosteres
(-CH(OH)CH~ ), enamine isosteres (-C( = CRR)NH-), aminoalcohol isosteres
(-CH(OH)CH2NH-), difluoroketone isosteres (-C(O)CF~ ), retroinverso compounds
(-NHC(O)-), divalent heterocyclyl or heteroaryl groups, and cyclopropyl
isosteres
such as:
30
As used herein, alkyl, alkenyl and alkynyl carbon chains, if not specified,
contain from 1 to 20 carbons, generally 1 to 16 carbons, and are straight or
branched. Alkenyl carbon chains of from 2 to 20 carbons typically contain 1 to
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-45-
8 double bonds, and the alkenyf carbon chains of 2 to 16 carbons and typically
contain 1 to 5 double bonds. Alkynyl carbon chains of from 2 to 20 carbons
typically contain 1 to 8 triple bonds, and the alkynyl carbon chains of 2 to
16
carbons and generally contain 1 to 5 triple bonds. Exemplary alkyl, alkenyl
and
alkynyl groups herein include, but are not limited to, methyl, ethyl, propyl,
isopropyl, isobutyl, n-butyl, sec-butyl, tert-butyl, isopentyl, neopentyl,
tert-pentyl
and isohexyl. The alkyl, alkenyl and alkynyl groups, unless otherwise
specified,
optionally can be substituted, with one or more groups, generally alkyl group
substituents that are the same or different. As used herein, lower alkyl,
lower
alkenyl, and lower alkynyl refer to carbon chains having less than about 6
carbons. As used herein, "alk(en)(yn)yl" refers to an alkyl group containing
at
least one double bond and at least one triple bond.
As used herein, "cycloalkyl" refers to a saturated mono- or multicyclic
ring system, typically 3 to 10 carbon atoms, such as, for example, 3 to 6
carbon atoms; cycloalkenyl and cycloalkynyl refer to mono- or multicyclic ring
systems that respectively include at least one double bond and at least one
triple
bond. Cycloalkenyl and cycloalkynyl groups contain, for example, 3 to 10
carbon atoms, with cycloalkenyl groups generally containing 4 to 7 carbon
atoms and cycloalkynyl groups that contain, for example 8 to 10 carbon atoms.
The ring systems of the cycloalkyl, cycloalkenyl and cycloalkynyl groups can
be
composed of one ring or two or more rings which can be joined together in a
fused, bridged or spiro-connected fashion, and optionally can be substituted
with one or more alkyl group substituents. "Cycloalk(en)(yn)yl" refers to a
cycloalkyl group containing at least one double bond and at least one triple
bond.
As used herein, "substituted alkyl," "substituted alkenyl," "substituted
alkynyl," "substituted cycloalkyl," "substituted cycloalkenyl," and
"substituted
cycloalkynyl" refer to alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl and
cycloalkynyl groups, respectively, that are substituted with one or more
substituents, in certain embodiments one to three substituents, independently
selected from alkyl, halo, haloalkyl, such as halo lower alkyl, pseudohalo,
aryl,
amino, dialkylamino, nitro, cyano, azido, alkylsulfinyl, alkylsulfonyl,
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-46-
alkylcarbonylamino, alkoxycarbonyfamino, aminoimino, hydroxy, alkoxy, aryloxy,
alkyloxy, alkylthio, arylthio, aralkyloxy, aralkylthio, carboxy,
alkylcarbonyl,
alkoxycarbonyl, oxo and cycloalkyl.
As used herein, "aryl" refers to cyclic groups containing from 6 to 19
carbon atoms. Aryl groups include, but are not limited to groups, such as
fluorenyl, substituted fluorenyl, phenyl, substituted phenyl, naphthyl and
substituted naphthyl. As used herein, "aryl" also refers to aryl-containing
groups, including, but not limited to, aryloxy, arylthio, arylcarbonyl and
arylamino groups.
As used herein, "heteroaryl" refers to a monocyclic or multicyclic
aromatic ring system, generally about 5 to about 15 members where one or
more, such as 1 to 3 of the atoms in the ring system is a heteroatom, that is,
an
element other than carbon, for example, nitrogen, oxygen and sulfur atoms.
The heteroaryl group optionally can be fused to a benzene ring. Exemplary
heteroaryl groups include, for example, furyl, imidazoiyl, pyrrolidinyl,
pyrimidinyl,
tetrazolyl, thienyl, pyridyl, pyrrolyl, N-methylpyrrolyl, quinolinyl and
isoquinolinyl,
with pyridyl, thienyl and quinolinyl as examples thereof.
As used herein, "heteroaryl" also refers to heteroaryl-containing groups,
including, but not limited to, heteroaryloxy, heteroarylthio,
heteroarylcarbonyl
and heteroarylamino.
As used herein, "heterocyclyl" refers to a monocyclic or multicyclic non-
aromatic ring system, such as systems of 3 to 10 members, for exmaple 4 to 7
members or 5 to 6 members, where one or more, such as 1 to 3 of the atoms in
the ring system is a heteroatom, that is, an element other than carbon, for
example, nitrogen, oxygen and/or sulfur atoms.
As used herein, "substituted aryl," "substituted heteroaryl" and
"substituted heterocyclyl" refer to aryl, heteroaryl and heterocyclyl groups,
respectively, that are substituted with one or more substituents, in certain
embodiments one to three substituents, independently selected from alkyl,
cycloalkyl, cycloalkylalkyl, aryl, heteroaryl optionally substituted with 1 or
more,
such as 1 to 3, substituents selected from halo, halo alkyl and alkyl,
aralkyl,
heteroaralkyl, alkenyl containing 1 to 2 double bonds, alkynyl containing 1 to
2
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-47-
triple bonds, alk(en)(yn)yl groups, halo, pseudohalo, cyano, hydroxy,
haloalkyl
and polyhaloalkyl, such as halo lower alkyl, especially trifluoromethyl,
formyl,
alkylcarbonyl, arylcarbonyl that optionally is substituted with 1 or more,
generally 1 to 3, substituents selected from halo, halo alkyl and alkyl,
heteroarylcarbonyl, carboxy, alkoxycarbonyl, aryloxycarbonyl, aminoimino,
alkoxycarbonylamino, aryloxycarbonylamino, aminocarbonyl, alkylaminocarbonyl,
dialkylaminocarbonyl, arylaminocarbonyl, diarylaminocarbonyl, aralkylaminocar-
bonyl, alkoxy, aryloxy, perfluoroalkoxy, alkenyloxy, alkynyloxy, arylalkoxy,
aminoalkyl, alkylaminoalkyl, dialkylaminoalkyl, arylaminoalkyl, amino,
alkylamino,
dialkylamino, arylamino, alkylarylamino, alkylcarbonylamino,
arylcarbonylamino,
azido, nitro, mercapto, alkylthio, arylthio, perfluoroalkylthio, thiocyano,
isothiocyano, alkylsulfinyl, alkylsulfonyl, arylsulfinyl, arylsulfonyl,
aminosulfonyl,
alkylaminosulfonyl, dialkylaminosulfonyl and arylaminosulfonyl.
As used herein, "aralkyl" refers to an alkyl group in which one of the
hydrogen atoms of the alkyl is replaced by an aryl group.
As used herein, "heteroaralkyl" refers to an alkyl group in which one of
the hydrogen atoms of the alkyl is replaced by a heteroaryl group.
As used herein, the nomenclature alkyl, alkoxy, carbonyl, ete. is used as
is generally understood by those of skill in this art. For example, as used
herein
alkyl refers to saturated carbon chains that contain one or more carbons; the
chains can be straight or branched or include cyclic portions or be cyclic.
Where the number of any given substituent is not specified (e.g.,
"haloalkyl"), there can be one or more substituents present. For example,
"haloalkyl" can include one or more of the same or different halogens. As
another example, "C,~3alkoxyphenyl" can include one or more of the same or
different alkoxy groups containing one, two or three carbons.
As used herein, "halo", "halogen" or "halide" refers to F, CI, Br or I.
As used herein, pseudohalides are compounds that behave substantially
similar to halides. Such compounds can be used in the same manner and
treated in the same manner as halides (X-, in which X is a halogen, such as CI
or
Br). Pseudohalides include, but are not limited to, cyanide, cyanate,
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-48-
thiocyanate, selenocyanate, trifluoromethoxy, difluoromethoxy, dichloromethoxy
and azide.
As used herein, "haloalkyl" refers to a lower alkyl radical in which one or
more of the hydrogen atoms are replaced by halogen. Such groups include, but
not limited to, chloromethyl, trifluoromethyl, 1-chloro-2-fluoroethyl and the
like.
As used herein, "haloalkoxy" refers to RO- in which R is a haloalkyl
group.
As used herein, "sulfinyl" or "thionyl" refers to -S(O)-. As used herein,
"sulfonyl" or "sulfury!" refers to -S(O)S-. As used herein, "sulfo" refers to
70 S(O)20-.
As used herein, "carboxy" refers to a divalent radical, -C(O)O-.
As used herein, "aminocarbonyl" refers to -C(O)NH2.
As used herein, "alkylaminocarbonyl" refers to -C(O)NHR in which R is
hydrogen or alkyl, such as, for example, lower alkyl.
As used herein "dialkylaminocarbonyl" as used herein refers to -C(O)NR~R
in which R~ and R are independently selected from hydrogen or alkyl, such as,
for example, lower alkyl; "carboxamide" refers to groups of formula -NR~COR.
As used herein, "diarylaminocarbonyl" refers to -C(O)NRR' in which R and
R' are independently selected from aryl, such as lower aryl, for example,
phenyl.
As used herein, "aralkylaminocarbonyl" refers to -C(O)NRR' in which one
of R and R' is aryl, such as, lower aryl, for example, phenyl, and the other
of R
and R' is alkyl, such as, for example, lower alkyl.
As used herein, "arylaminocarbonyl" refers to -C(O)NHR in which R is
aryl, such as lower aryl, for example, phenyl.
As used herein, "hydroxycarbonyl" refers to -COOH.
As used herein, "alkoxycarbonyl" refers to -C(O)OR in which R is alkyl,
such as lower alkyl.
As used herein, "aryloxycarbonyl" refers to -C(0)OR in which R is aryl,
such lower aryl, for example phenyl.
As used herein, "alkoxy" and "alkylthio" refer to RO- and RS-, in which R
is alkyl, such as, for example, lower alkyl.
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-49-
As used herein, "aryloxy" and "arylthio" refer to RO- and RS-, in which R
is aryl, such lower aryl, for example, phenyl.
As used herein, "alkylene" refers to a straight, branched or cyclic, such
as, for example, straight or branched, divalent aliphatic hydrocarbon group,
for
example, having from 1 to about 20 carbon atoms such as 1 to 12 carbons,
and for exmaple, is lower alkylene. There optionally can be inserted along the
alkylene group one or more oxygen, sulphur or substituted or unsubstituted
nitrogen atoms, where the nitrogen substituent is alkyl as previously
described.
Exemplary alkylene groups include methylene (-CHZ-), ethylene (-CH~CHz-),
propylene (-(CHz)3 ), cyclohexylene (-C6H,o ), methylenedioxy (-O-CH2 O-) and
ethylenedioxy (-O-(CHZ)~-O-). The term "lower alkylene" refers to alkylene
groups having 1 to 6 carbons. Exemplary alkylene groups are lower alkylene,
such as, for example, alkylene of 1 to 3 carbon atoms.
As used herein, "alkenylene" refers to a straight, branched or cyclic,
typically straight or branched, divalent aliphatic hydrocarbon group, such as,
for
example, having from 2 to about 20 carbon atoms and at least one double bond,
generally 1 to 12 carbons, and is for example, lower alkenylene. There
optionally can be inserted along the alkenylene group one or more oxygen,
sulphur or substituted or unsubstituted nitrogen atoms, where the nitrogen
substituent is alkyl as previously described. Exemplary alkenylene groups
include -CH=CH-CH=CH- and -CH=CH-CH2-. The term "lower alkenylene"
refers to alkenylene groups having 2 to 6 carbons. Examplary alkenylene groups
are lower alkenylene, such as, for example, alkenylene of 3 to 4 carbon atoms.
As used herein, "alkynylene" refers to a straight, branched or cyclic,
generally straight or branched, divalent aliphatic hydrocarbon group, such
those
having from 2 to about 20 carbon atoms and at least one triple bond, generally
1 to 12 carbons, such as, for example, lower alkynylene. There optionally can
be inserted along the alkynyfene group one or more oxygen, sulphur or
substituted or unsubstituted nitrogen atoms, where the nitrogen substituent is
alkyl as previously described. Exemplary alkynylene groups include
-C---C-CSC-, -C---C- and -C---C-CHZ-. The term "lower alkynylene" refers to
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-50-
alkynylene groups having 2 to 6 carbons. Exemplary alkynylene groups are
lower alkynylene, such as, for example, alkynylene of 3 to 4 carbon atoms.
As used herein, "alk(en)(yn)ylene" refers to a straight, branched or cyclic,
generally straight or branched, divalent aliphatic hydrocarbon group, having,
for
example, from 2 to about 20 carbon atoms and at least one triple bond, and at
least one double bond; typically 1 to 12 carbons, such as, for example, lower
alk(en)lyn)ylene. There optionally can be inserted along the alkynylene group
one or more oxygen, sulphur or substituted or unsubstituted nitrogen atoms,
where the nitrogen substituent is alkyl as previously described. Exemplary
alk(en)(yn)ylene groups include -C=C-(CH2)~-C---C-, where n is 1 or 2, The
term "lower alk(en)(yn)ylene" refers to alk(en)(yn)ylene groups having up to 6
carbons. Exemplary alk(en)(yn)ylene groups are lower alk(en)(yn)ylene, such
as,
for example, alk(en)(yn)ylene of 4 carbon atoms.
As used herein, "cycloalkylene" refers to a divalent saturated mono- or
multicyclic ring system, generally 3 to 10 carbon atoms, such as 3 to 6 carbon
atoms; cycloalkenylene and cycloalkynylene refer to divalent mono- or
multicyclic ring systems that respectively include at least one double bond
and
at least one triple bond. Cycloalkenylene and cycloalkynylene groups can
contain 3 to 10 carbon atoms, with, for example, cycloalkenylene groups
containing 4 to 7 carbon atoms and cycloalkynylene groups containing 8 to 10
carbon atoms. The ring systems of the cycloalkylene, cycloalkenylene and
cycloalkynylene groups can be composed of one ring or two or more rings that
can be joined together in a fused, bridged or spiro-connected fashion.
"Cycloalk(en)(yn)ylene" refers to a cycloaikylene group containing at least
one
double bond and at least one triple bond.
As used herein, "substituted alkylene," "substituted alkenylene,"
"substituted alkynylene," "substituted cycloalkylene," "substituted cyclo-
alkenylene," and "substitued cycloalkynylene" refer to alkylene, alkenylene,
alkynylene, cycloalkylene, cycloalkenylene and cycloalkynylene groups,
respectively, that are substituted with one or more substituents, in certain
embodiments one to three substituents, independently selected from halo,
haloalkyl, such as, for example, halo lower alkyl, aryl, hydroxy, alkoxy,
aryloxy,
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-51-
alkyloxy, alkylthio, arylthio, aralkyloxy, aralkylthio, carboxy
alkoxycarbonyl, oxo
and cycloalkyl. '
As used herein, "arylene" refers to a monocyclic or polycyclic, such as
monocyclic, divalent aromatic group, for example, having from 5 to about 20
carbon atoms and at least one aromatic ring, such as 5 to 12 carbons, and, is,
for example, lower arylene. There optionally can be inserted around the
arylene
group one or more oxygen, sulphur or substituted or unsubstituted nitrogen
atoms, where the nitrogen substituent is alkyl as previously described.
Exemplary arylene groups include 1,2-, 1,3- and 1,4-phenylene. The term
"lower arylene" refers to arylene groups having 5 or 6 carbons. Exemplary
arylene groups are lower arylene.
As used herein, "heteroary(ene" refers to a divalent monocyclic or
multicyclic aromatic ring system, such as of about 5 to about 15 members
where one or more, typically, for example, 1 to 3 of the atoms in the ring
system is a heteroatom, that is, an element other than carbon, for example,
nitrogen, oxygen and/or sulfur atom(s).
As used herein, "heterocyclylene" refers to a divalent monocyclic or
multicyclic non-aromatic ring system, generally of 3 to 10 members, such as,
for
example, 4 to 7 members or 5 to 6 members, where one or more, such as, for
example, 1 to 3 of the atoms in the ring system is a heteroatom, that is, an
element other than carbon, for example, nitrogen, oxygen and/or sulfur
atom(s).
As used herein, "substituted arylene," "substituted heteroarylene" and
"substituted heterocyclylene" refer to arylene, heteroarylene and
heterocyclylene
groups, respectively, that are substituted with one or more substituents, in
certain embodiments one to three substituents, independently selected from
alkyl, cycloalkyl, cycloalkylalkyl, aryl, heteroaryl optionally substituted
with 1 or
more, such as 1 to 3, substituents selected from halo, halo alkyl and alkyl,
aralkyl, heteroaralkyl, alkenyl containing 1 to 2 double bonds, alkynyl
containing
1 to 2 triple bonds, alk(en)(yn)yl groups, halo, pseudohalo, cyano, hydroxy,
haloalkyl and polyhaloalkyl, such as, halo lower alkyl, for example
trifluoromethyl, formyl, alkylcarbonyl, arylcarbonyl that optionally is
substituted
with 1 or more, such as 1 to 3, substituents selected from, for example, halo,
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-52-
halo alkyl and alkyl, heteroarylcarbonyl, carboxy, alkoxycarbonyl,
aryloxycarbonyl, aminocarbonyl, alkylaminocarbonyl, dialkylaminocarbonyl,
arylaminocarbonyl, diarylaminocarbonyl, aralkylaminocarbonyl, alkoxy, aryloxy,
perfluoroalkoxy, alkenyloxy, alkynyloxy, arylalkoxy, aminoalkyl,
alkylaminoalkyl,
dialkylaminoalkyl, arylaminoalkyl, amino, alkylamino, dialkylamino, arylamino,
alkylarylamino, alkylcarbonylamino, arylcarbonylamino, azido, nitro, mercapto,
alkylthio, arylthio, perfluoroaikylthio, thiocyano, isothiocyano,
alkylsulfinyl,
alkylsulfonyl, arylsulfinyl, arylsulfonyl, aminosulfonyl, alkylaminosulfonyl,
dialkylaminosulfonyl and arylaminosulfonyl.
As used herein, "alkylidene" refers to a divalent group, such as =CR'R",
which is attached to one atom of another group, forming a double bond.
Exemplary alkylidene groups are methylidene ( = CHI) and ethylidene ( =
CHCH3).
As used herein, "aralkylidene" refers to an alkylidene group in which either
R' or
R" is an aryl group. "Cycloalkylidene" groups are those where R' and R" are
linked to form a carbocyclic ring. "Heterocyclylidene" groups are those where
at
least one of R' and R" contain a heteroatom in the chain, and R' and R" are
linked to form a heterocyclic ring.
As used herein, "amido" refers to the divalent group -C(O)NH-.
"Thioamido" refers to the divalent group -C(S)NH-. "Oxyamido" refers to the
divalent group -OC(O)NH-. "Thiaamido" refers to the divalent group -SC(O)NH-.
"Difihiaamido" refers to the divalent group -SC(S)NH-. "Ureido" refers to the
divalent group -HNC(O)NH-. "Thioureido" refers to the divalent group -
HNC(S)NH-.
As used herein, "semicarbazide" refers to -NHC(O)NHNH-. "Carbazate"
refers to the divalent group -OC(O)NHNH-. "Isothiocarbazate" refers to the
divalent group -SC(O)NHNH-. "Thiocarbazate" refers to the divalent group -
OC(S)NHNH-. "Sulfonylhydrazide" refers to the group -S02NHNH-. "Hydrazide"
refers to the divalent group -C(O)NHNH-. "Azo" refers to the divalent group
-N=N-. "Hydrazinyl" refers to the divalent group -NH-NH-.
As used herein, the term "amino acid" refers to a-amino acids which are
racemic, or of either the D- or L-configuration. The designation "d" preceding
an
amino acid designation (e.g., dAla, dSer, dVal, etc.) refers to the D-isomer
of the
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-53-
amino acid. The designation "dl" preceding an amino acid designation (e.g.,
dlPip) refers to a mixture of the L- and D-isomers of the amino acid.
As used herein, when any particular group, such as phenyl or pyridyl, is
specified, this means that the group is unsubstituted or is substituted.
Exemplary substituents where not specified are halo, halo lower alkyl, and
lower
alkyl.
As used herein, the abbreviations for any protective groups, amino acids
and other compounds, are, unless indicated otherwise, in accord with their
common usage, recognized abbreviations, or the IUPAC-IUB Commission on
Biochemical Nomenclature (see, (1972) Biochem. 7 7:942-944).
As used herein, HHT and CHT refer to hexahydrotyrosyl (also known as
cyclohexyltyrosyl or p-hydroxycyclohexylalanyl), CHA is cyclohexylalanyl, Pyr
and pyroGlu refer to pyroglutamic acid, Pip is pipecolinic acid, Sar is
sarcosine,
nLeu and Nle are norleucine, nVal is norvaline, Aib is 2-aminoisobutyric acid,
Quat is (R)-Glu(a-(3-amidinobenzyl)), and Abu and But are 2-aminobutyric acid.
As used herein, PEG represents a polyethylene glycol containing
substituent having the designated number of ethyleneoxy subunits. Thus, the
term PEG(2) represents:
H3C ~O ~O
O
and the term PEG(6) represents:
.o~o~o~o~o
0
When R' and Rz are combined to form -(CH~)h , the cyclic moieties and
heteroatom-containing cyclic moieties so defined include, but are not limited
to:
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-54-
C .:,
' '
O S
O N
H
As
,S ~ N
O ~~ N ~ ~ used
O H O C O R4 herein,
the
term "hydroxylated" represents substitution on a substitutable carbon of the
ring
system being so described by a hydroxyl moiety. As used herein, the term "poly-
hydroxylated" represents substitution on two or more substitutable carbons of
the ring system being so described by 2, 3 or 4 hydroxyl moieties.
As used herein, the term "(d)(2,3-dihydroxypropionyl)" represents the
following structure:
O H
HO
O
40
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-55-
As used herein, the term "12R,3S)-2,3,4-trihydroxybutanoyl" represents
the following structure:
OH O
HO
OH
As used herein, the term "quinyl" represents the following structure:
HO O
H O ly,,
HOI~~
OH
2Q or a diastereomer thereof.
As used herein, the term "gulonyl" represents the following structure:
O
,l i
H O '
OOH
H O 1~~~1 O H
or a diastereomer thereof.
As used herein, the term "cotininyl" represents the following structure:
N
O
4o HsC-N
O
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-56-
or a diastereomer thereof.
As used herein, the term "gallyl" represents the following structure:
O
HO
HO
~5
OH
As used herein, the term "4-ethoxysquaryl" represents the following
structure:
Et0
O O
As used herein, 1-methylHis or (1 Me)H refers to the structure:
NON-Me
NH C(O)-~ .
As used herein, 3-methylHis or (3Me)H refers to the structure:
45
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-57-
Me ~ N ~ N As used herein, Quat2 refers to:
CN
NH C(O)~- COOMe
NH C(O)
Quat3 refers to:
NH
2o NH2
COOMe
~''
NH _C O
( )
Quat4 refers to:
Me
COOMe
i,
~ NH C(O)~-
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
_58_
and
Quat5 refers to:
Me
1 o COOH
i,
NH C(O)~--
Other abbreviations
as used herein
are as follows:
Abbreviation Refers to
Aib 2-aminoisobutyryl
4,4-dimethylThr 2-amino-3-hydroxy-4-methylpentanoyl
Met(OZ) methioninyl-S,S-dioxide
Ser(OMe) the O-methyl ether of serinyl, also known
as 2-
amino-3-methoxypropanoyl
hSer homoserinyl, also known as 2-amino-4-
hyd roxybutanoyl
(hS)Gly N-(2-hydroxyethyl)glycyl
N,N-dimethylGly N,N-dimethylglycyl
a-Ala 3-aminopropanoyl
Cys(Me) S-methylcysteinyl
t-butylGly 2-amino-3,3-dimethylbutanoyl
F(Gn) 4-guanidinylphenylalanyl
hCHA homocyclohexylalanyl, or 2-amino-4-
cyclohexylbutanoyl
hexylGly 2-aminooctanoyl
aIlyIGly 2-amino-4-pentenoyl
Inact. inactive
NT not tested
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-59-
Me0EtC0 3-methoxypropanoyl
3,4-MethyldioxyPhAc3,4-methylenedioxyphenylacetyl
L-3-PhLactyl L-2-hydroxy-3-phenylpropanoyl
MeOEtOCO 2-methoxyethoxycarbonyl
MeOCO methoxycarbonyl
Me0(EtO)2Ac 2-(2-methoxyethoxy)ethoxyacetyl
2-PyridylAc 2-pyridylacetyl
PhOAc phenoxyacetyl
MeOAc methoxyacetyl
PhAc phenylacetyl
MeOEtOAc 2-methoxyethoxyacetyl
HOOCButa glutaryl
Z benzyloxycarbonyl
EtOCO ethoxycarbonyl
~3A beta-alanyl or 3-aminopropanoyl
NapAc 1-naphthylacetyl
iBoc isobutoxycarbonyl
HOAc hydroxyacetyl
MeSucc 3-methoxycarbonylpropanoyl
Succ succinyl
HCO formyl
4-(guan)Phg 4-guanidinylphenylglycyl
Dox doxorubicin
Tax taxol
dA(Chx) or dCha d-cyclohexylalanyl
dhF d-homophenylalanyl
P(OH) 4-hydroxyprolyl
B. Protease targets
The conjugates herein
are designed to
target proteases
that are located
on cell surfaces, rly tumor cells and cells involved
particula in tumorigenic
processes and angiogenesis
and other proliferative
processes. The
conjugates,
described in detailcontain a peptidic substrate for a
below, selected targeted
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-60-
cell surface protease linked, either directly or via a linker, to a
therapeutic agent,
typically a cytotoxic agent, which is substantially inactive when in the
conjugate. The therapeutic agent is released in a form that is active or that
can
be activated in the vicinity of the targeted cell or tissue to which it is
delivered.
As a result, active therapeutic agent accumulates at the targeted cells or
tissue
or in the targeted cells.
The targeted protease is selected by identifying a protease that is located
on a cell or tissue (or associated therewith) that is involved in the disease
process or serendipitously present in the locale of cells or tissues involved
in the
disease or disease process, and, generally, is not located at all or present
or
active at lower levels, generally substaritially lower levels, or exhibits
altered
activity or specificity, on many, if not all, other cells or tissues. The
variety and
numbers of non-targeted cells or tissues that expresss the active protease
varies
for particular proteases and diseases intended for treatment. Those of skill
in
the art will select a target based upon the disease, targeted agents and
tolerable
or acceptable levels of side-effects. The goal is to achieve enhanced
therapeutic
index compared with administration of the targeted agent by itself.
The targeted protease may or may not be involved in the disease process
and its expression can be serendiptous; for purposes herein its particular
role or
lack thereof is not important; it is the fact that it is active in the locale
of
targeted tissues or cells that is important. For example, many of the cell
surface
proteases of interest herein are expressed or active on tumor cells or cells
involved in the tumorigenic processes. Any method known to one of skill in the
art for determining or detecting a tissue or cell expression profile can be
used.
For example, RNA blots composed of RNA from numerous tissues (e.g., a
multiple tissue expression (MTE) array available from CLONTECH, Palo Alto,
CA), can be screened with probes based upon the nucleic acid sequence of the
protease of interest to identify cells that express the protease. Northern
analysis of the blots to test for expression also can be used.
Included among the targeted proteases are those designated type II
membrane-bound serine proteases (MTSPs; see, e.g., U.S. application Serial No.
09/776,191, filed February 2, 2001 and International PCT application No.
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-61-
PCT/US01 /03471 published as International PCT application No. WO 01 /57194;
see International PCT application No. PCT/US02/07903; see, also U.S.
provisional application Serial Nos. 60/275,592, 60/278,166, 60/279,228,
60/291,001, 60/291,501 60/316,818, 60/302,939, 60/316,818, 60/328,529,
60/328,530, 60/332,015, 60/328,939, and provisional application, filed on
May 20, 2002 under attorney docket no. 24745-P1624; U.S. application Serial
Nos. 10/099,700, 10/104,271, 10/1 12,221, application filed on May 14, 2002
under attorney docket no. 24745-1616) and those found on endothelial cells
designated endotheliases (see, U.S. application Serial No. 09/717,473, filed
November 20, 2000, and International PCT application No. PCT/US00/31803
published as International PCT application No. WO 01 /36604); see, also SEQ ID
Nos. 3-26, 269-270 and 272-276.
Also contemplated are proteases that are located at the cell surface by
virtue of a specific interaction with a cell surface protein. Urokinase
plasminogen activator (u-PA) bound to urokinase plasminogen activator receptor
(u-PAR) is exemplary of such proteases. Nucleic acid sequence information and
expression profiles of exemplary MTSPs and endotheliases are as follows (see,
also EXAMPLE 6).
1. MTSPs
Cell surface proteolysis is a mechanism for the generation of biologically
active proteins that mediate a variety of cellular functions. These membrane-
anchored proteins, include a disintegrin-like and metalloproteinase (ADAM) and
membrane-type matrix metalloproteinase (MT-MMP). In addition to the MMPs,
serine proteases have been implicated in neoplastic disease progression. Most
serine proteases, which are either secreted enzymes or are sequestered in
cytoplasmic storage organelles, have roles in blood coagulation, wound
healing,
digestion, immune responses and tumor invasion and metastasis.
Transmembrane serine proteases (MTSPs) appear to be involved in the
etiology and pathogenesis of tumors. These enzymes are expressed in certain
cancerous and tumor cells and in other cells associated with other
proliferative
disorders and other disease states, such as in inflammatory cells and and can
be
tissue or organ-specific. In mammals, more than 20 members of the family are
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-62-
known (see, Hooper et al. (2001 ) J. Biol. Chem. 276:857-860, see, also U.S.
application Serial No. 09/776,191, filed February 2, 2001 and International
PCT
application No. PCT/US01 /03471; see, also U.S. provisional application Serial
Nos. 60/275,592 and 60/278,166; and see SEQ ID Nos. 1-37). These include
corin (accession nos. AF133845 and AB013874; see, Yan et al. (1999) J. Biol.
Chem. 274:14926-14938; Tomia et al. (1998) J. Biochem. 124:784-789; Uan
et al. (2000) Proc. Natl. Acad. Sci. U.S.A. 97:8525-8529); enterpeptidase
(also
designated enterokinase; accession no. 009860 for the human protein; see,
Kitamoto et al. (1995) Biochem. 27: 4562-4568; Yahagi et al. (1996) Biochem.
Biophys. Res. Common. 279:806-812; Kitamoto et al. (1994) Proc. Nat/. Acad.
Sci. U.S.A. 97:7588-7592; Matsushima et al. (1994) J. Biol. Chem.
269:19976-19982;); human airway trypsin-like protease (HAT; accession no.
AB002134; see Yamaoka et al. J. Biol. Chem. 273:1 1894-1 1901 ); MTSP1
(also called TADG-15 and matriptase, see SEQ ID Nos. 1 and 2; accession nos.
AF133086/AF1 18224, AF04280022; Takeuchi et al. (1999) Proc. Nat/. Acad.
Sci. U.S.A. 96:11054-1161; Lin et al. (1999) J. Biol. Chem. 274:18231-18236;
Takeuchi et al. (2000) J. Biol. Chem. 275:26333-26342; and Kim et al. ( 1999)
lmmunogenetics 49:420-429); hepsin (see, accession nos. M 18930,
AF030065, X70900; Leytus et al. (1988) Biochem. 27: 1 1895-1 1901; Vu et
a/. (1997) J. Biol. Chem. 272:31315-31320; and Farley et al. (1993) Biochem.
Biophys. Acta 7773:350-352; and see, U.S. Patent No. 5,972,616); TMPRS2
(see, Accession Nos. 075329 and AF1 13596; Paoloni-Giacobino et al. (1997)
Genomics 44:309-320; and Jacquinet et al. (2000) FEBS Lett. 468: 93-100);
and TMPRSS4 (see, Accession No. NM 016425; Wallrapp et al. (2000) Dancer
60:2602-2606). Also known MTSP3, MTSP4, MTSP6, MTSP7, MTSP9,
MTSP10, MTSP12, MTSP20, MTSP22 and MTSP25 (see, SEQ ID NOs. 3-26,
269-270 and 272-276; see, also U.S. application Serial No. 09/776,191, filed
February 2, 2001 and International PCT application No. PCT/US01 /03471
published as International PCT application No. WO 01 /57194; see International
PCT application No. PCT/US02/07903; see, also U.S. provisional application
Serial Nos. 60/275,592, 60/278,166, 60/279,228, 60/291,001, 60/291,501
60/316,818, 60/302,939, 60/316,818, 60/328,529, 60/328,530,
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-63-
60/332,015, 60/328,939, and provisional application, filed on May 20 2002,
under attorney docket no. 24745-P1624; U.S. application Serial Nos.
10/099,700, 10/104,271, 10/1 12,221, application filed on May 14, 2002
under attorney docket no. 24745-1616)).
Serine proteases, including transmembrane serine proteases, have been
implicated in processes involved in neoplastic development and progression.
While the precise role of these proteases has not been elaborated, serine
proteases and inhibitors thereof are involved in the control of many intra-
and
extracellular physiological processes, including degradative actions in cancer
cell
invasion, metastatic spread, and neovascularization of tumors, that are
involved
in tumor progression. It is believed that proteases are involved in the
degradation of extracellular matrix (ECM) and contribute to tissue remodeling,
and are necessary for cancer invasion and metastasis. The activity and/or
expression of some proteases have been shown to correlate with tumor
progression and development, and also are shown to be active in specific cell
types.
For example, a membrane-type serine protease MTSP1 (also called
matriptase; see SEQ ID Nos. 1 and 2 from U.S. Patent No. 5,972,616; and
GenBank Accession No. AF118224; (1999) J. Biol. Chem. 274:18231-18236;
U.S. Patent No. 5,792,616; see, also Takeuchi (1999) Proc. Nat/. Acad. Sci.
U.S.A. 96:1 1054-1 161 ) that is expressed in epithelial cancer and normal
tissue
(Takeucuhi et al. (1999) Proc. Nat/. Acad. Sci. USA 96:1 1054-61 ) has been
identified. It has been proposed that it plays a role in the metastasis of
breast
cancer. Its primary cleavage specificity is Arg-Lys residues. Matriptase also
is
expressed in a variety of epithelial tissues with high levels of activity
and/or
expression in the human gastrointestinal tract and the prostate.
Hepsin, a cell surface serine protease identified in hepatoma cells, is
overexpressed in ovarian cancer (Tanimoto et al. (1997) Cancer Res.,
57:2884-7). The hepsin transcript appears to be abundant in carcinoma tissue
and is almost never expressed in normal adult tissue, including normal ovary.
It
has been suggested that hepsin is frequently overexpressed in ovarian tumors
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-64-
and therefore can be a candidate protease in the invasive process and growth
capacity of ovarian tumor cells.
A serine protease-like gene, designated normal epithelial cell-specific 1
(NES1 ) (Liu et al. (1996) cancer Res. 56:3371-9) has been identified.
Although
expression of the NES1 mRNA is observed in all normal and immortalized
nontumorigenic epithelial cell lines, the majority of human breast cancer cell
lines
show a drastic reduction or a complete lack of its expression. The structural
similarity of NES1 to polypeptides known to regulate growth factor activity
and
a negative correlation of NES1 expression with breast oncogenesis suggest a
direct or indirect role for this protease-like gene product in the suppression
of
tumorigenesis.
Exemplary MTSPs
Each MTSP has a characteristic tissue expression profile; the MTSPs in
particular, although not exclusively expressed or activated in tumors, exhibit
characteristic tumor tissue expression or activation profiles. In some
instances,
MTSPs can have different activity in a tumor cell from a non-tumor cell by
virtue
of a change in a substrate or cofactor therefor or other factor that would
alter
functional activity of the MTSP. Hence each can serve as a diagnostic marker
for particular tumors, by virtue of a level of activity and/or expression or
function in a subject (i.e, a mammal, particularly a human) with neoplastic
disease, compared to a subject or subjects that do not have the neoplastic
disease. In addition, detection of activity (and/or expression) in a
particular
tissue can be indicative of neoplastic disease. Also, by virtue of the
activity
and/or expression profiles of each, they can serve as therapeutic targets,
such
as by administration of modulators of the activity thereof, or, as by
administration of a prodrug specifically activated by one of the MTSPs. Each
or
any of the MTSPs can exhibit activity or expression levels or substrate
specificities that differ in tumor cells from the levels in normal cells. Such
tumor
cells include, but are not limited to, colon, lung, prostate, breast,
esophagous,
pancreas, cervic, uterus, endometrium, and other solid tumors and in blood and
lymphatic tumors. Hence, conjugates provided herein can be designed by
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-65-
selection of substrafie specificity for treatment of any of such tumors and
neoplastic conditions.
Tissue expression profiles
The following are exemplary tissue and gene (see also, EXAMPLE 8)
profiles of some exemplary MTSPs. These profiles are not intended to define
the full scope of expression or activation of these MTPSs, but demonstrate
that
MTSPs are expressed in tumors, and, hence there expression or activation or
substrate specificity on the surface of tumor cells can be exploited in the
methods herein and conjugates, designed in accord with the methods herein and
as exemplified herein, that are cleaved by one or more of these MTSPs can be
prepared and employed for treatment of neoplastic or other diseases or
conditions or to target to cells that express these proteins on there
surfaces.
MTSP1 (matriptase)
MTSP1 (also called matriptase) is a trypsin-like serine protease with
broad spectrum cleavage activity and two potential regulatory modules. It was
named "matriptase" based on its ability to degrade the extra-cellular matrix
and
its trypsin-like activity. When isolated from breast cancer cells (or T-47D
cell
conditioned medium), MTSP1 has been reported to be primarily in an
uncomplexed form. MTSP1 has been isolated from human milk; when isolated
from human milk, it was reported to be in one of two complexed forms, 95 kDa
(the predominant form) and 1 10 kDa; uncomplexed MTSP1 was not detected
(Liu, et al. (1999) J. Biol. Chem. 274:18237-18242). It has been proposed that
MTSP1 exists as an uncomplexed protease when in its active state. In breast
milk, it has been reported to exist in complex with a fragment of hepatocyte
growth factor inhibitor-1 (HAI-1 ), a Kunitz-type serine protease inhibitor
having
activity against trypsin-like serine proteases.
Nucleic acids encoding the protein designed matriptase were cloned from
T-47D human breast cancer cell-conditioned medium (Lin et al. (1999) J. Biol.
Chem. 274:18231-18236). Upon analysis of the cDNA, it was determined that
the full length protease has 683 amino acids and contains three main
structural
regions: a serine protease domain near the carboxyl-terminal region, four
tandem low-density lipoprotein receptor domains, and two tandem complement
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-66-
subcomponents C 1 r and C 1 s (see SEQ ID No. 1 ). Studies to identify
additional
serine proteases made by cancer cells were done using PC-3 cells. A serine
protease termed "MT-SP1 " (MTSP1 ) by the authors, reported to be a
transmembrane protease was cloned (Takeuchi et al. ( 1999) Proc. Nat/. Acad.
Sci. U.S.A. 96:1 1054-1 1061 ). It was subsequently found that originally
identified matriptase sequence is included in the translated sequence of the
cDNA that encodes MTSP1. The nucleic acid encoding the protein originally
designated matriptase is a partial MTSP1 clone that lacks 516 of the coding
nucleotides (Takeuchi, et al., J. Biol. Chem 275:26333-26342 (2000).) Since
the reported matriptase encoding cDNA sequence encoded a possible initiating
methionine, it was proposed that alternative splicing could yield a protein
lacking
the N-terminal region of MTSP1. Hence, matriptase herein is a variant form of
MTSP1 .
MTSP1 demonstrates trypsin-like protease activity and is a Type II
transmembrane protein with an extracellular protease domain. Studies of
substrate specificity of MTSP1 reveal that protease-activated receptor 2
(PAR2),
pro-hepatacyte growth factor (pro-HGF) and single-chain urokinase-type
plasminogen activator (sc-uPA) are macromolecular substrates of MTSP1. PAR2
functions in inflammation, cytoprotection and/or cell adhesion, while sc-uPa
functions in tumor cell invasion and metastasis. HGF serves a growth and pro-
angiogenic factor.
An exemplary nucleotide sequence encoding a human MTSP1 is set forth
in SEQ ID Nos 1 and 2. As previously noted SEQ ID No. 1 sets for an MTSP1-
encoding nucleic acid sequence. This sequence is the longer version and
includes the protease domain, which is common to both variants.
MTSP1 is expressed in breast, prostate and colorectal tumors. Hence
conjugates with substrates therefor can be used for treatment of such tumors.
MTSP3
The MTSP3 transcript was detected in lung carcinoma (LX-1 ), colon
adenocarcinoma (CX-1 ), colon adenocarcinoma (GI-1 12) and ovarian carcinoma
(GI-102). No apparent signal was detected in another form of lung carcinoma
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-67-
(GI-1 17), breast carcinoma (GI-101 ), pancreatic adenocarcinoma (GI-103) and
prostatic adenocarcinoma (PC3).
MTSP4
The MTSP4 transcript, a DNA fragment encoding part of the LDL receptor
domain and the protease domain was used to probe an RNA blot composed of
76 different human tissues (catalog number 7775-1; human multiple tissue
expression (MTE) array; CLONTECH). As in the northern analysis of gel blot, a
very strong signal was observed in the liver. Signals in other tissues were
observed in (decreasing signal level): fetal liver > heart = kidney = adrenal
gland = testis = fetal heart and kidney = skeletal muscle = bladder =
placenta > brain = spinal cord = colon = stomach = spleen = lymph node =
bone marrow = trachea = uterus = pancreas = salivary gland = mammary
gland = lung. MTSP4 also is expressed less abundantly in several tumor cell
lines including HeLa S3 = leukemia IC-562 = Burkitt's lymphomas (Raji and
Daudi) = colorectal adenocarcinoma (SW480) > lung carcinoma (A549) _
leukemia MOLT-4 = leukemia HL-60. PCR of the MTSP4 transcript from cDNA
libraries made from several human primary tumors xenografted in nude mice
(human tumor multiple tissue cDNA panel, catalog number K1522-1,
CLONTECH) was performed using MTSP4-specific primers. The MTSP4
transcript was detected in breast carcinoma (GI-101 ), lung carcinoma (LX-1 ),
colon adenocarcinoma (Gi-1 12) and pancreatic adenocarcinoma (GI-103). No
apparent signal was detected in another form of lung carcinoma (GI-117), colon
adenocarcinoma (CX-1 ), ovarian carcinoma (Gi-102). and prostatic
adenocarcinoma (PC3). The MTSP4 transcript was also detected in LNCaP and
PC-3 prostate cancer cell lines as well as in HT-1080 human fibrosarcoma cell
line.
MTSP6
MTSP6 is expressed at high levels in the colon. It also is expressd in the,
stomach, trachea, mammary gland, thyroid gland, salivary gland, pituitary
gland
and pancreas. It is expressed at lower levels in other tissues (see EXAMPLE
6).
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-68-
MTSP6 also is expressed in several tumor cell lines including HeLa S3 >
colorectal adenocarcinoma (SW480) > leukemia MOLT-4 > leukemia K-562. In
mouse xenograft models, the MTSP6 transcript was strongly detected in lung
carcinoma (LX-1 ), moderately detected in pancreatic adenocarcinoma (GI-103),
weakly detected in ovarian carcinoma (GI-102); and weakly detected in colon
adenocarcinoma (GI-1 12 and CX-1 ), breast carcinoma (GI-101 ), lung carcinoma
(GI-117) and prostatic adenocarcinoma (PC3). The MTSP6 transcript was also
detected in breast cancer cell line MDA-MB-231, prostate cancer cell line PC-
3,
but not in HT-1080 human fibrosarcoma cell line. MTSP6 also is expressed in
mammary gland carcinoma cDNA (Clontech). MTSP6 also is over expressed in
ovarian tumor cells.
MTSP7
The MTSP7 transcript was detected in lung carcinoma (A549 cell line),
leukemia (K-562 cell line) and cervical carcinoma (HeLaS3 cell line). MTSP7 is
believed to be expressed in lung, colon, prostate, breast, cervical and other
tumors.
MTSP9
MTSP9 is, for example, expressed in esophageal tumor tissues, in lung
carcinoma, in colorectal carcinoma, lymphoma, a cervical carcinoma (HeLaS3)
and leukemia cell lines as well as in certain normal cells and tissues. MTSP9
also can be a marker for breast, prostate, cervical and colon cancer.
MTSP9 is highly expressed in the esophagus and expressed at a low level
in many other tissues. The MTSP9 transcript is found in kidney (adult and
fetal), spleen (adult and fetal), placenta, liver (adult and fetal), thymus,
peripheral blood leukocyte, lung (adult and fetal), pancreas, lymph node, bone
marrow, trachea, uterus, prostate, testes, ovary and the gland organs
(mammary, adrenal, thyroid, pituitary and salivary). MTSP9 also is expressed
in
esophagus tumor tissues, in a lung carcinoma and, at a lower level, in a
colorectal carcinoma, lymphoma, a cervical carcinoma (HeLaS3) and leukemia
cell lines.
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-69-
MTSP10
MTSP10, for example, is expressed in esophageal tumor tissues, in lung
carcinoma, prostate cancers, pancreatic and breast cancers and in cell lines
as
well as in certain normal cells and tissues (see e.g., EXAMPLES for tissue-
s specific expression profile). The level of activated MTSP10 can be
diagnostic of
prostate, uterine, lung esophagus, or colon cancer or leukemia or other
cancer.
The expression and/or activation of MTSP10 on or in the vicinity of a cell or
in a
bodily fluid in a subject can be a marker for breast, prostate, lung, colon,
esophageal and other cancers.
MTSP10 transcript was detected in pancreas, lung and kidney. MTSP10
transcript was also detected in small intestine Marathon-Ready cDNA
(Clontech).
The MTSP10 transcript was detected in breast carcinoma (GI-101 ), lung
carcinoma (LX-1 and GI-1 17), ovarian carcinoma (GI-102), and pancreatic
adenocarcinoma (GI-103). The MTSP10 transcript was weakly detected in
prostatic adenocarcinoma (PC3). The MTSP10 transcript was also detected in
CWR22R prostate tumor grown in nude mice. No apparent signal was detected
in two forms of colon adenocarcinomas (GI-1 12 and CX-1 ).
MTSP12
MTSP12 transcript was detected in pancreas, lung and kidney. MTSP12
transcript was also detected in small intestine Marathon-Ready cDNA
(Clontech).
The MTSP12 transcript was detected in breast carcinoma (Gl-101 ), lung
carcinoma (LX-1 and GI-117), ovarian carcinoma (GI-102), and pancreatic
adenocarcinoma (GI-103). The MTSP12 transcript was weakly detected in
prostatic adenocarcinoma (PC3). The MTSP12 transcript was also detected in
CWR22R prostate tumor grown on nude mice. No apparent signal was detected
in two forms of colon adenocarcinomas (GI-1 12 and CX-1 ).
MTSP20
MTSP20 is expressed in the lung, colon, cervical tumors and in leukemic
cells. it may also be expressed in breast, ovarian, pancreatic, prostate and
in
other tumors. MTSP20 transcript was detected in liver, lymph node,
cerebellum, pancreas, prostate, uterus, tesfiis, glands (adrenal, thyroid and
salivary), thymus, kidney and spleen. Lower transcript level was found in
lung,
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-70-
placenta, bladder, ovary, digestive system, circulatory system and other parts
of
the the brain. MTSP20 is also expressed in certain tumor cell lines including
Jung carcinoma (A519), colorectal carcinoma (SW480), lymphoma (Raji and
Daudi), cervical carcinoma (HeLaS3) and leukemia (HL-60, K-562 and MOLT-4)
cell lines.
MTSP22
MTSP22 is expressed in the uterine tissue, thymus, adipose tissue, and
lymph node. It may also be expressed in lung, stomach, uterine, breast,
ovarian, prostate and in other tumors.MTSP22 transcript was detected in some
uterus tissue samples, but not in their matched tumor samples. In one of 42
uterus samples, MTSP22 is expressed in tumor and its metastatic tissues, but
not in the normal tissue counterpart. MTSP22 is also expressed in some
stomach tumors and lung tumors, but not in their normal tissue counterparts.
MTSP22 is also expressed in the normal tissue of a pancreas matched cDNA
pair. MTSP22-encoding cDNA was detected in thymus, adipose tissue, and
lymph node
MTSP25
MTSP25 is expressed in breast, colon, uterine, ovarian, kidney, prostate,
testicular cancer tissue. It may also be expressed in lung, stomach, prostate
and in other tumors. MTSP25 transcript was expressed weakly in the lymph
node. In the cancer profiling array analysis, MTSP25 is highly expressed in
prostate samples (in normal and cancer samples). MTSP25 was highly
expressed in a kidney tumor sample, but not in its normal tissue counterpart.
MTSP25 was also expressed a breast cancer samples, but not in its normal
tissue counterpart. MTSP25 was expressed in normal uterus samples, but not
in their tumor counterparts. MTSP25 expression was also ovarian cancer
samples. Among these three samples, the expression of MTSP25 was also
detected in one of the matched normal tissue counterparts. MTSP25 expression
was also detected in tumor samples in colon cDNA pairs.
PCR analysis revealed that MTSP25 cDNA was strongly detected in testis
and mammary gland adenocarcinoma, weakly detected in brain, placenta, lung,
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-71-
spleen, prostate, small intestine, colon, and leukocyte, and very weakly
detected
in heart, liver and pancreas.
2. Endotheliases
Endotheliases are a class of cell surface proteases that are expressed on
cells, particularly endothelial cells, particularly those proliferating
endothelial
cells, which are involved in a variety of proliferative processes, including
undesirable angiogenesis associated with tumor growth and metastasis, and
with other hyperproliferative disorders, such as restenosis, scarring,
diabetic
retinopathies, diseases and disorders of the anterior eye (see, U.S.
application
Serial No. 09/717,473, filed November 20, 2000, and International PCT
application No. PCT/US00/31803),
Proliferative diseases
Endotheliases are particularly useful targets for delivery of therapeutic
agents for treatment of any disorder involving aberrant angiogenesis.
Endothelial cells play a key role in angiogenesis, which is
is the generation of new blood vessels from parent microvessels. Angiogenesis
plays a major role in the metastasis of cancer and in the pathology of a
variety
of other disorders.
Controlled and uncontrolled angiogenesis proceed in a similar manner.
Endothelial cells and pericytes, surrounded by a basement membrane, form
capillary blood vessels. Angiogenesis begins with the erosion of the basement
membrane by enzymes released by endothelial cells and leukocytes. The
endothelial cells, which line the lumen of blood vessels, then protrude
through
the basement membrane. Angiogenic stimulants induce the endothelial cells to
migrate through the eroded basement membrane. The migrating cells form a
"sprout" off the parent blood vessel, where the endothelial cells undergo
mitosis
and proliferate. The endothelial sprouts merge with each other to form
capillary
loops, creating the new blood vessel.
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-72-
Angiogenesis, modulators and associated diseases
Angiogenesis is highly regulated by a system of angiogenic stimulators
and inhibitors. Known examples of angiogenesis stimulators include certain
growth factors, cytokines, proteins, peptides, carbohydrates and lipids
(Norrby
( 1997) APMlS 705:417-437); Polverini ( 1995) Crit. Rev. Oral. Biol. Med.
6:230-
247). A variety of endogenous and exogenous angiogenesis inhibitors are
known in the art (Jackson et al. (1997) FASEB 7 7:457-465; Norrby (1997)
APMlS X05:417-437); and O'Reilly (1997) lnvestigational New Drugs, 15:5-13).
Angiogenesis is essential for normal placental, embryonic, fetal and post-
natal development and growth, but almost never occurs physiologically in
adulthood except in very specific restricted situations. For example,
angiogenesis is normally observed in wound healing, fetal and embryonal
development and formation of the corpus luteum, endometrium and placenta.
Angiogenesis in the adult is often associated with disease states.
Persistent, unregulated angiogenesis occurs in a multiplicity of disease
states, tumor metastasis and abnormal growth by endothelial cells and supports
the pathological damage seen in these conditions. The diverse pathological
disease states in which unregulated angiogenesis is present have been grouped
together as angiogenic dependent or angiogenic associated diseases.
The control of angiogenesis is altered in certain disease states and, in
many cases, the pathological damage associated with the disease is related to
uncontrolled angiogenesis (see generally, Norrby (1997) APMlS 705:417-437);
and O'Reilly (1997) lnvestigational Nevv Drugs 75:5-13). Thus, angiogenesis is
involved in the manifestation or progress of various diseases, for example,
various inflammatory diseases, such as rheumatoid arthritis, psoriasis,
diabetic
retinopathies, certain ocular disorders, including recurrence of pterygii,
scarring
excimer laser surgery and glaucoma filtering surgery, various disorders of the
anterior eye, cardiovascular disorders, chronic inflammatory diseases, wound
repair, circulatory disorders, crest syndromes, dermatological disorders (see,
e.g., U.S. Patent Nos. 5,593,990, 5,629,327 and 5,712,291 ) and notably
cancer, including solid neoplasms and vascular tumors. Angiogenesis is
essential for the growth and persistence of solid tumors and their metastases.
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-73-
Repressing, eliminating or modulating this activity, should impact the
etiology of
these diseases and serve as a point of therapeutic intervention. In the
disease
state, prevention of angiogenesis could avert the damage caused by the
invasion
of the new microvascular system. Therapies directed at control of the
angiogenic processes could lead to the abrogation or mitigation of these
diseases. Hence there is a need to develop therapeutics that target
angiogenesis and modulate, particularly, inhibit aberrant or uncontrolled
angiogenesis.
Hence conjugates that contain endotheliase substrates can be used to
deliver therapeutic agents for the treatment of diseases including, but are
not
limited to, rheumatoid arthritis, psoriasis, diabetic retinopathies, other
ocular
disorders, including recurrence of pterygii, scarring from excimer laser
surgery
and glaucoma filtering surgery, various disorders of the anterior eye,
cardiovascular disorders, autoimmune diseases, chronic inflammatory diseases,
wounds, circulatory disorders, crest syndromes, restenosis, psoriasis and
other
dermatological disorders (see, e.g., U.S. Patent Nos. 5,593,990, 5,629,327
and 5,712,291 ) and notably cancer, including solid neoplasms and vascular
tumors.
Endotheliases 1 and 2
Exemplary of endotheliases are two different endotheliases and variant
forms thereof designated endotheliase 1 and endotheliase 2 (see SEQ ID Nos.
21-27. Other members of the family can be identified by probing for genes or
searching libraries for genes that have sequence identity, particularly at
least
40%, 60%, 80%, 90%, 95%, 98% or greater sequence identity to the protease
domain of an endotheliase identified herein, or that hybridize under
conditions of
high stringency to the full-length of the nucleic acid encoding a protease
domain
of an endotheliase provided herein, and that are expressed on endothelial
cells.
Alternatively, and as a way of identifying endotheliases that can have
tower sequence identity, an endotheliase can be identified by the methods,
such
by identifying ESTs or other nucleic acid fragments that have sequences
similar
to a protease and then using such fragments as probes to identify and select
cDNA clones encoding full-length proteases or protease domains thereof,
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-74-
identifying those that have the characteristics of transmembrane proteins, and
then determining the gene expression profile to identify those that are
expressed
on the surface of endothelial cells. Encoded proteins that have protease
activity,
that include a transmembrane domain and an extracellular domain, and that are
expressed in endothelial cells are endotheliases. Any method for
identification
of genes encoding proteins (or proteins) that encode a transmembrane protease
expressed on an endothelial cell is contemplated herein.
Endotheliase 1
Exemplary of the endotheliase are endotheliase 1 and endotheliase 2.
These are expressed on endothelial cells. Exemplary of a full-length
endotheliase
1 is one that includes the sequence of amino acids set forth in SEQ ID No. 42
(see, International PCT application No. WO 00/5006, which describes a gene it
designates DESC1 that is expressed in squamous cell carcinomas and prostate
tumors). As noted endotheliases are expressed on endothelial cells. A protease
domain thereof is set forth in SEQ ID NO: 22.
Expression profile of endotheliase 1
To obtain information regarding the tissue distribution of endotheliase 1,
the DNA insert of clone H117 was used to probe an RNA blot composed of 76
different human tissues (catalog number 7775-1; human multiple tissue
expression (MTE) array; CLONTECH, Palo Alto, CA). Significant expression was
observed in the esophagus, with minor expression levels in the stomach,
salivary
gland, pancreas, prostate, bladder, trachea and uterus. Northern analysis
using
RNA blots (catalog numbers 7765-1 & 7782-1; human muscle and digestive
system multiple tissue northern (MTN) blots; CLONTECH) confirmed that the
expression was restricted to the esophagus. Two transcripts (approximately 1.7
and 2 kb) were detected in the esophagus. Endotheliase 1 also is expressed in
umbilical vein endothelial cells, PC3 and LnCAP cells.
Endothetiase 2 and nucleic acids encoding endotheliase 2
Two splice variant forms of endotheliase 2 designated endotheliase 2-S
and endotheliase 2-L are exemplified herein (see SEQ ID Nos. 23-26). The open
reading frame of the nucleic acid encoding endotheliase 2-S (SEQ ID No. 23) is
composed of 1,689 bp, which translates to a 562-amino acid protein (SEQ ID
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-75-
No. 24), while the ORF of endotheliase 2-L is composed of 2,067 by (SEQ ID
No. 25), which translates to a 688-amino acid protein (SEQ iD No. 26).
The nucleic acid encoding the protease domain of endotheliase 2-S is
composed of 729 by which translates to a 242-amino acid protein (amino acids
321-562 of SEQ ID Nos. 23 and 24), while that of endotheliase 2-L is composed
of 1,107 bp, which translates to a 368-amino acid protein (amino acids 321-688
of SEQ ID Nos. 25 and 26).
Endotheliase-2 proteins
Any and all of the above-noted endotheliases and/or protease domains
thereof, such as those that include the sequences of amino acids in SEQ ID
Nos.
22, 24, 26 and 27 or are encoded by nucleic acid that hybridize thereto under
the conditions as described above are contemplated for use in the methods
herein. Also contemplated herein are proteins that include amino acid sequence
changes, such as those set forth in Table 1 above, and retain protease
activity.
Gene expression profile and transcript size of endotheliase
2 in normal and tumor tissues
In addition to expression in endothelial cells, endotheliase 2 is expressed
in placenta, pancreas, thyroid gland, liver and lung tissues. It also is
expressed
at lower levels in mammary gland, salivary gland, kidney, trachea, esophagus,
appendix, heart and fetal lung. Endotheliase 2 also is expressed in several
tumor
cell lines and, hence, in certain tumors, including lung and colon, including
breast carcinoma, lung carcinomas, colon adenocarcinomas, pancreatic
adenocarcinoma (GI-103), and ovarian carcinoma. It has also been detected in
prostate and fibrosarcoma cell lines.
C. Conjugates
Conjugates that are substrates for proteases on the surfaces of cells,
particularly serine proteases, including type II membrane-bound serine
proteases,
and endotheliases are provided. Any cell surface protease, including cell-
associated or localized proteases, is contemplated herein. Generally proteases
expressed at high levels in active forms in essential tissues are not ideal
target
candidates. The proteases include those that are expressed on relatively
limited
numbers of cells or that are expressed at high levels in cells, such as tumor
cells
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-76-
and endothelial cells and immune cells, that are involved in disease states or
are
present in diseases states in the locale of cells involved in the disease
states.
For example, endothelial cells by virtue of their role in angiogenesis are
involved
in numerous proliferative disorders; immune cells are involved in many disease
processes including cancers and diseases and inflammatory disorders. Other
cell
surface proteases are expressed at higher levels in certain tumors than in
normal
. cells. Whether or not such proteases have a role in the disorder their
higher
expression in cells involved in a disease state is sufficient for use for
targeting
therapeutic agents in the conjugates provided herein.
The conjugates, which contain a therapeutic agent, such as a cytotoxic
agent, is activated upon cleavage by a cell surface protease, including cell-
associated and cell-localized proteses. Exemplary of such proteases are the
MTSPs, such as, but not limited to, MTSP1, MTSP3, MTsP4, MTSP6, MTSP7,
MTSP9, MTSP10, MTSP12, MTSP20, MTSP22, MTSP25, urokinases and
endotheliases. Hence, the conjugates targeted to such proteases are prodrugs
in
that the therapeutic agent is inactive as administered and is ultimately
activated
in the vicinity of the targeted cell or tissue. Although cell surface
proteases,
such as transmembrane proteases, are the intended targets, any released, shed
or soluble forms of the proteases and others also can be targeted.
Thus, the conjugates, which contain a therapeutic agent, such as a
cytotoxic agent, are substantially inactive prior to action by a cell surface
protease, a peptidic moiety that is a substrate for a targeted cell surface
protease (i.e., a peptidic substrate), and, optionally, a linker. The
therapeutic
agents in the conjugates are activated upon cleavage of the peptidic substrate
of
the conjugate by a cell surface protease. The therapeutic agents, such as
cytotoxic agents, are released as the free yagent, or, alternatively, are
released
coupled to the portion of the peptidic substrate (P1-P2-P3-etc. (i.e., the N-
terminus) or P1'-P2'-etc. (i.e., the C-terminus) that the agents were linked
to in
the conjugate, optionally via a linker. The cytotoxic agents, in these forms,
are
released in the vicinity of cells that express the proteases. Activation is
effected, in certain embodiments, because the therapeutic agent, such as
cytotoxic agent, following action of the cell surface protease, can cross the
cell
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-77_
membrane or otherwise interact with the cell or tissue and exhibit therapeutic
activity. In other embodiments, any remaining peptidic moieties or amino acids
can be cleaved from therapeutic agent to render it active. The conjugates act
as
prod rugs because the therapeutic agents when conjugated are substantially
inactive. Upon cleavage by the targeted protease, the therapeutic agent is
released either in active form or in a form that is activated by the targeted
cell,
tissue or surrounding environment.
In one exemplary embodiment, the targeted agent is a cytotoxic agent
and the conjugates for use in the methods and compositions provided herein
have the formula:
(peptide')S (linker)q (cytotoxic agent)t
or a derivative thereof, where peptide' is a peptidic substrate for a cell
surface
protease or a released, shed or otherwise unbound membrane protease, such as
an MTSP; s is greater than or equal to 1, or is 1 to 6, or is 1 or 2, or is 1;
linker
is any linker; q is greater than or equal to 0, or is 0 to 4, or is 0 or 1;
the
cytotoxic agent is an anti-tumor, anti-cancer or anti mitotic agent, including
anti-
antiangiogenic agents; and t is 1 or more, or is 1 or 2. In these conjugates,
the
cytotoxic agent is covalently attached, optionally via a linker, to either the
C-
terminus or the N-terminus of the peptidic substrate. In embodiments where the
therapeutic agent, such as a cytotoxic agent, is attached to the C-terminus of
the peptidic substrate, the N-terminus optionally is capped. N-Terminal caps
for
use herein include, but are not limited to, acyl, sulfonyl and carbamoyl
groups.
In embodiments where the therapeutic agent is attached to the N-terminus of
the peptidic substrate, the C-terminus is a carboxamide derivative.
In certain embodiments, peptide' is a peptidic substrate for a cell surface
protease or a soluble MTSP whereby, upon action of the protease, the
conjugate, which is substantially inactive, is cleaved at the P1-P1' bond to
release a compound of the formula:
(peptidea)S (linker)q (therapeutic agent)t
or a derivative thereof, that exhibits therapeutic activity, such as cytotoxic
activity in vitro and in vivo. In these compounds, peptides is a truncated
version
of peptide' resulting from cleavage at the P1-P1' bond.
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
_78_
In another embodiment, the conjugates for use in the methods and
compositions provided herein possess two therapeutic agents, such as cytotoxic
agents, which are the same or different, linked to the C-terminus and the N-
terminus, respectively, optionally via linkers linker' and linker, of a
peptidic
substrate for cell surface protease or a soluble MTSP. In this embodiment, the
conjugates have the formula:
(therapeutic agent')X (linker')W-(peptide')S-(linker2)q-(therapeutic agent2lt
or a derivative thereof, where peptide' is a peptidic substrate for a cell
surface
protease, or a soluble MTSP; s is greater than or equal to 1, or is 1 to 6, or
is 1
or 2, or is 1; linker' and linkers are each independently any linker and are
the
same or different; q and w are each independently greater than or equal to 0,
or
are 0 to 4, or are 0 or 1; the therapeutic agents, which are the same or
different, are anti-tumor, anti-cancer or anti mitotic agents; and t and x are
each'
independently 1 or more, or are 1 or 2.
In these embodiments, peptide' is a peptidic substrate for a cell surface
protease or a soluble MTSP whereby, upon action of the protease, the
conjugate, which is substantially inactive, is cleaved at a point on the
peptidic
chain to release two compounds of the formulae:
(therapeutic agent')x (linker')W-(peptidea')S; and
(peptidea~)S-(linker2)q-(therapeutic agent~)t
or derivatives thereof. The released therapeutic agents are active or are
further
activated by the cell, tissue or surrounding environment. In these compounds,
peptides' and peptidea2 are N-terminal and C-terminal truncated portions,
respectively, of peptide' resulting from cleavage at the P1-P1' bond.
In one embodiment, the conjugates for use in the compositions and
methods provided herein have formula I:
X"-(P6)m (P5)p (P4); (P3); (P2),-P1-IP1 ~)~-(P2')k (P3')~ (L)~ Z
or a derivative thereof, where Z is a therapeutic agent; L is a linker; f, j,
i, p and
m are selected as follows:
I is 0 or 1; when I is 0, j, i, p and m are 0; when I is 1, j is 0 or 1; when
j
is 0, i, p and m are 0; when j is 1, i is 0 or 1; when i is 0, p and m are 0;
when i
is 1, p is 0 or 1; when p is 0, m is 0; when p is 1, m is 0 or 1;
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
_7g_
u, k and r are selected as follows:
a is 0 or 1; when a is 0, k and r are 0; when a is 1, k is 0 or 1; when k is
0, r is 0; when k is 1, r is 0 or 1;
n is 0 or 1; X" is hydrogen, or an acyl, sulfonyl or carbamoyl cap; and P6
to P3' are amino acid residues, as defined below. In this embodiment, the P6
to
P3' residues are linked by peptide bonds or peptide bond surrogates. Thus, the
P6 to P3' portion of the conjugate is a peptidic substrate, as defined herein.
In another embodiment, the conjugates for use in the compositions and
methods provided herein have formula II:
Z-(L)~ (P6)m (P5)p (P4).,-(P3)~ (P2),-P1-(P1')~ (P2')k (P3')~ X
or a derivative thereof, where Z is a therapeutic agent; L is a linker; I, j,
i, p and
m are selected as follows:
I is 0 or 1; when I is 0, j, i, p and m are 0; when I is 1, j is 0 or 1; when
j
is 0, i, p and m are 0; when j is 1, i is 0 or 1; when i is 0, p and m are 0;
when i
is 1, p is 0 or 1; when p is 0, m is 0; when p is 1, m is 0 or 1;
u, k and r are selected as follows:
a is 0 or 1; when a is 0, k and r are 0; when a is 1, k is 0 or 1; when k is
0, r is 0; when k is 1, r is 0 or 1;
n is 0 or 1; X~, together with the carbonyl group of the amino acid
residue to which it is attached, forms a carboxylic acid or a carboxamide
group;
and P6 to P3' are amino acid residues, as defined below. In this embodiment,
the P6 to P3' residues are linked by peptide bonds or peptide bond surrogates.
Thus, the P6 to P3' portion of the conjugate is a peptidic substrate, as
defined
herein.
In a further embodiment, the conjugates for use in the compositions and
methods provided herein have formula III:
Z'-(L')~ (P6)m-(P5)p (P4); (P3)~ (P2),-P1-(P1')~ (P2')k (P3'l~ (LZ)~ ZZ
or a derivative thereof, where Z' and Zz are each therapeutic agents and are
the
same or different; L' and Lz are each linkers and are the same or different;
I, j, i,
p and m are selected as follows:
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-80-
Iis0or1;whenlis0,j,i,pandmare0;whenlis1,jis0or1;whenj
is 0, i, p and m. are 0; when j is 1, i is 0 or 1; when i is 0, p and m are 0;
when i
is 1, p is 0 or 1; when p is 0, m is 0; when p is 1, m is 0 or 1;
u, k and r are selected as follows:
a is 0 or 1; when a is 0, k and r are 0; when a is 1, k is 0 or 1; when k is
0, r is 0; when k is 1, r is 0 or 1;
n and v are each independently 0 or 1; and P6 to P3' are amino acid
residues, as defined below. In this embodiment, the P6 to P3' residues are
linked by peptide bonds or peptide bond surrogates. Thus, the P6 to P3'
portion
of the conjugate is a peptidic substrate, as defined herein.
In another embodiment, the conjugates for use in the compositions and
methods provided herein have formula IV:
X"-(P6)",-(P5)P (P4); (P3)j (P2),-P1-(P1')"-(P2')k (P3')~ (P4')S (L)~ Z
or a derivative thereof, where Z is a therapeutic agent; L is a linker; I, j,
i, p and
m are selected as follows:
Iis0or1;whenlis0,j,i,pandmare0;whenlis1,jis0or1;whenj
is 0, i, p and m are 0; when j is 1, i is 0 or 1; when i is 0, p and m are 0;
when i
is1,pis0or1;whenpis0,mis0;whenpis1,mis0or1;
u, k, r and s are selected as follows:
a is 0 or 1; when a is 0, k, r and s are 0; when a is 1, k is 0 or 1; when k
is 0, r and s are 0; when k is 1, r is 0 or 1; when r is 0, s is 0; when r is
1, s is
Oor1;
n is 0 or 1; X" is hydrogen, or an acyl, sulfonyl or carbamoyl cap; and P6
to P4' are amino acid residues, as defined below. In this embodiment, the P6
to
P4' residues are linked by peptide bonds or peptide bond surrogates. Thus, the
P6 to P4' portion of the conjugate is a peptidic substrate, as defined herein.
In
another embodiment, the conjugates for use in the compositions and methods
provided herein have formula V:
Z-(L)~ (P6)m-(P5)P (P4).,-(P3)~ (P2); P1-(P1')~ (P2')~ (P3')~ (P4')S
X°
or a derivative thereof, where Z is a therapeutic agent; L is a linker; I, j,
i, p and
m are selected as follows:
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-81-
I is 0 or 1; when I is 0, j, i, p and m are 0; when I is 1, j is 0 or 1; when
j
is 0, i, p and m are 0; when j is 1, i is 0 or 1; when i is 0, p and m are 0;
when i
is 1, p is 0 or 1; when p is 0, m is 0; when p is 1, m is 0 or 1;
u, k, r and s are selected as follows:
a is 0 or 1; when a is 0, k, r and s are 0; when a is 1, k is 0 or 7 ; when k
is 0, r and s are 0; when k is 1, r is 0 or 1; when r is 0, s is 0; when r is
1, s is
0 or 1;
n is 0 or 1; X°, together with the carbonyl group of the amino acid
residue to which it is attached, forms a carboxylic acid or a carboxamide
group;
and P6 to P4' are amino acid residues, as defined below. In this embodiment,
the P6 to P4' residues are linked by peptide bonds or peptide bond surrogates.
Thus, the P6 to P4' portion of the conjugate is a peptidic substrate, as
defined
herein.
In a further embodiment, the conjugates for use in the compositions and
methods provided herein have formula V1:
Z'-(L'l~ (P6)m (P5)P (P4); (P3)~ (P2)i-P1-(P1')"(P2')k (P3')~ (P4')S (Lz)~ ~z
or a derivative thereof, where Z' and Zz are each therapeutic agents and are
the
same or different; L' and Lz are each linkers and are the same or different;
I, j, i,
p and m are selected as follows:
I is 0 or 1; when I is 0, j, i, p and m are 0; when I is 1, j is 0 or 1; when
j
is 0, i, p and m are 0; when j is 1, i is 0 or 1; when i is 0, p and m are 0;
when i
is 1, p is 0 or 1; when p is 0, m is 0; when p is 1, m is 0 or 1;
u, k, r and s are selected as follows:
a is 0 or 1; when a is 0, k, r and s are 0; when a is 1, k is 0 or 1; when k
is 0, r and s are 0; when k is 1, r is 0 or 1; when r is 0, s is 0; when r is
1, s is
0 or 1;
n and v are each independently 0 or 1; and P6 to P4' are amino acid
residues, as defined below. In this embodiment, the P6 to P4' residues are
linked by peptide bonds or peptide bond surrogates, Thus, the P6 to P4'
portion
of the conjugate is a peptidic substrate, as defined herein.
Exemplary peptidic substrates, therapeutic agents, linkers and exemplary
conjugates of formulae I-VI are described in further detail below. It is
intended
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-82-
herein that conjugates resulting from all combinations and/or permutations of
the
groups recited below for the variables of formulae I-VI are encompassed within
the instant disclosure.
1. Peptidic Substrates
The peptidic substrates contemplated for use in the conjugates are
substrates for the targeted cell surface protease or a soluble, shed or
released
form thereof, and contain a sufficient number of amino acid residues to render
any therapeutic agent in the conjugate substantially inactive. In the
exemplary
embodiment where the therapeutic agent is, for example, doxorubicin, the
conjugate is substantially inactive by virtue of the inability of the
conjugated
therapeutic agent to cross the cell membrane. In certain embodiments, the
peptidic substrate contains at least 1, 2, 3, 4 or 5 amino acid residues, and
can
contain up to nine or ten residues. Longer peptidic substrates can be used in
the conjugates as long as upon cleavage, the resulting therapeutic agent or
therapeutic agent-amino acid or -peptidic moiety conjugate exhibits the
desired
therapeutic effect in vivo and in vitro.
Hence, exemplary peptidic substrates for use in the conjugates provided
herein possess at least one amino acid (P1), two amino acids (P1-P1'), three
amino acids (P2-P1-P1') and typically contain four, five or six amino acid
residues (P3-P2-P1-P1', P4-P3-P2-P1-P1' or P4-P3-P2-P1-P1'-P2'), where the
P1-P1' bond is the site of cleavage of cell surface protease, or a soluble,
shed or
released form thereof, including, but not limited to, a cell surface protease,
such
as a serine protease, including, for example, but not limited to, uPA bound to
its
receptor, MTSPs and endotheliases. The peptidic substrates optionally further
possess a P5, P6 or P3' amino acid residue, and, in certain embodiments,
possess P7, P8, P9, P10, P4', P5', P6' residues. Thus, the peptidic substrates
for use in the conjugates provided herein are penta-, hexa-, hepta-, octa- and
nona-peptidic substrates, and can contain 10, 1 1, 12, 13, 14, 15 or more
residues as long as, upon cleavage of the conjugate by the protease, the
resulting therapeutic agent or therapeutic agent-amino acid or -peptidic
moiety
conjugate exhibits the desired therapeutic effect in vivo and in vitro.
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-83-
The peptidic substrates are conjugated to the therapeutic agent (or to a
linker to which the therapeutic agent is linked) via the C-terminal residue
(i.e.,
P1 °, P2' or P3'), or the N-terminal residue (i.e., P6, P5 or P4), or
optionally an
internal residue. The peptidic substrates, for example, can be straight
chains,
but can be cyclized or include cyclized portions.
In embodiments where the conjugation is via the C-terminus of the
peptidic substrate, the peptidic substrate optionally possesses a cap, such as
an
acyl or carbamoyl cap at the N-terminus. In embodiments where conjugation is
via the N-terminus of the peptidic substrate, the peptidic substrate further
possess a terminal group, such as a carboxamide group, at the C-terminus.
The conjugates can contain a plurality of peptidic substrates and a
plurality of therapeutic agents. For example, in conjugates that contain two
therapeutic agents, which are the same or different, conjugation to the
therapeutic agents) or linker linked thereto can be via the C-terminal and N-
terminal residues of the peptidic substrate.
The methods described for selection of substrates above can be used to
design suitable substrates. In addition, substrates can be designed based upon
known specificities of other proteases. For example, the specificities of
trypsin-
like and trypsin family members can aid in design of possible substrates. The
following summarizes substrate preferences for particular serine proteases
(see,
e.g., Harris et al. (2000) PNAS 97(74J:7754-7759).
PROTEASE EXEMPLARY EXEMPLARY EXEMPLARY
P1 P2 P3
RESIDUES) RESIDUES) RESIDUES)
Chymotrypsin Tyr, Phe, -- --
Trp
Trypsin Arg, Lys --
Thrombin Arg, Lys Phe Thr, Trp
Plasmin Lys, Arg Trp, Tyr, Gln
Met
Granzyme B Asp -- -- I
Human NeutrophilAla, Val, -- --
Elastase Ile
Tissue PlasminogenArg Ser, Gly, Met, Tyr
Factor Ala
Urokinase Arg Ser, Ala Thr, Ser
Factor Xa Arg Gly --
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-84-
Typical protocols for preparation of the conjugates can include the steps
of: 1 ) identification of a targeted protease; 2) expression and assay
development; 3) substrate selection, such as, for example, by testing
chromogenic or fluorogenic substrates to identify those cleaved by a selected
target protease, by use of substrate phage display to identify peptidic
substrates
cleaved by a targeted profiease, by use of a natural protein or peptide
substrate
or a natural inhibitor of the protease, and by use of combinatorial libraries
to
identify substrates cleaved by a targeted protease; 4) synthesis of conjugates
containing the identified substrate; and 5) biological evaluation thereof,
including, but not limited to, in vitro assays, cell culture assays,
biological
assays, and in vivo animal models (see, e.g., EXAMPLE 10).
A conjugate can be designed by any methods known to those of skill in
the art. The following provides an exemplary protocol. First, a series of
commercially available chromogenic and fluorogenic peptidic substrates can be
tested for cleavage by the protease of interest (see Examples for lists of
exemplary chromogenic and fluorogenic substrates and the table below). The
peptidic portion of these substrates occupies the unprimed binding sites of
the
protease while the reporter group is located on the primed side of the scissle
bond. Effective conjugates can then be designed based on the structure of the
substrates that are efficiently cleaved by the protease.
The peptidic portion of these efficiently cleaved substrates can be used
as the unprimed region of the conjugate, and Ser-therapeutic agent, such as a
cytotoxic agent (e.g., doxorubicin), Ser-Leu-therapeutic agent or Ser-Ser-Leu-
therapeutic agent can be used as the primed region of the conjugate. Cleavage
of these conjugate prodrugs releases either Ser-therapeutic agent, Ser-Leu-
therapeutic agent or Ser-Ser-Leu-therapeutic agent compounds, (n another
embodiment, the Ser in the released Ser-therapeutic agent may be replaced by
other amino acid residues including, but not limited to, Ala, hSer, Abu, Thr,
Met,
nLeu and Val. In another embodiment, such as when the therapeutic agent is
doxorubicin, the amino acid residue conjugated to the therapeutic agent
possesses a hydrophobic side chain. Such amino acid residues include, but are
not limited to, Leu, Abu, nLeu, nVal, CHA, hCHA, (hex)Gly, (allyl)Gly,
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-85-
(propargyl)Gly and (cyclopropyl)Ala. In another embodiment, such as when the
therapeutic agent is taxol, the amino acid residue conjugated to the
therapeutic
agent possesses a side chain that is not sterically bulky. Such amino acid
residues include, but are not limited to, Gly and Ala. The resulting P1'-
therapeutic agent, P1'-P2'-therapeutic agent, or P1'-P2'-P3'-therapeutic agent
compound can be further processed in vivo into active therapeutic agents.
Another approach to designing a conjugate prodrug for a protease
substrate is to use substrate phage display to elucidate optimal subsite
occupancy for the protease. The resulting information can then be used to
design the peptidic, unprimed portion of the conjugate. As described above,
the
primed region of the conjugate can be fixed as Ser-therapeutic agent, Ser-Leu-
therapeutic agent or Ser-Ser-Leu-therapeutic agent.
A third approach to design an effective prod rug conjugate involves the
use of combinatorial fluorogenic substrate libraries to determine optimal
residues
for the unprimed region of a protease substrate. These selected sequences can
then be used as the unprimed portion of the conjugate prodrug and, and Ser-
therapeutic agent, (e.g., doxorubicin), Ser-Leu-therapeutic agent or Ser-Ser-
Leu-
therapeutic agent can be used as the primed region of the conjugate.
These methods have been used in the design.of the peptidic substrate portion
of
the conjugates provided herein. For example, sequences including GSGR (and
related sequences such as TGR, SGR, extended variants and others herein) were
based on or dervied from substrate phage display experiments using u-PA as the
taret protease. Many matriptase conjugates, such as (R/K)-X-S-R and X-(R/K)-S-
R, and related sequences as provided herein, were based on data from
combinatorial libraries. In other embodiemnts, seqeuence sequences in natural
substrates or natural inhibitors of a protease target, such as uPA, including
VSAR, PGR (from P3-P1 of plasminogen) and related sequences, were used in
design of u-PA-targetd conjugates. In other embodiments, sequences from
chromgenic substrates, such as D-HHT-Gly-Arg, and related sequences, were
used for design of ET-1-targeted conjugates.
Chromogenic/fluorogenic substrates
Enzyme Substrate Structure
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-86-
MTSP1 spectrozyme t-PA CH3S0~ D-HHT-Gly-Arg-pNA.AcOH
MTSP1 S 2765 N-a-Z-D-Arg-Gly-Arg-pNA.2HCl
MTSP3 Spectrozyme tXlla H-D-CHT-Gly-Arg-pNA.2AcOH
MTSP4aSpec PL H-D-Nle-HHT-Lys-pNA.2AcOH
MTSP5 S 2765 N-a-Z-D-Arg-Gly-Arg-pNA.2HCl
MTSP6 spectrozyme t-PA CH3S0~-D-HHT-Gly-Arg-pNA.AcON
MTSP7 S 2366 pyroGlu-Pro-Arg-pNA.HCI
MTSP9 Pefachrome tVlla CH3S0~ D-CHA-But-Arg-pNA
MTSP10spectrozyme t-PA CH3S02 D-HHT-Gly-Arg-pNA.AcOH
MTSP22S 2366 pyroGlu-Pro-Arg-pNA.HCI
ET-1 spectrozyme t-PA CH3S0~ D-HHT-Gly-Arg-pNA.AcOH
ET-2 S 2765 N-a-Z-D-Arg-Gly-Arg-pNA.2HCl
u-PA S-24-44. pyroGlu-Gly-Arg-pNA.HCI
a coupled assay, activation of plasminogen in the presence of Spec
PL
Briefly, for a coupled assay, the ability of the protease to activate an
enzyme, such as plasminogen or trypsinogen is tested. To perform these
assays, a protease is incubated with a zymogen, such as plasminogen or
trypsinogen, in the presence of a labelled known substrate, such as lys-
plasminogen or Spec PL (for plasmin), for the zymogen. If protease
activates the zymogen, the activated enzyme, such as plasmin and
trypsin, will degrade the substrate, thereby changing the spectral
properties of the substrate.
Exemplary peptidic substrates
The following description provides exemplary peptidic substrates
for cleavage by proteases, such as MTSP1 (or matriptase), endotheliase 1
and urokinase, and a general discussion of properties of the residues. In
a similar manner, peptidic substrates for cleavage by other cell surface
proteases, or a soluble, shed or released form thereof, can be similarly
designed by identifying peptidic substrates for the selected protease and
then preparing conjugates that contain such peptidic substrates.
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
_87_
a. The P1 Residue
Amino acid residues for use at the P1 position of the peptidic
substrates for use in the conjugates provided herein include Arg, Arg
surrogates and Lys. Arg surrogates include unnatural amino acids that
possess a group or moiety that functions in substantially the same way
as the naturally occurring side chain of arginine to achieve substantially
the same result (e.g., acting as the P1 residue in a substrate for a
MTSP1, urokinase or endotheliase). Arg surrogates include, but are not
limited to, a-amino acids that possess as the side chain any of the
following: the side chain of hornoarginine; guanidinoaminopropyl;
guanidinoaminoethyl; (Me)zarginine side chain; (Et)zarginine side chain; (4-
aminomethyl)phenylmethyl; 4-amidinophenylmethyl; 4-guanidinophenyl-
methyl; or the Arg surrogate is a conformationally constrained arginine
analog such as:
NH
NH' \....
z
O
where z is 0 or 1 (see, e.g., Webb et al. (1991) J. Org. Chem. 56:3009);
or the side chain is a conformationally constrained arginine side chain
analog such as:
35
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
,88_
H~N\ /NH NH
H~N\ /NH W W NH
HN ' ,
d
NH HzN NH
I ~ ~NHZ W
or
where d is an integer from 0 to 5, or 1 to 3; and W is N or CH; or a
mono- or di-substituted N-alkyl derivative of the above groups, where
alkyl is, in certain embodiments, lower alkyl, such as, for example,
methyl.
In certain embodiments herein, the P1 residue is Arg.
b. The P2 Residue
In the conjugates provided herein, the P2 residue is selected from
Phe, Ser, Gly, Ala, Ser(OMe), hSer, 1-methylHis, 3-methylHis, His, nVal,
nLeu, Abu, (hS)Gly, Thr, Aib, CHA and Tyr. In another embodimenfi, the
P2 residue is selected from Phe, Ser, Gly and Ala. In certain
embodiments herein, the P2 residue is Ser or Ala. In another
embodiment, the P2 residue is Gly or Ala.
c. The P3 Residue
Amino acid residues for use at the P3 position of the conjugates
provided herein include Arg, Lys, Gin, Quat, Arg surrogates, Ser, Thr,
hSer, dSer, Pro, (hS)Gly, Tyr, 4,4-dimethylThr, Asn, Met(O~), Quat2,
Quat3, Quat4 and Quat5. In another embodiment, the P3 residue is
selected from Arg, Lys, Gln, Quat and Arg surrogates. Arg surrogates
include those described above for the P1 residue.
In certain embodiments, the P3 residue is Gln or Ser.
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
_89_
d. The P4 Residue
In the conjugates provided for use in the compositions and
methods provided herein, the P4 residue is selected from Pro, Arg, Ser,
Ala, Lys, Gly, nLeu, Leu, Tyr, Glu, Phe, Val, N,N-dimethylGly, ~3-Ala,
Cys(Me), Gln, t-butylGly and nVal. In another embodiment, the P4
residue is selected from Pro, Arg, Ser, Ala, Lys, Gly, nLeu, Leu, Tyr, Glu,
Phe and Vat. In further embodiments, the P4 residue is selected from
Pro, Arg, Ser, Ala, Lys, Gly, nLeu, Phe or Val. In certain embodiments
herein, the P4 residue is Arg or Gly.
e. The P5 and P6 Residues
In certain embodiments herein, the peptidic substrates used in the
conjugates contain a P5 and, optionally, a P6 residue. P5 residues
include lle, Arg and Arg surrogates. In another embodiment, P5 residues
include Arg and Arg surrogates. Arg surrogates include those described
above for the P1 residue. P6 residues include, for example, Leu, Val and
Arg. In another embodiment, P6 residues include, for example, Leu.
f. The P1' Residue
The P1' residue of the conjugates provided herein is Gly, Ser, Ala,
Leu, Ile, d-Ile, nLeu, Val, nVal, Aib, Abu, Met, 6-aminohexanoyl, Thr or
hSer. In another embodiment, the P1' residue of the conjugates provided
herein is Gly, Ser, Ala, Leu, Ile, d-lle, nLeu, Val, nVal, Aib, Abu, Met or 6-
aminohexanoyl. In another embodiment, the P1' residue is Ser, Ala,
hSer, Abu, Thr, Met, nLeu or Val. In another embodiment, the P1'
residue is Gly or Ala. In another embodiment, the P1' residue is Ser, Ala
or Gly. In another embodiment, the P1' residue is Leu, Abu, nLeu, nVal,
CHA, hCHA, (hex)Gly, (allyl)Gly, (propargyl)Gly or (cyclopropyl)Ala. In
certain embodiments herein, the P1' residue is Ala, Ser, Gly, Ile or d-lle.
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-90-
g. The P2' Residue
In certain embodiments herein, the conjugates provided herein
possess a P2' residue. P2' residues for use herein include, but are not
limited to, Gly, Ser, Ala, Leu, Ile, d-Ile, nLeu, Val, nVal, Aib, Abu, Met, 6-
aminohexanoyl, hCHA, CHA, hexylGly, aIlyIGly and Phe. In another
embodiment, P2' residues for use herein include, but are not limited to,
Gly, Ser, Ala, Leu, Ile, d-Ile, nLeu, Val, nVal, Aib, Abu, Met and 6-
aminohexanoyl. In another embodiment, the P2' residue is Ser, hSer,
Abu, nLeu, nVal, CHA, hCHA, (allyl)Gly or (hexyl)Gly. In another
embodiment, the P2' residue is Gly or Ala. In another embodiment, the
P2' residue is Leu, Abu, nLeu, nVal, CHA, hCHA, (hex)Gly, (allyl)Gly,
(propargyl)Gly or (cyclopropyl)Ala. In further embodiments, the P2'
residues are Ala, Gly, Ile or d-lle.
h. The P3' Residue
In other embodiments herein, the peptidic substrates used in the
conjugates provided herein include a P3' residue. P3' residues for use
herein include, but are not limited to, Gly, Ser, Ala, Leu, Ile, nLeu, Val,
nVal, Aib, Abu, Met, 6-aminohexanoyl, CHA and aIlyIGly. In another
embodiment, the P2' residue is Ser, hSer, Abu, nLeu, nVal, CHA, hCHA,
(allyl)Gly or (hexyl)Gly. In another embodiment, P3' residues for use
herein include, but are not limited to, Gly, Ser, Ala, Leu, Ile, nLeu, Val,
nVal, Aib, Abu, Met and 6-aminohexanoyl. In another embodiment, the
P3' residue is Gly or Ala. In another embodiment, the P3' residue is Leu,
Abu, nLeu, nVal, CHA, hCHA, (hex)Gly, (allyl)Gly, (propargyl)Gly or
(cyclopropyl)Ala.
i. The P4' Residue
In other embodiments herein, the peptidic substrates used in the
conjugates provided herein include a P4' residue. P4' residues for use
herein include, but are not limited to, Gly, Ser, Ala, Leu, Ile, nLeu, Val,
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-91-
nVal, Aib, Abu, Met, 6-aminohexanoyl, CHA and allylGly. In another
embodiment, P4' residues for use herein include, but are not limited to,
Gly, Ser, Ala, Leu, lle, nLeu, Val, nVal, Aib, Abu, Met and 6-
aminohexanoyl. In another embodiment, the P4' residue is Gly or Ala. In
another embodiment, the P4' residue is Leu, Abu, nLeu, nVal, CHA,
hCHA, (hex)Gly, (allyl)Gly, (propargyl)Gly or (cyclopropyl)Ala. In another
embodiment, the P4' residue is Leu.
j. Caps
1 ) X" (the N-terminal Cap)
In embodiments herein where the therapeutic agent is conjugated
to the C-terminus of the peptidic substrate (i.e., where the conjugate has
formula I), the N-terminus of the peptidic substrate optionally is capped
with an acyl, sulfonyl or carbamoyl derivative. The cap is chosen, in
certain embodiments, to increase the hydrophilicity of the conjugate. In
embodiments where the peptidic substrate-therapeutic agent conjugate is
sufficiently hydrophilic so as not to require further hydrophilicity, a non-
hydrophilic N-terminal cap, such as an acetyl group, can be used. In
embodiments where increased hydrophilicity is desired, the N-terminal
amino acid is modified with a hydrophilic blocking group. Such blocking
groups are chosen based upon the presence of hydrophilic functionality.
Such blocking of the terminal amino group can also reduce or eliminate
the enzymatic degradation of such peptidyl therapeutic agents by the
action of exogenous amino peptidases which are present in the blood
plasma of warm blooded animals.
N-Terminal blocking groups that increase the hydrophilicity of the
conjugates and therefore increase the aqueous solubility of the
conjugates include, but are not limited to, hydroxylafied alkanoyl,
polyhydroxylated alkanoyl, polyethylene glycol, glycosylates, sugars and
crown ethers.
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
_92_
In certain embodiments herein, the N-terminal blocking group is one
of the following:
a)
O
HO
a
R' RZ
or b)
O
H 3lr / ~ O b c
O
where R' and R~ are selected from (i) or (ii) as follows:
(i) R' and Rz are each independently:
a) hydrogen;
b) unsubstituted or substituted aryl, unsubstituted or
substituted heterocyclyl, C3-C~~ cycloalkyl, C2-C6
alkenyl, C2-C6 alkynyl, halogen, C~-C6 perfluoroalkyl,
R4O-, R3C(O)NR3-, (R3)2NC(O)-, (R3)2N-C(NR3)-,
R4S(O)eNH-, -CN, -N02, R3C(O)-, -N3, -N(R3)2, or
R40C(O)NR3-;
c) unsubstituted C~-C6 alkyl;
d) substituted C~-C6 alkyl wherein the substituent on the
substituted C~-C6 alkyl is selected from unsubstituted
or substituted aryl, unsubstituted or substituted
heterocyclyl, C3-C,o cycloalkyl, C2-C6 alkenyl, C2-C6
alkynyl, R30-, R4S(O)eNH-, R3C(O)NR3-, (R3)2NC(O)-,
(R3)aN-C(NR3)-, -CN, R3C(O)-, -N3, -N(R3)a, and
R40C(O)-NR3-; or
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-93-
(ii) R' and R2 are combined to form -(CH2)f- where one of the
carbon atoms optionally is replaced by a moiety selected from: -O-,
-S(O)e-, -NC(O)-, -NH- and -N(COR4)-;
R3 is selected from: hydrogen, unsubstituted or substituted aryl,
unsubstituted or substituted heterocyclyl, C,-C6 alkyl and C3-Coo
cycloalkyl;
R4 is selected from: unsubstituted or substituted aryl, unsubstituted
or substituted heterocyclyl, C~-C6 alkyl and C3-Coo cycloalkyl;
eis0, 1 or2;
ais1,2,3or4;
b is zero or an integer between ! and 100; and
c is 0 to 10, provided that if b is zero, c is 1 to 10; and
f is 3, 4 or 5.
In certain embodiments, R' and R2 are each independently
hydrogen, OH, C,-C6 alkyl, C~-C6 alkoxy, C,-C6 aralkyl or aryl. In these
embodiments, a is 1, 2, 3 or 4; b is 0 or an integer between 1 and 100;
and c is 0 to 10, provided that if b is 0, c is 1 to 10.
In another embodiment, the N-terminal cap (?C") is hydrogen, or (i),
(ii), (iii) or (iv) as follows:
(i)
O
HO
a
R R
or (ii)
OH
HO
~ a
R, R2
O
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-94-
or (iii)
OH
HO
R' R2 O
or (iv)
O~( ~
H3C ~O b c
O
where R' and R2 are each independently hydrogen, C,-C6 alkyl and aryl; a
is 1, 2, 3 or 4; a' is 0, 1, 2 or 3; b is 0 or an integer between 1 and 14;
and c is 0 or 1, provided that if b is 0, c is 1.
In another embodiment, X" is R3°O-C(O)-, R3'R32N-C(O)-,
R33(CH~)kC(O)- or H-C(O)-; where k is an integer from 1 to 4, or is 1 or 2;
R3° is alkyl, aryl, heteroaryl, aralkyl or heteroaralkyl; R3' and R32
are each
independently hydrogen, alkyl, aryl, heteroaryi, aralkyl, or heteroaralkyl;
and R33 is hydrogen, hydroxy, alkyl, alkenyl, alkynyl, alkoxy, aryl, aryloxy,
heteroaryl, heteroaryloxy, aralkyl, aralkoxy, heteroaralkyl or
heteroaralkoxy.
In certain embodiments herein, X" is hydrogen, acetyl,
hydroxyacetyl, 2,3-dihydroxypropionyl, 2,3,4-trihydroxybutanoyl, PEG(1),
PEG(2), PEG(4), PEG(6), PEG(14), PEG(15), PEG(16), PEG(17), PEG(18)
or PEG(19). In other embodiments herein, X" is hydrogen, acetyl,
hydroxyacetyl, succinyl, quinyl, gallyl, 4-imidazolylacetyl, cotininyl, 3-
phosphonylpropionyl, gulonyl, 4-phosphonylbutyryl, glutaryl,
ethoxysquaryl or PEG(2). In further embodiments, X" is hydrogen, acetyl,
-C(O)NH2, HOCH2CH2C(O)-, diaminopropanoyl, or NH2-(CH2)5-C(O)-. In
another embodiment, X" is hydrogen, acetyl, succinyl, glutaryl, PEG(2) or
malonyl. In another embodiment, X" is hydrogen, acetyl, succinyl,
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-95-
glutaryl, PEG(2), malonyl, methoxycarbonyl, phenylsulfonyl, 3-
methoxypropanoyl, ethoxycarbonyl, isobutoxycarbonyl,
benzyloxycarbonyl, tert-butoxycarbonyl, 4-oxopentanoyl, 2-(2-
methoxyethoxy)ethoxy)acetyl, 3,4-methylenedioxyphenylacetyl, 2-
pyridylacetyl, phenoxyacetyl, phenylacetyl, methoxyacetyl, 2-
methoxyethoxycarbonyl, 2-methoxyethoxyacetyl, 3-phenyl-2-
hydroxypropanoyl, pent-4-ynoyl, 1-naphthylacetyl, hydroxyacefiyl, 3-
methoxycarbonylpropanoyl or formyl.
In certain embodiments herein, the N-terminal cap (X") is acetyl,
glutaryl, or related acyl, sulfonyl or carbamoyl derivatives. Capping
groups include, but are not limited to, a simple N-acetyl residue through
larger fragments that impact the overall physicochemical properties of the
conjugate. Appropriate choice of the capping group allows delivery of
either relatively hydrophilic or hydrophobic molecules to a target site. In
one embodiment, X" is acetyl.
2) X° (the C-terminal Cap)
In embodiments herein where the therapeutic agent is conjugated
to the N-terminus of the peptidic substrate (i.e., where the conjugate has
formula II), fihe C-terminus of the peptidic substrate is a carboxylic acid or
a carboxamide derivative. Appropriate choice of the capping group
allows delivery of either relatively hydrophilic or hydrophobic molecules to
a target site.
In one embodiment, X~, together with the carbonyl group to which
ifi is attached, forms a carboxamide derivative of formula -C(O)NRdRe,
where Rd and Re are selected from (i) or (ii) as follows:
(i) Rd and Re are each independently hydrogen, C~-C6 alkyl,
-C~-C6-alkyl-OH, -C,-C6-alkyl-di-OH, -C~-C6-alkyl-tri-OH and
H3C ~ '' O b c
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-96-
provided that at least one of Rd and Re are not hydrogen or C~-C6 alkyl; or
(ii) Rd and Re together form a -CH~CHzOCH~CH2 diradicai;
b is zero or an integer between I and 100; and
c is 0 or 1, provided that if b is zero, c is 1.
In one embodiment, Rd is hydrogen and Re is 2-hydroxyethyl.
2. Linkers
The conjugates optionally contain a linker (i.e., L, L' or L2 of
formulae I, II and III) that covalently binds the peptidic substrate to the
therapeutic agent. The linkers are any that result in a conjugate in which
the peptidic portion is a substrate for a cell surface protease and the
therapeutic agent is substantially inactive when°in the conjugate and
is
released in active form or in a form subsequently activated by the cell,
tissue or environment of the targeted tissue.
For example, the linker can include of carbohydrate, peptide,
diamine, arylamine, and/or hydrocarbon core structures. Linkers are
desirably synthetically accessible, provide shelf-stable products, and do
not possess any intrinsic biological activity that interferes with the
conjugates activity. They can add desirable properties such as increasing
solubility or serving to aid in trafficking the cleaved therapeutic agent in
the cell. In certain embodiments, some linkers will be enzymatically
cleaved in vitro and in vivo, and fragment to release active therapeutic
agent or activatable therapeutic agent. In embodiments where the
therapeutic agent is doxorubicin, the linker is, for example, a sugar and/or
a peptide, such the aminosugar daunosamine.
In one embodiment, linkers for use herein include, but are not
limited to, a biscarbonyl alkyl diradical whereby an amine moiety on the
therapeutic agent is connected with the linker unit to form an amide bond
and the amino terminus of the peptidic substrate is connected with the
other end of the linker unit also forming an amide bond. Conversely, a
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
_97_
diaminoalkyl diradical linker unit, whereby a carbonyl moiety on the
cytotoxic agent is covalently attached to one of the amines of the linker
unit while the other amine of the linker unit is covalently attached to the
C-terminus of the peptidic substrate, also can be useful. Other such linker
units which are stable to the physiological environment when not in the
presence of a cell surface protease, but are cleavable upon the cleavage
of the cell surface protease proteolytic cleavage site, are intended for use
herein. Furthermore, linker units can be utilized that, upon cleavage of the
cell surface protease proteolytic cleavage site, remain attached to the
therapeutic agent but do not significantly decrease the therapeutic
activity of such a post-cleavage therapeutic agent derivative when
compared with an unmodified therapeutic agent.
In other embodiments, the linker is a diamine containing a cyclic
alkyl moiety and, in certain embodiments, the diamine contains a
bicycloalkylene moiety. Examples of such diamine linkers include, but are
not limited to, 1,4-bis(aminomethyl)cyclohexane, 1,4-bis(aminomethyl)-
cycloheptane, 1,3-bis(aminomethyl)cyclopentane, 1-amino-4-(amino-
methyl)cyclohexane, 1,4-diaminocyclohexane and 1,4-bis(aminomefihyl)-
bicyclo[2.2.2]octane.
Other tinkers include 1,c~-diaminoalkanes, including, but not limited
to, 1,3-diaminopropane, and l,cu-dicarbonylaikanes, including, but not
limited to, oxalic, malonic, succinic, glutaric, adipic and pivalic acids.
Further linkers for use in the conjugates provided herein include
self-eliminating linkers such as those of the following formulae:
30
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
_98_
Rzs Rzs
/ I \ O --A / I \ \ 0
O~D ~
O~D
Rzs
Rzs
/ i \
/ I\
and
O
O O
O
v D -~--
where A is NH or O; D is N(H or alkyl) or O; R25 is H, alkyl, cycloa)kyl,
cycloalkylalkyl, aryl, heteroaryl optionally substituted with 1 or more,
such as 1 to 3, substituents selected from halo, halo alkyl and alkyl,
aralkyl, heteroaralkyl, alkenyl containing 1 to 2 double bonds, alkynyl
containing 1 to 2 triple bonds, alk(en)(yn)yl groups, halo, pseudohalo,
cyano, hydroxy, haloalkyl and polyhaloalkyl, such as, for example, halo
lower alkyl, especially trifluoromethyl, formyl, alkyicarbonyl, arylcarbonyl
that optionally is substituted with 1 or more, such as, for example, 1 to
3, substituents selected from, for example, halo, halo alkyl and alkyl,
heteroarylcarbonyl, carboxy, alkoxycarbonyl, aryloxycarbonyl,
aminoimino, alkoxycarbonylamino, aryloxycarbonylamino, aminocarbonyl,
alkylaminocarbonyl, dialkylaminocarbonyl, arylaminocarbonyl,
diarylaminocarbonyl, aralkylaminocarbonyl, alkoxy, aryloxy,
perfluoroalkoxy, alkenyloxy, alkynyloxy, arylalkoxy, aminoalkyl, alkyl-
aminoalkyl, dialkylaminoaikyl, arylaminoalkyl, amino, alkylamino, dialkyl-
amino, arylamino, alkylarylamino, alkylcarbonylamino, arylcarbonylamino,
azido, vitro, mercapto, alkylthio, arylthio, perfluoroalkylthio, thiocyano,
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
_99-
isothiocyano, alkylsulfinyl, alkylsulfonyl, arylsulfinyl, arylsulfonyl,
aminosulfonyl, alkylaminosulfonyl, dialkylaminosulfonyl and arylamino-
sulfonyl.; and y is an integer from 1 to 3.
3. Therapeutic agents
The conjugates are intended for modifying a variety of biological
responses. Accordingly, the therapeutic agents are any agents, including
proteins and polypeptides, small molecules and other molecules that
-possess or potentiate a desired biological activity. Such molecules
include cytotoxic agents, such as, but are not limited to, a toxin such as
abrin, ricin A, ~pseudomonas exotoxin, shiga toxin, diphtheria toxin and
other such toxins and toxic portions and/or subunits or chains thereof;
proteins such as, but not limited to, tumor necrosis factor, a-interferon,
y-interferon, nerve growth factor, platelet derived growth factor, tissue
plasminogen activator; or, biological response modifiers such as, for
example, lymphokines, interleukin- I (1L-1 ), interleukin-2 (IL-2),
interleukin-6 (IL-6), granulocyte macrophage colony stimulating factor
(GMCSF), granulocyte colony stimulating factor (G-CSF), erythropoietin
(EPO), pro-coagulants such as tissue factor and tissue factor variants,
pro-apoptotic agents such FAS-ligand, fibroblast growth factors (FGF),
nerve growth factor and other growth factors. Each must be in a form
that can enter a cell or otherwise exert a therapeutic effect when in the
vicinity thereof.
Thus, therapeutic agents, include, but are not limited to, anti-
tumor, anti-angiogenic, pro-apoptotic, anti-cancer and anti-mitotic agents.
These are conjugated, optionally via a linker, to a substrate, such as
peptidic substrate, which is a substrate for the protease.
Among the therapeutic agents are cytotoxic agents that include, in
general, but are not limited to, alkylating agents, toxins, antiproliferative
agents and tubulin binding agents. Classes of cytotoxic agents for use
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-100-
herein include, for example, the anthracycline family of drugs, the vinca
drugs, the mitomycins, the bleomycins, the cytotoxic nucleosides, the
pteridine family of drugs, diynenes, the maytansinoids, the epothilones,
the taxanes and the podophyllotoxins.
Exemplary members of those classes include, for example,
doxorubicin, carminomycin, daunorubicin, aminopterin, methotrexate,
methopterin, dichloro-methotrexate, mitomycin C, porfiromycin,
5-fluorouracil, 6-mercaptopurine, cytosine arabinoside, podophyllotoxin,
or podophyllotoxin derivatives such as etoposide or etoposide phosphate,
melphalan, vinblastine, vincristine, leurosidine, vindesine, leurosine,
maytansinol, epothilone A or B, taxotere, taxol and the like. Other such
therapeutic agents include estramustine, cisplatin, combretastatin and
analogs, and cyclophosphamide. One skilled in the art can make
chemical modifications to the desired therapeutic agent in order to make
reactions of that compound more convenient for purposes of preparing
the conjugates.
Particular therapeutic agents include the following drugs. One
skilled in the art understands that these strucfiural formulae are exemplary
only and that such compounds or derivatives or analogs thereof have
acpuired in the art different generic or trivial names.
a. The methotrexate group of formula ( 1 ):
H'N N N R8
R7 CORg
t
N ~ wN N ~ ~ CONHCHCHzCH~CO~H
RI' 's
R
in which
R'~ is amino or hydroxy;
R' is hydrogen or methyl;
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-101-
R$ is hydrogen, fluoro, chloro, bromo or iodo;
R9 is hydroxy or a moiety which completes a salt of the
carboxylic acid.
b. The mitomycin group of formula (2):
O
HZN ~ ~ CH,OCONHZ
OCH3
CH3
O ' ' N~Rio
in which R'° is hydrogen or methyl.
c. The bleomycin group of formula (3):
CONHZ NHZ
NH~ CONHZ O
N \ N CHs O N R~ j
-~~~0 HO
HZN CH3 NH O O Ng NH N N
NH CH3 HO CH~ S
HO OH O~ /NI
O N OH
OH ~OH
OH O' CONHZ
in which R" is hydroxy, amino, C,-C3 alkylamino, di(C,-C3 alkyl)amino,
C4-C6 polymethylene amino, -NHCH2CH2CH2CH2NH-C(NH)NH~ or
-NHCH2CH2CH2S+(CH3)2.
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-102-
d. Melphalan of formula (4):
HOZCCHCH~ ~ ~ N(CH7CH,C1)2
NHz
e. Mercaptopurine of formula (5):
SH
N ~ NH
N
N
f. Cyotosine arabinoside of formula (6):
NH~
~~N
N O
HOHZC O
HO OH
g. Podophyllotoxins of formula (7):
Ria
Ris/ \ O O
O
HO O
OH
O
O
O
' O
CH,O ~ OCH3
OH
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-103-
in which
R'3 is hydrogen or methyl; and
R'4 is methyl or thienyl or a phosphate salt thereof.
h. The vinca alkaloid group of drugs of formula (8): ,
Ris
15 :HZGH~
)R' 9
in which
when R" and R'$ are taken singly, R'S is H, CH3 or CHO; and
R'$ is H, and one of R'6 and R" is ethyl and the other is H
or OH;
when R" and R'$ are taken together with the carbons to which
they are attached, they form an oxirane ring in which case R'6 is ethyl;
and
R'9 is hydrogen, (C~-C3 alkyl)-CO, or chlorosubstituted
(C~-C3 alkyl)-CO.
The conjugates provided herein where the therapeutic agent is the
vinca alkaloid vinblastine include those of formula:
R" _- OH
COzCH3
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-104-
OH
,~~nEt
/ [ [ ~~~'iH
N ~ COZCH3
I-- N
[ ~'''~CHzCH3
CH30 ~ N ~~~OR'9
CH3 =
~O
L - peptide - X"
where the peptidic substrate is as described above for formulae I and II; L
is a linker such as -NH-(CH2)~ T-(CH2)"-NH-; X~ is
a) hydrogen,
b) -(C=O)R'a,
c)
O
I-[
a
2
R R
d)
H C/~~O b c
O
e)
HO
9
O O
f) ethoxysquarate; and
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-105-
g) cotininyl;
R' and R2 are independently hydrogen, OH, C~-C6 alkyl, C,-C6
alkoxy, C~-C6 aralkyl and aryl;
R'a is C~-C6-alkyl, hydroxylated C3-C$-cycloalkyl, polyhydroxylated
C3-C8-cycloalkyl, hydroxylated aryl, polyhydroxylated aryl or aryl,
R'9 is hydrogen, (C~-C3 alkyl)-CO, or chlorosubstituted (C~-C3
alkyl)-CO;
T is selected from cyclopentyl, cyclohexyl, cycloheptyl or
bicyclo[2.2.2~octanyl;
a is 1, 2, 3 or 4;
b is zero or an integer between 1 and 100;
c is 0 or 1, provided that if b is zero, c is 1;
g is 1, 2 or 3;
a is 0, 1, 2 or 3;
or a pharmaceutically acceptable derivative thereof.
i. Difluoronucleosides of formula (9):
R~ 1 O CH20H
F
F OH
in which R2' is a base of one of the formulae:
35
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-106-
O O Ra3
CH=CHR24
HN HN N ~ N
O N HZN N ; O N
1 o NHz NHz
R2?
N N N
O N N N
Rz2 is hydrogen, methyl, bromo, fluoro, chloro or iodo;
Rz3 is -OH or -NH2;
R24is hydrogen, bromo, chloro or iodo.
j. Estramustine (10):
30 (CICHzCHz)zNC00
k. Cyclophosphamide ( 11 ):
O N(CHZCHZCI)z
\P~O
NH
l~TT OH
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-107-
I. Anthracycline antibiotics of formula ( 12):
O OH O
/~ \ Ra
1~~~IOH
Rb O OH O
CH3 O
R6
Rs R°
in which
Ra Is -CH3, -CH20H, -CHZOCO(CH~)3CH3, or
CH~OCOCH(OCzHS)~;
Rb is -OCH3, -OH or -H;
R~ is -NH2, -NHCOCF3, 4-morpholinyl, 3-cyano-4-morpholinyl,
1-piperidinyl, 4-methoxy-1-piperidinyl, benzylamine, dibenzylamine,
cyanomethylamine, or 1-cyano-2-methoxyethyl amine;
R5 is -OH -OTHP or -H; and
R6 is -OH or -H provided that R6 is not -OH when R5 is -OH or
-OTH P.
Table 2, which follows, provides a number of anthracycline drugs
and their generic or trivial names:
O OH O
\ Ra
1~~'~OH
Rb O OH O
CH; O
Rs
Rs R
Compound Ra Rb R° R5 R6
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-108-
daunorubicinaCH3 OCH3 NHS OH H
doxorubicinbCHzOH OCH3 NHz OH H
detorubicin CH~OCOCHiOC2H5)Z OCH3 NHZ OH H
carminomycinCH3 OH NHZ OH H
idarubicin CH3 H NHa OH H
epirubicin CH~OH OCH3 NHZ OH OH
esorubicin CHZOH OCH3 NHZ H H
THP CHzOH OCH3 NHa OTHP H
-AD-32 I CH20C0(CHa)3CN3 OCH3 NHCOCF3 OH H
a daunorubicin is an alternative name for daunomycin
b doxorubicin is an alternative name for adriamycin.
In one embodiment, when the therapeutic agent is doxorubicin, it is
conjugated to the peptidic substrate via the amino group of the
aminoglycoside moiety of doxorubicin.
m. Maytansinol
OMe Me
H OH
O N
O,
Mel~'' N
~ OMe
OH O C) .
n. Epothilone A or B
35
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-109-
O li,,'
Me ~S
Me
,,,ilMe
'~nIOH
Me Me
O
~Me
O OH O
A
Oli'I1 Me
Me ~S
Me
,,ilMe
Me "'~IOH
_ Me
O
Me
O OH O
B
o. Taxols
Ac,.-. O nu
NHR O
O
Ph ~ C _
OH OH U \Ac
Ph O
where R is PhC(O) or t-BuOC(O).
In one embodiment, when the therapeutic agent is taxol (R =
C(O)Ph), the peptidic substrate is conjugated to the secondary hydroxyl
group of the cyclohexane moiety of taxol.
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-110-
p. Ribosome-inactivating proteins
Ribosome-inacfiivating proteins (RIPs), which include ricin, abrin and
saporin, are plant proteins that catalyticaliy inactivate eukaryotic
ribosomes. RIPS inactivate ribosomes by interfering with the protein
elongation step of protein synthesis. For example, the RIP saporin
(hereinafter also referred to as SAP) has been shown to enzymatically
inactivate 60S ribosomes by cleavage of the n-glycosidic bond of the
adenine at position 4324 in the rat 28S ribosomal RNA (rRNA). Some
RIPs, such as the fioxins abrin and ricin, contain two constituent chains:
a cell-binding chain that mediates binding to cell surface receptors and
internalization of the molecule; and an enzymatically active chain
responsible for protein synthesis inhibitory activifiy. Such RIPs are type II
RIPs. Other RIPs, such as the saporins, are single chains and are
designated type I RIPs. Because such RIPs lack a cell-binding chain, they
are less toxic to whole cells than the RIPs fihafi have two chains. Two
chain RIPs are generally used for conjugation herein, unless a single chain
is further conjugated to an agent, such as a growth factor fihat mediates
binding and internalization.
Several structurally related RIP's have been isolated from seeds and
leaves of the plant Saponaria officinaiis (soapwort). Among these, SAP-6
is the most active and abundant, representing 7% of total seed proteins.
Saporin is very stable, has a high isoelectric point, does not contain
carbohydrates, and is resistant to denafiuring agents, such as sodium
dodecyl sulfate (SDS), and a variety of proteases. The amino acid
sequences of several saporin-6 isoforms from seeds are known and there
appear to be families of saporin RIPs differing in a few amino acid
residues. Because saporin is a type I RIP, it does not possess a cell-
binding chain. Consequently, its toxicity to whole cells is much lower
than the other toxins, such as ricin and abrin. When internalized by
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-111-
eukaryotic cells, however, its cytotoxicity is 100- to 1000-fold more
potent than ricin A chain.
4. Exemplary Conjugates
The conjugates provided herein, are prepared by identifying suitable
peptidic substrates for the targeted cell surface protease, or a soluble,
shed or released form thereof, and forming a conjugate of the peptidic
substrates) with a therapeutic agent(s). Exemplary conjugates,
containing peptidic substrates designed, for example, for cleavage by
MTSP1, endotheliase 1 and urokinase, are described. It is understood
that upon identification of a cell surface protease, including cell-
associated and cell-localized proteases, or a soluble, shed or released
form thereof, in or associated with a cell involved in a disease or other
conditions of interest, or with a cell present in the vicinity of a cell or
tissue involved in or associated with a disease or other condition of
interest, suitable peptidic substrates therefor can be empirically designed
and then conjugated to therapeutic agents as exemplified herein.
In certain embodiments, the conjugates for use in the compositions
and methods provided herein include:
Ac-Leu-Arg-Ala-Quat-Gly-Arg-Ala-Ala-(therapeutic agent) (SEQ ID NO:
46);
Ac-Leu-Arg-Ala-Quat-Ala-Arg-Ala-Ala-(therapeutic agent) (SEQ ID N0:
47);
Ac-Leu-Arg-Ser-Quat-Gly-Arg-Ala-Ala-(therapeutic agent) (SEQ ID NO:
48);
Ac-Leu-Arg-Ser-Quat-Ala-Arg-Ala-Ala-(therapeutic agent) (SEQ ID NO:
49);
Ac-Leu-Arg-Pro-Arg-Phe-Lys-Ile-Ile-(therapeutic agent) (SEQ ID N0: 50);
Ac-Arg-Pro-Arg-Phe-Lys-Ile-Ile-(therapeutic agent) (SEQ ID NO: 51 );
Ac-Pro-Arg-Phe-Lys-Ile-Ile-(therapeutic agent) (SEQ ID NO: 52);
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-112-
Ac-Leu-Arg-Ser-Lys-Ser-Arg-Ala-Ala-(therapeutic agent) (SEO ID NO: 53);
Ac-Arg-Ser-Lys-Ser-Arg-Aia-Ala-(therapeutic agent) (SEQ ID NO: 54);
Ac-Ser-Lys-Ser-Arg-Ala-Ala-(therapeutic agent) (SEQ ID N0: 55);
Ac-Leu-Arg-Pro-Arg-Phe-Arg-Ile-Ile-(therapeutic agent) (SEQ ID NO: 56);
Ac-Arg-Pro-Arg-Phe-Arg-Ile-Ile-(therapeutic agent) (SEQ ID NO: 57);
Ac-Pro-Arg-Phe-Arg-Ile-Ile-(therapeutic agent) (SEQ ID NO: 58);
Ac-Leu-Arg-Ser-Arg-Ser-Arg-Ala-Ala-(therapeutic agent) (SEQ ID NO: 591;
Ac-Arg-Ser-Arg-Ser-Arg-Ala-Ala-(therapeutic agent) (SEQ ID NO: 60); and
Ac-Ser-Arg-Ser-Arg-Ala-Ala-(therapeutic agent) (SEQ ID NO; 61 ).
In further embodiments herein, the conjugates are Ac-Leu-Arg-Ala-
Quat-Gly-Arg-Ala-Ala-(therapeutic agent) (SEQ ID NO: 62); Ac-Leu-Arg-
Ala-Quat-Ala-Arg-Ala-Ala-(therapeutic agent) (SEQ ID NO: 63); Ac-Leu-
Arg-Ser-Quat-Gly-Arg-Ala-Ala-(therapeutic agent) (SEQ ID NO: 64); and
Ac-Leu-Arg-Ser-Quat-Ala-Arg-Ala-Ala-(therapeutic agent) (SEQ ID NO:
65).
In other embodiments herein, the conjugates are
Ac-Leu-Arg-Pro-Arg-Phe-Lys-Ile-Ile-(therapeutic agent) (SEQ ID NO: 66);
Ac-Arg-Pro-Arg-Phe-Lys-Ile-Ile-(therapeutic agent) (SEQ ID NO: 67);
Ac-Pro-Arg-Phe-Lys-Ile-Ile-(therapeutic agent) (SEQ ID N0: 68);
2Q Ac-Leu-Arg-Ser-Lys-Ser-Arg-Ala-Ala-(therapeutic agent) (SEQ ID NO: 69);
Ac-Arg-Ser-Lys-Ser-Arg-Ala-Ala-(therapeutic agent) (SEQ ID NO: 70);
Ac-Ser-Lys-Ser-Arg-Ala-Ala-(therapeutic agent) (SEQ ID NO: 71 );
Ac-Leu-Arg-Pro-Arg-Phe-Arg-Ile-Ile-(therapeutic agent) (SEQ ID NO: 72);
Ac-Arg-Pro-Arg-Phe-Arg-Ile-Ile-(therapeutic agent) (SEQ ID NO: 73);
Ac-Pro-Arg-Phe-Arg-Ile-Ile-(therapeutic agent) (SEQ ID NO: 74);
Ac-Leu-Arg-Ser-Arg-Ser-Arg-Ala-Ala-(therapeutic agent) (SEQ ID NO: 75);
Ac-Arg-Ser-Arg-Ser-Arg-Ala-Ala-(therapeutic agent) (SEQ ID NO: 76); and
Ac-Ser-Arg-Ser-Arg-Ala-Ala-(therapeutic agent) (SEQ ID NO: 77).
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-113-
In other embodiments, the conjugates for use herein include the
following:
pyroGlu-Pro-Arg-Ala-Ala-(therapeutic agent) (SEQ ID NO: 78);
CH3S02-D-HHT-Gly-Arg-Ala-Ala-(therapeutic agent) (SEQ ID NO: 79);
N-p-tosyl-Gly-Pro-Arg-Ala-Ala-(therapeutic agent) (SEQ ID NO: 80);
Benzoyl-Val-Gly-Arg-Ala-Ala-(therapeutic agent) (SEQ ID NO: 81 );
CH3S0~ D-HHT-Gly-Arg-Ala-Ala-(therapeutic agent) (SEQ ID NO: 82);
N-a-Z-D-Arg-Gly-Arg-Ala-Ala-(therapeutic agent) (SEQ ID N0: 83) (Z =
benzyloxycarbonyl);
pyroGlu-Gly-Arg-Ala-Ala-(therapeutic agent) (SEQ ID NO: 84);
H-D-Ile-Pro-Arg-Ala-Ala-(therapeutic agent) (SEQ ID NO: 85);
Cbo-L-(y)Glu(a-t-Bu0)-Gly-Arg-Ala-Ala-(therapeutic agent) (SEQ ID N0:
86) (Cbo = carbobenzoxy);
H-D-Pro-Phe-Arg-Ala-Ala-(therapeutic agent) (SEQ ID NO: 87);
H-D-Val-Leu-Arg-Ala-Ala-(therapeutic agent) (SEQ ID NO: 88);
Bz-Ile-Glu(y-OH)-Gly-Arg-Ala-Ala-(therapeutic agent) (SEQ ID N0: 89) (Bz
- benzoyl);
Bz-Ile-Glu(y-OMe)-Gly-Arg-Ala-Ala-(therapeutic agent) (SEQ ID NO: 90);
Benzoyl-Pro-Phe-Arg-Ala-Ala-(therapeutic agent) (SEQ iD NO: 91 );
H-D-Phe-Pip-Arg-Ala-Ala-(therapeutic agent) (SEQ ID NO: 92);
H-D-Val-Leu-Lys-Ala-Ala-(therapeutic agent) (SEQ ID NO: 93);
H-D-Nle-HHT-Lys-Ala-Ala-(therapeutic agent) (SEQ ID NO: 94);
Pyr-Arg-Thr-Lys-Arg-Ala-Ala-(therapeutic agent) (SEQ ID NO: 95);
H-Arg-Gln-Arg-Arg-Ala-Ala-(therapeutic agent) (SEQ ID NO: 96);
Boc-Gln-Gly-Arg-Ala-Ala-(therapeutic agent) (SEQ ID NO: 97);
Z-Arg-Arg-Ala-Ala-(therapeutic agent) (SEQ ID N0: 98);
H-D-HHT-Ala-Arg-Ala-Ala-(therapeutic agent) (SEQ ID NO: 99);
H-D-CHT-GIy-Arg-Ala-Ala-(therapeutic agent) (SEQ ID NO: 100);
MeS02 dPhe-Pro-Arg-Ala-Ala-(therapeutic agent) (SEQ ID NO: 101 );
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-114-
d'-Z-D-Lys-Pro-Arg-Ala-Ala-(therapeutic agent) (SEQ ID NO: 102); and
CH3S02-D-CHA-But-Arg-Ala-Ala-(therapeutic agent) (SEQ ID NO: 103).
In another embodiment, the conjugates for use in the compositions
and methods provided herein include:
Ac-Arg-Gln-Ser-Arg-Ala-AIa-(therapeutic agent) (SEQ ID NO: 104);
Ac-Arg-Arg-Gln-Ser-Arg-Ala-Ala-(therapeutic agent) (SEQ ID N0: 105);
Ac-Leu-Arg-Arg-Gln-Ser-Arg-Ala-Ala-(therapeutic agent) (SEQ ID NO:
106);
Ac-Arg-Gln-Ser-Arg-Ala-(therapeutic agent) (SEQ ID N0: 107);
Ac-Arg-Arg-Gln-Ser-Arg-Ala-(therapeutic agent) (SEQ ID NO: 108);
Ac-Leu-Arg-Arg-Gln-Ser-Arg-Gly-Gly-(therapeutic agent) (SEQ ID NO:
109);
Ac-Leu-Arg-Arg-Gln-Ser-Arg-Ala-(therapeutic agent) (SEQ ID N0: 1 10);
Ac-Arg-Arg-Gln-Ser-Arg-Ile-(therapeutic agent) (SEQ ID NO: 11 1 ); and
Ac-Leu-Arg-Arg-Gln-Ser-Arg-Ala-Ile-(therapeutic agent) (SEQ ID NO: 1 12).
In certain embodiments, the conjugates for use in the compositions
and methods provided herein include:
Ac-Leu-Arg-Ala-Quat-Gly-Arg-Ser-Leu-(fiherapeutic agent) (SEQ ID NO:
1 13);
Ac-Leu-Arg-Ala-Quat-Ala-Arg-Ser-Leu-(therapeutic agent) (SEQ ID NO:
1 14);
Ac-Leu-Arg-Ser-Quat-Gly-Arg-Ser-Leu-(therapeutic agent) (SEQ ID NO:
1 15);
Ac-Leu-Arg-Ser-Quat-Ala-Arg-Ser-Leu-(therapeutic agent) (SEQ ID NO:
1 16);
Ac-Leu-Arg-Pro-Arg-Phe-Lys-Ser-Leu-(therapeutic agent) (SEQ ID NO:
1 17);
Ac-Arg-Pro-Arg-Phe-Lys-Ser-Leu-(therapeutic agent) (SEQ ID N0: 1 18);
Ac-Pro-Arg-Phe-Lys-Ser-Leu-(therapeutic agent) (SEQ ID NO: 119);
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-115-
Ac-Leu-Arg-Ser-Lys-Ser-Arg-Ser-Leu-(therapeutic agent) (SEQ ID NO:
120);
Ac-Arg-Ser-Lys-Ser-Arg-Ser-Leu-(therapeutic agent) (SEQ ID N0: 121 );
Ac-Ser-Lys-Ser-Arg-Ser-Leu-(therapeutic agent) (SEQ ID NO: 122);
Ac-Leu-Arg-Pro-Arg-Phe-Arg-Ser-Leu-(therapeutic agent) (SEQ ID NO:
123);
Ac-Arg-Pro-Arg-Phe-Arg-Ser-Leu-(therapeutic agent) (SEQ ID NO: 124);
Ac-Pro-Arg-Phe-Arg-Ser-Leu-(therapeutic agent) (SEQ ID NO: 125);
Ac-Leu-Arg-Ser-Arg-Ser-Arg-Ser-Leu-(therapeutic agent) (SEQ ID NO:
126);
Ac-Arg-Ser-Arg-Ser-Arg-Ser-Leu-(therapeutic agent) (SEQ ID NO: 127);
and
Ac-Ser-Arg-Ser-Arg-Ser-Leu-(therapeutic agent) (SEQ ID NO: 128).
In further embodiments herein, the conjugates are Ac-Leu-Arg-Ala-
Quat-Gly-Arg-Ser-Leu-(therapeutic agent) (SEQ ID NO: 129); Ac-Leu-Arg-
Ala-Quat-Ala-Arg-Ser-Leu-(therapeutic agent) (SEQ ID NO: 130); Ac-Leu-
Arg-Ser-Quat-Gly-Arg-Ser-Leu-(therapeutic agent) (SEQ ID NO: 131 ); and
Ac-Leu-Arg-Ser-Quat-Ala-Arg-Ser-Leu-(therapeutic agent) (SEQ ID NO:
132) .
In other embodiments herein, the conjugates are
Ac-Leu-Arg-Pro-Arg-Phe-Lys-Ser-Leu-(therapeutic agent) (SEQ ID NO:
133);
Ac-Arg-Pro-Arg-Phe-Lys-Ser-Leu-(therapeutic agent) (SEQ ID N0: 134);
Ac-Pro-Arg-Phe-Lys-Ser-Leu-(therapeutic agent) (SEQ ID NO: 135);
Ac-Leu-Arg-Ser-Lys-Ser-Arg-Ser-Leu-(therapeutic agent) (SEQ ID NO:
136);
Ac-Arg-Ser-Lys-Ser-Arg-Ser-Leu-(therapeutic agent) (SEQ ID NO: 137);
Ac-Ser-Lys-Ser-Arg-Ser-Leu-(therapeutic agent) (SEQ ID NO: 138);
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-116-
Ac-Leu-Arg-Pro-Arg-Phe-Arg-Ser-Leu-(therapeutic agent) (SEQ ID NO:
139);
Ac-Arg-Pro-Arg-Phe-Arg-Ser-Leu-(therapeutic agent) (SEQ ID NO: 140);
Ac-Pro-Arg-Phe-Arg-Ser-Leu-(therapeutic agent) (SEQ ID NO: 141 );
Ac-Leu-Arg-Ser-Arg-Ser-Arg-Ser-Leu-(therapeutic agent) (SEQ ID NO:
142);
Ac-Arg-Ser-Arg-Ser-Arg-Ser-Leu-(therapeutic agent) (SEQ ID NO: 143);
and
Ac-Ser-Arg-Ser-Arg-Ser-Leu-(therapeutic agent) (SEQ ID NO: 144).
In other embodiments, the conjugates for use herein include the
following:
pyroGlu-Pro-Arg-Ser-Leu-(therapeutic agent) (SEQ ID NO: 145);
CH3S02-D-HHT-Gly-Arg-Ser-Leu-(therapeutic agent) (SEQ ID NO: 146);
N-p-tosyl-Gly-Pro-Arg-Ser-Leu-(therapeutic agent) (SEQ ID NO: 147);
Benzoyl-Val-Gly-Arg-Ser-Leu-(therapeutic agent) (SEQ ID NO: 148);
CH3S0~-D-HHT-Gly-Arg-Ser-Leu-(therapeutic agent) (SEQ ID NO: 149);
N-a-Z-D-Arg-Gly-Arg-Ser-Leu-(therapeutic agent) (SEQ iD NO: 150) (Z =
benzyloxycarbonyl);
pyroGlu-Gly-Arg-Ser-Leu-(therapeutic agent) (SEQ ID NO: 151 );
H-D-Ile-Pro-Arg-Ser-Leu-(therapeutic agent) (SEQ !D NO: 152);
Cbo-L-(y)Glu(a-t-Bu0)-Gly-Arg-Ser-Leu-(therapeutic agent) (SEQ ID NO:
153) (Cbo = carbobenzoxyl;
H-D-Pro-Phe-Arg-Ser-Leu-(therapeutic agent) (SEQ ID NO: 154);
H-D-Val-Leu-Arg-Ser-Leu-(therapeutic agent) (SEQ ID NO: 155);
Bz-Ile-Glu(y-OH)-Gly-Arg-Ser-Leu-(therapeutic agent) (SEQ ID NO: 156)
(Bz = benzoyl);
Bz-Ile-Glu(y-OMe)-Gly-Arg-Ser-Leu-(therapeutic agent) (SEQ ID NO: 157);
Benzoyl-Pro-Phe-Arg-Ser-Leu-(therapeutic agent) (SEQ ID NO: 158);
H-D-Phe-Pip-Arg-Ser-Leu-(therapeutic agent) (SEQ ID NO: 159);
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-117-
H-D-Val-Leu-Lys-Ser-Leu-(therapeutic agent) (SEQ ID N0: 160);
H-D-Nle-HHT-Lys-Ser-Leu-(therapeutic agent) (SEQ ID NO: 161 );
Pyr-Arg-Thr-Lys-Arg-Ser-Leu-(therapeutic agent) CSEQ ID NO: 162);
H-Arg-Gln-Arg-Arg-Ser-Leu-(therapeutic agent) (SEQ ID NO: 163);
Boc-Gln-Gly-Arg-Ser-Leu-(therapeutic agent) (SEQ ID NO: 164);
Z-Arg-Arg-Ser-Leu-(therapeutic agent) (SEC2 ID NO: 165);
H-D-HHT-Ala-Arg-Ser-Leu-(therapeutic agent) (SEQ ID NO: 166);
H-D-CHT-Gly-Arg-Ser-Leu-(therapeutic agent) (SEQ ID NO: 167);
MeS02-dPhe-Pro-Arg-Ser-Leu-(therapeutic agent) (SEQ ID NO: 168);
~-Z-D-Lys-Pro-Arg-Ser-Leu-(therapeutic agent) (SEQ ID NO: 169); and
CH3S02-D-CHA-But-Arg-Ser-Leu-(therapeutic agent) (SEQ ID N0: 170).
In another embodiment, the conjugates for use in the compositions
and methods provided herein include:
Ac-Arg-Gln-Ser-Arg-Ser-Leu-(therapeutic agent) (SEQ ID NO: 171 );
Ac-Arg-Arg-Gln-Ser-Arg-Ser-Leu-(therapeutic agent) (SEQ ID N0: 172);
Ac-Leu-Arg-Arg-Gln-Ser-Arg-Ser-Leu-(therapeutic agent) (SEQ ID NO:
173);
Ac-Arg-Gln-Ser-Arg-Leu-(therapeutic agent) (SEQ ID N0: 174);
Ac-Arg-Arg-Gln-Ser-Arg-Leu-(therapeutic agent) (SEQ ID NO: 175);
Ac-Leu-Arg-Arg-Gln-Ser-Arg-Ser-Leu-(therapeutic agent) (SEQ ID NO:
176);
Ac-Leu-Arg-Arg-Gln-Ser-Arg-Leu-(therapeutic agent) (SEQ ID N0: 177);
Ac-Arg-Arg-Gln-Ser-Arg-Leu-(therapeutic agent) (SEQ ID NO: 178); and
Ac-Leu-Arg-Arg-Gln-Ser-Arg-Ser-Leu-(therapeutic agenfi) (SEQ ID NO:
179).
In other embodiments, the conjugates provided herein include:
Ac-Arg-Gln-Gly-Arg-Ser-Leu-(therapeutic agent) (SEQ ID NO: 180);
Ac-Arg-Gln-Ala-Arg-Ser-Leu-(therapeutic agent) (SEQ ID NO: 181 );
Ac-Arg-Gln-Phe-Arg-Ser-Leu-(therapeutic agent) (SEQ ID NO: 182);
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-118-
Ac-Arg-Ser-Arg-Ser-Leu-(therapeutic agent) (SEQ 183);
ID NO:
Ac-Arg-Gly-Arg-Ser-Leu-(therapeutic agent) (SEQ 184);
ID NO:
Ac-Arg-Ala-Arg-Ser-Leu-(therapeutic agent) (SEQ 185);
ID NO:
Ac-Arg-Phe-Arg-Ser-Leu-(therapeutic agent) (SEQ 186);
ID NO:
Ac-Gln-Ser-Arg-Ser-Leu-(therapeutic agent) 187);
(SEQ iD N0:
Ac-Gln-Gly-Arg-Ser-Leu-(therapeutic agent) (SEQ 188);
ID NO:
Ac-Gin-Ala-Arg-Ser-Leu-(therapeutic agent) (SEQ 189); and
ID NO:
Ac-Gln-Phe-Arg-Ser-Leu-(therapeutic agent) (SEQ 190).
ID NO:
In further embodiments, the conjugates for use
in the compositions
and methods provided herein include:
Ac-Leu-Arg-Ala-Quat-Gly-Arg-Ser-Ser-Leu-(therapeutic agent) (SEQ ID NO:
191 );
Ac-Leu-Arg-Ala-Quat-Ala-Arg-Ser-Ser-Leu-(therapeutic agent) (SEQ ID NO:
192);
Ac-Leu-Arg-Ser-Quat-Gly-Arg-Ser-Ser-Leu-(therapeutic agent) (SEQ ID NO:
193);
Ac-Leu-Arg-Ser-Quat-Ala-Arg-Ser-Ser-Leu-(therapeutic agent) (SEQ ID NO:
194);
Ac-Leu-Arg-Pro-Arg-Phe-Lys-Ser-Ser-Leu-(therapeutic agent) (SEQ ID NO:
195);
Ac-Arg-Pro-Arg-Phe-Lys-Ser-Ser-Leu-(therapeufiic agent) (SEQ ID NO:
196);
Ac-Pro-Arg-Phe-Lys-Ser-Ser-Leu-(therapeutic agent) (SEQ ID NO: 197);
Ac-Leu-Arg-Ser-Lys-Ser-Arg-Ser-Ser-Leu~(therapeutic agent) (SEQ ID N0:
198);
Ac-Arg-Ser-Lys-Ser-Arg-Ser-Ser-Leu-(therapeutic agent) (SEQ ID NO:
199);
Ac-Ser-Lys-Ser-Arg-Ser-Ser-Leu-(therapeutic agent) (SEQ ID N0: 200);
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-119-
Ac-Leu-Arg-Pro-Arg-Phe-Arg-Ser-Ser-Leu-(therapeutic agent) (SEQ ID NO:
201 );
Ac-Arg-Pro-Arg-Phe-Arg-Ser-Ser-Leu-(therapeutic agent) (SEQ ID NO:
202);
Ac-Pro-Arg-Phe-Arg-Ser-Ser-Leu-(therapeutic agent) (SEQ ID NO: 203);
Ac-Leu-Arg-Ser-Arg-Ser-Arg-Ser-Ser-Leu-(therapeutic agent) (SEQ ID NO:
204);
Ac-Arg-Ser-Arg-Ser-Arg-Ser-Ser-Leu-(therapeutic agent) (SEQ ID NO:
205); and
Ac-Ser-Arg-Ser-Arg-Ser-Ser-Leu-(therapeutic agent) (SEO iD NO: 206).
In further embodiments herein, the conjugates are Ac-Leu-Arg-Ala-
Quat-Gly-Arg-Ser-Ser-Leu-(therapeutic agent) (SEQ ID N0: 207); Ac-Leu-
Arg-Ala-Quat-Ala-Arg-Ser-Ser-Leu-(therapeutic agent) (SEQ ID NO: 208);
Ac-Leu-Arg-Ser-Quat-Giy-Arg-Ser-Ser-Leu-(therapeufiic agent) (SEQ ID NO:
209); and Ac-Leu-Arg-Ser-Quat-Ala-Arg-Ser-Ser-Leu-(therapeutic agent)
(SEQ ID NO: 210).
In other embodiments herein, the conjugates are
Ac-Leu-Arg-Pro-Arg-Phe-Lys-Ser-Ser-Leu-(therapeutic agent) (SEQ ID NO:
211);
Ac-Arg-Pro-Arg-Phe-Lys-Ser-Ser-Leu-(therapeutic agent) (SEQ ID NO:
212);
Ac-Pro-Arg-Phe-Lys-Ser-Ser-Leu-(therapeutic agent) (SEQ ID NO: 213);
Ac-Leu-Arg-Ser-Lys-Ser-Arg-Ser-Ser-Leu-(therapeutic agent) (SEQ ID NO:
214);
Ac-Arg-Ser-Lys-Ser-Arg-Ser-Ser-Leu-(therapeutic agent) (SEQ ID NO:
215);
Ac-Ser-Lys-Ser-Arg-Ser-Ser-Leu-(therapeutic agent) (SEQ ID NO: 216);
Ac-Leu-Arg-Pro-Arg-Phe-Arg-Ser-Ser-Leu-(therapeutic agent) (SEQ ID NO:
217);
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-120-
Ac-Arg-Pro-Arg-Phe-Arg-Ser-Ser-Leu-(therapeutic agent) (SEQ ID NO:
218);
Ac-Pro-Arg-Phe-Arg-Ser-Ser-Leu-(therapeutic agent) (SEQ ID NO: 219);
Ac-Leu-Arg-Ser-Arg-Ser-Arg-Ser-Ser-Leu-(therapeutic agent) (SEQ ID NO:
220);
Ac-Arg-Ser-Arg-Ser-Arg-Ser-Ser-Leu-(therapeutic agent) (SEQ ID NO:
221 ); and
Ac-Ser-Arg-Ser-Arg-Ser-Ser-Leu-(therapeutic agent) (SEQ ID NO: 222).
In other embodiments, the conjugates for use herein include the
following:
pyroGlu-Pro-Arg-Ser-Ser-Leu-(therapeutic agent) (SEQ ID NO: 223);
CH3S0~-D-HHT-Gly-Arg-Ser-Ser-Leu-(therapeutic agent) (SEQ ID NO:
224);
N-p-tosyl-Gly-Pro-Arg-Ser-Ser-Leu-(therapeutic agent) (SEQ ID NO: 225);
Benzoyl-Val-Gly-Arg-Ser-Ser-Leu-(therapeutic agent) (SEQ ID NO: 226);
CH3S02-D-HHT-Gly-Arg-Ser-Ser-Leu-(therapeutic agent) (SEQ ID NO:
227);
N-a-Z-D-Arg-Gly-Arg-Ser-Ser-Leu-(therapeutic agent) (SEQ ID N0: 228) (Z
- benzyloxycarbonyl);
pyroGlu-Gly-Arg-Ser-Ser-Leu-(therapeutic agent) (SEQ ID NO: 229);
H-D-Ile-Pro-Arg-Ser-Ser-Leu-(therapeutic agent) (SEQ iD NO: 230);
Cbo-L-(y)Glu(a-t-Bu0)-Gly-Arg-Ser-Ser-Leu-(therapeutic agent) (SEQ ID
NO: 231 ) (Cbo = carbobenzoxy);
H-D-Pro-Phe-Arg-Ser-Ser-Leu-(therapeutic agent) (SEQ ID NO: 232);
H-D-Val-Leu-Arg-Ser-Ser-Leu-(therapeutic agent) (SEQ ID NO: 233);
Bz-Ile-Glu(y-OH)-Gly-Arg-Ser-Ser-Leu-(therapeutic agent) (SEQ ID NO:
234) (Bz = benzoyl);
Bz-Ile-Glu(y-OMe)-Gly-Arg-Ser-Ser-Leu-(therapeutic agent) (SEQ ID NO:
235);
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-121-
Benzoyl-Pro-Phe-Arg-Ser-Ser-Leu-(therapeutic agent) (SEQ ID NO: 236);
H-D-Phe-Pip-Arg-Ser-Ser-Leu-(therapeutic agent) (SEQ ID NO: 237);
H-D-Val-Leu-Lys-Ser-Ser-Leu-(therapeutic agent) (SEQ ID NO: 238);
H-D-Nle-HHT-Lys-Ser-Ser-Leu-(therapeutic agent) (SEQ ID NO: 239);
Pyr-Arg-Thr-Lys-Arg-Ser-Ser-Leu-(therapeutic agent) (SEQ ID NO: 240);
H-Arg-Gln-Arg-Arg-Ser-Ser-Leu-(therapeutic agent) (SEQ ID N0: 241 );
Boc-Gln-Gly-Arg-Ser-Ser-Leu-(therapeutic agent) (SEQ ID NO: 242);
Z-Arg-Arg-Ser-Ser-Leu-(therapeutic agent) (SEQ ID NO: 243);
H-D-HHT-Ala-Arg-Ser-Ser-Leu-(therapeutic agent) (SEQ ID NO: 244);
H-D-CHT-Gly-Arg-Ser-Ser-Leu-(therapeutic agent) (SEQ ID NO: 245);
MeS02-dPhe-Pro-Arg-Ser-Ser-Leu-(therapeutic agent) (SEQ ID NO: 246);
~S-Z-D-Lys-Pro-Arg-Ser-Ser-Leu-(therapeutic agent) (SEQ ID NO: 247); and
CH3S02-D-CHA-But-Arg-Ser-Ser-Leu-(therapeutic agent) (SEQ ID NO:
248) .
In another embodiment, the conjugates for use in the compositions
and methods provided herein include:
Ac-Arg-Gln-Ser-Arg-Ser-Ser-Leu-(therapeutic agent) (SEQ ID NO: 249);
Ac-Arg-Arg-Gln-Ser-Arg-Ser-Ser-Leu-(therapeutic agent) (SEQ ID N0:
250);
Ac-Leu-Arg-Arg-Gln-Ser-Arg-Ser-Ser-Leu-(therapeutic agent) (SEQ ID NO:
251 );
Ac-Arg-Gln-Ser-Arg-Leu-(therapeutic agent) (SEQ ID NO: 252);
Ac-Arg-Arg-Gln-Ser-Arg-Leu-(therapeutic agent) (SEQ ID NO: 253);
Ac-Leu-Arg-Arg-Gln-Ser-Arg-Ser-Ser-Leu-(therapeutic agent) (SEQ ID NO:
254);
Ac-Leu-Arg-Arg-Gln-Ser-Arg-Ser-Leu-(therapeutic agent) (SEQ ID NO:
255);
Ac-Arg-Arg-Gln-Ser-Arg-Ser-Leu-(therapeutic agent) (SEQ ID NO: 256);
and
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-122-
Ac-Leu-Arg-Arg-Gln-Ser-Arg-Ser-Ser-Leu-(therapeutic agent) (SEQ ID NO:
257).
In other embodiments, the conjugates provided herein include:
Ac-Arg-Gln-Gly-Arg-Ser-Ser-Leu-(therapeutic agent) (SEQ ID NO: 258);
Ac-Arg-Gln-Ala-Arg-Ser-Ser-Leu-(therapeutic agenfi) (SEQ ID NO: 259);
Ac-Arg-Gln-Phe-Arg-Ser-Ser-Leu-(therapeutic
agent) (SEQ ID N0: 260);
Ac-Arg-Ser-Arg-Ser-Ser-Leu-(therapeutic (SEQ ID NO: 261
agent) );
Ac-Arg-Gly-Arg-Ser-Ser-Leu-(therapeutic (SEQ ID NO: 262);
agent)
Ac-Arg-Ala-Arg-Ser-Ser-Leu-(therapeutic (SEQ ID NO: 263);
agent)
Ac-Arg-Phe-Arg-Ser-Ser-Leu-(therapeutic(SEQ ID NO: 264);
agent)
Ac-Gln-Ser-Arg-Ser-Ser-Leu-(therapeutic agent) (SEQ ID NO: 265);
Ac-Gln-Gly-Arg-Ser-Ser-Leu-(therapeutic agent) (SEQ ID NO: 266);
Ac-Gln-Ala-Arg-Ser-Ser-Leu-(therapeufiic agent) (SEQ ID NO: 267); and
Ac-Gln-Phe-Arg-Ser-Ser-Leu-(therapeutic agent) (SEQ ID NO: 268).
In another embodiment, the conjugates provided herein include:
Ac-Gly-dSer-Ala-Arg-Ser-Ala-(therapeutic agent) (SEQ ID NO: 569);
Ac-Arg-Gly-dSer-Ala-Arg-Ser-Ala-(therapeutic agent) (SEQ ID NO: 570);
Ac-Gly-Ser-Gly-Arg-Ser-Ala-(therapetutic agent) (SEO. ID NO: 571 );
Ac-Arg-Gly-Ser-Gly-Arg-Ser-Ala-(therapetutic agent) (SEQ ID NO: 572);
Ac-Leu-Arg-Gly-Ser-Gly-Arg-Ser-Ala-(therapetutic agent) (SEQ ID NO:
573);
Ac-Leu-Arg-Gly-dSer-Ala-Arg-Ser-Ala-(therapetutic agent) (SEQ ID NO:
574);
Ac-Cys(Me)-Pro-Gly-Arg-Val-Val-(therapeutic agent) (SEQ ID N0: 575);
Ac-Arg-Cys(Me)-Pro-Gly-Arg-Val-Val-(therapeutic agent) (SEQ ID NO:
577);
Ac-Arg-Arg-Cys(Me)-Pro-Gly-Arg-Val-Val-(therapeutic agent) (SEQ ID NO:
578);
Ac-Val-Ser-Ala-Arg-Met-Ala-(therapeutic agent) (SEQ ID NO: 579);
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-123-
Ac-Ile-Val-Ser-Ala-Arg-Met-Ala-(therapeutic agent) (SEQ ID N0: 580);
Ac-Val-Ile-Val-Ser-Ala-Arg-Met-Ala-(therapeutic agent) (SEQ ID NO: 581 );
Ac-Val-Ile-Val-Ser-Ala-Arg-nLeu-Ala-(therapeutic agent) (SEQ ID NO:
582);
Ac-Val-Ser-Ala-Arg-nLeu-Ala-(therapeutic agent) (SEQ ID NO: 583);
Ac-Ile-Val-Ser-Ala-Arg-nLeu-Ala-(therapeutic agent) (SEQ ID NO: 584);
Ac-Gly-Ser-Gly-Arg-Ser-Leu-(therapeutic agent) (SEQ ID NO: 585);
Ac-Gly-Ser-Gly-Arg-Ser-Ser-Leu-(therapeutic agent) (SEQ ID NO: 586);
Ac-Gly-Ser-Ala-Arg-Ser-Leu-(therapeutic agent) (SEQ ID NO: 587);
Ac-Ser-Gly-Arg-Ser-Leu-(therapeutic agent) (SEQ ID NO: 588);
Ac-Ser-Gly-Arg-Ser-Ser-Leu-(therapeutic agent) (SEQ ID NO: 589);
Ac-Ser-Ala-Arg-Ser-Leu-(therapeutic agent) (SEQ ID NO: 590);
Ac-Arg-Gly-Ser-Gly-Arg-Ser-Leu-(therapeutic agent) (SEQ ID NO: 591 );
Ac-Arg-Gly-Ser-Gly-Arg-Ser-Ser-Leu-(therapeutic agent) (SEQ ID NO:
592);
Ac-Arg-Gly-Ser-Ala-Arg-Ser-Leu-(therapeutic agent) (SEQ ID NO: 593);
Ac-Leu-Arg-Gly-Ser-Gly-Arg-Ser-Leu-(therapeutic agent) (SEQ ID NO:
594);
Ac-Leu-Arg-Gly-Ser-Gly-Arg-Ser-Ser-Leu-(therapeutic agent) (SEQ ID NO:
595); and
Ac-Leu-Arg-Gly-Ser-Ala-Arg-Ser-Leu-(therapeutic agent) (SEQ ID NO:
596).
In another embodiment, the conjugates provided herein are
selected from:
Ac-R-Q-G-R-S-L-(therapeutic agent) (SEQ ID NO: 491 );
Ac-R-Q-G-R-S-S-L-(therapeutic agent) (SEQ ID NO: 492);
Ac-R-Q-G-R-S-nL-(therapeutic agent) (SEQ ID NO: 493);
Ac-R-Q-G-R-S-nV-(therapeutic agent) (SEQ ID NO: 494);
Ac-R-Q-G-R-S-F-(therapeutic agent) (SEQ 1D NO: 495);
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-124-
Ac-R-Q-G-R-A-L-(therapeutic agent) (SEQ ID NO: 496);
Ac-R-Q-G-R-A-L-(therapeutic agent) (SEQ ID NO: 497);
Ac-R-Q-G-R-A-nL-(therapeutic agent) (SEQ ID NO: 498);
Ac-R-Q-G-R-A-nL-(therapeutic agent) (SEQ ID NO: 499);
Ac-R-Q-G-R-A-nV-(therapeutic agent) (SEQ ID NO: 500);
Ac-R-Q-G-R-A-Cha-(therapeutic agent) (SEQ ID NO: 501 );
Ac-R-Q-G-R-A-F-(therapeutic agent) (SEQ ID NO: 502);
Ac-R-N-G-R-S-L-(therapeutic agent) (SEQ ID NO: 503);
Ac-R-N-G-R-A-nL-(therapeutic agent) (SEQ ID NO: 504);
Ac-R-Q-A-R-S-L-(therapeutic agent) (SEQ ID NO: 505);
Ac-R-Q-A-R-S-nL-(therapeutic agent) (SEQ ID NO: 506);
Ac-R-Q-A-R-S-nV-(therapeutic agent) (SEQ ID NO: 507);
Ac-R-Q-A-A-S-Cha-(therapeutic agent) (SEQ ID NO: 508);
Ac-R-Q-A-R-S-S-Cha-(therapeutic agent) (SEQ ID NO: 509);
Ac-R-Q-A-R-T-nL-(therapeutic agent) (SEQ ID NO: 510);
Ac-R-Q-A-R-A-L-(therapeutic agent) (SEQ ID NO: 51 1 );
Ac-R-Q-A-R-A-nL-(therapeutic agent) (SEQ ID NO: 512);
Ac-R-Q-A-R-A-nV-(therapeutic agent) (SEQ ID NO: 513);
Ac-R-Q-A-R-A-Cha-(therapeutic agent) (SEQ ID NO: 514);
Ac-R-Q-S-R-A-A-(therapeutic agent) (SEQ ID NO: 515);
Ac-R-Q-S-R-A-(therapeutic agent) (SEQ ID NO: 516);
Ac-R-Q-S-R-A-nL-(therapeutic agent) (SEQ ID NO: 517);
Ac-R-Q-S-R-A-L-(therapeutic agent) (SEQ ID NO: 518);
Ac-R-Q-S-R-A-nV-(therapeutic agent) (SEQ ID NO: 519);
Ac-R-Q-S-R-A-Cha-(therapeutic agent) (SEQ ID NO: 520);
Ac-R-Q-S-R-S-S-L-(therapeutic agent) (SEQ ID NO: 521 );
Ac-R-Q-S-R-S-L-(therapeutic agent) (SEQ ID NO: 522);
Ac-R-Q-S-R-S-nL-(therapeutic agent) (SEQ ID NO: 523);
Ac-R-Q-S-R-S-nL-(therapeutic agent) (SEQ ID NO: 524);
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-125-
Ac-R-Q-S-R-S-nV-(therapeutic agent) (SEQ ID NO: 525);
Ac-R-Q-S-R-S-aIIyIG-(therapeutic agent) (SEQ ID NO: 526);
Ac-R-Q-S-R-S-Cha-(therapeutic agent) (SEQ ID NO: 527);
Ac-R-Q-S-R-T-nL-(therapeutic agent) (SEQ ID NO: 528);
Ac-R-Q-T-R-S-S-L-(therapeutic agent) (SEQ ID NO: 529);
Ac-R-Q-T-R-S-L-(therapeutic agent) (SEQ ID NO: 530);
Ac-R-N-S-R-S-nL-(therapeutic agent) (SEQ ID NO: 531 );
Ac-R-Q-F-R-S-L-(therapeutic agent) (SEQ ID NO: 532);
Ac-R-Q-F-R-S-nL-(therapeutic agent) (SEQ ID NO: 534);
Ac-R-Q-F-R-S-nV-(therapeutic agent) (SEQ ID NO: 535);
Ac-R-Q-F-R-S-nL-(therapeutic agent) (SEQ ID NO: 536);
Ac-R-Q-F-R-S-Cha-(therapeutic agent) (SEQ ID NO: 537);
Ac-R-Q-F-R-A-L-(therapeutic agent) (SEQ ID NO: 538);
Ac-R-Q-F-R-A-nL-(therapeutic agent) (SEQ ID NO: 539);
Ac-R-Q-F-R-A-nV-(therapeutic agent) (SEQ ID N0: 540);
Ac-R-Q-F-R-A-Cha-(therapeutic agent) (SEQ ID NO: 541 );
Ac-Q-S-R-S-S-nL-(therapeutic agent) (SEQ ID NO: 542);
MeOCO-Quat2-G-R-S-L-(therapeutic agent) (SEQ ID NO: 483);
MeOCO-Quat3-G-R-S-L-(therapeutic agent) (SEQ ID NO: 484);
MeOCO-Quat-G-R-S-L-(therapeutic agent) (SEQ ID NO: 485);
MeOCO-Quat4-G-R-S-L-(therapeutic agent) (SEQ ID NO: 486);
MeOCO-QuatS-G-R-S-L-(therapeutic agent) (SEQ ID N0: 487);
MeOCO-Quat2-G-R-S-S-L-(therapeutic agent) (SEQ ID NO: 488);
MeOCO-Quat4-G-R-S-L-(therapeutic agent) (SEQ ID NO: 489);
Me0C0-Quat2-G-R-S-L-(therapeutic agent) (SEQ ID NO: 490);
Ac-Q-G-R-S-L-(therapeutic agent) (SEQ ID NO: 445);
Ac-Q-G-R-S-S-L-(therapeutic agent) (SEQ ID N0: 446);
Ac-Q-G-R-A-S-L-(therapeutic agent) (SEQ ID NO: 447);
Ac-N-G-R-S-S-L-(therapeutic agent) (SEQ ID NO: 448);
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-126-
Ac-Q-G-R-S-S-nL-(therapeutic agent) (SEQ ID NO: 449);
Ac-Q-G-R-S-S-nV-(therapeutic agent) (SEQ ID NO: 450);
Ac-Q-G-R-S-S-Cha-(therapeutic agent) (SEQ ID NO: 451 );
Ac-Q-G-R-S-S-aIIyIG-(therapeutic agent) (SEQ ID NO: 452);
Ac-Q-G-R-S-S-aIIyIG-(therapeutic agent) (SEQ ID NO: 453);
Ac-Q-A-R-S-L-(therapeutic agent) (SEQ ID NO: 454);
Ac-Q-A-R-S-S-L-(therapeutic agent) (SEQ ID NO: 455);
Ac-Q-S-R-S-L-(therapeutic agent) (SEQ ID NO: 456);
Ac-Q-S-R-S-S-nV-(therapeutic agent) (SEQ ID NO: 457);
Ac-Q-S-R-S-S-Cha-(therapeutic agent) (SEQ ID NO: 458);
Ac-Q-S-R-S-S-L-(therapeutic agent) (SEQ ID NO: 459);
Ac-Q-T-R-S-S-L-(therapeutic agent) (SEQ ID NO: 460);
Ac-Q-Aib-R-S-S-Cha-(fiherapeutic agent) (SEQ ID NO: 461 );
Ac-Q-Aib -R-S-S-L-(therapeutic agent) (SEQ CD NO: 462);
Ac-Q-Abu-R-S-S-Cha-(therapeutic agent) (SEQ ID NO: 463);
Ac-Q-Abu-R-S-S-L-(therapeutic agent) (SEQ ID NO: 464);
Ac-Q-Cha-R-S-S-Cha-(therapeutic agent) (SEQ ID NO: 465);
Ac-Q-F-R-S-L-(therapeutic agent) (SEQ ID N0: 466);
Ac-Q-F-R-S-S-L-(therapeutic agent) (SEQ ID NO: 467);
Ac-Q-Y-R-S-S-L-(therapeutic agent) (SEQ ID NO: 468);
Ac-R-G-R-S-L-(therapeutic agent) (SEQ ID NO: 469);
Ac-R-G-R-S-S-L-(therapeutic agent) (SEQ ID NO: 470);
Ac-R-G-R-S-S-Cha-(therapeutic agent) (SEQ ID NO: 471 );
Ac-R-G-R-S-Cha-(therapeutic agent) (SEQ 1D NO: 472);
Ac-R-A-R-S-L-(therapeutic agent) (SEQ ID NO: 473);
Ac-R-A-R-S-S-L-(therapeutic agent) (SEQ ID NO: 474);
Ac-R-S-R-S-L-(therapeutic agent) (SEQ ID NO: 475);
Ac-R-S-R-S-S-L-(therapeutic agent) (SEQ ID NO: 476);
Ac-R-S-R-S-Cha-(therapeutic agent) (SEQ 1D NO: 477);
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-~ z~-
Ac-R-S-R-S-S-Cha-(therapeutic agent) (SEQ ID NO: 478);
Ac-R-F-R-S-L-(therapeutic agent) (SEQ ID NO: 479);
Ac-R-F-R-S-Cha-(therapeutic agent) (SEQ ID NO: 480);
Ac-Y-G-R-S-S-L-(therapeutic agent) (SEQ ID NO: 481 );
Ac-M(02)-S-R-S-L-(therapeutic agent) (SEQ ID NO: 482);
Ac-R-R-Q-S-R-A-A-(therapeutic agent) (SEQ ID NO: 105);
Ac-R-R-Q-S-R-I-(therapeutic agent) (SEQ ID NO: 610);
Ac-R-R-Q-S-R-S-S-L-(therapeutic agent) (SEQ ID NO: 543);
Ac-R-R-Q-S-R-S-L-(therapeutic agent) (SEQ ID NO: 544);
Ac-R-G-S-G-R-S-L-(therapeutic agent) ('SEQ ID NO: 545);
Ac-R-G-S-G-R--S-nL-(therapeutic agent) (SEQ (D N0: 546);
Ac-R-G-S-G-R-A-nL-(therapeutic agent) (SEQ ID NO: 547);
Ac-R-G-S-G-R-S-S-L-(therapeutic agent) (SEQ ID NO: 548);
Ac-I-V-S-G-R-A-S-L-(therapeutic agent) (SEQ ID NO: 549);
Ac-R-R-Q-S-R-A-(therapeutic agent) (SEQ ID NO: 108);
Ac-R-R-Q-S-R-I-(therapeutic agent) (SEQ ID NO: 1 1 1 );
Ac-L-R-R-Q-S-R-A-A-(therapeutic agent) (SEQ ID NO: 106);
Ac-L-R-R-Q-S-R-G-G-(therapeutic agent) (SEQ ID NO: 109);
Ac-L-R-R-Q-S-R-A-(therapeutic agent) (SEQ ID NO: 110);
Ac-L-R-R-Q-S-R-A-I-(therapeutic agent) (SEQ ID NO: 1 12);
Ac-L-R-R-Q-S-R-A-1-(therapeutic agent) (SEQ ID NO: 61 1 );
Ac-L-R-R-Q-S-R-S-S-L-(therapeutic agent) (SEQ ID NO: 550); and
Ac-L-R-R-Q-S-R-S-L-(therapeutic agent) (SEQ ID NO: 551 );
In another embodiment, the conjugates provided herein are
selecfied from:
Ac-S-G-R-S-L-(therapeutic agent) (SEQ ID NO: 362);
Ac-S-G-R-S-S-L-(therapeutic agent) (SEQ ID NO: 363);
Ac-S-G-R-S-S-S-L-(therapeutic agent) (SEQ ID NO: 364);
Ac-S-G-R-S-nL-(therapeutic agent) (SEQ ID NO: 365);
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-128-
Ac-S-G-R-S-nV-(therapeutic agent) (SEQ ID NO: 366); isomer 1
Ac-S-G-R-S-nV-(therapeutic agent) (SEQ ID NO: 367); isomer 2
Ac-S-G-R-S-G(hex)-(therapeutic agent) (SEQ ID NO: 368);
Ac-S-G-R-S-Cha-(therapeutic agent) (SEQ ID NO: 369);
Ac-S-G-R-S-hCha-(therapeutic agent) (SEQ ID NO: 370);
Ac-S-A-R-S-L-(therapeutic agent) (SEQ ID NO: 371 );
Ac-S-A-R-S-S-L-(therapeutic agent) (SEQ ID NO: 372);
Ac-S-S-R-S-nL-(therapeutic agent) (SEQ ID NO: 373);
Ac-T-G-R-S-Abu-(therapeutic agent) (SEQ ID NO: 374);
Ac-T-G-R-S-L-(therapeutic agent) (SEQ ID NO: 375);
Ac-T-G-R-S-nV-(therapeutic agent) (SEQ ID NO: 376);
Ac-T-G-R-S-nL-(therapeutic agent) (SEQ ID NO: 377);
Ac-T-G-R-S-G(hex)-(therapeutic agent) (SEQ ID NO: 378);
Ac-T-G-R-S-Cha-(therapeutic agent) (SEQ ID NO: 379);
Ac-T-G-R-S-hCha-(therapeutic agent) (SEQ ID NO: 380);
Ac-T-G-R-T-Abu-(therapeutic agent) (SEQ ID NO: 381 );
Ac-T-G-R-hS-nL-(therapeutic agent) (SEQ ID NO: 382);
Ac-T-G-R-Abu-nL-(therapeutic agent) (SEQ ID NO: 383);
Ac-T-G-R-Abu-nV-(therapeutic agent) (SEQ ID NO: 384);
Ac-T-G-F(Gn)-S-nL-(therapeutic agent) (SEQ ID NO: 385);
Ac-T-G-F(Gn)-S-Cha-(therapeutic agent) (SEQ ID NO: 386);
Ac-T-G-F(Gn)-Abu-nV-(therapeutic agent) (SEQ ID NO: 387);
Ac-T-G-K(alloc)-S-nL-(therapeutic agent) (SEQ ID NO: 388);
Ac-T-G-K-S-nL-(therapeutic agent) (SEQ ID NO: 389);
Ac-T-G-hR-S-nL-(therapeutic agent) (SEQ ID NO: 390);
Ac-(hS)G-G-R-S-nL-(therapeutic agent) (SEQ ID NO: 391 );
MeOCO-T-G-R-S-nL-(therapeutic agent) (SEQ ID NO: 392);
PhS02-T-G-R-S-nL-(therapeutic agent) (SEQ ID NO: 393);
Me0EtC0-T-G-R-S-nL-(therapeutic agent) (SEQ iD NO: 394);
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-129-
Me0(Et0)2Ac-T-G-R-S-nL-(therapeutic agent) (SEQ ID NO: 395);
4-oxo-Pentanoyl-T-G-R-S-nL-(therapeutic agent) (SEQ ID NO: 396);
3,4-MethyldioxyPhAc-T-G-R-S-nL-(therapeutic agent) (SEQ ID N0: 397);
2-PyridylAc-T-G-R-S-nL-(therapeutic agent) (SEQ ID NO: 398);
PhOAc-T-G-R-S-nL-(therapeutic agent) (SEQ ID NO: 399);
L-3-PhLactyl-T-G-R-S-nL-(therapeutic agent) (SEQ ID NO: 400);
MeOAc-T-G-R-S-nL-(therapeutic agent) (SEQ ID NO: 401 );
PhAc-T-G-R-S-nL-(therapeutic agent) (SEQ ID NO: 402);
MeOEtOCO-T-G-R-S-nL-(therapeutic agent) (SEQ ID NO: 403);
MeOEtOAc-T-G-R-S-nL-(therapeutic agent) (SEQ ID NO: 404);
HOOCButa-T-G-R-S-nL-(therapeutic agent) (SEQ ID NO: 405);
Z-T-G-R-S-nL-(therapeutic agent) (SEQ ID NO: 406);
EtOCO-T-G-R-S-nL-(therapeutic agent) (SEQ ID NO: 407);
~3A-T-G-R-S-nL-(therapeutic agent) (SEQ ID NO: 408);
Pent-4-ynoyl-T-G-R-S-nL-(therapeutic agent) (SEQ ID NO: 409);
NapAc-T-G-R-S-nL-(therapeutic agent) (SEQ ID NO: 410);
iBoc-T-G-R-S-nL-(therapeutic agent) (SEQ ID NO: 41 1 );
HOAc-T-G-R-S-nL-(therapeutic agent) (SEQ ID NO: 412);
MeSucc-T-G-R-S-nL-(therapeutic agent) (SEQ ID NO: 413);
N,N-diMeGly-T-G-R-S-nL-(therapeutic agent) (SEQ ID NO: 414);
Succ-T-G-R-S-nL-(therapeutic agent) (SEQ ID NO: 415);
HCO-T-G-R-S-nL-(therapeutic agent) (SEQ ID NO: 416);
Ac-T-A-R-S-nL-(therapeutic agent) (SEQ ID NO: 417);
Ac-T-A-F(Gn)-S-nL-(therapeutic agent) (SEQ ID NO: 418);
Ac-T-A-R-Abu-nV-(therapeutic agent) (SEQ ID NO: 419);
Ac-T-A-R-S-Abu-(therapeutic agent) (SEQ ID NO: 420);
Ac-T-A-R-T-Abu-(therapeutic agent) (SEQ ID NO: 421 );
Ac-T-S(O-Me)-R-S-nL-(therapeutic agent) (SEQ ID NO: 422);
Ac-T-hS-R-S-nL-(therapeutic agent) (SEQ ID NO: 423);
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-130-
Ac-T-(1-Me)H-R-S-nL-(therapeutic agent) (SEQ ID NO: 424);
Ac-T-(3-Me)H-R-S-nL-(therapeutic agent) (SEQ ID NO: 425);
Ac-T-H-R-S-nL-(therapeutic agent) (SEQ ID NO: 426);
Ac-T-Sar-R-S-nL-(therapeutic agent) (SEQ ID NO: 427);
Ac-T-nV-R-S-nL-(therapeutic agent) (SEQ ID NO: 428);
Ac-T-nL-R-S-nL-(therapeutic agent) (SEQ ID NO: 429);
Ac-T-A-R-S-Cha-(therapeutic agent) (SEQ ID NO: 430);
Ac-T-Abu-R-S-nL-(therapeutic agent) (SEQ ID NO: 431 );
Ac-4,4diMeThr-G-R-S-nL-(therapeutic agent) (SEQ ID NO: 432);
Ac-hS-G-R-S-nL-(therapeutic agent) (SEQ ID NO: 433);
Ac-hS-G-R-hS-Cha-(therapeutic agent) (SEQ ID NO: 434);
Ac-hS-G-R-S-Cha-(therapeutic agent) (SEQ ID NO: 435);
Ac-hS-G-R-T-Cha-(therapeutic agent) (SEQ ID NO: 436);
Ac-hS-A-R-S-Cha-(therapeutic agent) (SEQ ID NO: 437);
Ac-N-G-R-S-nL-(therapeutic agent) (SEQ ID NO: 438);
Ac-Y-G-R-S-S-L-(therapeutic agent) (SEQ ID NO: 439);
Ac-Y-G-R-S-Cha-(therapeutic agent) (SEQ ID NO: 440);
Ac-Q-G-R-S-S-nL-(therapeutic agent) (SEQ ID NO: 441 );
Ac-Q-G-R-S-S-nV-(therapeutic agent) (SEQ ID NO: 442);
Ac-L-R-G-S-G-R-S-A-(therapeutic agent) (SEQ ID NO: 573);
Ac-L-R-G-S-G-R-S-L-(therapeutic agent) (SEQ ID NO: 342);
Ac-L-R-G-S-G-R-S-L-(therapeutic agent) (SEQ ID NO: 343);
Ac-L-R-G-S-G-R-S-S-nL-(therapeutic agent) (SEQ ID NO: 344);
Ac-L-R-G-S-G-R-S-S-Cha-(therapeutic agent) (SEQ ID NO: 345);
Ac-L-R-G-dS-A-R-S-A-(therapeutic agent) (SEQ ID NO: 574);
Ac-L-R-G-S-A-R-S-S-L-(therapeutic agent) (SEQ ID N0:346 );
Ac-L-R-G-S-A-R-S-L-(therapeutic agent) (SEQ ID NO: 347);
Ac-L-R-G-S-A-R-S-S-Cha-(therapeutic agent) (SEQ ID NO: 348);
Ac-L-R-G-S-A-R-S-S-nV-(therapeutic agent) (SEQ ID NO: 349);
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-131-
Ac-L-R-G-S-A-R-S-S-nL-(therapeutic agent) (SEQ ID NO: 350);
Ac-V-I-V-S-G-R-A-L-(therapeutic agent) (SEQ ID NO: 351 );
Ac-V-I-V-S-A-R-S-L-(therapeutic agent) (SEQ 1D NO: 352);
Ac-V-I-V-S-G-R-S-S-L-(fiherapeutic agent) (SEQ ID NO: 353);
Ac-V-I-V-S-A-R-M-A-(therapeutic agent) (SEQ ID NO: 354);
Ac-V-I-V-S-A-R-nL-A-(therapeutic agent) (SEQ ID NO: 355);
Ac-V-I-V-S-A-R-S-nL-(therapeutic agent) (SEQ ID NO: 356);
Ac-V-I-V-S-A-R-S-Cha-(therapeutic agent) (SEQ ID NO: 357);
Ac-V-I-V-S-A-R-S-Cha-(therapeutic agent) (SEQ ID NO: 358);
Ac-V-I-V-S-A-R-S-S-Cha-(therapeutic agent) (SEQ ID NO: 359);
Ac-R-R-(Me)C-P-G-R-V-V-(therapeutic agent) (SEQ ID NO: 360);
Ac-R-R-nV-P-A-R-S-L-(therapeutic agent) (SEQ ID NO: 361 );
Ac-R-G-dS-A-R-S-A-(therapeutic agent) (SEQ ID NO: 309);
Ac-R-G-S-G-R-S-A-(therapeutic agent) (SEQ ID NO: 310);
Ac-R-G-S-G-R-A-L-(therapeutic agent) (SEQ ID ENO: 311 );
Ac-R-G-S-G-R-S-L-(therapeutic agent) (SEQ ID NO: 312);
Ac-R-G-S-G-R--S-nL-(therapeutic agent) (SEQ ID NO: 313);
Ac-R-G-S-G-R-A-nL-(therapeutic agent) (SEQ ID NO: 314);
Ac-R-G-S-G-R-S-S-L-(therapeutic agent) (SEQ ID NO: 315);
Ac-R-G-S-G-R-S-Cha-(therapeutic agent) (SEQ ID NO: 316);
Ac-R-G-S-G-R-S-S-Cha-(therapeutic agent) (SEQ ID N0: 317);
Ac-R-G-S-A-R-S-Cha-(therapeutic agent) (SEQ ID N0: 318);
Ac-R-G-S-A-R-S-S-(therapeutic agent) (SEQ ID NO: 319);
Ac-R-G-S-A-R-S-nV-(therapeutic agent) (SEQ ID NO: 320);
Ac-R-G-S-A-R-S-S-nV -(therapeutic agent) (SEQ ID NO: 321 );
Ac-R-G-S-A-R-S-L-(therapeutic agent) (SEQ ID NO: 322);
Ac-R-(Me)C-P-G-R-V-V-(therapeutic agent) (SEQ ID N0: 323);
Ac-R-(Me)C-P-G-R-V-V-(therapeutic agent) (SEQ ID NO: 324);
Ac-R-C(Me)-P-G-R-S-L-(therapeutic agent) (SEQ ID NO: 325);
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-132-
Ac-R-L-P-G-R-S-L-(therapeutic agent) (SEQ ID N0: 326);
Ac-R-V-P-G-R-S-L-(therapeutic agent) (SEQ ID NO: 327);
Ac-R-V-P-G-R-S-L-(therapeutic agent) (SEQ ID NO: 328);
Ac-R-nL-P-G-R-S-L-(therapeutic agent) (SEQ ID NO: 329);
Ac-R-G(tBu)-P-A-R-S-L-(therapeutic agent) (SEQ ID NO: 330);
Ac-R-L-P-A-R-S-L-(therapeutic agent) (SEQ ID NO: 331 );
Ac-R-V-P-A-R-S-L-(therapeutic agent) (SEQ ID NO: 332);
Ac-R-nL-P-A-R-S-L-(therapeutic agent) (SEQ ID NO: 333);
Ac-I-V-S-G-R-A-L-(therapeutic agent) (SEQ ID NO: 334);
Ac-I-V-S-G-R-S-S-L-(therapeutic agent) (SEQ ID NO: 335);
Ac-I-V-S-G-R-A-S-L-(therapeutic agent) (SEQ ID NO: 336);
Ac-I-V-S-A-R-M-A-(therapeutic agent) (SEQ ID NO: 337);
Ac-I-V-S-A-R-nL-A-(therapeutic agent) (SEQ ID NO: 338);
Ac-I-V-S-A-R-S-L-(therapeutic agent) (SEQ ID NO: 339);
Ac-I-V-S-A-R-S-nL-(therapeutic agent) (SEQ ID NO: 340);
Ac-I-V-S-A-R-S-S-L-(therapeutic agent) (SEQ ID NO: 341 );
Ac-G-S-G-R-S-A-(therapeutic agent) (SEQ ID NO: 585);
Ac-G-S-G-R-S-L-(therapeutic agent) (SEQ ID NO: 277);
Ac-G-S-G-R-A-L-(therapeutic agent) (SEQ ID NO: 278);
Ac-G-S-G-R-S-S-L-(therapeutic agent) (SEQ ID NO: 279);
Ac-G-S-G-R-L-(therapeutic agent) (SEQ ID NO: 280);
Ac-G-S-G-(4-guan)Phg-S-L-(therapeutic agent) (SEQ ID NO: 281);
Ac-G-S-G-R-S-S-Cha-(therapeutic agent) (SEQ ID NO: 282);
Ac-G-S-G-R-A-S-L-(therapeutic agent) (SEQ ID NO: 283);
Ac-G-S-G-R-S-nL-(therapeutic agent) (SEQ ID NO: 284);
Ac-G-T-G-R-S-nL-(therapeutic agent) (SEQ ID NO: 285);
Succ-bA-T-G-R-S-nL-(therapeutic agent) (SEQ ID NO: 286);
Ac-G-T-G-R-S-hCha-(therapeutic agent) (SEQ ID N0: 287);
Ac-G-hS-G-R-S-nL-(therapeutic agent) (SEQ ID NO: 288);
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-133-
Ac-G-dS-A-R-S-A-(therapeufiic agent) (SEQ ID NO: 289);
Ac-G-S-A-R-S-L-(therapeutic agent) (SEO ID N0: 290);
Ac-G-S-A-R-S-S-Cha-(therapeutic agent) (SEQ ID NO: 291 );
Ac-G-S-A-R-S-S-L-(therapeutic agent) (SEQ ID NO: 292);
Ac-G-S-A-R-A-S-L-(therapeutic agent) (SEQ ID NO: 293);
Ac-V-S-G-R-S-L-(therapeutic agent) (SEQ ID NO: 294);
Ac-V-S-G-R-A-L-(therapeutic agent) (SEQ ID NO: 295);
Ac-V-S-G-R-A-S-L-(therapeutic agent) (SEQ ID NO: 296);
Ac-V-S-G-R-S-S-L-(therapeutic agent) (SEQ ID NO: 297);
Ac-V-S-A-R-M-A-(therapeutic agent) (SEQ ID NO: 298);
Ac-V-S-A-R-nL-A-(therapeutic agent) (SEQ 1D NO: 299);
Ac-V-S-A-R-S-nL-(therapeutic agent) (SEQ ID N0: 300);
Ac-V-S-A-R-S-L-(therapeutic agent) (SEQ ID NO: 301 );
Ac-(Me)C-P-G-R-V-V-(therapeutic agent) (SEQ ID NO: 302);
Ac-(Me)C-P-G-R-V-V-(therapeutic agent) (SEQ ID NO: 303);
Ac-C(Me)-P-G-R-A-L-(therapeutic agent) (SEQ ID NO: 304);
Ac-C(Me)-P-G-R-S-L-(therapeutic agent) (SEQ ID NO: 305);
Ac-C(Me)-P-A-R-S-L-(therapeutic agent) (SEQ ID NO: 306);
Ac-C(Me)-P-A-R-A-S-L-(therapeutic agent) (SEQ ID NO: 307);and
Ac-G(tBu)-P-G-R-S-L-(therapeutic agent) (SEQ ID NO: 308);
In another embodiment, the conjugates provided herein are
selected from:
Ac-Q-S-R-A-A-(therapeutic agent) (SEQ ID NO: 552);
Ac-Q-S-R-S-A-(therapeutic agent) (SEQ ID NO: 553);
Ac-Q-S-R-S-G-(therapeutic agent) (SEQ ID NO: 554);
Ac-R-S-R-A-A-(therapeutic agent) (SEQ ID NO: 555);
Ac-R-Q.-S-R-A-A-(therapeutic agent) (SEQ ID NO: 556);
Ac-R-Q-S-R-S-A-(therapeutic agent) (SEQ ID NO: 557); and
Ac-R-Q-S-R-S-A-A-(therapeutic agent) (SEQ ID NO: 558);
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-134-
In another embodiment, the conjugates provided herein are
selected from:
Ac-R-G-S-G-R-S-A-(therapeutic agent) (SEQ ID NO: 559);
Ac-S-G-R-A-A-(therapeutic agent) (SEQ ID NO: 560);
Ac-S-G-R-S-A-(therapeutic agent) (SEQ ID NO: 561 );
Ac-S-G-R-S-S-A-(therapeutic agent) (SEQ ID NO: 562);
Ac-S-G-R-A-S-A-(therapeutic agent) (SEQ ID NO: 563);
Ac-S-G-R-S-G-(therapeutic agent) (SEC2 ID NO: 564); .
Ac-S-G-R-S-S-G-(therapeutic agent) (SEQ ID NO: 565);
Ac-S-G-R-S-G-A-(therapeutic agent) (SEQ ID NO: 566);
Ac-S-G-R-S-G-G-(therapeutic agent) (SEQ ID NO: 567); and
Ac-G-T-G-R-S-G-G-(therapeutic agent) (SEQ ID NO: 568);
In another embodiment, the conjugates provided herein are
selected from:
Ac-L-R-R-Q-S-R-A-A-(therapeutic agent) (SEQ ID NO: 597);
MeS02-dA(Chx)-Abu-R-S-L-(therapeufiic agent) (SEQ ID NO: 598);
Ac-R-A-R-S-L-(therapeutic agent) (SEQ ID NO: 599);
Ac-dA(Chx)-Abu-R-S-L-(therapeutic agent) (SEQ ID NO: 600);
Ac-dA(Chx)-Abu-R-S-S-L-(therapeutic agent) (SEQ ID NO: 601 );
Ac-Q-G-R-S-S-L-(therapeutic agent) (SEQ ID NO: 602);
MeOCO-dhF-P(OH)-R-S-S-L-(therapeutic agent) (SEQ ID NO: 603);
MeOCO-Quat4-G-R-S-L-(therapeutic agent) (SEQ ID NO: 604);
Ac-dCha-P(OH)-R-S-S-L-(therapeutic agent) (SEQ ID NO: 605);
Ac-dCha-Abu-R-S-S-A-(therapeutic agent) (SEQ ID NO: 606);
MeOCO-Quat2-G-R-S-L-(therapeutic agent) (SEQ ID NO: 607);
MeOCO-Quat3-G-R-S-L-(therapeutic agent) (SEQ ID NO: 608); and
MeOCO-Quat-G-R-S-L-(therapeutic agent) (SEQ ID NO: 609).
It also understood that conjugates containing the above peptidic
substrate portions can be prepared with other capping groups in place of
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-135-
Ac (see, e.g., the description herein of the capping groups X").
Therapeutic agents for use in the above conjugates include, for example,
cytotoxic agents, such as, but not limited to, a toxin such as abrin,
ricin A, pseudomonas exotoxin shiga toxin, diphtheria toxin and other
such toxins and toxic portions thereof; proteins such as tumor necrosis
factor, interferons, such as a-interferon and gamma-interferon, pro-
coagulants such as tissue factor and tissue factor variants, pro-apoptotic
agents such FAS-ligand, nerve growth factor, platelet derived growth
factor, tissue plasminogen activator; biological response modifiers such
as, for example, lymphokines, interleukin- I (1L-I), interleukin-2 (IL-2),
interleukin-6 (IL-61, granulocyte macrophage colony stimulating factor
(GMCSF), granulocyte colony stimulating factor (G-CSF), fibroblast
growth factors (FGFs) and other growth factors, the methotrexate group
of drugs, the anthracycline family of drugs, the vinca alkaloid drugs, the
mitomycins, the bleomycins, the cytotoxic nucleosides including cytosine
arabinosides and difluoronucleosides, the pteridine family of drugs,
diynenes, the taxanes and the podophyllotoxins. All such conjugates are
within the scope of the instant disclosure and can be prepared and used
as disclosed herein.
Thus, the conjugates provided herein include, but are not limified
to, those disclosed herein where the therapeutic agent is, e.g.,
doxorubicin, carminomycin, daunorubicin, detorubicin, idarubicin,
epirubicin, esorubicin, THP, AD-32, aminopterin, methotrexate,
methapterin, dichloromethotrexate, mitomycin C, porfiromycin,
5-fluorouracil, 6-mercaptopurine, cytosine arabinoside, podophyllotoxin,
or podophyllotoxin derivatives such as etoposide or etoposide phosphate,
melphalan, vinblastine, vincristine, leurosidine, vindesine, leurosine, taxol,
estramustine, cisplatin, combretastatin and analogs, and
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-136-
cyclophosphamide. In one embodiment, the therapeutic agent is
doxorubicin. In another embodiment, the therapeutic agent is taxol.
Any conjugates corresponding to the above conjugates or any
conjugates disclosed herein where the P1' and/or P2' residues are lle in
place of Ala are within the scope of the instant disclosure and can be
prepared and used as disclosed herein.
Any peptidic substrates formed by permutation and selection of
amino acids from those set forth in the above definitions of P groups are
contemplated.
D. Preparation of the Conjugates
The peptidic substrates of the conjugates provided herein are
synthesized from their constituent amino acids by conventional peptide
synthesis techniques, such as by solid-phase technology. The peptidic
substrates are then purified by reverse-phase high performance liquid
chromatography (HPLC).
The peptide acids can be prepared from their constituent Fmoc-
aminoacids. Standard methods of peptide synthesis are disclosed, for
example, in the following works: Synthesis Notes Section, NovaBiochem
Catalog 2002/3, Schroeder et al., "The Peptides", Vol. 1, Academic
Press 1965; Bodansky et al., "Peptide Synthesis", Interscience
Publishers, 1966; McOmie (ed.) "Protective Groups in Organic
Chemistry", Plenum Press, 1973, Barany et al., "The Peptides: Analysis,
Synthesis, Biology" 2, Chapter 1, Academic Press, 1990, and Stewart et
al., "Solid Phase Peptide Synthesis'; Second Edition, Pierce Chemical
Company, 1994. The disclosures of these references are hereby
incorporated by reference.
The pharmaceutically acceptable salts of the conjugates provided
herein include the conventional non-toxic salts of the conjugates as
formed, e.g., from non-toxic inorganic or organic acids. For example,
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-137-
such conventional non-toxic salts include those derived from inorganic
acids such as hydrochloric, hydrobromic, sulfuric, sulfamic, phosphoric,
nitric and the like: and the salts prepared from organic acids such as
acetic, propionic, succinic, glycolic, stearic, lactic, malic, tartaric,
citric,
ascorbic, pamoic, malefic, hydroxymaleic, phenyl-acetic, glutamic,
benzoic, salicylic, sulfanilic, 2-acetoxy-benzoic, fumaric, toluenesulfonic,
methanesulfonic, ethane disulfonic, oxalic, isethionic, trifluoroacetic and
the like.
The conjugates provided herein that contain the peptidic moieties
containing the cell surface protease cleavage site and a therapeutic agent
can similarly be synthesized by techniques known to those of skill in the
art. For example, a free amine moiety on the therapeutic agent can be
covalently attached to the peptidic substrate at the carboxyl terminus
such that an amide bond is formed. Similarly, an amide bond can be
formed by covalently coupling an amine moiety of the peptidic substrate
and a carboxyl moiety of the therapeutic agent. For these purposes a
reagent such as 2-(1 H-benzotriazol-1-yl)-1,3,3-tetramethyl-uronium
hexafluorophosphate (known as HBTU) and 1 -hyroxybenzotriazole
hydrate (known as HOBT), dicyclohexyl-carbodiimide (DCC),
N-ethyl-N-(3-dimethylaminopropyl)- carbodiimide (EDC), diphenyl-
phosphorylazide (DPPA), benzotriazol-1-yl-oxy-Iris-(dimethylamino)-
phosphonium hexafluorophosphate (BOP) and the like, used in
combination or singularly, can be utilized.
Furthermore, the instant conjugates can be formed by a non-
peptidyl bond between the cell surface protease cleavage site and a
therapeutic agent. For example, the therapeutic agent can be covalently
attached to the carboxyl terminus of the peptidic substrate via a hydroxyl
moiety on the therapeutic agent, thereby forming an ester linkage. For
this purpose a reagent such as a combination of HBTU and HOBT, a
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-138-
combination of BOP and imidazole, a combination of DCC and DMAP, and
the like can be utilized. The carboxylic acid also can be activated by
forming the nitro-phenyl ester or the like and reacted in the presence of
DBU (1,8-diazabicyclo[5,4,0]undec-7-ene).
The instant conjugates also can be formed by attachment of the
peptidic substrate to the therapeutic agent via a linker unit. Such linker
units include, for example, a biscarbonyl alkyl diradical whereby an amine
moiety on the therapeutic agent is connected with the linker unit to form
an amide bond and the amino terminus of the peptidic substrate is
connected with the other end of the linker unit also forming an amide
bond. Conversely, a diaminoalkyl diradical linker unit, whereby a carbonyl
moiety on the cytotoxic agent is covalently attached to one of the amines
of the linker unit while the other amine of the linker unit is covalently
attached to the C-terminus of the peptidic substrate, also can be useful.
Other such linker units which are stable to the physiological environment
when not in the presence of a cell surface protease, or a soluble, shed or
released form thereof, but are cleavable upon the cleavage of the cell
surface protease proteolytic cleavage site, or a soluble, shed or released
form thereof, are also envisioned. Furthermore, linker units can be utilized
that, upon cleavage of the cell surface protease proteolytic cleavage site,
remain attached to the therapeutic agent but do not significantly decrease
the therapeutic activity of such a post-cleavage therapeutic agent
derivative when compared with an unmodified therapeutic agent.
One skilled in the art understands that in the synthesis of the
conjugates provided herein, one can need to protect various reactive
functionalities on the starting compounds and intermediates while a
desired reaction is carried out on other portions of the molecule. After the
desired reactions are complete, or at any desired time, normally such
protecting groups will be removed by, for example, hydrolytic or
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-139-
hydrogenolytic means. Such protection and deprotection steps are
conventional in organic chemistry. One skilled in the art is referred to
Protective Groups in Organic Chemistry, McOmie, ed., Plenum Press, NY,
NY (1973); and, Protective Groups in Organic Synthesis, Greene, ed.,
John Wiley & Sons, NY, NY (1991 ) for the teaching of protective groups
which can be useful in the preparation of the conjugates provided herein.
By way of example only, useful amino-protecting groups can
include, for example, C~-Coo alkanoyl groups such as formyl, acetyl,
dichloroacetyl, propionyl, hexanoyl, 3,3-diethylhexanoyl, y-chlorobutryl,
and the like; C,-Coo alkoxycarbonyl and C5-C~5 aryloxycarbonyl groups
such as tert-butoxycarbonyl, benzyloxycarbonyl, allyloxycarbonyl,
4-nitrobenzyloxycarbonyl, fluorenylmethyloxycarbonyl and cinnamoyloxy-
carbonyl; halo(C~-Coo)-alkoxycarbonyl such as 2,2,2-trichloroethoxy-
carbonyl; and C~-C~5 arylalkyl and alkenyl group such as benzyl,
phenethyl, allyl, trityl, and the like. Other commonly used amino-
protecting groups are those in the form of enamines prepared with
,~-keto-esters such as methyl or ethyl acefioacetate.
Useful carboxy-protecting groups can include, for example, C~-Coo
alkyl groups such as methyl, tert-butyl, decyl; halo C~-Coo alkyl such as
2,2,2-trichloroethyl, and 2-iodoethyl; C5-C~5 arylalkyl such as benzyl,
4-methoxybenzy], 4-nitrobenzyl, triphenylmethyl, diphenyl-methyl; C~-C~0
alkanoyloxymethyl such as acetoxy-methyl, propionoxymethyl and the
like; and groups such as phenacyl, 4-halophenacyl, allyl, dimethylallyl,
tri-(C~-C3 alkyl)silyl, such as trimethylsilyl, ~3-p-toluenesulfonylethyl,
,~3-p-nitrophenyl-thioethyl, 2,4,6-trimethylbenzyl, ~3-methylthioethyl,
phthalimidomethyl, 2,4-dinitro-phenylsulphenyl, 2-nitrobenzhydryl and
related groups.
Similarly, useful hydroxy protecting groups can include, for
example, the formyl group, the chloroacetyl group, the benzyl group, the
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-140-
benzhydryl group, the trityl group, the 4-nitrobenzyl group, the
trimethylsilyl group, the phenacyl group, the tert-butyl group, the
methoxymethyl group, the tetrahydropyranyl group, the tert-butyl-
dimethylsilyl group and the like.
With respect to the embodiment of a pepfiidic substrate combined
with the anthracycline antibiotic doxorubicin, the following Reaction
Schemes illustrate the synthesis of the conjugates provided herein.
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-141-
REACTION SCHEME I
O OH O
~CHZOH
~~'n0 H
a s
OMe O OH O
Me O O
- O OH
NHZ
OH ~ ~ CHZOH
dox I I ,~'hOH
OMe O OH O
O OH O Me O
CHZO-peptide-X" OH NH
~~'~IOH
peptide-X°
OMe O OH O
M a e/O e'
~N~HZ
OH
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-142-
REACTION SCHEME II
O OH O
~CHZOH
~~'~IOH
r /
OMe O OH O
Me O
O OH NHz
NHZ
OH ~ ~ CHzOH
dox I I ~~'~IOH
OMe O OH O
r;
O OH NH-peptide-X° Me O
CNZOH OH NH-protect
~~~~IOH
I
OMe O OH O
Me O
NHz
OH
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-143-
REACTION SCHEME III
O OH O
W ~ , ~CHZOH O \ /(CHZ)ZCOZH
'hO HH
HN
O OH 'N
OMe O OH O
~CHZOH
Me O ~ ~ ~~~~~OH
NHS
OH
OMe O OH O
dox
Me°'~O
O OH NHZ
O OH N ~N ~~~peptide-X°
O
~~'~IOH CHZOH
OMe O OH O
Me O
OH
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-144-
REACTION SCHEME IV
CHZOH
OH
OMe O OH O
Me O
dox
NH
HaNHN-peptide-X°
H
N ~N -peptide-X°
O OH
\ \
~~'~IOH CHZOH
OMe O OH O
Me~
~N~H' ~
OH
n nu O
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-145-
REACTION SCHEME V
n nu O
CH3 O
B rz
'- , CHzBr
_ CC14 ~~IOH
OMe O OH O
Me O
dox
NHz
OH HST
HzN~ N-peptide-X
II I
O H
CHzS
i
,N
OMe O OH O ~N-peptide-X°
O H
Me O
NHz
OH
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-146-
Reaction Scheme VI illustrates preparation of the conjugates
provided herein of a peptidic substrate and the vinca alkaloid cytotoxic
agent vinblastine wherein the attachment of vinblastine is at the
C-terminus of the peptidic substrate. The use of the 1,3-diaminopropane
linker is illustrative only; other linker units between the carbonyl of
vinblastine and the C-terminus of the peptidic substrate are also
envisioned (e.g., (CH2)"-T-(CH2)~). The acyl azide starting material is
prepared from vinglasine by reaction with hydrazine (60-65 °C, MeOH),
followed by reaction with HCI/DMF/isoamyl nitrite. Furthermore, Reaction
Scheme VI illustrates a synthesis of conjugates wherein the C4-hydroxy
moiety is reacetylated following the addition of the linker unit. It is known
that the desacetyl vinblastine conjugate also is efficacious and can be
prepared by eliminating the steps shown in Reaction Scheme VI of
protecting the primary amine of the linker and reacting the intermediate
with acetic anhydride, followed by deprotection of the amine (see, e.g.,
International Patent Application Publication No. WO 98/10651 ).
Conjugation of the peptidic substrate at other positions and functional
groups of vinblastine can be readily accomplished by one of ordinary skill
in the art and also is expected to provide conjugates that are substrates
for cell surface proteases, or a soluble, shed or released form thereof.
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-147-
REACTION SC$EME VI
OH
1. H_N-CHaCH_CH: NEtz
2. BOC,O
,CH;
Me _- OH
CON
n 3 i
,.. N I ~. N
~ ~ I. AcZO, pyridine I 'ACT-I,CH
~CHzCH3
CH O ~ N H CH~O N ~~Ac
I . " 2. aq. HCl Me ' OH
Me - OH -
O~N~NH-BOC O N NHZ
I ~ H
H N
peptide-X° ( ~'' ~ CHZCH3
CH~O / N ~~~Ac
Me -- 'OH
O ~ N ~NH-peptide-X°
I
H
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-148-
Reaction Scheme VII illustrates preparation of certain of the
conjugates utilized in the compositions and methods provided herein
wherein the peptidic substrates are combined with the vinca alkaloid
cytotoxic agent vinblastine. Attachment of the N-terminus of the peptidic
substrate to vinblastine is illustrated (S.P. Kandukuri et al. (1985) J. Med.
Chem. 28:1079-1088) .
It also is understood that conjugates can be prepared wherein the
N-terminus of the peptidic substrate utilized in the compositions and
methods provided herein is combined with one therapeutic agent, such as
a cytotoxic agent, such as vinbiastine, while the C-fierminus is
simultaneously attached to anofiher cytotoxic agent, which is the same or
different cytotoxic agent, such as doxorubicin. Reaction Scheme VIII
illustrates the synthesis of such a polycytotoxic agent conjugate. Such a
polycytotoxic conjugate can offer advantages over a conjugate containing
only one cytotoxic agent.
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-149-
REACTION SCHEME VII
OH
NzH4, reflux, MeOH
;HZCH3
iAc
HONG
;HZCH3
CH30 iH
:HZCH3
CH30 ~H
Me _- OH
vinblastine COZCH3
Me - OH
CONHNHZ
Me - OH
C ON3
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-150-
REACTION SCHEME VII (Continued)
1. peptide-NR~Rc
2. Ac,O, pyriding
'HZCH3
~H
H,CH3
CH30 ~Ac
Me - OH
CO-peptide-NR''Re
Me _- OH
CONS
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-151-
REACTION SCHEME VIII
1. peptide-NR''R°
2. Ac20, pyriding
or
1. peptide-OMe
~HzCH~ 2. LiOH
~H
Me _- OH 3. Ac,O, pyridine
CONS
doxorubicin
~H,CH3
CH30 ~Ac
Me - OH
CO-peptide
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-152-
REACTION SCHEME VIII (Continued)
OH
10
;HZCH3
~Ac
Me - OH
i~0
peptide
O H
NH
Me O
OMe O OH O
\ \
OH
~~~iI~CHZOH
O OH
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-153-
With respect to the embodiment of a peptidic substrate combined
with desacetylvinblastine, the following Reaction Schemes IX and X
illustrate the synthesis of the conjugates provided herein.
Reaction Scheme IX illustrates preparation of conjugates provided
herein containing the peptidic substrates provided herein and the vinca
alkaloid cytotoxic agent vinblastine wherein the attachment of the oxygen
of the 4-desacetylvinblastine is at the C-terminus of the peptidic
substrate. While other sequences of reactions can be useful in forming
such conjugates, it is known that initial attachment of a single amino acid
to the 4-oxygen and subsequent attachment of the remaining peptidic
substrate sequence to that amino acid is an exemplarary method (see,
International Patenfi Application Publication No. WO 99/28345). It also is
known that 3,4-dihydro-3-hydroxy-4-oxo-1,2,3-benzotriazine (ODHBT)
can be utilized in place of HOAt in the final coupling step.
Reaction Scheme X illustrates preparation of conjugates of the
peptidic substrates provided herein wherein a hydroxy alkanoyl acid is
used as a linker between the vinca drug and the peptidic substrate.
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-154-
REACTION SCHEME IX
OH
N=H~, 20-25 °C, MeOH
;H,CH3
iAc
1. N-protected amino
acid chloride
pyridine/CHzCI,
'H,CH3
CH30 'H 2. deprotection
d esa cetylvin blastin a
Me _- OH
COZMe
vinblastine
Me - OH
COzMe
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-155-
REACTION SCHEME IX (Continued)
OH
peptide-X°, HOAt
2,4,6-collidirie
EDC, DMF
~HzCH~
~-amino acid
Me _- OH
COZMe
~HzCH3
CH30 t-amino acid-peptide-X°
Me - OH
CO~Me
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-156-
REACTION SCHEME X
N-protected amino acid , DMAP/DCC
HO-(CH,)~T(CH,)~-CO_benzyl
N-protected amino acid-O-(CH~) T(CH=)~-COzbenzyl
hydrogenation
OH
,~IBt
1. N-protected amino acid-O-(CHz)~T(CH~)~-COZH
DMAP/DCC
2. deprotect
N ~CO,CH,
H ~ ~ N ~I
''~CHZCH3
CH3O v N _ OH
I
Me _- OH
CO,Me
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-157-
REACTION SCHEME X (Continued)
peptide-X°, HOAt
2,4,6-collidine
EDC, DMF
:HZCH;
Me _- OH O
COZMe
amino acid-O-(CHZ)~T(CHZ)/
~HZCH3
CH30
Me - OH
_- O
COzMe
X°-peptide-amino acid-O-(CHZ)UT(CH,)~
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-158-
Taxol conjugates provided herein may be prepared by the general
method provided below. The preparation of 7-Ala-Taxol and 7-Gly-Taxol
is disclosed in Mathew et al. (1992) J. Med. Chem. 35:145-151.
O
Ac0 O O NHz
O Ph O
Ph~N~~~On~w wn
i ~ O
H OH
OH pg~ OAc
Ac-Arg-Gln-Ser-Arg-Ala-OH
HATU
2,6-lutidine
O H
i
N -Ala-Arg-Ser-Gln-Arg-Ac
Ac0 O O
O Ph O
Ph~N~~~On~, ~~n
i _ ~ O
H OH
OH ~gZ OAc
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-159-
E. Formulation and administration of pharmaceutical compositions
The conjugates and compositions provided herein are used for
treating, preventing, or ameliorating one or more symptoms of any
disease or disorder that can be treated by targeting a cell or tissue that
expresses a cell surface protease, particularly, a serine protease, on its
surface at higher levels compared to other cells, or soluble, shed or
released forms thereof. These include, but are not limited to,
hyperproliferative diseases, such as cancer, any disease associated with
aberrant or excessive angiogenesis, autoimmune disorders, inflammatory
diseases and any other disease for which an appropriate cell surface
protease, including cell-associated and cell-localized proteases, can be
identified.
The pharmaceutical compositions provided herein contain
therapeutically effective amounts of one or more of the conjugates
provided herein that are useful in the prevention, treatment, or
amelioration of one or more of the symptoms of diseases or disorders
associated with undesired and/or uncontrolled angiogenesis or
neovascularization. Such diseases or disorders include, but are not
limited to, solid neoplasms, including lung, colon, esophageal, breast,
ovarian and prostate cancers; vascular malformations and cardiovascular
disorders, including, but not limited to, angiofibroma, angiolipoma,
atherosclerosis, restenosis/reperfusion injury, arteriovenous
malformations, hemangiomatosis and vascular adhesions,
dyschondroplasia with vascular hematomas, hereditary hemorrhagic
telangiectasia and Von Hipple Lindau syndrome; chronic inflammatory
diseases and abherent wound repairs, including, but not limited to,
diabetes mellitus, hemophiliac joints, inflammatory bowel disease,
nonhealing fractures, rapidly progressing periodontitis, juvenile
periodontitis, psoriasis, rheumatoid arthritis, venous stasis ulcers,
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-160-
granulations-burns, hypertrophic scars, liver cirrhosis, osteoradionecrosis,
postoperative adhesions, pyogenic granuloma and systemic sclerosis;
circulatory disorders, including, but not limited to, Raynaud's
phenomenon; crest syndromes, including, but not limited to, calcinosis,
esophageal, dyomotiloty, sclerodactyly and teangiectasis; dermatological
disorders, including, but not limited to, systemic vasculitis, scleroderma,
pyoderma gangrenosum, vasculopathy, venous, arterial ulcers, Sturge-
Weber syndrome, Port-wine stains, blue rubber bleb nevus syndrome,
Klippel-Trenaunay-Weber syndrome and Osier-Weber-Rendu syndrome;
and ocular disorders, including, but not limited to, blindness caused by
ocular neovascular disease, corneal graft neovascularization, macular
degeneration in the eye, neovascular glaucoma, trachoma, diabetic
retinopathy, myopic degeneration, retinopathy of prematurity, retrolental
fibroplasia and corneal neovascularization.
The compositions contain one or more conjugates provided herein.
The conjugates can be formulated into suitable pharmaceutical
preparations such as, for example, solutions, suspensions, tablets,
dispersible tablets, pills, capsules, powders, sustained release
formulations or elixirs, for oral administration or in sterile solutions or
suspensions for parenteral administration, as well as transdermal patch
preparation and dry powder inhalers. Typically the cojugates described
above are formulated into pharmaceutical compositions using techniques
and procedures well lenown in the art (see, e. g., Ansel (1985)
Introduction to Pharmaceutical Dosage Forms, Fourth Edition, p. 126)).
Effective concentrations can be empirically determined using animal
models, in vitro models or test subjects.
In the compositions, effective concentrations of one or more
conjugates or pharmaceutically acceptable derivatives thereof is (are)
mixed with a suitable pharmaceutical carrier or vehicle. The conjugates
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-161-
can be derivatized as the corresponding salts, esters, enol ethers or
esters, acids, bases, solvates or hydrates prior to formulation, as
described above. The concentrations of the conjugates in the
compositions are effective for delivery of an amount, upon administration,
that treats, prevents, or ameliorates one or more of the symptoms of
diseases or disorders associated with undesired and/or uncontrolled
angiogenesis or neovascularization. Such diseases or disorders include,
but are not limited to, solid neoplasms; vascular malformations and
cardiovascular disorders, including, but not limited to, angiofibroma,
angiolipoma, atherosclerosis, restenosis/reperfusion injury, arteriovenous
malformations, hemangiomatosis and vascular adhesions,
dyschondroplasia with vascular hamartomas, hereditary hemorrhagic
telangiectasia and Von Hipple Lindau syndrome; chronic inflammatory
diseases and abherent wound repairs, including, but not limited to,
diabetes mellitus, hemophiliac joints, inflammatory bowel disease,
nonhealing fractures, rapidly progressing periodontitis, juvenile
periodontitis, psoriasis, rheumatoid arthritis, venous stasis ulcers,
granulations-burns, hypertrophic scars, liver cirrhosis, osteoradionecrosis,
postoperative adhesions, pyogenic granuloma and systemic sclerosis;
circulatory disorders, including, but not limited to, Raynaud's
phenomenon; crest syndromes, including, but not limited to, calcinosis,
esophageal, dyomotiloty, sclerodactyly and teangiectasis; dermatological
disorders, including, but not limited to, systemic vasculitis, scleroderma,
pyoderma gangrenosum, vasculopathy, venous, arterial ulcers, Sturge-
Weber syndrome, Port-wine stains, blue rubber bleb nevus syndrome,
Klippel-Trenaunay-Weber syndrome and Osler-Weber-Rendu syndrome;
and ocular disorders, including, but not limited to, blindness caused by
ocular neovascular disease, corneal graft neovascularization, macular
degeneration in the eye, neovascular glaucoma, trachoma, diabetic
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-162-
retinopathy, myopic degeneration, retinopathy of prematurity, retrolental
fibroplasia and corneal neovascularization.
The conjugates herein can be formulated into pharmaceutical
compositions suitable for topical, local, intravenous and systemic
application. Effective concentrations of one or more of the conjugates are
mixed with a suitable pharmaceutical carrier or vehicle. The
concentrations or amounts of the conjugates that are effective requires
delivery of an amount, upon administration, that ameliorates the
symptoms or treats the disease. Typically, the compositions are
formulated for single dosage administration. Therapeutically effective
concentrations and amounts can be determined empirically by testing the
conjugates in known in vitro and in vivo systems, such as those
described here; dosages for humans or other animals can then be
extrapolated therefrom.
Upon mixing or addition of the conjugates) with the vehicle,.the
resulting mixture can be a solution, suspension, emulsion or other such
composition. The form of the resulting mixture depends upon a number
of factors, including the intended mode of administration and the
solubility of the conjugate in the selected carrier or vehicle. The effective
concentration is sufficient for ameliorating the symptoms of the disease,
disorder or condition treated and can be empirically determined based
upon in vitro and/or in vivo data, such as the data from the mouse
xenograft model for tumors or rabbit ophthalmic model. If necessary,
pharmaceutically acceptable salts or other derivatives of the conjugates
can be prepared.
Pharmaceutical carriers or vehicles suitable for administration of the
conjugates provided herein include any such carriers known to those
skilled in the art to be suitable for the particular mode of administration.
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-163-
In addition, the conjugates can be formulated as the sole
pharmaceutically active ingredient in the composition or can be combined
with other active ingredients.
The conjugates can be administered by any appropriate route, for
example, orally, parenterally, intravenously, intradermally,
subcutaneously, or topically, in liquid, semi-liquid or solid form and are
formulated in a manner suitable for each route of administration.
Exemplary modes of administration depend upon the indication treated.
Dermatological and ophthalmologic indications will typically be treated
locally; whereas, tumors and vascular proliferative disorders, will typically
be treated by systemic, intradermal or intramuscular, modes of
administration.
The conjugate is included in the pharmaceutically acceptable carrier
in an amount sufficient to exert a therapeutically useful effect in the
absence of undesirable side effects on the patient treated. It is
understood that number and degree of side effects depends upon the
condition for which the conjugates are administered. For example,
certain toxic and undesirable side effects are tolerated when treating life-
threatening illnesses, such as tumors, that would not be tolerated when
treating disorders of lesser consequence.
The concentration of conjugate in the composition will depend on
absorption, inactivation and excretion rates thereof, the dosage schedule,
and amount administered as well as other factors known to those of skill
in the art.
Typically a therapeutically effective dosage should produce a serum
concentration of active ingredient of from about 0.1 ng/ml to about 50-
100 ,ug/ml. The pharmaceutical compositions typically should provide a
dosage of from about 0.01 mg to about 100 - 2000 mg of conjugate,
depending upon the conjugate selected as adjusted for body surface area
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-164-
and/or weight. Typically, for intravenous or systemic treatment a daily
dosage of about between 0.05 and 0.5 mg/kg should be sufficient. Local
application for ophthalmic disorders should provide about 1 ng up to 100
,ug, generally about 1 ,gig to about 10 ,ug, per single dosage
administration. It is understood that the amount to administer is a
function of the conjugate selected, the indication treated, and possibly
the side effects that will be tolerated. Dosages can be empirically
determined using recognized models for each disorder.
Typically, the compositions are formulated for single dosage
administration. To formulate a composition, the weight fraction of
conjugate is dissolved, suspended, dispersed or otherwise mixed in a
selected vehicle at an effective concentration such that the treated
condition is relieved or ameliorated. Pharmaceutical carriers or vehicles
suitable for administration of the conjugates provided herein include any
such carriers known to those skilled in the art to be suitable for the
particular mode of administration.
In addition, the conjugates can be formulated as the sole ingredient
in the composition or can be combined with other active ingredients.
Liposomal suspensions, including tissue-targeted liposomes, particularly
tumor-targeted liposomes, also can be suitable as pharmaceutically
acceptable carriers. These can be prepared according to methods known
to those skilled in the art. For example, liposome formulations can be
prepared as described in U.S. Patent No. 4,522,811. Briefly, liposomes
such as multilamellar vesicles (MLV's) can be formed by drying down egg
phosphatidyl choline and brain phosphatidyl serine (7:3 molar ratio) on
the inside of a flask. A solution of a conjugate provided herein in
phosphate buffered saline lacking divalent rations (PBS) is added and the
flask shaken until the lipid film is dispersed. The resulting vesicles are
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-165-
washed to remove unencapsulated conjugate, pelleted by centrifugation,
and then resuspended in PBS.
The conjugate is included in the pharmaceutically acceptable carrier
in an amount sufficient to exert a therapeutically useful effect in the
absence of undesirable side effects on the patient treated. The
therapeutically effective concentration can be determined empirically by
testing the conjugates in in ~sitro and in vivo systems described herein
(see, e.g., EXAMPLES 3 and 4) and then extrapolated therefrom for
dosages for humans.
The concentration of conjugate in the pharmaceutical composition
will depend on absorption, inactivation and excretion rates of the
conjugate, the physicochemical characteristics of the conjugate, the
dosage schedule, and amount administered as well as other factors
known to those of skill in the art. For example, the amount that is
delivered is sufficient to ameliorate one or more of the symptoms of
diseases or disorders associated with undesired and/or uncontrolled
angiogenesis or neovascularization, as described herein.
Typically a therapeutically effective dosage should produce a serum
concentration of active ingredient of from about 0.1 ng/ml to about 50-
100 ,ug/ml. The pharmaceutical compositions typically should provide a
dosage of from about 0.001 mg to about 2000 mg of conjugate per kilo-
gram of body weight per day. Pharmaceutical dosage unit forms are
prepared to provide from about 1 mg to about 1000 mg and generally
from about 10 to about 500 mg of the essential active ingredient or a
combination of essential ingredients per dosage unit form.
The conjugate can be administered at once, or can be divided into
a number of smaller doses to be administered at intervals of time. It is
understood that the precise dosage and duration of treatment is a
function of the disease being treated and can be determined empirically
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-166-
using known testing protocols or by extrapolation from in vivo or in vitro
test data. It is to be noted that concentrations and dosage values can
also vary with the severity of the condition to be alleviated. It is to be
further understood that for any particular subject, specific dosage
regimens should be adjusted over time according to the individual need
and the professional judgment of the person administering or supervising
the administration of the compositions, and that the concentration ranges
set forth herein are exemplary only and are not intended to limit the
scope or practice of the claimed compositions.
Exemplary pharmaceutically acceptable derivatives include acids,
bases, enol ethers and esters, salts, esters, hydrates, solvates and
conjugate forms. The derivative is selected such that its pharmacokinetic
properties are superior to the corresponding neutral conjugate.
Thus, effective concentrations or amounts of one or more of the
conjugates described herein or pharmaceutically acceptable derivatives
thereof are mixed with a suitable pharmaceutical carrier or vehicle for
systemic, topical or local administration to form pharmaceutical
compositions. Conjugates are included in an amount effective for
ameliorating one or more symptoms of, or for treating or preventing
diseases or disorders associated with undesired and/or uncontrolled
angiogenesis or neovascularization, as described herein. The
concentration of conjugate in the composition will depend on absorption,
inactivation, excretion rates of the conjugate, the dosage schedule,
amount administered, particular formulation as well as other factors
known to those of skill in the art.
The compositions are intended to be administered by a suitable
route, including orally, parenterally, rectally, topically and locally. For
oral
administration, capsules and tablefis are generally employed. The
compositions are in liquid, semi-liquid or solid form and are formulated in
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-167-
a manner suitable for each route of administration. Exemplary modes of
administration include parenteral and oral modes of administration.
Solutions or suspensions used for parenteral, intradermal,
subcutaneous, or topical application can include any of the following
components: a sterile diluent, such as water for injection, saline solution,
fixed oil, polyethylene glycol, glycerine, propylene glycol or other
synthetic solvent; antimicrobial agents, such as benzyl alcohol and methyl
parabens; antioxidants, such as ascorbic acid and sodium bisulfite;
chelating agents, such as ethylenediaminetetraacetic acid (EDTA);
buffers, such as acetates, citrates and phosphates; and agents for the
adjustment of tonicity such as sodium chloride or dextrose. Parenteral
preparations can be enclosed in ampules, disposable syringes or single or
multiple dose vials made of glass, plastic or other suitable material.
In instances in which the conjugates exhibit insufficient solubility,
methods for solubilizing conjugates can be used. Such methods are
known to those of skill in this art, and include, but are not limited to,
using cosolvents, such as dimethylsulfoxide (DMSO), using surfactants,
such as TWEEN~, or dissolution in aqueous sodium bicarbonate.
Derivatives of the conjugates also can be used in formulating effective
pharmaceutical compositions.
Upon mixing or addition of the conjugate(s), the resulting mixture
can be a solution, suspension, emulsion or the like. The form of the
resulting mixture depends upon a number of factors, including the
intended mode of administration and the solubility of the conjugate in the
selected carrier or vehicle. The effective concentration is sufficient for
ameliorating the symptoms of the disease, disorder or condition treated
and can be empirically determined.
The pharmaceutical compositions are provided for administration to
humans and animals in unit dosage forms, such as tablets, capsules, pills,
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-168-
powders, granules, sterile parenteral solutions or suspensions, and oral
solutions or suspensions, and oil-water emulsions containing suitable
quantities of the conjugates or pharmaceutically acceptable derivatives
thereof. The conjugates and derivatives thereof are typically formulated
and administered in unit-dosage forms or multiple-dosage forms.
Unit-dose forms as used herein refers to physically discrete units suitable
for human and animal subjects and packaged individually as is known in
the art. Each unit-dose contains a predetermined quantity of the
conjugate sufficient to produce the desired therapeutic effect, in
association with the required pharmaceutical carrier, vehicle or diluent.
Examples of unit-dose forms include ampoules and syringes and
individually packaged tablets or capsules. Unit-dose forms can be
administered in fractions or multiples thereof. A multiple-dose form is a
plurality of identical unit-dosage forms packaged in a single container to
be administered in segregated unit-dose form. Examples of multiple-dose
forms include vials, bottles of tablets or capsules or bottles of pints or
gallons. Hence, multiple dose form is a multiple of unit-doses which are
not segregated in packaging.
The composition can contain along with the conjugate: a diluent
2Q such as lactose, sucrose, dicalcium phosphate, or carboxymethyl-
cellulose; a lubricant, such as magnesium stearate, calcium stearate and
talc; and a binder such as starch, natural gums, such as gum acacia-
gelatin, glucose, molasses, polyvinylpyrrolidine, celluloses and derivatives
thereof, povidone, crospovidones and other such binders known to those
of skill in the art. Liquid pharmaceutically administrable compositions
can, for example, be prepared by dissolving, dispersing, or otherwise
mixing a conjugate as defined above and optional pharmaceutical
adjuvants in a carrier, such as, for example, water, saline, aqueous
dextrose, glycerol, glycols, ethanol, and the like, to thereby form a
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-169-
solution or suspension. If desired, the pharmaceutical composition to be
administered can also contain minor amounts of nontoxic auxiliary
substances such as wetting agents, emulsifying agents, or solubilizing
agents, pH buffering agents and the like, for example, acetate, sodium
citrate, cyclodextrine derivatives, sorbitan monolaurate, triethanolamine
sodium acetate, triethanolamine oleate, and other such agents. Actual
methods of preparing such dosage forms are known, or will be apparent,
to those skilled in this art; for example, see Remington's Pharmaceutical
Sciences, Mack Publishing Company, Easton, Pa., 15th Edition, 1975.
The composition or formulation to be administered will, in any event,
contain a quantity of the conjugate in an amount sufficient to alleviate
the symptoms of the treated subject.
Dosage forms or compositions containing active ingredient in the
range of 0.005% to 100% with the balance made up from non-toxic
carrier can be prepared. For oral administration, a pharmaceutically
acceptable non-toxic composition is formed by the incorporation of any of
the normally employed excipients, such as, for example pharmaceutical
grades of mannitol, lactose, starch, magnesium stearate, talcum,
cellulose derivatives, sodium crosscarmellose, glucose, sucrose,
magnesium carbonate or sodium saccharin. Such compositions include
solutions, suspensions, tablets, capsules, powders and sustained release
formulations, such as, but not limited to, implants and microencapsulated
delivery systems, and biodegradable, biocompatible polymers, such as
collagen, ethylene vinyl acetate, polyanhydrides, polyglycolic acid,
polyorthoesters, polylactic acid and others. Methods for preparation of
these compositions are known to those skilled in the art. The
contemplated compositions can contain 0.001 %-100% active ingredient,
such as 0.1-85%, for example 75-95%.
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-170-
The conjugates or pharmaceutically acceptable derivatives can be
prepared with carriers that protect the conjugate against rapid elimination
from the body, such as time release formulations or coatings. The
compositions can include other conjugates to obtain desired combinations
of properties. The conjugates provided herein, or pharmaceutically
acceptable derivatives thereof as described herein, also can be
advantageously administered for therapeutic or prophylactic purposes
together with another pharmacological agent known in the general art to
be of value in treating one or more of the diseases or medical conditions
referred to hereinabove, such as diseases or disorders associated with
undesired and/or uncontrolled angiogenesis or neovascularization. It is to
be understood that such combination therapy constitutes a further aspect
of the compositions and methods of treatment provided herein.
1. Compositions for oral administration
Oral pharmaceutical dosage forms are either solid, gel or liquid. The
solid dosage forms are tablets, capsules, granules, and bulk powders.
Types of oral tablets include compressed, chewable lozenges and tablets
which can be enteric-coated, sugar-coated or film-coated. Capsules can
be hard or soft gelatin capsules, while granules and powders can be
provided in non-effervescent or effervescent form with the combination
of other ingredients known to those skilled in the art.
In certain embodiments, the formulations are solid dosage forms,
such as, for example, capsules or tablets. The tablets, pills, capsules,
troches and other dosage forms can contain, for example, any of the
following ingredients, or compounds of a similar nature: a binder; a
diluent; a disintegrating agent; a lubricant; a glidant; a sweetening agent;
and a flavoring agent.
Examples of binders include microcrystalline cellulose, gum
tragacanth, glucose solution, acacia mucilage, gelatin solution, sucrose
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-171-
and starch paste. Lubricants include talc, starch, magnesium or calcium
stearate, lycopodium and stearic acid. Diluents include, for example,
lactose, sucrose, starch, kaolin, salt, mannitol and dicalcium phosphate.
Glidants include, but are not limited to, colloidal silicon dioxide.
Disintegrating agents include crosscarmellose sodium, sodium starch
glycolate, alginic acid, corn starch, potato starch, bentonite,
methylcellulose, agar and carboxymethylcellulose. Coloring agents
include, for example, any of the approved certified water soluble FD and
C dyes, mixtures thereof; and water insoluble FD and C dyes suspended
on alumina hydrate. Sweetening agents include sucrose, lactose, mannitol
and artificial sweetening agents such as saccharin, and any number of
spray dried flavors. Flavoring agents include natural flavors extracted
from plants such as fruits and synthetic blends of conjugates which
produce a pleasant sensation, such as, but not limited to peppermint and
methyl salicylate. Wetting agents include propylene glycol monostearate,
sorbitan monooleate, diethylene glycol monolaurate and polyoxyethylene
laural ether. Emetic-coatings include fatty acids, fats, waxes, shellac,
ammoniated shellac and cellulose acetate phthalates. Film coatings
include hydroxyethylcellulose, sodium carboxymethylcellulose,
polyethylene glycol 4000 and cellulose acetate phthalate.
If oral administration is desired, the conjugate could be provided in
a composition that protects it from the acidic environment of the
stomach. For example, the composition can be formulated in an enteric
coating that maintains its integrity in the stomach and releases the
conjugate in the intestine. The composition also can be formulated in
combination with an antacid or other such ingredient.
When the dosage unit form is a capsule, it can contain, in addition
to material of the above type, a liquid carrier such as a fatty oil. In
addition, dosage unit forms can contain various other materials which
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-172-
modify the physical form of the dosage unit, for example, coatings of
sugar and other enteric agents. The conjugates also can be administered
as a component of an elixir, suspension, syrup, wafer, sprinkle, chewing
gum or the like. A syrup can contain, in addition to the conjugates,
sucrose as a sweetening agent and certain preservatives, dyes and
colorings and flavors.
The conjugates also can be mixed with other active materials
which do not impair the desired action, or with materials that supplement
the desired action, such as antacids, H2 blockers, and diuretics. Higher
concentrations, up to about 98% by weight of the conjugate can be
included.
Pharmaceutically acceptable carriers included in tablets are binders,
lubricants, diluents, disintegrating agents, coloring agents, flavoring
agents, and wetting agents. Enteric-coated tablets, because of the
enteric-coating, resist the action of stomach acid and dissolve or
disintegrate in the neutral or alkaline intestines. Sugar-coated tablets
are compressed tablets to which different layers of pharmaceutically
acceptable substances are applied. Film-coated tablets are
compressed tablets which have been coated with a polymer or other
suitable coating. Multiple compressed tablets are compressed tablets
made by more than one compression cycle utilizing the pharmaceutically
acceptable substances previously mentioned. Coloring agents also can be
used in the above dosage forms. Flavoring and sweetening agents are
used in compressed tablets, sugar-coated, multiple compressed and
chewable tablets. Flavoring and sweetening agents are especially useful
in the formation of chewable tablets and lozenges.
Liquid oral dosage forms include aqueous solutions, emulsions,
suspensions, solutions and/or suspensions reconstituted from
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-173-
non-effervescent granules and effervescent preparations reconstituted
from effervescent granules. Aqueous solutions include, for example,
elixirs and syrups. Emulsions are either oil-in-water or water-in-oil.
Elixirs are clear, sweetened, hydroalcoholic preparations.
Pharmaceutically acceptable carriers used in elixirs include solvents.
Syrups are concentrated aqueous solutions of a sugar, for example,
sucrose, and can contain a preservative. An emulsion is a two-phase
system in which one liquid is dispersed in the form of small globules
throughout another liquid. Pharmaceutically acceptable carriers used in
emulsions are non-aqueous liquids, emulsifying agents and preservatives.
Suspensions use pharmaceutically acceptable suspending agents and
preservatives. Pharmaceutically acceptable substances used in
non-effervescent granules, to be reconstituted into a liquid oral dosage
form, include diluents, sweeteners and wetting agents. Pharmaceutically
acceptable substances used in effervescent granules, to be reconstituted
into a liquid oral dosage form, include organic acids and a source of car-
bon dioxide. Coloring and flavoring agents are used in all of the above
dosage forms.
Solvents include glycerin, sorbitol, ethyl alcohol and syrup.
Examples of preservatives include glycerin, methyl and propylparaben,
benzoic add, sodium benzoate and alcohol. Examples of non-aqueous
liquids utilized in emulsions include mineral oil and cottonseed oil.
Examples of emulsifying agents include gelatin, acacia, tragacanth,
bentonite, and surfactants such as polyoxyethylene sorbitan monooleate.
Suspending agents include sodium carboxymethylcellulose, pectin,
tragacanth, Veegum and acacia. Diluents include lactose and sucrose.
Sweetening agents include sucrose, syrups, glycerin and artificial
sweetening agents such as saccharin. Wetting agents include propylene
glycol monostearate, sorbitan monooleate, diethylene glycol monolaurate
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-174-
and polyoxyethylene lauryl ether. Organic adds include citric and tartaric
acid. Sources of carbon dioxide include sodium bicarbonate and sodium
carbonate. Coloring agents include any of the approved certified water
soluble FD and C dyes, and mixtures thereof. Flavoring agents include
natural flavors extracted from plants such fruits, and synthetic blends of
conjugates which produce a pleasant taste sensation.
For a solid dosage form, the solution or suspension, in for example
propylene carbonate, vegetable oils or triglycerides, for example the
formulation can be encapsulated in a gelatin capsule. Such solutions, and
the preparation and encapsulation thereof, are disclosed in U.S. Patent
Nos 4,328,245; 4,409,239; and 4,410,545. For a liquid dosage form,
the solution, e. g., for example, in a polyethylene glycol, can be diluted
with a sufficient quantity of a pharmaceutically acceptable liquid carrier,
e. g., water, to be easily measured for administration.
Alternatively, liquid or semi-solid oral formulations can be prepared
by dissolving or dispersing the conjugate or derivative thereof in
vegetable oils, glycols, triglycerides, propylene glycol esters (e.g.,
propylene carbonate) and other such carriers, and encapsulating these
solutions or suspensions in hard or soft gelatin capsule shells. Other
useful formulations include those set forth in U.S. Patent Nos. Re 28,819
and 4,358,603. Briefly, such formulations include, but are not limited to,
those containing a conjugate provided herein, a dialkylated mono- or poly-
alkylene glycol, including, but not limited to, 1,2-dimethoxymethane,
diglyme, triglyme, tetraglyme, polyethylene glycol-350-dimethyl ether,
polyethylene glycol-550-dimethyl ether, polyethylene glycol-750-dimethyl
ether wherein 350, 550 and 750 refer to the approximate average
molecular weight of the polyethylene glycol, and one or more
anitoxidants, such as butylated hydroxytoluene (BHT), butylated
hydroxyanisole (BHA), propyl gallate, vitamin E, hydroquinone,
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-175-
hydroxycoumarins, ethanolamine, lecithin, cephalin, ascorbic acid, malic
acid, sorbitol, phosphoric acid, thiodipropionic acid and its esters, and
dithiocarbamates.
Other formulations include, but are not limited to, aqueous
alcoholic solutions including a pharmaceutically acceptable acetal.
Alcohols used in these formulations are any pharmaceutically acceptable
water-miscible solvents having one or more hydroxyl groups, including,
but not limited to, propylene glycol and ethanol. Acetals include, but are
not limited to, di(lower alkyl) acetals of lower alkyl aldehydes such as
acetaldehyde diethyl acetal.
In all embodiments, tablets and capsules formulations can be
coated as known by those of skill in the art in order to modify or sustain
dissolution of the conjugate. Thus, for example, they can be coated with
a conventional enterically digestible coating, such as phenylsalicylate,
waxes and cellulose acetate phthalate.
2. Injectables, solutions and emulsions
Parenteral administration, generally characterized by injection,
either subcutaneously, intramuscularly or intravenously also is
contemplated herein. Injectables can be prepared in conventional forms,
either as liquid solutions or suspensions, solid forms suitable for solution
or suspension in liquid prior to injection, or as emulsions. Suitable
excipients are, for example, water, saline, dextrose, glycerol or ethanol.
In addition, if desired, the pharmaceutical compositions to be
administered can also contain minor amounts of non-toxic auxiliary
substances such as wetting or emulsifying agents, pH buffering agents,
stabilizers, solubility enhancers, and other such agents, such as for
example, sodium acetate, sorbitan monolaurate, triethanolamine oleate
and cyclodextrins. Implantation of a slow-release or sustained-release
system, such that a constant level of dosage is maintained (see, e.g.,
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-176-
U.S. Patent No. 3,710,795) also is contemplated herein. Briefly, a
conjugate provided herein is dispersed in a solid inner matrix, e.g.,
polymethylmethacrylate, polybutylmethacrylate, plasticized or
unplasticized polyvinylchloride, plasticized nylon, plasticized
polyethyleneterephthalate, natural rubber, polyisoprene, polyisobutylene,
polybutadiene, polyethylene, ethylene-vinylacetate copolymers, silicone
rubbers, polydimethylsiloxanes, silicone carbonate copolymers,
hydrophilic polymers such as hydrogels of esters of acrylic and
methacrylic acid, collagen, cross-linked polyvinylalcohol and cross-linked
partially hydrolyzed polyvinyl acetate, that is surrounded by an outer
polymeric membrane, e.g., polyethylene, polypropylene,
ethylene/propylene copolymers, ethylene/ethyl acrylate copolymers,
ethylene/vinylacetate copolymers, silicone rubbers, polydimethyl
siioxanes, neoprene rubber, chlorinated polyethylene, polyvinylchloride,
vinylchloride copolymers with vinyl acetate, vinylidene chloride, ethylene
and propylene, ionomer polyethylene terephthalate, butyl rubber
epichlorohydrin rubbers, ethylene/vinyl alcohol copolymer, ethylene/vinyl
acetate/vinyl alcohol terpolymer, and ethylene/vinyloxyethanol copolymer,
that is insoluble in body fluids. The conjugate diffuses through the outer
polymeric membrane in a release rate controlling step. The percentage of
conjugate contained in such parenteral compositions is highly dependent
on the specific nature thereof, as well as the activity of the conjugate
and the needs of the subject.
Parenteral administration of the compositions includes intravenous,
subcutaneous and intramuscular administrations. Preparations for
parenteral administration include sterile solutions ready for injection,
sterile dry soluble products, such as lyophilized powders, ready to be
combined with a solvent just prior to use, including hypodermic tablets,
sterile suspensions ready for injection, sterile dry insoluble products ready
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-177-
to be combined with a vehicle just prior to use and sterile emulsions. The
solutions can be either aqueous or nonaqueous.
If administered intravenously, suitable carriers include physiological
saline or phosphate buffered saline (PBS), and solutions containing
thickening and solubilizing agents, such as glucose, polyethylene glycol,
and polypropylene glycol and mixtures thereof.
Pharmaceutically acceptable carriers used in parenteral preparations
include aqueous vehicles, nonaqueous vehicles, antimicrobial agents,
isotonic agents, buffers, antioxidants, local anesthetics, suspending and
dispersing agents, emulsifying agents, sequestering or chelating agents
and other pharmaceutically acceptable substances.
Examples of aqueous vehicles include Sodium Chloride Injection,
Ringers Injection, Isotonic Dextrose Injection, Sterile Water Injection,
Dextrose and Lactated Ringers Injection. Nonaqueous parenteral vehicles
include fixed oils of vegetable origin, cottonseed oil, corn oil, sesame oil
and peanut oil. Antimicrobial agents in bacteriostatic or fungistatic
concentrations must be added to parenteral preparations packaged in
multiple-dose containers which include phenols or cresols, mercurials,
benzyl alcohol, chlorobutanol, methyl 'and propyl p-hydroxybenzoic acid
esters, thimerosal, benzalkonium chloride and benzethonium chloride.
Isotonic agents include sodium chloride and dextrose. Buffers include
phosphate and citrate. Antioxidants include sodium bisulfate. Local
anesthetics include procaine hydrochloride. Suspending and dispersing
agents include sodium carboxymethylcelluose, hydroxypropyl
methylcellulose and polyvinylpyrrolidone. Emulsifying agents include
Polysorbate 80 (TWEEN~ 80). A sequestering or chelating agent of metal
ions include EDTA. Pharmaceutical carriers also include ethyl alcohol,
polyethylene glycol and propylene glycol for water miscible vehicles and
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-178-
sodium hydroxide, hydrochloric acid, citric acid or lactic acid for pH
adjustment.
The concentration of the conjugate is adjusted so that an injection
provides an effective amount to produce the desired pharmacological
effect. The exact dose depends on the age, weight and condition of the
patient or animal as is known in the art.
The unit-dose parenteral preparations are packaged in an ampule, a
vial or a syringe with a needle. All preparations for parenteral
administration must be sterile, as is known and practiced in the art.
Illustratively, intravenous or intraarterial infusion of a sterile
aqueous solution containing a conjugate is an effective mode of
administration. Another embodiment is a sterile aqueous or oily solution
or suspension containing a conjugate injected as necessary to produce
the desired pharmacological effect.
Injectables are designed for local and systemic administration.
Typically a therapeutically effective dosage is formulated to contain a
concentration of at least about 0.1 % w/w up to about 90% w/w or
more, genrally more than 1 % w/w of the conjugate to the treated
tissue(s). The conjugate can be administered at once, or can be divided
into a number of smaller doses to be administered at intervals of time. It
is understood that the precise dosage and duration of treatment is a
function of the tissue being treated and can be determined empirically
using known testing protocols or by extrapolation from in vivo or in vitro
test data. It is to be noted that concentrations and dosage values can
also vary with the age of the individual treated. It is to be further
understood that for any particular subject, specific dosage regimens
should be adjusted over time according to the individual need and the
professional judgment of the person administering or supervising the
administration of the formulations, and that the concentration ranges set
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-179-
forth herein are exemplary only and are not intended to limit the scope or
practice of the claimed formulations.
The conjugate can be suspended in micronized or other suitable
form or can be derivatized to produce a more soluble product. The form
of the resulting mixture depends upon a number of factors, including the
intended mode of administration and the solubility of the conjugate in the
selected carrier or vehicle. The effective concentration is sufficient for
ameliorating the symptoms of the condition and can be empirically
determined.
3. Lyophilized powders
Of interest herein are also lyophilized powders, which can be
reconstituted for administration as solutions, emulsions and other
mixtures. They also can be reconstituted and formulated as solids or
gels.
The sterile, lyophilized powder is prepared by dissolving a
conjugate provided herein, or a pharmaceutically acceptable derivative
thereof, in a suitable solvent. The solvent can contain an excipient which
improves the stability or other pharmacological component of the powder
or reconstituted solution, prepared from the powder. Excipients that can
be used include, but are not limited to, dextrose, sorbital, fructose, corn
syrup, xylitol, glycerin, glucose, sucrose or other suitable agent. The
solvent can also contain a buffer, such as citrate, sodium or potassium
phosphate or other such buffer known to those of skill in the art at,
typically, about neutral pH. Subsequent sterile filtration of the solution
followed by lyophilization under standard conditions known to those of
skill in the art provides the desired formulation. Generally, the resulting
solution will be apportioned into vials for lyophiiization. Each vial wilt
contain a single dosage (such as 10-1000 mg, for example 100-500 mg)
or multiple dosages of the conjugate. The lyophilized powder can be
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-180-
stored under appropriate conditions, such as at about 4 °C to room
temperature.
Reconstitution of this lyophilized powder with water for injection
provides a formulation for use in parenteral administration. For
reconstitution, generally about 1-50 mg, such 5-35 mg or about 9-30 mg
of lyophilized powder, is added per mL of sterile water or other suitable
carrier. The precise amount depends upon the selected conjugate,
intended subject, and other empircally determinable parameters. Hence
the amount can be empirically determined.
4. Topical administration
Topical mixtures are prepared as described for the local and
systemic administration. The resulting mixture can be a solution,
suspension, emulsions or the like and are formulated as creams, gels,
ointments, emulsions, solutions, elixirs, lotions, suspensions, tinctures,
pastes, foams, aerosols, irrigations, sprays, suppositories, bandages,
dermal patches or any other formulations suitable for topical
administration.
The conjugates or pharmaceutically acceptable derivatives thereof
can be formulated as aerosols for topical application, such as by
inhalation (see, e. g., U.S. Patent Nos. 4,044,126, 4,414,209, and
4,364,923, which describe aerosols for delivery of a steroid useful for
treatment of inflammatory diseases, particularly asthma). These
formulations for administration to the respiratory tract can be in the form
of an aerosol or solution for a nebulizer, or as a microfine powder for
insufflation, alone or in combination with an inert carrier such as lactose.
In such a case, the particles of the formulation will typically have
diameters of less than 50 microns, generally less than 10 microns.
The conjugates can be formulated for local or topical application,
such as for topical application to the skin and mucous membranes, such
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-181-
as in the eye, in the form of gels, creams, and lotions and for application
to the eye or for intracisternal or intraspinal application. Topical
administration is contemplated for transdermal delivery and also for
administration to the eyes or mucosa, or for inhalation therapies. Nasal
solutions of the conjugate alone or in combination with other
pharmaceutically acceptable excipients also can be administered.
These solutions, particularly those intended for ophthalmic use, can
be formulated as 0.01 % - 10% isotonic solutions, pH about 5-7, with
appropriate salts.
5. Compositions for other routes of administration
Other routes of administration, such as topical application,
transdermal patches, and rectal administration are also contemplated
herein.
For example, pharmaceutical dosage forms for rectal administration
are rectal suppositories, capsules and tablets for systemic effect. Rectal
suppositories are used herein mean solid bodies for insertion into the
rectum which melt or soften at body temperature releasing one or more
conjugates. Pharmaceutically acceptable substances utilized in rectal
suppositories are bases or vehicles and agents to raise the melting point.
Examples of bases include cocoa butter (theobroma oil), glycerin-gelatin,
carbowax (polyoxyethylene glycol) and appropriate mixtures of mono-, di-
and triglycerides of fatty acids. Combinations of the various bases can be
used. Agents to raise the melting point of suppositories include
spermaceti and wax. Rectal suppositories can be prepared either by the
compressed method or by molding. The typical weight of a rectal
suppository is about 2 to 3 gm.
Tablets and capsules for rectal administration are manufactured
using the same pharmaceutically acceptable substance and by the same
methods as for formulations for oral administration.
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-182-
6. Articles of manufacture
The conjugates or pharmaceutically acceptable derivatives can be
packaged as articles of manufacture containing packaging material, a
conjugate or pharmaceutically acceptable derivative thereof provided
herein, which is used for treatment, prevention or amelioration of one or
more symptoms associated with proliferative diseases or disorders, and a
label that indicates that the conjugate or pharmaceutically acceptable
derivative thereof is used for treatment, prevention or amelioration of one
or more symptoms associated with proliferative diseases or disorders.
The articles of manufacture provided herein contain packaging
materials. Packaging materials for use in packaging pharmaceutical
products are well known to those of skill in the art. See, e.g., U.S.
Patent Nos. 5,323,907, 5,052,558 and 5,033,252. Examples of
pharmaceutical packaging materials include, but are not limited to, blister
packs, bottles, tubes, inhalers, pumps, bags, vials, containers, syringes,
bottles, and any packaging material suitable for a selected formulation
and intended mode of administration and treatment. A wide array of
formulations'of the conjugates and compositions provided herein are
contemplated as are a variety of treatments for any disorder in which a
cell surface protease, or a soluble, shed or secreted form thereof, is
implicated.
F. Evaluation of the activity of the conjugates
Standard physiological, pharmacological and biochemical
procedures are available for testing the conjugates to identify those that
possess therapeutic activity upon action of a cell surface protease or a
soluble, shed, or released form thereof. /n vitro and in vivo assays that
can be used to evaluate therapeutic activity, such as cytotoxicity, of the
conjugates will depend upon the therapeutic agent being tested.
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-183-
Exemplary assays are discussed briefly below with reference to
cytotoxic conjugates (see, also, Examples). It is understood that the
particular activity assayed will depend upon the conjugated therapeutic
agent.
1. In vitro Assays
The therapeutic activity, such as cytotoxicity, of the conjugates
provided herein can assessed by any assays normally used for assessing
the therapeutic activity, such as cytotoxicity, of the unconjugated
therapeutic agent. Numerous such assays are known, for example,
assays can employ cells that express the targeted cell surface protease
and the therapeutic activity of the therapeutic agent is assessed. For
example, cytoxicity can be assessed by measuring cell viability or by
measuring cell proliferation, such as by incorporation of a labeled
nucleotide or other such label. Generally the activity is compared with
cells that do not express the targeted protease.
For example, the cells will be any that express a targeted MTSP or
endotheliase. Such cells can be obtained by choosing cells known to
express the cell surface protease, such as by determining tissue
expression profiles, as discussed above, or by screening a variety of cell
lines with an antibody for a targeted protease, or for the protease activity
in the presence of a labeled, such as a chromogenic, substrate for the
protease in the presence and absence of a known inhibitor of the targeted
protease.
Alternatively, nucleic acid encoding the protease can be introduced
in a cell line that does not express the protease, and expressed therein to
produce a cell line that expresses the protease of interest. The resulting
recombinant cells can be used in cytotoxicity assays.
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-184-
2. In vivo Assays
Numerous animal models for assessing therapeutic activity are
known. Any suitable in vivo model can be used. Exemplary are the
mouse xenograft model and chicken embryo models.
Chicken Embryo Model
The CAM model (chick embryo chorioallantoic membrane model;
Ossowski (1988? J. Cell Biol. 707:2437-2445), provides another method
for evaluating the inhibitory activity of a test compound. In the CAM
model, tumor cells invade through the chorioallantoic membrane
containing CAM (with tumor cells in the presence of several serine
protease inhibitors results in less or no invasion of the tumor cells through
the membrane). Thus, the CAM assay is performed with CAM and tumor
cells in the presence and absence of various concentrations of test
compound. The invasiveness of tumor cells is measured under such
conditions to provide an indication of the compound's inhibitory activity.
A compound having inhibitory activity correlates with less tumor invasion.
Thus, the CAM assay is performed with CAM and tumor cells in
the presence and absence of various concentrations of a test compound.
A compound having activity correlates with a change in tumor invasion
and/or tumor growth.
For example, the ability of a cell surface protease to liberate a
therapeutic agent, such as a cytotoxic agent, or the activity of a
conjugate agent can be assessed using this model. If the therapeutic
agent is released from the compound and it is an inhibitory agent there
will be less tumor invasion or a decrease in size of the tumor. If the
therapeutic agent is inactive in the conjugate, there will be no effect on
tumor invasion.
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-185-
The CAM model also is used in a standard assay of angiogenesis
(i.e., effect on formation of new blood vessels (Brooks et al. (1991 )
Methods in Molecular Biology 729:257-269). According to this model, a
filter disc containing an angiogenesis inducer, such as basic fibroblast
growth factor (bFGF) is placed onto the CAM. Diffusion of the cytokine
into the CAM induces local angiogenesis, which can be measured in
several ways such as by counting the number of blood vessel branch
points within the CAM directly below the filter disc. The ability of
identified compounds to inhibit cytokine-induced angiogenesis can be
tested using this model. A test compound can either be added to the
filter disc that contains the angiogenesis inducer, be placed directly on
the membrane or be administered systemically. The extent of new blood
vessel formation in the presence and/or absence of test compound can be
compared using this model. The formation of fewer new blood vessels in
the presence of a test compound would be indicative of anti-angiogenesis
activity.
This can be adapted for use with the conjugates herein to 1 )
assess the activity of a therapeutic agent in the conjugate; and 2) to
assess the ability of a particular cell surface protease to liberate a
therapeutic agent from a conjugate.
Mouse xenograft model
In vivo activity can be a assessed using recognized animal
models, such as the well-known mouse xenograft model for anti-tumor
activity (see, e.g., Beitz et al. (1992) Cancer Research 52:227-230;
Houghton et al. (1982) Cancer Res. 42:535-539; Bogden et al. (1981 )
Cancer (Philadelphia) 48:10-20; Hoogenhout et al. (1983) lnt. J. Radiat.
Oncol., Biol. Ph ys. 9:871-879; Stastny et al. ( 1993) Cancer Res.
53:5740-5744). The in vivo mouse solid tumor xenograft model is used
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-186-
in assays for that test an agent's ability to inhibit tumor cell proliferation
and/or spontaneous metastasis. For example, a conjugate is evaluated
for anti-tumor activity against any tumor subtype that expresses the
targeted cell surface protease, e.g., an ovarian tumor, in a mouse tumor
xenograft model. Nude mice are given one or more, such as four
intravenous injections of the conjugate. Dosing material is prepared by
mixing the test material with appropriate volumes of, for example,
PBS/0.1 % BSA to achieve the desired doses. Mice IV injections (250-
300 ul) into the tail vein for the duration of the experiment, such as, for
example, days 5, 12, 19 and 26, with day 1 designated as the day that
the tumor cells are injected into the mice. Doses are either fixed or
normalized for differences in body weight. Tumor volume is measured
twice weekly for a selected period.
Female Balb/c nu/nu athymic mice (Roger Williams Hospital Animal
Facility, Providence, RI), 8-12 weeks old are suitable mice. They should
be maintained in an aseptic environment and selected such that body
weights range from about 25-30 grams the day prior to dosing. Animals
are maintained in a quarantined room and handled under aseptic
conditions. Food and water are supplied ad libitum. Appropriate tumor
cells can be obtained, for example, from the American Type Culture
Collection (Rockville, MD) and grown in modified Eagle's medium
supplemented with 10% fetal calf serum. A selected number of days,
such as five days prior to injection of the test material, mice receive a
subcutaneous injection of tumor cells in the right rear flank.
Calipers are used to measure the dimensions of each tumor.
Measurements (mm) of maximum and minimum width are performed prior
to injection of the test material and at selected, such as bi-weekly,
intervals for the duration of the experiment. Tumor volumes (mm3) can
be computed, for example, using the formula:
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-187-
Volume = [(width)2(length)]/2.
G. Methods for Identifying proteases to target
Also provided are methods for identifying proteases to target
conjugates for treatment of diseases. The methods involve identifying
cell-surface protease-associated disease by identifying a cell involved in
the disease process or a cell in the vicinity of the cell involved in the
disease process. For example, if disease involves a particular tumor, a
protease present on the particular tumor or on cells that a located in the
vicinity thereof is identified. A cell surface protease on the cell for
targeting and substrates therefor are then identified. Conjugates that
target such proteases as provided herein can then be prepared.
The following examples are included for illustrative purposes only
and are not intended to limit the scope of the invention.
EXAMPLE 1
General Procedures for Preparing Peptide-doxorubicin conjugates
Step A: Synthesis of Peptides on Wang resin
Peptides were prepared automatically using an ABI 431 A peptide
synthesizer from Perseptive Biosystems on preloaded Wang resin (0.25
mmol). The ABI 431A uses HOBT, HBTU, DIEA activation. The
synthesis of N-acetyl (or other amide) capped peptides involved the use
of AcOH (or other respective carboxylic acid) during the final coupling
step on the ABI 431 A. Other N-terminal caps where attached manually
by using the following reagents: For carbamates and sulfonamides the
peptides were capped with ROCOCI or RSO2C1 and DIEA (4 equivalents
each, 1 hr) in DMF (3 mL).
Step B: Cleavage of peptides from Wang resin
The cleavage of peptides from Wang resin involved shaking the
resin with 2 mL TFA/H20 (95:5) for 45 min. The resin was removed by
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-188-
filtration and the filtrate was allowed to stand for an additional hour. The
solution was concentrated to a residue. The crude peptide was analyzed
by analytical HPLC (system A). Typical purity of the crude peptide
ranged from 80% to 95%. The peptides were purified by preparative
HPLC (system B) using an appropriate gradient (typically 10-30%). Pure
fractions were then lyophilized to provide the desired peptide as a white
solid. Typical yields were 20-50% and a purity of 96-99%.
Analytical HPLC conditions (System A)
Column: Chromolith RP-18e 4.6 mm x 100 mm from EM science
Gradient: 5-50% B in A over 6 min
Flow Rate: 4 mL/min
Solvent A: 0.1 % TFA in water
Solvent B: 0.1 % TFA in acetonitrile
Wavelength: 210 nm, 280 nm
Preparative HPLC conditions (System B)
Column: Ultro 120 5 C18Q 150 x 20 mm from Peeke Scientific
Gradient: 0-20%, or 10-30% or 20-40% B in A over 40 min
Flow Rate: 18 mL/min
Solvent A: 0.1 % TFA in water
Solvent B: acetonitrile
Wavelength: 214 nm
Step C: Coupling of peptide acids to doxorubicin
To a mixture of peptide acid (0.052 mmol, 1.2 equivalents),
doxorubicin hydrochloride (0.043 mmol, 25 mg), and HATU (0.0604
mmol, 22.9 mg, 1.4 equivalents) was added DMF (1 mL) then 2,6-
lutidine (0.17 mmol, 20,~L, 4 eqiuvalents). The mixture was mixed until
a homogeneous solution was obtained. After 4 to 24 hours (monitor by
HPLC system A) the reaction was diluted with water (9 mL) and directly
purified by preparative HPLC (system D). Pure fractions were then
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-189-
lyophilized to provide the desired peptide doxorubicin conjugate as a
fluffy red solid. The quality of the final conjugate was verified by
analytical HPLC (system C) and mass spectroscopy. Typical yields were
10-30% with a purity of 95-99%. (Note: when the peptide acid
contained a histidine residue DIEA was substituted as the base and the
reaction time was shortened to 1 hour).
Deprotection of fluorenylmethylesters of peptide doxorubicin
conjugates: In cases where free carboxylic acid is present in the
conjugate a fluorenyl methyl ester was used to protect a carboxylic acid
during coupling of the C-terminus of the peptide acid to doxorubicin, the
flourenylmethyl group was subsequently removed with 10% morpholine
in DMF for 1 hour.
Analytical HPLC conditions (System C)
Column: Chromolith RP-18e 4.6 mm x 100 mm from EM science
Gradient: 5-50% B in A over 6 min
Flow Rate: 4 mLlmin
Solvent A: 0.1 % TFA in water
Solvent B: 0.1 % TFA in acetonitrile
Wavelength: 210 nm, 280 nm
Examples of retention times (min)
Doxorubicin 4.05
Ac-Gly-Ser-Gly-Arg-Ser-nLeu-Dox 4.34
MeOCO-Thr-Gly-Arg-Ser-nLeu-Dox 4.39
PhS02-Thr-Gly-Arg-Ser-nLeu-Dox 4.83
N,N-dimethylglycine-Thr-Gly-Arg-Ser-nLeu-Dox 4.27
Ac-Thr-Gly-Arg-Ser-nLeu-Dox 4.32
Preparative HPLC conditions (System D)
Column: Ultro 120 5 C18Q 150 x 20 mm from Peelee Scientific
Gradient: 10-30% B in A over 40 min
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-190-
Flow Rate: 18 mL/min
Solvent A: 0.1 % acetic acid in water
Solvent B: acetonitrile
Wavelength: 214 nm
EXAMPLE 2
Preparation of Ac-Gly-Ser-Gly-Arg-Ser-nLeu-Dox
Step A: Manual synthesis of Ac-Gly-Ser(tBu)-Gly-Arg(Pbf)-
Ser(tBu)-nLeu-Wang resin
In a 250 mL fritted peptide synthesis vessel equipped with nitrogen
agitation and vacumm assisted drainage, Fmoc-nL-Wang resin (nova-
biochem, 3.3 grams, 0.9 mmol/g, 3 mmol) was pre-swelled for 30 min
using DMF. The peptide was then elongated by repeating the 4 step
procedure below a total of five times with the following Fmoc
aminoacids: Fmoc-Ser(tBu)-OH, Fmoc-Arg(Pbf)-OH, Fmoc-Gly-OH, Fmoc-
Ser(tBu)-OH, Fmoc-Gly-OH.
Iterative Coupling Procedure
1. the resin was mixed with 20% piperdine in DMF (100 mL)
for 5 min then drained (repeat 3 times).
2. the resin was agitated with DMF (100 mL) for 30 sec then
drained (repeat 3 times).
3. to a mixture of Fmoc-aminoacid (12 mmol), HOBT (12 mmol,
4 equivalents, 1.622 g), TBTU (11.7 mmol, 3.9 equivalents, 3.757
g), DMF (10 mL) and NMP (90 mL) was added DIEA (12 mmol, 4
equivalents, 2.10 mL). After stirring for 5 min to allow pre-
activation, the solution was added to the synthesis vessel. The
reaction was checked for completion by ninhydrin test and then
drained. (If the ninhydrid test was blue, a double coupling (repeat
step 3) was performed.
4. the resin was agitated with DMF (100 mL) for 30 sec then
drained (repeat 3 times).
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-191-
The elongated resin (Fmoc-Gly-Ser(tBu)-Gly-Arg(Pbf)-Ser(tBu)-nLeu-
Wang resin) was treated to steps 1 and 2 above to remove the Fmoc
group. A solution of acetic anhydride (15 mmol, 5/equivalents, 1.42 mL),
DIEA (15 mmol, 5 equivalents, 2.62 mL), DMF (10 mL) and NMP (90 mL)
was added to the reaction vessel. After 1 hour the resin was washed
with DMF ( 100 mL, 3 times), CH2C12 ( 100 mL, 3 times) and MeOH ( 100
mL, 3 times). The resin was dried under vacuum for 15 hours.
Step B: Preparation of Ac-Gly-Ser-Gly-Arg-Ser-nLeu-OH
To the above synthesis vessel containing Ac-Gly-Ser(tBu)-Gly-
Arg(Pbf)-Ser(tBu)-nLeu-Wang resin (3 mmol) was added TFA/H20 (95:5,
50 mL). After gently agitation for 45 min the cleavage solution was
collected and the filtrate was allowed to stand for an additional 90 min.
The solution was concentrated to a residue. The crude peptide was
analyzed by analytical HPLC (system A, RT=1.73, purity = 90%). The
residue was dissolved in water (50 mL) and hexanes (10 mL) and mixed.
The hexanes layer was removed and the aqueous layer bubbled with
nitrogen to evaporate any remaining hexanes. The crude peptide was
purified by preparative HPLC (system E). Pure fractions were then
lyophilized to provide Ac-Gly-Ser-Gly-Arg-Ser-nLeu-OH (1.04 g, 1.68
mmol, 56%) as a white solid. The purity was evaluated by analytical
HPLC (system A, RT=1.73 min, 97% purity) and the constitution by
mass spectrospcopy (ion observed at 617.9).
Preparative HPLC conditions (System E)
Column: Waters Delta-Pak radial compression column, 15 um, 100A
Gradient: 5-15% B in A over 40 min
Flow Rate: 80 mL/min
Solvent A: 0.1 % acetic acid in water
Solvent B: acetonitrile
Wavelength: 214 nm
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-192-
Step C: Preparation of Ac-Gly-Ser-Gly-Arg-Ser-nLeu-Dox
To a mixture of Ac-Gly-Ser-Gly-Arg-Ser-nLeu-OH (1.68 mmol, 1.04
g, 1.1 equivalents), doxorubicin hydrochloride (1.53 mmol, 887.8 mg),
and HATU (1.76 mmol, 669.6 mg, 1.15 equivalents) was added DMF (40
mL) then 2,6-lutidine (6.12 mmol, 709 ,uL, 4 eqiuvalents). The solution
was stirred for 18 hours. The reaction was diluted with water (100 mL),
acidified with acetic acid (400 ,uL) and purified immediately in three
batches by preparative HPLC (system E). Each red colored fraction was
analyzed by analytical HPLC (system F). Fractions of greater than 95%
purity were then combined. The acetonitrile was removed under vacuum
and the remaining solution was lyophilized to provide Ac-Gly-Ser-Gly-Arg-
Ser-nLeu-Dox (0.682 mmol, 780 mg, 45%) as a fluffy red solid. The
purity was evaluated by analytical HPLC (system F, RT=3.51 min, 95%
purity) and the constitution by mass spectrospcopy (ion observed at
1 143.5).
Analytical HPLC conditions (System F)
Column: Chromolith RP-18e 4.6 mm x 100 mm from EM science
Gradient: 20-40% B in A over 6 min
Flow Rate: 4 mL/min
Solvent A: 0.1 % TFA in water
Solvent B: 0.1 % TFA in acetonitrile
Wavelength: 210 nm, 280 nm
Preparative HPLC conditions (System E)
Column: Waters Delta-Pak radial compression column, 15 um, 100A
Gradient: 15-25% B in A over 40 min
Flow Rate: 80 mL/min
Solvent A: 0.1 % acetic acid in water
Solvent B: acetonitrile
Wavelength: 214 nm
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-193-
EXAMPLE 3
General Procedures for Preparing Peptide-Taxol conjugates
Step A: Synthesis of Peptides on Wang resin
See Example 1, Step A.
Step B: Cleavage of peptides from Wang resin
See Example 1, Step B.
Step C: Coupling of peptide acids to 7-Gly-Taxol or 7-Ala-Taxol
To a mixture of peptide acid (0.0121 mmol, 1.1 equivalents), 7
Gly-Taxol of 7-Ala-Taxol (0.01 1 mmol), and HATU (0.0154 mmol, 5.9
mg, 1.4 equivalents) was added DMF (0.3 mL) then 2,6-lutidine (0.044
mmol, 5.1 ,c.~L, 4 eqiuvalents). The mixture was mixed until a
homogeneous solution was obtained. After 4 to 24 hours (monitor by
HPLC system H) the reaction was diluted with water (9 mL) and directly
purified by preparative HPLC (system I). Pure fractions were then
lyophilized to provide the desired peptide taxol conjugate as a fluffy white
solid. The quality of the final conjugate was verified by analytical HPLC
(system H) and mass spectroscopy. Typical yields were 30-50% with a
purity of 96-99%.
Analytical HPLC conditions (System H)
Column: Chromolith RP-18e 4.6 mm x 100 mm from EM science
Gradient: 5-90% B in A over 6 min
Flow Rate: 4 mL/min
Solvent A: 0.1 % TFA in water
Solvent B: 0.1 % TFA in acetonitrile
Wavelength: 210 nm, 280 nm
Examples of retention times (min)
Ac-Gln-Ser-Arg-Ala-Ala-Taxol 2.86
Ac-Gln-Ser-Arg-Ser-Ala-Ala-Taxol 2.79
Ac-Ser-Gly-Arg-Ala-Ser-Ala-Taxol 2.87
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-194-
Ac-Arg-Ser-Arg-Ala-Ala-Taxol 2.80
Ac-Ser-Gly-Arg-Ser-Ser-Ala-Taxol 2.81
Preparative HPLC conditions (System I)
Column: Ultro 120 5 C18Q 150 x 20 mm from Peeke Scientific
Gradient: 20-45% B in A over 40 min
Flow Rate: 18 mL/min '
Solvent A: 0.1 % TFA in water
Solvent B: acetonitrile
Wavelength: 214 nm
EXAMPLE 4
Preparation of N-Ac-Arg-Gln-Ser-Arg-Ala-Ala-DOX
Cl N
O
H
HN~NH~
OMe O OH O
HZN
0 H~N Me O
OH NH
H O H O H O
N v N N~N N~N
= I - I I
O H O ~- H O = H O
HO
,H
N
HN~NHZ
Step A: N-Ac-Arg-Gln-Ser-Arg-Ala-Ala-OH
Using the following general procedure, the N-acetyl peptidic
substrate N-Ac-Arg-Gln-Ser-Arg-Ala-Ala-OH was synthesized in a peptide
synthesis flask. Commencing with commercial Fmoc-Ala-Wang resin
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-195-
(0.35 g, 0.84 mmol, Nova), standard Fmoc-deprotection with 20%
piperidine was followed by a sequential iterative coupling-Fmoc
deprotection strategy. Each coupling employed a 3-fold excess (2.52
mmof) of Fmoc-Ala, Fmoc-Arg(Boc)2, Fmoc-Ser(tBu), Fmoc-Gln(Trt) and
Fmoc-Arg(Boc)~, respectively. Couplings were achieved using PyBOP
(2.52 mmol) and DIEA (2.52 mmol) in DMF solvent. During each coupling
cycle, the Fmoc protecting group was removed using 20% piperidine in
DMF. After removal of the N-terminal Fmoc group, capping with acetic
anhydride (1.43 mmol, 1.7 equiv.), DMAP (0.25 mmol, 0.3 equiv.), and
DIEA (1.26 mmole, 1.5 equiv.) afforded the resin-bound N-acetyl
intermediate. The protected peptide resin was treated with 50% TFA in
methylene chloride for 30 min to cleave the Wang resin and then the Boc,
Trt and t-Bu protecting groups were removed with 70% TFA in methylene
chloride. Solvent and other volatile byproducts were evaporated under
reduced pressure and the crude product was dissolved in water and
lyophilized to afford the title compound as a nearly colorless, amorphous
solid. Mass spectral analysis confirmed the desired molecular weight.
HPLC analysis indicated the product to be of approximately 95% purity.
The peptide carboxylic acid intermediate can be further purified by
trituration or by preparative HPLC, if desired.
Step B: N-Ac-Arg-Gln-Ser-Arg-Ala-Ala-DOX
The intermediate from Step A (20 mg, 0.027 mmol) was dissolved
in dry DMF (0.8 mL) and was stirred at room temperature under a
nitrogen atmosphere. To this solution was added doxorubicin
hydrochloride (15.6 mg, 0.027 mmol), EDC (6.8 mg, 0.035 mmol), HOAt
(4.8 mg, 0.035 mmol) and 2,6-lutidine (7.3,~L, 0.06 mmol). Stirring was
continued until completion of the coupling, as monitored by analytical
HPLC (system J, see below). The solution was filtered and the crude
product was purified by C18 RP-HPLC (A=0.1 % AcOH/H20; B=CH3CN),
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-196-
gradient elution 100% to 60% A over 60 min). Homogeneous product
fractions (evaluated by HPLC, system J) were pooled and lyophilized to
afford the title compound as a light red solid.
HPLC conditions, system J:
Column: Phenomenex 15 cm #OOF-3033-E0, C18
Eluant: Gradient 95:5 (A:B) to 25:75 (A:B) over 20 min.
A = 0.1 % TFA/H~O, B = 0.1 %TFA/Acetonitrile
Flow: 1 mL/min.
Wavelength: 210 nm, 280 nm
Retention times: Doxorubicin = 8.89 min.
N-Ac-Arg-Gln-Ser-Arg-Ala-Ala-Dox = 8.4 min.
Physical Properties:
Molecular Formula: C55H~8N~4O20
Molecular Weight: 1255.3
Low Resolution Mass Spec: 628.2 (M + 2/2)
Table 2 lists data for additional peptidic substrate-Doxorubicin
conjugates. These conjugates were prepared from the appropriate amino
acid precursors that were elaborated by the general procedures described
in Example 4.
TABLE 2
Peptidic substrate-DOX Conjugate Mass HPLC-Retention
Spectrum Time (min.)
Acetyl-Arg-Arg-Gln-Ser-Arg-Ala-Ala-DOX471.2 8.23
(M + 3/3)
Acetyl-Leu-Arg-Arg-Gln-Ser-Arg-Ala-Ala-DOX509.2 8.60
(M + 3/3)
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-197-
EXAMPLE 5
Determination of times to 50% cleavage of Doxorubicin/peptidic
substrate Conjugates by the recombinant protease domain of MTSP1
One millimolar stock solutions were prepared for each peptidic
substrate conjugate in double distilled water. Cleavage reactions were
then performed in which 100 ,~M conjugate was mixed with 1 or 10 nM
of the recombinantly-produced active single chain protease domain of
MTSP1 (residue 615-855 in SEQ ID No. 2, encoded by nucleotides 1865-
2582 in SEQ ID No. 1 ) in 29.2 mM Tris, pH 8.4, 29.2 mM Imidazole, 217
mM NaCI. Final reaction volume was 200 ,caL. These reactions were
incubated in a water bath at 37 °C. At times ranging from 2 to 128
minutes, 20 ,uL samples were removed, and enzymatic activity was
stopped by the addition of trifluoroacetic acid to 0.33%. The amount of
hydrolysis in each sample was measured by reverse phase HPLC. Percent
hydrolysis was then calculated by dividing the area under the product
peak by the sum of the areas under substrate and product peaks.
Percent unhydrolyzed substrate was plotted against log of reaction times,
and the plots were fit to sigmoidal curves using Prism software from
Graphpad Inc. (San Diego, CA) to determine times at which 50% of each
substrate was cleaved.
Results for certain of the conjugates provided herein are shown in
Figure 1 (conditions: 1 nM MTSP1 with 100,~,~M conjugate at 37 °C
in
12 mM tris(hydroxymethyl)aminomethane, pH 8.0, 25 rnM NaCI, 0.5 mM
CaCl2; reactions were quenched with 0.33% trifluoroacetic acid).
EXAMPLE 6
In vitro assay of cytotoxicity of Conjugates
The cytotoxicity of the conjugates also can be tested to confirm
that the conjugates act as prodrugs. The conjugates are tested against a
line of cells, which is known to be killed by unmodified cytotoxic agent,
using an Alamar Blue assay. Cells, such as LNCaP cells (The American
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-198-
Type Culture Collection (Rockville, Maryland)), that express a cell surface
protease, such as MTSP1 or endotheliase, are seeded in 96 well plates at
a density of 1 x 104 cells/well (0.1 mL/well). A plate containing medium
alone is used as a control. The cells are incubated for 3 days at 37 °C
and 20 ,uL of Alamar Blue is added to the assay well(s). After 7 h of
incubation, cell killing is measured using an EL-310 plate reader at 570
and 600 nm. Values for cell killing are expressed as the percentage
reduction in cell numbers relative to the media controls.
EXAMPLE 7
/n vivo efficacy of Conjugates
Tumor cells are trypsinized, resuspended in the growth medium and
centrifuged for 6 min at 200xg. The cells are resuspended in serum-free
a-MEM and counted. The appropriate volume of this solution containing
the desired number of cells is then transferred to a conical centrifuge
tube, centrifuged as before and resuspended in the appropriate volume of
a cold 1:1 mixture of a-MEM-Matrigel. The suspension is kept on ice
until the animals are inoculated.
Male nude mice 10 weeks of age are used. Mice are individually
weighed and assigned to groups (n = 10 per group) with no more than a
2-gram difference in weight between individual mice within each group.
On day 1, mice are inoculated subcutaneously with the tumor cell line.
ach mouse is inoculated with, for example, 0.5 mL of 0.5 x 106 to 10$
tumor cells/mL in a 60% solution of ice-cold Matrigel and a-MEM. Then,
24 h later, conjugate administration began. Vehicle-treated mice are
injected with 5% dextrose in water. At the end of a predetermined time,
such as 18 days to two months or more, the mice are sacrificed, and
tumor size and mass or other parameters are measured. Tumor size and
mass or the other parameters for conjugate-treated mice are compared to
vehicle-treated mice to determine efficacy of the conjugate.
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-199-
Following inoculation with the tumor cells the mice are treated
under one of three protocols:
Protocol A
One day after cell inoculation the animals are dosed with 1 to 100,
or 3 to 50, or 5 to 25, or 7 to 22 ,cimol/kg, including 7.2 or 17.9 ,cimol/kg,
of test conjugate, unmodified cytotoxic agent or vehicle control (sterile
water). Dosages of the conjugate and cytotoxic agent are initially the
maximum non-lethal amount, but can be subsequently titrated lower.
Identical doses are administered at 24 hour intervals for 5 days. At the
end of 5.5 weeks or other suitable interval, the mice are sacrificed and
weights of any tumors present are measured. The animals' weights are
determined at the beginning and end of the assay.
Protocol B
At 14-15 days after cell inoculation, the animals are dosed with 1
to 100, or 3 to 50, or 5 to 25, or 7 to 22 ,umol/kg, including 7.2 or 17.9
~umol/kg, of test conjugate, unmodified cytotoxic agent, or vehicle control
(sterile water). Dosages of the conjugate and cytotoxic agent are initially
the maximum non-lethal amount, but can be subsequently titrated lower.
Identical doses are administered at 24 hour intervals for 5 days. At the
end of 5.5 weeks or other suitable interval, the mice are sacrificed and
weights of any tumors present are measured. The animals' weights are
determined at the beginning and end of the assay.
Protocol C
One day after cell inoculation, the animals are dosed by
interperitoneal administration with 1 to 100, or 3 to 50, or 5 to 25, or 7
to 22 ,cimol/kg, including 7,2 or 17.9 ,umol/kg, of test conjugate,
unmodified cytotoxic agent, or vehicle control (sterile water). Dosages of
the conjugate and cytotoxic agent are initially the maximum non-lethal
amount, but can be subsequently titrated lower. Identical doses are
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-200-
administered at 7 day intervals for 5 weeks. At the end of 5.5 weeks or
other suitable interval, the mice are sacrificed and weights of any tumors
present are measured. The animals' weights are determined at the
beginning and end of the assay.
EXAMPLE 8
Gene expression profiles of exemplary MTSPs and Domain organization
Gene expression profile of MTSP1 in normal tissues, cancer cells
and cancer tissues
To obtain information regarding the tissue distribution and gene
expression level of MTSP1, the DNA insert from a Pichia pastoris
expression vector, pPIC9IC-MTSP1, containing the encoding nucleic acid,
was used to probe a blot containing RNA from 76 different human tissues
(catalog number 7775-1; human multiple tissue expression (MTE) array;
CLONTECH, Palo Alto, CA). Significant expression was observed in the
colon (ascending, transverse and descending), rectum, trachea,
esophagus and duodenum. Moderate expression levels were observed in
the jejunum, ileum, ilocecum, stomach, prostate, pituitary gland,
appendix, kidney, lung, placenta, pancreas, thyroid gland, salivary gland,
mammary gland, fetal kidney, and fetal lung. Lower expression levels
were seen in the spleen, thymus, peripheral blood leukocyte, lymph node,
bone marrow, bladder, uterus, liver, adrenal gland, fetal heart, fetal liver,
fetal spleen, and fetal thymus. A significant amount of the MTSP1
transcript was also detected in colorectal adenocarcinoma cell line
(SW480), Burkitt's lymphoma cell line (Daudi), and leukemia cell line (HL-
FO). RT-PCR of the MTSP1 transcript in several human primary tumors
xenografted in athymic nude mice was performed using gene-specific
primers. A high level of MTSP1 transcript was detected in colon
adenocarcinoma (CX-1 ) and pancreatic adenocarcinoma (GI-103).
Moderate levels were observed in another colon adenocarcinoma
(GI-112), ovarian carcinoma (GI-102), lung carcinoma (LX-1 ), and breast
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-201-
carcinoma (GI-101 ). Another lung carcinoma (GI-1 17) expressed a low
level of the MTSP1 transcript. A similar RT-PCR was performed to detect
the presence of the MTSP1 transcript in PC-3 and LNCaP cell lines. Both
cell lines expressed significant amounts of MTSP1 transcript. MTSP1
also is a marker for ovarian cancer.
Gene expression profile of the serine protease MTSP3 in normal
and tumor tissues
To obtain information regarding the tissue distribution of the
MTSP3 transcripts, the DNA insert encoding the MTSP3 protease domain
was used to probe a RNA blot composed of 76 different human tissues
(catalog number 7775-1; human multiple tissue expression (MTE) array;
CLONTECH, Palo Alto, CA). The expression pattern observed in
decreasing signal level was: trachea = colon (descending) = esophagus
> colon (ascending) > colon (transverse) = rectum > ileum >
duodenum > jejunum > bladder > ilocecum > stomach > kidney >
appendix. It also is expressed less abundantly in fetal kidney, and in two
tumor cell lines, HeLa S3 and leukemia, K-562. Northern analysis using
RNA blots (catalog numbers 7780-1, 7765-1 & 7782-1; human 12-lane,
human muscle and human digestive system multiple tissue northern
(MTN) blots; CLONTECH) confirmed that the expression was detected
most abundantly in the colon, moderately in the esophagus, small
intestine, bladder and kidney, and less abundantly in stomach and
rectum. A single transcript of -~-2.2 kb was detected.
, Amplification of the MTSP3 transcript in several human primary
tumors xenografted in mouse was performed using gene-specific primers.
The MTSP3 transcript was detected in lung carcinoma (LX-1 ), colon
adenocarcinoma (CX-1 ), colon adenocarcinoma (GI-112) and ovarian
carcinoma (GI-102). No apparent signal was detected in another form of
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-202-
lung carcinoma (GI-1 17), breast carcinoma (GI-101 ), pancreatic
adenocarcinoma (GI-103) and prostatic adenocarcinoma (PC3).
Gene expression profile of MTSP4 in normal and tumor tissues
To obtain information regarding the gene expression profile of the
MTSP4 transcript, a DNA fragment encoding part of the LDL receptor
domain and the protease domain was used to probe an RNA blot
composed of 76 different human tissues (catalog number 7775-1; human
multiple tissue expression (MTE) array; CLONTECH). As in the northern
analysis of gel blot, a very strong signal was observed in the liver.
Signals in other tissues were observed in (decreasing signal level): fetal
liver > heart = kidney = adrenal gland = testis = fetal heart and kidney
= skeletal muscle = bladder = placenta > brain = spinal cord = colon
= stomach = spleen = lymph node = bone marrow = trachea = uterus
- pancreas = salivary gland = mammary gland = lung. MTSP4 also is
expressed less abundantly in several tumor cell lines including HeLa S3 =
leukemia K-562 = Burkitt's lymphomas (Raji and Daudi) = colorectal
adenocarcinoma (SW480) > lung carcinoma (A549) = leukemia MOLT-4
= leukemia HL-60. PCR of the MTSP4 transcript from cDNA libraries
made from several human primary tumors xenografted in nude mice
(human tumor multiple tissue cDNA panel, catalog number K1522-1,
CLONTECH) was performed using MTSP4-specific primers. The MTSP4
transcript was detected in breast carcinoma (GI-101 ), lung carcinoma
(LX-1 ), colon adenocarcinoma (GI-1 12) and pancreatic adenocarcinoma
(GI-103). No apparent signal was detected in another form of lung
carcinoma (GI-1 17), colon adenocarcinoma (CX-1 ), ovarian carcinoma
(GI-102). and prostatic adenocarcinoma (PC3). The MTSP4 transcript
was also detected in LNCaP and PC-3 prostate cancer cell lines as well as
in HT-1080 human fibrosarcoma cell line.
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-203-
Gene expression profile of MTSP6 in normal and tumor tissues
To obtain information regarding the gene expression profile of the
MTSP6 transcript, a 495 by DNA fragment obtained from PCR reaction
with primers Chl7-NSP-3 and NSP-4AS was used to probe an RNA blot
composed of 76 different human tissues (catalog number 7775-1; human
multiple tissue expression (MTE) array; CLONTECH). The strongest signal
was observed in duodenum. Signals in other tissues were observed in
(decreased signal level): Stomach > trachea = mammary gland =
thyroid gland =salivary gland = pituitary gland = pancreas > kidney >
lung > jejunum = ileum = ilocecum = appendix = fetal kidney > fetal
lung. Very weak signals also can be detected in several other tissues.
MTSP6 also is expressed in several tumor cell lines including HeLa S3 >
colorectal adenocarcinoma (SW480) > leukemia MOLT-4 > leukemia
K-562. PCR analysis of the MTSP6 transcript from cDNA libraries made
from several human primary tumors xenografted in nude mice (human
tumor multiple tissue cDNA panel, catalog number K1522-1, CLONTECH)
was performed using MTSP6-specific primers (Ch 17-NSP-3 and
Ch17-NSP2AS). The MTSP6 transcript was strongly detected in lung
carcinoma (LX-1 ), moderately detected in pancreatic adenocarcinoma
(GI-103), weakly detected in ovarian carcinoma (GI-102); and very
weakly detected in colon adenocarcinoma (GI-1 12 and CX-1 ), breast
carcinoma (GI-101 ), lung carcinoma (GI-117) and prostatic
adenocarcinoma (PC3). The MTSP6 transcript was also detected in
breast cancer cell line MDA-MB-231, prostate cancer cell line PC-3, but
not in HT-1080 human fibrosarcoma cell line. MTSP6 also is expressed
in mammary gland carcinoma cDNA (Clontech).
Gene expression profile of MTSP9 in normal, tumor tissues and
cell lines
To obtain a gene expression profile of the MTSP9 transcript, the
MTSP9 cDNA fragment obtained from human pancreas was used to
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-204-
probe a dot blot composed of RNA extracted from 76 different human
tissues (Human Multiple Tissue Expression (MTE) Array; Clontech, Palo
Alto, CA; catalog no. 7775-1 ). The results of this analysis indicate that
MTSP9 is highly expressed in the esophagus and expressed at a low level
in many other tissues. The MTSP9 transcript is found in kidney (adult
and fetal), spleen (adult and fetal), placenta, liver (adult and fetal),
thymus, peripheral blood leukocyte, lung (adult and fetal), pancreas,
lymph node, bone marrow, trachea, uterus, prostate, esophagus, testes,
ovary and the gland organs (mammary, adrenal, thyroid, pituitary and
salivary). MTSP9 also is expressed in tumor esophagus tissues, in a lung
carcinoma (A549 cell line) and, at a low level, in a colorectal carcinoma
(SW480), lymphoma (Raji and Daudi), a cervical carcinoma (HeLaS3) and
leukemia (HL-60, K-562 and MOLT-4) cell fines.
Gene expression profile of MTSP10 in normal and tumor tissues
To obtain information regarding the gene expression profile of the
MTSP10 transcript, PCR analysis was carried out on cDNA panels made
from several human adult tissues (Clontech, Cat. #K1420-1 ) cDNA panel
using MTSP10-specific primers. MTSP10 transcript was detected in
pancreas, lung and kidney. MTSP10 transcript was also detected in small
intestine Marathon-Ready cDNA (Clontech). PCR of the MTSP10
transcript from cDNA libraries made from several human primary tumors
xenografted in nude mice (human tumor multiple tissue cDNA panel,
catalog number K1522-1, CLONTECH) was also performed. The
MTSP10 transcript was detected in breast carcinoma (GI-101 ), lung
carcinoma (LX-1 and GI-1 17), ovarian carcinoma (GI-102), and pancreatic
adenocarcinoma (GI-103). The MTSP10 transcript can be weakly
detected in prostatic adenocarcinoma (PC3). No apparent signal was
detected in two forms of colon adenocarcinomas (GI-112 and CX-1 ). The
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-205-
MTSP10 transcript was also detected in CWR22R prostate tumor grown
on nude mice.
Domain organization and gene expression profile of MTSP12 in
normal and tumor tissues
Domain organization of MTSP12PD1, -PD2 and -PD3 and
homology to other serine proteases
Sequence and protein domain analyses of the translated
MTSP12PD1, -PD2 and -PD3 nucleotide sequences indicate that these
three serine proteases are contiguous. The sequence order is as follows:
MTSP12-PD1 is found at the N terminus followed by MTSP12-PD2, and
MTSP12-PD3 is at the C terminus. MTSP12-PD1 and -PD2 contain a
trypsin-like serine protease domain (aa 236 to as 4-65 and as 537 to as
765 for MTSP12-PD 1 and -PD2, respectively) characterized by the
presence of a protease activation cleavage site (...8236 y IZa7VGGMEAS...,
and ... R537 yUsasUGGFGAA..., for MTSP12-PD1 and -PD2, respectively,
and where i indicates a protease activation cleavage site) and the
catalytic triad residues (His277, Asp32s and Ser42~ in MTSP12-PD1; His578,
Asp62s and Ser~2~ in MTSP12-PD2) in 3 highly-conserved regions of the
catalytic domain. MTSP12-PD3 contains a serine protease domain (aa
861 to as 1087); it has a protease activation cleavage site
(...R86oyI86~VGGSAAG...) and has the catalytic His9o2and Asp949, but it
has a Ala~o~3 instead of the conserved catalytic serine found in serine
proteases. Several domains are found upstream of the MTSP12-PD1
serine protease domain and these include a transmembrane domain (aa
28 to as 50), a SEA (sea urchin sperm protein-enterokinase-agrin) domain
(aa 51 to as 170) and an LDLa (low density jipoprotein receptor class a)
domain (aa 187 to as 225). There are 5 possible N-linked glycosylation
sites (N~~sSS, N58,HT, N672AT, N697FS and N82oST). In the protease
domain of MTSP12-PD1, there is an unpaired cysteine (C346) in a single
chain form of the protease domain and the following Cys pairings are
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-206-
noted: C262-Ca78% 6360-G427a 0417-G446~ 0392-C406~ In fihe protease domain of
MTSP12-PD2, there is an unpaired cysteine (0646) in a single chain form
of the protease domain, and the following Cys pairings are noted: C663-
G579~ 6660 6727% 6692-G706~ 6717-6746~ In the protease domain of MTSP12-
PD3, there is an unpaired cysteine (0969) in a single chain form of the
protease domain, and the following Cys pairings are noted: C$$~-C9o3%
6983 C1049~ 01014 G1028~ 61039 G1068~
Alignment (blastp; http://www.ncbi.nlm.nih.gov/BLAST) of the
respective MTSP12-PD1, MTSP12-PDZ and MTSP12-PD3 protein
sequences to lenown serine proteases deposited in the public database
showed a 45%, 45% and 48% identity to matriptase, a 44%, 43% and
41 % identity with DESG1/endotheliase 1, a 44%, 43% and 48% identity
to prostamin (AB030036), a 43%, 39% and 39% identity to spinesin
(TMPRSSS; NM 030770), and a 40%, 38% and 38% identity to
marapsin (NM 031948), The clone has about 93% homology at the
nucleotide and encoded protein levels to a clone and encoded provided
described in International PCT application No. WO 02/00860 (see SEQ ID
Nos. 38 and 97 therein). The encoded protein described in the PCT
application, however, includes the Sequence set forth in SEQ ID No. 271
between amino acids Leu373 and Va1374 of SEQ ID No. 20, as well as
an additional extended sequence of amino acids beteween amino acids
A1a48 and Phe49 of SEQ ID No. 20 and lacles amino acids 91-124 of SEQ
ID No. 20. The protein provided in International PCT application
No.W002/00860 can be used in the methods provided herein.
Gene and Tissue expression profile of MTSP12
To obtain information regarding the tissue distribution profile of the
MTSP12PD1, -PD2 and -PD3 transcripts, 3 cDNA probes were prepared.
Data indicate that the MTSP12PD1, -PD2 and -PD3 transcript is
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-207-
expressed at a low level in most of the 76 tissues and cell lines, but at a
higher level in the lymph node and testes.
To compare the expression profile of MTSP12PD1, -PD2 and -PD3
in a range of normal human and matched tumor tissues, a matched
tumor/normal expression array (catalog number 7840-1;
http://www.clontech.com) composed of 68 paired cDNA samples from
individual patients was used. Results show that the MTSP12PD1, -PD2
and -PD3 transcript is expressed at a low level in a number of normal
tissues including breast, uterus, colon, ovary, lung, kidney and rectum,
but is not differentially expressed in any of the matched tumors. It also is
expressed at a low level in several tumor cell lines, including HeLa
(cervical carcinoma), Daudi (Burkitt's lymphoma), K562 (chronic
myelogenous leukemia), HL-60 (premyelocytic leukemia), 6361
(melanoma), A549 (lung carcinoma), MOLT-4 (lymphoblastic leukemia),
SW480 (colorectal adenocarcinoma), and Raji (Burkitt's lymphoma).
Several SMARTT"" 5'-RACE cDNA libraries (catalog number K1811-
1; http:/lwww.clontech.com) prepared from normal breast, normal testes,
normal prostate, prostate cancer cell lines and breast cancer cell lines
were analyzed for the presence of MTSP12PD1, -PD2 and -PD3 transcript
by RT-PCR using two sets of gene-specific primers. The MTSP12-PD2
and -PD3 transcript was detected in normal prostate, PC-3, LNCaP,
normal breast, MDA-MB-231, MDA-MB-361, MDA-MB-453 and DU4475,
but higher levels were observed in normal breast and MDA-MB-231. The
MTSP12-PD1 transcript was detected in the same tissues and cell lines,
except higher levels were observed in normal breast, MDA-MB-231 and
DU4475.
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-208-
Gene expression profile of MTSP20 in normal, tumor tissues and
cell lines '
To obtain information regarding the gene expression profile of the
MTSP20 transcript, the MTSP20 cDNA fragment obtained from human
lung tissue was used to probe a dot blot composed of RNA extracted
from 76 different human tissues (Human Multiple Tissue Expression
(MTE) Array; Clontech, Palo Alto, CA; catalog no. 7775-1 ). The results
indicate that RNA encoding MTSP20 is expressed in a variety of tissues.
The MTSP20 transcript is found in liver, lymph node, cerebellum,
pancreas, prostate, uterus, testis, glands (adrenal, thyroid and salivary),
thymus, kidney and spleen. Lower transcript level can be found in lung,
placenta, bladder, ovary, digestive system, circulatory system and other
parts of the the brain. MTSP20 is also expressed in certain tumor cell
lines including lung carcinoma (A519), colorectal carcinoma (SW480),
lymphoma (Raji and Daudi), cervical carcinoma (HeLaS3) and leukemia
(HL-60, K-562 and MOLT-4) cell lines.
Gene expression profile of MTSP22 in normal, tumor tissues and
cell fines
MTSP22 is expressed in the uterine tissue, thymus, adipose tissue,
and lymph node. It may also be expressed in lung, stomach, uterine,
breast, ovarian, prostate and in other tumors. To obtain information
regarding the gene expression profile of the MTSP22 transcript, the cDNA
fragment encoding the entire serine protease domain was used to probe a
dot blot composed of RNA extracted from 72 different human tissues
(Human Multiple Tissue Expression (MTE) Array; Clontech, Palo Alto, CA;
catalog no. 7776-1 ) as well as a dot blot composed of normalized cDNA
from 241 tumor and corresponding normal tissues from individual patients
(Cancer Profiling Array, Clontech, catalog no. 7841-1 ). The results of
MTE analysis indicated that MTSP22 transcript is expressed primarily in
the esophagus. In the cancer profiling array analysis, MTSP22 is
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-209-
highly expressed in 3 of the 42 normal uterus tissue samples, but not in
their matched tumor samples. In one of the 42 uterus samples, MTSP22
is expressed in tumor and its metastatic tissues, but not in the normal
tissue counterpart. MTSP22 is also expressed in 2 of the 17 stomach
tumors and 2 of the 21 lung tumors, but not in their normal tissue
counterparts. MTSP22 is also expressed in the normal tissue of the only
pancreas matched cDNA pair. PCR analysis was also performed using
commercially available cDNA panel from several human adult tissues
(Clontech, Cat. #K1420-1 and K1420-2) and primary tumors (Clontech
Cat. #K1522-1 ) as well as several Marathon-Ready cDNAs (Clontech).
MTSP22 cDNA was detected in thymus, adipose tissue, and lymph
node. Serine protease domain of MTSP22 and homology to other
proteases.
Sequence analysis of the translated MTSP22 protease domain
sequence revealed that MTSP22 contains a trypsin-like serine protease
domain characterized by the presence of a protease activation cleavage
site at the amino terminus of the domain and the catalytic triad residues
(histidine, aspartate and serine) in three highly-conserved regions.
Alignment of the protein sequence with that of endotheliase 1 (same as
serine protease DESC1 protein; GenBank accession number AF064819)
indicated that the two proteins share 50% sequence identity in their
protease domains.
Gene expression profile of MTSP25 in normal, tumor tissues and
cell lines
MTSP25 is expressed in breast, colon, uterine, ovarian, kidney,
prostate, testicular cancer tissue. It may also be expressed in lung,
stomach, prostate and in other tumors. To obtain information regarding
the gene expression profile of the MTSP25 transcript, a 369 by DNA
fragment containing MTSP25 protease domain sequence (obtained from a
PCR reaction) was used to probe a dot blot composed of RNA extracted
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-210-
from 72 different human tissues (Human Multiple Tissue Expression
(MTE) Array; Clontech, Palo Alto, CA; catalog no. 7776-1 ) as well as a
dot blot composed of normalized cDNA from 241 tumor and
corresponding normal tissues from individual patients (Cancer Profiling
Array, Clontech, catalog no. 7841-1). The results of MTE analysis
indicate that MTSP25 transcript is expressed weakly in the lymph node.
In the cancer profiling array analysis, MTSP25 is highly expressed in all 4
prostate samples (in normal and cancer samples). fn one of the 20
kidney cDNA pairs, MTSP25 is highly expressed in the tumor sample,
but not in its normal tissue counterpart. MTSP25 is also expressed in 1
of the 50 breast cancer samples, but not in its normal tissue counterpart.
MTSP25 is also expressed in 3 of the 42 normal uterus samples,
but not in their tumor counterparts. MTSP25 expression is also detected
in 3 of the 14 ovarian cancer samples. Among these three samples, the
expression of MTSP25 was also detected in one of the matched normal
tissue counterparts. MTSP25 expression was also detected in 5 tumor
samples in the 34 colon cDNA pairs.
PCR analysis was also performed using a commercially available
cDNA panel from several human adult tissues (Clontech, Cat. #K1420-1
and K1420-2) as well as several Marathon-Ready cDNAs (Clontech).
MTSP25 cDNA was strongly detected in testis and mammary gland
adenocarcinoma, weakly detected in brain, placenta, lung, spleen,
prostate, small intestine, colon, and leukocyte, and very weakly detected
in heart, liver, and pancreas.
EXAMPLE 9
Conjugates that have been prepared according to the procedures of
Examples 1-4 by routine and minor modification of the procedures, such
as using different Fmoc-amino acid building blocks, include:
Ac-R-Q-G-R-S-L-(Dox) (SEQ ID N~: 491 );
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-211-
Ac-R-Q-G-R-S-S-L-(Dox) (SEQ ID NO: 492);
Ac-R-Q-G-R-S-nL-(Dox) (SEQ ID NO: 493);
Ac-R-Q-G-R-S-nV-(Dox) (SEQ ID NO: 494);
Ac-R-Q-G-R-S-F-(Dox) (SEQ ID NO: 495);
Ac-R-Q-G-R-A-L-(Dox) (SEQ ID NO: 496);
Ac-R-Q-G-R-A-L-(Dox) (SEQ ID NO: 497);
Ac-R-Q-G-R-A-nL-(Dox) (SEQ ID N0: 498);
Ac-R-Q-G-R-A-nL-(Dox) (SEQ ID NO: 499);
Ac-R-Q-G-R-A-nV-(Dox) (SEQ ID N0: 500);
Ac-R-Q-G-R-A-Cha-(Dox) (SEQ ID N0: 501 );
Ac-R-Q-G-R-A-F-(Dox) (SEQ ID NO: 502);
Ac-R-N-G-R-S-L-(Dox) (SEQ ID NO: 503);
Ac-R-N-G-R-A-nL-(Dox) (SEQ ID NO: 504);
Ac-R-Q-A-R-S-L-(Dox) (SEQ ID NO: 505);
Ac-R-Q-A-R-S-nL-(Dox) (SEQ ID NO: 506);
Ac-R-Q-A-R-S-nV-(Dox) (SEQ ID NO: 507);
Ac-R-Q-A-A-S-Cha-(Dox) (SEQ ID NO: 508);
Ac-R-Q-A-R-S-S-Cha-(Dox) (SEQ ID NO: 509);
Ac-R-Q-A-R-T-nL-(Dox) (SEQ ID NO: 510);
Ac-R-Q-A-R-A-L-(Dox) (SEQ ID NO: 51 1 );
Ac-R-Q-A-R-A-nL-(Dox) (SEQ ID NO: 513);
Ac-R-Q-A-R-A-nV-(Dox) (SEQ ID NO: 514);
Ac-R-Q-A-R-A-Cha-(Dox) (SEQ ID N0: 515);
Ac-R-Q-S-R-A-A-(Dox) (SEQ ID NO: 516);
Ac-R-Q-S-R-A-(Dox) (SEQ ID NO: 517);
Ac-R-Q-S-R-A-nL-(Dox) (SEQ ID NO: 518);
Ac-R-Q-S-R-A-L-(Dox) (SEQ ID NO: 519);
Ac-R-Q-S-R-A-nV-(Dox) (SEQ ID NO: 520);
Ac-R-Q-S-R-A-Cha-(Dox) (SEQ ID N0: 521 );
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-212-
Ac-R-Q-S-R-S-S-L-(Dox) (SEQ ID NO: 522);
Ac-R-Q-S-R-S-L-(Dox) (SEQ ID NO: 523);
Ac-R-Q-S-R-S-dnL-(Dox) (SEQ ID NO: 524);
Ac-R-Q-S-R-S-nL-(Dox) (SEQ ID NO: 525);
Ac-R-Q-S-R-S-nV-(Dox) (SEQ ID NO: 526);
Ac-R-Q-S-R-S-aIIyIG-(Dox) (SEQ ID NO: 527);
Ac-R-Q-S-R-S-Cha-(Dox) (SEQ ID NO: 528);
Ac-R-Q-S-R-T-nL-(Dox) (SEQ ID NO: 529);
Ac-R-Q-T-R-S-S-L-(Dox) (SEQ ID NO: 530);
Ac-R-Q-T-R-S-L-(Dox) (SEQ ID NO: 531 );
Ac-R-N-S-R-S-nL-(Dox) (SEQ ID NO; 532);
Ac-R-Q-F-R-S-L-(Dox) (SEQ ID NO: 533);
Ac-R-Q-F-R-S-nL-(Dox) (SEQ ID NO; 534);
Ac-R-Q-F-R-S-nV-(Dox) (SEQ ID NO: 535);
Ac-R-Q-F-R-S-nL-(Dox) (SEQ ID N0; 536);
Ac-R-Q-F-R-S-Cha-(Dox) (SEQ ID NO: 537);
Ac-R-Q-F-R-A-L-(Dox) (SEQ ID NO: 538);
Ac-R-Q-F-R-A-nL-(Dox) (SEQ ID NO: 539);
Ac-R-Q-F-R-A-nV-(Dox) (SEQ ID N0: 540);
Ac-R-Q-F-R-A-Cha-(Dox) (SEQ ID NO: 541 );
Ac-Q-S-R-S-S-nL-(Dox) (SEQ ID NO: 542);
MeOCO-Quat2-G-R-S-L-NH2 (SEQ ID NO: 483);
MeOCO-Quat3-G-R-S-L-NH2 (SEQ ID NO: 484);
MeOCO-Quat-G-R-S-L-NH2 (SEQ ID NO: 485);
Me0C0-Quat4-G-R-S-L-NH2 (SEQ ID NO: 486);
MeOCO-QuatS-G-R-S-L-NH2 (SEQ ID NO: 487);
MeOCO-Quat2-G-R-S-S-L-NH2 (SEQ ID NO: 488);
MeOCO-Quat4-G-R-S-L-(Dox) (SEQ ID NO: 489);
MeOCO-Quat2-G-R-S-L-(Dox) (SEQ ID NO: 490);
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-213-
Ac-Q-G-R-S-L-(Dox) (SEQ ID N0: 445);
Ac-Q-G-R-S-S-L-(Dox) (SEQ ID NO: 446);
Ac-Q-G-R-A-S-L-(Dox) (SEQ ID NO: 447);
Ac-N-G-R-S-S-L-(Dox) (SEQ ID NO: 448);
Ac-Q-G-R-S-S-nL-(Dox) (SEQ ID NO: 449);
Ac-Q-G-R-S-S-nV-(Dox) (SEQ. ID NO: 450);
Ac-Q-G-R-S-S-Cha-(Dox) (SEQ ID NO: 451 );
Ac-Q-G-R-S-S-aIIyIG-(Dox) (SEQ ID NO: 452);
Ac-Q-G-R-S-S-aIIyIG-(Dox) (SEQ ID NO: 453);
Ac-Q-A-R-S-L-(Dox) (SEQ ID NO: 454);
Ac-Q-A-R-S-S-L-(Dox) (SEQ ID NO: 455);
Ac-Q-S-R-S-L-(Dox) (SEQ ID N0: 456);
Ac-Q-S-R-S-S-nV-(Dox) (SEQ ID NO: 457);
Ac-Q-S-R-S-S-Cha-(Dox) (SEQ 1D NO: 458);
Ac-Q-S-R-S-S-L-(Dox) (SEQ ID NO: 459);
Ac-Q-T-R-S-S-L-(Dox) (SEQ ID NO: 460);
Ac-Q-Aib-R-S-S-Cha-(Dox) (SEQ ID NO: 461 );
Ac-Q-Aib -R-S-S-L-(Dox) (SEQ ID NO: 462);
Ac-Q-Abu-R-S-S-Cha-(Dox) (SEQ ID NO: 463);
Ac-Q-Abu-R-S-S-L-(Dox) (SEQ ID NO: 464);
Ac-Q-Cha-R-S-S-Cha-(Dox) (SEQ ID NO: 465);
Ac-Q-F-R-S-L-(Dox) (SEQ ID N0: 466);
Ac-Q-F-R-S-S-L-(Dox) (SEQ ID N0: 467);
Ac-Q-Y-R-S-S-L-(Dox) (SEQ ID NO: 468);
Ac-R-G-R-S-L-(Dox) (SEQ ID NO: 469);
Ac-R-G-R-S-S-L-(Dox) (SEQ ID NO: 470);
Ac-R-G-R-S-S-Cha-(Dox) (SEQ ID NO: 471 );
Ac-R-G-R-S-Cha-(Dox) (SEQ ID NO: 472);
Ac-R-A-R-S-L-(Dox) (SEQ ID N0: 473);
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-214-
Ac-R-A-R-S-S-L-(Dox) (SEQ ID NO: 474);
Ac-R-S-R-S-L-(Dox) (SEQ ID NO: 475);
Ac-R-S-R-S-S-L-(Dox) (SEQ ID NO: 476);
Ac-R-S-R-S-Cha-(Dox) (SEQ ID NO: 477);
Ac-R-S-R-S-S-Cha-(Dox) (SEQ ID NO: 478);
Ac-R-F-R-S-L-(Dox) (SEQ ID NO: 479);
Ac-R-F-R-S-Cha-(Dox) (SEQ ID NO: 480);
Ac-Y-G-R-S-S-L-(Dox) (SEQ ID NO: 481 );
Ac-M(02)-S-R-S-L-(Dox) (SEQ ID NO: 482);
Ac-R-R-Q-S-R-A-A-(Dox) (SEQ ID NO: 105);
Ac-R-R-Q-S-R-I-(Dox) (SEQ ID NO: 610);
Ac-R-R-Q-S-R-S-S-L-(Dox) (SEQ ID NO: 543);
Ac-R-R-Q-S-R-S-L-(Dox) (SEQ ID NO: 544);
Ac-R-G-S-G-R-S-L-(Dox) (SEQ 1D NO: 545);
Ac-R-G-S-G-R--S-nL-(Dox) (SEQ ID NO: 546);
Ac-R-G-S-G-R-A-nL-(Dox) (SEQ ID NO: 547);
Ac-R-G-S-G-R-S-S-L-(Dox) (SEQ ID NO: 548);
Ac-I-V-S-G-R-A-S-L-(Dox) (SEQ ID NO: 549);
Ac-R-R-Q-S-R-A-(Dox) (SEQ ID NO: 108);
Ac-R-R-Q-S-R-I-(Dox) (SEQ ID NO: 1 1 1 );
Ac-L-R-R-Q-S-R-A-A-(Dox) (SEQ ID NO: 106);
Ac-L-R-R-Q-S-R-G-G-(Dox) (SEQ ID NO: 109);
Ac-L-R-R-Q-S-R-A-(Dox) (SEQ fD NO: 110);
Ac-L-R-R-Q-S-R-A-I-(Dox) (SEQ ID NO: 112);
Ac-L-R-R-Q-S-R-A-I-(Dox) (SEQ ID NO: 61 1 );
Ac-L-R-R-Q-S-R-S-S-L-(Dox) (SEQ ID NO: 550);
Ac-L-R-R-Q-S-R-S-L-(Dox) (SEQ ID NO: 551 );
Ac-S-G-R-S-L-(Dox) (SEQ ID NO: 362);
Ac-S-G-R-S-S-L-(Dox) (SEQ ID NO: 363);
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-215-
Ac-S-G-R-S-S-S-L-(Dox) (SEQ ID NO: 364);
Ac-S-G-R-S-nL-(Dox) (SEQ ID NO: 365);
Ac-S-G-R-S-nV-(Dox) (SEQ ID NO: 366); isomer 1
Ac-S-G-R-S-nV-(Dox) (SEQ ID NO: 3671; isomer 2
Ac-S-G-R-S-G(hex)-(Dox) (SEQ ID NO: 368);
Ac-S-G-R-S-Cha-(Dox) (SEQ ID NO: 369);
Ac-S-G-R-S-hCha-(Dox) (SEQ ID NO: 370);
Ac-S-A-R-S-L-(Dox) (SEQ ID NO: 371 );
Ac-S-A-R-S-S-L-(Dox) (SEQ ID NO: 372);
Ac-S-S-R-S-nL-(Dox) (SEQ ID NO: 373);
Ac-T-G-R-S-Abu-(Dox) (SEQ ID NO: 374);
Ac-T-G-R-S-L-(Dox) (SEQ ID NO: 375);
Ac-T-G-R-S-nV-(Dox) (SEQ ID NO: 376);
Ac-T-G-R-S-nL-(Dox) (SEQ ID NO: 377);
Ac-T-G-R-S-G(hex)-(Dox) (SEQ ID NO: 378);
Ac-T-G-R-S-Cha-(Dox) (SEQ ID NO: 379);
Ac-T-G-R-S-hCha-(Dox) (SEQ ID NO: 380);
Ac-T-G-R-T-Abu-(Dox) (SEQ ID NO: 381 );
Ac-T-G-R-hS-nL-(Dox) (SEQ ID NO: 382);
Ac-T-G-R-Abu-nL-(Dox) (SEQ ID NO: 383);
Ac-T-G-R-Abu-nV-(Dox) (SEQ ID NO: 384);
Ac-T-G-F(Gn)-S-nL-(Dox) (SEQ ID NO: 385);
Ac-T-G-F(Gn)-S-Cha-(Dox) (SEQ ID NO: 386);
Ac-T-G-F(Gn)-Abu-nV-(Dox) (SEQ ID NO: 387);
Ac-T-G-K(alloc)-S-nL-(Dox) (SEQ ID N0: 388);
Ac-T-G-K-S-nL-(Dox) (SEQ ID NO: 389);
Ac-T-G-hR-S-nL-(Dox) (SEQ ID NO: 390);
Ac-(hS)G-G-R-S-nL-(Dox) (SEQ ID NO: 391 );
MeOCO-T-G-R-S-nL-(Dox) (SEQ ID NO: 392);
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-216-
PhS02-T-G-R-S-nL-(Dox) (SEQ ID NO: 393);
Me0EtC0-T-G-R-S-nL-(Dox) (SEQ ID NO: 394);
Me0(Et0)2Ac-T-G-R-S-nL-(Dox) (SEQ ID NO: 395);
4-oxo-Pentanoyl-T-G-R-S-nL-(Dox) (SEQ ID NO: 396);
3,4-MethyldioxyPhAc-T-G-R-S-nL-(Dox) (SEQ ID NO: 397);
2-PyridylAc-T-G-R-S-nL-(Dox) (SEQ ID NO: 398);
PhOAc-T-G-R-S-nL-(Dox) (SEQ ID NO: 399);
L-3-PhLactyl-T-G-R-S-nL-(Dox) (SEQ ID NO: 400);
MeOAc-T-G-R-S-nL-(Dox) (SEQ ID NO: 401 );
PhAc-T-G-R-S-nL-(Dox) (SEQ ID NO: 402);
MeOEtOCO-T-G-R-S-nL-(Dox) (SEQ ID NO: 403);
MeOEtOAc-T-G-R-S-nL-(Dox) (SEQ ID NO: 404);
HOOCButa-T-G-R-S-nL-(Dox) (SEQ ID NO: 405);
Z-T-G-R-S-nL-(Dox) (SEQ ID NO: 406);
EtOCO-T-G-R-S-nL-(Dox) (SEQ ID NO: 407);
~3A-T-G-R-S-nL-(Dox) (SEQ ID NO: 408);
Pent-4-ynoyl-T-G-R-S-nL-(Dox) (SEQ ID NO: 409);
NapAc-T-G-R-S-nL-(Dox) (SEQ ID N0: 410);
iBoc-T-G-R-S-nL-(Dox) (SEQ ID NO: 41 1 );
HOAc-T-G-R-S-nL-(Dox) (SEQ ID NO: 412);
MeSucc-T-G-R-S-nL-(Dox) (SEQ ID NO: 413);
N,N-diMeGly-T-G-R-S-nL-(Dox) (SEQ ID NO: 414);
Succ-T-G-R-S-nL-(Dox) (SEQ ID NO: 415);
HCO-T-G-R-S-nL-(Dox) (SEQ ID NO: 416);
Ac-T-A-R-S-nL-(Dox) (SEQ ID NO: 417);
Ac-T-A-F(Gn)-S-nL-(Dox) (SEQ ID NO: 418);
Ac-T-A-R-Abu-nV-(Dox) (SEQ ID NO: 419);
Ac-T-A-R-S-Abu-(Dox) (SEQ ID NO: 420);
Ac-T-A-R-T-Abu-(Dox) (SEQ ID NO: 421 );
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-217-
Ac-T-S(O-Me)-R-S-nL-(Dox) (SEQ ID NO: 422);
Ac-T-hS-R-S-nL-(Dox) (SEQ ID NO: 423);
Ac-T-(1-Me)H-R-S-nL-(Dox) (SEQ ID NO: 424);
Ac-T-(3-Me)H-R-S-nL-(Dox) (SEQ ID NO: 425);
Ac-T-H-R-S-nL-(Dox) (SEQ ID NO: 426);
Ac-T-Sar-R-S-nL-(Dox) (SEQ ID NO: 427);
Ac-T-nV-R-S-nL-(Dox) (SEQ ID NO: 428);
Ac-T-nL-R-S-nL-(Dox) (SEQ ID NO: 429);
Ac-T-A-R-S-Cha-(Dox) (SEQ ID N0: 430);
Ac-T-Abu-R-S-nL-(Dox) (SEQ ID NO: 431 );
Ac-4,4diMeThr-G-R-S-nL-(Dox) (SEQ ID NO: 432);
Ac-hS-G-R-S-nL-(Dox) (SEQ ID NO: 433);
Ac-hS-G-R-hS-Cha-(Dox) (SEQ ID NO: 434);
Ac-hS-G-R-S-Cha-(Dox) (SEQ 1D NO: 435);
Ac-hS-G-R-T-Cha-(Dox) (SEQ ID NO: 436);
Ac-hS-A-R-S-Cha-(Dox) (SEQ ID NO: 437);
Ac-N-G-R-S-nL-(Dox) (SEQ ID NO: 438);
Ac-Y-G-R-S-S-L-(Dox) (SEQ ID NO: 439);
Ac-Y-G-R-S-Cha-(Dox) (SEQ ID NO: 440);
Ac-Q-G-R-S-S-nL-(Dox) (SEQ ID NO: 441 );
Ac-Q-G-R-S-S-nV-(Dox) (SEQ ID NO: 442);
Ac-L-R-G-S-G-R-S-A-(Dox) (SEQ ID NO: 573);
Ac-L-R-G-S-G-R-S-L-(Dox) (SEQ ID N0: 342);
Ac-L-R-G-S-G-R-S-L-(Dox) (SEQ ID NO: 343);
Ac-L-R-G-S-G-R-S-S-nL-(Dox) (SEQ ID NO: 344);
Ac-L-R-G-S-G-R-S-S-Cha-(Dox) (SEQ ID NO: 345);
Ac-L-R-G-dS-A-R-S-A-(Dox) (SEQ ID NO: 574);
Ac-L-R-G-S-A-R-S-S-L-(Dox) (SEQ ID NO: 346);
Ac-L-R-G-S-A-R-S-L-(Dox) (SEQ ID NO: 347);
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-218-
Ac-L-R-G-S-A-R-S-S-Cha-(Dox) (SEQ ID NO: 348);
Ac-L-R-G-S-A-R-S-S-nV-(Dox) (SEQ ID NO: 349);
Ac-L-R-G-S-A-R-S-S-nL-(Dox) (SEQ ID NO: 350);
Ac-V-I-V-S-G-R-A-L-(Dox) (SEQ ID N0: 351 );
Ac-V-i-V-S-A-R-S-L-(Dox) (SEQ ID NO: 352);
Ac-V-I-V-S-G-R-S-S-L-(Dox) (SEQ ID NO: 353);
Ac-V-I-V-S-A-R-M-A-(DOX) (SEQ ID NO: 354);
Ac-V-I-V-S-A-R-nL-A-(Dox) (SEQ lD NO: 355);
Ac-V-I-V-S-A-R-S-nL-(Dox) (SEQ ID NO: 356);
Ac-V-I-V-S-A-R-S-Cha-(Dox) (SEQ ID NO: 357);
Ac-V-I-V-S-A-R-S-Cha-(Dox) (SEQ ID NO: 358);
Ac-V-I-V-S-A-R-S-S-Cha-(Dox) (SEQ ID NO: 359);
Ac-R-R-(Me)C-P-G-R-V-V-(Dox) (SEQ ID N0: 360);
Ac-R-R-nV-P-A-R-S-L-(Dox) (SEQ ID NO: 361 );
Ac-R-G-dS-A-R-S-A-(Dox) (SEQ ID NO: 309);
Ac-R-G-S-G-R-S-A-(Dox) (SEQ ID NO: 310);
Ac-R-G-S-G-R-A-L-(Dox) (SEQ ID NO: 31 1 );
Ac-R-G-S-G-R-S-L-(Dox) (SEQ ID N0: 312);
Ac-R-G-S-G-R--S-nL-(Dox) (SEQ ID NO: 313);
Ac-R-G-S-G-R-A-nL-(Dox) (SEQ ID NO: 314);
Ac-R-G-S-G-R-S-S-L-(Dox) (SEQ ID NO: 315);
Ac-R-G-S-G-R-S-Cha-(Dox) (SEQ ID NO: 316);
Ac-R-G-S-G-R-S-S-Cha-(Dox) (SEQ ID NO: 317);
Ac-R-G-S-A-R-S-Cha-(Dox) (SEQ ID NO: 318);
Ac-R-G-S-A-R-S-S-(Dox) (SEQ ID NO: 319);
Ac-R-G-S-A-R-S-nV-(Dox) (SEQ ID NO: 320);
Ac-R-G-S-A-R-S-S-nV -(Dox) (SEQ ID NO: 321 );
Ac-R-G-S-A-R-S-L-(Dox) (SEQ ID NO: 322);
Ac-R-(Me)C-P-G-R-V-V-(Dox) (SEQ ID NO: 323);
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-219-
Ac-R-(Me)C-P-G-R-V-V-(Dox) (SEQ ID NO: 324);
Ac-R-C(Me)-P-G-R-S-L-(Dox) (SEQ ID NO: 325);
Ac-R-L-P-G-R-S-L-(Dox) (SEQ ID NO: 326);
Ac-R-V-P-G-R-S-L-(Dox) (SEQ ID NO: 327);
Ac-R-V-P-G-R-S-L-(Dox) (SEQ fD NO: 328);
Ac-R-nL-P-G-R-S-L-(Dox) (SEQ ID NO: 329);
Ac-R-G(tBu)-P-A-R-S-L-(Dox) (SEQ ID NO: 330);
Ac-R-L-P-A-R-S-L-(Dox) (SEQ ID NO: 331 );
Ac-R-V-P-A-R-S-L-(Dox) (SEQ ID NO: 332);
Ac-R-nL-P-A-R-S-L-(Dox) (SEQ ID NO: 333);
Ac-I-V-S-G-R-A-L-(Dox) (SEQ ID NO: 334);
Ac-I-V-S-G-R-S-S-L-(Dox) (SEQ ID NO: 335);
Ac-I-V-S-G-R-A-S-L-(Dox) (SEQ ID NO: 336);
Ac-I-V-S-A-R-M-A-(Dox) (SEQ ID NO: 337);
Ac-I-V-S-A-R-nL-A-(Dox) (SEQ ID NO: 338);
Ac-I-V-S-A-R-S-L-(Dox) (SEQ ID NO: 339);
Ac-l-V-S-A-R-S-nL-(Dox) (SEQ ID NO: 340);
Ac-I-V-S-A-R-S-S-L-(Dox) (SEQ ID NO: 341 );
Ac-G-S-G-R-S-A-(Dox) (SEQ ID NO: 585);
Ac-G-S-G-R-S-L-(Dox) (SEQ ID NO: 277);
Ac-G-S-G-R-A-L-(Dox) (SEQ ID NO: 278);
Ac-G-S-G-R-S-S-L-(Dox) (SEQ ID NO: 279);
Ac-G-S-G-R-L-(Dox) (SEQ ID NO: 280);
Ac-G-S-G-(4-guan)Phg-S-L-NH2 (SEQ ID NO: 281 );
Ac-G-S-G-R-S-S-Cha-(Dox) (SEQ ID N0: 282);
Ac-G-S-G-R-A-S-L-(Dox) (SEQ ID NO: 283);
Ac-G-S-G-R-S-nL-(Dox) (SEQ ID NO: 284);
Ac-G-T-G-R-S-nL-(Dox) (SEQ ID NO: 285);
Succ-bA-T-G-R-S-nL-(Dox) (SEQ ID N0: 286);
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-220-
Ac-G-T-G-R-S-hCha-(Dox) (SEQ ID NO: 287);
Ac-G-hS-G-R-S-nL-(Dox) (SEQ ID NO: 288);
Ac-G-dS-A-R-S-A-(Dox) (SEQ ID NO: 289);
Ac-G-S-A-R-S-L-(Dox) (SEQ ID NO: 290);
Ac-G-S-A-R-S-S-Cha-(Dox) (SEO ID NO: 291 );
Ac-G-S-A-R-S-S-L-(Dox) (SEQ ID NO: 292);
Ac-G-S-A-R-A-S-L-(Dox) (SEQ ID NO: 293);
Ac-V-S-G-R-S-L-(Dox) (SEQ ID NO: 294);
Ac-V-S-G-R-A-L-(Dox) (SEQ ID NO: 295);
Ac-V-S-G-R-A-S-L-(Dox) (SEQ iD NO: 296);
Ac-V-S-G-R-S-S-L-(Dox) (SEO ID NO: 297);
Ac-V-S-A-R-M-A-(Dox) (SEQ ID NO: 298);
Ac-V-S-A-R-nL-A-(Dox) (SEQ ID NO: 299);
Ac-V-S-A-R-S-nL-(Dox) (SEQ ID NO: 300);
Ac-V-S-A-R-S-L-(Dox) (SEQ ID NO: 301 );
Ac-(Me)C-P-G-R-V-V-(Dox) (SEQ ID NO: 302);
Ac-(Me)C-P-G-R-V-V-(Dox) (SEQ ID NO: 303);
Ac-C(Me)-P-G-R-A-L-(Dox) (SEQ ID NO: 304);
Ac-C(Me)-P-G-R-S-L-(Dox) (SEQ ID NO: 305);
Ac-C(Me)-P-A-R-S-L-(Dox) (SEQ ID NO: 306);
Ac-C(Me)-P-A-R-A-S-L-(Dox) (SEQ ID NO: 307);
Ac-G(tBu)-P-G-R-S-L-(Dox) (SEQ ID NO: 308);
Ac-Q-S-R-A-A-(taxol) (SEQ ID NO: 552);
Ac-Q-S-R-S-A-(taxol) (SEQ ID NO: 5531;
Ac-Q-S-R-S-G-(taxol) (SEQ ID NO: 554);
Ac-R-S-R-A-A-(taxol) (SEQ ID NO: 555);
Ac-R-Q-S-R-A-A-(taxol) (SEQ ID NO: 556);
Ac-R-Q-S-R-S-A-(taxol) (SEO iD NO: 557);
Ac-R-Q-S-R-S-A-A-(taxol) (SEQ ID NO: 558);
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-221-
Ac-R-G-S-G-R-S-A-(taxol) (SEQ ID NO: 559);
Ac-S-G-R-A-A-(taxol) (SEQ ID NO: 560);
Ac-S-G-R-S-A-(taxol) (SEO ID NO: 561 );
Ac-S-G-R-S-S-A-(taxol) (SEQ fD NO: 562);
Ac-S-G-R-A-S-A-(taxol) (SEQ ID NO: 563);
Ac-S-G-R-S-G-(taxol) (SEQ ID NO: 564);
Ac-S-G-R-S-S-G-(taxol) (SEQ ID NO: 565);
Ac-S-G-R-S-G-A-(taxol) (SEQ ID NO: 566);
Ac-S-G-R-S-G-G-(taxol) (SEQ ID N0:567);
Ac-G-T-G-R-S-G-G-(taxol) (SEQ ID NO: 568);
Ac-L-R-R-Q-S-R-A-A-(Dox) (SEQ ID NO: 597);
MeS02-dA(Chx)-Abu-R-S-L-(Dox) (SEQ ID NO: 598);
Ac-R-A-R-S-L-(Dox) (SEQ ID NO: 599);
Ac-dA(Chx)-Abu-R-S-L-(Dox) (SEQ ID NO: 600);
Ac-dA(Chx)-Abu-R-S-S-L-(Dox) (SEQ ID NO: 601 );
Ac-Q-G-R-S-S-L-(Dox) (SEQ ID NO: 602);
MeOCO-dhF-P(OH)-R-S-S-L-(Dox) (SEQ ID NO: 603);
MeOCO-Quat4-G-R-S-L-(Dox) (SEQ ID NO: 604);
As-dCha-P(OH)-R-S-S-L-(Dox) (SEQ ID NO: 605);
Ac-dCha-Abu-R-S-S-A-(taxol) (SEQ ID NO: 606);
MeOGO-Quat2-G-R-S-L-NH2 (SEQ ID NO: 607);
MeOCO-Quat3-G-R-S-L-NH2 (SEQ ID NO: 608); and
MeOCO-Quat-G-R-S-L-NH2 (SEQ ID NO: 609).
EXAMPLE 10
Pharmacokinetic studies of conjugates and fraction of the dose
metabolized to Doxorubicin and Leucine-doxorubicin in naive and tumor
bearing mice.
Naive or tumor bearing nude mice 8-12 weeks of age have been
used for pharmacokinetic studies of the test conjugates. Tumor cells for
implantation have been prepared following one of three protocols.
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-222-
Protocol A Tumor cells collected from tissue culture
Tumor cells are trypsinized and resuspended in the growth medium
and centrifuged for 6 min at 200xg. The cells are resuspended in serum-
free medium and counted. The appropriate volume of the solution
containing the desired number of cells is then transferred to a conical
centrifuge tube, centrifuged as before and resuspended in the appropriate
volume of a cold 1:1 mixture of cells in phenol free medium : matrigel.
Each mouse is inoculated with 0.2 - 0.5 mL containing between 1 x1 O6
and 1 x 10' tumor cells subcutaneously or orthotopically.
Protocol B Tumor cell suspension
Established tumors (200-1000mm3) are dissected from mice,
weighed and rinsed in tumor cell growth medium. The tumors are passed
through a steel cell dissociation sieve. The cells are rinsed through the
sieve with growth medium. The cells are centrifuged for 6 min at 200xg
and resuspended in the appropriate volume of a cold 1:1 mixture of cells
matrigel. Each mouse is inoculated with 0.2-0.5 mL of tumor cells
subcutaneously or orthotopically.
Protocol C Tumor fragments
Alternatively a tumor measuring approximately 800mm3 is
dissected out of a mouse, rinsed in tumor cell growth medium and cut
into 1-2 mm3 fragments. Each fragment is inoculated subcutaneously or
orthotopically using a trocar needle.
Pharmacokinetic Study
Naive or tumor bearing mice are individually weighed and assigned
to groups. The mice are dosed with 1-100umolelkg, including
30umole/kg, 25umole/kg, or 21.5umole/kg of the test conjugate
intraperitoneally or intravenously. At a given time point between 5
minutes and 24 hours after administration of the compound the mice are
sacrificed. Blood is collected in a syringe containing protease inhibitors
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-223-
such as EDTA, AEBSF, Aprotinin, Leupeptin, Bestatin, Pepstanin A or E64
and transferred into a heparinized blood collection tube. The plasma is
prepared by centrifugation. The tumors are collected and pulverized in
liquid nitrogen. The resulting tumor powders are stored at -80°C. The
tumor powders and plasma are extracted and analyzed for the parent test
conjugate and its products including Leucine-doxorubicin (or norleucine-
doxorubicin, etc.) and doxorubicin.
Looking at the delivery of the toxin to the tumor cells, and also
looking at the parent conjugate and the levels of toxin (dox and nor-leu
dox) in the plasma.
RESULTS
For example, test conjugate (21 .5 umole/kg of Ac-Gly-Ser-Gly-Arg-
Ser-nLeu-Dox (see Example 2)) was administered to naive and tumor
bearing (TB) mice intraperitoneally (IP) or intravenously (IV). One hour
after administration plasma and tumor tissue was collected from the
mice. Concentrations of the test conjugate and its products are
compared. The results show that the conjugate does not get into the
tumor, the toxins (norleu dox and dox -,uM concentrations in the tumor at
one hour following the single (both IP and IV) injection. There were lower
levels of dox and nor-leu dox the plasma than in the tumor.
Extraction, chromatography LC/MS conditions
Plasma: Plasma samples are prepared using acetonitrile protein
precipitation. A standard curve was constructed from addition of 5 to 20
~L volumes of a standard compound to 0.1 mL or 0.05 mL volumes of
plasma on ice. The standard curve ranges from 10 ng/mL - 1 ug/mL or
from 100 ng/mL - 4 ug/mL of the standard compound. Immediumtely
after standard addition, acetonitrile is added to precipitate the proteins.
The study plasma samples were prepared by thawing the frozen plasma
samples on ice. The aliquots were added directly to the acetonitrile.
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-224-
After sample precipitation, the sample is mixed using vortex mixing. The
precipitate was pelleted using centrifugation. The supernatent was dried
using vacuum centrifugation. The sample was reconstituted with 0.15
mL of 30% acetonitrile - 70% (0.01 M ammonium acetate with 0.1
formic acid). 0.01 mL of the sample was injected for LC-MS analysis.
The HPLC conditions were a linear gradient of 20% acetonitrile - 80%
(10 mM ammonium acetate - .1 % formic acid) to 50% acetonitrile - 50%
(10 mM ammonium acetate - .1 % formic acid) in 1 minute at 0.3 mL/min
in a 30 x 2.1 mm ~orbax SB C18 HPLC column. Detection was provided
by a triple quad mass spectrometer with electrospray ionization.
Doxorubicin was monitored using the m/z transition 544.1 - 396.8.
Leucine-doxorubicin was monitored using 657.2 - 242.8. An exemplary
parent conjugate was monitored using 1555.9 -1555.9. Scanning LC-
MS and fluorescence detection was used to identify cleavage products
other than doxorubicin or leucine-doxorubicin (or norleucine-doxorubicin,
etc.) in the plasma.
Tumor: Immediately after excision from the mouse, the tumor for
analysis is weighed and placed into a mortar containing liquid nitrogen.
With the mortar nested in a bed of dry ice, the tumor is ground into a
fine powder while additional liquid nitrogen is added as needed to avoid
thawing. When a homogeneous tumor powder is achieved, the remaining
liquid nitrogen is allowed to boil off. The tumor powder is quantitatively
transferred to a 15ml conical tube that has been pre-chilled and is on dry
ice. The sample is stored at -70 °C until analysis. The tumor powder is
thawed on ice and vortex mixed with 0.01 M ammonium acetate in a 1
gram tumor/mL ammonium acetate solution concentration to form a
slurry. An aliquot of 0.1 mL of the tumor slurry is precipitated with 0.5
mL acetonitrile. The supernatant is separated from the precipitated solids
and then evaporated using vacuum centrifugation. Quantification of
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-225-
doxorubicin, leucine-doxorubicin (or norleucine-docorubicin, etc.), is
achieved by reference to a standard curve constructed from spiking
measured amounts of standard compounds (doxorubicin, leucine-
doxorubicin, etc.) into control tumor slurry. A typical standard curve
ranges from 1 ng to 200 ng of compound per aliquot of tumor slurry.
After the unknown samples and standards are processed and dried, the
residue is reconstituted in 0.15mL of 30% acetonitrile - 70% (0.01 M
ammonium acetate + 0.1 % formic acid). 10 ,uL of solution is injected
onto a liquid chromatography - mass spectrometry system. The HPLC
conditions were a linear gradient of 20% acetonitrile - 80% (10 mM
ammonium acetate - .1 % formic acid) to 50% acetonitrile - 50% (10 mM
ammonium acetate - .1 % formic acid) in 1 minute at 0.3 mL/min in a 30
x 2.1 mm Zorbax SB C18 HPLC column. Detection was provided by a
triple quad mass spectrometer with electrospray ionization. Doxorubicin
was monitored using the m/z transition 544.1 - 396.8. Leucine-
doxorubicin was monitored using 657.2 - 242.8.
Since modifications will be apparent to those of skill in this art, it is
intended that this invention be limited only by the scope of the appended
claims.
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-1-
SEQUENCE LISTING
<110> Edwin L. Madison
Joseph Edward Semple
George P. Vlasuk
Scott Jeffrey Kemp
Mallareddy Komandla
Daniel Vanna Siev
<120> Conjugates Activated By Cell Surface Proteases and Therapeutic Uses
Thereof
<130> 24745-1611PC
<140> Not Yet Assigned
<141> Herewith
<160> 611
<170> FastSEQ for Windows Version 4.0
<210> 1
<211> 3147
<212> DNA
<213> Homo Sapien
<220>
<223> Nucleotide sequence encoding MTSP1
<221> CDS
<222> (23) .. . (2589)
<300>
<301> 0'Brien, T.J. and Tanimoto, H.
<308> GenBank AR081724
<310> US Pat 5972616
<311> 1998-02-20
<312> 1999-10-26
<400>
1
tcaagagcgg gggagc cgg aagggc gga 52
cctcggggta gat gcc
cc cgc
atg
MetGlySer Arg LysGly
Asp Ala Gly
Arg
1 5 10
gggggcccg aaggacttc ggcgcgggactc aagtacaac tcccgg cac 100
GlyGlyPro LysAspPhe GlyAlaGlyLeu LysTyrAsn SerArg His
15 20 25
gagaaagtg aatggcttg gaggaaggcgtg gagttcctg ccagtc aac 148
GluLysVal AsnGlyLeu GluGluGlyVal GluPheLeu ProVal Asn
30 35 40
aacgtcaag aaggtggaa aagcatggcccg gggcgctgg gtggtg ctg 196
AsnValLys LysValGlu LysHisGlyPro GlyArgTrp ValVal Leu
45 50 55
gcagccgtg ctgatcggc ctcctcttggtc ttgctgggg atcggc ttc 244
AlaAlaVal LeuIleGly LeuLeuLeuVal LeuLeuGly IleGly Phe
60 65 70
ctggtgtgg catttgcag taccgggacgtg cgtgtccag aaggtc ttc 292
LeuValTrp HisLeuGln TyrArgAspVal ArgValGln LysVal Phe
75 80 85 90
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-2-
aatggctacatg aggatc acaaatgag aattttgtg gatgcctac gag 340
AsnGlyTyrMet ArgIle ThrAsnGlu AsnPheVal AspAlaTyr Glu
95 100 105
aactccaactoc actgag tttgtaagc ctggccagc aaggtgaag gac 388
AsnSerAsnSer ThrGlu PheValSer LeuAlaSer LysValLys Asp
110 115 120
gcgctgaagctg ctgtac agcggagtc ccattcctg ggcccctac cao 436
AlaLeuLysLeu LeuTyr SerGlyVal ProPheLeu GlyProTyr His
125 130 135
aaggagtcggot gtgacg gccttcagc gagggcagc gtcatcgcc tac 484
LysGluSerAla ValThr AlaPheSer GluGlySer ValIleAla Tyr
140 145 150
tactggtctgag ttcagc atcccgcag cacctggtg gaggaggcc gag 532
TyrTrpSerGlu PheSer IleProGln HisLeuVal GluGluAla Glu
155 160 165 170
cgcgtcatggoc gaggag cgcgtagtc atgctgCCC CCgcgggcg cgc 580
ArgValMetAla GluGlu ArgValVal MetLeuPro ProArgAla Arg
175 180 185
tccctgaagtoc tttgtg gtcacctca gtggtgget ttccccacg gac 628
SerLeuLysSer PheVal ValThrSer ValValAla PheProThr Asp
190 195 200
tccaaaacagta cagagg acccaggac aacagctgc agctttggc ctg 676
SerLysThrVal GlnArg ThrGlnAsp AsnSerCys SerPheGly Leu
205 210 215
CdCgCCCgCggt gtg~gagctgatgCgC ttCaCCaCg CCCggCttC CCt 724
HisAlaArgGly ValGlu LeuMetArg PheThrThr ProGlyPhe Pro
220 225 230
gacagcccctac cccget CatgCCCgC tgccagtgg gccctgcgg ggg 772
AspSerProTyr ProAla HisAlaArg CysGlnTrp AlaLeuArg Gly
235 240 245 250
gaCgCCgaCtCa gtgCtg agCCtCaCC ttCCgCagC tttgacctt geg 820
AspAlaAspSer ValLeu SerLeuThr PheArgSer PheAspLeu Ala
255 260 265
tcctgcgacgag cgcggo agcgacctg gtgacggtg tacaacacc ctg 868
SerCysAspGlu ArgGly SerAspLeu ValThrVal TyrAsnThr Leu
270 275 280
agccccatggag CCCCaC gccctggtg cagttgtgt ggcacctac cct 916
SerProMetGlu ProHis AlaLeuVal GlnLeuCys GlyThrTyr Pro
285 290 295
ccctcctacaac ctgacc ttccactcc tcccagaac gtcctgctc atc 964
ProSerTyrAsn LeuThr PheHisSer SerGlnAsn ValLeuLeu Ile
300 305 310
acactgataacc aacact gagcggcgg catcccggc tttgaggcc acc 1012
ThrLeuIleThr AsnThr GluArgArg HisProGly PheGluAla Thr
315 320 325 330
ttc ttc cag ctg cct agg atg agc agc tgt gga ggc cgc tta cgt aaa 1060
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-3-
Phe Phe Gln Leu Pro Arg Met Ser Ser Cys Gly Gly Arg Leu Arg Lys
335 340 345
gcccag gggacattcaac agcccc tactaccca ggccactac ccaccc 1108
AlaGln GlyThrPheAsn SerPro TyrTyrPro GlyHisTyr ProPro
350 . 355 360
aacatt gactgcacatgg aacatt gaggtgccc aacaaccag catgtg 1156
AsnIle AspCysThrTrp AsnIle GluValPro AsnAsnGln HisVal
365 370 375
aaggtg agcttcaaattc ttctac ctgctggag cccggcgtg cctgcg 1204
LysVal SerPheLysPhe PheTyr LeuLeuGlu ProGlyVal ProAla
380 385 390
ggcacc tgccccaaggac tacgtg gagatcaat ggggagaaa tactgc 1252
GlyThr CysProLysAsp TyrVal GluIleAsn GlyGluLys TyrCys
395 400 405 410
ggagag aggteccagttc gtcgtc accagcaac agcaacaag atcaca 1300
GlyGlu ArgSerGlnPhe ValVal ThrSerAsn SerAsnLys IleThr
415 420 425
gttcgc ttccactcagat cagtcc tacaccgac accggcttc ttaget 1348
Va1Arg PheHisSerAsp GlnSer TyrThrAsp ThrGlyPhe LeuAla
430 435 440
gaatac ctctcctacgac tccagt gacccatgc ccggggcag ttcacg 1396
GluTyr LeuSerTyrAsp SerSer AspProCys ProGlyGln PheThr
445 450 455
tgccgc acggggcggtgt atccgg aaggagctg cgctgtgat ggctgg 1444
CysArg ThrGlyArgCys IleArg LysGluLeu ArgCysAsp GlyTrp
460 465 470
gccgac tgcaccgaccac agcgat gagctcaac tgcagttgc gacgcc 1492
AlaAsp CysThrAspHis SerAsp GluLeuAsn CysSerCys AspAla
475 480 485 490
ggccac cagttcacgtgc aagaac aagttctgc aagCCCCtC ttctgg 1540
GlyHis GlnPheThrCys LysAsn LysPheCys LysProLeu PheTrp
495 500 505
gtctgc gacagtgtgaac gactgc ggagacaac agcgacgag cagggg 1588
ValCys AspSerValAsn AspCys GlyAspAsn SerAspGlu GlnGly
510 515 520
tgcagttgt ccggcccag accttc aggtgttcc aatgggaag tgcctc 1636
CysSerCys ProAlaGln ThrPhe ArgCysSer AsnG1yLys CysLeu
525 530 535
tcgaaaagc cagcagtgc aatggg aaggacgac tgtggggac gggtcc 1684
SerLysSer GlnGlnCys AsnGly LysAspAsp CysGlyAsp GlySer
540 545 550
gacgaggcc tcctgcccc aaggtg aacgtcgtc acttgtacc aaacac 1732
AspGluAla SerCysPro LysVal AsnValVal ThrCysThr LysHis
555 560 565 570
acctaccgc tgcctcaat gggctc tgcttgagc aagggcaac cctgag 1780
ThrTyrArg CysLeuAsn GlyLeu CysLeuSer LysGlyAsn ProGlu
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-4-
575 580 585
tgtgacggg aaggaggac tgtagc gacggctcagat gagaag gactgc 1828
CysAspGly LysGluAsp CysSer AspGlySerAsp GluLys AspCys
590 595 600
gactgtggg ctgcggtca ttcacg agacaggetcgt gttgtt gggggc 1876
AspCysGly LeuArgSer PheThr ArgGlnAlaArg ValVal GlyGly
605 610 615
acggatgcg gatgagggc gagtgg ccctggcaggta agcctg catget 1924
ThrAspAla AspGluGly GluTrp ProTrpGlnVal SerLeu HisAla
620 625 630
ctgggccag ggccacatc tgcggt gettccctcatc tctccc aactgg 1972
LeuGlyGln G1yHisIle CysGly AlaSerLeuIle SerPro AsnTrp
635 640 645 650
ctggtctct gccgcacac tgctac atcgatgacaga ggattc aggtac 2020
LeuValSer AlaAlaHis CysTyr I1eAspAspArg GlyPhe ArgTyr
655 660 665
tcagacccc acgcagtgg acggcc ttcctgggcttg cacgac cagagc 2068
SerAspPro ThrGlnTrp ThrAla PheLeuGlyLeu HisAsp GlnSer
670 675 680
cagcgcagc gcccctggg gtgcag gagcgcaggctc aagcgc atcatc 2116
GlnArgSer AlaProGly ValGln G1uArgArgLeu LysArg IleIle
685 690 695
tcccacccc ttcttcaat gacttc accttcgactat gacatc gcgctg 2164
SerHisPro PhePheAsn AspPhe ThrPheAspTyr AspI1e AlaLeu
700 705 710
ctggagctg gagaaaccg gcagag tacagctccatg gtgcgg cccatc 2212
LeuGluLeu GluLysPro AlaGlu TyrSerSerMet ValArg ProIle
715 720 725 730
tgcctgccg gacgcctcc catgtc ttccctgccggc aaggcc atctgg 2260
CysLeuPro AspAlaSer HisVal PheProAlaGly LysA1a IleTrp
735 740 745
gtcacgggc tggggacac acccag tatggaggcact ggcgcg ctgatc 2308
ValThrGly TrpGlyHis ThrGln TyrGlyGlyThr GlyA1a LeuIle
750 755 760
ctgcaaaag ggtgagatc cgcgtc atcaaccagacc acctgc gagaac 2356
LeuGlnLys GlyGluIle ArgVal IleAsnGlnThr ThrCys GluAsn
765 770 775
ctcctgccg cagcagatc acgccg cgcatgatgtgc gtgggc ttcctc 2404
LeuLeuPro GlnGlnIle ThrPro ArgMetMetCys ValGly PheLeu
780 785 790
agcggcggc gtggactcc tgccag ggtgattccggg ggaccc ctgtcc 2452
SerGlyGly ValAspSer CysGln GlyAspSerGly GlyPro LeuSer
795 800 805 810
agcgtggag gcggatggg cggatc ttccaggccggt gtggtg agctgg 2500
SerValGlu AlaAspGly ArgIle PheGlnAlaGly ValVal SerTrp
815 820 825
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-5-
gga gac tgc get gtg tac agg ctc 2548
ggc cag agg aca
aac aag
cca ggc
Gly Asp Val Tyr Arg Leu
Gly Cys Thr
Ala Gln
Arg Asn
Lys Pro
Gly
830 835 840
cct ctg cgg gac ggg gta ggggccgggg2599
ttt tgg atc to
aaa gag
aac act
Pro Leu Arg Asp Gly Val
Phe Trp Ile
Lys Glu
Asn Thr
845 850 855
ccacccaaatgtgtacacctgcggggccacccatcgtccaccccagtgtgcacgcctgca2659
ggctggagactggaccgctgactgcaccagcgcccccagaacatacactgtgaactcaat2719
ctccagggctccaaatctgcctagaaaacctctcgcttcctcagcctccaaagtggagct2779
gggaggtagaaggggaggacactggtggttctactgacccaactgggggcaaaggtttga2839
agacacagcctcccccgccagccccaagctgggccgaggcgcgtttgtgtatatctgcct2899
cccctgtctgtaaggagcagcgggaacggagcttcggagcctcctcagtgaaggtggtgg2959
ggctgccggatctgggctgtggggcccttgggccacgctcttgaggaagcccaggctcgg3019
aggaccctggaaaacagacgggtctgagactgaaattgttttaccagctcccagggtgga3079
cttcagtgtgtgtatttgtgtaaatgggtaaaacaatttatttctttttaaaaaaaaaaa3139
aaaaaaaa 3147
<210> 2
<211> 855
<212> PRT
<213> Homo Sapien
<400> 2
Met Gly Ser Asp Arg Ala Arg Lys Gly Gly Gly Gly Pro Lys Asp Phe
1 5 10 15
Gly Ala Gly Leu Lys Tyr Asn Ser Arg His Glu Lys Val Asn Gly Leu
20 25 30
Glu Glu Gly Val Glu Phe Leu Pro Val Asn Asn Val Lys Lys Val Glu
35 40 45
Lys His Gly Pro Gly Arg Trp Val Val Leu Ala Ala Val Leu Ile Gly
50 55 60
Leu Leu Leu Val Leu Leu Gly Ile Gly Phe Leu Val Trp His Leu Gln
65 70 75 80
Tyr Arg Asp Val Arg Val Gln Lys Val Phe Asn Gly Tyr Met Arg Ile
85 90 95
Thr Asn Glu Asn Phe Val Asp Ala Tyr Glu Asn Ser Asn Ser Thr Glu
100 105 110
Phe Val Ser Leu Ala Ser Lys Val Lys Asp Ala Leu Lys Leu Leu Tyr
115 120 125
Ser Gly Val Pro Phe Leu Gly Pro Tyr His Lys Glu Ser Ala Val Thr
130 135 140
Ala Phe Ser Glu Gly Ser Val Ile Ala Tyr Tyr Trp Ser Glu Phe Ser
145 150 155 160
Ile Pro Gln His Leu Val Glu Glu Ala Glu Arg Val Met Ala Glu Glu
165 170 175
Arg Val Val Met Leu Pro Pro Arg Ala Arg Ser Leu Lys Ser Phe Val
180 185 190
Val Thr Ser Val Val Ala Phe Pro Thr Asp Ser Lys Thr Val Gln Arg
195 200 205
Thr Gln Asp Asn Ser Cys Ser Phe Gly Leu His Ala Arg Gly Val Glu
210 215 220
Leu Met Arg Phe Thr Thr Pro Gly Phe Pro Asp Ser Pro Tyr Pro Ala
225 230 235 240
His Ala Arg Cys Gln Trp Ala Leu Arg Gly Asp Ala Asp Ser Val Leu
245 250 255
Ser Leu Thr Phe Arg Ser Phe Asp Leu Ala Ser Cys Asp Glu Arg Gly
260 265 270
Ser Asp Leu Val Thr Val Tyr Asn Thr Leu Ser Pro Met Glu Pro His
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-6-
275 280 285
Ala Leu Val Gln Leu Cys Gly Thr Tyr Pro Pro Ser Tyr Asn Leu Thr
290 295 300
Phe His Ser Ser Gln Asn Val Leu Leu Ile Thr Leu Ile Thr Asn Thr
305 310 315 320
Glu Arg Arg His Pro Gly Phe Glu Ala Thr Phe Phe Gln Leu Pro Arg
325 330 335
Met Ser Ser Cys Gly Gly Arg Leu Arg Lys Ala Gln Gly Thr Phe Asn
340 345 350
Ser Pro Tyr Tyr Pro Gly His Tyr Pro Pro Asn Ile Asp Cys Thr Trp
355 360 365
Asn Ile Glu Val Pro Asn Asn Gln His Val Lys Val Ser Phe Lys Phe
370 375 380
Phe Tyr Leu Leu Glu Pro Gly Val Pro Ala Gly Thr Cys Pro Lys Asp
385 390 395 400
Tyr Val Glu Ile Asn Gly Glu Lys Tyr Cys Gly Glu Arg Ser Gln Phe
405 410 415
Val Val Thr Ser Asn Ser Asn Lys Ile Thr Val Arg Phe His Ser Asp
420 425 430
Gln Ser Tyr Thr Asp Thr Gly Phe Leu Ala Glu Tyr Leu Ser Tyr Asp
435 440 445
Ser Ser Asp Pro Cys Pro Gly Gln Phe Thr Cys Arg Thr Gly Arg Cys
450 455 460
Ile Arg Lys Glu Leu Arg Cys Asp Gly Trp Ala Asp Cys Thr Asp His
465 470 475 480
Ser Asp Glu Leu Asn Cys Ser Cys Asp Ala Gly His Gln Phe Thr Cys
485 490 495
Lys Asn Lys Phe Cys Lys Pro Leu Phe Trp Val Cys Asp Ser Val Asn
500 505 510
Asp Cys Gly Asp Asn Ser Asp Glu Gln Gly Cys Ser Cys Pro Ala Gln
515 520 525
Thr Phe Arg Cys Ser Asn Gly Lys Cys Leu Ser Lys Ser Gln Gln Cys
530 535 540
Asn Gly Lys Asp Asp Cys Gly Asp Gly Ser Asp Glu Ala Ser Cys Pro
545 550 555 560
Lys Val Asn Val Val Thr Cys Thr Lys His Thr Tyr Arg Cys Leu Asn
565 570 575
Gly Leu Cys Leu Ser Lys Gly Asn Pro Glu Cys Asp Gly Lys Glu Asp
580 585 590
Cys Ser Asp Gly Ser Asp Glu Lys Asp Cys Asp Cys Gly Leu Arg Ser
595 600 605
Phe Thr Arg Gln Ala Arg Val Val Gly Gly Thr Asp Ala Asp Glu Gly
610 615 620
Glu Trp Pro Trp Gln Val Ser Leu His Ala Leu Gly Gln Gly His Ile
625 630 635 640
Cys Gly Ala Ser Leu Ile Ser Pro Asn Trp Leu Val Ser Ala Ala His
645 650 655
Cys Tyr Ile Asp Asp Arg Gly Phe Arg Tyr Ser Asp Pro Thr Gln Trp
660 665 670
Thr A1a Phe Leu Gly Leu His Asp G1n Ser G1n Arg Ser Ala Pro Gly
675 680 685
Val Gln Glu Arg Arg Leu Lys Arg I1e Ile Ser His Pro Phe Phe Asn
690 695 700
Asp Phe Thr Phe Asp Tyr Asp Ile Ala Leu Leu Glu Leu Glu Lys Pro
705 710 715 720
Ala Glu Tyr Ser Ser Met Val Arg Pro Ile Cys Leu Pro Asp Ala Ser
725 730 735
His Val Phe Pro Ala Gly Lys Ala Ile Trp Val Thr Gly Trp Gly His
740 745 750
Thr Gln Tyr Gly Gly Thr Gly Ala Leu Ile Leu Gln Lys Gly Glu Ile
755 760 765
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
_7_
Arg Val Asn GlnThr ThrCysGlu AsnLeuLeu ProGlnGln Ile
Ile
770 775 780
Thr Pro Met MetCys ValGlyPhe LeuSerGly GlyValAsp Ser
Arg
785 790 795 800
Cys Gln Asp SerGly GlyProLeu SerSerVal GluAlaAsp Gly
Gly
805 810 815
Arg Ile Gln AlaGly ValValSer TrpGlyAsp GlyCysAla Gln
Phe
820 825 830
Arg Asn Pro GlyVal TyrThrArg LeuProLeu PheArgAsp Trp
Lys
835 840 845
Ile Lys Asn ThrGly Val
Glu
850 855
<210>
3
<211>
2137
<212>
DNA
<213> Sapien
Homo
<220>
<221>
CDS
<222> ...(1574)
(261)
<223> ic a serine
Nucle acid transmembrane
encoding
protease (MTSP3)
protein
<400>
3
ccatcctaatacgactcact cgggcaggtc agagagaggc 60
atagggctcg
agcggccgcc
agcagcttgctcagcggaca ccaaggcctg ccctgcactc 120
aggatgctgg
gcgtgaggga
gggcctcctccagccagtgc gctggccagc caggacctgt 180
tgaccaggga
cttctgacct
gtggggaggccctcctgctg ctccaggcta cagggagacc 240
ccttggggtg
acaatctcag
gggaggatcacagagccagc aa 293
atg cct
tta ctg
cag
gat
cct
gac
agt
gat
c
Met Gln
Leu Pro
Gln Leu
Asp
Pro
Asp
Ser
Asp
1 5 10
aac agc gat gtcaaa cccctgcgc aaaccccgt atccccatg gag 341
ctc
Asn Ser Asp ValLys ProLeuArg LysProArg IleProMet Glu
Leu
15 20 25
acc ttc aag gtgggg atccccatc atcatagca ctactgagc ctg 389
aga
Thr Phe Lys ValGly IleProIle IleIleAla LeuLeuSer Leu
Arg
30 35 40
gcg agt atc attgtg gttgtcctc atcaaggtg attctggat aaa 437
atc
Ala Ser Ile IleVal ValValLeu IleLysVal IleLeuAsp Lys
Ile
45 50 55
taC taC CtC tgCggg CagCCtCtC Ca.CttCatC CCgaggaag cag 485
ttC
Tyr Tyr Leu CysGly GlnProLeu HisPheIle ProArgLys Gln
Phe
60 65 70 75
ctg tgt gga gagctg gactgtccc ttgggggag gacgaggag cac 533
gac
Leu Cys Gly GluLeu AspCysPro LeuGlyGlu AspGluGlu His
Asp
80 85 90
tgt gtc agc ttcccc gaagggcct gcagtggca gtccgcctc tcc 581
aag
Cys Val Ser PhePro GluGlyPro AlaValAla ValArgLeu Ser
Lys
95 100 105
aag gac tcc acactg caggtgetg gactcggcc acagggaac tgg 629
cga
Lys Asp Ser ThrLeu GlnValLeu AspSerAla ThrGlyAsn Trp
Arg
110 115 120
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
_g_
ttctct gcctgtttc gacaacttc acagaaget ctcgetgag acagcc 677
PheSer AlaCysPhe AspAsnPhe ThrGluAla LeuAlaGlu ThrAla
125 130 135
tgtagg cagatgggc tacagcagc aaacccacc ttcagaget gtggag 725
CysArg GlnMetGly TyrSerSer LysProThr PheArgAla ValGlu
140 145 150 155
attggc ccagaccag gatctggat gttgttgaa atcacagaa aacagc 773
IleGly ProAspGln AspLeuAsp ValValGlu IleThrGlu AsnSer
160 165 170
caggag cttcgcatg cggaactca agtgggccc tgtctctca ggctcc 821
GlnGlu LeuArgMet ArgAsnSer SerGlyPro CysLeuSer GlySer
175 180 185
ctggtc tccctgcac tgtcttgcc tgtgggaag agcctgaag accccc 869
LeuVal SerLeuHis CysLeuAla CysGlyLys SerLeuLys ThrPro
190 195 200
cgtgtg gtgggtggg gaggaggcc tctgtggat tcttggcct tggcag 917
ArgVal ValGlyGly GluGluAla SerValAsp SerTrpPro TrpGln
205 210 215
gtcagc atccagtac gacatacag cacgtctgt ggagggagc atcctg 965
ValSer IleGlnTyr AspIleGln HisValCys GlyGlySer IleLeu
220 225 230 235
gacccc cactgggtc ctcacggca gcccactgc ttcaggaaa catacc 1013
AspPro HisTrpVal LeuThrAla AlaHisCys PheArgLys HisThr
240 245 250
gatgtg ttcaactgg aaggtgcgg gcaggctca gacaaactg ggcagc 1061
AspVal PheAsnTrp LysValArg AlaGlySer AspLysLeu GlySer
255 260 265
ttccca tccctgget gtggccaag atcatcatc attgaattc aacccc 1109
PhePro SerLeuAla ValAlaLys IleIleIle IleGluPhe AsnPro
270 275 280
atgtac cccaaagac aatgacatc gccctcatg aagctgcag ttccca 1157
MetTyr ProLysAsp AsnAspIle AlaLeuMet LysLeuGln PhePro
285 290 295
ctcact ttctcaggc acagtcagg ctcatctgt ctgcccttc tttgat 1205
LeuThr PheSerGly ThrValArg LeuIleCys LeuProPhe PheAsp
300 305 310 315
gaggag ctcactcca gccacccca ctctggatc attggatgg ggcttt 1253
GluGlu LeuThrPro AlaThrPro LeuTrpIle IleGlyTrp GlyPhe
320 325 330
acgaag cagaatgga gggaagatg tctgacata ctgctgcag gcgtca 1301
ThrLys GlnAsnGly GlyLysMet SerAspIle LeuLeuGln AlaSer
335 340 345
gtccag gtcattgac agcacacgg tgcaatgca gacgatgcg taccag 1349
ValGln ValIleAsp SerThrArg CysAsnAla AspAspAla TyrGln
350 355 360
ggg gaa gtc acc gag aag atg atg tgt gca ggc atc ccg gaa ggg ggt 1397
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
_g_
Gly Glu Thr Glu LysMetMet CysAlaGly IleProGluGly Gly
Val
365 370 375
gtg gac tgc cag ggtgacagt ggtgggccc ctgatgtaccaa tct 1445
acc
Val Asp Cys Gln GlyAspSer GlyGlyPro LeuMetTyrGln Ser
Thr
380 385 390 395
gac cag cat gtg gtgggcatc gttagctgg ggctatggctgc ,ggg 1493
tgg
Asp Gln His Val ValGlyIle ValSerTrp GlyTyrGlyCys Gly
Trp
400 405 410
ggc ccg acc cca ggagtatac accaaggtc tcagcctatctc aac 1541
agc
Gly Pro Thr Pro GlyValTyr ThrLysVal SerAlaTyrLeu Asn
Ser
415 420 425
tgg atc aat gtc tggaagget gagctgtaa tgctgctgcc cctttgcagt1594
tac
Trp Ile Asn Val TrpLysAla GluLeu
Tyr
430 435
gctgggagccgcttccttcc cccccaaagt cagacacaga1654
tgccctgccc
acctggggat
gcaagagtccccttgggtac agcatttctt ggagcagcaa1714
acccctctgc
ccacagcctc
agggcctcaattcctgtaag cgcccagagg aagtcagcag1774
agaccctcgc
agcccagagg
ccctagctcggccacacttg agagacacag cccactgaac1834
gtgctcccag
catcccaggg
aaggtctcaggggtattgct cacactactg aatggaagca1894
aagccaagaa
ggaactttcc
ggctgtcttgtaaaagccca gagaaggaaa gggtctgcgc1954
gatcactgtg
ggctggagag
CagCCCtgtCCgtCttCaCC caagaaacca gttgtaatat2014
CatCCCCaag
cctactagag
aaaatgcactgccctactgt actgttgtca ttgttattac2074
tggtatgact
accgttacct
agctatggccactattatta aaaaaaaaaa aaaaaaaaaa2134
aagagctgtg
taacaaaaaa
aaa 2137
<210>
4
<211>
437
<212>
PRT
<213> Sapien
Homo
<400>
4
Met Leu Asp Pro AspSerAsp GlnProLeu AsnSerLeuAsp Val
Gln
1 5 10 15
Lys Pro Arg Lys ProArgIle ProMetGlu ThrPheArgLys Val
Leu
20 25 30
Gly Ile Ile Ile IleAlaLeu LeuSerLeu AlaSerIleIle Ile
Pro
35 40 45
Val Val Leu Ile LysValIle LeuAspLys TyrTyrPheLeu Cys
Val
50 55 60
Gly Gln Leu His PheIlePro ArgLysGln LeuCysAspGly Glu
Pro
65 70 75 80
Leu Asp Pro Leu GlyGluAsp GluGluHis CysValLysSer Phe
Cys
85 90 95
Pro Glu Pro Ala ValAlaVal ArgLeuSer LysAspArgSer Thr
Gly
100 105 110
Leu Gln Leu Asp SerAlaThr GlyAsnTrp PheSerAlaCys Phe
Val
115 120 125
Asp Asn Thr Glu AlaLeuAla GluThrAla CysArgGlnMet Gly
Phe
130 135 140
Tyr Ser Lys Pro ThrPheArg AlaValGlu IleGlyProAsp Gln
Ser
145 150 155 160
Asp Leu Val Val GluIleThr GluAsnSer GlnGluLeuArg Met
Asp
165 170 175
Arg Asn Ser Gly ProCysLeu SerGlySer LeuValSerLeu His
Ser
180 185 190
Cys Leu Cys Gly LysSerLeu LysThrPro ArgVa1ValGly Gly
Ala
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-10-
195 200 205
Glu Glu Ala Ser Val Asp Ser Trp Pro Trp Gln Val Ser Ile Gln Tyr
210 215 220
Asp Ile Gln His Val Cys Gly Gly Ser Ile Leu Asp Pro His Trp Val
225 230 235 240
Leu Thr Ala Ala His Cys Phe Arg Lys His Thr Asp Val Phe Asn Trp
245 250 255
Lys Val Arg Ala Gly Ser Asp Lys Leu Gly Ser Phe Pro Ser Leu Ala
260 265 270
Val Ala Lys Ile Ile Ile Ile Glu Phe Asn Pro Met Tyr Pro Lys Asp
275 280 285
Asn Asp Ile Ala Leu Met Lys Leu Gln Phe Pro Leu Thr Phe Ser Gly
290 295 300
Thr Val Arg Leu Ile Cys Leu Pro Phe Phe Asp Glu Glu Leu Thr Pro
305 310 315 320
Ala Thr Pro Leu Trp Ile Ile Gly Trp Gly Phe Thr Lys Gln Asn Gly
325 330 335
Gly Lys Met Ser Asp Ile Leu Leu Gln Ala Ser Val Gln Val Ile Asp
340 345 350
Ser Thr Arg Cys Asn Ala Asp Asp Ala Tyr Gln Gly Glu Val Thr Glu
355 360 365
Lys Met Met Cys Ala Gly Ile Pro Glu Gly Gly Val Asp Thr Cys Gln
370 375 380
Gly Asp Ser Gly Gly Pro Leu Met Tyr Gln Ser Asp Gln Trp His Val
385 390 395 400
Val Gly Ile Val Ser Trp Gly Tyr Gly Cys Gly Gly Pro Ser Thr Pro
405 410 415
Gly Val Tyr Thr Lys Val Ser Ala Tyr Leu Asn Trp Ile Tyr Asn Val
420 425 430
Trp Lys Ala Glu Leu
435
<210>
<211>
708
<212>
DNA
<213> Sapien
Homo
<220>
<221>
CDS
<222> .(708)
(1)..
<223> encoding an protease
Nucleic MTSP4 domain
acid
<400>
5
att gtt gga getgtg tcctccgag ggtgagtgg ccatggcag gcc 48
ggt
Ile Val Gly AlaVal SerSerGlu GlyGluTrp ProTrpGln Ala
Gly
1 5 10 15
agc ctc gtt cggggt cgacacatc tgtgggggg gccctcatc get 96
cag
Ser Leu Val ArgGly ArgHisIle CysGlyGly AlaLeuIle Ala
Gln
20 25 30
gac cgc gtg ataaca getgcccac tgcttccag gaggacagc atg 144
tgg
Asp Arg Val IleThr AlaAlaHis CysPheGln GluAspSer Met
Trp
35 40 45
gcc tcc gtg ctgtgg accgtgttc ctgggcaag gtgtggcag aac 192
acg
Ala Ser Val LeuTrp ThrValPhe LeuGlyLys ValTrpGln Asn
Thr
50 55 60
tcg cgc cct ggagag gtgtccttc aaggtgagc cgcctgctc ctg 240
tgg
Ser Arg Pro GlyGlu ValSerPhe LysValSer ArgLeuLeu Leu
Trp
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-11-
65 70 75 80
cacccgtac cacgaa gaggacagc catgactac gacgtggcg ctgctg 288
HisProTyr HisGlu GluAspSer HisAspTyr AspValAla LeuLeu
85 90 95
cagctcgac cacccg gtggtgcgc tcggccgcc gtgcgcccc gtctgc 336
GlnLeuAsp HisPro ValValArg SerAlaAla ValArgPro ValCys
100 105 110
ctgcccgcg cgctcc cacttcttc gagcccggc ctgcactgc tggatt 384
LeuProAla ArgSer HisPhePhe GluProGly LeuHisCys TrpIle
115 120 125
acgggctgg ggcgcc ttgcgcgag ggcggcccc atcagcaac getctg 432
ThrGlyTrp GlyAla LeuArgGlu GlyGlyPro IleSerAsn AlaLeu
130 135 140
cagaaagtg gatgtg cagttgatc ccacaggac ctgtgcagc gaggtc 480
GlnLysVal AspVal GlnLeuIle ProGlnAsp LeuCysSer GluVal
145 150 155 160
tatcgctac caggtg acgccacgc atgctgtgt gccggctac cgcaag 528
TyrArgTyr GlnVal ThrProArg MetLeuCys AlaGlyTyr ArgLys
165 170 175
ggcaagaag gatgcc tgtcagggt gactcaggt ggtccgctg gtgtgc 576
GlyLysLys AspAla CysGlnGly AspSerGly GlyProLeu ValCys
180 185 190
aaggcactc agtggc cgctggttc ctggcgggg ctggtcagc tggggc 624
LysAlaLeu SerGly ArgTrpPhe LeuAlaGly LeuValSer TrpGly
195 200 205
ctgggctgt ggccgg cctaactac ttcggcgtc tacacccgc atcaca 672
LeuGlyCys GlyArg ProAsnTyr PheGlyVal TyrThrArg IleThr
210 215 220
ggtgtgatc agctgg atccagcaa gtggtgacc tga 708
GlyValIle SerTrp IleGlnGln ValValThr
225 230 235
<210> 6
<211> 235
<212> PRT
<213> Homo Sapien
<400> 6
Ile Val Gly Gly Ala Val Ser Ser Glu Gly Glu Trp Pro Trp Gln Ala
1 5 10 15
Ser Leu Gln Val Arg Gly Arg His Ile Cys Gly Gly Ala Leu Ile Ala
20 25 30
Asp Arg Trp Val Ile Thr Ala Ala His Cys Phe Gln Glu Asp Ser Met
35 40 45
Ala Ser Thr Val Leu Trp Thr Val Phe Leu Gly Lys Val Trp Gln Asn
50 55 60
Ser Arg Trp Pro Gly Glu Val Ser Phe Lys Val Ser Arg Leu Leu Leu
65 70 75 80
His Pro Tyr His Glu Glu Asp Ser His Asp Tyr Asp Val Ala Leu Leu
85 90 95
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-12-
Gln Leu Asp His Pro Val Val Arg Ser Ala Ala Val Arg Pro Val Cys
100 105 110
Leu Pro Ala Arg Ser His Phe Phe Glu Pro Gly Leu His Cys Trp Ile
115 120 125
Thr Gly Trp Gly Ala Leu Arg Glu Gly Gly Pro Ile Ser Asn Ala Leu
130 135 140
Gln Lys Val Asp Val Gln Leu Ile Pro Gln Asp Leu Cys Ser Glu Val
145 150 155 160
Tyr Arg Tyr Gln Val Thr Pro Arg Met Leu Cys Ala Gly Tyr Arg Lys
165 170 175
Gly Lys Lys Asp Ala Cys Gln Gly Asp Ser Gly Gly Pro Leu Val Cys
180 185 190
Lys Ala Leu Ser Gly Arg Trp Phe Leu Ala Gly Leu Val Ser Trp Gly
195 200 205
Leu Gly Cys Gly Arg Pro Asn Tyr Phe Gly Val Tyr Thr Arg Ile Thr
210 215 220
Gly Val Ile Ser Trp Ile Gln Gln Val Val Thr
225 230 235
<210> 7
<211> 3104
<212> DNA
<213> Homo Sapien
<220>
<221> CDS
<222> (33)...(2441)
<223> Nucleic acid encoding MTSP4-L (long form) splice variant
<400> 7
tcatcggcca gagggtgatc agtgagcaga ag atg ccc gtg gcc gag gcc ccc 53
Met Pro Val Ala Glu Ala Pro
1 5
cag gtg get ggc ggg cag ggg gac gga ggt gat ggc gag gaa gcg gag 101
Gln Val Ala Gly Gly Gln Gly Asp Gly Gly Asp Gly Glu Glu Ala Glu
15 20
ccg gag ggglatg ttc aag gcc tgt gag gac tcc aag aga aaa gcc cgg 149
Pro Glu Gly Met Phe Lys Ala Cys Glu Asp Ser Lys Arg Lys Ala Arg
25 30 35
ggctacctccgc ctggtgccc ctgtttgtg ctgctggcc ctgctcgtg 197
GlyTyrLeuArg LeuValPro LeuPheVal LeuLeuAla LeuLeuVal
40 45 50 55
ctggettcggcg ggggtgcta ctctggtat ttcctaggg tacaaggcg 245
LeuAlaSerAla GlyValLeu LeuTrpTyr PheLeuGly TyrLysAla
60 65 70
gaggtgatggtc agccaggtg tactcaggc agtctgcgt gtactcaat 293
GluValMetVal SerGlnVal TyrSerGly SerLeuArg ValLeuAsn
75 80 85
cgccacttctcc caggatctt acccgccgg gaatctagt gccttccgc 341
ArgHisPheSer GlnAspLeu ThrArgArg GluSerSer AlaPheArg
90 95 100
agtgaaaccgcc aaagcccag aagatgctc aaggagctc atcaccagc 389
SerGluThrAla LysAlaGln LysMetLeu LysGluLeu IleThrSer
105 110 115
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-13-
acccgc ctggga acttactacaac tccagctcc gtctattcc tttggg 437
ThrArg LeuGly ThrTyrTyrAsn SerSerSer ValTyrSer PheGly
120 125 130 135
gaggga cccctc acctgcttcttc tggttcatt ctccaaatc cccgag 485
GluGly ProLeu ThrCysPhePhe TrpPheIle LeuGlnIle ProGlu
140 l45 150
caccgc cggctg atgctgagcccc gaggtggtg caggcactg ctggtg 533
HisArg ArgLeu MetLeuSerPro GluValVal GlnAlaLeu LeuVal
155 160 165
gaggag ctgctg tccacagtcaac agctcgget gccgtcccc tacagg 581
GluGlu LeuLeu SerThrValAsn SerSerAla AlaValPro TyrArg
170 175 180
gccgag tacgaa gtggaccccgag ggcctagtg atcctggaa gccagt 629
AlaGlu TyrGlu ValAspProGlu GlyLeuVal IleLeuGlu AlaSer
185 190 195
gtgaaa gacata getgcattgaat tccacgctg ggttgttac cgctac 677
ValLys AspIle AlaAlaLeuAsn SerThrLeu GlyCysTyr ArgTyr
200 205 210 215
agctac gtgggc cagggccaggtc ctccggctg aaggggcct gaccac 725
SerTyr ValGly GlnGlyGlnVal LeuArgLeu LysGlyPro AspHis
220 225 230
ctggcc tccagc tgcctgtggcac ctgcagggc cccaaggac ctcatg 773
LeuAla SerSer CysLeuTrpHis LeuGlnGly ProLysAsp LeuMet
235 240 245
ctcaaa ctccgg etggagtggacg ctggcagag tgccgggac cgactg 821
LeuLys LeuArg LeuGluTrpThr LeuAlaGlu CysArgAsp ArgLeu
250 255 260
gccatg tatgac gtggccgggccc ctggagaag aggctcatc acctcg 869
AlaMet TyrAsp ValAlaGlyPro LeuGluLys ArgLeuIle ThrSer
265 270 275
gtgtac ggctgc agcegccaggag CCCgtggtg gaggttctg gcgtcg 917
ValTyr GlyCys SerArgGlnGlu ProValVal GluValLeu AlaSer
280 285 290 295
ggggcc atcatg gcggtcgtctgg aagaagggc ctgcacagc tactac 965
GlyAla IleMet AlaValValTrp LysLysGly LeuHisSer TyrTyr
300 305 310
gacccc ttcgtg ctctccgtgcag ccggtggtc ttccaggcc tgtgaa 1013
AspPro PheVal LeuSerValGln ProValVal PheGlnAla CysGlu
315 320 325
gtgaac ctgacg ctggacaacagg ctcgactcc cagggcgtc ctcagc 1061
ValAsn LeuThr LeuAspAsnArg LeuAspSer GlnGlyVal LeuSer
330 335 340
accccg tacttc cccagctactac tcgccccaa acccactgc tcctgg 1109
ThrPro TyrPhe ProSerTyrTyr SerProGln ThrHisCys SerTrp
345 350 355
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-14-
cacctcacg gtgccctct ctggac tacggcttggcc ctctgg tttgat 1157
HisLeuThr ValProSer LeuAsp TyrGlyLeuAla LeuTrp PheAsp
360 365 370 375
gcctatgca ctgaggagg cagaag tatgatttgccg tgcacc cagggc 1205
AlaTyrAla LeuArgArg GlnLys TyrAspLeuPro CysThr GlnGly
380 385 390
cagtggacg atccagaac aggagg ctgtgtggcttg cgcatc ctgcag 1253
GlnTrpThr IleGlnAsn ArgArg LeuCysGlyLeu ArgIle LeuGln
395 400 405
ccctacgcc gagaggatc cccgtg gtggccacggcc gggatc accatc 1301
ProTyrAla GluArgIle ProVal ValAlaThrAla GlyIle ThrIle
410 415 420
aacttcacc tcccagatc tCCCtC aCCgggcccggt gtgcgg gtgcac 1349
AsnPheThr SerGlnIle SerLeu ThrGlyProGly ValArg ValHis
425 430 435
tatggcttg tacaaccag tcggac ccctgccctgga gagttc ctctgt 1397
TyrG1yLeu TyrAsnGln SerAsp ProCysProG1y GluPhe LeuCys
440 445 450 455
tctgtgaat ggactctgt gtccct gcctgtgatggg gtcaag gactgc 1445
SerValAsn GlyLeuCys ValPro AlaCysAspGly ValLys AspCys
460 465 470
cccaacggc ctggatgag agaaac tgcgtttgcaga gccaca ttccag 1493
ProAsnGly LeuAspGlu ArgAsn CysValCysArg AlaThr PheGln
475 480 485
tgcaaagag gacagcaca tgcatc tcactgcccaag gtctgt gatggg 1541
CysLysGlu AspSerThr CysIle SerLeuProLys ValCys AspGly
490 495 500
cagcctgat tgtctcaac ggcagc gacgaagagcag tgccag gaaggg 1589
GlnProAsp CysLeuAsn GlySer AspGluGluGln CysGln GluGly
505 510 515
gtgccatgt gggacattc accttc cagtgtgaggac cggagc tgcgtg 1637
ValProCys GlyThrPhe ThrPhe GlnCysGluAsp ArgSer CysVal
520 525 530 535
aagaagccc aacccgcag tgtgat gggcggcccgac tgcagg gacggc 1685
LysLysPro AsnProGln CysAsp GlyArgProAsp CysArg AspGly
540 545 550
tcggatgag gagcactgt gaatgt ggcctccagggc ccctcc agccgc 1733
SerAspGlu GluHisCys GluCys GlyLeuGlnGly ProSer SerArg
555 560 565
attgttggt ggagetgtg tcctcc gagggtgagtgg ccatgg caggcc 1781
IleValGly GlyAlaVal SerSer G1uGlyGluTrp ProTrp GlnAla
570 575 580
agcctccag gttcggggt cgacac atctgtgggggg gccctc atcget 1829
SerLeuGln ValArgGly ArgHis IleCysGlyGly AlaLeu IleAla
585 590 595
gac cgc tgg gtg ata aca get gcc cac tgc ttc cag gag gac agc atg 1877
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-15-
AspArgTrp ValIleThr AlaAla HisCysPheGln Glu Ser Met
Asp
600 605 610 615
gcctccacg gtgctgtgg accgtg ttcctgggcaag gtg cag aac 1925
tgg
AlaSerThr ValLeuTrp ThrVal PheLeuGlyLys Val Gln Asn
Trp
620 625 630
tcgcgctgg cctggagag gtgtcc ttcaaggtgagc cgc ctc ctg 1973
ctg
SerArgTrp ProGlyGlu ValSer PheLysValSer Arg Leu Leu
Leu
635 640 645
cacccgtac cacgaagag gacagc catgactacgac gtg ctg ctg 2021
gcg
HisProTyr HisGluGlu AspSer HisAspTyrAsp Val Leu Leu
Ala
650 655 660
cagctcgac cacccggtg gtgcgc tcggccgccgtg CgC gtc tgc 2069
CCC
GlnLeuAsp HisProVal ValArg SerAlaAlaVal Arg Val Cys
Pro
665 670 675
ctgcccgcg cgctCCCaC ttcttc gagcccggcctg cac tgg att 2117
tgc
LeuProAla ArgSerHis PhePhe GluProGlyLeu His Trp Ile
Cys
680 685 690 695
acgggctgg ggcgccttg cgcgag ggcggccccatc agc get ctg 2165
aac
ThrGlyTrp GlyAlaLeu ArgGlu GlyGlyProIle Ser Ala Leu
Asn
700 705 710
cagaaagtg gatgtgcag ttgatc ccacaggacctg tgc gag gtc 2213
agc
GlnLysVal AspValGln LeuIle ProGlnAspLeu Cys Glu Val
Ser
715 720 725
tatcgctac caggtgacg ccacgc atgctgtgtgcc ggc cgc aag 2261
tac
TyrArgTyr GlnValThr ProArg MetLeuCysAla Gly Arg Lys
Tyr
730 735 740
ggcaagaag gatgcctgt cagggt gactcaggtggt ccg gtg tgc 2309
ctg
GlyLysLys AspAlaCys GlnGly AspSerGlyGly Pro Val Cys
Leu
745 750 755
aaggcactc agtggccgc tggttc ctggcggggctg gtc tgg ggc 2357
agc
LysAlaLeu SerGlyArg TrpPhe LeuAlaGlyLeu Val Trp Gly
Ser
760 765 770 775
ctgggctgt ggccggcct aactac ttcggcgtctac acc atc aca 2405
cgc
LeuGlyCys GlyArgPro AsnTyr PheGlyValTyr Thr Ile Thr
Arg
780 785 790
ggtgtgatc agctggatc cagcaa gtggtgacctga ggaactgccc 2451
GlyValIle SerTrpIle GlnGln ValValThr
795 800
ccctgcaaag cagagagccc agggcaactg
2511
CagggCCCaC ccaagcaggg
Ct
CCtggaCt
ggacaagtat agagcaggcc ctgtggtggc
2571
tctggcgggg aggaggggca
ggtgggggag
tcttgtttcg tggcaggagg atgagaagtg
2631
tccctgatgt ccagcagttg
ctgtccagta
ggggtcaaga ccacacccag cccttttgcc
2691
cgtcccttga tcccaattct
ggacccaggc
ctctcctccg ctaatgcaag gcagtggctc
2751
tccccttcct agcagcaaga
ccactgctgc
atgctggttc aggtgcgccc cactctgtac
2811
tacatcccga agaggctgtt
ggagtgtctg
tgggcagcct cagcttcgga agcccctggt
2871
tgcctccaga ctaacttggg
gagcagattc
atctgggaat gggaccctca gagccctgga
2931
ggaaggtgct gactgccagg
cccatcggag
tgggcctgct ggggaagtcc tgactccagg
2991
gccactgtaa gtccttgccc
gccaaaaggt
CaCCCCtgCC cccagaccct cactgggagg
3051
tgccacctgg tgagctcagc
gccctcacag
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-16-
tgccctttgg aataaagctg cctgatgcaa aaaaaaaaaa aaaaaaaaaa aaa 3104
<210> 8
<211> 802
<212> PRT
<213> Homo Sapien
<400> 8
Met Pro Val Ala Glu Ala Pro Gln Val Ala Gly Gly Gln Gly Asp Gly
1 5 10 15
Gly Asp Gly Glu Glu Ala Glu Pro Glu Gly Met Phe Lys Ala Cys Glu
20 25 30
Asp Ser Lys Arg Lys Ala Arg Gly Tyr Leu Arg Leu Val Pro Leu Phe
35 40 45
Val Leu Leu Ala Leu Leu Val Leu Ala Ser Ala Gly Val Leu Leu Trp
50 55 60
Tyr Phe Leu Gly Tyr Lys Ala Glu Val Met Val Ser Gln Val Tyr Ser
65 70 75 80
Gly Ser Leu Arg Val Leu Asn Arg His Phe Ser Gln Asp Leu Thr Arg
85 90 95
Arg Glu Ser Ser Ala Phe Arg Ser Glu Thr Ala Lys Ala Gln Lys Met
100 105 110
Leu Lys Glu Leu Ile Thr Ser Thr Arg Leu Gly Thr Tyr Tyr Asn Ser
115 120 125
Ser Ser Val Tyr Ser Phe Gly Glu Gly Pro Leu Thr Cys Phe Phe Trp
130 135 140
Phe Ile Leu Gln Ile Pro Glu His Arg Arg Leu Met Leu Ser Pro Glu
145 150 155 160
Val Val Gln Ala Leu Leu Val Glu Glu Leu Leu Ser Thr Val Asn Ser
165 170 175
Ser Ala Ala Val Pro Tyr Arg Ala Glu Tyr Glu Val Asp Pro Glu Gly
180 185 190
Leu Val Ile Leu Glu Ala Ser Val Lys Asp Ile Ala Ala Leu Asn Ser
195 200 205
Thr Leu Gly Cys Tyr Arg Tyr Ser Tyr Val Gly Gln Gly Gln Val Leu
210 215 220
Arg Leu Lys Gly Pro Asp His Leu Ala Ser Ser Cys Leu Trp His Leu
225 230 235 240
Gln Gly Pro Lys Asp Leu Met Leu Lys Leu Arg Leu Glu Trp Thr Leu
245 250 255
Ala Glu Cys Arg Asp Arg Leu Ala Met Tyr Asp Val Ala Gly Pro Leu
260 265 270
Glu Lys Arg Leu Ile Thr Ser Val Tyr Gly Cys Ser Arg Gln Glu Pro
275 280 285
Val Val Glu Val Leu Ala Ser Gly Ala Ile Met Ala Val Val Trp Lys
290 295 300
Lys Gly Leu His Ser Tyr Tyr Asp Pro Phe Val Leu Ser Val Gln Pro
305 310 315 320
Val Val Phe Gln Ala Cys Glu Val Asn Leu Thr Leu Asp Asn Arg Leu
325 330 335
Asp Ser Gln Gly Val Leu Ser Thr Pro Tyr Phe Pro Ser Tyr Tyr Ser
340 345 350
Pro Gln Thr His Cys Ser Trp His Leu Thr Val Pro Ser Leu Asp Tyr
355 360 365
Gly Leu Ala Leu Trp Phe Asp Ala Tyr Ala Leu Arg Arg Gln Lys Tyr
370 375 380
Asp Leu Pro Cys Thr Gln Gly Gln Trp Thr Ile Gln Asn Arg Arg Leu
385 390 395 400
Cys Gly Leu Arg Ile Leu Gln Pro Tyr Ala Glu Arg Ile Pro Va1 Val
405 410 415
Ala Thr Ala Gly Ile Thr Ile Asn Phe Thr Ser Gln Ile Ser Leu Thr
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-17-
420 425 430
Gly Pro Gly Val Arg Val His Tyr Gly Leu Tyr Asn Gln Ser Asp Pro
435 440 445
Cys Pro Gly Glu Phe Leu Cys Ser Val Asn Gly Leu Cys Val Pro Ala
450 455 460
Cys Asp Gly Val Lys Asp Cys Pro Asn Gly Leu Asp Glu Arg Asn Cys
465 470 475 480
Val Cys Arg Ala Thr Phe Gln Cys Lys Glu Asp Ser Thr Cys Ile Ser
485 490 495
Leu Pro Lys Val Cys Asp Gly Gln Pro Asp Cys Leu Asn Gly Ser Asp
500 505 510
Glu Glu Gln Cys Gln Glu Gly Val Pro Cys Gly Thr Phe Thr Phe Gln
515 520 525
Cys Glu Asp Arg Ser Cys Val Lys Lys Pro Asn Pro Gln Cys Asp Gly
530 535 540
Arg Pro Asp Cys Arg Asp Gly Ser Asp Glu Glu His Cys Glu Cys Gly
545 550 555 560
Leu Gln Gly Pro Ser Ser Arg Ile Val Gly Gly Ala Val Ser Ser Glu
565 570 575
Gly Glu Trp Pro Trp Gln Ala Ser Leu Gln Val Arg Gly Arg His Ile
580 585 590
Cys Gly Gly Ala Leu Ile Ala Asp Arg Trp Val Ile Thr Ala Ala His
595 600 605
Cys Phe Gln Glu Asp Ser Met Ala Ser Thr Val Leu Trp Thr Val Phe
610 615 620
Leu Gly Lys Val Trp Gln Asn Ser Arg Trp Pro Gly Glu Val Ser Phe
625 630 635 640
Lys Val Ser Arg Leu Leu Leu His Pro Tyr His Glu Glu Asp Ser His
645 650 655
Asp Tyr Asp Val Ala Leu Leu Gln Leu Asp His Pro Val Val Arg Ser
660 665 670
Ala Ala Val Arg Pro Val Cys Leu Pro Ala Arg Ser His Phe Phe Glu
675 680 685
Pro Gly Leu His Cys Trp Ile Thr Gly Trp Gly Ala Leu Arg Glu Gly
690 695 700
Gly Pro Ile Ser Asn Ala Leu Gln Lys Val Asp Val Gln Leu Ile Pro
705 710 715 720
Gln Asp Leu Cys Ser Glu Val Tyr Arg Tyr Gln Val Thr Pro Arg Met
725 730 735
Leu Cys Ala Gly Tyr Arg Lys Gly Lys Lys Asp Ala Cys Gln Gly Asp
740 745 750
Ser Gly Gly Pro Leu Val Cys Lys Ala Leu Ser Gly Arg Trp Phe Leu
755 760 765
Ala Gly Leu Val Ser Trp Gly Leu Gly Cys Gly Arg Pro Asn Tyr Phe
770 775 780
Gly Val Tyr Thr Arg Ile Thr Gly Val Ile Ser Trp Ile Gln Gln Val
785 790 795 800
Val Thr
<210> 9
<211> 2672
<212> DNA
<213> Homo Sapien
<220>
<221> CDS
<222> (33) .. . (2009)
<223> cDNA encoding: MTSP4-S (short form) splice variant
<400> 9
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-18-
tcatcggcca atgccc gtggcc gaggccccc 53
gagggtgatc
agtgagcaga
ag
MetPro ValAla GluAlaPro
1 5
caggtg getggcggg cagggggac ggaggtgat ggcgag gaagcggag 101
GlnVal AlaGlyGly GlnGlyAsp GlyGlyAsp GlyGlu GluAlaGlu
10 15 20
ccggag gggatgttc aaggcctgt gaggactcc aagaga aaagcccgg 149
ProGlu GlyMetPhe LysAlaCys GluAspSer LysArg LysAlaArg
25 30 35
ggctac ctccgcctg gtgcccctg tttgtgctg ctggcc ctgctcgtg 197
GlyTyr LeuArgLeu ValProLeu PheValLeu LeuAla LeuLeuVal
40 45 50 55
etgget tcggcgggg gtgctactc tggtatttc ctaggg tacaaggcg 245
LeuAla SerAlaGly ValLeuLeu TrpTyrPhe LeuGly TyrLysAla
60 65 70
gaggtg atggtcagc caggtgtac tcaggcagt ctgcgt gtactcaat 293
GluVal MetValSer GlnValTyr SerGlySer LeuArg ValLeuAsn
75 80 85
cgccac ttctcccag gatcttacc cgccgggaa tctagt gccttCCgC 341
ArgHis PheSerGln AspLeuThr ArgArgGlu SerSer AlaPheArg
90 95 100
agtgaa accgccaaa gcccagaag atgctcaag gagctc atcaccagc 389
SerGlu ThrAlaLys AlaGlnLys MetLeuLys GluLeu IleThrSer
105 110 115
acccgc ctgggaact tactacaac tccagctcc gtctat tcctttggg 437
ThrArg LeuGIyThr TyrTyrAsn SerSerSer ValTyr SerPheGly
120 125 130 135
gtgtac ggctgcagc cgccaggag cccgtggtg gaggtt ctggcgtcg 485
ValTyr GlyCysSer ArgGlnGlu ProValVal GluVal LeuAlaSer
140 145 150
ggggcc atcatggcg gtcgtctgg aagaagggc ctgcac agctactac 533
GlyAla IleMetAla ValValTrp LysLysGly LeuHis SerTyrTyr
155 160 165
gacccc ttcgtgctc tccgtgcag ccggtggtc ttccag gcctgtgaa 581
AspPro PheValLeu SerValGln ProValVal PheGln AlaCysGlu
170 175 180
gtgaac ctgacgctg gacaacagg ctcgactcc cagggc gtcctcagc 629
ValAsn LeuThrLeu AspAsnArg LeuAspSer GlnGly ValLeuSer
185 190 195
accccg tacttcccc agctactac tcgccccaa acccac tgctcctgg 677
ThrPro TyrPhePro SerTyrTyr SerProGln ThrHis CysSerTrp
200 205 210 215
cacctc acggtgccc tctctggac tacggcttg gccctc tggtttgat 725
HisLeu ThrValPro SerLeuAsp TyrGlyLeu AlaLeu TrpPheAsp
220 225 230
gcctat gcactgagg aggcagaag tatgatttg ccgtgc acccagggc 773
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-19-
Ala Tyr Ala Leu Arg Arg Gln Lys Tyr Asp Leu Pro Cys Thr Gln Gly
235 240 245
cagtgg acgatccag aacaggagg ctgtgtggc ttgcgcatc ctgcag 821
GlnTrp ThrIleGln AsnArgArg LeuCysGly LeuArgIle LeuGln
250 255 260
ccctac gccgagagg atccccgtg gtggccacg gccgggatc accatc 869
ProTyr AlaGluArg IleProVal ValAlaThr AlaGlyIle ThrIle
265 270 275
aacttc acctcccag atctccctc accgggccc ggtgtgcgg gtgcac 917
AsnPhe ThrSerGln IleSerLeu ThrGlyPro GlyValArg ValHis
280 285 290 295
tatggc ttgtacaac cagtcggac ccctgccct ggagagttc ctctgt 965
TyrGly LeuTyrAsn GlnSerAsp ProCysPro GlyGluPhe LeuCys
300 305 310
tctgtg aatggactc tgtgtccct gcctgtgat ggggtcaag gactgc 1013
SerVal AsnGlyLeu CysValPro AlaCysAsp GlyValLys AspCys
315 320 325
cccaac ggcctggat gagagaaac tgcgtttgc agagccaca ttccag 1061
ProAsn GlyLeuAsp GluArgAsn CysValCys ArgAlaThr PheGln
330 335 340
tgcaaa gaggacagc acatgcatc tcactgccc aaggtctgt gatggg 1109
CysLys GluAspSer ThrCysIle SerLeuPro LysValCys AspGly
345 350 355
cagcct gattgtctc aacggcagc gacgaagag cagtgccag gaaggg 1157
GlnPro AspCysLeu AsnGlySer AspGluGlu GlnCysGln GluGly
360 365 370 375
gtgcca tgtgggaca ttcaccttc cagtgtgag gaccggagc tgcgtg 1205
ValPro CysGlyThr PheThrPhe GlnCysGlu AspArgSer CysVal
380 385 390
aagaag cccaacccg cagtgtgat gggcggccc gactgcagg gacggc 1253
LysLys ProAsnPro GlnCysAsp GlyArgPro AspCysArg AspGly
395 400 405
tcggat gaggagcac tgtgaatgt ggcctccag ggcccctcc agccgc 1301
SerAsp GluGluHis CysGluCys GlyLeuGln GlyProSer SerArg
410 415 420
attgtt ggtggaget gtgtcctcc gagggtgag tggccatgg caggcc 1349
IleVal GlyGlyAla ValSerSer GluGlyGlu TrpProTrp GlnAla
425 430 435
agcctc caggttcgg ggtcgacac atctgtggg ggggccctc atcget 1397
SerLeu GlnValArg GlyArgHis IleCysGly GlyAlaLeu IleAla
440 445 450 455
gaccgc tgggtgata acagetgcc cactgcttc caggaggac agcatg 1445
AspArg TrpValIle ThrAlaAla HisCysPhe GlnGluAsp SerMet
460 465 470
gcctcc acggtgctg tggaccgtg ttcctgggc aaggtgtgg cagaac 1493
AlaSer ThrValLeu TrpThrVal PheLeuGly LysValTrp GlnAsn
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-20-
475 480 485
tcg cgc cct gga gag gtg ttcaag gtgagc cgc ctg ctg 1541
tgg tcc ctc
Ser Arg Pro Gly Glu Val PheLys ValSer Arg Leu Leu
Trp Ser Leu
490 495 500
cac ccg cac gaa gag gac catgac tacgac gtg gcg ctg 1589
tac agc ctg
His Pro His Glu Glu Asp HisAsp TyrAsp Val Ala Leu
Tyr Ser Leu
505 510 515
cag ctc cac ccg gtg gtg tcggcc gccgtg CgC CCC tgc 1637
gac cgc gtc
Gln Leu His Pro Val Val SerAla AlaVal Arg Pro Cys
Asp Arg Val
520 525 530 535
ctg ccc cgc tcc cac ttc gagccc ggcctg cac tgc att 1685
gcg ttc tgg
Leu Pro Arg Ser His Phe GluPro GlyLeu His Cys Ile
Ala Phe Trp
540 545 550
acg ggc ggc gcc ttg cgc ggcggc cccatc agc aac ctg 1733
tgg gag get
Thr Gly Gly Ala Leu Arg GlyGly ProIle Ser Asn Leu
Trp Glu Ala
555 560 565
cag aaa gat gtg cag ttg ccacag gacctg tgc agc gtc 1781
gtg atc gag
Gln Lys Asp Val Gln Leu ProGln AspLeu Cys Ser Val
Val Ile Glu
570 575 580
tat cgc cag gtg acg cca atgctg tgtgcc ggc tac aag 1829
tac cgc cgc
Tyr Arg Gln Val Thr Pro MetLeu CysAla Gly Tyr Lys
Tyr Arg Arg
585 590 595
ggc aag gat gcc tgt cag gactca ggtggt ccg ctg tgc 1877
aag ggt gtg
Gly Lys Asp Ala Cys Gln AspSer GlyGly Pro Leu Cys
Lys Gly Val
600 605 610~ 615
aag gca agt ggc cgc tgg ctggcg gggctg gtc agc ggc 1925
ctc ttc tgg
Lys Ala Ser Gly Arg Trp LeuAla GlyLeu Val Ser Gly
Leu Phe Trp
620 625 630
ctg ggc ggc cgg cct aac ttcggc gtctac acc cgc aca 1973
tgt tac atc
Leu Gly Gly Arg Pro Asn PheGly ValTyr Thr Arg Thr
Cys Tyr Ile
635 640 645
ggt gtg agc tgg atc cag gtggtg acctga ggaactgccc 2019
atc caa
Gly Val Ser Trp Ile Gln ValVal Thr
Ile Gln
650 655
ccctgcaaag cagagagccc agggcaactg 2079
cagggcccac ccaagcaggg
ctcctggact
ggacaagtat agagcaggcc ctgtggtggc 2139
tctggcgggg aggaggggca
ggtgggggag
tcttgtttcg tggcaggagg atgagaagtg 2199
tccctgatgt ccagcagttg
ctgtccagta
ggggtcaagacgtcccttga ggacccaggcccacacccag cccttttgcc 2259
tcccaattct
CtCtCCCCCgtCCCCttCCt CCaCtgCtgCCtaatgCaag gcagtggctc 2319
agcagcaaga
atgctggttctacatcccga ggagtgtctgaggtgcgccc cactctgtac 2379
agaggctgtt
tgggcagccttgcctccaga gagcagattccagcttcgga agcccctggt 2439
ctaacttggg
atctgggaat gggaccctca gagccctgga 2499
ggaaggtgct gactgccagg
cccatcggag
tgggcctgct ggggaagtcc tgactccagg 2559
gccactgtaa gtccttgccc
gccaaaaggt
cacccctgcc cccagaccct cactgggagg 2619
tgCCaCCtgg tgagctcagc
gCCCtCaCag
tgccctttgg aaaaaaaaaa aaaaaaaaaa 2672
aataaagctg aaa
cctgatgcaa
<210>
<211>
658
<212>
PRT
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-21-
<213> Homo Sapien
~400> 10
Met Pro Val Ala Glu Ala Pro Gln Val Ala Gly Gly Gln Gly Asp Gly
1 5 10 15
Gly Asp Gly Glu Glu Ala Glu Pro Glu Gly Met Phe Lys Ala Cys Glu
20 25 30
Asp Ser Lys Arg Lys Ala Arg Gly Tyr Leu Arg Leu Val Pro Leu Phe
35 40 45
Val Leu Leu Ala Leu Leu Val Leu Ala Ser Ala Gly Val Leu Leu Trp
50 55 60
Tyr Phe Leu Gly Tyr Lys Ala Glu Val Met Val Ser Gln Val Tyr Ser
65 70 75 80
Gly Ser Leu Arg Val Leu Asn Arg His Phe Ser Gln Asp Leu Thr Arg
85 90 95
Arg Glu Ser Ser Ala Phe Arg Ser Glu Thr Ala Lys Ala Gln Lys Met
100 105 110
Leu Lys Glu Leu Ile Thr Ser Thr Arg Leu Gly Thr Tyr Tyr Asn Ser
115 120 125
Ser Ser Val Tyr Ser Phe Gly Val Tyr Gly Cys Ser Arg Gln Glu Pro
130 135 140
Val Val Glu Val Leu Ala Ser Gly Ala Ile Met Ala Val Val Trp Lys
145 150 155 160
Lys Gly Leu His Ser Tyr Tyr Asp Pro Phe Val Leu Ser Val Gln Pro
165 170 175
Val Val Phe Gln Ala Cys Glu Val Asn Leu Thr Leu Asp Asn Arg Leu
180 185 190
Asp Ser Gln Gly Val Leu Ser Thr Pro Tyr Phe Pro Ser Tyr Tyr Ser
195 200 205
Pro Gln Thr His Cys Ser Trp His Leu Thr Val Pro Ser Leu Asp Tyr
210 215 220
Gly Leu Ala Leu Trp Phe Asp Ala Tyr Ala Leu Arg Arg Gln Lys Tyr
225 230 235 240
Asp Leu Pro Cys Thr Gln Gly Gln Trp Thr Ile Gln Asn Arg Arg Leu
245 250 255
Cys Gly Leu Arg Ile Leu Gln Pro Tyr Ala Glu Arg Ile Pro Val Val
260 265 270
Ala Thr Ala Gly Ile Thr Ile Asn Phe Thr Ser Gln Ile Ser Leu Thr
275 280 285
Gly Pro Gly Val Arg Val His Tyr Gly Leu Tyr Asn Gln Ser Asp Pro
290 295 300
Cys Pro Gly Glu Phe Leu Cys Ser Val Asn Gly Leu Cys Val Pro Ala
305 310 315 320
Cys Asp Gly Val Lys Asp Cys Pro Asn Gly Leu Asp Glu Arg Asn Cys
325 330 335
Val Cys Arg Ala Thr Phe Gln Cys Lys Glu Asp Ser Thr Cys Ile Ser
340 345 350
Leu Pro Lys Val Cys Asp Gly Gln Pro Asp Cys Leu Asn Gly Ser Asp
355 360 365
Glu Glu Gln Cys Gln Glu Gly Val Pro Cys Gly Thr Phe Thr Phe Gln
370 375 380
Cys Glu Asp Arg Ser Cys Val Lys Lys Pro Asn Pro Gln Cys Asp Gly
385 390 395 400
Arg Pro Asp Cys Arg Asp Gly Ser Asp Glu Glu His Cys Glu Cys Gly
405 410 415
Leu Gln Gly Pro Ser Ser Arg Ile Val Gly Gly Ala Val Ser Ser Glu
420 425 430
Gly Glu Trp Pro Trp Gln Ala Ser Leu Gln Val Arg Gly Arg His Ile
435 440 445
Cys Gly Gly Ala Leu Ile Ala Asp Arg Trp Val Ile Thr Ala Ala His
450 455 460
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-22-
Cys Phe Gln Glu Asp Ser Met Ala Ser Thr Val Leu Trp Thr Val Phe
465 470 475 480
Leu Gly Lys Val Trp Gln Asn Ser Arg Trp Pro Gly Glu Val Ser Phe
485 490 495
Lys Val Ser Arg Leu Leu Leu His Pro Tyr His Glu Glu Asp Ser His
500 505 510
Asp Tyr Asp Val Ala Leu Leu Gln Leu Asp His Pro Val Val Arg Ser
515 520 525
Ala Ala Val Arg Pro Val Cys Leu Pro Ala Arg Ser His Phe Phe Glu
530 535 540
Pro Gly Leu His Cys Trp Ile Thr Gly Trp Gly Ala Leu Arg Glu Gly
545 550 555 560
Gly Pro Ile Ser Asn Ala Leu Gln Lys Val Asp Val Gln Leu Ile Pro
565 570 575
Gln Asp Leu Cys Ser Glu Val Tyr Arg Tyr Gln Val Thr Pro Arg Met
580 585 590
Leu Cys Ala Gly Tyr Arg Lys Gly Lys Lys Asp Ala Cys Gln Gly Asp
595 600 605
Ser Gly Gly Pro Leu Val Cys Lys Ala Leu Ser Gly Arg Trp Phe Leu
610 615 620
Ala Gly Leu Val Ser Trp Gly Leu Gly Cys Gly Arg Pro Asn Tyr Phe
625 630 635 640
Gly Val Tyr Thr Arg Ile Thr Gly Val Ile Ser Trp Ile Gln Gln Val
645 650 655
Val Thr
<210> 11
<211> 1656
<212> DNA
<213> Homo Sapien
<220>
<221> CDS
<222> (268) . . . (1629)
<223> Nucleic acid encoding a transmembraneserine
protease (MTSP-6) protein
<400> 11
cgcccgggca ggtcagtaac actgtggcct actatctcttccgtggtgcc atctacattt60
ttgggactcg ggaattatga ctgtttttgg ttaatcgatactgaatgcgc tttgtgtgga120
ctgtcgaatt tcaaagattt accgtatgac caagatgcacctgatgctac aagtataaat180
aggggaacaa atgctttctg ttcttcctcg gctaaggaggtagaggtgga ggcggagccg240
gatgtcagag gtcctgaaat agtcacc atg 294
ggg gaa aat gat ccg cct get gtt
Met Gly Glu Asn Asp Pro Pro Ala Val
1 5
gaa gcc ccc ttc tca ttc cga tcg ctt ctt gat gat ttg 342
ttt ggc aaa
Glu Ala Pro Phe Ser Phe Arg Ser Leu Leu Asp Asp Leu
Phe Gly Lys
15 20 25
ata agt cct gtt gca cca gat gca gat get gca cag atc 390
get gtt ctg
Ile Ser Pro Val Ala Pro Asp Ala Asp Ala Ala Gln Ile
Ala Val, Leu
30 35 40
tca ctg ctg cca ttg aag ttt ttt cca gtc att ggg atc 438
atc atc att
Ser Leu Leu Pro Leu Lys Phe Phe Pro Val Ile Gly Ile
Ile Ile Ile
45 50 55
gca ttg ata tta gca ctg gcc att ggt atc cac ttc gac 486
ctg ggc tgc
Ala Leu Ile Leu Ala Leu Ala Ile Gly Ile His Phe Asp
Leu Gly Cys
CA 02447023 2003-11-12
WO 02/095007 PCT/US02/16819
-23-
60 65 70
tcaggg aagtacaga tgtcgctca tcctttaag tgtatcgag ctgata 534
SerGly LysTyrArg CysArgSer SerPheLys CysIleGlu LeuIle
75 80 85
getcga tgtgacgga gtctcggat tgcaaagac ggggaggac gagtac 582
AlaArg CysAspGly ValSerAsp CysLysAsp GlyGluAsp GluTyr
90 95 100 105
cgctgt gtccgggtg ggtggtcag aatgccgtg ctccaggtg ttcaca 630
ArgCys ValArgVal GlyGlyGln AsnAlaVal LeuGlnVal PheThr
110 115 120
getget tcgtggaag accatgtgc tccgatgac tggaagggt cactac 678
AlaAla SerTrpLys ThrMetCys SerAspAsp TrpLysGly HisTyr
125 130 135
gcaaat gttgcctgt gcccaactg ggtttccca agctatgta agttca 726
AlaAsn ValAlaCys AlaGlnLeu GlyPhePro SerTyrVal SerSer
140 145 150
gataac ctcagagtg agctcgcta gaggggcag ttccgggag gagttt 774
AspAsn LeuArgVal SerSerLeu GluGlyGln PheArgGlu GluPhe
155 160 165
gtgtcc atcgatCaC CtCttgcca gatgacaag gtgactgca ttacac 822
ValSer IleAspHis LeuLeuPro AspAspLys ValThrAla LeuHis
170 175 180 185
cactca gtatatgtg agggaggga tgtgcctct ggccacgtg gttacc 870
HisSer ValTyrVal ArgGluGly CysAlaSer GlyHisVal ValThr
190 195 200
ttgcag tgcacagcc tgtggtcat agaaggggc tacagctca cgcatc 918
LeuGln CysThrAla CysGlyHis ArgArgGly TyrSerSer ArgIle
205 210 215
gtgggt ggaaacatg tccttgctc tcgcagtgg ccctggcag gccagc 966
ValGly GlyAsnMet SerLeuLeu SerGlnTrp ProTrpGln AlaSer
220 225 230
cttcag ttccagggc taccacctg tgcgggggc tctgtcatc aCgccc 1014
LeuGln PheGlnGly TyrHisLeu CysGlyGly SerValIle ThrPro
235 240 245
ctgtgg atcatcact getgcacac tgtgtttat gacttgtac ctcccc 1062
LeuTrp IleIleThr AlaAlaHis CysValTyr AspLeuTyr LeuPro
250 255 260 265
aagtca tggaccatc caggtgggt ctagtttcc ctgttggac aatcca 1110
LysSer TrpThrIle GlnValGly LeuValSer LeuLeuAsp AsnPro
270 275 280
gcccca tcccacttg gtggagaag attgtctac cacagcaag tacaag 1158
AlaPro SerHisLeu ValGluLys ~IleValTyr HisSers TyrLys
Ly
285 290 ,
295
ccaaag aggctgggc aatgacatc gcccttatg aagctggcc gggcca 1206
ProLys ArgLeuGly AsnAspIle AlaLeuMet LysLeuAla GlyPro
300 305 310
DEMANDES OU BREVETS VOLUMINEUX
LA PRESENTE PARTIE DE CETTE DEMANDE OU CE BREVETS
COMPRI~:ND PLUS D'UN TOME.
CECI EST L,E TOME 1 DE 2
NOTE: Pour les tomes additionels, veillez contacter le Bureau Canadien des
Brevets.
JUMBO APPLICATIONS / PATENTS
THIS SECTION OF THE APPLICATION / PATENT CONTAINS MORE
THAN ONE VOLUME.
THIS IS VOLUME 1 OF 2
NOTE: For additional valumes please contact the Canadian Patent Office.
