Note: Descriptions are shown in the official language in which they were submitted.
CA 02448620 2010-11-30
51440-164
- 1 -
VACCINATION AGAINST THE FELINE IMMUNODEFICIENCY VIRUS
The present invention relates to immunization and
vaccination against feline immunodeficiency virus. It
also relates to vaccination kits.
=
Feline immunodeficiency virus (FIV) is a single-
stranded RNA retrovirus of positive polarity belonging
to the lentivirus family.
FIV, which is widely distributed throughout the world,
essentially affects felines, in particular cats.
The disease is characterized by deterioration and
suppression of the immune system, allowing the
development of opportunistic diseases and possibly
leading to death.
The FIV RNA molecule is composed of several open
reading frames (ORFs) encoding structural proteins, in
particular env and gag, viral enzymes, in particular
pol and pro, and transactivators, in particular tat and
rev. The rev ORF is composed of two exons.
Inactivated vaccines have been proposed, but, in order
to be protective, require very large amounts of
antigens, which poses problems for industrialization.
Other vaccinal approaches have been attempted, in
particular the use of the envelope protein, in subunit
form or expressed by a recombined expression vector.
These studies have not produced satisfactory results.
They have, moreover, demonstrated enhancement
phenomena, resulting in a viraemia which occurs earlier
in vaccinated animals than in control animals.
The article by Cuisiner (Cuisinier A.M. et al.,
Vaccine, 1997, 11 AN 1085-1094) recalls that,
=
subsequent to vaccination attempts using inactivated
viruses, it appeared that the gp120 surface
CA 02448620 2010-11-30
51440-164
- 2 -
glycoprotein would be determinant for protection. It
recalls, however, that several vaccination attempts
using recombined env proteins have not made it possible
to induce protection. The authors describe experiments
in which cats are vaccinated by intramuscular
administration of DNA encoding FIV gp120 and p10
(nucleocapsid). Administering DNA encoding FIV gp120
induces only partial protection. When a combination of
gp120 and p10 is used, no protection is observed.
On the other hand, the article by Richardson
(Richardson J. et al., J. Virol., 1997, 71(12), 9640-
9649) reports, with administration of plasmids encoding
FIV env, an enhancement phenomenon. This phenomenon has
also been observed in vaccination using recombined FIV
proteins (Lutz H. et al., AIDS Research and Human
Retroviruses, 1996, 12(5), 431-433) and vaccinia virus
expressing FIV env (Osterhaus A.D.M.E. et a/., AIDS
Research and Human Retroviruses, 1996, 12(5), 437-441).
WO-A-98/21354 describes a protocol for vaccination
against EDT, in which a recombined canarypox vector
having Fly env and gag/pro as the insert is first
administered, followed by inactivated FIV produced on T
lymphocytes.
In Cuisinier A.M. et al., Vaccine, 1999, 17, 415-425,
the administration of DNA expressing gp120 is here
again the cause of enhancement phenomena.
Various vaccination approaches have therefore been
studied, namely inactivated vaccines, subunit vaccines
and recombined vaccines (viral vectors and DNA). To
date, there is no satisfactory solution nor any clear
direction for research.
After considerable research efforts, the applicant has
been. able to develop a technique for vaccinating
felines against FIV using recombined vaccines of the
CA 02448620 2010-11-30
51440-164
- 3 -
"viral vector and DNA (plasmid)" type. Notably, the
technique developed makes it possible to use the
expression of env without generating an enhancement
problem.
,Thus, a first subject of the invention is a method for
immunizing and vaccinating felines against FIV, using
an administration protocol comprising at least one
primary administration and at least one booster
administration using at least one common immunogen. The
immunogenic preparations and the vaccines used in
primary administration are different in nature from
those used as a booster. This administration protocol
is called "prime-boost". The prime-boost protocol
according to the invention comprises a primary
administration with an immunogenic preparation or a
vaccine comprising, in a pharmaceutically acceptable
vehicle or excipient, a plasmid containing and
expressing, in vivo, a polynucleotide encoding FIV env
and/or gag and/or gag/pro, followed by a booster with
an immunogenic preparation or a recombined vaccine
comprising, in a pharmaceutically acceptable vehicle or
excipient, a viral vector containing and expressing, in
vivo, a polynucleotide encoding Fly env and/or gag
and/or gag/pro, with the condition according to which
at least one of the env or gag or gag/pro proteins is
encoded by both the plasmids and the viral vectors.
The primary administration may comprise one or more
administrations of the same plasmid-based immunogenic
preparations or vaccines. Similarly, the booster
administration may comprise one or more administrations
of the same viral vector-based immunogenic preparations
or vaccines. According to a particular embodiment of
the invention, the protocol comprises two successive
administrations of the same plasmid-based immunogenic
preparation or vaccine, and then one administration of
a viral vector-based immunogenic preparation or
vaccine, as a booster.
CA 02448620 2012-07-31
51440-164
- 4 -
The various administrations are preferably carried out
3 to 6 weeks apart, and more particularly about 4 weeks
apart. According to a preferred mode, an annual booster,
preferably using the viral vector-based immunogenic
preparation or vaccine, is also envisaged. The animals are
preferably at least 6 to 8 weeks old at the time of the
first administration.
The plasmids and viral vectors used in the prime-boost protocol
preferably express both env and gag or env and gag/pro.
In a particular embodiment, the invention relates to a kit
for inducing an immune response directed against feline
immunodeficiency virus (FIV) in a cat, comprising, packaged
separately: a first immunogenic composition comprising,
in a pharmaceutically acceptable vehicle or excipient,
one or several plasmid(s) expressing, in vivo FIV env and
gag/pro; and a second immunogenic composition comprising,
in a pharmaceutically acceptable vehicle or excipient,
one or several attenuated viral vector(s) expressing
in vivo FIV env and gag/pro, wherein the one or several
attenuated viral vector(s) are one or several attenuated
canarypox virsus(es) or one or several attenuated fowlpox
virus(es).
In another particular embodiment, the invention relates to
the use of one or several plasmid(s) expressing, in vivo feline
immunodeficiency virus (FIV) env and gag/pro, for producing a
first immunogenic composition comprising the one or several
plasmid(s) and a pharmaceutically acceptable
CA 02448620 2012-07-31
51440-164
4a
vehicle or excipient, for administration to a cat as a
primary administration, and one or several attenuated viral
vector(s) expressing in vivo FIV env and gag/pro, for
producing a second immunogenic composition comprising the
attenuated viral vector(s) and a pharmaceutically acceptable
vehicle or excipient, for administration 3 to 6 weeks apart to
the same cat as a booster, wherein the first and second
immunogenic compositions are for intramuscular administration,
and the one or several attenuated viral vector(s) are
one or several attenuated canarypox virus(es) or one or several
attenuated fowlpox virus(es).
In another particular embodiment, the invention relates to the
use of one or several attenuated viral vector(s) expressing,
in vivo feline immunodeficiency virus (FIV) env and gag/pro,
for producing a first immunogenic composition comprising the
one or several attenuated viral vector(s) and a
pharmaceutically acceptable vehicle or excipient, for
inducing an immune response directed against FIV in a cat, for
intramuscular administration to a cat as a booster 3 to 6 weeks
apart of a second immunogenic composition comprising
one or several plasmid(s) expressing, in vivo, FIV env and
gag/pro and a pharmaceutically acceptable vehicle or excipient,
wherein the one or several attenuated viral vector(s) are
one or several attenuated canarypox virus(es) or one or several
attenuated fowlpox virus(es).
For the purposes of the invention, the term "protein"
encompasses the fragments, including peptides and polypeptides,
having substantially the same immunological activity as the
CA 02448620 2012-07-31
51440-164
4b
whole protein. The expressions env gene, gag gene,
gag/pro gene, etc., thus include polynucleotide fragments
encoding such protein fragments, peptides and polypeptides.
The polynucleotides, in order to control their expression, are
functionally associated with a promoter and, optionally, with
enhancers, with stabilizing sequences and/or with signal
sequences for secretion of the protein.
Other FIV proteins may be expressed jointly with env and/or gag
and/or gag/pro, in primary administration and/or as a booster.
The tat protein and/or rev protein may in particular be
expressed, preferably tat and optionally rev. They may be
expressed in the same plasmids and/or viral vectors as those
used for env and/or gag and/or gag/pro, or in separate plasmids
and/or viral vectors.
According to a particular mode, several Fly strains are
represented in the preparations or vaccines of the invention,
i.e. the protocol comprises the
CA 02448620 2010-11-30
51440-164
- 5 -
administration of plasmids and of viral vectors
comprising and expressing, in vivo, polynucleotides
encoding env and/or gag and/or gag/pro from two or
three or more FIV strains. Thus, polynucleotides from
several FIV strains may be carried by a single viral
vector or by separate viral vectors. For the plasmids,
preference is given to separate plasmids, but a single
plasmid carrying the polynucleotides from several FIV
Strains is not, however, excluded.
According to yet another mode, and as will be seen in
greater detail later, the protocol may comprise the
concomitant administration of one or more cytokines,
either in protein form or by incorporating a
polynucleotide encoding a cytokine into plasmids and/or
viral vectors, those used to express the FIV proteins
and/or others.
For producing the expression vectors according to the
invention, various FIV strains, the organization of
their genome and the nucleotide sequence of their
genome are available to those skilled in the art.
Useful FIV strains, such as the Petaluma strain are
cited in the part Examples. Supplemental information on
these strains and others, and their nucleotide
sequences, is given at the beginning of the part
Examples.
According to the invention, the primary administration
comprises the use of plasmids which express the FIN/
protein(s) in vivo. The term "plasmid" refers to a DNA
transcription unit comprising a polynucleotide
according to the invention and the elements required
for its expression in vivo. Preference is given to the
circular plasmid form, which may or may not be
supercoiled. The linear form also falls within the
context of this invention.
Each plasmid comprises a promoter capable of ensuring,
CA 02448620 2010-11-30
51440-164
- 6 -
in host cells, the expression of the polynucleotide
inserted under its control. It is, in general, a strong
eukaryotic promoter. The cytomegalovirus immediate
early (CMV-IE) promoter, of human or murine origin, or
optionally of any other origin such as rat or guinea
pig, is the preferred strong eukaryotic promoter. The
CMV-IE promoter may comprise the actual promoter
component, which may or may not be associated with the
enhancer component. Reference may be made to
EP-A-260 148, EP-A-323 597, US-A-5 168 062,
US-A-5 385 839, US-A-4 968 615 and WO-A-87/03905. Human
(Boshart M. et al., Cell., 1985, 41, 521-530) or murine
CMV-IE is preferred.
More generally, the promoter is either of viral origin
or of cellular origin. As a strong viral promoter other
than CMV-IE, mention may be made of the early promoter
or the late promoter of the SV40 virus or the LTR
promoter of the Rous Sarcoma virus. As a strong
cellular promoter, mention may be made of the promoter
of a cytoskeleton gene, such as, for example, the
desmin promoter (Kwissa M. et al., Vaccine, 2000,
18(22), 2337-2344) or the actin promoter (Miyazaki J.
et al., Gene, 1989, 79(2), 269-277).
By equivalence, the subfragments of these promoters,
which conserve suitable promoter activity, are included
in the present invention: e.g. the truncated CMV-IE
promoters according to WO-A-98/00166. The notion of
promoter according to the invention therefore includes
the derivatives and subfragments which conserve
suitable promoter activity, preferably substantially
similar to that of the actual promoter from which they
are derived. For CMV-IE, this notion comprises the
actual promoter component and/or the enhancer component
and the derivatives and subfragments.
The plasmids preferably comprise other elements for
controlling expression. In particular, it is
CA 02448620 2010-11-30
51440-164
- 7 -
advantageous to incorporate stabilizing sequences of
the intron type, preferably intron II of the rabbit 13-
globin gene (van Ooyen et al. Science, 1979, 206: 337-
344).
As a polyadenylation (polyA) signal for the plasmids,
use may in particular be made of that of the bovine
growth hormone (bGH) gene (US-A-5,122,458), that of the
rabbit 0-globin gene or that of the SV40 virus.
According to the invention, the booster administration
comprises the use of viral vectors which express the
FIV protein(s) in vivo. These viral expression vectors
are advantageously avipox viruses (in particular
canarypox, fowlpox) or attenuated mutants of the
vaccinia virus.
For the poxviruses, those skilled in the art may refer
to WO-A-90/12882, and more particularly, for the
vaccinia virus, to US-A-4,769,330; US-A-4,722,848;
US-A-4,603,112; US-A-5,110,587; US-A-5,494,807;
US-A-5,762,938; for fowlpox, to US-A-5,174,993;
US-A-5,505,941; US-5,766,599; and for canarypox, to
US-A-5,756,103.
As attenuated mutant of vaccinia virus, one may mention
the MVA (Ankara strain) (Stickl H. and Hochstein-
Mintzel V., Munch, Med. Wschr., 1971, 113, 1149-1153;
= Sutter G. et al., Proc. Natl.: Acad. Sci. USA., 1992,
89, 10847-10851; commercial strain ATCC.VR-1508; MVA is
obtained after 570 passages of the Ankara vaccinia
strain on chicken embryo fibroblasts), or the NYVAC
(its construction is described in US-A-5,494,807, in
particular in examples 1 to 6; this patent also
describes insertion of heterologous genes within
insertion sites in this recombinant, and the use of
appropriate promoters; see also WO-A-96/40241).
According to one of the preferred embodiments of the
CA 02448620 2010-11-30
51440-164
- 8 -
invention, the poxvirus expression vector is a
canarypox virus, optionally attenuated, e.g. an ALVAC
or a canarypox virus (for example of the Rentschler
strain) which has been attenuated, in particular by
more than 200 passages on chick embryo fibroblast (CEF)
cells. An ALVAC strain canarypox virus was registered,
on 14 November 1996, with the American Type Culture
Collection (ATCC) under the accession number VR-2547. A
canarypox is commercially available at the ATCC under
reference VR-111. Attenuated canarypox viruses are
described in US-A-5,756,103 and WO-A-01/05934.
Other attenuated poxviruses may be used, in particular
attenuated fowlpoxes (e.g. TROVAC). Regarding the
TROVAC poxvirus, those skilled in the art may refer to
patent WO-A-96/40241. A number of fowlpox vaccinal
strains are available, e.g. the vaccine DIFTOSEC CT
sold by Merial and the vaccine NOBILIS sold by
Intervet.
When the expression vector is an attenuated mutant of a
vaccinia virus, the insertion sites for the
polynucleotide(s) to be expressed are, in particular,
the thymidine kinase (TK) gene, the haemagglutinin (HA)
gene and/or the A-type inclusion body (ATI) region.
Insertion of genes in the MVA virus is also described
in several publications, e.g. in M. W. Carroll et al.,
Vaccine 1997, 15(4), 387-394; K.J. Stittelaar et al.,
J. Virol. 2000, 74(9), 4236-4243; G. Sutter et al.,
Vaccine 1994, 12(11), 1032-1040, to which the one
skilled in the art may refer. The complete genome of
MVA is described in G. Antoine, Virology 1998, 244,
365-396, which allows one to find other insertion sites
and other promoters.
When it is a canarypox, the insertion sites are in
particular located in, or consist of, ORFs C3, C5 and
C6. When it is a fowlpox, the insertion sites are in
particular located in, or consist of, ORFs F7 and F8.
CA 02448620 2010-11-30
51440-164
- 9 -
Preferably, when the expression vector is a poxvirus,
the polynucleotide to be expressed is inserted under
the control of a poxvirus-specific promoter, in
particular the vaccinia 7.5 kDa promoter (Cochran et
al., J. Virology, 1985, 54, 30-35), the vaccinia
promoter (Riviere et a/., J. Virology, 1992, 66, 3424-
3434), the vaccinia HA promoter (Shida, Virology, 1986,
150, 451-457), the cowpox ATI promoter (Funahashi et
al., J. Gen. Virol., 1988, 69, 35-47) or the vaccinia
H6 promoter (Taylor J. et al., Vaccine, 1988, 6, 504-
508; Guo P. et al., J. Viral., 1989, 63, 4189-4198;
Perkus M. et al., J. Virol., 1989, 63, 3829-3836).
A subject of the invention is also the use, firstly, of
plasmids containing and expressing, in vivo, the
polynucleotide(s) encoding FIV env and/or gag and/or
gag/pro, for producing a first immunogenic preparation
or a first vaccine comprising the plasmids and a
pharmaceutically acceptable vehicle or excipient,
intended to be administered to felines as a primary
administration and, secondly, of viral vectors
containing and expressing, in vivo, the
polynucleotide(s) encoding FIV env and/or gag and/or
gag/pro, for producing a second immunogenic preparation
or a second vaccine comprising the viral vectors and a
pharmaceutically acceptable vehicle or excipient,
intended to be administered to the same felines as a
booster, with the condition according to which at least
one of the env or gag or gag/pro proteins iS encoded by
both the plasmids and the viral vectors, for
vaccinating felines against FIV.
A subject of the invention is also the use of plasmids
containing and expressing, in vivo, one or more
polynucleotide(s) encoding FIV env and/or gag and/or
gag/pro, for producing a vaccine comprising the
plasmids and a pharmaceutically acceptable vehicle or
excipient, intended, for vaccinating felines against
CA 02448620 2010-11-30
51440-164
- 10 -
FIV, to be administered to felines as a primary
administration, the booster being effected using a
vaccine comprising viral vectors containing and
expressing, in vivo, one or more polynucleotide(s)
encoding FIV env and/or gag and/or gag/pro and a
pharmaceutically acceptable vehicle or excipient, with
the condition according to which at least one of the
env or gag or gag/pro proteins is encoded by both the
plasmids and the viral vectors.
A subject of the invention is also the use of viral
vectors containing and expressing, in vivo, one or more
polynucleotide(s) encoding FIV env and/or gag and/or
gag/pro, for producing a vaccine comprising the viral
vectors and a pharmaceutically acceptable vehicle or
excipient, intended, for vaccinating felines against
FIV, to be administered to felines as a booster for a
vaccine comprising plasmids containing and expressing,
in vivo, one or more polynucleotide(s) encoding FIV env
and/or gag and/or gag/pro and a pharmaceutically
acceptable vehicle or excipient, with the condition
according to which at least one of the env or gag or
gag/pro proteins is encoded by both the plasmids and
the viral vectors.
A subject of the present invention is also a kit for
immunizing or for vaccinating Felidae against FIV, in
particular intended to be used according to the
administration protocol according to the invention,
comprising, packaged separately:
- an immunogenic preparation or a vaccine comprising,
in a pharmaceutically acceptable vehicle or
excipient, a plasmid containing and expressing,
in vivo, a polynucleotide encoding FIV env and/or gag
and/or gag/pro,
- an immunogenic preparation or a recombined vaccine
comprising, in a pharmaceutically acceptable vehicle
or excipient, a viral vector containing and
expressing, in vivo, a polynucleotide encoding FIV
CA 02448620 2010-11-30
51440-164
- 11 -
env and/or gag and/or gag/pro,
with the condition according to which at least one of
the env or gag or gag/pro proteins is encoded by both
the plasmids and the viral vectors.
The plasmids and viral vectors preferably express env
and gag or env and gag/pro.
It goes without saying that all the characteristics
described in the present application, which relate, for
example, to the composition of the plasmids and viral
vectors, the composition of the preparations and
vaccines, the FIV polynucleotide combinations and the
administration protocol, apply, under the same
conditions, to the various subjects of the invention.
The notion of immunogenic composition covers any
composition capable, once administered to the target
species under the conditions of the invention, of
inducing an immune response directed against Fly. The
term "vaccine" is intended to mean a composition
capable of inducing effective protection. The target
species are the Felidae, preferably cats.
The pharmaceutically acceptable vehicles or excipients
are completely known to those skilled in the art. By
way of example, it may be a 0.9% NaC1 saline solution
or a phosphate buffer. The pharmaceutically acceptable
vehicles or excipients also encompass any compound or
combination of compounds which facilitate
administration of the vector, in particular
transfection, and/or which improve conservation.
The immunogenic compositions and the vaccines according
to the invention preferably comprise one or more
adjuvants, in particular selected. from the usual
adjuvants. The following are particularly suitable in
the context of the present invention: (1) polymers of
acrylic or methacrylic acid, polymers of maleic
CA 02448620 2010-11-30
51440-164
- 12 -
anhydride and of an alkenyl derivative, (2)
immunostimulatory sequences (ISS), in particular
oligodeoxyribonucleotide sequences having one or more
non-methylated CpG motifs (Klinman D.M. et al., Proc.
Natl. Acad. Sci. USA, 1996, 93, 2879-2883;
WO-A1-98/16247), (3) an oil-in-water emulsion, in
particular the SPT emulsion described on page 147 of
"Vaccine Design, The Subunit and Adjuvant Approach"
edited by M. Powell, M. Newman, Plenum Press 1995, and
the MF59 emulsion described on page 183 of the same
work, (4) cationic lipids containing a quaternary
ammonium salt, (5) cytokines, or (6) combinations or
mixtures thereof.
The oil-in-water emulsion (3), which is particularly
suitable for the viral vectors, may in particular be
based:
- on light liquid paraffin oil (European Pharmacopoeia
type);
- on isoprenoid oil, such as squalane or squalene;
- on oil resulting from the oligomerization of alkenes,
in particular of isobutene or of decene;
- of esters of acids or alcohols containing a linear
alkyl group;
- more particularly plant oils, ethyl oleate, propylene
glycol di(caprylate/caprate), glyceryl
tri(caprylate/caprate), propylene glycol dioleate;
- esters of branched fatty alcohols or acids, in
particular esters of isostearic acid.
The oil is used in combination with emulsifiers to form
the emulsion. The emulsifiers are preferably nonionic
surfactants, in particular:
- esters, firstly, of sorbitan, of mannide (e.g.
anhydromannitol oleate), of glycerol, of polyglycerol
or of propylene glycol and, secondly, of oleic,
isostearic, ricinoleic or hydroxystearic acid, these
esters optionally being ethoxylated,
- polyoxypropylene-polyoxyethylene block copolymers, in
CA 02448620 2010-11-30
51440-164
- 13 -
particular Pluronice, especially L121.
Among the adjuvant polymers of type (1), preference is
given to polymers of acrylic or methacrylic acid which
are crosslinked, in particular crosslinked with
polyalkenyl ethers of sugars or of polyalcohols. These
compounds are known as carbomers (Pharmeuropa Vol. 8,
No. 2, June 1996). Those skilled in the art may also
refer to US-A-2 909 462, which describes such acrylic
polymers crosslinked with a polyhydroxylated compound
having at least 3 hydroxyl groups, preferably no more
than 8, the hydrogen atoms of at least three hydroxyls
being replaced with unsaturated aliphatic radicals
having at least 2 carbon atoms. The preferred radicals
are those containing from 2 to 4 carbon atoms, e.g.
vinyls, allyls and other ethylenically unsaturated
groups. The unsaturated radicals may, themselves,
contain other substituents, such as methyl. The
products sold under the name Carbopol0 (BF Goodrich,
Ohio, USA) are particularly suitable. They are
especially crosslinked with an allyl sucrose or with
allyl pentaerythritol. Among these, mention may be made
in particular of Carbopol0 974P, 934P and 971P.
The concentration of polymer of carbomer type in the
final vaccinal composition may in particular range from
0.01% to 1.5% W/V, more particularly from 0.05% to 1%
w/v, preferably from 0.1% to 0.4% W/V.
The cationic lipids (4) containing a quaternary
ammonium salt, which are particularly but not
exclusively suitable for the plasmids, are preferably
those which correspond to the following formula:
CA 02448620 2010-11-30
51440-164
- 14 -
CH3
- 0 - CH2 - CH - CH2- N ¨ R2 - X+
OR, CH3
in which RI is a saturated or unsaturated linear
aliphatic radical having 12 to 18 carbon atoms, R2 is
another aliphatic radical, containing 2 or 3 carbon
atoms, and X is a hydroxyl or amine group.
Among these cationic lipids, preference is given to
DMRIE (N-(2-hydroxyethyl)-N,N-dimethy1-2,3-
bis(tetradecyloxy)-1-propanammonium; WO-
A-96/34109),
preferably associated with a neutral lipid, preferably
DOPE (dioleoylphosphatidylethanolamine; Behr J.P.,
1994, Bioconjugate Chemistry, 5, 382-389), to form
DMRIE-DOPE.
The plasmid is preferably mixed with this adjuvant
extemporaneously, and the mixture thus constituted is
preferably given time to form complexes, for example
for a period of time ranging from 10 to 60 minutes, in
particular of the order of 30 minutes, before it is
administered.
When DOPE is present, the DMRIE:DOPE molar ratio
preferably ranges from 95:5 to 5:95, more particularly
1:1.
The plasmid:DMRIE or DMRIE-DOPE adjuvant weight ratio
may in particular range from 50:1 to 1:10, in
particular from 10:1 to 1:5, and preferably from 1:1 to
1:2.
The cytokine(s) (5) optionally present may be
introduced into the composition or vaccine in the form
of protein, or may be coexpressed in the host with the
CA 02448620 2010-11-30
51440-164
- 15 -
FIV protein(s). Preference is given to coexpression of
the cytokine(s), either using the same vector as that
expressing the proteins or using a separate vector.
These cytokines may in particular be selected from
feline cytokines, especially those of cats, such as
feline interleukin 18 (fIL-18) (Taylor S. et al.,
DNA Seq., 2000, 10(6), 387-394), fIL-16 (Leutenegger
C.M. et al., DNA Seq., 1998, 9(1), 59-63), fIL-12
(Fehr D. et al., DNA Seq., 1997, 8(1-2), 77-82;
Imamura T. et al., J. Vet. Med. Sci., 2000 62(10),
1079-1087) and feline GM-CSF (granulocyte macrophage
colony-stimulating factor) (GenBank AF053007).
In accordance with the invention, the vaccination
against FIV may be combined with vaccinations against
other feline pathogenic agents. The other feline
pathogenic agents are in particular feline
rhinotracheitis virus or feline herpes virus (FHV),
feline leukaemia viruses (FeLV type A and type B),
feline parvoviruses (FPV), feline infectious
peritonitis virus (FIPV), feline calicivirus (FCV),
rabiesvirus, Chlamydia.
The preparations and vaccines according to the
invention may in particular be administered
parenterally, e.g. subcutaneously, intradermally and/or
intramuscularly, or orally and/or nasally.
The various preparations and vaccines may be injected
using a needleless liquid jet injector.
The immunogenic compositions and the vaccines according
to the invention comprise an effective amount of
plasmid or viral vector, the determination of these
amounts being within the scope of those skilled in the
art. The applicant recommends:
- in the case of the plasmid-based immunogenic
compositions or vaccines, a dose may comprise from
CA 02448620 2010-11-30
51440-164
- 16 -
approximately 1 p.g to approximately 2 000 in particular
from approximately 50 p.g
to approximately 1 000 rig. The dose volumes may be between 0.1 and 2 ml,
preferably
between 0.2 and I ml;
- in the case of the poxvirus-based immunogenic compositions or vaccines, a
dose may
be between approximately 103 pfu and approximately 109 pfu. When the vector is
the
canarypox virus, the dose is more particularly between approximately 105 pfu
and
approximately 109 pfu, preferably between approximately 106 and approximately
108
pfu. The dose volumes of the viral vector-based feline vaccines and
immunogenic
compositions are generally between 0.1 and 2.0 ml, preferably between 0.2 and
1.0 ml.
The kit may comprise the doses of vaccine to vaccinate either an animal or
several
animals.
The present invention provides a kit for vaccinating Felidae against Fly,
comprising,
packaged separately:
- a first vaccine comprising, in a pharmaceutically acceptable vehicle or
excipient, a plasmid containing and expressing, in vivo, a polynucleotide
encoding FIV
env and/or gag and/or gag/pro,
- a second vaccine comprising, in a pharmaceutically acceptable vehicle or
excipient, a viral vector containing and expressing in vivo, a polynucleotide
FIV env
and/or gag and/or gag/pro,
- wherein at least one of the FIV env or gag or gag/pro proteins is encoded by
both the plasmid and the viral vector,
- and wherein the second vaccine is administered as a booster of the first
vaccine.
The present invention also provides a use, firstly, of a plasmid containing
and
expressing, in vivo, one polynucleotide or polynucleotides encoding FIV env
and/or
gag and/or gag/pro, for producing a first vaccine comprising the plasmid and a
pharmaceutically acceptable vehicle or excipient, for administration to a
feline as a
primary administration, and, secondly, of a viral vector containing and
expressing, in
vivo, one polynucleotide or polynucleotides encoding FIV env and/or gag and/or
gag/pro, for producing a second vaccine comprising the viral vector and a
pharmaceutically acceptable vehicle or excipient, for administration to the
same feline
as a booster, wherein at least one of the env or gag or gag/pro proteins is
encoded by
both the plasmid and the viral vector, for vaccinating feline against Fly.
CA 02448620 2010-11-30
51440-164
- 17 -
In one aspect, the present invention relates to a kit for inducing an
immune response directed against feline immunodeficiency virus (FIV) in a cat,
comprising, packaged separately: a first immunogenic composition comprising,
in
a pharmaceutically acceptable vehicle or excipient, one or several plasmid(s)
expressing, in vivo FIV env and gag/pro; and a second immunogenic composition
comprising, in a pharmaceutically acceptable vehicle or excipient, one or
several
attenuated viral vector(s) expressing in vivo FIV env and gag/pro, wherein the
one
or several attenuated viral vector(s) are one or several attenuated canarypox
virsus(es) or one or several attenuated fowlpox virus(es).
In another aspect, the present invention relates to use, firstly, of one
or several plasmid(s) expressing, in vivo feline immunodeficiency virus (FIV)
env
and gag/pro, for producing a first immunogenic composition comprising the one
or
several plasmid(s) and a pharmaceutically acceptable vehicle or excipient, for
administration to a cat as a primary administration and, secondly, of one or
several attenuated viral vector(s) expressing in vivo FIV env and gag/pro, for
producing a second immunogenic composition comprising the attenuated viral
vector(s) and a pharmaceutically acceptable vehicle or excipient, for
administration 3 to 6 weeks apart to the same cat as a booster, wherein the
first
and second immunogenic compositions are for intramuscular administration, and
the one or several attenuated viral vector(s) are one or several attenuated
canarypox virus(es) or one or several attenuated fowlpox virus(es).
In still another aspect, the present invention relates to use of one or
several plasmid(s) expressing in vivo feline immunodeficiency virus (FIV) env
and
gag/pro, for producing an immunogenic composition comprising the one or
several
plasmid(s) and a pharmaceutically acceptable vehicle or excipient, for
inducing an
immune response directed against FIV in a cat, for intramuscular
administration to
the cat as a primary administration, whereby a booster is effected after 3 to
6
weeks using an immunogenic composition comprising one or several attenuated
viral vector(s) expressing in vivo FIV env and gag/pro and a pharmaceutically
acceptable vehicle or excipient, wherein the one or several attenuated viral
vector(s) are one or several attenuated canarypox virus(es) or one or several
attenuated fowlpox virus(es).
. , 1 CA 02448620 2010-11-30
51440-164
- 18 -
In yet another aspect, the present invention relates to use of one or
several attenuated viral vector(s) expressing, in vivo feline immunodeficiency
virus (FIV) env and gag/pro, for producing an immunogenic composition
comprising the one or several attenuated viral vector(s) and a
pharmaceutically
acceptable vehicle or excipient, for inducing an immune response directed
against
FIV in a cat, for intramuscular administration to a cat as a booster 3 to 6
weeks
apart of an immunogenic composition comprising one or several plasmid(s)
expressing, in vivo, FIV env and gag/pro and a pharmaceutically acceptable
vehicle or excipient, wherein the one or several attenuated viral vector(s)
are one
or several attenuated canarypox virus(es) or one or several attenuated fowlpox
virus(es).
CA 02448620 2010-11-30
51440-164
-19-
The present invention also provides a use of a plasmid containing and
expressing, in
vivo, one polynucleotide or polynucleotides encoding F1V env and/or gag and/or
gag/pro, for producing a vaccine comprising the plasmid and a pharmaceutically
acceptable vehicle or excipient, for vaccinating a feline against F1V, to be
administered
to the feline as a primary administration, whereby a booster is effected using
a vaccine
comprising a viral vector containing and expressing, in vivo, one
polynucleotide or
polynucleotides encoding F1V env and/or gag and/or gag/pro and a
pharmaceutically
acceptable vehicle or excipient, wherein at least one of the env or gag or
gag/pro
proteins is encoded by both the plasmid and the viral vector.
The present invention also provides a use of a viral vector containing and
expressing, in
vivo, a polynucleotide or polynucleotides encoding FIV env and/or gag and/or
gag/pro,
for producing a vaccine comprising the viral vector and a pharmaceutically
acceptable
vehicle or excipient, for vaccinating a feline against FIV, to be administered
to a feline
as a booster of a vaccine comprising a plasmid containing and expressing, in
vivo, a
polynucleotide or polynucleotides encoding FIV env and/or gag and/or gag/pro
and a
pharmaceutically acceptable vehicle or excipient, wherein at least one of the
env or gag
or gag/pro proteins is encoded by both the plasmid and the viral vector.
According to a particular mode, the kit comprises two doses of plasmid-based
vaccine
per dose of viral vector-based vaccine.
The invention will now be described in greater detail using embodiments taken
by way
of non-limiting examples.
Examples:
=
All the constructs are prepared using the standard molecular biology
techniques(cloning, restriction enzyme digestion, synthesis of a single-
stranded
complementary DNA, polymerase chain reaction, oligonucleotide DNA polymerase-
mediated elongation, etc.) described by Sambrook J. et al. (Molecular Cloning:
A
Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory, Cold Spring
Harbor,
New York, 1989). All the restriction fragments used for the present invention,
and also
the various polymerase chain reaction (PCR) fragments, are isolated and
purified using
= the "Genec1ean6" kit (BI0101 Inc. La Jolla, CA).
CA 02448620 2010-11-30
51440-164
- 20 -
The examples use the FIV Villefranche IFFA 1/88 strain
(Steffan A.M. et al., J. Gen. Virol., 1994, 75, 3647-
3653). It goes without saying that the invention may be
applied to the other FIV strains. Mention may be made,
for example, of the Petaluma strain (available from the
American Type Culture Collection (ATCC) under the
number VR-1312, and nucleotide sequence registered in
GenBank under the number M25381; env gene: nucleotides
6266 to 8836; gag gene: nucleotides 628-1980; gag/pro:
nucleotides 628-2336). One may also cite strain NCSU1
available from ATCC under reference VR2333. Reference
may also be made to the articles by Sodora and by
Bachmann (Sodora D.L. et a/., J. Virol., 1994, 68(4),
2230-2238; Bachmann M.H. et al., J. Virol., 1997,
71(6), 4241-4253) which describe a certain number of
FIV strains and indicate the references for access to
the sequences in GenBank. Strain FIV-14 is referenced
in Genbank under NC 001482 (env gene: nucleotides 6266
to 8836; gag gene: nucleotides 628-1980; gag/pro:
nucleotides 628-2336), strain BM3070 is referenced in
Genbank under AF474246 (env gene: nucleotides 6272 to
8833; gag gene: nucleotides 634-1986), strain OMA is
referenced in Genbank under U56928 (env gene:
nucleotides 6506 to 9097; gag gene: nucleotides 679-
2179), etc.
The one skilled in the art is able to determine the PCR
probes useful to clone the genes from the FIV strain
used. The PCR probes used in the following examples to
clone env, gag/pro, rev and tat from Villefranche
strain may be used on other strains such as Petaluma or
be slightly adapted when appropriate.
Example 1: Culturing of the FrV virus
In order for them to be amplified, feline immuno-
deficiency viruses of the Villefranche IFFA 1/88 strain
are cultured on Q201 cells (feline helper
CA 02448620 2010-11-30
51440-164
- 21 -
T lymphocytes; Willet B. et al., J. Gen. Virol., 1997,
78, 611-618).
The Q201 cells are cultured in 25-cm2 Falcon flasks
with MEM Eagle medium supplemented with 2 mM of
glutamine, with 10% of calf serum, with 100 IU/m1 of
penicillin with 100 g/ml of streptomycin and with
100 IU/ml of recombined human interleukin-2, containing
approximately 100 000 cells per ml. The cells are
cultured at +37 C.
After 3 days, the cell layer reaches confluence. The
culture medium is then replaced and the FIV virus is
added at 5 pfu/cell.
When the cytopathic effect (CPE) is complete (generally
48-72 hours after the start of culturing), the viral
suspensions are harvested and then clarified by
centrifugation and frozen at -80 C. 3 to 4 successive
passages are generally required for the production of a
viral batch. The viral batch is stored at -80 C.
Example 2: Extraction of the FIV viral RNA
The viral RNA contained in 100 ml of viral suspension
of the FIV Villefranche strain is extracted, after
thawing, with the solutions of the "High Purem Viral
RNA Kit" (Cat # 1 858 882, Roche
Molecular
Biochemicals), according to the manufacturer's
instructions for the extraction steps. The RNA pellet
obtained at the end of the extraction is resuspended
with 1 to 2 ml of RNase-free sterile distilled water.
Example 3: Construction of the plasmid pP8371
The FIV complementary DNA (cDNA) is synthesized with
the "Gene Amp RNA PCR Kit" (Cat # N 808 0017, Perkin-
Elmer, Norwalk, CT 06859, USA) using the conditions
given by the manufacturer.
*Trade-mark
CA 02448620 2010-11-30
51440-164
- 22 -
A reverse transcription reaction, followed by a
polymerase chain reaction ("RT-PCR" reaction) is
carried out with 50 1 of the FIV viral RNA suspension
(Example 2) and with the following oligonucleotides:
FC116 (36 mer) (SEQ ID No.: 1)
5' 1 1 1 I TTCTGCAGCAATAAGAATGGCAGAAGGATTTG 3'
and FC117 (36 mer) (SEQ ID No. :2)
5 TCGCACCTGAAACATCTCGAGTGTTTCCACATGTAT 3.
This pair of oligonucleotides allows the incorporation
of a PstI restriction site, of an XhoI restriction site
and of an initiating ATG codon in 5' of the insert.
The first cDNA strand is synthesized by elongation of
the oligonucleotide FC117, after hybridization of the
latter to the RNA matrix.
The conditions for synthesis of the first cDNA strand
are a temperature of 42 C for 15 min, then of 99 C for
5 min and, finally, of 4 C for 5 min. The conditions
for the PCR reaction in the presence of the pair of
oligonucleotides FC116 and FC117 are a temperature of
95 C for 2 min, then 40 cycles (95 C for 30 sec, then
50 C for 45 sec, and 72 C for 3 min) and, finally, 72 C
for 7 min, so as to produce a 1476 bp fragment.
This fragment is digested with the PstI restriction
enzyme and then with the XhoI restriction enzyme so as
to isolate, after agarose gel electrophoresis, the
approximately 1450 pb PstI-XhoI fragment. This fragment
is called fragment A.
A second reverse transcription reaction, followed by a
polymerase chain reaction ("RT-PCR" reaction), is
carried out with 50 1 of the FIV viral RNA suspension
. (Example 2) and with the following oligonucleotides:
FC118 (36 mer) (SEQ ID No. :3)
5' ATACATGTGGAAACACTCGAGATGTTTCAGGTGCGA 3'
CA 02448620 2010-11-30
51440-164
- 23 -
and FC119 (54 mer) (SEQ ID No. :4)
5'ittitiGGATCCCtCGGGCTGCAGGAATTCTpAGATACITCATCATTCC
TOCTC3'.
This pair of oligonucleotides allows the incorporation
of an XhoI restriction site, of a BamHI restriction
site aid of a stop codon in 3' of the insert.
The first cDNA strand is synthesized by elongation of
the oligonucleotide FC118, after hybridization of the
latter to the RNA matrix.
The conditions for synthesis of the first cDNA strand
are a temperature of 42 C for 15 min, then of 99 C for
min and, finally, of 4 C for 5 min. The conditions
for the PCR reaction in the presence of the pair of
oligonucleotides FC118 and FC119 are a temperature of
95 C for 2 min, then 40 cycles (95 C for 130 sec, then
50 C for 45 sec, and 72 C for 3 min) and, finally, 72 C
for 7 min, so as to produce a 1193 bp fragment.
This fragment is digested with the XhoI restriction
enzyme and then with the BamHI restriction enzyme so as
to isolate, after agarose gel electrophoresis, the
approximately 1170 bp XhoI-BamHI fragment. This
fragment is called fragment B.
Fragments A and B are ligated with the eukaryotic
expression plasmid pVR1012 =(Figure 1 and Example 7 of
WO-A-98/03199; Hartikka J. et a/., 1997, Human Gene
Therapy, 7, 1205-1217) digested beforehand with XbaI
and EcoRI, to give the plasmid pPB371 (7467 bp). This
plasmid contains, under the control of the human
cytomegalovirus immediate early, or hCMV-IE, promoter,
an insert encoding the FIV env protein.
Example 4: Construction of the plasmid pPB374
The FIV complementary DNA (cDNA) is synthesized with
CA 02448620 2010-11-30
51440-164
- 24 -
the "Gene Amp RNA PCR Kit" (Cat # N 808 0017, Perkin-
Elmer, Norwalk, CT 06859, USA) using the conditions
given by the manufacturer.
A reverse transcription reaction, followed by a
polymerase chain reaction ("RT-PCR" reaction), is
carried out with 50 1 of the FIV viral RNA suspension
(Example 2) and with the following oligonucleotides:
P5670 (37 mer) (SEQ ID No. :5) =
5' MGTCGACAAGGTAGGAGAGATTCTACAGCAACATG 3'
and P5674 (40 mer) (SEQ ID No. :6)
5' TTTGCGGCCGCGTTATTGAGCCATTACTAACCTAATATTG 3'.
This pair of oligonucleotides allows the incorporation
of a Sall restriction site, of a NotI restriction site
and of an initiating ATG codon in 5' at the insert, and
of a stop codon in 3' at the insert.
The first cDNA strand is synthesized by elongation of
the oligonucleotide PB674, after hybridization of the
latter to the RNA matrix.
The conditions for synthesis of the first cDNA strand
are a temperature of 42 C for 15 min, then of 99 C for
min and, finally, 4 C for 5 min. The conditions for
the PCR reaction in the presence of the pair of
oligonucleotides PB670 and PB674 are a temperature of
95 C for 2 min, then 40 cycles (95 C for 30 sec, then
50 C for 45 sec, and 72 C for 3 min) and, finally, 72 C
for 7 min, so as to produce a 1758 bp fragment.
This fragment is digested with the Sall restriction
enzyme and then with the NotI restriction enzyme so as
to isolate, after agarose gel electrophoresis, the
approximately 1750 bp SalI-NotI fragment. This fragment
is ligated with the expression plasmid pVR1012 (Example
3) digested beforehand with Sail and NotI, to give the
plasmid pPB374 (6633 bp). This plasmid contains, under
CA 02448620 2010-11-30
51440-164
- 25 -
the control of the hCMV-IE promoter, an insert encoding
the FIV gag/pro proteins.
Example 5: Construction of the plasmid pPB375
The FIV complementary DNA (cDNA) is synthesized with
the "Gene Amp RNA PCR Kit" (Cat # N 808 0017, Perkin-
Elmer, Norwalk, CT 06859, USA) using the conditions
given by the manufacturer.
A reverse transcription reaction, followed by a
polymerase chain reaction ("RT-PCR" reaction), is
carried out with 50 1 of the FIV viral RNA suspension
(Example 2) and with the following oligonucleotides:
FC116 (36 mer) (SEQ ID No. :1)
and FC120 (48 mer) (SEQ ID No. :7)
5'i i IACCTGCATTTCCTTCTTCCAGII HACCTCTTGAATTICGTTC 3.
This pair of oligonucleotides allows the incorporation
of a PstI restriction site, of a BspMI restriction site
and of an initiating ATG codon in 5' at the insert.
The first cDNA strand is synthesized by elongation of
the oligonucleotide FC120, after hybridization of the
latter to the RNA matrix.
The conditions for synthesis of the first cDNA strand
are a temperature of 42 C for 15 min, then of 99 C for
min and, -finally, of 4 C for 5 min. The conditions
for the PCR reaction in the presence of the pair of
oligonucleotides FC116 and FC120 are a temperature of
95 C for 2 min, then 40 cycles (95 C for 30 sec, then
50 C for 45 sec, and 72 C for 3 min) and, finally, 72 C
for 7 min, so as to produce a 265 bp fragment.
This fragment is digested with the PstI restriction
enzyme and then with the BspMI restriction enzyme so as
to isolate, after agarose gel electrophoresis, the
CA 02448620 2010-11-30
51440-164
- 26 -
a pp ro x ima tely 240 bp PstI-BspMI fragment. This fragment
is called fragment C.
A second reverse transcription reaction, followed by a
polymerase chain reaction ("RT-PCR" reaction), is
carried out with 50 ul of the FIV viral RNA suspension
(Example 2) and with the following oligonucleotides:
PB672 (48 mer) (SEQ ID No. :8)
TTTACTGGAAGAAGGAAATGCAGGTWAGGAAAAGACAAAGAAGAAG
and PB673 (36 mer) (SEQ ID No. :9)
FTITAGATCTITAGICCATAAGCATTCTTTCTATTTC 3.
This pair of oligonucleotides allows the incorporation
of a BspMI restriction site, of a BglII restriction
site and of a stop codon in 3' of the insert.
The first cDNA strand is synthesized by elongation of
the oligonucleotide PB673, after hybridization of the
latter to the RNA matrix.
The conditions for synthesis of the first cDNA strand
are a temperature of 42 C for 15 min, then of 99 C for
min and, finally, of 4 C for 5 min. The conditions
for the PCR reaction in the presence of the pair of
oligonucleotides P8672 and P8673 are a temperature of
95 C for 2 min, then 40 cycles (95 C for 30 sec, then
50 C for 45 sec, and 72 C for 3.min) and, finally, 72 C
for 7 min, so.as to produce a 246 bp fragment.
This fragment is digested with the BspMI restriction
enzyme and then with the BglII restriction enzyme so as
to isolate, after agarose gel electrophoresis, the
approximately 230 bp BspMI-BglII fragment. This
fragment is called fragment D.
Fragments C and D are ligated with the expression
plasmid pVR1012 (Example 3) digested beforehand with
the PstI and BglII restriction enzymes, to give the
CA 02448620 2010-11-30
51440-164
- 27 -
plasmid pPB375 (5316 bp). This plasmid contains, under
the control of the hCMV-IE promoter, an insert encoding
the FIV rev protein.
Example 6: Construction of the plasmid pPB383
The FIV complementary DNA (cDNA) is synthesized with
the "Gene Amp RNA PCR Kit" (Cat 4 N 808 0017, Perkin-
Elmer, Norwalk, CT 06859, USA) using the conditions
given by the manufacturer.
A reverse transcription reaction, followed by a
polymerase chain reaction ("RT-PCR" reaction), is
carried out with 50 1 of the FIV viral RNA suspension
(Example 2) and with the following oligonucleotides:
PB680 (29 mer) (SEQ ID No. :10)
5' i I CMCAGATGGAAGACATAATAGTATT 3',
and PB681 (32 mer) (SEQ ID No. :11)
5' ITTAGATCTCTAAGCAGTAGTTATTGATAATG 3'
This pair of oligonucleotides allows the incorporation
of a BglII restriction site, of a PstI restriction site
and of an initiating ATG codon in 5' of the insert, and
of a stop codon in 3' of the insert.
The first cDNA strand is synthesized by elongation of
the oligonucleotide PB681, after hybridization of the
latter to the RNA matrix.
The conditions for synthesis of the first cDNA strand
are a temperature of 42 C for 15 min, then of 99 C for
5 min and, finally, of 4 C for 5 min. The conditions
for the PCR reaction in the presence of the pair of
oligonucleotides PB680 and PB681 are a temperature of
95 C for 2 min, then 40 cycles .(95 C for 30 sec, then
50 C for 45 sec, and 72 C for I min) and, finally, 72 C
for 7 min, so as to produce a 254 bp fragment.
CA 02448620 2010-11-30
51440-164
- 28 -
This fragment is digested with the PstI restriction
enzyme and then with the BglII restriction enzyme so as
to isolate, after agarose gel electrophoresis, the
approximately 240 bp PstI-BglII fragment. This fragment
(fragment E) is ligated with the expression plasmid
pVR1012 (Example 3) digested beforehand with PstI and
BglII, to give the plasmid pPB383 (5089 bp). This
plasmid contains, under the control of the hCMV-IE
promoter, an insert encoding the FIV tat protein.
Example 7: Construction of the recombined viruses
vCP242, vCP253 and vCP255
Patent WO-A-98/21354 describes, in detail, the
production of the recombined viruses vCP242, vCP253 and
vCP255, respectively in Examples 1, 2 and 4.
The recombined virus vCP242 comprises the nucleotide
sequence encoding the env protein of the FIV
Villefranche strain, under the control of an H6
promoter of the vaccinia virus and inserted into the
ALVAC canarypox virus C6 site.
The recombined virus vCP253 comprises the nucleotide
sequence encoding the gag/pro proteins of the FIV
Villefranche strain, under the control of an I3L
promoter of the vaccinia virus and inserted into the
ALVAC canarypox virus C6 site.
The recombined virus vCP255 comprises the nucleotide
sequence encoding the env protein of the FIV
Villefranche strain, under the control of an 116
promoter of the vaccinia virus, and the nucleotide
sequence encoding the gag/pro proteins of the FIV
Villefranche strain, under the control of an I3L
promoter of the vaccinia virus, both inserted into the
ALVAC canarypox virus C6 site.
Example 8: Construction of the donor plasmid for the
CA 02448620 2010-11-30
51440-164
- 29 -
insertion into the ALVAC canarypox virus C5 site
Figure 16 of patent US-A-5,756,103 shows the sequence
of a 3199 bp fragment of the genomic DNA of the
canarypox virus. Analysis of this sequence revealed an
open reading frame (ORE), which was called C5L, which
begins at position 1538 and ends at position 1859. The
construction of a plasmid with an insertion resulting
in the deletion of ORE' C5L, and the replacement thereof
with a multiple cloning site flanked by transcription
and translation stop signals, was carried out as
described below.
A PCR reaction was carried out on the matrix consisting
of the genomic DNA of the canarypox virus, and with the
following oligonucleotides:
C5A1 (42 mer) (SEQ ID No. :12):
5' ATCATCGAGCTCCAGCTGTAATTCATGGTCGAAAAGAAGTGC 3'
and FC121 (79 mer) (SEQ ID No.:13):
1111 1 HATAGCTAATTAGTC
Aiiiti iGAGAGTACCACTTCAGCTACCTC 3'
so as to isolate a 229 bp PCR fragment (fragment B).
A PCR reaction was carried out on the matrix consisting
of the genomic DNA of the canarypox virus, and with the
following oligonucleotides:
FC122 (78 mer) (SEQ ID No.:14):
5'CCCGGGCTGCAGAGATCTCTCGAGGAATTC I
HATTGATTM+CTAGT
CATTATAAAGATCTAAAATGCATAATTTC 3'
and C5D1 (45 mer) (SEQ ID No.: 15):
5GATGATGGTACCGTAAACAAATATAATGAAAAGTATTCTAAACTA3'
so as to isolate a 488 bp 2CR fragment (fragment C).
Fragments B and C were hybridized together so as to
serve as a matrix for a PCR reaction carried out with
the oligonucleotides C5A1 (SEQ ID No. :12) and C5D1 (SEQ
ID No.. :15), to generate a 693 bp PCR fragment. This
fragment was digested with the Sad I and KpnI
CA 02448620 2010-11-30
51440-164
- 30 -
restriction enzymes so as to isolate, after agarose gel
electrophoresis, a 676 bp SacI-KpnI fragment. This
fragment was ligated with the vector
pBlueScript(9 II SK+ (Stratagene, La Jolla, CA, USA, Cat
# 212205), digested beforehand with the Sad I and KpnI
restriction enzymes, to give the plasmid pFC115. The
sequence of this plasmid was verified by sequencing.
This plasmid contains 166 bp of sequences located
upstream of ORF C5L ("C5 left flanking arm"), a
vaccinia early transcription stop signal, stop codons
in the 6 reading frames, a multiple cloning site
containing the SmaI, PstI, BglII, XhoI and EcoRI
restriction sites and, finally, 425 bp of sequences
located downstream of ORF C5L ("C5 right flanking
arm").
The plasmid pMP528HRH (Perkus M. et al. J. Virol. 1989,
63, 3829-3836) was used as matrix to amplify the
complete sequence of the vaccinia 1-16 promoter (GenBank
accession No. M28351) with the following
oligonucleotides:
JCA291 (34 mer) (SEQ ID No.: 16)
5'AAACCCGGGITCITTATTCTATACTTAAAAAGTG3'
and JCA292 (43 mer) (SEQ ID No.: 17)
5'AAAAGAATTCGTCGACTACGATACAAACTTAACGGATATCGCG3'
so as to amplify a 149 bp PCR fragment. This fragment
was digested with the SmaI and EcoRI restriction
enzymes so as to isolate, after agarose gel
electrophoresis,. a 138 bp SmaI-EcoRI restriction
fragment. This fragment was then ligated with the
plasmid pFC115, digested beforehand with SmaI and
EcoRI, to give the plasmid pFC116.
Example 9: Construction of the donor plasmid for the
insertion into the ALVAC canarypox virus C6 site
Figure. 4 of patent WO-A-01/05934 shows the sequence of =
a 3700 bp fragment of the gehomic DNA of the canarypox
CA 02448620 2010-11-30
51440-164
- 31 -
virus . Analysis of this sequence revealed an open
reading frame (ORF), which was called C6L, which begins
at position 377 and ends at position 2254. The
construction of a plasmid with an insertion resulting
in the deletion of ORE' C6L, and in the replacement
thereof with a multiple cloning site flanked by
transcription and translation stop signals, was carried
out as described below.
A PCR reaction was carried out on the matrix consisting
of the genomic DNA of the canarypox virus, and with the
following oligonucleotides:
C6A1 (42 mer) (SEQ ID No. :18):
5' ATCATCGAGCTCGCGGCCGCCTATCAAAAGTCTTAATGAGTT 3'
and FC123 (79 mer) (SEQ ID No. :19):
5'GAATTCCTCGAGAGATCTCTGCAGCCCGGG ATAGCTAATTAGTC
Aiiiiii CGTAAGTAAGTA I I I I ATTTAA 3'
so as to isolate a 438 bp PCR fragment (fragment D).
A PCR reaction was carried out on the matrix consisting
of the genomic DNA of the canarypox virus, and the
following oligonucleotides:
FC124 (78 mer) (SEQ ID No.:20):
5'CCOGGGCTGCAGAGATCTCTCGAGGAATTC II I I ATTGATTAACTAGT
CAAATGAGTATATATAATTGAAAAAGTAA 3'
and C6D1 (45 mer) (SEQ ID No. :21):
5' GATGATGGTACCTTCATAAATACAAGTITGATTAAACTTAAGTTG 3'
. so as to isolate a 1216 bp PCR fragment (fragment E).
Fragments D and E were hybridized together so as to
serve as a matrix for a PCR reaction carried out with
the oligonucleotides C6A1 (SEQ ID No. :18) and C6D1 (SEQ
ID No.:21), so as to generate a 1642 bp PCR fragment.
This fragment was digested with the Sad I and KpnI
restriction enzymes so as to isolate, after agarose gel
= electrophoresis, the 1625 bp SacI-KpnI fragment. This
fragment was ligated with the vector
pBlueScript0 II SK+ (Stratagene, La Jolla, CA, USA, Cat
# 212205), digested beforehand with the Sad I and KpnI
CA 02448620 2010-11-30
51440-164
- 32 -
re stri ct ion enzymes, to give the plasmid pFC117. The
sequence of this plasmid was verified by sequencing.
This plasmid contains 370 bp of sequences located
upstream of ORE' C61, ("C6 left flanking arm"), a
vaccinia early transcription stop signal, stop codons
in the 6 reading frames, a multiple cloning site
containing the SmaI, PstI, BglII, XhoI and EcoRI
restriction sites and, finally, 1156 bp of sequences
located downstream of ORE' C6L ("C6 right flanking
arm").
The plasmid pMPIVC (Schmitt J.F.C. et al, J. Viral.,
1988, 62, 1889-1897; Salk! R.K. et al., Science, 1988,
239, 487-491) was used as matrix to amplify the
complete sequence of the vaccinia I3L promoter with the
following oligonucleotides:
FC112 (33 mer) (SEQ ID No. :22)
5AAACCCGGGCGGTGGTTTGCGATTCCGAAATCT3'
and FC113 (43 mer) (SEQ ID No. :23):
5'AAAAGAATICGGATCCGATTAAACCTAAATAATTGTACI I IGT3'
so as to amplify a 151 bp PCR fragment. This fragment
was digested with the SmaI and EcoRI restriction
enzymes so as to isolate, after agarose gel
electrophoresis, an approximately 136 bp SmaI-EcoRI
restriction fragment. This fragment was then ligated
with the plasmid pFC117, digested beforehand with SmaI
and EcoRI, to give the plasmid pFC118.
Example 10: Construction of the recombined virus
vCP1719
Fragments C and D (Example 5) were ligated with the
plasmid pFC116 (Example 8), digested beforehand with
the PstI and BglII restriction enzymes, to give the
plasmid pFC119.
=
Fragment E (Example 6) was ligated with the plasmid
pFC118 (Example 9), digested beforehand with the PstI
CA 02448620 2010-11-30
51440-164
- 33 -
and 13g1II restriction enzymes, to give the plasmid
pFC120.
The plasmid pEC120 was linearized with NotI, and then
transfected into primary chick embryo cells infected
with canarypox virus (ALVAC strain) according to the
previously described calcium phosphate precipitation
technique (Panicali and Paoletti Proc. Nat. Acad. Sci.
1982, 79, 4927-4931; Piccini et al. In Methods in
Enzymology, 1987, 153, 545-563. Eds. Wu R. and Grossman
L. Academic Press). Positive plaques were selected on
the basis of hybridization with a radiolabelled probe
specific for the nucleotide sequence of the tat
protein. These plaques underwent 4 successive plaque
selection/purification cycles until a pure population
had been isolated. A plaque representative of in vitro
recombination between the donor plasmid pFC120 and the
genome of the ALVAC canarypox virus was then amplified
and the stock of recombined virus obtained was named
vCP1719.
Optionally, the recombined viruses obtained were used
for a second transfection into primary chick embryo
cells in the presence of the plasmid pFC119 linearized
with NotI, according to the calcium phosphate
precipitation technique. Positive plaques were selected
on the basis of hybridization with a radiolabelled
probe specific for the nucleotide sequence of the rev
protein. These plaques underwent 4 successive plaque
selection/purification cycles until a pure population
had been isolated. A plaque representative of in vitro
recombination between the donor plasmids pFC119 and
pFC120 and the genome of the ALVAC canarypox virus was
then amplified and the stock of recombined virus
obtained was named vCP1720.
Example 11: Construction of the plasmid pJP090
Cat blood was harvested in a tube containing EDTA, via
CA 02448620 2010-11-30
51440-164
- 34 -
a blood sample taken from the 'Jugular vein. The
mononuclear cells were harvested by centrifugation on a
Ficoll gradient, and then cultured in Petri dishes
60 mm in diameter. The cat mononuclear cells in culture
were then stimulated either with concanavalin A (conA)
(final concentration of approximately 5 g/ml) or with
phytohaemagglutinin (PHA) (final concentration of
approximately 10 pg/m1). After, stimulation, the "ConA"
and "PHA" lymphoblasts were harvested by scraping the
culture dishes, and the total RNA from these cells was
extracted using the "mRNA isolation kit for white blood
cells" (Boehringer Mannheim/Roche Cat # 1 934 325).
The total RNA extracted from the cat lymphocytes
stimulated with the ConA or with PHA was used as a
matrix for synthesizing the first complementary DNA
strand. This first complementary DNA strand was
produced by elongation of the oligonucleotide p(dT)15
(Boehringer Mannheim/Roche Cat # 814 270). The single-
stranded complementary DNA obtained was then used as a
matrix for a PCR reaction with the following
oligonucleotides:
FC125 (48 mer) (SEQ ID No. 24):
51i lifiGCGGCCGCCACCATGTGGCTGCAGAACCTGCm iCCTGGGCT
and FC126 (50 mer) (SEQ ID No. 25):
= 5'HIIIIGCGGCCGCTACGTATCACTMTTGACTGGTTTCCAGCAGTCAAA3'
so as to amplify an approximately 473 base pair (bp)
PCR fragment. This fragment was purified by agarose gel
electrophoresis. This fragment was then digested with
NotI and the approximately 453 bp NotI-NotI fragment
thus obtained was ligated with the plasmid pVR1012
(Example 3), digested beforehand with NotI, to give the
plasmid pJP090 (5365 bp). The direction of the insert
in pJP090 was verified. The NotI-NotI fragment cloned
on this plasmid was completely sequenced. This sequence
(SEQ ID No. 26), which encodes a 144 amino acid protein
(SEQ ID No. 27), is the feline GM-CSF cytokine.
*Trade-mark =
CA 02448620 2010-11-30
51440-164
- 35 -
Example 12: Production of DNA vaccines
A solution of DNA containing the plasmid pP13371
(Example 3) is concentrated by ethanol precipitation as
described in Sambrook et al. (1989). The DNA residue is
taken up with a 1.8% NaC1 solution so as to obtain a
concentration of 1 mg/ml. A 0.75 mM DMRIE-DOPE solution
is prepared by taking up a DMRIE-DOPE lyophilisate with
a suitable volume of sterile H20.
The plasmid DNA-lipid complexes are formed by diluting,
in equal amounts, the 0.75 mM solution of DMRIE-DOPE
(1:1) with the 1 mg/ml solution of DNA in 1.8% NaCl.
The DNA solution is introduced gradually, using a 26G
crimped needle, along the wall of the flask containing
the cationic lipid solution so as to avoid the
formation of foam. As soon as the two solutions are
mixed, gentle stirring is carried out. At the end of
this procedure, a composition is obtained which
comprises 0.375 mM of DMRIE-DOPE and 500 pg/ml of
plasmid.
It is desirable for all the solutions used to be at
ambient temperature for all of the operations described
above. The DNA/DMRIE-DOPE complexation is left to
develop at ambient temperature for 30 minutes, before
immunizing the animals.
DNA vaccines may also be produced .with solutions of DNA
containing the plasmids pPB374 (Example 4), pPB375
(Example 5), pPB383 (Example 6), pJP090 (Example 11) or
-mixtures of at least two of these 5 plasmids, according
to the technique described in the present example.
Example 13: In vitro expression tests
Expression of the FIV proteins is tested for each
construct, using the conventional methods of indirect
immunofluorescence and Western blotting.
= CA 02448620 2010-11-30
51440-164
- 36 -
These tests are 'carried out on Petri dishes containing
CHO cells cultured in monolayers and transfected with
plasmids, or containing CEF cells cultured in
monolayers and infected with recombined viruses.
The FIV proteins are detected using labelled antisera
and sera from infected cats.
The size of the fragments obtained after migration on
agarose gel is compared to those expected.
Example 14: Effectiveness on animals
SPF Hillgrove cats (Biological Laboratories Europe
Ltd.) without anti-FIV antibodies, approximately 12
weeks old, are randomly divided into three groups of 6
animals.
The cats of the first group (group A) are vaccinated on
DO and D28 by intraamuscular administration of 1 ml of
a mixture of plasmids pPB371 (Example 3) and pPB374
(Example 4), and then administration of a booster on
D56 by intramuscular injection of 1 ml of recombined
virus vCP255 (Example 7) at a titre of 10" TCID50/m1.
The cats of the second group (group B) are vaccinated
on DO and D28 by intramuscular administration of 1 ml
of a mixture of the plasmids pPB371 and pPB374,
formulated with DMRIE-DOPE (Example 12), and then
administration of a booster on D56 by intramuscular
injection of 1 ml of recombined virus vCP255 (Example
7) at a titre of 10" TCID50/ml.
The concentration of total DNA in the DNA vaccines is
200 pg/ml, i.e. 100 g/ml for each plasmid contained in
the mixture.
The lipid/DNA molar ratio for the DNA vaccines
- CA 02448620 2010-11-30
51440-164
- 37 -
formulated with DMRIE-DOPE is 0.25.
The third group (controls) is the control group (no
vaccination, challenge on D84).
All the cats are challenged on D84 by intraperitoneal
administration of 1 ml of pathogenic FIV virus
(Petaluma strain) at a titre of 25 CID50/m1 (CID being
50% infectious dose in cats).
Firstly, the viraemia assessed by viral re-isolation
and PCR was observed, as was the antibody response.
Viral re-isolation from week 4 after challenge to week
16 (number of animals exhibiting positive viraemia):
Groups Viral re-isolation PCR
Group A 2/6 2/6
Group B 3/6 2/6
Controls 6/6 5/6
The viral re-isolation is carried out by coculturing
approximately 5 x 106 peripheral blood mononuclear
cells (PBMCs) with approximately 106 MYA-1 cells in
RPMI 1640 medium for 21 days. The presence of FIV
proviral DNA present in the PBMC cells is identified by
PCR.
A lack of viraemia is observed in 67% of the animals of
group A and 50% of group B.
Cellular response on the day of the challenge and 4
weeks after challenge (number of animals exhibiting a
positive CTL response):
Antigen Gag Gag Env Env
detected Week 0 Week 4 Week 0 Week 4
Group A 1/6 4/6 0/6 2/6
Group B 2/6 6/6 2/6 0/6
¶ = CA 02448620 2010-11-30
51440-164
- 38 -
Controls 0/5* 12/6 10/5* 0/6
*: It was not possible to take samples from one animal.
Skin fibroblasts are taken, by biopsy, from each of the
cats. The fibroblasts are labelled with 51Cr and then
infected with a vaccinia recombinant expressing either
env or gag, in the presence of PBMCs originating from
each of the cats. The cytotoxic (CTL) response is
measured by 51Cr release.
It is observed that the vaccination stimulates (priming
effect) the cytotoxic response for the groups of
vaccinated animals, particularly for gag.
Humoral response after challenge (number of animals
having a positive anti-TM serological response by
ELISA):
Week 0 2 4 8 12 16
Group A 0/6 3/6 4/6 3/6 3/6 5/6
Group B 0/6 3/6 5/6 5/6 4/6 6/6
Controls ,0/6 ,0/6 0/6 ,3/6 ,5/6 5/6
This is an ELISA to quantify the antibodies using a
peptide corresponding to the major epitope of the
transmembrane (TM) protein.
The vaccination stimulates (priming effect) the humoral
immune response.
= It should be clearly understood that the invention
defined by the attached claims is not limited to the
particular embodiments indicated in the above
description, but encompasses the variants which depart
neither from the context nor from the spirit of the
present invention.
CA 02448620 2004-07-06
1
SEQUENCE LISTING
<110> FISCHER, LAURENT BERNARD
<120> VACCINATION AGAINST FELINE IMMUNODEFICIENCY VIRUS
<130> 30754-47
<140> 10/157,319
<141> 2002-05-29
<150> 60/295,371
<151> 2001-06-01
<160> 25
<170> PatentIn Ver. 3.2
<210> 1
<211> 36
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Synthetic
oligonucleotide
<400> 1
ttttttctgc agcaataaga atggcagaag gatttg 36
<210> 2
<211> 36
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Synthetic
oligonucleotide
<400> 2
tcgcacctga aacatctcga gtgtttccac atgtat 36
<210> 3
<211> 36
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Synthetic
oligonucleotide
<400> 3
atacatgtgg aaacactcga gatgtttcag gtgcga 36
CA 02448620 2004-07-06
2
<210> 4
<211> 54
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Synthetic
oligonucleotide
<400> 4
ttttttggat cccccgggct gcaggaattc tgagatactt catcattcct cctc 54
<210> 5
<211> 37
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Synthetic
oligonucleotide
<400> 5
tttgtcgaca aggtaggaga gattctacag caacatg 37
<210> 6
<211> 40
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Synthetic
oligonucleotide
<400> 6
tttgcggccg cgttattgag ccattactaa cctaatattg 40
<210> 7
<211> 48
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Synthetic
oligonucleotide
<400> 7
tttttacctg catttccttc ttccagtttt acctcttgaa tttcgttc 48
<210> 8
<211> 48
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Synthetic
oligonucleotide
CA 02448620 2004-07-06
3
<400> 8
tttactggaa gaaggaaatg caggtaaaag gaaaagacaa agaagaag 48
<210> 9
<211> 36
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Synthetic
oligonucleotide
<400> 9
tttagatctt tagtccataa gcattctttc tatttc 36
<210> 10
<211> 29
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Synthetic
oligonucleotide
<400> 10
tttctgcaga tggaagacat aatagtatt 29
<210> 11
<211> 32
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Synthetic
oligonucleotide
<400> 11
tttagatctc taagcagtag ttattgataa tg 32
<210> 12
<211> 42
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Synthetic
oligonucleotide
<400> 12
atcatcgagc tccagctgta attcatggtc gaaaagaagt gc 42
<210> 13
<211> 79
<212> DNA
<213> Artificial Sequence
CA 02448620 2004-07-06
4
<220>
<223> Description of Artificial Sequence: Synthetic
oligonucleotide
<400> 13
gaattcctcg agagatctct gcagcccggg tttttatagc taattagtca ttttttgaga 60
gtaccacttc agctacctc 79
<210> 14
<211> 78
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Synthetic
oligonucleotide
<400> 14
cccgggctgc agagatctct cgaggaattc tttttattga ttaactagtc attataaaga 60
tctaaaatgc ataatttc 78
<210> 15
<211> 45
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Synthetic
oligonucleotide
<400> 15
gatgatggta ccgtaaacaa atataatgaa aagtattcta aacta 45
<210> 16
<211> 34
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Synthetic
oligonucleotide
<400> 16
aaacccgggt tctttattct atacttaaaa agtg 34
<210> 17
<211> 43
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Synthetic
oligonucleotide
<400> 17
aaaagaattc gtcgactacg atacaaactt aacggatatc gcg 43
CA 02448620 2004-07-06
5
<210> 18
<211> 42
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Synthetic
oligonucleotide
<400> 18
atcatcgagc tcgcggccgc ctatcaaaag tcttaatgag tt 42
<210> 19
<211> 79
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Synthetic
oligonucleotide
<400> 19
gaattcctcg agagatctct gcagcccggg tttttatagc taattagtca ttttttcgta 60
agtaagtatt tttatttaa 79
<210> 20
<211> 78
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Synthetic
oligonucleotide
<400> 20
cccgggctgc agagatctct cgaggaattc tttttattga ttaactagtc aaatgagtat 60
atataattga aaaagtaa 78
<210> 21
<211> 45
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Synthetic
oligonucleotide
<400> 21
gatgatggta ccttcataaa tacaagtttg attaaactta agttg 45
<210> 22
<211> 33
<212> DNA
<213> Artificial Sequence
CA 02448620 2004-07-06
6
<220>
<223> Description of Artificial Sequence: Synthetic
oligonucleotide
<400> 22
aaacccgggc ggtggtttgc gattccgaaa tct 33
<210> 23
<211> 43
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Synthetic
oligonucleotide
<400> 23
aaaagaattc ggatccgatt aaacctaaat aattgtactt tgt 43
<210> 24
<211> 48
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Synthetic
oligonucleotide
<400> 24
ttttttgcgg ccgccaccat gtggctgcag aacctgcttt tcctgggc 48
<210> 25
<211> 50
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Synthetic
oligonucleotide
<400> 25
ttttttgcgg ccgctacgta tcacttcttg actggtttcc agcagtcaaa 50
