CRH AND POMC EFFECTS ON ANIMAL GROWTH

EFFETS DES GENOTYPES CRH ET POMC SUR LA CROISSANCE ANIMALE

English Abstract

The present invention provides for selection of bovine animals that will
display
phenotypes associated with increased rates of growth. These phenotypes include
hot
carcass weight, average daily lain, shipping weight, end of test rib eye area,
and adjusted
weaning weight which is a measure of post-natal growth, based on the knowledge
of their
CRH, POMC and MC4R genotypes. The predictive value comes from the discovery
that
certain single nucleotide polymorphisms (SNPs) in these genes are linked to
higher
growth rate phenotypes. Specifically, the phenotypes that correlated with
specific SNP's
are end-of-test rib-eye area, adjusted weaning weight, average daily gain,
shipping weight
and hot carcass weight. The invention also provides novel kits that can be
used in
making the determination of these genotypes. The invention further provides
for
methods of screening bovines to predict which animals will have higher growth
rate,
allowing producers to selectively breed and manage animals based on desired
characteristics, thereby maximizing productivity and profitability in
commercial meat
production operations.

Claims

CLAIMS:
We claim:
1. A method for distinguishing bovines having a CRH gene polymorphism,
comprising:
isolating a gnomic DNA sample form a bovine;
amplifying a region of the bovine CRH gene using an oligonucleotide pair to
form nucleic acid amplification products comprising amplified CRH gene
polymorphism sequences;
detecting a polymorphism present in the CRH gene at position 22 of SEQ ID
NO: 1;
analyzing the polymorphism, and
wherein the presence of a "G" residue is associated with the phenotypes of
increased hot carcass weight, increased end-of-test rib-eye area and increased
adjusted weaning weight, as compared to bovines with a "C" residue at
position 22 of SEQ ID NO: 1.
2. The method of Claim 1 wherein the oligonucleotide pair comprises SEQ ID NO:
4 and SEQ ID NO: 5.
3. The method of Claim 2 wherein the polymorphism detected is a restriction
fragment length polymorphism (RFLP).
48

4. The method of Claim 3 wherein the RFLP is the presence or absence of a DdeI
restriction site at nucleotide 137 in a nucleic acid amplification product
produced
by amplification of the CRH gene using the oligonucleotide pair SEQ ID NO: 4
and SEQ ID NO: 5.
5. The method of Claim 1 further comprising the inclusion of a detectable
moiety
such that the amplification product comprises a labeled amplification product.
6. The method of Claim 5 wherein the detectable moiety is selected from the
group
consisting of fluorescent, bioluminescent, chemiluminescent, radioactive and
colorigenic moieties.
7. The method of Claim 1 further comprising:
contacting the nucleic acid amplification products with a hybridization probe;
wherein the hybridization probes comprise at least one oligonucleotide labeled
with a detectable moiety;
under suitable conditions permitting hybridization of the at least one
oligonucleotide to the amplification product to form a hybridization complex;
and
wherein the presence of the detectable moiety in the hybridization complex
indicates the presence of a CRH polymorphism.
49

8. The method of Claim 1 wherein the nucleic acid amplification product is
produced by an amplification method selected from the group of polymerase
chain reaction (PCR), strand displacement amplification (SDA), nucleic acid
sequence based amplification (NASBA), rolling circle amplification, T7
polymerase mediated amplification, T3 polymerase mediated amplification and
SP6 polymerase mediated amplification.
9. A method for distinguishing bovines haying a POMC gene polymorphism;
comprising:
isolating genornic DNA from a bovine;
amplifying a region of the bovine POMC gene using an oligonucleotide pair
to form nucleic acid amplification sequences comprising amplified POMC
gene polymorphism sequences;
detecting a polymorphism present in the POMC gene at position 254 of SEQ
ID NO: 2;
analyzing the polymorphism, and
wherein the presence of a "T" residue is associated with the phenotypes of
increased shipping weight and increased average daily gain as compared to
bovines with a "C" residue at position 254 of SEQ ID NO: 2.
10. The method of Claim 9 wherein the oligonucleotide pair comprises SEQ ID
NO:
6 and SEQ ID NO: 7.
50

11. ~The method of Claim 14 wherein the polymorphism detected is a restriction
fragment length polymorphism (RFLP).
12. ~The method of Claim 11 wherein the RFLP is the presence or absence of a
BtsI
restriction site at nucleotide 157 in a nucleic acid amplification product
produced
by amplification of the POMC gene using the oligonucleotide pair SEQ ID NO: 6
and SEQ ID NO: 7.
13. ~The method of Claim 9 further comprising the inclusion of a detectable
moiety
such that the amplification product comprises a labeled amplification product.
14. ~The method of Claim 14 wherein the detectable moiety is selected from the
group
consisting of fluorescent, bioluminescent, chemiluminescent, radioactive and
colorigenic moieties.
15. ~The method of Claim 9 further comprising:
contacting the nucleic acid amplification product with a hybridization probe;
wherein the hybridization probes comprise at least one oligonucleoticle
labeled
with a detectable moiety;
under suitable conditions permitting hybridization of the at least one
oligonucleotide to the amplification product to form a hybridization complex;
and
51

wherein the presence of the detectable moiety in the hybridization complex
indicates the presence of a POMC polymorphism.
16. The method of Claim 9 wherein the nucleic acid amplification product is
produced by an amplification method selected from the group of polymerase
chain reaction (PCR), strand displacement amplification (SDA), nucleic acid
sequence based amplification (NASBA), rolling circle amplification, T7
polymerase mediated amplification, T3 polymerase mediated amplification and
SP6 polymerase mediated amplification.
17. A method for distinguishing bovines having a MC4R gene polymorphism,
comprising:
isolating genomic DNA from a bovine
amplifying a region of the bovine MC4R gene using an oligonucleotide pair to
form nucleic acid amplification sequences comprising amplified MC4R gene
polymorphism sequences;
detecting a polymorphism present in the MC4R gene at position 1069 of SEQ
ID NO: 3;
analyzing the polymorphism, and~
wherein the presence of a "G" residue is associated with the phenotype of
increased hot carcass weight, as compared to bovines with a "C" residue at
position 1069 of SEQ ID NO: 3.
52

18. The method of Claim 17 wherein the oligonucleotide pair comprises SEQ ID
NO:
8 and SEQ ID NO: 9.
19. The method of Claim 17 wherein the polymorphism detected is a restriction,
fragment length polymorphism (RFLP).
20. The method of Claim 19 wherein the RFLP is the presence or absence of a
Tail.
restriction site at nucleotide 123 in a nucleic acid amplification product
produced
by amplification of the MC4R gene using the oligonucleotide pair SEQ ID NO: 8
and SEQ ID NO: 9.
21. The method of Claim 17 further comprising the inclusion of a detectable
moiety
such that the amplification product comprises a labeled amplification product.
22. The method of Claim 21 wherein the detectable moiety is selected from the
group
consisting of fluorescent, bioluminescent, chemiluminescent, radioactive and
colorigenic moieties.
23. The method of Claim 17 further comprising:
contacting the nucleic: acid amplification product with a hybridization probe;
wherein the hybridization probe comprises at least one oligonucleotide labeled
with a detectable moiety;
53

under suitable conditions permitting hybridization of the at least one:
oligonucleotide to the amplification product to form a hybridization complex;
and
wherein the presence of the detectable moiety in the hybridization complex
indicates the presence: of a MC4R polymorphism.
24. The method of Claim 17 wherein the nucleic acid amplification product is
produced by an amplification method selected from the group of polymerase
chain reaction (PCR) strand displacement amplification (SDA), nucleic acid,
sequence based amplification (NASBA), rolling circle amplification, T7
polymerase mediated amplification, T3 polymerase mediated amplification and~
SP6 polymerase mediated amplification.
25. An isolated and purified nucleic acid comprising a portion of the bovine
CRH
gene, further comprising a polymorphism at position 22 as defined by the
positions in SEQ ID NO: 1, and in which there is a "C"' residue at position
22.
26. An isolated and purified nucleic acid comprising a portion of the bovine
POMC
gene, further comprising a polymorphism at position 254 as defined by the
positions in SEQ ID NO: 2, and in which there is a "T" residue at position
254.
27. A method of selecting individual livestock animals based on the knowledge
of am
animal's CRH genotype, comprising the steps of:~
determining the CRH alleles of an animal;
54

wherein the alleles of an animal will be one of "CC", "CG", or" G"G at
position 22 of SEQ ID NO: 1; and
sorting animals into groups of like genotype; and
wherein a "CG" or "GG" genotype is associated with the desired phenotypes
of increased hot carcass weight, increased end-of-test rib-eye area and
increased adjusted weaning weight.
28. A method of selecting individual livestock animals based on the knowledge
of an
animal's POMC genotype, comprising the steps of:
determining the POMC alleles of an animal;
wherein the alleles of an animal will be one of "CC", "CT", or "TT" at
position 254 of SEQ ID NO: 2; and
wherein a "CT" or "TT" genotype is associated with the desired phenotypes of
increased shipping weight, increased average daily gain and increased hot~
carcass weight.
29. A method of selecting individual livestock animals based on the knowledge
of an
animal's MC4R genotype, comprising the steps of;
determining the MC4R alleles of an animal;
wherein the alleles of an animal will be one of "CC", "CG", or "GG" at
position 1069 of SEQ ID NO: 3; and

wherein a "CG" or "GG" genotype is associated with increased hot carcass
weight.
30. ~The method of Claim 29, wherein the only phenotype of interest is maximum
increased hot carcass weight, and wherein an animal is first tested to
determine
the animal's MC4R genotype;
and wherein, if the animal is homozygous for the "G" allele at the MC4R gene
locus the animal is then tested to determine its CRH genotype, such that an
animal
that is homozygous for the "G" allele at the CRH gene locus will display the
desired phenotype of maximum increased hot carcass weight.
31. ~The method of selecting individual livestock animals based an the
knowledge of
an animal's CRH and POMC genotype, comprising the steps of:~
determining the CRH and POMC alleles of an animal;
wherein the genotype of an animal will be one of "CC", "CG" or "GG" at
position 22 of SEQ ID NO: 1, and "CC", "CT", or "TT" at position 254 of
SEQ ID NO: 2; and
wherein a "GG" genotype at the CRH gene and a "TT" genotype at the POMC
gene (a "GG-TT" phenotype) is associated with the desired phenotypes of
increased adjusted weaning weight, increased hot carcass weight, increased
shipping weight, increased average daily gain and increased end-of-test rib-
eye area, greater than that which would be obtained for animals homozygous
for only one of the CRH and POMC loci.
56

32. ~A diagnostic kit for determining the CRH genotype of a bovine animal, the
kit
comprising:
oligonucleotide primers for amplifying a portion of the CRH gene;
the primers comprising a forward primer comprising at it's 3' end sequence~
identical to at least 10 contiguous nucleotides within SEQ ID: 1;~
a reverse primer comprising at it's 3' end a nucleotide sequence fully
complementary to at least 10 contiguous nucleotides with SEQ ID NO: 1;
and wherein the forward and reverse primers are from 10 to 30 nucleotides in
length and in a PCR amplification reaction will produce a nucleic acid product
amplification product containing a residue corresponding to position 2 of SEQ
ID NO: 1.
33. ~The kit of Claim 32 wherein the primers comprise the oligonucleotides SEQ
ID
NO: 4 and SEQ ID NO: 5.
34. ~The kit of Claim 32 wherein the primers are labeled with a detectable
moiety.
35. ~The kit of Claim 32 further comprising at least one oligonucleotide,
labeled with a
detectable moiety and suitable for use as a hybridization probe.
36. ~A diagnostic kit for determining the POMC genotype of a bovine animal,
the kit
comprising:
57

oligonucleotide primers for amplifying the POMC gene;
the primers comprising a forward primer comprising at it's 3' end sequence
identical to at least 10 contiguous nucleotides within SEQ ID: 2;
a reverse primer comprising at it's 3' end a nucleotide sequence fully
complementary to at least 10 contiguous nucleotides with SEQ ID NO: 2;
at least one additional reagent selected from the group consisting of a lysing
buffer for lysing cells contained in a sample, dNTP's, reaction buffer, an
amplifying enzyme and a combination thereof.
and wherein the forward and reverse primers arc from 10 to 30 nucleotides in
length and in a PCR amplification reaction will produce a nucleic acid product
amplification product containing a residue corresponding to position 254 of
SEQ ID NO: 2.
37. The kit of Claim 36 wherein the primers comprise the oligonucleotides SEQ
ID
NO: 6 and SEQ ID NO: 7.
38. The kit of Claim 36 wherein the primers are labeled with a detectable
moiety.
39. The kit of Claim 36 further comprising an oligonucleotide, labeled with a
detectable moiety and suitable as a hybridization probe.
40. A kit for determining the MC4R genotype of an animal, the kit comprising:
58

oligonucleotide primers for amplifying the MC4R gene;
the primers comprising a forward primer comprising at it's 3' end sequence
identical to at least 10 contiguous nucleotides within SEQ ID: 3;
a reverse primer comprising at it's 3' end a nucleotide sequence fully
complementary to at least 10 contiguous nucleotides with SEQ ID NO: 3;
at least one additional reagent selected from the group consisting of a lysing
buffer for lysing cells contained in a sample, dNTP's, reaction buffer, an
amplifying enzyme and a combination thereof.
and wherein the forward and reverse primers are from 10 to 30 nucleotides in
length and in a PCR amplification reaction will produce a nucleic acid product
amplification product containing a residue corresponding to position 1069 of
SEQ ID NO: 3.
41. The kit of Claim 40 wherein the primers comprise the oligonucleotides SEQ
ID
NO: 8 and SEQ ID NO: 9.
42. The kit of Claim 40 wherein the primers are labeled with a detectable
moiety.
43. The kit of Claim 40 further comprising at least one oligonucleotide,
labeled with a
detectable moiety and suitable or use as a hybridization probe.
59

REFERENCES CITED:
1. Bagley C.P., Morrison D.G., Feazel J.I., Saxton A.M., Growth and sexual
characteristics of suckling beef calves as influenced by age at castration and
growth
implants, J. Anim. Sci. 67 (1989) 1258-1264.
2. Barendse W., Vaiman D., Kemp S.J., Sugimoto Y., Armitage S.M., Williams
J.L., Sun
H.S., Eggen A., Agaba M., Alcyasin S.A., Band M., Bishop M.D., Buitkamp J.,
Byrne
K, Collins F., Cooper L., Coppettiers W., Denys B., Drinkwater R.D., Easterday
K.,
Elduque C., Ennis S., Erhardt G., Ferretti L., Flavin N., Gao Q., Georges M.,
Gurung
R., Harlizius B., Hawkins G., Hetzel J., Hirano T., Hulme D., Jorgensen C.,
Kessler
M., Kirkpatrick B.W., Konfortov B., Kostia S., Kuln C., Lenstra J.A., Leveziel
H.,
Lewin H.A., Leyhe B., Lil L., Martin Burriel I., McGraw R.A., Miller J.R.,
Moody
D.E., Moore S.S., Nakane S., Nijman I.J., Olsaker I., Pomp D., Rando A., Ron
M.,
Shalom A., Teale A.J., Thieven U., Urquhart B.G.D., Vage D-I., Van de Weghe
A.,
Varvio S., Velmala R., Vilkki J., Weikard, R., Woodside C., Womack J.E.,
Zanotti M.,
Zaragoza P., A medium-density genetic linkage map of the bovine genome,
Mammal.
Genome 8 (1997) 21-28.
3. Buchanan F.C., Thue T.D., Winkelman-Sim D.C., Plante Y., Schmutz S.M., Two
QTLs for growth map to bovine chromosome 14, 27th International Conference on
Animal Genetics, July 22-26 2000, Minneapolis, MN.
4. Buchanan F.C., Fitzsimmon C.J., Van Kessel A.G., Thue T.D., Winkelman-Sim
D.C.,
Schmutz S.M., Association of a missense mutation in the bovine leptin gene
with
carcass fat content and leptin mRNA levels, Genet. Sel. Evol. 34 (2002) 105-
116.
5. Buchanan F.C., Thue T.D., Elsaesser E.D., Winkelman-Sim D.C.,A
corticotrophin-
releasing hormone polymorphism associated with post-natal growth in Beef
cattle,
Proceedings of the 7th World Congress on Genetics Applied to Livestock
Production.
2002 Paper. CD-ROM communication n~ 11-32.
60

6. Dunn A.J., Berridge, C.W., Physiological and behavioral responses to
corticotropin-
releasing factor administration: is CRF a mediator of anxiety or stress
responses?
Brain Research Reviews 15 (1990) 71-100.
7. Grobet L., Poncelet D., Royo L.J., Brouwers B., Pirotiin D., Michaux C.,
Menissier F.,
Zanotti M., Dunner S., Georges, M., Molecular definition of an allelic series
of
mutations disrupting the myostatin function and causing double-muscling in
cattle,
Mammal. Genome 9 (1998) 210-213.
8. Houseknecht K.L., Baile C.Z., Matteri R.L., Spurlock M.C., The biology of
leptin: A
review, J. Anim. Sci. 76 (1998) 1405-1420.
9. Kress D.D., Burfening P.J., Miller P.D., Vaniman D., Beef sire expected
progeny
differences calculated by three methods, J. Anim. Sci. 44 (1977) 195-202.
10. Liu H-X., Chew S.L., Cartegni L., Zhang M.Q., Krainer A.R., Exonic
splicing
enhancer motif recognized by human SC35 under splicing conditions, Molecular
and
cellular biology 20 (2000)1063 -1071.
11. Liu H-X., Cartegni L., Zhang M.Q., Krainer A.R., A mechanism for exon
skipping
caused by nonsense or missense mutations in BRCA1 and other genes, Nat.Genet.
27
(2001) 55 - 58.
12. Marsh D.J., Hollopeter G., Huszar D., Laufer R., Yagaloff K.A., Fisher
S.L. Burn P.
Palmiter R.D., Response of mclanocortin-4 receptor-deficient mice to anorectic
and
orexigenic peptides, Nat. Genet. 21 (1999) 119-122.
13. Pritchard L.E., Turnbull A.V., White A., Pro-opiomclanocortin processing
in the
hypothalamus: impact on melanocortin signalling and obesity, J. Endocrinol.
172
(2002) 411-421.
61

14. Roche P.J., Crawford R.J., Fernley R.T., Tregear G.W., Coghlan, J.P.,
Nucleotide
sequence of the gene coding far ovine corticotropin-releasing factor and
regulation of
its mRNA levels by glucocorticoids, Gene 71 (1988) 421-431.
15. SAS (1998) SAS/STAT User's Guide (Release 8.02). SAS Inst. Inc.,Cary, NC.
16. Schmutz S.M., Buchanan F.C., Winkelman-Sim D.C., Pawlyshyn V., Plante Y.,
McKinnon J.J., Fournier, B.P., Development of the Canadian Beef Reference Herd
for
gene mapping studies, Theriogenology 55 (2001) 963-972.
17. Schumann F.J., Janzen E.D., McKinnon, J.J., Prophylactic tilmicosin
medication of
feedlot calves at arrival, Can. Vet. J. 31 (1990) 285-288.
18. Sharpe P.M., Haynes N.B., Buttery P.J., Glucocorticoid status in growth,
in: Buttery
P.J., Haynes N.B., Lindsay D.B. (Eds.), Control and Manipulation of Animal
Growth,
Butterworths, London, 1986 , p 207-222.
19. Shibahara S., Morimoto Y., Furutani Y., Notake M., Takahashi H., Shimizu
S.,
Horikawa S., Numa, S., Isolation and sequence analysis of the human
corticotropin-
releasing factor precursor gene, EMBO J. 2 (1983) 775-779.
20. Szabo G., Dallmann G., Muller G., Patthy L., Soller M., Varga, L., A
deletion in the
myostatin gene causes the compact (Cmpt) hypermuscular mutation in mice,
Mammal. Genome. 9 (1998) 671-672.
21. Thue T.D., Schumtz S.M., Buchanan, F.C., A SNP in the cattle MC4R gene is
used to
map MC4R to BTA 24, Anim. Genet. 32 (2001) 390 - 391.
22. Thue T.D., Buchanan, F.C., Linkage mapping of POMC to bovine chromosome
11,
Anim. Genet. 34 (2003) 149.
62

Description

CA 02460437 2004-04-30
CRH AND PUMC EFFECTS 4N A14TIMAL ~RUWTH:
The present invention relates generally to methods of selective breeding and
management
of livestock animals based on particular allelic polymorp~usms, and
particularly to
predicting the growth characteristics of livestock animals based on these
allelic
polymorphisms.
~a~,C»~:»o~l~x~ o~ ~'x~~rrTrc~N:
Increased growth rates are typically associated with higher economic returns
to beef
producers. Consequently, methods to improve growth rate in cattle are of
significant benefit
to producers. Prior art methods of increasing growth k~as included such
approaches as the use
of hormone implants {l3agley et al., 19$9}, sub-therapeutic levels of
antibiotics (~chumann et
al., 1990) and by selective breeding based on expected progeny differences
{EPD} (Kress ~et
al., 1977). However, hormone implants and the use of antibiotiics arc becoming
unpopular
and may be banned in North America in the near fixture. Therefore, alternative
methods of
improving growth rates ofcattle that don't require artificial forms
ofstimuiation will become
increasingly important and desirable in the industry.
2o
Corticotropin releasing hormoxxe (CRH} indirectly causes the re~lea5e of
glucøcørticoids (Duz~n
and Bertadge, 1990}, naturally occurring hormones that arC. suggested to be
growth inhibitors
(Sharpe et al., 1.986). Although commonly referred to as a "stress-related
hormone", CItH is
released from the hypothalamus, an area of the brain known to be involved in
appetite control.
T'he release ofCI~H regulates appetite via two distinct mechanisms; (1)
indirectly triggering
the xelease o~pro-opiomalanucortin {POMC), and (2) by increavsing the
production of leptin
{Fig. 1 )
Tlzc up-regulation of P~MC levels leads to increased synthesis of alpha
melanocyte
3~ stimtdating hormone (aMSH) which, when bound to the melanocartin-4
receptor, reduces
appetite {Marsh et al., 1999). The increase of leptin, which is induced by
glucocorticoids,
2

CA 02460437 2004-04-30
reduces appetite by four other interactions (Fig. 1). Primarily l:eptin acts
to decrease the levels
ofneuropeptide ~', an appetite stimulant. Leptin also eats to increase POMC
levels, an
agoz~ist for the melanocortin 4-receptor (lVtC4Tt); decrease the levels of
antagonist agouti
related protein (AGRP); and increase the production of CRH (lElouseknecht et
al., 199$;
Marsh et al., 1999; Pritclzard et al., 2002).
The CIZEi gene conapxises two exons, laowevez~ only exan 2 is translated and
codes for ti~.e pre-
pro-protein (l~.oclze et al., 19$$; Shibihara et al., 19$$). The C~RH gene has
been mapped to
chromosome 14 ()$arezzdse et al., 199T), anal th.e results of quantitative
trait linkage (t7TL)
14 zzzappin,g suggested an association between a Locus fax post-natal growth
identified on
chromosome 14 and the CRH gene (Buchanan et al., 2000). In. addition, vc~e
previously
reported a non-conserved amino acid substitution at position T7 (CRH7~ in the
pro-peptide
reg'zon of CRH and showed an association with post-natal grourth in beef
cattle (Buchanan et
al., 2002b).
The PON.1C pro-lzoznxaazie peptide is an integral component ofth a appetite
regulation pathway
(Fig. 1) azzd.f~as also been identified by QTL analysis in our unpublished
studies as a
positional candidate gene for average daily gain and carcass wright. We
idcrztified a single
nucleotide polymorphism (SNP) in the P(7MC gene that is translationally silent
and used the
zo SNP to map the POltIC gene to chromosome 11 in beef cattle (Thus et al.,
2003), oonfimling
its position to previously identi#ied c~TL Foci. We also idezztified SNPs in
two other genes
integral to this pathway, leptin and Mt.'41t (Buchanan et al., 2002a; Thue et
al., 2001).
We have recently identified a novel SNk' iz~ the Cue' gene, at pasition ~ of
the signal
zs sequence, equivalent to position 22 of the sequence defined in SJE~ ~ N(7:
1. 'together
with the existing gene tests for 1'OM~'. N1C'41t and .i;.~'P' (l3uc)x<zzaazx
et al., 2002a;
Buehanarz ct al., 2002b;Thue et al., 2UU1; Thue et al., 20173) we. genotyped a
group of 256
steers. Our results show that knowledge of;~enotxpes of cattle, with respect
to these
particular genes, can be used to better predict growth and yield during beef
production.
3

CA 02460437 2004-04-30
SUMMARY OF THE INVENTION:
It is well known to those skilled in the art that single nucleotide
polymorphisms (SI~Ps~
can provide a useful way in which to distinguish different alleles of a gene.
Furthermore,
when the presence of a SNP can bc; associated with a spc;cific phenotype, the
SNP
operates as a powerful marker and can be used to predict phe~.notypfo outcomes
based on
at7 an1711a1'S genotypic makeup. The present invention relate, to methods of
managing
livestock animals, such as cattle and pigs, and taking advani;agc of genetic
factors that
affect an anilna,l's appetite. »y identifying animals with a particular
genotype, with
respect to herein described SNP alleles, it is possible; to identify animals
that will display
phenotypes associated with increased growth rate, as compared to animals
lacking the
de;sircd genotype.
In particular, the present invention relates to methods for establishing the
genetically
15 deteroxAizled predispvSitions of individual livestock animals, su~;h as
cattle and pigs, within
a group of such animals, to meet particular desired characteristics with
respect to growth,
based on the association of specific CRH, POMC or MC4F~', alleles with an
increased
appetite and hence growth phenotype.
2o The present invention pz~avides a method for analyzizlg the genotype Qf
animals with
respect to the Cl2Xf, ~C~MC and MC4R genes, anal using the genotype
infornlatian to
select animals with desired traits related to animal grorwth. Such knorwledge
further
permits producers to charge a premium for the more desirable faster-growing
phenotype,
and permits breeders to selecti~rely breed animals for genot~rpes that will
result in the
25 most desirable phenotypes.
It is therefore an abject of the present invention to provide a method far
selecting for
animals homozygous for the "G" allele at the CRH gene locus, in the knowledge
tklat
animals that are "GG" hornozygotes will display the desired phenotypes of
increased hot
3o carcass weight, increased end of test rib eye area, and increased adjusted
weaning weigklt.
4

CA 02460437 2004-04-30
It is a further object of the present invention to provide a, method for
selecting for animals
homozygous for the "T" allele at the POMC gene locus, in the knowledge that
animals
that arc "TT" hamozygotes will display the desired phenotype , of increased
average daily
gain, shipping weight and hat carcass weight.
It is still another ob3ect of the present invention to provide a method for
selecting for
animals having at least one "C" allele at the MC4R gene locus, in the
knowledge that
animals that arc "CG" or "CC" at the MC4~ gene lacus~ will display the desired
phenotype ofincrcasc hot carcass wezgl~t.
~o
It is a further object of the present invention td select for ari.imals
homoLygous for the
"G" allele at Clt~' said the '"T" allele at POMC loci, in the knowledge that
those animals
that are "GC-TT" hom~ozygotes will display concurrent increases in rib-eye
area,
shipping weight, hot carcass weight and average daily gain.
It is a fiuthcr object of the present invention that where the desired
phenotype is only
incroased hot carcass weight, that a more efficient method of testing animals
is provided,
wherein an animal as first tested to determine it's MC4R genotype in the
knowledge that
an animal with at least on "C" allele at MC4R will display the desired
phenotype of
2o increased carcass weight, regardless of the animal's CRH genotype, such
that only those
az~izz~.al.s thst are "GG" at MC4R will need to be tested with resheet to
their Cltirf genotype
in order to determine whether they will display the desired phenotype of
increased hot
carcass weights.
It is a further object of the present invention to gxovide a diagnostic kit to
be used in the
detemtination of an animal's C1ZH, POMC and MC4R genotype.
These and other objects, features, and advantages of the invention become
further
apparent in the following detailed description of the invention when taken in
conjunction
3o with the accompaz~yix~g drawings which illustrate, by way of example, the
principics of
this invention.
5

CA 02460437 2004-04-30
Thus, the inventian provides a genetic testing rnethad for the deterr»inatian
of an
axximal's C'.?2,~', .F~'O,MCC axxd .MC"4R genotype ba.,ged on analysis s~f
tire presence or absezzce
of S~eci~c SN)''s, and tote use of the knowledge of an animal's genotype such.
that
S animals of like genotype can be ideaztifZed azzd selected according to ~ze
desired
pb~enotypes of increased shippixag wei.gtxt, .hat oarcass weight, average
daily gaixz aa~.d xib~
eye area.
C

CA 02460437 2004-04-30
L1ESCRIPTIUN (?F THE FIGUh'ES:
While the invention is claimed in the concluding porCions hereof, preferred
embodiments
are provided in the accompanying detailed description which. may be best
understood iz~
canjunctian with the accompanying diagrama where like parts in each of tlae
several
diagrams are labeled with lilce numbers, and whers:
Fig. T : Appetite pathway. Arr-aws show the effect of leptins and CRH on
neuropeptides
t o that control appetite. Ovals represent neurons in the hypothalamus. CRH -
carticotrophin.-
releasing hormone, AGRP -~ agouti related protein, POIvIC - pro-
opiarnelanocortin, NPY -
neuropcptidc Y, aMSH - alpha melanoeyte stimulating hormone and MG4R -
melanocortin 4 zeceptar.
I S Fig. 2: Sequerlee of the CRH SNP with respect to the nucleotide and
protein coding
sequences. The SNP of the invention occurs at position 22 of the nucleotide
sequence as
dcfuicd by SEQ ID NO: l, which corresponds to codon 4 of the protein coding
sequence.
20 ~'ig. 3: xhe effect of C,W' genotype an CR~I secretion.
>dETAILE~ DESCRiI'TIQN QF' TH>T iN~IV'fTfJl'~:
xlC~rlAtiOns:
Tn the description that follows, a number of terms used in reGarnbinant 1~NA,
technolo~r
are ex;ensively utilized. In order to provide a clear and consistent
understanding of the
3o specification and claims, including the scope to ~e given such terms, the
following
dchnitians arc provided:
7

CA 02460437 2004-04-30
$y "amplifying a segment" as used herein, is meant the prAductian of
sufficient multiple
copies of the segment to pexmit relatively facile manipulation ~of the
segment.
Manipulation refers to both physical and chemical manipulation, that f s, the
ability to
rnave bulk quantities of the segment around and to conduct chemical reactions
rovith the
segment that result in detectable products.
A "segment" of a polynuclcatidc refers to an oligonuclcotidc that is a partial
se~qucncc of
entire nucleotide sequence of the polynucleotide.
fo
A "modified segment" refers to a se~rcnt in which one or more natural
nucleotides have
been replaced with one ar more modified nucleotides. A. "modified., labeled
segment"
refers to a modified segment that also contains a nucleotide, wJfucb is
dafFerex~t fro~oo. the
modified z~ucleatide or nucleotides therein, and which is detectabiy iabeled.
,fin "amplification primer" is an oligonucleotide that is capable of annealing
adjacent to a
target sequence arid serving as an initiation paint far DNA synthesis when
placed under
conditions in which synthesis of a primer extension product wluch is
complementary to a
nucleic acid strand is initiated.
By "analysis" is meant either detection of variations in the nucleotide
sequence among
tyro or morn related polynucleotides or, in the alternative, determining the
full nu.cleotidc
sequence of a polynuclcotidc. By "analyzing" the hybridized fragments for an
incorporated detectable label identifying the suspected polymorphism is meant
that, at
some stage of the sequence ofevcnts that Leads to hybridized fragments, a
label is
incorporated. The label maybe incorporated at virtually any stage of the
sequanca of
events including tlae amplification, cleavage or hybridization pnocedares. The
label may
further be introduced into the sequence of events after cleavage and before or
after
hybridization. The label so incorporated is then observed visually or by
instrumental
8

CA 02460437 2004-04-30
means. The presence of the label iderttifZes the polymorphisnZ due to the fact
that tlae
fragments obtained during cleavage are specific to the modified nucleotides)
used in the
amplification and at least one of the modified nucleotide is selected so as to
replace a
nucleotide involved in the polymorphism.
~'he term ''animal" is ufiod herein to include all vertebrate animals,
including humans. It
also ~ncludeS axi individual animal in all stages of develaprnent, including
embryonic and
fetal stages. As u;;od herein, the term "production animals" is used
interchangeably with
"livestock animals" and refers generally to animats raised primarily for food.
For
a 0 example, such animals include, but are not limited to, cattle ('bovine),
sheep (ovine), pigs
(porcine or swine), poultry (avian), and the like As used herein, the term
"cow" or
"cattle" is used generally to refer to an animal of bovine origi..n of any
age.
Interchangeable terms include "bovizxe", "calf", "steer", "bull", "heifer" and
the like. As
used herein, the terxxx "'pig" or iS used generally to refer to an animal of
porcine origin of
any age. Interchangeable terms include 'piglet", "sow" and the like.
~'he term "antisense" is intended to refer to polynucleotide molecules
complementary to a
pc~rtian of an RNA marker of a gene, as defined herein. "Complementary"
polynucleatides are those that are capable ofbase pairing according to the
standard
2o Watson-Crielc complementarity rules, whexe purines base paiu~ with
pyritmidines to form
combinations of guanine paired with cytosine (C~:~) and adenine paired with
eitkaer
thyn2inc (A:T) in the case of DNA, yr adenine paired with uracil (A:TTj in the
case of
RNA. Inclusion of less comnuon bases tine iraosixie, S-naethylcytosiuoe, G-
z~ntethyladez~e,
hypoxanthine and others in hybridizing sequences does not interFere with
pairing.
2s
$y the form "complementarily" or "complementary" is meant, for the purposes of
the
specifZCatioz~ or claims, a sufFcient number in the oligonucleoti.de of
complementary base
pairs in its sequence to interact specifically (hybridize) with the target
nucleic acid
sequence of the gene polymorphism to be amplified. or detected. As known to
those
9

CA 02460437 2004-04-30
skilled in the art, a very high degree of complementarii:y is needed for
speci~eity and
sensitivity involving hybridi~..ation, although it need not be 1 D~J%. Thus,
far example, an
oligonucleotide that is identical in nucleotide sequence to an oligonucleotide
disclosed
herein, except for one brio change or substitution, may function equivalently
to the
disclosed oligonuclcotidcs. A "complementary DNA," or "cDNA" gene includes
recombinant genes synthesized by reverse transcription of me.~sezxger J~1~TA
("zn,l~NA"}.
By the term "wmposition" is meant, for the purposes of the specifcation or
claims, a
combination of elements which may include one or more of the following; the
reaction
t o buffer far the respective method of enzymatic amplification, plus oae ox
rx~ore
oligonucleatides specific for CRH, !'dMC' or MC'9,tf gene polymoxphiszxas,
whereixx said
oligonucleotide is labeled with a detectable moiety.
A "cyclic polymexase-mediated reaction" refers to a bioehcnaical reaction in
~uvhich a
t 5 tez~rzplate z;nolecule or a population of template molecules is
periodically and repeatedly
copied to create a complementary template molecule or complementary template
. molecules, thereby increasing the number of the template molecules over
time. The
products of such a reaction are eomxx~on~.ly refezxed to as amplification
product..s.
20 "I7cnaturation" of a template molecule refers to the unfolding or other
alteratirn~ of the
structure of a template so as to znalce the template accessible far
duplication or
hybridization. In the case of DbTA, "denaturatian" refers to the separation of
the two
complementary strands of the double helix, thereby creating twm complementary,
single
stranded template molecules. "l7enaturatiøn" can be accomplish~l in any of a
variety of
2s ways wch known to those skilled in the ark, iz~GludiRlg heat or by
treatment of the ):?NA
with a bast or other chemical denaturant.
A "detectable amount ofpraduet" refers to an amount of amplified nucleic acid
that can
be detected using standard laboratozy tools. A "detectable marker" refers to a
nucleotide
1Q
,.~. m ........ _ .. ~. .~.,,, . .~.m..~- _._.... . a;..~".~.~,g ~~,_.r..
...~~._. _..._....~....~,""..a...,~x.~,m..,.___ .._ .. ._w..~ ~.........

CA 02460437 2004-04-30
analog that allows detection using visual or other means. For example,
fluorescently
labeled nucleotides can be incorporated into a nucleic acid dux*ang one or
more steps of a
cyclic polymcrase-mediated reaction, thereby allowing the detection of the
product of the
reaction using, ~.g. fluorescence microscopy or other fluorescf:nce-detection
instrumentation.
By the term "detectable moiety" is meant, far the purposes of the
specification or claims,
a Iabet molec~de (isotopic or non-isotopic) which is incorporated indirectly
or directly
into an otigonucleotide, wherein the label mdlecuIe facilitates the detection.
of the
i 0 alignnncleotide in which it is incorporated when the oligonueleotide is
hybridized to
amplified gone polymorphism sequences. Thus, "detectable moietyr' is used
synonymously with "label molecule". Synthesis of oligonucleotides can be
accomplished
by any one of several methods known to those skilled in tk~e art. lrabel
molecules, lalown
to those skilled in. the az~t as beiaag useful for detection, inolude
chemiluminescent ar
fluorescent molecules. Various fluorescent molecules are known in the art that
are
suitable for use to Iabel a nucleic acid substrate for the method of the
present invention.
The protocol for such incorporation may vary depending upon the fluorescent
molecule
ustxl. Such protocols are lzoown in the art for the respective fluorescent
indlecule.
zo By "dctcctably labeled." is meant that a fragment or an oligonucleotide
contains a
nucleotide that is radioactive, that is substituted with a fluorophore or some
other
molecular species Friat elicits a physical yr cl~eznical response can be
observed by the
naked eye or by means of instrumentation such as, without limitation,
sci~xtallation
counters, colorimeters, LTV spectrophotozr~eters aa~d the like. As used
herein, a "label" or
2s "tag" refers to a molecule that, when appended by, for example, without
limitation,
covalent bonding or hybridization, to another molecule, for example, also
without
limitation, a ~polynuclcotide or polynucleotide fragment, provides ar enhances
a means of
detecting the other molecule. A fluorescence or fluorescent label or tag emits
detectable
light at a particular wavelength when excited at a different wavelength. t1
radiolabel or
30 radioactive tag emits radioactive particles detectable with an instrument
such as, rxrithout
11

CA 02460437 2004-04-30
limitation, a scintillation counter. Other signal generation detection methods
include:
chemalurrxinescence, electracherniluminesccnce, ramanspectroscopy,
colorimetric,
hybridization protection assay, and Mass spectrometry.
S "DNA amplification" as used herein refers to any process that increases the
number of
copies of a specific DNA sequence by enzymatically amplifyin,~ the nucleic
acid
setluence. A variety of processes are known. l7ne of the mast commonly used is
the
polymerasc chain reaction {PCR) process of Mullis as described in U.S. Pat.
Nos.
A~,683,195 arid 4,683,202. PCR involves the use of a therxnostable DNA
polymerase,
io known sequences as prizx~,ers, and heating cycles, which separate the
replicating
deoxyribonucleic acid (1:7NA), strand..s and exponentially amplify a gene of
interest. Any
type of ~'CR, such as quantiiatir~e PCR, RT-PCR, hot start PCR, LA-PCR,
multiplex
PCR, taucla.dawn PCR, etc., may be used. Pn;fcrably, real-time FCR is used. Zn
general,
th.e PCR amplification process involves an enzymatic chaizz reacction for
preparing
15 exponential duantitics of a specific nucleic acid sequence. It requires a
small amount of a
secluenec to initiate the chain reaction and aligonucleotide prianers that
will hybridize to
the sequence. In PCR the primers are annealed to denatured nucleic acid
followed by
extension with an. inducing agent {enzyme) and nucleotides. This results in
nevviy ~ ~ r
synthesized extension products. Since these newly synthesized products become
ZO templates for the primers, repeated cycles of denaturing, primer annealing,
az~d extension
results in exponential accumulation of the specific sequence being axnpli~ed.
Tl~o
extension product of the chain reaction will be a discrete nucleic acid duplex
with a
termini corresponding to the ends of the speeif'nc primers employed,
25 "DNA" refers to the polymeric form of dcoxyribonucleotides (adenine,
guanine, thymine,
or cytosine) in it's either single stranded form, or a double-stranded helix.
This term
refers only to the primary and secondary structure of the molecule, and does
not limit it to
any particular tertiary foz~n5. Thus, this term includes double-stranded DNA
found in
linear and circular DNA molecules including, but not limited ta, restriction
Fragments,
34 viruses,, plasrnids, cosmids, and artificial and naturally occurring
chromosomes. In
12

CA 02460437 2004-04-30
discussing the structure ofparticular double-stranded DNA rnr~Iecules,
sequences may be
described herein accoxding to the normal convention ofgiving only the sequence
in the 5'
to 3' direction along the non-transcribed strand of Z7NA (i.e., the stxaud
having a
sequence homologous to the mRNA).
13y the tenns "enzymatieally amplify" or "amplify" is meant, j~or the purposes
of the
specification or claims, DNA amplification by any process by which nucleic
acid
sequences are anz~lified in number. There are several means i:or enzymatically
amplifying nucleic acid sequences known in the art. Currently the most
commonly used
~o method is the polymcrase chain ruction (PCR). Other azx~plifzcation methods
include
LCR (Iigase chain reaction) which utilizes DNA ligase, and a pxobe consisting
oftwo
halves of a DNA segment that is complementary to the sequence c~f the DNA to
be
amplified, enzyme ~J3 repiicase and a ribonucleic acid (RNA) sequence template
attached
to a probe complementary to the DNA to be copied rvhieh is used to make a DNA
15 template .for exponential production of complementary RNA; strand
displacement
amplification (SDA); Q13 replicase amplification (Q13RA); self~sustain~d
replication
(3SR); and NASBA (nucleic acid sequence-based amplification), which caz~ be
performed ran RNA or DNA, a th.e nucleic acid sequence to be amplified. The
particular"
methodology used to amplify hNA sequences is not intended to be limiting, and
all such
24 it is intended that the scope of the invention rWill include all mc;thods
of DNA
amplification lcz~own in the art.
The "extension of the primers" refers to the addition of nucleotides to a
primer molecule
so as to synthesize a nucleic acid complementary Co a template; molecule.
"Extension of
2s the primers" does not necessarily imply that the primer molecule is
extended to
synthesize a complete complementary template molecule. Rather, even ifr~nly a
fraction
of the template molecule has been copied, the primer i.s still considered
extended.
A "fragment" of a molecule such as a protein pr nucleic acid i~ meant to refer
to any
so portion of the amino acid yr nucleotide genetic sequence.
13

CA 02460437 2004-04-30
By "heterozygous" or "heterozygous polyioorphism" is meant that the two
alleles of a
diploid cell or organism at a given focus are different, that is, that they
have a different
nucleotide exchanged for the same nucleotide at the same place in their
sequences.
s
By "homozygous" is meant that the two alleles of a diploid cell or organism at
a given
loons are identical, that is, that they have the same nucleotide for
nucleotide exchange at
the same place in their sequences.
t o By "hybridization" or "hybridizing," as used herein, is meant the
forrnation oiF A-~' az~d
C~G base pairs between the nucleotide sequence of a fragment of a segment of a
polynucleotide and a con:zplexnentary nucleotide sequence of an
oligonucledtide. By
complementary is meant that at the loom of each A, C, (s or T (or U in the
casa of an
RNA molecule) in the fragment sequE;nce, the oligonucleotide sequenced has a
T, G, C or
t5 A, re~,pectively. The hybridized fragmcntloligonucleotide is celled a
"duplex." In the
case of a DNA~RNA hybrid, the molecular is called a '°k~eteroduplex: '
.. . . . , . .. . .., . . . . . . , s
A "hybridization complex", means a connplex of nucleic acid naolecaies
including at lea~~;t
the target nucleic acid and sensor probe. ,lt may also include an anchpr
probe.
By "immobilized on a solid suppork" is meant that a fragment, primer or
oligonucleotide
is attached to a substance at a particular location in such a manner that the
system
containing the immobilized fiagment, primer or oligonucleatide may be
subjected to
washing or other physical or chemical xnanipul.ativz~ without being dislodged
from that
location. A number of solid supports and means of immobilizing
nucleotide,containing
molec«les to them arc known in the art; any afthese suppoz is and means may be
used in
the methods t~f this invention.
14

CA 02460437 2004-04-30
As used herein, the term "nucleic acid molecule" is intended to include DNA
molecules
(e.g:, c171~tA or genoznic 17NA), ItNA zxxolecule;~ (e.g_, mRNA), analogs of
the DNA or
RNA generated using nucleotide analogs, and derivatives, fragments and
hornolu~
thereof. 'The nucleic acid molecule can be single-strazzded or double-
stranded, but
preferably is double-stranded DNA. An "isolated" nucleic acid zx~.olecule is
one that is
separated from other nucleic acid molecules that are presexzt iz~ the z~atweal
source of the
nucleic acid. A "nucleoside" refers to a base linked to a sugar.. The base may
be adenine
(A), guanine (G) (or its substitute, inosine (1)), cytosine (C), or thyxxaixae
('x) (or i.ts
substitute, uracil (U)). The sugar may be ribose (the sugar of a z~atuzal
nucleotide in
1 o RNA) or 2-deoxyribose (the sugar of a natural nucleotide in DNA). A
"nucleotide"
refers to a nucleoside linked to a single phosphate group.
As used herein, the term "oligozzucleotide" refers to a series of linked
nt~cleatide residues,
which aligonuclevtide ha.~ a sufficient number of nucleotide bests to be used
in a PCR.
I S rea~ctian. A short oliganucleotide sequence may be based on, or desigied
from, a
genomic or eDNA sequence and is used to amplify, con:~rm, or reveal the
presence of an
identical, similar or complementary DNA or RrJA in a particular cell oz
tissue.
Oligonucleotides may be chemically synthesized and may be used. as primers nr
probes: ' '
Dligonueleotide means any nucleotide of more than 3 bases in length used to
facilitate
20 detection or idez~ti~catiran of a target nucleic acid, including probes and
primirs.
"Polymerase chain. reaction" car "PCR" refers to a thermoeyelic, polymerase-
mediated,
DhIA amplification reaction. A PCR typically includes template molecules,
oligonucleotide primers complen5entary to each strand of the template
molecules, a
zs thermostable Dh(A polyznerase, and deoxyribonucleotides, and. invoIwes
three distinct
processes that are multiply repeated to effect the amplification of the
original nucleic
acid. The three processes (denaturation, hybridi~.ation, anri prinner
extension) are often
performed at distinct temperatures, and in distiu~ot temporal Steps. In many
embvditnents,
however, the hybridization and primer extension processes can be performed
30 concurrently. The nucleotide sample to be analyzed may be PCR amplification
products

CA 02460437 2004-04-30
provitded using the rapid cycling techniques described in U.~. Pat. No.
5,455,175. Other
methods of amplifZCation izrclude, without lirt~itation, NASBR, SDA, 3SR, T5A
and
rolling circle replication, It is understood that, in any method for producing
a
polynucleotide containing given modified nucleotides, one or several
polyrncrascs or
amplification methods may be used. The selection of optimal polymerization
conditions
depends on the application.
A ''polymerase" is an enzyme that catalyzes the sequential addition of
rnonorneric units
to a polymeric chain, or links two or more monomeric units to initiate a
polymeric chain.
i o In preferred embodiments of this invartion, the "polymerase" will work by
adding
rnonomcric units whose idcrztity is determined by and which is camplemeutary
to a
template molecule of a specific sequence. For Example, DIVA, polymerases such
as DNA
Po11 and Taq golyrxierase add deoxyribonucleotides to the 3' ~end of a
polynucleotide
chain in a template-dependent manner, thereby synthesizing a nucleic acid that
is
t 5 complementary to the template molecule. 1>olymerases may be used either to
extend a
primer once or repetitively ar to amplify a polyrzueleotide by repetitYVe
priming of two
complementary strands using two prirnErs.
A "polynucleotide" refers to a linear chain of nucleotides connected by a
phosphodiest~r
20 linkage between the 3'-hydroxyl group of one nucleoside and the 5'-hydroxyl
group of a
second nucleoside, wluch in turn is linked through its 3' hydroxyl group to
the 5'-
hydroxyl group of a third nucleoside and so on to form a polymer comprised of
nucleosides liked by a phosphodiester backbone. A "modified polynucleotide"
refers to a
polynucleotide ixz which one or more natural xzucleotides have been partially
or
Z,~ substantially completely replaced with modified nucleotides.
A '~rime~r" is a short oligonucleotide, the'sequence of which is complementary
to a
se,~m~nt of the template which is being replicated, and which the polymerase
usas as the
starting poizzt for the replication process. By "complementary''' is meant
that the
16

CA 02460437 2004-04-30
nucleotide sequence of a primer is such that the primex carp foxxn a stable
hydrogen bond
eoznplex with the template; d. e_, the primer can hybridize to the template by
virtue of the
formation of base~pairs over a length of at least ten consecutive base pairs.
The primers herein arc selected to be "substantially' complementary to
different strands
of a particular target DNA sequence. This means that the primers rn~xst be
suff cierrtly
complementary to hybridize with their respective strands. Thf~efore, the
primer
sequence need not reflect the exact sequence of the template. For example, a
non-
complernentary nucleotide ffagncnt may be attachEd to the S' end of the
primer, vv~ith the
to remainder ofthe primer sequence being complementary to the strand.
Alternatively, non-
complementary bases or longer sequences can be intezspersed into the primer,
provided
that the primer sequence has suff'tciez~t compleznex~tarity with the sequence
of the strand
to hybridize therewith and thereby form the template for the synthesis of the
extension
product.
A "restriction er~cyrne" refers to as ondonuclcas~ (an enzyme that cleaves
phosphodiester
bonds within a polynuclcotide chain) that cleaves DNA in response to a
recognition site
orr the DNA. The recognition site (action site) consists of a specific
sequence of
nucleotides typically about 4-$ nucleotides long.
24
A "single nucleotide polymorphism" or "SIfP" refers to polyxuclcotide that
differs from
another polynucleotide by a sizzgle z~ualeotide exchange. Por example, without
limitation,
exchar~ing one A for one C, G or T ire the entire sequence ofpolynucleotide
constitutes a
SNP. Of course, it is possible to have more than one Shlf in a particular
polynucleotidc.
2s For example, at one locus in a polynucleotide, a C may be ex~:hanged for a
T, at another
locus a G may be exchanged for an A anal so on. VYh.en referring to SNPs, the
polynucleotide is most often DNA and the SNP is one that usually results in a
change in
the genotype that is associated with a corresponding change in phenotype of
the organism
in which the SNf occurs.
x7

CA 02460437 2004-04-30
As used herein, a "template" refers to a target palynuclcotidc strand, for
example, without
limitation, an uzaxxzadi.fzed naturally-accruming I7NA strand, which a
palyn~erase uses as a
means of recagz~izi.ng which nucleotide it should next incorporate into a
growing strand
to polymerize the complement of tlae naturally-uccun-ing strand.. Such DNA
strand may
be single-stranded or it zxzay be part of a double-stranded DNA template. In
applications
of the present invention requiring repeated cycles ofpalyrn~rization, e.,~,
the polymerise
chain reaction (PC1Z), the template strand itself may become rn.odihed by
incorporation bf
modified nucleotides, yet still ser. ve as a template for a pblyrneraso to
synthesize
l0 additiozaal potyrzucl.aotides.
A. "thennacyclic reaction" is a mufti-stop reaction wherein at least two steps
arc
accomplished by changing the temperature of the reaction.
o s A "therrnostable polymerise" refers to a DNA or .1~NA polyzne~rase enzyme
that can
withstand extremely high temperatures, such as those approaching 100°C.
Thermastable
polymerises are typically isolated from organisms that live in extreme
temperatures, such - . ~ . . , , . . . n
as 7lzermus aquaticus. examples of thermostable polymera.sos include Taq, Tth,
Pfu,
Vent, deep vent, 'UlTma, and variations and derivatives thereof:
A "variant" is a difference in the nucleotide sequence among rc;latod
polynucleotides.
The difference may be the deletion of one or more nucleotides tom the scduence
of one
polynucleotide cozxzpared to the sequence of a related polynuclootidc, the
addition of one
or mare nucleoiades or the subsritution of one nuclvotidc for another. The
terms
"mutation," "polyznoxphiszzz" and "variant" are used interchangeably herein to
describe
such variants. As used hereizt, tlxe term "variant" in the singular is to be
construed to
include multiple variances; t.e., two or more nucleotide additions, deletions
andlor
substitutions in the wane polynucleotide. A "point zxzutation" .refers to a
single
substitution of one nucleotide for another.
18

CA 02460437 2004-04-30
The present invention makes use of a number of oligonucleotide sequences as
described
herein as primers for use in DNA amplification reaction or as hybridization
probes. It is
well known to those skilled in the art that such oligorruclcotidcs may be
modified in
tezms of length and even specificity, and they will still be well sW ted to
the practice of
the invention. As such, the invention is not limited to the preciae
oligonucleotides
described but is intended to include all those oligonucleotides chat will
allow the method
of the invention to be earned out as disclosed herein.
~o
tx~troduc~ion~:
A variety of charaetcristics of livestock animals are considered. important in
determining
the overall value of the finished product. Some factors are involved in the
palatability of
the meat produced, which is i~nC~.po~rtat7t to consumers, and which i5
reflected in the
grading system used to classify meat. 5ti11 other factors affect the cost of
producing an
animal of given size and therefore affect the cost o~Fmeat that tfze consumer
will
>.. .,. .. .. . i
ultimately pay, ~ and which will result in improved profitability for
producers ~of livestock ,
as well as the operators of feccllots. As a result, methods of production that
can improve
zo the duality, or reduce the cost of production are desirable far al.l
co~acez~,ed. in the
production and consumption of meat from livestock.
The present invention discloses the discovery of iNPs that are associated with
a variety
of parameters related to the growth rate of animals. Knowledge of the CRH,
PUJIIC and
MC4R genotype of animals permits the development of genetic testixzg rxxethods
such that
animals with the most desirable characteristics witlx regard to carcass
weight, average
daily wci~lht gain and rib eye area can be identified and selected. This in
turn leads to the
development of methods of livestock management, wherein a lugher degree of
predictability about the eventual development of livestock anintials becomes
possible,
19

CA 02460437 2004-04-30
ante the genotype of animals with regard to the CRH, POHC and MC4R genes is
detez~xziz~ed_
According to one aspect of the present invention, there i5 provided a method
far
dist'sn~mishing bovines .~l??vina ~ ~~~~°IIP-iJ'llytrlnl~5111~'ru ~F~f'
mpthnrW -nmnrice~,~~,e;._ _ ...... __.._ ..... ....
steps of first isolating a genozzzic JI~I°:lA sample from a bovine, and
then amplifying a
region of the bovine C1ZH gene using an oligonucleotide pair to form zxucleic
acid
ampliiacation products of C.t2.H gene polymorphism sequexzces. .A.rrzplil-
ZCatian can be by
any of a number of methods known to thane skilled in the art including 1'C1R.,
and the
i0 invention is izxterzded to encompass any sz~itabEe methods of DIVA
amplifcation.
7.'he aznplificatic~n products are then analyzed in order to detect the
presence or absence of
at polymorphism in the CRFI gene that alters the fourth amino acid and which
is
associated with a number of desired phenotypes. The polymorphism comprises a C
to G
is transition at a position corresponding to position 22 of SEQ LL> IVO: 1,
which is the
eDNA sequence of exon 2 of the .l3os tr~z~rus corticotrophin-releasing hormone
precursor
(CRIB gene (Gez~azxlc .Accession No. AF340152), The presence of a "G" residue
at tE~is
position results in animals that display the desirable phenotypes of increased
carcass
weight, increased end-of test rib~eye area and increased post-natal growth..
By practicing
2o the method of the present invention and analyzing the amplification
products it is
possible to determine the genotype of individual animals with respect to the
polymorphism.
Conveniently, analysis may be made by restriction fragzrzent length
polymorphism
2s (RFLP) analysis of a 129 by PCIt produced by amplification of bovine
genomic DNA
with the aligonucleotide pair of S~C,~ YD h10: -0~ and SEQ Ix7 NcJ: 5_ The use
of a forward
primer containing a purposeful mismatch, in combination with a target D1VA
containing
the "G" allele, creates a Dd~I site such that the presence of the "G" allele
is positively
indicated by digestion of the amplification products with Dc~el. In the
absence of the "G"
30 allele, the amplification product still contains a single .DdeI site,
normally present in the
CIZll gene, sncla that digestion yields two fragment of 8$ and ~G1 bp. In the
presence of

CA 02460437 2004-04-30
the SNP, the s'G" alley, an additional .Duel site is created at nucleotide 87
ofthe
amplification product, resulting in the further digestion of the 88 by
fragnnent to yield
fragments of ~9 and T 9 bp.
In order to simplify detection of the amplification products axed the
restriction fcagtz~.er~ts,
it will be obvious to those skilled in the art that the ampiif~ed DNA will
further comprise
labeled moieties to permit detection of relatively szxAall azaaouz~la of
product. .A, variety of
rnoietaes are well luaown. to those skilled in the art and include such
labeling tags as
fluorescent, bioluminescent, chemiluminescent, and radioactive or colorigenic
moieties.
,A, variety of methods of detecting the presence acrd restriction <iigestion
properties of
CRH gene amplification products are also suitable for use with the present
invention.
These can include methods such as gel electrophoresis, mass spectroscopy or
the like.
The present invention is also adapted to the use of single strancf.ed DIfA
detection
is techniques such as fluorescence resonance energy transfer (FRET). For FRET
analysis,
hybridization anchor and detection probes may be used to hybridize to the
amplification
products. The probes sequences are selected such that in the presence of the
SNP (i.e. a
G residue at position 22 as described above), the resulting hybridization
corn~plex is more
stable than if there is a C residue at the same position. By adjusting the
hybridization
2o conditions, it is therefore possible to distinguish between animals with
the SNP and those
without. A variety of parameters well known to those skilled in the art can be
used to
affect the ability ofa hybxidization complex to fozaxx. These include changes
in
temperature, ionic concentration, or the inclusion of che~nacal constituents
like
formamide that decrease complex stability. It is further possible to
distix~uish ax~ixu,als
2s heteroaygous for the SN'P versus those that are homozygous for the same.
The method of
FRET analysis is well latown to the art, and the conditions under which the
presence or
absence of the SNP would be detected by FRET are readily determinable.
It is also well known to those in the art that a number of DNA atnplifieation
techniques
3o are suitable for use with the present invention. Conveniently such
amplification
techniques zx~ay comprise methods such as polymerise chain reaction (PCR),
Strand
21
,.~~._-_~ .~. _~~",~".. _ .r~... ~~,.... ,r ..w. ,,.~,w~~"~~,~ "a~,,m, ~
~__.... __._...._.m_~~..,..,.~.,~,."n",.,~~ ~_.__

CA 02460437 2004-04-30
displacement amplification (SI3A}, nucleic acid sequence based amplification
(NAS$A.),
rolling circle amplifica#ion, T7 palym~c~a..s~ mediated amplification, T3
poiymerase
mediated amplification and SP6 palymerase mediated amplification. The precise
method
of DNA amplification is not intended to be li»~iting, an~i ether methods not
listed here
will be apparent to those skilled in the art arid (heir use i.s within the
scope of the
inventian.
In another aspect, the present invention provides a zaaothod for
distinguishing bovines
having a POMG' gene polymorphism. The method comprises :isolating genomie DNA
1o from a bovine, amplifying a region of the k~ovins POMC' gene using an
oligonucleotide
pair to form nucleic acid amplification sequences comprising
arnplified,i~O.ll~G' gene
polymorphism sequences, and than analyzing the amplification products in order
to detect
the presence or absence of a SNP in the POMC gene at position 254 of SEQ ID
NO: 2.
The polymorphism is a C to T transition, such that the presence ofa
°'T" residue at this
1s position is associated with the desirable phenotypes of increased shipping
weight and
increased average daily gain, as coznpaxed to azaixn,al.s with a. "C" residue
at position 254
of SEQ ID htO: 2.
Conveniently, the 3°O~IrfC SNP can be detected by restriction digest of
a 390 by
20 ampliFcation product produced using the oligonuclcotide pair SEQ ID NO: 6
and SEQ
ID NO: 7. The presence of a "T" residue creates a BtsI restriction site at
nucleotide 157
in a nucleic acid amplification product produced by amplification of the FOMC
gene
using the aligonucleotide pair SEQ ID NO: 6 and SEQ ID NO: 7. The presence of
the
SNP is readily detested by digestion of the amplification product with Btsl,
and the
2s digestion products analyzed by methods such as gel electrophoresis and the
like.
As was described about, in order to simplify deteetian of the ampli~catidn
products and
the restriction fragments, it will be obvious to those skilled in the art that
the amplified
D'NA will further comprise labeled moieties to permit detection of relatively
mall
30 amounts Of product.
za
........ ..,........_ .....,.. urw.":.~yrer» <,nsfi~~Y~~."''" ~~""~~~~-w v
nave.-o-wr;,~,~mq'.~yy".~. ~waaW an-.---..-
Y_.._.........,......~.~,~.e,~.~,~"., ,.~y,.es,rt~~e"-_.....
-0.%~.. ., rwww..

CA 02460437 2004-04-30
1n practicing the present invention it is also possible to use other known
methods of
analysis, such as FRET analysis, as a method of detection. Conveniently,
hybridization
probes comprising an anchor and detection probe, the design of which art is
well la~.own
to those skilled in the art of FRET analysis, are labeled with a detectable
moiety, and then
under suitable conditioxas are hybridized a PQ1VIC amplification product
containing the
site of iz~,texest in order to form a hybridization cnmple~c. Slsecificatly,
the hybridization
probe will be designed such that a change at position 2~4 of ~'EQ II7 NO: 2
will produce
a hybridization complex of altered stability. A variety of parameters well
known to those
skilled ixt the art can be used to affect the ability of a hybridization
complex to form.
1o These include changes in temperature, ionic concentration, or the inclusion
of chemical
constituents tike fonnamide that decrease complex stability.
The presence or absence of the PC7MC SNP is then determined by the stability
of the
hybridization complex as was described for the CX~'lT gene. The parameters
affecting
is hybridization and FRET analysis are well kxxowo. to those skilled in the
art. In addition;
the foregoiz~.g are examples of amplification products and hybridization
probes that are
suitable far use with FRET analysis. It will be readily apparent to those
skilled i;n the art
that modification may be made to the oligonuclc,otides that are used to
synthesize the
amplification products or probes while still permitting the practice of the
present
zo invention. As before, a variety of amplification methods are suitable faz~
use in the
practice of the present invention and all such methods are intended to be
within the scope
of the invention.
In another aspect, the present invention pmvidet a method for distinguishing
animals
2s having a MC4~i2 gene polynnorphism. The method comprises isolating genomic
'DNA
from a bovine, anaplifyi~og a region of the bovine kIC4R gene using an
aligonucleatide
pair to form nucleic acid amglification sequences comprising amplified Jta~G4R
gene
polymorphism sequences, and then detecting a SNF present in the MC4R gene.
'fhe SNP
comprises a G to C transition at position lOli9 of SECT ID NO: 3, and is
associated with
3o the phenotype of maximum increased hot carcass weight, as compared to
bovines with a
"G" residue at this position.
23
~.....~. ..,. . .... m . "m.~ __. .. _._.. . ,ri ~~_, .~.
....~~.~"~"r:..,,~,...a~~ ~. _._..W ,_...,~.~..h..,",w. .. .._... _
_~.~~..~..~...~

CA 02460437 2004-04-30
Conveniently, a porkion of the MG4R gene is amplified using the
oligonucleatide pair
SEQ ID NO: 13 and SEQ rD NU: 9, which yields a 226 by amplification product.
The
presence of a "T" residue results in an RFLP due to tlxe creation of a Tiu'I
restriction site.
s Thus, the presence or absence of the SNp in the t~tC4R gene can be detected
by
restricting the arnpli~catian product with Tair. h2 tl~e absence of the SNP
the 226 by is
undigested, while in the presence of the SNP, the X26 by is digested to yield
two
fragments of i23 and 103 bp. The results of the digestiozz reaction are
analyzed using
well-known DNA sizing techniques such as gel elec~broph,axesis az~d the like.
To aid i~a
io the detention of the digestion pxoducts in cases where small amounts of DNA
amplification products axe irzvolved, tlae amplification products may be
labeled v~ith a
detectable moiety to aid in the sensitivity of the detection methods used.
Such labeling
tags and znethads are known to those skilled in the art and it will be readily
apparent
whether such rnodifeatians would be needed or desired.
Detection of the SNP present in the ~f9.C4.tt gene caz~. also be conveniently
performed by
FILET analysis. Here the amplification product produced by the oligonueleotide
pair
SEQ 1D Na: $ and SEQ ID NO: 9 is included in a hybridization reaction with
oligonucleotide probes that serve as hybridisation anchor and probe sequences.
Conveniently, the anchor and probe arc labeled such that FRTT analysis can be
used to
detect the prasance or absence of the SNP in the lidG4R gene. The parameters
affecting
hybridir_ation and FRET analysis are well known to thQSe skilled in the art.
Isx addition,
the foregoing arc cxa~mples of amplification products and hybridization probes
that are
suitable far use with FRET analysis. it will lx readily apparent to those
skilled in the art
that modification may be made to the oligonucleotides that are used to
synthesize the
amplification products or probes while still pernxittizag the practice of the
present
invention. As before, a variety of amplification methods are suitable for use
in the
practice of the present invention and all such methods are intended to be
within the scope
of the izwention.
24

CA 02460437 2004-04-30
The present invention alw describes newly dxscovezed siztgle nucleotide
polymorphism
sequences, previously not kxaown in the art. In particular, the invention
describes nucleic
acids comprising a portion of the bovine Cltf! gene, further comprising a
polymorphism
at position 22 as defined by the positions in SEQ ID NO: 1, and in which there
is a "C"
s ~ residue at position 22. The invention also describes a nucleic acid
comprising a portion
of the bovine POMP' gene, in which a T residue is present at position 254 as
defined by
the positions in SEQ ID NO: 2.
Conveniently, purified and isolated nucleic acids comprising the SNPs of the
invention
io may be recovered from animals by subjecting a sample of gonomic DNA to an
amplification procedure. Alternatively, it will be readily apparent to those
skilled in the
art that DNA segxnezzts containing the SNP could be artificially produced by
oligonucleatide synthesis technology, or by screening cDNA ~ar genomic 17NA
libraries
produced from ;animals known to possess the polymorphisms.
is
Bovines, like all mammals, are diploid organisms possess;uig pairs of
homologous
chromosomes. Thus, at a typical genetic locus, an animal has throe possible
genotypes
that can result from the combining of two difFerez~t a~lletes (e.g_ A and T3).
The animal
E
may be homozygous for one or another aileie, or heterozygous, possessing oz~e
of each of
2p the two possible alleles (e.g. AA, BB or AB).
The present invention provides a method of selecting individual livestock
animals based
on the knowledge of an animal's CRH genotype. With respect to the SNP
described in
the present invention, the two possible alleles are a "C" or "G" residue at
position 22 as
2s defined by SEQ B7 NO: I. The method of the invention comprises the steps of
determining the GRH alleles of an animal, such that it can be determined
whether an
animal is "CC", "CG" or "GG" with respect to the CRH one Locus. The presence
of a
"G" allele is assaaiated the desired phenotypes. With the knowledge of the
animal's
genotype oz~e can. then identify and sort animals into l;roups of like
phenotype, or
30 otherwise use the larowledge of the genotype in order to predict: which
animals will have
z5

CA 02460437 2004-04-30
the desired phenotypes of increased hot carcass weight, increased end-of test
n'b-oye area
and increased adjusted weaning weight, a measure of post-natal growth.
Here sorting can be taken to mean placing animals in physical groupings such
as pens, so
that animals of like gcrnotype are kept separate fmm animals of a different
genotype:
This would be a useful practice in the case of breeding programs where it
would be
desirable to pmduce animals of particular genotypes. For example, it may be
desirable to
establish herds that are homozygous "GG" at the CRH gene, such that breeding
am4ng
these animals would only produce more "GG" animals. Here keeping animals of
this
i0 genotype separate would be needed to ensure that "GG" animals did not have
the
opportunity to breed with animals possessing one or more "C" alleles, which
could result
in the reproduction of animals with a reduced tendency to display the desired
phenotypes
associated wzth the C.~C "G" allele. further~xxore, by ex~suxing that at least
one animal in
a breeding pair is "GG" at the CRH locus, conveniently allows for the
frequency of the
i s "G" allele to be increased in the next, and subsequent generations.
Sorting may also be of a "virtual" nature, such that an animal's genotype is
recorded
either in a notebook or computer database. Hare, animals could then be
selected based on
their lrnown ge~~otype without the need for physical separation. This would
allow one to
24 select for animals of desired phenotype where physical separatian~ is xzot
required.
The invention further provides a method of seleetirig individual livestock
animals based
on the knowledge of an animal's P(7MC genotype. With respect to the ~"Q.tI~G'
SNp
described in the present invention, the two possible alleles are a "C" or "T"
residue at
25 position 254 as defined by SEQ ID NO: 2. The method of the invention
comprises the
steps of determining the FOMC alleles of an animal, such That it can be
detenxnined
whether an animal is "CC", "CT" or "TT" with respect to the PQ.MC gene locus:
With
the knowledge of the animal's genotype one can then sort aniaroals into groups
of like
phenotype, or athetwise use the laaowledge of the genotype in order to predict
which
30 animals will have the desired phenotypes of increased shipping weight,
increased average
daily gain and increased hot carcass weight. ?he extent of the phenotypic
response is
26

CA 02460437 2004-04-30
directly related to the number of "T" alleles, such that an animal homozygous
for the "T"
allele, a "TT°' ariinial, will display the greatest phenotypic change
for the desired
pl~ertotypes when compared to animals with the "CC" genotype. Animals that are
"C'f"
display an intermediate phenotypic response.
A.s descz~ibad for the CRX~' gene, krzawledge of the POMC genotype allows for
the
selection and sorting of animals that will display desired phenotypes. As
before, sorting
may be physical or virtual, and znay be used in conjunction with animal
breeding or other
herd znanageznerzt prograrxzs.
IO
T.he invention further comprises a method of selecting individual livestock
animals based
on the knorxrledge of an animal's MC4R genotype. With respect to the MC4R SNP
described in the present invention, the t~vo possible alleles aarc a "C" or
"G" residue at
position l Ob9 as defined by 5~Q ID NO: 3. The method of t:he invention
comprises the
is steps of determining the MC4R alleles of an animal, such that it can 'be
deterxrLined
whether an axtizzzal is "CC", "CC" or "GG" with respect to the A~IG'~R gene
locus. The
presence of a "C" allele is associated the desired phenotypes of increased hat
carcass
weight. With the knowledge of the animal's genotype one can then sort
aniit~als into
groups of lute phenotype, or otherwise use the knowledge of the genotype in
order to
2o predict which animals will have the desired phenotypes of increased hot
carcass weight.
Knowledge of an animal's MC4lt genotype provides a further advantage. Animals
with
one or two "C" alleles will display an increase in hot carcass weight,
regardless of the
animal's Cl~i' genotype. Thus, where the sale phenotype of iztterest is
increased hot
zs carcass weight, sel~taxzg animals with either the "GG°" C,tt~~'
genotype or the °'CC" or
"CCx" MC4R genotypes will accomplish the same goal, being the greatest
increase in hot
carcass weight. Any animals that have at least one "C" allele at the MC4R gene
locus
will display the increased hot carcass weight phenotype, and thus testing of
animals for
the prescance of the CRH SNPs wih not be necessary to detect and select the
desired
3o animals.
27

CA 02460437 2004-04-30
For the subgroup of a~aiznais that lack a "C" allele at MG'4R, further testing
for the
presence of G'Rff ~1"~Tp' could detect additional animals that will display
the desired
phenotype. In any population where the '°~" and "Gr'" alleles 1=or the
lvfC~R gene are both
present, testing for MC4R genotype provides the greatest chance of detecting
animals that
s will display the maximum increased hot carcass weight possible. xhis occurs
because
two out of tnrcc poss~le combinations will have a "G" allal~e. In cozztrast,
only ozze in
three of the possible combinations, "GG", in the CRff SNl' will e~,k~ibit the
same
maximum increase in hot carcass weight. The overall advantage will be that
fewer
animals will need to be tested for both CR!-1 and MC4R gezaotypes if the MC4R
getzotype
~ o of the animal is determined first. Thus, based. on the allele frequencies
shown in Table V,
it is more likely that an animal will have at least one "C" allele at MC~4R
than that it will
be homozygous for the "~'" allele at CRH.
A,s described for the CRH and POII~C ge.ncs, l~nowled~e of an animal's MC4R
genotype
i3 allows for the selection and sorting of animals that will display desired
phenotypes. As
before, sorting tray be physical or virtual; and may be used in conjunction
with anirxaal
breeding or other herd management programs.
It is a further aspect of the invention that animals can be selected as to
their combined
20 Ct~' and POMC genotypes. There is an advantage to selecting animals with a
"GG"
gexxotype at the CRH gene locus, and a "TT" genotype at the POMC gene locus,
in that
animals that are double homozygotes ("GG - 1T" animals) will display the
,greatest
phenotypic change in the desirable phenotypes of increased I~ot carcass
weight, increased
shipping weight, increased average daily gain and increased end~of test rib-
eye area,
~5 greater than that which would be obtained for animals homozygous for only
one of the
CRFf and POMC loci. Thus, through the method of the invention, animals with
the most
desirable combination of growth-related phenotypes can be selected. As before,
the
selection may be physical or virtual, and the advantage of selecting animals
based on
their combined CRH and P(7MC genotypes will be readily apparent to those
skilled in the
30 areas of animal breedixxg, herd management and the like.
28

CA 02460437 2004-04-30
In order to hilly realize the utility of the invention, there are also
provided diagnostic kits
that can be used to determine the CRtI, FOtVI~' ar MC4l~ genotypes of animals.
in
,general, each of the kits comprises oligonuclcotidc primers suitable to
amplify the
portions of each gene comprising the SNPs of the present invention. The kits
comprise
forward and reverse primers suitable for amplification of a DNA sample taken
fforn an
animal. The sample may be from any tissue or fluid in which genornic DNA is
present.
Conveni ently the sample may be Oaken from blood skin or a hair bixlb.
Ta for the presence of CRFir SNP alleles, the kit comprises a forward primer
comprising
In at it's 3' end secluencc identical to at least 10 contiguous nucleotides
within SEQ ID: 1, a
reverse primer oornprising at it's 3' end a nucleotide sequence folly
complementary to at
least I O contiguous nucleotides with SEQ ID NtS: 1. The primers are
preferably Pram 10
to 30 nucleotides in length, although variation in the length of the primer is
not intended
to be limiting. An example of suitable primers would be those defined by SEQ
ID NO: 4
and SEQ ID N(~: 5.
In one embodiment of a diag~astic lrit, the primers will be usc;d to amplify
DNA from a
genomic DNA sample to produce amplification products, which can then be
analyzed by
restriction digest for the presence or absence of the SNf' at position 22 as
defined by SEQ
2Q ID NGI: 1. In an alternative embodiment, the kit would further comprise
hybridization
probes adapted to distinguish between the two CRHslleles using FRET analysis.
Tn this
embodiment, the use of FRET analysis is one such method well known in the art
that is
suitable .for detecting SNPs. Where a method of analysis such as FRET is used,
the
bybridization probes would be labeled with a detectable moiety to aid in the
detection of
the SNP. The types of detectable moieties suitable for use in FRET analysis
are well
leaawn to thane Skilled in the art of molecular biology.
In another embodixxaent, where it is desired to test for the presence of POMC
SNP alleles,
the kit comprises a forward primer comprising at it's 3' end sequence
identical to at least
so 10 conti,guons nucleotides within SEQ ID: 2, a reverse primer <;omprising
at it's 3' end a
n~ccleatide sequence fully complementary to at least 10 contiguous nucleotides
with SEQ
29
...__.._ r x~., ,...~ ., .. ....... . _ . ... ..~ r.."~,.~,~" ~., r ..
........ . __._._ ~_.,Ar. ~....,~.,~..~, n o.. _.~ __._..

CA 02460437 2004-04-30
ID NO: 2. The primers are preferably fxoztz t0 to 3U nucleotides in length,
although
variation in the length of the primer is not izatended to be limiting. An
example of
suitable primers vvotild be those deE.ned by SEt~ i17 NO~: 6 and ShQ 1D Nt~:
7.
Xn one embodiment of a diagnostic kit, the primers will be used to amplify
.DNA from a
genomic DNA sample to produce amplification products, which can then be
analyzed by
restrictaoz~ digest far the presence ar absence of the SIWP at position 254 as
defined by
SEQ TD NO: 2. In an alternative embodiment, the kit would further comprise
lxybri.dization anchor and detection probes adapted to distinguish between the
two FOMC
ko alleles using FRET analysis. Where a method of analysis such as F).tE'x" is
used, the
hybridization probes would be labeled with a detectable znoieky to aid in the
detectaoxi of
the SNP. The types of detectable moieties suitable far use in FRET analysis
are well
known to those skilled in the art of zzzalecular biology.
In yet another embodiment, where it is desired to test for trxc presence of
MC4R SNP
alleles, the kit comprises a forward primer comprising at it's ~' end sequence
identical to
at least 10 contiguous nucleotides within SEQ 1D: 3, a ireverse priuzer
comprising at it's
3' end a nucleotide sequence fully camplezx~erttary to at least 1Q contiguous
nucleotides
with SEQ ID NO: 3. The primers are preferably from '10 to 30 nucleotides iri
length,
although variation in tb.e length of the primer is not intended to be
limiting. An example
of suitable primers would be those defined by 5E(~ ID NO: 8 and SEQ ID NO: 9.
In one embodiment of a diagnostic kit, the primers will be used to amplify DNA
from a
genomic DNA sample to produce amplification products, which can then be
analyzed by
restriction digest far the presence or absence of the SKIP at position 1069 as
defined by
S1JQ 1:17 NO: 3. In ate alternative embodiment, die kii: would further
comprise
hybridization probes adapted to distinguish between the two MC4R alleles by
FRET
analysis. tn this exnbadiment, the use of FRET analysis is one such method
well known
in the art that is suitable for detecting SNPs. Where a method of analysis
such as FRET
3o is used, the hybridisation probes would be labeled with a detectable moiety
to aid in the

CA 02460437 2004-04-30
detection of the SNP. The types of detectable moieties suitable for use in
FILET analysis
are well known to those skilled in the art of molecular biology.
It will also be obvious to one skilled in the art that diagnostic kits will
include additional
s reagents including, but not limited to lysing buffers for lysing cells
contained in a sample,
dNTP's, reaction buffer, an amplifying enzyme and combinations thereof. Kits
may also
include accessory diagnostic agents such as the restriction cnzyxne used to
detect the
SNP, or detection reagents to reveal the presence of detectable moieties. For
example, it
is well known in the art, and especially where only limited duantiti~s of DNA
are
to available, to use sensitive detection techniques such as Southern blot
hybridization,
chromatography or. mass spectroscopy in order to detect specie amplification
products,
or specific restriction digest products derived from az~apli~catioz~ products
as derived
herein. Thus, the precise means of detecting the various ShlPs from the
azz~plification or
~'estrictiran digest products could be performed by a variety of techniques
well known to
15 those skilled in the art of molecular biology, and the present invention is
intended to
encompass those methods of detection.
The diagnostic kits as referred to herein array be individually pacltaged for
each individual
gene locus to be tested, or the required reagents required to test foz
polymorphisms in alI
20 tbxee genes could be present in a single kit: Such variation is ~CW nmon in
diagnostic kits
and it xtot intended to be limiting Qf tfte invention.
Examnlcs:
In terms of demonstrating the practice of the inventions the following
examples are
provi ded.
31

CA 02460437 2004-04-30
Materials and Methods:
Cattle:
s A group of 2s6 tan-colored Charolais-cross steers were divided into two
groups of 12S
anirnaIs cash, and either limit-fed a grain diet or full-fed a forage-based
diet during the
backgrounding phase (90 day period). During the finishing phase each of these
two groups
were divided into half and allowed a full or limited high ,grain diet; this
was based on
voluntu~r intake. The full diets were 100% ad dibitum and the limited diets
were ~?5% ad
io lihitum. Live animal weight, ultrasound measurements of rib-eye area
(121;A) and average
daily gain (ADG) data were collected. Steers were sent far slaughtez~ as tlxey
approached a
target shipping weight of 635 kg (mean = 636.6 kg, SD = 21.4$). They were
weighed every
two weeks then ozx two consecutive days and transported for slaughter within a
week where
b.ot carcass weight (FiCV~ data was collected. Adjusted weaning weights were
available in a
15 second group of animals {n ~ 255) that included the Canadian Beef REfcrcncc
Herd (n ~ I32;
Schsrxut2 et al., 2001) and 123 animals from three ranches.
SIVP identificatiozx izt C,t2l~'~,ene:
20 Ba~ozx 2 of the C'RH gene was amplified and sequenced as described in
8uchanan et al. (2002b;
Gezx:Bank accession.number AF340I52). Briefly, the following single-stranded
DNA primers
were used Go amplify a 254 by fragment:
Forward:
25 5' - ATGCGACTGCCGCTGCTCG - 3'
Reverse:
S' - AGAGAGGGGAGCAGCCCG - 3'
3o The 20 ul reaction contaizxed: x 00 ng of DNA, I Ox PC1~ bufFer, 5x (~-
solution (C~iagex~.),
0.2 mM dNTPs, 0.5 emits Taq polymerase, 4 pmol forward primer, and 4 pmol
reverse
32

CA 02460437 2004-04-30
primer. The amplification programm consisted of one e~relc of 95°C for
2 minutes,
followed by 35 cycles of denaturation at 95°C for 45 sec, atrncaling at
55°C for 30 sec
and extension at 72°C far 45 sec, fallawed by a final cycle of
extension at ?2°C tbr 3
minutes. Sequez~cizzg of PCR products was gerFormed, an an AB~1373 sequenccr
(Applied
Biosystems). Sequence was aligned and compared for varixtian using Sequencher
4.1.2
(Gene Godes Corporada~x).
PCR-RFLP Anal,:
to
CRH4
The C'.t~H4 SNP is defined bar a C to G transition at position 22 of SLt,~ ID
NO: 1. Wherever
the tez~n "CRH~" or "CRH4 SN.P" is used it is meant to refer to the nucleotide
present at
position 22 of SEQ ID NO: 1. CRIT4 genotypes were derived from the
amplificataox~ and
t s subsequent digestion of the product with Ddel (New Ex~glar~.d ~3iaL.abs).
The following
primers were used to amplify a 12~ by pmduct:
1~orward:
i
5' - GCGCCCGCTAA~1ATGGGACTGA - 3'
zo
Reverse:
5' - CTGTGAT~GCCT~iCCCrCzGCAC - 3'
The 25 ul amplification reaction. cantaioed 50 ng of genarnic krovine DNA, 0.2
uM of each
2s primer, 0.2 mM dNTPs, 45 mM Tris-l~Cl pH 8.8, llm.M (Nl~i)2SU4, 4.5 mM
MgCl2, G.7 m11~
~i mercaptoethanol, 4.5 mM EDTA, 0,25 mM spermidane, l0~ra D1VIS0 axzd U.65
~,T Taq ~1~1,A,
polytnerase (Invitrogen). The cycling protocol was 2 rxxin at 94°C, 35
cycles of 94°C far t
rain, s2°C for 45 sec, 72°C for 50 sec, with a final exter~sioz~
at 72°C for 4 min. A 2-hour
digestion with DdeI was carried out in a 37°C water bath. The digesters
PCR-products were
30 separated on a 4% agarose gel. )=li,~esti an of the 12~ by FCR l~rnduet
with DcIeI produced
fragments of 88 and 41 bp, due to the presence of a DcleZ reca,8nition site at
nt 87 of tlae f'CR
33

CA 02460437 2004-04-30
pmciuct. This site was present in the DNA of all ariirnals tested. The CRH4
SNP introduces a
second Dde>' recognition site due the presence of a G residue at nucleotide
S7, resulting in
further digestxatx oftbe $$ by fragment further into fragments of ~9 and T 9
by upon digestion
with ~7det.
PGMC. LEP and MC4R Ge~aotypirg:
Genotypi.ng methods for SN)?s presexit in x'D,~I~IC. MC4.R and.~lG'.l' have
pzeviously beezx
t0 desczibed (~uckxazui~ et al., 2002x; 2002b; Thm et al., 2003).
Statistical Analysis:
is A regression analysis was carried out in the group of 255 c~a.ttle to
determine if the number of
copies of a GRH allele si~ai~ZCantly affected adjusted weaning weil;ht. Tn the
steers (fed two
different backgroundiz~g .rations and finishing diet:;) statistical analyses
were performed using
the general linear model (GLM) procedure of SAS (SAS,199f1}. 1Vo significant
e~'ects were
observed based on backgrounding (forage vs. grain} or f"rnishing (limited vs.
cad libiturn} diets
zc or the interaction between the two and hence these were deleted from the
model. No
sigt~ificat~t effects were observed with leptin or between the four or three
gene interactions
and hence these were deleted from the model.
In steers, tire model used to determine the effects of genotype on ADS, EOT-
REA, shipping
z5 weight and HCW was:
Y~o = ~. + GCRH~ + GPGMCn, + GMC~P," + GC:~H x t',POMC:,~" + GC~H x GMG.tR,o,
+
GPOMC x GMCAR"N,+ e,~"~,~
30 Where: Y~",no is an observation. of the dependent variable (cnd~of=test
REA, Shipping weight,
hot carcass weight (HCW) and average daily gain (ADG)}; p, is the overall
population mean
3~-
...... ..~,n ~~.>_, ; ,~.,N,~,,~~,:".,~,5« ,mx~.w....~_ . . ....

CA 02460437 2004-04-30
far the variable; GCRHx is the effect of the l~tl~ genotype of C.~t,~;C~ (k =1
( .l",xC), 2 (CC), 3
(GG)); GPOMCm is the effect of the mth genotype of PUMC (m =1 (CC}, 2 (CT), 3
(TT}};
GMC4R is the effect of the nth genotype of MC4R (n =1(CiG), 2 (GC), 3 (CC));
GCRH x
GPOMCxm, GCRH x GMC4Rx", and GPOMC x GMC4R~ are effects ofthe gene interaction
arid e~,T", is the randrnn error associated with the observation. Treatments
comparisons used
least sduares means by PI7IFF o~ptiorfs (SAS, 1998). Signifteauce was declared
at P ~ 0.05.
salts:
The CHR4, POMC, MtC4R and LEP genes were genotyped in 2;56 steers and then
analyzed using GLM for association with average daily gain (A1,7G), ezxd-of
test rib-eye
area (EOT-REA), shippin,~ weight and hot carcass weight {HCW). 'fhe CR~'4 SNP
was
positively correlated with EOT-R8A and HCW (Table I). The POMC SNP was
positively correlated with shipping weight arid HCW and there was evidence of
a trend
assaeiated with ADG (Table I). MC4R showed a'trend with HCW (Table I)
Interactions between two sets of genes were observed in the case of two
traits. The CRI~
and PUMC genes appeared to interact with respeck to EOT-REA, (Iy = 0.0407);
while the
CRH and tI~~CR4 gexles appeared to interact with recptxt to HC'JJ {P= 0.02)
{Table >),
Tn the case of the interaction between the CRX and MCR4 genc;s, HCW increased
ioy 26
lCg where animals were homozygous at CRH for the "C" allele, and had either
one or two
MC~4R "C" alleles (i.e. "CC" or "CG" at the MCR4 SNP site) as compared to
animals
~5 with an A~IC~tR "GG" genotype (P = 0.008 and P = 0.008). However, these
same animals
(CC-CC or CC-CG at lLiCR~ were not sigrnificantly different from animals that
had one
or two "G" alleles at CRH.
The data lead to the conolusxon drat, zf a~n anxrnal lxas either the "GG"
genotype at the
CRFI gene locus, or, at least one "C" allele at the 11~C4R gene locus, then
they will display
the desired phenotype of increase hot carcass weight. Thus, CRH and MC4R
operate as

CA 02460437 2004-04-30
parallel switches with respect to the increased hot carca..fis weight
phenotype such that if
one switch is on, the position of the athex is irrelevant.
Carcass yield least squaxe means for CXX and l~t~~C genotypes are reported in
'fables 'fl
and III respectively. The presence of a "Cx" allele at CRH4 is associated with
an izzcrease
in weiht. In the case of PC3MG, the "T" a11o1e is associated with increased
weights.
Furthermore, the effect of a "T" allele appeals to be additive with each copy
of the allele
rcsulti:ng in an increase of 9 kg. The "C" allele at tt?C4R is associated with
an ixzcrease in
HGW (LS Means CG = 378, CG = 377 and GG = 3b8 SEM =1.79), and acts in a
1 U dominant fashion.
The expected gains in cm2ofrib-eye 2trea or Iive and carcass weight irr
kilogt'arns are
shown in Tabie ItT. Allele frequencies observed in the 25b staers for CRH4,
POMC and
MC4R are shown in Table V. The allele frequencies were such, that adequate
t 5 representation of all genotypes would have been present in, the test
population,
Three SNPs have now been identified in the Clt~z' gene, two in the pro peptide
region and
another in tile signal sequence. The CIG SNP at codon ~. of CR~I (position 22
of SEQ ID
N'O: t) appears to be the mutation associated with effects on adjusted weaning
weight, a
20 measm-e of post natal growth and carcass weight. A Pro within the CRH
signal sequence
at cods~n 4 ltas been previously reported in both sheep (Itocl2e ct al., 1988)
and humans
(Shibabara et al., 1983). Similarly, in the Genbank database a Pro at this
same site has
been reported in another ovine sequence, two porcine, and two more human CRII
sequences (Accession Numbers JOUS03, AF440229, Y 151 ~9, NM000756 and ECU11
t)31
2s respectively).
The introduction of an Arg at position 4 in the signal sequence could lead to
a reduction
in the levels of circulating CRH (Fig. 3), resulting in a decrease in the
growth inhibition
effect zzormally associated with this hormone.
3C~
__~.., ~-~.~ -~"., - ...".,">r .T,.~.v~..~"~..~",..~ ~,:~,,. .,.......___ . ..

CA 02460437 2004-04-30
The data izzdicate that the CRH4 SNP is predictive of increased. E~JT-I~.EA
and HCW.
The data from animals that were "GG - TT" homozygotes at CRH and POMC
respectively, suggests that the presence ofthe C.?~~'4 allele does not result
in an increase
in shipping weight above that observed for .;t'?O,t'1~C "TT" k~oznozygotes
alone_ The r3ata
from animals with various CRll and MC4.R genotypes showed that the greatest
increase
in hot carcass weight could be achieved either by having CItH animals
hoxiaazygous for
the "G" allele SNP, or animals with at least one "C" allele at the MC4R locus.
We had previously sequenced PUMC as a candidate gene for AD ,1''x and carcass
weight. 'Vlre
mapped it directly under C~TX. peals (x'hue et al., 2003) and the cxu~-ent
results confirm its
association with ADG (!' = 0.07) and carcass weight. 'V~lhatever the møl~ular
mechanism
through which ,POMC polymorphisms act, the as.~ociations with increased ADG,
shipping and
hot carcass weight can be capitalized upon by selecting cattle that are
homozygous for the "T"
allele at POll~IC'. The effect seen on shipping weight is likely to be an
under estimate, based
~ 5 on how these animals were shipped (target weight) as compared to the usual
practice. The
usual practice in feedlots is to either use a set number of days an feed or
visually appraise the
weight of an animal, and then actually wex~, a truckload. of cai-kle.
Since CRH affects POMC levels both directly in the hypothalamus, and
indirectly by
~o affecting the release of glucocorticoids, it was important to determine if
the associations
between these genes and the various traits we have examined were dependent or
indcpcndEnt
effec,~ts of the SNPs that have been studied. As there was no interaction
effect observed with
respect to HCW, the data arc consistent with the premise that these genes act
independently of
each other. As a result, testing for the presence of either the CT~H or POMG'
SNPs will be
2s useful as a predictor of HCW. In addition, given that the allele
frequencies of each of the
alleles associated with the most desirable traits (increase weights) are
fairly common (U.37 far
the CRFT4 "G" allele, and 0.23 for the PUMC "T" allele), it will be possible
to use the genetic
test of the present invention to select for animals that arc; homozygous for
both the CRH4 G
and!?OMC "T" alleles. Selecting for such "GG -- TT" animals v~ill allow for
the concurrent
30 improvement R);A, shipping weight, HCW and ADG. Finally, the association
observed
37

CA 02460437 2004-04-30
bertween adj ustec~ weaning weight and the CRH4 SNP means the cow-calf
producer will
benefit from genetic selection methods based on this SNP.
38

CA 02460437 2004-04-30
Tabke x. Gerterak X,incar yodel Probability values for ~eneQs) with Trait
Associations.
Gene or Gene EOT-
iuteracti,on ADG R.EA Shipping HCW
cRi'-r4 a.37 0.03~~' 0.35 0.0015**
!'0lvIG' 0.07 O.A.S 0.0078** O.ooB**
lYl~4R 0.$$ 0.78 0.60 0.085
Cltfl4 x PC7ItIG'0.$9 0.047* 0.63 0.17
Cd~l'4 x MG~4~~0.28 U.~b 0.21 0.02*
* =1'~U.OS; * * = P~0.01
Table IL Effects of CRH4 on beef cattle performance (~,~ rneans)
Trait CC GC Cr ,C'x SE.M*
- ..~,.. - a
EOT-REA 88.6b 92.7a~ 94.6a U.84
Shipping 63 i .5 638.5 64.1.5 2.55
Wt
HCW 367.Sa 373.7bc 3$1.$a 1.64
*SEM = pooled standard erroz~ o~Fznean; lVifeans with different letters in the
same
row are significantlydi~1'erent (~ ~ 0.(?5)
Table XXX. ~f~ccts of PCy~IfC on beef cattle performance (LS means)
39

CA 02460437 2004-04-30
POMC
s
Trait CC CT TT S_ FM*
ADG 1.62 1.69 1.72 0.028
EaT-REA 92.5 933 90.2 1.11
S~uppxng 628.0 b 637.4 a 646.0 a 3.37
Wt
1-ICW 368.8 b 376.2 a 378.0 a 2.16
*SElVi = pooled standard error of mean; Means with different letters in the
same
z~ow acre significantly different (P ~ 0.05)
'X"ablc iV. Increase in ILEA end pounds expected from selec:iing animals GG
at CRH4 or TT at POMC or path GG and TT.
Trait CRH4 POMC CR.H4 ~ P'OMC
~(T~' ZtEA 6 cmz ~ 6 em2
Ship weight 'l8 kg 18 kg
Hot carcass weight 14.3 kg 9.2 kg 23.5 kg
Table V. Allele frequencies ifor Cue(, EUIViC axed lvXC4Fc
Cli'Cf4 POMC MC4R
Cx=0.37 T=0.23 C=0.66
C = 0.63 C = 0.77 ti = 0.34
40
i

CA 02460437 2004-04-30
Table 'VX, Sutoatnary of the >fhcnotypcs ,Associated with the CRFi, POMP and
MC4R Sh)las.
Gene S' P kk~e~otv~e(sl
CRII C. - G transition HCW, EQTREA, AWW
FOMC C - T transition ADCa, HCW, SW
MC4R G - C traxzsation ki'CW
The followi~ag abbreviations axe used in tlae tables: ~'J~:W - hot carcass
weight; EQTRE~
- end of test rib eye area; AWW - adjusted weaning weight; ADG - aveYage daily
gain;
SW - slxippzng weight.
The foregdin~ is considered as illustrative only of the principles of the
invention.
io Further, since numerous changes and modifications will readily occxzr to
those skirled in
the art, it is nat desired to limit the invention to the exact constructioxa
and operation
shown and described, and accordingly, all such suitable changes or
modifications ixz
stTUCttue or operation which may be resort~3 to are intended 6o fall within
the scope of .
the claimed invention.
i
41

CA 02460437 2004-04-30
SEQUENCE LISTING:
Number czf SEQ ID NOS: 9
SEQ ID NO: 1
LENGTH: 5$4 base pairs
'X"Y~'E: Dl'rTA
ORGANISM: Bos taws
k'EATUitE: SNP's present a~ nucleotide;s 22 ("CRH4"~, 14S ("GRH45") and 240
~ a ~s~GFtH77").
OTHER INFORMATION: GcnBank Accession AF340152
SEQUENCE:
I cgcccgctaaaatgcgactgccgctgctcgtgtccgtgygCgtcCtgCtggtggctCtgc
61 tgGCCtCCCCgccatgcagggCactcetaageegggggcccatecegggtgeccggeagg:
z2~. Catcacageacccccagcccctgagtttcttccagccgccgccgcagccccaggaacccc
lsl aggctctgcccaccctactccgtgttggggaggaatacttcctccgcetgggtaacctag
atgagacccgggctgctccactctctcccgccgcctcgcctctcgocagcagaagcagca
301 gtcgcctttctccggacaaggtggccgccaactttttacgagcgCtgctgcagccccggc
361 gcccattcgacagcccagcgggtcecgcggaacgcggcacggagaacgccatcggcagcc
421 gceaggaggegeeggccgecaggaagaggegatcccaggaacctceeatetccetggatc
481 tcaacttccacctcctccgagaagtcttggaaatgaCaaaggccgatcagttagcacagc
541 aagctcatarcaayaggaaaCCgttgga~attgctgggaaa'tga
SEQ ZD NO: 2
LENGTH: l (102 base
pairs
TYPE: DNA
ORGAN1SM:
.Bos taurus
3o rEATURE: SNP at pasitiozz
254
42

CA 02460437 2004-04-30
OTHER INFORMATION: CxenBaz~c ,Accession JQQ(f21
SEQUENCE:
1 gaggagggagtggaaggctcaggcggcgcgcttgaggggcgggtgaacgccgcggcctgg
61 agtgggcggggcctgacgCgCtCtgCCgGCGtCC~Cc'lggCgCgCatccgggCCtgcaagC
121 ccgaCCtCtCcgccgagacgcCggtgttCCCcggcaacggcgatgageagccgctgactg
181 agaacccCCggaagtacgtcatgggccatttccgctgggaccgcttcggccgtcggaatg
241 gtagcagcagcagcggagttgggggcg~ggcccagaagcgcgaggaggaagiggcggtgg
301 gcgaaggCCCCgggccCCgcggcgatgaegccgagacgggtccgcgcgaggacaagcgtt
361 cttactccatggaacacttccgctggggGaagCCggtgggCaagaagcggCgCCCggtga
421 aggtgtaCCCCaaCggCgCCgaggaCgagtcggcccaggcctttcccctcgaattcaaga
g81 gggagctgaecggggagaggctcgagcaggcgcgeggecccgaggcccaggetgagagtg
541 cggccgcGGgggCtgagctggagtatggcctggtggaggaggcggaggctgaggcggccg
~5 601 agaagaaggactcggggccctataagatggaacacttCCgGtcjgggCaeJGCcgCGCaagg
661 acaagcgctacggcgggttCaC.gaCCtCCgagaagr~.gC4s~daCgCCCCtCgtCe~CgCtgt '
721 tcaaaaacgccatcatcaagaacgcccacaagaagggccagtgagggcgcagc~ggcagg
781 ggectctatCcgcggaaagttgaccetgaaggcetetcttetgeaetactaaagectcgc
84z agCCtgggtgaggattcgcccaggcagtgatggcgccaggtatcccgactcttaaagctg
901 tctgtagttaagaaatadaaCCtttCaagttCCa,CgaatszttgaCtgggCgc~atLaaaaa
96X CgCatttccatcaagtaaagggcagtacatattggaggggcg
1
SEQ
ID
NO:
3
2S LENGTH: base pairs
1809
TYPE:.DNA
ORGANISM:
l3os
taurus
FEATURE: at position
SNP 169
i OTHER
INFORMATION:
Genbank
Accession
No.
AF2652~?i.
3~
SEQUENCE:
1 CagCCtaaga CttCCaag~.g atgCtgcaCCa gagccacact tgaaagagac tgaaaacttc
6x ctttccagct ccggagcatg ggacatttat tcacagcagg catgccactc tccgccgcct
35 122 aactttcgtt tggggcaagt caagactgga gaaaggtgct gaggctgcaa gatccaggag
43

CA 02460437 2004-04-30
1s1 gttcagtcag tacagagggg acctgaatec aaaatgaact ctacccagcc ccttgggatg
241 cacacctctc tccactcctg gaaccgcagc gcccacggaa tgcccaccaa tgtcagtgag
301 tccctggcaa aaggctactc ggacgggggg tgctatgagc agctctttgt ctctcccgag
361 gtgtttgtga ctctgggggt catcagcttg ttggagaata ttctggtgat cgtggccata
$ 42X gecaagaaca agaatetgca ctcaCCCatg tactttttca tctgaagcet ggctgtggct
481 gacatgttgg tgagcgtttc caacgggtcg gaaaccattg tcatcaccct gctgaacagC
54I acggaoacgg acgcgcagag cttcacggtg gatattgaca atgtaattga ctcggtgatc
64X tgtagctcct tgettgcctc catctgcagc Ctgctgtcga tcgcggtgga caggtacttc
661 actatcttct atgcgctcca gtaccataac atcatgacgg tgaagcgggt ggcgatcaCC
lU 721 atcagcgcca tctgggcagc ctgcacggtg tcgggcgtct tgttcatcat ttactcagac
781 agcagtgctg ttatcatctg cctCatcacc gtgttcttca ccatgctggc tctCatggCg
841 tctctctatg tccacatgtt cctcatggcc agactccaca ttaagaggat cgcggtcctg
901 ccaggtagcg gcaccatccg ccagggcgcc aacatgaagg gggcgattac cctgaccata
961 ctgatcgggg tctttgttgt ctgctgggcc cccttcttcc tgcacctgat attctacate
15 10x1 tcttgtcCec agaacccata ctgtgtgtgt ttcatgtctc actttaaact gtacctcatc
1081 ctcatcatgt gcaattccat cattgaccct ctgatttatg ccctgcggag ccaagaaatg
1141 aggaaaacct tcaaagagaG catttgttgc tctcctetag gtggcctCtg tgatttgtCt
1201 agcagatatt aaatggggac aaacgcgatg ctaaacacaa gcttaagaga ctttctcatC
1261 ctcatatgta caacctgaac agtctgtatc agccacagct ttttcttctg tgtagggcat
20 1321 ggagtgaaaa tttctattgt atcagttgaa gtttgtgatt tttttctgat gtgaaacagt
1381 gcccagtatt ggtgtatttt taatgtaatg ctactttCtg gCtgtaaaat gtgaatccac
1441 atcacaggtt ataggcacta tgcatttata aaaaaagaag aaaaaaagtc cttatgagga
1501 gtttaacagt gtttccttct tgttatttac aaggatgtga cactttgctt gcttttgtaa
1,561 catggaaatc aeagcttcat taagtatatc ctcataagtg gtttttttat gttatacttt
25 1621 acaacactga agtgtaaaaa tttgattcta gcatttaggg gagaaatatt gagaacatat
7.681 tgcttaatca taaaaaacaa gctgaaattt Caggtaattt aataagactt tctCattCat'
1741 tcttcctgtg cagaagttga aatgaagctt gtattgggag aaaaacagtt acttaaaaaa
isol aaaaaaaaa
SEA ID ~NO: 4
LEN CrTH: 22
TYPE: DNA
ORGANISM: Bos taurus
ss FEATURE:
OTHER INFORMATION: Forward primer f'or DNA amplii:ication of sequences within
SEQ ID 1~T0: 1.
44

CA 02460437 2004-04-30
SEQUENCE:
R gCgccogcta aaatgcr~act ga 22
SEQ ID NO: 5
LENGTH: 20
TYPE: DNA
ORGANISIVr: Bos taurus
IU FEATURE:
OTHER INFORMATION: Reverse primer for DNA amplification; seclnence is the
reverse cozxaplement of the corresponding sequence in SEQ ID NO: 1.
SEQUENCE:
IS
I etgtgatgcc tgccgggcaG ~0
SEQ IB NO: ~ . i
20 LENGTH; ~1
T'.YPE: DNA
ORGANISM: Bvs tauru5 ,
FEATURE:
OTHER INFORMATION; Forward primer far DNA ampli~catian of sequences within
25 SEQ ID NO: 2.
i SEQUENCE:
1. egtgcatccg ggcctgcaag c 21
SEQ ID NO: 7
LENGTH: 23

CA 02460437 2004-04-30
T~.'PF.: I~;~VA
ORGANISM: .~~.s taurLas
FEATURE:
OTHER LNFORMATION: Reverse primer far L7NA arnplificaticn; Sequence is the
s rcvcrsc complement of the corre~spondxng sequence xzt SEQ Z~ NO: ~.
I SEQUENCE:
1 gtcagctccc tettgaattc gag 23
SEQ ID NO: 8
LENGTH: 20
TYPE: L?NA
ORGANISM: Bos taurus
t5 FEATURE:
QT~IER INFORMATION: Forward primer for DNA amplification of sequences witf~
SEQ ID NO: 3.
SEQUENCE:
zo 1 taccCtgaCCataGtgatc~
SEQ ID NO: a
LENGTEi: z2
s 25 TYPE: 1DNA
i
ORGANISM: ,~os taur~ss
FEATURE:
OTHER INFORMATZC1N: Reverse pramer for DNA amplification; sequence is tk~e
1
reverse complement of corresponding sequence in SEt~ ID NC~: 3.
3Q
46

<IMG>