Note: Descriptions are shown in the official language in which they were submitted.
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
HYALURONAN SYNTHASES AND METHODS OF
MAKING AND USING SAME
CROSS-REFERENCE TO RELATED APPLICATIONS
This application claims Convention priority and benefit under 35 U.S.C.
119(e) to U.S. Patent Application No. 60/336,105, filed December 3, 2001,
entitled ~~NOVEL KINETIC PROPERTIES OF HYALURONIC SYNTHASES", the
entire contents of which are hereby expressly incorporated herein by this
reference.
This application also claims Convention priority to and is a U.S.
continuation-in-part of U.S. Patent Application No. 10/011,771, filed December
11, 2001, entitled "HYALURONAN SYNTHASE GENE AND USES THEREOF," the
entire contents of which are hereby expressly incorporated herein by this
reference.
STATEMENT REGARDING UNITED STATES FEDERALLY
SPONSORED RESEARCH OR DEVELOPMENT
This application was supported in part by a grant from the United States
National Institutes of Health (GM35978). The United States Government may
have rights in and to this application by virtue of this funding.
BACKGROUND OF THE INVENTION
1. Field of the Invention.
The present invention relates to nucleic acid segments having coding
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
regions encoding enzymatically active hyaluronate synthase (HAS), and to the
use of these nucleic acid segments in the preparation of recombinant cells
which produce hyaluronate synthase and its hyaluronic acid product.
Hyaluronate is also known as hyaluronic acid or hyaluronan. More particularly,
but not by way of limitation, the nucleic acid segments disclosed and claimed
herein have at least one mutation as compared to the native nucleic acid
segements such that the at least one mutation results in kinetic or enzymatic
changes/modifications to the resulting enzyme.
2. Brief Description of the Related Art.
The incidence of streptococcal infections is a major health and economic
problem worldwide, particularly in developing countries. One reason for this
is
due to the ability of Streptococcal bacteria to grow undetected by the body's
phagocytic cells, i.e., macrophages and polymorphonuclear cells (PMNs). These
cells are responsible for recognizing and engulfing foreign microorganisms.
One
effective way the bacteria evades surveillance is by coating themselves with
polysaccharide capsules, such as a hyaluronic acid (HA) capsule. The structure
of HA is identical in both prokaryotes and eukaryotes.
Since HA is generally nonimmunogenic, the encapsulated bacteria do not
elicit an immune response and are therefore not targeted for destruction.
Moreover, the capsule exerts an antiphagocytic effect on PMNs in vitro and
prevents attachment of Streptococcus to macrophages. Precisely because of
2
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
this, in Group A and Group C Streptococci, the HA capsules are major virulence
factors in natural and experimental infections. Group A Streptococcus are
responsible for numerous human diseases including pharyngitis, impetigo, deep
tissue infections, rheumatic fever and a toxic shock-like syndrome. The Group
C Streptococcus equisimilis is responsible for osteomyelitis, pharyngitis,
brain
abscesses, and pneumonia.
Structurally, HA is a high molecular weight linear polysaccharide of
repeating disaccharide units consisting of N-acetylglucosamine (GIcNAc) and
glucuronic acid (GIcUA). The number of repeating disaccharides in an HA
molecule can exceed 30,000, a M,> 10'. HA is the only glycosaminogylcan
synthesized by both mammalian and bacterial cells, particularly Groups A and
C Streptococci and Type A Pasteurella multocida. These strains make HA which
is secreted into the medium as well as HA capsules. The mechanism by which
these bacteria synthesize HA is of broad interest medicinally since the
production of the HA capsule is a very efficient and clever method that
bacteria
use to evade surveillance by the immune system. Additionally, organic or
inorganic molecules coated with HA have properties allowing them to escape
detection and destruction by a host's immune system.
HA is synthesized by mammalian and bacterial cells by the enzyme
hyaluronate synthase which has been localized to the plasma membrane. It is
believed that the synthesis of HA in these organisms is a multi-step process.
3
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Initiation involves binding of an initial precursor, UDP-GIcNAc or UDP-GIcUA.
This is followed by elongation which involves alternate addition of the two
sugars to the growing oligosaccharide chain. The growing polymer is extruded
across the plasma membrane region of the cell and into the extracellular
space.
HA has been identified in virtually every tissue in vertebrates and has
achieved widespread use in various clinical applications, most notably and
appropriately as an intra-articular matrix supplement and in eye surgery. The
scientific literature has also shown a transition from the original perception
that
HA is primarily a passive structural component in the matrix of a few
connective
tissues and in the capsule of certain strains of bacteria to a recognition
that this
ubiquitous macromolecule is dynamically involved in many biological processes:
from modulating cell migration and differentiation during embryogenesis to
regulation of extracellular matrix organization and metabolism to important
roles in the complex processes of metastasis, wound healing, and inflammation.
Further, it is becoming clear that HA is highly metabolically active and that
cells
focus much attention on the processes of its synthesis and catabolism. For
example, the half-life of HA in tissues ranges from 1 to 3 weeks in cartilage
to
< 1 day in epidermis. HA is also used in numerous technical applications
(e.g.,
lubricating compounds), cosmetics and neutraceuticals.
It is now clear that a single protein utilizes both sugar substrates to
synthesize HA, i.e., that HA synthases are single enzymes that have dual
4
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
catalytic properties. The abbreviation HAS, for HA synthase, has gained
widespread support for designating this class of enzymes. Markovitz et al.
( 1959) successfully characterized the HAS activity from Streptococcus
pyogenes
and discovered the enzymes's membrane localization and its requirements for
sugar nucleotide precursors and Mg2+. Prehm ( 1983) found that elongating HA,
made by B6 cells, was digested by hyaluronidase added to the medium and
proposed that HAS resides at the plasma membrane. Philipson and Schwartz
(1984) also showed that HAS activity cofractionated with plasma membrane
markers in mouse oligodendroglioma cells.
HAS assembles high M, HA that is simultaneously extruded through the
membrane into the extracellular space (or to make the cell capsule in the case
of bacteria) as glycosaminoglycan synthesis proceeds. This mode of
biosynthesis is unique among macromolecules since nucleic acids, proteins, and
lipids are synthesized in the nucleus, endoplasmic reticulum/Golgi, cytoplasm,
or mitochondria. The extrusion of the growing chain into the extracellular
space
also allows for unconstrained polymer growth, thereby achieving the
exceptionally large size of HA, whereas confinement of synthesis within a
Golgi
or post-Golgi compartment limits the overall amount or length of the polymers
formed. High concentrations of HA within a confined lumen may also create a
high viscosity environment that might be deleterious for other organelle
functions.
s
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Several studies have attempted to solubilize, identify, and purify HAS
from strains of Streptococci that make a capsular coat of HA as well as from
eukaryotic cells. Although the streptococcal and murine oligodendroglioma
enzymes were successfully detergent-solubilized and studied, efforts to purify
an active HAS for further study or molecular cloning remained unsuccessful for
decades. Prehm and Mausolf (1986) used periodate-oxidized UDP-GIcUA or
UDP-GIcNAc to affinity label a protein of N52 kDa in streptococcal membranes
that co-purified with HAS. This led to a report claiming that the Group C
streptococcal HAS had been cloned, which was unfortunately erroneous. This
study failed to demonstrate expression of an active synthase and may have
actually cloned a peptide transporter. Triscott and van de Rijn (1986) used
digitonin to solubilize HAS from streptococcal membranes in an active form.
Van de Rijn and Drake (1992) selectively radiolabeled three streptococcal
membrane proteins of 42, 33, and 27 kDa with 5-azido-UDP-GIcUA and
suggested that the 33-kDa protein was HAS. As shown later, however, HAS
actually turned out to be the 42-kDa protein.
Despite these efforts, progress in understanding the regulation and
mechanisms of HA synthesis was essentially stalled, since there were no
molecular probes for HAS mRNA or HAS protein. A major breakthrough
occurred in 1993 when DeAngelis et al. (1993a and 1993b) reported the
molecular cloning and characterization of the Group A streptococcal gene
6
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
encoding the protein HasA. This gene was known to be part of an operon
required for bacterial HA synthesis, although the function of this protein,
which
is now designated as spHAS (the S. pyogenes HAS), was unknown. spHAS was
subsequently proven to be responsible for HA elongation (DeAngelis and
Weigel, 1994) and was the first glycosaminoglycan synthase identified and
cloned and then successfully expressed. The S. pyogenes HA synthesis operon
encodes two other proteins. HasB is a UDP-glucose dehydrogenase, which is
required to convert UDP-glucose to UDP-GIcUA, one of the substrates for HA
synthesis. HasC is a UDP-glucose pyrophosphorylase, which is required to
convert glucose 1-phosphate and UTP to UDP-glucose. Co-transfection of both
hasA and hasB genes into either acapsular Streptococcus strains or Enteroccus
faecalis conferred them with the ability to synthesize HA and form a capsule.
This provided the first strong evidence that spHAS (hasA) was an HA synthase.
The spHAS was identified and is disclosed in detail in U.S. Serial No.
09/146,893, filed September 3, 1998, now U.S. Patent No.6,455,304, the
contents of which are expressly incorporated herein in their entirety by
reference.
The elusive HA synthase gene was finally cloned by a transposon
mutagenesis approach, in which an acapsular mutant Group A strain was
created containing a transposon interruption of the HA synthesis operon.
Known sequences of the transposon allowed the region of the junction with
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
streptococcal DNA to be identified and then cloned from wild-type cells. The
encoded spHAS was 5-10% identical to a family of yeast chitin synthases and
30% identical to the Xenopus laevis protein DG42 whose function was unknown
at the time (developmentally expressed during gastrulation), DeAngelis, et al.
1994. DeAngelis and Weigel (I994) expressed the active recombinant spHAS
in Escherichia toll and showed that this single purified gene product
synthesizes
high Mr HA when incubated in vitro with UDP-GIcUA and UDP-GIcNAc, thereby
showing that both glycosyltransferase activities required for HA synthesis are
catalyzed by the same protein, as first proposed in 1959. Utilizing the
knowledge that (i) spHAS was a dual action single enzyme and (ii) the areas of
sequence homology between the spHAS, chitin synthase, and DG42, the almost
simultaneous identification of eukaryotic HAS cDNAs in 1996 by four
laboratories, further strengthened the inventor's protein hypothesis that HAS
is a multigene family encoding distinct isozymes. Two genes (HASI and HAS2)
were quickly discovered in mammals, and a third gene HAS3 was later
discovered. A second streptococcal seHAS or Streptococcus equisimilis
hyaluronate synthase, was identified and is disclosed in detail in U.S. Serial
No.
09/469,200, filed December 21, 1999, the contents of which are expressly
incorporated herein in their entirety by reference. The seHAS protein has a
high level of identity (approximately 70 percent) to the spHAS enzyme. This
identity, however, is interesting because the seHAS gene does not cross-
8
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
hybridize to the spHAS gene.
Membranes prepared from E. coli expressing recombinant seHAS
synthesize HA when both substrates are provided. The results confirm that the
earlier report of Lansing et al. (1993) claiming to have cloned the Group C
HAS
was wrong. Unfortunately, several studies have employed antibodies to this
uncharacterized 52-kDa streptococcal protein to investigate what was believed
to be eukaryotic HAS.
Itano and Kimata (1996a) used expression cloning in a mutant mouse
mammary carcinoma cell line, unable to synthesize HA, to clone the first
putative mammalian HAS cDNA (mmHASl). Subclones defective in HA
synthesis fell into three separate classes that were complementary for HA
synthesis in somatic cell fusion experiments, suggesting that at least three
proteins are required. Two of these classes maintained some HA synthetic
activity, whereas one showed none. The latter cell line was used in transient
transfection experiments with cDNA prepared from the parental cells to
identify
a single protein that restored HA synthetic activity. Sequence analyses
revealed a deduced primary structure for a protein of N65 kDa with a predicted
membrane topology similar to that of spHAS. mmHAS1 is 30% identical to
spHAS and 55% identical to DG42. The same month this report appeared,
three other groups submitted papers describing cDNAs encoding what was
initially thought to be the same mouse and human enzyme. However, through
9
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
an extraordinary circumstance, each of the four laboratories had discovered a
separate HAS isozyme in both species.
Using a similar functional cloning approach to that of Itano and Kimata,
Shyjan et al. (1996) identified the human homolog of HAS 1. A mesenteric
lymph node cDNA library was used to transfect murine mucosal T lymphocytes
that were then screened for their ability to adhere in a rosette assay.
Adhesion
of one transfectant was inhibited by antisera to CD44, a known cell surface HA-
binding protein, and was abrogated directly by pretreatment with
hyaluronidase. Thus, rosetting by this transfectant required synthesis of HA.
Cloning and sequencing of the responsible cDNA identified hsHASI. Itano and
Kimata (1996b) also reported a human HAS1 cDNA isolated from a fetal brain
library. The hsHASi cDNAs reported by the two groups, however, differ in
length; they encode a 578 or a 543 amino acid protein, respectively. HAS
activity has only been demonstrated for the longer form.
Based on the molecular identification of spHAS as an authentic HA
synthase and regions of near identity among DG42, spHAS, and NodC (a ~3-
GIcNAc transferase nodulation factor in Rhizobium), Spicer et al. (1996) used
a degenerate RT-PCR approach to clone a mouse embryo cDNA encoding a
second distinct enzyme, which is designated mmHAS2. Transfection of
mmHAS2 cDNA into COS cells directed de novo production of an HA cell coat
detected by a particle exclusion assay, thereby providing strong evidence that
io
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
the HAS2 protein can synthesize HA. Using a similar approach, Watanabe and
Yarnaguchi (1996) screened a human fetal brain cDNA library to identify
hsHAS2. Fulop et al. independently used a similar strategy to identify mmHAS2
in RNA isolated from ovarian cumulus cells actively synthesizing HA, a
critical
process for normal cumulus oophorus expansion in the pre-ovulatory follicle.
Cumulus cell-oocyte complexes were isolated from mice immediately after
initiating an ovulatory cycle, before HA synthesis begins, and at later times
when HA synthesis is just beginning (3 h) or already apparent (4 h). RT-PCR
showed that HAS2 mRNA was absent initially but expressed at high levels 3-4
h later suggesting that transcription of HAS2 regulates HA synthesis in this
process. Both hsHAS2 are 552 amino acids in length and are 98% identical.
mmHASi is 583 amino acids long and 95% identical to hsHASi, which is 578
amino acids long.
Most recently Spicer et al. (1998) used a PCR approach to identify a third
HAS gene in mammals. The mmHAS3 protein is 554 amino acids long and 71,
56, and 28% identical, respectively, to mmHASi, mmHAS2, DG42, and spHAS.
Spicer et al. have also localized the three human and mouse genes to three
different chromosomes (HAS1 to hsChr 19/mmChr 17; HAS2 to hsChr 8/mmChr
15; HAS3 to hsChr 16/mmChr 8). Localization of the three HAS genes on
different chromosomes and the appearance of HA throughout the vertebrate
class suggest that this gene family is ancient and that isozymes appeared by
m
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
duplication early in the evolution of vertebrates. The high identity (N30%)
between the bacterial and eukarybtic HASs also suggests that the two had a
common ancestral gene. Perhaps primitive bacteria usurped the HAS gene
from an early vertebrate ancestor before the eukaryotic gene products became
larger and more complex. Alternatively, the bacteria could have obtained a
larger vertebrate HAS gene and deleted regulatory sequences nonessential for
enzyme activity.
The discovery of X. laevis DG42 by Dawid and co-workers played a
significant role in these recent developments, even though this protein was
not
known to be an HA synthase. Nonetheless, that DG42 and spHAS were 30%
identical was critical for designing oligonucleotides that allowed
identification of
mammalian HAS2. Ironically, definitive evidence that DG42 is a bona fide HA
synthase was reported only after the discoveries of the Mammalian isozymes,
when DeAngelis and Achyuthan (1996) expressed the recombinant protein in
yeast (an organism that cannot synthesize HA) and showed that it synthesizes
HA when isolated membranes are provided with the two substrates. Meyer and
Kreil ( 1996) also showed that lysates from cells transfected with cDNA for
DG42
synthesize elevated levels of HA. Now that its function is known, DG42 can,
therefore, be designated xIHAS.
There are common predicted structural features shared by all the HAS
proteins, including a large central domain and clusters of 2-3 transmembrane
i2
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
or membrane-associated domains at both the amino and carboxyl ends of the
protein. The central domain, which comprises up to N88% of the predicted
intracellular HAS protein sequences, probably contains the catalytic regions
of
the enzyme. This predicted central domain is 264 amino acids long in spHAS
(63% of the total protein) and 307-328 residues long in the eukaryotic HAS
members (54-56% of the total protein). The exact number and orientation of
membrane domains and the topological organization of extracellular and
intracellular loops has been determined experimentally for spHAS and will be
described in detail herein with respect to FIG. 14.
spHAS is a HAS family member that has been purified and partially
characterized. Initial studies using spHAS/alkaline phosphatase fusion
proteins
indicate that the N terminus, C terminus, and the large central domain of
spHAS
are, in fact, inside the cell. spHAS has 6 cysteines, whereas HAS1, HAS2, and
HAS3 have 13, 14 and 14 Cys residues, respectively. Two of the 6 Cys residues
in spHAS are conserved and identical in HAS1 and HAS2. Only one conserved
Cys residue is found at the same position (Cys-225 in spHAS) in all the HAS
family members. This may be an essential Cys whose modification by
sulfhydryl poisons partially inhibits enzyme activity. The possible presence
of
disulfide bonds or the identification of critical Cys residues needed for any
of the
multiple HAS functions noted below has not yet been elucidated for any
members of the HAS family.
13
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
In addition to the proposed unique mode of synthesis at the plasma
membrane, the HAS enzyme family is highly unusual in the large number of
functions required for the overall polymerization of HA. At least six discrete
activities are present within the HAS enzyme: binding sites for each of the
two
different sugar nucleotide precursors (UDP-GIcNAc and UDP-GIcUA), two
different glycosyltransferase activities, one or more binding sites that
anchor
the growing HA polymer to the enzyme (perhaps related to a B-X,-B motif), and
a ratchet-like transfer mechanism that moves the growing polymer one or two
sugars at a time. This later activity is likely coincident with the stepwise
advance of the polymer through the membrane. All of these functions, and
perhaps others as yet unknown, are present in a relatively small protein
ranging
in size from 417 (seHAS) to 588 (xIHAS) amino acids.
Although all the available evidence supports the conclusion that only the
spHAS protein is required for HA biosynthesis in bacteria or in vitro, it is
possible that the larger eukaryotic HAS family members are part of
multicomponent complexes. Since the eukaryotic HAS proteins are N40%
larger than spHAS, their additional protein domains could be involved in more
elaborate functions, such as intracellular trafficking and localization,
regulation
of enzyme activity, and mediating interactions with other cellular components.
The unexpected finding that there are multiple vertebrate HAS genes
encoding different synthases strongly supports the emerging consensus that HA
14
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
is an important regulator of cell behavior and not simply a structural
component
in tissues. Thus, in less than six months, the field moved from one known,
cloned HAS (spHAS) to recognition of a multigene family that promises rapid,
numerous, and exciting future advances in our understanding of the synthesis
and biology of HA.
For example, disclosed herein are the nucleotide sequences of HAS genes
as well as the amino acid sequences encoded therein from Streptococcus
equisimilis (SEQ ID NOS: 1 and 2, respectively), Streptococcus pyogenes (SEQ
ID N0S:3 and 4, respectively), Streptococcus uberis (SEQ ID NOS:S and 6,
respectively), Pasteurella multocida (SEQ ID NOS:7 and 8, respectively),
Xenopus laevis (SEQ ID NOS:9 and 10, respectively), Paramecium bursaria
Chlorella virus (PBCV-1; SEQ ID NOS:11 and 12, respectively), and Sulfolobus
solfataricus (SEQ ID N0S:13 and 14, respectively). The presence of hyaluronan
synthase in these systems and the purification and use of the hyaluronan
synthase from these different systems indicates an ability to purify and
isolate
nucleic acid sequences encoding enzymatically active hyaluronan synthase in
many different prokaryotic and viral sources, indeed, from microbial sources
in
general.
Group C Streptococcus equisimilis strain D181 synthesizes and secretes
hyaluronic acid (HA). Investigators have used this strain and Group A
Streptococcus pyogenes strains, such as S43 and A111, to study the
is
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
biosynthesis of HA and to characterize the HA-synthesizing activity in terms
of
its divalent cation requirement, precursor (UDP-GIcNAc and UDP-GIcUA)
utilization, and optimum pH.
Traditionally, HA has been prepared commercially by isolation from either
rooster combs or extracellular media from Streptococcal cultures. One method
which has been developed for preparing HA is through the use of cultures of
HA-producing Streptococcal bacteria. U.S. Patent No. 4,517,295, the contents
of which are herein incorporated by reference in their entirety, describes
such
a procedure wherein HA-producing Streptococci are fermented under anaerobic
conditions in a C02-enriched growth medium. Under these conditions, HA is
produced and can be extracted from the broth. It is generally felt that
isolation
of HA from rooster combs is laborious and difficult, since one starts with HA
in
a less pure state. The advantage of isolation from rooster combs is that the
HA
produced is of higher molecular weight. However, preparation of HA by
bacterial fermentation is easier, since the HA is of higher purity to start
with.
Usually, however, the molecular weight of HA produced in this way is smaller
than that from rooster combs. Additionally, HA prepared by Streptococcal
fermentation oftentimes elicits immune responses as does HA obtained from
rooster combs. Therefore, a technique that allows for the production of high
molecular weight HA by bacterial fermentation would be a distinct improvement
over existing procedures.
16
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
As mentioned previously, high molecular weight HA has a wide variety of
useful applications -- ranging from cosmetics to eye surgery. Due to its
potential for high viscosity and its high biocompatibility, HA finds
particular
application in eye surgery as a replacement for vitreous fluid. HA has also
been
used to treat racehorses for traumatic arthritis by intra-articular injections
of
HA, in shaving cream as a lubricant, and in a variety of cosmetic products due
to its physiochemical properties of high viscosity and its ability to retain
moisture for long periods of time. In fact, in August of 1997 the U.S. Food
and
Drug Agency approved the use of high molecular weight HA in the treatment of
severe arthritis through the injection of such high molecular weight HA
directly
into the affected joints. In general, the higher the molecular weight of HA
that
is employed the better. This is because HA solution viscosity increases with
the
average molecular weight of the individual HA polymer molecules in the
solution. Unfortunately, very high molecular weight HA, such as that ranging
up to 10', has been difficult to obtain by currently available isolation
procedures. The recombinant methods of production disclosed herein,
however, allow for the production of HA having an average molecular mass of
up to 10' and greater.
To address these or other difficulties, there is a need for new methods
and constructs that can be used to produce HA having one or more improved
properties such as greater purity, ease of preparation or desired product
size.
m
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
In particular, there is a need to develop methodology for the production of
larger amounts of relatively high molecular weight and relatively pure HA than
is currently commercially available. There is yet another need to be able to
develop methodology for the production of HA having a modified size
distribution (HAo5;2e) as well as HA having a modified structure (HA6mod)~
Although the streptococcal HA synthases are relatively small at <49 kDa,
they mediate at least six discrete functions: the ability to bind two
different
sugar nucleotide precursors, to catalyze two distinct glycosyltransferase
reactions, to bind the HA acceptor polymer and to translocate the growing HA
chain through the enzyme and the cell membrane.
All recombinant HASs, either from vertebrates or prokaryotes, have been
shown to synthesize high molecular weight HA in vitro. The class I HAS
proteins likely have essentially identical topological organizations in their
N-
terminal regions, which are highly homologous with spHAS, the only HAS whose
membrane topology has been determined experimentally.
There are six Cys residues in spHAS, four of which are conserved
perfectly in seHAS and suHAS (FIG. 1); both of these latter enzymes have only
four Cys residues (Kumari and Weigel, 1997; Ward et al., 2001). These four
Cys residues in turn are generally conserved among the three vertebrate HAS
isoenzymes (Weigel et al., 1997, and FIG. 1). However, to date the
involvement of one or more of these conserved Cys residues in enzyme activity
is
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
or disulfide bond formation has not been determined.
The present invention addresses one or more shortcomings in the art.
Using recombinant DNA technology, methods of producing enzymatically active
HAS having at least one mutation therein (as compared to the native enzyme)
is disclosed and claimed in conjunction with the preparation of recombinant
cells
which produce HAS and its hyaluronic acid product.
BRIEF SUMMARY OF THE INVENTION
The present invention involves the application of recombinant DNA
technology to solving one or more problems in the art of hyaluronic acid (HA)
preparation. These problems are addressed through the isolation and use of
a nucleic acid segment having a coding region encoding an enzymatically active
hyaluronate synthase (HAS) gene, a gene responsible for HA chain biosynthesis,
such as a HAS gene from Group A or C Streptococcus, Pasteurella multocida,
Sulfolobus solfataricus, Xenopus laevis and Ectocarpus siliculosus virus. The
HAS genes disclosed herein were cloned from DNA of an appropriate microbial
source and one or more mutations were engineered therein to provide HAS
enzymes with novel or modi>=ted kinetic or enzymatic activities.
The terms "hyaluronic acid synthase", "hyaluronate synthase",
"hyaluronan synthase" and "HA synthase", are used interchangeably herein to
describe an enzyme that polymerizes a glycosaminoglycan polysaccharide chain
19
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
composed of alternating glucuronic acid and N-acetylglucosamine sugars, ~3 1,3
and ~i 1,4 linked. The term "seHAS", for example, describes the HAS enzyme
derived from Streptococcus equisimilis, wherein expression of the gene
encoding the seHAS enzyme correlates with virulence of Streptococcal Group
A and Group C strains by providing a means of escaping phagocytosis and
immune surveillance.
SUMMARY OF INVENTION
The present invention is directed to a functionally active hyaluronan
synthase having at least one modified amino acid residue therein as compared
to a corresponding functionally active native hyaluronan synthase. The term
"modified amino acid residue" as used herein will be understood to include
mutated amino acid residues as well as other modifications to amino acid
residues, including but not limited to post-translational modifications of the
amino acid residue, such as. phosphorylations, glycosylations, methylations,
prenylations, and the like. When the amino acid residue is modified by
mutation, the mutation may arise by random mutagenesis or targeted or "site
directed" mutagenic techniques. For example, it may be desired to target a
specific amino acid residue of the hyaluronan synthase to determine if a
specific
property of enzyme is affected. In particular, it may be desired to target one
or more Cysteines of the hyaluronan synthase to determine its involvement in
disulfide bond formation or enzymatic activity of the hyaluronan synthase.
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Alternatively, one may randomly mutagenize the gene encoding hyaluronan
synthase and then screen or select for hyaluronan synthase mutants that
produce altered amounts of HA as compared with the corresponding wild type
HAS (that is, larger or smaller amounts of HA), or for hyaluronan synthase
mutants that produce HA having an altered size as compared with HA produced
by the corresponding wild type HAS (i.e., larger or smaller HA), without
regard
for the amino acids) that are mutated.
In one embodiment of the present invention, the corresponding
functionally active hyaluronan synthase is selected from the group consisting
of spHAS, seHAS, suHAS, and pmHAS. The corresponding functionally active
hyaluronan synthase may have an amino acid sequence essentially as set forth
in at least one of SEQ ID NOs:2, 4, 6, 8, 10, 12 and 14.
In another embodiment of the present invention, at least one of the
modified target amino acid residues is a cysteine and thereafter is modified
to
an alanine or serine residue. In a different embodiment, the functionally
active
hyaluronan synthase having at least one modified target amino acid residue
therein has an amino acid sequence comprising at least one SEQ ID Nos:15-92.
Additionally, the present invention relates to a functionally active
hyaluronan synthase having an altered enzymatic activity as compared to a
corresponding functionally active native hyaluronan synthase. The term
"altered enzymatic activity" as defined herein will be understood to refer to
2i
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
increased or decreased enzymatic activities, or activities that are
enzymatically
faster or slower than the native enzyme. In addition, the term "altered
enzymatic activity" as used herein will also be understood to include enzymes
that produce HA products having an altered size, that is, an HA polymer that
has a an average molecular mass that is greater or less than the average
molecular mass of an HA polymer produced by the native enzyme.
In a different embodiment of the present invention, the functionally active
hyaluronan synthase having an altered enzymatic activity is selected from the
group consisting of spHAS, seHAS, suHAS and pmHAS and has at least one
modified target amino acid residue therein as compared to a corresponding
functionally active native hyaluronan synthase. Further, in this embodiment of
the invention, at least one of the modified target amino acid residues is a
cysteine. The at least one modified target amino acid residue is modified to
an
alanine or a serine residue. Further, the functionally active hyaluronan
synthase having at least one modified target amino acid residue therein has an
amino acid sequence essentially as set forth in at least one of SEQ ID NOs:l5-
92.
Additionally, the present invention relates to a host cell having a
functionally active hyaluronan synthase having an altered enzymatic activity
as
compared to a corresponding functionally active native hyaluronan synthase
incorporated therein such that the host cell is capable of producing
hyaluronan.
22
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
In a separate embodiment of the present invention, the functionally active
hyaluronan synthase having an altered enzyme activity is selected from the
group consisting of spHAS, seHAS, suHAS, and pmHAS. Further, the
functionally active hyaluronan synthase has at least one modified target amino
acid therein as compared to a corresponding functionally active native
hyaluronan synthase. The at least one modified target amino acid residue is a
cysteine and thereafter is modified to an alanine or a serine residue. The
functionally active hyaluronan synthase has an amino acid sequence essentially
as set forth in at least one of SEQ ID NOs:l5-92.
Further, the present invention relates to a functionally active hyaluronan
synthase having an amino acid sequence comprising SEQ ID NOs:l5-92. Also,
the present invention relates to a functionally active hyaluronan synthase
having an amino acid sequence as essentially set forth in SEQ ID NOs:lS-92.
Moreover, the present invention is directed to a method of providing a
functionally active hyaluronan synthase having an altered enzymatic activity
as
compared to a corresponding functionally active native hyaluronan synthase.
The method includes providing a hyaluronan synthase and modifying at least
one target amino acid residue of the hyaluronan synthase to provide a
functionally active hyaluronan synthase having an altered enzymatic activity.
In a separate embodiment of the present invention, the hyaluronan synthase
is selected from the group consisting of spHAS, seHAS, suHAS; and pmHAS and
23
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
the at least one modified target amino acid residue is a cysteine. The target
amino acid residue may thereafter be modified to an alanine or serine residue
or any other desired residue. The functionally active hyaluronan synthase
having an altered enzymatic activity has an amino acid sequence essentially as
set forth in at least one of SEQ ID NOs:15-92.
In addition, the present invention is related to a method for producing
hyaluronic acid. The method includes providing a host cell having at least one
expression construct comprising a hyaluronan synthase gene encoding a
functionally active hyaluronan synthase incorporated therein such that the
host
cell is capable of producing hyaluronan, wherein the functionally active
hyaluronan synthase has an altered enzymatic activity as compared to a
corresponding functionally active native hyaluronan synthase. The host cell is
then cultured under conditions appropriate for the production of hyaluronic
acid.
The method may further include separating the hyaluronic acid from the host
cell. The altered enzymatic activity of the functionally active hyaluronan
synthase may be an increased or decreased enzymatic activity, or the
hyaluronan synthase may produce hyaluronic acid having an average molecular
mass that is greater than or less than an average molecular mass of hyaluronic
acid produced by a corresponding functionally active native hyaluronan
synthase.
The corresponding functionally active native hyaluronan synthase may
24
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
have an amino acid sequence essentially as set forth in at least one of SEQ ID
NOs:2, 4, 6, 8, 10, 12 and 14, while the functionally active hyaluronan
synthase
having an altered enzymatic activity may have an amino acid sequence
essentially as set forth in at least one of SEQ ID NOs:lS-92. The functionally
active hyaluronan synthase having an altered enzymatic activity may have at
least one modified amino acid residue therein as compared to the corresponding
functionally active native hyaluronan synthase, and the at least one modified
amino acid residue may be a Cysteine that is modified to a Serine or Alanine.
In another embodiment of the method of producing hyaluronic acid, the
expression construct may further include at least one gene encoding an enzyme
for synthesis of a hyaluronic acid sugar precursor. Optionally, the gene
encoding an enzyme for synthesis of a hyaluronic acid sugar precursor may be
present on a separate expression construct or may be chromosomally
integrated. The enzyme for synthesis of a hyaluronic acid sugar precursor is
selected from the group consisting of a pyrophosphorylase, a transferase, a
mutase, a dehydrogenase, or an epimerase, capable of producing UDP-GIcNAc
or UDP-GIcUA.
In another embodiment of the method of producing hyaluronic acid, at
least one biosynthetic pathway gene of a hyaluronic acid sugar precursor or at
least one gene encoding an enzyme for synthesis of a hyaluronic acid sugar
precursor may be provided, either in the same or different expression
construct
2s
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
or chomosomally integrated into the host cell. In a further alternative
embodiment of the method of the present invention, the hyaluronic sugar
precursors may be expressed in the host cell by endogenous genes of the host
cell.
In another embodiment of the method of producing hyaluronic acid,
nutrients utilized for a hyaluronic acid sugar precursor biosynthetic pathway
or
nutrients supplying the hyaluronic acid sugar precursor biosynthetic pathway
are fed or supplied to the host cell.
BRIEF DESCRIPTION OF THE SEVERAL VIEWS OF THE DRAWINGS
FIG. 1. General conservation of four cysteines in seHAS within the Class
I HAS protein family. The HAS protein sequences (and their accession numbers)
shown are: Streptococcus equisimilis (seHAS, AAB87874, SEQ ID N0:2);
Streptococcus uberis (suHAS, CAB46918, SEQ ID N0:6); Streptococcus
pyogenes (spHAS, AAA17981, SEQ ID N0:4); chicken (ggHAS2, AF106940_1);
mouse (mmHASi, BAA11654; mmHAS2, AAC53309; mmHAS3, AAC53128);
human (hsHASI, NP_001514; hsHAS2, NP_005319; hsHAS3, AF232772_1);
rabbit (ocHAS2, BAB63264; ocHAS3, BAB63265); bovine (btHAS2, CAA06239);
rat (rnHAS2, NP_037285); chlorella virus (cvHAS2, AF113757_1) and frog
(xIHASl, AF106940). The sequences were aligned using the DNAsis multiple
alignment program (v4.0). Cys residues including the four in seHAS that are
26
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
conserved in all three streptococcal enzymes, are in boldface. The bars
highlight the sequence regions of these four conserved Cys residues within the
larger HAS family. Residues that are identical in the three HASs and in some
of
the other family members are highlighted in dark gray: Residues in seHAS
conserved among all other HAS family members are highlighted in light gray.
Conserved residues that are within the active sites of all ~-
glycosyltransferases
are indicated by a dot.
FIG. 2. Effect of NEM concentration and incubation time on the activity of
seHAS and spHAS. Panel A: E, coli membranes containing recombinant seHAS
or spHAS were incubated at 4°C for 1 h with Phosphate Buffered Saline
(PBS)
alone (minus N-ethylmaleimide (NEM) control) or PBS containing different
concentrations of NEM. The unreacted NEM was quenched by addition of
dithioerythritol (DTE) to a final concentration of 1-6 mM and the samples were
assayed for HAS activity as described hereinafter. Panel B: The effect of
incubation time on seHAS and spHAS activity was assessed by incubating the
membranes with 5 mM NEM at 4°C for the indicated times. Aliquots were
removed into assay buffer containing 5 mM DTE, and HAS activities were
determined. HAS activity in control untreated membranes was stable for 1 h at
4°C. The inhibition of HAS activity is expressed as percent relative to
the
controls.
FIG. 3. Effect of NEM or sodium arsenite treatment on the utilization of
2~
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
UDP-GIcUA and UDP-GIcNAc by wild-type seHAS. E. coli membranes
containing seHAS protein were incubated at 4°C for 1 h in PBS
containing S mM
NEM or 10 mM Sodium Arsenite (SodArs), and the control membranes were
incubated with PBS alone. Michaelis-Menten constants (Km) were calculated
from the activities of seHAS at varying concentrations of UDP-GIcUA or UDP-
GIcNAc.
FIG. 4. Relative enzyme activities of the Cys-to-Ala or Cys-to-Ser single
Cys-mutants of seHAS. Membranes from E. coli (SURE) cells expressing either
wild-type seHAS or the indicated single Cys-mutants of seHAS were assayed for
HAS activity under linear conditions with respect to time and protein
concentration, and the amount of HAS protein expressed in each membrane
preparation was determined as described hereinafter. The normalized seHAS
specific activities.were calculated as nmol of UDP-GIcUA incorporated per pmol
of HAS per hour. The specific activities of seHAS mutants are given as a
percent
relative to wild-type activity as 100%.
FIG. 5. Relative enzyme activities of the Cys-to-Ala multiple Cys-mutants
of seHAS. Membranes expressing wild-type seHAS, the indicated multiple Cys-
mutants of seHAS or the seHAS'''S-""° were assayed and normalized as
described
in FIG. 4.
FIG. 6. Substrates protect triple Cys-mutants of seHAS from inactivation
by NEM. E. coli membranes containing the indicated triple Cys-mutant of
28
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
seHAS (each with a single remaining Cys residue) were treated at 4°C
for 10
min with no additions (control; 100% values) or with 5 mM NEM alone and in
the presence of either UDP, UDP-GIcUA or UDP-GIcNAc. Unreacted Nem was
then quenched and HAS activity was determined. Results are not shown for the
mutant containing only Cys36', since NEM inactivation of this mutant is N10%
and all values were essentially identical.
FIG. 7. Relative sizes of HA synthesized by wild-type seHAS and the Cys-
mutants of seHAS. E. coli membranes containing wild-type or the 19 Cys-
mutants of seHAS were incubated with UDP-[14C]GIcUA and the other
components described hereinafter for the assay of HAS activity. The 14C-
labeled
HA products were then recovered and analyzed by agarose gel electrophoresis
and autoradiography as described hereinafter. The molecular weight markers
used were the indicated DNA fragments of defined length (kb). A 7 kb DNA
fragment corresponds to an HA molecular weight of approximately 106 (32).
SeHAS variants shown are as follows. Panel A: Lane 1,C226A; Lane 2, C262A;
Lane 3, C281A; Lane 4, C367A; Lane 5, wild-type; lane 6, C226S; Lane 7,
C262S; Lane 8, C281S; Lane 9, C367S. Panel B: Lane 1, C(226,262)A; Lane
2, C(226,281)A; Lane 3, C(226,367)A; Lane 4, C(262,Z81)A; Lane 5,
C(262,367)A; Lane 6, C(281,367)A; Lane 7, wild-type; LaneB, (03C)C262; Lane
9, (o3C)CZ81; Lane 10, (o3C)C36'; Lane 11, seHAS'YS-~~n; Lane 12, (o3C)CZZS_
FIG. 8. Reactivity of 14C-NEM with the Cys-to-Ala double mutants of
29
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
seHAS. E. ~oli membranes containing wild-type or double Cys-mutants of seHAS
were incubated in two separate experiments (panels A and B) with 2.5 mM'4C-
NEM (8x 106 dpm) at 4°C for 10 min. The excess of 14C-NEM was
quenched by
addition of 40 mM DTE and incubation for 5 min at 4°C. Trichloroacetic
acid was
added to a final concentration of 10%, and the samples were incubated at
4°C
overnight. The membrane pellet was washed by centrifugation 3 times with 5%
TCA, suspended in 20 NI of Laemmli sample buffer (33) and neutralized with
sodium hydroxide. The samples were heated at 95°C for 3 minutes and
subjected to SDS-PAGE. The gels were processed and analyzed as described
hereinafter.
FIG. 9. MALDI-TOF mass spectrographs of seHAS-His6 derivatives
covalently modified by a sulfhydryl reagent. Wild-type seHAS-His6 (panel A)
or seHAS-His6'ys-"~° (panel B) were incubated with (the upper traces in
each
panel) or without (lower traces in each panel) biotin-PEO-maleimide, and the
eluted proteins were then prepared for mass analysis as described hereinafter.
The predicted mass-to-charge ratios for covalent adducts containing 2, 3 or 4
biotin-PEO-maleimide groups per wild-type enzyme molecule (in parentheses)
and the observed centroid mass-to-charge ratios are indicated above the peaks.
The predicted m/z ratio for the (MH)+ ion of unmodified SeHAS~ys-
"~°_His6 (with
four Ala residues replacing the four Cys residues) is 48,473.1.
FIG. 10. Kinetic analysis of UDP-GIcUA utilization by Cys-mutants of
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
spHAS. Membranes prepared from cells expressing the indicated spHAS mutant
were assayed as described hereinafter to assess the Michaelis-Menton constants
forUDP-GIcUA: wildtype (O), C(124,366,402)A(~), C(124,261,280,366,402)A
(~), and the Cys-null mutant (O).
FIG. 11. Hill analysis of UDP-GIcNAc utilization by Cys-mutants of spHAS.
Hill plots of data obtained from Km assays of wildtype and several mutant
spHAS
proteins, performed as in FIG. 10, demonstrate that the cooperative nature of
UDP-GIcNAc utilization is not affected by alteration of Cys residues. The
spHAS
variants shown are: wildtype (~), C(124,366,402)A (1),
C(124,261,280,366,402)A (~), and the Cys-null mutant (O).
FIG. 12. Inhibition of wildtype and Cys-mutants of spHAS by NEM. The
activity of the indicated spHAS enzymes in membranes was assessed after
pretreatment with (gray bars) or without (black bars) 20 mM NEM at room
temperature for 90 min. Wildtype and many of the Cys-mutant variants of
spHAS with multiple Cys residues mutated are still sensitive to NEM
inhibition.
The mutant containing only one Cys residue at CysZZS and the Cys-null mutant
were not sensitive to NEM inhibition.
FIG. 13. MALDI-TOF mass spectrographs of spHAS-His6 covalently
modified by a sulfhydryl reagent. Wildtype spHAS-His6 (panel A) or the Cys-
null mutant of spHAS-His6 (panel B) were bound to Ni+2 -NTA resin, washed and
incubated for 2 h at 4 °C with (the upper traces in each panel) or
without (lower
31
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
traces in each panel) 10 mg/ml biotin-PEO-maleimide. The columns were
washed and the proteins were then eluted and prepared for mass analysis as
described hereinafter. The centroid mass-to-charge ratios are indicated above
the observed peaks and the predicted mass-to-charge ratios for covalent
adducts containing 2, 3, 4, 5 or 6 biotin-PEO-maleimide groups per wildtype
enzyme molecule are indicated in parentheses. The predicted m/z ratio for the
(MH)+ ion of unmodified spHAS~ys-n~n_HiS6(With six Ala residues replacing tha
six
Cys residues) is 48,484.4.
FIG. 14. Alignment of seHAs, spHAS and suHAS sequences (FIG. 14A),
and topological organization of spHAS and probably all Class I HASs (FIG.
14B).
Membrane domains (MDs) are numbered 1-6 starting from the N-terminus.
FIG. 15. Activity of seHAS mutants at K48 and E327. Panel A: the
sequence alignments show K48 of seHAS within MD2 (using the nomenclature
in FIG. 14). Note that seHAS and spHAS contain 417 and 419 amino acids,
respectively, and their numbering is not identical. The analogous position in
spHAS is also Lys, and in the eukaryotic HASs this is a conserved polar
residue:
Gln, which could be involved in one or more H-bonds. MD4 contains an
absolutely conserved Glu residue in the Class I HAS family, which is E327 in
seHAS. Alteration of either K48 or E327 to the opposite charged residue caused
substantial loss of HAS activity (FIG. 15B). Activity was normalized for HAS
expression as described herein. HAS activity is substantially rescued in the
32
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
"double-switch" mutant, in which K48E and E327K mutations have exchanged
the two charged residues at their respective positions.
FIG. 16. Size distributions of HA made by K48 and E327 mutants of
seHAS are different from wild type. Data supporting FIG. 16 is described
hereinafter in detail.
FIG. 17. The HA size distribution made by mutants of seHAS can be
altered. Membranes from wild-type seHAS (WT) and the seHAS(E327K/K48E)
double-switch (DS) mutant were incubated with 1 mM UDP-GIcNAc and UDP-
GIcUA for 1 h at 30°C as described by Tlapak-Simmons et al (1999).
Reactions
were terminated by chilling the samples on ice, centrifuging 20,OOOxg at
4°C for
20 min and adding EDTA to the supernatant to a final concentration of 40 mM.
Prior to GPC-MALLS analysis, samples were heated at 100°C for 1
min. GPC
fractionation was over TSK-GEL G4000PWX~ and then TSK-GEL G6000PWx~
columns (7.8 x 30cm) from TOSO BIOSEP (Montgomeryville, PA). The
chromatography buffer was 50 mM NaZHP04, pH 7.0, 150 mM NaCI and the flow
rate was 0.5 ml/min. MALLS is performed using a DAWN DSP Laser Photometer
with an Optilab DSP refractometer (WYATT Technology, Santa Barbara, CA).
DETAILED DESCRIPTION OF THE INVENTION
Before explaining at least one embodiment of the invention in detail, it is
to be understood that the invention is not limited in its application to the
details
33
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
of construction and the arrangement of the components set forth in the
following description or illustrated in the drawings. The invention is capable
of
other embodiments or of being practiced or carried out in various ways. Also,
it is to be understood that the phraseology and terminology employed herein
is for the purpose of description and should not be regarded as limiting.
As used herein, the term "nucleic acid segment" and "DNA segment" are
used interchangeably and refer to a DNA molecule which has been isolated free
of total genomic DNA of a particular species. Therefore, a "purified" DNA or
nucleic acid segment as used herein, refers to a DNA segment which contains
a Hyaluronate Synthase ("HAS") coding sequence yet is isolated away from, or
purified free from, unrelated genomic DNA of the source cell. Included within
the term "DNA segment" are DNA segments and smaller .fragments of such
segments and also recombinant vectors, including, for example, plasmids,
cosmids, phage, viruses, and the like.
Similarly, a DNA segment comprising an isolated or purified HAS gene
refers to a DNA segment including HAS coding sequences isolated substantially
away from other naturally occurring genes or protein encoding sequences. In
this respect, the term "gene" is used for simplicity to refer to a functional
protein, polypeptide or peptide encoding unit. As will be understood by those
in the art, this functional term includes genomic sequences, cDNA sequences
or combinations thereof. "Isolated substantially away from other coding
34
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
sequences" means that the gene of interest, in this case HAS, forms the
significant part of the coding region of the DNA segment, and that the DNA
segment does not contain large portions of naturally-occurring coding DNA,
such as large chromosomal fragments or other functional genes or DNA coding
regions. Of course, this refers to the DNA segment as originally isolated, and
does not exclude genes or coding regions later added to, or intentionally left
in,
the segment by the hand of man.
Due to certain advantages associated with the use of prokaryotic sources,
one will likely -realize the most advantages upon isolation of the HAS gene
from
prokaryotes. In particular, one may choose to utilize a Class I or Class II
HAS,
such as a Class I HAS from S. equisimilis or S. pyogenes, or a Class II HAS
from
P. multocida.
Streptococcus is subdivided taxonomically into Lancefield Groups based
on different cell wall carbohydrate antigens. There are 18 distinct groups,
but
the most common pathogens are A, B, C and D. Historically, the most common
pathogens are also often given specific species names, but the unified
Lancefield testing method is recognized as being a clear method of typing and
thus a useful classification scheme. Streptococcus species that may be
utilized
as the source of the HAS gene include Group A Streptococcus, such as S.
pyogenes and S. haemoiyticus, and Group C Streptococcus, such as S. equi, S.
equisimilis, S. zooepidemicus, S. uberis and S. dysgalactiae.
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
One such advantage of isolating the HAS gene from prokaryotes is that,
typically, eukaryotic enzymes may require significant post-translational
modifications that can only be achieved in a eukaryotic host. This will tend
to
limit the applicability of any eukaryotic HA synthase gene that is obtained.
Moreover, those of ordinary skill in the art will likely realize additional
advantages in terms of time and ease of genetic manipulation where a
prokaryotic enzyme gene is sought to be employed. These additional
advantages include (a) the ease of isolation of a prokaryotic gene because of
the relatively small size of the genome and, therefore, the reduced amount of
screening of the corresponding genomic library, and (b) the ease of
manipulation because the overall size of the coding region of a prokaryotic
gene
is significantly smaller due to the absence of introns. Furthermore, if the
product of the HAS gene (i.e., the enzyme) requires posttranslational
modifications, these would best be achieved in a similar prokaryotic cellular
environment (host) from which the gene was derived.
Preferably, DNA sequences in accordance with the present invention will
further include genetic control regions which allow the expression of the
sequence in a selected recombinant host. Of course, the nature of the control
region employed will generally vary depending on the particular use (e.g.,
cloning host) envisioned.
In particular embodiments, the invention concerns isolated DNA segments
36
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
and recombinant vectors incorporating DNA sequences which encode a HAS
gene, that includes within its amino acid sequence an amino acid sequence in
accordance with at least one of SEQ ID NOs:2, 4, 6, 8, 10, 12 and 14-92.
Moreover, in other particular embodiments, the invention concerns isolated DNA
segments and recombinant vectors incorporating DNA sequences which encode
a gene that includes within its amino acid sequence the amino acid sequence
of a HAS gene or DNA, and in particular to a HAS gene or cDNA, corresponding
to at least one of Streptococcus equisimilis HAS, Streptococcus pyogenes HAS,
Streptococcus uberis HAS, Pasteurella multocida HAS, Xenopus laevis HAS, and
Sulfoiobus solfataricus HAS. For example, where the DNA segment or vector
encodes a full length HAS protein, or is intended for use in expressing the
HAS
protein, preferred sequences are those which are essentially as set forth in
at
least one of SEQ ID NOs:2, 4, 6, 8, 10, 12 and 14-92.
Nucleic acid segments having HA synthase activity may be isolated by the
methods described herein. The term "a sequence essentially as set forth in
SEQ ID NO:X" or '~a sequence as set forth in SEQ ID NO:X" means that the
sequence substantially corresponds to a portion of SEQ ID NO:X and has
relatively few amino acids which are not identical to, or a biologically
functional
equivalent of, the amino acids of SEQ ID NO:X. The term "biologically
functional equivalent" is well understood in the art and is further defined in
detail herein, as a gene having a sequence essentially as set forth in SEQ ID
37
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
NO:X or comprising SEQ ID NO:X, and that is associated with the ability of
prokaryotes or eukaryotes to produce HA or a hyaluronic acid coat.
For instance, the seHAS and spHAS coding sequences are approximately
70% identical and rich in the bases adenine (A) and thymine (T). SeHAS base
content is A-26.71%, C-19.13%, G-20.81%, and T-33.33% (A/T = 60%),
whereas spHAS is A-31.34%, C-16.42%, G-16.34%, and T-35.8% (A/T =
67%). Those of ordinary skill in the art. would be surprised that the seHAS
coding sequence does not hybridize with the spHAS gene and vice versa,
despite their being 70% identical. This unexpected inability to cross-
hybridize
could be due to short interruptions of mismatched bases throughout the open
reading frames. The longest stretch of identical nucleotides common to both
the seHAS and the spHAS coding sequences is only 20 nucleotides. In addition,
the very A-T rich sequences will form less stable hybridization complexes than
G-C rich sequences. Another possible explanation could be that there are
several stretches of As or Ts in both sequences that could hybridize in a
misaligned and unstable manner. This would put the seHAS and spHAS gene
sequences out of frame with respect to each other, thereby decreasing the
probability of productive hybridization.
Because of this unique phenomena of two genes encoding proteins which
are 70% identical not being capable of cross-hybridizing to one another, it is
beneficial to think of the claimed nucleic acid segment in terms of its
function;
38
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
i.e. a nucleic acid segment which encodes enzymatically active' hyaluronate
synthase. One of ordinary skill in the art would appreciate that a nucleic
acid
segment encoding enzymatically active hyaluronate synthase may contain
conserved or semi-conserved substitutions to the sequences set forth in SEQ
ID NOs:2, 4, 6, 8, 10, 12 and 14-92, and yet still be within the scope of the
invention.
In particular, the art is replete with examples of practitioners ability to
make structural changes to a nucleic acid segment (i.e. encoding conserved or
semi-conserved amino acid substitutions) and still preserve its enzymatic or
functional activity. See for example: (1) Risler et al. "Amino Acid
Substitutions
in Structurally Related Proteins. A Pattern Recognition Approach." ). Mol.
Biol.
204:1019-1029 (1988); (2) Niefind et al. "Amino Acid Similarity Coefficients
for
Protein Modeling and Sequence Alignment Derived from Main-Chain Folding
Anoles." ). Mol. Biol. 219:481-497 (1991) [similarity parameters allow amino
acid substitutions to be designed]; and (3) Overington et al. "Environment-
Specific Amino Acid Substitution Tables: Tertiary Templates and Prediction of
Protein Folds," Protein Science 1:216-226 (1992) ["Analysis of the pattern of
observed substitutions as a function of local environment shows that there are
distinct patterns..." Compatible changes can be made.], the contents of each
being expressly incorporated herein by reference in their entirety.
These references and countless others indicate that one of ordinary skill
39
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
in the art, given a nucleic acid sequence, could make substitutions and
changes
to the nucleic acid sequence without changing its functionality. Also, a
substituted nucleic acid segment may be highly identical and retain its
enzymatic activity with regard to its unadulterated parent, and yet still fail
to
hybridize thereto.
The invention discloses nucleic acid segments encoding enzymatically
active hyaluronate synthases, such _ as seHAS, spHAS, suHAS, xIHAS and
pmHAS. Although seHAS and spHAS are 70% identical and both encode
enzymatically active hyaluronate synthase, they do not cross hybridize. Thus,
one of ordinary skill in the art would appreciate that substitutions can be
made
to the HAS nucleic acid segments listed in SEQ ID NOS: 1, 3, 5, 7, 9, 11 and
13
without deviating outside the scope and claims of the present invention.
Standardized and accepted functionally equivalent amino acid substitutions are
presented in Table I.
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
TABLE I
Amino Acid Group Conservative and Semi-
Conservative Substitutions
NonPolar R Groups Alanine, Valine, Leucine, Isoleucine,
Proline, Methionine, Phenylalanine,
Tr to han
Polar, but uncharged, R GroupsGlycine, Serine, Threonine, Cysteine,
As ara ine Glutamine
Ne ativel Char ed R Grou As artic Acid, Glutamic Acid
s
Positively Charged R Grou Lysine, Arginine, Histidine
s
Another preferred embodiment of the present invention is a purified
nucleic acid segment that encodes a protein in accordance with SEQ ID NOs:2,
4, 6, 8, 10, 12 and 14-92 further defined as a recombinant vector. As used
herein, the term "recombinant vector" refers to a vector that has been
modified
to contain a nucleic acid segment that encodes an HAS protein, or fragment
thereof. The recombinant vector may be further defined as an expression
vector comprising a promoter operatively linked to said HAS encoding nucleic
acid segment.
A further preferred embodiment of'the present invention is a host cell,
made recombinant with a recombinant vector comprising an HAS gene. The
preferred recombinant host cell may be a prokaryotic cell. In another
embodiment, the recombinant host cell is a eukaryotic cell. As used herein,
the
term "engineered" or "recombinant" cell is intended to refer to a cell into
which
41
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
a recombinant gene, such as a gene encoding HAS, has been introduced.
Therefore, engineered cells are distinguishable from naturally occurring cells
which do not contain a recombinantly introduced gene. Engineered cells are
thus cells having a gene or genes introduced through the hand of man.
Recombinantly introduced genes will either be in the form of a cDNA gene, a
copy of a genomic gene, or will include genes positioned adjacent to a
promoter
not naturally associated with the particular introduced gene.
The recombinant host cell may further contain at least one gene encoding
an enzyme for synthesis of a HA sugar precursor. The HA sugar precursor may
be selected from a pyrophosphorylase, a transferase, a mutase, a
dehydrogenase, or an epimerase, capable of producing UDP-GIcNAc or UDP-
GIcUA, or combinations thereof. The recombinant host cell may further contain
a biosynthetic pathway gene of a HA sugar precursor or an enzyme for
synthesis of a HA sugar precursor. These one or more genes may be present
on the same expression construct as the HAS gene or on separate expression
construct. Optionally, these genes may be chromosomally integrated, as
described in more detail hereinbelow.
Where one desires to use a host other than Streptococcus, as may be
used to produce recombinant HA synthase, it may be advantageous to employ
a prokaryotic system such as E. coli, Bacillus strains, Lactococcus sp., or
even
eukaryotic systems such as yeast or Chinese hamster ovary, African green
42
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
monkey kidney cells, VERO cells, or the like. Of course, where this is
undertaken it will generally be desirable to bring the HA synthase gene under
the control of sequences which are functional in the selected alternative
host.
The appropriate DNA control sequences, as well as their construction and use,
are generally well known in the art as discussed in more detail hereinbelow.
For example, in a preferred embodiment, the host cell may be a Bacillus cell,
such as a Bacillus subtilis or Bacillus licheniformis cell, and the vector
introduced therein contains a Bacillus-compatible promoter to which the has
gene is operably linked.
In a more preferred embodiment, the host cell is a Bacillus cell, such as
Bacillus alkalophilus, Bacillus amyloliquefaciens, Bacillus brevis, Bacillus
circulans, Bacillus clausii, Bacillus coagulans, Bacillus >irmus, Bacillus
lautus,
Bacillus lentus, Bacillus licheniformis, Bacillus metaterium, Bacillus
pumilus,
Bacillus stearothermophilus, Bacillus subtilis and Bacillus thuringienisis.
In preferred embodiments, the HA synthase-encoding DNA segments
further include DNA sequences, known in the art functionally as origins of
replication or "replicons", which allow replication of contiguous sequences by
the particular host. Such origins allow the preparation of extrachromosomally
localized and replicating chimeric segments or plasmids, to which HA synthase
DNA sequences are ligated. In more preferred instances, the employed origin
is one capable of replication in bacterial hosts suitable for biotechnology
43
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
applications. However, for more versatility of cloned DNA segments, it may be
desirable to alternatively or even additionally employ origins recognized by
other host systems whose use is contemplated (such as in a shuttle vector).
The isolation and use of other replication origins such as the SV40,
polyoma or bovine papilloma virus origins, which may be employed for cloning
or expression in a number of higher organisms, are well known to those of
ordinary skill in the art. In certain embodiments, the invention may thus be
defined in terms of a recombinant transformation vector which includes the HA
synthase coding gene sequence together with an appropriate replication origin
and under the control of selected control regions.
Thus, it will be appreciated by those of skill in the art that other means
may be used to obtain the HAS gene or cDNA, in light of the present
disclosure.
For example, polymerase chain reaction or RT-PCR produced DNA fragments
may be obtained which contain full complements of genes or cDNAs from a
number of sources, including other strains of Streptococcus, or from
eukaryotic
sources, such as cDNA libraries. Virtually any molecular cloning approach may
be employed for the generation of DNA fragments in accordance with the
present invention. Thus, the only limitation generally on the particular
method
employed for DNA isolation is that the isolated nucleic acids should encode a
biologically functional equivalent HA synthase.
Once the DNA has been isolated, it is ligated together with a selected
44
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
vector. Virtually any cloning vector can be employed to realize advantages in
accordance with the invention. Typical useful vectors include plasmids and
phages for use in prokaryotic organisms and even viral vectors for use in
eukaryotic organisms. Examples include pKK223-3, pSA3, recombinant
lambda, SV40, polyoma, adenovirus, bovine papilloma virus and retroviruses.
However, it is believed that particular advantages will ultimately be realized
where vectors capable of replication in both Lactococcus or Bacillus strains
and
E, coli are employed.
Vectors such as these, exemplified by the pSA3 vector of Dao and Ferretti
or the pATl9 vector of Trieu-Cuot, et al., allow one to perform clonal colony
selection in an easily manipulated host such as E. coli, followed by
subsequent
transfer back into a food grade Lactococcus or Bacillus strain for production
of
HA. These are benign and well studied organisms used in the production of
certain foods and biotechnology products. These are advantageous in that one
can augment the Lactococcus or Bacillus strain's ability to synthesize HA
through gene dosaging (i.e., providing extra copies of the HA synthase gene by
amplification) and/or inclusion of additional genes to increase the
availability of
HA precursors. The inherent ability of a bacterium to synthesize HA can also
be augmented through the formation of extra copies, or amplification, of the
plasmid that carries the HA synthase gene. This amplification can account for
up to a 10-fold increase in plasmid copy number and therefore the HA synthase
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
gene copy number.
Another procedure that would further augment HA synthase gene copy
number is the insertion of multiple copies of the gene into the plasmid.
Another
technique would include integrating the HAS gene and/or the sugar precursor
genes) into chromosomal DNA. This extra amplification would be especially
feasible, since the bacterial HA synthase gene size is small. In some
scenarios,
the chromosomal DNA-ligated vector is employed to transfect the host that is
selected for clonal screening purposes such as E. coli, through the use of a
vector that is capable of expressing the inserted DNA in the chosen host.
In another preferred embodiment, the HA synthase gene is introduced
into the host cell chromosome via homologous or heterologous recombination.
The has gene may be more stable in this configuration, especially without drug
selection. Various vectors may be employed to introduce the has gene into
Bacillus, such as pTLH or pKSV7, or into yeast, such as YIp211, or into animal
cells, such as pcDNA/FRT. The DNA is first introduced into the host cell by
transformation, transduction or electroporation. The DNA segment with the has
gene is then stably integrated into the host chromosome. For example, the
spHAS gene was used to repair a mutant Streptococcus chromosome by
transduction and integration; this operation resulted in HA production
(DeAngelis et al, 1993a).
Where a eukaryotic source such as dermal or synovial 1=Ibroblasts or
46
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
rooster comb cells is employed, one will desire to proceed initially by
preparing
a cDNA library. This is carried out first by isolation of mRNA from the above
cells, followed by preparation of double stranded cDNA using an enzyme with
reverse transcriptase activity and ligation with the selected vector. Numerous
possibilities are available and known in the art for the preparation of the
double
stranded cDNA, and all such techniques are believed to be applicable. A
preferred technique involves reverse transcription. Once a population of
double
stranded cDNAs is obtained, a cDNA library is prepared in the selected host by
accepted techniques, such as by ligation into the appropriate vector and
amplification in the appropriate host. Due to the high number of clones that
are
obtained, and the relative ease of screening large numbers of clones by the
techniques set forth herein, one may desire to employ phage expression
vectors, such as Agtil, ~gtl2, ~Gemll, and/or AZAP for the cloning and
expression screening of cDNA clones.
In certain other embodiments, the invention concerns isolated DNA
segments and recombinant vectors that include within their sequence a nucleic
acid sequence essentially as set forth at least one of in SEQ ID NOS:1, 3, 5,
7,
9, il, 13 or a variant thereof wherein the variant encodes an amino acid
sequence essentially as set forth in at least one of SEQ ID NOs:l5-92. The
term "essentially as set forth in SEQ ID NO:X" or "as set forth in SEQ ID
NO:X",
for example, is used in the same sense as described hereinabove and means
47
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
that the nucleic acid sequence substantially corresponds to a portion of SEQ
ID
NO:X, and has relatively few codons which are not identical, or functionally
equivalent, to the codons of SEQ ID NO:X. The term "functionally equivalent
codon" is used herein to refer to codons that encode the same amino acid, such
as the six codons for arginine or serine, and also refers to codons that
encode
biologically equivalent amino acids as set forth in Table I.
It will also be understood that amino acid and nucleic acid sequences may
include additional residues, such as additional N- or C-terminal amino acids
or
additional 5' or 3' nucleic acid sequences, and yet still be essentially as
set forth
in one of the sequences disclosed herein, so long as the sequence meets the
criteria set forth above, including the maintenance of biological protein
activity
where protein expression and enzyme activity are concerned. The addition of
terminal sequences particularly applies to nucleic acid sequences which may,
for example, include various non-coding sequences flanking either of the 5' or
3' portions of the coding region or may include various internal sequences,
which are known to occur within genes. In particular, the amino acid sequence
of the has gene product in eukaryotes appears to be 40% larger than that
found in prokaryotes, yet the prokaryotic and eukaryotic HASs display
essentially identical enzymologic abilities to synthesize HA.
Allowing for the degeneracy of the genetic code as well as conserved and
semi-conserved substitutions, sequences which have between about 40% and
48
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
about 80%; or more preferably, between about 80% and about 90%; or even
more preferably, between about 90% and about 99%; of nucleotides which are
identical to the nucleotides of SEQ ID NOS:1, 3, 5, 7, 9, 11, 13 or a variant
thereof wherein the variant encodes an amino acid sequence essentially as set
forth in at least one of SEQ ID NOs:lS-92 will be sequences which are
"essentially as set forth in SEQ ID NO:X" or "comprising SEQ ID NO:X".
Sequerices which are essentially the same as those set forth in SEQ ID NOS:1,
3, 5, 7, 9, 11, 13 or a variant thereof wherein the variant encodes an amino
acid sequence essentially as set forth in at least one of SEQ ID NOs:15-92 may
also be functionally defined as sequences which are capable of hybridizing to
a
nucleic acid segment containing the complement of SEQ ID NOs:I, 3, 5, 7, 9,
11, 13 or a variant thereof wherein the variant encodes an amino acid sequence
essentially as set forth in at least one of SEQ ID NOs:l5-92 under "standard
stringent hybridization conditions," "moderately stringent hybridization
conditions," "less stringent hybridization conditions,'' or "low stringency
hybridization conditions." Suitable "standard" or "less stringent"
hybridization
conditions will be well known to those of skill in the art and are clearly set
forth
hereinbelow. In a preferred embodiment, standard stringent hybridization
conditions or less stringent hybridization conditions are utilized.
The terms "standard stringent hybridization conditions," "moderately
stringent conditions," and "less stringent hybridization conditions" or "low
49
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
stringency hybridization conditions" are used herein, describe those
conditions
under which substantially complementary nucleic acid segments will form
standard Watson-Crick base-pairing and thus "hybridize" to one another. A
number of factors are known that determine the specificity of binding or
hybridization, such as pH; temperature; salt concentration; the presence of
agents, such as formamide and dimethyl sulfoxide; the length of the segments
that are hybridizing; and the like. There are various protocols for standard
hybridization experiments. Depending on the relative similarity of the target
DNA and the probe or query DNA, then the hybridization is performed under
stringent, moderate, or under low or less stringent conditions.
The hybridizing portion of the hybridizing nucleic acids is typically at least
about 14 nucleotides in length, and preferably between about 14 and about 100
nucleotides in length. The hybridizing portion of the hybridizing nucleic acid
is
at least about 60%, e.g., at least about 80% or at least about 90%, identical
to a portion or all of a nucleic acid sequence encoding a HAS or its
complement,
such as SEQ ID NO: 2 or 4 or the complement thereof. Hybridization of the
oligonucleotide probe to a nucleic acid sample typically is performed under
standard or stringent hybridization conditions. Nucleic acid duplex or hybrid
stability is expressed as the melting temperature or Tm, which is the
temperature at which a probe nucleic acid sequence dissociates from a target
DNA. This melting temperature is used to define the required stringency
so
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
conditions. If sequences are to be identified that are related and
substantially
identical to the probe, rather than identical, then it is useful to first
establish the
lowest temperature at which only homologous hybridization occurs with a
particular concentration of salt (e.g., SSC, SSPE, or HPB). Then, assuming
that
1% mismatching results in a 1°C decrease in the Tm, the temperature of
the
final wash in the hybridization reaction is reduced accordingly (for example,
if
sequences having >95% identity with the probe are sought, the final wash
temperature is decreased by about 5°C). In practice, the change in Tm
can be
between about 0.5°C and about 1.5°C per 1% mismatch. Examples of
standard
stringent hybridization conditions include hybridizing at about 68°C in
5x
SSC/5x Denhardt's solution/1.0% SDS, followed with washing in 0.2x
SSC/0.1% SDS at room temperature or hybridizing in l.BxHPB at about
30°C
to about 45°C followed by washing a 0.2-0.5xHPB at about 45°C.
Moderately
stringent conditions include hybridizing as described above in
5xSSC\5xDenhardt's solution 1% SDS washing in 3x SSC at 42°C. The
parameters of salt concentration and temperature can be varied to achieve the
optimal level of identity between the probe and the target nucleic acid.
Additional guidance regarding such conditions is readily available in the art,
for
example, by Sambrook et al., 1989, Molecular Cloning, A Laboratory Manual,
(Cold Spring Harbor Press, N.Y.); and Ausubel et al. (eds.), 1995, Current
Protocols in Molecular Biology, (John Wiley & Sons, N.Y.). Several examples of
si
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
low stringency protocols include: (A) hybridizing in 5X SSC, 5X Denhardts
reagent, 30% formamide at about 30°C for about 20 hours followed by
washing
twice in 2X SSC,0.1% SDS at about 30°C for about 15 min followed by
0.5X
SSC, 0.1% SDS at about 30°C for about 30 min (FEMS Microbiology
Letters,
2000, vol. 193, p. 99-103); (B) hybridizing in 5X SSC at about 45°C
overnight
followed by washing with 2X SSC, then by 0.7X SSC at about 55°C. ().
Biological Methods, 1990, vol. 30, p. 141-150); or (C) hybridizing in 1.8XHPB
at about 30°C to about 45°C; followed by washing in 1X HPB at
23°C.
Naturally, the present invention also encompasses DNA segments which
are complementary, or essentially complementary, to the sequence set forth
in SEQ ID NOs:I, 3, 5, 7, 9, 11, 13 or a variant thereof wherein the variant
encodes an amino acid sequence essentially as set forth in at least one of SEQ
ID NOs:lS-92. Nucleic acid sequences which are "complementary" are those
which are capable of base-pairing according to the standard Watson-Crick
complementarity rules. As used herein, the term "complementary sequences"
means nucleic acid sequences which are substantially complementary, as may
be assessed by the same nucleotide comparison set forth above, or as defined
as being capable of hybridizing to the nucleic acid segment of SEQ ID NOS:1,
3, 5, 7, 9, 11, 13 or a variant thereof wherein the variant encodes an amino
acid sequence essentially as set forth in at least one of SEQ ID NOs:lS-92.
The nucleic acid segments of the present invention, regardless of the
s2
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
length of the coding sequence itself, may be combined with other DNA
sequences, such as promoters, polyadenylation signals, additional restriction
enzyme sites, multiple cloning sites, epitope tags, poly histidine regions,
other
coding segments, and the like, such that their overall length may vary
considerably. It is therefore contemplated that a nucleic acid fragment of
almost any length may be employed, with the total length preferably being
lirriited by the ease of preparation and use in the intended recombinant DNA
protocol.
Naturally, it will also be understood that this invention is not limited to
the
particular nucleic acid and amino acid sequences of SEQ ID NOs:I, 3, 5, 7, 9,
11 or 13 (or a variant thereof wherein the variant encodes an amino acid
sequence essentially as set forth in at least one of SEQ ID NOs:15-92) and SEQ
ID NOS: 15-92, respectively. Recombinant vectors and isolated DNA segments
may therefore variously include the HAS coding regions themselves, coding
regions bearing selected alterations or modifications in the basic coding
region,
or they may encode larger polypeptides which nevertheless include HAS-coding
regions or may encode biologically functional equivalent proteins or peptides
which have variant amino acids sequences.
Sulfhydryl reagents inhibit the activity of seHAS and spHAS.
SeHAS is the smallest HAS protein (417 amino acids) and contains four
Cys residues. The four cysteines of seHAS are completely conserved among the
53
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
three prokaryotic HASs (excluding pmHAS) and are conserved positionally
among all the vertebrate HASs (FIG. 1). To explore the possible role of
cysteines in the function of HAS, the activities of seHAS and spHAS were
assayed in the presence of different sulfhydryl reagents (Table II). Almost
identical sensitivities were observed for the two enzymes. For example, seHAS
activity was inhibited >93% by methylmethanethiosulfonate (0.05 mM) and
N70% by NEM (5 mM), whereas IAA inhibited only 15%. Sodium arsenite and
5,5'-dithiobis-(2-nitrobenzoic acid) also inhibited each HAS activity. These
results indicate that one or more Cys residues are important for the overall
HA
synthesis activity of the seHAS and spHAS proteins. The inhibition of each HAS
by NEM was examined in more detail with respect to time of incubation and
NEM concentration (FIG. 2). Both seHAS and spHAS were inhibited in a
biphasic manner, with respect to incubation time or NEM concentration.
Although the extent of inhibition varied from experiment to experiment, a 60-
70% effect was typical. About half of the observed inactivation occurred at si
mM NEM, whereas the remaining inactivation occurred from 1-6 mM (Fig 2A).
Kinetically, there was a fast' initial inactivation and then a much slower
phase
of inhibition; again each of the phases involved about half of the affected
activity (FIG. 2B).
A potential complication in the above NEM studies is that the effects of a
sulfhydryl modifying reagent may be due to secondary effects caused by
54
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
modification of other molecules in the membranes being tested. Although this
possibility is highly unlikely, since seHAS is the only protein necessary for
HA
biosynthesis, the effect of sulfhydryl reagents on the seHAS Cys-null mutant
in
isolated membranes was also examined under the conditions shown in FIG. 3.
The activity of seHAS'ys-"~° was not affected (s 1%) by treatment with
NEM, IAA
or sodium arsenite, which eliminates the possibility that modified secondary
proteins in the membranes preparations were responsible for the altered HAS
activity.
ss
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Table II
Effect of different sulfhydryl reagents on seHAS or spHAS
activity.
E. coli membranes expressing the recombinant seHAS-H6 or spHAS-H6
proteins were incubated at 4°C for 1 h with PBS containing either 5 mM
NEM,
mM IAA, 0.5 mM 5,5'-dithiobis-(2-nitrobenzoic acid), 0.05 mM
methylmethanethiosulfonate, 10 mM sodium arsenite or no addition (control,
which was set as 100%). The remaining seHAS activity was then determined
in quadruplicate and expressed as % relative to the control. The mean values
and standard deviations are shown.
Inhibition
Sulfhydryl Reagent of HAS Activity
(% relative
to control)
seHAS spHAS
N-ethylmaleimide 70 t 4.8 60 t 3.5
Iodoacetic acid 15 t 6.0 13 t 5.4
5,5'-dithiobis-(2-nitrobenzoic 52 t 6.5 52 f 4.9
acid)
Methylmethanethiosulfonate 93 t 5.4 89 f 5.5
Sodium Arsenite 40 t 4.0 46 t 5.1
56
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Table III
Effect of NEM or sodium arsenite treatment on the utilization
of UDP-GIcUA and UDP-GIcNAc by wild-type seHAS
E. coli membranes containing seHAS protein were incubated at 4°C
for 1
h with PBS alone (control) or PBS containing 5 mM NEM or 10 mM sodium
arsenite. The activity of seHAS was determined in triplicate with varying
concentrations of UDP-GIcUA or UDP-GIcNAc as described in Materials and
Methods, and the Michaelis-Menten Constants (Km and Vmax) ~ standard errors
were calculated.
UDP-GIcUA UDP-GIcNAc
Control NEM Sodium Control NEM Sodium
Arsenite Arsenite
Km
85110 5715 67123 122130 82117 112138
(ELM)
Vmax
(nmol/ 14,93.6 7.32.2 9.5 t 14.93.6 7.32.2 9.5 f
1.1 1.1
N~9/h)
57
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Modification of the protein by NEM could affect any one or several of the
six discrete functions that HAS must perform in order to synthesize HA. In
order
to determine if one of the nucleotide-sugar binding sites was affected by NEM,
we examined the UDP-GIcUA and UDP-GIcNAc saturation profiles for treated and
untreated seHAS (FIG. 3 and Table III). The Km values for either UDP-GIcNAc
(FIG. 3A) or UDP-GIcUA (FIG. 3B) were not altered significantly by treatment
with NEM or sodium arsenite, whereas the maximum enzymatic velocity was
reduced by up to N70%.
Effect of site-specific Cys mutagenesis on the HA synthase activity of seHAS.
Site-specific Cys-to-Ala and Cys-to-Ser mutants of seHAS were made in
order to explore the possible functional role of each Cys residue in HAS
activity.
In all of the following kinetic studies using the wild-type (or native) and
mutant
seHAS proteins, the data obtained were normalized to the amount of intact
seHAS protein as described herein. The single Cys-to-Ala or Cys-to-Ser
mutants of seHAS had lower enzyme activities compared to the wild-type
enzyme, except for the C367A and C367S variants (FIG. 4 and Table IV). This
result indicates that Cysz26, Cysz6z and CysZ81 contribute to the catalytic
activity
of seHAS. The Km values for UDP-GIcUA of the C226A and C262A mutants were
higher when compared to the corresponding values for the C226S and C262S
variants. However, the Km values for UDP-GIcNAc were not quite as clear-cut.
The K~DP-GIcNAc value for the C226S mutant was higher than that of the C226A
ss
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
mutant, whereas the C262A and C281A mutant proteins both had higher K~DP-
GIcNAc values compared to the C262S and C281S variants. At the C367
position, similar Km values for each nucleotide-sugar were obtained for both
the
Ala and Ser mutants.
From these results it is shown that functional constraints are put on the
HAS enzyme by particular alterations of at least one of its Cys residues.
Since
the C226A and C226S mutants were the least active, Cys2z6 appears to be the
most important Cys residue for enzyme activity. The seHAS(C367A) variant
was actually more active than wild-type (N145%) and the seHAS(C367S)
variant was not significantly altered. In each of the four cases, the Cys-to-
Ala
change resulted in a variant with greater activity than the Cys-to-Ser change.
The least tolerated single Cys change was C226S; this mutant was inhibited
>90%.
All the possible Cys-to-Ala double mutants (C226,262A; C226,281A;
C226,367A; C262,281A; C262,367A; C281,367A) as well as the triple mutants
and the Cys-null mutant were constructed and examined. For simplicity, the
triple Cys-mutants are designated by a convention that indicates which of the
four Cys residues remains unaltered. For example, the triple mutant containing
C(226,281,367)A changes is seHAS(o3C)C26z, which has only one Cys at
position 262 as in the wild-type protein. The HA synthase activities of these
multiple-Cys seHAS mutants were then determined under saturating conditions
59
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
for each substrate and normalized to the amount of seHAS protein present in
the isolated membranes (FIG. 5). The least active double mutant was
C(226,262)A, which had only 2-3% of the specific activity of the wild-type
enzyme. All three double mutants, in which CysZZS was changed to Ala, had
lower activity compared to the other three double mutants. Two of the triple
mutants, seHAS(o3C)CZZ6 and seHAS(o3C)C26z were significantly more active
(N3-30 fold) than the other two triple mutants seHAS(o3C)C281 and
seHAS(v3C)C36'.
Surprisingly, the Cys-null seHAS mutant was more active than the two
least active triple Cys-mutants and two of the six double Cys-mutants (FIG.
5).
The decreased activities of the single and multiple Cys-mutants are consistent
with the inhibition of seHAS or spHAS by sulfhydryl reagents described above.
Based on the lower specific activities of most of these Cys-mutants, it was
concluded that no particular cysteine residue in seHAS is required for a
critical
step during HA synthesis. Nonetheless, these data also support the conclusion
that CysZZ6 and Cys262 may play a role, or at least influence, one or more of
the
six sub-activities required for the overall activity of HAS. At least the
alteration
or modification of these latter two residues hinders the enzyme and results in
apparently lower Vmax values.
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Table IV
Michaelis-Menton Constants for single Cys-Mutants of seHAS
Kinetic analyses were performed as described herein using membranes
prepared from E. coli SURE cells expressing the indicated seHAS variants. Hill
numbers for the wild-type seHAS and single Cys-mutants of seHAS ranged from
0.9 to 1.2 and none of the mutant values were significantly different from
wild-
type
seHAS Vmax Km for UDPGIcUAKm for UDPGIcNAc
MUTANTS (nmol/pmol/h)a ( ~ ( M)
WT 5.60 f 0.48 77 t 5 74 t 7
C226A 1.34 f 0.21 88 t 17 154 f 23
C226S 0.45 f 0.08 44 f 7 232 t 0.2'
'
C262A 3.36 t 0.26 146 t 41 186 f 26
C262S 1.56 f 0.05 96 t 10 153 ~ 0.5 '
C281A 3.36 t 0.37 40 t 9 130 t 12
C281S 2.29 t 0.40 56 t 0.6 98 f 11
C367A 8.17 (0.32 85 t 12 90 t 10
C367S 5.37 t 0.21 79 t 10 --~ 91 ~ 1.
~
a. All values were significantly different than wild-type (p 5 0.05) except
for C3675.
b. Significantly different from wild-type (p <_ 0.05)
c. Significantly different from wild-type (p S 0.005)
61
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Table V
Michaelis-Menton Constants for double Cys-Mutants of seHAS
Kinetic analyses were performed as described herein using membranes
prepared from E. coli SURE cells expressing the indicated seHAS variants.
seHAS (nmol/pmol/h)aKm for UDPGIcUAUDPGIcNAc H~11
MUTANT (~M) ( M) number
WT 5.6010.48 7715 7417 1.110.1
C226 262A 0.18 f 0.01' 134 f 27 b 650 t 66 1.8 f 0.2
'
C226 281A 1.51 t 0.42 53 f 5 108 t 4 b 1.0 f 0.1
C226 367A 0.84 t 0.03 79 t 19 149 t 13 1.1 t 0.1
' b
C262 281A 2.5Z t 0.19 113 t 40 298 t 39 1.5 t 0.1
'
C262 367A 4.20 t 0.44 121 t 3b 172 t 3 ' 1.4 f 0.2
b
(C281,367A)3.69 f 0.42 65 t 24 131 f 1 b 1 2 f 0
~ ~ 2
a. All values were significantly different than wild-type (p < 0.05)
b. Significantly different from wild-type (p < 0.05)
c. Significantly different from wild-type (p S 0.005)
62
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Table VI
Michaelis-Menton Constants for triple and quadruple Cys-Mutants of
seHAS
Kinetic analyses were performed as described herein using membranes
prepared from E. coli SURE cells expressing the indicated seHAS variants.
Km for Km for
MUTANTS Vmax UDPGIcUA UDPGIcNAc H~II
(nmol/pmol/h)a( M) ( M) number
WT 5.60 t 0.48 77 t 5 74 t 7 1.1 t
0.1
(03C)Czze 2.57 3: 0.22 81 3: 11 273 3= 21' 1.7 t
0.3
(03C)C26z 2.63 f 0.06 87 f 15 189 ~ 34 1.5 t
0.2
(03C)C28' 0.08 3: 0.02 109 f 7 453 3= 137 1.9 t
0.4'
(~3C)C36' 0.78 3= 0.02 120 3= 12 444 3= 46' 1.8 f
0.5
Cys null 0.95 1 0.05 210 3: 46 447 3= 31' 1.6 1
0.1'
a. All values were significantly different than wild-type (p S 0.05)
b. Significantly different from wild-type (p _< 0.05)
c. All values were significantly different from wild-type (p _< 0.005)
63
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Enzymatic Analysis of seHAS Cys-mutants.
To determine which sub-activities of seHAS might be altered by mutating
its Cys residues, kinetic analyses of the wild-type enzyme and all the Cys-
mutants were performed and their respective Km and VmaX values calculated
(Tables IV-VI). A comparison of the VmaX values for each of the single,
double,
and triple Cys-to-Ala mutants of seHAS verified that the least active mutants
were C(226,262)A and seHAS(o3C)CZ81 , with only N1-3% of the wild-type
activity (as suggested by the results in FIG. 5). The seHAS(C226S) mutant had
N10% of the wild-type activity (Table , IV). The C226A, C(226,367)A,
seHAS(~3C)C36' and Cys-null mutants had activities between 17-30% of wild-
type. The remaining eight seHAS Cys-mutants retained 40% or more of the
activity of wild-type seHAS. The only mutant (Table IV) that had a higher
activity than wild-type was seHAS(C367A).
The Km values for UDP-GIcUA for all the Cys-mutants (Tables IV-VI)
differed by no more than 2-3 fold from wild-type seHAS. For most of the Cys-
mutants, the Km values for UDP-GIcNAc also did not change dramatically (within
1-3 fold). These relatively modest changes indicate that the altered Cys
residues in these seHAS variants play a relatively minor role in how the
enzyme
binds and uses each nucleotide-sugar. However, some combinations of Cys-
mutations had more dramatic effects on nucleotide-sugar utilization. For
example, the K~DP-GIcNAC value for seHAS(o3C)ZZS was N4-fold higher (Table
VI).
64
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
The K~DP-GIcNAc values for the C(226,262)A mutant (Table V) and the
seHAS(v3C)Cz8l, seHAS(v3C)C36' and Cys-null mutants (Table VI) were even
more affected; they were N6-9 fold more than wild-type. These latter mutants
were clearly less efi=tcient in their utilization of UDP-GIcNAc than the wild-
type
seHAS. Interestingly, these mutants also had -Hill numbers > 1.5, compared to
a value of 1.0 for the wild-type enzyme, indicating that they had acquired a
new level of cooperativity in their utilization of UDP-GIcNAc. All of the
above
kinetic results indicate a potentially important, though not absolutely
essential,
role for Cyszzs and Cysz6z in seHAS activity.
Cysteine residues are not essential for HAS activity but are in or near
substrate
binding sites.
Although the 4 Cys residues in seHAS (positions 226, 262, 281 and 367)
are roughly conserved in all Class I HAS family members, the Cys-null mutants
of seHAs and spHAS are active, with minimal changes in their kinetics compared
to wild type. It is also shown here that neither HAS contains disulfide bonds.
To understand why these four cysteines are, nevertheless, largely conserved
within the Class I HASs, NEM sensitivity was examined (i.e., the time- and
dose-dependent inhibition) of all possible Cys-to-Ala mutants of seHAS.
Chemical modification studies of seHAS showed that Cys226, Cys262 and
Cys281 react with NEM, whereas Cys367 is not accessible. Substrate protection
studies comparing the wild-type and Cys-mutants indicated that NEM-reactive
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Cys226 and Cys262 are located in or near a substrate binding site(s), because
the presence of UDP-GIcUA or UDP-GIcNAc prevented inactivation by NEM.
Cys281 appears not to be within a UDP-sugar binding site, since the triple Cys-
mutant seHAS (~3C)C281 was not protected from NEM inhibition by UDP, UDP-
GIcUA or UDP-GIcNAc (FIG. 6). Since sodium arsenite, which can crosslink two
close Cys residues, similarly inhibited the double Cys-mutant seHAS
C(226,367)A and wild type-seHAS, it is believed that Cys281 and Cys262 are
very close (essentially vicinal) in the protein.
Relative size distributions of HA synthesized by various Cys-mutants of seHAS.
HASs from different species synthesize HA products with a characteristic,
and often different, distribution of sizes. To determine whether any of the
Cys-
mutants of seHAS synthesize HA having an altered size distribution, compared
to wild-type seHAS, agarose gel electrophoresis was used to fractionate the
radiolabelled HA products made by each variant enzyme (FIG. 7). The
majority of the single (FIG. 7A) and double Cys-mutants (FIG. 7B) synthesized
HA of essentially identical size compared to the wild-type enzyme. The C281A
and C367S single mutants and the C(262,281)A and C(281,367)A double
mutants made smaller products. Three of the four triple mutants (all except
seHAS(o3C)Cz81) and the Cys-null mutant made smaller HA products (FIG. 6B).
The smallest relative HA size distribution was made by the triple mutant
seHAS(o3C)CZZ6. Interestingly, the HA size distributions of the seHAS mutants
66
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
C(226)S, C(226,262)A and (o3C)CZ81 were similar to that of the wild-type
enzyme, even though these mutants had the lowest activity (1.4 -8 % of wild-
type), and therefore the lowest HA elongation rates. Overall, these results
clearly show that mutations of various combinations of Cys residues cause
seHAS to synthesize shorter HA chains than the wild-type enzyme, indicating
that Cys residues can influence the HA size distribution made by seHAS.
Assessment of disulfide bond formation in seHAS.
In order to understand the potential role of Cys residues in the function
of seHAS, it is necessary to determine if any of its four cysteines are
involved
in the formation of disulfide bonds. Two approaches were undertaken to
answer this question. In the first approach, E. coli membranes containing
recombinant seHAS were treated with 14C-NEM to determine whether the wild-
type or Cys-mutant seHAS proteins could be radio-labeled and then identified
by autoradiography following SDS-PAGE (FIG. 8). This NEM-reactivity was used
to indicate the presence of free cysteines, which are not involved in
disulfide
bond formation. Each of the six Cys-to-Ala double Cys-mutants of seHAS was
radiolabeled by '4C-NEM. The labeling was specific because the vector-alone
control and the Cys-null mutant did not show significant labeling. These
results
indicate that none of the Cys residues in seHAS are involved in disulfide
bonds.
A 31 kDa band, which was present in the mixture of NEM-labeled proteins from ,
the wild-type and several double-Cys mutants, could be a degradation product
67
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
of HAS, since it was not present in the vector-alone controls. Such a fragment
is expected to be inactive and illustrates the importance of normalizing the
kinetic data to the amount of intact HAS protein, as assessed by protein
staining of SDS-PAGE gels.
In the second approach to assess the presence of disulfide bonds, the
purified enzyme was treated with biotin-PEO-maleimide, and the modified
protein products were then analyzed by MALDI-TOF mass spectrometry (FIG.
9). For each biotin-PEO-maleimidyl group added, the mass of the seHAS
derivative increased 525.6 Da. The treated wild-type seHAS contained a
distribution of derivatized products with increased masses equal to the
addition
of one-to-four biotin-PEO-maleimide groups per seHAS (FIG. 9A). Most of the
proteins were modified by the addition of 3 or 4 groups, demonstrating that
the
enzyme has no disulfide bonds. The observed mass values for the three largest
adducts differed from the predicted values by <0.005%. The degree of
modification was only slightly higher when the wild-type seHAS was treated
with biotin-PEO-maleimide in the presence of 6 M guanidinium hydrochloride
(not shown). This latter result indicates that none of the four Cys residues
is
substantially buried in the native enzyme; they are all accessible to react
with
the relatively large modifying reagent. The seHAS~ys-"~~~ protein was also
treated
with biotin-PEO-maleimide, as a control, to verify that no derivitized enzyme
products could be formed in the absence of Cys groups (FIG. 9B). The result
68
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
confirms that the modifying reagent does not react with any other amino acid
side chains and is specific for Cys; no covalent adducts were formed with the
Cys-null protein.
Mutagenesis of Cys residues and expression of spHAS
To explore the possible presence of disulfide bonds and the functional
roles of the conserved Cys residues in the enzymatic activity of the S.
pyogenes
HAS, each of the six Cys residues in spHAS was mutated to Ser or Ala.
Subsequently, spHAS mutants with combinations of Cys-to-Ala changes were
produced by using site directed mutagenesis or restriction enzyme digestion
and ligation of HAS fragments from different mutants. Studies with crude
membranes, in which the enzyme activity of spHAS mutants were initially
normalized to total, membrane protein, indicated that alteration of some Cys
residues had a dramatic affect on HA production. For example, spHAS(C225A)
appeared to be nearly inactive, and spHAS(C261A) and spHAS(C280A) had less
than half the activity of wildtype. However, these initial impressions were
incorrect due to significant variations in the expression of spHAS protein
among
the various mutants.
Therefore, in order to normalize for the level of HAS protein expression,
a sensitive and quantitative Western blot-based assay was developed
(Heldermon, et al. 2001). Since all of the HAS constructs contain a C-terminal
His6 tag, which is efficiently recognized by a commercial anti-Hiss monoclonal
69
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
antibody, this antibody was used, after biotinylation, as the primary antibody
for analysis of Western blots followed by incubation with lzSI-streptavidin as
the
secondary reagent. Unlike standard Western analysis, this detection protocol
provides greater sensitivity as well as the ability to quantitate HAS protein
over
a much broader concentration range. The normalizations for HAS protein
expression were performed relative to known amounts of purified spHAS-His6
included in each analysis as internal standards. Based on the normalized
results, it was clear that spHAS(C225S) was expressed at the lowest level
relative to any of the other mutants, N 66% of wildtype (Table VII). The
protein
expression levels for the majority of single Cys-mutants were not
significantly
different than wildtype, although the spHAS(C124S) and spHAS(C261A)
variants may have been elevated by N35% (p N 0.05). Interestingly, most of
the multiple Cys-mutants as well as the Cys-null mutant were expressed at 3-
to-5 fold higher levels than the wildtype enzyme. These above differences in
relative expression of these spHAS variants were consistent in multiple
experiments, with independent cell growth and enzyme induction, indicating
that several of the Cys residues in spHAS, particularly the conserved Cys at
position 225, may influence the initial folding and stability of the enzyme.
Enzymatic Analysis of Mutants
Kinetic analyses of the single and multiple spHAS Cys-mutants were
performed to investigate the possibility that multiple Cys residues are
critical
~o
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
in a coordinated way for enzyme activity. The activity of each of the mutants
was assayed and normalized by the above method to determine its maximum
velocity (VmaX) and Michaelis-Menton (Km) constants for UDP-GIcUA and UDP-
GIcNAc (FIGS. 10 and 11; Table VIII). This analysis revealed no dependence of
HAS activity on,any single Cys residue. These assays also revealed no extreme
changes in maximal enzyme activity relative to wildtype spHAS. The
spHAS(C225S) and spHAS(C280A) mutants had the most reduced activities
with Vmax values at 30-50% of wildtype. The spHAS(C261,280A) and Cys-null
mutant had 50-75% of the wildtype activity. Interestingly,
spHAS(C124,366,402A) and spHAS(C366A) had an increased activity that was
N150% of wildtype. The other single mutants, as well as spHAS(C124,402A),
and spHAS(C124,261,280,366,402A) demonstrated less than a 25% variation
from the wildtype Vmax~
All the mutant spHASs were also within 25% of the wildtype enzyme for
their K~DP-GIcNAc values. There were no changes in the sigmoidal behavior for
UDP-GIcNAc utilization by any of the mutant enzymes. When these data were
analyzed using the method of Hill (1913), the Hill numbers were all N2 (Table
VIII), which indicates a high degree of cooperativity associated with the
ability
of all the mutant enzymes to bind and use UDP-GIcNAc at a fixed UDP-GIcUA
concentration. Thus, the cooperativity observed for the utilization of UDP-
GIcNAc by the spHAS enzyme (Tlapak-Simmons et al., 1999b) is not influenced
m
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Table VII
Expression levels of various Cys-mutants of spHAS.
Membranes prepared from E. coli SURE cells expressing the indicated
spHAS variants were fractionated by SDS-PAGE and the proteins were
transferred to nitrocellulose. SpHAS protein levels were quantitated as
described in Methods and the values were normalized to that of the wildtype.
Student t-tests were performed to assess the significance of differences
compared to the expression of the wildtype enzyme.
spHAS Construct Relative Standard n t-test
Concentration Deviation value
Wildtype 1.00 0.18 8 -
C124A 1.01 0.12 4 0.89
C124S 1.35 0.39 4 0.06
C225A 1.24 0.52 4 0.24
C225S 0.66 0.22 4 0.02
C261A 1.35 0.10 3 0.01
C261 S 1.16 0.14 4 0.16
C280A 1.04 0.25 4 0.73
C280S 1.30 0.42 4 0.10
C366A 0.97 0.30 4 0.84
C366S 1.11 0.24 4 0.38
C402A 1.05 0.07 2 0.75
C402S 0.86 0.14 4 0.21
C( 124,402)A 0.82 0.33 6 0.21
C(261,280)A 3.20 1.48 6 <0.001
C(124,366,402)A 3.61 1.72 6 <0.001
C(124,261,280,366,402)A3.98 0.50 6 <0.0001
Cys-Null 4.94 1.08 6 <0.0001
72
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Table VIII
Kinetic constants for Cys-to-Ser/Ala mutants of spHAS.
The Vrt,aX values are in ~.mol of both substrates incorporated per hour per
pmol spHAS. The Km values for UDP-GIcNAc and UDP-GIcUA were determined
at 0.5 mM UDP-GIcUA and 1.5 mM UDP-GIcNAc, respectively. Experiments were
performed in duplicate or triplicate for the single or multiple Cys-mutants,
respectively. For the wildtype, n=7. Values that differ significantly, based
on
the Student t-test, from that of the wildtype enzyme are indicated by * (p <
0.05) or ** (p < 0.001).
spHAS ConstructVmax H~11
(umol/pmol/h)UDP-GIcUA UDP-GIcNAc Number
M M
Wildtype 791 t 215 50.4 t 10.8 398 t 112 I.8 t
0.1
C124A 617 1 132 37.3 f 10.1 458 f 60 1.8 1
0.1
C124S 584 t 176* 32.7 t 0.6 459 t 8.0 1.8 t
0.1
C225A 852 t 306 62.2 t 4.1 372 f 26.5 1.8 f
0.1
C225S 366 t 37** 42.7 t 4.6 464 1.7
C261A 923 t 173 42.6 ' 454 t 2.0 t
6.5 0.1
C261S 764 f 103 45.6 499 t 7.0 1.9 f
0.1
C280A 264 t 147** 33.8 t 9.7 344 t 45.5 1.7 f
0.1
C280S 680 t 90 29.4 f 1.6* 325 f 9.0 1.8 t
0.1
C366A 1201 t 154** 56.8 t 12.8 397 t 1.5 1.8 t
0.0
C366S 721 f 121 34.1 f 2.9 472 t 4.5 1.8 f
0.0
C402A 969 t 163 43.8 f 9.2 427 t 20.5 1.8 f
0.0
C402S 774 t 98 44.4 t 9.4 443 t 35.5 1.8 f
0.0
C( 124,402)A 894 t 306 39.5 t 7.0 330 f 38.8 1.9 t
0.1
C(261,280)A 436 t 105* 54.8 t 36.7 389 t 20.8 1.9 t
0.1
C(124,366,402)A1247 t 127** 130 f 21.6**285 t 4.5 1.8 t
0.2
C(124,261,280,
702 f 112 101 f 24.1* 471 3= 20.81.9 f
366,402)A 0.1
Cys-Null 522 f 47* 153 t 39.3**450 t 40.7 1.8 f
0.1
73
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
by, or dependent on, any of its six Cys residues. Similarly, none of these Cys
residues contribute structurally, or otherwise, to a possible secondary
binding
site for UDP-GIcNAc, i.e. an allosteric binding site.
The K~DP-GIcUA values for all of the single Cys-mutants and the two double
Cys-to-Ala mutants were within 50% of wildtype. The remaining multiple Cys-
to-Ala mutants exhibited K~pP-~~~uA values that were 2-3 times that of
wildtype.
Although these multiple Cys-mutations do alter the activity of the enzyme by
decreasing the efficiency of utilizing UDP-GIcUA, they do not do so in a large
way. Furthermore, the relatively modest difference in activity between the Cys-
null mutant and wildtype spHAS clearly shows that cysteine residues are not
absolutely necessary for HA synthesis, either catalytically or structurally.
Inhibition of spHAS activity by NEM
NEM treatment of membranes from a panel of multiple Cys-mutants
showed that this inhibition was no longer present in SpHAS~''s-"u~~ or the
mutant
with only CysZZS intact, whereas NEM sensitivity remained in the other
multiple
Cys-mutants (FIG. 12). These results indicate that the inhibition of the
wildtype
enzyme by NEM or other sulfhydryl/reactive agents is most likely due to
modification of the Cys residues alone, rather than the loss of the S-H group.
The lack of inhibition of the single Cys-containing mutant demonstrates that
Cys225 is either predominantly inaccessible to modification by NEM due to its
74
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
position in the enzyme or that this particular cysteine residue is not
involved in
the inhibition response of the enzyme when modified by NEM.
Assessment of disulfide bond formation
Although Cys residues may not be required for the enzymatic activity of
the HAS proteins, they could still be important in the structural integrity
and
long-term stability of the enzyme as indicated by the reduced expression of
the
spHAS(C225S) mutant and the increased expression of the spHAS(C124S) and
spHAS(C261A) mutants (Table VII). Cys residues may also be important for
maintaining the proper enzyme conformation to allow extrusion of the growing
HA chain through the membrane. The primary manner in which Cys residues
play structural roles in proteins is by forming either inter- or intra-
molecular
disulfide bonds. To investigate the possibility of disulfide bonds in spHAS, a
chemical labeling approach was utilized to determine the number of Cys
residues that are free and, therefore, could not be involved in disulfide
bonding.
Biotin-PEO-maleimide was allowed to react with puri>=fed spHAS, while bound to
a Ni+2-loaded NTA column, and the modified protein products were then
analyzed by MALDI-TOF mass spectrometry (FIG. 13). In nondenaturing
conditions, treated wildtype spHAS samples revealed a distribution of
derivatized products with increased masses equal to the addition of from one-
to-six biotin-PEO-maleimide groups per spHAS, with the majority of the protein
being modified by the addition of 5 or 6 groups (FIG. 13A). As a control for
this
~s
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
chemical modification approach, samples of SpHAS~ys-"~° were treated
with
biotin-PEO-maleimide in the same way to verify that no derivitized enzyme
products would be formed in the absence of Cys groups. The result (FIG. 13B)
demonstrates that no covalent adducts form with the Cys-null protein, which
confirms that the modifying reagent is specific for Cys and does not react
with
any other amino acid side chains. Treatment of the wildtype or Cys-null spHAS
proteins with biotin-PEO-maleimide in the presence of 6 M guanidinium
hydrochloride gave essentially the same results as obtained in the absence of
the denaturing agent, although the degree of modification was slightly greater
(not shown). This latter result indicates that spHAS contains no weak
disulfide
bonds that might be susceptible to reversible reduction when the protein is
denatured. The overall results demonstrate that there are no disulfide bonds
in the wildtype spHAS enzyme, and that there is a mixed degree of exposure
of the six Cys residues in this protein to the biotin-PEO-maleimide reagent in
solution.
Mutant HAS HA size range and prevalent size of HA.
Because spHAS mutants in which C280 was substituted with alanine
synthesized HA of a lower weight average mass than the spHAS wild type
enzyme, other amino acid substitutions were also examined (Table IX). For
example, the C280T and C280V mutants made HA with a larger size distribution
76
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
than the wild type, whereas the C280G mutant made HA that had a smaller
weight average mass than wild type.
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
TABLE IX
Mutant HAS HA Size Range and Prevalent Size
HA produced by mutants of spHAS and seHAS in one hour at saturating substrate
concentration were run on 1% agarose gels. Reactions were radiolabeled by
including UDP-
['4C]GIcUA in the reaction mix and HA product distribution was assessed with a
Molecular
Dynamics Phosphoimager. Size was estimated relative to High Molecular Weight
and Kb DNA
ladder standards. Distribution of product is reported as the percentage of
total counts (IDV)
between various size ranges. The prevalent HA size produced ("Peak Size") is
reported as the
approximate MW in MDa at which the greatest IDV intensity was located. MW
ranges are shown
as MDa and kbp of DNA in parentheses. C226A, C262A, C281A, and C367A are
mutants of
seHAS.
Mutant Peak Size <2 MDa 2-4 MDa 4-6 MDa >6 MDa
(MDa) (<3 Kb) (3-6 Kb) (6-9 Kb) (9->48.5
Kb)
WT (spHAS)2-3 33f5 2918 1212 2618
C280A ~1 65112 15f2 5f3 15f7
C280G ~1 58110 1715 5f2 1914
C2805 3-4 2714 4013 1313 21f3
C280T 8-32 1412 27f2 14f3 44f4
C280V 4-5 26f3 40f2 1413 21f6
C124S ~2 35 37 13 15
C124A ~-2 31 33 17 19
C2255 3-4 33 45 14 8
C225A 5-6 16 29 23 32
C261S 5-6 18 31 22 29
C261A 4-5 22 35 20 23
C3665 ~2 38 36 11 14
C402S 2-3 25 36 17 22
C402A ~~2 34 37 12 17
C402A ~-2 37 35 12 16
C124,402A1-2 38 0 12 20
seHAS 1-2 . 42121 25f7 1415 19f9
C226A ~-5 12f1 38f2 2310 27f1
C262A 1-2 48f0 28f1 9f0 15f1
C281A 1 5511 26f1 511 14f1
C367A ~3 15f1 62f0 4f1 19f2
78
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Targeted mutagenesis within two membrane domains ofseHAS and generation
of the "double switch" mutant.
There is a paradox in understanding how HASs polymerize long HA
chains. HA chains must be free to move through the enzyme at rapid rates as
they are elongated. Thus, one expects that the HA-binding ability of HAS would
not be a "high affinity" interaction, since a low off-rate would hinder chain
movement (i.e., translocation though the membrane). Yet, HA-binding
"affinity" cannot be very low because some chains are held for > 10,000 cycles
of HA disaccharide assembly and translocation before large HA chains (N4X106)
are released. It is expected that HAS possesses multiple HA-binding regions
whose interactions with the growing polymer must be made and broken in a
coordinated manner to enable the growing HA chain to translocate within the
enzyme without being released prematurely. FIG. 14A illustrates 5 motifs that
are putative HA-binding motifs of the type B-X,-B, where B is a basic amino
acid (i.e. Arg or l_ys) and X is any amino acid, as described by Yang et al.,
1994. It is anticipated that HAS utilizes two types of HA-binding regions; one
type that holds and orients the donor HA-UDP chain for assembly of the next
disaccharide unit and one type that holds the growing HA chain when it is
released from the former sites) and is translocated through the membrane.
Although there is no information about the possible HA-binding regions
within HAS, it is intriguing that motifs #2-5 are absolutely conserved in the
79
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
strepHASs and are generally conserved at these positions in the Class I HAS
family (i.e., conserved within the same general region of the primary
sequence). In addition, although motif #1 in suHAS contains Gln, rather than
Arg/Lys (which could still H-bond with HA), it is still a good candidate
motif,
because partial or "weaker" HA-binding motifs must be considered for the
reasons noted above. An overlapping motif at position #1 is highly conserved
in the Class I family. Further, complete conservation of HA-binding regions
within the Class I family are not expected because the three human HASs
intrinsically make HA of different sizes; this reflects the different
abilities of
HAS1, HAS2 and HAS3 to retain their HA chains. In particular, motif #4 (with
Asn rather than R/K) and motif #5 are conserved in all HASs, except the
chlorella enzyme.
The topological organization of spHAS and probably all Class I HASs is
shown in FIG. 14B. The experimentally determined topology of spHAS is similar
to that initially predicted except for two membrane domains (MD3 and MD6)
that are not transmembrane domains (TMDs). The N- and the C-termini and
the large central domain are intracellular. The first two TM Ds are ~3-sheets
(not
a-helices) and create a small extracellular loop that is inaccessible to
proteases.
MD3 within the large internal central domain is associated with, but does not
traverse, the membrane.
so
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
There are then two TMDs connected by a second small extracellular loop
that is also inaccessible to proteases. MD6, which has amphipathic helices, is
within the C-terminal 50 amino acids of spHAS and does not cross the
membrane. Numerous Mds may be required for HAS to create a pore-like
structure through which a growing HA chain can be extruded to the exterior.
Based on their similarities, all Class I HASs should have similar topological
organizations of their spHAS-related domains.
The presence in all Class I HASs of a possible charge/polar-pair between
two membrane domains was noted, and in seHAS, these residues are K48 and
E327 (indicated by the ovals in FIG. 14B and as seen in FIG. 15A). It is
believed that the two charged or polar residues form a salt bridge or strong H-
bond link that anchors MD2 (which traverses the membrane from outside to
inside) and MD4 (which traverses the membrane from inside to outside). A
series of site-directed mutants of seHAS were generated in which one or both
of these residues was changed either to destroy this putative interaction or
to
reverse the position of charged residues. Vmax values for these seHAS
mutants varied greatly (FIG. 15B). Since the "double switch" mutation
partially rescues the E327K mutant, the results support the idea that the two
residues interact with each other. Although most of the above seHAS mutants
were expressed, the level was reduced, indicating that the proteins do not
fold
correctly and are degraded, e.g., seHAS(E327K) had only N0.2% of wild-type
si
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
activity. However, creating a "double switch" mutant seHAS(K48E/E327K), in
which the charged residues were switched, restored HAS activity to N8% of
wild-type. These results, therefore, support the idea that K48 and E327
interact with each other and that MD2 and MD4 are close enough for these
residues to form an ion-pair or H-bonds.
Light scattering is routinely used to obtain important information that
complements the kinetic characterization of HAS variants. For example, a
current study uses E. coli membranes containing a HAS variant, to examine the
HA size produced by all the Cys-mutants of seHAS and spHAS. Analysis of HA
size is not as straightforward as one might expect, since it has been
discovered
that HA size distributions made by HAS can change slightly with time and are
surprisingly sensitive to HAS concentration - even under conditions of high
concentrations and kinetic linearity with time and protein. Kinetic analyses
assess the overall rates of sugar incorporation into HA regardless of size,
and
do not reflect changes in the size of the HA products being made. We are only
aware of this because GPC-MALLS analysis is so sensitive. The time-dependent
changes in HA size distribution are not surprising when one considers that the
HAS molecules present in a sample may need to go through several rounds of
chain synthesis before a steady-state size distribution is reached.
Additionally,
based on the changing ratio of substrates:HAS, very large chains are made at
early times when this ratio is the highest and smaller chains are made latter
as
s2
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
this ratio falls. The standard conditions utilized in the method of the
present
invention for comparing HA size differences by MALLS is that s 5% of the
substrates should be consumed, synthesis must be linear for >_ 2 h and the HA
size distribution observed should not change significantly over a several-fold
range of increasing protein concentration.
The seHAS(E327K) mutant has only N0.2% of wild-type activity.
However, creating a "double-switch mutant" seHAS(K48E/E327K), in which the
charged residues were switched, restored a significant level of HAS activity
(N8% of wilt-type). These results, therefore, suggest that Lys48 and GIu327
interact with each other and that MD2 and MD4 are close enough for these
residues to form an ion-pair or H-bonds. The interaction of K48 and E327
appears to be very important, perhaps critical, for enzyme activity. Further
supporting this conclusion is the very interesting result that the size
distribution
of HA produced by the double-switch mutant is shifted dramatically to smaller
size (Fig 15 and 16). Based on GPC-MALLS analysis the weight average mass
(Mw) for the mutant is 0.26 million compared to 2.8 million for wild-type
seHAS.
The HAS enzymes are unique in that they polymerize two sugars, GIcUA
and GIcNAc, in an alternate fashion and simultaneously extrude the growing HA
chain through the plasma membrane. The streptococcal HASs are the smallest
members of the Class I HAS family, and perform all the functions required for
83
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
HA synthesis and secretion from cells. Unlike the eukaryotic HAS enzymes,
with which they share substantial homology and probably an identical
topological organization in their common regions, the streptococcal enzymes
have been easier to study because they can be readily overexpressed, purified
and characterized. To date, only one eukaryotic enzyme, mouse HAS1, has
been overexpressed, purified and characterized kinetically.
The importance of Cys residues in seHAS and spHAS was initially focused
on for three reasons. First, Cys residues play important structural and
functional
roles in many proteins (e.g. 35). Second, the four Cys residues in seHAS at
positions 226, 262, 281, and 367 are completely conserved in the two other
streptococcal enzymes, suHAS and spHAS, and are generally conserved in all
the other eukaryotic HASs (FIG. 1). Finally, p-chloro-mercurobenzoate had
been reported to inhibit HA biosynthesis by the Group A spHAS in a cell-free
system (Sugahara et al., 1979). Although no further studies on the role of
sulfhydryls in HAS function had appeared since that report, it was important
to
investigate the possibility that Cys residues may be required for HAS
activity.
The present results demonstrate that a variety of sulfhydryl reagents
inhibit both the spHAS and seHAS enzymes. This inhibition could reflect an
important role of Cys in the function of these bacterial HAS proteins.
However,
interpretation of these results is complicated by the fact that Cys-
modification
creates two changes in the enzyme; the S-H group is eliminated but a new S-R
84
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
group is also introduced, where R depends on the sulfhydryl reagent used.
Because all the R groups are larger than the initial H, modified Cys residues
may create new steric constraints for particular enzyme functions such as
substrate binding. Alternatively, different degrees of HAS inhibition by
different
sulfhydryl reagents could indicate their different reactivity towards Cys
residues, which would depend upon their size, charge or polarity. The use of
site directed mutagenesis to alter the native Cys residues, while subject to
the
same concerns noted above, provides a complementary approach to determine
the importance of Cys residues in HAS function. Both approaches show that
although HAS activity is decreased by altering Cys residues, it is not
eliminated;
the completely modified seHAS and spHAS Cys-null enzymes were still able to
perform all of the functions needed for HA synthesis.
The experiments and results detailed herein demonstrate clearly that
neither the seHAS enzyme nor the spHAS enzyme contains any disulfide bonds.
It is reasonable to conclude, therefore, that the streptococcal HAS proteins
do
not have disulfide bonds. It may be more difficult to determine if the
eukaryotic
HAS proteins contain disulfide bonds, since these proteins are difficult to
purify
in high yield and contain more Cys residues (>_ 14) than the streptococcal
proteins.
All HAS enzymes make a broad size range of HA, rather than a discrete
size. This heterogeneity of product size may be important biologically for
ss
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
particular functions of the three vertebrate HAS enzymes. In addition, the HA
size distribution made varies among the streptococcal HASs and also among the
three mammalian HAS isoforms. These enzymatic differences in the size
distribution of HA products, which have only been observed in vitro (e.g. in
isolated cells or membrane preparations), could have very significant
biological
consequences if they also occur in vivo in various eukaryote cells and
tissues.
Numerous studies during the last decade have demonstrated that HA is not
simply a structural component of the extracellular matrices of most vertebrate
tissues, but also a cell signaling molecule capable of modifying important
aspects of cell behavior, including migration and adhesion. The most
interesting and surprising aspect of this new paradigm regarding the
biological
functions of HA is that many cells respond only if the HA is a specific size.
In
particular, small oligosaccharides of HA have very different biological
activities
than large, native-size HA.
An intriguing finding of the present invention is that some, but not all,
combinations of Cys-mutations in seHAS cause the enzyme to synthesize HA
products having an altered size. Eight of the 19 Cys-mutants examined
synthesized HA with an apparently normal distribution of sizes that were
shifted
to varying degrees to smaller mass. There was no apparent correlation
between changes in HA elongation rate (VmaX values) and HA size distribution
among these Cys-mutants. The least active seHAS variants, nonetheless, made
86
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
HA products that were similar in size to the HA made by the wild-type enzyme.
The agarose gel electrophoresis technique is very suitable for obtaining a
qualitative assessment of size differences. However, it is very difficult to
assess
the reliability of size assessments outside the narrow range in which
migration
is proportional to size. For example, several Cys-mutants (e.g. one each of
the
single, double and triple mutants in FIG. 7) may actually synthesize
substantially larger HA than wild-type but the migration differences compared
to wild-type are very small. For these reasons, a study to characterize the HA
size distributions of these seHAS mutants using gel permeation chromatography
coupled to dynamic light scattering (MALLS) is shown in FIG. 17. The present
invention demonstrates a role of Cys residues in controlling HA chain length.
In particular, the single seHAS Cys-mutant C281A makes much smaller HA,
whereas the seHAS C281S mutant makes HA products very similar in size,
compared to wild-type seHAS. In addition, the spHAS Cys mutant C280A also
makes much smaller HA, as seen in co-pending U.S. Serial No. 10/011,771, the
contents of which have been previously incorporated herein by reference in
their entirety.
Although NEM treatment of seHAS caused the velocity maximum (VmaX)
of the enzyme to decrease, it did not substantially change the Km values for
either nucleotide-sugar compared to untreated seHAS. These results indicate
that the ability of the NEM-treated enzyme to bind each substrate is not
greatly
8~
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
decreased by modification of its Cys residues, but the overall catalytic rate
is
slowed. In contrast, some of the site specific Cys-mutants showed greater
changes in their kinetic constants.
None of the single Cys-to-Ala or Cys-to-Ser mutants of seHAS or spHAS
are inactive, indicating that no single Cys residue plays a critical,
necessary role
in HA synthesis. The specific HAS activity remaining in the single, double,
triple, and Cys-null mutants confirms that Cys is not required at any position
within the enzyme for a critical step in HA synthesis. Nonetheless, CysZZ6 and
Cys26z together appear to play an important role in the activity of seHAS,
since
the double mutant seHAS(C226,262A) was the least active Cys-mutant with
only 2-3% of the wild-type activity. Despite its low activity, this double
mutant,
nonetheless, synthesized HA of normal size. The triple Cys-mutant
seHAS(o3C)Cz81 also had very low activity, similar to the double Cys-mutant
seHAS(C226,262A), and also synthesized normal size HA. These results
indicate that alteration of Cys36' does not cause decrease in HAS activity and
is
consistent with the single Cys-mutant results in Table VIII. In fact, the
seHAS
C367A and spHAS C366A mutants both exhibited increases in activity over the
corresponding wild-type enzymes.
Interestingly, the lower functionality of seHAS(C226,262A) was
substantially relieved by the introduction of a C281A change to create the
triple
Cys-mutant seHAS(o3C)C36'. Possibly, a structural or functional constraint,
88
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
perhaps related to HA chain length, brought about by mutating Cys2z6 and
Cys26z to Ala is substantially relieved by simultaneously mutating Cys281. The
triple mutant seHAS(03C)C36' and the Cys-null mutant had similar activities
and
HA product sizes, suggesting a similar degree of compensation for the
otherwise deleterious Cysz26/Cys2sz double mutation. The Cys-null mutant of
seHAS retained approximately 20% of wild-type activity. The results indicate
that Cys226 and Cys26z play an important role in the overall activity and
kinetic
characteristics of seHAS, but Cys28' may play a role in regulating HA size.
Based on the recently determined topology of spHAS and its high level of
homology with seHAS (72% identical plus 10% similar residues), we know that
Cys2z6, Cysz6z, and Cys28' are present in the central domain region of seHAS
(FIG. 1), which is the region that contains ~i-glycosyltransferase family
motifs.
The topological model predicts that Cys36' is very close to transmembrane
domain 4 and is probably not near the glycosyltransferase motifs.
Based on the NEM-modification and Cys-mutagenesis results, it appears
that one or more Cys residues may be located close to the nucleotide-sugar
binding sites of the seHAS or spHAS enzymes. This possibility provides a
rationale to explain why modification or alteration of these Cys residues
interferes with enzyme function and lowers enzyme activity. Preliminary
results
suggest that either substrate, UDP-GIcUA or UDP-GIcNAc, can protect seHAS
from inhibition by NEM (FIG. 6), supporting the premise that at least one Cys
89
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
residue is located in or near a nucleotide-sugar binding pocket. Substrate
binding to this site appears to interfere with the reaction between NEM and
the
nearby Cys residue(s). Similar conclusions about the proximity of Cys residues
to substrate binding sites have been reported for several other proteins,
including the lactose permease, glutathione synthetase, glucocorticoid
receptor,
retinoic acid receptor ~, and plasma membrane proton-ATPase. All of these
studies found that modification of Cys residues by sulfhydryl reagents
decreased the activity of the protein, even though Cys mutagenesis did not
inactivate the protein. Another recent study generated 400 Cys-scanning
mutants of a tetracycline transporter in order to map the membrane topology
and active site of the protein in membrane preparations. The ability of
tetracycline to protect only particular Cys residues from reaction with NEM,
and
subsequent inactivation of the protein, allowed the tetracycline binding site
and
channel to be mapped.
Another important consideration in evaluating the importance of Cys
residues in spHAS, and the other Class I HAS family members in general, may
be their involvement in HA translocation. The mechanism by which these
enzymes are able to hold onto the growing HA chain, while they continuously
extrude the polysaccharide through the bacterial cell or plasma membrane, is
still unknown. This extrusion process is referred to as a translocation, since
the
HA is not completely transferred across the membrane and released as would
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
occur in a typical transport process. The synthesis and extracellular
accumulation by some bacteria of polysaccharides, such as polysialic acid,
often
requires multiple factors and proteins encoded by very complex multi-gene
operons (Moxon and Kroll, 1990; Bliss and Silver, 1996). In contrast, all of
the
genetic and biochemical evidence to date (reviewed in Weigel, 1998)
demonstrate that the streptococcal enzymes are able to initiate HA chain
formation and then rapid extension of the HA chain in the absence of any
primer or other proteins. Other than the two sugar nucleotide substrates and
Mg+Z, the purified spHAS or seHAS enzymes only require a phospholipid
(Tlapak-Simmons et al., 1999a) in order to produce high molecular weight HA
(> 106 Da). In particular, cardiolipin dramatically stimulates the specific
activity
of detergent solubilized or purified spHAS and seHAS. The size distribution of
HA products is very similar for enzyme in isolated membranes or after
solubilization with dodecylmaltoside and affinity purification (data not
shown).
Therefore, the presence of a natural intact phospholipid bilayer and membrane
does not affect the ability of the HAS enzymes to synthesize HA. Presently, a
suitable assay to evaluate the ability of the wildtype or Cys-mutant enzymes
to
translocate HA is not available.
The creation of SeHAS~ys-nun and/or spHAS~''S-~~° mutants that
retain
enzymatic activity enables a more in depth analysis of the tertiary structure
of
the HAS enzyme and conformational changes that occur during substrate
91
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
binding, catalysis or HA translocation. To understand these processes, it is
necessary to determine the interactions and molecular proximity of various
domains within the protein in a more defined way. Cys-scanning mutants of
seHAS or spHAS containing a single unique Cys residue at a desired position
could enable one to employ electron paramagnetic resonance studies by
modifying this Cys residue with a suitable probe. This approach, for example,
allowed Voss et al., to determine the proximity of that modified residue to
another region of the Lac permease. Similarly, chemical modification of a
single
unique Cys residue with a fluorescent probe enables a systematic analysis of
the localized environment within different regions of the protein. Interacting
or proximal domains within seHAS or spHAS may also be determined by
assessing the formation of disulfide bonds in specific mutants containing two
Cys residues. Such approaches help to elucidate the structure and function of
seHAS and increase our understanding of how the HAS family is able to
synthesize HA.
92
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Materials and Methods
Vectors, Primers, and Reagents
pEx-1 was purchased from Promega as part of the Altered Sites
Mutagenesis kit. The expression vector pKK223 was from Pharmacis Biotech
Inc. E. coli SURE cells were from Stratagene. Successful mutagenesis was
achieved with the QUICK CHANGET"' Mutagenesis kit from Stratagene. Primers
were synthesized by The Great American Gene Company (Ransom Hill
Bioscience, Inc., CA), NBI, or Midland Certified Reagent Company. All of the
mutagenic oligonucleotides were synthesized by Genosys Biotechnologies, Inc.
(Spring, TX) and were purified by reverse-phase chromatography. Cy-5
fluorescent sequencing primers were synthesized by the Molecular Biology
Resource Facility, Oklahoma University Health Sciences Center.
Nonradiolabeled UDP-GIcUA, and 2,4,6-trihydroxyacetophenone were from
Fluka. UDP-GIcNAc was from Sigma. UDP-['4C]GIcUA (300 mCi/mmol) and 14C-
NEM (40 mCi/mmol) were from New England Nuclear. Agarose was from Bio-
Rad. (+)-Biotinyl-3-maleimidopropionamidyl-3,6-dioxaoctanediamine (biotin-
PEO-maleimide) was from Pierce Chemical Co. NEM and all other reagents
were from Sigma unless otherwise noted. To confirm the entire ORF of HAS
mutants, DNA sequencing was performed either using the T7 or PCR sequencing
kits from Amersham, or by the micro-sequencing facility operated by the
93
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Department of Microbiology & Immunology at the University of Oklahoma
Health Sciences Center. Anti-Hiss monoclonal antibody and Ni+Z-NTA resin were
from Qiagen.
Site-Directed Mutagenesis
The seHAS gene with a fusion at the 3' end encoding a His6 tail (seHAs-
His6) was cloned into pKK233. Mutagenic primers were designed to change the
cysteines to either Ala or Ser at positions 226, 262, 281 and 367. Two
complementary oligonucleotide primers encoding the desired mutation were
used to create the single Cys mutations (Table X). Mutagenesis was carried out
using the Quick Change method according to the manufacturer's instructions.
The pKK233 plasmid containing the seHAS-His6 gene was grown in SURE cells,
purified using a Spin Miniprep Kit (Qiagen) and analyzed by agarose gel
electrophoresis to verify the correct size. The purified pDNA was used as the
template for the primer extension reaction with a pair of mutagenic primers.
The PCR Amplification conditions for PCR, using pfu DNA polymerase, were 16
cycles of the following: 95°C for,i min, 58°C for 1 min, and
68°C for 18 min.
This amplification generated mutated plasmids with staggered nicks, which was
then treated with DpnI to digest the methylated and
94
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Table X
Synthetic oligonucleotides used to make seHAS mutants
The boldface font indicates the altered codon. All primers shown are in
the sense orientation.
seHAS
mutant Sequence SEQ ID NO:
C226A 5'- GGTAATATCCTTGTTGCCTCAGGTCCGCTTAGC
C226S 5'- GGTAATATCCTTGTTTCCTCAGGTCCGCTTAGC
C262A 5'- ATTGGTGATGACAGGGCCTTGACCAACTATGCA
C226S 5'- ATTGGTGATGACAGGTCCTTGACCAACTATGCA
C281A 5'- CAATCCACTGCTAAAGCTATTACAGATGTTCCT
C281S 5'-CAATCCACTGCTAAATCTATTACAGATGTTCCT
C367A 5'- TTCATTGTTGCCCTGGCTCGGAACATTCATTAC
C367S 5'-TTCATTGTTGCCCTGTCTCGGAACATTCATTAC
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Table XI
Oligonucleotides for Cys-to-Ser/Ala site directed mutagenesis of
spHAS.
Cys residues within spHAS at positions 124, 225, 261, 280, 366 and 402
were converted either to Ser using a single mutagenic oligonucleotide,
complementary to the coding strand, and the Altered Sites kit or to Ala using
a pair of complementary mutagenic oligonucleotides and the Quick Change
Mutagenesis kit (in the latter case only the forward primers complementary to
the coding strand are shown). The altered codons are indicated in boldface.
SpHAS mutation Mutagenic Oligonucleotide SEO ID NO:
( C 124S) 5'-TAACGTTTCGAGAAATATCCAC
( C 2 2 5 S ) 5'- G GTCCTGAG G AAACTAAAAT
( C2 61 S ) 5'-ATTTGTTAAAGATCGATCATC
( C280 S ) 5'-ATCAGTATCAGATCTAGCTGT
( C366S ) 5'-AACATTACGAGATAAAG CAAC
( C402 S ) 5'-TTTAATGGTGGATAAAGAATA
(C124A) 5'-AACGATAACGTTTCGAGCAATATCCACTTCTCT
(C225A) 5'- CAATGGTCCTGAGGCAACTAAAATATTACC
(C261A) 5'-AGCATAATTTGTTAAAGCTCGATCATCCCCAAT
(C280A) 5'-AGGTACATCAGTATCAGCTCTAGCTGTTGATTG
(C366A) 5'- AACATTACGAGCTAAAGCAAC
(C402A) 5'-CGTATTTTfAATGGTGGCTAAAGAATAAAGTTT
96
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
TABLE XII
All Possible Cysteine Mutants of seHAS and spHAS.
Each of the Cysteines listed may be mutated to Alanine, Serine, or any
other amino acid as described herein previously. In addition, when more than
one Cysteine is mutated, all the mutations may be the same (i.e., all Cys-Ala
mutations), or a mutant containing multiple Cysteine mutations may have a
combination of Cys-Ala, Cys-Ser and Cys-Xaa mutations.
HAS Cysteine(s) mutated SEQ ID NO:
seHAS 226 15
seHAS 262 16
seHAS 281 17
seHAS 367 18
seHAS 226,262 19
seHAS 226,281 20
seHAS 226,367 21
seHAS 262,281 22
seHAS 262,367 23
seHAS 281,367 24
seHAS 262,281,367 25
seHAS 226,281,367 26
seHAS 226,262,367 27
seHAS 226,262,281 28
seHAS Cys-null (226,262,281,367) 29
spHAS 124 30
spHAS 225 31
spHAS 261 32
spHAS 280 33
spHAS 366 34
spHAS 402 35
97
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
spHAS 125,225 36
spHAS 124,261 37
spHAS 124,280 38
spHAS 124,366 39
spHAS 124,402 40
spHAS 225,261 41
spHAS 225,280 42
spHAS 225,366 43
spHAS 225,402 44
spHAS 261,280 45
spHAS 261,366 46
spHAS 261,402 47
spHAS 280,366 48
spHAS 280,402 49
spHAS 366,402 50
spHAS 124,225,261 51
spHAS 124,225,280 52
spHAS 124,225,366 53
spHAS 124,225,402 54
spHAS 124,261,280 55
spHAS 124,261,366 56
spHAS 124,261,402 57
spHAS 124,280,366 58
spHAS 124,280,402 59
spHAS 124,366,402 60
spHAS 225,261,280 61
spHAS 225,261,366 62
spHAS 225,261,402 63
spHAS 225,280,366 64
98
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
spHAS 225,280,402 65
spHAS 225,366,402 66
spHAS 261,280,366 67
spHAS 261,280,402 68
spHAS 261,366,402 69
spHAS 280,366,402 70
spHAS 124,225,261,280 71
spHAS 124,225,261,366 72
spHAS 124,225,261,402 73
spHAS 124,225,280,366 74
spHAS 124,225,280,402 75
spHAS 124,225,366,402 76
spHAS 124,261,280,366 77
spHAS 124,261,280,402 78
spHAS 124,261,366,402 79
spHAS 124,280,366,402 80
spHAS 225,261,280,366 81
spHAS 225,261,280,402 82
spHAS 225,261,366,402 83
spHAS 225,280,366,402 84
spHAS 261,280,366,402 85
spHAS 124,225,261,280,366 86
spHAS 124,225,261,280,402 87
spHAS 124,225,261,366,402 88
spHAS 124,225,280,366,402 89
spHAS 124,261,280,366,402 90
spHAS 225,261,280,366,402 91
spHAS Cys-null (124,225,261,280,366,402)92
99
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
hemi-methylated parental DNA. The digested pDNA was transformed into SURE
cells and colonies were screened for the desired mutations by sequencing the
isolated plasmid DNA using fluorescently labeled terminators (ABI Prism 377
MODEL program, v2.1.1). The complete ORFs of selected mutants were
confirmed by sequencing in both directions with Cy-5 labeled vector primers on
a Pharmacia ALF Express DNA Sequencer. Data were analyzed using ALF
Manager, v3.02. The double, triple and null Cys-mutants of seHAS-His6 were
made using the appropriate single, double or triple Cys-mutant plasmid DNA as
the template, respectively.
Single mutants of spHAS were generated by the Altered Sites
Mutagenesis or Quick Change Mutagenesis protocols using primers (Table XI)
designed to change the Cys residues at positions 124, 225, 261, 280, 366, or
402 of spHAS containing His6 at the C-terminus (Tlapak-Simmons, et al.,
1999a). After generating and confirming the entire sequence of each
spHAS(Cys-to-Ser) mutant produced in the Altered Sites vector, internal
restriction sites within the HAS ORF were used to transfer mutated regions to
the spHAS insert in pKK223 (this vector carrying HAS is designated pKK3K).
Cys-to-Ala mutants of spHAS were generated directly in the pKK3K vector using
the Quick Change mutagenesis method. Site directed mutagenesis was used to
generate the C124, C402A double mutant, and then C366A was added by
restriction fragment exchange to generate a triple mutant. Site directed
ioo
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
mutagenesis was also used to create the double mutant spHAS(C261A,C280A).
The mutants containing five or six mutated Cys residues were generated by
utilizing restriction sites to combine fragments of spHAS containing different
mutations. For example, Avrll and Mfel were used to combine the
spHAS(C124A,C366A,C402A) triple Cys-mutant and the spHAS(C261A,C280A)
double mutant to create spHAS with only CysZZS intact. Finally, BgiII and
Avrll
were used to splice spHAS(C225A) into the latter quintupleCys-mutant to
generate the Cys-null clone, designated SpHAS~''S-""°. All Cys-to-
Ala/Ser mutants
were confirmed over the full ORF by automated DNA sequencing.
Effect of sulfhydryl reagent treatments on seHAS and spHAS activity and
determination of the kinetic constants of seHAS Cys mutants.
E. coli SURE cells transformed with plasmids containing various seHAS
mutants were grown in LB medium with vigorous shaking at 32°C to A6oo N
0.8
and induced with 1 mM isopropyl-~-thiogalactoside for 3 h. Cells were
harvested
and membranes were prepared as described previously. The kinetic constants
for HAS were determined at 37°C in 100 NI of 50 mM sodium and potassium
phosphate, pH 7.0, with 20 mM MgCl2, 1 mM DTE, 240 pM UDP-GIcUA, 0.7 NM
UDP-[14C]GIcUA and 0.6 -1.0 mM UDP-GIcNAc. in 100 ~.I of 25 mM sodium and
potassium phosphate, pH 7, containing 50 mM NaCI, 20 mM MgCIZ, 1 mM
dithiothreitol, 1 mM UDP-GIcUA, 0.68 ~.M UDP-GIcUA and 1 mM UDP-GIcNAc.
Some assays also contained 0.1 mM EDTA and 20% glycerol (v/v). To initiate
the enzyme reaction, N0.5-40 ~g of membrane protein was added and the
ioi
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
mixtures were gently shaken in a MicroMixer X-36 (Tiatec) at 30°C for 1-
2 h.
Reactions were terminated by the addition of SDS to a final concentration of
2%
(w/v). The incorporation of radioactive [14C]GIcUA was determined by
descending paper chromatography and the Km and VmaX values were determined
as described by Tlapak-Simmons et al (1999b). Data were analyzed by the
methods of Michaelis-Menton or Hill. Protein content was determined by the
method of Bradford using bovine serum albumin as the standard. All Cys-
mutant or sulfhydryl-treated seHAS samples were 'assayed in duplicate or
triplicate using two or three independent membrane preparations. Results are
presented as the mean ~ standard errors. All enzyme assays were performed
under conditions that were linear with respect to time and protein
concentration. None of the seHAS variant enzymes were unstable under the
conditions employed.
Determination of HA size produced by seHAS variants.
The relative M, of the HA synthesized by wild-type seHAS or the Cys-
mutants was determined by agarose gel electrophoresis of 14C-labeled HA
products synthesized under the assay conditions described above. The wild-
type seHAS synthesizes and releases an HA chain in <5 min under these
steady-state conditions, so that each enzyme molecule on average synthesizes
> 10 HA chains during the incubation. Reactions were terminated by heating at
95°C for 1 min, the mixtures were then centrifuged at high speed and
the HA-
io2
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
containing supernatants were recovered. The samples were concentrated N10-
fold using Microcon YM-3 filters (Amicon Bioseparations, Inc.) and treated
with
DNase and RNase (4 Pg/ml each) in the presence of 60 mM MgCl2 for 30 min
at 22 °C. The samples and a combination of DNA standards were then
electrophoresed on a 1.3% (w/v) agarose gel at 80-90 V. The gels were dried
without heating and exposed to Biomax-MR film (Kodak) for 1-4 weeks: The
autoradiograms were scanned to create digital files using a FluorchemT"'8000
(Alpha Innotech Corp.) image analysis station. As a control, samples were
treated with Streptomyces hyaluronate lyase (80 units) at 37°C
overnight,
which resulted in the complete loss of radiolabeled bands.
Determination of HA Chain Length Produced by spHAS Variants (Table IX).
HAS mutant HA size distribution was determined by agarose gel
electrophoresis. Membranes containing wildtype or mutant Has were incubated
in 0.5 mM UDP-GIcUA and 1.5 mM UDP-GIcNAc in 25 mM sodium/potassium
phosphate, pH 7.0, 75 mM NaCI, 1 mM DTT, 15% glycerol, 10 mM MgCl2, with
0.68-8.16 NM UDP-[14C]GIcUA for one hour at 30°C, while shaking in a
Taitec
E-36 micromixer. EDTA was added to 0.1 M to stop the reactions. 1 mg/ml
ovine testicular hyaluronidase was added to control tubes and incubated 1 hour
at 37°C to ensure the product formed was HA. 5 mg/ml Pronase was added
to
digest protein components that may bind HA, and the reactions were incubated
> 12 hours at 4°C. Reactions were either loaded directly to 1% agarose
gels or
103
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
were ethanol precipitated prior to loading. Components of the reaction were
retained in or near the wells after electrophoresis. Ethanol precipitation was
done to reduce this contamination. Reactions were centrifuged at 21,OOOXg for
min. One-tenth the volume of 3 M sodium acetate, pH 5.2, and three
volumes of ethanol were added to supernatants. The tubes were mixed and
incubated at - 20°C for 1 hour. The HA was collected by centrifugation
at
21,000 Xg for 10 min. The pellet was air dried and suspended in either water
or PBS. The suspension was loaded to agarose gels along with High Molecular
Weigh and KB ladder DNA standards from Gibco BRL. After electrophoresis was
stopped, the gel was dried and exposed to a phosphoscreen for 1 hour to >2
weeks. The gel image was obtained from the screen using a Molecular
Dynamics Phosphoimager. HA chain size was estimated by migration distance
relative to DNA standards. HA product size distribution was estimated by
integration over MW ranges of the integrated density value (IDV) curve
obtained for each lane. The preferred HA product size (peak size) was
designated by the MW range in which the greatest IDV was located.
Determination ofseHAS protein concentration in membranes and normalization
of seHAS activity.
The recombinant seHAS protein in isolated membranes is a major
component comprising N5-8% of the total protein, is well separated from other
major proteins by SDS-PAGE and can be readily identified in Coomassie Blue-
stained gels. E, coli membranes containing wild-type or mutant seHASs were
104
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
solubilized and electrophoresed on 10% (w/v) gels following the procedure of
Laemmli for SDS-PAGE. The amount of seHAS protein in each membrane
preparation was quantitated by image analysis of the stained gel using a
FluorchemT"'8000 (Alpha Innotech Corp). The linearity of Coomassie Blue-
stained seHAS bands was verified by loading different amounts of membrane
protein. To generate a standard curve, various amounts of affinity purified
seHAS-His6 were subjected to identical SDS-PAGE and the Integrated-Density
Value (IDV) was determined for each band. The IDVs were plotted against
pmol of pure seHAS. The IDV values for seHAS bands in membranes containing
wild-type or mutant proteins were then compared with the standard to estimate
the seHAS protein content per mg membrane protein. These data were then
used to normalize the seHAS enzyme activity in the membrane preparations for
wild-type and each variant seHAS.
Chemical modification of HAS in membranes.
Stock solutions (10-100 mM) of NEM, IAA or other sulfhydryl reagents
were made in PBS, pH 7Ø Suspensions of membranes containing seHAS or
spHAS were incubated with 0-5 mM of the sulfhydryl reagent at 4°C and
the
reactions were stopped by adding DTE to a final concentration of 10 mM. The
membranes were then assayed for HAS activity as described above.
Labeling of seHAS with '4C-NEM.
ios
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Isolated membranes from wild-type seHAS and each of the six double
Cys-mutants of seHAS were incubated at 4°C with 2.5 mM 14C-NEM (N8
x 106
dpm) for 5 min. The reactions were terminated by the addition of DTE to a
final
concentration of 5 mM. Total membrane proteins were precipitated by
incubation with 10% trichloroacetic acid overnight at 4°C and free 14C-
NEM was
then removed by two cycles of centrifugation and resuspension with 5%
trichloroacetic acid. The precipitated proteins were dissolved in 1x SDS
Laemmli sample buffer, neutralized by the addition of 0.1 N NaOH and analyzed
by SDS-PAGE using a 10% gel. The Coomassie Blue-stained gel was scanned
using a Model PDSIP60 densitometer (Molecular Dynamics), then treated with
scintillants and subjected to fluorography using Biomax-MR (Kodak) film and an
exposure of approximately one week. E, coli membranes prepared from cells
transformed with vector alone, containing no seHAS, were included as a
control.
MALDI-TOF analysis of seHAS derivatives.
Wild-type seHAS-His6 was bound to a Ni+Z-nitrilotriacetic acid chelate resin
(Qiagen), washed and treated with biotin-PEO-maleimide (10 mg/ml) for 2 h on
ice. After washing the column, the enzyme was eluted with distilled water
containing 0.5% (v/v) trifluoroacetic acid and 0.02% (w/v) dodecylmaltoside.
The degree of modification of Cys residues in treated seHAS samples was
determined using a MALDI-TOF Voyager Elite mass spectrometer (Applied
106
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Biosystems, Framingham, MA), which was equipped with a N2 laser (337nm),
located in the NSF EPSCoR Oklahoma Laser Mass Spectrometry Facility. The
sample (1 ~I) was spotted to a sample plate, followed by matrix solution (1
~.I)
and allowed to air dry. The matrix used was a 20 mg/ml solution of 2,4,6-
trihydroxyacetophenone in 50% acetonitrile containing 0.1% trifluoroacetic
acid
and 0.05% (w/v) dodecylmaltoside. Samples were analyzed in the linear,
positive ion mode using a delayed extraction of 300 ns, a grid voltage of
87.8%, and were subject to a 25 kV accelerating voltage. External and internal
calibrations were routinely performed using horse apomyoglobin and bovine
serum albumin (16,951 and 66,430 Da, respectively). Spectra were an
average of 80-120 scans and were processed using the 19 point Savitsky-Golay
smoothing option included in the software provided by the manufacturer.
Determination of recombinant spHAS-H6 content in membranes
Membranes were isolated from E, coil SURE strains expressing mutant or
wildtype spHAS, fractionated by SDS-PAGE according to the procedure of
Laemmli (1970) and the proteins were electrotransferred to nitrocellulose as
described by Towbin et al. (1979) with minor modifications (Tlapak-Simmons,
et al., 1998). Western analysis was performed by incubating these blots for 1
h at room temperature with a biotinylated anti-Hiss monoclonal antibody, as
the
primary antibody, then washing and incubating with 3 ~.g/ml 'Z5I-streptavidin,
prepared as described hereinabove. After 1 h at room temperature, the blots
ion
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
were washed, dried and exposed to a Phosphoscreen for 1 to 72 h. The screens
were analyzed using a Molecular Dynamics Phosphoimager and integrated
density values were obtained for each spHAS band. Integrated density values
were also obtained for increasing amounts of affinity-purified spHAS (Tlapak-
Simmons et al., 1999a), which was used as an internal standard in the same
blot to generate a standard curve. Dilutions of membrane samples were made
as necessary to ensure that all estimates of HAS quantity were in the linear
range of the assay. Those membrane samples giving a linear response with
increasing protein were then compared to the standard curve to calculate the
amount of spHAS present per ~.I membrane suspension. These values were then
used to normalize the kinetic results obtained using membranes from the
various spHAS mutants.
Enzymatic Analysis of HAS Mutants
E. coli SURE cells, previously transformed with plasmids containing
wildtype or mutant spHAS genes, were grown to an A6oo of N1.2 and induced
with 1 mM isopropyl thio-(3-D-galactoside for three h. Cells were harvested
and
membranes were prepared as described previously (Tlapak-Simmons, et al.,
1999a). The activities of mutant spHAS variants were assessed by measuring
their Vmaxand Km values in isolated membranes, normalized as described above
for the amount of enzyme expressed. The Km values were determined using a
descending paper chromatography assay (Tlapak-Simmons, et al., 1999b),
ios
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
holding one UDP-sugar substrate constant and varying the other from 0.01 to
4 mM. Data were analyzed by linear regression using Haynes-Wolf plots for
UDP-GIcUA or Hill plots for UDP-GIcNAc.
Inhibition of spHAS activity by NEM
Membrane preparations from wildtype and various spHAS mutants (i.e.
C124,402A, C261,280A, C124,366,402A, C124,261,280,366,402A, and the
Cys-null mutant) were incubated in 50 mM sodium, potassium phosphate, pH
7.0, 75 mM NaCI and 10% (v/v) glycerol with or without 20 mM NEM for 90 min
on ice. The ability of the membrane samples to synthesize HA was then
assessed by adding the following to the final concentrations indicated: 1 mM
UDP-GIcUA, 1 mM UDP-GIcNAc, 0.68 ~.M UDP-['4C]GIcUA in 25 mM
sodium/potassium phosphate, pH 7, 75 mM NaCI, 10 mM MgCl2, 1 mM
dithiothreitol, 0.1 mM EGTA, 15 % glycerol. Reactions were shaken for 1 h at
30° C in a Taitec E-36 micromixer, stopped by the addition of SDS to 2
(w/v), and spotted onto No. 3MM Whatman paper for descending paper
chromatography overnight using 1 mM ammonium acetate pH 5.5 / ethanol
(7:13). [14C]GIcUA incorporation into high molecular weight HA was assessed
by liquid scintillation spectroscopy to determine the radioactivity remaining
at
the origin. Confirmation that the latter material is authentic HA was obtained
by showing its complete loss after treatment with streptomyces hyaluronidase.
Assessment of Disulfide Bond Formation in spHAS by MALDI-TOF MS.
109
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Wildtype spHAS-His6 was bound to a Ni+Z chelate column (Qiagen) and
washed as previously described (Tlapak-Simmons, et al,. 1999a). While still
bound to the resin, the enzyme was incubated with biotin-PEO-maleimide (10
mg/ml) in the presence or absence of 6 M guanidinium-HCI for 2 h at
4°C. The
column was washed and spHAS-His6 was eluted with distilled water containing
0.5% (v/v) trifluroacetic acid and 0.02% (w/v) dodecylmaltoside. To assess the
degree of modification of Cys residues, samples containing purified spHAS were
analyzed by MALDI-TOF mass spectrometry using a Voyager Elite mass
spectrometer (Applied Biosystems, Framingham, MA), which was equipped with
a NZ laser (337nm), located in the NSF EPSCoR Oklahoma Laser Mass
Spectrometry Facility. A 1 ~I aliquot of sample was spotted to a sample plate
followed by 1 ~I of matrix and allowed to air dry. The matrix used was a
saturated solution of 2,4,6-trihydroxyacetophenone in 50% acetonitrile
containing 0.1% trifluoroacetic acid and 0.005% (w/v) dodecylmaltoside.
Samples were analyzed in the linear, positive ion mode using a delayed
extraction of 300ns, a grid voltage of 87.8%, and were subject to a 25kV
accelerating voltage. External calibrations were performed routinely using
horse
apomyoglobin and bovine serum albumin (16,951 and 66,430 Da, respectively).
Data were routinely processed using the 19 point Savitsky-Golay smoothing
option included in the software provided by the manufacturer.
iio
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
The invention includes a functionally active hyaluronan synthase having
at least one modified amino acid residue therein as compared to a
corresponding functionally active native hyaluronan synthase such that the
functionally active hyaluronan synthase has an altered enzymatic activity as
compared to the corresponding functionally active native hyaluronan synthase
is disclosed. Methods of producing hyaluronic acid utilizing a recombinant
host
cell having an expression construct encoding the functionally active
hyaluronan
synthase with altered enzymatic activity are also disclosed.
Thus it should be apparent that there has been provided in accordance
with the present invention a recombinant host cell having a purified nucleic
acid
segment having a coding region encoding enzymatically active HAS introduced
therein, as well as methods of producing hyaluronic acid from the recombinant
host cell, that fully satisfies the objectives and advantages set forth above.
Although the invention has been described in conjunction with specific
embodiments thereof, it is evident that many alternatives, modifications, and
variations will be apparent to those skilled in the art. Accordingly, it is
intended
to embrace all such alternatives, modifications, and variations that fall
within
the spirit and broad scope of the appended claims.
All of the numerical and quantitative measurements set forth in this
application (including in the examples and in the claims) are approximations.
m
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
The invention illustratively disclosed or claimed herein suitably may be
practiced in the absence of any element which is not specifically disclosed or
claimed herein. Thus, the invention may comprise, consist of, or consist
essentially of the elements disclosed or claimed herein.
The following claims are entitled to the broadest possible scope consistent
with this application. The claims shall not necessarily be limited to the
preferred embodiments or to the embodiments shown in the examples.
m2
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
REFERENCES
The following references, to the extent that they provide exemplary
procedural or other details supplementary to those set forth herein, are
specifically incorporated herein by reference in their entirety as though set
forth
herein particular.
Abatangelo, G., and Weigel, P. H. (2000) (editors) New Frontiers~in Medical
Sciences:Redefining Hyaluronan. ElsevierScience B. V., Amsterdam.
Appel, A., Horwitz, A.L., and Dorfman, A. (1979) J. Biol. Chem. 254, 12199-
12203.
Atkinson, E.M. and Long, S.R. (1992) Mol. Plant. Microbe. Interact. 5, 439-
442.
Bliss, J.M. and Silver, R.P. (1996) Mol. Microbiol. 21, 221-231.
Bradford, M. M. (1976) Anal. Biochem. 72, 248-254.
Breton, C., and Imberty, A. (1999) Curr. Opin. Struct. Biol. 9, 563-571.
Chakraborti, P.K., Garabedian, M.J., Yamamoto, K.R., and Simons, S.S., Jr.
(1992)
J.Biol. Chem. 267, 11366-73.
DeAngelis, P. L., Papaconstantinou, J. and Weigel, P. H. (1993a) J. Biol.
Chem.
268, 14568-14571.
DeAngelis, P. L., Papaconstantinou, J. and Weigel, P. H. (1993b) J. Biol.
Chem.
268, 19181-19184.
DeAngelis, P.L., Yang, N. and Weigel, P.H. (1994) Biochem. Biophys. Res.
Commun. 199, 1-10.
DeAngelis, P.L and Weigel, P.H. (1994) Biochem. 33, 9033-9039.
DeAngelis, P.L. (1996) Biochem. 35, 9768-9771.
DeAngelis, P.L. and Achyuthan, A.M. (1996) J. Biol. Chem. 271, 23657-23660.
113
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
DeAngelis, P.L., Jing, W., Drake, R.R. and Achyuthan, A.M. (1998) J. Biol.
Chem.
273, 8454-8458.
DeAngelis, P.L., Jing, W., Graves, M.V., Burbank, D.E. and Van Etten, J.L.
(1997)
Science, 278, 1800-1803.
DeAngelis, P.L. (1999) Cell. Mol. Life Sci. 56, 670-682.
Determan, H. (1968) Gel Chromatography, Springer-Verlag, Inc. New York.
Evered, D., and Whelan, J. (eds.) (1989) The biology of hyaluronan. Ciba Fnd.
Symposium 143, 1-288.
Fenderson, B.A., Stamenkovic, I., and.ArufFo, A. ( 1993) Differentiation 54,
85-98.
Frillingos, S., Sahin-Toh, M., Wu, J. and Kaback, H.R. (1998) FASEBJ. 12, 1281-
1299.
Heldermon, C.D., DeAngelis, P.L. and Weigel P.H. (2001) J. Biol. Chem. 276,
2037-2046.
Hill, A.V. (1913) Biochem. J, 7, 471-480.
Horton, M.R., Olman, M.A., Bao, C., White, K.E., Choi, A.M., Chin, B.Y.,
Noble,
P.W., and Lowenstein, C.J. (2000) Am. J. Physiol. Lung Cell. Mol. Physiol.
279,
707-715.
Itano, N. and Kimata, K. (1996a) J. Biol. Chem. 271, 9875-9878.
Itano, N. and Kimata, K. (1996b) Biochem. Biophys. Res. Common. 222, 816-
820.
Ishimoto, N., Temin, H.M., and Strominger, J.L. (1966) J. Biol. Chem. 241,
2052-
2057.
Itano, N., Sawai, T., Yoshida, M., Lenas, P., Yamada, Y., Imagawa, M.,
Shinomura,
T., Hamaguchi, M., Yoshida, Y., Ohnuki, Y., Miyauchi, S., Spicer, A.P.,
McDonald,
J.A., and Kimata, K. (1999) J. Biol. Chem. 274, 25085-25092.
Ito, K., Sato, T., and Yura, T. (1977) Cell, ii, 551-559.
Jung, K., Jung, H., and Kaback, H.R. (1994) Biochemistry 33, 3980-3985.
114
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Kass, E. H. and Seastone, C. V. (1944) J.Exp. Med. 79, 319-330.
Kato, H., Tanaka, T., Nishioka, T., Kimura, A., and Oda, J. (1988) J. Biol.
Chem.
263, 11646-11651.
Knudson, C.B., and Knudson, W. (1993) FASEB J. 7, 1233-1241.
Kumari, K. and Weigel, P.H. (1997) J. Biol. Chem., 272, 32539-32546.
Laemmli, U.K. (1970) Nature 227, 680-685.
Lansing, M., Lellig, S., Mausolf, A., Martini, I., Crescenzi, F., O'Regan, M.,
and
Prehm, P. (1993) Biochem. J. 289, 179-184.
Laurent, T.C., and Fraser, J.R.E. (1992) Hyaluronan. FASEB J. 6, 2397-2404.
Lee, H. G. and Cowman, M. K. (1994) Anal. Biochem. 2i9, 278-287.
Lin, Y., Mahan, K., Lathrop, W.F., Myles, D.G., and Primakoff, P. (1994) J.
Cell Biol.
125, 1157-1163.
Malinowski, N.M., Cysyk, R.L., and August, E.M. (1995) Biochem. and Molec.
Biol.
Intl. 35, 1123-1132.
Markovitz, A., J.A. Cifonelli, and Dorfman A. (1959) J. Biol. Chem. 234, 2343-
2350.
McDonald, J. and Spicer, A. (1998). In Science of Hyaluronan Today (V.C.
Hascall
and M. Yanagishita, eds) chapter 7, www.GIycoForum. r.ip.
Meyer, M.F. and Kreil, G. (1996) Proc. Natl. Acad. Sci. USA 93, 4543-4547.
Michaelis, L. and Menten, M.L. (1913) Biochem. Z. 49, 333-338.
Moxon, E.R. and Kroll, J.S. (1990) Curr. Top. Microbiol. Immunol. 6, 65-85.
Ng, K.F. and Schwartz, N.B. (1989) J. Biol. Chem. 264, 11776-11783.
Ohno, S., Tanimoto, K., Fujimoto, K., Ijuin, C., Honda, K., Tanaka, N., Doi,
T.,
Nakaharra, M., Tanne, K. (2001) Biochim Biophys Acta 1520, 71-78.
Ohya, T. and Kaneko, Y. (1970) Biochim. Biophys. Acta 198, 607-609.
ms
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Petrov, V.V., Pardo, J.P., and Slayman, C.W. (1997) J. Biol. Chem. 272, 1688-
1693.
Philipson, L.H., and Schwartz, N.B. (1984) J. Bioi. Chem. 259, 5017-5023.
Prehm, P. (1983) Biochem. J. 211, 181-189.
Prehm, P. (1983) Biochem. J. 211, 191-198.
Prehm, P. (1984). Biochem. J. 220: 597-600.
Prehm, P. and Mausolf, A. 1986. Biochem. J. 235:887-889.
Rosa, F., Sargent, T.D., Rebbert, M.L. Michaels, G.S., Jamrich, M., Grunz, H.,
Jonas, E., Winkles, J.A. and Dawid, I.B. (1988) Dev. Biol. 129, 114-123.
Shyjan, A.M., Heldin, P., Butcher, E.C., Yoshino, T. and Briskin, M.J. (1996)
J. Biol.
Chem. 271, 23395-23399.
Spicer, A.P., Augustine, M.L. and McDonald, J.A. (1996) J. Biol. Chem. 271,
23400-23406.
Spicer, A. P. and McDonald, J. A. (1998) J. Biol. Chem. 273, 1923-1932.
Sugahara, K., Schwartz, B.N., and Dorfman, A. (1979) J. Bioi. Chem. 254: 6252-
6261.
Tamura, N., Konishi, S., Iwaki, S., Kimura-Someya, T., Nada, S., Yamaguchi, A.
(2001) J. Bioi. Chem. 276, 20330-20339.
Tlapak-Simmons V.L., Baggenstoss, B. A., Clyne, T. and Weigel, P.H. (1999a) J.
Biol. Chem. 274, 4239-4245.
Tlapak-Simmons V.L., Baggenstoss, B. A., Kumari, K., Heldermon, C., and
Weigel,
P.H. (1999b) J. Biol. Chem. 274, 4246-4253.
Tlapak-Simmons, V.L., Kempner, E.S., Baggenstoss, B. A. and Weigel, P.H.
(1998)
J. Biol. Chem. 273, 26100-26109.
Toole, B.P. (1997) J. Intern. Med. 242, 35-40.
Towbin, H., Steahelin, T. and Cordon, J. (1979) Proc. Natl. Acad. Sci. U.S.A.
76,
4350-4354.
116
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Triscott, M. X. and van de Rijn, I. (1986) J. Biol. Chem. 261; 6004-6009.
Usui, T., Suzuki K., Kaji, Y., Amano, S., Miyata, K., Heldin, P., Yamashita,
H.
( 1999) Invest. Ophthalmol. Vis. Sci. 40, 563-7.
van de Rijn, I. and Drake, R.R. (1992) J. Biol. Chem. 267, 24302-24306.
Voss, )., Hubbell, W.L., Hernandez-Borrell, J. and Kaback, H.R. (1997)
Biochemistry 36, 15061-15066.
Wang, Q. and Kaback, H.R. (1999) Biochemistry 38, 16777-16782.
Ward, P.N., Field, T.R., Ditcham, W.G. Maguin, E. and Leigh, J.A. (2001)
Infect.
Immun. 69, 392-399.
Watanabe, K. and Yamaguchi, Y. (1996) J. Biol. Chem. 271, 22945-22948.
Weigel, P. H., Hascall, V. C. and Tammi, M. (1997) J. Biol. Chem. 272, 13997-
14000.
Weigel, P.H. (1998). Bacterial hyaluronan synthases. In Science of Hyaluronan
Todav (V.C. Hascall and M. Yanagishita, eds) chapter 6, www.GIycoForum.gr.ip.
Wessels, M.R., Goldberg, J.B., Moses, A.E., and Dicesare, T.J. (1994) Infect.
Immun. 62, 433-441.
Wessels, M.R., Moses, A.E., Goldberg, J.B., and Dicesare T.J. (1991) Proc.
Natl.
Acad. Sci. U.S.A. 88, 8317-8321.
White, S. H. and Wimley, W. C. (1999) Annu. Rev. Biophys. Biomol. Struct. 28,
319-365.
Whitnack, E., Bisno, A. L., and Beachey, E.H. (1981) Infect. Immun. 31, 985-
991.
Wolfgang, C.L., Zhang, Z-P., Gabriel, J.L., Pieringer, R.A., Soprano, K.J.,
and
Soprano, D. R. ( 1997) J. Biol. Chem. 272, 746-753.
Wu, J., and Kaback, R.H., (1994) Biochem. 33, 12166-12171.
Yang, et al., (1994) EMBO J. 13:286-960.
Yoshida, M., Itano, N., Yamada, Y. and Kimata, K. (2000) J. Biol. Chem. 275,
497-
506.
m
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
SEQUENCE LISTING
<110> WEIGEL, PAUL H
KUMARI, KSHAMA
<120> HYALURONAN SYNTHASES AND METHODS OF MAKING AND USING SAME
<130> 35541.082
<150> 60/336,105
<151> 2001-12-03
<160> 92
<170> Patentln version 3.1
<210> 1
<211> 1254
<212> DNA
<213> Streptococcus equisimilis
<400>
1
atgagaacattaaaaaacctcataactgttgtggcctttagtattttttgggtactgttg60
atttacgtcaatgtttatctctttggtgctaaaggaagcttgtcaatttatggctttttg120
ctgatagcttacctattagtcaaaatgtccttatcctttttttacaagccatttaaggga180
agggctgggcaatataaggttgcagccattattccctcttataacgaagatgctgagtca240
ttgctagagaccttaaaaagtgttcagcagcaaacctatcccctagcagaaatttatgtt300
gttgacgatggaagtgctgatgagacaggtattaagcgcattgaagactatgtgcgtgac360
actggtgacctatcaagcaatgtcattgttcatcggtcagagaaaaatcaaggaaagcgt420
catgcacaggcctgggcctttgaaagatcagacgctgatgtctttttgaccgttgactca480
gatacttatatctaccctgatgctttagaggagttgttaaaaacctttaatgacccaact540
gtttttgctgcgacgggtcaccttaatgtcagaaatagacaaaccaatctcttaacacgc600
ttgacagatattcgctatgataatgcttttggcgttgaacgagctgcccaatccgttaca660
1/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
ggtaatatccttgtttgctcaggtccgcttagcgtttacagacgcgaggtggttgttcct720
aacatagatagatacatcaaccagaccttcctgggtattcctgtaagtattggtgatgac780
aggtgcttgaccaactatgcaactgatttaggaaagactgtttatcaatccactgctaaa840
tgtattacagatgttcctgacaagatgtctacttacttgaagcagcaaaaccgctggaac900
aagtccttctttagagagtccattatttctgttaagaaaatcatgaacaatccttttgta960
gccctatggaccatacttgaggtgtctatgtttatgatgcttgtttattctgtggtggat1020
ttctttgtaggcaatgtcagagaatttgattggctcagggttttagcctttctggtgatt1080
atcttcattgttgccctgtgtcggaacattcattacatgcttaagcacccgctgtccttc1140
ttgttatctccgttttatggggtgctgcatttgtttgtcctacagcccttgaaattatat1200
tctctttttactattagaaatgctgactggggaacacgtaaaaaattattataa 1254
<210> 2
<211> 417
<212> PRT
<213> Streptococcus equisimilis
<400> 2
Met Arg Thr Leu Lys Asn Leu Ile Thr Val Val Ala Phe Ser Ile Phe
1 5 10 15
Trp Val Leu Leu Ile Tyr Val Asn Val Tyr Leu Phe Gly Ala Lys Gly
20 25 30
Ser Leu Ser Ile Tyr Gly Phe Leu Leu Il.e Ala Tyr Leu Leu Val Lys
35 40 . 45
Met Ser Leu Ser Phe Phe Tyr Lys Pro Phe Lys Gly Arg Ala Gly Gln
50 55 60
Tyr Lys Val Ala Ala Ile Ile Pro Ser Tyr Asn Glu Asp Ala Glu Ser
65 70 75 80
Leu Leu Glu Thr Leu Lys Ser Val Gln Gln Gln Thr Tyr Pro Leu Ala
85 90 95
Glu Ile Tyr Val Val Asp Asp Gly Ser Ala Asp Glu Thr Gly Ile Lys
100 105 110
Arg Ile Glu Asp Tyr Val Arg Asp Thr Gly Asp Leu Ser Ser Asn Val
115 120 125
Z/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Ile Val His Arg Ser Glu Lys Asn Gln Gly Lys Arg His Ala Gln Ala
130 135 140
Trp Ala Phe Glu Arg Ser Asp Ala Asp Val Phe Leu Thr Val Asp Ser
145 150 155 160
Asp Thr Tyr Ile Tyr Pro Asp Ala Leu Glu Glu Leu Leu Lys Thr Phe
165 170 175
Asn Asp Pro Thr Val Phe Ala Ala Thr Gly His Leu Asn Val Arg Asn
180 185 190
Arg Gln Thr Asn Leu Leu Thr Arg Leu Thr Asp Ile Arg Tyr Asp Asn
195 200 205
Ala Phe Gl~y Val Glu Arg Ala Ala Gln Ser Val Thr Gly Asn Ile Leu
210 215 220
Val Cys Ser Gly Pro Leu Ser Val Tyr Arg Arg Glu Val Val Val Pro
225 230 235 240
Asn Ile Asp Arg Tyr Ile Asn Gln Thr Phe Leu Gly Ile Pro Val Ser
245 250 255
Ile Gly Asp Asp Arg Cys Leu_Thr Asn Tyr Ala Thr Asp Leu Gly Lys
260 265 270
Thr Val Tyr Gln Ser Thr Ala Lys Cys Ile Thr Asp Val Pro Asp Lys
275 280 285
Met Ser Thr Tyr Leu Lys Gln Gln Asn Arg Trp Asn Lys Ser Phe Phe
290 295 300
Arg Glu Ser Ile Ile Ser Val Lys Lys Ile Met Asn Asn Pro Phe Val
305 310 315 320
Ala Leu Trp Thr Ile Leu Glu Val Ser Met Phe Met Met Leu Val Tyr
325 330 335
Ser Val Val Asp Phe Phe Val Gly Asn Val Arg Glu Phe Asp Trp Leu
340 345 350
Arg Val Leu Ala Phe Leu Val Ile Ile Phe Ile Val Ala Leu Cys Arg
355 360 365
Asn Ile His Tyr Met Leu Lys His Pro Leu Ser Phe Leu Leu Ser Pro
370 375 380
3/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Phe Tyr Gly Val Leu His Leu Phe Val Leu Gln Pro Leu Lys Leu Tyr
385 390 395 400
Ser Leu Phe Thr Ile Arg Asn Ala Asp Trp Gly Thr Arg Lys Lys Leu
405 410 415
Leu
<210> 3
<211> 1440
<212> DNA
<213> Streptococcus pyogenes
<400>
3
tttaatggaaacacaattttattaaaaatatctctatatctagttgacattatttcttat60
ttatattataatattgaggtcctttctttcaaggaaattaaaaaagaaagaggtgtaatt120
gtgcctatttttaaaaaaactttaattgttttatcctttatttttttgatatctatcttg180
atttatctaaatatgtatctatttggaacatcaactgtaggaatttatggagtaatatta240
ataacctatctagttatcaaacttggattatctttcctttatgagccatttaaaggaaat300
ccacatgactataaagttgctgctgtaattccttcttataatgaagatgccgagtcatta360
ttagaaacacttaaaagtgtgttagcacagacctatccgttatcagaaatttatattgtt420
gatgatgggagttcaaacacagatgcaatacaattaattgaagagtatgtaaatagagaa480
gtggatatttgtcgaaacgttatcgttcaccgttcccttgtcaataaaggaaaacgccat540
gctcaagcgtgggcatttgaaagatctgacgctgacgtttttttaaccgtagactcagat600
acttatatctatccaaatgccttagaagaactcctaaaaagcttcaatgatgagacagtt660
tatgctgcaacaggacatttgaatgctagaaacagacaaactaatctattaacgcgactt720
acagatatccgttacgataatgcctttggggtggagcgtgctgctcaatcattaacaggt780
aatattttagttt~ctcaggaccattgagtatttatcgacgtgaagtgattattcctaac840
ttagagcgctataaaaatcaaacattcctaggtttacctgttagcattggggatgatcga900
tgtttaacaaattatgctattgatttaggacgcactgtctaccaatcaacagctagatgt960
gatactgatgtacctttccaattaaaaagttatttaaagcaacaaaatcgatggaataaa1020
tctttttttagagaatctattatttctgttaaaaaaattctttctaatcccatcgttgcc1080
ttatggactattttcgaagtcgttatgtttatgatgttgattgtcgcaattgggaatctt1140
ttgtttaatcaagctattcaattagaccttattaaactttttgcctttttatccatcatc1200
4/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
tttatcgttgctttatgtcgtaatgttcattatatggtcaaacatcctgctagttttttg1260
ttatctcctctgtatggaatattacacttgtttgtcttacagcccctaaaactttattct1320
ttatgcaccattaaaaatacggaatggggaacacgtaaaaaggtcactatttttaaataa1380
tatatgcatcgagtagttagagaaggagtaattttatgaaaatagcagttgctggatcag1440
<210> 4
<211> 419
<212> PRT
<213> streptococcus pyogenes
<400> 4
Met Pro Ile Phe Lys Lys Thr Leu Ile Val Leu Ser Phe Ile Phe Leu
1 5 10 15
Ile Ser Ile Leu Ile Tyr Leu Asn Met Tyr Leu Phe Gly Thr Ser Thr
20 25 30
Val Gly Ile Tyr Gly Val Ile Leu Ile Thr Tyr Leu Val Ile Lys Leu
35 40 45
Gly Leu Ser Phe Leu Tyr Glu Pro Phe Lys Gly Asn Pro His Asp Tyr
50 55 60
Lys Val Ala Ala Val Ile Pro Ser Tyr Asn Glu Asp Ala Glu Ser Leu
65 70 75 80
Leu Glu Thr Leu Lys Ser Val Leu Ala Gln Thr Tyr Pro Leu Ser Glu
85 90 95
Ile Tyr Ile Val Asp Asp Gly Ser Ser Asn Thr Asp Ala Ile Gln Leu
100 105 110
Ile Glu Glu Tyr Val Asn Arg Glu Val Asp Ile Cys Arg Asn Val Ile
115 120 125
Val His Arg Ser Leu Val Asn Lys Gly Lys Arg His Ala Gln Ala Trp
130 135 140
Ala Phe Glu Arg Ser Asp Ala Asp Val Phe Leu Thr Val Asp Ser Asp
145 150 155 160
Thr Tyr Ile Tyr Pro Asn Ala Leu Glu Glu Leu Leu Lys Ser Phe Asn
165 170 175
S/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Asp Glu Thr Val Tyr Ala Ala Thr Gly His Leu Asn Ala Arg Asn Arg
180 185 190
Gln Thr Asn Leu Leu Thr Arg Leu Thr Asp Ile Arg Tyr Asp Asn Ala
195 200 205
Phe Gly Val Glu Arg Ala Ala Gln Ser Leu Thr Gly Asn Ile Leu Val
210 215 220
Cys Ser Gly Pro Leu Ser Ile Tyr Arg Arg Glu Val Ile Ile Pro Asn
225 230 235 240
Leu Glu Arg Tyr Lys Asn Gln Thr Phe Leu Gly Leu Pro Val Ser Ile.
245 250 255
Gly Asp Asp Arg Cys Leu Thr Asn Tyr Ala Ile Asp Leu Gly Arg Thr
260 265 270
Val Tyr Gln Ser Thr Ala Arg Cys Asp Thr Asp Val Pro Phe Gln Leu
275 280 285
Lys Ser Tyr Leu Lys Gln Gln Asn Arg Trp Asn Lys Ser Phe Phe Arg
290 295 300
Glu Ser Ile Ile Ser Val Lys Lys Ile Leu Ser Asn Pro Ile Val Ala
305 310 315 320
Leu Trp Thr Ile Phe Glu Val Val Met Phe Met Met Leu Ile Val Ala
325 330 335
Ile Gly Asn Leu Leu Phe Asn Gln Ala Ile Gln Leu Asp Leu Ile Lys
340 345 350
Leu Phe Ala Phe Leu Ser Ile Ile Phe Ile Val Ala Leu Cys Arg Asn
355 360 365
Val His Tyr Met Val Lys His Pro Ala Ser Phe Leu Leu Ser Pro Leu
370 375 380
Tyr Gly Ile Leu His Leu Phe Val Leu Gln Pro Leu Lys Leu Tyr Ser
385 390 395 400
Leu Cys Thr Ile Lys Asn Thr Glu Trp Gly Thr Arg Lys Lys Val Thr
405 410 415
Ile Phe Lys
6/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
<210> 5
<211> 3466
<212> DNA
<213> streptococcus uberis
<400> 5
gcaaaagtttaaaggaggaattatggaaaaactaaaaaatctcattacatttatgacttt60
tattttcctgtggctcataattattgggcttaatgtttttgtatttggaactaaaggaag120
tctaacagtgtatgggattattctattaacctatttgtcgataaaaatgggattatcttt180
tttttatcgtccctataaaggaagtgtaggtcaatataaggtagcagctattatcccatc240
ttataatgaggatggtgtcggtttactagaaactctaaagagtgttcaaaaacaaacata300
tccaattgcagaaattttcgtaattgacgatgggtcagtagataaaacaggtataaaatt360
ggtcgaagactatgtgaagttaaatggctttggagaccaagttatcgttcatcagatgcc420
tgaaaatgttggtaaaagacatgctcaggcttgggcatttgaaaggtctgatgctgatgt480
tttcttaacagtggattcagatacctacatctatcctgatgctcttgaagaattattaaa540
gacatttaatgatccagaggtctacgctgcaactggtcatttaaatgcaagaaatagaca600
aactaatctcttaactagactgactgatattcgttacgataatgcatttggtgtagaacg660
tgctgctcagtctgttacgggaaatattttggtttgttccggacctttaagtatttatag720
acgttccgtcggtattccaaatcttgaacgctatacctcacaaacatttcttggtgtccc780
tgtaagcataggggatgaccgttgtttgacaaattatgcaactgatttgggaaaaacggt840
ttatcagtcaactgcaagatgtgatactgacgttccagataagtttaaggttttcatcaa900
acaacaaaatcgttggaataagtcattttttagggagtctattatctctgttaagaagtt960
attagccacaccaagtgttgctgtttggactattacagaagtttccatgttcatcatgct1020
agtttattctatctttagcttattgataggagaggctcaagaatttaatctcataaaact1080
ggttgcttttttagttattattttcatagtagctctttgtagaaatgttcattacatggt1140
taagcatccatttgcttttttattgtcaccgttttatggattgatacatctattcgtttt1200
gcaacctcttaagatatattcgttatttactataagaaatgctacatggggaactcgtaa1260
aaagacaagtaaataattcaattagagaaaggacaaaatagtgaaaattgcagttgcagg1320
ttctggctatgttggcctatcattaagtgtattattagcacagaaaaatcctgttacagt1380
tgtagatattattgagaagaaagtaaatctcataaatcaaaaacaatcaccaatccagga1440
tgttgatattgaaaactatttaaaagaaaaaaagttacaattaagagctactctagacgc1500
cgatcaagcatttagggatgcagatatactaattattgctacaccaaccaattatgatgt1560
7/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
ggagaagaat ttttttgata ctagtcatgt tgagactgta attgagaaag ctttagcttt 1620
aaatagtcag gctttgttag ttattaaatc aacgatacca cttggtttta ttaaaaagat 1680
gcgtcaaaaa tatcagacag accgtattat ttttagtccc gaatttctta gagagtctaa 1740
agctttaaaa gataatcttt atcctagtcg aataattgtt tcctttgaag atgatgattc 1800
tatggaagta atagaagcag caaagacttt tgctcaattg ttaaaagatg gttctttgga 1860
taaagatgtt cctgtacttt ttatgggttc agcagaggct gaagcagtaa aattatttgc 1920
caatacctat ttagctatgc gtgtctccta ttttaatgag ttagatacat atgctgaaaa 1980
gaatggttta cgtgtggata atattattga gggcgtttgc catgatcgac gcataggaat 2040
tcattataat aacccttctt ttggctatgg aggatactgc ttacctaaag ataccaaaca 2100
gttgctagca ggctatgatg gtattcctca atcgcttata aaagcaattg ttgattctaa 2160
taaaattcgt aaagagtata tcgcatcaca aattttacaa caattgagtg atattaatgt 2220
agatcctaaa gatgcaacga ttggtattta ccgccttatc atgaaaagta actctgataa 2280
tttcagagag agtgcaataa aagatattat tgatcatatt aagagctatc aaattaatat 2340
agtcttgtat gagccaatga tgaatgaaga ttttgattta ccaatcattg atgatttatc 2400
tgacttcaaa gccatgtcac atattatcgt ttcaaataga tatgatttag ccttagaaga 2460
tgttaaagaa aaagtttaca ccagagatat ttacggtgtg gattaagttt gatttttaac 2520
aaatctccaa aaaatagata aaaaaaacag actctgataa aagagtctgt tttttaaaag 2580
tgtgagcatc ctattgctag gatgctcagg aaatttatga aaagggagat aagagggaac 2640
ttatcttccc caacggtttg ggagaccatt atttaggata gtcttatcat aagctatcaa 2700
ccttaaagat ttcttaactc gttttcgttt gggtcttgtc tttttaattt tttgatgaga 2760
attaaacttg atggaatgag aatcaggaca ctgcctatcc aggctgctgg attagctgaa 2820
gccacaccaa caaaaccaaa gtataacagg ccaataatgg cgactcctgc tctcatgact 2880
aattccataa tgccagctaa agtaggaaca aaaccgtatc cgagaccttg aatgaaactt 2940
cttagtataa ataggatggc taaaatccaa taaagagagc cattaatcag ataatagaga 3000
taggctaaat ggaaaacagc tggatcagcc ttactaatga aaatgccaga gaaaaagcgg 3060
tgttggaaaa ttaacagaat agcaaaaaga acagaccaaa taatacagat aatgagtgaa 3120
tctttaagac cctcaaggat tcttttataa gctttagcgc catagttctg agctgtaaag 3180
gttgacaagg ctaagcccag atttaacatc ggtagcatgg ccagttggtc tgttttactg 3240
gcaatagcaa tagctgcgat agcttcggtc cccaacttat taatggttac ctgcagtgta 3300
atggctccaa tggctataat actagcctga aatgccatgg gaaaaccaag gcgagcatga 3360
tttctgagat tttccctatc aagagtcaaa tcgtctttct tcagtcggaa atgggggatc 3420
tttttgttga tgtaaaggac caaatagagt acggagaaag cttgca 3466
8/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
<210> 6
<211> 417
<212> PRT
<213> Streptococcus uberis
<400> 6
Met Glu Lys Leu Lys Asn Leu Ile Thr Phe Met Thr Phe Ile Phe Leu
1 5 10 15
Trp Leu Ile Ile Ile Gly Leu Asn Val Phe Val Phe Gly Thr Lys Gly
20 25 30
Ser Leu Thr Val Tyr Gly Ile Ile Leu Leu Thr Tyr Leu Ser Ile Lys
35 40 45
Met Gly Leu Ser Phe Phe Tyr Arg Pro Tyr Lys Gly Ser Val Gly Gln
50 55 60
Tyr Lys Val Ala Ala Ile Ile Pro Ser Tyr Asn Glu Asp Gly Val Gly
65 70 75 80
Leu Leu Glu Thr Leu Lys Ser Val Gln Lys Gln Thr Tyr Pro Ile Ala
85 90 95
Glu Ile Phe Val Ile Asp Asp Gly Ser Val Asp Lys Thr Gly Ile Lys
100 105 110
Leu Val Glu Asp Tyr Val Lys Leu Asn Gly Phe Gly Asp Gln Val Ile
115 120 125
Val His Gln Met Pro Glu Asn Val Gly Lys Arg His Ala Gln Ala Trp
130 135 140
Ala Phe Glu Arg Ser Asp Ala Asp Val Phe Leu Thr Val Asp Ser Asp
145 150 155 160
Thr Tyr Ile Tyr Pro Asp Ala Leu Glu Glu Leu Leu Lys Thr Phe Asn
165 170 175
Asp Pro Glu Val Tyr Ala Ala Thr Gly His Leu Asn Ala Arg Asn Arg
180 185 190
Gln Thr Asn Leu Leu Thr Arg Leu Thr Asp Ile Arg Tyr Asp Asn Ala
195 200 205
9/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Phe Gly Val Glu Arg Ala Ala Gln Ser Val Thr Gly Asn Ile Leu Val
210 215 220
Cys Ser Gly Pro Leu Ser Ile Tyr Arg Arg Ser Val Gly Ile Pro Asn
225 230 235 240
Leu Glu Arg Tyr Thr Ser Gln Thr Phe Leu Gly Val Pro Val Ser Ile
245 250 255
Gly Asp Asp Arg Cys Leu Thr Asn Tyr Ala Thr Asp Leu Gly Lys Thr
260 265 270
Val Tyr Gln Ser Thr Ala Arg Cys Asp Thr Asp Val Pro Asp Lys Phe
275 280 285
Lys Val Phe Ile Lys Gln Gln Asn Arg Trp Asn Lys Ser Phe Phe Arg
290 295 300
Glu Ser Ile Ile Ser Val Lys Lys Leu Leu Ala Thr Pro Ser Val Ala
305 310 315 320
Val Trp Thr Ile Thr Glu Val Ser Met Phe Ile Met Leu Val Tyr Ser
325 330 335
Ile Phe Ser Leu Leu Ile Gly Glu Ala Gln Glu Phe Asn Leu Ile Lys
340 345 350
Leu Val Ala Phe Leu Val Ile Ile Phe Ile Val Ala Leu Cys Arg Asn
355 360 365
Val His Tyr Met Val Lys His Pro Phe Ala Phe Leu Leu Ser Pro Phe
370 375 380
Tyr Gly Leu Ile His Leu Phe Val Leu Gln Pro Leu Lys Ile Tyr Ser
385 390 395 400
Leu Phe Thr Ile Arg Asn Ala Thr Trp Gly Thr Arg Lys Lys Thr Ser
405 410 415
Ly5
<210> 7
<211> 2937
<212> DNA
10/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
<213> Pasteurella multocida
<400>
7
attttttaaggacagaaaatgaatacattatcacaagcaataaaagcatataacagcaat60
gactatcaattagcactcaaattatttgaaaagtcggcggaaatctatggacggaaaatt120
gttgaatttcaaattaccaaatgccaagaaaaactctcagcacatccttctgttaattca180
gcacatctttctgtaaataaagaagaaaaagtcaatgtttgcgatagtccgttagatatt240
gcaacacaactgttactttccaacgtaaaaaaattagtactttctgactcggaaaaaaac300
acgttaaaaaataaatggaaattgctcactgagaagaaatctgaaaatgcggaggtaaga360
gcggtcgcccttgtaccaaaagattttcccaaagatctggttttagcgcctttacctgat420
catgttaatgattttacatggtacaaaaagcgaaagaaaagacttggcataaaacctgaa480
catcaacatgttggtctttctattatcgttacaacattcaatcgaccagcaattttatcg540
attacattagcctgtttagtaaaccaaaaaacacattacccgtttgaagttatcgtgaca600
gatgatggtagtcaggaagatctatcaccgatcattcgccaatatgaaaataaattggat660
attcgctacgtcagacaaaaagataacggttttcaagccagtgccgctcggaatatggga720
ttacgcttagcaaaatatgactttattggcttactcgactgtgatatggcgccaaatcca780
ttatgggttcattcttatgttgcagagctattagaagatgatgatttaacaatcattggt840
ccaagaaaatacatcgatacacaacatattgacccaaaagacttcttaaataacgcgagt900
ttgcttgaatcattaccagaagtgaaaaccaataatagtgttgccgcaaaaggggaagga960
acagtttctctggattggcgcttagaacaattcgaaaaaacagaaaatctccgcttatcc1020
gattcgcctttccgtttttttgcggcgggtaatgttgctttcgctaaaaaatggctaaat1080
aaatccggtttctttgatgaggaatttaatcactggggtggagaagatgtggaatttgga1140
tatcgcttattccgttacgg.tagtttctttaaaactattgatggcattatggcctaccat1200
caagagccaccaggtaaagaaaatgaaaccgatcgtgaagcgggaaaaaatattacgctc1260
gatattatgagagaaaaggtcccttatatctatagaaaacttttaccaatagaagattcg1320
catatcaatagagtacctttagtttcaatttatatcccagcttataactgtgcaaactat1380
attcaacgttgcgtagatagtgcactgaatcagactgttgttgatctcgaggtttgtatt1440
tgtaacgatggttcaacagataataccttagaagtgatcaataagctttatggtaataat1500
cctagggtacgcatcatgtctaaaccaaatggcggaatagcctcagcatcaaatgcagcc1560
gtttcttttgctaaaggttattacattgggcagttagattcagatgattatcttgagcct1620
gatgcagttgaactgtgtttaaaagaatttttaaaagataaaacgctagcttgtgtttat1680
accactaatagaaacgtcaatccggatggtagcttaatcgctaatggttacaattggcca1740
gaattttcacgagaaaaactcacaacggctatgattgctcaccactttagaatgttcacg1800
11/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
attagagcttggcatttaactgatggattcaatgaaaaaattgaaaatgccgtagactat1860
gacatgttcctcaaactcagtgaagttggaaaatttaaacatcttaataaaatctgctat1920
aaccgtgtattacatggtgataacacatcaattaagaaacttggcattcaaaagaaaaac1980
cattttgttgtagtcaatcagtcattaaatagacaaggcataacttattataattatgac2040
gaatttgatgatttagatgaaagtagaaagtatattttcaataaaaccgctgaatatcaa2100
gaagagattgatatcttaaaagatattaaaatcatccagaataaagatgccaaaatcgca2160
gtcagtattttttatcccaatacattaaacggcttagtgaaaaaactaaacaatattatt2220
gaatataataaaaatatattcgttattgttctacatgttgataagaatcatcttacacca2280
gatatcaaaaaagaaatactagccttctatcataaacatcaagtgaatattttactaaat2340
aatgatatctcatattacacgagtaatagattaataaaaactgaggcgcatttaagtaat2400
attaataaattaagtcagttaaatctaaattgtgaatacatcatttttgataatcatgac2460
agcctattcgttaaaaatgacagctatgcttatatgaaaaaatatgatgtcggcatgaat2520
ttctcagcattaacacatgattggatcgagaaaatcaatgcgcatccaccatttaaaaag2580
ctcattaaaacttattttaatgacaatgacttaaaaagtatgaatgtgaaaggggcatca2640
caaggtatgtttatgacgtatgcgctagcgcatgagcttctgacgattattaaagaagtc2700
atcacatcttgccagtcaattgatagtgtgccagaatataacactgaggatatttggttc2760
caatttgcacttttaatcttagaaaagaaaaccggccatgtatttaataaaacatcgacc2820
ctgacttatatgccttgggaacgaaaattacaatggacaaatgaacaaattgaaagtgca2880
aaaagaggagaaaatatacctgttaacaagttcattattaatagtataactctataa 2937
<210> 8
<211> 972
<212> PRT
<213> Pasteurella multocida
<400> 8 -
Met Asn Thr Leu Ser Gln Ala Ile Lys Ala Tyr Asn Ser Asn Asp Tyr
1 5 10 15
Gln Leu Ala Leu Lys Leu Phe Glu Lys Ser Ala Glu Ile Tyr Gly Arg
20 25 30
Lys Ile Val Glu Phe Gln Ile Thr Lys Cys Gln Glu Lys Leu Ser Ala
35 40 45
12/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
His Pro Ser Val Asn Ser Ala His Leu Ser Val Asn Lys Glu Glu Lys
50 55 60
Val Asn Val Cys Asp Ser Pro Leu Asp Ile Ala Thr Gln Leu Leu Leu
65 70 75 80
Ser Asn Val Lys Lys Leu Val Leu Ser Asp Ser Glu Lys Asn Thr Leu
85 90 95
Lys Asn Lys Trp Lys Leu Leu Thr Glu Lys Lys Ser Glu Asn Ala Glu
100 105 110
Val Arg Ala Val Ala Leu Val Pro Lys Asp Phe Pro Lys Asp Leu Val
115 120 125
Leu Ala Pro Leu Pro Asp His Val Asn Asp Phe Thr Trp Tyr Lys Lys
130 135 140
Arg Lys Lys Arg Leu Gly Ile Lys Pro Glu His Gln His Val Gly Leu
145 150 155 160
Ser Ile Ile Val Thr Thr Phe Asn Arg Pro Ala Ile Leu Ser Ile Thr
165 170 175
Leu Ala Cys Leu Val Asn Gln Lys Thr His Tyr Pro Phe Glu Val Ile
180 185 190
Val Thr Asp Asp Gly Ser Gln Glu Asp Leu Ser Pro Ile Ile Arg Gln
195 200 205
Tyr Glu Asn Lys Leu Asp Ile Arg Tyr Val Arg Gln Lys Asp Asn Gly
210 215 220
Phe Gln Ala Ser Ala Ala Arg Asn Met Gly Leu Arg Leu Ala Lys Tyr
225 230 235 240
Asp Phe Ile Gly Leu Leu Asp Cys Asp Met Ala Pro Asn Pro Leu Trp
245 250 255
Val His Ser Tyr Val Ala Glu Leu Leu Glu Asp Asp Asp Leu Thr Ile
260 265 270
Ile Gly Pro Arg Lys Tyr Ile Asp Thr Gln His Ile Asp Pro Lys Asp
275 280 285
Phe Leu Asn Asn Ala Ser Leu Leu Glu Ser Leu Pro Glu Val Lys Thr
290 295 300
13/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Asn Asn Ser Val Ala Ala Lys Gly Glu Gly Thr Val Ser Leu Asp Trp
305 310 315 320
Arg Leu Glu Gln Phe Glu Lys Thr Glu Asn Leu Arg Leu Ser Asp Ser
325 330 335
Pro Phe Arg Phe Phe Ala Ala Gly Asn Val Ala Phe Ala Lys Lys Trp
340 345 350
Leu Asn Lys Ser Gly Phe Phe Asp Glu Glu Phe Asn His Trp Gly Gly
355 360 365
Glu Asp Val Glu Phe Gly Tyr Arg Leu Phe Arg Tyr Gly Ser Phe Phe
370 375 380
Lys Thr Ile Asp Gly Ile Met Ala Tyr His Gln Glu Pro Pro Gly Lys
385 390 395 400
Glu Asn Glu Thr Asp Arg Glu Ala Gly Lys Asn Ile Thr Leu Asp Ile
405 410 415
Met Arg Glu Lys Val Pro Tyr Ile Tyr Arg Lys Leu Leu Pro Ile Glu
420 425 430
Asp Ser His Ile Asn Arg Val Pro Leu Val Ser Ile Tyr Ile Pro Ala
435 440 445
Tyr Asn Cys Ala Asn Tyr Ile Gln Arg Cys Val Asp Ser Ala Leu Asn
450 455 460
Gln Thr Val Val Asp Leu Glu Val Cys Ile Cys Asn Asp Gly Ser Thr
465 470 475 480
Asp Asn Thr Leu Glu Val Ile Asn Lys Leu Tyr Gly Asn Asn Pro Arg
485 490 495
Val Arg Ile Met Ser Lys Pro Asn Gly Gly Ile Ala Ser Ala Ser Asn
500 505 510
Ala Ala Val Ser Phe Ala Lys Gly Tyr Tyr Ile Gly Gln Leu Asp Ser
515 520 525
Asp Asp Tyr Leu Glu Pro Asp Ala Val Glu Leu Cys Leu Lys Glu Phe
530 535 540
Leu Lys Asp Lys Thr Leu Ala Cys Val Tyr Thr Thr Asn Arg Asn Val
545 550 555 560
14/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Asn Pro Asp Gly Ser Leu Ile Ala Asn Gly Tyr Asn Trp Pro Glu Phe
565 570 575
Ser Arg Glu Lys Leu Thr Thr Ala Met Ile Ala His His Phe Arg Met
580 585 590
Phe Thr Ile Arg Ala Trp His Leu Thr Asp Gly Phe Asn Glu Lys Ile
595 600 605
Glu Asn Ala Val Asp Tyr Asp Met Phe Leu Lys Leu Ser Glu Val Gly
610 615 620
Lys Phe Lys His Leu Asn Lys Ile Cys Tyr Asn Arg Val Leu His Gly
625 630 635 640
Asp Asn Thr Ser Ile Lys Lys Leu Gly Ile Gln Lys Lys Asn His Phe
645 650 655
Val Val Val Asn Gln Ser Leu Asn Arg Gln Gly Ile Thr Tyr Tyr Asn
660 665 670
Tyr Asp Glu Phe Asp Asp Leu Asp Glu Ser Arg Lys Tyr Ile Phe Asn
675 680 685
Lys Thr Ala Glu Tyr Gln Glu Glu Ile Asp Ile Leu Lys Asp Ile Lys
690 695 700
Ile Ile Gln Asn Lys Asp Ala Lys Ile Ala Val Ser Ile Phe Tyr Pro
705 710 715 7Z0
Asn Thr Leu Asn Gly Leu Val Lys Lys Leu Asn Asn Ile Ile Glu Tyr
725 730 735
Asn Lys Asn Ile Phe Val Ile Val Leu His Val Asp Lys Asn His Leu
740 - 745 750
Thr Pro Asp Ile Lys Lys Glu Ile Leu Ala Phe Tyr His Lys His Gln
755 760 765
Val Asn Ile Leu Leu Asn Asn Asp Ile Ser Tyr Tyr Thr Ser Asn Arg
770 775 780
Leu Ile Lys Thr Glu Ala His Leu Ser Asn Ile Asn Lys Leu Ser Gln
785 790 795 800
Leu Asn Leu Asn Cys Glu Tyr Ile Ile Phe Asp Asn His Asp Ser Leu
805 810 815
1 S/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Phe Val Lys Asn Asp Ser Tyr Ala Tyr Met Lys Lys Tyr Asp Val Gly
820 825 830
Met Asn Phe Ser Ala Leu Thr His Asp Trp Ile Glu Lys Ile Asn Ala
835 840 845
His Pro Pro Phe Lys Lys Leu Ile Lys Thr Tyr Phe Asn Asp Asn Asp
850 855 860
Leu Lys Ser Met Asn Val Lys Gly Ala Ser Gln Gly Met Phe Met Thr
865 870 875 880
Tyr Ala Leu Ala His Glu Leu Leu Thr Ile Ile Lys Glu Val Ile Thr
885 890 895
Ser Cys Gln Ser Ile Asp Ser Val Pro Glu Tyr Asn Thr Glu Asp Ile
900 905 910
Trp Phe Gln Phe Ala Leu Leu Ile Leu Glu Lys Lys Thr Gly His Val
915 920 925
Phe Asn Lys Thr Ser Thr Leu Thr Tyr Met Pro Trp Glu Arg Lys Leu
930 935 940
Gln Trp Thr Asn Glu Gln Ile Glu Ser Ala Lys Arg Gly Glu Asn Ile
945 950 955 960
Pro Val Asn Lys Phe Ile Ile Asn Ser Ile Thr Leu
965 970
<210>9
<211>1767
<212>DNA
<213>xenopus laevis
<400>
9
atgaaggaaaaagctgcagaaacaatggagattcctgaagggatccccaaagatctagag60
ccaaaacaccccaccctttggaggataatttattattcttttggtgtggtgctattagct120
accattacagcagcctatgtggcagagttccaggtcctcaaacatgaagccattctcttc180
tcccttgggctttatggtcttgcaatgcttctccacctgatgatgcagagcctctttgcc240
ttcctggagatacgcagggtaaataagagtgagcttccttgcagctttaagaagacagtg300
gctctgaccattgctgggtatcaggagaaccctgagtacctgataaagtgcttggaatcc360
tgcaagtatgtgaaataccccaaagataaactcaagatcattttggtcatcgatgggaac420
16/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
acagaggatg atgcctacat gatggagatg ttcaaagacg tgttccacgg tgaagatgta 480
ggcacctacg tatggaaggg aaattaccac actgttaaaa agcctgagga gaccaataag 540
ggatcctgtc ctgaggtttc taagcccttg aatgaagatg aaggtatcaa tatggtggaa 600
gaacttgtta gaaacaagag atgtgtgtgc atcatgcaac agtggggcgg aaaaagagag 660
gtcatgtaca cagcattcca ggccattggg acttctgtgg actatgtaca ggtctgtgac 720
tcggacacca aactggatga actggcaaca gtggaaatgg tgaaggttct ggaatccaat 780
gacatgtacg gcgcagtggg aggagacgtt cgcattctga acccttatga ttccttcatt 840
agtttcatga gcagcctgcg ttactggatg gcgtttaacg tggagagggc ctgccagtct 900
tacttcgact gcgtgtcctg tataagtgga cctctgggaa tgtaccggaa caacattctc 960
caggtgtttt tggaagcctg gtacagacag aaatttttgg gaacctattg tactttggga 1020
gatgatagac atctgacaaa ccgagtgctc agcatgggat atcgcaccaa atacacccac 1080
aaatccagag cattctccga aactccatcc ctgtatctcc ggtggttgaa ccagcaaacc 1140
cggtggacca agtcctactt ccgagagtgg ctgtataatg cccagtggtg gcacaagcat 1200
cacatctgga tgacctatga gtctgtggtg tccttcatct ttcccttctt catcactgcc 1260
actgttatcc gcctcatcta tgccggcacc atatggaatg ttgtgtggct cctcctgtgc 1320
atccagatca tgtctctctt caaatccatc tatgcctgct ggctccgcgg caacttcatt 1380
atgctcctga tgtctctcta ctccatgctg tacatgactg ggcttctgcc atccaagtac 1440
tttgccttgt tgaccttaaa caagaccggt tggggaacat ctgggcgcaa gaagatagta 1500
ggcaactaca tgccaatact gcccctgtcc atatgggcag ctgttctgtg tggaggggtg 1560
ggttatagta tctatatgga ctgtcaaaat gactggagca cccctgaaaa gcaaaaggag 1620
atgtaccatc tattgtatgg gtgtgtgggc tatgtaatgt actgggtaat catggctgtg 1680
atgtactggg tctgggtgaa gaggtgctgc aggaagaggt.cccaaactgt caccctggtc 1740
catgacattc ctgatatgtg tgtttaa 1767
<210> 10
<211> 588
<212> PRT
<213> xenopus laevis
<400> 10
Met Lys Glu Lys Ala Ala Glu Thr Met Glu Ile Pro Glu Gly Ile Pro
1 5 10 15
j 7/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Lys Asp Leu Glu Pro Lys His Pro Thr Leu Trp Arg Ile Ile Tyr Tyr
20 25 30
Ser Phe Gly Val Val Leu Leu Ala Thr Ile Thr Ala Ala Tyr Val Ala
35 40 45
Glu Phe Gln Val Leu Lys His Glu Ala Ile Leu Phe Ser Leu Gly Leu
50 55 60
Tyr Gly Leu Ala Met Leu Leu His Leu Met Met Gln Ser Leu Phe Ala
65 70 75 80
Phe Leu Glu Ile Arg Arg Val Asn Lys Ser Glu Leu Pro Cys Ser Phe
85 90 95
Lys Lys Thr Val Ala Leu Thr Ile Ala Gly Tyr Gln Glu Asn Pro Glu
100 105 110
Tyr Leu Ile Lys Cys Leu Glu Ser Cys Lys Tyr Val Lys Tyr Pro Lys
115 120 125
Asp Lys Leu Lys Ile Ile Leu Val Ile Asp Gly Asn Thr Glu Asp Asp
130 135 140
Ala Tyr Met Met Glu Met Phe Lys Asp Val Phe His Gly Glu Asp Val
145 ~ 150 155 160
Gly Thr Tyr Val Trp Lys Gly Asn Tyr His Thr Val Lys Lys Pro Glu
165 170 175
Glu Thr Asn Lys Gly Ser Cys Pro Glu Val Ser Lys Pro Leu Asn Glu
180 185 190
Asp Glu Gly Ile Asn Met Val Glu Glu Leu Val Arg Asn Lys Arg Cys
195 200 205
Val Cys Ile Met Gln Gln Trp Gly Gly Lys Arg Glu Val Met Tyr Thr
210 Z15 220
Ala Phe Gln Ala Ile Gly Thr Ser Val Asp Tyr Val Gln Val Cys Asp
225 230 235 240
Ser Asp Thr Lys Leu Asp Glu Leu Ala Thr Val Glu Met Val Lys Val
245 250 255
Leu Glu Ser Asn Asp Met Tyr Gly Ala Val Gly Gly Asp Val Arg Ile
260 265 270
18/207
<211> 588
<212> PRT
<213> xenopus l
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Leu Asn Pro Tyr Asp Ser Phe Ile Ser Phe Met Ser Ser Leu Arg Tyr
275 280 285
Trp Met Ala Phe Asn Val Glu Arg Ala Cys Gln Ser Tyr Phe Asp Cys
290 295 300
Val Ser Cys Ile Ser Gly Pro Leu Gly Met Tyr Arg Asn Asn Ile Leu
305 310 315 320
Gln Val Phe Leu Glu Ala Trp Tyr Arg Gln Lys Phe Leu Gly Thr Tyr
325 330 335
Cys Thr Leu Gly Asp Asp Arg His Leu Thr Asn Arg Val Leu Ser Met
340 345 350
Gly Tyr Arg Thr Lys Tyr Thr His Lys-Ser Arg~Ala Phe Ser Glu Thr
355 360 365
Pro Ser Leu Tyr Leu Arg Trp Leu Asn Gln Gln Thr Arg Trp Thr Lys
370 375 380
Ser Tyr Phe Arg Glu Trp Leu Tyr Asn Ala Gln Trp Trp His Lys His
385 390 395 400
His Ile Trp Met Thr Tyr Glu Ser.Val Val Ser Phe Ile Phe Pro Phe
405 410 415
Phe Ile Thr Ala Thr Val Ile Arg Leu Ile Tyr Ala Gly Thr Ile Trp
420 425 430
Asn Val Val Trp Leu Leu Leu Cys Ile Gln Ile Met Ser Leu Phe Lys
435 440 445
Ser Ile Tyr Ala Cys Trp Leu Arg Gly Asn Phe Ile Met Leu Leu Met
450 455 460
Ser Leu Tyr Ser Met Leu Tyr Met Thr Gly Leu Leu Pro Ser Lys Tyr
465 470 475 480
Phe Ala Leu Leu Thr Leu Asn Lys Thr Gly Trp Gly Thr Ser Gly Arg
485 490 495
Lys Lys Ile Val Gly Asn Tyr Met Pro Ile Leu Pro Leu Ser Ile Trp
500 505 510
Ala Ala Val Leu Cys Gly Gly Val Gly Tyr Ser Ile Tyr Met Asp Cys
515 520 525
19/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Gln Asn Asp Trp Ser Thr Pro Glu Lys Gln Lys Glu Met Tyr His Leu
530 535 540
Leu Tyr Gly Cys Val Gly Tyr Val Met Tyr Trp Val Ile Met Ala Val
545 550 555 560
Met Tyr Trp Val Trp Val Lys Arg Cys Cys Arg Lys Arg Ser Gln Thr
565 570 575
Val Thr Leu Val His Asp Ile Pro Asp Met Cys Val
580 585
<210> 11
<211> 1740
<212> DNA
<213> Chlorella virus PBCV-1
<400>
11
aagacttcttgaaagttacaatgggtaaaaatataatcataatggtttcgtggtacacca60
tcataacttcaaatctaatcgcggttggaggagcctctctaatcttggctccggcaatta120
ctgggtatgttctacattggaatattgctctctcgacaatctggggagtatcagcttatg180
gtattttcgtttttgggtttttccttgcacaagttttattttcagaactgaacaggaaac240
gtcttcgcaagtggatttctctcagacctaagggttggaatgatgttcgtttggctgtga300
tcattgctggatatcgcgaggatccttatatgttccagaagtgcctcgagtctgtacgtg360
actctgattatggcaacgttgcccgtctgatttgtgtgattgacggtgatgaggacgatg420
atatgaggatggctgccgtttacaaggcgatctacaatgataatatcaagaagcccgagt480
ttgttctgtgtgagtcagacgacaaggaaggtgaacgcatcgactctgatttctctcgcg540
acatttgtgtcctccagcctcatcgtggaaaacgggagtgtctttatactgggtttcaac600
ttgcaaagatggaccccagtgtcaatgctgtcgttctgattgacagcgataccgttctcg660
agaaggatgctattctggaagttgtatacccacttgcatgcgatcccgagatccaagccg720
ttgcaggtgagtgtaagatttggaacacagacactcttttgagtcttctcgtcgcttggc780
ggtactattctgcgttttgtgtggagaggagtgcccagtcttttttcaggactgttcagt840
gcgttggggggccactgggtgcctacaagattgatatcattaaggagattaaggacccct900
ggatttcccagcgctttcttggtcagaagtgtacttacggtgacgaccgccggctaacca960
acgagatcttgatgcgtggtaaaaaggttgtgttcactccatttgctgttggttggtctglOZO
acagtccgaccaatgtgtttcggtacatcgttcagcagacccgctggagtaagtcgtggt1080
gccgcgaaatttggtacaccctcttcgccgcgtggaagcacggtttgtctggaatttggc1140
20/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
tggcctttgaatgtttgtatcaaattacatacttcttcctcgtgatttacctcttttctc1200
gcctagccgttgaggccgaccctcgcgcccagacagccacggtgattgtgagcaccacgg1260
ttgcattgattaagtgtgggtatttttcattccgagccaaggatattcgggcgttttact1320
ttgtgctttatacatttgtttactttttctgtatgattccggccaggattactgcaatga1380
tgacgctttgggacattggctgggatactcgcggtggaaacgagaagccttccgttggca1440
cccgggtcgctctgtgggcaaagcaatatctcattgcatatatgtggtgggccgcggttg1500
ttggcgctggagtttacagcatcgtccataactggatgttcgattggaattctctttctt1560
atcgttttgctttggttggtatttgttcttacattgtttttattgttattgtgctggtgg1620
tttatttcaccggcaaaattacgacttggaatttcacgaagcttcagaaggagctaatcg1680
aggatcgcgttctgtacgatgcaactaccaatgctcagtctgtgtgatttttcctgcaag1740
<210> 12
<211> 567
<212> PRT
<213> chlorella virus PBCV-1
<400> 12
Met Gly Lys Asn .Ile Ile Ile Met Val Ser Trp Tyr Thr Ile Ile Thr
1 5 10 15
Ser Asn Leu Ile Ala val Gly Gly Ala Ser Leu Ile Leu Ala Pro Ala
20 25 30
Ile Thr Gly Tyr Val Leu His Trp Asn Ile Ala Leu Ser Thr Ile Trp
35 40 45
Gly Val Ser Ala Tyr Gly Ile Phe val Phe Gly Phe Phe Leu Ala Gln
50 55 60
Val Leu Phe Ser Glu Leu Asn Arg Lys Arg Leu Arg Lys Trp Ile Ser
65 70 75 80
Leu Arg Pro Lys Gly Trp Asn Asp Val Arg Leu Ala Val Ile Ile Ala
85 90 95
Gly Tyr Arg Glu Asp Pro Tyr Met Phe Gln Lys Cys Leu Glu Ser Val
100 105 110
Arg Asp Ser Asp Tyr Gly Asn Val Ala Arg Leu Ile Cys Val Ile Asp
115 120 125
21/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Gly Asp Glu Asp Asp Asp Met Arg Met Ala Ala Val Tyr Lys Ala Ile
130 135 140
Tyr Asn Asp Asn Ile Lys Lys Pro Glu Phe Val Leu Cys Glu Ser Asp
145 150 155 160
Asp Lys Glu Gly Glu Arg Ile Asp Ser Asp Phe Ser Arg Asp Ile Cys
165 170 175
Val Leu Gln Pro His Arg Gly Lys Arg Glu Cys Leu Tyr Thr Gly Phe
180 185 190
Gln Leu Ala Lys Met Asp Pro Ser Val Asn Ala Val Val Leu Ile Asp
195 200 205
Ser Asp Thr Val Leu Glu Lys Asp Ala Ile Leu Glu Val Val Tyr Pro
210 215 220
Leu Ala Cys Asp Pro Glu Ile Gln Ala Val Ala Gly Glu Cys Lys Ile
225 230 235 240
Trp Asn Thr Asp Thr Leu Leu Ser Leu Leu Val Ala Trp Arg Tyr Tyr
245 250 255
Ser Ala Phe Cys Val Glu Arg Ser Ala Gln Ser Phe Phe Arg Thr Val
260 265 270
Gln Cys Val Gly Gly Pro Leu Gly Ala Tyr Lys Asp Ile Ile Lys Glu
275 280 285
Ile Lys Asp Pro Trp Ile Ser Gln Arg Phe Leu Gly Gln Lys Cys Thr
290 295 300
Tyr Gly Asp Asp Arg Arg Leu Thr Asn Glu Ile Leu Met Arg Gly Lys
305 310 315 320
Lys Val Val Phe Thr Pro Phe Ala Val Gly Trp Ser Asp Ser Pro Thr
325 330 335
Asn Val Phe Arg Tyr Ile Val Gln Gln Thr Arg Trp Ser Lys Ser Trp
340 345 350
Cys Arg Glu Ile Trp Tyr Thr Leu Phe Ala Ala Trp Lys His Gly Leu
355 360 365
Ser Gly Ile Trp Leu Ala Phe Glu Cys Leu Tyr Gln Ile Thr Tyr Phe
370 375 380
22/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Phe Leu Val Ile Tyr Leu Phe Ser Arg Leu Ala Val Glu Ala Asp Pro
385 390 395 400
Arg Ala Gln Thr Ala Thr Val Ile Val Ser Thr Thr Val Ala Leu Ile
405 410 415
Lys Cys Gly Tyr Phe Ser Phe Arg Ala Lys Asp Ile Arg Ala Phe Tyr
420 425 430
Phe Val Leu Tyr Thr Phe Val Tyr Phe Phe Cys Met Ile Pro Ala Arg
435 440 445
Ile Thr Ala Met Met Thr Leu Trp Asp Ile Gly Trp Asp Thr Arg Gly
450 455 460
Gly Asn Glu Lys Pro Ser Val Gly Thr Arg Val Ala Leu Trp Ala Lys
465 470 475 480
Gln Tyr Leu Ile Ala Tyr Met Trp Trp Ala Ala Val Val Gly Ala Gly
485 490 495
Val Tyr Ser Ile Val His Asn Trp Met Phe Asp Trp Asn Ser Leu Ser
500 505 510
Tyr Arg Phe Ala Leu Val Gly Ile Cys Ser Tyr Ile Val Phe Ile Val
515 520 525
Ile Val Leu Val Val Tyr Phe Thr Gly Lys Ile Thr Thr Trp Asn Phe
530 535 540
Thr Lys Leu Gln Lys Glu Leu Ile Glu Asp Arg Val Leu Tyr Asp Ala
545 550 555 560
Thr Thr Asn Ala Gln Ser Val
565
<210> 13
<211> 1380
<212> DNA
<213> sulfolobus solfataricus
<400> 13
tgccctcatg cggttaagct tgaaatggcc ttttttagaa agagaaagga gttatctagt ~ 60
taaccaatct tgccaccaga aagttatcat agcatatagg gaagcaatat attgcactgc 120
23/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
tagtgcgatagaaccgtatattagagttttcaatttatcttctggaattaaataaatcat180
ggtcattacaaagggtattatagctataaatcctccgtaatgcaagaataaataaaagat240
aaagaagtcggaatggtaacgggttggcagatacaatagtaataagagcttagtattaat300
tacattaattgaggaatagatcttaagaattctagtgaaactcatataaaggaacaagag360
cgtaaataatggtaacagattggtgtatatcatattaaaaacgtataatgaacccctttt420
acttatactaccgtcagctatctcccttataaaattaagataatttgctcttgtccatct480
agttacttgtttcgtaaacatttttatgtctctagggggttttgtatatgccactgcatc540
aaagacttttacagccctataccctttttttataacaaaatcggttaaatctctatcatc600
ggaaattttaattggtcttccaaacattttcggctctaaaaactctttagataatatata660
tggttttacgagttcggtcctatatattacacattgtccacttaatattatagcacttcc720
aaaatagtttaccgccctgtttactatctcacttattctctcaaagaattcaccataata780
atatgcatatttatttttctcgtcatacataattctaatatttggccctactccacctac840
tgactcatcaaaaacacttaacatctttagtatagagtctttataaataatcgtatcact900
atctagaaacatcactagaggagatcttacatacttaactccctcggctaacgcgtatct960
tttccccttatgttcacgcatataaataaatttaccaccatatctttccgtaattgattt1020
gtatggttctagaacactatcccctacaacaataaattctaaccttgtgtcatataaagt1080
ccttatcactttttcaaaaatatctatttcctccttataaactggtatcacaactgtaag1140
atcagagagattataaaaacttgagtgttgagtttttctattattacttattactgcaaa1200
aaatgaattcaaaaagaaataaagaatagttataattgtgaatgaaagagaataaatgaa1260
atatgagactccgtgaaataagtgaaacataatcaccactataatgctcgatatcgaaat1320
atataacgatttttcctaattcaccattcgaattctccgttcaaaaaggggttagttaac1380
<210> 14
<211> 415
<212> PRT
<213> Sulfolobus solfataricus
<400> 14
Met Val Ile Met Phe His Leu Phe His Gly Val Ser Tyr Phe Ile Tyr
1 5 10 15
Ser Leu Ser Phe Thr Ile Ile Thr Ile Leu Tyr Phe Phe Leu Asn Ser
20 25 30
24/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Phe Phe Ala Val Ile Ser Asn Asn Arg Lys Thr Gln His Ser Ser Phe
35 40 45
Tyr Asn Leu Ser Asp Leu Thr Val Val Ile Pro Val Tyr Lys Glu Glu
50 55 60
Ile Asp Ile Phe Glu Lys Val Ile Arg Thr Leu Tyr Asp Thr Arg Leu
65 70 75 80
Glu Phe Ile Val Val Gly Asp Ser Val Leu Glu Pro Tyr Lys Ser Ile
85 90 95
Thr Glu Arg Tyr Gly Gly Lys Phe Ile Tyr Met Arg Glu His Lys Gly
100 105 110
Lys Arg Tyr Ala Leu Ala Glu Gly Val Lys Tyr Val Arg Ser Pro Leu
115 120 125
Val Met Phe Leu Asp Ser Asp Thr Ile Ile Tyr Lys Asp Ser Ile Leu
130 135 140
Lys Met Leu Ser Val Phe Asp Glu Ser Val Gly Gly Val Gly Pro Asn
145 150 155 160
Ile Arg Ile Met Tyr Asp Glu Lys Asn Lys Tyr Ala Tyr Tyr Tyr Gly
165 170 175
Glu Phe Phe Glu Arg Ile Ser Glu Ile Val Asn Arg Ala Val Asn Tyr
180 185 190
Phe Gly Ser Ala Ile Ile Leu Ser Gly Gln Cys Val Ile Tyr Arg Thr
195 200 205
Glu Leu Val Lys Pro Tyr Ile Leu Ser Lys Glu Phe Leu Glu Pro Lys
210 215 220
Met Phe Gly Arg Pro Ile Lys Ile Ser Asp Asp Arg Asp Leu Thr Asp
225 230 235 240
Phe Val Ile Lys Lys Gly Tyr Arg Ala Val Lys Val Phe Asp Ala Val
245 250 255
Ala Tyr Thr Ly5 Pro Pro Arg ASp Ile Lys Met Phe Thr Ly5 Gln Val
260 265 270
Thr Arg Trp Thr Arg Ala Asn Tyr Leu Asn Phe Ile Arg Glu Ile Ala
275 280 285
25/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Asp Gly Ser Ile Ser Lys Arg Gly Ser Leu Tyr Val Phe Asn Met Ile
290 295 300
Tyr Thr Asn Leu Leu Pro Leu Phe Thr Leu Leu Phe Leu Tyr Met Ser
305 310 315 320
Phe Thr Arg Ile Leu Lys Ile Tyr Ser Ser Ile Asn Val Ile Asn Thr
325 330 335
Lys Leu Leu Leu Leu Leu Tyr Leu Pro Thr Arg Tyr His Ser Asp Phe
340 345 350
Phe Ile Phe Tyr Leu Phe Leu His Tyr Gly Gly Phe Ile Ala Ile Ile
355 360 365
Pro Phe Val Met Thr Met Ile Tyr Leu Ile Pro Glu Asp Lys Leu Lys
370 375 380
Thr Leu Ile Tyr Gly Ser Ile Ala Leu Ala Val Gln Tyr Ile Ala Ser
385 390 395 400
Leu Tyr Ala Met Ile Thr Phe Trp Trp Gln Asp Trp Leu Thr Arg
405 410 415
<210> 15
<211> 417
<212> PRT
<213> Streptococcus equisimilis
<220>
<221> MISC_FEATURE
<222> (226)..(226)
<223> xaa = Ala, ser, or any other amino acid
<400> 15
Met Arg Thr Leu Lys Asn Leu Ile Thr Val Val Ala Phe Ser Ile Phe
1 5 10 15
Trp Val Leu Leu Ile Tyr Val Asn Val Tyr Leu Phe Gly Ala Lys Gly
20 25 30
Ser Leu Ser Ile Tyr Gly Phe Leu Leu Ile Ala Tyr Leu Leu Val Lys
35 40 45
26/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Met Ser Leu Ser Phe Phe Tyr Lys Pro Phe Lys Gly Arg Ala Gly Gln
50 55 60
Tyr Lys Val Ala Ala Ile Ile Pro Ser Tyr Asn Glu Asp Ala Glu Ser
65 70 75 80
Leu Leu Glu Thr Leu Lys Ser Val Gln Gln Gln Thr Tyr Pro Leu Ala
85 90 95
Glu Ile Tyr Val Val Asp Asp Gly Ser Ala Asp Glu Thr Gly Ile Lys
100 105 110
Arg Ile Glu Asp Tyr Val Arg Asp Thr Gly Asp Leu Ser Ser Asn Val
115 120 , 125
Ile Val His Arg Ser Glu Lys Asn Gln Gly Lys Arg His Ala Gln Ala
130 135 140
Trp Ala Phe Glu Arg Ser Asp Ala Asp Val Phe Leu Thr Val Asp Ser
145 150 155 160
Asp Thr Tyr Ile Tyr Pro Asp Ala Leu Glu Glu Leu Leu Lys Thr Phe
165 170 175
Asn Asp Pro Thr Val Phe Ala Ala Thr Gly His Leu Asn Val Arg Asn
180 185 190
Arg Gln Thr Asn Leu Leu Thr Arg Leu Thr Asp Ile Arg Tyr Asp Asn
195 200 205
Ala Phe Gly Val Glu Arg Ala Ala Gln Ser Val Thr Gly Asn Ile Leu
210 215 220
Val Xaa Ser Gly Pro Leu Ser Val Tyr Arg Arg Glu Val Val Val Pro
225 230 235 240
Asn Ile Asp Arg Tyr Ile Asn Gln Thr Phe Leu Gly Ile Pro Val Ser
245 250 255
Ile Gly Asp Asp Arg Cys Leu Thr Asn Tyr Ala Thr Asp Leu Gly Lys
260 265 270
Thr Val Tyr Gln Ser Thr Ala Lys Cys Ile Thr Asp Val Pro Asp Lys
275 280 285
Met Ser Thr Tyr Leu Lys Gln Gln Asn Arg Trp Asn Lys Ser Phe Phe
290 295 300
27/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Arg Glu ser Ile Ile ser Val Lys Lys Ile Met Asn Asn Pro Phe Val
305 310 315 320
Ala Leu Trp Thr Ile Leu Glu val ser Met Phe Met Met Leu val Tyr
325 330 335
ser val val Asp Phe Phe Val Gly Asn val Arg Glu Phe Asp Trp Leu
340 345 350
Arg Val Leu Ala Phe Leu Val Ile Ile Phe Ile val Ala Leu Cys Arg
355 360 365
Asn Ile His Tyr Met Leu Lys His Pro Leu Ser Phe Leu Leu Ser Pro
370 375 380
Phe Tyr Gly Val Leu His Leu Phe Val Leu Gln Pro Leu Lys Leu Tyr
385 390 395 400
Ser Leu Phe Thr Ile Arg Asn Ala Asp Trp Gly Thr Arg Lys Lys Leu
405 410 415
Leu
<210> 16
<211> 417
<212> PRT
<213> Streptococcus equisimilis
<220>
<221> MISC_FEATURE
<222> (262)..(262)
<223> xaa = Ala, ser or any other amino acid
<400> 16
Met Arg Thr Leu Lys Asn Leu Ile Thr Val Val Ala Phe ser Ile Phe
1 5 10 15
Trp Val Leu Leu Ile Tyr Val Asn Val Tyr Leu Phe Gly Ala Lys Gly
20 25 30
28/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Ser Leu Ser Ile Tyr Gly Phe Leu Leu Ile Ala Tyr Leu Leu Val Lys
35 40 45
Met Ser Leu Ser Phe Phe Tyr Lys Pro Phe Lys Gly Arg Ala Gly Gln
50 55 60
Tyr Lys Val Ala Ala Ile Ile Pro Ser Tyr Asn Glu Asp Ala Glu Ser
65 70 75 80
Leu Leu Glu Thr Leu Lys Ser Val Gln Gln Gln Thr Tyr Pro Leu Ala
85 90 95
Glu Ile Tyr Val Val Asp Asp Gly Ser Ala Asp Glu Thr Gly Ile Lys
100 105 110
Arg Ile Glu Asp Tyr Val Arg Asp Thr Gly Asp Leu Ser Ser Asn Val
115 120 125
Ile Val His Arg Ser Glu Lys Asn Gln Gly Lys Arg His Ala Gln Ala
130 135 140
Trp Ala Phe Glu Arg Ser Asp Ala Asp Val Phe Leu Thr Val Asp Ser
145 150 155 160
Asp Thr Tyr Ile Tyr Pro Asp Ala Leu Glu Glu Leu Leu Lys Thr Phe ,
165 170 175
Asn Asp Pro Thr Val Phe Ala Ala Thr Gly His Leu Asn Val Arg Asn
180 185 190
Arg Gln Thr Asn Leu Leu Thr Arg Leu Thr Asp Ile Arg Tyr Asp Asn
195 200 205
Ala Phe Gly Val Glu Arg Ala Ala Gln Ser Val Thr Gly Asn Ile Leu
210 215 220
Val Cys Ser Gly Pro Leu Ser Val Tyr Arg Arg Glu Val Val.Va1 Pro
225 230 235 240
Asn Ile Asp Arg Tyr Ile Asn Gln Thr Phe Leu Gly Ile Pro Val Ser
245 250 255
Ile Gly Asp Asp Arg Xaa Leu Thr Asn Tyr Ala Thr Asp Leu Gly Lys
260 265 270
Thr Val Tyr Gln Ser Thr Ala Lys Cys Ile Thr Asp Val Pro Asp Lys
275 280 285
29/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Met Ser Thr Tyr Leu Lys Gln Gln Asn Arg Trp Asn Lys Ser Phe Phe
290 295 300
Arg Glu Ser Ile Ile Ser Val Lys Lys Ile Met Asn Asn Pro Phe Val
305 310 315 320
Ala Leu Trp Thr Ile Leu Glu Val Ser Met Phe Met Met Leu Val Tyr
325 330 335
Ser Val Val Asp Phe Phe Val Gly Asn Val Arg Glu Phe Asp Trp Leu
340 345 350
Arg Val Leu Ala Phe Leu Val Ile Ile Phe Ile Val Ala Leu Cys Arg
355 360 365
Asn Ile His Tyr Met Leu Lys His Pro Leu Ser Phe Leu Leu Ser Pro
370 375 380
Phe Tyr Gly Val Leu His Leu Phe Val Leu Gln Pro Leu Lys Leu Tyr
385 390 395 400
Ser Leu Phe Thr Ile Arg Asn Ala Asp Trp Gly Thr Arg Lys Lys Leu
405 410 415
Leu
<210> 17
<211> 417
<212> PRT
<213> Streptococcus equisimilis
<220>
<221> MISC_FEATURE
<222> (281)..(281)
<223> Xaa = Ala, Ser or any other amino acid
<400> 17
Met Arg Thr Leu Lys Asn Leu Ile Thr Val Val Ala Phe Ser Ile Phe
1 5 10 15
Trp Val Leu Leu Ile Tyr Val Asn Val Tyr Leu Phe Gly Ala Lys Gly
20 25 30
30/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Ser Leu Ser Ile Tyr Gly Phe Leu Leu Ile Ala Tyr Leu Leu Val Lys
35 40 45
Met ser Leu ser Phe Phe Tyr Lys Pro Phe Lys Gly Arg Ala Gly Gln
50 55 60
Tyr Lys Val Ala Ala Ile Ile Pro Ser Tyr Asn Glu Asp Ala Glu Ser
65 70 75 80
Leu Leu Glu Thr Leu Lys Ser Val Gln Gln Gln Thr Tyr Pro Leu Ala
85 90 95
Glu Ile Tyr val val Asp Asp Gly Ser Ala Asp Glu Thr Gly Ile Lys
loo l05 llo
Arg Ile Glu Asp Tyr Val Arg Asp Thr Gly Asp Leu Ser Ser Asn Val
115 120 125
Ile Val His Arg Ser Glu Lys Asn Gln Gly Lys Arg His Ala Gln Ala
130 135 140
Trp Ala Phe Glu Arg Ser Asp Ala Asp Val Phe Leu Thr Val Asp Ser
145 150 155 160
Asp Thr Tyr Ile Tyr Pro Asp Ala Leu Glu Glu Leu Leu Lys Thr Phe
165 170 175
Asn Asp Pro Thr Val Phe Ala Ala Thr Gly His Leu Asn Val Arg Asn
180 185 190
Arg Gln Thr Asn Leu Leu Thr Arg Leu Thr Asp Ile Arg Tyr Asp Asn
195 200 205
Ala Phe Gly Val Glu Arg Ala Ala Gln Ser Val Thr Gly Asn Ile Leu
210 215 220
val Cys Ser Gly Pro Leu ser val Tyr Arg Arg Glu val val val Pro
225 230 235 240
Asn Ile Asp Arg Tyr Ile Asn Gln Thr Phe Leu Gly Ile Pro Val Ser
245 250 255
Ile Gly Asp Asp Arg Cys Leu Thr Asn Tyr Ala Thr Asp Leu Gly Lys
260 265 270
Thr val Tyr Gln Ser Thr Ala Lys Xaa Ile Thr Asp Val Pro Asp Lys
275 280 285
31/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Met Ser Thr Tyr Leu Lys Gln Gln Asn Arg Trp Asn Lys Ser Phe Phe
290 295 300
Arg Glu Ser Ile Ile Ser Val Lys Lys Ile Met Asn Asn Pro Phe Val
305 310 315 320
Ala Leu Trp Thr Ile Leu Glu Val Ser Met Phe Met Met Leu Val Tyr
325 330 335
Ser Val Val Asp Phe Phe Val Gly Asn Val Arg Glu Phe Asp Trp Leu
340 345 350
Arg Val Leu Ala Phe Leu Val Ile Ile Phe Ile Val Ala Leu Cys Arg
355 360 365
Asn Ile His Tyr Met Leu Lys His Pro Leu Ser Phe Leu Leu Ser Pro
370 375 380
Phe Tyr Gly Val Leu His Leu Phe Val Leu Gln Pro Leu Lys Leu Tyr
385 390 395 400
Ser Leu Phe Thr Ile Arg Asn Ala Asp Trp Gly Thr Arg Lys Lys Leu
405 410 415
Leu
<210> 18
<211> 417
<212> PRT
<213> streptococcus equisimilis
<220>
<221> MISC_FEATURE
<222> (367)..(367)
<223> xaa = Ala, Ser or any other amino acid
<400> 18
Met Arg Thr Leu Lys Asn Leu Ile Thr Val Val Ala Phe Ser Ile Phe
1 5 10 15
32/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Trp val Leu Leu Ire -lyr val Asn Va1 Tyr Leu Phe Gly Ata Ly5 Gty
20 25 30
Ser Leu Ser Iie Tyr Gly Phe Leu Leu Ile Ala Tyr Leu Leu Val Lys
35 40 45
Met Ser Leu Ser Phe Phe Tyr Lys Pro Phe Lys Giy Arg Ala Gly Gln
50 55 60
Tyr Lys Val Ala Ala Iie Ile Pro Ser Tyr Asn Glu Asp Ala Glu Ser
65 70 75 80
Leu Leu Glu Thr Leu Lys Ser Val Gln Gln Gin Thr Tyr Pro Leu Ala
85 90 95
Giu Ile Tyr Val val Asp Asp Giy Ser Ala Asp Glu Thr Gly Ile Lys
loo l05 llo
Arg Ile Giu Asp Tyr Val Arg Asp Thr Gly Asp Leu Ser Ser Asn Val
I15 120 125
Ile Val His Arg Ser Glu Lys Asn Gln Gly Lys Arg His Aia Gin Ala
130 135 140
Trp Ala Phe Glu Arg Ser Asp Ala Asp Vai Phe Leu Thr Val asp Ser
145 150 155 160
Asp Thr Tyr Ile Tyr Pro Asp Ala Leu Glu Glu Leu Leu Lys Thr Phe
165 170 175
Asn Asp Pro Thr val Phe Ala Ala Thr Gly His Leu Asn Val Arg Asn
180 185 190
Arg Gin Thr Asn Leu Leu Thr Arg Leu Thr Asp Iie Arg Tyr asp Asn
195 200 205
Ala Phe Gly Val Glu Arg Aia Ala Gln Ser Val Thr Gly Asn Ile Leu
210 215 220
val Cys Ser Gly Pro Leu Ser val Tyr Arg Arg Glu vai val Val Pro
225 230 235 240
Asn Iie Asp Arg Tyr Ile Asn Gln Thr Phe Leu Gly Ile Pro Val Ser
245 250' 255
Iie Giy Asp Asp Arg Cys Leu Thr Asn Tyr Ala Thr Asp Leu Gly Lys
260 265 270
33/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Thr Val Tyr Gln Ser Thr Ala Lys Cys Ile Thr Asp Val Pro Asp Lys
275 280 285
Met Ser Thr Tyr Leu Lys Gln Gln Asn Arg Trp Asn Lys Ser Phe Phe
290 295 300
Arg Glu Ser Ile Ile Ser Val Lys Lys Ile Met Asn Asn Pro Phe Val
305 310 315 320
Ala Leu Trp Thr Ile Leu Glu Val Ser Met Phe Met Met Leu Val Tyr
325 330 335
Ser Val Val Asp Phe Phe Val Gly Asn Val Arg Glu Phe Asp Trp Leu
340 345 350
Arg Val Leu Ala Phe Leu Val Ile Ile Phe Ile Val Ala Leu Xaa Arg
355 360 365
Asn Ile His Tyr Met Leu Lys His Pro Leu Ser Phe Leu Leu Ser Pro
370 375 380
Phe Tyr Gly Val Leu His Leu Phe Val Leu Gln Pro Leu Lys Leu Tyr
385 390 395 400
Ser Leu Phe Thr Ile Arg Asn Ala Asp Trp Gly Thr Arg Lys Lys Leu
405 410 415
Leu
<210> 19
<211> 417
<212> PRT
<213> Streptococcus equisimilis
<220> '
<221> MISC_FEATURE
<222> (226)..(226)
<223> xaa = Ala, Ser or any other amino acid
<220>
<221> MISC_FEATURE
34/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
<222> (262)..(262)
<223> xaa = Ala, Ser or any other amino acid
<400> 19
Met Arg Thr Leu Lys Asn Leu Ile Thr Val Val Ala Phe Ser Ile Phe
1 5 10 15
Trp Val Leu Leu Ile Tyr Val Asn Val Tyr Leu Phe Gly Ala Lys Gly
20 25 30
Ser Leu Ser Ile Tyr Gly Phe Leu Leu Ile Ala Tyr Leu Leu Val Lys
35 40 45
Met Ser Leu Ser Phe Phe Tyr Lys Pro Phe Lys Gly Arg Ala Gly Gln
50 55 60
Tyr Lys Val Ala Ala Ile Ile Pro Ser Tyr Asn Glu Asp Ala Glu Ser
6S 70 75 80
Leu Leu Glu Thr Leu Lys Ser Val Gln Gln Gln Thr Tyr Pro Leu Ala
85 90 95
Glu Ile Tyr Val Val Asp Asp Gly Ser Ala Asp Glu Thr Gly Ile Lys
100 105 110
Arg Ile Glu Asp Tyr Val Arg Asp Thr Gly Asp Leu Ser Ser Asn Val
115 120 125
Ile Val His Arg Ser Glu Lys Asn Gln Gly Lys Arg His Ala Gln Ala
130 135 140
Trp Ala Phe Glu Arg Ser Asp Ala Asp Val Phe Leu Thr Val Asp Ser
145 150 155 160
Asp Thr Tyr Ile Tyr Pro Asp Ala Leu Glu Glu Leu Leu Lys Thr Phe
165 170 175
Asn Asp Pro Thr Val Phe Ala Ala Thr Gly His Leu Asn Val Arg Asn
180 185 190
Arg Gln Thr Asn Leu Leu Thr Arg Leu Thr Asp Ile Arg Tyr Asp Asn
195 200 205
Ala Phe Gly Val Glu Arg Ala Ala Gln 5er Val Thr Gly Asn Ile Leu
210 215 220
35/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Val Xaa Ser Gly Pro Leu Ser Val Tyr Arg Arg Glu Val Val Val Pro
225 230 235 240
Asn Ile Asp Arg Tyr Ile Asn Gln Thr Phe Leu Gly Ile Pro Val Ser
245 250 255
Ile Gly Asp Asp Arg Xaa Leu Thr Asn Tyr Ala Thr Asp Leu Gly Lys
260 265 270
Thr Val Tyr Gln Ser Thr Ala Lys Cys Ile Thr Asp Val Pro Asp Lys
275 280 285
Met Ser Thr Tyr Leu Lys Gln Gln Asn Arg Trp Asn Lys Ser Phe Phe
290 295 300
Arg Glu Ser Ile Ile Ser Val Lys Lys Ile Met Asn Asn Pro Phe Val
305 310' 315 320
Ala Leu Trp Thr Ile Leu Glu Val Ser Met Phe Met Met Leu Val Tyr
325 330 335
Ser Val Val Asp Phe Phe Val Gly Asn Val Arg Glu Phe Asp Trp Leu
340 345 350
Arg Val Leu Ala Phe Leu Val Ile Ile Phe Ile Val Ala Leu Cys Arg
355 360 365
Asn Ile His Tyr Met Leu Lys His Pro Leu Ser Phe Leu Leu Ser Pro
370 375 380
Phe Tyr Gly Val Leu His Leu Phe Val Leu Gln Pro Leu Lys Leu Tyr
385 390 395 400
Ser Leu Phe Thr Ile Arg Asn Ala Asp Trp Gly Thr Arg Lys Lys Leu
405 410 415
Leu
<210> 20
<211> 417
<212> PRT
<213> Streptococcus equisimilis
<220>-
36/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
<221> MISC_FEATURE
<222> (226)..(226)
<223> Xaa = Ala, Ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (281)..(281)
<223> xaa = Ala, Ser or any other amino acid
<400> 20
Met Arg Thr Leu Lys Asn Leu Ile Thr Val Val Ala Phe Ser Ile Phe
1 5 10 15
Trp Val Leu Leu Ile Tyr Val Asn Val Tyr Leu Phe Gly Ala Lys Gly
20 25 30
Ser Leu Ser Ile Tyr Gly Phe Leu Leu Ile Ala Tyr Leu Leu Val Lys
35 40 45
Met Ser Leu Ser Phe Phe Tyr Lys Pro Phe Lys Gly Arg Ala Gly Gln
50 55 60
Tyr Lys Val Ala Ala Ile Ile Pro Ser Tyr Asn Glu Asp Ala Glu Ser
65 70 75 80
Leu Leu Glu Thr Leu Lys Ser Val Gln Gln Gln Thr Tyr Pro Leu Ala
85 90 95
Glu Ile Tyr Val Val Asp Asp Gly Ser Ala Asp Glu Thr Gly Ile Lys
100 105 110
Arg Ile Glu ASp Tyr Val Arg Asp Thr Gly Asp Leu Ser Ser Asn Val
115 120 125
Ile Val His Arg Ser Glu Lys Asn Gln Gly Lys Arg His Ala Gln Ala
130 135 140
Trp Ala Phe Glu Arg Ser Asp Ala Asp Val Phe Leu Thr Val Asp Ser
145 150 155 160
Asp Thr Tyr Ile Tyr Pro Asp Ala Leu Glu Glu Leu Leu Lys Thr Phe
165 170 175
37/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Asn Asp Pro Thr Val Phe Ala Ala Thr Gly His Leu Asn Val Arg Asn
180 185 190
Arg Gln Thr Asn Leu Leu Thr Arg Leu Thr Asp Ile Arg Tyr Asp Asn
195 200 205
Ala Phe Gly Val Glu Arg Ala Ala Gln Ser Val Thr Gly Asn Ile Leu
210 215 220
Val Xaa Ser Gly Pro Leu Ser Val Tyr Arg Arg Glu Val Val Val Pro
225 230 235 240
Asn Ile Asp Arg Tyr Ile Asn Gln Thr Phe Leu Gly Ile Pro Val Ser
245 250 255
Ile Gly Asp Asp Arg Cys Leu Thr Asn Tyr Ala Thr Asp Leu Gly Lys
260 265 270
Thr Val Tyr Gln Ser Thr Ala Lys Xaa Ile Thr Asp Val Pro Asp Lys
275 280 285
Met Ser Thr Tyr Leu Lys Gln Gln Asn Arg Trp Asn Lys Ser Phe Phe
290 295 300
Arg Glu Ser Ile Ile Ser Val Lys Lys Ile Met Asn Asn Pro Phe Val
305 310 315 320
Ala Leu Trp Thr Ile Leu Glu Val Ser Met Phe Met Met Leu Val Tyr
325 330 335
Ser Val Val Asp Phe Phe Val Gly Asn Val Arg Glu Phe Asp Trp Leu
340 345 350
Arg Val Leu Ala Phe Leu Val Ile Ile Phe Ile Val Ala Leu Cys Arg
355 360 365
Asn Ile His Tyr Met Leu Lys His Pro Leu Ser Phe Leu Leu Ser Pro
370 375 380
Phe Tyr Gly Val Leu His Leu Phe Val Leu Gln Pro Leu Lys Leu Tyr
385 390 395 400
Ser Leu Phe Thr Ile Arg Asn Ala Asp Trp Gly Thr Arg Lys Lys Leu
405 410 415
Leu
38/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
<210> 21
<211> 417
<212> PRT
<213> Streptococcus equisimilis
<220>
<221> MISC_FEATURE
<222> (226)..(226)
<223> xaa = Ala, Ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (367)..(367)
<223> xaa = Ala, Ser or any other amino acid
<400> 21
Met Arg Thr Leu Lys Asn Leu Ile Thr Val Val Ala Phe Ser Ile Phe
1 5 10 15
Trp Val Leu Leu Ile Tyr Val Asn val Tyr Leu Phe Gly Ala Lys Gly
20 25 30
Ser Leu Ser Ile Tyr Gly Phe Leu Leu Ile Ala Tyr Leu Leu Val Lys
35 40 45
Met Ser Leu Ser Phe Phe Tyr Lys Pro Phe Lys Gly Arg Ala Gly Gln
50 55 60
Tyr Lys Val Ala Ala Ile Ile Pro Ser Tyr Asn Glu Asp Ala Glu Ser
65 70 75 80
Leu Leu Glu Thr Leu Lys Ser Val Gln Gln Gln Thr Tyr Pro Leu Ala
85 90 95
Glu Ile Tyr Val Val Asp Asp Gly Ser Ala Asp Glu Thr Gly Ile Lys
100 105 110
Arg Ile Glu Asp Tyr Val Arg Asp Thr Gly Asp Leu Ser Ser Asn Val
115 120 125
39/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Ile Val His Arg Ser Glu Lys Asn Gln Gly Lys Arg His Ala Gln Ala
130 135 140
Trp Ala Phe Glu Arg Ser Asp Ala Asp Val Phe Leu Thr Val Asp Ser
145 150 155 160
Asp Thr Tyr Ile Tyr Pro Asp Ala Leu Glu Glu Leu Leu Lys Thr Phe
165 170 175
Asn Asp Pro Thr Val Phe Ala Ala Thr Gly His Leu Asn Val Arg Asn
180 185 190
Arg Gln Thr Asn Leu Leu Thr Arg Leu Thr Asp Ile Arg Tyr Asp Asn
195 200 205
Ala Phe Gly Val Glu Arg Ala Ala Gln Ser Val Thr Gly Asn Ile Leu
210 Z15 220
Val Xaa Ser Gly Pro Leu Ser Val Tyr Arg Arg Glu Val Val Val Pro
225 230 235 240-
Asn Ile Asp Arg Tyr Ile Asn Gln Thr Phe Leu Gly Ile Pro Val Ser
245 250 255
Ile Gly Asp Asp Arg Cys Leu Thr Asn Tyr Ala Thr Asp Leu Gly Lys
260 265 270
Thr Val Tyr Gln Ser Thr Ala Lys Cys Ile Thr Asp Val Pro Asp Lys
275 280 285
Met Ser Thr Tyr Leu Lys Gln Gln Asn Arg Trp Asn Lys Ser Phe Phe
290 295 300
Arg Glu Ser Ile Ile Ser Val Lys Lys Ile Met Asn Asn Pro Phe Val
305 310 315 320
Ala Leu Trp Thr Ile Leu Glu Val Ser Met Phe Met Met Leu Val Tyr
325 330 335
Ser Val Val Asp Phe Phe Val Gly Asn Val Arg Glu Phe Asp Trp Leu
340 345 350
Arg Val Leu Ala Phe Leu Val Ile Ile Phe Ile Val Ala Leu Xaa Arg
355 360 365
Asn Ile His Tyr Met Leu Lys His Pro Leu Ser Phe Leu Leu Ser Pro
370 375 380
40/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Phe Tyr Gly Val Leu His Leu Phe Val Leu Gln Pro Leu Lys Leu Tyr
385 390 395 400
Ser Leu Phe Thr Ile Arg Asn Ala Asp Trp Gly Thr Arg Lys Lys Leu
405 410 415
Leu
<210> 22
<211> 417
<212> PRT
<213> Streptococcus equisimilis
<220>
<Z21> MISC_FEATURE
<222>. (262)..(262)
<223> xaa = Ala, Ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (281)..(281)
<223> xaa = Ala, Ser or any other amino acid
<400> 22
Met Arg Thr Leu Lys Asn Leu Ile Thr Val Val Ala Phe Ser Ile Phe
1 5 10 15
Trp Val Leu Leu Ile Tyr Val Asn Val Tyr Leu Phe Gly Ala Lys Gly
20 25 30
Ser Leu Ser Ile Tyr Gly Phe Leu Leu Ile Ala Tyr Leu Leu Val Lys
35 40 45
Met Ser Leu Ser Phe Phe Tyr Lys Pro Phe Lys Gly Arg Ala Gly Gln
50 55 60
Tyr Lys Val Ala Ala Ile Ile Pro Ser Tyr Asn Glu Asp Ala Glu Ser
65 70 75 80
41/207
.~...,~,~.~~_. _.
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Leu Leu Glu Thr Leu Lys Ser Val Gln Gln Gln Thr Tyr Pro Leu Ala
85 90 95
Glu Ile Tyr Val Val Asp Asp Gly Ser Ala Asp Glu Thr Gly Ile Lys
100 105 110
Arg Ile Glu Asp Tyr Val Arg Asp Thr Gly Asp Leu Ser Ser Asn Val
115 120 125
Ile Val His Arg Ser Glu Lys Asn Gln Gly Lys Arg His Ala Gln Ala
130 135 140
Trp Ala Phe Glu Arg Ser Asp Ala Asp Val Phe Leu Thr Val Asp Ser
145 150 1S5 160
Asp Thr Tyr Ile Tyr Pro Asp Ala Leu Glu Glu Leu Leu Lys Thr Phe
165 170 175
Asn Asp Pro Thr Val Phe Ala Ala Thr Gly His Leu Asn Val Arg Asn
180 185 190
Arg Gln Thr Asn Leu Leu Thr Arg Leu Thr Asp Ile Arg Tyr Asp Asn
195 200 205
Ala Phe Gly Val Glu Arg Ala Ala Gln Ser Val Thr Gly Asn Ile Leu
210 215 220
Val Cys Ser Gly Pro Leu Ser val Tyr Arg Arg Glu Val Val val Pro
225 230 235 240
Asn Ile Asp Arg Tyr Ile Asn Gln Thr Phe Leu Gly Ile Pro Val Ser
245 250 255
Ile Gly Asp Asp Arg Xaa Leu Thr Asn Tyr Ala Thr Asp Leu Gly Lys
260 265 270
Thr Val Tyr Gln Ser Thr Ala Lys Xaa Ile Thr Asp Val Pro Asp Lys
275 280 285
Met Ser Thr Tyr Leu Lys Gln Gln Asn Arg Trp Asn Lys Ser Phe Phe
290 295 300
Arg Glu Ser Ile Ile Ser Val Lys Lys Ile Met Asn Asn Pro Phe Val
305 310 315 320
Ala Leu Trp Thr Ile Leu Glu Val Ser Met Phe Met Met Leu Val Tyr
325 330 335
42/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Ser Val Val Asp Phe Phe Val Gly Asn Val Arg Glu Phe Asp Trp Leu
340 345 350
Arg Val Leu Ala Phe Leu Val Ile Ile Phe Ile Val Ala Leu Cys Arg
355 360 365
Asn Ile His Tyr Met Leu Lys His Pro Leu Ser Phe Leu Leu Ser Pro
370 375 380
Phe Tyr Gly Val Leu His Leu Phe Val Leu Gln Pro Leu Lys Leu Tyr
385 390 395 400
Ser Leu Phe Thr Ile Arg Asn Ala Asp Trp Gly Thr Arg Lys Lys Leu
405 410 415
Leu
<210> 23
<211> 417
<212> PRT
<213> streptococcus equisimilis
<220>
<221> MISC_FEATURE
<222> (262)..(262)
<223> xaa = Ala, Ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (367)..(367)
<223> xaa = Ala, Ser or any other amino acid
<400> 23
Met Arg Thr Leu Lys Asn Leu Ile Thr Val Val Ala Phe Ser Ile Phe
1 5 10 15
Trp Val Leu Leu Ile Tyr Val Asn Val Tyr Leu Phe Gly Ala Lys Gly
20 25 30
43/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Ser Leu Ser Ile Tyr Gly Phe Leu Leu Ile Ala Tyr Leu Leu Val Lys
35 40 45
Met Ser Leu Ser Phe Phe Tyr Lys Pro Phe Lys Gly Arg Ala Gly Gln
50 55 60
Tyr Lys Val Ala Ala Ile Ile Pro Ser Tyr Asn Glu Asp Ala Glu Ser
65 70 75 80
Leu Leu Glu Thr Leu Lys Ser Val Gln Gln Gln Thr Tyr Pro Leu Ala
85 90 95
Glu Ile Tyr Val Val Asp Asp Gly Ser Ala Asp Glu Thr Gly Ile Lys
100 105 110
Arg Ile Glu Asp Tyr Val Arg Asp Thr Gly Asp Leu Ser Ser Asn Val
115 120 125
Ile Val His Arg Ser Glu Lys Asn Gln Gly Lys Arg His Ala Gln Ala,
130 135 140
Trp Ala Phe Glu Arg Ser Asp Ala Asp Val Phe Leu Thr Val Asp Ser
145 150 155 160
Asp Thr Tyr Ile Tyr Pro Asp Ala Leu Glu Glu Leu Leu Lys Thr Phe
165 170 175
Asn Asp Pro Thr Val Phe Ala Ala Thr Gly His Leu Asn Val Arg Asn
180 185 190
Arg Gln Thr Asn Leu Leu Thr Arg Leu Thr Asp Ile Arg Tyr Asp Asn
195 200 205
Ala Phe Gly Val Glu Arg Ala Ala Gln Ser Val Thr Gly Asn Ile Leu
210 215 220
Val Cys Ser Gly Pro Leu Ser Val Tyr Arg Arg Glu Val Val Val Pro
225 230 235 240
Asn Ile Asp Arg Tyr Ile Asn Gln Thr Phe Leu Gly Ile Pro Val Ser
245 250 255
Ile Gly Asp Asp Arg Xaa Leu Thr Asn Tyr Ala Thr Asp Leu Gly Lys
260 265 270
Thr Val Tyr Gln Ser Thr Ala Lys Cys Ile Thr Asp Val Pro Asp Lys
275 280 285
44/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Met Ser Thr Tyr Leu Lys Gln Gln Asn Arg Trp Asn Lys Ser Phe Phe
290 295 300
Arg Glu Ser Ile Ile Ser Val Lys Lys Ile Met Asn Asn Pro Phe Val
305 310 315 320
Ala Leu Trp Thr Ile Leu Glu Val Ser Met Phe Met Met Leu Val Tyr
325 330 335
Ser Val Val Asp Phe Phe Val Gly Asn Val Arg Glu Phe Asp Trp Leu
340 345 350
Arg Val~Leu Ala Phe Leu Val Ile Ile Phe Ile Val Ala Leu Xaa Arg
355 360 365
Asn Ile His Tyr Met Leu Lys His Pro Leu Ser Phe Leu Leu Ser Pro
370 375 380
Phe Tyr Gly Val Leu His Leu Phe Val Leu Gln Pro Leu Lys Leu Tyr
385 390 395 400
Ser Leu Phe Thr Ile Arg Asn Ala Asp Trp Gly Thr Arg Lys Lys Leu
405 410 415
Leu
<210> 24
<211> 417
<212> PRT
<213> Streptococcus equisimilis
<220>
<221> MISC_FEATURE
<222> (281)..(281)
<223> Xaa = Ala, ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (367)..(367)
<223> Xaa = Ala, Ser or any other amino acid
45/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
<400> 24
Met Arg Thr Leu Lys Asn Leu Ile Thr Val Val Ala Phe Ser Ile Phe
1 5 10 15
Trp Val Leu Leu Ile Tyr Val Asn Val Tyr Leu Phe Gly Ala Lys Gly
20 25 30
Ser Leu Ser Ile Tyr Gly Phe Leu Leu Ile Ala Tyr Leu Leu Val Lys
35 40 45
Met Ser Leu Ser Phe Phe Tyr Lys Pro Phe Lys Gly Arg Ala Gly Gln
50 55 60
Tyr Lys Val Ala Ala Ile Ile Pro Ser Tyr Asn Glu Asp Ala Glu Ser
65 70 75 80
Leu Leu Glu Thr Leu Lys Ser Val Gln Gln Gln Thr Tyr Pro Leu Ala
85 90 95
Glu Ile Tyr Val Val Asp Asp Gly Ser Ala Asp Glu Thr Gly Ile Lys
100 105 110
Arg Ile Glu Asp Tyr Val Arg Asp Thr Gly Asp Leu Ser Ser Asn Val
115 120 125
Ile Val His Arg Ser Glu Ly5 Asn Gln Gly Ly5 Arg His Ala Gln Ala
130 135 140
Trp Ala Phe Glu Arg Ser Asp Ala Asp Val Phe Leu Thr Val Asp Ser
145 150 155 160
Asp Thr Tyr Ile Tyr Pro Asp Ala Leu Glu Glu Leu Leu Lys Thr Phe
165 170 175
Asn Asp Pro Thr Val Phe Ala Ala Thr Gly His Leu Asn Val Arg Asn
180 185 190
Arg Gln Thr Asn Leu Leu Thr Arg Leu Thr Asp Ile Arg Tyr Asp Asn
195 200 205
Ala Phe Gly Val Glu Arg Ala Ala Gln Ser Val Thr Gly Asn Ile Leu
210 215 220
Val Cys Ser Gly Pro Leu Ser Val Tyr Arg Arg Glu Val Val Val Pro
225 230 235 240
46/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Asn Ile Asp Arg Tyr Ile Asn Gln Thr Phe Leu Gly Ile Pro Val Ser
245 250 255
Ile Gly Asp Asp Arg Cys Leu Thr Asn Tyr Ala Thr Asp Leu Gly Lys
260 265 270
Thr Val Tyr Gln Ser Thr Ala Lys Xaa Ile Thr Asp Val Pro Asp Lys
275 280 285
Met Ser Thr Tyr Leu Lys Gln Gln Asn Arg Trp Asn Lys ser Phe Phe
290 295 300
Arg Glu Ser Ile Ile Ser Val Lys Lys Ile Met Asn Asn Pro Phe Val
305 310 315 320
Ala Leu Trp Thr Ile Leu Glu Val Ser Met Phe Met Met Leu Val Tyr
325 330 335
Ser Val Val Asp Phe Phe Val Gly Asn Val Arg Glu Phe Asp Trp Leu
340 345 350
Arg Val Leu Ala Phe Leu Val Ile Ile Phe Ile Val Ala Leu Xaa Arg
355 360 365
Asn Ile His Tyr Met Leu Lys His Pro Leu Ser Phe Leu Leu Ser Pro
370 375 380
Phe Tyr Gly Val Leu His Leu Phe Val Leu Gln Pro Leu Lys Leu Tyr
385 390 395 400
Ser Leu Phe Thr Ile Arg Asn Ala Asp Trp Gly Thr Arg Lys Lys Leu
405 410 415
Leu
<210> 25
<211> 417
<Z12> PRT
<213> Streptococcus equisimilis
<220>
<221> MISC_FEATURE
<222> (262)..(262)
47/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
<223> xaa = Ala, ser or any other amino acid
<220>
<221> MISC_FEATURE
<Z22> (281)..(281)
<223> xaa = Ala, Ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (367)..(367)
<223> xaa = Ala, ser or any other amino acid
<400> 25
Met Arg Thr Leu Lys Asn Leu Ile Thr Val Val Ala Phe Ser Ile Phe
1 5 10 15
Trp Val Leu Leu Ile Tyr Val Asn Val Tyr Leu Phe Gly Ala Lys Gly
20 25 30
Ser Leu Ser Ile Tyr Gly Phe Leu Leu Ile Ala Tyr Leu Leu Val Lys
35 40 45
Met Ser Leu Ser Phe Phe Tyr Lys Pro Phe Lys Gly Arg Ala Gly Gln
50 55 60
Tyr Lys Val Ala Ala Ile Ile Pro Ser Tyr Asn Glu Asp Ala Glu Ser
65 70 75 80
Leu Leu Glu Thr Leu Lys Ser Val Gln Gln Gln Thr Tyr Pro Leu Ala
85 90 95
Glu Ile Tyr Val Val Asp Asp Gly Ser Ala Asp Glu Thr Gly Ile Lys
100 105 110
Arg Ile Glu Asp Tyr Val Arg Asp Thr Gly Asp Leu Ser Ser Asn Val
115 120 125
Ile Val His Arg Ser Glu Lys Asn Gln Gly Lys Arg His Ala Gln Ala
130 135 140
Trp Ala Phe Glu Arg Ser Asp Ala Asp Val Phe Leu Thr Val Asp Ser
145 150 155 160
48/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Asp Thr Tyr Ile Tyr Pro Asp Ala Leu Glu Glu Leu Leu Lys Thr Phe
165 170 175
Asn Asp Pro Thr Val Phe Ala Ala Thr Gly His Leu Asn Val Arg Asn
180 185 190
Arg Gln Thr Asn Leu Leu Thr Arg Leu Thr Asp Ile Arg Tyr Asp Asn
195 200 205
Ala Phe Gly Val Glu Arg Ala Ala Gln Ser Val Thr Gly Asn Ile Leu
210 215 220
Val Cys Ser Gly Pro Leu Ser Val Tyr Arg Arg Glu Val Val Val Pro
225 230 235 240
Asn Ile Asp Arg Tyr Ile Asn Gln Thr Phe Leu Gly Ile Pro Val Ser
245 250 255
Ile Gly Asp Asp Arg Xaa Leu Thr Asn Tyr Ala Thr Asp Leu Gly Lys
260 265 270
Thr Val Tyr Gln Ser Thr Ala Lys Xaa Ile Thr Asp Val Pro Asp Lys
275 280 285
Met Ser Thr Tyr Leu Lys Gln Gln Asn Arg Trp Asn Lys Ser Phe Phe
290 295 300
Arg Glu Ser Ile Ile Ser Val Lys Lys Ile Met Asn Asn Pro Phe Val
305 310 315 320
Ala Leu Trp Thr Ile Leu Glu Val Ser Met Phe Met Met Leu Val Tyr
325 330 335
Ser Val Val Asp Phe Phe Val Gly Asn Val Arg Glu Phe Asp Trp Leu
340 345 350
Arg Val Leu Ala Phe Leu Val Ile Ile Phe Ile Val Ala Leu Xaa Arg
355 360 365
Asn Ile His Tyr Met Leu Lys His Pro Leu Ser Phe Leu Leu Ser Pro
370 375 380
Phe Tyr Gly Val Leu His Leu Phe Val Leu Gln Pro Leu Lys Leu Tyr
385 390 395 400
Ser Leu Phe Thr Ile Arg Asn Ala Asp Trp Gly Thr Arg Lys Lys Leu
405 410 415
49/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Leu
<210> 26
<211> 417
<212> PRT
<213> Streptococcus equisimilis
<220>
<221> MISC_FEATURE
<222> (226)..(226)
<223> xaa = Ala, ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (281)..(281)
<223> xaa = Ala, Ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (367)..(367)
<223> xaa = Ala, Ser or any other amino acid
<400> 26
Met Arg Thr Leu Lys Asn Leu Ile Thr Val Val Ala Phe Ser Ile Phe
1 5 10 15
Trp Val Leu Leu Ile Tyr Val Asn Val Tyr Leu Phe Gly Ala Lys Gly
20 25 30
Ser Leu Ser Ile Tyr Gly Phe Leu Leu Ile Ala Tyr Leu Leu Val Lys
35 40 45
Met Ser Leu Ser Phe Phe Tyr Lys Pro Phe Lys Gly Arg Ala Gly Gln
50 55 60
50/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Tyr Lys Val Ala Ala Ile Ile Pro Ser Tyr Asn Glu Asp Ala Glu Ser
65 70 75 80
Leu Leu Glu Thr Leu Lys Ser Val Gln Gln Gln Thr Tyr Pro Leu Ala
85 90 95
Glu Ile Tyr Val Val Asp Asp Gly Ser Ala Asp Glu Thr Gly Ile Lys
100 105 110
Arg Ile Glu Asp Tyr Val Arg Asp Thr Gly asp Leu ser ser Asn Val
115 120 125
Ile Val His Arg Ser Glu Lys Asn Gln Gly Lys Arg His Ala Gln Ala
130 135 140
Trp Ala Phe Glu Arg Ser Asp Ala Asp Val Phe Leu Thr Val Asp Ser
145 150 155 160
Asp Thr Tyr Ile Tyr Pro Asp Ala Leu Glu Glu Leu Leu Lys Thr Phe
165 170 175
Asn Asp Pro Thr Val Phe Ala Ala Thr Gly His Leu Asn Val Arg Asn
180 185 190
Arg Gln Thr Asn Leu Leu Thr Arg Leu Thr Asp Ile Arg Tyr Asp Asn
195 200 205
Ala Phe Gly Val Glu Arg Ala Ala Gln Ser Val Thr Gly Asn Ile Leu
210 215 220
Val Xaa Ser Gly Pro Leu Ser Val Tyr Arg Arg Glu Val Val Val Pro
225 230 235 240
Asn Ile Asp Arg Tyr Ile Asn Gln Thr Phe Leu Gly Ile Pro Val Ser
245 250 255
Ile Gly Asp Asp Arg Cys Leu Thr Asn Tyr Ala Thr Asp Leu Gly Lys
260 265 270
Thr Val Tyr Gln Ser Thr Ala Lys Xaa Ile Thr Asp Val Pro Asp Lys
275 280 285
Met Ser Thr Tyr Leu Lys Gln Gln Asn Arg Trp Asn Lys Ser Phe Phe
290 295 300
Arg Glu Ser Ile Ile Ser Val Lys Lys Ile Met Asn Asn Pro.Phe Val
305 310 315 320
51/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Ala Leu Trp Thr Ile Leu Glu Val Ser Met Phe Met Met Leu Val Tyr
325 330 335
Ser Val Val Asp Phe Phe Val Gly Asn Val Arg Glu Phe Asp Trp Leu
340 345 350
Arg Val Leu Ala Phe Leu Val Ile Ile Phe Ile Val Ala Leu Xaa Arg
355 360 365
Asn Ile His Tyr Met Leu Lys His Pro Leu Ser Phe Leu Leu Ser Pro
370 375 380
Phe Tyr Gly Val Leu His Leu Phe Val Leu Gln Pro Leu Lys Leu Tyr
385 390 395 400
Ser Leu Phe Thr Ile Arg Asn Ala Asp Trp Gly Thr Arg Lys Lys Leu
405 410 415
Leu
<210> 27
<211> 417
<212> PRT
<213> Streptococcus equisimilis
<220>
<221> MISC_FEATURE
<222> (226)..(226)
<223> xaa = Ala, ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (262)..(262)
<223> xaa = Ala, Ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (367)..(367)
s2/Z~7
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
<223> xaa = Ala, Ser or any other amino acid
<400> 27
Met Arg Thr Leu Lys Asn Leu Ile Thr Val Val Ala Phe Ser Ile Phe
1 5 10 15
Trp Val Leu Leu Ile Tyr Val Asn Val Tyr Leu Phe Gly Ala Lys Gly
20 25 30
Ser Leu Ser Ile Tyr Gly Phe Leu Leu Ile Ala Tyr Leu Leu Val Lys
35 40 45
Met Ser Leu Ser Phe Phe Tyr Lys Pro Phe Lys Gly Arg Ala Gly Gln
50 55 60
Tyr Lys Val Ala Ala Ile Ile Pro Ser Tyr Asn Glu Asp Ala Glu Ser
65 70 75 80
Leu Leu Glu Thr Leu Lys Ser Val Gln Gln Gln Thr Tyr Pro Leu Ala
85 90 95
Glu Ile Tyr Val Val Asp Asp Gly Ser Ala Asp Glu Thr Gly Ile Lys
100 105 110
Arg Ile Glu Asp Tyr Val Arg Asp Thr Gly Asp Leu Ser Ser Asn Val
115 120 125
Ile Val His Arg Ser Glu Lys Asn Gln Gly Lys Arg His Ala Gln Ala
130 135 140
Trp Ala Phe Glu Arg Ser Asp Ala Asp Val Phe Leu Thr Val Asp Ser
145 150 155 160
Asp Thr Tyr Ile Tyr Pro Asp Ala Leu Glu Gl,u Leu Leu Lys Thr Phe
165 170 175
Asn Asp Pro Thr Val Phe Ala Ala Thr Gly His Leu Asn Val Arg Asn
180 185 190
Arg Gln Thr Asn Leu Leu Thr Arg Leu Thr Asp Ile Arg Tyr Asp Asn
195 200 205
Ala Phe Gly Val Glu Arg Ala Ala Gln Ser Val Thr Gly Asn Ile Leu
210 215 220
Val Xaa Ser Gly Pro Leu Ser Val Tyr Arg Arg Glu Val Val Val Pro
225 230 235 240
53/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Asn Ile Asp Arg Tyr Ile Asn Gln Thr Phe Leu Gly Ile Pro Val Ser
245 250 255
Ile Gly Asp Asp Arg xaa Leu Thr Asn Tyr Ala Thr Asp Leu Gly Lys
260 265 270
Thr Val Tyr Gln Ser Thr Ala Lys Cys Ile Thr Asp Val Pro Asp Lys
275 280 Z85
Met Ser Thr Tyr Leu Lys Gln Gln Asn Arg Trp Asn Lys Ser Phe Phe
290 295 300
Arg Glu Ser Ile Ile Ser Val Lys Lys Ile Met Asn Asn Pro Phe Val
305 310 315 320
Ala Leu Trp Thr Ile Leu Glu Val Ser Met Phe Met Met Leu Val Tyr
325 330 335
Ser Val Val Asp Phe Phe Val Gly Asn Val Arg Glu Phe Asp Trp Leu
340 345 350
Arg Val Leu Ala Phe Leu Val Ile Ile Phe Ile Val Ala.Leu Xaa Arg
355 360 365
Asn Ile His Tyr Met Leu Lys His Pro Leu Ser Phe Leu Leu Ser Pro
370 375 380
Phe Tyr Gly Val Leu His Leu Phe Val Leu Gln Pro Leu Lys Leu Tyr
385 390 395 400
Ser Leu Phe Thr Ile Arg Asn Ala Asp Trp Gly Thr Arg Lys Lys Leu
405 410 415
Leu
<210> 28
<211> 417
<212> PRT
<213> Streptococcus equisimilis
<220>
<221> MISC_FEATURE
54/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
<222> (226)..(226)
<223> xaa = Ala, ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (26Z)..(262)
<223> xaa = Ala, Ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (281)..(281)
<223> xaa = Ala, Ser or any other amino acid
<400> 28
Met Arg Thr Leu Lys Asn Leu Ile Thr Val Val Ala Phe Ser Ile Phe
1 5 10 15
Trp Val Leu Leu Ile Tyr Val Asn Val Tyr Leu Phe Gly Ala Lys Gly
20 25 30
Ser Leu Ser Ile Tyr Gly Phe Leu Leu Ile Ala Tyr Leu Leu Val Lys
35 40 45
Met Ser Leu Ser Phe Phe Tyr Lys Pro Phe Lys Gly Arg Ala Gly Gln
50 55 60'
Tyr Lys Val Ala Ala Ile Ile Pro Ser Tyr Asn Glu Asp Ala Glu Ser
65 70 75 80
Leu Leu Glu Thr Leu Lys Ser Val Gln Gln Gln Thr Tyr Pro Leu Ala
85 90 95
Glu Ile Tyr Val Val Asp Asp Gly Ser Ala Asp Glu Thr Gly Ile Lys
100 105 110
Arg Ile Glu Asp Tyr Val Arg Asp Thr Gly Asp Leu Ser Ser Asn Val
115 120 125
Ile Val His Arg Ser Glu Lys Asn Gln Gly Lys Arg His Ala Gln Ala
130 135 140
55/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Trp Ala Phe Glu Arg Ser Asp Ala Asp Val Phe Leu Thr Val Asp Ser
145 150 155 160
Asp Thr Tyr Ile Tyr Pro Asp Ala Leu Glu Glu Leu Leu Lys Thr Phe
165 170 175
Asn Asp Pro Thr Val Phe Ala Ala Thr Gly His Leu Asn Val Arg Asn
180 185 190
Arg Gln Thr Asn Leu Leu Thr Arg Leu Thr Asp Ile Arg Tyr Asp Asn
195 200 205
Ala Phe Gly Val Glu Arg Ala Ala Gln Ser Val Thr Gly Asn Ile Leu
210 215 220
Val Xaa Ser Gly Pro Leu Ser VaT Tyr Arg Arg Glu Val Val Val Pro
225 230 235 240
Asn Ile Asp Arg Tyr Ile Asn Gln Thr Phe Leu Gly Ile Pro Val Ser
245 250 255
Ile Gly Asp Asp Arg Xaa Leu Thr Asn Tyr Ala Thr Asp Leu Gly Lys
260 265 270
Thr Val Tyr Gln Ser Thr Ala Lys Xaa Ile Thr Asp Val Pro Asp Lys
275 280 285
Met Ser Thr Tyr Leu Lys Gln Gln Asn Arg Trp Asn Lys Ser Phe Phe
290 295 300
Arg Glu Ser Ile Ile Ser Val Lys Lys Ile Met Asn Asn Pro Phe Val
305 310 315 320
Ala Leu Trp Thr Ile Leu Glu Val Ser Met Phe Met Met Leu Val Tyr
325 330 335
Ser Val Val Asp Phe Phe Val Gly Asn Val Arg Glu Phe Asp Trp Leu
340 345 350
Arg Val Leu Ala Phe Leu Val Ile Ile Phe Ile Val Ala Leu Cys Arg
355 360 365
Asn Ile His Tyr Met Leu Lys His Pro Leu Ser Phe Leu Leu Ser Pro
370 375 380
Phe Tyr Gly Val Leu His Leu Phe Val Leu Gln Pro Leu Lys Leu Tyr
385 390 395 400
56/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Ser Leu Phe Thr Ile Ar9 Asn Ala Asp Trp Gly Thr Arg Lys Lys Leu
405 410 415
Leu
<210> 29
<211> 417
<212> PRT
<213> Streptococcus equisimilis
<220>
<221> MISC_FEATURE
<222> (226)..(226)
<223> xaa = Ala, ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (262)..(262)
<223> xaa = Ala, Ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (281)..(281)
<223> xaa = Ala, Ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (367)..(367)
<223> xaa = Ala, Ser or any other amino acid
<400> 29
Met Arg Thr Leu Lys Asn Leu Ile Thr Val Val Ala Phe Ser I1a Phe
1 5 10 15
57/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Trp Val Leu Leu Ile Tyr Val Asn Val Tyr Leu Phe Gly Ala Lys Gly
20 25 30
Ser Leu Ser Ile Tyr Gly Phe Leu Leu Ile Ala Tyr Leu Leu Val Lys
35 40 45
Met 5e0r Leu Ser Phe Phe 55r Lys Pro Phe Lys 610y Arg Ala Gly Gln
Tyr Lys Val Ala Ala Ile Ile Pro Ser Tyr Asn Glu Asp Ala Glu Ser
65 70 75 80
Leu Leu Glu Thr Leu Lys Ser Val Gln Gln Gln Thr Tyr Pro Leu Ala
85 90 95
Glu Ile Tyr Val Val Asp Asp Gly Ser Ala Asp Glu Thr Gly Ile Lys
100 105 110
Arg Ile Glu Asp Tyr Val Arg Asp Thr Gly Asp Leu Ser Ser Asn Val
115 120 125
Ile Val His Arg Ser Glu Lys Asn Gln Gly Lys Arg His Ala Gln Ala
130 135 140
Trp Ala Phe Glu Arg Ser Asp Ala Asp,Val Phe Leu Thr Val Asp Ser
145 150 155 160
Asp Thr Tyr Ile Tyr Pro Asp Ala Leu Glu Glu Leu Leu Lys Thr Phe
165 170 175
Asn Asp Pro Thr Val Phe Ala Ala Thr Gly His Leu Asn Val Arg Asn
180 185 190
Arg Gln Thr Asn Leu Leu Thr Arg Leu Thr Asp Ile Arg Tyr Asp Asn
195 200 205
Ala Phe Gly Val Glu Arg Ala Ala Gln Ser Val Thr Gly Asn Ile Leu
210 215 220
Val Xaa Ser Gly Pro Leu Ser Val Tyr Arg Arg Glu Val Val Val Pro
225 230 235 240
Asn Ile Asp Arg Tyr Ile Asn Gln Thr Phe Leu Gly Ile Pro Val Ser
245 250 255
Ile Gly Asp Asp Arg Xaa Leu Thr Asn Tyr Ala Thr Asp Leu Gly Lys
260 265 270
58/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Thr Val Tyr Gln Ser Thr Ala Lys Xaa Ile Thr Asp Val Pro Asp Lys
275 280 285
Met Ser Thr Tyr Leu Lys Gln Gln Asn Arg Trp Asn Lys Ser Phe Phe
290 295 300
Arg Glu Ser Ile Ile Ser Val Lys Lys Ile Met Asn Asn Pro Phe Val
305 310 315 320
Ala Leu Trp Thr Ile Leu Glu Val Ser Met Phe Met Met Leu Val Tyr
325 330 335
Ser Val Val Asp Phe Phe Val Gly Asn Val Arg Glu Phe Asp Trp Leu
340 345 350
Arg Val Leu Ala Phe Leu Val Ile Ile Phe Ile Val Ala Leu Xaa Arg
355 360 365
Asn Ile His Tyr Met Leu Lys His Pro Leu Ser Phe Leu Leu Ser Pro
370 375 380
Phe Tyr Gly Val Leu His Leu Phe Val Leu Gln Pro Leu Lys Leu Tyr
385 390 395 400
Ser Leu Phe Thr Ile Arg Asn Ala Asp Trp Gly Thr Arg Lys Lys Leu
405 410 415
Leu
<210> 30
<211> 419
<212> PRT
<213> Streptococcus pyogenes
<220>
<221> MISC-FEATURE
<222> (124)..(124)
<223> xaa = Ala, Ser or any other amino acid
<400> 30
Met Pro Ile Phe Lys Lys Thr Leu Ile Val Leu Ser Phe Ile Phe Leu
1 5 10 15
59/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Ile Ser Ile Leu Ile Tyr Leu Asn Met Tyr Leu Phe Gly Thr Ser Thr
20 25 30
Val Gly Ile Tyr Gly Val Ile Leu Ile Thr Tyr Leu Val Ile Lys Leu
35 40 45
Gly Leu Ser Phe Leu Tyr Glu Pro Phe Lys Gly Asn Pro His Asp Tyr
50 55 60
Lys Val Ala Ala Val Ile Pro Ser Tyr Asn Glu Asp Ala Glu Ser Leu
65 70 75 80
Leu Glu Thr Leu Lys Ser Val Leu Ala Gln Thr Tyr Pro Leu Ser Glu
85 90 95
Ile Tyr Ile Val Asp Asp Gly Ser Ser Asn Thr Asp Ala Ile Gln Leu
100 105 110
Ile Glu Glu Tyr Val Asn Arg Glu Val Asp Ile Xaa Arg Asn Val Ile
115 120 125
val His Arg Ser Leu Val Asn Lys Gly Lys Arg His Ala Gln Ala Trp
130 135 140
Ala Phe Glu Arg Ser Asp Ala Asp Val Phe Leu Thr Val Asp Ser Asp
145 150 155 160
Thr Tyr Ile Tyr Pro Asn Ala Leu Glu Glu Leu Leu Lys Ser Phe Asn
165 170 175
Asp Glu Thr Val Tyr Ala Ala Thr Gly His Leu Asn Ala Arg Asn Arg
180 185 190
Gln Thr Asn Leu Leu Thr Arg Leu Thr Asp Ile Arg Tyr Asp Asn Ala
195 200 205
Phe Gly Val Glu Arg Ala Ala Gln Ser Leu Thr Gly Asn Ile Leu Val
210 215 220
Cys Ser Gly Pro Leu Ser Ile Tyr Arg Arg Glu Val Ile Ile Pro Asn
225 Z30 235 240
Leu Glu Arg Tyr Lys Asn Gln Thr Phe Leu Gly Leu Pro Val Ser Ile
245 250 255
Gly Asp Asp Arg Cys Leu Thr Asn Tyr Ala Ile Asp Leu Gly Arg Thr
260 265 270
60/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Val Tyr Gln Ser Thr Ala Arg Cys Asp Thr Asp Val Pro Phe Gln Leu
275 280 285
Lys Ser Tyr Leu Lys Gln Gln Asn Arg Trp Asn Lys Ser Phe Phe Arg
290 295 300
Glu Ser Ile Ile Ser Val Lys Lys Ile Leu Ser Asn Pro Ile Val Ala
305 310 315 320
Leu Trp Thr Ile Phe Glu Val Val Met Phe Met Met Leu Ile Val Ala
325 330 335
Ile Gly Asn Leu Leu Phe Asn Gln Ala Ile Gln Leu Asp Leu Ile Lys
340 345 350
Leu Phe Ala Phe Leu Ser Ile Ile Phe Ile Val Ala Leu Cys Arg Asn
355 360 365
Val His Tyr Met Val Lys His Pro Ala Ser Phe Leu Leu Ser Pro Leu
370 375 380
Tyr Gly Ile Leu His Leu Phe Val Leu Gln Pro Leu Lys Leu Tyr Ser
385 390 395 400
Leu Cys Thr Ile Lys Asn Thr Glu Trp Gly Thr Arg Lys Lys Val Thr
405 410 415
Ile Phe Lys
<210> 31
<211> 419
<212> PRT
<213> streptococcus pyogenes
<220>
<221> MISC_FEATURE
<222> (225)..(225)
<223> xaa = Ala, Ser or any other amino acid
<400> 31
61/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Met Pro I1e Phe Lys Lys Thr Leu Ile Val Leu Ser Phe Ile Phe Leu
1 5 10 15
Ile Ser Ile Leu Ile Tyr Leu Asn Met Tyr Leu Phe Gly Thr Ser Thr
20 25 30
Val Gly Ile Tyr Gly Val Ile Leu Ile Thr Tyr Leu Val Ile Lys Leu
35 40 45
Gly Leu Ser Phe Leu Tyr Glu Pro Phe Lys Gly Asn Pro His Asp Tyr
50 55 60
Lys Val Ala Ala Val Ile Pro Ser Tyr Asn Glu Asp Ala Glu Ser Leu
65 70 75 80
Leu Glu Thr Leu Lys Ser Val Leu Ala Gln Thr Tyr Pro Leu Ser Glu
85 90 95
Ile Tyr Ile Val Asp Asp Gly Ser Ser Asn Thr Asp Ala Ile Gln Leu
100 105 110
Ile Glu Glu Tyr Val Asn Arg Glu Val Asp Ile Cys Arg Asn Val Ile
115 120 125
Val His Arg Ser Leu Val Asn Lys Gly Lys Arg His Ala Gln Ala Trp
130 135 140
Ala Phe Glu Arg Ser Asp Ala Asp Val Phe Leu Thr Val Asp Ser Asp
145 150 155 160
Thr Tyr Ile Tyr Pro Asn Ala Leu Glu Glu Leu Leu Lys Ser Phe Asn
165 170 175
Asp Glu Thr Val Tyr Ala Ala Thr Gly His Leu Asn Ala Arg Asn Arg
180 185 190
Gln Thr Asn Leu Leu Thr Arg Leu Thr Asp Ile Arg Tyr Asp Asn Ala
195 200 205
Phe Gly Val Glu Arg Ala Ala Gln Ser Leu Thr Gly Asn Ile Leu Val
210 215 220
Xaa Ser Gly Pro Leu Ser Ile Tyr Arg Arg Glu Val Ile Ile Pro Asn
225 230 235 240
Leu Glu Arg Tyr Lys Asn Gln Thr Phe Leu Gly Leu Pro Val Ser ile
245 250 255
62/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Gly Asp Asp Arg Cys Leu Thr Asn Tyr Ala Ile Asp Leu Gly Arg Thr
260 265 270
Val Tyr Gln Ser Thr Ala Arg Cys Asp Thr Asp Val Pro Phe Gln Leu
275 280 285
Lys Ser Tyr Leu Lys Gln Gln Asn Arg Trp Asn Lys Ser Phe Phe Arg
290 295 300
Glu Ser Ile Ile Ser Val Lys Lys Ile Leu Ser Asn Pro Ile Val Ala
305 310 315 320
Leu Trp Thr Ile Phe Glu Val Val Met Phe Met Met Leu Ile Val Ala
325 330 335
Ile Gly Asn Leu Leu Phe Asn Gln Ala Ile Gln Leu Asp Leu Ile Lys
340 345 350
Leu Phe Ala Phe Leu Ser Ile Ile Phe Ile Val.Ala Leu Cys Arg Asn
355 360 365
Val His Tyr Met Val Lys His Pro Ala Ser Phe Leu Leu Ser Pro Leu
370 375 380
Tyr Gly Ile Leu His Leu Phe Val Leu Gln Pro Leu Lys Leu Tyr Ser
385 390 395 400
Leu Cys Thr Ile Lys Asn Thr Glu Trp Gly Thr Arg Lys Lys Vai Thr
405 410 415
Ile Phe Lys
<210> 32
<211> 419
<222> PRT
<213> Streptococcus pyogenes
<220>
<221> MISC_FEATURE
<222> (261)..(261)
<223> xaa = Ala, ser or any other amino acid
63/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
<400> 32
Met Pro Ile Phe Lys Lys Thr Leu Ile val Leu Ser Phe Ile Phe Leu
1 5 10 15
Ile Ser Ile Leu Iie Tyr Leu Asn Met Tyr Leu Phe Gly Thr Ser Thr
20 25 30
Val Gly Ile Tyr Gly Val Ile Leu Ile Thr Tyr Leu Val Ile Lys Leu
35 40 45
Gly Leu Ser Phe Leu Tyr Glu Pro Phe Lys Giy Asn Pro His Asp Tyr
50 55 60
Lys Val Ala Ala Val Ile Pro Ser Tyr Asn Glu Asp Ala Glu Ser Leu
65 70 75 80
Leu Glu Thr Leu Lys Ser Val Leu Ala Gln Thr Tyr Pro Leu-Ser Giu
85 90 95
Ile Tyr Ile Vai Asp Asp Gly Ser Ser Asn Thr Asp Ala Ile Gln Leu
loo l05 lIo
Ile Glu Glu Tyr Vai Asn Arg Glu Vai Asp Ile Cys Arg Asn Val Ile
115 120 125
val His Arg Ser Leu Val Asn Lys Giy Lys Arg His Ala Gln Ala Trp
130 135 140
Ala Phe Glu Arg Ser asp Ala Asp Val Phe Leu Thr val Asp Ser Asp
145 I50 155 160
Thr Tyr Ile Tyr Pro Asn Ala Leu Glu Glu Leu Leu Lys Ser Phe Asn
165 170 175
Asp Glu Thr val Tyr Ala Ala Thr Gly His Leu Asn Ala Arg Asn Arg
180 185 I90
G1n Thr Asn Leu Leu Thr Arg Leu Thr Asp Ile Arg Tyr Asp Asn Ala
195 200 205
Phe Gly Val Glu Arg Ala Ala Gln Ser Leu Thr Gly Asn Ile Leu Val
210 215 220
Cys Ser Gly Pro Leu Ser Ile Tyr Arg Arg Glu Val Ile Ile Pro Asn
225 230 235 240
Leu Glu Arg Tyr Lys Asn Gln Thr Phe Leu Gly Leu Pro Val Ser Ile
245 250 255
64/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Gly Asp Asp Arg Xaa Leu Thr Asn Tyr Ala Ile Asp Leu Gly Arg Thr
260 265 270
Val Tyr Gln Ser Thr Ala Arg Cys Asp Thr Asp Val Pro Phe Gln Leu
275 280 285
Lys Ser Tyr Leu Lys Gln Gln Asn Arg Trp Asn Lys Ser Phe Phe Arg
290 295 300
Glu Ser Ile Ile Ser Val Lys Lys Ile Leu Ser Asn Pro Ile Val Ala
305 310 315 320
Leu Trp Thr Ile Phe Glu Val Val Met Phe Met Met Leu Ile Val Ala
325 330 335
Ile Gly Asn Leu Leu Phe Asn Gln Ala Ile Gln Leu Asp Leu Ile Lys
340 345 350
Leu Phe Ala Phe Leu Ser Ile Ile Phe Ile Val Ala Leu Cys Arg Asn
355 360 365
Val His Tyr Met Val Lys His Pro Ala Ser Phe Leu Leu Ser Pro Leu
370 375 380
Tyr Gly Ile Leu His Leu Phe Val Leu Gln Pro Leu Lys Leu Tyr Ser
385 390 395 400
Leu Cys Thr Ile Lys Asn Thr Glu Trp Gly Thr Arg Lys Lys Val Thr
405 410 415
Ile Phe Lys
<210> 33
<211> 4I9
<212> PRT
<213> Streptococcus pyogenes
<220>
<221> MISC_FEATURE
<222> (280)..(280) .
<223> xaa = Ala, ser or any other amino acid
65/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
<400> 33
Met Pro Ile Phe Lys Lys Thr Leu Ile Val Leu Ser Phe Ile Phe Leu
1 5 10 15
Ile Ser Ile Leu Ile Tyr Leu Asn Met Tyr Leu Phe Gly Thr Ser Thr
20 25 30
Val Gly Ile Tyr Gly Val Ile Leu Ile Thr Tyr Leu Val Ile Lys Leu
35 40 45
Gly Leu Ser Phe Leu Tyr Glu Pro Phe Lys Gly Asn Pro His Asp Tyr
50 55 60
Lys Val Ala Ala Val Ile Pro Ser Tyr Asn Glu Asp Ala Glu Ser Leu
65 70 75 80
Leu Glu Thr Leu Lys Ser Val Leu Ala Gln Thr Tyr Pro Leu Ser Glu
g5 90 95
Ile Tyr Ile Val Asp Asp Gly Ser Ser Asn Thr Asp Ala Ile Gln Leu
100 105 110
Ile Glu Glu Tyr Val Asn Arg Glu Val Asp Ile Cys Arg Asn Val Ile
115 120 125
Val His Arg Ser Leu Val Asn Lys Gly Lys Arg His Ala Gln Ala Trp
130 135 140
Ala Phe Glu Arg Ser Asp Ala Asp Val Phe Leu Thr Val Asp Ser Asp
145 150 155 160
Thr Tyr Ile Tyr Pro Asn Ala Leu Glu Glu Leu Leu Lys Ser Phe Asn
165 170 175
Asp Glu Thr Val Tyr Ala Ala Thr Gly His Leu Asn Ala Arg Asn Arg
180 185 190
Gln Thr Asn Leu Leu Thr Arg Leu Thr Asp Ile Arg Tyr Asp Asn Ala
195 200 205
Phe Gly Val Glu Arg Ala Ala Gln Ser Leu Thr Gly Asn Ile Leu Val
210 215 220
Cys Ser Gly Pro Leu Ser Ile Tyr Arg Arg Glu Val Ile Ile Pro Asn
225 230 235 240
66/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Leu Glu Arg Tyr Lys Asn Gln Thr Phe Leu Gly Leu Pro Val Ser Ile
245 250 255
Gly Asp Asp Arg Cys Leu Thr Asn Tyr Ala Ile Asp Leu Gly Arg Thr
260 265 Z70
Val Tyr.Gln Ser Thr Ala Arg Xaa Asp Thr Asp Val Pro Phe Gln Leu
275 280 285
Lys Ser Tyr Leu Lys Gln Gln Asn Arg Trp Asn Lys Ser Phe Phe Arg
290 295 300
Glu Ser Ile Ile Ser Val Lys Lys Ile Leu Ser Asn Pro Ile Val Ala
305 310 315 320
Leu Trp Thr Ile Phe Glu Val Val Met Phe Met Met Leu Ile Val Ala
325 330 335
Ile Gly Asn Leu Leu Phe Asn Gln Ala Ile Gln Leu Asp Leu Ile Lys
340 345 350
Leu Phe Ala Phe Leu Ser Ile Ile Phe Ile Val Ala Leu Cys Arg Asn
355 360 365
Val His Tyr Met Val Lys His Pro Ala Ser Phe Leu Leu Ser Pro Leu
370 375 380
Tyr Gly Ile Leu His Leu Phe Val Leu Gln Pro Leu Lys Leu Tyr Ser
385 390 395 400
Leu Cys Thr Ile Lys Asn Thr Glu Trp Gly Thr Arg Lys Lys Val Thr
405 410 415
Ile Phe Lys
<210> 34
<211> 419
<212> PRT
<213> Streptococcus pyogenes
<220>
<221> MISC_FEATURE
<222> (366)..(366)
67/207
Phe Gly Val Glu Arg A
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
<223> xaa = Ala, Ser or any other amino acid
<400> 34
Met Pro Ile Phe Lys Lys Thr Leu Ile Val Leu Ser Phe Ile Phe Leu
1 5 10 15
Ile Ser Ile Leu Ile Tyr Leu Asn Met Tyr Leu Phe Gly Thr Ser Thr
20 25 30
Val Gly Ile Tyr Gly Val Ile Leu Ile Thr Tyr Leu Val Ile Lys Leu
35 40 45
Gly Leu Ser Phe Leu Tyr Glu Pro Phe Lys Gly Asn Pro His Asp Tyr
50 55 60
Lys Val Ala Ala Val Ile Pro Ser Tyr Asn Glu Asp Ala Glu Ser Leu
65 70 75 80
Leu Glu Thr Leu Lys Ser Val Leu Ala Gln Thr Tyr Pro Leu Ser Glu
85 90 95
Ile Tyr Ile Val Asp Asp Gly Ser Ser Asn Thr Asp Ala Ile Gln Leu
100 105 110
Ile Glu Gl.u Tyr Val Asn Arg Glu Val Asp Ile Cys Arg Asn Val Ile
115 120 125
Val His Arg Ser Leu Val Asn Lys Gly Lys Arg His Ala Gln Ala Trp
130 135 140
Ala Phe Glu Arg Ser Asp Ala Asp Val Phe Leu Thr Val Asp Ser Asp
145 150 155 160
Thr Tyr Ile Tyr Pro Asn Ala Leu Glu Glu Leu Leu Lys Ser Phe ASn
165 170 175
Asp Glu Thr Val Tyr Ala Ala Thr Gly His Leu Asn Ala Arg Asn Arg
180 185 190
Gln Thr Asn Leu Leu Thr Arg Leu Thr Asp Ile Arg Tyr Asp Asn Ala
195 200 205
Phe Gly Val Glu Arg Ala Ala Gln Ser Leu Thr Gly Asn Ile Leu Val
210 215 220
Cys Ser Gly Pro Leu Ser Ile Tyr Arg Arg Glu Val Ile Ile Pro Asn
225 230 235 240
68/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Leu Glu Arg Tyr Lys Asn Gln Thr Phe Leu Gly Leu Pro Val Ser Ile
245 250 255
Gly Asp Asp Arg Cys Leu Thr Asn Tyr Ala Ile Asp Leu Gly Arg Thr
260 265 270
Val Tyr Gln Ser Thr Ala Arg Cys Asp Thr Asp Val Pro Phe Gln Leu
275 280 285
Lys Ser Tyr Leu Lys Gln Gln Asn Arg Trp Asn Lys Ser Phe Phe Arg
290 295 300
Glu Ser Ile Ile Ser Val Lys Lys Ile Leu Ser Asn Pro Ile Val Ala
305 310 315 320
Leu Trp Thr Ile Phe Glu Val Val Met Phe Met Met Leu Ile Val Ala
325 330 335
Ile Gly Asn Leu Leu Phe Asn Gln Ala Ile Gln Leu Asp Leu Ile Lys
340 345 350
Leu Phe Ala Phe Leu Ser Ile Ile Phe Ile Val Ala Leu Xaa Arg Asn
355 360 365
Val His Tyr Met Val Lys His Pro Ala Ser Phe Leu Leu Ser Pro Leu
370 375 380
Tyr Gly Ile Leu His Leu Phe Val Leu Gln Pro Leu Lys Leu Tyr Ser
385 390 395 400
Leu Cys Thr Ile Lys Asn Thr Glu Trp Gly Thr Arg Lys Lys Val Thr
405 410 415
Ile Phe Lys
<210> 35
<211> 419
<212> PRT
<213> streptococcus pyogenes
<220>
<221> MISC_FEATURE
69/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
<222> (402)..(402)
<223> xaa = Ala, Ser or any other amino acid
<400> 35
Met Pro Ile Phe Lys Lys Thr Leu Ile Val Leu Ser Phe Ile Phe Leu
1 5 10 15
Ile Ser Ile Leu Ile Tyr Leu Asn Met Tyr Leu Phe Gly Thr Ser Thr
20 25 30
Val Gly Ile Tyr Gly Val Ile Leu Ile Thr Tyr Leu Val Ile Lys Leu
35 40 45
Gly Leu Ser Phe Leu Tyr Glu Pro Phe Lys Gly Asn Pro His Asp Tyr
SO 55 60
Lys Val Ala Ala Val Ile Pro Ser Tyr Asn Glu Asp Ala Glu Ser Leu
65 70 75 80
Leu Glu Thr Leu Lys Ser Val Leu Ala Gln Thr Tyr Pro Leu Ser Glu
85 90 95
Ile Tyr Ile Val Asp Asp Gly Ser Ser Asn Thr Asp Ala Ile Gln Leu
100 105 110
Ile Glu Glu Tyr Val Asn Arg Glu Val Asp Ile Cys Arg Asn Val Ile
115 120 125
Val His Arg Ser Leu Val Asn Lys Gly Lys Arg His Ala Gln Ala Trp
130 135 140
Ala Phe Glu Arg Ser Asp Ala Asp Val Phe Leu Thr Val Asp Ser ASp
145 150 155 160
Thr Tyr Ile Tyr Pro Asn Ala Leu Glu Glu Leu Leu Lys Ser Phe Asn
165 170 175
Asp Glu Thr Val.Tyr Ala Ala Thr Gly His Leu Asn Ala Arg Asn Arg
180 185 190
Gln Thr Asn Leu Leu Thr Arg Leu Thr Asp Ile Arg Tyr Asp Asn Ala
195 200 205
Phe Gly Val Glu Arg Ala Ala Gln Ser Leu Thr Gly Asn Ile Leu Val
210 215 220
70/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Cys Ser Gly Pro Leu Ser Ile Tyr Arg Arg Glu Val Ile Ile Pro Asn
225 230 235 240
Leu Glu Arg Tyr Lys Asn Gln Thr Phe Leu Gly Leu Pro Val Ser Ile
245 250 255
Gly Asp Asp Arg Cys Leu Thr Asn Tyr Ala Ile Asp Leu Gly Arg Thr
260 265 270
Val Tyr Gln Ser Thr Ala Arg ~ys Asp Thr Asp Val Pro Phe Gln Leu
275 280 285
Lys Ser Tyr Leu Lys Gln Gln Asn Arg Trp Asn Lys Ser Phe Phe Arg
290 295 300
Glu Ser Ile Ile Ser Val Lys Lys Ile Leu Ser Asn Pro Ile Val Ala
305 310 315 320
Leu Trp Thr Ile Phe Glu Val Val Met Phe Met Met Leu Ile Val Ala
325 330 335
Ile Gly Asn Leu Leu Phe Asn Gln Ala Ile Gln Leu Asp Leu Ile Lys
340 345 350
Leu Phe Ala Phe Leu Ser Ile Ile Phe Ile Val Ala Leu Cys Arg Asn
355 360 365
Val His Tyr Met Val Lys His Pro Ala Ser Phe Leu Leu Ser Pro Leu
370 375 380
Tyr Gly Ile Leu His Leu Phe Val Leu Gln Pro Leu Lys Leu Tyr Ser
385 390 395 400
Leu Xaa Thr Ile Lys Asn Thr Glu Trp Gly Thr Arg Lys Lys Val Thr
405 410 415
Ile Phe Lys
<210> 36
<211> 419
<212> PRT
<213> streptococcus pyogenes
<Z20>
71/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
<221> MISC_FEATURE
<222> (225)..(225)
<223> xaa = Ala, Ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (124)..(124)
<223> xaa = Ala, Ser or any other amino acid
<400> 36
Met Pro Ile Phe Lys Lys Thr Leu Ile Val Leu Ser Phe Ile Phe Leu
1 5 10 15
Ile Ser Ile Leu Ile Tyr Leu Asn Met Tyr Leu Phe Gly Thr Ser Thr
20 25 30
Val Gly Ile Tyr Gly Val Ile Leu Ile Thr Tyr Leu Val Ile Lys Leu
35 40 45
Gly Leu Ser Phe Leu Tyr Glu Pro Phe Lys Gly Asn Pro His Asp Tyr
50 55 60
Lys Val Ala Ala Val Ile Pro Ser Tyr Asn Glu ASp Ala Glu Ser Leu
65 70 75 80
Leu Glu Thr Leu Lys Ser Val Leu Ala Gln Thr Tyr Pro Leu Ser Glu
85 90 95
Ile Tyr Ile Val Asp Asp Gly Ser Ser Asn Thr Asp Ala Ile Gln Leu
100 105 110
Ile Glu Glu Tyr Val Asn Arg Glu Val Asp Ile Xaa Arg Asn Val Ile
115 120 12 5
Val His Arg Ser Leu Val Asn Lys Gly Lys Arg His Ala Gln Ala Trp
130 135 140
Ala Phe Glu Arg Ser Asp Ala Asp Val Phe Leu Thr Val Asp Ser Asp
145 150 155 160
Thr Tyr Ile Tyr Pro Asn Ala Leu Glu Glu Leu Leu Lys Ser Phe Asn
165 170 175
72/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Asp Glu Thr Val Tyr Ala Ala Thr Gly His Leu Asn Ala Arg Asn Arg
180 185 190
Gln Thr Asn Leu Leu Thr Arg Leu Thr Asp Ile Arg Tyr Asp Asn Ala
195 200 205
Phe Gly Val Glu Arg Ala Ala Gln Ser Leu Thr Gly Asn Ile Leu Val
210 215 220
Xaa Ser Gly Pro Leu Ser Ile Tyr Arg Arg Glu Val Ile Ile Pro Asn
225 230 235 240
Leu Glu Arg Tyr Lys Asn Gln Thr Phe Leu Gly Leu Pro Val Ser Ile
245 250 255
Gly Asp Asp Arg.Cys Leu Thr Asn Tyr Ala Ile Asp Leu Gly Arg Thr
260 265 270
Val Tyr Gln Ser Thr Ala Arg Cys Asp Thr Asp Val Pro Phe Gln Leu
275 280 285
Lys Ser Tyr Leu Lys Gln Gln Asn Arg Trp Asn Lys Ser Phe Phe Arg
290 295 300
Glu Ser Ile Ile Ser Val Lys Lys Ile Leu Ser Asn Pro Ile Val Ala
305 310 31S 320
Leu Trp Thr Ile Phe Glu Val Val Met Phe Met Met Leu Ile Val Ala
325 330 335
Ile Gly Asn Leu Leu Phe Asn Gln Ala Ile Gln Leu Asp Leu Ile Lys
340 345 350
Leu Phe Ala Phe Leu Ser Ile Ile Phe Ile Val Ala Leu Cys Arg Asn
355 360 365
Val His Tyr Met Val Lys His Pro Ala Ser Phe Leu Leu Ser Pro Leu
370 375 380
Tyr Gly Ile Leu His Leu Phe Val Leu Gln Pro Leu Lys Leu Tyr Ser
385 390 395 400
Leu Cys Thr Ile Lys Asn Thr Glu Trp Gly Thr Arg Lys Lys Val Thr
405 410 415
Ile Phe Lys
73/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
<210> 37
<211> 419
<212> PRT
<213> Streptococcus pyogenes
<220>
<221> MISC_FEATURE
<222> (124)..(124)
<223> xaa = Ala, Ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (261)..(261)
<223> xaa = Ala, Ser or any other amino acid
<400> 37
Met Pro Ile Phe Lys Lys Thr Leu Ile Val Leu Ser Phe Ile Phe Leu
1 5 10 15
Ile Ser Ile Leu Ile Tyr Leu Asn Met Tyr Leu Phe Gly Thr Ser Thr
20 25 30
Val Gly Ile Tyr Gly Val Ile Leu Ile Thr Tyr Leu Val Ile Lys Leu
35 40 45
Gly Leu Ser Phe Leu Tyr Glu Pro Phe Lys Gly Asn Pro His Asp Tyr
50 55 60
Lys Val Ala Ala Val Ile Pro Ser Tyr Asn Glu Asp Ala Glu Ser Leu
65 70 75 80
Leu Glu Thr Leu Lys Ser Val Leu Ala Gln Thr Tyr Pro Leu Ser Glu
85 90 95
Ile Tyr Ile Val Asp Asp Gly Ser Ser Asn Thr Asp Ala Ile Gln Leu
100 105 110
Ile Glu Glu Tyr Val Asn Arg Glu Val Asp Ile Xaa Arg Asn Val Ile
115 120 125
74/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Val His Arg Ser Leu Val Asn Lys Gly Lys Arg His Ala Gln Ala Trp
130 135 140
Ala Phe Glu Arg Ser Asp Ala Asp Val Phe Leu Thr Val Asp Ser Asp
145 150 155 160
Thr Tyr Ile Tyr Pro Asn Ala Leu Glu Glu Leu Leu Lys Ser Phe Asn
165 170 175
Asp Glu Thr Val Tyr Ala Ala Thr Gly His Leu Asn Ala Arg Asn Arg
180 185 190
Gln Thr Asn Leu Leu Thr Arg Leu Thr Asp Ile Arg Tyr Asp Asn Ala
195 200 205
Phe Gly Val Glu Arg Ala Ala~Gln Ser Leu Thr Gly Asn Ile Leu Val
210 215 220
Cys Ser Gly Pro Leu Ser Ile Tyr Arg Arg Glu Val Ile Ile Pro Asn
225 230 235 240
Leu Glu Arg Tyr Lys Asn Gln Thr Phe Leu Gly Leu Pro Val Ser Ile
245 250 255
Gly Asp Asp Arg Xaa Leu Thr Asn Tyr Ala Ile Asp Leu Gly Arg Thr
260 26S 270
Val Tyr Gln Ser Thr Ala Arg Cys Asp Thr Asp Val Pro Phe Gln Leu
275 280 285
Lys Ser Tyr Leu Lys Gln Gln Asn Arg Trp Asn Lys Ser Phe Phe Arg
290 295 300
Glu Ser Ile Ile Ser Val Lys Lys Ile Leu Ser Asn Pro Ile Val Ala
305 310 315 320
Leu Trp Thr Ile Phe Glu Val Val Met Phe Met Met Leu Ile Val Ala
325 330 335
Ile Gly Asn Leu Leu Phe Asn Gln Ala Ile Gln Leu Asp Leu Ile Lys
340 345 350
Leu Phe Ala Phe Leu Ser Ile Ile Phe Ile Val Ala Leu Cys Arg Asn
355 360 365
Val His Tyr Met Val Lys His Pro Ala Ser Phe Leu Leu Ser Pro Leu
370 375 380
75/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Tyr Gly Ile Leu His Leu Phe Val Leu Gln Pro Leu Lys Leu Tyr Ser
385 390 395 400
Leu Cys Thr Ile Lys Asn Thr Glu Trp Gly Thr Arg Lys Lys Val Thr
405 410 415
Ile Phe Lys
<210> 38
<211> 419
<212> PRT
<213> Streptococcus pyogenes
<220>
<221> MISC_FEATURE
<222> (124)..(124)
<223> xaa = Ala, Ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (280)..(280)
<223> xaa = Ala, Ser or any other amino acid
<400> 38
Met Pro Ile Phe Lys Lys Thr Leu Ile Val Leu Ser Phe Ile Phe Leu
1 5 10 15
Ile Ser Ile Leu Ile Tyr Leu Asn Met Tyr Leu Phe Gly Thr Ser Thr
20 25 30
Val Gly Ile Tyr Gly Val Ile Leu Ile Thr Tyr Leu Val Ile Lys Leu
35 40 45
Gly Leu Ser Phe Leu Tyr Glu Pro Phe Lys Gly Asn Pro His Asp Tyr
50 55 60
Lys Val Ala Ala Val Ile Pro Ser Tyr Asn Glu Asp Ala Glu Ser Leu
65 70 75 80
76/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Leu Glu Thr Leu Lys Ser Val Leu Ala Gln Thr Tyr Pro Leu Ser Glu
85 90 95
Ile Tyr Ile Val Asp Asp Gly Ser Ser Asn Thr Asp Ala Ile Gln Leu
100 105 110
Ile Glu Glu Tyr Val Asn Arg Glu Val Asp Ile Xaa Arg Asn Val Ile
115 120 125
Val His Arg Ser Leu Val Asn Lys Gly Lys Arg His Ala Gln Ala Trp
130 135 140
Ala Phe Glu Arg Ser Asp Ala Asp Val Phe Leu Thr Val Asp Ser Asp
145 150 155 160
Thr Tyr Ile Tyr Pro Asn Ala Leu Glu Glu Leu Leu Lys Ser Phe Asn
165 170 175
Asp Glu Thr Val Tyr Ala Ala Thr Gly His Leu Asn Ala Arg Asn Arg
180 185 190
Gln Thr Asn Leu Leu Thr Arg Leu Thr Asp Ile Arg Tyr Asp Asn Ala
195 200 205
Phe Gly Val Glu Arg Ala Ala Gln Ser Leu Thr Gly Asn Ile Leu Val
210 215 220
Cys Ser Gly Pro Leu Ser Ile Tyr Arg Arg Glu Val Ile Ile Pro Asn
225 230 235 240
Leu Glu Arg Tyr Lys Asn Gln Thr Phe Leu Gly Leu Pro Val Ser Ile
245 250 255
Gly Asp Asp Arg Cys Leu Thr Asn Tyr Ala Ile Asp Leu Gly Arg Thr
260 265 270
Val Tyr Gln Ser Thr Ala Arg Xaa Asp Thr Asp Val Pro Phe Gln Leu
275 280 285
Lys Ser Tyr Leu Lys Gln Gln Asn Arg Trp Asn Lys Ser Phe Phe Arg
290 295 ' 300
Glu Ser Ile Ile Ser Val Lys Lys Ile Leu Ser Asn Pro Ile Val Ala
305 310 315 320
Leu Trp Thr Ile Phe Glu Val Val Met Phe Met Met Leu Ile Val Ala
325 330 335
77/Z07
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Ile Gly Asn Leu Leu Phe Asn Gln Ala Ile Gln Leu Asp Leu Ile Lys
340 345 350
Leu Phe Ala Phe Leu Ser Ile Ile Phe Ile Val Ala Leu Cys Arg Asn
355 360 365
Val His Tyr Met Val Lys His Pro Ala Ser Phe Leu Leu Ser Pro Leu
370 375 380
Tyr Gly Ile Leu His Leu Phe Val Leu Gln Pro Leu Lys Leu Tyr Ser
385 390 395 400
Leu Cys Thr Ile Lys Asn Thr Glu Trp Gly Thr Arg Lys Lys Val Thr
405 410 415
Ile Phe Lys
<210> 39
<211> 419
<212> PRT
<213> Streptococcus pyogenes
<220>
<221> MISC_FEATURE
<222> (124)..(124)
<223> xaa = Ala, Ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (366)..(366)
<223> xaa = Ala, Ser or any other amino acid
<400> 39
Met Pro Ile Phe Lys Lys Thr Leu Ile Val Leu Ser Phe Ile Phe Leu
1 5 10 15
Ile Ser Ile Leu Ile Tyr Leu Asn Met Tyr Leu Phe Gly Thr Ser Thr
20 2S 30
78/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Val Gly Ile Tyr Gly Val Ile Leu Ile Thr Tyr Leu Val Ile Lys Leu
35 40 45
Gly Leu Ser Phe Leu Tyr Glu Pro Phe Lys Gly Asn Pro His Asp Tyr
50 55 60
Lys Val Ala Ala Val Ile Pro Ser Tyr Asn Glu Asp Ala Glu Ser Leu
65 70 75 80
Leu Glu Thr Leu Lys Ser Val Leu Ala Gln Thr Tyr Pro Leu Ser Glu
85 90 95
Ile Tyr Ile Val Asp Asp Gly Ser Ser Asn Thr Asp Ala Ile Gln Leu
100 105 110
Ile Glu Glu Tyr Val Asn Arg Glu Val Asp Ile Xaa Arg Asn Val Ile
115 120 125
Val His Arg Ser Leu Val Asn Lys Gly Lys Arg His Ala Gln Ala Trp
130 135 140
Ala Phe Glu Arg Ser Asp Ala Asp Val Phe Leu Thr Val Asp Ser Asp
145 150 155 160
Thr Tyr Ile Tyr Pro Asn Ala Leu Glu Glu Leu Leu Lys Ser Phe Asn
165 170 175
Asp Glu Thr Val Tyr-Ala Ala Thr Gly His Leu Asn Ala Arg Asn Arg
180 185 190
Gln Thr Asn Leu Leu Thr Arg Leu Thr Asp Ile Arg Tyr Asp Asn Ala
195 200 205
Phe Gly Val Glu Arg Ala Ala Gln Ser Leu Thr Gly Asn Ile Leu Val
210 215 220
Cys Ser Gly Pro Leu Ser Ile Tyr Arg Arg Glu Val Ile Ile Pro Asn
225 230 235 240
Leu G1u Arg Tyr Lys Asn Gln Thr Phe Leu Gly Leu Pro Val Ser Ile
245 250 255
Gly Asp Asp Arg Cys Leu Thr Asn Tyr Ala Ile Asp Leu Gly Arg Thr
260 265 270
Val Tyr Gln Ser Thr Ala Arg Cys Asp Thr Asp Val Pro Phe Gln Leu
275 280 285
79/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Lys Ser Tyr Leu Lys Gln Gln Asn Arg Trp Asn Ly5 Ser Phe Phe Arg
290 295 300
Glu Ser Ile Ile Ser Val Lys Lys Ile Leu Ser Asn Pro Ile Val Ala
305 310 315 320
Leu Trp Thr Ile Phe Glu Val Val Met Phe Met Met Leu Ile Val Ala
325 330 335
Ile Gly Asn Leu Leu Phe Asn Gln Ala Ile Gln Leu Asp Leu Ile Lys
340 345 350
Leu Phe Ala Phe Leu Ser Ile Ile Phe Ile Val Ala Leu Xaa Arg Asn
355 360 365
Val His Tyr Met Val Lys His Pro Ala Ser Phe Leu Leu Ser Pro Leu
370 375 380
Tyr Gly Ile Leu His Leu Phe Val Leu Gln Pro Leu Lys Leu Tyr Ser
385 390 395 400
Leu Cys Thr Ile Lys Asn Thr Glu Trp Gly Thr Arg Lys Lys Val Thr
405 410 415
Ile Phe Lys
<210> 40
<211> 419
<212> PRT
<213> streptococcus pyogenes
<220>
<221> MISC_FEATURE
<222> (124)..(124)
<223> xaa = Ala, Ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (402)..(402)
<223> xaa = Ala, ser or any other amino acid
80/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
<400> 40
Met Pro Ile Phe Lys Lys Thr Leu Ile Val Leu Ser Phe Ile Phe Leu
1 5 l0 15
Ile Ser Ile Leu Ile Tyr Leu Asn Met Tyr Leu Phe Gly Thr Ser Thr
20 25 30
Val Gly Ile Tyr Gly Val Ile Leu Ile Thr Tyr Leu Val Ile Lys Leu
35 40 45
Gly Leu Ser Phe Leu Tyr Glu Pro Phe Lys Gly Asn Pro His Asp Tyr
50 55 60
Lys Val Ala Ala Val Ile Pro Ser Tyr Asn Glu Asp Ala Glu Ser Leu
65 70 75 80
Leu Glu Thr Leu Lys Ser Val Leu Ala Gln Thr Tyr Pro Leu Ser Glu
85 90 95
Ile Tyr Ile Val Asp Asp Gly Ser Ser Asn Thr Asp Ala Ile Gln Leu
100 105 110
Ile Glu Glu Tyr Val Asn Arg Glu Val Asp Ile Xaa Arg Asn Val Ile
115 120 125
Val His Arg Ser Leu Val Asn Lys Gly Lys Arg His Ala Gln Ala Trp
130 135 140
Ala Phe Glu Arg Ser Asp Ala Asp Val Phe Leu Thr Val Asp Ser Asp
145 150 155 160
Thr Tyr Ile Tyr Pro Asn Ala Leu Glu Glu Leu Leu Lys Ser Phe Asn
165 170 175
Asp Glu Thr Val Tyr Ala Ala Thr Gly His Leu Asn Ala Arg Asn Arg
180 185 190
Gln Thr Asn Leu Leu Thr Arg Leu Thr Asp Ile Arg Tyr Asp Asn Ala
195 200 205
Phe Gly Val Glu Arg Ala Ala Gln Ser Leu Thr Gly Asn Ile Leu Val
210 215 220
Cys Ser Gly Pro Leu Ser Ile Tyr Arg Arg Glu Val Ile Ile Pro Asn
225 230 235 240
81/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Leu Glu Arg Tyr Lys Asn Gln Thr Phe Leu Gly Leu Pro Val Ser Ile
245 250 255
Gly Asp Asp Arg Cys Leu Thr Asn Tyr Ala Ile Asp Leu Gly Arg Thr
260 265 270
Val Tyr Gln Ser Thr Ala Arg Cys Asp Thr Asp Val Pro Phe Gln Leu
275 280 285
Lys Ser Tyr Leu Lys Gln Gln Asn Arg Trp Asn Lys Ser Phe Phe Arg
290 295 300
Glu Ser Ile Ile Ser Val Lys Lys Ile Leu Ser Asn Pro Ile Val Ala
305 310 315 320
Leu Trp Thr Ile Phe Glu Val Val Met Phe Met Met Leu Ile Val Ala . -
325 330 335
Ile Gly Asn Leu Leu Phe Asn Gln Ala Ile Gln Leu Asp Leu Ile Lys
340 345 350
Leu Phe Ala Phe Leu Ser Ile Ile Phe Ile Val Ala Leu Cys Arg Asn
355 360 365
Val His Tyr Met Val Lys His Pro Ala Ser Phe Leu Leu Ser Pro Leu
370 375 380
Tyr Gly Ile Leu.His Leu Phe Val Leu Gln Pro Leu Lys Leu Tyr Ser
385 390 395 400
Leu Xaa Thr Ile Lys Asn Thr Glu Trp Gly Thr Arg Lys Lys Val Thr
405 410 415
Ile Phe Lys
<210> 41
<211> 419
<212> PRT
<213> Streptococcus pyogenes
<220>
<221> MISC_FEATURE
<222> (225)..(225)
82/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
<223> xaa = Ala, ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (261)..(261)
<223> xaa = Ala, Ser or any other amino acid
<400> 41
Met Pro Ile Phe Lys Lys Thr Leu Ile Val Leu Ser Phe Ile Phe Leu
1 5 10 15
Ile Ser Ile Leu Ile Tyr Leu Asn Met Tyr Leu Phe Gly Thr Ser Thr
20 25 30
Val Gly Ile Tyr Gly Val Ile Leu Ile Thr Tyr Leu Val Ile Lys Leu
35 40 45
Gly Leu Ser Phe Leu Tyr Glu Pro Phe Lys Gly Asn Pro His Asp Tyr
50 55 60
Lys Val Ala Ala Val Ile Pro Ser Tyr Asn Glu Asp Ala Glu Ser'Leu
65 70 75 80
Leu Glu Thr Leu Lys Ser Val Leu Ala Gln Thr Tyr Pro Leu Ser Glu
85 90 g5
Ile Tyr Ile Val Asp Asp Gly Ser Ser Asn Thr Asp Ala Ile Gln Leu
100 105 110
Ile Glu Glu Tyr Val Asn Arg Glu Val Asp Ile Cys Arg Asn Val Ile
115 120 125
Val His Arg Ser Leu Val Asn Lys Gly Lys Arg His Ala Gln Ala Trp
130 135 140
Ala Phe Glu Arg Ser Asp Ala Asp Val Phe Leu Thr Val Asp Ser Asp
145 150 155 160
Thr Tyr.Ile Tyr Pro Asn Ala Leu Glu Glu Leu Leu Lys Ser Phe Asn
165 170 175
Asp Glu Thr Val Tyr Ala Ala Thr Gly His Leu Asn Ala Arg Asn Arg
180 18S 190
83/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Gln Thr Asn Leu Leu Thr Arg Leu Thr Asp Ile Arg Tyr Asp Asn Ala
195 200 205
Phe Gly Val Glu Arg Ala Ala Gln Ser Leu Thr Gly Asn Ile Leu Val
210 215 220
Xaa Ser Gly Pro Leu Ser Ile Tyr Arg Arg Glu Val Ile Ile Pro Asn
225 230 235 240
Leu Glu Arg Tyr Lys Asn Gln Thr Phe Leu Gly Leu Pro Val Ser Ile
245 250 255
Gly Asp Asp Arg Xaa Leu Thr Asn Tyr Ala Ile Asp Leu Gly Arg Thr
260 265 270
Val Tyr Gln Ser Thr Ala Arg Cys Asp Thr Asp Val Pro Phe Gln Leu
275 280 285
Ly5 Ser Tyr Leu Lys Gln Gln Asn Arg Trp Asn Lys Ser Phe Phe Arg
290 295 300
Glu Ser Ile Ile Ser Val Lys Lys Ile Leu Ser Asn Pro Ile Val Ala
305 310 315 320
Leu Trp Thr Ile Phe Glu Val Val Met Phe Met Met Leu Ile Val Ala
325 330 335
Ile Gly Asn Leu Leu Phe Asn Gln Ala Ile Gln Leu Asp Leu Ile Lys
340 345 350
Leu Phe Ala Phe Leu Ser Ile Ile Phe Ile Val Ala Leu Cys Arg Asn
355 360 365
Val His Tyr Met Val Lys His Pro Ala Ser Phe Leu Leu Ser Pro Leu
370 375 380
Tyr Gly Ile Leu His Leu Phe Val Leu Gln Pro Leu Lys Leu Tyr Ser
385 390 395 400
Leu Cys Thr Ile Lys Asn Thr Glu Trp Gly Thr Arg Lys Lys Val Thr
405 410 415
Ile Phe Lys
<210> 42
<211> 419
84/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
<21Z> PRT
<213> Streptococcus pyogenes
<220>
<221> MISC_FEATURE
<222> (225)..(280)
<223> xaa = Ala, ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (280)..(280)
<223> xaa = Ala, Ser or any other amino acid
<400> 42
Met Pro Ile Phe Lys Lys Thr Leu Ile Val Leu Ser Phe Ile Phe Leu
1 5 10 15
Ile Ser Ile Leu Ile Tyr Leu Asn Met Tyr Leu Phe Gly Thr Ser Thr
20 25 30
Val Gly Ile Tyr Gly Val Ile Leu Ile Thr Tyr Leu Val Ile Lys Leu
35 40 45
Gly Leu Ser Phe Leu Tyr Glu Pro Phe Lys Gly Asn Pro His Asp Tyr
50 55 60
Lys Val Ala Ala Val Ile Pro Ser Tyr Asn Glu Asp Ala Glu Ser Leu
65 70 75 80
Leu Glu Thr Leu Lys Ser Val Leu Ala Gln Thr Tyr Pro Leu Ser Glu
85 90 95
Ile Tyr Ile Val Asp Asp Gly Ser Ser Asn Thr Asp Ala Ile Gln Leu
100 105 110
Ile Glu Glu Tyr Val Asn Arg Glu Val Asp Ile Cys Arg Asn Val Ile
115 120 125
Val His Arg Ser Leu Val Asn Lys Gly Lys Arg His Ala Gln Ala Trp
130 135 140
85/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Ala Phe Glu Arg Ser Asp Ala Asp Val Phe Leu Thr Val Asp Ser Asp
145 150 155 160
Thr Tyr Ile Tyr Pro Asn Ala Leu Glu Glu Leu Leu tys Ser Phe Asn
165 170 175
Asp Glu Thr Val Tyr Ala Ala Thr Gly His Leu Asn Ala Arg Asn Arg
180 185 190
Gln Thr Asn Leu Leu Thr Arg Leu Thr Asp Ile Arg Tyr Asp Asn Ala
195 200 205
Phe Gly Val Glu Arg Ala Ala Gln Ser Leu Thr Gly Asn Ile Leu Val
210 215 220
Xaa Ser Gly Pro Leu ser Ile Tyr Arg Arg Glu Val Ile Ile Pro Asn
225 230 235 240
Leu Glu Arg Tyr Lys Asn Gln-Thr-Phe Leu Gly Leu Pro Val Ser Ile
245 250 255
Gly Asp Asp Arg Cys Leu Thr Asn Tyr Ala Ile Asp,Leu Gly Arg Thr
260 265 270
Val Tyr Gln ser Thr Ala Arg Xaa Asp Thr Asp Val Pro Phe Gln Leu
275 280 285
Lys Ser Tyr Leu Lys Gln Gln Asn Arg Trp Asn Lys Ser Phe Phe Arg
290 295 300
Glu Ser Ile Ile Ser Val Lys Lys Ile Leu Ser Asn Pro Ile Val Ala
305 310 315 320
Leu Trp Thr Ile Phe Glu Val Val Met Phe Met Met Leu Ile Val Ala
325 330 335
Ile Gly Asn Leu Leu Phe Asn Gln Ala Ile Gln Leu Asp Leu Ile Lys
340 345 35'0
Leu Phe Ala Phe Leu Ser Ile Ile Phe Ile Val Ala Leu Cys Arg Asn
355 360 365
Val His Tyr Met Val Lys His Pro Ala Ser Phe Leu Leu Ser Pro Leu
370 375 380
Tyr Gly Ile Leu His Leu Phe Val Leu Gln Pro Leu Lys Leu Tyr Ser
385 390 395 400
86/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Leu Cys Thr Ile Lys Asn Thr Glu Trp Gly Thr Arg Lys Lys Val Thr
405 410 415
Ile Phe Lys
<210> 43
<211> 419
<Z12> PRT
<213> streptococcus pyogenes
<220>
<221> MISC_FEATURE
<222> (2Z5)..(225)
<223> xaa = Ala, Ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (366)..(366)
<223> xaa = Ala, Ser or any other amino acid
<400> 43
Met Pro Ile Phe Lys Lys Thr Leu Ile Val Leu Ser Phe Ile Phe Leu
1 5 10 15
Ile Ser Ile Leu Ile Tyr Leu Asn Met Tyr Leu Phe Gly Thr Ser Thr
20 25 30
Val Gly Ile Tyr Gly Val Ile Leu Ile Thr Tyr Leu Val Ile Lys Leu
35 40 45
Gly Leu Ser Phe Leu Tyr Glu Pro Phe Lys Gly Asn Pro His Asp Tyr
50 55 60
Lys Val Ala Ala Val Ile Pro Ser Tyr Asn Glu Asp Ala Glu Ser Leu
65 70 75 80
Leu Glu Thr Leu Lys Ser Val Leu Ala Gln Thr Tyr Pro Leu Ser Glu
85 90 95
87/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Ile Tyr Ile Val Asp Asp Gly Ser Ser Asn Thr Asp Ala Ile Gln Leu
100 105 110
Ile Glu Glu Tyr Val Asn Arg Glu Val Asp Ile Cys Arg Asn Val Ile
115 120 125
Val His Arg Ser Leu Val Asn Lys Gly Lys Arg His Ala Gln Ala Trp
130 135 140
Ala Phe Glu Arg Ser Asp Ala Asp Val Phe Leu Thr Val Asp Ser Asp
145 150 155 160
Thr Tyr Ile Tyr Pro Asn Ala Leu Glu Glu Leu Leu Lys Ser Phe Asn
165 170 175
Asp Glu Thr Val Tyr Ala Ala Thr Gly His Leu Asn Ala Arg Asn Arg
180 185 190
Gln Thr Asn Leu Leu Thr Arg Leu Thr Asp Ile Arg Tyr Asp Asn Ala
195 200 205
Phe Gly Val Glu Arg Ala Ala Gln Ser Leu Thr Gly Asn Ile Leu Val
210 215 220
Xaa Ser Gly Pro Leu Ser Ile Tyr Arg Arg Glu Val Ile Ile Pro Asn
225 230 235 240
Leu Glu Arg Tyr Lys Asn Gln Thr Phe Leu Gly Leu Pro Val Ser Ile
245 250 255
Gly Asp Asp Arg Cys Leu Thr Asn Tyr Ala Ile Asp Leu Gly Arg Thr
260 265 270
Val Tyr Gln Ser Thr Ala Arg Cys Asp Thr Asp Val Pro Phe Gln Leu
275 280 285
Lys Ser Tyr Leu Lys Gln Gln Asn Arg Trp Asn Lys Ser Phe Phe Arg
290 295 300
Glu Ser Ile Ile Ser Val Lys Lys Ile Leu Ser Asn Pro Ile Val Ala
305 310 315 320
Leu Trp Thr Ile Phe Glu Val Val Met Phe Met Met Leu Ile Val Ala
325 330 335
Ile Gly Asn Leu Leu Phe Asn G?n Ala Ile Gln Leu Asp Leu Ile Lys
340 345 350
88/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Leu Phe Ala Phe Leu Ser Ile Ile Phe Ile Val Ala Leu Xaa Arg Asn
355 360 365
Val His Tyr Met Val Lys His Pro Ala Ser Phe Leu Leu Ser Pro Leu
370 375 380
Tyr Gly Ile Leu His Leu Phe Val Leu Gln Pro Leu Lys Leu Tyr Ser
385 390 395 400
Leu Cys Thr Ile Lys Asn Thr Glu Trp Gly Thr Arg Lys Lys Val Thr
405 410 415
Ile Phe Lys
<210> 44
<211> 419
<212> PRT
<213> Streptococcus pyogenes
<220>
<221> MISC_FEATURE
<222> (225)..(225)
<223> xaa = Ala, ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (402)..(402)
<Z23> xaa = Ala, ser or any other amino acid
<400> 44
Met Pro Ile Phe Lys Lys Thr Leu Ile Val Leu Ser Phe Ile Phe Leu
1 5 10 15
Ile Ser Ile Leu Ile Tyr Leu Asn Met Tyr Leu Phe Gly Thr Ser Thr
20 25 30
Val Gly Ile Tyr Gly Val Ile Leu Ile Thr Tyr Leu Val Ile Lys Leu
35 40 45
89/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Gly Leu Ser Phe Leu Tyr Glu Pro Phe Lys Gly Asn Pro His Asp Tyr
50 55 60
Lys Val Ala Ala Val Ile Pro Ser Tyr Asn Glu Asp Ala Glu Ser Leu
65 70 75 80
Leu Glu Thr Leu Lys Ser Val Leu Ala Gln Thr Tyr Pro Leu Ser Glu
85 90 95
Ile Tyr Ile Val Asp Asp Gly Ser Ser Asn Thr Asp Ala Ile Gln Leu
100 105 110
Ile Glu Glu Tyr Val Asn Arg Glu Val Asp Ile Cys Arg Asn Val Ile
115 120 125
Val His Arg Ser Leu Val Asn Lys Gly Lys Arg His Ala Gln Ala Trp
130 135 140
Ala Phe Glu Arg Ser Asp Ala Asp Val Phe Leu Thr Val Asp Ser Asp
145 150 155 160
Thr Tyr Ile Tyr Pro Asn Ala Leu Glu Glu Leu Leu Lys Ser Phe Asn
165 170 175
Asp Glu Thr Val Tyr Ala Ala Thr Gly His Leu Asn Ala Arg Asn Arg
180 185 190
Gln Thr Asn Leu Leu Thr Arg Leu Thr Asp Ile Arg Tyr Asp Asn Ala
195 200 205
Phe Gly Val Glu Arg Ala Ala Gln Ser Leu Thr Gly Asn Ile Leu Val
210 215 220
Xaa Ser Gly Pro Leu Ser Ile Tyr Arg Arg Glu Val Ile Ile Pro Asn
225 230 235 240
Leu Glu Arg Tyr Lys Asn Gln Thr Phe Leu Gly Leu Pro Val Ser Ile
245 250 255
Gly Asp Asp Arg Cys Leu Thr Asn Tyr Ala Ile Asp Leu Gly Arg Thr
260 265 270
Val Tyr Gln Ser Thr Ala Arg Cys Asp Thr Asp Val Pro Phe Gln Leu
275 280 285
Lys Ser Tyr Leu Lys Gln Gln Asn Arg Trp Asn Lys Ser Phe Phe Arg
290 295 300
90/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Glu Ser Ile Ile Ser Val Lys Lys Ile Leu Ser Asn Pro Ile Val Ala
305 310 315 320
Leu Trp Thr Ile Phe Glu Val Val Met Phe Met Met Leu Ile Val Ala
325 330 335
Ile Gly Asn Leu Leu Phe Asn Gln Ala Ile Gln Leu Asp Leu Ile Lys
340 345 350
Leu Phe Ala Phe Leu Ser Ile Ile Phe Ile Val Ala Leu Cys Arg Asn
355 360 365
Val His Tyr Met Val Lys His Pro Ala Ser Phe Leu Leu Ser Pro Leu
370 375 380
Tyr Gly Ile Leu His Leu Phe Val Leu Gln Pro Leu Lys Leu Tyr Ser
385 390 395 400
Leu Xaa Thr Ile Lys Asn Thr Glu Trp Gly Thr Arg Lys Lys Val Thr
405 410 415
Ile Phe Lys
<210> 45
<211> 419
<212> PRT
<213> streptococcus pyogenes
<220>
<221> MISC_FEATURE
<222> (261)..(261)
<223> Xaa = Ala, Ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (280)..(280)
<223> Xaa = Ala, Ser or any other amino acid
<400> 45
91/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Met Pro Ile Phe Lys Lys Thr Leu Ile val Leu Ser Phe Ile Phe Leu
1 5 10 15
Ile Ser Ile Leu Ile Tyr Leu Asn Met Tyr Leu Phe Gly Thr Ser Thr
20 25 30
Val Gly Ile Tyr Gly Val Ile Leu Ile Thr Tyr Leu Val Ile Lys Leu
35 40 45
Gly Leu Ser Phe Leu Tyr Glu Pro Phe Lys Gly Asn Pro His Asp Tyr
50 55 60
Lys Val Ala Ala Val Ile Pro Ser Tyr Asn Glu Asp Ala Glu Ser Leu
65 70 75 80
Leu Glu Thr Leu Lys Ser Val Leu Ala Gln Thr Tyr Pro Leu Ser Glu
85 90 95~
Ile Tyr Ile Val Asp Asp Gly Ser Ser Asn Thr Asp Ala Ile Gln Leu
100 105 110
Ile Glu Glu Tyr Val Asn Arg Glu Val Asp Ile Cys Arg Asn Val Ile
115 120 125
Val His Arg Ser Leu Val Asn Lys Gly Lys Arg His Ala Gln Ala Trp
130 135 140
Ala Phe Glu Arg Ser Asp Ala Asp Val Phe Leu Thr Val Asp Ser Asp
145 150 155 160
Thr Tyr Ile Tyr Pro Asn Ala Leu Glu Glu Leu Leu Lys Ser Phe Asn
165 170 175
Asp Glu Thr Val Tyr Ala Ala Thr Gly His Leu Asn Ala Arg Asn Arg
180 185 190
Gln Thr Asn Leu Leu Thr Arg Leu Thr Asp Ile Arg Tyr Asp Asn Ala
195 200 205 .
Phe Gly Val Glu Arg Ala Ala Gln Ser Leu Thr Gly Asn Ile Leu Val
210 215 220
Cys Ser Gly Pro Leu Ser Ile Tyr Arg Arg Glu Val Ile Ile Pro Asn
225 230 235 240
Leu Glu Arg Tyr Lys Asn Gln Thr Phe Leu Gly Leu Pro Val Ser Ile
245 250 255
92/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Gly Asp Asp Arg Xaa Leu Thr Asn Tyr Ala Ile Asp Leu Gly Arg Thr
260 265 270
Val Tyr Gln Ser Thr Ala Arg Xaa Asp Thr Asp Val Pro Phe Gln Leu
275 280 285
Lys Ser Tyr Leu Lys Gln Gln Asn Arg Trp Asn Lys Ser Phe Phe Arg
290 295 300
Glu Ser Ile Ile Ser Val Lys Lys Ile Leu Ser Asn Pro Ile Val Ala
305 310 315 320.. _~
Leu Trp Thr Ile Phe Glu Val Val Met Phe Met Met Leu Ile Val Ala
325 330 335
Ile Gly Asn Leu Leu Phe Asn Gln Ala Ile Gln Leu Asp Leu Ile Lys
340 345 350
Leu Phe Ala Phe Leu Ser Ile Ile Phe Ile Val Ala Leu Cys Arg Asn
355 360 365
Val His Tyr Met Val Lys His Pro Ala Ser Phe Leu Leu Ser Pro Leu
370 375 380
Tyr Gly Ile Leu His Leu Phe Val Leu Gln Pro Leu Lys Leu Tyr Ser
385 390 395 400
Leu Cys Thr Ile Lys Asn Thr Glu Trp Gly Thr Arg Lys Lys Val Thr
40S 410 415
Ile Phe Lys
<210> 46
<211> 419
<212> PRT
<213> streptococcus pyogenes
<220>
<221> MISC_FEATURE
<222> (261)..(261)
<223> xaa = Ala, ser or any other amino acid
93/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
<220>
<221> MISC_FEATURE
<222> (366)..(366)
<223> xaa = Ala, Ser or any other amino acid
<400> 46
Met Pro Ile Phe Lys Lys Thr Leu Ile Val Leu Ser Phe Ile Phe Leu
1 5 10 15
Ile Ser Ile Leu Ile Tyr Leu Asn Met Tyr Leu Phe Gly Thr Ser Thr
20 25 30
Val Gly Ile Tyr Gly Val Ile Leu Ile Thr Tyr Leu Val Ile Lys Leu
35 40 45
Gly Leu Ser Phe Leu Tyr Glu Pro Phe Lys Gly Asn Pro His Asp Tyr
50 55 60
Lys Val Ala Ala Val Ile Pro Ser Tyr Asn Glu Asp Ala Glu Ser Leu
65 70 75 80
Leu Glu Thr Leu Lys Ser Val Leu Ala Gln Thr Tyr Pro Leu Ser Glu
85 90 95
Ile Tyr Ile Val Asp Asp Gly Ser Ser Asn Thr Asp Ala Ile Gln Leu
100 105 110
Ile Glu Glu Tyr Val Asn Arg Glu Val Asp Ile Cys Arg Asn Val Ile
115 120 125
Val His Arg Ser Leu Val Asn Lys Gly Lys Arg His Ala Gln Ala Trp
130 135 140
Ala Phe Glu Arg Ser Asp Ala Asp Val Phe.Leu Thr Val Asp Ser Asp
145 150 155 160
Thr Tyr Ile Tyr Pro Asn Ala Leu Glu Glu Leu Leu Lys Ser Phe Asn
165 170 175
Asp Glu Thr Val Tyr Ala Ala Thr Gly His Leu Asn Ala Arg Asn Arg
180 185 190
Gln Thr Asn Leu Leu Thr Arg Leu Thr Asp Ile Arg Tyr Asp Asn Ala
195 200 205
94/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Phe Gly Val Glu Arg Ala Ala Gln Ser Leu Thr Gly Asn Ile Leu Val
210 215 220
Cys Ser Gly Pro Leu Ser Ile Tyr Arg Arg Glu Val Ile Ile Pro Asn
225 230 Z35 240
Leu Glu Arg Tyr Lys Asn Gln Thr Phe Leu Gly Leu Pro Val Ser Ile
245 250 255
Gly Asp Asp Arg Xaa Leu Thr Asn Tyr Ala Ile Asp Leu Gly Arg Thr
260 265 270
Val Tyr Gln Ser Thr Ala Arg Cys Asp Thr Asp val Pro Phe Gln Leu
275 280 285
Lys~Ser Tyr Leu Lys Gln Gln Asn Arg Trp Asn Lys Ser Phe Phe Arg
290 295 300
Glu Ser Ile Ile Ser Val Lys Lys Ile Leu Ser Asn Pro Ile Val Ala
305 310 315 320
Leu Trp Thr Ile Phe Glu Val Val Met Phe Met Met Leu Ile Val Ala
325 330 335
Ile Gly Asn Leu Leu Phe Asn Gln Ala Ile Gln Leu Asp Leu Ile Lys
340 345 350
Leu Phe Ala Phe Leu Ser Ile Ile Phe Ile Val Ala Leu Xaa Arg Asn
355 360 365
Val His Tyr Met Val Lys His Pro Ala Ser Phe Leu Leu Ser Pro Leu
370 375 380
Tyr Gly Ile Leu His Leu Phe Val Leu Gln Pro Leu Lys Leu Tyr Ser
385 390 395 400
Leu Cys Thr Ile Lys Asn Thr Glu Trp Gly Thr Arg Lys Lys Val Thr
405 410 415
Ile Phe Lys
<210> 47
<211> 419
<212> PRT
<213> Streptococcus pyogenes
95/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
<220>
<221> MISC_FEATURE
<222> (261)..(261)
<223> xaa = Ala, Ser or any other amino acid
<220>
<221> MISC FEATURE
<222> (402)..(402)
<223> xaa = Ala, Ser or any other amino acid
<400> 47
Met Pro Ile Phe Lys Lys Thr Leu Ile Val Leu Ser Phe Ile Phe Leu
1 5 10 15
Ile Ser Ile Leu Ile Tyr Leu Asn Met Tyr Leu Phe Gly Thr Ser Thr
20 25 30
Val Gly Ile Tyr Gly Val Ile Leu Ile Thr Tyr Leu Val Ile Lys Leu
35 40 45
Gly Leu Ser Phe Leu Tyr Glu Pro Phe Lys Gly Asn Pro.His Asp Tyr
50 55 60
Lys Val Ala Ala Val Ile Pro Ser Tyr Asn Glu Asp Ala Glu Ser Leu
65 70 75 80
Leu Glu Thr Leu Lys Ser Val Leu Ala Gln Thr Tyr Pro Leu Ser Glu
85 90 95
Ile Tyr Ile val Asp Asp Gly Ser Ser Asn Thr Asp Ala Ile Gln Leu
100 105 110
Ile Glu Glu Tyr Val Asn Arg Glu Val Asp Ile Cys Arg Asn Va1 Ile
115 120 125
Val His Arg Ser Leu Val Asn Lys Gly Lys Arg His Ala Gln Ala Trp
130 135 140
Ala Phe Glu Arg Ser Asp Ala Asp Val Phe Leu Thr val Asp ser Asp
145 150 155 160
96/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Thr Tyr Ile Tyr Pro Asn Ala Leu Glu Glu Leu Leu Lys Ser Phe Asn
165 170 175
Asp Glu Thr Val Tyr Ala Ala Thr Gly tiffs Leu Asn Ala Arg Asn Arg
180 185 190
Gln Thr Asn Leu Leu Thr Arg Leu Thr Asp Ile Arg Tyr Asp Asn Ala
195 200 205
Phe Gly Val Glu Arg Ala Ala Gln Ser Leu Thr Gly Asn Ile Leu Val
210 215 220
Cys Ser Gly Pro Leu Ser Ile Tyr Arg Arg Glu Val Ile Ile Pro Asn
225 230' 235 240
Leu Glu Arg Tyr Lys Asn Gln Thr Phe Leu Gly Leu Pro Val Ser Ile
245 250 255
Gly Asp Asp Arg Xaa Leu Thr Asn Tyr Ala Ile Asp Leu Gly Arg Thr
260 265 270
Val Tyr Gln Ser Thr Ala Arg Cys Asp Thr Asp Val Pro Phe Gln Leu
275 280 285
Lys Ser Tyr Leu Lys Gln Gln Asn Arg Trp Asn Lys Ser Phe Phe Arg
290 295 300
Glu Ser Ile Ile See Val Lys Lys Ile Leu Ser Asn Pro Ile Val Ala
305 310 315 320
Leu Trp Thr Ile Phe Glu Val Val Met Phe Met Met Leu Ile Val Ala
325 330 335
Ile Gly Asn Leu Leu Phe Asn Gln Ala Ile Gln Leu Asp Leu Ile Lys
340 345 350
Leu Phe Ala Phe Leu Ser Ile Ile Phe Ile Val Ala Leu Cys Arg Asn
355 360 365
Val His Tyr Met Val Lys His Pro Ala 5er Phe Leu Leu Ser Pro Leu
370 375 380
Tyr Gly Ile Leu His Leu Phe Val Leu Gln Pro Leu Lys Leu Tyr Ser
385 390 395 400
Leu Xaa Thr Ile Lys Asn Thr Glu Trp Gly Thr Arg Lys Lys Val Thr
405 410 415
97/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Ile Phe Lys
<210> 48
<211> 419
<212> PRT
<213> Streptococcus pyogenes
<220>
<221> MISC_FEATURE
<222> (280)..(280)
<223> xaa = Ala, Ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (366)..(366)
<223> xaa = Ala, Ser or any other amino acid
<400> 48
Met Pro Ile Phe Lys Lys Thr Leu Ile Val Leu Ser Phe Ile Phe Leu
1 5 10 15
Ile Ser Ile Leu Ile Tyr Leu Asn Met Tyr Leu Phe Gly Thr Ser Thr
20 25 30
Val Gly Ile Tyr Gly Val Ile Leu Ile Thr Tyr Leu Val Ile Lys Leu
35 40 45
Gly Leu Ser Phe Leu Tyr Glu Pro Phe Lys Gly Asn Pro His Asp Tyr
50 55 60
Lys Val Ala Ala Val Ile Pro Ser Tyr Asn Glu Asp Ala Glu Ser Leu
65 70 75 80
Leu Glu Thr Leu Lys Ser Val Leu Ala Gln Thr Tyr Pro Leu Ser Glu
85 90 95
Ile Tyr Ile Val Asp Asp Gly Ser Ser Asn Thr Asp Ala Ile Gln Leu
100 105 110
98/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Ile Glu Glu Tyr Val Asn Arg Glu Val Asp Ile Cys Arg Asn Val ile
115 120 125
Val His Arg Ser Leu Val Asn Lys Gly Lys Arg His Ala Gln Ala Trp
130 135 140
Ala Phe Glu Arg Ser Asp Ala Asp Val Phe Leu Thr Val Asp Ser Asp
145 150 155 160
Thr Tyr Ile Tyr Pro Asn Ala Leu Glu Glu Leu Leu Lys Ser Phe Asn
165 170 175
Asp Glu Thr Val Tyr Ala Ala Thr Gly His Leu Asn Ala Arg Asn Arg
180 185 190
Gln Thr Asn Leu Leu Thr Arg Leu Thr Asp Ile Arg Tyr Asp Asn Ala
195 200 205
Phe Gly Val Glu Arg Ala Ala Gln Ser Leu Thr Gly Asn Ile Leu Val
210 215 220
Cys Ser Gly Pro Leu Ser Ile Tyr Arg Arg Glu Val Ile Ile Pro Asn
225 230 235 240
Leu Glu Arg Tyr Lys Asn Gln Thr Phe Leu Gly Leu Pro Val Ser Ile
245 250 255
Gly Asp Asp Arg Cys Leu Thr Asn Tyr Ala Ile Asp Leu Gly Arg Thr
260 265 270
Val Tyr Gln Ser Thr Ala Arg Xaa Asp Thr Asp Val Pro Phe Gln Leu
275 280 285
Lys Ser Tyr Leu Lys Gln Gln Asn Arg Trp Asn Lys Ser Phe Phe Arg
290 295 300
Glu Ser Ile Ile Ser Val Lys Lys Ile Leu Ser Asn Pro Ile Val Ala
305 310 315 320
Leu Trp Thr Ile Phe Glu Val Val Met Phe Met Met Leu Ile Val Ala
325 330 335
Ile Gly Asn Leu Leu Phe Asn Gln Ala Ile Gln Leu Asp Leu Ile Lys
340 345 350
Leu Phe Ala Phe Leu Ser Ile Ile Phe Ile Val Ala Leu Xaa Arg Asn
355 360 365
99/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Val His Tyr Met Val Lys His Pro Ala Ser Phe Leu Leu Ser Pro Leu
370 375 380
Tyr Gly Ile Leu His Leu Phe Val Leu Gln Pro Leu Lys Leu Tyr Ser
385 390 395 400
Leu Cys Thr Ile Lys Asn Thr Glu Trp Gly Thr Arg Lys Lys Val Thr
405 410 415
Ile Phe Lys
<210> 49
<211> 419
<212> PRT
<213> Streptococcus pyogenes
<220>
<221> MISC_FEATURE
<222> (280)..(280)
<223> xaa = Ala, Ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (402)..(402)
<223> xaa = Ala, 5er or any other amino acid
<400> 49
Met Pro Ile Phe Lys Lys Thr Leu Ile Val Leu Ser Phe Ile Phe Leu
1 5 10 15
Ile ser Ile Leu Ile Tyr Leu Asn Met Tyr Leu Phe Gly Thr Ser Thr
20 25 30
Val Gly Ile Tyr Gly Val Ile Leu Ile Thr Tyr Leu Val Ile Lys Leu
35 40 45
Gly Leu Ser Phe Leu Tyr Glu Pro Phe Lys Gly Asn Pro His Asp Tyr
50 55 60
100/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Lys Val Ala Ala Val Ile Pro Ser Tyr Asn Glu Asp Ala Glu Ser Leu
65 70 75 80
Leu Glu Thr Leu Lys Ser Val Leu Ala Gln Thr Tyr Pro Leu Ser Glu
85 90 95
Ile Tyr Ile Val Asp Asp Gly Ser Ser ASn Thr Asp Ala Ile Gln Leu
100 105 110
Ile Glu Glu Tyr Val Asn Arg Glu Val Asp Ile Cys Arg Asn Val Ile
115 120 125
Val His Arg Ser Leu Val Asn Lys Gly Lys Arg His Ala Gln Ala Trp
130 135 140
Ala Phe Glu Arg Ser Asp Ala Asp Val Phe Leu Thr Val Asp Ser Asp
145 150 155 160
Thr Tyr Ile Tyr Pro Asn Ala Leu Glu Glu Leu Leu Lys Ser Phe Asn
165 170 175
Asp Glu Thr Val Tyr Ala Ala Thr Gly His Leu Asn Ala Arg Asn Arg
180 185 190
Gln Thr Asn Leu Leu Thr Arg Leu Thr Asp Ile Arg Tyr Asp Asn Ala
195 200 205
Phe Gly Val Glu Arg Ala Ala Gln Ser Leu Thr Gly Asn Ile Leu Val
210 215 220
Cys Ser Gly Pro Leu Ser Ile Tyr Arg.Arg Glu Val Ile Ile Pro Asn
225 230 235 240
Leu Glu Arg Tyr Lys Asn Gln Thr Phe Leu Gly Leu Pro Val Ser Ile
245 250 255
Gly Asp Asp Arg Cys Leu Thr Asn Tyr Ala Ile Asp Leu Gly Arg Thr
260 265 270
Val Tyr Gln Ser Thr Ala Arg Xaa Asp Thr Asp Val Pro Phe Gln Leu
275 280 285
Lys Ser Tyr Leu Lys Gln Gln Asn Arg Trp Asn Lys Ser Phe Phe Arg
290 295 300
Glu Ser Ile Ile Ser val Lys Lys Ile Leu Ser Asn Pro Ile Val Ala
305 310 315 320
101/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Leu Trp Thr Ile Phe Glu Val Val Met Phe Met Met Leu Ile Val Ala
325 330 335
Ile Gly Asn Leu Leu Phe Asn Gln Ala Ile Gln Leu Asp Leu Ile Lys
340 345 350
Leu Phe Ala Phe Leu Ser Ile Ile Phe Ile Val Ala Leu Cys Arg Asn
355 360 365
Val His Tyr Met Val Lys His Pro Ala Ser Phe Leu Leu Ser Pro Leu
370 375 380
Tyr Gly Ile Leu His Leu Phe Val Leu Gln Pro Leu Lys Leu Tyr Ser
385 390 395 400
Leu Xaa Thr Ile Lys Asn Thr Glu Trp Gly Thr Arg Lys Lys Val Thr
405 410 415
Ile Phe Lys
<210> 50
<211> 419
<212> PRT
<213> streptococcus pyogenes
<220>
<221> MISC_FEATURE
<222> (366)..(366)
<223> Xaa= Ala, Ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (402)..(402)
<223> Xaa= Ala, Ser or any other amino acid
<400> 50
Met Pro Ile Phe Lys Lys Thr Leu Ile Val Leu Ser Phe Ile Phe Leu
1 5 10 15
102/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Ile Ser Ile Leu Ile Tyr Leu Asn Met Tyr Leu Phe Gly Thr Ser Thr
20 25 30
Val Gly Ile Tyr Gly Val Ile Leu Ile Thr Tyr Leu Val Ile Lys Leu
35 40 45
Gly Leu Ser Phe Leu Tyr Glu Pro Phe Lys Gly Asn Pro His Asp Tyr
50 55 60
Lys Val Ala Ala Val Ile Pro Ser Tyr Asn Glu Asp Ala Glu Ser Leu
6S 70 75 80
Leu Glu Thr Leu Lys Ser Val Leu Ala Gln Thr Tyr Pro Leu Ser Glu
85 90 95
Ile Tyr Ile Val Asp Asp Gly Ser Ser Asn Thr Asp Ala Ile Gln Leu
100 105 110
Ile Glu Glu Tyr Val Asn Arg Glu Val Asp Ile Cys Arg Asn Val Ile
115 120 125
Val His Arg Ser Leu Val Asn Lys Gly Lys Arg His Ala Gln Ala Trp
130 13S 140
Ala Phe Glu Arg Ser Asp Ala Asp Val Phe Leu Thr Val Asp Ser Asp
145 150 155 160
Thr Tyr Ile Tyr Pro Asn Ala Leu Glu Glu Leu Leu Lys Ser Phe Asn
165 170 175
Asp Glu Thr Val Tyr Ala Ala Thr Gly His Leu Asn Ala Arg Asn Arg
180 185 190
Gln Thr Asn Leu Leu Thr Arg Leu Thr Asp Ile Arg Tyr Asp Asn Ala
195 200 205
Phe Gly Val Glu Arg Ala Ala Gln Ser Leu Thr Gly Asn Ile Leu Val
210 215 220
Cys Ser Gly Pro Leu Ser Ile Tyr Arg Arg Glu Val Ile Ile Pro Asn
225 230 235 240
Leu Glu Arg Tyr Lys Asn Gln Thr Phe Leu Gly Leu Pro Val Ser Ile
245 250 255
Gly Asp Asp Arg Cys Leu Thr Asn Tyr Ala Ile Asp Leu Gly Arg Thr
260 26S 270
103/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Val Tyr Gln Ser Thr Ala Arg Cys Asp Thr Asp Val Pro Phe Gln Leu
275 280 285
Lys Ser Tyr Leu Lys Gln Gln Asn Arg Trp Asn Lys Ser Phe Phe Arg
290 295 300
Glu Ser Ile Ile Ser Val Lys Lys Ile Leu Ser Asn Pro Ile val Ala
305 310 315 320
Leu Trp Thr Ile Phe Glu Val Val Met Phe Met Met Leu Ile Val Ala
325 330 335
Ile Gly Asn Leu Leu Phe Asn Gln Ala Ile Gln Leu Asp Leu Ile Lys
340 345 350
Leu Phe Ala Phe Leu Ser Ile Ile Phe Ile Val Ala Leu Xaa Arg Asn
355 360 365
Val His Tyr Met Val Lys His Pro Ala Ser Phe Leu Leu Ser Pro Leu
370 375 380
Tyr Gly Ile Leu His Leu Phe Val Leu Gln Pro Leu Lys Leu Tyr See
385 390 395 400
Leu Xaa Thr Ile Lys Asn Thr Glu Trp Gly Thr Arg Lys Lys Val Thr
405 410 415
Ile Phe Lys
<210> 51
<211> 419
<212> PRT
<213> Streptococcus pyogenes
<220>
<221> MISC_FEATURE
<222> (124)..(124)
<223> xaa = Ala, ser or any other amino acid
<220>
<221> MISC_FEATURE
104/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
<222> (261)..(261)
<223> Xaa = Ala, Ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (225)..(225)
<223> xaa = Ala, Ser or any other amino acid
<400> 51
Met Pro Ile Phe Lys Lys Thr Leu Ile Val Leu Ser Phe Ile Phe Leu
1 5 10 15
Ile Ser Ile Leu Ile Tyr Leu Asn Met Tyr Leu Phe Gly Thr Ser Thr
20 25 30
Val Gly Ile Tyr Gly Val Ile Leu Ile Thr Tyr Leu Val Ile Lys Leu
35 40 45
Gly Leu Ser Phe Leu Tyr Glu Pro Phe Lys Gly Asn Pro His Asp Tyr
50 55 60
Lys Val Ala Ala Val Ile Pro Ser Tyr Asn Glu Asp Ala Glu Ser Leu
65 70 75 80
Leu Glu Thr Leu Lys Ser Val Leu Ala Gln Thr Tyr Pro Leu Ser Glu
85 90 95
Ile Tyr Ile Val Asp Asp Gly Ser Ser Asn Thr Asp Ala Ile Gln Leu
100 105 110
Ile Glu Glu Tyr Val Asn Arg Glu Val Asp.Ile Xaa Arg Asn Val Ile
115 120 125
Val His Arg Ser Leu Val Asn Lys Gly Lys Arg His Ala Gln Ala Trp
130 135 140
Ala Phe Glu Arg Ser Asp Ala Asp Val Phe Leu Thr Val Asp Ser Asp
145 150 155 160
Thr Tyr Ile Tyr Pro Asn Ala Leu Glu Glu Leu Leu Lys Ser Phe Asn
165 170 175
Asp Glu Thr Val Tyr Ala Ala Thr Gly His Leu Asn Ala Arg Asn Arg
180 185 190
105/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Gln Thr Asn Leu Leu Thr Arg Leu Thr Asp Ile Arg Tyr Asp Asn Ala
195 200 205
Phe Gly Val Glu Arg Ala Ala Gln Ser Leu Thr Gly Asn Ile Leu Val
210 215 220
Xaa Ser Gly Pro Leu ser Ile Tyr Arg Arg Glu Val Ile Ile Pro Asn
225 230 235 240
Leu Glu Arg Tyr Lys Asn Gln Thr Phe Leu Gly Leu Pro Val Ser Ile
245 250 255
Gly Asp Asp Arg Xaa Leu Thr Asn Tyr Ala Ile Asp Leu Gly Arg Thr
260 265 270
Val Tyr Gln Ser Thr Ala Arg ~ys Asp Thr Asp Val Pro Phe Gln Leu
275 280 285
Lys Ser Tyr Leu Lys Gln Gln Asn Arg Trp Asn Lys ser Phe Phe Arg
290 Z95 300
Glu ser Ile Ile ser Val Lys Lys Ile Leu Ser Asn Pro Ile Val Ala
305 310 315 320
Leu Trp Thr Ile Phe Glu Val Val Met Phe Met Met Leu Ile Val Ala
325 330 335
Ile Gly Asn Leu Leu Phe Asn Gln Ala Ile Gln Leu Asp Leu Ile Lys
340 345 350
Leu Phe Ala Phe Leu ser Ile Ile Phe Ile Val Ala Leu Cys Arg Asn
355 360 365
Val His Tyr Met Val Lys His Pro Ala ser Phe Leu Leu ser Pro Leu
370 375 380
Tyr Gly Ile Leu His Leu Phe Val Leu Gln Pro Leu Lys Leu Tyr ser
385 390 395 400
Leu Cys Thr Ile Lys Asn Thr Glu Trp Gly Thr Arg Lys Lys Val Thr
405 410 415
Ile Phe Lys
<210> .52
106/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
<211> 419
<212> PRT
<213> streptococcus pyogenes
<220>
<221> MISC_FEATURE
<222> (124)..(124)
<223> xaa = Ala, Ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (225)..(225)
<223> Xaa = Ala, Ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (280)..(280)
<223> Xaa = Ala, Ser or any other amino acid
<400> 52
Met Pro Ile Phe Lys Lys Thr Leu Ile Val Leu Ser Phe Ile Phe Leu
1 5 10 15
Ile Ser Ile Leu Ile Tyr Leu Asn Met Tyr Leu Phe Gly Thr Ser Thr
20 25 30
Val Gly Ile Tyr Gly Val Ile Leu Ile Thr Tyr Leu Val Ile Lys Leu
35 40 45
Gly Leu Ser Phe Leu Tyr Glu Pro Phe Lys Gly Asn Pro His Asp Tyr
50 55 60
Lys Val Ala Ala Val Ile Pro Ser Tyr Asn Glu Asp Ala Glu Ser Leu
65 70 75 80
Leu Glu Thr Leu Lys Ser Val Leu Ala Gln Thr Tyr Pro Leu Ser Glu
85 90 95
107%207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Ile Tyr Ile Val Asp Asp Gly Ser Ser Asn Thr Asp Ala Ile Gln Leu
100 105 110
Ile Glu Glu Tyr Val Asn Arg Glu Val Asp Ile Xaa Arg Asn Val Ile
115 120 125
Val His Arg Ser Leu Val Asn Lys Gly Lys Arg His Ala Gln Ala Trp
130 135 140
Ala Phe Glu Arg Ser Asp Ala Asp Val Phe Leu Thr Val Asp Ser Asp
145 150 155 160
Thr Tyr Ile Tyr Pro Asn Ala Leu Glu Glu Leu Leu Lys Ser Phe Asn
165 170 175
Asp Glu Thr Val Tyr Ala A'la Thr Gly His Leu Asn Ala Arg Asn Arg
180 185 190
Gln Thr Asn Leu Leu Thr Arg Leu Thr Asp Ile Arg Tyr Asp Asn Ala
195 200 205
Phe Gly Val Glu Arg Ala Ala Gln Ser Leu Thr Gly Asn Ile Leu Val
210 215 220
Xaa Ser Gly Pro Leu Ser Ile Tyr Arg Arg Glu Val Ile Ile Pro Asn
225 230 235 240
Leu Glu Arg Tyr Lys Asn Gln Thr Phe Leu Gly Leu Pro Val Ser Ile
245 250 255
Gly Asp Asp Arg Cys Leu Thr Asn Tyr Ala Ile Asp Leu Gly Arg Thr
260 265 270
Val Tyr Gln Ser Thr Ala Arg Xaa Asp Thr Asp Val Pro Phe Gln Leu
275 280 285
Lys Ser Tyr Leu Lys Gln Gln Asn Arg Trp Asn Lys Ser Phe Phe Arg
290 295 300
Glu Ser Ile Ile Ser Val Lys Lys Ile Leu Ser Asn Pro Ile Val Ala
305 310 315 320
Leu Trp Thr Ile Phe Glu Val Val Met Phe Met Met Leu Ile Val Ala
325 330 335
Ile Gly Asn Leu Leu Phe Asn Gln Ala Ile Gln Leu Asp Leu Ile Lys
340 345 350
108/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Leu Phe Ala Phe Leu Ser Ile Ile Phe Ile Val Ala Leu Cys Arg Asn
355 360 365
Val His Tyr Met Val Lys His Pro Ala Ser Phe Leu Leu Ser Pro Leu
370 375 380
Tyr Gly Ile Leu His Leu Phe Val Leu Gln Pro Leu Lys Leu Tyr Ser
385 390 395 400
Leu Cys Thr Ile Lys Asn Thr Glu Trp Gly Thr Arg Lys Lys Val Thr
405 410 415
Ile Phe Lys
<210> 53
<211> 419
<212> PRT
<213> Streptococcus pyogenes
<220>
<221> MISC_FEATURE
<222> (124)..(124)
<223> xaa = Ala, ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (225)..(225)
<223> xaa = Ala, ser or any other amino acid
<220>
<221> MIS~FEATURE
<222> (366)..(366)
<223> Xaa = Ala, Ser or any other amino acid
<400> 53
Met Pro Ile Phe Lys Lys Thr Leu Ile Val Leu Ser Phe Ile Phe Leu
1 5 10 15
109/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Ile Ser Ile Leu Ile Tyr Leu Asn Met Tyr Leu Phe Gly Thr Ser Thr
20 25 30
Val Gly Ile Tyr Gly Val Ile Leu Ile Thr Tyr Leu Val Ile Lys Leu
35 40 45
Gly Leu Ser Phe Leu Tyr Glu Pro Phe Lys Gly Asn Pro His Asp Tyr
50 55 60
Lys Val Ala Ala Val Ile Pro Ser Tyr Asn Glu Asp Ala Glu Ser Leu
65 70 75 80
Leu Glu Thr Leu Lys Ser Val Leu Ala Gln Thr Tyr Pro Leu Ser Glu
85 90 95
Ile Tyr Ile Val Asp Asp Gly Ser Ser Asn Thr Asp Ala Ile Gln Leu
100 105 110
Ile Glu Glu Tyr Val Asn Arg Glu Val Asp Ile Xaa Arg Asn Val Ile
115 120 125
Val His Arg Ser Leu Val Asn Lys Gly Lys Arg His Ala Gln Ala Trp
130 135 140
Ala Phe Glu Arg Ser Asp Ala Asp Val Phe Leu Thr Val Asp Ser Asp
145 150 155 160
Thr Tyr Ile Tyr Pro Asn Ala Leu Glu Glu Leu Leu Lys Ser Phe Asn
165 170 175
Asp Glu Thr Val Tyr Ala Ala Thr Gly His Leu Asn Ala Arg Asn Arg
180 185 190
Gln Thr Asn Leu Leu Thr Arg Leu Thr Asp Ile Arg Tyr Asp Asn Ala
195 200 205
Phe Gly Val Glu Arg Ala Ala Gln Ser Leu Thr Gly Asn Ile Leu Val
210 215 220
Xaa Ser Gly Pro Leu Ser Ile Tyr Arg Arg Glu Val Ile Ile Pro Asn
225 230 235 240
Leu Glu Arg Tyr Lys Asn Gln Thr Phe Leu Gly Leu Pro Val 5er Ile
245 250 255
Gly Asp Asp Arg Cys Leu Thr Asn Tyr Ala Ile Asp Leu Gly Arg Thr
260 265 270
110/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Val Tyr Gln Ser Thr Ala Arg Cys Asp Thr Asp Val Pro Phe Gln Leu
275 280 285
Lys Ser Tyr Leu Lys Gln Gln Asn Arg Trp Asn Lys Ser Phe Phe Arg
290 295 300
Glu Ser Ile Ile Ser Val Lys Lys Ile Leu Ser Asn Pro Ile Val Ala
305 310 315 320
Leu Trp Thr Ile Phe Glu Val Val Met Phe Met Met Leu Ile Val Ala
325 330 335
Ile Gly Asn Leu Leu Phe Asn Gln Ala Ile Gln Leu Asp Leu Ile Lys
340 345 350
Leu Phe Ala Phe Leu Ser Ile Ile Phe Ile Val Ala Leu Xaa Arg Asn
355 360 365
Val His Tyr Met Val Lys His Pro Ala Ser Phe Leu Leu Ser Pro Leu
370 375 380
Tyr Gly Ile Leu His Leu Phe Val Leu Gln Pro Leu Lys Leu Tyr Ser
385 390 395 400
Leu Cys Thr Ile Lys Asn Thr Glu Trp Gly Thr Arg Lys Lys Val Thr
405 410 415
Ile Phe Lys
<210> 54
<211> 419
<212> PRT
<213> Streptococcus pyogenes
<220>
<221> MISC_FEATURE
<222> (124)..(124)
<223> xaa = Ala, Ser or any other amino acid
<220>
111/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
<221> MISC_FEATURE
<222> (225)..(225)
<223> xaa = Ala, ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (402)..(402)
<223> xaa = Ala, Ser or any other amino acid
<400> 54
Met Pro Ile Phe Lys Lys Thr Leu Ile Val Leu Ser Phe Ile Phe Leu
1 5 10 15
Ile Ser Ile Leu Ile Tyr Leu Asn Met Tyr Leu Phe Gly Thr Ser Thr
20 25 30
Val Gly Ile Tyr Gly Val Ile Leu Ile Thr Tyr Leu Val Ile Lys Leu
35 40 45
Gly Leu Ser Phe Leu Tyr Glu Pro Phe Lys Gly Asn Pro His Asp Tyr
50 55 60
Lys Val Ala Ala Val Ile Pro Ser Tyr Asn Glu Asp Ala Glu Ser Leu
65 70 75 80
Leu Glu Thr Leu Lys Ser Val Leu Ala Gln Thr Tyr Pro Leu Ser Glu
85 90 95
Ile Tyr Ile Val Asp Asp Gly Ser Ser Asn Thr Asp Ala Ile Gln Leu
100 105 , 110
Ile Glu Glu Tyr Val Asn Arg Glu Val Asp Ile Xaa Arg Asn Val Ile
115 120 125
Val His Arg Ser Leu Val Asn Lys Gly Lys Arg His Ala Gln Ala Trp
130 135 140
Ala Phe Glu Arg Ser Asp Ala Asp Val Phe Leu Thr Val Asp Ser Asp
145 150 155 160
Thr Tyr Ile Tyr Pro Asn Ala Leu Glu Glu Leu Leu Lys Ser Phe Asn
165 170 175
112/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Asp Glu Thr Val Tyr Ala Ala Thr Gly His Lew Asn Ala Arg Asn Arg
180 185 190
Gln Thr Asn Leu Leu Thr Arg Leu Thr Asp Ile Arg Tyr Asp Asn Ala
195 200 205
Phe Gly Val Glu Arg Ala Ala Gln Ser Leu Thr Gly Asn Ile Leu Val
210 215 220
Xaa Ser Gly Pro Leu Ser Ile Tyr Arg Arg Glu Val Ile Ile Pro Asn
225 230 235 240
Leu Glu Arg Tyr Lys Asn Gln Thr Phe Leu Gly Leu Pro Val Ser Ile
245 250 255
Gly Asp Asp Arg Cys Leu Thr Asn Tyr Ala Ile Asp Leu Gly Arg Thr
260 265 270
Val Tyr Gln Ser Thr Ala Arg Cys Asp Thr Asp Val Pro Phe Gln Leu
275 280 285
Lys Ser Tyr Leu Lys Gln Gln Asn Arg Trp Asn Lys Ser Phe Phe Arg
290 295 300
Glu Ser Ile Ile Ser val Lys Lys Ile Leu Ser Asn Pro Ile Val Ala
305 310 315 320
Leu Trp Thr Ile Phe Glu Val Val Met Phe Met Met Leu Ile Val Ala
325 330 335
Ile Gly Asn Leu Leu Phe Asn Gln Ala Ile Gln Leu Asp Leu Ile Lys
340 345 350
Leu Phe Ala Phe Leu Ser Ile Ile Phe Ile Val Ala Leu Cys Arg Asn
355 360 365
Val His Tyr Met Val Lys His Pro Ala Ser Phe Leu Leu Ser Pro Leu
370 375 380
Tyr Gly Ile Leu His Leu Phe Val Leu Gln Pro Leu Lys Leu Tyr Ser
385 390 395 400
Leu Xaa Thr Ile Lys Asn Thr Glu Trp Gly Thr Arg Lys Lys Val Thr
405 410 415
Ile Phe Lys
113/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
<210> 55
<211> 419
<212> PRT
<213> Streptococcus pyogenes
<220>
<221> MISC_FEATURE
<222> (124)..(124)
<223> xaa = Ala, ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (261):.(261)
<223> xaa = Ala, Ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (280)..(280)
<223> xaa = Ala, ser or any other amino acid
<400> 55
Met Pro Ile Phe Lys Lys Thr Leu Ile Val Leu Ser Phe Ile Phe Leu
1 5 10 15
Ile Ser Ile Leu Ile Tyr Leu Asn Met Tyr Leu Phe Gly Thr Ser Thr
20 2S 30
Val Gly Ile Tyr Gly Val Ile Leu Ile Thr Tyr Leu Val Ile Lys Leu
35 40 45
Gly Leu Ser Phe Leu Tyr Glu Pro Phe Lys Gly Asn Pro His Asp Tyr
50 55 60
Lys Val Ala Ala Val Ile Pro Ser Tyr Asn Glu Asp Ala Glu Ser Leu
65 70 75 80
Leu Glu Thr Leu Lys Ser Val Leu Ala Gln Thr Tyr Pro Leu Ser Glu
85 90 95
114/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Ile Tyr Ile Val Asp Asp Gly Ser Ser Asn Thr Asp Ala Ile Gln Leu
100 105 110
Ile Glu Glu Tyr Val Asn Arg Glu Val Asp Ile Xaa Arg Asn Val Ile
115 120 125
Val His Arg Ser Leu Val Asn Lys Gly Lys Arg His Ala Gln Ala Trp
130 135 140
Ala Phe Glu Arg Ser Asp Ala Asp Val Phe Leu Thr Val Asp Ser Asp
145 150 155 160
Thr Tyr Ile Tyr Pro Asn Ala Leu Glu Glu Leu Leu Lys Ser Phe Asn
165 170 175
Asp Glu Thr Val Tyr Ala Ala Thr Gly His Leu Asn Ala Arg Asn Arg
180 185 190
Gln Thr Asn Leu Leu Thr Arg Leu Thr Asp Ile Arg Tyr Asp Asn Ala
195 200 205
Phe Gly Val Glu Arg Ala Ala Gln Ser Leu Thr Gly Asn Ile Leu Val
210 215 220
Cys Ser Gly Pro Leu Ser Ile Tyr Arg Arg Glu Val Ile Ile Pro Asn
225 230 235 240
Leu Glu Arg Tyr Lys Asn Gln Thr Phe Leu Gly Leu Pro Val Ser Ile
245 250 255
Gly Asp Asp Arg Xaa Leu Thr Asn Tyr Ala Ile Asp Leu Gly Arg Thr
260 265 270
Val Tyr Gln Ser Thr Ala Arg Xaa Asp Thr Asp Val Pro Phe Gln Leu
275 280 Z85
Lys Ser Tyr Leu Lys Gln Gln Asn Arg Trp Asn Lys Ser Phe Phe Arg
290 295 300
Glu Ser Ile Ile Ser Val Lys Lys Ile Leu Ser Asn Pro Ile Val Ala
305 310 315 320
Leu Trp Thr Ile Phe Glu Val Val Met Phe Met Met Leu Ile Val Ala
325 330 335
Ile Gly Asn Leu Leu Phe Asn Gln Ala Ile Gln Leu Asp Leu Ile Lys
340 345 350
115/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Leu Phe Ala Phe Leu Ser Ile Ile Phe Ile Val Ala Leu Cys Arg Asn
355 360 365
Val His Tyr Met Val Lys His Pro Ala Ser Phe Leu Leu Ser Pro Leu
370 375 380
Tyr Gly Ile Leu His Leu Phe Val Leu Gln Pro Leu Lys Leu Tyr Ser
385 390 395 400
Leu Cys Thr Ile Lys Asn Thr Glu Trp Gly Thr Arg Lys Lys Val Thr
405 410 415
Ile Phe Lys
<210> 56
<211> 419
<212> PRT
<213> Streptococcus pyogenes
<220>
<221> MISC_FEATURE
<222> (124)..(124)
<223> xaa = Ala, Ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (261)..(261)
<223> xaa = Ala, Ser or any other amino acid
<Z20>
<221> MISC_FEATURE
<222> (366)..(366)
<223> xaa = Ala, ser or any other amino acid
<400> 56
116/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Met Pro Ile Phe Lys Lys Thr Leu Ile Val Leu Ser Phe Ile Phe Leu
1 5 10 15
Ile Ser Ile Leu Ile Tyr Leu Asn Met Tyr Leu Phe Gly Thr Ser Thr
20 25 30
Val Gly Ile Tyr Gly Val Ile Leu Ile Thr Tyr Leu Val Ile Lys Leu
35 40 45
Gly Leu Ser Phe Leu Tyr Glu Pro Phe Lys Gly Asn Pro His Asp Tyr
50 55 60
Lys Val Ala Ala Val Ile Pro Ser Tyr Asn Glu Asp Ala Glu Ser Leu
65 70 75 80
Leu Glu Thr Leu Lys Ser Val Leu Ala Gln Thr Tyr Pro Leu Ser Glu
85 90 95
Ile Tyr Ile Val Asp Asp Gly Ser Ser Asn Thr Asp Ala Ile Gln Leu
100 105 110
Ile Glu Glu Tyr Val Asn Arg Glu Val Asp Ile Xaa Arg Asn Val Ile
115 120 125
Val His Arg Ser Leu Val Asn Lys Gly Lys Arg His Ala Gln Ala Trp
130 135 140
Ala Phe Glu Arg Ser Asp Ala Asp Val Phe Leu Thr Val Asp Ser Asp
145 150 155 160
Thr Tyr Ile Tyr Pro Asn Ala Leu Glu Glu Leu Leu Lys Ser Phe Asn
165 170 175
Asp Glu Thr Val Tyr Ala Ala Thr Gly His Leu Asn Ala Arg Asn Arg
180 185 190
Gln Thr Asn Leu LewThr Arg Leu Thr Asp Ile Arg Tyr Asp Asn Ala
195 200 Z05
Phe Gly Val Glu Arg Ala Ala Gln Ser Leu Thr Gly Asn Ile Leu Val
210 215 220
~ys Ser Gly Pro Leu Ser ile Tyr Arg Arg Glu Val Ile Ile Pro Asn
225 230 235 240
Leu Glu Arg Tyr Lys Asn Gln Thr Phe Leu Gly Leu Pro Val Ser Ile
245 250 255
117/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Gly Asp Asp Arg Xaa Leu Thr Asn Tyr Ala Ile Asp Leu Gly Arg Thr
260 265 270
Val Tyr Gln Ser Thr Ala Arg Cys Asp Thr Asp Val Pro Phe Gln Leu
275 280 285
Lys Ser Tyr Leu Lys Gln Gln Asn Arg Trp Asn Lys Ser Phe Phe Arg
290 295 300
Glu Ser Ile Ile Ser Val Lys Lys Ile Leu Ser Asn Pro Ile Val Ala
305 ~ 310 315 320
Leu Trp Thr Ile Phe Glu Val Val Met Phe Met Met Leu Ile Val Ala
325 330 335
Ile Gly Asn Leu Leu Phe Asn Gln Ala Ile Gln Leu Asp Leu Ile Lys
340 345 350
Leu Phe Ala Phe Leu Ser Ile Ile Phe Ile Val Ala Leu Xaa Arg Asn
355 360 365
Val His Tyr Met Val Lys His Pro Ala Ser Phe Leu Leu Ser Pro Leu
370 375 380
Tyr Gly Ile Leu His Leu Phe Val Leu Gln Pro Leu Lys Leu Tyr Ser
385 390 395 400
Leu Cys Thr Ile Lys Asn Thr Glu Trp Gly Thr Arg Lys Lys Val Thr
405 410 415
Ile Phe Lys
<210> 57
<211> 419
<212> PRT
<213> Streptococcus pyogenes
<220>
<221> MISC_FEATURE
<222> (124)..(124)
<223> xaa = Ala, Ser or any other amino acid
118/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
<220>
<221> MISC_FEATURE
<222> (261)..(261)
<223> xaa = Ala, ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (402)..(402)
<223> xaa = Ala, Ser or any other amino acid
<400> 57
Met Pro Ile Phe Lys Lys Thr Leu Ile Val Leu Ser Phe Ile Phe Leu
1 5 10 15
Ile Ser Ile Leu Ile Tyr Leu Asn Met Tyr Leu Phe Gly Thr Ser Thr
20 25 30
Val Gly Ile Tyr Gly Val Ile Leu Ile Thr Tyr Leu Val Ile Lys Leu
35 40 45
Gly Leu Ser Phe Leu Tyr Glu Pro Phe Lys Gly Asn Pro His Asp Tyr
50 55 60
Lys Val Ala Ala Val Ile Pro Ser Tyr Asn Glu Asp Ala Glu Ser Leu
65 70 75 gp
Leu Glu Thr Leu Lys Ser Val Leu Ala Gln Thr Tyr Pro Leu Ser Glu
85 90 95
Ile Tyr Ile Val Asp Asp Gly Ser Ser Asn Thr Asp Ala Ile Gln Leu
100 105 110
Ile Glu Glu Tyr Val Asn Arg Glu Val Asp Ile Xaa Arg Asn Val Ile
115 120 125
Val His Arg Ser Leu Val Asn Lys Gly Lys Arg His Ala Gln Ala Trp
130 135 140
Ala Phe Glu Arg Ser Asp Ala Asp Val Phe Leu Thr Val Asp Ser Asp
145 150 155 160
Thr Tyr Ile Tyr Pro Asn Ala Leu Glu Glu Leu Leu Lys Ser Phe Asn
165 170 175
119/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Asp Glu Thr Val Tyr Ala Ala Thr Gly His Leu Asn Ala Arg Asn Arg
180 185 190
Gln Thr Asn Leu Leu Thr Arg Leu Thr Asp Ile Arg Tyr Asp Asn Ala
195 200 205
Phe Gly Val Glu Arg Ala Ala Gln Ser Leu Thr Gly Asn Ile Leu Val
210 215 220
Cys Ser Gly Pro Leu Ser Ile Tyr Arg Arg Glu Val Ile Ile Pro Asn
225 230 235 240
Leu Glu Arg Tyr Lys Asn Gln Thr Phe Leu Gly Leu Pro Val Ser Ile
245 250 255
Gly Asp Asp Arg Xaa Leu Thr Asn Tyr Ala Ile Asp Leu Gly Arg Thr
260 265 270
Val Tyr Gln Ser Thr Ala Arg Cys Asp Thr Asp Val Pro Phe Gln Leu
275 280 285
Lys Ser Tyr Leu Lys Gln Gln Asn Arg Trp Asn Lys Ser Phe Phe Arg
290 295 300
Glu Ser Ile Ile Ser Val Lys Lys Ile Leu Ser Asn Pro Ile Val Ala
305 310 315 320
Leu Trp Thr Ile Phe Glu Val Val Met Phe Met Met Leu Ile Val Ala
325 330 335
Ile Gly Asn Leu Leu Phe Asn Gln Ala Ile Gln Leu Asp Leu Ile Lys
340 345 350
Leu Phe Ala Phe Leu Ser Ile Ile Phe Ile Val Ala Leu Cys Arg Asn
355 360 365
Val His Tyr Met Val Lys His Pro Ala Ser Phe Leu Leu Ser Pro Leu
370 375 380
Tyr Gly Ile Leu His Leu Phe Val Leu Gln Pro Leu Lys Leu Tyr Ser
385 390 395 400
Leu Xaa Thr Ile Lys Asn Thr Glu Trp Gly Thr Arg Lys Lys Val Thr
405 410 415
Ile Phe Lys
,120/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
<210> 58
<211> 419
<212> PRT
<213> Streptococcus pyogenes
<220>
<221> MISC_FEATURE
<222> (124)..(124)
<223> xaa = Ala, Ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (280)..(280)
<223> xaa = Ala, ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (366)..(366)
<223> xaa = Ala, Ser or any other amino acid
<400> 58
Met Pro Ile Phe Lys Lys Thr Leu Ile Val Leu Ser Phe Ile Phe Leu
1 5 10 15
Ile Ser Ile Leu Ile Tyr Leu Asn Met Tyr Leu Phe Gly Thr Ser Thr
20 25 30
Val Gly Ile Tyr Gly Val Ile Leu ile Thr Tyr Leu Val Ile Lys Leu
35 40 45
Gly Leu Ser Phe Leu Tyr Glu Pro Phe Lys Gly Asn Pro His Asp Tyr
50 55 60
Lys Val Ala Ala Val Ile Pro Ser Tyr Asn Glu Asp Ala Glu Ser Leu
65 70 75 80
121/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Leu Glu Thr Leu Lys Ser Val Leu Ala Gln Thr Tyr Pro Leu Ser Glu
85 90 95
Ile Tyr Ile Val Asp Asp Gly Ser Ser Asn Thr Asp Ala Ile Gln Leu
100 105 110
Ile Glu Glu Tyr Val Asn Arg Glu Val Asp Ile Xaa Arg Asn Val Ile
115 120 125
Val His Arg Ser Leu Val Asn Lys Gly Lys Arg His Ala Gln Ala Trp
130 ' 135 140
Ala Phe Glu Arg Ser Asp Ala Asp Val Phe Leu Thr Val Asp Ser Asp
145 150 155 160
Thr Tyr Ile Tyr Pro Asn Ala Leu Glu Glu Leu Leu Lys Ser Phe Asn
165 170 175
Asp Glu Thr Val Tyr Ala Ala Thr Gly His Leu Asn Ala Arg Asn Arg
180 185 190
Gln Thr Asn Leu Leu Thr Arg Leu Thr Asp Ile Arg Tyr Asp Asn Ala
195 200 205
Phe Gly Val Glu Arg Ala Ala Gln Ser Leu Thr Gly Asn Ile Leu Val
Z10 215 220
Cys Ser Gly Pro Leu Ser Ile Tyr Arg Arg Glu Val Ile Ile Pro Asn
225 230 235 240
Leu Glu Arg Tyr Lys Asn Gln Thr Phe Leu Gly Leu Pro Val Ser Ile
245 250 255
Gly Asp Asp Arg Cys Leu Thr Asn Tyr Ala Ile Asp Leu Gly Arg Thr
260 265 270
Val Tyr Gln Ser Thr Ala Arg Xaa Asp Thr Asp Val Pro Phe Gln Leu
275 280 285
Lys Ser Tyr Leu Lys Gln Gln Asn Arg Trp Asn Lys Ser Phe Phe Arg
290 295 300
Glu Ser Ile Ile Ser Val Lys Lys Ile Leu Ser Asn Pro Ile Val Ala
305 310 315 320
Leu Trp Thr Ile Phe Glu Val Val Met Phe Met Met Leu Ile Val Ala
325 330 335
122/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Ile Gly Asn Leu Leu Phe Asn Gln Ala Ile Gln Leu Asp Leu Ile Lys
340 345 350
Leu Phe Ala Phe Leu Ser Ile Ile Phe Ile Val Ala Leu Xaa Arg Asn
355 360 365
Val His Tyr Met Val Lys His Pro Ala Ser Phe Leu Leu Ser Pro Leu
370 375 380
Tyr Gly Ile Leu His Leu Phe Val Leu Gln Pro Leu Lys Leu Tyr Ser
385 390 395 400
Leu Cys Thr Ile Lys Asn Thr Glu Trp Gly Thr Arg Lys Lys Val Thr
405 410 415
Ile Phe Lys
<210> 59
<211> 419
<212> PRT
<213> Streptococcus pyogenes
<220>
<221> MISC_FEATURE
<222> (124)..(124)
<223> Xaa = Ala, Ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (280)..(280)
<223> xaa = Ala, Ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (402)..(402)
<223> Xaa = Ala, Ser or any other amino acid
123/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
<400> 59
Met Pro Ile Phe Lys Lys Thr Leu Ile Val Leu Ser Phe Ile Phe Leu
1 5 10 15
Ile Ser Ile Leu Ile Tyr Leu Asn Met Tyr Leu Phe Gly Thr Ser Thr
20 25 30
Val Gly Ile Tyr Gly Val Ile Leu Ile Thr Tyr Leu Val Ile Lys Leu
35 40 4S
Gly Leu Ser Phe Leu Tyr Glu Pro Phe Lys Gly Asn Pro His Asp Tyr
50 55 60
Lys Val Ala Ala Val Ile Pro Ser Tyr Asn Glu Asp Ala Glu Ser Leu
65 70 75 80
Leu Glu Thr Leu Lys Ser Val Leu Ala.Gln Thr Tyr Pro Leu Ser Glu
85 90 95
Ile Tyr Ile Val Asp Asp Gly Ser Ser Asn Thr Asp Ala Ile Gln Leu
100 105 110
Ile Glu Glu Tyr Val Asn Arg Glu Val Asp Ile Xaa Arg Asn Val Ile
115 120 125
Val His Arg Ser Leu Val Asn Lys Gly Lys Arg His Ala Gln Ala Trp
130 135 140
Ala Phe Glu Arg Ser Asp Ala Asp Val Phe Leu Thr Val Asp Ser Asp
145 150 155 160
Thr Tyr Ile Tyr Pro Asn Ala Leu Glu Glu Leu Leu Lys Ser Phe Asn
165 170 175
Asp Glu Thr Val Tyr Ala Ala Thr Gly His Leu Asn Ala Arg Asn Arg
180 185 190
Gln Thr Asn Leu Leu Thr Arg Leu Thr Asp Ile Arg Tyr Asp Asn Ala
195 200 205
Phe Gly Val Glu Arg Ala Ala Gln Ser Leu Thr Gly Asn Ile Leu Val
210 215 220
Cys Ser Gly Pro Leu Ser Ile Tyr Arg Arg Glu Val Ile Ile Pro Asn
225 230 235 240
Leu Glu Arg Tyr Lys Asn Gln Thr Phe Leu Gly Leu Pro Val Ser Ile
245 250 255
124/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Gly Asp Asp Arg Cys Leu Thr Asn Tyr Ala Ile Asp Leu Gly Arg Thr
260 265 270
Val Tyr Gln Ser Thr Ala Arg Xaa Asp Thr Asp Val Pro Phe Gln Leu
275 280 285
Lys Ser Tyr Leu Lys Gln Gln Asn Arg Trp Asn Lys Ser Phe Phe Arg
290 295 300
Glu Ser Ile Ile Ser Val Lys Lys Ile Leu Ser Asn Pro Ile Val Ala
305 310 315 320
Leu Trp Thr Ile Phe Glu Val Val Met Phe Met Met Leu Ile Val Ala
325 330 335
Ile Gly Asn Leu Leu Phe Asn Gln Ala Ile Gln Leu Asp Leu Ile Lys
340 345 350
Leu Phe Ala Phe Leu Ser Ile Ile Phe Ile Val Ala Leu Cys Arg Asn
355 360 365
Val His Tyr Met Val Lys His Pro Ala Ser Phe Leu Leu Ser Pro Leu
370 375 380
Tyr Gly Ile Leu His Leu Phe Val Leu Gln Pro Leu Lys Leu Tyr Ser
385 390 395 400
Leu Xaa Thr Ile Lys Asn Thr Glu Trp Gly Thr Arg Lys Lys Val Thr
405 410 415
Ile Phe Lys
<210> 60
<211> 419
<212> PRT
<Z13> streptococcus pyogenes
<220>
<221> MISC_FEATURE
<222> (124)..(124)
<223> xaa = Ala, Ser or any other amino acid
125/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
<220>
<221> MISC_FEATURE
<222> (366)..(366)
<223> Xaa = Ala, ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (402)..(402)
<223> Xaa = Ala, Ser or any other amino acid
<400> 60
Met Pro Ile Phe Lys Lys Thr Leu Ile Val Leu ser Phe Ile Phe Leu
1 5 10 15
Ile Ser Ile Leu Ile Tyr Leu Asn Met Tyr Leu Phe Gly Thr Ser Thr
20 25 30
Val Gly Ile Tyr Gly Val Ile Leu Ile Thr Tyr Leu Val Ile Lys Leu
35 40 45
Gly Leu Ser Phe Leu Tyr Glu Pro Phe Lys Gly Asn Pro His Asp Tyr
50 55 60
Lys Val Ala Ala Val Ile Pro Ser Tyr Asn Glu Asp Ala Glu Ser Leu
65 70 75 80
Leu Glu Thr Leu Lys Ser Val Leu Ala Gln Thr Tyr Pro Leu Ser Glu
85 90 95
Ile Tyr Ile Val Asp Asp Gly Ser Ser Asn Thr Asp Ala Ile Gln Leu
100 105 110
Ile Glu Glu Tyr Val Asn Arg Glu Val Asp Ile.Xaa Arg Asn Val Ile .
115 120 125
Val His Arg ser Leu val Asn Lys Gly Lys Arg His Ala Gln Ala Trp
130 135 140
Ala Phe Glu Arg Ser Asp Ala Asp Val Phe Leu Thr Val Asp Ser Asp
145 150 155 160
126/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Thr Tyr Ile Tyr Pro Asn Ala Leu Glu Glu Leu Leu Lys Ser Phe Asn
165 170 175
Asp Glu Thr val Tyr Ala Ala Thr Gly His Leu Asn Ala Arg Asn Arg
180 185 190
Gln Thr Asn Leu Leu Thr Arg Leu Thr Asp Ile Arg Tyr Asp Asn Ala
195 200 205
Phe Gly Val Glu Arg Ala Ala Gln Ser Leu Thr Gly Asn Ile Leu Val
210 215 220
Cys Ser Gly Pro Leu Ser Ile Tyr Arg Arg Glu Val Ile Ile Pro Asn
225 230 235 240
Leu Glu Arg Tyr Lys Asn Gln Thr Phe Leu Gly Leu Pro Val Ser Ile
245 250 255
Gly Asp Asp Arg Cys Leu Thr Asn Tyr Ala Ile Asp Leu Gly Arg Thr
260 265 270
Val Tyr Gln Ser Thr Ala Arg Cys Asp Thr Asp Val Pro Phe Gln Leu
275 280 285
Lys Ser Tyr Leu Lys Gln Gln Asn Arg Trp Asn Lys Ser Phe Phe Arg
290 295 300
Glu Ser Ile Ile Ser Val Lys Lys Ile Leu Ser Asn Pro Ile Val Ala
305 310 315 320
Leu Trp Thr Ile Phe Glu Val Val Met Phe Met Met Leu Ile Val Ala
325 330 335
Ile Gly Asn Leu Leu Phe Asn Gln Ala Ile Gln Leu Asp Leu Ile Lys
340 345 350
Leu Phe Ala Phe Leu Ser Ile Ile Phe Ile Val Ala Leu Xaa Arg Asn
355 360 365
Val His Tyr Met Val Lys His Pro Ala Ser Phe Leu Leu Ser Pro Leu
370 375 380
Tyr Gly Ile Leu His Leu Phe Val Leu Gln Pro Leu Lys Leu Tyr Ser
385 390 395 400
Leu Xaa Thr Ile Lys Asn Thr Glu Trp Gly Thr Arg Lys Lys Val Thr
405 410 415
127/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Ile Phe Lys
<210> 61
<211> 419
<212> PRT
<213> Streptococcus pyogenes
<220>
<221> MISC_FEATURE
<222> (225)..(225)
<223> xaa = Ala, ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (261)..(261)
<223> xaa = Ala, 5er or any other amino acid
<220>
<221> MISC_FEATURE
<222> (280)..(280)
<223> Xaa = Ala, Ser or any other amino acid
<400> 61
Met Pro Ile Phe Lys Lys Thr Leu Ile Val Leu Ser Phe Ile Phe Leu
1 5 10 15
Ile Ser Ile Leu Ile Tyr Leu Asn Met Tyr Leu Phe Gly Thr Ser Thr
20 25 30
Val Gly Ile Tyr Gly Val Ile Leu Ile Thr Tyr Leu Val Ile Lys Leu
35 40 45
Gly Leu Ser Phe Leu Tyr Glu Pro Phe Lys Gly Asn Pro His Asp Tyr
50 55 60
Lys Val Ala Ala Val Ile Pro Ser Tyr Asn Glu Asp Ala Glu Ser Leu
65 70 75 g0
128/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Leu Glu Thr Leu Lys Ser Val Leu Ala Gln Thr Tyr Pro Leu Ser Glu
85 90 95
Ile Tyr Ile Val Asp Asp Gly Ser Ser Asn Thr Asp Ala Ile Gln Leu
100 105 110
Ile Glu Glu Tyr Val Asn Arg Glu Val Asp Ile Cys Arg Asn Val Ile
115 120 125
Val His Arg Ser Leu Val Asn Lys Gly Lys Arg His Ala Gln Ala Trp
130 135 140
Ala Phe Glu Arg Ser Asp Ala Asp Val Phe Leu Thr Val Asp Ser Asp
145 150 155 160
Thr Tyr Ile Tyr Pro Asn Ala Leu Glu Glu Leu Leu Lys Ser Phe Asn
165 170 175
Asp Glu Thr Val Tyr Ala Ala Thr Gly His Leu Asn Ala Arg Asn Arg
180 185 190
Gln Thr Asn Leu Leu Thr Arg Leu Thr Asp Ile Arg Tyr Asp Asn Ala
195 200 205
Phe Gly Val Glu Arg Ala Ala Gln Ser Leu Thr Gly Asn Ile Leu Val
210 215 220
Xaa Ser Gly Pro Leu Ser Ile Tyr Arg Arg Glu Val Ile Ile Pro Asn
225 230 235 240
Leu Glu Arg Tyr Lys Asn Gln Thr Phe Leu Gly Leu Pro Val Ser Ile
245 250 255
Gly Asp Asp Arg Xaa Leu Thr Asn Tyr Ala Ile Asp Leu Gly Arg Thr
260 265 270
Val Tyr Gln Ser Thr Ala Arg Xaa Asp Thr Asp Val Pro Phe Gln Leu
275 280 285
Lys Ser Tyr Leu Lys Gln Gln Asn Arg Trp Asn Lys Ser Phe Phe Arg
290 295 300
Glu Ser Ile Ile Ser Val Lys Lys Ile Leu Ser Asn Pro Ile Val Ala
305 310 315 320
Leu Trp Thr Ile Phe Glu Val Val Met Phe Met Met Leu Ile Val Ala
325 330 335
129/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Ile Gly Asn Leu Leu Phe Asn Gln Ala Ile Gln Leu Asp Leu Ile Lys
340 345 350
Leu Phe Ala Phe Leu Ser Ile Ile Phe Ile Val Ala Leu Cys Arg Asn
355 360 365
Val His Tyr Met Val Lys His Pro Ala Ser Phe Leu Leu Ser Pro Leu
370 375 380
Tyr Gly Ile Leu His Leu Phe Val Leu Gln Pro Leu Lys Leu Tyr Ser
385 390 395 400
Leu Cys Thr Ile Lys Asn Thr Glu Trp Gly Thr Arg Lys Lys Val Thr
405 410 415
Ile Phe Lys
<210> 62
<211> 419
<212> PRT
<213> Streptococcus pyogenes
<220>
<221> MISC_FEATURE
<222> (225)..(225)
<223> xaa = Ala, Ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (261)..(261)
<223> xaa = Ala, Ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (366)..(366)
<223> xaa = Ala, Ser or any other amino acid
130/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
<400> 62
Met Pro Ile Phe Lys Lys Thr Leu Ile Val Leu Ser Phe Ile Phe Leu
1 5 10 15
Ile Ser Ile Leu Ile Tyr Leu Asn Met Tyr Leu Phe Gly Thr Ser Thr
20 25 30
Val Gly Ile Tyr Gly Val Ile Leu Ile Thr Tyr Leu Val Ile Lys Leu
35 40 45
Gly Leu Ser Phe Leu Tyr Glu Pro Phe Lys Gly Asn Pro His Asp Tyr
50 55 60
Lys Val Ala Ala Val Ile Pro Ser Tyr Asn Glu Asp Ala Glu Ser Leu
65 70 75 80
Leu Glu Thr Leu Lys Ser Val Leu Ala Gln Thr Tyr Pro Leu Ser Glu
85 90 95
Ile Tyr Ile Val Asp Asp Gly Ser Ser Asn Thr Asp Ala Ile Gln Leu
100 105 110
Ile Glu Glu Tyr Val Asn Arg Glu Val Asp Ile Cys Arg Asn Val Ile
115 120 125
Val His Arg Ser Leu Val Asn Lys Gly Lys Arg His Ala Gln Ala Trp
130 135 140
Ala Phe Glu Arg Ser Asp Ala Asp Val Phe Leu Thr Val Asp Ser Asp
145 150 155 . 160
Thr Tyr Ile Tyr Pro ASn Ala Leu Glu Glu Leu Leu Lys Ser Phe Asn
165 170 175
Asp Glu Thr Val Tyr Ala Ala Thr Gly His Leu Asn Ala Arg Asn Arg
180 185 190
Gln Thr Asn Leu Leu Thr Arg Leu Thr Asp Ile Arg Tyr Asp Asn Ala
195 200 205
Phe Gly Val Glu Arg Ala Ala Gln Ser Leu Thr Gly Asn Ile Leu Val
210 215 220
Xaa Ser Gly Pro Leu Ser Ile Tyr Arg Arg Glu Val Ile Ile Pro Asn
225 230 235 240
131/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Leu Glu Arg Tyr Lys Asn Gln Thr Phe Leu Gly Leu Pro Val Ser Ile
245 250 255
Gly Asp Asp Arg Xaa Leu Thr Asn Tyr Ala Ile Asp Leu Gly Arg Thr
260 265 270
Val Tyr Gln Ser Thr Ala Arg Cys Asp Thr Asp Val Pro Phe Gln Leu
275 280 285
Lys Ser Tyr Leu Lys Gln Gln Asn Arg Trp Asn Lys Ser Phe Phe Arg
290 295 300
Glu Ser Ile Ile Ser Val Lys Lys Ile Leu Ser Asn Pro Ile Val Ala
305 310 315 320
Leu Trp Thr Ile Phe Glu Val Val Met Phe Met Met Leu Ile Val Ala
325 330 335
Ile Gly Asn Leu Leu Phe Asn Gln Ala Ile Gln Leu Asp Leu Ile Lys
340 345 350
Leu Phe Ala Phe Leu Ser Ile Ile Phe Ile Val Ala Leu Xaa Arg Asn
355 360 365
Val His Tyr Met Val Lys His Pro Ala Ser Phe Leu Leu Ser Pro Leu
370 375 380
Tyr Gly Ile Leu His Leu Phe Val Leu Gln Pro Leu Lys Leu Tyr Ser
385 390 395 400
Leu Cys Thr Ile Lys Asn Thr Glu Trp Gly Thr Arg Lys Lys Val Thr
405 410 415
Ile Phe Lys
<210> 63
<211> 419
<212> PRT
<213> Streptococcus pyogenes
<220>
<221> MISC_FEATURE
<222> (225)..(225)
132/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
<223> xaa = Ala, Ser or any, other amino acid
<220>
<221> MISC_FEATURE
<222> (261)..(261)
<223> xaa = Ala, Ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (402)..(402)
<223> xaa = Ala, Ser or any other amino acid
- <400> 63
Met Pro Ile Phe Lys Lys Thr Leu Ile Val Leu Ser Phe Ile Phe Leu
1 5 10 15
Ile Ser Ile Leu Ile Tyr Leu Asn Met Tyr Leu Phe Gly Thr Ser Thr
20 25 30
Val Gly Ile Tyr Gly Val Ile Leu Ile Thr Tyr Leu Val Ile Lys Leu
35 40 45
Gly Leu Ser Phe Leu Tyr Glu Pro Phe Lys Gly Asn Pro His Asp Tyr
50 55 60
Lys Val Ala Ala Val Ile Pro Ser Tyr Asn Glu Asp Ala Glu Ser Leu
65 70 75 80
Leu Glu Thr Leu Lys Ser Val Leu Ala Gln Thr Tyr Pro Leu Ser Glu
85 90 95
Ile Tyr Ile Val Asp Asp Gly Ser Ser Asn Thr Asp Ala Ile Gln Leu
100 105 110
Ile Glu Glu Tyr Val Asn Arg Glu Val Asp Ile Cys Arg Asn Val Ile
115 120 125
Val His Arg Ser Leu Val Asn Lys Gly Lys Arg His Ala Gln Ala Trp
130 135 140
Ala Phe Glu Arg Ser Asp Ala Asp Val Phe Leu Thr Val Asp Ser Asp
145 150 155 160
133/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Thr Tyr Ile Tyr Pro Asn Ala Leu Glu Glu Leu Leu Lys Ser Phe Asn
165 170 175
Asp Glu Thr Val Tyr Ala Ala Thr Gly His Leu Asn Ala Arg Asn Arg
180 185 190
Gln Thr Asn Leu Leu Thr Arg Leu Thr Asp Ile Arg Tyr Asp Asn Ala
195 200 205
Phe Gly Val Glu Arg Ala Ala Gln Ser Leu Thr Gly Asn Ile Leu Val
210 215 220
Xaa Ser Gly Pro Leu Ser Ile Tyr Arg Arg Glu Val Ile Ile Pro Asn
225 230 235 240
Leu Glu Arg Tyr Lys Asn Gln Thr Phe Leu Gly Leu Pro Val Ser Ile
245 250 255
Gly Asp Asp Arg Xaa Leu Thr Asn Tyr Ala Ile Asp Leu Gly Arg Thr
260 265 270
Val Tyr Gln Ser Thr Ala Arg Cys Asp Thr Asp Val Pro Phe Gln Leu
275 280 285
Lys Ser Tyr Leu Lys Gln Gln Asn Arg Trp Asn Lys Ser Phe Phe Arg
290 295 300
Glu Ser Ile Ile Ser Val Lys Lys Ile Leu Ser Asn Pro Ile Val Ala
305 310 315 320
Leu Trp Thr Ile Phe Glu Val Val Met Phe Met Met Leu Ile Val Ala
325 330 335
Ile Gly Asn Leu Leu Phe Asn Gln Ala Ile Gln Leu Asp Leu Ile Lys
340 345 350
Leu Phe Ala Phe Leu Ser Ile Ile Phe Ile Val Ala Leu Cys Arg Asn
355 360 365
Val His Tyr Met Val Lys His Pro Ala Ser Phe Leu Leu Ser Pro Leu
370 375 380
Tyr Gly Ile Leu His Leu Phe Val Leu Gln Pro Leu Lys Leu Tyr Ser
385 390 395 400
Leu Xaa Thr Ile Lys Asn Thr Glu Trp Gly Thr Arg Lys Lys Val Thr
405 410 415
134/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Ile Phe Lys
<210> 64
<211> 419
<212> PRT
<213> Streptococcus pyogenes
<220>
<221> MISC_FEATURE
<222> (225)..(225)
<223> xaa = Ala, Ser or any other amino acid
<220>
<221> MISC_FEATURE
<Z22> (280)..(280)
<223> xaa = Ala, Ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (366)..(366)
<223> xaa = Ala, ser or any other amino acid
<400> 64
Met Pro Ile Phe Lys Lys Thr Leu Ile val Leu Ser Phe Ile Phe Leu
1 5 10 15
Ile Ser Ile Leu Ile Tyr Leu Asn Met Tyr Leu Phe Gly Thr Ser Thr
20 25 30
Val Gly Ile Tyr Gly Val Ile Leu Ile Thr Tyr Leu Val Ile Lys Leu
35 40 45
Gly Leu Ser Phe Leu Tyr Glu Pro Phe Lys Gly Asn Pro His Asp Tyr
50 55 60
135/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Lys Val Ala Ala Val Ile Pro Ser Tyr Asn Glu Asp Ala Glu Ser Leu
65 70 75 80
Leu Glu Thr Leu Lys Ser Val Leu Ala Gln Thr Tyr Pro Leu Ser Glu
85 90 95
Ile Tyr Ile Val Asp Asp Gly Ser Ser Asn Thr Asp Ala Ile Gln Leu
100 105 110
Ile Glu Glu Tyr Val Asn Arg Glu Val Asp Ile Cys Arg Asn Val Ile
115 120 125
Val His Arg Ser Leu Val Asn Lys Gly Lys Arg His Ala Gln Ala Trp
130 135 140
Ala Phe Glu Arg Ser Asp Ala Asp Val Phe Leu Thr Val Asp Ser Asp
145 150 155 160
Thr Tyr Ile Tyr Pro Asn Ala Leu Glu Glu Leu Leu Lys Ser Phe Asn
165 170 175
Asp Glu Thr Val Tyr Ala Ala Thr Gly His Leu Asn Ala Arg Asn Arg
180 185 190
Gln Thr Asn Leu Leu Thr Arg Leu Thr Asp Ile Arg Tyr Asp Asn Ala
195 200 205
Phe Gly Val Glu Arg Ala Ala Gln Ser Leu Thr Gly Asn Ile Leu Val
210 215 220
Xaa Ser Gly Pro Leu Ser Ile Tyr Arg Arg Glu Val Ile Ile Pro Asn
225 230 235 240
Leu Glu Arg Tyr Lys Asn Gln Thr Phe Leu Gly Leu Pro Val Ser Ile
245 250 255
Gly Asp Asp Arg Cys Leu Thr Asn Tyr Ala Ile Asp Leu Gly Arg Thr
260 265 270
Val Tyr Gln Ser Thr Ala Arg Xaa Asp Thr Asp Val Pro Phe Gln Leu
275 280 285
Lys Ser Tyr Leu Lys Gln Gln Asn Arg Trp Asn Lys Ser Phe Phe Arg
290 295 300
Glu Ser Ile Ile Ser Val Lys Lys Ile Leu Ser Asn Pro Ile Val Ala
305 310 315 320
136/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Leu Trp Thr Ile Phe Glu Val Val Met Phe Met Met Leu Ile Val Ala
325 330 335
Ile Gly Asn Leu Leu Phe Asn Gln Ala Ile Gln Leu Asp Leu Ile Lys
340 345 350
Leu Phe Ala Phe Leu Ser Ile Ile Phe Ile Val Ala Leu Xaa Arg Asn
355 360 365
Val His Tyr Met Val Lys His Pro Ala Ser Phe Leu Leu Ser Pro Leu
370 375 380
Tyr Gly Ile Leu His Leu Phe Val Leu Gln Pro Leu Lys Leu Tyr Ser
385 390 395 400
Leu Cys Thr Ile Lys Asn Thr Glu Trp Gly Thr Arg Lys Lys Val Thr
405 410 415
Ile Phe Lys
<210> 65
<211> 419
<212> PRT
<213> Streptococcus pyogenes
<220>
<221> MISC_FEATURE
<222> (225)..(225)
<223> xaa = Ala, Ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (280)..(280)
<223> Xaa = Ala, Ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (402)..(402)
137/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
<223> xaa = Ala, Ser or any other amino acid
<400> 65
Met Pro Ile Phe Lys Lys Thr Leu Ile Val Leu Ser Phe Ile Phe Leu
1 5 10 15
Ile Ser Ile Leu Ile Tyr Leu Asn Met Tyr Leu Phe Gly Thr Ser Thr
20 25 30
Val Gly Ile Tyr Gly Val Ile Leu Ile Thr Tyr Leu Val Ile Lys Leu
35 40 45
Gly Leu Ser Phe Leu Tyr Glu Pro Phe Lys Gly Asn Pro His Asp Tyr
50 55 60
Lys Val Ala Ala Val Ile Pro Ser Tyr Asn Glu Asp Ala Glu Ser Leu
65 70 75 80
Leu Glu Thr Leu Lys Ser Val Leu Ala Gln Thr Tyr Pro Leu Ser Glu
85 90 95
Ile Tyr Ile Val Asp Asp Gly Ser Ser Asn Thr Asp Ala Ile Gln Leu
100 105 110
Ile Glu Glu Tyr Val Asn Arg Glu Val Asp Ile Cys Arg Asn Val Ile
115 120 125
Val His Arg Ser L~u Val Asn Lys Gly Lys Arg His Ala Gln Ala Trp
130 135 140
Ala Phe Glu Arg Ser Asp Ala Asp Val Phe Leu Thr Val Asp Ser Asp
145 150 155 160
Thr Tyr Ile Tyr Pro Asn Ala Leu Glu Glu Leu Leu Lys Ser Phe Asn
165 170 175
Asp Glu Thr Val Tyr Ala Ala Thr Gly His Leu Asn Ala Arg Asn Arg
180 185 190
Gln Thr Asn Leu Leu Thr Arg Leu Thr Asp Ile Arg Tyr Asp Asn Ala
195 200 205
Phe Gly Val Glu Arg Ala Ala Gln Ser Leu Thr Gly Asn Ile Leu Val
210 215 220
Xaa Ser Gly Pro Leu Ser Ile Tyr Arg Arg Glu Val Ile Ile Pro Asn
225 230 235 240
138/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Leu Glu Arg Tyr Lys Asn Gln Thr Phe Leu Gly Leu Pro Val Ser Ile
245 250 255
Gly Asp Asp Arg Cys Leu Thr Asn Tyr Ala Ile Asp Leu Gly Arg Thr
260 265 270
Val Tyr Gln Ser Thr Ala Arg Xaa Asp Thr Asp Val Pro Phe Gln Leu
275 280 285
Lys Ser Tyr Leu Lys Gln Gln Asn Arg Trp Asn Lys Ser Phe Phe Arg
290 295 300
Glu Ser Ile Ile Ser Val Lys Lys Ile Leu Ser Asn Pro Ile Val Ala
305 310 315 320
Leu Trp Thr Ile Phe Glu Val Val Met Phe Met Met Leu Ile Val Ala
325 330 335
Ile Gly Asn Leu Leu Phe Asn Gln Ala Ile Gln Leu Asp Leu Ile Lys
340 345 350
Leu Phe Ala Phe Leu Ser Ile Ile Phe Ile Val Ala Leu Cys Arg Asn
355 360 365
Val His Tyr Met Val Lys His Pro Ala Ser Phe Leu Leu Ser Pro Leu
370 375 380
Tyr Gly Ile Leu His Leu Phe Val Leu Gln Pro Leu Lys Leu Tyr Ser
385 390 395 400
Leu Xaa Thr Ile Lys Asn Thr Glu Trp Gly Thr Arg Lys Lys Val Thr
405 410 415
Ile Phe Lys
<210> 66
<211> 419
<212> PRT
<213> Streptococcus pyogenes
<220>
<221> MISC_FEATURE
139/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
<222> (225)..(225)
<223> xaa = Ala, Ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (366)..(366)
<223> xaa = Ala, Ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (402)..(402)
<223> xaa = Ala, Ser or any other amino acid
<400> 66
Met Pro Ile Phe Lys Lys Thr Leu Ile Val Leu Ser Phe Ile Phe Leu
1 5 10 15
Ile Ser Ile Leu Ile Tyr Leu Asn Met Tyr Leu Phe Gly Thr Ser Thr
20 25 30
Val Gly Ile Tyr Gly Val Ile Leu Ile Thr Tyr Leu Val Ile Lys Leu
35 40 45
Gly Leu Ser Phe Leu Tyr Glu Pro Phe Lys Gly Asn Pro His Asp Tyr
50 55 60
Lys Val Ala Ala Val Ile Pro Ser Tyr A5n Glu Asp Ala Glu Ser Leu
65 70 75 80
Leu Glu Thr Leu Lys Ser Val Leu Ala Gln Thr Tyr Pro Leu Ser Glu
85 90 95
Ile Tyr Ile Val Asp Asp Gly Ser Ser Asn Thr Asp Ala Ile Gln Leu
100 105 110
Ile Glu Glu Tyr Val Asn Arg Glu Val Asp Ile Cys Arg Asn Val Ile
115 120 125
Val His Arg Ser Leu Val Asn Lys Gly Lys Arg His Ala Gln Ala Trp
130 135 140
140/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Ala Phe Glu Arg Ser Asp Ala Asp Val Phe Leu Thr Val Asp Ser Asp
145 150 155 160
Thr Tyr Ile Tyr Pro Asn Ala Leu Glu Glu Leu Leu Lys Ser Phe Asn
165 170 175
Asp Glu Thr Val Tyr Ala Ala Thr Gly His Leu Asn Ala Arg Asn Arg
180 185 190
Gln Thr Asn Leu Leu Thr Arg Leu Thr Asp Ile Arg Tyr Asp Asn Ala
195 200 205
Phe Gly Va1 Glu Arg Ala Ala Gln Ser Leu Thr Gly Asn Ile Leu Val
210 215 220
Xaa Ser Gly Pro Leu Ser Ile Tyr Arg Arg Glu Val Ile Ile Pro Asn
225 230 235 240
Leu Glu Arg Tyr Lys Asn Gln Thr Phe Leu Gly Leu Pro Val Ser Ile
245 250 255
Gly Asp Asp Arg Cys Leu Thr Asn Tyr Ala Ile Asp Leu Gly Arg Thr
260 265 270
Val Tyr Gln Ser Thr Ala Arg Cys Asp Thr asp Val Pro Phe Gln Leu
275 280 . 285
Lys Ser Tyr Leu Lys Gln Gln Asn Arg Trp Asn LyS Ser Phe Phe Arg
290 295 300
Glu Ser Ile Ile Ser Val Lys Lys Ile Leu Ser Asn Pro Ile Val Ala
305 310 315 320
Leu Trp Thr Ile Phe Glu Val Val Met Phe Met Met Leu Ile Val Ala
325 330 335
Ile Gly Asn Leu Leu Phe Asn Gln Ala Ile Gln Leu Asp Leu Ile Lys
340 345 350
Leu Phe Ala Phe Leu Ser Ile Ile Phe Ile Val Ala Leu Xaa Arg Asn
355 360 365
Val His Tyr Met Val Lys His Pro Ala Ser Phe Leu Leu Ser Pro Leu
370 375 380
Tyr Gly Ile Leu His Leu Phe Val Leu Gln Pro Leu Lys Leu Tyr Ser
385 390 395 400
141/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Leu Xaa Thr Ile Lys Asn Thr Glu Trp Gly Thr Arg Lys Lys Val Thr
405 410 415
Ile Phe Lys
<210> 67
<211> 419
<212> PRT
<213> Streptococcus pyogenes
<220>
<221> MISC_FEATURE
<222> (261)..(261)
<223> xaa = Ala, ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (280)..(280)
<223> Xaa = Ala, ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (366)..(366)
<223> Xaa = Ala, ser or any other amino acid
<400> 67
Met Pro Ile Phe Lys Lys Thr Leu Ile Val Leu Ser Phe Ile Phe Leu
1 5 10 15
Ile Ser Ile Leu Ile Tyr Leu Asn Met Tyr Leu Phe Gly Thr Ser Thr
20 25 30
Val Gly Ile Tyr Gly Val Ile Leu Ile Thr Tyr Leu Val Ile Lys Leu
35 40 45
Gly Leu Ser Phe Leu Tyr Glu Pro Phe Lys Gly Asn Pro His Asp Tyr
50 55 60
142/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Lys Val Ala Ala Val Ile Pro Ser Tyr Asn Glu Asp Ala Glu Ser Leu
65 70 75 80
Leu Glu Thr Leu Lys Ser Val Leu Ala Gln Thr Tyr Pro Leu Ser Glu
85 90 95
Ile Tyr Ile Val Asp Asp Gly Ser Ser Asn Thr Asp Ala Ile Gln Leu
100 105 110
Ile Glu Glu Tyr Val Asn Arg Glu Val Asp Ile Cys Arg Asn Val Ile
115 120 125
Val His Arg Ser Leu Val Asn Lys Gly Lys Arg His Ala Gln Ala Trp
130 135 140
Ala Phe Glu Arg Ser Asp Ala Asp Val Phe Leu Thr Val Asp Ser Asp
145 150 155 160
Thr Tyr Ile Tyr Pro Asn Ala Leu Glu Glu Leu Leu Lys Ser Phe Asn
165 170 175
Asp Glu Thr Val Tyr Ala Ala Thr Gly His Leu Asn Ala Arg Asn Arg
180 185 190
Gln Thr Asn Leu Leu Thr Arg Leu Thr Asp Ile Arg Tyr Asp Asn Ala
195 200 205
Phe Gly Val Glu Arg Ala Ala Gln Ser Leu Thr Gly Asn Ile Leu Val
210 215 220
Cys Ser Gly Pro Leu Ser Ile Tyr Arg Arg Glu Val Ile Ile Pro Asn
225 230 235 240
Leu Glu Arg Tyr Lys Asn Gln Thr Phe Leu Gly Leu Pro Val Ser Ile
245 250 255
Gly Asp Asp Arg Xaa Leu Thr Asn Tyr Ala Ile Asp Leu Gly Arg Thr
260 265 270
Val Tyr Gln Ser Thr Ala Arg Xaa Asp Thr Asp Val Pro Phe Gln Leu
275 280 285
Lys Ser Tyr Leu Lys Gln Gln Asn Arg Trp Asn Lys Ser Phe Phe Arg
290 295 300
Glu Ser Ile Ile Ser Val Lys Lys Ile Leu Ser Asn Pro Ile Val Ala
305 310 315 320
143/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Leu Trp Thr Ile Phe Glu Val Val Met Phe Met Met Leu Ile Val Ala
325 330 335
Ile Gly Asn Leu Leu Phe Asn Gln Ala Ile Gln Leu Asp Leu Ile Lys
340 345 350
Leu Phe Ala Phe Leu Ser Ile Ile Phe Ile Val Ala Leu Xaa Arg Asn
355 360 365
Val His Tyr Met Val Lys His Pro Ala ser Phe Leu Leu Ser Pro Leu
370 375 380
Tyr Gly Ile Leu His Leu Phe Val Leu Gln Pro Leu Lys Leu Tyr ser
385 390 395 400
Leu Cys Thr Ile Lys Asn Thr Glu Trp Gly Thr Arg Lys Lys Val Thr
405 410 415
Ile Phe Lys
<210> 68
<211> 419
<212> PRT
<213> Streptococcus pyogenes
<220>
<221> MISC_FEATURE
<222> (261)..(261)
<223> xaa = Ala, ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (280)..(280)
<223> xaa = Ala, Ser or any other amino acid
<220>
<221> MISC_FEATURE
144/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
<222> (402)..(402)
<223> xaa = Ala, Ser or any other amino acid
<400> 68
Met Pro Ile Phe Lys Lys Thr Leu Ile Val Leu Ser Phe Ile Phe Leu
1 5 10 15
Ile Ser Ile Leu Ile Tyr Leu Asn Met Tyr Leu Phe Gly Thr Ser Thr
20 25 30
Val Gly Ile Tyr Gly Val Ile Leu Ile Thr Tyr Leu Val Ile Lys Leu
35 40 45
Gly Leu Ser Phe Leu Tyr Glu Pro Phe Lys Gly Asn Pro His Asp Tyr
50 55 60
Lys Val Ala Ala Val Ile Pro Ser Tyr Asn Glu Asp Ala Glu Ser Leu
65 70 75 80
Leu Glu Thr Leu Lys Ser Val Leu Ala Gln Thr Tyr Pro Leu Ser Glu
85 90 95
Ile Tyr Ile Val Asp Asp Gly Ser Ser Asn Thr Asp Ala Ile Gln Leu
100 105 110
Ile Glu Glu Tyr Val Asn Arg Glu Val Asp Ile Cys Arg Asn Val Ile
115 120 125
Val His Arg Ser Leu Val Asn Lys Gly Lys Arg His Ala Gln Ala Trp
130 135 140
Ala Phe Glu Arg Ser Asp Ala Asp Val Phe Leu Thr Val Asp Ser Asp
145 150 155 160
Thr Tyr Ile Tyr Pro Asn Ala Leu Glu Glu Leu Leu Lys Ser Phe Asn
165 170 175
Asp Glu Thr Val Tyr Ala Ala Thr Gly His Leu Asn Ala Arg Asn Arg
180 185 190
Gln Thr Asn Leu Leu Thr Arg Leu Thr Asp Ile Arg Tyr Asp Asn Ala
'195 200 205
Phe Gly Val Glu Arg Ala Ala Gln Ser Leu Thr Gly Asn Ile Leu Val
210 215 220
145/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Cys Ser Gly Pro Leu Ser Ile Tyr Arg Arg Glu Val Ile Ile Pro Asn
225 230 235 240
Leu Glu Arg Tyr Lys Asn Gln Thr Phe Leu Gly Leu Pro Val Ser Ile
245 Z50 255
Gly Asp Asp Arg Xaa Leu Thr Asn Tyr Ala Ile Asp Leu Gly Arg Thr
260 265 270
Val Tyr Gln Ser Thr Ala Arg Xaa Asp Thr Asp Val Pro Phe Gln Leu
275 280 285
Lys Ser Tyr Leu Lys Gln Gln Asn Arg Trp Asn Lys Ser Phe Phe Arg
290 295 300
Glu Ser Ile Ile Ser Val Lys Lys Ile Leu Ser Asn Pro Ile Val Ala
305 310 315 320
Leu Trp Thr Ile Phe Glu Val Val Met Phe Met Met Leu Ile Val Ala
325 330 335
Ile Gly Asn Leu Leu Phe Asn Gln Ala Ile Gln Leu Asp Leu Ile Lys
340 345 350
Leu Phe Ala Phe Leu Ser Ile Ile Phe Ile Val Ala Leu Cys Arg Asn
355 360 365
Val His Tyr Met Val Lys His Pro Ala Ser Phe Leu Leu Ser Pro Leu
370 375 380
Tyr Gly Ile Leu His Leu Phe Val Leu Gln Pro Leu Lys Leu Tyr Ser
385 390 395 400
Leu Xaa Thr Ile Lys Asn Thr Glu Trp Gly Thr Arg Lys Lys Val Thr
405 410 415
Ile Phe Lys
<210> 69
<211> 419
<212> PRT
<213> streptococcus pyogenes
<220>
146/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
<221> MISC_FEATURE
<222> (261)..(261)
<223> xaa = Ala, Ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (366)..(366)
<223> xaa = Ala, Ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (402)..(402)
<223> xaa = Ala, Ser or any other amino acid
<400> 69
Met Pro Ile Phe Lys Lys Thr Leu Ile Val Leu Ser Phe Ile Phe Leu
1 5 10 15
Ile Ser Ile Leu Ile Tyr Leu Asn Met Tyr Leu Phe Gly Thr Ser Thr
20 25 30
Val Gly Ile Tyr Gly Val Ile Leu Ile Thr Tyr Leu Val Ile Lys Leu
35 40 45
Gly Leu Ser Phe Leu Tyr Glu Pro Phe Lys Gly Asn Pro His Asp Tyr
50 55 60
Lys Val Ala Ala Val Ile Pro Ser Tyr Asn Glu Asp Ala Glu Ser Leu
65 70 75 80
Leu Glu Thr Leu Lys Ser Val Leu Ala Gln Thr Tyr Pro Leu Ser Glu
85 90 95
Ile Tyr Ile Val Asp Asp Gly Ser Ser Asn Thr Asp Ala Ile Gln Leu
100 105 110
Ile Glu Glu Tyr Val Asn Arg Glu Val Asp Ile Cys Arg Asn Val Ile
115 120 125
Val His Arg Ser Leu Val Asn Lys Gly Lys Arg His Ala Gln Ala Trp
130 13 5 140
147/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Ala Phe Glu Arg Ser Asp Ala Asp Val Phe Leu Thr Val Asp Ser Asp
145 150 155 160
Thr Tyr Ile Tyr Pro Asn Ala Leu Glu Glu Leu Leu Lys Ser Phe Asn
165 170 175
Asp Glu Thr Val Tyr Ala Ala Thr Gly His Leu Asn Ala Arg Asn Arg
180 185 190
Gln Thr Asn Leu Leu Thr Arg Leu Thr Asp Ile Arg Tyr Asp Asn Ala
195 200 205
Phe Gly Val Glu Arg Ala Ala Gln Ser Leu Thr Gly Asn Ile Leu Val
210 215 220
Cys Ser Gly Pro Leu Ser Ile Tyr Arg Arg Glu Val Ile Ile Pro Asn
225 230 235 240
Leu Glu Arg Tyr Lys Asn Gln Thr Phe Leu Gly Leu Pro Val Ser Ile
245 250 255
Gly Asp Asp Arg Xaa Leu Thr Asn Tyr Ala Ile Asp Leu Gly Arg Thr
260 265 270
Val Tyr Gln Ser Thr Ala Arg Cys Asp Thr Asp Val Pro Phe Gln Leu
275 280 285
Lys Ser Tyr Leu Lys Gln Gln Asn Arg Trp Asn Lys Ser Phe Phe Arg
290 295 300
Glu Ser Ile Ile Ser Val Lys Lys Ile Leu Ser Asn Pro Ile Val Ala
305 310 315 320
Leu Trp Thr Ile Phe Glu Val Val Met Phe Met Met Leu Ile Val Ala
325 330 335
Ile Gly Asn Leu Leu Phe Asn Gln Ala Ile Gln Leu Asp Leu Ile Lys
340 345 350
Leu Phe Ala Phe Leu Ser Ile Ile Phe Ile Val Ala Leu Xaa Arg Asn
355 360 365
Val His Tyr Met Val Lys His Pro Ala Ser Phe Leu Leu Ser Pro Leu
370 375 380
Tyr Gly Ile Leu His Leu Phe Val Leu Gln Pro Leu Lys Leu Tyr Ser
385 390 395 400
148/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Leu Xaa Thr Ile Lys Asn Thr Glu Trp Gly Thr Arg Lys Lys val Thr
405 410 415
Ile Phe Lys
<210> 70
<211> 419
<212> PRT
<213> Streptococcus pyogenes
<220>
<221> MISC_FEATURE
<222> (280)..(280)
<223> xaa = Ala, ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (366)..(366)
<223> xaa = Ala, Ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (402)..(402)
<223> Xaa = Ala, Ser or any other amino acid
<400> 70
Met Pro Ile Phe Lys Lys Thr Leu Ile val Leu Ser Phe Ile Phe Leu
1 S 10 15
Ile Ser Ile Leu Ile Tyr Leu Asn Met Tyr Leu Phe Gly Thr Ser Thr
20 25 30
Val Gly Ile Tyr Gly Val Ile Leu Ile Thr Tyr Leu Val Ile Lys Leu
35 40 45
149/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Gly Leu Ser Phe Leu Tyr Glu Pro Phe Lys Gly Asn Pro His Asp Tyr
50 55 60
Lys Val Ala Ala Val Ile Pro Ser Tyr Asn Glu Asp Ala Glu Ser Leu
65 70 75 80
Leu Glu Thr Leu Lys Ser Val Leu Ala Gln Thr Tyr Pro Leu Ser Glu
85 90 95
Ile Tyr Ile Val Asp Asp Gly Ser Ser Asn Thr Asp Ala Ile Gln Leu
100 105 110
Ile Glu Glu Tyr Val Asn Arg Glu Val Asp Ile Cys Arg Asn Val Ile
115 120 125
Val His Arg Ser Leu Val Asn Lys Gly Lys Arg His Ala Gln Ala Trp
130 135 140
Ala Phe Glu Arg Ser Asp Ala Asp Val Phe Leu Thr Val Asp Ser Asp
145 150 155 160
Thr Tyr Ile Tyr Pro Asn Ala Leu Glu Glu Leu Leu Lys Ser Phe Asn
165 170 175
Asp Glu Thr Val Tyr Ala Ala Thr Gly His Leu Asn Ala Arg Asn Arg
180 185 190
Gln Thr Asn Leu Leu Thr Arg Leu Thr Asp Ile Arg Tyr Asp Asn Ala
195 200 205
Phe Gly Val Glu Arg Ala Ala Gln Ser Leu Thr Gly Asn Ile Leu Val
210 215 220
Cys Ser Gly Pro Leu Ser Ile Tyr Arg Arg Glu Val Ile Ile Pro Asn
225 230 235 240
Leu Glu Arg Tyr Lys Asn Gln Thr Phe Leu Gly Leu Pro Val Ser Ile
245 250 255
Gly Asp Asp Arg Cys Leu Thr Asn Tyr Ala Ile Asp Leu Gly Arg Thr
260 265 270
Val Tyr Gln Ser Thr Ala Arg Xaa Asp Thr Asp Val Pro Phe Gln Leu
275 280 285
Lys Ser Tyr Leu Lys Gln Gln Asn Arg Trp Asn Lys Ser Phe Phe Arg
290 295 300
1 SO/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Glu Ser Ile Ile Ser Val Lys Lys Ile Leu Ser Asn Pro Ile Val Ala
305 310 315 320
Leu Trp Thr Ile Phe Glu Val Val Met Phe Met Met Leu Ile Val Ala
325 330 335
Ile Gly Asn Leu Leu Phe Asn Gln Ala Ile Gln Leu Asp Leu Ile Lys
340 345 350
Leu Phe Ala Phe Leu Ser Ile Ile Phe Ile Val Ala Leu Xaa Arg Asn
355 360 365
Val His Tyr Met Val Lys His Pro Ala Ser Phe Leu Leu Ser Pro Leu
370 375 380
Tyr Gly Ile Leu His Leu Phe Val Leu Gln Pro Leu Lys Leu Tyr Ser
385 390 395 400
Leu Xaa Thr Ile Lys Asn Thr Glu Trp Gly Thr Arg Lys Lys Val Thr
405 410 415
Ile Phe Lys
<210> 71
<211> 419
<212> PRT
<213> Streptococcus pyogenes
<220>
<221> MISC_FEATURE
<222> (124)..(124)
<223> xaa = Ala, ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (225)..(225)
<223> xaa = Ala, Ser or any other amino acid
<220>
151/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
<221> MISC_FEATURE
<222> (261)..(261)
<223> xaa = Ala, Ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (280)..(280)
<223> xaa = Ala, Ser or any other amino acid
<400> 71
Met Pro Ile Phe Lys Lys Thr Leu Ile Val Leu Ser Phe Ile Phe Leu
1 5 10 15
Ile Ser Ile Leu Ile Tyr Leu Asn Met Tyr Leu Phe Gly Thr Ser Thr
20 25 30
Val Gly Ile Tyr Gly Val Ile Leu Ile Thr Tyr Leu Val Ile Lys Leu
35 40 45
Gly Leu Ser Phe Leu Tyr Glu Pro Phe Lys Gly Asn Pro His Asp Tyr
50 55 60
Lys Val Ala Ala Val Ile Pro Ser Tyr Asn Glu Asp Ala Glu Ser Leu
65 70 75 80
Leu Glu Thr Leu Lys Ser Val Leu Ala Gln Thr Tyr Pro Leu Ser Glu
85 90 95
Ile Tyr Ile Val Asp Asp Gly Ser Ser Asn Thr Asp Ala Ile Gln Leu
100 105 110
Ile Glu Glu Tyr Val Asn Arg Glu Val Asp Ile Xaa Arg Asn Val Ile
115 120 125
Val His Arg Ser Leu Val Asn Lys Gly Lys Arg His Ala Gln Ala Trp
130 135 140
Ala Phe Glu Arg Ser Asp Ala Asp Val Phe Leu Thr Val Asp Ser Asp
145 150 155 160
Thr Tyr Ile Tyr Pro Asn Ala Leu Glu Glu Leu Leu Lys Ser Phe Asn
165 170 175
152/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Asp Glu Thr Val Tyr Ala Ala Thr Gly His Leu Asn Ala Arg Asn Arg
180 185 190
Gln Thr Asn Leu Leu Thr Arg Leu Thr Asp Ile Arg Tyr Asp Asn Ala
195 200 205
Phe Gly Val Glu Arg Ala Ala Gln Ser Leu Thr Gly Asn Ile Leu Val
210 215 220
Xaa Ser Gly Pro Leu Ser Ile Tyr Arg Arg Glu Val Ile Ile Pro Asn
225 230 235 240
Leu Glu Arg Tyr Lys Asn Gln Thr Phe Leu Gly Leu Pro Val Ser Ile
245 250 255
Gly Asp Asp Arg Xaa Leu Thr Asn Tyr Ala Ile Asp Leu Gly Arg Thr
260 265 270
Val Tyr Gln Ser Thr Ala Arg Xaa Asp Thr Asp Val Pro Phe Gln Leu
275 280 285
Lys Ser Tyr Leu Lys Gln Gln Asn Arg Trp Asn Lys Ser Phe Phe Arg
290 295 300
Glu Ser Ile Ile Ser Val Lys Lys Ile Leu Ser Asn Pro Ile Val Ala
305 310 315 320
Leu Trp Thr Ile Phe Glu Val Val Met Phe Met Met Leu Ile Val Ala
325 330 335
Ile Gly Asn Leu Leu Phe Asn Gln Ala Ile Gln Leu Asp Leu Ile Lys
340 345 350
Leu Phe Ala Phe Leu Ser Ile Ile Phe Ile Val Ala Leu Cys Arg Asn
355 360 365
Val His Tyr Met Val Lys His Pro Ala Ser Phe Leu Leu Ser Pro Leu
370 375 380
Tyr Gly Ile Leu His Leu Phe Val Leu Gln Pro Leu Lys Leu Tyr Ser
385 390 395 400
Leu Cys Thr Ile Lys Asn Thr Glu Trp Gly Thr Arg Lys Lys Val Thr
405 410 415
Ile Phe Lys
153/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
<210> 72
<211> 419
<212> PRT
<213> Streptococcus pyogenes
<220>
<221> MISC_FEATURE
<222> (124)..(124)
<223> xaa = Ala, ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (225)-.(225)
<223> xaa = Ala, ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (261)..(261)
<223> xaa = Ala, Ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (366)..(366)
<223> xaa = Ala, ser or any other amino acid
<400> 72
Met Pro Ile Phe Lys Lys Thr Leu Ile Val Leu Ser Phe Ile Phe Leu
1 5 10 15
Ile Ser Ile Leu Ile Tyr Leu Asn Met Tyr Leu Phe Gly Thr Ser Thr
20 25 30
Val Gly Ile Tyr Gly Val Ile Leu Ile Thr Tyr Leu Val Ile Lys Leu
35 40 45
154/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Gly Leu Ser Phe Leu Tyr Glu Pro Phe Lys Gly Asn Pro His Asp Tyr
5p 55 60
Lys Val Ala Ala Val Ile Pro Ser Tyr Asn Glu Asp Ala Glu Ser Leu
65 70 75 80
Leu Glu Thr Leu Lys Ser val Leu Ala Gln Thr Tyr Pro Leu Ser Glu
85 90 95
Ile Tyr Ile Val Asp Asp Gly Ser Ser Asn Thr Asp Ala Ile Gln Leu
100 105 110
Ile Glu Glu Tyr Val Asn Arg Glu Val Asp Ile Xaa Arg Asn Val Ile
115 120 125
Val His Arg Ser Leu Val Asn Lys Gly Lys Arg His Ala Gln Ala Trp
130 135 140
Ala Phe Glu Arg Ser Asp Ala Asp Val Phe Leu Thr Val Asp Ser Asp
145 150 155 160
Thr Tyr Ile Tyr Pro Asn Ala Leu Glu Glu Leu Leu Lys Ser Phe Asn
165 170 175
Asp Glu Thr Val Tyr Ala Ala Thr Gly His Leu Asn Ala Arg Asn Arg
180 185 190
Gln Thr Asn Leu Leu Thr Arg Leu Thr Asp Ile Arg Tyr Asp Asn Ala
195 200 205
Phe Gly Val Glu Arg Ala Ala Gln Ser Leu Thr Gly Asn Ile Leu Val
210 215 220
Xaa Ser Gly Pro Leu Ser Ile Tyr Arg Arg Glu Val Ile Ile Pro Asn
225 230 235 240
Leu Glu Arg Tyr Lys Asn Gln Thr Phe Leu Gly Leu Pro Val Ser Ile
245 250 255
Gly Asp Asp Arg Xaa Leu Thr Asn Tyr Ala Ile Asp Leu Gly Arg Thr
260 265 270
Val Tyr Gln Ser Thr Ala Arg Cys Asp Thr Asp Val Pro Phe Gln Leu
275 280 285
Lys Ser Tyr Leu Lys Gln Gln Asn Arg Trp Asn Lys Ser Phe Phe Arg
290 295 300
155/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Glu Ser Ile Ile Ser Val Lys Lys Ile Leu Ser Asn Pro Ile Val Ala
305 310 315 320
Leu Trp Thr Ile Phe Glu Val Val Met Phe Met Met Leu Ile Val Ala
325 330 335
Ile Gly Asn Leu Leu Phe Asn Gln Ala Ile Gln Leu Asp Leu Ile Lys
340 345 350
Leu Phe Ala Phe Leu Ser Ile Ile Phe Ile Val Ala Leu Xaa Arg Asn
355 360 365
Val His Tyr Met Val Lys His Pro Ala Ser Phe Leu Leu Ser Pro Leu
370 375 380
Tyr Gly Ile Leu His Leu Phe Val Leu Gln Pro Leu Lys Leu Tyr Ser
385 390 395 400
Leu Cys Thr Ile Lys Asn Thr Glu Trp Gly Thr Arg Lys Lys Val Thr
405 410 415
Ile Phe Lys
<210> 73
<211> 419
<212> PRT
<213> Streptococcus pyogenes
<220>
<221> MISC_FEATURE
<222> (124)..(124)
<223> Xaa = Ala, Ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (225)..(225)
<223> xaa = Ala, Ser or any other amino acid
<220>
156/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
<221> MISC_FEATURE
<222> (261)..(261)
<223> xaa = Ala, Ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (402)..(402)
<223> xaa = Ala, ser or any other amino acid
<400> 73
Met Pro Ile Phe Lys Lys Thr Leu Ile Val Leu Ser Phe Ile Phe Leu
1 5 10 15
Ile Ser Ile Leu Ile Tyr Leu Asn Met Tyr Leu Phe Gly Thr Ser Thr
20 25 30
Val Gly Ile Tyr Gly Val Ile Leu Ile Thr Tyr Leu Val Ile Lys Leu
35 40 45
Gly Leu Ser Phe Leu Tyr Glu Pro Phe Lys Gly Asn Pro His Asp Tyr
50 55 60
Lys Val Ala Ala Val Ile Pro Ser Tyr Asn Glu Asp Ala Glu Ser Leu
65 70 75 80
Leu Glu Thr Leu Lys Ser Val Leu Ala Gln Thr Tyr Pro Leu Ser Glu
85 90 95
Ile Tyr Ile Val Asp ASp Gly Ser Ser Asn Thr Asp Ala Ile Gln Leu
100 105 110
Ile Glu Glu Tyr Val Asn Arg Glu Val Asp Ile Xaa Arg Asn Val Ile
115 120 125
Val His Arg Ser Leu Val Asn Lys Gly Lys Arg His Ala Gln Ala Trp
130 135 140
Ala Phe Glu Arg Ser Asp Ala Asp Val Phe Leu Thr Val Asp Ser Asp
145 150 155 160
Thr Tyr Ile Tyr Pro Asn Ala Leu Glu Glu Leu Leu Lys Ser Phe Asn
165 170 17S
157/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Asp Glu Thr Val Tyr Ala Ala Thr Gly His Leu Asn Ala Arg Asn Arg
180 185 190
Gln Thr Asn Leu Leu Thr Arg Leu Thr Asp Ile Arg Tyr Asp Asn Ala
195 200 205
Phe Gly Val Glu Arg Ala Ala Gln Ser Leu Thr Gly Asn Ile Leu Val
210 215 220
Xaa Ser Gly Pro Leu Ser Ile Tyr Arg Arg Glu Val Ile Ile Pro Asn
225 230 235 240
Leu Glu Arg Tyr Lys Asn Gln Thr Phe Leu Gly Leu Pro Val Ser Ile
245 250 25S
Gly Asp Asp Arg Xaa Leu Thr Asn Tyr Ala Ile Asp Leu Gly Arg Thr
260 265 270
Val Tyr Gln Ser Thr Ala Arg Cys Asp Thr Asp Val Pro Phe Gln Leu
275 280 285
Lys Ser Tyr Leu Lys Gln Gln Asn Arg Trp Asn Lys Ser Phe Phe Arg
290 295 300
Glu Ser Ile Ile Ser Val Lys Lys Ile Leu Ser Asn Pro I1e Val Ala
305 310 315 320
Leu Trp Thr Ile Phe Glu Val Val Met Phe Met Met Leu Ile Val Ala
325 330 335
Ile Gly Asn Leu Leu Phe Asn Gln Ala Ile Gln Leu Asp Leu Ile Lys
340 345 350
Leu Phe Ala Phe Leu Ser Ile Ile Phe Ile Val Ala Leu Cys Arg Asn
355 360 365
Val His Tyr Met Val Lys His Pro Ala Ser Phe Leu Leu Ser Pro Leu
370 375 380
Tyr Gly Ile Leu His Leu Phe Val Leu Gln Pro Leu Lys Leu Tyr Ser
385 390 395 400
Leu Xaa Thr Ile Lys Asn Thr Glu Trp Gly Thr Arg Lys Lys Val Thr
405 410 415
Ile Phe Lys
158/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
<210> 74
<211> 419
<212> PRT
<213> Streptococcus pyogenes
<220>
<221> MISC_FEATURE
<222> (124)..(124)
<223> xaa = Ala, Ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (225)..(225)
<223> xaa = Ala, Ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (280)..(280)
<223> xaa = Ala, ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (366)..(366)
<223> xaa =-Ala, Ser or any other amino acid
<400> 74
Met Pro Ile Phe Lys Lys Thr Leu Ile Val Leu Ser Phe Ile Phe Leu
1 5 10 15
Ile Ser Ile Leu Ile Tyr Leu Asn Met Tyr Leu Phe Gly Thr Ser Thr
20 25 30
Val Gly Ile Tyr Gly Val Ile Leu Ile Thr Tyr Leu Val Ile Lys Leu
35 40 45
159/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Gly Leu Ser Phe Leu Tyr Glu Pro Phe Lys Gly Asn Pro His Asp Tyr
SO 55 60
Lys Val Ala Ala Val Ile Pro Ser Tyr Asn Glu Asp Ala Glu Ser Leu
65 70 75 80
Leu Glu Thr Leu Lys Ser Val Leu Ala Gln Thr Tyr Pro Leu Ser Glu
85 90 95
Ile Tyr Ile Val Asp Asp Gly Ser Ser Asn Thr Asp Ala Ile Gln Leu
100 105 110
Ile Glu Glu Tyr Val Asn Arg Glu Val Asp Ile Xaa Arg Asn Val Ile
115 120 125
Val His Arg Ser Leu Val Asn Lys Gly Lys Arg His Ala Gln Ala Trp
130 135 140
Ala Phe Glu Arg Ser Asp Ala Asp Val Phe Leu Thr Val Asp Ser Asp
145 150 155 160
Thr Tyr Ile Tyr Pro Asn Ala Leu Glu Glu Leu Leu Lys Ser Phe Asn
165 170 175
Asp Glu Thr Val Tyr Ala Ala Thr Gly His Leu Asn Ala Arg Asn Arg
180 185 190
Gln Thr Asn Leu Leu Thr Arg Leu Thr Asp Ile Arg Tyr Asp Asn Ala
195 200 205
Phe Gly Val Glu Arg Ala Ala Gln Ser Leu Thr Gly Asn Ile Leu Val
210 215 220
Xaa Ser Gly Pro Leu Ser Ile Tyr Arg Arg Glu Val Ile Ile Pro Asn
225 Z30 235 240
Leu Glu Arg Tyr Lys Asn Gln Thr Phe Leu Gly Leu Pro Val Ser Ile
245 250 255
Gly Asp Asp Arg Cys Leu Thr Asn Tyr Ala Ile Asp Leu Gly Arg Thr
260 265 270
Val Tyr Gln Ser Thr Ala Arg Xaa Asp Thr Asp Val Pro Phe Gln Leu
275 280 285
Lys Ser Tyr Leu Lys Gln Gln Asn Arg Trp Asn Lys Ser Phe Phe Arg
290 295 300
160/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Glu Ser Ile Ile Ser Val Lys Lys Ile Leu Ser Asn Pro Ile Val Ala
305 310 315 320
Leu Trp Thr Ile Phe Glu Val Val Met Phe Met Met Leu Ile Val Ala
325 330 335
Ile Gly Asn Leu Leu Phe Asn Gln Ala Ile Gln Leu Asp Leu Ile Lys
340 345 350
Leu Phe Ala Phe Leu Ser Ile Ile Phe Ile Val Ala Leu-Xaa Arg Asn
355 360 365
Val His Tyr Met Val Lys His Pro Ala Ser Phe Leu Leu Ser Pro Leu
370 375 380
Tyr Gly Ile Leu His Leu Phe Val Leu Gln Pro Leu Lys Leu Tyr Ser
385 390 395 400
Leu Cys Thr Ile Lys Asn Thr Glu Trp Gly Thr Arg Lys Lys Val Thr
405 410 415
Ile Phe Lys
<210> 75
<211> 419
<212> PRT
<213> Streptococcus pyogenes
<220>
<221> MISC_FEATURE
<222> (124)..(124)
<223> xaa = Ala, ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (225)..(225)
<223> xaa = Ala, Ser or any other amino acid
<220>
161/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
<221> MISC_FEATURE
<222> (280)..(280)
<223> xaa = Ala, Ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (402)..(402)
<223> xaa = Ala, Ser or any other amino acid
<400> 75
Met Pro Ile Phe Lys Lys Thr Leu Ile Val Leu Ser Phe Ile Phe Leu
1 5 10 15
Ile Ser Ile Leu Ile Tyr Leu Asn Met Tyr Leu Phe Gly Thr Ser Thr
20 25 30
Val Gly Ile Tyr Gly Val Ile Leu Ile Thr Tyr Leu Val Ile Lys Leu
35 40 45
Gly Leu Ser Phe Leu Tyr Glu Pro Phe Lys Gly Asn Pro His Asp Tyr
50 55 60
Lys Val Ala Ala Val Ile Pro Ser Tyr Asn Glu Asp Ala Glu Ser Leu
65 70 75 80
Leu Glu Thr Leu Lys Ser Val Leu Ala Gln Thr Tyr Pro Leu Ser Glu
85 90 95
Ile Tyr Ile Val Asp Asp Gly Ser Ser Asn Thr Asp Ala Ile Gln Leu
100 105 110
Ile Glu Glu Tyr Val Asn Arg Glu Val Asp Ile Xaa Arg Asn Val Ile
115 120 125
Val His Arg Sec Leu Val ASn Lys Gly Lys Arg His Ala Gln Ala Trp
130 135 140
Ala Phe Glu Arg Ser Asp Ala Asp Val Phe Leu Thr Val Asp Ser Asp
145 150 155 160
Thr Tyr Ile Tyr Pro Asn Ala Leu Glu Glu Leu Leu Lys Ser Phe Asn
165 170 175
162/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Asp Glu Thr Val Tyr Ala Ala Thr Gly His Leu Asn Ala Arg Asn Arg
180 185 190
Gln Thr Asn Leu Leu Thr Arg Leu Thr Asp Ile Arg Tyr Asp Asn Ala
195 200 205
Phe Gly Val Glu Arg Ala Ala Gln Ser Leu Thr Gly Asn Ile Leu Val
210 215 220
Xaa Ser Gly Pro Leu Ser Ile Tyr Arg Arg Glu Val Ile Ile Pro Asn
225 230 235 240
Leu Glu Arg Tyr Lys Asn Gln Thr Phe Leu Gly Leu Pro Val Ser Ile
245 250 255
Gly Asp Asp Arg Cys Leu Thr Asn Tyr Ala Ile Asp Leu Gly Arg Thr
260 265 270
Val Tyr Gln Ser Thr Ala Arg Xaa Asp Thr Asp Val Pro Phe Gln Leu
275 280 285
Lys Ser Tyr Leu Lys Gln Gln Asn Arg Trp Asn Lys Ser Phe Phe Arg
290 295 300
Glu Ser Ile Ile Ser Val Lys Lys Ile Leu Ser Asn Pro Ile Val Ala
305 310 315 320
Leu Trp Thr Ile Phe Glu Val Val Met Phe Met Met Leu Ile Val Ala
325 330 335
Ile Gly Asn Leu Leu Phe Asn Gln Ala Ile Gln Leu Asp Leu Ile Lys
340 345 350
Leu Phe Ala Phe Leu Ser Ile Ile Phe Ile Val Ala Leu Cys Arg Asn
355 360 365
Val His Tyr Met Val Lys His Pro Ala Ser Phe Leu Leu Ser Pro Leu
370 375 380
Tyr Gly Ile Leu His Leu.Phe Val Leu Gln Pro Leu Lys Leu Tyr Ser
385 390 395 400
Leu Xaa Thr Ile Lys Asn Thr Glu Trp Gly Thr Arg Lys Lys Val Thr
405 410 415
Ile Phe Lys
163/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
<210> 76
<211> 419
<212> PRT
<213> streptococcus pyogenes
<220>
<221> MISC_FEATURE
<222> (124)..(124)
<223> xaa = Ala, ser or any other amino.acid
<220>
<221> MISC_FEATURE
<222> (225)..(225)
<223> xaa = Ala, ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (366)..(366)
<223> xaa = Ala, ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (402)..(402)
<223> xaa = Ala, Ser or any other amino acid
<400> 76
Met Pro Ile Phe Lys Lys Thr Leu Ile Val Leu Ser Phe Ile Phe Leu
1 5 10 15
Ile ser Ile Leu Ile Tyr Leu Asn Met Tyr Leu Phe Gly Thr ser Thr
20 25 30
Val Gly Ile Tyr Gly val Ile Leu Ile Thr Tyr Leu Val Ile Lys Leu
35 40 45
164/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Gly Leu Ser Phe Leu Tyr Glu Pro Phe Lys Gly Asn Pro His Asp Tyr
50 55 60
Lys Val Ala Ala Val Ile Pro Ser Tyr Asn Glu Asp Ala Glu Ser Leu
65 70 75 80
Leu Glu Thr Leu Lys Ser Val Leu Ala Gln Thr Tyr Pro Leu Ser Glu
85 90 95
Ile Tyr Ile Val Asp Asp Gly Ser Ser Asn Thr Asp Ala Ile Gln Leu
100 105 110
Ile Glu Glu Tyr Val Asn Arg Glu Val Asp Ile Xaa Arg Asn Val Ile
115 120 125
Val His Arg Ser Leu Val Asn Lys Gly Lys Arg His Ala Gln Ala Trp
130 135 140
Ala Phe Glu Arg Ser Asp Ala Asp Val Phe Leu Thr Val Asp Ser Asp
145 150 155 160
Thr Tyr Ile Tyr Pro Asn Ala Leu Glu Glu Leu Leu Lys Ser Phe Asn
165 170 175
Asp Glu Thr Val Tyr Ala Ala Thr Gly His Leu Asn Ala Arg Asn Arg
180 185 190
Gln Thr Asn Leu Leu Thr Arg Leu Thr Asp Ile Arg Tyr Asp Asn Ala
195 200 205
Phe Gly Val Glu Arg Ala Ala Gln Ser Leu Thr Gly Asn Ile Leu Val
210 215 220
Xaa Ser Gly Pro Leu Ser Ile Tyr Arg Arg Glu Va1 Ile Ile Pro Asn
225 230 235 240
Leu Glu Arg Tyr Lys Asn Gln Thr Phe Leu Gly Leu Pro Val Ser Ile
245 250 255
Gly Asp Asp Arg Cys Leu Thr Asn Tyr Ala Ile Asp Leu Gly Arg Thr
260 265 270
Val Tyr Gln Ser Thr Ala Arg Cys Asp Thr Asp Val Pro Phe Gln Leu
275 280 285
Lys Ser Tyr Leu Lys Gln Gln Asn Arg Trp Asn Lys Ser Phe Phe Arg
290 295 300
165/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Glu Ser Ile Ile Ser Val Lys Lys Ile Leu Ser Asn Pro Ile Val Ala
305 310 315 320
Leu Trp Thr Ile Phe Glu Val Val Met Phe Met Met Leu Ile Val Ala
325 330 335
Ile Gly Asn Leu Leu Phe Asn Gln Ala Ile Gln Leu Asp Leu Ile Lys
340 345 350
Leu Phe Ala Phe Leu Ser Ile Ile Phe Ile Val Ala Leu Xaa Arg Asn
355 360 365
Val Hi5 Tyr Met Val Lys His Pro Ala Ser Phe Leu Leu Ser Pro Leu
370 375 380
Tyr Gly Ile Leu His Leu Phe Val Leu Gln Pro Leu Lys Leu Tyr Ser
385 390 395 400
Leu Xaa Thr Ile Lys Asn Thr Glu Trp Gly Thr Arg Lys Lys Val Thr
405 410 415
Ile Phe Lys
<210> 77
<211> 419
<212> PRT
<213> Streptococcus pyogenes
<220>
<221> MISC_FEATURE
<222> (124)..(124)
<223> xaa = Ala, ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (261)..(261)
<223> xaa = Ala, Ser or any other amino acid
<220>
166/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
<221> MISC_FEATURE
<222> (280)..(280)
<223> xaa = Ala, Ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (366)..(366)
<223> xaa = Ala, Ser or any other amino acid
<400> 77
Met Pro Ile Phe Lys Lys Thr Leu Ile Val Leu Ser Phe Ile Phe Leu
1 5 10 15
Ile Ser Ile Leu Ile Tyr Leu Asn Met Tyr Leu Phe Gly Thr Ser Thr
20 25 30
Val Gly Ile Tyr Gly Val Ile Leu Ile Thr Tyr Leu Val Ile Lys Leu
35 40 45
Gly Leu Ser Phe Leu Tyr Glu Pro Phe Lys Gly Asn Pro His Asp Tyr
50 55 60
Lys Val Ala Ala Val Ile Pro Ser Tyr Asn Glu Asp Ala Glu Ser Leu
65 70 75 80
Leu Glu Thr Leu Lys Ser Val Leu Ala Gln Thr Tyr Pro Leu Ser Glu
85 90 95
Ile Tyr Ile Val Asp Asp Gly Ser Ser Asn Thr Asp Ala Ile Gln Leu
100 105 110
Ile Glu Glu Tyr Val Asn Arg Glu Val Asp Ile Xaa Arg Asn Val Ile
115 120 125
Val His Arg Ser Leu Val Asn Lys Gly Lys Arg His Ala Gln Ala Trp
130 135 140
Ala Phe Glu Arg Ser Asp Ala Asp Val Phe Leu Thr Val Asp Ser Asp
145 150 155 160
Thr Tyr Ile Tyr Pro Asn Ala Leu Glu Glu Leu Leu Lys Ser Phe Asn
165 170 175
167/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Asp Glu Thr Val Tyr Ala Ala Thr Gly His Leu Asn Ala Arg Asn Arg
180 185 190
Gln Thr Asn Leu Leu Thr Arg Leu Thr Asp Ile Arg Tyr Asp Asn Ala
195 200 205
Phe Gly Val Glu Arg Ala Ala Gln Ser Leu Thr Gly Asn Ile Leu Val
210 215 220
Cys Ser Gly Pro Leu Ser Ile Tyr Arg Arg Glu Val Ile Ile Pro Asn
225 230 235 240
Leu Glu Arg Tyr Lys Asn Gln Thr Phe Leu Gly Leu Pro Val Ser Ile
245 250 255
Gly Asp Asp Arg Xaa Leu Thr Asn Tyr Ala Ile Asp Leu Gly Arg Thr
260 265 270
Val Tyr Gln Ser Thr Ala Arg Xaa Asp Thr Asp Val Pro Phe Gln Leu
275 280 285
Lys Ser Tyr Leu Lys Gln Gln Asn Arg Trp Asn Lys Ser Phe Phe Arg
290 295 300
Glu Ser Ile Ile Ser Val Lys Lys Ile Leu Ser Asn Pro Ile Val Ala
305 310 315 320
Leu Trp Thr Ile Phe Glu Val Val Met Phe Met Met Leu Ile Val Ala
325 330 335
Ile Gly Asn Leu Leu Phe Asn Gln Ala Ile Gln Leu Asp Leu Ile Lys
340 345 350
Leu Phe Ala Phe Leu Ser Ile Ile Phe Ile Val Ala Leu Xaa Arg Asn
355 360 365
Val His Tyr Met Val Lys His Pro Ala Ser Phe Leu Leu Ser Pro Leu
370 375 380
Tyr Gly Ile Leu His Leu Phe Val Leu Gln Pro Leu Lys Leu Tyr Ser
385 390 395 400
Leu Cys Thr Ile Lys Asn Thr Glu Trp Gly Thr Arg Lys Lys Val Thr
405 410 415
Ile Phe Lys
168/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
<210> 78
<211> 419
<212> PRT
<213> Streptococcus pyogenes
<220>
<221> MISC_FEATURE
<222> (124)..(124)
<223> xaa = Ala, Ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (261)..(261)
<223> xaa = Ala, ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (280)..(280)
<223> Xaa = Ala, Ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (402)..(402)
<223> xaa = Ala, ser or any other amino acid
<400> 78
Met Pro Ile Phe Lys Lys Thr Leu Ile Val Leu Ser Phe Ile Phe Leu
1 5 10 15
Ile Ser Ile Leu Ile Tyr Leu Asn Met Tyr Leu Phe Gly Thr Ser Thr
20 25 30
Val Gly Ile Tyr Gly Val Ile Leu Ile Thr Tyr Leu Val Ile Lys Leu
35 40 45
169/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Gly Leu Ser Phe Leu Tyr Glu Pro Phe Lys Gly Asn Pro His Asp Tyr
50 55 60
Lys Val Ala Ala Val Ile Pro Ser Tyr Asn Glu Asp Ala Glu 5er Leu
65 70 75 80
Leu Glu Thr Leu Lys Ser Val Leu Ala Gln Thr Tyr Pro Leu Ser Glu
85 90 95
Ile Tyr Ile Val Asp Asp Gly Ser Ser Asn Thr Asp Ala Ile Gln Leu
100 105 110
Ile Glu Glu Tyr Val Asn Arg Glu Val Asp Ile Xaa Arg Asn Val Ile
115 120 125
Val His Arg Ser Leu Val Asn Lys Gly Lys Arg His Ala Gln Ala Trp
130 135 140
Ala Phe Glu Arg Ser Asp Ala Asp Val Phe Leu Thr Val Asp Ser Asp
145 150 155 160
Thr Tyr Ile Tyr Pro Asn Ala Leu Glu Glu Leu Leu Lys Ser Phe Asn
165 170 175
Asp Glu Thr Val Tyr Ala Ala Thr Gly His Leu Asn Ala Arg Asn Arg
180 185 190
Gln Thr Asn Leu Leu Thr Arg Leu Thr Asp Ile Arg Tyr Asp Asn Ala
195 200 205
Phe Gly Val Glu Arg Ala Ala Gln Ser Leu Thr Gly Asn Ile Leu Val
210 215 220
Cys. Ser Gly Pro Leu Ser Ile Tyr Arg Arg Glu Val Ile Ile Pro Asn
225 230 235 240
Leu G'lu Arg Tyr Lys Asn Gln Thr Phe Leu Gly Leu Pro Val Ser Ile
245 250 255
Gly Asp Asp Arg Xaa Leu Thr Asn Tyr Ala Ile Asp Leu Gly Arg Thr
260 265 270
Val Tyr Gln Ser Thr Ala Arg Xaa Asp Thr Asp Val Pro Phe Gln Leu
275 280 285
Lys Ser Tyr Leu Lys Gln Gln Asn Arg Trp Asn Lys Ser Phe Phe Arg
290 295 300
170/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Glu Ser Ile Ile Ser Val Lys Lys Ile Leu Ser Asn Pro Ile Val Ala
305 310 315 320
Leu Trp Thr Ile Phe Glu Val Val Met Phe Met Met Leu Ile Val Ala
325 330 335
Ile Gly Asn Leu Leu Phe Asn Gln Ala Ile Gln Leu Asp Leu Ile Lys
340 345 350
Leu Phe Ala Phe Leu Ser Ile Ile Phe Ile Val Ala Leu Cys Arg Asn
355 360 365
Val His Tyr Met Val Lys His Pro Ala Ser Phe Leu Leu Ser Pro Leu
370 375 380
Tyr Gly Ile Leu His Leu Phe Val Leu Gln Pro Leu Lys Leu Tyr Ser
385 390 395 400
Leu Xaa Thr Ile Lys Asn Thr Glu Trp Gly Thr Arg Lys Lys Val Thr
405 410 415
Ile Phe Lys
<210> 79
<211> 419
<212> PRT
<213> Streptococcus pyogenes
<220>
<221> MISC_FEATURE
<222> (124)..(124)
<223> xaa = Ala, Ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (261)..(261)
<223> Xaa = Ala, ser or any other amino acid
<220>
171/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
<221> MISC_FEATURE
<222> (366)..(366)
<223> xaa = Ala, Ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (402)..(402)
<223> xaa = Ala, ser or any other amino acid
<400> 79
Met Pro Ile Phe Lys Lys Thr Leu Ile Val Leu Ser Phe Ile Phe Leu
1 5 10 15
Ile Ser Ile Leu Ile Tyr Leu Asn Met Tyr Leu Phe Gly Thr Ser Thr
20 25 30
Val Gly Ile Tyr Gly Val Ile Leu Ile Thr Tyr Leu Val Ile Lys Leu
35 40 45
Gly Leu Ser Phe Leu Tyr Glu Pro Phe Lys Gly Asn Pro His Asp Tyr
50 55 60
Lys Val Ala Ala Val Ile Pro Ser Tyr Asn Glu Asp Ala Glu Ser Leu
65 70 75 80
Leu Glu Thr Leu Lys Ser Val Leu Ala Gln Thr Tyr Pro Leu Ser Glu
85 90 95
Ile Tyr Ile Val Asp Asp Gly Ser Ser Asn Thr Asp Ala Ile Gln Leu
100 105 110
Ile Glu Glu Tyr Val Asn Arg Glu Val Asp Ile Xaa Arg Asn Val Ile
115 120 125
Val His Arg Ser Leu Val Asn Lys Gly Lys Arg His Ala Gln Ala Trp
130 135 140
Ala Phe Glu Arg Ser Asp Ala Asp Val Phe Leu Thr Val Asp Ser Asp
145 150 155 160
Thr Tyr Ile Tyr Pro Asn Ala Leu Glu Glu Leu Leu Lys Ser Phe Asn
165 170 175
172/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Asp Glu Thr Val Tyr Ala Ala Thr Gly His Leu Asn Ala Arg Asn Arg
180 185 190
Gln Thr Asn Leu Leu Thr Arg Leu Thr Asp Ile Arg Tyr Asp Asn Ala
195 200 205
Phe Gly Val Glu Arg Ala Ala Gln Ser Leu Thr Gly Asn Ile Leu Val
210 215 220
~ys Ser Gly Pro Leu Ser Ile Tyr Arg Arg Glu Val Ile Ile Pro Asn
225 230 235 240
Leu Glu Arg Tyr Lys Asn Gln Thr Phe Leu Gly Leu Pro Val Ser Ile
245 250 255
Gly Asp Asp Arg Xaa Leu Thr Asn Tyr Ala Ile Asp Leu Gly Arg Thr
260 265 270
Val Tyr Gln Ser Thr Ala Arg Cys Asp Thr Asp Val Pro Phe Gln Leu
275 280 285
Lys Ser Tyr Leu Lys Gln Gln Asn Arg Trp Asn Lys Ser Phe Phe Arg
290 295 300
Glu Ser Ile Ile Ser Val Lys Lys Ile Leu Ser Asn Pro Ile Val Ala
305 310 315 320
Leu Trp Thr Ile Phe Glu Val Val Met Phe Met Met Leu Ile Val Ala
325 330 335
Ile Gly Asn Leu Leu Phe Asn Gln Ala Ile Gln Leu Asp Leu Ile Lys
340 345 350
Leu Phe Ala Phe Leu Ser Ile Ile Phe Ile Val Ala Leu Xaa Arg Asn
355 360 365
Val His Tyr Met Val Lys His Pro Ala Ser Phe Leu Leu Ser Pro Leu
3~0 375 380
Tyr Gly Ile Leu His Leu Phe Val Leu Gln Pro Leu Lys Leu Tyr Ser
385 390 395 400
Leu Xaa Thr Ile Lys Asn Thr Glu Trp Gly Thr Arg Lys Lys Val Thr
405 410 415
Ile Phe Lys
173/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
<210> 80
<211> 419
<212> PRT
<213> Streptococcus pyogenes
<220>
<221> MISC_FEATURE
<222> (124)..(124)
<223> xaa = Ala, Ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (280)..(280)
<223> xaa = Ala, Ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (366)..(366)
<223> xaa = Ala, ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (402)..(402)
<223> xaa = Ala, Ser or any other amino acid
<400> 80
Met Pro Ile Phe Lys Lys Thr Leu Ile Val Leu Ser Phe Ile Phe Leu
1 5 10 15
Ile Ser Ile Leu Ile Tyr Leu Asn Met Tyr Leu Phe Gly Thr Ser Thr
20 25 30
Val Gly Ile Tyr Gly Val Ile Leu Ile Thr Tyr Leu Val Ile Lys Leu
35 40 45
174/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Gly Leu Ser Phe Leu Tyr Glu Pro Phe Lys Gly Asn Pro His Asp Tyr
50 55 60
Lys Val Ala Ala Val Ile Pro Ser Tyr Asn Glu Asp Ala Glu Ser Leu
65 70 75 80
Leu Glu Thr Leu Lys Ser Val Leu Ala Gln Thr Tyr Pro Leu Ser Glu
85 90 95
Ile Tyr Ile Val Asp Asp Gly Ser Ser Asn Thr Asp Ala Ile Gln Leu
100 105 110
Ile Glu Glu Tyr Val Asn Arg Glu Val Asp Ile Xaa Arg Asn Val Ile
115 120 125
Val His Arg Ser Leu Val Asn Lys Gly Lys Arg His Ala Gln Ala Trp
130 135 140
Ala Phe Glu Arg Ser Asp Ala Asp Val Phe Leu Thr Val Asp Ser Asp
145 150 155 160
Thr Tyr Ile Tyr Pro Asn Ala Leu Glu Glu Leu Leu Lys Ser Phe Asn
165 170 175
Asp Glu Thr Val Tyr Ala Ala Thr Gly His Leu Asn Ala Arg Asn Arg
180 185 190
Gln Thr Asn Leu Leu Thr Arg Leu Thr Asp Ile Arg Tyr Asp Asn Ala
195 200 Z05
Phe Gly Val Glu Arg Ala Ala Gln Ser Leu Thr Gly Asn Ile Leu Val
210 215 220
Cys Ser Gly Pro Leu Ser Ile Tyr Arg Arg Glu Val Ile Ile Pro Asn
225 230 235 240
Leu Glu Arg Tyr Lys Asn Gln Thr Phe Leu Gly Leu Pro Val Ser Ile
245 250 255
Gly Asp Asp Arg Cys Leu Thr Asn Tyr Ala Ile Asp Leu Gly Arg Thr
260 265 270
Val Tyr Gln Ser Thr Ala Arg Xaa Asp Thr Asp Val Pro Phe Gln Leu
275 280 285
Lys Ser Tyr Leu Lys Gln Gln Asn Arg Trp Asn Lys 5er Phe Phe Arg
290 295 300
175/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Glu Ser Ile Ile Ser Val Lys Lys Ile Leu Ser Asn Pro Ile Val Ala
305 310 315 320
Leu Trp Thr Ile Phe Glu Val Val Met Phe Met Met Leu Ile Val Ala
325 330 335
Ile Gly Asn Leu Leu Phe Asn Gln Ala Ile Gln Leu Asp Leu Ile Lys
340 345 350
Leu Phe Ala Phe Leu Ser Ile Ile Phe Ile Val Ala Leu Xaa Arg Asn
355 360 365
Val His Tyr Met Val Lys His Pro Ala Ser Phe Leu Leu Ser Pro Leu
370 375 380
Tyr Gly Ile Leu His Leu Phe Val Leu Gln Pro Leu Lys Leu Tyr Ser
385 390 395 400
Leu Xaa Thr Ile Lys Asn Thr Glu Trp Gly Thr Arg Lys Lys Val Thr
405 410 415
Ile Phe Lys
<210> 81
<211> 419
<212> PRT
<213> Streptococcus pyogenes
<220>
<221> MISC_FEATURE
<222> (225)..(225)
<223> Xaa = Ala, Ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (261)..(261)
<223> xaa = Ala, Ser or any other amino acid
<220>
176/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
<221> MISC_FEATURE
<222> (280)..(280)
<223> xaa = Ala, Ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (366)..(366)
<223> Xaa = Ala, Ser or any other amino acid
<400> 81
Met Pro Ile Phe Lys Lys Thr Leu Ile Val Leu Ser Phe Ile Phe Leu
1 5 10 15
Ile Ser Ile Leu Ile Tyr Leu Asn Met Tyr Leu Phe Gly Thr Ser Thr
20 25 30
Val Gly ile Tyr Gly Val Ile Leu Ile Thr Tyr Leu Val Ile Lys Leu
35 40 45
Gly Leu Ser Phe Leu Tyr Glu Pro Phe Lys Gly Asn Pro His Asp Tyr
50 55 60
Lys Val Ala Ala Val Ile Pro Ser Tyr Asn Glu Asp Ala Glu Ser Leu
65 70 75 80
Leu Glu Thr Leu Lys Ser Val Leu Ala Gln Thr Tyr Pro Leu Ser Glu
85 90 95
Ile Tyr Ile Val Asp Asp Gly Ser Ser Asn Thr Asp Ala Ile Gln Leu
100 105 110
Ile Glu Glu Tyr Val Asn Arg Glu Val Asp Ile Cys Arg Asn Val Ile
115 120 125
Val His Arg Ser Leu Val Asn Lys Gly Lys Arg His Ala Gln Ala Trp
130 135 140
Ala Phe Glu Arg Ser Asp Ala Asp Val Phe Leu Thr Val Asp Ser Asp
145 150 155 160
Thr Tyr Ile Tyr Pro Asn Ala Leu Glu Glu Leu Leu Lys Ser Phe Asn
165 170 175
177/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Asp Glu Thr Val Tyr Ala Ala Thr Gly His Leu Asn Ala Arg Asn Arg
180 185 190
Gln Thr Asn Leu Leu Thr Arg Leu Thr Asp Ile Arg Tyr Asp Asn Ala
195 200 205
Phe Gly Val Glu Arg Ala Ala Gln Ser Leu Thr Gly Asn Ile Leu Val
210 215 220
Xaa Ser Gly.Pro Leu Ser Ile Tyr Arg Arg Glu Val Ile Ile Pro Asn
225 230 235 240
Leu Glu Arg Tyr Lys Asn Gln Thr Phe Leu Gly Leu Pro val Ser Ile
245 250 255
Gly Asp Asp Arg Xaa Leu Thr Asn Tyr Ala Ile Asp Leu Gly Arg Thr
260 265 270
Val Tyr Gln Ser Thr Ala Arg Xaa Asp Thr Asp Val Pro Phe Gln Leu
275 280 285
Lys Ser Tyr Leu Lys Gln Gln Asn Arg Trp Asn Lys Ser Phe Phe Arg
290 295 300
Glu Ser Ile Ile Ser Val Lys Lys Ile Leu Ser Asn Pro Ile Val Ala
305 310 315 320
Leu Trp Thr Ile Phe Glu Val Val Met Phe Met Met Leu Ile Val Ala
325 330 335
Ile Gly Asn Leu Leu Phe Asn Gln Ala Ile Gln Leu Asp Leu Ile Lys
340 345 350
Leu Phe Ala Phe Leu Ser Ile Ile Phe Ile Val Ala Leu Xaa Arg Asn
355 360 365
Val His Tyr Met Val Lys His Pro Ala Ser Phe Leu Leu Ser Pro Leu
370 375 380
Tyr Gly Ile Leu His Leu Phe Val Leu Gln Pro Leu Lys Leu Tyr Ser
385 390 395 400
Leu Cys Thr Ile Lys Asn Thr Glu Trp Gly Thr Arg Lys Lys Val Thr
405 410 415
Ile Phe Lys
178/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
<210> 82
<211> 419
<212> PRT
<213> Streptococcus pyogenes
<220>
<221> MISC_FEATURE
<222> (225)..(225)
<223> xaa = Ala, Ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (261)..(261)
<223> xaa = Ala, Ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (280)..(280)
<223> xaa = Ala, ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (402)..(402)
<223> xaa = Ala, Ser or any other amino acid
<400> 82
Met Pro Ile Phe Lys Lys Thr Leu Ile Val Leu Ser Phe Ile Phe Leu
1 5 10 15
Ile Ser Ile Leu Ile Tyr Leu Asn Met Tyr Leu Phe Gly Thr Ser Thr
20 25 30
Val Gly Ile Tyr Gly val Ile Leu Ile Thr Tyr Leu Val Ile Lys Leu
35 40 45
179/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Gly Leu Ser Phe Leu Tyr Glu Pro Phe Lys Gly Asn Pro His Asp Tyr
50 55 60
Lys Val Ala Ala Val Ile Pro Ser Tyr Asn Glu Asp Ala Glu Ser Leu
65 70 75 80
Leu Glu Thr Leu Lys Ser Val Leu Ala Gln Thr Tyr Pro Leu Ser Glu
85 90 95
Ile Tyr Ile Val Asp Asp Gly Ser Ser Asn Thr Asp Ala Ile Gln Leu
100 105 110
Ile Glu Glu Tyr Val Asn Arg Glu Val Asp Ile Cys Arg Asn Val Ile
115 120 125
Val His Arg Ser Leu Val Asn Lys Gly Lys Arg His Ala Gln Ala Trp
130 135 140
Ala Phe Glu Arg Ser Asp Ala Asp Val Phe Leu Thr Val Asp Ser Asp
145 150 155 160
Thr Tyr Ile Tyr Pro Asn Ala Leu Glu Glu Leu Leu Lys Ser Phe Asn
165 170 175
Asp Glu Thr Val Tyr Ala Ala Thr Gly His Leu Asn Ala Arg Asn Arg
180 185 190
Gln Thr Asn Leu Leu Thr Arg Leu Thr Asp Ile Arg Tyr Asp Asn Ala
195 200 205
Phe Gly Val Glu Arg Ala Ala Gln Ser Leu Thr Gly Asn Ile Leu Val
210 215 220
Xaa Ser Gly Pro Leu Ser Ile Tyr Arg Arg Glu Val Ile Ile Pro Asn
225 230 235 240
Leu Glu Arg Tyr Lys Asn Gln Thr Phe Leu Gly Leu Pro Val Ser Ile
245 250 255
Gly Asp Asp Arg Xaa Leu Thr Asn Tyr Ala Ile Asp Leu Gly Arg Thr
260 265 270
Val Tyr Gln Ser Thr Ala Arg Xaa Asp Thr Asp Val Pro Phe Gln Leu
275 280 285
Lys Ser Tyr Leu Lys Gln Gln Asn Arg Trp Asn Lys Ser Phe Phe Arg
290 295 300
180/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Glu Ser Ile Ile Ser Val Lys Lys Ile Leu Ser Asn Pro Ile Val Ala
305 310 315 320
Leu Trp Thr Ile Phe Glu Val Val Met Phe Met Met Leu Ile Val Ala
325 330 335
Ile Gly Asn Leu .Leu Phe Asn Gln Ala Ile Gln Leu Asp Leu Ile Lys
340 345 350
Leu Phe Ala Phe Leu Ser Ile Ile Phe Ile Val Ala Leu Cys Arg Asn
355 360 365
Val His Tyr Met Val Lys His Pro Ala Ser Phe Leu Leu Ser Pro Leu
370 375 380
Tyr Gly Ile Leu His Leu Phe Val Leu Gln Pro Leu Lys Leu Tyr Ser
385 390 395 400
Leu Xaa Thr Ile Lys Asn Thr Glu Trp Gly Thr Arg Lys Lys Val Thr
405 410 415
Ile Phe Lys
<210> 83
<211> 419
<212> PRT
<213> Streptococcus pyogenes
<220>
<221> MISC_FEATURE
<222> (225)..(225)
<223> xaa = Ala, Ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (261)..(261)
<223> xaa = Ala, Ser or any other amino acid
<220>
181/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
<221> MISC_FEATURE
<222> (366)..(366)
<223> Xaa = Ala, Ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (402)..(402)
<223> Xaa = Ala, Ser or any other amino acid
<400> 83
Met Pro Ile Phe Lys Lys Thr Leu Ile Val Leu Ser Phe Ile Phe Leu
1 5 10 15
Ile Ser Ile Leu Ile Tyr Leu Asn Met Tyr Leu Phe Gly Thr Ser Thr
20 25 30
Val Gly Ile Tyr Gly Val Ile Leu Ile Thr Tyr Leu Val Ile Lys Leu
35 40 45
Gly Leu Ser Phe Leu Tyr Glu Pro Phe Lys Gly Asn Pro His Asp Tyr
50 55 60
Lys Val Ala Ala Val Ile Pro Ser Tyr Asn Glu Asp Ala Glu Ser Leu
65 70 75 80
Leu Glu Thr Leu Lys Ser Val Leu Ala Gln Thr Tyr Pro Leu Ser Glu
85 90 95
Ile Tyr Ile Val Asp Asp Gly Ser Ser Asn Thr Asp Ala Ile Gln Leu
100 105 110
Ile.Glu Glu Tyr Val Asn Arg Glu Val Asp Ile Cys Arg Asn Val Ile
115 120 125
Val His Arg Ser Leu Val Asn Lys Gly Lys Arg His Ala Gln Ala Trp
130 135 140
Ala Phe Glu Arg Ser Asp Ala Asp Val Phe Leu Thr Val Asp Ser Asp
145 150 155 160
Thr Tyr Ile Tyr Pro Asn Ala Leu Glu Glu Leu Leu Lys Ser Phe Asn
165 170 175
182/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Asp Glu Thr Val Tyr Ala Ala Thr Gly His Leu Asn Ala Arg Asn Arg
180 185 190
Gln Thr Asn Leu Leu Thr Arg Leu Thr Asp Ile Arg Tyr Asp Asn Ala
195 200 205
Phe Gly Val Glu Arg Ala Ala Gln Ser Leu Thr Gly Asn Ile Leu Val
210 215 220
Xaa Ser Gly Pro Leu Ser Ile Tyr Arg Arg Glu Val Ile Ile Pro Asn
225 230 235 240
Leu Glu Arg Tyr Lys Asn Gln Thr Phe Leu Gly Leu Pro Val Ser Ile
245 250 255
Gly Asp Asp Arg Xaa Leu Thr Asn Tyr Ala Ile Asp Leu Gly Arg Thr
260 265 270
Val Tyr Gln Ser Thr Ala Arg Cys Asp Thr Asp Val Pro Phe Gln Leu
275 280 285
Lys Ser Tyr Leu Lys Gln Gln Asn Arg Trp Asn Lys Ser Phe Phe Arg
2.90 295 300
Glu Ser Ile Ile Ser Val Lys Lys Ile Leu Ser Asn Pro Ile Val Ala
305 310 315 320
Leu Trp Thr Ile Phe Glu Val Val Met Phe Met Met Leu Ile Val Ala
325 330 335
Ile Gly Asn Leu Leu Phe Asn Gln Ala Ile Gln Leu Asp Leu Ile Lys
340 345 350
Leu Phe Ala Phe Leu Ser Ile Ile Phe Ile Val Ala Leu Xaa Arg Asn
355 360 365
Val His Tyr Met Val Lys His Pro Ala Ser Phe Leu Leu Ser Pro Leu
370 375 380
Tyr Gly Ile Leu His Leu Phe Val Leu Gln Pro Leu Lys Leu Tyr Ser
385 390 395 400
Leu Xaa Thr Ile Lys Asn Thr Glu Trp Gly Thr Arg Lys Lys Val Thr
405 410 415
Ile Phe Lys
183/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
<210> 84
<211> 419
<212> PRT
<213> Streptococcus pyogenes
<220>
<221> MISC_FEATURE
<222> (225)..(225)
<223> xaa = Ala, Ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (280)..(280)
<223> xaa = Ala, Ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (366)..(366)
<223> Xaa = Ala, Ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (402)..(402)
<223> xaa = Ala, Ser or any other amino acid
<400> 84
Met Pro Ile Phe Lys Lys Thr Leu Ile Val Leu Ser Phe Ile Phe Leu
1 5 10 15
Ile Ser Ile Leu Ile Tyr Leu Asn Met Tyr Leu Phe Gly Thr Ser Thr
20 25 30
Val Gly Ile Tyr Gly Val Ile Leu Ile Thr Tyr Leu Val Ile Lys Leu
35 40 45
184/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Gly Leu Ser Phe Leu Tyr Glu Pro Phe Lys Gly Asn Pro His Asp Tyr
50 55 60
Lys Val Ala Ala Val Ile Pro Ser Tyr Asn Glu Asp Ala Glu Ser Leu
65 70 75 80
Leu Glu Thr Leu Lys 5er Val Leu Ala Gln Thr Tyr Pro Leu Ser Glu
85 90 95
Ile Tyr Ile Val Asp Asp Gly Ser Ser Asn Thr Asp Ala Ile Gln Leu
100 105 110
Ile Glu Glu Tyr Val Asn Arg Glu Val Asp Ile Cys Arg Asn Val Ile
115 120 125
Val His Arg Ser Leu Val Asn Lys Gly Lys Arg His Ala Gln Ala Trp
130 135 140
Ala Phe Glu Arg Ser Asp Ala Asp Val Phe Leu Thr Val Asp Ser Asp
145 150 155 160
Thr Tyr Ile Tyr Pro Asn Ala Leu Glu Glu Leu Leu Lys Ser Phe Asn
165 170 175
Asp Glu Thr Val Tyr Ala Ala Thr Gly His Leu Asn Ala Arg Asn Arg
180 185 190
Gln Thr Asn Leu Leu Thr Arg Leu Thr Asp Ile Arg Tyr Asp Asn Ala
195 200 205
Phe Gly Val Glu Arg Ala Ala Gln Ser Leu Thr Gly Asn Ile Leu Val
210 215 220
Xaa Ser Gly Pro Leu Ser Ile Tyr Arg Arg Glu Va1 Ile Ile Pro Asn
225 230 235 240
Leu Glu Arg Tyr Lys Asn Gln Thr Phe Leu Gly Leu Pro Val Ser Ile
245 250 255
Gly Asp Asp Arg Cys Leu Thr Asn Tyr Ala Ile Asp Leu Gly Arg Thr
260 265 270
Val Tyr Gln Ser Thr Ala Arg Xaa Asp Thr Asp Val Pro Phe Gln Leu
275 280 285
Lys Ser Tyr Leu Lys Gln Gln Asn Arg Trp Asn Lys Ser Phe Phe Arg
290 295 300
185/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Glu Ser Ile Ile Ser Val Lys Lys Ile Leu Ser Asn Pro Ile Val Ala
305 310 315 320
Leu Trp Thr Ile Phe Glu Val Val Met Phe Met Met Leu Ile Val Ala
325 330 335
Ile Gly Asn Leu Leu Phe Asn Gln Ala Ile Gln Leu Asp Leu Ile Lys
340 345 350
Leu Phe Ala Phe Leu Ser Ile Ile Phe Ile Val Ala Leu Xaa Arg Asn
355 360 365
Val His Tyr Met Val Lys His Pro Ala Ser Phe Leu Leu Ser Pro Leu
370 375 . 380
Tyr Gly Ile Leu His Leu Phe Val Leu Gln Pro Leu Lys Leu Tyr Ser
385 390 395 400
Leu Xaa Thr Ile Lys Asn Thr Glu Trp Gly Thr Arg Lys Lys Val Thr
405 410 415
Ile Phe Lys
<210> 85
<211> 419
<212> PRT
<213> Streptococcus pyogenes
<220>
<221> MISC_FEATURE
<222> (261)..(261)
<223> Xaa = Ala, Ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (280)..(280)
<223> Xaa = Ala, Ser or any other amino acid
<220>
186/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
<221> MISC_FEATURE
<222> (366)..(366)
<223> xaa = Ala, Ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (402)..(402)
<223> xaa = Ala, Ser or any other amino acid
<400> 85
Met Pro Ile Phe Lys Lys Thr Leu Ile Val Leu Ser Phe Ile Phe Leu
1 5 10 15
Ile Ser Ile Leu Ile Tyr Leu Asn Met Tyr Leu Phe Gly Thr Ser Thr
20 25 30
Val Gly Ile Tyr Gly val Ile Leu Ile Thr Tyr Leu Val Ile Lys Leu
35 40 45
Gly Leu Ser Phe Leu Tyr Glu Pro Phe Lys Gly Asn Pro His Asp Tyr
50 55 60
Lys Val Ala Ala Val Ile Pro Ser Tyr Asn Glu Asp Ala Glu Ser Leu
65 70 75 80
Leu Glu Thr Leu Lys Ser Val Leu Ala Gln Thr Tyr Pro Leu Ser Glu
85 90 95
Ile Tyr Ile Val Asp Asp Gly Ser Ser Asn Thr Asp Ala Ile Gln Leu
100 105 110
Ile Glu Glu Tyr Val Asn Arg Glu Val Asp Ile Cys Arg Asn Val Ile
115 120 125
Val His Arg Ser Leu Val Asn Lys Gly Lys Arg His Ala Gln Ala Trp
130 135 140
Ala Phe Glu Arg Ser Asp Ala Asp Val Phe Leu Thr Val Asp Ser Asp
145 150 155 160
Thr Tyr Ile Tyr Pro Asn Ala Leu Glu Glu Leu Leu Lys Ser Phe Asn
165 170 175
187/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Asp Glu Thr Val Tyr Ala Ala Thr Gly His Leu Asn Ala Arg Asn Arg
180 18S 190
Gln Thr Asn Leu Leu Thr Arg Leu Thr Asp Ile Arg Tyr Asp Asn Ala
195 200 205
Phe Gly Val Glu Arg Ala Ala Gln Ser Leu Thr Gly Asn Ile Leu val
210 215 220
Cys Ser Gly Pro Leu Ser Ile Tyr Arg Arg Glu Val Ile Ile Pro Asn
225 230 235 240
Leu Glu Arg Tyr Lys Asn G1n Thr Phe Leu Gly Leu Pro Val Ser Ile
245 250 255
Gly Asp Asp Arg Xaa Leu Thr Asn Tyr Ala Ile Asp Leu Gly Arg Thr
260 265 270
Val Tyr Gln Ser Thr Ala Arg Xaa Asp Thr Asp Val Pro Phe Gln Leu
275 280 285
Lys Ser Tyr Leu Lys Gln Gln Asn Arg Trp Asn Lys Ser Phe Phe Arg
290 295 300
Glu Ser Ile Ile Ser Val Lys Lys Ile Leu Ser Asn Pro Ile Val Ala
305 310 315 320
Leu Trp Thr Ile Phe Glu Val Val Met Phe Met Met Leu Ile Val Ala
325 330 335
Ile Gly Asn Leu Leu Phe Asn Gln Ala Ile Gln Leu Asp Leu Ile Lys
340 345 350
Leu Phe Ala Phe Leu Ser Ile Ile Phe Ile Val Ala Leu Xaa Arg Asn
355 360 365
Val His Tyr Met Val Lys His Pro Ala Ser Phe Leu Leu Ser Pro Leu
370 375 380
Tyr Gly Ile Leu His Leu Phe Val Leu Gln Pro Leu Lys Leu Tyr Ser
385 390 395 400
Leu Xaa Thr Ile Lys Asn Thr Glu Trp Gly Thr Arg Lys Lys Val Thr
405 410 415
Ile Phe Lys
188/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
<210> 86
<211> 419
<212> PRT
<213> Streptococcus pyogenes
<220>
<221> MISC_FEATURE
<222> (124)..(124)
<223> xaa = Ala, Ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (225)..(225)
<223> xaa = Ala, Ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (261)..(261)
<223> xaa = Ala, ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (280)..(280)
<223> xaa = Ala, Ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (366)..(366)
<223> Xaa = Ala, Ser or any other amino acid
<400> 86
Met Pro Ile Phe Lys Lys Thr Leu Ile Val Leu Ser Phe Ile Phe Leu
1 5 10 15
189/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Ile Ser Ile Leu Ile Tyr Leu Asn Met Tyr Leu Phe Gly Thr Ser Thr
20 25 30
Val Gly Ile Tyr Gly Val Ile Leu Ile Thr Tyr Leu Val Ile Lys Leu
35 40 45
Gly Leu Ser Phe Leu Tyr Glu Pro Phe Lys Gly Asn Pro His Asp Tyr
50 55 60
Lys Val Ala Ala Val Ile Pro Ser Tyr Asn Glu Asp Ala Glu Ser Leu
65 70 75 80
Leu Glu Thr Leu Lys Ser Val Leu Ala Gln Thr Tyr Pro Leu Ser Glu
85 90 95
Ile Tyr Ile Val Asp Asp Gly Ser Ser Asn Thr Asp Ala Ile Gln Leu
100 105 110
Ile Glu Glu Tyr Val Asn Arg Glu Val Asp Ile Xaa Arg Asn Val Ile
115 120 125
Val His Arg Ser Leu Val Asn Lys Gly Lys Arg His Ala Gln Ala Trp
130 135 140
Ala Phe Glu Arg Ser Asp Ala Asp Val Phe Leu Thr Val Asp Ser Asp
145 150 155 160
Thr Tyr Ile Tyr Pro Asn Ala Leu Glu Glu Leu Leu Lys Ser Phe Asn
165 170 175
Asp Glu Thr Val Tyr Ala Ala Thr Gly His Leu Asn Ala Arg Asn Arg
180 185 190
Gln Thr Asn Leu Leu Thr Arg Leu Thr Asp Ile Arg Tyr Asp Asn Ala
195 200 205
Phe Gly Val Glu Arg Ala Ala Gln Ser Leu Thr Gly Asn Ile Leu Val
210 215 220
Xaa Ser Gly Pro Leu Ser Ile Tyr Arg Arg Glu Val Ile Ile Pro Asn
225 230 235 240
Leu Glu Arg Tyr Lys Asn Gln Thr Phe Leu Gly Leu Pro Val Ser Ile
245 250 255
Gly Asp Asp Arg Xaa Leu Thr Asn Tyr Ala Ile Asp Leu Gly Arg Thr
260 265 270
190/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Val Tyr Gln Ser Thr Ala Arg Xaa Asp Thr Asp Val Pro Phe Gln Leu
275 280 285
Lys Ser Tyr Leu Lys Gln Gln Asn Arg Trp Asn Lys Ser Phe Phe Arg
290 295 300
Glu Ser Ile Ile Ser Val Lys Lys Ile Leu Ser Asn Pro Ile Val Ala
305 310 315 320
Leu Trp Thr Ile Phe Glu Val Val Met Phe Met Met Leu Ile Val Ala
325 330 335
Ile Gly Asn Leu Leu Phe Asn Gln Ala Ile Gln Leu Asp Leu Ile Lys
340 345 350
Leu Phe Ala Phe Leu Ser Ile Ile Phe Ile Val Ala Leu Xaa Arg Asn
355 360 365
Val His Tyr Met Val Lys His Pro Ala Ser Phe Leu Leu Ser Pro Leu
370 375 380
Tyr Gly Ile Leu His Leu Phe Val Leu Gln Pro Leu Lys Leu Tyr Ser
385 390 395 400
Leu Cys Thr Ile Lys Asn Thr Glu Trp Gly Thr Arg Lys Lys Val Thr
405 410 415
Ile Phe Lys
<210> 87
<211> 419
<212> PRT
<213> streptococcus pyogenes
<220>
<221> MISC_FEATURE
<222> (124)..(124)
<223> Xaa = Ala, Ser or any other amino acid
<220>
191/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
<221> MISC_FEATURE
<222> (225)..(225)
<Z23> xaa = Ala, Ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (261)..(261)
<223> xaa = Ala, ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (280)..(280)
<223> xaa = Ala, ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (402)..(402)
<223> xaa = Ala, Ser or any other amino acid
<400> 87
Met Pro Ile Phe Lys Lys Thr Leu Ile Val Leu Ser Phe Ile Phe Leu
1 5 10 15
Ile Ser Ile Leu Ile Tyr Leu Asn Met Tyr Leu Phe Gly Thr Ser Thr
20 25 30
Val Gly Ile Tyr Gly Val Ile Leu Ile Thr Tyr Leu Val Ile Lys Leu
35 40 45
Gly Leu Ser Phe Leu Tyr Glu Pro Phe Lys Gly Asn Pro His Asp Tyr
50 55 60
Lys Val Ala Ala Val Ile Pro Ser Tyr Asn Glu Asp Ala Glu Ser Leu
65 70 75 80
Leu Glu Thr Leu Lys Ser Val Leu Ala Gln Thr Tyr Pro Leu Ser Glu
85 90 95
192/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Ile Tyr Ile Val Asp Asp Gly Ser Ser Asn Thr Asp Ala Ile Gln Leu
100 105 110
Ile Glu Glu Tyr Val Asn Arg Glu Val Asp Ile Xaa Arg Asn Val Ile
115 120 125
Val His Arg Ser Leu Val Asn Lys Gly Lys Arg His Ala Gln Ala Trp
130 135 140
Ala Phe Glu Arg Ser Asp Ala Asp Val Phe Leu Thr Val Asp Ser Asp
145 150 155 160
Thr Tyr Ile Tyr Pro Asn Ala Leu Glu Glu Leu Leu Lys Ser Phe Asn
165 170 175
Asp Glu Thr Val Tyr Ala Ala Thr Gly His Leu Asn Ala Arg Asn Arg
180 185 190
Gln Thr Asn Leu Leu Thr Arg Leu Thr Asp Ile Arg Tyr Asp Asn Ala
195 200 205
Phe Gly Val Glu Arg Ala Ala Gln Ser Leu Thr Gly Asn Ile Leu Val
210 215 220
Xaa Ser Gly Pro Leu Ser Ile Tyr Arg Arg Glu Val Ile Ile Pro Asn
225 230 Z35 240
Leu Glu Arg Tyr Lys Asn Gln Thr Phe Leu Gly Leu Pro Val Ser Ile
245 250 255
Gly Asp Asp Arg Xaa Leu Thr Asn Tyr Ala Ile Asp Leu Gly Arg Thr
260 265 270
Val Tyr Gln Ser Thr Ala Arg Xaa Asp Thr Asp Val Pro Phe Gln Leu
275 280 285
Lys Ser Tyr Leu Lys Gln Gln Asn Arg Trp Asn Lys Ser Phe Phe Arg
290 295 300
Glu Ser Ile Ile Ser val Lys Lys Ile Leu Ser Asn Pro Ile Val Ala
305 310 315 320
Leu Trp Thr Ile Phe Glu Val Val Met Phe Met Met Leu Ile Val Ala
325 330 335
Ile Gly Asn Leu Leu Phe Asn Gln Ala Ile Gln Leu Asp Leu Ile Lys
340 345 350
193/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Leu Phe Ala Phe Leu Ser Ile Ile Phe Ile Val Ala Leu Cys Arg Asn
355 360 365
Val His Tyr Met Val Lys His Pro Ala Ser Phe Leu Leu Ser Pro Leu
370 375 380
Tyr Gly Ile Leu His Leu Phe Val Leu Gln Pro Leu Lys Leu Tyr Ser
385 390 395 400
Leu Xaa Thr Ile Lys Asn Thr Glu Trp Gly Thr Arg Lys Lys Val Thr
405 410 415
Ile Phe Lys
<210> 88
<211> 419
<212> PRT
<213> Streptococcus pyogenes
<220>
<221> MISC_FEATURE
<222> (124)..(124)
<223> xaa = Ala, ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (225)..(225)
<223> xaa = Ala, ser or any other amino acid
<220>
<221> MISC_FEATURE
/<222> (261)..(261)
<223> xaa = Ala, ser or any other amino acid
<220>
<221> MISC_FEATURE
194/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
<222> (366)..(366)
<223> xaa = Ala, Ser or any other amino acid
<Z20>
<221> MISC_FEATURE
<222> (402)..(402)
<223> xaa = Ala, ser or any other amino acid
<400> 88
Met Pro Ile Phe Lys Lys Thr Leu Ile Val Leu Ser Phe Ile Phe Leu
1 5 10 15
Ile 5er Ile Leu Ile Tyr Leu Asn Met Tyr Leu Phe Gly Thr Ser Thr
20 25 30
Val Gly Ile Tyr Gly Val Ile Leu Ile Thr Tyr Leu Val Ile Lys Leu
35 40 45
Gly Leu Ser Phe Leu Tyr Glu Pro Phe Lys Gly Asn Pro His Asp Tyr
50 55 60
Lys Val Ala Ala Val Ile Pro Ser Tyr Asn Glu Asp Ala Glu Ser Leu
65 70 75 80
Leu Glu Thr Leu Lys Ser Val Leu Ala Gln Thr Tyr Pro Leu Ser Glu
85 90 95
Ile Tyr Ile Val Asp Asp Gly Ser Ser Asn Thr Asp Ala Ile Gln Leu
100 105 110
Ile Glu Glu Tyr val Asn Arg Glu Val Asp Ile Xaa Arg Asn Val Ile
115 120 125
Val His Arg Ser Leu Val Asn Lys Gly Lys Arg His Ala Gln Ala Trp
130 135 140
Ala Phe Glu Arg Ser Asp Ala Asp Val Phe Leu Thr Val Asp Ser Asp
145 150 155 160
Thr Tyr Ile Tyr Pro Asn Ala Leu Glu Glu Leu Leu Lys Ser Phe Asn
165 170 175
Asp Glu Thr Val Tyr Ala Ala Thr Gly His Leu Asn Ala Arg Asn Arg
180 185 190
195/Z07
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Gln Thr Asn Leu Leu Thr Arg Leu Thr Asp Ile Arg Tyr Asp Asn Ala
195 200 205
Phe Gly Val Glu Arg Ala Ala Gln Ser Leu Thr Gly Asn Ile Leu Val
210 215 220
Xaa 5er Gly Pro Leu Ser Ile Tyr Arg Arg Glu Val Ile Ile Pro Asn
225 230 235 240
w -Leu Glu Arg Tyr Lys Asn Gln Thr Phe Leu Gly Leu Pro Val Ser Ile
245 250 255
Gly Asp Asp Arg Xaa Leu Thr Asn Tyr Ala Ile Asp Leu Gly Arg Thr
260 265 270
Val Tyr Gln Ser Thr Ala Arg Cys Asp Thr Asp Val Pro Phe Gln Leu
275 280 285
Lys Ser Tyr Leu Lys Gln Gln Asn Arg Trp Asn Lys Ser Phe Phe Arg
290 295 300
Glu Ser Ile Ile Ser Val Lys Lys ile Leu Ser Asn Pro Ile val Ala
305 310 315 320
Leu Trp Thr Ile Phe Glu Val Val Met Phe Met Met Leu Ile Val Ala
325 330 335
Ile Gly Asn Leu Leu Phe Asn Gln Ala Ile Gln Leu Asp Leu Ile Lys
340 345 350
Leu Phe Ala Phe Leu Ser Ile Ile Phe Ile Val Ala Leu Xaa Arg Asn
355 360 365
Val His Tyr Met Val Lys His Pro Ala Ser Phe Leu Leu Ser Pro Leu
370 375 380
Tyr Gly Ile Leu His Leu Phe Val Leu Gln Pro Leu Lys Leu Tyr Ser
385 390 395 400
Leu Xaa Thr Ile Lys Asn Thr Glu Trp Gly Thr Arg Lys Lys Val Thr
405 410 415
Ile Phe Lys
<210> 89
196/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
<211> 419
<212> PRT
<213> streptococcus pyogenes
<220>
<221> MISC_FEATURE
<222> (124)..(124)
<223> xaa = Ala, ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (225)..(225)
<223> xaa = Ala, Ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (280)..(280)
<223> xaa = Ala, Ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (366).:(366)
<223> xaa = Ala, ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (402)..(402)
<223> xaa = Ala, Ser or any other amino acid
<400> 89
Met Pro Ile Phe Lys Lys Thr Leu Ile Val Leu Ser Phe Ile Phe Leu
1 5 10 15
197/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Ile Ser Ile Leu Ile Tyr Leu Asn Met Tyr Leu Phe Gly Thr Ser Thr
20 25 30
Val Gly Ile Tyr Gly Val Ile Leu Ile Thr Tyr Leu Val Ile Lys Leu
35 40 45
Gly Leu Ser Phe Leu Tyr Glu Pro Phe Lys Gly Asn Pro His Asp Tyr
50 55 60
Lys Val Ala Ala Val Ile Pro Ser Tyr Asn Glu Asp Ala Glu Ser Leu
65 70 75 80
Leu Glu Thr Leu Lys Ser Val Leu Ala Gln Thr Tyr Pro Leu Ser Glu
85 90 ~ 95
Ile Tyr Ile Val Asp Asp Gly Ser Ser Asn Thr Asp Ala Ile Gln Leu
loo l05 llo
Ile Glu Glu Tyr Val Asn Arg Glu Val Asp Ile Xaa Arg Asn Val Ile
115 120 125
Val His Arg Ser Leu Val Asn Lys Gly Lys Arg His Ala Gln Ala Trp
130 135 140
Ala Phe Glu Arg Ser Asp Ala Asp Val Phe Leu Thr Val Asp Ser Asp
145 150 155 160
Thr Tyr Ile Tyr Pro Asn Ala Leu Glu Glu Leu Leu Lys Ser Phe Asn
165 170 175
Asp Glu Thr Val Tyr Ala Ala Thr Gly His Leu Asn Ala Arg Asn Arg
180 185 190
Gln Thr Asn Leu Leu Thr Arg Leu Thr Asp Ile Arg Tyr Asp Asn Ala
195 200 205
Phe Gly Val Glu Arg Ala Ala Gln Ser Leu Thr Gly Asn Ile Leu Val
210 215 220
Xaa Ser Gly Pro Leu Ser Ile Tyr Arg Arg Glu Val Ile Ile Pro Asn
225 230 235 240
Leu Glu Arg Tyr Lys Asn Gln Thr Phe Leu Gly Leu Pro Val Ser Ile
245 250 255
Gly Asp Asp Arg Cys Leu Thr Asn Tyr Ala Ile Asp Leu Gly Arg Thr
260 265 270
198/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Val Tyr Gln Ser Thr Ala Arg Xaa Asp Thr Asp Val Pro Phe Gln Leu
275 280 285
Lys Ser Tyr Leu Lys Gln Gln Asn Arg Trp Asn Lys Ser Phe Phe Arg
290 295 300
Glu Ser Ile Ile Ser Val Lys Lys Ile Leu Ser Asn Pro Ile Val Ala
305 310 315 320
Leu Trp Thr Ile Phe Glu Val Val Met Phe Met Met Leu Ile Val Ala
325 330 335
Ile Gly Asn Leu Leu Phe Asn Gln Ala Ile Gln Leu Asp Leu Ile Lys
340 345 350
Leu Phe Ala Phe Leu Ser Ile Ile Phe ile Val Ala Leu Xaa Arg Asn
355 360 365
Val His Tyr Met Val Lys His Pro Ala Ser Phe Leu Leu Ser Pro Leu
370 375 380
Tyr Gly Ile Leu His Leu Phe Val Leu Gln Pro Leu Lys Leu Tyr Ser
385 390 395 400
Leu Xaa Thr Ile Lys Asn Thr Glu Trp Gly Thr Arg Lys Lys Val Thr
405 410 415
Ile Phe Lys
<210> 90
<211> 419
<212> PRT
<213> Streptococcus pyogenes
Q20>
<221> MISC_FEATURE
<222> (124)..(124)
<223> xaa = Ala, Ser or any other amino acid
<220>
<221> MISC_FEATURE
199/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
<222> (261):.(261)
<223> xaa = Ala, Ser or any other amino acid
<Z20>
<221> MISC_FEATURE
<222> (280)..(280)
<223> xaa = Ala, Ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (366)..(366)
<223> xaa = Ala, Ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (402)..(402)
<223> xaa = Ala, Ser or any other amino acid
<400> 90
Met Pro Ile Phe Lys Lys Thr Leu Ile Val Leu Ser Phe Ile Phe Leu
1 5 10 15
Ile Ser Ile Leu Ile Tyr Leu Asn Met Tyr Leu Phe Gly Thr Ser Thr
20 25 30
Val Gly Ile Tyr Gly val Ile Leu Ile Thr Tyr Leu Val Ile Lys Leu
35 40 45
Gly Leu Ser Phe Leu Tyr Glu Pro Phe Lys Gly Asn Pro His Asp Tyr
50 55 60
65s val Ala Ala vaJ ~10e Pro ser Tyr Asn ~5u Asp Ala Glu ser 8e0u
Leu Glu Thr Leu Lys Ser Val Leu Ala Gln Thr Tyr Pro Leu Ser Glu
85 90 95
Ile Tyr Ile Val Asp Asp Gly Ser Ser Asn Thr Asp Ala Ile Gln Leu
100 105 110
200/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Ile Glu Glu Tyr Val Asn Arg Glu Val Asp Ile Xaa Arg Asn Val Ile
115 120 125
Val His Arg Ser Leu Val Asn Lys Gly Lys Arg His Ala Gln Ala Trp
130 135 140
Ala Phe Glu Arg Ser Asp Ala Asp Val Phe Leu Thr Val Asp Ser Asp
145 150 155 160
Thr Tyr Ile Tyr Pro Asn Ala Leu Glu Glu Leu Leu Lys Ser Phe Asn
165 170 175
Asp Glu Thr Val Tyr Ala Ala Thr Gly His Leu Asn Ala Arg Asn Arg
180 185 190
Gln Thr Asn Leu Leu Thr Arg Leu Thr Asp Ile Arg Tyr Asp Asn Ala
195 200 205
Phe Gly Val Glu Arg Ala Ala Gln Ser Leu Thr Gly Asn Ile Leu Val
210 215 220
Cys Ser Gly Pro Leu Ser Ile Tyr Arg Arg Glu Val Ile Ile Pro Asn
225 230 235 240
Leu Glu Arg Tyr Lys Asn Gln Thr Phe Leu Gly Leu Pro Val Ser Ile
245 250 255
Gly Asp Asp Arg Xaa Leu Thr Asn Tyr Ala Ile Asp Leu Gly Arg Thr
260 265 270
Val Tyr Gln Ser Thr Ala Arg Xaa Asp Thr Asp Val Pro Phe Gln Leu
275 280 285
Lys Ser Tyr Leu Lys Gln Gln Asn Arg Trp Asn Lys Ser Phe Phe Arg
290 295 300
Glu Ser Ile Ile Ser Val Lys Lys Ile Leu Ser Asn Pro Ile Val Ala
305 310 315 320
Leu Trp Thr Ile Phe Glu Val Val Met Phe Met Met Leu Ile Val Ala
325 330 335
Ile Gly Asn Leu Leu Phe Asn Gln Ala Ile Gln Leu Asp Leu Ile Lys
340 345 350
Leu Phe Ala Phe Leu Ser Ile Ile Phe Ile Val Ala Leu Xaa Arg Asn
355 360 365
201/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Val His Tyr Met Val Lys His Pro Ala Ser Phe Leu Leu Ser Pro Leu
370 375 380
Tyr Gly Ile Leu His Leu Phe Val Leu Gln Pro Leu Lys Leu Tyr Ser
385 390 395 400
Leu Xaa Thr Ile Lys Asn Thr Glu Trp Gly Thr Arg Lys Lys Val Thr
405 410 415
Ile Phe Lys
<210> 91
<211> 419
<212> PRT
<213> streptococcus pyogenes
<220>
<221> MISC_FEATURE
<222> (225)..(225)
<223> xaa = Ala, Ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (261)..(261)
<223> xaa = Ala, Ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (280)..(280)
<223> xaa = Ala, Ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (366)..(366)
202/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
<223> Xaa = Ala, Ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (402)..(402)
<223> xaa = Ala, Ser or any other amino acid
<400> 91
Met Pro Ile Phe Lys Lys Thr Leu Ile Val Leu Ser Phe Ile Phe Leu
1 5 10 15
Ile Ser Ile Leu Ile Tyr Leu Asn Met Tyr Leu Phe Gly Thr Ser Thr
20 25 30
Val Gly Ile Tyr Gly Val Ile Leu Ile Thr Tyr Leu Val Ile Lys Leu
35 40 45
Gly Leu Ser Phe Leu Tyr Glu Pro Phe Lys Gly Asn Pro His Asp Tyr
50 55 60
Lys Val Ala Ala Val Ile Pro Ser Tyr Asn Glu Asp Ala Glu Ser Leu
65 70 75 80
Leu Glu Thr Leu Lys Ser Val Leu Ala Gln Thr Tyr Pro Leu Ser Glu
85 90 95
Ile Tyr Ile Val Asp Asp Gly Ser Ser Asn Thr Asp Ala Ile Gln Leu
100 105 110
Ile Glu Glu Tyr Val Asn Arg Glu Val Asp Ile Cys Arg Asn Val Ile
115 120 125
Val His Arg Ser Leu Val Asn Lys Gly Lys Arg His Ala Gln Ala Trp
130 135 140
Ala Phe Glu Arg Ser Asp Ala Asp Val Phe Leu Thr Val Asp Ser Asp
145 150 155 160
Thr Tyr Ile Tyr Pro Asn Ala Leu Glu Glu Leu Leu Lys Ser Phe Asn
165 170 175
Asp Glu Thr Val Tyr Ala Ala Thr Gly His Leu Asn Ala Arg Asn Arg
180 185 190
203/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Gln Thr Asn Leu Leu Thr Arg Leu Thr Asp Ile Arg Tyr Asp Asn Ala
195 200 205
Phe Gly Val Glu Arg Ala Ala Gln Ser Leu Thr Gly Asn Ile Leu Val
210 215 220
Xaa Ser Gly Pro Leu Ser Ile Tyr Arg Arg Glu Val Ile Ile Pro Asn
225 230 235 240
Leu Glu Arg Tyr Lys Asn Gln Thr Phe Leu Gly Leu Pro Val Ser Ile
245 250 255
Gly Asp Asp Arg Xaa Leu Thr Asn Tyr Ala Ile Asp Leu Gly Arg Thr
260 265 270
Val Tyr Gln .Ser Thr Ala Arg Xaa Asp Thr Asp Val Pro Phe Gln Leu
275 280 285
Lys Ser Tyr Leu Lys Gln Gln Asn Arg Trp Asn Lys Ser Phe Phe Arg
290 295 300
Glu Ser Ile Ile Ser Val Lys Lys Ile Leu Ser Asn Pro Ile Val Ala
305 310 315 320
Leu Trp Thr Ile Phe Glu Val Val Met Phe Met Met Leu Ile Val~ Ala
325 330 335
Ile Gly Asn Leu Leu Phe Asn Gln Ala Ile Gln Leu Asp Leu Ile Lys
340 345 350
Leu Phe Ala Phe Leu Ser Ile Ile Phe Ile Val Ala Leu Xaa Arg Asn
355 360 365
Val His Tyr Met Val Lys His Pro Ala Ser Phe Leu Leu Ser Pro Leu
370 375 380
Tyr Gly Ile Leu His Leu Phe Val Leu Gln Pro Leu Lys Leu Tyr Ser
385 390 395 400
Leu Xaa Thr Ile Lys Asn Thr Glu Trp Gly Thr Arg Lys Lys Val Thr
405 410 415
Ile Phe Lys
<210> 92
<211> 419
204/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
<212> PRT
<213> streptococcus pyogenes
<220>
<221> MISC_FEATURE
<222> (124)..(124)
<223> xaa = Ala, 5er or any other amino acid
<220>
<221> MISC_FEATURE
<2Z2> (225)..(225)
<223> xaa = Ala, ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (261)..(261)
<223> xaa = Ala, ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (280)..(280)
<223> xaa = Ala, ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (366)..(366)
<223> xaa = Ala, ser or any other amino acid
<220>
<221> MISC_FEATURE
<222> (402)..(402)
<223> xaa = Ala, ser or any other amino acid
205/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
<400> 92
Met Pro Ile Phe Lys Lys Thr Leu Ile Val Leu Ser Phe Ile Phe Leu
1 5 10 15
Ile Ser Ile Leu Ile Tyr Leu Asn Met Tyr Leu Phe Gly Thr Ser Thr
20 25 30
Val Gly Ile Tyr Gly Val Ile Leu Ile Thr Tyr Leu Val Ile Lys Leu
35 40 45
Gly Leu Ser Phe Leu Tyr Glu Pro Phe Lys Gly Asn Pro His Asp Tyr
50 55 60
Lys Val Ala Ala Val Ile Pro Ser Tyr Asn Glu Asp Ala Glu Ser Leu
65 70 75 80
Leu Glu Thr Leu Lys Ser Val Leu Ala Gln Thr Tyr Pro Leu Ser Glu
85 90 95
Ile Tyr Ile Val Asp Asp Gly Ser Ser Asn Thr Asp Ala Ile Gln Leu
100 105 110
Ile Glu Glu Tyr Val Asn Arg Glu Val Asp Ile Xaa Arg Asn Val Ile
115 120 125
Val His Arg Ser Leu Val Asn Lys Gly Lys Arg His Ala Gln Ala Trp
130 135 140
Ala Phe Glu Arg Ser Asp Ala Asp Val Phe Leu Thr Val Asp Ser Asp
145 150 155 160
Thr Tyr Ile Tyr Pro Asn Ala Leu Glu Glu Leu Leu Lys Ser Phe Asn
165 170 175
Asp Glu Thr Val Tyr Ala Ala Thr Gly His Leu Asn Ala Arg Asn Arg
180 185 190
Gln Thr Asn Leu Leu Thr Arg Leu Thr Asp Ile Arg Tyr Asp Asn Ala
195 200 205
Phe Gly Val Glu Arg Ala Ala Gln Ser Leu Thr Gly Asn Ile Leu Val
210 215 ZZO
Xaa Ser Gly Pro Leu Ser Ile Tyr Arg Arg Glu Val Ile Ile Pro Asn
225 230 235 240
206/207
CA 02469566 2004-06-02
WO 03/048330 PCT/US02/38596
Leu Glu Arg Tyr Lys Asn Gln Thr Phe Leu Gly Leu Pro Val Ser Ile
245 250 255
Gly Asp Asp Arg Xaa Leu Thr Asn Tyr Ala Ile Asp Leu Gly Arg Thr
260 265 270
Val Tyr Gln Ser Thr Ala Arg Xaa Asp Thr Asp Val Pro Phe Gln Leu
275 280 285
Lys Ser Tyr Leu Lys Gln Gln Asn Arg Trp Asn Lys Ser Phe Phe Arg
290 295 300
Glu Ser Ile Ile Ser Val Lys Lys Ile Leu Ser Asn Pro Ile Val Ala
305 310 315 320
Leu Trp Thr Ile Phe Glu Va1 Val Met Phe Met Met Leu Ile Val Ala
325 330 335
Ile Gly Asn Leu Leu Phe Asn Gln Ala Ile Gln Leu Asp Leu Ile Lys
340 345 350
Leu Phe Ala Phe Leu Ser Ile Ile Phe Ile Val Ala Leu Xaa Arg Asn
355 360 365
Val His Tyr Met Val Lys.His Pro Ala Ser Phe Leu Leu Ser Pro Leu
370 375 380
Tyr Gly Ile Leu His Leu Phe Val Leu Gln Pro Leu Lys Leu Tyr Ser
385 390 395 400
Leu Xaa Thr Ile Lys Asn Thr Glu Trp Gly Thr Arg Lys Lys Val Thr
405 410 415
Ile Phe Lys
207/207
