Note: Descriptions are shown in the official language in which they were submitted.
CA 02472970 2004-07-22
1
New detection format for hot start real time Polymerase
Chain Reaction
Technical field
The present invention relates to the field of real time
PCR. More particular, the present invention provides a
new method for real time PCR, characterized
amplification of a target DNA is monitored by means of
hybridization with an appropriately labeled fluorescent
hybridization probe in combination with a specific
chemistry providing a hot start PCR effect.
Prior art background
Amplification of DNA by polymerase chain reaction (PCR)
is a technique fundamental to molecular biology.
Nucleic acid analysis by PCR requires sample
preparation, amplification, and product analysis.
Although these steps are usually performed sequentially,
amplification and analysis can occur simultaneously.
DNA dyes or fluorescent probes can be added to the PCR
mixture before amplification and used to analyze PCR
products during amplification. Sample analysis occurs
concurrently with amplification in the same tube within
the same instrument. This combined approach decreases
sample handling, saves time, and greatly reduces the
risk of product contamination for subsequent reactions,
as there is no need to remove the samples from their
closed containers for further analysis. The concept of
combining amplification with product analysis has
become known as "real time" PCR. See, for example, U.S.
Patent No. 6,174,670.
CA 02472970 2011-10-25
2
Real Time PCR detection formats
In kinetic real time PCR, the formation of PCR products
is monitored in each cycle of the PCR. The
amplification is usually measured in thermocyclers
which have additional devices for measuring
fluorescence signals during the amplification reaction.
a) DNA binding dye formate
Since the amount of double stranded amplification
product usually exceeds the amount of nucleic acid
originally present in the sample to be analyzed,
double-stranded DNA specific dyes may be used, which
upon excitation with an appropriate wavelength show
enhanced fluorescence only if they are bound to double-
stranded DNA. Preferably, only those dyes may be used
which like SybrGreenl I, for example, do not affect the
efficiency of the PCR reaction.
All other fomates known in the art require the design
of a fluorescent labeled Hybridization Probe which only
emits fluorescence upon binding to its target nucleic
20. acid.
b) Molecular Beacons
These hybridization probes are also labeled with a
first component and with a quencher, the labels
preferably being located at both ends of the probe. As
a result of the secondary structure of the probe, both
components are in spatial vicinity in solution. After
hybridization to the target nucleic acids both
components are separated from one another such that
after excitation with light of a suitable wavelength
the fluorescence emission of the first component can be
measured (US 5,118,801).
*Trade-mark
CA 02472970 2004-07-22
3
c) FRET hybridization probes
The FRET Hybridization Probe test format is especially
useful for all kinds of homogenous hybridization assays
(Matthews, J.A., and Kricka, L.J., Analytical
Biochemistry 169 (1988) 1-25). It is characterized by
two single-stranded hybridization probes which are used
simultaneously and are complementary to adjacent sites
of the same strand of the amplified target nucleic acid.
Both probes are labeled with different fluorescent
components. When excited with light of a suitable
wavelength, a first component transfers the absorbed
energy to the second component according to the
principle of fluorescence resonance energy transfer
such that a fluorescence emission of the second
component can be measured when both hybridization
probes bind to adjacent positions of the target
molecule to be detected. Alternatively to monitoring
the increase in fluorescence of the FRET acceptor
component, it is also possible to monitor fluorescence
decrease of the FRET donor component as a quantitative
measurement of hybridization event.
In particular, the FRET Hybridization Probe format may
be used in real time PCR, in order to detect the
amplified target DNA. Among all detection formats known
in the art of real time PCR, the FRET-Hybridization
Probe format has been proven to be highly sensitive,
exact and reliable (WO 97/46707; WO 97/46712; WO
97/46714). As an alternative to the usage of two FRET
hybridization probes, it is also possible to use a
fluorescent-labeled primer and only one labeled
oligonucleotide probe (Bernard, P.S., et al.,
Analytical Biochemistry 255 (1998) 101-107). In this
regard, it may be chosen arbitrarily, whether the
primer is labeled with the FRET donor or the FRET
acceptor compound.
CA 02472970 2004-07-22
4
d) Single Label Probe (SLP) Format
This detection format consists of a single
oligonucleotide labeled with a single fluorescent dye
at either the 51- or 31-end (WO 02/14555). Two
different designs can be used for oligo labeling: G-
Quenching Probes and Nitroindole-Dequenching probes. In
the G-Quenching embodiment, the fluorescent dye is
attached to a C at oligo 51- or 31-end. Fluorescence
decreases significantly when the probe is hybridized to
the target, in case two G's are located on the target
strand opposite to C and in position 1 aside of
complementary oligonucleotide probe. In the Nitroindole
Dequenching embodiment, the fluorescent dye is attached
to Nitroindole at the 5'- or 31-end of the
oligonucleotide. Nitroindole somehow decreases the
fluorescent signaling of the free probe. Fluorescence
increases when the probe is hybridized to the target
DNA due to a dequenching effect.
e) TaqMan probe
A single-stranded Hybridization Probe is labeled with
two components. When the first component is excited
with light of a suitable wavelength, the absorbed
energy is transferred to the second component, the so-
called quencher, according to the principle of
fluorescence resonance energy transfer. During the
annealing step of the PCR reaction, the hybridization
probe binds to the target DNA and is degraded by the
5'-3' exonuclease activity of the Taq Polymerase during
the subsequent elongation phase. As a result the
excited fluorescent component and the quencher are
spatially separated from one another and thus a
fluorescence emission of the first component can be
measured. TagMan probe assays are disclosed in detail
in US 5,210,015, US 5,538,848, and US 5,487,972. TaqMan
CA 02472970 2004-07-22
hybridization probes and reagent mixtures are disclosed
in US 5,804,375.
f) Releasing formats
Moreover, two other formats restricted to allele
5 specific detection have been disclosed recently which
are based on the principle of specific detection of a
release of a labeled 3' terminal nucleotide due to a
match or mismatch situation regarding its binding to
the target nucleic acid. US 6,391,551 discloses a
method, characterized in that the 3' terminal
nucleotide of a hybridization probe is released by a
depolymerizing enzyme in case a perfect match between
target sequence and probe has occurred. Similarily, EP
0 930 370 suggest to use a primer labeled with a
reporter and a Qunecher moiety, characterized in that a
3'-5' proofreading activity removes one moiety in case
no perfect match between primer and amplification
target has occurred.
PCR Enzymology
In vitro nucleic acid synthesis is routinely performed
with DNA polymerases with or without additional
polypeptides. DNA polymerases are a family of enzymes
involved in DNA replication and repair. Extensive
research has been conducted on the isolation of DNA
polymerases from mesophilic microorganisms such as
E.coli. See, for example, Bessman,..., et al., J. Biol.
Chem. 223 (1957) 171-177, and Buttin, G., and Kornberg,
A., J. Biol. Chem. 241 (1966) 5419-5427.
Research has also been conducted on the isolation and
purification of DNA polymerases from thermophiles, such
as Thermus aquaticus. Chien, A., et al., J. Bacteriol.
127 (1976) 1550-1557 discloses the isolation and
CA 02472970 2004-07-22
6
purification of a DNA polymerase with a temperature
optimum of 80 C from Thermus aquaticus YT1 strain.
United States Patent No. 4,889,818 discloses a purified
thermostable DNA polymerase from T. aquaticus, Taq
polymerase, having a molecular weight of about 86,000
to 90,000 daltons. In addition, European Patent
Application 0 258 017 discloses Taq polymerase as the
preferred enzyme for use in the PCR process.
Research has indicated that while Taq DNA polymerase
has a 5'-3' polymerase-dependent exonuclease function,
Taq DNA polymerase does not possess a 3'-5' exonuclease
function (Lawyer, F.C., et al., J. Biol. Chem. 264
(1989) 6427-6437; Bernad, A., et al., Cell 59 (1989)
219-228). The 3'-5' exonuclease activity of DNA
polymerases is commonly referred to as õproofreading
activity". The 3'-5' exonuclease activity removes bases
which are mismatched at the 3' end of a primer-template
duplex. The presence of 3'-5' exonuclease activity may
be advantageousas it leads to an increase in fidelity
of replication of nucleic acid strands and to the
elongation of prematurely terminated products . As Taq
DNA polymerase is not able to remove mismatched primer
ends it is prone to base incorporation errors, making
its use in certain applications undesirable. For
example, attempting to clone an amplified gene is
problematic since any one copy of the gene may contain
an error due to a random misincorporation event.
Depending on the cycle in which that error occurs (e.g.,
in an early replication cycle), the entire DNA
amplified could contain the erroneously incorporated
base, thus, giving rise to a mutated gene product.
There are several thermostable DNA polymerases known in
the art which exhibit 3'- 5'exonuclease activity, like
B-type polymerases from thermophilic Archaebacteria
which are used for high fidelity DNA amplification.
CA 02472970 2004-07-22
7
Thermostable polymerases exhibiting 3'- 5'exonuclease
activity may be isolated or cloned from Pyrococcus
(Purified thermostable Pyrococcus furiosus DNA
polymerase, Mathur E., Stratagene, WO 92/09689, US
5,545,552; Purified thermostable DNA polymerase from
Pyrococcus species, Comb D. G. et al., New England
Biolabs, Inc., EP 0 547 359; Organization and
nucleotide sequence of the DNA polymerase gene from the
archaeon Pyrococcus furiosus, Uemori, T., et al.,
Nucleic Acids Res. 21 (1993) 259-265), from Pyrodictium
spec. (Thermostable nucleic acid polymerase, Gelfand D.
H., F. Hoffmann-La Roche AG, EP 0 624 641; Purified
thermostable nucleic acid polymerase and DNA coding
sequences from Pyrodictium species, Gelfand D. H.,
Hoffmann-La Roche Inc., US 5,491,086), from
Thermococcus (e.g. Thermostable DNA polymerase from
Thermococcus spec. TY, Niehaus F., et al. WO 97/35988;
Purified Thermocccus barossii DNA polymerase, Luhm R.
A., Pharmacia Biotech, Inc., WO 96/22389; DNA
polymerase from Thermococcus barossii with intermediate
exonuclease activity and better long term stability at
high temperature, useful for DNA sequencing, PCR etc.,
Dhennezel O. B., Pharmacia Biotech Inc., WO 96/22389; A
purified thermostable DNA polymerase from Thermococcus
litoralis for use in DNA manipulations, Comb D. G., New
England Biolabs, Inc., US 5,322,785, EP 0 455 430;
Recombinant thermostable DNA polymerase from
Archaebacteria, Comb D. G., New England Biolabs, Inc.,
US 5, 352, 778, EP 0 547 920, EP 0 701 000; New isolated
thermostable DNA polymerase obtained from Thermococcus
gorgonarius, Angerer B. et al. Boehringer Mannheim GmbH,
WO 98/14590.
One possibility to set up a PCR reaction with high
processivity and additional proofreading activity are
mixtures of Taq Polymerases and fairly trhermostable
template dependent exonucleases. In this context, EP-A-
CA 02472970 2004-07-22
8
1088891 discloses a thermostable enzyme obtainable from
Archaeoglobus fulgidus, which catalyzes the degradation
of mismatched ends of primers or polynucleotides in the
3' to 5' direction in double stranded DNA. The gene
encoding the thermostable exonuclease III obtainable
from Archaeoglobus fulgidus (Afu) was cloned, expressed
in E.coli and isolated. The enzyme is active under the
incubation and temperature conditions used in PCR
reactions. The enzyme supports DNA polymerases like Taq
in performing DNA synthesis at low error rates and
synthesis of products of more than 3 kb on genomic DNA
- the upper range of products synthesized by Taq
polymerase - in good yields with or without dUTP
present in the reaction mixture. Preferably, 50-500 ng
of the exonuclease III obtainable from Afu were used
per 2,5 U of Taq polymerase in order to have an optimal
PCR performance. More preferably is the use of 67 ng to
380 ng of the exonuclease III obtainable from Afu per
2,5 U of the Taq polymerase in the PCR reaction.
Hot start PCR
Another major problem with nucleic acid amplification
and more especially with PCR is the generation of
unspecific amplification products. In many cases, this
is due to an unspecific oligonucleotide priming and
subsequent primer extension event prior to the actual
thermocycling procedure itself, since thermostable DNA
polymerases are also moderately active at ambient
temperature. For example, amplification products due to
eventually by chance occuring primer dimerisation and
subsequent extension are observed frequently. In order
to overcome this problem, it is well known in the art
to perform a so called "hot start" PCR, wherein one
component essential for the amplification reaction is
either separated from the reaction mixture or kept in
an inactive state until the temperature of the reaction
CA 02472970 2004-07-22
9
mixture is being raised for the first time. Since the
polymerase cannot function under these conditions,
there is no primer elongation during the period when
the primers can bind non specifically. In order to
achieve this effect, several methods have been applied:
a) Physical separation of the DNA polymeraseThe
physical separation can be obtained for example by
a barrier of solid wax, which separates the
compartment containing the DNA polymerase from the
compartment containing the bulk of the other
reagents. During the first heating step the wax is
then melting automatically and the fluid
compartments are mixed (Chou, Q., et al., Nucleic
Acids Res. 20 (1992) 1717-1723). Alternatively,
the DNA polymerase is affinity immobilized on a
solid support prior to the amplification reaction
and only released into the reaction mixture by a
heat mediated release (Nilsson, J., et al.,
Biotechniques 22 (1997) 744-751). Both methods,
however are time consuming and unconvenient to
perform.
b) Chemical modification of DNA polymerase
For this type of hot start PCR, the DNA polymerase
is reversibly inactivated as a result of a
chemical modification. More precisely, heat labile
blocking groups are introduced into the Taq DNA
polymerase which render the enzyme inactive at
room temperature. These blocking groups are
removed at high temperature during a pre-PCR step
such that the enzyme is becoming activated. Such a
heat labile modification, for example can be
obtained by coupling Citraconic Anhydride or
Aconitric Anhydride to the Lysine residues of the
enzyme (US 5,677,152). Enzymes carrying such
CA 02472970 2004-07-22
modifications are meanwhile commercially
availabile as Amplitaq Gold (Moretti, T., et al.,
Biotechniques 25 (1998) 716-722) or FastStart DNA
polymerase (Roche Molecular Biochemicals) . However,
5 the introduction of blocking groups is a chemical
reaction which arbitrarily occurs on all
sterically available Lysine residues of the enzyme.
Therefore, the reproducibility and quality of
chemically modified enzyme preparations may vary
10 and can hardly be controlled.
c) DNA polymerase inhibition by nucleic acid
additives
Extension of non-specifically annealed primers has
been shown to be inhibited by the addition of
short doublestranded DNA fragments (Kainz, P., et
al., Biotechniques 28 (2000) 278-282). In this
case, primer extension is inhibited at
temperatures below the melting point of the short
double stranded DNA fragment, but independent from
the sequence of the competitor DNA itself. However,
it is not known, to which extent the excess of
competitor DNA influences the yield of the nucleic
acid amplification reaction. Alternatively,
oligonucleotide Aptamers with a specific sequence
resulting in a defined secondary structure may be
used. Such Aptamers have been selected using the
SELEX Technology for a very high affinity to the
DNA polymerase (US 5,693,502), (Lin, Y., and
Jayasena, S.D., J. Mol. Biol. 271 (1997) 100-111).
The presence of such Aptamers within the
amplification mixture prior to the actual
thermocycling process itself again results in a
high affinity binding to the DNA polymerase and
consequently a heat labile inhibition of its
activity. Due to the selection process, however,
CA 02472970 2004-07-22
11
all so far available Aptamers can only be used in
combination with one particular species of DNA
polymerase.
d) Taq DNA antibodies
An alternative approach to achieve heat labile
inhibition of Taq DNA polymerase is the addition
of monoclonal antibodies raised against the
purified enzyme (Kellogg, D.E., et al.,
Biotechniques 16 (1994) 1134-1137; Sharkey, D.J.,
et al., Biotechnology (N Y) 12 (1994) 506-509).
Like the oligonucleotide Aptamers, the antibody
binds to Taq DNA polymerase with high affinity at
ambient temperatures in an inhibitory manner. The
complex is resolved in a preheating step prior to
the thermocycling process itself. This leads to a
substantial time consuming prolongation of the
amplification as a whole, especially if protocols
for rapid thermocycling are applied (WO 97/46706).
US 5,985,619 discloses a specific embodiment for
performing PCR using a hot start antibody, wherein
besides Taq polymerase, e. g. Exonuclease III from
E. coli is added as a supplement to the
amplification mixture in order to digest
unspecific primer dimer intermediates. As
disclosed above, Exonucleasae III recognizes
doublestranded DNA as a substrate, like, for
example, target/primer- or target/primer extension
product hybrids. Digestion is taking place by
means of cleavage of the phosphodiester bond at
the 5' end of the 3' terminal deoxynucleotide
residue. Since this type of exonuclease is active
at ambient temperatures, all unspecifically
annealed primers and primer extension products
therefore are digested. This results in some
embodiments in an even enhanced specifity of the
CA 02472970 2004-07-22
12
amplification reaction. Yet, digestion of the
unspecific primers dependent on the duration of
the preincubation time may lead to a substantial
and uncontrolled decrease in primer concentration,
which in turn may affect the amplification
reaction itself.
e) Usage of Exonucleases
Another alternative for increasing amplification
efficiency is the use of phosphorothioate
oligonucleotide primers in combination with an
exonuclease III in the PCR reaction mixes (EP 0
744 470). In this case, a 3' exonuclease, which
usually accepts double stranded as well as single
stranded DNA substrates, degrades duplex artefacts
such as primer dimers as well as carry over
amplicons, while leaving the single stranded
amplification primers undegraded. In this context,
it has also been suggested to use 3' bound
phopshate groups which are removed upon double
strand formation as a means for prevention of non
template dependent primer elongation (EP 0 439
182). Similarily, the usage of primers with abasic
modified 3' ends and template dependent removal by
E.coli Endonuclease IV has been suggested (US
5,792,607). However, there exist several major
draw backs of these methods:
First, oligonucleotides containing
phosphorothioate residues can not be synthesized
in a stereoisomerically pure manner. Moreover,
their hybridisation temperatures are different as
compared to unmodified oligonucleotides of the
same sequence and unspecific hybridization events
are observed frequently. Second, primers
containing phosphorothioate residues even at their
CA 02472970 2004-07-22
13
3' ends can still be elongated by the DNA
polymerase, which is already present in the
reaction mixture. In other words, the effect of
the exonuclease is at least partially compensated
by the presence of the polymerase itself. Third,
the enzymatic acitivity of E.coli Endonuclease IV
is very low in the presence of Mg++ ions (Siwek,
B., et al., Nucleic Acids Res. 16 (1988) 5031-
5038). Yet, dependent on the specific type of
assay, an exact significant Mg++ concentration is
an essentiall prerequisite for a successful PCR
amplification reaction, which renders application
of an endonuclease IV in a PCR sample quite
ineffective. Fourth and most important,
conventional nucleases like E.coli Exonuclease III
or E. coli Endonuclease IV are thermolabile and
therefore only active prior to the thermocycling
procedure itself. As a consequence, unspecific
primer binding and extension is only inhibited
prior but not during the temperature cycling
process.
A further improvement of the exonuclease concept
for hot start applications is disclosed in EP-A-1
277 841, which allows for an inhibition of
unspecific priming and primer extension not only
prior to the amplification process itself but also
during the thermocycling process. In this regard,
EP-A-277 841 discloses a composition for
performing a nucleic acid amplification reaction
comprising a thermostable DNA-Polymerase, a
thermostable 3'-5' Exonuclease, and at least one
primer for nucleic acid amplification with a
modified 3' terminal residue which is not
elongated by said thermostable DNA-Polymerase.In
this context, the thermostable 3' - 5' Exonuclease
is more active at temperatures between 37 C and
CA 02472970 2004-07-22
14
72 C and less active at temperatures below 37 C.
The thermostable Exonuclease may either be an
Exonuclease III homologue or a mutated DNA-
Polymerase with no or reduced Polymerase activity.
The concept disclosed in EP-A-1 277 841 is
primarily based on the possibility to prevent
primer elogation at low temperatures by
introducing chemical modifications at the 3' end
of at least one primer. In order to make the
primer accessible at typical PCR elongation
temperatures, the concept includes the use of a
thermostable exonuclease which is inactive at
ambient temperatures or below thus leaving the
modified primer at these temperatures unaffected.
Upon temperature increase, the exonuclease becomes
active and capable of removing the 3' modification
of the primer thus enabeling the primer to
participate in the amplification reaction itself.
According to the concept, the exonuclease activity
is a 3'-5' exonuclease which especially recognizes
such template-primer hybrids as substrates. This
is the case for E. coli exonuclease III and
homologues from other organisms, which recognize
double stranded DNA with a 5' overhang as a
preferred substrate and are especially capable of
digesting the recessed 3' end of the substrate in
31-5' direction.
In view of the prior art discussed above, it was
an object of the invention to provide an
alternative economical method for real time PCR
which facilitates a hot start protocol and at the
same time allows for real time detection. In other
words, it was an object of the present invention
to develop an improved real time PCR method which
does not require additional hot start additives.
CA 02472970 2004-07-22
Brief description of the invention
The principle underlying the present invention is
schematically depicted in Fig. 1 and 2.
In a first aspect, the invention is directed to a
5 method for amplifying and detecting a target nucleic
comprising
- subjecting said target nucleic acid to a real
time PCR amplification reaction in the
presence of
10 - a thermostable DNA Polymerase
- a thermostable double strand dependent 3'-
5' exonuclease
- a pair of amplification primers
- Deoxynucleosidetriiphosphates,
15 - a detecting oligonucleotide carrying a
first label and a second label ,
- said first label being capable of acting
as a fluorescent reporter entity when
excited with light of an appropriate
wavelength,
- said second label being capable of
acting as a fluorescence quenching
entity of said fluorescent reporter
entity
CA 02472970 2004-07-22
16
characterized in that one label is bound to
the 3' end of said detecting oligonucleotide,
and
further characterized in that the other label
is bound either internally or at the 5' end
to said detecting oligonucleotide.
- monitoring fluorescence of said fluorerescent
reporter entity at least after a plurality of
amplification cycles.
In one major embodiment, the reporting entity is at the
3' end of said detecting oligonucleotide. In an
alternative major embodiment, the quencher entity is at
the 3' end of said detecting oligonucleotide.
The detecting oligonucleotide is either a hybridization
probe or, alternativeley, is identical to one member of
said pair of amplification primers.
Preferably, the label bound to the 3' terminal
nucleotide residue of said detecting oligonucleotide is
linked to said oligonucleotide via a phosphate group.
Also preferably, the second label is linked to a base
of one residue of said detecting oligonucleotide.
Alternatively, the second label may be linked to an
abasic element of said detecting oligonucleotide.
The double strand dependent 3'-5' exonuclease is
preferably selected from a group of enzymes, siaid
group consisiting of exonuclease III, endonuclease IV,
DNA polymerases exhibiting 3 5"exonuclease activity or
other enzymes with 3'-5" exonuclease or proofreading
activity from eucarya, prokarya, archaea,
bacteriophages or viruses.
CA 02472970 2011-10-25
16a
It is provided a method for amplifying and detecting a
target nucleic acid comprising:
subjecting the target nucleic acid to a real time
PCR amplification reaction in the presence of:
- a thermostable DNA Polymerase,
- a thermostable double strand dependent
thermostable 31-5' exonuclease,
- a pair of amplification primers,
- Deoxynucleoside-Tri-Phosphates, and
- a detecting oligonucleotide comprising a first
label and a second label , and being a hybridization
probe,
the first label being capable of acting as a
fluorescent reporter entity when excited with
light of an appropriate wavelength,
- the second label being capable of acting as a
fluorescence quenching entity of said
fluorescent reporter entity,
characterized in that one label is bound to the 3'
end of said detecting oligonucleotide, and
further characterized in that the other label is
bound either internally or at the 5' end to the
detecting oligonucleotide; and
monitoring fluorescence of the fluorerescent reporter
entity at least after a plurality of amplification cycles,
wherein a fluorescence signal is created by means of removing
a 3'-label from said hybridization probe during each cycle of
amplification by the thermostable exonuclease.
CA 02472970 2004-07-22
17
In a second aspect, the present invention is directed
to a composition or reagent mixture for amplifying and
detecting a target nucleic acid comprising
- a thermostable DNA polymerase
- a thermostable double strand dependent 3'-5'
exonuclease
- a detecting oligonucleotide carrying a first
label and a second label
said first label being capable of acting
as a fluorescent reporter entity when
excited with light of an appropriate
wavelength,
- said second label being capable of
acting as a fluorescence quenching
entity of said fluorescent reporter
entity
characterized in that one label is bound to
the 3' end of said detecting oligonucleotide,
and
further characterized in that the other label
is bound either internally or at the 5' end
to said detecting oligonucleotide.
The detecting oligonucleotide is either a hybridization
probe or alternatively may serve as an amplification
primer.
In a third aspect, the present invention is directed to
a kit for amplifying and detecting a target nucleic
acid sequence comprising
CA 02472970 2004-07-22
18
- a thermostable DNA Polymerase
- a thermostable double strand dependent 3'-5'
exonuclease
- a pair of amplification primers, wherein one
of said amplification primers serves as a
detecting oligonucleotide, said detecting
oligonucleotide carrying a first label and a
second label ,
- said first label being capable of acting
as a fluorescent reporter entity when
excited with light of an appropriate
wavelength,
- said second label being capable of
acting as a fluorescence quenching
entity of said fluorescent reporter
entity
characterized in that one label is bound to
the 3' end of said detecting oligonucleotide,
and
further characterized in that the other label
is bound eihter internally or at the 5' end
to said detecting oligonucleotide.
Detailed description of the invention
As already outlined above, the present invention is
directed to a method of perfroming real time PCR. It
relates to a method for homogenous detection and
analysis of nucleic acid sequences by means of using
labeled oligonucleotides whose fluorescence changes in
response to probe-target hybridization. This invention
CA 02472970 2004-07-22
19
also relates to degradation of 3ends of
oligonucleotides hybridized to a DNA template, and a
method for quantification of specific sequences in
real-time nucleic acid amplification. Predominantly the
invention is characterized in that a detecting
oligonucleotide carries a fluorescent quenching entity
and a fluorescent reporting entity. Similar to the
TaqMan detection format, a fluorescent signal is
created by means of removing a 3' fluorescent entity
from said detecting oligonucleotide during each cycle
of amplification.
More precisely, the present invention is directed to a
method for amplifying and detecting a target nucleic
comprising
- subjecting said target nucleic acid to a real
time PCR amplification reaction in the
presence of
- a thermostable DNA Polymerase
- a thermostable double strand dependent 3'-
5' exonuclease
- a pair of amplification primers
- Deoxynucleosidetriphosphates,
- a detecting oligonucleotide carrying a
first label and a second label ,
- said first label being capable of acting
as a fluorescent reporter entity when
excited with light of an appropriate
wavelength,
CA 02472970 2004-07-22
said second label being capable of
acting as a fluorescence quenching
entity of said fluorescent reporter
entity
5 characterized in that one label is bound to
the 3' end of said detecting oligonucleotide,
and
further characterized in that the other label
is bound either internally or at the 5' end
10 to said detecting oligonucleotide.
- monitoring fluorescence of said fluorerescent
reporter entity at least after a plurality of
amplification cycles.
Prior to the thermocycling itself, only basal or
15 substantially no fluorescent signalling occurs due to
the quenching of the fluorescent reporter entity by the
fluorescence quenching entity. Upon increase in
temperature, the thermostable exonuclease becomes
active and starts to remove the 3' terminal label
20 provided that the detecting oligonucleotide is bound to
a target molecule. As a consequence, fluorescent
signalling changes during each amplification cycle due
to an increase in the concentration of the amplified
target DNA.
The thermostable polymerase may be any kind of DNA
dependent or RNA dependent DNA polymerase, preferably
Taq Polymerase from Thermus aquaticus. In a specific
embodiment, a mixture of thermostable polymerases is
used, wherein one polymerase Taq polymerase is
providing high processivity and a second enzyme is
providing a 3'-5' proofreading activity (e.g. ROCHE
Cat. No.1732641).
CA 02472970 2004-07-22
21
In the context of this invention, the term
"thermostable" is defined as an enzyme which retains
more than 50 %, preferably more than 80% and most
preferably more than 90% of its activity after 60
minutes of incubation at 70 C.
In the context of the present invention, the term
double strand dependent thermostable 31-5'
exonuclease" is defined as a nuclease which recognizes
the 3' terminal recessive end of a double stranded DNA
as a substrate and is capable of cleaving directly
upstream (5') of the terminal phosphate group at the 3'
recessive end. It is also noted that in the context of
the present invention, such exonucleases are clearly
disciminated from DNA polymerases possessing an
additional 3'-5' proofreading activity.
The method according to the invention is also
applicable for any oligonucleotide labeled at its 3'
independent from the linkage between the fluorescent
compound and the oligonucleotide itself, Nevertheless
it is highly preferred if the label bound to the 3'
terminal nucleotide residue of said detecting
oligonucleotide is linked to said oligonucleotide via a
phosphate group, because such a linkage facilitates a
cleavage by the respective exonuclease. In case other
linkers without a phosphate group are used, cleavage
most probably occurs at the phosphate bonding between
the terminal and the proxyterminal nucleotide residue.
Preferably, the thermostable 3' - 5' Exonuclease is
more active at temperatures between 37 C and 72 C and
less active at temperatures below 37 C. In other words,
the enzymatic activity of the enzyme at any temperature
below 37 C is in any case lower as compared to the
enzymatic activity at any temperature between 37 C and
CA 02472970 2004-07-22
22
72 C. The temperature optimum for the enzyme
consequently may be in the range between 50 C and 85 C.
The thermostable exonuclease is preferably an
exonuclease III homologue which may be originated from
any thermostable organism. In the context of this
invention, an exonuclease III homologue is defined as
an enzyme which recognizes double stranded DNA with a
5' overhang as a substrate and is capable of removing
nucleotide residues from the 3' recesssed end. A
thermostable exonuclease III homologue from
Archaeoglobus fulgidus (Afu ExoIII) has been disclosed
recently (EP-A-1088891), which is especially suitable
for hot start protocols according to the invention. The
advantage of the use of the enzyme in comparison with
other enzymes is that
- the enzyme is clearly preferably active on double
stranded DNA, and
- is highly active at temperatures between 37 C and
72"C but has a low activity at temperatures between
20 C and 37 C.
Alternatively, the thermostable 3' -5' exonuclease may
be a mutated DNA polymerase with no or substantially
reduced polymerase activity but sufficiently high 3'-
exonuclease-activity. Reduced DNA polymerase activity
in this context means less than 50% of said activity of
an enzyme exhibiting DNA polymerase activity. Also
alternativily, Endonuclease IV may be used for a mehtod
according to the invention.
Two major emodiments of the invention need to be
discriminated:
CA 02472970 2004-07-22
23
In the first major embodiment, the detecting
oligonucleotide probe is simultanously serving as a
primer for nucleic acid amplification. The advantage is
that a respective assay requires only two different
oligonucleotides: a first daual labeled amplification
primer and a second amplification primer hybridizing to
the target DNA downstream of the first primer in
opposite orientation. No further hybridization probe is
required. More imortant, a primer labeled at its 3' end
with a fluorescent entity cannot be elongated unless
the label is removed by the thermostable exonuclease.
Thus a hot start effect is achieved.
The disadvantage is that since the probe acts as primer,
the second label must be attached to the
oligonucleotide in such a way that PCR is not
negatively influenced. Therefore the second label is
preferably attached to a nucleobase at a position which
does not influence hybridization.
Moreover, the labeling of said first primer has to be
in such a way that it may serve as a template for DNA
synthesis during the second and all subsequent cycles
of amplification. Thus, an internal labeling using
abasic linkers is not possible for this embodiment.
In this context, it is also an object of the invention
to use a dual labeled primer for allelspecific PCR.
Discrimination between different alleles may be
achieved by a 3' labeled discriminitaing 3' terminal
nucleotide residue which is complementary to a first
target sequence variant but does not perform base
pairing with another sequence variant. As a consequence,
the 3'terminal label is only removed in case the primer
hybridizes to said first target sequences but not upon
hybridization to another target sequence. In other
words: allelle specific amplification can occur.
CA 02472970 2004-07-22
24
In the second major embodiment, the detecting
oligonucleotide is a hybridization probe for real time
PCR monitoring which itself does not participate in the
amplification process by means of priming a DNA
polymerization reaction. In this case, almost any kind
of labeling is possible and, even more important, a
higher degree of specificity is achieved. The
disadvantage is that for a respective assay, at least 2
amplification primers and an additional dual labeled
hybidization probe are required. Thus, the complexity
of such an assay is increased.
In order to obtain an appropriate hot start effect, at
least one or both amplification primers may be modified
with a 3' terminal phosphate group or another
modification which upon temperature increease is
cleaved of by the thermostable exonuclease.
Furthermore, for this embodiment it has been proven to
be advantageous if the hybridization probe is being
prevented from an undesired extension by the
thermostable DNA Polymerase during PCR. This can be
obtained in two different ways:
i) If the 3' terminal label is attached to the
hybridization probe via a phosphate group, the 3'-
terminal nucleotide may be a so called "polymerase
stopper", i. e. a nucleotide derivative or any
other structure replacing a nucleotide residue
which cannot be elongated by a DNA polymerase
reaction. A list of putative polymerase stoppers
includes base analogs, modified internucleosidic
linkages and sugar analogs. Such a modification
allows still cleavage of the 31label, but after
cleavage the polymerase can not recognize the
generated õmodified" 3 end.
CA 02472970 2004-07-22
ii) In case the 3' terminal label is attached to the
hybridization probe via a linker that does not
contain a phosphate group, the 3' proxiterminal
residue is the preferred position for a
5 "polymerase stopper".
In addition, "polymerase stoppers" as disclosed above
may also prevent the detecting oligonucleotide from
being completely degraded by the activity of the
thermostable double strand dependent 3'-5' exonuclease.
10 Upon usage of a an internal "polymerase stopper" allele
specific detection with a 3' labeled, discriminating 3'
terminal residue may be achieved. In this case, a dual
labeled oligonucleotide according to the invention in
addition contains a derivatized nucleotide residue
15 between the internal label and the 3'labeled 3'
terminal residue, said derivatized nucleotide being
incapable of being elongated by the thermostable DNA
polymerase. If the 3' terminal discriminating
nucleotide residue is matched with the target DNA,
20 allele independent amplification and subsequent allele
specific signal generation occurs due to removal of the
label by the exonulcease. When the 3' terminal
discriminating nucleotide residue is NOT matched with
the target DNA, allele independent amplification occurs,
25 but exonucleolytic removal of the 3' discriminating
nucleotide carrying the fluorescent label is not
possible and consequently, no detection signal is being
generated.
As explained above, the detecting oligonucleotide
according to the invention is carrying a first label
and a second label. The first label is capable of
acting as a fluorescent reporter entity when excited
with light of an appropriate wavelength, and the said
second label being capable of acting as a fluorescence
CA 02472970 2004-07-22
26
quenching entity of said fluorescent reporter entity.
In principle, it can be chosen abritrarily which of
either the fluorescent reporter entity or the
fluorescence quenching entity is bound to the 3' end of
the detecting oligonucleotide and which of either of
these entities is bound either internally or at the 5'
end of said detecting ologonucleotide. A person skilled
in the art will make his choice in this regard
according to the availabiliy of fluorescent labeling
reagents for any of the indicated alternatives.
Synthesis of 3' terminal modified oligonucleotide
primers can be done by any method known in the art.
Fluorescent dyes can be introduced by using a special
type of commercially available controlled pore glass
particles as a starter matrix for oligonucleotide
synthesis. Fluorescein, for example, is disclosed in
EP-A-1 186 613.
In principle, the second label can be introduced at the
5' end of the detecting oligonucleotide by methods
known in the art. For example, appropriate Fluorophore-
Phosphoramidites may be coupled to the oligonucleotide
at the end of a conventional oligonucleotide synthesis.
Preferably, however, the second label is attached
internally to the oligonucleotide to provide for a
close spacial vicinity between the fluorescent reporter
entity and the fluorescence quenching entity as long as
the 3' terminal label hasn't been removed.
In a first embodiment, said second internal label is
linked to a base of one residue of said detecting
oligonucleotide. An internal label can be attached at
the 5 position of an internal dU (Glenn Research,
Fluorescein dTlO-1056-xx). Alternatively, base labeling
CA 02472970 2004-07-22
27
may be done according to European application No.
03007844.8 (filed 5.4.03).
In a second embodiment, which is mutually exclusive to
said first embodiment, said second label is linked to
an appropriate abasic element (linker) of said
detecting oligonucleotide. In this case, the abasic
element is desgned in such a way that the neighbouring
nucleotide residues can base pair to two complementary
nucleotide residues in the target nucleic acid, which
by themselves are separated from each other by 1
additional nucleotide residue. Examples are disclosed
in
WO 97/43451.
In a third emodiment which is also mutually exclusive
to said first and said second embodiment, the label is
attached to the backbone of the nucleotide chain for
example by means of an appropriate Phosphthioate.
In general, any kind of Fluorescence Resonance Energy
Transfer (FRET) system known in the art, which consists
of a couple of a FRET donor and a FRET acceptor, can be
used for providing an appropriate first label and an
appropriateand an appropriate second label according to
the invention. Similar if not identical to the TaqMan
detection format, it is always the FRET donor compound
which is excited with light of an appropriate
wavelength and detected in an appropriate detection
channel. For the purpose of this invention, the FRET
donor is termed "fluorescent reporter entity."
Consequently, the FRET acceptor compound for the
purpose of this invention is called "fluorescence
quenching entity". Summarizing, fluorescent reporter
entities and fluorescence quenching entities which may
be used for the present invention are well known by
persons skilled in the art. All standard TaqMan
CA 02472970 2004-07-22
28
reporter dyes such as FAM (detected at 530 nm) and HEX
or VIC (detected at 560 nm) can be used. Two other
specific examples are the combination Fluorescein
(Reporter) and LC-Red640 (Roche Applied
Science)(Quencher) or Fluorescein (Reporter) and Dabcyl
(Molecular Probes) (Quencher) In a further specific
embodiment, Black hole Quenchers (Biosearch
Technologies) or even Nitroindole (which is known to be
a quenching compound) may be used in combination with a
variety of different reporter entities.
The present invention is also directed to compositions,
kits and oligonucleotides which are sepcifically
designed to perform a method according to the invention.
Thus, the preseent invention is first of all directed
to composition or reagent mixture for amplifying and
detecting a target nucleic acid comprising
- a thermostable DNA polymerase
- a thermostable double strand dependent 3'-5'
exonuclease having a temperature optimum
above 3 7 C
- a detecting oligonucleotide carrying a first
label and a second label ,
said first label being capable of acting
as a fluorescent reporter entity when
excited with light of an appropriate
wavelength,
said second label being capable of
acting as a fluorescence quenching
entity of said fluorescent reporter
entity
CA 02472970 2004-07-22
29
characterized in that one label is bound to
the 3' end of said detecting oligonucleotide,
and
further characterized in that the other label
is bound either internally or at the 5' end
to said detecting oligonucleotide.
When a sample potentially containing a target DNA to
become detected is exposed to such a composition and an
approriate thermocycling protocol is performed,
amplification of the respective target DNA may become
monitored in real time for example in a LightCycler
instrument.
Within the composition, the detecting oligonucleotide
may either be a hyridization probe or alternatively,
the detecting oligonucleotide serves as an
amplification primer.
The present invention is also directed to kits which
can be used directly to provide a composition according
to the invention and perform an assay according to the
invention.
Such a kit according to the invention suitable for
amplifying and detecting a target nucleic acid sequence
comprises
- a thermostable DNA Polymerase
- a thermostable double strand dependent 3'-5'
Exonuclease having a temperature optimum
above 3 7 C
- a pair of amplification primers
CA 02472970 2004-07-22
- an oligonucleotide hybridization probe
carrying a first label and a second label ,
- said first label being capable of acting
as a fluorescent reporter entity when
5 excited with light of an appropriate
wavelength,
said second label being capable of
acting as a fluorescence quenching
entity of said fluorescent reporter
10 entity
characterized in that one label is bound to
the 3' end of said detecting oligonucleotide
hybridization probe, and
further characterized in that the other label
15 is bound either internally or at the 5' end
to said detecting oligonucleotide
hybridization probe.
Alternatively, such a kit for amplifying and detecting
a target nucleic acid sequence comprises
20 - a thermostable DNA Polymerase
- a thermostable double strand dependent 3'-5'
Exonuclease having a temperature optimum
above 3 7 C
- a pair of amplification primers, wherein one
25 of said amplification primers serves as a
detecting oligonucleotide, said detecting
oligonucleotide carrying a first label and a
second label ,
CA 02472970 2004-07-22
31
- said first label being capable of acting
as a fluorescent reporter entity when
excited with light of an appropriate
wavelength,
- said second label being capable of
acting as a fluorescence quenching
entity of said fluorescent reporter
entity
characterized in that one label is bound to
the 3' end of said detecting oligonucleotide,
and
further characterized in that the other label
is bound eihter internally or at the 5' end
to said detecting oligonucleotide.
The kit may already comprise a composition containing
a) a thermostable DNA-Polymerase
b) a thermostable 3'-5' Exonuclease
c) at least one detecting oligonucleotide for nucleic
acid amplification with a modified 3' terminal
residue which is not elongated by said thermostable
DNA-Polymerase.
Alternatively, a kit according to the invention may
comprise separate storage vessels for a thermostable
DNA-Polymerase, a thermostable 31-5' Exonuclease, and
at least one detecting oligonucleotide for nucleic acid
amplification with a modified 3' terminal residue which
is not elongated by said thermostable DNA-Polymerase.
It is also within the scope of the invention, if two of
CA 02472970 2004-07-22
32
the three components mentioned above are kept within
one storage vessel.
In addition , these kits may comprise additional
buffers or reagents suitable for nucleic acid
amplification reactions such as deoxynucleoside
triphosphates. The kits may also contain reagents for
detection of the amplification products like
amplification primers and/or oligonucleotide
hybridization probes.
In a still further aspect, the present invention is
directed to a detecting oligonucleotide carrying a
first label and a second label ,
- said first label being capable of acting
as a fluorescent reporter entity when
excited with light of an appropriate
wavelength,
said second label being capable of
acting as a fluorescence quenching
entity of said fluorescent reporter
entity
characterized in that one label is bound to
the 3' end of said detecting oligonucleotide,
and
further characterized in that the other label
is bound internally to said detecting
oligonucleotide.
To the best knowledge of the inventors, such detecting
oligonucleotides haven't been disclosed so far for any
DNA based analytical assay such as real time PCR .
CA 02472970 2004-07-22
33
The following examples, references, sequence listing
and figures are provided to aid the understanding of
the present invention, the true scope of which is set
forth in the appended claims. It is understood that
modifications can be made in the procedures set forth
without departing from the spirit of the invention.
Description of the Figures
Figure 1
Schematic drawing of a real time hot start PCR reaction
method according to the invention, characterized in
that the detecting oligonucleotide is a hybridization
probe.
Figure 2
Schematic drawing of a real time hot start PCR reaction
method according to the invention, characterized in
that the detecting oligonucleotide is a hybridization
probe.
Figure 3
Real time monitoring of a decrease in LCRed 640 FRET
signal as disclosed in examplel. The primer carried an
internal R640 label and a 3' terminal Fluorescein label.
The terminal label was removed by exonuclease III after
hybridization of the primer.
Figure 4
Real time monitoring of an increase in fluorescence of
Fluorescein as disclosed in example 1. The primer
carries an internal R640 label and a 3' terminal
Fluorescein label. The terminal label is released by
CA 02472970 2004-07-22
34
exonuclease III upon hybridization of the primer
leading to a change in flourescent signal.
Figure 5
Gel stain of amplification products obtained in example
1.
1. PCR reaction in the absence of exonuclease III
2. in the presence of 33 ng
3. in the presence of 20 ng
4. in the presence of 12.5 ng
5. in the presence of 5 ng of exonuclease III
6. Molecular weight Marker V from Roche Applied Science,
Cat. No. 821705
Figure 6
Real Time PCR reaction as disclosed in example 2.
"Primer 300.1 + 500rev + ProbeHPQ15: detection of
product formation with a probe carrying an internal
Fluorescein and a quencher molecule at the 3'end.
"Primer 300.1 + ProbeHPQl5": detection of product
formation with the help of a primer carrying an
internal Fluorescein and a quencher molecule at the
3"end.
CA 02472970 2004-07-22
Examples
Example 1
For this Real time PCR experiment, using the FRET
process, a dual labeled primer according to the
5 invention was desgned which carried an internal LC-
Red640 label (Roche Applied Science Cat. No. 2 015 161)
and a 3' terminal Fluorescein label (Roche Applied
Science Cat. No. 3 138 178) . The terminal label was
removed by exonuclease III after hybridization of the
10 primer which resulted in a decrease in LCRed640
signalling and at the same time in an increase in
Fluorescein fluorescence.
Primers were as follows:
Seq. Id No.1:
15 "i3Actin5.2fd": GGATTCCTATGTGGGCGACG
Seq. Id.No. 2:
"JActinHP25": CCTGGGTCATCTTCT**(Red
640)CGCGG*U*TpFluos-3'
T**(Red640)=T-LCRed640 (Amino-modified T-
20 Phosphoramidate was introduced during oligonucleotide
synthesis. Subsequently, the reactive amino group was
reacted with LC-Red640 NHS ester)
U*:= 2'-O-Methyl-U
G*= 2'-O-Methyl-G
25 p= phosphate
CA 02472970 2004-07-22
36
Fluos= Fluorescein
Synthesis and labeling of the oligonucleotides were
performed according to standard protocols known in the
art.
PCR reactions were setup with 2 Al LightCycler
FastStart Reaction Mix Hybridization Probes (Roche
Applied Science Cat.No. 3003248), 30 ng of human
genomic DNA (Roche Applied Science Cat.No. 1691112), 3
MM MgC12, 500 nM Primer seqences No. AActin5.2fd, 400 nM
Primer Seq.No. SActinHP25 and 2.5 units of Taq
polymerase without A. fulgidus exonuclease III and with
addition of decreasing amounts of A. fulgidus
exonuclease III, 33 ng, 20 ng, 12.5 ng and 5 ng per
reaction. The final reaction volume of 20 l was
adjusted with destilled water. The PCR reactions were
performed on a LightCycler (Roche Applied Science
Cat.No. 2011468) programed according to the
instructions of the manufacturer's user manual. PCR
conditions were as follows:
1 cycle
60 sec 95 C
45 cycles
0 sec 95 C
10 sec 60 C
15 sec 72 C
CA 02472970 2004-07-22
37
Results are shown in Figures. 3, 4, and 5. As can be
seen in Fig. 3, the LCRed640 signal monitored in
Channel F2 decreased with increasing cycle number. The
effect was dose dependent with respect to the amount of
A. fulgidus exonuclease III in the reaction mixture. In
the absence of exonuclease III no decrease in LC-red640
fluorescence was observed.
The Fluorescence emission of Fluorescein was monitored
in Channel Fl. As can be seen in Fig. 4, the signal
increased with increasing cycle number. The effect was
dose dependent witrh respect to the amount of A.
fulgidus exonuclease III in the reaction mixture. In
the absence of exonuclease III no increase in
Fluorescein signaling was observed.
After completion of the LightCycler analysis the PCR
products were analyzed on a 3% ROCHE Agarose MS gel
stained with Ethidiumbromide. The result are shown in
Fig.5. Only in the presence of A. fulgidus exonuclease
III the expected PCR product of 214 bp could be
detected (lanes 2-5).
Example 2
In another real time PCR experiment, the reaction was
monitored with an oligonucleotide probe carrying an
internal Fluorescein and Dabcyl as a 3" terminal
quencher compound. After hybridization of the
oligonucleotide the terminal quencher was removed by
exonuclease III which resulted in a dequenching of the
fluorescein signal. The reporter groups awere either
located on an oligonucleotide used either as a probe
(Reaction 1, "Primer 300.1 + 500rev + ProbeHPQ15") or,
alternatively as a primer (Reaction 2, "Primer 300.1 +
ProbeHPQ15").
CA 02472970 2004-07-22
38
Primer and probe sequences were as follows:
SEQ ID NO: 3
"Primer JSAct300.1" CACCCCGTGCTGCTGACCGAp
p= phosphate
SEQ. ID. No: 4
"s-Act 500 rev" AGGGAGGCGGCCACCAGAAGp
p=phosphate
SEQ. ID. No: 5
"f3ActinHPQ15" CCTGGGTCATCTTCT**(Fluos)CGCGGTTpZ
p=phosphate
Z=Dabcyl
T**(Fluos)= T-Fluorescein, incorporated during
oligonucleotide synthesis as T-Fluorescein-
Phosphoramidite.
PCR reactions were setup with 2 l LightCycler
FastStart Reaction Mix Hybridization Probes (Roche
Applied Science Cat.No. 3003248), 30 ng of human
genomic DNA (Roche Applied Science Cat.No. 1691112), 3
MM MgC12, 2.5 units of Taq polymerase, 33 ng of A.
fulgidus exonuclease III. Reaction No 1 contained 500
nM of Primer Seq 300.1, 500 nM of Primer 500 rev and
500nM of Probe Sequ. No HPQ15. Reaction No. 2 contained
500 nM of Primer 300.1 and 500 nM of 13Actin HPQ15. The
final reaction volume of 20 l was adjusted with
destilled water. The PCR reactions werde performed on a
CA 02472970 2004-07-22
39
LightCycler (Roche Applied Science Cat.No. 2011468)
programed according to the instructions of the
manufacturer's user manual. PCR conditions were as
follows:
1 cycle
60 sec 95 C
45 cycles
0 sec 95 C
sec 65 C
10 sec 72 C
5
The real time PCR reactions were monitored in Channel
F1 and an increase in signal was observed with
increasing PCR product formation. As it is shown in
Figure 6, both, use of a double labeled probe according
10 to the invention (Reaction 1, "Primer 300.1 + 500rev +
ProbeHPQ15") as well as use of a double labeled primer
according to the invention (Reaction 2, "Primer 300.1 +
ProbeHPQ15) resulted insuccessful amplification
signaling.
CA 02472970 2004-07-22
List of References
Bernad, A., et al., Cell 59 (1989) 219-228
Bernard, P.S., et al., Analytical Biochemistry 255
(1998) 101-107
5 Bessman, M.J., et al., J. Biol. Chem. 223 (1957) 171-
177
Buttin, G., and Kornberg, A., J. Biol. Chem. 241 (1966)
5419-5427
Chien, A., et al., J. Bacteriol. 127 (1976) 1550-1557
10 Chou, Q., et al., Nucleic Acids Res. 20 (1992) 1717-
1723
EP 0 258 017
EP 0 3 007 844.8
EP 0 439 182
15 EP 0 455 430
EP 0 547 359
EP 0 547 920
EP 0 624 641
EP 0 701 000
20 EP 0 744 470
EP 0 930 370
EP-A-1 088 891
EP-A-1 186 613
EP-A-1 277 841
25 EP-A-277.841
Kainz, P., et al., Biotechniques 28 (2000) 278-282
Kellogg, D.E., et al., Biotechniques 16 (1994) 1134-
1137
Lawyer, F.C., et al., J. Biol. Chem. 264 (1989) 6427-
30 6437
Lin, Y., and Jayasena, S.D., J. Mol. Biol. 271 (1997)
100-111
Matthews, J.A., and Kricka, L.J., Analytical
Biochemistry 169 (1988) 1-25
35 Moretti, T., et al., Biotechniques 25 (1998) 716-722
Nilsson, J., et al., Biotechniques 22 (1997) 744-751
CA 02472970 2004-07-22
41
Sharkey, D.J., et al., Biotechnology 12 (1994) 506-509
Siwek, B., et al., Nucleic Acids Res. 16 (1988) 5031-
5038
Uemori, T., et al., Nucleic Acids Res. 21 (1993) 259-
265
US 4,889,818
US 5,118,801
US 5,210,015
US 5,322,785
US 5,352,778
US 5,487,972
US 5,491,086
US 5,538,848
US 5,545,552
US 5,677,152
US 5,693,502
US 5,792,607
US 5,804,375
US 5,985,619
US 6,391,551
WO 02/14555
WO 92/09689
WO 96/22389
WO 97/35988
WO 97/43451
WO 97/46706
WO 97/46707
WO 97/46712
WO 97/46714
WO 98/14590
CA 02472970 2004-07-22
41a
SEQUENCE LISTING
(1) GENERAL INFORMATION:
(i) APPLICANT: F. Hoffmann-La Roche AG
(ii) TITLE OF INVENTION: New detection format for hot start real time
Polymerase Chain
Reaction
(iii) NUMBER OF SEQUENCES: 5
(iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: OGILVY RENAULT
(B) STREET: 1981 McGill College Avenue - Suite 1600
(C) CITY: Montreal
(D) STATE: QC
(E) COUNTRY: CANADA
(F) ZIP: H3A 2Y3
(v) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Diskette
(B) COMPUTER: IBM Compatible
(c) OPERATING SYSTEM: DOS
(D) SOFTWARE: Patentln version 3.2
(vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER:
(B) FILING DATE:
(vii) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER: EP 03 016 669.8
(B) FILING DATE: 2003-08-01
(viii) ATTORNEY / AGENT INFORMATION:
(A) NAME: Christian Cawthorn
(B) REGISTRATION NUMBER: 11005
(C) REFERENCE / DOCKET NUMBER: 3580-953CA CC/gc
(ix) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: 514-847-4256
(B) TELEFAX: 514-288-8389
(C) TELEX:
(2) INFORMATION FOR SEQ ID NO: 1:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20
(B) TYPE: nucleic acid
(C) STRANDEDNESS: Single
(D) TOPOLOGY: Linear
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Artificial
CA 02472970 2004-07-22
4lb
(ix) FEATURE:
(D) OTHER INFORMATION: primer
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1:
ggattcctat gtgggcgacg 20
(2) INFORMATION FOR SEQ ID NO: 2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 22
(B) TYPE: nucleic acid
(C) STRANDEDNESS: Single
(D) TOPOLOGY: Linear
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Artificial
(ix) FEATURE:
(D) OTHER INFORMATION: primer
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2:
cctgggtcat cttctcgcgg tt 22
(2) INFORMATION FOR SEQ ID NO: 3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20
(B) TYPE: nucleic acid
(C) STRANDEDNESS: Single
(D) TOPOLOGY: Linear
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Artificial
(ix) FEATURE:
(D) OTHER INFORMATION: primer
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 3:
caccccgtgc tgctgaccga 20
(2) INFORMATION FOR SEQ ID NO: 4:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20
(B) TYPE: nucleic acid
(C) STRANDEDNESS: Single
(D) TOPOLOGY: Linear
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Artificial
(ix) FEATURE:
(D) OTHER INFORMATION: primer
4
CA 02472970 2004-07-22
41c
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 4:
agggaggcgg ccaccagaag 20
(2) INFORMATION FOR SEQ ID NO: 5:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 22
(B) TYPE: nucleic acid
(C) STRANDEDNESS: Single
(D) TOPOLOGY: Linear
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Artificial
(ix) FEATURE:
(D) OTHER INFORMATION: primer
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 5:
cctgggtcat cttctcgcgg tt 22
