Note: Descriptions are shown in the official language in which they were submitted.
CA 02473707 2004-07-16
WO 03/061365 PCT/US03/01694
A NUCLEIC ACID ENCODING A G-PROTEIN-COUPLED RECEPTOR AND USES
THEREOF
FIELD OF THE INVENTION
The present invention relates generally to a novel nucleic acid molecule that
encodes for GAVE6, a
heretofore unknown G-protein-coupled receptor, along with uses of the nucleic
acid molecule and
GAVE6.
BACKGROUND OF THE INVENTION
The G protein-coupled receptors (GPCRs) are a large family of integral
membrane proteins that are
involved in cellular signal transduction. GPCRs respond to a variety of
extracellular signals,
including neurotransmitters, hormones, odorants and light, and are capable of
transducing signals so
as to initiate a second messenger response within the cell. Many therapeutic
drugs target GPCRs
because those receptors mediate a wide variety, of physiological responses,
including inflammation,
vasodilation, heart rate, bronchodilation, endocrine secretion and
peristalsis.
GPCRs are characterized by extracellular domains, seven transmembrane domains
and intracellular
domains. Some of the functions the receptors perform, such as binding ligands
and interacting with G
proteins, are related to the presence of certain amino acids in critical
positions. For example, a variety
of studies have shown that differences in amino acid sequence in GPCRs account
for differences in
affinity to either a natural ligand or a small molecule agonist or antagonist.
In other words, minor
differences in sequence can account for different binding affinities and
activities. (See, for example,
Meng et al., J Bio Chem (1996) 271(50):32016-20; Burd et al., J Bio Chem
(1998) 273(51):34488-95;
and Hurley et al., J Neurochem (1999) 72(1):413-21). In particular, studies
have shown that amino
acid sequence differences in the third intracellular domain can result in
different activities. Myburgh
et al. found that alanine 261 of intracellular loop 3 of gonadotropin
releasing hormone receptor is
crucial for G protein coupling and receptor internalization (Biochem J (1998)
331(Part 3):893-6).
Wonerow et al. studied the thyrotropin receptor and demonstrated that
deletions in the third
intracellular loop resulted in constitutive receptor activity (J Bio Chem
(1998)273(14):7900-5).
In general, the action of the binding of an endogenous ligand to a receptor
results in a change in the
conformation of the intracellular domains) of the receptor allowing for
coupling between the
intracellular domains) and an intracellular component, a G-protein. Several G
proteins exist, such as
Gq, GS, G;, GZ and Go (see, e.g. Dessauer et al., Clin Sci (Colch) (1996)
91(5):527-37). The IC-3 loop
as well as the carboxy terminus of the receptor interact with the G proteins
(Pauwels et al., Mol
Neurobiol (1998) 17(1-3):109-135 and Wonerow et. al., supra). Some GPCRs are
"promiscuous" with
CA 02473707 2004-07-16
WO 03/061365 PCT/US03/01694
respect to G proteins, i.e., a GPCR can interact with more than one G protein
(see, e.g., I~enakin, Life
Sciences (19SS) 43:1095).
Ligand activated GPCR coupling with G protein begins a signaling cascade
process (referred to as
"signal transduction"). Such signal transduction ultimately results in
cellular activation or cellular
inhibition.
GPCRs exist in the cell membrane in equilibrium between two different
conformations: an "inactive"
and an "active" state. A receptor in an inactive state is unable to link to
the intracellular signaling
transduction pathway to produce a biological response (exceptions exist, such
as during over-
expression of receptor in transduced cells, see e.g.,
www.crei~hton.edu/Pharmacolo~y/inverse htm ).
Modulation of the conformation to the active state allows linkage to the
transduction pathway (via the
G protein) and produces a biological response. Agonists bind and make the
active conformation much
more likely. However, sometimes, if there is already a considerable response
in the absence of any
agonist, such receptors are said to be constitutively active (i.e., already in
an active conformation or
ligand independent or autonomous active state). When agonists are added to
such systems, an
enhanced response routinely is observed. However, when a classical antagonist
is added, binding by
such molecules produces no effect. On the other hand, some antagonists cause
an inhibition of the
constitutive activity of the receptor, suggesting that the latter class of
drugs technically are not
antagonists but are agonists with negative intrinsic activity. Those drugs are
called inverse agonists,
www.crei~hton.edu/PharmacoloQy/inverse.htm.).
Traditional study of receptors has proceeded from the assumption that the
endogenous ligand first be
identified before discovery could move forward to identify antagonists and
other receptor effector
molecules. Even where antagonists might have been discovered first, the
dogmatic response was to
identify the endogenous ligand (WO 00/22131). However, as the active state is
the most useful for
assay screening purposes, obtaining such constitutive receptors, especially
GPCRs, would allow for
the facile isolation of agonists, partial, agonists, inverse agonists and
antagonists in the absence of
information concerning endogenous ligands. Moreover, in diseases that result
from disorders of
receptor activity, drugs that cause inhibition of constitutive activity, or
more specifically, reduce the
effective activated receptor concentration, could be discovered more readily
by assays using receptors
in the autonomous active state. For example, as receptors that may be
transfected into patients to treat
disease, the activity of such receptors may be fine-tuned with inverse
agonists discovered by such
assays.
CA 02473707 2004-07-16
WO 03/061365 PCT/US03/01694
Diseases such as asthma, chronic obstructive pulmonary disease (COPD) and
rheumatoid arthritis
(RA) generally are considered to have an inflammatory etiology involving T
helper cells,
monocyte-macrophages and eosinophils. Current anti-inflammatory therapy with
corticosteroids is
effective in asthma but is associated with metabolic and endocrine side
effects. The same is possibly
true for inhaled formulations that can be absorbed through lung or nasal
mucosa. Satisfactory oral
therapies for RA or COPD currently are lacking.
Eosinophils mediate much of the airway dysfunction in allergy and asthma.
Interleukin-5 (II,-5) is an
eosinophil growth and activating cytokine. Studies have shown IL-5 to be
necessary for tissue
eosinophilia and for eosinophil-mediated tissue damage resulting in airway
hyperresponsiveness
(Chang et al., J Allergy Clin Immunol (1996) 98(5 pt 1):922-931 and Duez et
al., Am J Respir Crit
Care Med (2000) 161(1):200-206). IL-5 is made by T-helper-2 cells (Th2)
following allergen (e.g.
house dust mite antigen) exposure in atopic asthma.
RA is believed to result from accumulation of activated macrophages in the
affected synovium,
Interferon y (lFN~y) is a T_helper-1 (Thl) cell-derived cytokine with numerous
proinflammato'ry
properties. It is the most potent macrophage activating cytokine and induces
MHC class II gene
transcription contributing to a dendritic cell-like phenotype.
~0 Lipopolysaccharide (LPS) is a component of gram-negative bacterial cell
walls that elicits
inflammatory responses, including tumor necrosis factor a (TNFa) release. The
efficacy of
intravenous anti-Z'NFa therapy in RA has been demonstrated in the clinic. COPD
is thought also to
result from macrophage accumulation in the lung, the macrophages produce
neutrophil
chemoattractants (e.g., II,-8: de Boer et al., J Pathol (2000) 190(5):619-
626). Both macrophages and
neutropliils release cathepsins that cause degradation of the alveolar wall.
It is believed that lung
epithelium can be an important source for inflammatory cell chemoattractants
and other inflammatory
cell-activating agents (see, for example, Thomas et al., J Virol (2000)
74(18):8425-8433; Lamkhioued
et al., Am J Respir Crit Care Med (2000) 162(2 Pt. 1):723-732; and Sekiya et
al., J Immunol (2000)
165(4):2205-2213).
Given the role GPCRs have in disease and the ability to treat diseases by
modulating the activity of
GPCRs, identification and characterization of previously unlrnown GPCRs can
provide for the
development of new compositions and methods for treating disease states that
involve the activity of a
GPCR. Accordingly, what is needed is the discovery, isolation and
characterization of novel and
useful nucleic acid molecules that encode for heretofore unknown GPCRs. .
CA 02473707 2004-07-16
WO 03/061365 PCT/US03/01694
What is also needed are assays that utilize such heretofore unknown GPCRs to
identify molecules that
can serve potential agonists or antagonists of particular GPCRS. These
molecules may readily have
applications as therapeutic agents for modulating the activity of GPCRs in
vivo, and thus, treat a
plethora of diseases related to GPCR activity.
The citation of any reference herein should not be construed as an admission
that such reference is
available as "Prior Art" to the instant application.
SUMMARY OF THE INVENTION
The instant invention identifies and characterizes the expression of a novel
constitutively active
GPCR, GAVE6, and provides compositions and methods for applying the discovery
to the
identification and treatment of related diseases.
Thus broadly, the present invention extends to an isolated nucleic acid
molecule comprising a ANA
sequence of Figure 1 (SEQ )D NO:1), a variant thereof, a fragment thereof, or
an analog or a
derivative thereof. Such a variant of the present invention may be an allelic
variant, a degenerate
variant, or an allelic variant that results. in a degenerate change in the
sequence.
Moreover, the present invention extends to an isolated nucleic acid molecule
hybridizable to the
isolated nucleic acid molecule of SEQ 1D NO:1, or a variant thereof, under
stringent hybridization
conditions. Yet further, the present invention extends to an isolated nucleic
acid molecule
hybridizable to a nucleic acid molecule that is complementary to the DNA
sequence of SEQ ID NO: l
under stringent hybridization conditions. Stringent hybridization conditions
are described infra.
Furthermore, the present invention extends to an isolated nucleic acid
molecule comprising a DNA
sequence that encodes a polypeptide comprising an amino acid sequence of SEQ
ID N0:2.
Optionally, an isolated nucleic acid molecule of the present invention as
described above may be
detectably labeled. Examples of detectable labels having applications herein
include, but certainly are
not limited to an enzyme, a radioactive isotope, or a chemical which
fluoresces. Particular examples of
detectable labels are described infra.
Particular polypeptides are also encompassed within the present 'invention.
For example, the present
invention. extends to a purified polypeptide comprising the amino acid
sequence of SEQ lZ7 N0:2, a
CA 02473707 2004-07-16
WO 03/061365 PCT/US03/01694
conservative variant thereof, or an analog or derivative thereof. Optionally,
a polypeptide of the
present invention may be detectably labeled.
In addition, the present invention extends to antibodies wherein a polypeptide
of the present invention
is the immunogen used in production of the antibodies. These antibodies can be
monoclonal or
polyclonal. Moreover, the antibodies can be "chimeric" as, for example, they
may comprise protein
domains ~of antibodies raised against a purified polypeptide of the present
invention in different
species. In a particular embodiment, an antibody of the present invention may
be "humanized."
Naturally, an antibody of the present invention may be detectable labeled.
Particular examples of
detectable labels having applications herein are described infra.
The present invention further extends to an expression vector comprising a
nucleic acid molecule
comprising a DNA sequence of SEQ )D NO:1, a variant thereof, an analog or
derivative thereof, or a
fragment thereof, operatively associated with an expression control element.
Furthermore, an
expression vector of the present invention may comprise an isolated nucleic
acid molecule ,
hybridizable under stringent hybridization conditions to an isolated nucleic
acid molecule comprising
a DNA sequence of SEQ iD NO:1, operatively associated with an expression
control element, or is
hybridizable under stringent hybridization conditions to a hybridization probe
that is complementary
to an isolated nucleic acid molecule comprising a DNA sequence of SEQ >D NO:1,
wherein the
z0 hybridization probe is operatively associated with an expression control
element. A particular
example of an expression control element having applications herein is a
promoter. Examples of
particular promoters applicable to the present invention, include, but are not
limited to early promoters
of hCMV, early promoters of SV40, early promoters of adenovirus, early
promoters of vaccinia, early
promoters of polyoma, late promoters of SV40, late promoters of adenovirus,
late promoters of
vaccinia, late promoters of polyoma, the lac the trp system, the TAC system,
the TRC system, the
major operator and promoter regions of phage lambda, control regions of fd
coat protein, 3-
phosphoglycerate kinase promoter, acid phosphatase promoter, or promoters of
yeast a mating factor.
With an expression vector of the present invention, one may transfect or
transform a host cell and
produce a polypeptide comprising an amino acid sequence of SEQ )D N0:2, or a
variant thereof. The
host cell may be either a prokaryotic cell or a eukaryotic cell. Particular
examples of unicellular hosts.
having applications herein include E. coli, Pseudonomas, Bacillus,
Strepomyces, yeast, CHO, Rl.l, B-
W, L-M, COS1, COS7, BSC1, BSC40, BMT10 and Sf9 cells, to name only a few.
Moreover, the present invention further extends to a method for producing a
purified polypeptide
CA 02473707 2004-07-16
WO 03/061365 PCT/US03/01694
comprising the amino acid sequence of SEQ ID N0:2, a variant thereof, or a
fragment thereof. Such a
method comprises culturing a host cell transformed or transfected with an
expression vector of the
present invention under conditions that provide for expression of the purified
polypeptide, and then
recovering the purified polypeptide from the unicellular host, the culture
surrounding the host cell, or
from both.
Moreover, the present invention extends to assays for identifying compounds
that can modulate the
activity of GAVE6. Such compounds can be an agonist, an antagonist, or an
inverse agonist of
GAVE6. Hence accordingly, the present invention extends to a method for
identifying an agonist of
GAVE6 comprising contacting a potential agonist with a cell expressing GAVE6
in the presence of
an endogenous ligand, and determining whether the signaling activity of GAVE6
is increased when
the potential agonist is present, relative to the signaling activity of GAVE6
in the absence of the
potential agonist.
Lileewise, the present invention extends to a method for identifying an
inverse agonist of GAVE6.
Such a method comprises contacting a potential inverse agonist with a cell
expressing GAVE6, and
determining whether the signaling activity of GAVE6 in the presence of the
potential inverse agonist
and an endogenous ligand or agonist is decreased relative to the signaling
activity of GAVE6 under
conditions in which the presence of an endogenous ligand or agonist, but in
absence of potential
inverse agonist, and is decreased in the presence of an endogenous ligand or
agonist.
Naturally, the present invention extends to methods for identifying an
antagonist of GAVE6. Such a
method comprises the steps of contacting a potential antagonist with a cell
expressing GAVE6, and
determining whether in the presence of said potential antagonist the signaling
activity of GAVE6 is
decreased relative to the activity of GAVE6 in the presence of an endogenous
ligand or agonist.
Accordingly, it is an object of the present invention to provide an isolated
nucleic acid sequence
which encodes a GAVE6 protein, a fragment thereof, or a variant thereof.
It is also an object of the present invention to provide a variant of an
nucleic acid molecule comprising
a DNA sequence of SEQ 117 NO:1, or is hybridizable to SEQ ID NO:1 under
stringent conditions.
It is a further object of the present invention to provide an amino acid
sequence for GAVE6, along
with variant thereof, a fragment thereof, or an analog or derivative thereof.
CA 02473707 2004-07-16
WO 03/061365 PCT/US03/01694
It is a further object of the present invention to provide an expression
vector comprising a DNA
sequence that encodes GAVE6, a variant thereof, a fragment thereof, or an
analog or derivative
thereof, wherein the DNA sequence is operably associated with an expression
control element.
It is still a further object of the present invention to provide an antibody
having GAVE6, an variant
thereof, an analog or derivative thereof, or a fragment thereof, as an
immunogen.
Yet another object of the present invention involves methods for identify
compounds that can
modulate the activity of GAVE6 protein. Such modulator may be an antagonist of
GAVE6, an agonist
of GAVE6, or inverse agonist of GAVE6.
It is a still further object of the present invention to provide
pharmaceutical compositions for use in
modulating GAVE6 activity. Such modulation can be used to treat a variety of
diseases related to
GAVE6 activity, e.g., various inflammatory diseases, asthma, chronic
obstructive pulmonary disease
(COPD), and rheumatoid arthritis, to name only a few.
These and other aspects of the present invention will be better appreciated by
reference to the
following drawings and Detailed Description.
?0 BRIEF DESCRIPTION OF THE DRAWINGS
FIGURE 1: DNA sequence that encodes GAVE6 (SEQ ID NO:1).
FIGURE 2: Amino acid sequence of GAVE6 (SEQ ID NO:2)
!5 FIGURE 3: Comparison of the amino acid sequence of GAVE6 (SEQ 117 N0:2)
with the amino
acid sequences of HM74 and GPR31 (SEQ ID N0:3 and SEQ ID N0:4, respectively).
FIGURE 4: Northern Blot of the transcription of GAVE6 in various tissues.
0 FIGURE S: GAVE6 Expression Profile in various tissues in a human
organ/tissue panel.
DETAILED DESCRIPTION OF THE INVENTION
As explained above, the present invention relates to the surprising and
unexpected discovery of a
heretofore unknown nucleic acid molecule that encodes a heretofore unknown G
protein-coupled
receptor referred to herein as GAVE6. In particular, it has been discovered
that GAVE6 is expressed
CA 02473707 2004-07-16
WO 03/061365 PCT/US03/01694
in immune tissues or organs, such as the kidney, liver and small intestine.
Various terms and phrases used throughout the instant Specification and Claims
to describe the
present invention are set forth below:
As used herein, the term "modulator" refers to a moiety (e.g., but not limited
to a ligand and a
candidate compound) that modulates the activity of GAVE6. A modulator of the
present invention
may be an agonist, a partial agonist, an antagonist, or an inverse agonist of
GAVE6.
As used herein, the term "agonist" refers to moieties (e.g., but not limited
to ligands and candidate
compounds) that activate the intracellular response when bound to the
receptor, or enhance GTP
binding to membranes.
As used herein, the term "partial agonist" refers to moieties (e.g., but not
limited to ligands and
candidate compounds) that activate the intracellular response when bound to
the receptor to a lesser
degree/extent than do agonists, or enhance GTP binding to membranes to a
lesser degree/extent than
do agonists.
As used herein, the term "antagonist" refers moieties (e.g., but not limited
to ligands and candidate
compounds) that competitively bind to the receptor at the same site as does an
agonist. However, an
antagonist does not activate the intracellular response initiated by the
active form of the receptor and
thereby can inhibit the intracellular responses by agonists or partial
agonists. In a related aspect,
antagonists do not diminish the baseline intracellular response in the absence
of an agonist or partial
agonist.
As used herein, the term "inverse agonist" refers to moieties (e.g., but not
limited to ligand and
candidate compound) that bind to a constitutively active receptor and inhibit
the baseline intracellular
response. The baseline response is initiated by the active form of the
receptor below the normal base
level of activity that is observed in the absence of agonists or partial
agonists, or decrease of GTP
binding to membranes.
As used herein, the term "candidate compound" refers to a moiety (e.g., but
not limited to a chemical
compound) that is amenable to a screening technique. In one embodiment, the
term does not include
compounds that were publicly known to be compounds selected from the group
consisting of agonist,
partial agonist, inverse agonist or antagonist of GAVE6. Those compounds were
identified by
CA 02473707 2004-07-16
WO 03/061365 PCT/US03/01694
traditional drug discovery processes involving identification of an endogenous
ligand specific for a
receptor, andlor screening of candidate compounds against a receptor wherein
such a screening
requires a competitive assay to assess efficacy.
As used herein, the terins "constitutively activated receptor" or
"autonomously active receptor," are
used herein~interchangeably, and refer to a receptor subject to activation in
the absence of ligand.
Such constitutively active receptors can be endogenous (e.g., GAVE6) or non-
endogenous; i.e.,
GPCRs can be modified by recombinant means to produce mutant constitutive
forms of wild-type
GPCRs (e.g., see EP 1071701; WO 00/22129; WO 00/22131; and U.S. Pat. Nos.
6,150,393 and
l0 6,140,509 which are hereby incorporated by reference herein in their
entireties.
As used herein, the term "constitutive receptor activation" refers to the
stabilization of a receptor in
the active state by means other than binding of the receptor with the
endogenous ligand or chemical
equivalent thereof.
t5
As used herein, the term "ligand" refers to a moiety that binds to another
molecule, wherein the
moiety includes, but certainly is not limited to a hormone or a
neurotransmitter, and further, wherein
the moiety stereoselectively binds to a receptor.
'0 As used herein, the term "family," when referring to a protein or a nucleic
acid molecule of the
invention, is intended to mean two or more proteins or nucleic acid molecules
having a seemingly
common structural domain and having sufficient amino acid or nucleotide
sequence identity as
defined herein. Such family members can be naturally occurnng and can be from
either the same or
different species. For example, a family can contain a first protein of human
origin and a homologue
?5 of that protein of marine origin, as well as a second, distinct protein of
human origin and a marine
homologue of that second protein. Members of a family also may have common
functional
characteristics.
As used herein interchangeably, the terms "GAVE6 activity", "biological
activity of GAVE6" and
30 "functional activity of GAVE6", refer to an activity exerted by a GAVE6
protein, polypeptide or
nucleic acid molecule on a GAVE6 responsive cell as determined in vivo or in
vitro, according to
standard techniques. A GAVE6 activity can be a direct activity, such as an
association with or an
enzymatic activity on a second protein or an indirect activity, such as a
cellular signaling activity
mediated by interaction of the GAVE6 protein with a second protein. In a
particular embodiment, a
35 GAVE6 activity includes, but is not limited to at least one or more of the
following activities: (i) the
CA 02473707 2004-07-16
WO 03/061365 PCT/US03/01694
ability to interact with proteins in the GAVE6 signaling pathway; (ii) the
ability to interact with a
GAVE6 ligand; and (iii) the ability to interact with an intracellular target
protein.
Furthermore, in accordance with the present invention there may be employed
conventional molecular
biology, microbiology, and recombinant DNA techniques within the skill of the
art. Such techniques
are explained fully in the literature. See, e.g., Sambrook, Fritsch &
Maniatis, Molecular Cloning: A
Laboratory Manual, Second Edition (1989) Cold Spring Harbor Laboratory Press,
Cold Spring
Harbor, New York (herein "Sambrook et al., 1989"); DNA Cloning: A Practical
Approach, Volumes I
and II (D.N. Glover ed. 1985); Oligonucleotide Synthesis (M.J. Gait ed. 1984);
Nucleic Acid
t0 Hybridization [B.D. Hames & S.J. Higgins eds. (1985)]; Transcription And
Translation [B.D. Hames
& S.J. Higgins, eds. (1984)]; Animal Cell Culture [R.I. Freshney, ed. (1986)];
Immobilized Cells And
Enzymes [IRL Press, (1986)]; B. Perbal, A Practical Guide To Molecular Cloning
(1984); F.M.
Ausubel et al. (eds.), Current Protocols in Molecular Biology, John Wiley ~
Sons, Inc. (1994).
LS Therefore, if appearing herein, the following terms shall have the
definitions set out below.
A "vector" is a replicon, such as plasmid, phage or cosmid, to name only a
few, to which another DNA
segment may be attached so as to bring about the replication of the attached
segment. A "replicon" is
any genetic element (e.g., plasmid, chromosome, virus) that functions as an
autonomous unit of DNA
?0 replication in vivo, i.e., capable of replication under its own control.
Particular examples of vectors
are described infra.
A "cassette" refers to a segment of DNA that can be inserted into a vector at
specific restriction sites.
The segment of DNA encodes a polypeptide of interest, and the cassette and
restriction sites are
?5 designed to ensure insertion of the cassette in the proper reading frame
for transcription and
translation.
A cell has been "transfected" by exogenous or heterologous DNA when such DNA
has been
introduced inside the cell. A cell has been "transformed" by exogenous or
heterologous DNA when
30 the transfected DNA effects a phenotypic change. Preferably, the
transforming DNA should be
integrated (covalently linked) into chromosomal DNA making up the genome of
the cell.
"Heterologous" DNA refers to DNA not naturally located in the cell, or in a
chromosomal site of the
cell. Preferably, the heterologous DNA includes a gene foreign to the cell.
CA 02473707 2004-07-16
WO 03/061365 PCT/US03/01694
11
"Homologous recombination" refers to the insertion of a foreign DNA sequence
of a vector in a
chromosome. In particular, the vector targets a specific chromosomal site for
homologous
recombination. For specific homologous recombination, the vector will contain
sufficiently long
regions of homology to sequences of the chromosome to allow complementary
binding and
incorporation of the vector into the chromosome. Longer regions of homology,
and greater degrees of
sequence similarity, may increase the efficiency of homologous recombination.
Isolated Nucleic Acid Molecules of the Present Invention
In one aspect, the present invention extends to an isolated nucleic acid
molecule comprising DNA
sequence of Figure 1 (SEQ ID NO:1), a variant thereof, a fragment thereof, or
an analog or derivative
thereof.
A "nucleic acid molecule" refers to the phosphate ester polymeric form of
ribonucleosides (adenosine,
guanosine, uridine or cytidine; "RNA molecules") or deoxyribonucleosides
(deoxyadenosine,
deoxyguanosine, deoxythymidine, or deoxycytidine; "DNA molecules"), or any
phosphoester analogs
thereof, such as phosphorothioates and thioesters, in either single stranded
form, or a double-stranded
helix. Double stranded DNA-DNA, DNA-RNA and RNA-RNA helices are possible. The
term
nucleic acid molecule, and in particular DNA or RNA molecule, refers only to
the primary and
secondary structure of the molecule, and does not limit it to any particular
tertiary forms. Thus, this
term includes double-stranded DNA found, inter alia, in linear or circular DNA
molecules (e.g.,
restriction fragments), plasmids, and chromosomes. In discussing the structure
of particular double-
stranded DNA molecules, sequences may be described herein according to the
normal convention of
giving only the sequence in the 5' to 3' direction along the nontranscribed
strand of DNA (i.e., the
strand having a sequence homologous to the mRNA). A "recombinant DNA molecule"
is a DNA
molecule that has undergone a molecular biological manipulation.
An "isolated" nucleic acid molecule is one that is separated from other
nucleic acid molecules present
in the natural source of the nucleic acid. In particular, an "isolated"
nucleic acid is free of sequences
that naturally flank the nucleic acid encoding GAVE6 (i.e., sequences located
at the 5' and 3' ends of
the nucleic acid) in the genomic DNA of the organism from which the nucleic
acid is derived. In
various embodiments, the isolated GAVE6 nucleic acid molecule can contain less
than about 5 kb, 4
kb, 3 kb, 2 kb, 1 kb, 0.5 kb or 0.1 kb of nucleotide sequences that naturally
flank the nucleic acid
molecule in genomic DNA of the cell from which the nucleic acid is derived.
Moreover, an "isolated"
nucleic acid molecule, such as a cDNA molecule, can be substantially free of
other cellular material or
CA 02473707 2004-07-16
WO 03/061365 PCT/US03/01694
12
culture medium when produced by recombinant techniques or substantially free
of chemical
precursors or other chemicals when synthesized chemically.
A nucleic acid molecule of the present invention, e.g., a nucleic acid
molecule having the nucleotide
sequence of SEQ ID NO:1 or a fragment or complement of any of that nucleotide
sequence, or an
analog or derivative thereof, can be isolated using standard molecular biology
techniques and the
sequence information provided herein. Using all or a portion of the nucleic
acid sequence of
SEQ m NO:1 as a hybridization probe, GAVE6 nucleic acid molecules can be
isolated using standard
hybridization and cloning techniques (e.g., as described in Sambrook et a~.
l0
A nucleic acid molecule of the invention can be amplified using cDNA, mRNA or
genomic DNA as a
template and appropriate oligonucleotide primers according to standard PCR
amplification techniques.
Such primers may be readily made using information set forth in SEQ ~ NO:1,
and routine
laboratory techniques. The nucleic acid so amplified can be cloned into an
appropriate vector and
l5 characterized by DNA sequence analysis. Furthermore, oligonucleotides
corresponding to GAVE6
nucleotide sequences can be prepared by standard synthetic techniques, e.g.,
using an automated DNA
synthesizer.
Isolated nucleic Acid molecule hybridizable to GAVE6 DNA
?0 The present invention further extends to isolated nucleic acid molecules
hybridizable to GAVE6
DNA, hybridizable to a hybridization probe that is complementary under
stringent hybridization
conditions GAVE6 DNA, or hybridizable under stringent hybridization conditions
to both. In
particular, the present invention extends to an isolated nucleic acid molecule
that is hybridizable under
stringent hybridization conditions to a nucleic acid molecule comprising a DNA
sequence of SEQ ID
?5 NO:1, or to a probe that is complementary to an isolated nucleic acid
molecule comprising a DNA
sequence of SEQ ID NO:1.
A nucleic acid molecule is "hybridizable" to another nucleic acid molecule,
such as a cDNA, genomic
DNA, or RNA, when a single stranded form of the nucleic acid molecule can
anneal to another nucleic
30 acid molecule under the appropriate conditions of temperature and solution
ionic strength (see
Sambrook et al., supra). The conditions of temperature-and ionic strength
determine the "stringency"
of the hybridization. For preliminary screening for homologous nucleic acids,
low stringency
hybridization conditions, corresponding to a Tm of SS° C, can be used,
e.g., Sx SSC, 0.1% SDS, 0.25%
milk, and no formamide; or 30% formamide, Sx SSC, 0.5% SDS). Moderate
stringency hybridization
35 conditions correspond to a higher Tm, e.g., 40% formamide, with Sx or 6x
SSC. High stringency
CA 02473707 2004-07-16
WO 03/061365 PCT/US03/01694
13
hybridization conditions correspond to the highest Tm, e.g., 50% formamide, Sx
or 6x SSC.
Hybridization requires that the two nucleic acids contain complementary
sequences, although
depending on the stringency of the hybridization, mismatches between bases are
possible. The
appropriate stringency for hybridizing nucleic acids depends on the length of
the nucleic acids and the
degree of complementation, variables well known in the art. The greater the
degree of similarity or
homology between two nucleotide sequences, the greater the value of Tm for
hybrids of nucleic acids
having those sequences. The relative stability (corresponding to higher Tm) of
nucleic acid
hybridizations decreases in the following order: RNA:RNA, DNA:RNA, DNA:DNA.
For hybrids of
greater than 100 nucleotides in length, equations for calculating Tm have been
derived (see Sambrook
et al., supra, 9.50-0.51). For hybridization with shorter nucleic acids, i.e.,
oligonucleotides, the
position of mismatches becomes more important, and the length of the
oligonucleotide determines its
specificity (see Sambrook et al., supra, 11.7-11.8). A minimum length for a
hybridizable nucleic acid
molecule is at least about 20 nucleotides; particularly at least about 30
nucleotides; more particularly
at least about 40 nucleotides, even more particularly about 50 nucleotides,
and yet more particularly at
least about 60 nucleotides. In a particular embodiment of the present
invention, a hybridizable, nucleic
acid molecule of the invention is at least 300, 325, 350, 375, 400, 425, 450,
500, 550, 600, 650, 700,
800, 900, 1000 or 1100 nucleotides in length and hybridizes under stringent
conditions to the nucleic
acid molecule comprising the nucleotide sequence, preferably the coding
sequence, of SEQ ID NO:1 a
complement thereof, or a fragment thereof.
As used herein, the term "hybridizes under stringent conditions" is intended
to describe conditions for
hybridization and washing under which nucleotide sequences at least 55%, 60%,
65%, 70% and
preferably 75% or more complementary to each other typically remain
hybridized. Such stringent
conditions are known to those skilled in the art and can be found in "Current
Protocols in Molecular
Biology", John Wiley & Sons, N.Y. (1989), 6.3.1-6.3.6. A preferred, non-
limiting example of
stringent hybridization conditions are hybridization in 6X sodium
chloride/sodium citrate (SSC) at
about 45° C, followed by one or more washes in 0.2X SSC, 0.1% SDS at 50-
65° C. Preferably, an
isolated nucleic acid molecule of the invention that hybridizes under
stringent conditions to the
sequence of SEQ )D NO:1 or the complement thereof corresponds to a naturally
occurring nucleic
acid molecule. As used herein, a "naturally-occurring" nucleic acid molecule
refers to an RNA or
DNA molecule having a nucleotide sequence that occurs in nature (e.g., encodes
a natural protein).
The skilled artisan will appreciate that the conditions may be modified in
view of sequence-specific
variables (e.g., length, G-C richness etc.).
CA 02473707 2004-07-16
WO 03/061365 PCT/US03/01694
14
The invention contemplates encompassing nucleic acid fragments of GAVE6 that
are diagnostic of
GAVE6-like molecules that have similar properties. The diagnostic fragments
can arise from any
portion of the GAVE6 gene including flanking sequences. The fragments can be
used as .probe of a
library practicing known methods.
Moreover, a nucleic acid molecule of the invention can comprise only a portion
of a nucleic acid
sequence encoding GAVE6, for example, a fragment that can be used as a probe
or primer, or a
fragment encoding a biologically active portion of GAVE6. For example, such a
fragment can
comprise, but is not limited to, a region encoding amino acid residues about 1
to about 14 of
SEQ )D N0:2. The nucleotide sequence determined from the cloning of the human
GAVE6 gene
allows for the generation of probes and primers for identifying and/or cloning
GAVE6 homologues in
other cell types, e.g., from other tissues, as well as GAVE6 homologues from
other mammals. The
probe/primer typically comprises substantially purified oligonucleotide. The
oligonucleotide typically
comprises a region of nucleotide sequence that hybridizes under stringent
conditions to at least about
12, preferably about 25, more preferably about 50, 75, 100, 125, 150, 175,
200, 250, 300, 350 or 400
consecutive nucleotides of the sense or anti-sense sequence of SEQ ll~ NO:1 or
of a naturally'
occurring mutant of SEQ )D NO:1. Probes based on the human GAVE6 nucleotide
sequence can be
used to detect transcripts or genomic sequences encoding the similar or
identical proteins.
As used herein, the terms "fragment" or "portion" of an isolated nucleic acid
molecule of the present
invention comprise at least 12, particularly about 25, more particularly about
50, 75, 100, 125, 150,
175, 200, 250, 300, 350 or 400 consecutive nucleotides. Consequently, a
"fragment" of an isolated
nucleic acid molecule of the present invention is not merely 1 or 2
nucleotides.
ZS Similarly, a "fragment" or "portion" of a polypeptide of the present
invention comprises at least 9
contiguous amino acid residues. A particular example of a fragment of a
polypeptide of the present
invention comprises is an epitope to which a GAVE6 antibody, or fragment
thereof, binds.
A nucleic acid fragment encoding a "biologically active portion of GAVE6" can
be prepared by
isolating a portion of SEQ )D NO: l that encodes a polypeptide having a GAVE6
biological activity,
expressing the encoded poxtion of GAVE6 protein (e.g., by recombinant
expression in.vitro) and
assessing the activity of the encoded portion of GAVE6. The invention further
encompasses nucleic
acid molecules that differ from the nucleotide sequence of SEQ )D NO:1 due to
degeneracy of the
genetic code, and thus encode the same GAVE6 protein as that encoded by the
nucleotide sequence
t5 shown in SEQ )D NO:1.
CA 02473707 2004-07-16
WO 03/061365 PCT/US03/01694
Homologous Nucleic Acid Molecules
The present invention further extends to an isolated nucleic acid molecule
that is.homologous to a
GAVE6 DNA molecule, e.g., is homologous to an isolated nucleic acid molecule
having a DNA
5 sequence of SEQ )D NO: l . Two DNA sequences are "substantially homologous"
or "substantially
similar" when at least about 50% (preferably at least about 75%, and most
preferably at least about 90
or 95%) of the nucleotides match over the defined length of the DNA sequences.
Sequences that are
substantially homologous can be identified by comparing the sequences using
standard software
available in sequence data banks using default parameters, or in a Southern
hybridization experiment
10 under, for example, stringent conditions as defined for that particular
system. Defining appropriate
hybridization conditions is within the skill of the art. See, e.g., Maniatis
et al., supra; DNA Cloning,
Vols. I & II, supra; Nucleic Acid Hybridization, supra. Moreover, nucleic acid
molecules encoding
GAVE6 proteins from other species (GAVE6 homologues) with a nucleotide
sequence that differs
from that of a human GAVE6, are intended to be within the scope of the
invention.
Variants of an Isolated Nucleic acid Molecule of the present Invention '
The present invention further extends to variants of an isolated nucleic acid
molecule comprising a
DNA sequence of SEQ ID NO: l . Such variants can be degenerate, allelic, or a
combination thereof
Nucleic acid molecules corresponding to natural allelic variants and
homologues of the GAVE6
cDNA of the invention can be isolated based on identity with the human GAVE6
nucleic acids
disclosed herein using the human cDNA or a portion thereof, as a hybridization
probe according to
standard hybridization techniques under stringent hybridization conditions.
The term "corresponding to" is used herein to refer similar or homologous
sequences, whether the
exact position is identical or different from the molecule to which the
similarity or homology is
measured. Thus, the term "corresponding to" refers to the sequence similarity,
and not the numbering
of the amino acid residues or nucleotide bases.
Moreover, due to degenerate nature of codons in the genetic code, a GAVE6
protein of the present
invention can be encoded by numerous isolated nucleic acid molecules.
"Degenerate nature" refers to
the use of different three-letter codons to specify a particular amino acid
pursuant to the genetic code.
It is well known in the art that the following codons can be used
interchangeably to code for each
specific amino acid:
Phenylalanine (Phe or F) UUU or UUC
CA 02473707 2004-07-16
WO 03/061365 PCT/US03/01694
16
Leucine (Leu or L) UUA or UUG or CUU or CUC or CUA or CUG
Isoleucine (Ile or I) AUU or AUC or AUA
Methionine (Met or M) AUG
Valine (Val or V) GUU or GUC of GUA or GUG
Serine (Ser or S) UCU or UCC or UCA or UCG or AGU
or AGC
Proline (Pro or P) CCU or CCC or CCA or CCG
Threonine (Thr or ACU or ACC or ACA or ACG
T)
Alanine (Ala or A) GCU or GCG or GCA or GCG
Tyrosine (Tyr or I~ UAU or UAC
.0 Histidine (His CAU or CAC
or H)
Glutamine (Gln or CAA or CAG
Q)
Asparagine (Asn or AAU or AAC
N)
Lysine (Lys or K) AAA or AAG
Aspartic Acid (Asp GAU or GAC
or D)
.5 Glutamic Acid (GluGAA or GAG
or E)
Cysteine (Cys or C) UGU or UGC
Arginine (Arg or R) CGU or CGC or CGA or CGG or AGA
or AGG
Glycine (Gly or G) GGU or GGC or GGA or GGG
Tryptophan (Trp or UGG
W)
!0 Termination codon UAA (ochre) or UAG (amber) or
UGA (opal)
It should be understood that the codons specified above are for RNA sequences.
The corresponding
codons for DNA have a T substituted for U.
!5 In addition to the human GAVE6 nucleotide sequence shown in SEQ ID NO:1, it
will be appreciated
by those skilled in the art that DNA sequence polymorphisms that lead to
changes in the amino acid
sequences of GAVE6 may exist within a population (e.g., the human population).
Such genetic
polymorphism in the GAVE6 gene may exist among individuals within a population
due to natural
allelic variation. An allele is one of a group of genes that occur
alternatively at a given genetic locus.
~0 As used herein, the terms "gene" and "recombinant gene" refer to nucleic
acid molecules comprising
an open reading frame encoding a GAVE6 protein, preferably a mammalian GAVE6
protein. As used
herein, the phrase "allelic variant" refers to a nucleotide sequence that
occurs at a GAVE6 locus or to
a polypeptide encoded by the nucleotide sequence. Alternative alleles can be
identified by sequencing
the gene of interest in a number of different individuals. That can be carried
out readily by using
t5 hybridization probes to identify the same genetic locus in a variety of
individuals. Any and all such
CA 02473707 2004-07-16
WO 03/061365 PCT/US03/01694
17
nucleotide variations and resulting amino acid polymoiphisms or variations in
GAVE6 that are the
result of natural allelic variation and that do not alter the functional
activity of GAVE6 are intended to
be within the scope of the invention.
Moreover, variants of an isolated nucleic acid molecule of the present
invention can be readily made
by one of ordinary skill in the art using routine laboratory techniques, e.g.,
site-directed mutagenesis.
Antisense Nucleotide Sequences
The instant invention also extends to antisense nucleic acid molecules, i.e.,
molecules that are
complementary to a sense nucleic acid encoding a protein, e.g., complementary
to the coding strand of
a double-stranded cDNA molecule or complementary to an mRNA sequence.
Accordingly, an
antisense nucleic acid can hydrogen bond to a sense nucleic acid. The
antisense nucleic acid can be
complementary to an entire GAVE6 coding strand or to only a portion thereof,
e.g., all or part of the
protein coding region (or open reading frame). An antisense nucleic acid
molecule can be antisense to
a noncoding region of the coding strand of a nucleotide sequence encoding
GAVE6. The noncoding
regions ("5' and 3' untranslated regions") are the 5' and 3' sequences that
flank the coding region and
are not translated into amino acids.
Given the coding strand sequences encoding GAVE6 disclosed herein (e.g., SEQ m
NO:1), antisense
nucleic acids of the invention can be designed according to the rules of
Watson & Crick base pairing.
The antisense nucleic acid molecule can be complementary to the entire coding
region of GAVE6
mRNA, but more preferably is an oligonucleotide that is antisense to only a
portion of the coding or
noncoding region of GAVE6 mRNA. For example, the antisense oligonucleotide can
be
complementary to the region surrounding the translation start site of GAVE6
mRNA. An antisense
oligonucleotide can be, for example, about 5, 10, 15, 20, 25, 30, 35, 40, 45
or 50 nucleotides in length.
An antisense nucleic acid of the invention can be constructed using chemical
synthesis and enzymatic
ligation reactions using procedures known in the art. For example, an
antisense nucleic acid (e.g., an
antisense oligonucleotide) can be synthesized chemically using naturally
occurring nucleotides or
various chemically modified nucleotides designed to increase the biological
stability of the molecules,
or to increase the physical stability of the duplex formed between the
antisense and sense nucleic
acids, e.g., phosphorothioate derivatives, phosphonate derivatives and
acridine-substituted nucleotides
can be used.
Examples of modified nucleotides that can be used to generate the antisense
nucleic acid include
5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine,
xanthine, 4-acetylcytosine,
CA 02473707 2004-07-16
WO 03/061365 PCT/US03/01694
18
5-(carboxyhydroxylmethyl)uracil, 5-carboxymethylaminomethyl-2-thiouridine,
S-carboxymethylaminomethyluracil, dihydrouracil, (3-D-galactosylqueosine,
inosine,
N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, ,2,2-dimethylguanine,
2-methyladenine,
2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-
methylguanine,
5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, (3-D-
mannosylqueosine,
5-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N6-
isopentenyladenine,
uracil-5-oxyacetic acid, wybutoxosine, pseudouracil, queosine, 2-thiocytosine,
5-methyl-2-thiouracil,
2-thiouracil, 4-thiouracil, S-methyluracil, uracil-5-oxyacetic acid
methylester, uracil-5-oxyacetic acid,
5-methyl-2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl)uracil and 2,6-
diaminopurine. Alternatively,
the antisense nucleic acid can be produced biologically using an expression
vector into that a nucleic
acid has been subcloned in an antisense orientation (i.e., RNA transcribed
from the inserted nucleic
acid will be of an antisense orientation to a target nucleic acid of
interest).
The antisense nucleic acid molecules of the invention typically are
administered to a subject or
generated in situ so as to hybridize with or bind to cellular mRNA and/or
genomic DNA encoding a
GAVE6 protein thereby to inhibit expression of the protein, e.g., by
inhibiting transcription and/or
translation. The hybridization can be by conventional nucleotide
complementarity to form a stable
duplex, or, for example, in the case of an antisense nucleic acid molecule
that binds to DNA duplexes,
through specific interactions in the major groove of the double helix, or to a
regulatory region of
GAVE6.
An example of a route of administration of antisense nucleic acid molecules of
the invention includes
direct injection at a tissue site. Alternatively, antisense nucleic acid
molecules can be modified to
target selected cells and then administered systemically. For example, for
systemic administration,
antisense molecules can be modified such that the molecules specifically bind
to receptors or antigens
expressed on a selected cell surface, e.g., by linking the antisense nucleic
acid molecules to peptides
or antibodies that bind to cell surface receptors or antigens. The antisense
nucleic acid molecules also
can be delivered to cells using the vectors described herein. To achieve
sufficient intracellular
concentrations of the antisense molecules, vector constructs in which the
antisense nucleic acid
molecule is placed under the control of a strong pol II or pol III promoter
are preferred.
An antisense nucleic acid molecule of the invention can be an c~~omeric
nucleic acid molecule. An
a-anomeric nucleic acid molecule forms specific double-stranded hybrids with
complementary RNA
in that the strands run parallel to each other (Gaultier et al., Nucleic Acids
Res (1987)15:6625-6641).
The antisense nucleic acid molecule also can comprise a methylribonucleotide
(moue et al., Nucleic
CA 02473707 2004-07-16
WO 03/061365 PCT/US03/01694
19
Acids Res (1987) 15:6131-6148) or a chimeric RNA-DNA analogue (moue et al.,
FEBS Lett (1987)
215:327-330).
Ribozymes
The invention also encompasses ribozymes. Ribozymes are catalytic RNA
molecules with
ribonuclease activity that are capable of cleaving a single-stranded nucleic
acid, such as an mRNA,
that hybridizes to the ribozyme. Thus, ribozymes (e.g., hammerhead ribozymes
(described in
Haselhoff et al., Nature (1988) 334:585-591)) can be used to cleave
catalytically GAVE6 mRNA
transcripts, and thus inhibit translation of GAVE6 mRNA. A ribozyrne having
specificity for a
GAVE6-encoding nucleic acid can be designed based on the nucleotide sequence
of a GAVE6 DNA
disclosed herein (e.g., SEQ 1D NO:1). For example, a derivative of a
Tetrahymena L-19 IVS RNA
can be constructed so that the nucleotide sequence of the active site is
complementary to the
nucleotide sequence to be cleaved in a GAVE6-encoding mRNA, see, e.g., U.S.
Patent Nos. 4,987,071
and 5,116,742. Alternatively, GAVE6 mRNA can be used to select a catalytic RNA
having a specific
ribonuclease activity from a pool of RNA molecules, see, e.g., Bartel et al.,
Science (1993) ,
261:1411-1418.
Triple Helical Nucleic Acid Molecules and Peptide Nucleic Acids of the of the
Present Invention
The invention also encompasses nucleic acid molecules that form triple helical
structures. For
example, GAVE6 gene expression can be inhibited by targeting nucleotide
sequences complementary
to the regulatory region of the GAVE6 (e.g., the GAVE6 promoter andlor
enhancers) to form tripe
helical structures that prevent transcription of the GAVE6 gene in target
cells, see generally, Helene,
Anticancer Drug Des (1991) 6(6):569; Helene Ann NY Acad Sci (1992) 660:27; and
Maher,
Bioassays (1992) 14(12):807.
In particular embodiments, the nucleic acid molecules of the invention can be
modified at the base
moiety, sugar moiety or phosphate backbone to improve, e.g., the stability,
hybridization or solubility
of the molecule. For example, the deoxyribose phosphate backbone of the
nucleic acids can be
modified to generate peptide nucleic acids (see Hyrup et al., Bioorganic &
Medicinal Chemistry
(1996) 4:5). As used herein, the terms "peptide nucleic acids" or "PNAs" refer
to nucleic acid
mimics, e.g., DNA mimics, in that the deoxyribose phosphate backbone is
replaced by a
pseudopeptide backbone and only the four natural nucleobases are retained. The
neutral backbone of
PNAs has been shown to allow for specific hybridization to DNA and RNA under
conditions of low
ionic strength. The synthesis of PNA oligomers can be performed using standard
solid phase peptide
CA 02473707 2004-07-16
WO 03/061365 PCT/US03/01694
synthesis protocols as described in Hyrup et al. (1996) supra; Perry-O'Keefe
et al., Proc Natl Acad Sci
USA ( 1996) 93:14670.
PNAs of GAVE6 can be used in therapeutic and diagnostic applications. For
example, PNAs can be
used as antisense or antigene agents for sequence-specific modulation of gene
expression by, e.g.,
inducing transcription or translation arrest or inhibiting replication. PNAs
of GAVE6 also can be
used. For example, a PNA can be used in the analysis of single base pair
mutations in a gene by, e.g.,
PNA-directed PCR clamping; as artificial restriction enzymes when used in
combination with other
enzymes, e.g., S1 nucleases (Hyrup et al. (1996) supra) or as probes or
primers for DNA sequence and
l0 hybridization (Hyrup et al. (1996) supra; Perry-O'Keefe et al. (1996)
supra).
In another embodiment, PNAs of GAVE6 can be modified, e.g., to enhance
stability, specificity or
cellular uptake, by attaching lipophilic or other helper groups to the PNA, by
the formation of
PNA-DNA chimeras or by the use of liposomes or other techniques of drug
delivery known in the art.
l5 The synthesis of PNA-DNA chimeras can be performed as described in Hyrup et
al. (1996) supra,
Finn et al., Nucleic Acids Res (1996) 24(17):3357-63, Mag et al., Nucleic
Acids Res (1989) 17:5973;
and Peterser et al., Bioorganic Med Chem Lett (1975) 5:1119.
GAVE6 Protein
?0 Moreover, the present invention extends to an isolated polypeptide
comprising the amino acid
sequence of Figure 2 (SEQ ID N0:2), a variant thereof, a fragment thereof or
an analog or derivative
thereof.
An isolated nucleic acid molecule encoding a GAVE6 protein having a sequence
that differs from that
?5 of SEQ ~ N0:2, e.g. a variant, can be created by introducing one or more
nucleotide substitutions,
additions or deletions into the nucleotide sequence of SEQ >D NO:l such that
one or more amino acid
substitutions, additions or deletions are introduced into the encoded protein.
In a particular embodiment, a mutant GAVE6 protein can be assayed for: (1) the
ability to form
protein:protein interactions with proteins in the GAVE6 signaling pathway; (2)
the ability to bind a
GAVE6 ligand; or (3) the ability to bind to an intracellular target protein.
In yet another embodiment,
a mutant GAVE6 can be assayed for the ability to modulate cellular
proliferation or cellular
differentiation.
CA 02473707 2004-07-16
WO 03/061365 PCT/US03/01694
21
Native GAVE6 proteins can be isolated from cells or tissue sources by an
appropriate purification
scheme using standard protein purification techniques. Alternatively, GAVE6
proteins can readily be
produced by recombinant DNA techniques. Yet another alternative encompassed by
the present
invention is the chemical synthesis of a GAVE6 protein or polypeptide using
standard peptide
synthesis techniques.
An "isolated" or "purified" protein, or biologically active portion thereof,
is substantially free of
cellular material or other contaminating proteins from the cell or tissue
source from which the GAVE6
protein is derived, or is substantially free of chemical precursors or other
chemicals when chemically
synthesized. The phrase, "substantially free of cellular material" includes
preparations of GAVE6
protein in which the protein is separated from cellular components of the
cells from which the protein
is isolated or recombinantly produced. Thus, GAVE6 protein that is
substantially free of cellular
material includes preparations of GAVE6 protein having less than about 30%,
20%, 10% or 5% or
less (by dry weight) of non-GAVE6 protein (also referred to herein as a
"contaminating protein").
When the GAVE6 protein or biologically active portion thereof is produced
recombinantly, it also is
preferably substantially free of culture medium, i.e., culture medium
represents less than about 20%,
10% or 5% or less of the volume of the protein preparation. When GAVE6 protein
is produced by
chemical synthesis, it is preferably substantially free of chemical precursors
or other chemicals, i.e., it
is separated from chemical precursors or other chemicals that are involved in
the synthesis of the
protein. Accordingly, such preparations of GAVE6 protein have less than about
30%, 20%, 10% or
5% or less (by dry weight) of chemical precursors or non-GAVE6 chemicals.
Biologically active portions or fragments of a GAVE6 protein include peptides
comprising amino acid
sequences sufficiently identical to or derived from the amino acid sequence of
the GAVE6 protein
(e.g., the amino acid sequence shown in SEQ )D N0:2), that include fewer amino
acids than the full
length GAVE6 protein and exhibit at least one activity of a GAVE6 protein.
Typically, biologically
active portions comprise a domain or motif with at least one activity of a
GAVE6 protein. A
biologically active portion of a GAVE6 protein can be a polypeptide that is,
for example, 10, 25, 50,
100 or more amino acids in length. Particular biologically active polypeptides
include one or more
identified GAVE6 structural domains.
Moreover, other biologically active portions, in which other regions of the
protein are deleted, can be
prepared by recombinant techniques and evaluated for one or more of the
functional activities of a
native GAVE6 protein.
CA 02473707 2004-07-16
WO 03/061365 PCT/US03/01694
22
Other useful GAVE6 proteins are substantially identical to SEQ ll~ N0:2 and
retain a functional
activity of the protein of SEQ )D N0:2 yet differ in amino acid sequence due
to natural allelic
variation or mutagenesis. For example, such GAVE6 proteins and polypeptides
possess at least one
biological activity described herein.
Accordingly, a useful GAVE6 protein is a protein that includes an amino acid
sequence at least about
45%, preferably 55%, 65%, 75%, 85%, 95%, 99% or 100%identical to the amino
acid sequence of
SEQ ID N0:2 and retains a functional activity of a GAVE6 protein of SEQ )D
N0:2. In a particular
embodiment, the GAVE6 protein retains a functional activity of the GAVE6
protein of SEQ ID N0:2.
To determine the percent identity of two amino acid sequences or of two
nucleic acids, the sequences
are aligned for optimal comparison purposes (e.g., gaps can be introduced in
the sequence of a first
amino acid or nucleic acid sequence for optimal alignment with a second amino
or nucleic acid
sequence). The amino acid residues or nucleotides at corresponding amino acid
positions or
nucleotide positions then are compared. When a position in the first sequence
is occupied by the same
amino acid residue or nucleotide as the corresponding position in the second
sequence, then the
molecules are considered identical at that position. The percent identity
between the two sequences is
a function of the number of identical positions shared by the sequences (i.e.,
percent identity = number
of identical positionsltotal number of positions (e.g., overlapping positions)
X 100). In one
embodiment, the two sequences are the same length.
The determination of percent identity between two sequences can be
accomplished using a
mathematical algorithm. A particular, non-limiting example of a mathematical
algorithm utilized for
the comparison of two sequences is the algorithm of Karlin et al., Proc Natl
Acad Sci USA (1990)
87:2264, modified as in Karlin et al., Proc Natl Acad Sci USA (1993) 90:5873-
5877. Such an
algorithm is incorporated into the NBLAST and XBLAST programs of Altschul et
al., J Mol Bio
( 1990) 215:403. BLAST nucleotide searches can be performed with the NBLAST
program, for
example, score=100, wordlength=12, to obtain nucleotide sequences homologous
to a GAVE6 nucleic
acid molecule of the present invention. BLAST protein searches can be
performed with the XBLAST
program, score=S0, wordlength=3 to obtain amino acid sequences homologous to a
GAVE6 protein
molecule of the invention. To obtain gapped alignments for comparison
purposes, Gapped BLAST
can be utilized as described in Altschul et al., Nucleic Acids Res (1997)
25:3389. Alternatively,
PSI-Blast can be used to perform an iterated search that detects distant
relationships between
molecules. Altschul et al. (1997) supra. When utilizing BLAST, Gapped BLAST
and PSI-Blast
CA 02473707 2004-07-16
WO 03/061365 PCT/US03/01694
23
programs, the default parameters of the respective programs (e.g., XBLAST and
NBLAST) can be
used, see http://www.ncbi.nlm.nih.gov.
Another particular, non-limiting example of a mathematical algorithm utilized
for the comparison of
sequences is the algorithm of Myers et al., CABIOS (1988) 4:11-17. Such an
algorithm is
incorporated into the ALIGN program (version 2.0) that is part of the GCG
sequence alignment
software package. When utilizing the ALIGN program for comparing amino acid
sequences, a
PAM120 weight residue table, a gap length penalty of 12 and a gap penalty of 4
may be used.
0 The percent identity between two sequences can be determined using
techniques similar to those
described above, with or without allowing gaps. In calculating percent
identity, only exact matches
are counted.
The present invention further extends to GAVE6 chimeric or fusion proteins. As
used herein, a
GAVE6 "chimeric protein" or "fusion protein" comprises a GAVE6 polypeptide
operably linked to a
non-GAVE6 polypeptide. A "GAVE6 polypeptide" refers to a polypeptide having an
amino acid
sequence corresponding to GAVE6. A "non-GAVE6 polypeptide" refers to a
polypeptide having an
amino acid sequence corresponding to a protein that is not substantially
identical to the GAVE6
protein, e.g., a protein that is different from the GAVE6 protein and is
derived from the same or a
:0 different organism. Within a GAVE6 fusion protein, the GAVE6 polypeptide
can correspond to all or
a portion of a GAVE6 protein, preferably at least one biologically active
portion of a GAVE6 protein.
Within the fusion protein, the term "operably linked" is intended to indicate
that the GAVE6
polypeptide and the non-GAVE6 polypeptide are fused in-frame to each other.
The non-GAVE6
polypeptide can be fused to the N-terminus or C-terminus of a GAVE6
polypeptide. One useful
;5 fusion protein is GST-GAVE6 in which a GAVE6 sequence is fused to the C-
terminus of
glutathione-S-transferase (GST). Such fusion proteins can facilitate the
purification of recombinant
GAVE6.
In another embodiment, a fusion protein of the present invention extends to a
.0 GAVE6-immunoglobulin fusion protein in which all or part of GAVE6 is fused
to sequences derived
from a member of the immunoglobulin protein family. The GAVE6-immunoglobulin
fusion proteins
of the invention can be incorporated into pharmaceutical compositions and
administered to a subject
to inhibit an interaction between a GAVE6 ligand and a GAVE6 protein on the
surface of a cell,
thereby to suppress GAVE6-mediated signal transduction in vivo. The GAVE6-
immunoglobulin
t5 fusion proteins can be used to affect the bioavailability of a GAVE6
cognate ligand. Inhibition of the
CA 02473707 2004-07-16
WO 03/061365 PCT/US03/01694
24
GAVE6 ligand-GAVE6 interaction may be useful therapeutically, both for
treating proliferative and
differenfiative disorders and for modulating (e.g. promoting or inhibiting)
cell survival. Moreover, the
GAVE6-immunoglobulin fusion proteins of the invention can be used as
immunogens to produce
anti-GAVE6 antibodies in a subject, to purify GAVE6 ligands and in screening
assays to identify
molecules that inhibit the interaction of GAVE6 with a GAVE6 ligand.
In a particular embodiment, a GAVE6 chimeric or fusion protein of the present
invention is produced
by standard recombinant DNA techniques. For example, DNA fragments coding for
the different
polypeptide sequences are ligated together in-frame in accordance with
conventional techniques, for
example, by employing blunt-ended or stagger-ended termini for ligation,
restriction enzyme digestion
to provide for appropriate termini, filling-in of cohesive ends as
appropriate, alkaline phosphatase
treatment to avoid undesirable joining and enzymatic ligation. In another
embodiment, the fusion
gene can be synthesized by conventional techniques including automated DNA
synthesizers.
Alternatively, PCR amplification of gene fragments can be carried out using
anchor primers that give
rise to complementary overhangs between two consecutive gene fragments that
subsequently can be~
annealed and reamplified to generate a chimeric gene sequence (see e.g.,
Ausubel et al., supra).
Moreover, many expression vectors are commercially available that already
encode a fusion moiety
(e.g., a GST polypeptide). A GAVE6-encoding nucleic acid can be cloned into
such an expression
vector so that the fusion moiety is linked in-frame to the GAVE6 protein.
Variants
As explained above, the present invention further extends to variants of the
GAVE6 protein. For
example, mutations may be introduced into the amino acid sequence of SEQ )D
N0:2 using standard
techniques, such as site-directed mutagenesis and PCR-mediated mutagenesis.
Moreover,
?5 conservative amino acid substitutions can be made at one or more predicted
non-essential amino acid
residues. A "conservative amino acid substitution" is one in which the amino
acid residue is replaced
with an amino acid residue having a similar side chain. For example, one or
more amino acids can be
substituted by another amino acid of a similar polarity, which acts as a
functional equivalent, resulting
in a silent alteration. Substitutes for an amino acid within the amino acid
sequence of a polypeptide of
the present invention may be selected from other members of the class to which
the amino acid
belongs. For example, the nonpolar (hydrophobic) amino acids include alanine,
leucine, isoleucine,
valine, proline, phenylalanine, tryptophan and methionine. Amino acids
containing aromatic ring
structures are phenylalanine, tryptophan, and tyrosine. The polar neutral
amino acids include glycine,
serine, threonine, cysteine, tyrosine, asparagine, and glutamine. The
positively charged (basic) amino
SS acids include arginine, lysine and histidine. The negatively charged
(acidic) amino acids include
CA 02473707 2004-07-16
WO 03/061365 PCT/US03/01694
aspartic acid and glutamic acid. Such alterations will not be expected to
effect apparent molecular
weight as determined by polyacrylamide gel electrophoresis, or isoelectric
point.
Particularly preferred substitutions are:
- Lys for Arg and vice versa such that a positive charge may be maintained;
- Glu for Asp and vice versa such that a negative charge may be maintained;
- Ser for Thr such that a free -OH can be maintained; and
- Gln for Asn such that a free NHz can be maintained.
10 Moreover, amino acid substitutions may also be introduced to substitute an
amino acid with a
particularly preferable property. For example, a Cys may be introduced for a
potential site for
disulfide bridges with another Cys. A His may be introduced as a particularly
"catalytic" site (i.e., His
can act as an acid or base and is the most common amino acid in biochemical
catalysis). Pro may be
introduced because of its particularly planar structure, which induces ~i-
turns in the protein's structure.
Mutations can also be introduced randomly along all or part of a GAVE6 coding
sequence, such as by
saturation mutagenesis, and the resultant mutants can be screened for GAVE6
biological activity to
identify mutants that retain activity. Following mutagenesis, the encoded
protein can be expressed
recombinantly and the activity of the protein can be determined.
Variants of the present invention can function as a GAVE6 agonist (mimetic) or
as GAVE6
antagonist. Variants of the GAVE6 protein can be generated by mutagenesis,
e.g., discrete point
mutation or truncation of the GAVE6 protein. An agonist of the GAVE6 protein
can retain
substantially the same or a subset of the biological activities of the
naturally occurring GAVE6
protein. For example, an antagonist of the GAVE6 protein can competitively
bind to a downstream or
upstream member of a cellular signaling cascade that includes the GAVE6
protein, and thus inhibit
one or more of the activities of the naturally occurnng form of the GAVE6
protein. Thus, specific
biological effects can be elicited by treatment with a variant of limited
function. Treatment of a
subject with a variant having a subset of the biological activities of the
naturally occurring form of the
protein can have fewer side effects in a subject relative to treatment with
the naturally occurring form
of the GAVE6 proteins.
Variants of the GAVE6 protein that function as either GAVE6 agonists
(mimetics) or as GAVE6
antagonists can be identified by screening combinatorial libraries of mutants,
e.g., truncation mutants,
of the GAVE6 protein for GAVE6 agonist or antagonist activity. In one
embodiment, a variegated
CA 02473707 2004-07-16
WO 03/061365 PCT/US03/01694
26
library of GAVE6 variants is generated by combinatorial mutagenesis at the
nucleic acid level, and is
encoded by a variegated gene library. A variegated library of GAVE6 variants
can be produced by,
for example, enzymatically ligating a mixture of synthetic oligonucleotides
into gene sequences such
that a degenerate set of potential GAVE6 sequences is expressed as individual
polypeptides or
alternatively, as a set of larger fusion proteins (e.g., for phage display)
containing the set of GAVE6
sequences therein. There are a variety of methods that can be used to produce
libraries of potential
GAVE6 variants from a degenerate oligonucleotide sequence. Chemical synthesis
of a degenerate
gene sequence can be performed in an automated DNA synthesizer and the
synthetic gene then ligated
into an appropriate expression vector. Use of a degenerate set of genes allows
for the provision, in
l0 one mixture, of all of the sequences encoding the desired set of potential
GAVE6 sequences. Methods
for synthesizing degenerate oligonucleotides are known in the art (see, e.g.,
Narang, Tetrahedron
(1983) 39:3; Itakura et al., Ann Rev Biochem (1984) 53:323; Itakura et al.,
Science (1984) 198:1056;
Ike et al., Nucleic Acid Res (1983) 11:477).
IS In addition, libraries of fragments of the GAVE6 protein coding sequence
can be used to generate a
variegated population of GAVE6 fragments for screening and subsequent
selection of variants of a
GAVE6 protein. In one embodiment, a library of coding sequence fragments can
be generated by
treating a double-stranded PCR fragment of a GAVE6 coding sequence with a
nuclease under
conditions wherein nicking occurs only about once per molecule, denaturing the
double-stranded
z0 DNA, renaturing the DNA to form double-stranded DNA that can include
senselantisense pairs from
different nicked products, removing single-stranded portions from reformed
duplexes by treatment
with S 1 nuclease and ligating the resulting fragment library into an
expression vector. By that
method, an expression library can be derived that encodes N-terminal and
internal fragments of
various sizes of the GAVE6 protein.
~5
Several techniques are known in the art for screening gene products of
combinatorial libraries made
by point mutations or truncation and for screening cDNA libraries for gene
products having a selected
property. Such techniques are adaptable for rapid screening of the gene
libraries generated by the
combinatorial mutagenesis of GAVE6 proteins. The most widely used techniques
that are amenable
30 to high through-put analysis for screening large gene libraries typically
include cloning the gene
library into replicable expression vectors, transforming appropriate cells
with the resulting library of
vectors, and expressing the combinatorial genes under conditions in which
detection of a desired
activity facilitates isolation of the vector encoding the gene whose product
was detected. Recursive
ensemble mutagenesis (REM), a technique that enhances the frequency of
functional mutants in the
35 libraries, can be used in combination with the screening assays to identify
GAVE6 variants (Arkin et
CA 02473707 2004-07-16
WO 03/061365 PCT/US03/01694
27
al., Proc Natl Acad Sci USA (1992) 89:7811-7815; Delgrave et al., Protein
Engineering (1993)
6(3):327-331).
Analogs and Derivatives of GAVE6
Moreover, the present invention also includes derivatives or analogs of GAVE6
produced from a
chemical modification. A GAVE6 protein of the present invention may be
derivatized by the
attachment of one or more chemical moieties to the protein moiety.
Chemical Moieties For Derivatization. The chemical moieties suitable for
derivatization may be
selected from among water soluble polymers so that the GAVE6 analog or
derivative does not
precipitate in an aqueous environment, such as a physiological environment.
Optionally, the polymer
will be pharmaceutically acceptable. One skilled in the art will be able to
select the desired polymer
based on such considerations as whether the polymer/component conjugate will
be used
therapeutically, and if so, the desired dosage, circulation time, resistance
to proteolysis, and other
considerations. For GAVE6, these may be ascertained using the assays provided
herein. Examples of
water soluble polymers having applications herein include, but are not limited
to, polyethylene glycol,
copolymers of ethylene glycol/propylene glycol, carboxymethylcellulose,
dextran, polyvinyl alcohol,
polyvinyl pyrrolidone, poly-1, 3-dioxolane, poly-1,3,6-trioxane,
ethylene/maleic anhydride copolymer,
polyaminoacids (either homopolymers or random copolymers), dextran, poly(n-
vinyl
pyrrolidone)polyethylene glycol, propropylene glycol homopolymers,
polypropylene oxidelethylene
oxide co- polymers, polyoxyethylated polyols or polyvinyl alcohol.
Polyethylene glycol
propionaldenhyde may have advantages in manufacturing due to its stability in
water.
The polymer may be of any molecular weight; and may be branched or unbranched.
For polyethylene
glycol, the preferred molecular weight is between about 2 kDa and about 100
kDa (the term "about"
indicating that in preparations of polyethylene glycol, some molecules will
weigh more, some less,
than the stated molecular weight) for ease in handling and manufacturing.
Other sizes may be used,
depending on the desired therapeutic profile (e.g., the duration of sustained
release desired, the effects
if any, on biological activity, the ease in handling, the degree or lack of
antigenicity and other known
effects of the polyethylene glycol to a therapeutic protein or analog).
The number of polymer molecules so attached to GAVE6 may vary, and one skilled
in the art will be
able to ascertain the effect on function. One may mono-derivatize, or may
provide for a di-, tri-, tetra-
or some combination of derivatization, with the same or different chemical
moieties (e.g., polymers,
such as different weights of polyethylene glycols). The proportion of polymer
molecules to GAVE6
CA 02473707 2004-07-16
WO 03/061365 PCT/US03/01694
28
molecules will vary, as will their concentrations in the reaction mixture. In
general, the optimum ratio
(in terms of efficiency of reaction in that there is no excess unreacted
component or components and
polymer) will be determined by factors such as the desired degree of
derivatization (e.g., mono, di-,
tri-, etc.), the molecular weight of the polymer selected, whether the polymer
is branched or
unbranched, and the reaction conditions.
The polyethylene glycol molecules (or other chemical moieties) should be
attached to GAVE6 with
consideration of effects on functional or antigenic domains of GAVE6. There
are a number of
attachment methods available to those skilled in the art, e.g., EP 0 401 384
herein incorporated by
reference (coupling PEG to G-CSF), see also Malik et al., 1992, Exp. Hematol.
20:1028-1035
(reporting pegylation of GM-CSF using tresyl chloride). For example,
polyethylene glycol may be
covalently bound through amino acid residues via a reactive group, such as, a
free amino or carboxyl
group. Reactive groups are those to which an activated polyethylene glycol
molecule may be bound.
The amino acid residues having a free amino group include lysine residues and
the N- terminal amino
acid residues; those having a free carboxyl group include aspartic acid
residues, glutamic acid residues
and the C-terminal amino acid residue. Sulfllydryl groups may also be used as
a reactive group for
attaching the polyethylene glycol molecule(s). Preferred for therapeutic
purposes is attachment at an
amino group, such as attachment at the N-terminus or lysine group.
One may specifically desire N-terminally chemically modified GAVE6. Using
polyethylene glycol as
an illustration of the present compositions, one may select from a variety of
polyethylene glycol
molecules (by molecular weight, branching, etc.), the proportion of
polyethylene glycol molecules to
GAVE6 molecules in the reaction mix, the type of pegylation reaction to be
performed, and the
method of obtaining the selected N-terminally pegylated protein. The method of
obtaining the N-
terminally pegylated preparation (i.e., separating this moiety from other
monopegylated moieties if
necessary) may be by purification of the N-terminally pegylated material from
a population of
pegylated protein molecules. Selective N-terminal chemical modification may be
accomplished by
reductive alkylation which exploits differential reactivity of different types
of primary amino groups
(lysine versus the N-terminal) available for derivatization in GAVE6. Under
the appropriate reaction
conditions, substantially selective derivatization of GAVE6 at the N-terminus
with a carbonyl group
containing polymer is achieved. For example, one may selectively N-terminally
pegylate GAVE6 by
performing the reaction at a pH which allows one to take advantage of the pKa
differences between the
E-amino groups of the lysine residues and that of the cx.amino group of the N-
terminal residue of
GAVE6. By such selective derivatization, attachment of a water soluble polymer
to GAVE6 is
controlled: the conjugation with the polymer takes place predominantly at the
N-terminus of GAVE6
CA 02473707 2004-07-16
WO 03/061365 PCT/US03/01694
29
and no significant modification of other reactive groups, such as the lysine
side chain amino groups,
occurs. Using reductive alkylation, the water soluble polymer may be of the
type described above, and
should have .a single reactive aldehyde for coupling to GAVE6. Polyethylene
glycol proprionaldehyde,
containing a single reactive aldehyde, may be used.
Antibodies of GAVE6, variants thereof, fragments thereof, or analogs or
derivatives thereof
An isolated GAVE6 protein or a portion or fragment thereof, can be used as an
immunogen to
generate antibodies that bind GAVE6 using standard techniques for polyclonal
and monoclonal
antibody preparation. The term "antibody" as used herein refers to
immunoglobulin molecules and
0 immunologically active portions of immunoglobulin molecules, i.e., molecules
that contain an
antigen-binding site that specifically binds an antigen, such as GAVE6, or a
fragment thereof. A
molecule that specifically binds to GAVE6 is a molecule that binds GAVE6, but
does not
substantially bind other molecules in a sample, e.g., a biological sample that
naturally contains
GAVE6. Examples of immunologically active portions of immunoglobulin molecules
include Flab)
and F~ab~z fragments that can be generated by treating the antibody with an
enzyme such as pepsin.
The invention provides polyclonal, monoclonal and chimeric antibodies that
have GAVE6, a variant
thereof, a fragment thereof, or an analog or derivative thereof, as an
immunogen. Chimeric antibodies
are preferred for use in therapy of human diseases or disorders, since the
human or humanized antibodies
are much less likely than xenogenic antibodies to induce an immune response,
in particular an allergic
'0 response, themselves.
The full-length GAVE6 protein can be used or, alternatively, the invention
provides antigenic peptide
fragments of GAVE6 for use as immunogens. The antigenic peptide of GAVE6
comprises at least ~
!5 (preferably 10, 15, 20, 30 or more) amino acid residues of the amino acid
sequence shown in
SEQ ID N0:2 and encompasses an epitope of GAVE6 such that an antibody raised
against the peptide
forms a specific immune complex with GAVE6.
A GAVE6 immunogen typically is used to prepare antibodies by immunizing a
suitable subject, (e.g.,
40 rabbit, goat, mouse or other mammal) with the immunogen. An appropriate
immunogenic preparation
can contain, for example, recombinantly expressed GAVE6 proteinor a chemically
synthesized
GAVE6 polypeptide. The preparation further can include an adjuvant, such as
Freund's complete or
incomplete adjuvant or similar immunostimulatory agent. Immunization of a
suitable subject with an
immunogenic GAVE6 preparation induces a polyclonal anti-GAVE6 antibody
response.
SS
CA 02473707 2004-07-16
WO 03/061365 PCT/US03/01694
An antibody of the present invention can be a monoclonal antibody, a
polyclonal antibody, or a
chimeric antibody. The term "monoclonal antibody" or "monoclonal antibody
composition.", as used
herein, refers to a population of antibody molecules that contain only one
species of an
antigen-binding site capable of immunoreacting with a particular epitope of
GAVE6. A monoclonal
antibody composition thus typically displays a single binding affinity for a
particular GAVE6 protein
epitope.
Polyclonal anti-GAVE6 antibodies can be prepared as described above by
immunizing a suitable
subject with a GAVE6 immunogen. The anti-GAVE6 antibody titer in the immunized
subject can be
LO monitored over time by standard techniques, such as with an enzyme-linked
immunosorbent assay
(ELISA) using immobilized GAVE6. If desired, the antibody molecules directed
against GAVE6 can
be isolated from the mammal (e.g., from the blood) and further purified by
well-known techniques,
such as protein A chromatography, to obtain the IgG fraction. At an
appropriate time after
immunization, e.g., when the anti-GAVE6 antibody titers are highest, antibody-
producing cells can be
15 obtained from the subject and used to prepare monoclonal antibodies by
standard techniques, such as
the hybridoma technique originally described by Kohler et al., Nature (1975)
256:495-497, the human
B cell hybridoma technique (Kohler et al., Immunol Today (1983) 4:72), the EBV
hybridoma
technique (Cole et al., Monoclonal Antibodies and Cancer Therapy, (1985), Alan
R. Liss, Inc., pp.
77-96) or trioma techniques. The technology for producing hybridomas is well
known (see generally
20 Current Protocols in Immunology (1994) Coligan et al., eds., John Wiley &
Sons, Inc., New York,
NY). Briefly, an immortal cell line (typically a myeloma) is fused to
lymphocytes (typically
splenocytes) from a mammal immunized with a GAVE6 immunogen as described above
and the
culture supernatants of the resulting hybridoma cells are screened to identify
a hybridoma producing a
monoclonal antibody that binds GAVE6.
ZS
Any of the many well known protocols used for fusing lymphocytes and
immortalized cell lines can be
applied for the purpose of generating an anti-GAVE6 monoclonal antibody (see,
e.g., Current
Protocols in Immunology, supra; Galfre et al., Nature (1977) 266:550-552;
Kenneth, in Monoclonal
Antibodies: A New Dimension In Biological Analyses, Plenum Publishing Corp.,
New York, N.Y.
30 (1980); and Lerner, Yale J Biol Med (1981) 54:387-402). Moreover, the
ordinarily skilled worker
will appreciate that there are many variations of such methods that also would
be useful. Typically,
the immortal cell line (e.g., a myeloma cell line) is derived from the same
mammalian species as the
lymphocytes. For example, marine hybridomas can be made by fusing lymphocytes
from a mouse
immunized with an immunogenic preparation of the instant invention with an
immortalized mouse cell
line, e.g., a myeloma cell line that is sensitive to culture medium containing
hypoxanthine,
CA 02473707 2004-07-16
WO 03/061365 PCT/US03/01694
31
aminopterin and thymidine ("HAT medium"). Any of a number of myeloma cell
lines can be used as
a fusion partner according to standard techniques, e.g., the P3-NS1/1-Ag4-1,
P3-x63-Ag8.653 or
Sp2/O-Agl4 myeloma lines. The myeloma lines are available from ATCC.
Typically, HAT-sensitive
mouse myeloma cells are fused to mouse splenocytes using polyethylene glycol
("PEG"). Hybridoma
cells resulting from the fusion then are selected using HAT medium that kills
unfused and
unproductively fused myeloma cells (unfused splenocytes die after several days
because they are not
transformed). Hybridoma cells producing a monoclonal antibody of the invention
are detected by
screening the hybridoma culture supernatants for antibodies that bind GAVE6,
e.g., using a standard
ELISA assay.
Alternative to preparing monoclonal antibody-secreting hybridomas, a
monoclonal anti-GAVE6
antibody can be identified and isolated by screening a recombinant
combinatorial immunoglobulin
library (e.g., an antibody phage display library) with GAVE6 thereby to
isolate immunoglobulin
library members that bind GAVE6. Kits for generating and screening phage
display libraries are
commercially available (e.g., the Pharmacia Recombinant Phage Antibody System,
Catalog
No. 27-9400-O1; and the Stratagene "SURFZAP" Phage Display Kit, Catalog No.
240612).
Additionally, examples of methods and reagents particularly amenable for use
in generating and
screening antibody display libraries can be found in, for example, U.S. Patent
No. 5,223,409; PCT
0 Publication No. WO 92/18619; PCT Publication No. WO 91/17271; PCT
Publication
No. WO 92/20791; PCT Publication No. WO 92/15679; PCT Publication No. WO
93/01288; PCT
Publication No. WO 92/01047; PCT Publication No. WO 92/09690; PCT Publication
No. WO 90/02809; Fuchs et al., Bio/Technology (1991) 9:1370-1372; Hay et al.,
Hum Antibody
Hybridomas (1992) 3:81-85; Huse et al., Science (1989) 246:1275-1281; and
Griffiths et al., EMBO J
(1993) 25(12):725-734.
Furthermore, recombinant anti-GAVE6 antibodies, such as chimeric and humanized
monoclonal
antibodies comprising both human and non-human portions, can be made using
standard recombinant
DNA techniques. Such chimeric and humanized monoclonal antibodies can be
produced by
recombinant DNA techniques known in the art, for example using methods
described in PCT
Publication No. WO 87/02671; Europe Patent Application No. 184,187; Europe
Patent Application
No. 171,496; Europe Patent Application No. 173,494; PCT Publication No. WO
86/01533;
U.S. Patent No. 4,816,567; Europe Patent Application No. 125,023; Better et
al., Science (1988)
240:1041-1043; Liu et al., Proc Natl Acad Sci USA (1987) 84:3439-3443; Lin et
al., J Immunol
.5 (1987) 139:3521-3526; Sun et al., Proc Natl Acad Sci USA (1987) 84:214-218;
Nishimura et al., Canc
CA 02473707 2004-07-16
WO 03/061365 PCT/US03/01694
32
Res (1987) 47:999-1005; Wood et al., Nature (1985) 314:446-449; Shaw et al., J
Natl Cancer Inst
(1988) 80:1553-1559; Morrison, Science (1985) 229:1202-1207; Oi et al.,
Bio/Techniques (1986)
4:214; U.S. Patent No. 5,225,539; Jones et al., Nature (1986) 321:552-525;
Verhoeyan et al., Science
(1988) 239:1534; and Beidler et al., J Immunol (1988) 141:4053-4060.
Completely human antibodies are particularly desirable for therapeutic
treatment of human patients.
Such antibodies can be produced using transgenic mice that are incapable of
expressing endogenous
immunoglobulin heavy and light chains genes, but can express human heavy and
light chain genes.
The transgenic mice are immunized in the normal fashion with a selected
antigen, e.g., all or a portion
of GAVE6. Monoclonal antibodies directed against the antigen can be obtained
using conventional
hybridoma technology. The human immunoglobulin transgenes harbored by the
transgenic mice
rearrange during B cell differentiation and subsequently undergo class
switching and somatic
mutation. Thus, using such an epitope, e.g., an antibody that inhibits GAVE6
activity is identified.
The heavy chain and the light chain of the non-human antibody are cloned and
used to create phage
display Fab fragments. For example, the heavy chain gene can be cloned into a
plasmid vector so that
the heavy chain can be secreted from bacteria. The light chain gene can be
cloned into a phage coat
protein gene so that the light chain can be expressed on the surface of phage.
A repertoire (random
collection) of human light chains fused to phage is used to infect the
bacteria that express the
non-human heavy chain. The resulting progeny phage display hybrid antibodies
(human light
chain/non-human heavy chain). The selected antigen is used in a panning screen
to select phage that
bind the selected antigen. Several rounds of selection may be required to
identify such phage.
Human light chain genes are isolated from the selected phage that bind the
selected antigen. The
selected human light chain genes then are used to guide the selection of human
heavy chain genes as
~ follows. The selected human light chain genes axe inserted into vectors for
expression by bacteria.
Bacteria expressing the selected human light chains are infected with a
repertoire of human heavy
chains fused to phage. The resulting progeny phage display human antibodies
(human light
chain/human heavy chain).
Next, the selected antigen is used in a panning screen to select phage that
bind the selected antigen.
The selected phage display a completely human antibody that recognizes the
same epitope recognized
by the original selected, non-human monoclonal antibody. The genes encoding
both the heavy and
light chains are isolated and can be manipulated further for production of
human antibody. The
technology is described by Jespers et al. (Bio/Technology (1994) 12:899-903).
CA 02473707 2004-07-16
WO 03/061365 PCT/US03/01694
33
An anti-GAVE6 antibody (e.g., monoclonal antibody) can be used to isolate
GAVE6 by standard
techniques, such as affinity chromatography or immunoprecipitation. An anti-
GAVE6 antibody can
facilitate the purification of natural GAVE6 from cells and of recombinantly
produced GAVE6
expressed in host cells. Moreover, an anti-GAVE6 antibody can be used to
detect GAVE6 protein
(e.g., in a cellular lysate or cell supernatant) to evaluate the abundance and
pattern of expression of the
GAVE6 protein. Anti-GAVE6 antibodies can be used diagnostically to monitor
protein levels in
tissue as part of a clinical testing procedure, for example, to determine the
efficacy of a given
treatment regimen. Detection can be facilitated by coupling the antibody to a
detectable substance,
which are described infra.
Detectable Labels
Optionally, isolated nucleic acid molecules of the present invention,
polypeptides of the present
invention, and antibodies of the present invention, as well as fragments of
such moieties, may be
detectably labeled. Suitable labels include enzymes, fluorophores (e.g.,
fluoresoene isothiocyanate
(FTTC), phycoerythrin (PE), Texas red (TR), rhodamine, free or chelated
lanthanide series salts,
especially Eu3+, to name a few fluorophores), chromophores, radioisotopes,
chelating agents, dyes,
colloidal gold, latex particles, ligands (e.g., biotin), bioluminescent
materials, and chemiluminescent
agents. When a control marker is employed, the same or different labels may be
used for the receptor
and control marker.
In the instance where a radioactive label, such as the isotopes 3H,'øC, 32P,
ssS~ ssCh s'Cr, s'Co, sBCo,
s9Fe, 9°Y,'ZSI,'3'I, and'$6Re are used, known currently available
counting procedures may be utilized.
In the instance where the label is an enzyme, detection may be accomplished by
any of the presently
utilized colorimetric, spectrophotometric, fluorospectrophotometric,
amperometric or gasometric
techniques known in the art.
Direct labels are one example of labels which can be used according to the
present invention. A direct
label has been defined as an entity, which in its natural state, is readily
visible, either to the naked eye,
or with the aid of an optical filter and/or applied stimulation, e.g. U.V.
light to promote fluorescence.
Among examples of colored labels, which can be used according to the present
invention, include
metallic sol particles, for example, gold sol particles such as those
described by Leuvering .(U.S.
Patent 4,313,734); dye sole particles such as described by Gribnau et al.
(U.S. Patent 4,373,932) and
May et al. (WO 88/08534); dyed latex such as described by May, supra, Snyder
(EP-A 0 280 559 and
0 281 327); or dyes encapsulated in liposomes as described by Campbell et al.
(IJ.S. Patent
4,703,017). Other direct labels include a radionucleotide, a fluorescent
moiety or a luminescent
CA 02473707 2004-07-16
WO 03/061365 PCT/US03/01694
34
moiety. In addition to these direct labelling devices, indirect labels
comprising enzymes can also be
used according to the present invention. Various types of enzyme linked
immunoassays are well
known in the art, for example, alkaline phosphatase and horseradish
peroxidase, lysozyme, glucose-6-
phosphate dehydrogenase, lactate dehydrogenase, urease, these and others have
been discussed in
detail by Eva Engvall in Enzyme Immunoassay ELISA and EMIT in Methods in
Enzymology, 70. 419-
439, 1980 and in U.S. Patent 4,857,453.
Other labels for use in the invention include magnetic beads or magnetic
resonance imaging labels.
1n another embodiment, a phosphorylation site can be created on an isolated
polypeptide of the present
invention, an antibody of the present invention, or a fragment thereof, for
labeling with 3zP, e.g., as
described in European Patent No. 0372707 (application No. 89311108.8) by
Sidney Pestka, or U.S.
Patent No. 5,459,240, issued October 17, 1995 to Foxwell et al.
As exemplified herein, proteins, including antibodies, can be labeled by
metabolic labeling.
Metabolic labeling occurs during in vitro incubation of the cells that express
the protein in the
presence of culture medium supplemented with a metabolic label, such as [35S]-
methionine or [3zP]-
orthphosphate. In addition to metabolic (or biosynthetic) labeling with [35S]-
methionine, the invention
further contemplates labeling with ['4C]-amino acids and [3H]-amino acids
(with the tritium
substituted at non-labile positions).
Recombinant Expression Vectors and Host Cells
Another aspect of the invention pertains to vectors, preferably expression
vectors, containing a nucleic
acid encoding GAVE6 (or a portion thereof). As explained above, one type of
vector is a "plasmid,"
which refers to a circular double-stranded DNA loop into which additional DNA
segments can be
ligated. Another type of vector is a viral vector, wherein additional DNA
segments can be ligated into
a viral genome. Certain vectors are capable of autonomous replication in a
host cell (e.g., bacterial
vectors having a bacterial origin of replication and episomal mammalian
vectors). Other vectors (e.g.,
non-episomal mammalian vectors) are integrated into the genome of a host cell
on introduction into
the host cell and thereby are replicated along with the host genome. Moreover,
expression vectors are
capable of directing the expression of genes operably linked thereto. In
general, expression vectors of
utility in recombinant DNA techniques are often in the form of plasmids
(vectors). However, the
invention is intended to include such other forms of expression vectors, such
as viral vectors (e.g.,
replication defective retroviruses, adenoviruses and adeno-associated
viruses), that serve equivalent
functions.
CA 02473707 2004-07-16
WO 03/061365 PCT/US03/01694
A recombinant expression vector of the invention comprises a nucleic acid
molecule of the present
invention in a form suitable for expression of the nucleic acid in a host
cell. That means a
recombinant expression vector of the present invention includes one or more
regulatory sequences,
5 selected on the basis of the host cells to be used for expression, that is
operably linked to the nucleic
acid to be expressed. Within a recombinant expression vector, "operably
linked" is intended to mean
that the nucleotide sequence of interest is linked to the regulatory
sequences) in a manner that allows
for expression of the nucleotide sequence (e.g., in an in vitro
transcription/translation system or in a
host cell when the vector is introduced into the host cell). The term
"regulatory sequence" is intended
10 to include promoters, enhancers and other expression control elements
(e.g., polyadenylation signals).
Such regulatory sequences are described, for example, in Goeddel, Gene
Expression Technology:
Methods in Enzymology Vol. 155, Academic Press, San Diego, CA (1990).
Regulatory sequences
include those that direct constitutive expression of the nucleotide sequence
in many types of host cells
(e.g., tissue specific regulatory sequences). It will be appreciated by those
skilled in the art that the
15 design of the expression vector can depend on such factors as the choice of
host cell to be ,
transformed, the level of expression of protein desired etc. The expression
vectors of the invention
can be introduced into host cells to produce proteins or peptides encoded by
nucleic acids as described
herein (e.g., GAVE6 proteins, mutant forms of GAVE6, fusion proteins etc.).
20 A. recombinant expression vector of the invention can be designed for
expression of GAVE6 in
prokaryotic or eukaryotic cells, e.g., bacterial cells such as E. coli, insect
cells (using baculovirus
expression vectors), yeast cells or mammalian cells. Suitable host cells are
discussed further in
Goeddel, supra. Alternatively, the recombinant expression vector can be
transcribed and translated in
vitro, for example using phage regulatory elements and proteins, such as, a T7
promoter and/or a T7
25 polymerase.
Expression of proteins in prokaryotes is most often carned out in E. eoli with
vectors containing
constitutive or inducible promoters directing the expression of either fusion
or non-fusion proteins.
Fusion vectors add a number of amino acids to a protein encoded therein,
usually to the amino
30 terminus of the recombinant protein. Such fusion vectors typically serve
three purposes: 1) to
increase expression of recombinant protein; 2) to increase the solubility of
the recombinant protein;
and 3) to aid in the purification of the recombinant protein by acting as a
ligand in affinity
purification. Often, in fusion expression vectors, a proteolytic cleavage site
is introduced at the
junction of the fusion moiety and the recombinant protein to enable separation
of the recombinant
35 protein from the fusion moiety subsequent to purification of the fusion
protein. Such enzymes and the
CA 02473707 2004-07-16
WO 03/061365 PCT/US03/01694
36
cognate recognition sequences, include Factor Xa, thrombin and enterokinase.
Typical fusion
expression vectors include pGEX (Pharmacia Biotech Inc; Smith et al., Gene
(1988) 67:31-4.0), pMAL
(New England Biolabs, Beverly, MA) and pRITS (Pharmacia, Piscataway, NJ), that
fuse glutathione
5-transferase (GST), maltose E binding protein or protein A, respectively, to
the target recombinant
protein.
Examples of suitable inducible non-fusion E. coli expression vectors include
pTrc (Amann et al., Gene
(1988) 69:301-315) and pET l ld (Studier et al., Gene Expression Technology:
Methods in
Enzymology, Academic Press, San Diego, California (1990) 185:60-89). Target
gene expression from
the pTrc vector relies on host RNA polymerase transcription from a hybrid trp-
lac fusion promoter.
One strategy to maximize recombinant protein expression in E. coli is to
express the protein in a host
with impaired capacity to cleave proteolytically the recombinant protein
(Gottesman, Gene Expression
Technology: Methods in Enzymology, Academic Press, San Diego, California
(1990) 185:119-128).
Another strategy is to alter the nucleic acid sequence of the nucleic acid
molecule to be inserted into
an expression vector so that the individual codons for each amino acid are
those preferentially utilized
in E. coli (Wada et al., Nucleic Acids Res (1992) 20:2111-2118). Such
alteration of nucleic acid
sequences of the invention can be carned out by standard DNA synthesis
techniques.
In another embodiment, the GAVE6 expression vector is a yeast expression
vector. Examples of
vectors for expression in yeast such as S cerevisiae include pYepSecl (Baldari
et al., EMBO J (1987)
6:229-234), pMFa (Kurjan et al., Cell (1982) 30:933-943), pJRY88 (Schultz et
al., Gene (1987)
54:113-123), pYES2 (Invitrogen Corporation, San Diego, CA) and pPicZ
(Invitrogen Corp, San
Diego, CA).
Alternatively, GAVE6 can be expressed in insect cells using baculovirus
expression vectors.
Baculovirus vectors available for expression of proteins in cultured insect
cells (e.g., Sf 9 cells)
include the pAc series (Smith et al., Mol Cell Biol (1983) 3:2156-2165) and
the pVL series (Lucklow
et al., Virology (1989) 170:31-39).
In yet another embodiment, a nucleic acid of the invention is expressed in
mammalian cells using a
mammalian expression vector. Examples of mammalian expression vectors having
applications herein
include, but certainly are not limited to pCDMB (Seed, Nature (1987) 329:840)
and pMT2PC
(Kaufinan et al., EMBO J (1987) 6:187-195). When used in mammalian cells,
control functions of the
expression vector often are provided by viral regulatory elements. For
example, commonly used
CA 02473707 2004-07-16
WO 03/061365 PCT/US03/01694
37
promoters are derived from polyoma, adenovirus 2, cytomegalovirus and simian
virus 40. For other
suitable expression systems for both prokaryotic and eukaryotic cells, see
chapters 16 and 17 of
Sambrook et al., supra.
In another embodiment, a recombinant mammalian expression vector of the
present invention is
capable of directing expression of the nucleic acid preferentially in a
particular cell type (e.g.,
tissue-specific regulatory elements are used to express the nucleic acid).
Tissue-specific regulatory
elements are known in the art. Non-limiting examples of suitable tissue-
specific promoters include
the albumin promoter (liver-specific; Pinkert et al., Genes Dev (1987) 1:268-
277), lymphoid-specific
promoters (Calame et al., Adv Immunol (1988) 43:235-275), in particular,
promoters of T cell
receptors (Winoto et al., EMBO J (1989) 8:729-733) and immunoglobulins
(Banerji et al., Cell (1983)
33:729-740; Queen et al., Cell (1983) 33:741-748), neuron-specific promoters
(e.g., the neurofilament
promoter; Byrne et al., Proc Natl Acad Sci USA (1989) 86:5473-5477), pancreas-
specific promoters
(Edlund et al., Science (1985) 230:912-916) and mammary gland-specific
promoters (e.g., milk whey
promoter; U.S. Patent No. 4,873,316 and Europe Application No. 264,166).
Developmentally-regulated promoters also are encompassed; for example the
murine hox promoters
(Kessel et al., Science (1990) 249:374-379) and the c~fetoprotein promoter
(Campes et al., Genes Dev
(1989) 3:537-546).
The invention further provides a recombinant expression vector comprising a
DNA molecule of the
invention cloned into an expression vector in an antisense orientation. That
is, the DNA molecule is
operably linked to a regulatory sequence in a manner that allows for
expression (by transcription of
the DNA molecule) of an RNA molecule that is antisense to GAVE6 mRNA.
Regulatory sequences
operably linked to a nucleic acid cloned in the antisense orientation can be
chosen that direct the
continuous expression of the antisense RNA molecule in a variety of.cell
types. For example, viral
promoters and/or enhancers or regulatory sequences can be chosen that direct
constitutive,
tissue-specific or cell type-specific expression of antisense RNA. The
antisense expression vector can
be in the form of a recombinant plasmid, phagemid or attenuated virus in which
antisense nucleic
acids are produced under the control of a high efficiency regulatory region,
the activity of which can
be determined by the cell type into which the vector is introduced. For a
discussion of the regulation
of gene expression using antisense genes, see Weintraub et al. (Reviews-Trends
in Genetics, Vol.
1(1)1986).
Another aspect of the present invention pertains to host cells into which a
recombinant expression
vector of the invention has been introduced. The terms "host cell" and
"recombinant host cell" are
CA 02473707 2004-07-16
WO 03/061365 PCT/US03/01694
38
used interchangeably herein. It is understood that such terms refer not only
to the particular subject
cell but also to the progeny or potential progeny of such a cell. Because
certain modifications may
occur in succeeding generations due to either mutation or environmental
influences, such progeny may
not, in fact, be identical to the parent cell, but still are included within
the scope of the term as used
herein.
A host cell can be any prokaryotic or eukaryotic cell. For example, GAVE6
protein can be expressed
in bacterial cells such as E. coli, insect cells, yeast or mammalian cells
(such as Chinese hamster ovary
cells (CHO), 293 cells or COS cells). Other suitable host cells are known to
those skilled in the art.
t0 Vector DNA can be introduced into prokaryotic or eukaryotic cells via
conventional transformation or
transfection techniques. As used herein, the terms "transformation" and
"transfection" are intended to
refer to a variety of art-recognized techniques for introducing foreign
nucleic acid (e.g., DNA) into a
host cell, including calcium phosphate or calcium chloride co-precipitation,
transduction,
DEAF-dextran-mediated transfection, lipofection or electroporation.
LS
For stable transfection of mammalian cells, it is known that, depending on the
expression vecfor and
transfection technique used, only a small fraction of cells may integrate the
foreign DNA into the
genome. To identify and to select the integrants, a gene that encodes a
selectable marker (e.g., for
resistance to antibiotics) generally is introduced into the host cells along
with the gene of interest.
?0 Preferred selectable markers include those that confer resistance to drugs,
such as G41~, hygromycin
and methotrexate. Nucleic acid encoding a selectable marker can be introduced
into a host cell on the
same vector as that encoding GAVE6 or can be introduced on a separate vector.
Cells stably
transfected with the introduced nucleic acid can be identified by drug
selection (e.g., cells that have
incorporated the selectable marker gene will survive, while the other cells
die).
A host cell of the invention, such as a prokaryotic or eukaryotic host cell in
culture, can be used to
produce (i.e., express) GAVE6 protein. Accordingly, the invention further
provides methods for
producing GAVE6 protein using the host cells of the invention. In one
embodiment, the method
comprises culturing the host cell of invention (into that a recombinant
expression vector encoding
GAVE6 has been introduced) in a suitable medium such that GAVE6 protein is
produced. In another
embodiment, the method further comprises isolating GAVE6 from the medium or
the host cell.
In another embodiment, GAVE6 comprises an inducible expression system for the
recombinant
expression of other proteins subcloned in modified expression vectors. For
example, host cells
comprising a mutated G protein (e.g., yeast cells, Y2 adrenocortical cells and
cyc S49, see U.S. Pat.
CA 02473707 2004-07-16
WO 03/061365 PCT/US03/01694
39
Nos. 6,168,927 Bl, 5,739,029 and 5,482,835; Mitchell et al., Proc Natl Acad
Sci USA (1992)
89(19):8933-37 and Katada et al., J Biol Chem (1984) 259(6):3586-95) are
transduced with a first
expression vector comprising a nucleic acid sequence encoding GAVE6, wherein
GAVE6 is
functionally expressed in the host cells. Even though the expressed GAVE6 is
constitutively active,
the mutation does not allow for signal transduction; i.e., no activation of a
G-protein directed
downstream cascade occurs (e.g., no adenylyl cyclase activation).
Subsequently, a second expression
vector is used to transduce the GAVE6-comprsing host cells. The second vector
comprises a
structural gene that complements the G protein mutation of the host cell
(i.e., functional mammalian
or yeast GS, G;, Go, or Gq, e.g., see PCT Publication No. WO 97/48820; U.S.
Pat. Nos. 6,168,927 B1,
5,739,029 and 5,482,835) in addition to the gene of interest to be expressed
by the inducible system.
The complementary structural gene of the second vector is inducible; i.e.,
under the control of an
exogenously added component (e.g., tetracycline, IPTG, small molecules etc.,
see Sambrook et al.
supra) that activates a promoter which is operably linked to the complementary
structural gene. On
addition of the inducer, the protein encoded by the complementary structural
gene is functionally
expressed such that the constitutively active GAVE6 now will form a complex
that leads to
appropriate downstream pathway activation (e.g., second messenger formation).
The gene of interest
comprising the second vector possesses an operably linked promoter that is
activated by the
appropriate second messenger (e.g., CREB, AP1 elements). Thus, as second
messenger accumulates,
the promoter upstream from the gene of interest is activated to express the
product of said gene.
When the inducer is absent, expression of the gene of interest is switched
off.
In a particular embodiment, the host cells for the inducible expression system
include, but are not
limited to, S49 (cyc ) cells. While cell lines are contemplated that comprise
G-protein mutations,
suitable mutants may be artificially produced/constructed (see U.S. Pat. Nos.
6,168,927 B 1, 5,739,029
and 5,482,835 for yeast cells).
In a related aspect, the cells are transfected with a vector operably linked
to a cDNA comprising a
sequence encoding a protein as set forth in SEQ >D N0:2. The first and second
vectors comprising
said system are contemplated to include, but are not limited to, pCDM8 (Seed,
Nature (1987)
329:840) and pMT2PC (Kaufrnan et al., EMBO J (1987) 6:187-195), pYepSecl
(Baldari et al., EMBO
J (1987) 6:229-234), pMFa (Kurjan et al.,.Cel1 (1982) 30:933-943), pJRY88
(Schultz et al., Gene
(1987) 54:113-123), pYES2 (Invitrogen Corporation, San Diego, CA) and pPicZ
(Invitrogen Corp,
San Diego, CA).
In a related aspect, the host cells may be transfected by such suitable means,
wherein transfection
results in the expression of a functional GAVE6 protein (e.g., Sambrook et
al., supra, and Kriegler,
CA 02473707 2004-07-16
WO 03/061365 PCT/US03/01694
Gene Transfer and Expression: A Laboratory Manual, Stockton Press, New York,
NY, 1990). Such
"functional proteins" include, but are not limited to, proteins that once
expressed, form complexes
with G-proteins, where the G-proteins regulate second messenger formation.
Other methods for
transfecting host cells that have applications herein include, but certainly
are not limited to
transfection, electroporation, microinjection, transduction, cell fusion, DEAE
dextran, calcium
phosphate precipitation, lipofection (lysosome fusion), use of a gene gun, or
a DNA vector transporter
(see, e.g., Wu et al., 1992, J. Biol. Chem. 267:963-967; Wu and Wu, 1988, J.
Biol. Chem. 263:14621-
14624; Hartmut et al., Canadian Patent Application No. 2,012,31 l, filed March
15, 1990).
10 A large variety of promoters have applications in the present invention:
Indeed, expression of a
polypeptide of the present invention may be controlled by any
promoter/enhancer element known in
the art, but these regulatory elements must be functional in the host selected
for expression.
Promoters which may be used to control GAVE6 expression include, but are not
limited to, the SV40
early promoter region (Benoist and Chambon, 1981, Nature 290:304-310), the
promoter contained in
15 the 3' long terminal repeat of Rous sarcoma virus (Yamamoto, et al., 1980,
Cell 22:787-797), the
herpes thymidine kinase promoter (Wagner et al., 1981, Proc. Natl. Acad. Sci.
U.S.A. 78:1441-1445),
the regulatory sequences of the metallothionein gene (Brinster et al., 1982,
Nature 296:39-42);
prokaryotic expression vectors such as the (3-lactamase promoter (Villa-
Kamaroff, et al., 1978, Proc.
Natl. Acad. Sci. U.S.A. 75:3727-3731), or the tac promoter (DeBoer, et al.,
1983, Proc. Natl. Acad.
20 Sci. U.S.A. 80:21-25); see also "Useful proteins from recombinant bacteria"
in Scientific American,
1980, 242:74-94; promoter elements from yeast or other fungi. such as the Gal
4 promoter, the ADC
(alcohol dehydrogenase) promoter, PGK (phosphoglycerol kinase) promoter,
alkaline phosphatase
promoter; and the animal transcriptional control regions, which exhibit tissue
specificity and have
been utilized in transgenic animals: elastase I gene control region which is
active in pancreatic acinar
25 cells (Swift et al., 1984, Cell 38:639-646; Ornitz et al., 1986, Cold
Spring Harbor Symp. Quart. Biol.
50:399-409; MacDonald, 1987, Hepatology 7:425-515); insulin gene control
region which is active in
pancreatic beta cells (Hanahan, 1985, Nature 315:115-122), immunoglobulin gene
control region
which is active in lymphoid cells (Grosschedl et al., 1984, Cell 38:647-658;
Adames et al., 1985,
Nature 318:533-538; Alexander et al., 1987, Mol. Cell. Biol. 7:1436-1444),
mouse mammary tumor
30 virus control region which is active in testicular, breast, lymphoid and
mast cells (Leder et al., 1986,
Cell 45:485-495), albumin gene control region which is active in liver
(Pinkert et al., 1987, Genes and
Devel. 1:268-276), alpha-fetoprotein gene control region which is active in
liver (Krumlauf et al.,
1985, Mol. Cell. Biol. 5:1639-1648; Hammer et al., 1987, Science 235:53-58),
alpha 1-antitrypsin
gene control region which is active in the liver (Kelsey et al., 1987, Genes
and Devel. 1:161-171),
35 beta-globin gene control region which is active in myeloid cells (Mogram et
al., 1985, Nature
CA 02473707 2004-07-16
WO 03/061365 PCT/US03/01694
41
315:338-340; Kollias et al., 1986, Cell 46:89-94), myelin basic protein gene
control region which is
active in oligodendrocyte cells in the brain (Readhead et al., 1987, Cell
48:703-712), myosin light
chain-2 gene control region which is active in skeletal muscle (Sani, 1985,
Nature 314:283-286), and
gonadotropic releasing hormone gene control region which is active in the
hypothalamus (Mason et
al., 1986, Science 234:1372-1378).
Expression vectors containing a nucleic acid molecule of the invention can be
identified by four
general approaches: (a) PCR amplification of the desired plasmid DNA or
specific mRNA, (b) nucleic
acid hybridization, (c) presence or absence of selection marker gene
functions, and (d) expression of
inserted sequences. In the first approach, the nucleic acids can be amplified
by PCR to provide for
detection of the amplified product. In the second approach, the presence of a
foreign gene inserted in
an expression vector can be detected by nucleic acid hybridization using
probes comprising sequences
that are homologous to an inserted marker gene. In the third approach, the
recombinant vector/host
system can be identiEed and selected based upon the presence or absence of
certain "selection
marker" gene functions (e.g.~ a-galactosidase activity, thymidine kinase
activity, resistance to
antibiotics, transformation phenotype, occlusion body formation in
baculovirus, etc.) caused by the
insertion of foreign genes in the vector. In another example, if the nucleic
acid encoding GAVE6
protein, a variant thereof, or an analog or derivative thereof, is inserted
within the "selection marker"
gene sequence of the vector, recombinants containing the insert can be
identified by the absence of the
GAVE6 gene function. In the fourth approach, recombinant expression vectors
can be identified by
assaying for the activity, biochemical, or immunological characteristics of
the gene product expressed
by the recombinant, provided that the expressed protein assumes a functionally
active conformation.
A wide variety of host/expression vector combinations may be employed in
expressing the DNA
sequences of this invention. Useful expression vectors, for example, may
consist of segments of
chromosomal, non-chromosomal and synthetic DNA sequences. Suitable vectors
include derivatives
of SV40 and known bacterial plasmids, e:g., E. cola plasmids col El, pCRI,
pBR322, pMal-C2, pET,
pGEX (Smith et al., 1988, Gene 67:31-40), pMB9 and their derivatives, plasmids
such as RP4; phage
DNAS, e.g., the numerous derivatives of phage a, e.g., NM989, and other phage
DNA, e.g., M13 and
filamentous single stranded phage DNA; yeast plasmids such as the 2~ plasrnid
or derivatives thereof;
vectors useful in eukaryotic cells, such as vectors useful in insect or
mammalian cells; vectors derived
from combinations of plasmids and phage DNAs, such as plasmids that have been
modified to employ
phage DNA or other expression control sequences; and the like.
For example, in a baculovirus expression systems, both non-fusion transfer
vectors, such as but not
CA 02473707 2004-07-16
WO 03/061365 PCT/US03/01694
42
limited to pVL941 (BamHl cloning site; Summers), pVL1393 (BamHl, SmaI, XbaI,
EcoRl, NotI,
XmallI, BgIII, and PstI cloning site; Invitrogen), pVL1392 (BgIII, PstI, NotI,
XmaIll, EcoRI, XbaI,
SmaI, and BamHl cloning site; Summers and Invitrogen), and pBlueBacllI (BamHl,
BgllI, PstI, NcoI,
and HindIll cloning site, with blue/white recombinant screening possible;
Invitrogen), and fusion
transfer vectors, such as but not limited to pAc700 (BamHl and KpnI cloning
site, in which the
BamHl recognition site begins with the initiation codon; Summers), pAc701 and
pAc702 (same as
pAc700, with different reading frames), pAc360 (BamHl cloning site 36 base
pairs downstream of a
polyhedrin initiation codon; Invitrogen(195)), and pBlueBacHisA, B, C (three
different reading
frames, with BamHl, BgIII, PstI, NcoI, and HindIll cloning site, an N-terminal
peptide for ProBond
purification, and blue/white recombinant screening of plaques; Invitrogen
(220)) can be used.
Mammalian expression vectors contemplated for use in the invention include
vectors with inducible
promoters, such as the dihydrofolate reductase (DHFR) promoter, e.g., any
expression vector with a
DHFR expression vector, or a DHFR/methotrexate co-amplification vector, such
as pED (PstI, SaII,
SbaI, SmaI, and EcoRI cloning site, with the vector expressing both the cloned
gene and DHFR; see
Kaufman, Current Protocols in Molecular Biology, 16.12 (1991). Alternatively,
a glutamine'
synthetase/methionine sulfoximine co-amplification vector, such as pEEl4
(HindIll, KbaI, SmaI, SbaI,
EcoRI, and BcII cloning site, in which the vector expresses glutamine synthase
and the cloned gene;
Celltech). In another embodiment, a vector that directs episomal expression
under control of Epstein
Barr Virus (EBV) can be used, such as pREP4 (BamHl, SfiI, ~YhoI, NotI, NheI,
HindIll, NheI, PvuII,
and KpnI cloning site, constitutive RSV-LTR promoter, hygromycin selectable
marker; Invitrogen),
pCEP4 (BamHl, SfiI, XhoI, NotI, NheI, Hina'tll, NheI, PvuII, and KpnI cloning
site, constitutive
hCMV immediate early gene, hygromycin selectable marker; Invitrogen), pMEP4
(KpnI, PvuI, NheI,
HindlB, NotI, XhoI, SCI, BamHl cloning site, inducible metallothionein Iia
gene promoter,
hygromycin selectable marker: Invitrogen), pREP8 (BamHl, ~'hoI, NotI, HindItl,
NheI, and KpnI
cloning site, RSV-LTR promoter, histidinol selectable marker; Invitrogen),
pREP9 (KpnI, NheI,
HindIll, NotI, XhoI, SfiI, and BamHI cloning site, RSV-LTR promoter, 6418
selectable marker;
Invitrogen), and pEBVHis (RSV-LTR promoter, hygromycin selectable marker, N-
terminal peptide
purifiable via ProBond resin and cleaved by enterokinase; Invitrogen).
Selectable mammalian
expression vectors for use in the invention include pRcICMV (Hindl)1, BstXI,
NotI, SbaI, and ApaI
cloning site, 6418 selection; Invitrogen), pRc/RSV (Hindlll, SpeI, BstXI,
NotI, ~YbaI cloning site,
6418 selection; Invitrogen), and others. Vaccinia virus mammalian expression
vectors (see,
Kaufman, 1991, supra) for use according to the invention include but are not
limited to pSCl l (SmaI
cloning site, TK- and (3-gal selection), pMJ601 (SaII, SmaI, AfII, NarI,
BspMII, BamHI, ApaI, NheI,
SacII, KpnI, and Hindi cloning site; TK- and a-gal selection), and pTKgptFl S
(EcoRI, PstI, SaII,
CA 02473707 2004-07-16
WO 03/061365 PCT/US03/01694
43
AccI, HindII, SbaI, BamHI, and Hpa cloning site, TK or XPRT selection).
Yeast expression systems can also be used according to the invention to
express GAVE6 protein, a
variant thereof, or an analog or derivative thereof. For example, the non-
fusion pYES2° vector (XbaI,
SphI, ShoI, NotI, GstXI, EcoRI, BstXI, BamHl, SacI, Kpnl, and HindIll cloning
sit; Invitrogen) or the
fusion pYESHisA, B, C (XbaI, SphI, ShoI, NotI, BstXI, EcoRI, BarnHl, SacI,
KpnI, and HindIll
cloning site, N-terminal peptide purified with ProBond resin and cleaved with
enterokinase;
Invitrogen), to mention just two, can be employed according to the invention.
Once a particular recombinant DNA molecule is identified and isolated, several
methods known in the
art may be used to propagate it. Once a suitable host system and growth
conditions are established,
recombinant expression vectors can be propagated and prepared in quantity. As
previously explained,
the expression vectors that can be used include, but are not limited to, the
following vectors or their
derivatives: human or animal viruses such as vaccinia virus or adenovirus;
insect viruses such as
baculovirus; yeast vectors; bacteriophage vectors (e.g., lambda), and plasmid
and cosmid DNA
vectors, to name but a few.
In addition, a host cell strain may be chosen which modulates the expression
of the inserted
sequences, or modifies and processes the gene product in the specific fashion
desired. Different host
cells have characteristic and specific mechanisms for the translational and
post-translational
processing and modification (e.g., glycosylation, cleavage [e.g., of signal
sequence]) of proteins.
Appropriate cell lines or host systems can be chosen to ensure the desired
modification and processing
of the foreign protein expressed. For example, expression in a bacterial
system can be used to
produce an nonglycosylated core protein product.
Transgenic Animals
A host cell of the present invention also can be used to produce nonhuman
transgenic animals. For
example, in one embodiment, a host cell of the invention is a fertilized
oocyte or an embryonic stem
cell into which GAVE6-coding sequences have been introduced. Such host cells
then can be used to
create non-human transgenic animals into which exogenous GAVE6 sequences have
been introduced
into the genome, or homologous recombinant animals in which endogenous GAVE6
sequences have
been altered. Such animals are useful for studying the function and/or
activity of GAVE6 and for
identifying and/or evaluating modulators of GAVE6 activity. As used herein, a
"transgenic animal" is
a non-human animal, preferably a mammal, more preferably a rodent such as a
rat or mouse, in that
CA 02473707 2004-07-16
WO 03/061365 PCT/US03/01694
44
one or more of the cells of the animal includes a transgene. Other examples of
transgenic animals
include non-human primates, sheep, dogs, cows, goats, chickens, amphibians
etc.
As used herein, the term "transgene" refers to exogenous DNA that is
integrated into the genome of a
cell from which a transgenic animal develops and that remains in the genome of
the mature animal.
The transgene directs the expression of an encoded gene product in one or more
cell types or tissues of
the transgenic animal. As used herein, a "homologous recombinant animal" is a
non-human animal,
preferably a mammal, more preferably a mouse, in which an endogenous GAVE6
gene has been
altered by homologous recombination. That is accomplished between the
endogenous gene and an
l0 exogenous DNA molecule introduced into a cell of the animal, e.g., an
embryonic cell of the animal,
prior to development of the animal.
A transgenic animal of the invention can be created by introducing a GAVE6-
encoding nucleic acid
molecule into the male pronuclei of a fertilized oocyte using one of the
transfection methods described
l5 above. The oocyte is then allowed to develop in a pseudopregnant female
foster animal. The GAVE6
cDNA sequence e.g., that of (SEQ 1D NO:1), for example, can be introduced as a
transgene into the
genome of a non-human animal. Alternatively, a nonhuman homologue of the human
GAVE6 gene,
such as a mouse GAVE6 gene, can be isolated based on hybridization to the
human GAVE6 cDNA,
and used as a transgene. Intronic sequences and polyadenylation signals also
can be included in the
ZO transgene to increase the efficiency of expression of the transgene. A
tissue-specific regulatory
sequences) can be operably linked to the GAVE6 transgene to direct expression
of GAVE6 protein in
particular cells. Methods for generating transgenic animals via embryo
manipulation and
microinjection, particularly animals such as mice, are conventional in the art
and are described, for
example, in U.S. Patent Nos. 4,736,866 and 4,870,009, U.S. Patent No.
4,873,191 and in Hogan,
ZS Manipulating the Mouse Embryo, (Cold Spring Harbor Laboratory Press, Cold
Spring Harbor, N.Y.,
1986). Similar methods are used for production of other transgenic animals
with a transgene in the
genome and/or expression of GAVE6 mRNA in tissues or cells of the animals. A
transgenic founder
animal then can be used to breed additional animals carrying the transgene.
Moreover, transgenic
animals carrying a transgene encoding GAVE6 can be bred further to other
transgenic animals
30 carrying other transgenes.
To create a homologous recombinant animal, a vector is prepared that contains
at least a portion of a
GAVE6 gene (e.g., a human or a non-human homolog of the GAVE6 gene, e.g., a
marine GAVE6
gene) into which a deletion, addition or substitution has been introduced
thereby to alter, e.g.,
35 functionally disrupt, the GAVE6 gene. In a particular embodiment, the
vector is designed such that,
CA 02473707 2004-07-16
WO 03/061365 PCT/US03/01694
on homologous recombination, the endogenous GAVE6 gene is disrupted
functionally (i.e., no longer
encodes a functional protein; also referred to as ~a ~~knoclc out" vector).
Alternatively, the vector can be designed such that, on homologous
recombination, the endogenous
GAVE6 gene is mutated or otherwise altered but still encodes functional
protein (e.g., the upstream
regulatory region can be altered thereby to alter the expression of the
endogenous GAVE6 protein).
In the homologous recombination vector, the altered portion of the GAVE6 gene
is flanked at the 5'
and 3' ends by an additional nucleic acid sequence of the GAVE6 gene to allow
for homologous
t0 recombination to occur between the exogenous GAVE6 gene carried by the
vector and an endogenous
GAVE6 gene in an embryonic stem cell. The additional flanking GAVE6 nucleic
acid sequence is of
sufficient length for successful homologous recombination with the endogenous
gene. Typically,
several kilobases of flanking DNA (both at the 5' and 3' ends) are included in
the vector (see, e.g.,
Thomas et al., Cell (1987) 51:503 for a description of homologous
recombination vectors).
LS
The vector is introduced into an embryonic stem cell line (e.g., by
electroporation) and cells iii which
the introduced GAVE6 gene has homologously recombined with the endogenous
GAVE6 gene are
selected (see, e.g., Li et al., Cell (1992) 69:915). The selected cells then
are injected into a blastocyst
of an animal (e.g., a mouse) to form aggregation chimeras (see, e.g., Bradley
in Teratocarcinomas and
'0 Embryonic Stem Cells: A Practical Approach, Robertson, ed., IRL, Oxford,
(1987) pp. 113-152). A
chimeric embryo then can be implanted into a suitable pseudopregnant female
foster animal and the
embryo brought to term. Progeny harboring the homologously recombined DNA in
the germ cells can
be used to breed animals in that all cells of the animal contain the
homologously recombined DNA by
germline transmission of the transgene.
~5
Methods for constructing homologous recombination vectors and homologous
recombinant animals
are described further in Bradley, Current Opinion in Bio/Technology (1991)
2:823-829 and in PCT
Publication Nos. WO 90111354, WO 91/01140, WO 92/0968 and WO 93/04169.
30 In another embodiment, transgenic non-human animals can be produced that
contain selected systems
to allow for regulated expression of the transgene. One example of such a
system is the cre/loxP
recombinase system of bacteriophage Pl. For a description of the cre/loxP
recombinase system, see,
e.g., Lakso et al., Proc Natl Acad Sci USA (1992) 89:6232-6236. Another
example of a recombinase
system is the FLP recombinase system of S. cerevisiae (O'Gorrnan et al.,
Science (1991)
35 251:1351-1355). If a cre/loxP recombinase system is used to regulate
expression of the transgene,
CA 02473707 2004-07-16
WO 03/061365 PCT/US03/01694
46
animals containing transgenes encoding both the cre recombinase and a selected
protein are required.
Such animals can be provided through the construction of "double" transgenic
animals, e.g., by mating
two transgenic animals, one containing a transgene encoding a selected protein
and the other
containing a transgene encoding a recombinase.
Clones of the non-human transgenic animals described herein also can be
produced according to the
methods described in Wilmut et al., Nature (1997) 385:810-813 and PCT
Publication Nos.
WO 97/07668 and WO 97/07669. In brief, a cell, e.g., a somatic cell, from the
transgenic animal can
be isolated and induced to exit the growth cycle and enter Go phase. The
quiescent cell then can be
fused, e.g., through the use of electrical pulses, to an enucleated oocyte
from an animal of the same
species from which the quiescent cell is isolated. The reconstructed oocyte
then is cultured such that it
develops to morula or blastocyte, and then is transferred to a pseudopregnant
female foster animal.
The offspring borne of the female foster animal will be a clone of the animal
from that the cell, e.g.,
the somatic cell, is isolated.
Pharmaceutical Compositions
The GAVE6 nucleic acid molecules, GAVE6 proteins and anti-GAVE6 antibodies
(also referred to
herein as "active compounds") of the present invention can be incorporated
into pharmaceutical.
compositions suitable for administration. Such compositions typically comprise
the nucleic acid
molecule, protein or antibody, and a pharmaceutically acceptable carrier. As
used herein, the
language "pharmaceutically acceptable carrier" is intended to include any and
all solvents, dispersion
media, coatings, antibacterial and antifungal agents, isotonic and absorption
delaying agents and the
like, compatible with pharmaceutical administration. The use of such media and
agents for
pharmaceutically active substances is well known in the art. Except insofar as
any conventional
media or agent is incompatible with the active compound, use thereof in the
compositions is
contemplated. Supplementary active compounds also can be incorporated into the
compositions.
A pharmaceutical composition of the present invention is formulated to be
compatible with the
intended route of administration. Examples of routes of administration include
parenteral, e.g.,
intravenous, intradermal, subcutaneous, oral (e.g., inhalation), transdermal
(topical), transmucosal and
rectal administration. Solutions or suspensions used for parenteral,
intradermal or subcutaneous
application can include the following components: a sterile diluent such as
water for injection, saline
solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or
other synthetic solvents;
antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants
such as ascorbic acid or
sodium bisulfate; chelating agents such as EDTA; buffers such as acetates,
citrates or phosphates and
CA 02473707 2004-07-16
WO 03/061365 PCT/US03/01694
47
agents for the adjustment of tonicity such as sodium chloride or dextrose. pH
can be adjusted with
acids or bases, such as HCl or NaOH. The parenteral preparation can be
enclosed in ampoules,
disposable syringes or multiple dose vials made of glass or plastic.
Pharmaceutical compositions suitable for injectable use include sterile
aqueous solutions (water
miscible) or dispersions and sterile powders for the extemporaneous
preparation of sterile injectable
solutions or dispersions. For intravenous administration, suitable Garners
include physiological saline,
bacteriostatic water, "CREMOPHOR EL" (BASF; Parsippany, NJ) or phosphate
buffered saline
(PBS). In all cases, the composition must be sterile and should be fluid to
the extent that easy
syringability exists. The composition must be stable under the conditions of
manufacture and storage
and must be preserved against the contaminating action of microorganisms such
as bacteria and fungi.
The carrier can be a solvent or dispersion medium containing, for example,
water, ethanol, polyol (for
example, glycerol, propylene glycol and liquid polyetheylene glycol and the
like) and suitable
mixtures thereof. The proper fluidity can be maintained, for example, by the
use of a coating such as
lecithin, by the maintenance of the required particle size in the case of
dispersion and by the use of
surfactants. Prevention of the action of microorganisms can be achieved by
various antibacterial and
antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic
acid, thimerosal and the
like. In many cases, it will be preferable to include isotonic agents, for
example, sugars, polyalcohols
such as mannitol, sorbitol or sodium chloride in the composition. Prolonged
absorption of the
injectable compositions can be brought about by including in the composition
an agent that delays
absorption, for example, aluminum monostearate and gelatin.
Sterile injectable solutions can be prepared by incorporating the active
compound (e.g., a GAVE6
protein, variant thereof, or analog or derivative thereof; or an anti-GAVE6
antibody) in the required
amount in an appropriate solvent with one or a combination of ingredients
enumerated above, as
required, followed by filtered sterilization. Generally, dispersions are
prepared by incorporating the
active compound into a sterile vehicle that contains a basic dispersion medium
and the required other
ingredients from those enumerated above. In the case of sterile powders for
the preparation of sterile
injectable solutions, the preferred methods of preparation are vacuum drying
and freeze drying to
yield a powder of the active ingredient plus any additional desired ingredient
from a previously
sterile-filtered solution thereof.
Oral compositions generally include an inert diluent or an edible carrier. The
compositions can be
enclosed in gelatin capsules or compressed into tablets. For the purpose of
oral therapeutic
administration, the active compound can be incorporated with excipients and
used in the form of
CA 02473707 2004-07-16
WO 03/061365 PCT/US03/01694
48
tablets, troches or capsules. Oral compositions also can be prepared using a
fluid carrier for use as a
mouthwash, wherein the compound in the fluid carrier is applied orally and
swished and expectorated
or swallowed.
Pharmaceutically compatible binding agents, and/or adjuvant materials can be
included as part of the
composition. The tablets, pills, capsules, troches and the like can contain
any of the following
ingredients or compounds of a similar nature: a binder such as
microcrystalline cellulose, gum
tragacanth or gelatin; an excipient such as starch or lactose, a
disintegrating agent such as alginic acid,
Primogel or corn starch; a lubricant such as magnesium stearate or Sterotes; a
glidant such as colloidal
silicon dioxide; a sweetening agent such as sucrose or saccharin; or a
flavoring agent such as
peppermint, methyl salicylate or orange flavoring. For administration by
inhalation, the compounds
are delivered in the form of an aerosol spray from a pressurized 'container or
dispenser that contains a
suitable propellant, e.g., a gas such as carbon dioxide or a nebulizer.
Systemic administration also can be by transmucosal or transdermal means. For
transmucosal or
transdermal administration, penetrants appropriate to the barrier to be
permeated are used in the
formulation. Such penetrants generally are known in the art and include, for
example, for
transmucosal administration, detergents, bile salts and fusidic acid
derivatives. Transmucosal
administration can be accomplished through the use of nasal sprays or
suppositories. For transdermal
administration, the active compounds are formulated into ointments, salves,
gels or creams as
generally known in the art.
The compounds also can be prepared in the form of suppositories (e.g., with
conventional suppository
bases such as cocoa butter and other glycerides) or retention enemas for
rectal delivery.
In a particular embodiment, the active compounds are prepared with Garners
that will protect the
compound against rapid elimination from the body, such as a controlled release
formulation, including
implants and microencapsulated delivery systems. Biodegradable, biocompatible
polymers can be
used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid,
collagen, polyorthoesters and
polylactic acid.
Methods for preparation of such formulations will be apparent to those skilled
in the art. The
materials also can be obtained commercially from Alza Corporation and Nova
Pharmaceuticals, Inc.
Liposomal suspensions (including liposomes targeted to infected cells with
monoclonal antibodies)
CA 02473707 2004-07-16
WO 03/061365 PCT/US03/01694
49
also can be used as pharmaceutically acceptable carriers. Those can be
prepared according to methods
known to those skilled in the art, for example, as described in U.S. Patent
No. 4,522,811.
It is especially advantageous to formulate oral or parenteral compositions in
dosage unit form for ease
of administration and uniformity of dosage. Dosage unit form as used herein
refers to physically
discrete units suited as unitary dosages for the subject to be treated; each
unit containing a
predetermined quantity of active compound calculated to produce the desixed
therapeutic effect in
association with the required pharmaceutical carrier. Depending on the type
and severity of the
disease, about 1 ~,g/kg to 15 mglkg (e.g., 0.1 to 20 mg/kg) of compound is an
initial candidate dosage
for administration to the patient, whether, for example, by one or more
separate administrations or by
continuous infusion.. A typical daily dosage might range from about 1 ~,g/kg
to 100 mg/kg or more,
depending on the factors mentioned above. For repeated administrations over
several days or longer,
depending on the condition, the treatment is sustained until a desired
suppression of disease symptoms
occurs. However, other dosage regimens may be useful. The progress of the
therapy is monitored
easily by conventional techniques and assays. An exemplary dosing regimen is
disclosed in ,
WO 94/04188. The specification for the dosage unit forms of the invention are
dictated by arid
directly dependent on the unique characteristics of the active compound and
the particular therapeutic
effect to be achieved and the limitations inherent in the art of compounding
such an active compound
for the treatment of individuals.
z0
Furthermore, a nucleic acid molecule of the present invention can be inserted
into vectors and used as
gene therapy vectors. Gene therapy vectors can be delivered to a subject by,
for example, intravenous
injection, local administration (U.S. Patent No. 5,328,470) or by stereotactic
injection (see, e.g., Chen
et al., Proc Natl Acad Sci USA (1994) 91:3054-3057). The pharmaceutical
preparation of the gene
ZS therapy vector can include the gene therapy vector in an acceptable diluent
or can comprise a slow
release matrix in which the gene delivery vehicle is imbedded. Alternatively,
where the complete
gene delivery vector can be produced intact from recombinant cells, e.g.
retroviral vectors, the
pharmaceutical preparation can include one or more cells that produce the gene
delivery system.
30 The pharmaceutical compositions can be included in a container, pack or
dispenser together with
instructions for administration.
Uses and Methods of the Invention
The nucleic acid molecules, proteins, protein homologues, antibodies of the
present invention, and
35 fragments of such moieties, may be used in one or more of the following
methods: a) screening
CA 02473707 2004-07-16
WO 03/061365 PCT/US03/01694
assays; b) detection assays (e.g., chromosomal mapping, tissue typing,
forensic biology); c) predictive
medicine (e.g., diagnostic assays, prognostic assays, monitoring clinical
trials and
pharmacogenomics); and d) methods of treatment (e.g., therapeutic and
prophylactic). A GAVE6
protein interacts with other cellular proteins, and thus can be used for (i)
regulation of cellular
5 proliferation; (ii) regulation of cellular differentiation; and (iii)
regulation of cell survival. The
isolated nucleic acid molecules of the invention can be used to express GAVE6
protein (e.g., via a
recombinant expression vector in a host cell in gene therapy applications), to
detect GAVE6 mRNA
(e.g., in a biological sample) or to detect a genetic lesion in a GAVE6 gene
and to modulate GAVE6
activity. In addition, a GAVE6 protein can be used to screen drugs or
compounds that modulate
10 GAVE6 activity or expression, as well as to treat disorders characterized
by insufficient or excessive
production of GAVE6 protein. Screening for the production of GAVE6 protein
forms that have
decreased or aberrant activity compared to GAVE6 wild type protein can also be
performed with the
present invention. In addition, an anti-GAVE6 antibody of the invention can be
used to detect and to
isolate GAVE6 proteins and to modulate GAVE6 activity. The invention further
pertains to novel
15 agents identified by the above-described screening assays and uses thereof
for.treatments as described
herein.
Screening Assays
Activation of a G protein receptor in the presence of endogenous ligand allows
for G protein receptor
20 complex formation, thereupon leading to the binding of GTP to the G
protein. The GTPase domain of
the G protein slowly hydrolyzes the GTP to GDP resulting, under normal
conditions, in receptor
deactivation. However, constitutively activated receptors continue to
hydrolyze GDP to GTP.
A non-hydrolyzable substrate of G protein, [35S]GTT''YS, can be used to
monitor enhanced binding to
25 membranes which express constitutively activated receptors. Traynor and
Nahorski reported that
[3sS]GTPyS can be used to monitor G protein coupling to membranes in the
absence and presence of
ligand (Traynor et al., Mol Pharmacol (1995) 47(4):848-54). A preferred use of
such an assay system
is for initial screening of candidate compounds, since the system is
generically applicable to all
G protein-coupled receptors without regard to the particular G protein that
binds to the receptor.
Gsao stimulates the enzyme adenylyl cyclase, while G; and Go inhibit that
enzyme. As is well lrnown
the art, adenylyl cyclase catalyzes the conversion of ATP to cAMP; thus,
constitutively activated
GPCRs that couple the GS protein are associated with increased cellular levels
of cAMP.
Alternatively, constitutively activated GCPRs that might couple the G; (or Go)
protein are associated
with decreased cellular levels of cAMP. See "Indirect Mechanism of Synaptic
Transmission",
CA 02473707 2004-07-16
WO 03/061365 PCT/US03/01694
51
Chpt. 8, from Neuron to Brain (3'~ Ed.), Nichols et al. eds., Sinauer
Associates, Inc., 1992. Thus,
assays that detect cAMP can be used to determine if a candidate compound is an
inverse agonist to the
receptor. A variety of approaches known in the art for measuring cAMP can be
utilized. In one
embodiment, anti-cAMP antibodies are used in an ELISA-based format. In another
embodiment, a
whole cell second messenger reporter system assay is contemplated (see PCT
Publication No.
WO 00/22131).
In a related aspect, cyclic AMP drives gene expression by promoting the
binding of a cAMP-
responsive DNA binding protein or transcription factor (CREB) which then binds
to the promoter at
specific sites called cAMP response elements, and drives the expression of the
gene. Thus, reporter
systems can be constructed which have a promoter containing multiple cAMP
response elements
before the reporter gene, e.g., ~3-galactosidase or luciferase. Further, as a
constitutively activated
GS-linked receptor causes the accumulation of CAMP, that then activates the
gene and expression of
the reporter protein. The reporter protein, such as (3-galactosidase or
luciferase, then can be detected
using standard biochemical assays (PCT Publication No. WO 00/22131).
Other G proteins, such as Go and Gq, are associated with activation of'the
enzyme, phospholipase C,
which in turn hydrolyzes the phospholipid, PIP2, releasing two intracellular
messengers:
diacylglycerol (DAG) and inositol 1,4,5-triphosphate (IP3). Increased
accumulation of IP3 is
associated with activation of Gq associated receptors and Go associated
receptors (PCT Publication
No. WO 00/22131). Assays that detect IP3 accumulation can be used to determine
if a candidate
compound is an inverse agonist to a Gq associated receptor or a Ga-associated
receptor. Gq-associated
receptors also can be examined using an AP1 reporter assays that measures
whether Gq dependent
phospholipase C causes activation of genes containing AP1 elements. Thus,
activated Gq-associated
receptors will demonstrate an increase in the expression of such genes,
whereby inverse agonists will
demonstrate a decrease in such expression.
Also provided herein is a method (also referred to herein as a "screening
assay") for identifying
modulators, i.e., candidate or test compounds or agents (e.g., peptides,
peptidomimetics, small
molecules or other drugs) that bind to GAVE6 proteins or have a stimulatory or
inhibitory effect on,
for example, GAVE6 expression or GAVE6 activity.
In one embodiment, the invention provides assays for screening candidate or
test compounds that bind
to or modulate the activity of the membrane-bound form of a GAVE6 protein,
polypeptide or
biologically active portion thereof. The test compounds of the instant
invention can be obtained using
CA 02473707 2004-07-16
WO 03/061365 PCT/US03/01694
52
any of the numerous approaches in combinatorial library methods known in the
art, including:
biological libraries; spatially addressable parallel solid phase or solution
phase libraries; synthetic
library methods requiring deconvolution; the "one-bead one-compound" library
method; and synthetic
library methods using affinity chromatography selection. The biological
library approach is limited to
peptide libraries, while the other four approaches are applicable to peptide,
non-peptide oligomer or
small molecule libraries of compounds (Lam, Anticancer Drug Des (1997)
12:145).
Examples of methods for the synthesis of molecular libraries can be found in
the art, for example in:
DeWitt et al., Proc Natl Acad Sci USA (1993) 90:6909; Erb et al., Proc Natl
Acad Sci USA (1994)
0 91:11422; Zuckermann et al., J Med Chem (1994) 37:2678; Cho et al., Science
(1993) 261:1303;
Carrell et al., Angew Chem Int Ed Engl (1994) 33:2059; Carell et al., Angew
Chem Int Ed Engl
(1994) 33:2061; and Gallop et al., J Med Chem (1994) 37:1233.
Libraries of compounds may be presented in solution (e.g., Houghten
BiolTechniques (1992)
13:412-421) or on beads (Lam, Nature (1991) 354:82-84), chips (Fodor, Nature
(1993) 364:555-556),
bacteria (U.S. Patent No. 5,223,409), spores (LJ.S. Patent Nos. 5,571,698;
5,403,484; and 5,223,409),
plasmids (Cull et al., Proc Natl Acad Sci USA (1992) 89:1865-1869) or phage
(Scott et al., Science
(1990) 249:386-390; Devlin, Science (1990) 249:404-406; Cwirla et al., Proc
Natl Acad Sci USA
(1990) 87:6378-6382; and Felici, J Mol Biol (1991) 222:301-310).
In a particular embodiment of the present invention, an assay is a cell-based
assay in which a cell that
expresses a membrane-bound form of GAVE6 protein, or a biologically active
portion thereof, on the
cell surface is contacted with a test compound and the ability of the test
compound to bind to a
GAVE6 protein is determined. The cell, for example, can be a yeast cell or a
cell of mammalian
S origin. Determining the ability of the test compound to bind to the GAVE6
protein can be
accomplished, for example, by coupling the test compound with a radioisotope
or enzymatic label so
that binding of the test compound to the GAVE6 protein or biologically active
portion thereof can be
determined by detecting the labeled compound in a complex. For example, test
compounds can be
labeled with'ZSh ssSy4C or 3H, either directly or indirectly and the
radioisotope detected by direct
counting of radioemmission or by scintillation counting. Alternatively, test
compounds can be labeled
enzymatically with, for example, horseradish peroxidase, alkaline phosphatase
or luciferase and the
enzymatic label detected by determination of'conversion of an appropriate
substrate to product. In a
particular embodiment, the assay comprises contacting a cell that expresses a
membrane-bound form
of GAVE6 protein or a biologically active portion thereof, on the cell surface
with a known compound
that binds GAVE6 to form an assay mixture, contacting the assay mixture with a
test compound and
CA 02473707 2004-07-16
WO 03/061365 PCT/US03/01694
53
determining the ability of the test compound to interact with a GAVE6 protein,
wherein determining
the ability of the test compound to interact with a GAVE6 protein comprises
determining the ability of
the test compound to bind preferentially to GAVE6 or a biologically active
portion thereof as
compared to the known compound.
In another embodiment, an assay is a cell-based assay comprising contacting a
cell expressing a
membrane-bound form of GAVE6 protein or a biologically active portion thereof,
on the cell surface
with a test compound and determining the ability of the test compound to
modulate (e.g., stimulate or
inhibit) the activity of the GAVE6 protein or biologically active portion
thereof. Determining the
ability of the test compound to modulate the activity of GAVE6 or a
biologically active portion
thereof can be accomplished, for example, by determining the ability of the
GAVE6 protein to bind to
or to interact with a GAVE6 target molecule. As used herein, a "target
molecule" is a molecule with
which a GAVE6 protein binds or interacts in nature, for example, a molecule on
the surface of a cell
that expresses a GAVE6 protein, a molecule on the surface of a second cell, a
molecule in the
extracellular milieu, a molecule associated with the internal surface of a
cell membrane or a
cytoplasmic molecule. A GAVE6 target molecule can be a non-GAVE6 molecule or a
GAVE6
protein or polypeptide of the instant invention. In one embodiment, a GAVE6
target molecule is a
component of a signal transduction pathway that facilitates transduction of an
extracellular signal
(e.g., a signal generated by binding of a compound to a membrane-bound GAVE6
molecule) through
the cell membrane and into the cell. The target, for example, can be a second
intercellular protein that
has catalytic activity or a protein that facilitates the association of
downstream signaling molecules
with GAVE6.
Determining the ability of the GAVE6 protein to bind to or to interact with a
GAVE6 target molecule
can be accomplished by one of the methods described above for determining
direct binding. In a
particular embodiment, determining the ability of the GAVE6 protein to bind to
or to interact with a
GAVE6 target molecule can be accomplished by determining the activity of the
target molecule. For
example, the activity of the target molecule can be determined by detecting
induction of a cellular
second messenger of the target (e.g., intracellular Caz+, diacylglycerol, Il'3
etc.), detecting
catalyticlenzymatic activity of the target on an appropriate substrate,
detecting the induction of a
reporter gene (e.g., a GAVE6-responsive regulatory element operably linked to
a nucleic acid
encoding a detectable maiker, e.g. luciferase) or detecting a cellular
response, e.g., cellular
differentiation or cell proliferation.
CA 02473707 2004-07-16
WO 03/061365 PCT/US03/01694
54
The present invention further extends to a cell-free assay comprising
contacting a GAVE6 protein, or
biologically active portion thereof, with a test compound, and determining the
ability of the test
compound to bind to the GAVE6 protein or biologically active portion thereof.
Binding of the test
compound to the GAVE6 protein can be determined either directly or indirectly
as described above.
In a preferred embodiment, the assay includes contacting the GAVE6 protein or
biologically active
portion thereof with a lrnown compound that binds GAVE6 to form an assay
mixture, contacting the
assay mixture with a test compound, and determining the ability of the test
compound to interact with
a GAVE6 protein, wherein determining the ability of the test compound to
interact with a GAVE6
protein comprises determining the ability of the test compound to
preferentially bind to GAVE6 or
biologically active portion thereof as compared to the lrnown compound.
Another cell-free assay of the present invention involves contacting GAVE6
protein or biologically
active portion thereof, with a test compound and determining the ability of
the test compound to
modulate (e.g., stimulate or inhibit) the activity of the GAVE6 protein or
biologically active portion
thereof. Determining the ability of the test compound to modulate the activity
of GAVE6 can ~e
accomplished, for example, by determining the ability of the GAVE6 protein to
bind to a GAVE6
target molecule by one of the methods described above for determining direct
binding. In an
alternative embodiment, determining the ability of the test compound to
modulate the activity of
GAVE6 can be accomplished by determining the ability of the GAVE6 protein to
further modulate a
GAVE6 target molecule. For example, the catalytic/enzymatic activity of the
target molecule on an
appropriate substrate can be determined as described previously.
Still another cell-free assay of the present invention comprises contacting
the GAVE6 protein or
biologically active portion thereof, with a lrnown compound that binds GAVE6
to form an assay
mixture, contacting the assay mixture with a test compound and determining the
ability of the test
compound to interact with a GAVE6 protein. The step for determining the
ability of the test
compound to interact with a GAVE6 protein comprises determining the ability of
the GAVE6 protein
preferentially to bind to or to modulate the activity of a GAVE6 target
molecule.
Receptors can be activated by non-ligand molecules that necessarily do not
inhibit ligand binding but
cause structural changes in the receptor to enable G protein binding or,
perhaps receptor aggregation,
dimerization or clustering that can cause activation. For example, antibodies
can be raised to the
various portions of GAVE6 that are exposed at the cell surface. Those
antibodies activate a cell via
the G protein cascade as determined by standard assays, such as monitoring
cAMP levels or
intracellular Ca~2 levels. Because molecular mapping, and particularly epitope
mapping, is involved,
CA 02473707 2004-07-16
WO 03/061365 PCT/US03/01694
monoclonal antibodies may be preferred. The monoclonal antibodies can be
raised both to intact
receptor expressed at the cell surface and peptides lrnown to form at the cell
surface. The method of
Geysen et al., U.S. Pat. No. 5,998,577, can be practiced to obtain a plurality
of relevant peptides.
Antibodies found to activate GAVE6 may be modified to minimize activities
extraneous to GAVE6
activation, such as complement fixation. Thus, the antibody molecules can be
truncated or mutated to
minimize or to remove activities outside of GAVE6 activation. For example, for
certain antibodies,
only the antigen-binding portion is needed. Thus, the F~ portion of the
antibody can be removed.
Cells expressing GAVE6 are exposed to antibody to activate GAVE6. Activated
cells then are
~10 exposed to various molecules in order to identify which molecules modulate
receptor activity, and
result in higher activation levels or lower activation levels. Molecules that
achieve those goals then
can be tested on cells expressing GAVE6 without antibody to observe the effect
on non-activated
cells. The target molecules then can be tested and modified as candidate drugs
for the treatment of
disorders associated with altered GAVE6 metabolism using lrnown techniques.
The cell-free assays of the instant invention are amenable to use of both the
soluble form and 'the
membrane-bound form of GAVE6. In the case of cell-free assays comprising the
membrane-bound
form of GAVE6, it may be desirable to utilize a solubilizing agent such that
the membrane-bound
form of GAVE6 is maintained in solution. Examples of such solubilizing agents
include non-ionic
detergents such as n-octylglucoside, n-dodecylglucoside, n-dodecylmaltoside,
octanoyl-N-methylglucamide, decanoyl N-methylglucamide, TRITON X-100, TRITON X-
114,
THESTT, isotridecylpoly(ethylene glycol ether)", 3-[(3-
cholamidopropyl)dimethylammino]-1-propane
sulfonate (CHAPS), 3-[(3-cholamidopropyl)dimethylamrnino]-2-hydroxy-1-propane
sulfonate
(CHAPSO) or N-dodecyl=N,N-dimethyl-3-ammonio-1-propane sulfonate.
In more than one embodiment of the above assay methods of the instant
invention, it may be desirable
to immobilize either GAVE6 or a target molecule thereof to facilitate
separation of complexed from
uncomplexed forms of one or both of the proteins, as well as to accommodate
automation of the assay.
Binding of a test compound to GAVE6 or interaction of GAVE6 with a target
molecule in the
presence and absence of a candidate compound, can be accomplished in any
vessel suitable for
containing the reactants. Examples of such vessels include microtitre plates,
test tubes and
micro-centrifuge tubes. In one embodiment, a fusion protein can be provided
that adds a domain that
allows one or both of the proteins to be bound to a matrix. For example,
glutathione-S-transferase/GAVE6 fusion proteins or glutathione-S-
transferase/target fusion proteins
can be adsorbed onto glutathione SEPHAROSE beads (Sigma Chemical, St. Louis,
MO).
CA 02473707 2004-07-16
WO 03/061365 PCT/US03/01694
56
Alternatively, glutathione-derivatized microtitre plates are then combined
with the test compound or
the test compound. Subsequently, either the non-adsorbed target protein or
GAVE6 protein and the
mixture are incubated under conditions conducive to complex formation (e.g.,
at physiological
conditions for salt and pH). Following incubation, the beads or microtitre
plate wells are washed to
remove any unbound components, and the presence of complex formation is
measured either directly
or indirectly. Alternatively, the complexes can be dissociated from the matrix
and the level of
GAVE6 binding or activity determined using standard techniques.
Other techniques for immobilizing proteins on matrices can also be used in the
screening assays of the
invention. For example, either GAVE6 or a target molecule thereof can be
immobilized utilizing
conjugation of biotin and streptavidin. Biotinylated GAVE6 or target molecules
can be prepared from
biotin-NHS (N-hydroxy-succinimide) using techniques well known in the art
(e.g., biotinylation kit,
Pierce Chemicals, Rockford, IL) and immobilized in the wells of streptavidin-
coated 96-well plates
(Pierce Chemicals). Alternatively, antibodies that are reactive with GAVE6 or
a target molecule, but
do not interfere with binding of the GAVE6 protein to the target molecule, can
be derivatized to the
wells of the plate. Upon incubation, unbound target or GAVE6 can be trapped in
the wells by
antibody conjugation. Methods for detecting such complexes, in addition to
those described above for
the GST-immobilized complexes, include immunodetection of complexes using
antibodies reactive
with GAVE6 or target molecule, as well as enzyme-linked assays that rely on
detecting an enzymatic
activity associated with the GAVE6 or target molecule.
In another embodiment, modulators of GAVE6 expression are identified in a
method wherein a cell is
contacted with a candidate compound, and the expression of GAVE6 mRNA or
protein in the cell is
determined. The level of expression of GAVE6 mRNA or protein in the presence
of the candidate
compound is compared to the level of expression of GAVE6 mRNA or protein in
the absence of the
candidate compound. The candidate compound then can be identified as a
modulator of GAVE6
expression based on that comparison. For example, when expression of GAVE6
mRNA or protein is
greater (statistically significantly greater) in the presence of the candidate
compound than in the
absence thereof, the candidate compound is identified as a stimulator or
agonist of GAVE6 mRNA or
protein expression. Alternatively, when expression of GAVE6 mRNA or protein is
less (statistically
significantly less) in the presence of the candidate compound than in the
absence thereof, the
candidate compound is identified as an inhibitor or antagonist of GAVE6 mRNA
or protein
expression. ~If GAVE6 activity is reduced in the presence of ligand or
agonist, or in a constitutive
GAVE6, below baseline, the candidate compound is identified as an inverse
agonist. The level of
CA 02473707 2004-07-16
WO 03/061365 PCT/US03/01694
57
GAVE6 mRNA or protein expression in the cells can be determined by methods
described herein for
detecting GAVE6 mRNA or protein.
In yet another aspect of the invention, the GAVE6 proteins can be used as
"bait proteins" in a
two-hybrid assay or three-hybrid assay (see, e.g., U.S. Patent No. 5,283,317;
Zervos et al., Cell (1993)
72:223-232; Madura et al., J Biol Chem (1993) 268:12046-12054; Bartel et al.,
Bio/Techniques (1993)
14:920-924; Iwabuchi et al., Oncogene (1993) 8:1693-1696; and PCT Publication
No. WO 94/10300),
to identify other proteins that bind to or interact with GAVE6 ("GAVE6-binding
proteins" or
"GAVE6-by"), and modulate GAVE6 activity. Such GAVE6-binding proteins are also
likely to be
involved in the propagation of signals by the GAVE6 proteins such as, for
example, upstream or
downstream elements of the GAVE6 pathway.
Since the present invention enables the production of large quantities of pure
GAVE6, physical
characterization of the conformation of areas of likely function can be
ascertained for rational drug
design. For example, the IC3 region of the molecule and EC domains are regions
of particular
interest. Once the shape and ionic configuration of a region is discerned,
candidate drugs that should
interact with those regions can be configured and then tested in intact cells,
animals and patients.
Methods that would enable deriving such 3-D structure information include X-
ray crystallography,
NMR spectroscopy, molecular modeling and so on. The 3-D structure also can
lead to identification
of analogous conformational sites in other known proteins where known drugs
that act at site exist.
Those drugs, or derivatives thereof, may find use with GAVE6.
The invention further pertains to novel agents identified by the above-
described screening assays and
uses thereof for treatments as described herein.
Assays of the Present Invention
A. Detection Assays
Portions or fragments of the DNA sequences of the present invention can be
used in numerous ways
as polynucleotide reagents. For example, the sequences can be used to: (i) map
the respective genes
on a chromosome and, thus, locate gene regions associated with genetic
disease; (ii) identify an
individual from a minute biological sample (tissue typing); and (iii) aid in
forensic identification of a
biological sample. The applications are described in the subsections below.
CA 02473707 2004-07-16
WO 03/061365 PCT/US03/01694
58
1. Chromosome Mapping
Once the sequence (or a portion of the sequence) of a gene has been isolated,
the sequence can be used
to map the location of the GAVE6 gene on a chromosome. Accordingly, GAVE6
nucleic acid
molecules described herein or fragments thereof can been used to map the
location of GAVE6 in a
genome. The mapping of the location of the GAVE6 sequence in a genome,
particularly a human
genome, is an important first step in correlating the sequences with genes
associated with disease.
Briefly, GAVE6 genes can be mapped in a genome by preparing PCR primers
(preferably 15-25 by in
length) from the GAVE6 sequences. The primers are used for PCR screening of
somatic cell hybrids
containing individual human chromosomes. Only those hybrids containing the
human gene
corresponding to the GAVE6 sequences yield an amplified fragment.
Somatic cell hybrids are prepared by fusing somatic cells from different
mammals (e.g., human and
mouse cells). As hybrids of human and mouse cells grow and divide, generally
human chromosomes
are lost in random order, but the mouse chromosomes are retained. By using
media in which mouse
cells cannot grow (because of lack of a particular enzyme), but in which human
cells can grow, the
one human chromosome that contains the gene encoding the needed enzyme will be
retained. By
using various media, panels of hybrid cell lines are established. Each cell
line in a panel contains
either a single human chromosome or a small number of human chromosomes and a
full set of mouse
chromosomes, allowing easy mapping of individual genes to specific human
chromosomes.
(D'Eustachio et al., Science (1983) 220:919-924). Somatic cell hybrids
containing only fragments of
human chromosomes also can be produced by using human chromosomes with
translocations arid
deletions.
PCR mapping of somatic cell hybrids is a rapid procedure for assigning a
particular sequence to a
particular chromosome. Three or more sequences can be assigned per day using a
single
thermocycler.
Other mapping strategies that can similarly be used to map a GAVE6 sequence to
a particular
chromosome in a genome include in situ hybridization (described in Fan et al.,
Proc Natl Acad Sci
USA (1990) 87:6223-27), pre-screening with labeled flow-sorted chromosomes and
pre-selection by
hybridization to chromosome-specific cDNA libraries.
Fluorescence in situ hybridization (FISH) of a DNA sequence to a metaphase
chromosomal spread can
also be used to provide a precise chromosomal location in one step. Chromosome
spreads can be
CA 02473707 2004-07-16
WO 03/061365 PCT/US03/01694
59
made using cells in which division has been blocked in metaphase by a
chemical, e.g., colcemid, that
disrupts the mitotic spindle. The chromosomes can be treated briefly with
trypsin and then stained
with Giemsa. A pattern of light and dark bands develops on each chromosome so
that the
chromosomes can be identified individually. The FISH technique can be used
with a DNA sequence
as short as 500 or 600 bases. However, clones larger than 1,000 bases have a
higher likelihood of
binding to a unique chromosomal location with sufficient signal intensity for
simple detection.
Preferably 1,000 bases and more preferably, 2,000 bases will suffice to get
good results in a
reasonable amount of time. For a review of the technique, see Verma et al.
(Human Chromosomes: A
Manual of Basic Techniques (Pergamon Press, New York, 1988)). Chromosomal
mapping can be
inferred in silico, and employing statistical considerations, such as lod
scores or mere proximity.
Reagents for chromosome mapping can be used individually to locate a single
site on a chromosome.
Furthermore, panels of reagents can be used for marking multiple sites and/or
multiple chromosomes.
Reagents corresponding to flanking regions of the GAVE6 gene actually are
preferred for mapping
purposes. Coding sequences are more likely to be conserved within gene
families, thus increasing the
chance of cross hybridization during chromosomal mapping. '
Once a sequence has been mapped to a precise chromosomal location, the
physical position of the
sequence on the chromosome can be correlated with genetic map data. (Such data
are found, for
example, in McKusick, Mendelian Inheritance in Man, available on-line through
Johns Hopkins
University, Welch Medical Library). The relationship between genes and
disease, mapped to the same
chromosomal region, can then be identified through linkage analysis (co-
inheritance of physically
adjacent genes), described in, e.g., Egeland et al., Nature (1987) 325:783-
787.
Moreover, differences in the DNA sequences between individuals affected and
unaffected with a
disease associated with GAVE6 can be determined. If a mutation is observed in
some or all of the
affected individuals, but not in any unaffected individuals, then the mutation
is likely to be the
causative agent of the particular disease. Comparison of affected and
unaffected individuals generally
involves first looking for structural alterations in the chromosomes such as
deletions or translocations
that are visible from chromosome spreads or detectable using PCR based on that
DNA sequence.
ITltimately, complete sequencing of genes from several individuals can be
performed to confirm the
presence of a mutation and to distinguish mutations from polymorphisms.
CA 02473707 2004-07-16
WO 03/061365 PCT/US03/01694
2. Tissue Typing
A GAVE6 sequence of the present invention also can be used to identify
individuals from minute
biological samples. The United States military, for example, is considering
the use of restriction
fragment length polymorphism (RFLP) for identification of personnel. In the
technique, genomic
DNA of an individual is digested with one or more restriction enzymes and
probed on a Southern blot
to yield unique bands for identification. The method does not suffer from the
current limitations of
"Dog Tags" that can be lost, switched or stolen, making positive
identification difficult. The
sequences of the instant invention are useful as additional DNA markers for
RFLP (described in
U.S. Patent No. 5,272,057).
Furthermore, the sequences of the instant invention can be used to provide an
alternative technique
that determines the actual base-by-base DNA sequence of selected portions of
the genome of an
individual. 'Thus, a GAVE6 sequence described herein can be used to prepare
two PCR primers from
the 5' and 3' ends of the sequences. The primers then can be used to amplify
the DNA of an
individual and subsequently provide a sequence thereof.
Panels of corresponding DNA sequences from individuals, prepared in that
manner, can provide
unique individual identifications, as each individual will have a unique set
of such DNA sequences
due to allelic differences. The sequences of the instant invention can be used
to obtain such
LO identification sequences from individuals and from tissue. GAVE6 sequence
of the invention uniquely
represents portions of the human genome. Allelic variation occurs to some
degree in the coding
regions of the sequences and to a greater degree in the noncoding regions. It
is estimated that allelic
variation between individual humans occurs with a frequency of about once per
each 500 bases. Each
of the sequences described herein can, to some degree, be used as a standard
against which DNA from
?5 an individual can be compared for identification purposes. Because greater
numbers of
polymorphisms occur in the noncoding regions, fewer sequences are necessary to
differentiate
individuals. The noncoding sequences of SEQ ID NO:1 can provide positive
individual identification
with a panel of perhaps 10 to 1,000 primers that each yield a noncoding
amplified sequence of 100
bases. If predicted coding sequences, such as those in SEQ )D NO:1 are used, a
more appropriate
30 number of primers for positive individual identification would be 500-
2,000.
If a panel of reagents from GAVE6 sequences described herein is used to
generate a unique
identification database for an individual, those same reagents can later be
used to identify tissue from
that individual. Using the unique identification database, positive
identification of the individual,
15 living or dead, can be made from extremely small tissue samples.
CA 02473707 2004-07-16
WO 03/061365 PCT/US03/01694
61
Use of Partial GAVE6 Sequences in Forensic Biology
DNA-based identification techniques also can be used in forensic biology.
Forensic biology is a
scientific field employing genetic typing of biological evidence found at a
crime scene as a means for
positively identifying, for example, a perpetrator of a crime. To make such an
identification, PCR
technology can be used to amplify DNA sequences taken from very small
biological samples such as
tissues, e.g., hair or skin, or body fluids, e.g., blood, saliva or semen
found at a crime scene. The
amplified sequence then can be compared to a standard, thereby allowing
identification of the origin
of the biological sample.
The sequences of the instant invention can be used to provide polynucleotide
reagents, e.g., PCR
primers, targeted to specific loci in the human genome, that can enhance the
reliability of DNA-based
forensic identifications. For example, a nucleic acid of interest can provide
another "identification
marker" (i.e., another DNA sequence that is unique to a particular
individual). As mentioned above,
actual base sequence information can be used for identification as an accurate
alternative to patterns
formed by restriction enzyme generated fragments. Sequences targeted to
noncoding regions'of
SEQ )D NO:1 are particularly appropriate for that use as greater numbers of
polymorphisms occur in
the noncoding regions, enhancing discrimination to differentiate individuals
using that technique.
Examples of polynucleotide reagents, include the GAVE6 sequences or portions
thereof; e.g.,
fragments derived from the noncoding regions of SEQ )D NO:1 having a length of
at least 20 or 30
bases.
The GAVE6 sequences described herein further can be used to provide
polynucleotide reagents, e.g.,
labeled or labelable probes that can be used in, for example, an in situ
hybridization technique, to
identify a specific tissue, e.g., brain tissue. Such polynucleotide reagents
can be very useful in cases
in which a forensic pathologist is presented with a tissue of unknown origin.
Panels of such GAVE6
probes can be used to identify tissue by species and/or by organ type.
In a similar fashion, the reagents, e.g., GAVE6 primers or probes, can be used
to screen tissue culture
for contamination (i.e., screen for the presence of a mixture of different
types of cells in a culture).
B. Predictive Medicine
The instant invention also pertains to the field of predictive medicine in
that diagnostic assays,
prognostic assays, pharmacogenomics and monitoring clinical trials are used
for prognostic
(predictive) purposes to treat an individual prophylactically. Accordingly,
one aspect of the present
CA 02473707 2004-07-16
WO 03/061365 PCT/US03/01694
62
invention relates to diagnostic assays for determining GAVE6 protein and/or
nucleic acid expression
as well as GAVE6 activity in the context of a biological sample (e.g., blood,
urine, feces, sputum,
serum, cells and tissue). The assay can be used to determine whether an-
individual is afflicted with a
disease or disorder, or is at risk of developing a disorder, associated with
aberrant GAVE6 expression
or activity.
The invention also provides for prognostic (or predictive) assays for
determining whether an
individual is at risk of developing a disorder associated with GAVE6 protein,
nucleic acid expression,
or activity. For example, mutations in a GAVE6 gene can be assayed in a
biological sample. Such
assays can be used for prognostic or predictive purpose thereby to treat
prophylactically an individual
prior to the onset of a disorder characterized by or associated with GAVE6
protein, nucleic acid
expression or activity.
Another aspect of the invention provides methods for determining GAVE6
protein, nucleic acid
expression or GAVE6 activity in an individual thereby to select appropriate
therapeutic or
prophylactic agents for that individual (referred to herein as
"pharmacogenomics"). '
Pharmacogenomics allows for the selection of agents (e.g., drugs) for
therapeutic or prophylactic
treatment of an individual based on the genotype of the individual (e.g., the
genotype of the individual
examined to determine the ability of the individual to respond to a particular
agent).
Yet another aspect of the invention pertains to monitoring the influence of
agents (e.g., drugs or other
compounds) on the expression or activity of GAVE6 in clinical trials. Those
and other agents are
described in further detail in the following sections.
1. Diagnostic Assays
An exemplary method for detecting the presence or absence of GAVE6 in a
biological sample
involves obtaining a biological sample from a test subject and contacting the
biological sample with a
compound or an agent capable of detecting GAVE6 protein or nucleic acid (e.g.,
mRNA or genomic
DNA) that encodes GAVE6 protein such that the presence of GAVE6 is detected in
the biological
sample. A preferred agent for detecting GAVE6 mRNA or genomic DNA is a labeled
nucleic acid
probe capable of hybridizing to GAVE6 mRNA or genomic DNA. The nucleic acid
probe can be, for
example, a full-length GAVE6 nucleic acid, such as the nucleic acid of SEQ )D
NO:1 or a portion
thereof, such as an oligonucleotide of at least 15, 30, 50, 100, 250 or S00 or
more nucleotides in length
and sufficient to specifically hybridize under stringent conditions to GAVE6
mRNA or genomic
DNA. Other suitable probes for use in the diagnostic assays of the invention
are described herein.
CA 02473707 2004-07-16
WO 03/061365 PCT/US03/01694
63
A particular agent for detecting GAVE6 protein is an antibody capable of
binding to GAVE6 protein,
preferably an antibody with a detectable label. Antibodies can be polyclonal,
chimeric, or more ~~
preferably, monoclonal. An intact antibody or a fragment thereof (e.g., Fab or
F~ab~z) can be used. The
term "biological sample" is intended to include tissues, cells and biological
fluids isolated from a
subject, as well as tissues, cells and fluids present within a subject. That
is, the detection method of
the invention can be used to detect GAVE6 mRNA, protein or genomic DNA in a
biological sample in
vitro as well as in vivo. For example, in vitro techniques for detection of
GAVE6 mRNA include
Northern hybridization and in situ hybridization. In vitro techniques for
detection of GAVE6 protein
include ELISA, Western blot, immunoprecipitation and immunofluorescence. In
vitro techniques for
detection of GAVE6 genomic DNA include Southern hybridization. Furthermore, in
vivo techniques
for detection of GAVE6 protein include introducing into a subject a labeled
anti-GAVE6 antibody.
For example, the antibody can be labeled with a radioactive marker, the
presence and location of
which in a subject can be detected by standard imaging techniques.
,
In an embodiment, the biological sample contains protein molecules from the
test subject.
Alternatively, the biological sample can contain mRNA molecules from the test
subject or genomic
DNA molecules from the test subj ect. A particular biological sample having
applications herein is a
peripheral blood leukocyte sample isolated by conventional means from a
subject.
Hence, association with a disease and identification of nucleic acid or
protein polymorphism
diagnostic for the carrier or the affected can be beneficial in developing
prognostic or diagnostic
assays. For example, it would be beneficial to have a prognostic or diagnostic
assay for rheumatoid
arthritis, asthma, Crohn's Disease and so on. GAVE6 expression is elevated in
cells associated with
activated or inflammatory states. Disorders associated with inflammation
include, anaphylactic states,
colitis, Crohn's Disease, edematous states, contact hypersensitivity, allergy,
other forms of arthritis,
meningitis and other conditions wherein the immune system reacts to an insult
by vascular dilation,
heat, collecting cells, fluids and the like at a site resulting in swelling
and the like. Thus, a disorder in
GAVE6 metabolism may be diagnostic for rheumatoid arthritis. Moreover, the
molecular mechanism
of rheumatoid arthritis may be detectable, such as, there may be a diagnostic
SNP, RFLP, variability
of expression level, variability of function and so on, that can be detectable
in a tissue sample, such as
a blood sample.
In another embodiment, the methods further involve obtaining a biological
sample from a control
subject, contacting the control sample with a compound or agent capable of
detecting GAVE6 protein,
CA 02473707 2004-07-16
WO 03/061365 PCT/US03/01694
64
mRNA or genomic DNA, such that the presence and amount of GAVE6 protein, mRNA
or genomic
DNA is detected in the biological sample, and then comparing the presence and
amount of GAVE6
protein, mRNA or genomic DNA in the control sample with the presence and
amount of GAVE6
protein, mRNA or genomic DNA in a test sample. .
Hiah throughput assays of chemical libraries
Any of the assays for compounds capable of modulating the activity of GAVE6
are amenable to high
throughput screening. High throughput screening systems are commercially
available (see, e.g.,
Zymark Corp., Hopkinton, MA; Air Technical Industries, Mentor, OH; Beckman
Instruments, Inc.
Fullerton, CA; Precision Systems, Inc., Natick, MA, etc.). These systems
typically automate entire
procedures including all sample and reagent pipetting, liquid dispensing,
timed incubations, and final
readings of the microplate in detectors) appropriate for the assay. These
configurable systems
provide high thruput and rapid start up as well as a high degree of
flexibility and customization. The
manufacturers of such systems provide detailed protocols the various high
throughput. Thus, for
example, Zymark Corp. provides technical bulletins describing screening
systems for detecting the
modulation of gene transcription, ligand binding, and the like.
Kits
The invention also encompasses kits for detecting the presence of GAVE6 in a
biological sample (a
test sample). Such kits can be used to determine if a subject is suffering
from or is at increased risk of
developing a disorder associated with aberrant expression of GAVE6 (e.g., an
immunological
disorder). For example, the kit can comprise a labeled compound or agent
capable of detecting
GAVE6 protein or mRNA in a biological sample and means for determining the
amount of GAVE6 in
the sample (e.g., an anti-GAVE6 antibody or an oligonucleotide probe that
binds to DNA encoding
GAVE6, e.g., SEQ ID NO:1). Kits also can be used to yield results indicating
whether the tested
subject is suffering from or is at risk of developing a disorder associated
with aberrant expression of
GAVE6, if the amount of GAVE6 protein or mRNA is above or below a normal
level.
For antibody-based kitsa the kit can comprise, for example: (1) a first
antibody (e.g., attached to a
solid support) that binds to GAVE6 protein; and, optionally, (2) a second,
different antibody that
binds to GAVE6 protein or to the first antibody and is conjugated to a
detectable agent. If the second-'
antibody is not present, then either the first antibody can be detectably
labeled, or alternatively,
another molecule that binds the first antibody can be detectably labeled. In
any event, a labeled
binding moiety is included to serve as the detectable reporter molecule, as
known in the art.
CA 02473707 2004-07-16
WO 03/061365 PCT/US03/01694
For oligonucleotide-based kits, a kit of the present invention can comprise,
for example: (1) an
oligonucleotide, e.g., a detectably-labeled oligonucleotide, that hybridizes
to a GAVE6 nucleic acid
sequence or (2) a pair of primers useful for amplifying a GAVE6 nucleic acid
molecule.
5 The kit also can comprise, e.g., a buffering agent, a preservative or a
protein stabilizing agent. The kit
also can comprise components necessary for detecting the detectable agent
(e.g., an enzyme or a
substrate). Furthermore, the kit may also contain a control sample or series
of control samples that
can be assayed and compared to the test sample. Each component of the kit is
usually enclosed
within an individual container, and all of the various containers are within a
single package.
10 Instructions for observing whether the tested subject is suffering from or
is at risk of developing a
disorder associated with aberrant expression of GAVE6 may also be enclosed.
2. Prognostic Assays
The methods described herein furthermore can be utilized as diagnostic or
prognostic assays to
15 identify subjects having or are at risk of developing a disease or disorder
associated with aberrant
GAV E6 expression or activity. For example, the assays described herein, such
as the preceding
diagnostic assays or the following assays, can be utilized to identify a
subject having, or is at risk of
developing, a disorder associated with GAVE6 protein, nucleic acid expression
or activity. For
example, recent contact with bacteria or inflammation associated with asthma,
chronic obstructive
20 pulmonary disease and rheumatoid arthritis are amenable for assay.
Alternatively, the prognostic
assays can be utilized to identify a subject having or is at risk for
developing such a disease or
disorder.
Thus, the instant invention provides a method in which a test.sample is
obtained from a subject and
25 GAVE6 protein or nucleic acid (e.g., mRNA or genomic DNA) is detected. The
presence of GAVE6
protein or nucleic acid is diagnostic of a subject having, or is at risk of
developing, a disease or
disorder associated with aberrant GAVE6 expression or activity. As used
herein, a "test sample"
refers to a biological sample obtained from a subject of interest. For
example, a test sample can be a
biological fluid (e.g., serum), cell sample or tissue.
Furthermore, the prognostic assays described herein can be used to determine
whether a subject can be
administered an agent (e.g., an agonist, antagonist, peptidomimetic, protein,
peptide, nucleic acid,
small molecule or other drug candidate) to treat a disease or disorder
associated with aberrant GAVE6
expression or activity. For example, such methods can be used to determine
whether a subject can be
treated effectively with a specific agent or class of agents (e.g., agents of
a type that decrease GAVE6
CA 02473707 2004-07-16
WO 03/061365 PCT/US03/01694
66
activity). Thus, the instant invention provides methods for determining
whether a subject can be
treated effectively with an agent for a disorder associated with aberrant
GAVE6 expression or activity
in which a test sample is obtained and GAVE6 protein or nucleic acid is
detected (e.g., wherein the
presence of GAVE6 protein or nucleic acid is diagnostic of a subject that can
be administered the
agent to treat a disorder associated with aberrant GAVE6 expression or
activity).
°The methods of the invention also can be used to detect genetic
lesions or mutations in a GAVE6
gene, and thereby determine whether a subject with the lesioned gene is at
risk for a disorder
characterized by aberrant cell proliferation and/or differentiation. In
preferred embodiments, the
methods include detecting, in a sample of cells from the subject, the presence
or absence of a genetic
lesion or mutation characterized by at least one of an alteration affecting
the integrity of a gene
encoding a GAVE6-protein or the mis-expression of the GAVE6 gene. For example,
such genetic
lesions or mutations can be detected by ascertaining the existence of at least
one of 1) a deletion of
one or more nucleotides from a GAVE6 gene; 2) an addition of one or more
nucleotides to a GAVE6
gene; 3) a substitution of one or more nucleotides of a GAVE6 gene; 4) a
chromosomal rearrangement
involving a GAVE6 gene; 5) an alteration in the level of a messenger RNA
transcript of a GAVE6
gene; 6) an aberrant modification of a GAVE6 gene, such as of the methylation
pattern of the genomic
DNA; 7) a non-wild type level of a GAVE6 protein; 8) an allelic loss of a
GAVE6 gene; and 9) an
inappropriate post-translational modification of a GAVE6 protein. As described
herein, there are a
large number of assay techniques known in the art that can be used for
detecting lesions in a GAVE6
gene. A preferred biological sample is a peripheral blood leukocyte sample
isolated by conventional
means from a subject.
In certain embodiments, detection of the lesion involves the use of a
probe/primer in a polymerase
chain reaction (PCR) (see, e.g., U.S Patent Nos. 4,683,195 and 4,683,202),
such as anchor PCR or
RACE PCR, or, alternatively, in a ligation chain reaction (LCR) (see, e.g.,
Landegran et al., Science
(1988) 241:1077-1080; and Nakazawa et al., Proc Natl Acad Sci USA (1994)
91:360-364), the latter
of which can be particularly useful for detecting point mutations in the GAVE6
gene (see, e.g.,
Abravaya et al., Nucleic Acids Res (1995) 23:675-682). The method can include
the steps of
collecting a sample of cells from a patient, isolating nucleic acid (e.g.,
genomic, mRNA or both) from
the cells of the sample, contacting the nucleic acid sample with one or more
primers that specifically
hybridize to a GAVE6 gene under conditions such that hybridization and
amplification of the GAVE6
gene (if present) occurs and detecting the presence or absence of an
amplification product or detecting
the size of the amplification product and comparing the length to a control
sample. It is anticipated
CA 02473707 2004-07-16
WO 03/061365 PCT/US03/01694
67
that PCR and/or LCR may be desirable to use as a preliminary amplification
step in conjunction with
any of the techniques used for detecting mutations described herein.
Alternative amplification methods include: self sustained sequence replication
(Guatelli et al., Proc
Natl Acad Sci USA (1990) 87:1874-1878), transcriptional amplification system
(Kwoh et al., Proc
Natl Acad Sci USA (1989) 86:1173-1177), Q-(3 replicase (Lizardi et al.,
Bio/Technology (1988)
6:1197) or any other nucleic acid amplification method, followed by the
detection of the amplified
molecules using techniques well known to those of skill in the art. The
detection schemes are
especially useful for the detection of nucleic acid molecules if such
molecules are present in very low
numbers.
0
~n an alternative embodiment, mutations in a GAVE6 gene from a sample cell can
be identified by
alterations in restriction enzyme cleavage patterns. For example, sample and
control DNA is isolated,
amplified (optionally), digested with one or more restriction endonucleases
and fragment length sizes
are determined by gel electrophoresis and compared. Differences in fragment
length sizes between
sample and control DNA indicate mutations in the sample DNA. Moreover, the use
of sequence
specific ribozymes (see, e.g., U.S. Patent No. 5,498,531) can be used to score
for the presence'of
specific mutations by development or loss of a ribozyme cleavage site.
In other embodiments, genetic mutations in GAVE6 can be identified by
hybridizing a sample and
;0 control nucleic acids, e.g., DNA or RNA, to high density arrays containing
hundreds or thousands of
oligonucleotides probes (Cronin et al., Human Mutation (1996) 7:244-255; Kozal
et al., Nature
Medicine (1996) 2:753-759). For example, genetic mutations in GAVE6 can be
identified in
two-dimensional arrays containing light-generated DNA probes as described in
Cronin et al., supra.
Briefly, a first hybridization array of probes can be used to scan through
long stretches of DNA in a
.5 sample and control to identify base changes between the sequences by
generating linear arrays of
sequential overlapping probes. That step allows the identification of point
mutations. The step is
followed by a second hybridization array that allows the characterization of
specific mutations by
using smaller, specialized probe arrays complementary to all variants or
mutations detected. Each
mutation array is composed of parallel probe sets, one complementary to the
wild type gene and the
0 other complementary to the mutant gene.
In yet another embodiment, any of a variety of sequencing reactions known in
the art can be used to
directly sequence the GAVE6 gene and detect mutations by comparing the
sequence of the sample
GAVE6 with the corresponding wild type (control) sequence. Examples of
sequencing reactions
include those based on techniques developed by Maxam & Gilbert (Proc Natl Acad
Sci USA (1977)
CA 02473707 2004-07-16
WO 03/061365 PCT/US03/01694
68
74:560) or Sanger (Proc Natl Acad Sci USA (1977) 74:5463). It also is
contemplated that any of a
variety of automated sequencing procedures can be utilized when performing the
diagnostic assays
(Bio/Techniques (1995) 19:448), including sequencing by mass spectrometry
(see, e.g., PCT
Publication No. WO 94/16101; Cohen et al., Adv Chromatogr (1996) 36:127-162;
and Griffin et al.,
Appl Biochem Biotechnol (1993) 38:147-159).
Other methods for detecting mutations in the GAVE6 gene include methods in
which protection from
cleavage agents is used to detect mismatched bases in RNA/RNA or RNA/DNA
heteroduplexes
(Myers et al., Science (1985) 230:1242). In general, the technique of
"mismatch cleavage" entails
providing heteroduplexes formed by hybridizing (labeled) RNA or DNA containing
the wild type
GAVE6 sequence with potentially mutant RNA or DNA obtained from a tissue
sample. The
double-stranded duplexes are treated with an agent that cleaves single-
stranded regions of the duplex
such as that will exist due to base pair mismatches between the control and
sample strands.
RNA/DNA duplexes can be treated with RNase to digest mismatched regions and
DNA/DNA hybrids
can be treated with S 1 nuclease to digest mismatched regions. In other
embodiments, either
DNA/DNA or RNA/DNA duplexes can be treated with hydroxylamine or osmium
tetroxide and with
piperidine to digest mismatched regions. After digestion of the mismatched
regions, the resulting
material then is separated by size on denaturing polyacrylamide gels to
determine the site of mutation.
See, e.g., Cotton et al., Proc Natl Acad Sci USA (1988) 85:4397; Saleeba et
al., Methods Enzymol
(1992) 217:286-295. In a preferred embodiment, the control DNA or RNA can be
labeled for
detection.
In still another embodiment, the mismatch cleavage reaction employs one or
more proteins that
recognize mismatched base pairs in double-stranded DNA (so called "DNA
mismatch repair"
enzymes) in defined systems for detecting and mapping point mutations in GAVE6
cDNAs obtained
from samples of cells. For example, the mutt enzyme of E. coli cleaves A at
G/A mismatches and the
thymidine DNA glycosylase from HeLa cells cleaves T at G/T mismatches (Hsu et
al., Carcinogenesis
(1994) 15:1657-1662). According to an exemplary embodiment, a probe based on a
GAVE6
sequence, e.g., a wild type GAVE6 sequence, is hybridized to a cDNA or other
DNA product from a
test cell(s). The duplex is treated with a DNA mismatch repair enzyme and the
cleavage products, if
any, can be detected in electrophoresis protocols or the like, see, e.g., U.S.
Patent No. 5,459,039.
In other embodiments, alterations in electrophoretic mobility will be used to
identify mutations in
GAVE6 genes. For example, single-strand conformation polymorphism (SSCP) may
be used to detect
differences in electrophoretic mobility between mutant and wild type nucleic
acids (Orita et al., Proc
CA 02473707 2004-07-16
WO 03/061365 PCT/US03/01694
69
Natl Acad Sci USA (1989) 86:2766; see also Cotton, Mutat Res (1993) 285:125-
144; Hayashi, Genet
Anal Tech Appl (1992) 9:73-79). Single-stranded DNA fragments of sample and
control GAVE6
nucleic acids will be denatured and allowed to renature. The secondary
structure of single-stranded
nucleic acids varies according to sequence and the resulting alteration in
electrophoretic mobility
enables the detection of even a single base change. The DNA fragments may be
labeled or detected
with labeled probes. The sensitivity of the assay may be enhanced by using RNA
(rather than DNA)
because the secondary structure of RNA is more sensitive to a change in
sequence. In a preferred
embodiment, the subject method utilizes heteroduplex analysis to separate
double-stranded
heteroduplex molecules on the basis of changes in electrophoretic mobility
(Keen et al., Trends Genet
(1991) 7:5).
In yet another embodiment, the movement of mutant or wild type fragments in
polyacrylamide gels
containing a gradient of denaturant is assayed using denaturing gradient gel
electrophoresis (DGGE)
(Myers et al., Nature (1985) 313:495). When DGGE is~used as the method of
analysis, DNA will be
modified to insure that it does not completely denature, for example by
adding~a GC clamp of ,
approximately 40 by of high-melting GC-rich DNA by PCR. In a further
embodiment, a temperature
gradient is used in place of a denaturing gradient to identify differences in
the mobility of control and
sample DNA (Rosenbaum et al., Biophys Chem (1987) 265:12753).
Examples of other techniques for detecting point mutations include, but are
not limited to, selective
oligonucleotide hybridization, selective amplification or selective primer
extension. For example,
oligonucleotide primers may be prepared in that the known mutation is placed
centrally and then
hybridized to target DNA under conditions that permit hybridization only if a
perfect match is found
(Saiki et al., Nature (1986) 324:163); Saiki et al., Proc Natl Acad Sci USA
(1989) 86:6230). Such
allele-specific oligonucleotides are hybridized to PCR-amplified target DNA or
a number of different
mutations when the oligonucleotides are attached to the hybridizing membrane
and hybridized with
labeled target DNA:
Alternatively, allele-specific amplification technology that depends on
selective PCR amplification
may be used in conjunction with the instant invention. Oligonucleotides used
as primers for specific
amplification may carry the mutation of interest in the center of the molecule
(so that amplification
depends on differential hybridization) (Gibbs et al., Nucleic Acids Res (1989)
17:2437-2448) or at the
extreme 3' end of one primer where, under appropriate conditions, mismatch can
prevent or reduce
polymerase extension (Prossner, Tibtech (1993) 11:238). In addition, it may be
desirable to introduce
a novel restriction site in the region of the mutation to create cleavage-
based detection (Gasparini et
CA 02473707 2004-07-16
WO 03/061365 PCT/US03/01694
al., Mol Cell Probes (1992) 6:1). It is anticipated that in certain
embodiments amplification also may
be performed using Taq ligase for amplification (Barany; Proc Natl Acad Sci
USA (1991) 88:189). In
such cases, ligation will occur only if there is a perfect match at the 3' end
of the 5' sequence making it
possible to detect the presence of a known mutation at a specific site by
looking for the presence or
absence of amplification.
The methods described herein may be performed, for example, by utilizing pre-
packaged diagnostic
kits comprising at least one probe nucleic acid or antibody reagent described
herein. The method and
kit may be used conveniently, e.g., in clinical settings, to diagnose patients
exhibiting symptoms or
10 family history of a disease or illness involving a GAVE6 gene.
Furthermore, any cell type or tissue where GAVE6 is expressed may be utilized
in the prognostic
assays described herein.
15 3. Pharmacogenomics
Agents or modulators that have a stimulatory or inhibitory effect on GAVE6
activity (e.g., GAVE6
gene expression) as identified by a screening assay described herein can be
administered to
individuals to treat (prophylactically or therapeutically) disorders (e.g.,
inflammation associated with
asthma, chronic obstructive pulmonary disease and rheumatoid arthritis)
associated with GAVE6
20 activity. In conjunction with such treatment, the pharmacogenomics (i.e.,
the study of the relationship
between the genotype of an individual and the response of the individual to a
foreign compound or
drug) of the individual may be considered. Differences in metabolism of
therapeutics can lead to
severe toxicity or therapeutic failure by altering the relation between dose
and blood concentration of
the pharmacologically active drug. Thus, the pharmacogenomics of the
individual permits the
25 selection of effective agents (e.g., drugs) for prophylactic or therapeutic
treatments based on a
consideration of the genotype of the individual. Such pharmacogenomics further
can be used to
determine appropriate dosages and therapeutic regimens. Accordingly, the
activity of GAVE6
protein, expression of GAVE6 nucleic acid or mutation content of GAVE6 genes
in an individual can
be determined thereby to select appropriate agents) for therapeutic or
prophylactic treatment of the
30 individual.
Pharmacogenomics deals with clinically significant hereditary variations in
the response to drugs due
to altered drug disposition and abnormal action in affected persons. See,
e.g., Linder, Clin Chem
(1997) 43(2):254-266. In general, two types of pharmacogenetic conditions can
be differentiated.
35 Genetic conditions transmitted as a single factor altering the way drugs
act on the body are referred to
CA 02473707 2004-07-16
WO 03/061365 PCT/US03/01694
71
as "altered drug action." Genetic conditions transmitted as single factors
altering the way the body
acts on drugs are referred to as "altered drug metabolism." The
pharmacogenetic conditions can occur
either as rare defects or as polymorphisms. For example, glucose-6-phosphate
dehydrogenase
deficiency (G6PD) is a common inherited enzymopathy in that the main clinical
complication is
hemolysis after ingestion of oxidant drugs (anti-malarials, sulfonamides,
analgesics or nitrofurans) and
consumption of fava beans.
As an illustrative embodiment, the activity of drug metabolizing enzymes is a
major determinant of
both the intensity and duration of drug action. The discovery of genetic
polymorphisms of drug
metabolizing enzymes (e.g., N-acetyltransferase 2 (NAT 2) and cytochrome P450
enzymes, CYPZD6
and CYPZCI 9) has provided an explanation as to why some patients do not
obtain the expected drug
effects or show exaggerated drug response and serious toxicity after taking
the standard and safe dose
of a drug. The polymorphisms are expressed in two phenotypes in the
population, the extensive
metabolizes (EM) and poor metabolizes (PM). The prevalence of PM is different
among different
populations. For example, the gene coding for CYP2D6 is highly polymorphic and
several mutations
have been identified in PM, all which lead to the absence of functional
CYP2D6. Poor metabolizers
of CYP2D6 and CYP2C19 quite frequently experience exaggerated drug response
and side effects
when standard doses are received. If a metabolite is the active therapeutic
moiety, a PM will show no
therapeutic response, as demonstrated for the analgesic effect of codeine
mediated by the
CYP2D6-formed metabolite, morphine. The other extreme is the so-called ultra-
rapid metabolizers
who do not respond to standard doses. Recently, the molecular basis of ultra-
rapid metabolism has
been identified to be due to CYP2D6 gene amplification.
Thus, the activity of GAVE6 protein, expression of GAVE6 nucleic acid or
mutation content of
GAVE6 genes in an individual can be determined to select thereby appropriate
agents) for therapeutic
or prophylactic treatment of the individual. In addition, pharmacogenetic
studies can be used to apply
genotyping of polymorphic alleles encoding drug-metabolizing enzymes to the
identification of the
drug responsiveness phenotype of an individual. That knowledge, when applied
to dosing or drug
selection, can avoid adverse reactions or therapeutic failure and thus enhance
therapeutic or
prophylactic efficiency when treating a subject with a GAVE6 modulator, such
as a modulator
identified by one of the exemplary screening assays described herein.
4. Monitoring of Effects During Clinical Trials
Monitoring the influence of agents (e.g., drugs or compounds) on the
expression or activity of GAVE6
(e.g., the ability to modulate aberrant cell proliferation and/or
differentiation) can be applied not only
CA 02473707 2004-07-16
WO 03/061365 PCT/US03/01694
72
in basic drug screening, but also in clinical trials. For example, the
effectiveness of an agent, as
determined by a screening assay as described herein, to increase GAVE6 gene
expression, protein
levels or protein activity, can be monitored in clinical trials of subjects
exhibiting decreased GAVE6
gene expression, protein levels or protein activity. Alternatively, the
effectiveness of an agent, as
determined by a screening assay, to decrease GAVE6 gene expression, protein
levels or protein
activity, can be monitored in clinical trials of subjects exhibiting increased
GAVE6 gene expression,
protein levels or protein activity. In such clinical trials, GAVE6 expression
or activity and preferably,
that of other genes that have been implicated in, for example, a cellular
proliferation disorder, can be
used as a marker of the immune responsiveness of a particular cell. For
example, and not by way of
limitation, genes, including GAVE6, that are modulated in cells by treatment
with an agent (e.g.,
compound, drug or small molecule) that modulates GAVE6 activity (e.g., as
identified in a screening
assay described herein) can be identified. Thus, to study the effect of agents
on cellular proliferation
disorders, for example, in a clinical trial, cells can be isolated and RNA
prepared and analyzed for the
levels of expression of GAVE6 and other genes implicated in the disorder. The
levels of gene
expression (i.e., a gene expression pattern) can be quantified by Northern
blot analysis or RT-PCR, as
described herein, or alternatively by measuring the amount of protein produced
by one of the' methods
as described herein or by measuring the levels of activity of GAVE6 or other
genes. In that way, the
gene expression pattern can serve as a marker, indicative of the physiological
response of the cells to
the agent. Accordingly, the response state may be determined before and at
various points during
treatment of the individual with the agent.
In a particular embodiment, the instant invention provides a method for
monitoring the effectiveness
of treatment of a subject with an agent (e.g., an agonist, antagonist,
peptidomimetic, protein, peptide,
nucleic acid, small molecule or other drug candidate identified by the
screening assays described
herein) comprising the steps of (i) obtaining a pre-administration sample from
a subject prior to
administration of the agent; (ii) detecting the level of expression of a GAVE6
protein, mRNA or
genomic DNA in the preadministration sample; (iii) obtaining one or more post-
administration
samples from the subject; (iv) detecting the level of expression or activity
of the GAVE6 protein,
mRNA or genomic DNA in the post-administration samples; (v) comparing the
level of expression or
activity of the GAVE6 protein, mRNA or genomic DNA in the pre-administration
sample with the
GAVE6 protein, mRNA or genomic DNA in the post-administration sample or
samples; and (vi)
altering the administration of the agent to the subject accordingly. For
example, increased
administration of the agent may be desirable to increase the expression or
activity of GAVE6 to higher
levels than detected, i.e., to increase the effectiveness of the agent.
Alternatively, decreased
CA 02473707 2004-07-16
WO 03/061365 PCT/US03/01694
73
administration of the agent may be desirable to decrease expression or
activity of GAVE6 to lower
levels than detected, i.e., to decrease the effectiveness of the agent.
D. Methods of Treatment
The instant invention provides for both prophylactic and therapeutic methods
of treating a subject at
risk of (or susceptible to) a disorder or having a disorder associated with
aberrant GAVE6 expression
or activity. Such disorders include, but are not limited to, for example,
inflammatory disorders such
as asthma, chronic obstructive pulmonary disease and rheumatoid arthritis.
Prophylactic Methods
In one aspect, the invention provides a method for preventing in a subject, a
disease or condition
associated with an aberrant GAVE6 expression or activity, by administering to
the subject an agent
that modulates GAVE6 expression or at least one GAVE6 activity. Subjects at
risk for a disease that
is caused by or contributed to by aberrant GAVE6 expression or activity can be
identified by, for
example, any or a combination of diagnostic or prognostic assays as described
herein. Administration
of a prophylactic agent can occur prior to the manifestation of symptoms
characteristic of the GAVE6
aberrancy, such that a disease or disorder is prevented or, alternatively,
delayed in progression.
Depending on the type of GAVE6 aberrancy, for example, a GAVE6 agonist or
GAVE6 antagonist
agent can be used for treating the subject. The appropriate agent can be
determined based on
screening assays described herein.
2. Therapeutic Methods
Another aspect of the invention pertains to methods of modulating GAVE6
expression or activity for
therapeutic purposes. The modulatory method of the invention involves
contacting a cell with an
agent that modulates one or more of the activities of GAVE6 protein activity
associated with the cell.
An agent that modulates GAVE6 protein activity can be an agent as described
herein, such as a
nucleic acid or a protein, a naturally-occurring cognate ligand of a GAVE6
protein, a peptide, a
GAVE6 peptidomimetic or other small molecule. In one embodiment, the agent
stimulates one or
more of the biological activities of GAVE6 protein. Examples of such
stimulatory agents include
active GAVE6 protein and a nucleic acid molecule encoding GAVE6 that has been
introduced into the
cell. In another embodiment, the agent inhibits one or more of the biological
activities of GAVE6
protein. Examples of such inhibitory agents include antisense GAVE6 nucleic
acid molecules and
anti-GAVE6 antibodies. The modulatory methods can be performed in vitro (e.g.,
by culturing the
cell with the agent) or, alternatively, in vivo (e.g., by administering the
agent to a subject). As such,
CA 02473707 2004-07-16
WO 03/061365 PCT/US03/01694
74
the instant invention provides methods of treating an individual afflicted
with a disease or disorder
characterized by aberrant expression or activity of a GAVE6 protein or nucleic
acid molecule. In one
embodiment, the method involves administering an agent (e.g., an agent
identified by a screening
assay described herein) or combination of agents that modulates (e.g.,
upregulates or downregulates)
GAVE6 expression or activity. In another embodiment, the method involves
administering a GAVE6
protein or nucleic acid molecule as therapy to compensate for reduced or
aberrant GAVE6 expression
or activity.
Stimulation of GAVE6 activity is desirable in situations in which GAVE6 is
downregulated
abnormally and/or in which increased GAVE6 activity is likely to have a
beneficial effect.
Conversely, inhibition of GAVE6 activity is desirable in situations in which
GAVE6 is upregulated
abnormally andlor in which decreased GAVE6 activity is likely to have a
beneficial effect.
The present invention may be better understood by reference to the following
non-limiting Example,
which is provided as exemplary of the invention. The following Example is
presented in order to
more fully illustrate the preferred embodiments of the invention. It should in
no way be construed,
however, as limiting the broad scope of the invention.
EXAMPLE
. Materials and Methods
Identification of GAVE6. Homology searching against human genome sequence
database HTG
(NCBI/NIH) using various GPCR as queries was carned out using FASTA algorithm
(Wisconsin
GCG Package Version 10.1). Genomic DNA sequences that returned having
statistically significant
were translated into three forward frames for BLASTp searching of protein
databases. A genomic
DNA sequence AC013396 was identified to contain a putative GPCR sequence and
was then named
as GAVE6. Chromosonne location of GAVE6 is mapped at 2p22.1.
Cloning ofgenomic I~NA encoding GAYE6. Primers specific for the 5' and 3'
sequences of the
predicted GAVE6 were designed. Forward primer HP 157, CAG CCC ATG GAA CT"T CAT
AAC
CTG (SEQ ID NO:S), and reverse primer HP158, CTG GCC CTC AGC CCT GGG AGG AG
(SEQ
ID N0:6), were used to amplify GAVE6 genomic DNA by polymerase chain reaction
(PCR) using
human genomic DNA as template. PCR conditions were as follows: denaturation at
94 °C for 30 s,
annealing at 55 °C for 30 s, and extension at 72 °C for 1 min,
for 35 cycles, followed by a 5-min
extension at 72 °C. Amplified DNA fragment was cloned into the pCRII-
TOPO vector from
Invitrogen. The cloned DNA insert was verified by DNA sequencing. All the PCR
amplifications
CA 02473707 2004-07-16
WO 03/061365 PCT/US03/01694
were done in DNA Engine Tetrad (MJ Research, model PTC-225).
Nortlaerzz blot analyses. Human multiple tissue Northern blots'from Clontech
were hybridized
according to the manufacturer's instructions with [a 3apjdCTP labeled full-
length open reading frame
5 DNA fragment. Hybridized blots were washed with 2XSSPE and 0.1% SDS at 50
°C for 30 min and
with O.1XSSPE and 0.1%SDS at 50 °C for 1 hour. The blots were then
exposed to X-ray film at -70 °C
in the presence of an intensifying screen. The results of this Northern blot
analysis are shown in
Figure 4
10 Taqman analysis. Total RNA from human tissues was purchased from Clontech.
Prior to cDNA
generation, total RNA was subjected to DNAsel treatment to avoid potential
genomic DNA
contamination. In brief, Total RNA was mixed with Sul~ of lOx DNAseI buffer (
20mM Hepes pH 7.5;
IOmM CaCl2 ;lOmM MgCl2; 1mM DTT and 50% (v/v) glycerol) (Ambion), RNAse
Inhibitor and lul
of DNAseI RNase free (2U/ul; Ambion) in a final volume of SOuI at 37C for one
hour. Following a
15 phenol precipitation step, cDNA synthesis was performed using Superscript
choice system as ,
described by Life Technologies. Taqman primer/probes were designed using the
Primer Express 1.0
software (ABI). The TaqMan forward primer of Gave 6: S' GCT GCC TGC AAA GTC
AAC CT 3'
(SEQ ID N0:7), the reverse primer: 5' TGG CTG TGA GGA AGA CAA CG 3' (SEQ )D
N0:8) and
the Taqman probe sequence: 5'FAM- CCA CCA ACC GCA CGG CAA - TAMRA 3' (SEQ ID
20 N0:9). Fam is used as a reporter dye and Tamra as a quencher. Taqman probe
was custom synthesized
by Operon Technologies. Taqman reactions was performed in a 96-well plate
MicroAmp optical tube
(PE). in a final volume of Soul containing: 25u1 Taqman PCR Mixture (Perkin
Elmer); 1 ul Forward
Primer for a final concentration of 900nM; lul Reverse Primer for a final
concentration of 900nM and
lul Taqman probe for a final concentration of 200nM; Sul of cDNA template
(calculated
25 concentration of l Ong/ul) and 17 ul of water. Taqman PCR condition was
performed as described by
PE Applied Biosystem. Human Beta actin primer probes (designed and purchased
from PE applied
Biosystem) was used as internal control. For each tissue, Taqman reactions
were performed in
duplicate for both target gene and internal control. In addition, a standard
curve is generated for
human beta actin in total brain cDNA using increasing amount of template in
duplicate. This allows us
30 to obtain relative number of amplicon amplified. Expression of target gene
is expressed relative to
brain cDNA as relative fold expression. The data obtained from the Taqman
analysis are set forth
below in Table 1 and .graphically in Figure 5.
CA 02473707 2004-07-16
WO 03/061365 PCT/US03/01694
76
TABLE 1
Tissue Type Mean ii 2 as Expression
Mean Ct
Adrenal Gland 28.59 19.67 8.93 2.06
Bone marrow 28.25 21.45 ~ 6.818.91
Brain 29.84 22.72 7.13 ?.14
Colon 28.29 19.88 8.41 2.94
Fetal Brain 29.11 23.92 5.20 27.30
Fetal Liver 27.54 22.36 5.18 27.49
Heart 31.41 20.96 10.45 0.71
Kidney 26.23 21.26 4.97 31.80
Liver 29.18 22.96 6.22 13.37
Lung 30.18 19.09 11.09 0.46
Mammary Gland 29.65 21.55 8.11 3.63
Pancxeas 31.66 24.91 6.75 9.29
Placenta 31.00 23.43 7.57 5.28
Prostate 29.34 20.66 8.69 2.42
Salivary Gland 30.84 20.96 9.88 1.06
Skeletal Muscle28.80 20.18 8.63 2.53
Smalllntestine 28.68 21.19 7.49 5.56
Spinal Cord 29.84 21.56 8.28 3.23
Spleen 29.40 18.63 10.77 0.57
Stomach 29.48 21.36 8.13 3.58
Testis 29.81 22.53 7.28 6.46
Thymus 28.08 20.07 8.02 3.87
Thyroid 30.25 20.57 9.68 1.22
'Trachea 30.42 19.41 11.01 0.48
Uterus 29.57 20.93 8.65 2.49
PBMC/Control 26.64 18.48 8.15 3.52
PBMC/PMA 31.31 18.50 12.81 0.14
PBMC/PHA 32.22 18.34 13.88 0.07
PBMCIHDM 27.29 17.48 9.80 1.12
A549 Cells 34.9 21.32 13.58 0.08
THP-1 28.4 20.50 7.90 4.19
(+ve) Positive 30.95 21.98 8.96 2.00
Control
S PCR screening of cDNA library. PCR primers specific to the GAVE6 coding
region: 5'TTC CTC
s
CTG ATC AGC AAC CT 3' (SEQ >I7 NO:10), and 5'TTG GTG GAC AGC ATG AAG AG 3'
(SEQ
ID NO:11 ) were used to screen pooled human spleen, brain, kidney, activated T
cells, and lung cDNA
libraries. PCR screenings were done in 96-well plates using the following PCR
protocol: 94°C, hold
for 3 min; 40 cycles of 94 °C for 30 second, 52 °C for 30
second, and 68 °C for 45 second. Positive
0 subpools were subsequently diluted for further round PCR screening. A
limited number of colonies
from positive subpools were plated on agar plates and positive plasmids were
verified by PCR and
were subjected for DNA sequencing analysis.
CA 02473707 2004-07-16
WO 03/061365 PCT/US03/01694
77
The present invention is not to be limited in scope by the specific
embodiments describe herein.
Indeed, various modifications of the invention in addition to those described
herein will become
apparent to those slcilled in the art from the foregoing description and the
accompanying figures. Such
modifications are intended to fall within the scope of the appended claims.
It is further to be understood that all base sizes or amino acid sizes, and
all molecular weight or
molecular mass values, given for nucleic acids or polypeptides are
approximate, and are provided for
description.
Various publications are cited herein, the disclosures of which are
incorporated by reference in their
entireties.
CA 02473707 2004-07-16
WO 03/061365 PCT/US03/01694
USAV20010054WOPCT.ST25
SEQUENCE LISTING
<110> Aventis Pharmaceuticals Inc.
EISHINGDRELO, Haifeng
CAI, Jidong
SANDRASAGRA, Anthony
<120> NUCLEIC ACID ENCODING A G-PROTEIN COUPLED RECEPTOR, AND USES THEREOF
<130> USAV2001/0054 WO PCT
<140> NOT YET ASSIGNED
<141> 2003-O1-21
<150> US 06/351,006
<15l> 2002-01-23
<150> GB 0210597.1
<151> 2002-05-09
<160> 11
<170> PatentIn version 3.0
<210> 1
<211> 1155
<212> DNA
<213> Homo sapiens
<400>
1
atggaacttcataacctgagctctccatctccctctctctcctcctctgttctccctccc60
tccttctctccctcaccctcctctgctccctctgcctttaccactgtgggggggtcctct120
ggagggccctgccaccccacctcttcctcgctggtgtctgccttcctggcaccaatcctg180
gccctggagtttgtcctgggcctggtggggaacagtttggccctcttcatcttctgcatc240
cacacgcggccctggacctccaacacggtgttcctggtcagcctggtggccgctgacttc300
ctcctgatcagcaacctgcccctccgcgtggactactacctcctccatgagacctggcgc360
tttggggctgctgcctgcaaagtcaacctcttcatgctgtccaccaaccgcacggccagc420
gttgtcttcctcacagccatcgcactcaaccgctacctgaaggtggtgcagccccaccac480
gtgctgagccgtgcttccgtgggggcagctgcccgggtggccgggggactctgggtgggc540
atcctgctcctcaacgggcacctgctcctgagcaccttctccggcccctcctgcctcagc600
tacagggtgggcacgaagccctcggcctcgctccgctggcaccaggcactgtacctgctg660
gagttcttcctgccactggcgctcatcctctttgctattgtgagcattgggctcaccatc720
cggaaccgtggtctgggcgggcaggcaggcccgcagagggccatgcgtgtgctggccatg780
gtggtggccgtctacaccatctgcttcttgcccagcatcatctttggcatggcttccatg840
gtggctttctggctgtccgcctgccgatccctggacctctgcacacagctcttccatggc900
1
CA 02473707 2004-07-16
WO 03/061365 PCT/US03/01694
USAV20010054WOPCT.ST25
tccctggccttcacctacctcaacagtgtcctggaccccgtgctctactgcttctctagc960
cccaacttcctccaccagagccgggccttgctgggcctcacgcggggccggcagggccca1020
gtgagcgacgagagctcctaccaaccctccaggcagtggcgctaccgggaggcctctagg1080
aaggcggaggccatagggaagctgaaagtgcagggcgaggtctctctggaaaaggaaggc1140
tcctcccagggctga 1155
<210> 2
<211> 384
<212> PRT
<213> Homo Sapiens
<400> 2
Met Glu Leu His Asn Leu Ser Ser Pro Ser Pro Ser Leu Ser Ser Ser
1 5 10 15
Val Leu Pro Pro Ser Phe Ser Pro Ser Pro Ser Ser Ala Pro Ser Ala
20 25 30
Phe Thr Thr Val Gly Gly Ser Ser Gly Gly Pro Cys His Pro Thr Ser
35 40 45
Ser Ser Leu Val 5er Ala Phe Leu Ala Pro Ile Leu Ala Leu Glu Phe
50 55 60
Val Leu Gly Leu Val Gly Asn Ser Leu Ala Leu Phe Ile Phe Cys Ile
65 70 75 80
His Thr Arg Pro Trp Thr Ser Asn Thr Val Phe Leu Val Ser Leu Val
85 90 95
Ala Ala Asp Phe Leu Leu Ile Ser Asn Leu Pro Leu Arg Val Asp Tyr
100 105 110
Tyr Leu Leu His Glu Thr Trp Arg Phe Gly Ala Ala Ala Cys Lys Val
115 120 125
Asn Leu Phe Met Leu Ser Thr Asn Arg Thr Ala Ser Val Val Phe Leu
130 135 140
Thr Ala Ile Ala Leu Asn Arg Tyr Leu Lys Val Val Gln Pro His His
145 150 155 160
Val Leu Ser Arg Ala Ser Val Gly Ala Ala Ala Arg Val Ala Gly Gly
165 170 175
Leu Trp Val Gly Ile Leu Leu Leu Asn Gly His Leu Leu Leu Ser Thr
180 185 190
Phe Ser Gly Pro Ser Cys Leu Ser Tyr Arg Val Gly Thr Lys Pro Ser
195 200 205
Ala Ser Leu Arg Trp His Gln Ala Leu Tyr Leu Leu Glu Phe Phe Leu
2
CA 02473707 2004-07-16
WO 03/061365 PCT/US03/01694
USAV20010054WOPCT.ST25
210 215 220
Pro Leu Ala Leu Ile Leu Phe Ala Ile Val Ser Ile Gly Leu Thr Ile
225 230 235 240
Arg Asn Arg Gly Leu Gly Gly Gln Ala Gly Pro Gln Arg, Ala Met Arg
245 250 255
Val Leu Ala Met Val Val Ala Val Tyr Thr Ile Cys Phe Leu Pro Ser
260 265 270
Ile Ile Phe Gly Met Ala Ser Met Val Ala Phe Trp Leu Ser Ala Cys
275 ~ 280 285
Arg Ser Leu Asp Leu Cys Thr Gln Leu Phe His Gly Ser Leu Ala Phe
290 295 300
Thr Tyr Leu Asn Ser Val Leu Asp Pro Val Leu Tyr Cys Phe Ser Ser
305 310 315 320
Pro Asn Phe Leu His Gln Ser Arg Ala Leu Leu Gly Leu Thr Arg Gly
325 330 335
Arg Gln Gly Pro Val Ser Asp Glu Ser Ser Tyr Gln Pro Ser Arg Gln
340 345 350
Trp Arg Tyr Arg Glu Ala Ser Arg Lys Ala Glu Ala Ile Gly Lys Leu
355 360 365
Lys Val Gln Gly Glu Val Ser Leu Glu Lys Glu Gly Ser Ser Gln Gly
370 375 380
<210> 3
<211> 387
<212> PRT
<213> Homo sapiens
<400> 3
Met Asn Arg His His Leu Gln Asp His Phe Leu Glu Ile Asp Lys Lys
1 5 10 15
Asn Cys Cys Val Phe Arg Asp Asp Phe Ile Ala Lys Val Leu Pro Pro
20 25 30
Val Leu Gly Leu Glu Phe the Phe Gly Leu Leu Gly Asn Gly Leu Ala
35 40 45
Leu Trp Ile Phe Cys Phe His Leu Lys Ser Trp Lys Ser Ser Arg Ile
50 55 60
Phe Leu Phe Asn Leu Ala Val Ala Asp Phe Leu Leu Ile Ile Cys Leu
65 70 75 80
Pro Phe Val Met Asp Tyr Tyr Val Arg Arg Ser Asp Trp Asn Phe Gly
85 90 95
Asp Ile Pro Cys Arg Leu Val Leu Phe Met Phe Ala Met Asn Arg Gln
100 105 110
3
CA 02473707 2004-07-16
WO 03/061365 PCT/US03/01694
USAV20010054WOPCT.ST25
Gly Ser Ile Ile Phe Leu Thr Val Val Ala Val Asp Arg Tyr Phe Arg
115 120 125
Val Val His Pro His His Ala Leu Asn Lys Ile Ser Asn Trp Thr Ala
130 135 140
Ala Ile Ile Ser Cys Leu Leu Trp Gly Ile,Thr Val Gly Leu Thr Val
145 150 155 160
His Leu Leu Lys Lys Lys Leu Leu Ile Gln Asn Gly Pro Ala Asn Val
165 170 175
Cys Ile Ser Phe Ser Ile Cys His Thr Phe Arg Trp His Glu Ala Met
180 185 190
Phe Leu Leu Glu Phe Leu Leu Pro Leu Gly Ile Ile Leu Phe Cys Ser
195 200 205
Ala Arg Ile Ile Trp Ser Leu Arg Gln Arg Gln Met Asp Arg His Ala
210 215 220
Lys Ile Lys Arg Ala Ile Thr Phe Ile Met Val Val Ala Ile Val Phe
225 230 235 240
Val Ile Cys Phe Leu Pro Ser Va1 Val Val Arg Ile Arg Ile Phe Trp
245 250 255
Leu Leu His Thr Ser Gly Thr Gln Asn Cys Glu.Val Tyr Arg Ser Val
260 265 270
Asp Leu Ala Phe Phe Ile Thr Leu Ser Phe Thr Tyr Met Asn Ser Met
275 280 285
Leu Asp Pro Val Val Tyr Tyr Phe Ser Ser Pro Ser Phe Pro Asn Phe
290 295 300
Phe Ser Thr Leu Ile Asn Arg Cys Leu Gln Arg Lys Met Thr Gly Glu
305 310 315 320
Pro Asp Asn Asn Arg Ser Thr Ser Val Glu Leu Thr Gly Asp Pro Asn
325 330 335
Lys Thr Arg Gly Ala Pro Glu Ala Leu Met Ala Asn Ser Gly Glu Pro
340 345 350
Trp Ser Pro Ser Tyr Leu Gly Pro Thr Ser Asn Asn His Ser Lys Lys
355 360 365
Gly His Cys His Gln Glu Pro Ala Ser Leu Glu Lys Gln Leu Gly Cys
370 375 380
Cys Ile Glu
385
<210> 4
<211> 319
<212> PRT
<213> Homo Sapiens
4
CA 02473707 2004-07-16
WO 03/061365 PCT/US03/01694
USAV20010054WOPCT.ST25
<400> 4
Met Pro Phe Pro Asn Cys Ser Ala Pro Ser Thr Val Val Ala Thr Ala
1 5 10 15
Val Gly Val Leu Leu Gly Leu Glu Cys Gly Leu Gly Leu Leu Gly Asn
20 25 30
Ala Val Ala Leu Trp Thr Phe Leu Phe Arg Val Arg Val Trp Lys Pro
35 40 45
Tyr Ala Val Tyr Leu Leu Asn Leu Ala Leu Ala Asp Leu Leu Leu Ala
50 55 60
Ala Cys Leu Pro Phe Leu Ala Ala Phe Tyr Leu Ser Leu Gln Ala Trp
65 70 75 80
His Leu Gly Arg Val Gly Cys Trp Ala Leu Arg Phe Leu Leu Asp Leu
85 90 95
Ser Arg Ser Val Gly, Met Ala Phe Leu Ala Ala Val A1'a Leu Asp Arg
100 105 110
Tyr Leu Arg Val Val His Pro Arg Leu Lys Val Asn Leu Leu Ser Pro
115 120 125
Gln Ala Ala Leu Gly Val Ser Gly Leu Val Trp Leu Leu Met Val Ala
130 135 140
Leu Thr Cys Pro Gly Leu Leu Ile Ser Glu Ala Ala Gln Asn Ser Thr
145 150 l55 160
Arg Cys His Ser Phe Tyr Ser Arg Ala Asp Gly Ser Phe Ser Ile Ile
165 170 175
Trp Gln Glu Ala Leu Ser Cys Leu Gln Phe Val Leu Pro Phe Gly Leu
180 185 190
Ile Val Phe Cys Asn Ala Gly Ile Ile Arg Ala Leu Gln Lys Arg Leu
195 200 205
Arg Glu Pro Glu Lys Gln Pro Lys Leu Gln Arg Ala Gln Ala Leu Val
210 215 220
Thr Leu Val Val Val Leu Phe Ala Leu Cys Phe Leu Pro Cys Phe Leu
225 230 235 240
Ala Arg Val Leu Met His Ile Phe Glri Asn Leu Gly Ser Cys Arg Ala
245 250 255
Leu Cys Ala Val Ala His Thr Ser Asp Val Thr Gly Ser Leu Thr Tyr
260 265 270
Leu His Ser Val Val Asn Pro Val Val Tyr Cys Phe Ser Ser Pro Thr
275 280 285
Phe Arg Ser Ser Tyr Arg Arg Val Phe His Thr Leu Arg Gly Lys Gly
290 295 300
CA 02473707 2004-07-16
WO 03/061365 PCT/US03/01694
USAV20010054WOPCT.ST25
Gln Ala Ala Glu Pro Pro Asp Phe Asn Pro Arg Asp Ser Tyr Ser
305 310 315
<2l0> 5
<211> 24
<212> DNA
<213> Artificial
<220>
<223> Primer
<400> 5
cagcccatgg aacttcataa cctg 24
<210> 6
<211> 23
<212> DNA
<213> Artificial
<220>
<223> Primer
<400> 6
ctggccctca gccctgggag gag 23
<210> 7
<211> 20
<212> DNA
<213> Artificial
<220>
<223> Primer
<400> 7
gctgcctgca aagtcaacct 20
<210> 8
<211> 18
<212> DNA
<213> Artificial
<220>
<223> Primer
<400> 8
tggctgtgag gaagacaa lg
<210> 9
<211> 18
<212> DNA
<213> Artificial
<220>
<223> Probe
6
CA 02473707 2004-07-16
WO 03/061365 PCT/US03/01694
USAV20010054WOPCT.ST25
<400> 9
ccaccaaccg cacggcaa lg
<210> 10
<211> 17
<212> DNA
<213> Artificial
<220>
<223> Primer
<400> 10
ctcctgatca gcaacct 17
<210> 11
<211> 20
<212> DNA
<213> Artificial
<220>
<223> Primer
<400> 11
ttggtggaca gcatgaagag 20
7
