Note: Descriptions are shown in the official language in which they were submitted.
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
HUMAN MONOCLONAL ANTIBODIES TO
PROSTATE SPECIFIC MEMBRANE ANTIGEN (PSMA)
Related Applications
The present application claims priority to U.S. Utility Application Serial
No. 10/059,989 filed on January 28, 2002, which is a continuation-in-part of
PCT
International Application PCT/US00/20247 filed 26 July 2000, which claims
priority to
U.S. Provisional Application Serial No. 60/146,285 filed 29 July 1999, U.S.
Provisional
Application Serial No. 60/158,759 filed 12 October 1999 and U.S. Provisional
Application Serial No. 60/188,087 filed 09 March 2000. The entire contents of
each of
these applications are hereby incorporated herein by reference.
Background of the Invention
Prostate cancer is a leading cause of morbidity and mortality among men.
Treatments for prostate cancer include surgery, hormones, radiation, and
chemotherapy.
There is little effective treatment for metastatic prostate disease.
Therefore, the
identification of genes and/or gene products that represent diagnostic and
prognostic
markers, as well as targets for therapy, is critical. Prostate specific
antigen (PSA) is one
such cancer marker which is useful in the clinical diagnosis and staging of
prostate
cancer. However, PSA cannot differentiate benign prostatic hyperplasia (BPH)
from
prostatitis or prostate cancer in the range of 4-10 ng/ml, thus, necessitating
a cytologic
and/or histologic assessment to confirm the proper diagnosis (Barren, R.J. et
al. (1998)
Prostate 36:181-188).
Prostate specific membrane antigen (PSMA) is a 750 amino acid, type II
transmembrane glycoprotein of approximately 110 kD that has 54% homology to
the
transferrin receptor. PSMA has 3 structural domains, including a 19 amino acid
intracellular domain, a 24 amino acid transmembrane domain, and a 707 amino
acid
extracellular domain. The PSMA protein displays neurocarboxypeptidase and
folate
hydrolase activity and is reported to be involved in the neuroendocrine
regulation of
prostate growth and differentiation (Heston, W.D. (1996) Urologe-Ausgabe A.
35:400-
407). PSM' is an alternatively spliced form of PSMA which is localized in the
cytoplasm.
1
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
PSMA is predominantly expressed by prostatic epithelial cells. The
expression of PSMA is increased in prostate cancer, especially in poorly
differentiated,
metastatic, and hormone refractory carcinomas (Gregorakis, A.K. et al. (1998)
Seminars
in Urologic Oncology 16:2-12; Silver, D.A. (1997) Clinical Cancer Research
3:81-85).
S Low level expression of PSMA is observed in extraprostatic tissues such as
the small
bowel, salivary gland, duodenal mucosa, proximal renal tubules, and brain
(Silver, D.A.
(1997) Clinical Cancer Research 3:81-85). PSMA is also expressed in
endothelial cells
of capillary vessels in peritumoral and endotumoral areas of certain
malignancies,
including renal cell carcinomas, and colon carcinomas, but not in blood
vessels from
normal tissues. In addition, PSMA is reported to be related to tumor
angiogenesis
(Silver, D.A. (1997) Clinical Cancer Research 3:81-85).
Accordingly, PSMA represents a valuable target for the treatment of
prostate cancer and a variety of other diseases characterized by PSMA
expression.
Summary of the Invention
The present invention provides isolated human monoclonal antibodies
which bind to human Prostate Specific Membrane Antigen (PSMA), as well as
immunoconjugates, bispecific molecules, and other therapeutic compositions
containing
such antibodies, alone or in combination with additional therapeutic agents.
In
particular, human antibodies of the present invention bind to a native protein
epitope on
human PSMA (e.g., an epitope located in the extracellular domain of human
PSMA) and
inhibit the growth and/or mediate killing of cells which express PSMA (e.g.,
via lysis or
phagocytosis) in the presence of human effector cells, e.g., polymorphonuclear
cells,
monocytes, macrophages, and dendritic cells. Accordingly, the antibodies can
be used
in a variety of methods for diagnosing, treating, and/or preventing diseases
related to the
expression of PSMA, particularly PSMA-expressing tumors and cancers, such as
prostate cancer, colon cancer, and renal carcinoma.
Isolated human antibodies of the invention include a variety of antibody
isotypes, such as IgGI, (e.g., IgGlk), IgG2, IgG3, IgG4, IgM, IgAI, IgA2,
IgAsec, IgD,
and IgE. The antibodies can be full-length antibodies (e.g., IgGI or IgG3) or
can
include only an antigen-binding portion (e.g., a Fab, F(ab')2, Fv, or a single
chain Fv
fragment).
2
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
Particular therapeutic antibodies of the invention include human
monoclonal antibody (HuMAb) 4A3, 7F12, 8A11, 8C12, 16F9, and functionally
equivalent antibodies which, for example, (a) are encoded by human heavy chain
and
human light chain nucleic acids comprising nucleotide sequences in their
variable
regions as set forth in SEQ ID NOs: 1, 3, 5, 7 or 9 and SEQ ID NOs: 2, 4, 6,
8, or 10,
respectively, and conservative modifications thereof, and/or (b) include heavy
chain and
light chain variable regions which comprise the amino acid sequence as set
forth in SEQ
ID NOs: l l, 12, 13, 14, or 15, and SEQ ID NOs:l6, 17, 18, 19, or 20,
respectively, and
conservative modifications thereof.
Still other particular human antibodies of the invention include those
which comprise a CDR domain having a human heavy and light chain CDR1 region,
a
human heavy and light chain CDR2 region, and a human heavy and light chain
CDR3
region, wherein
(a) the CDR1, CDR2, and CDR3 of the human heavy chain regions
comprise an amino acid sequence selected from the group consisting of the
amino acid
sequences of the CDR1, CDR2, and CDR3 regions shown in Figure 19 (SEQ ID
NOs:21-35), and conservative sequence modifications thereof, and
(b) the CDR1, CDR2, and CDR3 of the human light chain regions
comprise an amino acid sequence selected from the group consisting of the
amino acid
sequences of the CDR1, CDR2, and CDR3 regions shown in Figures 22 and 23 (SEQ
ID
NOs:36-50), and conservative sequence modifications thereof.
Other particular antibodies of the invention include human monoclonal
antibodies which bind to an epitope defined by antibody 4A3, 7F12, 8A1 l,
8C12, or
16F9, and/or which compete for binding to PSMA with antibody 4A3, 7F12, 8A11,
8C12, or 16F9, or which have other functional binding characteristics
exhibited by
antibody 4A3, 7F12, 8A11, 8C12, or 16F9. Such antibodies include, for example,
those
which bind to PSMA with a dissociation constant (KD) of 10'7 M or less, such
as of 10'8
M or less, 10'9 M or less, 10''° M or less, or even lower (e.g., 10-11
M or less). Such
antibodies further include those which cross react with marine anti-PSMA
antibody 3C6
(ATCC Accession Number HB 12491 ), but exhibit no cross reactivity with marine
anti-
PSMA antibodies 4D4 (ATCC Accession Number HB 12493) or 1G9 (ATCC
Accession Number HB 12495).
3
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
In yet another aspect of the invention, the human anti-PSMA antibodies
are derivatized, linked to or co-expressed with another functional molecule,
e.g., another
peptide or protein (e.g., an Fab' fragment). For example, an antibody or
antigen-binding
portion of the invention can be functionally linked (e.g., by chemical
coupling, genetic
fusion, noncovalent association or otherwise) to one or more other molecular
entities,
such as another antibody (e.g., to produce a bispecific or a multispecific
antibody), a
cytotoxin, a cellular ligand or an antigen. Accordingly, present invention
encompasses a
large variety of antibody conjugates, bi- and multispecific molecules, and
fusion
proteins, all of which bind to PSMA expressing cells and which target other
molecules
to the cells, or which bind to PSMA and to other molecules or cells.
In a particular embodiment, the invention includes a bispecific or
multispecific molecule comprising at least one binding specificity for PSMA
which is a
human anti-PSMA antibody (or fragment or mimetic thereof), and a second
binding
specificity for an Fc receptor, e.g., human FcyRI or a human Fca receptor, or
another
antigen on an antigen presenting cell (APC). The second binding specificity
can also be
an antibody or fragment thereof (e.g., an Fab, Fab', F(ab')2, Fv, or a single
chain Fv),
such as a human antibody or a portion thereof, or a "chimeric" or a
"humanized"
antibody or a portion thereof (e.g., has a variable region, or at least a
complementarity
determining region (CDR), derived from a nonhuman antibody (e.g., murine) with
the
remaining portions) being human in origin).
Accordingly, the present invention includes bispecific and multispecific
molecules that bind to both human PSMA and to an Fc receptor, e.g., a human
IgG
receptor, e.g., an Fc-gamma receptor (FcyR), such as FcyRI (CD64), FcyRII
(CD32),
and FcyRIII (CD16). Other Fc receptors, such as human IgA receptors (e.g.
FcaRI),
also can be targeted. The Fc receptor is preferably located on the surface of
an effector
cell, e.g., a monocyte, macrophage or an activated polymorphonuclear cell. In
a
preferred embodiment, the bispecific and multispecific molecules bind to an Fc
receptor
at a site which is distinct from the immunoglobulin Fc (e.g., IgG or IgA)
binding site of
the receptor. Therefore, the binding of the bispecific and multispecific
molecules is not
blocked by physiological levels of immunoglobulins.
4
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
In another embodiment, the present invention provides an
immunoconjugate, e.g., an immunotoxin, which includes a fully human anti-PSMA
antibody conjugated to a therapeutic agent, e.g., a cytotoxic drug, an
enzymatically
active toxin, or a fragment thereof, a radioisotope, or a small molecule anti-
cancer drug.
Alternatively, human antibodies of the invention can be co-administered
with such therapeutic and cytotoxic agents, but not linked to them. They can
be
coadministered simultaneously with such agents (e.g., in a single composition
or
separately) or can be administered before or after administration of such
agents. Such
agents can include chemotherapeutic agents, such as doxorubicin (adriamycin),
cisplatin
bleomycin sulfate, carmustine, chlorambucil, cyclophosphamide hydroxyurea and
combinations thereof. Human antibodies of the invention also can be
administered in
conjunction with radiation therapy.
In another embodiment, the present invention provides compositions,
e.g., pharmaceutical and diagnostic compositions/kits, comprising a
pharmaceutically
1 S acceptable Garner and at least one human anti-PSMA antibody, or an antigen-
binding
portion thereof. In one embodiment, the composition comprises a combination of
human antibodies or antigen-binding portions thereof, preferably each of which
binds to
a distinct epitope. For example, a pharmaceutical composition comprising a
human
monoclonal antibody that mediates highly effective killing of target cells in
the presence
of effector cells can be combined with another human monoclonal antibody that
inhibits
the growth of cells expressing PSMA. Thus, the combination provides multiple
therapies tailored to provide the maximum therapeutic benefit. Compositions,
e.g.,
pharmaceutical compositions, comprising a combination of at least one human
anti-
PSMA antibody, or antigen-binding portion thereof, and at least one bispecific
or
multispecific molecule of the invention, are also within the scope of the
invention.
In yet another embodiment, the present invention provides a method for
inhibiting the proliferation and/or growth of a cell expressing PSMA, and/or
inducing
killing of a cell expressing PSMA, by contacting the cells with (e.g.,
administering to a
subject) one or more human antibodies of the invention and/or related
therapeutic
compositions, derivatives etc. containing the antibodies as described above.
In a
particular embodiment, the method comprises contacting cells expressing PSMA
either
in vitro or in vivo with one or a combination of human anti-PSMA antibodies of
the
invention in the presence of a human effector cell. The method can be employed
in
5
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
culture, e.g. in vitro or ex vivo (e.g., cultures comprising cells expressing
PSMA and
effector cells). For example, a sample containing cells expressing PSMA and
effector
cells can be cultured in vitro, and combined with an antibody of the
invention.
Alternatively, the method can be performed in a subject, e.g., as part of an
in vivo (e.g.,
therapeutic or prophylactic) protocol.
For use in in vivo treatment and prevention of PSMA mediated diseases,
human antibodies of the present invention are administered to patients (e.g.,
human
subjects) at therapeutically effective dosages (e.g., to inhibit, eliminate or
prevent
growth of cells expressing PSMA) using any suitable route of administration
for
antibody-based clinical products as are well known in the art, such as by
injection or
infusion.
Accordingly, human antibodies of the present invention can be used to
treat and/or prevent a variety of diseases characterized by PSMA expression by
administering a suitable dosage (or series of dosages) of the antibodies to
patients
suffering from such diseases. Exemplary diseases that can be treated (e.g.,
ameliorated)
or prevented using the methods and compositions of the invention include, but
are not
limited to, cancers, such as prostate cancer, colon cancer, and renal
carcinoma.
In a particular embodiment of the invention, the patient can be
additionally treated with a chemotherapeutic agent, radiation, or an agent
that
modulates, e.g., enhances, the expression or activity of an Fc receptor, e.g.,
an Fcoc
receptor or an Fcy receptor, such as a cytokine. Typical cytokines for
administration
during treatment include granulocyte colony-stimulating factor (G-CSF),
granulocyte-
macrophage colony-stimulating factor (GM-CSF), interferon-y (IFN-y), and tumor
necrosis factor (TNF). Typical therapeutic agents include, among others, anti-
neoplastic
agents such as doxorubicin (adriamycin), cisplatin bleomycin sulfate,
carmustine,
chlorambucil, and cyclophosphamide hydroxyurea.
In another embodiment, the present invention provides a method for
detecting in vitro or in vivo the presence of PSMA or PSMA expressing cells,
e.g., for
diagnosing a PSMA-related disease. This can be achieved by, for example,
contacting
a sample to be tested, optionally along with a control sample, with a human
monoclonal antibody of the invention (or an antigen-binding portion thereof)
under
conditions that allow for formation of a complex between the antibody and
PSMA.
Complex formation is then detected (e.g., using an ELISA). When using a
control
6
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
sample along with the test sample, complex is detected in both samples and any
statistically significant difference in the formation of complexes between the
samples
is indicative of the presence of PSMA in the test sample.
In yet another aspect, the present invention provides a transgenic
nonhuman animal, such as a transgenic mouse (also referred to herein as a
"HuMAb
mouse"), which expresses a fully human monoclonal antibody that binds to PSMA.
In
a particular embodiment, the transgenic nonhuman animal is a transgenic mouse
having a genome comprising a human heavy chain transgene and a human light
chain
transgene encoding all or a portion of an anti-PSMA antibody of the invention.
To
generate human anti-PSMA antibodies, the transgenic nonhuman animal can be
immunized with a purified or enriched preparation of PSMA antigen and/or cells
expressing PSMA. Preferably, the transgenic nonhuman animal, e.g., the
transgenic
mouse, is capable of producing multiple isotypes of human monoclonal
antibodies to
PSMA (e.g., IgG, IgA and/or IgM) by undergoing V-D-J recombination and isotype
switching. Isotype switching may occur by, e.g., classical or non-classical
isotype
switching.
Accordingly, in another embodiment, the invention provides isolated B-
cells derived from a transgenic nonhuman animal as described above, e.g., a
transgenic
mouse, which express human anti-PSMA antibodies. The isolated B-cells can then
be
immortalized to by fusion to an immortalized cell to provide a source (e.g., a
hybridoma) of human anti-PSMA antibodies. Such hybridomas (i. e., which
produce
human anti-PSMA antibodies) are also included within the scope of the
invention.
As exemplified herein, human anti-PSMA antibodies can be obtained
directly from hybridomas which express the antibody, or can be cloned and
recombinantly expressed in a host cell, such as a transfectoma (e.g., a
transfectoma
consisting of immortalized CHO cells or lymphocytic cells). Accordingly, the
present
invention provides methods for producing human monoclonal antibodies which
bind to
human PSMA. In a particular embodiment, the method includes immunizing a
transgenic nonhuman animal, e.g., a transgenic mouse, as previously described
(e.g.,
having a genome comprising a human heavy chain transgene and a human light
chain
transgene encoding all or a portion of an anti-PSMA antibody), with a purified
or
enriched preparation of human PSMA antigen and/or cells expressing human PSMA.
B cells (e.g., splenic B cells) of the animal are then obtained and fused with
myeloma
7
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
cells to form immortal, hybridoma cells that secrete human monoclonal
antibodies
against PSMA.
In yet another aspect, the invention provides nucleic acid molecules
encoding all or a portion of a human monoclonal anti-PSMA antibody (e.g.,
which
encode at least one light or heavy chain of the antibody), as well as
recombinant
expression vectors which include such nucleic acids, and host cells
transfected with such
vectors. Methods of producing the antibodies by culturing such host cells are
also
encompassed by the invention. Particular nucleic acids provided by the
invention
comprise the nucleotide sequences shown in SEQ ID NOs:I, 3, 5, 7, or 9 and SEQ
ID
NOs:2, 4, 6, 8, or 10, which encode the heavy and light chains, respectively,
of human
anti-PSMA antibodies (HuMAbs) 4A3, 7F12, 8A11, 8C12, and 16F9.
Other features and advantages of the instant invention be apparent from
the following detailed description and examples which should not be construed
as
limiting. The contents of all references, patents and published patent
applications cited
1 S throughout this application are expressly incorporated herein by
reference.
Brief Description of the Drawings
Figure 1 is a bar graph showing the reactivity (solid phase ELISA) of
HuMAb 11C10 with full length PSMA and bacterially expressed fusion proteins
containing PSMA fragments corresponding to amino acids 1-173, 134-437, and 438-
750. The assays were conducted using the murine 7E11 antibody as a control.
Figure 2 is a graph showing the reactivity (solid phase ELISA) of human
anti-PSMA monoclonal antibodies with membrane fractions from human prostatic
adenocarcinoma LNCaP and PC3 cells. Background absorbance at 405 nm was 0.05.
Figure 3 is a bar graph showing the effect of heat denaturation of isolated
PSMA on antibody binding. Purified PSMA, with and without heat denaturation,
was
coated onto 96-well plates and treated with the indicated antibodies. Bound
antibody
was detected by ELISA.
8
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
Figure 4 shows immunoprecipitation of PSMA from LNCaP cell
detergent lysates using HuMAbs. Immunoprecipitated protein was separated by
SDS
gel electrophoresis, blotted onto PVDF membranes, and probed with the murine
anti-
PSMA 4D8 antibody (lanes 2-7). Lane 1 shows total LNCaP cell lysate. Lanes 2-7
show immunoprecipitation with the following antibodies, respectively:
irrelevant human
IgGI, 4A3, 7F12, 8A11, 8C12 and 16F9. The positions of PSMA and PSM' are
indicated by arrows. ,
Figure 5 shows graphs measuring the antibody dependent cellular
cytotoxicity (ADCC) response of HuMAbs 4A3, 7F12, 8A11, 8C12, and 16F9 using
LNCaP cell targets with PBMC's from two donors (Panels A and B), each at an
E:T
ratio of 100:1.
Figure 6 shows a fully human bispecific molecule, 14A8 x 8C12, which
binds to CD89 (FcaR) and to PSMA. The molecule contains an anti-CD89 F ab'
antibody fragment (derived from human monoclonal anti-CD89 antibody, 14A8)
chemically linked by disulfide bond to an anti-PSMA F ab' antibody fragment
(derived
from human monoclonal anti-PSMA antibody, 8C12).
Figure 7, Panel A is a graph showing monocyte-mediated antibody
dependent cell cytotoxicity (ADCC) of PSMA-expressing cells via the 14A8 x
8C12
bispecific molecule shown in Figure 6 as a function bispecific molecule
concentration.
Results were measured as a percent of specific cell lysis using no added
inhibitor, 50
~,g/ml free anti-FcRaR (14A8) F(ab')2 and 50 pg/ml free anti-FcyRI (H22)
F(ab')2;
Panel B is a graph showing monocyte-mediated antibody dependent cell
cytotoxicity
(ADCC) of LNCaP cells via the bispecific molecule 14A8 x 8C 12 and monoclonal
antibody 8C12 at an effectoraarget ratio of 100:1; Panel C is a graph showing
monocyte-mediated antibody dependent cell cytotoxicity (ADCC) of LNCaP cells
via
the 14A8 x 8C 12 bispecific molecule in the absence of inhibitor, or in the
presence of
excess amounts of 14A8 F(ab')2 or H22 F(ab')2, and at an effectoraarget ratio
of 100:1.
9
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
Figure 8, Panel A is a graph showing neutrophil-mediated antibody
dependent cell cytotoxicity (ADCC) of PSMA-expressing cells via the 14A8 x 8C
12
bispecific molecule shown in Figure 6 as a function bispecific molecule
concentration.
Results were measured as a percent of specific cell lysis using no added
inhibitor, 25
S gg/ml free anti-FcRaR (14A8) F(ab')2 and 25 ~g/ml free anti-FcyRI (H22)
F(ab')2;
Panel B is a graph showing neutrophil-mediated antibody dependent cell
cytotoxicity
(ADCC) of LNCaP cells via the 14A8 x 8C 12 bispecific molecule in the absence
of
inhibitor, or in the presence of excess amounts of 14A8 F(ab')2 or H22
F(ab')2, and at an
effectoraarget ratio of 200: I .
Figure 9, Panel A is a graph showing whole blood-mediated antibody
dependent cell cytotoxicity (ADCC) of PSMA-expressing cells via the 14A8 x
8C12
bispecific molecule shown in Figure 6 as a function bispecific molecule
concentration.
Results were measured as a percent of specific cell lysis using no added
inhibitor, 25
~g/ml free anti-FcRaR (14A8) F(ab')2 and 25 p.g/ml free anti-FcyRI (H22)
F(ab')2;
Panel B is a graph showing whole blood-mediated antibody dependent cell
cytotoxicity
(ADCC) of LNCaP cells via the 14A8 x 8C12 bispecific molecule in the absence
of
inhibitor, or in the presence of excess amounts of 14A8 F(ab')2 or H22
F(ab')2.
Figure 10 is a graph showing bispecific molecule (14A8 x 8C12) -
mediated phagocytosis of PSMA expressing (LNCaP) cells by monocyte derived
macrophages (MDM) (circles). Results were measured as a percent of
phagocytosis
both in the presence and absence of excess 14A8 antibody as an inhibitor
(squares) and
H22 antibody as a control (diamonds).
Figure Il is a graph showing bispecific molecule (14A8 x 8C12)-
mediated phagocytosis and antibody (8C12)- mediated phagocytosis of LNCaP
tumor
cells by monocyte derived macrophages (MDM).
Figure 12 is a graph showing bispecific molecule (14A8 x 8C12)-
mediated phagocytosis of LNCaP tumor cells by monocyte derived macrophages
(MDM) (circles). The inset is a graph showing phagocytosis mediated by the
14A8 x
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
8C12 bispecific molecule (1 ~,g/ml) in the presence of excess 14A8 F(ab')2 or
H22
F(ab')2 .
Figure 13 is a bar graph showing the biodistribution of izsl_4A3 in nude
mice with LNCaP cell tumors. Animals were injected with 100pg of lzsl-4A3
through
the tail vein and sacrificed at 0.25 and 24 hours after injection. The amount
of
radioactivity present in each tissue was determined. The data shows results
from
duplicate animals at each time point.
Figure 14 is a graph showing the internalization and processing of lzsl-
labeled HuMAb by LNCaP cells in culture. LNCaP cells were labeled with
iodinated
antibody, washed extensively, and the amount of cell surface bound label
internalized
and converted to TCA soluble products was determined at the indicated times.
Results
are shown for three HuMAbs that retained antigen binding properties after
iodination, as
well as irrelevant human IgG~ as a negative control.
Figure I S is a graph showing the effect of iodination with ~zSI on the
antigen binding ability of certain anti-PSMA HuMAbs. The results show the
amount of
~zSI-labeled HuMAb bound to immobilized native purified LNCaP PSMA, as a
function
of the dilution factor of the antibody.
Figure 16 include graphs showing the effect of DOTA-labeling on the
antigen binding ability of certain anti-PSMA HuMAbs. The results show the
amount of
DOTA-labeled HuMAb, or unconjugated antibody, bound to PSMA, as measured by
ELISA, as a function of the titration of the amount of antibody (in pg/ml).
Figure 17A and B shows the nucleotide sequence sequences of the VH-
and VL-regions, respectively, from each HuMAb 4A3, 7F12, 8C12, 8A11, and 16F9.
Figure 18 is an alignment comparison of the nucleotide sequence of the
heavy chain V regions of HuMAbs 4A3, 7F 12, 8A 11, 8C 12, 16F9, and the
corresponding chain V region of the germline nucleotide sequence.
11
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
Figure 19 is an alignment comparison of the amino acid sequence of the
heavy chain V region of HuMAbs 4A3, 7F12, 8A11, 8C12, 16F9, and the
corresponding
chain V region of the germline amino acid sequence.
Figure 20 is an alignment comparison of the nucleotide sequence of the
light (kappa) chain V region of HuMAbs 4A3, 7F 12, 8C 12, and the
corresponding chain
V region of the germline nucleotide sequence.
Figure 21 is an alignment comparison of the nucleotide sequence of the
light (kappa) chain V region of HuMAbs 8A11, 16F9, and the corresponding chain
V
region of the germline nucleotide sequence.
Figure 22 is an alignment comparison of the amino acid sequence of the
light (kappa) chain V region of HuMAbs 4A3, 7F 12, 8C 12, and the
corresponding chain
1 S V region of the germline amino acid sequence.
Figure 23 is an alignment comparison of the amino acid sequence of the
light (kappa) chain V region of HuMAbs 8A11, 16F9, and the corresponding chain
V
region of the germline amino acid sequence.
Detailed Description of the Invention
The present invention provides novel antibody-based therapies for
treating and diagnosing diseases characterized by expression of Prostate
Specific
Membrane Antigen (referred to herein as "PSMA"). Therapies of the invention
employ
isolated human monoclonal antibodies and/or related compositions containing
the
antibodies which bind to an epitope present on PSMA. In a particular
embodiment
exemplified herein, the human antibodies are produced in a nonhuman transgenic
animal, e.g., a transgenic mouse, capable of producing multiple isotypes of
human
monoclonal antibodies to PSMA (e.g., IgG, IgA and/or IgE) by undergoing V-D-J
recombination and isotype switching. Accordingly, aspects of the invention
include not
only antibodies, antibody fragments, and pharmaceutical compositions thereof,
but also
nonhuman transgenic animals, B-cells and hybridomas which produce monoclonal
antibodies. Methods of using the antibodies of the invention to detect a cell
expressing
PSMA, or to inhibit growth, differentiation and/or motility of a cell
expressing PSMA,
either in vitro or in vivo, are also encompassed by the invention.
12
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
In order that the present invention may be more readily understood,
certain terms are first defined. Additional definitions are set forth
throughout the
detailed description.
The term "Prostate Specific Membrane Antigen," "PSMA," and "PSMA
antigen" are used interchangeably herein, and include variants, isoforms and
species
homologs of human PSMA. Accordingly, human antibodies of the invention may, in
certain cases, cross-react with PSMA from species other than human, or other
proteins
which are structurally related to human PSMA (e.g., human PSMA homologs). In
other
cases, the antibodies may be completely specific for human PSMA and not
exhibit
species or other types of cross-reactivity.
As used herein, the term "inhibits growth" (e.g., referring to cells) is
intended to include any measurable decrease in the growth of a cell when
contacted with
an anti-PSMA antibody as compared to the growth of the same cell not in
contact with
an anti-PSMA antibody, e.g., the inhibition of growth of a cell by at least
about 10%,
1 S 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 99%, or 100%.
The term "antibody" as referred to herein includes whole antibodies and
arty antigen binding fragment (i.e., "antigen-binding portion") or single
chain thereof.
An "antibody" refers to a glycoprotein comprising at least two heavy (H)
chains and two
light (L) chains inter-connected by disulfide bonds, or an antigen binding
portion
thereof. Each heavy chain is comprised of a heavy chain variable region
(abbreviated
herein as VH) and a heavy chain constant region. The heavy chain constant
region is
comprised of three domains, CH,, C,-12 and CH3. Each light chain is comprised
of a light
chain variable region (abbreviated herein as VL) and a light chain constant
region. The
light chain constant region is comprised of one domain, C~. The VH and VL
regions can
be further subdivided into regions of hypervariability, termed complementarity
determining regions (CDR), interspersed with regions that are more conserved,
termed
framework regions (FR). Each VH and VL is composed of three CDRs and four FRs,
arranged from amino-terminus to carboxy-terminus in the following order: FR1,
CDR1,
FR2, CDR2, FR3, CDR3, FR4. The variable regions of the heavy and light chains
contain a binding domain that interacts with an antigen. The constant regions
of the
antibodies may mediate the binding of the immunoglobulin to host tissues or
factors,
including various cells of the immune system (e.g., effector cells) and the
first
component (Clq) of the classical complement system.
13
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
The term "antigen-binding portion" of an antibody (or simply "antibody
portion"), as used herein, refers to one or more fragments of an antibody that
retain the
ability to specifically bind to an antigen (e.g., PSMA). It has been shown
that the
antigen-binding function of an antibody can be performed by fragments of a
full-length
antibody. Examples of binding fragments encompassed within the term "antigen-
binding portion" of an antibody include (i) a Fab fragment, a monovalent
fragment
consisting of the VL, VH, CL and CH1 domains; (ii) a F(ab')2 fragment, a
bivalent
fragment comprising two Fab fragments linked by a disulfide bridge at the
hinge region;
(iii) a Fd fragment consisting of the VH and CHI domains; (iv) a Fv fragment
consisting
of the VL and VH domains of a single arm of an antibody, (v) a dAb fragment
(Ward et
al., (1989) Nature 341:544-546), which consists of a VH domain; and (vi) an
isolated
complementarity determining region (CDR). Furthermore, although the two
domains of
the Fv fragment, VL and VH, are coded for by separate genes, they can be
joined, using
recombinant methods, by a synthetic linker that enables them to be made as a
single
protein chain in which the VL and VH regions pair to form monovalent molecules
(known as single chain Fv (scFv); see e.g., Bird et al. (1988) Science 242:423-
426; and
Huston et al. (1988) Proc. Natl. Acad Sci. USA 85: 5879-5883). Such single
chain
antibodies are also intended to be encompassed within the term "antigen-
binding
portion" of an antibody. These antibody fragments are obtained using
conventional
techniques known to those with skill in the art, and the fragments are
screened for utility
in the same manner as are intact antibodies.
The term "epitope" means a protein determinant capable of specific
binding to an antibody. Epitopes usually consist of chemically active surface
groupings
of molecules such as amino acids or sugar side chains and usually have
specific three
dimensional structural characteristics, as well as specific charge
characteristics.
Conformational and nonconformational epitopes are distinguished in that the
binding to
the former but not the latter is lost in the presence of denaturing solvents.
The term "native conformational epitope" or "native protein epitope" are
used interchangeably herein, and include protein epitopes resulting from
conformational
folding of the PSMA molecule which arise when amino acids from differing
portions of
the linear sequence of the PSMA molecule come together in close proximity in 3-
dimensional space. Such conformational epitopes are distributed on the
extracellular
side of the plasma membrane.
14
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
The term "bispecific molecule" is intended to include any agent, e.g., a
protein, peptide, or protein or peptide complex, which has two different
binding
specificities. For example, the molecule may bind to, or interact with, (a) a
cell surface
antigen and (b) an Fc receptor on the surface of an effector cell. The term
"multispecific
molecule" or "heterospecific molecule" is intended to include any agent, e.g.,
a protein,
peptide, or protein or peptide complex, which has more than two different
binding
specificities. For example, the molecule may bind to, or interact with, (a) a
cell surface
antigen, (b) an Fc receptor on the surface of an effector cell, and (c) at
least one other
component. Accordingly, the invention includes, but is not limited to,
bispecific,
trispecific, tetraspecific, and other multispecific molecules which are
directed to cell
surface antigens, such as PSMA, and to other targets, such as Fc receptors on
effector
cells.
The term "bispecific antibodies" also includes diabodies. Diabodies are
bivalent, bispecific antibodies in which the VH and VL domains are expressed
on a single
polypeptide chain, but using a linker that is too short to allow for pairing
between the
two domains on the same chain, thereby forcing the domains to pair with
complementary domains of another chain and creating two antigen binding sites
(see
e.g., Holliger, P., et al. (1993) Proc. Natl. Acad. Sci. USA 90:6444-6448;
Poljak, R.J., et
al. (1994) Structure 2:1121-1123).
The term "human antibody derivatives" refers to any modified form of
the antibody, e.g., a conjugate of the antibody and another agent or antibody.
As used herein, a human antibody is "derived from" a particular germline
sequence if the antibody is obtained from a system using human immunoglobulin
sequences, e.g., by immunizing a transgenic mouse carrying human
immunoglobulin
genes or by screening a human immunoglobulin gene library. A human antibody
that is
"derived from" a human germline immunoglobulin sequence can be identified as
such
by comparing the amino acid sequence of the human antibody to the amino acid
sequence of human germline immunoglobulins. A selected human antibody
typically is
at least 90% identical in amino acids sequence to an amino acid sequence
encoded by a
human germline immunoglobulin gene and contains amino acid residues that
identify
the human antibody as being human when compared to the germline immunoglobulin
amino acid sequences of other species (e.g., marine germline sequences). In
certain
cases, a human antibody may be at least 95%, or even at least 96%, 97%, 98%,
or 99%
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
identical in amino acid sequence to the amino acid sequence encoded by the
germline
immunoglobulin gene. Typically, a human antibody derived from a particular
human
germline sequence will display no more than 10 amino acid differences from the
amino
acid sequence encoded by the human germline immunoglobulin gene. In certain
cases,
the human antibody may display no more than S, or even no more than 4, 3, 2,
or 1
amino acid difference from the amino acid sequence encoded by the germline
immunoglobulin gene.
As used herein, the term "heteroantibodies" refers to two or more
antibodies, antibody binding fragments (e.g., Fab), derivatives therefrom, or
antigen
binding regions linked together, at least two of which have different
specificities. These
different specificities include a binding specificity for an Fc receptor on an
effector cell,
and a binding specificity for an antigen or epitope on a target cell, e.g., a
tumor cell.
The term "human antibody", as used herein, is intended to include antibodies
having
variable and constant regions derived from human germline immunoglobulin
sequences.
The human antibodies of the invention may include amino acid residues not
encoded by
human germline immunoglobulin sequences (e.g., mutations introduced by random
or
site-specific mutagenesis in vitro or by somatic mutation in vivo). However,
the term
"human antibody", as used herein, is not intended to include antibodies in
which CDR
sequences derived from the germline of another mammalian species, such as a
mouse,
have been grafted onto human framework sequences.
The terms "monoclonal antibody" or "monoclonal antibody composition"
as used herein refer to a preparation of antibody molecules of single
molecular
composition. A monoclonal antibody composition displays a single binding
specificity
and affinity for a particular epitope. Accordingly, the term "human monoclonal
antibody" refers to antibodies displaying a single binding specificity which
have
variable and constant regions derived from human germline immunoglobulin
sequences.
In one embodiment, the human monoclonal antibodies are produced by a hybridoma
which includes a B cell obtained from a transgenic nonhuman animal, e.g., a
transgenic
mouse, having a genome comprising a human heavy chain transgene and a light
chain
transgene fused to an immortalized cell.
The term "recombinant human antibody", as used herein, includes all
human antibodies that are prepared, expressed, created or isolated by
recombinant
means, such as (a) antibodies isolated from an animal (e.g., a mouse) that is
transgenic
16
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
or transchromosomal for human immunoglobulin genes or a hybridoma prepared
therefrom (described further in Section I, below), (b) antibodies isolated
from a host cell
transformed to express the antibody, e.g., from a transfectoma, (c) antibodies
isolated
from a recombinant, combinatorial human antibody library, and (d) antibodies
prepared,
expressed, created or isolated by any other means that involve splicing of
human
immunoglobulin gene sequences to other DNA sequences. Such recombinant human
antibodies have variable and constant regions derived from human germline
immunoglobulin sequences. In certain embodiments, however, such recombinant
human antibodies can be subjected to in vitro mutagenesis (or, when an animal
transgenic for human Ig sequences is used, in vivo somatic mutagenesis) and
thus the
amino acid sequences of the VH and VL regions of the recombinant antibodies
are
sequences that, while derived from and related to human germline VH and VL
sequences,
may not naturally exist within the human antibody germline repertoire in vivo.
As used herein, a "heterologous antibody" is defined in relation to the
transgenic nonhuman organism producing such an antibody. This term refers to
an
antibody having an amino acid sequence or an encoding nucleic acid sequence
corresponding to that found in an organism not consisting of the transgenic
nonhuman
animal, and generally from a species other than that of the transgenic
nonhuman animal.
As used herein, a "heterohybrid antibody" refers to an antibody having a
light and heavy chains of different organismal origins. For example, an
antibody having
a human heavy chain associated with a murine light chain is a heterohybrid
antibody.
Examples of heterohybrid antibodies include chimeric and humanized antibodies,
discussed supra.
An "isolated antibody," as used herein, is intended to refer to an antibody
which is substantially free of other antibodies having different antigenic
specificities
(e.g., an isolated antibody that specifically binds to PSMA is substantially
free of
antibodies that specifically bind antigens other than PSMA). An isolated
antibody that
specifically binds to an epitope, isoform or variant of human PSMA may,
however, have
cross-reactivity to other related antigens, e.g., from other species (e.g.,
PSMA species
homologs). Moreover, an isolated antibody may be substantially free of other
cellular
material and/or chemicals. In one embodiment of the invention, a combination
of
"isolated" monoclonal antibodies having different specificities are combined
in a well
defined composition.
17
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
As used herein, "specific binding" refers to antibody binding to a
predetermined antigen. Typically, the antibody binds with a dissociation
constant (KD)
of 10-~ M or less , and binds to the predetermined antigen with a KD that is
at least two-
fold less than its KD for binding to a non-specific antigen (e.g., BSA,
casein) other than
the predetermined antigen or a closely-related antigen. The phrases "an
antibody
recognizing an antigen" and " an antibody specific for an antigen" are used
interchangeably herein with the term "an antibody which binds specifically to
an
antigen".
As used herein, the term "high affinity" for an IgG antibody refers to an
antibody having a KD of 10-g M or less, more preferably 10-9 M or less and
even more
preferably 10-1° M or less. binding affinity of at least about 10~M'1,
preferably at least
about 109M-~, more preferably at least about 10'°M-~,10~~M-1, 1O12M-1
or greater, e.g., up
to 10 ~ 3M-1 or greater. However, "high affinity" binding can vary for other
antibody
isotypes. For example, "high affinity" binding for an IgM isotype refers to an
antibody
having a KD of 10-~ M or less, more preferably 10-8 M or less.. -
The term "Kassoc~~ or "Ka", as used herein, is intended to refer to the
association rate of a
particular antibody-antigen interaction, whereas the term "Kdis" or "Kd," as
used herein,
is intended to refer to the dissociation rate of a particular antibody-antigen
interaction.
The term "Kp", as used herein, is intended to refer to the dissociation
constant, which is
obtained from the ratio of Kd to Ka (i. e,. Kd/Ka) and is expressed as a molar
concentration (M).
As used herein, "isotype" refers to the antibody class (e.g., IgM or IgGI)
that is encoded by heavy chain constant region genes.
As used herein, "isotype switching" refers to the phenomenon by which
the class, or isotype, of an antibody changes from one Ig class to one of the
other Ig
classes.
As used herein, "nonswitched isotype" refers to the isotypic class of
heavy chain that is produced when no isotype switching has taken place; the CH
gene
encoding the nonswitched isotype is typically the first CH gene immediately
downstream from the functionally rearranged VDJ gene. Isotype switching has
been
classified as classical or non-classical isotype switching. Classical isotype
switching
occurs by recombination events which involve at least one switch sequence
region in the
transgene. Non-classical isotype switching may occur by, for example,
homologous
18
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
recombination between human a~ and human ~~ (8-associated deletion).
Alternative
non-classical switching mechanisms, such as intertransgene and/or
interchromosomal
recombination, among others, may occur and effectuate isotype switching.
As used herein, the term "switch sequence" refers to those DNA
sequences responsible for switch recombination. A "switch donor" sequence,
typically a
~ switch region, will be 5' (i.e., upstream) of the construct region to be
deleted during
the switch recombination. The "switch acceptor" region will be between the
construct
region to be deleted and the replacement constant region (e.g., ~y, E, etc.).
As there is no
specific site where recombination always occurs, the final gene sequence will
typically
not be predictable from the construct.
As used herein, "glycosylation pattern" is defined as the pattern of
carbohydrate units that are covalently attached to a protein, more
specifically to an
immunoglobulin protein. A glycosylation pattern of a heterologous antibody can
be
characterized as being substantially similar to glycosylation patterns which
occur
naturally on antibodies produced by the species of the nonhuman transgenic
animal,
when one of ordinary skill in the art would recognize the glycosylation
pattern of the
heterologous antibody as being more similar to said pattern of glycosylation
in the
species of the nonhuman transgenic animal than to the species from which the
CH genes
of the transgene were derived.
The term "naturally-occurring" as used herein as applied to an object
refers to the fact that an object can be found in nature. For example, a
polypeptide or
polynucleotide sequence that is present in an organism (including viruses)
that can be
isolated from a source in nature and which has not been intentionally modified
by man
in the laboratory is naturally-occurring.
The term "rearranged" as used herein refers to a configuration of a heavy
chain or light chain immunoglobulin locus wherein a V segment is positioned
immediately adjacent to a D-J or J segment in a conformation encoding
essentially a
complete VH or V,, domain, respectively. A rearranged immunoglobulin gene
locus can
be identified by comparison to germline DNA; a rearranged locus will have at
least one
recombined heptamer/nonamer homology element.
The term "unrearranged" or "germline configuration" as used herein in
reference to a V segment refers to the configuration wherein the V segment is
not
recombined so as to be immediately adjacent to a D or J segment.
19'
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
The term "nucleic acid molecule", as used herein, is intended to include
DNA molecules and RNA molecules. A nucleic acid molecule may be single-
stranded
or double-stranded, but preferably is double-stranded DNA.
The term "isolated nucleic acid molecule," as used herein in reference to
nucleic acids encoding antibodies or antibody portions (e.g., VH, VL, CDR3)
that bind to
PSMA, is intended to refer to a nucleic acid molecule in which the nucleotide
sequences
encoding the antibody or antibody portion are free of other nucleotide
sequences
encoding antibodies or antibody portions that bind antigens other than PSMA,
which
other sequences may naturally flank the nucleic acid in human genomic DNA. In
one
embodiment, the human anti-PSMA antibody, or portion thereof, includes the
nucleotide
or amino acid sequence of 4A3, 7F12, 8A11, 8C12, or 16F9, as well as heavy
chain
(VH) and light chain (VL) variable regions having the sequences shown in SEQ
ID
NOs:I, 3, 5, 7, or 9 and 2, 4, 6, 8, or 10, respectively.
As disclosed and claimed herein, the sequences set forth in SEQ ID NOs:
1-58 include "conservative sequence modifications", i.e., nucleotide and amino
acid
sequence modifications which do not significantly affect or alter the binding
characteristics of the antibody encoded by the nucleotide sequence or
containing the
amino acid sequence. Such conservative sequence modifications include
nucleotide and
amino acid substitutions, additions and deletions. Modifications can be
introduced into
SEQ ID NOs: 1-58 by standard techniques known in the art, such as site-
directed
mutagenesis and PCR-mediated mutagenesis. Conservative amino acid
substitutions
include ones in which the amino acid residue is replaced with an amino acid
residue
having a similar side chain. Families of amino acid residues having similar
side chains
have been defined in the art. These families include amino acids with basic
side chains
(e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid,
glutamic acid),
uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine,
threonine,
tyrosine, cysteine, tryptophan), nonpolar side chains (e.g., alanine, valine,
leucine,
isoleucine, proline, phenylalanine, methionine), beta-branched side chains
(e.g.,
threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine,
phenylalanine,
tryptophan, histidine). Thus, a predicted nonessential amino acid residue in a
human
anti-PSMA antibody is preferably replaced with another amino acid residue from
the
same side chain family.
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
Alternatively, in another embodiment, mutations can be introduced
randomly along all or part of a anti-PSMA antibody coding sequence, such as by
saturation mutagenesis, and the resulting modified anti-PSMA antibodies can be
screened for binding activity.
Accordingly, antibodies encoded by the (heavy and light chain variable
region) nucleotide sequences disclosed herein and/or containing the (heavy and
light
chain variable region) amino acid sequences disclosed herein (i.e., SEQ ID
NOs: 1-50)
include substantially similar antibodies encoded by or containing similar
sequences
which have been conservatively modified. Further discussion as to how such
substantially similar antibodies can be generated based on the partial (i.e.,
heavy and
light chain variable regions) sequences disclosed herein as SEQ ID NOs: 1-50
is
provided below.
For nucleic acids, the term "substantial homology" indicates that two
nucleic acids, or designated sequences thereof, when optimally aligned and
compared,
are identical, with appropriate nucleotide insertions or deletions, in at
least about 80% of
the nucleotides, usually at least about 90% to 95%, and more preferably at
least about
98% to 99.5% of the nucleotides. Alternatively, substantial homology exists
when the
segments will hybridize under selective hybridization conditions, to the
complement of
the strand.
The percent identity between two sequences is a function of the number
of identical positions shared by the sequences (i.e., % homology = # of
identical
positions/total # of positions x 100), taking into account the number of gaps,
and the
length of each gap, which need to be introduced for optimal alignment of the
two
sequences. The comparison of sequences and determination of percent identity
between
two sequences can be accomplished using a mathematical algorithm, as described
in the
non-limiting examples below.
The percent identity between two nucleotide sequences can be
determined using the GAP program in the GCG software package (available at
http://www.gcg.com), using a NWSgapdna.CMP matrix and a gap weight of 40, 50,
60,
70, or 80 and a length weight of 1, 2, 3, 4, 5, or 6. The percent identity
between two
nucleotide or amino acid sequences can also determined using the algorithm of
E.
Meyers and W. Miller (Comput. Appl. Biosci., 4:11-17 (1988)) which has been
incorporated into the ALIGN program (version 2.0), using a PAM120 weight
residue
21
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
table, a gap length penalty of 12 and a gap penalty of 4. In addition, the
percent identity
between two amino acid sequences can be determined using the Needleman and
Wunsch (J. Mol. Biol. 48:444-453 (1970)) algorithm which has been incorporated
into
the GAP program in the GCG software package (available at http://www.gcg.com),
S using either a Blossum 62 matrix or a PAM250 matrix, and a gap weight of 16,
14, 12,
10, 8, 6, or 4 and a length weight of 1, 2, 3, 4, 5, or 6.
The nucleic acid and protein sequences of the present invention can
further be used as a "query sequence" to perform a search against public
databases to,
for example, identify related sequences. Such searches can be performed using
the
NBLAST and XBLAST programs (version 2.0) of Altschul, et al. (1990) J. Mol.
Biol.
215:403-10. BLAST nucleotide searches can be performed with the NBLAST
program,
score = 100, wordlength = 12 to obtain nucleotide sequences homologous to the
nucleic
acid molecules of the invention. BLAST protein searches can be performed with
the
XBLAST program, score = 50, wordlength = 3 to obtain amino acid sequences
homologous to the protein molecules of the invention. To obtain gapped
alignments for
comparison purposes, Gapped BLAST can be utilized as described in Altschul et
al.,
(1997) Nucleic Acids Res. 25(17):3389-3402. When utilizing BLAST and Gapped
BLAST programs, the default parameters of the respective programs (e.g.,
XBI,AST
and NBLAST) can be used. See http://www.ncbi.nlm.nih.gov.
The nucleic acids may be present in whole cells, in a cell lysate, or in a
partially purified or substantially pure form. A nucleic acid is "isolated" or
"rendered
substantially pure" when purified away from other cellular components or other
contaminants, e.g., other cellular nucleic acids or proteins, by standard
techniques,
including alkaline/SDS treatment, CsCI banding, column chromatography, agarose
gel
electrophoresis and others well known in the art. See, F. Ausubel, et al., ed.
Current
Protocols in Molecular Biology, Greene Publishing and Wiley Interscience, New
York
(1987).
The nucleic acid compositions of the present invention, while often in a
native sequence (except for modified restriction sites and the like), from
either cDNA,
genomic or mixtures may be mutated, thereof in accordance with standard
techniques to
provide gene sequences. For coding sequences, these mutations, may affect
amino acid
sequence as desired. In particular, DNA sequences substantially homologous to
or
derived from native V, D, J, constant, switches and other such sequences
described
22
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
herein are contemplated (where "derived" indicates that a sequence is
identical or
modified from another sequence).
A nucleic acid is "operably linked" when it is placed into a functional
relationship with another nucleic acid sequence. For instance, a promoter or
enhancer is
operably linked to a coding sequence if it affects the transcription of the
sequence. With
respect to transcription regulatory sequences, operably linked means that the
DNA
sequences being linked are contiguous and, where necessary to join two protein
coding
regions, contiguous and in reading frame. For switch sequences, operably
linked
indicates that the sequences are capable of effecting switch recombination.
The term "vector," as used herein, is intended to refer to a nucleic acid
molecule capable of transporting another nucleic acid to which it has been
linked. One
type of vector is a "plasmid", which refers to a circular double stranded DNA
loop into
which additional DNA segments may be ligated. Another type of vector is a
viral
vector, wherein additional DNA segments may be ligated into the viral genome.
Certain
vectors are capable of autonomous replication in a host cell into which they
are
introduced (e.g., bacterial vectors having a bacterial origin of replication
and episomal
mammalian vectors). Other vectors (e.g., non-episomal mammalian vectors) can
be
integrated into the genome of a host cell upon introduction into the host
cell, and thereby
are replicated along with the host genome. Moreover, certain vectors are
capable of
directing the expression of genes to which they are operatively linked. Such
vectors are
referred to herein as "recombinant expression vectors" (or simply, "expression
vectors").
In general, expression vectors of utility in recombinant DNA techniques are
often in the
form of plasmids. In the present specification, "plasmid" and "vector" may be
used
interchangeably as the plasmid is the most commonly used form of vector.
However,
the invention is intended to include such other forms of expression vectors,
such as viral
vectors (e.g., replication defective retroviruses, adenoviruses and adeno-
associated
viruses), which serve equivalent functions.
The term "recombinant host cell" (or simply "host cell"), as used herein,
is intended to refer to a cell into which a recombinant expression vector has
been
introduced. It should be understood that such terms are intended to refer not
only to the
particular subject cell but to the progeny of such a cell. Because certain
modifications
may occur in succeeding generations due to either mutation or environmental
influences,
such progeny may not, in fact, be identical to the parent cell, but are still
included within
23
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
the scope of the term "host cell" as used herein. Recombinant host cells
include, for
example, CHO cells and lymphocytic cells.
As used herein, the term "subject" includes any human or nonhuman
animal. The term "nonhuman animal" includes all vertebrates, e.g., mammals and
non-
mammals, such as nonhuman primates, sheep, dog, cow, chickens, amphibians,
reptiles,
etc.
The terms "transgenic, nonhuman animal" refers to a nonhuman animal
having a genome comprising one or more human heavy and/or light chain
transgenes or
transchromosomes (either integrated or non-integrated into the animal's
natural genomic
DNA) and which is capable of expressing fully human antibodies. For example, a
transgenic mouse can have a human light chain transgene and either a human
heavy
chain transgene or human heavy chain transchromosome, such that the mouse
produces
human anti-PSMA antibodies when immunized with PSM antigen and/or cells
expressing PSMA. The human heavy chain transgene can be integrated into the
chromosomal DNA of the mouse, as is the case for transgenic, e.g., HuMAb mice,
or the
human heavy chain transgene can be maintained extrachromosomally, as is the
case for
transchromosomal (e.g., KM) mice as described in WO 02/43478. Such transgenic
and
transchromosomal mice are capable of producing multiple isotypes of human
monoclonal antibodies to PSMA (e.g., IgG, IgA and/or IgE) by undergoing V-D-J
recombination and isotype switching.
Various aspects of the invention are described in further detail in the
following subsections.
L Production of Human Antibodies to PSMA
Human monoclonal antibodies (mAbs) of the present invention can be
produced by a variety of techniques, including conventional monoclonal
antibody
methodology e.g., the standard somatic cell hybridization technique of Kohler
and
Milstein (1975) Nature 256: 495. Although somatic cell hybridization
procedures are
preferred, in principle, other techniques for producing monoclonal antibody
can be
employed e.g., viral or oncogenic transformation of B lymphocytes.
The preferred animal system for preparing hybridomas is the murine
system. Hybridoma production in the mouse is a very well-established
procedure.
Immunization protocols and techniques for isolation of immunized splenocytes
for
24
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
fusion are known in the art. Fusion partners (e.g., marine myeloma cells) and
fusion
procedures are also known.
In a preferred embodiment, human monoclonal antibodies directed
against PSMA can be generated using transgenic or transchromosomic mice
carrying
parts of the human immune system rather than the mouse system. These
transgenic and
transchromosomic mice include mice referred to herein as HuMAb mice and KM
mice,
respectively, and are collectively referred to herein as "transgenic mice."
The HuMAb mouse contains a human immunoglobulin gene miniloci
that encodes unrearranged human heavy (~ and y) and K light chain
immunoglobulin
sequences, together with targeted mutations that inactivate the endogenous ~
and K
chain loci (Lonberg, et al. (1994) Nature 368(6474): 856-859). Accordingly,
the mice
exhibit reduced expression of mouse IgM or K, and in response to immunization,
the
introduced human heavy and light chain transgenes undergo class switching and
somatic
mutation to generate high affinity human IgGK monoclonal (Lonberg, N. et al.
(1994),
supra; reviewed in Lonberg, N. (1994) Handbook ofExperimental Pharmacology
113:49-101; Lonberg, N. and Huszar, D. (1995) Intern. Rev. Imrnunol. Vol. 13:
65-93,
and Handing, F. and Lonberg, N. (1995) Ann. N. Y. Acad. Sci 764:536-546). The
preparation of HuMAb mice is described in detail Section II below and in
Taylor, L. et
al. (1992) Nucleic Acids Research 20:6287-6295; Chen, J. et al. (1993)
International
Immunology 5: 647-656; Tuaillon et al. (1993) Proc. Natl. Acad Sci USA 90:3720-
3724; Choi et al. (1,993) Nature Genetics 4:117-123; Chen, J. et al. (1993)
EMBO J. 12:
821-830; Tuaillon et al. (1994) J. Immunol. 152:2912-2920; Lonberg et al.,
(1994)
Nature 368(6474): 856-859; Lonberg, N. (1994) Handbook of Experimental
Pharmacology 113:49-101; Taylor, L. et al. (1994) International Immunology 6:
579-
591; Lonberg, N. and Huszar, D. (1995) Intern. Rev. Immunol. Vol. 13: 65-93;
Handing,
F. and Lonberg, N. (1995) Ann. N Y. Acad Sci 764:536-546; Fishwild, D. et al.
(1996)
Nature Biotechnology 14: 845-851, the contents of all of which are hereby
incorporated
by reference in their entirety. See further, U.S. Patent Nos. 5,545,806;
5,569,825;
5,625,126; 5,633,425; 5,789,650; 5,877,397; 5,661,016; 5,814,318; 5,874,299;
and
5,770,429; all to Lonberg and Kay, and GenPharm International; U.S. Patent No.
5,545,807 to Surani et al.; International Publication Nos. WO 98/24884,
published on
June 11, 1998; WO 94/25585, published November 10, 1994; WO 93/1227, published
June 24, 1993; WO 92/22645, published December 23, 1992; WO 92/03918,
published
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
March 19, 1992, the disclosures of all of which are hereby incorporated by
reference in
their entity. Alternatively, the HC012 transgenic mice described in Example 2,
can be
used to generate human anti-PSMA antibodies.
Immunizations
To generate fully human monoclonal antibodies to PSMA, HuMAb mice
can be immunized with a purified or enriched preparation of PSMA antigen
and/or cells
expressing PSMA, as described by Lonberg, N. et al. (1994) Nature 368(6474):
856-859; Fishwild, D. et al. (1996) Nature Biotechnology 14: 845-851 and WO
98/24884. Preferably, the mice will be 6-16 weeks of age upon the first
infusion. For
example, a purified or enriched preparation (5-20 pg) of PSMA antigen (e.g.,
purified
from PSMA-expressing LNCaP cells) can be used to immunize the HuMAb mice
intraperitoneally. In the event that immunizations using a purified or
enriched
preparation of PSMA antigen do not result in antibodies, mice can also be
immunized
with cells expressing PSMA, e.g., a tumor cell line, to promote immune
responses.
Cumulative experience with various antigens has shown that the HuMAb
transgenic mice typically respond best when initially immunized
intraperitoneally (IP)
with antigen in complete Freund's adjuvant, followed by every other week i.p.
immunizations (up to a total of 6) with antigen in incomplete Freund's
adjuvant,
followed by every other week IP/SC immunizations (up to a total of 10) with
antigen in
incomplete Freund's adjuvant. The immune response can be monitored over the
course
of the immunization protocol with plasma samples being obtained by
retroorbital bleeds.
The plasma can be screened by ELISA (as described below), and mice with
sufficient
titers of anti-PSMA human immunoglobulin can be used for fusions. Mice can be
boosted intravenously with antigen 3 days before sacrifice and removal of the
spleen. It
is expected that 2-3 fusions for each antigen may need to be performed.
Several mice
will be immunized for each antigen. For example, a total of twelve HuMAb mice
of the
HC07 and HC012 strains can be immunized.
Generation of Hybridomas Producing Human Monoclonal Antibodies to PSMA
To generate hybridomas producing human monoclonal antibodies to
PSMA, splenocytes and lymph node cells from immunized mice can be isolated and
fused to an appropriate immortalized cell line, such as a mouse myeloma cell
line. The
26
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
resulting hybridomas can be screened for the production of antigen-specific
antibodies.
For example, single cell suspensions of splenic lymphocytes from immunized
mice can
be fused to one-sixth the number of P3X63-Ag8.653 nonsecreting mouse myeloma
cells
(ATCC, CRL 1580) with 50% PEG. Cells are plated at approximately 2 x 105 in
flat
bottom microtiter plate, followed by a two week incubation in selective medium
containing 20% fetal Clone Serum, 18% "653" conditioned media, 5% origen
(IGEN), 4
mM L-glutamine, 1 mM L~glutamine, 1 mM sodium pyruvate, SmM HEPES, 0.055
mM 2-mercaptoethanol, SO units/ml penicillin, SO mg/ml streptomycin, 50 mg/ml
gentamycin and 1X HAT (Sigma; the HAT is added 24 hours after the fusion).
After
approximately two weeks, cells can be cultured in medium in which the HAT is
replaced
with HT. Individual wells can then be screened by ELISA for human anti-PSMA
monoclonal IgM and IgG antibodies. Once extensive hybridoma growth occurs,
medium can be observed usually after 10-14 days. The antibody secreting
hybridomas
can be replated, screened again, and if still positive for human IgG, anti-
PSMA
monoclonal antibodies, can be subcloned at least twice by limiting dilution.
The stable
subclones can then be cultured in vitro to generate small amounts of antibody
in tissue
culture medium for characterization.
Generation of Transfectomas Producing Human Monoclonal Antibodies to PSMA
Human antibodies of the invention also can be produced in a host cell
transfectoma using, for example, a combination of recombinant DNA techniques
and
gene transfection methods as is well known in the art (e.g., Morrison, S.
(1985) Science
229:1202).
For example, to express the antibodies, or antibody fragments thereof,
DNAs encoding partial or full-length light and heavy chains, can be obtained
by
standard molecular biology techniques (e.g., PCR amplification, site directed
mutagenesis) and can be inserted into expression vectors such that the genes
are
operatively linked to transcriptional and translational control sequences. In
this context,
the term "operatively linked" is intended to mean that an antibody gene is
ligated into a
vector such that transcriptional and translational control sequences within
the vector
serve their intended function of regulating the transcription and translation
of the
antibody gene. The expression vector and expression control sequences are
chosen to be
compatible with the expression host cell used. The antibody light chain gene
and the
27
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
antibody heavy chain gene can be inserted into separate vector or, more
typically, both
genes are inserted into the same expression vector. The antibody genes are
inserted into
the expression vector by standard methods (e.g., ligation of complementary
restriction
sites on the antibody gene fragment and vector, or blunt end ligation if no
restriction
sites are present). The light and heavy chain variable regions of the
antibodies described
herein can be used to create full-length antibody genes of any antibody
isotype by
inserting them into expression vectors already encoding heavy chain constant
and light
chain constant regions of the desired isotype such that the VH segment is
operatively
linked to the CH segments) within the vector and the V,, segment is
operatively linked
to the CL segment within the vector. Additionally or alternatively, the
recombinant
expression vector can encode a signal peptide that facilitates secretion of
the antibody
chain from a host cell. The antibody chain gene can be cloned into the vector
such that
the signal peptide is linked in-frame to the amino terminus of the antibody
chain gene.
The signal peptide can be an immunoglobulin signal peptide or a heterologous
signal
peptide (i.e., a signal peptide from a non-immunoglobulin protein).
In addition to the antibody chain genes, the recombinant expression
vectors of the invention carry regulatory sequences that control the
expression of the
antibody chain genes in a host cell. The term "regulatory sequence" is
intended to
includes promoters, enhancers and other expression control elements (e.g.,
polyadenylation signals) that control the transcription or translation of the
antibody
chain genes. Such regulatory sequences are described, for example, in Goeddel;
Gene
Expression Technology. Methods in Enzymology 185, Academic Press, San Diego,
CA
(1990). It will be appreciated by those skilled in the art that the design of
the expression
vector, including the selection of regulatory sequences may depend on such
factors as
the choice of the host cell to be transformed, the level of expression of
protein desired,
etc. Preferred regulatory sequences for mammalian host cell expression include
viral
elements that direct high levels of protein expression in mammalian cells,
such as
promoters and/or enhancers derived from cytomegalovirus (CMV), Simian Virus 40
(SV40), adenovirus, (e.g., the adenovirus major late promoter (AdMLP)) and
polyoma.
Alternatively, nonviral regulatory sequences may be used, such as the
ubiquitin
promoter or (3-globin promoter.
28
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
In addition to the antibody chain genes and regulatory sequences, the
recombinant expression vectors of the invention may carry additional
sequences, such as
sequences that regulate replication of the vector in host cells (e.g., origins
of replication)
and selectable marker genes. The selectable marker gene facilitates selection
of host
cells into which the vector has been introduced (see, e.g., U.S. Pat. Nos.
4,399,216,
4,634,665 and 5,179,017, all by Axel et al.). For example, typically the
selectable
marker gene confers resistance to drugs, such as 6418, hygromycin or
methotrexate, on
a host cell into which the vector has been introduced. Preferred selectable
marker genes
include the dihydrofolate reductase (DHFR) gene (for use in dhfr- host cells
with
methotrexate selection/amplification) and the neo gene (for 6418 selection).
For expression of the light and heavy chains, the expression vectors)
encoding the heavy and light chains is transfected into a host cell by
standard
techniques. The various forms of the term "transfection" are intended to
encompass a
wide variety of techniques commonly used for the introduction of exogenous DNA
into
a prokaryotic or eukaryotic host cell, e.g., electroporation, calcium-
phosphate
precipitation, DEAE-dextran transfection and the like. Although it is
theoretically
possible to express the antibodies of the invention in either prokaryotic or
eukaryotic
host cells, expression of antibodies in eukaryotic cells, and most preferably
mammalian
host cells, is the most preferred because such eukaryotic cells, and in
particular
mammalian cells, are more likely than prokaryotic cells to assemble and
secrete a
properly folded and immunologically active antibody. Prokaryotic expression of
antibody genes has been reported to be ineffective for production of high
yields of active
antibody (Boss, M. A. and Wood, C. R. (1985) Immunology Today 6:12-13).
Preferred mammalian host cells for expressing the recombinant
antibodies of the invention include Chinese Hamster Ovary (CHO cells)
(including dhfr-
CHO cells, described in Urlaub and Chasin, (1980) Proc. Natl. Acad. Sci. USA
77:4216-
4220, used with a DHFR selectable marker, e.g., as described in R. J. Kaufman
and P.
A. Sharp (1982) Mol. Biol. 159:601-621), NSO myeloma cells, COS cells and SP2
cells.
In particular, for use with NSO myeloma cells, another preferred expression
system is
the GS gene expression system disclosed in WO 87/04462, WO 89/01036 and EP
338,841. When recombinant expression vectors encoding antibody genes are
introduced
into mammalian host cells, the antibodies are produced by culturing the host
cells for a
period of time sufficient to allow for expression of the antibody in the host
cells or, more
29
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
preferably, secretion of the antibody into the culture medium in which the
host cells are
grown. Antibodies can be recovered from the culture medium using standard
protein
purification methods.
Use of Partial Antibody Sequences to Express Intact Antibodies
Antibodies interact with target antigens predominantly through amino
acid residues that are located in the six heavy and light chain
complementarity
determining regions (CDRs). For this reason, the amino acid sequences within
CDRs
are more diverse between individual antibodies than sequences outside of CDRs.
Because CDR sequences are responsible for most antibody-antigen interactions,
it is
possible to express recombinant antibodies that mimic the properties of
specific
naturally occurring antibodies by constructing expression vectors that include
CDR
sequences from the specific naturally occurring antibody grafted onto
framework
sequences from a different antibody with different properties (see, e.g.,
Riechmann, L. et
al., 1998, Nature 332:323-327; Jones, P. et al., 1986, Nature 321:522-525; and
Queen,
C. et al., 1989, Proc. Natl. Acad. See. U.S.A. 86:10029-10033). Such framework
sequences can be obtained from public DNA databases that include germline
antibody
gene sequences. These germline sequences will differ from mature antibody gene
sequences because they will not include completely assembled variable genes,
which are
formed by V(D)J joining during B cell maturation. Germline gene sequences will
also
differ from the sequences of a high affinity secondary repertoire antibody at
individual
evenly across the variable region. For example, somatic mutations are
relatively
infrequent in the amino-terminal portion of framework region. For example,
somatic
mutations are relatively infrequent in the amino terminal portion of framework
region 1
and in the carboxy-terminal portion of framework region 4. Furthermore, many
somatic
mutations do not significantly alter the binding properties of the antibody.
For this
reason, it is not necessary to obtain the entire DNA sequence of a particular
antibody in
order to recreate an intact recombinant antibody having binding properties
similar to
those of the original antibody (see PCT/LTS99/05535 filed on March 12, 1999,
which is
herein incorporated by referenced for all purposes). Partial heavy and light
chain
sequence spanning the CDR regions is typically sufficient for this purpose.
The partial
sequence is used to determine which germline variable and joining gene
segments
contributed to the recombined antibody variable genes. The germline sequence
is then
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
used to fill in missing portions of the variable regions. Heavy and light
chain leader
sequences are cleaved during protein maturation and do not contribute to the
properties
of the final antibody. For this reason, it is necessary to use the
corresponding germline
leader sequence for expression constructs. To add missing sequences, cloned
cDNA sequences cab be combined with synthetic oligonucleotides by ligation or
PCR amplification. Alternatively, the entire variable region can be
synthesized as a set
of short, overlapping, oligonucleotides and combined by PCR amplification to
create an
entirely synthetic variable region clone. This process has certain advantages
such as
elimination or, inclusion or particular restriction sites, or optimization of
particular
codons.
The nucleotide sequences of heavy and light chain transcripts from a
hybridomas are used to design an overlapping set of synthetic oligonucleotides
to create
synthetic V sequences with identical amino acid coding capacities as the
natural
sequences. The synthetic heavy and kappa chain sequences can differ from the
natural
sequences in three ways: strings of repeated nucleotide bases are interrupted
to facilitate
oligonucleotide synthesis and PCR amplification; optimal translation
initiation sites are
incorporated according to Kozak's rules (Kozak, 1991, J. Biol. Chem. 266:19867-
19870); and, HindIII sites are engineered upstream of the translation
initiation sites.
For both the heavy and light chain variable regions, the optimized coding,
and corresponding non-coding, strand sequences are broken down into 30 -
SO nucleotide approximately the midpoint of the corresponding non-coding
oligonucleotide. Thus, for each chain, the oligonucleotides can be assemble
into
overlapping double stranded sets that span segments of 1 SO - 400 nucleotides.
The
pools are then used as templates to produce PCR amplification products of 150 -
400 nucleotides. Typically, a single variable region oligonucleotide set will
be broken
down into two pools which are separately amplified to generate two overlapping
PCV
products. These overlapping products are then combined by PCT amplification to
form
the complete variable region. It may also be desirable to include an
overlapping
fragment of the heavy or light chain constant region (including the BbsI site
of the kappa
light chain, or the AgeI site if the gamma heavy chain) in the PCR
amplification to
generate fragments that can easily be cloned into the expression vector
constructs.
31
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
The reconstructed heavy and light chain variable regions are then
combined with cloned promoter, translation initiation, constant region, 3'
untranslated,
polyadenylation, and transcription termination, sequences to form expression
vector
constructs. The heavy and light chain expression constructs can be combined
into a
single vector, co-transfected, serially transfected, or separately transfected
into host cells
which are then fused to form a host cell expressing both chains.
Plasmids for use in construction of expression vectors for human IgGK
are described below. The plasmids were constructed so that PCR amplified V
heavy and
V kappa light chain cDNA sequences could be used to reconstruct complete heavy
and
light chain minigenes. These plasmids can be used to express completely human,
or
chimeric IgGIK or IgG4K antibodies. Similar plasmids can be constructed for
expression
of other heavy chain isotypes, or for expression of antibodies comprising
lambda light
chains.
Thus, in another aspect of the invention, the structural features of an
human anti-PSMA antibodies of the invention, 4A3, 7F12, 8A11, 8C12 or 16F9,
are
used to create structurally related human anti-PSMA antibodies that retain at
least one
functional property of the antibodies of the invention, such as binding to
PSMA. More
specifically, one or more CDR regions of 4A3, 7F12, 8A11, 8C12 or 16F9 can be
combined recombinantly with known human framework regions and CDRs to create
additional, recombinantly-engineered, human anti-PSMA antibodies of the
invention.
Accordingly, in another embodiment, the invention provides a method for
preparing an anti-PSMA antibody comprising:
preparing an antibody comprising ( 1 ) human heavy chain framework
regions and human heavy chain CDRs, wherein at least one of the human heavy
chain
CDRs comprises an amino acid sequence selected from the amino acid sequences
of
CDRs shown in Figure 19 (SEQ ID NOs: 21-35); and (2) human light chain
framework
regions and human light chain CDRs, wherein at least one of the human heavy
chain
CDRs comprises an amino acid sequence selected from the amino acid sequences
of
CDRs shown in Figures 22 and 23 (SEQ ID NOs: 36-50);
wherein the antibody retains the ability to bind to PSMA.
The ability of the antibody to bind PSMA can be determined using standard
binding
assays, such as those set forth in the Examples (e.g., an ELISA).
32
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
Since it is well known in the art that antibody,heavy and light chain
CDR3 domains play a particularly important role in the binding
specificity/affinity of an
antibody for an antigen, the recombinant antibodies of the invention prepared
as set
forth above preferably comprise the heavy and light chain CDR3s of 4A3, 7F12,
8A1 l,
8C12 or 16F9. The antibodies further can comprise the CDR2s of 4A3, 7F12,
8A11,
8C12 or 16F9. The antibodies further can comprise the CDRIs of 4A3, 7F12, 8A1
l,
8C12 or 16F9. Accordingly, the invention further provides anti-PSMA antibodies
comprising: (1) human heavy chain framework regions, a human heavy chain CDR1
region, a human heavy chain CDR2 region, and a human heavy chain CDR3 region,
wherein the human heavy chain CDR3 region is selected from the CDR3s of 4A3,
7F12, 8A1 l, 8C12 and 16F9 as shown in Figure 19 (SEQ ID NOs: 23, 26, 29, 32,
or
35); and (2) human light chain framework regions, a human light chain CDR1
region, a
human light chain CDR2 region, and a human light chain CDR3 region, wherein
the
human light chain CDR3 region is selected from the CDR3s of 4A3, 7F12, 8A11,
8C12
and 16F9 as shown in Figures 22 and 23 (SEQ ID NOs: 38, 41, 44, 47, or 50),
wherein
the antibody binds PSMA. The antibody may further comprise the heavy chain
CDR2
and/or the light chain CDR2 of 4A3, 7F12, 8A1 l, 8C12 or 16F9. The antibody
may
further comprise the heavy chain CDR1 and/or the light chain CDR1 of 4A3, 7F
12,
8All, 8C12 or 16F9.
Preferably, the CDRl, 2, and/or 3 of the engineered antibodies described
above comprise the exact amino acid sequences) as those of 4A3, 7F12, 8A11,
8C12 or
16F9 disclosed herein. However, the ordinarily skilled artisan will appreciate
that some
deviation from the exact CDR sequences of 4A3, 7F12, 8A11, 8C12 and ~16F9 may
be
possible while still retaining the ability of the antibody to bind PSMA
effectively (e.g.,
conservative substitutions). Accordingly, in another embodiment, the
engineered
antibody may be composed of one or more CDRs that are, for example, 90%, 95%,
98%
or 99.5% identical to one or more CDRs of 4A3, 7F12, 8A11, 8C12 or 16F9
In addition to simply binding PSMA, engineered antibodies such as those
described above may be selected for their retention of other functional
properties of
antibodies of the invention, such as:
1) binding to live cells expressing human PSMA;
2) binding to human PSMA with a Ko of 10-8 M or less (e.g., 10-9 M or 10-
x° M
or less);
33
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
3) binding to a unique epitope on PSMA (to eliminate the possibility that
monoclonal antibodies with complimentary activities when used in
combination would compete for binding to the same epitope);
4) growth inhibition of PSMA expressing tumor cells in vivo; and/or
5) phagocytosis and/or killing of cells expressing PSMA in the presence of
human effector cells (e.g., in an ADCC assay).
Characterization of Binding of Human Monoclonal Antibodies to PSMA
Human monoclonal antibodies of the invention can be tested for binding
to PSMA by, for example, standard ELISA. Briefly, microtiter plates are coated
with
purified PSMA at 0.25 ~g/ml in PBS, and then blocked with 5% bovine serum
albumin
in PBS. Dilutions of plasma from PSMA-immunized mice are added to each well
and
incubated for 1-2 hours at 37°C. The plates are washed with PBS/Tween
and then
incubated with a goat-anti-human IgG Fc-specific polyclonal reagent conjugated
to
alkaline phosphatase for 1 hour at 37°C. After washing, the plates are
developed with
pNPP substrate (1 mg/ml), and analyzed at OD of 405-650. Preferably, mice
which
develop the highest titers will be used for fusions.
An ELISA assay as described above can also be used to screen for
hybridomas that show positive reactivity with PSMA immunogen. Hybridomas that
bind with high avidity to PSMA will be subcloned and further characterized.
One clone
from each hybridoma, which retains the reactivity of the parent cells (by
ELISA), can be
chosen for making a 5-10 vial cell bank stored at -140 °C, and for
antibody purification.
To purify human anti-PSMA antibodies, selected hybridomas can be
grown in two-liter spinner-flasks for monoclonal antibody purification.
Supernatants
can be filtered and concentrated before affinity chromatography with protein A-
sepharose EPharmacia, Piscataway, NJ). Eluted IgG can be checked by gel
electrophoresis and high performance liquid chromatography to ensure purity.
The
buffer solution can be exchanged into PBS, and the concentration can be
determined by
ODZBO using 1.43 extinction coefficient. The monoclonal antibodies can be
aliquoted
and stored at -80 °C.
To determine if the selected human anti-PSMA monoclonal antibodies
bind to unique epitopes, each antibody can be biotinylated using commercially
available
reagents (Pierce, Rockford, IL). Competition studies using unlabeled
monoclonal
34
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
antibodies and biotinylated monoclonal antibodies can be performed using PSMA
coated-ELISA plates as described above. Biotinylated mAb binding can be
detected
with a strep-avidin-alkaline phosphatase probe.
To determine the isotype of purified antibodies, isotype ELISAs can be
performed. Wells of microtiter plates can be coated with 10 p.g/ml of anti-
human Ig
overnight at 4°C. After blocking with 5% BSA, the plates are reacted
with 10 ~g/ml of
monoclonal antibodies or purified isotype controls, at ambient temperature for
two
hours. The wells can then be reacted with either human IgGI or human IgM-
specific
alkaline phosphatase-conjugated probes. Plates are developed and analyzed as
described
above.
In order to demonstrate binding of monoclonal antibodies to live cells
expressing the PSMA, flow cytometry can be used. Briefly, cell lines
expressing PSMA
(grown under standard growth conditions) are mixed with various concentrations
of
monoclonal antibodies in PBS containing 0.1% Tween 80 and 20% mouse serum, and
incubated at 37°C for 1 hour. After washing, the cells are reacted with
Fluorescein-
labeled anti-human IgG antibody under the same conditions as the primary
antibody
staining. The samples can be analyzed by FACScan instrument using light and
side
scatter properties to gate on single cells. An alternative assay using
fluorescence
microscopy may be used (in addition to or instead of) the flow cyiometry
assay. Cells
can be stained exactly as described above and examined by fluorescence
microscopy.
This method allows visualization of individual cells, but may have diminished
sensitivity depending on the density of the antigen.
Anti-PSMA human IgGs can be further tested for reactivity with PSMA
antigen by Western blotting. Briefly, cell extracts from cells expressing PSMA
can be
prepared and subjected to sodium dodecyl sulfate (SDS) polyacrylamide gel
electrophoresis. After electrophoresis, the separated antigens will be
transferred to
nitrocellulose membranes, blocked with 20% mouse serum, and probed with the
monoclonal antibodies to be tested. Human IgG binding can be detected using
anti-
human IgG alkaline phosphatase and developed with BCIP/NBT substrate tablets
(Sigma Chem. Co., St. Louis, MO).
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
Phagocytic and Cell Killing Activities of Human Monoclonal Antibodies to PSMA
In addition to binding specifically to PSMA, human monoclonal anti-
PSMA antibodies can be tested for their ability to mediate phagocytosis and
killing of
cells expressing PSMA. The testing of monoclonal antibody activity in vitro
will
provide an initial screening prior to testing in vivo models. Briefly,
polymorphonuclear
cells (PMN), or other effector cells, from healthy donors can be purified by
Ficoll
Hypaque density centrifugation, followed by lysis of contaminating
erythrocytes.
Washed PMNs, can be suspended in RPMI supplemented with 10% heat-inactivated
fetal calf serum and mixed with SICr labeled cells expressing PSMA, at various
ratios of
effector cells to tumor cells (-effector cellsaumor cells). Purified human
anti-PSMA
IgGs can then be added at various concentrations. Irrelevant human IgG can be
used as
negative control. Assays can be carried out for 0-120 minutes at 37°C.
Samples can be
assayed for cytolysis by measuring S~Cr release into the culture supernatant.
Anti-
PSMA monoclonal can also be tested in combinations with each other to
determine
whether cytolysis is enhanced with multiple monoclonal antibodies.
Human monoclonal antibodies which bind to PSMA also can be tested in
an in vivo model (e.g., in mice) to determine their efficacy in mediating
phagocytosis
and killing of cells expressing PSMA, e.g., tumor cells. These antibodies can
be
selected, for example, based on the following criteria, which are not intended
to be
exclusive:
1) binding to live cells expressing PSMA;
2) high affinity of binding to PSMA;
3) binding to a unique epitope on PSMA (to eliminate the possibility that
monoclonal antibodies with complimentary activities when used in combination
would
compete for binding to the same epitope);
4) opsonization of cells expressing PSMA;
5) mediation of growth inhibition, phagocytosis andlor killing of cells
expressing
PSMA in the presence of human effector cells.
Preferred human monoclonal antibodies of the invention meet one or
more, and preferably all, of these criteria. In a particular embodiment, the
human
monoclonal antibodies are used in combination, e.g., as a pharmaceutical
composition
comprising two or more anti-PSMA monoclonal antibodies or fragments thereof.
For
example, human anti-PSMA monoclonal antibodies having different, but
36
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
complementary activities can be combined in a single therapy to achieve a
desired
therapeutic or diagnostic effect. An illustration of this would be a
composition
containing an anti-PSMA human monoclonal antibody that mediates highly
effective
killing of target cells in the presence of effector cells, combined with
another human
anti-PSMA monoclonal antibody that inhibits the growth of cells expressing
PSMA.
II. Production of Transgenic Nonhuman Animals Which Generate Human Monoclonal
Anti-PSMA Antibodies
In yet another aspect, the invention provides transgenic and
transchromosomal nonhuman animals, such as transgenic or transchromosomal
mice,
which are capable of expressing human monoclonal antibodies that specifically
bind to
PSMA. In a particular embodiment, the invention provides a transgenic or
transchromosomal mouse having a genome comprising a human heavy chain
transgene,
such that the mouse produces human anti-PSMA antibodies when immunized with
PSMA and/or cells expressing PSMA. The human heavy chain transgene can be
integrated into the chromosomal DNA of the mouse, as is the case for
transgenic, e.g.,
HuMAb mice, as described in detail herein and exemplified. Alternatively, the
human
heavy chain transgene can be maintained extrachromosomally, as is the case for
transchromosomal (e.g., KM) mice as described in WO 02/43478. Such transgenic
and
transchromosomal animals are capable of producing multiple isotypes of human
monoclonal antibodies to PSMA (e.g., IgG, IgA and/or IgE) by undergoing V-D-J
recombination and isotype switching. Isotype switching may occur by, e.g.,
classical or
non-classical isotype switching.
The design of a transgenic or transchromosomal nonhuman animal that
responds to foreign antigen stimulation with a heterologous antibody
repertoire, requires
that the heterologous immunoglobulin transgenes contain within the transgenic
animal
function correctly throughout the pathway of B-cell development. This
includes, for
example, isotype switching of the heterologous heavy chain transgene.
Accordingly,
transgenes are constructed so as to produce isotype switching and one or more
of the
following: (1) high level and cell-type specific expression, (2) functional
gene
rearrangement, (3) activation of and response to allelic exclusion, (4)
expression of a
sufficient primary repertoire, (5) signal transduction, (6) somatic
hypermutation, and (7)
domination of the transgene antibody locus during the immune response.
37
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
Not all of the foregoing criteria need be met. For example, in those
embodiments wherein the endogenous immunoglobulin loci of the transgenic
animal are
functionally disrupted, the transgene need not activate allelic exclusion.
Further, in
those embodiments wherein the transgene comprises a functionally rearranged
heavy
and/or light chain immunoglobulin gene, the second criteria of functional,
gene
rearrangement is unnecessary, at least for that transgene which is already
rearranged.
For background on molecular immunology, see, Fundamental Immunology, 2nd
edition
(1989), Paul William E., ed. Raven Press, N.Y., which is incorporated herein
by
reference.
In certain embodiments, the transgenic or transchromosomal nonhuman
animals used to generate the human monoclonal antibodies of the invention
contain
rearranged, unrearranged or a combination of rearranged and unrearranged
heterologous
immunoglobulin heavy and light chain transgenes in the germline of the
transgenic
animal. Each of the heavy chain transgenes comprises at least one CH gene. In
addition,
the heavy chain transgene may contain functional isotype switch sequences,
which are
capable of supporting isotype switching of a heterologous transgene encoding
multiple
CH genes in the B-cells of the transgenic animal. Such switch sequences may be
those
which occur naturally in the germline immunoglobulin locus from the species
that
serves as the source of the transgene CH genes, or such switch sequences may
be derived
from those which occur in the species that is to receive the transgene
construct (the
transgenic animal). For example, a human transgene construct that is used to
produce a
transgenic mouse may produce a higher frequency of isotype switching events if
it
incorporates switch sequences similar to those that occur naturally in the
mouse heavy
chain locus, as presumably the mouse switch sequences are optimized to
function with
the mouse switch recombinase enzyme system, whereas the human switch sequences
are
not. Switch sequences may be isolated and cloned by conventional cloning
methods, or
may be synthesized de novo from overlapping synthetic oligonucleotides
designed on
the basis of published sequence information relating to immunoglobulin switch
region
sequences (Mills et al., Nucl. Acids Res. 15:7305-7316 (1991); Sideras et al.,
Intl.
Immunol. 1:631-642 (1989), which are incorporated herein by reference).
For each of the foregoing transgenic animals, functionally rearranged
heterologous
heavy and light chain immunoglobulin transgenes are found in a significant
fraction of
the B-cells of the transgenic animal (at least 10 percent).
38
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
The transgenes used to generate the transgenic animals of the invention
include a heavy chain transgene comprising DNA encoding at least one variable
gene
segment, one diversity gene segment, one joining gene segment and at least one
constant
region gene segment. The immunoglobulin light chain transgene comprises DNA
encoding at least one variable gene segment, one joining gene segment and at
least one
constant region gene segment. The gene segments encoding the light and heavy
chain
gene segments are heterologous to the transgenic nonhuman animal in that they
are
derived from, or correspond to, DNA encoding immunoglobulin heavy and light
chain
gene segments from a species not consisting of the transgenic nonhuman animal.
In one
aspect of the invention, the transgene is constructed such that the individual
gene
segments are unrearranged, i.e., not rearranged so as to encode a functional
immunoglobulin light or heavy chain. Such unrearranged transgenes support
recombination of the V, D, and J gene segments (functional rearrangement) and
preferably support incorporation of all or a portion of a D region gene
segment in the
resultant rearranged immunoglobulin heavy chain within the transgenic nonhuman
animal when exposed to PSMA antigen.
In an alternate embodiment, the transgenes comprise an unrearranged
"mini-locus." Such transgenes typically comprise a substantial portion of the
C, D, and
J segments as well as a subset of the V gene segments. In such transgene
constructs, the
various regulatory sequences, e.g. promoters, enhancers, class switch regions,
splice-
donor and splice-acceptor sequences for RNA processing, recombination signals
and the
like, comprise corresponding sequences derived from the heterologous DNA. Such
regulatory sequences may be incorporated into the transgene from the same or a
related
species of the nonhuman animal used in the invention. For example, human
immunoglobulin gene segments may be combined in a transgene with a rodent
immunoglobulin enhancer sequence for use in a transgenic mouse. Alternatively,
synthetic regulatory sequences may be incorporated into the transgene, wherein
such
synthetic regulatory sequences are not homologous to a functional DNA sequence
that is
known to occur naturally in the genomes of mammals. Synthetic regulatory
sequences
are designed according to consensus rules, such as, for example, those
specifying the
permissible sequences of a splice-acceptor site or a promoter/enhancer motif.
For
example, a minilocus comprises a portion of the genomic immunoglobulin locus
having
at least one internal (i. e., not at a terminus of the portion) deletion of a
non-essential
39
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
DNA portion (e.g., intervening sequence; intron or portion thereof) as
compared to the
naturally-occurring germline Ig locus.
In a preferred embodiment of the invention, the transgenic or
transchromosomal animal used to generate human antibodies to PSMA contains at
least
S one, typically 2-10, and sometimes 25-SO or more copies of the transgene
described in
Example 12 of WO 98/24884 (e.g., pHCI or pHC2) bred with an animal containing
a
single copy of a light chain transgene described in Examples 5, 6, 8, or 14 of
WO
98/24884, and the offspring bred with the JH deleted animal described in
Example 10 of
WO 98/24884, the contents of which are hereby expressly incorporated by
reference.
Animals are bred to homozygosity for each of these three traits. Such animals
have the
following genotype: a single copy (per haploid set of chromosomes) of a human
heavy
chain unrearranged mini-locus (described in Example 12 of WO 98/24884), a
single
copy (per haploid set of chromosomes) of a rearranged human K light chain
construct
(described in Example 14 of WO 98/24884), and a deletion at each endogenous
mouse
heavy chain locus that removes all of the functional JH segments (described in
Example
10 of WO 98/24884). Such animals are bred with mice that are homozygous for
the
deletion of the JH segments (Examples 10 of WO 98/24884) to produce offspring
that
are homozygous for the JH deletion and hemizygous for the human heavy and
light chain
constructs. The resultant animals are injected with antigens and used for
production of
human monoclonal antibodies against these antigens.
B cells isolated from such an animal are monospecific with regard to the
human heavy and light chains because they contain only a single copy of each
gene.
Furthermore, they will be monospecific with regards to human or mouse heavy
chains
because both endogenous mouse heavy chain gene copies are nonfunctional by
virtue of
the deletion spanning the JH region introduced as described in Example 9 and
12 of WO
98/24884. Furthermore, a substantial fraction of the B cells will be
monospecific with
regards to the human or mouse light chains because expression of the single
copy of the
rearranged human K light chain gene will allelically and isotypically exclude
the
rearrangement of the endogenous mouse K and lambda chain genes in a
significant
fraction of B-cells.
Preferred transgenic and transchromosomal nonhuman animals, e.g.,
mice, will exhibit immunoglobulin production with a significant repertoire,
ideally
substantially similar to that of a native mouse. Thus, for example, in
embodiments
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
where the endogenous Ig genes have been inactivated, the total immunoglobulin
levels
will range from about 0.1 to 10 mg/ml of serum, preferably 0.5 to 5 mg/ml,
ideally at
least about 1.0 mg/ml. When a transgene capable of effecting a switch to IgG
from IgM
has been introduced into the transgenic mouse, the adult mouse ratio of serum
IgG to
IgM is preferably about 10:1. The IgG to IgM ratio will be much lower in the
immature
mouse. In general, greater than about 10%, preferably 40 to 80% of the spleen
and
lymph node B cells express exclusively human IgG protein.
The repertoire will ideally approximate that shown in a native mouse,
usually at least about 10% as high, preferably 25 to 50% or more. Generally,
at least
about a thousand different immunoglobulins (ideally IgG), preferably 104 to
106 or
more, will be produced, depending primarily on the number of different V, J
and D
regions introduced into the mouse genome. These immunoglobulins will typically
recognize about one-half or more of highly antigenic proteins, e.g.,
staphylococcus
protein A. Typically, the immunoglobulins will exhibit an affinity for
preselected
antigens of at least about 107M-1, preferably at least about 109M-~, more
preferably at
least about 101°M-~,1O11M-~, lOlzM-~, or greater, e.g., up to10~3M-1 or
greater.
In some embodiments, it may be preferable to generate nonhuman
animals with predetermined repertoires to limit the selection of V genes
represented in
the antibody response to a predetermined antigen type. A heavy chain transgene
having
a predetermined repertoire may comprise, for example, human VH genes which are
preferentially used in antibody responses to the predetermined antigen type in
humans.
Alternatively, some VH genes may be excluded from a defined repertoire for
various
reasons (e.g., have a low likelihood of encoding high affinity V regions for
the
predetermined antigen; have a low propensity to undergo somatic mutation and
affinity
sharpening; or are immunogenic to certain humans). Thus, prior to
rearrangement of a
transgene containing various heavy or light chain gene segments, such gene
segments
may be readily identified, e.g. by hybridization or DNA sequencing, as being
from a
species of organism other than the transgenic animal.
The transgenic and transchromosomal nonhuman animals, e.g., mice, as
described above can be immunized with, for example, a purified or recombinant
preparation of PSMA and/or cells expressing PSMA as described previously.
Alternatively, the transgenic animals can be immunized with DNA encoding human
PSMA. The animals will then produce B cells which undergo class-switching via
41
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
intratransgene switch recombination (cis-switching) and express
immunoglobulins
reactive with PSMA. The immunoglobulins can be human antibodies (also referred
to
as "human sequence antibodies"), wherein the heavy and light chain
polypeptides are
encoded by human transgene sequences, which may include sequences derived by
S somatic mutation and V region recombinatorial joints, as well as germline-
encoded
sequences; these human antibodies can be referred to as being substantially
identical to a
polypeptide sequence encoded by a human VL or VH gene segment and a human JL
or JL
segment, even though other non-germline sequences may be present as a result
of
somatic mutation and differential V-J and V-D-J recombination joints. The
variable
regions of each antibody chain are typically at least 80 percent encoded by
human
germline V, J, and, in the case of heavy chains, D, gene segments; frequently
at least 85
percent of the variable regions are encoded by human germline sequences
present on the
transgene; often 90 or 95 percent or more of the variable region sequences are
encoded
by human germline sequences present on the transgene. However, since non-
germline
sequences are introduced by somatic mutation and VJ and VDJ joining, the human
sequence antibodies will frequently have some variable region sequences (and
less
frequently constant region sequences) which are not encoded by human V, D, or
J gene
segments as found in the human transgene(s) in the germline o.f the mice.
Typically,
such non-germline sequences (or individual nucleotide positions) will cluster
in or near
CDRs, or in regions where somatic mutations are known to cluster.
Human antibodies which bind to the predetermined antigen can result
from isotype switching, such that human antibodies comprising a human sequence
y
chain (such as yl, y2, 'y3, or y4) and a human sequence light chain (such as
K) are
produced. Such isotype-switched human sequence antibodies often contain one or
more
somatic mutation(s), typically in the variable region and often in or within
about 10
residues of a CDR) as a result of affinity maturation and selection of B cells
by antigen,
particularly subsequent to secondary (or subsequent) antigen challenge. These
high
affinity human sequence antibodies may have KDS of 10-7 M or less, such as
10'8 M or
less, 10-9 M or less, or 10-x° M or less, or even lower.
Another aspect of the invention pertains to the B cells derived from
transgenic or transchromosomal nonhuman animals as described herein. The B
cells can
be used to generate hybridomas expressing human monoclonal antibodies which
bind
with high affinity (e.g., a Kp of 10-7 M or less) to PSMA. Thus, in another
embodiment,
42
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
the invention provides a hybridoma which produces a human antibody having a KD
of
10-7 M or less, such as 10-g M or less, 10-9 M or less, 10-1° M or
less, or even lower, ,
wherein the antibody comprises:
a human sequence light chain composed of (1) a light chain variable
region having a polypeptide sequence which is substantially identical to a
polypeptide
sequence encoded by a human VL gene segment and a human JL segment, and (2) a
light
chain constant region having a polypeptide sequence which is substantially
identical to a
polypeptide sequence encoded by a human C~ gene segment; and
a human sequence heavy chain composed of a ( 1 ) a heavy chain variable
region having a polypeptide sequence which is substantially identical to a
polypeptide
sequence encoded by a human VH gene segment, optionally a D region, and a
human JH
segment, and (2) a constant region having a polypeptide sequence which is
substantially
identical to a polypeptide sequence encoded by a human CH gene segment.
The development of high affinity human monoclonal antibodies against
PSMA is facilitated by a method for expanding the repertoire of human variable
region
gene segments in a transgenic mouse having a genome comprising an integrated
human
immunoglobulin transgene, said method comprising introducing into the genome a
V
gene transgene comprising V region gene segments which are not present in said
integrated human immunoglobulin transgene. Often, the V region transgene is a
yeast
artificial chromosome comprising a portion of a human VH or V,_, (VK) gene
segment
array, as may naturally occur in a human genome or as may be spliced together
separately by recombinant methods, which may include out-of order or omitted V
gene
segments. Often at least five or more functional V gene segments are contained
on the
YAC. In this variation, it is possible to make a transgenic mouse produced by
the V
repertoire expansion method, wherein the mouse expresses an immunoglobulin
chain
comprising a variable region sequence encoded by a V region gene segment
present on
the V region transgene and a C region encoded on the human Ig transgene. By
means of
the V repertoire expansion method, transgenic mice having at least 5 distinct
V genes
can be generated; as can mice containing at least about 24 V genes or more.
Some V
gene segments may be non-functional (e.g., pseudogenes and the like); these
segments
may be retained or may be selectively deleted by recombinant methods available
to the
skilled artisan, if desired.
43
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
Once the mouse germline has been engineered to contain a functional
YAC having an expanded V segment repertoire, substantially not present in the
human
Ig transgene containing the J and C gene segments, the trait can be propagated
and bred
into other genetic backgrounds, including backgrounds where the functional YAC
having an expanded V segment repertoire is bred into a mouse germline having a
different human Ig transgene. Multiple functional YACs having an expanded V
segment repertoire may be bred into a germline to work with a human Ig
transgene (or
multiple human Ig transgenes). Although referred to herein as YAC transgenes,
such
transgenes when integrated into the genome may substantially lack yeast
sequences,
such as sequences required for autonomous replication in yeast; such sequences
may
optionally be removed by genetic engineering (e.g., restriction digestion and
pulsed-field
gel electrophoresis or other suitable method) after replication in yeast in no
longer
necessary (i.e., prior to introduction into a mouse ES cell or mouse
prozygote). Methods
of propagating the trait of human sequence immunoglobulin expression, include
breeding a transgenic mouse having the human Ig transgene(s), and optionally
also
having a functional YAC having an expanded V segment repertoire. Both VH and
VL
gene segments may be present on the YAC. The transgenic mouse may be bred into
any
background desired by the practitioner, including backgrounds harboring other
human
transgenes, including human Ig transgenes and/or transgenes encoding other
human
lymphocyte proteins. The invention also provides a high affinity human
sequence
immunoglobulin produced by a transgenic mouse having an expanded V region
repertoire YAC transgene. Although the foregoing describes a preferred
embodiment of
the transgenic animal of the invention, other embodiments are contemplated
which have
been classified in four categories:
I. Transgenic animals containing an unrearranged heavy and rearranged
light immunoglobulin transgene;
II. Transgenic animals containing an unrearranged heavy and
unrearranged light immunoglobulin transgene;
III. Transgenic animal containing rearranged heavy and an unrearranged
light immunoglobulin transgene; and
IV. Transgenic animals containing rearranged heavy and rearranged light
immunoglobulin transgenes.
44
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
Of these categories of transgenic animal, the preferred order of
preference is as follows II > I > III > IV where the endogenous light chain
genes (or at
least the K gene) have been knocked out by homologous recombination (or other
method) and I > II > III >IV where the endogenous light chain genes have not
been
knocked out and must be dominated by allelic exclusion.
III. Bispecific/ Multispecific Molecules Which Bind to PSMA
In yet another embodiment of the invention, human monoclonal
antibodies to PSMA, or antigen-binding portions thereof, can be derivatized or
linked to
another functional molecule, e.g., another peptide or protein (e.g., an Fab'
fragment) to
generate a bispecific or multispecific molecule which binds to multiple
binding sites or
target epitopes. For example, an antibody or antigen-binding portion of the
invention
can be functionally linked (e.g., by chemical coupling, genetic fusion,
noncovalent
association or otherwise) to one or more other binding molecules, such as
another
antibody, antibody fragment, peptide or binding mimetic.
Accordingly, the present invention includes bispecific and multispecific
molecules comprising at least one first binding specificity for PSMA and a
second
binding specificity for a second target epitope. In a particular embodiment of
the
invention, the second target epitope is an Fc receptor, e.g., human FcyRI
(CD64) or a
human Fca receptor (CD89). Therefore, the invention includes bispecific and
multispecific molecules capable of binding both to FcyR, FcaR or FcER
expressing
effector cells (e.g., monocytes, macrophages or polymorphonuclear cells
(PMNs)), and
to target cells expressing PSMA. These bispecific and multispecific molecules
target
PSMA expressing cells to effector cell and, like the human monoclonal
antibodies of the
invention, trigger Fc receptor-mediated effector cell activities, such as
phagocytosis of a
PSMA expressing cells, antibody dependent cell-mediated cytotoxicity (ADCC),
cytokine release, or generation of superoxide anion.
Bispecific and multispecific molecules of the invention can further
include a third binding specificity, in addition to an anti-Fc binding
specificity and an
anti-PSMA binding specificity. In one embodiment, the third binding
specificity is an
anti-enhancement factor (EF) portion, e.g., a molecule which binds to a
surface protein
involved in cytotoxic activity and thereby increases the immune response
against the
target cell. The "anti-enhancement factor portion" can be an antibody,
functional
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
antibody fragment or a ligand that binds to a given molecule, e.g., an antigen
or a
receptor, and thereby results in an enhancement of the effect of the binding
determinants
for the Fc receptor or target cell antigen. The "anti-enhancement factor
portion" can
bind an Fc receptor or a target cell antigen. Alternatively, the anti-
enhancement factor
portion can bind to an entity that is different from the entity to which the
first and
second binding specificities bind. For example, the anti-enhancement factor
portion can
bind a cytotoxic T-cell (e.g. via CD2, CD3, CDB, CD28, CD4, CD40, ICAM-1 or
other
immune cell that results in an increased immune response against the target
cell).
In one embodiment, the bispecific and multispecific molecules of the
invention comprise as a binding specificity at least one antibody, or an
antibody
fragment thereof, including, e.g., an Fab, Fab', F(ab')2, Fv, or a single
chain Fv. The
antibody may also be a light chain or heavy chain dimer, or any minimal
fragment
thereof such as a Fv or a single chain construct as described in Ladner et al.
U.S. Patent
No. 4,946,778, issued August 7, 1990, the contents of which is expressly
incorporated
by reference.
In one embodiment bispecific and multispecific molecules of the
invention comprise a binding specificity for an FcyR or an FcaR present on the
surface
of an effector cell, and a second binding specificity for a target cell
antigen, e.g., PSMA.
In one embodiment, the binding specificity for an Fc receptor is provided
by a human monoclonal antibody, the binding of which is not blocked by human
immunoglobulin G (IgG). As used herein, the term "IgG receptor" refers to any
of the
eight y-chain genes located on chromosome 1. These genes encode a total of
twelve
transmembrane or soluble receptor isoforms which are grouped into three Fcy
receptor
classes: FcyRI (CD64), FcyRII(CD32), and FcyRIII (CD16). In one preferred
embodiment, the Fcy receptor a human high affinity FcyRI. The human FcyRI is a
72
kDa molecule, which shows high affinity for monomeric IgG (10g - lO9M-').
The production and characterization of these preferred monoclonal
antibodies are described by Fanger et al. in PCT application WO 88/00052 and
in U.S.
Patent No. 4,954,617, the teachings of which are fully incorporated by
reference herein.
These antibodies bind to an epitope of FcyRI, FcyRII or FcyRIII at a site
which is
distinct from the Fcy binding site of the receptor and, thus, their binding is
not blocked
substantially by physiological levels of IgG. Specific anti-FcyRI antibodies
useful in
this invention are mAb 22, mAb 32, mAb 44, mAb 62 and mAb 197. The hybridoma
46
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
producing mAb 32 is available from the American Type Culture Collection, ATCC
Accession No. HB9469. In other embodiments, the anti-Fcy receptor antibody is
a
humanized form of monoclonal antibody 22 (H22). The production and
characterization
of the H22 antibody is described in Graziano, R.F. et al. (1995) J. Immunol
155 (10):
S 4996-5002 and PCT/LTS93/10384. The H22 antibody producing cell line was
deposited
at the American Type Culture Collection under the designation HA022CL1 and has
the
accession no. CRL 11177.
In still other preferred embodiments, the binding specificity for an Fc
receptor is provided by an antibody that binds to a human IgA receptor, e.g.,
an Fc-alpha
receptor (FcaRI (CD89)), the binding of which is preferably not blocked by
human
immunoglobulin A (IgA). The term "IgA receptor" is intended to include the
gene
product of one a-gene (FcaRI) located on chromosome 19. This gene is known to
encode several alternatively spliced transmembrane isoforms of 55 to 110 kDa.
FcaRI
(CD89) is constitutively expressed on monocytes/macrophages, eosinophilic and
neutrophilic granulocytes, but not on non-effector cell populations. FcaRI has
medium
affinity (~ 5 X 10' M-') for both IgAI and IgA2, which is increased upon
exposure to
cytokines such as G-CSF or GM-CSF (Morton, H.C. et al. (1996) Critical Reviews
in
Immunology 16:423-440). Four FcaRI-specific monoclonal antibodies, identified
as
A3; A59, A62 and A77, which bind FcaRI outside the IgA ligand binding domain,
have
been described (Monteiro, R.C. et al., 1992, J. Immunol. 148:1764).
FcaRI and FcyRI are preferred trigger receptors for use in the invention
because they are (1) expressed primarily on immune effector cells, e.g.,
monocytes,
PMNs, macrophages and dendritic cells; (2) expressed at high levels (e.g.,
5,000-
100,000 per cell); (3) mediators of cytotoxic activities (e.g., ADCC,
phagocytosis); (4)
mediate enhanced antigen presentation of antigens, including self antigens,
targeted to
them.
In other embodiments, bispecific and multispecific molecules of the
invention further comprise a binding specificity which recognizes, e.g., binds
to, a target
cell antigen, e.g., PSMA. In a preferred embodiment, the binding specificity
is provided
by a human monoclonal antibody of the present invention.
47
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
An "effector cell specific antibody" as used herein refers to an antibody
or functional antibody fragment that binds the Fc receptor of effector cells.
Preferred
antibodies for use in the subject invention bind the Fc receptor of effector
cells at a site
which is not bound by endogenous immunoglobulin.
As used herein, the term "effector cell" refers to an immune cell which is
involved in the effector phase of an immune response, as opposed to the
cognitive and
activation phases of an immune response. Exemplary immune cells include a cell
of a
myeloid or lymphoid origin, e.g., lymphocytes (e.g., B cells and T cells
including
cytolytic T cells (CTLs)), killer cells, natural killer cells, macrophages,
monocytes,
eosinophils, neutrophils, polymorphonuclear cells, granulocytes, mast cells,
and
basophils. Some effector cells express specific Fc receptors and carry out
specific
immune functions. In preferred embodiments, an effector cell is capable of
inducing
antibody-dependent cell-mediated cytotoxicity (ADCC), e.g., a neutrophil
capable of
inducing ADCC. For example, monocytes, macrophages, which express FcR are
involved in specific killing of target cells and presenting antigens to other
components
of the immune system, or binding to cells that present antigens. In other
embodiments,
an effector cell can phagocytose a target antigen, target cell, or
microorganism. The
expression of a particular FcR on an effector cell can be regulated by humoral
factors
such as cytokines. For example, expression of FcyRI has been found to be up-
regulated
by interferon gamma (IFN-y). This enhanced expression increases the cytotoxic
activity
of FcyRI-bearing cells against targets. An effector cell can phagocytose or
lyse a target
antigen or a target cell.
"Target cell" shall mean any undesirable cell in a subject (e.g., a human
or animal) that can be targeted by a composition (e.g., a human monoclonal
antibody, a
bispecific or a multispecific molecule) of the invention. In preferred
embodiments, the
target cell is a cell expressing or overexpressing PSMA. Cells expressing PSMA
typically include tumor cells, such as bladder, breast, colon, kidney,
ovarian, prostate,
renal cell, squamous cell, lung (non-small cell), and head and neck tumor
cells. Other
target cells include synovial fibroblast cells.
While human monoclonal antibodies are preferred, other antibodies
which can be employed in the bispecific or multispecific molecules of the
invention are
marine, chimeric and humanized monoclonal antibodies.
48
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
Chimeric mouse-human monoclonal antibodies (i.e., chimeric antibodies)
can be produced by recombinant DNA techniques known in the art. For example, a
gene encoding the Fc constant region of a murine (or other species) monoclonal
antibody molecule is digested with restriction enzymes to remove the region
encoding
the murine Fc, and the equivalent portion of a gene encoding a human Fc
constant
region is substituted. (see Robinson et al., International Patent Publication
PCT/L1S86/02269; Akira, et al., European Patent Application 184,187;
Taniguchi, M.,
European Patent Application 171,496; Morrison et al., European Patent
Application
173,494; Neuberger et al., International Application WO 86/01533; Cabilly et
al. U.S.
Patent No. 4,816,567; Cabilly et al., European Patent Application 125,023;
Better et al.
(1988 Science 240:1041-1043); Liu et al. (1987) PNAS 84:3439-3443; Liu et al.,
1987,
J. Immunol. 139:3521-3526; Sun et al. (1987) PNAS 84:214-218; Nishimura et
al.,
1987, Canc. Res. 47:999-1005; Wood et al. (1985) Nature 314:446-449; and Shaw
et al.,
1988, J. Natl Cancer Inst. 80:1553-1559).
The chimeric antibody can be further humanized by replacing sequences
of the Fv variable region which are not directly involved in antigen binding
with
equivalent sequences from human Fv variable regions. General reviews of
humanized
chimeric antibodies are provided by Morrison, S. L., 1985, Science 229:1202-
1207 and
by Oi et al., 1986, BioTechniques 4:214. Those methods include isolating,
manipulating, and expressing the nucleic acid sequences that encode all or
part of
immunoglobulin Fv variable regions from at least one of a heavy or light
chain. Sources
of such nucleic acid are well known to those skilled in the art and, for
example, may be
obtained from 7E3, an anti-GPIIbIIIa antibody producing hybridoma. The
recombinant
DNA encoding the chimeric antibody, or fragment thereof, can then be cloned
into an
appropriate expression vector. Suitable humanized antibodies can alternatively
be
produced by CDR substitution U.S. Patent 5,225,539; Jones et al. 1986 Nature
321:552-
525; Verhoeyan et al. 1988 Science 239:1534; and Beidler et al. 1988 J.
Immunol.
141:4053-4060.
All of the CDRs of a particular human antibody may be replaced with at
least a portion of a nonhuman CDR or only some of the CDRs may be replaced
with
nonhuman CDRs. It is only necessary to replace the number of CDRs required for
binding of the humanized antibody to the Fc receptor.
49
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
An antibody can be humanized by any method, which is capable of
replacing at least a portion of a CDR of a human antibody with a CDR derived
from a
nonhuman antibody. Winter describes a method which may be used to prepare the
humanized antibodies of the present invention (UK Patent Application GB
2188638A,
filed on March 26, 1987), the contents of which is expressly incorporated by
reference.
The human CDRs may be replaced with nonhuman CDRs using oligonucleotide site-
directed mutagenesis as described in International Application WO 94/10332
entitled,
Humanized Antibodies to Fc Receptors for Immunoglobulin G on Human Mononuclear
Phagocytes.
Also within the scope of the invention are chimeric and humanized
antibodies in which specific amino acids have been substituted, deleted or
added. In
particular, preferred humanized antibodies have amino acid substitutions in
the
framework region, such as to improve binding to the antigen. For example, in a
humanized antibody having mouse CDRs, amino acids located in the human
framework
region can be replaced with the amino acids located at the corresponding
positions in the
mouse antibody. Such substitutions are known to improve binding of humanized
antibodies to the antigen in some instances. Antibodies in which amino acids
have been
added, deleted, or substituted are referred to herein as modified antibodies
or altered
antibodies.
The term modified antibody is also intended to include antibodies, such
as monoclonal antibodies, chimeric antibodies, and humanized antibodies which
have
been modified by, e.g., deleting, adding, or substituting portions of the
antibody. For
example, an antibody can be modified by deleting the constant region and
replacing it
with a constant region meant to increase half life, e.g., serum half life,
stability or
affinity of the antibody. Any modification is within the scope of the
invention so long
as the bispecific and multispecific molecule has at least one antigen binding
region
specific for an FcyR and triggers at least one effector function.
Bispecific and multispecific molecules of the present invention can be
made using chemical techniques (see e.g., D. M. Kranz et al. (1981) Proc.
Natl. Acad.
Sci. USA 78:5807), "polydoma" techniques (See U.S. Patent 4,474,893, to
Reading), or
recombinant DNA techniques.
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
In particular, bispecific and multispecific molecules of the present
invention can be prepared by conjugating the constituent binding
specificities, e.g., the
anti-FcR and anti-PSMA binding specificities, using methods known in the art
and
described in the examples provided herein. For example, each binding
specificity of the
bispecific and multispecific molecule can be generated separately and then
conjugated to
one another. When the binding specificities are proteins or peptides, a
variety of
coupling or cross-linking agents can be used for covalent conjugation.
Examples of
cross-linking agents include protein A, carbodiimide, N-succinimidyl-S-acetyl-
thioacetate (SATA), 5,5'-dithiobis(2-nitrobenzoic acid) (DTNB), o-
phenylenedimaleimide (oPDM), N-succinimidyl-3-(2-pyridyldithio)propionate
(SPDP),
and sulfosuccinimidyl 4-(N-maleimidomethyl) cyclohaxane-1-carboxylate (sulfo-
SMCC) (see e.g., Karpovsky et al. (1984) J. Exp. Med. 160:1686; Liu, MA et al.
(1985)
Proc. Natl. Acad. Sci. USA 82:8648). Other methods include those described by
Paulus
(Behring Ins. Mitt. (1985) No. 78, 118-132); Brennan et al. (Science (1985)
229:81-83),
and Glennie et al. (J. Immunol. (1987) 139: 2367-2375). Preferred conjugating
agents
are SATA and sulfo-SMCC, both available from Pierce Chemical Co. (Rockford,
IL).
When the binding specificities are antibodies (e.g., two humanized
antibodies), they can be conjugated via sulfhydryl bonding of the C-terminus
hinge
regions of the two heavy chains. In a particularly preferred embodiment, the
hinge
region is modified to contain an odd number of sulfhydryl residues, preferably
one, prior
to conjugation.
Alternatively, both binding specificities can be encoded in the same
vector and expressed and assembled in the same host cell. This method is
particularly
useful where the bispecific and multispecific molecule is a mAb x mAb, mAb x
Fab,
Fab x F(ab')2 or ligand x Fab fusion protein. A bispecific and multispecific
molecule of
the invention, e.g., a bispecific molecule can be a single chain molecule,
such as a single
chain bispecific antibody, a single chain bispecific molecule comprising one
single
chain antibody and a binding determinant, or a single chain bispecific
molecule
comprising two binding determinants. Bispecific and multispecific molecules
can also
be single chain molecules or may comprise at least two single chain molecules.
Methods for preparing bi- and multspecific molecules are described for example
in U.S.
Patent Number 5,260,203; U.S. Patent Number 5,455,030; U.S. Patent Number
4,881,175; U.S. Patent Number 5,132,405; U.S. Patent Number 5,091,513; U.S.
Patent
51
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
Number 5,476,786; U.S. Patent Number 5,013,653; U.S. Patent Number 5,258,498;
and U.S. Patent Number 5,482,858.
Binding of the bispecific and multispecific molecules to their specific
targets can be confirmed by enzyme-linked immunosorbent assay (ELISA), a
radioimmunoassay (RIA), FACS analysis, a bioassay (e.g., growth inhibition),
or a
Western Blot Assay. Each of these assays generally detects the presence of
protein-
antibody complexes of particular interest by employing a labeled reagent
(e.g., an
antibody) specific for the complex of interest. For example, the FcR-antibody
complexes can be detected using e.g., an enzyme-linked antibody or antibody
fragment
which recognizes and specifically binds to the antibody-FcR complexes.
Alternatively,
the complexes can be detected using any of a variety of other immunoassays.
For
example, the antibody can be radioactively labeled and used in a
radioimmunoassay
(RIA) (see, for example, Weintraub, B., Principles of Radioimmunoassays,
Seventh
Training Course on Radioligand Assay Techniques, The Endocrine Society, March,
1986, which is incorporated by reference herein). The radioactive isotope can
be
detected by such means as the use of a y counter or a scintillation counter or
by
autoradiography.
IV. Antibody Conjugates/Immunotoxins
In another aspect, the present invention features a human anti-PSMA
monoclonal antibody, or a fragment thereof, conjugated to another therapeutic
moiety,
such as a cytotoxin, a drug or a radioisotope. When conjugated to a cytotoxin,
these
antibody conjugates are referred to as "immunotoxins." A cytotoxin or
cytotoxic agent
includes any agent that is detrimental to (e.g., kills) cells or which
inhibits their growth.
Examples include taxol, cytochalasin B, gramicidin D, ethidium bromide,
emetine,
mitomycin, etoposide, tenoposide, vincristine, vinblastine, colchicin,
doxorubicin,
daunorubicin, dihydroxy anthracin dione, mitoxantrone, mithramycin,
actinomycin D, 1-
dehydrotestosterone, glucocorticoids, procaine, tetracaine, lidocaine,
propranolol, and
puromycin and analogs or homologs thereof. Therapeutic agents also include,
for
example, antimetabolites (e.g., methotrexate, 6-mercaptopurine, 6-thioguanine,
cytarabine, 5-fluorouracil decarbazine), alkylating agents (e.g.,
mechlorethamine,
thioepa chlorambucil, melphalan, carmustine (BSNU) and lomustine (CCNU),
cyclothosphamide, busulfan, dibromomannitol, streptozotocin, mitomycin C, and
cis-
52
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
dichlorodiamine platinum (II) (DDP) cisplatin), anthracyclines (e.g.,
daunorubicin
(formerly daunomycin) and doxorubicin), antibiotics (e.g., dactinomycin
(formerly
actinomycin), bleomycin, mithramycin, and anthramycin (AMC)), and anti-mitotic
agents (e.g., vincristine and vinblastine). Other examples of therapeutic
cytotoxins that
can be conjugated to an antibody of the invention include calicheamicins and
duocarmycins.
Human antibodies of the present invention also can be conjugated to a
radioisotope, e.g., radioactive iodine, to generate cytotoxic or non-cytotoxic
radiopharmaceuticals for treating or diagnosing PSMA-related disorders (e.g.,
tumors).
Antibody conjugates of the invention can be used to modify a given
biological response, and the drug moiety is not to be construed as limited to
classical
chemical therapeutic agents. For example, the drug moiety may be a protein or
polypeptide possessing a desired biological activity. Such proteins may
include, for
example, an enzymatically active toxin, or active fragment thereof, such as
abrin, ricin
A, pseudomonas exotoxin, or diphtheria toxin; a protein such as tumor necrosis
factor or
interferon-y; or, biological response modifiers such as, for example,
lymphokines,
interleukin-1 ("IL-1 "), interleukin-2 ("IL-2"), interleukin-6 ("IL-6"),
granulocyte
macrophage colony stimulating factor ("GM-CSF"), granulocyte colony
stimulating
factor ("G-CSF"), or other growth factors.
Techniques for conjugating such therapeutic moiety to antibodies are
well known, see, e.g., Arnon et al., "Monoclonal Antibodies For
Immunotargeting Of
Drugs In Cancer Therapy", in Monoclonal Antibodies And Cancer Therapy,
Reisfeld et
al. (eds.), pp. 243-56 (Alan R. Liss, Inc. 1985); Hellstrom et al.,
"Antibodies For Drug
Delivery", in Controlled Drug Delivery (2nd Ed.), Robinson et al. (eds.), pp.
623-53
(Marcel Dekker, Inc. 1987); Thorpe, "Antibody Carriers Of Cytotoxic Agents In
Cancer
Therapy: A Review", in Monoclonal Antibodies '84: Biological And Clinical
Applications, Pinchera et al. (eds.), pp. 475-506 (1985); "Analysis, Results,
And Future
Prospective Of The Therapeutic Use Of Radiolabeled Antibody In Cancer
Therapy", in
Monoclonal Antibodies For Cancer Detection And Therapy, Baldwin et al. (eds.),
pp.
303-16 (Academic Press 1985), and Thorpe et al., "The Preparation And
Cytotoxic
Properties Of Antibody-Toxin Conjugates", Immunol. Rev., 62:119-58 (1982).
53
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
V. Pharmaceutical Compositions
In another aspect, the present invention provides a composition, e.g., a
pharmaceutical composition, containing one or a combination of human
monoclonal
antibodies, or antigen-binding portions) thereof, of the present invention,
formulated
together with a pharmaceutically acceptable carrier. Such compositions may
include
one or a combination of (e.g., two or more different) human antibodies of the
invention.
In one embodiment, the invention provides a therapeutic composition
comprising a combination of human anti-PSMA antibodies which bind to different
epitopes on human PSMA and have complementary activities, e.g., as a
pharmaceutical
composition. For example, a human monoclonal antibody that mediates highly
effective
killing of target cells in the presence of effector cells can be combined with
another
human monoclonal antibody that inhibits the growth of cells expressing PSMA.
In another embodiment, the therapeutic composition comprises one or a
combination of immunoconjugates or bispecific (or multispecific) molecules of
the
invention.
Pharmaceutical compositions of the invention also can be administered in
combination therapy, i.e., combined with other agents. For example, the
combination
therapy can include a composition of the present invention with at least one
anti-tumor
agent or other conventional therapy.
As used herein, "pharmaceutically acceptable carrier" includes any and
all solvents, dispersion media, coatings, antibacterial and antifungal agents,
isotonic and
absorption delaying agents, and the like that are physiologically compatible.
Preferably,
the carrier is suitable for intravenous, intramuscular, subcutaneous,
parenteral, spinal or
epidermal administration (e.g., by injection or infusion). Depending on the
route of
administration, the active compound, i.e., antibody, bispecific and
multispecific
molecule, may be coated in a material to protect the compound from the action
of acids
and other natural conditions that may inactivate the compound.
A "pharmaceutically acceptable salt" refers to a salt that retains the
desired biological activity of the parent compound and does not impart any
undesired
toxicological effects (see e.g., Berge, S.M., et al. (1977) J. Pharm. Sci.
66:1-19).
Examples of such salts include acid addition salts and base addition salts.
Acid addition
salts include those derived from nontoxic inorganic acids, such as
hydrochloric, nitric,
phosphoric, sulfuric, hydrobromic, hydroiodic, phosphorous and the like, as
well as
54
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
from nontoxic organic acids such as aliphatic mono- and dicarboxylic acids,
phenyl-
substituted alkanoic acids, hydroxy alkanoic acids, aromatic acids, aliphatic
and
aromatic sulfonic acids and the like. Base addition salts include those
derived from
alkaline earth metals, such as sodium, potassium, magnesium, calcium and the
like, as
well as from nontoxic organic amines, such as N,N'-dibenzylethylenediamine, N-
methylglucamine, chloroprocaine, choline, diethanolamine, ethylenediamine,
procaine
and the like.
A composition of the present invention can be administered by a variety
of methods known in the art. As will be appreciated by the skilled artisan,
the route
and/or mode of administration will vary depending upon the desired results.
The active
compounds can be prepared with carriers that will protect the compound against
rapid
release, such as a controlled release formulation, including implants,
transdermal
patches, and microencapsulated delivery systems. Biodegradable, biocompatible
polymers can be used, such as ethylene vinyl acetate, polyanhydrides,
polyglycolic acid,
collagen, polyorthoesters, and polylactic acid. Many methods for the
preparation of
such formulations are patented or generally known to those skilled in the art.
See, e.g.,
Sustained and Controlled Release Drug Delivery Systems, J.R. Robinson, ed.,
Marcel
Dekker, Inc., New York, 1978.
To administer a compound of the invention by certain routes of
administration, it may be necessary to coat the compound with, or co-
administer the
compound with, a material to prevent its inactivation. For example, the
compound may
be administered to a subject in an appropriate carrier, for example,
liposomes, or a
diluent. Pharmaceutically acceptable diluents include saline and aqueous
buffer
solutions. Liposomes include water-in-oil-in-water CGF emulsions as well as
conventional liposomes (Strejan et al. (1984) J. Neuroimmunol. 7:27).
Pharmaceutically acceptable carriers include sterile aqueous solutions or
dispersions and sterile powders for the extemporaneous preparation of sterile
injectable
solutions or dispersion. The use of such media and agents for pharmaceutically
active
substances is known in the art. Except insofar as any conventional media or
agent is
incompatible with the active compound, use thereof in the pharmaceutical
compositions
of the invention is contemplated. Supplementary active compounds can also be
incorporated into the compositions.
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
Therapeutic compositions typically must be sterile and stable under the
conditions of manufacture and storage. The composition can be formulated as a
solution, microemulsion, liposome, or other ordered structure suitable to high
drug
concentration. The carrier can be a solvent or dispersion medium containing,
for
example, water, ethanol, polyol (for example, glycerol, propylene glycol, and
liquid
polyethylene glycol, and the like), and suitable mixtures thereof. The proper
fluidity can
be maintained, for example, by the use of a coating such as lecithin, by the
maintenance
of the required particle size in the case of dispersion and by the use of
surfactants. In
many cases, it will be preferable to include isotonic agents, for example,
sugars,
polyalcohols such as mannitol, sorbitol, or sodium chloride in the
composition.
Prolonged absorption of the injectable compositions can be brought about by
including
in the composition an agent that delays absorption, for example, monostearate
salts and
gelatin.
Sterile injectable solutions can be prepared by incorporating the active
compound in the required amount in an appropriate solvent with one or a
combination of
ingredients enumerated above, as required, followed by sterilization
microfiltration.
Generally, dispersions are prepared by incorporating the active compound into
a sterile
vehicle that contains a basic dispersion medium and the required other
ingredients from
those enumerated above. In the case of sterile powders for the preparation of
sterile
injectable solutions, the preferred methods of preparation are vacuum drying
and freeze-
drying (lyophilization) that yield a powder of the active ingredient plus any
additional
desired ingredient from a previously sterile-filtered solution thereof.
Dosage regimens are adjusted to provide the optimum desired response
(e.g., a therapeutic response). For example, a single bolus may be
administered, several
divided doses may be administered over time or the dose may be proportionally
reduced
or increased as indicated by the exigencies of the therapeutic situation. It
is especially
advantageous to formulate parenteral compositions in dosage unit form for ease
of
administration and uniformity of dosage. Dosage unit form as used herein
refers to
physically discrete units suited as unitary dosages for the subjects to be
treated; each
unit contains a predetermined quantity of active compound calculated to
produce the
desired therapeutic effect in association with the required pharmaceutical
carrier. The
specification for the dosage unit forms of the invention are dictated by and
directly
dependent on (a) the unique characteristics of the active compound and the
particular
56
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
therapeutic effect to be achieved, and (b) the limitations inherent in the art
of
compounding such an active compound for the treatment of sensitivity in
individuals.
Examples of pharmaceutically-acceptable antioxidants include: (1) water
soluble antioxidants, such as ascorbic acid, cysteine hydrochloride, sodium
bisulfate,
S sodium metabisulfite, sodium sulfite and the like; (2) oil-soluble
antioxidants, such as
ascorbyl palmitate, butylated hydroxyanisole (BHA), butylated hydroxytoluene
(BHT),
lecithin, propyl gallate, alpha-tocopherol, and the like; and (3) metal
chelating agents,
such as citric acid, ethylenediamine tetraacetic acid (EDTA), sorbitol,
tartaric acid,
phosphoric acid, and the like.
For the therapeutic compositions, formulations of the present invention
include those suitable for oral, nasal, topical (including buccal and
sublingual), rectal,
vaginal and/or parenteral administration. The formulations may conveniently be
presented in unit dosage form and may be prepared by any methods known in the
art of
pharmacy. The amount of active ingredient which can be combined with a carrier
material to produce a single dosage form will vary depending upon the subject
being
treated, and the particular mode of administration. The amount of active
ingredient
which can be combined with a carrier material to produce a single dosage form
will
generally be that amount of the composition which produces a therapeutic
effect.
Generally, out of one hundred per cent, this amount will range from about 0.01
per cent
to about ninety-nine percent of active ingredient, preferably from about 0.1
per cent to
about 70 per cent, most preferably from about 1 per cent to about 30 per cent.
Formulations of the present invention which are suitable for vaginal
administration also include pessaries, tampons, creams, gels, pastes, foams or
spray
formulations containing such carriers as are known in the art to be
appropriate. Dosage
forms for the topical or transdermal administration of compositions of this
invention
include powders, sprays, ointments, pastes, creams, lotions, gels, solutions,
patches and
inhalants. The active compound may be mixed under sterile conditions with a
pharmaceutically acceptable carrier, and with any preservatives, buffers, or
propellants
which may be required.
The phrases "parenteral administration" and "administered parenterally"
as used herein means modes of administration other than enteral and topical
administration, usually by injection, and includes, without limitation,
intravenous,
intramuscular, intraarterial, intrathecal, intracapsular, intraorbital,
intracardiac,
57
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular,
intraarticular,
subcapsular, subarachnoid, intraspinal, epidural and intrasternal injection
and infusion.
Examples of suitable aqueous and nonaqueous carriers which may be
employed in the pharmaceutical compositions of the invention include water,
ethanol,
polyols (such as glycerol, propylene glycol, polyethylene glycol, and the
like), and
suitable mixtures thereof, vegetable oils, such as olive oil, and injectable
organic esters,
such as ethyl oleate. Proper fluidity can be maintained, for example, by the
use of
coating materials, such as lecithin, by the maintenance of the required
particle size in the
case of dispersions, and by the use of surfactants.
These compositions may also contain adjuvants such as preservatives,
wetting agents, emulsifying agents and dispersing agents. Prevention of
presence of
microorganisms may be ensured both by sterilization procedures, supra, and by
the
inclusion of various antibacterial and antifungal agents, for example,
paraben,
chlorobutanol, phenol sorbic acid, and the like. It may also be desirable to
include
isotonic agents, such as sugars, sodium chloride, and the like into the
compositions. In
addition, prolonged absorption of the injectable pharmaceutical form may be
brought
about by the inclusion of agents which delay absorption such as aluminum
monostearate
and gelatin.
When the compounds of the present invention are administered as
pharmaceuticals, to humans and animals, they can be given alone or as a
pharmaceutical
composition containing, for example, 0.01 to 99.5% (more preferably, 0.1 to
90%) of
active ingredient in combination with a pharmaceutically acceptable carrier.
Regardless of the route of administration selected, the compounds of the
present invention, which may be used in a suitable hydrated form, and/or the
pharmaceutical compositions of the present invention, are formulated into
pharmaceutically acceptable dosage forms by conventional methods known to
those of
skill in the art.
Actual dosage levels of the active ingredients in the pharmaceutical
compositions of the present invention may be varied so as to obtain an amount
of the
active ingredient which is effective to achieve the desired therapeutic
response for a
particular patient, composition, and mode of administration, without being
toxic to the
patient. The selected dosage level will depend upon a variety of
pharmacokinetic
factors including the activity of the particular compositions of the present
invention
58
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
employed, or the ester, salt or amide thereof, the route of administration,
the time of
administration, the rate of excretion of the particular compound being
employed, the
duration of the treatment, other drugs, compounds and/or materials used in
combination
with the particular compositions employed, the age, sex, weight, condition,
general
health and prior medical history of the patient being treated, and like
factors well known
in the medical arts.
A physician or veterinarian having ordinary skill in the art can readily
determine and prescribe the effective amount of the pharmaceutical composition
required. For example, the physician or veterinarian could start doses of the
compounds
of the invention employed in the pharmaceutical composition at levels lower
than that
required in order to achieve the desired therapeutic effect and gradually
increase the
dosage until the desired effect is achieved. In general, a suitable daily dose
of a
compositions of the invention will be that amount of the compound which is the
lowest
dose effective to produce a therapeutic effect. Such an effective dose will
generally
depend upon the factors described above. It is preferred that administration
be
intravenous, intramuscular, intraperitoneal, or subcutaneous, preferably
administered
proximal to the site of the target. If desired, the effective daily dose of a
therapeutic
compositions may be administered as two, three, four, five, six or more sub-
doses
administered separately at appropriate intervals throughout the day,
optionally, in unit
dosage forms. While it is possible for a compound of the present invention to
be
administered alone, it is preferable to administer the compound as a
pharmaceutical
formulation (composition).
Therapeutic compositions can be administered with medical devices
known in the art. For example, in a preferred embodiment, a therapeutic
composition of
the invention can be administered with a needleless hypodermic injection
device, such
as the devices disclosed in U.S. Patent Nos. 5,399,163; 5,383,851; 5,312,335;
5,064,413;
4,941,880; 4,790,824; or 4,596,556. Examples of well-known implants and
modules
useful in the present invention include: U.S. Patent No. 4,487,603, which
discloses an
implantable micro-infusion pump for dispensing medication at a controlled
rate;
U.S. Patent No. 4,486,194, which discloses a therapeutic device for
administering
medicants through the skin; U.S. Patent No. 4,447,233, which discloses a
medication
infusion pump for delivering medication at a precise infusion rate; U.S.
Patent
No. 4,447,224, which discloses a variable flow implantable infusion apparatus
for
59
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
continuous drug delivery; U.S. Patent No. 4,439,196, which discloses an
osmotic drug
delivery system having mufti-chamber compartments; and U.S. Patent No.
4,475,196,
which discloses an osmotic drug delivery system. These patents are
incorporated herein
by reference. Many other such implants, delivery systems, and modules are
known to
those skilled in the art.
In certain embodiments, the human monoclonal antibodies of the
invention can be formulated to ensure proper distribution in vivo. For
example, the
blood-brain barrier (BBB) excludes many highly hydrophilic compounds. To
ensure
that the therapeutic compounds of the invention cross the BBB (if desired),
they can be
formulated, for example, in liposomes. For methods of manufacturing liposomes,
see,
e.g., U.S. Patents 4,522,811; 5,374,548; and 5,399,331. The liposomes may
comprise
one or more moieties which are selectively transported into specific cells or
organs, thus
enhance targeted drug delivery (see, e.g., V.V. Ranade (1989) J. Clin.
Pharmacol.
29:685). Exemplary targeting moieties include folate or biotin (see, e.g.,
U.S. Patent
5,416,016 to Low et al.); mannosides (Umezawa et al., (1988) Biochem. Biophys.
Res.
Commun. 153:1038); antibodies (P.G. Bloeman et al. (1995) FEBSLett. 357:140;
M.
Owais et al. ( 1995) Antimicrob. Agents Chemother. 39:180); surfactant protein
A
receptor (Briscoe et al. (1995) Am. J. Physiol. 1233:134), different species
of which may
comprise the formulations of the inventions, as well as components of the
invented
molecules; p120 (Schreier et al. (1994) J. Biol. Chem. 269:9090); see also K.
Keinanen;
M.L. Laukkanen (1994) FEBS Lett. 346:123; J.J. Killion; LJ. Fidler (1994)
Immunomethods 4:273. In one embodiment of the invention, the therapeutic
compounds
of the invention are formulated in liposomes; in a more preferred embodiment,
the
liposomes include a targeting moiety. In a most preferred embodiment, the
therapeutic
compounds in the liposomes are delivered by bolus injection to a site proximal
to the
tumor or infection. The composition must be fluid to the extent that easy
syringability
exists. It must be stable under the conditions of manufacture and storage and
must be
preserved against the contaminating action of microorganisms such as bacteria
and
fungi.
A "therapeutically effective dosage" preferably inhibits tumor growth by
at least about 20%, more preferably by at least about 40%, even more
preferably by at
least about 60%, and still more preferably by at least about 80% relative to
untreated
subjects. The ability of a compound to inhibit cancer can be evaluated in an
animal
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
model system predictive of efficacy in human tumors. Alternatively, this
property of a
composition can be evaluated by examining the ability of the compound to
inhibit, such
inhibition in vitro by assays known to the skilled practitioner. A
therapeutically
effective amount of a therapeutic compound can decrease tumor size, or
otherwise
ameliorate symptoms in a subject. One of ordinary skill in the art would be
able to
determine such amounts based on such factors as the subject's size, the
severity of the
subject's symptoms, and the particular composition or route of administration
selected.
The composition must be sterile and fluid to the extent that the
composition is deliverable by syringe. In addition to water, the carrier can
be an
isotonic buffered saline solution, ethanol, polyol (for example, glycerol,
propylene
glycol, and liquid polyetheylene glycol, and the like), and suitable mixtures
thereof.
Proper fluidity can be maintained, for example, by use of coating such as
lecithin, by
maintenance of required particle size in the case of dispersion and by use of
surfactants.
In many cases, it is preferable to include isotonic agents, for example,
sugars,
polyalcohols such as mannitol or sorbitol; and sodium chloride in the
composition.
Long-term absorption of the injectable compositions can be brought about by
including
in the composition an agent which delays absorption, for example, aluminum
monostearate or gelatin.
When the active compound is suitably protected, as described above, the
compound may be orally administered, for example, with an inert diluent or an
assimilable edible carrier.
VI. Uses and Methods of the Invention
Human monoclonal anti-PSMA antibodies and related
derivatives/conjugates and compositions of the present invention have a
variety of in
vitro and in vivo diagnostic and therapeutic utilities. For example, these
molecules can
be administered to cells in culture, e.g. in vitro or ex vivo. Alternatively,
they can be
administered to a subject, e.g., in vivo, to treat, prevent or diagnose a
variety of PSMA-
related disorders. As used herein, the term "subject" is intended to include
both human
and nonhuman animals. Preferred subjects include human patients exhibiting
disorders
characterized by expression of PSMA, typically aberrant expression (e.g.,
overexpression) of PSMA. Accordingly, the methods and compositions of the
present
invention can be used to treat subjects with tumorigenic disorders
characterized by the
61
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
presence of tumor cells expressing PSMA including, for example, prostate
cancer, colon
cancer, and renal carcinoma. The term "nonhuman animals" of the invention
includes
all vertebrates, e.g., mammals and non-mammals, such as nonhuman primates,
sheep,
dog, cow, chickens, amphibians, reptiles, etc.
S In a preferred embodiment, the invention provides a method for treating
prostate cancer in a subject comprising administering to the subject one of
the anti-
PSMA antibodies of the invention. In another embodiment, the anti-PSMA
antibody is
administered as a conjugate, wherein the antibody is linked to, for example, a
radioactive agent or a cytotoxic drug. In yet another embodiment, the anti-
PSMA
antibody is administered as a bispecific molecule, e.g., linked to anti-FcyRI
or anti-Fca.
Human antibodies of the invention can be initially tested for binding
activity associated with therapeutic or diagnostic use in vitro. For example,
compositions of the invention can be tested using the ELISA and flow
cytometric assays
described in the Examples below. Moreover, the activity of these molecules in
triggering at least one effector-mediated effector cell activity, including
cytolysis of
cells expressing PSMA can be assayed. Protocols for assaying for effector cell-
mediated phagocytosis are described in the Examples below.
Human antibodies of the invention also have additional utility in therapy
and diagnosis of PSMA-related diseases. For example, the human monoclonal
antibodies, the multispecific or bispecific molecules can be used, for
example, to elicit
in vivo or in vitro one or more of the following biological activities: to
opsonize a cell
expressing PSMA; to mediate phagocytosis or cytolysis of a cell expressing
PSMA in
the presence of human effector cells; or to inhibit the growth of a cell
expressing PSMA.
Suitable methods for administering antibodies and compositions of the
present invention are well known in the art. Suitable dosages also can be
determined
within the skill in the art and will depend on the age and weight of the
subject and the
particular drug used.
Human anti-PSMA antibodies of the invention also can be co-
administered with other therapeutic agents, e.g., a chemotherapeutic agent, or
can be co-
administered with other known therapies, e.g., an anti-cancer therapy, e.g.,
radiation.
Such therapeutic agents include, among others, anti-neoplastic agents such as
doxorubicin (adriamycin), cisplatin bleomycin sulfate, carmustine,
chlorambucil, and
cyclophosphamide hydroxyurea which, by themselves, are only effective at
levels which
62
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
are toxic or subtoxic to a patient. Cisplatin is intravenously administered as
a 100
mg/m2 dose once every four weeks and adriamycin is intravenously administered
as a
60-75 mg/m2 dose once every 21 days. Co-administration of the human anti-PSMA
antibodies, or antigen binding fragments thereof, of the present invention
with
chemotherapeutic agents provides two anti-cancer agents which operate via
different
mechanisms which yield a cytotoxic effect to human tumor cells. Such co-
administration can solve problems due to development of resistance to drugs or
a change
in the antigenicity of the tumor cells which would render them unreactive with
the
antibody.
Target-specific effector cells, e.g., effector cells linked to human
antibodies, multispecific or bispecific molecules of the invention, also can
also be used
as therapeutic agents. Effector cells for targeting can be human leukocytes
such as
macrophages, neutrophils or monocytes. Other cells include eosinophils,
natural killer
cells and other IgG- or IgA-receptor bearing cells. If desired, effector cells
can be
obtained from the subject to be treated. The target-specific effector cells,
can be
administered as a suspension of cells in a physiologically acceptable
solution. The
number of cells administered can be in the order of 10g-109 but will vary
depending on
the therapeutic purpose. In general, the amount will be sufficient to obtain
localization
at the target cell, e.g., a tumor cell expressing PSMA, and to effect cell
killing by, e.g.,
phagocytosis. Routes of administration can also vary.
Therapy with target-specific effector cells can be performed in
conjunction with other techniques for removal of targeted cells. For example,
anti-
tumor therapy using the compositions (e.g., human antibodies, multispecific
and
bispecific molecules) of the invention and/or effector cells armed with these
compositions can be used in conjunction with chemotherapy. Additionally,
combination
immunotherapy may be used to direct two distinct cytotoxic effector
populations toward
tumor cell rejection. For example, anti-PSMA antibodies linked to anti-Fc-
gammaRI or
anti-CD3 may be used in conjunction with IgG- or IgA-receptor specific binding
agents.
Bispecific and multispecific molecules of the invention can also be used
to modulate FcyR or FcaR levels on effector cells, such as by capping and
elimination
of receptors on the cell surface. Mixtures of anti-Fc receptors can also be
used for this
purpose.
63
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
The compositions (e.g., human antibodies, multispecific and bispecific
molecules) of the invention which have complement binding sites, such as
portions from
IgGl, -2, or -3 or IgM which bind complement, can also be used in the presence
of
complement. In one embodiment, ex vivo treatment of a population of cells
comprising
target cells with a binding agent of the invention and appropriate effector
cells can be
supplemented by the addition of complement or serum containing complement.
Phagocytosis of target cells coated with a binding agent of the invention can
be
improved by binding of complement proteins. In another embodiment target cells
coated with the compositions (e.g., human antibodies, multispecific and
bispecific
molecules) of the invention can also be lysed by complement. In yet another
embodiment, the compositions of the invention do not activate complement.
The compositions (e.g., human antibodies, multispecific and bispecific
molecules) of the invention can also be administered together with complement.
Accordingly, within the scope of the invention are compositions comprising
human
antibodies, multispecific or bispecific molecules and serum or complement.
These
compositions are advantageous in that the complement is located in close
proximity to
the human antibodies, multispecific or bispecific molecules. Alternatively,
the human
antibodies, multispecific or bispecific molecules of the invention and the
complement or
serum can be administered separately.
Also within the scope of the invention are kits comprising the
compositions (e.g., human antibodies, multispecific and bispecific molecules)
of the
invention and instructions for use. The kit can further contain a least one
additional
reagent, such as complement, or one or more additional human antibodies of the
invention (e.g., a human antibody having a complementary activity which binds
to an
epitope in PSMA antigen distinct from the first human antibody).
In other embodiments, the subject can be additionally treated with an
agent that modulates, e.g., enhances or inhibits, the expression or activity
of Fcy or Fcoc
receptors by, for example, treating the subject with a cytokine. Preferred
cytokines for
administration during treatment with the multispecific molecule include of
granulocyte
colony-stimulating factor (G-CSF), granulocyte- macrophage colony-stimulating
factor
(GM-CSF), interferon-y (IFN-y), and tumor necrosis factor (TNF).
64
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
The compositions (e.g., human antibodies, multispecific and bispecific
molecules) of the invention can also be used to target cells expressing FcyR
or PSMA,
for example for labeling such cells. For such use, the binding agent can be
linked to a
molecule that can be detected. Thus, the invention provides methods for
localizing ex
vivo or in vitro cells expressing Fc receptors, such as FcyR, or PSMA. The
detectable
label can be, e.g., a radioisotope, a fluorescent compound, an enzyme, or an
enzyme co-
factor.
Human antibodies of the invention also can be used to detect the presence
of PSMA antigen in a sample, or to measure the amount of PSMA antigen in a
sample,
by contacting the sample (e.g., along with a control sample) with the human
monoclonal
antibody under conditions that allow for formation of a complex between the
antibody
and PSMA. The formation of a complex is then detected, wherein a difference
complex
formation between the sample compared to the control sample is indicative the
presence
of PSMA antigen in the sample.
In still another embodiment, the invention provides a method for
detecting the presence or quantifying the amount of Fc-expressing cells in
vivo or in
vitro. The method comprises (i) administering to a subject a composition
(e.g., a multi-
or bispecific molecule) of the invention or a fragment thereof, conjugated to
a detectable
marker; (ii) exposing the subject to a means for detecting said detectable
marker to
identify areas containing Fc-expressing cells.
The present invention is further illustrated by the following examples
which should not be construed as further limiting. The contents of all figures
and all
references, patents and published patent applications cited throughout this
application
are expressly incorporated herein by reference.
EXAMPLES
Methods and Materials
Screening assay for PSMA-specific monoclonal antibodies: PSMA-
HuMAbs were detected using a solid-phase ELISA-based assay. Immunoaffinity
purified PSMA from LNCaP cells, or bacterially-expressed fusion proteins
containing
PSMA derived fragments, were coated onto Maxi-Sorp (Nunc, Rochester, NY) 96-
well
plates with an overnight incubation at 4°C. The plates were washed with
PBS-0.2%
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
Tween-20 and blocked with 5% BSA in PBS for 1 hour at room temperature. Fifty
p,l of
supernatant from the hybridoma cultures was added to the PSMA-coated wells and
the
plates were incubated for 2 hours at room temperature. The plates W ere washed
as
above and 501 of 1:1000 diluted rabbit-anti-human IgG H&L chain (ICN, Costa
Mesa,
CA) was added to each well. Following a one-hour incubation at room
temperature, the
plates were washed as above and 501 of a 1:2000 dilution of HRP-conjugated
Protein-
A (Sigma, St. Louis, MO) was added to each well. Following a one-hour
incubation at
room temperature, the plates were washed as above and 100 pl of ABTS (150 mg
2,2'-
azino-bis(3-ethylbenzthiazoline-6-sulfonic acid in 500 ml of 0.1 M citric
acid, pH 4.
35)/H202 (10 x,130% H202 per 10 ml of ABTS solution) chromagen/substrate
solution
was added to each well. After a five minute incubation the reaction was
stopped with
the addition of 100 p,l of stop solution (SDS/dimethylformamide) and the
absorbance at
405 nm was read in_a microplate reader. The hybridoma cells producing
supernatants
with high A4os values were cloned by limiting dilution and subjected to
additional
1 S analysis.
Isolation of antibody protein: Monoclonal antibodies were isolated from
a Cellmax bioreactor (Cellco, Laguna Hills, CA) using RPMI-1640 medium
containing
1- to 5% Fetalclone (Hyclone, Logan, UT). Monoclonal antibodies were purified
by chromatography on a Protein A-Agarose column according to manufacturer's
specifications (KPL, Gaithersburg, MD).
Preparation of LNCaP cell membranes: LNCaP cells were scraped from
plastic dishes, washed extensively in PBS, resuspended in 10 volumes of
deionized
water, and homogenized by three strokes with a Dounce homogenizer. The
membrane
fraction was isolated by centrifugation at 15,000 x g for 45 minutes and the
pellet
resuspended in PBS. Protein concentration of the membrane pellet was
determined
using the Pierce (Rockford, IL) BCA kit.
Heat denaturation experiments: An aliquot of immunoaffinity purified
PSMA from LNCaP cells (40 pg/ml in PBS) was heat denatured by boiling for 10
minutes and cooled on ice. This, and an identical aliquot which was not heat
denatured,
were diluted 1:4 in PBS and 50 ~1 was added to wells of a 96-well Maxi-Sore
plate
(Nunc) and coated overnight at 4°. After coating, all plates were
blocked with 5% BSA
in PBS for one hour, washed in PBS and subjected to a standard sandwich ELISA
using
the indicated primary antibodies as described above.
66
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
Western blot analysis: Western blot analysis following SDS-PAGE of
PSMA containing fractions and transfer to PVDF membranes. The blots were
blocked
overnight in TBS containing 5% nonfat milk and incubated with purified
antibody
present at a concentration of S p,g/ml in TBS for one hour. The blots were
washed 5
times with TBS containing 0.5% Tween-20 (TBS-T), the blots were developed
using the
LumiGLO chemiluminescent substrate kit (KPL, Gaithersburg, MD), and visualized
by
exposing x-ray film.
Immunoprecipitation studies: A detergent lysate of LNCaP cells was
prepared by adding PBS containing 1% NP-40 to LNCaP cells, incubating for one
hour,
and centrifugation to remove particulate material. The lysate was pre-cleared
by adding
150 pg irrelevant human IgG, per ml of lysate, incubating for one hour at room
temperature, followed by the addition of 150 ~1 of packed Protein G-Sepharose
beads
per ml lystae. The supernatant fraction was used after centrifugation to
remove the
beads. Aliquots, 100 pl each, of the pre-cleared lysate were mixed with 5 p.g
of
antibody protein and incubated overnight at 4°C. At the end of this
period, 20 pl of
packed Protein G-Sepharose beads were added to each tube and the tubes were
incubated for one hour at 4°C. Following extensive washing with lysis
buffer, 50 pl of
Laemmli sample buffer (Bio-Rad) was added to each sample and the tubes were
heated
for 10 minutes at 95°C. The tubes were centrifuged for two minutes and
25 pl of each
sample was loaded onto an SDS-PAGE gel and electrophoresed at 175 volts for 60
minutes. The electrophoresed samples were electroblotted onto PVDF membranes
for
Western blot analysis using the murine anti-PSMA antibody 4D8 (5 pg/ml) and
developed as described above.
Flow cytometry: LNCaP and PC-3 cells were freshly harvested from
tissue culture flasks and a single cell suspension prepared. LNCaP cell
suspensions were
either stained with primary antibody directly or after fixation with 1 %
paraformaldehyde
in PBS. Approximately one million cells were resuspended in PBS containing
0.5%
BSA and 50-200 pg/ml ofprimary antibody and incubated on ice for 30 minutes.
The
cells were washed twice with PBS containing 0.1% BSA, 0.01% NaN3, resuspended
in
100 pl of 1:100 diluted FITC-conjugated goat-anti-human IgG (Jackson
ImmunoResearch, West Grove, PA), and incubated on ice for an additional 30
minutes.
The cells were again washed twice, resuspended in 0.5 ml of wash buffer and
analyzed
67
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
for fluorescent staining on a FACSCalibur cytometer (Becton-Dickinson, San
Jose, CA)
with CellQuest acquisition software.
FITC labeling of monoclonal antibodies: Purified monoclonal antibodies
were first extensively dialyzed against 0.3M sodium carbonate buffer, pH 9.5.
A stock
fluorescein isothiocyanate (FITC) solution was prepared by dissolving 1 mg
solid FITC
in 1 ml of DMSO. Stock FITC was added dropwise with constant mixing in an
amount
to provide 50 pg FITC per mg of antibody protein. Once added, the solution was
incubated in the dark at room temperature for 1-3 hours. FITC-labeled antibody
was
isolated by gel filtration on a Sephadex G-IO column equilibrated in PBS.
DOTA labeling of 4A3 and 7F 12: Five milligrams of 4A3 and 7F 12
antibody protein was DOTA labeled via direct coupling of one of the four
carboxylic
acid groups of DOTA to amino groups of the antibody protein. DOTA
(tetraazacyclododecanetetraacidic acid) is a common chelator which can be used
for
complexing radionuclides. The protein in approximately 1.5 ml of PBS was first
washed in a centrifugal concentrator with a M~ 25,000 cut-off using 5 x 4m1 of
1
DTPA (diethylenetriaminepentaacetic acid), pH 5.0 over a 24 hour period. The
antibody
buffer was then changed to O.1M phosphate, pH 7.0 using the same procedure. An
active ester of DOTA was created by dissolving 30 mg of DOTA (0.072 mmol) in
0.4
ml water and the pH was adjusted to 7.3 with NaOH. Ten mg of 1-ethyl-3-(3-
dimethylaminopropyl)carbodiimide was then added and the mixture cooled on ice
for
one hour and added to the antibody solution and stirred at 4°C
overnight. The resultant
DOTA-antibody conjugate was separated from excess DOTA and other reactants by
repeated washing with 0.3 M NH40ac and centrifugal concentration.
Antibody inhibition studies: Approximately one million LNCaP cells
were initially treated with 200 pg/ml purified 4A3, 7F12, 8A11, 8C12, 16F9, or
irrelevant human IgGi antibody in PBS for one hour on ice. After washing, the
cells
were incubated with SO p.g/ml FITC conjugated human or murine anti-PSMA
monoclonal antibody for one hour on ice. After washing, the cells were stained
with 10
pg/ml propidium iodide and analyzed by flow cytometry on a FACsCalibur with
CellQuest software.
Biodistribution of ~25I-labeled HuMAb in nude mice bearing LNCaP cell
tumors: LNCaP cells, 2x106 in 50% Matrigel (Becton-Dickinson (150 pl total
volume),
were injected subcutaneously in nude mice. When tumors reached a size of
68
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
approximately 0.5 cm in diameter, the animals were subjected to in vivo
labeling with
izsl-labeled antibody via i. v. administration through the tail vein of 100 ~g
of antibody
(containing 5- to 35 pCi of ~ZSI). After varying time points, the animals were
sacrificed
and the level of ~2sI-label present in individual normal organs and tissues,
as well as
tumor tissue, was determined.
One milligram of antibody protein was iodinated with 1- to 1.5 mCi of
~2s1 using lodobeads (Pierce) according to manufacturer's instructions.
Internalization of ~ZSI-labeled HuMAbs: LNCaP cells were plated into 6-
well plates and allowed to reach near confluency. The medium was then removed
and
the wells washed with PBS to remove non-adherant cells. The cells were then
labeled
with ~zsI-labeled HuMAb or isotype matched irrelevant human IgG present at a
concentration of 10 p,g/ml in a total volume of 1.5 ml in fresh culture medium
and
incubated in a 37°C incubator for 10 minutes. At the end of this period
the medium was
removed, the cells washed extensively with PBS to remove unbound labeled
antibody,
1.5 ml of culture medium was added, and the plates returned to the 37°
incubator for the
desired incubation time. At 0 (immediately after addition of the culture
medium), 4, 18,
and 28 hours of incubation the culture medium was removed, centrifuged to
eliminate
non-adherent cells. 'The supernatant fraction was cooled on ice, and subjected
to TCA
precipitation by addition of 100% TCA to yield a 10% final TCA concentration.
After
incubating on ice for 10 minutes, the fraction was centrifuged for 10 minutes
at 1000 xg
and the supernatant removed. The amount of radioactivity present in both the
TCA
soluble and insoluble fractions was determined in a gamma counter. The
adherent cells
present in the wells after removal of the medium for TCA precipitation were
released
using trypsin and placed in a tube for counting along with a 1 ml wash with
O.1N NaOH.
The radioactivity bound to the cells was also determined in a gamma counter.
The
proportion of the total counts originally bound to the cells which was
internalized,
processed, and distributed into the TCA soluble fraction with time was
plotted.
Purified antibody protein, 0.5 mg, was iodinated with 1 mCi of'ZSl as
described previously. Labeling of each antibody was between 0.4 and 1.6 pCi/pg
antibody protein.
69
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
ADCC and CDC screening of HuMAbs: ADCC and CDC tests were
four hour S~Cr release assays using LNCaP cells as target cells. Assays were
conducted in 96-well plates with 2500 targets per well in triplicate using an
effector to
target cell ratio (E:T ratio) of 100:1. Effector cells were PBMC's isolated
from one male
and one female donor. For CDC assays, fresh human plasma at a final
concentration of
1:200 was used as a complement source.
Tissue cross reactivity screening of HuMAbs by IHC: Conditions for
IHC cross reactivity screening were first optimized by use of a fixed
concentration of
purified unconjugated human monoclonal antibody (5 pg/ml) and varying
concentrations of biotinylated goat-anti-human IgGI secondary antibody on
frozen tissue
sections fixed by treatment with acetone for 10 minutes after cryotomy or with
10%
neutral-buffered formalin for 10 seconds immediately prior to staining. Based
upon
these conditions, a second test was conducted with the optimized secondary
antibody
concentration with varying concentrations of the HuMAb primary antibody.
Based on these results, tissue screening was conducted on human frozen
sections after fixation in acetone for 10 minutes at the time of cryotomy
followed by 10
seconds in 10% neutral-buffered formalin immediately prior to staining.
Staining was
done with primary antibody at a concentration of 5 ~g/ml containing 1.5 mg/ml
excess
carrier IgG followed by 7.5 pg/ml biotinylated goat-anti-human IgG secondary
antibody containing 1.5 mg/ml excess carrier IgG. Heat aggregated rabbit IgG
(1
mg/ml), 5% normal goat serum, and 1% BSA were included in the protein block of
the
sections.
Example 1 Generation of Cmu targeted mice for the production of anti-PSMA
human antibodies
Construction of a CMD targeting vector: The plasmid pICEmu contains
an EcoRI/XhoI fragment of the marine Ig heavy chain locus, spanning the mu
gene, that
was obtained from a Balb/C genomic lambda phage library (Marcu et al. Cell 22:
187,
1980). This genomic fragment was subcloned into the XhoI/EcoRI sites of the
plasmid
pICEMI9H (Marsh et al; Gene 32, 481-485, 1984). The heavy chain sequences
included
in pICEmu extend downstream of the EcoRI site located just 3' of the mu
intronic
enhancer, to the XhoI site located approximately 1 kb downstream of the last
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
transmembrane exon of the mu gene; however, much of the mu switch repeat
region has
been deleted by passage in E. coli.
The targeting vector was constructed as follows. A 1.3 kb HindIII/SmaI
fragment was excised from pICEmu and subcloned into HindIII/SmaI digested
pBluescript (Stratagene, La Jolla, CA). This pICEmu fragment extends from the
HindIII
site located approximately 1 kb 5' of Cmul to the SmaI site located within
Cmul. The
resulting plasmid was digested with SmaI/SpeI and the approximately 4 kb
SmaI/XbaI
fragment from pICEmu, extending from the SmaI site in Cmul 3' to the XbaI site
located just downstream of the last Cmu exon, was inserted. The resulting
plasmid,
pTARI, was linearized at the SmaI site, and a neo expression cassette
inserted. This
cassette consists of the neo gene under the transcriptional control of the
mouse
phosphoglycerate kinase (pgk) promoter (XbaI/TaqI fragment; Adra et al. (1987)
Gene
60: 65-74) and containing the pgk polyadenylation site (PvuII/HindIII
fragment; Boer et
al. (1990) Biochemical Genetics 28: 299-308). This cassette was obtained from
the
plasmid pKJI (described by Tybulewicz et al. (1991) Cell 65: 1153-1163) from
which
the neo cassette was excised as an EcoRI/HindIII fragment and subcloned into
EcoRI/HindIII digested pGEM-7Zf (+) to generate pGEM-7 (KJ1). The neo cassette
was excised from pGEM-7 (KJ1) by EcoRI/SaII digestion, blunt ended and
subcloned
into the SmaI site of the plasmid pTARI, in the opposite orientation of the
genomic
Cmu sequences. The resulting plasmid was linearized with Not I, and a herpes
simplex
virus thymidine kinase (tk) cassette was inserted to allow for enrichment of
ES clones
bearing homologous recombinants, as described by Mansour et al. (1988) Nature
336:
348-352. This cassette consists of the coding sequences of the tk gene
bracketed by the
mouse pgk promoter and polyadenylation site, as described by Tybulewicz et al.
(1991)
Cell 65: 1153-1163. The resulting CMD targeting vector contains a total of
approximately 5.3 kb of homology to the heavy chain locus and is designed to
generate
a mutant mu gene into which has been inserted a neo expression cassette in the
unique
SmaI site of the first Cmu exon. The targeting vector was linearized with
PvuI, which
cuts within plasmid sequences, prior to electroporation into ES cells.
Generation and analysis of targeted ES cells: AB-1 ES cells (McMahon,
A. P. and Bradley, A., (1990) Cell 62: 1073-1085) were grown on mitotically
inactive
SNL76/7 cell feeder layers (ibid.) essentially as described (Robertson, E. J.
(1987) in
Teratocarcinomas and Embryonic Stem Cells: a Practical Approach (E. J.
Robertson,
71
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
ed.) Oxford: IRL Press, p. 71-112). The linearized CMD targeting vector was
electroporated into AB-1 cells by the methods described Hasty et al. (Hasty,
P. R. et al.
(1991) Nature 350: 243-246). Electroporated cells were plated into 100 mm
dishes at a
density of 1-2 x 106 cells/dish. After 24 hours, 6418 (200 micrograms/ml of
active
component) and FIAU (S x 10-7 M) were added to the medium, and drug-resistant
clones
were allowed to develop over 8-9 days. Clones were picked, trypsinized,
divided into
two portions, and further expanded. Half of the cells derived from each clone
were then
frozen and the other half analyzed for homologous recombination between vector
and
target sequences.
DNA analysis was carried out by Southern blot hybridization. DNA was
isolated from the clones as described Laird et al. (Laird, P. W. et al. , (
1991 ) Nucleic
Acids Res. 19 : 4293). Isolated genomic DNA was digested with SpeI and probed
with
a 915 by SacI fragment, probe A (see Figure 1 ), which hybridizes to a
sequence between
the mu intronic enhancer and the mu switch region. Probe A detects a 9.9 kb
SpeI
fragment from the wild type locus, and a diagnostic 7.6 kb band from a mu
locus which
has homologously recombined with the CMD targeting vector (the neo expression
cassette contains a SpeI site). Of 1132 6418 and FIAU resistant clones
screened by
Southern blot analysis, 3 displayed the 7.6 kb SpeI band indicative of
homologous
recombination at the mu locus. These 3 clones were further digested with the
enzymes
BgII, BstXI, and EcoR1 to verify that the vector integrated homologously into
the mu
gene. When hybridized with probe A, Southern blots of wild type DNA digested
with
BgII, BstXI, or EcoRI produce fragments of 15.7, 7.3, and 12.5 kb,
respectively,
whereas the presence of a targeted mu allele is indicated by fragments of 7.7,
6.6, and
14.3 kb, respectively. All 3 positive clones detected by the SpeI digest
showed the
expected BgII, BstXI, and EcoRI restriction fragments diagnostic of insertion
of the neo
cassette into the Cmul exon.
Generation of mice bearing the mutated mu gene: The three targeted ES
clones, designated number 264, 272, and 408, were thawed and injected into
C57BL/6J
blastocysts as described by Bradley (Bradley, A. (1987) in Teratocarcinomas
and
Embryonic Stem Cells: a Practical Approach. (E. J. Robertson, ed.) Oxford: IRL
Press,
p. 113-151). Injected blastocysts were transferred into the uteri of
pseudopregnant
females to generate chimeric mice representing a mixture of cells derived from
the input
ES cells and the host blastocyst. The extent of ES cell contribution to the
chimera can
72
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
be visually estimated by the amount of agouti coat coloration, derived from
the ES cell
line, on the black C57BL/6J background. Clones 272 and 408 produced only low
percentage chimeras (i. e. low percentage of agouti pigmentation) but clone
264
produced high percentage male chimeras. These chimeras were bred with C57BL/6J
females and agouti offspring were generated, indicative of germline
transmission of the
ES cell genome. Screening for the targeted mu gene was carried out by Southern
blot
analysis of BgII digested DNA from tail biopsies (as described above for
analysis of ES
cell DNA). Approximately 50% of the agouti offspring showed a hybridizing BgII
band
of 7.7 kb in addition to the wild type band of 15.7 kb, demonstrating a
germline
transmission of the targeted mu gene.
Analysis of transgenic mice for functional inactivation of mu gene: To
determine whether the insertion of the neo cassette into Cmul has inactivated
the Ig
heavy chain gene, a clone 264 chimera was bred with a mouse homozygous for the
JHD
mutation, which inactivates heavy chain expression as a result of deletion of
the JH gene
segments (Chen et al, (1993) Immunol. 5: 647-656). Four agouti offspring were
generated. Serum was obtained from these animals at the age of 1 month and
assayed
by ELISA for the presence of marine IgM. Two of the four offspring were
completely
lacking IgM (see Table 1 ). Genotyping of the four animals by Southern blot
analysis of
DNA from tail biopsies by BgII digestion and hybridization with probe A (see
Figure 1 ),
and by StuI digestion and hybridization with a 475 by EcoRI/StuI fragment
(ibid.)
demonstrated that the animals which fail to express serum IgM are those in
which one
allele of the heavy chain locus carries the JHD mutation, the other allele the
Cmu 1
mutation. Mice heterozygous for the JHD mutation display wild type levels of
serum Ig.
These data demonstrate that the Cmul mutation inactivates expression of the mu
gene.
TABLE 1
Mouse Serum IgM Ig H chain genotype
(micrograms/ml)
42 <0.002 CMD/JHD
43 196 +/JHD
44 <0.002 CMD/JHD
45 174 +/JHD
129 x BL6 F 1 153 +/+
JHD <0.002 JHD/JHD
73
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
Table 1 shows the levels of serum IgM, detected by ELISA, for mice carrying
both the
CMD and JHD mutations (CMD/JHD), for mice heterozygous for the JHD mutation
(+/JHD), for wild type (129Sv x C57BL/6J)F1 mice (+/+), and for B cell
deficient mice
homozygous for the JHD mutation (JHD/JHD).
Example 2 Generation of HC012 transgenic mice for the production of anti-
PSMA human antibodies
The HC012 human heavy chain transgene: The HC012 transgene was
generated by coinjection of the 80 kb insert of pHC2 (Taylor et al., 1994,
Int. Immunol.,
6: 579-591) and the 25 kb insert of pVx6. The plasmid pVx6 was constructed as
described below.
An 8.5 kb HindIII/SaII DNA fragment, comprising the germline human
VH1-18 (DP-14) gene together with approximately 2.5 kb of 5' flanking, and 5
kb of 3'
flanking genomic sequence was subcloned into the plasmid vector pSP72
(Promega,
Madison, WI) to generate the plasmid p343.7.16. A 7 kb BamHI/HindIII DNA
fragment, comprising the germline human VHS-51 (DP-73) gene together with
approximately 5 kb of 5' flanking and 1 kb of 3' flanking genomic sequence,
was cloned
into the pBR322 based plasmid cloning vector pGPlf (Taylor et al. 1992,
Nucleic Acids
Res. 20: 6287-6295), to generate the plasmid p251f. A new cloning vector
derived from
pGPlf, pGPlk, was digested with EcoRV/BamHI, and ligated to a 10 kb
EcoRV/BamHI
DNA fragment, comprising the germline human VH3-23 (DP47) gene together with
approximately 4 kb of 5' flanking and 5 kb of 3' flanking genomic sequence.
The
resulting plasmid, pl 12.2RR.7, was digested with BamHI/SaII and ligated with
the 7 kb
purified BamHI/SaII insert of p251f. The resulting plasmid, pVx4, was digested
with
XhoI and ligated with the 8.5 kb XhoI/SaII insert of p343.7.16.
A clone was obtained with the VH1-18 gene in the same orientation as the
other two V genes. This clone, designated pVx6, was then digested with NotI
and the
purified 26 kb insert coinjected (together with the purified 80 kb NotI insert
of pHC2 at
a 1:1 molar ratio) into the pronuclei of one-half day (C57BL/6J x DBA/2J)F2
embryos
as described by Hogan et al. (B. Hogan et al., Manipulating the Mouse Embryo,
A
Laboratory Manual, 2"d edition, 1994, Cold Spring Harbor Laboratory Press,
Plainview
74
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
NY). Three independent lines of transgenic mice comprising sequences from both
Vx6
and HC2 were established from mice that developed from the injected embryos.
These
lines are designated (HC012)14881, (HC012)15083, and (HC012)15087. Each of the
three lines were then bred with mice comprising the CMD mutation described in
Example 1, the JKD mutation (Chen et al. 1993, EMBO J. 12: 811-820), and the
(KCoS)9272 transgene (Fishwild et al. 1996, Nature Biotechnology 14: 845-851).
The
resulting mice express human immunoglobulin heavy and kappa light chain
transgenes
in a background homozygous for disruption of the endogenous mouse heavy and
kappa
light chain loci.
Example 3 Production of Human Monoclonal Antibodies and Bispecifics
Against PSMA
Anti en: Antigen (Northwest Biotherapeutics, Inc) was provided in two
forms: (1) cell membranes and (2) purified protein (PSMA) isolated from LNCaP
cells
(Cat#CRL-1740; American Type Culture Collection, Rockville, MD). With purified
antigen (1.05 mg/ml), one immunization and the final tail vein boosts v~ere
performed.
The mcnoclonal antibody 7E11.C5 was obtained from Cytogen, Inc, Princeton, NJ.
Soluble PSMA and membranes from LNCaP cells were mixed with
either complete or incomplete Freunds adjuvant (CFA and IFA). Mice were
injected with 0.2cc prepared antigen into the intraperitoneal cavity. Final
tail vein immunizations were performed with soluble PSMA in sterile
PBS.
Transgenic Mice: Mice were housed in filter cages and were evaluated to
be in good physical condition on dates of immunization, bleeds and the day of
the
fusion. Hybridomas 4A3, 7F12, 8A11, 8C12, and 16F9 were produced by a male
mouse
ID#17018 ofthe (CMD)++; (HCol2) 15087+; (JKD)++; (KCoS) 9272+
genotype. Individual transgene designations are in parentheses, followed
by line numbers for randomly integrated transgenes. The symbols ++ and
+ indicate homozygous or hemizygous; however, because the mice are
routinely screened using a PCR-based assay that does not allow distinction
between
heterozygosity and homozygosity for the randomly integrated human Ig
transgenes, a +
designation may be given to mice that are actually homozygous for these
elements.
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
Immunization Procedure: The immunization schedule is listed in Table
2. Mouse #17018 was fused on Day 112 included among a cohort of ten mice from
HCo7 and HCol2 genotypes. All immunizations were injected into the
intraperitoneal
cavity. Three and two days prior to fusion, IV boosts were performed.
TABLE 2
Date of activityImmunization: adjuvant, Bleed and titer*
antigen
Day 1 CFA, membranes
Day 13 IFA, PSMA (~ 50~g)
Day 27 IFA, membranes
Day 38 Titer
Day 40 IFA, PSMA (~ 50~g)
Day 48 Titer
Day 55 IFA, PSMA (50~g)
Day 62 Titer _
Day 70 IFA, membranes
Day 80 Titer
Day 84 IFA, membranes
Day 94 Titer
IV boost day - 3 & day
- 2 prior to
fusion. Fusion performed
Day 112
*f'or titers, see 'fable 3.
Hybridoma Preparation: The P3 X63 ag8.653 myeloma cell line (ATCC
CRL 1580, lot F-15183) was used for the fusions. The original ATCC vial was
thawed
and expanded in culture. A seed stock of frozen vials was prepared from this
expansion.
Cells are maintained in culture for 3-6 months, passed twice a week. P388D1
(ATCC
TIB-63 FL) was expanded to 200mLs and exhausted. The supernatant was spun and
filtered and used as a media addition for the hybridomas. This cell line is
passed for 3-6
months when a new vial is thawed.
High Glucose DMEM: (Mediatech Cellgro, # 1001233) containing 10%
FBS and Penicillin-Streptomycin (Gibco, #11K1763), was used to culture P388D1
cells
and myeloma cells. Additional media supplements were added to the Hybridoma
growth
media.
76
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
The spleen from mouse number #17018 was normal in size and yielded
1.78 x 10g viable cells. The splenocytes were fused.
The initial ELISA screen for human IgG,x antibodies was performed 7-
days post fusion. Human IgG,K positive wells were then screened on soluble
PSMA
5 coated ELISA plates. Antigen positive hybridomas were then transferred to 24
well
plates, and eventually to tissue pulture flasks. PSMA specific hybridomas were
subcloned by limiting dilution to assure monoclonality. Antigen positive
hybridomas
were preserved at several stages in the development process by freezing cells
in DMEM,
50% FBS plus 10% DMSO (Sigma, D2650).
10 The titers for mouse #17018 are shown below in the table. The titers are
Hu- antigen specific-y. The response to the antigen after repeated
immunizations show
a robust response level and the mouse was prepared for fusion.
TABLE 3
Date Titer
Day 38 100
Day 48 50
Day 62 50
Day 80 1600
Day 94 3200
The fusion resulted in 38 Hu-y,x hybridomas that were re-screened on antigen.
Following the screen on antigen (ELISA based) five antigen specific hybridomas
were
identified. These were retested on antigen and all five clones were confirmed
positive
for the target: 4A3, 7F12, 8A1 l, 8C12 and 16F9. Supernatants of these five
hybridomas
were further evaluated. Antibodies from these five clones bound to the native
form of
PSMA expressed on LNCaP cells. All five antibodies are yl,K isotype.
The bispecific molecule designated 14A8 x 8C12 was made by chemical
conjugation of the Fab'2 fragments from the human anti-CD89 antibody 14A8 or a
subclone of the 14A8 antibody, designated 14A8, and the human anti-PSMA
antibody,
8C12, via disulfide bonds using standard cross-linking procedures (Figure 6).
77
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
Example 4 Binding Characteristics of Human anti-PSMA Antibodies
Solid phase ELISA studies: Binding characteristics of anti-PSMA
specific antibodies were studied by comparing reactivities (solid phase ELISA)
against
full length PSMA and bacterially expressed fusion proteins containing portions
of the
PSMA protein. HuMAbs 4A3, 7F12, 8A11, 8C12, and 16F9 reacted with purified
PSMA but were unreactive with any fusion protein containing a portion of the
PSMA
sequence (results not shown). In contrast, the HuMAb 11 C 10 reacted strongly
with both
full length PSMA and the fusion protein containing the PSMA amino acid 1-173
sequence (Figure 1 ). A lower level of binding of the 11 C 10 antibody was
also observed
to the amino acid 134-437 PSMA fragment.
Binding characteristics of human anti-PSMA specific antibodies were
also studied by solid phase ELISA using plasma membrane fractions derived from
both
LNCaP and PC3 cells. Membrane fractions were serially diluted in 96-well
plates and
air dried. The plates were blocked with 5% BSA and treated with 5 p,g/ml
antibody in
PBS for one hour prior to detection using standard ELISA procedures.
The results presented in Figure 2 show results for HuMAbs 4A3, 7F 12,
8A11, 8C12, and 16F9 demonstrate high specificity for LNCaP cell membranes
over a
range of antigen concentrations. Little or no antibody binding above
background was
observed to PC3 cell membranes. Bispecific molecule 14A8 x 8C12 was also
tested for
the ability to bind to PSMA-expressing LNCaP cells and CD89-expressing U937
cells
using similar assays. The bispecific molecule binds both LNCaP and U937 cells
in a
dose-dependent fashion.
The ELISA results with native PSMA and bacterially expressed PSMA
fusion protein fragments show that all of the HuMAbs, except 11 C 10, are
specific for
PSMA when present in a native conformation. To confirm this observation,
antibody
binding to native and heat denatured PSMA was tested to determine the
importance of
protein conformation on binding specificity. Figure 3 shows results from a
solid phase ELISA with native and heat denatured PSMA. The marine anti-PSMA
monoclonal antibody 7E11, specific for an epitope composed of the first six
amino acids
from the N-terminal of the protein, was used as a positive control. The
results indicate
that heat denaturation has no impact on 7E11 binding, consistent with its
recognition of
a linear sequence epitope. In contrast to these results, antibodies 4A3, 7F12,
8A1 l,
78
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
8C12, and 16F9 all strongly bound to native purified PSMA. However, heat
denaturation of PSMA virtually abolished antibody binding indicating a native
protein
conformation is required for antibody binding. Consistent with this result,
antibodies
4A3, 7F12, 8A11, 8C12, and 16F9 were ineffective in detecting PSMA in a
Western
blot analysis (results not shown).
Accordingly, HuMAbs 4A3, 7F12, 8A11, 8C12, and 16F9 do not
recognize linear amino acid sequence epitopes but instead bind to protein
conformational epitopes, i. e., native protein epitopes resulting from
conformational
folding of the PSMA molecules which arise when amino acids from differing
portions of
the linear sequence come together in close proximity in 3-dimensional space.
Such
conformational epitopes are distributed on the extracellular side of the
plasma
membrane.
Immunoprecipitation of PSMA from LNCaP Cells: The binding
specificity of antibodies 4A3, 7F12, 8A11, 8C12, and 16F9 was studied by
immunoprecipitation of protein derived from a 1% NP-40 detergent lysate of
LNCaP
cells. The lysate was treated with antibody followed by addition of Protein G-
Sepharose
beads. The beads were washed extensively and the bound immune complex
subjected to
SDS gel electrophoresis and Western blotting with the murine linear PSMA
sequence
epitope specific antibody 4D8. The results are shown in Figure 4. Lane 1 shows
Western blot reactivity of PSMA and PSM' (an alternate splice variant missing
the first
57 amino acids from the N-terminal) present in LNCaP cell lysate. Lane 2 shows
results
from immunoprecipitation with an isotype matched (IgGI) irrelevant human
antibody.
Lanes 3 through 7 show results from immunoprecipitation with antibodies 4A3,
7F12,
8A11, 8C12, and 16F9, respectively. In each case, intense bands corresponding
to both
PSMA and PSM' are observed indicating these antibodies bind to protein
epitopes
present within the extracellular domain of the protein.
HuMAb binding to PSMA expressed on live LNCaP cells: Antibody
binding to viable and non-viable (fixed) LNCaP cells was studied by flow
cytometry
using irrelevant human IgGI antibody as a control. Viable cells are a
propidium iodide
negative cell population. Fixed cells were treated with 1% paraformaldehyde in
PBS
prior to primary antibody treatment. Strong binding of antibodies 4A3, 7F12,
8A11,
8C 12, and 16F9 was observed to both live and fixed LNCaP cells. Negative
staining
79
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
was observed with PC3. cells or when an isotype matched irrelevant human
antibody was
used with LNCaP cells.
By comparison, antibody binding results with marine linear epitope-
specific antibodies using the same preparation of viable and fixed cells and
irrelevant
marine antibody control demonstrated significantly lower binding to live
cells. Binding
to fixed cells was higher, however, no linear epitope antibody was comparable
under
any condition to the binding observed with conformational HuMAbs found using
irrelevant human IgGI antibody as a control. No binding of either marine or
human
conformational or linear epitope antibodies was detected in experiments using
PSMA
negative PC3 cells (results not shown).
Accordingly, HuMAbs exhibit strong antibody binding to live LNCaP
cells and bind to an epitope related to that bound by the marine
conformational antibody
3C6.
FACS analysis of antibody binding competition: Antibody binding
competition studies were conducted to address whether each antibody bound to a
similar
or distinct epitope on PSMA. In these experiments, LNCaP cells were first
treated with
either irrelevant human IgG,, or PSMA-specific HuMAbs, extensively washed, and
labeled with FITC-labeled individual HuMAbs prior to analysis by flow
cytometry. The
ability of unlabeled HuMAbs to block binding of FITC-labeled HuMAb was tested.
Strong binding of FITC-labeled antibody was found in each case with cells pre-
treated
with irrelevant human IgG,. In contrast, pretreatment with anti-PSMA specific
HuMAbs gave rise to substantial inhibition of FITC-labeled antibody binding in
each
case. Taken together, the data shows the competitive binding behavior of 7F 12
and
16F9 with the other HuMAbs are most similar. Slight variations in extents of
binding
inhibition are seen with differing antibody pairings. For example, 8C12
effectively
inhibits 4A3, 8A 11, and 8C 12 binding but has much less of an effect on 7F
12. Overall,
slightly different, but closely distributed conformational epitopes are
recognized by
these antibodies.
HuMAb binding competition with marine PSMA conformational
antibodies: Marine PSMA-specific antibodies designated 1 G9, 3C6, and 4D4 were
developed which are also directed toward protein conformational epitopes.
Antibody
competition studies, as measured by flow cytometry, were conducted with
antibodies
1 G9, 3C6, and 4D4 to determine if the HuMAbs recognize epitopes in common
with the
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
marine antibodies. The ability of unlabeled HuMAbs to block binding of FITC-
labeled
1G9, 3C6, and 4D4 was tested. Pretreatment of LNCaP cells with HuMAbs,
followed
by labeling with FITC-marine 4D4 and 1 G9, indicated similar results with
little or no
apparent inhibition. In contrast, significant inhibition of FITC-3C6 was
observed by
HuMAbs 4A3, 7F12, 8A11, 8C12, and 16F9 indicating each binds to a similar or
closely
distributed epitope as recognized by 3C6.
Binding affinity of conformational HuMAbs to PSMA on LNCaP cells:
PSMA HuMAbs are highly sensitive to the native conformation of PSMA. Numerous
experiments to determine affinity constants using purified PSMA failed to
provide
reliable or reproducible results. Experiments were conducted to obtain some
affinity
binding information from native PSMA as expressed in viable LNCaP cells. To
test the
binding affinity of each antibody to native PSMA, a flow cytometric assay was
used in
which the primary antibody concentration was varied for a fixed number of
LNCaP cells
(1 x 106) with excess FITC-labeled secondary antibody. The data in Table 4
shows
results expressed as the antibody concentration required to give half maximal
shift in
cell labeling intensity. These results demonstrate that the highest binding
affinities were
found with antibodies 4A3, 7F12, and 16F9. Antibody 8C12 had about a 3-fold
lower
binding affinity followed by antibody 8A11 with a binding affinity
approximately 20-
fold lower than the high affinity antibodies.
TABLE 4
Antibody Antibody Required
for
'/Z Maximal Shift
(p/ml)
7F12 7
4A3 9
16F9 10
8C12 28
8Al 1 195
81
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
Example 5 ADCC and CDC activity of Human anti-PSMA Antibodies
and Bispecifics
I. Antibody dependent cell-mediated cytotoxicity (ADCC) activity of
human anti-PSMA antibodies: The ability of anti-PSMA HuMAbs to mediate
antibody
dependent cellular cytotoxicity (ADCC) or complement dependent cytotoxicity
(CDC)
was tested for each conformational antibody described in the examples above in
experiments using PBMC's from two donors. The results shown in Figure SA and B
indicate strong ADCC for each HuMAb. Each HuMAb has similar titer and has
reactivity similar to Herceptin as a positive control (Figure SB). No CDC
activity was
observed for any HuMAb (data not shown),
II. Antibody dependent cell-mediated cytotoxicity (ADCC) activity of
human anti-PSMA bispecific antibodies: Bispecific molecule 14A8 x 8C12 (shown
in
Figure 6) and the monoclonal antibody 8C12 were tested for polymorphonuclear
cell-
mediated ADCC killing of labeled PSMA-expressing tumor cells.
In particular, mononuclear cells (monocytes and neutrophils), as well as
whole blood, were isolated from healthy donors and incubated with SICr labeled
PSMA
expressing tumor cells in the presence of bispecific molecule 14A8 x 8C 12.
After
approximately 4 hours, the culture supernatant from the wells was harvested
and 5 ~ Cr
release measured on a gamma counter. The percent specific lysis was determined
according the following formula: (experimental CPM - target leak
CPM)/(detergent
lysis CPM - target leak CPM) X 100%. The results, shown in Figures 7A, 8A and
9A,
demonstrate that 14A8 x 8C12 mediates dose dependent lysis of tumor cells by
monocytes and neutrophils and whole blood, respectively, as compared to a
control
antibody.
Mononuclear cells and whole blood were also incubated with 5 ~ Cr
labeled LNCaP tumor cells in the presence of either bispecific molecule 14A8 x
8C12 or
monoclonal antibody 8C12 (Figures 7B, 7C, 8B and 9B). LNCaP cells were labeled
with 100 pCi of S~Cr for 1 hour at 37°C (5% C02) prior to incubation
with mononuclear
cells and whole blood, along with various concentrations of bispecific or
monoclonal
antibody. After an incubation of 16 hours, the supernatant was harvested and
analyzed
for radioactivity as described above.
82
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
Monocyte Induced ADCC: As shown in Figure 7A, bispecific molecule
14A8 X 8C12 mediated cell killing of tumor cells expressing PSMA by monocytes
in a
dose dependent fashion. Addition of 50 ~g/ml of 14A8 Fab'Z completely blocked
ADCC of the tumor cells by 1 ~g/ml of the bispecific molecule 14A8 X 8C 12,
demonstrating that targeted cell killing was mediated exclusively by CD89 on
the
effector cells. As shown in Figure 7B, bispecific molecule 14A8 x 8C12 and
monoclonal antibody 8C 12 also mediated dose dependent lysis by monocytes of
LNCaP
tumor cells. Moreover, the addition of excess 14A8 F(ab)'2 completely
inhibited ADCC
of the tumor cells by bispecific molecule 14A8 x 8C 12 as compared to H22
F(ab)'2
(humanized anti-FcyRI), indicating that targeted cell killing was mediated
through CD89
(see Figure 7C).
Neutrophil Induced ADCC: As shown in Figure 8A, bispecific molecule
14A8 X 8C12 mediated cell killing of tumor cells expressing PSMA by
neutrophils in a
dose dependent fashion. Addition of 25 ~g/ml of 14A8 Fab'2 significantly
blocked
1 S ADCC of the tumor cells by the bispecific molecule, demonstrating that
targeted cell
killing was mediated specifically by CD89 binding to the effector cells. As
shown in
Figure 8B, bispecific molecule 14A8 x 8C 12 also mediated dose dependent lysis
by
neutrophils of LNCaP tumor cells. The addition of excess 14A8 F(ab)'2
completely
inhibited ADCC of the tumor cells by 14A8 x 8C12 as compared to H22 F(ab)'2
(humanized anti-FcyRI), indicating that targeted cell killing was mediated
through
CD89.
Whole Blood Induced ADCC: As shown in Figure 9A, bispecific
molecule 14A8 X 8C12 mediated cell killing of tumor cells expressing PSMA by
whole-
blood in a dose dependent fashion. Addition of 25 pg/ml of 14A8 Fab'2
significantly
blocked ADCC of the tumor cells by the bispecific molecule, again
demonstrating that
targeted cell killing was mediated specifically by CD89 binding to the
effector cells.
Similarly, as shown in Figure 9B, bispecific molecule 14A8 x 8C12 also
mediated dose
dependent lysis by whole blood of LNCaP tumor cells. The addition of excess
14A8
F(ab)'2 completely inhibited ADCC of the tumor cells by 14A8 x 8C 12 as
compared to
H22 F(ab)'2 (humanized anti-FcyRI), indicating that targeted cell killing was
mediated
through CD89.
83
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
III. Human anti-PSMA antibodies and bispecific antibodies mediate
phagocytosis and killing of tumor cells expressing PSMA in the presence of
human
effector cells: Bispecific molecule 14A8 x 8C12 and the monoclonal antibody
8C12
were tested for their ability to mediate phagocytosis of labeled PSMA-
expressing tumor
cells (LNCaP cells) alone, as well as in the presence of excess 14A8 (human
anti-FcaR)
Fab'2 antibody or excess H22 (humanized anti-FcyRI) Fab'2 antibody as a
control.
Briefly, bispecific-mediated phagocytosis of LNCaP cells by monocyte
derived macrophages (MDM) was examined by a modification of the method
described
Munn et al. (1990) J. Exp. Med. 172:231-237. Monocytes, purified from normal
adult
source leukopacs (ABI), were differentiated in 24-well plates (1 x 106/ml) in
macrophage serum free medium (Gibco, Grand Island, NY) supplemented with 10%
FBS and lOng/ml of M-CSF for 7-12 days. LNCaP cells were labeled with the
lipophilic red fluorescent dye, PKH 26 (Sigma, St. Louis, MO). The labeled
LNCaP
cells were added to the wells containing MDM in the absence or presence of
bispecific
antibody (or control antibody) and incubated at 37° C for 5-24 hours
(5% C02). MDM
and non-phagocytized LNCaP cells were recovered with trypsin, and stained with
a
FITC-labeled anti-CD33 mAb (251) and an anti-CD14 mAb (AML-2-23) for 1 hour on
ice (4°C). Cells were washed and analyzed by two color fluorescence
using the
FACScan. Percent phagocytosis was calculated as the number of dual-positive
target
20. cells (ingested by MDM) divided by the total number of target cells x
100%.
As shown in Figure 10, bispecific molecule 14A8 x 8C12 mediated
increasing specific phagocytosis of tumor cells in a dose-dependent fashion.
Addition of
14A8 Fab'2 significantly blocked phagocytosis of the tumor cells by the
bispecific
molecule, again demonstrating that targeted phagocytosis was mediated
specifically by
CD89 binding to the effector cells. Similarly, as shown in Figure 11,
bispecific
molecule 14A8 x 8C12 and monoclonal antibody 8C12 also mediated phagocytosis
of
LNCaP cells in a dose dependent fashion. Figure 12 shows that 14A8 x 8C12
mediated
phagocytosis of LNCaP tumor cells was mediated through CD89, as it was
inhibited by
the addition of excess 14A8 F(ab)'2, as compared to H22 F(ab)'2 (humanized
anti-FcyRI)
(see inset, Figure 12).
The foregoing Examples demonstrate the generation of human
monoclonal antibodies and bispecifics that specifically react with high
affinity to
PSMA. These antibodies and bispecifics recognize native conformational protein
84
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
epitopes present in the extracellular domain of the molecule, rather than
epitopes defined
by a linear amino acid sequence. In addition, the human anti-PSMA antibodies
and
bispecific molecules thereof mediate cell killing and phagocytosis in the
presence of
effector cells against human tumor cells expressing high levels of PSMA.
Example 6 Biodistribution of l2sl-labeled Human anti-PSMA Antibodies to
LNCaP Cell'fumors in Nude Mice
Biodistribution of l2sl-Tabled HuMAb in nude mice bearing LNCaP cell
tumors was tested by following time-dependent uptake of labeled antibody into
normal
and tumor tissues. Results were obtained for two HuMAbs, 4A3 and 7F 12.
Antibody
7F 12 was used initially based upon binding affinity studies and availability
of adequate
antibody protein. Subsequent experiments, however, demonstrated that
iodination of
7F 12 virtually abolished the ability of this antibody to bind antigen. Thus,
useful data
was obtained only for 4A3. The results for 4A3 are shown in Figure 13 and
indicate that
the labeled antibody is initially predominantly in blood and highly
vascularized tissues.
This diminishes as tumor uptake occurs and tumor labeling is highest compared
to
normal tissues (2-fold or greater labeling compared to normal tissues) after
24 hours.
Thus, significant biodistribution to tumor tissue occurs. The extent of tumor
labeling
with time after uptake may be, in part, a function of diminished levels of
circulating
antibody and antibody internalization of bound antibody with the resultant
release from
the cell of labeled antibody protein fragments.
Example 7 Analysis of Internalization of lxsl-labeled Human anti-PSMA
Antibodies by LNCaP Cells
Internalization of ~2sI-labeled HuMAb protein was monitored by
analyzing the time-dependent release into the culture supernatant of TCA
soluble l2sl
counts. LNCaP cells, surface labeled with iodinated antibody, were incubated
at 37°C
and the culture supernate removed, TCA precipitated, and the amount of ~zsl
label
present in the supernatant fraction determined at the times shown in Figure
14. The
results indicate that iodinated antibodies 4A3, 16F9, and 8A11 effectively
labeled
LNCaP cells at zero time and were efficiently internalized into the cells,
degraded, and
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
protein fragments released into the culture supernatant. Approximately 50% of
the
originally bound antibody was recovered in a TCA soluble fraction after an 18
hour
incubation period with each of these antibodies.
Differing cell binding and internalization results were obtained for
iodinated HuMAbs 7F 12 and 8C 12. In particular, significantly lower total
LNCaP cell
labeling was found using iodinated 7F 12 and 8C 12 antibodies suggesting
iodination
may have an impact on the ability of the labeled antibodies to bind antigen.
To test this
hypothesis, a solid phase binding assay was conducted using immobilized native
purified LNCaP cell PSMA and iodinated HuMAb. The results shown in Figure 15
confirm binding of the positive control iodinated 4A3 antibody to PSMA and
also
demonstrate that iodination abolished the ability of both 7F 12 and 8C 12 to
bind antigen.
Thus, internalization rates for antibodies 7F12 and 8C12 cannot be assessed
using lzsl-
labeled 7F12 and 8C12 antibodies.
Example 8 Effect of DOTA Labeling of HuMAbs 4A3 and 7F12 on Binding to
PSMA
Antibodies were DOTA-labeled and the effect on antibody binding to
antigen tested by ELISA. DOTA (tetraazacyclododecanetetraacidic acid) is a
common
chelator which can be used for complexing radionuclides. The results in Figure
16
demonstrate that DOTA-labeled antibodies retain high antigen binding
capability
indicating these antibodies will be useful in forming radiometal chelates.
Example 9 Tissue Reactivity of Human anti-PSMA Antibodies binding to
Normal and Malignant Human Tissues by Immunohistochemistry
Immunohistochemical analysis of the binding of five HuMAbs specific
for conformational epitopes present in PSMA was applied to a cross reactivity
screen
with frozen sections of normal and malignant human tissues. The results from a
single
specimen of each tissue type demonstrate strong binding to prostatic
epithelium and
tumor vascular endothelium of non-prostatic malignancies or of normal tissues.
No
staining of vascular endothelium within prostatic cancer was observed. Other
weaker
reactivity was observed including varying reactivity of glandular epithelium
from non-
86
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
neoplastic tissues, potential cross reactivity in brain tissues, and staining
of lymphocytes
of the jejunum and Kuppfer cells in the liver. There is some question
concerning non-
prostatic staining results given that some of these "normal" tissues were
obtained from
the same donor that showed strong tumor vascular staining from adjacent or
nearby
S tumors. Lymphocyte staining may be due to antigen uptake from the primary
tumor.
Other tissues and elements were negative with these antibodies. No significant
differences were observed in tissue reactivity via IHC between the five HuMAbs
tested.
Example 10 Binding Affinity
Binding affinity of anti-PSMA HuMAbs was determined using flow
cytometry with LNCaP cells wherein the HuMAb was diluted out over a series of
tubes
of cells. The amount of antibody bound was detected using an FITC-labeled
secondary
antibody present in saturating amounts. The data, analyzed as the amount of
antibody
protein required for '/z maximal shift (the shift seen with saturating HuMAb),
was as
follows:
TABLE 5
Antibody Antibody Required for'/Z Maximal Shift
(N,/ml)
7F12 7
4A3 9
16F9 10
8C12 28
8A11 195
Further affinity studies on HuMAbs 4A3 and 7F12 utilized radiolabeled
antibody (~ 1'In-DOTA-labeled antibody) and binding to a fixed number of LNCaP
cells.
Scatchard analysis was performed with the resulting antibody binding data. The
results
for both antibodies (4A3 and 7F 12) demonstrated similar affinity constants
with a KD=
0.5 t 0.1 nM or 10-1° M).
87
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
Example 11 V region cloning
PolyA+ mRNA and first strand cDNA were prepared from the anti-
PSMA hybridomas utilizing mRNA isolation and cDNA synthesis kits (Invitrogen,
Carlsbad, CA). The 4A3, 7F12 and 8C12 V regions were amplified by polymerase
chain reaction (PCR) utilizing a panel of 5' primers that correspond to human
VH and VL
(or VK) signal sequences. The 8A11 and 16F9 V regions were amplified using
primers
that bind to the 5' end of the mature V region sequences in framework 1. The
3' VH and
VK PCR primers contained the following sequences, respectively:
TGCCAGGGGGAAGACCGATGG (SEQ ID NO: 57) and
CGGGAAGATGAAGACAGATG (SEQ ID NO: 58). The PCR, cloning and
sequencing were performed in duplicate in order to monitor for potential PCR-
introduced changes in the sequences.
I S Conclusion
The foregoing examples demonstrate the production of five fully human
monoclonal antibodies specific for conformational epitopes on human PSMA, as
well as
therapeutic bispecific agents containing the antibodies. All five antibodies
had high
antigen specificity and reactivity with native, but not denatured, PSMA. The
antibodies
are efficiently internalized into PSMA expressing cells, have strong antibody-
dependent
cell mediated cytotoxicity (ADCC) activity, bio-distribute to PSMA expressing
tumors
in animal models and have similar performance in immuno-histochemical studies
of
human tissues, supporting their therapeutic and diagnostic utility in human
treatment.
Equivalents
Those skilled in the art will recognize, or be able to ascertain using no
more than routine experimentation, many equivalents of the specific
embodiments of the
invention described herein. Such equivalents are intended to be encompassed by
the
following claims.
Incorporation by Reference
All patents, pending patent applications and other publications cited
herein are hereby incorporated by reference in their entirety.
88
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
1
SEQUENCE LISTING
<110> Medarex, Inc. et al.
<120> HUMAN MONOCLONAL ANTIBODIES TO PROSTATE
SPECIFIC MEMBRANE ANTIGEN (PSMA)
<130> MXI-163CPPC
<150> 10/059989
<151> 2002-Ol-28
<150> PCT/US00/20247
<151> 2000-07-26
<150> 60/146285
<151> 1999-07-29
<150> 60/158759
<151> 1999-10-12
<150> 60/188087
<151> 2000-03-09
<160> 58
<170> FastSEQ for Windows Version 4.0
<210> 1
<211> 357
<212> DNA
<213> Homo Sapiens
<400> 1
gaggtgcagt tggtgcagtc tggagcagag gtgaaaaagc ccggggagtc tctgaagatc 60
tcctgtaagg gttctggata cagttttacc agctactgga tcggctgggc gcgccagatg 120
cccgggaaag gcctggagtg gatggggatc atctatcctg gtgactctga taccagatac 180
agcccgtcct tccaaggcca ggtcaccatc tcagccgaca agtccatcag caccgcctac 240
ctgcagtgga gcagcctgaa ggcctcggac accgccatgt attactgttc ggccgctaat 300
tcttctcact ggtacttcga tctctggggc cgtggcaccc tggtcactgt ctcctca 357
<210> 2
<211> 325
<212> DNA
<213> Homo Sapiens
<400> 2
gaaattgtgt tgacacagtc tccagccacc ctgtctttgt ctccagggga aagagccacc 60
ctctcctgca gggccagtca gagtgttagc agctacttag cctggttcca acagaaacct 120
ggccaggctc ccaggctcct catctatgat gcatccaaca gggccactgg catcccagcc 180
aggttcagtg gcagtgggtc tgggacagac ttcactctca ccatcagcag cctagagcct 240
gaagattttg cagtttatta ctgtcagcag cgtagcaact ggctcatgta cacttttggc 300
caggggacca agctggagat caaac 325
<210> 3
<211> 357
<212> DNA
<213> Homo Sapiens
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
2
<400> 3
caggtgcagc tgcaggagtc tggagcagag gtgaaaaagc ccggggagtc tctgaagatc 60
tcctgtaagg gttctggata tagttttacc agcttctgga tcggctgggc gcgccagatg 120
cccgggaaag gcctggagtg gatggggatc atctatcctg gtgactctga taccagatac 180
agcccgtcct tccaaggcca ggtcaccatc tcagccgaca agtccatcag caccgcctac 240
ctgcagtgga gtagcctgaa ggcctcggac accgccatgt attactgtgc gaccgctaac 300
tcctctttct ggaatttcga tctctggggc cgtggcaccc tggtcactgt ctcctca 357
<210> 4
<211> 325
<212> DNA
<213> Homo sapiens
<400> 4
gaaattgtgt tgacacagtc tccagccacc ctgtctttgt ctccagggga aagagccacc 60
ctctcctgca gggccagtca gagtgttagc agctacttag cctggtacca acagaaacct 120
ggccaggctc ccaggctcct catctatgat gcatccaaca gggccactgg catcccagcc 180
aggttcagtg gcagtgggtc tgggacagac ttcactctca ccatcagcag cctagagcct 240
gaagattttg cagtttatta ctgtcagcag cgtagcaact ggctcatgta cacttttggc 300
caggggacca agctggagat caaac 325
<210> 5
<211> 357
<212> DNA
<213> Homo sapiens
<400> 5
gaggtgcagc tggtgcagtc tggagcagag gtgaaaacgc ccggggagtc tctgaagatc 60
tcctgtaagg gctctggata cacctttacc agctactgga tcggctgggt gcgccagatg 120
cccgggaaag gcccggagtg gatggggatc atctatcctg gtgactctga taccagatac 180
agcccgtcct tccaaggcca ggtcaccttc tcagccgaca agtccatcag caccgcctac 240
ctgcagtgga acagcctgaa gacctcggac accgccatgt attactgtgc gaccgctaac 300
ccctcttatt ggtatttcga tctctggggc cgtggcaccc tggtcactgt ctcctca 357
<210> 6
<211> 325
<212> DNA
<213> Homo sapiens
<400> 6
gaaattgtgt tgacacagtc tccagccacc ctgtctttgt ctccagggga aagagccacc 60
ctctcctgca gggccagtca gagtgttagc agctacttag cctggtacca acagaaacct 120
ggccaggctc ccaggctcct catctatgat gcatccaaca gggccactgg catcccagcc 180
aggttcagtg gcagtgggtc tgggacagac ttcactctca ccatcagcag cctagagcct 240
gaagattttg cagtttatta ctgtcagcag cgtagcgact ggctcatgta cacttttggc 300
caggggacca agctggagat caaac 325
<210> 7
<211> 341
<212> DNA
<213> Homo sapiens
<400> 7
agtctggagc agaggtgaaa acgcccgggg agtctctgaa gatctcctgt aagggctctg 60
gatacacctt taccaactac tggatcggct gggtgcgcca gatgcccggg aaaggcccgg 120
agtggatggg gatcatctat cctggtgact ctgataccag atacagcccg tccttccaag 180
gccaggtcac cttctcagcc gacaagtcca tcagcaccgc ctacctgcag tggagcagcc 240
tgaagacctc ggacaccgcc atgtattact gtgcgaccgc taacccctct tattggtatt 300
tcgatctctg gggccgtggc accctggtca ctgtctcctc a 341
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
3
<210> 8
<211> 302
<212> DNA
<213> Homo sapiens
<400> 8
tccatcctcc ctgtctgcat ctgtaggaga cagcgtcacc atcacttgcc gggtgagtca 60
gggcattagc agttatttaa attggtatcg gcagaaacca gggaaagttc ctaagctcct 120
gatctatagt gcatccaatt tgcaacctgg agtcccatct cggttcagtg gcagtggatc 180
tgggacagat ttcactctca ctatcaacag cctgcagcct gaagatgttg caacttatta 240
cggtcaacgg acttacaatg ccccattcac tttcggccct gggaccaaag tggatatcaa 300
ac 302
<210> 9
<211> 341
<212> DNA
<213> Homo Sapiens
<400> 9
agtctggagc agaactgaaa aagcccgggg agtctctgaa gatctcctgt aagggttctg 60
gatacagttt taccaactac tggatcggct gggcgcgcca gatgcccggg aaaggcctgg 120
agtggatggg gatcatctat cctggtgact ctgataccag atacagtccg tccttccaag 180
gccaggtcac catctctgcc gacaagtccg tcagcaccgc ctacctgcag tggaacagtc 240
tgaaggcctc ggacaccgcc atgtattact gtgcgaccgc taactcctct ttctggaact 300
tcgatctctg gggccgtggc accctggtca ctgtctcctc a 341
<210> 10
<211> 302
<212> DNA
<213> Homo Sapiens
<400> 10
tccatcctcc ctgtctgcat ctgtaggaga cagagtcacc atcacttgcc gggtgagtca 60
gggcattagc agttatttaa attggtatcg gcagaaacca gggaaagttc ctaagctcct 120
gatgtatagt gcatccaatt tgcaatctgg agtcccatct cggttcagtg gcagtggatc 180
tgggacagat ttcactctca ctatcagcag cctgcagcct gaagatgttg caacttatta 240
cggtcaacgg acttacaatg ccccattcac tttcggccct gggaccaaag tggatatcaa 300
ac 302
<210> 11
<211> 119
<212> PRT
<213> Homo Sapiens
<400> 11
Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Glu
1 5 10 15
Ser Leu Lys Ile Ser Cys Lys Gly Ser Gly Tyr Ser Phe Thr Ser Tyr
20 25 30
Trp Ile Gly Trp Ala Arg Gln Met Pro Gly Lys Gly Leu Glu Trp Met
35 40 45
Gly Ile Ile Tyr Pro Gly Asp Ser Asp Thr Arg Tyr Ser Pro Ser Phe
50 55 60
Gln Gly Gln Val Thr Ile Ser Ala Asp Lys Ser Ile Ser Thr Ala Tyr
65 70 75 80
Leu Gln Trp Ser Ser Leu Lys Ala Ser Asp Thr Ala Met Tyr Tyr Cys
85 90 95
Ser Ala Ala Asn Ser Ser His Trp Tyr Phe Asp Leu Trp Gly Arg Gly
100 105 110
Thr Leu Val Thr Val Ser Ser
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
4
115
<210> 12
<211> 119
<212> PRT
<213> Homo Sapiens
<400> 12
Ala Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Glu
1 5 10 15
Ser Leu Lys Ile Ser Cys Lys Gly Ser Gly Tyr Ser Phe Thr Ser Phe
20 25 30
Trp Ile Gly Trp Ala Arg Gln Met Pro Gly Lys Gly Leu Glu Trp Met
35 40 45
Gly Ile Ile Tyr Pro Gly Asp Ser Asp Thr Arg Tyr Ser Pro Ser Phe
50 55 60
Gln Gly Gln Val Thr Ile Ser Ala Asp Lys Ser Ile Ser Thr Ala Tyr
65 70 75 80
Leu Gln Trp Ser Ser Leu Lys Ala Ser Asp Thr Ala Met Tyr Tyr Cys
85 90 95
Ala Thr Ala Asn Ser Ser Phe Trp Asn Phe Asp Leu Trp Gly Arg Gly
100 105 110
Thr Leu Val Thr Val Ser Ser
115
<210> 13
<211> 119
<212> PRT
<213> Homo Sapiens
<400> 13
Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Thr Pro Gly Glu
1 5 10 15
Ser Leu Lys Ile Ser Cys Lys Gly Ser Gly Tyr Thr Phe Thr Ser Tyr
20 25 30
Trp Ile Gly Trp Val Arg Gln Met Pro Gly Lys Gly Pro Glu Trp Met
35 40 45
Gly Ile Ile Tyr Pro Gly Asp Ser Asp Thr Arg Tyr Ser Pro Ser Phe
50 55 60
Gln Gly Gln Val Thr Phe Ser Ala Asp Lys Ser Ile Ser Thr Ala Tyr
65 70 75 80
Leu Gln Trp Asn Ser Leu Lys Thr Ser Asp Thr Ala Met Tyr Tyr Cys
85 90 95
Ala Thr Ala Asn Pro Ser Tyr Trp Tyr Phe Asp Leu Trp Gly Arg Gly
100 105 110
Thr Leu Val Thr Val Ser Ser
115
<210> 14
<211> 113
<212> PRT
<213> Homo Sapiens
<400> 14
Ser Gly Ala Glu Val Lys Thr Pro Gly Glu Ser Leu Lys Ile Ser Cys
1 5 10 15
Lys Gly Ser Gly Tyr Thr Phe Thr Asn Tyr Trp Ile Gly Trp Val Arg
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
20 25 30
Gln Met Pro Gly Lys Gly Pro Glu Trp Met Gly Ile Ile Tyr Pro Gly
35 40 45
Asp Ser Asp Thr Arg Tyr Ser Pro Ser Phe Gln Gly Gln Val Thr Phe
50 55 60
Ser Ala Asp Lys Ser Ile Ser Thr Ala Tyr Leu Gln Trp Ser Ser Leu
65 70 75 80
Lys Thr Ser Asp Thr Ala Met Tyr Tyr Cys Ala Thr Ala Asn Pro Ser
85 90 95
Tyr Trp Tyr Phe Asp Leu Trp Gly Arg Gly Thr Leu Val Thr Val Ser
100 105 110
Ser
<210> 15
<211> 113
<212> PRT
<213> Homo Sapiens
<400> 15
Ser Gly Ala Glu Leu Lys Lys Pro Gly Glu Ser Leu Lys Ile Ser Cys
1 5 10 15
Lys Gly Ser Gly Tyr Ser Phe Thr Asn Tyr Trp Ile Gly Trp Ala Arg
20 25 30
Gln Met Pro Gly Lys Gly Leu Glu Trp Met Gly Ile Ile Tyr Pro Gly
35 40 45
Asp Ser Asp Thr Arg Tyr Ser Pro Ser Phe Gln Gly Gln Val Thr Ile
50 55 60
Ser Ala Asp Lys Ser Val Ser Thr Ala Tyr Leu Gln Trp Asn Ser Leu
65 70 75 80
Lys Ala Ser Asp Thr Ala Met Tyr Tyr Cys Ala Thr Ala Asn Ser Ser
85 90 95
Phe Trp Asn Phe Asp Leu Trp Gly Arg Gly Thr Leu Val Thr Val Ser
100 105 110
Ser
<210> 16
<211> 108
<212> PRT
<213> Homo Sapiens
<400> 16
Glu Ile Val Leu Thr Gln Ser Pro Ala Thr Leu Ser Leu Ser Pro Gly
1 5 10 15
Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gln Ser Val Ser Ser Tyr
20 25 30
Leu Ala Trp Phe Gln Gln Lys Pro Gly Gln Ala Pro Arg Leu Leu Ile
35 40 45
Tyr Asp Ala Ser Asn Arg Ala Thr Gly Ile Pro Ala Arg Phe Ser Gly
50 55 60
Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Glu Pro
65 70 75 80
Glu Asp Phe Ala Val Tyr Tyr Cys Gln Gln Arg Ser Asn Trp Leu Met
85 90 95
Tyr Thr Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys
100 105
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
6
<210> 17
<211> 108
<212> PRT
<213> Homo Sapiens
<400> 17
Glu Ile Val Leu Thr Gln Ser Pro Ala Thr Leu Ser Leu Ser Pro Gly
1 5 10 15
Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gln Ser Val Ser Ser Tyr
20 25 30
Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Arg Leu Leu Ile
35 40 45
Tyr Asp Ala Ser Asn Arg Ala Thr Gly Ile Pro Ala Arg Phe Ser Gly
50 55 60
Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Glu Pro
65 70 75 80
Glu Asp Phe Ala Val Tyr Tyr Cys Gln Gln Arg Ser Asn Trp Leu Met
85 90 95
Tyr Thr Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys
100 105
<210> 18
<211> 108
<212> PRT
<213> Homo sapiens
<400> 18
Glu Ile Val Leu Thr Gln Ser Pro Ala Thr Leu Ser Leu Ser Pro Gly
1 5 10 15
Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gln Ser Val Ser Ser Tyr
20 25 30
Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Arg Leu Leu Ile
35 40 45
Tyr Asp Ala Ser Asn Arg Ala Thr Gly Ile Pro Ala Arg Phe Ser Gly
50 55 60
Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Glu Pro
65 70 75 80
Glu Asp Phe Ala Val Tyr Tyr Cys Gln Gln Arg Ser Asp Trp Leu Met
85 90 95
Tyr Thr Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys
100 105
<210> 19
<211> 100
<212> PRT
<213> Homo Sapiens
<400> 19
Pro Ser Ser Leu Ser Ala Ser Val Gly Asp Ser Val Thr Ile Thr Cys
1 5 10 15
Arg Val Ser Gln Gly Ile Ser Ser Tyr Leu Asn Trp Tyr Arg Gln Lys
20 25 30 '
Pro Gly Lys Val Pro Lys Leu Leu Ile Tyr Ser Ala Ser Asn Leu Gln
35 40 45
Ser Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe
50 55 60
Thr Leu Thr Ile Asn Ser Leu Gln Pro Glu Asp Val Ala Thr Tyr Tyr
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
7
65 70 75 80
Gly Gln Arg Thr Tyr Asn Ala Pro Phe Thr Phe Gly Pro Gly Thr Lys
85 90 95
Val Asp Ile Lys
100
<210> 20
<211> 100
<212> PRT
<213> Homo Sapiens
1
<400> 20
Pro Ser Ser Leu Ser Ala Ser Val Gly Asp Arg Val Thr Ile Thr Cys
1 5 10 15
Arg Val Ser Gln Gly Ile Ser Ser Tyr Leu Asn Trp Tyr Arg Gln Lys
20 25 30
Pro Gly Lys Val Pro Lys Leu Leu Met Tyr Ser Ala Ser Asn Leu Gln
35 40 45
Ser Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe
50 55 60
Thr Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp Val Ala Thr Tyr Tyr
65 70 75 80
Gly Gln Arg Thr Tyr Asn Ala Pro Phe Thr Phe Gly Pro Gly Thr Lys
85 90 95
Val Asp Ile Lys
100
<210> 21
<211> 5
<212> PRT
<213> Homo Sapiens
<400> 21
Ser Tyr Trp Ile Gly
1 5
<210> 22
<211> 17
<212> PRT
<213> Homo Sapiens
<400> 22
Ile Ile Tyr Pro Gly Asp Ser Asp Thr Arg Tyr Ser Pro Ser Phe Gln
1 5 10 15
Gly
<210> 23
<211> 10
<212> PRT
<213> Homo Sapiens
<400> 23
Ala Asn Ser Ser His Trp Tyr Phe Asp Leu
1 S 10
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
g
<210> 24
<211> 5
<212> PRT
<213> Homo Sapiens
<400> 24
Ser Phe Trp Ile Gly
1 5
<210> 25
<211> 17
<212> PRT
<213> Homo Sapiens
<400> 25
Ile Ile Tyr Pro Gly Asp Ser Asp Thr Arg Tyr Ser Pro Ser Phe G1n
1 5 10 15
Gly
<210> 26
<211> 9
<212> PRT
<213> Homo Sapiens
<400> 26
Ala Asn Ser Phe Trp Asn Phe Asp Leu
1 5
<210> 27
<211> 5
<212> PRT
<213> Homo Sapiens
<400> 27
Ser Tyr Trp Ile Gly
1 5
<210> 28
<211> 17
<212> PRT
<213> Homo sapiens
<400> 28
Ile Ile Tyr Pro Gly Asp Ser Asp Thr Arg Tyr Ser Pro Ser Phe Gln
1 5 10 15
Gly
<210> 29
<211> 10
<212> PRT
<213> Homo Sapiens
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
9
<400> 29
Ala Asn Pro Ser Tyr Trp Tyr Phe Asp Leu
1 5 10
<210> 30
<211> 5
<212> PRT
<213> Homo sapiens
<400> 30
Asn Tyr Trp Ile Gly
1 5
<210> 31
<211> 17
<212> PRT
<213> Homo sapiens
<400> 31
Ile Ile Tyr Pro Gly Asp Ser Asp Thr Arg Tyr Ser Pro Ser Phe Gln
1 5 10 15
Gly
<210> 32
<211> 10
<212> PRT
<213> Homo Sapiens
<400> 32
Ala Asn Pro Ser Tyr Trp Tyr Phe Asp Leu
1 5 10
<210> 33
<211> 5
<212> PRT
<213> Homo Sapiens
<400> 33
Asn Tyr Trp Ile Gly
1 5
<210> 34
<211> 17
<212> PRT
<213> Homo Sapiens
<400> 34
Ile Ile Tyr Pro Gly Asp Ser Asp Thr Arg Tyr Ser Pro Ser Phe Gln
1 5 10 15
Gly
<210> 35
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
<211> 10
<212> PRT
<213> Homo Sapiens
<400> 35
Ala Asn Ser Ser Phe Trp Asn Phe Asp Leu
1 5 10
<210> 36
<211> 11
<212> PRT
<213> Homo Sapiens
<400> 36
Arg Ala Ser Gln Ser Val Ser Ser Tyr Leu Ala
1 5 10
<210> 37
<211> 7
<212> PRT
<213> Homo Sapiens
<400> 37
Asp Ala Ser Asn Arg Ala Thr
1 5
<210> 38
<211> 10
<212> PRT
<213> Homo Sapiens
<400> 38
Gln Gln Arg Ser Asn Trp Leu Met Tyr Thr
1 5 10
<210> 39
<211> 11
<212> PRT
<213> Homo Sapiens
<400> 39
Arg Ala Ser Gln Ser Val Ser Ser Tyr Leu Ala
1 5 10
<210> 40
<211> 7
<212> PRT
<213> Homo sapiens
<400> 40
Asp Ala Ser Asn Arg Ala Thr
1 5
<210> 41
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
11
<211> 10
<212> PRT
<213> Homo sapiens
<400> 41
Gln Gln Arg Ser Asn Trp Leu Met Tyr Thr
1 5 10
<210> 42
<211> 11
<212> PRT
<213> Homo Sapiens
<400> 42
Arg Ala Ser Gln Ser Val Ser Ser Tyr Leu Ala
1 5 10
<210> 43
<211> 7
<212> PRT
<213> Homo sapiens
<400> 43
Asp Ala Ser Asn Arg Ala Thr
1 5
<210> 44
<211> 10
<212> PRT
<213> Homo Sapiens
<400> 44
Gln Gln Arg Ser Asp Trp Leu Met Tyr Thr
1 5 10
<210> 45
<211> 11
<212> PRT
<213> Homo Sapiens
<400> 45
Arg Val Ser Gln Gly Ile Ser Ser Tyr Leu Asn
1 5 10
<210> 46
<211> 7
<212> PRT
<213> Homo Sapiens
<400> 46
Ser Ala Ser Asn Leu Gln Ser
1 5
<210> 47
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
12
<211> 9
<212> PRT
<213> Homo Sapiens
<400> 47
Gln Arg Thr Tyr Asn Ala Pro Phe Thr
1 5
<210> 48
<211> 11
<212> PRT
<213> Homo Sapiens
<400> 48
Arg Val Ser Gln Gly Ile Ser Ser Tyr Leu Asn
1 5 10
<210> 49
<211> 7
<212> PRT
<213> Homo sapiens
<400> 49
Ser Ala Ser Asn Leu Gln Ser
1 5
<210> 50
<211> 9
<212> PRT
<213> Homo Sapiens
<400> 50
Gln Arg Thr Tyr Asn Ala Pro Phe Thr
1 5
<210> 51
<211> 98
<212> PRT
<213> Homo Sapiens
<400> 51
Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Glu
1 5 10 15
Ser Leu Lys Ile Ser Cys Lys Gly Ser Gly Tyr Ser Phe Thr Ser Tyr
20 25 30
Trp Ile Gly Trp Val Arg Gln Met Pro Gly Lys Gly Leu Glu Trp Met
35 40 45
Gly Ile Ile Tyr Pro Gly Asp Ser Asp Thr Arg Tyr Ser Pro Ser Phe
50 55 60
Gln Gly Gln Val Thr Ile Ser Ala Asp Lys Ser Ile Ser Thr Ala Tyr
65 70 75 80
Leu Gln Trp Ser Ser Leu Lys Ala Ser Asp Thr Ala Met Tyr Tyr Cys
85 90 95
Ala Arg
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
13
<210> 52
<211> 94
<212> PRT
<213> Homo sapiens
<400> 52
Glu Ile Val Leu Thr Gln Ser Pro Ala Thr Leu Ser Leu Ser Pro Gly
1 5 10 15
Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gln Ser Val Ser Ser Tyr
20 25 30
Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Arg Leu Leu Ile
35 40 45
Tyr Asp Ala Ser Asn Arg Ala Thr Gly Ile Pro Ala Arg Phe Ser Gl.y
50 55 60
Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Glu Pro
65 70 75 80
Glu Asp Phe Ala Val Tyr Tyr Cys Gln Gln Arg Ser Asn Trp
85 90
<210> 53
<211> 103
<212> PRT
<213> Homo sapiens
<400> 53
Asp Ile Gln Leu Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly
1 5 10 15
Asp Arg Val Thr Ile Thr Cys Arg Val Ser Gln Gly Ile Ser Ser Tyr
20 25 30
Leu Asn Trp Tyr Arg Gln Lys Pro Gly Lys Val Pro Lys Leu Leu Ile
35 40 45
Tyr Ser Ala Ser Asn Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro
65 70 75 80
Glu Asp Val Ala Thr Tyr Tyr Gly Gln Arg Thr Tyr Asn Ala Pro Phe
85 90 95
Thr Thr Lys Val Asp Ile Lys
100
<210> 54
<211> 343
<212> DNA
<213> Homo sapiens
<400> 54
gaggtgcagc tggtgcagtc tggagcagag gtgaaaaagc ccggggagtc tctgaagatc 60
tcctgtaagg gttctggata cagctttacc agctactgga tcggctgggt gcgccagatg 120
cccgggaaag gcctggagtg gatggggatc atctatcctg gtgactctga taccagatac 180
agcccgtcct tccaaggcca ggtcaccatc tcagccgaca agtccatcag caccgcctac 240
ctgcagtgga gcagcctgaa ggcctcggac accgccatgt attactgtgc gatactggta 300
cttcgatctc tggggccgtg gcaccctggt cactgtctcc tca 343
<210> 55
<211> 283
<212> DNA
<213> Homo sapiens
CA 02474616 2004-07-27
WO 03/064606 PCT/US03/02448
14
<400> 55
gaaattgtgt tgacacagtc tccagccacc ctgtctttgt ctccagggga aagagccacc 60
ctctcctgca gggccagtca gagtgttagc agctacttag cctggtacca acagaaacct 120
ggccaggctc ccaggctcct catctatgat gcatccaaca gggccactgg catcccagcc 180
aggttcagtg gcagtgggtc tgggacagac ttcactctca ccatcagcag cctagagcct 240
gaagattttg cagtttatta ctgtcagcag cgtagcaact ggc 283
<210> 56
<211> 322
<212> DNA
<213> Homo sapiens
<400> 56
gacatccagt tgacccagtc tccatcctcc ctgtctgcat ctgtaggaga cagagtcacc 60
atcacttgcc gggtgagtca gggcattagc agttatttaa attggtatcg gcagaaacca 120
gggaaagttc ctaagctcct gatctatagt gcatccaatt tgcaatctgg agtcccatct 180
cggttcagtg gcagtggatc tgggacagat ttcactctca ctatcagcag cctgcagcct 240
gaagatgttg caacttatta cggtcaacgg acttacaatg ccccattcac tttcggccct 300
gggaccaaag tggatatcaa ac 322
<210> 57
<211> 21
<212> DNA
<213> Homo Sapiens
<400> 57
tgccaggggg aagaccgatg g 21
<210> 58
<211> 20
<212> DNA
<213> Homo sapiens
<400> 58
cgggaagatg aagacagatg 20
