Note: Descriptions are shown in the official language in which they were submitted.
CA 02476239 2004-08-12
WO 03/068803 PCT/US03/04350
The present invention relates generally to a novel nucleic acid molecule that
encodes for GAVE 19, a
heretofore unlrnown G-protein-coupled receptor, along with uses of the nucleic
acid molecule and
GAVE 19.
The G protein-coupled receptors (GPCRs) are a large family of integral
membrane proteins that are
involved in cellular signal transduction. GPCRs respond to a variety of
extracellular signals,
including neurotransmitters, hormones, odorants and light, and are capable of
transducing signals so
as to initiate a second messenger response within the cell. Many therapeutic
drugs target GPCRs
because those receptors mediate a wide variety of physiological responses,
including inflammation,
vasodilation, heart rate, bronchodilation, endocrine secretion and
peristalsis.
GPCRs are characterized by extracellular domains, seven transmembrane domains
and intracellular
domains. Some of the functions the receptors perform, such as binding ligands
and interacting with G
proteins, are related to the presence of certain amino acids in critical
positions. For example, a variety
of studies have shown that differences in amino acid sequence in GPCRs account
for differences in
affinity to either a natural ligand or a small molecule agonist or antagonist.
In other words, minor
differences in sequence can account for different binding affinities and
activities. (See, for example,
Meng et al., J Bio Chem (1996) 271(50):32016-20; Burd et al., J Bio Chem
(1998) 273(51):34488-95;
and Hurley et al., J Neurochem (1999) 72(1):413-21). In particular, studies
have shown that amino
acid sequence differences in the third intracellular domain can result in
different activities. Myburgh
et al. found that alanine 261 of intracellular loop 3 of gonadotropin
releasing hormone receptor is
crucial for G protein coupling and receptor internalization (Biochem J (1998)
331(Part 3):893-6).
Wonerow et al. studied the thyrotropin receptor and demonstrated that
deletions in the third
intracellular loop resulted in constitutive receptor activity (J Bio Chem
(1998)273(14):7900-5).
In general, the action of the binding of an endogenous ligand to a receptor
results in a change in the
conformation of the intracellular domains) of the receptor allowing for
coupling between the
intracellular domains) and an intracellular component, a G-protein. Several G
proteins exist, such as
Gq, GS, G;, GZ and Go (see, e.g. Dessauer et al., Clin Sci (Colch) (1996)
91(5):527-37). The IC-3 loop
as well as the carboxy terminus of the receptor interact with the G proteins
(Pauwels et al., Mol
CA 02476239 2004-08-12
WO 03/068803 PCT/US03/04350
Neurobiol (1998) 17(1-3):109-135 and Wonerow et. al., supra). Some GPCRs are
"promiscuous" with
respect to G proteins, i.e., a GPCR can interact with more than one G protein
(see, e.g., Kenakin, Life
Sciences (1988) 43:1095).
Ligand activated GPCR coupling with G protein begins a signaling cascade
process (referred to as
"signal transduction"). Such signal transduction ultimately results in
cellular activation or cellular
inhibition.
GPCRs exist in the cell membrane in equilibrium between two different
conformations: an "inactive"
and an "active" state. A receptor in an inactive state is unable to link to
the intracellular signaling
transduction pathway to produce a biological response (exceptions exist, such
as during over-
expression of receptor in transduced cells, see e.g., www creighton
edu/Pharmac~l~gy/inver~e_htm_l.
Modulation of the conformation to the active state allows linkage to the
transduction pathway (via the
G protein) and produces a biological response. Agonists bind and make the
active conformation much
more likely. However, sometimes, if there is already a considerable response
in the absence of any
agonist, such receptors are said to be constitutively active (i.e., already in
an active conformation or
ligand independent or autonomous active state). When agonists are added to
such systems, an
enhanced response routinely is observed. However, when a classical antagonist
is added, binding by
such molecules produces no effect. On the other hand, some antagonists cause
an inhibition of the
constitutive activity of the receptor, suggesting that the latter class of
drugs technically are not
antagonists but are agonists with negative intrinsic activity. Those drugs are
called inverse agonists,
Traditional study of receptors has proceeded from the assumption that the
endogenous ligand first be
identified before discovery could move forward to identify antagonists and
other receptor effector
molecules. Even where antagonists might have been discovered first, the
dogmatic response was to
identify the endogenous ligand (WO 00/22131). However, as the active state is
the most useful for
assay screening purposes, obtaining such constitutive receptors, especially
GPCRs, would allow for
the facile isolation of agonists, partial, agonists, inverse agonists and
antagonists in the absence of
information concerning endogenous ligands. Moreover, in diseases that result
from disorders of
receptor activity, drugs that cause inhibition of constitutive activity, or
more specifically, reduce the
effective activated receptor concentration, could be discovered more readily
by assays using receptors
in the autonomous active state. For example, as receptors that may be
transfected into patients to treat
disease, the activity of such receptors may be fine-tuned with inverse
agonists discovered by such
assays.
CA 02476239 2004-08-12
WO 03/068803 PCT/US03/04350
Diseases such as asthma, chronic obstructive pulmonary disease (COPD) and
rheumatoid arthritis
(RA) generally are considered to have an inflammatory etiology involving T
helper cells,
monocyte-macrophages and eosinophils. Current anti-inflammatory therapy with
corticosteroids is
effective in asthma but is associated with metabolic and endocrine side
effects. The same is possibly
true for inhaled formulations that can be absorbed through lung or nasal
mucosa. Satisfactory oral
therapies for RA or COPD currently are lacking.
Eosinophils mediate much of the airway dysfunction in allergy and asthma.
Interleukin-5 (IL-5) is an
eosinophil growth and activating cytokine. Studies have shown IL-5 to be
necessary for tissue
eosinophilia and for eosinophil-mediated tissue damage resulting in airway
hyperresponsiveness
(Chang et al., J Allergy Clin Immunol (1996) 98(5 pt 1):922-931 and Duez et
al., Am J Respir Crit
Care Med (2000) 161(1):200-206). IL-S is made by T-helper-2 cells (Th2)
following allergen (e.g.
house dust mite antigen) exposure in atopic asthma.
RA is believed to result from accumulation of activated macrophages in the
affected synovium.
Interferon 'y(IFN~y) is a T-helper-1 (Thl) cell-derived cytokine with numerous
proinflammatory
properties. It is the most potent macrophage activating cytokine and induces
MHC class II gene
transcription contributing to a dendritic cell-like phenotype.
Lipopolysaccharide (LPS) is a component of gram-negative bacterial cell walls
that elicits
inflammatory responses, including tumor necrosis factor a (TNFa) release. The
efficacy of
intravenous anti-TNFa therapy in RA has been demonstrated in the clinic. COPD
is thought also to
result from macrophage accumulation in the lung, the macrophages produce
neutrophil
chemoattractants (e.g., IL-8: de Boer et al., J Pathol (2000) 190(5):619-626).
Both macrophages and
neutrophils release cathepsins that cause degradation of the alveolar wall. It
is believed that lung
epithelium can be an important source for inflammatory cell chemoattractants
and other inflammatory
cell-activating agents (see, for example, Thomas et al., J Virol (2000)
74(18):8425-8433; Lamkhioued
et al., Am J Respir Crit Care Med (2000) 162(2 Pt. 1):723-732; and Sekiya et
al., J Immunol (2000)
165(4):2205-2213).
Given the role GPCRs have in disease and the ability to treat diseases by
modulating the activity of
GPCRs, identification and characterization of previously unknown GPCRs can
provide for the
development of new compositions and methods for treating disease states that
involve the activity of a
GPCR. Accordingly, what is needed is the discovery, isolation and
characterization of novel and
useful nucleic acid molecules that encode for heretofore unknown GPCRs.
CA 02476239 2004-08-12
WO 03/068803 PCT/US03/04350
What is also needed are assays that utilize such heretofore unknown GPCRs to
identify molecules that
can serve potential agonists or antagonists of GPCRS. These molecules may
readily have applications
as therapeutic agents for modulating the activity of GPCRs in vivo, and thus,
treat a plethora of
diseases related to GPCR activity.
The citation of any reference herein should not be construed as an admission
that such reference is
available as "Prior Art" to the instant application.
STTMMARY (7F THF TNVF.NTTON
The instant invention identifies and characterizes the expression of a novel
constitutively active
murine GPCR, GAVE19, and provides compositions and methods for applying the
discovery to the
identification and treatment of related diseases.
Thus broadly, the present invention extends to an isolated nucleic acid
molecule comprising a DNA
sequence of Figure 1 (SEQ >I7 N0:1), a variant thereof, a fragment thereof, or
an analog or a
derivative thereof. Such a variant of the present invention may be an allelic
variant, a degenerate
variant, or an allelic variant that results in a degenerate change in the
sequence.
Moreover, the present invention extends to an isolated nucleic acid molecule
hybridizable to the
isolated nucleic acid molecule of SEQ >D NO:1, or a variant thereof, under
stringent hybridization
conditions. Yet further, the present invention extends to an isolated nucleic
acid molecule
hybridizable to a nucleic acid molecule that is complementary to the DNA
sequence of SEQ )D NO:1
under stringent hybridization conditions. Stringent hybridization conditions
are described infra.
Furthermore, the present invention extends to an isolated nucleic acid
molecule comprising a DNA
sequence that encodes a polypeptide comprising an amino acid sequence of SEQ
>D N0:2.
Optionally, an isolated nucleic acid molecule of the present invention as
described above may be
detectably labeled. Examples of detectable labels having applications herein
include, but certainly are
not limited to an enzyme, a radioactive isotope, or a chemical which
fluoresces. Particular examples of
detectable labels are described infra.
Particular polypeptides are also encompassed within the present invention. For
example, the present
invention extends to a purified polypeptide comprising the amino acid sequence
of SEQ >D N0:2, a
CA 02476239 2004-08-12
WO 03/068803 PCT/US03/04350
conservative variant thereof, or an analog or derivative thereof. Optionally,
a polypeptide of the
present invention may be detectably labeled.
In addition, the present invention extends to antibodies wherein a polypeptide
of the present invention
is the immunogen used in production of the antibodies. These antibodies can be
monoclonal or
polyclonal. Moreover, the antibodies can be "chimeric" as, for example, they
may comprise protein
domains of antibodies raised against a purified polypeptide of the present
invention in different
species. Naturally, an antibody of the present invention may be detectably
labeled. Particular
examples of detectable labels having applications herein are described infra.
The present invention further extends to an expression vector comprising a
nucleic acid molecule
comprising a DNA sequence of SEQ >D NO:1, a variant thereof, an analog or
derivative thereof, or a
fragment thereof, operatively associated with an expression control element.
Furthermore, an
expression vector of the present invention may comprise an isolated nucleic
acid molecule
hybridizable under stringent hybridization conditions to an isolated nucleic
acid molecule comprising
a DNA sequence of SEQ ID NO:1, operatively associated with an expression
control element, or is
hybridizable under stringent hybridization conditions to a hybridization probe
that is complementary
to an isolated nucleic acid molecule comprising a DNA sequence of SEQ m NO:1,
wherein the
hybridization probe is operatively associated with an expression control
element. A particular
example of an expression control element having applications herein is a
promoter. Examples of
particular promoters applicable to the present invention, include, but are not
limited to early promoters
of hCMV, early promoters of SV40, early promoters of adenovirus, early
promoters of vaccinia, early
promoters of polyoma, late promoters of SV40, late promoters of adenovirus,
late promoters of
vaccinia, late promoters of polyoma, the lac system, the trp system, the TAC
system, the TRC system,
the major operator and promoter regions of phage lambda, control regions of fd
coat protein, 3-
phosphoglycerate kinase promoter, acid phosphatase promoter, or promoters of
yeast a mating factor,
to name only a few.
With an expression vector of the present invention, one may transfect or
transform a host cell and
produce a polypeptide comprising an amino acid sequence of SEQ )D N0:2, or a
variant thereof. The
host cell may be either a prokaryotic cell or a eukaryotic cell. Particular
examples of unicellular hosts
having applications herein include E. coli, Pseudonomas, Bacillus,
Strepomyces, yeast, CHO, R1.1, B-
W, L-M, COS1, COS7, BSC1, BSC40, BMT10 and Sf9 cells, etc.
Moreover, the present invention further extends to a method for producing a
purified polypeptide
CA 02476239 2004-08-12
WO 03/068803 PCT/US03/04350
comprising the amino acid sequence of SEQ )I? N0:2, a variant thereof, or a
fragment thereof. Such a
method comprises culturing a host cell transformed or transfected with an
expression vector of the
present invention under conditions that provide for expression of the purified
polypeptide, and then
recovering the purified polypeptide from the unicellular host, the culture
surrounding the host cell, or
from both.
The present invention also extends to assays for identifying compounds that
can modulate the activity
of GAVE19. Such compounds can be an agonist, an antagonist, or an inverse
agonist of GAVE19.
Hence accordingly, the present invention extends to a method for identifying
an agonist of GAVE19
comprising contacting a potential agonist with a cell expressing GAVE19 in the
presence of an
endogenous ligand, and determining whether the signaling activity of GAVE19 is
increased when the
potential agonist is present, relative to the signaling activity of GAVE19 in
the absence of the
potential agonist.
Likewise, the present invention extends to a method for identifying an inverse
agonist of GAVE19.
Such a method comprises contacting a potential inverse agonist with a cell
expressing GAVE19, and
determining whether the signaling activity of GAVE19 in the presence of the
potential inverse agonist
and an endogenous ligand or agonist is decreased relative to the signaling
activity of GAVE19 under
conditions in which the presence of an endogenous ligand or agonist, but in
absence of potential
inverse agonist, and is decreased in the presence of an endogenous ligand or
agonist.
Naturally, the present invention extends to methods for identifying an
antagonist of GAVE19. Such a
method comprises the steps of contacting a potential antagonist with a cell
expressing GAVE19, and
determining whether in the presence of said potential antagonist the signaling
activity of GAVE19 is
decreased relative to the activity of GAVE19 in the presence of an endogenous
ligand or agonist.
Accordingly, it is an aspect of the present invention to provide an isolated
nucleic acid sequence
which encodes a GAVE19 protein, a fragment thereof, or a variant thereof.
It is also an aspect of the present invention to provide a variant of an
nucleic acid molecule comprising
a DNA sequence of SEQ ll~ NO: l, as well as a DNA molecule that is
hybridizable to SEQ ID NO:1
under stringent conditions.
It is a further aspect of the present invention to provide an amino acid
sequence for GAVE19, along
with variant thereof, a fragment thereof, or an analog or derivative thereof.
CA 02476239 2004-08-12
WO 03/068803 PCT/US03/04350
It is a further aspect of the present invention to provide an expression
vector comprising a DNA
sequence that encodes GAVE19, a variant thereof, a fragment thereof, or an
analog or derivative
thereof, wherein the DNA sequence is operably associated with an expression
control element.
It is still a further aspect of the present invention to provide an antibody
having GAVE19, an variant
thereof, an analog or derivative thereof, or a fragment thereof, as an
immunogen.
Yet another aspect of the present invention involves methods for identify
compounds that can
modulate the activity of GAVE19 protein. Such modulators may be an antagonist
of GAVE19, an
agonist of GAVE19, or inverse agonist of GAVE19. Moreover, compounds that
modulate the
expression or activity of GAVE 19 in mice may well have applications in
treating a plethora of
diseases or disorders such as various inflammatory diseases, asthma, chronic
obstructive pulmonary
disease (COPD), and rheumatoid arthritis, to name only a few.
These and other aspects of the present invention will be better appreciated by
reference to the
following drawings and Detailed Description.
FIGURE 1: DNA sequence that encodes GAVE19 (SEQ ID NO:1).
FIGURE 2: Amino acid sequence of GAVE19 (SEQ ID N0:2)
FIGURE 3: GAVE19 Expression Profile on MPD1.1.2
FIGURE 4: Comparison of the amino acid sequence of GAVE19 (SEQ ID N0:2) with
the human
ortholog GAVE18 (SEQ ID N0:7).
As explained above, the present invention relates to the surprising and
unexpected discovery of a
heretofore unknown murine nucleic acid molecule that encodes a heretofore
unknown G
protein-coupled receptor referred to herein as GAVE19. In particular, it has
been discovered that
GAVE19 is expressed in immune tissues or organs, such as the kidney, liver and
small intestine.
Hence, GAVE19 can readily serve as a target for the development of
pharmaceutical compositions to
treat a variety inflammation diseases, such as asthma, rheumatoid arthritis,
COPD, etc.
CA 02476239 2004-08-12
WO 03/068803 PCT/US03/04350
Various terms and phrases used throughout the instant Specification and Claims
to describe the
present invention are set forth below:
As used herein, the term "modulator" refers to a moiety (e.g., but not limited
to a ligand and a
candidate compound) that modulates the activity of GAVE19. A modulator of the
present invention
may be an agonist, a partial agonist, an antagonist, or an inverse agonist of
GAVE19.
As used herein, the term "agonist" refers to moieties (e.g., but not limited
to ligands and candidate
compounds) that activate the intracellular response when bound to the
receptor, or enhance GTP
binding to membranes.
As used herein, the term "partial agonist" refers to moieties (e.g., but not
limited to ligands and
candidate compounds) that activate the intracellular response when bound to
the receptor to a lesser
degree/extent than do agonists, or enhance GTP binding to membranes to a
lesser degree/extent than
do agonists.
As used herein, the term "antagonist" refers moieties (e.g., but not limited
to ligands and candidate
compounds) that competitively bind to the receptor at the same site as does an
agonist. However, an
antagonist does not activate the intracellular response initiated by the
active form of the receptor and
thereby can inhibit the intracellular responses by agonists or partial
agonists. In a related aspect,
antagonists do not diminish the baseline intracellular response in the absence
of an agonist or partial
agonist.
As used herein, the term "inverse agonist" refers to moieties (e.g., but not
limited to ligand and
candidate compound) that bind to a constitutively active receptor and inhibit
the baseline intracellular
response. The baseline response is initiated by the active form of the
receptor below the normal base
level of activity that is observed in the absence of agonists or partial
agonists, or decrease of GTP
binding to membranes.
As used herein, the term "candidate compound" refers to a moiety (e.g., but
not limited to a chemical
compound) that is amenable to a screening technique. In one embodiment, the
term does not include
compounds that were publicly lrnown to be compounds selected from the group
consisting of agonist,
partial agonist, inverse agonist or antagonist of GAVE19. Those compounds were
identified by
traditional drug discovery processes involving identification of an endogenous
ligand specific for a
CA 02476239 2004-08-12
WO 03/068803 PCT/US03/04350
receptor, and/or screening of candidate compounds against a receptor wherein
such a screening
requires a competitive assay to assess efficacy.
As used herein, the terms "constitutively activated receptor" or "autonomously
active receptor," are
used herein interchangeably, and refer to a receptor subject to activation in
the absence of ligand.
Such constitutively active receptors can be endogenous (e.g., GAVE19) or non-
endogenous; i.e.,
GPCRs that can be modified by recombinant means to produce mutant constitutive
forms of wild-type
GPCRs (e.g., see EP 1071701; WO 00/22129; WO 00/22131; and U.S. Pat. Nos.
6,150,393 and
6,140,509 which are hereby incorporated by reference herein in their
entireties.
As used herein, the term "constitutive receptor activation" refers to the
stabilization of a receptor in
the active state by means other than binding of the receptor with the
endogenous ligand or chemical
equivalent thereof.
As used herein, the term "ligand" refers to a moiety that binds to another
molecule, wherein the
moiety includes, but certainly is not limited to a hormone or a
neurotransmitter, and further, wherein
the moiety stereoselectively binds to a receptor.
As used herein, the term "family," when referring to a protein or a nucleic
acid molecule of the
invention, is intended to mean two or more proteins or nucleic acid molecules
having a seemingly
common structural domain and having sufficient amino acid or nucleotide
sequence identity as
defined herein. Such family members can be naturally occurring and can be from
either the same or
different species. For example, a family can contain a first protein of human
origin and a homologue
of that protein of murine origin, as well as a second, distinct protein of
human origin and a murine
homologue of that second protein. Members of a family also may have common
functional
characteristics.
As used herein interchangeably, the terms "GAVE19 activity", "biological
activity of GAVE19" and
"functional activity of GAVE19", refer to an activity exerted by a GAVE19
protein, polypeptide or
nucleic acid molecule on a GAVE19 responsive cell as determined in vivo or in
vitro, according to
standard techniques. A GAVE19 activity can be a direct activity, such as an
association with or an
enzymatic activity on a second protein or an indirect activity, such as a
cellular signaling activity
mediated by interaction of the GAVE19 protein with a second protein. In a
particular embodiment, a
GAVE19 activity includes, but is not limited to at least one or more of the
following activities: (i) the
CA 02476239 2004-08-12
WO 03/068803 PCT/US03/04350
ability to interact with proteins in the GAVE19 signaling pathway; (ii) the
ability to interact with a
GAVE19 ligand; and (iii) the ability to interact with an intracellular target
protein.
Furthermore, in accordance with the present invention there may be employed
conventional molecular
5 biology, microbiology, and recombinant DNA techniques within the skill of
the art. Such techniques
are explained fully in the literature. See, e.g., Sambrook, Fritsch &
Maniatis, Molecular Cloning. A
Laboratory Manual, Second Edition (1989) Cold Spring Harbor Laboratory Press,
Cold Spring
Harbor, New York (herein "Sambrook et al., 1989"); DNA Cloning.' A Practical
Approach, Volumes I
and II (D.N. Glover ed. 1985); Oligonucleotide Synthesis (M.J. Gait ed. 1984);
Nucleic Acid
10 Hybridization [B.D. Hames & S.J. Higgins eds. (1985)]; Transcription And
Translation [B.D. Hames
& S.J. Higgins, eds. (1984)]; Animal Cell Culture [R.I. Freshney, ed. (1986)];
Immobilized Cells And
Enzymes [IRL Press, (1986)]; B. Perbal, A Practical Guide To Molecular Cloning
(1984); F.M.
Ausubel et al. (eds.), Current Protocols in Molecular Biology, John Wiley &
Sons, Inc. (1994).
Therefore, if appearing herein, the following terms shall have the definitions
set out below.
A "vector" is a replicon, such as plasmid, phage or cosmid, to name only a
few, to which another DNA
segment may be attached so as to bring about the replication of the attached
segment. A "replicon" is
any genetic element (e.g., plasmid, chromosome, virus) that functions as an
autonomous unit of DNA
replication in vivo, i.e., capable of replication under its own control.
Particular examples of vectors
are described infra.
A "cassette" refers to a segment of DNA that can be inserted into a vector at
specific restriction sites.
The segment of DNA encodes a polypeptide of interest, and the cassette and
restriction sites are
designed to ensure insertion of the cassette in the proper reading frame for
transcription and
translation.
A cell has been "transfected" by exogenous or heterologous DNA when such DNA
has been
introduced inside the cell. A cell has been "transformed" by exogenous or
heterologous DNA when
the transfected DNA effects a phenotypic change. Preferably, the transforming
DNA should be
integrated (covalently linked) into chromosomal DNA making up the genome of
the cell.
"Heterologous" DNA refers to DNA not naturally located in the cell, or in a
chromosomal site of the
cell. Preferably, the heterologous DNA includes a gene foreign to the cell.
CA 02476239 2004-08-12
WO 03/068803 PCT/US03/04350
11
"Homologous recombination" refers to the insertion of a foreign DNA sequence
of a vector into a
chromosome. In particular, the vector targets a specific chromosomal site for
homologous
recombination. For specific homologous recombination, the vector will contain
sufficiently long
regions of homology to sequences of the chromosome to allow complementary
binding and
incorporation of the vector into the chromosome. Longer regions of homology,
and greater degrees of
sequence similarity, may increase the efficiency of homologous recombination.
In one aspect, the present invention extends to an isolated nucleic acid
molecule comprising DNA
sequence of Figure 1 (SEQ >D NO:1), a variant thereof, a fragment thereof, or
an analog or derivative
thereof.
A "nucleic acid molecule" refers to the phosphate ester polymeric form of
ribonucleosides (adenosine,
guanosine, uridine or cytidine; "RNA molecules") or deoxyribonucleosides
(deoxyadenosine,
deoxyguanosine, deoxythymidine, or deoxycytidine; "DNA molecules"), or any
phosphoester analogs
thereof, such as phosphorothioates and thioesters, in either single stranded
form, or a double-stranded
helix. Double stranded DNA-DNA, DNA-RNA and RNA-RNA helices are possible. The
term
nucleic acid molecule, and in particular DNA or RNA molecule, refers only to
the primary and
secondary structure of the molecule, and does not limit it to any particular
tertiary forms. Thus, this
term includes double-stranded DNA found, inter alia, in linear or circular DNA
molecules (e.g.,
restriction fragments), plasmids, and chromosomes. In discussing the structure
of particular double-
stranded DNA molecules, sequences may be described herein according to the
normal convention of
giving only the sequence in the 5' to 3' direction along the nontranscribed
strand of DNA (i.e., the
strand having a sequence homologous to the mRNA). A "recombinant DNA molecule"
is a DNA
molecule that has undergone a molecular biological manipulation.
An "isolated" nucleic acid molecule is one that is separated from other
nucleic acid molecules present
in the natural source of the nucleic acid. In particular, an "isolated"
nucleic acid is free of sequences
that naturally flank the nucleic acid encoding GAVE19 (i.e., sequences located
at the 5' and 3' ends of
the nucleic acid) in the genomic DNA of the organism from which the nucleic
acid is derived. In
various embodiments, the isolated GAVE19 nucleic acid molecule can contain
less than about 5 kb, 4
kb, 3 kb, 2 kb, 1 kb, 0.5 kb or 0.1 kb of nucleotide sequences that naturally
flank the nucleic acid
molecule in genomic DNA of the cell from which the nucleic acid is derived.
Moreover, an "isolated"
nucleic acid molecule, such as a cDNA molecule, can be substantially free of
other cellular material or
CA 02476239 2004-08-12
WO 03/068803 PCT/US03/04350
12
culture medium when produced by recombinant techniques or substantially free
of chemical
precursors or other chemicals when synthesized chemically.
A nucleic acid molecule of the present invention, e.g., a nucleic acid
molecule having the nucleotide
sequence of SEQ >D NO:1 or a fragment or complement of any of that nucleotide
sequence, or an
analog or derivative thereof, can be isolated using standard molecular biology
techniques and the
sequence information provided herein. Using all or a portion of the nucleic
acid sequence of
SEQ )D NO:1 as a hybridization probe, GAVE19 nucleic acid molecules can be
isolated using
standard hybridization and cloning techniques (e.g., as described in Sambrook
et a~.
A nucleic acid molecule of the invention can be amplified using cDNA, mRNA or
genomic DNA as a
template and appropriate oligonucleotide primers according to standard PCR
amplification techniques.
Such primers may be readily made using information set forth in SEQ )D NO:1,
and routine
laboratory techniques. The nucleic acid so amplified can be cloned into an
appropriate vector and
characterized by DNA sequence analysis. Furthermore, oligonucleotides
corresponding to GAVE19
nucleotide sequences can be prepared by standard synthetic techniques, e.g.,
using an automated DNA
synthesizer.
The present invention further extends to isolated nucleic acid molecules
hybridizable to GAVE19
DNA, hybridizable to a hybridization probe that is complementary under
stringent hybridization
conditions to GAVE19 DNA, or hybridizable under stringent hybridization
conditions to both. In
particular, the present invention extends to an isolated nucleic acid molecule
that is hybridizable under
stringent hybridization conditions to a nucleic acid molecule comprising a DNA
sequence of SEQ B7
NO:1, or to a probe that is complementary to an isolated nucleic acid molecule
comprising a DNA
sequence of SEQ m NO:1.
A nucleic acid molecule is "hybridizable" to another nucleic acid molecule,
such as a cDNA, genomic
DNA, or RNA, when a single stranded form of the nucleic acid molecule can
anneal to another nucleic
acid molecule under the appropriate conditions of temperature and solution
ionic strength (see
Sambrook et al., supra). The conditions of temperature and ionic strength
determine the "stringency"
of the hybridization. For preliminary screening for homologous nucleic acids,
low stringency
hybridization conditions, corresponding to a Tm of 55° C, can be used,
e.g., 5x SSC, 0.1% SDS, 0.25%
milk, and no formamide; or 30% formamide, 5x SSC, 0.5% SDS). Moderate
stringency hybridization
conditions correspond to a higher Tm, e.g., 40% formamide, with Sx or 6x SSC.
High stringency
CA 02476239 2004-08-12
WO 03/068803 PCT/US03/04350
13
hybridization conditions correspond to the highest T",, e.g., 50% formamide,
5x or 6x SSC.
Hybridization requires that the two nucleic acids contain complementary
sequences, although
depending on the stringency of the hybridization, mismatches between bases are
possible. The
appropriate stringency for hybridizing nucleic acids depends on the length of
the nucleic acids and the
degree of complementation, variables well known in the art. The greater the
degree of similarity or
homology between two nucleotide sequences, the greater the value of Tm for
hybrids of nucleic acids
having those sequences. The relative stability (corresponding to higher Tm) of
nucleic acid
hybridizations decreases in the following order: RNA:RNA, DNA:RNA, DNA:DNA.
For hybrids of
greater than 100 nucleotides in length, equations for calculating Tm have been
derived (see Sambrook
et al., supra, 9.50-0.51). For hybridization with shorter nucleic acids, i.e.,
oligonucleotides, the
position of mismatches becomes more important, and the length of the
oligonucleotide determines its
specificity (see Sambrook et al., supra, 11.7-11.8). A minimum length for a
hybridizable nucleic acid
molecule is at least about 20 nucleotides; particularly at least about 30
nucleotides; more particularly
at least about 40 nucleotides, even more particularly about 50 nucleotides,
and yet more particularly at
least about 60 nucleotides. In a particular embodiment of the present
invention, a hybridizable nucleic
acid molecule of the invention is at least 300, 325, 350, 375, 400, 425, 450,
500, 550, 600, 650, 700,
800, 900, 1000 or 1100 nucleotides in length and hybridizes under stringent
conditions to the nucleic
acid molecule comprising the nucleotide sequence, preferably the coding
sequence, of SEQ >D NO:1 a
complement thereof, or a fragment thereof.
As used herein, the term "hybridizes under stringent conditions" is intended
to describe conditions for
hybridization and washing under which nucleotide sequences at least 55%, 60%,
65%, 70% and
preferably 75% or more complementary to each other typically remain
hybridized. Such stringent
conditions are known to those skilled in the art and can be found in "Current
Protocols in Molecular
Biology", John Wiley & Sons, N.Y. (1989), 6.3.1-6.3.6. A preferred, non-
limiting example of
stringent hybridization conditions are hybridization in 6X sodium
chloride/sodium citrate (SSC) at
about 45° C, followed by one or more washes in 0.2X SSC, 0.1% SDS at 50-
65° C. Preferably, an
isolated nucleic acid molecule of the invention that hybridizes under
stringent conditions to the
sequence of SEQ m NO:1 or the complement thereof corresponds to a naturally
occurring nucleic
acid molecule. As used herein, a "naturally-occurring" nucleic acid molecule
refers to an RNA or
DNA molecule having a nucleotide sequence that occurs in nature (e.g., encodes
a natural protein).
The skilled artisan will appreciate that the conditions may be modified in
view of sequence-specific
variables (e.g., length, G-C richness etc.).
CA 02476239 2004-08-12
WO 03/068803 PCT/US03/04350
14
The invention contemplates encompassing nucleic acid fragments of GAVE19 that
are diagnostic of
GAVE19-like molecules that have similar properties. The diagnostic fragments
can arise from any
portion of the GAVE19 gene including flanking sequences. The fragments can be
used as probe of a
library practicing known methods.
Moreover, a nucleic acid molecule of the invention can comprise only a portion
of a nucleic acid
sequence encoding GAVE19, for example, a fragment that can be used as a probe
or primer, or a
fragment encoding a biologically active portion of GAVE19. For example, such a
fragment can
comprise, but is not limited to, a region encoding amino acid residues about 1
to about 14 of
SEQ >D N0:2. The nucleotide sequence determined from the cloning of the human
GAVE19 gene
allows for the generation of probes and primers for identifying and/or cloning
GAVE19 homologues
in other cell types, e.g., from other tissues, as well as GAVE19 homologues
from other mammals.
The probe/primer typically comprises substantially purified oligonucleotide.
The oligonucleotide
typically comprises a region of nucleotide sequence that hybridizes under
stringent conditions to at
least about 12, preferably about 25, more preferably about 50, 75, 100, 125,
150, 175, 200, 250, 300,
350 or 400 consecutive nucleotides of the sense or anti-sense sequence of SEQ
>D NO:1 or of a
naturally occurring mutant of SEQ >D NO:1. Probes based on a GAVE19 nucleotide
sequence can be
used to detect transcripts or genomic sequences encoding the similar or
identical proteins.
As used herein, the terms "fragment" or "portion" of an isolated nucleic acid
molecule of the present
invention comprise at least 12, particularly about 25, more particularly about
50, 75, 100, 125, 150,
175, 200, 250, 300, 350 or 400 consecutive nucleotides. Consequently, a
"fragment" of an isolated
nucleic acid molecule of the present invention is not merely 1 or 2
nucleotides.
Similarly, a "fragment" or "portion" of a polypeptide of the present invention
comprises at least 9
contiguous amino acid residues. A particular example of a fragment of a
polypeptide of the present
invention comprises an epitope to which a GAVE19 antibody, or fragment
thereof, binds.
A nucleic acid fragment encoding a "biologically active portion of GAVE19" can
be prepared by
isolating a portion of SEQ >D NO:1 that encodes a polypeptide having a GAVE19
biological activity,
expressing the encoded portion of GAVE19 protein (e.g., by recombinant
expression in vitro) and
assessing the activity of the encoded portion of GAVE 19. The invention
further encompasses nucleic
acid molecules that differ from the nucleotide sequence of SEQ >D NO:1 due to
degeneracy of the
genetic code, and thus encode the same GAVE19 protein as that encoded by the
nucleotide sequence
shown in SEQ >I7 NO:1.
CA 02476239 2004-08-12
WO 03/068803 PCT/US03/04350
The present invention further extends to an isolated nucleic acid molecule
that is homologous to a
GAVE19 DNA molecule, e.g., is homologous to an isolated nucleic acid molecule
having a DNA
5 sequence of SEQ ID NO:1. Two DNA sequences are "substantially homologous" or
"substantially
similar" when at least about 50% (preferably at least about 75%, and most
preferably at least about 90
or 95%) of the nucleotides match over the defined length of the DNA sequences.
Sequences that are
substantially homologous can be identified by comparing the sequences using
standard software
available in sequence data banks using default parameters, or in a Southern
hybridization experiment
10 under, for example, stringent conditions as defined for that particular
system. Defining appropriate
hybridization conditions is within the skill of the art. See, e.g., Maniatis
et al., supra; DNA Cloning,
Vols. I & II, supra; Nucleic Acid Hybridization, supra. Moreover, nucleic acid
molecules encoding
GAVE19 proteins from other species (GAVE19 homologues) with a nucleotide
sequence that differs
from that of a human GAVE19, are intended to be within the scope of the
invention.
Variants of an Tanlated NLCleic acid Molecule of the present Tnvention
The present invention further extends to variants of an isolated nucleic acid
molecule comprising a
DNA sequence of SEQ >D NO:1. Such variants can be degenerate, allelic, or a
combination thereof.
Nucleic acid molecules corresponding to natural allelic variants and
homologues of the GAVE19
cDNA of the invention can be isolated based on identity with the murine GAVE19
nucleic acids
disclosed herein using the murine cDNA or a portion thereof, as a
hybridization probe according to
standard hybridization techniques under stringent hybridization conditions.
The term "corresponding to" is used herein to refer similar or homologous
sequences, whether the
exact position is identical or different from the molecule to which the
similarity or homology is
measured. Thus, the term "corresponding to" refers to the sequence similarity,
and not the numbering
of the amino acid residues or nucleotide bases.
Moreover, due to degenerate nature of codons in the genetic code, a GAVE19
protein of the present
invention can be encoded by numerous isolated nucleic acid molecules.
"Degenerate nature" refers to
the use of different three-letter codons to specify a particular amino acid
pursuant to the genetic code.
It is well known in the art that the following codons can be used
interchangeably to code for each
specific amino acid:
Phenylalanine (Phe or F) LTLIU or WC
CA 02476239 2004-08-12
WO 03/068803 PCT/US03/04350
16
Leucine (Leu or L) UUA or UUG or CUU or CUC or CUA or CUG
Isoleucine (Ile or I) AUU or AUC or AUA
Methionine (Met or M) AUG
Valine (Val or V) GUU or GUC of GUA or GUG
Serine (Ser or S) UCU or UCC or UCA or UCG or
AGU or AGC
Proline (Pro or P) CCU or CCC or CCA or CCG
Threonine (Thr or T) ACU or ACC or ACA or ACG
Alanine (Ala or A) GCU or GCG or GCA or GCG
Tyrosine (Tyr or Y) UAU or UAC
Histidine (His or CAU or CAC
H)
Glutamine (Gln or Q) CAA or CAG
Asparagine (Asn or AAU or AAC
N)
Lysine (Lys or K) AAA or AAG
Aspartic Acid (Asp GAU or GAC
or D)
Glutamic Acid (Glu GAA or GAG
or E)
Cysteine (Cys or C) UGU or UGC
Arginine (Arg or R) CGU or CGC or CGA or CGG or AGA or AGG
Glycine (Gly or G) GGU or GGC or GGA or GGG
Tryptophan (Trp or W) UGG
Termination codon UAA (ochre) or UAG (amber) or UGA (opal)
It should be understood that the codons specified above are for RNA sequences.
The corresponding
codons for DNA have a T substituted for U.
In addition to the murine GAVE19 nucleotide sequence shown in SEQ ID NO:1, it
will be appreciated
by those skilled in the art that DNA sequence polymorphisms that lead to
changes in the amino acid
sequences of GAVE19 may exist within a population. Such genetic polymorphism
in the GAVE19
gene may exist among individuals within a population due to natural allelic
variation. An allele is one
of a group of genes that occur alternatively at a given genetic locus. As used
herein, the terms "gene"
and "recombinant gene" refer to nucleic acid molecules comprising an open
reading frame encoding a
GAVE19 protein, preferably a mammalian GAVE19 protein. As used herein, the
phrase "allelic
variant" refers to a nucleotide sequence that occurs at a GAVE19 locus or to a
polypeptide encoded by
the nucleotide sequence. Alternative alleles can be identified by sequencing
the gene of interest in a
number of different individuals. That can be carried out readily by using
hybridization probes to
identify the same genetic locus in a variety of individuals. Any and all such
nucleotide variations and
CA 02476239 2004-08-12
WO 03/068803 PCT/US03/04350
17
resulting amino acid polymorphisms or variations in GAVE19 that are the result
of natural allelic
variation and that do not alter the functional activity of GAVE19 are intended
to be within the scope
of the invention.
Moreover, variants of an isolated nucleic acid molecule of the present
invention can be readily made
by one of ordinary skill in the art using routine laboratory techniques, e.g.,
site-directed mutagenesis.
The instant invention also extends to antisense nucleic acid molecules, i.e.,
molecules that are
complementary to a sense nucleic acid encoding a protein, e.g., complementary
to the coding strand of
a double-stranded cDNA molecule or complementary to an mRNA sequence.
Accordingly, an
antisense nucleic acid can hydrogen bond to a sense nucleic acid. The
antisense nucleic acid can be
complementary to an entire GAVE19 coding strand or to only a portion thereof,
e.g., all or part of the
protein coding region (or open reading frame). An antisense nucleic acid
molecule can be antisense to
a noncoding region of the coding strand of a nucleotide sequence encoding
GAVE19. The noncoding
regions ("5' and 3' untranslated regions") are the 5' and 3' sequences that
flank the coding region and
are not translated into amino acids.
Given the coding strand sequences encoding GAVE19 disclosed herein (e.g., SEQ
)D NO:1),
antisense nucleic acids of the invention can be designed according to the
rules of Watson & Crick
base pairing. The antisense nucleic acid molecule can be complementary to the
entire coding region
of GAVE19 mRNA, but more preferably is an oligonucleotide that is antisense to
only a portion of the
coding or noncoding region of GAVE19 mRNA. For example, the antisense
oligonucleotide can be
complementary to the region surrounding the translation start site of GAVE19
mRNA. An antisense
oligonucleotide can be, for example, about 5, 10, 15, 20, 25, 30, 35, 40, 45
or SO nucleotides in length.
An antisense nucleic acid of the invention can be constructed using chemical
synthesis and enzymatic
ligation reactions using procedures known in the art. For example, an
antisense nucleic acid (e.g., an
antisense oligonucleotide) can be synthesized chemically using naturally
occurring nucleotides or
various chemically modified nucleotides designed to increase the biological
stability of the molecules,
or to increase the physical stability of the duplex formed between the
antisense and sense nucleic
acids, e.g., phosphorothioate derivatives, phosphonate derivatives and
acridine-substituted nucleotides
can be used.
Examples of modified nucleotides that can be used to generate the antisense
nucleic acid include
5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine,
xanthine, 4-acetylcytosine,
CA 02476239 2004-08-12
WO 03/068803 PCT/US03/04350
18
5-(carboxyhydroxylmethyl)uracil, 5-carboxymethylaminomethyl-2-thiouridine,
5-carboxymethylaminomethyluracil, dihydrouracil, (3-D-galactosylqueosine,
inosine,
N6-isopentenyladenine, 1-methylguanine, 1-methylinosirle, 2,2-dimethylguanine,
2-methyladenine,
2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-
methylguanine,
5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, (3-D-
mannosylqueosine,
5-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N6-
isopentenyladenine,
uracil-5-oxyacetic acid, wybutoxosirie, pseudouracil, queosine, 2-
thiocytosine, 5-methyl-2-thiouracil,
2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid
methylester, uracil-5-oxyacetic acid,
5-methyl-2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl)uracil and 2,6-
diaminopurine. Alternatively,
the antisense nucleic acid can be produced biologically using an expression
vector into which a
nucleic acid has been subcloned in an antisense orientation (i.e., RNA
transcribed from the inserted
nucleic acid will be of an antisense orientation to a target nucleic acid of
interest).
The antisense nucleic acid molecules of the invention typically are
administered to a subject or
generated in situ so as to hybridize with or bind to cellular mRNA and/or
genomic DNA encoding a
GAVE19 protein thereby to inhibit expression of the protein, e.g., by
inhibiting transcription and/or
translation. The hybridization can be by conventional nucleotide
complementarity to form a stable
duplex, or, for example, in the case of an antisense nucleic acid molecule
that binds to DNA duplexes,
through specific interactions in the major groove of the double helix, or to a
regulatory region of
GAVE 19.
An example of a route of administration of antisense nucleic acid molecules of
the invention includes
direct injection at a tissue site. Alternatively, antisense nucleic acid
molecules can be modified to
target selected cells and then administered systemically. For example, for
systemic administration,
antisense molecules can be modified such that the molecules specifically bind
to receptors or antigens
expressed on a selected cell surface, e.g., by linking the antisense nucleic
acid molecules to peptides
or antibodies that bind to cell surface receptors or antigens. The antisense
nucleic acid molecules also
can be delivered to cells using the vectors described herein. To achieve
sufficient intracellular
concentrations of the antisense molecules, vector constructs in which the
antisense nucleic acid
molecule is placed under the control of a strong pol II or pol III promoter
are preferred.
An antisense nucleic acid molecule of the invention can be an a-anomeric
nucleic acid molecule. An
a-anomeric nucleic acid molecule forms specific double-stranded hybrids with
complementary RNA
in that the strands run parallel to each other (Gaultier et al., Nucleic Acids
Res (1987)15:6625-6641).
The antisense nucleic acid molecule also can comprise a methylribonucleotide
(moue et al., Nucleic
CA 02476239 2004-08-12
WO 03/068803 PCT/US03/04350
19
Acids Res (1987) 15:6131-6148) or a chimeric RNA-DNA analogue (moue et al.,
FEBS Lett (1987)
215:327-330).
The invention also encompasses ribozymes. Ribozymes are catalytic RNA
molecules with
ribonuclease activity that are capable of cleaving a single-stranded nucleic
acid, such as an mRNA,
that hybridizes to the ribozyme. Thus, ribozymes (e.g., hammerhead ribozymes
(described in
Haselhoff et al., Nature (1988) 334:585-591)) can be used to cleave
catalytically GAVE19 mRNA
transcripts, and thus inhibit translation of GAVE19 mRNA. A ribozyme having
specificity for a
GAVE19-encoding nucleic acid can be designed based on the nucleotide sequence
of a GAVE19
DNA disclosed herein (e.g., SEQ )17 NO:1). For example, a derivative of a
Tetrahymena L-19 NS
RNA can be constructed so that the nucleotide sequence of the active site is
complementary to the
nucleotide sequence to be cleaved in a GAVE19-encoding mRNA, see, e.g., U.S.
Patent Nos.
4,987,071 and 5,116,742. Alternatively, GAVE19 mRNA can be used to select a
catalytic RNA
having a specific ribonuclease activity from a pool of RNA molecules, see,
e.g., Bartel et al., Science
(1993) 261:1411-1418.
Triple Helical Nucleic Acid Mnle.culeS and Pentid N ~ .1 i . A .ids of th . ~f
th . Pr ~ .nt Tnventinn
The invention also encompasses nucleic acid molecules that form triple helical
structures. For
example, GAVE19 gene expression can be inhibited by targeting nucleotide
sequences
complementary to the regulatory region of the GAVE19 (e.g., the GAVE19
promoter and/or
enhancers) to form triple helical structures that prevent transcription of the
GAVE19 gene in target
cells, see generally, Helene, Anticancer Drug Des (1991) 6(6):569; Helene Ann
NY Acad Sci (1992)
660:27; and Maher, Bioassays (1992) 14(12):807.
In particular embodiments, the nucleic acid molecules of the invention can be
modified at the base
moiety, sugar moiety or phosphate backbone to improve, e.g., the stability,
hybridization or solubility
of the molecule. For example, the deoxyribose phosphate backbone of the
nucleic acids can be
modified to generate peptide nucleic acids (see Hyrup et al., Bioorganic &
Medicinal Chemistry
(1996) 4:5). As used herein, the terms "peptide nucleic acids" or "PNAs" refer
to nucleic acid
mimics, e.g., DNA mimics, in that the deoxyribose phosphate backbone is
replaced by a
pseudopeptide backbone and only the four natural nucleobases are retained. The
neutral backbone of
PNAs has been shown to allow for specific hybridization to DNA and RNA under
conditions of low
ionic strength. The synthesis of PNA oligomers can be performed using standard
solid phase peptide
CA 02476239 2004-08-12
WO 03/068803 PCT/US03/04350
synthesis protocols as described in Hyrup et al. (1996) supra; Perry-O'Keefe
et al., Proc Natl Acad Sci
USA (1996) 93:14670.
PNAs of GAVE19 can also be used in therapeutic and diagnostic applications.
For example, PNAs
can be used as antisense or antigene agents for sequence-specific modulation
of gene expression by,
e.g., inducing transcription or translation arrest or inhibiting replication.
PNAs of GAVE19 also can
be used. For example, a PNA can be used in the analysis of single base pair
mutations in a gene by,
e.g., PNA-directed PCR clamping; as artificial restriction enzymes when used
in combination with
other enzymes, e.g., S1 nucleases (Hyrup et al. (1996) supra) or as probes or
primers for DNA
10 sequence and hybridization (Hyrup et al. (1996) supra; Perry-O'Keefe et al.
(1996) supra).
In another embodiment, PNAs of GAVE19 can be modified, e.g., to enhance
stability, specificity or
cellular uptake, by attaching lipophilic or other helper groups to the PNA, by
the formation of
PNA-DNA chimeras or by the use of liposomes or other techniques of drug
delivery known in the art.
15 The synthesis of PNA-DNA chimeras can be performed as described in Hyrup et
al. (1996) supra,
Finn et al., Nucleic Acids Res (1996) 24(17):3357-63, Mag et al., Nucleic
Acids Res (1989) 17:5973;
and Peterser et al., Bioorganic Med Chem Lett (1975) 5:1119.
20 Moreover, the present invention extends to an isolated polypeptide
comprising the amino acid
sequence of Figure 2 (SEQ >D N0:2), a variant thereof, a fragment thereof or
an analog or derivative
thereof.
An isolated nucleic acid molecule encoding a GAVE19 protein having a sequence
that differs from
that of SEQ >D N0:2, e.g. a variant, can be created by introducing one or more
nucleotide
substitutions, additions or deletions into the nucleotide sequence of SEQ >D
NO:1 such that one or
more amino acid substitutions, additions or deletions are introduced into the
encoded protein.
In a particular embodiment, a mutant GAVE19 protein can be assayed for: (1)
the ability to form
protein:protein interactions with proteins in the GAVE19 signaling pathway;
(2) the ability to bind a
GAVE19 ligand; or (3) the ability to bind to an intracellular target protein.
In yet another
embodiment, a mutant GAVE19 can be assayed for the ability to modulate
cellular proliferation or
cellular differentiation.
CA 02476239 2004-08-12
WO 03/068803 PCT/US03/04350
21
Native. GAVE19 proteins can be isolated from cells or tissue sources by an
appropriate purification
scheme using standard protein purification techniques. Alternatively, GAVE19
proteins can readily
be produced by recombinant DNA techniques. Yet another alternative encompassed
by the present
invention is the chemical synthesis of a GAVE19 protein or polypeptide using
standard peptide
synthesis techniques.
An "isolated" or "purified" protein, or biologically active portion thereof,
is substantially free of
cellular material or other contaminating proteins from the cell or tissue
source from which the
GAVE19 protein is derived, or is substantially free of chemical precursors or
other chemicals when
chemically synthesized. The phrase, "substantially free of cellular material"
includes preparations of
GAVE19 protein in which the protein is separated from cellular components of
the cells from which
the protein is isolated or recombinantly produced. Thus, GAVE19 protein that
is substantially free of
cellular material includes preparations of GAVE19 protein having less than
about 30%, 20%, 10% or
5% or less (by dry weight) of non-GAVE19 protein (also referred to herein as a
"contaminating
protein"). When the GAVE19 protein or biologically active portion thereof is
produced
recombinantly, it also is preferably substantially free of culture medium,
i.e., culture medium
represents less than about 20%, 10% or 5% or less of the volume of the protein
preparation. When
GAVE19 protein is produced by chemical synthesis, it is preferably
substantially free of chemical
precursors or other chemicals, i.e., it is separated from chemical precursors
or other chemicals that are
involved in the synthesis of the protein. Accordingly, such preparations of
GAVE19 protein have less
than about 30%, 20%, 10% or 5% or less (by dry weight) of chemical precursors
or non-GAVE19
chemicals.
Biologically active portions or fragments of a GAVE19 protein include peptides
comprising amino
acid sequences sufficiently identical to or derived from the amino acid
sequence of the GAVE19
protein (e.g., the amino acid sequence shown in SEQ 1D N0:2), that include
fewer amino acids than
the full length GAVE19 protein and exhibit at least one activity of a GAVE19
protein. Typically,
biologically active portions comprise a domain or motif with at least one
activity of a GAVE19
protein. A biologically active portion of a GAVE19 protein can be a
polypeptide that is, for example,
10, 25, S0, 100 or more amino acids in length. Particular biologically active
polypeptides include one
or more identiEed GAVE19 structural domains.
Moreover, other biologically active portions, in which other regions of the
protein are deleted, can be
prepared by recombinant techniques and evaluated for one or more of the
functional activities of a
native GAVE19 protein.
CA 02476239 2004-08-12
WO 03/068803 PCT/US03/04350
22
Other useful GAVE 19 proteins are substantially identical to SEQ ID N0:2 and
retain a functional
activity of the protein of SEQ ID N0:2 yet differ in amino acid sequence due
to natural allelic
variation or mutagenesis. For example, such GAVE19 proteins and polypeptides
possess at least one
biological activity described herein.
Accordingly, a useful GAVE19 protein is a protein that includes an amino acid
sequence at least about
45%, preferably 55%, 65%, 75%, 85%, 95%, 99% or 100%identical to the amino
acid sequence of
SEQ ID N0:2 and retains a functional activity of a GAVE19 protein of SEQ ID
N0:2. In a particular
embodiment, the GAVE19 protein retains a functional activity of the GAVE19
protein of
SEQ ID N0:2.
To determine the percent identity of two amino acid sequences or of two
nucleic acids, the sequences
are aligned for optimal comparison purposes (e.g., gaps can be introduced in
the sequence of a first
amino acid or nucleic acid sequence for optimal alignment with a second amino
or nucleic acid
sequence). The amino acid residues or nucleotides at corresponding amino acid
positions or
nucleotide positions then are compared. When a position in the first sequence
is occupied by the same
amino acid residue or nucleotide as the corresponding position in the second
sequence, then the
molecules are considered identical at that position. The percent identity
between the two sequences is
a function of the number of identical positions shared by the sequences (i.e.,
percent identity = number
of identical positions/total number of positions (e.g., overlapping positions)
X 100). In one
embodiment, the two sequences are the same length.
The determination of percent identity between two sequences can be
accomplished using a
mathematical algorithm. A particular, non-limiting example of a mathematical
algorithm utilized for
the comparison of two sequences is the algorithm of Karlin et al., Proc Natl
Acad Sci USA (1990)
87:2264, modified as in Karlin et al., Proc Natl Acad Sci USA (1993) 90:5873-
5877. Such an
algorithm is incorporated into the NBLAST and XBLAST programs of Altschul et
al., J Mol Bio
(1990) 215:403. BLAST nucleotide searches can be performed with the NBLAST
program, for
example, score=100, wordlength=12, to obtain nucleotide sequences homologous
to a GAVE19
nucleic acid molecule of the present invention. BLAST protein searches can be
performed with the
XBLAST program, score=50, wordlength=3 to obtain amino acid sequences
homologous to a
GAVE19 protein molecule of the invention. To obtain gapped alignments for
comparison purposes,
Gapped BLAST can be utilized as described in Altschul et al., Nucleic Acids
Res (1997) 25:3389.
Alternatively, PSI-Blast can be used to perform an iterated search that
detects distant relationships
CA 02476239 2004-08-12
WO 03/068803 PCT/US03/04350
23
between molecules. Altschul et al. (1997) supra. When utilizing BLAST, Gapped
BLAST and
PSI-Blast programs, the default parameters of the respective programs (e.g.,
XBLAST and NBLAST)
can be used, see http://www.ncbi.nlm.nih.gov.
Another particular, non-limiting example of a mathematical algorithm utilized
for the comparison of
sequences is the algorithm of Myers et al., CABIOS (1988) 4:11-17. Such an
algorithm is
incorporated into the ALIGN program (version 2.0) that is part of the GCG
sequence alignment
software package. When utilizing the ALIGN program for comparing amino acid
sequences, a
PAM120 weight residue table, a gap length penalty of 12 and a gap penalty of 4
may be used.
The percent identity between two sequences can be determined using techniques
similar to those
described above, with or without allowing gaps. In calculating percent
identity, only exact matches
are counted.
The present invention further extends to GAVE19 chimeric or fusion proteins.
As used herein, a
GAVE19 "chimeric protein" or "fusion protein" comprises a GAVE19 polypeptide
operably linked to
a non-GAVE19 polypeptide. A "GAVE19 polypeptide~~ refers to a polypeptide
having an amino acid
sequence corresponding to GAVE19. A "non-GAVE19 polypeptide" refers to a
polypeptide having
an amino acid sequence corresponding to a protein that is not substantially
identical to the GAVE19
protein, e.g., a protein that is different from the GAVE19 protein and is
derived from the same or a
different organism. Within a GAVE19 fusion protein, the GAVE19 polypeptide can
correspond to all
or a portion of a GAVE19 protein, preferably at least one biologically active
portion of a GAVE19
protein. Within the fusion protein, the term "operably linked" is intended to
indicate that the
GAVE19 polypeptide and the non-GAVE19 polypeptide are fused in-frame to each
other. The
non-GAVE19 polypeptide can be fused to the N-terminus or C-terminus of a
GAVE19 polypeptide.
One useful fusion protein is GST-GAVE19 in which a GAVE19 sequence is fused to
the C-terminus
of glutathione-S-transferase (GST). Such fusion proteins can facilitate the
purification of recombinant
GAVE 19.
In another embodiment, a fusion protein of the present invention extends to a
GAVE19-immunoglobulin fusion protein in which all or part of GAVE19 is fused
to sequences
derived from a member of the immunoglobulin protein family. The GAVE19-
immunoglobulin fusion
proteins of the invention can be incorporated into pharmaceutical compositions
and administered to a
subject to inhibit an interaction between a GAVE19 ligand and a GAVE19 protein
on the surface of a
cell, thereby to suppress GAVE19-mediated signal transduction in vivo. The
CA 02476239 2004-08-12
WO 03/068803 PCT/US03/04350
24
GAVE19-immunoglobulin fusion proteins can be used to affect the
bioavailability of a GAVE19
cognate ligand. Inhibition of the GAVE19 ligand-GAVE19 interaction may be
useful therapeutically,
both for treating proliferative and differentiative disorders and for
modulating (e.g. promoting or
inhibiting) cell survival. Moreover, the GAVE 19-immunoglobulin fusion
proteins of the invention
can be used as immunogens to produce anti-GAVE19 antibodies in a subject, to
purify GAVE19
ligands and in screening assays to identify molecules that inhibit the
interaction of GAVE19 with a
GAVE19 ligand.
In a particular embodiment, a GAVE19 chimeric or fusion protein of the present
invention is produced
by standard recombinant DNA techniques. For example, DNA fragments coding for
the different
polypeptide sequences are ligated together in-frame in accordance with
conventional techniques, for
example, by employing blunt-ended or stagger-ended termini for ligation,
restriction enzyme digestion
to provide for appropriate termini, filling-in of cohesive ends as
appropriate, alkaline phosphatase
treatment to avoid undesirable joining and enzymatic ligation. In another
embodiment, the fusion
gene can be synthesized by conventional techniques including automated DNA
synthesizers.
Alternatively, PCR amplification of gene fragments can be carried out using
anchor primers that give
rise to complementary overhangs between two consecutive gene fragments that
subsequently can be
annealed and reamplified to generate a chimeric gene sequence (see e.g.,
Ausubel et al., supra).
Moreover, many expression vectors are commercially available that already
encode a fusion moiety
(e.g., a GST polypeptide). A GAVE19-encoding nucleic acid can be cloned into
such an expression
vector so that the fusion moiety is linked in-frame to the GAVE19 protein.
As explained above, the present invention further extends to variants of the
GAVE19 protein. For
example, mutations may be introduced into the amino acid sequence of SEQ ID
N0:2 using standard
techniques, such as site-directed mutagenesis and PCR-mediated mutagenesis.
Moreover,
conservative amino acid substitutions can be made at one or more predicted non-
essential amino acid
residues. A "conservative amino acid substitution" is one in which the amino
acid residue is replaced
with an amino acid residue having a similar side chain. For example, one or
more amino acids can be
substituted by another amino acid of a similar polarity, which acts as a
functional equivalent, resulting
in a silent alteration. Substitutes for an amino acid within the amino acid
sequence of a polypeptide of
the present invention may be selected from other members of the class to which
the amino acid
belongs. For example, the nonpolar (hydrophobic) amino acids include alanine,
leucine, isoleucine,
valine, proline, phenylalanine, tryptophan and methionine. Amino acids
containing aromatic ring
structures are phenylalanine, tryptophan, and tyrosine. The polar neutral
amino acids include glycine,
CA 02476239 2004-08-12
WO 03/068803 PCT/US03/04350
serine, threonine, cysteine, tyrosine, asparagine, and glutamine. The
positively charged (basic) amino
acids include arginine, lysine and histidine. The negatively charged (acidic)
amino acids include
aspartic acid and glutamic acid. Such alterations will not be expected to
effect apparent molecular
weight as determined by polyacrylamide gel electrophoresis, or isoelectric
point.
Particularly preferred substitutions are:
- Lys for Arg and vice versa such that a positive charge may be maintained;
- Glu for Asp and vice versa such that a negative charge may be maintained;
- Ser for Thr such that a free -OH can be maintained; and
10 - Gln for Asn such that a free NHZ can be maintained.
Moreover, amino acid substitutions may also be introduced to substitute an
amino acid with a
particularly preferable property. For example, a Cys may be introduced for a
potential site for
disulfide bridges with another Cys. A His may be introduced as a particularly
"catalytic" site (i.e., His
15 can act as an acid or base and is the most common amino acid in biochemical
catalysis). Pro may be
introduced because of its particularly planar structure, which induces (3-
turns in the protein's structure.
Mutations can also be introduced randomly along all or part of a GAVE19 coding
sequence, such as
by saturation mutagenesis, and the resultant mutants can be screened for
GAVE19 biological activity
20 to identify mutants that retain activity. Following mutagenesis, the
encoded protein can be expressed
recombinantly and the activity of the protein can be determined.
Variants of the present invention can function as a GAVE19 agonist (mimetic)
or as GAVE19
antagonist. Variants of the GAVE19 protein can be generated by mutagenesis,
e.g., discrete point
25 mutation or truncation of the GAVE19 protein. An agonist of the GAVE19
protein can retain
substantially the same or a subset of the biological activities of the
naturally occurring GAVE19
protein. For example, an antagonist of the GAVE19 protein can competitively
bind to a downstream
or upstream member of a cellular signaling cascade that includes the GAVE19
protein, and thus
inhibit one or more of the activities of the naturally occurring form of the
GAVE19 protein. Thus,
specific biological effects can be elicited by treatment with a variant of
limited function. Treatment of
a subject with a variant having a subset of the biological activities of the
naturally occurring form of
the protein can have fewer side effects in a subject relative to treatment
with the naturally occurring
form of the GAVE19 proteins.
CA 02476239 2004-08-12
WO 03/068803 PCT/US03/04350
26
Variants of the GAVE19 protein that function as either GAVE19 agonists
(mimetics) or as GAVE19
antagonists can be identified by screening combinatorial libraries of mutants,
e.g., truncation mutants,
of the GAVE19 protein for GAVE19 agonist or antagonist activity. In one
embodiment, a variegated
library of GAVE19 variants is generated by combinatorial mutagenesis at the
nucleic acid level, and is
S encoded by a variegated gene library. A variegated library of GAVE19
variants can be produced by,
for example, enzymatically ligating a mixture of synthetic oligonucleotides
into gene sequences such
that a degenerate set of potential GAVE19 sequences is expressed as individual
polypeptides or
alternatively, as a set of larger fusion proteins (e.g., for phage display)
containing the set of GAVE19
sequences therein. There are a variety of methods that can be used to produce
libraries of potential
GAVE19 variants from a degenerate oligonucleotide sequence. Chemical synthesis
of a degenerate
gene sequence can be performed in an automated DNA synthesizer and the
synthetic gene then ligated
into an appropriate expression vector. Use of a degenerate set of genes allows
for the provision, in
one mixture, of all of the sequences encoding the desired set of potential
GAVE 19 sequences.
Methods for synthesizing degenerate oligonucleotides are known in the art
(see, e.g., Narang,
Tetrahedron (1983) 39:3; Itakura et al., Ann Rev Biochem (1984) 53:323;
Itakura et al., Science
(1984) 198:1056; Ike et al., Nucleic Acid Res (1983) 11:477).
In addition, libraries of fragments of the GAVE19 protein coding sequence can
be used to generate a
variegated population of GAVE19 fragments for screening and subsequent
selection of variants of a
GAVE19 protein. In one embodiment, a library of coding sequence fragments can
be generated by
treating a double-stranded PCR fragment of a GAVE19 coding sequence with a
nuclease under
conditions wherein nicking occurs only about once per molecule, denaturing the
double-stranded
DNA, renaturing the DNA to form double-stranded DNA that can include
sense/antisense pairs from
different nicked products, removing single-stranded portions from reformed
duplexes by treatment
with S 1 nuclease and ligating the resulting fragment library into an
expression vector. By this method,
an expression library can be derived that encodes N-terminal and internal
fragments of various sizes of
the GAVE19 protein.
Several techniques are known in the art for screening gene products of
combinatorial libraries made
by point mutations or truncation and for screening cDNA libraries for gene
products having a selected
property. Such techniques are adaptable for rapid screening of the gene
libraries generated by the
combinatorial mutagenesis of GAVE19 proteins. The most widely used techniques
that are amenable
to high through-put analysis for screening large gene libraries typically
include cloning the gene
library into replicable expression vectors, transforming appropriate cells
with the resulting library of
vectors, and expressing the combinatorial genes under conditions in which
detection of a desired
CA 02476239 2004-08-12
WO 03/068803 PCT/US03/04350
27
activity facilitates isolation of the vector encoding the gene whose product
was detected. Recursive
ensemble mutagenesis (REM), a technique that enhances the frequency of
functional mutants in the
libraries, can be used in combination with the screening assays to identify
GAVE19 variants (Arkin et
al., Proc Natl Acad Sci USA (1992) 89:7811-7815; Delgrave et al., Protein
Engineering (1993)
6(3):327-331).
Moreover, the present invention also includes derivatives or analogs of GAVE19
produced from a
chemical modification. A GAVE19 protein of the present invention may be
derivatized by the
attachment of one or more chemical moieties to the protein moiety.
Chemical Moieties For Derivatization. The chemical moieties suitable for
derivatization may be
selected from among water soluble polymers so that the GAVE19 analog or
derivative does not
precipitate in an aqueous environment, such as a physiological environment.
Optionally, the polymer
will be pharmaceutically acceptable. One skilled in the art will be able to
select the desired polymer
based on such considerations as whether the polymer/component conjugate will
be used
therapeutically, and if so, the desired dosage, circulation time, resistance
to proteolysis, and other
considerations. For GAVE19, these may be ascertained using the assays provided
herein. Examples
of water soluble polymers having applications herein include, but are not
limited to, polyethylene
glycol, copolymers of ethylene glycol/propylene glycol,
carboxymethylcellulose, dextran, polyvinyl
alcohol, polyvinyl pyrrolidone, poly-1, 3-dioxolane, poly-1,3,6-trioxane,
ethylene/maleic anhydride
copolymer, polyaminoacids (either homopolymers or random copolymers), dextran,
poly(n-vinyl
pyrrolidone)polyethylene glycol, propropylene glycol homopolymers,
polypropylene oxide/ethylene
oxide co- polymers, polyoxyethylated polyols or polyvinyl alcohol.
Polyethylene glycol
propionaldenhyde may have advantages in manufacturing due to its stability in
water.
The polymer may be of any molecular weight, and may be branched or unbranched.
For polyethylene
glycol, the preferred molecular weight is between about 2 kDa and about 100
kDa (the term "about"
indicating that in preparations of polyethylene glycol, some molecules will
weigh more, some less,
than the stated molecular weight) for ease in handling and manufacturing.
Other sizes may be used,
depending on the desired therapeutic profile (e.g., the duration of sustained
release desired, the effects
if any, on biological activity, the ease in handling, the degree or lack of
antigenicity and other known
effects of the polyethylene glycol to a therapeutic protein or analog).
The number of polymer molecules so attached to GAVE19 may vary, and one
skilled in the art will be
CA 02476239 2004-08-12
WO 03/068803 PCT/US03/04350
28
able to ascertain the effect on function. One may mono-derivatize, or may
provide for a di-, tri-, tetra-
or some combination of derivatization, with the same or different chemical
moieties (e.g., polymers,
such as different weights of polyethylene glycols). The proportion of polymer
molecules to GAVE19
molecules will vary, as will their concentrations in the reaction mixture. In
general, the optimum ratio
(in terms of efficiency of reaction in that there is no excess unreacted
component or components and
polymer) will be determined by factors such as the desired degree of
derivatization (e.g., mono, di-,
tri-, etc.), the molecular weight of the polymer selected, whether the polymer
is branched or
unbranched, and the reaction conditions.
The polyethylene glycol molecules (or other chemical moieties) should be
attached to GAVE19 with
consideration of effects on functional or antigenic domains of GAVE19. There
are a number of
attachment methods available to those skilled in the art, e.g., EP 0 401 384
herein incorporated by
reference (coupling PEG to G-CSF), see also Malik et al., 1992, Exp. Hematol.
20:1028-1035
(reporting pegylation of GM-CSF using tresyl chloride). For example,
polyethylene glycol may be
covalently bound through amino acid residues via a reactive group, such as a
free amino or carboxyl
group. Reactive groups are those to which an activated polyethylene glycol
molecule may be bound.
The amino acid residues having a free amino group include lysine residues and
the N- terminal amino
acid residues; those having a free carboxyl group include aspartic acid
residues, glutamic acid residues
and the C-terminal amino acid residue. Sulfhydryl groups may also be used as a
reactive group for
attaching the polyethylene glycol molecule(s). Preferred for therapeutic
purposes is attachment at an
amino group, such as attachment at the N-terminus or lysine group.
One may specifically desire N-terminally chemically modified GAVE19. Using
polyethylene glycol
as an illustration of the present compositions, one may select from a variety
of polyethylene glycol
molecules (by molecular weight, branching, etc.), the proportion of
polyethylene glycol molecules to
GAVE19 molecules in the reaction mix, the type of pegylation reaction to be
performed, and the
method of obtaining the selected N-terminally pegylated protein. The method of
obtaining the N-
terminally pegylated preparation (i.e., separating this moiety from other
monopegylated moieties if
necessary) may be by purification of the N-terminally pegylated material from
a population of
pegylated protein molecules. Selective N-terminal chemical modification may be
accomplished by
reductive alkylation which exploits differential reactivity of different types
of primary amino groups
(lysine versus the N-terminal) available for derivatization in GAVE19. Under
the appropriate reaction
conditions, substantially selective derivatization of GAVE19 at the N-terminus
with a carbonyl group
containing polymer is achieved. For example, one may selectively N-terminally
pegylate GAVE19 by
performing the reaction at a pH which allows one to take advantage of the pKa
differences between the
CA 02476239 2004-08-12
WO 03/068803 PCT/US03/04350
29
E-amino groups of the lysine residues and that of the a amino group of the N-
terminal residue of
GAVE19. By such selective derivatization, attachment of a water soluble
polymer to GAVE19 is
controlled: the conjugation with the polymer takes place predominantly at the
N-terminus of
GAVE19 and no significant modification of other reactive groups, such as the
lysine side chain amino
groups, occurs. Using reductive alkylation, the water soluble polymer may be
of the type described
above, and should have a single reactive aldehyde for coupling to GAVE19.
Polyethylene glycol
proprionaldehyde, containing a single reactive aldehyde, may be used.
An isolated GAVE19 protein or a portion or fragment thereof, can be used as an
immunogen to
generate antibodies that bind GAVE19 using standard techniques for polyclonal
and monoclonal
antibody preparation. The term "antibody" as used herein refers to
immunoglobulin molecules and
immunologically active portions of immunoglobulin molecules, i.e., molecules
that contain an
antigen-binding site that specifically binds an antigen, such as GAVE19, or a
fragment thereof. A
molecule that specifically binds to GAVE19 is a molecule that binds GAVE19,
but does not
substantially bind other molecules in a sample, e.g., a biological sample that
naturally contains
GAVE19. Examples of immunologically active portions of immunoglobulin
molecules include Flab)
and F~~b~>z fragments that can be generated by treating the antibody with an
enzyme such as pepsin.
The invention provides polyclonal, monoclonal and chimeric antibodies that
have GAVE19, a variant
thereof, a fragment thereof, or an analog or derivative thereof, as an
immunogen.
The full-length GAVE19 protein can be used or, alternatively, the invention
provides antigenic
peptide fragments of GAVE19 for use as immunogens. The antigenic peptide of
GAVE19 comprises
at least 8 (preferably 10, 15, 20, 30 or more) amino acid residues of the
amino acid sequence shown in
SEQ ID N0:2 and encompasses an epitope of GAVE19 such that an antibody raised
against the
peptide forms a specific immune complex with GAVE19.
A GAVE19 immunogen typically is used to prepare antibodies by immunizing a
suitable subject, (e.g.,
rabbit, goat, mouse or other mammal) with the immunogen. An appropriate
immunogenic preparation
can contain, for example, recombinantly expressed GAVE19 protein or a
chemically synthesized
GAVE19 polypeptide. The preparation further can include an adjuvant, such as
Freund's complete or
incomplete adjuvant or similar immunostimulatory agent. Immunization of a
suitable subject with an
immunogenic GAVE19 preparation induces a polyclonal anti-GAVE19 antibody
response.
CA 02476239 2004-08-12
WO 03/068803 PCT/US03/04350
An antibody of the present invention can be a monoclonal antibody, a
polyclonal antibody, or a
chimeric antibody. The term "monoclonal antibody" or "monoclonal antibody
composition", as used
herein, refers to a population of antibody molecules that contain only one
species of an
antigen-binding site capable of immunoreacting with a particular epitope of
GAVE19. A monoclonal
antibody composition thus typically displays a single binding affinity for a
particular GAVE19 protein
epitope.
Polyclonal anti-GAVE19 antibodies can be prepared as described above by
immunizing a suitable
subject with a GAVE19 immunogen. The anti-GAVE19 antibody titer in the
immunized subject can
10 be monitored over time by standard techniques, such as with an enzyme-
linked immunosorbent assay
(ELISA) using immobilized GAVE19. If desired, the antibody molecules directed
against GAVE19
can be isolated from the mammal (e.g., from the blood) and further purified by
well-known
techniques, such as protein A chromatography, to obtain the IgG fraction. At
an appropriate time after
immunization, e.g., when the anti-GAVE19 antibody titers are highest, antibody-
producing cells can
15 be obtained from the subject and used to prepare monoclonal antibodies by
standard techniques, such
as the hybridoma technique originally described by Kohler et al., Nature
(1975) 256:495-497, the
human B cell hybridoma technique (Kohler et al., Immunol Today (1983) 4:72),
the EBV hybridoma
technique (Cole et al., Monoclonal Antibodies and Cancer Therapy, (1985), Alan
R. Liss, Inc., pp.
77-96) or trioma techniques. The technology for producing hybridomas is well
known (see generally
20 Current Protocols in Immunology (1994) Coligan et al., eds., John Wiley &
Sons, Inc., New York,
NY). Briefly, an immortal cell line (typically a myeloma) is fused to
lymphocytes (typically
splenocytes) from a mammal immunized with a GAVE19 immunogen as described
above and the
culture supernatants of the resulting hybridoma cells are screened to identify
a hybridoma producing a
monoclonal antibody that binds GAVE19.
Any of the many well known protocols used for fusing lymphocytes and
immortalized cell lines can be
applied for the purpose of generating an anti-GAVE19 monoclonal antibody (see,
e.g., Current
Protocols in Immunology, supra; Galfre et al., Nature (1977) 266:550-552;
Kenneth, in Monoclonal
Antibodies: A New Dimension In Biological Analyses, Plenum Publishing Corp.,
New York, N.Y.
(1980); and Lerner, Yale J Biol Med (1981) 54:387-402). Moreover, the
ordinarily skilled worker
will appreciate that there are many variations of such methods that also would
be useful. Typically,
the immortal cell line (e.g., a myeloma cell line) is derived from the same
mammalian species as the
lymphocytes. For example, murine hybridomas can be made by fusing lymphocytes
from a mouse
immunized with an immunogenic preparation of the instant invention with an
immortalized mouse cell
line, e.g., a myeloma cell line that is sensitive to culture medium containing
hypoxanthine,
CA 02476239 2004-08-12
WO 03/068803 PCT/US03/04350
31
aminopterin and thymidine ("HAT medium"). Any of a number of myeloma cell
lines can be used as
a fusion partner according to standard techniques, e.g., the P3-NS1/1-Ag4-1,
P3-x63-Ag8.653 or
Sp2/O-Agl4 myeloma lines. The myeloma lines are available from ATCC.
Typically, HAT-sensitive
mouse myeloma cells are fused to mouse splenocytes using polyethylene glycol
("PEG"). Hybridoma
cells resulting from the fusion then are selected using HAT medium that kills
unfused and
unproductively fused myeloma cells (unfused splenocytes die after several days
because they are not
transformed). Hybridoma cells producing a monoclonal antibody of the invention
are detected by
screening the hybridoma culture supernatants for antibodies that bind GAVE19,
e.g., using a standard
ELISA assay.
Alternative to preparing monoclonal antibody-secreting hybridomas, a
monoclonal anti-GAVE19
antibody can be identified and isolated by screening a recombinant
combinatorial immunoglobulin
library (e.g., an antibody phage display library) with GAVE19 thereby to
isolate immunoglobulin
library members that bind GAVE19. Kits for generating and screening phage
display libraries are
commercially available (e.g., the Pharmacia Recombinant Phage Antibody System,
Catalog
No. 27-9400-O1; and the Stratagene "SURFZAP" Phage Display Kit, Catalog No.
240612).
Additionally, examples of methods and reagents particularly amenable for use
in generating and
screening antibody display libraries can be found in, for example, U.S. Patent
No. 5,223,409; PCT
Publication No. WO 92/18619; PCT Publication No. WO 91/17271; PCT Publication
No. WO 92/20791; PCT Publication No. WO 92/15679; PCT Publication No. WO
93/01288; PCT
Publication No. WO 92/01047; PCT Publication No. WO 92/09690; PCT Publication
No. WO 90/02809; Fuchs et al., Bio/Technology (1991) 9:1370-1372; Hay et al.,
Hum Antibody
Hybridomas (1992) 3:81-85; Huse et al., Science (1989) 246:1275-1281; and
Griffiths et al., EMBO J
(1993)25(12):725-734.
Furthermore, recombinant anti-GAVE19 antibodies, including, e.g., monoclonal
and chimeric
antibodies, can be made using standard recombinant DNA techniques. Such
antibodies can be
produced by recombinant DNA techniques known in the art, for example using
methods described in
PCT Publication No. WO 87/02671; Europe Patent Application No. 184,187; Europe
Patent
Application No. 171,496; Europe Patent Application No. 173,494; PCT
Publication
No. WO 86/01533; U.S. Patent No. 4,816,567; Europe Patent Application No.
125,023; Better et al.,
Science (1988) 240:1041-1043; Liu et al., Proc Natl Acad Sci USA (1987)
84:3439-3443; Lin et al., J
Immunol (1987) 139:3521-3526; Sun et al., Proc Natl Acad Sci USA (1987) 84:214-
218; Nishimura et
al., Canc Res (1987) 47:999-1005; Wood et al., Nature (1985) 314:446-449; Shaw
et al., J Natl Cancer
CA 02476239 2004-08-12
WO 03/068803 PCT/US03/04350
32
Inst (1988) 80:1553-1559; Morrison, Science (1985) 229:1202-1207; Oi et al.,
Bio/Techniques (1986)
4:214; U.S. Patent No. 5,225,539; Jones et al., Nature (1986) 321:552-525;
Verhoeyan et al., Science
(1988) 239:1534; and Beidler et al., J Immunol (1988) 141:4053-4060.
An anti-GAVE19 antibody (e.g., monoclonal antibody) can be used to isolate
GAVE19 by standard
techniques, such as affinity chromatography or immunoprecipitation. An anti-
GAVE19 antibody can
facilitate the purification of natural GAVE19 from cells and of recombinantly
produced GAVE19
expressed in host cells. Moreover, an anti-GAVE19 antibody can be used to
detect GAVE19 protein
(e.g., in a cellular lysate or cell supernatant) to evaluate the abundance and
pattern of expression of the
GAVE19 protein. Anti-GAVE19 antibodies can be used diagnostically to monitor
protein levels in
tissue as part of a clinical testing procedure, for example, to determine the
efficacy of a given
treatment regimen. Detection can be facilitated by coupling the antibody to a
detectable substance,
which are described infra.
Detectable l.ahelc
Optionally, isolated nucleic acid molecules of the present invention,
polypeptides of the present
invention, and antibodies of the present invention, as well as fragments of
such moieties, may be
detectably labeled. Suitable labels include enzymes, fluorophores (e.g.,
fluorescene isothiocyanate
(FITC), phycoerythrin (PE), Texas red (TR), rhodamine, free or chelated
lanthanide series salts,
especially Eu3+, to name a few fluorophores), chromophores, radioisotopes,
chelating agents, dyes,
colloidal gold, latex particles, ligands (e.g., biotin), bioluminescent
materials, and chemiluminescent
agents. When a control marker is employed, the same or different labels may be
used for the receptor
and control marker.
In the instance where a radioactive label, such as the isotopes 3H, '4C, 3zP,
3sS ssCh s'Cr, s'Co, sgCo,
s9Fe~ 9oI, ~zsh'3'I, and'g6Re are used, known currently available counting
procedures may be utilized.
In the instance where the label is an enzyme, detection may be accomplished by
any of the presently
utilized colorimetric, spectrophotometric, fluorospectrophotometric,
amperometric or gasometric
techniques known in the art.
Direct labels are one example of labels which can be used according to the
present invention. A direct
label has been defined as an entity, which in its natural state, is readily
visible, either to the naked eye,
or with the aid of an optical filter and/or applied stimulation, e.g. U.V.
light to promote fluorescence.
Among examples of colored labels, which can be used according to the present
invention, include
metallic sol particles, for example, gold sol particles such as those
described by Leuvering (U.S.
CA 02476239 2004-08-12
WO 03/068803 PCT/US03/04350
33
Patent 4,313,734); dye sole particles such as described by Gribnau et al.
(U.S. Patent 4,373,932) and
May et al. (WO 88/08534); dyed latex such as described by May, supra, Snyder
(EP-A 0 280 559 and
0 281 327); or dyes encapsulated in liposomes as described by Campbell et al.
(U.S. Patent
4,703,017). Other direct labels include a radionucleotide, a fluorescent
moiety or a luminescent
moiety. In addition to these direct labelling devices, indirect labels
comprising enzymes can also be
used according to the present invention. Various types of enzyme linked
immunoassays are well
known in the art, for example, alkaline phosphatase and horseradish
peroxidase, lysozyme, glucose-6-
phosphate dehydrogenase, lactate dehydrogenase, urease, these and others have
been discussed in
detail by Eva Engvall in Enzyme Immunoassay ELISA and EMIT in Methods in
Enzymology, 70. 419-
439, 1980 and in U.S. Patent 4,857,453.
Other labels for use in the invention include magnetic beads or magnetic
resonance imaging labels.
In another embodiment, a phosphorylation site can be created on an isolated
polypeptide of the present
invention, an antibody of the present invention, or a fragment thereof, for
labeling with 32P, e.g., as
described in European Patent No. 0372707 or U.S. Patent No. 5,459,240, issued
October 17, 1995 to
Foxwell et al.
As exemplified herein, proteins, including antibodies, can be labeled by
metabolic labeling.
Metabolic labeling occurs during in vitro incubation of the cells that express
the protein in the
presence of culture medium supplemented with a metabolic label, such as [35S]-
methionine or [32P]-
orthophosphate. In addition to metabolic (or biosynthetic) labeling with [35S]-
methionine, the
invention further contemplates labeling with ['4C]-amino acids and [3H]-amino
acids (with the tritium
substituted at non-labile positions).
Another aspect of the invention pertains to vectors, preferably expression
vectors, containing a nucleic
acid encoding GAVE19 (or a portion thereof). As explained above, one type of
vector is a "plasmid,"
which refers to a circular double-stranded DNA loop into which additional DNA
segments can be
ligated. Another type of vector is a viral vector, wherein additional DNA
segments can be ligated into
a viral genome. Certain vectors are capable of autonomous replication in a
host cell (e.g., bacterial
vectors having a bacterial origin of replication and episomal mammalian
vectors). Other vectors (e.g.,
non-episomal mammalian vectors) are integrated into the genome of a host cell
on introduction into
the host cell and thereby are replicated along with the host genome. Moreover,
expression vectors are
capable of directing the expression of genes operably linked thereto. In
general, expression vectors of
CA 02476239 2004-08-12
WO 03/068803 PCT/US03/04350
34
utility in recombinant DNA techniques are often in the form of plasmids
(vectors). However, the
invention is intended to include other forms of expression vectors, such as
viral vectors (e.g.,
replication defective retroviruses, adenoviruses and adeno-associated
viruses), that serve equivalent
functions.
A recombinant expression vector of the invention comprises a nucleic acid
molecule of the present
invention in a form suitable for expression of the nucleic acid in a host
cell. That means a
recombinant expression vector of the present invention includes one or more
regulatory sequences,
selected on the basis of the host cells to be used for expression, that is
operably linked to the nucleic
acid to be expressed. Within a recombinant expression vector, "operably
linked" is intended to mean
that the nucleotide sequence of interest is linked to the regulatory
sequences) in a manner that allows
for expression of the nucleotide sequence (e.g., in an in vitro
transcription/translation system or in a
host cell when the vector is introduced into the host cell). The term
"regulatory sequence" is intended
to include promoters, enhancers and other expression control elements (e.g.,
polyadenylation signals).
IS Such regulatory sequences are described, for example, in Goeddel, Gene
Expression Technology:
Methods in Enzymology Vol. 185, Academic Press, San Diego, CA (1990).
Regulatory sequences
include those that direct constitutive expression of the nucleotide sequence
in many types of host cells
(e.g., tissue specific regulatory sequences). It will be appreciated by those
skilled in the art that the
design of the expression vector can depend on such factors as the choice of
host cell to be
transformed, the level of expression of protein desired etc. The expression
vectors of the invention
can be introduced into host cells to produce proteins or peptides encoded by
nucleic acids as described
herein (e.g., GAVE19 proteins, mutant forms of GAVE19, fusion proteins etc.).
A recombinant expression vector of the invention can be designed for
expression of GAVE19 in
prokaryotic or eukaryotic cells, e.g., bacterial cells such as E. coli, insect
cells (using baculovirus
expression vectors), yeast cells or mammalian cells. Suitable host cells are
discussed further in
Goeddel, supra. Alternatively, the recombinant expression vector can be
transcribed and translated in
vitro, for example using phage regulatory elements and proteins, such as, a T7
promoter and/or a T7
polymerise.
Expression of proteins in prokaryotes is most often carried out in E. coli
with vectors containing
constitutive or inducible promoters directing the expression of either fusion
or non-fusion proteins.
Fusion vectors add a number of amino acids to a protein encoded therein,
usually to the amino
terminus of the recombinant protein. Such fusion vectors typically serve three
purposes: 1) to
increase expression of recombinant protein; 2) to increase the solubility of
the recombinant protein;
CA 02476239 2004-08-12
WO 03/068803 PCT/US03/04350
and 3) to aid in the purification of the recombinant protein by acting as a
ligand in affinity
purification. Often, in fusion expression vectors, a proteolytic cleavage site
is introduced at the
junction of the fusion moiety and the recombinant protein to enable separation
of the recombinant
protein from the fusion moiety subsequent to purification of the fusion
protein. Such enzymes and the
cognate recognition sequences, include Factor Xa, thrombin and enterokinase.
Typical fusion
expression vectors include pGEX (Pharmacia Biotech Inc; Smith et al., Gene
(1988) 67:31-40), pMAL
(New England Biolabs, Beverly, MA) and pRITS (Pharmacia, Piscataway, NJ), that
fuse glutathione
5-transferase (GST), maltose E binding protein or protein A, respectively, to
the target recombinant
protein.
Examples of suitable inducible non-fusion E. coli expression vectors include
pTrc (Amann et al., Gene
(1988) 69:301-315) and pET l ld (Studier et al., Gene Expression Technology:
Methods in
Enzymology, Academic Press, San Diego, California (1990) 185:60-89). Target
gene expression from
the pTrc vector relies on host RNA polymerase transcription from a hybrid trp-
lac fusion promoter.
IS
One strategy to maximize recombinant protein expression in E. coli is to
express the protein in a host
with impaired capacity to cleave proteolytically the recombinant protein
(Gottesman, Gene Expression
Technology: Methods in Enzymology, Academic Press, San Diego, California
(1990) 185:119-128).
Another strategy is to alter the nucleic acid sequence of the nucleic acid
molecule to be inserted into
an expression vector so that the individual codons for each amino acid are
those preferentially utilized
in E. coli (Wada et al., Nucleic Acids Res (1992) 20:2111-2118). Such
alteration of nucleic acid
sequences of the invention can be carried out by standard DNA synthesis
techniques.
In another embodiment, the GAVE19 expression vector is a yeast expression
vector. Examples of
vectors for expression in yeast such as S. cerevisiae include pYepSecl
(Baldari et al., EMBO J (1987)
6:229-234), pMFa (Kurjan et al., Cell (1982) 30:933-943), pJRY88 (Schultz et
al., Gene (1987)
54:113-123), pYES2 (Invitrogen Corporation, San Diego, CA) and pPicZ
(Invitrogen Corp, San
Diego, CA).
Alternatively, GAVE19 can be expressed in insect cells using baculovirus
expression vectors.
Baculovirus vectors available for expression of proteins in cultured insect
cells (e.g., Sf 9 cells)
include the pAc series (Smith et al., Mol Cell Biol (1983) 3:2156-2165) and
the pVL series (Lucklow
et al., Virology (1989) 170:31-39).
CA 02476239 2004-08-12
WO 03/068803 PCT/US03/04350
36
In yet another embodiment, a nucleic acid of the invention is expressed in
mammalian cells using a
mammalian expression vector. Examples of mammalian expression vectors having
applications herein
include, but certainly are not limited to pCDM8 (Seed, Nature (1987) 329:840)
and pMT2PC
(Kaufman et al., EMBO J (1987) 6:187-195). When used in mammalian cells,
control functions of the
expression vector often are provided by viral regulatory elements. For
example, commonly used
promoters are derived from polyoma, adenovirus 2, cytomegalovirus and simian
virus 40. For other
suitable expression systems for both prokaryotic and eukaryotic cells, see
chapters 16 and 17 of
Sambrook et al., supra.
In another embodiment, a recombinant mammalian expression vector of the
present invention is
capable of directing expression of the nucleic acid preferentially in a
particular cell type (e.g.,
tissue-specific regulatory elements are used to express the nucleic acid).
Tissue-specific regulatory
elements are known in the art. Non-limiting examples of suitable tissue-
specific promoters include
the albumin promoter (liver-specific; Pinkert et al., Genes Dev (1987) 1:268-
277), lymphoid-specific
promoters (Calame et al., Adv Immunol (1988) 43:235-275), in particular,
promoters of T cell
receptors (Winoto et al., EMBO J (1989) 8:729-733) and immunoglobulins
(Banerji et al., Cell (1983)
33:729-740; Queen et al., Cell (1983) 33:741-748), neuron-specific promoters
(e.g., the neurofilament
promoter; Byrne et al., Proc Natl Acad Sci USA (1989) 86:5473-5477), pancreas-
specific promoters
(Edlund et al., Science (1985) 230:912-916) and mammary gland-specific
promoters (e.g., milk whey
promoter; U.S. Patent No. 4,873,316 and Europe Application No. 264,166).
Developmentally-regulated promoters also are encompassed, for example the
murine hox promoters
(Kessel et al., Science (1990) 249:374-379) and the a-fetoprotein promoter
(Campes et al., Genes Dev
(1989) 3:537-546).
The invention further provides a recombinant expression vector comprising a
DNA molecule of the
invention cloned into an expression vector in an antisense orientation. That
is, the DNA molecule is
operably linked to a regulatory sequence in a manner that allows for
expression (by transcription of
the DNA molecule) of an RNA molecule that is antisense to GAVE19 mRNA.
Regulatory sequences
operably linked to a nucleic acid cloned in the antisense orientation can be
chosen that direct the
continuous expression of the antisense RNA molecule in a variety of cell
types. For example, viral
promoters and/or enhancers or regulatory sequences can be chosen that direct
constitutive,
tissue-specific or cell type-specific expression of antisense RNA. The
antisense expression vector can
be in the form of a recombinant plasmid, phagemid or attenuated virus in which
antisense nucleic
acids are produced under the control of a high efficiency regulatory region,
the activity of which can
be determined by the cell type into which the vector is introduced. For a
discussion of the regulation
CA 02476239 2004-08-12
WO 03/068803 PCT/US03/04350
37
of gene expression using antisense genes, see Weintraub et al. (Reviews-Trends
in Genetics, Vol.
1(1)1986).
Another aspect of the present invention pertains to host cells into which a
recombinant expression
vector of the invention has been introduced. The terms "host cell" and
"recombinant host cell" are
used interchangeably herein. It is understood that such terms refer not only
to the particular subject
cell but also to the progeny or potential progeny of such a cell. Because
certain modifications may
occur in succeeding generations due to either mutation or environmental
influences, such progeny may
not, in fact, be identical to the parent cell, but still are included within
the scope of the term as used
herein.
A host cell can be any prokaryotic or eukaryotic cell. For example, GAVE19
protein can be expressed
in bacterial cells such as E. coli, insect cells, yeast or mammalian cells
(such as Chinese hamster ovary
cells (CHO), 293 cells or COS cells). Other suitable host cells are known to
those skilled in the art.
Vector DNA can be introduced into prokaryotic or eukaryotic cells via
conventional transformation or
transfection techniques. As used herein, the terms "transformation" and
"transfection" are intended to
refer to a variety of art-recognized techniques for introducing foreign
nucleic acid (e.g., DNA) into a
host cell, including calcium phosphate or calcium chloride co-precipitation,
transduction,
DEAE-dextran-mediated transfection, lipofection or electroporation.
For stable transfection of mammalian cells, it is known that, depending on the
expression vector and
transfection technique used, only a small fraction of cells may integrate the
foreign DNA into the
genome. To identify and to select the integrants, a gene that encodes a
selectable marker (e.g., for
resistance to antibiotics) generally is introduced into the host cells along
with the gene of interest.
Preferred selectable markers include those that confer resistance to drugs,
such as 6418, hygromycin
and methotrexate. Nucleic acid encoding a selectable marker can be introduced
into a host cell on the
same vector as that encoding GAVE19 or can be introduced on a separate vector.
Cells stably
transfected with the introduced nucleic acid can be identified by drug
selection (e.g., cells that have
incorporated the selectable marker gene will survive, while the other cells
die).
A host cell of the present invention, such as a prokaryotic or eukaryotic host
cell in culture, can be
used to produce (i.e., express) GAVE19 protein. Accordingly, the invention
further provides methods
for producing GAVE19 protein using the host cells of the invention. In one
embodiment, the method
comprises culturing a host cell of the present invention (into which a
recombinant expression vector
encoding GAVE19 has been introduced) in a suitable medium such that GAVE19
protein is produced.
CA 02476239 2004-08-12
WO 03/068803 PCT/US03/04350
38
In another embodiment, the method further comprises isolating GAVE19 from the
medium or the host
cell.
In another embodiment, GAVE19 comprises an inducible expression system for the
recombinant
expression of other proteins subcloned in modified expression vectors. For
example, host cells
comprising a mutated G protein (e.g., yeast cells, Y2 adrenocortical cells and
cyc S49, see U.S. Pat.
Nos. 6,168,927 B1, 5,739,029 and 5,482,835; Mitchell et al., Proc Natl Acad
Sci USA (1992)
89(19):8933-37 and Katada et al., J Biol Chem (1984) 259(6):3586-95) are
transduced with a first
expression vector comprising a nucleic acid sequence encoding GAVE19, wherein
GAVE19 is
functionally expressed in the host cells. Even though the expressed GAVE19 is
constitutively active,
the mutation does not allow for signal transduction; i.e., no activation of a
G-protein directed
downstream cascade occurs (e.g., no adenylyl cyclase activation).
Subsequently, a second expression
vector is used to transduce the GAVE19-comprising host cells. The second
vector comprises a
structural gene that complements the G protein mutation of the host cell
(i.e., functional mammalian
or yeast GS, G;, Go, or Gq, e.g., see PCT Publication No. WO 97/48820; U.S.
Pat. Nos. 6,168,927 B1,
5,739,029 and 5,482,835) in addition to the gene of interest to be expressed
by the inducible system.
The complementary structural gene of the second vector is inducible; i.e.,
under the control of an
exogenously added component (e.g., tetracycline, IPTG, small molecules etc.,
see Sambrook et al.
supra) that activates a promoter which is operably linked to the complementary
structural gene. On
addition of the inducer, the protein encoded by the complementary structural
gene is functionally
expressed such that the constitutively active GAVE19 now will form a complex
that leads to
appropriate downstream pathway activation (e.g., second messenger formation).
The gene of interest
comprising the second vector possesses an operably linked promoter that is
activated by the
appropriate second messenger (e.g., CREB, AP1 elements). Thus, as second
messenger accumulates,
the promoter upstream from the gene of interest is activated to express the
product of said gene.
When the inducer is absent, expression of the gene of interest is switched
off.
In a particular embodiment, the host cells for the inducible expression system
include, but are not
limited to, 549 (cyc-) cells. While cell lines are contemplated that comprise
G-protein mutations,
suitable mutants may be artificially produced/constructed (see U.S. Pat. Nos.
6,168,927 B1, 5,739,029
and 5,482,835 for yeast cells).
In a related aspect, the cells are transfected with a vector operably linked
to a cDNA comprising a
sequence encoding a protein as set forth in SEQ >D N0:2. The first and second
vectors comprising
said system are contemplated to include, but are not limited to, pCDM8 (Seed,
Nature (1987)
CA 02476239 2004-08-12
WO 03/068803 PCT/US03/04350
39
329:840) and pMT2PC (Kaufman et al., EMBO J (1987) 6:187-195), pYepSecl
(Baldari et al., EMBO
J (1987) 6:229-234), pMFa (Kurjan et al., Cell (1982) 30:933-943), pJRY88
(Schultz et al., Gene
(1987) 54:113-123), pYES2 (Invitrogen Corporation, San Diego, CA) and pPicZ
(Invitrogen Corp,
San Diego, CA).
In a related aspect, the host cells may be transfected by such suitable means,
wherein transfection
results in the expression of a functional GAVE19 protein (e.g., Sambrook et
al., supra, and Kriegler,
Gene Transfer and Expression: A Laboratory Manual, Stockton Press, New York,
NY, 1990). Such
"functional proteins" include, but are not limited to, proteins that once
expressed, form complexes
with G-proteins, where the G-proteins regulate second messenger formation.
Other methods for
transfecting host cells that have applications herein include, but certainly
are not limited to
transfection, electroporation, microinjection, transduction, cell fusion, DEAF
dextran, calcium
phosphate precipitation, lipofection (lysosome fusion), use of a gene gun, or
a DNA vector transporter
(see, e.g., Wu et al., 1992, J. Biol. Chem. 267:963-967; Wu and Wu, 1988, J.
Biol. Chem. 263:14621-
14624; Hartmut et al., Canadian Patent Application No. 2,012,311, Oled March
15, 1990).
A large variety of promoters have applications in the present invention.
Indeed, expression of a
polypeptide of the present invention may be controlled by any
promoter/enhancer element known in
the art, but these regulatory elements must be functional in the host selected
for expression.
Promoters which may be used to control GAVE19 expression include, but are not
limited to, the
SV40 early promoter region (Benoist and Chambon, 1981, Nature 290:304-310),
the promoter
contained in the 3' long terminal repeat of Rous sarcoma virus (Yamamoto, et
al., 1980, Cell 22:787-
797), the herpes thymidine kinase promoter (Wagner et al., 1981, Proc. Natl.
Acad. Sci. U.S.A.
78:1441-1445), the regulatory sequences of the metallothionein gene (Brinster
et al., 1982, Nature
296:39-42); prokaryotic expression vectors such as the /3-lactamase promoter
(Villa-Kamaroff, et al.,
1978, Proc. Natl. Acad. Sci. U.S.A. 75:3727-3731), or the tac promoter
(DeBoer, et al., 1983, Proc.
Natl. Acad. Sci. U.S.A. 80:21-25); see also "Useful proteins from recombinant
bacteria" in Scientific
American, 1980, 242:74-94; promoter elements from yeast or other fungi such as
the Gal 4 promoter,
the ADC (alcohol dehydrogenase) promoter, PGK (phosphoglycerol kinase)
promoter, alkaline
phosphatase promoter; and the animal transcriptional control regions, which
exhibit tissue specificity
and have been utilized in transgenic animals: elastase I gene control region
which is active in
pancreatic acinar cells (Swift et al., 1984, Cell 38:639-646; Ornitz et al.,
1986, Cold Spring Harbor
Symp. Quant. Biol. 50:399-409; MacDonald, 1987, Hepatology 7:425-515); insulin
gene control
region which is active in pancreatic beta cells (Hanahan, 1985, Nature 315:115-
122), immunoglobulin
gene control region which is active in lymphoid cells (Grosschedl et al.,
1984, Cell 38:647-658;
Adames et al., 1985, Nature 318:533-538; Alexander et al., 1987, Mol. Cell.
Biol. 7:1436-1444),
CA 02476239 2004-08-12
WO 03/068803 PCT/US03/04350
mouse mammary tumor virus control region which is active in testicular,
breast, lymphoid and mast
cells (Leder et al., 1986, Cell 45:485-495), albumin gene control region which
is active in liver
(Pinkert et al., 1987, Genes and Devel. 1:268-276), alpha-fetoprotein gene
control region which is
active in liver (Krumlauf et al., 1985, Mol. Cell. Biol. 5:1639-1648; Hammer
et al., 1987, Science
5 235:53-58), alpha 1-antitrypsin gene control region which is active in the
liver (Kelsey et al., 1987,
Genes and Devel. 1:161-171), beta-globin gene control region which is active
in myeloid cells
(Mogram et al., 1985, Nature 315:338-340; Kollias et al., 1986, Cell 46:89-
94), myelin basic protein
gene control region which is active in oligodendrocyte cells in the brain
(Readhead et al., 1987, Cell
48:703-712), myosin light chain-2 gene control region which is active in
skeletal muscle (Sani, 1985,
10 Nature 314:283-286), and gonadotropic releasing hormone gene control region
which is active in the
hypothalamus (Mason et al., 1986, Science 234:1372-1378).
Expression vectors containing a nucleic acid molecule of the invention can be
identified by four
general approaches: (a) PCR amplification of the desired plasmid DNA or
specific mRNA, (b) nucleic
15 acid hybridization, (c) presence or absence of selection marker gene
functions, and (d) expression of
inserted sequences. In the first approach, the nucleic acids can be amplified
by PCR to provide for
detection of the amplified product. In the second approach, the presence of a
foreign gene inserted in
an expression vector can be detected by nucleic acid hybridization using
probes comprising sequences
that are homologous to an inserted marker gene. In the third approach, the
recombinant vector/host
20 system can be identified and selected based upon the presence or absence of
certain "selection
marker" gene functions (e.g., (3-galactosidase activity, thymidine kinase
activity, resistance to
antibiotics, transformation phenotype, occlusion body formation in
baculovirus, etc.) caused by the
insertion of foreign genes in the vector. In another example, if the nucleic
acid encoding GAVE19
protein, a variant thereof, or an analog or derivative thereof, is inserted
within the "selection marker"
25 gene sequence of the vector, recombinants containing the insert can be
identified by the absence of the
GAVE19 gene function. In the fourth approach, recombinant expression vectors
can be identified by
assaying for the activity, biochemical, or immunological characteristics of
the gene product expressed
by the recombinant, provided that the expressed protein assumes a functionally
active conformation.
30 A wide variety of host/expression vector combinations may be employed in
expressing the DNA
sequences of this invention. Useful expression vectors, for example, may
consist of segments of
chromosomal, non-chromosomal and synthetic DNA sequences. Suitable vectors
include derivatives
of SV40 and known bacterial plasmids, e.g., E. coli plasmids col El, pCRI,
pBR322, pMal-C2, pET,
pGEX (Smith et al., 1988, Gene 67:31-40), pMB9 and their derivatives, plasmids
such as RP4; phage
35 DNAS, e.g., the numerous derivatives of phage ~, e.g., NM989, and other
phage DNA, e.g., M13 and
CA 02476239 2004-08-12
WO 03/068803 PCT/US03/04350
41
filamentous single stranded phage DNA; yeast plasmids such as the 2~. plasmid
or derivatives thereof;
vectors useful in eukaryotic cells, such as vectors useful in insect or
mammalian cells; vectors derived
from combinations of plasmids and phage DNAs, such as plasmids that have been
modified to employ
phage DNA or other expression control sequences; and the like.
For example, in a baculovirus expression systems, both non-fusion transfer
vectors, such as but not
limited to pVL941 (BamHl cloning site; Summers), pVL1393 (BamHl, SmaI, XbaI,
EcoRl, NotI,
XmaIII, Bglll, and PstI cloning site; Invitrogen), pVL1392 (BgIII, PstI, NotI,
XmaIll, EcoRI, XbaI,
SmaI, and BamHl cloning site; Summers and Invitrogen), and pBlueBacIII (BamHl,
BgIII, PstI, NcoI,
and HindIII cloning site, with blue/white recombinant screening,possible;
Invitrogen), and fusion
transfer vectors, such as but not limited to pAc700 (BamHl and KpnI cloning
site, in which the
BamHl recognition site begins with the initiation codon; Summers), pAc701 and
pAc702 (same as
pAc700, with different reading frames), pAc360 (BamHl cloning site 36 base
pairs downstream of a
polyhedrin initiation codon; Invitrogen(195)), and pBlueBacHisA, B, C (three
different reading
frames, with BarnHl, Bglll, PstI, NcoI, and HindIll cloning site, an N-
terminal peptide for ProBond
purification, and blue/white recombinant screening of plaques; Invitrogen
(220)) can be used.
Mammalian expression vectors contemplated for use in the invention include
vectors with inducible
promoters, such as the dihydrofolate reductase (DHFR) promoter, e.g., any
expression vector with a
DHFR expression vector, or a DHFR/methotrexate co-amplification vector, such
as pED (PstI, SaII,
SbaI, SmaI, and EcoRI cloning site, with the vector expressing both the cloned
gene and DHFR; see
Kaufman, Current Protocols in Molecular Biology, 16.12 (1991). Alternatively,
a glutamine
synthetase/methionine sulfoximine co-amplification vector, such as pEEl4
(HindIII, XbaI, SmaI, SbaI,
EcoRI, and BcII cloning site, in which the vector expresses glutamine synthase
and the cloned gene;
Celltech). In another embodiment, a vector that directs episomal expression
under control of Epstein
Barr Virus (EBV) can be used, such as pREP4 (BamHl, SfiI, XhoI, NotI, NheI,
HindIII, NheI, PvuII,
and KpnI cloning site, constitutive RSV-LTR promoter, hygromycin selectable
marker; Invitrogen),
pCEP4 (BamHl, SfiI, XhoI, NotI, NheI, HindIII, NheI, PvuII, and KpnI cloning
site, constitutive
hCMV immediate early gene, hygromycin selectable marker; Invitrogen), pMEP4
(KpnI, PvuI, NheI,
HindIll, NotI, XhoI, SfiI, BamHl cloning site, inducible metallothionein Iia
gene promoter,
hygromycin selectable marker: Invitrogen), pREP8 (BamHl, XhoI, NotI, HindIll,
NheI, and KpnI
cloning site, RSV-LTR promoter, histidinol selectable marker; Invitrogen),
pREP9 (KpnI, NheI,
Hindlll, NotI, XhoI, SfiI, and BamHI cloning site, RSV-LTR promoter, 6418
selectable marker;
Invitrogen), and pEBVHis (RSV-LTR promoter, hygromycin selectable marker, N-
terminal peptide
purifiable via ProBond resin and cleaved by enterokinase; Invitrogen).
Selectable mammalian
CA 02476239 2004-08-12
WO 03/068803 PCT/US03/04350
42
expression vectors for use in the invention include pRc/CMV (HindIll, BstXI,
NotI, SbaI, and ApaI
cloning site, 6418 selection; Invitrogen), pRc/RSV (HindllI, SpeI, BstXI,
NotI, XbaI cloning site,
6418 selection; Invitrogen), and others. Vaccinia virus mammalian expression
vectors (see,
Kaufman, 1991, supra) for use according to the invention include but are not
limited to pSCl l (SmaI
cloning site, TK- and /3-gal selection), pMJ601 (SaII, SmaI, AflI, NarI,
BspMII, BamHI, ApaI, NheI,
SacII, KpnI, and HindIII cloning site; TK- and (3-gal selection), and pTKgptF
1 S (EcoRI, PstI, SaII,
AccI, HindII, SbaI, BamHI, and Hpa cloning site, TK or XPRT selection).
Yeast expression systems can also be used according to the invention to
express GAVE19 protein, a
variant thereof, or an analog or derivative thereof. For example, the non-
fusion pYES2 vector (XbaI,
SphI, ShoI, NotI, GstXI, EcoRI, BstXI, BamHl, SacI, Kpnl, and HindIII cloning
sit; Invitrogen) or the
fusion pYESHisA, B, C (XbaI, SphI, ShoI, NotI, BstXI, EcoRI, BamHl, SacI,
KpnI, and HindIII
cloning site, N-terminal peptide purified with ProBond resin and cleaved with
enterokinase;
Invitrogen), to mention just two, can be employed according to the invention.
Once a particular recombinant DNA molecule is identified and isolated, several
methods known in the
art may be used to propagate it. Once a suitable host system and growth
conditions are established,
recombinant expression vectors can be propagated and prepared in quantity. As
previously explained,
the expression vectors that can be used include, but are not limited to, the
following vectors or their
derivatives: human or animal viruses such as vaccinia virus or adenovirus;
insect viruses such as
baculovirus; yeast vectors; bacteriophage vectors (e.g., lambda), and plasmid
and cosmid DNA
vectors, to name but a few.
In addition, a host cell strain may be chosen which modulates the expression
of the inserted
sequences, or modifies and processes the gene product in the specific fashion
desired. Different host
cells have characteristic and specific mechanisms for the translational and
post-translational
processing and modification (e.g., glycosylation, cleavage [e.g., of signal
sequence]) of proteins.
Appropriate cell lines or host systems can be chosen to ensure the desired
modification and processing
of the foreign protein expressed. For example, expression in a bacterial
system can be used to
produce an nonglycosylated core protein product.
A host cell of the present invention also can be used to produce transgenic
animals. For example, in
one embodiment, a host cell of the invention is a fertilized oocyte or an
embryonic stem cell into
which GAVE19-coding sequences have been introduced. Such host cells then can
be used to create
CA 02476239 2004-08-12
WO 03/068803 PCT/US03/04350
43
non-human transgenic animals into which exogenous GAVE19 sequences have been
introduced into
the genome, or homologous recombinant animals in which endogenous GAVE19
sequences have been
altered. Such animals are useful for studying the function and/or activity of
GAVE19 and for
identifying and/or evaluating modulators of GAVE19 activity. As used herein, a
"transgenic animal"
is a non-human animal, preferably a mammal, in which one or more of the cells
of the animal includes
a transgene. Examples of transgenic animals include non-human primates, sheep,
dogs, cows, goats,
chickens, rats, amphibians etc.
As used herein, the term "transgene" refers to exogenous DNA that is
integrated into the genome of a
cell from which a transgenic animal develops and that remains in the genome of
the mature animal.
The transgene directs the expression of an encoded gene product in one or more
cell types or tissues of
the transgenic animal. As used herein, a "homologous recombinant animal" is a
non-human animal,
preferably a mammal, in which an endogenous GAVE19 gene has been altered by
homologous
recombination. That is accomplished between the endogenous gene and an
exogenous DNA molecule
introduced into a cell of the animal, e.g., an embryonic cell of the animal,
prior to development of the
animal.
A transgenic animal of the invention can be created by introducing a GAVE19-
encoding nucleic acid
molecule into the male pronuclei of a fertilized oocyte using one of the
transfection methods described
above. The oocyte is then allowed to develop in a pseudopregnant female foster
animal. The
GAVE19 cDNA sequence e.g., that of (SEQ B7 NO:1), for example, can be
introduced as a transgene
into the genome of a non-human animal. Intronic sequences and polyadenylation
signals also can be
included in the transgene to increase the efficiency of expression of the
transgene. A tissue-specific
regulatory sequences) can be operably linked to the GAVE19 transgene to direct
expression of
GAVE19 protein in particular cells. Methods for generating transgenic animals
via embryo
manipulation and microinjection are conventional in the art and are described,
for example, in
U.S. Patent Nos. 4,736,866 and 4,870,009 and U.S. Patent No. 4,873,191.
Similar methods are used
for production of other transgenic animals with a transgene in the genome
and/or expression of
GAVE19 mRNA in tissues or cells of the animals. A transgenic founder animal
then can be used to
breed additional animals carrying the transgene. Moreover, transgenic animals
carrying a transgene
encoding GAVE19 can be bred further to other transgenic animals carrying other
transgenes.
To create a homologous recombinant animal, a vector is prepared that contains
at least a portion of a
GAVE19 gene into which a deletion, addition or substitution has been
introduced thereby to alter, e.g.,
functionally disrupt, the GAVE19 gene. In a particular embodiment, the vector
is designed such that,
CA 02476239 2004-08-12
WO 03/068803 PCT/US03/04350
44
on homologous recombination, the endogenous GAVE19 gene is disrupted
functionally (i.e., no
longer encodes a functional protein; also referred to as a ~~knock out"
vector).
Alternatively, the vector can be designed such that, on homologous
recombination, the endogenous
GAVE19 gene is mutated or otherwise altered but still encodes functional
protein (e.g., the upstream
regulatory region can be altered thereby to alter the expression of the
endogenous GAVE19 protein).
In the homologous recombination vector, the altered portion of the GAVE19 gene
is flanked at the 5'
and 3' ends by an additional nucleic acid sequence of the GAVE19 gene to allow
for homologous
recombination to occur between the exogenous GAVE19 gene carried by the vector
and an
endogenous GAVE19 gene in an embryonic stem cell. The additional flanking
GAVE19 nucleic acid
sequence is of sufficient length for successful homologous recombination with
the endogenous gene.
Typically, several kilobases of flanking DNA (both at the 5' and 3' ends) are
included in the vector
(see, e.g., Thomas et al., Cell (1987) 51:503 for a description of homologous
recombination vectors).
The vector is introduced into an embryonic stem cell line (e.g., by
electroporation) and cells in which
the introduced GAVE19 gene has homologously recombined with the endogenous
GAVE19 gene are
selected (see, e.g., Li et al., Cell (1992) 69:915). The selected cells then
are injected into a blastocyst
of an animal to form aggregation chimeras (see, e.g., Bradley in
Teratocarcinomas and Embryonic
Stem Cells: A Practical Approach, Robertson, ed., IRL, Oxford, (1987) pp. 113-
152). A chimeric
embryo then can be implanted into a suitable pseudopregnant female foster
animal and the embryo
brought to term. Progeny harboring the homologously recombined DNA in the germ
cells can be used
to breed animals wherein all cells of the animal contain the homologously
recombined DNA by
germline transmission of the transgene.
Methods for constructing homologous recombination vectors and homologous
recombinant animals
are described further in Bradley, Current Opinion in Bio/Technology (1991)
2:823-829 and in PCT
Publication Nos. WO 90/11354, WO 91/01140, WO 92/0968 and WO 93/04169.
In another embodiment, transgenic non-human animals can be produced that
contain selected systems
to allow for regulated expression of the transgene. One example of such a
system is the cre/loxP
recombinase system of bacteriophage P 1. For a description of the cre/loxP
recombinase system, see,
e.g., Lakso et al., Proc Natl Acad Sci USA (1992) 89:6232-6236. Another
example of a recombinase
system is the FLP recombinase system of S. cerevisiae (O'Gorrnan et al.,
Science (1991)
251:1351-1355). If a cre/loxP recombinase system is used to regulate
expression of the transgene,
CA 02476239 2004-08-12
WO 03/068803 PCT/US03/04350
animals containing transgenes encoding both the cre recombinase and a selected
protein are required.
Such animals can be provided through the construction of "double" transgenic
animals, e.g., by mating
two transgenic animals, one containing a transgene encoding a selected protein
and the other
containing a transgene encoding a recombinase.
Clones of the non-human transgenic animals described herein also can be
produced according to the
methods described in Wilmut et al., Nature (1997) 385:810-813 and PCT
Publication Nos.
WO 97/07668 and WO 97/07669. In brief, a cell, e.g., a somatic cell, from the
transgenic animal can
be isolated and induced to exit the growth cycle and enter Go phase. The
quiescent cell then can be
10 fused, e.g., through the use of electrical pulses, to an enucleated oocyte
from an animal of the same
species from which the quiescent cell is isolated. The reconstructed oocyte
then is cultured such that it
develops to morula or blastocyte, and then is transferred to a pseudopregnant
female foster animal.
The offspring borne of the female foster animal will be a clone of the animal
from that the cell, e.g.,
the somatic cell, is isolated.
The nucleic acid molecules, proteins, protein homologues, antibodies of the
present invention, and
fragments of such moieties, may be used in one or more of the following
methods: a) screening
assays; b) detection assays (e.g., chromosomal mapping, tissue typing,
forensic biology); c) predictive
medicine (e.g., diagnostic assays, prognostic assays, monitoring clinical
trials and
pharmacogenomics); and d) methods of treatment (e.g., therapeutic and
prophylactic). A GAVE19
protein interacts with other cellular proteins, and thus can be used for (i)
regulation of cellular
proliferation; (ii) regulation of cellular differentiation; and (iii)
regulation of cell survival. The
isolated nucleic acid molecules of the invention can be used to express GAVE19
protein (e.g., via a
recombinant expression vector in a host cell in gene therapy applications), to
detect GAVE19 mRNA
(e.g., in a biological sample) or to detect a genetic lesion in a GAVE19 gene
and to modulate
GAVE19 activity. In addition, a GAVE19 protein can be used to screen drugs or
compounds that
modulate GAVE19 activity or expression. Such drugs or compounds may readily
have applications in
treating diseases inflammatory diseases such as rheumatoid arthritis, COPD,
etc. Screening for the
production of GAVE19 protein forms that have decreased or aberrant activity
compared to GAVE19
wild type protein can also be performed with the present invention. In
addition, an anti-GAVE19
antibody of the invention can be used to detect and to isolate GAVE19 proteins
and to modulate
GAVE19 activity. The invention further pertains to novel agents identified by
the above-described
screening assays and uses thereof for treatments as described herein.
CA 02476239 2004-08-12
WO 03/068803 PCT/US03/04350
46
S.~r~n;ngA
Activation of a G protein receptor in the presence of endogenous ligand allows
for G protein receptor
complex formation, thereupon leading to the binding of GTP to the G protein.
The GTPase domain of
the G protein slowly hydrolyzes the GTP to GDP resulting, under normal
conditions, in receptor
deactivation. However, constitutively activated receptors continue to
hydrolyze GDP to GTP.
A non-hydrolyzable substrate of G protein, [35S]GTP~yS, can be used to monitor
enhanced binding to
membranes which express constitutively activated receptors. Traynor and
Nahorski reported that
['sS]GTPyS can be used to monitor G protein coupling to membranes in the
absence and presence of
ligand (Traynor et al., Mol Pharmacol (1995) 47(4):848-54). A preferred use of
such an assay system
is for initial screening of candidate compounds, since the system is
generically applicable to all
G protein-coupled receptors without regard to the particular G protein that
binds to the receptor.
Gszo stimulates the enzyme adenylyl cyclase, while G; and Go inhibit that
enzyme. As is well known
1 S the art, adenylyl cyclase catalyzes the conversion of ATP to cAMP; thus,
constitutively activated
GPCRs that couple the GS protein are associated with increased cellular levels
of cAMP.
Alternatively, constitutively activated GCPRs that might couple the G; (or Go)
protein are associated
with decreased cellular levels of cAMP. See "Indirect Mechanism of Synaptic
Transmission",
Chpt. 8, from Neuron to Brain (3'd Ed.), Nichols et al. eds., Sinauer
Associates, Inc., 1992. Thus,
assays that detect cAMP can be used to determine if a candidate compound is an
inverse agonist to the
receptor. A variety of approaches known in the art for measuring cAMP can be
utilized. In one
embodiment, anti-cAMP antibodies are used in an ELISA-based format. In another
embodiment, a
whole cell second messenger reporter system assay is contemplated (see PCT
Publication No.
WO 00/22131).
In a related aspect, cyclic AMP drives gene expression by promoting the
binding of a cAMP-
responsive DNA binding protein or transcription factor (CREB) which then binds
to the promoter at
specific sites called cAMP response elements, and drives the expression of the
gene. Thus, reporter
systems can be constructed which have a promoter containing multiple cAMP
response elements
before the reporter gene, e.g., (3-galactosidase or luciferase. Further, as a
constitutively activated
GS linked receptor causes the accumulation of cAMP, that then activates the
gene and expression of
the reporter protein. The reporter protein, such as (3-galactosidase or
luciferase, then can be detected
using standard biochemical assays (PCT Publication No. WO 00/22131).
Other G proteins, such as Go and Gq, are associated with activation of the
enzyme phospholipase C,
CA 02476239 2004-08-12
WO 03/068803 PCT/US03/04350
47
which in turn hydrolyzes the phospholipid, PIP2, releasing two intracellular
messengers:
diacylglycerol (DAG) and inositol 1,4,5-triphosphate (IP3). Increased
accumulation of IP3 is
associated with activation of Gq-associated receptors and Go associated
receptors (PCT Publication
No. WO 00/22131). Assays that detect IP3 accumulation can be used to determine
if a candidate
compound is an inverse agonist to a Gq-associated receptor or a Go associated
receptor. Gq-associated
receptors also can be examined using an AP1 reporter assays that measures
whether Gq-dependent
phospholipase C causes activation of genes containing AP1 elements. Thus,
activated Gq-associated
receptors will demonstrate an increase in the expression of such genes,
whereby inverse agonists will
demonstrate a decrease in such expression.
Also provided herein is a method (also referred to herein as a "screening
assay") for identifying
modulators, i.e., candidate or test compounds or agents (e.g., peptides,
peptidomimetics, small
molecules or other drugs) that bind to GAVE19 proteins or have a stimulatory
or inhibitory effect on,
for example, GAVE19 expression or GAVE19 activity.
In one embodiment, the invention provides assays for screening candidate or
test compounds that bind
to or modulate the activity of the membrane-bound form of a GAVE19 protein,
polypeptide or
biologically active portion thereof. The test compounds of the instant
invention can be obtained using
any of the numerous approaches in combinatorial library methods known in the
art, including:
biological libraries; spatially addressable parallel solid phase or solution
phase libraries; synthetic
library methods requiring deconvolution; the "one-bead one-compound" library
method; and synthetic
library methods using affinity chromatography selection. The biological
library approach is limited to
peptide libraries, while the other four approaches are applicable to peptide,
non-peptide oligomer or
small molecule libraries of compounds (Lam, Anticancer Drug Des (1997)
12:145).
Examples of methods for the synthesis of molecular libraries can be found in
the art, for example in:
DeWitt et al., Proc Natl Acad Sci USA (1993) 90:6909; Erb et al., Proc Natl
Acad Sci USA (1994)
91:11422; Zuckermann et al., J Med Chem (1994) 37:2678; Cho et al., Science
(1993) 261:1303;
Carrell et al., Angew Chem Int Ed Engl (1994) 33:2059; Carell et al., Angew
Chem Int Ed Engl
(1994) 33:2061; and Gallop et al., J Med Chem (1994) 37:1233.
Libraries of compounds may be presented in solution (e.g., Houghten
Bio/Techniques (1992)
13:412-421) or on beads (Lam, Nature (1991) 354:82-84), chips (Fodor, Nature
(1993) 364:555-556),
bacteria (U.S. Patent No. 5,223,409), spores (U.S. Patent Nos. 5,571,698;
5,403,484; and 5,223,409),
plasmids (Cull et al., Proc Natl Acad Sci USA (1992) 89:1865-1869) or phage
(Scott et al., Science
CA 02476239 2004-08-12
WO 03/068803 PCT/US03/04350
48
(1990) 249:386-390; Devlin, Science (1990) 249:404-406; Cwirla et al., Proc
Natl Acad Sci USA
(1990) 87:6378-6382; and Felici, J Mol Biol (1991) 222:301-310).
In a particular embodiment of the present invention, an assay is a cell-based
assay in which a cell that
S expresses a membrane-bound form of GAVE19 protein, or a biologically active
portion thereof, on the
cell surface is contacted with a test compound and the ability of the test
compound to bind to a
GAVE19 protein is determined. The cell, for example, can be a yeast cell or a
cell of mammalian
origin. Determining the ability of the test compound to bind to the GAVE19
protein can be
accomplished, for example, by coupling the test compound with a radioisotope
or enzymatic label so
that binding of the test compound to the GAVE 19 protein or biologically
active portion thereof can be
determined by detecting the labeled compound in a complex. For example, test
compounds can be
labeled with'zsh ssS iaC or 3H, either directly or indirectly and the
radioisotope detected by direct
counting of radioemmission or by scintillation counting. Alternatively, test
compounds can be labeled
enzymatically with, for example, horseradish peroxidase, alkaline phosphatase
or luciferase and the
enzymatic label detected by determination of conversion of an appropriate
substrate to product. In a,
particular embodiment, the assay comprises contacting a cell that expresses a
membrane-bound form
of GAVE19 protein or a biologically active portion thereof, on the cell
surface with a known
compound that binds GAVE19 to form an assay mixture, contacting the assay
mixture with a test
compound and determining the ability of the test compound to interact with a
GAVE19 protein,
wherein determining the ability of the test compound to interact with a GAVE19
protein comprises
determining the ability of the test compound to bind preferentially to GAVE19
or a biologically active
portion thereof as compared to the known compound.
In another embodiment, an assay is a cell-based assay comprising contacting a
cell expressing a
membrane-bound form of GAVE19 protein or a biologically active portion
thereof, on the cell surface
with a test compound and determining the ability of the test compound to
modulate (e.g., stimulate or
inhibit) the activity of the GAVE19 protein or biologically active portion
thereof. Determining the
ability of the test compound to modulate the activity of GAVE19 or a
biologically active portion
thereof can be accomplished, for example, by determining the ability of the
GAVE19 protein to bind
to or to interact with a GAVE19 target molecule. As used herein, a "target
molecule" is a molecule
with which a GAVE19 protein binds or interacts in nature, for example, a
molecule on the surface of a
cell that expresses a GAVE19 protein, a molecule on the surface of a second
cell, a molecule in the
extracellular milieu, a molecule associated with the internal surface of a
cell membrane or a
cytoplasmic molecule. A GAVE19 target molecule can be a non-GAVE19 molecule or
a GAVE19
protein or polypeptide of the instant invention. In one embodiment, a GAVE19
target molecule is a
CA 02476239 2004-08-12
WO 03/068803 PCT/US03/04350
49
component of a signal transduction pathway that facilitates transduction of an
extracellular signal
(e.g., a signal generated by binding of a compound to a membrane-bound GAVE19
molecule) through
the cell membrane and into the cell. The target, for example, can be a second
intercellular protein that
has catalytic activity or a protein that facilitates the association of
downstream signaling molecules
with GAVE19.
Determining the ability of the GAVE19 protein to bind to or to interact with a
GAVE19 target
molecule can be accomplished by one of the methods described above for
determining direct binding.
In a particular embodiment, determining the ability of the GAVE19 protein to
bind to or to interact
with a GAVE19 target molecule can be accomplished by determining the activity
of the target
molecule. For example, the activity of the target molecule can be determined
by detecting induction
of a cellular second messenger of the target (e.g., intracellular Ca2+,
diacylglycerol, IP3 etc.), detecting
catalytic/enzymatic activity of the target on an appropriate substrate,
detecting the induction of a
reporter gene (e.g., a GAVE19-responsive regulatory element operably linked to
a nucleic acid
encoding a detectable marker, e.g. luciferase) or detecting a cellular
response, e.g., cellular
differentiation or cell proliferation.
The present invention further extends to a cell-free assay comprising
contacting a GAVE19 protein, or
biologically active portion thereof, with a test compound, and determining the
ability of the test
compound to bind to the GAVE 19 protein or biologically active portion
thereof. Binding of the test
compound to the GAVE19 protein can be determined either directly or indirectly
as described above.
In a preferred embodiment, the assay includes contacting the GAVE19 protein or
biologically active
portion thereof with a known compound that binds GAVE19 to form an assay
mixture, contacting the
assay mixture with a test compound, and determining the ability of the test
compound to interact with
a GAVE19 protein, wherein determining the ability of the test compound to
interact with a GAVE19
protein comprises determining the ability of the test compound to
preferentially bind to GAVE19 or
biologically active portion thereof as compared to the known compound.
Another cell-free assay of the present invention involves contacting GAVE19
protein or biologically
active portion thereof, with a test compound and determining the ability of
the test compound to
modulate (e.g., stimulate or inhibit) the activity of the GAVE19 protein or
biologically active portion
thereof. Determining the ability of the test compound to modulate the activity
of GAVE19 can be
accomplished, for example, by determining the ability of the GAVE19 protein to
bind to a GAVE19
target molecule by one of the methods described above for determining direct
binding. In an
alternative embodiment, determining the ability of the test compound to
modulate the activity of
CA 02476239 2004-08-12
WO 03/068803 PCT/US03/04350
GAVE19 can be accomplished by determining the ability of the GAVE19 protein to
further modulate
a GAVE19 target molecule. For example, the catalytic/enzymatic activity of the
target molecule on an
appropriate substrate can be determined as described previously.
5 Still another cell-free assay of the present invention comprises contacting
the GAVE19 protein or
biologically active portion thereof, with a lrnown compound that binds GAVE19
to form an assay
mixture, contacting the assay mixture with a test compound and determining the
ability of the test
compound to interact with a GAVE19 protein. The step for determining the
ability of the test
compound to interact with a GAVE19 protein comprises determining the ability
of the GAVE19
10 protein preferentially to bind to or to modulate the activity of a GAVE19
target molecule.
Receptors can be activated by non-ligand molecules that necessarily do not
inhibit ligand binding but
cause structural changes in the receptor to enable G protein binding or,
perhaps receptor aggregation,
dimerization or clustering that can cause activation. For example, antibodies
can be raised to the
15 various portions of GAVE19 that are exposed at the cell surface. Those
antibodies activate a cell via
the G protein cascade as determined by standard assays, such as monitoring
cAMP levels or
intracellular Ca+Z levels. Because molecular mapping, and particularly epitope
mapping, is involved,
monoclonal antibodies may be preferred. The monoclonal antibodies can be
raised both to intact
receptor expressed at the cell surface and peptides lrnown to form at the cell
surface. The method of
20 Geysen et al., U.S. Pat. No. 5,998,577, can be practiced to obtain a
plurality of relevant peptides.
Antibodies found to activate GAVE19 may be modified to minimize activities
extraneous to GAVE19
activation, such as complement fixation. Thus, the antibody molecules can be
truncated or mutated to
minimize or to remove activities outside of GAVE19 activation. For example,
for certain antibodies,
only the antigen-binding portion is needed. Thus, the F~ portion of the
antibody can be removed.
Cells expressing GAVE19 are exposed to antibody to activate GAVE19. Activated
cells then are
exposed to various molecules in order to identify which molecules modulate
receptor activity, and
result in higher activation levels or lower activation levels. Molecules that
achieve those goals then
can be tested on cells expressing GAVE19 without antibody to observe the
effect on non-activated
cells. The target molecules then can be tested and modified as candidate drugs
for the treatment of
disorders associated with altered GPCR metabolism using lrnown techniques.
The cell-free assays of the instant invention are amenable for use of both the
soluble form and the
membrane-bound form of GAVE19. In the case of cell-free assays comprising the
membrane-bound
form of GAVE19, it may be desirable to utilize a solubilizing agent such that
the membrane-bound
CA 02476239 2004-08-12
WO 03/068803 PCT/US03/04350
51
form of GAVE19 is maintained in solution. Examples of such solubilizing agents
include non-ionic
detergents such as n-octylglucoside, n-dodecylglucoside, n-dodecylmaltoside,
octanoyl-N-methylglucamide, decanoyl-N-methylglucamide, TRITON X-100, TRITON X-
114,
THESIT, isotridecylpoly(ethylene glycol ether)", 3-[(3-
cholamidopropyl)dimethylammino]-1-propane
sulfonate (CHAPS), 3-[(3-cholamidopropyl)dimethylammino]-2-hydroxy-1-propane
sulfonate
(CHAPSO) or N-dodecyl=N,N-dimethyl-3-ammonio-1-propane sulfonate.
In more than one embodiment of the above assay methods of the instant
invention, it may be desirable
to immobilize either GAVE19 or a target molecule thereof to facilitate
separation of complexed from
uncomplexed forms of one or both of the proteins, as well as to accommodate
automation of the assay.
Binding of a test compound to GAVE19 or interaction of GAVE19 with a target
molecule in the
presence and absence of a candidate compound, can be accomplished in any
vessel suitable for
containing the reactants. Examples of such vessels include microtitre plates,
test tubes and
micro-centrifuge tubes. In one embodiment, a fusion protein can be provided
that adds a domain that
allows one or both of the proteins to be bound to a matrix. For example,
glutathione-S-transferase/GAVE19 fusion proteins or glutathione-S-
transferase/target fusion proteins
can be adsorbed onto glutathione SEPHAROSE beads (Sigma Chemical, St. Louis,
MO).
Alternatively, glutathione-derivatized microtitre plates are then combined
with the test compound.
Subsequently, either the non-adsorbed target protein or GAVE19 protein and the
mixture are
incubated under conditions conducive to complex formation (e.g., at
physiological conditions for salt
and pH). Following incubation, the beads or microtitre plate wells are washed
to remove any
unbound components, and the presence of complex formation is measured either
directly or indirectly.
Alternatively, the complexes can be dissociated from the matrix and the level
of GAVE19 binding or
activity determined using standard techniques.
Other techniques for immobilizing proteins on matrices can also be used in the
screening assays of the
invention. For example, either GAVE19 or a target molecule thereof can be
immobilized utilizing
conjugation of biotin and streptavidin. Biotinylated GAVE19 or target
molecules can be prepared
from biotin-NHS (N-hydroxy-succinimide) using techniques well known in the art
(e.g., biotinylation
kit, Pierce Chemicals, Rockford, IL) and immobilized in the wells of
streptavidin-coated 96-well
plates (Pierce Chemicals). Alternatively, antibodies that are reactive with
GAVE19 or a target
molecule, but do not interfere with binding of the GAVE19 protein to the
target molecule, can be
derivatized to the wells of the plate. Upon incubation, unbound target or
GAVE19 can be trapped in
the wells by antibody conjugation. Methods for detecting such complexes, in
addition to those
described above for the GST-immobilized complexes, include immunodetection of
complexes using
CA 02476239 2004-08-12
WO 03/068803 PCT/US03/04350
52
antibodies reactive with GAVE19 or target molecule, as well as enzyme-linked
assays that rely on
detecting an enzymatic activity associated with the GAVE19 or target molecule.
In another embodiment, modulators of GAVE19 expression are identified in a
method wherein a cell
is contacted with a candidate compound, and the expression of GAVE19 mRNA or
protein in the cell
is determined. The level of expression of GAVE19 mRNA or protein in the
presence of the candidate
compound is compared to the level of expression of GAVE 19 mRNA or protein in
the absence of the
candidate compound. The candidate compound then can be identi$ed as a
modulator of GAVE19
expression based on that comparison. For example, when expression of GAVE19
mRNA or protein is
greater (statistically significantly greater) in the presence of the candidate
compound than in the
absence thereof, the candidate compound is identified as a stimulator or
agonist of GAVE19 mRNA
or protein expression. Alternatively, when expression of GAVE19 mRNA or
protein is less
(statistically significantly less) in the presence of the candidate compound
than in the absence thereof,
the candidate compound is identified as an inhibitor or antagonist of GAVE19
mRNA or protein
expression. If GAVE19 activity is reduced in the presence of ligand or
agonist, or in a constitutive
GAVE19, below baseline, the candidate compound is identified as an inverse
agonist. The level of
GAVE19 mRNA or protein expression in the cells can be determined by methods
described herein for
detecting GAVE19 mRNA or protein.
In yet another aspect of the invention, the GAVE19 proteins can be used as
"bait proteins" in a
two-hybrid assay or three-hybrid assay (see, e.g., U.S. Patent No. 5,283,317;
Zervos et al., Cell (1993)
72:223-232; Madura et al., J Biol Chem (1993) 268:12046-12054; Bartel et al.,
Bio/Techniques (1993)
14:920-924; Iwabuchi et al., Oncogene (1993) 8:1693-1696; and PCT Publication
No. WO 94/10300),
to identify other proteins that bind to or interact with GAVE19 ("GAVE19-
binding proteins" or
"GAVE19-by"), and modulate GAVE19 activity. Such GAVE19-binding proteins are
also likely to
be involved in the propagation of signals by the GAVE19 proteins such as, for
example, upstream or
downstream elements of the GAVE19 pathway.
Since the present invention enables the production of large quantities of pure
GAVE19, physical
characterization of the conformation of areas of likely function can be
ascertained for rational drug
design. For example, the IC3 region of the molecule and EC domains are regions
of particular
interest. Once the shape and ionic configuration of a region is discerned,
candidate drugs that should
interact with those regions can be configured and then tested in intact cells,
animals and patients.
Methods that would enable deriving such 3-D structure information include X-
ray crystallography,
NMR spectroscopy, molecular modeling and so on. The 3-D structure also can
lead to identification
CA 02476239 2004-08-12
WO 03/068803 PCT/US03/04350
53
of analogous conformational sites in other known proteins where known drugs
that act at site exist.
Those drugs, or derivatives thereof, may find use in treating inflammatory
diseases or disorders such
as rheumatoid arthritis or COPD, to name only a few.
The invention further pertains to novel agents identified by the above-
described screening assays and
uses thereof for treatments as described herein.
A. DetPCti~n AccaT
Portions or fragments of the DNA sequences of the present invention can be
used in numerous ways
as polynucleotide reagents. For example, the sequences can be used to: (i) map
the respective genes
on a chromosome and, thus, locate gene regions associated with genetic
disease; (ii) identify an
individual from a minute biological sample (tissue typing); and (iii) aid in
forensic identification of a
biological sample. The applications are described in the subsections below.
1. Chromosome Mapping
Once the sequence (or a portion of the sequence) of a gene has been isolated,
the sequence can be used
to map the location of the GAVE19 gene on a chromosome. Accordingly, GAVE19
nucleic acid
molecules described herein or fragments thereof can been used to map the
location of GAVE19 in a
genome. The mapping of the location of the GAVE19 sequence in a genome is an
important step in
correlating the sequences with genes associated with disease.
Briefly, GAVE19 genes can be mapped in a genome by preparing PCR primers
(preferably 15-25 by
in length) from the GAVE19 sequences. The primers are used for PCR screening
of somatic cell
hybrids containing individual murine chromosomes. Only those hybrids
containing the murine gene
corresponding to the GAVE19 sequences yield an amplified fragment.
A particular method includes, but certainly is not limited to denaturing
murine chromosomes and then
contacting them with a detectably labeled GAVE19 DNA molecule under stringent
hybridization
conditions. Hybridization and subsequent detection of the detectably labeled
GAVE19 DNA molecule
will reveal the location of GAVE 19 in the murine chromosome. Such an in situ
hybridization
technique is described in Fan et al., Proc Natl Acad Sci USA (1990) 87:6223-
27, which involves
pre-screening with labeled flow-sorted chromosomes and pre-selection by
hybridization to
chromosome-specific cDNA libraries. The in situ hybridization (FISH) of a DNA
sequence to a
metaphase chromosomal spread can also be used to provide a precise chromosomal
location in one
CA 02476239 2004-08-12
WO 03/068803 PCT/US03/04350
54
step. Chromosome spreads can be made using cells in which division has been
blocked in metaphase
by a chemical, e.g., colcemid, that disrupts the mitotic spindle. The
chromosomes can be treated
briefly with trypsin and then stained with Giemsa. A pattern of light and dark
bands develops on each
chromosome so that the chromosomes can be identified individually. The FISH
technique can be used
with a DNA sequence as short as 500 or 600 bases. However, clones larger than
1,000 bases have a
higher likelihood of binding to a unique chromosomal location with sufficient
signal intensity for
simple detection. Preferably 1,000 bases and more preferably, 2,000 bases will
suffice to get good
results in a reasonable amount of time. For a review of the technique, see
Verma et al. (Human
Chromosomes: A Manual of Basic Techniques (Pergamon Press, New York, 1988)).
Chromosomal
mapping can be inferred in silico, and employing statistical considerations,
such as lod scores or mere
proximity.
Reagents for chromosome mapping can be used individually to locate a single
site on a chromosome.
Furthermore, panels of reagents can be used for marking multiple sites and/or
multiple chromosomes.
Reagents corresponding to flanking regions of the GAVE19 gene actually are
preferred for mapping
purposes. Coding sequences are more likely to be conserved within gene
families, thus increasing the
chance of cross hybridization during chromosomal mapping.
Once a sequence has been mapped to a precise chromosomal location, the
physical position of the
sequence on the chromosome can be correlated with genetic map data. The
relationship between
genes and disease, mapped to the same chromosomal region, can then be
identified through linkage
analysis (co-inheritance of physically adjacent genes), described in, e.g.,
Egeland et al., Nature (1987)
325:783-787.
Moreover, differences in the DNA sequences between animals affected and
unaffected with a disease
associated with GAVE19 can be determined. If a mutation is observed in some or
all of the affected
animals, but not in any unaffected animals, then the mutation is likely to be
the causative agent of the
particular disease. Comparison of affected and unaffected animals generally
involves first looking for
structural alterations in the chromosomes such as deletions or translocations
that are visible from
chromosome spreads or detectable using PCR based on that DNA sequence.
Ultimately, complete
sequencing of genes from several animals can be performed to confirm the
presence of a mutation and
to distinguish mutations from polymorphisms.
CA 02476239 2004-08-12
WO 03/068803 PCT/US03/04350
1. Diagnostic Assays
An exemplary method for detecting the presence or absence of GAVE19 in a
biological sample
involves obtaining a biological sample from a test animal and contacting the
biological sample with a
5 compound or an agent capable of detecting GAVE19 protein or nucleic acid
(e.g., mRNA or genomic
DNA) that encodes GAVE19 protein such that the presence of GAVE19 is detected
in the biological
sample. A preferred agent for detecting GAVE19 mRNA or genomic DNA is a
labeled nucleic acid
probe capable of hybridizing to GAVE19 mRNA or genomic DNA. The nucleic acid
probe can be,
for example, a full-length GAVE19 nucleic acid, such as the nucleic acid of
SEQ >D NO:1 or a portion
10 thereof, such as an oligonucleotide of at least 15, 30, 50, 100, 250 or 500
or more nucleotides in length
and sufficient to specifically hybridize under stringent conditions to GAVE19
mRNA or genomic
DNA. Other suitable probes for use in the diagnostic assays of the invention
are described herein.
A particular agent for detecting GAVE19 protein is an antibody capable of
binding to GAVE19
15 protein, preferably an antibody with a detectable label. Antibodies can be
polyclonal, chimeric, or
more preferably, monoclonal. An intact antibody or a fragment thereof (e.g.,
Fab or F~ab')z) can be used.
The term "biological sample" is intended to include tissues, cells and
biological fluids isolated from a
subject, as well as tissues, cells and fluids present within a subject. That
is, the detection method of
the invention can be used to detect GAVE19 mRNA, protein or genomic DNA in a
biological sample
20 in vitro as well as in vivo. For example, in vitro techniques for detection
of GAVE19 mRNA include
Northern hybridization and in situ hybridization. In vitro techniques for
detection of GAVE19 protein
include ELISA, Western blot, immunoprecipitation and immunofluorescence. In
vitro techniques for
detection of GAVE19 genomic DNA include Southern hybridization. Furthermore,
in vivo techniques
for detection of GAVE19 protein include introducing into an animal a labeled
anti-GAVE19 antibody.
25 For example, the antibody can be labeled with a radioactive marker, the
presence and location of
which in an animal can be detected by standard imaging techniques.
In an embodiment, the biological sample contains protein molecules from the
test animal.
Alternatively, the biological sample can contain mRNA molecules from the test
animal or genomic
30 DNA molecules from the test animal. A particular biological sample having
applications herein is a
peripheral blood leukocyte sample isolated by conventional means from an
animal.
In another embodiment, the methods further involve obtaining a biological
sample from a control
animal, contacting the control sample with a compound or agent capable of
detecting GAVE19
35 protein, mRNA or genomic DNA, such that the presence and amount of GAVE19
protein, mRNA or
CA 02476239 2004-08-12
WO 03/068803 PCT/US03/04350
56
genomic DNA is detected in the biological sample, and then comparing the
presence and amount of
GAVE19 protein, mRNA or genomic DNA in the control sample with the presence
and amount of
GAVE19 protein, mRNA or genomic DNA in a test sample to determine whether the
compound
modulates the expression or activity of GAVE 19.
Any of the assays for compounds capable of modulating the activity of GAVE19
are amenable to high
throughput screening. High throughput screening systems are commercially
available (see, e.g.,
Zymark Corp., Hopkinton, MA; Air Technical Industries, Mentor, OH; Beckman
Instruments, Ins.
Fullerton, CA; Precision Systems, Ins., Natick, MA, etc.). These systems
typically automate entire
procedures including all sample and reagent pipetting, liquid dispensing,
timed incubations, and final
readings of the microplate in detectors) appropriate for the assay. These
configurable systems
provide high throughput and rapid start up as well as a high degree of
flexibility and customization.
The manufacturers of such systems provide detailed protocols the various high
throughput. Thus, for
example, Zymark Corp. provides technical bulletins describing screening
systems for detecting the
modulation of gene transcription, ligand binding, and the like.
Kits
The invention also encompasses kits for detecting the presence of GAVE19 in a
biological sample (a
test sample). Such kits can be used to determine whether a particular compound
modulates the
expression or activity of GAVE19. For example, the kit can comprise a labeled
compound or agent
capable of detecting GAVE19 protein or mRNA in a biological sample and means
for determining the
amount of GAVE19 in the sample (e.g., an anti-GAVE19 antibody or an
oligonucleotide probe that
binds to DNA encoding GAVE19, e.g., SEQ ID NO:1).
For antibody-based kits, the kit can comprise, for example: (1) a first
antibody (e.g., attached to a
solid support) that binds to GAVE19 protein; and, optionally, (2) a second,
different antibody that
binds to GAVE19 protein or to the first antibody and is conjugated to a
detectable agent. If the second
antibody is not present, then either the first antibody can be detestably
labeled, or alternatively,
another molecule that binds the first antibody can be detestably labeled. In
any event, a labeled
binding moiety is included to serve as the detectable reporter molecule, as
known in the art.
For oligonucleotide-based kits, a kit of the present invention can comprise,
for example: (1) an
oligonucleotide, e.g., a detestably-labeled oligonucleotide, that hybridizes
to a GAVE19 nucleic acid
sequence or (2) a pair of primers useful for amplifying a GAVE19 nucleic acid
molecule.
CA 02476239 2004-08-12
WO 03/068803 PCT/US03/04350
57
The kit also can comprise, e.g., a buffering agent, a preservative or a
protein stabilizing agent. The kit
also can comprise components necessary for detecting the detectable agent
(e.g., an enzyme or a
substrate). Furthermore, the kit may also contain a control sample or series
of control samples that
can be assayed and compared to the test sample. Each component of the kit is
usually enclosed
within an individual container, and all of the various containers are within a
single package.
2. Pharmacogenomics
As explained herein, GAVE19 expression is modulated in cells associated with
activated or
inflammatory states. Disorders associated with inflammation include,
anaphylactic states, colitis,
Crohn's Disease, edematous states, contact hypersensitivity, allergy,
other~forms of arthritis,
meningitis and other conditions wherein the immune system reacts to an insult
by vascular dilation,
heat, collecting cells, fluids and the like at a site resulting in swelling
and the like. Thus, agents or
modulators that have a stimulatory or inhibitory effect on GAVE19 activity
(e.g., GAVE19 gene
expression) as identified by a screening assay described herein can be
administered to individuals to
treat (prophylactically or therapeutically) disorders (e.g., inflammation
associated with asthma,
chronic obstructive pulmonary disease and rheumatoid arthritis). In
conjunction with such treatment,
the pharmacogenomics (i.e., the study of the relationship between the genotype
of an individual and
the response of the individual to a foreign compound or drug) of the
individual may be considered.
Differences in metabolism of therapeutics can lead to severe toxicity or
therapeutic failure by altering
the relation between dose and blood concentration of the pharmacologically
active drug. Thus, the
pharmacogenomics of the individual permits the selection of effective agents
(e.g., drugs) for
prophylactic or therapeutic treatments based on a consideration of the
genotype of the individual.
Such pharmacogenomics further can be used to determine appropriate dosages and
therapeutic
regimens.
Pharmacogenomics deals with clinically significant hereditary variations in
the response to drugs due
to altered drug disposition and abnormal action in affected persons. See,
e.g., Linden Clin Chem
(1997) 43(2):254-266. In general, two types of pharmacogenetic conditions can
be differentiated.
Genetic conditions transmitted as a single factor altering the way drugs act
on the body are referred to
as "altered drug action." Genetic conditions transmitted as single factors
altering the way the body
acts on drugs are referred to as "altered drug metabolism." The
pharmacogenetic conditions can occur
either as rare defects or as polymorphisms. For example, glucose-6-phosphate
dehydrogenase
deficiency (G6PD) is a common inherited enzymopathy in that the main clinical
complication is
CA 02476239 2004-08-12
WO 03/068803 PCT/US03/04350
58
hemolysis after ingestion of oxidant drugs (anti-malarials, sulfonamides,
analgesics or nitrofurans) and
consumption of fava beans.
As an illustrative embodiment, the activity of drug metabolizing enzymes is a
major determinant of
both the intensity and duration of drug action. The discovery of genetic
polymorphisms of drug
metabolizing enzymes (e.g., N-acetyltransferase 2 (NAT 2) and cytochrome P450
enzymes, CYP2D6
and CYP2C19) has provided an explanation as to why some patients do not obtain
the expected drug
effects or show exaggerated drug response and serious toxicity after taking
the standard and safe dose
of a drug. The polymorphisms are expressed in two phenotypes in the
population, the extensive
metabolizer (EM) and poor metabolizer (PM). The prevalence of PM is different
among different
populations. For example, the gene coding for CYP2D6 is highly polymorphic and
several mutations
have been identified in PM, all which lead to the absence of functional
CYP2D6. Poor metabolizers
of CYP2D6 and CYP2Cl 9 quite frequently experience exaggerated drug response
and side effects
when standard doses are received. If a metabolite is the active therapeutic
moiety, a PM will show no
therapeutic response, as demonstrated for the analgesic effect of codeine
mediated by the
CYP2D6-formed metabolite, morphine. The other extreme is the so-called ultra-
rapid metabolizers
that do not respond to standard doses. Recently, the molecular basis of ultra-
rapid metabolism has
been identified to be due to CYP2D6 gene amplification.
Activity of a homolog of GAVE19 protein, or expression of a DNA molecule that
is a homolog of
GAVE19 nucleic acid in an individual can be determined to select thereby
appropriate agents) for
therapeutic or prophylactic treatment of the individual. In addition,
pharmacogenetic studies can be
used to apply genotyping of polymorphic alleles encoding drug-metabolizing
enzymes to the
identification of the drug responsiveness phenotype of an individual. That
knowledge, when applied
to dosing or drug selection, can avoid adverse reactions or therapeutic
failure and thus enhance
therapeutic or prophylactic efficiency when treating a subject with a GAVE19
modulator, such as a
modulator identified by one of the exemplary screening assays described
herein.
D. Methods of Treatment
As explained above, the present invention extends to assays for identifying
drugs or agents that
modulate the expression of GAVE19 in mice. Due to the expression profile of
GAVE19, i.e. is highly
expressed in normal spleen, has an expression level that is increased two fold
relative to normal spleen
in collagen induced arthritis (CIA) RA mouse spleen, and has an expression
level elevated over five-
CA 02476239 2004-08-12
WO 03/068803 PCT/US03/04350
59
fold in CIA RA mouse lung compared with normal lung, such drugs or agents may
readily have
applications in treating diseases or disorders such as inflammatory disorders
(e.g. asthma), chronic
obstructive pulmonary disease and rheumatoid arthritis, to name only a few.
1. Prophylactic Methods
In one aspect, the invention provides a method for preventing in a subject, a
disease or condition such
as those described above, by administering to the subject an agent that
modulates GAVE19 expression
or at least one GAVE19 activity. Subjects that may benefit from such treatment
can be identified by,
for example, any or a combination of diagnostic or prognostic assays well
known to those of ordinary
skill in the art. Administration of a prophylactic agent can occur prior to
the manifestation of
symptoms for such a disease or disorder in order to prevent the disease or
disorder, or alternatively to
delay its progression.
2. Therapeutic Methods
An agent that can used for treating inflammatory diseases, i.e., that is found
to modulate GAVE19
protein activity in mice, can be an agent as described herein, such as a
nucleic acid or a protein, a
naturally-occurring cognate ligand of a GAVE19 protein, a peptide, a GAVE19
peptidomimetic or
other small molecule. In one embodiment, the agent stimulates one or more of
the biological activities
of GAVE19 protein. Examples of such stimulatory agents include active GAVE19
protein and a
nucleic acid molecule encoding GAVE19 that has been introduced into the cell.
In another
embodiment, the agent inhibits one or more of the biological activities of
GAVE19 protein. Examples
of such inhibitory agents include antisense GAVE19 nucleic acid molecules and
anti-GAVE19
antibodies. The modulatory methods can be performed in vitro (e.g., by
culturing the cell with the
agent) or, alternatively, in vivo (e.g., by administering the agent to a
subject). As such, the instant
invention provides methods of treating an individual afflicted with a disease
or disorder as described
above that comprises administering to the individual an agent (e.g., an agent
identified by a screening
assay described herein) or combination of agents that modulates (e.g.,
upregulates or downregulates)
GAVE19 expression or activity in mice. In another embodiment, the method
involves administering a
GAVE19 protein or nucleic acid molecule as therapy.
The present invention may be better understood by reference to the following
non-limiting Example,
which is provided as exemplary of the invention. The following Example is
presented in order to
more fully illustrate the preferred embodiments of the invention. It should in
no way be construed,
however, as limiting the broad scope of the invention.
CA 02476239 2004-08-12
WO 03/068803 PCT/US03/04350
The large number of G-protein coupled receptors are the target of ~50% of the
current therapeutic
drugs on the market. The GPCRs are activated by a wide variety of ligands,
including peptide,
neurotransmitters, hormones, growth factors, amines, lipids, fatty acids,
odorant molecules and ligts.
5 The perturbation of GPCR function results in many pathological conditions.
GAVE19, the ortholog of
human GAVE18, is highly expressed in normal spleen, has an expression level
that is increased two
fold relative to normal spleen in collagen induced arthritis (CIA) RA mouse
spleen, and has an
expression level elevated over five-fold in CIA RA mouse lung compared with
normal lung. Thus,
GAVE19 provides a new drug target drugs or agents for treating diseases or
disorders such as
10 inflammatory disorders (e.g. asthma), chronic obstructive pulmonary disease
and rheumatoid arthritis,
to name only a few.
Identification and cloning of GAVE19 also provides the opportunity to find the
endogenous ligand
through a process "de-orphaning". Natural ligand or surrogate ligand
identified through de-orphaning
15 provides a tool for screening some molecules which activate or block the
receptor signal transduction,
and therefore change the cellular physiology and cell function.
Materials and Methods
Identification and cloning of GAVEl9. Using human GAVE18 DNA sequence to quire
mouse
20 genomic DNA database did not reveal the mouse homolog DNA sequence. Human
GAVE18 DNA
containing coding region was then used as the probe to screen Research
Genetics mouse genomic
BAC libraries. Multiple DNA primers designed according human GAVE18 sequence
were used to
sequence the positive mouse BAC. Only the primers, 5' GGC TTC CCC CAA AGA CAA
AG 3'
(SEQ >D N0:3) gave the mouse GAVE19 DNA sequence data.. Multiple mouse DNA
sequencing
25 primers were then designed for primer walking to sequence the mouse GAVE19
coding region.
Mouse disease models and RNA isolation. Mouse total RNAs isolated from
different tissues and
organs are performed with Trizol reagent from GIBCO BLR according manufactory
instruction. The
total RNAs were converted to cDNAs by using Multiscribe RT-PCR kit from ABI.
TaqMan analysis. TaqMan reactions are performed in duplicate with mouse tissue
cDNA and
GAPDH gene is used as an internal control. TaqMan results are then calculated
as relative
expression. The relative expression equals (2~(0-ddCt))*1000, where ddCT
equals (GAVE19 mean
Cts- GAPDH mean Cts) - (GAVE 19 mean NTC Cts- GAPDH mean NTC Cts). TaqMan
probe was
custom synthesized by Operon Technologies. TaqMan primer sequence 1: 5'
CA 02476239 2004-08-12
WO 03/068803 PCT/US03/04350
61
CTGTTCTTGCTGGTGAAAATGAA 3' (SEQ ID N0:4) and sequence 2: 5'
CCATGAACCACCACGAGGTT 3' (SEQ ID N0:5). TaqMan probe sequence: S' (Fam)-
TCACGTTCAGTGACCACCATGGCTG-(Tet) 3' (SEQ ID N0:6). TaqMan reaction was
performed
in a 96-well plate MicroAmp optical tube (PE).
TaqMan expression profile showed gradualy increased expression levels of
GAVE19 in the joints of
CIA RA model from normal controled sample to RA grade 4. The higher RA grade
in the joints
correlates higher GAVE19 expression. GAVE19 also showed dramatically increased
expression
levels in CIA RA lung and spleen to compare with normal controled lung and
spleen. In mouse EAE
(Experimental allergic encephalomyelitis) model of multiple sclerosis, GAVE19
showed increased
expression level in the brain during the EAE peak stage to compare with the
expression level in the
brain during preclinic stage.
Tahle of TanMan RxpreSSion Profile of (TAVR19 in Muse Tissues
Tissue T a CT Mean GAPDH GAPDH Ex ression
CT Mean
EAE Control Unlmm.34.7834.5819.04 19.35 I 15.240.03
Brain 5.24
34.3 19.65
8
EAE Control Unlmm.35.6335.8622.12 22.07 13.8013.800.07
Heart
36.09 22.01
EAE Control Unimm.36.8136.8020.63 20.93 15.8715.870.02
Liver
36.78 21.22
EAE Vehicle Brain34.2134.1219.12 19.09 15.0415.040.03
34.03 19.05
EAE Vehicle Heart33.0132.6419.13 18.66 13.9813.980.06
32.26 18.18
EAE vehicle Liver35.3735.2720.86 20.70 14.5714.570.04
35.16 20.54
EAE Preclinical,35.0635.1019.94 19.99 15.1215.120.03
d7 Brain
35.14 20.03
EAE Preclinical,34.3334.3219.05 18.99 15.3315.330.02
d7 Heart
34.3 18.93
EAE Preclinical,34.1534.2420.23 20.33 I 13.910.06
d7 Liver 3.91
34.33 20.43
EAE Peak Brain 30.7530.7319.96 19.93 10.8010.800.56
30.7 19.9
EAE Peak Heart 32.8232.7518.84 19.09 13.6713.670.08
32.68 19.33
EAE Peak Liver 32.6132.4119.93 20.48 I 11.930.26
1.93
32.2 21.03
EAE Sustained 33.633.5219.61 19.80 13.7313.730.07
Remission
33.44 19.98
EAE Rela se Brain34.3234.4220.89 20.71 13.7113.710.07
34.51 20.52
EAE Unimm. Lun 32.0432.1122 22.46 9.669.66 1.24
CA 02476239 2004-08-12
WO 03/068803 PCT/US03/04350
62
Expression profile data is also graphically shown in Figure 3. All of these
data point that GAVE 19
plays important roles in inflammation related diseases.
A novel mouse G-protein coupled receptor, GAVE19, which is the ortholog of
human GAVE18 has
been identified and cloned. Full-length coding region of the DNA and its
deduced amino acid
sequence have been characterized. Tissue distribution of the receptor has been
analyszed by RT-PCR
(TaqMan) analyses in normal controled mice and collegen induced arthritis
(CIA) mice. Expression
profiles of GAVE19 show the similarities to GAVE18 (the human ortholog) and
clearly indicate its
roles in inflammation diseases such as rheumatoid arthritis. Hence, using
various assays described
herein, GAVE19 provides a new drug target for inflammation diseases, such as
asthma, RA, COPD,
etc. Moreover, compounds and agents found with assays of the present invention
to modulate the
expression and/or activity of GAVE19 in mice may readily applications in
treating such diseases.
The present invention is not to be limited in scope by the specific
embodiments describe herein.
Indeed, various modifications of the invention in addition to those described
herein will become
apparent to those skilled in the art from the foregoing description and the
accompanying figures. Such
modifications are intended to fall within the scope of the appended claims.
It is further to be understood that all base sizes or amino acid sizes, and
all molecular weight or
molecular mass values, given for nucleic acids or polypeptides are
approximate, and are provided for
description.
Various publications are cited herein, the disclosures of which are
incorporated by reference in their
entireties.
CA 02476239 2004-08-12
WO 03/068803 PCT/US03/04350
USAV20020002WOPCTsqIt.ST25
SEQUENCE LISTING
<110> Aventis Pharmaceuticals Inc.
Eishingdrelo, Haifeng
Dressler, Holly
Cai, Jidong
Wright, Paul
<120> A NUCLEIC ACID ENCODING A G-PROTEIN-COUPLED RECEPTOR, AND USES THEREOF
<130> USAV2002/0002 WO PCT
<140> Not Yet Assigned
<141> 2003-02-13
<150> US 60/356,686
<151> 2002-02-14
<150> GB 0219574.1
<151> 2002-08-22
<160> 7
<170> PatentIn version 3.0
<210> 1
<211> 810
<212> DNA
<213> Mus musculus
<400>
1
atggatggatataatacctctgagaattcctcttgtgaccctatactggcacaccactta60
acatcgatttacttcatagtgctcattggaggactggtaggtctcatctccatcctgttc120
ttgctggtgaaaatgaactcacgttcagtgaccaccatggctgtcatcaacctcgtggtg180
gttcatggggtcttcctactgacggtgcctttccgcttggcatacctcatcaaagggact240
tggacgtttggattacccttctgcaaatttgtgagtgccatgttacatatccacatgtac300
ctcacgttcctcttctacgtggtgatactagtcatcagatacctcatcttcttcaagcgt360
agagacaaagtagaattctatagaaaattgcatgcagttgctgcaagttctgccatgtgg420
cttctggtgattgttattgttgtgcccttggtggtttctcagtatggaaatagcgaagaa480
tacaatgagcaacagtgctttagattccataaagaacttggccatgattctgtgcgagtt540
atcaactatatgatagtcattgttgtcatagctgttgcgttgattctcttgggtttccag600
gtcttcatcacattgtccatggtgcggaagtttcgccactccttactatcccaccaggag660
ttctgggcacaactgaaaaatcttttctttataggtatcattattatttgttttcttccc720
taccagttcttcaggatttattacttgtatgttgtggcacattccaagagctgtaaaaac780
aaagttgcattttacaatgaaatcggttga 810
Page 1
CA 02476239 2004-08-12
WO 03/068803 PCT/US03/04350
USAV20020002WOPCTsqIt.ST25
<210> 2
<211> 269
<212> PRT
<213> Mus musculus
<400> 2
Met Asp Gly Tyr Asn Thr Ser Glu Asn Ser Ser Cys Asp Pro Ile Leu
1 5 10 15
Ala His His Leu Thr Ser Ile Tyr Phe Ile Val Leu Ile Gly Gly Leu
20 25 30
Val Gly Leu Ile Ser Ile Leu Phe Leu Leu Val Lys Met Asn Ser Arg
35 40 45
Ser Val Thr Thr Met Ala Val Ile Asn Leu Val Val Val His Gly Val
50 55 60
Phe Leu Leu Thr Val Pro Phe Arg Leu Ala Tyr Leu Ile Lys Gly Thr
65 70 75 80
Trp Thr Phe Gly Leu Pro Phe Cys Lys Phe Val Ser Ala Met Leu His
85 90 95
Ile His Met Tyr Leu Thr Phe Leu Phe Tyr Val Val Ile Leu Val Ile
100 105 110
Arg Tyr Leu Ile Phe Phe Lys Arg Arg Asp Lys Val Glu Phe Tyr Arg
115 120 125
Lys Leu His Ala Val Ala Ala Ser Ser Ala Met Trp Leu Leu Val Ile
130 135 140
Val Ile Val Val Pro Leu Val Val Ser Gln Tyr Gly Asn Ser Glu Glu
145 150 155 160
Tyr Asn Glu Gln Gln Cys Phe Arg Phe His Lys Glu Leu Gly His Asp
165 170 175
Ser Val Arg Val Ile Asn Tyr Met Ile Val Ile Val Val Ile Ala Val
180 185 190
Ala Leu Ile Leu Leu Gly Phe Gln Val Phe Ile Thr Leu Ser Met Val
195 200 205
Arg Lys Phe Arg His Ser Leu Leu Ser His Gln Glu Phe Trp Ala Gln
210 215 220
Leu Lys Asn Leu Phe Phe Ile Gly Ile Ile Ile Ile Cys Phe Leu Pro
225 230 235 240
Tyr Gln Phe Phe Arg Ile Tyr Tyr Leu Tyr Val Val Ala His Ser Lys
245 250 255
Ser Cys Lys Asn Lys Val Ala Phe Tyr Asn Glu Ile Gly
260 265
Page 2
CA 02476239 2004-08-12
WO 03/068803 PCT/US03/04350
<210> 3
<211> 20
<212> DNA
<213> Artificial
<220>
<223> Primer
USAV20020002WOPCTsqIt.ST25
<400> 3
ggcttccccc aaagacaaag 20
<210> 4
<211> 23
<212> DNA
<213> Artificial
<220>
<223> Primer
<400> 4
ctgttcttgc tggtgaaaat gaa 23
<210> 5
<211> 20
<212> DNA
<213> Artificial
<220>
<223> Primer
<400> 5
ccatgaacca ccacgaggtt 20
<210> 6
<211> 25
<212> DNA
<213> Artificial
<220>
<223> Probe
<400> 6
tcacgttcag tgaccaccat ggctg 25
<210> 7
<211> 305
<212> PRT
<213> Homo Sapiens
<400> 7
Met Pro Gly His Asn Thr Ser Arg Asn Ser Ser Cys Asp Pro Ile Val
1 5 10 15
Thr Pro His Leu Ile Ser Leu Tyr Phe Ile Val Leu Ile Gly Gly Leu
Page 3
CA 02476239 2004-08-12
WO 03/068803 PCT/US03/04350
USAV20020002WOPCTsqIt.ST25
20 25 30
Val Gly Val Ile Ser Ile Leu Phe Leu Leu Val Lys Met Asn Thr Arg
35 40 45
Ser Val Thr Thr Met Ala Val Ile Asn Leu Val Val Val His Ser Val
50 55 60
Phe Leu Leu Thr Val Pro Phe Arg Leu Thr Tyr Leu Ile Lys Lys Thr
65 70 75 80
Trp Met Phe Gly Leu Pro Phe Cys Lys Phe Val Ser Ala Met Leu His
85 90 95
Ile His Met Tyr Leu Thr Phe Leu Phe Tyr Val Val Ile Leu Val Thr
100 105 110
Arg Tyr Leu Ile Phe Phe Lys Cys Lys Asp Lys Val Glu Phe Tyr Arg
115 120 125
Lys Leu His Ala Val Ala Ala Ser Ala Gly Met Trp Thr Leu Val Ile
130 135 140
Val Ile Val Val Pro Leu Val Val Ser Arg Tyr Gly Ile His Glu Glu
145 150 155 160
Tyr Asn Glu Glu His Cys Phe Lys Phe His Lys Glu Leu Ala Tyr Thr
165 170 175
Tyr Val Lys Ile Ile Asn Tyr Met Ile val Ile Phe Val Ile Ala Val
180 185 190
Ala Val Ile Leu Leu Val Phe Gln Val Phe Ile Ile Met Leu Met Val
195 200 205
Gln Lys Leu Arg His Ser Leu Leu Ser His Gln Glu Phe Trp Ala Gln
210 215 220
Leu Lys Asn Leu Phe Phe Ile Gly Val Ile Leu Val Cys Phe Leu Pro
225 230 235 240
Tyr Gln Phe Phe Arg Ile Tyr Tyr Leu Asn Val Val Thr His Ser Asn
245 250 255
Ala Cys Asn Ser Lys Val Ala Phe Tyr Asn Glu Ile Phe Leu Ser Val
260 265 270
Thr Ala Tle Ser Cys Tyr Asp Leu Leu Leu Phe val Phe Gly Gly Ser
275 2B0 285
His Trp Phe Lys Gln Lys Ile Ile Gly Leu Trp Asn Cys Val Leu Cys
290 295 300
Arg
305
Page 4
