Note: Descriptions are shown in the official language in which they were submitted.
CA 02485218 2004-11-04
1
METHOD FOR CREATING POLYNUCLEOTIDE MOLECULES
The present invention relates to a method for generating
polynucleotide molecules wit altered properties.
Biomolecules, and in particular biopolymers such as
polynucleotides, polypeptides, polysaccharides, etc.wnot only.
form the basis of biological life as we know it, but are also
increasingly used in a whole variety of industrial applications.
The search for new functional biomolecules, their isolation and
preparation and their industrial application are the subject
matter of modern biotechnology. In addition to finding by chance
previously unknown biomolecules with desired properties in nature
(cf. screening for natural substances), there have recently
appeared methods which mimic in a laboratory the principles of
natural evolution.
In addition to the methods for generating point mutations (in the
form of exchange, deletion and insertion of bases), recombination
of sequence sections is a very successful strategy in nature for
the combination of point mutations, but also of domains within a
polymer, of subunits of a heteromultimer, or of gene variants
within a gene cluster or of genes within a genome. Homologous
recombination, i.e. the combination of corresponding sequence
sections from different variants while retaining orientation and
reading frame, is particularly important.
Experimentally, recombination can be realized in different ways:
firstly, in vitro by using individual enzyme functions or defined
mixtures or sequences of enzymatic processing steps, secondly, in
vivo by using cellular recombination and/or repair processes.
Previously, mainly PCR-based methods have been used in industrial
in vitro methods. First to be mentioned here is DNA shuffling,
also referred to as secual PCR (WO 95/22625; Stemmer, Nature 370
(1994), 389). In this case, random gene fragments whose sequences
overlap are generated and subsequently reconstructed by PCR
without addition of primers to give products of the original
length. Thus, in each PCR cycle it is possible for fragments of
different origins, by priming each other, to combine randomly and
homologously to a product molecule. DNA shuffling makes it _.
CA 02485218 2004-11-04
1a
possible in principle to limit the frequency of recombination
events by adjusting the fragment length. However, this method is
experimentally complicated, since first the reaction conditions
for generating the nucleic acid fragments have to be established.
Another method for preparing recombinant DNA in vitro has been
PF 53571 CA 02485218 2004-11-04
2
reported by Shao et al., Nucl. Acids Res. 26 (1998), 681). This
method used primers with ranc~~mized sequences, which enable
polymerization to start at random sites within a polynucleotide.
Thus, similar to DNA shuffling, short polynucleotide fragments
are produced which can recombine with one another by priming each
other. Controlling the recombination frequency is hardly possible
using this method. Moreover, the non-specific primers cause a
comparatively high inherent error rate which can become a problem
for sensitive sequence sections and/or long genes. As an
alternative to these methods, the staggered extension process
(WO 98/42728; Zhao et al., Nat. Biotechnol. (1998), 258) uses a
modified PCR protocol in order to provoke strand exchange during
PCR amplification. By using very short phases at the
polymerization temperature between the melting and annealing
phases, incomplete products can hybridize with new templates and
be extended further. The recombination frequency can be adjusted
by presetting the polymerization time and the number of cycles. A <
technical limitation here is the accurate setting of very short
phases at a particular temperature. As an alternative to these
PCR-based methods, a method has been described which generates
from a population of polynucieotide sequences with mutations
heteroduplexes which are then subjected to random repair in vivo
by introducing them into cells or in vitro by incubating them
with a cell extract, resulting in a certain proportion of
recombinant molecule variants, depending on the relative
frequency of the variants in the starting population
(WO 99129902). This method is characterized by the use of
cellular repair systems which specifically recognize unpaired
bases and randomly repair either of the two strands in a double
strand. This method if limited on the one hand by the limited
efficiency in introducing polynucleotides into cells and by the
missing controllability of the repair processes. A decisive
disadvantage is furthermore the fact that in each repair step
only two starting molecules can be recombined with one another.
It is an object of the present invention to provide a method for
preparing polynucleotides with altered properties, which avoids
the above-described disadvantages of the known methods and which
allows efficient recombination of genotypes of polynucleotide
molecules, thereby generating altered phenotypes.
We have found that this object is achieved by providing the
embodiments described in the claims.
PF 53571 CA 02485218 2004-11-04
.:i
Thus the present invention relates to a method for generating
polynucleotide molecules with altered properties, which comprises
going through at least one cycle comprising the following steps:
(a) providing a double-stranded polynucleotide molecule or a
population of double-stranded polynucleotide molecules, with
the individual polynucleotides of said population having at
least one homologous sequence section and at least one
heterologous sequence section,
(b) generating single strand :;peaks in said double-stranded
polynucleotide molecules
(c) 5'-+3' nucleolytic degradation starting from said single
strand breaks, with simultaneous 5'-+3' de-novo synthesis and
shifting of said single strand breaks in the direction of the
3' end,
(d) preparing single-stranded polynucleotide molecules
(e) preparing partially double-stranded polynucleotide molecules
of the single-stranded polynucleotide molecules provided by
step (d),
(f) template-directed nucleic acid synthesis starting from the
partially double-stranded polynucleotide molecules prepared
in step (e),
it being possible to carry out the steps (b) and (c) successively
or simultaneously.
The method of the invention is therefore distinguished by a
combination of advantages, which cannot be achieved with any of
the methods previously described. Further benefits of said method
are its low experimental complexity and the small amount of time
needed and also the possibility of automation.
The method of the invention is distinguished by the fact that
simultaneous nucleolytic degradation and nucleic acid synthesis,
i.e. "nick translation", avoids both excessive nucleic acid
fragmentation and degradation of recombinable nucleic acids. In
principle, the entire amount of DNA used is available for
subsequent recombination of said nucleic acids in vitro.
PF 53571 CA 02485218 2004-11-04
4
This makes it possible to increase recombination efficiency
compared with the previously described .-lethods for recombining
nucleic acids in vitro.
A preferred embodiment comprises going through more than one
cycle comprising the abovementioned steps (a) to id), i.e, at
least two, preferably at least 5, particularly preferably at
least 10, and very particularly preferably at least 20, cycles.
Cyclic application of the method of the invention thus makes it
possible to prepare from a starting distribution of related
polynucleotide sequences polynucleotides with sequence regions
which have been newly combined several times. Said cyclic
application in particular allows a plurality of different
heterologous sequence sections can be combined with one another.
Furthermore, it is possible to control precisely the
recombination frequency per polynucleotide strand via the number
of cycles. Cyclic application makes it also possible to control
in this way the average interval between recombination events
from one cycle to the next.
In a further preferred embodiment, a selection step is carried
out after one, several or all cycles of the method of the
invention. Said selection step may be related to either the
genotype or the phenotype or to both the genotype and the
phenotype of the polynucleotide.
In this connection, the genotype of a polynucleotide is the
sequence of different monomers in said polynucleotide. The
phenotype is the sum of the functions and properties of a
polynucleotide molecule and of the transcription or translation
products encoded by a polynucleotide.
The selection step may be carried out, for example, as
amplification-coupled (natural) selection, selection by physical
separation or selection by screening (Koltermann and Kettling,
Biophys. Chem. 66 (1999), 159; Kettling et al., Current Topics in
Microbiol. and Immunol. 243 (1999), 173; Koltermann,
Dissertation, TU Berlin (1998), Zhao et al., in Manual of Ind.
Microbiol. and Biotechnol. Chapter 49, pp. 597604, ASM Press,
Washington, DC, 1999; Reetz, Angew. Chem. 113 (2001) 113,
292-320. Step (a) of the method of the invention provides a
double-stranded polynucleotide molecule or a population of
double-stranded polynucleotides.
PF 53571 CA 02485218 2004-11-04
The population of double-stranded polynucleotide molecules which
is provided according to step (a) of the method of the invention
may be any population of double-stranded polynucleotide molecules
which comprises at least two types of polynucleotide molecules,
which comprise at least one homologous sequence section and at
least one heterologous sequence section. In this connection, the
term "population of single-stranded polynucleotide molecules"
refers to an amount of polynucleotide molecules, with
intermolecular interactions in the form of specific base pairings
between said molecules being prevented or being nonexistent. The
term "polynucleotides" (nucleic acids, oligonucleotides) here
comprises both DNA and RNA, polynucleotides are linear, oriented
(5'--~3') heteropolymers which may be in single-stranded or
double-stranded form. In a double strand, two single strands bind
to one another via interactions in the form of specific base
pairing. In principle, the polynucleotides may also be DNA or RNA
with modified monomers. In general, the method can also be
applied to similarly constructed artificial polymers and also to
DNA-RNA hybrid double strands.
The term "homologous sections" refers to sections which are
identical or complementary in two or more polynucleotide
molecules, i.e, which contain the same information in
corresponding positions. The term "heterologous sections" refers
to sections which are not identical or not complementary in two
or more polynucleotide molecules, i.e. which contain differing
information in the corresponding positions. Information of a
polynucleotide molecule (genotype) here refers to the sequence of
different monomers in a polynucleotide molecule. A heterologous
sequence region is at least one nucleotide in length, but may
also be substantially longer. A heteroiogous sequence region may
in particular be two nucleotides, or three nucleotides, for
example of a codon, and preferably more than 5 nucleotides,
particularly preferably more than 10 nucleotides, in length. In
principle, the length of a heterologous region has no upper
limit. Preferably, however, a heterologous region should be no
longer'than 10 000 nucleotides, particularly preferably no longer
than S 000 nucleotides, in particular no longer than 2 000
nucleotides, and very particularly preferably no longer than
1 000 nucleotides. Relatively long sequence sections of this kind
may be, for example, the hypervariable regions of a sequence
encoding an antibody, domains of a protein, genes in a gene
cluster or regions of a genome. The heterologous regions are
preferably sequence regions in which the polynucleotide molecules
differ from one another in individual bases. However,
heterologous regions may also be based on a deletion,
PF 53571 CA 02485218 2004-11-04
duplication, insertion, inversion or addition being present or
having occurred in a polynucleotide molecule.
The double-stranded polynucleotide molecules provided according
to step (a) of the method of the invention have, according to the
invention, at least one homologous and at least one heterologous
sequence region. Preferably, ~=owever, they have a multiplicity of
homologous and heterologous sections. In principle, there is no
upper limit for the number of homologous and heterologous
sections.
The heterologous sections in said double-stranded polynucleotide
molecules are in each case interrupted by homologous sections. In
this connection, the homologous sections are preferentially at
least 5, preferably at least 10, and particularly preferably at
least 20, nucleotides in length. However, like the heterologous
sections, the homologous sections.may be substantially longer,
and in principle there is no upper limit of their length:
Preferentially, they should be no longer than 50 000 nucleotides,
preferably no longer than 20 000 nucleotides, particularly
preferably no longer than 10 OOO nucleotides, and very
particularly preferably no longer than 1 000 nucleotides.
Double-stranded polynucleotide molecules can be provided
according to step (a) of the method of the invention by methods
known to the skilled worker. These include, for example,
physical, chemical, biochemical and biological methods. These
include both synthetic and preparative methods, such as, for
example, chemical synthesis of oligonucleotides, synthesis of
nucleic acids by polymerase chain reaction (PCR), preparation of
plasmids, cosmids, phages, BACs (bacterial artificial
chromosomes), YACs (yeast artificial chromosomes) or chromosomal
DNA.
In a particularly preferred embodiment of the method of the
invention, a population of double-stranded polynucleotides with
homologous and heterologous sections is provided by using related
polynucleotide sequences from the distribution of mutants of a
quasispecies. The term "related" here relates to polynucleotides,
among which there are both hornologous and heterologous sections.
Quasispecies refers to a dynamic population of molecule variants
(mutants) related to one another, which is produced by
error-prone replication. It was possible to show that, according
to the quasispecies principle, the subject of selection is not ..
the wild type (center of mass of the quasispecies) but the entire
distribution. tnlith altered selection conditions, such a
distribution of mutants already contains advantageous variants
. PF 53571 CA 02485218 2004-11-04
7
according to their fitness value, which therefore need not be
produced first by subsequent, random mutations. In the case of
successive shifting of the selection parameters, evolutive '
generation then resembles an implicitly directed drift of said
quasispecies along ridges of the value landscape. WO 92/18645
describes the preparation of quasispecies and the application of
this principle for evolutive biotechnology.
The generation of a quasispecies if based on error-prone
replication of the molecular variants. V~hen using
polynucleotides, replication is preferably carried out with the
aid of replication enzymes, i.e. polymerases, which enable
template-controlled synthesis of a polynucleotide molecule. The
introduction of errors, i.e. variation in molecular information,
can be achieved by the inherently error-prone copying process
alone or else by specifically increasing polymerase inaccuracy
(e.g. specifically imbalanced addition of monomers, addition of
base analogs, error-prone PCR, polymerases with very high error
rates), by post-synthesis chemical modification of
polynucleotides, by complete synthesis of polynucleotides with at
least partial use of monomer mixtures and/or nucleotide analogs,
and by a combination of said methods. Preference is given to
using distributions of mutants of a qaasispecies, the
phenotypical properties of a desired molecular function of the
individual mutants of said quasispecies having already been
improved compared to the wild type. The term "phenotype of a
polynucleotide molecule" refers to the sum of functions and
properties of a polynucleotide molecule and of the transcription
or translation product encoded by a polynucleotide.
In addition, it is possible to use sequences of different origin,
inter alia polynucleotide sequences of a gene family from
different species, polynucleotide sequences which have been
replicated at a particularly high error rate in vivo (e.g. by
viruses, by mutator bacteria, by bacteria under W irradiation)
or in vitro (e. g. by means of Qi3-repiicase react~~.on, error-prone
PCR), polynucleotide sequences into which, after synthesis,
mutations have been introduced by means of chemical agents or
which have been chemically synthesized in such a way that they
have homologous and heterologous sections, or polynucleotide
sequences which have been generated by a combination of
abovementioned methods. In principle, the polynucleotides used in
the method of the invention may be any polynucleotides, in
particular DNA or RNA molecules.
PF 53571 CA 02485218 2004-11-04
The single strand break required in step (b) of the method of the
invention can, in principle, be generated by any method which
leads to cleavage of a phosphodiester bond between 2 nucleotides
in a polynucleotide strand of the double-stranded polynucleotide
molecule. Said methods may be physical or chemical methods (e. g.
ultrasound treatment, partial ester hydrolysis).
Enzymic methods are particularly suitable for step (b).
Examples of enzymes suitable for this are nucleases.
In a preferred embodiment of the method of the invention, single
strand breaks are introduced by sequence-specific nicking
enzymes.
Examples of said nicking enzymes are V.BchI from Bacillus _
chitinosporus, N.BstNBI from Bacillus stearothermophilus,
N.BstSEI from Bacillus stearothermophilus, N.CviPII from
Chlorella strain NC64A, N.CviQXI from Chlorella strain NC64A,
20 V.EcoDem from E.coli, V.HpaII from Haemophilus parainfluenzae,
V.Neal from Nocardia aerocolonigenes and V.XorII from Xanthomonas
oryzae.
In a further preferred embodiment it is possible to introduce
25 single strand breaks into said double-stranded polynucleotide
molecules by non-sequence-specific nicking enzymes. In this
connection, it is possible to use, for example, calf pancreas
DNase I with Mg2+ as cofactor (Kunitz, J. Genetic Physiology 33
(1950), 349; Kunitz, J. Genetic Physiology 33 (1950), 363, and
Melgac and Goldthwaite, J. Liolog. Chem. 243 (1968), 4409).
The reaction conditions in step (c) are chosen depending on the
enzymes used.
In a preferred embodiment, step (c) is carried out under
conditions which cause an increased error rate of de-novo
synthesis.
Said error rate of de-novo synthesis may be chosen depending an
the desired variants to be generated. Typical error rates are
from 0.1 x 10-3 to 10 x 10-3, i.e. 0.01 to 1~ error (exchange of 1
to 10 bases in a DNA section of 10 000 bases).
It is particularly useful to carry out step (c) with an error .
rate of from 1 x 10-3 to 5 x 10-3, i.e. 0.1 to 0.5~ error, i.e. 1
to 5 bases are exchanged in a DNA section of 1 000 bases.
PF 53571 CA 02485218 2004-11-04
9
The error rate of DNA polymerise I is 9 x 10-6 (Kunkel et al.
(1984) J. Biol. Chem. 259:1539-1545). Consequently, when using
DNA polymerise I, an increase in the error rate means an error
rate of more than 9 x 10-6.
In principle, the error rate of de-novo synthesis can be
increased, for example, by using mutated DNA polymerise or by
choosing the proper reaction conditions in step (c).
In a preferred embodiment, the error rate of de-novo synthesis is
increased by using polymerises with reduced or no proofreading
activity.
In a preferred embodiment of the method of the invention, the
error rate of de-novo synthesis is increased by different
nucleotide concentrations as starting material. In this
connection, the concentration of individual or several
nucleotides can be varied relatively to the other nucleotides.
Preference is given to a substoichiometric amount of one
nucleotide, in particular of dATP, compared to the other
nucleotides. Examples of suitable concentrations are 200 ~.M each
of dGTP, dCTP and dTTP and from 20 to 50 ~M ATP.
Preference is given to substoichiometric amounts of two
nucleotides, in particular o' dATP and dGTP, compared to the
other nucleotides. Examples of suitable concentrations are 200 ~,M
each of dCTP and dTTP and 40 ~M each of dATP and dGTP.
In a further embodiment of the method of the invention, the error
rate of de-novo synthesis is increased by the addition of
nucleotide analogs. Nucleotide analogs which may be mentioned are
deoxyinosine triphosphate, ?-deazadeoxyguanosine triphosphate and
deoxynucleoside a-thiotriphosphate. Particular preference is
given to using deoxyinosine triphosphate.
In a further embodiment of the method of the invention the error
rate of de-novo synthesis is increased by varying the salt
concentration. An example suitable for this is an increase in the
concentration of Mg2+ ions to concentrations above 1.5 mM. Also
suitable is the addition of Mn2+ ions, for example in a
concentration range from 0.2 to 1 mM, in particular 0.2 to
0.5 mM.
In a further embodiment of the method of the invention, the error
rate of de-novo synthesis is increased by adding additives. A
suitable additive is any substance which increases the error
PF 53571 CA 02485218 2004-11-04
rate; examples which may be mentioned are dimethyl sulfoxide,
polyethylene glycol and glycerol. Particular preference is given
to adding said additives at the following concentrations: DMSO at
from 2 to 100, PEG at from 5 to 150, glycerol at from > 0 to 300,
5 preferably 5 to 20~.
In a further embodiment, the error rate of de-novo synthesis is
increased by changing the reaction temperature, in particular by
an increase in temperature.
All of the measures mentioned for increasing the error rate may
also be carried out in combination with one another, for example
excess of a nucleotide at increased Mn2+ ion concentration.
In a preferred embodiment, s~eps (b) and (c) are carried out
simultaneously.
Preparation of single-stranded polynucleotide molecules,
according to step (d) of the method of the invention, may be
carried out using methods known to the skilled worker. These
include, for example, physical, chemical, biochemical and
biological methods. Examples which may be listed here are melting
of polynucleotide double strands by means of heating to
temperatures above the annealing temperature (Newton, in: PCR,
Spektrum Akademischer Verlag (1994); Lazurkin, Biopolymers 9
(1970), 1253-1306), denaturing polynucleotide double strands by
means of adding denaturing reagents (e. g. urea or detergents),
addition of enzymes which convert double-stranded polynucleotides
to single-stranded polynucleotides, for example by exonucleolytic
degradation of double-stranded DNA to single-stranded DNA.
Preparation of partially double-stranded polynucleotide molecules
of the single-stranded polynucleotide molecules provided by step
(d), according to step (e) of the method of the invention, may be
carried out using methods known to the skilled worker and is
preferably achieved by hybridizing the homologous sections of the
complementary single-stranded polynucleotide molecules.
Hybridization to give double-stranded polynucleotides is carried
out using methods known to the skilled worker and may, in
particular, be achieved, for example, by combining the single
strands and setting reaction conditions, which promote annealing
of complementary polynucleotides, such as, for example, by
lowering the temperature and/or reducing the salt concentration.
PF 53571 CA 02485218 2004-11-04
11
Starting from the partially double-stranded polynucleotide
molecules prepared in step (e), a template-directed nucleic acid
synthesis is carried out in step (f) of the method of the
invention.
10
The term "template-directed nucleic acid synthesis" here refers
to the synthesis of a polynucleotide by extending an existing
single strand on the basis of the information of a corresponding
template strand.
The skilled worker is familiar with carrying out a
template-directed polymerization of this kind, which is
described, for example, in Sambrook (Molecular Cloning, Cold
Spring Harbor Laboratory Press (1989)).
Any enzyme which has template-controlled polynucleotide
polymerization activity and which is capable of synthesizing
polynucleotide strands may be used for the polymerase reaction. A
multiplicity of polymerases from a large variety of organisms and
20 with different functions have already been isolated and
described. There is a distinction with respect to the type of
template and of synthesized polynucleotide between DNA-dependent
DNA polymerases, RNA-dependent DNA polymerases (reverse
transcriptases), DNA-dependent RNA polymerases and RNA-dependent
25 RNA polymerases (replicases). With respect to temperature
stability, there is a distinction between non-thermostable (37°C)
and thermostable polymerases (75 to 95°C). Furthermore,
polymerases differ with respect to the presence of 5'-3'- and
3'-5'-exonucleolytic activity. The most important polymerases are
DNA-dependent DNA polymerases.
In particular, it is possible to use DNA polymerases having a
temperature optimum of around 37°C. These include, for example,
the E. coli DNA polymerase I, T7 DNA polymerase of bacteriophage
T7 and T4 DNA polymerase of bacteriophage T4, each of which is
commercially sold by a multiplicity of manufacturers, for example
USB, Rbche Molecular Biochemicals, Stratagene, NEB or Quantum
Biotechnologies. E. coli DNA polymerase I (holoenzyme) has a
5'-3' polymerase activity, a 3'-5' proofreading exonuclease
activity and a 5'-3' exonuclease activity. The enzyme is used for
in vitro DNA labeling by means of the nick translation method
(Rigby et al. (J. Mol. Biol. 113 (1977)), 237-251). In contrast
to the holoenzyme, the Klenow fragment of E. coli DNA polymerase
I, like T7 DNA polymerase and T4 DNA polymerase, has no 5'
exonuclease activity. Therefore, these enzymes are used for
"fill-in reactions" or for the synthesis of long strands (Young
et al. (Biochemistry 31 (1992), $675-8690), Lehman (Methods
PF 53571 CA 02485218 2004-11-04
22
Enzymol. 29 (1974), 46-53)). Finally, the 3'-5'-exo(-) variant of
the Klenow fragment of E. coli DNA polymerise I also lacks the 3'
exonuclease activity. This enzyme is often used for DNA
sequencing according to Singer (Singer (Proc. Natl. Acid. Sci.
USA 74 (1977), 5463-5467)). In addition to these enzymes, there
exists a multiplicity of further 37°C DNA polymerises with
different properties, which may be used in the method of the
invention.
The most common, thermostable DNA polymerise which has a
temperature optimum of 75°C and is sufficiently stable at 95°C
is
Taq DNA polymerise from Therrlus aquaticus, which is commercially
available. Taq DNA polymerise is a highly processive 5'-3' DNA
polymerise which has no 3'-5' exonuclease activity. It is often
used for standard PCRs, for sequencing reactions and for
mutagenic PCRs (Cadwell and 3oyce (PCR Methods Appl. 3 (1994),
136-140, Agrogoni and Kaminski (Methods Mol. Biol. 23 (1993),
109-114)). Tth DNA polymerise from Thermus thermophilus HB8 and
Tfl DNA polymerise from Thermus flavus have similar properties.
Tth DNA polymerise, however, additionally has an intrinsic
reverse-transcriptase (RT) activity in the presence of manganese
ions (Cusi et a1. (Biotechniques 17 (1994), 1034-1036)). Again,
quite a number of the thermostable DNA polymerises with 3' but no
5' exonuclease activity are sold commercially: Pwo DNA polymerise
from Pyrococcus woesei, Tli, Vent and DeepVent DNA polymerises
from Thermococcus litoralix, Pfx and Pfu DNA polymerises from
Pyrococcus furiosus, Tub DNA polymerise from Thermus ubiquitous,
Tma and UlTma DNA polymerise from Thermotoga maritima (Newton and
Graham, in: PCR, Spektrum Akad. Verlag Heidelberg (1994), 1)).
Polymerises lacking 3' proofreading exonuclease activity are used
in order to amplify PCR products as with as few errors as
possible. Finally, DNA polymerises lacking both 5' and 3'
exonucleolytic activities are available in the form of the
Stoffel fragment of Taq DNA polymerise, the Vent-(exo-) DNA
polymerise and Tsp DNA polymerise. The most common enzymes among
the RNA-dependant DNA polymerises (reverse transcriptases)
include AMV reverse transcriptase fro_n avian myeloblastosis
virus, M-MuLV reverse transcriptase from Moloney murine leukemia
virus and HIV reverse transcriptase from human immunodeficiency
virus, which are also sold by various suppliers such as, for
example, NEB, Life Technologies, Quantum Biotechnologies. Like
HIV reverse transcriptase, ~~2V reverse transcriptase has an
associated RNase H activity which is markedly reduced in M-MuLV
reverse transcriptase. Both M-MuLV and AMV reverse transcriptase
lack 3'-5' exonuclease activity.
a PF 53571 CA 02485218 2004-11-04
23
The most common enzymes among the DNA-dependent RNA polymerises
include E. coli RNA polymerise, SP6 RNA polymerise from
Salmonella thyphimurium LT2 infected with bacteriophase SP6, T3
RNA polymerise from bacteriophage T3 and T7 RNA polymerise from
bacteriophage T7.
In a preferred embodiment of the method of the invention the
template strands in step (f) of the method are DNA molecules and
a DNA-dependent DNA polymerise is used for template-directed
single strand synthesis.
In a particularly preferred embodiment, a non-thermostable DNA
polymerise, particularly preferably one with 5' and 3'
exonucleolytic activity, such as, for example, E. coli polymerise
I, is used here.
As an alternative, it is also possible to use a non-thermostable
DNA polymerise which has a 3'-+5' exonucleolytic activity but no
5'-+3' exonucleolytic activity, such as, for example, the Klenow
fragment of E. coli DNA polymerise I, T7 DNA polymerise from
bacteriophage T7 or T4 DNA polymerise from bacteriophage T4.
It is furthermore also possible to use a non-thermostable DNA
polymerise which has neither 5'-+3' nor 3'--~5' exonucleolytic
activity, such as, for example, the 3'-5'-exo(-) variant of the
Klenow fragment of E. coli DNA polymerise I.
Another, particularly preferred embodiment uses a thermostable
polymerise (e. g. Taq polymerise, Pwo polymerise) which may again
have 5' and 3' exonucleolytic activities or else 5'
exonucleolytic activity but no 3' exonucleolytic activity, such
as, for example, Taq DNA polymerise from Thermus aquaticus, Tth
DNA polymerise from Thermus thermophilis HB8 or Tfl DNA
polymerise from Thermus flavus.
Alternatively, the thermostable DNA polymerise may have 3'-+5' but
no 5'--t3' exonucleolytic activity, such as, for example, the Pwo
DNA polymerise from Pyrococcus woesei, the VentR DNA polymerise,
the DeepVentR DNA polymerise or the Tli DNA polymerise from
Thermococcus litoralis, the Pfu DNA polymerise or the Pfx DNA
polymerise from Pyrococcus furiosus or Tma DNA polymerise or
UlTma DNA polymerise from Thermotoga maritima.
It is further possible to use a thermostable polymerise which has
neither 3'-5' nor 5'-3' exonucleolytic activity, such as, for
example, the Stoffel fragment of Taq DNA polymerise from Thermus
aquaticus, the Tsp DNA polymerise or the exo(-) variant of VentR
PF 53571 CA 02485218 2004-11-04
14
DNA polymerase or DeepVentR DNA polymerase from Thermococcus
litoralis.
If a thermostable polymerase is used, the polymerase reaction
preferably immediately follows step (e), without intermediate
purification or further sample treatment.
In another preferred embodiment of the method of the invention,
the template strands on which template-directed single strand
synthesis is carried out in step (f) of the method of the
invention are RNA molecules, In this case, the template-directed
single strand synthesis uses an RNA-dependent DNA polymerase,
preferably AMV reverse transcriptase from avian myeloblastosis
virus, HIV reverse transcriptase from human immunodeficiency
25 virus, or M-MuLV reverse transcriptase from Moloney murine
leukemia virus. Preference is further given to using a
thermostable reverse transcriptase, very particularly Tth DNA
polymerase from Thermus thermophilus, which has intrinsic reverse
transcriptase activity.
Example 1
Unless stated otherwise, the experiments were carried out
according to Current Protocols in Molecular Biology.
I. Providing the starting material
4 lipase variants were used as starting material:
LipA H86W encoded by pBP2035, LipA S87T encoded by pBP2008,
LipA F142W encoded by pBP2006, LipA L167A encoded by pBP2007.
1. Plasmid preparation of the following plasmids:
Plasmid Vector Vector Insert Insert size Enzyme
size variant
pBP2006 pBSIIKS 2961 56-20 1142 by F142W
by
pBP2007 pBSIIKS 2961 98-10 1142 by L167A
by
pBP2008 pBSIIKS 2961 124-9 1142 by S87T
by
pBP2035 pBSIIKS 2961 198-1-3 1142 by H86W
by
2. Cleaving the plasmids with restriction endonucleases HindIII
and SacI
3. Isolating the inserts b~~ gel extraction using the GFX Kit
(Pharmacia)
4. Resuspending the DNA fragments in H20
5. Adjusting the DNA concentrations to 250 ng/~l
PF 53572 CA 02485218 2004-11-04
II. Generation of single strand breaks and de-novo synthesis
1. 4 separate reaction mixtures for r_ick translation of inserts
56-20, 98-10, 124-9, 198-1-3, using the nick translation kit
5 (Roche, Cat. No. 976776)
Component Volume
DNA solution with insert -250 ng/~,l 16 ~,~.1
dATP 0.4 mM 2,5 ~l
10 dCTP 0.4 mM 2,5 ~l
dGTP 0 . 4 mM 2 , 5
~,1
dTTP 0 . 4 mM 2 , 5
~,l
10 x buffer 5 ~tl
H20 14 ~l
Enzyme mix 1 ) 5 ~.1
15 Total 50 ~,1
1) Enzyme mix:
DNA polymerase I and DNAseI in 50 $ glycerol (v!v)
2. Incubating the mixtures at 15~C, 90 min
3. Stopping the reaction by adding 5 ~1 of 0.5 M EDTA, pH 8.8
4. Precipitating, washing, drying and resuspending the mixtures
in 20 ~l of H20
III.PCR without primers
Reaction mixture for PCR using the GC rich PCR system (Roche,
Cat. No. 2140306)
Component Volume
Mixture of 6 ~tl of each mixture from 24 ~1
2.4
dNTP 10 mM 1 ~l
GC rich resolution solution 5 M 10 ~,1
GC rich reaction buffer 10 ~tl
PCR grade H20 4 ~1
GC rich enzyme mix ) 1 ~l
Total 50 ~,l
Thermostatic Taq-DNA polymerase and Tgo DNA polymerase
45
PF 53571 CA 02485218 2004-11-04
x6
PCR conditions:
Temperature Time Cycles
95C 5 min
55C 60 s 45
72C 60 s
95C 30 s
72C 10 min
4C x min
IV. PCR with primers
Reaction mixture for PCR using the GC rich PCR system (Roche,
Cat. No. 2140306):
Component Volume
PCR product from step 3 5 ~.l
dNTP 10 mM 1 ~.1
Primer MAT16 * 6 , 2 5 ).~M 2 ~1
Primer MAT19* 6, 25 ~,M 2 ~,1
GC rich resolution solution 10 ~1
5 M
GC rich reaction buffer 10 ~l
PCR grade H20 19 ~1
GC rich enzyme mix 1 ~1
Total ~ ( 5 0
~,1
~
* Primer MAT16 = 5'-GATCGACGTAAGCTTTAACGATGGAGAT-3'
* Primer MAT19 = 5'-CATCGGGCGAGCTCCCAGCCCGCCGCG-3'
PCR conditions:
Temperature Time Cycles
95C 5 min
52C 30 s 25
72C 60 s
g5C 30 s
72C 10 min
4C x min
~0 V. Cloning and analyzing the fragments
1. 20 ~l of the PCR product from step 4 are cut with HindIII and
Sa cI
2. Precipitating, washing, drying and resuspending the mixture
in 20 ~.1 of H20
3. Purifying the cut fragments using the GFX kit (Pharmacia)
PF 53571 CA 02485218 2004-11-04
27
4. Ligating the cut fragments with vector pBSIIKS (Stratagene),
which has been cut beforehand with HindIII and Sacl
5. Transforming the ligation mixtures into Escherichia coli
XL1-Blue
6. Sequence analysis of 29 clones with inserts
15
25
35
45
PF 53571 CA 02485218 2004-11-04
1
SEQUENCE LISTING
<110> BASF AG
<120> Method for generating polynucleotide molecules
<130> PF5357I/MSt
<140> PCT/EP03/05308
<141> 2003-05-21
<160> 4
<170> PatentIn version 3.1
<210> 1
<211> 1142
<212> DNA
<213> pBluescriptIIKS+
<220>
<221> misc_feature
<223> Lipases in pBluescriptIIKS+
<400> 1
aagctttaacgatggagataaacatggtcagattgatgcgttccagggtggcggcgaggg 60
cggtggcatgggcgttggcggtgatgccgctggccggcgcggccgggttgacgatggccg 120
cgtcgcccgcggccgtcgcggcggacacctacgcggcgacgcgctatccggtgatcctcg 180
tccacggcctcgcgggcaccgacaagttcgcgaacgtggtggactattggtacggaatcc 240
agagcgatctgcaatcgcatggcgcgaaggtgtacgtcgcgaatctctcgggattccaga 300
gcgacgacgggccgaacggccgcggcgagcagctgctcgcctacgtgaagcaggtgctcg 360
cggccaccggcgcgaccaaggtgaacctgatcggctggagccagggcggcetgacctcgc 420
gctacgtcgcggccgtcgcgccgcaactggtggcctcggtgacgacgatcggcacgccgc 480
atcgcggctccgagttcgccgacttcgtgcaggacgtgctgaagaccgatccgaccgggc 540
tctcgtcgacggtgatcgccgccttcgtcaacgtgttcggcacgctcgtcagcagctcgc 600
acaacaccgaccaggacgcgctcgcggcgctgcgcacgctcaccaccgcgcagaccgcca 660
cctacaaccggaacttcccgagcgcgggcctgggcgcgcccggttcgtgccagacgggcg 720
ccgcgaccgaaaccgtcggcggcagccagcacctgctctattcgtggggcggcaccgcga 780
tccagcccacctccaccgtgctcggcgtgaccggcgcgaccgacaccagcaccggcacgc 840
tcgacgtcgcgaacgtgaccgacccgtccacgctcgcgctgctcgccaccggcgcggtga 900
tgatcaatcgcgcctcggggcagaacgacgggctcgtctcgcgctgcagctcgctgttcg 960
53 ~ 7 1 CA 02485218 2004-11-04
ggcaggtgat cagcaccagc taccactgga accatctcga cgagatcaac cagctgctcg 1020
gcgtgcgcgg cgccaacgcg gaagatccgg tcgcggtgat ccgcacgcac gtgaaccggc 1080
tcaagctgca gggcgtgtga tggcgcaggc cgatcgtccg gcgcgcggcg ggctgggagc 1140
tc 1I42
<210> 2
<211> 1142
<212> DNA
<213> pBluescriptKSII+
<220>
<221> misc feature
<222> (1)..-(1142)
<223>
<220>
<221> misc_feature
<222> (1). (1142)
<223>
<400> 2
aagctttaacgatggagataaacatggtcagattgatgcgttccagggtggcggcgaggg 60
cggtggcatgggcgttggcggtgatgccgctggccggcgcggccgggttgacgatggccg 120
cgtcgcccgcggccgtcgcggcggacacctacgcggcgacgcgctatccggtgatcctcg 180
tccacggcctcgcgggcaccgacaagttcgcgaacgtggtggactattggtacggaatcc 240
agagcgatctgcaatcgcatggcgcgaaggtgtacgtcgcgaatctctcgggattccaga 300
gcgacgacgggccgaacggc.cgcggcgagcagctgctcgcctacgtgaagcaggtgctcg 360
cggccaccggcgcgaccaaggtgaacctgatcggccacacccagggcggcctgacctcgc 420
gctacgtcgcggccgtcgcgccgcaactggtggcctcggtgacgacgatcggcacgccgc 480
atcgcggctccgagttcgccgacttcgtgcaggacgtgctgaagaccgatccgaccgggc 540
tctcgtcgacggtgatcgccgccttcgtcaacgtgttcggcacgctcgtcagcagctcgc 600
acaacaccgaccaggacgcgctcgcggcgctgcgcacgctcaccaccgcgcagaccgcca 660
cctacaaccggaacttcccgagcgcgggcctgggcgcgcccggttcgtgccagacgggcg 720
ccgcgaccgaaaccgtcggcggcagccagcacctgctctattcgtggggcggcaccgcga 780
tccagcccacctccaccgtgctcggcgtgaccggcgcgaccgacaccagcaccggcacgc 840
tcgacgtcgcgaacgtgaccgacccgtccacgctcgcgctgctcgccaccggcgcggtga 900
P,.k' 53571 CA 02485218 2004-11-04
3
tgatcaatcg cgcctcgggg cagaacgacg ggctcgtctc gcgctgcagc tcgctgttcg 960
ggcaggtgat cagcaccagc taccactgga accatctcga cgagatcaac cagctgctcg 1020
gcgtgcgcgg cgccaacgcg gaagatccgg tcgcggtgat ccgcacgcac gtgaaccggc 1080
tcaagctgca gggcgtgtga tggcgcaggc cgatcgtccg gcgcgcggcg ggctgggagc 1140
tc I142
<210> 3
<211> 1142
<212> DNA
<213> pBluescriptKSII+
<220>
<221> misc_feature
<222> (1)..(1142)
<223>
<220>
<221> misc_feature
<222> (1)..(1142)
<223>
<220>
<221> misc_feature
<222> (1). (1142)
<223>
<220>
<221> misc_feature
<222> (1)..(1142)
<223>
<400> 3
aagctttaacgatggagataaacatggtcagattgatgcgttccagggtggcggcgaggg 60
cggtggcatgggcgttggcggtgatgccgctggccggcgcggccgggttgacgatggccg 120
cgtcgcccgcggccgtcgcggcggacacctacgcggcgacgcgctatccggtgatcctcg 180
tccacggcctcgcgggcaccgacaagttcgcgaacgtggtggactattggtacggaatcc 240
agagcgatctgcaatcgcatggcgcgaaggtgtacgtcgcgaatctctcgggattccaga 300
gcgacgacgggccgaacggccgcggcgagcagctgctcgcctacgtgaagcaggtgctcg 360
cggccaccggcgcgaccaaggtgaacctgatcggccacagccagggcggcctgacctcgc 420
gctacgtcgcggccgtcgcgccgcaactggtggcctcggtgacgacgatcggcacgccgc 480
BF 53571 _ CA 02485218 2004-11-04
4
atcgcggctc cgagttcgcc gacttcgtgc aggacgtgct gaagaccgat ccgaccgggc 540
tctcgtcgac ggtgatcgcc gccttcgtca acgtgttcgg cacgctcgtc agcagctcgc 600
acaacaccgaccaggacgcgctcgcggcgctgcgcacggccaccaccgcgcagaccgcca 660
cctacaaccggaacttcccgagcgcgggcctgggcgcgcccggttcgtgccagacgggcg 720
ccgcgaccgaaaccgtcggcggcagccagcacctgctctattcgtggggcggcaccgcga 780
tccagcccacctccaccgtgctcggcgtgaccggcgcgaccgacaccagcaccggcacgc 840
tcgacgtcgcgaacgtgaccgacccgtccacgctcgcgctgctcgccaccggcgcggtga 900
tgatcaatcgcgcctcggggcagaacgacgggctcgtctcgcgctgcagctcgctgttcg 960
ggcaggtgatcagcaccagctaccactggaaccatctcgacgagatcaaccagctgctcg 1020
gcgtgcgcgg cgccaacgcg gaagatccgg tcgcggtgat ccgcacgcac gtgaaccggc 1080
tcaagctgca gggcgtgtga tggcgcaggc cgatcgtccg gcgcgcggcg ggctgggagc 1140
tc 1142
<210> 4
<2-I1> 1142
<212> DNA
<213> pBluescriptKSII+
<220>
<221> misc feature
<222> (1)..(I142)
<223>
<400> 4
aagctttaacgatggagataaacatggtcagattgatgcgttccagggtggcggcgaggg 60
cggtggcatgggcgttggcggtgatgccgctggccggcgcggccgggttgacgatggccg 120
cgtcgcccgcggccgtcgcggcggacacctacgcggcgacgcgctatccggtgatcctcg 180
tccacggcctcgcgggcaccgacaagttcgcgaacgtggtggactattggtacggaatcc 240
agagcgatctgcaatcgcatggcgcgaaggtgtacgtcgcgaatctctcgggattccaga 300
gcgacgacgggccgaacggccgcggcgagcagctgctcgcctacgtgaagcaggtgctcg 360
cggccaccggcgcgaccaaggtgaacctgatcggccacagccagggcggcctgacctcgc 420
gctacgtcgcggccgtcgcgccgcaactggtggcctcggtgacgacgatcggcacgccgc 480
atcgcggctccgagttcgccgacttcgtgcaggacgtgctgaagaccgatccgaccgggc 540
tctcgtcgacggtgatcgccgcctgggtcaacgtgttcggcacgctcgtcagcagctcgc 600
P~' 53571 . CA 02485218 2004-11-04
acaacaccgaccaggacgcgctcgcggcgc tgcgcacgctcaccaccgcgcagaccgcca 660
cctacaaccggaacttcccgagcgcgggcc tgggcgcgcccggttcgtgccagacgggcg 720
ccgcgaccgaaaccgtcggcggcagccagc acctgctctattcgtggggcggcaccgcga 780
tccagcccacctccaccgtgctcggcgtga ccggcgcgaccgacaccagcaccggcacgc 840
tcgacgtcgcgaacgtgaccgacccgtcca cgctcgcgctgctcgccaccggcgcggtga 900
tgatcaatcgcgcctcggggcagaacgacg ggctcgtctcgcgctgcagctcgctgttcg 960
ggcaggtgatcagcaccagctaccactgga accatctcgacgagatcaaccagctgctcg 1020
gcgtgcgcggcgccaacgcggaagatccgg tcgcggtgatccgcacgcacgtgaaccggc 1080
tcaagctgcagggcgtgtgatggcgcaggc cgatcgtccggcgcgcggcgggctgggagc 1140
tc 1142
